hexsha
string | size
int64 | ext
string | lang
string | max_stars_repo_path
string | max_stars_repo_name
string | max_stars_repo_head_hexsha
string | max_stars_repo_licenses
list | max_stars_count
int64 | max_stars_repo_stars_event_min_datetime
string | max_stars_repo_stars_event_max_datetime
string | max_issues_repo_path
string | max_issues_repo_name
string | max_issues_repo_head_hexsha
string | max_issues_repo_licenses
list | max_issues_count
int64 | max_issues_repo_issues_event_min_datetime
string | max_issues_repo_issues_event_max_datetime
string | max_forks_repo_path
string | max_forks_repo_name
string | max_forks_repo_head_hexsha
string | max_forks_repo_licenses
list | max_forks_count
int64 | max_forks_repo_forks_event_min_datetime
string | max_forks_repo_forks_event_max_datetime
string | content
string | avg_line_length
float64 | max_line_length
int64 | alphanum_fraction
float64 | qsc_code_num_words_quality_signal
int64 | qsc_code_num_chars_quality_signal
float64 | qsc_code_mean_word_length_quality_signal
float64 | qsc_code_frac_words_unique_quality_signal
float64 | qsc_code_frac_chars_top_2grams_quality_signal
float64 | qsc_code_frac_chars_top_3grams_quality_signal
float64 | qsc_code_frac_chars_top_4grams_quality_signal
float64 | qsc_code_frac_chars_dupe_5grams_quality_signal
float64 | qsc_code_frac_chars_dupe_6grams_quality_signal
float64 | qsc_code_frac_chars_dupe_7grams_quality_signal
float64 | qsc_code_frac_chars_dupe_8grams_quality_signal
float64 | qsc_code_frac_chars_dupe_9grams_quality_signal
float64 | qsc_code_frac_chars_dupe_10grams_quality_signal
float64 | qsc_code_frac_chars_replacement_symbols_quality_signal
float64 | qsc_code_frac_chars_digital_quality_signal
float64 | qsc_code_frac_chars_whitespace_quality_signal
float64 | qsc_code_size_file_byte_quality_signal
float64 | qsc_code_num_lines_quality_signal
float64 | qsc_code_num_chars_line_max_quality_signal
float64 | qsc_code_num_chars_line_mean_quality_signal
float64 | qsc_code_frac_chars_alphabet_quality_signal
float64 | qsc_code_frac_chars_comments_quality_signal
float64 | qsc_code_cate_xml_start_quality_signal
float64 | qsc_code_frac_lines_dupe_lines_quality_signal
float64 | qsc_code_cate_autogen_quality_signal
float64 | qsc_code_frac_lines_long_string_quality_signal
float64 | qsc_code_frac_chars_string_length_quality_signal
float64 | qsc_code_frac_chars_long_word_length_quality_signal
float64 | qsc_code_frac_lines_string_concat_quality_signal
float64 | qsc_code_cate_encoded_data_quality_signal
float64 | qsc_code_frac_chars_hex_words_quality_signal
float64 | qsc_code_frac_lines_prompt_comments_quality_signal
float64 | qsc_code_frac_lines_assert_quality_signal
float64 | qsc_codepython_cate_ast_quality_signal
float64 | qsc_codepython_frac_lines_func_ratio_quality_signal
float64 | qsc_codepython_cate_var_zero_quality_signal
bool | qsc_codepython_frac_lines_pass_quality_signal
float64 | qsc_codepython_frac_lines_import_quality_signal
float64 | qsc_codepython_frac_lines_simplefunc_quality_signal
float64 | qsc_codepython_score_lines_no_logic_quality_signal
float64 | qsc_codepython_frac_lines_print_quality_signal
float64 | qsc_code_num_words
int64 | qsc_code_num_chars
int64 | qsc_code_mean_word_length
int64 | qsc_code_frac_words_unique
null | qsc_code_frac_chars_top_2grams
int64 | qsc_code_frac_chars_top_3grams
int64 | qsc_code_frac_chars_top_4grams
int64 | qsc_code_frac_chars_dupe_5grams
int64 | qsc_code_frac_chars_dupe_6grams
int64 | qsc_code_frac_chars_dupe_7grams
int64 | qsc_code_frac_chars_dupe_8grams
int64 | qsc_code_frac_chars_dupe_9grams
int64 | qsc_code_frac_chars_dupe_10grams
int64 | qsc_code_frac_chars_replacement_symbols
int64 | qsc_code_frac_chars_digital
int64 | qsc_code_frac_chars_whitespace
int64 | qsc_code_size_file_byte
int64 | qsc_code_num_lines
int64 | qsc_code_num_chars_line_max
int64 | qsc_code_num_chars_line_mean
int64 | qsc_code_frac_chars_alphabet
int64 | qsc_code_frac_chars_comments
int64 | qsc_code_cate_xml_start
int64 | qsc_code_frac_lines_dupe_lines
int64 | qsc_code_cate_autogen
int64 | qsc_code_frac_lines_long_string
int64 | qsc_code_frac_chars_string_length
int64 | qsc_code_frac_chars_long_word_length
int64 | qsc_code_frac_lines_string_concat
null | qsc_code_cate_encoded_data
int64 | qsc_code_frac_chars_hex_words
int64 | qsc_code_frac_lines_prompt_comments
int64 | qsc_code_frac_lines_assert
int64 | qsc_codepython_cate_ast
int64 | qsc_codepython_frac_lines_func_ratio
int64 | qsc_codepython_cate_var_zero
int64 | qsc_codepython_frac_lines_pass
int64 | qsc_codepython_frac_lines_import
int64 | qsc_codepython_frac_lines_simplefunc
int64 | qsc_codepython_score_lines_no_logic
int64 | qsc_codepython_frac_lines_print
int64 | effective
string | hits
int64 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
0c20144fc45cf09d8222a79480e0638c0888bbe1
| 13,027
|
py
|
Python
|
tests/knowledge/rules/aws/non_context_aware/test_ensure_rds_resource_has_iam_authentication_enabled_rule.py
|
my-devops-info/cloudrail-knowledge
|
b7c1bbd6fe1faeb79c105a01c0debbe24d031a0e
|
[
"MIT"
] | null | null | null |
tests/knowledge/rules/aws/non_context_aware/test_ensure_rds_resource_has_iam_authentication_enabled_rule.py
|
my-devops-info/cloudrail-knowledge
|
b7c1bbd6fe1faeb79c105a01c0debbe24d031a0e
|
[
"MIT"
] | null | null | null |
tests/knowledge/rules/aws/non_context_aware/test_ensure_rds_resource_has_iam_authentication_enabled_rule.py
|
my-devops-info/cloudrail-knowledge
|
b7c1bbd6fe1faeb79c105a01c0debbe24d031a0e
|
[
"MIT"
] | null | null | null |
import unittest
from cloudrail.dev_tools.rule_test_utils import create_empty_entity
from cloudrail.knowledge.context.aws.rds.rds_cluster import RdsCluster
from cloudrail.knowledge.context.aws.rds.rds_instance import RdsInstance
from cloudrail.knowledge.context.aws.aws_environment_context import AwsEnvironmentContext
from cloudrail.knowledge.context.terraform_action_type import TerraformActionType
from cloudrail.knowledge.context.terraform_state import TerraformState
from cloudrail.knowledge.rules.aws.non_context_aware.ensure_rds_resource_has_iam_authentication_enabled_rule import \
EnsureRdsResourceIamAuthenticationEnabledRule
from cloudrail.knowledge.rules.base_rule import RuleResultType
class TestEnsureRdsResourceIamAuthenticationEnabledRule(unittest.TestCase):
def setUp(self):
self.rule = EnsureRdsResourceIamAuthenticationEnabledRule()
def test_non_car_rds_database_iam_authentication_enabled__supported_ver_no_auth__fail(self):
# Arrange
rds_instance: RdsInstance = create_empty_entity(RdsInstance)
rds_instance.engine_type = 'mysql'
rds_instance.engine_version = '5.7.16'
rds_instance.iam_database_authentication_enabled = False
context = AwsEnvironmentContext(rds_instances=[rds_instance])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.FAILED, result.status)
self.assertEqual(1, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__supported_ver_no_auth_8_0_17__fail(self):
# Arrange
rds_instance: RdsInstance = create_empty_entity(RdsInstance)
rds_instance.engine_type = 'mysql'
rds_instance.engine_version = '8.0.17'
rds_instance.iam_database_authentication_enabled = False
context = AwsEnvironmentContext(rds_instances=[rds_instance])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.FAILED, result.status)
self.assertEqual(1, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__supported_ver_no_auth_9_0_17__fail(self):
# Arrange
rds_instance: RdsInstance = create_empty_entity(RdsInstance)
rds_instance.engine_type = 'mysql'
rds_instance.engine_version = '9.0.17'
rds_instance.iam_database_authentication_enabled = False
context = AwsEnvironmentContext(rds_instances=[rds_instance])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.FAILED, result.status)
self.assertEqual(1, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__unsupported_version__pass(self):
# Arrange
rds_instance: RdsInstance = create_empty_entity(RdsInstance)
rds_instance.engine_type = 'mysql'
rds_instance.engine_version = '5.7.15'
rds_instance.iam_database_authentication_enabled = False
context = AwsEnvironmentContext(rds_instances=[rds_instance])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.SUCCESS, result.status)
self.assertEqual(0, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__unsupported_version_5_0_16_pass(self):
# Arrange
rds_instance: RdsInstance = create_empty_entity(RdsInstance)
rds_instance.engine_type = 'mysql'
rds_instance.engine_version = '5.0.16'
rds_instance.iam_database_authentication_enabled = False
context = AwsEnvironmentContext(rds_instances=[rds_instance])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.SUCCESS, result.status)
self.assertEqual(0, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__unsupported_version_5_6_33__pass(self):
# Arrange
rds_instance: RdsInstance = create_empty_entity(RdsInstance)
rds_instance.engine_type = 'mysql'
rds_instance.engine_version = '5.6.33'
rds_instance.iam_database_authentication_enabled = False
context = AwsEnvironmentContext(rds_instances=[rds_instance])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.SUCCESS, result.status)
self.assertEqual(0, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__supported_version_auth_disabled__fail(self):
# Arrange
rds_instance: RdsInstance = create_empty_entity(RdsInstance)
rds_instance.engine_type = 'mysql'
rds_instance.engine_version = '5.7'
rds_instance.iam_database_authentication_enabled = False
rds_instance.terraform_state = TerraformState(address='address',
action=TerraformActionType.CREATE,
resource_metadata=None,
is_new=True)
context = AwsEnvironmentContext(rds_instances=[rds_instance])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.FAILED, result.status)
self.assertEqual(1, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__supported_version_auth_disabled_5_6__fail(self):
# Arrange
rds_instance: RdsInstance = create_empty_entity(RdsInstance)
rds_instance.engine_type = 'mysql'
rds_instance.engine_version = '5.6'
rds_instance.iam_database_authentication_enabled = False
rds_instance.terraform_state = TerraformState(address='address',
action=TerraformActionType.CREATE,
resource_metadata=None,
is_new=True)
context = AwsEnvironmentContext(rds_instances=[rds_instance])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.FAILED, result.status)
self.assertEqual(1, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__rds_cluster__fail(self):
# Arrange
rds_cluster: RdsCluster = create_empty_entity(RdsCluster)
rds_cluster.engine_type = 'mysql'
rds_cluster.engine_version = '5.7.mysql_aurora.2.03.2'
rds_cluster.iam_database_authentication_enabled = False
context = AwsEnvironmentContext(rds_clusters=[rds_cluster])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.FAILED, result.status)
self.assertEqual(1, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__rds_cluster__pass(self):
# Arrange
rds_cluster: RdsCluster = create_empty_entity(RdsCluster)
rds_cluster.engine_type = 'mysql'
rds_cluster.engine_version = '5.7.mysql_aurora.2.03.2'
rds_cluster.iam_database_authentication_enabled = True
context = AwsEnvironmentContext(rds_clusters=[rds_cluster])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.SUCCESS, result.status)
self.assertEqual(0, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__rds_instance_old_ver__fail(self):
# Arrange
rds_instance: RdsInstance = create_empty_entity(RdsInstance)
rds_instance.engine_type = 'postgresql'
rds_instance.engine_version = '9.5.16'
context = AwsEnvironmentContext(rds_instances=[rds_instance])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.FAILED, result.status)
self.assertEqual(1, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__rds_instance_old_ver_9_5__fail(self):
# Arrange
rds_instance: RdsInstance = create_empty_entity(RdsInstance)
rds_instance.engine_type = 'postgresql'
rds_instance.engine_version = '9.5'
rds_instance.terraform_state = TerraformState(address='address',
action=TerraformActionType.CREATE,
resource_metadata=None,
is_new=True)
context = AwsEnvironmentContext(rds_instances=[rds_instance])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.FAILED, result.status)
self.assertEqual(1, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__rds_instance_old_ver_8_5__pass(self):
# Arrange
rds_instance: RdsInstance = create_empty_entity(RdsInstance)
rds_instance.engine_type = 'postgresql'
rds_instance.engine_version = '8.5'
context = AwsEnvironmentContext(rds_instances=[rds_instance])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.SUCCESS, result.status)
self.assertEqual(0, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__rds_instance_old_ver_11_2__fail(self):
# Arrange
rds_instance: RdsInstance = create_empty_entity(RdsInstance)
rds_instance.engine_type = 'postgresql'
rds_instance.engine_version = '11.2'
rds_instance.terraform_state = TerraformState(address='address',
action=TerraformActionType.CREATE,
resource_metadata=None,
is_new=True)
context = AwsEnvironmentContext(rds_instances=[rds_instance])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.FAILED, result.status)
self.assertEqual(1, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__rds_instance_old_ver_14__fail(self):
# Arrange
rds_instance: RdsInstance = create_empty_entity(RdsInstance)
rds_instance.engine_type = 'postgresql'
rds_instance.engine_version = '14'
rds_instance.terraform_state = TerraformState(address='address',
action=TerraformActionType.CREATE,
resource_metadata=None,
is_new=True)
context = AwsEnvironmentContext(rds_instances=[rds_instance])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.FAILED, result.status)
self.assertEqual(1, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__rds_instance_old_ver_14_5_non_tf__fail(self):
# Arrange
rds_instance: RdsInstance = create_empty_entity(RdsInstance)
rds_instance.engine_type = 'postgresql'
rds_instance.engine_version = '14'
context = AwsEnvironmentContext(rds_instances=[rds_instance])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.FAILED, result.status)
self.assertEqual(1, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__rds_instance_old_ver_9_5_5_non_tf__pass(self):
# Arrange
rds_instance: RdsInstance = create_empty_entity(RdsInstance)
rds_instance.engine_type = 'postgresql'
rds_instance.engine_version = '9.5.5'
context = AwsEnvironmentContext(rds_instances=[rds_instance])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.SUCCESS, result.status)
self.assertEqual(0, len(result.issues))
def test_non_car_rds_database_iam_authentication_enabled__rds_instance_old_ver_9_5_5_tf__pass(self):
# Arrange
rds_instance: RdsInstance = create_empty_entity(RdsInstance)
rds_instance.engine_type = 'postgresql'
rds_instance.engine_version = '9.5.5'
rds_instance.terraform_state = TerraformState(address='address',
action=TerraformActionType.CREATE,
resource_metadata=None,
is_new=True)
context = AwsEnvironmentContext(rds_instances=[rds_instance])
# Act
result = self.rule.run(context, {})
# Assert
self.assertEqual(RuleResultType.SUCCESS, result.status)
self.assertEqual(0, len(result.issues))
| 48.790262
| 117
| 0.672373
| 1,365
| 13,027
| 6.032234
| 0.071795
| 0.116225
| 0.066068
| 0.028419
| 0.926281
| 0.912801
| 0.912801
| 0.903571
| 0.902963
| 0.902963
| 0
| 0.011797
| 0.251708
| 13,027
| 266
| 118
| 48.973684
| 0.832889
| 0.026176
| 0
| 0.764398
| 0
| 0
| 0.022959
| 0.003642
| 0
| 0
| 0
| 0
| 0.188482
| 1
| 0.099476
| false
| 0.036649
| 0.04712
| 0
| 0.151832
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
0c27a02e0d45c2d7552f3e578a1297e69759f64b
| 3,180
|
py
|
Python
|
ABC253/c/main.test.py
|
seigot/atcoder
|
6c2da684c75b7c5de162de3713a13507aeecce1d
|
[
"MIT"
] | 2
|
2021-12-28T11:43:47.000Z
|
2022-02-20T14:41:27.000Z
|
ABC253/c/main.test.py
|
seigot/atcoder
|
6c2da684c75b7c5de162de3713a13507aeecce1d
|
[
"MIT"
] | null | null | null |
ABC253/c/main.test.py
|
seigot/atcoder
|
6c2da684c75b7c5de162de3713a13507aeecce1d
|
[
"MIT"
] | null | null | null |
import sys
inputSys = sys.stdin.readline
# sys.setrecursionlimit(10**7)
from copy import deepcopy
import itertools # combinations() <- nCr, permutations() <- nPr
import bisect # 二分探索
import math # factorial() <- 階乗, sqrt() <- 平方根
from functools import lru_cache # <- メモ化再帰 @lru_cache
import string
mod = 998244353
mod2 = 1000000007
inf = float("inf")
minf = -float("inf")
def YesNo(flag: bool, yes="Yes", no="No"): print(yes) if flag else print(no)
# lst.sort(key=lambda x: x[N]) <- N番目の要素でソート
# sorted_lst = sorted(lst.items(), key=lambda x: x[0]) <- 辞書のkeyでソート
# sorted_lst = sorted(lst.items(), key=lambda x: x[1]) <- 辞書のvalueでソート
n = int(inputSys())
s = {}
st = set()
_min = inf
_max = minf
for i in range(n):
q = list(map(int, inputSys().split()))
if q[0] == 1:
if q[1] in st:
s[q[1]] += 1
else:
s[q[1]] = 1
st.add(q[1])
if q[1] < _min:
_min = q[1]
if q[1] > _max:
_max = q[1]
elif q[0] == 2:
x = import sys
inputSys = sys.stdin.readline
# sys.setrecursionlimit(10**7)
from copy import deepcopy
import itertools # combinations() <- nCr, permutations() <- nPr
import bisect # 二分探索
import math # factorial() <- 階乗, sqrt() <- 平方根
from functools import lru_cache # <- メモ化再帰 @lru_cache
import string
mod = 998244353
mod2 = 1000000007
inf = float("inf")
minf = -float("inf")
def YesNo(flag: bool, yes="Yes", no="No"): print(yes) if flag else print(no)
# lst.sort(key=lambda x: x[N]) <- N番目の要素でソート
# sorted_lst = sorted(lst.items(), key=lambda x: x[0]) <- 辞書のkeyでソート
# sorted_lst = sorted(lst.items(), key=lambda x: x[1]) <- 辞書のvalueでソート
n = int(inputSys())
s = {}
st = set()
_min = inf
_max = minf
for i in range(n):
q = list(map(int, inputSys().split()))
if q[0] == 1:
if q[1] in st:
s[q[1]] += 1
else:
s[q[1]] = 1
st.add(q[1])
if q[1] < _min:
_min = q[1]
if q[1] > _max:
_max = q[1]
elif q[0] == 2:
x = q[1]
c = q[2]
if x in st:
m = min(c, s[x])
if m == s[x]:
s.pop(x)
st.remove(x)
if _min == x:
if len(st) > 0:
_min = min(st)
else:
_min = inf
if _max == q[1]:
if len(st) > 0:
_max = max(st)
else:
_max = minf
else:
s[x] -= m
else:
print(_max - _min)
if c in st:
m = min(q[2], s[q[1]])
if m == s[q[1]]:
s.pop(q[1])
st.remove(q[1])
if _min == q[1]:
if len(st) > 0:
_min = min(st)
else:
_min = inf
if _max == q[1]:
if len(st) > 0:
_max = max(st)
else:
_max = minf
else:
s[q[1]] -= m
else:
print(_max - _min)
| 26.5
| 76
| 0.450314
| 432
| 3,180
| 3.231481
| 0.18287
| 0.035817
| 0.025788
| 0.047278
| 0.93553
| 0.912607
| 0.911175
| 0.911175
| 0.911175
| 0.911175
| 0
| 0.04887
| 0.401572
| 3,180
| 119
| 77
| 26.722689
| 0.684708
| 0.195283
| 0
| 0.823529
| 0
| 0
| 0.008655
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | null | 0
| 0.137255
| null | null | 0.039216
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
0c2a6b611ed8a5112172fed5c149f829b7221724
| 44,193
|
py
|
Python
|
test/integration/plugins/nuagevsp/test_nuage_internal_dns.py
|
n3wtype/cloudstack
|
2037dc9eb3979cbefc0a1c7f8b927c8d8b53ac26
|
[
"Apache-2.0"
] | null | null | null |
test/integration/plugins/nuagevsp/test_nuage_internal_dns.py
|
n3wtype/cloudstack
|
2037dc9eb3979cbefc0a1c7f8b927c8d8b53ac26
|
[
"Apache-2.0"
] | null | null | null |
test/integration/plugins/nuagevsp/test_nuage_internal_dns.py
|
n3wtype/cloudstack
|
2037dc9eb3979cbefc0a1c7f8b927c8d8b53ac26
|
[
"Apache-2.0"
] | 1
|
2018-03-26T17:53:33.000Z
|
2018-03-26T17:53:33.000Z
|
# Licensed to the Apache Software Foundation (ASF) under one
# or more contributor license agreements. See the NOTICE file
# distributed with this work for additional information
# regarding copyright ownership. The ASF licenses this file
# to you under the Apache License, Version 2.0 (the
# "License"); you may not use this file except in compliance
# with the License. You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing,
# software distributed under the License is distributed on an
# "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
# KIND, either express or implied. See the License for the
# specific language governing permissions and limitations
# under the License.
""" Component tests for Internal DNS functionality with Nuage VSP SDN plugin
"""
# Import Local Modules
from nuageTestCase import nuageTestCase
from marvin.cloudstackAPI import updateZone
from marvin.lib.base import Account, Network
# Import System Modules
from nose.plugins.attrib import attr
import time
class TestNuageInternalDns(nuageTestCase):
DNS = "06"
HOSTNAME = "0c"
DOMAINNAME = "0f"
@classmethod
def setUpClass(cls):
super(TestNuageInternalDns, cls).setUpClass()
cls.dnsdata = cls.test_data["nuagevsp"]
return
def setUp(self):
self.apiclient = self.testClient.getApiClient()
self.account = Account.create(
self.apiclient,
self.test_data["account"],
admin=True,
domainid=self.domain.id
)
self.test_data["virtual_machine"]["displayname"] = "vm1"
self.test_data["virtual_machine"]["name"] = "vm1"
self.cleanup = [self.account]
return
# Creates and verifies the firewall rule
def create_and_verify_fw(self, vm, public_ip, network):
self.debug("Create and verify firewall rule")
self.create_StaticNatRule_For_VM(vm, public_ip, network)
# VSD verification
self.verify_vsd_floating_ip(network, vm, public_ip.ipaddress)
fw_rule = self.create_FirewallRule(
public_ip, self.test_data["ingress_rule"])
self.verify_vsd_firewall_rule(fw_rule)
def verify_vsd_dhcp_option(self, dhcp_type, value, subnet_or_vm_interface,
is_vm_interface=False):
self.debug("Verifying the creation and value of DHCP option type - %s "
"in VSD" % dhcp_type)
found_dhcp_type = False
if is_vm_interface:
dhcp_options = self.vsd.get_vm_interface_dhcpoptions(
filter=self.get_externalID_filter(subnet_or_vm_interface.id))
else:
dhcp_options = self.vsd.get_subnet_dhcpoptions(
filter=self.get_externalID_filter(subnet_or_vm_interface.id))
for dhcp_option in dhcp_options:
self.debug("dhcptype option is %s:" % dhcp_option.actual_type)
self.debug("dhcptype expected value is option is %s:" % dhcp_type)
if dhcp_option.type == dhcp_type:
found_dhcp_type = True
if isinstance(dhcp_option.actual_values, list):
self.debug("dhcptype actual value is %s:" %
dhcp_option.actual_values)
if value in dhcp_option.actual_values:
self.debug("Excepted DHCP option value found in VSD")
else:
self.fail("Excepted DHCP option value not found in "
"VSD")
else:
self.assertEqual(dhcp_options.actual_values, value,
"Expected DHCP option value is not same "
"in both CloudStack and VSD"
)
if not found_dhcp_type:
self.fail("Expected DHCP option type and value not found in the "
"VSD")
self.debug("Successfully verified the creation and value of DHCP "
"option type - %s in VSD" % dhcp_type)
@attr(tags=["advanced", "nuagevsp"], required_hardware="false")
def test_01_Isolated_Network_with_zone(self):
""" Verify InternalDns on Isolated Network
"""
# Validate the following
# 1. Create an Isolated network - network1 (10.1.1.1/24) by using DNS
# network offering.
# 2. Deploy vm1 in network1.
# 3. Verify dhcp option 06 and 0f for subnet
# 4. Verify dhcp option 06,15 and 0f for vm Interface.
# update Network Domain at zone level
cmd = updateZone.updateZoneCmd()
cmd.id = self.zone.id
cmd.domain = "isolated.com"
self.apiclient.updateZone(cmd)
self.debug("Creating and enabling Nuage Vsp Isolated Network "
"offering...")
network_offering = self.create_NetworkOffering(
self.dnsdata["isolated_network_offering"])
self.validate_NetworkOffering(network_offering, state="Enabled")
network_1 = self.create_Network(network_offering)
vm_1 = self.create_VM(network_1)
# VSD verification
self.verify_vsd_network(self.domain.id, network_1)
self.verify_vsd_vm(vm_1)
# Internal DNS check point on VSD
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", network_1)
self.verify_vsd_dhcp_option(self.DOMAINNAME, "isolated.com", network_1)
for nic in vm_1.nic:
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", nic, True)
self.verify_vsd_dhcp_option(
self.DOMAINNAME, "isolated.com", nic, True)
self.verify_vsd_dhcp_option(self.HOSTNAME, "vm1", nic, True)
@attr(tags=["advanced", "nuagevsp"], required_hardware="true")
def test_02_Isolated_Network(self):
""" Verify InternalDns on Isolated Network with ping by hostname
"""
# Validate the following
# 1. Create an Isolated network - network1 (10.1.1.1/24) by using DNS
# network offering.
# 2. Deploy vm1 in network1.
# 3. Verify dhcp option 06 and 0f for subnet
# 4. Verify dhcp option 06,15 and 0f for vm Interface.
# 5. Deploy VM2 in network1.
# 6. Verify end to end by pinging with hostname
cmd = updateZone.updateZoneCmd()
cmd.id = self.zone.id
cmd.domain = "isolated.com"
self.apiclient.updateZone(cmd)
self.debug("Creating and enabling Nuage Vsp Isolated Network "
"offering...")
network_offering = self.create_NetworkOffering(
self.dnsdata["isolated_network_offering"])
self.validate_NetworkOffering(network_offering, state="Enabled")
network_1 = self.create_Network(network_offering)
vm_1 = self.create_VM(network_1)
# VSD verification
self.verify_vsd_network(self.domain.id, network_1)
self.verify_vsd_vm(vm_1)
# Internal DNS check point on VSD
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", network_1)
self.verify_vsd_dhcp_option(self.DOMAINNAME, "isolated.com", network_1)
for nic in vm_1.nic:
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", nic, True)
self.verify_vsd_dhcp_option(
self.DOMAINNAME, "isolated.com", nic, True)
self.verify_vsd_dhcp_option(self.HOSTNAME, "vm1", nic, True)
self.test_data["virtual_machine"]["displayname"] = "vm2"
self.test_data["virtual_machine"]["name"] = "vm2"
vm_2 = self.create_VM(network_1)
self.test_data["virtual_machine"]["displayname"] = "vm1"
self.test_data["virtual_machine"]["name"] = "vm1"
self.verify_vsd_vm(vm_2)
for nic in vm_2.nic:
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", nic, True)
self.verify_vsd_dhcp_option(
self.DOMAINNAME, "isolated.com", nic, True)
self.verify_vsd_dhcp_option(self.HOSTNAME, "vm2", nic, True)
public_ip_1 = self.acquire_PublicIPAddress(network_1)
self.create_and_verify_fw(vm_1, public_ip_1, network_1)
vm_public_ip = public_ip_1.ipaddress.ipaddress
try:
vm_1.ssh_ip = vm_public_ip
vm_1.ssh_port = self.test_data["virtual_machine"]["ssh_port"]
vm_1.username = self.test_data["virtual_machine"]["username"]
vm_1.password = self.test_data["virtual_machine"]["password"]
self.debug("SSHing into VM: %s with %s" %
(vm_1.ssh_ip, vm_1.password))
ssh = vm_1.get_ssh_client(ipaddress=vm_public_ip)
except Exception as e:
self.fail("SSH into VM failed with exception %s" % e)
cmd = 'ping -c 2 vm2'
self.debug("ping vm2 by hostname with command: " + cmd)
outputlist = ssh.execute(cmd)
self.debug("command is executed properly " + cmd)
completeoutput = str(outputlist).strip('[]')
self.debug("complete output is " + completeoutput)
expectedlist = ['2 received', 'vm2.isolated.com', vm_2.ipaddress]
for item in expectedlist:
if item in completeoutput:
self.debug("excepted value found in vm: " + item)
else:
self.fail("excepted value not found in vm: " + item)
@attr(tags=["advanced", "nuagevsp"], required_hardware="true")
def test_03_Isolated_Network_restarts(self):
""" Verify InternalDns on Isolated Network with restart networks and
ping by hostname
"""
# Validate the following
# 1. Create an Isolated network - network1 (10.1.1.1/24) by using DNS
# network offering.
# 2. Deploy vm1 in network1.
# 3. Verify dhcp option 06 and 0f for subnet
# 4. Verify dhcp option 06,15 and 0f for vm Interface.
# 5. Deploy VM2 in network1.
# 6. Verify end to end by pinging with hostname while restarting
# network1 without and with cleanup.
cmd = updateZone.updateZoneCmd()
cmd.id = self.zone.id
cmd.domain = "isolated.com"
self.apiclient.updateZone(cmd)
self.debug("Creating and enabling Nuage Vsp Isolated Network "
"offering...")
network_offering = self.create_NetworkOffering(
self.dnsdata["isolated_network_offering"])
self.validate_NetworkOffering(network_offering, state="Enabled")
network_1 = self.create_Network(network_offering)
vm_1 = self.create_VM(network_1)
# VSD verification
self.verify_vsd_network(self.domain.id, network_1)
self.verify_vsd_vm(vm_1)
# Internal DNS check point on VSD
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", network_1)
self.verify_vsd_dhcp_option(self.DOMAINNAME, "isolated.com", network_1)
for nic in vm_1.nic:
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", nic, True)
self.verify_vsd_dhcp_option(
self.DOMAINNAME, "isolated.com", nic, True)
self.verify_vsd_dhcp_option(self.HOSTNAME, "vm1", nic, True)
self.test_data["virtual_machine"]["displayname"] = "vm2"
self.test_data["virtual_machine"]["name"] = "vm2"
vm_2 = self.create_VM(network_1)
self.test_data["virtual_machine"]["displayname"] = "vm1"
self.test_data["virtual_machine"]["name"] = "vm1"
self.verify_vsd_vm(vm_2)
for nic in vm_2.nic:
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", nic, True)
self.verify_vsd_dhcp_option(
self.DOMAINNAME, "isolated.com", nic, True)
self.verify_vsd_dhcp_option(self.HOSTNAME, "vm2", nic, True)
public_ip_1 = self.acquire_PublicIPAddress(network_1)
self.create_and_verify_fw(vm_1, public_ip_1, network_1)
vm_public_ip = public_ip_1.ipaddress.ipaddress
try:
vm_1.ssh_ip = vm_public_ip
vm_1.ssh_port = self.test_data["virtual_machine"]["ssh_port"]
vm_1.username = self.test_data["virtual_machine"]["username"]
vm_1.password = self.test_data["virtual_machine"]["password"]
self.debug("SSHing into VM: %s with %s" %
(vm_1.ssh_ip, vm_1.password))
ssh = vm_1.get_ssh_client(ipaddress=vm_public_ip)
except Exception as e:
self.fail("SSH into VM failed with exception %s" % e)
time.sleep(30)
cmd = 'ping -c 2 vm2'
self.debug("ping vm2 by hostname with command: " + cmd)
outputlist = ssh.execute(cmd)
self.debug("command is executed properly " + cmd)
completeoutput = str(outputlist).strip('[]')
self.debug("complete output is " + completeoutput)
expectedlist = ['2 received', 'vm2.isolated.com', vm_2.ipaddress]
for item in expectedlist:
if item in completeoutput:
self.debug("excepted value found in vm: " + item)
else:
self.fail("excepted value not found in vm: " + item)
# Restarting Isolated network (cleanup = false)
self.debug("Restarting the created Isolated network without "
"cleanup...")
Network.restart(network_1, self.api_client, cleanup=False)
self.validate_Network(network_1, state="Implemented")
vr = self.get_Router(network_1)
self.check_Router_state(vr, state="Running")
self.check_VM_state(vm_1, state="Running")
self.check_VM_state(vm_2, state="Running")
# VSD verification
self.verify_vsd_network(self.domain.id, network_1)
self.verify_vsd_router(vr)
self.verify_vsd_vm(vm_1)
self.verify_vsd_vm(vm_2)
try:
vm_1.ssh_ip = vm_public_ip
vm_1.ssh_port = self.test_data["virtual_machine"]["ssh_port"]
vm_1.username = self.test_data["virtual_machine"]["username"]
vm_1.password = self.test_data["virtual_machine"]["password"]
self.debug("SSHing into VM: %s with %s" %
(vm_1.ssh_ip, vm_1.password))
ssh = vm_1.get_ssh_client(ipaddress=vm_public_ip)
except Exception as e:
self.fail("SSH into VM failed with exception %s" % e)
cmd = 'ping -c 2 vm2'
self.debug("ping vm2 by hostname with command: " + cmd)
outputlist = ssh.execute(cmd)
self.debug("command is executed properly " + cmd)
completeoutput = str(outputlist).strip('[]')
self.debug("complete output is " + completeoutput)
expectedlist = ['2 received', 'vm2.isolated.com', vm_2.ipaddress]
for item in expectedlist:
if item in completeoutput:
self.debug("excepted value found in vm: " + item)
else:
self.fail("excepted value not found in vm: " + item)
# Restarting Isolated network (cleanup = true)
self.debug("Restarting the created Isolated network with cleanup...")
Network.restart(network_1, self.api_client, cleanup=True)
self.validate_Network(network_1, state="Implemented")
vr = self.get_Router(network_1)
self.check_Router_state(vr, state="Running")
self.check_VM_state(vm_1, state="Running")
self.check_VM_state(vm_2, state="Running")
# VSD verification
self.verify_vsd_network(self.domain.id, network_1)
self.verify_vsd_router(vr)
self.verify_vsd_vm(vm_1)
self.verify_vsd_vm(vm_2)
try:
vm_1.ssh_ip = vm_public_ip
vm_1.ssh_port = self.test_data["virtual_machine"]["ssh_port"]
vm_1.username = self.test_data["virtual_machine"]["username"]
vm_1.password = self.test_data["virtual_machine"]["password"]
self.debug("SSHing into VM: %s with %s" %
(vm_1.ssh_ip, vm_1.password))
ssh = vm_1.get_ssh_client(ipaddress=vm_public_ip)
except Exception as e:
self.fail("SSH into VM failed with exception %s" % e)
cmd = 'ping -c 2 vm2'
self.debug("ping vm2 by hostname with command: " + cmd)
outputlist = ssh.execute(cmd)
self.debug("command is executed properly " + cmd)
completeoutput = str(outputlist).strip('[]')
self.debug("complete output is " + completeoutput)
expectedlist = ['2 received', 'vm2.isolated.com', vm_2.ipaddress]
for item in expectedlist:
if item in completeoutput:
self.debug("excepted value found in vm: " + item)
else:
self.fail("excepted value not found in vm: " + item)
@attr(tags=["advanced", "nuagevsp"], required_hardware="false")
def test_04_Update_Network_with_Domain(self):
""" Verify update NetworkDomain for InternalDns on Isolated Network
"""
# Validate the following
# 1. Create an Isolated network - network1 (10.1.1.1/24) by using DNS
# network offering.
# 2. Deploy vm1 in network1.
# 3. Verify dhcp option 06 and 0f for subnet
# 4. Verify dhcp option 06,15 and 0f for vm Interface.
# 5. Update Network domain and verify it is properly updated
# update Network Domain at zone level
cmd = updateZone.updateZoneCmd()
cmd.id = self.zone.id
cmd.domain = "isolated.com"
self.apiclient.updateZone(cmd)
self.debug("Creating and enabling Nuage Vsp Isolated Network "
"offering...")
network_offering = self.create_NetworkOffering(
self.dnsdata["isolated_network_offering"])
self.validate_NetworkOffering(network_offering, state="Enabled")
network_1 = self.create_Network(network_offering)
vm_1 = self.create_VM(network_1)
# VSD verification
self.verify_vsd_network(self.domain.id, network_1)
self.verify_vsd_vm(vm_1)
# Internal DNS check point on VSD
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", network_1)
self.verify_vsd_dhcp_option(self.DOMAINNAME, "isolated.com", network_1)
for nic in vm_1.nic:
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", nic, True)
self.verify_vsd_dhcp_option(
self.DOMAINNAME, "isolated.com", nic, True)
self.verify_vsd_dhcp_option(self.HOSTNAME, "vm1", nic, True)
update_response = Network.update(
network_1, self.apiclient, id=network_1.id,
networkdomain="update.com", changecidr=False)
completeoutput = str(update_response).strip('[]')
self.debug("network update response is " + completeoutput)
self.assertEqual("update.com", update_response.networkdomain,
"Network Domain is not updated as expected"
)
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", network_1)
self.verify_vsd_dhcp_option(self.DOMAINNAME, "update.com", network_1)
for nic in vm_1.nic:
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", nic, True)
self.verify_vsd_dhcp_option(
self.DOMAINNAME, "update.com", nic, True)
self.verify_vsd_dhcp_option(self.HOSTNAME, "vm1", nic, True)
@attr(tags=["advanced", "nuagevsp"], required_hardware="true")
def test_05_Update_Network_with_Domain(self):
""" Verify update NetworkDomain for InternalDns on Isolated Network
with ping VM
"""
# Validate the following
# 1. Create an Isolated network - network1 (10.1.1.1/24) by using DNS
# network offering.
# 2. Deploy vm1 in network1.
# 3. Verify dhcp option 06 and 0f for subnet
# 4. Verify dhcp option 06,15 and 0f for vm Interface.
# 5. Update Network domain and verify it is properly updated
# update Network Domain at zone level
cmd = updateZone.updateZoneCmd()
cmd.id = self.zone.id
cmd.domain = "isolated.com"
self.apiclient.updateZone(cmd)
self.debug("Creating and enabling Nuage Vsp Isolated Network "
"offering...")
network_offering = self.create_NetworkOffering(
self.dnsdata["isolated_network_offering"])
self.validate_NetworkOffering(network_offering, state="Enabled")
network_1 = self.create_Network(network_offering)
vm_1 = self.create_VM(network_1)
# VSD verification
self.verify_vsd_network(self.domain.id, network_1)
self.verify_vsd_vm(vm_1)
# Internal DNS check point on VSD
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", network_1)
self.verify_vsd_dhcp_option(
self.DOMAINNAME, "isolated.com", network_1)
for nic in vm_1.nic:
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", nic, True)
self.verify_vsd_dhcp_option(
self.DOMAINNAME, "isolated.com", nic, True)
self.verify_vsd_dhcp_option(self.HOSTNAME, "vm1", nic, True)
update_response = Network.update(
network_1, self.apiclient, id=network_1.id,
networkdomain="update.com", changecidr=False)
completeoutput = str(update_response).strip('[]')
self.debug("network update response is " + completeoutput)
self.assertEqual("update.com", update_response.networkdomain,
"Network Domain is not updated as expected"
)
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", network_1)
self.verify_vsd_dhcp_option(self.DOMAINNAME, "update.com", network_1)
for nic in vm_1.nic:
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", nic, True)
self.verify_vsd_dhcp_option(
self.DOMAINNAME, "update.com", nic, True)
self.verify_vsd_dhcp_option(self.HOSTNAME, "vm1", nic, True)
# stop and start VM to get new DHCP option
try:
vm_1.stop(self.apiclient)
except Exception as e:
self.fail("Failed to stop the virtual instances, %s" % e)
self.test_data["virtual_machine"]["displayname"] = "vm2"
self.test_data["virtual_machine"]["name"] = "vm2"
vm_2 = self.create_VM(network_1)
self.test_data["virtual_machine"]["displayname"] = "vm1"
self.test_data["virtual_machine"]["name"] = "vm1"
self.verify_vsd_vm(vm_2)
for nic in vm_2.nic:
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", nic, True)
self.verify_vsd_dhcp_option(
self.DOMAINNAME, "update.com", nic, True)
self.verify_vsd_dhcp_option(self.HOSTNAME, "vm2", nic, True)
try:
vm_1.start(self.apiclient)
except Exception as e:
self.fail("Failed to start the virtual instances, %s" % e)
public_ip_1 = self.acquire_PublicIPAddress(network_1)
self.create_and_verify_fw(vm_1, public_ip_1, network_1)
vm_public_ip = public_ip_1.ipaddress.ipaddress
try:
vm_1.ssh_ip = vm_public_ip
vm_1.ssh_port = self.test_data["virtual_machine"]["ssh_port"]
vm_1.username = self.test_data["virtual_machine"]["username"]
vm_1.password = self.test_data["virtual_machine"]["password"]
self.debug("SSHing into VM: %s with %s" %
(vm_1.ssh_ip, vm_1.password))
ssh = vm_1.get_ssh_client(ipaddress=vm_public_ip)
except Exception as e:
self.fail("SSH into VM failed with exception: %s " % e)
cmd = 'ping -c 2 vm2'
self.debug("ping vm2 by hostname with command: " + cmd)
outputlist = ssh.execute(cmd)
self.debug("command is executed properly " + cmd)
completeoutput = str(outputlist).strip('[]')
self.debug("complete output is " + completeoutput)
expectedlist = ['2 received', 'vm2.update.com', vm_2.ipaddress]
for item in expectedlist:
if item in completeoutput:
self.debug("excepted value found in vm: " + item)
else:
self.fail("excepted value not found in vm: " + item)
@attr(tags=["advanced", "nuagevsp"], required_hardware="false")
def test_06_VPC_Network_With_InternalDns(self):
""" Verify InternalDns on VPC Network
"""
# Validate the following
# 1. Create a VPC and tier network by using DNS network offering.
# 2. Deploy vm1 in tier network.
# 3. Verify dhcp option 06 and 0f for subnet
# 4. Verify dhcp option 06,15 and 0f for vm Interface.
cmd = updateZone.updateZoneCmd()
cmd.id = self.zone.id
cmd.domain = "vpc.com"
self.apiclient.updateZone(cmd)
vpc_off = self.create_VpcOffering(self.dnsdata["vpc_offering"])
self.validate_VpcOffering(vpc_off, state="Enabled")
vpc = self.create_Vpc(vpc_off, cidr='10.1.0.0/16', cleanup=False)
self.debug("Creating Nuage Vsp VPC Network offering...")
network_offering = self.create_NetworkOffering(
self.dnsdata["vpc_network_offering"])
self.validate_NetworkOffering(network_offering, state="Enabled")
network_1 = self.create_Network(
network_offering, gateway='10.1.1.1', vpc=vpc)
vm_1 = self.create_VM(network_1)
# VSD verification
self.verify_vsd_network(self.domain.id, network_1, vpc)
self.verify_vsd_vm(vm_1)
# Internal DNS check point on VSD
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", network_1)
self.verify_vsd_dhcp_option(self.DOMAINNAME, "vpc.com", network_1)
for nic in vm_1.nic:
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", nic, True)
self.verify_vsd_dhcp_option(self.DOMAINNAME, "vpc.com", nic, True)
self.verify_vsd_dhcp_option(self.HOSTNAME, "vm1", nic, True)
@attr(tags=["advanced", "nuagevsp"], required_hardware="true")
def test_07_VPC_Network_With_InternalDns(self):
""" Verify InternalDns on VPC Network by ping with hostname
"""
# Validate the following
# 1. Create a VPC and Tier network by using DNS network offering.
# 2. Deploy vm1 in Tier network network1.
# 3. Verify dhcp option 06 and 0f for subnet
# 4. Verify dhcp option 06,15 and 0f for vm Interface.
# 5. Deploy Vm2.
# 6. Verify end to end by pinging with hostname
cmd = updateZone.updateZoneCmd()
cmd.id = self.zone.id
cmd.domain = "vpc.com"
self.apiclient.updateZone(cmd)
vpc_off = self.create_VpcOffering(self.dnsdata["vpc_offering"])
self.validate_VpcOffering(vpc_off, state="Enabled")
vpc = self.create_Vpc(vpc_off, cidr='10.1.0.0/16', cleanup=False)
self.debug("Creating Nuage Vsp VPC Network offering...")
network_offering = self.create_NetworkOffering(
self.dnsdata["vpc_network_offering"])
self.validate_NetworkOffering(network_offering, state="Enabled")
network_1 = self.create_Network(
network_offering, gateway='10.1.1.1', vpc=vpc)
vm_1 = self.create_VM(network_1)
# VSD verification
self.verify_vsd_network(self.domain.id, network_1, vpc)
self.verify_vsd_vm(vm_1)
# Internal DNS check point on VSD
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", network_1)
self.verify_vsd_dhcp_option(self.DOMAINNAME, "vpc.com", network_1)
for nic in vm_1.nic:
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", nic, True)
self.verify_vsd_dhcp_option(self.DOMAINNAME, "vpc.com", nic, True)
self.verify_vsd_dhcp_option(self.HOSTNAME, "vm1", nic, True)
self.test_data["virtual_machine"]["displayname"] = "vm2"
self.test_data["virtual_machine"]["name"] = "vm2"
vm_2 = self.create_VM(network_1)
self.test_data["virtual_machine"]["displayname"] = "vm1"
self.test_data["virtual_machine"]["name"] = "vm1"
self.verify_vsd_vm(vm_2)
for nic in vm_2.nic:
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", nic, True)
self.verify_vsd_dhcp_option(self.DOMAINNAME, "vpc.com", nic, True)
self.verify_vsd_dhcp_option(self.HOSTNAME, "vm2", nic, True)
public_ip_1 = self.acquire_PublicIPAddress(network_1, vpc)
self.create_StaticNatRule_For_VM(vm_1, public_ip_1, network_1)
# Adding Network ACL rule in the Public tier
self.debug("Adding Network ACL rule to make the created NAT rule "
"(SSH) accessible...")
public_ssh_rule = self.create_NetworkAclRule(
self.test_data["ingress_rule"], network=network_1)
# VSD verification
self.verify_vsd_firewall_rule(public_ssh_rule)
vm_public_ip = public_ip_1.ipaddress.ipaddress
try:
vm_1.ssh_ip = vm_public_ip
vm_1.ssh_port = self.test_data["virtual_machine"]["ssh_port"]
vm_1.username = self.test_data["virtual_machine"]["username"]
vm_1.password = self.test_data["virtual_machine"]["password"]
self.debug("SSHing into VM: %s with %s" %
(vm_1.ssh_ip, vm_1.password))
ssh = vm_1.get_ssh_client(ipaddress=vm_public_ip)
except Exception as e:
self.fail("SSH into VM failed with exception %s" % e)
cmd = 'ping -c 2 vm2'
self.debug("ping vm2 by hostname with command: " + cmd)
outputlist = ssh.execute(cmd)
self.debug("command is executed properly " + cmd)
completeoutput = str(outputlist).strip('[]')
self.debug("complete output is " + completeoutput)
expectedlist = ['2 received', 'vm2.vpc.com', vm_2.ipaddress]
for item in expectedlist:
if item in completeoutput:
self.debug("excepted value found in vm: " + item)
else:
self.fail("excepted value not found in vm: " + item)
@attr(tags=["advanced", "nuagevsp"], required_hardware="true")
def test_08_VPC_Network_Restarts_With_InternalDns(self):
""" Verify InternalDns on VPC Network with restarts and ping by
hostname
"""
# Validate the following
# 1. Create a VPC and Tier network by using DNS network offering.
# 2. Deploy vm1 in Tier network network1.
# 3. Verify dhcp option 06 and 0f for subnet
# 4. Verify dhcp option 06,15 and 0f for vm Interface.
# 5. Deploy Vm2.
# 6. Verify end to end by pinging with hostname while restarting
# VPC and Tier without and with cleanup.
cmd = updateZone.updateZoneCmd()
cmd.id = self.zone.id
cmd.domain = "vpc.com"
self.apiclient.updateZone(cmd)
vpc_off = self.create_VpcOffering(self.dnsdata["vpc_offering"])
self.validate_VpcOffering(vpc_off, state="Enabled")
vpc = self.create_Vpc(vpc_off, cidr='10.1.0.0/16', cleanup=False)
self.debug("Creating Nuage Vsp VPC Network offering...")
network_offering = self.create_NetworkOffering(
self.dnsdata["vpc_network_offering"])
self.validate_NetworkOffering(network_offering, state="Enabled")
network_1 = self.create_Network(
network_offering, gateway='10.1.1.1', vpc=vpc)
vm_1 = self.create_VM(network_1)
# VSD verification
self.verify_vsd_network(self.domain.id, network_1, vpc)
self.verify_vsd_vm(vm_1)
# Internal DNS check point on VSD
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", network_1)
self.verify_vsd_dhcp_option(self.DOMAINNAME, "vpc.com", network_1)
for nic in vm_1.nic:
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", nic, True)
self.verify_vsd_dhcp_option(self.DOMAINNAME, "vpc.com", nic, True)
self.verify_vsd_dhcp_option(self.HOSTNAME, "vm1", nic, True)
self.test_data["virtual_machine"]["displayname"] = "vm2"
self.test_data["virtual_machine"]["name"] = "vm2"
vm_2 = self.create_VM(network_1)
self.test_data["virtual_machine"]["displayname"] = "vm1"
self.test_data["virtual_machine"]["name"] = "vm1"
self.verify_vsd_vm(vm_2)
for nic in vm_2.nic:
self.verify_vsd_dhcp_option(self.DNS, "10.1.1.2", nic, True)
self.verify_vsd_dhcp_option(self.DOMAINNAME, "vpc.com", nic, True)
self.verify_vsd_dhcp_option(self.HOSTNAME, "vm2", nic, True)
public_ip_1 = self.acquire_PublicIPAddress(network_1, vpc)
self.create_StaticNatRule_For_VM(vm_1, public_ip_1, network_1)
# Adding Network ACL rule in the Public tier
self.debug("Adding Network ACL rule to make the created NAT rule "
"(SSH) accessible...")
public_ssh_rule = self.create_NetworkAclRule(
self.test_data["ingress_rule"], network=network_1)
# VSD verification
self.verify_vsd_firewall_rule(public_ssh_rule)
vm_public_ip = public_ip_1.ipaddress.ipaddress
try:
vm_1.ssh_ip = vm_public_ip
vm_1.ssh_port = self.test_data["virtual_machine"]["ssh_port"]
vm_1.username = self.test_data["virtual_machine"]["username"]
vm_1.password = self.test_data["virtual_machine"]["password"]
self.debug("SSHing into VM: %s with %s" %
(vm_1.ssh_ip, vm_1.password))
ssh = vm_1.get_ssh_client(ipaddress=vm_public_ip)
except Exception as e:
self.fail("SSH into VM failed with exception %s" % e)
cmd = 'ping -c 2 vm2'
self.debug("ping vm2 by hostname with command: " + cmd)
outputlist = ssh.execute(cmd)
self.debug("command is executed properly " + cmd)
completeoutput = str(outputlist).strip('[]')
self.debug("complete output is " + completeoutput)
expectedlist = ['2 received', 'vm2.vpc.com', vm_2.ipaddress]
for item in expectedlist:
if item in completeoutput:
self.debug("excepted value found in vm: " + item)
else:
self.fail("excepted value not found in vm: " + item)
# Restarting VPC network (cleanup = false)
self.debug("Restarting the created VPC network without cleanup...")
Network.restart(network_1, self.api_client, cleanup=False)
self.validate_Network(network_1, state="Implemented")
vr = self.get_Router(network_1)
self.check_Router_state(vr, state="Running")
self.check_VM_state(vm_1, state="Running")
self.check_VM_state(vm_2, state="Running")
# VSD verification
self.verify_vsd_network(self.domain.id, network_1, vpc)
self.verify_vsd_router(vr)
self.verify_vsd_vm(vm_1)
self.verify_vsd_vm(vm_2)
try:
vm_1.ssh_ip = vm_public_ip
vm_1.ssh_port = self.test_data["virtual_machine"]["ssh_port"]
vm_1.username = self.test_data["virtual_machine"]["username"]
vm_1.password = self.test_data["virtual_machine"]["password"]
self.debug("SSHing into VM: %s with %s" %
(vm_1.ssh_ip, vm_1.password))
ssh = vm_1.get_ssh_client(ipaddress=vm_public_ip)
except Exception as e:
self.fail("SSH into VM failed with exception %s" % e)
cmd = 'ping -c 2 vm2'
self.debug("ping vm2 by hostname with command: " + cmd)
outputlist = ssh.execute(cmd)
self.debug("command is executed properly " + cmd)
completeoutput = str(outputlist).strip('[]')
self.debug("complete output is " + completeoutput)
expectedlist = ['2 received', 'vm2.vpc.com', vm_2.ipaddress]
for item in expectedlist:
if item in completeoutput:
self.debug("excepted value found in vm: " + item)
else:
self.fail("excepted value not found in vm: " + item)
# Restarting VPC network (cleanup = true)
self.debug("Restarting the created VPC network with cleanup...")
Network.restart(network_1, self.api_client, cleanup=True)
self.validate_Network(network_1, state="Implemented")
vr = self.get_Router(network_1)
self.check_Router_state(vr, state="Running")
self.check_VM_state(vm_1, state="Running")
self.check_VM_state(vm_2, state="Running")
# VSD verification
self.verify_vsd_network(self.domain.id, network_1, vpc)
self.verify_vsd_router(vr)
self.verify_vsd_vm(vm_1)
self.verify_vsd_vm(vm_2)
try:
vm_1.ssh_ip = vm_public_ip
vm_1.ssh_port = self.test_data["virtual_machine"]["ssh_port"]
vm_1.username = self.test_data["virtual_machine"]["username"]
vm_1.password = self.test_data["virtual_machine"]["password"]
self.debug("SSHing into VM: %s with %s" %
(vm_1.ssh_ip, vm_1.password))
ssh = vm_1.get_ssh_client(ipaddress=vm_public_ip)
except Exception as e:
self.fail("SSH into VM failed with exception %s" % e)
cmd = 'ping -c 2 vm2'
self.debug("ping vm2 by hostname with command: " + cmd)
outputlist = ssh.execute(cmd)
self.debug("command is executed properly " + cmd)
completeoutput = str(outputlist).strip('[]')
self.debug("complete output is " + completeoutput)
expectedlist = ['2 received', 'vm2.vpc.com', vm_2.ipaddress]
for item in expectedlist:
if item in completeoutput:
self.debug("excepted value found in vm: " + item)
else:
self.fail("excepted value not found in vm: " + item)
# Restarting VPC (cleanup = false)
self.debug("Restarting the VPC without cleanup...")
self.restart_Vpc(vpc, cleanup=False)
self.validate_Network(network_1, state="Implemented")
vr = self.get_Router(network_1)
self.check_Router_state(vr, state="Running")
self.check_VM_state(vm_1, state="Running")
self.check_VM_state(vm_2, state="Running")
# VSD verification
self.verify_vsd_network(self.domain.id, network_1, vpc)
self.verify_vsd_router(vr)
self.verify_vsd_vm(vm_1)
try:
vm_1.ssh_ip = vm_public_ip
vm_1.ssh_port = self.test_data["virtual_machine"]["ssh_port"]
vm_1.username = self.test_data["virtual_machine"]["username"]
vm_1.password = self.test_data["virtual_machine"]["password"]
self.debug("SSHing into VM: %s with %s" %
(vm_1.ssh_ip, vm_1.password))
ssh = vm_1.get_ssh_client(ipaddress=vm_public_ip)
except Exception as e:
self.fail("SSH into VM failed with exception %s" % e)
cmd = 'ping -c 2 vm2'
self.debug("ping vm2 by hostname with command: " + cmd)
outputlist = ssh.execute(cmd)
self.debug("command is executed properly " + cmd)
completeoutput = str(outputlist).strip('[]')
self.debug("complete output is " + completeoutput)
expectedlist = ['2 received', 'vm2.vpc.com', vm_2.ipaddress]
for item in expectedlist:
if item in completeoutput:
self.debug("excepted value found in vm: " + item)
else:
self.fail("excepted value not found in vm: " + item)
# Restarting VPC (cleanup = true)
self.debug("Restarting the VPC with cleanup...")
self.restart_Vpc(vpc, cleanup=True)
self.validate_Network(network_1, state="Implemented")
vr = self.get_Router(network_1)
self.check_Router_state(vr, state="Running")
self.check_VM_state(vm_1, state="Running")
self.check_VM_state(vm_2, state="Running")
# VSD verification
self.verify_vsd_network(self.domain.id, network_1, vpc)
self.verify_vsd_router(vr)
self.verify_vsd_vm(vm_1)
try:
vm_1.ssh_ip = vm_public_ip
vm_1.ssh_port = self.test_data["virtual_machine"]["ssh_port"]
vm_1.username = self.test_data["virtual_machine"]["username"]
vm_1.password = self.test_data["virtual_machine"]["password"]
self.debug("SSHing into VM: %s with %s" %
(vm_1.ssh_ip, vm_1.password))
ssh = vm_1.get_ssh_client(ipaddress=vm_public_ip)
except Exception as e:
self.fail("SSH into VM failed with exception %s" % e)
cmd = 'ping -c 2 vm2'
self.debug("ping vm2 by hostname with command: " + cmd)
outputlist = ssh.execute(cmd)
self.debug("command is executed properly " + cmd)
completeoutput = str(outputlist).strip('[]')
self.debug("complete output is " + completeoutput)
expectedlist = ['2 received', 'vm2.vpc.com', vm_2.ipaddress]
for item in expectedlist:
if item in completeoutput:
self.debug("excepted value found in vm: " + item)
else:
self.fail("excepted value not found in vm: " + item)
@attr(tags=["advanced", "nuagevsp"], required_hardware="true")
def test_09_update_network_offering_isolated_network(self):
"""Test Update network offering for isolated Networks
with Nuage VSP SDN plugin
"""
# Create an Isolated Network with Nuage VSP Isolated Network
# offering specifying Services which don't need a VR.
# Update the network offering of this network to one that
# needs a VR, check that a VR is spawn
# After that update network to previous offering
# Check that VR is destroyed and removed.
self.debug("+++Create an Isolated network with a network "
"offering which has only services without VR")
cmd = updateZone.updateZoneCmd()
cmd.id = self.zone.id
cmd.domain = "isolated.com"
self.apiclient.updateZone(cmd)
self.debug("Creating and enabling Nuage Vsp Isolated Network "
"offering which has only service without VR...")
network_offering = self.create_NetworkOffering(
self.test_data["nuagevsp"]
["isolated_network_offering_without_vr"])
self.validate_NetworkOffering(network_offering, state="Enabled")
network_1 = self.create_Network(network_offering)
self.validate_Network(network_1, state="Allocated")
self.debug("+++Deploy VM in the created Isolated network "
"with only services without VR")
vm_1 = self.create_VM(network_1)
# VSD verification
self.verify_vsd_network(self.domain.id, network_1)
self.verify_vsd_vm(vm_1)
with self.assertRaises(Exception):
self.get_Router(network_1)
self.debug("+++Verified no VR is spawned for this network ")
self.debug("+++ Upgrade offering of created Isolated network with "
"a dns offering which spins a VR")
self.upgrade_Network(self.test_data["nuagevsp"][
"isolated_network_offering"],
network_1)
vr = self.get_Router(network_1)
self.check_Router_state(vr, state="Running")
# VSD verification
self.verify_vsd_network(self.domain.id, network_1)
self.verify_vsd_router(vr)
self.debug("+++ Upgrade offering of created Isolated network with "
"an offering which removes the VR...")
self.upgrade_Network(self.test_data["nuagevsp"][
"isolated_network_offering_without_vr"],
network_1)
with self.assertRaises(Exception):
self.get_Router(network_1)
self.debug("+++Verified no VR is spawned for this network ")
| 43.755446
| 79
| 0.624601
| 5,741
| 44,193
| 4.606166
| 0.054346
| 0.046892
| 0.057026
| 0.047421
| 0.900885
| 0.88228
| 0.873922
| 0.869914
| 0.863031
| 0.854523
| 0
| 0.022439
| 0.272917
| 44,193
| 1,009
| 80
| 43.798811
| 0.800542
| 0.117824
| 0
| 0.865734
| 0
| 0
| 0.196701
| 0.005731
| 0
| 0
| 0
| 0
| 0.006993
| 1
| 0.018182
| false
| 0.030769
| 0.006993
| 0
| 0.033566
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
a7d47a70f8507f52c6bf779bb979fb8806f598f5
| 34
|
py
|
Python
|
bananagui/wrappers/dummy/font.py
|
Akuli/BananaGUI
|
d1bb2823770fb9d2e13da1d377d7a51e6a144679
|
[
"MIT"
] | 4
|
2017-01-13T16:51:45.000Z
|
2019-06-13T20:54:42.000Z
|
bananagui/wrappers/dummy/font.py
|
Akuli/BananaGUI
|
d1bb2823770fb9d2e13da1d377d7a51e6a144679
|
[
"MIT"
] | 1
|
2019-06-13T21:04:42.000Z
|
2019-06-20T13:27:56.000Z
|
bananagui/wrappers/dummy/font.py
|
Akuli/BananaGUI
|
d1bb2823770fb9d2e13da1d377d7a51e6a144679
|
[
"MIT"
] | null | null | null |
def get_families():
return []
| 11.333333
| 19
| 0.617647
| 4
| 34
| 5
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.235294
| 34
| 2
| 20
| 17
| 0.769231
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.5
| true
| 0
| 0
| 0.5
| 1
| 0
| 1
| 1
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 1
| 1
| 0
|
0
| 7
|
ac8261e3098a9e81b9402fd44fefa8055431c0df
| 102
|
py
|
Python
|
demo/cli.py
|
tiborsimon/python-cmd-test
|
8900f44a933f39b679684e1a4a64c7b66a9d69a7
|
[
"MIT"
] | null | null | null |
demo/cli.py
|
tiborsimon/python-cmd-test
|
8900f44a933f39b679684e1a4a64c7b66a9d69a7
|
[
"MIT"
] | null | null | null |
demo/cli.py
|
tiborsimon/python-cmd-test
|
8900f44a933f39b679684e1a4a64c7b66a9d69a7
|
[
"MIT"
] | 1
|
2021-02-20T13:56:47.000Z
|
2021-02-20T13:56:47.000Z
|
from termcolor import cprint
def imre():
cprint('Imre!!?!', 'yellow', 'on_red', attrs=['bold'])
| 17
| 58
| 0.617647
| 13
| 102
| 4.769231
| 0.846154
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.156863
| 102
| 5
| 59
| 20.4
| 0.72093
| 0
| 0
| 0
| 0
| 0
| 0.235294
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.333333
| true
| 0
| 0.333333
| 0
| 0.666667
| 0.666667
| 1
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 1
| 0
| 1
| 1
|
0
| 7
|
3bb61bcb9a755707eeabc89af0d6e250130350c2
| 7,613
|
py
|
Python
|
code/src/main/python/store/base_store.py
|
anonfse/COSAL_Anonymized
|
709906294fd775131f3e019862bbdd554d83773d
|
[
"Unlicense"
] | null | null | null |
code/src/main/python/store/base_store.py
|
anonfse/COSAL_Anonymized
|
709906294fd775131f3e019862bbdd554d83773d
|
[
"Unlicense"
] | 1
|
2021-11-03T08:28:31.000Z
|
2021-11-03T08:28:31.000Z
|
code/src/main/python/store/base_store.py
|
anonfse/COSAL_Anonymized
|
709906294fd775131f3e019862bbdd554d83773d
|
[
"Unlicense"
] | 1
|
2022-03-22T14:24:13.000Z
|
2022-03-22T14:24:13.000Z
|
import sys
import os
sys.path.append(os.path.abspath("."))
sys.dont_write_bytecode = True
__author__ = "COSAL"
from utils.lib import O
class InputStore(O):
def __init__(self, dataset, **kwargs):
O.__init__(self, **kwargs)
self.dataset = dataset
def load_inputs(self, args_key):
raise NotImplementedError("Should be implemented in subclass")
@staticmethod
def is_array(arg_sets):
if not type(arg_sets[0]) is list:
return False
return len(arg_sets[0]) != len(arg_sets[1]) != len(arg_sets[2])
class FunctionStore(O):
def __init__(self, dataset, **kwargs):
O.__init__(self, **kwargs)
self.dataset = dataset
def load_function(self, function_name):
raise NotImplementedError("Should be implemented in subclass")
def load_functions(self, function_names=None, limit=None):
raise NotImplementedError("Should be implemented in subclass")
def load_all_metadata(self, limit=None):
raise NotImplementedError("Should be implemented in subclass")
def load_java_generated_functions(self, limit=None):
raise NotImplementedError("Should be implemented in subclass")
def load_metadata(self, function_name):
raise NotImplementedError("Should be implemented in subclass")
def update_py_function_metadata(self, function_json):
raise NotImplementedError("Should be implemented in subclass")
def load_py_function_metadata(self, function_name):
raise NotImplementedError("Should be implemented in subclass")
def load_py_functions_metadata(self, file_path):
raise NotImplementedError("Should be implemented in subclass")
def del_all_py_functions_metadata(self):
raise NotImplementedError("Should be implemented in subclass")
def load_py_generated_functions(self):
raise NotImplementedError("Should be implemented in subclass")
def load_py_functions_from_names(self, function_names):
raise NotImplementedError("Should be implemented in subclass")
def del_py_function_metadata(self, function_name):
raise NotImplementedError("Should be implemented in subclass")
def del_py_functions_metadata(self, file_path):
raise NotImplementedError("Should be implemented in subclass")
def get_generated_file(self, source_file_path):
raise NotImplementedError("Should be implemented in subclass")
def save_py_function(self, function_json):
raise NotImplementedError("Should be implemented")
def load_py_function(self, function_name):
raise NotImplementedError("Should be implemented")
def del_all_py_functions(self):
raise NotImplementedError("Should be implemented in subclass")
def exists_py_function(self, function_json):
raise NotImplementedError("Should be implemented")
def save_failed_py_function(self, function_json):
raise NotImplementedError("Should be implemented")
def is_invalid_py_function(self, function_name):
raise NotImplementedError("Should be implemented")
def load_py_functions(self):
raise NotImplementedError("Should be implemented")
def save_py_metadata(self, func_json):
raise NotImplementedError("Should be implemented")
def load_py_metadata(self, function_name):
raise NotImplementedError("Should be implemented")
@staticmethod
def is_object_return(metadata):
"""
Is the return type of object
:param metadata:
:return:
"""
return not metadata["isArray"] and not metadata["isPrimitive"]
@staticmethod
def get_return_vals(returns):
return_keys = []
def get_key(d):
keys = []
for k in d.keys():
if isinstance(d[k], dict):
keys += ["%s.%s" % (k, k_i) for k_i in get_key(d[k])]
else:
keys.append(k)
return keys
def get_value(d):
values = []
for k in d.keys():
if isinstance(d[k], dict):
values += get_value(d[k])
else:
values.append(d[k])
return values
for ret in returns:
if ret is None: continue
return_keys = get_key(ret)
break
ret_vals_dict = {k: [] for k in return_keys}
for ret in returns:
if ret is None:
for k in return_keys:
ret_vals_dict[k].append(None)
else:
for k, v in zip(return_keys, get_value(ret)):
ret_vals_dict[k].append(v)
return ret_vals_dict
class PyFileMetaStore(O):
def __init__(self, dataset, **kwargs):
O.__init__(self, **kwargs)
self.dataset = dataset
def load_meta(self, file_name):
raise NotImplementedError("Should be implemented in subclass")
def save_meta(self, bson_dict):
raise NotImplementedError("Should be implemented in subclass")
def del_meta(self, file_path):
raise NotImplementedError("Should be implemented in subclass")
class ArgumentStore(O):
def __init__(self, dataset, **kwargs):
O.__init__(self, **kwargs)
self.dataset = dataset
def load_args(self, arg_key):
raise NotImplementedError("Should be implemented in subclass")
class ExecutionStore(O):
def __init__(self, dataset, **kwargs):
O.__init__(self, **kwargs)
self.dataset = dataset
class ClusterStore(O):
def __init__(self, dataset, **kwargs):
O.__init__(self, **kwargs)
self.dataset = dataset
def save_difference(self, difference, clustering_error):
raise NotImplementedError("Should be implemented in subclass")
def load_differences(self, clustering_error):
raise NotImplementedError("Should be implemented in subclass")
def count_differences(self, clustering_error):
raise NotImplementedError("Should be implemented in subclass")
def save_clusters(self, cluster, suffix):
raise NotImplementedError("Should be implemented in subclass")
def register_completed_function(self, function_name, clustering_error):
raise NotImplementedError("Should be implemented in subclass")
def get_completed_functions(self, clustering_error):
raise NotImplementedError("Should be implemented in subclass")
class SystemClassStore(O):
def __init__(self, dataset, **kwargs):
O.__init__(self, **kwargs)
self.dataset = dataset
def is_valid_class(self, project, class_key):
raise NotImplementedError("Should be implemented in subclass")
def get_class(self, project, class_key):
raise NotImplementedError("Should be implemented in subclass")
class PyClassStore(O):
def __init__(self, **kwargs):
O.__init__(self, **kwargs)
def is_valid_system_class(self, module, name):
raise NotImplementedError("Should be implemented in subclass")
def load_system_class(self, module, name):
raise NotImplementedError("Should be implemented in subclass")
def save_system_class(self, system_class):
raise NotImplementedError("Should be implemented in subclass")
def load_custom_class(self, file_source, name):
raise NotImplementedError("Should be implemented in subclass")
def save_custom_class(self, custom_class):
raise NotImplementedError("Should be implemented in subclass")
class TokenStore(O):
def __init__(self, **kwargs):
O.__init__(self, **kwargs)
def save_tokens(self, token_json):
raise NotImplementedError("Should be implemented in subclass")
def save_contextual_tokens(self, context_json):
raise NotImplementedError("Should be implemented in subclass")
def get_contextual_tokens(self, language=None):
raise NotImplementedError("Should be implemented in subclass")
def sample_documents(self, language, sample_size):
raise NotImplementedError("Should be implemented in subclass")
def get_tokens(self, language=None):
raise NotImplementedError("Should be implemented in subclass")
| 30.452
| 73
| 0.733745
| 965
| 7,613
| 5.543005
| 0.133679
| 0.206394
| 0.257992
| 0.275192
| 0.765003
| 0.745186
| 0.745186
| 0.74313
| 0.683679
| 0.582726
| 0
| 0.000636
| 0.173782
| 7,613
| 250
| 74
| 30.452
| 0.849762
| 0.007093
| 0
| 0.482558
| 0
| 0
| 0.192542
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.348837
| false
| 0
| 0.017442
| 0
| 0.453488
| 0
| 0
| 0
| 0
| null | 1
| 1
| 1
| 0
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
3bfe8ea4945e26184c08cdf956d5fd0de275fb82
| 205
|
py
|
Python
|
data/__all_models.py
|
pithko/badgettingbetter
|
b57007ed770674e0b8d8cc78d2003534daefc938
|
[
"MIT"
] | null | null | null |
data/__all_models.py
|
pithko/badgettingbetter
|
b57007ed770674e0b8d8cc78d2003534daefc938
|
[
"MIT"
] | null | null | null |
data/__all_models.py
|
pithko/badgettingbetter
|
b57007ed770674e0b8d8cc78d2003534daefc938
|
[
"MIT"
] | null | null | null |
import centurio.data.attemptdays
import centurio.data.attempts
import centurio.data.calendars
import centurio.data.cohorts
import centurio.data.days
import centurio.data.projects
import centurio.data.users
| 29.285714
| 32
| 0.868293
| 28
| 205
| 6.357143
| 0.357143
| 0.550562
| 0.707865
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.063415
| 205
| 7
| 33
| 29.285714
| 0.927083
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
ce10c15fcaae009b9dfb80f17f6c07eeab444321
| 3,116
|
py
|
Python
|
IfxPy/tests/test_159a_FetchAssocSeveralRows_02.py
|
jaimundada/IfxPy
|
e6941d77051933dfe6affd3b096ea6d8f485ae9b
|
[
"Apache-2.0"
] | 39
|
2017-09-25T00:10:23.000Z
|
2022-02-10T22:03:36.000Z
|
IfxPy/tests/test_159a_FetchAssocSeveralRows_02.py
|
jaimundada/IfxPy
|
e6941d77051933dfe6affd3b096ea6d8f485ae9b
|
[
"Apache-2.0"
] | 58
|
2018-05-11T09:45:45.000Z
|
2022-03-10T10:27:01.000Z
|
IfxPy/tests/test_159a_FetchAssocSeveralRows_02.py
|
jaimundada/IfxPy
|
e6941d77051933dfe6affd3b096ea6d8f485ae9b
|
[
"Apache-2.0"
] | 22
|
2018-02-02T12:41:18.000Z
|
2022-02-24T14:29:17.000Z
|
#
#
#
import unittest, sys
import IfxPy
import config
from testfunctions import IfxPyTestFunctions
class IfxPyTestCase(unittest.TestCase):
def test_159a_FetchAssocSeveralRows_02(self):
obj = IfxPyTestFunctions()
obj.assert_expect(self.run_test_159a)
def run_test_159a(self):
conn = IfxPy.connect(config.ConnStr, config.user, config.password)
server = IfxPy.server_info( conn )
if (server.DBMS_NAME[0:3] == 'Inf'):
op = {IfxPy.ATTR_CASE: IfxPy.CASE_UPPER}
IfxPy.set_option(conn, op, 1)
result = IfxPy.exec_immediate(conn, "select prstdate,prendate from project")
i = 1
row = IfxPy.fetch_assoc(result)
while ( row ):
#printf("%3d %10s %10s\n",i, row['PRSTDATE'], row['PRENDATE'])
print("%3d %10s %10s" % (i, row['PRSTDATE'], row['PRENDATE']))
i += 1
row = IfxPy.fetch_assoc(result)
#__END__
#__LUW_EXPECTED__
# 1 1982-01-01 1983-02-01
# 2 1982-01-01 1983-02-01
# 3 1982-01-01 1983-02-01
# 4 1982-01-01 1983-02-01
# 5 1982-01-01 1983-02-01
# 6 1982-01-01 1983-02-01
# 7 1982-01-01 1983-02-01
# 8 1982-01-01 1983-02-01
# 9 1982-01-01 1983-02-01
# 10 1982-01-01 1982-12-01
# 11 1982-01-01 1982-12-01
# 12 1982-02-15 1982-12-01
# 13 1982-01-01 1983-02-01
# 14 1982-01-01 1983-02-01
# 15 1982-01-01 1983-02-01
# 16 1982-01-01 1983-02-01
# 17 1982-01-01 1983-02-01
# 18 1982-01-01 1983-02-01
# 19 1982-01-01 1983-02-01
# 20 1982-01-01 1982-09-15
#__ZOS_EXPECTED__
# 1 1982-01-01 1983-02-01
# 2 1982-01-01 1983-02-01
# 3 1982-01-01 1983-02-01
# 4 1982-01-01 1983-02-01
# 5 1982-01-01 1983-02-01
# 6 1982-01-01 1983-02-01
# 7 1982-01-01 1983-02-01
# 8 1982-01-01 1983-02-01
# 9 1982-01-01 1983-02-01
# 10 1982-01-01 1982-12-01
# 11 1982-01-01 1982-12-01
# 12 1982-02-15 1982-12-01
# 13 1982-01-01 1983-02-01
# 14 1982-01-01 1983-02-01
# 15 1982-01-01 1983-02-01
# 16 1982-01-01 1983-02-01
# 17 1982-01-01 1983-02-01
# 18 1982-01-01 1983-02-01
# 19 1982-01-01 1983-02-01
# 20 1982-01-01 1982-09-15
#__SYSTEMI_EXPECTED__
# 1 1982-01-01 1983-02-01
# 2 1982-01-01 1983-02-01
# 3 1982-01-01 1983-02-01
# 4 1982-01-01 1983-02-01
# 5 1982-01-01 1983-02-01
# 6 1982-01-01 1983-02-01
# 7 1982-01-01 1983-02-01
# 8 1982-01-01 1983-02-01
# 9 1982-01-01 1983-02-01
# 10 1982-01-01 1982-12-01
# 11 1982-01-01 1982-12-01
# 12 1982-02-15 1982-12-01
# 13 1982-01-01 1983-02-01
# 14 1982-01-01 1983-02-01
# 15 1982-01-01 1983-02-01
# 16 1982-01-01 1983-02-01
# 17 1982-01-01 1983-02-01
# 18 1982-01-01 1983-02-01
# 19 1982-01-01 1983-02-01
# 20 1982-01-01 1982-09-15
#__IDS_EXPECTED__
# 1 1982-01-01 1983-02-01
# 2 1982-01-01 1983-02-01
# 3 1982-01-01 1983-02-01
# 4 1982-01-01 1983-02-01
# 5 1982-01-01 1983-02-01
# 6 1982-01-01 1983-02-01
# 7 1982-01-01 1983-02-01
# 8 1982-01-01 1983-02-01
# 9 1982-01-01 1983-02-01
# 10 1982-01-01 1982-12-01
# 11 1982-01-01 1982-12-01
# 12 1982-02-15 1982-12-01
# 13 1982-01-01 1983-02-01
# 14 1982-01-01 1983-02-01
# 15 1982-01-01 1983-02-01
# 16 1982-01-01 1983-02-01
# 17 1982-01-01 1983-02-01
# 18 1982-01-01 1983-02-01
# 19 1982-01-01 1983-02-01
# 20 1982-01-01 1982-09-15
| 25.752066
| 80
| 0.661425
| 683
| 3,116
| 2.959004
| 0.125915
| 0.225631
| 0.300841
| 0.38001
| 0.75903
| 0.736269
| 0.736269
| 0.710539
| 0.710539
| 0.710539
| 0
| 0.553406
| 0.170732
| 3,116
| 120
| 81
| 25.966667
| 0.228715
| 0.685494
| 0
| 0.095238
| 0
| 0
| 0.077528
| 0
| 0
| 0
| 0
| 0
| 0.047619
| 1
| 0.095238
| false
| 0.047619
| 0.190476
| 0
| 0.333333
| 0.047619
| 0
| 0
| 0
| null | 1
| 1
| 1
| 0
| 1
| 1
| 1
| 1
| 1
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 10
|
cbf31be8f02d27ed69c0d85f549b0d4871719756
| 1,189
|
py
|
Python
|
tests/parser/detcons.1.test.py
|
veltri/DLV2
|
944aaef803aa75e7ec51d7e0c2b0d964687fdd0e
|
[
"Apache-2.0"
] | null | null | null |
tests/parser/detcons.1.test.py
|
veltri/DLV2
|
944aaef803aa75e7ec51d7e0c2b0d964687fdd0e
|
[
"Apache-2.0"
] | null | null | null |
tests/parser/detcons.1.test.py
|
veltri/DLV2
|
944aaef803aa75e7ec51d7e0c2b0d964687fdd0e
|
[
"Apache-2.0"
] | null | null | null |
input = """
% Test with the following options:
%
% dl x -det
% dl x -det -filter=edb -filter=det -filter=true -filter=false -filter=ok
% dl x -det -filter=edb -filter=det -filter=true -filter=false -pfilter=ok
% EDB
edb.
edb_filtered.
% IDB, immediate.
det :- edb.
det_filtered :- edb.
% IDB, undefined.
undef1 | undef2 :- det.
% IDB, deterministic.
true | false :- det.
:- false.
true_filtered | false_filtered :- det.
:- false_filtered.
% IDB, deterministic, true negation.
ok | -ok :- edb.
:- -ok.
ok_filtered | -ok_filtered :- edb.
:- -ok_filtered.
"""
output = """
% Test with the following options:
%
% dl x -det
% dl x -det -filter=edb -filter=det -filter=true -filter=false -filter=ok
% dl x -det -filter=edb -filter=det -filter=true -filter=false -pfilter=ok
% EDB
edb.
edb_filtered.
% IDB, immediate.
det :- edb.
det_filtered :- edb.
% IDB, undefined.
undef1 | undef2 :- det.
% IDB, deterministic.
true | false :- det.
:- false.
true_filtered | false_filtered :- det.
:- false_filtered.
% IDB, deterministic, true negation.
ok | -ok :- edb.
:- -ok.
ok_filtered | -ok_filtered :- edb.
:- -ok_filtered.
"""
| 18.292308
| 75
| 0.628259
| 158
| 1,189
| 4.626582
| 0.151899
| 0.098495
| 0.049248
| 0.065663
| 0.984952
| 0.984952
| 0.984952
| 0.984952
| 0.984952
| 0.984952
| 0
| 0.004278
| 0.213625
| 1,189
| 64
| 76
| 18.578125
| 0.77754
| 0
| 0
| 0.92
| 0
| 0.08
| 0.972542
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
02016ee003ad32708a7326e34c777669590268e9
| 5,253
|
py
|
Python
|
test/client/test_control_dtc_setting.py
|
sgnes/python-udsoncan
|
0906911a50e8e4e64feaf4d29c0ac884ec0df61d
|
[
"MIT"
] | 1
|
2019-07-02T10:15:03.000Z
|
2019-07-02T10:15:03.000Z
|
test/client/test_control_dtc_setting.py
|
sgnes/python-udsoncan
|
0906911a50e8e4e64feaf4d29c0ac884ec0df61d
|
[
"MIT"
] | null | null | null |
test/client/test_control_dtc_setting.py
|
sgnes/python-udsoncan
|
0906911a50e8e4e64feaf4d29c0ac884ec0df61d
|
[
"MIT"
] | null | null | null |
from udsoncan.client import Client
from udsoncan import services
from udsoncan.exceptions import *
from test.ClientServerTest import ClientServerTest
class TestControlDTCSettings(ClientServerTest):
def __init__(self, *args, **kwargs):
ClientServerTest.__init__(self, *args, **kwargs)
def test_set_on(self):
request = self.conn.touserqueue.get(timeout=0.2)
self.assertEqual(request, b"\x85\x01")
self.conn.fromuserqueue.put(b"\xC5\x01") # Positive response
def _test_set_on(self):
response = self.udsclient.control_dtc_setting(services.ControlDTCSetting.SettingType.on)
self.assertEqual(response.service_data.setting_type_echo, services.ControlDTCSetting.SettingType.on)
def test_set_on_spr(self):
request = self.conn.touserqueue.get(timeout=0.2)
self.assertEqual(request, b"\x85\x81")
self.conn.fromuserqueue.put("wait") # Synchronize
def _test_set_on_spr(self):
with self.udsclient.suppress_positive_response:
response = self.udsclient.control_dtc_setting(services.ControlDTCSetting.SettingType.on)
self.assertEqual(response, None)
self.conn.fromuserqueue.get(timeout=0.2) #Avoid closing connection prematurely
def test_set_on_with_extra_data(self):
request = self.conn.touserqueue.get(timeout=0.2)
self.assertEqual(request, b"\x85\x01\x11\x22\x33")
self.conn.fromuserqueue.put(b"\xC5\x01") # Positive response
def _test_set_on_with_extra_data(self):
response = self.udsclient.control_dtc_setting(setting_type=services.ControlDTCSetting.SettingType.on, data=b'\x11\x22\x33')
self.assertEqual(response.service_data.setting_type_echo, services.ControlDTCSetting.SettingType.on)
def test_set_on_harmless_extra_bytes_in_response(self):
self.wait_request_and_respond(b"\xC5\x01\x77\x88\x99") # Positive response
def _test_set_on_harmless_extra_bytes_in_response(self):
response = self.udsclient.control_dtc_setting(setting_type=services.ControlDTCSetting.SettingType.on)
self.assertEqual(response.service_data.setting_type_echo, services.ControlDTCSetting.SettingType.on)
def test_set_params_denied_exception(self):
self.wait_request_and_respond(b"\x7F\x85\x45") #Request Out Of Range
def _test_set_params_denied_exception(self):
with self.assertRaises(NegativeResponseException) as handle:
self.udsclient.control_dtc_setting(setting_type=0x45)
def test_set_params_denied_no_exception(self):
self.wait_request_and_respond(b"\x7F\x85\x45") #Request Out Of Range
def _test_set_params_denied_no_exception(self):
self.udsclient.config['exception_on_negative_response'] = False
response = self.udsclient.control_dtc_setting(setting_type=0x45)
self.assertTrue(response.valid)
self.assertFalse(response.positive)
def test_set_params_invalid_service_exception(self):
self.wait_request_and_respond(b"\x00\x45") #Inexistent Service
def _test_set_params_invalid_service_exception(self):
with self.assertRaises(InvalidResponseException) as handle:
self.udsclient.control_dtc_setting(setting_type=0x45)
def test_set_params_invalid_service_no_exception(self):
self.wait_request_and_respond(b"\x00\x45") #Inexistent Service
def _test_set_params_invalid_service_no_exception(self):
self.udsclient.config['exception_on_invalid_response'] = False
response = self.udsclient.control_dtc_setting(setting_type=0x45)
self.assertFalse(response.valid)
def test_wrong_service_exception(self):
self.wait_request_and_respond(b"\x7E\x22") # Valid but wrong service (Tester Present)
def _test_wrong_service_exception(self):
with self.assertRaises(UnexpectedResponseException) as handle:
self.udsclient.control_dtc_setting(setting_type=0x22)
def test_wrong_service_no_exception(self):
self.wait_request_and_respond(b"\x7E\x22") # Valid but wrong service (Tester Present)
def _test_wrong_service_no_exception(self):
self.udsclient.config['exception_on_unexpected_response'] = False
response = self.udsclient.control_dtc_setting(setting_type=0x22)
self.assertTrue(response.valid)
self.assertTrue(response.unexpected)
def test_bad_setting_type_response_exception(self):
self.wait_request_and_respond(b"\xC5\x23") # Valid but access type
def _test_bad_setting_type_response_exception(self):
with self.assertRaises(UnexpectedResponseException) as handle:
self.udsclient.control_dtc_setting(setting_type=0x22)
def test_bad_setting_type_response_no_exception(self):
self.wait_request_and_respond(b"\xC5\x23") # Valid but access type
def _test_bad_setting_type_response_no_exception(self):
self.udsclient.config['exception_on_unexpected_response'] = False
response = self.udsclient.control_dtc_setting(setting_type=0x22)
self.assertTrue(response.valid)
self.assertTrue(response.unexpected)
def test_bad_param(self):
pass
def _test_bad_param(self):
with self.assertRaises(ValueError):
self.udsclient.control_dtc_setting(setting_type=-1)
with self.assertRaises(ValueError):
self.udsclient.control_dtc_setting(setting_type=0x80)
with self.assertRaises(ValueError):
self.udsclient.control_dtc_setting(setting_type=services.ControlDTCSetting.SettingType.on, data=1)
with self.assertRaises(ValueError):
self.udsclient.control_dtc_setting(setting_type=services.ControlDTCSetting.SettingType.on, data='asdasdasd')
| 42.024
| 125
| 0.820293
| 720
| 5,253
| 5.663889
| 0.148611
| 0.04463
| 0.039235
| 0.09024
| 0.866601
| 0.845267
| 0.828102
| 0.820991
| 0.783472
| 0.767043
| 0
| 0.022001
| 0.08281
| 5,253
| 124
| 126
| 42.362903
| 0.824408
| 0.057681
| 0
| 0.419355
| 0
| 0
| 0.059157
| 0.024919
| 0
| 0
| 0.007293
| 0
| 0.236559
| 1
| 0.290323
| false
| 0.010753
| 0.043011
| 0
| 0.344086
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
02109cc9b9f8f228248d76b10f028ca821b70484
| 5,463
|
py
|
Python
|
model/fusion.py
|
Tianfang-Zhang/acm-pytorch
|
239a3f2010c8f8bb746e81953eba9fa917f9ee44
|
[
"MIT"
] | 15
|
2020-12-10T05:05:13.000Z
|
2022-03-06T06:52:16.000Z
|
model/fusion.py
|
Yidan-Zhang/acm-pytorch
|
239a3f2010c8f8bb746e81953eba9fa917f9ee44
|
[
"MIT"
] | 3
|
2021-03-08T13:12:33.000Z
|
2022-03-25T06:34:20.000Z
|
model/fusion.py
|
Yidan-Zhang/acm-pytorch
|
239a3f2010c8f8bb746e81953eba9fa917f9ee44
|
[
"MIT"
] | 8
|
2020-12-07T12:10:12.000Z
|
2021-09-29T07:15:33.000Z
|
import torch
import torch.nn as nn
class BiLocalChaFuseReduce(nn.Module):
def __init__(self, in_high_channels, in_low_channels, out_channels=64, r=4):
super(BiLocalChaFuseReduce, self).__init__()
assert in_low_channels == out_channels
self.high_channels = in_high_channels
self.low_channels = in_low_channels
self.out_channels = out_channels
self.bottleneck_channels = int(out_channels // r)
self.feature_high = nn.Sequential(
nn.Conv2d(self.high_channels, self.out_channels, 1, 1, 0),
nn.BatchNorm2d(self.out_channels),
nn.ReLU(True),
)
self.topdown = nn.Sequential(
nn.Conv2d(self.out_channels, self.bottleneck_channels, 1, 1, 0),
nn.BatchNorm2d(self.bottleneck_channels),
nn.ReLU(True),
nn.Conv2d(self.bottleneck_channels, self.out_channels, 1, 1, 0),
nn.BatchNorm2d(self.out_channels),
nn.Sigmoid()
)
self.bottomup = nn.Sequential(
nn.Conv2d(self.low_channels, self.bottleneck_channels, 1, 1, 0),
nn.BatchNorm2d(self.bottleneck_channels),
nn.ReLU(True),
nn.Conv2d(self.bottleneck_channels, self.out_channels, 1, 1, 0),
nn.BatchNorm2d(self.out_channels),
nn.Sigmoid(),
)
self.post = nn.Sequential(
nn.Conv2d(self.out_channels, self.out_channels, 3, 1, 1),
nn.BatchNorm2d(self.out_channels),
nn.ReLU(True),
)
def forward(self, xh, xl):
xh = self.feature_high(xh)
topdown_wei = self.topdown(xh)
bottomup_wei = self.bottomup(xl)
out = 2 * xl * topdown_wei + 2* xh * bottomup_wei
out = self.post(out)
return out
class AsymBiChaFuseReduce(nn.Module):
def __init__(self, in_high_channels, in_low_channels, out_channels=64, r=4):
super(AsymBiChaFuseReduce, self).__init__()
assert in_low_channels == out_channels
self.high_channels = in_high_channels
self.low_channels = in_low_channels
self.out_channels = out_channels
self.bottleneck_channels = int(out_channels // r)
self.feature_high = nn.Sequential(
nn.Conv2d(self.high_channels, self.out_channels, 1, 1, 0),
nn.BatchNorm2d(out_channels),
nn.ReLU(True),
)
self.topdown = nn.Sequential(
nn.AdaptiveAvgPool2d((1, 1)),
nn.Conv2d(self.out_channels, self.bottleneck_channels, 1, 1, 0),
nn.BatchNorm2d(self.bottleneck_channels),
nn.ReLU(True),
nn.Conv2d(self.bottleneck_channels, self.out_channels, 1, 1, 0),
nn.BatchNorm2d(self.out_channels),
nn.Sigmoid(),
)
self.bottomup = nn.Sequential(
nn.Conv2d(self.low_channels, self.bottleneck_channels, 1, 1, 0),
nn.BatchNorm2d(self.bottleneck_channels),
nn.ReLU(True),
nn.Conv2d(self.bottleneck_channels, self.out_channels, 1, 1, 0),
nn.BatchNorm2d(self.out_channels),
nn.Sigmoid(),
)
self.post = nn.Sequential(
nn.Conv2d(self.out_channels, self.out_channels, 3, 1, 1),
nn.BatchNorm2d(self.out_channels),
nn.ReLU(True),
)
def forward(self, xh, xl):
xh = self.feature_high(xh)
topdown_wei = self.topdown(xh)
bottomup_wei = self.bottomup(xl)
xs = 2 * xl * topdown_wei + 2 * xh * bottomup_wei
out = self.post(xs)
return out
class BiGlobalChaFuseReduce(nn.Module):
def __init__(self, in_high_channels, in_low_channels, out_channels=64, r=4):
super(BiGlobalChaFuseReduce, self).__init__()
assert in_low_channels == out_channels
self.high_channels = in_high_channels
self.low_channels = in_low_channels
self.out_channels = out_channels
self.bottleneck_channels = int(out_channels // r)
self.feature_high = nn.Sequential(
nn.Conv2d(self.high_channels, self.out_channels, 1, 1, 0),
nn.BatchNorm2d(out_channels),
nn.ReLU(True),
)
self.topdown = nn.Sequential(
nn.AdaptiveAvgPool2d((1, 1)),
nn.Conv2d(self.out_channels, self.bottleneck_channels, 1, 1, 0),
nn.BatchNorm2d(self.bottleneck_channels),
nn.ReLU(True),
nn.Conv2d(self.bottleneck_channels, self.out_channels, 1, 1, 0),
nn.BatchNorm2d(self.out_channels),
nn.Sigmoid(),
)
self.bottomup = nn.Sequential(
nn.AdaptiveAvgPool2d((1, 1)),
nn.Conv2d(self.low_channels, self.bottleneck_channels, 1, 1, 0),
nn.BatchNorm2d(self.bottleneck_channels),
nn.ReLU(True),
nn.Conv2d(self.bottleneck_channels, self.out_channels, 1, 1, 0),
nn.BatchNorm2d(self.out_channels),
nn.Sigmoid(),
)
self.post = nn.Sequential(
nn.Conv2d(self.out_channels, self.out_channels, 3, 1, 1),
nn.BatchNorm2d(self.out_channels),
nn.ReLU(True),
)
def forward(self, xh, xl):
xh = self.feature_high(xh)
topdown_wei = self.topdown(xh)
bottomup_wei = self.bottomup(xl)
xs = 2 * xl * topdown_wei + 2 * xh * bottomup_wei
out = self.post(xs)
return out
| 33.931677
| 80
| 0.600403
| 665
| 5,463
| 4.706767
| 0.067669
| 0.158147
| 0.148562
| 0.110224
| 0.943131
| 0.943131
| 0.943131
| 0.943131
| 0.943131
| 0.937061
| 0
| 0.029374
| 0.289584
| 5,463
| 161
| 81
| 33.931677
| 0.777119
| 0
| 0
| 0.820313
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.023438
| 1
| 0.046875
| false
| 0
| 0.015625
| 0
| 0.109375
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
0213d41f8cf66f40d07804686e597a56513e42fe
| 5,219
|
py
|
Python
|
tests/test_generate_token.py
|
willnx/vlab_auth_service
|
a3e7781959dbccdd773cdb917b2dce62ac6b8ace
|
[
"Apache-2.0"
] | 1
|
2019-04-10T16:17:35.000Z
|
2019-04-10T16:17:35.000Z
|
tests/test_generate_token.py
|
willnx/vlab_auth_service
|
a3e7781959dbccdd773cdb917b2dce62ac6b8ace
|
[
"Apache-2.0"
] | 6
|
2018-05-23T03:55:51.000Z
|
2018-09-19T16:50:29.000Z
|
tests/test_generate_token.py
|
willnx/vlab_auth_service
|
a3e7781959dbccdd773cdb917b2dce62ac6b8ace
|
[
"Apache-2.0"
] | 1
|
2018-06-04T16:56:37.000Z
|
2018-06-04T16:56:37.000Z
|
# -*- coding: UTF-8 -*-
"""
Suite(s) of tests for the generate_token.py module
"""
import time
import unittest
import jwt
from vlab_auth_service.lib import const
from vlab_auth_service.lib import generate_token
class TestGenerateToken(unittest.TestCase):
"""Test suite for the generate_token.py module"""
def setUp(self):
"""Runs before each test case"""
self.username = 'pat'
self.version = 1
self.memberOf = []
def test_basic_usage(self):
"""Calling generate_token function returns a JSON Web Token"""
token = generate_token.generate_token(username=self.username,
version=self.version,
memberOf=self.memberOf,
issued_at_timestamp=time.time())
self.assertTrue(token is not None)
def test_return_type(self):
"""Return type for generate_token function is String"""
token = generate_token.generate_token(username=self.username,
version=self.version,
memberOf=self.memberOf,
issued_at_timestamp=time.time())
self.assertTrue(isinstance(token, str))
def test_token_content_keys(self):
"""The JSON Web Token contains all expected data"""
time_stamp = time.time()
token = generate_token.generate_token(username=self.username,
version=self.version,
memberOf=self.memberOf,
issued_at_timestamp=time_stamp)
token_data = jwt.decode(token, const.AUTH_TOKEN_SECRET, algorithms=const.AUTH_TOKEN_ALGORITHM)
expected = {'memberOf' : [],
'username' : 'pat',
'version' : 1,
'iat' : time_stamp,
'exp' : time_stamp + const.AUTH_TOKEN_TIMEOUT,
'iss' : 'https://localhost'}
self.assertEqual(token_data, expected)
class TestGenerateV2Token(unittest.TestCase):
"""Test suite for the generate_v2_token function"""
def setUp(self):
"""Runs before each test case"""
self.username = 'alice'
self.version = 2
self.memberOf = []
def test_basic_usage(self):
"""Calling ``generate_v2_token`` returns a JWT"""
token = generate_token.generate_v2_token(username=self.username,
version=self.version,
client_ip='127.0.0.1',
issued_at_timestamp=time.time())
self.assertTrue(token is not None)
def test_return_type(self):
"""Return type for generate_v2_token function is String"""
token = generate_token.generate_v2_token(username=self.username,
version=self.version,
client_ip='127.0.0.1',
issued_at_timestamp=time.time())
self.assertTrue(isinstance(token, str))
def test_token_content_keys(self):
"""The JSON Web Token contains all expected data"""
time_stamp = time.time()
token = generate_token.generate_v2_token(username=self.username,
version=self.version,
client_ip='127.0.0.1',
issued_at_timestamp=time_stamp)
token_data = jwt.decode(token, const.AUTH_TOKEN_SECRET, algorithms=const.AUTH_TOKEN_ALGORITHM)
expected = {'client_ip' : '127.0.0.1',
'username' : 'alice',
'version' : 2,
'email' : '',
'iat' : time_stamp,
'exp' : time_stamp + const.AUTH_TOKEN_TIMEOUT,
'iss' : 'https://localhost'}
self.assertEqual(token_data, expected)
def test_token_email(self):
"""The JSON Web Token assigns the email when provided with one"""
time_stamp = time.time()
token = generate_token.generate_v2_token(username=self.username,
version=self.version,
client_ip='127.0.0.1',
email='foo@bar.org',
issued_at_timestamp=time_stamp)
token_data = jwt.decode(token, const.AUTH_TOKEN_SECRET, algorithms=const.AUTH_TOKEN_ALGORITHM)
expected = {'client_ip' : '127.0.0.1',
'username' : 'alice',
'version' : 2,
'email' : 'foo@bar.org',
'iat' : time_stamp,
'exp' : time_stamp + const.AUTH_TOKEN_TIMEOUT,
'iss' : 'https://localhost'}
self.assertEqual(token_data, expected)
if __name__ == '__main__':
unittest.main()
| 42.430894
| 102
| 0.510251
| 508
| 5,219
| 5.019685
| 0.190945
| 0.076471
| 0.070588
| 0.071373
| 0.86549
| 0.858039
| 0.820392
| 0.789804
| 0.773333
| 0.735686
| 0
| 0.015878
| 0.396628
| 5,219
| 122
| 103
| 42.778689
| 0.793903
| 0.109791
| 0
| 0.767442
| 1
| 0
| 0.057604
| 0
| 0
| 0
| 0
| 0
| 0.081395
| 1
| 0.104651
| false
| 0
| 0.05814
| 0
| 0.186047
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
023c8aa4afbb1478b0cbf9b97055f66212b354c1
| 833
|
py
|
Python
|
pc/blender/scripts/bodynodes_utils.py
|
ManuDev9/body-nodes-host
|
af1d1816a3bb2a1f2c27396e5e647c6aa07ac652
|
[
"MIT"
] | null | null | null |
pc/blender/scripts/bodynodes_utils.py
|
ManuDev9/body-nodes-host
|
af1d1816a3bb2a1f2c27396e5e647c6aa07ac652
|
[
"MIT"
] | null | null | null |
pc/blender/scripts/bodynodes_utils.py
|
ManuDev9/body-nodes-host
|
af1d1816a3bb2a1f2c27396e5e647c6aa07ac652
|
[
"MIT"
] | null | null | null |
import bpy
from mathutils import *
bodynodes_objs_init = {
"forearm_left": Quaternion((0.5000, 0.5000, 0.5000, 0.5000)),
"forearm_right": Quaternion((0.5000, 0.5000, -0.5000, -0.5000)),
"head": Quaternion((1.0000, 0.0000, 0.0000, 0.0000)),
"Hip": Quaternion((1.0000, 0.0000, 0.0000, 0.0000)),
"lowerbody": Quaternion((1.0000, 0.0000, 0.0000, 0.0000)),
"lowerleg_left": Quaternion((-0.0000, 1.0000, 0.0000, -0.0000)),
"lowerleg_right": Quaternion((-0.0000, 1.0000, 0.0000, -0.0000)),
"upperarm_left": Quaternion((0.5000, 0.5000, 0.5000, 0.5000)),
"upperarm_right": Quaternion((0.5000, 0.5000, -0.5000, -0.5000)),
"upperbody": Quaternion((1.0000, 0.0000, 0.0000, 0.0000)),
"upperleg_left": Quaternion((-0.0000, 1.0000, 0.0000, -0.0000)),
"upperleg_right": Quaternion((-0.0000, 1.0000, 0.0000, -0.0000))
}
| 46.277778
| 67
| 0.645858
| 136
| 833
| 3.882353
| 0.161765
| 0.227273
| 0.340909
| 0.227273
| 0.810606
| 0.810606
| 0.75
| 0.75
| 0.75
| 0.522727
| 0
| 0.327422
| 0.120048
| 833
| 18
| 68
| 46.277778
| 0.392906
| 0
| 0
| 0
| 0
| 0
| 0.160539
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.125
| 0
| 0.125
| 0
| 0
| 0
| 0
| null | 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 10
|
5a39d223653969cbaf4280a08ebaecb71cbaac45
| 23,400
|
py
|
Python
|
glance/tests/functional/test_shared_images.py
|
rcbops/glance-buildpackage
|
13e52178fb25d6062db6c7fad9df122d279320ab
|
[
"Apache-2.0"
] | 2
|
2015-09-30T09:43:37.000Z
|
2017-06-26T14:36:21.000Z
|
glance/tests/functional/test_shared_images.py
|
rcbops/glance-buildpackage
|
13e52178fb25d6062db6c7fad9df122d279320ab
|
[
"Apache-2.0"
] | null | null | null |
glance/tests/functional/test_shared_images.py
|
rcbops/glance-buildpackage
|
13e52178fb25d6062db6c7fad9df122d279320ab
|
[
"Apache-2.0"
] | null | null | null |
# vim: tabstop=4 shiftwidth=4 softtabstop=4
# Copyright 2011 OpenStack, LLC
# All Rights Reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License"); you may
# not use this file except in compliance with the License. You may obtain
# a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS, WITHOUT
# WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the
# License for the specific language governing permissions and limitations
# under the License.
"""Functional test case that verifies private images functionality"""
import httplib2
import json
from glance.tests import functional
from glance.tests.functional import keystone_utils
from glance.tests.utils import execute, skip_if_disabled
FIVE_KB = 5 * 1024
FIVE_GB = 5 * 1024 * 1024 * 1024
class TestSharedImagesApi(keystone_utils.KeystoneTests):
def _push_image(self):
# First, we need to push an image up
image_data = "*" * FIVE_KB
headers = {'Content-Type': 'application/octet-stream',
'X-Image-Meta-Name': 'Image1'}
path = "http://%s:%d/v1/images" % ("0.0.0.0", self.api_port)
response, content = self._request(path, 'POST',
keystone_utils.pattieblack_token,
headers=headers,
body=image_data)
self.assertEqual(response.status, 201)
data = json.loads(content)
self.assertEqual(data['image']['size'], FIVE_KB)
self.assertEqual(data['image']['name'], "Image1")
self.assertEqual(data['image']['is_public'], False)
self.assertEqual(data['image']['owner'], keystone_utils.pattieblack_id)
return content
def _request(self, path, method, auth_token, headers=None, body=None):
http = httplib2.Http()
headers = headers or {}
headers['X-Auth-Token'] = auth_token
if body:
return http.request(path, method, headers=headers,
body=body)
else:
return http.request(path, method, headers=headers)
@skip_if_disabled
def test_share_image(self):
self.cleanup()
self.start_servers()
# First, we need to push an image up
data = json.loads(self._push_image())
image_id = data['image']['id']
# Now add froggy as a shared image member
args = ("0.0.0.0", self.api_port, image_id, keystone_utils.froggy_id)
path = "http://%s:%d/v1/images/%s/members/%s" % args
response, _ = self._request(path, 'PUT',
keystone_utils.pattieblack_token)
self.assertEqual(response.status, 204)
# Ensure pattieblack can still see the image
path = "http://%s:%d/v1/images" % ("0.0.0.0", self.api_port)
response, content = self._request(path, 'GET',
keystone_utils.pattieblack_token)
self.assertEqual(response.status, 200)
data = json.loads(content)
self.assertEqual(len(data['images']), 1)
self.assertEqual(data['images'][0]['id'], image_id)
self.assertEqual(data['images'][0]['size'], FIVE_KB)
self.assertEqual(data['images'][0]['name'], "Image1")
# Ensure froggy can see the image now
response, content = self._request(path, 'GET',
keystone_utils.froggy_token)
self.assertEqual(response.status, 200)
data = json.loads(content)
self.assertEqual(len(data['images']), 1)
self.assertEqual(data['images'][0]['id'], image_id)
self.assertEqual(data['images'][0]['size'], FIVE_KB)
self.assertEqual(data['images'][0]['name'], "Image1")
# ensure that no one else can see the image
path = "http://%s:%d/v1/images" % ("0.0.0.0", self.api_port)
response, content = self._request(path, 'GET',
keystone_utils.bacon_token)
self.assertEqual(response.status, 200)
self.assertEqual(content, '{"images": []}')
self.stop_servers()
@skip_if_disabled
def test_share_and_replace_members(self):
self.cleanup()
self.start_servers()
# First, we need to push an image up
data = json.loads(self._push_image())
image_id = data['image']['id']
# Now add froggy as a shared image member
args = ("0.0.0.0", self.api_port, image_id, keystone_utils.froggy_id)
path = "http://%s:%d/v1/images/%s/members/%s" % args
response, _ = self._request(path, 'PUT',
keystone_utils.pattieblack_token)
self.assertEqual(response.status, 204)
# Ensure pattieblack can still see the image
path = "http://%s:%d/v1/images" % ("0.0.0.0", self.api_port)
response, content = self._request(path, 'GET',
keystone_utils.pattieblack_token)
self.assertEqual(response.status, 200)
data = json.loads(content)
self.assertEqual(len(data['images']), 1)
self.assertEqual(data['images'][0]['id'], image_id)
self.assertEqual(data['images'][0]['size'], FIVE_KB)
self.assertEqual(data['images'][0]['name'], "Image1")
# Ensure froggy can see the image now
response, content = self._request(path, 'GET',
keystone_utils.froggy_token)
self.assertEqual(response.status, 200)
data = json.loads(content)
self.assertEqual(len(data['images']), 1)
self.assertEqual(data['images'][0]['id'], image_id)
self.assertEqual(data['images'][0]['size'], FIVE_KB)
self.assertEqual(data['images'][0]['name'], "Image1")
# ensure that no one else can see the image
path = "http://%s:%d/v1/images" % ("0.0.0.0", self.api_port)
response, content = self._request(path, 'GET',
keystone_utils.bacon_token)
self.assertEqual(response.status, 200)
self.assertEqual(content, '{"images": []}')
# Build path for the next couple of checks
path = ("http://%s:%d/v1/images/%s/members" %
("0.0.0.0", self.api_port, image_id))
# Make sure update with invalid data gets rejected with 400
body = {
'test': [
{
'member_id': keystone_utils.bacon_id,
'can_share': False,
},
],
}
response, _ = self._request(path, 'PUT',
keystone_utils.pattieblack_token,
body=json.dumps(body))
self.assertEqual(response.status, 400)
# Replace froggy with bacon
body = {
'memberships': [
{
'member_id': keystone_utils.bacon_id,
'can_share': False,
},
],
}
response, content = self._request(path, 'PUT',
keystone_utils.pattieblack_token,
body=json.dumps(body))
self.assertEqual(response.status, 204)
# Ensure bacon can see the image
path = "http://%s:%d/v1/images" % ("0.0.0.0", self.api_port)
response, content = self._request(path, 'GET',
keystone_utils.bacon_token)
self.assertEqual(response.status, 200)
data = json.loads(content)
self.assertEqual(len(data['images']), 1)
self.assertEqual(data['images'][0]['id'], image_id)
self.assertEqual(data['images'][0]['size'], FIVE_KB)
self.assertEqual(data['images'][0]['name'], "Image1")
# ensure that no one else can see the image
path = "http://%s:%d/v1/images" % ("0.0.0.0", self.api_port)
response, content = self._request(path, 'GET',
keystone_utils.froggy_token)
self.assertEqual(response.status, 200)
self.assertEqual(content, '{"images": []}')
self.stop_servers()
@skip_if_disabled
def test_unshare_image(self):
self.cleanup()
self.start_servers()
# First, we need to push an image up
data = json.loads(self._push_image())
image_id = data['image']['id']
# Now add froggy as a shared image member
args = ("0.0.0.0", self.api_port, image_id, keystone_utils.froggy_id)
path = "http://%s:%d/v1/images/%s/members/%s" % args
response, _ = self._request(path, 'PUT',
keystone_utils.pattieblack_token)
self.assertEqual(response.status, 204)
# Ensure pattieblack can still see the image
path = "http://%s:%d/v1/images" % ("0.0.0.0", self.api_port)
response, content = self._request(path, 'GET',
keystone_utils.pattieblack_token)
self.assertEqual(response.status, 200)
data = json.loads(content)
self.assertEqual(len(data['images']), 1)
self.assertEqual(data['images'][0]['id'], image_id)
self.assertEqual(data['images'][0]['size'], FIVE_KB)
self.assertEqual(data['images'][0]['name'], "Image1")
# Ensure froggy can see the image now
response, content = self._request(path, 'GET',
keystone_utils.froggy_token)
self.assertEqual(response.status, 200)
data = json.loads(content)
self.assertEqual(len(data['images']), 1)
self.assertEqual(data['images'][0]['id'], image_id)
self.assertEqual(data['images'][0]['size'], FIVE_KB)
self.assertEqual(data['images'][0]['name'], "Image1")
# ensure that no one else can see the image
path = "http://%s:%d/v1/images" % ("0.0.0.0", self.api_port)
response, content = self._request(path, 'GET',
keystone_utils.bacon_token)
self.assertEqual(response.status, 200)
self.assertEqual(content, '{"images": []}')
# Now remove froggy as a shared image member
args = ("0.0.0.0", self.api_port, image_id,
keystone_utils.froggy_id)
path = "http://%s:%d/v1/images/%s/members/%s" % args
response, content = self._request(path, 'DELETE',
keystone_utils.pattieblack_token)
self.assertEqual(response.status, 204)
# ensure that no one else can see the image
path = "http://%s:%d/v1/images" % ("0.0.0.0", self.api_port)
response, content = self._request(path, 'GET',
keystone_utils.froggy_token)
self.assertEqual(response.status, 200)
self.assertEqual(content, '{"images": []}')
# ensure that no one else can access the image
path = "http://%s:%d/v1/images/%s" % ("0.0.0.0", self.api_port,
image_id)
response, content = self._request(path, 'GET',
keystone_utils.froggy_token)
self.assertEqual(response.status, 404)
# Ensure pattieblack can still see the image
path = "http://%s:%d/v1/images" % ("0.0.0.0", self.api_port)
response, content = self._request(path, 'GET',
keystone_utils.pattieblack_token)
self.assertEqual(response.status, 200)
data = json.loads(content)
self.assertEqual(len(data['images']), 1)
self.assertEqual(data['images'][0]['id'], image_id)
self.assertEqual(data['images'][0]['size'], FIVE_KB)
self.assertEqual(data['images'][0]['name'], "Image1")
self.stop_servers()
@skip_if_disabled
def test_share_and_can_share_image(self):
self.cleanup()
self.start_servers()
# First, we need to push an image up
data = json.loads(self._push_image())
image_id = data['image']['id']
# Now add froggy as a shared image member
body = json.dumps({'member': {'can_share': True}})
args = ("0.0.0.0", self.api_port, image_id, keystone_utils.froggy_id)
path = "http://%s:%d/v1/images/%s/members/%s" % args
response, content = self._request(path, 'PUT',
keystone_utils.pattieblack_token,
body=body)
self.assertEqual(response.status, 204)
# Ensure froggy can see the image now
path = "http://%s:%d/v1/images" % ("0.0.0.0", self.api_port)
response, content = self._request(path, 'GET',
keystone_utils.froggy_token)
self.assertEqual(response.status, 200)
data = json.loads(content)
self.assertEqual(len(data['images']), 1)
self.assertEqual(data['images'][0]['id'], image_id)
self.assertEqual(data['images'][0]['size'], FIVE_KB)
self.assertEqual(data['images'][0]['name'], "Image1")
# Froggy is going to share with bacon
args = ("0.0.0.0", self.api_port, image_id, keystone_utils.bacon_id)
path = "http://%s:%d/v1/images/%s/members/%s" % args
response, _ = self._request(path, 'PUT',
keystone_utils.froggy_token)
self.assertEqual(response.status, 204)
# Ensure bacon can see the image now
path = "http://%s:%d/v1/images" % ("0.0.0.0", self.api_port)
response, content = self._request(path, 'GET',
keystone_utils.bacon_token)
self.assertEqual(response.status, 200)
data = json.loads(content)
self.assertEqual(len(data['images']), 1)
self.assertEqual(data['images'][0]['id'], image_id)
self.assertEqual(data['images'][0]['size'], FIVE_KB)
self.assertEqual(data['images'][0]['name'], "Image1")
# Ensure prosciutto cannot see the image
response, content = self._request(path, 'GET',
keystone_utils.prosciutto_token)
self.assertEqual(response.status, 200)
self.assertEqual(content, '{"images": []}')
# Redundant, but prove prosciutto cannot share it
path = "http://%s:%d/v1/images/%s/members/%s" % \
("0.0.0.0", self.api_port, image_id, 'franknbeans')
response, _ = self._request(path, 'PUT',
keystone_utils.prosciutto_token)
self.assertEqual(response.status, 404)
self.stop_servers()
@skip_if_disabled
def test_get_members(self):
self.cleanup()
self.start_servers()
# First, we need to push an image up
data = json.loads(self._push_image())
# Now add froggy as a shared image member
args = ("0.0.0.0", self.api_port, data['image']['id'],
keystone_utils.froggy_id)
path = "http://%s:%d/v1/images/%s/members/%s" % args
response, content = self._request(path, 'PUT',
keystone_utils.pattieblack_token)
self.assertEqual(response.status, 204)
path = "http://%s:%d/v1/images/%s/members" % \
("0.0.0.0", self.api_port, data['image']['id'])
response, content = self._request(path, 'GET',
keystone_utils.pattieblack_token)
self.assertEqual(response.status, 200)
body = json.loads(content)
self.assertEqual(body['members'][0]['can_share'], False)
self.assertEqual(body['members'][0]['member_id'],
keystone_utils.froggy_id)
self.stop_servers()
class TestSharedImagesCli(keystone_utils.KeystoneTests):
def _push_image(self, name=1):
# First, we need to push an image up
image_data = "*" * FIVE_KB
headers = {'Content-Type': 'application/octet-stream',
'X-Image-Meta-Name': str(name)}
path = "http://%s:%d/v1/images" % ("0.0.0.0", self.api_port)
response, content = self._request(path, 'POST',
keystone_utils.pattieblack_token,
headers=headers,
body=image_data)
self.assertEqual(response.status, 201)
data = json.loads(content)
self.assertEqual(data['image']['size'], FIVE_KB)
self.assertEqual(data['image']['name'], str(name))
self.assertEqual(data['image']['is_public'], False)
self.assertEqual(data['image']['owner'], keystone_utils.pattieblack_id)
return content
def _request(self, path, method, auth_token, headers=None, body=None):
http = httplib2.Http()
headers = headers or {}
headers['X-Auth-Token'] = auth_token
if body:
return http.request(path, method, headers=headers,
body=body)
else:
return http.request(path, method, headers=headers)
def _outsplit(self, out):
return [l.strip() for l in out.strip().split('\n')]
@skip_if_disabled
def test_share_image(self):
self.cleanup()
self.start_servers()
# Push an image up
data = json.loads(self._push_image())
image_id = data['image']['id']
# Test that we can add froggy as a shared image member
args = (self.api_port, keystone_utils.pattieblack_token,
image_id, keystone_utils.froggy_id)
cmd = "bin/glance --port=%d --auth_token=%s member-add %s %s" % args
exitcode, out, err = execute(cmd)
self.assertEqual(0, exitcode)
# Verify the membership of the image
path = ("http://%s:%d/v1/images/%s/members" %
("0.0.0.0", self.api_port, image_id))
response, content = self._request(path, 'GET',
keystone_utils.pattieblack_token)
self.assertEqual(response.status, 200)
data = json.loads(content)
self.assertEqual(len(data['members']), 1)
self.assertEqual(data['members'][0]['member_id'],
keystone_utils.froggy_id)
self.assertEqual(data['members'][0]['can_share'], False)
# Test that we can replace a shared image membership list
cmd = ("bin/glance --port=%d --auth_token=%s members-replace %s %s "
"--can-share" %
(self.api_port, keystone_utils.pattieblack_token,
image_id, keystone_utils.bacon_id))
exitcode, out, err = execute(cmd)
self.assertEqual(0, exitcode)
# Verify the membership of the image
path = ("http://%s:%d/v1/images/%s/members" %
("0.0.0.0", self.api_port, image_id))
response, content = self._request(path, 'GET',
keystone_utils.pattieblack_token)
self.assertEqual(response.status, 200)
data = json.loads(content)
self.assertEqual(len(data['members']), 1)
self.assertEqual(data['members'][0]['member_id'],
keystone_utils.bacon_id)
self.assertEqual(data['members'][0]['can_share'], True)
# Test that we can delete an image membership
cmd = ("bin/glance --port=%d --auth_token=%s member-delete %s %s" %
(self.api_port, keystone_utils.pattieblack_token,
image_id, keystone_utils.bacon_id))
exitcode, out, err = execute(cmd)
self.assertEqual(0, exitcode)
# Verify the membership of the image
path = ("http://%s:%d/v1/images/%s/members" %
("0.0.0.0", self.api_port, image_id))
response, content = self._request(path, 'GET',
keystone_utils.pattieblack_token)
self.assertEqual(response.status, 200)
data = json.loads(content)
self.assertEqual(len(data['members']), 0)
self.stop_servers()
@skip_if_disabled
def test_list_shares(self):
self.cleanup()
self.start_servers()
# Push an image up
data = json.loads(self._push_image(1))
image1_id = data['image']['id']
# Push a second image up
data = json.loads(self._push_image(2))
image2_id = data['image']['id']
# Share images with froggy and bacon
cmd = ("bin/glance --port=%d --auth_token=%s member-add %s %s" %
(self.api_port, keystone_utils.pattieblack_token,
image1_id, keystone_utils.froggy_id))
exitcode, out, err = execute(cmd)
self.assertEqual(0, exitcode)
cmd = ("bin/glance --port=%d --auth_token=%s member-add %s %s" %
(self.api_port, keystone_utils.pattieblack_token,
image1_id, keystone_utils.bacon_id))
exitcode, out, err = execute(cmd)
self.assertEqual(0, exitcode)
cmd = ("bin/glance --port=%d --auth_token=%s member-add %s %s "
"--can-share" %
(self.api_port, keystone_utils.pattieblack_token,
image2_id, keystone_utils.froggy_id))
exitcode, out, err = execute(cmd)
self.assertEqual(0, exitcode)
cmd = ("bin/glance --port=%d --auth_token=%s member-add %s %s "
"--can-share" %
(self.api_port, keystone_utils.pattieblack_token,
image2_id, keystone_utils.bacon_id))
exitcode, out, err = execute(cmd)
self.assertEqual(0, exitcode)
# Get the list of image members
cmd = ("bin/glance --port=%d --auth_token=%s image-members %s" %
(self.api_port, keystone_utils.pattieblack_token, image1_id))
exitcode, out, err = execute(cmd)
self.assertEqual(0, exitcode)
result = self._outsplit(out)
self.assertTrue(keystone_utils.froggy_id in result)
self.assertTrue(keystone_utils.bacon_id in result)
# Try again for can_share
cmd = ("bin/glance --port=%d --auth_token=%s image-members %s" %
(self.api_port, keystone_utils.pattieblack_token, image2_id))
exitcode, out, err = execute(cmd)
self.assertEqual(0, exitcode)
result = self._outsplit(out)
self.assertEqual(result[-1], '(*: Can share image)')
self.assertTrue(keystone_utils.froggy_id + ' *' in result[:-2])
self.assertTrue(keystone_utils.bacon_id + ' *' in result[:-2])
# Get the list of member images
cmd = ("bin/glance --port=%d --auth_token=%s member-images %s" %
(self.api_port, keystone_utils.pattieblack_token,
keystone_utils.froggy_id))
exitcode, out, err = execute(cmd)
self.assertEqual(0, exitcode)
result = self._outsplit(out)
self.assertEqual(result[-1], '(*: Can share image)')
self.assertTrue(('%s' % image1_id) in result)
self.assertTrue(('%s *' % image2_id) in result)
self.stop_servers()
| 42.391304
| 79
| 0.567094
| 2,781
| 23,400
| 4.634664
| 0.078389
| 0.125689
| 0.013034
| 0.074249
| 0.883311
| 0.875242
| 0.871674
| 0.859415
| 0.816743
| 0.802855
| 0
| 0.022088
| 0.299615
| 23,400
| 551
| 80
| 42.46824
| 0.764354
| 0.107436
| 0
| 0.82
| 0
| 0
| 0.128783
| 0.002306
| 0
| 0
| 0
| 0
| 0.285
| 1
| 0.03
| false
| 0
| 0.0125
| 0.0025
| 0.065
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
ce4eda630d7277be8613f04097ab7cbed0f3ce26
| 258
|
py
|
Python
|
entity/cards/LETL_038H/__init__.py
|
x014/lushi_script
|
edab2b88e3f0de8139de2541ab2daa331f777c0e
|
[
"MIT"
] | 102
|
2021-10-20T09:06:39.000Z
|
2022-03-28T13:35:11.000Z
|
entity/cards/LETL_038H/__init__.py
|
x014/lushi_script
|
edab2b88e3f0de8139de2541ab2daa331f777c0e
|
[
"MIT"
] | 98
|
2021-10-19T16:13:27.000Z
|
2022-03-27T13:27:49.000Z
|
entity/cards/LETL_038H/__init__.py
|
x014/lushi_script
|
edab2b88e3f0de8139de2541ab2daa331f777c0e
|
[
"MIT"
] | 55
|
2021-10-19T03:56:50.000Z
|
2022-03-25T08:25:26.000Z
|
# -*- coding: utf-8 -*-
import entity.cards.LETL_038H.LETL_274
import entity.cards.LETL_038H.LETL_275
import entity.cards.LETL_038H.LETL_276
import entity.cards.LETL_038H.LETL_277
import entity.cards.LETL_038H.LETL_278
import entity.cards.LETL_038H.LETL_279
| 32.25
| 38
| 0.829457
| 45
| 258
| 4.488889
| 0.311111
| 0.356436
| 0.504951
| 0.623762
| 0.861386
| 0.861386
| 0
| 0
| 0
| 0
| 0
| 0.153527
| 0.065891
| 258
| 7
| 39
| 36.857143
| 0.684647
| 0.081395
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 0
| 0
| 0
| null | 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 0
| 0
|
0
| 8
|
cec12dde1e9b7357f89fea8522241f7b931fbef8
| 75,693
|
py
|
Python
|
RI/flask_server/tapi_server/controllers/tapi_oam_controller.py
|
arthurMll/TAPI
|
e1171bb139c6791a953af09cfc2bc7ad928da73d
|
[
"Apache-2.0"
] | 57
|
2018-04-09T08:56:18.000Z
|
2022-03-23T08:31:06.000Z
|
RI/flask_server/tapi_server/controllers/tapi_oam_controller.py
|
arthurMll/TAPI
|
e1171bb139c6791a953af09cfc2bc7ad928da73d
|
[
"Apache-2.0"
] | 143
|
2016-06-08T04:09:54.000Z
|
2018-02-23T10:45:59.000Z
|
RI/flask_server/tapi_server/controllers/tapi_oam_controller.py
|
arthurMll/TAPI
|
e1171bb139c6791a953af09cfc2bc7ad928da73d
|
[
"Apache-2.0"
] | 64
|
2018-03-07T07:55:17.000Z
|
2022-03-28T07:14:28.000Z
|
import connexion
import six
from tapi_server.models.inline_object10 import InlineObject10 # noqa: E501
from tapi_server.models.inline_object16 import InlineObject16 # noqa: E501
from tapi_server.models.inline_object21 import InlineObject21 # noqa: E501
from tapi_server.models.inline_object22 import InlineObject22 # noqa: E501
from tapi_server.models.inline_object23 import InlineObject23 # noqa: E501
from tapi_server.models.inline_object29 import InlineObject29 # noqa: E501
from tapi_server.models.inline_object3 import InlineObject3 # noqa: E501
from tapi_server.models.inline_object30 import InlineObject30 # noqa: E501
from tapi_server.models.inline_object31 import InlineObject31 # noqa: E501
from tapi_server.models.inline_object4 import InlineObject4 # noqa: E501
from tapi_server.models.inline_object5 import InlineObject5 # noqa: E501
from tapi_server.models.inline_object8 import InlineObject8 # noqa: E501
from tapi_server.models.inline_object9 import InlineObject9 # noqa: E501
from tapi_server.models.tapi_common_name_and_value import TapiCommonNameAndValue # noqa: E501
from tapi_server.models.tapi_common_service_interface_point_ref import TapiCommonServiceInterfacePointRef # noqa: E501
from tapi_server.models.tapi_common_time_interval import TapiCommonTimeInterval # noqa: E501
from tapi_server.models.tapi_common_time_period import TapiCommonTimePeriod # noqa: E501
from tapi_server.models.tapi_common_time_range import TapiCommonTimeRange # noqa: E501
from tapi_server.models.tapi_connectivity_connectivity_service_end_point_ref import TapiConnectivityConnectivityServiceEndPointRef # noqa: E501
from tapi_server.models.tapi_oam_create_oam_job import TapiOamCreateOamJob # noqa: E501
from tapi_server.models.tapi_oam_create_oam_service import TapiOamCreateOamService # noqa: E501
from tapi_server.models.tapi_oam_create_oam_service_end_point import TapiOamCreateOamServiceEndPoint # noqa: E501
from tapi_server.models.tapi_oam_get_meg import TapiOamGetMeg # noqa: E501
from tapi_server.models.tapi_oam_get_oam_job import TapiOamGetOamJob # noqa: E501
from tapi_server.models.tapi_oam_get_oam_service import TapiOamGetOamService # noqa: E501
from tapi_server.models.tapi_oam_get_oam_service_end_point import TapiOamGetOamServiceEndPoint # noqa: E501
from tapi_server.models.tapi_oam_get_oam_service_list import TapiOamGetOamServiceList # noqa: E501
from tapi_server.models.tapi_oam_meg_mep import TapiOamMegMep # noqa: E501
from tapi_server.models.tapi_oam_meg_mip import TapiOamMegMip # noqa: E501
from tapi_server.models.tapi_oam_meg_ref import TapiOamMegRef # noqa: E501
from tapi_server.models.tapi_oam_mep_mip_list import TapiOamMepMipList # noqa: E501
from tapi_server.models.tapi_oam_mep_ref import TapiOamMepRef # noqa: E501
from tapi_server.models.tapi_oam_mip_ref import TapiOamMipRef # noqa: E501
from tapi_server.models.tapi_oam_oam_context import TapiOamOamContext # noqa: E501
from tapi_server.models.tapi_oam_oam_job import TapiOamOamJob # noqa: E501
from tapi_server.models.tapi_oam_oam_profile import TapiOamOamProfile # noqa: E501
from tapi_server.models.tapi_oam_oam_profile_ref import TapiOamOamProfileRef # noqa: E501
from tapi_server.models.tapi_oam_oam_service import TapiOamOamService # noqa: E501
from tapi_server.models.tapi_oam_oam_service_end_point import TapiOamOamServiceEndPoint # noqa: E501
from tapi_server.models.tapi_oam_oam_service_end_point_ref import TapiOamOamServiceEndPointRef # noqa: E501
from tapi_server.models.tapi_oam_oamcontext_meg import TapiOamOamcontextMeg # noqa: E501
from tapi_server.models.tapi_oam_pm_bin_data import TapiOamPmBinData # noqa: E501
from tapi_server.models.tapi_oam_pm_current_data import TapiOamPmCurrentData # noqa: E501
from tapi_server.models.tapi_oam_pm_history_data import TapiOamPmHistoryData # noqa: E501
from tapi_server.models.tapi_oam_pm_threshold_data import TapiOamPmThresholdData # noqa: E501
from tapi_server.models.tapi_oam_update_oam_job import TapiOamUpdateOamJob # noqa: E501
from tapi_server.models.tapi_oam_update_oam_service import TapiOamUpdateOamService # noqa: E501
from tapi_server.models.tapi_oam_update_oam_service_end_point import TapiOamUpdateOamServiceEndPoint # noqa: E501
from tapi_server import util
def data_context_oam_context_delete(): # noqa: E501
"""data_context_oam_context_delete
removes tapi.oam.OamContext # noqa: E501
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_get(): # noqa: E501
"""data_context_oam_context_get
returns tapi.oam.OamContext # noqa: E501
:rtype: TapiOamOamContext
"""
return 'do some magic!'
def data_context_oam_context_meguuid_get(uuid): # noqa: E501
"""data_context_oam_context_meguuid_get
returns tapi.oam.oamcontext.Meg # noqa: E501
:param uuid: Id of meg
:type uuid: str
:rtype: TapiOamOamcontextMeg
"""
return 'do some magic!'
def data_context_oam_context_meguuid_meplocal_id_get(uuid, local_id): # noqa: E501
"""data_context_oam_context_meguuid_meplocal_id_get
returns tapi.oam.meg.Mep # noqa: E501
:param uuid: Id of meg
:type uuid: str
:param local_id: Id of mep
:type local_id: str
:rtype: TapiOamMegMep
"""
return 'do some magic!'
def data_context_oam_context_meguuid_meplocal_id_namevalue_name_get(uuid, local_id, value_name): # noqa: E501
"""data_context_oam_context_meguuid_meplocal_id_namevalue_name_get
returns tapi.common.NameAndValue # noqa: E501
:param uuid: Id of meg
:type uuid: str
:param local_id: Id of mep
:type local_id: str
:param value_name: Id of name
:type value_name: str
:rtype: TapiCommonNameAndValue
"""
return 'do some magic!'
def data_context_oam_context_meguuid_miplocal_id_get(uuid, local_id): # noqa: E501
"""data_context_oam_context_meguuid_miplocal_id_get
returns tapi.oam.meg.Mip # noqa: E501
:param uuid: Id of meg
:type uuid: str
:param local_id: Id of mip
:type local_id: str
:rtype: TapiOamMegMip
"""
return 'do some magic!'
def data_context_oam_context_meguuid_miplocal_id_namevalue_name_get(uuid, local_id, value_name): # noqa: E501
"""data_context_oam_context_meguuid_miplocal_id_namevalue_name_get
returns tapi.common.NameAndValue # noqa: E501
:param uuid: Id of meg
:type uuid: str
:param local_id: Id of mip
:type local_id: str
:param value_name: Id of name
:type value_name: str
:rtype: TapiCommonNameAndValue
"""
return 'do some magic!'
def data_context_oam_context_meguuid_namevalue_name_get(uuid, value_name): # noqa: E501
"""data_context_oam_context_meguuid_namevalue_name_get
returns tapi.common.NameAndValue # noqa: E501
:param uuid: Id of meg
:type uuid: str
:param value_name: Id of name
:type value_name: str
:rtype: TapiCommonNameAndValue
"""
return 'do some magic!'
def data_context_oam_context_oam_job_post(tapi_oam_oam_job=None): # noqa: E501
"""data_context_oam_context_oam_job_post
creates tapi.oam.OamJob # noqa: E501
:param tapi_oam_oam_job: tapi.oam.OamJob to be added to list
:type tapi_oam_oam_job: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_job = TapiOamOamJob.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_delete(uuid): # noqa: E501
"""data_context_oam_context_oam_jobuuid_delete
removes tapi.oam.OamJob # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_get(uuid): # noqa: E501
"""data_context_oam_context_oam_jobuuid_get
returns tapi.oam.OamJob # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:rtype: TapiOamOamJob
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_name_post(uuid, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_jobuuid_name_post
creates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added to list
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_namevalue_name_delete(uuid, value_name): # noqa: E501
"""data_context_oam_context_oam_jobuuid_namevalue_name_delete
removes tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param value_name: Id of name
:type value_name: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_namevalue_name_get(uuid, value_name): # noqa: E501
"""data_context_oam_context_oam_jobuuid_namevalue_name_get
returns tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param value_name: Id of name
:type value_name: str
:rtype: TapiCommonNameAndValue
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_namevalue_name_post(uuid, value_name, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_jobuuid_namevalue_name_post
creates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param value_name: Id of name
:type value_name: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added to list
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_namevalue_name_put(uuid, value_name, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_jobuuid_namevalue_name_put
creates or updates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param value_name: Id of name
:type value_name: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added or updated
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_oam_profile_delete(uuid): # noqa: E501
"""data_context_oam_context_oam_jobuuid_oam_profile_delete
removes tapi.oam.OamProfileRef # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_oam_profile_get(uuid): # noqa: E501
"""data_context_oam_context_oam_jobuuid_oam_profile_get
returns tapi.oam.OamProfileRef # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:rtype: TapiOamOamProfileRef
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_oam_profile_post(uuid, tapi_oam_oam_profile_ref=None): # noqa: E501
"""data_context_oam_context_oam_jobuuid_oam_profile_post
creates tapi.oam.OamProfileRef # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param tapi_oam_oam_profile_ref: tapi.oam.OamProfileRef to be added to list
:type tapi_oam_oam_profile_ref: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_profile_ref = TapiOamOamProfileRef.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_oam_profile_put(uuid, tapi_oam_oam_profile_ref=None): # noqa: E501
"""data_context_oam_context_oam_jobuuid_oam_profile_put
creates or updates tapi.oam.OamProfileRef # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param tapi_oam_oam_profile_ref: tapi.oam.OamProfileRef to be added or updated
:type tapi_oam_oam_profile_ref: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_profile_ref = TapiOamOamProfileRef.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_oam_service_end_point_post(uuid, tapi_oam_oam_service_end_point_ref=None): # noqa: E501
"""data_context_oam_context_oam_jobuuid_oam_service_end_point_post
creates tapi.oam.OamServiceEndPointRef # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param tapi_oam_oam_service_end_point_ref: tapi.oam.OamServiceEndPointRef to be added to list
:type tapi_oam_oam_service_end_point_ref: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_service_end_point_ref = TapiOamOamServiceEndPointRef.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_oam_service_end_pointoam_service_uuidoam_service_end_point_local_id_delete(uuid, oam_service_uuid, oam_service_end_point_local_id): # noqa: E501
"""data_context_oam_context_oam_jobuuid_oam_service_end_pointoam_service_uuidoam_service_end_point_local_id_delete
removes tapi.oam.OamServiceEndPointRef # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param oam_service_uuid: Id of oam-service-end-point
:type oam_service_uuid: str
:param oam_service_end_point_local_id: Id of oam-service-end-point
:type oam_service_end_point_local_id: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_oam_service_end_pointoam_service_uuidoam_service_end_point_local_id_get(uuid, oam_service_uuid, oam_service_end_point_local_id): # noqa: E501
"""data_context_oam_context_oam_jobuuid_oam_service_end_pointoam_service_uuidoam_service_end_point_local_id_get
returns tapi.oam.OamServiceEndPointRef # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param oam_service_uuid: Id of oam-service-end-point
:type oam_service_uuid: str
:param oam_service_end_point_local_id: Id of oam-service-end-point
:type oam_service_end_point_local_id: str
:rtype: TapiOamOamServiceEndPointRef
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_oam_service_end_pointoam_service_uuidoam_service_end_point_local_id_post(uuid, oam_service_uuid, oam_service_end_point_local_id, tapi_oam_oam_service_end_point_ref=None): # noqa: E501
"""data_context_oam_context_oam_jobuuid_oam_service_end_pointoam_service_uuidoam_service_end_point_local_id_post
creates tapi.oam.OamServiceEndPointRef # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param oam_service_uuid: Id of oam-service-end-point
:type oam_service_uuid: str
:param oam_service_end_point_local_id: Id of oam-service-end-point
:type oam_service_end_point_local_id: str
:param tapi_oam_oam_service_end_point_ref: tapi.oam.OamServiceEndPointRef to be added to list
:type tapi_oam_oam_service_end_point_ref: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_service_end_point_ref = TapiOamOamServiceEndPointRef.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_oam_service_end_pointoam_service_uuidoam_service_end_point_local_id_put(uuid, oam_service_uuid, oam_service_end_point_local_id, tapi_oam_oam_service_end_point_ref=None): # noqa: E501
"""data_context_oam_context_oam_jobuuid_oam_service_end_pointoam_service_uuidoam_service_end_point_local_id_put
creates or updates tapi.oam.OamServiceEndPointRef # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param oam_service_uuid: Id of oam-service-end-point
:type oam_service_uuid: str
:param oam_service_end_point_local_id: Id of oam-service-end-point
:type oam_service_end_point_local_id: str
:param tapi_oam_oam_service_end_point_ref: tapi.oam.OamServiceEndPointRef to be added or updated
:type tapi_oam_oam_service_end_point_ref: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_service_end_point_ref = TapiOamOamServiceEndPointRef.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_pm_current_datalocal_id_elapsed_time_get(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_jobuuid_pm_current_datalocal_id_elapsed_time_get
returns tapi.common.TimeInterval # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param local_id: Id of pm-current-data
:type local_id: str
:rtype: TapiCommonTimeInterval
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_pm_current_datalocal_id_elapsed_time_periodunit_get(uuid, local_id, unit): # noqa: E501
"""data_context_oam_context_oam_jobuuid_pm_current_datalocal_id_elapsed_time_periodunit_get
returns tapi.common.TimePeriod # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param local_id: Id of pm-current-data
:type local_id: str
:param unit: Id of period
:type unit: str
:rtype: TapiCommonTimePeriod
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_pm_current_datalocal_id_get(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_jobuuid_pm_current_datalocal_id_get
returns tapi.oam.PmCurrentData # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param local_id: Id of pm-current-data
:type local_id: str
:rtype: TapiOamPmCurrentData
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_pm_current_datalocal_id_granularity_period_get(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_jobuuid_pm_current_datalocal_id_granularity_period_get
returns tapi.common.TimePeriod # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param local_id: Id of pm-current-data
:type local_id: str
:rtype: TapiCommonTimePeriod
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_pm_current_datalocal_id_namevalue_name_get(uuid, local_id, value_name): # noqa: E501
"""data_context_oam_context_oam_jobuuid_pm_current_datalocal_id_namevalue_name_get
returns tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param local_id: Id of pm-current-data
:type local_id: str
:param value_name: Id of name
:type value_name: str
:rtype: TapiCommonNameAndValue
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_pm_current_datalocal_id_pm_history_datapm_history_data_local_id_get(uuid, local_id, pm_history_data_local_id): # noqa: E501
"""data_context_oam_context_oam_jobuuid_pm_current_datalocal_id_pm_history_datapm_history_data_local_id_get
returns tapi.oam.PmHistoryData # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param local_id: Id of pm-current-data
:type local_id: str
:param pm_history_data_local_id: Id of pm-history-data
:type pm_history_data_local_id: str
:rtype: TapiOamPmHistoryData
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_pm_current_datalocal_id_pm_history_datapm_history_data_local_id_granularity_period_get(uuid, local_id, pm_history_data_local_id): # noqa: E501
"""data_context_oam_context_oam_jobuuid_pm_current_datalocal_id_pm_history_datapm_history_data_local_id_granularity_period_get
returns tapi.common.TimePeriod # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param local_id: Id of pm-current-data
:type local_id: str
:param pm_history_data_local_id: Id of pm-history-data
:type pm_history_data_local_id: str
:rtype: TapiCommonTimePeriod
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_pm_current_datalocal_id_pm_history_datapm_history_data_local_id_namevalue_name_get(uuid, local_id, pm_history_data_local_id, value_name): # noqa: E501
"""data_context_oam_context_oam_jobuuid_pm_current_datalocal_id_pm_history_datapm_history_data_local_id_namevalue_name_get
returns tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param local_id: Id of pm-current-data
:type local_id: str
:param pm_history_data_local_id: Id of pm-history-data
:type pm_history_data_local_id: str
:param value_name: Id of name
:type value_name: str
:rtype: TapiCommonNameAndValue
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_post(uuid, tapi_oam_oam_job=None): # noqa: E501
"""data_context_oam_context_oam_jobuuid_post
creates tapi.oam.OamJob # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param tapi_oam_oam_job: tapi.oam.OamJob to be added to list
:type tapi_oam_oam_job: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_job = TapiOamOamJob.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_put(uuid, tapi_oam_oam_job=None): # noqa: E501
"""data_context_oam_context_oam_jobuuid_put
creates or updates tapi.oam.OamJob # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param tapi_oam_oam_job: tapi.oam.OamJob to be added or updated
:type tapi_oam_oam_job: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_job = TapiOamOamJob.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_schedule_delete(uuid): # noqa: E501
"""data_context_oam_context_oam_jobuuid_schedule_delete
removes tapi.common.TimeRange # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_schedule_get(uuid): # noqa: E501
"""data_context_oam_context_oam_jobuuid_schedule_get
returns tapi.common.TimeRange # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:rtype: TapiCommonTimeRange
"""
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_schedule_post(uuid, tapi_common_time_range=None): # noqa: E501
"""data_context_oam_context_oam_jobuuid_schedule_post
creates tapi.common.TimeRange # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param tapi_common_time_range: tapi.common.TimeRange to be added to list
:type tapi_common_time_range: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_time_range = TapiCommonTimeRange.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_jobuuid_schedule_put(uuid, tapi_common_time_range=None): # noqa: E501
"""data_context_oam_context_oam_jobuuid_schedule_put
creates or updates tapi.common.TimeRange # noqa: E501
:param uuid: Id of oam-job
:type uuid: str
:param tapi_common_time_range: tapi.common.TimeRange to be added or updated
:type tapi_common_time_range: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_time_range = TapiCommonTimeRange.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profile_post(tapi_oam_oam_profile=None): # noqa: E501
"""data_context_oam_context_oam_profile_post
creates tapi.oam.OamProfile # noqa: E501
:param tapi_oam_oam_profile: tapi.oam.OamProfile to be added to list
:type tapi_oam_oam_profile: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_profile = TapiOamOamProfile.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_delete(uuid): # noqa: E501
"""data_context_oam_context_oam_profileuuid_delete
removes tapi.oam.OamProfile # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_get(uuid): # noqa: E501
"""data_context_oam_context_oam_profileuuid_get
returns tapi.oam.OamProfile # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:rtype: TapiOamOamProfile
"""
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_name_post(uuid, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_name_post
creates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added to list
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_namevalue_name_delete(uuid, value_name): # noqa: E501
"""data_context_oam_context_oam_profileuuid_namevalue_name_delete
removes tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param value_name: Id of name
:type value_name: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_namevalue_name_get(uuid, value_name): # noqa: E501
"""data_context_oam_context_oam_profileuuid_namevalue_name_get
returns tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param value_name: Id of name
:type value_name: str
:rtype: TapiCommonNameAndValue
"""
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_namevalue_name_post(uuid, value_name, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_namevalue_name_post
creates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param value_name: Id of name
:type value_name: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added to list
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_namevalue_name_put(uuid, value_name, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_namevalue_name_put
creates or updates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param value_name: Id of name
:type value_name: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added or updated
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_bin_data_post(uuid, tapi_oam_pm_bin_data=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_bin_data_post
creates tapi.oam.PmBinData # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param tapi_oam_pm_bin_data: tapi.oam.PmBinData to be added to list
:type tapi_oam_pm_bin_data: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_pm_bin_data = TapiOamPmBinData.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_delete(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_delete
removes tapi.oam.PmBinData # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-bin-data
:type local_id: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_get(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_get
returns tapi.oam.PmBinData # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-bin-data
:type local_id: str
:rtype: TapiOamPmBinData
"""
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_granularity_period_delete(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_granularity_period_delete
removes tapi.common.TimePeriod # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-bin-data
:type local_id: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_granularity_period_get(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_granularity_period_get
returns tapi.common.TimePeriod # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-bin-data
:type local_id: str
:rtype: TapiCommonTimePeriod
"""
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_granularity_period_post(uuid, local_id, tapi_common_time_period=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_granularity_period_post
creates tapi.common.TimePeriod # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-bin-data
:type local_id: str
:param tapi_common_time_period: tapi.common.TimePeriod to be added to list
:type tapi_common_time_period: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_time_period = TapiCommonTimePeriod.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_granularity_period_put(uuid, local_id, tapi_common_time_period=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_granularity_period_put
creates or updates tapi.common.TimePeriod # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-bin-data
:type local_id: str
:param tapi_common_time_period: tapi.common.TimePeriod to be added or updated
:type tapi_common_time_period: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_time_period = TapiCommonTimePeriod.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_name_post(uuid, local_id, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_name_post
creates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-bin-data
:type local_id: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added to list
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_namevalue_name_delete(uuid, local_id, value_name): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_namevalue_name_delete
removes tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-bin-data
:type local_id: str
:param value_name: Id of name
:type value_name: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_namevalue_name_get(uuid, local_id, value_name): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_namevalue_name_get
returns tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-bin-data
:type local_id: str
:param value_name: Id of name
:type value_name: str
:rtype: TapiCommonNameAndValue
"""
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_namevalue_name_post(uuid, local_id, value_name, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_namevalue_name_post
creates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-bin-data
:type local_id: str
:param value_name: Id of name
:type value_name: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added to list
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_namevalue_name_put(uuid, local_id, value_name, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_namevalue_name_put
creates or updates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-bin-data
:type local_id: str
:param value_name: Id of name
:type value_name: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added or updated
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_post(uuid, local_id, tapi_oam_pm_bin_data=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_post
creates tapi.oam.PmBinData # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-bin-data
:type local_id: str
:param tapi_oam_pm_bin_data: tapi.oam.PmBinData to be added to list
:type tapi_oam_pm_bin_data: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_pm_bin_data = TapiOamPmBinData.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_put(uuid, local_id, tapi_oam_pm_bin_data=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_bin_datalocal_id_put
creates or updates tapi.oam.PmBinData # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-bin-data
:type local_id: str
:param tapi_oam_pm_bin_data: tapi.oam.PmBinData to be added or updated
:type tapi_oam_pm_bin_data: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_pm_bin_data = TapiOamPmBinData.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_threshold_data_post(uuid, tapi_oam_pm_threshold_data=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_threshold_data_post
creates tapi.oam.PmThresholdData # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param tapi_oam_pm_threshold_data: tapi.oam.PmThresholdData to be added to list
:type tapi_oam_pm_threshold_data: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_pm_threshold_data = TapiOamPmThresholdData.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_delete(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_delete
removes tapi.oam.PmThresholdData # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-threshold-data
:type local_id: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_get(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_get
returns tapi.oam.PmThresholdData # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-threshold-data
:type local_id: str
:rtype: TapiOamPmThresholdData
"""
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_granularity_period_delete(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_granularity_period_delete
removes tapi.common.TimePeriod # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-threshold-data
:type local_id: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_granularity_period_get(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_granularity_period_get
returns tapi.common.TimePeriod # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-threshold-data
:type local_id: str
:rtype: TapiCommonTimePeriod
"""
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_granularity_period_post(uuid, local_id, tapi_common_time_period=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_granularity_period_post
creates tapi.common.TimePeriod # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-threshold-data
:type local_id: str
:param tapi_common_time_period: tapi.common.TimePeriod to be added to list
:type tapi_common_time_period: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_time_period = TapiCommonTimePeriod.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_granularity_period_put(uuid, local_id, tapi_common_time_period=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_granularity_period_put
creates or updates tapi.common.TimePeriod # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-threshold-data
:type local_id: str
:param tapi_common_time_period: tapi.common.TimePeriod to be added or updated
:type tapi_common_time_period: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_time_period = TapiCommonTimePeriod.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_name_post(uuid, local_id, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_name_post
creates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-threshold-data
:type local_id: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added to list
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_namevalue_name_delete(uuid, local_id, value_name): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_namevalue_name_delete
removes tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-threshold-data
:type local_id: str
:param value_name: Id of name
:type value_name: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_namevalue_name_get(uuid, local_id, value_name): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_namevalue_name_get
returns tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-threshold-data
:type local_id: str
:param value_name: Id of name
:type value_name: str
:rtype: TapiCommonNameAndValue
"""
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_namevalue_name_post(uuid, local_id, value_name, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_namevalue_name_post
creates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-threshold-data
:type local_id: str
:param value_name: Id of name
:type value_name: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added to list
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_namevalue_name_put(uuid, local_id, value_name, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_namevalue_name_put
creates or updates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-threshold-data
:type local_id: str
:param value_name: Id of name
:type value_name: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added or updated
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_post(uuid, local_id, tapi_oam_pm_threshold_data=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_post
creates tapi.oam.PmThresholdData # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-threshold-data
:type local_id: str
:param tapi_oam_pm_threshold_data: tapi.oam.PmThresholdData to be added to list
:type tapi_oam_pm_threshold_data: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_pm_threshold_data = TapiOamPmThresholdData.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_put(uuid, local_id, tapi_oam_pm_threshold_data=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_pm_threshold_datalocal_id_put
creates or updates tapi.oam.PmThresholdData # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param local_id: Id of pm-threshold-data
:type local_id: str
:param tapi_oam_pm_threshold_data: tapi.oam.PmThresholdData to be added or updated
:type tapi_oam_pm_threshold_data: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_pm_threshold_data = TapiOamPmThresholdData.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_post(uuid, tapi_oam_oam_profile=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_post
creates tapi.oam.OamProfile # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param tapi_oam_oam_profile: tapi.oam.OamProfile to be added to list
:type tapi_oam_oam_profile: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_profile = TapiOamOamProfile.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_profileuuid_put(uuid, tapi_oam_oam_profile=None): # noqa: E501
"""data_context_oam_context_oam_profileuuid_put
creates or updates tapi.oam.OamProfile # noqa: E501
:param uuid: Id of oam-profile
:type uuid: str
:param tapi_oam_oam_profile: tapi.oam.OamProfile to be added or updated
:type tapi_oam_oam_profile: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_profile = TapiOamOamProfile.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_service_post(tapi_oam_oam_service=None): # noqa: E501
"""data_context_oam_context_oam_service_post
creates tapi.oam.OamService # noqa: E501
:param tapi_oam_oam_service: tapi.oam.OamService to be added to list
:type tapi_oam_oam_service: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_service = TapiOamOamService.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_delete(uuid): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_delete
removes tapi.oam.OamService # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_point_post(uuid, tapi_oam_oam_service_end_point=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_point_post
creates tapi.oam.OamServiceEndPoint # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param tapi_oam_oam_service_end_point: tapi.oam.OamServiceEndPoint to be added to list
:type tapi_oam_oam_service_end_point: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_service_end_point = TapiOamOamServiceEndPoint.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_connectivity_service_end_point_delete(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_connectivity_service_end_point_delete
removes tapi.connectivity.ConnectivityServiceEndPointRef # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_connectivity_service_end_point_get(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_connectivity_service_end_point_get
returns tapi.connectivity.ConnectivityServiceEndPointRef # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:rtype: TapiConnectivityConnectivityServiceEndPointRef
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_connectivity_service_end_point_post(uuid, local_id, tapi_connectivity_connectivity_service_end_point_ref=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_connectivity_service_end_point_post
creates tapi.connectivity.ConnectivityServiceEndPointRef # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:param tapi_connectivity_connectivity_service_end_point_ref: tapi.connectivity.ConnectivityServiceEndPointRef to be added to list
:type tapi_connectivity_connectivity_service_end_point_ref: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_connectivity_connectivity_service_end_point_ref = TapiConnectivityConnectivityServiceEndPointRef.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_connectivity_service_end_point_put(uuid, local_id, tapi_connectivity_connectivity_service_end_point_ref=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_connectivity_service_end_point_put
creates or updates tapi.connectivity.ConnectivityServiceEndPointRef # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:param tapi_connectivity_connectivity_service_end_point_ref: tapi.connectivity.ConnectivityServiceEndPointRef to be added or updated
:type tapi_connectivity_connectivity_service_end_point_ref: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_connectivity_connectivity_service_end_point_ref = TapiConnectivityConnectivityServiceEndPointRef.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_delete(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_delete
removes tapi.oam.OamServiceEndPoint # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_get(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_get
returns tapi.oam.OamServiceEndPoint # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:rtype: TapiOamOamServiceEndPoint
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_mep_get(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_mep_get
returns tapi.oam.MepRef # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:rtype: TapiOamMepRef
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_mip_get(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_mip_get
returns tapi.oam.MipRef # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:rtype: TapiOamMipRef
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_name_post(uuid, local_id, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_name_post
creates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added to list
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_namevalue_name_delete(uuid, local_id, value_name): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_namevalue_name_delete
removes tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:param value_name: Id of name
:type value_name: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_namevalue_name_get(uuid, local_id, value_name): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_namevalue_name_get
returns tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:param value_name: Id of name
:type value_name: str
:rtype: TapiCommonNameAndValue
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_namevalue_name_post(uuid, local_id, value_name, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_namevalue_name_post
creates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:param value_name: Id of name
:type value_name: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added to list
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_namevalue_name_put(uuid, local_id, value_name, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_namevalue_name_put
creates or updates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:param value_name: Id of name
:type value_name: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added or updated
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_post(uuid, local_id, tapi_oam_oam_service_end_point=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_post
creates tapi.oam.OamServiceEndPoint # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:param tapi_oam_oam_service_end_point: tapi.oam.OamServiceEndPoint to be added to list
:type tapi_oam_oam_service_end_point: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_service_end_point = TapiOamOamServiceEndPoint.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_put(uuid, local_id, tapi_oam_oam_service_end_point=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_put
creates or updates tapi.oam.OamServiceEndPoint # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:param tapi_oam_oam_service_end_point: tapi.oam.OamServiceEndPoint to be added or updated
:type tapi_oam_oam_service_end_point: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_service_end_point = TapiOamOamServiceEndPoint.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_service_interface_point_delete(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_service_interface_point_delete
removes tapi.common.ServiceInterfacePointRef # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_service_interface_point_get(uuid, local_id): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_service_interface_point_get
returns tapi.common.ServiceInterfacePointRef # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:rtype: TapiCommonServiceInterfacePointRef
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_service_interface_point_post(uuid, local_id, tapi_common_service_interface_point_ref=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_service_interface_point_post
creates tapi.common.ServiceInterfacePointRef # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:param tapi_common_service_interface_point_ref: tapi.common.ServiceInterfacePointRef to be added to list
:type tapi_common_service_interface_point_ref: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_service_interface_point_ref = TapiCommonServiceInterfacePointRef.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_end_pointlocal_id_service_interface_point_put(uuid, local_id, tapi_common_service_interface_point_ref=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_end_pointlocal_id_service_interface_point_put
creates or updates tapi.common.ServiceInterfacePointRef # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param local_id: Id of end-point
:type local_id: str
:param tapi_common_service_interface_point_ref: tapi.common.ServiceInterfacePointRef to be added or updated
:type tapi_common_service_interface_point_ref: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_service_interface_point_ref = TapiCommonServiceInterfacePointRef.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_get(uuid): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_get
returns tapi.oam.OamService # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:rtype: TapiOamOamService
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_meg_get(uuid): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_meg_get
returns tapi.oam.MegRef # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:rtype: TapiOamMegRef
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_name_post(uuid, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_name_post
creates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added to list
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_namevalue_name_delete(uuid, value_name): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_namevalue_name_delete
removes tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param value_name: Id of name
:type value_name: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_namevalue_name_get(uuid, value_name): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_namevalue_name_get
returns tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param value_name: Id of name
:type value_name: str
:rtype: TapiCommonNameAndValue
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_namevalue_name_post(uuid, value_name, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_namevalue_name_post
creates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param value_name: Id of name
:type value_name: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added to list
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_namevalue_name_put(uuid, value_name, tapi_common_name_and_value=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_namevalue_name_put
creates or updates tapi.common.NameAndValue # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param value_name: Id of name
:type value_name: str
:param tapi_common_name_and_value: tapi.common.NameAndValue to be added or updated
:type tapi_common_name_and_value: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_common_name_and_value = TapiCommonNameAndValue.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_oam_profile_delete(uuid): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_oam_profile_delete
removes tapi.oam.OamProfileRef # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:rtype: None
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_oam_profile_get(uuid): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_oam_profile_get
returns tapi.oam.OamProfileRef # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:rtype: TapiOamOamProfileRef
"""
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_oam_profile_post(uuid, tapi_oam_oam_profile_ref=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_oam_profile_post
creates tapi.oam.OamProfileRef # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param tapi_oam_oam_profile_ref: tapi.oam.OamProfileRef to be added to list
:type tapi_oam_oam_profile_ref: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_profile_ref = TapiOamOamProfileRef.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_oam_profile_put(uuid, tapi_oam_oam_profile_ref=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_oam_profile_put
creates or updates tapi.oam.OamProfileRef # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param tapi_oam_oam_profile_ref: tapi.oam.OamProfileRef to be added or updated
:type tapi_oam_oam_profile_ref: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_profile_ref = TapiOamOamProfileRef.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_post(uuid, tapi_oam_oam_service=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_post
creates tapi.oam.OamService # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param tapi_oam_oam_service: tapi.oam.OamService to be added to list
:type tapi_oam_oam_service: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_service = TapiOamOamService.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_oam_serviceuuid_put(uuid, tapi_oam_oam_service=None): # noqa: E501
"""data_context_oam_context_oam_serviceuuid_put
creates or updates tapi.oam.OamService # noqa: E501
:param uuid: Id of oam-service
:type uuid: str
:param tapi_oam_oam_service: tapi.oam.OamService to be added or updated
:type tapi_oam_oam_service: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_service = TapiOamOamService.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_post(tapi_oam_oam_context=None): # noqa: E501
"""data_context_oam_context_post
creates tapi.oam.OamContext # noqa: E501
:param tapi_oam_oam_context: tapi.oam.OamContext to be added to list
:type tapi_oam_oam_context: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_context = TapiOamOamContext.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_oam_context_put(tapi_oam_oam_context=None): # noqa: E501
"""data_context_oam_context_put
creates or updates tapi.oam.OamContext # noqa: E501
:param tapi_oam_oam_context: tapi.oam.OamContext to be added or updated
:type tapi_oam_oam_context: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
tapi_oam_oam_context = TapiOamOamContext.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def data_context_topology_context_topologyuuid_nodenode_uuid_owned_node_edge_pointowned_node_edge_point_uuid_cep_list_connection_end_pointconnection_end_point_uuid_mep_mip_list_get(uuid, node_uuid, owned_node_edge_point_uuid, connection_end_point_uuid): # noqa: E501
"""data_context_topology_context_topologyuuid_nodenode_uuid_owned_node_edge_pointowned_node_edge_point_uuid_cep_list_connection_end_pointconnection_end_point_uuid_mep_mip_list_get
returns tapi.oam.MepMipList # noqa: E501
:param uuid: Id of topology
:type uuid: str
:param node_uuid: Id of node
:type node_uuid: str
:param owned_node_edge_point_uuid: Id of owned-node-edge-point
:type owned_node_edge_point_uuid: str
:param connection_end_point_uuid: Id of connection-end-point
:type connection_end_point_uuid: str
:rtype: TapiOamMepMipList
"""
return 'do some magic!'
def data_context_topology_context_topologyuuid_nodenode_uuid_owned_node_edge_pointowned_node_edge_point_uuid_cep_list_connection_end_pointconnection_end_point_uuid_mep_mip_list_mepmeg_uuidmep_local_id_get(uuid, node_uuid, owned_node_edge_point_uuid, connection_end_point_uuid, meg_uuid, mep_local_id): # noqa: E501
"""data_context_topology_context_topologyuuid_nodenode_uuid_owned_node_edge_pointowned_node_edge_point_uuid_cep_list_connection_end_pointconnection_end_point_uuid_mep_mip_list_mepmeg_uuidmep_local_id_get
returns tapi.oam.MepRef # noqa: E501
:param uuid: Id of topology
:type uuid: str
:param node_uuid: Id of node
:type node_uuid: str
:param owned_node_edge_point_uuid: Id of owned-node-edge-point
:type owned_node_edge_point_uuid: str
:param connection_end_point_uuid: Id of connection-end-point
:type connection_end_point_uuid: str
:param meg_uuid: Id of mep
:type meg_uuid: str
:param mep_local_id: Id of mep
:type mep_local_id: str
:rtype: TapiOamMepRef
"""
return 'do some magic!'
def data_context_topology_context_topologyuuid_nodenode_uuid_owned_node_edge_pointowned_node_edge_point_uuid_cep_list_connection_end_pointconnection_end_point_uuid_mep_mip_list_mipmeg_uuidmip_local_id_get(uuid, node_uuid, owned_node_edge_point_uuid, connection_end_point_uuid, meg_uuid, mip_local_id): # noqa: E501
"""data_context_topology_context_topologyuuid_nodenode_uuid_owned_node_edge_pointowned_node_edge_point_uuid_cep_list_connection_end_pointconnection_end_point_uuid_mep_mip_list_mipmeg_uuidmip_local_id_get
returns tapi.oam.MipRef # noqa: E501
:param uuid: Id of topology
:type uuid: str
:param node_uuid: Id of node
:type node_uuid: str
:param owned_node_edge_point_uuid: Id of owned-node-edge-point
:type owned_node_edge_point_uuid: str
:param connection_end_point_uuid: Id of connection-end-point
:type connection_end_point_uuid: str
:param meg_uuid: Id of mip
:type meg_uuid: str
:param mip_local_id: Id of mip
:type mip_local_id: str
:rtype: TapiOamMipRef
"""
return 'do some magic!'
def operations_create_oam_job_post(inline_object3=None): # noqa: E501
"""operations_create_oam_job_post
# noqa: E501
:param inline_object3:
:type inline_object3: dict | bytes
:rtype: TapiOamCreateOamJob
"""
if connexion.request.is_json:
inline_object3 = InlineObject3.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def operations_create_oam_service_end_point_post(inline_object4=None): # noqa: E501
"""operations_create_oam_service_end_point_post
# noqa: E501
:param inline_object4:
:type inline_object4: dict | bytes
:rtype: TapiOamCreateOamServiceEndPoint
"""
if connexion.request.is_json:
inline_object4 = InlineObject4.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def operations_create_oam_service_post(inline_object5=None): # noqa: E501
"""operations_create_oam_service_post
# noqa: E501
:param inline_object5:
:type inline_object5: dict | bytes
:rtype: TapiOamCreateOamService
"""
if connexion.request.is_json:
inline_object5 = InlineObject5.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def operations_delete_oam_job_post(inline_object8=None): # noqa: E501
"""operations_delete_oam_job_post
# noqa: E501
:param inline_object8:
:type inline_object8: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
inline_object8 = InlineObject8.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def operations_delete_oam_service_end_point_post(inline_object9=None): # noqa: E501
"""operations_delete_oam_service_end_point_post
# noqa: E501
:param inline_object9:
:type inline_object9: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
inline_object9 = InlineObject9.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def operations_delete_oam_service_post(inline_object10=None): # noqa: E501
"""operations_delete_oam_service_post
# noqa: E501
:param inline_object10:
:type inline_object10: dict | bytes
:rtype: None
"""
if connexion.request.is_json:
inline_object10 = InlineObject10.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def operations_get_meg_post(inline_object16=None): # noqa: E501
"""operations_get_meg_post
# noqa: E501
:param inline_object16:
:type inline_object16: dict | bytes
:rtype: TapiOamGetMeg
"""
if connexion.request.is_json:
inline_object16 = InlineObject16.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def operations_get_oam_job_post(inline_object21=None): # noqa: E501
"""operations_get_oam_job_post
# noqa: E501
:param inline_object21:
:type inline_object21: dict | bytes
:rtype: TapiOamGetOamJob
"""
if connexion.request.is_json:
inline_object21 = InlineObject21.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def operations_get_oam_service_end_point_post(inline_object22=None): # noqa: E501
"""operations_get_oam_service_end_point_post
# noqa: E501
:param inline_object22:
:type inline_object22: dict | bytes
:rtype: TapiOamGetOamServiceEndPoint
"""
if connexion.request.is_json:
inline_object22 = InlineObject22.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def operations_get_oam_service_list_post(): # noqa: E501
"""operations_get_oam_service_list_post
# noqa: E501
:rtype: TapiOamGetOamServiceList
"""
return 'do some magic!'
def operations_get_oam_service_post(inline_object23=None): # noqa: E501
"""operations_get_oam_service_post
# noqa: E501
:param inline_object23:
:type inline_object23: dict | bytes
:rtype: TapiOamGetOamService
"""
if connexion.request.is_json:
inline_object23 = InlineObject23.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def operations_update_oam_job_post(inline_object29=None): # noqa: E501
"""operations_update_oam_job_post
# noqa: E501
:param inline_object29:
:type inline_object29: dict | bytes
:rtype: TapiOamUpdateOamJob
"""
if connexion.request.is_json:
inline_object29 = InlineObject29.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def operations_update_oam_service_end_point_post(inline_object30=None): # noqa: E501
"""operations_update_oam_service_end_point_post
# noqa: E501
:param inline_object30:
:type inline_object30: dict | bytes
:rtype: TapiOamUpdateOamServiceEndPoint
"""
if connexion.request.is_json:
inline_object30 = InlineObject30.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
def operations_update_oam_service_post(inline_object31=None): # noqa: E501
"""operations_update_oam_service_post
# noqa: E501
:param inline_object31:
:type inline_object31: dict | bytes
:rtype: TapiOamUpdateOamService
"""
if connexion.request.is_json:
inline_object31 = InlineObject31.from_dict(connexion.request.get_json()) # noqa: E501
return 'do some magic!'
| 34.28125
| 315
| 0.760348
| 10,903
| 75,693
| 4.886728
| 0.017243
| 0.081832
| 0.05991
| 0.089865
| 0.939264
| 0.931982
| 0.916291
| 0.894595
| 0.885623
| 0.866836
| 0
| 0.020327
| 0.167426
| 75,693
| 2,207
| 316
| 34.296783
| 0.825119
| 0.523945
| 0
| 0.565702
| 0
| 0
| 0.058939
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.291759
| false
| 0
| 0.113586
| 0
| 0.697105
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
ced4de4a24dd8539de84f00fd45ffe0dd3ea6f67
| 91
|
py
|
Python
|
{{ cookiecutter.project_name }}/{{ cookiecutter.project_name.lower().replace(' ', '_').replace('-', '_') }}/example.py
|
gabrielguarisa/poetry-template
|
ce1d555121c0d492cb592d57f19b57a8116756d3
|
[
"MIT"
] | null | null | null |
{{ cookiecutter.project_name }}/{{ cookiecutter.project_name.lower().replace(' ', '_').replace('-', '_') }}/example.py
|
gabrielguarisa/poetry-template
|
ce1d555121c0d492cb592d57f19b57a8116756d3
|
[
"MIT"
] | null | null | null |
{{ cookiecutter.project_name }}/{{ cookiecutter.project_name.lower().replace(' ', '_').replace('-', '_') }}/example.py
|
gabrielguarisa/poetry-template
|
ce1d555121c0d492cb592d57f19b57a8116756d3
|
[
"MIT"
] | null | null | null |
"""Example of code."""
def add(a, b):
return a + b
def mult(a, b):
return a * b
| 10.111111
| 22
| 0.505495
| 17
| 91
| 2.705882
| 0.529412
| 0.173913
| 0.347826
| 0.391304
| 0.434783
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.307692
| 91
| 8
| 23
| 11.375
| 0.730159
| 0.175824
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.5
| false
| 0
| 0
| 0.5
| 1
| 0
| 1
| 0
| 0
| null | 0
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 1
| 1
| 0
|
0
| 7
|
0cd589958b0fae178bf37de315d9acafe3d57dcd
| 11,062
|
py
|
Python
|
Kgf/.Kgf2.py
|
shyamjangid07/Reverse-Engineering
|
469efabcd6057f7895d8d891f1fabdf2ffe730b0
|
[
"Apache-2.0"
] | 337
|
2020-08-15T12:22:14.000Z
|
2022-03-29T06:05:15.000Z
|
Kgf/.Kgf2.py
|
ajairakaam/Reverse-Engineering
|
49d00bafd0622ffb79e081946a19c5fd3a42628f
|
[
"Apache-2.0"
] | 3
|
2020-11-12T14:30:48.000Z
|
2021-05-18T16:56:22.000Z
|
Kgf/.Kgf2.py
|
ajairakaam/Reverse-Engineering
|
49d00bafd0622ffb79e081946a19c5fd3a42628f
|
[
"Apache-2.0"
] | 83
|
2020-08-15T00:22:58.000Z
|
2022-03-31T08:40:23.000Z
|
# Auther : QaiserAbbas
# GitHub : https://github.com/TechQaiser
# YouTube Channel : Tech Qaiser
import marshal,zlib,base64
exec(marshal.loads(zlib.decompress(base64.b64decode("eJztXGtsG9l1vkOKlEiReku0LHs9Wtuy9mGKelCy7JVdWfIru2srlHflSlXVIWckjURy6JnhWtpY2SSbpG0aoAiy227bbYEiKJo2bbJBCzRBCyRA0AfQH0UfyI8iKNItiv4IAjRI0f5o0Pacc+fOg6Qe3mw2SRHLurpz3+fOved855x7p8CcfxH4/Sn4tV4JMbb7DaYypkqsyNgyE3GJLUsiHmLLIREPs+WwiDex5SYRj7DliIhH2XJUxJvZcrOIt7DlFhGPseWYiMfZclzEW9lyq4gn2HJCxJNsOUnxECu2sVI7W25nEj6HWbGDlTrZcid/bsJ6pS623MWkpfIF1qR1s+04M/sk+KcxttXD1Ah7VWLiIep/aKaHssTuab1Mk3iWxLb6mNrCHxJsq4u9ClOVYlqKbR1jWj/PgIfjDLMH2NYJLKECgXHIkyT1DNuQsPjaSaYm2Ueh9mNMbaPIKaa2U0RmagdFBpnaSZHHmQp0nGZqNz2eYWoPWz7LNiA+ROE5CocxVJ6g+JMUPkXh0xSepzDN1F5qZISpfRTJMDVFkVGmHqPIGFP7KTLO1OMUmWDqAEWyTD1BkUmmnqTIFFMfo8gFpp6iyDRTZYpcZOogRS4x9XGKPMO0GaaeZtshZn4gpI3g7EhlerGLw2dhIer/C/9uD0sQteMQ3N00NUVdMIwiT2uHYM4ol7WCrRvla6ZpmDyjGYKrpvHA0kyrF+IVvTIm62XLVopF2dTuVzXLtqy+2pySVthUyvrLmtWGWbv2plEek5/dWE9DvAmSqvb6BbsFIiVlZ83WS5qO3Vk4tir0dV7Z0Mq29RgkzivFl/TtkdH0ZDojDz+nl6s7l+QXLsmzZdU0dFWeSE+kxy7Jt+9ls/LVql5UR569czebzUw+Ia9cvzp7e+T61YnZSxB7cWQ0A23Az9hkevICJF19cWQiO52ZGJ3MwNP88yMfULWypdu7M+PpzNMPdNXenBnNXMg8vanpG5v2zOj0WGYPSj43N6Lba7fuQjQXaGIuN7JgWLb2vJHXixokPH99RLGqFvY1L2ILt0cKRim9rhS0vGFsp7cVWykrOIAXR2YXX1hcW85kZufhefHFkWwam72zMDKKrc+O7FyYvKiYJU3J6+dfmlIurRYEy8Hpm8MpxHcB7/3GTRt2HOysEC0G2LmLw8CM2G16IyuDqwMro5emR0vXdnR7OIyvGnNh8Bi3di16SxpmYuteYGExdSOHC+M4PjdR7xGpgCPAhxYxkkU+kj0JmcpeiO1cZDCm+dUxthdmD0PIWh5KzKYxAlux6RG2OrCPY6+GWH/qYZilpqDi/W62BOOBKq/igo4iGbQylU1bfXmrYOMQbOx/UMcoraXhiEjcsbGGqZRVo0TVMKqXbSK1COsMSxY0W9kebhJ18hQ+oFClUK+bA5oipaBsnxJLl0lR+ElKGT4b2G6zmI0PurOxM4uEzq9O46RAbIs5pOG0NOFLg/mClD6YIJumBicC8vtgVvaa2P0kW4JyME1T8OTUiBLXpXygawsSI5gFDBdr8vePb+Z2DkMLSR88a1k4vIGVs9al0ZJ+SrzOgZVMiWgczFhIR5ymnKZJL6vaDp9ErVKEJczXi23mqEiUHlSjalPpB6Zua/Qich0YdGLQLeZ4K9facGkhMzqHz23OlCaldmlYiktdfFqxWFhMKwY7z7CHNLmp+dUMzrC79PmCkpznMG0Fm+ZGpRmX7reyJZqbMO0NonbjS4997Fvv/9JvXSGyibDcMQz6xSysF6vWJr1+ZF2UZBU1rUI7jGh7mUKtfs1g2U2l9LIyioktRGGn1AE0vje0/fqv4b8vN6QtN4DBCQxO4rhxMLnHMDjV6EVxWoyKZU3W0mJFoM84sZix0tuv/+Hbr33Y+f/6593k1151cl7/PMT9yZjzRYp8RtT8I/rvxn2RYIteVWodm4Y2PidqfI6yKIK5XwgM5i1q7gu+qv4RvOpV9Y2WV3KI+AzWxpQ/pf+8ni/i6w8G6fx/C5N5+lTp/KP9c+qNQntvUGy8NGeominL8kV6zpbugiiW36/oIFXrC9/Q7c1q3iu8adsV6+LIyAalp0FOjWD9/apfd2SYqM7LybP5vGLVl/5pYAvVvHa0kd02bF/JTd2Sb1myUS7uytcNU76mVgsKQhWlKC9UzYphaQ2a0B7IL1RUxdeQfAskvA0SXl4wjXxRK8nX9R1NlUczmbPyrXUZhig/Z2zoZXkJZkCeLRQ0S75rbGvld/qGSEAHdvV1LghUEoAbYbYHmzyDm3x+dZiEZRNu7dSNgPzmPN0B1vf7nI1NkpBYdhreOI+k3UhatnBrJ1fefvM1Ie6BOKBuQ75Vlj0p6WMDDTgAbXOYM32beJpRzwcIPujbC54YbAce0MKSjMQxTUHE+aUp+Bg0xMlTORPb7SdJR1MCQoxzM5iYpfL7WBMwNVQwTAZIP1ALZkrAHGdmYKxbUaFyODmeyrE7g4B2qwV1DZhvFIzIUGNsK05yuJWEMMle0C36HZQSh1gTjMSEkSRoJN+rH0nrI4zkCWgIhpFkW23U3BnUnNQEtuCvhCMOdAIo/cZNUG8QDUCkDeU7RtpRsemBSCfmd2HQjUEPBr0Y9GGQwuAY9tLhQUJk+7c5ACpqimnFIFbEDZC2d2x636aFMM8DjHw7yLA/YSdWy6qFkt0syefNddmtydF8Pfa3nkKRIZiMqVQ2PRyMzKakXVFwz1lrNvYyQzK2rICMxaWmq9YwH4vsDAb2q4m7FAZiI4O4U5bnNrXCdsUAfGedDBa+o1QsGLfsKTpWktAO5E6UbkMvF2Uas+wk3ZoHzijrI0Kon7dkUX60tDK66vAZedFWTFueKxpl2Fppa9xXaMwthNkaZys0ahiooRc0eUGxrAeGqaatM75646LeDVPJ53HHAvEw9UbRChaccMgbL81WbUOe14oa8Dun4JCvYNYdicMTianOGaUSoOG0lfYVnRRFF6t5q2DqwLOf35UF+54Dza6sFdNWyldlSlQBBgPlrC6cxrp/wwQAiZ8QUgQ1QyvROzYqwJcxgnop4ctbd0gN9ZgRqYtC5SSes6HZVGfLMjiILxqKyjUXG1AqVXhW26V2SO3VdgpahV58ThKDyCM1JrVX0spca6AAFiBXEQyb6wFKDlFpbrghFmri9asKpj1HTDAphaV+CJOgHWHYCc/dAGLjUpsvtQPSMNZEKTH6idT8EAcV8JA46Bc5B+WcARjlQ7LcoP5/DnkobHKJGwE+Lj0kow1mzSCTpdQKpUYo9cuOwiB4VUQwKpgexyiDsZgbi7uxVjeWcGNJHuNNtvEHznTbOVv7DxpsB/X9N8h9aUT/RKmdlPqvaKSg1L+i1C5KfVYKjrOVM0zgdb4Oe1waet1Yn38QKbd0BO0yNKI89dJPvZRFS8d5wQQfyBUqMkBFflsUOeF2cdI/BqfVBFpw3BdB3PYUyevjYt9MloAHAHSR79CilM+fvyzLOWTBVrfLhkZLS6ZBErtS5Rx5lMKxHBp2BI8TzHkBuDg0uKTotry0qRc12erxuhvNnE2nn4NNQnzKlzEGGSI9kJHdL2Nqv6amAxmdIiNbms5CxjwwwTRxByEY0nwOQDiQ0CDaximcoDBrZZHEt9/89Krgy/VEIr9D/k+sDbllGv+RLQSgrFypFouyYeoI7EoKMB3TeqK2URmHxhu6qVjyVQ2EHOeUqmzdEKVF4fohXC0YL8uLwDIIXvmGAlCLi6myauqGqocbi0YidtKahXBH3TiPDFEWkvLBgwfpXc5+SUwWOAseeWHupmbfn71ffWHb2Np58aUFLf/+Sj6zQW1NNZTMfMEQ4YgFgbg7VVterJLUXYd52qVZ84lN3/IbRnlp4wI1lQdrOiblJgXDLJhKYZuYe+5JDFBW5gYDeJK4JIj9PPHVvGHn8N3mLiIzlUS+qZSVeqMAdvOL+HybeGECfiLASRP0m4TQ/4NcNeHLjVCal5N0a3WEHO6K/1x8+qvsKPhUQVQ4A2AuQjBOQ1TYAJJG2VbzvpA0CPBaEKJREMMgjgGxuZjHQxLIQ/jeD4C1HAp7byOOljhO08svKUX9EVHasGhlDGGO2CEcwVw3DdCaTF0rq0XdstME6UThMXeD+ArPlkHdquaLekG+NZ+2HveVH2/YOGwnH7qAYhmn2FTpKqyx9HBcwAi+0nAEuacxmMLgfGDN0RIj6U8LdA2F9D42TXz3f4zPaPNgISG/hfRO1krkNv+amQofUSLHQp5E/jQuK1hNYq00+ZUAu9lVUVrYVoxUlLijoux8TULdpJn1z6+m0HAI4nArgaoBrJ9+UhKrsDp/k+R8jPr6kNSgL+aIc9BwdueY03UraRYg01NiCBExhIgYAgwvicL+YRSlfD8ZGZfK52A3cKXmCVJq2p0+OoQCQzOA6z7QU6fXU0Niv878xDYLYps9YvPQ+Vs+sNAWqicWCWQOXthrQaUbNKGHLQQaoHAnDm5+tZ/txUQHMccXRV18TVpaup8JNdnc3xUPIYG9DoF9fgKh1L3y4zSaFI3mTMju4aQnGFfB+FrAKQTO0svsPuzyVVo7NJU2ub4ECEki9GiYfKI+GcAIAA/UB8lvtBdndj+6jpBqmO9WdKM9jFN/ISg9iMNJoidJtHmax/ioBpxR7SXEOE+IFCh6htUUS6ln4V0GC6KOKsaEczXE2+/xeNo5wkWICoKA6LKLh4RMAt5QBJl1q1wwTBOUuOJu7hJucuKHqHgdqFyOrBPfshoomSCsFYL2uWewqRRJyTdedxjPZInkH/AvUBEHDu6GGGqwB09jy5aEtor6plDdLjrcTSYNg6w2PgEMaqirbQ/STMQXTGhcvlYGJAOQRUauKMuU1ZjE3IwAlQ45xGRlrvNyyXE82CnPF92myfnXoNe0TFgjQy+v/uXQPMrCimfYStERHdZFeYML3W9esc56swNaqYa2ORy7h8NIwdaCWioMYNE2Km5hPri5u7nnsI2y87xM2nsO0R7Z1wXLRt+UNRQlNg08Z7czKO+Xyp3AyUK00Z9EuU7mo29HHIRPxvcUcPUU8LEUZ1JczgOf2mpxfDnA49EbQ+Yl4ENUJcpSxPE8vhpFu9PDiMNU0TIVZdtRZn4V+TbVifM6sHkSaDWCNHwkBLEUQRZK+lc/VjonqUleqc2t1Ma4hQidQ83INLfasQgyXRpKF28LM7hhyO6s7ebfm4BrAsusp6XlSLR8UvLT0hKkpcXp5JeagrR8N0BLy6G0tBxMi+jmTBMKyR7WD7w7hay+jqbYkWj6uZCfpliQppjT2Z+EgzT9ZchPU+xQmmIH0yS6WQgLmvqApngDmuJHomki7KcpHqQp7nT2L6EgTb8R9tMUP5Sm+ME0iW4ehgRNKaCptQFNrUeiqaXJT1NrkKZWp7P2GpqMJj9NrYfS1HowTaKbz0qCpmNAU6IBTYkj0fSNAE2JIE0Jp7NLUpCmuYifpsShNCUOpkl08w8EOvud/ZRsQFPySDS9FfHTlAzSlHQ622BBmlJRP03JQ2lKHkyT6AYdD82C7RNCQel4m4CCpbykHQoB0IU9UoMy0Ng4dWES/luf8lXPn1cqei1QAW1MHVGq9maalLVgS2PjU1PZ6enMdHZ6dDKbPTuWHctOzWXWRycyipLX1PX8ZFYpjE0pU+PTmjqqjI1NjudHh9YNs6TYM2gsHbLU7bWXNNMCkDUzNqSVFL04Q7J6qGgUlKI2o5XXXlgcqji26RnrJuZBrRndsIY2tLJmKra2ZsGgoIm1Aoxc16yZ0SFL35gZX89ms+vT0zCO0fWCOqUomcLExHr2wnp2bExbn7RRhfVTRMYYFOvjoOs5fz2LhJNAmuV4piSTTUnogw/dVFRw0U7in0kyVWho/l0rWRvWlE+lFGqn6y04f6eilWfXAdtMzSu7TrFVAczqO6XUbmdBjBTcdkgXn2aOJeshd7uTKXpB2QaFWSmTMrqum5a9Rq4NtIWMjo3T6oK/E2RNwUiWvB6jY0RGUXHKD3cJ7ZcKlrZV3SSL+Z1FbjFHkJQbcdXhDAZ42iA3xhybd9UsFvU8VYKoa3tH8zm3eG9bVE6pQJbK9Wv38EOhCAidK9Qu0cOIq6iqYnJbOJ7iommgkx9UEVfTaO6mmJr7VL5g2m7mmBsbd2MTbizrxibd2NQ+hnhFL4egD+vPSJGPgiLfSSb2sDQgdUlR6ZTULiUgrSfUAWE7qPlxiO+X3vZDST8WDUs6WiLIAOrg9kdzPnMrJxo2V9OOqlGHreeMUgV9RoCu0ZiyMldxPUre5gDFZ9EHx2HFO/4qmYN6ZzfdeXZE7KsF+aLs7Fw6GTLi7BkLDTPiFEQjNWaYjDZXMbjBAmYeshUeuLi5AvczTFgfUSEkqw4tYW641BS1qJc1i5/asU29wg1GaITMIQvM4Vr22Y+YWNolpZJbwZSfxTXnrviCWSINik7K0Mrm3ild5e6jLWObn62r8KNPUcpD2xnfdDCY3JaoWqGiOztUc2dnp95IhZPyF/j8Mqb6DKFonkL3Uqd0zHlKhPh673NMoK305OWH4e8JSOO5bU0JKR6KSM2h42Qa5b+xSMxKSB1UAk9gdUlPSLFQ3HNJuQawN9mRnfozrlN/P6PpgX78oNG0eR+jKfeot3hWBjRe7285rdF/vy8vNy5S13CaLV3bsU2lACp/taSZZAW1uKXTZxWlnTpWV+Uaiub60rgBhI8YlGZRemETjajQTR42VG0dpGAl49Yh7Z2Oa/j8s7HgjvMMq41sqlgYjfncpCqJPVm/ZOfhDx75IPe55xdtZFdt5Ov8ZXZEy6rKGvk6bzPP17mIW5ZSL1BqlFJ1dDxQKjfaNVPqKyi1hNGupcaTh7TftvpdXlbryrt8+WBHHrdaoamJTDO5W1i23VmCvBy5V/gxPeKGOzgNCWIe6/BquZ2HTm4TfvOl4Zsu0yLwEn1OFnKdm6X694Q9vIHv6UQNawn8Co8JkhcV7+jPQ0fe/Bl38987wuYnwwu3zjQLHsCtMy3Uxp5rnXkjeCTHRm4AMIW7sNHGc9kx6/r1DOaab+g4Dppv2oX5ppU0G9A0QKvgpu0O6jJKpu2k07zj4u70TNuBTtq9TppEJ02iE1CHuoRxnE7v4JR1kYk6hNrRzkuoKTnGiv751XUyfnfjTQo0fvdx4zfoQ1u9IgG1ZWruGNlgU1hcmGb7YSy8VOqGfYxt9aMpmDQgPuPcfnxfkZawyQG+2geQlZ6oa4wTf9KxpauPMcdCE8frCr4ZWSp/1n3fV8hkLjsTNxiYuI9AKejlJFvnVrdtKvt4w7Ivuq/iU1TqdMNSuM7gVTzGtk5R2a+G+E2RmmNWvjdHO/vsgVKi29miRxYPufe5O/upVVlYkeV3ZkbGZgL244uOxXiABU4BcBurb3joFmwEtkjsXFnXtaJqzTiW43RRL+n2cDaTyTwxFOwfgZY4l+R4uh1zrl+2pckrPis/QL94mp9COiJexQPhpE/pKs05al2kpjhjI+2BUB7Xq4hzJVcs5EPyqjxzWd743u995++ezy9c8Q4/jZcaGpV9wHfAV5TwLElonDlNFa8quXJllZAvN53TQS7nHVjngl1RgSBalmctmQjz4d+JhviXYLUPiJBO55wxmAP0SrO+Dk9kkm/oCbBOM89M3tieboBmx1dtbVccCL395q+4yYEjc8PyESHCixgsCbDARZgH3mtwOwF1hAmE2x34vMmRPJ1M94B5zVnVVSyPy+RZbTdvKKZ6C6fCrFb48a9rd65zpXgCC9OJ15gAKrkKBvcxMDHwQDyuqvzLXIsn5xDAqnpxuQt//gDFpd0A1jT5dE7C4o7u2RnA4nGIt0u9kNorySzJOimlF0rHqEzSwd3dzl//c5KL4Va/GM6E3ysM7snkljqZ/AlXJv/nPjI5VieT41xcth4ik7mLO1knk7tJJrc5zbfvI5OdTjoOl8mdXCaTLO7hcrmHzpRxufzXJJf7UCZ/xXNIY/vN6PPtDxDSIvpoEX3E2K4t5HgMPcJ+Oc4TUFjTEI7Xy/EB8gxgqRRIZorjjGCVhnKdn05bul+WxHQ9jbIQnu/Br1/Y44E1kN8QyPtIfJKxe3H0Fzu2/rjrMa6X+L/vydy611Ir8b9OZc82LOtJ/O9RqaGGpWol/lNhLHvuMIk/fKDEfxf1Qo4F2pjn7XznUKBPtDJRaogITgSH7ZZxB76/9NjfjewdXZxwAYBPQ6UrcmTtEXclaOQk90hHcWW6J8fJDEOZjkTH7KRTf0VYXEnTElZX1yjr5qK8kB/KG+fnTnzr7cnjV+iM0RHghuuWx0PcviNwQqEGuf08jowOzckBhIDpfoiA6lVmfJwX8R0sHC81wAyCANfvT2BFVNgHPlx0AETdAYB3AB1OBws+GkDwnTF776FBgpaLT689IkbIvYLBhzDwoEDrgVCArNcfxgBRP11W5LfhPsIaWTnQHvdvCAc+1AAOdB4RDsQADnRKpyAeJlCQIVCQlFoIGHw/0OCpHzFo8J2fQIMfR2jQGBXIAhUM+lBB+36o4HcCuv3BqOBvAxr+mX1QwX8dgB1qUcFQ2EUQB6GCc+8tKniXLAQuLMg2hgUDwXHXGQreLVQwWyw6dmirASpoF6iAWykbwQLk8yX6jMJaBa3adehgTKCDsRIdmKtDB7XgwDUMnD4SODhPp4ADMl8Y1j2p78cFDeT8RS6SDxHsXKw/kuw+inLfs8+r9C69jZZkLtF7mWek/uGI9LLxoyjSPwB/ngw5H2/4wYj0RxLo/w/9bcFbpWVgROuP7m+jOy2ev81/ExK/x2KlyULnc69RCbzdXbGFsTTn3CxM03FU92aCU/aFMl+bxNiEzZPIwssJ3JeGT+/QlYbcMW/Yh3rSrsGf7dCPtSfN1433URI6Phzfx4W2/32kRl40n8fs55lz80OltVCBpcCPtdCLp0mvluvcY038XVj1s4/t7YWO6h9Dtuai7/+uu/F+s/Fmdb7g0eS/oM5PFkviZDG/oB6hC+p8b8dob79Gezvq7W3nGmccT9yJm5w8J7bP3k7wHW27J+n4DU/Y2gAjEezy0bUxH0jmo2sSo4uwnW8TBG5HCPzPiInxwF4HDLcZwTNiXt5KF0LiFKBoFw7HRGsx0Vqc7Y4jpBQ+sL1WxNYcSssAmQHpAraFCUwBGib4C+D//nddYPi7BP4PqHECa+AlkJNsCoZGVZvwMshWFzXw99QAXeTsdl1b/OoClL0Hv0vu7HDXVm0xWuWDB/LCR7wVz6HcO7iW7379pRETdaHjeC109CDHPq4U53w+IT06a29lDqNoZF3T1BqyXPRHn404FP7iLrzCz0rO8B0edFdx0xJd/kYXUglylA2NwKewLzl/dWQSzkk9DGUCjXiD9LhX2L2DRvdQFIBiKgmeIN7kpp8VLn3UVS6yfDflPWzlw16NEfc5djDQ8xxY8nDvftJmXxDWSAw5X1tQ+OkpXBB0yOPubkWr8aJwBoviiC4kkrgitw1U59/VMoq0TPmhQKvKP5ZlVa1cVbxlSqropkFlqmaRH5Pazn2yoez7BfjzKeS+73NlXy8deGqrkYAxAl38KFRcihIMC0Ops5A7CL8cYLXTPXvnIBOuD+/259G/TvKuAyu7xTuw4Jykbnhagd9PC+HBZfe0AvBr58ACJOHp6G8yfkqhxT2l0C6+DAjs0VGTgTMDVwbutfNBUX1+1RQ3VzqJTTehraMfeXAKT3mLcUTEOCJiHFHkzjgOIhjHsCYB3xUNHCPjzP3/QQ5cl7bkjgQYMx/1gH/UxEdPHMhHH9k7f+Dl12yJb8jn0B+O29IBjAIpImc86pUz8d2KK+Rcn6F+a5zruMxXVokJegot6WPrQYQ64GU25BuDh/AN4tY+Xj10RBqsEdqxqKhxF3y9/YG2rnfPDMTSCueUq6CBc7HV603vCp9Qniv7v1ZymMN+X6bpHY4+Auw+RE1NCRbH1VTiVgAhh5tdhkffHMEXSsuPfzZEKyllftCTzlkpFimd9ewML7N/GdnZRZed1UL5hHN6M+Jca49B+mk6g9kT6vWzr6iffd37UWBfklAOgS/BjkabJudmCT+w5dxDEtwjxHZuErZNIg96hr6HGKbrxXv0DUSElMh0YmgyBW4BfIfuDjstSpxVITf5GltaKk8Bde1EXQpBnM8kPEOgDj+SZHe63wzp8ux/vU5Onz+H+E/qB89/fF/3OfgypK+g7/LjsmwHb0am9TF3q7/DG7Icmblfv6GD4kdrpqqrDZmdi4iywCKEcs0ZwZENXOQIkxuywEdgJfsdjRrufhROIh/ESUjp5AiV1NFb+BFNDqhecdkQYamoy1qQeVS0bX7CHDBRd+AN1LOTT8Cff0R28sy+7CRO2CjsIqM4lIAcFnYNVhiSWry2hlco1tboA3A/+Srvo36Vd/iyu3aiYrHQvOLnZPCToTkEzaSVbCrWJt7FwYk2NYLbNn2cWS9v8GV0jzkwnN+yEhd3NjQbb8BQjvu5ZVqCNi7pUrVo6xW+7vFLPBUDADkuDbubeZ/RStd8EStHH/xDs+itUgX0Jr5InxRr2NToihDKWEuzVW1dgV60csHA0fJTUyYdxoLcNRiRWtTWTAONKSQbrytFyOiqydfWYfdtUoE1ZCo0/Jt37y7keI6zeZ1PeCmqugmzo5kWfYI4h4Xpi7G+783QjjwjZHYedjPNGJ9Xi5qxXG8/3eagex00hA1lQynmPig2Wu6jGHwcA7oggp+h4TdK6HIKGbHx2DQdBiMXMBmNOWxAexGpLSTsaYs6uwvvccHucndx4AYTFnmmZKjVonaZPtaLIwxLn5U64KeHNjRs6TBaiPEexwkpEYpFYi2xOITHohCPSnU/4dhw7KlYV+wrse5YT+xSbC42C089kDoYO5WQ/g9MNClb"))))
| 1,843.666667
| 10,938
| 0.96601
| 345
| 11,062
| 30.973913
| 0.982609
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.150656
| 0.001537
| 11,062
| 5
| 10,939
| 2,212.4
| 0.81684
| 0.008046
| 0
| 0
| 0
| 0.5
| 0.991886
| 0.991886
| 0
| 1
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 0.5
| 0
| 0.5
| 0
| 0
| 0
| 1
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 1
| null | 1
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 0
| 0
|
0
| 10
|
0cf7ee7241d56d02f24780ca1f5140ca32c7e979
| 414,417
|
py
|
Python
|
pirates/leveleditor/worldData/MadreDelFuegoIsland.py
|
Willy5s/Pirates-Online-Rewritten
|
7434cf98d9b7c837d57c181e5dabd02ddf98acb7
|
[
"BSD-3-Clause"
] | 81
|
2018-04-08T18:14:24.000Z
|
2022-01-11T07:22:15.000Z
|
pirates/leveleditor/worldData/MadreDelFuegoIsland.py
|
Willy5s/Pirates-Online-Rewritten
|
7434cf98d9b7c837d57c181e5dabd02ddf98acb7
|
[
"BSD-3-Clause"
] | 4
|
2018-09-13T20:41:22.000Z
|
2022-01-08T06:57:00.000Z
|
pirates/leveleditor/worldData/MadreDelFuegoIsland.py
|
Willy5s/Pirates-Online-Rewritten
|
7434cf98d9b7c837d57c181e5dabd02ddf98acb7
|
[
"BSD-3-Clause"
] | 26
|
2018-05-26T12:49:27.000Z
|
2021-09-11T09:11:59.000Z
|
# Embedded file name: pirates.leveleditor.worldData.DelFuegoIsland
from pandac.PandaModules import Point3, VBase3, Vec4
objectStruct = {'AmbientColors': {0: Vec4(0.496039, 0.568627, 0.67451, 1),2: Vec4(0.666667, 0.721569, 0.792157, 1),4: Vec4(0.721569, 0.611765, 0.619608, 1),6: Vec4(0.437059, 0.446471, 0.556667, 1),8: Vec4(0.389216, 0.426275, 0.569608, 1)},'DirectionalColors': {0: Vec4(0.960784, 0.913725, 0.894118, 1),2: Vec4(1, 1, 1, 1),4: Vec4(0.439216, 0.176471, 0, 1),6: Vec4(0.513726, 0.482353, 0.643137, 1),8: Vec4(0.447059, 0.439216, 0.541176, 1)},'FogColors': {0: Vec4(0.27451, 0.192157, 0.211765, 0),2: Vec4(0.894118, 0.894118, 1, 1),4: Vec4(0.231373, 0.203922, 0.184314, 0),6: Vec4(0.156863, 0.219608, 0.329412, 0),8: Vec4(0.129412, 0.137255, 0.207843, 0)},'FogRanges': {0: 0.0002,2: 0.00019999999494757503,4: 0.0004,6: 0.0004,8: 0.0002},'Interact Links': [['1176229120.0dxschafe0', '1176229120.0dxschafe1', 'Bi-directional'], ['1189471232.0dxschafe', '1189470592.0dxschafe3', 'Bi-directional'], ['1189471232.0dxschafe2', '1189470592.0dxschafe1', 'Bi-directional'], ['1189470592.0dxschafe2', '1189471232.0dxschafe0', 'Bi-directional'], ['1189471232.0dxschafe1', '1189470592.0dxschafe', 'Bi-directional']],'Locator Links': [['1158120851.05sdnaik', '1158120448.17sdnaik', 'Bi-directional'], ['1158123738.78sdnaik', '1158123603.92sdnaik', 'Bi-directional'], ['1158123997.81sdnaik', '1153509328.84sdnaik', 'Bi-directional'], ['1158123997.89sdnaik', '1167857698.22sdnaik', 'Bi-directional'], ['1164929430.19sdnaik', '1167857698.19sdnaik', 'Bi-directional'], ['1158123738.83sdnaik', '1167879276.14sdnaik', 'Bi-directional'], ['1167862588.59sdnaik', '1164929430.2sdnaik', 'Bi-directional'], ['1164929111.03sdnaik', '1158120851.09sdnaik', 'Bi-directional'], ['1167862588.55sdnaik', '1158121685.56sdnaik', 'Bi-directional'], ['1158121685.63sdnaik', '1168057131.75sdnaik', 'Bi-directional'], ['1168057131.78sdnaik', '1168057258.83sdnaik', 'Bi-directional'], ['1164929111.0sdnaik', '1168057258.8sdnaik', 'Bi-directional']],'Objects': {'1142018473.22dxschafe': {'Type': 'Island','Name': 'DelFuegoIsland.py','File': '','Objects': {'1153427017.86dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153427017.86dzlu0','Hpr': VBase3(130.005, 0.0, 0.0),'Objects': {'1200533376.0dxschafe12': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-8.035, -1.903, 0.068),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe13': {'Type': 'Door Locator Node','Name': 'door_locator_2','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(8.421, -1.743, 0.156),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-968.615, 217.242, 123.495),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_a_exterior'}},'1153427043.1dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153427043.1dzlu0','Hpr': VBase3(139.643, 0.0, 0.0),'Objects': {'1200533376.0dxschafe7': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-8.141, -3.523, -0.0),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe8': {'Type': 'Door Locator Node','Name': 'door_locator_2','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(12.344, -2.798, -0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-945.194, 177.092, 126.255),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_g_exterior'}},'1153430563.72dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153430563.72dzlu0','Hpr': VBase3(131.177, 0.0, 0.0),'Objects': {'1200533376.0dxschafe43': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-3.491, -7.864, -0.03),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-926.762, 158.614, 128.033),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_d_exterior'}},'1153430674.19dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153430674.19dzlu0','Hpr': VBase3(153.976, 0.0, 0.0),'Objects': {'1200533376.0dxschafe2': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-8.035, -1.903, 0.068),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe3': {'Type': 'Door Locator Node','Name': 'door_locator_2','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(8.421, -1.743, 0.156),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-873.97, 127.58, 131.229),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_shanty_guildhall','Model': 'models/buildings/spanish_npc_house_a_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153430734.73dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153430734.73dzlu0','Hpr': VBase3(-36.152, -0.284, 0.0),'Objects': {'1200533376.0dxschafe61': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-3.491, -7.864, -0.03),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-1049.769, 163.272, 79.459),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_spanish_npc','Model': 'models/buildings/spanish_npc_house_d_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153430887.13dzlu': {'Type': 'Building Exterior','File': 'del_fuego_building_int_barber_1','ExtUid': '1153430887.13dzlu0','Hpr': VBase3(-34.516, 0.0, 0.0),'Objects': {'1200533376.0dxschafe28': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-7.141, -11.488, 0.006),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-929.95, 92.922, 94.773),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_o_exterior','SignFrame': 'models/buildings/sign1_spanish_b_frame','SignImage': 'models/buildings/sign1_eng_a_icon_barber'}},'1153431088.58dzlu': {'Type': 'Wall','Hpr': VBase3(-47.965, 0.0, 0.0),'Pos': Point3(-958.697, 188.816, 123.865),'Scale': VBase3(1.105, 1.105, 1.105),'Visual': {'Model': 'models/buildings/TallWallStone_Broken10'}},'1153431227.81dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153431227.81dzlu0','Hpr': VBase3(-127.804, 2.01, -1.283),'Objects': {'1200533376.0dxschafe53': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-0.152, -8.067, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-986.853, 115.637, 89.022),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/navy_jail_interior','Model': 'models/buildings/spanish_npc_house_e_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153434069.63dzlu': {'Type': 'Wall','Hpr': VBase3(-29.274, 0.0, 0.0),'Pos': Point3(-1038.334, 158.517, 78.57),'Scale': VBase3(1.105, 1.105, 1.105),'Visual': {'Model': 'models/buildings/TallWallStone_Broken10'}},'1153434458.97dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153434458.97dzlu0','Hpr': VBase3(-42.911, 3.963, 0.477),'Objects': {'1200533376.0dxschafe35': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-0.152, -8.067, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-1168.508, 322.217, 68.283),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_e_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153434600.3dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153434600.3dzlu0','Hpr': VBase3(-14.071, 0.0, 0.0),'Objects': {'1200533376.0dxschafe30': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-0.424, -10.271, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-1157.088, 300.039, 69.597),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/navy_jail_interior','Model': 'models/buildings/spanish_npc_house_i_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153434762.53dzlu': {'Type': 'Building Exterior','File': 'del_fuego_building_int_tavern_2','ExtUid': '1153434762.53dzlu0','Hpr': VBase3(-44.911, -0.005, 0.0),'Objects': {'1153434762.58dzlu': {'Type': 'Locator Node','Name': 'portal_exterior_1','GridPos': Point3(-1036.776, 143.736, 87.18),'Hpr': VBase3(-90.0, 0.0, 0.0),'Pos': Point3(26.442, -16.638, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe62': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(26.732, -16.596, -0.001),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-1094.166, 214.937, 75.032),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_tavern','Model': 'models/buildings/spanish_tavern_exterior','SignFrame': 'models/buildings/sign1_spanish_c_frame','SignImage': 'models/buildings/sign1_eng_a_icon_tavern'}},'1153434880.63dzlu': {'Type': 'Building Exterior','File': 'del_fuego_building_int_tattoo_1','ExtUid': '1153434880.63dzlu0','Hpr': VBase3(-126.486, 0.0, 0.0),'Objects': {'1200533376.0dxschafe27': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-7.141, -11.488, 0.006),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-1079.696, 249.867, 77.684),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_spanish_npc','Model': 'models/buildings/spanish_npc_house_o_exterior','SignFrame': 'models/buildings/sign1_spanish_b_frame','SignImage': 'models/buildings/sign1_eng_a_icon_tattoo'}},'1153434903.61dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153434903.61dzlu0','Hpr': VBase3(-114.81, 0.779, 1.718),'Objects': {'1200533376.0dxschafe24': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-0.152, -8.067, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-1049.332, 292.88, 82.922),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_spanish_npc','Model': 'models/buildings/spanish_npc_house_e_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153434928.03dzlu': {'Type': 'Building Exterior','File': 'del_fuego_building_int_blacksmith_2','ExtUid': '1153434928.03dzlu0','Hpr': VBase3(140.891, 0.0, 0.0),'Objects': {'1200533376.0dxschafe40': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(2.885, -7.231, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-1057.341, 95.339, 80.683),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/navy_jail_interior','Model': 'models/buildings/spanish_npc_house_p_exterior','SignFrame': 'models/buildings/sign1_spanish_a_frame','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153434980.85dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153434980.85dzlu0','Hpr': VBase3(-131.092, 0.0, 0.0),'Objects': {'1200533376.0dxschafe16': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(2.885, -7.231, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-1099.747, 233.247, 74.326),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/navy_jail_interior','Model': 'models/buildings/spanish_npc_house_p_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153435103.16dzlu': {'Type': 'Building Exterior','File': 'del_fuego_building_int_tavern_1','ExtUid': '1153435103.16dzlu0','Hpr': VBase3(28.635, 0.0, 0.0),'Objects': {'1153434762.58dzlu00': {'Type': 'Locator Node','Name': 'portal_exterior_1','GridPos': Point3(-1036.776, 143.736, 87.18),'Hpr': VBase3(-90.0, 0.0, 0.0),'Pos': Point3(26.442, -16.638, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe37': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(26.732, -16.596, -0.001),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-878.397, 70.516, 102.448),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_tavern_b','Model': 'models/buildings/spanish_tavern_exterior','SignFrame': 'models/buildings/sign1_spanish_c_frame','SignImage': 'models/buildings/sign1_eng_a_icon_tavern'}},'1153435251.58dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153435251.58dzlu0','Hpr': VBase3(23.65, -4.938, -1.514),'Objects': {'1200533376.0dxschafe32': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-0.152, -8.067, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-906.19, 69.836, 97.152),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_e_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153435388.6dzlu': {'Type': 'Building Exterior','File': 'del_fuego_building_int_jeweler_1','ExtUid': '1153435388.6dzlu0','Hpr': VBase3(-84.235, 0.0, 0.0),'Objects': {'1200533376.0dxschafe38': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-3.491, -7.864, -0.03),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-798.232, 40.365, 102.841),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_d_exterior','SignFrame': 'models/buildings/sign1_spanish_b_frame','SignImage': 'models/buildings/sign1_eng_a_icon_jeweler'}},'1153435428.14dzlu': {'Type': 'Building Exterior','File': 'del_fuego_building_int_blacksmith_1','ExtUid': '1153435428.14dzlu0','Hpr': VBase3(-45.853, 0.151, -0.418),'Objects': {'1200533376.0dxschafe34': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(0.816, -10.166, -0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-780.761, 20.239, 107.52),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_mansion_gov','Model': 'models/buildings/spanish_npc_house_k_exterior','SignFrame': 'models/buildings/sign1_spanish_b_frame','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153435636.19dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153435636.19dzlu0','Hpr': VBase3(-43.94, 0.0, 0.0),'Objects': {'1200533376.0dxschafe45': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-15.63, -2.321, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe46': {'Type': 'Door Locator Node','Name': 'door_locator_2','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(1.022, -2.942, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe47': {'Type': 'Door Locator Node','Name': 'door_locator_3','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(16.298, -2.671, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-690.858, 84.311, 112.433),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_j_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153435760.44dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153435760.44dzlu0','Hpr': VBase3(46.238, 0.0, 0.0),'Objects': {'1200533376.0dxschafe11': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(0.816, -10.166, -0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-751.272, 106.476, 112.342),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_k_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153435842.17dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153435842.17dzlu0','Hpr': VBase3(136.307, 0.0, 0.0),'Objects': {'1200533376.0dxschafe52': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(2.885, -7.231, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-754.949, 74.973, 111.785),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_p_exterior'}},'1153435903.89dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153435903.89dzlu0','Hpr': VBase3(-176.045, 0.0, 0.0),'Objects': {'1200533376.0dxschafe49': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(2.885, -7.231, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-837.155, 120.308, 131.997),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_p_exterior'}},'1153436006.19dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153436006.19dzlu0','Hpr': VBase3(-138.42, -1.151, -3.494),'Objects': {'1200533376.0dxschafe54': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-7.141, -11.488, 0.006),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-787.642, -189.663, 162.085),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_o_exterior'}},'1153436023.94dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153436023.94dzlu0','Hpr': VBase3(-78.645, 0.0, 0.0),'Objects': {'1200533376.0dxschafe58': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-3.491, -7.864, -0.03),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-798.107, -229.038, 166.212),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_d_exterior'}},'1153436035.52dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153436035.52dzlu0','Hpr': VBase3(-162.646, 0.0, 0.0),'Objects': {'1200533376.0dxschafe59': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(0.816, -10.166, -0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-796.663, -305.167, 167.874),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_k_exterior'}},'1153436052.28dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153436052.28dzlu0','Hpr': VBase3(103.495, 0.0, 0.0),'Objects': {'1200533376.0dxschafe18': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(2.885, -7.231, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-805.251, -248.337, 167.547),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_p_exterior'}},'1153436073.35dzlu': {'Type': 'Building Exterior','File': 'del_fuego_building_int_weapons_1','ExtUid': '1153436073.35dzlu0','Hpr': VBase3(179.7, 0.0, 0.0),'Objects': {'1200533376.0dxschafe60': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(2.885, -7.231, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-803.956, -52.459, 106.265),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_mansion_gov','Model': 'models/buildings/spanish_npc_house_p_exterior','SignFrame': 'models/buildings/sign1_spanish_a_frame','SignImage': 'models/buildings/sign1_eng_a_icon_weapons'}},'1153436123.61dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153436123.61dzlu0','Hpr': VBase3(-127.808, 0.0, 0.0),'Objects': {'1200533376.0dxschafe51': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-7.141, -11.488, 0.006),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-775.395, -39.709, 108.246),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_shanty_guildhall','Model': 'models/buildings/spanish_npc_house_o_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153436162.31dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153436162.31dzlu0','Hpr': VBase3(-125.446, 0.0, 0.0),'Objects': {'1200533376.0dxschafe20': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-8.035, -1.903, 0.068),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe21': {'Type': 'Door Locator Node','Name': 'door_locator_2','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(8.421, -1.743, 0.156),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-841.72, -353.512, 108.559),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_a_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153436182.45dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153436182.45dzlu0','Hpr': VBase3(154.887, 0.0, 0.0),'Objects': {'1200533376.0dxschafe64': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-7.141, -11.488, 0.006),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-921.676, -356.672, 106.21),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_shanty_guildhall','Model': 'models/buildings/spanish_npc_house_o_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153436381.55dzlu': {'Type': 'Building Exterior','File': 'del_fuego_building_int_tailor_1','ExtUid': '1153436381.55dzlu0','Hpr': VBase3(-118.017, 0.0, 0.0),'Objects': {'1200533376.0dxschafe36': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(2.885, -7.231, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-842.924, -278.796, 106.211),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_p_exterior','SignFrame': 'models/buildings/sign1_spanish_a_frame','SignImage': 'models/buildings/sign1_eng_a_icon_tailor'}},'1153436398.13dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153436398.13dzlu0','Hpr': VBase3(133.912, 0.0, 0.0),'Objects': {'1200533376.0dxschafe63': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-3.491, -7.864, -0.03),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-951.843, -334.321, 106.246),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_d_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153436426.8dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153436426.8dzlu0','Hpr': VBase3(-55.945, 0.0, 0.0),'Objects': {'1200533376.0dxschafe39': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(0.816, -10.166, -0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-851.2, -196.762, 107.411),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_k_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153436556.14dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153436556.14dzlu0','Hpr': VBase3(-75.45, 0.0, 0.0),'Objects': {'1200533376.0dxschafe10': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-7.141, -11.488, 0.006),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-839.222, -249.433, 106.123),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_o_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153436814.2dzlu': {'Type': 'Fountain','DisableCollision': False,'Hpr': VBase3(69.255, 0.0, 0.0),'Pos': Point3(-895.654, -307.571, 106.246),'Scale': VBase3(0.515, 0.515, 0.515),'Visual': {'Model': 'models/props/spanishtown_fountain'}},'1153436900.97dzlu': {'Type': 'Shanty Tents','Hpr': VBase3(19.86, -4.093, -7.161),'Pos': Point3(-972.273, -185.44, 88.079),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (1.0, 0.93, 0.7568627450980392, 1.0),'Model': 'models/buildings/3shanty_tents'}},'1153436923.03dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153436923.03dzlu0','Hpr': VBase3(-129.565, 0.0, 0.0),'Objects': {'1200533376.0dxschafe41': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(2.885, -7.231, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-927.595, -220.169, 94.809),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_mansion_gov','Model': 'models/buildings/spanish_npc_house_p_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153437235.45dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153437235.45dzlu0','Hpr': VBase3(-119.147, 0.0, 0.0),'Pos': Point3(-955.843, 488.706, 96.322),'Scale': VBase3(1.604, 1.604, 1.604),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/burned_half_house'}},'1153437283.31dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153437283.31dzlu0','Hpr': VBase3(-157.187, 0.0, 0.0),'Pos': Point3(-965.666, 440.141, 96.126),'Scale': VBase3(1.178, 1.178, 1.178),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/burned_house'}},'1153437295.8dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153437295.8dzlu0','Hpr': VBase3(-45.983, 0.0, 0.0),'Pos': Point3(-1008.233, 363.952, 91.717),'Scale': VBase3(1.561, 1.561, 1.561),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/burned_gate','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153437376.53dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153437376.53dzlu0','Hpr': VBase3(62.942, 1.131, 0.0),'Pos': Point3(-1025.4, 579.465, 95.908),'Scale': VBase3(4.471, 4.471, 4.471),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/navy_jail_interior','Model': 'models/buildings/burned_woods'}},'1153437552.45dzlu': {'Type': 'Building Exterior','File': 'del_fuego_building_int_weapons_2','ExtUid': '1153437552.45dzlu0','Hpr': VBase3(97.614, -2.758, -2.886),'Objects': {'1200533376.0dxschafe55': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-0.152, -8.067, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-1150.002, 152.733, 61.581),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/navy_jail_interior','Model': 'models/buildings/spanish_npc_house_e_exterior','SignFrame': 'models/buildings/sign1_spanish_a_frame','SignImage': 'models/buildings/sign1_eng_a_icon_weapons'}},'1153437585.28dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153437585.28dzlu0','Hpr': VBase3(149.338, 0.0, 0.0),'Objects': {'1200533376.0dxschafe25': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(2.885, -7.231, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-1181.093, 208.546, 64.937),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_mansion_gov','Model': 'models/buildings/spanish_npc_house_p_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153437658.0dzlu': {'Type': 'Arch','Hpr': VBase3(0.741, 0.0, 0.0),'Pos': Point3(-1192.706, 338.095, 65.871),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.699999988079071, 0.699999988079071, 0.699999988079071, 1.0),'Model': 'models/buildings/smallstucco_arch'}},'1153437866.02dzlu': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(78.62, -27.312, 0.0),'Pos': Point3(-1227.625, 236.813, 63.471),'Scale': VBase3(2.024, 2.024, 2.024),'Visual': {'Color': (1.0, 1.0, 1.0, 1.0),'Model': 'models/props/zz_dont_use_rock_Dk_4F'}},'1153439434.77dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153439434.77dzlu0','Hpr': VBase3(-28.816, 0.0, 0.0),'Objects': {'1200533376.0dxschafe4': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(0.816, -10.166, -0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-1025.427, 149.421, 82.667),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_k_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153439501.56dzlu': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-1013.92, 143.591, 82.917),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_c'}},'1153439512.64dzlu': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(-52.559, 10.275, 0.0),'Pos': Point3(-987.504, 135.856, 91.725),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_c'}},'1153439562.8dzlu': {'Type': 'Tree','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-995.877, 139.014, 91.626),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_d'}},'1153439589.61dzlu': {'Type': 'Arch','Hpr': VBase3(4.554, 0.0, 0.0),'Pos': Point3(-1110.871, 140.525, 68.296),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/spanish_archA'}},'1153441219.3dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153441219.3dzlu0','Hpr': VBase3(-64.849, 0.0, 0.0),'Objects': {'1200533376.0dxschafe17': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(0.816, -10.166, -0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-848.483, -301.596, 106.217),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_k_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153441633.03dzlu': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(-51.535, 1.11, 1.589),'Pos': Point3(-914.609, -206.723, 94.015),'Scale': VBase3(0.373, 0.373, 0.373),'Visual': {'Model': 'models/props/madre_mound_small'}},'1153442729.95dzlu': {'Type': 'Locator Node','Name': 'portal_exterior_1','Hpr': VBase3(-90.0, 0.0, 0.0),'Pos': Point3(26.442, -16.638, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)},'1153443230.38dzlu': {'Type': 'Arch','Hpr': VBase3(-78.612, 0.0, 0.0),'Pos': Point3(-918.178, 42.726, 95.65),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/spanish_archB'}},'1153443320.44dzlu': {'Type': 'Arch','Hpr': VBase3(53.324, 0.0, 0.0),'Pos': Point3(-1001.912, 96.589, 86.276),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/spanish_archB'}},'1153443854.47dzlu': {'Type': 'Arch','Hpr': VBase3(-78.612, 0.0, 0.0),'Pos': Point3(-772.052, -6.489, 106.052),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/spanish_archB'}},'1153443938.06dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153443938.06dzlu0','Hpr': VBase3(45.829, 0.0, 0.0),'Objects': {'1200533376.0dxschafe14': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-8.035, -1.903, 0.068),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe15': {'Type': 'Door Locator Node','Name': 'door_locator_2','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(8.421, -1.743, 0.156),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-744.097, 52.96, 112.342),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_a_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153444094.69dzlu': {'Type': 'Arch','Hpr': VBase3(116.241, 0.0, 0.0),'Pos': Point3(-862.299, -39.167, 100.068),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/spanish_archB'}},'1153444176.56dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153444176.56dzlu0','Hpr': VBase3(-59.38, 4.19, -2.379),'Objects': {},'Pos': Point3(-1076.111, -205.66, 77.948),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/navy_jail_interior','Model': 'models/buildings/shanty_repairshop_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153444546.22dzlu': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-1232.22, 156.649, 54.896),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_c'}},'1153444554.22dzlu': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, 11.062),'Pos': Point3(-1228.592, 162.203, 54.362),'Scale': VBase3(0.692, 0.692, 0.692),'Visual': {'Model': 'models/vegetation/fern_tree_c'}},'1153444556.45dzlu': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(-18.634, 0.0, 0.0),'Pos': Point3(-1229.308, 151.33, 53.017),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_c'}},'1153500451.36dzlu': {'Type': 'Shanty Tents','Hpr': VBase3(-60.711, 1.861, 0.561),'Pos': Point3(-887.617, -97.697, 98.673),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/3shanty_tents'}},'1153500493.92dzlu': {'Type': 'Shanty Tents','Hpr': VBase3(-151.3, 2.002, 6.12),'Pos': Point3(-961.763, -241.205, 89.002),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.97, 0.93, 1.0, 1.0),'Model': 'models/buildings/6shanty_tents'}},'1153500516.7dzlu': {'Type': 'Shanty Tents','Hpr': VBase3(126.603, -2.327, 2.105),'Pos': Point3(-1038.3, -203.507, 81.195),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6, 0.6, 0.6039215686274509, 1.0),'Model': 'models/buildings/6shanty_tents'}},'1153500581.08dzlu': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-988.206, -258.112, 85.024),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_c'}},'1153500606.09dzlu': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-839.489, -310.059, 106.082),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_c'}},'1153507305.2dzlu': {'Type': 'Building Exterior','File': 'del_fuego_npc_house_interior_5','ExtUid': '1153507305.2dzlu0','Hpr': VBase3(-30.889, 0.0, 0.0),'Objects': {'1200533376.0dxschafe0': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(8.404, -1.766, 0.156),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe1': {'Type': 'Door Locator Node','Name': 'door_locator_2','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-8.07, -1.903, 0.068),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-957.146, 112.567, 92.086),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_spanish_npc','Model': 'models/buildings/spanish_npc_house_l_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153507825.14dzlu': {'Type': 'Wall','Hpr': VBase3(33.288, 0.0, 0.0),'Pos': Point3(-826.464, 119.394, 112.275),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/english_wall_60'}},'1153508272.11dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153508272.11dzlu0','Hpr': VBase3(-66.045, 0.0, 0.0),'Pos': Point3(-984.117, 526.041, 96.372),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/shanty_gypsywagon_exterior'}},'1153508552.43dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153508552.43dzlu0','Hpr': VBase3(68.173, -0.982, -3.869),'Objects': {'1200533376.0dxschafe42': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-0.152, -8.067, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-1214.655, 271.155, 65.35),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_e_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153508657.78dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153508657.78dzlu0','Hpr': VBase3(95.296, 0.0, 0.0),'Objects': {'1200533376.0dxschafe66': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-4.482, -5.123, -0.112),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-1165.638, 173.599, 62.275),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/spanish_npc_house_b_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153509328.84sdnaik': {'Type': 'Locator Node','Name': 'portal_exterior_1','Hpr': VBase3(-68.015, 0.0, 0.0),'Pos': Point3(530.137, -1106.49, 37.792),'Scale': VBase3(1.0, 1.0, 1.0)},'1153777653.46dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153777653.46dzlu0','Hpr': VBase3(-20.923, 1.205, -0.35),'Objects': {'1154560298.86dxschafe0': {'Type': 'Locator Node','Name': 'portal_exterior_1','GridPos': Point3(677.421, -1233.262, 80.682),'Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-0.277, -13.756, 1.023),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe9': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-0.819, -13.822, 1.347),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(665.181, -1223.32, 32.397),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Color': (0.57, 0.57, 0.42745098039215684, 1.0),'Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_shanty_guildhall','Model': 'models/buildings/shanty_npc_house_combo_A','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153777676.87dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153777676.87dzlu0','Hpr': VBase3(-33.94, 0.0, 0.0),'Objects': {'1157148512.79dxschafe': {'Type': 'Cacti','DisableCollision': False,'GridPos': Point3(810.583, -1341.909, 19.939),'Hpr': VBase3(71.346, 0.553, -1.817),'Pos': Point3(9.118, 9.264, 0.667),'Scale': VBase3(1.562, 1.562, 1.562),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1200533376.0dxschafe44': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(0.161, -4.399, 16.391),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(797.846, -1344.504, 19.272),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Color': (0.55, 0.53, 0.4549019607843137, 1.0),'Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/navy_jail_interior','Model': 'models/buildings/shanty_npc_house_combo_E','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153777696.89dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153777696.89dzlu0','Hpr': VBase3(-49.483, 1.972, 1.513),'Objects': {'1156383083.42dxschafe': {'Type': 'Cart','DisableCollision': False,'GridPos': Point3(733.196, -1328.031, 25.177),'Hpr': VBase3(115.304, 0.0, 0.0),'Pos': Point3(13.979, 7.673, -0.024),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cart_broken'}},'1200533376.0dxschafe29': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(0.044, -4.421, 4.89),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(718.278, -1322.399, 25.306),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Color': (0.45, 0.44, 0.5686274509803921, 1.0),'Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_shanty_guildhall','Model': 'models/buildings/shanty_npc_house_combo_I','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153777776.85dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153777776.85dzlu0','Hpr': VBase3(-74.063, 0.0, 0.0),'Objects': {},'Pos': Point3(709.995, -1287.918, 29.809),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Color': (0.44, 0.49, 0.5568627450980392, 1.0),'Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/shanty_npc_house_combo_D','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153777833.68dzlu': {'Type': 'Building Exterior','File': 'del_fuego_building_int_tavern_3','ExtUid': '1153777833.68dzlu0','Hpr': VBase3(36.514, 0.0, 0.0),'Objects': {'1153777833.7dzlu': {'Type': 'Locator Node','Name': 'portal_exterior_1','GridPos': Point3(644.294, -1348.51, 67.997),'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-0.365, -5.213, 0.955),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe22': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-179.829, 0.0, 0.0),'Pos': Point3(-0.498, -4.479, 0.952),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe23': {'Type': 'Door Locator Node','Name': 'door_locator_2','Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-6.626, 20.841, 1.006),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(567.273, -1253.069, 30.708),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Color': (0.42, 0.41, 0.3764705882352941, 1.0),'Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_tavern','Model': 'models/buildings/shanty_tavern_exterior','SignFrame': 'models/buildings/sign1_shanty_a_frame','SignImage': 'models/buildings/sign1_eng_a_icon_tavern'}},'1153777945.95dzlu': {'Type': 'Building Exterior','File': 'del_fuego_building_int_barber_2','ExtUid': '1153777945.95dzlu0','Hpr': VBase3(-2.296, 0.0, 0.0),'Objects': {'1200533376.0dxschafe19': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(0.162, -4.354, 0.599),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(761.958, -1346.33, 22.573),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Color': (0.46, 0.5019607843137255, 0.5411764705882353, 1.0),'Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_shanty_guildhall','Model': 'models/buildings/shanty_npc_house_combo_G','SignFrame': 'models/buildings/sign1_shanty_a_frame','SignImage': 'models/buildings/sign1_eng_a_icon_barber'}},'1153778017.46dzlu': {'Type': 'Building Exterior','File': 'del_fuego_building_int_tailor_2','ExtUid': '1153778017.46dzlu0','Hpr': VBase3(-27.758, 0.0, 0.0),'Objects': {'1154560297.97dxschafe': {'Type': 'Locator Node','Name': 'portal_exterior_1','GridPos': Point3(752.064, -1312.231, 94.729),'Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-0.277, -13.756, 15.717),'Scale': VBase3(1.0, 1.0, 1.0)},'1184088804.73kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'GridPos': Point3(778.503, -1312.094, 28.029),'Hpr': VBase3(89.547, 0.0, 0.0),'Pos': Point3(21.081, -1.142, -2.176),'Scale': VBase3(3.396, 2.102, 3.396),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184088842.66kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'GridPos': Point3(750.641, -1316.598, 29.688),'Hpr': VBase3(-0.255, 0.0, 0.0),'Pos': Point3(-1.477, -18.105, -0.517),'Scale': VBase3(4.401, 2.377, 3.039),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184088940.21kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'GridPos': Point3(740.505, -1288.958, 32.926),'Hpr': VBase3(-90.011, 0.0, 0.0),'Pos': Point3(-23.32, 1.634, 2.721),'Scale': VBase3(3.928, 2.591, 2.591),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1200533376.0dxschafe26': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(0.044, -13.993, 15.909),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(760.38, -1301.265, 30.205),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Color': (0.73, 0.73, 0.6666666666666666, 1.0),'Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_shanty_guildhall','Model': 'models/buildings/shanty_npc_house_combo_F','SignFrame': 'models/buildings/sign1_shanty_a_frame','SignImage': 'models/buildings/sign1_eng_a_icon_tailor'}},'1153778094.12dzlu': {'Type': 'Building Exterior','File': 'del_fuego_building_int_jeweler_2','ExtUid': '1153778094.12dzlu0','Hpr': VBase3(99.56, 0.0, 0.0),'Objects': {'1200533376.0dxschafe67': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-0.179, -4.421, 4.89),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(488.366, -1300.52, 28.122),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Color': (0.52, 0.47, 0.3607843137254902, 1.0),'Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/shanty_npc_house_combo_H','SignFrame': 'models/buildings/sign1_shanty_a_frame','SignImage': 'models/buildings/sign1_eng_a_icon_jeweler'}},'1153778118.18dzlu': {'Type': 'Building Exterior','File': 'del_fuego_building_int_weapons_3','ExtUid': '1153778118.18dzlu0','Hpr': VBase3(126.638, 0.0, 0.0),'Objects': {'1154560298.86dxschafe': {'Type': 'Locator Node','Name': 'portal_exterior_1','GridPos': Point3(579.307, -1206.995, 79.663),'Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-0.277, -13.756, 1.023),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe5': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(0.41, -5.622, 0.912),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe6': {'Type': 'Door Locator Node','Name': 'door_locator_2','Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(6.973, 21.237, 1.039),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(574.632, -1205.305, 31.373),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Color': (0.5, 0.5, 0.5, 1.0),'Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_mansion_gov','Model': 'models/buildings/shanty_npc_house_combo_B','SignFrame': 'models/buildings/sign1_shanty_a_frame','SignImage': 'models/buildings/sign1_eng_a_icon_weapons'}},'1153778153.99dzlu': {'Type': 'Building Exterior','File': 'del_fuego_building_int_blacksmith_3','ExtUid': '1153778153.99dzlu0','Hpr': VBase3(27.88, 1.132, -0.733),'Objects': {'1200533376.0dxschafe33': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(0.313, -4.016, 1.444),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(520.283, -1273.821, 30.466),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Color': (0.56, 0.68, 0.7176470588235294, 1.0),'Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_mansion_gov','Model': 'models/buildings/shanty_npc_house_combo_J','SignFrame': 'models/buildings/sign1_shanty_a_frame','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153778248.93dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153778248.93dzlu0','Hpr': VBase3(152.199, 0.0, 0.0),'Objects': {'1157148830.25dxschafe': {'Type': 'Cacti','DisableCollision': False,'GridPos': Point3(579.401, -1334.034, 25.833),'Hpr': VBase3(-83.059, 2.028, -3.453),'Pos': Point3(-14.881, -5.391, 1.684),'Scale': VBase3(1.699, 1.699, 1.699),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}}},'Pos': Point3(563.723, -1331.862, 24.149),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Color': (0.77, 0.65, 0.6352941176470588, 1.0),'Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/shanty_npc_house_combo_D','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153778337.46dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153778337.46dzlu0','Hpr': VBase3(121.669, -2.094, -3.222),'Objects': {'1157148899.28dxschafe': {'Type': 'Cacti','DisableCollision': False,'GridPos': Point3(496.268, -1328.61, 26.868),'Hpr': VBase3(-33.564, -0.035, -1.736),'Pos': Point3(9.715, 5.645, -0.269),'Scale': VBase3(1.51, 1.51, 1.51),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1200533376.0dxschafe50': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(0.161, -4.399, 16.391),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(506.178, -1333.911, 26.797),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Color': (0.43, 0.49, 0.5725490196078431, 1.0),'Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/shanty_npc_house_combo_E','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1153778377.37dzlu': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(65.895, 8.305, -5.677),'Pos': Point3(549.127, -1338.263, 24.923),'Scale': VBase3(2.376, 2.376, 2.376),'Visual': {'Model': 'models/props/zz_dont_use_rock_Dk_1F'}},'1153778390.65dzlu': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(95.977, 0.0, 0.0),'Objects': {},'Pos': Point3(579.358, -1230.962, 29.882),'Scale': VBase3(3.18, 3.18, 3.18),'Visual': {'Model': 'models/props/zz_dont_use_rock_Dk_1F'}},'1153778420.49dzlu': {'Type': 'Rock','DisableCollision': True,'GridPos': Point3(585.778, -1238.827, 30.476),'Hpr': VBase3(-148.3, 0.0, 0.0),'Objects': {},'Pos': Point3(585.778, -1238.827, 30.476),'Scale': VBase3(2.55, 2.55, 2.55),'Visual': {'Model': 'models/props/zz_dont_use_rock_Dk_4F'}},'1153778450.01dzlu': {'Type': 'Rock','DisableCollision': True,'GridPos': Point3(582.592, -1238.562, 77.601),'Hpr': VBase3(-74.325, 0.0, 0.0),'Objects': {},'Pos': Point3(579.871, -1239.119, 30.354),'Scale': VBase3(3.79, 3.79, 3.79),'Visual': {'Model': 'models/props/zz_dont_use_rock_Dk_4F'}},'1153778520.39dzlu': {'Type': 'Well','DisableCollision': False,'Hpr': VBase3(54.923, 0.0, 0.0),'Pos': Point3(600.425, -1250.422, 30.363),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/wellA'}},'1153778557.87dzlu': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(0.0, 5.322, 0.0),'Pos': Point3(564.144, -1112.307, 37.721),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_a'}},'1153778566.73dzlu': {'Type': 'Bush','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(486.267, -1279.704, 30.133),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_a'}},'1153778611.01dzlu': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(-65.551, 0.0, 0.0),'Pos': Point3(707.692, -1308.691, 28.562),'Scale': VBase3(1.198, 1.198, 1.198),'Visual': {'Model': 'models/vegetation/bush_g'}},'1153778638.7dzlu': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(31.854, 0.0, 0.0),'Pos': Point3(776.692, -1339.735, 21.215),'Scale': VBase3(1.198, 1.198, 1.198),'Visual': {'Model': 'models/vegetation/bush_g'}},'1153778672.26dzlu': {'Type': 'Bush','DisableCollision': True,'GridPos': Point3(586.225, -1230.262, 30.773),'Hpr': VBase3(73.168, 0.0, 0.0),'Pos': Point3(586.182, -1230.651, 30.148),'Scale': VBase3(1.409, 1.409, 1.409),'Visual': {'Model': 'models/vegetation/bush_g'}},'1153778975.64dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153778975.64dzlu0','Hpr': VBase3(12.001, 0.0, 0.0),'Pos': Point3(614.736, -1182.143, 33.606),'Scale': VBase3(1.151, 1.151, 1.151),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/burned_gate'}},'1153778993.74dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153778993.74dzlu0','Hpr': VBase3(44.631, 0.762, -0.063),'Pos': Point3(631.861, -1184.438, 33.741),'Scale': VBase3(1.749, 1.749, 1.749),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/burned_woods'}},'1153779024.62dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153779024.62dzlu0','Hpr': VBase3(105.322, 0.318, -0.696),'Pos': Point3(644.296, -1167.157, 34.919),'Scale': VBase3(2.181, 2.181, 2.181),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/burned_woods'}},'1153779071.14dzlu': {'Type': 'Building Exterior','File': '','ExtUid': '1153779071.14dzlu0','Hpr': VBase3(38.477, 2.27, -0.698),'Pos': Point3(510.734, -1363.456, 23.857),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Model': 'models/buildings/burned_house'}},'1153848061.84sdnaik': {'Type': 'Locator Node','Name': 'portal_exterior_1','Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-0.365, -5.213, 0.955),'Scale': VBase3(1.0, 1.0, 1.0)},'1154564157.01dxschafe': {'Type': 'Simple Fort','Hpr': VBase3(109.259, 0.0, 0.0),'Objects': {'1156183483.02dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1567.901, -699.881, 150.183),'Hpr': VBase3(-135.117, 0.0, 0.0),'Pos': Point3(69.725, 134.51, 0.0),'Scale': VBase3(0.877, 0.877, 0.877),'Visual': {'Model': 'models/props/barrel_group_2'}},'1156183541.79dxschafe': {'Type': 'Log_Stack','DisableCollision': False,'GridPos': Point3(-1520.16, -732.446, 150.396),'Hpr': VBase3(-87.456, 0.0, 0.0),'Pos': Point3(23.235, 100.183, 0.213),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/Log_stack_b'}},'1156183705.04dxschafe': {'Type': 'Crate','DisableCollision': False,'GridPos': Point3(-1573.487, -637.309, 150.396),'Hpr': VBase3(-68.149, 0.0, 0.0),'Pos': Point3(130.637, 119.145, 0.213),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (1.0, 1.0, 1.0, 1.0),'Model': 'models/props/crates_group_2'}},'1156183706.59dxschafe': {'Type': 'Crate','DisableCollision': False,'GridPos': Point3(-1570.679, -643.198, 150.396),'Hpr': VBase3(141.482, 0.0, 0.0),'Pos': Point3(124.152, 118.437, 0.213),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (1.0, 0.7799999713897705, 0.5299999713897705, 1.0),'Model': 'models/props/crates_group_1'}},'1156183756.57dxschafe': {'Type': 'Sack','DisableCollision': False,'GridPos': Point3(-1562.496, -663.776, 150.396),'Hpr': VBase3(174.943, 0.0, 0.0),'Pos': Point3(102.026, 117.499, 0.213),'Scale': VBase3(0.865, 0.865, 0.865),'Visual': {'Color': (0.69, 0.7, 0.5568627450980392, 1.0),'Model': 'models/props/sack_18stack'}},'1156183864.46dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1414.202, -659.391, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(57.253, -23.942, 0.0),'Scale': VBase3(0.765, 0.765, 0.765),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/barrel'}},'1157666874.71dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1507.754, -731.949, 150.396),'Hpr': VBase3(-88.771, 0.0, 0.0),'Pos': Point3(19.613, 88.307, 0.213),'Scale': VBase3(0.741, 0.741, 0.741),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/barrel_group_3'}},'1157666893.76dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1521.678, -770.339, 150.396),'Hpr': VBase3(-172.77, 0.0, 0.0),'Pos': Point3(-12.036, 114.114, 0.213),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.4000000059604645, 0.4000000059604645, 0.4000000059604645, 1.0),'Model': 'models/props/barrel_group_1'}},'1157666896.48dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1525.783, -756.961, 150.396),'Hpr': VBase3(-168.42, 0.0, 0.0),'Pos': Point3(1.947, 113.577, 0.213),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.4000000059604645, 0.4000000059604645, 0.4000000059604645, 1.0),'Model': 'models/props/barrel_group_1'}},'1157666905.9dxschafe': {'Type': 'Barrel','DisableCollision': True,'GridPos': Point3(-1616.517, -804.949, 218.051),'Hpr': VBase3(-153.8, 0.0, 0.0),'Pos': Point3(-13.428, 215.062, 67.868),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/barrel_group_1'}},'1157666910.71dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1467.327, -839.887, 197.597),'Hpr': VBase3(-172.897, 0.0, 0.0),'Pos': Point3(-95.62, 85.745, 47.414),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/barrel_group_3'}},'1157666917.42dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1397.422, -597.192, 191.855),'Hpr': VBase3(154.14, 0.0, 0.0),'Pos': Point3(110.436, -60.299, 41.672),'Scale': VBase3(0.816, 0.816, 0.816),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/barrel_sideways'}},'1157666947.56dxschafe': {'Type': 'Trellis','DisableCollision': False,'GridPos': Point3(-1471.652, -614.284, 150.396),'Hpr': VBase3(178.27, 0.0, 0.0),'Pos': Point3(118.784, 15.415, 0.213),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/trellis_d'}},'1157666986.59dxschafe': {'Type': 'Horse_trough','DisableCollision': False,'GridPos': Point3(-1458.346, -620.568, 150.183),'Hpr': VBase3(-179.759, 0.0, 0.0),'Pos': Point3(108.464, 4.926, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/horse_trough'}},'1157667037.12dxschafe': {'Type': 'Cart','DisableCollision': False,'GridPos': Point3(-1547.473, -700.377, 150.183),'Hpr': VBase3(9.177, 0.0, 0.0),'Pos': Point3(62.519, 115.389, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cart_flat'}},'1157667055.05dxschafe': {'Type': 'Cart','DisableCollision': False,'Hpr': VBase3(21.906, 0.0, 0.0),'Pos': Point3(138.791, 117.247, 0.213),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.84, 0.72, 0.43, 1.0),'Model': 'models/props/cart_flat'}},'1157667065.86dxschafe': {'Type': 'Cart','DisableCollision': False,'GridPos': Point3(-1452.826, -637.199, 150.039),'Hpr': VBase3(9.41, 0.0, -6.058),'Pos': Point3(90.943, 5.2, -0.144),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cart_reg'}},'1157667107.11dxschafe': {'Type': 'Hay','DisableCollision': False,'GridPos': Point3(-1465.588, -592.427, 148.799),'Hpr': VBase3(-77.311, -7.613, 17.072),'Pos': Point3(137.419, 2.48, -1.384),'Scale': VBase3(1.94, 1.94, 1.94),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/haystack'}},'1157667403.19dxschafe': {'Type': 'Sack','DisableCollision': False,'GridPos': Point3(-1571.768, -632.449, 153.119),'Hpr': VBase3(-158.468, 0.0, 8.593),'Pos': Point3(134.658, 115.919, 2.936),'Scale': VBase3(0.755, 0.755, 0.755),'Visual': {'Model': 'models/props/sack_6stack'}},'1170964864.0dxschafe': {'Type': 'Building Exterior','File': 'del_fuego_jail_interior','ExtUid': '1170964864.0dxschafe0','GridPos': Point3(-1550.169, -742.887, 150.903),'Hpr': VBase3(21.32, 0.0, 0.0),'Objects': {'1200533376.0dxschafe48': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(12.899, -22.494, 0.283),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(23.277, 131.956, 0.72),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Color': (0.75, 0.75, 0.7529411764705882, 1.0),'Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/navy_jail_interior','Model': 'models/buildings/jail_exterior','SignImage': 'models/buildings/sign1_eng_a_icon_doctor'}},'1175822976.0dxschafe': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1393.423, -620.776, 150.183),'Hpr': VBase3(-92.004, 0.0, 0.0),'Pos': Point3(86.853, -56.295, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/desk_gov'},'searchTime': '10.0','type': 'Desk'},'1175823104.0dxschafe': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1379.008, -639.136, 150.183),'Hpr': VBase3(88.272, 0.0, 0.0),'Pos': Point3(64.766, -63.848, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.4000000059604645, 0.4000000059604645, 0.4000000059604645, 1.0),'Model': 'models/props/bookshelf_fancy'},'searchTime': '10.0','type': 'Bookshelf'},'1175823104.0dxschafe0': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1409.381, -644.022, 150.183),'Hpr': VBase3(6.6, 0.0, 0.0),'Pos': Point3(70.172, -33.562, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/cabinet_fancy_low'},'searchTime': '10.0','type': 'Cabinet'},'1175823232.0dxschafe1': {'Type': 'Furniture - Fancy','DisableCollision': True,'GridPos': Point3(-1374.882, -637.577, 150.183),'Hpr': VBase3(92.79, 0.0, 0.0),'Pos': Point3(64.876, -68.257, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/bookshelf_fancy'}},'1175823232.0dxschafe3': {'Type': 'Furniture - Fancy','DisableCollision': True,'GridPos': Point3(-1383.138, -640.499, 150.116),'Hpr': VBase3(88.686, 0.0, 0.0),'Pos': Point3(64.841, -59.499, -0.067),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/bookshelf_fancy'}},'1175823360.0dxschafe': {'Type': 'Furniture - Fancy','DisableCollision': False,'GridPos': Point3(-1395.957, -644.341, 150.085),'Hpr': VBase3(92.458, 0.0, 0.0),'Pos': Point3(65.443, -46.131, -0.098),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/cabinet_fancy_low'}},'1175823360.0dxschafe0': {'Type': 'Furniture - Fancy','DisableCollision': False,'GridPos': Point3(-1376.896, -623.318, 150.183),'Hpr': VBase3(179.672, 0.0, 0.0),'Pos': Point3(79.003, -71.059, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/cabinet_fancy_tall'}},'1175823488.0dxschafe': {'Type': 'Furniture - Fancy','DisableCollision': False,'GridPos': Point3(-1391.402, -626.04, 150.183),'Hpr': VBase3(103.957, 0.0, 0.0),'Pos': Point3(81.217, -56.467, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/chair_fancy'}},'1175823488.0dxschafe0': {'Type': 'Furniture - Fancy','DisableCollision': False,'GridPos': Point3(-1393.127, -621.462, 150.223),'Hpr': VBase3(86.471, 0.0, 0.0),'Pos': Point3(86.108, -56.348, 0.04),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/rug_oriental'}},'1175823488.0dxschafe2': {'Type': 'Furniture - Fancy','DisableCollision': False,'GridPos': Point3(-1406.802, -628.538, 150.304),'Hpr': VBase3(0.903, 0.0, 0.0),'Pos': Point3(83.938, -41.105, 0.121),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.699999988079071, 0.699999988079071, 0.699999988079071, 1.0),'Model': 'models/props/rug_oriental'}},'1175823488.0dxschafe3': {'Type': 'Furniture - Fancy','DisableCollision': True,'GridPos': Point3(-1411.896, -630.745, 150.183),'Hpr': VBase3(3.146, 0.0, 0.0),'Pos': Point3(83.535, -35.568, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/sofa_fancy'}},'1175823616.0dxschafe': {'Type': 'Furniture - Fancy','DisableCollision': False,'GridPos': Point3(-1403.542, -632.791, 150.183),'Hpr': VBase3(136.527, 0.0, 0.0),'Pos': Point3(78.848, -42.779, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/chair_fancy'}},'1175823616.0dxschafe0': {'Type': 'Furniture - Fancy','DisableCollision': False,'GridPos': Point3(-1406.608, -623.697, 150.183),'Hpr': VBase3(-134.846, 0.0, 0.0),'Pos': Point3(88.444, -42.885, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/chair_fancy'}},'1175823616.0dxschafe1': {'Type': 'Furniture - Fancy','DisableCollision': False,'GridPos': Point3(-1388.092, -641.691, 150.183),'Hpr': VBase3(90.473, 0.0, 0.0),'Pos': Point3(65.35, -54.429, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/chair_fancy'}},'1175823744.0dxschafe': {'Type': 'Furniture - Fancy','DisableCollision': False,'GridPos': Point3(-1380.373, -620.357, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(82.945, -68.753, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/stool_fancy'}},'1175823744.0dxschafe0': {'Type': 'Furniture - Fancy','DisableCollision': False,'GridPos': Point3(-1401.736, -646.797, 150.183),'Hpr': VBase3(92.172, 0.0, 0.0),'Pos': Point3(65.03, -39.864, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/clock_fancy_tall'}},'1175823744.0dxschafe1': {'Type': 'Furniture - Fancy','DisableCollision': False,'GridPos': Point3(-1418.667, -622.011, 150.183),'Hpr': VBase3(2.92, 0.0, 0.0),'Pos': Point3(94.014, -32.057, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cabinet_fancy_tall'}},'1175823872.0dxschafe': {'Type': 'Interior_furnishings','DisableCollision': False,'GridPos': Point3(-1374.507, -628.368, 150.183),'Hpr': VBase3(178.983, 0.0, 0.0),'Pos': Point3(73.447, -71.649, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/interior_wall_fort'}},'1175824000.0dxschafe': {'Type': 'Interior_furnishings','DisableCollision': False,'GridPos': Point3(-1381.598, -606.06, 150.183),'Hpr': VBase3(178.367, 0.0, 0.0),'Pos': Point3(96.845, -72.312, 0.0),'Scale': VBase3(1.133, 1.0, 1.0),'Visual': {'Model': 'models/props/interior_wall_fort'}},'1175824000.0dxschafe0': {'Type': 'Interior_furnishings','DisableCollision': False,'GridPos': Point3(-1380.283, -640.855, 150.183),'Hpr': VBase3(-89.931, 0.0, 0.0),'Pos': Point3(63.564, -62.077, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/interior_wall_fort'}},'1175824000.0dxschafe1': {'Type': 'Interior_furnishings','DisableCollision': False,'GridPos': Point3(-1400.37, -648.045, 150.183),'Hpr': VBase3(-88.242, 0.0, 0.0),'Pos': Point3(63.402, -40.743, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/interior_wall_fort'}},'1175824000.0dxschafe2': {'Type': 'Interior_furnishings','DisableCollision': False,'GridPos': Point3(-1413.806, -639.456, 150.183),'Hpr': VBase3(-0.163, 0.0, 0.0),'Pos': Point3(75.941, -30.891, 0.0),'Scale': VBase3(1.121, 1.0, 1.0),'Visual': {'Model': 'models/props/interior_wall_fort'}},'1175824000.0dxschafe3': {'Type': 'Interior_furnishings','DisableCollision': False,'GridPos': Point3(-1422.481, -616.844, 150.183),'Hpr': VBase3(1.779, 0.0, 0.0),'Pos': Point3(100.15, -30.16, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/interior_wall_fort'}},'1175824128.0dxschafe': {'Type': 'Interior_furnishings','DisableCollision': False,'GridPos': Point3(-1395.573, -596.068, 150.183),'Hpr': VBase3(-93.487, 0.0, 0.0),'Pos': Point3(110.888, -62.415, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/interior_wall_fort_brick'}},'1175824128.0dxschafe0': {'Type': 'Interior_furnishings','DisableCollision': False,'GridPos': Point3(-1422.149, -605.698, 150.183),'Hpr': VBase3(-89.027, 0.0, 0.0),'Pos': Point3(110.562, -34.15, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/interior_wall_fort_brick'}},'1175824256.0dxschafe': {'Type': 'Crate','DisableCollision': False,'GridPos': Point3(-1392.183, -587.434, 150.183),'Hpr': VBase3(-113.482, 0.0, 0.0),'Pos': Point3(117.92, -68.463, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.49, 0.45, 0.30980392156862746, 1.0),'Model': 'models/props/crates_group_1'}},'1175824512.0dxschafe': {'Type': 'Wall_Hangings','GridPos': Point3(-1396.547, -597.34, 159.611),'Hpr': VBase3(-93.857, 0.349, -0.015),'Pos': Point3(110.008, -61.076, 9.428),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/Map_01'}},'1175824512.0dxschafe0': {'Type': 'Wall_Hangings','GridPos': Point3(-1415.175, -632.515, 160.38),'Hpr': VBase3(-179.327, -3.535, -0.052),'Pos': Point3(82.946, -31.888, 10.197),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/seascape_battle'}},'1175824512.0dxschafe1': {'Type': 'Wall_Hangings','GridPos': Point3(-1395.056, -645.135, 161.121),'Hpr': VBase3(-89.082, 0.0, 0.0),'Pos': Point3(64.396, -46.719, 10.938),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/Map_02'}},'1175824512.0dxschafe2': {'Type': 'Wall_Hangings','GridPos': Point3(-1382.174, -604.165, 159.114),'Hpr': VBase3(-2.987, 0.0, 0.0),'Pos': Point3(98.824, -72.394, 8.931),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/Map_03'}},'1175824768.0dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1422.457, -600.579, 150.183),'Hpr': VBase3(-97.772, 0.0, 0.0),'Pos': Point3(115.496, -35.548, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/barrel_group_1'}},'1175824768.0dxschafe0': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1396.369, -592.004, 150.183),'Hpr': VBase3(-169.846, 0.0, 0.0),'Pos': Point3(114.987, -63.004, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.47, 0.43, 0.3254901960784314, 1.0),'Model': 'models/props/crate_04'},'searchTime': '10.0','type': 'Crate'},'1175824768.0dxschafe1': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1429.337, -590.678, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(127.113, -32.319, 0.0),'Scale': VBase3(0.861, 0.861, 0.861),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/barrel'},'searchTime': '10.0','type': 'Barrel'},'1175824896.0dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1432.489, -582.632, 150.128),'Hpr': VBase3(-174.135, 0.0, 0.0),'Pos': Point3(135.748, -31.997, -0.055),'Scale': VBase3(0.866, 0.866, 0.866),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/barrel_group_3'}},'1175825280.0dxschafe': {'Type': 'Location Sphere','GridPos': Point3(-1494.772, -719.267, 154.916),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(27.303, 71.869, 4.733),'Scale': VBase3(228.627, 228.627, 228.627),'Visual': {}},'1176420480.0dxschafe': {'Type': 'Movement Node','GridPos': Point3(-1437.989, -570.811, 197.394),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(148.722, -30.703, 47.211),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1176420480.0dxschafe0': {'Type': 'Movement Node','GridPos': Point3(-1352.04, -632.159, 189.288),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(62.458, -91.608, 39.105),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1176420480.0dxschafe1': {'Type': 'Movement Node','GridPos': Point3(-1414.102, -627.908, 190.232),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(86.941, -34.42, 40.049),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1176420608.0dxschafe': {'Type': 'Movement Node','GridPos': Point3(-1306.975, -768.713, 197.546),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(-81.319, -89.11, 47.363),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1176420608.0dxschafe0': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','GridPos': Point3(-1469.549, -816.081, 197.593),'Hpr': VBase3(-109.259, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': '100','Pause Duration': '30','Pos': Point3(-72.412, 79.99, 47.41),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Navy - Sergeant','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1176420608.0dxschafe1': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(200.742, 152.92, 62.667),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1176420736.0dxschafe0': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(-56.532, -44.714, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1176420736.0dxschafe1': {'Type': 'Movement Node','GridPos': Point3(-1496.508, -721.794, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(25.49, 74.341, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1176420736.0dxschafe2': {'Type': 'Movement Node','GridPos': Point3(-1579.549, -611.828, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(156.692, 116.463, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1176420992.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','GridPos': Point3(-1530.887, -562.804, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': '100','Pause Duration': '30','Pos': Point3(186.922, 54.355, 0.0),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Navy - Veteran','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1176421120.0dxschafe': {'Type': 'Movement Node','GridPos': Point3(-1425.682, -775.924, 150.23),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(-48.972, 25.333, 0.047),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1176421120.0dxschafe1': {'Type': 'Movement Node','GridPos': Point3(-1500.714, -754.363, 150.183),'Hpr': VBase3(-145.266, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(-3.869, 89.054, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1176421248.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','GridPos': Point3(-1471.165, -809.275, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': '100','Pause Duration': '30','Pos': Point3(-65.454, 79.271, 0.0),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Navy - Sergeant','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1176421248.0dxschafe0': {'Type': 'Movement Node','GridPos': Point3(-1430.262, -648.73, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(72.615, -12.297, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1176421504.0dxschafe': {'Type': 'Movement Node','GridPos': Point3(-1404.749, -566.518, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(141.811, -63.5, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1176421504.0dxschafe0': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','GridPos': Point3(-1586.889, -581.292, 150.183),'Hpr': VBase3(130.218, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': '100','Pause Duration': '30','Pos': Point3(187.94, 113.321, 0.0),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'High Navy','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1176421632.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','GridPos': Point3(-1433.979, -544.04, 196.913),'Hpr': VBase3(-109.259, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': '100','Pause Duration': '30','Pos': Point3(172.672, -43.319, 46.73),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Navy - Veteran','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1176421632.0dxschafe0': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(-96.121, -83.585, 47.354),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1176422016.0dxschafe': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(-6.269, -115.596, -0.012),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1177374848.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','GridPos': Point3(-1414.808, -582.876, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(129.686, -48.608, 0.0),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'High Navy','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1177539968.0dxschafe': {'Type': 'Searchable Container','Aggro Radius': 5.0,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(148.494, 119.294, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.88, 0.88, 0.8823529411764706, 1.0),'Model': 'models/props/barrel'},'searchTime': '10.0','type': 'Barrel'},'1177540096.0dxschafe': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1567.375, -691.034, 150.183),'Hpr': VBase3(-75.201, 0.0, 0.0),'Pos': Point3(77.904, 131.095, 0.0),'Scale': VBase3(1.385, 1.385, 1.385),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/crate_04'},'searchTime': '10.0','type': 'Crate'},'1177540096.0dxschafe0': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1514.596, -771.893, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(-15.839, 107.941, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/barrel'},'searchTime': '10.0','type': 'Barrel'},'1177540224.0dxschafe': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1320.64, -771.903, 150.183),'Hpr': VBase3(-93.962, 0.0, 0.0),'Pos': Point3(-79.823, -75.158, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.30000001192092896, 0.30000001192092896, 0.30000001192092896, 1.0),'Model': 'models/props/crate_04'},'searchTime': '10.0','type': 'Crate'},'1177540224.0dxschafe0': {'Type': 'Crate','DisableCollision': False,'GridPos': Point3(-1306.082, -783.65, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Objects': {},'Pos': Point3(-95.715, -85.026, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.4000000059604645, 0.4000000059604645, 0.4000000059604645, 1.0),'Model': 'models/props/crate'}},'1177540224.0dxschafe1': {'Type': 'Crate','DisableCollision': False,'GridPos': Point3(-1300.849, -784.65, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(-98.384, -89.636, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.30000001192092896, 0.30000001192092896, 0.30000001192092896, 1.0),'Model': 'models/props/crates_group_2'}},'1177540224.0dxschafe2': {'Type': 'Crate','DisableCollision': False,'GridPos': Point3(-1304.405, -778.474, 150.183),'Hpr': VBase3(-55.813, 0.0, 0.0),'Pos': Point3(-91.381, -88.316, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.30000001192092896, 0.30000001192092896, 0.30000001192092896, 1.0),'Model': 'models/props/crates_group_1'}},'1177540224.0dxschafe3': {'Type': 'Crate','DisableCollision': False,'GridPos': Point3(-1313.562, -775.86, 150.183),'Hpr': VBase3(141.482, 0.0, 0.0),'Pos': Point3(-85.893, -80.534, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/crates_group_2'}},'1177540224.0dxschafe4': {'Type': 'Crate','DisableCollision': False,'GridPos': Point3(-1319.152, -764.48, 150.183),'Hpr': VBase3(141.482, 0.0, 0.0),'Pos': Point3(-73.306, -79.01, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.4000000059604645, 0.4000000059604645, 0.4000000059604645, 1.0),'Model': 'models/props/crates_group_2'}},'1177540224.0dxschafe7': {'Type': 'Crate','DisableCollision': False,'GridPos': Point3(-1298.223, -790.51, 150.183),'Hpr': VBase3(98.225, 0.0, 0.0),'Pos': Point3(-104.782, -90.182, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.30000001192092896, 0.30000001192092896, 0.30000001192092896, 1.0),'Model': 'models/props/crates_group_1'}},'1177540352.0dxschafe0': {'Type': 'Crate','DisableCollision': False,'GridPos': Point3(-1303.915, -795.727, 150.183),'Hpr': VBase3(-171.007, 0.0, 0.0),'Pos': Point3(-107.83, -83.088, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.4000000059604645, 0.4000000059604645, 0.4000000059604645, 1.0),'Model': 'models/props/crates_group_1'}},'1177540352.0dxschafe1': {'Type': 'Crate','DisableCollision': False,'GridPos': Point3(-1312.414, -780.992, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(-91.117, -79.925, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/crate_04'}},'1177540480.0dxschafe': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1334.028, -768.72, 150.183),'Hpr': VBase3(-3.895, 0.0, 0.0),'Pos': Point3(-72.402, -63.569, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannon_stack_01'}},'1177540480.0dxschafe1': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1358.157, -780.542, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(-75.604, -36.89, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannonball_stack_triangle'}},'1177540480.0dxschafe2': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1359.16, -777.536, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(-72.436, -36.935, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannonball_stack_triangle'}},'1177540608.0dxschafe': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1314.759, -799.372, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(-107.695, -71.649, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannonball_stack_square'}},'1177540608.0dxschafe0': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1322.028, -802.502, 150.183),'Hpr': VBase3(-141.597, 0.0, 0.0),'Pos': Point3(-108.252, -63.755, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannonball_stack_square'}},'1177540608.0dxschafe1': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1329.427, -805.789, 150.183),'Hpr': VBase3(-162.085, 0.0, 0.0),'Pos': Point3(-108.915, -55.685, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannonball_stack_square'}},'1177540736.0dxschafe': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1339.077, -807.643, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(-107.482, -45.963, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannon_stack_02'}},'1177540736.0dxschafe0': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1348.796, -773.702, 150.183),'Hpr': VBase3(-2.728, 0.0, 0.0),'Pos': Point3(-72.234, -47.984, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannon_stack_01'}},'1177540736.0dxschafe1': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1309.125, -765.686, 150.183),'Hpr': VBase3(1.343, 0.0, 0.0),'Pos': Point3(-77.752, -88.079, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannon_broken_prop'}},'1177540864.0dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1307.969, -765.727, 150.183),'Hpr': VBase3(174.232, 0.0, 0.0),'Pos': Point3(-78.172, -89.156, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.4000000059604645, 0.4000000059604645, 0.4000000059604645, 1.0),'Model': 'models/props/barrel_group_1'}},'1177540864.0dxschafe0': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1305.951, -788.342, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(-100.187, -83.602, 0.0),'Scale': VBase3(0.706, 0.706, 0.706),'Visual': {'Model': 'models/props/barrel'}},'1177540864.0dxschafe1': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1308.521, -792.611, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(-103.37, -79.768, 0.0),'Scale': VBase3(0.682, 0.682, 0.682),'Visual': {'Color': (0.4000000059604645, 0.4000000059604645, 0.4000000059604645, 1.0),'Model': 'models/props/barrel'},'searchTime': '10.0','type': 'Barrel'},'1177540992.0dxschafe': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1411.543, -779.95, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(-57.436, 13.313, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.4000000059604645, 0.4000000059604645, 0.4000000059604645, 1.0),'Model': 'models/props/barrel'},'searchTime': '10.0','type': 'Barrel'},'1177540992.0dxschafe0': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','GridPos': Point3(-1373.709, -800.436, 150.183),'Hpr': VBase3(6.348, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(-89.255, -15.646, 0.0),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'High Navy','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1177541120.0dxschafe': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1349.317, -763.038, 150.183),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(-61.995, -51.009, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.4000000059604645, 0.4000000059604645, 0.4000000059604645, 1.0),'Model': 'models/props/barrel'},'searchTime': '10.0','type': 'Barrel'},'1177541120.0dxschafe0': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1351.287, -753.425, 150.183),'Hpr': VBase3(-7.189, 0.0, 0.0),'Pos': Point3(-52.271, -52.32, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.4000000059604645, 0.4000000059604645, 0.4000000059604645, 1.0),'Model': 'models/props/barrel_group_3'}},'1177541248.0dxschafe': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1407.589, -652.667, 189.82),'Hpr': VBase3(-178.168, 0.0, 0.0),'Pos': Point3(61.42, -32.403, 39.637),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannon_stack_01'}},'1177541248.0dxschafe0': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1412.505, -644.947, 189.868),'Hpr': VBase3(-80.641, 0.0, 0.0),'Pos': Point3(70.328, -30.309, 39.685),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/crate_04'},'searchTime': '10.0','type': 'Crate'},'1177541248.0dxschafe1': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1643.898, -551.335, 212.798),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(235.025, 157.258, 62.615),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/barrel'},'searchTime': '10.0','type': 'Barrel'},'1177541248.0dxschafe2': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1626.626, -794.152, 217.887),'Hpr': VBase3(-83.686, -2.008, -1.375),'Pos': Point3(0.099, 221.044, 67.704),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/crate_04'},'searchTime': '10.0','type': 'Crate'},'1177541376.0dxschafe': {'Type': 'Crate','DisableCollision': False,'GridPos': Point3(-1625.75, -799.172, 218.451),'Hpr': VBase3(-51.452, 0.0, 0.0),'Pos': Point3(-4.929, 221.872, 68.268),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.699999988079071, 0.699999988079071, 0.699999988079071, 1.0),'Model': 'models/props/crates_group_1'}},'1177541376.0dxschafe0': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1478.408, -748.989, 198.219),'Hpr': VBase3(-113.727, 0.0, 0.0),'Pos': Point3(-6.153, 66.223, 48.036),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannonball_stack_square'}},'1177541376.0dxschafe2': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1474.03, -750.784, 198.021),'Hpr': VBase3(-124.163, 0.0, 0.0),'Pos': Point3(-9.292, 62.682, 47.838),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannonball_stack_square'}},'1177541376.0dxschafe3': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1469.368, -752.276, 197.827),'Hpr': VBase3(-64.006, 0.0, 0.0),'Pos': Point3(-12.238, 58.773, 47.644),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannonball_stack_square'}},'1177541376.0dxschafe4': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1465.089, -754.74, 197.603),'Hpr': VBase3(-133.497, 0.0, 0.0),'Pos': Point3(-15.976, 55.547, 47.42),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannonball_stack_square'}},'1177541504.0dxschafe': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1314.179, -791.741, 197.625),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(-100.682, -74.713, 47.442),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannonball_stack_square'}},'1177541504.0dxschafe0': {'Type': 'Ship_Props','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-14.953, 193.545, 67.017),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannonball_stack_square'}},'1177541504.0dxschafe1': {'Type': 'Ship_Props','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(223.572, 130.837, 61.524),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannonball_stack_square'}},'1177541504.0dxschafe2': {'Type': 'Ship_Props','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(174.293, -3.112, 47.132),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannonball_stack_square'}},'1177541504.0dxschafe3': {'Type': 'Ship_Props','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(107.158, -59.451, 41.408),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannonball_stack_square'}},'1177541504.0dxschafe4': {'Type': 'Ship_Props','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-24.771, -93.087, 47.411),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannonball_stack_square'}},'1177541504.0dxschafe5': {'Type': 'Ship_Props','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-102.359, 51.306, 47.409),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannonball_stack_square'}},'1177541632.0dxschafe': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1483.218, -745.676, 198.495),'Hpr': VBase3(-48.842, 0.0, 0.0),'Pos': Point3(-1.439, 69.671, 48.312),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/crate_04'},'searchTime': '10.0','type': 'Crate'},'1177541632.0dxschafe0': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1296.817, -787.007, 197.587),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(-101.94, -92.665, 47.404),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/barrel'},'searchTime': '10.0','type': 'Barrel'},'1177541760.0dxschafe': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1454.712, -629.05, 150.175),'Hpr': VBase3(-109.259, 0.0, 0.0),'Pos': Point3(99.258, 4.293, -0.008),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.76, 0.54, 0.38, 1.0),'Model': 'models/props/barrel'},'searchTime': '10.0','type': 'Barrel'},'1177541888.0dxschafe': {'Type': 'Searchable Container','Aggro Radius': 5.0,'GridPos': Point3(-1523.099, -733.214, 150.183),'Hpr': VBase3(-66.778, 0.0, 0.0),'Pos': Point3(23.479, 103.211, 0.0),'Scale': VBase3(0.818, 0.818, 0.818),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/barrel'},'searchTime': '10.0','type': 'Barrel'},'1177542144.0dxschafe': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1501.968, -562.27, 150.183),'Hpr': VBase3(-175.17, 0.0, 0.0),'Pos': Point3(177.887, 26.878, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannon_stack_01'}},'1177542144.0dxschafe0': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1488.514, -552.898, 150.183),'Hpr': VBase3(4.745, 0.0, 0.0),'Pos': Point3(182.297, 11.085, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannon_stack_01'}},'1177542144.0dxschafe1': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1564.201, -555.973, 150.183),'Hpr': VBase3(153.308, 0.0, 0.0),'Pos': Point3(204.359, 83.551, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannon_stack_01'}},'1177542144.0dxschafe2': {'Type': 'Ship_Props','DisableCollision': False,'GridPos': Point3(-1575.036, -550.74, 150.183),'Hpr': VBase3(-25.579, 0.0, 0.0),'Pos': Point3(212.873, 92.054, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cannon_stack_01'}},'1189113274.95kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'GridPos': Point3(-1378.328, -639.302, 149.799),'Hpr': VBase3(-90.519, 0.0, 0.0),'Pos': Point3(64.385, -64.434, -0.384),'Scale': VBase3(2.844, 0.652, 2.286),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1189113339.42kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'GridPos': Point3(-1413.464, -631.085, 149.747),'Hpr': VBase3(-88.31, 0.0, 0.0),'Pos': Point3(83.731, -33.976, -0.436),'Scale': VBase3(1.037, 2.017, 1.598),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1189619968.0dxschafe': {'Type': 'Interior_furnishings','DisableCollision': False,'GridPos': Point3(-1404.844, -598.991, 150.183),'Hpr': VBase3(-92.428, 0.0, 0.0),'Pos': Point3(111.186, -52.699, 0.0),'Scale': VBase3(0.556, 1.0, 1.0),'Visual': {'Model': 'models/props/interior_column_fort'}},'1189624960.0dxschafe': {'Type': 'Interior_furnishings','DisableCollision': False,'GridPos': Point3(-1413.943, -602.746, 150.183),'Hpr': VBase3(91.833, 0.0, 0.0),'Pos': Point3(110.642, -42.87, 0.0),'Scale': VBase3(0.556, 0.86, 1.0),'Visual': {'Model': 'models/props/interior_column_fort'}},'1189629568.0dxschafe': {'Type': 'Interior_furnishings','DisableCollision': False,'GridPos': Point3(-1403.695, -598.59, 166.705),'Hpr': VBase3(91.677, 1.231, 90.537),'Pos': Point3(111.186, -53.916, 16.522),'Scale': VBase3(0.556, 1.176, 1.0),'Visual': {'Model': 'models/props/interior_column_fort'}},'1189629824.0dxschafe': {'Type': 'Interior_furnishings','DisableCollision': False,'GridPos': Point3(-1403.911, -598.758, 166.669),'Hpr': VBase3(-92.445, -0.191, 90.852),'Pos': Point3(111.099, -53.657, 16.486),'Scale': VBase3(0.556, 1.176, 1.0),'Visual': {'Model': 'models/props/interior_column_fort'}},'1190411317.9kmuller': {'Type': 'Interior_furnishings','DisableCollision': False,'GridPos': Point3(-1391.005, -644.62, 149.787),'Hpr': VBase3(-177.483, 0.0, 0.0),'Pos': Point3(63.547, -50.713, -0.396),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/interior_column_fort'}},'1190411389.18kmuller': {'Type': 'Interior_furnishings','DisableCollision': False,'GridPos': Point3(-1419.3, -628.154, 149.427),'Hpr': VBase3(-93.368, 0.0, 0.0),'Pos': Point3(88.423, -29.433, -0.756),'Scale': VBase3(1.0, 1.0, 1.026),'Visual': {'Model': 'models/props/interior_column_fort'}},'1192672768.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','GridPos': Point3(-1368.472, -708.955, 150.183),'Hpr': VBase3(179.546, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': '100','Pause Duration': '30','Pos': Point3(-4.621, -50.765, 0.0),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Navy - Sergeant','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1192672768.0dxschafe0': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','GridPos': Point3(-1436.62, -650.314, 150.183),'Hpr': VBase3(70.287, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': '100','Pause Duration': '30','Pos': Point3(73.216, -5.773, 0.0),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Navy - Sergeant','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1192672896.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','GridPos': Point3(-1533.892, -722.433, 150.183),'Hpr': VBase3(-158.284, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': '100','Pause Duration': '30','Pos': Point3(37.217, 109.843, 0.0),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Navy - Sergeant','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1192672896.0dxschafe0': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','GridPos': Point3(-1329.161, -691.378, 197.559),'Hpr': VBase3(179.579, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': '100','Pause Duration': '30','Pos': Point3(-0.993, -93.673, 47.376),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Navy - Veteran','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1192673024.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','GridPos': Point3(-1327.015, -701.493, 197.551),'Hpr': VBase3(-179.164, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': '100','Pause Duration': '30','Pos': Point3(-11.251, -92.363, 47.368),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Navy - Veteran','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1192673024.0dxschafe0': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','GridPos': Point3(-1579.197, -784.249, 216.938),'Hpr': VBase3(169.724, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': '100','Pause Duration': '30','Pos': Point3(-6.196, 173.002, 66.755),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Navy - Veteran','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1192673152.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','GridPos': Point3(-1579.197, -784.249, 216.938),'Hpr': VBase3(60.465, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': '100','Pause Duration': '30','Pos': Point3(-0.16, 205.823, 67.581),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Navy - Veteran','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1192673152.0dxschafe0': {'Type': 'Movement Node','Hpr': VBase3(-109.259, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(0.415, 134.77, 66.043),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1192673152.0dxschafe1': {'Type': 'Movement Node','Hpr': VBase3(-109.259, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(-7.608, 81.032, 48.151),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1192673152.0dxschafe2': {'Type': 'Movement Node','Hpr': VBase3(-109.259, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(-51.212, 59.428, 47.428),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1194569540.75akelts': {'Type': 'Collision Barrier','DisableCollision': False,'GridPos': Point3(-1612.354, -803.368, 217.515),'Hpr': VBase3(29.326, 0.0, 0.0),'Pos': Point3(-13.309, 210.61, 67.332),'Scale': VBase3(1.551, 1.0, 1.097),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1194569560.91akelts': {'Type': 'Collision Barrier','DisableCollision': False,'GridPos': Point3(-1620.894, -798.961, 217.771),'Hpr': VBase3(84.481, 0.0, 0.0),'Pos': Point3(-6.331, 217.218, 67.588),'Scale': VBase3(0.614, 1.0, 1.055),'Visual': {'Model': 'models/misc/coll_plane_barrier'}}},'Pos': Point3(-1417.92, -721.337, 150.183),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6, 0.6, 0.6, 1.0),'Model': 'models/buildings/fort_medium'}},'1155666849.43dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(98.95, 0.0, 0.0),'Pos': Point3(-918.757, 55.3, 93.814),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_20'}},'1155666863.17dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(-44.184, 0.0, 0.0),'Pos': Point3(-909.367, 13.961, 98.479),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_60'}},'1155667777.63dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(-80.277, 0.0, 0.0),'Pos': Point3(-912.511, 33.593, 96.617),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_20'}},'1155667947.62dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(24.548, 0.0, 0.0),'Pos': Point3(-909.123, 13.929, 99.616),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_Column'}},'1155684760.49dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-96.344, 0.0, 18.775),'Pos': Point3(-1026.306, -308.482, 77.659),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_a'}},'1155684828.4dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-40.335, -8.196, -5.491),'Pos': Point3(-1037.413, -335.106, 73.75),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_a'}},'1155684840.45dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(152.817, 2.506, 0.953),'Pos': Point3(-1036.255, -315.638, 73.572),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_a'}},'1155684860.92dxschafe': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(54.699, -1.299, 2.346),'Pos': Point3(-1087.791, -315.365, 73.257),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_a'}},'1155684906.36dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(8.903, -9.515, 2.58),'Pos': Point3(-1050.531, -327.465, 71.275),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_a'}},'1155684946.54dxschafe': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(4.907, 9.489, 2.026),'Pos': Point3(-994.176, -261.861, 83.797),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_a'}},'1155685060.64dxschafe': {'Type': 'Stairs','Hpr': VBase3(-130.401, 0.0, 0.0),'Objects': {},'Pos': Point3(-941.661, -212.049, 88.276),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.7099999785423279, 0.6700000166893005, 0.6000000238418579, 1.0),'Model': 'models/buildings/stone_stairs_single'}},'1155685160.26dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(32.294, 0.0, 0.0),'Pos': Point3(-875.652, -190.076, 102.76),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_Broken20'}},'1155685272.34dxschafe': {'Type': 'Arch','Hpr': VBase3(35.276, 0.0, 0.0),'Pos': Point3(-887.911, -198.369, 100.892),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/spanish_archC'}},'1155685480.08dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(53.299, 0.0, 0.0),'Pos': Point3(-934.569, -256.74, 95.661),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_60'}},'1155686336.37dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(37.283, 0.0, 0.0),'Pos': Point3(-996.39, -335.311, 103.859),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_60'}},'1155686356.86dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(75.265, 0.0, 0.0),'Pos': Point3(-947.645, -297.815, 95.759),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_20'}},'1155686393.63dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(69.746, 0.0, 0.0),'Pos': Point3(-942.65, -277.375, 96.3),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_Column'}},'1155686422.03dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(-19.129, 0.0, 0.0),'Pos': Point3(-995.48, -335.061, 106.288),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_60'}},'1155687216.36dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(-33.945, 0.0, 0.0),'Pos': Point3(-935.113, -258.202, 96.542),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_Column'}},'1155687259.5dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(70.736, 0.0, 0.0),'Pos': Point3(-942.238, -277.619, 95.596),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_20'}},'1155687319.17dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(63.159, 0.0, 0.0),'Pos': Point3(-947.941, -298.05, 107.736),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_Column'}},'1155687328.16dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(37.283, 0.0, 0.0),'Pos': Point3(-995.869, -335.233, 108.448),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_Column'}},'1155687503.23dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(-10.769, 0.0, 0.0),'Pos': Point3(-909.621, -356.932, 106.246),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_60'}},'1155687894.29dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(142.535, 0.0, 0.0),'Pos': Point3(-1023.637, 74.305, 78.621),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.62, 0.6, 0.5764705882352941, 1.0),'Model': 'models/buildings/TallWallStone_60'}},'1155687992.31dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(53.426, 0.0, 0.0),'Pos': Point3(-1022.422, 73.496, 84.448),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.62, 0.596078431372549, 0.5764705882352941, 1.0),'Model': 'models/buildings/TallWallStone_Column'}},'1155688040.88dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(53.426, 0.0, 0.0),'Pos': Point3(-1022.801, 72.385, 83.405),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.62, 0.596078431372549, 0.5764705882352941, 1.0),'Model': 'models/buildings/TallWallStone_20'}},'1155688072.41dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(142.033, 0.0, 0.0),'Pos': Point3(-1071.164, 110.73, 73.969),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.62, 0.6, 0.5764705882352941, 1.0),'Model': 'models/buildings/TallWallStone_20'}},'1155688135.99dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(128.964, 0.0, 0.0),'Pos': Point3(-1086.512, 122.783, 69.77),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.62, 0.6, 0.5764705882352941, 1.0),'Model': 'models/buildings/TallWallStone_20'}},'1155688270.81dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(173.825, 0.0, 0.0),'Pos': Point3(-1121.323, 140.262, 61.443),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.62, 0.596078431372549, 0.5764705882352941, 1.0),'Model': 'models/buildings/TallWallStone_20'}},'1155688602.99dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(-73.174, 0.0, 0.0),'Pos': Point3(-852.656, -206.158, 105.726),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/LowWallStone_60'}},'1155688729.94dxschafe': {'Type': 'Stairs','Hpr': VBase3(-57.466, 0.0, 0.0),'Pos': Point3(-862.826, -205.28, 102.954),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.7099999785423279, 0.6700000166893005, 0.6000000238418579, 1.0),'Model': 'models/buildings/stone_stairs_single'}},'1155752242.79dxschafe': {'Type': 'Stairs','Hpr': VBase3(-35.668, 0.0, 0.0),'Pos': Point3(-1058.684, 156.58, 76.248),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/brick_stairs_double'}},'1155752378.92dxschafe': {'Type': 'Stairs','Hpr': VBase3(-41.734, 0.049, 0.0),'Pos': Point3(-1089.394, 181.239, 70.641),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/stone_stairs_double'}},'1155753131.97dxschafe': {'Type': 'Stairs','Hpr': VBase3(-124.347, 0.0, 0.0),'Pos': Point3(-845.75, -341.114, 102.059),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/brick_stairs_double'}},'1155765923.85dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(-11.246, 0.0, 0.0),'Pos': Point3(-738.777, 106.153, 112.342),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/LowWallStone_60'}},'1155766116.09dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(-58.538, 0.0, 0.0),'Pos': Point3(-804.797, 35.852, 103.455),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/LowWallStucco_10'}},'1155766194.11dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(-6.612, 0.0, 0.0),'Pos': Point3(-853.115, -42.363, 103.696),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/LowWallStucco_60'}},'1155766300.24dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(99.516, 0.0, 0.0),'Pos': Point3(-832.182, -337.567, 106.246),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_60'}},'1155766494.6dxschafe': {'Type': 'TreeBase','Hpr': VBase3(-19.413, 0.0, 0.0),'Pos': Point3(-873.512, -353.58, 105.419),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/TreeBase'}},'1155766521.72dxschafe': {'Type': 'TreeBase','Hpr': VBase3(-19.413, 0.0, 0.0),'Pos': Point3(-891.431, -350.073, 106.137),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/TreeBase'}},'1155766525.62dxschafe': {'Type': 'TreeBase','Hpr': VBase3(-55.631, 0.0, 0.0),'Pos': Point3(-853.262, -318.744, 106.246),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/TreeBase'}},'1155766543.53dxschafe': {'Type': 'TreeBase','Hpr': VBase3(-19.413, 0.0, 0.0),'Pos': Point3(-936.114, -301.011, 106.009),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/TreeBase'}},'1155766545.68dxschafe': {'Type': 'TreeBase','Hpr': VBase3(-19.413, 0.0, 0.0),'Pos': Point3(-928.149, -273.123, 105.975),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/TreeBase'}},'1155766547.3dxschafe': {'Type': 'TreeBase','Hpr': VBase3(-36.725, 0.0, 0.0),'Pos': Point3(-915.675, -249.941, 105.017),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/TreeBase'}},'1155766548.77dxschafe': {'Type': 'TreeBase','Hpr': VBase3(-36.913, 0.0, 0.0),'Pos': Point3(-900.867, -226.258, 103.789),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/TreeBase'}},'1155766682.4dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(13.213, 0.0, 0.0),'Pos': Point3(-763.256, -19.04, 111.335),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_60'}},'1155766778.29dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(68.429, 0.0, 0.0),'Pos': Point3(-705.205, -5.303, 111.443),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_100'}},'1155766974.82dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(24.548, 0.0, 0.0),'Pos': Point3(-704.403, -4.818, 113.839),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStucco_Column'}},'1155767384.23dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(-26.531, -0.087, -0.018),'Pos': Point3(-1018.263, 145.244, 83.561),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStone_60'}},'1155768439.83dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(-43.247, 0.0, 0.0),'Pos': Point3(-1074.015, 194.273, 73.688),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/TallWallStone_60'}},'1155768743.05dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(117.312, 0.0, 0.0),'Pos': Point3(-1170.649, 185.507, 59.871),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/buildings/TallWallStone_20'}},'1155768838.56dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(53.426, 0.0, 0.0),'Pos': Point3(-1071.713, 111.151, 79.173),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.62, 0.6, 0.5764705882352941, 1.0),'Model': 'models/buildings/TallWallStone_Column'}},'1155768840.77dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(53.426, 0.0, 0.0),'Pos': Point3(-1087.015, 123.419, 74.425),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.62, 0.596078431372549, 0.5764705882352941, 1.0),'Model': 'models/buildings/TallWallStone_Column'}},'1155769179.08dxschafe': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(19.163, -0.303, -0.242),'Pos': Point3(-881.356, -25.641, 99.952),'Scale': VBase3(0.883, 0.883, 0.883),'Visual': {'Model': 'models/vegetation/bush_a'}},'1155769240.78dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(14.915, -0.029, -0.107),'Pos': Point3(-868.754, -57.562, 100.683),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_c'}},'1155769322.16dxschafe': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(21.172, -2.073, -4.46),'Pos': Point3(-914.853, 16.868, 97.003),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_d'}},'1155769322.17dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-120.595, 12.577, -5.668),'Pos': Point3(-872.662, -180.14, 100.821),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_a'}},'1155769462.45dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(173.773, -0.012, 0.111),'Pos': Point3(-1095.139, -238.079, 75.678),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_a'}},'1155769802.33dxschafe': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(10.981, -2.779, 0.334),'Pos': Point3(-1319.42, 74.072, 9.219),'Scale': VBase3(1.582, 1.582, 1.582),'Visual': {'Model': 'models/vegetation/bush_d'}},'1155769916.47dxschafe': {'Type': 'Cart','DisableCollision': False,'Hpr': VBase3(116.32, -0.244, 0.415),'Pos': Point3(-1346.349, 72.856, 7.766),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cart_reg'}},'1155770041.03dxschafe': {'Type': 'Building Exterior','File': '','ExtUid': '1155770041.03dxschafe0','Hpr': VBase3(-36.585, 0.0, 0.0),'Objects': {'1200533376.0dxschafe31': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(0.313, -4.016, 1.444),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-1340.588, 93.146, 6.894),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/navy_jail_interior','Model': 'models/buildings/shanty_npc_house_combo_J','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1155770102.37dxschafe': {'Type': 'Crane','Hpr': VBase3(144.003, 0.0, 0.0),'Pos': Point3(-1415.68, 155.15, 8.489),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/Crane'}},'1155770146.67dxschafe': {'Type': 'Crane','Hpr': VBase3(-47.423, 0.0, 0.0),'Pos': Point3(-1556.865, 238.948, 0.0),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/Crane_A'}},'1155770267.94dxschafe': {'Type': 'Tunnel Cap','Hpr': VBase3(-39.636, 0.0, 0.348),'Pos': Point3(-768.279, 129.213, 100.282),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/tunnels/tunnelcap_volcano'}},'1155770342.53dxschafe': {'Type': 'Tunnel Cap','Hpr': VBase3(-54.852, 0.0, 0.0),'Pos': Point3(-896.68, -654.897, 123.326),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/tunnels/tunnelcap_volcano'}},'1155770364.29dxschafe': {'Type': 'Tunnel Cap','Hpr': VBase3(20.831, 0.0, 0.0),'Pos': Point3(529.603, -1106.582, 40.386),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/tunnels/tunnelcap_volcano'}},'1155770415.57dxschafe': {'Type': 'Well','DisableCollision': False,'Hpr': VBase3(30.162, 0.0, 0.0),'Pos': Point3(-801.347, -24.657, 104.492),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/wellA'}},'1155770510.38dxschafe': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(-6.886, 0.0, 0.0),'Pos': Point3(-901.502, -226.266, 106.444),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/gen_tree_d'}},'1155770527.83dxschafe': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(-130.401, 0.0, 0.0),'Pos': Point3(-496.929, 644.495, 180.43),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/gen_tree_d'}},'1155770534.77dxschafe': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(29.109, 0.0, 0.0),'Pos': Point3(-936.425, -301.665, 108.299),'Scale': VBase3(0.901, 0.901, 0.901),'Visual': {'Model': 'models/vegetation/gen_tree_d'}},'1155770536.07dxschafe': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-929.015, -273.636, 106.622),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/gen_tree_d'}},'1155770537.26dxschafe': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(-28.418, 0.0, 0.0),'Pos': Point3(-916.535, -249.41, 107.551),'Scale': VBase3(0.792, 0.792, 0.792),'Visual': {'Model': 'models/vegetation/gen_tree_d'}},'1155770634.15dxschafe': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(29.109, 0.0, 0.0),'Pos': Point3(-891.841, -349.648, 108.085),'Scale': VBase3(0.901, 0.901, 0.901),'Visual': {'Model': 'models/vegetation/gen_tree_d'}},'1155770635.44dxschafe': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(29.109, 0.0, 0.0),'Pos': Point3(-873.357, -353.76, 107.563),'Scale': VBase3(0.901, 0.901, 0.901),'Visual': {'Model': 'models/vegetation/gen_tree_a'}},'1155770636.87dxschafe': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(45.095, 0.0, 0.0),'Pos': Point3(-852.48, -318.892, 108.595),'Scale': VBase3(0.901, 0.901, 0.901),'Visual': {'Model': 'models/vegetation/gen_tree_d'}},'1155770977.43dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(-36.639, 0.0, 0.0),'Pos': Point3(-975.424, -319.71, 106.338),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/LowWallStucco_60'}},'1155771286.15dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(-99.243, -0.451, -3.924),'Pos': Point3(-814.94, -190.733, 162.558),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/LowWallStucco_60'}},'1155771300.3dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(-81.61, 0.0, -1.68),'Pos': Point3(-824.262, -249.254, 166.864),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/LowWallStucco_60'}},'1155771305.19dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(-119.323, 0.0, -3.596),'Pos': Point3(-785.613, -138.536, 158.936),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/LowWallStucco_60'}},'1155771339.9dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(-81.61, 0.0, -0.891),'Pos': Point3(-816.994, -308.464, 168.488),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/LowWallStucco_60'}},'1155771506.4dxschafe': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-928.771, -203.732, 92.432),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_c'}},'1155771536.16dxschafe': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-870.219, -177.431, 100.931),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_c'}},'1155771541.16dxschafe': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(11.255, -2.128, -10.567),'Pos': Point3(-878.92, -18.921, 100.345),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_c'}},'1155771545.51dxschafe': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 8.293),'Pos': Point3(-880.571, -22.846, 100.125),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_c'}},'1155771564.79dxschafe': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(55.403, 0.0, 0.0),'Pos': Point3(-1037.323, -338.901, 75.693),'Scale': VBase3(1.227, 1.227, 1.227),'Visual': {'Model': 'models/vegetation/fern_tree_c'}},'1155771566.13dxschafe': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-1041.685, -314.417, 72.433),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_c'}},'1155771599.37dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(166.039, -0.027, 0.108),'Pos': Point3(-935.898, -235.037, 91.216),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_a'}},'1155771677.27dxschafe': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, -6.16),'Pos': Point3(-867.351, -155.995, 99.691),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_b'}},'1155771697.27dxschafe': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(1.098, 10.07, -6.257),'Pos': Point3(-868.919, -57.835, 101.1),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_a'}},'1155771700.55dxschafe': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, -6.16),'Pos': Point3(-927.635, 68.947, 93.576),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_b'}},'1155771711.01dxschafe': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, -1.147),'Pos': Point3(-1138.769, 136.911, 60.952),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_a'}},'1155771720.96dxschafe': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, -15.342),'Pos': Point3(-1097.872, -230.413, 75.943),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_a'}},'1155771734.27dxschafe': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(1.693, 15.311, -6.388),'Pos': Point3(-792.01, 131.801, 97.023),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_a'}},'1155771775.96dxschafe': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(1.693, 15.311, -6.388),'Pos': Point3(-915.7, 134.485, 127.864),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_a'}},'1155771821.05dxschafe': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, 4.29),'Pos': Point3(-1109.471, 313.37, 70.423),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_a'}},'1155771831.21dxschafe': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, -6.16),'Pos': Point3(-997.561, 211.054, 121.34),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_a'}},'1155771870.63dxschafe': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, -1.193),'Pos': Point3(-1100.102, 131.927, 66.899),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_b'}},'1155771872.96dxschafe': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(29.295, 1.926, 5.721),'Pos': Point3(-1080.365, 123.015, 72.068),'Scale': VBase3(1.559, 1.559, 1.559),'Visual': {'Model': 'models/vegetation/fern_tree_b'}},'1155771874.99dxschafe': {'Type': 'Tree','DisableCollision': False,'Hpr': VBase3(-18.527, 2.588, 0.221),'Pos': Point3(-1063.59, 109.219, 75.672),'Scale': VBase3(1.253, 1.253, 1.253),'Visual': {'Model': 'models/vegetation/fern_tree_b'}},'1155771875.74dxschafe': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(-103.668, 11.702, -9.168),'Pos': Point3(-1042.383, 97.681, 80.144),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_b'}},'1155771877.07dxschafe': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(-42.193, 4.146, -0.125),'Pos': Point3(-1023.359, 77.475, 81.006),'Scale': VBase3(1.212, 1.212, 1.212),'Visual': {'Model': 'models/vegetation/fern_tree_b'}},'1155771919.55dxschafe': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, -6.16),'Pos': Point3(-1038.915, 98.674, 80.542),'Scale': VBase3(1.265, 1.265, 1.265),'Visual': {'Model': 'models/vegetation/fern_tree_b'}},'1155771920.54dxschafe': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, 5.889),'Pos': Point3(-1022.016, 133.212, 81.298),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_b'}},'1155772093.82dxschafe': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(159.448, 0.028, -0.076),'Pos': Point3(-786.744, 78.494, 99.3),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_e'}},'1155772372.59dxschafe': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(-101.616, 10.856, 0.0),'Pos': Point3(-1027.652, 71.738, 82.532),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_c'}},'1155772436.63dxschafe': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(91.077, -11.603, 2.372),'Pos': Point3(-1067.383, 104.073, 76.419),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_c'}},'1155772629.19dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1357.618, 112.676, 7.499),'Scale': VBase3(0.754, 0.754, 0.754),'Visual': {'Model': 'models/props/barrel'}},'1155772629.71dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': VBase3(23.582, 0.0, 0.0),'Pos': Point3(-1360.041, 115.641, 7.516),'Scale': VBase3(0.914, 0.914, 0.914),'Visual': {'Model': 'models/props/barrel_worn'}},'1155772630.15dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1364.545, 115.976, 7.538),'Scale': VBase3(0.873, 0.873, 0.873),'Visual': {'Model': 'models/props/barrel_sideways'}},'1155772632.09dxschafe': {'Type': 'Barrel','DisableCollision': True,'Hpr': VBase3(-18.243, -0.076, 0.232),'Pos': Point3(-1377.329, 39.809, 7.554),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/barrel_group_1'}},'1155772632.48dxschafe': {'Type': 'Barrel','DisableCollision': True,'Hpr': VBase3(0.0, -0.146, 0.0),'Pos': Point3(-1385.503, 44.217, 7.554),'Scale': VBase3(0.657, 0.657, 0.657),'Visual': {'Model': 'models/props/barrel_group_2'}},'1155772633.09dxschafe': {'Type': 'Barrel','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1389.825, 46.459, 7.569),'Scale': VBase3(0.645, 0.645, 0.645),'Visual': {'Model': 'models/props/barrel'}},'1155772633.63dxschafe': {'Type': 'Barrel','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1391.254, 48.554, 7.506),'Scale': VBase3(0.601, 0.601, 0.601),'Visual': {'Model': 'models/props/barrel'}},'1155772646.07dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-1257.094, 22.797, 16.432),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/barrel_group_2'}},'1155772649.52dxschafe': {'Type': 'Barrel','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-1266.29, 30.281, 15.46),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/barrel'}},'1155772650.51dxschafe': {'Type': 'Barrel','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-1263.17, 27.299, 16.106),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.4000000059604645, 0.4000000059604645, 0.4000000059604645, 1.0),'Model': 'models/props/barrel'}},'1155772663.05dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': VBase3(-41.105, 4.944, 0.0),'Pos': Point3(-1069.446, 184.808, 75.579),'Scale': VBase3(0.69, 0.69, 0.69),'Visual': {'Model': 'models/props/barrel_group_1'}},'1155772664.05dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': VBase3(-38.268, 4.866, -6.353),'Pos': Point3(-1072.492, 180.914, 73.923),'Scale': VBase3(0.775, 0.775, 0.775),'Visual': {'Model': 'models/props/barrel_group_1'}},'1155772686.65dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': VBase3(-58.136, 4.148, 0.0),'Pos': Point3(-1086.181, -249.08, 76.656),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/barrel_group_1'}},'1155772687.37dxschafe': {'Type': 'Barrel','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1079.351, -257.285, 77.076),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/barrel'}},'1155772688.85dxschafe': {'Type': 'Barrel','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1082.688, -256.505, 76.488),'Scale': VBase3(0.81, 0.81, 0.81),'Visual': {'Model': 'models/props/barrel'}},'1155772699.68dxschafe': {'Type': 'Barrel','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-870.42, -190.697, 103.41),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/barrel'}},'1155772744.26dxschafe': {'Type': 'Barrel','DisableCollision': True,'Hpr': VBase3(-21.099, -0.829, -6.647),'Pos': Point3(-994.04, 129.898, 86.79),'Scale': VBase3(0.651, 0.651, 0.651),'Visual': {'Model': 'models/props/barrel_group_3'}},'1155772764.04dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-866.499, -21.695, 101.183),'Scale': VBase3(0.818, 0.818, 0.818),'Visual': {'Color': (0.8500000238418579, 0.8199999928474426, 0.7300000190734863, 1.0),'Model': 'models/props/barrel'}},'1155772764.46dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-867.504, -15.061, 100.94),'Scale': VBase3(0.792, 0.792, 0.792),'Visual': {'Color': (0.8500000238418579, 0.8199999928474426, 0.7300000190734863, 1.0),'Model': 'models/props/barrel'}},'1155772764.93dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-869.227, -18.533, 100.77),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6600000262260437, 0.5400000214576721, 0.4699999988079071, 1.0),'Model': 'models/props/barrel'}},'1155772772.04dxschafe': {'Type': 'Barrel','DisableCollision': True,'Hpr': VBase3(-0.981, -8.445, -6.652),'Pos': Point3(-910.588, 55.989, 94.799),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/barrel'}},'1155772775.94dxschafe': {'Type': 'Barrel','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-836.422, 86.427, 99.533),'Scale': VBase3(0.605, 0.605, 0.605),'Visual': {'Color': (0.8999999761581421, 0.8999999761581421, 0.699999988079071, 1.0),'Model': 'models/props/barrel'}},'1155772776.74dxschafe': {'Type': 'Barrel','DisableCollision': True,'Hpr': VBase3(0.0, -15.661, 0.0),'Pos': Point3(-855.836, 65.03, 100.062),'Scale': VBase3(0.66, 0.66, 0.66),'Visual': {'Model': 'models/props/barrel'}},'1155772778.27dxschafe': {'Type': 'Barrel','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-841.019, 80.094, 99.348),'Scale': VBase3(0.747, 0.747, 0.747),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/barrel_group_2'}},'1155772779.19dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-838.242, 74.386, 99.405),'Scale': VBase3(0.508, 0.508, 0.508),'Visual': {'Color': (0.75, 0.9300000071525574, 1.0, 1.0),'Model': 'models/props/barrel'}},'1155773744.21dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1418.674, 147.169, 7.608),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/crates_group_1'}},'1155773754.16dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1412.899, 146.137, 7.572),'Scale': VBase3(1.511, 1.511, 1.511),'Visual': {'Color': (0.8999999761581421, 0.8999999761581421, 0.8999999761581421, 1.0),'Model': 'models/props/crate_net'}},'1155773766.88dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(35.75, 0.0, 0.0),'Pos': Point3(-1339.792, 81.247, 7.593),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/crates_group_2'}},'1155773767.68dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1342.773, 84.993, 7.584),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/crate'}},'1155773774.1dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, -2.325),'Pos': Point3(-1240.635, -47.358, 23.501),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/crate'}},'1155773774.77dxschafe': {'Type': 'Crate','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1230.394, -45.972, 24.583),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/crate_04'}},'1155773775.3dxschafe': {'Type': 'Crate','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, -4.82),'Pos': Point3(-1226.609, -43.145, 24.979),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/crates_group_2'}},'1155773775.71dxschafe': {'Type': 'Crate','DisableCollision': True,'Hpr': VBase3(-67.429, 0.0, 0.0),'Pos': Point3(-1234.485, -51.55, 24.325),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/crates_group_1'}},'1155773786.34dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(102.339, 0.0, 0.0),'Pos': Point3(-1360.326, 108.115, 7.555),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/crate'}},'1155773789.24dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-1381.714, 123.449, 32.922),'Scale': VBase3(2.207, 2.207, 2.207),'Visual': {'Color': (1.0, 0.73, 0.6, 1.0),'Model': 'models/props/crate'}},'1155773866.59dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(9.122, 0.0, 0.0),'Pos': Point3(-688.258, 50.8, 112.342),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/crates_group_1'}},'1155773867.43dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(-35.19, 0.0, 0.0),'Pos': Point3(-689.605, 42.963, 112.342),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (1.0, 1.0, 0.6000000238418579, 1.0),'Model': 'models/props/crate'}},'1155773902.95dxschafe': {'Type': 'Crate','DisableCollision': True,'Hpr': VBase3(65.811, 0.0, 0.0),'Pos': Point3(-1013.7, 137.321, 84.093),'Scale': VBase3(1.328, 1.328, 1.328),'Visual': {'Model': 'models/props/crate'}},'1155773904.67dxschafe': {'Type': 'Crate','DisableCollision': True,'Hpr': VBase3(102.339, 0.0, 0.0),'Pos': Point3(-1009.685, 137.415, 84.637),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/crates_group_2'}},'1155773906.04dxschafe': {'Type': 'Crate','DisableCollision': True,'Hpr': VBase3(102.339, 0.0, 0.0),'Pos': Point3(-1006.22, 135.37, 85.215),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/crate'}},'1155773948.78dxschafe': {'Type': 'Rope','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1416.245, 139.893, 7.519),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/rope_pile'}},'1155773994.64dxschafe': {'Type': 'Rope','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1461.632, 105.365, 7.523),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/rope_pile'}},'1155774000.89dxschafe': {'Type': 'Rope','DisableCollision': False,'GridPos': Point3(-1452.815, 117.612, 7.208),'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-1465.53, 106.079, 8.085),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/rope_pile'}},'1155774058.12dxschafe': {'Type': 'FountainSmall','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-1167.462, 386.44, 68.584),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/FountainSmall'}},'1155774119.98dxschafe': {'Type': 'Bucket','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-806.989, -23.961, 104.454),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/bucket'}},'1155774130.87dxschafe': {'Type': 'Bucket','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-937.469, 82.137, 92.852),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/bucket'}},'1155774136.47dxschafe': {'Type': 'Bucket','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1153.013, 299.586, 69.427),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/bucket'}},'1155774143.76dxschafe': {'Type': 'Bucket','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1463.274, 103.215, 7.604),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/bucket'}},'1155774174.53dxschafe': {'Type': 'Bucket','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-932.4, -211.488, 93.194),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/bucket'}},'1155774183.73dxschafe': {'Type': 'Bucket','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-855.635, -313.401, 106.246),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/bucket'}},'1155774187.78dxschafe': {'Type': 'Bucket','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-946.847, -325.962, 106.246),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/bucket'}},'1155774213.43dxschafe': {'Type': 'LaundryRope','DisableCollision': False,'Hpr': VBase3(-34.582, 0.0, 0.0),'Pos': Point3(-900.961, 132.614, 129.008),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/LaundryRope'}},'1155774217.81dxschafe': {'Type': 'LaundryRope','DisableCollision': False,'Hpr': VBase3(-84.398, 0.0, 0.0),'Pos': Point3(-815.866, -265.27, 167.217),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/LaundryRope'}},'1155774220.67dxschafe': {'Type': 'LaundryRope','DisableCollision': False,'Hpr': VBase3(110.195, 0.0, 0.0),'Pos': Point3(-780.267, -154.079, 158.327),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/LaundryRope'}},'1155774227.8dxschafe': {'Type': 'LaundryRope','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1167.378, 141.819, 55.604),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/LaundryRope'}},'1155774238.19dxschafe': {'Type': 'LaundryRope','DisableCollision': False,'Hpr': VBase3(78.112, 0.0, 0.0),'Pos': Point3(-777.51, 71.25, 110.656),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/LaundryRope'}},'1155774283.59dxschafe': {'Type': 'Trellis','DisableCollision': False,'Hpr': VBase3(-45.322, 0.0, 0.0),'Pos': Point3(-1171.94, 381.472, 63.483),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/trellisB'}},'1155774336.91dxschafe': {'Type': 'Trellis','DisableCollision': False,'Hpr': VBase3(-50.846, 0.0, 0.0),'Pos': Point3(-962.386, -322.854, 104.434),'Scale': VBase3(0.817, 0.817, 0.817),'Visual': {'Model': 'models/props/trellisB'}},'1155774409.39dxschafe': {'Type': 'Trellis','DisableCollision': False,'Hpr': VBase3(-72.978, 0.0, 0.0),'Pos': Point3(-859.008, -224.331, 101.328),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/trellisB'}},'1155776698.45dxschafe': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(-86.267, 0.0, 0.0),'Pos': Point3(-801.549, 118.127, 97.495),'Scale': VBase3(2.954, 2.954, 2.954),'Visual': {'Color': (0.6, 0.58, 0.69, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_1F'}},'1155777971.03dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(177.309, -4.193, 0.623),'Pos': Point3(-1157.126, 140.919, 57.274),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/LowWallStone_20'}},'1155847912.55dxschafe': {'Type': 'Cart','DisableCollision': True,'Hpr': VBase3(17.502, 0.0, -10.645),'Pos': Point3(-878.313, -70.578, 100.261),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cart_reg'}},'1155847945.66dxschafe': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(-95.563, 13.605, -5.206),'Pos': Point3(-1011.142, 71.707, 84.846),'Scale': VBase3(2.954, 2.954, 2.954),'Visual': {'Color': (0.7, 0.8, 0.91, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_1F'}},'1155847967.2dxschafe': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(-64.977, 12.355, -4.7),'Pos': Point3(-1070.636, 324.639, 78.266),'Scale': VBase3(2.954, 2.954, 2.954),'Visual': {'Color': (0.6, 0.58, 0.69, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_1F'}},'1155848008.31dxschafe': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(147.098, 9.884, 0.0),'Pos': Point3(-1006.305, -428.288, 101.112),'Scale': VBase3(2.954, 2.954, 2.954),'Visual': {'Color': (0.6, 0.58, 0.69, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_1F'}},'1155848076.92dxschafe': {'Type': 'Rock','DisableCollision': True,'GridPos': Point3(-1280.903, -796.111, 197.509),'Hpr': VBase3(109.415, -3.906, 0.0),'Pos': Point3(-1003.207, -276.543, 83.869),'Scale': VBase3(2.954, 2.954, 2.954),'Visual': {'Color': (0.6, 0.58, 0.69, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_1F'}},'1155848093.47dxschafe': {'Type': 'Rock','DisableCollision': True,'GridPos': Point3(-1280.903, -796.111, 197.509),'Hpr': VBase3(109.415, 0.0, 7.078),'Pos': Point3(-780.079, 87.133, 99.28),'Scale': VBase3(2.954, 2.954, 2.954),'Visual': {'Color': (0.6, 0.58, 0.69, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_1F'}},'1155848103.28dxschafe': {'Type': 'Rock','DisableCollision': True,'GridPos': Point3(-1280.903, -796.111, 197.509),'Hpr': VBase3(109.213, -6.863, -1.689),'Pos': Point3(-1045.541, 313.977, 82.015),'Scale': VBase3(2.954, 2.954, 2.954),'Visual': {'Color': (0.6, 0.58, 0.69, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_1F'}},'1155848305.51dxschafe': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(-129.958, -0.202, 37.57),'Pos': Point3(-869.012, -747.074, 113.211),'Scale': VBase3(1.749, 1.749, 1.749),'Visual': {'Model': 'models/props/madre_mound_small'}},'1155848750.0dxschafe': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(-133.72, 0.0, 5.209),'Objects': {},'Pos': Point3(-1094.509, -304.666, 72.932),'Scale': VBase3(3.02, 3.02, 3.02),'Visual': {'Color': (0.6, 0.58, 0.69, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_1F'}},'1155848859.34dxschafe': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(105.186, -12.262, -6.302),'Objects': {},'Pos': Point3(-1067.683, -162.862, 77.923),'Scale': VBase3(3.47, 3.47, 3.47),'Visual': {'Color': (0.3700000047683716, 0.3499999940395355, 0.44999998807907104, 1.0),'Model': 'models/props/rock_group_2_sphere'}},'1155849570.14dxschafe': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(0.764, 7.833, -18.039),'Objects': {},'Pos': Point3(-1155.765, 36.871, 44.989),'Scale': VBase3(3.02, 3.02, 3.02),'Visual': {'Color': (0.6, 0.58, 0.69, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_2F'}},'1155849610.12dxschafe': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(18.569, -4.26, -20.156),'Objects': {},'Pos': Point3(-1127.248, 10.179, 51.341),'Scale': VBase3(3.02, 3.02, 3.02),'Visual': {'Color': (0.6, 0.58, 0.69, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_3F'}},'1155849648.82dxschafe': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(-32.31, 10.665, -1.538),'Objects': {},'Pos': Point3(-1020.288, 383.24, 92.478),'Scale': VBase3(3.02, 3.02, 3.02),'Visual': {'Color': (0.6, 0.58, 0.69, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_3F'}},'1155849696.25dxschafe': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(-33.362, 2.142, -6.94),'Objects': {},'Pos': Point3(-947.881, 424.386, 95.59),'Scale': VBase3(3.02, 3.02, 3.02),'Visual': {'Color': (0.6, 0.58, 0.69, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_3F'}},'1155849717.8dxschafe': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(-59.793, -4.772, 3.848),'Objects': {},'Pos': Point3(-959.205, 544.54, 95.583),'Scale': VBase3(3.02, 3.02, 3.02),'Visual': {'Color': (0.6, 0.58, 0.69, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_3F'}},'1155849762.45dxschafe': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(-152.507, -0.849, -0.196),'Objects': {},'Pos': Point3(-1053.167, 571.351, 95.629),'Scale': VBase3(0.924, 0.924, 0.924),'Visual': {'Color': (0.45, 0.43, 0.53, 1.0),'Model': 'models/props/rock_group_3_sphere'}},'1155849771.59dxschafe': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(152.13, 6.846, -1.336),'Objects': {},'Pos': Point3(-1088.228, 526.603, 96.912),'Scale': VBase3(3.02, 3.02, 3.02),'Visual': {'Color': (0.6, 0.58, 0.69, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_3F'}},'1155849890.3dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-81.028, 0.0, 0.0),'Pos': Point3(-1147.122, 392.148, 66.775),'Scale': VBase3(1.75, 1.75, 1.75),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155849954.14dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-50.947, 0.0, 0.0),'Pos': Point3(-1154.079, 400.494, 66.045),'Scale': VBase3(1.433, 1.433, 1.433),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155849956.0dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-15.443, 1.269, 0.0),'Pos': Point3(-1164.041, 406.953, 67.509),'Scale': VBase3(1.75, 1.75, 1.75),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155850027.19dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-11.284, 0.0, 0.0),'Pos': Point3(-1175.896, 402.273, 67.901),'Scale': VBase3(1.75, 1.75, 1.75),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155850028.86dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-9.148, 0.0, 0.0),'Pos': Point3(-1184.018, 399.225, 63.456),'Scale': VBase3(1.75, 1.75, 1.75),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155850252.52dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-15.443, 1.269, 0.0),'Pos': Point3(-1166.471, 155.552, 54.404),'Scale': VBase3(1.75, 1.75, 1.75),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155850272.55dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-56.374, 0.959, 0.831),'Pos': Point3(-1178.45, 194.378, 56.968),'Scale': VBase3(1.75, 1.75, 1.75),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155850326.54dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-56.374, 0.959, 0.831),'Pos': Point3(-1095.106, 132.418, 65.771),'Scale': VBase3(1.75, 1.75, 1.75),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155850350.53dxschafe': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(-56.374, 0.959, 0.831),'Pos': Point3(-802.12, 56.087, 99.771),'Scale': VBase3(1.75, 1.75, 1.75),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155850375.17dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-56.374, 0.959, 0.831),'Pos': Point3(-858.74, 104.384, 128.682),'Scale': VBase3(1.75, 1.75, 1.75),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155850394.26dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-56.374, 0.959, 0.831),'Pos': Point3(-990.055, 221.531, 120.04),'Scale': VBase3(1.75, 1.75, 1.75),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155850443.39dxschafe': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(-105.644, 4.003, 9.152),'Pos': Point3(-1105.954, 319.657, 71.843),'Scale': VBase3(2.611, 2.611, 2.611),'Visual': {'Color': (1.0, 1.0, 1.0, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_3F'}},'1155850680.51dxschafe': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(59.741, 0.0, 0.0),'Objects': {},'Pos': Point3(-1189.911, -691.555, 118.567),'Scale': VBase3(5.519, 5.519, 5.519),'Visual': {'Color': (0.6, 0.58, 0.69, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_1F'}},'1155850915.44dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-97.403, 0.177, 1.256),'Pos': Point3(-865.61, -152.872, 98.061),'Scale': VBase3(1.75, 1.75, 1.75),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155850952.52dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-175.95, -1.196, 0.423),'Pos': Point3(-840.943, -53.66, 101.349),'Scale': VBase3(1.75, 1.75, 1.75),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155850988.27dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-148.347, -0.864, 0.929),'Pos': Point3(-819.373, -59.017, 103.76),'Scale': VBase3(1.75, 1.75, 1.75),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155851356.17dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(127.057, 0.0, 0.0),'Pos': Point3(-1205.138, 333.392, 65.791),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_c'}},'1155851629.69dxschafe': {'Type': 'Wall','Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1236.66, 142.418, 52.958),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/woodfence_60'}},'1155851813.2dxschafe': {'Type': 'Wall','Hpr': VBase3(-3.789, 0.0, -1.18),'Pos': Point3(-1233.605, 190.569, 57.551),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/woodfence_60'}},'1155851820.86dxschafe': {'Type': 'Wall','Hpr': VBase3(86.609, -0.812, -5.593),'Pos': Point3(-1235.93, 142.837, 53.227),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/woodfence_60'}},'1155852041.03dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(94.772, 0.0, 0.0),'Pos': Point3(-1176.716, 141.958, 57.171),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/LowWallStone_20'}},'1155852183.79dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': VBase3(3.507, 0.0, 0.0),'Pos': Point3(-1178.881, 161.601, 57.135),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/LowWallStone_20'}},'1155852371.97dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-85.962, 13.438, 2.254),'Pos': Point3(-1088.466, 131.492, 70.646),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_c'}},'1155852423.1dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(59.093, -6.846, -1.712),'Pos': Point3(-1035.18, 89.357, 80.939),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_d'}},'1155852718.39dxschafe': {'Type': 'Cart','DisableCollision': False,'Hpr': VBase3(-71.915, 0.0, -8.292),'Pos': Point3(-896.089, 12.215, 98.801),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cart_reg'}},'1155853802.17dxschafe': {'Type': 'Wall','Hpr': VBase3(6.374, -0.422, -4.147),'Pos': Point3(-1149.976, 288.891, 69.45),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/woodfence_60'}},'1155853947.65dxschafe': {'Type': 'Wall','Hpr': VBase3(65.097, -3.442, -4.601),'Pos': Point3(-1090.0, 295.621, 74.706),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/woodfence_60'}},'1155855913.71dxschafe': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(148.117, -2.327, 4.333),'Pos': Point3(-709.778, -0.715, 112.323),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_d'}},'1155855980.52dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-111.377, 0.0, 0.0),'Pos': Point3(-678.116, 26.134, 117.201),'Scale': VBase3(2.62, 2.62, 2.62),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155856108.37dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-111.377, 0.0, 0.0),'Pos': Point3(-685.446, 9.237, 115.218),'Scale': VBase3(2.62, 2.62, 2.62),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155856142.18dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-10.865, 0.0, 0.0),'Pos': Point3(-724.02, 113.997, 110.44),'Scale': VBase3(2.215, 2.215, 2.215),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155856359.7dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-61.79, 0.876, 0.918),'Pos': Point3(-889.595, 73.315, 93.453),'Scale': VBase3(1.75, 1.75, 1.75),'Visual': {'Model': 'models/vegetation/bush_g'}},'1155856439.06dxschafe': {'Type': 'Cart','DisableCollision': False,'Hpr': VBase3(-34.372, 0.0, -5.285),'Pos': Point3(-929.711, 62.47, 93.397),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cart_reg'}},'1155856503.55dxschafe': {'Type': 'Rock','DisableCollision': False,'GridPos': Point3(-1280.903, -796.111, 197.509),'Hpr': VBase3(158.69, -2.551, 2.959),'Pos': Point3(-870.927, -138.951, 97.951),'Scale': VBase3(2.954, 2.954, 2.954),'Visual': {'Color': (0.6, 0.58, 0.69, 1.0),'Model': 'models/props/zz_dont_use_rocks_Dk_group_1F'}},'1155858033.57dxschafe': {'Type': 'Crane','Hpr': VBase3(14.995, 0.0, 0.0),'Pos': Point3(-1300.09, -398.583, 7.779),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (1.0, 0.93, 0.7568627450980392, 1.0),'Model': 'models/props/Crane_B'}},'1155925540.59dxschafe': {'Type': 'Stairs','Hpr': VBase3(-144.964, -0.094, 1.943),'Pos': Point3(-893.676, -190.476, 95.865),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.7099999785423279, 0.6700000166893005, 0.6000000238418579, 1.0),'Model': 'models/buildings/stone_stairs_quadruple'}},'1155941531.64dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-975.058, -332.48, 106.246),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_a'}},'1155941550.51dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(52.69, 0.0, 0.0),'Pos': Point3(-942.808, -351.99, 107.382),'Scale': VBase3(1.359, 1.359, 1.359),'Visual': {'Model': 'models/vegetation/bush_f'}},'1155941719.13dxschafe': {'Type': 'Stairs','Hpr': VBase3(-124.347, 0.0, 0.0),'Pos': Point3(-850.607, -357.668, 105.353),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/brick_stairs_double'}},'1155941890.86dxschafe': {'Type': 'Furniture','DisableCollision': False,'Hpr': VBase3(-69.741, 0.0, -1.68),'Pos': Point3(-851.336, -222.082, 105.833),'Scale': VBase3(1.747, 1.747, 1.747),'Visual': {'Model': 'models/props/bench'}},'1155941970.65dxschafe': {'Type': 'Bucket','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-854.669, -232.328, 106.246),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/bucket'}},'1155942005.18dxschafe': {'Type': 'Horse_trough','DisableCollision': True,'Hpr': VBase3(20.667, 0.0, 0.0),'Pos': Point3(-861.519, -284.039, 106.147),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/horse_trough'}},'1155942067.88dxschafe': {'Type': 'Log_Stack','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-956.813, -324.554, 106.246),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/Log_stack_a'}},'1155942102.09dxschafe': {'Type': 'Barrel','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-934.845, -340.252, 106.169),'Scale': VBase3(0.8, 0.8, 0.8),'Visual': {'Model': 'models/props/barrel'}},'1155942201.61dxschafe': {'Type': 'Hay','DisableCollision': True,'Hpr': VBase3(-26.714, 0.0, 0.0),'Pos': Point3(-963.63, -316.182, 106.205),'Scale': VBase3(2.082, 2.082, 2.082),'Visual': {'Model': 'models/props/haystack'}},'1155942312.25dxschafe': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(11.37, 0.0, 0.0),'Pos': Point3(-846.185, -212.847, 108.266),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_d'}},'1155942953.23dxschafe': {'Type': 'Stairs','Hpr': VBase3(-32.219, 0.0, 0.0),'Pos': Point3(-1033.014, 135.389, 77.202),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/brick_stairs_single'}},'1155945066.71dxschafe': {'Type': 'Stairs','Hpr': VBase3(-126.336, 0.0, 0.0),'Pos': Point3(-994.266, 121.063, 86.615),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/brick_stairs_single'}},'1155945133.67dxschafe': {'Type': 'Stairs','Hpr': VBase3(-126.336, 0.0, 0.0),'Pos': Point3(-781.755, -25.702, 104.892),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/brick_stairs_single'}},'1155945173.1dxschafe': {'Type': 'Stairs','Hpr': VBase3(178.964, 0.0, 0.0),'Pos': Point3(-806.883, -42.918, 103.005),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/brick_stairs_single'}},'1155945210.8dxschafe': {'Type': 'Stairs','Hpr': VBase3(-45.323, 0.0, 0.0),'Pos': Point3(-787.996, 12.017, 105.3),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/brick_stairs_single'}},'1155945354.74dxschafe': {'Type': 'Animal','Hpr': Point3(0.0, 0.0, 0.0),'Patrol Radius': '12.0000','Pos': Point3(-805.774, -17.017, 104.588),'PoseAnim': '','PoseFrame': '','Respawns': True,'Scale': VBase3(1.0, 1.0, 1.0),'Species': 'Rooster','Start State': 'Walk','StartFrame': '0'},'1155945372.59dxschafe': {'Type': 'Animal','Hpr': VBase3(59.558, 0.0, 0.0),'Patrol Radius': 12,'Pos': Point3(-806.58, -11.475, 104.464),'PoseAnim': '','PoseFrame': '','Respawns': True,'Scale': VBase3(1.0, 1.0, 1.0),'Species': 'Rooster','Start State': 'Idle','StartFrame': '0'},'1155945461.27dxschafe': {'Type': 'Horse_trough','DisableCollision': True,'Hpr': VBase3(-4.577, 0.196, -2.45),'Pos': Point3(-818.648, -42.784, 103.274),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/horse_trough'}},'1155945610.41dxschafe': {'Type': 'Pig_stuff','DisableCollision': False,'Hpr': VBase3(-21.368, 1.304, -3.751),'Pos': Point3(-1207.824, 284.611, 65.599),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/pig_pen'}},'1155945662.52dxschafe': {'Type': 'Animal','Hpr': VBase3(-51.752, 0.0, 0.0),'Patrol Radius': '1.6667','Pos': Point3(-1211.516, 287.056, 65.416),'PoseAnim': '','PoseFrame': '','Respawns': True,'Scale': VBase3(1.0, 1.0, 1.0),'Species': 'Pig','Start State': 'Walk','StartFrame': '0'},'1155945683.57dxschafe': {'Type': 'Hay','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1139.626, 312.485, 70.596),'Scale': VBase3(1.966, 1.966, 1.966),'Visual': {'Model': 'models/props/haystack'}},'1155945692.64dxschafe': {'Type': 'Hay','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1144.891, 308.72, 70.019),'Scale': VBase3(1.739, 1.739, 1.739),'Visual': {'Model': 'models/props/haystack'}},'1155945812.54dxschafe': {'Type': 'Animal','Hpr': VBase3(128.187, 0.0, 0.0),'Patrol Radius': 12,'Pos': Point3(-1189.77, 157.002, 54.768),'PoseAnim': '','PoseFrame': '','Respawns': True,'Scale': VBase3(1.0, 1.0, 1.0),'Species': 'Pig','Start State': 'Walk','StartFrame': '0'},'1155945885.17dxschafe': {'Type': 'Pig_stuff','DisableCollision': False,'Hpr': VBase3(-43.856, 4.005, 0.014),'Pos': Point3(-1111.666, 220.959, 69.265),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/pig_pen'}},'1155945912.72dxschafe': {'Type': 'Pig_stuff','DisableCollision': False,'Hpr': VBase3(-43.243, 0.0, 0.0),'Pos': Point3(-1105.278, 222.708, 71.061),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/pigtrough'}},'1155945937.65dxschafe': {'Type': 'Animal','Hpr': VBase3(3.804, 0.0, 0.0),'Patrol Radius': '2.3333','Pos': Point3(-1111.106, 222.1, 70.197),'PoseAnim': '','PoseFrame': '','Respawns': True,'Scale': VBase3(1.0, 1.0, 1.0),'Species': 'Pig','Start State': 'Walk','StartFrame': '0'},'1155946145.17dxschafe': {'Type': 'Stairs','Hpr': VBase3(-123.797, 0.0, 0.0),'Pos': Point3(-1085.526, 262.851, 75.46),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/brick_stairs_single'}},'1155946192.71dxschafe': {'Type': 'Stairs','Hpr': VBase3(-130.777, 0.0, 0.0),'Pos': Point3(-1109.558, 237.626, 71.21),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/brick_stairs_single'}},'1155946215.92dxschafe': {'Type': 'Stairs','Hpr': VBase3(-113.019, 0.0, 0.0),'Pos': Point3(-1057.309, 296.744, 80.544),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/brick_stairs_single'}},'1155946281.86dxschafe': {'Type': 'Wall','Hpr': VBase3(-130.398, -0.225, 6.574),'Pos': Point3(-1056.88, 290.247, 80.487),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/woodfence_60'}},'1155946387.37dxschafe': {'Type': 'Hay','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1039.272, 275.876, 81.443),'Scale': VBase3(2.798, 2.798, 2.798),'Visual': {'Color': (0.6, 0.6, 0.6, 1.0),'Model': 'models/props/haystack'}},'1155946460.27dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(124.302, -5.139, 0.0),'Pos': Point3(-1061.168, 263.53, 79.712),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_c'}},'1155946515.72dxschafe': {'Type': 'Stairs','Hpr': VBase3(-13.957, 0.0, 0.0),'Pos': Point3(-1160.017, 289.615, 67.414),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/stone_stairs_single'}},'1155947101.13dxschafe': {'Type': 'Stairs','Hpr': VBase3(95.962, -0.036, -0.033),'Pos': Point3(-1157.211, 167.33, 58.969),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/stone_stairs_double'}},'1155947190.31dxschafe': {'Type': 'Stairs','Hpr': VBase3(-81.325, 0.0, 0.0),'Pos': Point3(-810.823, 42.684, 98.355),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/brick_stairs_single'}},'1155947249.51dxschafe': {'Type': 'Stairs','Hpr': VBase3(25.078, 0.0, 0.0),'Pos': Point3(-902.744, 61.676, 95.708),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/brick_stairs_single'}},'1155947295.55dxschafe': {'Type': 'Stairs','Hpr': VBase3(34.582, 0.0, 0.0),'Pos': Point3(-846.646, 68.197, 100.235),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/stone_stairs_double'}},'1155947583.34dxschafe': {'Type': 'Stairs','Hpr': VBase3(144.244, 0.0, 0.0),'Pos': Point3(-1054.506, 103.59, 78.53),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/brick_stairs_single'}},'1155947701.62dxschafe': {'Type': 'Stairs','Hpr': VBase3(-32.219, 0.0, 0.0),'Pos': Point3(-942.773, 87.045, 92.544),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/brick_stairs_single'}},'1155947801.43dxschafe': {'Type': 'Log_Stack','DisableCollision': False,'Hpr': VBase3(48.543, 0.0, 0.0),'Pos': Point3(-1066.286, 160.111, 75.205),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/Log_stack_a'}},'1155947898.92dxschafe': {'Type': 'Hay','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, -4.341),'Pos': Point3(-1057.28, 174.718, 76.37),'Scale': VBase3(2.448, 2.448, 2.448),'Visual': {'Model': 'models/props/haystack'}},'1155947955.98dxschafe': {'Type': 'Sack','DisableCollision': False,'Hpr': VBase3(-76.044, 0.0, 0.0),'Pos': Point3(-878.705, -111.684, 98.663),'Scale': VBase3(0.786, 0.786, 0.786),'Visual': {'Model': 'models/props/sack_18stack'}},'1155948010.93dxschafe': {'Type': 'Sack','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-1397.013, 142.779, 7.642),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/sack_18stack'}},'1155948143.7dxschafe': {'Type': 'Log_Stack','DisableCollision': False,'Hpr': VBase3(-23.318, 0.0, -4.43),'Pos': Point3(-906.01, 28.724, 97.498),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/Log_stack_b'}},'1155948260.31dxschafe': {'Type': 'Horse_trough','DisableCollision': False,'Hpr': VBase3(-57.771, 0.0, 0.0),'Pos': Point3(-885.994, 61.164, 97.582),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/horse_trough'}},'1155948286.18dxschafe': {'Type': 'Furniture','DisableCollision': False,'Hpr': VBase3(28.294, 0.0, -2.975),'Pos': Point3(-863.15, 63.065, 99.722),'Scale': VBase3(1.743, 1.743, 1.743),'Visual': {'Model': 'models/props/bench'}},'1155948346.94dxschafe': {'Type': 'Log_Stack','DisableCollision': True,'Hpr': VBase3(67.812, 0.0, 0.0),'Pos': Point3(-1146.408, 298.558, 69.967),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/Log_stack_c'}},'1155948397.45dxschafe': {'Type': 'Horse_trough','DisableCollision': False,'Hpr': VBase3(-44.461, 0.0, 0.0),'Pos': Point3(-1097.874, 198.644, 70.25),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/horse_trough'}},'1155948445.23dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1067.053, -70.049, 76.547),'Scale': VBase3(4.589, 4.589, 4.589),'Visual': {'Model': 'models/vegetation/Cactus_a'}},'1155948476.27dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(114.403, 0.0, 0.0),'Pos': Point3(-1071.083, -64.131, 74.576),'Scale': VBase3(3.349, 3.349, 3.349),'Visual': {'Model': 'models/vegetation/Cactus_a'}},'1155948478.1dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(168.043, 0.0, 0.0),'Pos': Point3(-1067.628, -70.69, 76.357),'Scale': VBase3(4.575, 4.575, 4.575),'Visual': {'Model': 'models/vegetation/Cactus_a'}},'1155948508.96dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-127.912, 0.0, 0.0),'Pos': Point3(-1060.382, -93.817, 79.343),'Scale': VBase3(3.349, 3.349, 3.349),'Visual': {'Model': 'models/vegetation/Cactus_a'}},'1155948519.59dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-49.334, 0.0, 0.0),'Pos': Point3(-1065.734, -154.219, 79.525),'Scale': VBase3(3.349, 3.349, 3.349),'Visual': {'Model': 'models/vegetation/Cactus_a'}},'1155948583.47dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-162.646, 0.0, 0.0),'Pos': Point3(-1118.931, 14.26, 56.259),'Scale': VBase3(3.349, 3.349, 3.349),'Visual': {'Model': 'models/vegetation/Cactus_a'}},'1155948596.8dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-28.206, 12.254, -16.666),'Pos': Point3(-1123.433, 13.525, 54.99),'Scale': VBase3(6.873, 6.873, 6.873),'Visual': {'Model': 'models/vegetation/Cactus_a'}},'1155948635.89dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-4.112, 0.106, -2.057),'Pos': Point3(-904.262, -199.699, 97.453),'Scale': VBase3(4.14, 4.14, 4.14),'Visual': {'Model': 'models/vegetation/Cactus_a'}},'1155948667.04dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(96.932, -2.039, 0.29),'Pos': Point3(-904.491, -195.744, 96.98),'Scale': VBase3(4.14, 4.14, 4.14),'Visual': {'Model': 'models/vegetation/Cactus_b'}},'1155948683.66dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(96.932, -2.039, 0.29),'Pos': Point3(-905.754, -198.925, 96.903),'Scale': VBase3(4.14, 4.14, 4.14),'Visual': {'Model': 'models/vegetation/Cactus_a'}},'1155948708.34dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(96.932, -2.039, 0.29),'Pos': Point3(-907.416, -197.09, 96.744),'Scale': VBase3(3.056, 3.056, 3.056),'Visual': {'Model': 'models/vegetation/Cactus_b'}},'1155948726.44dxschafe': {'Type': 'Cacti','DisableCollision': True,'Hpr': VBase3(96.932, -2.039, 0.29),'Pos': Point3(-1012.622, -279.304, 83.434),'Scale': VBase3(3.056, 3.056, 3.056),'Visual': {'Model': 'models/vegetation/Cactus_b'}},'1155948736.37dxschafe': {'Type': 'Cacti','DisableCollision': True,'Hpr': VBase3(-70.893, 1.932, -0.714),'Pos': Point3(-1012.707, -276.701, 83.406),'Scale': VBase3(2.098, 2.098, 2.098),'Visual': {'Model': 'models/vegetation/Cactus_b'}},'1155948775.77dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(96.932, -2.039, 0.29),'Pos': Point3(-875.086, -131.107, 98.516),'Scale': VBase3(3.423, 3.423, 3.423),'Visual': {'Model': 'models/vegetation/Cactus_b'}},'1155948783.19dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(96.932, -2.039, 0.29),'Pos': Point3(-871.2, -142.306, 99.209),'Scale': VBase3(5.479, 5.479, 5.479),'Visual': {'Model': 'models/vegetation/Cactus_b'}},'1155948799.8dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(96.932, -2.039, 0.29),'Pos': Point3(-876.402, -132.665, 98.5),'Scale': VBase3(2.331, 2.331, 2.331),'Visual': {'Model': 'models/vegetation/Cactus_b'}},'1155948837.11dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-108.936, 1.962, 0.628),'Pos': Point3(-1005.786, -429.006, 102.941),'Scale': VBase3(3.977, 3.977, 3.977),'Visual': {'Model': 'models/vegetation/Cactus_a'}},'1155948847.17dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(96.932, -2.039, 0.29),'Pos': Point3(-1001.911, -427.415, 102.995),'Scale': VBase3(2.331, 2.331, 2.331),'Visual': {'Model': 'models/vegetation/Cactus_a'}},'1155948849.72dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(107.816, -1.948, 0.67),'Pos': Point3(-1004.578, -420.277, 101.537),'Scale': VBase3(2.331, 2.331, 2.331),'Visual': {'Model': 'models/vegetation/Cactus_a'}},'1155948850.35dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-174.709, 0.232, 2.047),'Pos': Point3(-1006.999, -420.367, 101.258),'Scale': VBase3(2.331, 2.331, 2.331),'Visual': {'Model': 'models/vegetation/Cactus_a'}},'1155948990.46dxschafe': {'Type': 'Furniture','DisableCollision': False,'Hpr': VBase3(-135.447, 1.047, 1.206),'Pos': Point3(-1161.834, 378.042, 68.764),'Scale': VBase3(1.747, 1.747, 1.747),'Visual': {'Model': 'models/props/bench'}},'1155948998.15dxschafe': {'Type': 'Furniture','DisableCollision': False,'Hpr': VBase3(-129.684, 0.994, -0.575),'Pos': Point3(-1175.408, 391.671, 67.827),'Scale': VBase3(1.747, 1.747, 1.747),'Visual': {'Model': 'models/props/bench'}},'1155949073.86dxschafe': {'Type': 'Hay','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, 2.092),'Pos': Point3(-1180.61, 333.159, 66.678),'Scale': VBase3(2.262, 2.262, 2.262),'Visual': {'Model': 'models/props/haystack'}},'1156182759.75dxschafe': {'Type': 'Log_Stack','DisableCollision': True,'Hpr': VBase3(13.402, 5.354, -5.736),'Pos': Point3(-1170.619, 192.868, 60.404),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/Log_stack_b'}},'1156182904.01dxschafe': {'Type': 'Well','DisableCollision': False,'Hpr': VBase3(122.626, 0.0, 0.0),'Pos': Point3(-1170.915, 257.137, 67.685),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/well_Bstucco'}},'1156182940.72dxschafe': {'Type': 'Stairs','Hpr': VBase3(149.462, 0.0, 0.0),'Pos': Point3(-1179.449, 217.157, 62.874),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/buildings/brick_stairs_single'}},'1156182985.26dxschafe': {'Type': 'Barrel','DisableCollision': True,'Hpr': VBase3(60.28, -3.447, -6.79),'Pos': Point3(-1172.304, 201.197, 61.228),'Scale': VBase3(0.706, 0.706, 0.706),'Visual': {'Model': 'models/props/barrel_group_3'}},'1156183097.15dxschafe': {'Type': 'Horse_trough','DisableCollision': True,'Hpr': VBase3(93.039, 0.0, 0.0),'Pos': Point3(-1180.872, 154.543, 53.981),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/horse_trough'}},'1156183290.24dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-1371.461, 122.05, 33.458),'Scale': VBase3(1.788, 1.788, 1.788),'Visual': {'Model': 'models/props/crate_group_net'}},'1156183642.53dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1567.684, -653.558, 150.396),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6600000262260437, 0.5400000214576721, 0.4699999988079071, 1.0),'Model': 'models/props/crates_group_1'}},'1156183661.28dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(23.519, 2.863, -0.899),'Pos': Point3(484.877, -1331.243, 42.395),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/crates_group_1'}},'1156183664.31dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(-16.704, 1.506, -0.04),'Pos': Point3(686.979, -1214.675, 34.414),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/crates_group_1'}},'1156183674.35dxschafe': {'Type': 'Crate','DisableCollision': True,'GridPos': Point3(571.414, -1238.425, 30.218),'Hpr': VBase3(179.658, 0.0, 0.0),'Pos': Point3(571.414, -1238.425, 30.077),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/crates_group_1'}},'1156183688.01dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1566.701, -647.744, 150.489),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/crates_group_2'}},'1156183696.74dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(167.962, -4.597, -0.895),'Pos': Point3(698.915, -1272.52, 31.343),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/crates_group_1'}},'1156183697.76dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(-113.361, -2.378, 1.27),'Pos': Point3(546.978, -1264.928, 31.277),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.6000000238418579, 0.6000000238418579, 0.6000000238418579, 1.0),'Model': 'models/props/crates_group_1'}},'1156183850.87dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1568.721, -695.468, 150.324),'Hpr': VBase3(11.772, 0.0, 0.0),'Pos': Point3(530.162, -1259.869, 31.331),'Scale': VBase3(0.659, 0.659, 0.659),'Visual': {'Color': (0.699999988079071, 0.699999988079071, 0.699999988079071, 1.0),'Model': 'models/props/barrel_group_2'}},'1156183854.4dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1568.721, -695.468, 150.324),'Hpr': VBase3(56.147, -0.115, -4.586),'Pos': Point3(696.146, -1300.603, 29.405),'Scale': VBase3(0.664, 0.664, 0.664),'Visual': {'Model': 'models/props/barrel_group_2'}},'1156381848.24dxschafe': {'Type': 'Log_Stack','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(507.461, -1284.65, 29.847),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.5, 0.5, 0.5, 1.0),'Model': 'models/props/Log_stack_a'}},'1156382924.75dxschafe': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(-65.46, 3.155, 4.296),'Pos': Point3(500.595, -1127.065, 36.347),'Scale': VBase3(1.376, 1.376, 1.376),'Visual': {'Model': 'models/vegetation/bush_c'}},'1156383048.91dxschafe': {'Type': 'Cart','DisableCollision': False,'Hpr': VBase3(12.853, 0.0, 0.0),'Pos': Point3(628.788, -1190.088, 33.024),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cart_broken'}},'1156383144.19dxschafe': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(169.768, -5.799, 0.0),'Pos': Point3(746.543, -1349.996, 22.549),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_d'}},'1157097728.52jasyeung': {'Type': 'Townsperson','Category': 'Shipwright','AnimSet': 'default','CustomModel': 'None','Hpr': VBase3(-143.914, 0.0, 0.0),'Patrol Radius': '12.0000','Pos': Point3(-1065.128, -223.153, 78.848),'PoseAnim': '','PoseFrame': '','Private Status': 'All','Respawns': True,'Scale': VBase3(1.0, 1.0, 1.0),'ShopID': 'PORT_ROYAL_DEFAULTS','Start State': 'Idle','StartFrame': '0','Team': 'Villager','TrailFX': 'None'},'1157097924.52jasyeung': {'Type': 'Townsperson','Category': 'Gypsy','Aggro Radius': '12.0000','AnimSet': 'default','CustomModel': 'None','Hpr': VBase3(144.557, 0.0, 0.0),'Patrol Radius': '4.1667','Pos': Point3(-985.703, 506.256, 96.56),'PoseAnim': '','PoseFrame': '','Private Status': 'All','Respawns': True,'Scale': VBase3(1.0, 1.0, 1.0),'ShopID': 'PORT_ROYAL_DEFAULTS','Start State': 'Idle','StartFrame': '0','Team': 'Villager','TrailFX': 'None'},'1157097962.5jasyeung': {'Type': 'Townsperson','Category': 'Commoner','Aggro Radius': '12.0000','AnimSet': 'coin_flip','CustomModel': 'None','DNA': '1157097962.5jasyeung','Hpr': VBase3(141.157, 0.0, 0.0),'Patrol Radius': '12.0000','Pos': Point3(-893.9, -99.789, 98.332),'PoseAnim': '','PoseFrame': '','Private Status': 'All','Respawns': True,'Scale': VBase3(1.0, 1.0, 1.0),'ShopID': 'PORT_ROYAL_DEFAULTS','Start State': 'Walk','StartFrame': '0','Team': 'Villager','TrailFX': 'None'},'1157139270.98dxschafe': {'Type': 'Pier','Hpr': VBase3(62.956, 0.0, 0.0),'Objects': {'1157149352.85dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(481.285, -1538.013, 30.914),'Hpr': VBase3(85.273, 0.0, 0.0),'Pos': Point3(1.23, 36.293, 33.651),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/barrel_group_3'}},'1157149387.27dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(479.031, -1545.906, 31.046),'Hpr': VBase3(-62.956, 0.0, 0.0),'Pos': Point3(-6.824, 34.713, 33.783),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/barrel_group_3'}},'1157149738.37dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(499.187, -1493.349, 5.659),'Hpr': VBase3(44.125, 0.0, 0.0),'Pos': Point3(49.15, 40.657, 8.396),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.97, 0.93, 1.0, 1.0),'Model': 'models/props/barrel_sideways'}}},'Pos': Point3(513.051, -1555.611, -2.736),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/islands/pier_platform'}},'1157144544.82dxschafe': {'Type': 'Pier','GridPos': Point3(494.924, -1608.88, -0.83),'Hpr': VBase3(-38.759, 0.0, 0.0),'Objects': {'1155772636.68dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1546.847, 217.387, 6.877),'Hpr': VBase3(-0.029, 0.0, 0.0),'Pos': Point3(-136.654, 13.613, 7.705),'Scale': VBase3(0.662, 0.662, 0.662),'Visual': {'Model': 'models/props/barrel_group_3'}},'1155772637.15dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1519.26, 197.55, 6.851),'Hpr': VBase3(38.759, 0.0, 0.0),'Pos': Point3(-102.724, 15.414, 7.679),'Scale': VBase3(0.603, 0.603, 0.603),'Visual': {'Model': 'models/props/barrel_worn'}},'1155773758.38dxschafe': {'Type': 'Crate','DisableCollision': False,'GridPos': Point3(-1555.087, 225.929, 6.676),'Hpr': VBase3(-3.645, 0.0, 0.0),'Pos': Point3(-148.427, 15.115, 7.504),'Scale': VBase3(0.818, 0.818, 0.818),'Visual': {'Model': 'models/props/crates_group_1'}},'1155773759.29dxschafe': {'Type': 'Crate','DisableCollision': False,'GridPos': Point3(-1551.978, 222.712, 6.7),'Hpr': VBase3(38.759, 0.0, 0.0),'Objects': {'1155772636.23dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1552.669, 222.021, 9.958),'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-0.691, -0.69, 2.75),'Scale': VBase3(0.473, 0.473, 0.473),'Visual': {'Model': 'models/props/barrel'}}},'Pos': Point3(-143.989, 14.553, 7.528),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/crate'}},'1155773953.71dxschafe': {'Type': 'Rope','DisableCollision': False,'GridPos': Point3(-1519.288, 195.452, 6.781),'Hpr': VBase3(38.759, 0.0, 0.0),'Pos': Point3(-101.432, 13.762, 7.609),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/rope_pile'}},'1155773957.76dxschafe': {'Type': 'Rope','DisableCollision': False,'GridPos': Point3(-1570.935, 212.224, 6.973),'Hpr': VBase3(38.759, 0.0, 0.0),'Pos': Point3(-152.205, -5.494, 7.801),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/rope_pile'}},'1155773963.09dxschafe': {'Type': 'Rope','DisableCollision': False,'GridPos': Point3(-1486.401, 147.6, 7.208),'Hpr': VBase3(38.759, 0.0, 0.0),'Pos': Point3(-45.83, -2.964, 8.036),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/rope_pile'}},'1155774149.67dxschafe': {'Type': 'Bucket','DisableCollision': False,'GridPos': Point3(-1560.109, 225.825, 6.821),'Hpr': VBase3(38.759, 0.0, 0.0),'Pos': Point3(-152.279, 11.89, 7.649),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/bucket'}},'1192733659.33akelts': {'Type': 'Collision Barrier','DisableCollision': False,'GridPos': Point3(-1486.762, 183.516, -0.769),'Hpr': VBase3(-117.304, 0.0, 0.0),'Pos': Point3(-68.596, 24.817, 0.059),'Scale': VBase3(1.533, 1.0, 1.0),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1192733746.33akelts': {'Type': 'Collision Barrier','DisableCollision': False,'GridPos': Point3(-1558.817, 195.502, -1.167),'Hpr': VBase3(-66.539, 0.0, 0.0),'Pos': Point3(-132.287, -10.947, -0.339),'Scale': VBase3(1.224, 1.0, 1.104),'Visual': {'Model': 'models/misc/coll_plane_barrier'}}},'Pos': Point3(-1448.808, 121.22, -0.828),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/islands/pier_walkway'}},'1157144574.32dxschafe': {'Type': 'Pier','GridPos': Point3(494.924, -1608.88, -0.83),'Hpr': VBase3(-37.367, 0.0, 0.0),'Objects': {'1155774004.04dxschafe': {'Type': 'Rope','DisableCollision': False,'GridPos': Point3(-1416.104, 76.751, 8.517),'Hpr': VBase3(37.367, 0.0, 0.0),'Pos': Point3(-4.053, -26.833, 8.517),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/rope_pile'}},'1175721216.0dxschafe': {'Type': 'Townsperson','Category': 'Commoner','Aggro Radius': '12.0000','AnimSet': 'default','CustomModel': 'None','DNA': '1175721216.0dxschafe','GridPos': Point3(-1375.244, 82.982, 7.663),'Hpr': VBase3(150.163, 0.0, 0.0),'Patrol Radius': '12.0000','Pos': Point3(24.64, 2.919, 8.517),'PoseAnim': '','PoseFrame': '','Private Status': 'All','Respawns': True,'Scale': VBase3(1.0, 1.0, 1.0),'ShopID': 'PORT_ROYAL_DEFAULTS','Start State': 'Walk','StartFrame': '0','Team': 'Villager','TrailFX': 'None'},'1184028369.52kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'GridPos': Point3(-1381.787, 42.833, 6.839),'Hpr': VBase3(14.228, 0.0, 0.0),'Pos': Point3(43.807, -32.962, 7.693),'Scale': VBase3(4.993, 1.794, 2.405),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1186087680.0dxschafe': {'Type': 'Player Spawn Node','GridPos': Point3(-1373.702, 82.207, 7.663),'Hpr': VBase3(97.125, 0.0, 0.0),'Index': 1,'Pos': Point3(26.336, 3.238, 8.517),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}}},'Pos': Point3(-1396.598, 95.617, -0.983),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/islands/pier_platform'}},'1157145675.46dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(148.909, 0.0, 0.0),'Pos': Point3(-1492.295, 153.04, 6.725),'Scale': VBase3(1.788, 1.788, 1.788),'Visual': {'Model': 'models/props/crate_group_net'}},'1157145751.12dxschafe': {'Type': 'Cacti','DisableCollision': True,'Hpr': VBase3(-114.412, 0.751, -3.232),'Pos': Point3(-1010.5, -512.479, 109.056),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157145760.13dxschafe': {'Type': 'Cacti','DisableCollision': True,'Hpr': VBase3(-69.073, 0.0, 0.0),'Pos': Point3(-1002.956, -498.362, 108.542),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157145774.46dxschafe': {'Type': 'Cacti','DisableCollision': True,'Hpr': VBase3(-51.383, 0.0, -3.36),'Pos': Point3(-982.889, -588.378, 117.924),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157145785.44dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-116.856, 0.0, 0.0),'Pos': Point3(-1127.61, -691.787, 118.158),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157145805.24dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-153.859, 0.0, 0.0),'Pos': Point3(-1189.18, -670.919, 119.533),'Scale': VBase3(1.721, 1.721, 1.721),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157145810.96dxschafe': {'Type': 'Cacti','DisableCollision': True,'Hpr': VBase3(95.862, 0.863, 5.086),'Pos': Point3(-1327.048, -516.326, 116.988),'Scale': VBase3(1.659, 1.659, 1.659),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157145817.35dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(45.204, -6.908, 5.275),'Pos': Point3(-1139.506, -473.064, 102.037),'Scale': VBase3(1.135, 1.135, 1.135),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157145818.51dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-153.431, 5.021, -4.881),'Pos': Point3(-1128.132, -450.662, 98.449),'Scale': VBase3(2.38, 2.38, 2.38),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157145828.43dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(81.732, -7.154, 19.708),'Pos': Point3(-1083.298, -350.036, 79.087),'Scale': VBase3(1.259, 1.259, 1.259),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157145849.99dxschafe': {'Type': 'Cacti','DisableCollision': True,'Hpr': VBase3(74.527, 0.0, 2.436),'Pos': Point3(-1234.024, -772.755, 122.122),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157145855.67dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-164.011, -1.009, 0.129),'Pos': Point3(-950.664, -779.583, 120.21),'Scale': VBase3(2.185, 2.185, 2.185),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157145859.1dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(75.803, -3.069, -2.216),'Pos': Point3(-1019.768, -712.502, 118.058),'Scale': VBase3(1.399, 1.399, 1.399),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157145864.65dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(74.527, 0.0, 0.698),'Pos': Point3(-1329.662, -583.869, 120.708),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157145908.37dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(119.08, 0.0, 0.0),'Pos': Point3(-1317.578, -624.053, 121.733),'Scale': VBase3(1.657, 1.657, 1.657),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157145919.98dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-141.183, 0.0, 0.0),'Pos': Point3(-1115.603, -679.75, 117.756),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157145928.07dxschafe': {'Type': 'Cacti','DisableCollision': True,'Hpr': VBase3(-84.252, 5.039, -4.427),'Pos': Point3(-1013.339, -526.005, 110.77),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157145938.12dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-22.657, 0.0, 0.0),'Pos': Point3(-925.7, -645.346, 120.812),'Scale': VBase3(1.439, 1.439, 1.439),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157145951.17dxschafe': {'Type': 'Cacti','DisableCollision': True,'Hpr': VBase3(104.004, -2.689, 8.186),'Pos': Point3(-1012.055, -410.45, 98.926),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157145985.93dxschafe': {'Type': 'Cacti','DisableCollision': True,'Hpr': VBase3(92.112, -3.866, 5.296),'Pos': Point3(-1009.253, -451.461, 105.275),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157145995.87dxschafe': {'Type': 'Cacti','DisableCollision': True,'Hpr': VBase3(-57.381, 0.633, -6.523),'Pos': Point3(-991.688, -573.875, 116.484),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157146026.73dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-76.474, -1.335, 0.707),'Pos': Point3(-904.22, -688.452, 120.847),'Scale': VBase3(1.373, 1.373, 1.373),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157146053.46dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(17.026, -1.806, 4.127),'Pos': Point3(-1262.191, -468.91, 113.046),'Scale': VBase3(1.802, 1.802, 1.802),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157146159.7dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(92.003, -4.066, 13.246),'Pos': Point3(-1089.345, -384.861, 88.977),'Scale': VBase3(1.678, 1.678, 1.678),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157146184.65dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(0.7, -1.985, 0.868),'Pos': Point3(-1254.028, -605.406, 119.133),'Scale': VBase3(1.807, 1.807, 1.807),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157146478.64dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(138.839, -6.307, -10.248),'Pos': Point3(-1228.563, 67.516, 40.528),'Scale': VBase3(1.802, 1.802, 1.802),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157146526.89dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(71.277, 1.348, -3.958),'Pos': Point3(-1239.398, 126.101, 50.675),'Scale': VBase3(1.802, 1.802, 1.802),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157146558.16dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(114.573, 2.419, 0.126),'Pos': Point3(-1073.281, 515.65, 96.81),'Scale': VBase3(1.802, 1.802, 1.802),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157146590.97dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-23.629, 0.981, 1.177),'Pos': Point3(-1017.262, 570.359, 96.675),'Scale': VBase3(1.802, 1.802, 1.802),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157146605.59dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-23.629, 0.981, 2.787),'Pos': Point3(-960.339, 407.435, 96.651),'Scale': VBase3(1.802, 1.802, 1.802),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157146634.11dxschafe': {'Type': 'Cacti','DisableCollision': True,'Hpr': VBase3(-142.561, 0.0, 8.678),'Pos': Point3(-1035.809, 327.424, 85.035),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157146659.53dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-142.561, 0.0, 8.678),'Pos': Point3(-968.396, 389.445, 95.648),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157146935.28dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(36.38, -0.04, 2.166),'Pos': Point3(-815.183, 104.025, 98.624),'Scale': VBase3(1.504, 1.504, 1.504),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157147129.36dxschafe': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(166.713, 0.0, 0.0),'Pos': Point3(-1230.147, 147.961, 53.576),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_d'}},'1157147420.64dxschafe': {'Type': 'Animal','Hpr': VBase3(-156.379, 0.0, 0.0),'Patrol Radius': 12,'Pos': Point3(-1212.014, 169.749, 55.967),'PoseAnim': '','PoseFrame': '','Respawns': True,'Scale': VBase3(1.0, 1.0, 1.0),'Species': 'Pig','Start State': 'Walk','StartFrame': '0'},'1157147497.41dxschafe': {'Type': 'Pier','Hpr': VBase3(12.919, 0.0, 0.0),'Objects': {'1155772607.13dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1395.471, -448.554, 7.426),'Hpr': VBase3(-122.251, 0.0, 0.0),'Pos': Point3(-141.395, -4.861, 7.528),'Scale': VBase3(0.728, 0.728, 0.728),'Visual': {'Model': 'models/props/barrel_sideways'}},'1155772611.87dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1401.143, -450.897, 7.593),'Hpr': VBase3(-13.175, 0.0, 0.0),'Pos': Point3(-147.447, -5.877, 7.695),'Scale': VBase3(0.731, 0.731, 0.731),'Visual': {'Model': 'models/props/barrel_worn'}},'1155772616.24dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1286.85, -421.404, 7.662),'Hpr': VBase3(-2.433, 0.0, 0.0),'Pos': Point3(-29.453, -2.682, 7.764),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.62, 0.6, 0.5764705882352941, 1.0),'Model': 'models/props/barrel_group_1'}},'1155772616.84dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1298.387, -426.69, 7.462),'Hpr': VBase3(-13.175, 0.0, 0.0),'Pos': Point3(-41.88, -5.256, 7.564),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.81, 0.83, 0.7058823529411765, 1.0),'Model': 'models/props/barrel'}},'1155772617.41dxschafe': {'Type': 'Barrel','DisableCollision': False,'GridPos': Point3(-1313.579, -430.396, 7.591),'Hpr': VBase3(-13.175, 0.0, 0.0),'Pos': Point3(-57.517, -5.472, 7.693),'Scale': VBase3(0.831, 0.831, 0.831),'Visual': {'Color': (0.87, 0.79, 0.7098039215686275, 1.0),'Model': 'models/props/barrel_worn'}},'1155773972.48dxschafe': {'Type': 'Rope','DisableCollision': False,'GridPos': Point3(-1408.524, -428.544, 7.597),'Hpr': VBase3(-10.859, 0.0, 0.0),'Pos': Point3(-149.644, 17.561, 7.699),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/rope_pile'}},'1155773975.89dxschafe': {'Type': 'Rope','DisableCollision': False,'GridPos': Point3(-1337.728, -413.84, 7.471),'Hpr': VBase3(-13.175, 0.0, -0.533),'Pos': Point3(-77.352, 16.064, 7.573),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/rope_pile'}},'1155773977.74dxschafe': {'Type': 'Rope','DisableCollision': False,'GridPos': Point3(-1286.038, -400.531, 7.569),'Hpr': VBase3(-13.175, 0.0, 0.0),'Pos': Point3(-23.995, 17.48, 7.671),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/rope_pile'}},'1155773981.17dxschafe': {'Type': 'Rope','DisableCollision': False,'GridPos': Point3(-1316.899, -430.08, 7.454),'Hpr': VBase3(-13.175, 0.0, 0.0),'Pos': Point3(-60.681, -4.421, 7.556),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/rope_pile'}},'1155774164.22dxschafe': {'Type': 'Bucket','DisableCollision': False,'GridPos': Point3(-1288.166, -403.179, 7.666),'Hpr': VBase3(-13.175, 0.0, 0.0),'Pos': Point3(-26.661, 15.375, 7.768),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/bucket'}}},'Pos': Point3(-1258.742, -412.204, -0.102),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.699999988079071, 0.699999988079071, 0.699999988079071, 1.0),'Model': 'models/islands/pier_walkway'}},'1157147919.6dxschafe': {'Type': 'Bridge','Hpr': VBase3(-90.954, 0.0, 0.0),'Pos': Point3(-1066.032, -322.152, 65.32),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/islands/pier_bridge'}},'1157148044.76dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(19.295, 2.464, -1.29),'Pos': Point3(650.775, -1087.153, 40.078),'Scale': VBase3(1.935, 1.935, 1.935),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157148058.4dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(19.295, 5.124, 7.372),'Pos': Point3(889.493, -1247.407, 20.463),'Scale': VBase3(1.935, 1.935, 1.935),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157148068.83dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(18.441, 4.927, 9.842),'Pos': Point3(304.74, -1343.162, 35.698),'Scale': VBase3(1.935, 1.935, 1.935),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157148075.91dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(19.295, 0.0, 0.0),'Pos': Point3(476.21, -1132.207, 36.696),'Scale': VBase3(1.935, 1.935, 1.935),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157148087.6dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(19.295, 0.0, 0.0),'Pos': Point3(376.693, -1309.482, 26.099),'Scale': VBase3(1.935, 1.935, 1.935),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157148100.09dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(19.338, 1.533, -1.612),'Pos': Point3(575.848, -1107.131, 38.402),'Scale': VBase3(1.935, 1.935, 1.935),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157148182.43dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(111.45, 0.0, -6.675),'Pos': Point3(492.281, -1370.214, 24.028),'Scale': VBase3(1.935, 1.935, 1.935),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157148213.45dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(77.584, 3.731, -5.539),'Pos': Point3(333.716, -1228.575, 31.96),'Scale': VBase3(2.875, 2.875, 2.875),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157148589.72dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-45.322, 3.957, 0.0),'Pos': Point3(785.799, -1146.65, 35.335),'Scale': VBase3(1.935, 1.935, 1.935),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157148620.8dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(147.739, 1.053, 1.235),'Pos': Point3(813.421, -1261.02, 28.64),'Scale': VBase3(2.143, 2.143, 2.143),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157148724.52dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(82.032, 0.433, -10.139),'Pos': Point3(505.666, -1436.69, 17.031),'Scale': VBase3(2.143, 2.143, 2.143),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157148817.48dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-125.769, 0.433, -7.064),'Pos': Point3(673.986, 121.038, 49.814),'Scale': VBase3(2.143, 2.143, 2.143),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157148820.47dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(26.43, 0.433, -7.064),'Pos': Point3(675.282, 118.1, 50.037),'Scale': VBase3(2.143, 2.143, 2.143),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157148825.13dxschafe': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(178.629, 0.433, -7.064),'Pos': Point3(679.335, 120.192, 49.705),'Scale': VBase3(2.143, 2.143, 2.143),'Visual': {'Model': 'models/vegetation/rock_cacti_group_linear'}},'1157148936.24dxschafe': {'Type': 'Cacti','DisableCollision': False,'GridPos': Point3(496.268, -1328.61, 26.868),'Hpr': VBase3(-145.06, -3.038, 0.606),'Pos': Point3(489.029, -1198.538, 30.868),'Scale': VBase3(1.877, 1.877, 1.877),'Visual': {'Model': 'models/vegetation/rock_cacti_group_circle'}},'1157149057.61dxschafe': {'Type': 'Pier','Hpr': VBase3(61.522, 0.0, 0.0),'Objects': {},'Pos': Point3(497.683, -1609.675, -1.768),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/islands/pier_walkway'}},'1157149172.07dxschafe': {'Type': 'Crane','Hpr': VBase3(-115.722, 0.0, 0.0),'Pos': Point3(456.12, -1587.028, 5.982),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/Crane'}},'1157149393.54dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': VBase3(-174.347, 0.0, 0.0),'Pos': Point3(479.934, -1539.525, 5.669),'Scale': VBase3(0.852, 0.852, 0.852),'Visual': {'Color': (0.79, 0.82, 0.8, 1.0),'Model': 'models/props/barrel_group_2'}},'1157149399.82dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': VBase3(123.044, 0.0, 0.0),'Pos': Point3(521.291, -1615.858, 5.696),'Scale': VBase3(0.802, 0.802, 0.802),'Visual': {'Model': 'models/props/barrel'}},'1157149400.65dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': VBase3(2.465, 0.0, 0.0),'Pos': Point3(513.608, -1617.684, 5.401),'Scale': VBase3(0.844, 0.844, 0.844),'Visual': {'Model': 'models/props/barrel_group_1'}},'1157149508.2dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(465.34, -1577.213, 5.63),'Scale': VBase3(1.414, 1.414, 1.414),'Visual': {'Color': (0.78, 0.84, 0.8117647058823529, 1.0),'Model': 'models/props/crate'}},'1157149511.76dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(461.193, -1577.854, 5.663),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (1.0, 0.93, 0.7568627450980392, 1.0),'Model': 'models/props/crates_group_1'}},'1157149512.2dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(80.003, 0.0, 0.0),'Pos': Point3(464.419, -1572.144, 5.626),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.82, 0.72, 0.6666666666666666, 1.0),'Model': 'models/props/crates_group_1'}},'1157149512.71dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(465.048, -1567.168, 5.704),'Scale': VBase3(1.303, 1.303, 1.303),'Visual': {'Color': (1.0, 0.93, 0.7568627450980392, 1.0),'Model': 'models/props/crate'}},'1157149526.42dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(557.101, -1530.134, 0.344),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/crate'}},'1157149781.11dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': VBase3(-159.602, 0.0, 0.0),'Pos': Point3(496.203, -1499.749, 5.436),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.8, 0.75, 0.6392156862745098, 1.0),'Model': 'models/props/barrel_sideways'}},'1157149801.34dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': VBase3(-92.16, -0.791, -0.329),'Pos': Point3(502.039, -1497.784, 5.712),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (1.0, 0.93, 0.7568627450980392, 1.0),'Model': 'models/props/barrel_sideways'}},'1157151456.44dxschafe': {'Type': 'Tunnel Cap','Hpr': VBase3(46.878, 0.0, 0.0),'Pos': Point3(-1082.989, 568.505, 99.083),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (1.0, 0.75, 0.75, 1.0),'Model': 'models/tunnels/tunnelcap_volcano'}},'1157484771.28dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, -2.4),'Pos': Point3(-1069.34, -236.326, 78.37),'Scale': VBase3(0.783, 0.783, 0.783),'Visual': {'Model': 'models/props/barrel_grey'}},'1157484843.04dxschafe': {'Type': 'Paddle','Hpr': VBase3(65.292, -33.084, -9.364),'Pos': Point3(-1067.181, -237.36, 78.48),'Scale': VBase3(1.847, 1.847, 1.847),'Visual': {'Model': 'models/props/paddle_A'}},'1157484938.58dxschafe': {'Type': 'Bucket','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-1066.941, -236.699, 78.619),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/bucket'}},'1157484949.25dxschafe': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(39.467, 0.0, -3.84),'Pos': Point3(-1052.492, -227.928, 79.911),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/crates_group_1'}},'1157485013.63dxschafe': {'Type': 'Barrel','DisableCollision': False,'Hpr': VBase3(-58.925, 1.866, -3.426),'Pos': Point3(-1060.01, -253.207, 79.186),'Scale': VBase3(0.783, 0.783, 0.783),'Visual': {'Model': 'models/props/barrel_group_3'}},'1157485107.05dxschafe': {'Type': 'Sack','DisableCollision': False,'Hpr': VBase3(-59.613, 12.675, -1.368),'Pos': Point3(-1041.477, -244.293, 80.688),'Scale': VBase3(0.777, 0.777, 0.777),'Visual': {'Model': 'models/props/sack_6stack'}},'1157490715.58dxschafe': {'Type': 'Stairs','Hpr': VBase3(-32.652, 0.0, 0.0),'Pos': Point3(-952.0, 104.345, 88.752),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.47999998927116394, 0.4399999976158142, 0.3700000047683716, 1.0),'Model': 'models/buildings/stone_stairs_double'}},'1157490742.74dxschafe': {'Type': 'Stairs','Hpr': VBase3(-32.652, 0.0, 0.0),'Pos': Point3(-967.421, 111.138, 87.687),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.48, 0.44, 0.37, 1.0),'Model': 'models/buildings/stone_stairs_double'}},'1157670645.75dxschafe': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(16.446, 4.821, -9.86),'Pos': Point3(-1082.259, 320.655, 76.311),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/fern_tree_d'}},'1157671725.5dxschafe': {'Type': 'Animal','Hpr': Point3(0.0, 0.0, 0.0),'Patrol Radius': '12.0000','Pos': Point3(-1126.594, 258.198, 71.019),'PoseAnim': '','PoseFrame': '','Respawns': True,'Scale': VBase3(1.0, 1.0, 1.0),'Species': 'Rooster','Start State': 'Walk','StartFrame': '0'},'1158120438.44sdnaik': {'Type': 'Locator Node','Name': 'portal_exterior_2','Hpr': VBase3(-133.791, 0.0, 0.0),'Pos': Point3(-769.9, 130.039, 98.506),'Scale': VBase3(1.0, 1.0, 1.0)},'1158120448.17sdnaik': {'Type': 'Locator Node','Name': 'portal_exterior_3','Hpr': VBase3(-43.496, 0.0, 0.0),'Pos': Point3(-1083.39, 570.413, 99.164),'Scale': VBase3(1.0, 1.0, 1.0)},'1158120851.02sdnaik': {'Type': 'Connector Tunnel','File': '','Hpr': VBase3(43.298, 0.0, 0.0),'Objects': {'1158120851.05sdnaik': {'Type': 'Locator Node','Name': 'portal_connector_1','Hpr': VBase3(91.003, 0.0, 0.0),'Pos': Point3(95.197, 150.0, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)},'1158120851.09sdnaik': {'Type': 'Locator Node','Name': 'portal_connector_2','GridPos': Point3(-1334.578, 1072.954, 198.976),'Hpr': VBase3(-91.316, 0.0, 0.0),'Pos': Point3(0.0, 3.262, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-1189.695, 830.134, 328.63),'Scale': VBase3(0.917, 0.917, 0.917),'Visual': {'Model': 'models/tunnels/tunnel_volcano_left'}},'1158121685.53sdnaik': {'Type': 'Connector Tunnel','File': '','Hpr': VBase3(75.992, -1.249, 1.465),'Objects': {'1158121685.56sdnaik': {'Type': 'Locator Node','Name': 'portal_connector_1','Hpr': VBase3(91.003, 0.0, 0.0),'Pos': Point3(95.197, 150.0, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)},'1158121685.63sdnaik': {'Type': 'Locator Node','Name': 'portal_connector_2','GridPos': Point3(-801.382, 1019.754, 373.737),'Hpr': VBase3(-91.316, 0.0, 0.0),'Pos': Point3(0.0, 3.262, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(1041.847, 2345.234, 509.302),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/tunnels/tunnel_volcano_left'}},'1158123603.92sdnaik': {'Type': 'Locator Node','Name': 'portal_exterior_4','Hpr': VBase3(-144.565, 0.0, 0.0),'Pos': Point3(-896.895, -654.409, 122.037),'Scale': VBase3(1.0, 1.0, 1.0)},'1158123738.75sdnaik': {'Type': 'Connector Tunnel','File': '','Hpr': Point3(0.0, 0.0, 0.0),'Objects': {'1158123738.78sdnaik': {'Type': 'Locator Node','Name': 'portal_connector_1','Hpr': VBase3(91.003, 0.0, 0.0),'Pos': Point3(95.197, 150.0, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)},'1158123738.83sdnaik': {'Type': 'Locator Node','Name': 'portal_connector_2','GridPos': Point3(-761.266, -474.484, 268.987),'Hpr': VBase3(-91.316, 0.0, 0.0),'Pos': Point3(0.0, 3.262, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-856.266, -710.115, 717.132),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/tunnels/tunnel_volcano_left'}},'1158123997.77sdnaik': {'Type': 'Connector Tunnel','File': '','Hpr': Point3(0.0, 0.0, 0.0),'Objects': {'1158123997.81sdnaik': {'Type': 'Locator Node','Name': 'portal_connector_1','Hpr': VBase3(91.003, 0.0, 0.0),'Pos': Point3(95.197, 150.0, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)},'1158123997.89sdnaik': {'Type': 'Locator Node','Name': 'portal_connector_2','GridPos': Point3(274.631, -258.048, 510.262),'Hpr': VBase3(-91.316, 0.0, 0.0),'Pos': Point3(0.0, 3.262, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(1110.104, -1686.407, 728.27),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/tunnels/tunnel_volcano_left'}},'1158214443.45sdnaik': {'Type': 'Locator Node','Name': 'portal_exterior_1','Hpr': VBase3(-77.782, 0.0, 0.0),'Pos': Point3(531.288, -1109.38, 39.564),'Scale': VBase3(1.0, 1.0, 1.0)},'1158214452.48sdnaik': {'Type': 'Locator Node','Name': 'portal_exterior_2','Hpr': VBase3(-133.791, 0.0, 0.0),'Pos': Point3(-769.609, 130.343, 98.506),'Scale': VBase3(1.0, 1.0, 1.0)},'1158214452.53sdnaik': {'Type': 'Locator Node','Name': 'portal_exterior_3','Hpr': VBase3(-49.908, 0.0, 0.0),'Pos': Point3(-1082.41, 569.718, 97.081),'Scale': VBase3(1.0, 1.0, 1.0)},'1158214452.56sdnaik': {'Type': 'Locator Node','Name': 'portal_exterior_4','Hpr': VBase3(-144.565, 0.0, 0.0),'Pos': Point3(-900.016, -656.636, 121.934),'Scale': VBase3(1.0, 1.0, 1.0)},'1158285017.39sdnaik': {'Type': 'Port Collision Sphere','Name': 'DelFuegoPort','Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1379.733, 629.735, 0.0),'Scale': VBase3(1584.899, 1584.899, 1584.899),'Visual': {'Color': (0.5, 0.5, 1.0, 0.2),'Model': 'models/misc/smiley'}},'1158960478.48sdnaik': {'Type': 'Player Spawn Node','Hpr': VBase3(-44.493, 0.0, 0.0),'Index': -1,'Pos': Point3(-1163.873, 83.379, 53.03),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Model': 'models/misc/smiley'}},'1162408579.95kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(-81.141, 0.0, 0.0),'Pos': Point3(-1323.261, 87.442, 8.669),'Scale': VBase3(1.997, 1.997, 1.997),'Visual': {'Color': (0.4000000059604645, 0.4000000059604645, 0.4000000059604645, 1.0),'Model': 'models/props/rock_1_sphere'}},'1164929110.98sdnaik': {'Type': 'Island Game Area','File': 'del_fuego_area_cave_c_1','Hpr': VBase3(-136.183, 0.523, 0.069),'Objects': {'1164929111.03sdnaik': {'Type': 'Locator Node','Name': 'portal_interior_2','GridPos': Point3(-807.618, 2244.026, 590.162),'Hpr': VBase3(174.133, 0.0, 0.0),'Pos': Point3(161.832, -12.67, -0.954),'Scale': VBase3(1.0, 1.0, 1.0)},'1164929111.0sdnaik': {'Type': 'Locator Node','Name': 'portal_interior_1','GridPos': Point3(-659.153, 2538.427, 614.729),'Hpr': VBase3(57.196, 0.0, 0.0),'Pos': Point3(-149.155, -122.077, 24.239),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-682.084, 2346.936, 591.426),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/caves/cave_c_zero'}},'1164929430.17sdnaik': {'Type': 'Connector Tunnel','File': '','Hpr': VBase3(0.0, 0.0, -0.425),'Objects': {'1164929430.19sdnaik': {'Type': 'Locator Node','Name': 'portal_connector_1','GridPos': Point3(2925.582, 1539.735, 0.004),'Hpr': VBase3(91.003, 0.0, 0.0),'Pos': Point3(95.197, 150.0, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)},'1164929430.2sdnaik': {'Type': 'Locator Node','Name': 'portal_connector_2','GridPos': Point3(3020.779, 1686.474, 0.004),'Hpr': VBase3(-91.316, 0.0, 0.0),'Pos': Point3(0.0, 3.262, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(2640.012, 125.662, 830.046),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/tunnels/tunnel_volcano_left'}},'1167857698.16sdnaik': {'Type': 'Island Game Area','File': 'del_fuego_area_jungle_b_1','Hpr': VBase3(44.548, 0.0, 0.0),'Objects': {'1167857698.19sdnaik': {'Type': 'Locator Node','Name': 'portal_interior_1','GridPos': Point3(721.459, -68.32, 502.19),'Hpr': VBase3(-90.0, 0.0, 0.0),'Pos': Point3(498.114, 427.808, 45.336),'Scale': VBase3(1.0, 1.0, 1.0)},'1167857698.22sdnaik': {'Type': 'Locator Node','Name': 'portal_interior_2','GridPos': Point3(-95.614, -1061.896, 457.529),'Hpr': VBase3(121.61, 0.0, 0.0),'Pos': Point3(-318.959, -565.768, 0.675),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(2065.858, -1072.114, 964.532),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/jungles/jungle_b_zero'}},'1167862588.52sdnaik': {'Type': 'Island Game Area','File': 'del_fuego_area_cave_d_1','Hpr': VBase3(-21.365, 0.0, 0.0),'Objects': {'1167862588.55sdnaik': {'Type': 'Locator Node','Name': 'portal_interior_1','GridPos': Point3(1754.21, 1037.564, 79.839),'Hpr': VBase3(16.688, 0.0, 0.0),'Pos': Point3(123.68, 4.822, 47.3),'Scale': VBase3(1.0, 1.0, 1.0)},'1167862588.59sdnaik': {'Type': 'Locator Node','Name': 'portal_interior_2','GridPos': Point3(2208.802, 805.681, 54.154),'Hpr': VBase3(-155.353, 0.0, 0.0),'Pos': Point3(740.592, 53.189, 56.852),'Scale': VBase3(1.0, 1.0, 1.0)},'1167879276.14sdnaik': {'Type': 'Locator Node','Name': 'portal_interior_3','GridPos': Point3(2431.346, 724.273, 1057.484),'Hpr': VBase3(164.008, 0.0, 0.0),'Pos': Point3(539.448, -174.203, 39.295),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(1272.322, 1670.721, 774.862),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/caves/cave_d_zero'}},'1168057131.73sdnaik': {'Type': 'Island Game Area','File': 'del_fuego_area_cave_e_1','Hpr': VBase3(-83.499, 0.0, 0.0),'Objects': {'1168057131.75sdnaik': {'Type': 'Locator Node','Name': 'portal_interior_1','GridPos': Point3(616.066, 2769.511, 383.186),'Hpr': VBase3(-145.621, 0.0, 0.0),'Pos': Point3(296.45, 137.952, 2.31),'Scale': VBase3(1.0, 1.0, 1.0)},'1168057131.78sdnaik': {'Type': 'Locator Node','Name': 'portal_interior_2','GridPos': Point3(259.175, 2767.278, 3.411),'Hpr': VBase3(115.096, 0.0, 0.0),'Pos': Point3(3.07, -362.101, 41.673),'Scale': VBase3(1.0, 1.0, 1.0)},'1169515851.24fxlara': {'Type': 'Locator Node','Name': 'portal_interior_3','GridPos': Point3(336.591, 2500.98, 419.695),'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(532.349, -171.284, 38.819),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(446.501, 3049.299, 380.876),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/caves/cave_e_zero'}},'1168057258.78sdnaik': {'Type': 'Connector Tunnel','File': '','Hpr': Point3(0.0, 0.0, 0.0),'Objects': {'1168057258.83sdnaik': {'Type': 'Locator Node','Name': 'portal_connector_2','GridPos': Point3(-680.839, 2714.345, 0.0),'Hpr': VBase3(-91.316, 0.0, 0.0),'Pos': Point3(0.0, 3.262, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)},'1168057258.8sdnaik': {'Type': 'Locator Node','Name': 'portal_connector_1','GridPos': Point3(-776.035, 2567.607, 0.0),'Hpr': VBase3(91.003, 0.0, 0.0),'Pos': Point3(95.197, 150.0, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-551.696, 2586.584, 694.451),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/tunnels/tunnel_volcano_left'}},'1169862272.0dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1186.879, 337.662, 67.236),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.699999988079071, 0.699999988079071, 0.699999988079071, 1.0),'Model': 'models/buildings/LowWallStone_20'}},'1169862400.0dxschafe': {'Type': 'Spanish Walls','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1217.876, 337.981, 66.444),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.699999988079071, 0.699999988079071, 0.699999988079071, 1.0),'Model': 'models/buildings/LowWallStone_20'}},'1170964352.0dxschafe0': {'Type': 'Stairs','Hpr': VBase3(123.726, 0.0, 0.0),'Objects': {'1176422016.0dxschafe0': {'Type': 'Movement Node','GridPos': Point3(-1215.622, -644.304, 119.565),'Hpr': VBase3(-123.726, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(-14.517, -110.731, -30.578),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}}},'Pos': Point3(-1315.777, -693.71, 150.143),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.36, 0.39, 0.49, 1.0),'Model': 'models/buildings/dirt_ramp'}},'1172265076.31kmuller': {'Type': 'Cart','DisableCollision': True,'Hpr': VBase3(168.162, 0.0, 0.0),'Pos': Point3(-1205.456, 256.638, 65.246),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cart_reg'}},'1172265254.22kmuller': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(-160.827, 0.0, 0.0),'Pos': Point3(-1070.149, 100.029, 76.007),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_f'}},'1173205109.93kmuller': {'Type': 'Barrel','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-1236.687, -46.486, 23.552),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/barrel'}},'1173207434.85kmuller': {'Type': 'Cart','DisableCollision': True,'Hpr': VBase3(-139.151, 8.243, 4.884),'Pos': Point3(-762.553, 9.72, 108.312),'Scale': VBase3(0.882, 0.882, 0.882),'Visual': {'Model': 'models/props/cart_reg'}},'1175275783.27kmuller': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(108.656, 0.0, 0.0),'Pos': Point3(-906.716, 5.779, 98.084),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/bush_b'}},'1175276684.3kmuller': {'Type': 'Cart','DisableCollision': False,'Hpr': VBase3(-148.863, 0.822, 20.055),'Pos': Point3(-1239.519, 11.536, 22.666),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/cart_flat'}},'1175276726.11kmuller': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-1247.745, 10.215, 18.651),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/crates_group_2'}},'1175276953.83kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(-1063.874, -147.856, 79.338),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.30000001192092896, 0.30000001192092896, 0.30000001192092896, 1.0),'Model': 'models/props/rock_2_sphere'}},'1175277545.67kmuller': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(0.0, 0.284, 0.0),'Pos': Point3(520.356, -1012.563, 204.181),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/gen_tree_b'}},'1175277589.36kmuller': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(472.531, -1050.931, 195.164),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/gen_tree_d'}},'1175277611.0kmuller': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(368.956, -1081.152, 210.421),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/gen_tree_h'}},'1175277676.03kmuller': {'Type': 'Tree','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(382.836, -1010.294, 188.971),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/gen_tree_h'}},'1175277684.45kmuller': {'Type': 'Tree','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(244.129, -1149.297, 193.302),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/gen_tree_b'}},'1175277695.06kmuller': {'Type': 'Tree','DisableCollision': True,'Hpr': VBase3(-45.481, 0.0, 0.0),'Pos': Point3(264.411, -1067.762, 213.43),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/gen_tree_g'}},'1175277742.66kmuller': {'Type': 'Tree','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(850.875, -1025.346, 209.736),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/gen_tree_h'}},'1175277760.02kmuller': {'Type': 'Tree','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(638.587, -967.661, 209.049),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/gen_tree_g'}},'1175277776.23kmuller': {'Type': 'Tree','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(700.838, -943.465, 215.178),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/vegetation/gen_tree_b'}},'1175278324.22kmuller': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(-72.159, -0.199, -0.007),'Pos': Point3(742.465, -1338.063, 23.788),'Scale': VBase3(2.498, 2.498, 2.498),'Visual': {'Color': (0.4000000059604645, 0.4000000059604645, 0.4000000059604645, 1.0),'Model': 'models/props/rock_3_floor'}},'1175278370.05kmuller': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(-43.858, 13.298, -0.393),'Pos': Point3(744.756, -1329.032, 25.318),'Scale': VBase3(2.377, 2.377, 2.377),'Visual': {'Color': (0.4000000059604645, 0.4000000059604645, 0.4000000059604645, 1.0),'Model': 'models/props/rock_1_floor'}},'1175622157.78sdnaik': {'Type': 'Port Collision Sphere','Name': '','Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(706.358, -1439.245, 13.0),'Scale': VBase3(1076.847, 1076.847, 1076.847),'Visual': {'Color': (0.5, 0.5, 1.0, 0.2),'Model': 'models/misc/smiley'}},'1175729664.0dxschafe': {'Type': 'Building Exterior','File': 'del_fuego_npc_house_interior_7','ExtUid': '1175729664.0dxschafe0','Hpr': VBase3(-87.099, 0.0, 0.0),'Objects': {'1200533376.0dxschafe65': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-0.179, -4.421, 4.89),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(-1022.714, -482.096, 105.817),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Color': (0.7099999785423279, 0.6700000166893005, 0.6000000238418579, 1.0),'Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_shanty_npc_house','Model': 'models/buildings/shanty_npc_house_combo_H','SignImage': 'models/buildings/sign1_eng_a_icon_blacksmith'}},'1176229120.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': Point3(0.0, 0.0, 0.0),'Min Population': '1','Patrol Radius': '4.6667','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(-1139.676, -704.799, 118.913),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Scorpion','Start State': 'Ambush','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1176229120.0dxschafe0': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': Point3(0.0, 0.0, 0.0),'Min Population': '1','Patrol Radius': '3.3333','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(-1230.683, -755.436, 122.224),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Scorpion','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1176229120.0dxschafe1': {'Type': 'Object Spawn Node','Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1149.428, -743.427, 119.955),'Priority': '1','Scale': VBase3(1.0, 1.0, 1.0),'SpawnDelay': '20','Spawnables': 'Buried Treasure','Visual': {'Color': (0.8, 0.2, 0.65, 1),'Model': 'models/misc/smiley'},'startingDepth': '15'},'1176229120.0dxschafe2': {'Type': 'Object Spawn Node','Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1042.2, -769.203, 119.626),'Priority': '1','Scale': VBase3(1.0, 1.0, 1.0),'SpawnDelay': '20','Spawnables': 'Buried Treasure','Visual': {'Color': (0.8, 0.2, 0.65, 1),'Model': 'models/misc/smiley'},'startingDepth': '15'},'1176229632.0dxschafe': {'Type': 'Object Spawn Node','Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1183.203, 381.595, 67.484),'Priority': '1','Scale': VBase3(1.0, 1.0, 1.0),'SpawnDelay': '20','Spawnables': 'Buried Treasure','Visual': {'Color': (0.8, 0.2, 0.65, 1),'Model': 'models/misc/smiley'},'startingDepth': '15'},'1176235904.0dxschafe': {'Type': 'Object Spawn Node','Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-963.315, 444.022, 97.11),'Priority': '1','Scale': VBase3(1.0, 1.0, 1.0),'SpawnDelay': '20','Spawnables': 'Buried Treasure','Visual': {'Color': (0.8, 0.2, 0.65, 1),'Model': 'models/misc/smiley'},'startingDepth': '15'},'1176235904.0dxschafe0': {'Type': 'Player Spawn Node','Hpr': VBase3(-161.877, 0.0, 0.0),'Index': -1,'Pos': Point3(-1148.969, 246.757, 69.117),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176235904.0dxschafe1': {'Type': 'Player Spawn Node','Hpr': VBase3(-126.472, 0.0, 0.0),'Index': -1,'Pos': Point3(-1108.385, 172.119, 67.986),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176235904.0dxschafe2': {'Type': 'Player Spawn Node','Hpr': VBase3(-160.184, 0.0, 0.0),'Index': -1,'Pos': Point3(-1191.744, 306.944, 66.721),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176235904.0dxschafe3': {'Type': 'Player Spawn Node','Hpr': VBase3(-168.49, 0.0, 0.0),'Index': -1,'Pos': Point3(-1015.587, 516.791, 96.765),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176235904.0dxschafe4': {'Type': 'Player Spawn Node','Hpr': VBase3(-117.423, 0.0, 0.0),'Index': -1,'Pos': Point3(-1081.665, 51.01, 69.384),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176235904.0dxschafe5': {'Type': 'Player Spawn Node','Hpr': VBase3(49.908, 0.0, 0.0),'Index': -1,'Pos': Point3(-1291.748, 2.964, 14.475),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176235904.0dxschafe6': {'Type': 'Player Spawn Node','Hpr': VBase3(-88.744, 0.0, 0.0),'Index': -1,'Pos': Point3(-1036.536, -19.006, 79.29),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176236032.0dxschafe': {'Type': 'Player Spawn Node','Hpr': VBase3(-38.154, 0.0, 0.0),'Index': -1,'Pos': Point3(-959.202, -21.005, 92.948),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176236032.0dxschafe0': {'Type': 'Player Spawn Node','Hpr': VBase3(39.193, 0.0, 0.0),'Index': -1,'Pos': Point3(-1003.586, -196.863, 84.0),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176236032.0dxschafe1': {'Type': 'Player Spawn Node','Hpr': Point3(0.0, 0.0, 0.0),'Index': -1,'Pos': Point3(-903.761, -170.163, 96.771),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176236032.0dxschafe10': {'Type': 'Player Spawn Node','Hpr': VBase3(-122.501, 0.0, 0.0),'Index': -1,'Pos': Point3(-968.405, 73.759, 90.993),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176236032.0dxschafe11': {'Type': 'Player Spawn Node','Hpr': VBase3(50.339, 0.0, 0.0),'Index': -1,'Pos': Point3(-1030.454, 118.097, 81.546),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176236032.0dxschafe2': {'Type': 'Player Spawn Node','Hpr': VBase3(-38.487, 0.0, 0.0),'Index': -1,'Pos': Point3(-1065.858, -279.232, 77.862),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176236032.0dxschafe3': {'Type': 'Player Spawn Node','Hpr': Point3(0.0, 0.0, 0.0),'Index': -1,'Pos': Point3(-1062.363, -478.306, 103.473),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176236032.0dxschafe4': {'Type': 'Player Spawn Node','Hpr': VBase3(61.267, 0.0, 0.0),'Index': -1,'Pos': Point3(-986.729, -675.187, 119.544),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176236032.0dxschafe5': {'Type': 'Player Spawn Node','Hpr': VBase3(-26.858, 0.0, 0.0),'Index': -1,'Pos': Point3(-1160.854, -602.567, 116.151),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176236032.0dxschafe6': {'Type': 'Player Spawn Node','Hpr': VBase3(3.616, 0.0, 0.0),'Index': -1,'Pos': Point3(-881.516, -269.525, 106.246),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176236032.0dxschafe7': {'Type': 'Player Spawn Node','Hpr': VBase3(77.204, 0.0, 0.0),'Index': -1,'Pos': Point3(-860.017, 25.577, 100.957),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176236032.0dxschafe8': {'Type': 'Player Spawn Node','Hpr': VBase3(127.107, 0.0, 0.0),'Index': -1,'Pos': Point3(-713.177, 31.06, 112.342),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176236032.0dxschafe9': {'Type': 'Player Spawn Node','Hpr': VBase3(59.778, 0.0, 0.0),'Index': -1,'Pos': Point3(-816.57, -11.178, 103.744),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1176420352.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'attention','Hpr': VBase3(-65.737, 0.0, 0.0),'Min Population': '1','Patrol Radius': '3.0000','Pause Chance': '100','Pause Duration': '30','Pos': Point3(-1212.098, -649.663, 119.746),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Navy - Veteran','Start State': 'Idle','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1176420352.0dxschafe0': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(-1235.57, -602.108, 118.893),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1176421760.0dxschafe': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(-1065.012, -355.833, 82.047),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1176421760.0dxschafe0': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(-1085.307, -481.237, 104.32),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1176421760.0dxschafe1': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(-51.412, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': '100','Pause Duration': '30','Pos': Point3(-1229.85, -615.462, 118.701),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Navy - Sergeant','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1176421888.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': Point3(0.0, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': '100','Pause Duration': '30','Pos': Point3(-1515.261, -765.291, 150.237),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Navy - Veteran','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1176422016.0dxschafe1': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(-929.611, -657.451, 120.611),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1177377280.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(-171.264, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(354.613, -1406.58, 9.972),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Rock Crab','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1177377280.0dxschafe0': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(-100.132, 0.0, 0.0),'Min Population': '1','Patrol Radius': '7.1807','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(366.679, -1213.781, 33.146),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Dread Scorpion','Start State': 'Ambush','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1177377280.0dxschafe1': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(83.538, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(857.689, -1222.143, 26.54),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Dread Scorpion','Start State': 'Ambush','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1177377408.0dxschafe0': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(150.122, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(893.11, -1451.604, 6.446),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Giant Crab','Start State': 'Ambush','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1177714944.0mike': {'Type': 'Townsperson','Category': 'Gypsy','Aggro Radius': '12.0000','AnimSet': 'default','CustomModel': 'None','Hpr': VBase3(108.292, 0.0, 0.0),'Patrol Radius': '1.8333','Pos': Point3(-1163.214, 383.467, 68.727),'PoseAnim': '','PoseFrame': '','Private Status': 'All','Respawns': True,'Scale': VBase3(1.0, 1.0, 1.0),'ShopID': 'PORT_ROYAL_DEFAULTS','Start State': 'Idle','StartFrame': '0','Team': 'Villager','TrailFX': 'None'},'1178924204.55kmuller': {'Type': 'Rock','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1035.111, 580.303, 96.831),'Scale': VBase3(2.036, 2.036, 2.036),'Visual': {'Color': (0.37, 0.35, 0.45, 1.0),'Model': 'models/props/rock_2_sphere'}},'1178924866.44kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1246.406, -451.378, 109.182),'Scale': VBase3(2.965, 2.965, 2.965),'Visual': {'Color': (0.3700000047683716, 0.3499999940395355, 0.44999998807907104, 1.0),'Model': 'models/props/rock_2_sphere'}},'1178925118.73kmuller': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(-2.629, 12.358, 12.109),'Pos': Point3(-1025.84, -717.966, 119.557),'Scale': VBase3(2.172, 2.172, 2.172),'Visual': {'Model': 'models/vegetation/Cactus_a'}},'1178925144.44kmuller': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(17.372, 4.142, 12.999),'Pos': Point3(-1029.327, -724.264, 118.315),'Scale': VBase3(3.322, 3.322, 3.322),'Visual': {'Model': 'models/vegetation/Cactus_a'}},'1178926672.39kmuller': {'Type': 'Log_Stack','DisableCollision': False,'Hpr': VBase3(179.538, 0.0, 0.0),'Pos': Point3(-1184.591, 335.602, 67.177),'Scale': VBase3(0.723, 0.723, 0.723),'Visual': {'Model': 'models/props/Log_stack_a'}},'1178927090.41kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(51.286, 0.0, 0.0),'Pos': Point3(-1334.583, -565.787, 120.11),'Scale': VBase3(1.699, 1.699, 1.699),'Visual': {'Color': (0.3700000047683716, 0.3499999940395355, 0.44999998807907104, 1.0),'Model': 'models/props/rock_group_5_sphere'}},'1178927140.17kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(-11.339, -22.638, -16.726),'Pos': Point3(-1341.804, -568.531, 119.885),'Scale': VBase3(5.707, 5.707, 5.707),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.5299999713897705, 1.0),'Model': 'models/props/rock_3_sphere'}},'1178927192.59kmuller': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(142.492, 0.0, 1.982),'Pos': Point3(-1330.102, -555.55, 119.293),'Scale': VBase3(1.624, 1.624, 1.624),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.5299999713897705, 1.0),'Model': 'models/props/rock_group_2_sphere'}},'1178927329.86kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(57.238, -0.27, 2.22),'Pos': Point3(-1323.457, -487.862, 116.341),'Scale': VBase3(2.272, 2.272, 2.272),'Visual': {'Color': (0.3700000047683716, 0.3499999940395355, 0.44999998807907104, 1.0),'Model': 'models/props/rock_group_2_sphere'}},'1178927379.84kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(68.355, 0.0, -0.085),'Pos': Point3(-1308.536, -499.308, 116.047),'Scale': VBase3(1.65, 1.65, 1.65),'Visual': {'Color': (0.45, 0.43, 0.47, 1.0),'Model': 'models/props/rock_group_1_sphere'}},'1178927452.7kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1313.492, -506.155, 116.695),'Scale': VBase3(3.855, 3.855, 3.855),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.4699999988079071, 1.0),'Model': 'models/props/rock_4_sphere'}},'1178927571.76kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(113.161, 0.0, 0.0),'Pos': Point3(-1243.996, -769.706, 122.527),'Scale': VBase3(2.539, 2.539, 2.539),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.4699999988079071, 1.0),'Model': 'models/props/rock_4_sphere'}},'1178927587.14kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(154.471, -25.132, -18.423),'Pos': Point3(-1225.346, -774.733, 122.706),'Scale': VBase3(1.57, 1.57, 1.57),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.5299999713897705, 1.0),'Model': 'models/props/rock_3_sphere'}},'1178927659.05kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1240.602, -765.113, 122.343),'Scale': VBase3(1.224, 1.224, 1.224),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.5299999713897705, 1.0),'Model': 'models/props/rock_1_sphere'}},'1178927732.2kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(0.0, -11.862, 0.0),'Pos': Point3(-1033.73, -352.683, 79.254),'Scale': VBase3(1.662, 1.662, 1.662),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.4699999988079071, 1.0),'Model': 'models/props/rock_group_1_sphere'}},'1178927758.11kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(118.295, 4.656, 18.718),'Pos': Point3(-1050.047, -347.06, 77.986),'Scale': VBase3(1.621, 1.621, 1.621),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.4699999988079071, 1.0),'Model': 'models/props/rock_group_3_sphere'}},'1178927808.08kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(0.0, -31.161, 5.082),'Pos': Point3(-1038.116, -355.91, 79.176),'Scale': VBase3(2.771, 2.771, 2.771),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.5299999713897705, 1.0),'Model': 'models/props/rock_group_4_sphere'}},'1178927920.67kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(98.751, -12.508, -7.08),'Pos': Point3(-1201.539, 245.985, 63.889),'Scale': VBase3(2.078, 2.078, 2.078),'Visual': {'Color': (0.64, 0.62, 0.6549019607843137, 1.0),'Model': 'models/props/rock_group_5_sphere'}},'1178927971.62kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(-109.139, 3.997, 14.949),'Pos': Point3(-1184.617, 234.32, 64.728),'Scale': VBase3(1.575, 1.575, 1.575),'Visual': {'Color': (0.64, 0.62, 0.7019607843137254, 1.0),'Model': 'models/props/rock_group_3_sphere'}},'1178928013.81kmuller': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(77.418, -14.758, -15.652),'Pos': Point3(-1188.411, 225.801, 62.175),'Scale': VBase3(1.478, 1.478, 1.478),'Visual': {'Color': (0.66, 0.64, 0.6745098039215687, 1.0),'Model': 'models/props/rock_group_4_sphere'}},'1178928286.8kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(46.685, 0.0, 0.0),'Pos': Point3(-1209.099, 321.825, 65.762),'Scale': VBase3(1.777, 1.777, 1.777),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.4699999988079071, 1.0),'Model': 'models/props/rock_group_2_sphere'}},'1178928325.97kmuller': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(-172.502, -0.981, 5.39),'Pos': Point3(-1211.746, 305.855, 64.935),'Scale': VBase3(1.349, 1.349, 1.349),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.5299999713897705, 1.0),'Model': 'models/props/rock_group_3_sphere'}},'1178928520.11kmuller': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(-97.081, 0.0, 0.0),'Pos': Point3(-1181.918, 347.533, 67.926),'Scale': VBase3(1.46, 1.46, 1.46),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.4699999988079071, 1.0),'Model': 'models/props/rock_group_2_sphere'}},'1178928553.41kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(179.83, 0.0, -12.041),'Pos': Point3(-1173.862, 343.18, 67.965),'Scale': VBase3(3.057, 3.057, 3.057),'Visual': {'Color': (0.3700000047683716, 0.3499999940395355, 0.44999998807907104, 1.0),'Model': 'models/props/rock_3_sphere'}},'1178928809.22kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(105.285, 0.0, 0.0),'Pos': Point3(-1076.992, -69.026, 75.012),'Scale': VBase3(1.751, 1.751, 1.751),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.4699999988079071, 1.0),'Model': 'models/props/rock_group_5_sphere'}},'1178928834.56kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(110.778, -9.234, 3.191),'Pos': Point3(-1061.09, -84.459, 78.566),'Scale': VBase3(1.64, 1.64, 1.64),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.5299999713897705, 1.0),'Model': 'models/props/rock_group_2_sphere'}},'1178928881.36kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(-35.545, 9.855, -20.192),'Pos': Point3(-1062.15, -73.151, 76.447),'Scale': VBase3(1.071, 1.071, 1.071),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.4699999988079071, 1.0),'Model': 'models/props/rock_group_1_sphere'}},'1178928955.59kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(-47.836, 5.164, -1.509),'Pos': Point3(-1061.719, -103.214, 78.077),'Scale': VBase3(2.449, 2.449, 2.449),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.4699999988079071, 1.0),'Model': 'models/props/rock_1_sphere'}},'1178929080.8kmuller': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(-161.851, 7.25, 16.107),'Pos': Point3(-1115.169, -267.416, 71.14),'Scale': VBase3(1.436, 1.436, 1.436),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.5299999713897705, 1.0),'Model': 'models/props/rock_group_3_sphere'}},'1178929170.19kmuller': {'Type': 'Rock','DisableCollision': False,'Hpr': VBase3(153.971, -2.595, 26.979),'Pos': Point3(-1129.455, -281.047, 66.606),'Scale': VBase3(1.737, 1.737, 1.737),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.4699999988079071, 1.0),'Model': 'models/props/rock_group_4_sphere'}},'1178929373.34kmuller': {'Type': 'Rock','DisableCollision': True,'Hpr': VBase3(15.338, 0.0, 0.0),'Pos': Point3(-1104.232, -243.783, 75.224),'Scale': VBase3(4.073, 4.073, 4.073),'Visual': {'Color': (0.44999998807907104, 0.4300000071525574, 0.5299999713897705, 1.0),'Model': 'models/props/rock_4_sphere'}},'1179781037.0kmuller': {'Type': 'Shanty Tents','Hpr': VBase3(79.674, 0.0, 0.0),'Pos': Point3(-1054.074, -171.207, 80.049),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.67, 0.62, 0.4235294117647059, 1.0),'Model': 'models/buildings/1shanty_tents_empty'}},'1179781062.09kmuller': {'Type': 'Shanty Tents','Hpr': VBase3(136.865, 0.0, 0.0),'Pos': Point3(-1049.201, -164.599, 80.643),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.81, 0.81, 0.807843137254902, 1.0),'Model': 'models/buildings/1shanty_tents_empty'}},'1179781095.34kmuller': {'Type': 'Shanty Tents','Hpr': VBase3(125.668, 0.0, 0.0),'Pos': Point3(-1060.008, -160.231, 82.265),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.48, 0.6, 0.84, 1.0),'Model': 'models/buildings/1shanty_tents_empty'}},'1179781207.28kmuller': {'Type': 'Crate','DisableCollision': True,'Hpr': VBase3(32.818, -4.209, 0.0),'Pos': Point3(-1058.19, -163.749, 79.894),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/crates_group_1'}},'1184022449.09kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(117.127, 0.0, 0.0),'Pos': Point3(-1081.7, 538.89, 96.945),'Scale': VBase3(2.701, 2.701, 2.701),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184022575.31kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(5.391, 0.0, 0.0),'Pos': Point3(-945.624, 433.441, 97.359),'Scale': VBase3(3.312, 3.312, 3.312),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184022677.43kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(44.58, 0.0, 0.0),'Pos': Point3(-1043.21, 316.981, 77.645),'Scale': VBase3(7.436, 2.657, 2.657),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184022894.76kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(6.352, 0.0, 0.0),'Pos': Point3(-1013.575, 138.591, 82.49),'Scale': VBase3(4.16, 2.222, 2.222),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184022987.87kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-23.241, 0.0, 0.0),'Pos': Point3(-992.374, 130.582, 86.257),'Scale': VBase3(2.402, 1.0, 1.045),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184023106.66kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-46.225, 0.0, 0.0),'Pos': Point3(-1032.027, 88.539, 79.733),'Scale': VBase3(6.4, 2.357, 2.673),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184023288.73kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(14.28, 0.0, 0.0),'Pos': Point3(-1096.84, 131.272, 67.361),'Scale': VBase3(2.097, 2.869, 2.097),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184023340.98kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-48.315, 0.0, 0.0),'Pos': Point3(-1085.255, 128.157, 69.958),'Scale': VBase3(3.578, 1.824, 1.961),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184023695.48kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1195.117, 239.557, 65.875),'Scale': VBase3(2.74, 2.74, 2.74),'Visual': {'Model': 'models/misc/coll_sphere_barrier'}},'1184024094.82kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(20.597, 0.0, 0.0),'Pos': Point3(-1172.78, 399.902, 68.254),'Scale': VBase3(6.983, 1.782, 1.782),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184024126.48kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-54.307, 0.0, 0.0),'Pos': Point3(-1157.597, 393.742, 67.862),'Scale': VBase3(1.519, 1.386, 2.144),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184024187.46kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-56.056, 0.0, 0.0),'Pos': Point3(-1183.013, 329.298, 64.508),'Scale': VBase3(1.308, 1.308, 2.361),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184024898.73kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(22.252, 0.0, 0.0),'Pos': Point3(-912.178, 56.882, 95.545),'Scale': VBase3(1.27, 1.27, 1.699),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184025002.57kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-20.278, 0.0, 0.0),'Pos': Point3(-892.115, 64.737, 96.974),'Scale': VBase3(1.196, 1.196, 1.441),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184025055.27kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(66.019, 0.0, 0.0),'Pos': Point3(-836.864, 81.359, 99.631),'Scale': VBase3(1.64, 1.64, 2.2),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184025216.46kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(46.329, 0.0, 0.0),'Pos': Point3(-758.56, 10.221, 109.847),'Scale': VBase3(2.273, 1.916, 1.916),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184025311.44kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-113.249, 0.0, 0.0),'Pos': Point3(-719.872, -8.358, 111.776),'Scale': VBase3(1.0, 1.0, 1.055),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184025511.59kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-129.975, 0.0, 0.0),'Pos': Point3(-869.72, -52.984, 100.046),'Scale': VBase3(1.301, 0.408, 1.826),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184025688.1kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-863.777, -153.828, 99.065),'Scale': VBase3(2.096, 2.096, 2.096),'Visual': {'Model': 'models/misc/coll_sphere_barrier'}},'1184025715.73kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-90.552, 0.0, 0.0),'Pos': Point3(-879.819, -179.825, 96.045),'Scale': VBase3(1.862, 1.862, 3.738),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184025832.68kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(161.591, 0.0, 0.0),'Pos': Point3(-934.269, -338.222, 105.067),'Scale': VBase3(1.0, 1.0, 1.571),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184025992.1kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-162.538, 0.0, 0.0),'Pos': Point3(-940.417, -222.848, 91.175),'Scale': VBase3(0.335, 1.0, 1.975),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184026113.29kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1025.517, -332.231, 75.246),'Scale': VBase3(6.199, 6.199, 6.199),'Visual': {'Model': 'models/misc/coll_sphere_barrier'}},'1184026151.32kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-26.857, 0.0, 0.0),'Pos': Point3(-1039.256, -360.666, 78.772),'Scale': VBase3(2.454, 2.57, 2.57),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184026211.99kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(4.471, 0.0, 0.0),'Pos': Point3(-1010.071, -423.425, 96.482),'Scale': VBase3(1.733, 7.624, 2.256),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184026328.88kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-132.428, 0.0, 0.0),'Pos': Point3(-1013.985, -505.281, 108.345),'Scale': VBase3(1.438, 0.564, 1.65),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184026367.35kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1011.364, -534.611, 111.359),'Scale': VBase3(0.944, 0.944, 1.031),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184026655.52kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-70.809, 0.0, 0.0),'Pos': Point3(-994.598, -577.847, 111.749),'Scale': VBase3(4.232, 3.305, 3.305),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184026771.9kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1239.427, -776.805, 122.486),'Scale': VBase3(3.2, 3.2, 3.2),'Visual': {'Model': 'models/misc/coll_sphere_barrier'}},'1184026863.37kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-26.585, 0.0, 0.0),'Pos': Point3(-1320.263, -508.13, 106.787),'Scale': VBase3(3.534, 8.642, 3.534),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184026917.71kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(100.548, 0.0, 0.0),'Pos': Point3(-1311.381, -483.351, 116.082),'Scale': VBase3(1.94, 1.94, 1.94),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184027087.51kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(5.885, 0.0, 0.0),'Pos': Point3(-1099.858, -246.556, 75.184),'Scale': VBase3(1.772, 1.772, 1.772),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184027124.76kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-21.017, 0.0, 0.0),'Pos': Point3(-1081.119, -259.055, 77.123),'Scale': VBase3(1.0, 1.0, 1.626),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184027277.77kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(2.267, 0.0, 0.0),'Pos': Point3(-1067.981, -85.538, 71.986),'Scale': VBase3(5.894, 9.429, 5.255),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184027370.13kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-38.842, 0.0, 0.0),'Pos': Point3(-1145.592, 24.263, 37.171),'Scale': VBase3(14.736, 6.495, 6.495),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184027432.65kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-37.098, 0.0, 0.0),'Pos': Point3(-1115.287, -1.148, 57.115),'Scale': VBase3(1.661, 2.649, 1.661),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184086690.55kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-31.829, 0.0, 0.0),'Pos': Point3(-1327.103, 83.231, 7.435),'Scale': VBase3(1.705, 1.705, 1.705),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184087018.59kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(64.155, 0.0, 0.0),'Pos': Point3(-1231.23, 138.914, 51.63),'Scale': VBase3(1.0, 1.0, 1.412),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184087119.18kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1138.702, 137.692, 58.676),'Scale': VBase3(1.421, 1.748, 2.933),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184087184.52kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-31.53, 0.0, 0.0),'Pos': Point3(-1174.049, 200.75, 60.248),'Scale': VBase3(1.0, 2.465, 1.241),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184087225.63kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(9.837, 0.0, 0.0),'Pos': Point3(-1169.56, 190.574, 59.742),'Scale': VBase3(1.599, 1.186, 1.307),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1184087268.51kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(153.533, 0.0, 0.0),'Pos': Point3(-1199.9, 257.492, 65.946),'Scale': VBase3(2.343, 1.549, 1.549),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184088724.93kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-31.419, 0.0, 0.0),'Pos': Point3(764.067, -1133.399, 34.556),'Scale': VBase3(7.56, 7.56, 7.56),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184089135.23kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(579.465, -1231.628, 31.005),'Scale': VBase3(2.624, 2.624, 2.624),'Visual': {'Model': 'models/misc/coll_sphere_barrier'}},'1184089160.09kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(23.151, 0.0, 0.0),'Pos': Point3(571.765, -1242.719, 30.076),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184089179.18kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(27.823, 0.0, 0.0),'Pos': Point3(529.199, -1263.951, 31.192),'Scale': VBase3(0.31, 1.0, 1.805),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184089205.46kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-157.883, 0.0, 0.0),'Pos': Point3(526.758, -1258.341, 31.59),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184089231.3kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-56.229, 0.0, 0.0),'Pos': Point3(504.666, -1280.976, 29.397),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184089296.07kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(85.902, 0.0, 0.0),'Pos': Point3(490.932, -1285.172, 29.6),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184089318.93kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-106.756, 0.0, 0.0),'Pos': Point3(482.09, -1285.55, 30.452),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184089379.09kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(99.598, 0.0, 0.0),'Pos': Point3(494.178, -1313.169, 28.904),'Scale': VBase3(1.0, 1.0, 2.28),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184089427.66kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(100.525, 0.0, 0.0),'Pos': Point3(503.734, -1359.508, 24.247),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184090819.57kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(19.898, 0.0, 0.0),'Pos': Point3(-1022.775, 361.558, 88.818),'Scale': VBase3(2.178, 2.178, 3.4),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184090878.63kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(57.95, 0.0, 0.0),'Pos': Point3(-1008.517, 371.608, 93.082),'Scale': VBase3(0.483, 1.0, 2.945),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184090911.01kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(85.473, 0.0, 0.0),'Pos': Point3(-1006.457, 383.276, 93.414),'Scale': VBase3(1.963, 2.314, 2.921),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184090967.99kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(123.547, 0.0, 0.0),'Pos': Point3(-1009.087, 397.725, 95.265),'Scale': VBase3(1.203, 1.773, 2.355),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184091101.43kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-123.653, 0.0, 0.0),'Pos': Point3(-1187.356, 340.19, 67.162),'Scale': VBase3(0.345, 1.0, 1.0),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1184631580.1joswilso': {'Type': 'Dinghy','Aggro Radius': '20.0000','Hpr': VBase3(6.78, 0.0, 0.0),'Location': 'Water','Pos': Point3(454.768, -1732.993, 0.85),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/shipparts/dingy-geometry_High'}},'1184631683.63joswilso': {'Type': 'Dinghy','Aggro Radius': '20.0000','Hpr': VBase3(-95.316, 0.0, 0.0),'Location': 'Water','Pos': Point3(-1448.845, 73.571, 0.616),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/shipparts/dingy-geometry_High'}},'1186087168.0dxschafe': {'Type': 'Dinghy','Aggro Radius': '20.0000','Hpr': VBase3(-47.614, 0.0, 0.0),'Location': 'Water','Pos': Point3(442.941, -1645.133, 0.63),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/shipparts/dingy-geometry_High'}},'1186087296.0dxschafe': {'Type': 'Dinghy','Aggro Radius': '20.0000','Hpr': VBase3(6.78, 0.0, 0.0),'Location': 'Water','Pos': Point3(543.676, -1604.44, 0.516),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/shipparts/dingy-geometry_High'}},'1186087552.0dxschafe': {'Type': 'Dinghy','Aggro Radius': '20.0000','Hpr': VBase3(-96.287, 0.0, 0.0),'Location': 'Water','Pos': Point3(-1561.034, 185.03, 0.76),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/shipparts/dingy-geometry_High'}},'1186087552.0dxschafe0': {'Type': 'Dinghy','Aggro Radius': '20.0000','Hpr': VBase3(-165.126, 0.0, 0.0),'Location': 'Water','Pos': Point3(-1472.541, 184.074, 0.624),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/shipparts/dingy-geometry_High'}},'1186087680.0dxschafe0': {'Type': 'Player Spawn Node','GridPos': Point3(-1373.702, 82.206, 7.636),'Hpr': VBase3(-53.615, 0.0, 0.0),'Index': 1,'Pos': Point3(-1271.228, -29.176, 18.7),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1186087680.0dxschafe1': {'Type': 'Player Spawn Node','GridPos': Point3(-1373.702, 82.206, 7.636),'Hpr': VBase3(-56.555, 0.0, 0.0),'Index': 1,'Pos': Point3(-1226.257, -373.125, 21.31),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1186087680.0dxschafe2': {'Type': 'Player Spawn Node','GridPos': Point3(-1373.702, 82.206, 7.636),'Hpr': VBase3(-110.442, 0.0, 0.0),'Index': 1,'Pos': Point3(-1216.995, 102.488, 48.394),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1186087680.0dxschafe3': {'Type': 'Player Spawn Node','GridPos': Point3(-1373.702, 82.206, 7.636),'Hpr': VBase3(-88.038, 0.0, 0.0),'Index': 1,'Pos': Point3(-1102.542, -271.592, 74.038),'Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'All','Visual': {'Color': (0.5, 0.5, 0.5, 1),'Model': 'models/misc/smiley'}},'1186087680.0dxschafe4': {'Type': 'Dinghy','Aggro Radius': '20.0000','Hpr': VBase3(-44.991, 0.0, 0.0),'Location': 'Water','Pos': Point3(-1326.493, -392.534, 0.975),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/shipparts/dingy-geometry_High'}},'1186087680.0dxschafe5': {'Type': 'Dinghy','Aggro Radius': '20.0000','Hpr': VBase3(-98.899, 0.0, 0.0),'Location': 'Water','Pos': Point3(-1389.741, -409.264, 0.738),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/shipparts/dingy-geometry_High'}},'1188320582.09akelts': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(146.458, 0.0, 0.0),'Pos': Point3(-953.45, -322.093, 106.124),'Scale': VBase3(0.686, 1.0, 2.993),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1188320614.28akelts': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(115.575, 0.0, 0.0),'Pos': Point3(-958.628, -315.063, 106.1),'Scale': VBase3(1.196, 1.0, 3.09),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1188324692.53akelts': {'Type': 'Hay','DisableCollision': True,'Hpr': VBase3(2.739, 0.0, 0.0),'Pos': Point3(-960.08, -322.036, 106.246),'Scale': VBase3(1.591, 1.591, 1.591),'Visual': {'Model': 'models/props/haystack'}},'1188334011.89akelts': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-870.679, -193.101, 102.732),'Scale': VBase3(0.467, 1.0, 1.52),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1188334102.31akelts': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-85.154, 0.0, 0.0),'Pos': Point3(-929.798, -207.284, 92.886),'Scale': VBase3(0.253, 1.0, 1.345),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1188334483.89akelts': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(82.291, 0.0, 0.0),'Pos': Point3(-1326.383, -570.849, 120.183),'Scale': VBase3(1.236, 1.236, 1.236),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1188334836.97akelts': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(20.385, 0.0, 0.0),'Pos': Point3(-861.286, -284.511, 106.046),'Scale': VBase3(1.925, 1.13, 1.0),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1188335045.33akelts': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-108.2, 0.0, 0.0),'Pos': Point3(-874.934, -61.964, 100.482),'Scale': VBase3(1.031, 0.311, 1.712),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1188335129.05akelts': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-85.695, 0.0, 0.0),'Pos': Point3(-888.736, -75.327, 99.345),'Scale': VBase3(1.021, 1.865, 1.865),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1188335193.84akelts': {'Type': 'Barrel','DisableCollision': True,'Hpr': VBase3(-15.88, 0.0, 0.0),'Pos': Point3(-887.067, -78.215, 99.625),'Scale': VBase3(0.566, 0.566, 0.476),'Visual': {'Color': (0.7900000214576721, 0.6499999761581421, 0.5299999713897705, 1.0),'Model': 'models/props/barrel'}},'1188583287.37kmuller': {'Type': 'Bush','DisableCollision': True,'Hpr': VBase3(-119.796, 0.0, 0.0),'Pos': Point3(-1046.505, 154.504, 78.193),'Scale': VBase3(0.694, 0.694, 0.694),'Visual': {'Model': 'models/vegetation/bush_f'}},'1188583309.23kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-38.696, 0.0, 0.0),'Pos': Point3(-1047.36, 151.089, 78.056),'Scale': VBase3(1.0, 1.0, 1.276),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1188583789.34kmuller': {'Type': 'Crate','DisableCollision': False,'Hpr': VBase3(-32.238, 0.0, 0.0),'Pos': Point3(-1344.685, 111.556, 8.246),'Scale': VBase3(0.868, 0.868, 0.868),'Visual': {'Color': (0.4699999988079071, 0.4099999964237213, 0.3799999952316284, 1.0),'Model': 'models/props/crate'}},'1188584057.33kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(38.968, 0.0, 0.0),'Pos': Point3(-1003.592, -276.805, 82.037),'Scale': VBase3(5.944, 2.741, 1.537),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1188584117.41kmuller': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(0.0, 0.0, -6.399),'Pos': Point3(-1014.356, -280.4, 83.124),'Scale': VBase3(2.931, 2.931, 4.945),'Visual': {'Model': 'models/vegetation/Cactus_b'}},'1188584164.94kmuller': {'Type': 'Cacti','DisableCollision': False,'Hpr': VBase3(105.024, -8.7, 4.103),'Pos': Point3(-1016.223, -281.123, 82.692),'Scale': VBase3(1.771, 1.771, 1.569),'Visual': {'Model': 'models/vegetation/Cactus_b'}},'1188584876.69kmuller': {'Type': 'Bush','DisableCollision': False,'Hpr': VBase3(50.542, 0.0, 0.0),'Pos': Point3(-1035.971, 93.134, 80.652),'Scale': VBase3(1.232, 1.232, 1.232),'Visual': {'Model': 'models/vegetation/bush_f'}},'1189106461.23kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-159.256, 0.0, 0.0),'Pos': Point3(-882.227, -67.971, 99.237),'Scale': VBase3(1.472, 1.61, 1.941),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1189106660.31kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-3.42, 0.0, 0.0),'Pos': Point3(-818.78, -43.55, 102.713),'Scale': VBase3(1.971, 1.39, 1.76),'Visual': {'Model': 'models/misc/coll_cube_barrier'}},'1189106824.26kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(8.006, 0.0, 0.0),'Pos': Point3(-854.894, 64.134, 100.168),'Scale': VBase3(0.324, 1.0, 2.788),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1189106846.25kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-50.103, 0.0, 0.0),'Pos': Point3(-857.888, 65.676, 99.257),'Scale': VBase3(0.476, 1.0, 2.959),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1189106972.64kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-92.303, 0.0, 0.0),'Pos': Point3(-1061.324, 286.836, 79.08),'Scale': VBase3(0.179, 1.0, 2.477),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1189107199.53kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(56.391, 0.0, 0.0),'Pos': Point3(-973.162, 115.487, 88.092),'Scale': VBase3(1.0, 1.0, 3.025),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1189107229.0kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-88.323, 0.0, 0.0),'Pos': Point3(-945.077, 99.291, 91.369),'Scale': VBase3(0.465, 1.0, 2.633),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1189111036.84kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-166.101, 0.0, 0.0),'Pos': Point3(-679.401, 62.499, 111.486),'Scale': VBase3(0.568, 1.0, 2.4),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1189111340.15kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(150.127, 0.0, 0.0),'Pos': Point3(-1062.932, -144.329, 78.888),'Scale': VBase3(1.635, 1.141, 2.975),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1189111365.98kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(91.958, 0.0, 0.0),'Pos': Point3(-1055.693, -155.704, 79.771),'Scale': VBase3(1.497, 1.0, 2.813),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1189111437.9kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(122.842, 0.0, 0.0),'Pos': Point3(-1050.654, -171.319, 79.575),'Scale': VBase3(2.129, 1.855, 2.859),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1189111495.71kmuller': {'Type': 'Crate','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1058.651, -156.959, 79.958),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/crate_04'}},'1189111511.64kmuller': {'Type': 'Barrel','DisableCollision': False,'Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(-1048.227, -178.863, 80.033),'Scale': VBase3(0.486, 0.486, 0.486),'Visual': {'Model': 'models/props/barrel'}},'1189470592.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(166.802, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(715.682, -1180.383, 34.539),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'High Skeleton','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1189470592.0dxschafe0': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(142.699, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(860.565, -1346.859, 18.654),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Elite Skeleton','Start State': 'Ambush','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1189470592.0dxschafe1': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(-71.71, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(432.771, -1215.657, 32.012),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Elite Skeleton','Start State': 'Ambush','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1189470592.0dxschafe2': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(144.659, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': '100','Pause Duration': '30','Pos': Point3(646.196, -1123.976, 36.766),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'High Skeleton','Start State': 'Ambush','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1189470592.0dxschafe3': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(-114.731, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(323.336, -1310.389, 33.375),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Fierce Skeleton','Start State': 'Ambush','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1189470592.0dxschafe4': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'gp_searching','Hpr': VBase3(168.609, 0.0, 0.0),'Min Population': '1','Patrol Radius': '3.8614','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(615.191, -1192.934, 32.175),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Elite Skeleton','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1189470592.0dxschafe5': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(-90.352, 0.0, 0.0),'Min Population': '1','Patrol Radius': '8.2108','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(460.232, -1171.971, 33.983),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Elite Skeleton','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1189470848.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'attack_sword_slash','Hpr': VBase3(-114.724, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(575.28, -1143.076, 35.719),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Navy - Officer','Start State': 'Idle','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1189470976.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'attack_sword_lunge','Hpr': VBase3(48.02, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(582.976, -1147.807, 35.544),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Undead - Zombie','Start State': 'Idle','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1189470976.0dxschafe0': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'attack_sword_cleave','Hpr': Point3(0.0, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(528.264, -1158.69, 32.995),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Undead - Corpse','Start State': 'Idle','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1189471104.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'attack_sword_lunge','Hpr': VBase3(153.864, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(531.027, -1151.731, 34.063),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Navy - Sergeant','Start State': 'Idle','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1189471232.0dxschafe': {'Type': 'Object Spawn Node','Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(326.955, -1264.944, 34.365),'Priority': '1','Scale': VBase3(1.0, 1.0, 1.0),'SpawnDelay': '20','Spawnables': 'Buried Treasure','Visual': {'Color': (0.8, 0.2, 0.65, 1),'Model': 'models/misc/smiley'},'startingDepth': '15'},'1189471232.0dxschafe0': {'Type': 'Object Spawn Node','Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(608.754, -1093.614, 39.742),'Priority': '1','Scale': VBase3(1.0, 1.0, 1.0),'SpawnDelay': '20','Spawnables': 'Buried Treasure','Visual': {'Color': (0.8, 0.2, 0.65, 1),'Model': 'models/misc/smiley'},'startingDepth': '15'},'1189471232.0dxschafe1': {'Type': 'Object Spawn Node','Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(775.848, -1233.147, 29.836),'Priority': '1','Scale': VBase3(1.0, 1.0, 1.0),'SpawnDelay': '20','Spawnables': 'Buried Treasure','Visual': {'Color': (0.8, 0.2, 0.65, 1),'Model': 'models/misc/smiley'},'startingDepth': '15'},'1189471232.0dxschafe2': {'Type': 'Object Spawn Node','Hpr': Point3(0.0, 0.0, 0.0),'Pos': Point3(459.195, -1253.116, 29.879),'Priority': '1','Scale': VBase3(1.0, 1.0, 1.0),'SpawnDelay': '20','Spawnables': 'Buried Treasure','Visual': {'Color': (0.8, 0.2, 0.65, 1),'Model': 'models/misc/smiley'},'startingDepth': '15'},'1190411258.51kmuller': {'Type': 'Interior_furnishings','DisableCollision': False,'Hpr': VBase3(108.875, 0.0, 0.0),'Pos': Point3(-1377.787, -618.117, 149.523),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Model': 'models/props/interior_column_fort'}},'1190672768.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(72.846, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(734.003, -1383.503, 19.559),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Fierce Skeleton','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1190672768.0dxschafe0': {'Type': 'Building Exterior','File': 'del_fuego_building_int_tattoo_2','ExtUid': '1190672768.0dxschafe1','Hpr': VBase3(-85.986, 2.067, 0.0),'Objects': {'1154560299.24dxschafe': {'Type': 'Locator Node','Name': 'portal_exterior_1','GridPos': Point3(699.728, -1258.837, 80.755),'Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-0.277, -13.756, 1.023),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe56': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(0.41, -5.622, 0.912),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe57': {'Type': 'Door Locator Node','Name': 'door_locator_2','Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(6.973, 21.237, 1.039),'Scale': VBase3(1.0, 1.0, 1.0)}},'Pos': Point3(712.056, -1238.393, 32.925),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Name': '','Color': (0.30000001192092896, 0.30000001192092896, 0.30000001192092896, 1.0),'Door': 'models/buildings/shanty_guildhall_door','Interior': 'models/buildings/interior_shanty_guildhall','Model': 'models/buildings/shanty_npc_house_combo_B','SignFrame': 'models/buildings/sign1_shanty_a_frame','SignImage': 'models/buildings/sign1_eng_a_icon_tattoo'}},'1190672768.0dxschafe2': {'Type': 'Locator Node','Name': 'portal_exterior_1','GridPos': Point3(699.728, -1258.837, 80.755),'Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-0.277, -13.756, 1.023),'Scale': VBase3(1.0, 1.0, 1.0)},'1190672896.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(142.699, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(654.503, -1295.96, 29.972),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Fierce Skeleton','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1190672896.0dxschafe0': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(-112.502, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(547.795, -1372.131, 23.206),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Fierce Skeleton','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1190672896.0dxschafe1': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(150.122, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(713.016, -1500.44, 4.684),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Rock Crab','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1190672896.0dxschafe2': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(150.122, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(800.348, -1442.607, 13.304),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Rock Crab','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1190928751.4kmuller': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(159.317, 0.0, 0.0),'Pos': Point3(-742.217, 77.238, 111.906),'Scale': VBase3(0.392, 1.024, 1.241),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1192672000.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(150.122, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(611.139, -1529.948, 2.942),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Rock Crab','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1192672000.0dxschafe0': {'Type': 'Spawn Node','Aggro Radius': '44.8795','AnimSet': 'default','Hpr': VBase3(39.18, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(859.201, -1518.257, -2.521),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Giant Crab','Start State': 'Ambush','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1192672000.0dxschafe1': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(150.122, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(923.951, -1340.015, 15.279),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Rock Crab','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1192672000.0dxschafe2': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(150.122, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(790.732, -1493.804, 2.006),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Giant Crab','Start State': 'Ambush','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1192672128.0dxschafe': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(36.028, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(375.298, -1455.691, 2.643),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Giant Crab','Start State': 'Ambush','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1192672128.0dxschafe0': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(-64.771, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(528.019, -1297.188, 30.009),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Fierce Skeleton','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1192672128.0dxschafe1': {'Type': 'Spawn Node','Aggro Radius': '12.0000','AnimSet': 'default','Hpr': VBase3(-64.771, 0.0, 0.0),'Min Population': '1','Patrol Radius': '12.0000','Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(587.105, -1309.196, 28.94),'PoseAnim': '','PoseFrame': '','Scale': VBase3(1.0, 1.0, 1.0),'Spawnables': 'Fierce Skeleton','Start State': 'Patrol','StartFrame': '0','Team': 'default','TrailFX': 'None','Visual': {'Color': (0, 0, 0.65, 1),'Model': 'models/misc/smiley'}},'1192672128.0dxschafe2': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(663.008, -1348.379, 23.604),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1192672128.0dxschafe3': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(678.633, -1263.409, 31.446),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1192672128.0dxschafe4': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(776.555, -1208.27, 30.951),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1192672128.0dxschafe5': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(858.697, -1289.644, 21.75),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1192672128.0dxschafe6': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(799.994, -1387.079, 17.988),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1192672256.0dxschafe': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': 100,'Pause Duration': 30,'Pos': Point3(624.899, -1327.891, 26.374),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1192672256.0dxschafe0': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(583.474, -1369.466, 23.058),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1192672256.0dxschafe1': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(531.604, -1330.298, 27.06),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1192672256.0dxschafe2': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(558.529, -1286.097, 29.904),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1192672256.0dxschafe3': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(624.329, -1242.825, 31.071),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1192672384.0dxschafe': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(679.873, -1102.11, 39.16),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1192672384.0dxschafe0': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(335.752, -1371.361, 20.313),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1192672512.0dxschafe': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(578.573, -1178.79, 32.949),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1192672512.0dxschafe0': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(663.404, -1279.429, 30.583),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1192672512.0dxschafe1': {'Type': 'Movement Node','Hpr': Point3(0.0, 0.0, 0.0),'Pause Chance': '100','Pause Duration': '30','Pos': Point3(710.485, -1206.964, 33.672),'Scale': VBase3(1.0, 1.0, 1.0),'Visual': {'Color': (0.65, 0, 0, 1),'Model': 'models/misc/smiley'}},'1195173306.84akelts': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-83.423, 0.0, 0.0),'Pos': Point3(-1017.273, -522.484, 108.794),'Scale': VBase3(2.463, 0.564, 1.545),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1195173411.14akelts': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(-73.658, 0.0, 0.0),'Pos': Point3(-1010.121, -497.108, 108.222),'Scale': VBase3(0.772, 0.564, 1.669),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1196811067.33akelts': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(130.139, 0.0, 0.0),'Pos': Point3(-1220.524, 286.021, 64.4),'Scale': VBase3(0.83, 1.038, 2.239),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1200005812.86akelts': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(6.134, 0.0, 0.0),'Pos': Point3(-1213.788, 304.769, 65.265),'Scale': VBase3(1.815, 1.53, 1.53),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1200005822.8akelts': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(82.29, 0.0, 0.0),'Pos': Point3(-1198.048, 328.869, 65.632),'Scale': VBase3(1.586, 1.53, 1.53),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1200005840.83akelts': {'Type': 'Collision Barrier','DisableCollision': False,'Hpr': VBase3(69.323, 0.0, 0.0),'Pos': Point3(-1201.999, 313.46, 65.526),'Scale': VBase3(1.691, 1.53, 1.53),'Visual': {'Model': 'models/misc/coll_plane_barrier'}},'1200533376.0dxschafe68': {'Type': 'Door Locator Node','Name': 'door_locator','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(-0.179, -4.421, 4.89),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe69': {'Type': 'Door Locator Node','Name': 'door_locator_2','Hpr': VBase3(0.0, 0.0, 0.0),'Pos': Point3(6.973, 21.237, 1.039),'Scale': VBase3(1.0, 1.0, 1.0)},'1200533376.0dxschafe70': {'Type': 'Door Locator Node','Name': 'door_locator_3','Hpr': VBase3(-180.0, 0.0, 0.0),'Pos': Point3(16.298, -2.671, 0.0),'Scale': VBase3(1.0, 1.0, 1.0)},'1207073489.41mtucker': {'Type': 'Townsperson','Category': 'Commoner','AnimSet': 'default','CustomModel': 'None','DNA': '1207073489.41mtucker','Hpr': Point3(0.0, 0.0, 0.0),'Patrol Radius': '1.0000','Pos': Point3(-950.112, -763.949, 119.881),'PoseAnim': '','PoseFrame': '','Private Status': 'All','Respawns': True,'Scale': VBase3(1.0, 1.0, 1.0),'ShopID': 'DEL_FUEGO_DEFAULTS','Start State': 'Idle','StartFrame': '0','Team': 'Player','TrailFX': 'None'},'1219424341.05mtucker': {'Type': 'Skeleton','Aggro Radius': '3.0120','AnimSet': 'idleB','AvId': 7,'AvTrack': 0,'Boss': True,'Hpr': VBase3(161.262, 2.019, 0.0),'Patrol Radius': '3.5181','Pos': Point3(752.034, -1317.243, 45.866),'PoseAnim': '','PoseFrame': '','Respawns': True,'Scale': VBase3(1.0, 1.0, 1.0),'Start State': 'Idle','StartFrame': '0','TrailFX': 'None'},'1219425030.24mtucker': {'Type': 'Skeleton','Aggro Radius': '3.9157','AnimSet': 'default','AvId': 6,'AvTrack': 0,'Boss': True,'Hpr': VBase3(-36.625, 0.0, 0.0),'Patrol Radius': '3.0602','Pos': Point3(512.452, -1186.194, 30.378),'PoseAnim': '','PoseFrame': '','Respawns': True,'Scale': VBase3(1.0, 1.0, 1.0),'Start State': 'Idle','StartFrame': '0','TrailFX': 'None'}},'Phase': 1,'Undockable': False,'Visual': {'Model': 'models/islands/madre_del_fuego_zero'}}},'Node Links': [['1176420352.0dxschafe0', '1176420352.0dxschafe', 'Bi-directional'], ['1176420608.0dxschafe', '1176420608.0dxschafe0', 'Bi-directional'], ['1176420608.0dxschafe', '1176420480.0dxschafe0', 'Bi-directional'], ['1176420480.0dxschafe0', '1176420480.0dxschafe1', 'Bi-directional'], ['1176420480.0dxschafe1', '1176420480.0dxschafe', 'Bi-directional'], ['1176420480.0dxschafe', '1176420608.0dxschafe1', 'Bi-directional'], ['1176420736.0dxschafe2', '1176420736.0dxschafe0', 'Bi-directional'], ['1176420736.0dxschafe2', '1176420736.0dxschafe1', 'Bi-directional'], ['1176420736.0dxschafe2', '1176420992.0dxschafe', 'Bi-directional'], ['1176420736.0dxschafe0', '1176420736.0dxschafe1', 'Bi-directional'], ['1176420736.0dxschafe0', '1176420992.0dxschafe', 'Bi-directional'], ['1176420736.0dxschafe1', '1176420992.0dxschafe', 'Bi-directional'], ['1176421120.0dxschafe1', '1176421120.0dxschafe', 'Bi-directional'], ['1176421120.0dxschafe1', '1176421248.0dxschafe0', 'Bi-directional'], ['1176421120.0dxschafe1', '1176421248.0dxschafe', 'Bi-directional'], ['1176421120.0dxschafe', '1176421248.0dxschafe0', 'Bi-directional'], ['1176421120.0dxschafe', '1176421248.0dxschafe', 'Bi-directional'], ['1176421248.0dxschafe0', '1176421248.0dxschafe', 'Bi-directional'], ['1176421504.0dxschafe0', '1176421504.0dxschafe', 'Bi-directional'], ['1176421632.0dxschafe0', '1176421632.0dxschafe', 'Bi-directional'], ['1176421760.0dxschafe1', '1176421760.0dxschafe0', 'Bi-directional'], ['1176421760.0dxschafe', '1176421760.0dxschafe0', 'Bi-directional'], ['1176422016.0dxschafe0', '1176422016.0dxschafe1', 'Bi-directional'], ['1176422016.0dxschafe0', '1176422016.0dxschafe', 'Bi-directional'], ['1176421888.0dxschafe', '1176422016.0dxschafe', 'Bi-directional'], ['1190672768.0dxschafe', '1192672128.0dxschafe2', 'Bi-directional'], ['1192672128.0dxschafe3', '1192672128.0dxschafe2', 'Bi-directional'], ['1192672128.0dxschafe3', '1192672128.0dxschafe4', 'Bi-directional'], ['1192672128.0dxschafe5', '1192672128.0dxschafe4', 'Bi-directional'], ['1192672128.0dxschafe5', '1192672128.0dxschafe6', 'Bi-directional'], ['1192672128.0dxschafe6', '1190672768.0dxschafe', 'Bi-directional'], ['1190672896.0dxschafe0', '1192672256.0dxschafe0', 'Bi-directional'], ['1192672256.0dxschafe', '1192672256.0dxschafe0', 'Bi-directional'], ['1192672256.0dxschafe', '1192672256.0dxschafe3', 'Bi-directional'], ['1192672256.0dxschafe3', '1192672256.0dxschafe2', 'Bi-directional'], ['1192672256.0dxschafe1', '1192672256.0dxschafe2', 'Bi-directional'], ['1192672256.0dxschafe1', '1190672896.0dxschafe0', 'Bi-directional'], ['1192672256.0dxschafe2', '1192672128.0dxschafe0', 'Bi-directional'], ['1192672256.0dxschafe', '1192672128.0dxschafe1', 'Bi-directional'], ['1192672128.0dxschafe3', '1190672896.0dxschafe', 'Bi-directional'], ['1192672128.0dxschafe5', '1189470592.0dxschafe0', 'Bi-directional'], ['1192672384.0dxschafe', '1177377280.0dxschafe1', 'Bi-directional'], ['1177377280.0dxschafe0', '1192672384.0dxschafe0', 'Bi-directional'], ['1192672512.0dxschafe', '1192672512.0dxschafe0', 'Bi-directional'], ['1189470592.0dxschafe2', '1192672512.0dxschafe', 'Bi-directional'], ['1189470592.0dxschafe2', '1192672512.0dxschafe1', 'Bi-directional'], ['1192672512.0dxschafe1', '1192672512.0dxschafe0', 'Bi-directional'], ['1176421248.0dxschafe0', '1192672768.0dxschafe0', 'Bi-directional'], ['1192672768.0dxschafe', '1176420736.0dxschafe0', 'Bi-directional'], ['1192672896.0dxschafe', '1176420736.0dxschafe1', 'Bi-directional'], ['1192672896.0dxschafe0', '1176420480.0dxschafe0', 'Bi-directional'], ['1192673024.0dxschafe', '1176421632.0dxschafe0', 'Bi-directional'], ['1192673024.0dxschafe0', '1176420608.0dxschafe1', 'Bi-directional'], ['1192673152.0dxschafe2', '1192673152.0dxschafe1', 'Bi-directional'], ['1192673152.0dxschafe1', '1192673152.0dxschafe0', 'Bi-directional'], ['1192673152.0dxschafe', '1192673152.0dxschafe0', 'Bi-directional']],'Layers': {'Collisions': ['1184008208.59kmuller', '1184016064.62kmuller', '1184013852.84kmuller', '1185822696.06kmuller', '1184006140.32kmuller', '1184002350.98kmuller', '1184007573.29kmuller', '1184021176.59kmuller', '1184005963.59kmuller', '1188324241.31akelts', '1184006537.34kmuller', '1184006605.81kmuller', '1187139568.33kmuller', '1188324186.98akelts', '1184006730.66kmuller', '1184007538.51kmuller', '1184006188.41kmuller', '1184021084.27kmuller', '1185824396.94kmuller', '1185824250.16kmuller', '1185823630.52kmuller', '1185823760.23kmuller', '1185824497.83kmuller', '1185824751.45kmuller', '1187739103.34akelts', '1188323993.34akelts', '1184016538.29kmuller', '1185822200.97kmuller', '1184016225.99kmuller', '1195241421.34akelts', '1195242796.08akelts', '1184020642.13kmuller', '1195237994.63akelts', '1184020756.88kmuller', '1184020833.4kmuller', '1185820992.97kmuller', '1185821053.83kmuller', '1184015068.54kmuller', '1184014935.82kmuller', '1185821432.88kmuller', '1185821701.86kmuller', '1195240137.55akelts', '1195241539.38akelts', '1195238422.3akelts', '1195238473.22akelts', '1185821453.17kmuller', '1184021269.96kmuller', '1185821310.89kmuller', '1185821165.59kmuller', '1185821199.36kmuller', '1185822035.98kmuller', '1184015806.59kmuller', '1185822059.48kmuller', '1185920461.76kmuller', '1194984449.66akelts', '1185824206.22kmuller', '1184003446.23kmuller', '1184003254.85kmuller', '1184003218.74kmuller', '1184002700.44kmuller', '1186705073.11kmuller', '1187658531.86akelts', '1186705214.3kmuller', '1185824927.28kmuller', '1184014204.54kmuller', '1184014152.84kmuller']},'ObjectIds': {'1142018473.22dxschafe': '["Objects"]["1142018473.22dxschafe"]','1153427017.86dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153427017.86dzlu"]','1153427017.86dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153427017.86dzlu"]','1153427043.1dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153427043.1dzlu"]','1153427043.1dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153427043.1dzlu"]','1153430563.72dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153430563.72dzlu"]','1153430563.72dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153430563.72dzlu"]','1153430674.19dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153430674.19dzlu"]','1153430674.19dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153430674.19dzlu"]','1153430734.73dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153430734.73dzlu"]','1153430734.73dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153430734.73dzlu"]','1153430887.13dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153430887.13dzlu"]','1153430887.13dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153430887.13dzlu"]','1153431088.58dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153431088.58dzlu"]','1153431227.81dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153431227.81dzlu"]','1153431227.81dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153431227.81dzlu"]','1153434069.63dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434069.63dzlu"]','1153434458.97dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434458.97dzlu"]','1153434458.97dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434458.97dzlu"]','1153434600.3dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434600.3dzlu"]','1153434600.3dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434600.3dzlu"]','1153434762.53dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434762.53dzlu"]','1153434762.53dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434762.53dzlu"]','1153434762.58dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434762.53dzlu"]["Objects"]["1153434762.58dzlu"]','1153434762.58dzlu00': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435103.16dzlu"]["Objects"]["1153434762.58dzlu00"]','1153434880.63dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434880.63dzlu"]','1153434880.63dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434880.63dzlu"]','1153434903.61dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434903.61dzlu"]','1153434903.61dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434903.61dzlu"]','1153434928.03dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434928.03dzlu"]','1153434928.03dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434928.03dzlu"]','1153434980.85dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434980.85dzlu"]','1153434980.85dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434980.85dzlu"]','1153435103.16dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435103.16dzlu"]','1153435103.16dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435103.16dzlu"]','1153435251.58dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435251.58dzlu"]','1153435251.58dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435251.58dzlu"]','1153435388.6dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435388.6dzlu"]','1153435388.6dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435388.6dzlu"]','1153435428.14dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435428.14dzlu"]','1153435428.14dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435428.14dzlu"]','1153435636.19dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435636.19dzlu"]','1153435636.19dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435636.19dzlu"]','1153435760.44dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435760.44dzlu"]','1153435760.44dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435760.44dzlu"]','1153435842.17dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435842.17dzlu"]','1153435842.17dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435842.17dzlu"]','1153435903.89dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435903.89dzlu"]','1153435903.89dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435903.89dzlu"]','1153436006.19dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436006.19dzlu"]','1153436006.19dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436006.19dzlu"]','1153436023.94dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436023.94dzlu"]','1153436023.94dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436023.94dzlu"]','1153436035.52dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436035.52dzlu"]','1153436035.52dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436035.52dzlu"]','1153436052.28dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436052.28dzlu"]','1153436052.28dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436052.28dzlu"]','1153436073.35dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436073.35dzlu"]','1153436073.35dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436073.35dzlu"]','1153436123.61dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436123.61dzlu"]','1153436123.61dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436123.61dzlu"]','1153436162.31dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436162.31dzlu"]','1153436162.31dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436162.31dzlu"]','1153436182.45dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436182.45dzlu"]','1153436182.45dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436182.45dzlu"]','1153436381.55dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436381.55dzlu"]','1153436381.55dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436381.55dzlu"]','1153436398.13dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436398.13dzlu"]','1153436398.13dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436398.13dzlu"]','1153436426.8dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436426.8dzlu"]','1153436426.8dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436426.8dzlu"]','1153436556.14dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436556.14dzlu"]','1153436556.14dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436556.14dzlu"]','1153436814.2dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436814.2dzlu"]','1153436900.97dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436900.97dzlu"]','1153436923.03dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436923.03dzlu"]','1153436923.03dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436923.03dzlu"]','1153437235.45dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153437235.45dzlu"]','1153437235.45dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153437235.45dzlu"]','1153437283.31dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153437283.31dzlu"]','1153437283.31dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153437283.31dzlu"]','1153437295.8dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153437295.8dzlu"]','1153437295.8dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153437295.8dzlu"]','1153437376.53dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153437376.53dzlu"]','1153437376.53dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153437376.53dzlu"]','1153437552.45dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153437552.45dzlu"]','1153437552.45dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153437552.45dzlu"]','1153437585.28dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153437585.28dzlu"]','1153437585.28dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153437585.28dzlu"]','1153437658.0dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153437658.0dzlu"]','1153437866.02dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153437866.02dzlu"]','1153439434.77dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153439434.77dzlu"]','1153439434.77dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153439434.77dzlu"]','1153439501.56dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153439501.56dzlu"]','1153439512.64dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153439512.64dzlu"]','1153439562.8dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153439562.8dzlu"]','1153439589.61dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153439589.61dzlu"]','1153441219.3dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153441219.3dzlu"]','1153441219.3dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153441219.3dzlu"]','1153441633.03dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153441633.03dzlu"]','1153442729.95dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153442729.95dzlu"]','1153443230.38dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153443230.38dzlu"]','1153443320.44dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153443320.44dzlu"]','1153443854.47dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153443854.47dzlu"]','1153443938.06dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153443938.06dzlu"]','1153443938.06dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153443938.06dzlu"]','1153444094.69dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153444094.69dzlu"]','1153444176.56dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153444176.56dzlu"]','1153444176.56dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153444176.56dzlu"]','1153444546.22dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153444546.22dzlu"]','1153444554.22dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153444554.22dzlu"]','1153444556.45dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153444556.45dzlu"]','1153500451.36dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153500451.36dzlu"]','1153500493.92dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153500493.92dzlu"]','1153500516.7dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153500516.7dzlu"]','1153500581.08dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153500581.08dzlu"]','1153500606.09dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153500606.09dzlu"]','1153507305.2dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153507305.2dzlu"]','1153507305.2dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153507305.2dzlu"]','1153507825.14dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153507825.14dzlu"]','1153508272.11dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153508272.11dzlu"]','1153508272.11dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153508272.11dzlu"]','1153508552.43dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153508552.43dzlu"]','1153508552.43dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153508552.43dzlu"]','1153508657.78dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153508657.78dzlu"]','1153508657.78dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153508657.78dzlu"]','1153509328.84sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153509328.84sdnaik"]','1153777653.46dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777653.46dzlu"]','1153777653.46dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777653.46dzlu"]','1153777676.87dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777676.87dzlu"]','1153777676.87dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777676.87dzlu"]','1153777696.89dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777696.89dzlu"]','1153777696.89dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777696.89dzlu"]','1153777776.85dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777776.85dzlu"]','1153777776.85dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777776.85dzlu"]','1153777833.68dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777833.68dzlu"]','1153777833.68dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777833.68dzlu"]','1153777833.7dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777833.68dzlu"]["Objects"]["1153777833.7dzlu"]','1153777945.95dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777945.95dzlu"]','1153777945.95dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777945.95dzlu"]','1153778017.46dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778017.46dzlu"]','1153778017.46dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778017.46dzlu"]','1153778094.12dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778094.12dzlu"]','1153778094.12dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778094.12dzlu"]','1153778118.18dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778118.18dzlu"]','1153778118.18dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778118.18dzlu"]','1153778153.99dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778153.99dzlu"]','1153778153.99dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778153.99dzlu"]','1153778248.93dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778248.93dzlu"]','1153778248.93dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778248.93dzlu"]','1153778337.46dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778337.46dzlu"]','1153778337.46dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778337.46dzlu"]','1153778377.37dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778377.37dzlu"]','1153778390.65dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778390.65dzlu"]','1153778420.49dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778420.49dzlu"]','1153778450.01dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778450.01dzlu"]','1153778520.39dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778520.39dzlu"]','1153778557.87dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778557.87dzlu"]','1153778566.73dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778566.73dzlu"]','1153778611.01dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778611.01dzlu"]','1153778638.7dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778638.7dzlu"]','1153778672.26dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778672.26dzlu"]','1153778975.64dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778975.64dzlu"]','1153778975.64dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778975.64dzlu"]','1153778993.74dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778993.74dzlu"]','1153778993.74dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778993.74dzlu"]','1153779024.62dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153779024.62dzlu"]','1153779024.62dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153779024.62dzlu"]','1153779071.14dzlu': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153779071.14dzlu"]','1153779071.14dzlu0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153779071.14dzlu"]','1153848061.84sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153848061.84sdnaik"]','1154560297.97dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778017.46dzlu"]["Objects"]["1154560297.97dxschafe"]','1154560298.86dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778118.18dzlu"]["Objects"]["1154560298.86dxschafe"]','1154560298.86dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777653.46dzlu"]["Objects"]["1154560298.86dxschafe0"]','1154560299.24dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1190672768.0dxschafe0"]["Objects"]["1154560299.24dxschafe"]','1154564157.01dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]','1155666849.43dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155666849.43dxschafe"]','1155666863.17dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155666863.17dxschafe"]','1155667777.63dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155667777.63dxschafe"]','1155667947.62dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155667947.62dxschafe"]','1155684760.49dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155684760.49dxschafe"]','1155684828.4dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155684828.4dxschafe"]','1155684840.45dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155684840.45dxschafe"]','1155684860.92dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155684860.92dxschafe"]','1155684906.36dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155684906.36dxschafe"]','1155684946.54dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155684946.54dxschafe"]','1155685060.64dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155685060.64dxschafe"]','1155685160.26dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155685160.26dxschafe"]','1155685272.34dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155685272.34dxschafe"]','1155685480.08dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155685480.08dxschafe"]','1155686336.37dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155686336.37dxschafe"]','1155686356.86dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155686356.86dxschafe"]','1155686393.63dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155686393.63dxschafe"]','1155686422.03dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155686422.03dxschafe"]','1155687216.36dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155687216.36dxschafe"]','1155687259.5dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155687259.5dxschafe"]','1155687319.17dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155687319.17dxschafe"]','1155687328.16dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155687328.16dxschafe"]','1155687503.23dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155687503.23dxschafe"]','1155687894.29dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155687894.29dxschafe"]','1155687992.31dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155687992.31dxschafe"]','1155688040.88dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155688040.88dxschafe"]','1155688072.41dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155688072.41dxschafe"]','1155688135.99dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155688135.99dxschafe"]','1155688270.81dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155688270.81dxschafe"]','1155688602.99dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155688602.99dxschafe"]','1155688729.94dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155688729.94dxschafe"]','1155752242.79dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155752242.79dxschafe"]','1155752378.92dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155752378.92dxschafe"]','1155753131.97dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155753131.97dxschafe"]','1155765923.85dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155765923.85dxschafe"]','1155766116.09dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155766116.09dxschafe"]','1155766194.11dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155766194.11dxschafe"]','1155766300.24dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155766300.24dxschafe"]','1155766494.6dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155766494.6dxschafe"]','1155766521.72dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155766521.72dxschafe"]','1155766525.62dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155766525.62dxschafe"]','1155766543.53dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155766543.53dxschafe"]','1155766545.68dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155766545.68dxschafe"]','1155766547.3dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155766547.3dxschafe"]','1155766548.77dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155766548.77dxschafe"]','1155766682.4dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155766682.4dxschafe"]','1155766778.29dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155766778.29dxschafe"]','1155766974.82dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155766974.82dxschafe"]','1155767384.23dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155767384.23dxschafe"]','1155768439.83dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155768439.83dxschafe"]','1155768743.05dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155768743.05dxschafe"]','1155768838.56dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155768838.56dxschafe"]','1155768840.77dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155768840.77dxschafe"]','1155769179.08dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155769179.08dxschafe"]','1155769240.78dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155769240.78dxschafe"]','1155769322.16dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155769322.16dxschafe"]','1155769322.17dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155769322.17dxschafe"]','1155769462.45dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155769462.45dxschafe"]','1155769802.33dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155769802.33dxschafe"]','1155769916.47dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155769916.47dxschafe"]','1155770041.03dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770041.03dxschafe"]','1155770041.03dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770041.03dxschafe"]','1155770102.37dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770102.37dxschafe"]','1155770146.67dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770146.67dxschafe"]','1155770267.94dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770267.94dxschafe"]','1155770342.53dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770342.53dxschafe"]','1155770364.29dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770364.29dxschafe"]','1155770415.57dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770415.57dxschafe"]','1155770510.38dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770510.38dxschafe"]','1155770527.83dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770527.83dxschafe"]','1155770534.77dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770534.77dxschafe"]','1155770536.07dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770536.07dxschafe"]','1155770537.26dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770537.26dxschafe"]','1155770634.15dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770634.15dxschafe"]','1155770635.44dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770635.44dxschafe"]','1155770636.87dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770636.87dxschafe"]','1155770977.43dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770977.43dxschafe"]','1155771286.15dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771286.15dxschafe"]','1155771300.3dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771300.3dxschafe"]','1155771305.19dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771305.19dxschafe"]','1155771339.9dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771339.9dxschafe"]','1155771506.4dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771506.4dxschafe"]','1155771536.16dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771536.16dxschafe"]','1155771541.16dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771541.16dxschafe"]','1155771545.51dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771545.51dxschafe"]','1155771564.79dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771564.79dxschafe"]','1155771566.13dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771566.13dxschafe"]','1155771599.37dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771599.37dxschafe"]','1155771677.27dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771677.27dxschafe"]','1155771697.27dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771697.27dxschafe"]','1155771700.55dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771700.55dxschafe"]','1155771711.01dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771711.01dxschafe"]','1155771720.96dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771720.96dxschafe"]','1155771734.27dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771734.27dxschafe"]','1155771775.96dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771775.96dxschafe"]','1155771821.05dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771821.05dxschafe"]','1155771831.21dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771831.21dxschafe"]','1155771870.63dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771870.63dxschafe"]','1155771872.96dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771872.96dxschafe"]','1155771874.99dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771874.99dxschafe"]','1155771875.74dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771875.74dxschafe"]','1155771877.07dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771877.07dxschafe"]','1155771919.55dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771919.55dxschafe"]','1155771920.54dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155771920.54dxschafe"]','1155772093.82dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772093.82dxschafe"]','1155772372.59dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772372.59dxschafe"]','1155772436.63dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772436.63dxschafe"]','1155772607.13dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157147497.41dxschafe"]["Objects"]["1155772607.13dxschafe"]','1155772611.87dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157147497.41dxschafe"]["Objects"]["1155772611.87dxschafe"]','1155772616.24dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157147497.41dxschafe"]["Objects"]["1155772616.24dxschafe"]','1155772616.84dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157147497.41dxschafe"]["Objects"]["1155772616.84dxschafe"]','1155772617.41dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157147497.41dxschafe"]["Objects"]["1155772617.41dxschafe"]','1155772629.19dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772629.19dxschafe"]','1155772629.71dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772629.71dxschafe"]','1155772630.15dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772630.15dxschafe"]','1155772632.09dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772632.09dxschafe"]','1155772632.48dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772632.48dxschafe"]','1155772633.09dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772633.09dxschafe"]','1155772633.63dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772633.63dxschafe"]','1155772636.23dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144544.82dxschafe"]["Objects"]["1155773759.29dxschafe"]["Objects"]["1155772636.23dxschafe"]','1155772636.68dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144544.82dxschafe"]["Objects"]["1155772636.68dxschafe"]','1155772637.15dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144544.82dxschafe"]["Objects"]["1155772637.15dxschafe"]','1155772646.07dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772646.07dxschafe"]','1155772649.52dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772649.52dxschafe"]','1155772650.51dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772650.51dxschafe"]','1155772663.05dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772663.05dxschafe"]','1155772664.05dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772664.05dxschafe"]','1155772686.65dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772686.65dxschafe"]','1155772687.37dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772687.37dxschafe"]','1155772688.85dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772688.85dxschafe"]','1155772699.68dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772699.68dxschafe"]','1155772744.26dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772744.26dxschafe"]','1155772764.04dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772764.04dxschafe"]','1155772764.46dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772764.46dxschafe"]','1155772764.93dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772764.93dxschafe"]','1155772772.04dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772772.04dxschafe"]','1155772775.94dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772775.94dxschafe"]','1155772776.74dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772776.74dxschafe"]','1155772778.27dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772778.27dxschafe"]','1155772779.19dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155772779.19dxschafe"]','1155773744.21dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773744.21dxschafe"]','1155773754.16dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773754.16dxschafe"]','1155773758.38dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144544.82dxschafe"]["Objects"]["1155773758.38dxschafe"]','1155773759.29dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144544.82dxschafe"]["Objects"]["1155773759.29dxschafe"]','1155773766.88dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773766.88dxschafe"]','1155773767.68dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773767.68dxschafe"]','1155773774.1dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773774.1dxschafe"]','1155773774.77dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773774.77dxschafe"]','1155773775.3dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773775.3dxschafe"]','1155773775.71dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773775.71dxschafe"]','1155773786.34dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773786.34dxschafe"]','1155773789.24dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773789.24dxschafe"]','1155773866.59dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773866.59dxschafe"]','1155773867.43dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773867.43dxschafe"]','1155773902.95dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773902.95dxschafe"]','1155773904.67dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773904.67dxschafe"]','1155773906.04dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773906.04dxschafe"]','1155773948.78dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773948.78dxschafe"]','1155773953.71dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144544.82dxschafe"]["Objects"]["1155773953.71dxschafe"]','1155773957.76dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144544.82dxschafe"]["Objects"]["1155773957.76dxschafe"]','1155773963.09dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144544.82dxschafe"]["Objects"]["1155773963.09dxschafe"]','1155773972.48dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157147497.41dxschafe"]["Objects"]["1155773972.48dxschafe"]','1155773975.89dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157147497.41dxschafe"]["Objects"]["1155773975.89dxschafe"]','1155773977.74dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157147497.41dxschafe"]["Objects"]["1155773977.74dxschafe"]','1155773981.17dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157147497.41dxschafe"]["Objects"]["1155773981.17dxschafe"]','1155773994.64dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155773994.64dxschafe"]','1155774000.89dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774000.89dxschafe"]','1155774004.04dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144574.32dxschafe"]["Objects"]["1155774004.04dxschafe"]','1155774058.12dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774058.12dxschafe"]','1155774119.98dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774119.98dxschafe"]','1155774130.87dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774130.87dxschafe"]','1155774136.47dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774136.47dxschafe"]','1155774143.76dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774143.76dxschafe"]','1155774149.67dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144544.82dxschafe"]["Objects"]["1155774149.67dxschafe"]','1155774164.22dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157147497.41dxschafe"]["Objects"]["1155774164.22dxschafe"]','1155774174.53dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774174.53dxschafe"]','1155774183.73dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774183.73dxschafe"]','1155774187.78dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774187.78dxschafe"]','1155774213.43dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774213.43dxschafe"]','1155774217.81dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774217.81dxschafe"]','1155774220.67dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774220.67dxschafe"]','1155774227.8dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774227.8dxschafe"]','1155774238.19dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774238.19dxschafe"]','1155774283.59dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774283.59dxschafe"]','1155774336.91dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774336.91dxschafe"]','1155774409.39dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155774409.39dxschafe"]','1155776698.45dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155776698.45dxschafe"]','1155777971.03dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155777971.03dxschafe"]','1155847912.55dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155847912.55dxschafe"]','1155847945.66dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155847945.66dxschafe"]','1155847967.2dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155847967.2dxschafe"]','1155848008.31dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155848008.31dxschafe"]','1155848076.92dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155848076.92dxschafe"]','1155848093.47dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155848093.47dxschafe"]','1155848103.28dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155848103.28dxschafe"]','1155848305.51dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155848305.51dxschafe"]','1155848750.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155848750.0dxschafe"]','1155848859.34dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155848859.34dxschafe"]','1155849570.14dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155849570.14dxschafe"]','1155849610.12dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155849610.12dxschafe"]','1155849648.82dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155849648.82dxschafe"]','1155849696.25dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155849696.25dxschafe"]','1155849717.8dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155849717.8dxschafe"]','1155849762.45dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155849762.45dxschafe"]','1155849771.59dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155849771.59dxschafe"]','1155849890.3dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155849890.3dxschafe"]','1155849954.14dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155849954.14dxschafe"]','1155849956.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155849956.0dxschafe"]','1155850027.19dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155850027.19dxschafe"]','1155850028.86dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155850028.86dxschafe"]','1155850252.52dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155850252.52dxschafe"]','1155850272.55dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155850272.55dxschafe"]','1155850326.54dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155850326.54dxschafe"]','1155850350.53dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155850350.53dxschafe"]','1155850375.17dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155850375.17dxschafe"]','1155850394.26dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155850394.26dxschafe"]','1155850443.39dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155850443.39dxschafe"]','1155850680.51dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155850680.51dxschafe"]','1155850915.44dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155850915.44dxschafe"]','1155850952.52dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155850952.52dxschafe"]','1155850988.27dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155850988.27dxschafe"]','1155851356.17dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155851356.17dxschafe"]','1155851629.69dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155851629.69dxschafe"]','1155851813.2dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155851813.2dxschafe"]','1155851820.86dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155851820.86dxschafe"]','1155852041.03dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155852041.03dxschafe"]','1155852183.79dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155852183.79dxschafe"]','1155852371.97dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155852371.97dxschafe"]','1155852423.1dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155852423.1dxschafe"]','1155852718.39dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155852718.39dxschafe"]','1155853802.17dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155853802.17dxschafe"]','1155853947.65dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155853947.65dxschafe"]','1155855913.71dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155855913.71dxschafe"]','1155855980.52dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155855980.52dxschafe"]','1155856108.37dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155856108.37dxschafe"]','1155856142.18dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155856142.18dxschafe"]','1155856359.7dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155856359.7dxschafe"]','1155856439.06dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155856439.06dxschafe"]','1155856503.55dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155856503.55dxschafe"]','1155858033.57dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155858033.57dxschafe"]','1155925540.59dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155925540.59dxschafe"]','1155941531.64dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155941531.64dxschafe"]','1155941550.51dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155941550.51dxschafe"]','1155941719.13dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155941719.13dxschafe"]','1155941890.86dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155941890.86dxschafe"]','1155941970.65dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155941970.65dxschafe"]','1155942005.18dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155942005.18dxschafe"]','1155942067.88dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155942067.88dxschafe"]','1155942102.09dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155942102.09dxschafe"]','1155942201.61dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155942201.61dxschafe"]','1155942312.25dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155942312.25dxschafe"]','1155942953.23dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155942953.23dxschafe"]','1155945066.71dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155945066.71dxschafe"]','1155945133.67dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155945133.67dxschafe"]','1155945173.1dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155945173.1dxschafe"]','1155945210.8dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155945210.8dxschafe"]','1155945354.74dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155945354.74dxschafe"]','1155945372.59dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155945372.59dxschafe"]','1155945461.27dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155945461.27dxschafe"]','1155945610.41dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155945610.41dxschafe"]','1155945662.52dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155945662.52dxschafe"]','1155945683.57dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155945683.57dxschafe"]','1155945692.64dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155945692.64dxschafe"]','1155945812.54dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155945812.54dxschafe"]','1155945885.17dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155945885.17dxschafe"]','1155945912.72dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155945912.72dxschafe"]','1155945937.65dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155945937.65dxschafe"]','1155946145.17dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155946145.17dxschafe"]','1155946192.71dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155946192.71dxschafe"]','1155946215.92dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155946215.92dxschafe"]','1155946281.86dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155946281.86dxschafe"]','1155946387.37dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155946387.37dxschafe"]','1155946460.27dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155946460.27dxschafe"]','1155946515.72dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155946515.72dxschafe"]','1155947101.13dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155947101.13dxschafe"]','1155947190.31dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155947190.31dxschafe"]','1155947249.51dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155947249.51dxschafe"]','1155947295.55dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155947295.55dxschafe"]','1155947583.34dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155947583.34dxschafe"]','1155947701.62dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155947701.62dxschafe"]','1155947801.43dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155947801.43dxschafe"]','1155947898.92dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155947898.92dxschafe"]','1155947955.98dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155947955.98dxschafe"]','1155948010.93dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948010.93dxschafe"]','1155948143.7dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948143.7dxschafe"]','1155948260.31dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948260.31dxschafe"]','1155948286.18dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948286.18dxschafe"]','1155948346.94dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948346.94dxschafe"]','1155948397.45dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948397.45dxschafe"]','1155948445.23dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948445.23dxschafe"]','1155948476.27dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948476.27dxschafe"]','1155948478.1dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948478.1dxschafe"]','1155948508.96dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948508.96dxschafe"]','1155948519.59dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948519.59dxschafe"]','1155948583.47dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948583.47dxschafe"]','1155948596.8dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948596.8dxschafe"]','1155948635.89dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948635.89dxschafe"]','1155948667.04dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948667.04dxschafe"]','1155948683.66dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948683.66dxschafe"]','1155948708.34dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948708.34dxschafe"]','1155948726.44dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948726.44dxschafe"]','1155948736.37dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948736.37dxschafe"]','1155948775.77dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948775.77dxschafe"]','1155948783.19dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948783.19dxschafe"]','1155948799.8dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948799.8dxschafe"]','1155948837.11dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948837.11dxschafe"]','1155948847.17dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948847.17dxschafe"]','1155948849.72dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948849.72dxschafe"]','1155948850.35dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948850.35dxschafe"]','1155948990.46dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948990.46dxschafe"]','1155948998.15dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155948998.15dxschafe"]','1155949073.86dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155949073.86dxschafe"]','1156182759.75dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156182759.75dxschafe"]','1156182904.01dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156182904.01dxschafe"]','1156182940.72dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156182940.72dxschafe"]','1156182985.26dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156182985.26dxschafe"]','1156183097.15dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156183097.15dxschafe"]','1156183290.24dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156183290.24dxschafe"]','1156183483.02dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1156183483.02dxschafe"]','1156183541.79dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1156183541.79dxschafe"]','1156183642.53dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156183642.53dxschafe"]','1156183661.28dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156183661.28dxschafe"]','1156183664.31dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156183664.31dxschafe"]','1156183674.35dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156183674.35dxschafe"]','1156183688.01dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156183688.01dxschafe"]','1156183696.74dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156183696.74dxschafe"]','1156183697.76dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156183697.76dxschafe"]','1156183705.04dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1156183705.04dxschafe"]','1156183706.59dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1156183706.59dxschafe"]','1156183756.57dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1156183756.57dxschafe"]','1156183850.87dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156183850.87dxschafe"]','1156183854.4dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156183854.4dxschafe"]','1156183864.46dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1156183864.46dxschafe"]','1156381848.24dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156381848.24dxschafe"]','1156382924.75dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156382924.75dxschafe"]','1156383048.91dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156383048.91dxschafe"]','1156383083.42dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777696.89dzlu"]["Objects"]["1156383083.42dxschafe"]','1156383144.19dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1156383144.19dxschafe"]','1157097728.52jasyeung': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157097728.52jasyeung"]','1157097924.52jasyeung': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157097924.52jasyeung"]','1157097962.5jasyeung': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157097962.5jasyeung"]','1157139270.98dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157139270.98dxschafe"]','1157144544.82dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144544.82dxschafe"]','1157144574.32dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144574.32dxschafe"]','1157145675.46dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145675.46dxschafe"]','1157145751.12dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145751.12dxschafe"]','1157145760.13dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145760.13dxschafe"]','1157145774.46dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145774.46dxschafe"]','1157145785.44dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145785.44dxschafe"]','1157145805.24dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145805.24dxschafe"]','1157145810.96dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145810.96dxschafe"]','1157145817.35dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145817.35dxschafe"]','1157145818.51dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145818.51dxschafe"]','1157145828.43dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145828.43dxschafe"]','1157145849.99dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145849.99dxschafe"]','1157145855.67dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145855.67dxschafe"]','1157145859.1dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145859.1dxschafe"]','1157145864.65dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145864.65dxschafe"]','1157145908.37dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145908.37dxschafe"]','1157145919.98dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145919.98dxschafe"]','1157145928.07dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145928.07dxschafe"]','1157145938.12dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145938.12dxschafe"]','1157145951.17dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145951.17dxschafe"]','1157145985.93dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145985.93dxschafe"]','1157145995.87dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157145995.87dxschafe"]','1157146026.73dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157146026.73dxschafe"]','1157146053.46dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157146053.46dxschafe"]','1157146159.7dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157146159.7dxschafe"]','1157146184.65dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157146184.65dxschafe"]','1157146478.64dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157146478.64dxschafe"]','1157146526.89dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157146526.89dxschafe"]','1157146558.16dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157146558.16dxschafe"]','1157146590.97dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157146590.97dxschafe"]','1157146605.59dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157146605.59dxschafe"]','1157146634.11dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157146634.11dxschafe"]','1157146659.53dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157146659.53dxschafe"]','1157146935.28dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157146935.28dxschafe"]','1157147129.36dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157147129.36dxschafe"]','1157147420.64dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157147420.64dxschafe"]','1157147497.41dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157147497.41dxschafe"]','1157147919.6dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157147919.6dxschafe"]','1157148044.76dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157148044.76dxschafe"]','1157148058.4dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157148058.4dxschafe"]','1157148068.83dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157148068.83dxschafe"]','1157148075.91dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157148075.91dxschafe"]','1157148087.6dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157148087.6dxschafe"]','1157148100.09dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157148100.09dxschafe"]','1157148182.43dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157148182.43dxschafe"]','1157148213.45dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157148213.45dxschafe"]','1157148512.79dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777676.87dzlu"]["Objects"]["1157148512.79dxschafe"]','1157148589.72dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157148589.72dxschafe"]','1157148620.8dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157148620.8dxschafe"]','1157148724.52dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157148724.52dxschafe"]','1157148817.48dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157148817.48dxschafe"]','1157148820.47dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157148820.47dxschafe"]','1157148825.13dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157148825.13dxschafe"]','1157148830.25dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778248.93dzlu"]["Objects"]["1157148830.25dxschafe"]','1157148899.28dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778337.46dzlu"]["Objects"]["1157148899.28dxschafe"]','1157148936.24dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157148936.24dxschafe"]','1157149057.61dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157149057.61dxschafe"]','1157149172.07dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157149172.07dxschafe"]','1157149352.85dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157139270.98dxschafe"]["Objects"]["1157149352.85dxschafe"]','1157149387.27dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157139270.98dxschafe"]["Objects"]["1157149387.27dxschafe"]','1157149393.54dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157149393.54dxschafe"]','1157149399.82dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157149399.82dxschafe"]','1157149400.65dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157149400.65dxschafe"]','1157149508.2dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157149508.2dxschafe"]','1157149511.76dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157149511.76dxschafe"]','1157149512.2dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157149512.2dxschafe"]','1157149512.71dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157149512.71dxschafe"]','1157149526.42dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157149526.42dxschafe"]','1157149738.37dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157139270.98dxschafe"]["Objects"]["1157149738.37dxschafe"]','1157149781.11dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157149781.11dxschafe"]','1157149801.34dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157149801.34dxschafe"]','1157151456.44dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157151456.44dxschafe"]','1157484771.28dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157484771.28dxschafe"]','1157484843.04dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157484843.04dxschafe"]','1157484938.58dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157484938.58dxschafe"]','1157484949.25dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157484949.25dxschafe"]','1157485013.63dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157485013.63dxschafe"]','1157485107.05dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157485107.05dxschafe"]','1157490715.58dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157490715.58dxschafe"]','1157490742.74dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157490742.74dxschafe"]','1157666874.71dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1157666874.71dxschafe"]','1157666893.76dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1157666893.76dxschafe"]','1157666896.48dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1157666896.48dxschafe"]','1157666905.9dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1157666905.9dxschafe"]','1157666910.71dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1157666910.71dxschafe"]','1157666917.42dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1157666917.42dxschafe"]','1157666947.56dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1157666947.56dxschafe"]','1157666986.59dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1157666986.59dxschafe"]','1157667037.12dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1157667037.12dxschafe"]','1157667055.05dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1157667055.05dxschafe"]','1157667065.86dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1157667065.86dxschafe"]','1157667107.11dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1157667107.11dxschafe"]','1157667403.19dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1157667403.19dxschafe"]','1157670645.75dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157670645.75dxschafe"]','1157671725.5dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157671725.5dxschafe"]','1158120438.44sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158120438.44sdnaik"]','1158120448.17sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158120448.17sdnaik"]','1158120851.02sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158120851.02sdnaik"]','1158120851.05sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158120851.02sdnaik"]["Objects"]["1158120851.05sdnaik"]','1158120851.09sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158120851.02sdnaik"]["Objects"]["1158120851.09sdnaik"]','1158121685.53sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158121685.53sdnaik"]','1158121685.56sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158121685.53sdnaik"]["Objects"]["1158121685.56sdnaik"]','1158121685.63sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158121685.53sdnaik"]["Objects"]["1158121685.63sdnaik"]','1158123603.92sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158123603.92sdnaik"]','1158123738.75sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158123738.75sdnaik"]','1158123738.78sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158123738.75sdnaik"]["Objects"]["1158123738.78sdnaik"]','1158123738.83sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158123738.75sdnaik"]["Objects"]["1158123738.83sdnaik"]','1158123997.77sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158123997.77sdnaik"]','1158123997.81sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158123997.77sdnaik"]["Objects"]["1158123997.81sdnaik"]','1158123997.89sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158123997.77sdnaik"]["Objects"]["1158123997.89sdnaik"]','1158214443.45sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158214443.45sdnaik"]','1158214452.48sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158214452.48sdnaik"]','1158214452.53sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158214452.53sdnaik"]','1158214452.56sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158214452.56sdnaik"]','1158285017.39sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158285017.39sdnaik"]','1158960478.48sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1158960478.48sdnaik"]','1162408579.95kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1162408579.95kmuller"]','1164929110.98sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1164929110.98sdnaik"]','1164929111.03sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1164929110.98sdnaik"]["Objects"]["1164929111.03sdnaik"]','1164929111.0sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1164929110.98sdnaik"]["Objects"]["1164929111.0sdnaik"]','1164929430.17sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1164929430.17sdnaik"]','1164929430.19sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1164929430.17sdnaik"]["Objects"]["1164929430.19sdnaik"]','1164929430.2sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1164929430.17sdnaik"]["Objects"]["1164929430.2sdnaik"]','1167857698.16sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1167857698.16sdnaik"]','1167857698.19sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1167857698.16sdnaik"]["Objects"]["1167857698.19sdnaik"]','1167857698.22sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1167857698.16sdnaik"]["Objects"]["1167857698.22sdnaik"]','1167862588.52sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1167862588.52sdnaik"]','1167862588.55sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1167862588.52sdnaik"]["Objects"]["1167862588.55sdnaik"]','1167862588.59sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1167862588.52sdnaik"]["Objects"]["1167862588.59sdnaik"]','1167879276.14sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1167862588.52sdnaik"]["Objects"]["1167879276.14sdnaik"]','1168057131.73sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1168057131.73sdnaik"]','1168057131.75sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1168057131.73sdnaik"]["Objects"]["1168057131.75sdnaik"]','1168057131.78sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1168057131.73sdnaik"]["Objects"]["1168057131.78sdnaik"]','1168057258.78sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1168057258.78sdnaik"]','1168057258.83sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1168057258.78sdnaik"]["Objects"]["1168057258.83sdnaik"]','1168057258.8sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1168057258.78sdnaik"]["Objects"]["1168057258.8sdnaik"]','1169515851.24fxlara': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1168057131.73sdnaik"]["Objects"]["1169515851.24fxlara"]','1169862272.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1169862272.0dxschafe"]','1169862400.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1169862400.0dxschafe"]','1170964352.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1170964352.0dxschafe0"]','1170964864.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1170964864.0dxschafe"]','1170964864.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1170964864.0dxschafe"]','1172265076.31kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1172265076.31kmuller"]','1172265254.22kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1172265254.22kmuller"]','1173205109.93kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1173205109.93kmuller"]','1173207434.85kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1173207434.85kmuller"]','1175275783.27kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175275783.27kmuller"]','1175276684.3kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175276684.3kmuller"]','1175276726.11kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175276726.11kmuller"]','1175276953.83kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175276953.83kmuller"]','1175277545.67kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175277545.67kmuller"]','1175277589.36kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175277589.36kmuller"]','1175277611.0kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175277611.0kmuller"]','1175277676.03kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175277676.03kmuller"]','1175277684.45kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175277684.45kmuller"]','1175277695.06kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175277695.06kmuller"]','1175277742.66kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175277742.66kmuller"]','1175277760.02kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175277760.02kmuller"]','1175277776.23kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175277776.23kmuller"]','1175278324.22kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175278324.22kmuller"]','1175278370.05kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175278370.05kmuller"]','1175622157.78sdnaik': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175622157.78sdnaik"]','1175721216.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144574.32dxschafe"]["Objects"]["1175721216.0dxschafe"]','1175729664.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175729664.0dxschafe"]','1175729664.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175729664.0dxschafe"]','1175822976.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175822976.0dxschafe"]','1175823104.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823104.0dxschafe"]','1175823104.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823104.0dxschafe0"]','1175823232.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823232.0dxschafe1"]','1175823232.0dxschafe3': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823232.0dxschafe3"]','1175823360.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823360.0dxschafe"]','1175823360.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823360.0dxschafe0"]','1175823488.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823488.0dxschafe"]','1175823488.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823488.0dxschafe0"]','1175823488.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823488.0dxschafe2"]','1175823488.0dxschafe3': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823488.0dxschafe3"]','1175823616.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823616.0dxschafe"]','1175823616.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823616.0dxschafe0"]','1175823616.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823616.0dxschafe1"]','1175823744.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823744.0dxschafe"]','1175823744.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823744.0dxschafe0"]','1175823744.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823744.0dxschafe1"]','1175823872.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175823872.0dxschafe"]','1175824000.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175824000.0dxschafe"]','1175824000.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175824000.0dxschafe0"]','1175824000.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175824000.0dxschafe1"]','1175824000.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175824000.0dxschafe2"]','1175824000.0dxschafe3': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175824000.0dxschafe3"]','1175824128.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175824128.0dxschafe"]','1175824128.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175824128.0dxschafe0"]','1175824256.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175824256.0dxschafe"]','1175824512.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175824512.0dxschafe"]','1175824512.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175824512.0dxschafe0"]','1175824512.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175824512.0dxschafe1"]','1175824512.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175824512.0dxschafe2"]','1175824768.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175824768.0dxschafe"]','1175824768.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175824768.0dxschafe0"]','1175824768.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175824768.0dxschafe1"]','1175824896.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175824896.0dxschafe"]','1175825280.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1175825280.0dxschafe"]','1176229120.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176229120.0dxschafe"]','1176229120.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176229120.0dxschafe0"]','1176229120.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176229120.0dxschafe1"]','1176229120.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176229120.0dxschafe2"]','1176229632.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176229632.0dxschafe"]','1176235904.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176235904.0dxschafe"]','1176235904.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176235904.0dxschafe0"]','1176235904.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176235904.0dxschafe1"]','1176235904.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176235904.0dxschafe2"]','1176235904.0dxschafe3': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176235904.0dxschafe3"]','1176235904.0dxschafe4': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176235904.0dxschafe4"]','1176235904.0dxschafe5': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176235904.0dxschafe5"]','1176235904.0dxschafe6': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176235904.0dxschafe6"]','1176236032.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176236032.0dxschafe"]','1176236032.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176236032.0dxschafe0"]','1176236032.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176236032.0dxschafe1"]','1176236032.0dxschafe10': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176236032.0dxschafe10"]','1176236032.0dxschafe11': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176236032.0dxschafe11"]','1176236032.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176236032.0dxschafe2"]','1176236032.0dxschafe3': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176236032.0dxschafe3"]','1176236032.0dxschafe4': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176236032.0dxschafe4"]','1176236032.0dxschafe5': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176236032.0dxschafe5"]','1176236032.0dxschafe6': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176236032.0dxschafe6"]','1176236032.0dxschafe7': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176236032.0dxschafe7"]','1176236032.0dxschafe8': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176236032.0dxschafe8"]','1176236032.0dxschafe9': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176236032.0dxschafe9"]','1176420352.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176420352.0dxschafe"]','1176420352.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176420352.0dxschafe0"]','1176420480.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176420480.0dxschafe"]','1176420480.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176420480.0dxschafe0"]','1176420480.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176420480.0dxschafe1"]','1176420608.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176420608.0dxschafe"]','1176420608.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176420608.0dxschafe0"]','1176420608.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176420608.0dxschafe1"]','1176420736.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176420736.0dxschafe0"]','1176420736.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176420736.0dxschafe1"]','1176420736.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176420736.0dxschafe2"]','1176420992.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176420992.0dxschafe"]','1176421120.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176421120.0dxschafe"]','1176421120.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176421120.0dxschafe1"]','1176421248.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176421248.0dxschafe"]','1176421248.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176421248.0dxschafe0"]','1176421504.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176421504.0dxschafe"]','1176421504.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176421504.0dxschafe0"]','1176421632.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176421632.0dxschafe"]','1176421632.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176421632.0dxschafe0"]','1176421760.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176421760.0dxschafe"]','1176421760.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176421760.0dxschafe0"]','1176421760.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176421760.0dxschafe1"]','1176421888.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176421888.0dxschafe"]','1176422016.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1176422016.0dxschafe"]','1176422016.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1170964352.0dxschafe0"]["Objects"]["1176422016.0dxschafe0"]','1176422016.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1176422016.0dxschafe1"]','1177374848.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177374848.0dxschafe"]','1177377280.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1177377280.0dxschafe"]','1177377280.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1177377280.0dxschafe0"]','1177377280.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1177377280.0dxschafe1"]','1177377408.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1177377408.0dxschafe0"]','1177539968.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177539968.0dxschafe"]','1177540096.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540096.0dxschafe"]','1177540096.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540096.0dxschafe0"]','1177540224.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540224.0dxschafe"]','1177540224.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540224.0dxschafe0"]','1177540224.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540224.0dxschafe1"]','1177540224.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540224.0dxschafe2"]','1177540224.0dxschafe3': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540224.0dxschafe3"]','1177540224.0dxschafe4': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540224.0dxschafe4"]','1177540224.0dxschafe7': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540224.0dxschafe7"]','1177540352.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540352.0dxschafe0"]','1177540352.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540352.0dxschafe1"]','1177540480.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540480.0dxschafe"]','1177540480.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540480.0dxschafe1"]','1177540480.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540480.0dxschafe2"]','1177540608.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540608.0dxschafe"]','1177540608.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540608.0dxschafe0"]','1177540608.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540608.0dxschafe1"]','1177540736.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540736.0dxschafe"]','1177540736.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540736.0dxschafe0"]','1177540736.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540736.0dxschafe1"]','1177540864.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540864.0dxschafe"]','1177540864.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540864.0dxschafe0"]','1177540864.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540864.0dxschafe1"]','1177540992.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540992.0dxschafe"]','1177540992.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177540992.0dxschafe0"]','1177541120.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541120.0dxschafe"]','1177541120.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541120.0dxschafe0"]','1177541248.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541248.0dxschafe"]','1177541248.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541248.0dxschafe0"]','1177541248.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541248.0dxschafe1"]','1177541248.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541248.0dxschafe2"]','1177541376.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541376.0dxschafe"]','1177541376.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541376.0dxschafe0"]','1177541376.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541376.0dxschafe2"]','1177541376.0dxschafe3': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541376.0dxschafe3"]','1177541376.0dxschafe4': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541376.0dxschafe4"]','1177541504.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541504.0dxschafe"]','1177541504.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541504.0dxschafe0"]','1177541504.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541504.0dxschafe1"]','1177541504.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541504.0dxschafe2"]','1177541504.0dxschafe3': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541504.0dxschafe3"]','1177541504.0dxschafe4': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541504.0dxschafe4"]','1177541504.0dxschafe5': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541504.0dxschafe5"]','1177541632.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541632.0dxschafe"]','1177541632.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541632.0dxschafe0"]','1177541760.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541760.0dxschafe"]','1177541888.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177541888.0dxschafe"]','1177542144.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177542144.0dxschafe"]','1177542144.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177542144.0dxschafe0"]','1177542144.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177542144.0dxschafe1"]','1177542144.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1177542144.0dxschafe2"]','1177714944.0mike': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1177714944.0mike"]','1178924204.55kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178924204.55kmuller"]','1178924866.44kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178924866.44kmuller"]','1178925118.73kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178925118.73kmuller"]','1178925144.44kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178925144.44kmuller"]','1178926672.39kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178926672.39kmuller"]','1178927090.41kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178927090.41kmuller"]','1178927140.17kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178927140.17kmuller"]','1178927192.59kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178927192.59kmuller"]','1178927329.86kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178927329.86kmuller"]','1178927379.84kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178927379.84kmuller"]','1178927452.7kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178927452.7kmuller"]','1178927571.76kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178927571.76kmuller"]','1178927587.14kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178927587.14kmuller"]','1178927659.05kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178927659.05kmuller"]','1178927732.2kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178927732.2kmuller"]','1178927758.11kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178927758.11kmuller"]','1178927808.08kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178927808.08kmuller"]','1178927920.67kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178927920.67kmuller"]','1178927971.62kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178927971.62kmuller"]','1178928013.81kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178928013.81kmuller"]','1178928286.8kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178928286.8kmuller"]','1178928325.97kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178928325.97kmuller"]','1178928520.11kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178928520.11kmuller"]','1178928553.41kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178928553.41kmuller"]','1178928809.22kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178928809.22kmuller"]','1178928834.56kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178928834.56kmuller"]','1178928881.36kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178928881.36kmuller"]','1178928955.59kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178928955.59kmuller"]','1178929080.8kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178929080.8kmuller"]','1178929170.19kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178929170.19kmuller"]','1178929373.34kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1178929373.34kmuller"]','1179781037.0kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1179781037.0kmuller"]','1179781062.09kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1179781062.09kmuller"]','1179781095.34kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1179781095.34kmuller"]','1179781207.28kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1179781207.28kmuller"]','1184022449.09kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184022449.09kmuller"]','1184022575.31kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184022575.31kmuller"]','1184022677.43kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184022677.43kmuller"]','1184022894.76kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184022894.76kmuller"]','1184022987.87kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184022987.87kmuller"]','1184023106.66kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184023106.66kmuller"]','1184023288.73kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184023288.73kmuller"]','1184023340.98kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184023340.98kmuller"]','1184023695.48kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184023695.48kmuller"]','1184024094.82kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184024094.82kmuller"]','1184024126.48kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184024126.48kmuller"]','1184024187.46kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184024187.46kmuller"]','1184024898.73kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184024898.73kmuller"]','1184025002.57kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184025002.57kmuller"]','1184025055.27kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184025055.27kmuller"]','1184025216.46kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184025216.46kmuller"]','1184025311.44kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184025311.44kmuller"]','1184025511.59kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184025511.59kmuller"]','1184025688.1kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184025688.1kmuller"]','1184025715.73kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184025715.73kmuller"]','1184025832.68kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184025832.68kmuller"]','1184025992.1kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184025992.1kmuller"]','1184026113.29kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184026113.29kmuller"]','1184026151.32kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184026151.32kmuller"]','1184026211.99kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184026211.99kmuller"]','1184026328.88kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184026328.88kmuller"]','1184026367.35kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184026367.35kmuller"]','1184026655.52kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184026655.52kmuller"]','1184026771.9kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184026771.9kmuller"]','1184026863.37kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184026863.37kmuller"]','1184026917.71kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184026917.71kmuller"]','1184027087.51kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184027087.51kmuller"]','1184027124.76kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184027124.76kmuller"]','1184027277.77kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184027277.77kmuller"]','1184027370.13kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184027370.13kmuller"]','1184027432.65kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184027432.65kmuller"]','1184028369.52kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144574.32dxschafe"]["Objects"]["1184028369.52kmuller"]','1184086690.55kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184086690.55kmuller"]','1184087018.59kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184087018.59kmuller"]','1184087119.18kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184087119.18kmuller"]','1184087184.52kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184087184.52kmuller"]','1184087225.63kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184087225.63kmuller"]','1184087268.51kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184087268.51kmuller"]','1184088724.93kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184088724.93kmuller"]','1184088804.73kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778017.46dzlu"]["Objects"]["1184088804.73kmuller"]','1184088842.66kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778017.46dzlu"]["Objects"]["1184088842.66kmuller"]','1184088940.21kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778017.46dzlu"]["Objects"]["1184088940.21kmuller"]','1184089135.23kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184089135.23kmuller"]','1184089160.09kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184089160.09kmuller"]','1184089179.18kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184089179.18kmuller"]','1184089205.46kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184089205.46kmuller"]','1184089231.3kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184089231.3kmuller"]','1184089296.07kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184089296.07kmuller"]','1184089318.93kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184089318.93kmuller"]','1184089379.09kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184089379.09kmuller"]','1184089427.66kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184089427.66kmuller"]','1184090819.57kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184090819.57kmuller"]','1184090878.63kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184090878.63kmuller"]','1184090911.01kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184090911.01kmuller"]','1184090967.99kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184090967.99kmuller"]','1184091101.43kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184091101.43kmuller"]','1184631580.1joswilso': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184631580.1joswilso"]','1184631683.63joswilso': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1184631683.63joswilso"]','1186087168.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1186087168.0dxschafe"]','1186087296.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1186087296.0dxschafe"]','1186087552.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1186087552.0dxschafe"]','1186087552.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1186087552.0dxschafe0"]','1186087680.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144574.32dxschafe"]["Objects"]["1186087680.0dxschafe"]','1186087680.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1186087680.0dxschafe0"]','1186087680.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1186087680.0dxschafe1"]','1186087680.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1186087680.0dxschafe2"]','1186087680.0dxschafe3': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1186087680.0dxschafe3"]','1186087680.0dxschafe4': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1186087680.0dxschafe4"]','1186087680.0dxschafe5': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1186087680.0dxschafe5"]','1188320582.09akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188320582.09akelts"]','1188320614.28akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188320614.28akelts"]','1188324692.53akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188324692.53akelts"]','1188334011.89akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188334011.89akelts"]','1188334102.31akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188334102.31akelts"]','1188334483.89akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188334483.89akelts"]','1188334836.97akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188334836.97akelts"]','1188335045.33akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188335045.33akelts"]','1188335129.05akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188335129.05akelts"]','1188335193.84akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188335193.84akelts"]','1188583287.37kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188583287.37kmuller"]','1188583309.23kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188583309.23kmuller"]','1188583789.34kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188583789.34kmuller"]','1188584057.33kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188584057.33kmuller"]','1188584117.41kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188584117.41kmuller"]','1188584164.94kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188584164.94kmuller"]','1188584876.69kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1188584876.69kmuller"]','1189106461.23kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189106461.23kmuller"]','1189106660.31kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189106660.31kmuller"]','1189106824.26kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189106824.26kmuller"]','1189106846.25kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189106846.25kmuller"]','1189106972.64kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189106972.64kmuller"]','1189107199.53kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189107199.53kmuller"]','1189107229.0kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189107229.0kmuller"]','1189111036.84kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189111036.84kmuller"]','1189111340.15kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189111340.15kmuller"]','1189111365.98kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189111365.98kmuller"]','1189111437.9kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189111437.9kmuller"]','1189111495.71kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189111495.71kmuller"]','1189111511.64kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189111511.64kmuller"]','1189113274.95kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1189113274.95kmuller"]','1189113339.42kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1189113339.42kmuller"]','1189470592.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189470592.0dxschafe"]','1189470592.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189470592.0dxschafe0"]','1189470592.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189470592.0dxschafe1"]','1189470592.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189470592.0dxschafe2"]','1189470592.0dxschafe3': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189470592.0dxschafe3"]','1189470592.0dxschafe4': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189470592.0dxschafe4"]','1189470592.0dxschafe5': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189470592.0dxschafe5"]','1189470848.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189470848.0dxschafe"]','1189470976.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189470976.0dxschafe"]','1189470976.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189470976.0dxschafe0"]','1189471104.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189471104.0dxschafe"]','1189471232.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189471232.0dxschafe"]','1189471232.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189471232.0dxschafe0"]','1189471232.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189471232.0dxschafe1"]','1189471232.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1189471232.0dxschafe2"]','1189619968.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1189619968.0dxschafe"]','1189624960.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1189624960.0dxschafe"]','1189629568.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1189629568.0dxschafe"]','1189629824.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1189629824.0dxschafe"]','1190411258.51kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1190411258.51kmuller"]','1190411317.9kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1190411317.9kmuller"]','1190411389.18kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1190411389.18kmuller"]','1190672768.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1190672768.0dxschafe"]','1190672768.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1190672768.0dxschafe0"]','1190672768.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1190672768.0dxschafe0"]','1190672768.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1190672768.0dxschafe2"]','1190672896.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1190672896.0dxschafe"]','1190672896.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1190672896.0dxschafe0"]','1190672896.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1190672896.0dxschafe1"]','1190672896.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1190672896.0dxschafe2"]','1190928751.4kmuller': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1190928751.4kmuller"]','1192672000.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672000.0dxschafe"]','1192672000.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672000.0dxschafe0"]','1192672000.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672000.0dxschafe1"]','1192672000.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672000.0dxschafe2"]','1192672128.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672128.0dxschafe"]','1192672128.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672128.0dxschafe0"]','1192672128.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672128.0dxschafe1"]','1192672128.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672128.0dxschafe2"]','1192672128.0dxschafe3': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672128.0dxschafe3"]','1192672128.0dxschafe4': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672128.0dxschafe4"]','1192672128.0dxschafe5': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672128.0dxschafe5"]','1192672128.0dxschafe6': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672128.0dxschafe6"]','1192672256.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672256.0dxschafe"]','1192672256.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672256.0dxschafe0"]','1192672256.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672256.0dxschafe1"]','1192672256.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672256.0dxschafe2"]','1192672256.0dxschafe3': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672256.0dxschafe3"]','1192672384.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672384.0dxschafe"]','1192672384.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672384.0dxschafe0"]','1192672512.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672512.0dxschafe"]','1192672512.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672512.0dxschafe0"]','1192672512.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1192672512.0dxschafe1"]','1192672768.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1192672768.0dxschafe"]','1192672768.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1192672768.0dxschafe0"]','1192672896.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1192672896.0dxschafe"]','1192672896.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1192672896.0dxschafe0"]','1192673024.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1192673024.0dxschafe"]','1192673024.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1192673024.0dxschafe0"]','1192673152.0dxschafe': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1192673152.0dxschafe"]','1192673152.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1192673152.0dxschafe0"]','1192673152.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1192673152.0dxschafe1"]','1192673152.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1192673152.0dxschafe2"]','1192733659.33akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144544.82dxschafe"]["Objects"]["1192733659.33akelts"]','1192733746.33akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1157144544.82dxschafe"]["Objects"]["1192733746.33akelts"]','1194569540.75akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1194569540.75akelts"]','1194569560.91akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1194569560.91akelts"]','1195173306.84akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1195173306.84akelts"]','1195173411.14akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1195173411.14akelts"]','1196811067.33akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1196811067.33akelts"]','1200005812.86akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1200005812.86akelts"]','1200005822.8akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1200005822.8akelts"]','1200005840.83akelts': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1200005840.83akelts"]','1200533376.0dxschafe0': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153507305.2dzlu"]["Objects"]["1200533376.0dxschafe0"]','1200533376.0dxschafe1': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153507305.2dzlu"]["Objects"]["1200533376.0dxschafe1"]','1200533376.0dxschafe10': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436556.14dzlu"]["Objects"]["1200533376.0dxschafe10"]','1200533376.0dxschafe11': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435760.44dzlu"]["Objects"]["1200533376.0dxschafe11"]','1200533376.0dxschafe12': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153427017.86dzlu"]["Objects"]["1200533376.0dxschafe12"]','1200533376.0dxschafe13': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153427017.86dzlu"]["Objects"]["1200533376.0dxschafe13"]','1200533376.0dxschafe14': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153443938.06dzlu"]["Objects"]["1200533376.0dxschafe14"]','1200533376.0dxschafe15': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153443938.06dzlu"]["Objects"]["1200533376.0dxschafe15"]','1200533376.0dxschafe16': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434980.85dzlu"]["Objects"]["1200533376.0dxschafe16"]','1200533376.0dxschafe17': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153441219.3dzlu"]["Objects"]["1200533376.0dxschafe17"]','1200533376.0dxschafe18': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436052.28dzlu"]["Objects"]["1200533376.0dxschafe18"]','1200533376.0dxschafe19': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777945.95dzlu"]["Objects"]["1200533376.0dxschafe19"]','1200533376.0dxschafe2': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153430674.19dzlu"]["Objects"]["1200533376.0dxschafe2"]','1200533376.0dxschafe20': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436162.31dzlu"]["Objects"]["1200533376.0dxschafe20"]','1200533376.0dxschafe21': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436162.31dzlu"]["Objects"]["1200533376.0dxschafe21"]','1200533376.0dxschafe22': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777833.68dzlu"]["Objects"]["1200533376.0dxschafe22"]','1200533376.0dxschafe23': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777833.68dzlu"]["Objects"]["1200533376.0dxschafe23"]','1200533376.0dxschafe24': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434903.61dzlu"]["Objects"]["1200533376.0dxschafe24"]','1200533376.0dxschafe25': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153437585.28dzlu"]["Objects"]["1200533376.0dxschafe25"]','1200533376.0dxschafe26': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778017.46dzlu"]["Objects"]["1200533376.0dxschafe26"]','1200533376.0dxschafe27': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434880.63dzlu"]["Objects"]["1200533376.0dxschafe27"]','1200533376.0dxschafe28': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153430887.13dzlu"]["Objects"]["1200533376.0dxschafe28"]','1200533376.0dxschafe29': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777696.89dzlu"]["Objects"]["1200533376.0dxschafe29"]','1200533376.0dxschafe3': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153430674.19dzlu"]["Objects"]["1200533376.0dxschafe3"]','1200533376.0dxschafe30': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434600.3dzlu"]["Objects"]["1200533376.0dxschafe30"]','1200533376.0dxschafe31': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1155770041.03dxschafe"]["Objects"]["1200533376.0dxschafe31"]','1200533376.0dxschafe32': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435251.58dzlu"]["Objects"]["1200533376.0dxschafe32"]','1200533376.0dxschafe33': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778153.99dzlu"]["Objects"]["1200533376.0dxschafe33"]','1200533376.0dxschafe34': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435428.14dzlu"]["Objects"]["1200533376.0dxschafe34"]','1200533376.0dxschafe35': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434458.97dzlu"]["Objects"]["1200533376.0dxschafe35"]','1200533376.0dxschafe36': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436381.55dzlu"]["Objects"]["1200533376.0dxschafe36"]','1200533376.0dxschafe37': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435103.16dzlu"]["Objects"]["1200533376.0dxschafe37"]','1200533376.0dxschafe38': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435388.6dzlu"]["Objects"]["1200533376.0dxschafe38"]','1200533376.0dxschafe39': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436426.8dzlu"]["Objects"]["1200533376.0dxschafe39"]','1200533376.0dxschafe4': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153439434.77dzlu"]["Objects"]["1200533376.0dxschafe4"]','1200533376.0dxschafe40': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434928.03dzlu"]["Objects"]["1200533376.0dxschafe40"]','1200533376.0dxschafe41': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436923.03dzlu"]["Objects"]["1200533376.0dxschafe41"]','1200533376.0dxschafe42': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153508552.43dzlu"]["Objects"]["1200533376.0dxschafe42"]','1200533376.0dxschafe43': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153430563.72dzlu"]["Objects"]["1200533376.0dxschafe43"]','1200533376.0dxschafe44': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777676.87dzlu"]["Objects"]["1200533376.0dxschafe44"]','1200533376.0dxschafe45': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435636.19dzlu"]["Objects"]["1200533376.0dxschafe45"]','1200533376.0dxschafe46': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435636.19dzlu"]["Objects"]["1200533376.0dxschafe46"]','1200533376.0dxschafe47': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435636.19dzlu"]["Objects"]["1200533376.0dxschafe47"]','1200533376.0dxschafe48': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1154564157.01dxschafe"]["Objects"]["1170964864.0dxschafe"]["Objects"]["1200533376.0dxschafe48"]','1200533376.0dxschafe49': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435903.89dzlu"]["Objects"]["1200533376.0dxschafe49"]','1200533376.0dxschafe5': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778118.18dzlu"]["Objects"]["1200533376.0dxschafe5"]','1200533376.0dxschafe50': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778337.46dzlu"]["Objects"]["1200533376.0dxschafe50"]','1200533376.0dxschafe51': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436123.61dzlu"]["Objects"]["1200533376.0dxschafe51"]','1200533376.0dxschafe52': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153435842.17dzlu"]["Objects"]["1200533376.0dxschafe52"]','1200533376.0dxschafe53': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153431227.81dzlu"]["Objects"]["1200533376.0dxschafe53"]','1200533376.0dxschafe54': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436006.19dzlu"]["Objects"]["1200533376.0dxschafe54"]','1200533376.0dxschafe55': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153437552.45dzlu"]["Objects"]["1200533376.0dxschafe55"]','1200533376.0dxschafe56': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1190672768.0dxschafe0"]["Objects"]["1200533376.0dxschafe56"]','1200533376.0dxschafe57': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1190672768.0dxschafe0"]["Objects"]["1200533376.0dxschafe57"]','1200533376.0dxschafe58': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436023.94dzlu"]["Objects"]["1200533376.0dxschafe58"]','1200533376.0dxschafe59': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436035.52dzlu"]["Objects"]["1200533376.0dxschafe59"]','1200533376.0dxschafe6': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778118.18dzlu"]["Objects"]["1200533376.0dxschafe6"]','1200533376.0dxschafe60': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436073.35dzlu"]["Objects"]["1200533376.0dxschafe60"]','1200533376.0dxschafe61': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153430734.73dzlu"]["Objects"]["1200533376.0dxschafe61"]','1200533376.0dxschafe62': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153434762.53dzlu"]["Objects"]["1200533376.0dxschafe62"]','1200533376.0dxschafe63': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436398.13dzlu"]["Objects"]["1200533376.0dxschafe63"]','1200533376.0dxschafe64': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153436182.45dzlu"]["Objects"]["1200533376.0dxschafe64"]','1200533376.0dxschafe65': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1175729664.0dxschafe"]["Objects"]["1200533376.0dxschafe65"]','1200533376.0dxschafe66': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153508657.78dzlu"]["Objects"]["1200533376.0dxschafe66"]','1200533376.0dxschafe67': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153778094.12dzlu"]["Objects"]["1200533376.0dxschafe67"]','1200533376.0dxschafe68': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1200533376.0dxschafe68"]','1200533376.0dxschafe69': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1200533376.0dxschafe69"]','1200533376.0dxschafe7': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153427043.1dzlu"]["Objects"]["1200533376.0dxschafe7"]','1200533376.0dxschafe70': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1200533376.0dxschafe70"]','1200533376.0dxschafe8': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153427043.1dzlu"]["Objects"]["1200533376.0dxschafe8"]','1200533376.0dxschafe9': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1153777653.46dzlu"]["Objects"]["1200533376.0dxschafe9"]','1207073489.41mtucker': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1207073489.41mtucker"]','1219424341.05mtucker': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1219424341.05mtucker"]','1219425030.24mtucker': '["Objects"]["1142018473.22dxschafe"]["Objects"]["1219425030.24mtucker"]'}}
extraInfo = {'camPos': Point3(700.471, -1334.25, 66.8916),'camHpr': VBase3(-83.6983, -31.7236, 0),'focalLength': 0.90600001812,'skyState': 2,'fog': 0}
| 103,604.25
| 414,146
| 0.68162
| 56,655
| 414,417
| 4.945848
| 0.057241
| 0.022583
| 0.022109
| 0.020642
| 0.695618
| 0.57439
| 0.492411
| 0.422827
| 0.338853
| 0.320013
| 0
| 0.280848
| 0.048364
| 414,417
| 4
| 414,147
| 103,604.25
| 0.429663
| 0.000154
| 0
| 0
| 0
| 0.666667
| 0.58242
| 0.356101
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.333333
| 0
| 0.333333
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
|
0
| 7
|
0cfa694d21a6dffc1f181c7b389536b261b9c7d4
| 9,393
|
py
|
Python
|
condlib.py
|
jzmnd/RRAM_network_analysis_model
|
f05a62cca2e5c46a348b7dd45a6afd000a60ee6c
|
[
"MIT"
] | 1
|
2017-12-19T14:52:24.000Z
|
2017-12-19T14:52:24.000Z
|
condlib.py
|
jzmnd/RRAM_network_analysis_model
|
f05a62cca2e5c46a348b7dd45a6afd000a60ee6c
|
[
"MIT"
] | null | null | null |
condlib.py
|
jzmnd/RRAM_network_analysis_model
|
f05a62cca2e5c46a348b7dd45a6afd000a60ee6c
|
[
"MIT"
] | 1
|
2019-09-10T13:54:30.000Z
|
2019-09-10T13:54:30.000Z
|
#! /usr/bin/env python
"""
condlib.py
Functions for generating conductance matrices for crossbar memory arrays
Created by Jeremy Smith on 2017-07-06
University of California, Berkeley
All vectors are stored as [WL 0 0, WL 0 1 ... WL 0 n-1, WL 1 0 ... WL n-1 n-1,
BL 0 0, BL 0 1 ... BL 0 n-1, BL 1 0 ... BL n-1 n-1]
Indices are for ith WL and jth BL
Functions:
conductance_matrix_WRITE
conductance_matrix_READ
conductance_matrix_CAMREAD
"""
import numpy as np
__author__ = "Jeremy Smith"
__version__ = "1.0"
def conductance_matrix_WRITE(n, rline, rcell, vWLsel, vWLnsel, vBLsel, vBLnsel,
isel=0, jsel=0, verbose=True):
"""
Calculates the conductance matrix and the vector of supply currents for a
WRITE event i.e. all word and bit lines have an applied voltage
n x n matrix
power supplied on 0-index side of array (single side supply)
no pull up resistor (equal to line resistance on power line side)
"""
# Conductance coefficients
a2 = 1.0 / rcell + 2.0 / rline
a1 = 1.0 / rcell + 1.0 / rline
b = -1.0 / rline
c = -1.0 / rcell
dWLsel = vWLsel / rline
dWLnsel = vWLnsel / rline
dBLsel = vBLsel / rline
dBLnsel = vBLnsel / rline
# Setup empty conductance matrix and current vector
nsq = n * n
mat = np.zeros((2 * nsq, 2 * nsq))
iin = np.zeros(2 * nsq)
# Loop for word line nodes (W) and bit line nodes (B)
for l in ['W', 'B']:
# Loop for all word lines (i)
for i in xrange(n):
# Loop for all bit lines (j)
for j in xrange(n):
if l is 'W':
p = n*i + j
if verbose:
print l, i, j, p
if j == 0: # i.e. power line side (WL)
mat[p][p] = a2
mat[p][p + 1] = b
mat[p][p + nsq] = c
iin[p] = dWLsel if i is isel else dWLnsel
elif j == (n - 1): # i.e. floating side
mat[p][p] = a1
mat[p][p - 1] = b
mat[p][p + nsq] = c
else: # i.e. middle of array
mat[p][p] = a2
mat[p][p - 1] = b
mat[p][p + 1] = b
mat[p][p + nsq] = c
else:
p = n*i + j + nsq
if verbose:
print l, i, j, p
if i == 0: # i.e. power line side (BL)
mat[p][p] = a2
mat[p][p + n] = b
mat[p][p - nsq] = c
iin[p] = dBLsel if j is jsel else dBLnsel
elif i == (n - 1): # i.e. floating side
mat[p][p] = a1
mat[p][p - n] = b
mat[p][p - nsq] = c
else: # i.e. middle of array
mat[p][p] = a2
mat[p][p - n] = b
mat[p][p + n] = b
mat[p][p - nsq] = c
return mat, iin
def conductance_matrix_READ(n, rline, rcell, rpu, vWLsel, vBLsel,
isel=0, jsel=0, verbose=True):
"""
Calculates the conductance matrix and the vector of supply currents for a
standard READ event i.e. selected word and bit lines have an applied
voltage and others are floating
n x n matrix
power supplied on 0-index side of array (single side supply)
pull up resistor (rpu) can be set for selected line
"""
# Conductance coefficients
a2 = 1.0 / rcell + 2.0 / rline
a1 = 1.0 / rcell + 1.0 / rline
a3 = 1.0 / rcell + 1.0 / rline + 1.0 / rpu
b = -1.0 / rline
c = -1.0 / rcell
dWLsel = vWLsel / rpu
dBLsel = vBLsel / rpu
# Setup empty conductance matrix and current vector
nsq = n * n
mat = np.zeros((2 * nsq, 2 * nsq))
iin = np.zeros(2 * nsq)
# Loop for word line nodes (W) and bit line nodes (B)
for l in ['W', 'B']:
# Loop for all word lines (i)
for i in xrange(n):
# Loop for all bit lines (j)
for j in xrange(n):
if l is 'W':
p = n*i + j
if verbose:
print l, i, j, p
if j == 0: # i.e. power line side (WL)
if i is isel:
mat[p][p] = a3
mat[p][p + 1] = b
mat[p][p + nsq] = c
iin[p] = dWLsel
else:
mat[p][p] = a1
mat[p][p + 1] = b
mat[p][p + nsq] = c
elif j == (n - 1): # i.e. floating side
mat[p][p] = a1
mat[p][p - 1] = b
mat[p][p + nsq] = c
else: # i.e. middle of array
mat[p][p] = a2
mat[p][p - 1] = b
mat[p][p + 1] = b
mat[p][p + nsq] = c
else:
p = n*i + j + nsq
if verbose:
print l, i, j, p
if i == 0: # i.e. power line side (BL)
if j is jsel:
mat[p][p] = a3
mat[p][p + n] = b
mat[p][p - nsq] = c
iin[p] = dBLsel
else:
mat[p][p] = a1
mat[p][p + n] = b
mat[p][p - nsq] = c
elif i == (n - 1): # i.e. floating side
mat[p][p] = a1
mat[p][p - n] = b
mat[p][p - nsq] = c
else: # i.e. middle of array
mat[p][p] = a2
mat[p][p - n] = b
mat[p][p + n] = b
mat[p][p - nsq] = c
return mat, iin
def conductance_matrix_CAMREAD(n, rline, rcell, vWLsel, vWLnsel, vBL0, vBL1,
isel=0, jpattern=None, verbose=True):
"""
Calculates the conductance matrix and the vector of supply currents for a
CAM READ event i.e. all word (match) lines have an applied voltage and all
bit lines have an applied pattern of voltages
n x n matrix
power supplied on 0-index side of array (single side supply)
no pull up resistor (equal to line resistance on power line side)
can apply any pattern to bit lines (bool array of length n)
"""
# Set bit line pattern to all zeros if not specified
if jpattern is None:
jpattern = np.zeros(n, dtype=bool)
# Conductance coefficients
a2 = 1.0 / rcell + 2.0 / rline
a1 = 1.0 / rcell + 1.0 / rline
b = -1.0 / rline
c = -1.0 / rcell
dWLsel = vWLsel / rline
dWLnsel = vWLnsel / rline
dBL0 = vBL0 / rline
dBL1 = vBL1 / rline
# Setup empty conductance matrix and current vector
nsq = n * n
mat = np.zeros((2 * nsq, 2 * nsq))
iin = np.zeros(2 * nsq)
# Loop for word line nodes (W) and bit line nodes (B)
for l in ['W', 'B']:
# Loop for all word lines (i)
for i in xrange(n):
# Loop for all bit lines (j)
for j in xrange(n):
if l is 'W':
p = n*i + j
if verbose:
print l, i, j, p
if j == 0: # i.e. power line side (WL)
mat[p][p] = a2
mat[p][p + 1] = b
mat[p][p + nsq] = c
iin[p] = dWLsel if i is isel else dWLnsel
elif j == (n - 1): # i.e. floating side
mat[p][p] = a1
mat[p][p - 1] = b
mat[p][p + nsq] = c
else: # i.e. middle of array
mat[p][p] = a2
mat[p][p - 1] = b
mat[p][p + 1] = b
mat[p][p + nsq] = c
else:
p = n*i + j + nsq
if verbose:
print l, i, j, p
if i == 0: # i.e. power line side (BL)
mat[p][p] = a2
mat[p][p + n] = b
mat[p][p - nsq] = c
iin[p] = dBL1 if jpattern[j] else dBL0
elif i == (n - 1): # i.e. floating side
mat[p][p] = a1
mat[p][p - n] = b
mat[p][p - nsq] = c
else: # i.e. middle of array
mat[p][p] = a2
mat[p][p - n] = b
mat[p][p + n] = b
mat[p][p - nsq] = c
return mat, iin
| 35.048507
| 79
| 0.391888
| 1,231
| 9,393
| 2.974005
| 0.12104
| 0.072111
| 0.090139
| 0.042611
| 0.769189
| 0.743786
| 0.731494
| 0.72767
| 0.706364
| 0.706364
| 0
| 0.032195
| 0.507293
| 9,393
| 267
| 80
| 35.179775
| 0.758859
| 0.107953
| 0
| 0.872832
| 0
| 0
| 0.003541
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | null | 0
| 0.00578
| null | null | 0.034682
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
0b34b47ac2d0c35ebbc7e5d55e3634721bce2608
| 99
|
py
|
Python
|
kaldi/fstext/_lat_ops.py
|
mxmpl/pykaldi
|
0570307138c5391cc47b019450d08bcb9686dd98
|
[
"Apache-2.0"
] | 916
|
2017-11-22T19:33:36.000Z
|
2022-03-31T11:51:58.000Z
|
kaldi/fstext/_lat_ops.py
|
mxmpl/pykaldi
|
0570307138c5391cc47b019450d08bcb9686dd98
|
[
"Apache-2.0"
] | 268
|
2018-01-16T22:06:45.000Z
|
2022-03-29T03:24:41.000Z
|
kaldi/fstext/_lat_ops.py
|
mxmpl/pykaldi
|
0570307138c5391cc47b019450d08bcb9686dd98
|
[
"Apache-2.0"
] | 260
|
2018-01-23T18:39:40.000Z
|
2022-03-24T08:17:39.000Z
|
from _lat_inplace_ops import *
from _lat_construct1_ops import *
from _lat_construct2_ops import *
| 24.75
| 33
| 0.848485
| 15
| 99
| 5
| 0.466667
| 0.28
| 0.346667
| 0.426667
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.022989
| 0.121212
| 99
| 3
| 34
| 33
| 0.83908
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 8
|
0b38e065847f1ea269376bf6485e3e2058fd3228
| 13,123
|
py
|
Python
|
omega_miya/plugins/members_skill/__init__.py
|
Ailitonia/nonebot_miya
|
71d8cf3e91bbb0dd63cbee85fd757c738b99f10c
|
[
"MIT"
] | 5
|
2020-10-03T14:24:41.000Z
|
2021-03-05T12:36:44.000Z
|
omega_miya/plugins/members_skill/__init__.py
|
Ailitonia/nonebot_miya
|
71d8cf3e91bbb0dd63cbee85fd757c738b99f10c
|
[
"MIT"
] | null | null | null |
omega_miya/plugins/members_skill/__init__.py
|
Ailitonia/nonebot_miya
|
71d8cf3e91bbb0dd63cbee85fd757c738b99f10c
|
[
"MIT"
] | null | null | null |
from nonebot import permission, CommandSession, CommandGroup, log
from nonebot.command.argfilter import validators, controllers
from omega_miya.plugins.Group_manage.group_permissions import *
from omega_miya.plugins.members_skill.skill_manage import add_skill_to_db, clean_user_skill_in_db, add_user_skill_in_db
from omega_miya.plugins.members_skill.skil_query import query_skill_list, query_my_skill_list
__plugin_name__ = '技能'
__plugin_usage__ = r'''【技能】
使用这个命令可以设置/查询自己的技能
用法:
【不输入参数可进入向导模式】
/添加技能 [技能名称] [技能描述] *只有超管能使用
/查询技能 或 /技能列表
/我的技能
/设置技能 [技能名称] [技能等级] *(会重置已有技能)
/新增技能 [技能名称] [技能等级]
'''
skill = CommandGroup('Skill')
@skill.command('add_skill', aliases='添加技能', only_to_me=False, permission=permission.SUPERUSER)
async def add_skill(session: CommandSession):
group_id = session.event.group_id
session_type = session.event.detail_type
if session_type == 'group':
if not has_command_permissions(group_id):
await session.send('本群组没有执行命令的权限呢QAQ')
log.logger.info(f'{__name__}: 群组: {group_id} 没有命令权限, 已中止命令执行')
return
elif session_type == 'private':
await session.send('本命令不支持在私聊中使用QAQ')
log.logger.info(f'{__name__}: 用户: {session.event.user_id} 在{session_type}中使用了命令, 已中止命令执行')
return
else:
log.logger.info(f'{__name__}: 用户: {session.event.user_id} 在{session_type}环境中使用了命令, 已中止命令执行')
return
# 从会话状态(session.state)中获取信息, 如果当前不存在, 则询问用户
skill_name = session.get('skill_name', prompt='即将向可用技能列表中添加技能, 开始新增技能向导~\n请输入技能名称: ',
arg_filters=[controllers.handle_cancellation(session),
validators.not_empty('输入不能为空')])
skill_description = session.get('skill_description', prompt='请输入技能描述: ',
arg_filters=[controllers.handle_cancellation(session),
validators.not_empty('输入不能为空')])
try:
__result = await add_skill_to_db(skill_name, skill_description)
if __result:
await session.send(f'已添加技能【{skill_name}】\n\n技能描述: \n{skill_description}')
log.logger.info(f'{__name__}: 群组: {group_id}, 用户: {session.event.user_id} 添加技能成功')
else:
await session.send('添加失败, 这个技能好像已经在技能列表中了~')
log.logger.info(f'{__name__}: 群组: {group_id}, 用户: {session.event.user_id} 试图添加技能失败, 技能已在技能列表中')
except Exception as e:
log.logger.warning(f'{__name__}: 群组: {group_id}, 用户: {session.event.user_id} 试图使用命令add_skill时发生了错误: {e}')
@add_skill.args_parser
async def _(session: CommandSession):
group_id = session.event.group_id
session_type = session.event.detail_type
if session_type == 'group':
if not has_command_permissions(group_id):
return
elif session_type == 'private':
return
else:
return
# 去掉消息首尾的空白符
stripped_arg = session.current_arg_text.strip()
if session.is_first_run:
# 该命令第一次运行(第一次进入命令会话)
if stripped_arg:
# 第一次运行参数不为空, 意味着用户直接将参数跟在命令名后面
# 分割参数
splited_arg = stripped_arg.split()
if len(splited_arg) == 2:
session.state['skill_name'] = splited_arg[0]
session.state['skill_description'] = splited_arg[1]
return
else:
session.finish('输入的格式好像不对呢, 请确认后重新输入命令吧~')
return
# 用户没有发送有效的参数(而是发送了空白字符), 返回向导
if not stripped_arg:
return
@skill.command('query_skill', aliases=('查询技能', '技能列表'), only_to_me=False, permission=permission.GROUP)
async def query_skill(session: CommandSession):
group_id = session.event.group_id
session_type = session.event.detail_type
if session_type == 'group':
if not has_command_permissions(group_id):
await session.send('本群组没有执行命令的权限呢QAQ')
log.logger.info(f'{__name__}: 群组: {group_id} 没有命令权限, 已中止命令执行')
return
elif session_type == 'private':
await session.send('本命令不支持在私聊中使用QAQ')
log.logger.info(f'{__name__}: 用户: {session.event.user_id} 在{session_type}中使用了命令, 已中止命令执行')
return
else:
log.logger.info(f'{__name__}: 用户: {session.event.user_id} 在{session_type}环境中使用了命令, 已中止命令执行')
return
try:
__result = await query_skill_list()
msg = ''
for __skill_name in __result:
msg += f'\n{__skill_name}'
await session.send(f'目前已有的技能列表如下: \n{msg}')
log.logger.info(f'{__name__}: 群组: {group_id}, 用户: {session.event.user_id} 成功查询了技能列表')
except Exception as e:
log.logger.warning(f'{__name__}: 群组: {group_id}, 用户: {session.event.user_id} 试图使用命令query_skill时发生了错误: {e}')
@skill.command('query_my_skill', aliases='我的技能', only_to_me=False, permission=permission.GROUP)
async def query_my_skill(session: CommandSession):
group_id = session.event.group_id
session_type = session.event.detail_type
if session_type == 'group':
if not has_command_permissions(group_id):
await session.send('本群组没有执行命令的权限呢QAQ')
log.logger.info(f'{__name__}: 群组: {group_id} 没有命令权限, 已中止命令执行')
return
elif session_type == 'private':
await session.send('本命令不支持在私聊中使用QAQ')
log.logger.info(f'{__name__}: 用户: {session.event.user_id} 在{session_type}中使用了命令, 已中止命令执行')
return
else:
log.logger.info(f'{__name__}: 用户: {session.event.user_id} 在{session_type}环境中使用了命令, 已中止命令执行')
return
__user_qq = session.event.user_id
try:
__result = await query_my_skill_list(__user_qq)
msg = ''
if not __result:
await session.send('你似乎没有掌握任何技能哦~\n请使用【/设置技能】或者【/新增技能】为自己设置技能吧~')
log.logger.info(f'{__name__}: 群组: {group_id}, 用户: {__user_qq} 成功查询了自己的技能')
else:
skill_level = ''
for __skill_list in __result:
if __skill_list[0] == 1:
skill_level = '普通'
elif __skill_list[0] == 2:
skill_level = '熟练'
elif __skill_list[0] == 3:
skill_level = '专业'
msg += f'\n【{__skill_list[1]}/{skill_level}】'
await session.send(f'你目前已掌握了以下技能: \n{msg}')
log.logger.info(f'{__name__}: 群组: {group_id}, 用户: {__user_qq} 成功查询了自己的技能')
except Exception as e:
log.logger.warning(f'{__name__}: 群组: {group_id}, 用户: {__user_qq} 试图使用命令query_my_skill时发生了错误: {e}')
@skill.command('set_my_skill', aliases='设置技能', only_to_me=False, permission=permission.GROUP)
async def set_my_skill(session: CommandSession):
group_id = session.event.group_id
session_type = session.event.detail_type
if session_type == 'group':
if not has_command_permissions(group_id):
await session.send('本群组没有执行命令的权限呢QAQ')
log.logger.info(f'{__name__}: 群组: {group_id} 没有命令权限, 已中止命令执行')
return
elif session_type == 'private':
await session.send('本命令不支持在私聊中使用QAQ')
log.logger.info(f'{__name__}: 用户: {session.event.user_id} 在{session_type}中使用了命令, 已中止命令执行')
return
else:
log.logger.info(f'{__name__}: 用户: {session.event.user_id} 在{session_type}环境中使用了命令, 已中止命令执行')
return
__user_qq = session.event.user_id
try:
# 清空技能列表
await clean_user_skill_in_db(__user_qq)
except Exception as e:
await session.send('发生了意外的错误QAQ')
log.logger.warning(f'{__name__}: 群组: {group_id}, 用户: {__user_qq} 试图设置技能时发生了错误: {e}, 清空技能列表失败')
return
__skill_list = await query_skill_list()
skill_name = session.get('skill_name', prompt='请输入你想设置的技能名称: ',
arg_filters=[controllers.handle_cancellation(session),
validators.not_empty('输入不能为空')])
if skill_name not in __skill_list:
session.finish('没有这个技能哦, 请重新设置~')
skill_level = session.get('skill_level', prompt='请输入你想设置的技能等级: \n可设置等级有"普通"、"熟练"、"专业"',
arg_filters=[controllers.handle_cancellation(session),
validators.not_empty('输入不能为空'),
validators.match_regex(r'^(普通|熟练|专业)$', '没有这个技能等级, 请重新输入~',
fullmatch=True)])
try:
__result = await add_user_skill_in_db(user_qq=__user_qq, skill_name=skill_name, skill_level=skill_level)
if __result:
await session.send(f'为你设置了技能: 【{skill_name}/{skill_level}】')
log.logger.info(f'{__name__}: 群组: {group_id}, 用户: {__user_qq} 成功设置了自己的技能')
else:
await session.send('添加失败, 发生了意外的错误QAQ')
log.logger.info(f'{__name__}: 群组: {group_id}, 用户: {__user_qq} 设置技能失败, add_user_skill_in_db错误')
except Exception as e:
log.logger.warning(f'{__name__}: 群组: {group_id}, 用户: {__user_qq} 试图使用命令set_my_skill时发生了错误: {e}')
@set_my_skill.args_parser
async def _(session: CommandSession):
group_id = session.event.group_id
session_type = session.event.detail_type
if session_type == 'group':
if not has_command_permissions(group_id):
return
elif session_type == 'private':
return
else:
return
# 去掉消息首尾的空白符
stripped_arg = session.current_arg_text.strip()
if session.is_first_run:
# 该命令第一次运行(第一次进入命令会话)
if stripped_arg:
# 第一次运行参数不为空, 意味着用户直接将参数跟在命令名后面
# 分割参数
splited_arg = stripped_arg.split()
if len(splited_arg) == 2 and splited_arg[1] in ['普通', '熟练', '专业']:
session.state['skill_name'] = splited_arg[0]
session.state['skill_level'] = splited_arg[1]
return
else:
session.finish('输入的格式好像不对呢, 请确认后重新输入命令吧~')
# 用户没有发送有效的参数(而是发送了空白字符), 返回向导
if not stripped_arg:
return
@skill.command('add_my_skill', aliases='新增技能', only_to_me=False, permission=permission.GROUP)
async def add_my_skill(session: CommandSession):
group_id = session.event.group_id
session_type = session.event.detail_type
if session_type == 'group':
if not has_command_permissions(group_id):
await session.send('本群组没有执行命令的权限呢QAQ')
log.logger.info(f'{__name__}: 群组: {group_id} 没有命令权限, 已中止命令执行')
return
elif session_type == 'private':
await session.send('本命令不支持在私聊中使用QAQ')
log.logger.info(f'{__name__}: 用户: {session.event.user_id} 在{session_type}中使用了命令, 已中止命令执行')
return
else:
log.logger.info(f'{__name__}: 用户: {session.event.user_id} 在{session_type}环境中使用了命令, 已中止命令执行')
return
__user_qq = session.event.user_id
__skill_list = await query_skill_list()
skill_name = session.get('skill_name', prompt='请输入你想设置的技能名称: ',
arg_filters=[controllers.handle_cancellation(session),
validators.not_empty('输入不能为空')])
if skill_name not in __skill_list:
session.finish('没有这个技能哦, 请重新设置~')
skill_level = session.get('skill_level', prompt='请输入你想设置的技能等级: \n可设置等级有"普通"、"熟练"、"专业"',
arg_filters=[controllers.handle_cancellation(session),
validators.not_empty('输入不能为空'),
validators.match_regex(r'^(普通|熟练|专业)$', '没有这个技能等级, 请重新输入~',
fullmatch=True)])
try:
__result = await add_user_skill_in_db(user_qq=__user_qq, skill_name=skill_name, skill_level=skill_level)
if __result:
await session.send(f'为你新增了技能: 【{skill_name}/{skill_level}】')
log.logger.info(f'{__name__}: 群组: {group_id}, 用户: {__user_qq} 成功新增了自己的技能')
else:
await session.send('添加失败, 发生了意外的错误QAQ')
log.logger.info(f'{__name__}: 群组: {group_id}, 用户: {__user_qq} 新增技能失败, add_user_skill_in_db错误')
except Exception as e:
log.logger.warning(f'{__name__}: 群组: {group_id}, 用户: {__user_qq} 试图使用命令add_my_skill时发生了错误: {e}')
@add_my_skill.args_parser
async def _(session: CommandSession):
group_id = session.event.group_id
session_type = session.event.detail_type
if session_type == 'group':
if not has_command_permissions(group_id):
return
elif session_type == 'private':
return
else:
return
# 去掉消息首尾的空白符
stripped_arg = session.current_arg_text.strip()
if session.is_first_run:
# 该命令第一次运行(第一次进入命令会话)
if stripped_arg:
# 第一次运行参数不为空, 意味着用户直接将参数跟在命令名后面
# 分割参数
splited_arg = stripped_arg.split()
if len(splited_arg) == 2 and splited_arg[1] in ['普通', '熟练', '专业']:
session.state['skill_name'] = splited_arg[0]
session.state['skill_level'] = splited_arg[1]
return
else:
session.finish('输入的格式好像不对呢, 请确认后重新输入命令吧~')
# 用户没有发送有效的参数(而是发送了空白字符), 返回向导
if not stripped_arg:
return
| 42.060897
| 119
| 0.622114
| 1,552
| 13,123
| 4.900129
| 0.12049
| 0.0405
| 0.041026
| 0.044181
| 0.811966
| 0.803682
| 0.785141
| 0.780671
| 0.780671
| 0.761341
| 0
| 0.001858
| 0.261907
| 13,123
| 311
| 120
| 42.196141
| 0.783295
| 0.025375
| 0
| 0.730038
| 0
| 0.007605
| 0.254933
| 0.075869
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.019011
| 0
| 0.140684
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
0b68fc875c1c5aeb3d80b1f0bb4deb5bc8e8ecca
| 23,244
|
py
|
Python
|
osm/migrations/0001_initial.py
|
dcopm999/django-osm
|
7a5d87a4e64292b7726d4401f529020ead732c77
|
[
"MIT"
] | 7
|
2021-08-19T07:18:21.000Z
|
2021-09-13T19:39:18.000Z
|
osm/migrations/0001_initial.py
|
dcopm999/django-osm
|
7a5d87a4e64292b7726d4401f529020ead732c77
|
[
"MIT"
] | 5
|
2021-04-22T06:42:42.000Z
|
2021-09-11T15:21:22.000Z
|
osm/migrations/0001_initial.py
|
dcopm999/django-osm
|
7a5d87a4e64292b7726d4401f529020ead732c77
|
[
"MIT"
] | null | null | null |
# Generated by Django 3.2.5 on 2021-08-02 05:23
import django.contrib.gis.db.models.fields
from django.db import migrations, models
class Migration(migrations.Migration):
initial = True
dependencies = [
]
operations = [
migrations.CreateModel(
name='Building',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Name')),
('type', models.CharField(blank=True, max_length=20, null=True, verbose_name='Object Type')),
('geom', django.contrib.gis.db.models.fields.PolygonField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Building',
'verbose_name_plural': 'Buildings',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='Country',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('fips', models.CharField(blank=True, max_length=2, null=True, verbose_name='Fips')),
('iso2', models.CharField(max_length=2, verbose_name='iso2')),
('iso3', models.CharField(max_length=3, verbose_name='iso3')),
('un', models.IntegerField(verbose_name='UN')),
('name', models.CharField(db_index=True, max_length=50, unique=True, verbose_name='Name')),
('area', models.IntegerField(verbose_name='Area')),
('pop2005', models.BigIntegerField(verbose_name='Pop 2005')),
('region', models.IntegerField(verbose_name='Region')),
('subregion', models.IntegerField(verbose_name='Subregion')),
('lon', models.FloatField(verbose_name='Lon')),
('lat', models.FloatField(verbose_name='Lat')),
('geom', django.contrib.gis.db.models.fields.MultiPolygonField(srid=4326, verbose_name='Geom')),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Country',
'verbose_name_plural': 'Countries',
},
),
migrations.CreateModel(
name='Landuse',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Name')),
('geom', django.contrib.gis.db.models.fields.MultiPolygonField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Landuse',
'verbose_name_plural': 'Landuses',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='Natural',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Name')),
('geom', django.contrib.gis.db.models.fields.PointField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Natural',
'verbose_name_plural': 'Naturals',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='NaturalA',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Name')),
('geom', django.contrib.gis.db.models.fields.MultiPolygonField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Natural A',
'verbose_name_plural': 'Naturals A',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='Place',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('population', models.BigIntegerField()),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Name')),
('geom', django.contrib.gis.db.models.fields.MultiPointField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Place',
'verbose_name_plural': 'Places',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='PlaceA',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('population', models.BigIntegerField()),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Name')),
('geom', django.contrib.gis.db.models.fields.MultiPolygonField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Place A',
'verbose_name_plural': 'Places A',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='Pofw',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Name')),
('geom', django.contrib.gis.db.models.fields.MultiPointField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Pofw',
'verbose_name_plural': 'Pofw',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='PofwA',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Name')),
('geom', django.contrib.gis.db.models.fields.MultiPolygonField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Pofw A',
'verbose_name_plural': 'Pofw A',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='Pois',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Name')),
('geom', django.contrib.gis.db.models.fields.PointField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Pois',
'verbose_name_plural': 'Poises',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='PoisA',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Name')),
('geom', django.contrib.gis.db.models.fields.MultiPolygonField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Pois A',
'verbose_name_plural': 'Poises A',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='RailWay',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Name')),
('layer', models.BigIntegerField(verbose_name='Layer')),
('bridge', models.CharField(max_length=1, verbose_name='Bridge')),
('tunnel', models.CharField(max_length=1, verbose_name='Tunnel')),
('geom', django.contrib.gis.db.models.fields.MultiLineStringField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'RailWay',
'verbose_name_plural': 'RailWays',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='Road',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Object name')),
('ref', models.CharField(max_length=20, null=True, verbose_name='Ref')),
('oneway', models.CharField(max_length=1, verbose_name='One way')),
('maxspeed', models.IntegerField(verbose_name='Max speed')),
('layer', models.BigIntegerField(verbose_name='Layer')),
('bridge', models.CharField(max_length=1, verbose_name='Bridge')),
('tunnel', models.CharField(max_length=1, verbose_name='Tunnel')),
('geom', django.contrib.gis.db.models.fields.MultiLineStringField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Road',
'verbose_name_plural': 'Roads',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='Traffic',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Object name')),
('geom', django.contrib.gis.db.models.fields.MultiPointField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Traffic',
'verbose_name_plural': 'Traffics',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='TrafficA',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Object name')),
('geom', django.contrib.gis.db.models.fields.MultiPolygonField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Traffic A',
'verbose_name_plural': 'Traffics A',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='Transport',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Object name')),
('geom', django.contrib.gis.db.models.fields.MultiPointField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Transport',
'verbose_name_plural': 'Transports',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='TransportA',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Object name')),
('geom', django.contrib.gis.db.models.fields.MultiPolygonField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Transport A',
'verbose_name_plural': 'Transports A',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='Water',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Object name')),
('geom', django.contrib.gis.db.models.fields.MultiPolygonField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Water',
'verbose_name_plural': 'Waters',
'ordering': ['-id'],
},
),
migrations.CreateModel(
name='WaterWay',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('osm_id', models.CharField(db_index=True, max_length=10, unique=True, verbose_name='OSM ID')),
('code', models.IntegerField(verbose_name='Code')),
('fclass', models.CharField(max_length=28, verbose_name='Object class')),
('width', models.IntegerField()),
('name', models.CharField(blank=True, max_length=100, null=True, verbose_name='Object name')),
('geom', django.contrib.gis.db.models.fields.MultiLineStringField(srid=4326)),
('created', models.DateTimeField(auto_now_add=True, verbose_name='Created')),
('updated', models.DateTimeField(auto_now=True, verbose_name='Updated')),
('deleted', models.BooleanField(default=False, verbose_name='Is deleted')),
],
options={
'verbose_name': 'Water Way',
'verbose_name_plural': 'WaterWays',
'ordering': ['-id'],
},
),
]
| 58.69697
| 114
| 0.570083
| 2,324
| 23,244
| 5.519363
| 0.056799
| 0.178374
| 0.091214
| 0.077025
| 0.892414
| 0.861932
| 0.83831
| 0.825446
| 0.825446
| 0.825446
| 0
| 0.014439
| 0.275985
| 23,244
| 395
| 115
| 58.84557
| 0.747757
| 0.001936
| 0
| 0.737113
| 1
| 0
| 0.143338
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.005155
| 0
| 0.015464
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
0b94f6e84f0501d63868598032b137058b1cd739
| 4,291
|
py
|
Python
|
autogl/datasets/__init__.py
|
dedsec-9/AutoGL
|
487f2b2f798b9b1363ad5dc100fb410b12222e06
|
[
"MIT"
] | null | null | null |
autogl/datasets/__init__.py
|
dedsec-9/AutoGL
|
487f2b2f798b9b1363ad5dc100fb410b12222e06
|
[
"MIT"
] | null | null | null |
autogl/datasets/__init__.py
|
dedsec-9/AutoGL
|
487f2b2f798b9b1363ad5dc100fb410b12222e06
|
[
"MIT"
] | null | null | null |
from autogl import backend as _backend
from ._dataset_registry import (
DatasetUniversalRegistry,
build_dataset_from_name
)
from ._gtn_data import (
GTNACMDataset,
GTNDBLPDataset,
GTNIMDBDataset,
)
from ._matlab_matrix import BlogCatalogDataset, WIKIPEDIADataset
from ._ogb import (
OGBNProductsDataset, OGBNProteinsDataset, OGBNArxivDataset, OGBNPapers100MDataset,
OGBLPPADataset, OGBLCOLLABDataset, OGBLDDIDataset, OGBLCitation2Dataset,
OGBGMOLHIVDataset, OGBGMOLPCBADataset, OGBGPPADataset, OGBGCode2Dataset
)
if _backend.DependentBackend.is_dgl():
from ._dgl import (
CoraDataset,
CiteSeerDataset,
PubMedDataset,
RedditDataset,
AmazonComputersDataset,
AmazonPhotoDataset,
CoauthorPhysicsDataset,
CoauthorCSDataset,
MUTAGDataset,
ENZYMESDataset,
IMDBBinaryDataset,
IMDBMultiDataset,
RedditBinaryDataset,
REDDITMulti5KDataset,
COLLABDataset,
ProteinsDataset,
PTCMRDataset,
NCI1Dataset
)
from ._heterogeneous_datasets import ACMHANDataset, ACMHGTDataset
elif _backend.DependentBackend.is_pyg():
from ._pyg import (
CoraDataset,
CiteSeerDataset,
PubMedDataset,
FlickrDataset,
RedditDataset,
AmazonComputersDataset,
AmazonPhotoDataset,
CoauthorPhysicsDataset,
CoauthorCSDataset,
PPIDataset,
QM9Dataset,
MUTAGDataset,
ENZYMESDataset,
IMDBBinaryDataset,
IMDBMultiDataset,
RedditBinaryDataset,
REDDITMulti5KDataset,
REDDITMulti12KDataset,
COLLABDataset,
ProteinsDataset,
PTCMRDataset,
NCI1Dataset,
NCI109Dataset,
ModelNet10TrainingDataset,
ModelNet10TestDataset,
ModelNet40TrainingDataset,
ModelNet40TestDataset
)
if _backend.DependentBackend.is_pyg():
__all__ = [
"CoraDataset",
"CiteSeerDataset",
"PubMedDataset",
"FlickrDataset",
"RedditDataset",
"AmazonComputersDataset",
"AmazonPhotoDataset",
"CoauthorPhysicsDataset",
"CoauthorCSDataset",
"PPIDataset",
"QM9Dataset",
"MUTAGDataset",
"ENZYMESDataset",
"IMDBBinaryDataset",
"IMDBMultiDataset",
"RedditBinaryDataset",
"REDDITMulti5KDataset",
"REDDITMulti12KDataset",
"COLLABDataset",
"ProteinsDataset",
"PTCMRDataset",
"NCI1Dataset",
"NCI109Dataset",
"ModelNet10TrainingDataset",
"ModelNet10TestDataset",
"ModelNet40TrainingDataset",
"ModelNet40TestDataset",
"OGBNProductsDataset",
"OGBNProteinsDataset",
"OGBNArxivDataset",
"OGBNPapers100MDataset",
"OGBLPPADataset",
"OGBLCOLLABDataset",
"OGBLDDIDataset",
"OGBLCitation2Dataset",
"OGBGMOLHIVDataset",
"OGBGMOLPCBADataset",
"OGBGPPADataset",
"OGBGCode2Dataset",
"GTNACMDataset",
"GTNDBLPDataset",
"GTNIMDBDataset",
"BlogCatalogDataset",
"WIKIPEDIADataset"
]
else:
__all__ = [
"CoraDataset",
"CiteSeerDataset",
"PubMedDataset",
"RedditDataset",
"AmazonComputersDataset",
"AmazonPhotoDataset",
"CoauthorPhysicsDataset",
"CoauthorCSDataset",
"MUTAGDataset",
"ENZYMESDataset",
"IMDBBinaryDataset",
"IMDBMultiDataset",
"RedditBinaryDataset",
"REDDITMulti5KDataset",
"COLLABDataset",
"ProteinsDataset",
"PTCMRDataset",
"NCI1Dataset",
"ACMHANDataset",
"ACMHGTDataset",
"OGBNProductsDataset",
"OGBNProteinsDataset",
"OGBNArxivDataset",
"OGBNPapers100MDataset",
"OGBLPPADataset",
"OGBLCOLLABDataset",
"OGBLDDIDataset",
"OGBLCitation2Dataset",
"OGBGMOLHIVDataset",
"OGBGMOLPCBADataset",
"OGBGPPADataset",
"OGBGCode2Dataset",
"GTNACMDataset",
"GTNDBLPDataset",
"GTNIMDBDataset",
"BlogCatalogDataset",
"WIKIPEDIADataset"
]
| 26.652174
| 86
| 0.622466
| 199
| 4,291
| 13.276382
| 0.356784
| 0.039364
| 0.059046
| 0.11355
| 0.833838
| 0.833838
| 0.833838
| 0.833838
| 0.833838
| 0.833838
| 0
| 0.016938
| 0.298299
| 4,291
| 160
| 87
| 26.81875
| 0.860511
| 0
| 0
| 0.683871
| 0
| 0
| 0.304125
| 0.05663
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.051613
| 0
| 0.051613
| 0
| 0
| 0
| 1
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
f002b3574f1f837ac0a27e28f9b8c88d3f0a75d7
| 186
|
py
|
Python
|
backend/views/__init__.py
|
gogaz/coach_royale
|
fc6b9f9021c2470a8bcd8aa27dffef8ec079364c
|
[
"MIT"
] | 10
|
2018-11-08T08:29:17.000Z
|
2021-11-02T11:55:49.000Z
|
backend/views/__init__.py
|
gogaz/coach_royale
|
fc6b9f9021c2470a8bcd8aa27dffef8ec079364c
|
[
"MIT"
] | 138
|
2018-09-14T03:47:51.000Z
|
2022-02-01T18:33:09.000Z
|
backend/views/__init__.py
|
gogaz/coach_royale
|
fc6b9f9021c2470a8bcd8aa27dffef8ec079364c
|
[
"MIT"
] | null | null | null |
from django.http import JsonResponse
def handler404(*args, **kwargs):
return JsonResponse({'error': {'message': 'The requested resource was not found.'}, 'code': 404}, status=404)
| 31
| 113
| 0.709677
| 23
| 186
| 5.73913
| 0.913043
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.055901
| 0.134409
| 186
| 5
| 114
| 37.2
| 0.763975
| 0
| 0
| 0
| 0
| 0
| 0.284946
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.333333
| true
| 0
| 0.333333
| 0.333333
| 1
| 0
| 1
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 1
| 1
| 1
| 0
|
0
| 7
|
f0433aa28475afaddebc9e3379c89589f7436a84
| 67,906
|
py
|
Python
|
splunk_topology/test_splunk_topology.py
|
StackVista/sts-agent-integrations-core
|
909344f2a829256c114f261a3a3efbe27e09ba2c
|
[
"BSD-3-Clause"
] | 3
|
2018-01-21T09:35:56.000Z
|
2020-11-12T07:05:03.000Z
|
splunk_topology/test_splunk_topology.py
|
StackVista/sts-agent-integrations-core
|
909344f2a829256c114f261a3a3efbe27e09ba2c
|
[
"BSD-3-Clause"
] | 9
|
2017-11-09T15:06:51.000Z
|
2020-07-15T08:31:26.000Z
|
splunk_topology/test_splunk_topology.py
|
StackVista/sts-agent-integrations-core
|
909344f2a829256c114f261a3a3efbe27e09ba2c
|
[
"BSD-3-Clause"
] | 4
|
2018-06-04T12:59:53.000Z
|
2020-01-23T19:04:12.000Z
|
# stdlib
import json
import os
from checks import CheckException, FinalizeException, TokenExpiredException
from tests.checks.common import AgentCheckTest, Fixtures
FIXTURE_DIR = os.path.join(os.path.dirname(__file__), 'ci')
def _mocked_saved_searches(*args, **kwargs):
return []
def _mocked_auth_session(instance_key):
return "sessionKey1"
def _mocked_dispatch(*args, **kwargs):
return args[1].name
class TestSplunkNoTopology(AgentCheckTest):
"""
Splunk check should work in absence of topology
"""
CHECK_NAME = 'splunk_topology'
def test_checks(self):
self.maxDiff = None
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'component_saved_searches': [],
'relation_saved_searches': []
}
]
}
self.run_check(config, mocks={'_saved_searches':_mocked_saved_searches, '_auth_session': _mocked_auth_session})
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
# Sid is equal to search name
def _mocked_dispatch_saved_search(*args, **kwargs):
name = args[1].name
if name == "dispatch_error":
raise Exception("BOOM")
return args[1].name
def _mocked_search(*args, **kwargs):
# sid is set to saved search name
sid = args[0]
return [json.loads(Fixtures.read_file("%s.json" % sid, sdk_dir=FIXTURE_DIR))]
class TestSplunkTopology(AgentCheckTest):
"""
Splunk check should work with component and relation data
"""
CHECK_NAME = 'splunk_topology'
def tear_down(self, url, qualifier):
"""
Clear the persistent state from the system for next time
"""
self.check.update_persistent_status(url, qualifier, None, 'clear')
def test_checks(self):
self.maxDiff = None
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'component_saved_searches': [{
"name": "components",
"parameters": {}
}],
'relation_saved_searches': [{
"name": "relations",
"parameters": {}
}],
'tags': ['mytag', 'mytag2']
}
]
}
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session
})
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
self.assertEqual(instances[0]['instance'], {"type":"splunk","url":"http://localhost:8089"})
self.assertEqual(instances[0]['components'][0], {
"externalId": u"vm_2_1",
"type": {"name": u"vm"},
"data": {
u"running": True,
u"_time": u"2017-03-06T14:55:54.000+00:00",
"label.label1Key": "label1Value",
"tags": ['result_tag1', 'mytag', 'mytag2']
}
})
self.assertEqual(instances[0]['components'][1], {
"externalId": u"server_2",
"type": {"name": u"server"},
"data": {
u"description": u"My important server 2",
u"_time": u"2017-03-06T14:55:54.000+00:00",
"label.label2Key": "label2Value",
"tags": ['result_tag2', 'mytag', 'mytag2']
}
})
self.assertEquals(instances[0]['relations'][0], {
"externalId": u"vm_2_1-HOSTED_ON-server_2",
"type": {"name": u"HOSTED_ON"},
"sourceId": u"vm_2_1",
"targetId": u"server_2",
"data": {
u"description": u"Some relation",
u"_time": u"2017-03-06T15:10:57.000+00:00",
"tags": ['mytag', 'mytag2']
}
})
self.assertEquals(instances[0]["start_snapshot"], True)
self.assertEquals(instances[0]["stop_snapshot"], True)
self.assertEquals(self.service_checks[0]['status'], 0, "service check should have status AgentCheck.OK")
def test_checks_backward_compatibility(self):
self.maxDiff = None
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'username': 'admin',
'password': 'admin',
'component_saved_searches': [{
"name": "components",
"parameters": {}
}],
'relation_saved_searches': [{
"name": "relations",
"parameters": {}
}],
'tags': ['mytag', 'mytag2']
}
]
}
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session
})
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
self.assertEqual(instances[0]['instance'], {"type":"splunk","url":"http://localhost:8089"})
self.assertEqual(instances[0]['components'][0], {
"externalId": u"vm_2_1",
"type": {"name": u"vm"},
"data": {
u"running": True,
u"_time": u"2017-03-06T14:55:54.000+00:00",
"label.label1Key": "label1Value",
"tags": ['result_tag1', 'mytag', 'mytag2']
}
})
self.assertEqual(instances[0]['components'][1], {
"externalId": u"server_2",
"type": {"name": u"server"},
"data": {
u"description": u"My important server 2",
u"_time": u"2017-03-06T14:55:54.000+00:00",
"label.label2Key": "label2Value",
"tags": ['result_tag2', 'mytag', 'mytag2']
}
})
self.assertEquals(instances[0]['relations'][0], {
"externalId": u"vm_2_1-HOSTED_ON-server_2",
"type": {"name": u"HOSTED_ON"},
"sourceId": u"vm_2_1",
"targetId": u"server_2",
"data": {
u"description": u"Some relation",
u"_time": u"2017-03-06T15:10:57.000+00:00",
"tags": ['mytag', 'mytag2']
}
})
self.assertEquals(instances[0]["start_snapshot"], True)
self.assertEquals(instances[0]["stop_snapshot"], True)
self.assertEquals(self.service_checks[0]['status'], 0, "service check should have status AgentCheck.OK")
def test_checks_backward_compatibility_with_new_conf(self):
self.maxDiff = None
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'username': 'admin',
'password': 'admin',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'component_saved_searches': [{
"name": "components",
"parameters": {}
}],
'relation_saved_searches': [{
"name": "relations",
"parameters": {}
}],
'tags': ['mytag', 'mytag2']
}
]
}
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session
})
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
self.assertEqual(instances[0]['instance'], {"type":"splunk","url":"http://localhost:8089"})
self.assertEqual(instances[0]['components'][0], {
"externalId": u"vm_2_1",
"type": {"name": u"vm"},
"data": {
u"running": True,
u"_time": u"2017-03-06T14:55:54.000+00:00",
"label.label1Key": "label1Value",
"tags": ['result_tag1', 'mytag', 'mytag2']
}
})
self.assertEqual(instances[0]['components'][1], {
"externalId": u"server_2",
"type": {"name": u"server"},
"data": {
u"description": u"My important server 2",
u"_time": u"2017-03-06T14:55:54.000+00:00",
"label.label2Key": "label2Value",
"tags": ['result_tag2', 'mytag', 'mytag2']
}
})
self.assertEquals(instances[0]['relations'][0], {
"externalId": u"vm_2_1-HOSTED_ON-server_2",
"type": {"name": u"HOSTED_ON"},
"sourceId": u"vm_2_1",
"targetId": u"server_2",
"data": {
u"description": u"Some relation",
u"_time": u"2017-03-06T15:10:57.000+00:00",
"tags": ['mytag', 'mytag2']
}
})
self.assertEquals(instances[0]["start_snapshot"], True)
self.assertEquals(instances[0]["stop_snapshot"], True)
self.assertEquals(self.service_checks[0]['status'], 0, "service check should have status AgentCheck.OK")
def test_not_dispatch_sids_checks(self):
self.maxDiff = None
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089/',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'component_saved_searches': [{
"name": "components",
"parameters": {}
}],
'relation_saved_searches': [],
'tags': ['mytag', 'mytag2']
}
]
}
instance = config.get('instances')[0]
persist_status_key = instance.get('url')+"components"
def _mocked_finalize_sid_none(*args, **kwargs):
return None
# Run the check first time and get the persistent status data
self.run_check(config, mocks={
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session,
'_dispatch': _mocked_dispatch
})
first_persistent_data = self.check._status().data.get(persist_status_key)
# Run the check 2nd time and get the persistent status data
self.run_check(config, mocks={
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session,
'_dispatch': _mocked_dispatch,
'_finalize_sid': _mocked_finalize_sid_none
}, force_reload=True)
second_persistent_data = self.check._status().data.get(persist_status_key)
# The second run_check will finalize the previous saved search id and create a new one,
# so we make sure this is the case
self.assertEqual(first_persistent_data, second_persistent_data)
def _mocked_finalize_sid_exception(*args, **kwargs):
raise FinalizeException(None, "Error occured")
thrown = False
try:
self.run_check(config, mocks={
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session,
'_dispatch': _mocked_dispatch,
'_finalize_sid': _mocked_finalize_sid_exception
}, force_reload=True)
except CheckException:
thrown = True
self.assertTrue(thrown)
self.assertEquals(self.service_checks[0]['status'], 2, "service check should have status AgentCheck.CRITICAL")
# make sure the data still persists after exception raised
self.assertIsNotNone(self.check._status().data.get(persist_status_key))
# tear down the persistent data
self.tear_down(instance.get('url'), "components")
class TestSplunkNoSnapshot(AgentCheckTest):
"""
Splunk check should work with component and relation data
"""
CHECK_NAME = 'splunk_topology'
def test_checks(self):
self.maxDiff = None
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'snapshot': False,
'component_saved_searches': [{
"name": "components",
"parameters": {}
}],
'relation_saved_searches': [{
"name": "relations",
"parameters": {}
}],
'tags': ['mytag', 'mytag2']
}
]
}
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session
})
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
self.assertEqual(instances[0]['instance'], {"type":"splunk","url":"http://localhost:8089"})
self.assertEqual(len(instances[0]['components']), 2)
self.assertEquals(len(instances[0]['relations']), 1)
self.assertFalse("start_snapshot" in instances[0])
self.assertFalse("stop_snapshot" in instances[0])
self.assertEquals(self.service_checks[0]['status'], 0, "service check should have status AgentCheck.OK")
class TestSplunkMinimalTopology(AgentCheckTest):
"""
Splunk check should work with minimal component and relation data
"""
CHECK_NAME = 'splunk_topology'
def test_checks(self):
self.maxDiff = None
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'component_saved_searches': [{
"name": "minimal_components",
"element_type": "component",
"parameters": {}
}],
'relation_saved_searches': [{
"name": "minimal_relations",
"element_type": "relation",
"parameters": {}
}],
'tags': ['mytag', 'mytag2']
}
]
}
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session
})
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
self.assertEqual(instances[0]['instance'], {"type":"splunk","url":"http://localhost:8089"})
self.assertEqual(instances[0]['components'][0], {
"externalId": u"vm_2_1",
"type": {"name": u"vm"},
"data": {
"tags": ['mytag', 'mytag2']
}
})
self.assertEqual(instances[0]['components'][1], {
"externalId": u"server_2",
"type": {"name": u"server"},
"data": {
"tags": ['mytag', 'mytag2']
}
})
self.assertEquals(instances[0]['relations'][0], {
"externalId": u"vm_2_1-HOSTED_ON-server_2",
"type": {"name": u"HOSTED_ON"},
"sourceId": u"vm_2_1",
"targetId": u"server_2",
"data": {
"tags": ['mytag', 'mytag2']
}
})
self.assertEquals(self.service_checks[0]['status'], 0, "service check should have status AgentCheck.OK")
class TestSplunkIncompleteTopology(AgentCheckTest):
"""
Splunk check should crash on incomplete data
"""
CHECK_NAME = 'splunk_topology'
def test_checks(self):
self.maxDiff = None
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'component_saved_searches': [{
"name": "incomplete_components",
"element_type": "component",
"parameters": {}
}],
'relation_saved_searches': [{
"name": "incomplete_relations",
"element_type": "relation",
"parameters": {}
}],
'tags': ['mytag', 'mytag2']
}
]
}
thrown = False
try:
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session
})
except CheckException:
thrown = True
self.assertTrue(thrown, "Retrieving incomplete data from splunk should throw")
self.assertEquals(self.service_checks[0]['status'], 2, "service check should have status AgentCheck.CRITICAL")
def _mocked_partially_incomplete_search(*args, **kwargs):
# sid is set to saved search name
sid = args[0]
return [json.loads(Fixtures.read_file("partially_incomplete_%s.json" % sid, sdk_dir=FIXTURE_DIR))]
class TestSplunkPartiallyIncompleteTopology(AgentCheckTest):
"""
Splunk check should crash on incomplete data
"""
CHECK_NAME = 'splunk_topology'
def test_checks(self):
self.maxDiff = None
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'component_saved_searches': [{
"name": "partially_incomplete_components",
"element_type": "component",
"parameters": {}
}],
'relation_saved_searches': [{
"name": "partially_incomplete_relations",
"element_type": "relation",
"parameters": {}
}],
'tags': ['mytag', 'mytag2']
}
]
}
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session
})
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
self.assertEqual(instances[0]['instance'], {"type":"splunk","url":"http://localhost:8089"})
self.assertEqual(len(instances[0]['components']), 1)
self.assertEqual(len(instances[0]['relations']), 1)
self.assertEqual(instances[0]['components'][0], {
"externalId": u"vm_2_1",
"type": {"name": u"vm"},
"data": {
"tags": ['mytag', 'mytag2']
}
})
self.assertEquals(instances[0]['relations'][0], {
"externalId": u"vm_2_1-HOSTED_ON-server_2",
"type": {"name": u"HOSTED_ON"},
"sourceId": u"vm_2_1",
"targetId": u"server_2",
"data": {
"tags": ['mytag', 'mytag2']
}
})
self.assertEquals(len(self.service_checks), 2)
self.assertEquals(self.service_checks[0]['status'], 1, "service check should have status AgentCheck.WARNING")
self.assertEquals(self.service_checks[0]['message'],
"The saved search 'partially_incomplete_components' contained 1 incomplete component records")
self.assertEquals(self.service_checks[1]['status'], 1, "service check should have status AgentCheck.WARNING")
self.assertEquals(self.service_checks[1]['message'],
"The saved search 'partially_incomplete_relations' contained 1 incomplete relation records")
def _mocked_partially_incomplete_and_incomplete_search(*args, **kwargs):
# sid is set to saved search name
sid = args[0]
return [json.loads(Fixtures.read_file("partially_incomplete_%s.json" % sid, sdk_dir=FIXTURE_DIR)),
json.loads(Fixtures.read_file("incomplete_%s.json" % sid, sdk_dir=FIXTURE_DIR))]
class TestSplunkPartiallyIncompleteAndIncompleteTopology(AgentCheckTest):
"""
Splunk check should crash on incomplete data
"""
CHECK_NAME = 'splunk_topology'
def test_checks(self):
self.maxDiff = None
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'component_saved_searches': [{
"name": "components",
"element_type": "component",
"parameters": {}
}],
'relation_saved_searches': [{
"name": "relations",
"element_type": "relation",
"parameters": {}
}],
'tags': ['mytag', 'mytag2']
}
]
}
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_partially_incomplete_and_incomplete_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session
})
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
self.assertEqual(instances[0]['instance'], {"type":"splunk","url":"http://localhost:8089"})
self.assertEqual(len(instances[0]['components']), 1)
self.assertEqual(len(instances[0]['relations']), 1)
self.assertEqual(instances[0]['components'][0], {
"externalId": u"vm_2_1",
"type": {"name": u"vm"},
"data": {
"tags": ['mytag', 'mytag2']
}
})
self.assertEquals(instances[0]['relations'][0], {
"externalId": u"vm_2_1-HOSTED_ON-server_2",
"type": {"name": u"HOSTED_ON"},
"sourceId": u"vm_2_1",
"targetId": u"server_2",
"data": {
"tags": ['mytag', 'mytag2']
}
})
self.assertEquals(len(self.service_checks), 2)
self.assertEquals(self.service_checks[0]['status'], 1, "service check should have status AgentCheck.WARNING")
self.assertEquals(self.service_checks[0]['message'],
"The saved search 'components' contained 3 incomplete component records")
self.assertEquals(self.service_checks[1]['status'], 1, "service check should have status AgentCheck.WARNING")
self.assertEquals(self.service_checks[1]['message'],
"The saved search 'relations' contained 2 incomplete relation records")
class TestSplunkTopologyPollingInterval(AgentCheckTest):
"""
Test whether the splunk check properly implements the polling intervals
"""
CHECK_NAME = 'splunk_topology'
def test_checks(self):
self.maxDiff = None
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'component_saved_searches': [{
"name": "components_fast",
"element_type": "component",
"parameters": {}
}],
'relation_saved_searches': [{
"name": "relations_fast",
"element_type": "relation",
"parameters": {}
}],
'tags': ['mytag', 'mytag2']
},
{
'url': 'http://remotehost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'polling_interval_seconds': 30,
'component_saved_searches': [{
"name": "components_slow",
"element_type": "component",
"parameters": {}
}],
'relation_saved_searches': [{
"name": "relations_slow",
"element_type": "relation",
"parameters": {}
}],
'tags': ['mytag', 'mytag2']
}
]
}
# Used to validate which searches have been executed
test_data = {
"expected_searches": [],
"time": 0,
"throw": False
}
def _mocked_current_time_seconds():
return test_data["time"]
def _mocked_interval_search(*args, **kwargs):
if test_data["throw"]:
raise CheckException("Is broke it")
sid = args[0]
self.assertTrue(sid in test_data["expected_searches"])
return [json.loads(Fixtures.read_file("empty.json", sdk_dir=FIXTURE_DIR))]
test_mocks = {
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_interval_search,
'_current_time_seconds': _mocked_current_time_seconds,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session
}
# Inital run
test_data["expected_searches"] = ["components_fast", "relations_fast", "components_slow", "relations_slow"]
test_data["time"] = 1
self.run_check(config, mocks=test_mocks)
self.check.get_topology_instances()
# Only fast ones after 15 seconds
test_data["expected_searches"] = ["components_fast", "relations_fast"]
test_data["time"] = 20
self.run_check(config, mocks=test_mocks)
self.check.get_topology_instances()
# Slow ones after 40 seconds aswell
test_data["expected_searches"] = ["components_fast", "relations_fast", "components_slow", "relations_slow"]
test_data["time"] = 40
self.run_check(config, mocks=test_mocks)
self.check.get_topology_instances()
# Nothing should happen when throwing
test_data["expected_searches"] = []
test_data["time"] = 60
test_data["throw"] = True
thrown = False
try:
self.run_check(config, mocks=test_mocks)
except CheckException:
thrown = True
self.check.get_topology_instances()
self.assertTrue(thrown, "Expect thrown to be done from the mocked search")
self.assertEquals(self.service_checks[0]['status'], 2, "service check should have status AgentCheck.CRITICAL")
# Updating should happen asap after throw
test_data["expected_searches"] = ["components_fast", "relations_fast"]
test_data["time"] = 61
test_data["throw"] = False
self.run_check(config, mocks=test_mocks)
self.check.get_topology_instances()
self.assertEquals(self.service_checks[0]['status'], 0, "service check should have status AgentCheck.OK")
class TestSplunkTopologyErrorResponse(AgentCheckTest):
"""
Splunk check should handle a FATAL message response
"""
CHECK_NAME = 'splunk_topology'
def test_checks(self):
self.maxDiff = None
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'component_saved_searches': [{
"name": "error",
"element_type": "component",
"parameters": {}
}],
'relation_saved_searches': [],
'tags': ['mytag', 'mytag2']
}
]
}
thrown = False
try:
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session
})
except CheckException:
thrown = True
self.assertTrue(thrown, "Retrieving FATAL message from Splunk should throw.")
self.assertEquals(self.service_checks[0]['status'], 2, "service check should have status AgentCheck.CRITICAL")
class TestSplunkSavedSearchesError(AgentCheckTest):
"""
Splunk topology check should have a service check failure when getting an exception from saved searches
"""
CHECK_NAME = 'splunk_topology'
def test_checks(self):
self.maxDiff = None
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'component_saved_searches': [{
"name": "error",
"element_type": "component",
"parameters": {}
}],
'relation_saved_searches': [],
'tags': ['mytag', 'mytag2']
}
]
}
def _mocked_saved_searches(*args, **kwargs):
raise Exception("Boom")
thrown = False
try:
self.run_check(config, mocks={
'_saved_searches': _mocked_saved_searches
})
except CheckException:
thrown = True
self.assertTrue(thrown, "Retrieving FATAL message from Splunk should throw.")
self.assertEquals(self.service_checks[0]['status'], 2, "service check should have status AgentCheck.CRITICAL")
class TestSplunkSavedSearchesIgnoreError(AgentCheckTest):
"""
Splunk topology check should ignore exception when getting an exception from saved searches
"""
CHECK_NAME = 'splunk_topology'
def test_checks(self):
self.maxDiff = None
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'ignore_saved_search_errors': True,
'component_saved_searches': [{
"name": "error",
"element_type": "component",
"parameters": {}
}],
'relation_saved_searches': [],
'tags': ['mytag', 'mytag2']
}
]
}
def _mocked_saved_searches(*args, **kwargs):
raise Exception("Boom")
thrown = False
try:
self.run_check(config, mocks={
'_saved_searches': _mocked_saved_searches
})
except CheckException:
thrown = True
self.assertFalse(thrown)
self.assertEquals(self.service_checks[0]['status'], 2, "service check should have status AgentCheck.CRITICAL")
class TestTopologyDataIsClearedOnFailure(AgentCheckTest):
"""
Splunk topology check should clear all topology data when one or more saves searches fail.
"""
CHECK_NAME = 'splunk_topology'
def test_checks(self):
self.maxDiff = None
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'saved_searches_parallel': 1,
'component_saved_searches': [{
"name": "components",
"element_type": "component",
"parameters": {}
},{
"name": "components",
"element_type": "component",
"parameters": {}
},{
"name": "dispatch_error",
"element_type": "component",
"parameters": {}
}],
'relation_saved_searches': [],
'tags': ['mytag', 'mytag2']
}
]
}
thrown = False
try:
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session
})
except CheckException:
thrown = True
self.assertTrue(thrown, "Retrieving FATAL message from Splunk should throw.")
self.assertEquals(self.service_checks[0]['status'], 2, "service check should have status AgentCheck.CRITICAL")
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
instance = instances[0]
self.assertEqual(instance['instance'], {"type":"splunk","url":"http://localhost:8089"})
self.assertEqual(len(instance['components']), 0)
self.assertEqual(len(instance['relations']), 0)
class TestSplunkWildcardTopology(AgentCheckTest):
"""
Splunk check should work with component and relation data
"""
CHECK_NAME = 'splunk_topology'
def test_checks(self):
self.maxDiff = None
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'polling_interval_seconds': 0,
'component_saved_searches': [{
"match": "comp.*",
"parameters": {}
}],
'relation_saved_searches': [{
"match": "rela.*",
"parameters": {}
}],
'tags': ['mytag', 'mytag2']
}
]
}
data = {
'saved_searches': []
}
def _mocked_saved_searches(*args, **kwargs):
return data['saved_searches']
# Add the saved searches
data['saved_searches'] = ["components", "relations"]
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session
})
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
self.assertEqual(instances[0]['instance'], {"type":"splunk","url":"http://localhost:8089"})
self.assertEqual(len(instances[0]['components']), 2)
self.assertEquals(len(instances[0]['relations']), 1)
self.assertEquals(self.service_checks[0]['status'], 0, "service check should have status AgentCheck.OK")
# Remove the saved searches
data['saved_searches'] = []
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches
})
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
self.assertEqual(instances[0]['instance'], {"type":"splunk","url":"http://localhost:8089"})
self.assertEqual(len(instances[0]['components']), 0)
self.assertEquals(len(instances[0]['relations']), 0)
self.assertEquals(self.service_checks[0]['status'], 0, "service check should have status AgentCheck.OK")
class TestSplunkTopologyRespectParallelDispatches(AgentCheckTest):
CHECK_NAME = 'splunk_topology'
def test_checks(self):
self.maxDiff = None
saved_searches_parallel = 2
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'saved_searches_parallel': saved_searches_parallel,
'component_saved_searches': [
{"name": "savedsearch1", "element_type": "component", "parameters": {}},
{"name": "savedsearch2", "element_type": "component", "parameters": {}},
{"name": "savedsearch3", "element_type": "component", "parameters": {}}
],
'relation_saved_searches': [
{"name": "savedsearch4", "element_type": "relation", "parameters": {}},
{"name": "savedsearch5", "element_type": "relation", "parameters": {}}
]
}
]
}
self.expected_sid_increment = 1
def _mock_dispatch_and_await_search(instance, saved_searches):
self.assertLessEqual(len(saved_searches), saved_searches_parallel, "Did not respect the configured saved_searches_parallel setting, got value: %i" % len(saved_searches))
for saved_search in saved_searches:
result = saved_search.name
expected = "savedsearch%i" % self.expected_sid_increment
self.assertEquals(result, expected)
self.expected_sid_increment += 1
return True
self.run_check(config, mocks={
'_dispatch_and_await_search': _mock_dispatch_and_await_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session
})
class TestSplunkDefaults(AgentCheckTest):
CHECK_NAME = 'splunk_topology'
def test_default_parameters(self):
"""
when no default parameters are provided, the code should provide the parameters
"""
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'component_saved_searches': [{
"name": "components"
}],
'relation_saved_searches': [{
"name": "relations"
}]
}
]
}
expected_default_parameters = {'dispatch.now': True, 'force_dispatch': True}
def _mocked_auth_session_to_check_instance_config(instance):
for saved_search in instance.saved_searches.searches:
self.assertEqual(saved_search.parameters, expected_default_parameters, msg="Unexpected default parameters for saved search: %s" % saved_search.name)
return "sessionKey1"
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session_to_check_instance_config
})
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
def test_non_default_parameters(self):
"""
when non default parameters are provided, the code should respect them.
"""
config = {
'init_config': {
'default_parameters': {
'respect': 'me'
}
},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'component_saved_searches': [{
"name": "components"
}],
'relation_saved_searches': [{
"name": "relations"
}]
}
]
}
expected_default_parameters = {'respect': 'me'}
def _mocked_auth_session_to_check_instance_config(instance):
for saved_search in instance.saved_searches.searches:
self.assertEqual(saved_search.parameters, expected_default_parameters, msg="Unexpected non-default parameters for saved search: %s" % saved_search.name)
return "sessionKey1"
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session_to_check_instance_config
})
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
def test_overwrite_default_parameters(self):
"""
when default parameters are overwritten, the code should respect them.
"""
config = {
'init_config': {
'default_parameters': {
'default_should': 'be ignored'
}
},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'component_saved_searches': [{
"name": "components",
"parameters": {
"respect": "me"
}
}],
'relation_saved_searches': [{
"name": "relations",
"parameters": {
"respect": "me"
}
}]
}
]
}
expected_default_parameters = {'respect': 'me'}
def _mocked_auth_session_to_check_instance_config(instance):
for saved_search in instance.saved_searches.searches:
self.assertEqual(saved_search.parameters, expected_default_parameters, msg="Unexpected overwritten default parameters for saved search: %s" % saved_search.name)
return "sessionKey1"
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session_to_check_instance_config
})
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
class TestSplunkContinue(AgentCheckTest):
CHECK_NAME = 'splunk_topology'
def test_check_exception_continue(self):
"""
When 1 saved search fails with Check Exception, the code should continue and send topology.
"""
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'ignore_saved_search_errors': True,
'component_saved_searches': [
{"name": "components", "search_max_retry_count": 0, "parameters": {}},
{"name": "components12", "search_max_retry_count": 0, "parameters": {}}
],
'relation_saved_searches': []
}
]
}
def _mocked_check_exception_search(*args, **kwargs):
sid = args[0]
if sid == "components12":
raise CheckException("maximum retries reached for saved search " + str(sid))
return [json.loads(Fixtures.read_file("%s.json" % sid, sdk_dir=FIXTURE_DIR))]
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_check_exception_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session
})
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
# Even second saved search failed but topology reported from first saved search
self.assertEqual(len(instances[0]['components']), 2)
# Check if all components came from first saved search
self.assertEqual(instances[0]['components'][0]['externalId'], "vm_2_1")
self.assertEqual(instances[0]['components'][0]['type']['name'], "vm")
self.assertEqual(instances[0]['components'][1]['externalId'], "server_2")
self.assertEqual(instances[0]['components'][1]['type']['name'], "server")
self.assertEquals(len(instances[0]['relations']), 0)
# second saved search throws a check exception for maximum retries data and report a service check
self.assertEquals(self.service_checks[0]['status'], 1, "service check should have status AgentCheck.WARNING")
# check if still the check continued and finished
self.assertEqual(instances[0]["stop_snapshot"], True)
self.assertEqual(instances[0]["start_snapshot"], True)
def test_check_exception_false_continue(self):
"""
When 1 saved search fails with Check Exception, the code should break and clear the whole topology.
"""
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'ignore_saved_search_errors': False,
'component_saved_searches': [
{"name": "components", "search_max_retry_count": 0, "parameters": {}},
{"name": "components12", "search_max_retry_count": 0, "parameters": {}}
],
'relation_saved_searches': []
}
]
}
def _mocked_check_exception_search(*args, **kwargs):
sid = args[0]
if sid == "components12":
raise CheckException("maximum retries reached for saved search " + str(sid))
return [json.loads(Fixtures.read_file("%s.json" % sid, sdk_dir=FIXTURE_DIR))]
thrown = False
try:
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_check_exception_search,
'_saved_searches': _mocked_saved_searches,
'_auth_session': _mocked_auth_session
})
except Exception:
# Catch exception thrown from check as the ignore_saved_search_errors flag is False
thrown = True
self.assertTrue(thrown, "maximum retries reached for saved search components12")
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
# Even first saved search reported topology but not sent because the ignore_saved_search_errors flag was False
self.assertEqual(len(instances[0]['components']), 0)
self.assertEquals(len(instances[0]['relations']), 0)
# second saved search throws a check exception for maximum retries data and report a service check
self.assertEquals(self.service_checks[0]['status'], 2, "service check should have status AgentCheck.CRITICAL")
def test_check_exception_fail_count_continue(self):
"""
When both saved search fails with Check Exception, the code should continue and send topology.
"""
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
}
},
'ignore_saved_search_errors': True,
'component_saved_searches': [
{"name": "components", "search_max_retry_count": 0, "parameters": {}},
{"name": "components12", "search_max_retry_count": 0, "parameters": {}}
],
'relation_saved_searches': []
}
]
}
def _mocked_check_exception_search(*args, **kwargs):
sid = args[0]
if sid == "components12":
raise CheckException("maximum retries reached for saved search " + str(sid))
return [json.loads(Fixtures.read_file("%s.json" % sid, sdk_dir=FIXTURE_DIR))]
def _mocked_extract_components(*args, **kwargs):
return 2
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_check_exception_search,
'_saved_searches': _mocked_saved_searches,
'_extract_components': _mocked_extract_components,
'_auth_session': _mocked_auth_session
})
instance = self.check.get_topology_instances()
self.assertEqual(len(instance), 1)
# first saved search throws an exception for incomplete data and report a service check
self.assertEquals(self.service_checks[0]['status'], 1, "service check should have status AgentCheck.WARNING")
self.assertEquals(self.service_checks[0]['message'], "All result of saved search 'components' contained incomplete data")
# second saved search throws a check exception for maximum retries and report a service check
self.assertEquals(self.service_checks[1]['status'], 1, "service check should have status AgentCheck.WARNING")
self.assertEquals(self.service_checks[1]['message'], "maximum retries reached for saved search components12")
# Both saved search failed so there should be no components and relations
self.assertEqual(len(instance[0]['components']), 0)
self.assertEqual(len(instance[0]['relations']), 0)
# check if the check continued and finished
self.assertEqual(instance[0]["stop_snapshot"], True)
self.assertEqual(instance[0]["start_snapshot"], True)
class TestSplunkTokenBasedAuth(AgentCheckTest):
CHECK_NAME = 'splunk_topology'
def test_check_valid_initial_token(self):
"""
Splunk topology check should work with valid initial token
"""
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'token_auth': {
'name': "admin",
'initial_token': "dsfdgfhgjhkjuyr567uhfe345ythu7y6tre456sdx",
'audience': "search",
'renewal_days': 10
}
},
'component_saved_searches': [{
"name": "components",
"parameters": {}
}],
'relation_saved_searches': [],
'tags': ['mytag', 'mytag2']
}
]
}
def _mocked_token_auth_session(*args):
return False
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_token_auth_session': _mocked_token_auth_session
})
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
self.assertEqual(instances[0]['instance'], {"type":"splunk","url":"http://localhost:8089"})
self.assertEqual(instances[0]['components'][0], {
"externalId": u"vm_2_1",
"type": {"name": u"vm"},
"data": {
u"running": True,
u"_time": u"2017-03-06T14:55:54.000+00:00",
"label.label1Key": "label1Value",
"tags": ['result_tag1', 'mytag', 'mytag2']
}
})
self.assertEqual(instances[0]['components'][1], {
"externalId": u"server_2",
"type": {"name": u"server"},
"data": {
u"description": u"My important server 2",
u"_time": u"2017-03-06T14:55:54.000+00:00",
"label.label2Key": "label2Value",
"tags": ['result_tag2', 'mytag', 'mytag2']
}
})
self.assertEquals(instances[0]["start_snapshot"], True)
self.assertEquals(instances[0]["stop_snapshot"], True)
self.assertEquals(self.service_checks[0]['status'], 0, "service check should have status AgentCheck.OK")
def test_check_invalid_initial_token(self):
"""
Splunk check should not work with invalid initial token and stop the check
"""
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'token_auth': {
'name': "admin",
'initial_token': "dsfdgfhgjhkjuyr567uhfe345ythu7y6tre456sdx",
'audience': "search",
'renewal_days': 10
}
},
'component_saved_searches': [{
"name": "components",
"parameters": {}
}],
'relation_saved_searches': [],
'tags': ['mytag', 'mytag2']
}
]
}
def _mocked_token_auth_session(*args):
raise TokenExpiredException("Current in use authentication token is expired. Please provide a valid "
"token in the YAML and restart the Agent")
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_token_auth_session': _mocked_token_auth_session
})
msg = "Current in use authentication token is expired. Please provide a valid token in the YAML and restart " \
"the Agent"
# Invalid token should throw a service check with proper message
self.assertEquals(self.service_checks[0]['status'], 2, msg)
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
# there should be no topology as the check stopped while validating token
self.assertEqual(len(instances[0]['components']), 0)
def test_check_audience_param_not_set(self):
"""
Splunk topology check should fail and raise exception when audience param is not set
"""
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'token_auth': {
'name': "admin",
'token': "dsfdgfhgjhkjuyr567uhfe345ythu7y6tre456sdx"
},
},
'component_saved_searches': [{
"name": "components",
"parameters": {}
}],
'relation_saved_searches': [],
'tags': ['mytag', 'mytag2']
}
]
}
check = False
try:
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
})
except CheckException:
check = True
self.assertTrue(check, msg='Splunk topology instance missing "authentication.token_auth.audience" value')
def test_check_name_param_not_set(self):
"""
Splunk topology check should fail and raise exception when name param is not set
"""
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'token_auth': {
'audience': "admin",
'token': "dsfdgfhgjhkjuyr567uhfe345ythu7y6tre456sdx"
},
},
'component_saved_searches': [{
"name": "components",
"parameters": {}
}],
'relation_saved_searches': [],
'tags': ['mytag', 'mytag2']
}
]
}
check = False
try:
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
})
except CheckException:
check = True
self.assertTrue(check, msg='Splunk topology instance missing "authentication.token_auth.name" value')
def test_check_token_auth_preferred_over_basic_auth(self):
"""
Splunk topology check should prefer Token based authentication over Basic auth mechanism
"""
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
},
'token_auth': {
'name': "api-admin",
'initial_token': "dsfdgfhgjhkjuyr567uhfe345ythu7y6tre456sdx",
'audience': "admin",
'renewal_days': 10
}
},
'component_saved_searches': [{
"name": "components",
"parameters": {}
}],
'relation_saved_searches': [],
'tags': ['mytag', 'mytag2']
}
]
}
def _mocked_token_auth_session(*args):
return None
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_token_auth_session': _mocked_token_auth_session
})
instances = self.check.get_topology_instances()
self.assertEqual(len(instances), 1)
self.assertEqual(instances[0]['instance'], {"type":"splunk","url":"http://localhost:8089"})
self.assertEqual(instances[0]['components'][0], {
"externalId": u"vm_2_1",
"type": {"name": u"vm"},
"data": {
u"running": True,
u"_time": u"2017-03-06T14:55:54.000+00:00",
"label.label1Key": "label1Value",
"tags": ['result_tag1', 'mytag', 'mytag2']
}
})
self.assertEqual(instances[0]['components'][1], {
"externalId": u"server_2",
"type": {"name": u"server"},
"data": {
u"description": u"My important server 2",
u"_time": u"2017-03-06T14:55:54.000+00:00",
"label.label2Key": "label2Value",
"tags": ['result_tag2', 'mytag', 'mytag2']
}
})
self.assertEquals(instances[0]["start_snapshot"], True)
self.assertEquals(instances[0]["stop_snapshot"], True)
self.assertEquals(self.service_checks[0]['status'], 0, "service check should have status AgentCheck.OK")
# clear the in memory token
self.check.status.data.clear()
self.check.status.persist("splunk_topology")
def test_check_memory_token_expired(self):
"""
Splunk topology check should fail when memory token is expired itself.
"""
config = {
'init_config': {},
'instances': [
{
'url': 'http://localhost:8089',
'authentication': {
'basic_auth': {
'username': "admin",
'password': "admin"
},
'token_auth': {
'name': "api-admin",
'initial_token': "dsfdgfhgjhkjuyr567uhfe345ythu7y6tre456sdx",
'audience': "admin",
'renewal_days': 10
}
},
'component_saved_searches': [{
"name": "components",
"parameters": {}
}],
'relation_saved_searches': [],
'tags': ['mytag', 'mytag2']
}
]
}
self.load_check(config)
self.check.status.data['http://localhost:8089token'] = "dsvljbfovjsdvkj"
self.check.status.persist("splunk_topology")
def _mocked_token_auth_session(*args):
raise TokenExpiredException("Current in use authentication token is expired. Please provide a valid "
"token in the YAML and restart the Agent")
self.run_check(config, mocks={
'_dispatch_saved_search': _mocked_dispatch_saved_search,
'_search': _mocked_search,
'_saved_searches': _mocked_saved_searches,
'_token_auth_session': _mocked_token_auth_session
})
msg = "Current in use authentication token is expired. Please provide a valid token in the YAML and restart" \
" the Agent"
# Invalid token should throw a service check with proper message
self.assertEquals(self.service_checks[0]['status'], 2, msg)
# clear the in memory token
self.check.status.data.clear()
self.check.status.persist("splunk_topology")
| 37.496411
| 181
| 0.501487
| 5,744
| 67,906
| 5.666086
| 0.063719
| 0.059516
| 0.029773
| 0.025195
| 0.85184
| 0.83193
| 0.811498
| 0.785565
| 0.776532
| 0.76375
| 0
| 0.021985
| 0.382426
| 67,906
| 1,810
| 182
| 37.517127
| 0.754084
| 0.054119
| 0
| 0.736842
| 0
| 0
| 0.260969
| 0.053456
| 0
| 0
| 0
| 0
| 0.098428
| 1
| 0.038278
| false
| 0.018455
| 0.006152
| 0.006152
| 0.082023
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
f06959e9339af113920c8c9f542cef491b2a8866
| 72
|
py
|
Python
|
bmt/__init__.py
|
RichardBruskiewich/biolink-model-toolkit
|
f219289b6cf47a2817f5e1332111ffea92ac505d
|
[
"BSD-3-Clause"
] | 6
|
2020-09-28T18:50:53.000Z
|
2021-08-19T16:53:23.000Z
|
bmt/__init__.py
|
RichardBruskiewich/biolink-model-toolkit
|
f219289b6cf47a2817f5e1332111ffea92ac505d
|
[
"BSD-3-Clause"
] | 67
|
2020-02-09T12:06:28.000Z
|
2022-03-16T04:40:21.000Z
|
bmt/__init__.py
|
RichardBruskiewich/biolink-model-toolkit
|
f219289b6cf47a2817f5e1332111ffea92ac505d
|
[
"BSD-3-Clause"
] | 6
|
2020-02-19T17:40:50.000Z
|
2022-03-16T01:41:26.000Z
|
from bmt.toolkit import Toolkit
from bmt.toolkit import ToolkitGenerator
| 36
| 40
| 0.875
| 10
| 72
| 6.3
| 0.5
| 0.222222
| 0.444444
| 0.634921
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.097222
| 72
| 2
| 40
| 36
| 0.969231
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 0
| 0
|
0
| 7
|
b2c781777870997f0f27d475af1c3e35b778ff65
| 2,848
|
py
|
Python
|
preprocessing/delete_event_column.py
|
Elkoumy/ShareProm
|
8c7d586cb097cf7367fa3ccd82dd608a1ee470e2
|
[
"Apache-2.0"
] | 4
|
2019-12-05T15:19:30.000Z
|
2021-10-05T15:36:29.000Z
|
preprocessing/delete_event_column.py
|
Elkoumy/ShareProm
|
8c7d586cb097cf7367fa3ccd82dd608a1ee470e2
|
[
"Apache-2.0"
] | 1
|
2020-04-17T11:35:47.000Z
|
2020-04-17T11:35:47.000Z
|
preprocessing/delete_event_column.py
|
Elkoumy/ShareProm
|
8c7d586cb097cf7367fa3ccd82dd608a1ee470e2
|
[
"Apache-2.0"
] | 3
|
2019-12-19T17:01:00.000Z
|
2021-10-05T15:36:30.000Z
|
# -*- coding: utf-8 -*-
"""
Created on Thu Nov 21 11:38:25 2019
@author: Elkoumy
"""
import pandas as pd
#file = r'C:\Gamal Elkoumy\PhD\OneDrive - Tartu Ülikool\Secure MPC\Business Process Mining SourceCode\Datasets\BPI_Challenge_2017_MPC.csv'
#data = pd.read_csv(file)
#
#del data['Unnamed: 0']
#
#data.to_csv(file,index=0)
#
#file = r'C:\Gamal Elkoumy\PhD\OneDrive - Tartu Ülikool\Secure MPC\Business Process Mining SourceCode\Datasets\party_A_BPI_Challenge_2017_MPC.csv'
#data = pd.read_csv(file)
#
#del data['Unnamed: 0']
#
#data.to_csv(file,index=0)
#
#file = r'C:\Gamal Elkoumy\PhD\OneDrive - Tartu Ülikool\Secure MPC\Business Process Mining SourceCode\Datasets\party_B_BPI_Challenge_2017_MPC.csv'
#data = pd.read_csv(file)
#
#del data['Unnamed: 0']
#
#data.to_csv(file,index=0)
#
#
#
#file = r'C:\Gamal Elkoumy\PhD\OneDrive - Tartu Ülikool\Secure MPC\Business Process Mining SourceCode\Datasets\Hospital_log_MPC.csv'
#data = pd.read_csv(file)
#
#del data['Unnamed: 0']
#
#data.to_csv(file, index=0)
#
#file = r'C:\Gamal Elkoumy\PhD\OneDrive - Tartu Ülikool\Secure MPC\Business Process Mining SourceCode\Datasets\party_A_Hospital_log_MPC.csv'
#data = pd.read_csv(file)
#
#del data['Unnamed: 0']
#
#data.to_csv(file, index=0)
#
#file = r'C:\Gamal Elkoumy\PhD\OneDrive - Tartu Ülikool\Secure MPC\Business Process Mining SourceCode\Datasets\party_B_Hospital_log_MPC.csv'
#data = pd.read_csv(file)
#
#del data['Unnamed: 0']
#
#data.to_csv(file, index=0)
#
#
#
#file = r'C:\Gamal Elkoumy\PhD\OneDrive - Tartu Ülikool\Secure MPC\Business Process Mining SourceCode\Datasets\Road_Traffic_Fine_Management_Process_MPC.csv'
#data = pd.read_csv(file)
#
#del data['Unnamed: 0']
#
#data.to_csv(file, index=0)
#
#file = r'C:\Gamal Elkoumy\PhD\OneDrive - Tartu Ülikool\Secure MPC\Business Process Mining SourceCode\Datasets\party_A_Road_Traffic_Fine_Management_Process_MPC.csv'
#data = pd.read_csv(file)
#
#del data['Unnamed: 0']
#
#data.to_csv(file, index=0)
#
#file = r'C:\Gamal Elkoumy\PhD\OneDrive - Tartu Ülikool\Secure MPC\Business Process Mining SourceCode\Datasets\party_B_Road_Traffic_Fine_Management_Process_MPC.csv'
#data = pd.read_csv(file)
#
#del data['Unnamed: 0']
#
#data.to_csv(file, index=0)
file = r'C:\Gamal Elkoumy\PhD\OneDrive - Tartu Ülikool\Secure MPC\Business Process Mining SourceCode\Datasets\CreditRequirement_MPC.csv'
data = pd.read_csv(file)
del data['event']
data.to_csv(file, index=0)
file = r'C:\Gamal Elkoumy\PhD\OneDrive - Tartu Ülikool\Secure MPC\Business Process Mining SourceCode\Datasets\party_A_CreditRequirement_MPC.csv'
data = pd.read_csv(file)
del data['event']
data.to_csv(file, index=0)
file = r'C:\Gamal Elkoumy\PhD\OneDrive - Tartu Ülikool\Secure MPC\Business Process Mining SourceCode\Datasets\party_B_CreditRequirement_MPC.csv'
data = pd.read_csv(file)
del data['event']
data.to_csv(file, index=0)
| 29.360825
| 164
| 0.757725
| 460
| 2,848
| 4.532609
| 0.119565
| 0.080576
| 0.034532
| 0.063309
| 0.968345
| 0.968345
| 0.968345
| 0.968345
| 0.968345
| 0.968345
| 0
| 0.017941
| 0.099719
| 2,848
| 97
| 165
| 29.360825
| 0.795242
| 0.71559
| 0
| 0.692308
| 0
| 0.230769
| 0.554953
| 0.204885
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.076923
| 0
| 0.076923
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
b2f164c85b37728fa477c376d1ed55dfe6c2560f
| 4,077
|
py
|
Python
|
utils/backup_test.py
|
ngpjunior/Libera
|
4e51772028845e99c4eda7d0c11e77c35cf62207
|
[
"Apache-2.0"
] | 21
|
2019-12-09T06:30:51.000Z
|
2021-12-04T10:33:32.000Z
|
utils/backup_test.py
|
ngpjunior/Libera
|
4e51772028845e99c4eda7d0c11e77c35cf62207
|
[
"Apache-2.0"
] | 5
|
2021-02-16T16:30:37.000Z
|
2021-12-14T21:35:33.000Z
|
utils/backup_test.py
|
ngpjunior/Libera
|
4e51772028845e99c4eda7d0c11e77c35cf62207
|
[
"Apache-2.0"
] | 18
|
2020-02-14T05:40:17.000Z
|
2021-12-04T10:33:33.000Z
|
echo "*****************************"
echo "***** VIRTUAL NETWORK 1 *****"
echo "*****************************"
echo ""
echo ""
./ovxctl.py -n createNetwork tcp 192.168.255.1 10000 192.168.0.0 16
./ovxctl.py -n createSwitch 1 00:00:00:00:00:00:00:6b,00:00:00:00:00:00:00:6c,00:00:00:00:00:00:00:73,00:00:00:00:00:00:00:74
./ovxctl.py -n createSwitch 1 00:00:00:00:00:00:00:6d,00:00:00:00:00:00:00:6e,00:00:00:00:00:00:00:75,00:00:00:00:00:00:00:76
./ovxctl.py -n createSwitch 1 00:00:00:00:00:00:00:69,00:00:00:00:00:00:00:6a,00:00:00:00:00:00:00:6f,00:00:00:00:00:00:00:70,00:00:00:00:00:00:00:71,00:00:00:00:00:00:00:72,00:00:00:00:00:00:00:77,00:00:00:00:00:00:00:78,00:00:00:00:00:00:00:79,00:00:00:00:00:00:00:7a
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:73 1
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:73 2
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:74 1
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:74 2
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:75 1
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:75 2
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:76 1
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:76 2
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:77 1
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:77 2
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:78 1
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:78 2
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:79 1
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:79 2
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:7a 1
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:7a 2
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:6c 1
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:6e 2
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:69 1
./ovxctl.py -n createPort 1 00:00:00:00:00:00:00:6a 2
./ovxctl.py -n connectHost 1 00:a4:23:05:00:00:00:01 1 00:00:00:00:00:01
./ovxctl.py -n connectHost 1 00:a4:23:05:00:00:00:01 2 00:00:00:00:00:02
./ovxctl.py -n connectHost 1 00:a4:23:05:00:00:00:01 3 00:00:00:00:00:03
./ovxctl.py -n connectHost 1 00:a4:23:05:00:00:00:01 4 00:00:00:00:00:04
./ovxctl.py -n connectHost 1 00:a4:23:05:00:00:00:02 1 00:00:00:00:00:05
./ovxctl.py -n connectHost 1 00:a4:23:05:00:00:00:02 2 00:00:00:00:00:06
./ovxctl.py -n connectHost 1 00:a4:23:05:00:00:00:02 3 00:00:00:00:00:07
./ovxctl.py -n connectHost 1 00:a4:23:05:00:00:00:02 4 00:00:00:00:00:08
./ovxctl.py -n connectHost 1 00:a4:23:05:00:00:00:03 1 00:00:00:00:00:09
./ovxctl.py -n connectHost 1 00:a4:23:05:00:00:00:03 2 00:00:00:00:00:0a
./ovxctl.py -n connectHost 1 00:a4:23:05:00:00:00:03 3 00:00:00:00:00:0b
./ovxctl.py -n connectHost 1 00:a4:23:05:00:00:00:03 4 00:00:00:00:00:0c
./ovxctl.py -n connectHost 1 00:a4:23:05:00:00:00:03 5 00:00:00:00:00:0d
./ovxctl.py -n connectHost 1 00:a4:23:05:00:00:00:03 6 00:00:00:00:00:0e
./ovxctl.py -n connectHost 1 00:a4:23:05:00:00:00:03 7 00:00:00:00:00:0f
./ovxctl.py -n connectHost 1 00:a4:23:05:00:00:00:03 8 00:00:00:00:00:10
./ovxctl.py -n connectLink 1 00:a4:23:05:00:00:00:01 5 00:a4:23:05:00:00:00:03 9 spf 1
./ovxctl.py -n connectLink 1 00:a4:23:05:00:00:00:02 5 00:a4:23:05:00:00:00:03 10 spf 1
./ovxctl.py -n startNetwork 1
read a
echo "*****************************"
echo "*** ADD NEW PATH (P=200) ****"
echo "*****************************"
echo ""
echo ""
./ovxctl.py -n setLinkPath 1 1 00:00:00:00:00:00:00:6c/1-00:00:00:00:00:00:00:67/4,00:00:00:00:00:00:00:67/2-00:00:00:00:00:00:00:66/1,00:00:00:00:00:00:00:66/4-00:00:00:00:00:00:00:6a/2,00:00:00:00:00:00:00:6a/1-00:00:00:00:00:00:00:65/4,00:00:00:00:00:00:00:65/3-00:00:00:00:00:00:00:69/1 200
read a
echo "*****************************"
echo "*** ADD NEW ROUTE (P=200) ***"
echo "*****************************"
echo ""
echo ""
./ovxctl.py -n connectRoute 1 00:a4:23:05:00:00:00:03 2 9 00:00:00:00:00:00:00:77/8-00:00:00:00:00:00:00:70/3,00:00:00:00:00:00:00:70/2-00:00:00:00:00:00:00:6a/4,00:00:00:00:00:00:00:6a/5-00:00:00:00:00:00:00:71/2,00:00:00:00:00:00:00:71/1-00:00:00:00:00:00:00:69/5 200
| 59.086957
| 295
| 0.631101
| 1,046
| 4,077
| 2.459847
| 0.075526
| 0.687136
| 0.813836
| 0.795958
| 0.93665
| 0.92227
| 0.839098
| 0.828216
| 0.655655
| 0.598523
| 0
| 0.41694
| 0.102281
| 4,077
| 68
| 296
| 59.955882
| 0.286066
| 0
| 0
| 0.225806
| 0
| 0
| 0.065136
| 0.043424
| 0
| 0
| 0
| 0
| 0
| 0
| null | null | 0
| 0
| null | null | 0
| 0
| 0
| 0
| null | 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 10
|
b2faec88453c2011c992571e263f4b172e638412
| 43,102
|
py
|
Python
|
apliai/accounts/emails.py
|
manthanchauhan/apli_work
|
c3c4b3c9bd08195159e5cccc761fd8321033f799
|
[
"MIT"
] | null | null | null |
apliai/accounts/emails.py
|
manthanchauhan/apli_work
|
c3c4b3c9bd08195159e5cccc761fd8321033f799
|
[
"MIT"
] | 2
|
2021-04-30T20:43:55.000Z
|
2021-06-10T21:34:23.000Z
|
apliai/accounts/emails.py
|
manthanchauhan/apli_work
|
c3c4b3c9bd08195159e5cccc761fd8321033f799
|
[
"MIT"
] | 1
|
2020-02-26T13:15:03.000Z
|
2020-02-26T13:15:03.000Z
|
from django.core.mail import send_mail
from string import ascii_lowercase,ascii_uppercase
import string
def mail(s,r):
subject = 'Thank You For Contacting Us'
message=""
html_message = """
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml">
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
<!--[if !mso]><!-->
<meta http-equiv="X-UA-Compatible" content="IE=edge" />
<!--<![endif]-->
<meta name="viewport" content="width=device-width, initial-scale=1.0" />
<title></title>
<style type="text/css">
* {
-webkit-font-smoothing: antialiased;
}
body {
Margin: 0;
padding: 0;
min-width: 100%;
font-family: Arial, sans-serif;
-webkit-font-smoothing: antialiased;
mso-line-height-rule: exactly;
}
table {
border-spacing: 0;
color: #333333;
font-family: Arial, sans-serif;
}
img {
border: 0;
}
.wrapper {
width: 100%;
table-layout: fixed;
-webkit-text-size-adjust: 100%;
-ms-text-size-adjust: 100%;
}
.webkit {
max-width: 600px;
}
.outer {
Margin: 0 auto;
width: 100%;
max-width: 600px;
}
.full-width-image img {
width: 100%;
max-width: 600px;
height: auto;
}
.inner {
padding: 10px;
}
p {
Margin: 0;
padding-bottom: 10px;
}
.h1 {
font-size: 21px;
font-weight: bold;
Margin-top: 15px;
Margin-bottom: 5px;
font-family: Arial, sans-serif;
-webkit-font-smoothing: antialiased;
}
.h2 {
font-size: 18px;
font-weight: bold;
Margin-top: 10px;
Margin-bottom: 5px;
font-family: Arial, sans-serif;
-webkit-font-smoothing: antialiased;
}
.one-column .contents {
text-align: left;
font-family: Arial, sans-serif;
-webkit-font-smoothing: antialiased;
}
.one-column p {
font-size: 14px;
Margin-bottom: 10px;
font-family: Arial, sans-serif;
-webkit-font-smoothing: antialiased;
}
.two-column {
text-align: center;
font-size: 0;
}
.two-column .column {
width: 100%;
max-width: 300px;
display: inline-block;
vertical-align: top;
}
.contents {
width: 100%;
}
.two-column .contents {
font-size: 14px;
text-align: left;
}
.two-column img {
width: 100%;
max-width: 280px;
height: auto;
}
.two-column .text {
padding-top: 10px;
}
.three-column {
text-align: center;
font-size: 0;
padding-top: 10px;
padding-bottom: 10px;
}
.three-column .column {
width: 100%;
max-width: 200px;
display: inline-block;
vertical-align: top;
}
.three-column .contents {
font-size: 14px;
text-align: center;
}
.three-column img {
width: 100%;
max-width: 180px;
height: auto;
}
.three-column .text {
padding-top: 10px;
}
.img-align-vertical img {
display: inline-block;
vertical-align: middle;
}
@media only screen and (max-device-width: 480px) {
table[class=hide], img[class=hide], td[class=hide] {
display: none !important;
}
.contents1 {
width: 100%;
}
.contents1 {
width: 100%;
}
</style>
<!--[if (gte mso 9)|(IE)]>
<style type="text/css">
table {border-collapse: collapse !important;}
</style>
<![endif]-->
</head>
<body style="Margin:0;padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;min-width:100%;background-color:#f3f2f0;">
<center class="wrapper" style="width:100%;table-layout:fixed;-webkit-text-size-adjust:100%;-ms-text-size-adjust:100%;background-color:#f3f2f0;">
<table width="100%" cellpadding="0" cellspacing="0" border="0" style="background-color:#f3f2f0;" bgcolor="#f3f2f0;">
<tr>
<td width="100%"><div class="webkit" style="max-width:600px;Margin:0 auto;">
<!-- ======= start main body ======= -->
<table class="outer" align="center" cellpadding="0" cellspacing="0" border="0" style="border-spacing:0;Margin:0 auto;width:100%;max-width:600px;">
<tr>
<td style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;"><!-- ======= start header ======= -->
<table border="0" width="100%" cellpadding="0" cellspacing="0" >
<tr>
<td><table style="width:100%;" cellpadding="0" cellspacing="0" border="0">
<tbody>
<tr>
<td align="center"><center>
<table border="0" align="center" width="100%" cellpadding="0" cellspacing="0" style="Margin: 0 auto;">
<tbody>
<tr>
<td class="one-column" style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;" bgcolor="#FFFFFF"><!-- ======= start header ======= -->
<table cellpadding="0" cellspacing="0" border="0" width="100%" bgcolor="#f3f2f0">
<tr>
<td class="two-column" style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;text-align:left;font-size:0;" >
<div class="column" style="width:100%;max-width:80px;display:inline-block;vertical-align:top;">
<table class="contents" style="border-spacing:0; width:100%" >
<tr>
<td style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:5px;" align="left"><a href="#" target="_blank"><img src="https://apli-ai.herokuapp.com/static/apliai/img/apli-blue.png" alt="" width="60" height="60" style="border-width:0; max-width:60px;height:auto; display:block" align="left"/></a></td>
</tr>
</table>
</div>
<div class="column" style="width:100%;max-width:518px;display:inline-block;vertical-align:top;">
<table width="100%" style="border-spacing:0" cellpadding="0" cellspacing="0" border="0" >
<tr>
<td class="inner" style="padding-top:0px;padding-bottom:10px; padding-right:10px;padding-left:10px;"><table class="contents" style="border-spacing:0; width:100%" cellpadding="0" cellspacing="0" border="0">
<tr>
<td align="left" valign="top"> </td>
</tr>
</table></td>
</tr>
</table>
</div>
</td>
</tr>
<tr>
<td> </td>
</tr>
</table></td>
</tr>
</tbody>
</table>
</center></td>
</tr>
</tbody>
</table></td>
</tr>
</table>
<!-- ======= end header ======= -->
<!-- ======= start hero image ======= --><!-- ======= end hero image ======= -->
<!-- ======= start hero article ======= -->
<table class="one-column" border="0" cellpadding="0" cellspacing="0" width="100%" style="border-spacing:0; border-left:1px solid #e8e7e5; border-right:1px solid #e8e7e5; border-bottom:1px solid #e8e7e5; border-top:1px solid #e8e7e5" bgcolor="#FFFFFF">
<tr>
<td align="left" style="padding:50px 50px 50px 50px"><p style="color:#262626; font-size:24px; text-align:left; font-family: Verdana, Geneva, sans-serif"><strong>Thank You</strong> 😊,</p>
<p style="color:#000000; font-size:16px; text-align:left; font-family: Verdana, Geneva, sans-serif; line-height:22px ">Thanks for contacting us!.<br/> We will be in touch with you shortly.<br />
<br />
<br />
</p>
<table border="0" align="left" cellpadding="0" cellspacing="0" style="Margin:0 auto;">
<tbody>
<tr>
<td align="center"><table border="0" cellpadding="0" cellspacing="0" style="Margin:0 auto;">
<tr>
<td width="250" height="60" align="center" bgcolor="#752873" style="-moz-border-radius: 30px; -webkit-border-radius: 30px; border-radius: 30px;"><a href="https://apli-ai.herokuapp.com" style="width:250; display:block; text-decoration:none; border:0; text-align:center; font-weight:bold;font-size:18px; font-family: Arial, sans-serif; color: #ffffff" class="button_link">Back to Apli.Ai<img src="https://gallery.mailchimp.com/fdcaf86ecc5056741eb5cbc18/images/ac08f159-2260-46e0-a7f0-d196c81eb6cc.jpg" width="32" height="17" style="padding-top:5px" alt="" border="0"/></a></td>
</tr>
</table></td>
</tr>
</tbody>
</table>
<p style="color:#000000; font-size:16px; text-align:left; font-family: Verdana, Geneva, sans-serif; line-height:22px "><br />
<br />
<br />
<br />
<br />
Best Regards, <br />
Team Apli</p></td>
</tr>
</table>
<!-- ======= end hero article ======= -->
<!-- ======= start footer ======= -->
<table cellpadding="0" cellspacing="0" border="0" width="100%">
<tr>
<td height="30"> </td>
</tr>
<tr>
<td class="two-column" style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;text-align:center;font-size:0;">
<div class="column" style="width:100%;max-width:350px;display:inline-block;vertical-align:top;">
<table class="contents" style="border-spacing:0; width:100%">
<tr>
<td width="39%" align="right" style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;"><a href="#" target="_blank"><img src="https://apli-ai.herokuapp.com/static/apliai/img/apli-blue.png" alt="" width="59" height="59" style="border-width:0; max-width:59px;height:auto; display:block; padding-right:20px" /></a></td>
<td width="61%" align="left" valign="middle" style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;"><p style="color:#787777; font-size:13px; text-align:left; font-family: Verdana, Geneva, sans-serif"> Apli.ai © 2018<br />
</p></td>
</tr>
</table>
</div>
<div class="column" style="width:100%;max-width:248px;display:inline-block;vertical-align:top;">
<table width="100%" style="border-spacing:0">
<tr>
<td class="inner" style="padding-top:0px;padding-bottom:10px; padding-right:10px;padding-left:10px;"><table class="contents" style="border-spacing:0; width:100%">
<tr>
<td width="32%" align="center" valign="top" style="padding-top:10px"><table width="150" border="0" cellspacing="0" cellpadding="0">
<tr>
<td width="33" align="center"><a href="https://www.linkedin.com/company/apli-ai/about/" target="_blank"><img src="https://gallery.mailchimp.com/fdcaf86ecc5056741eb5cbc18/images/8eaae33a-c54c-4537-9823-1bc52d85b3f8.jpg" alt="linkedin" width="36" height="36" border="0" style="border-width:0; max-width:36px;height:auto; display:block; max-height:36px"/></a></td>
</tr>
</table></td>
</tr>
</table></td>
</tr>
</table>
</div>
</td>
</tr>
<tr>
<td height="30"> </td>
</tr>
</table>
<!-- ======= end footer ======= --></td>
</tr>
</table>
</div></td>
</tr>
</table>
</center>
</body>
</html>
"""
recipient_list = [r,]
send_mail(subject, message,s, recipient_list,fail_silently=False,html_message=html_message)
def mail2(cn,ce,en,eno,u_type):
subject = 'Contacted Company via Website'
message="Company Name: "+" "+cn+"\n"+"CompanyEmail: "+" "+ce+"\n"+"Employee Name: "+" "+en+"\nEmployee Number: "+ " "+eno+"\n"+"User_type"+" : "+u_type
recipient_list = ['aplidotaiintern@gmail.com',]
send_mail(subject, message,'aplidotaiintern@gmail.com', recipient_list,fail_silently=False,)
def mail3(r):
subject = 'Welcome to Apli.ai'
message=""
html_message = """
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml">
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
<!--[if !mso]><!-->
<meta http-equiv="X-UA-Compatible" content="IE=edge" />
<!--<![endif]-->
<meta name="viewport" content="width=device-width, initial-scale=1.0" />
<title></title>
<style type="text/css">
* {
-webkit-font-smoothing: antialiased;
}
body {
Margin: 0;
padding: 0;
min-width: 100%;
font-family: Arial, sans-serif;
-webkit-font-smoothing: antialiased;
mso-line-height-rule: exactly;
}
table {
border-spacing: 0;
color: #333333;
font-family: Arial, sans-serif;
}
img {
border: 0;
}
.wrapper {
width: 100%;
table-layout: fixed;
-webkit-text-size-adjust: 100%;
-ms-text-size-adjust: 100%;
}
.webkit {
max-width: 600px;
}
.outer {
Margin: 0 auto;
width: 100%;
max-width: 600px;
}
.full-width-image img {
width: 100%;
max-width: 600px;
height: auto;
}
.inner {
padding: 10px;
}
p {
Margin: 0;
padding-bottom: 10px;
}
.h1 {
font-size: 21px;
font-weight: bold;
Margin-top: 15px;
Margin-bottom: 5px;
font-family: Arial, sans-serif;
-webkit-font-smoothing: antialiased;
}
.h2 {
font-size: 18px;
font-weight: bold;
Margin-top: 10px;
Margin-bottom: 5px;
font-family: Arial, sans-serif;
-webkit-font-smoothing: antialiased;
}
.one-column .contents {
text-align: left;
font-family: Arial, sans-serif;
-webkit-font-smoothing: antialiased;
}
.one-column p {
font-size: 14px;
Margin-bottom: 10px;
font-family: Arial, sans-serif;
-webkit-font-smoothing: antialiased;
}
.two-column {
text-align: center;
font-size: 0;
}
.two-column .column {
width: 100%;
max-width: 300px;
display: inline-block;
vertical-align: top;
}
.contents {
width: 100%;
}
.two-column .contents {
font-size: 14px;
text-align: left;
}
.two-column img {
width: 100%;
max-width: 280px;
height: auto;
}
.two-column .text {
padding-top: 10px;
}
.three-column {
text-align: center;
font-size: 0;
padding-top: 10px;
padding-bottom: 10px;
}
.three-column .column {
width: 100%;
max-width: 200px;
display: inline-block;
vertical-align: top;
}
.three-column .contents {
font-size: 14px;
text-align: center;
}
.three-column img {
width: 100%;
max-width: 180px;
height: auto;
}
.three-column .text {
padding-top: 10px;
}
.img-align-vertical img {
display: inline-block;
vertical-align: middle;
}
@media only screen and (max-device-width: 480px) {
table[class=hide], img[class=hide], td[class=hide] {
display: none !important;
}
.contents1 {
width: 100%;
}
.contents1 {
width: 100%;
}
.center {
display: block;
margin-left: auto;
margin-right: auto;
height: 20px
width: 20px;
}
</style>
<!--[if (gte mso 9)|(IE)]>
<style type="text/css">
table {border-collapse: collapse !important;}
</style>
<![endif]-->
</head>
<body style="Margin:0;padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;min-width:100%;background-color:#f3f2f0;">
<center class="wrapper" style="width:100%;table-layout:fixed;-webkit-text-size-adjust:100%;-ms-text-size-adjust:100%;background-color:#f3f2f0;">
<table width="100%" cellpadding="0" cellspacing="0" border="0" style="background-color:#f3f2f0;" bgcolor="#f3f2f0;">
<tr>
<td width="100%"><div class="webkit" style="max-width:600px;Margin:0 auto;">
<!-- ======= start main body ======= -->
<table class="outer" align="center" cellpadding="0" cellspacing="0" border="0" style="border-spacing:0;Margin:0 auto;width:100%;max-width:600px;">
<tr>
<td style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;"><!-- ======= start header ======= -->
<table border="0" width="100%" cellpadding="0" cellspacing="0" >
<tr>
<td><table style="width:100%;" cellpadding="0" cellspacing="0" border="0">
<tbody>
<tr>
<td align="center"><center>
<table border="0" align="center" width="100%" cellpadding="0" cellspacing="0" style="Margin: 0 auto;">
<tbody>
<tr>
<td class="one-column" style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;" bgcolor="#FFFFFF"><!-- ======= start header ======= -->
<table cellpadding="0" cellspacing="0" border="0" width="100%" bgcolor="#f3f2f0">
<tr>
<td class="two-column" style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;text-align:left;font-size:0;" >
<div class="column" style="width:100%;max-width:80px;display:inline-block;vertical-align:top;">
<table class="contents" style="border-spacing:0; width:100%" >
<tr>
<td style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:5px;" align="left"><a href="https://apli-ai.herokuapp.com/" target="_blank"><img src="https://apli-ai.herokuapp.com/static/apliai/img/apli-blue.png" alt="" width="60" height="60" style="border-width:0; max-width:60px;height:auto; display:block" align="left"/></a></td>
</tr>
</table>
</div>
<div class="column" style="width:100%;max-width:518px;display:inline-block;vertical-align:top;">
<table width="100%" style="border-spacing:0" cellpadding="0" cellspacing="0" border="0" >
<tr>
<td class="inner" style="padding-top:0px;padding-bottom:10px; padding-right:10px;padding-left:10px;"><table class="contents" style="border-spacing:0; width:100%" cellpadding="0" cellspacing="0" border="0">
<tr>
<td align="left" valign="top"> </td>
</tr>
</table></td>
</tr>
</table>
</div>
</td>
</tr>
<tr>
<td> </td>
</tr>
</table></td>
</tr>
</tbody>
</table>
</center></td>
</tr>
</tbody>
</table></td>
</tr>
</table>
<!-- ======= end header ======= -->
<!-- ======= start hero image ======= --><!-- ======= end hero image ======= -->
<!-- ======= start hero article ======= -->
<table class="one-column" border="0" cellpadding="0" cellspacing="0" width="100%" style="border-spacing:0; border-left:1px solid #e8e7e5; border-right:1px solid #e8e7e5; border-bottom:1px solid #e8e7e5; border-top:1px solid #e8e7e5" bgcolor="#FFFFFF">
<tr>
<td align="left" style="padding:50px 50px 50px 50px"><p style="color:#262626; font-size:24px; text-align:left; font-family: Verdana, Geneva, sans-serif"><strong>Registration Complete</strong><img src="https://png.pngtree.com/element_our/sm/20180515/sm_5afb099d307d3.jpg" alt="Paris" class="center" align="middle" height=100 width=100></p>
<p style="color:#000000; font-size:16px; text-align:left; font-family: Verdana, Geneva, sans-serif; line-height:22px "><b>Welcome to Apli.ai! We are glad to have you here with us!</b><br>You can start recruiting by using our recruitment platform. Please, proceed to the login page<br />
<br />
<br />
</p>
<table border="0" align="left" cellpadding="0" cellspacing="0" style="Margin:0 auto;">
<tbody>
<tr>
<td align="center"><table border="0" cellpadding="0" cellspacing="0" style="Margin:0 auto;">
<tr>
<td width="250" height="60" align="center" bgcolor="#752873" style="-moz-border-radius: 30px; -webkit-border-radius: 30px; border-radius: 30px;"><a href="https://apli-ai.herokuapp.com/accounts/login" style="width:250; display:block; text-decoration:none; border:0; text-align:center; font-weight:bold;font-size:18px; font-family: Arial, sans-serif; color: #ffffff" class="button_link">Log Me In<img src="https://gallery.mailchimp.com/fdcaf86ecc5056741eb5cbc18/images/ac08f159-2260-46e0-a7f0-d196c81eb6cc.jpg" width="32" height="17" style="padding-top:5px" alt="" border="0"/></a></td>
</tr>
</table></td>
</tr>
</tbody>
</table>
<p style="color:#000000; font-size:16px; text-align:left; font-family: Verdana, Geneva, sans-serif; line-height:22px "><br />
<br />
<br />
<br />
<br />
Best Regards, <br />
Team Apli</p></td>
</tr>
</table>
<!-- ======= end hero article ======= -->
<!-- ======= start footer ======= -->
<table cellpadding="0" cellspacing="0" border="0" width="100%">
<tr>
<td height="30"> </td>
</tr>
<tr>
<td class="two-column" style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;text-align:center;font-size:0;">
<div class="column" style="width:100%;max-width:350px;display:inline-block;vertical-align:top;">
<table class="contents" style="border-spacing:0; width:100%">
<tr>
<td width="39%" align="right" style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;"><a href="#" target="_blank"><img src="https://apli-ai.herokuapp.com/static/apliai/img/apli-blue.png" alt="" width="59" height="59" style="border-width:0; max-width:59px;height:auto; display:block; padding-right:20px" /></a></td>
<td width="61%" align="left" valign="middle" style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;"><p style="color:#787777; font-size:13px; text-align:left; font-family: Verdana, Geneva, sans-serif"> Apli.ai © 2019<br />
</p></td>
</tr>
</table>
</div>
<div class="column" style="width:100%;max-width:248px;display:inline-block;vertical-align:top;">
<table width="100%" style="border-spacing:0">
<tr>
<td class="inner" style="padding-top:0px;padding-bottom:10px; padding-right:10px;padding-left:10px;"><table class="contents" style="border-spacing:0; width:100%">
<tr>
<td width="32%" align="center" valign="top" style="padding-top:10px"><table width="150" border="0" cellspacing="0" cellpadding="0">
<tr>
<!--<td width="33" align="center"><a href="#" target="_blank"><img src="https://gallery.mailchimp.com/fdcaf86ecc5056741eb5cbc18/images/87d1ec7d-041a-4cd2-99c4-6e76b358e9d6.jpg" alt="facebook" width="36" height="36" border="0" style="border-width:0; max-width:36px;height:auto; display:block; max-height:36px"/></a></td>
<td width="34" align="center"><a href="#" target="_blank"><img src="https://gallery.mailchimp.com/fdcaf86ecc5056741eb5cbc18/images/036c2fa3-4460-4a3f-ac1e-d3ebc24f3b71.jpg" alt="twitter" width="36" height="36" border="0" style="border-width:0; max-width:36px;height:auto; display:block; max-height:36px"/></a></td> -->
<td width="33" align="center"><a href="https://www.linkedin.com/company/apli-ai" target="_blank"><img src="https://gallery.mailchimp.com/fdcaf86ecc5056741eb5cbc18/images/8eaae33a-c54c-4537-9823-1bc52d85b3f8.jpg" alt="linkedin" width="36" height="36" border="0" style="border-width:0; max-width:36px;height:auto; display:block; max-height:36px"/></a></td>
</tr>
</table></td>
</tr>
</table></td>
</tr>
</table>
</div>
</td>
</tr>
<tr>
<td height="30"> </td>
</tr>
</table>
<!-- ======= end footer ======= --></td>
</tr>
</table>
</div></td>
</tr>
</table>
</center>
</body>
</html>
"""
recipient_list = [r,]
send_mail(subject, message,'aplidotaiintern@gmail.com', recipient_list,fail_silently=False,html_message=html_message)
def fmail(umail):
subject = 'Password Reset Request'
pass_phrase = 'E7rtQhHyMPriyam'
used = {' ', '\n'}
key = []
for c in pass_phrase.lower() + ascii_lowercase:
if c not in used:
key.append(c)
used.add(c)
key = ''.join(key)
encode = {u: v for u, v in zip(ascii_lowercase, key)}
encmail=''.join([encode.get(c, c) for c in umail.lower()])
message="http://127.0.0.1:8000/accounts/reset_confirm/"+encmail
html_message1="""
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml">
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
<!--[if !mso]><!-->
<meta http-equiv="X-UA-Compatible" content="IE=edge" />
<!--<![endif]-->
<meta name="viewport" content="width=device-width, initial-scale=1.0" />
<title></title>
<style type="text/css">
* {{-webkit-font-smoothing: antialiased;}}
body {{
Margin: 0;
padding: 0;
min-width: 100%;
font-family: Arial, sans-serif;
-webkit-font-smoothing: antialiased;
mso-line-height-rule: exactly;
}}
table {{
border-spacing: 0;
color: #333333;
font-family: Arial, sans-serif;
}}
img{{
border: 0;
}}
.wrapper {{
width: 100%;
table-layout: fixed;
-webkit-text-size-adjust: 100%;
-ms-text-size-adjust: 100%;
}}
.webkit {{
max-width: 600px;
}}
.outer {{
Margin: 0 auto;
width: 100%;
max-width: 600px;
}}
.full-width-image img {{
width: 100%;
max-width: 600px;
height: auto;
}}
.inner {{
padding: 10px;
}}
p {{
Margin: 0;
padding-bottom: 10px;
}}
.h1 {{
font-size: 21px;
font-weight: bold;
Margin-top: 15px;
Margin-bottom: 5px;
font-family: Arial, sans-serif;
-webkit-font-smoothing: antialiased;
}}
.h2 {{
font-size: 18px;
font-weight: bold;
Margin-top: 10px;
Margin-bottom: 5px;
font-family: Arial, sans-serif;
-webkit-font-smoothing: antialiased;
}}
.one-column .contents {{
text-align: left;
font-family: Arial, sans-serif;
-webkit-font-smoothing: antialiased;
}}
.one-column p {{
font-size: 14px;
Margin-bottom: 10px;
font-family: Arial, sans-serif;
-webkit-font-smoothing: antialiased;
}}
.two-column {{
text-align: center;
font-size: 0;
}}
.two-column .column {{
width: 100%;
max-width: 300px;
display: inline-block;
vertical-align: top;
}}
.contents {{
width: 100%;
}}
.two-column .contents {{
font-size: 14px;
text-align: left;
}}
.two-column img {{
width: 100%;
max-width: 280px;
height: auto;
}}
.two-column .text {{
padding-top: 10px;
}}
.three-column {{
text-align: center;
font-size: 0;
padding-top: 10px;
padding-bottom: 10px;
}}
.three-column .column {{
width: 100%;
max-width: 200px;
display: inline-block;
vertical-align: top;
}}
.three-column .contents {{
font-size: 14px;
text-align: center;
}}
.three-column img {{
width: 100%;
max-width: 180px;
height: auto;
}}
.three-column .text {{
padding-top: 10px;
}}
.img-align-vertical img {{
display: inline-block;
vertical-align: middle;
}}
@media only screen and (max-device-width: 480px) {{
table[class=hide], img[class=hide], td[class=hide] {{
display: none !important;
}}
.contents1 {{
width: 100%;
}}
.contents1 {{
width: 100%;
}}
.center {{
display: block;
margin-left: auto;
right: 30px;
height: 20px
width: 20px;
}}
</style>
</head>
<body style="Margin:0;padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;min-width:100%;background-color:#f3f2f0;">
<center class="wrapper" style="width:100%;table-layout:fixed;-webkit-text-size-adjust:100%;-ms-text-size-adjust:100%;background-color:#f3f2f0;">
<table width="100%" cellpadding="0" cellspacing="0" border="0" style="background-color:#f3f2f0;" bgcolor="#f3f2f0;">
<tr>
<td width="100%"><div class="webkit" style="max-width:600px;Margin:0 auto;">
<!-- ======= start main body ======= -->
<table class="outer" align="center" cellpadding="0" cellspacing="0" border="0" style="border-spacing:0;Margin:0 auto;width:100%;max-width:600px;">
<tr>
<td style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;"><!-- ======= start header ======= -->
<table border="0" width="100%" cellpadding="0" cellspacing="0" >
<tr>
<td><table style="width:100%;" cellpadding="0" cellspacing="0" border="0">
<tbody>
<tr>
<td align="center"><center>
<table border="0" align="center" width="100%" cellpadding="0" cellspacing="0" style="Margin: 0 auto;">
<tbody>
<tr>
<td class="one-column" style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;" bgcolor="#FFFFFF"><!-- ======= start header ======= -->
<table cellpadding="0" cellspacing="0" border="0" width="100%" bgcolor="#f3f2f0">
<tr>
<td class="two-column" style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;text-align:left;font-size:0;" >
<div class="column" style="width:100%;max-width:80px;display:inline-block;vertical-align:top;">
<table class="contents" style="border-spacing:0; width:100%" >
<tr>
<td style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:5px;" align="left"><a href="https://apli-ai.herokuapp.com/" target="_blank"><img src="https://apli-ai.herokuapp.com/static/apliai/img/apli-blue.png" alt="" width="60" height="60" style="border-width:0; max-width:60px;height:auto; display:block" align="left"/></a></td>
</tr>
</table>
</div>
<div class="column" style="width:100%;max-width:518px;display:inline-block;vertical-align:top;">
<table width="100%" style="border-spacing:0" cellpadding="0" cellspacing="0" border="0" >
<tr>
<td class="inner" style="padding-top:0px;padding-bottom:10px; padding-right:10px;padding-left:10px;"><table class="contents" style="border-spacing:0; width:100%" cellpadding="0" cellspacing="0" border="0">
<tr>
<td align="left" valign="top"> </td>
</tr>
</table></td>
</tr>
</table>
</div>
</td>
</tr>
<tr>
<td> </td>
</tr>
</table></td>
</tr>
</tbody>
</table>
</center></td>
</tr>
</tbody>
</table></td>
</tr>
</table>
<!-- ======= end header ======= -->
<!-- ======= start hero image ======= --><!-- ======= end hero image ======= -->
<!-- ======= start hero article ======= -->
<table class="one-column" border="0" cellpadding="0" cellspacing="0" width="100%" style="border-spacing:0; border-left:1px solid #e8e7e5; border-right:1px solid #e8e7e5; border-bottom:1px solid #e8e7e5; border-top:1px solid #e8e7e5" bgcolor="#FFFFFF">
<tr>
<td align="left" style="padding:50px 50px 50px 50px"><p style="color:#262626; font-size:24px; text-align:left; font-family: Verdana, Geneva, sans-serif"><img src="https://pngimg.com/uploads/exclamation_mark/exclamation_mark_PNG76.png" alt="successful" class="center" align="middle" height=45 width=45 style="top: 40px"><strong> Reset Password</strong></p>
<p style="color:#000000; font-size:16px; text-align:left; font-family: Verdana, Geneva, sans-serif; line-height:22px "><b>Welcome to Apli.ai!</b><br>Please, Click on the link below to reset your password.<br />
<br />
<br />
</p>
<table border="0" align="left" cellpadding="0" cellspacing="0" style="Margin:0 auto;">
<tbody>
<tr>
<td align="center"><table border="0" cellpadding="0" cellspacing="0" style="Margin:0 auto;">
<tr>
<td width="250" height="60" align="center" bgcolor="#752873" style="-moz-border-radius: 30px; -webkit-border-radius: 30px; border-radius: 30px;"><a href="http://127.0.0.1:8000/accounts/reset_confirm/{0}" style="width:250; display:block; text-decoration:none; border:0; text-align:center; font-weight:bold;font-size:18px; font-family: Arial, sans-serif; color: #ffffff" class="button_link">Reset Password<img src="https://gallery.mailchimp.com/fdcaf86ecc5056741eb5cbc18/images/ac08f159-2260-46e0-a7f0-d196c81eb6cc.jpg" width="32" height="17" style="padding-top:5px" alt="" border="0"/></a></td>
</tr>
</table></td>
</tr>
</tbody>
</table>
<p style="color:#000000; font-size:16px; text-align:left; font-family: Verdana, Geneva, sans-serif; line-height:22px "><br />
<br />
<br />
<br />
<br />
Best Regards, <br />
Team Apli</p></td>
</tr>
</table>
<!-- ======= end hero article ======= -->
<!-- ======= start footer ======= -->
<table cellpadding="0" cellspacing="0" border="0" width="100%">
<tr>
<td height="30"> </td>
</tr>
<tr>
<td class="two-column" style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;text-align:center;font-size:0;">
<div class="column" style="width:100%;max-width:350px;display:inline-block;vertical-align:top;">
<table class="contents" style="border-spacing:0; width:100%">
<tr>
<td width="39%" align="right" style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;"><a href="#" target="_blank"><img src="https://apli-ai.herokuapp.com/static/apliai/img/apli-blue.png" alt="" width="59" height="59" style="border-width:0; max-width:59px;height:auto; display:block; padding-right:20px" /></a></td>
<td width="61%" align="left" valign="middle" style="padding-top:0;padding-bottom:0;padding-right:0;padding-left:0;"><p style="color:#787777; font-size:13px; text-align:left; font-family: Verdana, Geneva, sans-serif"> Apli.ai © 2019<br />
</p></td>
</tr>
</table>
</div>
<div class="column" style="width:100%;max-width:248px;display:inline-block;vertical-align:top;">
<table width="100%" style="border-spacing:0">
<tr>
<td class="inner" style="padding-top:0px;padding-bottom:10px; padding-right:10px;padding-left:10px;"><table class="contents" style="border-spacing:0; width:100%">
<tr>
<td width="32%" align="center" valign="top" style="padding-top:10px"><table width="150" border="0" cellspacing="0" cellpadding="0">
<tr>
<!--<td width="33" align="center"><a href="#" target="_blank"><img src="https://gallery.mailchimp.com/fdcaf86ecc5056741eb5cbc18/images/87d1ec7d-041a-4cd2-99c4-6e76b358e9d6.jpg" alt="facebook" width="36" height="36" border="0" style="border-width:0; max-width:36px;height:auto; display:block; max-height:36px"/></a></td>
<td width="34" align="center"><a href="#" target="_blank"><img src="https://gallery.mailchimp.com/fdcaf86ecc5056741eb5cbc18/images/036c2fa3-4460-4a3f-ac1e-d3ebc24f3b71.jpg" alt="twitter" width="36" height="36" border="0" style="border-width:0; max-width:36px;height:auto; display:block; max-height:36px"/></a></td>-->
<td width="33" align="center"><a href="https://www.linkedin.com/company/apli-ai" target="_blank"><img src="https://gallery.mailchimp.com/fdcaf86ecc5056741eb5cbc18/images/8eaae33a-c54c-4537-9823-1bc52d85b3f8.jpg" alt="linkedin" width="36" height="36" border="0" style="border-width:0; max-width:36px;height:auto; display:block; max-height:36px"/></a></td>
</tr>
</table></td>
</tr>
</table></td>
</tr>
</table>
</div>
</td>
</tr>
<tr>
<td height="30"> </td>
</tr>
</table>
<!-- ======= end footer ======= --></td>
</tr>
</table>
</div></td>
</tr>
</table>
</center>
</body>
</html>
"""
html_message=html_message1.format(encmail)
recipient_list = [umail,]
send_mail(subject, message,'aplidotaiintern@gmail.com', recipient_list,html_message=html_message,fail_silently=False,)
| 45.755839
| 628
| 0.49471
| 4,653
| 43,102
| 4.56974
| 0.076725
| 0.036495
| 0.017777
| 0.040634
| 0.943235
| 0.938579
| 0.938579
| 0.938579
| 0.938579
| 0.932653
| 0
| 0.063859
| 0.336226
| 43,102
| 942
| 629
| 45.755839
| 0.679343
| 0
| 0
| 0.851606
| 0
| 0.117386
| 0.969724
| 0.185718
| 0.001107
| 0
| 0
| 0
| 0
| 1
| 0.00443
| false
| 0.006645
| 0.008859
| 0
| 0.013289
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
e8dd3b0fa5390d0f2e1f637d29a44634afd7c33c
| 125,386
|
py
|
Python
|
pynos/versions/base/yang/brocade_ip_policy.py
|
bdeetz/pynos
|
bd8a34e98f322de3fc06750827d8bbc3a0c00380
|
[
"Apache-2.0"
] | 12
|
2015-09-21T23:56:09.000Z
|
2018-03-30T04:35:32.000Z
|
pynos/versions/base/yang/brocade_ip_policy.py
|
bdeetz/pynos
|
bd8a34e98f322de3fc06750827d8bbc3a0c00380
|
[
"Apache-2.0"
] | 10
|
2016-09-15T19:03:27.000Z
|
2017-07-17T23:38:01.000Z
|
pynos/versions/base/yang/brocade_ip_policy.py
|
bdeetz/pynos
|
bd8a34e98f322de3fc06750827d8bbc3a0c00380
|
[
"Apache-2.0"
] | 6
|
2015-08-14T08:05:23.000Z
|
2022-02-03T15:33:54.000Z
|
#!/usr/bin/env python
import xml.etree.ElementTree as ET
class brocade_ip_policy(object):
"""Auto generated class.
"""
def __init__(self, **kwargs):
self._callback = kwargs.pop('callback')
def hide_routemap_holder_route_map_name(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
name = ET.SubElement(route_map, "name")
name.text = kwargs.pop('name')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_action_rm(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
action_rm = ET.SubElement(route_map, "action-rm")
action_rm.text = kwargs.pop('action_rm')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_instance(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance = ET.SubElement(route_map, "instance")
instance.text = kwargs.pop('instance')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_ipv6_address_ipv6_prefix_list_rmm(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
ipv6 = ET.SubElement(match, "ipv6")
address = ET.SubElement(ipv6, "address")
ipv6_prefix_list_rmm = ET.SubElement(address, "ipv6-prefix-list-rmm")
ipv6_prefix_list_rmm.text = kwargs.pop('ipv6_prefix_list_rmm')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_ipv6_address_ipv6_acl_rmm(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
ipv6 = ET.SubElement(match, "ipv6")
address = ET.SubElement(ipv6, "address")
ipv6_acl_rmm = ET.SubElement(address, "ipv6-acl-rmm")
ipv6_acl_rmm.text = kwargs.pop('ipv6_acl_rmm')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_ipv6_next_hop_ipv6_prefix_list_rmm_n(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
ipv6 = ET.SubElement(match, "ipv6")
next_hop = ET.SubElement(ipv6, "next-hop")
ipv6_prefix_list_rmm_n = ET.SubElement(next_hop, "ipv6-prefix-list-rmm-n")
ipv6_prefix_list_rmm_n.text = kwargs.pop('ipv6_prefix_list_rmm_n')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_ipv6_route_source_ipv6_prefix_list_rmrs(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
ipv6 = ET.SubElement(match, "ipv6")
route_source = ET.SubElement(ipv6, "route-source")
ipv6_prefix_list_rmrs = ET.SubElement(route_source, "ipv6-prefix-list-rmrs")
ipv6_prefix_list_rmrs.text = kwargs.pop('ipv6_prefix_list_rmrs')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_ip_address_prefix_list_rmm(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
ip = ET.SubElement(match, "ip")
address = ET.SubElement(ip, "address")
prefix_list_rmm = ET.SubElement(address, "prefix-list-rmm")
prefix_list_rmm.text = kwargs.pop('prefix_list_rmm')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_ip_address_acl_rmm(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
ip = ET.SubElement(match, "ip")
address = ET.SubElement(ip, "address")
acl_rmm = ET.SubElement(address, "acl-rmm")
acl_rmm.text = kwargs.pop('acl_rmm')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_ip_next_hop_prefix_list_rmm_n(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
ip = ET.SubElement(match, "ip")
next_hop = ET.SubElement(ip, "next-hop")
prefix_list_rmm_n = ET.SubElement(next_hop, "prefix-list-rmm-n")
prefix_list_rmm_n.text = kwargs.pop('prefix_list_rmm_n')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_ip_route_source_prefix_list_rmrs(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
ip = ET.SubElement(match, "ip")
route_source = ET.SubElement(ip, "route-source")
prefix_list_rmrs = ET.SubElement(route_source, "prefix-list-rmrs")
prefix_list_rmrs.text = kwargs.pop('prefix_list_rmrs')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_extcommunity_extcommunity_num(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
extcommunity = ET.SubElement(match, "extcommunity")
extcommunity_num = ET.SubElement(extcommunity, "extcommunity-num")
extcommunity_num.text = kwargs.pop('extcommunity_num')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_metric_metric_rmm(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
metric = ET.SubElement(match, "metric")
metric_rmm = ET.SubElement(metric, "metric-rmm")
metric_rmm.text = kwargs.pop('metric_rmm')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_route_type_route_type_rmm(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
route_type = ET.SubElement(match, "route-type")
route_type_rmm = ET.SubElement(route_type, "route-type-rmm")
route_type_rmm.text = kwargs.pop('route_type_rmm')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_as_path_as_path_access_list_name(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
as_path = ET.SubElement(match, "as-path")
as_path_access_list_name = ET.SubElement(as_path, "as-path-access-list-name")
as_path_access_list_name.text = kwargs.pop('as_path_access_list_name')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_community_community_access_list_name(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
community = ET.SubElement(match, "community")
community_access_list_name = ET.SubElement(community, "community-access-list-name")
community_access_list_name.text = kwargs.pop('community_access_list_name')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_next_hop_next_hop_filter_val(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
next_hop = ET.SubElement(match, "next-hop")
next_hop_filter_val = ET.SubElement(next_hop, "next-hop-filter-val")
next_hop_filter_val.text = kwargs.pop('next_hop_filter_val')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_protocol_protocol_static_container_static(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
protocol = ET.SubElement(match, "protocol")
protocol_static_container = ET.SubElement(protocol, "protocol-static-container")
static = ET.SubElement(protocol_static_container, "static")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_protocol_bgp_protocol_container_protocol_bgp(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
protocol = ET.SubElement(match, "protocol")
bgp_protocol_container = ET.SubElement(protocol, "bgp-protocol-container")
protocol_bgp = ET.SubElement(bgp_protocol_container, "protocol-bgp")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_protocol_bgp_protocol_container_bgp_route_type(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
protocol = ET.SubElement(match, "protocol")
bgp_protocol_container = ET.SubElement(protocol, "bgp-protocol-container")
bgp_route_type = ET.SubElement(bgp_protocol_container, "bgp-route-type")
bgp_route_type.text = kwargs.pop('bgp_route_type')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ip_dscp_dscp_rms(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ip = ET.SubElement(set, "ip")
dscp = ET.SubElement(ip, "dscp")
dscp_rms = ET.SubElement(dscp, "dscp-rms")
dscp_rms.text = kwargs.pop('dscp_rms')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ip_interface_null0(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ip = ET.SubElement(set, "ip")
interface = ET.SubElement(ip, "interface")
null0 = ET.SubElement(interface, "null0")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ip_next_hop_peer_address(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ip = ET.SubElement(set, "ip")
next_hop = ET.SubElement(ip, "next-hop")
peer_address = ET.SubElement(next_hop, "peer-address")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ip_globl_next_global_hop_next_hop(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ip = ET.SubElement(set, "ip")
globl = ET.SubElement(ip, "global")
next_global_hop = ET.SubElement(globl, "next-global-hop")
next_hop = ET.SubElement(next_global_hop, "next-hop")
next_hop.text = kwargs.pop('next_hop')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ip_next_ip_next_hop_next_hop(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ip = ET.SubElement(set, "ip")
next_ip = ET.SubElement(ip, "next-ip")
next_hop = ET.SubElement(next_ip, "next-hop")
next_hop = ET.SubElement(next_hop, "next-hop")
next_hop.text = kwargs.pop('next_hop')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ip_next_vrf_next_vrf_list_vrf(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ip = ET.SubElement(set, "ip")
next_vrf = ET.SubElement(ip, "next-vrf")
next_vrf_list = ET.SubElement(next_vrf, "next-vrf-list")
next_hop_key = ET.SubElement(next_vrf_list, "next-hop")
next_hop_key.text = kwargs.pop('next_hop')
vrf = ET.SubElement(next_vrf_list, "vrf")
vrf.text = kwargs.pop('vrf')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ip_next_vrf_next_vrf_list_next_hop(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ip = ET.SubElement(set, "ip")
next_vrf = ET.SubElement(ip, "next-vrf")
next_vrf_list = ET.SubElement(next_vrf, "next-vrf-list")
vrf_key = ET.SubElement(next_vrf_list, "vrf")
vrf_key.text = kwargs.pop('vrf')
next_hop = ET.SubElement(next_vrf_list, "next-hop")
next_hop.text = kwargs.pop('next_hop')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ipv6_globl_next_global_hop_next_hop(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ipv6 = ET.SubElement(set, "ipv6")
globl = ET.SubElement(ipv6, "global")
next_global_hop = ET.SubElement(globl, "next-global-hop")
next_hop = ET.SubElement(next_global_hop, "next-hop")
next_hop.text = kwargs.pop('next_hop')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ipv6_next_ip_next_hop_next_hop(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ipv6 = ET.SubElement(set, "ipv6")
next_ip = ET.SubElement(ipv6, "next-ip")
next_hop = ET.SubElement(next_ip, "next-hop")
next_hop = ET.SubElement(next_hop, "next-hop")
next_hop.text = kwargs.pop('next_hop')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ipv6_next_vrf_next_vrf_list_vrf(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ipv6 = ET.SubElement(set, "ipv6")
next_vrf = ET.SubElement(ipv6, "next-vrf")
next_vrf_list = ET.SubElement(next_vrf, "next-vrf-list")
next_hop_key = ET.SubElement(next_vrf_list, "next-hop")
next_hop_key.text = kwargs.pop('next_hop')
vrf = ET.SubElement(next_vrf_list, "vrf")
vrf.text = kwargs.pop('vrf')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ipv6_next_vrf_next_vrf_list_next_hop(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ipv6 = ET.SubElement(set, "ipv6")
next_vrf = ET.SubElement(ipv6, "next-vrf")
next_vrf_list = ET.SubElement(next_vrf, "next-vrf-list")
vrf_key = ET.SubElement(next_vrf_list, "vrf")
vrf_key.text = kwargs.pop('vrf')
next_hop = ET.SubElement(next_vrf_list, "next-hop")
next_hop.text = kwargs.pop('next_hop')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_extcommunity_rt_ASN_NN_rt(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
extcommunity = ET.SubElement(set, "extcommunity")
rt = ET.SubElement(extcommunity, "rt")
ASN_NN_rt = ET.SubElement(rt, "ASN-NN-rt")
ASN_NN_rt.text = kwargs.pop('ASN_NN_rt')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_extcommunity_soo_ASN_NN_soo(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
extcommunity = ET.SubElement(set, "extcommunity")
soo = ET.SubElement(extcommunity, "soo")
ASN_NN_soo = ET.SubElement(soo, "ASN-NN-soo")
ASN_NN_soo.text = kwargs.pop('ASN_NN_soo')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_community_set_community_expr(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
community = ET.SubElement(set, "community")
set_community_expr = ET.SubElement(community, "set-community-expr")
set_community_expr.text = kwargs.pop('set_community_expr')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_metric_delta_rms(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
metric = ET.SubElement(set, "metric")
delta_rms = ET.SubElement(metric, "delta-rms")
delta_rms.text = kwargs.pop('delta_rms')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_metric_metric_rms(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
metric = ET.SubElement(set, "metric")
metric_rms = ET.SubElement(metric, "metric-rms")
metric_rms.text = kwargs.pop('metric_rms')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_distance_dist_rms(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
distance = ET.SubElement(set, "distance")
dist_rms = ET.SubElement(distance, "dist-rms")
dist_rms.text = kwargs.pop('dist_rms')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_route_type_route_type_rms(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
route_type = ET.SubElement(set, "route-type")
route_type_rms = ET.SubElement(route_type, "route-type-rms")
route_type_rms.text = kwargs.pop('route_type_rms')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_tag_tag_rms(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
tag = ET.SubElement(set, "tag")
tag_rms = ET.SubElement(tag, "tag-rms")
tag_rms.text = kwargs.pop('tag_rms')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_weight_weight_value(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
weight = ET.SubElement(set, "weight")
weight_value = ET.SubElement(weight, "weight-value")
weight_value.text = kwargs.pop('weight_value')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_as_path_aspath_tag(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
as_path = ET.SubElement(set, "as-path")
aspath_tag = ET.SubElement(as_path, "aspath-tag")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_as_path_prepend(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
as_path = ET.SubElement(set, "as-path")
prepend = ET.SubElement(as_path, "prepend")
prepend.text = kwargs.pop('prepend')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_automatic_tag_tag_empty(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
automatic_tag = ET.SubElement(set, "automatic-tag")
tag_empty = ET.SubElement(automatic_tag, "tag-empty")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_comm_list_comm_list_name(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
comm_list = ET.SubElement(set, "comm-list")
comm_list_name = ET.SubElement(comm_list, "comm-list-name")
comm_list_name.text = kwargs.pop('comm_list_name')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_comm_list_match_comm_delete(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
comm_list = ET.SubElement(set, "comm-list")
match_comm_delete = ET.SubElement(comm_list, "match-comm-delete")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_dampening_half_life(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
dampening = ET.SubElement(set, "dampening")
half_life = ET.SubElement(dampening, "half-life")
half_life.text = kwargs.pop('half_life')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_dampening_reuse(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
dampening = ET.SubElement(set, "dampening")
reuse = ET.SubElement(dampening, "reuse")
reuse.text = kwargs.pop('reuse')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_dampening_suppress(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
dampening = ET.SubElement(set, "dampening")
suppress = ET.SubElement(dampening, "suppress")
suppress.text = kwargs.pop('suppress')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_dampening_max_suppress_time(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
dampening = ET.SubElement(set, "dampening")
max_suppress_time = ET.SubElement(dampening, "max-suppress-time")
max_suppress_time.text = kwargs.pop('max_suppress_time')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_local_preference_local_preference_value(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
local_preference = ET.SubElement(set, "local-preference")
local_preference_value = ET.SubElement(local_preference, "local-preference-value")
local_preference_value.text = kwargs.pop('local_preference_value')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_origin_origin_igp(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
origin = ET.SubElement(set, "origin")
origin_igp = ET.SubElement(origin, "origin-igp")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_origin_origin_incomplete(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
origin = ET.SubElement(set, "origin")
origin_incomplete = ET.SubElement(origin, "origin-incomplete")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_metric_type_external(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
metric_type = ET.SubElement(set, "metric-type")
external = ET.SubElement(metric_type, "external")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_metric_type_internal(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
metric_type = ET.SubElement(set, "metric-type")
internal = ET.SubElement(metric_type, "internal")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_metric_type_type_1(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
metric_type = ET.SubElement(set, "metric-type")
type_1 = ET.SubElement(metric_type, "type-1")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_metric_type_type_2(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
metric_type = ET.SubElement(set, "metric-type")
type_2 = ET.SubElement(metric_type, "type-2")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_continue_holder_cont(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
continue_holder = ET.SubElement(content, "continue-holder")
cont = ET.SubElement(continue_holder, "continue")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_continue_holder_continue_val(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
continue_holder = ET.SubElement(content, "continue-holder")
continue_val = ET.SubElement(continue_holder, "continue-val")
continue_val.text = kwargs.pop('continue_val')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_filter_change_update_delay_holder_filter_change_update_delay_filter_delay_value(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_filter_change_update_delay_holder = ET.SubElement(config, "hide-filter-change-update-delay-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
filter_change_update_delay = ET.SubElement(hide_filter_change_update_delay_holder, "filter-change-update-delay")
filter_delay_value = ET.SubElement(filter_change_update_delay, "filter-delay-value")
filter_delay_value.text = kwargs.pop('filter_delay_value')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_name(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
name = ET.SubElement(route_map, "name")
name.text = kwargs.pop('name')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_action_rm(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
action_rm = ET.SubElement(route_map, "action-rm")
action_rm.text = kwargs.pop('action_rm')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_instance(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance = ET.SubElement(route_map, "instance")
instance.text = kwargs.pop('instance')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_ipv6_address_ipv6_prefix_list_rmm(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
ipv6 = ET.SubElement(match, "ipv6")
address = ET.SubElement(ipv6, "address")
ipv6_prefix_list_rmm = ET.SubElement(address, "ipv6-prefix-list-rmm")
ipv6_prefix_list_rmm.text = kwargs.pop('ipv6_prefix_list_rmm')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_ipv6_address_ipv6_acl_rmm(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
ipv6 = ET.SubElement(match, "ipv6")
address = ET.SubElement(ipv6, "address")
ipv6_acl_rmm = ET.SubElement(address, "ipv6-acl-rmm")
ipv6_acl_rmm.text = kwargs.pop('ipv6_acl_rmm')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_ipv6_next_hop_ipv6_prefix_list_rmm_n(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
ipv6 = ET.SubElement(match, "ipv6")
next_hop = ET.SubElement(ipv6, "next-hop")
ipv6_prefix_list_rmm_n = ET.SubElement(next_hop, "ipv6-prefix-list-rmm-n")
ipv6_prefix_list_rmm_n.text = kwargs.pop('ipv6_prefix_list_rmm_n')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_ipv6_route_source_ipv6_prefix_list_rmrs(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
ipv6 = ET.SubElement(match, "ipv6")
route_source = ET.SubElement(ipv6, "route-source")
ipv6_prefix_list_rmrs = ET.SubElement(route_source, "ipv6-prefix-list-rmrs")
ipv6_prefix_list_rmrs.text = kwargs.pop('ipv6_prefix_list_rmrs')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_ip_address_prefix_list_rmm(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
ip = ET.SubElement(match, "ip")
address = ET.SubElement(ip, "address")
prefix_list_rmm = ET.SubElement(address, "prefix-list-rmm")
prefix_list_rmm.text = kwargs.pop('prefix_list_rmm')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_ip_address_acl_rmm(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
ip = ET.SubElement(match, "ip")
address = ET.SubElement(ip, "address")
acl_rmm = ET.SubElement(address, "acl-rmm")
acl_rmm.text = kwargs.pop('acl_rmm')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_ip_next_hop_prefix_list_rmm_n(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
ip = ET.SubElement(match, "ip")
next_hop = ET.SubElement(ip, "next-hop")
prefix_list_rmm_n = ET.SubElement(next_hop, "prefix-list-rmm-n")
prefix_list_rmm_n.text = kwargs.pop('prefix_list_rmm_n')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_ip_route_source_prefix_list_rmrs(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
ip = ET.SubElement(match, "ip")
route_source = ET.SubElement(ip, "route-source")
prefix_list_rmrs = ET.SubElement(route_source, "prefix-list-rmrs")
prefix_list_rmrs.text = kwargs.pop('prefix_list_rmrs')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_extcommunity_extcommunity_num(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
extcommunity = ET.SubElement(match, "extcommunity")
extcommunity_num = ET.SubElement(extcommunity, "extcommunity-num")
extcommunity_num.text = kwargs.pop('extcommunity_num')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_metric_metric_rmm(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
metric = ET.SubElement(match, "metric")
metric_rmm = ET.SubElement(metric, "metric-rmm")
metric_rmm.text = kwargs.pop('metric_rmm')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_route_type_route_type_rmm(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
route_type = ET.SubElement(match, "route-type")
route_type_rmm = ET.SubElement(route_type, "route-type-rmm")
route_type_rmm.text = kwargs.pop('route_type_rmm')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_as_path_as_path_access_list_name(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
as_path = ET.SubElement(match, "as-path")
as_path_access_list_name = ET.SubElement(as_path, "as-path-access-list-name")
as_path_access_list_name.text = kwargs.pop('as_path_access_list_name')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_community_community_access_list_name(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
community = ET.SubElement(match, "community")
community_access_list_name = ET.SubElement(community, "community-access-list-name")
community_access_list_name.text = kwargs.pop('community_access_list_name')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_next_hop_next_hop_filter_val(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
next_hop = ET.SubElement(match, "next-hop")
next_hop_filter_val = ET.SubElement(next_hop, "next-hop-filter-val")
next_hop_filter_val.text = kwargs.pop('next_hop_filter_val')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_protocol_protocol_static_container_static(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
protocol = ET.SubElement(match, "protocol")
protocol_static_container = ET.SubElement(protocol, "protocol-static-container")
static = ET.SubElement(protocol_static_container, "static")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_protocol_bgp_protocol_container_protocol_bgp(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
protocol = ET.SubElement(match, "protocol")
bgp_protocol_container = ET.SubElement(protocol, "bgp-protocol-container")
protocol_bgp = ET.SubElement(bgp_protocol_container, "protocol-bgp")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_match_protocol_bgp_protocol_container_bgp_route_type(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
match = ET.SubElement(content, "match")
protocol = ET.SubElement(match, "protocol")
bgp_protocol_container = ET.SubElement(protocol, "bgp-protocol-container")
bgp_route_type = ET.SubElement(bgp_protocol_container, "bgp-route-type")
bgp_route_type.text = kwargs.pop('bgp_route_type')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ip_dscp_dscp_rms(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ip = ET.SubElement(set, "ip")
dscp = ET.SubElement(ip, "dscp")
dscp_rms = ET.SubElement(dscp, "dscp-rms")
dscp_rms.text = kwargs.pop('dscp_rms')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ip_interface_null0(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ip = ET.SubElement(set, "ip")
interface = ET.SubElement(ip, "interface")
null0 = ET.SubElement(interface, "null0")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ip_next_hop_peer_address(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ip = ET.SubElement(set, "ip")
next_hop = ET.SubElement(ip, "next-hop")
peer_address = ET.SubElement(next_hop, "peer-address")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ip_globl_next_global_hop_next_hop(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ip = ET.SubElement(set, "ip")
globl = ET.SubElement(ip, "global")
next_global_hop = ET.SubElement(globl, "next-global-hop")
next_hop = ET.SubElement(next_global_hop, "next-hop")
next_hop.text = kwargs.pop('next_hop')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ip_next_ip_next_hop_next_hop(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ip = ET.SubElement(set, "ip")
next_ip = ET.SubElement(ip, "next-ip")
next_hop = ET.SubElement(next_ip, "next-hop")
next_hop = ET.SubElement(next_hop, "next-hop")
next_hop.text = kwargs.pop('next_hop')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ip_next_vrf_next_vrf_list_vrf(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ip = ET.SubElement(set, "ip")
next_vrf = ET.SubElement(ip, "next-vrf")
next_vrf_list = ET.SubElement(next_vrf, "next-vrf-list")
next_hop_key = ET.SubElement(next_vrf_list, "next-hop")
next_hop_key.text = kwargs.pop('next_hop')
vrf = ET.SubElement(next_vrf_list, "vrf")
vrf.text = kwargs.pop('vrf')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ip_next_vrf_next_vrf_list_next_hop(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ip = ET.SubElement(set, "ip")
next_vrf = ET.SubElement(ip, "next-vrf")
next_vrf_list = ET.SubElement(next_vrf, "next-vrf-list")
vrf_key = ET.SubElement(next_vrf_list, "vrf")
vrf_key.text = kwargs.pop('vrf')
next_hop = ET.SubElement(next_vrf_list, "next-hop")
next_hop.text = kwargs.pop('next_hop')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ipv6_globl_next_global_hop_next_hop(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ipv6 = ET.SubElement(set, "ipv6")
globl = ET.SubElement(ipv6, "global")
next_global_hop = ET.SubElement(globl, "next-global-hop")
next_hop = ET.SubElement(next_global_hop, "next-hop")
next_hop.text = kwargs.pop('next_hop')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ipv6_next_ip_next_hop_next_hop(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ipv6 = ET.SubElement(set, "ipv6")
next_ip = ET.SubElement(ipv6, "next-ip")
next_hop = ET.SubElement(next_ip, "next-hop")
next_hop = ET.SubElement(next_hop, "next-hop")
next_hop.text = kwargs.pop('next_hop')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ipv6_next_vrf_next_vrf_list_vrf(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ipv6 = ET.SubElement(set, "ipv6")
next_vrf = ET.SubElement(ipv6, "next-vrf")
next_vrf_list = ET.SubElement(next_vrf, "next-vrf-list")
next_hop_key = ET.SubElement(next_vrf_list, "next-hop")
next_hop_key.text = kwargs.pop('next_hop')
vrf = ET.SubElement(next_vrf_list, "vrf")
vrf.text = kwargs.pop('vrf')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_ipv6_next_vrf_next_vrf_list_next_hop(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
ipv6 = ET.SubElement(set, "ipv6")
next_vrf = ET.SubElement(ipv6, "next-vrf")
next_vrf_list = ET.SubElement(next_vrf, "next-vrf-list")
vrf_key = ET.SubElement(next_vrf_list, "vrf")
vrf_key.text = kwargs.pop('vrf')
next_hop = ET.SubElement(next_vrf_list, "next-hop")
next_hop.text = kwargs.pop('next_hop')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_extcommunity_rt_ASN_NN_rt(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
extcommunity = ET.SubElement(set, "extcommunity")
rt = ET.SubElement(extcommunity, "rt")
ASN_NN_rt = ET.SubElement(rt, "ASN-NN-rt")
ASN_NN_rt.text = kwargs.pop('ASN_NN_rt')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_extcommunity_soo_ASN_NN_soo(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
extcommunity = ET.SubElement(set, "extcommunity")
soo = ET.SubElement(extcommunity, "soo")
ASN_NN_soo = ET.SubElement(soo, "ASN-NN-soo")
ASN_NN_soo.text = kwargs.pop('ASN_NN_soo')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_community_set_community_expr(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
community = ET.SubElement(set, "community")
set_community_expr = ET.SubElement(community, "set-community-expr")
set_community_expr.text = kwargs.pop('set_community_expr')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_metric_delta_rms(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
metric = ET.SubElement(set, "metric")
delta_rms = ET.SubElement(metric, "delta-rms")
delta_rms.text = kwargs.pop('delta_rms')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_metric_metric_rms(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
metric = ET.SubElement(set, "metric")
metric_rms = ET.SubElement(metric, "metric-rms")
metric_rms.text = kwargs.pop('metric_rms')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_distance_dist_rms(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
distance = ET.SubElement(set, "distance")
dist_rms = ET.SubElement(distance, "dist-rms")
dist_rms.text = kwargs.pop('dist_rms')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_route_type_route_type_rms(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
route_type = ET.SubElement(set, "route-type")
route_type_rms = ET.SubElement(route_type, "route-type-rms")
route_type_rms.text = kwargs.pop('route_type_rms')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_tag_tag_rms(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
tag = ET.SubElement(set, "tag")
tag_rms = ET.SubElement(tag, "tag-rms")
tag_rms.text = kwargs.pop('tag_rms')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_weight_weight_value(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
weight = ET.SubElement(set, "weight")
weight_value = ET.SubElement(weight, "weight-value")
weight_value.text = kwargs.pop('weight_value')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_as_path_aspath_tag(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
as_path = ET.SubElement(set, "as-path")
aspath_tag = ET.SubElement(as_path, "aspath-tag")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_as_path_prepend(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
as_path = ET.SubElement(set, "as-path")
prepend = ET.SubElement(as_path, "prepend")
prepend.text = kwargs.pop('prepend')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_automatic_tag_tag_empty(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
automatic_tag = ET.SubElement(set, "automatic-tag")
tag_empty = ET.SubElement(automatic_tag, "tag-empty")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_comm_list_comm_list_name(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
comm_list = ET.SubElement(set, "comm-list")
comm_list_name = ET.SubElement(comm_list, "comm-list-name")
comm_list_name.text = kwargs.pop('comm_list_name')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_comm_list_match_comm_delete(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
comm_list = ET.SubElement(set, "comm-list")
match_comm_delete = ET.SubElement(comm_list, "match-comm-delete")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_dampening_half_life(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
dampening = ET.SubElement(set, "dampening")
half_life = ET.SubElement(dampening, "half-life")
half_life.text = kwargs.pop('half_life')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_dampening_reuse(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
dampening = ET.SubElement(set, "dampening")
reuse = ET.SubElement(dampening, "reuse")
reuse.text = kwargs.pop('reuse')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_dampening_suppress(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
dampening = ET.SubElement(set, "dampening")
suppress = ET.SubElement(dampening, "suppress")
suppress.text = kwargs.pop('suppress')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_dampening_max_suppress_time(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
dampening = ET.SubElement(set, "dampening")
max_suppress_time = ET.SubElement(dampening, "max-suppress-time")
max_suppress_time.text = kwargs.pop('max_suppress_time')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_local_preference_local_preference_value(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
local_preference = ET.SubElement(set, "local-preference")
local_preference_value = ET.SubElement(local_preference, "local-preference-value")
local_preference_value.text = kwargs.pop('local_preference_value')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_origin_origin_igp(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
origin = ET.SubElement(set, "origin")
origin_igp = ET.SubElement(origin, "origin-igp")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_origin_origin_incomplete(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
origin = ET.SubElement(set, "origin")
origin_incomplete = ET.SubElement(origin, "origin-incomplete")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_metric_type_external(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
metric_type = ET.SubElement(set, "metric-type")
external = ET.SubElement(metric_type, "external")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_metric_type_internal(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
metric_type = ET.SubElement(set, "metric-type")
internal = ET.SubElement(metric_type, "internal")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_metric_type_type_1(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
metric_type = ET.SubElement(set, "metric-type")
type_1 = ET.SubElement(metric_type, "type-1")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_set_metric_type_type_2(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
set = ET.SubElement(content, "set")
metric_type = ET.SubElement(set, "metric-type")
type_2 = ET.SubElement(metric_type, "type-2")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_continue_holder_cont(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
continue_holder = ET.SubElement(content, "continue-holder")
cont = ET.SubElement(continue_holder, "continue")
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_routemap_holder_route_map_content_continue_holder_continue_val(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_routemap_holder = ET.SubElement(config, "hide-routemap-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
route_map = ET.SubElement(hide_routemap_holder, "route-map")
name_key = ET.SubElement(route_map, "name")
name_key.text = kwargs.pop('name')
action_rm_key = ET.SubElement(route_map, "action-rm")
action_rm_key.text = kwargs.pop('action_rm')
instance_key = ET.SubElement(route_map, "instance")
instance_key.text = kwargs.pop('instance')
content = ET.SubElement(route_map, "content")
continue_holder = ET.SubElement(content, "continue-holder")
continue_val = ET.SubElement(continue_holder, "continue-val")
continue_val.text = kwargs.pop('continue_val')
callback = kwargs.pop('callback', self._callback)
return callback(config)
def hide_filter_change_update_delay_holder_filter_change_update_delay_filter_delay_value(self, **kwargs):
"""Auto Generated Code
"""
config = ET.Element("config")
hide_filter_change_update_delay_holder = ET.SubElement(config, "hide-filter-change-update-delay-holder", xmlns="urn:brocade.com:mgmt:brocade-ip-policy")
filter_change_update_delay = ET.SubElement(hide_filter_change_update_delay_holder, "filter-change-update-delay")
filter_delay_value = ET.SubElement(filter_change_update_delay, "filter-delay-value")
filter_delay_value.text = kwargs.pop('filter_delay_value')
callback = kwargs.pop('callback', self._callback)
return callback(config)
| 50.376055
| 160
| 0.661996
| 15,719
| 125,386
| 5.018894
| 0.00738
| 0.166405
| 0.100416
| 0.116108
| 0.998301
| 0.998301
| 0.998301
| 0.998301
| 0.998301
| 0.998301
| 0
| 0.001232
| 0.210542
| 125,386
| 2,489
| 161
| 50.376055
| 0.795761
| 0.027667
| 0
| 0.99801
| 1
| 0
| 0.160927
| 0.042944
| 0
| 0
| 0
| 0
| 0
| 1
| 0.059204
| false
| 0
| 0.000498
| 0
| 0.118905
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
330cbb21cdf017a54ffaccf5678145e44247f514
| 10,881
|
py
|
Python
|
src/bot/tests/launches/test_launches_sln_330.py
|
ItsCalebJones/SpaceLaunchNow_API
|
09289068465c462557649172792ab0f41f833028
|
[
"Apache-2.0"
] | 11
|
2017-06-26T05:01:31.000Z
|
2019-09-13T18:48:27.000Z
|
src/bot/tests/launches/test_launches_sln_330.py
|
ItsCalebJones/SpaceLaunchNow_API
|
09289068465c462557649172792ab0f41f833028
|
[
"Apache-2.0"
] | 14
|
2019-01-30T23:13:34.000Z
|
2019-10-08T10:43:36.000Z
|
src/bot/tests/launches/test_launches_sln_330.py
|
ItsCalebJones/SpaceLaunchNow_API
|
09289068465c462557649172792ab0f41f833028
|
[
"Apache-2.0"
] | 5
|
2018-04-24T16:52:59.000Z
|
2018-08-22T14:06:01.000Z
|
import json
import unittest
from datetime import timedelta
from rest_framework import status
from api.models import *
from api.tests.test__base import LLAPITests, settings
class LaunchSLNv330Tests(LLAPITests):
@unittest.skipIf(settings.IS_LL, "Not supported in this configuration.")
def test_upcoming_normal(self):
"""
Ensure launch endpoints work as expected.
"""
# Test Normal endpoint
path = '/api/3.3.0/launch/upcoming/?limit=1'
response = self.client.get(path)
self.assertEqual(response.status_code, status.HTTP_200_OK)
data = json.loads(response.content.decode('utf-8'))
self.assertEqual(data['count'], Launch.objects.filter(net__gte=timezone.now() - timedelta(hours=2)).count())
self.assertIsNotNone(data['next'])
self.assertIsNone(data['previous'])
for data in data['results']:
launch = Launch.objects.get(id=data['id'])
self.assertEqual(data['id'], str(launch.id))
self.assertEqual(data['name'], launch.name)
self.assertNotIn('netstamp', data)
self.assertNotIn('isonet', data)
self.assertIn('name', data['status'])
self.assertIn('rocket', data)
self.assertIn('net', data)
self.assertIn('configuration', data['rocket'])
self.assertIn('launcher_stage', data['rocket'])
self.assertIn('pad', data)
self.assertIn('location', data['pad'])
self.check_permissions(path)
@unittest.skipIf(settings.IS_LL, "Not supported in this configuration.")
def test_upcoming_list(self):
"""
Ensure launch endpoints work as expected.
"""
# Test list endpoint
path = '/api/3.3.0/launch/upcoming/?limit=1&mode=list'
response = self.client.get(path)
self.assertEqual(response.status_code, status.HTTP_200_OK)
data = json.loads(response.content.decode('utf-8'))
self.assertEqual(data['count'], Launch.objects.filter(net__gte=timezone.now() - timedelta(hours=2)).count())
self.assertIsNotNone(data['next'])
self.assertIsNone(data['previous'])
for data in data['results']:
launch = Launch.objects.get(id=data['id'])
self.assertEqual(data['id'], str(launch.id))
self.assertEqual(data['name'], launch.name)
self.assertNotIn('netstamp', data)
self.assertNotIn('isonet', data)
self.assertNotIn('rocket', data)
self.assertIn('name', data['status'])
self.assertIn('name', data)
self.assertIn('net', data)
self.assertIn('pad', data)
self.assertIn('landing', data)
self.assertIn('orbit', data)
self.check_permissions(path)
@unittest.skipIf(settings.IS_LL, "Not supported in this configuration.")
def test_upcoming_detailed(self):
"""
Ensure launch endpoints work as expected.
"""
# Test detailed endpoint
path = '/api/3.3.0/launch/upcoming/?limit=1&mode=detailed'
response = self.client.get(path)
self.assertEqual(response.status_code, status.HTTP_200_OK)
data = json.loads(response.content.decode('utf-8'))
self.assertEqual(data['count'], Launch.objects.filter(net__gte=timezone.now() - timedelta(hours=2)).count())
self.assertIsNotNone(data['next'])
self.assertIsNone(data['previous'])
for data in data['results']:
launch = Launch.objects.get(id=data['id'])
self.assertEqual(data['id'], str(launch.id))
self.assertEqual(data['name'], launch.name)
self.assertNotIn('netstamp', data)
self.assertNotIn('isonet', data)
self.assertIn('name', data['status'])
self.assertIn('rocket', data)
self.assertIn('net', data)
self.assertIn('configuration', data['rocket'])
self.assertIn('diameter', data['rocket']['configuration'])
self.assertIn('launcher_stage', data['rocket'])
self.assertIn('pad', data)
self.assertIn('location', data['pad'])
self.check_permissions(path)
@unittest.skipIf(settings.IS_LL, "Not supported in this configuration.")
def test_previous_normal(self):
"""
Ensure launch endpoints work as expected.
"""
# Test Normal endpoint
path = '/api/3.3.0/launch/previous/?limit=1'
response = self.client.get(path)
self.assertEqual(response.status_code, status.HTTP_200_OK)
data = json.loads(response.content.decode('utf-8'))
self.assertIsNotNone(data['next'])
self.assertIsNone(data['previous'])
self.assertEqual(data['count'], Launch.objects.filter(net__lte=timezone.now()).count())
for data in data['results']:
launch = Launch.objects.get(id=data['id'])
self.assertEqual(data['id'], str(launch.id))
self.assertEqual(data['name'], launch.name)
self.assertNotIn('netstamp', data)
self.assertNotIn('isonet', data)
self.assertIn('name', data['status'])
self.assertIn('rocket', data)
self.assertIn('net', data)
self.assertIn('configuration', data['rocket'])
self.assertIn('launcher_stage', data['rocket'])
self.assertIn('pad', data)
self.assertIn('location', data['pad'])
self.check_permissions(path)
@unittest.skipIf(settings.IS_LL, "Not supported in this configuration.")
def test_previous_list(self):
"""
Ensure launch endpoints work as expected.
"""
# Test list endpoint
path = '/api/3.3.0/launch/previous/?limit=1&mode=list'
response = self.client.get(path)
self.assertEqual(response.status_code, status.HTTP_200_OK)
data = json.loads(response.content.decode('utf-8'))
self.assertIsNotNone(data['next'])
self.assertIsNone(data['previous'])
self.assertEqual(data['count'], Launch.objects.filter(net__lte=timezone.now()).count())
for data in data['results']:
launch = Launch.objects.get(id=data['id'])
self.assertEqual(data['id'], str(launch.id))
self.assertEqual(data['name'], launch.name)
self.assertNotIn('netstamp', data)
self.assertNotIn('isonet', data)
self.assertNotIn('rocket', data)
self.assertIn('name', data['status'])
self.assertIn('name', data)
self.assertIn('net', data)
self.assertIn('pad', data)
self.assertIn('landing', data)
self.assertIn('orbit', data)
self.check_permissions(path)
@unittest.skipIf(settings.IS_LL, "Not supported in this configuration.")
def test_previous_detailed(self):
"""
Ensure launch endpoints work as expected.
"""
# Test detailed endpoint
path = '/api/3.3.0/launch/previous/?limit=1&mode=detailed'
response = self.client.get(path)
self.assertEqual(response.status_code, status.HTTP_200_OK)
data = json.loads(response.content.decode('utf-8'))
self.assertIsNotNone(data['next'])
self.assertIsNone(data['previous'])
self.assertEqual(data['count'], Launch.objects.filter(net__lte=timezone.now()).count())
for data in data['results']:
launch = Launch.objects.get(id=data['id'])
self.assertEqual(data['id'], str(launch.id))
self.assertEqual(data['name'], launch.name)
self.assertNotIn('netstamp', data)
self.assertNotIn('isonet', data)
self.assertIn('name', data['status'])
self.assertIn('rocket', data)
self.assertIn('net', data)
self.assertIn('configuration', data['rocket'])
self.assertIn('diameter', data['rocket']['configuration'])
self.assertIn('launcher_stage', data['rocket'])
self.assertIn('pad', data)
self.assertIn('location', data['pad'])
self.check_permissions(path)
@unittest.skipIf(settings.IS_LL, "Not supported in this configuration.")
def test_launch_with_landings(self):
launch = Launch.objects.get(launch_library_id=864)
path = '/api/3.3.0/launch/%s/' % launch.id
response = self.client.get(path)
self.assertEqual(response.status_code, status.HTTP_200_OK)
data = json.loads(response.content.decode('utf-8'))
self.assertNotIn('next', data)
self.assertNotIn('result', data)
self.assertNotIn('previous', data)
self.assertNotIn('count', data)
self.assertEqual(data['id'], str(launch.id))
self.assertEqual(data['name'], launch.name)
self.assertIn('slug', data)
self.assertEqual(data['status']['id'], launch.status.id)
self.assertNotIn('netstamp', data)
self.assertNotIn('wsstamp', data)
self.assertNotIn('westamp', data)
self.assertIn('net', data)
self.assertIn('window_end', data)
self.assertIn('window_start', data)
self.assertNotIn('isonet', data)
self.assertNotIn('isostart', data)
self.assertNotIn('isoend', data)
self.assertEqual(data['rocket']['configuration']['id'], launch.rocket.configuration.id)
self.assertEqual(data['rocket']['configuration']['launch_service_provider']['name'], launch.rocket.configuration.manufacturer.name)
self.assertEqual(len(data['rocket']['launcher_stage']), launch.rocket.firststage.count())
for index, stage_data in enumerate(data['rocket']['launcher_stage']):
stage = launch.rocket.firststage.all().order_by('id')[index]
self.assertEqual(stage_data['type'], stage.type.name)
self.assertEqual(stage_data['reused'], stage.reused)
self.assertEqual(stage_data['launcher_flight_number'], stage.launcher_flight_number)
self.assertEqual(stage_data['launcher']['id'], stage.launcher.id)
self.assertEqual(stage_data['launcher']['serial_number'], stage.launcher.serial_number)
self.assertEqual(stage_data['landing']['attempt'], stage.landing.attempt)
self.assertEqual(stage_data['landing']['success'], stage.landing.success)
self.assertEqual(stage_data['landing']['description'], stage.landing.description)
self.assertEqual(stage_data['landing']['location']['name'], stage.landing.landing_location.name)
self.assertEqual(stage_data['landing']['type']['name'], stage.landing.landing_type.name)
self.assertEqual(data['mission']['id'], launch.mission.id)
self.assertEqual(data['pad']['id'], launch.pad.id)
self.assertEqual(data['pad']['location']['id'], launch.pad.location.id)
| 47.103896
| 139
| 0.622002
| 1,230
| 10,881
| 5.42439
| 0.101626
| 0.059952
| 0.069544
| 0.05036
| 0.829586
| 0.766787
| 0.758094
| 0.746253
| 0.746253
| 0.746253
| 0
| 0.007609
| 0.227001
| 10,881
| 230
| 140
| 47.308696
| 0.785638
| 0.034739
| 0
| 0.724868
| 0
| 0
| 0.158992
| 0.031277
| 0
| 0
| 0
| 0
| 0.666667
| 1
| 0.037037
| false
| 0
| 0.031746
| 0
| 0.074074
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
331d0ddd964f5c7e62f457a20adb9b2b8c67d9d8
| 8,612
|
py
|
Python
|
will_of_the_prophets/tests/test_calculate_position.py
|
craiga/will-of-the-prophets
|
d968fedcf382d26c07ecd2e9f6dc75e24a277883
|
[
"MIT"
] | 20
|
2018-07-03T01:28:51.000Z
|
2021-05-20T13:30:57.000Z
|
will_of_the_prophets/tests/test_calculate_position.py
|
craiga/will-of-the-prophets
|
d968fedcf382d26c07ecd2e9f6dc75e24a277883
|
[
"MIT"
] | 511
|
2018-06-27T10:54:29.000Z
|
2022-03-31T08:10:18.000Z
|
will_of_the_prophets/tests/test_calculate_position.py
|
craiga/will-of-the-prophets
|
d968fedcf382d26c07ecd2e9f6dc75e24a277883
|
[
"MIT"
] | 6
|
2018-08-23T13:28:21.000Z
|
2020-01-10T23:11:49.000Z
|
"""Test calculate_position."""
from datetime import datetime
import pytest
from model_bakery import baker
from pytz import utc
from will_of_the_prophets import board, models
@pytest.fixture(autouse=True)
def clear_caches():
board.clear_caches()
@pytest.mark.django_db
def test_zero_rolls():
"""Test with zero rolls."""
assert models.Roll.objects.count() == 0
assert board.calculate_position(utc.localize(datetime(2369, 7, 5, 8))) == 1
@pytest.mark.django_db
def test_one_roll():
"""Test with one roll."""
baker.make("Roll", number=22, embargo=utc.localize(datetime(2369, 7, 1)))
assert board.calculate_position(utc.localize(datetime(2369, 1, 1))) == 1
assert board.calculate_position(utc.localize(datetime(2369, 12, 31))) == 23
@pytest.mark.django_db
def test_many_rolls():
"""Test with many rolls."""
for day_of_month, roll in enumerate([3, 20, 2, 40, 17, 5]):
baker.make(
"Roll",
number=roll,
embargo=utc.localize(datetime(2369, 7, day_of_month + 1)),
)
assert board.calculate_position(utc.localize(datetime(2369, 7, 1, 1))) == 4
assert board.calculate_position(utc.localize(datetime(2369, 7, 6, 1))) == 88
@pytest.mark.django_db
def test_butthole():
"""Test that a butthole has an effect."""
baker.make("Butthole", start_square=88, end_square=5)
# Create some rolls.
for day_of_month, roll in enumerate([3, 20, 2, 40, 17, 5, 2]):
baker.make(
"Roll",
number=roll,
embargo=utc.localize(datetime(2369, 7, day_of_month + 1)),
)
assert board.calculate_position(utc.localize(datetime(2369, 7, 10))) == 7
@pytest.mark.django_db
def test_butthole_before_effective():
"""Test that a butthole has no effect before it's time frame has started."""
# Make a butthole which isn't effective until the end of July.
baker.make(
"Butthole",
start_square=88,
end_square=5,
start=utc.localize(datetime(2369, 8, 1)),
)
# Create some rolls, all which take place in July.
for day_of_month, roll in enumerate([3, 20, 2, 40, 17, 5, 2]):
baker.make(
"Roll",
number=roll,
embargo=utc.localize(datetime(2369, 7, day_of_month + 1)),
)
# Assert that calculate_position doesn't take the butthole into consideration.
assert board.calculate_position(utc.localize(datetime(2369, 7, 5, 1))) == 83
assert board.calculate_position(utc.localize(datetime(2369, 7, 6, 1))) == 88
assert board.calculate_position(utc.localize(datetime(2369, 7, 7, 1))) == 90
@pytest.mark.django_db
def test_butthole_after_effective():
"""Test that a butthole has no effect after it's time frame has passed."""
# Make a butthole which is effective until the start of July.
baker.make(
"Butthole",
start_square=88,
end_square=5,
end=utc.localize(datetime(2369, 7, 1)),
)
# Create some rolls, all which take place in July.
for day_of_month, roll in enumerate([3, 20, 2, 40, 17, 5, 2]):
baker.make(
"Roll",
number=roll,
embargo=utc.localize(datetime(2369, 7, day_of_month + 1)),
)
# Assert that calculate_position doesn't take the butthole into consideration.
assert board.calculate_position(utc.localize(datetime(2369, 7, 5, 1))) == 83
assert board.calculate_position(utc.localize(datetime(2369, 7, 6, 1))) == 88
assert board.calculate_position(utc.localize(datetime(2369, 7, 7, 1))) == 90
@pytest.mark.django_db
def test_special_square_auto_move_positive():
"""Test a special square can move the runabout forwards."""
# Make a special square which moves the runabout forward five spaces.
baker.make("SpecialSquare", square=24, type__auto_move=5, type__image="")
# Create some rolls.
for day_of_month, roll in enumerate([3, 20, 2]):
baker.make(
"Roll",
number=roll,
embargo=utc.localize(datetime(2369, 7, day_of_month + 1)),
)
# Assert that calculate_position takes the special square into
# consideration.
assert board.calculate_position(utc.localize(datetime(2369, 7, 1, 1))) == 4
assert board.calculate_position(utc.localize(datetime(2369, 7, 2, 1))) == 29
assert board.calculate_position(utc.localize(datetime(2369, 7, 3, 1))) == 31
@pytest.mark.django_db
def test_special_square_auto_move_negative():
"""Test a special square can move the runabout backwards."""
# Make a special square which moves the runabout backward five spaces.
baker.make("SpecialSquare", square=24, type__auto_move=-5, type__image="")
# Create some rolls.
for day_of_month, roll in enumerate([3, 20, 2]):
baker.make(
"Roll",
number=roll,
embargo=utc.localize(datetime(2369, 7, day_of_month + 1)),
)
# Assert that calculate_position takes the special square into
# consideration.
assert board.calculate_position(utc.localize(datetime(2369, 7, 1, 1))) == 4
assert board.calculate_position(utc.localize(datetime(2369, 7, 2, 1))) == 19
assert board.calculate_position(utc.localize(datetime(2369, 7, 3, 1))) == 21
@pytest.mark.django_db
def test_special_square_before_effective():
"""Test that a special square has no effect before it's time frame has started."""
# Make a special square which isn't effective until the end of July.
baker.make(
"SpecialSquare",
square=24,
type__auto_move=5,
type__image="",
start=utc.localize(datetime(2369, 8, 1)),
)
# Create some rolls, all which take place in July.
for day_of_month, roll in enumerate([3, 20, 2]):
baker.make(
"Roll",
number=roll,
embargo=utc.localize(datetime(2369, 7, day_of_month + 1)),
)
# Assert that calculate_position doesn't take the special square into consideration.
assert board.calculate_position(utc.localize(datetime(2369, 7, 1, 1))) == 4
assert board.calculate_position(utc.localize(datetime(2369, 7, 2, 1))) == 24
assert board.calculate_position(utc.localize(datetime(2369, 7, 3, 1))) == 26
@pytest.mark.django_db
def test_special_square_after_effective():
"""Test that a special square has no effect after it's time frame has passed."""
# Make a special square which isn't effective until the start of July.
baker.make(
"SpecialSquare",
square=24,
type__auto_move=5,
type__image="",
end=utc.localize(datetime(2369, 7, 1, 0, 0)),
)
# Create some rolls, all which take place in July.
for day_of_month, roll in enumerate([3, 20, 2]):
baker.make(
"Roll",
number=roll,
embargo=utc.localize(datetime(2369, 7, day_of_month + 1)),
)
# Assert that calculate_position doesn't take the special square into consideration.
assert board.calculate_position(utc.localize(datetime(2369, 7, 1, 0, 0))) == 4
assert board.calculate_position(utc.localize(datetime(2369, 7, 2, 0, 0))) == 24
assert board.calculate_position(utc.localize(datetime(2369, 7, 3, 0, 0))) == 26
@pytest.mark.django_db
@pytest.mark.parametrize(
"rolls, expected_position",
[
([3, 20, 2, 40, 17, 5, 10, 1], 99),
([3, 20, 2, 40, 17, 5, 10, 2], 100),
([3, 20, 2, 40, 17, 5, 10, 3], 1),
([3, 20, 2, 40, 17, 5, 10, 6], 4),
],
)
def test_100(rolls, expected_position):
"""Tests for series of rolls around 100."""
# Create a series of rolls which move the runabout to position 99.
for day_of_month, roll in enumerate(rolls):
baker.make(
"Roll",
number=roll,
embargo=utc.localize(datetime(2369, 7, day_of_month + 1)),
)
assert (
board.calculate_position(utc.localize(datetime(2369, 12, 31)))
== expected_position
)
@pytest.mark.django_db
def test_butthole_after_100():
"""Test that buttholes take effect on the second time around to board."""
# Positions should be calculated as 99, 9, and 14…
for day_of_month, roll in enumerate([98, 10, 5]):
baker.make(
"Roll",
number=roll,
embargo=utc.localize(datetime(2369, 7, day_of_month + 1)),
)
# …except there's a butthole from 9 to 2, meaning the positions should be 99, 2,
# and 7.
baker.make("Butthole", start_square=9, end_square=2)
assert board.calculate_position(utc.localize(datetime(2369, 12, 31))) == 7
| 34.866397
| 88
| 0.644914
| 1,227
| 8,612
| 4.403423
| 0.118989
| 0.083472
| 0.144179
| 0.174533
| 0.855636
| 0.839534
| 0.819915
| 0.783639
| 0.712382
| 0.683879
| 0
| 0.072895
| 0.230608
| 8,612
| 246
| 89
| 35.00813
| 0.741624
| 0.226544
| 0
| 0.555556
| 0
| 0
| 0.023132
| 0
| 0
| 0
| 0
| 0
| 0.166667
| 1
| 0.080247
| false
| 0
| 0.030864
| 0
| 0.111111
| 0
| 0
| 0
| 0
| null | 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
33212d4c5909bf57bead046c29482c9cab755f0d
| 34,891
|
py
|
Python
|
sunshine_conversations_client/api/webhooks_api.py
|
Dima2022/sunshine-conversations-python
|
8085a82dc320d97f09bb0174d11dd1865a65404a
|
[
"Apache-2.0"
] | 4
|
2020-09-27T14:28:25.000Z
|
2022-02-02T13:51:29.000Z
|
sunshine_conversations_client/api/webhooks_api.py
|
Dima2022/sunshine-conversations-python
|
8085a82dc320d97f09bb0174d11dd1865a65404a
|
[
"Apache-2.0"
] | 3
|
2021-09-30T18:18:58.000Z
|
2021-12-04T07:55:23.000Z
|
sunshine_conversations_client/api/webhooks_api.py
|
Dima2022/sunshine-conversations-python
|
8085a82dc320d97f09bb0174d11dd1865a65404a
|
[
"Apache-2.0"
] | 5
|
2020-11-07T02:08:18.000Z
|
2021-12-07T17:10:23.000Z
|
# coding: utf-8
"""
Sunshine Conversations API
The version of the OpenAPI document: 9.4.5
Generated by: https://openapi-generator.tech
"""
from __future__ import absolute_import
import re # noqa: F401
# python 2 and python 3 compatibility library
import six
from sunshine_conversations_client.api_client import ApiClient
from sunshine_conversations_client.exceptions import ( # noqa: F401
ApiTypeError,
ApiValueError
)
class WebhooksApi(object):
"""NOTE: This class is auto generated by OpenAPI Generator
Ref: https://openapi-generator.tech
Do not edit the class manually.
"""
def __init__(self, api_client=None):
if api_client is None:
api_client = ApiClient()
self.api_client = api_client
def create_webhook(self, app_id, integration_id, webhook_create_body, **kwargs): # noqa: E501
"""Create Webhook # noqa: E501
Creates a new webhook associated with a Sunshine Conversations Connect integration or a custom integration. # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.create_webhook(app_id, integration_id, webhook_create_body, async_req=True)
>>> result = thread.get()
:param async_req bool: execute request asynchronously
:param str app_id: Identifies the app. (required)
:param str integration_id: The id of the integration. (required)
:param WebhookCreateBody webhook_create_body: (required)
:param _preload_content: if False, the urllib3.HTTPResponse object will
be returned without reading/decoding response
data. Default is True.
:param _request_timeout: timeout setting for this request. If one
number provided, it will be total request
timeout. It can also be a pair (tuple) of
(connection, read) timeouts.
:return: WebhookResponse
If the method is called asynchronously,
returns the request thread.
"""
kwargs['_return_http_data_only'] = True
return self.create_webhook_with_http_info(app_id, integration_id, webhook_create_body, **kwargs) # noqa: E501
def create_webhook_with_http_info(self, app_id, integration_id, webhook_create_body, **kwargs): # noqa: E501
"""Create Webhook # noqa: E501
Creates a new webhook associated with a Sunshine Conversations Connect integration or a custom integration. # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.create_webhook_with_http_info(app_id, integration_id, webhook_create_body, async_req=True)
>>> result = thread.get()
:param async_req bool: execute request asynchronously
:param str app_id: Identifies the app. (required)
:param str integration_id: The id of the integration. (required)
:param WebhookCreateBody webhook_create_body: (required)
:param _return_http_data_only: response data without head status code
and headers
:param _preload_content: if False, the urllib3.HTTPResponse object will
be returned without reading/decoding response
data. Default is True.
:param _request_timeout: timeout setting for this request. If one
number provided, it will be total request
timeout. It can also be a pair (tuple) of
(connection, read) timeouts.
:return: tuple(WebhookResponse, status_code(int), headers(HTTPHeaderDict))
If the method is called asynchronously,
returns the request thread.
"""
local_var_params = locals()
all_params = [
'app_id',
'integration_id',
'webhook_create_body'
]
all_params.extend(
[
'async_req',
'_return_http_data_only',
'_preload_content',
'_request_timeout'
]
)
for key, val in six.iteritems(local_var_params['kwargs']):
if key not in all_params:
raise ApiTypeError(
"Got an unexpected keyword argument '%s'"
" to method create_webhook" % key
)
local_var_params[key] = val
del local_var_params['kwargs']
# verify the required parameter 'app_id' is set
if self.api_client.client_side_validation and ('app_id' not in local_var_params or # noqa: E501
local_var_params['app_id'] is None): # noqa: E501
raise ApiValueError("Missing the required parameter `app_id` when calling `create_webhook`") # noqa: E501
# verify the required parameter 'integration_id' is set
if self.api_client.client_side_validation and ('integration_id' not in local_var_params or # noqa: E501
local_var_params['integration_id'] is None): # noqa: E501
raise ApiValueError("Missing the required parameter `integration_id` when calling `create_webhook`") # noqa: E501
# verify the required parameter 'webhook_create_body' is set
if self.api_client.client_side_validation and ('webhook_create_body' not in local_var_params or # noqa: E501
local_var_params['webhook_create_body'] is None): # noqa: E501
raise ApiValueError("Missing the required parameter `webhook_create_body` when calling `create_webhook`") # noqa: E501
collection_formats = {}
path_params = {}
if 'app_id' in local_var_params:
path_params['appId'] = local_var_params['app_id'] # noqa: E501
if 'integration_id' in local_var_params:
path_params['integrationId'] = local_var_params['integration_id'] # noqa: E501
query_params = []
header_params = {}
form_params = []
local_var_files = {}
body_params = None
if 'webhook_create_body' in local_var_params:
body_params = local_var_params['webhook_create_body']
# HTTP header `Accept`
header_params['Accept'] = self.api_client.select_header_accept(
['application/json']) # noqa: E501
# HTTP header `Content-Type`
header_params['Content-Type'] = self.api_client.select_header_content_type( # noqa: E501
['application/json']) # noqa: E501
# Authentication setting
auth_settings = ['basicAuth', 'bearerAuth'] # noqa: E501
return self.api_client.call_api(
'/v2/apps/{appId}/integrations/{integrationId}/webhooks', 'POST',
path_params,
query_params,
header_params,
body=body_params,
post_params=form_params,
files=local_var_files,
response_type='WebhookResponse', # noqa: E501
auth_settings=auth_settings,
async_req=local_var_params.get('async_req'),
_return_http_data_only=local_var_params.get('_return_http_data_only'), # noqa: E501
_preload_content=local_var_params.get('_preload_content', True),
_request_timeout=local_var_params.get('_request_timeout'),
collection_formats=collection_formats)
def delete_webhook(self, app_id, integration_id, webhook_id, **kwargs): # noqa: E501
"""Delete Webhook # noqa: E501
Deletes the specified webhook associated with a Sunshine Conversations Connect integration or a custom integration. # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.delete_webhook(app_id, integration_id, webhook_id, async_req=True)
>>> result = thread.get()
:param async_req bool: execute request asynchronously
:param str app_id: Identifies the app. (required)
:param str integration_id: The id of the integration. (required)
:param str webhook_id: The id of the webhook. (required)
:param _preload_content: if False, the urllib3.HTTPResponse object will
be returned without reading/decoding response
data. Default is True.
:param _request_timeout: timeout setting for this request. If one
number provided, it will be total request
timeout. It can also be a pair (tuple) of
(connection, read) timeouts.
:return: object
If the method is called asynchronously,
returns the request thread.
"""
kwargs['_return_http_data_only'] = True
return self.delete_webhook_with_http_info(app_id, integration_id, webhook_id, **kwargs) # noqa: E501
def delete_webhook_with_http_info(self, app_id, integration_id, webhook_id, **kwargs): # noqa: E501
"""Delete Webhook # noqa: E501
Deletes the specified webhook associated with a Sunshine Conversations Connect integration or a custom integration. # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.delete_webhook_with_http_info(app_id, integration_id, webhook_id, async_req=True)
>>> result = thread.get()
:param async_req bool: execute request asynchronously
:param str app_id: Identifies the app. (required)
:param str integration_id: The id of the integration. (required)
:param str webhook_id: The id of the webhook. (required)
:param _return_http_data_only: response data without head status code
and headers
:param _preload_content: if False, the urllib3.HTTPResponse object will
be returned without reading/decoding response
data. Default is True.
:param _request_timeout: timeout setting for this request. If one
number provided, it will be total request
timeout. It can also be a pair (tuple) of
(connection, read) timeouts.
:return: tuple(object, status_code(int), headers(HTTPHeaderDict))
If the method is called asynchronously,
returns the request thread.
"""
local_var_params = locals()
all_params = [
'app_id',
'integration_id',
'webhook_id'
]
all_params.extend(
[
'async_req',
'_return_http_data_only',
'_preload_content',
'_request_timeout'
]
)
for key, val in six.iteritems(local_var_params['kwargs']):
if key not in all_params:
raise ApiTypeError(
"Got an unexpected keyword argument '%s'"
" to method delete_webhook" % key
)
local_var_params[key] = val
del local_var_params['kwargs']
# verify the required parameter 'app_id' is set
if self.api_client.client_side_validation and ('app_id' not in local_var_params or # noqa: E501
local_var_params['app_id'] is None): # noqa: E501
raise ApiValueError("Missing the required parameter `app_id` when calling `delete_webhook`") # noqa: E501
# verify the required parameter 'integration_id' is set
if self.api_client.client_side_validation and ('integration_id' not in local_var_params or # noqa: E501
local_var_params['integration_id'] is None): # noqa: E501
raise ApiValueError("Missing the required parameter `integration_id` when calling `delete_webhook`") # noqa: E501
# verify the required parameter 'webhook_id' is set
if self.api_client.client_side_validation and ('webhook_id' not in local_var_params or # noqa: E501
local_var_params['webhook_id'] is None): # noqa: E501
raise ApiValueError("Missing the required parameter `webhook_id` when calling `delete_webhook`") # noqa: E501
collection_formats = {}
path_params = {}
if 'app_id' in local_var_params:
path_params['appId'] = local_var_params['app_id'] # noqa: E501
if 'integration_id' in local_var_params:
path_params['integrationId'] = local_var_params['integration_id'] # noqa: E501
if 'webhook_id' in local_var_params:
path_params['webhookId'] = local_var_params['webhook_id'] # noqa: E501
query_params = []
header_params = {}
form_params = []
local_var_files = {}
body_params = None
# HTTP header `Accept`
header_params['Accept'] = self.api_client.select_header_accept(
['application/json']) # noqa: E501
# Authentication setting
auth_settings = ['basicAuth', 'bearerAuth'] # noqa: E501
return self.api_client.call_api(
'/v2/apps/{appId}/integrations/{integrationId}/webhooks/{webhookId}', 'DELETE',
path_params,
query_params,
header_params,
body=body_params,
post_params=form_params,
files=local_var_files,
response_type='object', # noqa: E501
auth_settings=auth_settings,
async_req=local_var_params.get('async_req'),
_return_http_data_only=local_var_params.get('_return_http_data_only'), # noqa: E501
_preload_content=local_var_params.get('_preload_content', True),
_request_timeout=local_var_params.get('_request_timeout'),
collection_formats=collection_formats)
def get_webhook(self, app_id, integration_id, webhook_id, **kwargs): # noqa: E501
"""Get Webhook # noqa: E501
Gets the specified webhook associated with a Sunshine Conversations Connect integration or a custom integration. # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.get_webhook(app_id, integration_id, webhook_id, async_req=True)
>>> result = thread.get()
:param async_req bool: execute request asynchronously
:param str app_id: Identifies the app. (required)
:param str integration_id: The id of the integration. (required)
:param str webhook_id: The id of the webhook. (required)
:param _preload_content: if False, the urllib3.HTTPResponse object will
be returned without reading/decoding response
data. Default is True.
:param _request_timeout: timeout setting for this request. If one
number provided, it will be total request
timeout. It can also be a pair (tuple) of
(connection, read) timeouts.
:return: WebhookResponse
If the method is called asynchronously,
returns the request thread.
"""
kwargs['_return_http_data_only'] = True
return self.get_webhook_with_http_info(app_id, integration_id, webhook_id, **kwargs) # noqa: E501
def get_webhook_with_http_info(self, app_id, integration_id, webhook_id, **kwargs): # noqa: E501
"""Get Webhook # noqa: E501
Gets the specified webhook associated with a Sunshine Conversations Connect integration or a custom integration. # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.get_webhook_with_http_info(app_id, integration_id, webhook_id, async_req=True)
>>> result = thread.get()
:param async_req bool: execute request asynchronously
:param str app_id: Identifies the app. (required)
:param str integration_id: The id of the integration. (required)
:param str webhook_id: The id of the webhook. (required)
:param _return_http_data_only: response data without head status code
and headers
:param _preload_content: if False, the urllib3.HTTPResponse object will
be returned without reading/decoding response
data. Default is True.
:param _request_timeout: timeout setting for this request. If one
number provided, it will be total request
timeout. It can also be a pair (tuple) of
(connection, read) timeouts.
:return: tuple(WebhookResponse, status_code(int), headers(HTTPHeaderDict))
If the method is called asynchronously,
returns the request thread.
"""
local_var_params = locals()
all_params = [
'app_id',
'integration_id',
'webhook_id'
]
all_params.extend(
[
'async_req',
'_return_http_data_only',
'_preload_content',
'_request_timeout'
]
)
for key, val in six.iteritems(local_var_params['kwargs']):
if key not in all_params:
raise ApiTypeError(
"Got an unexpected keyword argument '%s'"
" to method get_webhook" % key
)
local_var_params[key] = val
del local_var_params['kwargs']
# verify the required parameter 'app_id' is set
if self.api_client.client_side_validation and ('app_id' not in local_var_params or # noqa: E501
local_var_params['app_id'] is None): # noqa: E501
raise ApiValueError("Missing the required parameter `app_id` when calling `get_webhook`") # noqa: E501
# verify the required parameter 'integration_id' is set
if self.api_client.client_side_validation and ('integration_id' not in local_var_params or # noqa: E501
local_var_params['integration_id'] is None): # noqa: E501
raise ApiValueError("Missing the required parameter `integration_id` when calling `get_webhook`") # noqa: E501
# verify the required parameter 'webhook_id' is set
if self.api_client.client_side_validation and ('webhook_id' not in local_var_params or # noqa: E501
local_var_params['webhook_id'] is None): # noqa: E501
raise ApiValueError("Missing the required parameter `webhook_id` when calling `get_webhook`") # noqa: E501
collection_formats = {}
path_params = {}
if 'app_id' in local_var_params:
path_params['appId'] = local_var_params['app_id'] # noqa: E501
if 'integration_id' in local_var_params:
path_params['integrationId'] = local_var_params['integration_id'] # noqa: E501
if 'webhook_id' in local_var_params:
path_params['webhookId'] = local_var_params['webhook_id'] # noqa: E501
query_params = []
header_params = {}
form_params = []
local_var_files = {}
body_params = None
# HTTP header `Accept`
header_params['Accept'] = self.api_client.select_header_accept(
['application/json']) # noqa: E501
# Authentication setting
auth_settings = ['basicAuth', 'bearerAuth'] # noqa: E501
return self.api_client.call_api(
'/v2/apps/{appId}/integrations/{integrationId}/webhooks/{webhookId}', 'GET',
path_params,
query_params,
header_params,
body=body_params,
post_params=form_params,
files=local_var_files,
response_type='WebhookResponse', # noqa: E501
auth_settings=auth_settings,
async_req=local_var_params.get('async_req'),
_return_http_data_only=local_var_params.get('_return_http_data_only'), # noqa: E501
_preload_content=local_var_params.get('_preload_content', True),
_request_timeout=local_var_params.get('_request_timeout'),
collection_formats=collection_formats)
def list_webhooks(self, app_id, integration_id, **kwargs): # noqa: E501
"""List Webhooks # noqa: E501
Lists all webhooks for a given Sunshine Conversations Connect integration or custom integration. # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.list_webhooks(app_id, integration_id, async_req=True)
>>> result = thread.get()
:param async_req bool: execute request asynchronously
:param str app_id: Identifies the app. (required)
:param str integration_id: The id of the integration. (required)
:param _preload_content: if False, the urllib3.HTTPResponse object will
be returned without reading/decoding response
data. Default is True.
:param _request_timeout: timeout setting for this request. If one
number provided, it will be total request
timeout. It can also be a pair (tuple) of
(connection, read) timeouts.
:return: WebhookListResponse
If the method is called asynchronously,
returns the request thread.
"""
kwargs['_return_http_data_only'] = True
return self.list_webhooks_with_http_info(app_id, integration_id, **kwargs) # noqa: E501
def list_webhooks_with_http_info(self, app_id, integration_id, **kwargs): # noqa: E501
"""List Webhooks # noqa: E501
Lists all webhooks for a given Sunshine Conversations Connect integration or custom integration. # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.list_webhooks_with_http_info(app_id, integration_id, async_req=True)
>>> result = thread.get()
:param async_req bool: execute request asynchronously
:param str app_id: Identifies the app. (required)
:param str integration_id: The id of the integration. (required)
:param _return_http_data_only: response data without head status code
and headers
:param _preload_content: if False, the urllib3.HTTPResponse object will
be returned without reading/decoding response
data. Default is True.
:param _request_timeout: timeout setting for this request. If one
number provided, it will be total request
timeout. It can also be a pair (tuple) of
(connection, read) timeouts.
:return: tuple(WebhookListResponse, status_code(int), headers(HTTPHeaderDict))
If the method is called asynchronously,
returns the request thread.
"""
local_var_params = locals()
all_params = [
'app_id',
'integration_id'
]
all_params.extend(
[
'async_req',
'_return_http_data_only',
'_preload_content',
'_request_timeout'
]
)
for key, val in six.iteritems(local_var_params['kwargs']):
if key not in all_params:
raise ApiTypeError(
"Got an unexpected keyword argument '%s'"
" to method list_webhooks" % key
)
local_var_params[key] = val
del local_var_params['kwargs']
# verify the required parameter 'app_id' is set
if self.api_client.client_side_validation and ('app_id' not in local_var_params or # noqa: E501
local_var_params['app_id'] is None): # noqa: E501
raise ApiValueError("Missing the required parameter `app_id` when calling `list_webhooks`") # noqa: E501
# verify the required parameter 'integration_id' is set
if self.api_client.client_side_validation and ('integration_id' not in local_var_params or # noqa: E501
local_var_params['integration_id'] is None): # noqa: E501
raise ApiValueError("Missing the required parameter `integration_id` when calling `list_webhooks`") # noqa: E501
collection_formats = {}
path_params = {}
if 'app_id' in local_var_params:
path_params['appId'] = local_var_params['app_id'] # noqa: E501
if 'integration_id' in local_var_params:
path_params['integrationId'] = local_var_params['integration_id'] # noqa: E501
query_params = []
header_params = {}
form_params = []
local_var_files = {}
body_params = None
# HTTP header `Accept`
header_params['Accept'] = self.api_client.select_header_accept(
['application/json']) # noqa: E501
# Authentication setting
auth_settings = ['basicAuth', 'bearerAuth'] # noqa: E501
return self.api_client.call_api(
'/v2/apps/{appId}/integrations/{integrationId}/webhooks', 'GET',
path_params,
query_params,
header_params,
body=body_params,
post_params=form_params,
files=local_var_files,
response_type='WebhookListResponse', # noqa: E501
auth_settings=auth_settings,
async_req=local_var_params.get('async_req'),
_return_http_data_only=local_var_params.get('_return_http_data_only'), # noqa: E501
_preload_content=local_var_params.get('_preload_content', True),
_request_timeout=local_var_params.get('_request_timeout'),
collection_formats=collection_formats)
def update_webhook(self, app_id, integration_id, webhook_id, webhook_body, **kwargs): # noqa: E501
"""Update Webhook # noqa: E501
Updates the specified webhook associated with a Sunshine Conversations Connect integration or a custom integration. # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.update_webhook(app_id, integration_id, webhook_id, webhook_body, async_req=True)
>>> result = thread.get()
:param async_req bool: execute request asynchronously
:param str app_id: Identifies the app. (required)
:param str integration_id: The id of the integration. (required)
:param str webhook_id: The id of the webhook. (required)
:param WebhookBody webhook_body: (required)
:param _preload_content: if False, the urllib3.HTTPResponse object will
be returned without reading/decoding response
data. Default is True.
:param _request_timeout: timeout setting for this request. If one
number provided, it will be total request
timeout. It can also be a pair (tuple) of
(connection, read) timeouts.
:return: WebhookResponse
If the method is called asynchronously,
returns the request thread.
"""
kwargs['_return_http_data_only'] = True
return self.update_webhook_with_http_info(app_id, integration_id, webhook_id, webhook_body, **kwargs) # noqa: E501
def update_webhook_with_http_info(self, app_id, integration_id, webhook_id, webhook_body, **kwargs): # noqa: E501
"""Update Webhook # noqa: E501
Updates the specified webhook associated with a Sunshine Conversations Connect integration or a custom integration. # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.update_webhook_with_http_info(app_id, integration_id, webhook_id, webhook_body, async_req=True)
>>> result = thread.get()
:param async_req bool: execute request asynchronously
:param str app_id: Identifies the app. (required)
:param str integration_id: The id of the integration. (required)
:param str webhook_id: The id of the webhook. (required)
:param WebhookBody webhook_body: (required)
:param _return_http_data_only: response data without head status code
and headers
:param _preload_content: if False, the urllib3.HTTPResponse object will
be returned without reading/decoding response
data. Default is True.
:param _request_timeout: timeout setting for this request. If one
number provided, it will be total request
timeout. It can also be a pair (tuple) of
(connection, read) timeouts.
:return: tuple(WebhookResponse, status_code(int), headers(HTTPHeaderDict))
If the method is called asynchronously,
returns the request thread.
"""
local_var_params = locals()
all_params = [
'app_id',
'integration_id',
'webhook_id',
'webhook_body'
]
all_params.extend(
[
'async_req',
'_return_http_data_only',
'_preload_content',
'_request_timeout'
]
)
for key, val in six.iteritems(local_var_params['kwargs']):
if key not in all_params:
raise ApiTypeError(
"Got an unexpected keyword argument '%s'"
" to method update_webhook" % key
)
local_var_params[key] = val
del local_var_params['kwargs']
# verify the required parameter 'app_id' is set
if self.api_client.client_side_validation and ('app_id' not in local_var_params or # noqa: E501
local_var_params['app_id'] is None): # noqa: E501
raise ApiValueError("Missing the required parameter `app_id` when calling `update_webhook`") # noqa: E501
# verify the required parameter 'integration_id' is set
if self.api_client.client_side_validation and ('integration_id' not in local_var_params or # noqa: E501
local_var_params['integration_id'] is None): # noqa: E501
raise ApiValueError("Missing the required parameter `integration_id` when calling `update_webhook`") # noqa: E501
# verify the required parameter 'webhook_id' is set
if self.api_client.client_side_validation and ('webhook_id' not in local_var_params or # noqa: E501
local_var_params['webhook_id'] is None): # noqa: E501
raise ApiValueError("Missing the required parameter `webhook_id` when calling `update_webhook`") # noqa: E501
# verify the required parameter 'webhook_body' is set
if self.api_client.client_side_validation and ('webhook_body' not in local_var_params or # noqa: E501
local_var_params['webhook_body'] is None): # noqa: E501
raise ApiValueError("Missing the required parameter `webhook_body` when calling `update_webhook`") # noqa: E501
collection_formats = {}
path_params = {}
if 'app_id' in local_var_params:
path_params['appId'] = local_var_params['app_id'] # noqa: E501
if 'integration_id' in local_var_params:
path_params['integrationId'] = local_var_params['integration_id'] # noqa: E501
if 'webhook_id' in local_var_params:
path_params['webhookId'] = local_var_params['webhook_id'] # noqa: E501
query_params = []
header_params = {}
form_params = []
local_var_files = {}
body_params = None
if 'webhook_body' in local_var_params:
body_params = local_var_params['webhook_body']
# HTTP header `Accept`
header_params['Accept'] = self.api_client.select_header_accept(
['application/json']) # noqa: E501
# HTTP header `Content-Type`
header_params['Content-Type'] = self.api_client.select_header_content_type( # noqa: E501
['application/json']) # noqa: E501
# Authentication setting
auth_settings = ['basicAuth', 'bearerAuth'] # noqa: E501
return self.api_client.call_api(
'/v2/apps/{appId}/integrations/{integrationId}/webhooks/{webhookId}', 'PATCH',
path_params,
query_params,
header_params,
body=body_params,
post_params=form_params,
files=local_var_files,
response_type='WebhookResponse', # noqa: E501
auth_settings=auth_settings,
async_req=local_var_params.get('async_req'),
_return_http_data_only=local_var_params.get('_return_http_data_only'), # noqa: E501
_preload_content=local_var_params.get('_preload_content', True),
_request_timeout=local_var_params.get('_request_timeout'),
collection_formats=collection_formats)
| 49.56108
| 137
| 0.608982
| 3,943
| 34,891
| 5.133147
| 0.050723
| 0.046245
| 0.06917
| 0.02668
| 0.965267
| 0.962994
| 0.959931
| 0.956966
| 0.955336
| 0.952668
| 0
| 0.015887
| 0.318076
| 34,891
| 703
| 138
| 49.631579
| 0.834783
| 0.429136
| 0
| 0.73487
| 1
| 0
| 0.210459
| 0.036474
| 0
| 0
| 0
| 0
| 0
| 1
| 0.0317
| false
| 0
| 0.014409
| 0
| 0.07781
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
687edfe8fb6b5d24b966b255afaff2eb5d6e9027
| 5,967
|
py
|
Python
|
tests/git/test_create_git.py
|
christiansiegel/gitopscli
|
9748e498155f782eddf48d35f6d4a1676f08d196
|
[
"Apache-2.0"
] | null | null | null |
tests/git/test_create_git.py
|
christiansiegel/gitopscli
|
9748e498155f782eddf48d35f6d4a1676f08d196
|
[
"Apache-2.0"
] | null | null | null |
tests/git/test_create_git.py
|
christiansiegel/gitopscli
|
9748e498155f782eddf48d35f6d4a1676f08d196
|
[
"Apache-2.0"
] | null | null | null |
from os import path, makedirs
import unittest
from unittest.mock import patch, MagicMock
import uuid
from pathlib import Path
from git import Repo
import pytest
from gitopscli.gitops_exception import GitOpsException
from gitopscli.git.create_git import create_git
class CreateGitTest(unittest.TestCase):
@patch("gitopscli.git.create_git.GithubGitUtil")
def test_github(self, mock_github_git_util_constructor):
mock_github_git_util = MagicMock()
mock_github_git_util_constructor.return_value = mock_github_git_util
git = create_git(
tmp_dir="TMP_DIR",
username="USER",
password="PASS",
git_user="GIT_USER",
git_email="GIT_EMAIL",
organisation="ORG",
repository_name="REPO",
git_provider="github",
git_provider_url=None,
)
self.assertEqual(git, mock_github_git_util)
mock_github_git_util_constructor.assert_called_with(
tmp_dir="TMP_DIR",
username="USER",
password="PASS",
git_user="GIT_USER",
git_email="GIT_EMAIL",
organisation="ORG",
repository_name="REPO",
)
@patch("gitopscli.git.create_git.GithubGitUtil")
def test_github_via_git_provider_url(self, mock_github_git_util_constructor):
mock_github_git_util = MagicMock()
mock_github_git_util_constructor.return_value = mock_github_git_util
git = create_git(
tmp_dir="TMP_DIR",
username="USER",
password="PASS",
git_user="GIT_USER",
git_email="GIT_EMAIL",
organisation="ORG",
repository_name="REPO",
git_provider=None,
git_provider_url="www.github.com",
)
self.assertEqual(git, mock_github_git_util)
mock_github_git_util_constructor.assert_called_with(
tmp_dir="TMP_DIR",
username="USER",
password="PASS",
git_user="GIT_USER",
git_email="GIT_EMAIL",
organisation="ORG",
repository_name="REPO",
)
@patch("gitopscli.git.create_git.BitBucketGitUtil")
def test_bitbucket_server(self, mock_bitbucket_git_util_constructor):
mock_bitbucket_git_util = MagicMock()
mock_bitbucket_git_util_constructor.return_value = mock_bitbucket_git_util
git = create_git(
tmp_dir="TMP_DIR",
username="USER",
password="PASS",
git_user="GIT_USER",
git_email="GIT_EMAIL",
organisation="ORG",
repository_name="REPO",
git_provider="bitbucket-server",
git_provider_url="GIT_PROVIDER_URL",
)
self.assertEqual(git, mock_bitbucket_git_util)
mock_bitbucket_git_util_constructor.assert_called_with(
tmp_dir="TMP_DIR",
username="USER",
password="PASS",
git_user="GIT_USER",
git_email="GIT_EMAIL",
organisation="ORG",
repository_name="REPO",
git_provider_url="GIT_PROVIDER_URL",
)
def test_bitbucket_server_missing_git_provider_url(self):
with pytest.raises(GitOpsException) as ex:
create_git(
tmp_dir="TMP_DIR",
username="USER",
password="PASS",
git_user="GIT_USER",
git_email="GIT_EMAIL",
organisation="ORG",
repository_name="REPO",
git_provider="bitbucket-server",
git_provider_url=None, # <- missing
)
self.assertEqual("Please provide --git-provider-url for bitbucket-server", str(ex.value))
@patch("gitopscli.git.create_git.BitBucketGitUtil")
def test_bitbucket_server_via_git_provider_url(self, mock_bitbucket_git_util_constructor):
mock_bitbucket_git_util = MagicMock()
mock_bitbucket_git_util_constructor.return_value = mock_bitbucket_git_util
git = create_git(
tmp_dir="TMP_DIR",
username="USER",
password="PASS",
git_user="GIT_USER",
git_email="GIT_EMAIL",
organisation="ORG",
repository_name="REPO",
git_provider=None,
git_provider_url="bitbucket.baloise.dev",
)
self.assertEqual(git, mock_bitbucket_git_util)
mock_bitbucket_git_util_constructor.assert_called_with(
tmp_dir="TMP_DIR",
username="USER",
password="PASS",
git_user="GIT_USER",
git_email="GIT_EMAIL",
organisation="ORG",
repository_name="REPO",
git_provider_url="bitbucket.baloise.dev",
)
def test_unknown_git_provider(self):
with pytest.raises(GitOpsException) as ex:
create_git(
tmp_dir="TMP_DIR",
username="USER",
password="PASS",
git_user="GIT_USER",
git_email="GIT_EMAIL",
organisation="ORG",
repository_name="REPO",
git_provider="unknown", # <- unknown
git_provider_url="GIT_PROVIDER_URL",
)
self.assertEqual("Git provider 'unknown' is not supported.", str(ex.value))
def test_cannot_infer_git_provider_from_url(self):
with pytest.raises(GitOpsException) as ex:
create_git(
tmp_dir="TMP_DIR",
username="USER",
password="PASS",
git_user="GIT_USER",
git_email="GIT_EMAIL",
organisation="ORG",
repository_name="REPO",
git_provider=None,
git_provider_url="some.unknown-url.com",
)
self.assertEqual("Please provide --git-provider", str(ex.value))
| 34.69186
| 97
| 0.591252
| 637
| 5,967
| 5.150706
| 0.11303
| 0.090521
| 0.067053
| 0.062176
| 0.843645
| 0.843645
| 0.79366
| 0.79366
| 0.79366
| 0.7516
| 0
| 0
| 0.314563
| 5,967
| 171
| 98
| 34.894737
| 0.8022
| 0.003519
| 0
| 0.772727
| 0
| 0
| 0.147905
| 0.033653
| 0
| 0
| 0
| 0
| 0.071429
| 1
| 0.045455
| false
| 0.071429
| 0.058442
| 0
| 0.11039
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
|
0
| 8
|
6893046a85aba289ae157f9e16f318f9f4605f9a
| 106
|
py
|
Python
|
test_sample.py
|
zima-blue-8/test-pub
|
3ae0a974b4c0fd0446f23e844efe075dc23bb9bc
|
[
"MIT"
] | null | null | null |
test_sample.py
|
zima-blue-8/test-pub
|
3ae0a974b4c0fd0446f23e844efe075dc23bb9bc
|
[
"MIT"
] | null | null | null |
test_sample.py
|
zima-blue-8/test-pub
|
3ae0a974b4c0fd0446f23e844efe075dc23bb9bc
|
[
"MIT"
] | null | null | null |
def inc(x):
return x + 1
def test_pass():
assert inc(7) == 8
def test_fail():
assert inc(3) == 5
| 10.6
| 20
| 0.575472
| 20
| 106
| 2.95
| 0.65
| 0.237288
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.063291
| 0.254717
| 106
| 9
| 21
| 11.777778
| 0.683544
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.333333
| 1
| 0.5
| false
| 0.166667
| 0
| 0.166667
| 0.666667
| 0
| 1
| 0
| 0
| null | 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 1
| 0
|
0
| 7
|
d79c7f2d01d511495ceaffdca8a7b4076dbf26b8
| 13,350
|
py
|
Python
|
t/indices_build_test.py
|
rohankumardubey/orioledb
|
a736714ed5d71c7f85bee23150c4432b3fbdff1f
|
[
"PostgreSQL"
] | 947
|
2021-11-29T10:58:09.000Z
|
2022-03-31T18:14:07.000Z
|
t/indices_build_test.py
|
rohankumardubey/orioledb
|
a736714ed5d71c7f85bee23150c4432b3fbdff1f
|
[
"PostgreSQL"
] | 22
|
2021-12-12T22:02:32.000Z
|
2022-03-30T19:31:46.000Z
|
t/indices_build_test.py
|
rohankumardubey/orioledb
|
a736714ed5d71c7f85bee23150c4432b3fbdff1f
|
[
"PostgreSQL"
] | 30
|
2021-12-15T01:11:09.000Z
|
2022-03-27T11:22:16.000Z
|
#!/usr/bin/env python3
# coding: utf-8
from .base_test import BaseTest, wait_checkpointer_stopevent
from .base_test import ThreadQueryExecutor
from .base_test import wait_checkpointer_stopevent
import re
class IndicesBuildTest(BaseTest):
def test_index_build_checkpoint(self):
node = self.node
node.start()
node.safe_psql('postgres',"""
CREATE EXTENSION orioledb;
CREATE TABLE o_indices0
(
key bigint NOT NULL,
val int,
val2 int,
PRIMARY KEY (key)
) USING orioledb;
CREATE INDEX o_indices0_idx0 ON o_indices0 (val2);
INSERT INTO o_indices0 SELECT 1000 + i, 3000 + i,
3000 + i FROM
generate_series(1, 500) AS i;
""")
node.safe_psql('postgres',"""
CREATE INDEX o_indices0_idx1 ON o_indices0 (val2);
""")
self.assertEqual(node.execute('postgres', 'SELECT count(*) FROM o_indices0;')[0][0], 500)
self.assertEqual(node.execute('postgres', 'SELECT count(val2) FROM o_indices0 WHERE val2 > 0;')[0][0], 500)
node.stop()
node.start()
self.assertEqual(node.execute('postgres', 'SELECT count(*) FROM o_indices0;')[0][0], 500)
self.assertEqual(node.execute('postgres', 'SELECT count(val2) FROM o_indices0 WHERE val2 > 0;')[0][0], 500)
node.stop()
def test_index_build_recovery(self):
node = self.node
node.append_conf('postgresql.conf',
"shared_preload_libraries = orioledb\n")
node.start()
node.safe_psql('postgres',"""
CREATE EXTENSION orioledb;
CREATE TABLE o_indices0
(
key TEXT NOT NULL,
val int,
val2 int,
PRIMARY KEY (key)
) USING orioledb;
INSERT INTO o_indices0 SELECT (1000 + i)::text, 3000 + i,
3000 + i FROM
generate_series(1, 500) AS i;
""")
node.safe_psql('postgres',"""
CREATE INDEX o_indices0_idx1 ON o_indices0 (val2);
""")
self.assertEqual(node.execute('postgres', 'SELECT count(*) FROM o_indices0;')[0][0], 500)
self.assertEqual(node.execute('postgres', 'SELECT count(val2) FROM o_indices0 WHERE val2 > 0;')[0][0], 500)
node.stop(['-m', 'immediate'])
node.start()
explain = node.safe_psql("""
SET enable_seqscan = off;
EXPLAIN SELECT * FROM o_indices0
WHERE val2 > 0 ORDER BY val2;""").decode('utf-8')
self.assertEqual(explain.find('o_indices0_pkey'), -1)
self.assertNotEqual(explain.find('o_indices0_idx1'), -1)
self.assertEqual(node.execute('postgres', 'SELECT count(*) FROM o_indices0;')[0][0], 500)
self.assertEqual(node.execute('postgres', 'SELECT count(val2) FROM o_indices0 WHERE val2 > 0;')[0][0], 500)
node.stop()
def test_drop_primary_recovery(self):
node = self.node
node.start()
node.safe_psql('postgres',"""
CREATE EXTENSION orioledb;
CREATE TABLE o_indices0
(
key TEXT NOT NULL,
val int,
val2 int,
PRIMARY KEY (key)
) USING orioledb;
INSERT INTO o_indices0 SELECT (1000 + i)::text, 3000 + i,
3000 + i FROM
generate_series(1, 500) AS i;
""")
node.safe_psql('postgres',"""
CREATE INDEX o_indices0_idx1 ON o_indices0 (val2);
""")
self.assertEqual(node.execute('postgres', 'SELECT count(*) FROM o_indices0;')[0][0], 500)
self.assertEqual(node.execute('postgres', 'SELECT count(val2) FROM o_indices0 WHERE val2 > 0;')[0][0], 500)
node.safe_psql('postgres',"""
ALTER TABLE o_indices0 DROP CONSTRAINT o_indices0_pkey;
""")
self.assertEqual(node.execute('postgres', 'SELECT count(*) FROM o_indices0;')[0][0], 500)
self.assertEqual(node.execute('postgres', 'SELECT count(val2) FROM o_indices0 WHERE val2 > 0;')[0][0], 500)
node.stop(['-m', 'immediate'])
node.start()
self.assertEqual(node.execute('postgres', 'SELECT count(*) FROM o_indices0;')[0][0], 500)
self.assertEqual(node.execute('postgres', 'SELECT count(val2) FROM o_indices0 WHERE val2 > 0;')[0][0], 500)
node.stop()
def test_create_primary_recovery(self):
node = self.node
node.start()
node.safe_psql('postgres',"""
CREATE EXTENSION orioledb;
CREATE TABLE o_indices0
(
key TEXT NOT NULL,
val int,
val2 int,
PRIMARY KEY (key)
) USING orioledb;
INSERT INTO o_indices0 SELECT (1000 + i)::text, 3000 + i,
3000 + i FROM
generate_series(1, 500) AS i;
""")
node.safe_psql('postgres',"""
CREATE INDEX o_indices0_idx1 ON o_indices0 (val2);
""")
self.assertEqual(node.execute('postgres', 'SELECT count(*) FROM o_indices0;')[0][0], 500)
self.assertEqual(node.execute('postgres', 'SELECT count(val2) FROM o_indices0 WHERE val2 > 0;')[0][0], 500)
node.safe_psql('postgres',"""
ALTER TABLE o_indices0 DROP CONSTRAINT o_indices0_pkey;
""")
node.safe_psql('postgres',"""
ALTER TABLE o_indices0
ADD CONSTRAINT o_indices0_pkey
PRIMARY KEY (key);
""")
self.assertEqual(node.execute('postgres', 'SELECT count(*) FROM o_indices0;')[0][0], 500)
self.assertEqual(node.execute('postgres', 'SELECT count(val2) FROM o_indices0 WHERE val2 > 0;')[0][0], 500)
node.stop(['-m', 'immediate'])
node.start()
self.assertEqual(node.execute('postgres', 'SELECT count(*) FROM o_indices0;')[0][0], 500)
self.assertEqual(node.execute('postgres', 'SELECT count(val2) FROM o_indices0 WHERE val2 > 0;')[0][0], 500)
node.stop()
def test_toast_recovery(self):
node = self.node
node.start()
string = self.genString(1, 4000)
test_tuple = (2, 'test', string)
node.safe_psql('postgres',"""
CREATE EXTENSION orioledb;
CREATE TABLE o_indices0
(
key integer NOT NULL,
val text COLLATE "C" NOT NULL,
val2 text COLLATE "C" NOT NULL,
PRIMARY KEY (key)
) USING orioledb;
INSERT INTO o_indices0 VALUES(2, 'test', '%s');
""" % string)
self.assertEqual(node.execute('postgres', 'SELECT * FROM o_indices0;')[0], test_tuple)
node.safe_psql('postgres',"""
ALTER TABLE o_indices0 DROP CONSTRAINT o_indices0_pkey;
""")
self.assertEqual(node.execute('postgres', 'SELECT * FROM o_indices0;')[0], test_tuple)
node.safe_psql('postgres',"""
ALTER TABLE o_indices0
ADD CONSTRAINT o_indices0_pkey
PRIMARY KEY (key);
""")
self.assertEqual(node.execute('postgres', 'SELECT * FROM o_indices0;')[0], test_tuple)
node.stop(['-m', 'immediate'])
node.start()
self.assertEqual(node.execute('postgres', 'SELECT * FROM o_indices0;')[0], test_tuple)
node.stop()
def check_used_index(self, node, query, expected_index):
explain = node.safe_psql("SET enable_seqscan = off; EXPLAIN %s;" % query).decode('utf-8')
groups = re.search(r'index (?:only )?scan of: (\w+).*', explain)
if groups:
used_index = groups.group(1)
else:
groups = re.search(r'Seq Scan on (\w+).*', explain)
used_index = groups.group(1)
self.assertEqual(expected_index, used_index)
self.assertEqual(node.execute("""
WITH o_test_cte AS (
%s
) SELECT COUNT(*) FROM o_test_cte;
""" % query)[0][0], 500)
node.poll_query_until("SELECT orioledb_has_retained_undo();",
expected = False)
def catchup_orioledb(self, replica):
# wait for synchronization
replica.catchup()
replica.poll_query_until("SELECT orioledb_recovery_synchronized();",
expected = True)
def test_index_build_replication(self):
with self.node as master:
master.start()
# create a backup
with self.getReplica().start() as replica:
master.safe_psql('postgres', """
CREATE EXTENSION IF NOT EXISTS orioledb;
CREATE TABLE o_indices0
(
key TEXT NOT NULL,
val int,
val2 int,
PRIMARY KEY (key)
) USING orioledb;
INSERT INTO o_indices0
SELECT 1000 + i, 3000 + i,
3000 + i FROM generate_series(1, 500) AS i;
""")
# CREATE INDEX replication of rollback and commit
with master.connect() as con:
con.execute("""
CREATE UNIQUE INDEX o_indices0_idx1
ON o_indices0 (val2);
""")
con.rollback()
self.catchup_orioledb(replica)
self.check_used_index(replica,
"""SELECT * FROM o_indices0
WHERE val2 > 0 AND val > 0 ORDER BY key""",
'o_indices0_pkey')
master.safe_psql('postgres', """
CREATE UNIQUE INDEX o_indices0_idx1
ON o_indices0 (val2);
""")
self.catchup_orioledb(replica)
self.check_used_index(replica,
"""SELECT * FROM o_indices0
WHERE val2 > 0 AND val > 0 ORDER BY val2""",
'o_indices0_idx1')
# primary index drop replication of rollback and commit
with master.connect() as con:
con.execute("""
ALTER TABLE o_indices0
DROP CONSTRAINT o_indices0_pkey;
""")
con.rollback()
self.catchup_orioledb(replica)
self.check_used_index(replica,
"SELECT * FROM o_indices0 ORDER BY key",
'o_indices0_pkey')
master.safe_psql('postgres', """
ALTER TABLE o_indices0 DROP CONSTRAINT o_indices0_pkey;
""")
self.catchup_orioledb(replica)
self.check_used_index(replica,
"SELECT * FROM o_indices0",
'o_indices0')
# primary index creation replication of rollback and commit
with master.connect() as con:
con.execute("""
ALTER TABLE o_indices0
ADD CONSTRAINT o_indices0_pkey
PRIMARY KEY (key);
""")
con.rollback()
self.catchup_orioledb(replica)
self.check_used_index(replica,
"SELECT * FROM o_indices0",
'o_indices0')
master.safe_psql('postgres', """
ALTER TABLE o_indices0
ADD CONSTRAINT o_indices0_pkey
PRIMARY KEY (key);
""")
self.catchup_orioledb(replica)
self.check_used_index(replica,
"SELECT * FROM o_indices0 ORDER BY key",
'o_indices0_pkey')
# DROP INDEX replication of rollback and commit
with master.connect() as con:
con.execute("""
DROP INDEX o_indices0_idx1;
""")
con.rollback()
self.catchup_orioledb(replica)
self.check_used_index(replica,
"""SELECT * FROM o_indices0
WHERE val2 > 0 AND val > 0 ORDER BY val2""",
'o_indices0_idx1')
master.safe_psql('postgres', """
DROP INDEX o_indices0_idx1;
""")
self.catchup_orioledb(replica)
self.check_used_index(replica,
"""SELECT * FROM o_indices0
WHERE val2 > 0 AND val > 0 ORDER BY key""",
'o_indices0_pkey')
# primary index drop without any indices
master.safe_psql('postgres', """
ALTER TABLE o_indices0 DROP CONSTRAINT o_indices0_pkey;
""")
self.catchup_orioledb(replica)
self.check_used_index(replica,
"SELECT * FROM o_indices0",
'o_indices0')
# primary index create without any indices
master.safe_psql('postgres', """
ALTER TABLE o_indices0
ADD CONSTRAINT o_indices0_pkey
PRIMARY KEY (key);
""")
self.catchup_orioledb(replica)
self.check_used_index(replica,
"SELECT * FROM o_indices0 ORDER BY key",
'o_indices0_pkey')
def test_multiple_indices_build_replication(self):
with self.node as master:
master.start()
# create a backup
with self.getReplica().start() as replica:
columns = ",\n".join(
["val%d int" % x for x in range(1, 10)])
values = ", ".join(
["i + %d" % ((x + 1) * 1000) for x in range(0, 10)])
master.safe_psql('postgres', f"""
CREATE EXTENSION IF NOT EXISTS orioledb;
CREATE TABLE o_indices0
(
key TEXT NOT NULL,
PRIMARY KEY (key),
{columns}
) USING orioledb;
INSERT INTO o_indices0
SELECT {values} FROM generate_series(1, 500) AS i;
""")
# multiple CREATE INDEX in the same transaction
with master.connect() as con:
con.begin()
for i in range(1, 10):
con.execute(f"""
CREATE UNIQUE INDEX o_indices0_idx{i}
ON o_indices0 (val{i});
""")
con.commit()
self.catchup_orioledb(replica)
for i in range(1, 10):
self.check_used_index(replica,
f"""SELECT * FROM o_indices0
WHERE val{i} > 0 ORDER BY val{i}""",
f'o_indices0_idx{i}')
def test_indices_build_xip(self):
node = self.node
node.append_conf('postgresql.conf',
"orioledb.enable_stopevents = true\n")
node.start()
columns = ",\n".join(
["val%d int" % x for x in range(1, 10)])
values = ", ".join(
["i + %d" % ((x + 1) * 1000) for x in range(0, 10)])
node.safe_psql('postgres', f"""
CREATE EXTENSION IF NOT EXISTS orioledb;
CREATE TABLE o_indices0
(
key TEXT NOT NULL,
PRIMARY KEY (key),
{columns}
) USING orioledb;
INSERT INTO o_indices0
SELECT {values} FROM generate_series(1, 500) AS i;
""")
con1 = node.connect()
chkp_con = node.connect()
con1.begin()
for i in range(1, 9):
con1.execute(f"""
CREATE UNIQUE INDEX o_indices0_idx{i}
ON o_indices0 (val{i});
""")
con1.execute("SELECT pg_stopevent_set('checkpoint_index_start', '$.treeName == \"o_indices0_idx1\"');")
chkp_thread = ThreadQueryExecutor(chkp_con, "CHECKPOINT;")
chkp_thread.start()
wait_checkpointer_stopevent(node)
con1.execute(f"""
CREATE UNIQUE INDEX o_indices0_idx9
ON o_indices0 (val9);
""")
con1.execute("SELECT pg_stopevent_reset('checkpoint_index_start');")
chkp_thread.join()
con1.commit()
con1.close()
chkp_con.close()
node.stop(['-m', 'immediate'])
node.start()
for i in range(1, 10):
self.check_used_index(node,
f"""SELECT * FROM o_indices0
WHERE val{i} > 0 ORDER BY val{i}""",
f'o_indices0_idx{i}')
node.stop()
| 31.191589
| 109
| 0.652584
| 1,817
| 13,350
| 4.632911
| 0.094662
| 0.119743
| 0.057139
| 0.077215
| 0.830245
| 0.798765
| 0.78736
| 0.779995
| 0.775006
| 0.745308
| 0
| 0.041987
| 0.211461
| 13,350
| 427
| 110
| 31.264637
| 0.757671
| 0.03176
| 0
| 0.77027
| 0
| 0
| 0.502222
| 0.015789
| 0
| 0
| 0
| 0
| 0.075676
| 1
| 0.027027
| false
| 0
| 0.010811
| 0
| 0.040541
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
d7a09564a00e67cc1e146e72a4d8484ee580f14f
| 156,283
|
py
|
Python
|
operators/kogito-operator/python/pulumi_pulumi_kubernetes_crds_operators_kogito_operator/app/v1beta1/outputs.py
|
pulumi/pulumi-kubernetes-crds
|
372c4c0182f6b899af82d6edaad521aa14f22150
|
[
"Apache-2.0"
] | null | null | null |
operators/kogito-operator/python/pulumi_pulumi_kubernetes_crds_operators_kogito_operator/app/v1beta1/outputs.py
|
pulumi/pulumi-kubernetes-crds
|
372c4c0182f6b899af82d6edaad521aa14f22150
|
[
"Apache-2.0"
] | 2
|
2020-09-18T17:12:23.000Z
|
2020-12-30T19:40:56.000Z
|
operators/kogito-operator/python/pulumi_pulumi_kubernetes_crds_operators_kogito_operator/app/v1beta1/outputs.py
|
pulumi/pulumi-kubernetes-crds
|
372c4c0182f6b899af82d6edaad521aa14f22150
|
[
"Apache-2.0"
] | null | null | null |
# coding=utf-8
# *** WARNING: this file was generated by crd2pulumi. ***
# *** Do not edit by hand unless you're certain you know what you are doing! ***
import warnings
import pulumi
import pulumi.runtime
from typing import Any, Mapping, Optional, Sequence, Union
from ... import _utilities, _tables
from . import outputs
__all__ = [
'KogitoBuildSpec',
'KogitoBuildSpecArtifact',
'KogitoBuildSpecEnv',
'KogitoBuildSpecEnvValueFrom',
'KogitoBuildSpecEnvValueFromConfigMapKeyRef',
'KogitoBuildSpecEnvValueFromFieldRef',
'KogitoBuildSpecEnvValueFromResourceFieldRef',
'KogitoBuildSpecEnvValueFromResourceFieldRefDivisor',
'KogitoBuildSpecEnvValueFromSecretKeyRef',
'KogitoBuildSpecGitSource',
'KogitoBuildSpecResources',
'KogitoBuildSpecResourcesLimits',
'KogitoBuildSpecResourcesRequests',
'KogitoBuildSpecWebHooks',
'KogitoBuildStatus',
'KogitoBuildStatusBuilds',
'KogitoBuildStatusConditions',
'KogitoInfraSpec',
'KogitoInfraSpecResource',
'KogitoInfraStatus',
'KogitoInfraStatusCondition',
'KogitoInfraStatusEnv',
'KogitoInfraStatusEnvValueFrom',
'KogitoInfraStatusEnvValueFromConfigMapKeyRef',
'KogitoInfraStatusEnvValueFromFieldRef',
'KogitoInfraStatusEnvValueFromResourceFieldRef',
'KogitoInfraStatusEnvValueFromResourceFieldRefDivisor',
'KogitoInfraStatusEnvValueFromSecretKeyRef',
'KogitoInfraStatusVolumes',
'KogitoInfraStatusVolumesMount',
'KogitoInfraStatusVolumesVolume',
'KogitoInfraStatusVolumesVolumeConfigMap',
'KogitoInfraStatusVolumesVolumeConfigMapItems',
'KogitoInfraStatusVolumesVolumeSecret',
'KogitoInfraStatusVolumesVolumeSecretItems',
'KogitoRuntimeSpec',
'KogitoRuntimeSpecEnv',
'KogitoRuntimeSpecEnvValueFrom',
'KogitoRuntimeSpecEnvValueFromConfigMapKeyRef',
'KogitoRuntimeSpecEnvValueFromFieldRef',
'KogitoRuntimeSpecEnvValueFromResourceFieldRef',
'KogitoRuntimeSpecEnvValueFromResourceFieldRefDivisor',
'KogitoRuntimeSpecEnvValueFromSecretKeyRef',
'KogitoRuntimeSpecMonitoring',
'KogitoRuntimeSpecResources',
'KogitoRuntimeSpecResourcesLimits',
'KogitoRuntimeSpecResourcesRequests',
'KogitoRuntimeStatus',
'KogitoRuntimeStatusCloudEvents',
'KogitoRuntimeStatusCloudEventsConsumes',
'KogitoRuntimeStatusCloudEventsProduces',
'KogitoRuntimeStatusConditions',
'KogitoRuntimeStatusDeploymentConditions',
'KogitoSupportingServiceSpec',
'KogitoSupportingServiceSpecEnv',
'KogitoSupportingServiceSpecEnvValueFrom',
'KogitoSupportingServiceSpecEnvValueFromConfigMapKeyRef',
'KogitoSupportingServiceSpecEnvValueFromFieldRef',
'KogitoSupportingServiceSpecEnvValueFromResourceFieldRef',
'KogitoSupportingServiceSpecEnvValueFromResourceFieldRefDivisor',
'KogitoSupportingServiceSpecEnvValueFromSecretKeyRef',
'KogitoSupportingServiceSpecMonitoring',
'KogitoSupportingServiceSpecResources',
'KogitoSupportingServiceSpecResourcesLimits',
'KogitoSupportingServiceSpecResourcesRequests',
'KogitoSupportingServiceStatus',
'KogitoSupportingServiceStatusCloudEvents',
'KogitoSupportingServiceStatusCloudEventsConsumes',
'KogitoSupportingServiceStatusCloudEventsProduces',
'KogitoSupportingServiceStatusConditions',
'KogitoSupportingServiceStatusDeploymentConditions',
]
@pulumi.output_type
class KogitoBuildSpec(dict):
"""
KogitoBuildSpec defines the desired state of KogitoBuild.
"""
def __init__(__self__, *,
type: str,
artifact: Optional['outputs.KogitoBuildSpecArtifact'] = None,
build_image: Optional[str] = None,
disable_incremental: Optional[bool] = None,
enable_maven_download_output: Optional[bool] = None,
env: Optional[Sequence['outputs.KogitoBuildSpecEnv']] = None,
git_source: Optional['outputs.KogitoBuildSpecGitSource'] = None,
maven_mirror_url: Optional[str] = None,
native: Optional[bool] = None,
resources: Optional['outputs.KogitoBuildSpecResources'] = None,
runtime: Optional[str] = None,
runtime_image: Optional[str] = None,
target_kogito_runtime: Optional[str] = None,
web_hooks: Optional[Sequence['outputs.KogitoBuildSpecWebHooks']] = None):
"""
KogitoBuildSpec defines the desired state of KogitoBuild.
:param str type: Sets the type of build that this instance will handle: Binary - takes an uploaded binary file already compiled and creates a Kogito service image from it. RemoteSource - pulls the source code from a Git repository, builds the binary and then the final Kogito service image. LocalSource - takes an uploaded resource file such as DRL (rules), DMN (decision) or BPMN (process), builds the binary and the final Kogito service image.
:param 'KogitoBuildSpecArtifactArgs' artifact: Artifact contains override information for building the Maven artifact (used for Local Source builds). You might want to override this information when building from decisions, rules or process files. In this scenario the Kogito Images will generate a new Java project for you underneath. This information will be used to generate this project.
:param str build_image: Image used to build the Kogito Service from source (Local and Remote). The operator will use the one provided by the Kogito Team based on the "Runtime" field. Example: "quay.io/kiegroup/kogito-jvm-builder:latest". On OpenShift an ImageStream will be created in the current namespace pointing to the given image.
:param bool disable_incremental: DisableIncremental indicates that source to image builds should NOT be incremental. Defaults to false.
:param bool enable_maven_download_output: If set to true will print the logs for downloading/uploading of maven dependencies. Defaults to false.
:param Sequence['KogitoBuildSpecEnvArgs'] env: Environment variables used during build time.
:param 'KogitoBuildSpecGitSourceArgs' git_source: Information about the git repository where the Kogito Service source code resides. Ignored for binary builds.
:param str maven_mirror_url: Maven Mirror URL to be used during source-to-image builds (Local and Remote) to considerably increase build speed.
:param bool native: Native indicates if the Kogito Service built should be compiled to run on native mode when Runtime is Quarkus (Source to Image build only). For more information, see https://www.graalvm.org/docs/reference-manual/aot-compilation/.
:param 'KogitoBuildSpecResourcesArgs' resources: Resources Requirements for builder pods.
:param str runtime: Which runtime Kogito service base image to use when building the Kogito service. If "BuildImage" is set, this value is ignored by the operator. Default value: quarkus.
:param str runtime_image: Image used as the base image for the final Kogito service. This image only has the required packages to run the application. For example: quarkus based services will have only JVM installed, native services only the packages required by the OS. The operator will use the one provided by the Kogito Team based on the "Runtime" field. Example: "quay.io/kiegroup/kogito-jvm-builder:latest". On OpenShift an ImageStream will be created in the current namespace pointing to the given image.
:param str target_kogito_runtime: Set this field targeting the desired KogitoRuntime when this KogitoBuild instance has a different name than the KogitoRuntime. By default this KogitoBuild instance will generate a final image named after its own name (.metadata.name). On OpenShift, an ImageStream will be created causing a redeployment on any KogitoRuntime with the same name. On Kubernetes, the final image will be pushed to the KogitoRuntime deployment. If you have multiple KogitoBuild instances (let's say BinaryBuildType and Remote Source), you might need that both target the same KogitoRuntime. Both KogitoBuilds will update the same ImageStream or generate a final image to the same KogitoRuntime deployment.
:param Sequence['KogitoBuildSpecWebHooksArgs'] web_hooks: WebHooks secrets for source to image builds based on Git repositories (Remote Sources).
"""
pulumi.set(__self__, "type", type)
if artifact is not None:
pulumi.set(__self__, "artifact", artifact)
if build_image is not None:
pulumi.set(__self__, "build_image", build_image)
if disable_incremental is not None:
pulumi.set(__self__, "disable_incremental", disable_incremental)
if enable_maven_download_output is not None:
pulumi.set(__self__, "enable_maven_download_output", enable_maven_download_output)
if env is not None:
pulumi.set(__self__, "env", env)
if git_source is not None:
pulumi.set(__self__, "git_source", git_source)
if maven_mirror_url is not None:
pulumi.set(__self__, "maven_mirror_url", maven_mirror_url)
if native is not None:
pulumi.set(__self__, "native", native)
if resources is not None:
pulumi.set(__self__, "resources", resources)
if runtime is not None:
pulumi.set(__self__, "runtime", runtime)
if runtime_image is not None:
pulumi.set(__self__, "runtime_image", runtime_image)
if target_kogito_runtime is not None:
pulumi.set(__self__, "target_kogito_runtime", target_kogito_runtime)
if web_hooks is not None:
pulumi.set(__self__, "web_hooks", web_hooks)
@property
@pulumi.getter
def type(self) -> str:
"""
Sets the type of build that this instance will handle: Binary - takes an uploaded binary file already compiled and creates a Kogito service image from it. RemoteSource - pulls the source code from a Git repository, builds the binary and then the final Kogito service image. LocalSource - takes an uploaded resource file such as DRL (rules), DMN (decision) or BPMN (process), builds the binary and the final Kogito service image.
"""
return pulumi.get(self, "type")
@property
@pulumi.getter
def artifact(self) -> Optional['outputs.KogitoBuildSpecArtifact']:
"""
Artifact contains override information for building the Maven artifact (used for Local Source builds). You might want to override this information when building from decisions, rules or process files. In this scenario the Kogito Images will generate a new Java project for you underneath. This information will be used to generate this project.
"""
return pulumi.get(self, "artifact")
@property
@pulumi.getter(name="buildImage")
def build_image(self) -> Optional[str]:
"""
Image used to build the Kogito Service from source (Local and Remote). The operator will use the one provided by the Kogito Team based on the "Runtime" field. Example: "quay.io/kiegroup/kogito-jvm-builder:latest". On OpenShift an ImageStream will be created in the current namespace pointing to the given image.
"""
return pulumi.get(self, "build_image")
@property
@pulumi.getter(name="disableIncremental")
def disable_incremental(self) -> Optional[bool]:
"""
DisableIncremental indicates that source to image builds should NOT be incremental. Defaults to false.
"""
return pulumi.get(self, "disable_incremental")
@property
@pulumi.getter(name="enableMavenDownloadOutput")
def enable_maven_download_output(self) -> Optional[bool]:
"""
If set to true will print the logs for downloading/uploading of maven dependencies. Defaults to false.
"""
return pulumi.get(self, "enable_maven_download_output")
@property
@pulumi.getter
def env(self) -> Optional[Sequence['outputs.KogitoBuildSpecEnv']]:
"""
Environment variables used during build time.
"""
return pulumi.get(self, "env")
@property
@pulumi.getter(name="gitSource")
def git_source(self) -> Optional['outputs.KogitoBuildSpecGitSource']:
"""
Information about the git repository where the Kogito Service source code resides. Ignored for binary builds.
"""
return pulumi.get(self, "git_source")
@property
@pulumi.getter(name="mavenMirrorURL")
def maven_mirror_url(self) -> Optional[str]:
"""
Maven Mirror URL to be used during source-to-image builds (Local and Remote) to considerably increase build speed.
"""
return pulumi.get(self, "maven_mirror_url")
@property
@pulumi.getter
def native(self) -> Optional[bool]:
"""
Native indicates if the Kogito Service built should be compiled to run on native mode when Runtime is Quarkus (Source to Image build only). For more information, see https://www.graalvm.org/docs/reference-manual/aot-compilation/.
"""
return pulumi.get(self, "native")
@property
@pulumi.getter
def resources(self) -> Optional['outputs.KogitoBuildSpecResources']:
"""
Resources Requirements for builder pods.
"""
return pulumi.get(self, "resources")
@property
@pulumi.getter
def runtime(self) -> Optional[str]:
"""
Which runtime Kogito service base image to use when building the Kogito service. If "BuildImage" is set, this value is ignored by the operator. Default value: quarkus.
"""
return pulumi.get(self, "runtime")
@property
@pulumi.getter(name="runtimeImage")
def runtime_image(self) -> Optional[str]:
"""
Image used as the base image for the final Kogito service. This image only has the required packages to run the application. For example: quarkus based services will have only JVM installed, native services only the packages required by the OS. The operator will use the one provided by the Kogito Team based on the "Runtime" field. Example: "quay.io/kiegroup/kogito-jvm-builder:latest". On OpenShift an ImageStream will be created in the current namespace pointing to the given image.
"""
return pulumi.get(self, "runtime_image")
@property
@pulumi.getter(name="targetKogitoRuntime")
def target_kogito_runtime(self) -> Optional[str]:
"""
Set this field targeting the desired KogitoRuntime when this KogitoBuild instance has a different name than the KogitoRuntime. By default this KogitoBuild instance will generate a final image named after its own name (.metadata.name). On OpenShift, an ImageStream will be created causing a redeployment on any KogitoRuntime with the same name. On Kubernetes, the final image will be pushed to the KogitoRuntime deployment. If you have multiple KogitoBuild instances (let's say BinaryBuildType and Remote Source), you might need that both target the same KogitoRuntime. Both KogitoBuilds will update the same ImageStream or generate a final image to the same KogitoRuntime deployment.
"""
return pulumi.get(self, "target_kogito_runtime")
@property
@pulumi.getter(name="webHooks")
def web_hooks(self) -> Optional[Sequence['outputs.KogitoBuildSpecWebHooks']]:
"""
WebHooks secrets for source to image builds based on Git repositories (Remote Sources).
"""
return pulumi.get(self, "web_hooks")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoBuildSpecArtifact(dict):
"""
Artifact contains override information for building the Maven artifact (used for Local Source builds). You might want to override this information when building from decisions, rules or process files. In this scenario the Kogito Images will generate a new Java project for you underneath. This information will be used to generate this project.
"""
def __init__(__self__, *,
artifact_id: Optional[str] = None,
group_id: Optional[str] = None,
version: Optional[str] = None):
"""
Artifact contains override information for building the Maven artifact (used for Local Source builds). You might want to override this information when building from decisions, rules or process files. In this scenario the Kogito Images will generate a new Java project for you underneath. This information will be used to generate this project.
:param str artifact_id: Indicates the unique base name of the primary artifact being generated.
:param str group_id: Indicates the unique identifier of the organization or group that created the project.
:param str version: Indicates the version of the artifact generated by the project.
"""
if artifact_id is not None:
pulumi.set(__self__, "artifact_id", artifact_id)
if group_id is not None:
pulumi.set(__self__, "group_id", group_id)
if version is not None:
pulumi.set(__self__, "version", version)
@property
@pulumi.getter(name="artifactId")
def artifact_id(self) -> Optional[str]:
"""
Indicates the unique base name of the primary artifact being generated.
"""
return pulumi.get(self, "artifact_id")
@property
@pulumi.getter(name="groupId")
def group_id(self) -> Optional[str]:
"""
Indicates the unique identifier of the organization or group that created the project.
"""
return pulumi.get(self, "group_id")
@property
@pulumi.getter
def version(self) -> Optional[str]:
"""
Indicates the version of the artifact generated by the project.
"""
return pulumi.get(self, "version")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoBuildSpecEnv(dict):
"""
EnvVar represents an environment variable present in a Container.
"""
def __init__(__self__, *,
name: str,
value: Optional[str] = None,
value_from: Optional['outputs.KogitoBuildSpecEnvValueFrom'] = None):
"""
EnvVar represents an environment variable present in a Container.
:param str name: Name of the environment variable. Must be a C_IDENTIFIER.
:param str value: Variable references $(VAR_NAME) are expanded using the previous defined environment variables in the container and any service environment variables. If a variable cannot be resolved, the reference in the input string will be unchanged. The $(VAR_NAME) syntax can be escaped with a double $$, ie: $$(VAR_NAME). Escaped references will never be expanded, regardless of whether the variable exists or not. Defaults to "".
:param 'KogitoBuildSpecEnvValueFromArgs' value_from: Source for the environment variable's value. Cannot be used if value is not empty.
"""
pulumi.set(__self__, "name", name)
if value is not None:
pulumi.set(__self__, "value", value)
if value_from is not None:
pulumi.set(__self__, "value_from", value_from)
@property
@pulumi.getter
def name(self) -> str:
"""
Name of the environment variable. Must be a C_IDENTIFIER.
"""
return pulumi.get(self, "name")
@property
@pulumi.getter
def value(self) -> Optional[str]:
"""
Variable references $(VAR_NAME) are expanded using the previous defined environment variables in the container and any service environment variables. If a variable cannot be resolved, the reference in the input string will be unchanged. The $(VAR_NAME) syntax can be escaped with a double $$, ie: $$(VAR_NAME). Escaped references will never be expanded, regardless of whether the variable exists or not. Defaults to "".
"""
return pulumi.get(self, "value")
@property
@pulumi.getter(name="valueFrom")
def value_from(self) -> Optional['outputs.KogitoBuildSpecEnvValueFrom']:
"""
Source for the environment variable's value. Cannot be used if value is not empty.
"""
return pulumi.get(self, "value_from")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoBuildSpecEnvValueFrom(dict):
"""
Source for the environment variable's value. Cannot be used if value is not empty.
"""
def __init__(__self__, *,
config_map_key_ref: Optional['outputs.KogitoBuildSpecEnvValueFromConfigMapKeyRef'] = None,
field_ref: Optional['outputs.KogitoBuildSpecEnvValueFromFieldRef'] = None,
resource_field_ref: Optional['outputs.KogitoBuildSpecEnvValueFromResourceFieldRef'] = None,
secret_key_ref: Optional['outputs.KogitoBuildSpecEnvValueFromSecretKeyRef'] = None):
"""
Source for the environment variable's value. Cannot be used if value is not empty.
:param 'KogitoBuildSpecEnvValueFromConfigMapKeyRefArgs' config_map_key_ref: Selects a key of a ConfigMap.
:param 'KogitoBuildSpecEnvValueFromFieldRefArgs' field_ref: Selects a field of the pod: supports metadata.name, metadata.namespace, metadata.labels, metadata.annotations, spec.nodeName, spec.serviceAccountName, status.hostIP, status.podIP, status.podIPs.
:param 'KogitoBuildSpecEnvValueFromResourceFieldRefArgs' resource_field_ref: Selects a resource of the container: only resources limits and requests (limits.cpu, limits.memory, limits.ephemeral-storage, requests.cpu, requests.memory and requests.ephemeral-storage) are currently supported.
:param 'KogitoBuildSpecEnvValueFromSecretKeyRefArgs' secret_key_ref: Selects a key of a secret in the pod's namespace
"""
if config_map_key_ref is not None:
pulumi.set(__self__, "config_map_key_ref", config_map_key_ref)
if field_ref is not None:
pulumi.set(__self__, "field_ref", field_ref)
if resource_field_ref is not None:
pulumi.set(__self__, "resource_field_ref", resource_field_ref)
if secret_key_ref is not None:
pulumi.set(__self__, "secret_key_ref", secret_key_ref)
@property
@pulumi.getter(name="configMapKeyRef")
def config_map_key_ref(self) -> Optional['outputs.KogitoBuildSpecEnvValueFromConfigMapKeyRef']:
"""
Selects a key of a ConfigMap.
"""
return pulumi.get(self, "config_map_key_ref")
@property
@pulumi.getter(name="fieldRef")
def field_ref(self) -> Optional['outputs.KogitoBuildSpecEnvValueFromFieldRef']:
"""
Selects a field of the pod: supports metadata.name, metadata.namespace, metadata.labels, metadata.annotations, spec.nodeName, spec.serviceAccountName, status.hostIP, status.podIP, status.podIPs.
"""
return pulumi.get(self, "field_ref")
@property
@pulumi.getter(name="resourceFieldRef")
def resource_field_ref(self) -> Optional['outputs.KogitoBuildSpecEnvValueFromResourceFieldRef']:
"""
Selects a resource of the container: only resources limits and requests (limits.cpu, limits.memory, limits.ephemeral-storage, requests.cpu, requests.memory and requests.ephemeral-storage) are currently supported.
"""
return pulumi.get(self, "resource_field_ref")
@property
@pulumi.getter(name="secretKeyRef")
def secret_key_ref(self) -> Optional['outputs.KogitoBuildSpecEnvValueFromSecretKeyRef']:
"""
Selects a key of a secret in the pod's namespace
"""
return pulumi.get(self, "secret_key_ref")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoBuildSpecEnvValueFromConfigMapKeyRef(dict):
"""
Selects a key of a ConfigMap.
"""
def __init__(__self__, *,
key: str,
name: Optional[str] = None,
optional: Optional[bool] = None):
"""
Selects a key of a ConfigMap.
:param str key: The key to select.
:param str name: Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
:param bool optional: Specify whether the ConfigMap or its key must be defined
"""
pulumi.set(__self__, "key", key)
if name is not None:
pulumi.set(__self__, "name", name)
if optional is not None:
pulumi.set(__self__, "optional", optional)
@property
@pulumi.getter
def key(self) -> str:
"""
The key to select.
"""
return pulumi.get(self, "key")
@property
@pulumi.getter
def name(self) -> Optional[str]:
"""
Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
"""
return pulumi.get(self, "name")
@property
@pulumi.getter
def optional(self) -> Optional[bool]:
"""
Specify whether the ConfigMap or its key must be defined
"""
return pulumi.get(self, "optional")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoBuildSpecEnvValueFromFieldRef(dict):
"""
Selects a field of the pod: supports metadata.name, metadata.namespace, metadata.labels, metadata.annotations, spec.nodeName, spec.serviceAccountName, status.hostIP, status.podIP, status.podIPs.
"""
def __init__(__self__, *,
field_path: str,
api_version: Optional[str] = None):
"""
Selects a field of the pod: supports metadata.name, metadata.namespace, metadata.labels, metadata.annotations, spec.nodeName, spec.serviceAccountName, status.hostIP, status.podIP, status.podIPs.
:param str field_path: Path of the field to select in the specified API version.
:param str api_version: Version of the schema the FieldPath is written in terms of, defaults to "v1".
"""
pulumi.set(__self__, "field_path", field_path)
if api_version is not None:
pulumi.set(__self__, "api_version", api_version)
@property
@pulumi.getter(name="fieldPath")
def field_path(self) -> str:
"""
Path of the field to select in the specified API version.
"""
return pulumi.get(self, "field_path")
@property
@pulumi.getter(name="apiVersion")
def api_version(self) -> Optional[str]:
"""
Version of the schema the FieldPath is written in terms of, defaults to "v1".
"""
return pulumi.get(self, "api_version")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoBuildSpecEnvValueFromResourceFieldRef(dict):
"""
Selects a resource of the container: only resources limits and requests (limits.cpu, limits.memory, limits.ephemeral-storage, requests.cpu, requests.memory and requests.ephemeral-storage) are currently supported.
"""
def __init__(__self__, *,
resource: str,
container_name: Optional[str] = None,
divisor: Optional['outputs.KogitoBuildSpecEnvValueFromResourceFieldRefDivisor'] = None):
"""
Selects a resource of the container: only resources limits and requests (limits.cpu, limits.memory, limits.ephemeral-storage, requests.cpu, requests.memory and requests.ephemeral-storage) are currently supported.
:param str resource: Required: resource to select
:param str container_name: Container name: required for volumes, optional for env vars
:param 'KogitoBuildSpecEnvValueFromResourceFieldRefDivisorArgs' divisor: Specifies the output format of the exposed resources, defaults to "1"
"""
pulumi.set(__self__, "resource", resource)
if container_name is not None:
pulumi.set(__self__, "container_name", container_name)
if divisor is not None:
pulumi.set(__self__, "divisor", divisor)
@property
@pulumi.getter
def resource(self) -> str:
"""
Required: resource to select
"""
return pulumi.get(self, "resource")
@property
@pulumi.getter(name="containerName")
def container_name(self) -> Optional[str]:
"""
Container name: required for volumes, optional for env vars
"""
return pulumi.get(self, "container_name")
@property
@pulumi.getter
def divisor(self) -> Optional['outputs.KogitoBuildSpecEnvValueFromResourceFieldRefDivisor']:
"""
Specifies the output format of the exposed resources, defaults to "1"
"""
return pulumi.get(self, "divisor")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoBuildSpecEnvValueFromResourceFieldRefDivisor(dict):
def __init__(__self__):
pass
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoBuildSpecEnvValueFromSecretKeyRef(dict):
"""
Selects a key of a secret in the pod's namespace
"""
def __init__(__self__, *,
key: str,
name: Optional[str] = None,
optional: Optional[bool] = None):
"""
Selects a key of a secret in the pod's namespace
:param str key: The key of the secret to select from. Must be a valid secret key.
:param str name: Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
:param bool optional: Specify whether the Secret or its key must be defined
"""
pulumi.set(__self__, "key", key)
if name is not None:
pulumi.set(__self__, "name", name)
if optional is not None:
pulumi.set(__self__, "optional", optional)
@property
@pulumi.getter
def key(self) -> str:
"""
The key of the secret to select from. Must be a valid secret key.
"""
return pulumi.get(self, "key")
@property
@pulumi.getter
def name(self) -> Optional[str]:
"""
Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
"""
return pulumi.get(self, "name")
@property
@pulumi.getter
def optional(self) -> Optional[bool]:
"""
Specify whether the Secret or its key must be defined
"""
return pulumi.get(self, "optional")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoBuildSpecGitSource(dict):
"""
Information about the git repository where the Kogito Service source code resides. Ignored for binary builds.
"""
def __init__(__self__, *,
uri: str,
context_dir: Optional[str] = None,
reference: Optional[str] = None):
"""
Information about the git repository where the Kogito Service source code resides. Ignored for binary builds.
:param str uri: Git URI for the s2i source.
:param str context_dir: Context/subdirectory where the code is located, relative to the repo root.
:param str reference: Branch to use in the Git repository.
"""
pulumi.set(__self__, "uri", uri)
if context_dir is not None:
pulumi.set(__self__, "context_dir", context_dir)
if reference is not None:
pulumi.set(__self__, "reference", reference)
@property
@pulumi.getter
def uri(self) -> str:
"""
Git URI for the s2i source.
"""
return pulumi.get(self, "uri")
@property
@pulumi.getter(name="contextDir")
def context_dir(self) -> Optional[str]:
"""
Context/subdirectory where the code is located, relative to the repo root.
"""
return pulumi.get(self, "context_dir")
@property
@pulumi.getter
def reference(self) -> Optional[str]:
"""
Branch to use in the Git repository.
"""
return pulumi.get(self, "reference")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoBuildSpecResources(dict):
"""
Resources Requirements for builder pods.
"""
def __init__(__self__, *,
limits: Optional[Mapping[str, 'outputs.KogitoBuildSpecResourcesLimits']] = None,
requests: Optional[Mapping[str, 'outputs.KogitoBuildSpecResourcesRequests']] = None):
"""
Resources Requirements for builder pods.
:param Mapping[str, 'KogitoBuildSpecResourcesLimitsArgs'] limits: Limits describes the maximum amount of compute resources allowed. More info: https://kubernetes.io/docs/concepts/configuration/manage-compute-resources-container/
:param Mapping[str, 'KogitoBuildSpecResourcesRequestsArgs'] requests: Requests describes the minimum amount of compute resources required. If Requests is omitted for a container, it defaults to Limits if that is explicitly specified, otherwise to an implementation-defined value. More info: https://kubernetes.io/docs/concepts/configuration/manage-compute-resources-container/
"""
if limits is not None:
pulumi.set(__self__, "limits", limits)
if requests is not None:
pulumi.set(__self__, "requests", requests)
@property
@pulumi.getter
def limits(self) -> Optional[Mapping[str, 'outputs.KogitoBuildSpecResourcesLimits']]:
"""
Limits describes the maximum amount of compute resources allowed. More info: https://kubernetes.io/docs/concepts/configuration/manage-compute-resources-container/
"""
return pulumi.get(self, "limits")
@property
@pulumi.getter
def requests(self) -> Optional[Mapping[str, 'outputs.KogitoBuildSpecResourcesRequests']]:
"""
Requests describes the minimum amount of compute resources required. If Requests is omitted for a container, it defaults to Limits if that is explicitly specified, otherwise to an implementation-defined value. More info: https://kubernetes.io/docs/concepts/configuration/manage-compute-resources-container/
"""
return pulumi.get(self, "requests")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoBuildSpecResourcesLimits(dict):
def __init__(__self__):
pass
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoBuildSpecResourcesRequests(dict):
def __init__(__self__):
pass
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoBuildSpecWebHooks(dict):
"""
WebHookSecret Secret to use for a given webHook.
"""
def __init__(__self__, *,
secret: Optional[str] = None,
type: Optional[str] = None):
"""
WebHookSecret Secret to use for a given webHook.
:param str secret: Secret value for webHook
:param str type: WebHook type, either GitHub or Generic.
"""
if secret is not None:
pulumi.set(__self__, "secret", secret)
if type is not None:
pulumi.set(__self__, "type", type)
@property
@pulumi.getter
def secret(self) -> Optional[str]:
"""
Secret value for webHook
"""
return pulumi.get(self, "secret")
@property
@pulumi.getter
def type(self) -> Optional[str]:
"""
WebHook type, either GitHub or Generic.
"""
return pulumi.get(self, "type")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoBuildStatus(dict):
"""
KogitoBuildStatus defines the observed state of KogitoBuild.
"""
def __init__(__self__, *,
builds: 'outputs.KogitoBuildStatusBuilds',
conditions: Sequence['outputs.KogitoBuildStatusConditions'],
latest_build: Optional[str] = None):
"""
KogitoBuildStatus defines the observed state of KogitoBuild.
:param 'KogitoBuildStatusBuildsArgs' builds: History of builds
:param Sequence['KogitoBuildStatusConditionsArgs'] conditions: History of conditions for the resource, shows the status of the younger builder controlled by this instance
"""
pulumi.set(__self__, "builds", builds)
pulumi.set(__self__, "conditions", conditions)
if latest_build is not None:
pulumi.set(__self__, "latest_build", latest_build)
@property
@pulumi.getter
def builds(self) -> 'outputs.KogitoBuildStatusBuilds':
"""
History of builds
"""
return pulumi.get(self, "builds")
@property
@pulumi.getter
def conditions(self) -> Sequence['outputs.KogitoBuildStatusConditions']:
"""
History of conditions for the resource, shows the status of the younger builder controlled by this instance
"""
return pulumi.get(self, "conditions")
@property
@pulumi.getter(name="latestBuild")
def latest_build(self) -> Optional[str]:
return pulumi.get(self, "latest_build")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoBuildStatusBuilds(dict):
"""
History of builds
"""
def __init__(__self__, *,
cancelled: Optional[Sequence[str]] = None,
complete: Optional[Sequence[str]] = None,
error: Optional[Sequence[str]] = None,
failed: Optional[Sequence[str]] = None,
new: Optional[Sequence[str]] = None,
pending: Optional[Sequence[str]] = None,
running: Optional[Sequence[str]] = None):
"""
History of builds
:param Sequence[str] cancelled: Builds have been stopped from executing.
:param Sequence[str] complete: Builds have executed and succeeded.
:param Sequence[str] error: Builds have been prevented from executing by an error.
:param Sequence[str] failed: Builds have executed and failed.
:param Sequence[str] new: Builds are being created.
:param Sequence[str] pending: Builds are about to start running.
:param Sequence[str] running: Builds are running.
"""
if cancelled is not None:
pulumi.set(__self__, "cancelled", cancelled)
if complete is not None:
pulumi.set(__self__, "complete", complete)
if error is not None:
pulumi.set(__self__, "error", error)
if failed is not None:
pulumi.set(__self__, "failed", failed)
if new is not None:
pulumi.set(__self__, "new", new)
if pending is not None:
pulumi.set(__self__, "pending", pending)
if running is not None:
pulumi.set(__self__, "running", running)
@property
@pulumi.getter
def cancelled(self) -> Optional[Sequence[str]]:
"""
Builds have been stopped from executing.
"""
return pulumi.get(self, "cancelled")
@property
@pulumi.getter
def complete(self) -> Optional[Sequence[str]]:
"""
Builds have executed and succeeded.
"""
return pulumi.get(self, "complete")
@property
@pulumi.getter
def error(self) -> Optional[Sequence[str]]:
"""
Builds have been prevented from executing by an error.
"""
return pulumi.get(self, "error")
@property
@pulumi.getter
def failed(self) -> Optional[Sequence[str]]:
"""
Builds have executed and failed.
"""
return pulumi.get(self, "failed")
@property
@pulumi.getter
def new(self) -> Optional[Sequence[str]]:
"""
Builds are being created.
"""
return pulumi.get(self, "new")
@property
@pulumi.getter
def pending(self) -> Optional[Sequence[str]]:
"""
Builds are about to start running.
"""
return pulumi.get(self, "pending")
@property
@pulumi.getter
def running(self) -> Optional[Sequence[str]]:
"""
Builds are running.
"""
return pulumi.get(self, "running")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoBuildStatusConditions(dict):
"""
KogitoBuildConditions describes the conditions for this build instance according to Kubernetes status interface.
"""
def __init__(__self__, *,
status: str,
type: str,
last_transition_time: Optional[str] = None,
message: Optional[str] = None,
reason: Optional[str] = None):
"""
KogitoBuildConditions describes the conditions for this build instance according to Kubernetes status interface.
:param str status: Status ...
:param str type: Type of this condition
:param str last_transition_time: LastTransitionTime ...
:param str message: Message ...
:param str reason: Reason of this condition
"""
pulumi.set(__self__, "status", status)
pulumi.set(__self__, "type", type)
if last_transition_time is not None:
pulumi.set(__self__, "last_transition_time", last_transition_time)
if message is not None:
pulumi.set(__self__, "message", message)
if reason is not None:
pulumi.set(__self__, "reason", reason)
@property
@pulumi.getter
def status(self) -> str:
"""
Status ...
"""
return pulumi.get(self, "status")
@property
@pulumi.getter
def type(self) -> str:
"""
Type of this condition
"""
return pulumi.get(self, "type")
@property
@pulumi.getter(name="lastTransitionTime")
def last_transition_time(self) -> Optional[str]:
"""
LastTransitionTime ...
"""
return pulumi.get(self, "last_transition_time")
@property
@pulumi.getter
def message(self) -> Optional[str]:
"""
Message ...
"""
return pulumi.get(self, "message")
@property
@pulumi.getter
def reason(self) -> Optional[str]:
"""
Reason of this condition
"""
return pulumi.get(self, "reason")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraSpec(dict):
"""
KogitoInfraSpec defines the desired state of KogitoInfra.
"""
def __init__(__self__, *,
resource: Optional['outputs.KogitoInfraSpecResource'] = None):
"""
KogitoInfraSpec defines the desired state of KogitoInfra.
:param 'KogitoInfraSpecResourceArgs' resource: Resource for the service. Example: Infinispan/Kafka/Keycloak.
"""
if resource is not None:
pulumi.set(__self__, "resource", resource)
@property
@pulumi.getter
def resource(self) -> Optional['outputs.KogitoInfraSpecResource']:
"""
Resource for the service. Example: Infinispan/Kafka/Keycloak.
"""
return pulumi.get(self, "resource")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraSpecResource(dict):
"""
Resource for the service. Example: Infinispan/Kafka/Keycloak.
"""
def __init__(__self__, *,
api_version: str,
kind: str,
name: Optional[str] = None,
namespace: Optional[str] = None):
"""
Resource for the service. Example: Infinispan/Kafka/Keycloak.
:param str api_version: APIVersion describes the API Version of referred Kubernetes resource for example, infinispan.org/v1
:param str kind: Kind describes the kind of referred Kubernetes resource for example, Infinispan
:param str name: Name of referred resource.
:param str namespace: Namespace where referred resource exists.
"""
pulumi.set(__self__, "api_version", api_version)
pulumi.set(__self__, "kind", kind)
if name is not None:
pulumi.set(__self__, "name", name)
if namespace is not None:
pulumi.set(__self__, "namespace", namespace)
@property
@pulumi.getter(name="apiVersion")
def api_version(self) -> str:
"""
APIVersion describes the API Version of referred Kubernetes resource for example, infinispan.org/v1
"""
return pulumi.get(self, "api_version")
@property
@pulumi.getter
def kind(self) -> str:
"""
Kind describes the kind of referred Kubernetes resource for example, Infinispan
"""
return pulumi.get(self, "kind")
@property
@pulumi.getter
def name(self) -> Optional[str]:
"""
Name of referred resource.
"""
return pulumi.get(self, "name")
@property
@pulumi.getter
def namespace(self) -> Optional[str]:
"""
Namespace where referred resource exists.
"""
return pulumi.get(self, "namespace")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraStatus(dict):
"""
KogitoInfraStatus defines the observed state of KogitoInfra.
"""
def __init__(__self__, *,
app_props: Optional[Mapping[str, str]] = None,
condition: Optional['outputs.KogitoInfraStatusCondition'] = None,
env: Optional[Sequence['outputs.KogitoInfraStatusEnv']] = None,
volumes: Optional[Sequence['outputs.KogitoInfraStatusVolumes']] = None):
"""
KogitoInfraStatus defines the observed state of KogitoInfra.
:param Mapping[str, str] app_props: Application properties extracted from the linked resource that will be added to the deployed Kogito service.
:param 'KogitoInfraStatusConditionArgs' condition: KogitoInfraCondition ...
:param Sequence['KogitoInfraStatusEnvArgs'] env: Environment variables extracted from the linked resource that will be added to the deployed Kogito service.
:param Sequence['KogitoInfraStatusVolumesArgs'] volumes: List of volumes that should be added to the services bound to this infra instance
"""
if app_props is not None:
pulumi.set(__self__, "app_props", app_props)
if condition is not None:
pulumi.set(__self__, "condition", condition)
if env is not None:
pulumi.set(__self__, "env", env)
if volumes is not None:
pulumi.set(__self__, "volumes", volumes)
@property
@pulumi.getter(name="appProps")
def app_props(self) -> Optional[Mapping[str, str]]:
"""
Application properties extracted from the linked resource that will be added to the deployed Kogito service.
"""
return pulumi.get(self, "app_props")
@property
@pulumi.getter
def condition(self) -> Optional['outputs.KogitoInfraStatusCondition']:
"""
KogitoInfraCondition ...
"""
return pulumi.get(self, "condition")
@property
@pulumi.getter
def env(self) -> Optional[Sequence['outputs.KogitoInfraStatusEnv']]:
"""
Environment variables extracted from the linked resource that will be added to the deployed Kogito service.
"""
return pulumi.get(self, "env")
@property
@pulumi.getter
def volumes(self) -> Optional[Sequence['outputs.KogitoInfraStatusVolumes']]:
"""
List of volumes that should be added to the services bound to this infra instance
"""
return pulumi.get(self, "volumes")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraStatusCondition(dict):
"""
KogitoInfraCondition ...
"""
def __init__(__self__, *,
status: str,
type: str,
last_transition_time: Optional[str] = None,
message: Optional[str] = None,
reason: Optional[str] = None):
"""
KogitoInfraCondition ...
:param str status: Status ...
:param str type: Type ...
:param str last_transition_time: LastTransitionTime ...
:param str message: Message ...
:param str reason: Reason ...
"""
pulumi.set(__self__, "status", status)
pulumi.set(__self__, "type", type)
if last_transition_time is not None:
pulumi.set(__self__, "last_transition_time", last_transition_time)
if message is not None:
pulumi.set(__self__, "message", message)
if reason is not None:
pulumi.set(__self__, "reason", reason)
@property
@pulumi.getter
def status(self) -> str:
"""
Status ...
"""
return pulumi.get(self, "status")
@property
@pulumi.getter
def type(self) -> str:
"""
Type ...
"""
return pulumi.get(self, "type")
@property
@pulumi.getter(name="lastTransitionTime")
def last_transition_time(self) -> Optional[str]:
"""
LastTransitionTime ...
"""
return pulumi.get(self, "last_transition_time")
@property
@pulumi.getter
def message(self) -> Optional[str]:
"""
Message ...
"""
return pulumi.get(self, "message")
@property
@pulumi.getter
def reason(self) -> Optional[str]:
"""
Reason ...
"""
return pulumi.get(self, "reason")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraStatusEnv(dict):
"""
EnvVar represents an environment variable present in a Container.
"""
def __init__(__self__, *,
name: str,
value: Optional[str] = None,
value_from: Optional['outputs.KogitoInfraStatusEnvValueFrom'] = None):
"""
EnvVar represents an environment variable present in a Container.
:param str name: Name of the environment variable. Must be a C_IDENTIFIER.
:param str value: Variable references $(VAR_NAME) are expanded using the previous defined environment variables in the container and any service environment variables. If a variable cannot be resolved, the reference in the input string will be unchanged. The $(VAR_NAME) syntax can be escaped with a double $$, ie: $$(VAR_NAME). Escaped references will never be expanded, regardless of whether the variable exists or not. Defaults to "".
:param 'KogitoInfraStatusEnvValueFromArgs' value_from: Source for the environment variable's value. Cannot be used if value is not empty.
"""
pulumi.set(__self__, "name", name)
if value is not None:
pulumi.set(__self__, "value", value)
if value_from is not None:
pulumi.set(__self__, "value_from", value_from)
@property
@pulumi.getter
def name(self) -> str:
"""
Name of the environment variable. Must be a C_IDENTIFIER.
"""
return pulumi.get(self, "name")
@property
@pulumi.getter
def value(self) -> Optional[str]:
"""
Variable references $(VAR_NAME) are expanded using the previous defined environment variables in the container and any service environment variables. If a variable cannot be resolved, the reference in the input string will be unchanged. The $(VAR_NAME) syntax can be escaped with a double $$, ie: $$(VAR_NAME). Escaped references will never be expanded, regardless of whether the variable exists or not. Defaults to "".
"""
return pulumi.get(self, "value")
@property
@pulumi.getter(name="valueFrom")
def value_from(self) -> Optional['outputs.KogitoInfraStatusEnvValueFrom']:
"""
Source for the environment variable's value. Cannot be used if value is not empty.
"""
return pulumi.get(self, "value_from")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraStatusEnvValueFrom(dict):
"""
Source for the environment variable's value. Cannot be used if value is not empty.
"""
def __init__(__self__, *,
config_map_key_ref: Optional['outputs.KogitoInfraStatusEnvValueFromConfigMapKeyRef'] = None,
field_ref: Optional['outputs.KogitoInfraStatusEnvValueFromFieldRef'] = None,
resource_field_ref: Optional['outputs.KogitoInfraStatusEnvValueFromResourceFieldRef'] = None,
secret_key_ref: Optional['outputs.KogitoInfraStatusEnvValueFromSecretKeyRef'] = None):
"""
Source for the environment variable's value. Cannot be used if value is not empty.
:param 'KogitoInfraStatusEnvValueFromConfigMapKeyRefArgs' config_map_key_ref: Selects a key of a ConfigMap.
:param 'KogitoInfraStatusEnvValueFromFieldRefArgs' field_ref: Selects a field of the pod: supports metadata.name, metadata.namespace, metadata.labels, metadata.annotations, spec.nodeName, spec.serviceAccountName, status.hostIP, status.podIP, status.podIPs.
:param 'KogitoInfraStatusEnvValueFromResourceFieldRefArgs' resource_field_ref: Selects a resource of the container: only resources limits and requests (limits.cpu, limits.memory, limits.ephemeral-storage, requests.cpu, requests.memory and requests.ephemeral-storage) are currently supported.
:param 'KogitoInfraStatusEnvValueFromSecretKeyRefArgs' secret_key_ref: Selects a key of a secret in the pod's namespace
"""
if config_map_key_ref is not None:
pulumi.set(__self__, "config_map_key_ref", config_map_key_ref)
if field_ref is not None:
pulumi.set(__self__, "field_ref", field_ref)
if resource_field_ref is not None:
pulumi.set(__self__, "resource_field_ref", resource_field_ref)
if secret_key_ref is not None:
pulumi.set(__self__, "secret_key_ref", secret_key_ref)
@property
@pulumi.getter(name="configMapKeyRef")
def config_map_key_ref(self) -> Optional['outputs.KogitoInfraStatusEnvValueFromConfigMapKeyRef']:
"""
Selects a key of a ConfigMap.
"""
return pulumi.get(self, "config_map_key_ref")
@property
@pulumi.getter(name="fieldRef")
def field_ref(self) -> Optional['outputs.KogitoInfraStatusEnvValueFromFieldRef']:
"""
Selects a field of the pod: supports metadata.name, metadata.namespace, metadata.labels, metadata.annotations, spec.nodeName, spec.serviceAccountName, status.hostIP, status.podIP, status.podIPs.
"""
return pulumi.get(self, "field_ref")
@property
@pulumi.getter(name="resourceFieldRef")
def resource_field_ref(self) -> Optional['outputs.KogitoInfraStatusEnvValueFromResourceFieldRef']:
"""
Selects a resource of the container: only resources limits and requests (limits.cpu, limits.memory, limits.ephemeral-storage, requests.cpu, requests.memory and requests.ephemeral-storage) are currently supported.
"""
return pulumi.get(self, "resource_field_ref")
@property
@pulumi.getter(name="secretKeyRef")
def secret_key_ref(self) -> Optional['outputs.KogitoInfraStatusEnvValueFromSecretKeyRef']:
"""
Selects a key of a secret in the pod's namespace
"""
return pulumi.get(self, "secret_key_ref")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraStatusEnvValueFromConfigMapKeyRef(dict):
"""
Selects a key of a ConfigMap.
"""
def __init__(__self__, *,
key: str,
name: Optional[str] = None,
optional: Optional[bool] = None):
"""
Selects a key of a ConfigMap.
:param str key: The key to select.
:param str name: Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
:param bool optional: Specify whether the ConfigMap or its key must be defined
"""
pulumi.set(__self__, "key", key)
if name is not None:
pulumi.set(__self__, "name", name)
if optional is not None:
pulumi.set(__self__, "optional", optional)
@property
@pulumi.getter
def key(self) -> str:
"""
The key to select.
"""
return pulumi.get(self, "key")
@property
@pulumi.getter
def name(self) -> Optional[str]:
"""
Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
"""
return pulumi.get(self, "name")
@property
@pulumi.getter
def optional(self) -> Optional[bool]:
"""
Specify whether the ConfigMap or its key must be defined
"""
return pulumi.get(self, "optional")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraStatusEnvValueFromFieldRef(dict):
"""
Selects a field of the pod: supports metadata.name, metadata.namespace, metadata.labels, metadata.annotations, spec.nodeName, spec.serviceAccountName, status.hostIP, status.podIP, status.podIPs.
"""
def __init__(__self__, *,
field_path: str,
api_version: Optional[str] = None):
"""
Selects a field of the pod: supports metadata.name, metadata.namespace, metadata.labels, metadata.annotations, spec.nodeName, spec.serviceAccountName, status.hostIP, status.podIP, status.podIPs.
:param str field_path: Path of the field to select in the specified API version.
:param str api_version: Version of the schema the FieldPath is written in terms of, defaults to "v1".
"""
pulumi.set(__self__, "field_path", field_path)
if api_version is not None:
pulumi.set(__self__, "api_version", api_version)
@property
@pulumi.getter(name="fieldPath")
def field_path(self) -> str:
"""
Path of the field to select in the specified API version.
"""
return pulumi.get(self, "field_path")
@property
@pulumi.getter(name="apiVersion")
def api_version(self) -> Optional[str]:
"""
Version of the schema the FieldPath is written in terms of, defaults to "v1".
"""
return pulumi.get(self, "api_version")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraStatusEnvValueFromResourceFieldRef(dict):
"""
Selects a resource of the container: only resources limits and requests (limits.cpu, limits.memory, limits.ephemeral-storage, requests.cpu, requests.memory and requests.ephemeral-storage) are currently supported.
"""
def __init__(__self__, *,
resource: str,
container_name: Optional[str] = None,
divisor: Optional['outputs.KogitoInfraStatusEnvValueFromResourceFieldRefDivisor'] = None):
"""
Selects a resource of the container: only resources limits and requests (limits.cpu, limits.memory, limits.ephemeral-storage, requests.cpu, requests.memory and requests.ephemeral-storage) are currently supported.
:param str resource: Required: resource to select
:param str container_name: Container name: required for volumes, optional for env vars
:param 'KogitoInfraStatusEnvValueFromResourceFieldRefDivisorArgs' divisor: Specifies the output format of the exposed resources, defaults to "1"
"""
pulumi.set(__self__, "resource", resource)
if container_name is not None:
pulumi.set(__self__, "container_name", container_name)
if divisor is not None:
pulumi.set(__self__, "divisor", divisor)
@property
@pulumi.getter
def resource(self) -> str:
"""
Required: resource to select
"""
return pulumi.get(self, "resource")
@property
@pulumi.getter(name="containerName")
def container_name(self) -> Optional[str]:
"""
Container name: required for volumes, optional for env vars
"""
return pulumi.get(self, "container_name")
@property
@pulumi.getter
def divisor(self) -> Optional['outputs.KogitoInfraStatusEnvValueFromResourceFieldRefDivisor']:
"""
Specifies the output format of the exposed resources, defaults to "1"
"""
return pulumi.get(self, "divisor")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraStatusEnvValueFromResourceFieldRefDivisor(dict):
def __init__(__self__):
pass
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraStatusEnvValueFromSecretKeyRef(dict):
"""
Selects a key of a secret in the pod's namespace
"""
def __init__(__self__, *,
key: str,
name: Optional[str] = None,
optional: Optional[bool] = None):
"""
Selects a key of a secret in the pod's namespace
:param str key: The key of the secret to select from. Must be a valid secret key.
:param str name: Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
:param bool optional: Specify whether the Secret or its key must be defined
"""
pulumi.set(__self__, "key", key)
if name is not None:
pulumi.set(__self__, "name", name)
if optional is not None:
pulumi.set(__self__, "optional", optional)
@property
@pulumi.getter
def key(self) -> str:
"""
The key of the secret to select from. Must be a valid secret key.
"""
return pulumi.get(self, "key")
@property
@pulumi.getter
def name(self) -> Optional[str]:
"""
Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
"""
return pulumi.get(self, "name")
@property
@pulumi.getter
def optional(self) -> Optional[bool]:
"""
Specify whether the Secret or its key must be defined
"""
return pulumi.get(self, "optional")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraStatusVolumes(dict):
"""
KogitoInfraVolume describes the data structure for volumes that should be mounted in the given service provided by this infra instance
"""
def __init__(__self__, *,
mount: 'outputs.KogitoInfraStatusVolumesMount',
volume: 'outputs.KogitoInfraStatusVolumesVolume'):
"""
KogitoInfraVolume describes the data structure for volumes that should be mounted in the given service provided by this infra instance
:param 'KogitoInfraStatusVolumesMountArgs' mount: Mount is the Kubernetes VolumeMount referenced by this instance
:param 'KogitoInfraStatusVolumesVolumeArgs' volume: NamedVolume describes the pod Volume reference
"""
pulumi.set(__self__, "mount", mount)
pulumi.set(__self__, "volume", volume)
@property
@pulumi.getter
def mount(self) -> 'outputs.KogitoInfraStatusVolumesMount':
"""
Mount is the Kubernetes VolumeMount referenced by this instance
"""
return pulumi.get(self, "mount")
@property
@pulumi.getter
def volume(self) -> 'outputs.KogitoInfraStatusVolumesVolume':
"""
NamedVolume describes the pod Volume reference
"""
return pulumi.get(self, "volume")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraStatusVolumesMount(dict):
"""
Mount is the Kubernetes VolumeMount referenced by this instance
"""
def __init__(__self__, *,
mount_path: str,
name: str,
mount_propagation: Optional[str] = None,
read_only: Optional[bool] = None,
sub_path: Optional[str] = None,
sub_path_expr: Optional[str] = None):
"""
Mount is the Kubernetes VolumeMount referenced by this instance
:param str mount_path: Path within the container at which the volume should be mounted. Must not contain ':'.
:param str name: This must match the Name of a Volume.
:param str mount_propagation: mountPropagation determines how mounts are propagated from the host to container and the other way around. When not set, MountPropagationNone is used. This field is beta in 1.10.
:param bool read_only: Mounted read-only if true, read-write otherwise (false or unspecified). Defaults to false.
:param str sub_path: Path within the volume from which the container's volume should be mounted. Defaults to "" (volume's root).
:param str sub_path_expr: Expanded path within the volume from which the container's volume should be mounted. Behaves similarly to SubPath but environment variable references $(VAR_NAME) are expanded using the container's environment. Defaults to "" (volume's root). SubPathExpr and SubPath are mutually exclusive.
"""
pulumi.set(__self__, "mount_path", mount_path)
pulumi.set(__self__, "name", name)
if mount_propagation is not None:
pulumi.set(__self__, "mount_propagation", mount_propagation)
if read_only is not None:
pulumi.set(__self__, "read_only", read_only)
if sub_path is not None:
pulumi.set(__self__, "sub_path", sub_path)
if sub_path_expr is not None:
pulumi.set(__self__, "sub_path_expr", sub_path_expr)
@property
@pulumi.getter(name="mountPath")
def mount_path(self) -> str:
"""
Path within the container at which the volume should be mounted. Must not contain ':'.
"""
return pulumi.get(self, "mount_path")
@property
@pulumi.getter
def name(self) -> str:
"""
This must match the Name of a Volume.
"""
return pulumi.get(self, "name")
@property
@pulumi.getter(name="mountPropagation")
def mount_propagation(self) -> Optional[str]:
"""
mountPropagation determines how mounts are propagated from the host to container and the other way around. When not set, MountPropagationNone is used. This field is beta in 1.10.
"""
return pulumi.get(self, "mount_propagation")
@property
@pulumi.getter(name="readOnly")
def read_only(self) -> Optional[bool]:
"""
Mounted read-only if true, read-write otherwise (false or unspecified). Defaults to false.
"""
return pulumi.get(self, "read_only")
@property
@pulumi.getter(name="subPath")
def sub_path(self) -> Optional[str]:
"""
Path within the volume from which the container's volume should be mounted. Defaults to "" (volume's root).
"""
return pulumi.get(self, "sub_path")
@property
@pulumi.getter(name="subPathExpr")
def sub_path_expr(self) -> Optional[str]:
"""
Expanded path within the volume from which the container's volume should be mounted. Behaves similarly to SubPath but environment variable references $(VAR_NAME) are expanded using the container's environment. Defaults to "" (volume's root). SubPathExpr and SubPath are mutually exclusive.
"""
return pulumi.get(self, "sub_path_expr")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraStatusVolumesVolume(dict):
"""
NamedVolume describes the pod Volume reference
"""
def __init__(__self__, *,
name: str,
config_map: Optional['outputs.KogitoInfraStatusVolumesVolumeConfigMap'] = None,
secret: Optional['outputs.KogitoInfraStatusVolumesVolumeSecret'] = None):
"""
NamedVolume describes the pod Volume reference
:param str name: Volume's name. Must be a DNS_LABEL and unique within the pod. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names
:param 'KogitoInfraStatusVolumesVolumeConfigMapArgs' config_map: ConfigMap represents a configMap that should populate this volume
:param 'KogitoInfraStatusVolumesVolumeSecretArgs' secret: Secret represents a secret that should populate this volume. More info: https://kubernetes.io/docs/concepts/storage/volumes#secret
"""
pulumi.set(__self__, "name", name)
if config_map is not None:
pulumi.set(__self__, "config_map", config_map)
if secret is not None:
pulumi.set(__self__, "secret", secret)
@property
@pulumi.getter
def name(self) -> str:
"""
Volume's name. Must be a DNS_LABEL and unique within the pod. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names
"""
return pulumi.get(self, "name")
@property
@pulumi.getter(name="configMap")
def config_map(self) -> Optional['outputs.KogitoInfraStatusVolumesVolumeConfigMap']:
"""
ConfigMap represents a configMap that should populate this volume
"""
return pulumi.get(self, "config_map")
@property
@pulumi.getter
def secret(self) -> Optional['outputs.KogitoInfraStatusVolumesVolumeSecret']:
"""
Secret represents a secret that should populate this volume. More info: https://kubernetes.io/docs/concepts/storage/volumes#secret
"""
return pulumi.get(self, "secret")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraStatusVolumesVolumeConfigMap(dict):
"""
ConfigMap represents a configMap that should populate this volume
"""
def __init__(__self__, *,
default_mode: Optional[int] = None,
items: Optional[Sequence['outputs.KogitoInfraStatusVolumesVolumeConfigMapItems']] = None,
name: Optional[str] = None,
optional: Optional[bool] = None):
"""
ConfigMap represents a configMap that should populate this volume
:param int default_mode: Optional: mode bits to use on created files by default. Must be a value between 0 and 0777. Defaults to 0644. Directories within the path are not affected by this setting. This might be in conflict with other options that affect the file mode, like fsGroup, and the result can be other mode bits set.
:param Sequence['KogitoInfraStatusVolumesVolumeConfigMapItemsArgs'] items: If unspecified, each key-value pair in the Data field of the referenced ConfigMap will be projected into the volume as a file whose name is the key and content is the value. If specified, the listed keys will be projected into the specified paths, and unlisted keys will not be present. If a key is specified which is not present in the ConfigMap, the volume setup will error unless it is marked optional. Paths must be relative and may not contain the '..' path or start with '..'.
:param str name: Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
:param bool optional: Specify whether the ConfigMap or its keys must be defined
"""
if default_mode is not None:
pulumi.set(__self__, "default_mode", default_mode)
if items is not None:
pulumi.set(__self__, "items", items)
if name is not None:
pulumi.set(__self__, "name", name)
if optional is not None:
pulumi.set(__self__, "optional", optional)
@property
@pulumi.getter(name="defaultMode")
def default_mode(self) -> Optional[int]:
"""
Optional: mode bits to use on created files by default. Must be a value between 0 and 0777. Defaults to 0644. Directories within the path are not affected by this setting. This might be in conflict with other options that affect the file mode, like fsGroup, and the result can be other mode bits set.
"""
return pulumi.get(self, "default_mode")
@property
@pulumi.getter
def items(self) -> Optional[Sequence['outputs.KogitoInfraStatusVolumesVolumeConfigMapItems']]:
"""
If unspecified, each key-value pair in the Data field of the referenced ConfigMap will be projected into the volume as a file whose name is the key and content is the value. If specified, the listed keys will be projected into the specified paths, and unlisted keys will not be present. If a key is specified which is not present in the ConfigMap, the volume setup will error unless it is marked optional. Paths must be relative and may not contain the '..' path or start with '..'.
"""
return pulumi.get(self, "items")
@property
@pulumi.getter
def name(self) -> Optional[str]:
"""
Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
"""
return pulumi.get(self, "name")
@property
@pulumi.getter
def optional(self) -> Optional[bool]:
"""
Specify whether the ConfigMap or its keys must be defined
"""
return pulumi.get(self, "optional")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraStatusVolumesVolumeConfigMapItems(dict):
"""
Maps a string key to a path within a volume.
"""
def __init__(__self__, *,
key: str,
path: str,
mode: Optional[int] = None):
"""
Maps a string key to a path within a volume.
:param str key: The key to project.
:param str path: The relative path of the file to map the key to. May not be an absolute path. May not contain the path element '..'. May not start with the string '..'.
:param int mode: Optional: mode bits to use on this file, must be a value between 0 and 0777. If not specified, the volume defaultMode will be used. This might be in conflict with other options that affect the file mode, like fsGroup, and the result can be other mode bits set.
"""
pulumi.set(__self__, "key", key)
pulumi.set(__self__, "path", path)
if mode is not None:
pulumi.set(__self__, "mode", mode)
@property
@pulumi.getter
def key(self) -> str:
"""
The key to project.
"""
return pulumi.get(self, "key")
@property
@pulumi.getter
def path(self) -> str:
"""
The relative path of the file to map the key to. May not be an absolute path. May not contain the path element '..'. May not start with the string '..'.
"""
return pulumi.get(self, "path")
@property
@pulumi.getter
def mode(self) -> Optional[int]:
"""
Optional: mode bits to use on this file, must be a value between 0 and 0777. If not specified, the volume defaultMode will be used. This might be in conflict with other options that affect the file mode, like fsGroup, and the result can be other mode bits set.
"""
return pulumi.get(self, "mode")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraStatusVolumesVolumeSecret(dict):
"""
Secret represents a secret that should populate this volume. More info: https://kubernetes.io/docs/concepts/storage/volumes#secret
"""
def __init__(__self__, *,
default_mode: Optional[int] = None,
items: Optional[Sequence['outputs.KogitoInfraStatusVolumesVolumeSecretItems']] = None,
optional: Optional[bool] = None,
secret_name: Optional[str] = None):
"""
Secret represents a secret that should populate this volume. More info: https://kubernetes.io/docs/concepts/storage/volumes#secret
:param int default_mode: Optional: mode bits to use on created files by default. Must be a value between 0 and 0777. Defaults to 0644. Directories within the path are not affected by this setting. This might be in conflict with other options that affect the file mode, like fsGroup, and the result can be other mode bits set.
:param Sequence['KogitoInfraStatusVolumesVolumeSecretItemsArgs'] items: If unspecified, each key-value pair in the Data field of the referenced Secret will be projected into the volume as a file whose name is the key and content is the value. If specified, the listed keys will be projected into the specified paths, and unlisted keys will not be present. If a key is specified which is not present in the Secret, the volume setup will error unless it is marked optional. Paths must be relative and may not contain the '..' path or start with '..'.
:param bool optional: Specify whether the Secret or its keys must be defined
:param str secret_name: Name of the secret in the pod's namespace to use. More info: https://kubernetes.io/docs/concepts/storage/volumes#secret
"""
if default_mode is not None:
pulumi.set(__self__, "default_mode", default_mode)
if items is not None:
pulumi.set(__self__, "items", items)
if optional is not None:
pulumi.set(__self__, "optional", optional)
if secret_name is not None:
pulumi.set(__self__, "secret_name", secret_name)
@property
@pulumi.getter(name="defaultMode")
def default_mode(self) -> Optional[int]:
"""
Optional: mode bits to use on created files by default. Must be a value between 0 and 0777. Defaults to 0644. Directories within the path are not affected by this setting. This might be in conflict with other options that affect the file mode, like fsGroup, and the result can be other mode bits set.
"""
return pulumi.get(self, "default_mode")
@property
@pulumi.getter
def items(self) -> Optional[Sequence['outputs.KogitoInfraStatusVolumesVolumeSecretItems']]:
"""
If unspecified, each key-value pair in the Data field of the referenced Secret will be projected into the volume as a file whose name is the key and content is the value. If specified, the listed keys will be projected into the specified paths, and unlisted keys will not be present. If a key is specified which is not present in the Secret, the volume setup will error unless it is marked optional. Paths must be relative and may not contain the '..' path or start with '..'.
"""
return pulumi.get(self, "items")
@property
@pulumi.getter
def optional(self) -> Optional[bool]:
"""
Specify whether the Secret or its keys must be defined
"""
return pulumi.get(self, "optional")
@property
@pulumi.getter(name="secretName")
def secret_name(self) -> Optional[str]:
"""
Name of the secret in the pod's namespace to use. More info: https://kubernetes.io/docs/concepts/storage/volumes#secret
"""
return pulumi.get(self, "secret_name")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoInfraStatusVolumesVolumeSecretItems(dict):
"""
Maps a string key to a path within a volume.
"""
def __init__(__self__, *,
key: str,
path: str,
mode: Optional[int] = None):
"""
Maps a string key to a path within a volume.
:param str key: The key to project.
:param str path: The relative path of the file to map the key to. May not be an absolute path. May not contain the path element '..'. May not start with the string '..'.
:param int mode: Optional: mode bits to use on this file, must be a value between 0 and 0777. If not specified, the volume defaultMode will be used. This might be in conflict with other options that affect the file mode, like fsGroup, and the result can be other mode bits set.
"""
pulumi.set(__self__, "key", key)
pulumi.set(__self__, "path", path)
if mode is not None:
pulumi.set(__self__, "mode", mode)
@property
@pulumi.getter
def key(self) -> str:
"""
The key to project.
"""
return pulumi.get(self, "key")
@property
@pulumi.getter
def path(self) -> str:
"""
The relative path of the file to map the key to. May not be an absolute path. May not contain the path element '..'. May not start with the string '..'.
"""
return pulumi.get(self, "path")
@property
@pulumi.getter
def mode(self) -> Optional[int]:
"""
Optional: mode bits to use on this file, must be a value between 0 and 0777. If not specified, the volume defaultMode will be used. This might be in conflict with other options that affect the file mode, like fsGroup, and the result can be other mode bits set.
"""
return pulumi.get(self, "mode")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeSpec(dict):
"""
KogitoRuntimeSpec defines the desired state of KogitoRuntime.
"""
def __init__(__self__, *,
config: Optional[Mapping[str, str]] = None,
deployment_labels: Optional[Mapping[str, str]] = None,
enable_istio: Optional[bool] = None,
env: Optional[Sequence['outputs.KogitoRuntimeSpecEnv']] = None,
image: Optional[str] = None,
infra: Optional[Sequence[str]] = None,
insecure_image_registry: Optional[bool] = None,
monitoring: Optional['outputs.KogitoRuntimeSpecMonitoring'] = None,
properties_config_map: Optional[str] = None,
replicas: Optional[int] = None,
resources: Optional['outputs.KogitoRuntimeSpecResources'] = None,
runtime: Optional[str] = None,
service_labels: Optional[Mapping[str, str]] = None):
"""
KogitoRuntimeSpec defines the desired state of KogitoRuntime.
:param Mapping[str, str] config: Application properties that will be set to the service. For example 'MY_VAR: my_value'.
:param Mapping[str, str] deployment_labels: Additional labels to be added to the Deployment and Pods managed by the operator.
:param bool enable_istio: Annotates the pods managed by the operator with the required metadata for Istio to setup its sidecars, enabling the mesh. Defaults to false.
:param Sequence['KogitoRuntimeSpecEnvArgs'] env: Environment variables to be added to the runtime container. Keys must be a C_IDENTIFIER.
:param str image: Image definition for the service. Example: "quay.io/kiegroup/kogito-service:latest". On OpenShift an ImageStream will be created in the current namespace pointing to the given image.
:param Sequence[str] infra: Infra provides list of dependent KogitoInfra objects.
:param bool insecure_image_registry: A flag indicating that image streams created by Kogito Operator should be configured to allow pulling from insecure registries. Usable just on OpenShift. Defaults to 'false'.
:param 'KogitoRuntimeSpecMonitoringArgs' monitoring: Create Service monitor instance to connect with Monitoring service
:param str properties_config_map: Custom ConfigMap with application.properties file to be mounted for the Kogito service. The ConfigMap must be created in the same namespace. Use this property if you need custom properties to be mounted before the application deployment. If left empty, one will be created for you. Later it can be updated to add any custom properties to apply to the service.
:param int replicas: Number of replicas that the service will have deployed in the cluster. Default value: 1.
:param 'KogitoRuntimeSpecResourcesArgs' resources: Defined compute resource requirements for the deployed service.
:param str runtime: The name of the runtime used, either Quarkus or SpringBoot. Default value: quarkus
:param Mapping[str, str] service_labels: Additional labels to be added to the Service managed by the operator.
"""
if config is not None:
pulumi.set(__self__, "config", config)
if deployment_labels is not None:
pulumi.set(__self__, "deployment_labels", deployment_labels)
if enable_istio is not None:
pulumi.set(__self__, "enable_istio", enable_istio)
if env is not None:
pulumi.set(__self__, "env", env)
if image is not None:
pulumi.set(__self__, "image", image)
if infra is not None:
pulumi.set(__self__, "infra", infra)
if insecure_image_registry is not None:
pulumi.set(__self__, "insecure_image_registry", insecure_image_registry)
if monitoring is not None:
pulumi.set(__self__, "monitoring", monitoring)
if properties_config_map is not None:
pulumi.set(__self__, "properties_config_map", properties_config_map)
if replicas is not None:
pulumi.set(__self__, "replicas", replicas)
if resources is not None:
pulumi.set(__self__, "resources", resources)
if runtime is not None:
pulumi.set(__self__, "runtime", runtime)
if service_labels is not None:
pulumi.set(__self__, "service_labels", service_labels)
@property
@pulumi.getter
def config(self) -> Optional[Mapping[str, str]]:
"""
Application properties that will be set to the service. For example 'MY_VAR: my_value'.
"""
return pulumi.get(self, "config")
@property
@pulumi.getter(name="deploymentLabels")
def deployment_labels(self) -> Optional[Mapping[str, str]]:
"""
Additional labels to be added to the Deployment and Pods managed by the operator.
"""
return pulumi.get(self, "deployment_labels")
@property
@pulumi.getter(name="enableIstio")
def enable_istio(self) -> Optional[bool]:
"""
Annotates the pods managed by the operator with the required metadata for Istio to setup its sidecars, enabling the mesh. Defaults to false.
"""
return pulumi.get(self, "enable_istio")
@property
@pulumi.getter
def env(self) -> Optional[Sequence['outputs.KogitoRuntimeSpecEnv']]:
"""
Environment variables to be added to the runtime container. Keys must be a C_IDENTIFIER.
"""
return pulumi.get(self, "env")
@property
@pulumi.getter
def image(self) -> Optional[str]:
"""
Image definition for the service. Example: "quay.io/kiegroup/kogito-service:latest". On OpenShift an ImageStream will be created in the current namespace pointing to the given image.
"""
return pulumi.get(self, "image")
@property
@pulumi.getter
def infra(self) -> Optional[Sequence[str]]:
"""
Infra provides list of dependent KogitoInfra objects.
"""
return pulumi.get(self, "infra")
@property
@pulumi.getter(name="insecureImageRegistry")
def insecure_image_registry(self) -> Optional[bool]:
"""
A flag indicating that image streams created by Kogito Operator should be configured to allow pulling from insecure registries. Usable just on OpenShift. Defaults to 'false'.
"""
return pulumi.get(self, "insecure_image_registry")
@property
@pulumi.getter
def monitoring(self) -> Optional['outputs.KogitoRuntimeSpecMonitoring']:
"""
Create Service monitor instance to connect with Monitoring service
"""
return pulumi.get(self, "monitoring")
@property
@pulumi.getter(name="propertiesConfigMap")
def properties_config_map(self) -> Optional[str]:
"""
Custom ConfigMap with application.properties file to be mounted for the Kogito service. The ConfigMap must be created in the same namespace. Use this property if you need custom properties to be mounted before the application deployment. If left empty, one will be created for you. Later it can be updated to add any custom properties to apply to the service.
"""
return pulumi.get(self, "properties_config_map")
@property
@pulumi.getter
def replicas(self) -> Optional[int]:
"""
Number of replicas that the service will have deployed in the cluster. Default value: 1.
"""
return pulumi.get(self, "replicas")
@property
@pulumi.getter
def resources(self) -> Optional['outputs.KogitoRuntimeSpecResources']:
"""
Defined compute resource requirements for the deployed service.
"""
return pulumi.get(self, "resources")
@property
@pulumi.getter
def runtime(self) -> Optional[str]:
"""
The name of the runtime used, either Quarkus or SpringBoot. Default value: quarkus
"""
return pulumi.get(self, "runtime")
@property
@pulumi.getter(name="serviceLabels")
def service_labels(self) -> Optional[Mapping[str, str]]:
"""
Additional labels to be added to the Service managed by the operator.
"""
return pulumi.get(self, "service_labels")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeSpecEnv(dict):
"""
EnvVar represents an environment variable present in a Container.
"""
def __init__(__self__, *,
name: str,
value: Optional[str] = None,
value_from: Optional['outputs.KogitoRuntimeSpecEnvValueFrom'] = None):
"""
EnvVar represents an environment variable present in a Container.
:param str name: Name of the environment variable. Must be a C_IDENTIFIER.
:param str value: Variable references $(VAR_NAME) are expanded using the previous defined environment variables in the container and any service environment variables. If a variable cannot be resolved, the reference in the input string will be unchanged. The $(VAR_NAME) syntax can be escaped with a double $$, ie: $$(VAR_NAME). Escaped references will never be expanded, regardless of whether the variable exists or not. Defaults to "".
:param 'KogitoRuntimeSpecEnvValueFromArgs' value_from: Source for the environment variable's value. Cannot be used if value is not empty.
"""
pulumi.set(__self__, "name", name)
if value is not None:
pulumi.set(__self__, "value", value)
if value_from is not None:
pulumi.set(__self__, "value_from", value_from)
@property
@pulumi.getter
def name(self) -> str:
"""
Name of the environment variable. Must be a C_IDENTIFIER.
"""
return pulumi.get(self, "name")
@property
@pulumi.getter
def value(self) -> Optional[str]:
"""
Variable references $(VAR_NAME) are expanded using the previous defined environment variables in the container and any service environment variables. If a variable cannot be resolved, the reference in the input string will be unchanged. The $(VAR_NAME) syntax can be escaped with a double $$, ie: $$(VAR_NAME). Escaped references will never be expanded, regardless of whether the variable exists or not. Defaults to "".
"""
return pulumi.get(self, "value")
@property
@pulumi.getter(name="valueFrom")
def value_from(self) -> Optional['outputs.KogitoRuntimeSpecEnvValueFrom']:
"""
Source for the environment variable's value. Cannot be used if value is not empty.
"""
return pulumi.get(self, "value_from")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeSpecEnvValueFrom(dict):
"""
Source for the environment variable's value. Cannot be used if value is not empty.
"""
def __init__(__self__, *,
config_map_key_ref: Optional['outputs.KogitoRuntimeSpecEnvValueFromConfigMapKeyRef'] = None,
field_ref: Optional['outputs.KogitoRuntimeSpecEnvValueFromFieldRef'] = None,
resource_field_ref: Optional['outputs.KogitoRuntimeSpecEnvValueFromResourceFieldRef'] = None,
secret_key_ref: Optional['outputs.KogitoRuntimeSpecEnvValueFromSecretKeyRef'] = None):
"""
Source for the environment variable's value. Cannot be used if value is not empty.
:param 'KogitoRuntimeSpecEnvValueFromConfigMapKeyRefArgs' config_map_key_ref: Selects a key of a ConfigMap.
:param 'KogitoRuntimeSpecEnvValueFromFieldRefArgs' field_ref: Selects a field of the pod: supports metadata.name, metadata.namespace, metadata.labels, metadata.annotations, spec.nodeName, spec.serviceAccountName, status.hostIP, status.podIP, status.podIPs.
:param 'KogitoRuntimeSpecEnvValueFromResourceFieldRefArgs' resource_field_ref: Selects a resource of the container: only resources limits and requests (limits.cpu, limits.memory, limits.ephemeral-storage, requests.cpu, requests.memory and requests.ephemeral-storage) are currently supported.
:param 'KogitoRuntimeSpecEnvValueFromSecretKeyRefArgs' secret_key_ref: Selects a key of a secret in the pod's namespace
"""
if config_map_key_ref is not None:
pulumi.set(__self__, "config_map_key_ref", config_map_key_ref)
if field_ref is not None:
pulumi.set(__self__, "field_ref", field_ref)
if resource_field_ref is not None:
pulumi.set(__self__, "resource_field_ref", resource_field_ref)
if secret_key_ref is not None:
pulumi.set(__self__, "secret_key_ref", secret_key_ref)
@property
@pulumi.getter(name="configMapKeyRef")
def config_map_key_ref(self) -> Optional['outputs.KogitoRuntimeSpecEnvValueFromConfigMapKeyRef']:
"""
Selects a key of a ConfigMap.
"""
return pulumi.get(self, "config_map_key_ref")
@property
@pulumi.getter(name="fieldRef")
def field_ref(self) -> Optional['outputs.KogitoRuntimeSpecEnvValueFromFieldRef']:
"""
Selects a field of the pod: supports metadata.name, metadata.namespace, metadata.labels, metadata.annotations, spec.nodeName, spec.serviceAccountName, status.hostIP, status.podIP, status.podIPs.
"""
return pulumi.get(self, "field_ref")
@property
@pulumi.getter(name="resourceFieldRef")
def resource_field_ref(self) -> Optional['outputs.KogitoRuntimeSpecEnvValueFromResourceFieldRef']:
"""
Selects a resource of the container: only resources limits and requests (limits.cpu, limits.memory, limits.ephemeral-storage, requests.cpu, requests.memory and requests.ephemeral-storage) are currently supported.
"""
return pulumi.get(self, "resource_field_ref")
@property
@pulumi.getter(name="secretKeyRef")
def secret_key_ref(self) -> Optional['outputs.KogitoRuntimeSpecEnvValueFromSecretKeyRef']:
"""
Selects a key of a secret in the pod's namespace
"""
return pulumi.get(self, "secret_key_ref")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeSpecEnvValueFromConfigMapKeyRef(dict):
"""
Selects a key of a ConfigMap.
"""
def __init__(__self__, *,
key: str,
name: Optional[str] = None,
optional: Optional[bool] = None):
"""
Selects a key of a ConfigMap.
:param str key: The key to select.
:param str name: Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
:param bool optional: Specify whether the ConfigMap or its key must be defined
"""
pulumi.set(__self__, "key", key)
if name is not None:
pulumi.set(__self__, "name", name)
if optional is not None:
pulumi.set(__self__, "optional", optional)
@property
@pulumi.getter
def key(self) -> str:
"""
The key to select.
"""
return pulumi.get(self, "key")
@property
@pulumi.getter
def name(self) -> Optional[str]:
"""
Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
"""
return pulumi.get(self, "name")
@property
@pulumi.getter
def optional(self) -> Optional[bool]:
"""
Specify whether the ConfigMap or its key must be defined
"""
return pulumi.get(self, "optional")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeSpecEnvValueFromFieldRef(dict):
"""
Selects a field of the pod: supports metadata.name, metadata.namespace, metadata.labels, metadata.annotations, spec.nodeName, spec.serviceAccountName, status.hostIP, status.podIP, status.podIPs.
"""
def __init__(__self__, *,
field_path: str,
api_version: Optional[str] = None):
"""
Selects a field of the pod: supports metadata.name, metadata.namespace, metadata.labels, metadata.annotations, spec.nodeName, spec.serviceAccountName, status.hostIP, status.podIP, status.podIPs.
:param str field_path: Path of the field to select in the specified API version.
:param str api_version: Version of the schema the FieldPath is written in terms of, defaults to "v1".
"""
pulumi.set(__self__, "field_path", field_path)
if api_version is not None:
pulumi.set(__self__, "api_version", api_version)
@property
@pulumi.getter(name="fieldPath")
def field_path(self) -> str:
"""
Path of the field to select in the specified API version.
"""
return pulumi.get(self, "field_path")
@property
@pulumi.getter(name="apiVersion")
def api_version(self) -> Optional[str]:
"""
Version of the schema the FieldPath is written in terms of, defaults to "v1".
"""
return pulumi.get(self, "api_version")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeSpecEnvValueFromResourceFieldRef(dict):
"""
Selects a resource of the container: only resources limits and requests (limits.cpu, limits.memory, limits.ephemeral-storage, requests.cpu, requests.memory and requests.ephemeral-storage) are currently supported.
"""
def __init__(__self__, *,
resource: str,
container_name: Optional[str] = None,
divisor: Optional['outputs.KogitoRuntimeSpecEnvValueFromResourceFieldRefDivisor'] = None):
"""
Selects a resource of the container: only resources limits and requests (limits.cpu, limits.memory, limits.ephemeral-storage, requests.cpu, requests.memory and requests.ephemeral-storage) are currently supported.
:param str resource: Required: resource to select
:param str container_name: Container name: required for volumes, optional for env vars
:param 'KogitoRuntimeSpecEnvValueFromResourceFieldRefDivisorArgs' divisor: Specifies the output format of the exposed resources, defaults to "1"
"""
pulumi.set(__self__, "resource", resource)
if container_name is not None:
pulumi.set(__self__, "container_name", container_name)
if divisor is not None:
pulumi.set(__self__, "divisor", divisor)
@property
@pulumi.getter
def resource(self) -> str:
"""
Required: resource to select
"""
return pulumi.get(self, "resource")
@property
@pulumi.getter(name="containerName")
def container_name(self) -> Optional[str]:
"""
Container name: required for volumes, optional for env vars
"""
return pulumi.get(self, "container_name")
@property
@pulumi.getter
def divisor(self) -> Optional['outputs.KogitoRuntimeSpecEnvValueFromResourceFieldRefDivisor']:
"""
Specifies the output format of the exposed resources, defaults to "1"
"""
return pulumi.get(self, "divisor")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeSpecEnvValueFromResourceFieldRefDivisor(dict):
def __init__(__self__):
pass
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeSpecEnvValueFromSecretKeyRef(dict):
"""
Selects a key of a secret in the pod's namespace
"""
def __init__(__self__, *,
key: str,
name: Optional[str] = None,
optional: Optional[bool] = None):
"""
Selects a key of a secret in the pod's namespace
:param str key: The key of the secret to select from. Must be a valid secret key.
:param str name: Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
:param bool optional: Specify whether the Secret or its key must be defined
"""
pulumi.set(__self__, "key", key)
if name is not None:
pulumi.set(__self__, "name", name)
if optional is not None:
pulumi.set(__self__, "optional", optional)
@property
@pulumi.getter
def key(self) -> str:
"""
The key of the secret to select from. Must be a valid secret key.
"""
return pulumi.get(self, "key")
@property
@pulumi.getter
def name(self) -> Optional[str]:
"""
Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
"""
return pulumi.get(self, "name")
@property
@pulumi.getter
def optional(self) -> Optional[bool]:
"""
Specify whether the Secret or its key must be defined
"""
return pulumi.get(self, "optional")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeSpecMonitoring(dict):
"""
Create Service monitor instance to connect with Monitoring service
"""
def __init__(__self__, *,
path: Optional[str] = None,
scheme: Optional[str] = None):
"""
Create Service monitor instance to connect with Monitoring service
:param str path: HTTP path to scrape for metrics.
:param str scheme: HTTP scheme to use for scraping.
"""
if path is not None:
pulumi.set(__self__, "path", path)
if scheme is not None:
pulumi.set(__self__, "scheme", scheme)
@property
@pulumi.getter
def path(self) -> Optional[str]:
"""
HTTP path to scrape for metrics.
"""
return pulumi.get(self, "path")
@property
@pulumi.getter
def scheme(self) -> Optional[str]:
"""
HTTP scheme to use for scraping.
"""
return pulumi.get(self, "scheme")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeSpecResources(dict):
"""
Defined compute resource requirements for the deployed service.
"""
def __init__(__self__, *,
limits: Optional[Mapping[str, 'outputs.KogitoRuntimeSpecResourcesLimits']] = None,
requests: Optional[Mapping[str, 'outputs.KogitoRuntimeSpecResourcesRequests']] = None):
"""
Defined compute resource requirements for the deployed service.
:param Mapping[str, 'KogitoRuntimeSpecResourcesLimitsArgs'] limits: Limits describes the maximum amount of compute resources allowed. More info: https://kubernetes.io/docs/concepts/configuration/manage-compute-resources-container/
:param Mapping[str, 'KogitoRuntimeSpecResourcesRequestsArgs'] requests: Requests describes the minimum amount of compute resources required. If Requests is omitted for a container, it defaults to Limits if that is explicitly specified, otherwise to an implementation-defined value. More info: https://kubernetes.io/docs/concepts/configuration/manage-compute-resources-container/
"""
if limits is not None:
pulumi.set(__self__, "limits", limits)
if requests is not None:
pulumi.set(__self__, "requests", requests)
@property
@pulumi.getter
def limits(self) -> Optional[Mapping[str, 'outputs.KogitoRuntimeSpecResourcesLimits']]:
"""
Limits describes the maximum amount of compute resources allowed. More info: https://kubernetes.io/docs/concepts/configuration/manage-compute-resources-container/
"""
return pulumi.get(self, "limits")
@property
@pulumi.getter
def requests(self) -> Optional[Mapping[str, 'outputs.KogitoRuntimeSpecResourcesRequests']]:
"""
Requests describes the minimum amount of compute resources required. If Requests is omitted for a container, it defaults to Limits if that is explicitly specified, otherwise to an implementation-defined value. More info: https://kubernetes.io/docs/concepts/configuration/manage-compute-resources-container/
"""
return pulumi.get(self, "requests")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeSpecResourcesLimits(dict):
def __init__(__self__):
pass
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeSpecResourcesRequests(dict):
def __init__(__self__):
pass
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeStatus(dict):
"""
KogitoRuntimeStatus defines the observed state of KogitoRuntime.
"""
def __init__(__self__, *,
conditions: Sequence['outputs.KogitoRuntimeStatusConditions'],
cloud_events: Optional['outputs.KogitoRuntimeStatusCloudEvents'] = None,
deployment_conditions: Optional[Sequence['outputs.KogitoRuntimeStatusDeploymentConditions']] = None,
external_uri: Optional[str] = None,
image: Optional[str] = None):
"""
KogitoRuntimeStatus defines the observed state of KogitoRuntime.
:param Sequence['KogitoRuntimeStatusConditionsArgs'] conditions: History of conditions for the resource
:param 'KogitoRuntimeStatusCloudEventsArgs' cloud_events: Describes the CloudEvents that this instance can consume or produce
:param Sequence['KogitoRuntimeStatusDeploymentConditionsArgs'] deployment_conditions: General conditions for the Kogito Service deployment.
:param str external_uri: URI is where the service is exposed.
:param str image: Image is the resolved image for this service.
"""
pulumi.set(__self__, "conditions", conditions)
if cloud_events is not None:
pulumi.set(__self__, "cloud_events", cloud_events)
if deployment_conditions is not None:
pulumi.set(__self__, "deployment_conditions", deployment_conditions)
if external_uri is not None:
pulumi.set(__self__, "external_uri", external_uri)
if image is not None:
pulumi.set(__self__, "image", image)
@property
@pulumi.getter
def conditions(self) -> Sequence['outputs.KogitoRuntimeStatusConditions']:
"""
History of conditions for the resource
"""
return pulumi.get(self, "conditions")
@property
@pulumi.getter(name="cloudEvents")
def cloud_events(self) -> Optional['outputs.KogitoRuntimeStatusCloudEvents']:
"""
Describes the CloudEvents that this instance can consume or produce
"""
return pulumi.get(self, "cloud_events")
@property
@pulumi.getter(name="deploymentConditions")
def deployment_conditions(self) -> Optional[Sequence['outputs.KogitoRuntimeStatusDeploymentConditions']]:
"""
General conditions for the Kogito Service deployment.
"""
return pulumi.get(self, "deployment_conditions")
@property
@pulumi.getter(name="externalURI")
def external_uri(self) -> Optional[str]:
"""
URI is where the service is exposed.
"""
return pulumi.get(self, "external_uri")
@property
@pulumi.getter
def image(self) -> Optional[str]:
"""
Image is the resolved image for this service.
"""
return pulumi.get(self, "image")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeStatusCloudEvents(dict):
"""
Describes the CloudEvents that this instance can consume or produce
"""
def __init__(__self__, *,
consumes: Optional[Sequence['outputs.KogitoRuntimeStatusCloudEventsConsumes']] = None,
produces: Optional[Sequence['outputs.KogitoRuntimeStatusCloudEventsProduces']] = None):
"""
Describes the CloudEvents that this instance can consume or produce
"""
if consumes is not None:
pulumi.set(__self__, "consumes", consumes)
if produces is not None:
pulumi.set(__self__, "produces", produces)
@property
@pulumi.getter
def consumes(self) -> Optional[Sequence['outputs.KogitoRuntimeStatusCloudEventsConsumes']]:
return pulumi.get(self, "consumes")
@property
@pulumi.getter
def produces(self) -> Optional[Sequence['outputs.KogitoRuntimeStatusCloudEventsProduces']]:
return pulumi.get(self, "produces")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeStatusCloudEventsConsumes(dict):
"""
KogitoCloudEventInfo describes the CloudEvent information based on the specification
"""
def __init__(__self__, *,
type: str,
source: Optional[str] = None):
"""
KogitoCloudEventInfo describes the CloudEvent information based on the specification
"""
pulumi.set(__self__, "type", type)
if source is not None:
pulumi.set(__self__, "source", source)
@property
@pulumi.getter
def type(self) -> str:
return pulumi.get(self, "type")
@property
@pulumi.getter
def source(self) -> Optional[str]:
return pulumi.get(self, "source")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeStatusCloudEventsProduces(dict):
"""
KogitoCloudEventInfo describes the CloudEvent information based on the specification
"""
def __init__(__self__, *,
type: str,
source: Optional[str] = None):
"""
KogitoCloudEventInfo describes the CloudEvent information based on the specification
"""
pulumi.set(__self__, "type", type)
if source is not None:
pulumi.set(__self__, "source", source)
@property
@pulumi.getter
def type(self) -> str:
return pulumi.get(self, "type")
@property
@pulumi.getter
def source(self) -> Optional[str]:
return pulumi.get(self, "source")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeStatusConditions(dict):
"""
Condition is the detailed condition for the resource
"""
def __init__(__self__, *,
status: str,
type: str,
last_transition_time: Optional[str] = None,
message: Optional[str] = None,
reason: Optional[str] = None):
"""
Condition is the detailed condition for the resource
:param str type: ConditionType is the type of condition
:param str reason: KogitoServiceConditionReason is the type of reason
"""
pulumi.set(__self__, "status", status)
pulumi.set(__self__, "type", type)
if last_transition_time is not None:
pulumi.set(__self__, "last_transition_time", last_transition_time)
if message is not None:
pulumi.set(__self__, "message", message)
if reason is not None:
pulumi.set(__self__, "reason", reason)
@property
@pulumi.getter
def status(self) -> str:
return pulumi.get(self, "status")
@property
@pulumi.getter
def type(self) -> str:
"""
ConditionType is the type of condition
"""
return pulumi.get(self, "type")
@property
@pulumi.getter(name="lastTransitionTime")
def last_transition_time(self) -> Optional[str]:
return pulumi.get(self, "last_transition_time")
@property
@pulumi.getter
def message(self) -> Optional[str]:
return pulumi.get(self, "message")
@property
@pulumi.getter
def reason(self) -> Optional[str]:
"""
KogitoServiceConditionReason is the type of reason
"""
return pulumi.get(self, "reason")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoRuntimeStatusDeploymentConditions(dict):
"""
DeploymentCondition describes the state of a deployment at a certain point.
"""
def __init__(__self__, *,
status: str,
type: str,
last_transition_time: Optional[str] = None,
last_update_time: Optional[str] = None,
message: Optional[str] = None,
reason: Optional[str] = None):
"""
DeploymentCondition describes the state of a deployment at a certain point.
:param str status: Status of the condition, one of True, False, Unknown.
:param str type: Type of deployment condition.
:param str last_transition_time: Last time the condition transitioned from one status to another.
:param str last_update_time: The last time this condition was updated.
:param str message: A human readable message indicating details about the transition.
:param str reason: The reason for the condition's last transition.
"""
pulumi.set(__self__, "status", status)
pulumi.set(__self__, "type", type)
if last_transition_time is not None:
pulumi.set(__self__, "last_transition_time", last_transition_time)
if last_update_time is not None:
pulumi.set(__self__, "last_update_time", last_update_time)
if message is not None:
pulumi.set(__self__, "message", message)
if reason is not None:
pulumi.set(__self__, "reason", reason)
@property
@pulumi.getter
def status(self) -> str:
"""
Status of the condition, one of True, False, Unknown.
"""
return pulumi.get(self, "status")
@property
@pulumi.getter
def type(self) -> str:
"""
Type of deployment condition.
"""
return pulumi.get(self, "type")
@property
@pulumi.getter(name="lastTransitionTime")
def last_transition_time(self) -> Optional[str]:
"""
Last time the condition transitioned from one status to another.
"""
return pulumi.get(self, "last_transition_time")
@property
@pulumi.getter(name="lastUpdateTime")
def last_update_time(self) -> Optional[str]:
"""
The last time this condition was updated.
"""
return pulumi.get(self, "last_update_time")
@property
@pulumi.getter
def message(self) -> Optional[str]:
"""
A human readable message indicating details about the transition.
"""
return pulumi.get(self, "message")
@property
@pulumi.getter
def reason(self) -> Optional[str]:
"""
The reason for the condition's last transition.
"""
return pulumi.get(self, "reason")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceSpec(dict):
"""
KogitoSupportingServiceSpec defines the desired state of KogitoSupportingService.
"""
def __init__(__self__, *,
service_type: str,
config: Optional[Mapping[str, str]] = None,
deployment_labels: Optional[Mapping[str, str]] = None,
env: Optional[Sequence['outputs.KogitoSupportingServiceSpecEnv']] = None,
image: Optional[str] = None,
infra: Optional[Sequence[str]] = None,
insecure_image_registry: Optional[bool] = None,
monitoring: Optional['outputs.KogitoSupportingServiceSpecMonitoring'] = None,
properties_config_map: Optional[str] = None,
replicas: Optional[int] = None,
resources: Optional['outputs.KogitoSupportingServiceSpecResources'] = None,
service_labels: Optional[Mapping[str, str]] = None):
"""
KogitoSupportingServiceSpec defines the desired state of KogitoSupportingService.
:param str service_type: Defines the type for the supporting service, eg: DataIndex, JobsService Default value: JobsService
:param Mapping[str, str] config: Application properties that will be set to the service. For example 'MY_VAR: my_value'.
:param Mapping[str, str] deployment_labels: Additional labels to be added to the Deployment and Pods managed by the operator.
:param Sequence['KogitoSupportingServiceSpecEnvArgs'] env: Environment variables to be added to the runtime container. Keys must be a C_IDENTIFIER.
:param str image: Image definition for the service. Example: "quay.io/kiegroup/kogito-service:latest". On OpenShift an ImageStream will be created in the current namespace pointing to the given image.
:param Sequence[str] infra: Infra provides list of dependent KogitoInfra objects.
:param bool insecure_image_registry: A flag indicating that image streams created by Kogito Operator should be configured to allow pulling from insecure registries. Usable just on OpenShift. Defaults to 'false'.
:param 'KogitoSupportingServiceSpecMonitoringArgs' monitoring: Create Service monitor instance to connect with Monitoring service
:param str properties_config_map: Custom ConfigMap with application.properties file to be mounted for the Kogito service. The ConfigMap must be created in the same namespace. Use this property if you need custom properties to be mounted before the application deployment. If left empty, one will be created for you. Later it can be updated to add any custom properties to apply to the service.
:param int replicas: Number of replicas that the service will have deployed in the cluster. Default value: 1.
:param 'KogitoSupportingServiceSpecResourcesArgs' resources: Defined compute resource requirements for the deployed service.
:param Mapping[str, str] service_labels: Additional labels to be added to the Service managed by the operator.
"""
pulumi.set(__self__, "service_type", service_type)
if config is not None:
pulumi.set(__self__, "config", config)
if deployment_labels is not None:
pulumi.set(__self__, "deployment_labels", deployment_labels)
if env is not None:
pulumi.set(__self__, "env", env)
if image is not None:
pulumi.set(__self__, "image", image)
if infra is not None:
pulumi.set(__self__, "infra", infra)
if insecure_image_registry is not None:
pulumi.set(__self__, "insecure_image_registry", insecure_image_registry)
if monitoring is not None:
pulumi.set(__self__, "monitoring", monitoring)
if properties_config_map is not None:
pulumi.set(__self__, "properties_config_map", properties_config_map)
if replicas is not None:
pulumi.set(__self__, "replicas", replicas)
if resources is not None:
pulumi.set(__self__, "resources", resources)
if service_labels is not None:
pulumi.set(__self__, "service_labels", service_labels)
@property
@pulumi.getter(name="serviceType")
def service_type(self) -> str:
"""
Defines the type for the supporting service, eg: DataIndex, JobsService Default value: JobsService
"""
return pulumi.get(self, "service_type")
@property
@pulumi.getter
def config(self) -> Optional[Mapping[str, str]]:
"""
Application properties that will be set to the service. For example 'MY_VAR: my_value'.
"""
return pulumi.get(self, "config")
@property
@pulumi.getter(name="deploymentLabels")
def deployment_labels(self) -> Optional[Mapping[str, str]]:
"""
Additional labels to be added to the Deployment and Pods managed by the operator.
"""
return pulumi.get(self, "deployment_labels")
@property
@pulumi.getter
def env(self) -> Optional[Sequence['outputs.KogitoSupportingServiceSpecEnv']]:
"""
Environment variables to be added to the runtime container. Keys must be a C_IDENTIFIER.
"""
return pulumi.get(self, "env")
@property
@pulumi.getter
def image(self) -> Optional[str]:
"""
Image definition for the service. Example: "quay.io/kiegroup/kogito-service:latest". On OpenShift an ImageStream will be created in the current namespace pointing to the given image.
"""
return pulumi.get(self, "image")
@property
@pulumi.getter
def infra(self) -> Optional[Sequence[str]]:
"""
Infra provides list of dependent KogitoInfra objects.
"""
return pulumi.get(self, "infra")
@property
@pulumi.getter(name="insecureImageRegistry")
def insecure_image_registry(self) -> Optional[bool]:
"""
A flag indicating that image streams created by Kogito Operator should be configured to allow pulling from insecure registries. Usable just on OpenShift. Defaults to 'false'.
"""
return pulumi.get(self, "insecure_image_registry")
@property
@pulumi.getter
def monitoring(self) -> Optional['outputs.KogitoSupportingServiceSpecMonitoring']:
"""
Create Service monitor instance to connect with Monitoring service
"""
return pulumi.get(self, "monitoring")
@property
@pulumi.getter(name="propertiesConfigMap")
def properties_config_map(self) -> Optional[str]:
"""
Custom ConfigMap with application.properties file to be mounted for the Kogito service. The ConfigMap must be created in the same namespace. Use this property if you need custom properties to be mounted before the application deployment. If left empty, one will be created for you. Later it can be updated to add any custom properties to apply to the service.
"""
return pulumi.get(self, "properties_config_map")
@property
@pulumi.getter
def replicas(self) -> Optional[int]:
"""
Number of replicas that the service will have deployed in the cluster. Default value: 1.
"""
return pulumi.get(self, "replicas")
@property
@pulumi.getter
def resources(self) -> Optional['outputs.KogitoSupportingServiceSpecResources']:
"""
Defined compute resource requirements for the deployed service.
"""
return pulumi.get(self, "resources")
@property
@pulumi.getter(name="serviceLabels")
def service_labels(self) -> Optional[Mapping[str, str]]:
"""
Additional labels to be added to the Service managed by the operator.
"""
return pulumi.get(self, "service_labels")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceSpecEnv(dict):
"""
EnvVar represents an environment variable present in a Container.
"""
def __init__(__self__, *,
name: str,
value: Optional[str] = None,
value_from: Optional['outputs.KogitoSupportingServiceSpecEnvValueFrom'] = None):
"""
EnvVar represents an environment variable present in a Container.
:param str name: Name of the environment variable. Must be a C_IDENTIFIER.
:param str value: Variable references $(VAR_NAME) are expanded using the previous defined environment variables in the container and any service environment variables. If a variable cannot be resolved, the reference in the input string will be unchanged. The $(VAR_NAME) syntax can be escaped with a double $$, ie: $$(VAR_NAME). Escaped references will never be expanded, regardless of whether the variable exists or not. Defaults to "".
:param 'KogitoSupportingServiceSpecEnvValueFromArgs' value_from: Source for the environment variable's value. Cannot be used if value is not empty.
"""
pulumi.set(__self__, "name", name)
if value is not None:
pulumi.set(__self__, "value", value)
if value_from is not None:
pulumi.set(__self__, "value_from", value_from)
@property
@pulumi.getter
def name(self) -> str:
"""
Name of the environment variable. Must be a C_IDENTIFIER.
"""
return pulumi.get(self, "name")
@property
@pulumi.getter
def value(self) -> Optional[str]:
"""
Variable references $(VAR_NAME) are expanded using the previous defined environment variables in the container and any service environment variables. If a variable cannot be resolved, the reference in the input string will be unchanged. The $(VAR_NAME) syntax can be escaped with a double $$, ie: $$(VAR_NAME). Escaped references will never be expanded, regardless of whether the variable exists or not. Defaults to "".
"""
return pulumi.get(self, "value")
@property
@pulumi.getter(name="valueFrom")
def value_from(self) -> Optional['outputs.KogitoSupportingServiceSpecEnvValueFrom']:
"""
Source for the environment variable's value. Cannot be used if value is not empty.
"""
return pulumi.get(self, "value_from")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceSpecEnvValueFrom(dict):
"""
Source for the environment variable's value. Cannot be used if value is not empty.
"""
def __init__(__self__, *,
config_map_key_ref: Optional['outputs.KogitoSupportingServiceSpecEnvValueFromConfigMapKeyRef'] = None,
field_ref: Optional['outputs.KogitoSupportingServiceSpecEnvValueFromFieldRef'] = None,
resource_field_ref: Optional['outputs.KogitoSupportingServiceSpecEnvValueFromResourceFieldRef'] = None,
secret_key_ref: Optional['outputs.KogitoSupportingServiceSpecEnvValueFromSecretKeyRef'] = None):
"""
Source for the environment variable's value. Cannot be used if value is not empty.
:param 'KogitoSupportingServiceSpecEnvValueFromConfigMapKeyRefArgs' config_map_key_ref: Selects a key of a ConfigMap.
:param 'KogitoSupportingServiceSpecEnvValueFromFieldRefArgs' field_ref: Selects a field of the pod: supports metadata.name, metadata.namespace, metadata.labels, metadata.annotations, spec.nodeName, spec.serviceAccountName, status.hostIP, status.podIP, status.podIPs.
:param 'KogitoSupportingServiceSpecEnvValueFromResourceFieldRefArgs' resource_field_ref: Selects a resource of the container: only resources limits and requests (limits.cpu, limits.memory, limits.ephemeral-storage, requests.cpu, requests.memory and requests.ephemeral-storage) are currently supported.
:param 'KogitoSupportingServiceSpecEnvValueFromSecretKeyRefArgs' secret_key_ref: Selects a key of a secret in the pod's namespace
"""
if config_map_key_ref is not None:
pulumi.set(__self__, "config_map_key_ref", config_map_key_ref)
if field_ref is not None:
pulumi.set(__self__, "field_ref", field_ref)
if resource_field_ref is not None:
pulumi.set(__self__, "resource_field_ref", resource_field_ref)
if secret_key_ref is not None:
pulumi.set(__self__, "secret_key_ref", secret_key_ref)
@property
@pulumi.getter(name="configMapKeyRef")
def config_map_key_ref(self) -> Optional['outputs.KogitoSupportingServiceSpecEnvValueFromConfigMapKeyRef']:
"""
Selects a key of a ConfigMap.
"""
return pulumi.get(self, "config_map_key_ref")
@property
@pulumi.getter(name="fieldRef")
def field_ref(self) -> Optional['outputs.KogitoSupportingServiceSpecEnvValueFromFieldRef']:
"""
Selects a field of the pod: supports metadata.name, metadata.namespace, metadata.labels, metadata.annotations, spec.nodeName, spec.serviceAccountName, status.hostIP, status.podIP, status.podIPs.
"""
return pulumi.get(self, "field_ref")
@property
@pulumi.getter(name="resourceFieldRef")
def resource_field_ref(self) -> Optional['outputs.KogitoSupportingServiceSpecEnvValueFromResourceFieldRef']:
"""
Selects a resource of the container: only resources limits and requests (limits.cpu, limits.memory, limits.ephemeral-storage, requests.cpu, requests.memory and requests.ephemeral-storage) are currently supported.
"""
return pulumi.get(self, "resource_field_ref")
@property
@pulumi.getter(name="secretKeyRef")
def secret_key_ref(self) -> Optional['outputs.KogitoSupportingServiceSpecEnvValueFromSecretKeyRef']:
"""
Selects a key of a secret in the pod's namespace
"""
return pulumi.get(self, "secret_key_ref")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceSpecEnvValueFromConfigMapKeyRef(dict):
"""
Selects a key of a ConfigMap.
"""
def __init__(__self__, *,
key: str,
name: Optional[str] = None,
optional: Optional[bool] = None):
"""
Selects a key of a ConfigMap.
:param str key: The key to select.
:param str name: Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
:param bool optional: Specify whether the ConfigMap or its key must be defined
"""
pulumi.set(__self__, "key", key)
if name is not None:
pulumi.set(__self__, "name", name)
if optional is not None:
pulumi.set(__self__, "optional", optional)
@property
@pulumi.getter
def key(self) -> str:
"""
The key to select.
"""
return pulumi.get(self, "key")
@property
@pulumi.getter
def name(self) -> Optional[str]:
"""
Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
"""
return pulumi.get(self, "name")
@property
@pulumi.getter
def optional(self) -> Optional[bool]:
"""
Specify whether the ConfigMap or its key must be defined
"""
return pulumi.get(self, "optional")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceSpecEnvValueFromFieldRef(dict):
"""
Selects a field of the pod: supports metadata.name, metadata.namespace, metadata.labels, metadata.annotations, spec.nodeName, spec.serviceAccountName, status.hostIP, status.podIP, status.podIPs.
"""
def __init__(__self__, *,
field_path: str,
api_version: Optional[str] = None):
"""
Selects a field of the pod: supports metadata.name, metadata.namespace, metadata.labels, metadata.annotations, spec.nodeName, spec.serviceAccountName, status.hostIP, status.podIP, status.podIPs.
:param str field_path: Path of the field to select in the specified API version.
:param str api_version: Version of the schema the FieldPath is written in terms of, defaults to "v1".
"""
pulumi.set(__self__, "field_path", field_path)
if api_version is not None:
pulumi.set(__self__, "api_version", api_version)
@property
@pulumi.getter(name="fieldPath")
def field_path(self) -> str:
"""
Path of the field to select in the specified API version.
"""
return pulumi.get(self, "field_path")
@property
@pulumi.getter(name="apiVersion")
def api_version(self) -> Optional[str]:
"""
Version of the schema the FieldPath is written in terms of, defaults to "v1".
"""
return pulumi.get(self, "api_version")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceSpecEnvValueFromResourceFieldRef(dict):
"""
Selects a resource of the container: only resources limits and requests (limits.cpu, limits.memory, limits.ephemeral-storage, requests.cpu, requests.memory and requests.ephemeral-storage) are currently supported.
"""
def __init__(__self__, *,
resource: str,
container_name: Optional[str] = None,
divisor: Optional['outputs.KogitoSupportingServiceSpecEnvValueFromResourceFieldRefDivisor'] = None):
"""
Selects a resource of the container: only resources limits and requests (limits.cpu, limits.memory, limits.ephemeral-storage, requests.cpu, requests.memory and requests.ephemeral-storage) are currently supported.
:param str resource: Required: resource to select
:param str container_name: Container name: required for volumes, optional for env vars
:param 'KogitoSupportingServiceSpecEnvValueFromResourceFieldRefDivisorArgs' divisor: Specifies the output format of the exposed resources, defaults to "1"
"""
pulumi.set(__self__, "resource", resource)
if container_name is not None:
pulumi.set(__self__, "container_name", container_name)
if divisor is not None:
pulumi.set(__self__, "divisor", divisor)
@property
@pulumi.getter
def resource(self) -> str:
"""
Required: resource to select
"""
return pulumi.get(self, "resource")
@property
@pulumi.getter(name="containerName")
def container_name(self) -> Optional[str]:
"""
Container name: required for volumes, optional for env vars
"""
return pulumi.get(self, "container_name")
@property
@pulumi.getter
def divisor(self) -> Optional['outputs.KogitoSupportingServiceSpecEnvValueFromResourceFieldRefDivisor']:
"""
Specifies the output format of the exposed resources, defaults to "1"
"""
return pulumi.get(self, "divisor")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceSpecEnvValueFromResourceFieldRefDivisor(dict):
def __init__(__self__):
pass
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceSpecEnvValueFromSecretKeyRef(dict):
"""
Selects a key of a secret in the pod's namespace
"""
def __init__(__self__, *,
key: str,
name: Optional[str] = None,
optional: Optional[bool] = None):
"""
Selects a key of a secret in the pod's namespace
:param str key: The key of the secret to select from. Must be a valid secret key.
:param str name: Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
:param bool optional: Specify whether the Secret or its key must be defined
"""
pulumi.set(__self__, "key", key)
if name is not None:
pulumi.set(__self__, "name", name)
if optional is not None:
pulumi.set(__self__, "optional", optional)
@property
@pulumi.getter
def key(self) -> str:
"""
The key of the secret to select from. Must be a valid secret key.
"""
return pulumi.get(self, "key")
@property
@pulumi.getter
def name(self) -> Optional[str]:
"""
Name of the referent. More info: https://kubernetes.io/docs/concepts/overview/working-with-objects/names/#names TODO: Add other useful fields. apiVersion, kind, uid?
"""
return pulumi.get(self, "name")
@property
@pulumi.getter
def optional(self) -> Optional[bool]:
"""
Specify whether the Secret or its key must be defined
"""
return pulumi.get(self, "optional")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceSpecMonitoring(dict):
"""
Create Service monitor instance to connect with Monitoring service
"""
def __init__(__self__, *,
path: Optional[str] = None,
scheme: Optional[str] = None):
"""
Create Service monitor instance to connect with Monitoring service
:param str path: HTTP path to scrape for metrics.
:param str scheme: HTTP scheme to use for scraping.
"""
if path is not None:
pulumi.set(__self__, "path", path)
if scheme is not None:
pulumi.set(__self__, "scheme", scheme)
@property
@pulumi.getter
def path(self) -> Optional[str]:
"""
HTTP path to scrape for metrics.
"""
return pulumi.get(self, "path")
@property
@pulumi.getter
def scheme(self) -> Optional[str]:
"""
HTTP scheme to use for scraping.
"""
return pulumi.get(self, "scheme")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceSpecResources(dict):
"""
Defined compute resource requirements for the deployed service.
"""
def __init__(__self__, *,
limits: Optional[Mapping[str, 'outputs.KogitoSupportingServiceSpecResourcesLimits']] = None,
requests: Optional[Mapping[str, 'outputs.KogitoSupportingServiceSpecResourcesRequests']] = None):
"""
Defined compute resource requirements for the deployed service.
:param Mapping[str, 'KogitoSupportingServiceSpecResourcesLimitsArgs'] limits: Limits describes the maximum amount of compute resources allowed. More info: https://kubernetes.io/docs/concepts/configuration/manage-compute-resources-container/
:param Mapping[str, 'KogitoSupportingServiceSpecResourcesRequestsArgs'] requests: Requests describes the minimum amount of compute resources required. If Requests is omitted for a container, it defaults to Limits if that is explicitly specified, otherwise to an implementation-defined value. More info: https://kubernetes.io/docs/concepts/configuration/manage-compute-resources-container/
"""
if limits is not None:
pulumi.set(__self__, "limits", limits)
if requests is not None:
pulumi.set(__self__, "requests", requests)
@property
@pulumi.getter
def limits(self) -> Optional[Mapping[str, 'outputs.KogitoSupportingServiceSpecResourcesLimits']]:
"""
Limits describes the maximum amount of compute resources allowed. More info: https://kubernetes.io/docs/concepts/configuration/manage-compute-resources-container/
"""
return pulumi.get(self, "limits")
@property
@pulumi.getter
def requests(self) -> Optional[Mapping[str, 'outputs.KogitoSupportingServiceSpecResourcesRequests']]:
"""
Requests describes the minimum amount of compute resources required. If Requests is omitted for a container, it defaults to Limits if that is explicitly specified, otherwise to an implementation-defined value. More info: https://kubernetes.io/docs/concepts/configuration/manage-compute-resources-container/
"""
return pulumi.get(self, "requests")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceSpecResourcesLimits(dict):
def __init__(__self__):
pass
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceSpecResourcesRequests(dict):
def __init__(__self__):
pass
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceStatus(dict):
"""
KogitoSupportingServiceStatus defines the observed state of KogitoSupportingService.
"""
def __init__(__self__, *,
conditions: Sequence['outputs.KogitoSupportingServiceStatusConditions'],
cloud_events: Optional['outputs.KogitoSupportingServiceStatusCloudEvents'] = None,
deployment_conditions: Optional[Sequence['outputs.KogitoSupportingServiceStatusDeploymentConditions']] = None,
external_uri: Optional[str] = None,
image: Optional[str] = None):
"""
KogitoSupportingServiceStatus defines the observed state of KogitoSupportingService.
:param Sequence['KogitoSupportingServiceStatusConditionsArgs'] conditions: History of conditions for the resource
:param 'KogitoSupportingServiceStatusCloudEventsArgs' cloud_events: Describes the CloudEvents that this instance can consume or produce
:param Sequence['KogitoSupportingServiceStatusDeploymentConditionsArgs'] deployment_conditions: General conditions for the Kogito Service deployment.
:param str external_uri: URI is where the service is exposed.
:param str image: Image is the resolved image for this service.
"""
pulumi.set(__self__, "conditions", conditions)
if cloud_events is not None:
pulumi.set(__self__, "cloud_events", cloud_events)
if deployment_conditions is not None:
pulumi.set(__self__, "deployment_conditions", deployment_conditions)
if external_uri is not None:
pulumi.set(__self__, "external_uri", external_uri)
if image is not None:
pulumi.set(__self__, "image", image)
@property
@pulumi.getter
def conditions(self) -> Sequence['outputs.KogitoSupportingServiceStatusConditions']:
"""
History of conditions for the resource
"""
return pulumi.get(self, "conditions")
@property
@pulumi.getter(name="cloudEvents")
def cloud_events(self) -> Optional['outputs.KogitoSupportingServiceStatusCloudEvents']:
"""
Describes the CloudEvents that this instance can consume or produce
"""
return pulumi.get(self, "cloud_events")
@property
@pulumi.getter(name="deploymentConditions")
def deployment_conditions(self) -> Optional[Sequence['outputs.KogitoSupportingServiceStatusDeploymentConditions']]:
"""
General conditions for the Kogito Service deployment.
"""
return pulumi.get(self, "deployment_conditions")
@property
@pulumi.getter(name="externalURI")
def external_uri(self) -> Optional[str]:
"""
URI is where the service is exposed.
"""
return pulumi.get(self, "external_uri")
@property
@pulumi.getter
def image(self) -> Optional[str]:
"""
Image is the resolved image for this service.
"""
return pulumi.get(self, "image")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceStatusCloudEvents(dict):
"""
Describes the CloudEvents that this instance can consume or produce
"""
def __init__(__self__, *,
consumes: Optional[Sequence['outputs.KogitoSupportingServiceStatusCloudEventsConsumes']] = None,
produces: Optional[Sequence['outputs.KogitoSupportingServiceStatusCloudEventsProduces']] = None):
"""
Describes the CloudEvents that this instance can consume or produce
"""
if consumes is not None:
pulumi.set(__self__, "consumes", consumes)
if produces is not None:
pulumi.set(__self__, "produces", produces)
@property
@pulumi.getter
def consumes(self) -> Optional[Sequence['outputs.KogitoSupportingServiceStatusCloudEventsConsumes']]:
return pulumi.get(self, "consumes")
@property
@pulumi.getter
def produces(self) -> Optional[Sequence['outputs.KogitoSupportingServiceStatusCloudEventsProduces']]:
return pulumi.get(self, "produces")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceStatusCloudEventsConsumes(dict):
"""
KogitoCloudEventInfo describes the CloudEvent information based on the specification
"""
def __init__(__self__, *,
type: str,
source: Optional[str] = None):
"""
KogitoCloudEventInfo describes the CloudEvent information based on the specification
"""
pulumi.set(__self__, "type", type)
if source is not None:
pulumi.set(__self__, "source", source)
@property
@pulumi.getter
def type(self) -> str:
return pulumi.get(self, "type")
@property
@pulumi.getter
def source(self) -> Optional[str]:
return pulumi.get(self, "source")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceStatusCloudEventsProduces(dict):
"""
KogitoCloudEventInfo describes the CloudEvent information based on the specification
"""
def __init__(__self__, *,
type: str,
source: Optional[str] = None):
"""
KogitoCloudEventInfo describes the CloudEvent information based on the specification
"""
pulumi.set(__self__, "type", type)
if source is not None:
pulumi.set(__self__, "source", source)
@property
@pulumi.getter
def type(self) -> str:
return pulumi.get(self, "type")
@property
@pulumi.getter
def source(self) -> Optional[str]:
return pulumi.get(self, "source")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceStatusConditions(dict):
"""
Condition is the detailed condition for the resource
"""
def __init__(__self__, *,
status: str,
type: str,
last_transition_time: Optional[str] = None,
message: Optional[str] = None,
reason: Optional[str] = None):
"""
Condition is the detailed condition for the resource
:param str type: ConditionType is the type of condition
:param str reason: KogitoServiceConditionReason is the type of reason
"""
pulumi.set(__self__, "status", status)
pulumi.set(__self__, "type", type)
if last_transition_time is not None:
pulumi.set(__self__, "last_transition_time", last_transition_time)
if message is not None:
pulumi.set(__self__, "message", message)
if reason is not None:
pulumi.set(__self__, "reason", reason)
@property
@pulumi.getter
def status(self) -> str:
return pulumi.get(self, "status")
@property
@pulumi.getter
def type(self) -> str:
"""
ConditionType is the type of condition
"""
return pulumi.get(self, "type")
@property
@pulumi.getter(name="lastTransitionTime")
def last_transition_time(self) -> Optional[str]:
return pulumi.get(self, "last_transition_time")
@property
@pulumi.getter
def message(self) -> Optional[str]:
return pulumi.get(self, "message")
@property
@pulumi.getter
def reason(self) -> Optional[str]:
"""
KogitoServiceConditionReason is the type of reason
"""
return pulumi.get(self, "reason")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
@pulumi.output_type
class KogitoSupportingServiceStatusDeploymentConditions(dict):
"""
DeploymentCondition describes the state of a deployment at a certain point.
"""
def __init__(__self__, *,
status: str,
type: str,
last_transition_time: Optional[str] = None,
last_update_time: Optional[str] = None,
message: Optional[str] = None,
reason: Optional[str] = None):
"""
DeploymentCondition describes the state of a deployment at a certain point.
:param str status: Status of the condition, one of True, False, Unknown.
:param str type: Type of deployment condition.
:param str last_transition_time: Last time the condition transitioned from one status to another.
:param str last_update_time: The last time this condition was updated.
:param str message: A human readable message indicating details about the transition.
:param str reason: The reason for the condition's last transition.
"""
pulumi.set(__self__, "status", status)
pulumi.set(__self__, "type", type)
if last_transition_time is not None:
pulumi.set(__self__, "last_transition_time", last_transition_time)
if last_update_time is not None:
pulumi.set(__self__, "last_update_time", last_update_time)
if message is not None:
pulumi.set(__self__, "message", message)
if reason is not None:
pulumi.set(__self__, "reason", reason)
@property
@pulumi.getter
def status(self) -> str:
"""
Status of the condition, one of True, False, Unknown.
"""
return pulumi.get(self, "status")
@property
@pulumi.getter
def type(self) -> str:
"""
Type of deployment condition.
"""
return pulumi.get(self, "type")
@property
@pulumi.getter(name="lastTransitionTime")
def last_transition_time(self) -> Optional[str]:
"""
Last time the condition transitioned from one status to another.
"""
return pulumi.get(self, "last_transition_time")
@property
@pulumi.getter(name="lastUpdateTime")
def last_update_time(self) -> Optional[str]:
"""
The last time this condition was updated.
"""
return pulumi.get(self, "last_update_time")
@property
@pulumi.getter
def message(self) -> Optional[str]:
"""
A human readable message indicating details about the transition.
"""
return pulumi.get(self, "message")
@property
@pulumi.getter
def reason(self) -> Optional[str]:
"""
The reason for the condition's last transition.
"""
return pulumi.get(self, "reason")
def _translate_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
| 43.124448
| 725
| 0.670585
| 17,981
| 156,283
| 5.668817
| 0.03982
| 0.020043
| 0.028951
| 0.042313
| 0.829944
| 0.811755
| 0.791418
| 0.772415
| 0.762015
| 0.753833
| 0
| 0.000742
| 0.240884
| 156,283
| 3,623
| 726
| 43.136351
| 0.858442
| 0.400389
| 0
| 0.753916
| 1
| 0
| 0.153724
| 0.098154
| 0
| 0
| 0
| 0.004968
| 0
| 1
| 0.186458
| false
| 0.005053
| 0.003032
| 0.045478
| 0.375947
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
040815b9745d5d9ce14109e37a5bfd0144c5c3e1
| 39,161
|
py
|
Python
|
api/migrations/20210910_01_Gr6cJ-add-metrics-to-annotation-config.py
|
zpapakipos/dynabench-1
|
95884b4e29c57263dc1a85909be979c084d5fac3
|
[
"MIT"
] | 15
|
2021-09-24T00:46:04.000Z
|
2022-03-16T13:24:56.000Z
|
api/migrations/20210910_01_Gr6cJ-add-metrics-to-annotation-config.py
|
zpapakipos/dynabench-1
|
95884b4e29c57263dc1a85909be979c084d5fac3
|
[
"MIT"
] | 98
|
2021-09-22T12:33:21.000Z
|
2022-03-21T22:23:52.000Z
|
api/migrations/20210910_01_Gr6cJ-add-metrics-to-annotation-config.py
|
zpapakipos/dynabench-1
|
95884b4e29c57263dc1a85909be979c084d5fac3
|
[
"MIT"
] | 12
|
2021-09-25T05:08:18.000Z
|
2022-02-28T21:02:20.000Z
|
# Copyright (c) Facebook, Inc. and its affiliates.
# This source code is licensed under the MIT license found in the
# LICENSE file in the root directory of this source tree.
"""
Add metrics to annotation_config_json
"""
from yoyo import step
__depends__ = {"20210826_01_H1Nks-modify-tasks-table"}
steps = [
step(
"",
"""UPDATE tasks SET model_wrong_metric_config_json='{"type": "exact_match",
"constructor_args": {"reference_names": ["label"]}}'
WHERE shortname not in ('QA','DK_QA', 'UCL_QA', 'VQA', 'VQA-VAL')""",
),
step(
"",
"""UPDATE tasks SET model_wrong_metric_config_json='{"type": "string_f1",
"constructor_args": {"threshold": 0.9, "reference_name": "answer"}}'
WHERE shortname in ('QA','DK_QA', 'UCL_QA')""",
),
step(
"",
"""UPDATE tasks SET model_wrong_metric_config_json='{"type": "ask_user",
"constructor_args": {}}' WHERE shortname in ('VQA', 'VQA-VAL')""",
),
step(
"ALTER TABLE tasks DROP aggregation_metric",
"ALTER TABLE tasks ADD COLUMN aggregation_metric ENUM('dynascore')",
),
step(
"ALTER TABLE tasks DROP model_wrong_metric_config_json",
"ALTER TABLE tasks ADD COLUMN model_wrong_metric_config_json TEXT",
),
step(
"",
"""UPDATE tasks SET perf_metric='macro_f1', eval_metrics='macro_f1'
WHERE shortname IN ('Sentiment', 'Hate Speech')""",
),
step(
"",
"""UPDATE tasks SET perf_metric='squad_f1', eval_metrics='squad_f1'
WHERE shortname IN ('QA', 'UCL_QA', 'DK_QA', 'VQA', 'VQA-VAL')""",
),
step(
"",
"""UPDATE tasks SET perf_metric='accuracy', eval_metrics='accuracy' WHERE
shortname IN ('DK_NLI', 'NLI', 'LADC')""",
),
step(
"",
"""UPDATE tasks SET perf_metric='sp_bleu', eval_metrics='sp_bleu' WHERE
shortname IN ('FLORES-FULL','FLORES-SMALL1', 'FLORES-SMALL2')""",
),
step(
"ALTER TABLE tasks DROP perf_metric",
"ALTER TABLE tasks ADD COLUMN perf_metric TEXT",
),
step(
"ALTER TABLE tasks DROP eval_metrics",
"ALTER TABLE tasks ADD COLUMN eval_metrics TEXT",
),
step(
"",
"""UPDATE tasks SET delta_metrics='fairness|robustness' WHERE shortname NOT
IN ('FLORES-FULL', 'FLORES-SMALL1', 'FLORES-SMALL2')""",
),
step(
"ALTER TABLE tasks DROP delta_metrics",
"ALTER TABLE tasks ADD COLUMN delta_metrics TEXT",
),
step(
"""UPDATE tasks SET annotation_config_json='
{
"model_wrong_metric": {"type": "exact_match", "constructor_args":
{"reference_names": ["label"]}},
"aggregation_metric": {"type": "dynascore", "constructor_args": {}},
"perf_metric": {"type": "accuracy", "constructor_args":
{"reference_name": "label"}},
"delta_metrics": [{"type": "fairness", "constructor_args": {}},
{"type": "robustness", "constructor_args": {}}],
"context": [{"name": "context", "type": "string",
"constructor_args": {"placeholder": "Enter context..."}}],
"input": [{"name": "hypothesis", "type": "string",
"constructor_args": {"placeholder": "Enter hypothesis..."}},
{"name": "label", "type": "target_label",
"constructor_args": {
"labels": ["entailed", "neutral", "contradictory"]}}],
"output": [
{"name": "label", "type": "target_label",
"constructor_args": {
"labels": ["entailed", "neutral", "contradictory"]}},
{"name": "prob", "type": "multiclass_probs",
"constructor_args": {"reference_name": "label"}}
],
"metadata": {
"create":
[
{"name": "example_explanation", "type": "string",
"constructor_args":
{"placeholder": "Explain why your example is correct..."},
"display_name": "example explanation"},
{"name": "model_explanation_right", "type": "string",
"constructor_args": {"placeholder":
"Explain why you thought the model would make a mistake..."},
"model_wrong_condition": false,
"display_name": "model explanation"},
{"name": "model_explanation_wrong", "type": "string",
"constructor_args": {"placeholder":
"Explain why you think the model made a mistake..."},
"model_wrong_condition": true,
"display_name": "model explanation"}
],
"validate":
[
{"name": "corrected_label",
"type": "multiclass",
"constructor_args": {
"labels": ["entailed", "neutral", "contradictory"],
"placeholder": "Enter corrected label"
},
"validated_label_condition": "incorrect"},
{"name": "target_explanation", "type": "string",
"constructor_args":
{"placeholder":
"Explain why your proposed target is correct..."},
"validated_label_condition": "incorrect"},
{"name": "flag_reason", "type": "string",
"constructor_args":
{"placeholder": "Enter the reason for flagging..."},
"validated_label_condition": "flagged"},
{"name": "validator_example_explanation", "type": "string",
"constructor_args":
{"placeholder": "Explain why the example is correct..."},
"validated_label_condition": "correct"},
{"name": "validator_model_explanation", "type": "string",
"constructor_args": {"placeholder":
"Enter what you think was done to try to trick the model..."}}
]
}
}
' WHERE task_code in ('dk_nli', 'nli', 'ladc')""",
"""UPDATE tasks SET annotation_config_json='
{
"context": [{"name": "context", "type": "string",
"constructor_args": {"placeholder": "Enter context..."}}],
"input": [{"name": "hypothesis", "type": "string",
"constructor_args": {"placeholder": "Enter hypothesis..."}},
{"name": "label", "type": "target_label",
"constructor_args": {
"labels": ["entailed", "neutral", "contradictory"]}}],
"output": [
{"name": "label", "type": "target_label",
"constructor_args": {
"labels": ["entailed", "neutral", "contradictory"]}},
{"name": "prob", "type": "multiclass_probs",
"constructor_args": {"reference_name": "label"}}
],
"metadata": {
"create":
[
{"name": "example_explanation", "type": "string",
"constructor_args":
{"placeholder": "Explain why your example is correct..."},
"display_name": "example explanation"},
{"name": "model_explanation_right", "type": "string",
"constructor_args": {"placeholder":
"Explain why you thought the model would make a mistake..."},
"model_wrong_condition": false,
"display_name": "model explanation"},
{"name": "model_explanation_wrong", "type": "string",
"constructor_args": {"placeholder":
"Explain why you think the model made a mistake..."},
"model_wrong_condition": true,
"display_name": "model explanation"}
],
"validate":
[
{"name": "corrected_label",
"type": "multiclass",
"constructor_args": {
"labels": ["entailed", "neutral", "contradictory"],
"placeholder": "Enter corrected label"
},
"validated_label_condition": "incorrect"},
{"name": "target_explanation", "type": "string",
"constructor_args":
{"placeholder":
"Explain why your proposed target is correct..."},
"validated_label_condition": "incorrect"},
{"name": "flag_reason", "type": "string",
"constructor_args":
{"placeholder": "Enter the reason for flagging..."},
"validated_label_condition": "flagged"},
{"name": "validator_example_explanation", "type": "string",
"constructor_args":
{"placeholder": "Explain why the example is correct..."},
"validated_label_condition": "correct"},
{"name": "validator_model_explanation", "type": "string",
"constructor_args": {"placeholder":
"Enter what you think was done to try to trick the model..."}}
]
}
}
' WHERE task_code in ('dk_nli', 'nli', 'ladc')""",
),
step(
"""UPDATE tasks SET annotation_config_json='
{
"model_wrong_metric": {"type": "exact_match", "constructor_args":
{"reference_names": ["label"]}},
"aggregation_metric": {"type": "dynascore", "constructor_args": {}},
"perf_metric": {"type": "macro_f1", "constructor_args":
{"reference_name": "label"}},
"delta_metrics": [{"type": "fairness", "constructor_args": {}},
{"type": "robustness", "constructor_args": {}}],
"content_warning":
"""
+ '"This is sensitive content! If you do not want to see any hateful '
+ 'examples, please switch to another task.", '
+ """
"context": [{"name": "context", "type": "string",
"constructor_args": {"placeholder": "Enter context..."}}],
"input": [{"name": "statement", "type": "string",
"constructor_args": {"placeholder": "Enter statement..."}},
{"name": "label", "type": "target_label",
"constructor_args": {
"labels": ["not-hateful", "hateful"]}}],
"output": [
{"name": "label", "type": "target_label",
"constructor_args": {
"labels": ["not-hateful", "hateful"]}},
{"name": "prob", "type": "multiclass_probs",
"constructor_args": {"reference_name": "label"}}
],
"metadata": {
"create":
[
{"name": "example_explanation", "type": "string",
"constructor_args":
{"placeholder": "Explain why your example is correct..."},
"display_name": "example explanation"},
{"name": "model_explanation_right", "type": "string",
"constructor_args": {"placeholder":
"Explain why you thought the model would make a mistake..."},
"model_wrong_condition": false,
"display_name": "model explanation"},
{"name": "model_explanation_wrong", "type": "string",
"constructor_args": {"placeholder":
"Explain why you think the model made a mistake..."},
"model_wrong_condition": true,
"display_name": "model explanation"}
],
"validate":
[
{"name": "corrected_label",
"type": "multiclass",
"constructor_args": {
"labels": ["not-hateful", "hateful"],
"placeholder": "Enter corrected label"
},
"validated_label_condition": "incorrect"},
{"name": "target_explanation", "type": "string",
"constructor_args":
{"placeholder":
"Explain why your proposed target is correct..."},
"validated_label_condition": "incorrect"},
{"name": "flag_reason", "type": "string",
"constructor_args":
{"placeholder": "Enter the reason for flagging..."},
"validated_label_condition": "flagged"},
{"name": "validator_example_explanation", "type": "string",
"constructor_args":
{"placeholder": "Explain why the example is correct..."},
"validated_label_condition": "correct"},
{"name": "validator_model_explanation", "type": "string",
"constructor_args": {"placeholder":
"Enter what you think was done to try to trick the model..."}}
]
}
}
' WHERE task_code in ('hs')""",
"""UPDATE tasks SET annotation_config_json='
{
"content_warning":
"""
+ '"This is sensitive content! If you do not want to see any hateful '
+ 'examples, please switch to another task.", '
+ """
"context": [{"name": "context", "type": "string",
"constructor_args": {"placeholder": "Enter context..."}}],
"input": [{"name": "statement", "type": "string",
"constructor_args": {"placeholder": "Enter statement..."}},
{"name": "label", "type": "target_label",
"constructor_args": {
"labels": ["not-hateful", "hateful"]}}],
"output": [
{"name": "label", "type": "target_label",
"constructor_args": {
"labels": ["not-hateful", "hateful"]}},
{"name": "prob", "type": "multiclass_probs",
"constructor_args": {"reference_name": "label"}}
],
"metadata": {
"create":
[
{"name": "example_explanation", "type": "string",
"constructor_args":
{"placeholder": "Explain why your example is correct..."},
"display_name": "example explanation"},
{"name": "model_explanation_right", "type": "string",
"constructor_args": {"placeholder":
"Explain why you thought the model would make a mistake..."},
"model_wrong_condition": false,
"display_name": "model explanation"},
{"name": "model_explanation_wrong", "type": "string",
"constructor_args": {"placeholder":
"Explain why you think the model made a mistake..."},
"model_wrong_condition": true,
"display_name": "model explanation"}
],
"validate":
[
{"name": "corrected_label",
"type": "multiclass",
"constructor_args": {
"labels": ["not-hateful", "hateful"],
"placeholder": "Enter corrected label"
},
"validated_label_condition": "incorrect"},
{"name": "target_explanation", "type": "string",
"constructor_args":
{"placeholder":
"Explain why your proposed target is correct..."},
"validated_label_condition": "incorrect"},
{"name": "flag_reason", "type": "string",
"constructor_args":
{"placeholder": "Enter the reason for flagging..."},
"validated_label_condition": "flagged"},
{"name": "validator_example_explanation", "type": "string",
"constructor_args":
{"placeholder": "Explain why the example is correct..."},
"validated_label_condition": "correct"},
{"name": "validator_model_explanation", "type": "string",
"constructor_args": {"placeholder":
"Enter what you think was done to try to trick the model..."}}
]
}
}
' WHERE task_code in ('hs')""",
),
step(
"""UPDATE tasks SET annotation_config_json='
{
"model_wrong_metric": {"type": "exact_match", "constructor_args":
{"reference_names": ["label"]}},
"aggregation_metric": {"type": "dynascore", "constructor_args": {}},
"perf_metric": {"type": "macro_f1", "constructor_args":
{"reference_name": "label"}},
"delta_metrics": [{"type": "fairness", "constructor_args": {}},
{"type": "robustness", "constructor_args": {}}],
"context": [{"name": "context", "type": "string",
"constructor_args": {"placeholder": "Enter context..."}}],
"input": [{"name": "statement", "type": "string",
"constructor_args": {"placeholder": "Enter statement..."}},
{"name": "label", "type": "target_label",
"constructor_args": {
"labels": ["negative", "positive", "neutral"]}}],
"output": [
{"name": "label", "type": "target_label",
"constructor_args": {
"labels": ["negative", "positive", "neutral"]}},
{"name": "prob", "type": "multiclass_probs",
"constructor_args": {"reference_name": "label"}}
],
"metadata": {
"create":
[
{"name": "example_explanation", "type": "string",
"constructor_args":
{"placeholder": "Explain why your example is correct..."},
"display_name": "example explanation"},
{"name": "model_explanation_right", "type": "string",
"constructor_args": {"placeholder":
"Explain why you thought the model would make a mistake..."},
"model_wrong_condition": false,
"display_name": "model explanation"},
{"name": "model_explanation_wrong", "type": "string",
"constructor_args": {"placeholder":
"Explain why you think the model made a mistake..."},
"model_wrong_condition": true,
"display_name": "model explanation"}
],
"validate":
[
{"name": "corrected_label",
"type": "multiclass",
"constructor_args": {
"labels": ["negative", "positive", "entailed"],
"placeholder": "Enter corrected label"
},
"validated_label_condition": "incorrect"},
{"name": "target_explanation", "type": "string",
"constructor_args":
{"placeholder":
"Explain why your proposed target is correct..."},
"validated_label_condition": "incorrect"},
{"name": "flag_reason", "type": "string",
"constructor_args":
{"placeholder": "Enter the reason for flagging..."},
"validated_label_condition": "flagged"},
{"name": "validator_example_explanation", "type": "string",
"constructor_args":
{"placeholder": "Explain why the example is correct..."},
"validated_label_condition": "correct"},
{"name": "validator_model_explanation", "type": "string",
"constructor_args": {"placeholder":
"Enter what you think was done to try to trick the model..."}}
]
}
}
' WHERE task_code in ('sentiment')""",
"""UPDATE tasks SET annotation_config_json='
{
"context": [{"name": "context", "type": "string",
"constructor_args": {"placeholder": "Enter context..."}}],
"input": [{"name": "statement", "type": "string",
"constructor_args": {"placeholder": "Enter statement..."}},
{"name": "label", "type": "target_label",
"constructor_args": {
"labels": ["negative", "positive", "neutral"]}}],
"output": [
{"name": "label", "type": "target_label",
"constructor_args": {
"labels": ["negative", "positive", "neutral"]}},
{"name": "prob", "type": "multiclass_probs",
"constructor_args": {"reference_name": "label"}}
],
"metadata": {
"create":
[
{"name": "example_explanation", "type": "string",
"constructor_args":
{"placeholder": "Explain why your example is correct..."},
"display_name": "example explanation"},
{"name": "model_explanation_right", "type": "string",
"constructor_args": {"placeholder":
"Explain why you thought the model would make a mistake..."},
"model_wrong_condition": false,
"display_name": "model explanation"},
{"name": "model_explanation_wrong", "type": "string",
"constructor_args": {"placeholder":
"Explain why you think the model made a mistake..."},
"model_wrong_condition": true,
"display_name": "model explanation"}
],
"validate":
[
{"name": "corrected_label",
"type": "multiclass",
"constructor_args": {
"labels": ["negative", "positive", "entailed"],
"placeholder": "Enter corrected label"
},
"validated_label_condition": "incorrect"},
{"name": "target_explanation", "type": "string",
"constructor_args":
{"placeholder":
"Explain why your proposed target is correct..."},
"validated_label_condition": "incorrect"},
{"name": "flag_reason", "type": "string",
"constructor_args":
{"placeholder": "Enter the reason for flagging..."},
"validated_label_condition": "flagged"},
{"name": "validator_example_explanation", "type": "string",
"constructor_args":
{"placeholder": "Explain why the example is correct..."},
"validated_label_condition": "correct"},
{"name": "validator_model_explanation", "type": "string",
"constructor_args": {"placeholder":
"Enter what you think was done to try to trick the model..."}}
]
}
}
' WHERE task_code in ('sentiment')""",
),
step(
"""UPDATE tasks SET annotation_config_json='
{
"model_wrong_metric": {"type": "string_f1", "constructor_args":
{"reference_name": "answer"}},
"aggregation_metric": {"type": "dynascore", "constructor_args": {}},
"perf_metric": {"type": "squad_f1", "constructor_args":
{"reference_name": "answer"}},
"delta_metrics": [{"type": "fairness", "constructor_args": {}},
{"type": "robustness", "constructor_args": {}}],
"goal_message":
"enter a question and select an answer in the context, such that the model is fooled.",
"context": [{"name": "context", "type": "string",
"constructor_args": {"placeholder": "Enter context..."}}],
"input": [{"name": "question", "type": "string",
"constructor_args": {"placeholder": "Enter question..."}},
{"name": "answer", "type": "context_string_selection",
"constructor_args": {
"reference_name": "context"}}],
"output": [
{"name": "answer", "type": "context_string_selection",
"constructor_args": {
"reference_name": "context"}},
{"name": "conf", "type": "conf",
"constructor_args": {}}
],
"metadata": {
"create":
[
{"name": "example_explanation", "type": "string",
"constructor_args":
{"placeholder": "Explain why your example is correct..."},
"display_name": "example explanation"},
{"name": "model_explanation_right", "type": "string",
"constructor_args": {"placeholder":
"Explain why you thought the model would make a mistake..."},
"model_wrong_condition": false,
"display_name": "model explanation"},
{"name": "model_explanation_wrong", "type": "string",
"constructor_args": {"placeholder":
"Explain why you think the model made a mistake..."},
"model_wrong_condition": true,
"display_name": "model explanation"}
],
"validate":
[
{"name": "corrected_answer",
"type": "context_string_selection",
"constructor_args": {"reference_name": "context"},
"validated_label_condition": "incorrect"},
{"name": "target_explanation", "type": "string",
"constructor_args":
{"placeholder":
"Explain why your proposed target is correct..."},
"validated_label_condition": "incorrect"},
{"name": "flag_reason", "type": "string",
"constructor_args":
{"placeholder": "Enter the reason for flagging..."},
"validated_label_condition": "flagged"},
{"name": "validator_example_explanation", "type": "string",
"constructor_args":
{"placeholder": "Explain why the example is correct..."},
"validated_label_condition": "correct"},
{"name": "validator_model_explanation", "type": "string",
"constructor_args": {"placeholder":
"Enter what you think was done to try to trick the model..."}}
]
}
}
' WHERE task_code in ('qa','dk_qa', 'ucl_qa')""",
"""UPDATE tasks SET annotation_config_json='
{
"goal_message":
"enter a question and select an answer in the context, such that the model is fooled.",
"context": [{"name": "context", "type": "string",
"constructor_args": {"placeholder": "Enter context..."}}],
"input": [{"name": "question", "type": "string",
"constructor_args": {"placeholder": "Enter question..."}},
{"name": "answer", "type": "context_string_selection",
"constructor_args": {
"reference_name": "context"}}],
"output": [
{"name": "answer", "type": "context_string_selection",
"constructor_args": {
"reference_name": "context"}},
{"name": "conf", "type": "conf",
"constructor_args": {}}
],
"metadata": {
"create":
[
{"name": "example_explanation", "type": "string",
"constructor_args":
{"placeholder": "Explain why your example is correct..."},
"display_name": "example explanation"},
{"name": "model_explanation_right", "type": "string",
"constructor_args": {"placeholder":
"Explain why you thought the model would make a mistake..."},
"model_wrong_condition": false,
"display_name": "model explanation"},
{"name": "model_explanation_wrong", "type": "string",
"constructor_args": {"placeholder":
"Explain why you think the model made a mistake..."},
"model_wrong_condition": true,
"display_name": "model explanation"}
],
"validate":
[
{"name": "corrected_answer",
"type": "context_string_selection",
"constructor_args": {"reference_name": "context"},
"validated_label_condition": "incorrect"},
{"name": "target_explanation", "type": "string",
"constructor_args":
{"placeholder":
"Explain why your proposed target is correct..."},
"validated_label_condition": "incorrect"},
{"name": "flag_reason", "type": "string",
"constructor_args":
{"placeholder": "Enter the reason for flagging..."},
"validated_label_condition": "flagged"},
{"name": "validator_example_explanation", "type": "string",
"constructor_args":
{"placeholder": "Explain why the example is correct..."},
"validated_label_condition": "correct"},
{"name": "validator_model_explanation", "type": "string",
"constructor_args": {"placeholder":
"Enter what you think was done to try to trick the model..."}}
]
}
}
' WHERE task_code in ('qa','dk_qa', 'ucl_qa')""",
),
step(
"""UPDATE tasks SET annotation_config_json='
{
"model_wrong_metric": {"type": "ask_user", "constructor_args": {}},
"aggregation_metric": {"type": "dynascore", "constructor_args": {}},
"perf_metric": {"type": "squad_f1", "constructor_args":
{"reference_name": "answer"}},
"delta_metrics": [],
"goal_message":
"enter a question and answer based on the image, such that the model is fooled.",
"context": [{"name": "image_url", "type": "image_url",
"constructor_args": {}, "display_name": "image"}],
"input": [{"name": "question", "type": "string",
"constructor_args": {"placeholder": "Enter question..."}}],
"output": [
{"name": "answer", "type": "string",
"constructor_args": {"placeholder": "Enter answer..."}}
],
"metadata": {
"create":
[
{"name": "target_answer", "type": "string",
"constructor_args": {"placeholder":
"The model was wrong, so enter the correct answer..."},
"display_name": "answer",
"model_wrong_condition": true,
"display_name": "answer"}
],
"validate":
[
{"name": "is_question_valid",
"type": "multiclass",
"constructor_args": {
"labels": ["yes", "no"],
"placeholder": "Is the question even valid?"
},
"validated_label_condition": "incorrect"}
]
}
}
' WHERE task_code in ('vqa', 'vqa_val')""",
"""UPDATE tasks SET annotation_config_json='
{
"goal_message":
"enter a question and answer based on the image, such that the model is fooled.",
"context": [{"name": "image_url", "type": "image_url",
"constructor_args": {}, "display_name": "image"}],
"input": [{"name": "question", "type": "string",
"constructor_args": {"placeholder": "Enter question..."}}],
"output": [
{"name": "answer", "type": "string",
"constructor_args": {"placeholder": "Enter answer..."}}
],
"metadata": {
"create":
[
{"name": "target_answer", "type": "string",
"constructor_args": {"placeholder":
"The model was wrong, so enter the correct answer..."},
"display_name": "answer",
"model_wrong_condition": true,
"display_name": "answer"}
],
"validate":
[
{"name": "is_question_valid",
"type": "multiclass",
"constructor_args": {
"labels": ["yes", "no"],
"placeholder": "Is the question even valid?"
},
"validated_label_condition": "incorrect"}
]
}
}
' WHERE task_code in ('vqa', 'vqa_val')""",
),
step(
"""UPDATE tasks SET annotation_config_json='
{
"model_wrong_metric": {"type": "ask_user", "constructor_args": {}},
"aggregation_metric": {"type": "dynascore", "constructor_args": {}},
"perf_metric": {"type": "sp_bleu", "constructor_args": {}},
"delta_metrics": [],
"context": [
{"name": "sourceLanguage", "type": "string",
"constructor_args": {"placeholder": "Enter source language..."}},
{"name": "targetLanguage", "type": "string",
"constructor_args": {"placeholder": "Enter target language..."}}],
"input": [{"name": "sourceText", "type": "string",
"constructor_args": {"placeholder": "Enter source text..."}},
{"name": "targetText", "type": "string",
"constructor_args": {"placeholder": "Enter target text"}}],
"output": [
{"name": "targetText", "type": "string",
"constructor_args": {"placeholder": "Enter target text"}}],
"metadata": {"create": [], "validate": []}
}
' WHERE task_code in ('flores_full', 'flores_small1', 'flores_small2')""",
"""UPDATE tasks SET annotation_config_json='
{
"context": [
{"name": "sourceLanguage", "type": "string",
"constructor_args": {"placeholder": "Enter source language..."}},
{"name": "targetLanguage", "type": "string",
"constructor_args": {"placeholder": "Enter target language..."}}],
"input": [{"name": "sourceText", "type": "string",
"constructor_args": {"placeholder": "Enter source text..."}},
{"name": "targetText", "type": "string",
"constructor_args": {"placeholder": "Enter target text"}}],
"output": [
{"name": "targetText", "type": "string",
"constructor_args": {"placeholder": "Enter target text"}}],
"metadata": {"create": [], "validate": []}
}
' WHERE task_code in ('flores_full', 'flores_small1', 'flores_small2')""",
),
]
| 52.706595
| 87
| 0.440464
| 2,817
| 39,161
| 5.908768
| 0.067448
| 0.137879
| 0.111024
| 0.132172
| 0.960649
| 0.947972
| 0.928807
| 0.928807
| 0.921718
| 0.919796
| 0
| 0.001361
| 0.418222
| 39,161
| 742
| 88
| 52.777628
| 0.729228
| 0.005286
| 0
| 0.786408
| 0
| 0
| 0.895067
| 0.08636
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.004854
| 0
| 0.004854
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
0441cc581efa70b31e609f0a4628371578f25091
| 161,561
|
py
|
Python
|
src/oci/artifacts/artifacts_client.py
|
ezequielramos/oci-python-sdk
|
cc4235cf217beaf9feed75760e9ce82610222762
|
[
"Apache-2.0",
"BSD-3-Clause"
] | 3
|
2020-09-10T22:09:45.000Z
|
2021-12-24T17:00:07.000Z
|
src/oci/artifacts/artifacts_client.py
|
ezequielramos/oci-python-sdk
|
cc4235cf217beaf9feed75760e9ce82610222762
|
[
"Apache-2.0",
"BSD-3-Clause"
] | null | null | null |
src/oci/artifacts/artifacts_client.py
|
ezequielramos/oci-python-sdk
|
cc4235cf217beaf9feed75760e9ce82610222762
|
[
"Apache-2.0",
"BSD-3-Clause"
] | null | null | null |
# coding: utf-8
# Copyright (c) 2016, 2021, Oracle and/or its affiliates. All rights reserved.
# This software is dual-licensed to you under the Universal Permissive License (UPL) 1.0 as shown at https://oss.oracle.com/licenses/upl or Apache License 2.0 as shown at http://www.apache.org/licenses/LICENSE-2.0. You may choose either license.
from __future__ import absolute_import
from oci._vendor import requests # noqa: F401
from oci._vendor import six
from oci import retry, circuit_breaker # noqa: F401
from oci.base_client import BaseClient
from oci.config import get_config_value_or_default, validate_config
from oci.signer import Signer
from oci.util import Sentinel, get_signer_from_authentication_type, AUTHENTICATION_TYPE_FIELD_NAME
from .models import artifacts_type_mapping
missing = Sentinel("Missing")
class ArtifactsClient(object):
"""
API covering the [Registry](/iaas/Content/Registry/Concepts/registryoverview.htm) services.
Use this API to manage resources such as container images and repositories.
"""
def __init__(self, config, **kwargs):
"""
Creates a new service client
:param dict config:
Configuration keys and values as per `SDK and Tool Configuration <https://docs.cloud.oracle.com/Content/API/Concepts/sdkconfig.htm>`__.
The :py:meth:`~oci.config.from_file` method can be used to load configuration from a file. Alternatively, a ``dict`` can be passed. You can validate_config
the dict using :py:meth:`~oci.config.validate_config`
:param str service_endpoint: (optional)
The endpoint of the service to call using this client. For example ``https://iaas.us-ashburn-1.oraclecloud.com``. If this keyword argument is
not provided then it will be derived using the region in the config parameter. You should only provide this keyword argument if you have an explicit
need to specify a service endpoint.
:param timeout: (optional)
The connection and read timeouts for the client. The default values are connection timeout 10 seconds and read timeout 60 seconds. This keyword argument can be provided
as a single float, in which case the value provided is used for both the read and connection timeouts, or as a tuple of two floats. If
a tuple is provided then the first value is used as the connection timeout and the second value as the read timeout.
:type timeout: float or tuple(float, float)
:param signer: (optional)
The signer to use when signing requests made by the service client. The default is to use a :py:class:`~oci.signer.Signer` based on the values
provided in the config parameter.
One use case for this parameter is for `Instance Principals authentication <https://docs.cloud.oracle.com/Content/Identity/Tasks/callingservicesfrominstances.htm>`__
by passing an instance of :py:class:`~oci.auth.signers.InstancePrincipalsSecurityTokenSigner` as the value for this keyword argument
:type signer: :py:class:`~oci.signer.AbstractBaseSigner`
:param obj retry_strategy: (optional)
A retry strategy to apply to all calls made by this service client (i.e. at the client level). There is no retry strategy applied by default.
Retry strategies can also be applied at the operation level by passing a ``retry_strategy`` keyword argument as part of calling the operation.
Any value provided at the operation level will override whatever is specified at the client level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. A convenience :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY`
is also available. The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
:param obj circuit_breaker_strategy: (optional)
A circuit breaker strategy to apply to all calls made by this service client (i.e. at the client level).
This client uses :py:data:`~oci.circuit_breaker.DEFAULT_CIRCUIT_BREAKER_STRATEGY` as default if no circuit breaker strategy is provided.
The specifics of circuit breaker strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/circuit_breakers.html>`__.
:param function circuit_breaker_callback: (optional)
Callback function to receive any exceptions triggerred by the circuit breaker.
"""
validate_config(config, signer=kwargs.get('signer'))
if 'signer' in kwargs:
signer = kwargs['signer']
elif AUTHENTICATION_TYPE_FIELD_NAME in config:
signer = get_signer_from_authentication_type(config)
else:
signer = Signer(
tenancy=config["tenancy"],
user=config["user"],
fingerprint=config["fingerprint"],
private_key_file_location=config.get("key_file"),
pass_phrase=get_config_value_or_default(config, "pass_phrase"),
private_key_content=config.get("key_content")
)
base_client_init_kwargs = {
'regional_client': True,
'service_endpoint': kwargs.get('service_endpoint'),
'base_path': '/20160918',
'service_endpoint_template': 'https://artifacts.{region}.oci.{secondLevelDomain}',
'skip_deserialization': kwargs.get('skip_deserialization', False),
'circuit_breaker_strategy': kwargs.get('circuit_breaker_strategy', circuit_breaker.GLOBAL_CIRCUIT_BREAKER_STRATEGY)
}
if 'timeout' in kwargs:
base_client_init_kwargs['timeout'] = kwargs.get('timeout')
if base_client_init_kwargs.get('circuit_breaker_strategy') is None:
base_client_init_kwargs['circuit_breaker_strategy'] = circuit_breaker.DEFAULT_CIRCUIT_BREAKER_STRATEGY
self.base_client = BaseClient("artifacts", config, signer, artifacts_type_mapping, **base_client_init_kwargs)
self.retry_strategy = kwargs.get('retry_strategy')
self.circuit_breaker_callback = kwargs.get('circuit_breaker_callback')
def change_container_repository_compartment(self, repository_id, change_container_repository_compartment_details, **kwargs):
"""
Moves a container repository into a different compartment within the same tenancy. For information about moving
resources between compartments, see
`Moving Resources to a Different Compartment`__.
__ https://docs.cloud.oracle.com/iaas/Content/Identity/Tasks/managingcompartments.htm#moveRes
:param str repository_id: (required)
The `OCID`__ of the container repository.
Example: `ocid1.containerrepo.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param oci.artifacts.models.ChangeContainerRepositoryCompartmentDetails change_container_repository_compartment_details: (required)
Change container repository compartment details.
:param str if_match: (optional)
For optimistic concurrency control. In the PUT or DELETE call for a resource, set the `if-match`
parameter to the value of the etag from a previous GET or POST response for that resource. The resource
will be updated or deleted only if the etag you provide matches the resource's current etag value.
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param str opc_retry_token: (optional)
A token that uniquely identifies a request so it can be retried in case of a timeout or
server error without risk of executing that same action again. Retry tokens expire after 24
hours, but can be invalidated before then due to conflicting operations (for example, if a resource
has been deleted and purged from the system, then a retry of the original creation request
may be rejected).
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type None
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/change_container_repository_compartment.py.html>`__ to see an example of how to use change_container_repository_compartment API.
"""
resource_path = "/container/repositories/{repositoryId}/actions/changeCompartment"
method = "POST"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"if_match",
"opc_request_id",
"opc_retry_token"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"change_container_repository_compartment got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"repositoryId": repository_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"if-match": kwargs.get("if_match", missing),
"opc-request-id": kwargs.get("opc_request_id", missing),
"opc-retry-token": kwargs.get("opc_retry_token", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_retry_token_if_needed(header_params)
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
body=change_container_repository_compartment_details)
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
body=change_container_repository_compartment_details)
def change_repository_compartment(self, repository_id, change_repository_compartment_details, **kwargs):
"""
Moves a repository into a different compartment within the same tenancy. For information about moving
resources between compartments, see
`Moving Resources to a Different Compartment`__.
__ https://docs.cloud.oracle.com/iaas/Content/Identity/Tasks/managingcompartments.htm#moveRes
:param str repository_id: (required)
The `OCID`__ of the repository.
Example: `ocid1.artifactrepository.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param oci.artifacts.models.ChangeRepositoryCompartmentDetails change_repository_compartment_details: (required)
Moves a repository into a different compartment.
:param str if_match: (optional)
For optimistic concurrency control. In the PUT or DELETE call for a resource, set the `if-match`
parameter to the value of the etag from a previous GET or POST response for that resource. The resource
will be updated or deleted only if the etag you provide matches the resource's current etag value.
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param str opc_retry_token: (optional)
A token that uniquely identifies a request so it can be retried in case of a timeout or
server error without risk of executing that same action again. Retry tokens expire after 24
hours, but can be invalidated before then due to conflicting operations (for example, if a resource
has been deleted and purged from the system, then a retry of the original creation request
may be rejected).
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type None
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/change_repository_compartment.py.html>`__ to see an example of how to use change_repository_compartment API.
"""
resource_path = "/repositories/{repositoryId}/actions/changeCompartment"
method = "POST"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"if_match",
"opc_request_id",
"opc_retry_token"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"change_repository_compartment got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"repositoryId": repository_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"if-match": kwargs.get("if_match", missing),
"opc-request-id": kwargs.get("opc_request_id", missing),
"opc-retry-token": kwargs.get("opc_retry_token", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_retry_token_if_needed(header_params)
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
body=change_repository_compartment_details)
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
body=change_repository_compartment_details)
def create_container_image_signature(self, create_container_image_signature_details, **kwargs):
"""
Upload a signature to an image.
:param oci.artifacts.models.CreateContainerImageSignatureDetails create_container_image_signature_details: (required)
Upload container image signature details
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param str opc_retry_token: (optional)
A token that uniquely identifies a request so it can be retried in case of a timeout or
server error without risk of executing that same action again. Retry tokens expire after 24
hours, but can be invalidated before then due to conflicting operations (for example, if a resource
has been deleted and purged from the system, then a retry of the original creation request
may be rejected).
:param str if_match: (optional)
For optimistic concurrency control. In the PUT or DELETE call for a resource, set the `if-match`
parameter to the value of the etag from a previous GET or POST response for that resource. The resource
will be updated or deleted only if the etag you provide matches the resource's current etag value.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.ContainerImageSignature`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/create_container_image_signature.py.html>`__ to see an example of how to use create_container_image_signature API.
"""
resource_path = "/container/imageSignatures"
method = "POST"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"opc_request_id",
"opc_retry_token",
"if_match"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"create_container_image_signature got unknown kwargs: {!r}".format(extra_kwargs))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"opc-request-id": kwargs.get("opc_request_id", missing),
"opc-retry-token": kwargs.get("opc_retry_token", missing),
"if-match": kwargs.get("if_match", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_retry_token_if_needed(header_params)
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
header_params=header_params,
body=create_container_image_signature_details,
response_type="ContainerImageSignature")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
header_params=header_params,
body=create_container_image_signature_details,
response_type="ContainerImageSignature")
def create_container_repository(self, create_container_repository_details, **kwargs):
"""
Create a new empty container repository. Avoid entering confidential information.
:param oci.artifacts.models.CreateContainerRepositoryDetails create_container_repository_details: (required)
Create container repository details.
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param str opc_retry_token: (optional)
A token that uniquely identifies a request so it can be retried in case of a timeout or
server error without risk of executing that same action again. Retry tokens expire after 24
hours, but can be invalidated before then due to conflicting operations (for example, if a resource
has been deleted and purged from the system, then a retry of the original creation request
may be rejected).
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.ContainerRepository`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/create_container_repository.py.html>`__ to see an example of how to use create_container_repository API.
"""
resource_path = "/container/repositories"
method = "POST"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"opc_request_id",
"opc_retry_token"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"create_container_repository got unknown kwargs: {!r}".format(extra_kwargs))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"opc-request-id": kwargs.get("opc_request_id", missing),
"opc-retry-token": kwargs.get("opc_retry_token", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_retry_token_if_needed(header_params)
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
header_params=header_params,
body=create_container_repository_details,
response_type="ContainerRepository")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
header_params=header_params,
body=create_container_repository_details,
response_type="ContainerRepository")
def create_repository(self, create_repository_details, **kwargs):
"""
Creates a new repository for storing artifacts.
:param oci.artifacts.models.CreateRepositoryDetails create_repository_details: (required)
Creates a new repository for storing artifacts.
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param str opc_retry_token: (optional)
A token that uniquely identifies a request so it can be retried in case of a timeout or
server error without risk of executing that same action again. Retry tokens expire after 24
hours, but can be invalidated before then due to conflicting operations (for example, if a resource
has been deleted and purged from the system, then a retry of the original creation request
may be rejected).
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.Repository`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/create_repository.py.html>`__ to see an example of how to use create_repository API.
"""
resource_path = "/repositories"
method = "POST"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"opc_request_id",
"opc_retry_token"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"create_repository got unknown kwargs: {!r}".format(extra_kwargs))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"opc-request-id": kwargs.get("opc_request_id", missing),
"opc-retry-token": kwargs.get("opc_retry_token", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_retry_token_if_needed(header_params)
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
header_params=header_params,
body=create_repository_details,
response_type="Repository")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
header_params=header_params,
body=create_repository_details,
response_type="Repository")
def delete_container_image(self, image_id, **kwargs):
"""
Delete a container image.
:param str image_id: (required)
The `OCID`__ of the container image.
Example: `ocid1.containerimage.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str if_match: (optional)
For optimistic concurrency control. In the PUT or DELETE call for a resource, set the `if-match`
parameter to the value of the etag from a previous GET or POST response for that resource. The resource
will be updated or deleted only if the etag you provide matches the resource's current etag value.
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type None
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/delete_container_image.py.html>`__ to see an example of how to use delete_container_image API.
"""
resource_path = "/container/images/{imageId}"
method = "DELETE"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"if_match",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"delete_container_image got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"imageId": image_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"if-match": kwargs.get("if_match", missing),
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params)
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params)
def delete_container_image_signature(self, image_signature_id, **kwargs):
"""
Delete a container image signature.
:param str image_signature_id: (required)
The `OCID`__ of the container image signature.
Example: `ocid1.containersignature.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param str if_match: (optional)
For optimistic concurrency control. In the PUT or DELETE call for a resource, set the `if-match`
parameter to the value of the etag from a previous GET or POST response for that resource. The resource
will be updated or deleted only if the etag you provide matches the resource's current etag value.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type None
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/delete_container_image_signature.py.html>`__ to see an example of how to use delete_container_image_signature API.
"""
resource_path = "/container/imageSignatures/{imageSignatureId}"
method = "DELETE"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"opc_request_id",
"if_match"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"delete_container_image_signature got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"imageSignatureId": image_signature_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"opc-request-id": kwargs.get("opc_request_id", missing),
"if-match": kwargs.get("if_match", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params)
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params)
def delete_container_repository(self, repository_id, **kwargs):
"""
Delete container repository.
:param str repository_id: (required)
The `OCID`__ of the container repository.
Example: `ocid1.containerrepo.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str if_match: (optional)
For optimistic concurrency control. In the PUT or DELETE call for a resource, set the `if-match`
parameter to the value of the etag from a previous GET or POST response for that resource. The resource
will be updated or deleted only if the etag you provide matches the resource's current etag value.
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type None
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/delete_container_repository.py.html>`__ to see an example of how to use delete_container_repository API.
"""
resource_path = "/container/repositories/{repositoryId}"
method = "DELETE"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"if_match",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"delete_container_repository got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"repositoryId": repository_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"if-match": kwargs.get("if_match", missing),
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params)
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params)
def delete_generic_artifact(self, artifact_id, **kwargs):
"""
Deletes an artifact with a specified `OCID`__.
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str artifact_id: (required)
The `OCID`__ of the artifact.
Example: `ocid1.genericartifact.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str if_match: (optional)
For optimistic concurrency control. In the PUT or DELETE call for a resource, set the `if-match`
parameter to the value of the etag from a previous GET or POST response for that resource. The resource
will be updated or deleted only if the etag you provide matches the resource's current etag value.
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type None
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/delete_generic_artifact.py.html>`__ to see an example of how to use delete_generic_artifact API.
"""
resource_path = "/generic/artifacts/{artifactId}"
method = "DELETE"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"if_match",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"delete_generic_artifact got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"artifactId": artifact_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"if-match": kwargs.get("if_match", missing),
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params)
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params)
def delete_generic_artifact_by_path(self, repository_id, artifact_path, version, **kwargs):
"""
Deletes an artifact with a specified `artifactPath` and `version`.
:param str repository_id: (required)
The `OCID`__ of the repository.
Example: `ocid1.artifactrepository.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str artifact_path: (required)
A user-defined path to describe the location of an artifact. You can use slashes to organize the repository, but slashes do not create a directory structure. An artifact path does not include an artifact version.
Example: `project01/my-web-app/artifact-abc`
:param str version: (required)
A user-defined string to describe the artifact version.
Example: `1.1.2` or `1.2-beta-2`
:param str if_match: (optional)
For optimistic concurrency control. In the PUT or DELETE call for a resource, set the `if-match`
parameter to the value of the etag from a previous GET or POST response for that resource. The resource
will be updated or deleted only if the etag you provide matches the resource's current etag value.
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type None
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/delete_generic_artifact_by_path.py.html>`__ to see an example of how to use delete_generic_artifact_by_path API.
"""
resource_path = "/generic/repositories/{repositoryId}/artifactPaths/{artifactPath}/versions/{version}"
method = "DELETE"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"if_match",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"delete_generic_artifact_by_path got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"repositoryId": repository_id,
"artifactPath": artifact_path,
"version": version
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"if-match": kwargs.get("if_match", missing),
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params)
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params)
def delete_repository(self, repository_id, **kwargs):
"""
Deletes the specified repository. This operation fails unless all associated artifacts are in a DELETED state. You must delete all associated artifacts before deleting a repository.
:param str repository_id: (required)
The `OCID`__ of the repository.
Example: `ocid1.artifactrepository.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str if_match: (optional)
For optimistic concurrency control. In the PUT or DELETE call for a resource, set the `if-match`
parameter to the value of the etag from a previous GET or POST response for that resource. The resource
will be updated or deleted only if the etag you provide matches the resource's current etag value.
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type None
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/delete_repository.py.html>`__ to see an example of how to use delete_repository API.
"""
resource_path = "/repositories/{repositoryId}"
method = "DELETE"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"if_match",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"delete_repository got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"repositoryId": repository_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"if-match": kwargs.get("if_match", missing),
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params)
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params)
def get_container_configuration(self, compartment_id, **kwargs):
"""
Get container configuration.
:param str compartment_id: (required)
The `OCID`__ of the compartment.
__ https://docs.cloud.oracle.com/Content/General/Concepts/identifiers.htm
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.ContainerConfiguration`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/get_container_configuration.py.html>`__ to see an example of how to use get_container_configuration API.
"""
resource_path = "/container/configuration"
method = "GET"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"get_container_configuration got unknown kwargs: {!r}".format(extra_kwargs))
query_params = {
"compartmentId": compartment_id
}
query_params = {k: v for (k, v) in six.iteritems(query_params) if v is not missing and v is not None}
header_params = {
"accept": "application/json",
"content-type": "application/json",
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
query_params=query_params,
header_params=header_params,
response_type="ContainerConfiguration")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
query_params=query_params,
header_params=header_params,
response_type="ContainerConfiguration")
def get_container_image(self, image_id, **kwargs):
"""
Get container image metadata.
:param str image_id: (required)
The `OCID`__ of the container image.
Example: `ocid1.containerimage.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.ContainerImage`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/get_container_image.py.html>`__ to see an example of how to use get_container_image API.
"""
resource_path = "/container/images/{imageId}"
method = "GET"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"get_container_image got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"imageId": image_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
response_type="ContainerImage")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
response_type="ContainerImage")
def get_container_image_signature(self, image_signature_id, **kwargs):
"""
Get container image signature metadata.
:param str image_signature_id: (required)
The `OCID`__ of the container image signature.
Example: `ocid1.containersignature.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.ContainerImageSignature`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/get_container_image_signature.py.html>`__ to see an example of how to use get_container_image_signature API.
"""
resource_path = "/container/imageSignatures/{imageSignatureId}"
method = "GET"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"get_container_image_signature got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"imageSignatureId": image_signature_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
response_type="ContainerImageSignature")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
response_type="ContainerImageSignature")
def get_container_repository(self, repository_id, **kwargs):
"""
Get container repository.
:param str repository_id: (required)
The `OCID`__ of the container repository.
Example: `ocid1.containerrepo.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.ContainerRepository`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/get_container_repository.py.html>`__ to see an example of how to use get_container_repository API.
"""
resource_path = "/container/repositories/{repositoryId}"
method = "GET"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"get_container_repository got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"repositoryId": repository_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
response_type="ContainerRepository")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
response_type="ContainerRepository")
def get_generic_artifact(self, artifact_id, **kwargs):
"""
Gets information about an artifact with a specified `OCID`__.
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str artifact_id: (required)
The `OCID`__ of the artifact.
Example: `ocid1.genericartifact.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.GenericArtifact`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/get_generic_artifact.py.html>`__ to see an example of how to use get_generic_artifact API.
"""
resource_path = "/generic/artifacts/{artifactId}"
method = "GET"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"get_generic_artifact got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"artifactId": artifact_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
response_type="GenericArtifact")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
response_type="GenericArtifact")
def get_generic_artifact_by_path(self, repository_id, artifact_path, version, **kwargs):
"""
Gets information about an artifact with a specified `artifactPath` and `version`.
:param str repository_id: (required)
The `OCID`__ of the repository.
Example: `ocid1.artifactrepository.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str artifact_path: (required)
A user-defined path to describe the location of an artifact. You can use slashes to organize the repository, but slashes do not create a directory structure. An artifact path does not include an artifact version.
Example: `project01/my-web-app/artifact-abc`
:param str version: (required)
A user-defined string to describe the artifact version.
Example: `1.1.2` or `1.2-beta-2`
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.GenericArtifact`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/get_generic_artifact_by_path.py.html>`__ to see an example of how to use get_generic_artifact_by_path API.
"""
resource_path = "/generic/repositories/{repositoryId}/artifactPaths/{artifactPath}/versions/{version}"
method = "GET"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"get_generic_artifact_by_path got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"repositoryId": repository_id,
"artifactPath": artifact_path,
"version": version
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
response_type="GenericArtifact")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
response_type="GenericArtifact")
def get_repository(self, repository_id, **kwargs):
"""
Gets the specified repository's information.
:param str repository_id: (required)
The `OCID`__ of the repository.
Example: `ocid1.artifactrepository.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.Repository`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/get_repository.py.html>`__ to see an example of how to use get_repository API.
"""
resource_path = "/repositories/{repositoryId}"
method = "GET"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"get_repository got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"repositoryId": repository_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
response_type="Repository")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
response_type="Repository")
def list_container_image_signatures(self, compartment_id, **kwargs):
"""
List container image signatures in an image.
:param str compartment_id: (required)
The `OCID`__ of the compartment.
__ https://docs.cloud.oracle.com/Content/General/Concepts/identifiers.htm
:param bool compartment_id_in_subtree: (optional)
When set to true, the hierarchy of compartments is traversed
and all compartments and subcompartments in the tenancy are
inspected depending on the the setting of `accessLevel`.
Default is false. Can only be set to true when calling the API
on the tenancy (root compartment).
:param str image_id: (optional)
A filter to return a container image summary only for the specified container image OCID.
:param str repository_id: (optional)
A filter to return container images only for the specified container repository OCID.
:param str repository_name: (optional)
A filter to return container images or container image signatures that match the repository name.
Example: `foo` or `foo*`
:param str image_digest: (optional)
The digest of the container image.
Example: `sha256:e7d38b3517548a1c71e41bffe9c8ae6d6d29546ce46bf62159837aad072c90aa`
:param str display_name: (optional)
A filter to return only resources that match the given display name exactly.
:param str kms_key_id: (optional)
The `OCID`__ of the kmsKeyVersionId used to sign the container image.
Example: `ocid1.keyversion.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/Content/General/Concepts/identifiers.htm
:param str kms_key_version_id: (optional)
The `OCID`__ of the kmsKeyVersionId used to sign the container image.
Example: `ocid1.keyversion.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/Content/General/Concepts/identifiers.htm
:param str signing_algorithm: (optional)
The algorithm to be used for signing. These are the only supported signing algorithms for container images.
Allowed values are: "SHA_224_RSA_PKCS_PSS", "SHA_256_RSA_PKCS_PSS", "SHA_384_RSA_PKCS_PSS", "SHA_512_RSA_PKCS_PSS"
:param int limit: (optional)
For list pagination. The maximum number of results per page, or items to return in a paginated
\"List\" call. For important details about how pagination works, see
`List Pagination`__.
Example: `50`
__ https://docs.cloud.oracle.com/iaas/Content/API/Concepts/usingapi.htm#nine
:param str page: (optional)
For list pagination. The value of the `opc-next-page` response header from the previous \"List\"
call. For important details about how pagination works, see
`List Pagination`__.
__ https://docs.cloud.oracle.com/iaas/Content/API/Concepts/usingapi.htm#nine
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param str sort_by: (optional)
The field to sort by. You can provide one sort order (`sortOrder`). Default order for
TIMECREATED is descending. Default order for DISPLAYNAME is ascending. The DISPLAYNAME
sort order is case sensitive.
**Note:** In general, some \"List\" operations (for example, `ListInstances`) let you
optionally filter by availability domain if the scope of the resource type is within a
single availability domain. If you call one of these \"List\" operations without specifying
an availability domain, the resources are grouped by availability domain, then sorted.
Allowed values are: "TIMECREATED", "DISPLAYNAME"
:param str sort_order: (optional)
The sort order to use, either ascending (`ASC`) or descending (`DESC`). The DISPLAYNAME sort order
is case sensitive.
Allowed values are: "ASC", "DESC"
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.ContainerImageSignatureCollection`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/list_container_image_signatures.py.html>`__ to see an example of how to use list_container_image_signatures API.
"""
resource_path = "/container/imageSignatures"
method = "GET"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"compartment_id_in_subtree",
"image_id",
"repository_id",
"repository_name",
"image_digest",
"display_name",
"kms_key_id",
"kms_key_version_id",
"signing_algorithm",
"limit",
"page",
"opc_request_id",
"sort_by",
"sort_order"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"list_container_image_signatures got unknown kwargs: {!r}".format(extra_kwargs))
if 'signing_algorithm' in kwargs:
signing_algorithm_allowed_values = ["SHA_224_RSA_PKCS_PSS", "SHA_256_RSA_PKCS_PSS", "SHA_384_RSA_PKCS_PSS", "SHA_512_RSA_PKCS_PSS"]
if kwargs['signing_algorithm'] not in signing_algorithm_allowed_values:
raise ValueError(
"Invalid value for `signing_algorithm`, must be one of {0}".format(signing_algorithm_allowed_values)
)
if 'sort_by' in kwargs:
sort_by_allowed_values = ["TIMECREATED", "DISPLAYNAME"]
if kwargs['sort_by'] not in sort_by_allowed_values:
raise ValueError(
"Invalid value for `sort_by`, must be one of {0}".format(sort_by_allowed_values)
)
if 'sort_order' in kwargs:
sort_order_allowed_values = ["ASC", "DESC"]
if kwargs['sort_order'] not in sort_order_allowed_values:
raise ValueError(
"Invalid value for `sort_order`, must be one of {0}".format(sort_order_allowed_values)
)
query_params = {
"compartmentIdInSubtree": kwargs.get("compartment_id_in_subtree", missing),
"compartmentId": compartment_id,
"imageId": kwargs.get("image_id", missing),
"repositoryId": kwargs.get("repository_id", missing),
"repositoryName": kwargs.get("repository_name", missing),
"imageDigest": kwargs.get("image_digest", missing),
"displayName": kwargs.get("display_name", missing),
"kmsKeyId": kwargs.get("kms_key_id", missing),
"kmsKeyVersionId": kwargs.get("kms_key_version_id", missing),
"signingAlgorithm": kwargs.get("signing_algorithm", missing),
"limit": kwargs.get("limit", missing),
"page": kwargs.get("page", missing),
"sortBy": kwargs.get("sort_by", missing),
"sortOrder": kwargs.get("sort_order", missing)
}
query_params = {k: v for (k, v) in six.iteritems(query_params) if v is not missing and v is not None}
header_params = {
"accept": "application/json",
"content-type": "application/json",
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
query_params=query_params,
header_params=header_params,
response_type="ContainerImageSignatureCollection")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
query_params=query_params,
header_params=header_params,
response_type="ContainerImageSignatureCollection")
def list_container_images(self, compartment_id, **kwargs):
"""
List container images in a compartment.
:param str compartment_id: (required)
The `OCID`__ of the compartment.
__ https://docs.cloud.oracle.com/Content/General/Concepts/identifiers.htm
:param bool compartment_id_in_subtree: (optional)
When set to true, the hierarchy of compartments is traversed
and all compartments and subcompartments in the tenancy are
inspected depending on the the setting of `accessLevel`.
Default is false. Can only be set to true when calling the API
on the tenancy (root compartment).
:param str display_name: (optional)
A filter to return only resources that match the given display name exactly.
:param str image_id: (optional)
A filter to return a container image summary only for the specified container image OCID.
:param bool is_versioned: (optional)
A filter to return container images based on whether there are any associated versions.
:param str repository_id: (optional)
A filter to return container images only for the specified container repository OCID.
:param str repository_name: (optional)
A filter to return container images or container image signatures that match the repository name.
Example: `foo` or `foo*`
:param str version: (optional)
A filter to return container images that match the version.
Example: `foo` or `foo*`
:param str lifecycle_state: (optional)
A filter to return only resources that match the given lifecycle state name exactly.
:param int limit: (optional)
For list pagination. The maximum number of results per page, or items to return in a paginated
\"List\" call. For important details about how pagination works, see
`List Pagination`__.
Example: `50`
__ https://docs.cloud.oracle.com/iaas/Content/API/Concepts/usingapi.htm#nine
:param str page: (optional)
For list pagination. The value of the `opc-next-page` response header from the previous \"List\"
call. For important details about how pagination works, see
`List Pagination`__.
__ https://docs.cloud.oracle.com/iaas/Content/API/Concepts/usingapi.htm#nine
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param str sort_by: (optional)
The field to sort by. You can provide one sort order (`sortOrder`). Default order for
TIMECREATED is descending. Default order for DISPLAYNAME is ascending. The DISPLAYNAME
sort order is case sensitive.
**Note:** In general, some \"List\" operations (for example, `ListInstances`) let you
optionally filter by availability domain if the scope of the resource type is within a
single availability domain. If you call one of these \"List\" operations without specifying
an availability domain, the resources are grouped by availability domain, then sorted.
Allowed values are: "TIMECREATED", "DISPLAYNAME"
:param str sort_order: (optional)
The sort order to use, either ascending (`ASC`) or descending (`DESC`). The DISPLAYNAME sort order
is case sensitive.
Allowed values are: "ASC", "DESC"
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.ContainerImageCollection`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/list_container_images.py.html>`__ to see an example of how to use list_container_images API.
"""
resource_path = "/container/images"
method = "GET"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"compartment_id_in_subtree",
"display_name",
"image_id",
"is_versioned",
"repository_id",
"repository_name",
"version",
"lifecycle_state",
"limit",
"page",
"opc_request_id",
"sort_by",
"sort_order"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"list_container_images got unknown kwargs: {!r}".format(extra_kwargs))
if 'sort_by' in kwargs:
sort_by_allowed_values = ["TIMECREATED", "DISPLAYNAME"]
if kwargs['sort_by'] not in sort_by_allowed_values:
raise ValueError(
"Invalid value for `sort_by`, must be one of {0}".format(sort_by_allowed_values)
)
if 'sort_order' in kwargs:
sort_order_allowed_values = ["ASC", "DESC"]
if kwargs['sort_order'] not in sort_order_allowed_values:
raise ValueError(
"Invalid value for `sort_order`, must be one of {0}".format(sort_order_allowed_values)
)
query_params = {
"compartmentIdInSubtree": kwargs.get("compartment_id_in_subtree", missing),
"compartmentId": compartment_id,
"displayName": kwargs.get("display_name", missing),
"imageId": kwargs.get("image_id", missing),
"isVersioned": kwargs.get("is_versioned", missing),
"repositoryId": kwargs.get("repository_id", missing),
"repositoryName": kwargs.get("repository_name", missing),
"version": kwargs.get("version", missing),
"lifecycleState": kwargs.get("lifecycle_state", missing),
"limit": kwargs.get("limit", missing),
"page": kwargs.get("page", missing),
"sortBy": kwargs.get("sort_by", missing),
"sortOrder": kwargs.get("sort_order", missing)
}
query_params = {k: v for (k, v) in six.iteritems(query_params) if v is not missing and v is not None}
header_params = {
"accept": "application/json",
"content-type": "application/json",
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
query_params=query_params,
header_params=header_params,
response_type="ContainerImageCollection")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
query_params=query_params,
header_params=header_params,
response_type="ContainerImageCollection")
def list_container_repositories(self, compartment_id, **kwargs):
"""
List container repositories in a compartment.
:param str compartment_id: (required)
The `OCID`__ of the compartment.
__ https://docs.cloud.oracle.com/Content/General/Concepts/identifiers.htm
:param bool compartment_id_in_subtree: (optional)
When set to true, the hierarchy of compartments is traversed
and all compartments and subcompartments in the tenancy are
inspected depending on the the setting of `accessLevel`.
Default is false. Can only be set to true when calling the API
on the tenancy (root compartment).
:param str repository_id: (optional)
A filter to return container images only for the specified container repository OCID.
:param str display_name: (optional)
A filter to return only resources that match the given display name exactly.
:param bool is_public: (optional)
A filter to return resources that match the isPublic value.
:param str lifecycle_state: (optional)
A filter to return only resources that match the given lifecycle state name exactly.
:param int limit: (optional)
For list pagination. The maximum number of results per page, or items to return in a paginated
\"List\" call. For important details about how pagination works, see
`List Pagination`__.
Example: `50`
__ https://docs.cloud.oracle.com/iaas/Content/API/Concepts/usingapi.htm#nine
:param str page: (optional)
For list pagination. The value of the `opc-next-page` response header from the previous \"List\"
call. For important details about how pagination works, see
`List Pagination`__.
__ https://docs.cloud.oracle.com/iaas/Content/API/Concepts/usingapi.htm#nine
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param str sort_by: (optional)
The field to sort by. You can provide one sort order (`sortOrder`). Default order for
TIMECREATED is descending. Default order for DISPLAYNAME is ascending. The DISPLAYNAME
sort order is case sensitive.
**Note:** In general, some \"List\" operations (for example, `ListInstances`) let you
optionally filter by availability domain if the scope of the resource type is within a
single availability domain. If you call one of these \"List\" operations without specifying
an availability domain, the resources are grouped by availability domain, then sorted.
Allowed values are: "TIMECREATED", "DISPLAYNAME"
:param str sort_order: (optional)
The sort order to use, either ascending (`ASC`) or descending (`DESC`). The DISPLAYNAME sort order
is case sensitive.
Allowed values are: "ASC", "DESC"
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.ContainerRepositoryCollection`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/list_container_repositories.py.html>`__ to see an example of how to use list_container_repositories API.
"""
resource_path = "/container/repositories"
method = "GET"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"compartment_id_in_subtree",
"repository_id",
"display_name",
"is_public",
"lifecycle_state",
"limit",
"page",
"opc_request_id",
"sort_by",
"sort_order"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"list_container_repositories got unknown kwargs: {!r}".format(extra_kwargs))
if 'sort_by' in kwargs:
sort_by_allowed_values = ["TIMECREATED", "DISPLAYNAME"]
if kwargs['sort_by'] not in sort_by_allowed_values:
raise ValueError(
"Invalid value for `sort_by`, must be one of {0}".format(sort_by_allowed_values)
)
if 'sort_order' in kwargs:
sort_order_allowed_values = ["ASC", "DESC"]
if kwargs['sort_order'] not in sort_order_allowed_values:
raise ValueError(
"Invalid value for `sort_order`, must be one of {0}".format(sort_order_allowed_values)
)
query_params = {
"compartmentIdInSubtree": kwargs.get("compartment_id_in_subtree", missing),
"compartmentId": compartment_id,
"repositoryId": kwargs.get("repository_id", missing),
"displayName": kwargs.get("display_name", missing),
"isPublic": kwargs.get("is_public", missing),
"lifecycleState": kwargs.get("lifecycle_state", missing),
"limit": kwargs.get("limit", missing),
"page": kwargs.get("page", missing),
"sortBy": kwargs.get("sort_by", missing),
"sortOrder": kwargs.get("sort_order", missing)
}
query_params = {k: v for (k, v) in six.iteritems(query_params) if v is not missing and v is not None}
header_params = {
"accept": "application/json",
"content-type": "application/json",
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
query_params=query_params,
header_params=header_params,
response_type="ContainerRepositoryCollection")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
query_params=query_params,
header_params=header_params,
response_type="ContainerRepositoryCollection")
def list_generic_artifacts(self, compartment_id, repository_id, **kwargs):
"""
Lists artifacts in the specified repository.
:param str compartment_id: (required)
The `OCID`__ of the compartment.
__ https://docs.cloud.oracle.com/Content/General/Concepts/identifiers.htm
:param str repository_id: (required)
A filter to return the artifacts only for the specified repository OCID.
:param str id: (optional)
A filter to return the resources for the specified OCID.
:param str display_name: (optional)
A filter to return only resources that match the given display name exactly.
:param str artifact_path: (optional)
Filter results by a prefix for the `artifactPath` and and return artifacts that begin with the specified prefix in their path.
:param str version: (optional)
Filter results by a prefix for `version` and return artifacts that that begin with the specified prefix in their version.
:param str sha256: (optional)
Filter results by a specified SHA256 digest for the artifact.
:param str lifecycle_state: (optional)
A filter to return only resources that match the given lifecycle state name exactly.
:param int limit: (optional)
For list pagination. The maximum number of results per page, or items to return in a paginated
\"List\" call. For important details about how pagination works, see
`List Pagination`__.
Example: `50`
__ https://docs.cloud.oracle.com/iaas/Content/API/Concepts/usingapi.htm#nine
:param str page: (optional)
For list pagination. The value of the `opc-next-page` response header from the previous \"List\"
call. For important details about how pagination works, see
`List Pagination`__.
__ https://docs.cloud.oracle.com/iaas/Content/API/Concepts/usingapi.htm#nine
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param str sort_by: (optional)
The field to sort by. You can provide one sort order (`sortOrder`). Default order for
TIMECREATED is descending. Default order for DISPLAYNAME is ascending. The DISPLAYNAME
sort order is case sensitive.
**Note:** In general, some \"List\" operations (for example, `ListInstances`) let you
optionally filter by availability domain if the scope of the resource type is within a
single availability domain. If you call one of these \"List\" operations without specifying
an availability domain, the resources are grouped by availability domain, then sorted.
Allowed values are: "TIMECREATED", "DISPLAYNAME"
:param str sort_order: (optional)
The sort order to use, either ascending (`ASC`) or descending (`DESC`). The DISPLAYNAME sort order
is case sensitive.
Allowed values are: "ASC", "DESC"
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.GenericArtifactCollection`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/list_generic_artifacts.py.html>`__ to see an example of how to use list_generic_artifacts API.
"""
resource_path = "/generic/artifacts"
method = "GET"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"id",
"display_name",
"artifact_path",
"version",
"sha256",
"lifecycle_state",
"limit",
"page",
"opc_request_id",
"sort_by",
"sort_order"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"list_generic_artifacts got unknown kwargs: {!r}".format(extra_kwargs))
if 'sort_by' in kwargs:
sort_by_allowed_values = ["TIMECREATED", "DISPLAYNAME"]
if kwargs['sort_by'] not in sort_by_allowed_values:
raise ValueError(
"Invalid value for `sort_by`, must be one of {0}".format(sort_by_allowed_values)
)
if 'sort_order' in kwargs:
sort_order_allowed_values = ["ASC", "DESC"]
if kwargs['sort_order'] not in sort_order_allowed_values:
raise ValueError(
"Invalid value for `sort_order`, must be one of {0}".format(sort_order_allowed_values)
)
query_params = {
"compartmentId": compartment_id,
"repositoryId": repository_id,
"id": kwargs.get("id", missing),
"displayName": kwargs.get("display_name", missing),
"artifactPath": kwargs.get("artifact_path", missing),
"version": kwargs.get("version", missing),
"sha256": kwargs.get("sha256", missing),
"lifecycleState": kwargs.get("lifecycle_state", missing),
"limit": kwargs.get("limit", missing),
"page": kwargs.get("page", missing),
"sortBy": kwargs.get("sort_by", missing),
"sortOrder": kwargs.get("sort_order", missing)
}
query_params = {k: v for (k, v) in six.iteritems(query_params) if v is not missing and v is not None}
header_params = {
"accept": "application/json",
"content-type": "application/json",
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
query_params=query_params,
header_params=header_params,
response_type="GenericArtifactCollection")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
query_params=query_params,
header_params=header_params,
response_type="GenericArtifactCollection")
def list_repositories(self, compartment_id, **kwargs):
"""
Lists repositories in the specified compartment.
:param str compartment_id: (required)
The `OCID`__ of the compartment.
__ https://docs.cloud.oracle.com/Content/General/Concepts/identifiers.htm
:param str id: (optional)
A filter to return the resources for the specified OCID.
:param str display_name: (optional)
A filter to return only resources that match the given display name exactly.
:param bool is_immutable: (optional)
A filter to return resources that match the isImmutable value.
:param str lifecycle_state: (optional)
A filter to return only resources that match the given lifecycle state name exactly.
:param int limit: (optional)
For list pagination. The maximum number of results per page, or items to return in a paginated
\"List\" call. For important details about how pagination works, see
`List Pagination`__.
Example: `50`
__ https://docs.cloud.oracle.com/iaas/Content/API/Concepts/usingapi.htm#nine
:param str page: (optional)
For list pagination. The value of the `opc-next-page` response header from the previous \"List\"
call. For important details about how pagination works, see
`List Pagination`__.
__ https://docs.cloud.oracle.com/iaas/Content/API/Concepts/usingapi.htm#nine
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param str sort_by: (optional)
The field to sort by. You can provide one sort order (`sortOrder`). Default order for
TIMECREATED is descending. Default order for DISPLAYNAME is ascending. The DISPLAYNAME
sort order is case sensitive.
**Note:** In general, some \"List\" operations (for example, `ListInstances`) let you
optionally filter by availability domain if the scope of the resource type is within a
single availability domain. If you call one of these \"List\" operations without specifying
an availability domain, the resources are grouped by availability domain, then sorted.
Allowed values are: "TIMECREATED", "DISPLAYNAME"
:param str sort_order: (optional)
The sort order to use, either ascending (`ASC`) or descending (`DESC`). The DISPLAYNAME sort order
is case sensitive.
Allowed values are: "ASC", "DESC"
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.RepositoryCollection`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/list_repositories.py.html>`__ to see an example of how to use list_repositories API.
"""
resource_path = "/repositories"
method = "GET"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"id",
"display_name",
"is_immutable",
"lifecycle_state",
"limit",
"page",
"opc_request_id",
"sort_by",
"sort_order"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"list_repositories got unknown kwargs: {!r}".format(extra_kwargs))
if 'sort_by' in kwargs:
sort_by_allowed_values = ["TIMECREATED", "DISPLAYNAME"]
if kwargs['sort_by'] not in sort_by_allowed_values:
raise ValueError(
"Invalid value for `sort_by`, must be one of {0}".format(sort_by_allowed_values)
)
if 'sort_order' in kwargs:
sort_order_allowed_values = ["ASC", "DESC"]
if kwargs['sort_order'] not in sort_order_allowed_values:
raise ValueError(
"Invalid value for `sort_order`, must be one of {0}".format(sort_order_allowed_values)
)
query_params = {
"compartmentId": compartment_id,
"id": kwargs.get("id", missing),
"displayName": kwargs.get("display_name", missing),
"isImmutable": kwargs.get("is_immutable", missing),
"lifecycleState": kwargs.get("lifecycle_state", missing),
"limit": kwargs.get("limit", missing),
"page": kwargs.get("page", missing),
"sortBy": kwargs.get("sort_by", missing),
"sortOrder": kwargs.get("sort_order", missing)
}
query_params = {k: v for (k, v) in six.iteritems(query_params) if v is not missing and v is not None}
header_params = {
"accept": "application/json",
"content-type": "application/json",
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
query_params=query_params,
header_params=header_params,
response_type="RepositoryCollection")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
query_params=query_params,
header_params=header_params,
response_type="RepositoryCollection")
def remove_container_version(self, image_id, remove_container_version_details, **kwargs):
"""
Remove version from container image.
:param str image_id: (required)
The `OCID`__ of the container image.
Example: `ocid1.containerimage.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param oci.artifacts.models.RemoveContainerVersionDetails remove_container_version_details: (required)
Remove version details.
:param str if_match: (optional)
For optimistic concurrency control. In the PUT or DELETE call for a resource, set the `if-match`
parameter to the value of the etag from a previous GET or POST response for that resource. The resource
will be updated or deleted only if the etag you provide matches the resource's current etag value.
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param str opc_retry_token: (optional)
A token that uniquely identifies a request so it can be retried in case of a timeout or
server error without risk of executing that same action again. Retry tokens expire after 24
hours, but can be invalidated before then due to conflicting operations (for example, if a resource
has been deleted and purged from the system, then a retry of the original creation request
may be rejected).
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.ContainerImage`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/remove_container_version.py.html>`__ to see an example of how to use remove_container_version API.
"""
resource_path = "/container/images/{imageId}/actions/removeVersion"
method = "POST"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"if_match",
"opc_request_id",
"opc_retry_token"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"remove_container_version got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"imageId": image_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"if-match": kwargs.get("if_match", missing),
"opc-request-id": kwargs.get("opc_request_id", missing),
"opc-retry-token": kwargs.get("opc_retry_token", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_retry_token_if_needed(header_params)
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
body=remove_container_version_details,
response_type="ContainerImage")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
body=remove_container_version_details,
response_type="ContainerImage")
def restore_container_image(self, image_id, restore_container_image_details, **kwargs):
"""
Restore a container image.
:param str image_id: (required)
The `OCID`__ of the container image.
Example: `ocid1.containerimage.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param oci.artifacts.models.RestoreContainerImageDetails restore_container_image_details: (required)
Restore container image details.
:param str if_match: (optional)
For optimistic concurrency control. In the PUT or DELETE call for a resource, set the `if-match`
parameter to the value of the etag from a previous GET or POST response for that resource. The resource
will be updated or deleted only if the etag you provide matches the resource's current etag value.
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param str opc_retry_token: (optional)
A token that uniquely identifies a request so it can be retried in case of a timeout or
server error without risk of executing that same action again. Retry tokens expire after 24
hours, but can be invalidated before then due to conflicting operations (for example, if a resource
has been deleted and purged from the system, then a retry of the original creation request
may be rejected).
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.ContainerImage`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/restore_container_image.py.html>`__ to see an example of how to use restore_container_image API.
"""
resource_path = "/container/images/{imageId}/actions/restore"
method = "POST"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"if_match",
"opc_request_id",
"opc_retry_token"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"restore_container_image got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"imageId": image_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"if-match": kwargs.get("if_match", missing),
"opc-request-id": kwargs.get("opc_request_id", missing),
"opc-retry-token": kwargs.get("opc_retry_token", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_retry_token_if_needed(header_params)
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
body=restore_container_image_details,
response_type="ContainerImage")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
body=restore_container_image_details,
response_type="ContainerImage")
def update_container_configuration(self, compartment_id, update_container_configuration_details, **kwargs):
"""
Update container configuration.
:param str compartment_id: (required)
The `OCID`__ of the compartment.
__ https://docs.cloud.oracle.com/Content/General/Concepts/identifiers.htm
:param oci.artifacts.models.UpdateContainerConfigurationDetails update_container_configuration_details: (required)
Update container configuration details.
:param str if_match: (optional)
For optimistic concurrency control. In the PUT or DELETE call for a resource, set the `if-match`
parameter to the value of the etag from a previous GET or POST response for that resource. The resource
will be updated or deleted only if the etag you provide matches the resource's current etag value.
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.ContainerConfiguration`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/update_container_configuration.py.html>`__ to see an example of how to use update_container_configuration API.
"""
resource_path = "/container/configuration"
method = "PUT"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"if_match",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"update_container_configuration got unknown kwargs: {!r}".format(extra_kwargs))
query_params = {
"compartmentId": compartment_id
}
query_params = {k: v for (k, v) in six.iteritems(query_params) if v is not missing and v is not None}
header_params = {
"accept": "application/json",
"content-type": "application/json",
"if-match": kwargs.get("if_match", missing),
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
query_params=query_params,
header_params=header_params,
body=update_container_configuration_details,
response_type="ContainerConfiguration")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
query_params=query_params,
header_params=header_params,
body=update_container_configuration_details,
response_type="ContainerConfiguration")
def update_container_repository(self, repository_id, update_container_repository_details, **kwargs):
"""
Modify the properties of a container repository. Avoid entering confidential information.
:param str repository_id: (required)
The `OCID`__ of the container repository.
Example: `ocid1.containerrepo.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param oci.artifacts.models.UpdateContainerRepositoryDetails update_container_repository_details: (required)
Update container repository details.
:param str if_match: (optional)
For optimistic concurrency control. In the PUT or DELETE call for a resource, set the `if-match`
parameter to the value of the etag from a previous GET or POST response for that resource. The resource
will be updated or deleted only if the etag you provide matches the resource's current etag value.
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.ContainerRepository`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/update_container_repository.py.html>`__ to see an example of how to use update_container_repository API.
"""
resource_path = "/container/repositories/{repositoryId}"
method = "PUT"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"if_match",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"update_container_repository got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"repositoryId": repository_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"if-match": kwargs.get("if_match", missing),
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
body=update_container_repository_details,
response_type="ContainerRepository")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
body=update_container_repository_details,
response_type="ContainerRepository")
def update_generic_artifact(self, artifact_id, update_generic_artifact_details, **kwargs):
"""
Updates the artifact with the specified `OCID`__. You can only update the tags of an artifact.
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str artifact_id: (required)
The `OCID`__ of the artifact.
Example: `ocid1.genericartifact.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param oci.artifacts.models.UpdateGenericArtifactDetails update_generic_artifact_details: (required)
Updates the artifact with the specified `OCID`__. You can only update the tags of an artifact.
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str if_match: (optional)
For optimistic concurrency control. In the PUT or DELETE call for a resource, set the `if-match`
parameter to the value of the etag from a previous GET or POST response for that resource. The resource
will be updated or deleted only if the etag you provide matches the resource's current etag value.
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.GenericArtifact`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/update_generic_artifact.py.html>`__ to see an example of how to use update_generic_artifact API.
"""
resource_path = "/generic/artifacts/{artifactId}"
method = "PUT"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"if_match",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"update_generic_artifact got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"artifactId": artifact_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"if-match": kwargs.get("if_match", missing),
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
body=update_generic_artifact_details,
response_type="GenericArtifact")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
body=update_generic_artifact_details,
response_type="GenericArtifact")
def update_generic_artifact_by_path(self, repository_id, artifact_path, version, update_generic_artifact_by_path_details, **kwargs):
"""
Updates an artifact with a specified `artifactPath` and `version`. You can only update the tags of an artifact.
:param str repository_id: (required)
The `OCID`__ of the repository.
Example: `ocid1.artifactrepository.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param str artifact_path: (required)
A user-defined path to describe the location of an artifact. You can use slashes to organize the repository, but slashes do not create a directory structure. An artifact path does not include an artifact version.
Example: `project01/my-web-app/artifact-abc`
:param str version: (required)
A user-defined string to describe the artifact version.
Example: `1.1.2` or `1.2-beta-2`
:param oci.artifacts.models.UpdateGenericArtifactByPathDetails update_generic_artifact_by_path_details: (required)
Updates an artifact with a specified `artifactPath` and `version`. You can only update the tags of an artifact.
:param str if_match: (optional)
For optimistic concurrency control. In the PUT or DELETE call for a resource, set the `if-match`
parameter to the value of the etag from a previous GET or POST response for that resource. The resource
will be updated or deleted only if the etag you provide matches the resource's current etag value.
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.GenericArtifact`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/update_generic_artifact_by_path.py.html>`__ to see an example of how to use update_generic_artifact_by_path API.
"""
resource_path = "/generic/repositories/{repositoryId}/artifactPaths/{artifactPath}/versions/{version}"
method = "PUT"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"if_match",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"update_generic_artifact_by_path got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"repositoryId": repository_id,
"artifactPath": artifact_path,
"version": version
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"if-match": kwargs.get("if_match", missing),
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
body=update_generic_artifact_by_path_details,
response_type="GenericArtifact")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
body=update_generic_artifact_by_path_details,
response_type="GenericArtifact")
def update_repository(self, repository_id, update_repository_details, **kwargs):
"""
Updates the properties of a repository. You can update the `displayName` and `description` properties.
:param str repository_id: (required)
The `OCID`__ of the repository.
Example: `ocid1.artifactrepository.oc1..exampleuniqueID`
__ https://docs.cloud.oracle.com/iaas/Content/General/Concepts/identifiers.htm
:param oci.artifacts.models.UpdateRepositoryDetails update_repository_details: (required)
Updates the properties of a repository.
:param str if_match: (optional)
For optimistic concurrency control. In the PUT or DELETE call for a resource, set the `if-match`
parameter to the value of the etag from a previous GET or POST response for that resource. The resource
will be updated or deleted only if the etag you provide matches the resource's current etag value.
:param str opc_request_id: (optional)
Unique identifier for the request.
If you need to contact Oracle about a particular request, please provide the request ID.
:param obj retry_strategy: (optional)
A retry strategy to apply to this specific operation/call. This will override any retry strategy set at the client-level.
This should be one of the strategies available in the :py:mod:`~oci.retry` module. This operation will not retry by default, users can also use the convenient :py:data:`~oci.retry.DEFAULT_RETRY_STRATEGY` provided by the SDK to enable retries for it.
The specifics of the default retry strategy are described `here <https://docs.oracle.com/en-us/iaas/tools/python/latest/sdk_behaviors/retries.html>`__.
To have this operation explicitly not perform any retries, pass an instance of :py:class:`~oci.retry.NoneRetryStrategy`.
:return: A :class:`~oci.response.Response` object with data of type :class:`~oci.artifacts.models.Repository`
:rtype: :class:`~oci.response.Response`
:example:
Click `here <https://docs.cloud.oracle.com/en-us/iaas/tools/python-sdk-examples/latest/artifacts/update_repository.py.html>`__ to see an example of how to use update_repository API.
"""
resource_path = "/repositories/{repositoryId}"
method = "PUT"
# Don't accept unknown kwargs
expected_kwargs = [
"retry_strategy",
"if_match",
"opc_request_id"
]
extra_kwargs = [_key for _key in six.iterkeys(kwargs) if _key not in expected_kwargs]
if extra_kwargs:
raise ValueError(
"update_repository got unknown kwargs: {!r}".format(extra_kwargs))
path_params = {
"repositoryId": repository_id
}
path_params = {k: v for (k, v) in six.iteritems(path_params) if v is not missing}
for (k, v) in six.iteritems(path_params):
if v is None or (isinstance(v, six.string_types) and len(v.strip()) == 0):
raise ValueError('Parameter {} cannot be None, whitespace or empty string'.format(k))
header_params = {
"accept": "application/json",
"content-type": "application/json",
"if-match": kwargs.get("if_match", missing),
"opc-request-id": kwargs.get("opc_request_id", missing)
}
header_params = {k: v for (k, v) in six.iteritems(header_params) if v is not missing and v is not None}
retry_strategy = self.base_client.get_preferred_retry_strategy(
operation_retry_strategy=kwargs.get('retry_strategy'),
client_retry_strategy=self.retry_strategy
)
if retry_strategy:
if not isinstance(retry_strategy, retry.NoneRetryStrategy):
self.base_client.add_opc_client_retries_header(header_params)
retry_strategy.add_circuit_breaker_callback(self.circuit_breaker_callback)
return retry_strategy.make_retrying_call(
self.base_client.call_api,
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
body=update_repository_details,
response_type="Repository")
else:
return self.base_client.call_api(
resource_path=resource_path,
method=method,
path_params=path_params,
header_params=header_params,
body=update_repository_details,
response_type="Repository")
| 49.346671
| 261
| 0.654335
| 19,962
| 161,561
| 5.118375
| 0.027753
| 0.062091
| 0.017539
| 0.015072
| 0.930236
| 0.920351
| 0.909291
| 0.903409
| 0.898153
| 0.893739
| 0
| 0.002006
| 0.265658
| 161,561
| 3,273
| 262
| 49.361748
| 0.859189
| 0.458743
| 0
| 0.839851
| 0
| 0
| 0.15388
| 0.03052
| 0
| 0
| 0
| 0
| 0
| 1
| 0.019243
| false
| 0.000621
| 0.005587
| 0
| 0.062694
| 0.000621
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
044e113a5e31d324e11a0f0fe18d41bb49893fcd
| 31,899
|
py
|
Python
|
python/demos/create_and_export_mesh.py
|
cmaurini/dolfinx_mpc
|
f7dba13c4d2d5231d13050af7a64206fafd0e2f4
|
[
"MIT"
] | null | null | null |
python/demos/create_and_export_mesh.py
|
cmaurini/dolfinx_mpc
|
f7dba13c4d2d5231d13050af7a64206fafd0e2f4
|
[
"MIT"
] | null | null | null |
python/demos/create_and_export_mesh.py
|
cmaurini/dolfinx_mpc
|
f7dba13c4d2d5231d13050af7a64206fafd0e2f4
|
[
"MIT"
] | null | null | null |
import dolfinx.common as _common
import dolfinx.cpp as _cpp
import dolfinx.io as _io
import dolfinx.mesh as _mesh
import dolfinx_mpc.utils as _utils
import gmsh
import numpy as np
import ufl
from mpi4py import MPI
def gmsh_3D_stacked(celltype, theta, res=0.1, verbose=False):
if celltype == "tetrahedron":
mesh, ft = generate_tet_boxes(0, 0, 0, 1, 1, 1, 2, res,
facet_markers=[[11, 5, 12, 13, 4, 14],
[21, 9, 22, 23, 3, 24]],
volume_markers=[1, 2], verbose=verbose)
else:
mesh, ft = generate_hex_boxes(0, 0, 0, 1, 1, 1, 2, res,
facet_markers=[[11, 5, 12, 13, 4, 14],
[21, 9, 22, 23, 3, 24]],
volume_markers=[1, 2], verbose=verbose)
r_matrix = _utils.rotation_matrix([1, 1, 0], -theta)
mesh.geometry.x[:] = np.dot(r_matrix, mesh.geometry.x.T).T
return mesh, ft
def generate_tet_boxes(x0, y0, z0, x1, y1, z1, z2, res, facet_markers,
volume_markers, verbose=False):
"""
Generate the stacked boxes [x0,y0,z0]x[y1,y1,z1] and
[x0,y0,z1] x [x1,y1,z2] with different resolution in each box.
The markers are is a list of arrays containing markers
array of markers for [back, bottom, right, left, top, front] per box
volume_markers a list of marker per volume
"""
gmsh.initialize()
if verbose:
gmsh.option.setNumber("General.Terminal", 1)
else:
gmsh.option.setNumber("General.Terminal", 0)
if MPI.COMM_WORLD.rank == 0:
gmsh.clear()
# NOTE: Have to reset this until:
# https://gitlab.onelab.info/gmsh/gmsh/-/issues/1001
# is in master
gmsh.option.setNumber("Mesh.RecombineAll", 0)
# Added tolerance to ensure that gmsh separates boxes
tol = 1e-12
gmsh.model.occ.addBox(x0, y0, z0, x1 - x0, y1 - y0, z1 - z0)
gmsh.model.occ.addBox(x0, y0, z1 + tol, x1 - x0, y1 - y0, z2 - z1)
# Syncronize to be able to fetch entities
gmsh.model.occ.synchronize()
# Create entity -> marker map (to be used after rotation)
volumes = gmsh.model.getEntities(3)
volume_entities = {"Top": [None, volume_markers[1]],
"Bottom": [None, volume_markers[0]]}
for i, volume in enumerate(volumes):
com = gmsh.model.occ.getCenterOfMass(volume[0], np.abs(volume[1]))
if np.isclose(com[2], (z1 - z0) / 2):
bottom_index = i
volume_entities["Bottom"][0] = volume
elif np.isclose(com[2], (z2 - z1) / 2 + z1):
top_index = i
volume_entities["Top"][0] = volume
surfaces = ["Top", "Bottom", "Left", "Right", "Front", "Back"]
entities = {"Bottom": {key: [[], None] for key in surfaces},
"Top": {key: [[], None] for key in surfaces}}
# Identitfy entities for each surface of top and bottom cube
# Physical markers for bottom cube
bottom_surfaces = gmsh.model.getBoundary([volumes[bottom_index]],
oriented=False, recursive=False)
for entity in bottom_surfaces:
com = gmsh.model.occ.getCenterOfMass(entity[0], entity[1])
if np.allclose(com, [(x1 - x0) / 2, y1, (z1 - z0) / 2]):
entities["Bottom"]["Back"][0].append(entity[1])
entities["Bottom"]["Back"][1] = facet_markers[0][0]
elif np.allclose(com, [(x1 - x0) / 2, (y1 - y0) / 2, z0]):
entities["Bottom"]["Bottom"][0].append(entity[1])
entities["Bottom"]["Bottom"][1] = facet_markers[0][1]
elif np.allclose(com, [x1, (y1 - y0) / 2, (z1 - z0) / 2]):
entities["Bottom"]["Right"][0].append(entity[1])
entities["Bottom"]["Right"][1] = facet_markers[0][2]
elif np.allclose(com, [x0, (y1 - y0) / 2, (z1 - z0) / 2]):
entities["Bottom"]["Left"][0].append(entity[1])
entities["Bottom"]["Left"][1] = facet_markers[0][3]
elif np.allclose(com, [(x1 - x0) / 2, (y1 - y0) / 2, z1]):
entities["Bottom"]["Top"][0].append(entity[1])
entities["Bottom"]["Top"][1] = facet_markers[0][4]
elif np.allclose(com, [(x1 - x0) / 2, y0, (z1 - z0) / 2]):
entities["Bottom"]["Front"][0].append(entity[1])
entities["Bottom"]["Front"][1] = facet_markers[0][5]
# Physical markers for top
top_surfaces = gmsh.model.getBoundary([volumes[top_index]],
oriented=False, recursive=False)
for entity in top_surfaces:
com = gmsh.model.occ.getCenterOfMass(entity[0], entity[1])
if np.allclose(com, [(x1 - x0) / 2, y1, (z2 - z1) / 2 + z1]):
entities["Top"]["Back"][0].append(entity[1])
entities["Top"]["Back"][1] = facet_markers[1][0]
elif np.allclose(com, [(x1 - x0) / 2, (y1 - y0) / 2, z1]):
entities["Top"]["Bottom"][0].append(entity[1])
entities["Top"]["Bottom"][1] = facet_markers[1][1]
elif np.allclose(com, [x1, (y1 - y0) / 2, (z2 - z1) / 2 + z1]):
entities["Top"]["Right"][0].append(entity[1])
entities["Top"]["Right"][1] = facet_markers[1][2]
elif np.allclose(com, [x0, (y1 - y0) / 2, (z2 - z1) / 2 + z1]):
entities["Top"]["Left"][0].append(entity[1])
entities["Top"]["Left"][1] = facet_markers[1][3]
elif np.allclose(com, [(x1 - x0) / 2, (y1 - y0) / 2, z2]):
entities["Top"]["Top"][0].append(entity[1])
entities["Top"]["Top"][1] = facet_markers[1][4]
elif np.allclose(com, [(x1 - x0) / 2, y0, (z2 - z1) / 2 + z1]):
entities["Top"]["Front"][0].append(entity[1])
entities["Top"]["Front"][1] = facet_markers[1][5]
# Note: Rotation cannot be used on recombined surfaces
gmsh.model.occ.synchronize()
for volume in volume_entities.keys():
gmsh.model.addPhysicalGroup(
volume_entities[volume][0][0], [volume_entities[volume][0][1]],
tag=volume_entities[volume][1])
gmsh.model.setPhysicalName(volume_entities[volume][0][0],
volume_entities[volume][1], volume)
for box in entities.keys():
for surface in entities[box].keys():
gmsh.model.addPhysicalGroup(2, entities[box][surface][0],
tag=entities[box][surface][1])
gmsh.model.setPhysicalName(2, entities[box][surface][1], box
+ ":" + surface)
gmsh.model.mesh.field.add("Box", 1)
gmsh.model.mesh.field.setNumber(1, "VIn", res)
gmsh.model.mesh.field.setNumber(1, "VOut", 2 * res)
gmsh.model.mesh.field.setNumber(1, "XMin", 0)
gmsh.model.mesh.field.setNumber(1, "XMax", 1)
gmsh.model.mesh.field.setNumber(1, "YMin", 0)
gmsh.model.mesh.field.setNumber(1, "YMax", 1)
gmsh.model.mesh.field.setNumber(1, "ZMin", 0)
gmsh.model.mesh.field.setNumber(1, "ZMax", 1)
gmsh.model.mesh.field.setAsBackgroundMesh(1)
# NOTE: Need to synchronize after setting mesh sizes
gmsh.model.occ.synchronize()
# Generate mesh
gmsh.option.setNumber("Mesh.MaxNumThreads1D", MPI.COMM_WORLD.size)
gmsh.option.setNumber("Mesh.MaxNumThreads2D", MPI.COMM_WORLD.size)
gmsh.option.setNumber("Mesh.MaxNumThreads3D", MPI.COMM_WORLD.size)
gmsh.model.mesh.generate(3)
gmsh.model.mesh.setOrder(1)
mesh, ft = _utils.gmsh_model_to_mesh(gmsh.model, facet_data=True)
gmsh.finalize()
return mesh, ft
def generate_hex_boxes(x0, y0, z0, x1, y1, z1, z2, res, facet_markers,
volume_markers, verbose=False):
"""
Generate the stacked boxes [x0,y0,z0]x[y1,y1,z1] and
[x0,y0,z1] x [x1,y1,z2] with different resolution in each box.
The markers are is a list of arrays containing markers
array of markers for [back, bottom, right, left, top, front] per box
volume_markers a list of marker per volume
"""
gmsh.initialize()
if verbose:
gmsh.option.setNumber("General.Terminal", 1)
else:
gmsh.option.setNumber("General.Terminal", 0)
if MPI.COMM_WORLD.rank == 0:
gmsh.clear()
gmsh.option.setNumber("Mesh.RecombinationAlgorithm", 2)
gmsh.option.setNumber("Mesh.RecombineAll", 2)
bottom = gmsh.model.occ.addRectangle(x0, y0, z0, x1 - x0, y1 - y0)
top = gmsh.model.occ.addRectangle(x0, y0, z2, x1 - x0, y1 - y0)
# Set mesh size at point
gmsh.model.occ.extrude([(2, bottom)], 0, 0, z1 - z0,
numElements=[int(1 / (2 * res))], recombine=True)
gmsh.model.occ.extrude([(2, top)], 0, 0, z1 - z2 - 1e-12,
numElements=[int(1 / (2 * res))], recombine=True)
# Syncronize to be able to fetch entities
gmsh.model.occ.synchronize()
# Create entity -> marker map (to be used after rotation)
volumes = gmsh.model.getEntities(3)
volume_entities = {"Top": [None, volume_markers[1]],
"Bottom": [None, volume_markers[0]]}
for i, volume in enumerate(volumes):
com = gmsh.model.occ.getCenterOfMass(volume[0], volume[1])
if np.isclose(com[2], (z1 - z0) / 2):
bottom_index = i
volume_entities["Bottom"][0] = volume
elif np.isclose(com[2], (z2 - z1) / 2 + z1):
top_index = i
volume_entities["Top"][0] = volume
surfaces = ["Top", "Bottom", "Left", "Right", "Front", "Back"]
entities = {"Bottom": {key: [[], None] for key in surfaces},
"Top": {key: [[], None] for key in surfaces}}
# Identitfy entities for each surface of top and bottom cube
# Physical markers for bottom cube
bottom_surfaces = gmsh.model.getBoundary([volumes[bottom_index]], oriented=False, recursive=False)
for entity in bottom_surfaces:
com = gmsh.model.occ.getCenterOfMass(entity[0], entity[1])
if np.allclose(com, [(x1 - x0) / 2, y1, (z1 - z0) / 2]):
entities["Bottom"]["Back"][0].append(entity[1])
entities["Bottom"]["Back"][1] = facet_markers[0][0]
elif np.allclose(com, [(x1 - x0) / 2, (y1 - y0) / 2, z0]):
entities["Bottom"]["Bottom"][0].append(entity[1])
entities["Bottom"]["Bottom"][1] = facet_markers[0][1]
elif np.allclose(com, [x1, (y1 - y0) / 2, (z1 - z0) / 2]):
entities["Bottom"]["Right"][0].append(entity[1])
entities["Bottom"]["Right"][1] = facet_markers[0][2]
elif np.allclose(com, [x0, (y1 - y0) / 2, (z1 - z0) / 2]):
entities["Bottom"]["Left"][0].append(entity[1])
entities["Bottom"]["Left"][1] = facet_markers[0][3]
elif np.allclose(com, [(x1 - x0) / 2, (y1 - y0) / 2, z1]):
entities["Bottom"]["Top"][0].append(entity[1])
entities["Bottom"]["Top"][1] = facet_markers[0][4]
elif np.allclose(com, [(x1 - x0) / 2, y0, (z1 - z0) / 2]):
entities["Bottom"]["Front"][0].append(entity[1])
entities["Bottom"]["Front"][1] = facet_markers[0][5]
# Physical markers for top
top_surfaces = gmsh.model.getBoundary([volumes[top_index]], oriented=False, recursive=False)
for entity in top_surfaces:
com = gmsh.model.occ.getCenterOfMass(entity[0], entity[1])
if np.allclose(com, [(x1 - x0) / 2, y1, (z2 - z1) / 2 + z1]):
entities["Top"]["Back"][0].append(entity[1])
entities["Top"]["Back"][1] = facet_markers[1][0]
elif np.allclose(com, [(x1 - x0) / 2, (y1 - y0) / 2, z1]):
entities["Top"]["Bottom"][0].append(entity[1])
entities["Top"]["Bottom"][1] = facet_markers[1][1]
elif np.allclose(com, [x1, (y1 - y0) / 2, (z2 - z1) / 2 + z1]):
entities["Top"]["Right"][0].append(entity[1])
entities["Top"]["Right"][1] = facet_markers[1][2]
elif np.allclose(com, [x0, (y1 - y0) / 2, (z2 - z1) / 2 + z1]):
entities["Top"]["Left"][0].append(entity[1])
entities["Top"]["Left"][1] = facet_markers[1][3]
elif np.allclose(com, [(x1 - x0) / 2, (y1 - y0) / 2, z2]):
entities["Top"]["Top"][0].append(entity[1])
entities["Top"]["Top"][1] = facet_markers[1][4]
elif np.allclose(com, [(x1 - x0) / 2, y0, (z2 - z1) / 2 + z1]):
entities["Top"]["Front"][0].append(entity[1])
entities["Top"]["Front"][1] = facet_markers[1][5]
# gmsh.model.occ.rotate(volumes, 0, 0, 0,
# 1 / np.sqrt(2), 1 / np.sqrt(2), 0, theta)
# Note: Rotation cannot be used on recombined surfaces
gmsh.model.occ.synchronize()
for volume in volume_entities.keys():
gmsh.model.addPhysicalGroup(
volume_entities[volume][0][0], [volume_entities[volume][0][1]], tag=volume_entities[volume][1])
gmsh.model.setPhysicalName(volume_entities[volume][0][0], volume_entities[volume][1], volume)
for box in entities.keys():
for surface in entities[box].keys():
gmsh.model.addPhysicalGroup(2, entities[box][surface][0], tag=entities[box][surface][1])
gmsh.model.setPhysicalName(2, entities[box][surface][1], box + ":" + surface)
# Set mesh sizes on the points from the surface we are extruding
bottom_nodes = gmsh.model.getBoundary([(2, bottom)], oriented=False, recursive=True)
gmsh.model.occ.mesh.setSize(bottom_nodes, res)
top_nodes = gmsh.model.getBoundary([(2, top)], oriented=False, recursive=True)
gmsh.model.occ.mesh.setSize(top_nodes, 2 * res)
# NOTE: Need to synchronize after setting mesh sizes
gmsh.model.occ.synchronize()
# Generate mesh
gmsh.option.setNumber("Mesh.MaxNumThreads1D", MPI.COMM_WORLD.size)
gmsh.option.setNumber("Mesh.MaxNumThreads2D", MPI.COMM_WORLD.size)
gmsh.option.setNumber("Mesh.MaxNumThreads3D", MPI.COMM_WORLD.size)
gmsh.model.mesh.generate(3)
gmsh.model.mesh.setOrder(1)
mesh, ft = _utils.gmsh_model_to_mesh(gmsh.model, facet_data=True)
gmsh.clear()
gmsh.finalize()
MPI.COMM_WORLD.barrier()
return mesh, ft
def gmsh_2D_stacked(celltype, theta, verbose=False):
res = 0.1
x0, y0, z0 = 0, 0, 0
x1, y1 = 1, 1
y2 = 2
# Check if GMSH is initialized
gmsh.initialize()
gmsh.clear()
if MPI.COMM_WORLD.rank == 0:
if celltype == "quadrilateral":
gmsh.option.setNumber("Mesh.RecombinationAlgorithm", 2)
gmsh.option.setNumber("Mesh.RecombineAll", 2)
recombine = True
else:
recombine = False
points = [gmsh.model.occ.addPoint(x0, y0, z0), gmsh.model.occ.addPoint(x1, y0, z0),
gmsh.model.occ.addPoint(x0, y2, z0), gmsh.model.occ.addPoint(x1, y2, z0)]
bottom = gmsh.model.occ.addLine(points[0], points[1])
top = gmsh.model.occ.addLine(points[2], points[3])
gmsh.model.occ.extrude([(1, bottom)], 0, y1 - y0, 0, numElements=[int(1 / (res))], recombine=recombine)
gmsh.model.occ.extrude([(1, top)], 0, y1 - y2 - 1e-12, 0, numElements=[int(1 / (2 * res))], recombine=recombine)
# Syncronize to be able to fetch entities
gmsh.model.occ.synchronize()
# Create entity -> marker map (to be used after rotation)
volumes = gmsh.model.getEntities(2)
volume_entities = {"Top": [None, 1], "Bottom": [None, 2]}
for i, volume in enumerate(volumes):
com = gmsh.model.occ.getCenterOfMass(volume[0], volume[1])
if np.isclose(com[1], (y1 - y0) / 2):
bottom_index = i
volume_entities["Bottom"][0] = volume
elif np.isclose(com[1], (y2 - y1) / 2 + y1):
top_index = i
volume_entities["Top"][0] = volume
surfaces = ["Top", "Bottom", "Left", "Right"]
entities = {"Bottom": {key: [[], None] for key in surfaces},
"Top": {key: [[], None] for key in surfaces}}
# Identitfy entities for each surface of top and bottom cube
# Bottom cube: Top, Right, Bottom, Left
# Top cube : Top, Right, Bottom, Left
facet_markers = [[4, 7, 5, 6], [3, 12, 9, 13]]
bottom_surfaces = gmsh.model.getBoundary([volumes[bottom_index]], oriented=False, recursive=False)
for entity in bottom_surfaces:
com = gmsh.model.occ.getCenterOfMass(entity[0], abs(entity[1]))
if np.allclose(com, [(x1 - x0) / 2, y0, z0]):
entities["Bottom"]["Bottom"][0].append(entity[1])
entities["Bottom"]["Bottom"][1] = facet_markers[0][2]
elif np.allclose(com, [x1, (y1 - y0) / 2, z0]):
entities["Bottom"]["Right"][0].append(entity[1])
entities["Bottom"]["Right"][1] = facet_markers[0][1]
elif np.allclose(com, [x0, (y1 - y0) / 2, z0]):
entities["Bottom"]["Left"][0].append(entity[1])
entities["Bottom"]["Left"][1] = facet_markers[0][3]
elif np.allclose(com, [(x1 - x0) / 2, y1, z0]):
entities["Bottom"]["Top"][0].append(entity[1])
entities["Bottom"]["Top"][1] = facet_markers[0][0]
# Physical markers for top
top_surfaces = gmsh.model.getBoundary([volumes[top_index]], oriented=False, recursive=False)
for entity in top_surfaces:
com = gmsh.model.occ.getCenterOfMass(entity[0], abs(entity[1]))
if np.allclose(com, [(x1 - x0) / 2, y1, z0]):
entities["Top"]["Bottom"][0].append(entity[1])
entities["Top"]["Bottom"][1] = facet_markers[1][2]
elif np.allclose(com, [x1, y1 + (y2 - y1) / 2, z0]):
entities["Top"]["Right"][0].append(entity[1])
entities["Top"]["Right"][1] = facet_markers[1][1]
elif np.allclose(com, [x0, y1 + (y2 - y1) / 2, z0]):
entities["Top"]["Left"][0].append(entity[1])
entities["Top"]["Left"][1] = facet_markers[1][3]
elif np.allclose(com, [(x1 - x0) / 2, y2, z0]):
entities["Top"]["Top"][0].append(entity[1])
entities["Top"]["Top"][1] = facet_markers[1][0]
# Note: Rotation cannot be used on recombined surfaces
gmsh.model.occ.synchronize()
for volume in volume_entities.keys():
gmsh.model.addPhysicalGroup(
volume_entities[volume][0][0], [volume_entities[volume][0][1]],
tag=volume_entities[volume][1])
gmsh.model.setPhysicalName(volume_entities[volume][0][0], volume_entities[volume][1], volume)
for box in entities.keys():
for surface in entities[box].keys():
gmsh.model.addPhysicalGroup(1, entities[box][surface][0], tag=entities[box][surface][1])
gmsh.model.setPhysicalName(1, entities[box][surface][1], box + ":" + surface)
# Set mesh sizes on the points from the surface we are extruding
bottom_nodes = gmsh.model.getBoundary([volumes[bottom_index]], oriented=False, recursive=True)
gmsh.model.occ.mesh.setSize(bottom_nodes, res)
top_nodes = gmsh.model.getBoundary([volumes[top_index]], oriented=False, recursive=True)
gmsh.model.occ.mesh.setSize(top_nodes, 2 * res)
# NOTE: Need to synchronize after setting mesh sizes
gmsh.model.occ.synchronize()
# Generate mesh
gmsh.option.setNumber("Mesh.MaxNumThreads1D", MPI.COMM_WORLD.size)
gmsh.option.setNumber("Mesh.MaxNumThreads2D", MPI.COMM_WORLD.size)
gmsh.option.setNumber("Mesh.MaxNumThreads3D", MPI.COMM_WORLD.size)
gmsh.model.mesh.generate(2)
gmsh.model.mesh.setOrder(1)
mesh, ft = _utils.gmsh_model_to_mesh(gmsh.model, facet_data=True, gdim=2)
r_matrix = _utils.rotation_matrix([0, 0, 1], theta)
# NOTE: Hex mesh must be rotated after generation due to gmsh API
mesh.geometry.x[:] = np.dot(r_matrix, mesh.geometry.x.T).T
gmsh.clear()
gmsh.finalize()
MPI.COMM_WORLD.barrier()
return mesh, ft
def mesh_2D_dolfin(celltype, theta=0):
"""
Create two 2D cubes stacked on top of each other,
and the corresponding mesh markers using dolfin built-in meshes
"""
def find_line_function(p0, p1):
"""
Find line y=ax+b for each of the lines in the mesh
https://mathworld.wolfram.com/Two-PointForm.html
"""
# Line aligned with y axis
if np.isclose(p1[0], p0[0]):
return lambda x: np.isclose(x[0], p0[0])
return lambda x: np.isclose(x[1], p0[1] + (p1[1] - p0[1]) / (p1[0] - p0[0]) * (x[0] - p0[0]))
def over_line(p0, p1):
"""
Check if a point is over or under y=ax+b for each of the
lines in the mesh https://mathworld.wolfram.com/Two-PointForm.html
"""
return lambda x: x[1] > p0[1] + (p1[1] - p0[1]) / (p1[0] - p0[0]) * (x[0] - p0[0])
# Using built in meshes, stacking cubes on top of each other
N = 15
if celltype == "quadrilateral":
ct = _mesh.CellType.quadrilateral
elif celltype == "triangle":
ct = _mesh.CellType.triangle
else:
raise ValueError("celltype has to be tri or quad")
if MPI.COMM_WORLD.rank == 0:
mesh0 = _mesh.create_unit_square(MPI.COMM_SELF, N, N, ct)
mesh1 = _mesh.create_unit_square(MPI.COMM_SELF, 2 * N, 2 * N, ct)
mesh0.geometry.x[:, 1] += 1
# Stack the two meshes in one mesh
r_matrix = _utils.rotation_matrix([0, 0, 1], theta)
points = np.vstack([mesh0.geometry.x, mesh1.geometry.x])
points = np.dot(r_matrix, points.T)
points = points[:2, :].T
# Transform topology info into geometry info
tdim0 = mesh0.topology.dim
num_cells0 = mesh0.topology.index_map(tdim0).size_local
cells0 = _cpp.mesh.entities_to_geometry(
mesh0, tdim0, np.arange(num_cells0, dtype=np.int32).reshape((-1, 1)), False)
tdim1 = mesh1.topology.dim
num_cells1 = mesh1.topology.index_map(tdim1).size_local
cells1 = _cpp.mesh.entities_to_geometry(
mesh1, tdim1, np.arange(num_cells1, dtype=np.int32).reshape((-1, 1)), False)
cells1 += mesh0.geometry.x.shape[0]
cells = np.vstack([cells0, cells1])
cell = ufl.Cell(celltype, geometric_dimension=points.shape[1])
domain = ufl.Mesh(ufl.VectorElement("Lagrange", cell, 1))
mesh = _mesh.create_mesh(MPI.COMM_SELF, cells, points, domain)
tdim = mesh.topology.dim
fdim = tdim - 1
# Find information about facets to be used in MeshTags
bottom_points = np.dot(r_matrix, np.array([[0, 0, 0], [1, 0, 0], [1, 1, 0], [0, 1, 0]]).T)
bottom = find_line_function(bottom_points[:, 0], bottom_points[:, 1])
bottom_facets = _mesh.locate_entities_boundary(mesh, fdim, bottom)
top_points = np.dot(r_matrix, np.array([[0, 1, 0], [1, 1, 0], [1, 2, 0], [0, 2, 0]]).T)
top = find_line_function(top_points[:, 2], top_points[:, 3])
top_facets = _mesh.locate_entities_boundary(mesh, fdim, top)
left_side = find_line_function(top_points[:, 0], top_points[:, 3])
left_facets = _mesh.locate_entities_boundary(mesh, fdim, left_side)
right_side = find_line_function(top_points[:, 1], top_points[:, 2])
right_facets = _mesh.locate_entities_boundary(mesh, fdim, right_side)
top_cube = over_line(bottom_points[:, 2], bottom_points[:, 3])
num_cells = mesh.topology.index_map(tdim).size_local
cell_midpoints = _cpp.mesh.compute_midpoints(mesh, tdim, range(num_cells))
interface = find_line_function(bottom_points[:, 2], bottom_points[:, 3])
i_facets = _mesh.locate_entities_boundary(mesh, fdim, interface)
bottom_interface = []
top_interface = []
mesh.topology.create_connectivity(fdim, tdim)
facet_to_cell = mesh.topology.connectivity(fdim, tdim)
for facet in i_facets:
i_cells = facet_to_cell.links(facet)
assert(len(i_cells == 1))
i_cell = i_cells[0]
if top_cube(cell_midpoints[i_cell]):
top_interface.append(facet)
else:
bottom_interface.append(facet)
top_cube_marker = 2
indices = []
values = []
for cell_index in range(num_cells):
if top_cube(cell_midpoints[cell_index]):
indices.append(cell_index)
values.append(top_cube_marker)
ct = _mesh.MeshTags(mesh, tdim, np.array(indices, dtype=np.intc), np.array(values, dtype=np.intc))
# Create meshtags for facet data
markers = {3: top_facets, 4: bottom_interface, 9: top_interface,
5: bottom_facets, 6: left_facets, 7: right_facets}
indices = np.array([], dtype=np.intc)
values = np.array([], dtype=np.intc)
for key in markers.keys():
indices = np.append(indices, markers[key])
values = np.append(values, np.full(len(markers[key]), key, dtype=np.intc))
arg_sort = np.argsort(indices)
mt = _mesh.MeshTags(mesh, fdim, indices[arg_sort], values[arg_sort])
mt.name = "facet_tags"
with _io.XDMFFile(MPI.COMM_SELF, f"meshes/mesh_{celltype}_{theta:.2f}.xdmf", "w") as o_f:
o_f.write_mesh(mesh)
o_f.write_meshtags(ct)
o_f.write_meshtags(mt)
MPI.COMM_WORLD.barrier()
def mesh_3D_dolfin(theta=0, ct=_mesh.CellType.tetrahedron, ext="tetrahedron", res=0.1):
timer = _common.Timer("~~Contact: Create mesh")
def find_plane_function(p0, p1, p2):
"""
Find plane function given three points:
http://www.nabla.hr/CG-LinesPlanesIn3DA3.htm
"""
v1 = np.array(p1) - np.array(p0)
v2 = np.array(p2) - np.array(p0)
n = np.cross(v1, v2)
D = -(n[0] * p0[0] + n[1] * p0[1] + n[2] * p0[2])
return lambda x: np.isclose(0, np.dot(n, x) + D)
def over_plane(p0, p1, p2):
"""
Returns function that checks if a point is over a plane defined
by the points p0, p1 and p2.
"""
v1 = np.array(p1) - np.array(p0)
v2 = np.array(p2) - np.array(p0)
n = np.cross(v1, v2)
D = -(n[0] * p0[0] + n[1] * p0[1] + n[2] * p0[2])
return lambda x: n[0] * x[0] + n[1] * x[1] + D > -n[2] * x[2]
N = int(1 / res)
if MPI.COMM_WORLD.rank == 0:
mesh0 = _mesh.create_unit_cube(MPI.COMM_SELF, N, N, N, ct)
mesh1 = _mesh.create_unit_cube(MPI.COMM_SELF, 2 * N, 2 * N, 2 * N, ct)
mesh0.geometry.x[:, 2] += 1
# Stack the two meshes in one mesh
r_matrix = _utils.rotation_matrix([1 / np.sqrt(2), 1 / np.sqrt(2), 0], -theta)
points = np.vstack([mesh0.geometry.x, mesh1.geometry.x])
points = np.dot(r_matrix, points.T).T
# Transform topology info into geometry info
tdim0 = mesh0.topology.dim
num_cells0 = mesh0.topology.index_map(tdim0).size_local
cells0 = _cpp.mesh.entities_to_geometry(
mesh0, tdim0, np.arange(num_cells0, dtype=np.int32).reshape((-1, 1)), False)
tdim1 = mesh1.topology.dim
num_cells1 = mesh1.topology.index_map(tdim1).size_local
cells1 = _cpp.mesh.entities_to_geometry(
mesh1, tdim1, np.arange(num_cells1, dtype=np.int32).reshape((-1, 1)), False)
cells1 += mesh0.geometry.x.shape[0]
cells = np.vstack([cells0, cells1])
cell = ufl.Cell(ext, geometric_dimension=points.shape[1])
domain = ufl.Mesh(ufl.VectorElement("Lagrange", cell, 1))
mesh = _mesh.create_mesh(MPI.COMM_SELF, cells, points, domain)
tdim = mesh.topology.dim
fdim = tdim - 1
# Find information about facets to be used in MeshTags
bottom_points = np.dot(r_matrix, np.array([[0, 0, 0], [1, 0, 0], [0, 1, 0], [1, 1, 0]]).T)
bottom = find_plane_function(bottom_points[:, 0], bottom_points[:, 1], bottom_points[:, 2])
bottom_facets = _mesh.locate_entities_boundary(mesh, fdim, bottom)
top_points = np.dot(r_matrix, np.array([[0, 0, 2], [1, 0, 2], [0, 1, 2], [1, 1, 2]]).T)
top = find_plane_function(top_points[:, 0], top_points[:, 1], top_points[:, 2])
top_facets = _mesh.locate_entities_boundary(mesh, fdim, top)
# left_side = find_line_function(top_points[:, 0], top_points[:, 3])
# left_facets = _mesh.locate_entities_boundary(
# mesh, fdim, left_side)
# right_side = find_line_function(top_points[:, 1], top_points[:, 2])
# right_facets = _mesh.locate_entities_boundary(
# mesh, fdim, right_side)
if_points = np.dot(r_matrix, np.array([[0, 0, 1], [1, 0, 1],
[0, 1, 1], [1, 1, 1]]).T)
interface = find_plane_function(if_points[:, 0], if_points[:, 1], if_points[:, 2])
i_facets = _mesh.locate_entities_boundary(mesh, fdim, interface)
mesh.topology.create_connectivity(fdim, tdim)
top_interface = []
bottom_interface = []
facet_to_cell = mesh.topology.connectivity(fdim, tdim)
num_cells = mesh.topology.index_map(tdim).size_local
cell_midpoints = _cpp.mesh.compute_midpoints(mesh, tdim, range(num_cells))
top_cube = over_plane(if_points[:, 0], if_points[:, 1], if_points[:, 2])
for facet in i_facets:
i_cells = facet_to_cell.links(facet)
assert(len(i_cells == 1))
i_cell = i_cells[0]
if top_cube(cell_midpoints[i_cell]):
top_interface.append(facet)
else:
bottom_interface.append(facet)
num_cells = mesh.topology.index_map(tdim).size_local
cell_midpoints = _cpp.mesh.compute_midpoints(mesh, tdim, range(num_cells))
top_cube_marker = 2
indices = []
values = []
for cell_index in range(num_cells):
if top_cube(cell_midpoints[cell_index]):
indices.append(cell_index)
values.append(top_cube_marker)
ct = _mesh.MeshTags(mesh, tdim, np.array(indices, dtype=np.intc), np.array(values, dtype=np.intc))
# Create meshtags for facet data
markers = {3: top_facets, 4: bottom_interface, 9: top_interface,
5: bottom_facets} # , 6: left_facets, 7: right_facets}
indices = np.array([], dtype=np.intc)
values = np.array([], dtype=np.intc)
for key in markers.keys():
indices = np.append(indices, markers[key])
values = np.append(values, np.full(len(markers[key]), key, dtype=np.intc))
arg_sort = np.argsort(indices)
mt = _mesh.MeshTags(mesh, fdim, indices[arg_sort], values[arg_sort])
mt.name = "facet_tags"
fname = f"meshes/mesh_{ext}_{theta:.2f}.xdmf"
with _io.XDMFFile(MPI.COMM_SELF, fname, "w") as o_f:
o_f.write_mesh(mesh)
o_f.write_meshtags(ct)
o_f.write_meshtags(mt)
timer.stop()
| 49.302937
| 120
| 0.570457
| 4,262
| 31,899
| 4.15908
| 0.080244
| 0.042649
| 0.025048
| 0.025274
| 0.887566
| 0.862067
| 0.839783
| 0.808812
| 0.796739
| 0.77581
| 0
| 0.045959
| 0.276968
| 31,899
| 646
| 121
| 49.379257
| 0.722598
| 0.104455
| 0
| 0.711382
| 0
| 0
| 0.047123
| 0.004486
| 0
| 0
| 0
| 0
| 0.004065
| 1
| 0.020325
| false
| 0
| 0.018293
| 0
| 0.056911
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
f08bc2a770d214a0fbee41855f36bcb141a5c286
| 135
|
py
|
Python
|
daceml/testing/profiling/__init__.py
|
spcl/dace-onnx
|
ddd1120db96c900bd017b8b134dfce0bfb66d1bd
|
[
"BSD-3-Clause"
] | 30
|
2020-09-09T21:13:36.000Z
|
2022-03-15T01:58:10.000Z
|
daceml/testing/profiling/__init__.py
|
Shigangli/daceml
|
c2133c677d5174763e30cf2d98dcb3fd64059db3
|
[
"BSD-3-Clause"
] | 83
|
2020-09-05T11:45:06.000Z
|
2021-09-28T14:21:44.000Z
|
daceml/testing/profiling/__init__.py
|
Shigangli/daceml
|
c2133c677d5174763e30cf2d98dcb3fd64059db3
|
[
"BSD-3-Clause"
] | 7
|
2020-09-03T13:28:45.000Z
|
2021-12-12T02:53:22.000Z
|
from .event_profiler import time_one, time_funcs, print_time_statistics
__all__ = ["time_one", "time_funcs", "print_time_statistics"]
| 33.75
| 71
| 0.807407
| 19
| 135
| 5.052632
| 0.526316
| 0.145833
| 0.229167
| 0.333333
| 0.729167
| 0.729167
| 0.729167
| 0
| 0
| 0
| 0
| 0
| 0.088889
| 135
| 3
| 72
| 45
| 0.780488
| 0
| 0
| 0
| 0
| 0
| 0.288889
| 0.155556
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.5
| 0
| 0.5
| 1
| 1
| 0
| 0
| null | 0
| 1
| 1
| 0
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
|
0
| 8
|
f09c06b0fd20e5002616ba646cf95327505ffd83
| 10,582
|
gyp
|
Python
|
binding.gyp
|
KonataDev/node-silk
|
efb683856838995d71add66b475243a25694fcda
|
[
"MIT"
] | 1
|
2022-03-08T09:03:34.000Z
|
2022-03-08T09:03:34.000Z
|
binding.gyp
|
KonataDev/node-silk
|
efb683856838995d71add66b475243a25694fcda
|
[
"MIT"
] | null | null | null |
binding.gyp
|
KonataDev/node-silk
|
efb683856838995d71add66b475243a25694fcda
|
[
"MIT"
] | null | null | null |
{
"targets": [
{
"target_name": "<(module_name)",
"sources": [
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_A2NLSF.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_ana_filt_bank_1.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_apply_sine_window.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_array_maxabs.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_autocorr.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_biquad.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_biquad_alt.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_burg_modified.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_bwexpander.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_bwexpander_32.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_CNG.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_code_signs.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_control_audio_bandwidth.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_control_codec_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_corrMatrix_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_create_init_destroy.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_dec_API.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_decode_core.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_decode_frame.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_decode_parameters.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_decode_pitch.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_decode_pulses.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_decoder_set_fs.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_detect_SWB_input.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_div_oabi.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_enc_API.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_encode_frame_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_encode_parameters.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_encode_pulses.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_find_LPC_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_find_LTP_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_find_pitch_lags_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_find_pred_coefs_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_gain_quant.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_HP_variable_cutoff_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_init_encoder_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_inner_prod_aligned.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_interpolate.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_k2a.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_k2a_Q16.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_LBRR_reset.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_lin2log.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_log2lin.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_LP_variable_cutoff.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_LPC_inv_pred_gain.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_LPC_synthesis_filter.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_LPC_synthesis_order16.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_LSF_cos_table.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_LTP_analysis_filter_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_LTP_scale_ctrl_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_MA.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_NLSF2A.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_NLSF2A_stable.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_NLSF_MSVQ_decode.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_NLSF_MSVQ_encode_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_NLSF_stabilize.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_NLSF_VQ_rate_distortion_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_NLSF_VQ_sum_error_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_NLSF_VQ_weights_laroia.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_noise_shape_analysis_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_NSQ.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_NSQ_del_dec.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_pitch_analysis_core.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_pitch_est_tables.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_PLC.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_prefilter_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_process_gains_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_process_NLSFs_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_quant_LTP_gains_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_range_coder.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_regularize_correlations_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_resampler.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_resampler_down2.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_resampler_down2_3.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_resampler_down3.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_resampler_private_AR2.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_resampler_private_ARMA4.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_resampler_private_copy.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_resampler_private_down4.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_resampler_private_down_FIR.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_resampler_private_IIR_FIR.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_resampler_private_up2_HQ.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_resampler_private_up4.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_resampler_rom.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_resampler_up2.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_residual_energy16_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_residual_energy_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_scale_copy_vector16.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_scale_vector.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_schur.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_schur64.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_shell_coder.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_sigm_Q15.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_solve_LS_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_sort.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_sum_sqr_shift.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_tables_gain.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_tables_LTP.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_tables_NLSF_CB0_10.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_tables_NLSF_CB0_16.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_tables_NLSF_CB1_10.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_tables_NLSF_CB1_16.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_tables_other.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_tables_pitch_lag.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_tables_pulses_per_block.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_tables_sign.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_tables_type_offset.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_VAD.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_VQ_nearest_neighbor_FIX.c",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/SKP_Silk_warped_autocorrelation_FIX.c",
"libSilkCodec/src/decoder.c",
"libSilkCodec/src/encoder.c",
"src/codec.c"
],
"cflags": [ "-Wno-unused-variable", "-Wno-unused-but-set-variable" ],
"include_dirs": [
"<!(node -e \"require('nan')\")",
"libSilkCodec/src/include/",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/interface/",
"libSilkCodec/silk/src/SILK_SDK_SRC_ARM_v1.0.9/src/",
],
"conditions:": [
["OS=='win'", {"libraries": ["-lnode-silk.lib"] }],
["OS=='linux'", {"libraries": ["-lnode-silk.lib"] }]
]
},
{
"target_name": "action_after_build",
"type": "none",
"dependencies": [ "<(module_name)" ],
"copies": [
{
"files": [ "<(PRODUCT_DIR)/<(module_name).node" ],
"destination": "<(module_path)"
}
]
}
]
}
| 73.486111
| 99
| 0.746267
| 1,914
| 10,582
| 3.680773
| 0.103971
| 0.254365
| 0.302058
| 0.365649
| 0.843861
| 0.843861
| 0.843861
| 0.843861
| 0.843861
| 0.843861
| 0
| 0.040773
| 0.119259
| 10,582
| 144
| 100
| 73.486111
| 0.715129
| 0
| 0
| 0.013889
| 0
| 0
| 0.835585
| 0.808939
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
|
0
| 12
|
9bdc3002a3f3256fed4a83ff3defc2f5153a5fff
| 92
|
py
|
Python
|
mean.py
|
orbeckst/mean_calculator
|
f3e3f076136eb852f8b05a8a97c6e1c8f8198af4
|
[
"MIT"
] | null | null | null |
mean.py
|
orbeckst/mean_calculator
|
f3e3f076136eb852f8b05a8a97c6e1c8f8198af4
|
[
"MIT"
] | null | null | null |
mean.py
|
orbeckst/mean_calculator
|
f3e3f076136eb852f8b05a8a97c6e1c8f8198af4
|
[
"MIT"
] | null | null | null |
from __future__ import division
def mean(num_list):
return sum(num_list)/len(num_list)
| 18.4
| 38
| 0.771739
| 15
| 92
| 4.266667
| 0.733333
| 0.328125
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.141304
| 92
| 4
| 39
| 23
| 0.810127
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.333333
| false
| 0
| 0.333333
| 0.333333
| 1
| 0
| 1
| 0
| 0
| null | 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 1
| 1
| 0
|
0
| 7
|
9bf0cbf7093fa05857aebe092568a1005a538525
| 3,270
|
py
|
Python
|
tests/components/ozw/test_fan.py
|
MTrab/core
|
14b5847da8b08acd70388f05e128f08c8110c1b4
|
[
"Apache-2.0"
] | null | null | null |
tests/components/ozw/test_fan.py
|
MTrab/core
|
14b5847da8b08acd70388f05e128f08c8110c1b4
|
[
"Apache-2.0"
] | 13
|
2021-12-16T20:49:04.000Z
|
2022-03-31T06:26:43.000Z
|
tests/components/ozw/test_fan.py
|
MTrab/core
|
14b5847da8b08acd70388f05e128f08c8110c1b4
|
[
"Apache-2.0"
] | null | null | null |
"""Test Z-Wave Fans."""
from .common import setup_ozw
async def test_fan(hass, fan_data, fan_msg, sent_messages, caplog):
"""Test fan."""
receive_message = await setup_ozw(hass, fixture=fan_data)
# Test loaded
state = hass.states.get("fan.in_wall_smart_fan_control_level")
assert state is not None
assert state.state == "on"
# Test turning off
await hass.services.async_call(
"fan",
"turn_off",
{"entity_id": "fan.in_wall_smart_fan_control_level"},
blocking=True,
)
assert len(sent_messages) == 1
msg = sent_messages[-1]
assert msg["topic"] == "OpenZWave/1/command/setvalue/"
assert msg["payload"] == {"Value": 0, "ValueIDKey": 172589073}
# Feedback on state
fan_msg.decode()
fan_msg.payload["Value"] = 0
fan_msg.encode()
receive_message(fan_msg)
await hass.async_block_till_done()
state = hass.states.get("fan.in_wall_smart_fan_control_level")
assert state is not None
assert state.state == "off"
# Test turning on
await hass.services.async_call(
"fan",
"turn_on",
{"entity_id": "fan.in_wall_smart_fan_control_level", "percentage": 66},
blocking=True,
)
assert len(sent_messages) == 2
msg = sent_messages[-1]
assert msg["topic"] == "OpenZWave/1/command/setvalue/"
assert msg["payload"] == {
"Value": 66,
"ValueIDKey": 172589073,
}
# Feedback on state
fan_msg.decode()
fan_msg.payload["Value"] = 66
fan_msg.encode()
receive_message(fan_msg)
await hass.async_block_till_done()
state = hass.states.get("fan.in_wall_smart_fan_control_level")
assert state is not None
assert state.state == "on"
assert state.attributes["percentage"] == 66
# Test turn on without speed
await hass.services.async_call(
"fan",
"turn_on",
{"entity_id": "fan.in_wall_smart_fan_control_level"},
blocking=True,
)
assert len(sent_messages) == 3
msg = sent_messages[-1]
assert msg["topic"] == "OpenZWave/1/command/setvalue/"
assert msg["payload"] == {
"Value": 255,
"ValueIDKey": 172589073,
}
# Feedback on state
fan_msg.decode()
fan_msg.payload["Value"] = 99
fan_msg.encode()
receive_message(fan_msg)
await hass.async_block_till_done()
state = hass.states.get("fan.in_wall_smart_fan_control_level")
assert state is not None
assert state.state == "on"
assert state.attributes["percentage"] == 100
# Test set percentage to 0
await hass.services.async_call(
"fan",
"set_percentage",
{"entity_id": "fan.in_wall_smart_fan_control_level", "percentage": 0},
blocking=True,
)
assert len(sent_messages) == 4
msg = sent_messages[-1]
assert msg["topic"] == "OpenZWave/1/command/setvalue/"
assert msg["payload"] == {
"Value": 0,
"ValueIDKey": 172589073,
}
# Feedback on state
fan_msg.decode()
fan_msg.payload["Value"] = 0
fan_msg.encode()
receive_message(fan_msg)
await hass.async_block_till_done()
state = hass.states.get("fan.in_wall_smart_fan_control_level")
assert state is not None
assert state.state == "off"
| 27.024793
| 79
| 0.636391
| 428
| 3,270
| 4.616822
| 0.175234
| 0.051619
| 0.040992
| 0.063765
| 0.870951
| 0.870951
| 0.822874
| 0.806174
| 0.806174
| 0.806174
| 0
| 0.028
| 0.235474
| 3,270
| 120
| 80
| 27.25
| 0.7624
| 0.057187
| 0
| 0.707865
| 0
| 0
| 0.22757
| 0.141126
| 0
| 0
| 0
| 0
| 0.269663
| 1
| 0
| false
| 0
| 0.011236
| 0
| 0.011236
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
5010c39de7a80d732abf87d0474d18f14bae5260
| 10,786
|
py
|
Python
|
tests/plugins/test_sharded_plugin.py
|
cuent/pytorch-lightning
|
b50ad528e69618d831aa01ee69f29b4f2a6a3e84
|
[
"Apache-2.0"
] | 2
|
2021-06-24T11:46:53.000Z
|
2021-06-24T13:29:50.000Z
|
tests/plugins/test_sharded_plugin.py
|
cuent/pytorch-lightning
|
b50ad528e69618d831aa01ee69f29b4f2a6a3e84
|
[
"Apache-2.0"
] | null | null | null |
tests/plugins/test_sharded_plugin.py
|
cuent/pytorch-lightning
|
b50ad528e69618d831aa01ee69f29b4f2a6a3e84
|
[
"Apache-2.0"
] | 1
|
2022-03-21T18:37:54.000Z
|
2022-03-21T18:37:54.000Z
|
import os
import platform
from unittest import mock
import pytest
import torch
from pytorch_lightning import Trainer
from pytorch_lightning.callbacks import Callback
from pytorch_lightning.plugins.sharded_native_amp_plugin import ShardedNativeAMPPlugin
from pytorch_lightning.plugins.sharded_plugin import DDPShardedPlugin, FAIRSCALE_AVAILABLE
from pytorch_lightning.utilities import NATIVE_AMP_AVAILABLE, APEX_AVAILABLE
from pytorch_lightning.utilities.exceptions import MisconfigurationException
from tests.base.boring_model import BoringModel
@mock.patch.dict(
os.environ,
{
"CUDA_VISIBLE_DEVICES": "0,1",
"SLURM_NTASKS": "2",
"SLURM_JOB_NAME": "SOME_NAME",
"SLURM_NODEID": "0",
"LOCAL_RANK": "0",
"SLURM_LOCALID": "0",
},
)
@mock.patch("torch.cuda.device_count", return_value=2)
@pytest.mark.parametrize(
["ddp_backend", "gpus", "num_processes"],
[("ddp_cpu", None, None), ("ddp", 2, 0), ("ddp2", 2, 0), ("ddp_spawn", 2, 0)],
)
@pytest.mark.skipif(not FAIRSCALE_AVAILABLE, reason="Fairscale is not available")
def test_ddp_choice_sharded(tmpdir, ddp_backend, gpus, num_processes):
"""
Test to ensure that plugin is correctly chosen
"""
class CB(Callback):
def on_fit_start(self, trainer, pl_module):
assert isinstance(trainer.accelerator_backend.ddp_plugin, DDPShardedPlugin)
raise SystemExit()
model = BoringModel()
trainer = Trainer(
fast_dev_run=True,
gpus=gpus,
num_processes=num_processes,
distributed_backend=ddp_backend,
plugins=[DDPShardedPlugin()],
callbacks=[CB()],
)
with pytest.raises(SystemExit):
trainer.fit(model)
@pytest.mark.skipif(not APEX_AVAILABLE, reason="test requires apex")
@pytest.mark.skipif(not FAIRSCALE_AVAILABLE, reason="Fairscale is not available")
def test_invalid_apex_sharded(tmpdir):
"""
Test to ensure that we raise an error when we try to use apex and sharded
"""
model = BoringModel()
with pytest.raises(MisconfigurationException, match='Sharded Plugin is not supported with Apex AMP'):
trainer = Trainer(
fast_dev_run=True,
distributed_backend='ddp_spawn',
plugins=[DDPShardedPlugin()],
precision=16,
amp_backend='apex'
)
trainer.fit(model)
@mock.patch.dict(
os.environ,
{
"CUDA_VISIBLE_DEVICES": "0,1",
"SLURM_NTASKS": "2",
"SLURM_JOB_NAME": "SOME_NAME",
"SLURM_NODEID": "0",
"LOCAL_RANK": "0",
"SLURM_LOCALID": "0",
},
)
@mock.patch("torch.cuda.device_count", return_value=2)
@pytest.mark.parametrize(
["ddp_backend", "gpus", "num_processes"],
[("ddp_cpu", None, None), ("ddp", 2, 0), ("ddp2", 2, 0), ("ddp_spawn", 2, 0)],
)
@pytest.mark.skipif(not FAIRSCALE_AVAILABLE, reason="Fairscale is not available")
@pytest.mark.skipif(not NATIVE_AMP_AVAILABLE, reason="Requires native AMP")
def test_ddp_choice_sharded_amp(tmpdir, ddp_backend, gpus, num_processes):
"""
Test to ensure that plugin native amp plugin is correctly chosen when using sharded
"""
class CB(Callback):
def on_fit_start(self, trainer, pl_module):
assert isinstance(trainer.accelerator_backend.ddp_plugin, DDPShardedPlugin)
assert isinstance(trainer.precision_connector.backend, ShardedNativeAMPPlugin)
raise SystemExit()
model = BoringModel()
trainer = Trainer(
fast_dev_run=True,
gpus=gpus,
precision=16,
num_processes=num_processes,
distributed_backend=ddp_backend,
plugins=[DDPShardedPlugin()],
callbacks=[CB()],
)
with pytest.raises(SystemExit):
trainer.fit(model)
@pytest.mark.skipif(platform.system() == "Windows",
reason="Distributed training is not supported on Windows")
@pytest.mark.skipif(not FAIRSCALE_AVAILABLE, reason="Fairscale is not available")
def test_ddp_sharded_plugin_checkpoint_cpu(tmpdir):
"""
Test to ensure that checkpoint is saved correctly
"""
model = BoringModel()
trainer = Trainer(
accelerator='ddp_cpu',
plugins=[DDPShardedPlugin()],
fast_dev_run=True,
)
trainer.fit(model)
checkpoint_path = os.path.join(tmpdir, 'model.pt')
trainer.save_checkpoint(checkpoint_path)
saved_model = BoringModel.load_from_checkpoint(checkpoint_path)
# Assert model parameters are identical after loading
for ddp_param, shard_param in zip(model.parameters(), saved_model.parameters()):
assert torch.equal(ddp_param, shard_param)
@pytest.mark.skipif(torch.cuda.device_count() < 2, reason="test requires multi-GPU machine")
@pytest.mark.skipif(platform.system() == "Windows",
reason="Distributed training is not supported on Windows")
@pytest.mark.skipif(not FAIRSCALE_AVAILABLE, reason="Fairscale is not available")
def test_ddp_sharded_plugin_checkpoint_multi_gpu(tmpdir):
"""
Test to ensure that checkpoint is saved correctly when using multiple GPUs
"""
model = BoringModel()
trainer = Trainer(
gpus=2,
accelerator='ddp_spawn',
plugins=[DDPShardedPlugin()],
fast_dev_run=True,
)
trainer.fit(model)
checkpoint_path = os.path.join(tmpdir, 'model.pt')
trainer.save_checkpoint(checkpoint_path)
saved_model = BoringModel.load_from_checkpoint(checkpoint_path)
# Assert model parameters are identical after loading
for ddp_param, shard_param in zip(model.parameters(), saved_model.parameters()):
assert torch.equal(ddp_param, shard_param)
@pytest.mark.skipif(torch.cuda.device_count() < 2, reason="test requires multi-GPU machine")
@pytest.mark.skipif(platform.system() == "Windows",
reason="Distributed training is not supported on Windows")
@pytest.mark.skipif(not FAIRSCALE_AVAILABLE, reason="Fairscale is not available")
def test_ddp_sharded_plugin_finetune(tmpdir):
"""
Test to ensure that we can save and restart training (simulate fine-tuning)
"""
model = BoringModel()
trainer = Trainer(
gpus=2,
accelerator='ddp_spawn',
plugins=[DDPShardedPlugin()],
fast_dev_run=True,
)
trainer.fit(model)
checkpoint_path = os.path.join(tmpdir, 'model.pt')
trainer.save_checkpoint(checkpoint_path)
saved_model = BoringModel.load_from_checkpoint(checkpoint_path)
trainer = Trainer(
fast_dev_run=True,
)
trainer.fit(saved_model)
@pytest.mark.skipif(platform.system() == "Windows",
reason="Distributed training is not supported on Windows")
@pytest.mark.skipif(not FAIRSCALE_AVAILABLE, reason="Fairscale is not available")
def test_ddp_sharded_plugin_resume_from_checkpoint(tmpdir):
"""
Test to ensure that resuming from checkpoint works
"""
model = BoringModel()
trainer = Trainer(
accelerator='ddp_cpu',
plugins=[DDPShardedPlugin()],
fast_dev_run=True,
)
trainer.fit(model)
checkpoint_path = os.path.join(tmpdir, 'model.pt')
trainer.save_checkpoint(checkpoint_path)
model = BoringModel()
trainer = Trainer(
accelerator='ddp_cpu',
plugins=[DDPShardedPlugin()],
fast_dev_run=True,
resume_from_checkpoint=checkpoint_path
)
trainer.fit(model)
@pytest.mark.skip(reason="Not a critical test, skip till drone CI performance improves.")
@pytest.mark.skip(reason="Currently unsupported restarting training on different number of devices.")
@pytest.mark.skipif(torch.cuda.device_count() < 2, reason="test requires multi-GPU machine")
@pytest.mark.skipif(platform.system() == "Windows",
reason="Distributed training is not supported on Windows")
@pytest.mark.skipif(not FAIRSCALE_AVAILABLE, reason="Fairscale is not available")
def test_ddp_sharded_plugin_resume_from_checkpoint_downsize_gpus(tmpdir):
"""
Test to ensure that resuming from checkpoint works when downsizing number of GPUS
"""
model = BoringModel()
trainer = Trainer(
accelerator='ddp_spawn',
plugins=[DDPShardedPlugin()],
fast_dev_run=True,
gpus=2,
)
trainer.fit(model)
checkpoint_path = os.path.join(tmpdir, 'model.pt')
trainer.save_checkpoint(checkpoint_path)
model = BoringModel()
trainer = Trainer(
accelerator='ddp_spawn',
plugins=[DDPShardedPlugin()],
fast_dev_run=True,
gpus=1,
resume_from_checkpoint=checkpoint_path
)
trainer.fit(model)
@pytest.mark.skipif(not torch.cuda.is_available(), reason="requires GPU machine")
@pytest.mark.skipif(platform.system() == "Windows",
reason="Distributed training is not supported on Windows")
@pytest.mark.skipif(not FAIRSCALE_AVAILABLE, reason="Fairscale is not available")
def test_ddp_sharded_plugin_resume_from_checkpoint_gpu_to_cpu(tmpdir):
"""
Test to ensure that resuming from checkpoint works when going from GPUs- > CPU
"""
model = BoringModel()
trainer = Trainer(
accelerator='ddp_spawn',
plugins=[DDPShardedPlugin()],
gpus=1,
fast_dev_run=True
)
trainer.fit(model)
checkpoint_path = os.path.join(tmpdir, 'model.pt')
trainer.save_checkpoint(checkpoint_path)
model = BoringModel()
trainer = Trainer(
plugins=[DDPShardedPlugin()],
accelerator='ddp_cpu',
fast_dev_run=True,
resume_from_checkpoint=checkpoint_path
)
trainer.fit(model)
@pytest.mark.skipif(platform.system() == "Windows",
reason="Distributed training is not supported on Windows")
@pytest.mark.skipif(not FAIRSCALE_AVAILABLE, reason="Fairscale is not available")
def test_ddp_sharded_plugin_test(tmpdir):
"""
Test to ensure we can use test without fit
"""
model = BoringModel()
trainer = Trainer(
accelerator='ddp_cpu',
plugins=[DDPShardedPlugin()],
fast_dev_run=True,
)
trainer.test(model)
@pytest.mark.skipif(torch.cuda.device_count() < 2, reason="test requires multi-GPU machine")
@pytest.mark.skipif(platform.system() == "Windows",
reason="Distributed training is not supported on Windows")
@pytest.mark.skipif(not FAIRSCALE_AVAILABLE, reason="Fairscale is not available")
def test_ddp_sharded_plugin_test_multigpu(tmpdir):
"""
Test to ensure we can use test without fit
"""
model = BoringModel()
trainer = Trainer(
accelerator='ddp_spawn',
gpus=2,
plugins=[DDPShardedPlugin()],
fast_dev_run=True,
)
trainer.test(model)
| 32.197015
| 105
| 0.681346
| 1,266
| 10,786
| 5.616904
| 0.130332
| 0.042188
| 0.058501
| 0.029532
| 0.832091
| 0.805653
| 0.788778
| 0.787231
| 0.787231
| 0.747996
| 0
| 0.00493
| 0.210087
| 10,786
| 334
| 106
| 32.293413
| 0.829695
| 0.074912
| 0
| 0.764463
| 0
| 0
| 0.161564
| 0.00471
| 0
| 0
| 0
| 0
| 0.020661
| 1
| 0.053719
| false
| 0
| 0.049587
| 0
| 0.11157
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
ace3700bb210ecf51613e5fbfc6e5f6188a9dbb6
| 2,530
|
py
|
Python
|
lib/systems/18-crown-6.py
|
pulsar-chem/BPModule
|
f8e64e04fdb01947708f098e833600c459c2ff0e
|
[
"BSD-3-Clause"
] | null | null | null |
lib/systems/18-crown-6.py
|
pulsar-chem/BPModule
|
f8e64e04fdb01947708f098e833600c459c2ff0e
|
[
"BSD-3-Clause"
] | null | null | null |
lib/systems/18-crown-6.py
|
pulsar-chem/BPModule
|
f8e64e04fdb01947708f098e833600c459c2ff0e
|
[
"BSD-3-Clause"
] | null | null | null |
import pulsar as psr
def load_ref_system():
""" Returns 18-crown-6 as found in the IQMol fragment library.
All credit to https://github.com/nutjunkie/IQmol
"""
return psr.make_system("""
C 0.52133 2.98003 -0.69606
C 2.02024 2.69966 -0.72281
O 2.27141 1.31380 -0.56707
C 2.84145 1.03853 0.69606
C 3.34810 -0.39974 0.72281
O 2.27348 -1.31020 0.56707
C 2.32012 -1.94150 -0.69606
C 1.32786 -3.09941 -0.72281
O 0.00208 -2.62400 -0.56707
C -0.52133 -2.98003 0.69606
C -2.02024 -2.69967 0.72281
O -2.27141 -1.31379 0.56707
C -2.84145 -1.03853 -0.69606
C -3.34810 0.39974 -0.72281
O -2.27349 1.31020 -0.56707
C -2.32011 1.94150 0.69606
C -1.32786 3.09941 0.72281
O -0.00207 2.62399 0.56707
H 0.40333 4.07155 -0.89000
H 0.02825 2.38963 -1.49976
H 2.52185 3.34807 0.03529
H 2.42796 3.01062 -1.70808
H 2.08360 1.17035 1.49976
H 3.72773 1.68648 0.89000
H 3.82125 -0.59737 1.70808
H 4.16044 -0.50995 -0.03529
H 3.32440 -2.38506 -0.89000
H 2.05535 -1.21928 -1.49976
H 1.63859 -3.85802 0.03529
H 1.39329 -3.60798 -1.70808
H -0.02825 -2.38963 1.49976
H -0.40333 -4.07155 0.89000
H -2.42796 -3.01062 1.70808
H -2.52185 -3.34807 -0.03529
H -3.72773 -1.68648 -0.89000
H -2.08360 -1.17035 -1.49976
H -4.16044 0.50995 0.03529
H -3.82125 0.59737 -1.70808
H -2.05535 1.21928 1.49976
H -3.32440 2.38506 0.89000
H -1.39329 3.60798 1.70808
H -1.63859 3.85802 -0.03529
""")
| 50.6
| 66
| 0.371146
| 325
| 2,530
| 2.88
| 0.276923
| 0.017094
| 0.044872
| 0.034188
| 0.773504
| 0.773504
| 0.713675
| 0.675214
| 0.316239
| 0.226496
| 0
| 0.657143
| 0.543478
| 2,530
| 49
| 67
| 51.632653
| 0.153247
| 0.042292
| 0
| 0
| 0
| 0
| 0.965044
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.021739
| true
| 0
| 0.021739
| 0
| 0.065217
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
4a039b407da29b5d3a2683bd53ca39820efb97da
| 34,366
|
py
|
Python
|
tests/test_generation.py
|
goibibo/swaggergenerator
|
60aeb44c6e9df874e527a3f34ae77e1c82df4fa9
|
[
"MIT"
] | 1
|
2021-06-07T10:37:52.000Z
|
2021-06-07T10:37:52.000Z
|
tests/test_generation.py
|
goibibo/swaggergenerator
|
60aeb44c6e9df874e527a3f34ae77e1c82df4fa9
|
[
"MIT"
] | null | null | null |
tests/test_generation.py
|
goibibo/swaggergenerator
|
60aeb44c6e9df874e527a3f34ae77e1c82df4fa9
|
[
"MIT"
] | 1
|
2021-06-05T08:26:44.000Z
|
2021-06-05T08:26:44.000Z
|
import pytest
import requests
from swaggergenerator3 import Generator, get_yaml
def test_no_params(httpbin):
generator = Generator()
response = requests.get(httpbin.url + '/get')
generator.provide_example(response.request, response)
response = requests.post(httpbin.url + '/post')
generator.provide_example(response.request, response)
expected = {
'/post': {
'post': {
'responses': {
'200': {
'description': 'TODO',
'schema': {
'additionalProperties': False,
'type': 'object',
'properties': {
'files': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'origin': {
'type': 'string'},
'form': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'url': {
'type': 'string'},
'args': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'headers': {
'additionalProperties': False,
'type': 'object',
'properties': {
'Content-Length': {'type': 'string'},
'Accept-Encoding': {'type': 'string'},
'Connection': {'type': 'string'},
'Accept': {'type': 'string'},
'User-Agent': {'type': 'string'},
'Host': {'type': 'string'}}
},
'json': {'type': 'null'},
'data': {'type': 'string'}}
}
}
},
'parameters': [], 'description': 'TODO'}},
'/get': {
'get': {
'responses': {
'200': {
'description': 'TODO',
'schema': {
'additionalProperties': False, 'type': 'object',
'properties': {
'origin': {'type': 'string'},
'headers': {
'additionalProperties': False,
'type': 'object',
'properties': {
# 'Content-Length': {'type': 'string'},
'Accept-Encoding': {'type': 'string'},
'Connection': {'type': 'string'},
'Accept': {'type': 'string'},
'User-Agent': {'type': 'string'},
'Host': {'type': 'string'}}},
'args': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'url': {'type': 'string'}}}}},
'parameters': [], 'description': 'TODO'}}}
assert generator.generate_paths() == expected
def test_get_params(httpbin):
generator = Generator()
response = requests.get(httpbin.url + '/get', params={'query_key': 'query_val'})
generator.provide_example(response.request, response)
expected = {
'/get': {
'get': {
'responses': {
'200': {
'description': 'TODO',
'schema': {
'additionalProperties': False,
'type': 'object',
'properties': {
'origin': {'type': 'string'},
'headers': {
'additionalProperties': False,
'type': 'object',
'properties': {
# 'Content-Length': {'type': 'string'},
'Accept-Encoding': {'type': 'string'},
'Connection': {'type': 'string'},
'Accept': {'type': 'string'},
'User-Agent': {'type': 'string'},
'Host': {'type': 'string'}}},
'args': {
'additionalProperties': False,
'type': 'object',
'properties': {
'query_key': {
'type': 'string'}}},
'url': {'type': 'string'}}}}
},
'parameters': [
{'required': True, 'type': 'string', 'name': 'query_key',
'in': 'query'}], 'description': 'TODO'}}
}
assert generator.generate_paths() == expected
def test_post_body(httpbin):
generator = Generator()
response = requests.post(httpbin.url + '/post', json={'body_key': {'body_subkey': 'body_val'}})
generator.provide_example(response.request, response)
expected = {
'/post': {
'post': {
'responses': {
'200': {
'description': 'TODO',
'schema': {
'additionalProperties': False,
'type': 'object',
'properties': {
'files': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'origin': {'type': 'string'},
'form': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'url': {'type': 'string'},
'args': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'headers': {
'additionalProperties': False,
'type': 'object',
'properties': {
'Content-Length': {'type': 'string'},
'Accept-Encoding': {'type': 'string'},
'Connection': {'type': 'string'},
'Accept': {'type': 'string'},
'User-Agent': {'type': 'string'},
'Host': {'type': 'string'},
'Content-Type': {'type': 'string'}}},
'json': {
'additionalProperties': False,
'type': 'object',
'properties': {
'body_key': {
'additionalProperties': False,
'type': 'object',
'properties': {
'body_subkey': {
'type': 'string'}}}}
},
'data': {'type': 'string'}}}}},
'parameters': [{'schema': {'additionalProperties': False,
'type': 'object', 'properties': {
'body_key': {'additionalProperties': False,
'type': 'object', 'properties': {
'body_subkey': {'type': 'string'}}}}},
'name': 'body_data', 'in': 'body'}],
'description': 'TODO'}}}
assert generator.generate_paths() == expected
def test_naive_path_params(httpbin):
generator = Generator()
response = requests.get(httpbin.url + '/cache/1')
generator.provide_example(response.request, response)
response = requests.get(httpbin.url + '/cache/2')
generator.provide_example(response.request, response)
expected = {
'/cache/{param1}': {
'get': {
'responses': {
'200': {
'description': 'TODO',
'schema': {
'additionalProperties': False,
'type': 'object',
'properties': {'origin': {
'type': 'string'},
'headers': {
'additionalProperties': False,
'type': 'object',
'properties': {
# 'Content-Length': {'type': 'string'},
'Accept-Encoding': {'type': 'string'},
'Connection': {'type': 'string'},
'Accept': {'type': 'string'},
'User-Agent': {'type': 'string'},
'Host': {'type': 'string'}}},
'args': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'url': {'type': 'string'}}}
}
},
'parameters': [{'required': True, 'type': 'string',
'name': 'param1', 'in': 'path'}],
'description': 'TODO'}}}
assert generator.generate_paths() == expected
def test_component_length_mismatch(httpbin):
generator = Generator()
response = requests.get(httpbin.url + '/get')
generator.provide_example(response.request, response)
response = requests.get(httpbin.url + '/cache/2')
generator.provide_example(response.request, response)
expected = {
'/get': {
'get': {
'responses': {
'200': {
'description': 'TODO',
'schema': {
'additionalProperties': False,
'type': 'object',
'properties': {
'origin': {'type': 'string'},
'headers': {
'additionalProperties': False,
'type': 'object',
'properties': {
# 'Content-Length': {'type': 'string'},
'Accept-Encoding': {'type': 'string'},
'Connection': {'type': 'string'},
'Accept': {'type': 'string'},
'User-Agent': {'type': 'string'},
'Host': {'type': 'string'}}},
'args': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'url': {
'type': 'string'}}}}
},
'parameters': [],
'description': 'TODO'}
},
'/cache/{param1}': {
'get': {
'responses': {
'200': {
'description': 'TODO',
'schema': {
'additionalProperties': False,
'type': 'object',
'properties': {
'origin': {'type': 'string'},
'headers': {
'additionalProperties': False,
'type': 'object',
'properties': {
# 'Content-Length': {'type': 'string'},
'Accept-Encoding': {'type': 'string'},
'Connection': {'type': 'string'},
'Accept': {'type': 'string'},
'User-Agent': {'type': 'string'},
'Host': {'type': 'string'}}
},
'args': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'url': {'type': 'string'}}}
}
},
'parameters': [{
'required': True, 'type': 'string', 'name': 'param1', 'in': 'path'
}],
'description': 'TODO'}}}
assert generator.generate_paths() == expected
def test_non_naive_path_params(httpbin):
generator = Generator()
response = requests.get(httpbin.url + '/basic-auth/1/pass', auth=('1', 'pass'))
generator.provide_example(response.request, response)
response = requests.get(httpbin.url + '/basic-auth/user/pass', auth=('user', 'pass'))
generator.provide_example(response.request, response)
expected = {
'/basic-auth/{param1}/pass': {
'get': {
'responses': {
'200': {
'description': 'TODO',
'schema': {
'additionalProperties': False,
'type': 'object',
'properties': {
'authenticated': {'type': 'boolean'},
'user': {'type': 'string'}}}}},
'parameters': [
{'required': True, 'type': 'string',
'name': 'param1', 'in': 'path'}],
'description': 'TODO'}}}
assert generator.generate_paths() == expected
def test_custom_path_params(httpbin):
class CustomGenerator(Generator):
def is_param(self, e, path):
return e in {'user1', 'user2'} or super(CustomGenerator, self).is_param(e, path)
generator = CustomGenerator()
response = requests.get(httpbin.url + '/basic-auth/user1/pass', auth=('user1', 'pass'))
generator.provide_example(response.request, response)
response = requests.get(httpbin.url + '/basic-auth/user2/pass', auth=('user2', 'pass'))
generator.provide_example(response.request, response)
expected = {
'/basic-auth/{param1}/pass': {
'get': {
'responses': {
'200': {
'description': 'TODO',
'schema': {
'additionalProperties': False,
'type': 'object',
'properties': {
'authenticated': {'type': 'boolean'},
'user': {'type': 'string'}}}}},
'parameters': [
{'required': True, 'type': 'string',
'name': 'param1', 'in': 'path'}],
'description': 'TODO'}}}
assert generator.generate_paths() == expected
def test_base_path(httpbin):
generator = Generator(base_path='/cache')
response = requests.get(httpbin.url + '/cache/1')
generator.provide_example(response.request, response)
response = requests.get(httpbin.url + '/cache/2')
generator.provide_example(response.request, response)
expected = {
'/{param1}': {
'get': {
'responses': {
'200': {
'description': 'TODO',
'schema': {
'additionalProperties': False, 'type': 'object',
'properties': {
'origin': {'type': 'string'},
'headers': {
'additionalProperties': False, 'type': 'object',
'properties': {
# 'Content-Length': {'type': 'string'},
'Accept-Encoding': {'type': 'string'},
'Connection': {'type': 'string'},
'Accept': {'type': 'string'},
'User-Agent': {'type': 'string'},
'Host': {'type': 'string'}}
},
'args': {
'additionalProperties': False, 'type': 'object',
'properties': {}}, 'url': {'type': 'string'}
}}}
},
'parameters': [
{
'required': True, 'type': 'string', 'name': 'param1',
'in': 'path'}],
'description': 'TODO'}}}
assert generator.generate_paths() == expected
def test_param_blacklist(httpbin):
generator = Generator(query_key_blacklist={'token'})
response = requests.get(httpbin.url + '/get', params={'token': '123'})
generator.provide_example(response.request, response)
expected = {
'/get': {
'get': {
'responses': {
'200': {
'description': 'TODO',
'schema': {'additionalProperties': False,
'type': 'object',
'properties': {'origin': {
'type': 'string'},
'headers': {
'additionalProperties': False,
'type': 'object',
'properties': {
# 'Content-Length': {'type': 'string'},
'Accept-Encoding': {'type': 'string'},
'Connection': {'type': 'string'},
'Accept': {'type': 'string'},
'User-Agent': {'type': 'string'},
'Host': {'type': 'string'}}},
'args': {
'additionalProperties': False,
'type': 'object',
'properties': {'token': {'type': 'string'}}
},
'url': {'type': 'string'}}}}
},
'parameters': [], 'description': 'TODO'}}}
assert generator.generate_paths() == expected
def test_definition_matching(httpbin):
existing_schema = {
'definitions': {
'Person': {
'type': 'object',
'properties': {
'name': {
'type': 'string',
},
'id': {
'type': 'integer',
}
}
}
}
}
generator = Generator(existing_schema=existing_schema)
response = requests.post(httpbin.url + '/post',
json=[{'name': 'foo', 'id': 1}, {'name': 'bar', 'id': 2}])
generator.provide_example(response.request, response)
expected = {
'/post': {
'post': {
'responses': {
'200': {
'description': 'TODO',
'schema': {'$ref': '#/definitions/Person'}}
},
'parameters': [
{
'schema': {
'items': {
'$ref': '#/definitions/Person'
},
'type': 'array'},
'name': 'body_data', 'in': 'body'}], 'description': 'TODO'}}}
assert generator.generate_paths() == expected
def test_subdefinition_matching(httpbin):
existing_schema = {
'definitions': {
'Person': {
'type': 'object',
'additionalProperties': False,
'properties': {
'name': {
'$ref': '#/definitions/Name',
}
},
},
'Name': {
'type': 'object',
'additionalProperties': False,
'properties': {
'first': {
type: 'string',
},
'last': {
type: 'string',
},
}
}
}
}
generator = Generator(existing_schema=existing_schema)
response = requests.post(httpbin.url + '/post', json={'name': {'first': 'foo', 'last': 'bar'}})
generator.provide_example(response.request, response)
expected = {
'/post': {
'post': {
'responses': {
'200': {
'description': 'TODO',
'schema': {'additionalProperties': False,
'type': 'object',
'properties': {
'files': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'origin': {'type': 'string'},
'form': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'url': {'type': 'string'},
'args': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'headers': {
'additionalProperties': False,
'type': 'object',
'properties': {
'Content-Length': {'type': 'string'},
'Accept-Encoding': {'type': 'string'},
'Connection': {'type': 'string'},
'Accept': {'type': 'string'},
'User-Agent': {'type': 'string'},
'Host': {'type': 'string'},
'Content-Type': {'type': 'string'}}},
'json': {
'$ref': '#/definitions/Person'},
'data': {
'type': 'string'}}}}},
'parameters': [{'schema': {'$ref': '#/definitions/Person'},
'name': 'body_data', 'in': 'body'}],
'description': 'TODO'}}}
assert generator.generate_paths() == expected
def test_empty_array_with_valid_examples(httpbin):
generator = Generator()
response = requests.post(httpbin.url + '/post', json=[])
generator.provide_example(response.request, response)
response = requests.post(httpbin.url + '/post', json=[1, 2, 3])
generator.provide_example(response.request, response)
expected = {
'/post': {
'post': {
'responses': {
'200': {
'description': 'TODO',
'schema': {
'additionalProperties': False,
'type': 'object',
'properties': {
'files': {
'additionalProperties': False,
'type': 'object',
'properties': {}
},
'origin': {'type': 'string'},
'form': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'url': {'type': 'string'},
'args': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'headers': {
'additionalProperties': False,
'type': 'object',
'properties': {
'Content-Length': {'type': 'string'},
'Accept-Encoding': {'type': 'string'},
'Connection': {'type': 'string'},
'Accept': {'type': 'string'},
'User-Agent': {'type': 'string'},
'Host': {'type': 'string'},
'Content-Type': {'type': 'string'}}},
'json': {
'items': {'type': 'number'},
'type': 'array'
},
'data': {'type': 'string'}}}}
},
'parameters': [
{'schema': {'items': {'type': 'number'}, 'type': 'array'},
'name': 'body_data', 'in': 'body'}],
'description': 'TODO'}}}
assert generator.generate_paths() == expected
def test_empty_array_alone_ignored(httpbin):
generator = Generator()
response = requests.post(httpbin.url + '/post', json=[])
generator.provide_example(response.request, response)
expected = {'/post': {'post': {'responses': {}, 'parameters': [], 'description': 'TODO'}}}
assert generator.generate_paths() == expected
def test_known_paths_ignored(httpbin):
existing_schema = {
'paths': {
'/get': {
'get': {}
}
}
}
generator = Generator(existing_schema=existing_schema)
response = requests.get(httpbin.url + '/get')
generator.provide_example(response.request, response)
expected = {}
assert generator.generate_paths() == expected
def test_example_str(httpbin):
generator = Generator()
response = requests.get(httpbin.url + '/get')
generator.provide_example(response.request, response)
assert str(generator.path_to_examples['/get'][0]) == "'get /get -> 200'"
def test_get_yaml(httpbin):
generator = Generator()
response = requests.post(httpbin.url + '/post', json=[])
generator.provide_example(response.request, response)
expected = {'/post': {'post': {'responses': {}, 'parameters': [], 'description': 'TODO'}}}
schemas = generator.generate_paths()
assert schemas == expected
expected_yaml = """ /post:
post:
description: TODO
parameters: []
responses: {}
"""
assert get_yaml(schemas) == expected_yaml
def test_provided_default(httpbin):
generator = Generator(
default={'description': 'unexpected error', 'schema': {'$ref': '#/definitions/Error'}})
response = requests.post(httpbin.url + '/get', json=[])
generator.provide_example(response.request, response)
expected = {'/get': {'post': {'responses': {
'default': {'description': 'unexpected error',
'schema': {'$ref': '#/definitions/Error'}}},
'description': 'TODO'}}}
assert generator.generate_paths() == expected
def test_optional_field_nonempty_example(httpbin):
generator = Generator()
response = requests.post(httpbin.url + '/post', json={'parent': {'other': True}})
generator.provide_example(response.request, response)
response = requests.post(httpbin.url + '/post',
json={'parent': {'optional': True, 'other': True}})
generator.provide_example(response.request, response)
expected = {
'/post': {
'post': {
'responses': {
'200': {
'description': 'TODO',
'schema': {
'additionalProperties': False,
'type': 'object',
'properties': {'files': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'origin': {
'type': 'string'},
'form': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'url': {
'type': 'string'},
'args': {
'additionalProperties': False,
'type': 'object',
'properties': {}},
'headers': {
'additionalProperties': False,
'type': 'object',
'properties': {
'Content-Length': {'type': 'string'},
'Accept-Encoding': {'type': 'string'},
'Connection': {'type': 'string'},
'Accept': {'type': 'string'},
'User-Agent': {'type': 'string'},
'Host': {'type': 'string'},
'Content-Type': {'type': 'string'}}},
'json': {
'additionalProperties': False,
'type': 'object',
'properties': {
'parent': {
'additionalProperties': False,
'type': 'object',
'properties': {
'other': {'type': 'boolean'},
'optional': {'type': 'boolean'}}
}
}
},
'data': {
'type': 'string'
}}}}},
'parameters': [
{
'schema': {
'additionalProperties': False,
'type': 'object',
'properties': {
'parent': {
'additionalProperties': False,
'type': 'object',
'properties': {
'other': {'type': 'boolean'},
'optional': {'type': 'boolean'}}}}
},
'name': 'body_data', 'in': 'body'}],
'description': 'TODO'}}}
assert generator.generate_paths() == expected
if __name__ == '__main__':
pytest.main()
| 45.337731
| 99
| 0.33312
| 1,772
| 34,366
| 6.383747
| 0.072799
| 0.106082
| 0.100778
| 0.173267
| 0.895951
| 0.874381
| 0.872613
| 0.86006
| 0.827175
| 0.812588
| 0
| 0.005065
| 0.534656
| 34,366
| 757
| 100
| 45.397622
| 0.702289
| 0.007711
| 0
| 0.765051
| 0
| 0
| 0.204059
| 0.003373
| 0
| 0
| 0
| 0
| 0.0279
| 1
| 0.0279
| false
| 0.008811
| 0.004405
| 0.001468
| 0.035242
| 0
| 0
| 0
| 0
| null | 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 9
|
c59b9d4967d9f685644498c2762ce50d2d1971f4
| 138
|
py
|
Python
|
restapi/src/api/__init__.py
|
Nyoton/MovieApp
|
48f703f23be544248d9de0004d12fa3c1db0aa42
|
[
"MIT"
] | null | null | null |
restapi/src/api/__init__.py
|
Nyoton/MovieApp
|
48f703f23be544248d9de0004d12fa3c1db0aa42
|
[
"MIT"
] | null | null | null |
restapi/src/api/__init__.py
|
Nyoton/MovieApp
|
48f703f23be544248d9de0004d12fa3c1db0aa42
|
[
"MIT"
] | null | null | null |
from src.api.Api import Api
from src.api.Movies import Movies
from src.api.Categories import Categories
from src.api.Upload import Upload
| 27.6
| 41
| 0.826087
| 24
| 138
| 4.75
| 0.291667
| 0.245614
| 0.350877
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.115942
| 138
| 4
| 42
| 34.5
| 0.934426
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
c5eb18ea2aac8377a7b0ca66d747c5a3251f0f35
| 16,209
|
py
|
Python
|
climateeconomics/tests/utility_tests/_l2_test_gradient_witness_dev.py
|
os-climate/witness-core
|
3ef9a44d86804c5ad57deec3c9916348cb3bfbb8
|
[
"MIT",
"Apache-2.0",
"BSD-3-Clause"
] | 1
|
2022-01-14T06:37:42.000Z
|
2022-01-14T06:37:42.000Z
|
climateeconomics/tests/utility_tests/_l2_test_gradient_witness_dev.py
|
os-climate/witness-core
|
3ef9a44d86804c5ad57deec3c9916348cb3bfbb8
|
[
"MIT",
"Apache-2.0",
"BSD-3-Clause"
] | null | null | null |
climateeconomics/tests/utility_tests/_l2_test_gradient_witness_dev.py
|
os-climate/witness-core
|
3ef9a44d86804c5ad57deec3c9916348cb3bfbb8
|
[
"MIT",
"Apache-2.0",
"BSD-3-Clause"
] | null | null | null |
'''
Copyright 2022 Airbus SAS
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
'''
from os.path import join, dirname, exists
from sos_trades_core.execution_engine.execution_engine import ExecutionEngine
from sos_trades_core.tests.core.abstract_jacobian_unit_test import AbstractJacobianUnittest
from climateeconomics.sos_processes.iam.witness.witness_dev_optim_process.usecase_witness_optim_invest_distrib import Study as witness_usecase
class WitnessDevJacobianDiscTest(AbstractJacobianUnittest):
#AbstractJacobianUnittest.DUMP_JACOBIAN = True
def setUp(self):
self.name = 'Test'
self.ee = ExecutionEngine(self.name)
def analytic_grad_entry(self):
'''
'''
return [
self.test_01_gradient_dev_specific_disciplines,
]
def test_01_gradient_dev_specific_disciplines(self):
'''
Test all the couplings for the disciplines in the "specific_disc" list on the witness_dev process
'''
specific_disciplines = ['Resources.coal_resource', 'Resources.oil_resource',
'Resources.natural_gas_resource',
'Resources.uranium_resource', 'Resources',
'Resources', 'Land.Land_Use', 'Land.Agriculture',
'Population', 'Land.Forest', ]
self.name = 'Test'
self.ee = ExecutionEngine(self.name)
builder = self.ee.factory.get_builder_from_process(
'climateeconomics.sos_processes.iam.witness', 'witness_dev_optim_process')
self.ee.factory.set_builders_to_coupling_builder(builder)
self.ee.configure()
usecase = witness_usecase(
bspline=True, execution_engine=self.ee)
usecase.study_name = self.name
values_dict = usecase.setup_usecase()
full_values_dict = {}
for dict_v in values_dict:
full_values_dict.update(dict_v)
full_values_dict[f'{self.name}.WITNESS_MDO.WITNESS_Eval.tolerance_linear_solver_MDO'] = 1.0e-12
full_values_dict[f'{self.name}.WITNESS_MDO.WITNESS_Eval.linearization_mode'] = 'adjoint'
full_values_dict[f'{self.name}.WITNESS_MDO.WITNESS_Eval.warm_start'] = False
full_values_dict[f'{self.name}.WITNESS_MDO.WITNESS_Eval.tolerance'] = 1.0e-12
full_values_dict[f'{self.name}.WITNESS_MDO.WITNESS_Eval.chain_linearize'] = False
full_values_dict[f'{self.name}.WITNESS_MDO.WITNESS_Eval.sub_mda_class'] = 'MDANewtonRaphson'
full_values_dict[f'{self.name}.WITNESS_MDO.WITNESS_Eval.max_mda_iter'] = 1
self.ee.load_study_from_input_dict(full_values_dict)
for i in range(10):
self.ee = ExecutionEngine(self.name)
builder = self.ee.factory.get_builder_from_process(
'climateeconomics.sos_processes.iam.witness', 'witness_dev_optim_process')
self.ee.factory.set_builders_to_coupling_builder(builder)
self.ee.configure()
full_values_dict[f'{self.name}.max_mda_iter'] = i
self.ee.load_study_from_input_dict(full_values_dict)
self.ee.execute()
for j, disc in enumerate(self.ee.root_process.sos_disciplines):
inputs = disc.get_input_data_names()
inputs = [input for input in inputs if self.ee.dm.get_data(
input, 'coupling') and not input.endswith('resources_price') and not input.endswith('resources_CO2_emissions')]
outputs = disc.get_output_data_names()
outputs = [output for output in outputs if self.ee.dm.get_data(
output, 'coupling')]
print('*************************************************')
print(f'For discipline {disc.name} [{j}], check gradients of:')
print('-------------------------------------------------')
print(f'Inputs:')
print(inputs)
print('-------------------------------------------------')
print(f'Outputs:')
print(outputs)
print('-------------------------------------------------')
disc_underscored_name = disc.name.replace('.', '_')
pkl_name = f'pickle_{disc_underscored_name}_ite{i}.pkl'
filepath = join(dirname(__file__), AbstractJacobianUnittest.PICKLE_DIRECTORY, 'l2_witness_dev',
pkl_name)
if (len(inputs) != 0) and (len(outputs) != 0):
self.ee.dm.delete_complex_in_df_and_arrays()
self.check_jacobian(location=dirname(__file__), filename='l2_witness_dev/' + pkl_name, discipline=disc,
step=1.0e-15, derr_approx='complex_step', threshold=1e-5,
inputs=inputs,
outputs=outputs)
def test_02_gradient_dev_root_process(self):
'''
Test all the couplings for the root coupling discipline on the witness_dev process
'''
self.name = 'Test'
self.ee = ExecutionEngine(self.name)
builder = self.ee.factory.get_builder_from_process(
'climateeconomics.sos_processes.iam.witness', 'witness_v1')
self.ee.factory.set_builders_to_coupling_builder(builder)
self.ee.configure()
usecase = witness_usecase(
bspline=True, execution_engine=self.ee)
usecase.study_name = self.name
values_dict = usecase.setup_usecase()
full_values_dict = {}
for dict_v in values_dict:
full_values_dict.update(dict_v)
full_values_dict[f'{self.name}.tolerance_linear_solver_MDO'] = 1.0e-12
full_values_dict[f'{self.name}.linearization_mode'] = 'adjoint'
full_values_dict[f'{self.name}.warm_start'] = False
full_values_dict[f'{self.name}.tolerance'] = 1.0e-12
full_values_dict[f'{self.name}.chain_linearize'] = False
full_values_dict[f'{self.name}.sub_mda_class'] = 'MDAGaussSeidel'
full_values_dict[f'{self.name}.max_mda_iter'] = 1
self.ee.load_study_from_input_dict(full_values_dict)
self.ee.execute()
disc = self.ee.root_process
inputs = disc.get_input_data_names()
inputs = [input for input in inputs if self.ee.dm.get_data(
input, 'coupling') and not input.endswith('resources_price') and not input.endswith('resources_CO2_emissions')]
outputs = disc.get_output_data_names()
outputs = [output for output in outputs if self.ee.dm.get_data(
output, 'coupling')]
print('*************************************************')
print(f'For discipline {disc.name}, check gradients of:')
print('-------------------------------------------------')
print(f'Inputs:')
print(inputs)
print('-------------------------------------------------')
print(f'Outputs:')
print(outputs)
print('-------------------------------------------------')
disc_underscored_name = disc.name.replace('.', '_')
pkl_name = f'pickle_{disc_underscored_name}.pkl'
filepath = join(dirname(__file__), AbstractJacobianUnittest.PICKLE_DIRECTORY, 'l2_witness_dev',
pkl_name)
if (len(inputs) != 0) and (len(outputs) != 0):
self.ee.dm.delete_complex_in_df_and_arrays()
self.check_jacobian(location=dirname(__file__), filename='l2_witness_dev/' + pkl_name, discipline=disc,
step=1.0e-15, derr_approx='complex_step', threshold=1e-5,
inputs=inputs,
outputs=outputs)
def test_05_gradient_lagrangian_objective_wrt_csv_design_var_on_witness_full_subprocess_each_step(self):
'''
Test on the witness full MDA + design var to get bspline with func manager
we can test only lagrangian objective vs design var
Need to checkout to gems_without_cache in gems repository
'''
self.name = 'Test'
self.ee = ExecutionEngine(self.name)
builder = self.ee.factory.get_builder_from_process(
'climateeconomics.sos_processes.iam.witness', 'witness_v1')
self.ee.factory.set_builders_to_coupling_builder(builder)
self.ee.configure()
usecase = witness_usecase(
bspline=True, execution_engine=self.ee)
usecase.study_name = self.name
values_dict = usecase.setup_usecase()
full_values_dict = {}
for dict_v in values_dict:
full_values_dict.update(dict_v)
full_values_dict[f'{self.name}.tolerance_linear_solver_MDO'] = 1.0e-12
full_values_dict[f'{self.name}.linearization_mode'] = 'adjoint'
full_values_dict[f'{self.name}.warm_start'] = False
full_values_dict[f'{self.name}.tolerance'] = 1.0e-12
full_values_dict[f'{self.name}.chain_linearize'] = False
full_values_dict[f'{self.name}.sub_mda_class'] = 'MDAGaussSeidel'
full_values_dict[f'{self.name}.max_mda_iter'] = 1
self.ee.load_study_from_input_dict(full_values_dict)
disc = self.ee.root_process.sos_disciplines[0]
values_dict_design_var = {}
# df_xvect = pd.read_csv(
# join(dirname(__file__), 'data', 'design_space_last_ite_crash.csv'))
# for i, row in df_xvect.iterrows():
# try:
# ns_var = self.ee.dm.get_all_namespaces_from_var_name(
# row['variable'])[0]
# values_dict_design_var[ns_var] = np.asarray(
# row['value'][1:-1].split(', '), dtype=float)
# except:
# pass
# dspace_df = df_xvect
# self.ee.load_study_from_input_dict(values_dict_design_var)
self.ee.execute()
i = 0
for disc in self.ee.root_process.sos_disciplines:
# disc = self.ee.dm.get_disciplines_with_name(
# f'{self.name}.{usecase.coupling_name}.WITNESS.EnergyMix')[0]
outputs = disc.get_output_data_names()
outputs = [output for output in outputs if self.ee.dm.get_data(output, 'coupling')
and not output.endswith('all_streams_demand_ratio')]
if disc.name == 'FunctionsManager':
outputs.append(self.ee.dm.get_all_namespaces_from_var_name(
'objective_lagrangian')[0])
inputs = disc.get_input_data_names()
inputs = [input for input in inputs if self.ee.dm.get_data(input, 'coupling')
and not input.endswith('resources_price')
and not input.endswith('resources_CO2_emissions')
and not input.endswith('all_streams_demand_ratio')]
print(disc.name)
print(i)
if i in [0, 1, 2, 3, 4, 5, 6, 11, 81, 82, 83]:
print(inputs)
print(outputs)
pkl_name = f'jacobian_lagrangian_objective_wrt_design_var_on_witness_dev_{i}.pkl'
filepath = join(dirname(__file__), AbstractJacobianUnittest.PICKLE_DIRECTORY, 'l2_witness_dev',
pkl_name)
if len(inputs) != 0:
if not exists(filepath):
self.ee.dm.delete_complex_in_df_and_arrays()
AbstractJacobianUnittest.DUMP_JACOBIAN = True
self.check_jacobian(location=dirname(__file__), filename=pkl_name, discipline=disc,
step=1.0e-15, derr_approx='complex_step', threshold=1e-5,
inputs=inputs,
outputs=outputs) # , filepath=filepath)
else:
AbstractJacobianUnittest.DUMP_JACOBIAN = False
self.check_jacobian(location=dirname(__file__), filename=pkl_name, discipline=disc,
step=1.0e-15, derr_approx='complex_step', threshold=1e-5,
inputs=inputs,
outputs=outputs) # , filepath=filepath)
i += 1
def test_06_gradient_each_discipline_on_dm_pkl(self):
'''
Test on the witness full MDA + design var to get bspline with func manager
we can test only lagrangian objective vs design var
'''
self.name = 'Test'
self.ee = ExecutionEngine(self.name)
builder = self.ee.factory.get_builder_from_process(
'climateeconomics.sos_processes.iam.witness', 'witness_v1')
self.ee.factory.set_builders_to_coupling_builder(builder)
self.ee.configure()
# pkl_dict = pd.read_pickle(
# join(dirname(__file__), 'data', 'dm_3_ite.pkl'))
# inp_dict = {key.replace('<study_ph>.WITNESS_MDO',
# self.name): value for key, value in pkl_dict.items()}
# self.ee.load_study_from_dict(inp_dict)
i = 0
for disc in self.ee.root_process.sos_disciplines[0].sos_disciplines:
# disc = self.ee.dm.get_disciplines_with_name(
# f'{self.name}.{usecase.coupling_name}.WITNESS.EnergyMix')[0]
outputs = disc.get_output_data_names()
outputs = [output for output in outputs if self.ee.dm.get_data(
output, 'coupling')]
if disc.name == 'FunctionsManager':
outputs.append(self.ee.dm.get_all_namespaces_from_var_name(
'objective_lagrangian')[0])
inputs = disc.get_input_data_names()
inputs = [input for input in inputs if self.ee.dm.get_data(
input, 'coupling') and not input.endswith('resources_price') and not input.endswith('resources_CO2_emissions')]
print(disc.name)
print(i)
if i not in [6, 27, 53, 58, 62]:
print(inputs)
print(outputs)
pkl_name = f'jacobian_lagrangian_objective_wrt_design_var_on_witness_full_withx0_ite3nR_{i}.pkl'
filepath = join(dirname(__file__), AbstractJacobianUnittest.PICKLE_DIRECTORY, 'l2_witness_dev',
pkl_name)
if len(inputs) != 0:
if not exists(filepath):
self.ee.dm.delete_complex_in_df_and_arrays()
AbstractJacobianUnittest.DUMP_JACOBIAN = True
self.check_jacobian(location=dirname(__file__), filename=pkl_name, discipline=disc,
step=1.0e-15, derr_approx='complex_step', threshold=1e-5,
inputs=inputs,
outputs=outputs) # , filepath=filepath)
else:
AbstractJacobianUnittest.DUMP_JACOBIAN = False
self.check_jacobian(location=dirname(__file__), filename=pkl_name, discipline=disc,
step=1.0e-15, derr_approx='complex_step', threshold=1e-5,
inputs=inputs,
outputs=outputs) # , filepath=filepath)
i += 1
if '__main__' == __name__:
AbstractJacobianUnittest.DUMP_JACOBIAN = True
cls = WitnessDevJacobianDiscTest()
cls.test_01_gradient_dev_specific_disciplines()
# self.test_02_gradient_dev_root_process()
# self.test_06_gradient_each_discipline_on_dm_pkl()
| 48.385075
| 142
| 0.591338
| 1,852
| 16,209
| 4.868791
| 0.148488
| 0.036598
| 0.049684
| 0.036598
| 0.811024
| 0.787623
| 0.780193
| 0.76389
| 0.735167
| 0.715759
| 0
| 0.012875
| 0.290826
| 16,209
| 334
| 143
| 48.52994
| 0.771553
| 0.135357
| 0
| 0.777293
| 0
| 0
| 0.184792
| 0.13576
| 0
| 0
| 0
| 0
| 0
| 1
| 0.026201
| false
| 0
| 0.017467
| 0
| 0.052402
| 0.113537
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
a88c17ef5eacd4059dbed9a04a518fa8c160a4f6
| 8,045
|
py
|
Python
|
tests/test_neat.py
|
Knowledge-Graph-Hub/NEAT
|
744b8abd6fc08037be349e2e637d891d80100771
|
[
"BSD-3-Clause"
] | 6
|
2020-10-27T15:54:26.000Z
|
2022-02-28T15:41:06.000Z
|
tests/test_neat.py
|
Knowledge-Graph-Hub/NEAT
|
744b8abd6fc08037be349e2e637d891d80100771
|
[
"BSD-3-Clause"
] | 52
|
2020-11-24T18:27:44.000Z
|
2022-03-31T16:20:06.000Z
|
tests/test_neat.py
|
Knowledge-Graph-Hub/NEAT
|
744b8abd6fc08037be349e2e637d891d80100771
|
[
"BSD-3-Clause"
] | 1
|
2021-08-23T06:04:02.000Z
|
2021-08-23T06:04:02.000Z
|
import re
from unittest import TestCase, mock
from click.testing import CliRunner
from neat.cli import run, updateyaml
class TestRun(TestCase):
"""Tests the neat.py script."""
def setUp(self) -> None:
self.runner = CliRunner()
def test_run_no_yaml_file(self):
result = self.runner.invoke(catch_exceptions=False,
cli=run,
args=['--config', 'doesntexist'])
self.assertTrue(re.search('doesntexist', result.output))
self.assertNotEqual(result.exit_code, 0)
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_upload")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_classifier")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_tsne")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_embeddings")
@mock.patch("boto3.client")
@mock.patch("neat.cli.pre_run_checks")
def test_run_do_upload(self,
mock_pre_run_checks,
mock_boto3_client,
mock_do_embeddings, mock_do_tsne, mock_do_classifier,
mock_do_upload):
mock_do_embeddings.return_value = False
mock_do_tsne.return_value = False
mock_do_classifier.return_value = False
mock_do_upload.return_value = True
mock_pre_run_checks.return_value = True
result = self.runner.invoke(catch_exceptions=False,
cli=run,
args=['--config',
'tests/resources/test_neat.yaml'])
self.assertTrue(mock_do_upload.called)
self.assertTrue(mock_boto3_client.called)
self.assertEqual(result.exit_code, 0)
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_upload")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_classifier")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_tsne")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_embeddings")
@mock.patch("neat.graph_embedding.graph_embedding.make_node_embeddings")
@mock.patch("boto3.client")
def test_run_do_embeddings(self,
mock_boto,
mock_make_node_embeddings,
mock_do_embeddings, mock_do_tsne, mock_do_classifier,
mock_do_upload):
mock_do_embeddings.return_value = True
mock_do_tsne.return_value = False
mock_do_classifier.return_value = False
mock_do_upload.return_value = False
result = self.runner.invoke(catch_exceptions=False,
cli=run,
args=['--config',
'tests/resources/test_neat.yaml'])
self.assertEqual(result.exit_code, 0)
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_upload")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_classifier")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_tsne")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_embeddings")
@mock.patch("neat.visualization.visualization.make_tsne")
@mock.patch("boto3.client")
def test_run_do_embeddings(self,
mock_boto,
mock_make_tnse,
mock_do_embeddings, mock_do_tsne, mock_do_classifier,
mock_do_upload):
mock_do_embeddings.return_value = False
mock_do_tsne.return_value = True
mock_do_classifier.return_value = False
mock_do_upload.return_value = False
result = self.runner.invoke(catch_exceptions=False,
cli=run,
args=['--config',
'tests/resources/test_neat.yaml'])
self.assertEqual(result.exit_code, 0)
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_upload")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_classifier")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_tsne")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_embeddings")
@mock.patch("boto3.client")
def test_run_do_classifiers(self,
mock_boto,
mock_do_embeddings, mock_do_tsne, mock_do_classifier,
mock_do_upload):
mock_do_embeddings.return_value = False
mock_do_tsne.return_value = False
mock_do_classifier.return_value = True
mock_do_upload.return_value = False
result = self.runner.invoke(catch_exceptions=False,
cli=run,
args=['--config',
'tests/resources/test_neat.yaml'])
self.assertEqual(result.exit_code, 0)
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_upload")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_classifier")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_tsne")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_embeddings")
@mock.patch("neat.cli.pre_run_checks")
@mock.patch("boto3.client")
def test_run_pre_run_checks(self,
mock_boto,
mock_pre_run_checks,
mock_do_embeddings, mock_do_tsne, mock_do_classifier,
mock_do_upload):
mock_do_embeddings.return_value = False
mock_do_tsne.return_value = False
mock_do_classifier.return_value = False
mock_do_upload.return_value = False
mock_pre_run_checks.return_value = True
result = self.runner.invoke(catch_exceptions=False,
cli=run,
args=['--config',
'tests/resources/test_neat.yaml'])
self.assertTrue(mock_pre_run_checks.called)
self.assertEqual(result.exit_code, 0)
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_upload")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_classifier")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_tsne")
@mock.patch("neat.yaml_helper.yaml_helper.YamlHelper.do_embeddings")
@mock.patch("neat.cli.pre_run_checks")
@mock.patch("boto3.client")
@mock.patch('neat.yaml_helper.yaml_helper.YamlHelper.deal_with_url_node_edge_paths')
def test_run_pre_run_checks(self,
mock_deal_with_url_node_edge_paths,
mock_boto,
mock_pre_run_checks,
mock_do_embeddings, mock_do_tsne, mock_do_classifier,
mock_do_upload):
mock_do_embeddings.return_value = False
mock_do_tsne.return_value = False
mock_do_classifier.return_value = False
mock_do_upload.return_value = False
mock_pre_run_checks.return_value = True
result = self.runner.invoke(catch_exceptions=False,
cli=run,
args=['--config',
'tests/resources/test_neat.yaml'])
self.assertTrue(mock_deal_with_url_node_edge_paths.called)
self.assertEqual(result.exit_code, 0)
@mock.patch("neat.cli.do_update_yaml")
def test_run_pre_run_checks(self,
mock_do_update_yaml):
result = self.runner.invoke(catch_exceptions=False,
cli=updateyaml,
args=['--input_path',
'tests/resources/test_neat.yaml'])
self.assertTrue(mock_do_update_yaml.called)
self.assertEqual(result.exit_code, 0)
| 49.355828
| 88
| 0.597638
| 904
| 8,045
| 4.962389
| 0.085177
| 0.068212
| 0.089835
| 0.094739
| 0.881186
| 0.874053
| 0.868703
| 0.843736
| 0.804949
| 0.789345
| 0
| 0.002892
| 0.312368
| 8,045
| 162
| 89
| 49.660494
| 0.808026
| 0.003108
| 0
| 0.778523
| 0
| 0
| 0.230097
| 0.209883
| 0
| 0
| 0
| 0
| 0.09396
| 1
| 0.060403
| false
| 0
| 0.026846
| 0
| 0.09396
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
a89fcd9828eeb56ccc239df2003f351eb66f5fa9
| 139
|
py
|
Python
|
Codewars/8kyu/miles-per-gallon-to-kilometers-per-liter/Python/test.py
|
RevansChen/online-judge
|
ad1b07fee7bd3c49418becccda904e17505f3018
|
[
"MIT"
] | 7
|
2017-09-20T16:40:39.000Z
|
2021-08-31T18:15:08.000Z
|
Codewars/8kyu/miles-per-gallon-to-kilometers-per-liter/Python/test.py
|
RevansChen/online-judge
|
ad1b07fee7bd3c49418becccda904e17505f3018
|
[
"MIT"
] | null | null | null |
Codewars/8kyu/miles-per-gallon-to-kilometers-per-liter/Python/test.py
|
RevansChen/online-judge
|
ad1b07fee7bd3c49418becccda904e17505f3018
|
[
"MIT"
] | null | null | null |
# Python - 3.6.0
Test.assert_equals(converter(12), 4.25)
Test.assert_equals(converter(24), 8.50)
Test.assert_equals(converter(36), 12.74)
| 23.166667
| 40
| 0.741007
| 25
| 139
| 4
| 0.64
| 0.3
| 0.48
| 0.75
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.148438
| 0.079137
| 139
| 5
| 41
| 27.8
| 0.632813
| 0.100719
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| true
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| null | 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
a8c29bab9d95aec92b5a43f1129fc97fb396b3dc
| 246
|
py
|
Python
|
src/prism-fruit/Games-DQL/examples/games/car/networkx/algorithms/traversal/__init__.py
|
kushgrover/apt-vs-dift
|
250f64e6c442f6018cab65ec6979d9568a842f57
|
[
"MIT"
] | null | null | null |
src/prism-fruit/Games-DQL/examples/games/car/networkx/algorithms/traversal/__init__.py
|
kushgrover/apt-vs-dift
|
250f64e6c442f6018cab65ec6979d9568a842f57
|
[
"MIT"
] | null | null | null |
src/prism-fruit/Games-DQL/examples/games/car/networkx/algorithms/traversal/__init__.py
|
kushgrover/apt-vs-dift
|
250f64e6c442f6018cab65ec6979d9568a842f57
|
[
"MIT"
] | null | null | null |
import networkx.algorithms.traversal.depth_first_search
from networkx.algorithms.traversal.depth_first_search import *
import networkx.algorithms.traversal.breadth_first_search
from networkx.algorithms.traversal.breadth_first_search import *
| 49.2
| 65
| 0.878049
| 30
| 246
| 6.933333
| 0.3
| 0.346154
| 0.519231
| 0.317308
| 0.884615
| 0.884615
| 0
| 0
| 0
| 0
| 0
| 0
| 0.065041
| 246
| 4
| 66
| 61.5
| 0.904348
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 0
| 0
| 0
| null | 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 9
|
a8d7ccc9b09920a6453480f6a824ab5e3854593b
| 92
|
py
|
Python
|
parameters_8005.py
|
jupadhya1/Twitter-Sentimental-Analysis
|
e8c3449cf341ca9dae44ae53e27d5b1ae0d82c5f
|
[
"BSD-3-Clause"
] | null | null | null |
parameters_8005.py
|
jupadhya1/Twitter-Sentimental-Analysis
|
e8c3449cf341ca9dae44ae53e27d5b1ae0d82c5f
|
[
"BSD-3-Clause"
] | null | null | null |
parameters_8005.py
|
jupadhya1/Twitter-Sentimental-Analysis
|
e8c3449cf341ca9dae44ae53e27d5b1ae0d82c5f
|
[
"BSD-3-Clause"
] | null | null | null |
password="pbkdf2(1000,20,sha512)$b365ded41ff51ee0$5849bda7fa66e49cc11dc7effb081b5bf8536ff6"
| 46
| 91
| 0.891304
| 7
| 92
| 11.714286
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.428571
| 0.01087
| 92
| 1
| 92
| 92
| 0.472527
| 0
| 0
| 0
| 0
| 0
| 0.869565
| 0.869565
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 1
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
|
0
| 8
|
76810746e0b92e11918bb38c40ab8bc1c309521f
| 7,329
|
py
|
Python
|
saefportal/saef/forms/dataset_forms.py
|
harry-consulting/SAEF
|
12ef43bbcc3178b8a988e21c1bef035881cf6e6d
|
[
"BSD-2-Clause"
] | 4
|
2020-12-16T13:14:26.000Z
|
2022-03-26T08:54:12.000Z
|
saefportal/saef/forms/dataset_forms.py
|
harry-consulting/SAEF
|
12ef43bbcc3178b8a988e21c1bef035881cf6e6d
|
[
"BSD-2-Clause"
] | 1
|
2022-03-26T09:09:04.000Z
|
2022-03-26T09:09:04.000Z
|
saefportal/saef/forms/dataset_forms.py
|
harry-consulting/SAEF
|
12ef43bbcc3178b8a988e21c1bef035881cf6e6d
|
[
"BSD-2-Clause"
] | 1
|
2020-12-16T13:20:17.000Z
|
2020-12-16T13:20:17.000Z
|
from crispy_forms.helper import FormHelper
from crispy_forms.layout import Submit, Layout, Field
from django import forms
from django.forms import ModelForm
from saef.models import Dataset
class SelectConnectionForm(ModelForm):
def __init__(self, *args, **kwargs):
super().__init__(*args, **kwargs)
self.helper = FormHelper(self)
self.helper.form_id = "select_connection_form"
self.helper.form_method = "post"
self.helper.form_tag = False
self.helper.layout = Layout(
Field("connection", onchange="form.submit();")
)
class Meta:
model = Dataset
fields = ["connection"]
class AddDatasetForm(ModelForm):
def __init__(self, dataset_table_choices, *args, **kwargs):
super().__init__(*args, **kwargs)
self.helper = FormHelper(self)
self.helper.form_id = "id_add_dataset_form"
self.helper.form_name = "add_dataset_form"
self.helper.form_method = "post"
self.helper.layout = Layout(
Field("connection", onchange="form.submit();"),
"job",
"sequence_in_job",
"dataset_name",
"dataset_type",
"query_timeout",
Field("dataset_access_method", onChange="selectRelevant();"),
"dataset_extraction_table",
"dataset_extraction_sql",
Submit("Operation", "Save", css_class="btn-success", onClick="removeRequired();")
)
self.fields["dataset_extraction_table"].choices = dataset_table_choices
dataset_extraction_table = forms.ChoiceField(choices=(), required=False)
dataset_extraction_sql = forms.CharField(label="SQL query (LIMIT 50)", widget=forms.Textarea)
class Meta:
model = Dataset
fields = [
"connection",
"job",
"sequence_in_job",
"dataset_name",
"dataset_type",
"query_timeout",
"dataset_access_method",
"dataset_extraction_table",
"dataset_extraction_sql"
]
class DatasetWithoutSQLForm(ModelForm):
class Meta:
model = Dataset
fields = [
"connection",
"job",
"sequence_in_job",
"dataset_name",
"dataset_type",
"query_timeout",
"dataset_access_method",
"dataset_extraction_table"
]
class DatasetWithoutTableForm(ModelForm):
class Meta:
model = Dataset
fields = [
"connection",
"job",
"sequence_in_job",
"dataset_name",
"dataset_type",
"query_timeout",
"dataset_access_method",
"dataset_extraction_sql"
]
class EditDatasetForm(ModelForm):
def __init__(self, dataset_table_choices, enabled_manage=True, *args, **kwargs):
super().__init__(*args, **kwargs)
self.helper = FormHelper(self)
self.helper.form_id = "edit_dataset_form"
self.helper.form_method = "post"
self.fields["dataset_extraction_table"].choices = dataset_table_choices
main_layout = Layout(
Field("connection", onChange="form.submit();", formnovalidate="formnovalidate"),
"job",
"sequence_in_job",
"dataset_name",
"dataset_type",
"query_timeout",
Field("dataset_access_method", onChange="selectRelevant();"),
Field("dataset_extraction_table"),
Field("dataset_extraction_sql"),
Submit("Operation", "Save", css_class="btn-success", onClick="removeRequired();"),
Submit("Operation", "Delete", css_class="btn-danger", formnovalidate="formnovalidate"),
)
if enabled_manage:
manage_layout = Layout(
Submit("Operation", "Manage Column", css_class="btn-info", formnovalidate="formnovalidate"),
Submit("Operation", "Manage Constraint", css_class="btn-info", formnovalidate="formnovalidate"),
)
else:
manage_layout = Layout()
self.helper.layout = Layout(
main_layout,
manage_layout,
Submit("Operation", "Preview", css_class="btn-info", onClick="removeRequired();")
)
dataset_extraction_table = forms.ChoiceField(choices=(), required=False)
dataset_extraction_sql = forms.CharField(label="SQL query (LIMIT 50)", widget=forms.Textarea)
class Meta:
model = Dataset
fields = [
"connection",
"job",
"sequence_in_job",
"dataset_name",
"dataset_type",
"query_timeout",
"dataset_access_method",
"dataset_extraction_table",
"dataset_extraction_sql"
]
class AddAzureBlobStorageDatasetForm(ModelForm):
def __init__(self, *args, **kwargs):
super().__init__(*args, **kwargs)
self.helper = FormHelper(self)
self.helper.form_id = "id_add_azure_blob_storage_dataset_form"
self.helper.form_name = "add_azure_blob_storage_dataset_form"
self.helper.form_method = "post"
self.helper.layout = Layout(
Field("connection", onchange="form.submit();"),
"job",
"sequence_in_job",
"dataset_name",
"dataset_type",
"query_timeout",
"dataset_extraction_sql",
Submit("Operation", "Save", css_class="btn-success", onClick="return verifyDatasetName();")
)
dataset_extraction_sql = forms.CharField(label="SQL query (LIMIT 50)", widget=forms.Textarea)
class Meta:
model = Dataset
fields = [
"connection",
"job",
"sequence_in_job",
"dataset_name",
"dataset_type",
"query_timeout",
"dataset_extraction_sql"
]
class EditAzureBlobStorageDatasetForm(ModelForm):
def __init__(self, *args, **kwargs):
super().__init__(*args, **kwargs)
self.helper = FormHelper(self)
self.helper.form_id = "edit_azure_blob_storage_dataset_form"
self.helper.form_method = "post"
self.helper.layout = Layout(
Field("connection", onChange="form.submit();", formnovalidate="formnovalidate"),
"job",
"sequence_in_job",
"dataset_name",
"dataset_type",
"query_timeout",
Field("dataset_extraction_sql"),
Submit("Operation", "Save", css_class="btn-success",
onClick="removeRequired(); return verifyDatasetName();"),
Submit("Operation", "Delete", css_class="btn-danger", formnovalidate="formnovalidate"),
Submit("Operation", "Manage Column", css_class="btn-info", formnovalidate="formnovalidate"),
Submit("Operation", "Preview", css_class="btn-info")
)
dataset_extraction_sql = forms.CharField(label="SQL query (LIMIT 50)", widget=forms.Textarea)
class Meta:
model = Dataset
fields = [
"connection",
"job",
"sequence_in_job",
"dataset_name",
"dataset_type",
"query_timeout",
"dataset_extraction_sql"
]
| 34.570755
| 112
| 0.586574
| 679
| 7,329
| 6.019146
| 0.129602
| 0.056276
| 0.044531
| 0.039149
| 0.854906
| 0.853438
| 0.828481
| 0.786151
| 0.76829
| 0.683386
| 0
| 0.001548
| 0.294856
| 7,329
| 211
| 113
| 34.734597
| 0.78928
| 0
| 0
| 0.71123
| 0
| 0
| 0.280802
| 0.085005
| 0
| 0
| 0
| 0
| 0
| 1
| 0.026738
| false
| 0
| 0.026738
| 0
| 0.160428
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
4f9361c79c4577dd19e7ec8c947c261d62eb2107
| 47
|
py
|
Python
|
src/drovirt/connectors/ovirt/__init__.py
|
Storware/drovirt
|
4726b237e2f8940a652e2b773ace0742bb788192
|
[
"MIT"
] | 22
|
2018-10-19T13:40:56.000Z
|
2021-05-11T08:39:37.000Z
|
src/drovirt/connectors/ovirt/__init__.py
|
Storware/drovirt
|
4726b237e2f8940a652e2b773ace0742bb788192
|
[
"MIT"
] | 12
|
2019-02-11T15:07:53.000Z
|
2019-02-11T15:21:33.000Z
|
src/drovirt/connectors/ovirt/__init__.py
|
Storware/drovirt
|
4726b237e2f8940a652e2b773ace0742bb788192
|
[
"MIT"
] | 7
|
2018-12-10T14:17:49.000Z
|
2022-02-03T23:43:51.000Z
|
from . import connection
from . import system
| 11.75
| 24
| 0.765957
| 6
| 47
| 6
| 0.666667
| 0.555556
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.191489
| 47
| 3
| 25
| 15.666667
| 0.947368
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 1
| 0
| null | 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
8c1712e2fac7900f3b39848e2e37a2aeeb918fee
| 8,068
|
py
|
Python
|
2019/18_ManyWorldsInterpretation/test/test_solver.py
|
deanearlwright/AdventOfCode
|
ca4cf6315c0efa38bd7748fb6f4bc99e7934871d
|
[
"MIT"
] | 1
|
2021-01-03T23:09:28.000Z
|
2021-01-03T23:09:28.000Z
|
2019/18_ManyWorldsInterpretation/test/test_solver.py
|
deanearlwright/AdventOfCode
|
ca4cf6315c0efa38bd7748fb6f4bc99e7934871d
|
[
"MIT"
] | 6
|
2020-12-26T21:02:42.000Z
|
2020-12-26T21:02:52.000Z
|
2019/18_ManyWorldsInterpretation/test/test_solver.py
|
deanearlwright/AdventOfCode
|
ca4cf6315c0efa38bd7748fb6f4bc99e7934871d
|
[
"MIT"
] | null | null | null |
# ======================================================================
# Many-Worlds Interpretation
# Advent of Code 2019 Day 18 -- Eric Wastl -- https://adventofcode.com
#
# codeuter simulation by Dr. Dean Earl Wright III
# ======================================================================
# ======================================================================
# t e s t _ s o l v e r . p y
# ======================================================================
"Test key maze solver AoC 2019 day 18, Many-Worlds Interpretation"
# ----------------------------------------------------------------------
# import
# ----------------------------------------------------------------------
import unittest
import solver
import test_vault
from aoc_mw import from_text
# ----------------------------------------------------------------------
# constants
# ----------------------------------------------------------------------
# ======================================================================
# TestSolver
# ======================================================================
class TestSolver(unittest.TestCase): # pylint: disable=R0904
"""Test Asteroids object"""
def test_empty_init(self):
"""Test default Solver object creation"""
# 1. Create default Astroids object
mysolver = solver.Solver()
# 2. Make sure it has the default values
self.assertEqual(mysolver.vault.text, None)
self.assertEqual(mysolver.vault.origin, None)
self.assertEqual(mysolver.vault.origins, None)
self.assertEqual(len(mysolver.key_paths), 0)
# 3. Check methods
solution = mysolver.get_all_keys()
self.assertEqual(solution[0], 0)
self.assertEqual(solution[1], [solver.ORIGIN_KEY])
def test_p1e0_solve(self):
"Test Solver object creation with text of part 1 example 0"
# 1. Create Intcode obhect with values
mysolver = solver.Solver(text=from_text(test_vault.EXAMPLES[0]))
# 2. Make sure it has the specified values
self.assertEqual(mysolver.vault.rows, 3)
self.assertEqual(mysolver.vault.cols, 9)
self.assertEqual(len(mysolver.key_paths), 3)
# 3. Check methods
solution = mysolver.get_all_keys()
self.assertEqual(solution[0], 8)
self.assertEqual(solution[1], [solver.ORIGIN_KEY, 'a', 'b'])
def test_p1e1_solve(self):
"Test Solver object creation with text of part 1 example 1"
# 1. Create Intcode obhect with values
mysolver = solver.Solver(text=from_text(test_vault.EXAMPLES[1]))
# 2. Make sure it has the specified values
self.assertEqual(mysolver.vault.rows, 5)
self.assertEqual(mysolver.vault.cols, 24)
self.assertEqual(len(mysolver.key_paths), 7)
# 3. Check methods
solution = mysolver.get_all_keys()
self.assertEqual(solution[0], 86)
self.assertEqual(solution[1], [solver.ORIGIN_KEY, 'a', 'b', 'c', 'd', 'e', 'f'])
def test_p1e2_init(self):
"Test Solver object creation with text of part 1 example 2"
# 1. Create Intcode obhect with values
mysolver = solver.Solver(text=from_text(test_vault.EXAMPLES[2]))
# 2. Make sure it has the specified values
self.assertEqual(mysolver.vault.rows, 5)
self.assertEqual(mysolver.vault.cols, 24)
self.assertEqual(len(mysolver.key_paths), 8)
# 3. Check methods
solution = mysolver.get_all_keys()
self.assertEqual(solution[0], 132)
self.assertEqual(solution[1], [solver.ORIGIN_KEY, 'b', 'a', 'c', 'd', 'f', 'e', 'g'])
def test_p1e3_init(self):
"Test Solver object creation with text of part 1 example 3"
# 1. Create Intcode obhect with values
mysolver = solver.Solver(text=from_text(test_vault.EXAMPLES[3]))
# 2. Make sure it has the specified values
self.assertEqual(mysolver.vault.rows, 9)
self.assertEqual(mysolver.vault.cols, 17)
self.assertEqual(len(mysolver.key_paths), 17)
# 3. Check methods
solution = mysolver.get_all_keys()
self.assertEqual(solution[0], 136)
self.assertEqual(len(solution[1]), 17)
def test_p1e4_init(self):
"Test Solver object creation with text of part 1 example 4"
# 1. Create Intcode obhect with values
mysolver = solver.Solver(text=from_text(test_vault.EXAMPLES[4]))
# 2. Make sure it has the specified values
self.assertEqual(mysolver.vault.rows, 6)
self.assertEqual(mysolver.vault.cols, 24)
self.assertEqual(len(mysolver.key_paths), 10)
# 3. Check methods
solution = mysolver.get_all_keys()
self.assertEqual(solution[0], 81)
self.assertEqual(len(solution[1]), 10)
def test_p2e0_solve(self):
"Test Solver object creation with text of part 2 example 0"
# 1. Create Intcode obhect with values
mysolver = solver.Solver(text=from_text(test_vault.EXAMPLES_PART2[0]),
part2=True)
# 2. Make sure it has the specified values
self.assertEqual(mysolver.vault.rows, 7)
self.assertEqual(mysolver.vault.cols, 7)
self.assertEqual(len(mysolver.key_paths), 8)
# 3. Check methods
solution = mysolver.get_all_keys()
self.assertEqual(solution[0], 8)
self.assertEqual(solution[1], [solver.ORIGIN_KEY, 'a', 'b', 'c', 'd'])
def test_p2e1_solve(self):
"Test Solver object creation with text of part 2 example 1"
# 1. Create Intcode obhect with values
mysolver = solver.Solver(text=from_text(test_vault.EXAMPLES_PART2[1]),
part2=True)
#print(mysolver.key_paths.keys())
# 2. Make sure it has the specified values
self.assertEqual(mysolver.vault.rows, 7)
self.assertEqual(mysolver.vault.cols, 15)
self.assertEqual(len(mysolver.key_paths), 8)
# 3. Check methods
solution = mysolver.get_all_keys()
self.assertEqual(solution[0], 24)
def test_p2e2_solve(self):
"Test Solver object creation with text of part 2 example 2"
# 1. Create Intcode obhect with values
mysolver = solver.Solver(text=from_text(test_vault.EXAMPLES_PART2[2]),
part2=True)
#print(mysolver.key_paths.keys())
# 2. Make sure it has the specified values
self.assertEqual(mysolver.vault.rows, 7)
self.assertEqual(mysolver.vault.cols, 13)
self.assertEqual(len(mysolver.key_paths), 16)
# 3. Check methods
solution = mysolver.get_all_keys()
self.assertEqual(solution[0], 32)
def test_p2e3_solve(self):
"Test Solver object creation with text of part 2 example 3"
# 1. Create Intcode obhect with values
mysolver = solver.Solver(text=from_text(test_vault.EXAMPLES_PART2[3]),
part2=True)
#print(mysolver.key_paths.keys())
# 2. Make sure it has the specified values
self.assertEqual(mysolver.vault.rows, 9)
self.assertEqual(mysolver.vault.cols, 13)
self.assertEqual(len(mysolver.key_paths), 19)
# 3. Check methods
solution = mysolver.get_all_keys()
self.assertEqual(solution[0], 72)
# ----------------------------------------------------------------------
# module initialization
# ----------------------------------------------------------------------
if __name__ == '__main__':
pass
# ======================================================================
# end t e s t _ s o l v e r . p y end
# ======================================================================
| 38.602871
| 93
| 0.537556
| 896
| 8,068
| 4.736607
| 0.151786
| 0.169651
| 0.113808
| 0.138549
| 0.845193
| 0.801838
| 0.773798
| 0.755419
| 0.755419
| 0.755419
| 0
| 0.029539
| 0.253099
| 8,068
| 208
| 94
| 38.788462
| 0.674743
| 0.40295
| 0
| 0.313131
| 0
| 0
| 0.113193
| 0
| 0
| 0
| 0
| 0
| 0.484848
| 1
| 0.10101
| false
| 0.010101
| 0.040404
| 0
| 0.151515
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
8c190fed08c4cd32a4aadc5113463fe827bbffbc
| 910
|
py
|
Python
|
question_bank/sum-of-all-odd-length-subarrays/sum-of-all-odd-length-subarrays.py
|
yatengLG/leetcode-python
|
5d48aecb578c86d69835368fad3d9cc21961c226
|
[
"Apache-2.0"
] | 9
|
2020-08-12T10:01:00.000Z
|
2022-01-05T04:37:48.000Z
|
question_bank/sum-of-all-odd-length-subarrays/sum-of-all-odd-length-subarrays.py
|
yatengLG/leetcode-python
|
5d48aecb578c86d69835368fad3d9cc21961c226
|
[
"Apache-2.0"
] | 1
|
2021-02-16T10:19:31.000Z
|
2021-02-16T10:19:31.000Z
|
question_bank/sum-of-all-odd-length-subarrays/sum-of-all-odd-length-subarrays.py
|
yatengLG/leetcode-python
|
5d48aecb578c86d69835368fad3d9cc21961c226
|
[
"Apache-2.0"
] | 4
|
2020-08-12T10:13:31.000Z
|
2021-11-05T01:26:58.000Z
|
# -*- coding: utf-8 -*-
# @Author : LG
"""
执行用时:72 ms, 在所有 Python3 提交中击败了56.70% 的用户
内存消耗:13.4 MB, 在所有 Python3 提交中击败了25.43% 的用户
解题思路:
先以奇数长度截取字符串,求和
"""
class Solution:
def sumOddLengthSubarrays(self, arr: List[int]) -> int:
result = []
n = len(arr)
for l in range(1, n+1): # 依次尝试 1~n的长度
if l%2 == 1: # 如果当前 长度为奇数
for j in range(n-l+1): # 以当前长度截取字符串,求和
result.append(sum(arr[j:j+l]))
return sum(result)
"""
执行用时:72 ms, 在所有 Python3 提交中击败了56.70% 的用户
内存消耗:13.3 MB, 在所有 Python3 提交中击败了84.07% 的用户
解题思路:
先以奇数长度截取字符串,求和
"""
class Solution:
def sumOddLengthSubarrays(self, arr: List[int]) -> int:
result = []
n = len(arr)
for l in range(1, n+1, 2): # 依次尝试 1~n的长度
for j in range(n-l+1): # 以当前长度截取字符串,求和
result.append(sum(arr[j:j+l]))
return sum(result)
| 23.947368
| 59
| 0.546154
| 136
| 910
| 3.654412
| 0.382353
| 0.080483
| 0.032193
| 0.044266
| 0.804829
| 0.804829
| 0.804829
| 0.804829
| 0.804829
| 0.804829
| 0
| 0.066561
| 0.306593
| 910
| 37
| 60
| 24.594595
| 0.721078
| 0.22967
| 0
| 0.823529
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.117647
| false
| 0
| 0
| 0
| 0.352941
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
8c262e528d6c1a90cdc13270470c2fdcb8cfccdd
| 42
|
py
|
Python
|
jupyterhub_config.py
|
caseyjlaw/activecontainer
|
783f6be6fec6578f112efbd64629dd856ae65318
|
[
"BSD-3-Clause"
] | null | null | null |
jupyterhub_config.py
|
caseyjlaw/activecontainer
|
783f6be6fec6578f112efbd64629dd856ae65318
|
[
"BSD-3-Clause"
] | null | null | null |
jupyterhub_config.py
|
caseyjlaw/activecontainer
|
783f6be6fec6578f112efbd64629dd856ae65318
|
[
"BSD-3-Clause"
] | null | null | null |
#c.JupyterHub.hub_ip = '136.152.227.149'
| 14
| 40
| 0.690476
| 8
| 42
| 3.5
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.315789
| 0.095238
| 42
| 2
| 41
| 21
| 0.421053
| 0.928571
| 0
| null | 0
| null | 0
| 0
| null | 0
| 0
| 0
| null | 1
| null | true
| 0
| 0
| null | null | null | 1
| 1
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
4fdc38f610903e978308f10e83ed39957f5fec67
| 8,573
|
py
|
Python
|
attic/vsom-distances.py
|
rougier/VSOM
|
78e6eb924b5f89a0e6f42eb6bbe7971473a9abaa
|
[
"BSD-3-Clause"
] | 17
|
2020-11-20T06:27:15.000Z
|
2022-01-11T22:20:28.000Z
|
attic/vsom-distances.py
|
rougier/VSOM
|
78e6eb924b5f89a0e6f42eb6bbe7971473a9abaa
|
[
"BSD-3-Clause"
] | null | null | null |
attic/vsom-distances.py
|
rougier/VSOM
|
78e6eb924b5f89a0e6f42eb6bbe7971473a9abaa
|
[
"BSD-3-Clause"
] | 1
|
2022-01-03T04:41:57.000Z
|
2022-01-03T04:41:57.000Z
|
# -----------------------------------------------------------------------------
# VSOM (Voronoidal Self Organized Map)
# Copyright (c) 2019 Nicolas P. Rougier
#
# Distributed under the terms of the BSD License.
# -----------------------------------------------------------------------------
import numpy as np
import scipy.spatial
import networkx as nx
import matplotlib
import matplotlib.pyplot as plt
import matplotlib.patheffects as path_effects
from matplotlib.collections import LineCollection, PolyCollection
from vsom import VSOM, blue_noise, voronoi, centroid
def generate_som(n_neuron=1024, n_neighbour=2, seed=None):
if seed is None:
seed = np.random.randint(0,1000)
np.random.seed(seed)
radius = np.sqrt(2/(n_neuron*np.pi))
P = blue_noise((1,1), radius=radius)
np.random.shuffle(P)
print("Random seed: {0}".format(seed))
print("Number of neurons: {0}".format(len(P)))
D = scipy.spatial.distance.cdist(P,P)
sources = np.repeat(np.arange(len(P)),n_neighbour).reshape(len(P),n_neighbour)
targets = np.argsort(D,axis=1)[:,1:n_neighbour+1]
edges = np.c_[sources.ravel(), targets.ravel()]
C = np.zeros(D.shape, dtype=int)
C[sources,targets] = 1
lengths = nx.shortest_path_length(nx.Graph(C))
distance = np.zeros(D.shape, dtype=int)
for i in range(len(P)):
for j in range(len(P)):
try:
distance[i,j] = lengths[i][j]
except:
pass
return P, distance
# -----------------------------------------------------------------------------
if __name__ == '__main__':
import sys
P, D = generate_som(1024, 2)
plt.subplot(1,2,1, aspect=1)
plt.scatter(P[:,0], P[:,1])
plt.subplot(1,2,2, aspect=1)
plt.imshow(D)
plt.show()
sys.exit()
# Parameters
# ----------
seed = 123
radius = 0.025 # number of neurons ~ 2/(pi*radius**2)
n_neighbour = 2
# Initialization
# --------------
if seed is None:
seed = np.random.randint(0,1000)
np.random.seed(seed)
print("Random seed: {0}".format(seed))
# Nice uniform random distribution (blue noise)
# ---------------------------------------------
P = blue_noise((1,1), radius=radius)
print("Number of neurons: {0}".format(len(P)))
# Centroidal Voronoi Tesselation (10 iterations)
# ----------------------------------------------
for i in range(10):
V = voronoi(P, bbox=[0,1,0,1])
C = []
for region in V.filtered_regions:
vertices = V.vertices[region + [region[0]], :]
C.append(centroid(vertices))
P = np.array(C)
# Display neural and weight maps
# ------------------------------
fig = plt.figure(figsize=(12,4))
n_neighbour = 2
D = scipy.spatial.distance.cdist(P,P)
sources = np.repeat(np.arange(len(P)),n_neighbour).reshape(len(P),n_neighbour)
targets = np.argsort(D,axis=1)[:,1:n_neighbour+1]
edges = np.c_[sources.ravel(), targets.ravel()]
C = np.zeros(D.shape, dtype=int)
C[sources,targets] = 1
lengths = nx.shortest_path_length(nx.Graph(C))
distance = np.zeros(D.shape, dtype=int)
for i in range(len(P)):
for j in range(len(P)):
distance[i,j] = lengths[i][j]
som = VSOM((len(P),3), distance)
# Neuronal space
# --------------
ax = plt.subplot(1, 3, 1, aspect=1)
# ax.set_title("Neural space")
ax.scatter(P[:,0], P[:,1], s=15, edgecolor="k", facecolor="w", linewidth=0.75)
segments = np.zeros((len(edges), 2, 2))
for i in range(len(edges)):
segments[i] = P[edges[i,0]], P[edges[i,1]]
collection = LineCollection(segments, color="k", zorder=-10, lw=.75)
ax.add_collection(collection)
source = np.argmin(((P-[(0,0)])**2).sum(axis=1))
target = np.argmin(((P-[(1,1)])**2).sum(axis=1))
path = nx.shortest_path(nx.Graph(C), source, target)
print(len(path))
P_ = P[path]
ax.scatter(P_[:,0], P_[:,1], s=15, edgecolor="k", facecolor="k", linewidth=0.75)
segments = []
for region in V.filtered_regions:
segments.append(V.vertices[region + [region[0]], :])
collection = LineCollection(segments, color="k", linewidth=0.5,
zorder=-20, alpha=0.25)
ax.add_collection(collection)
ax.set_xlim(0,1), ax.set_ylim(0,1)
ax.set_xticks([]), ax.set_yticks([])
text = ax.text(0.05, 0.05, "A",
fontsize=24, fontweight="bold", transform=ax.transAxes)
text.set_path_effects([path_effects.Stroke(linewidth=2, foreground='white'),
path_effects.Normal()])
n_neighbour = 3
D = scipy.spatial.distance.cdist(P,P)
sources = np.repeat(np.arange(len(P)),n_neighbour).reshape(len(P),n_neighbour)
targets = np.argsort(D,axis=1)[:,1:n_neighbour+1]
edges = np.c_[sources.ravel(), targets.ravel()]
C = np.zeros(D.shape, dtype=int)
C[sources,targets] = 1
lengths = nx.shortest_path_length(nx.Graph(C))
distance = np.zeros(D.shape, dtype=int)
for i in range(len(P)):
for j in range(len(P)):
distance[i,j] = lengths[i][j]
som = VSOM((len(P),3), distance)
# Neuronal space
# --------------
ax = plt.subplot(1, 3, 2, aspect=1)
ax.scatter(P[:,0], P[:,1], s=15, edgecolor="k", facecolor="w", linewidth=0.75)
segments = np.zeros((len(edges), 2, 2))
for i in range(len(edges)):
segments[i] = P[edges[i,0]], P[edges[i,1]]
collection = LineCollection(segments, color="k", zorder=-10, lw=.75)
ax.add_collection(collection)
source = np.argmin(((P-[(0,0)])**2).sum(axis=1))
target = np.argmin(((P-[(1,1)])**2).sum(axis=1))
path = nx.shortest_path(nx.Graph(C), source, target)
print(len(path))
P_ = P[path]
ax.scatter(P_[:,0], P_[:,1], s=15, edgecolor="k", facecolor="k", linewidth=0.75)
segments = []
for region in V.filtered_regions:
segments.append(V.vertices[region + [region[0]], :])
collection = LineCollection(segments, color="k", linewidth=0.5,
zorder=-20, alpha=0.25)
ax.add_collection(collection)
ax.set_xlim(0,1), ax.set_ylim(0,1)
ax.set_xticks([]), ax.set_yticks([])
text = ax.text(0.05, 0.05, "B",
fontsize=24, fontweight="bold", transform=ax.transAxes)
text.set_path_effects([path_effects.Stroke(linewidth=2, foreground='white'),
path_effects.Normal()])
n_neighbour = 4
D = scipy.spatial.distance.cdist(P,P)
sources = np.repeat(np.arange(len(P)),n_neighbour).reshape(len(P),n_neighbour)
targets = np.argsort(D,axis=1)[:,1:n_neighbour+1]
edges = np.c_[sources.ravel(), targets.ravel()]
C = np.zeros(D.shape, dtype=int)
C[sources,targets] = 1
lengths = nx.shortest_path_length(nx.Graph(C))
distance = np.zeros(D.shape, dtype=int)
for i in range(len(P)):
for j in range(len(P)):
distance[i,j] = lengths[i][j]
som = VSOM((len(P),3), distance)
# Neuronal space
# --------------
ax = plt.subplot(1, 3, 3, aspect=1)
# ax.set_title("Neural space")
ax.scatter(P[:,0], P[:,1], s=15, edgecolor="k", facecolor="w", linewidth=0.75)
segments = np.zeros((len(edges), 2, 2))
for i in range(len(edges)):
segments[i] = P[edges[i,0]], P[edges[i,1]]
collection = LineCollection(segments, color="k", zorder=-10, lw=.75)
ax.add_collection(collection)
source = np.argmin(((P-[(0,0)])**2).sum(axis=1))
target = np.argmin(((P-[(1,1)])**2).sum(axis=1))
path = nx.shortest_path(nx.Graph(C), source, target)
print(len(path))
P_ = P[path]
ax.scatter(P_[:,0], P_[:,1], s=15, edgecolor="k", facecolor="k", linewidth=0.75)
segments = []
for region in V.filtered_regions:
segments.append(V.vertices[region + [region[0]], :])
collection = LineCollection(segments, color="k", linewidth=0.5,
zorder=-20, alpha=0.25)
ax.add_collection(collection)
ax.set_xlim(0,1), ax.set_ylim(0,1)
ax.set_xticks([]), ax.set_yticks([])
text = ax.text(0.05, 0.05, "C",
fontsize=24, fontweight="bold", transform=ax.transAxes)
text.set_path_effects([path_effects.Stroke(linewidth=2, foreground='white'),
path_effects.Normal()])
plt.tight_layout()
plt.savefig("vsom-topology-2.pdf")
plt.show()
| 32.350943
| 84
| 0.561647
| 1,204
| 8,573
| 3.921096
| 0.152824
| 0.017793
| 0.0233
| 0.023724
| 0.81021
| 0.80322
| 0.782461
| 0.772294
| 0.759161
| 0.759161
| 0
| 0.038039
| 0.224192
| 8,573
| 264
| 85
| 32.473485
| 0.671779
| 0.098099
| 0
| 0.76
| 0
| 0
| 0.019598
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.005714
| false
| 0.005714
| 0.051429
| 0
| 0.062857
| 0.04
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
4ffe1ca3f9d48ff83e6c885e24d740a1bb1c5e0e
| 10,089
|
py
|
Python
|
hg_delivery/tests/test_pushpull.py
|
19emtuck/hg_delivery
|
a1f1cf95c78f5e1e6a1f6ff7eaa3516e642739b0
|
[
"MIT"
] | null | null | null |
hg_delivery/tests/test_pushpull.py
|
19emtuck/hg_delivery
|
a1f1cf95c78f5e1e6a1f6ff7eaa3516e642739b0
|
[
"MIT"
] | 3
|
2019-12-26T17:34:01.000Z
|
2019-12-28T13:33:42.000Z
|
hg_delivery/tests/test_pushpull.py
|
19emtuck/hg_delivery
|
a1f1cf95c78f5e1e6a1f6ff7eaa3516e642739b0
|
[
"MIT"
] | null | null | null |
from . import BasicDataIgnition
import transaction
from mock import MagicMock, Mock
from mock_alchemy.mocking import AlchemyMagicMock
from pyramid import testing
from unittest.mock import patch
from sqlalchemy.exc import OperationalError
# ------------------------------------------------------------------------------
class TestPushPull(BasicDataIgnition):
def setUp(self):
self.config = testing.setUp(
settings={'sqlalchemy.url': 'sqlite:///:memory:'})
self.config.include('..models')
settings = self.config.get_settings()
import logging
from ..models import (
get_engine,
get_session_factory,
get_tm_session,
)
from ..models.meta import (
Base,
)
self.engine = get_engine(settings)
session_factory = get_session_factory(self.engine)
Base.metadata.create_all(bind=self.engine)
self.session = get_tm_session(session_factory, transaction.manager)
logging.disable(logging.CRITICAL)
# add a user
self.users_list = self._add_some_user()
self.projects_list = self._add_some_projects()
def tearDown(self):
transaction.abort()
testing.tearDown()
def test_shall_we_push(self):
"""
mock HgNode behavior to pilot HgNode
and test any view that push or pull
"""
from ..nodes import PoolSsh
from ..views import shall_we_push
# bad parameters
request = testing.DummyRequest()
request.dbsession = self.session
result = shall_we_push(request)
self.assertFalse(result['result'])
self.assertIsInstance(result['result'], bool)
self.assertEqual(result['error'], 'bad parameter')
request = testing.DummyRequest()
request.matchdict['id'] = 1
request.dbsession = self.session
result = shall_we_push(request)
self.assertFalse(result['result'])
self.assertIsInstance(result['result'], bool)
self.assertEqual(result['error'], 'bad parameter')
request = testing.DummyRequest()
request.matchdict['target'] = 2
request.dbsession = self.session
result = shall_we_push(request)
self.assertFalse(result['result'])
self.assertIsInstance(result['result'], bool)
self.assertEqual(result['error'], 'bad parameter')
cls_mmock = MagicMock()
cls_mmock.pushable.return_value = True
with patch.object(PoolSsh, 'get_node', return_value=cls_mmock):
request = testing.DummyRequest()
request.dbsession = self.session
request.matchdict['id'] = 1
request.matchdict['target'] = 2
result = shall_we_push(request)
self.assertTrue(result['result'])
self.assertIsInstance(result['result'], bool)
self.assertIsNone(result['error'])
# second call, bc now node is in spool
cls_mmock = MagicMock()
cls_mmock.pushable.return_value = False
with patch.object(PoolSsh, 'get_node', return_value=cls_mmock):
request = testing.DummyRequest()
request.dbsession = self.session
request.matchdict['id'] = 1
request.matchdict['target'] = 2
result = shall_we_push(request)
self.assertFalse(result['result'])
self.assertIsNone(result['error'])
def test_shall_we_push_unkown_project(self):
"""
mock HgNode behavior to pilot HgNode
and test any view that push or pull
"""
from ..views import shall_we_push
request = testing.DummyRequest()
request.dbsession = self.session
request.matchdict['id'] = 8
request.matchdict['target'] = 9
result = shall_we_push(request)
self.assertFalse(result['result'],)
self.assertEqual(result['error'], 'Unknown project')
exception_mock = OperationalError(None, None, 'database timeout')
request.dbsession.query = Mock()
request.dbsession.query.side_effect = exception_mock
request.dbsession.query.raiseError.side_effect = exception_mock
result = shall_we_push(request)
self.assertFalse(result['result'],)
self.assertEqual(result['error'], 'database timeout')
request.dbsession = AlchemyMagicMock()
exception_mock = Exception('dummy error')
request.dbsession.query = Mock()
request.dbsession.query.side_effect = exception_mock
request.dbsession.query.raiseError.side_effect = exception_mock
result = shall_we_push(request)
self.assertFalse(result['result'],)
self.assertEqual(result['error'], 'dummy error')
def test_shall_we_pull(self):
"""
mock HgNode behavior to pilot HgNode
and test any view that push or pull
"""
from ..nodes import PoolSsh
from ..views import shall_we_pull
# bad parameters
request = testing.DummyRequest()
request.dbsession = self.session
result = shall_we_pull(request)
self.assertFalse(result['result'])
self.assertIsInstance(result['result'], bool)
self.assertEqual(result['error'], 'bad parameter')
request = testing.DummyRequest()
request.matchdict['id'] = 1
request.dbsession = self.session
result = shall_we_pull(request)
self.assertFalse(result['result'])
self.assertIsInstance(result['result'], bool)
self.assertEqual(result['error'], 'bad parameter')
request = testing.DummyRequest()
request.matchdict['source'] = 2
request.dbsession = self.session
result = shall_we_pull(request)
self.assertFalse(result['result'])
self.assertIsInstance(result['result'], bool)
self.assertEqual(result['error'], 'bad parameter')
cls_mmock = MagicMock()
cls_mmock.pullable.return_value = True
with patch.object(PoolSsh, 'get_node', return_value=cls_mmock):
request = testing.DummyRequest()
request.dbsession = self.session
request.matchdict['id'] = 1
request.matchdict['source'] = 2
result = shall_we_pull(request)
self.assertTrue(result['result'])
self.assertIsNone(result['error'])
cls_mmock = MagicMock()
cls_mmock.pullable.return_value = False
with patch.object(PoolSsh, 'get_node', return_value=cls_mmock):
request.matchdict['id'] = 1
request.matchdict['source'] = 2
result = shall_we_pull(request)
self.assertFalse(result['result'])
self.assertIsNone(result['error'])
def test_shall_we_pull_unknown_project(self):
"""
mock HgNode behavior to pilot HgNode
and test any view that push or pull
"""
from ..views import shall_we_pull
request = testing.DummyRequest()
request.dbsession = self.session
request.matchdict['id'] = 8
request.matchdict['source'] = 9
result = shall_we_pull(request)
self.assertFalse(result['result'],)
self.assertEqual(result['error'], 'Unknown project')
request.dbsession = AlchemyMagicMock()
exception_mock = OperationalError(None, None, 'database timeout')
request.dbsession.query = Mock()
request.dbsession.query.side_effect = exception_mock
request.dbsession.query.raiseError.side_effect = exception_mock
result = shall_we_pull(request)
self.assertFalse(result['result'],)
self.assertEqual(result['error'], 'database timeout')
request.dbsession = AlchemyMagicMock()
exception_mock = Exception('dummy exception')
request.dbsession.query = Mock()
request.dbsession.query.side_effect = exception_mock
request.dbsession.query.raiseError.side_effect = exception_mock
result = shall_we_pull(request)
self.assertFalse(result['result'],)
self.assertEqual(result['error'], 'dummy exception')
def test_direct_pull(self):
from ..views import pull
from ..nodes import PoolSsh
p_1, p_2 = self.projects_list
request = testing.DummyRequest()
request.dbsession = self.session
result = pull(request)
self.assertFalse(result['result'])
self.assertEqual(result['error'], 'bad parameter')
request = testing.DummyRequest()
request.dbsession = self.session
request.matchdict['id'] = p_1.id
result = pull(request)
self.assertFalse(result['result'])
self.assertEqual(result['error'], 'bad parameter')
request = testing.DummyRequest()
request.dbsession = self.session
request.matchdict['id'] = p_1.id
request.matchdict['source'] = p_2.id
cls_mmock = MagicMock()
cls_mmock.pull_from.return_value = False
with patch.object(PoolSsh, 'get_node', return_value=cls_mmock):
result = pull(request)
self.assertTrue(result['result'])
self.assertIsNone(result['error'])
request.dbsession = AlchemyMagicMock()
exception_mock = OperationalError(None, None, 'database timeout')
request.dbsession.query = Mock()
request.dbsession.query.side_effect = exception_mock
request.dbsession.query.raiseError.side_effect = exception_mock
result = pull(request)
self.assertFalse(result['result'],)
self.assertEqual(result['error'], 'database timeout')
request.dbsession = AlchemyMagicMock()
exception_mock = Exception("standard error")
request.dbsession.query = Mock()
request.dbsession.query.side_effect = exception_mock
request.dbsession.query.raiseError.side_effect = exception_mock
result = pull(request)
self.assertFalse(result['result'],)
self.assertEqual(result['error'], 'standard error')
| 38.071698
| 80
| 0.630984
| 1,047
| 10,089
| 5.938873
| 0.118434
| 0.095207
| 0.054037
| 0.081055
| 0.842715
| 0.830975
| 0.822451
| 0.822451
| 0.792055
| 0.792055
| 0
| 0.002797
| 0.255922
| 10,089
| 264
| 81
| 38.215909
| 0.825496
| 0.044504
| 0
| 0.743961
| 0
| 0
| 0.077751
| 0
| 0
| 0
| 0
| 0
| 0.236715
| 1
| 0.033816
| false
| 0
| 0.086957
| 0
| 0.125604
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
8b012a3df7f0b3367a7cf9401512309ed74b73f6
| 124
|
py
|
Python
|
optimtool/__init__.py
|
linjing-lab/optimtool
|
9ca298b91ba755b4dab4028879af2c5a06c2e6d6
|
[
"MIT"
] | 3
|
2022-01-24T14:16:07.000Z
|
2022-02-18T20:02:50.000Z
|
optimtool/__init__.py
|
linjing-lab/optimtool
|
9ca298b91ba755b4dab4028879af2c5a06c2e6d6
|
[
"MIT"
] | null | null | null |
optimtool/__init__.py
|
linjing-lab/optimtool
|
9ca298b91ba755b4dab4028879af2c5a06c2e6d6
|
[
"MIT"
] | null | null | null |
from optimtool import constrain
from optimtool import unconstrain
from optimtool import example
from optimtool import hybrid
| 31
| 33
| 0.879032
| 16
| 124
| 6.8125
| 0.4375
| 0.477064
| 0.697248
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.120968
| 124
| 4
| 34
| 31
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
8c7e28049cbb4853ae6e23766833e71a347e6393
| 4,993
|
py
|
Python
|
back_end/migrations/versions/9132b0c70bdf_made_various_name_columns_larger.py
|
gerlichlab/HiCognition
|
dff022025b7c83732b9510ff5ca8232d30aa5304
|
[
"MIT"
] | null | null | null |
back_end/migrations/versions/9132b0c70bdf_made_various_name_columns_larger.py
|
gerlichlab/HiCognition
|
dff022025b7c83732b9510ff5ca8232d30aa5304
|
[
"MIT"
] | 5
|
2022-03-31T11:54:12.000Z
|
2022-03-31T12:04:29.000Z
|
back_end/migrations/versions/9132b0c70bdf_made_various_name_columns_larger.py
|
gerlichlab/HiCognition
|
dff022025b7c83732b9510ff5ca8232d30aa5304
|
[
"MIT"
] | null | null | null |
"""made various name columns larger
Revision ID: 9132b0c70bdf
Revises: d3185dbf793f
Create Date: 2021-07-12 10:45:28.304870
"""
from alembic import op
import sqlalchemy as sa
from sqlalchemy.dialects import mysql
# revision identifiers, used by Alembic.
revision = "9132b0c70bdf"
down_revision = "d3185dbf793f"
branch_labels = None
depends_on = None
def upgrade():
# ### commands auto generated by Alembic - please adjust! ###
op.alter_column(
"average_interval_data",
"file_path",
existing_type=mysql.VARCHAR(length=128),
type_=sa.String(length=512),
existing_nullable=True,
)
op.alter_column(
"average_interval_data",
"name",
existing_type=mysql.VARCHAR(length=64),
type_=sa.String(length=512),
existing_nullable=True,
)
op.alter_column(
"bed_file_metadata",
"file_path",
existing_type=mysql.VARCHAR(length=128),
type_=sa.String(length=512),
existing_nullable=True,
)
op.alter_column(
"bed_file_metadata",
"name",
existing_type=mysql.VARCHAR(length=128),
type_=sa.String(length=512),
existing_nullable=True,
)
op.alter_column(
"individual_interval_data",
"file_path",
existing_type=mysql.VARCHAR(length=128),
type_=sa.String(length=512),
existing_nullable=True,
)
op.alter_column(
"individual_interval_data",
"name",
existing_type=mysql.VARCHAR(length=64),
type_=sa.String(length=512),
existing_nullable=True,
)
op.alter_column(
"intervals",
"file_path",
existing_type=mysql.VARCHAR(length=128),
type_=sa.String(length=512),
existing_nullable=True,
)
op.alter_column(
"intervals",
"file_path_sub_sample_index",
existing_type=mysql.VARCHAR(length=128),
type_=sa.String(length=512),
existing_nullable=True,
)
op.alter_column(
"intervals",
"name",
existing_type=mysql.VARCHAR(length=64),
type_=sa.String(length=512),
existing_nullable=True,
)
op.alter_column(
"task",
"description",
existing_type=mysql.VARCHAR(length=128),
type_=sa.String(length=512),
existing_nullable=True,
)
op.alter_column(
"task",
"name",
existing_type=mysql.VARCHAR(length=128),
type_=sa.String(length=512),
existing_nullable=True,
)
# ### end Alembic commands ###
def downgrade():
# ### commands auto generated by Alembic - please adjust! ###
op.alter_column(
"task",
"name",
existing_type=sa.String(length=512),
type_=mysql.VARCHAR(length=128),
existing_nullable=True,
)
op.alter_column(
"task",
"description",
existing_type=sa.String(length=512),
type_=mysql.VARCHAR(length=128),
existing_nullable=True,
)
op.alter_column(
"session",
"session_object",
existing_type=sa.Text(length=1000000000),
type_=mysql.LONGTEXT(),
existing_nullable=True,
)
op.alter_column(
"intervals",
"name",
existing_type=sa.String(length=512),
type_=mysql.VARCHAR(length=64),
existing_nullable=True,
)
op.alter_column(
"intervals",
"file_path_sub_sample_index",
existing_type=sa.String(length=512),
type_=mysql.VARCHAR(length=128),
existing_nullable=True,
)
op.alter_column(
"intervals",
"file_path",
existing_type=sa.String(length=512),
type_=mysql.VARCHAR(length=128),
existing_nullable=True,
)
op.alter_column(
"individual_interval_data",
"name",
existing_type=sa.String(length=512),
type_=mysql.VARCHAR(length=64),
existing_nullable=True,
)
op.alter_column(
"individual_interval_data",
"file_path",
existing_type=sa.String(length=512),
type_=mysql.VARCHAR(length=128),
existing_nullable=True,
)
op.alter_column(
"bed_file_metadata",
"name",
existing_type=sa.String(length=512),
type_=mysql.VARCHAR(length=128),
existing_nullable=True,
)
op.alter_column(
"bed_file_metadata",
"file_path",
existing_type=sa.String(length=512),
type_=mysql.VARCHAR(length=128),
existing_nullable=True,
)
op.alter_column(
"average_interval_data",
"name",
existing_type=sa.String(length=512),
type_=mysql.VARCHAR(length=64),
existing_nullable=True,
)
op.alter_column(
"average_interval_data",
"file_path",
existing_type=sa.String(length=512),
type_=mysql.VARCHAR(length=128),
existing_nullable=True,
)
# ### end Alembic commands ###
| 26.558511
| 65
| 0.60685
| 548
| 4,993
| 5.281022
| 0.140511
| 0.055632
| 0.103317
| 0.167243
| 0.872495
| 0.872495
| 0.860055
| 0.858673
| 0.858673
| 0.858673
| 0
| 0.050801
| 0.274584
| 4,993
| 187
| 66
| 26.700535
| 0.748205
| 0.062888
| 0
| 0.788235
| 0
| 0
| 0.118268
| 0.049978
| 0
| 0
| 0
| 0
| 0
| 1
| 0.011765
| false
| 0
| 0.017647
| 0
| 0.029412
| 0
| 0
| 0
| 0
| null | 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
8cb8bc0792b4255b3fafc31ee388b3e4dae9dbf9
| 662
|
py
|
Python
|
contest/biweekly/47/submissions/pair_nodes.py
|
phunc20/leetcode
|
4581f39be565593ad0f5718dd4b0e1c34c209bf3
|
[
"MIT"
] | null | null | null |
contest/biweekly/47/submissions/pair_nodes.py
|
phunc20/leetcode
|
4581f39be565593ad0f5718dd4b0e1c34c209bf3
|
[
"MIT"
] | null | null | null |
contest/biweekly/47/submissions/pair_nodes.py
|
phunc20/leetcode
|
4581f39be565593ad0f5718dd4b0e1c34c209bf3
|
[
"MIT"
] | null | null | null |
class Solution:
def countPairs(self, n: int, edges: List[List[int]], queries: List[int]) -> List[int]:
D = dict()
for e in edges:
e = sorted(e)
if e in D:
D[e] += 1
else:
D[e] = 1
return [sum(list(D.values()) > q) for q in queries]
class Solution:
def countPairs(self, n: int, edges: List[List[int]], queries: List[int]) -> List[int]:
D = dict()
for e in edges:
e = str(sorted(e))
if e in D:
D[e] += 1
else:
D[e] = 1
return [sum(list(D.values()) > q) for q in queries]
| 30.090909
| 90
| 0.442598
| 93
| 662
| 3.150538
| 0.258065
| 0.143345
| 0.040956
| 0.177474
| 0.989761
| 0.989761
| 0.989761
| 0.989761
| 0.989761
| 0.989761
| 0
| 0.010336
| 0.415408
| 662
| 21
| 91
| 31.52381
| 0.74677
| 0
| 0
| 0.9
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.1
| false
| 0
| 0
| 0
| 0.3
| 0
| 0
| 0
| 0
| null | 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
8cd0814ff7f3174a138e5ee40ab4366cafbef87b
| 61
|
py
|
Python
|
new_feature/auth.py
|
codecov/example-flags
|
3644cb7c377c0dd61035beb822865d8e128ab292
|
[
"MIT"
] | 1
|
2021-08-07T12:04:10.000Z
|
2021-08-07T12:04:10.000Z
|
new_feature/auth.py
|
codecov/example-flags
|
3644cb7c377c0dd61035beb822865d8e128ab292
|
[
"MIT"
] | 3
|
2021-04-08T01:59:11.000Z
|
2021-04-09T14:53:49.000Z
|
new_feature/auth.py
|
codecov/example-flags
|
3644cb7c377c0dd61035beb822865d8e128ab292
|
[
"MIT"
] | 1
|
2021-07-15T13:30:09.000Z
|
2021-07-15T13:30:09.000Z
|
def login():
return True
def logout():
return True
| 8.714286
| 15
| 0.606557
| 8
| 61
| 4.625
| 0.625
| 0.540541
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.295082
| 61
| 6
| 16
| 10.166667
| 0.860465
| 0
| 0
| 0.5
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.5
| true
| 0
| 0
| 0.5
| 1
| 0
| 1
| 0
| 0
| null | 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 1
| 1
| 0
|
0
| 7
|
50752fd47bae0ae8c9ef47c1f1085900af228d2b
| 5,236
|
py
|
Python
|
evolution_analysis/code/site_dn_ds_hyphy/batch_file_meme.py
|
SysBioChalmers/Multi_scale_evolution
|
b5f28ead733872519bc0758df034a076224c4253
|
[
"MIT"
] | 1
|
2020-05-27T13:43:55.000Z
|
2020-05-27T13:43:55.000Z
|
evolution_analysis/code/site_dn_ds_hyphy/batch_file_meme.py
|
SysBioChalmers/Multi_scale_evolution
|
b5f28ead733872519bc0758df034a076224c4253
|
[
"MIT"
] | null | null | null |
evolution_analysis/code/site_dn_ds_hyphy/batch_file_meme.py
|
SysBioChalmers/Multi_scale_evolution
|
b5f28ead733872519bc0758df034a076224c4253
|
[
"MIT"
] | 1
|
2021-03-24T18:29:29.000Z
|
2021-03-24T18:29:29.000Z
|
# -*- coding: utf-8 -*-
# -*- python 3 -*-
# -*- hongzhong Lu -*-
import os
data_dir = "/home/luhongzhong/ortholog_343/cds_align_unify"
all_file = os.listdir(data_dir)
all_file = [x for x in all_file if "_code" in x]
outfile = "/home/luhongzhong/Documents/evolution_analysis/code/evolution_hyphy/meme_cluster_new.sh"
cluster_result = "/c3se/NOBACKUP/users/luho/meme_result"
cluster_input ="/c3se/NOBACKUP/users/luho/cds_align_unify"
template0 = "hyphy meme --alignment /c3se/NOBACKUP/users/luho/cds_align_unify/OG2049_code.fasta --tree /c3se/NOBACKUP/users/luho/unroot_tree_unify/OG2049_aa_unroot.tre --pvalue 0.1"
newfile = open(outfile, "w")
# write in the start file
start_part = "#!/bin/bash\n" \
"#SBATCH -A C3SE2020-1-8\n" \
"#SBATCH -N 1\n#SBATCH -n 20\n" \
"#SBATCH -o out.txt\n" \
"#SBATCH -t 7-00:00:00\n" \
"#SBATCH --mail-user=luho@chalmers.se\n" \
"#SBATCH --mail-type=end\n" \
"" \
"rm -rf /c3se/NOBACKUP/users/luho/meme_result\n" \
"mkdir /c3se/NOBACKUP/users/luho/meme_result\n" \
"cd /c3se/NOBACKUP/users/luho/cds_align_unify\n"
newfile.writelines(start_part)
for i, cds in enumerate(all_file):
print(i)
tree_id = cds.replace("_code.fasta", "_aa_unroot.tre")
out1 = template0.replace("OG2049_code.fasta", cds).replace('OG2049_aa_unroot.tre', tree_id) + " & \n"
print(out1)
if (i+1) % 20 == 0:
newfile.write(out1)
newfile.write("wait" + "\n")
else:
newfile.write(out1)
newfile.write("wait" + "\n")
newfile.close()
# produce the sh file on mac for all cds files
data_dir = "/Users/luho/Documents/cds_align_macse_remove_stop_code"
all_file = os.listdir(data_dir)
all_file = [x for x in all_file if "_code" in x]
# divide files into three part
all_file1 = all_file[0:1130]
all_file2 = all_file[1130:2260]
all_file3 = all_file[2260:]
#batch1
outfile = "/Users/luho/Documents/evolution_analysis/code/evolution_hyphy/meme_cluster_1.sh"
cluster_result = "/c3se/NOBACKUP/users/luho/meme_result"
cluster_input ="/c3se/NOBACKUP/users/luho/cds_align_unify"
template0 = "hyphy meme --alignment /c3se/NOBACKUP/users/luho/cds_align_macse_remove_stop_code/OG2049_code.fasta --tree /c3se/NOBACKUP/users/luho/unroot_tree/OG2049_aa_unroot.tre --pvalue 0.1"
newfile = open(outfile, "w")
# write in the start file
start_part = "#!/bin/bash\n" \
"#SBATCH -A C3SE2020-1-8\n" \
"#SBATCH -C MEM128\n" \
"#SBATCH -N 1\n#SBATCH -n 20\n" \
"#SBATCH -o out.txt\n" \
"#SBATCH -t 2-00:00:00\n" \
"#SBATCH --mail-user=luho@chalmers.se\n" \
"#SBATCH --mail-type=end\n"
newfile.writelines(start_part)
for i, cds in enumerate(all_file1):
print(i)
tree_id = cds.replace("_code.fasta", "_aa_unroot.tre")
out1 = template0.replace("OG2049_code.fasta", cds).replace('OG2049_aa_unroot.tre', tree_id) + " & \n"
print(out1)
if (i+1) % 20 == 0:
newfile.write(out1)
newfile.write("wait" + "\n")
else:
newfile.write(out1)
newfile.write("wait" + "\n")
newfile.close()
#batch2
outfile = "/Users/luho/Documents/evolution_analysis/code/evolution_hyphy/meme_cluster_2.sh"
cluster_result = "/c3se/NOBACKUP/users/luho/meme_result"
cluster_input ="/c3se/NOBACKUP/users/luho/cds_align_unify"
template0 = "hyphy meme --alignment /c3se/NOBACKUP/users/luho/cds_align_macse_remove_stop_code/OG2049_code.fasta --tree /c3se/NOBACKUP/users/luho/unroot_tree/OG2049_aa_unroot.tre --pvalue 0.1"
newfile = open(outfile, "w")
# write in the start file
start_part = "#!/bin/bash\n" \
"#SBATCH -A C3SE2020-1-8\n" \
"#SBATCH -C MEM128\n" \
"#SBATCH -N 1\n#SBATCH -n 20\n" \
"#SBATCH -o out.txt\n" \
"#SBATCH -t 2-00:00:00\n" \
"#SBATCH --mail-user=luho@chalmers.se\n" \
"#SBATCH --mail-type=end\n"
newfile.writelines(start_part)
for i, cds in enumerate(all_file2):
print(i)
tree_id = cds.replace("_code.fasta", "_aa_unroot.tre")
out1 = template0.replace("OG2049_code.fasta", cds).replace('OG2049_aa_unroot.tre', tree_id) + " & \n"
print(out1)
if (i+1) % 20 == 0:
newfile.write(out1)
newfile.write("wait" + "\n")
else:
newfile.write(out1)
newfile.write("wait" + "\n")
newfile.close()
#batch3
outfile = "/Users/luho/Documents/evolution_analysis/code/evolution_hyphy/meme_cluster_3.sh"
cluster_result = "/c3se/NOBACKUP/users/luho/meme_result"
cluster_input ="/c3se/NOBACKUP/users/luho/cds_align_unify"
template0 = "hyphy meme --alignment /c3se/NOBACKUP/users/luho/cds_align_macse_remove_stop_code/OG2049_code.fasta --tree /c3se/NOBACKUP/users/luho/unroot_tree/OG2049_aa_unroot.tre --pvalue 0.1"
newfile = open(outfile, "w")
# write in the start file
start_part = "#!/bin/bash\n" \
"#SBATCH -A C3SE2020-1-8\n" \
"#SBATCH -C MEM128\n" \
"#SBATCH -N 1\n#SBATCH -n 20\n" \
"#SBATCH -o out.txt\n" \
"#SBATCH -t 2-00:00:00\n" \
"#SBATCH --mail-user=luho@chalmers.se\n" \
"#SBATCH --mail-type=end\n"
newfile.writelines(start_part)
for i, cds in enumerate(all_file3):
print(i)
tree_id = cds.replace("_code.fasta", "_aa_unroot.tre")
out1 = template0.replace("OG2049_code.fasta", cds).replace('OG2049_aa_unroot.tre', tree_id) + " & \n"
print(out1)
if (i+1) % 20 == 0:
newfile.write(out1)
newfile.write("wait" + "\n")
else:
newfile.write(out1)
newfile.write("wait" + "\n")
newfile.close()
| 34.447368
| 192
| 0.696142
| 832
| 5,236
| 4.207933
| 0.135817
| 0.061982
| 0.092259
| 0.113967
| 0.911454
| 0.911454
| 0.903742
| 0.874322
| 0.858612
| 0.858612
| 0
| 0.053187
| 0.131016
| 5,236
| 152
| 193
| 34.447368
| 0.716264
| 0.047173
| 0
| 0.820513
| 0
| 0.034188
| 0.533052
| 0.301788
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.008547
| 0
| 0.008547
| 0.068376
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
50beaf811f036a552327bea232c09d173a215e99
| 2,258
|
py
|
Python
|
lemon_markets/portfolio.py
|
Fadope1/lemon-markets-python-sdk
|
58b976c9ccf26cb8ced1a196ca4ef976ef0c8502
|
[
"MIT"
] | 16
|
2020-10-26T06:54:21.000Z
|
2021-08-11T07:01:56.000Z
|
lemon_markets/portfolio.py
|
Fadope1/lemon-markets-python-sdk
|
58b976c9ccf26cb8ced1a196ca4ef976ef0c8502
|
[
"MIT"
] | 1
|
2020-11-25T11:55:54.000Z
|
2020-12-23T10:16:49.000Z
|
lemon_markets/portfolio.py
|
Fadope1/lemon-markets-python-sdk
|
58b976c9ccf26cb8ced1a196ca4ef976ef0c8502
|
[
"MIT"
] | 6
|
2020-11-03T15:29:35.000Z
|
2021-05-06T07:18:06.000Z
|
from lemon_markets.account import Account
from lemon_markets.common.objects import AbstractApiObjectMixin, ListMixin, ListIterator
from lemon_markets.common.requests import ApiRequest
from lemon_markets.instrument import Instrument
class Portfolio(AbstractApiObjectMixin, ListMixin):
class Fields(AbstractApiObjectMixin.Fields):
account: Account
quantity: int
average_price: float
instrument: Instrument
uuid: str
def __init__(self,
account: Account,
isin: str = None,
**kwargs):
super().__init__(isin=isin, account=account, **kwargs)
self.account = account
self.isin = isin
@property
def retrieve(self):
request = ApiRequest(
endpoint="portfolio/{}/".format(self.isin),
account=self.account,
method="GET"
)
self.set_data(request.response)
return self
@staticmethod
def list(account: Account, limit: int = None, offset: int = None) -> ListIterator:
return ListMixin.list(object_class=Portfolio, account=account, limit=limit, offset=offset,
list_endpoint="portfolio/")
class AggregatedPortfolio(AbstractApiObjectMixin, ListMixin):
class Fields(AbstractApiObjectMixin.Fields):
account: Account
quantity: int
average_price: float
instrument: Instrument
uuid: str
def __init__(self,
account: Account,
isin: str = None,
**kwargs
):
super().__init__(isin=isin, account=account, **kwargs)
self.account = account
self.isin = isin
@property
def retrieve(self):
request = ApiRequest(
endpoint="portfolio/{}/aggregated/".format(self.isin),
account=self.account,
method="GET"
)
self.set_data(request.response)
return self
@staticmethod
def list(account: Account, limit: int = None, offset: int = None) -> ListIterator:
return ListMixin.list(object_class=Portfolio, account=account, limit=limit, offset=offset,
list_endpoint="portfolio/aggregated/")
| 30.513514
| 98
| 0.612932
| 212
| 2,258
| 6.396226
| 0.226415
| 0.123894
| 0.047198
| 0.032448
| 0.80826
| 0.80826
| 0.80826
| 0.80826
| 0.80826
| 0.80826
| 0
| 0
| 0.297609
| 2,258
| 73
| 99
| 30.931507
| 0.854981
| 0
| 0
| 0.745763
| 0
| 0
| 0.032772
| 0.019929
| 0
| 0
| 0
| 0
| 0
| 1
| 0.101695
| false
| 0
| 0.067797
| 0.033898
| 0.305085
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
50d21714eb2af24ff048732d35ac789d12ddca7c
| 150
|
py
|
Python
|
boa3_test/test_sc/interop_test/blockchain/Transaction.py
|
hal0x2328/neo3-boa
|
6825a3533384cb01660773050719402a9703065b
|
[
"Apache-2.0"
] | 25
|
2020-07-22T19:37:43.000Z
|
2022-03-08T03:23:55.000Z
|
boa3_test/test_sc/interop_test/blockchain/Transaction.py
|
hal0x2328/neo3-boa
|
6825a3533384cb01660773050719402a9703065b
|
[
"Apache-2.0"
] | 419
|
2020-04-23T17:48:14.000Z
|
2022-03-31T13:17:45.000Z
|
boa3_test/test_sc/interop_test/blockchain/Transaction.py
|
hal0x2328/neo3-boa
|
6825a3533384cb01660773050719402a9703065b
|
[
"Apache-2.0"
] | 15
|
2020-05-21T21:54:24.000Z
|
2021-11-18T06:17:24.000Z
|
from boa3.builtin import public
from boa3.builtin.interop.blockchain import Transaction
@public
def main() -> Transaction:
return Transaction()
| 18.75
| 55
| 0.78
| 18
| 150
| 6.5
| 0.611111
| 0.136752
| 0.25641
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.015504
| 0.14
| 150
| 7
| 56
| 21.428571
| 0.891473
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.2
| true
| 0
| 0.4
| 0.2
| 0.8
| 0
| 1
| 0
| 0
| null | 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 1
| 1
| 0
|
0
| 7
|
50de894323320839ccbc87d0febda74ce1acd667
| 43
|
py
|
Python
|
src/webview/build.py
|
DeveshPankaj/py-cli
|
59d56e03f2b203cd65e9bd6fecf11d6b580931ff
|
[
"MIT"
] | null | null | null |
src/webview/build.py
|
DeveshPankaj/py-cli
|
59d56e03f2b203cd65e9bd6fecf11d6b580931ff
|
[
"MIT"
] | null | null | null |
src/webview/build.py
|
DeveshPankaj/py-cli
|
59d56e03f2b203cd65e9bd6fecf11d6b580931ff
|
[
"MIT"
] | null | null | null |
def build():
print("building app")
| 4.3
| 22
| 0.55814
| 5
| 43
| 4.8
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.27907
| 43
| 9
| 23
| 4.777778
| 0.774194
| 0
| 0
| 0
| 0
| 0
| 0.333333
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.5
| true
| 0
| 0
| 0
| 0.5
| 0.5
| 1
| 1
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| 0
| 1
|
0
| 7
|
50e3eb143d4dae2a96f080407e1bbf84999c03bc
| 105
|
py
|
Python
|
Codeforces/274 Division 2/Problem A/A.py
|
VastoLorde95/Competitive-Programming
|
6c990656178fb0cd33354cbe5508164207012f24
|
[
"MIT"
] | 170
|
2017-07-25T14:47:29.000Z
|
2022-01-26T19:16:31.000Z
|
Codeforces/274 Division 2/Problem A/A.py
|
navodit15/Competitive-Programming
|
6c990656178fb0cd33354cbe5508164207012f24
|
[
"MIT"
] | null | null | null |
Codeforces/274 Division 2/Problem A/A.py
|
navodit15/Competitive-Programming
|
6c990656178fb0cd33354cbe5508164207012f24
|
[
"MIT"
] | 55
|
2017-07-28T06:17:33.000Z
|
2021-10-31T03:06:22.000Z
|
a = input()
b = input()
c = input()
l = [a+b+c, (a+b)*c, a+(b*c), (a*b)+c, a*(b+c), a*b*c]
print max(l)
| 15
| 54
| 0.438095
| 28
| 105
| 1.642857
| 0.25
| 0.26087
| 0.391304
| 0.434783
| 0.391304
| 0.391304
| 0.391304
| 0.391304
| 0.391304
| 0.391304
| 0
| 0
| 0.190476
| 105
| 6
| 55
| 17.5
| 0.541176
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | null | 0
| 0
| null | null | 0.2
| 1
| 0
| 1
| null | 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
0fb8cce2804d852d3ccbed536d244c75df8be39d
| 17,925
|
py
|
Python
|
tests/atomistics/structure/test_pyscal.py
|
caglayanoaras/pyiron
|
f656f1bc89393e8c5a4175229937f7b169cf3786
|
[
"BSD-3-Clause"
] | null | null | null |
tests/atomistics/structure/test_pyscal.py
|
caglayanoaras/pyiron
|
f656f1bc89393e8c5a4175229937f7b169cf3786
|
[
"BSD-3-Clause"
] | null | null | null |
tests/atomistics/structure/test_pyscal.py
|
caglayanoaras/pyiron
|
f656f1bc89393e8c5a4175229937f7b169cf3786
|
[
"BSD-3-Clause"
] | null | null | null |
# coding: utf-8
# Copyright (c) Max-Planck-Institut für Eisenforschung GmbH - Computational Materials Design (CM) Department
# Distributed under the terms of "New BSD License", see the LICENSE file.
import unittest
import numpy as np
import pyscal.core as pc
from pyiron.project import Project
from pyiron_base import ProjectHDFio
from pyiron.atomistics.job.atomistic import AtomisticGenericJob
from pyiron.atomistics.structure.atoms import Atoms, CrystalStructure
import os
from ase.build import bulk
from pyiron.atomistics.structure.atoms import ase_to_pyiron
import pyiron.atomistics.structure.pyscal as pas
class Testpyscal(unittest.TestCase):
@classmethod
def setUpClass(cls):
cls.execution_path = os.path.dirname(os.path.abspath(__file__))
cls.project = Project(os.path.join(cls.execution_path, "test_job"))
cls.job = AtomisticGenericJob(
project=ProjectHDFio(project=cls.project, file_name="test_job"),
job_name="test_job",
)
cls.job.structure = CrystalStructure(
element="Al", bravais_basis="fcc", lattice_constants=4
).repeat(4)
@classmethod
def tearDownClass(cls):
cls.execution_path = os.path.dirname(os.path.abspath(__file__))
project = Project(os.path.join(cls.execution_path, "test_job"))
project.remove_jobs_silently(recursive=True)
project.remove(enable=True)
def test_attributes(self):
self.assertIsInstance(self.job.structure, Atoms)
def test_simple_system(self):
"""
Test a simple ase to pyscal conversion
"""
sysp = pc.System()
sysp.read_inputfile(self.job.structure, format="ase")
self.assertEqual(len(sysp.atoms), 256)
def test_steinhardt_parameters(self):
"""
Test the calculation of Steinhardts parameters
"""
perfect_vals = [0.00, 0.00, 0.190, 0.00, 0.575, 0.00, 0.404, 0.00,
0.013, 0.00, 0.600]
qtest = np.random.randint(2, 13, size=2)
qs, _ = pas.get_steinhardt_parameter_structure(self.job.structure, cutoff=0, n_clusters=2, q=qtest)
for c, q in enumerate(qs):
self.assertLess(np.abs(np.mean(q) - perfect_vals[qtest[c]-2]), 1E-3)
def test_centrosymmetry(self):
csm = pas.analyse_centro_symmetry(self.job.structure, num_neighbors=12)
self.assertLess(np.mean(csm), 1E-5)
def test_cna(self):
cna = pas.analyse_cna_adaptive(self.job.structure)
self.assertEqual(cna['fcc'], len(self.job.structure))
rand = np.random.randint(0, len(self.job.structure))
cna = pas.analyse_cna_adaptive(self.job.structure, mode="numeric")
self.assertEqual(cna[rand], 1)
cna = pas.analyse_cna_adaptive(self.job.structure, mode="str")
self.assertEqual(cna[rand], "fcc")
def test_volume(self):
vols = pas.analyse_voronoi_volume(self.job.structure)
self.assertLess(np.abs(np.mean(vols) - 16.0), 1E-3)
class Testpyscalatoms(unittest.TestCase):
@classmethod
def setUpClass(cls):
cls.al_fcc = ase_to_pyiron(bulk("Al", cubic=True))
cls.fe_bcc = ase_to_pyiron(bulk("Fe", cubic=True))
cls.ti_hcp = ase_to_pyiron(bulk("Ti", orthorhombic=True))
cls.si_dia = ase_to_pyiron(bulk("Si", cubic=True))
def test_analyse_pyscal_centro_symmetry(self):
self.assertTrue(all([np.isclose(v, 0.0) for v in self.al_fcc.analyse_pyscal_centro_symmetry()]))
self.assertTrue(all([np.isclose(v, 6.177675) for v in self.fe_bcc.analyse_pyscal_centro_symmetry()]))
self.assertTrue(all([np.isclose(v, 8.7025) for v in self.ti_hcp.analyse_pyscal_centro_symmetry()]))
self.assertTrue(all([np.isclose(v, 22.113675) for v in self.si_dia.analyse_pyscal_centro_symmetry()]))
self.assertEqual(len(self.al_fcc.analyse_pyscal_centro_symmetry()), len(self.al_fcc))
self.assertEqual(len(self.fe_bcc.analyse_pyscal_centro_symmetry()), len(self.fe_bcc))
self.assertEqual(len(self.ti_hcp.analyse_pyscal_centro_symmetry()), len(self.ti_hcp))
self.assertEqual(len(self.si_dia.analyse_pyscal_centro_symmetry()), len(self.si_dia))
def test_analyse_pyscal_voronoi_volume(self):
self.assertAlmostEqual(np.mean(self.al_fcc.analyse_pyscal_voronoi_volume()), 16.60753125)
self.assertAlmostEqual(np.mean(self.fe_bcc.analyse_pyscal_voronoi_volume()), 11.8199515)
self.assertAlmostEqual(np.mean(self.ti_hcp.analyse_pyscal_voronoi_volume()), 17.65294557)
self.assertAlmostEqual(np.mean(self.si_dia.analyse_pyscal_voronoi_volume()), 20.01287587)
self.assertEqual(len(self.al_fcc.analyse_pyscal_voronoi_volume()), len(self.al_fcc))
self.assertEqual(len(self.fe_bcc.analyse_pyscal_voronoi_volume()), len(self.fe_bcc))
self.assertEqual(len(self.ti_hcp.analyse_pyscal_voronoi_volume()), len(self.ti_hcp))
self.assertEqual(len(self.si_dia.analyse_pyscal_voronoi_volume()), len(self.si_dia))
def test_analyse_pyscal_cna_adaptive(self):
pyscal_keys = [
'others', 'fcc', 'hcp', 'bcc', 'ico',
]
ovito_keys = [
'CommonNeighborAnalysis.counts.OTHER',
'CommonNeighborAnalysis.counts.FCC',
'CommonNeighborAnalysis.counts.HCP',
'CommonNeighborAnalysis.counts.BCC',
'CommonNeighborAnalysis.counts.ICO'
]
res_dict_total = self.al_fcc.analyse_pyscal_cna_adaptive(mode="total", ovito_compatibility=False)
self.assertEqual(sum([k in res_dict_total.keys() for k in pyscal_keys]), len(pyscal_keys))
self.assertEqual(res_dict_total[pyscal_keys[1]], len(self.al_fcc))
res_dict_total = self.fe_bcc.analyse_pyscal_cna_adaptive(mode="total", ovito_compatibility=False)
self.assertEqual(sum([k in res_dict_total.keys() for k in pyscal_keys]), len(pyscal_keys))
self.assertEqual(res_dict_total[pyscal_keys[3]], len(self.fe_bcc))
res_dict_total = self.ti_hcp.analyse_pyscal_cna_adaptive(mode="total", ovito_compatibility=False)
self.assertEqual(sum([k in res_dict_total.keys() for k in pyscal_keys]), len(pyscal_keys))
self.assertEqual(res_dict_total[pyscal_keys[2]], len(self.ti_hcp))
res_dict_total = self.si_dia.analyse_pyscal_cna_adaptive(mode="total", ovito_compatibility=False)
self.assertEqual(sum([k in res_dict_total.keys() for k in pyscal_keys]), len(pyscal_keys))
self.assertEqual(res_dict_total[pyscal_keys[0]], len(self.si_dia))
res_numeric = self.al_fcc.analyse_pyscal_cna_adaptive(mode="numeric", ovito_compatibility=False)
self.assertEqual(len(res_numeric), len(self.al_fcc))
self.assertTrue(all([v == 1 for v in res_numeric]))
res_numeric = self.fe_bcc.analyse_pyscal_cna_adaptive(mode="numeric", ovito_compatibility=False)
self.assertEqual(len(res_numeric), len(self.fe_bcc))
self.assertTrue(all([v == 3 for v in res_numeric]))
res_numeric = self.ti_hcp.analyse_pyscal_cna_adaptive(mode="numeric", ovito_compatibility=False)
self.assertEqual(len(res_numeric), len(self.ti_hcp))
self.assertTrue(all([v == 2 for v in res_numeric]))
res_numeric = self.si_dia.analyse_pyscal_cna_adaptive(mode="numeric", ovito_compatibility=False)
self.assertEqual(len(res_numeric), len(self.si_dia))
self.assertTrue(all([v == 0 for v in res_numeric]))
res_str = self.al_fcc.analyse_pyscal_cna_adaptive(mode="str", ovito_compatibility=False)
self.assertEqual(len(res_str), len(self.al_fcc))
self.assertTrue(all([v == 'fcc' for v in res_str]))
res_str = self.fe_bcc.analyse_pyscal_cna_adaptive(mode="str", ovito_compatibility=False)
self.assertEqual(len(res_str), len(self.fe_bcc))
self.assertTrue(all([v == 'bcc' for v in res_str]))
res_str = self.ti_hcp.analyse_pyscal_cna_adaptive(mode="str", ovito_compatibility=False)
self.assertEqual(len(res_str), len(self.ti_hcp))
self.assertTrue(all([v == 'hcp' for v in res_str]))
res_str = self.si_dia.analyse_pyscal_cna_adaptive(mode="str", ovito_compatibility=False)
self.assertEqual(len(res_str), len(self.si_dia))
self.assertTrue(all([v == 'others' for v in res_str]))
res_dict_total = self.al_fcc.analyse_pyscal_cna_adaptive(mode="total", ovito_compatibility=True)
self.assertEqual(sum([k in res_dict_total.keys() for k in ovito_keys]), len(ovito_keys))
self.assertEqual(res_dict_total[ovito_keys[1]], len(self.al_fcc))
res_dict_total = self.fe_bcc.analyse_pyscal_cna_adaptive(mode="total", ovito_compatibility=True)
self.assertEqual(sum([k in res_dict_total.keys() for k in ovito_keys]), len(ovito_keys))
self.assertEqual(res_dict_total[ovito_keys[3]], len(self.fe_bcc))
res_dict_total = self.ti_hcp.analyse_pyscal_cna_adaptive(mode="total", ovito_compatibility=True)
self.assertEqual(sum([k in res_dict_total.keys() for k in ovito_keys]), len(ovito_keys))
self.assertEqual(res_dict_total[ovito_keys[2]], len(self.ti_hcp))
res_dict_total = self.si_dia.analyse_pyscal_cna_adaptive(mode="total", ovito_compatibility=True)
self.assertEqual(sum([k in res_dict_total.keys() for k in ovito_keys]), len(ovito_keys))
self.assertEqual(res_dict_total[ovito_keys[0]], len(self.si_dia))
res_numeric = self.al_fcc.analyse_pyscal_cna_adaptive(mode="numeric", ovito_compatibility=True)
self.assertEqual(len(res_numeric), len(self.al_fcc))
self.assertTrue(all([v == 1 for v in res_numeric]))
res_numeric = self.fe_bcc.analyse_pyscal_cna_adaptive(mode="numeric", ovito_compatibility=True)
self.assertEqual(len(res_numeric), len(self.fe_bcc))
self.assertTrue(all([v == 3 for v in res_numeric]))
res_numeric = self.ti_hcp.analyse_pyscal_cna_adaptive(mode="numeric", ovito_compatibility=True)
self.assertEqual(len(res_numeric), len(self.ti_hcp))
self.assertTrue(all([v == 2 for v in res_numeric]))
res_numeric = self.si_dia.analyse_pyscal_cna_adaptive(mode="numeric", ovito_compatibility=True)
self.assertEqual(len(res_numeric), len(self.si_dia))
self.assertTrue(all([v == 0 for v in res_numeric]))
res_str = self.al_fcc.analyse_pyscal_cna_adaptive(mode="str", ovito_compatibility=True)
self.assertEqual(len(res_str), len(self.al_fcc))
self.assertTrue(all([v == 'FCC' for v in res_str]))
res_str = self.fe_bcc.analyse_pyscal_cna_adaptive(mode="str", ovito_compatibility=True)
self.assertEqual(len(res_str), len(self.fe_bcc))
self.assertTrue(all([v == 'BCC' for v in res_str]))
res_str = self.ti_hcp.analyse_pyscal_cna_adaptive(mode="str", ovito_compatibility=True)
self.assertEqual(len(res_str), len(self.ti_hcp))
self.assertTrue(all([v == 'HCP' for v in res_str]))
res_str = self.si_dia.analyse_pyscal_cna_adaptive(mode="str", ovito_compatibility=True)
self.assertEqual(len(res_str), len(self.si_dia))
self.assertTrue(all([v == 'OTHER' for v in res_str]))
def test_analyse_pyscal_diamond_structure(self):
pyscal_keys = [
'others', 'fcc', 'hcp', 'bcc', 'ico',
'cubic diamond', 'cubic diamond 1NN', 'cubic diamond 2NN',
'hex diamond', 'hex diamond 1NN', 'hex diamond 2NN'
]
ovito_keys = [
'IdentifyDiamond.counts.CUBIC_DIAMOND',
'IdentifyDiamond.counts.CUBIC_DIAMOND_FIRST_NEIGHBOR',
'IdentifyDiamond.counts.CUBIC_DIAMOND_SECOND_NEIGHBOR',
'IdentifyDiamond.counts.HEX_DIAMOND',
'IdentifyDiamond.counts.HEX_DIAMOND_FIRST_NEIGHBOR',
'IdentifyDiamond.counts.HEX_DIAMOND_SECOND_NEIGHBOR',
'IdentifyDiamond.counts.OTHER'
]
res_dict_total = self.al_fcc.analyse_pyscal_diamond_structure(mode="total", ovito_compatibility=False)
self.assertEqual(sum([k in res_dict_total.keys() for k in pyscal_keys]), len(pyscal_keys))
self.assertEqual(res_dict_total[pyscal_keys[0]], len(self.al_fcc))
res_dict_total = self.fe_bcc.analyse_pyscal_diamond_structure(mode="total", ovito_compatibility=False)
self.assertEqual(sum([k in res_dict_total.keys() for k in pyscal_keys]), len(pyscal_keys))
self.assertEqual(res_dict_total[pyscal_keys[0]], len(self.fe_bcc))
res_dict_total = self.ti_hcp.analyse_pyscal_diamond_structure(mode="total", ovito_compatibility=False)
self.assertEqual(sum([k in res_dict_total.keys() for k in pyscal_keys]), len(pyscal_keys))
self.assertEqual(res_dict_total[pyscal_keys[0]], len(self.ti_hcp))
res_dict_total = self.si_dia.analyse_pyscal_diamond_structure(mode="total", ovito_compatibility=False)
self.assertEqual(sum([k in res_dict_total.keys() for k in pyscal_keys]), len(pyscal_keys))
self.assertEqual(res_dict_total[pyscal_keys[5]], len(self.si_dia))
res_numeric = self.al_fcc.analyse_pyscal_diamond_structure(mode="numeric", ovito_compatibility=False)
self.assertEqual(len(res_numeric), len(self.al_fcc))
self.assertTrue(all([v == 0 for v in res_numeric]))
res_numeric = self.fe_bcc.analyse_pyscal_diamond_structure(mode="numeric", ovito_compatibility=False)
self.assertEqual(len(res_numeric), len(self.fe_bcc))
self.assertTrue(all([v == 0 for v in res_numeric]))
res_numeric = self.ti_hcp.analyse_pyscal_diamond_structure(mode="numeric", ovito_compatibility=False)
self.assertEqual(len(res_numeric), len(self.ti_hcp))
self.assertTrue(all([v == 0 for v in res_numeric]))
res_numeric = self.si_dia.analyse_pyscal_diamond_structure(mode="numeric", ovito_compatibility=False)
self.assertEqual(len(res_numeric), len(self.si_dia))
self.assertTrue(all([v == 5 for v in res_numeric]))
res_str = self.al_fcc.analyse_pyscal_diamond_structure(mode="str", ovito_compatibility=False)
self.assertEqual(len(res_str), len(self.al_fcc))
self.assertTrue(all([v == 'others' for v in res_str]))
res_str = self.fe_bcc.analyse_pyscal_diamond_structure(mode="str", ovito_compatibility=False)
self.assertEqual(len(res_str), len(self.fe_bcc))
self.assertTrue(all([v == 'others' for v in res_str]))
res_str = self.ti_hcp.analyse_pyscal_diamond_structure(mode="str", ovito_compatibility=False)
self.assertEqual(len(res_str), len(self.ti_hcp))
self.assertTrue(all([v == 'others' for v in res_str]))
res_str = self.si_dia.analyse_pyscal_diamond_structure(mode="str", ovito_compatibility=False)
self.assertEqual(len(res_str), len(self.si_dia))
self.assertTrue(all([v == 'cubic diamond' for v in res_str]))
res_dict_total = self.al_fcc.analyse_pyscal_diamond_structure(mode="total", ovito_compatibility=True)
self.assertEqual(sum([k in res_dict_total.keys() for k in ovito_keys]), len(ovito_keys))
self.assertEqual(res_dict_total[ovito_keys[6]], len(self.al_fcc))
res_dict_total = self.fe_bcc.analyse_pyscal_diamond_structure(mode="total", ovito_compatibility=True)
self.assertEqual(sum([k in res_dict_total.keys() for k in ovito_keys]), len(ovito_keys))
self.assertEqual(res_dict_total[ovito_keys[6]], len(self.fe_bcc))
res_dict_total = self.ti_hcp.analyse_pyscal_diamond_structure(mode="total", ovito_compatibility=True)
self.assertEqual(sum([k in res_dict_total.keys() for k in ovito_keys]), len(ovito_keys))
self.assertEqual(res_dict_total[ovito_keys[6]], len(self.ti_hcp))
res_dict_total = self.si_dia.analyse_pyscal_diamond_structure(mode="total", ovito_compatibility=True)
self.assertEqual(sum([k in res_dict_total.keys() for k in ovito_keys]), len(ovito_keys))
self.assertEqual(res_dict_total[ovito_keys[0]], len(self.si_dia))
res_numeric = self.al_fcc.analyse_pyscal_diamond_structure(mode="numeric", ovito_compatibility=True)
self.assertEqual(len(res_numeric), len(self.al_fcc))
self.assertTrue(all([v == 6 for v in res_numeric]))
res_numeric = self.fe_bcc.analyse_pyscal_diamond_structure(mode="numeric", ovito_compatibility=True)
self.assertEqual(len(res_numeric), len(self.fe_bcc))
self.assertTrue(all([v == 6 for v in res_numeric]))
res_numeric = self.ti_hcp.analyse_pyscal_diamond_structure(mode="numeric", ovito_compatibility=True)
self.assertEqual(len(res_numeric), len(self.ti_hcp))
self.assertTrue(all([v == 6 for v in res_numeric]))
res_numeric = self.si_dia.analyse_pyscal_diamond_structure(mode="numeric", ovito_compatibility=True)
self.assertEqual(len(res_numeric), len(self.si_dia))
self.assertTrue(all([v == 0 for v in res_numeric]))
res_str = self.al_fcc.analyse_pyscal_diamond_structure(mode="str", ovito_compatibility=True)
self.assertEqual(len(res_str), len(self.al_fcc))
self.assertTrue(all([v == 'IdentifyDiamond.counts.OTHER' for v in res_str]))
res_str = self.fe_bcc.analyse_pyscal_diamond_structure(mode="str", ovito_compatibility=True)
self.assertEqual(len(res_str), len(self.fe_bcc))
self.assertTrue(all([v == 'IdentifyDiamond.counts.OTHER' for v in res_str]))
res_str = self.ti_hcp.analyse_pyscal_diamond_structure(mode="str", ovito_compatibility=True)
self.assertEqual(len(res_str), len(self.ti_hcp))
self.assertTrue(all([v == 'IdentifyDiamond.counts.OTHER' for v in res_str]))
res_str = self.si_dia.analyse_pyscal_diamond_structure(mode="str", ovito_compatibility=True)
self.assertEqual(len(res_str), len(self.si_dia))
self.assertTrue(all([v == 'IdentifyDiamond.counts.CUBIC_DIAMOND' for v in res_str]))
if __name__ == "__main__":
unittest.main()
| 60.557432
| 110
| 0.707503
| 2,573
| 17,925
| 4.6541
| 0.07773
| 0.095198
| 0.0481
| 0.056117
| 0.817871
| 0.791315
| 0.775031
| 0.738873
| 0.718163
| 0.710814
| 0
| 0.010797
| 0.168089
| 17,925
| 295
| 111
| 60.762712
| 0.792248
| 0.015565
| 0
| 0.335968
| 0
| 0
| 0.061545
| 0.033358
| 0
| 0
| 0
| 0
| 0.474308
| 1
| 0.051383
| false
| 0
| 0.043478
| 0
| 0.102767
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
ba117e3dbdef5038dd174048247dae910302ab91
| 80
|
py
|
Python
|
tests/utils.py
|
flapflapio/machinist-ui-test
|
1f80dc3b133c6c7721e11092cd496aced0434419
|
[
"MIT"
] | null | null | null |
tests/utils.py
|
flapflapio/machinist-ui-test
|
1f80dc3b133c6c7721e11092cd496aced0434419
|
[
"MIT"
] | 7
|
2022-01-12T00:48:27.000Z
|
2022-01-28T01:53:04.000Z
|
tests/utils.py
|
flapflapio/machinist-ui-test
|
1f80dc3b133c6c7721e11092cd496aced0434419
|
[
"MIT"
] | null | null | null |
def contains_class(substings):
return f'.//*[contains(@class,{substings})]'
| 26.666667
| 48
| 0.6875
| 9
| 80
| 6
| 0.666667
| 0.481481
| 0.814815
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.1
| 80
| 2
| 49
| 40
| 0.75
| 0
| 0
| 0
| 0
| 0
| 0.425
| 0.425
| 0
| 0
| 0
| 0
| 0
| 1
| 0.5
| false
| 0
| 0
| 0.5
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 1
| 1
| 0
|
0
| 8
|
ba26516c0c286697b8d941dab0ba213dac1398df
| 87,806
|
py
|
Python
|
hotpass.py
|
blackravens-hackers/Hotpass
|
1d051222cf4cbbcb1acfa872eea3bbdd5ac2562f
|
[
"Apache-2.0"
] | 1
|
2020-05-25T17:32:30.000Z
|
2020-05-25T17:32:30.000Z
|
hotpass.py
|
blackravens-hackers/Hotpass
|
1d051222cf4cbbcb1acfa872eea3bbdd5ac2562f
|
[
"Apache-2.0"
] | null | null | null |
hotpass.py
|
blackravens-hackers/Hotpass
|
1d051222cf4cbbcb1acfa872eea3bbdd5ac2562f
|
[
"Apache-2.0"
] | null | null | null |
import os
import sys
import time
from colorama import Fore, Back, Style
def cls():
os.system('cls' if os.name=='nt' else 'clear')
# let me to be free!
cls()
print(Fore.CYAN + "")
print(" _/ _/ _/ _/ _/ ")
print(" _/ _/ _/_/ _/_/_/_/ _/_/_/ _/_/_/ _/_/_/ _/_/_/ _/ _/ _/ _/ ")
print(" _/_/_/_/ _/ _/ _/ _/ _/ _/ _/ _/_/ _/_/ _/_/_/_/ _/ _/ ")
print(" _/ _/ _/ _/ _/ _/ _/ _/ _/ _/_/ _/_/ _/ _/ _/ ")
print("_/ _/ _/_/ _/_/ _/_/_/ _/_/_/ _/_/_/ _/_/_/ _/ _/_/_/ ")
print(" _/ ")
print(" _/ ")
print(" ")
print(Fore.GREEN + " by @blackravens-hackers |git| @blackravenshackers |telegram| ")
print("")
print("")
print(Fore.CYAN + " {1} SAVE IN FILE")
start = input("Choose option:")
if start == "1":
cls()
print(Fore.CYAN + "")
print(" _/ _/ _/ _/ _/ ")
print(" _/ _/ _/_/ _/_/_/_/ _/_/_/ _/_/_/ _/_/_/ _/_/_/ _/ _/ _/ _/ ")
print(" _/_/_/_/ _/ _/ _/ _/ _/ _/ _/ _/_/ _/_/ _/_/_/_/ _/ _/ ")
print(" _/ _/ _/ _/ _/ _/ _/ _/ _/ _/_/ _/_/ _/ _/ _/ ")
print("_/ _/ _/_/ _/_/ _/_/_/ _/_/_/ _/_/_/ _/_/_/ _/ _/_/_/ ")
print(" _/ ")
print(" _/ ")
print(" ")
print(Fore.GREEN + " by @blackravens-hackers |git| @blackravenshackers |telegram| ")
#tut budet nachalo, eta hren
#zapizivaet v fail to chto nado
email = input("Type email:")
name0 = input("Name of victim:" )
secname0 = input("Lastname:" )
name1 = input("Name of victim's first child:" )
secname1 = input("Lastname of victim's first child:" )
name2 = input("Name of victim's second child:" )
secname2 = input ("Lastname of victim's second child:" )
# his or her nickname in instagram or in another app...
nickname = input("Nickname of victim:" )
age0 = input("Birthyear:" )
age1 = input("Birthmounth:" )
age2 = input("BirthDAY:" )
# first child
age3 = input("Birthyear of the first child of the victim:" )
age4 = input("Birthmounth of the first child of the victim:" )
age5 = input("BirthDAY of the first child of the victim:" )
# second child
age6 = input("Birthyear of the second child of the victim:" )
age7 = input("Birthmounth of the second child of the victim:" )
age8 = input("BirthDAY of the second child of the victim:" )
# pet name
pet0 = input("First pet:" )
pet1 = input ("Second pet:" )
cls()
file = open("hotpass.txt","w")
file.write(email + name0 + '\n')
file.write(email + name0 + age0 + '\n')
file.write(email + age0 + name0 + '\n')
file.write(email + name0 + secname0 +'\n')
file.write(email + name0 + age1 + '\n')
file.write(email + age1 + name0 + '\n')
file.write(email + name0 + secname0 + age0 + '\n')
file.write(email + name0 + age0 + secname0 + age1 +'\n')
file.write(email + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(email + age0 + name0 + secname0 + age1 + age2 +'\n')
file.write(email + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(email + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(email + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(email + name1 + '\n')
file.write(email + name1 + age3 + '\n')
file.write(email + age3 + name1 + '\n')
file.write(email + name1 + secname1 +'\n')
file.write(email + name1 + age4 + '\n')
file.write(email + age4 + name1 + '\n')
file.write(email + name1 + secname1 + age3 + '\n')
file.write(email + name1 + age3 + secname1 + age4 + '\n')
file.write(email + age3 + name1 + secname1 + age4 + age5 + '\n')
file.write(email + age3 + name2 + secname1 + age4 + age5 + '\n')
file.write(email + age3 + name0 + secname1 + age4 + age5 + '\n')
file.write(email + age3 + pet1 + secname1 + age4 + age5 + '\n')
file.write(email + age3 + pet0 + secname1 + age4 + age5 + '\n')
file.write(name2 + name0 + '\n')
file.write(name1 + name0 + age0 + '\n')
file.write(name0 + age0 + email + '\n')
file.write(pet0 + name0 + secname0 + '\n')
file.write(pet1 + name0 + age1 + '\n')
file.write(pet0 + age1 + name0 + '\n')
file.write(pet1 + name0 + secname0 + age0 + '\n')
file.write(pet0 + name0 + age0 + secname0 + age1 + '\n')
file.write(pet1 + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(pet0 + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(pet1 + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(pet0 + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(name1 + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(name2 + name1 + '\n')
file.write(name0 + name1 + age3 + '\n')
file.write(age0 + age3 + name1 + '\n')
file.write(age1 + name1 + secname1 +'\n')
file.write(secname0 + name1 + age4 + '\n')
file.write(secname1 + age4 + name1 + '\n')
file.write(secname2 + name1 + secname1 + age3 + '\n')
file.write(pet1 + name1 + age3 + secname1 + age4 + '\n')
file.write(pet0 + age3 + name1 + secname1 + age4 + age5 +'\n')
file.write(secname0 + age3 + name2 + secname1 + age4 + age5 + '\n')
file.write(secname2 + age3 + name0 + secname1 + age4 + age5 + '\n')
file.write(secname2 + age3 + pet1 + secname1 + age4 + age5 + '\n')
file.write(email + age3 + pet0 + secname1 + age4 + age5 + '\n')
file.write(name0 + secname0 + '\n')
file.write(name0 + secname0 + age0 + '\n')
file.write(name0 + secname0 + age0 + age1 + '\n')
file.write(name0 + secname0 + age0 + age1 + age2 + '\n')
file.write(name1 + secname1 + '\n')
file.write(name2 + secname1 + '\n')
file.write(name2 + age3 + '\n')
file.write(name2 + secname2 + age2 + '\n')
file.write(name2 + secname2 + age2 + age3 + '\n')
file.write(name2 + secname2 + age2 + age3 + age4 + '\n')
file.write(name2 + secname2 + age2 + age3 + age4 + age5 + '\n')
file.write(secname2 + name2 + age2 + age3 + age4 + age5 + '\n')
file.write(secname2 + name2 + age3 + age2 + age4 + age5 + '\n')
file.write(secname1 + name1 + age3 + age2 + age4 + age5 + '\n')
file.write(secname1 + name1 + age3 + age4 + age5 + '\n')
file.write(email + secname1 + '\n')
file.write(email + name0 + secname1 + '\n')
file.write(email + age0 + name2 + '\n')
file.write(email + age1 + name2 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name2 + age1)
file.write(name2 + age1 + age2 + '\n')
file.write(name2 + age1 + age2 + age3 + '\n')
file.write(name2 + age1 + age3 + age2 + '\n')
file.write(name2 + age2 + age1 + age3 + '\n')
file.write(name2 + age2 + age3 + age1 + '\n')
file.write(name2 + age3 + age2 + age1 + '\n')
file.write(name2 + age3 + age1 + age2 + '\n')
file.write(name2 + age0 + age1 + age2 + age3 + '\n')
file.write(name2 + age0 + age1 + age3 + age2 + '\n')
file.write(name2 + age0 + age2 + age1 + age3 + '\n')
file.write(name2 + age0 + age2 + age3 + age1 + '\n')
file.write(name2 + age0 + age3 + age2 + age1 + '\n')
file.write(name2 + age0 + age3 + age1 + age2 + '\n')
file.write(name2 + age1 + age2 + age3 + age0 + '\n')
file.write(name2 + age1 + age3 + age2 + age0 + '\n')
file.write(name2 + age1 + age2 + age0 + age3 + '\n')
file.write(name2 + age1 + age3 + age0 + age2 + '\n')
file.write(name2 + age2 + age1 + age3 + age0 + '\n')
file.write(name2 + age2 + age1 + age0 + age3 + '\n')
file.write(name2 + age2 + age0 + age1 + age3 + '\n')
file.write(name2 + age2 + age0 + age3 + age1 + '\n')
file.write(name2 + age2 + age3 + age1 + age0 + '\n')
file.write(name2 + age2 + age3 + age0 + age1 + '\n')
file.write(name2 + age3 + age2 + age1 + age0 + '\n')
file.write(name2 + age3 + age2 + age0 + age1 + '\n')
file.write(name2 + age3 + age1 + age0 + age2 + '\n')
file.write(name2 + age3 + age1 + age2 + age0 + '\n')
file.write(name2 + age3 + age0 + age2 + age1 + '\n')
file.write(name2 + age3 + age0 + age1 + age2 + '\n')
file.write(pet1 + age1 + '\n')
file.write(pet1 + age1 + age2 + '\n')
file.write(pet1 + age1 + age2 + age3 + '\n')
file.write(pet1 + age1 + age3 + age2 + '\n')
file.write(pet1 + age2 + age1 + age3 + '\n')
file.write(pet1 + age2 + age3 + age1 + '\n')
file.write(pet1 + age3 + age2 + age1 + '\n')
file.write(pet1 + age3 + age1 + age2 + '\n')
file.write(pet1 + age0 + age1 + age2 + age3 + '\n')
file.write(pet1 + age0 + age1 + age3 + age2 + '\n')
file.write(pet1 + age0 + age2 + age1 + age3 + '\n')
file.write(pet1 + age0 + age2 + age3 + age1 + '\n')
file.write(pet1 + age0 + age3 + age2 + age1 + '\n')
file.write(pet1 + age0 + age3 + age1 + age2 + '\n')
file.write(pet1 + age1 + age2 + age3 + age0 + '\n')
file.write(pet0 + age1 + age3 + age2 + age0 + '\n')
file.write(pet0 + age1 + age2 + age0 + age3 + '\n')
file.write(pet0 + age1 + age3 + age0 + age2 + '\n')
file.write(pet0 + age2 + age1 + age3 + age0 + '\n')
file.write(pet0 + age2 + age1 + age0 + age3 + '\n')
file.write(pet0 + age2 + age0 + age1 + age3 + '\n')
file.write(pet0 + age2 + age0 + age3 + age1 + '\n')
file.write(pet0 + age2 + age3 + age1 + age0 + '\n')
file.write(pet0 + age2 + age3 + age0 + age1 + '\n')
file.write(pet0 + age3 + age2 + age1 + age0 + '\n')
file.write(pet0 + age3 + age2 + age0 + age1 + '\n')
file.write(pet0 + age3 + age1 + age0 + age2 + '\n')
file.write(pet0 + age3 + age1 + age2 + age0 + '\n')
file.write(pet0 + age3 + age0 + age2 + age1 + '\n')
file.write(pet0 + age3 + age0 + age1 + age2 + '\n')
file.write(email + name0 + '\n')
file.write(email + name1 + '\n')
file.write(email + name0 + secname1 + '\n')
file.write(email + age0 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
file.write(email + secname0 + '\n')
file.write(email + secname0 + secname1 + '\n')
file.write(email + secname0 + secname1 + secname2 + '\n')
file.write(email + secname0 + secname2 + secname1 + '\n')
file.write(email + pet0 + '\n')
file.write(email + pet1 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
file.write(email + name1 + '\n')
file.write(email + name1 + secname1 + '\n')
file.write(email + age0 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(email + secname0 + '\n')
file.write(email + name1 + '\n')
file.write(email + name1 + secname1 + '\n')
file.write(email + age0 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
if name0 == "0":
file.write(email + secname0 + '\n')
file.write(email + secname0 + secname1 + '\n')
file.write(email + secname0 + secname1 + secname2 + '\n')
file.write(email + secname0 + secname2 + secname1 + '\n')
file.write(email + pet0 + '\n')
file.write(email + pet1 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
file.write(email + name1 + '\n')
file.write(email + name1 + secname1 + '\n')
file.write(email + age0 + '\n' )
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(email + secname0 + '\n')
file.write(email + name1 + '\n')
file.write(email + name1 + secname1 + '\n')
file.write(email + age0 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
if secname0 == "0":
file.write(email + name0 + '\n')
file.write(email + name1 + '\n')
file.write(email + name0 + secname1 + '\n')
file.write(email + age0 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
if name1 == "0":
file.write(email + name0 + '\n')
file.write(email + secname1 + '\n')
file.write(email + name0 + secname1 + '\n')
file.write(email + age0 + name2 + '\n')
file.write(email + age1 + name2 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name2 + age1 + '\n')
file.write(name2 + age1 + age2 + '\n')
file.write(name2 + age1 + age2 + age3 + '\n')
file.write(name2 + age1 + age3 + age2 + '\n')
file.write(name2 + age2 + age1 + age3 + '\n')
file.write(name2 + age2 + age3 + age1 + '\n')
file.write(name2 + age3 + age2 + age1 + '\n')
file.write(name2 + age3 + age1 + age2 + '\n')
file.write(name2 + age0 + age1 + age2 + age3 + '\n')
file.write(name2 + age0 + age1 + age3 + age2 + '\n')
file.write(name2 + age0 + age2 + age1 + age3 + '\n')
file.write(name2 + age0 + age2 + age3 + age1 + '\n')
file.write(name2 + age0 + age3 + age2 + age1 + '\n')
file.write(name2 + age0 + age3 + age1 + age2 + '\n')
file.write(name2 + age1 + age2 + age3 + age0 + '\n')
file.write(name2 + age1 + age3 + age2 + age0 + '\n')
file.write(name2 + age1 + age2 + age0 + age3 + '\n')
file.write(name2 + age1 + age3 + age0 + age2 + '\n')
file.write(name2 + age2 + age1 + age3 + age0 + '\n')
file.write(name2 + age2 + age1 + age0 + age3 + '\n')
file.write(name2 + age2 + age0 + age1 + age3 + '\n')
file.write(name2 + age2 + age0 + age3 + age1 + '\n')
file.write(name2 + age2 + age3 + age1 + age0 + '\n')
file.write(name2 + age2 + age3 + age0 + age1 + '\n')
file.write(name2 + age3 + age2 + age1 + age0 + '\n')
file.write(name2 + age3 + age2 + age0 + age1 + '\n')
file.write(name2 + age3 + age1 + age0 + age2 + '\n')
file.write(name2 + age3 + age1 + age2 + age0 + '\n')
file.write(name2 + age3 + age0 + age2 + age1 + '\n')
file.write(name2 + age3 + age0 + age1 + age2 + '\n')
file.write(name0 + age1 + '\n')
file.write(name0 + age1 + age2 + '\n')
file.write(name0 + age1 + age2 + age3 + '\n')
file.write(name0 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name3 + age2 + age3 + age1 + '\n')
file.write(name3 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name2 + age2 + age1 + age3 + age0 + '\n')
file.write(name2 + age2 + age1 + age0 + age3 + '\n')
file.write(name2 + age2 + age0 + age1 + age3 + '\n')
file.write(name2 + age2 + age0 + age3 + age1 + '\n')
file.write(name2 + age2 + age3 + age1 + age0 + '\n')
file.write(name2 + age2 + age3 + age0 + age1 + '\n')
file.write(name2 + age3 + age2 + age1 + age0 + '\n')
file.write(name2 + age3 + age2 + age0 + age1 + '\n')
file.write(name2 + age3 + age1 + age0 + age2 + '\n')
file.write(name2 + age3 + age1 + age2 + age0 + '\n')
file.write(name2 + age3 + age0 + age2 + age1 + '\n')
file.write(name2 + age3 + age0 + age1 + age2 + '\n')
elif name1 =="0":
file.write(name0 + secname0 + '\n')
file.write(name0 + secname0 + age0 + '\n')
file.write(name0 + secname0 + age0 + age1 + '\n')
file.write(name0 + secname0 + age0 + age1 + age2 + '\n')
file.write(name1 + secname1 + '\n')
file.write(name2 + secname1 + '\n')
file.write(name2 + age3 + '\n')
file.write(name2 + secname2 + age2 + '\n')
file.write(name2 + secname2 + age2 + age3 + '\n')
file.write(name2 + secname2 + age2 + age3 + age4 + '\n')
file.write(name2 + secname2 + age2 + age3 + age4 + age5 + '\n')
file.write(secname2 + name2 + age2 + age3 + age4 + age5 + '\n')
file.write(secname2 + name2 + age3 + age2 + age4 + age5 + '\n')
file.write(secname1 + name1 + age3 + age2 + age4 + age5 + '\n')
file.write(secname1 + name1 + age3 + age4 + age5 + '\n')
file.write(email + secname1 + '\n')
file.write(email + name0 + secname1 + '\n')
file.write(email + age0 + name2 + '\n')
file.write(email + age1 + name2 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name2 + age1 + '\n')
file.write(name2 + age1 + age2 + '\n')
file.write(name2 + age1 + age2 + age3 + '\n')
file.write(name2 + age1 + age3 + age2 + '\n')
file.write(name2 + age2 + age1 + age3 + '\n')
file.write(name2 + age2 + age3 + age1 + '\n')
file.write(name2 + age3 + age2 + age1 + '\n')
file.write(name2 + age3 + age1 + age2 + '\n')
file.write(name2 + age0 + age1 + age2 + age3 + '\n')
file.write(name2 + age0 + age1 + age3 + age2 + '\n')
file.write(name2 + age0 + age2 + age1 + age3 + '\n')
file.write(name2 + age0 + age2 + age3 + age1 + '\n')
file.write(name2 + age0 + age3 + age2 + age1 + '\n')
file.write(name2 + age0 + age3 + age1 + age2 + '\n')
file.write(name2 + age1 + age2 + age3 + age0 + '\n')
file.write(name2 + age1 + age3 + age2 + age0 + '\n')
file.write(name2 + age1 + age2 + age0 + age3 + '\n')
file.write(name2 + age1 + age3 + age0 + age2 + '\n')
file.write(name2 + age2 + age1 + age3 + age0 + '\n')
file.write(name2 + age2 + age1 + age0 + age3 + '\n')
file.write(name2 + age2 + age0 + age1 + age3 + '\n')
file.write(name2 + age2 + age0 + age3 + age1 + '\n')
file.write(name2 + age2 + age3 + age1 + age0 + '\n')
file.write(name2 + age2 + age3 + age0 + age1 + '\n')
file.write(name2 + age3 + age2 + age1 + age0 + '\n')
file.write(name2 + age3 + age2 + age0 + age1 + '\n')
file.write(name2 + age3 + age1 + age0 + age2 + '\n')
file.write(name2 + age3 + age1 + age2 + age0 + '\n')
file.write(name2 + age3 + age0 + age2 + age1 + '\n')
file.write(name2 + age3 + age0 + age1 + age2 + '\n')
file.write(pet1 + age1 + '\n')
file.write(pet1 + age1 + age2 + '\n')
file.write(pet1 + age1 + age2 + age3 + '\n')
file.write(pet1 + age1 + age3 + age2 + '\n')
file.write(pet1 + age2 + age1 + age3 + '\n')
file.write(pet1 + age2 + age3 + age1 + '\n')
file.write(pet1 + age3 + age2 + age1 + '\n')
file.write(pet1 + age3 + age1 + age2 + '\n')
file.write(pet1 + age0 + age1 + age2 + age3 + '\n')
file.write(pet1 + age0 + age1 + age3 + age2 + '\n')
file.write(pet1 + age0 + age2 + age1 + age3 + '\n')
file.write(pet1 + age0 + age2 + age3 + age1 + '\n')
file.write(pet1 + age0 + age3 + age2 + age1 + '\n')
file.write(pet1 + age0 + age3 + age1 + age2 + '\n')
file.write(pet1 + age1 + age2 + age3 + age0 + '\n')
file.write(pet0 + age1 + age3 + age2 + age0 + '\n')
file.write(pet0 + age1 + age2 + age0 + age3 + '\n')
file.write(pet0 + age1 + age3 + age0 + age2 + '\n')
file.write(pet0 + age2 + age1 + age3 + age0 + '\n')
file.write(pet0 + age2 + age1 + age0 + age3 + '\n')
file.write(pet0 + age2 + age0 + age1 + age3 + '\n')
file.write(pet0 + age2 + age0 + age3 + age1 + '\n')
file.write(pet0 + age2 + age3 + age1 + age0 + '\n')
file.write(pet0 + age2 + age3 + age0 + age1 + '\n')
file.write(pet0 + age3 + age2 + age1 + age0 + '\n')
file.write(pet0 + age3 + age2 + age0 + age1 + '\n')
file.write(pet0 + age3 + age1 + age0 + age2 + '\n')
file.write(pet0 + age3 + age1 + age2 + age0 + '\n')
file.write(pet0 + age3 + age0 + age2 + age1 + '\n')
file.write(pet0 + age3 + age0 + age1 + age2 + '\n')
file.write(email + name0 + '\n')
file.write(email + name1 + '\n')
file.write(email + name0 + secname1 + '\n')
file.write(email + age0 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
file.write(email + secname0 + '\n')
file.write(email + secname0 + secname1 + '\n')
file.write(email + secname0 + secname1 + secname2 + '\n')
file.write(email + secname0 + secname2 + secname1 + '\n')
file.write(email + pet0 + '\n')
file.write(email + pet1 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
file.write(email + name1 + '\n')
file.write(email + name1 + secname1 + '\n')
file.write(email + age0 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(email + secname0 + '\n')
file.write(email + name1 + '\n')
file.write(email + name1 + secname1 + '\n')
file.write(email + age0 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
file.close()
def sigint_handler(signum, frame):
print(os.getpid())
print('CTRL + C/Z Pressed, app is now killed!')
os.kill(os.getpid(),9)
file = open("hotpass.txt","w")
file.write(email + name0 + '\n')
file.write(email + name0 + age0 + '\n')
file.write(email + age0 + name0 + '\n')
file.write(email + name0 + secname0 +'\n')
file.write(email + name0 + age1 + '\n')
file.write(email + age1 + name0 + '\n')
file.write(email + name0 + secname0 + age0 + '\n')
file.write(email + name0 + age0 + secname0 + age1 +'\n')
file.write(email + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(email + age0 + name0 + secname0 + age1 + age2 +'\n')
file.write(email + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(email + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(email + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(email + name1 + '\n')
file.write(email + name1 + age3 + '\n')
file.write(email + age3 + name1 + '\n')
file.write(email + name1 + secname1 +'\n')
file.write(email + name1 + age4 + '\n')
file.write(email + age4 + name1 + '\n')
file.write(email + name1 + secname1 + age3 + '\n')
file.write(email + name1 + age3 + secname1 + age4 + '\n')
file.write(email + age3 + name1 + secname1 + age4 + age5 + '\n')
file.write(email + age3 + name2 + secname1 + age4 + age5 + '\n')
file.write(email + age3 + name0 + secname1 + age4 + age5 + '\n')
file.write(email + age3 + pet1 + secname1 + age4 + age5 + '\n')
file.write(email + age3 + pet0 + secname1 + age4 + age5 + '\n')
file.write(name2 + name0 + '\n')
file.write(name1 + name0 + age0 + '\n')
file.write(name0 + age0 + email + '\n')
file.write(pet0 + name0 + secname0 + '\n')
file.write(pet1 + name0 + age1 + '\n')
file.write(pet0 + age1 + name0 + '\n')
file.write(pet1 + name0 + secname0 + age0 + '\n')
file.write(pet0 + name0 + age0 + secname0 + age1 + '\n')
file.write(pet1 + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(pet0 + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(pet1 + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(pet0 + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(name1 + age0 + name0 + secname0 + age1 + age2 + '\n')
file.write(name2 + name1 + '\n')
file.write(name0 + name1 + age3 + '\n')
file.write(age0 + age3 + name1 + '\n')
file.write(age1 + name1 + secname1 +'\n')
file.write(secname0 + name1 + age4 + '\n')
file.write(secname1 + age4 + name1 + '\n')
file.write(secname2 + name1 + secname1 + age3 + '\n')
file.write(pet1 + name1 + age3 + secname1 + age4 + '\n')
file.write(pet0 + age3 + name1 + secname1 + age4 + age5 +'\n')
file.write(secname0 + age3 + name2 + secname1 + age4 + age5 + '\n')
file.write(secname2 + age3 + name0 + secname1 + age4 + age5 + '\n')
file.write(secname2 + age3 + pet1 + secname1 + age4 + age5 + '\n')
file.write(email + age3 + pet0 + secname1 + age4 + age5 + '\n')
file.write(name0 + secname0 + '\n')
file.write(name0 + secname0 + age0 + '\n')
file.write(name0 + secname0 + age0 + age1 + '\n')
file.write(name0 + secname0 + age0 + age1 + age2 + '\n')
file.write(name1 + secname1 + '\n')
file.write(name2 + secname1 + '\n')
file.write(name2 + age3 + '\n')
file.write(name2 + secname2 + age2 + '\n')
file.write(name2 + secname2 + age2 + age3 + '\n')
file.write(name2 + secname2 + age2 + age3 + age4 + '\n')
file.write(name2 + secname2 + age2 + age3 + age4 + age5 + '\n')
file.write(secname2 + name2 + age2 + age3 + age4 + age5 + '\n')
file.write(secname2 + name2 + age3 + age2 + age4 + age5 + '\n')
file.write(secname1 + name1 + age3 + age2 + age4 + age5 + '\n')
file.write(secname1 + name1 + age3 + age4 + age5 + '\n')
file.write(email + secname1 + '\n')
file.write(email + name0 + secname1 + '\n')
file.write(email + age0 + name2 + '\n')
file.write(email + age1 + name2 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name2 + age1)
file.write(name2 + age1 + age2 + '\n')
file.write(name2 + age1 + age2 + age3 + '\n')
file.write(name2 + age1 + age3 + age2 + '\n')
file.write(name2 + age2 + age1 + age3 + '\n')
file.write(name2 + age2 + age3 + age1 + '\n')
file.write(name2 + age3 + age2 + age1 + '\n')
file.write(name2 + age3 + age1 + age2 + '\n')
file.write(name2 + age0 + age1 + age2 + age3 + '\n')
file.write(name2 + age0 + age1 + age3 + age2 + '\n')
file.write(name2 + age0 + age2 + age1 + age3 + '\n')
file.write(name2 + age0 + age2 + age3 + age1 + '\n')
file.write(name2 + age0 + age3 + age2 + age1 + '\n')
file.write(name2 + age0 + age3 + age1 + age2 + '\n')
file.write(name2 + age1 + age2 + age3 + age0 + '\n')
file.write(name2 + age1 + age3 + age2 + age0 + '\n')
file.write(name2 + age1 + age2 + age0 + age3 + '\n')
file.write(name2 + age1 + age3 + age0 + age2 + '\n')
file.write(name2 + age2 + age1 + age3 + age0 + '\n')
file.write(name2 + age2 + age1 + age0 + age3 + '\n')
file.write(name2 + age2 + age0 + age1 + age3 + '\n')
file.write(name2 + age2 + age0 + age3 + age1 + '\n')
file.write(name2 + age2 + age3 + age1 + age0 + '\n')
file.write(name2 + age2 + age3 + age0 + age1 + '\n')
file.write(name2 + age3 + age2 + age1 + age0 + '\n')
file.write(name2 + age3 + age2 + age0 + age1 + '\n')
file.write(name2 + age3 + age1 + age0 + age2 + '\n')
file.write(name2 + age3 + age1 + age2 + age0 + '\n')
file.write(name2 + age3 + age0 + age2 + age1 + '\n')
file.write(name2 + age3 + age0 + age1 + age2 + '\n')
file.write(pet1 + age1 + '\n')
file.write(pet1 + age1 + age2 + '\n')
file.write(pet1 + age1 + age2 + age3 + '\n')
file.write(pet1 + age1 + age3 + age2 + '\n')
file.write(pet1 + age2 + age1 + age3 + '\n')
file.write(pet1 + age2 + age3 + age1 + '\n')
file.write(pet1 + age3 + age2 + age1 + '\n')
file.write(pet1 + age3 + age1 + age2 + '\n')
file.write(pet1 + age0 + age1 + age2 + age3 + '\n')
file.write(pet1 + age0 + age1 + age3 + age2 + '\n')
file.write(pet1 + age0 + age2 + age1 + age3 + '\n')
file.write(pet1 + age0 + age2 + age3 + age1 + '\n')
file.write(pet1 + age0 + age3 + age2 + age1 + '\n')
file.write(pet1 + age0 + age3 + age1 + age2 + '\n')
file.write(pet1 + age1 + age2 + age3 + age0 + '\n')
file.write(pet0 + age1 + age3 + age2 + age0 + '\n')
file.write(pet0 + age1 + age2 + age0 + age3 + '\n')
file.write(pet0 + age1 + age3 + age0 + age2 + '\n')
file.write(pet0 + age2 + age1 + age3 + age0 + '\n')
file.write(pet0 + age2 + age1 + age0 + age3 + '\n')
file.write(pet0 + age2 + age0 + age1 + age3 + '\n')
file.write(pet0 + age2 + age0 + age3 + age1 + '\n')
file.write(pet0 + age2 + age3 + age1 + age0 + '\n')
file.write(pet0 + age2 + age3 + age0 + age1 + '\n')
file.write(pet0 + age3 + age2 + age1 + age0 + '\n')
file.write(pet0 + age3 + age2 + age0 + age1 + '\n')
file.write(pet0 + age3 + age1 + age0 + age2 + '\n')
file.write(pet0 + age3 + age1 + age2 + age0 + '\n')
file.write(pet0 + age3 + age0 + age2 + age1 + '\n')
file.write(pet0 + age3 + age0 + age1 + age2 + '\n')
file.write(email + name0 + '\n')
file.write(email + name1 + '\n')
file.write(email + name0 + secname1 + '\n')
file.write(email + age0 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
file.write(email + secname0 + '\n')
file.write(email + secname0 + secname1 + '\n')
file.write(email + secname0 + secname1 + secname2 + '\n')
file.write(email + secname0 + secname2 + secname1 + '\n')
file.write(email + pet0 + '\n')
file.write(email + pet1 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
file.write(email + name1 + '\n')
file.write(email + name1 + secname1 + '\n')
file.write(email + age0 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(email + secname0 + '\n')
file.write(email + name1 + '\n')
file.write(email + name1 + secname1 + '\n')
file.write(email + age0 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
if name0 == "0":
file.write(email + secname0 + '\n')
file.write(email + secname0 + secname1 + '\n')
file.write(email + secname0 + secname1 + secname2 + '\n')
file.write(email + secname0 + secname2 + secname1 + '\n')
file.write(email + pet0 + '\n')
file.write(email + pet1 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
file.write(email + name1 + '\n')
file.write(email + name1 + secname1 + '\n')
file.write(email + age0 + '\n' )
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(email + secname0 + '\n')
file.write(email + name1 + '\n')
file.write(email + name1 + secname1 + '\n')
file.write(email + age0 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
if secname0 == "0":
file.write(email + name0 + '\n')
file.write(email + name1 + '\n')
file.write(email + name0 + secname1 + '\n')
file.write(email + age0 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
if name1 == "0":
file.write(email + name0 + '\n')
file.write(email + secname1 + '\n')
file.write(email + name0 + secname1 + '\n')
file.write(email + age0 + name2 + '\n')
file.write(email + age1 + name2 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name2 + age1 + '\n')
file.write(name2 + age1 + age2 + '\n')
file.write(name2 + age1 + age2 + age3 + '\n')
file.write(name2 + age1 + age3 + age2 + '\n')
file.write(name2 + age2 + age1 + age3 + '\n')
file.write(name2 + age2 + age3 + age1 + '\n')
file.write(name2 + age3 + age2 + age1 + '\n')
file.write(name2 + age3 + age1 + age2 + '\n')
file.write(name2 + age0 + age1 + age2 + age3 + '\n')
file.write(name2 + age0 + age1 + age3 + age2 + '\n')
file.write(name2 + age0 + age2 + age1 + age3 + '\n')
file.write(name2 + age0 + age2 + age3 + age1 + '\n')
file.write(name2 + age0 + age3 + age2 + age1 + '\n')
file.write(name2 + age0 + age3 + age1 + age2 + '\n')
file.write(name2 + age1 + age2 + age3 + age0 + '\n')
file.write(name2 + age1 + age3 + age2 + age0 + '\n')
file.write(name2 + age1 + age2 + age0 + age3 + '\n')
file.write(name2 + age1 + age3 + age0 + age2 + '\n')
file.write(name2 + age2 + age1 + age3 + age0 + '\n')
file.write(name2 + age2 + age1 + age0 + age3 + '\n')
file.write(name2 + age2 + age0 + age1 + age3 + '\n')
file.write(name2 + age2 + age0 + age3 + age1 + '\n')
file.write(name2 + age2 + age3 + age1 + age0 + '\n')
file.write(name2 + age2 + age3 + age0 + age1 + '\n')
file.write(name2 + age3 + age2 + age1 + age0 + '\n')
file.write(name2 + age3 + age2 + age0 + age1 + '\n')
file.write(name2 + age3 + age1 + age0 + age2 + '\n')
file.write(name2 + age3 + age1 + age2 + age0 + '\n')
file.write(name2 + age3 + age0 + age2 + age1 + '\n')
file.write(name2 + age3 + age0 + age1 + age2 + '\n')
file.write(name0 + age1 + '\n')
file.write(name0 + age1 + age2 + '\n')
file.write(name0 + age1 + age2 + age3 + '\n')
file.write(name0 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name3 + age2 + age3 + age1 + '\n')
file.write(name3 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name2 + age2 + age1 + age3 + age0 + '\n')
file.write(name2 + age2 + age1 + age0 + age3 + '\n')
file.write(name2 + age2 + age0 + age1 + age3 + '\n')
file.write(name2 + age2 + age0 + age3 + age1 + '\n')
file.write(name2 + age2 + age3 + age1 + age0 + '\n')
file.write(name2 + age2 + age3 + age0 + age1 + '\n')
file.write(name2 + age3 + age2 + age1 + age0 + '\n')
file.write(name2 + age3 + age2 + age0 + age1 + '\n')
file.write(name2 + age3 + age1 + age0 + age2 + '\n')
file.write(name2 + age3 + age1 + age2 + age0 + '\n')
file.write(name2 + age3 + age0 + age2 + age1 + '\n')
file.write(name2 + age3 + age0 + age1 + age2 + '\n')
else:
file.write(name0 + secname0 + '\n')
file.write(name0 + secname0 + age0 + '\n')
file.write(name0 + secname0 + age0 + age1 + '\n')
file.write(name0 + secname0 + age0 + age1 + age2 + '\n')
file.write(name1 + secname1 + '\n')
file.write(name2 + secname1 + '\n')
file.write(name2 + age3 + '\n')
file.write(name2 + secname2 + age2 + '\n')
file.write(name2 + secname2 + age2 + age3 + '\n')
file.write(name2 + secname2 + age2 + age3 + age4 + '\n')
file.write(name2 + secname2 + age2 + age3 + age4 + age5 + '\n')
file.write(secname2 + name2 + age2 + age3 + age4 + age5 + '\n')
file.write(secname2 + name2 + age3 + age2 + age4 + age5 + '\n')
file.write(secname1 + name1 + age3 + age2 + age4 + age5 + '\n')
file.write(secname1 + name1 + age3 + age4 + age5 + '\n')
file.write(email + secname1 + '\n')
file.write(email + name0 + secname1 + '\n')
file.write(email + age0 + name2 + '\n')
file.write(email + age1 + name2 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name2 + age1 + '\n')
file.write(name2 + age1 + age2 + '\n')
file.write(name2 + age1 + age2 + age3 + '\n')
file.write(name2 + age1 + age3 + age2 + '\n')
file.write(name2 + age2 + age1 + age3 + '\n')
file.write(name2 + age2 + age3 + age1 + '\n')
file.write(name2 + age3 + age2 + age1 + '\n')
file.write(name2 + age3 + age1 + age2 + '\n')
file.write(name2 + age0 + age1 + age2 + age3 + '\n')
file.write(name2 + age0 + age1 + age3 + age2 + '\n')
file.write(name2 + age0 + age2 + age1 + age3 + '\n')
file.write(name2 + age0 + age2 + age3 + age1 + '\n')
file.write(name2 + age0 + age3 + age2 + age1 + '\n')
file.write(name2 + age0 + age3 + age1 + age2 + '\n')
file.write(name2 + age1 + age2 + age3 + age0 + '\n')
file.write(name2 + age1 + age3 + age2 + age0 + '\n')
file.write(name2 + age1 + age2 + age0 + age3 + '\n')
file.write(name2 + age1 + age3 + age0 + age2 + '\n')
file.write(name2 + age2 + age1 + age3 + age0 + '\n')
file.write(name2 + age2 + age1 + age0 + age3 + '\n')
file.write(name2 + age2 + age0 + age1 + age3 + '\n')
file.write(name2 + age2 + age0 + age3 + age1 + '\n')
file.write(name2 + age2 + age3 + age1 + age0 + '\n')
file.write(name2 + age2 + age3 + age0 + age1 + '\n')
file.write(name2 + age3 + age2 + age1 + age0 + '\n')
file.write(name2 + age3 + age2 + age0 + age1 + '\n')
file.write(name2 + age3 + age1 + age0 + age2 + '\n')
file.write(name2 + age3 + age1 + age2 + age0 + '\n')
file.write(name2 + age3 + age0 + age2 + age1 + '\n')
file.write(name2 + age3 + age0 + age1 + age2 + '\n')
file.write(pet1 + age1 + '\n')
file.write(pet1 + age1 + age2 + '\n')
file.write(pet1 + age1 + age2 + age3 + '\n')
file.write(pet1 + age1 + age3 + age2 + '\n')
file.write(pet1 + age2 + age1 + age3 + '\n')
file.write(pet1 + age2 + age3 + age1 + '\n')
file.write(pet1 + age3 + age2 + age1 + '\n')
file.write(pet1 + age3 + age1 + age2 + '\n')
file.write(pet1 + age0 + age1 + age2 + age3 + '\n')
file.write(pet1 + age0 + age1 + age3 + age2 + '\n')
file.write(pet1 + age0 + age2 + age1 + age3 + '\n')
file.write(pet1 + age0 + age2 + age3 + age1 + '\n')
file.write(pet1 + age0 + age3 + age2 + age1 + '\n')
file.write(pet1 + age0 + age3 + age1 + age2 + '\n')
file.write(pet1 + age1 + age2 + age3 + age0 + '\n')
file.write(pet0 + age1 + age3 + age2 + age0 + '\n')
file.write(pet0 + age1 + age2 + age0 + age3 + '\n')
file.write(pet0 + age1 + age3 + age0 + age2 + '\n')
file.write(pet0 + age2 + age1 + age3 + age0 + '\n')
file.write(pet0 + age2 + age1 + age0 + age3 + '\n')
file.write(pet0 + age2 + age0 + age1 + age3 + '\n')
file.write(pet0 + age2 + age0 + age3 + age1 + '\n')
file.write(pet0 + age2 + age3 + age1 + age0 + '\n')
file.write(pet0 + age2 + age3 + age0 + age1 + '\n')
file.write(pet0 + age3 + age2 + age1 + age0 + '\n')
file.write(pet0 + age3 + age2 + age0 + age1 + '\n')
file.write(pet0 + age3 + age1 + age0 + age2 + '\n')
file.write(pet0 + age3 + age1 + age2 + age0 + '\n')
file.write(pet0 + age3 + age0 + age2 + age1 + '\n')
file.write(pet0 + age3 + age0 + age1 + age2 + '\n')
file.write(email + name0 + '\n')
file.write(email + name1 + '\n')
file.write(email + name0 + secname1 + '\n')
file.write(email + age0 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
file.write(email + secname0 + '\n')
file.write(email + secname0 + secname1 + '\n')
file.write(email + secname0 + secname1 + secname2 + '\n')
file.write(email + secname0 + secname2 + secname1 + '\n')
file.write(email + pet0 + '\n')
file.write(email + pet1 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
file.write(email + name1 + '\n')
file.write(email + name1 + secname1 + '\n')
file.write(email + age0 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(email + secname0 + '\n')
file.write(email + name1 + '\n')
file.write(email + name1 + secname1 + '\n')
file.write(email + age0 + '\n')
file.write(email + age0 + age1 + '\n')
file.write(email + age0 + age1 + age2 + '\n')
file.write(email + age0 + age2 + age1 + '\n')
file.write(email + age1 + age0 + age2 + '\n')
file.write(email + age1 + age2 + age0 + '\n')
file.write(email + age2 + age0 + age1 + '\n')
file.write(email + age2 + age1 + age0 + '\n')
file.write(email + age3 + age4 + age5 + '\n')
file.write(email + age3 + age5 + age4 + '\n')
file.write(email + age4 + age3 + age5 + '\n')
file.write(email + age4 + age5 + age3 + '\n')
file.write(email + age5 + age3 + age4 + '\n')
file.write(email + age5 + age4 + age3 + '\n')
file.write(email + age6 + age7 + age8 + '\n')
file.write(email + age6 + age8 + age7 + '\n')
file.write(email + age7 + age8 + age6 + '\n')
file.write(email + age7 + age6 + age8 + '\n')
file.write(email + age8 + age6 + age7 + '\n')
file.write(email + age8 + age7 + age6 + '\n')
file.write(name1 + age1 + '\n')
file.write(name1 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + '\n')
file.write(name1 + age1 + age3 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + '\n')
file.write(name1 + age2 + age3 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + '\n')
file.write(name1 + age3 + age1 + age2 + '\n')
file.write(name1 + age0 + age1 + age2 + age3 + '\n')
file.write(name1 + age0 + age1 + age3 + age2 + '\n')
file.write(name1 + age0 + age2 + age1 + age3 + '\n')
file.write(name1 + age0 + age2 + age3 + age1 + '\n')
file.write(name1 + age0 + age3 + age2 + age1 + '\n')
file.write(name1 + age0 + age3 + age1 + age2 + '\n')
file.write(name1 + age1 + age2 + age3 + age0 + '\n')
file.write(name1 + age1 + age3 + age2 + age0 + '\n')
file.write(name1 + age1 + age2 + age0 + age3 + '\n')
file.write(name1 + age1 + age3 + age0 + age2 + '\n')
file.write(name1 + age2 + age1 + age3 + age0 + '\n')
file.write(name1 + age2 + age1 + age0 + age3 + '\n')
file.write(name1 + age2 + age0 + age1 + age3 + '\n')
file.write(name1 + age2 + age0 + age3 + age1 + '\n')
file.write(name1 + age2 + age3 + age1 + age0 + '\n')
file.write(name1 + age2 + age3 + age0 + age1 + '\n')
file.write(name1 + age3 + age2 + age1 + age0 + '\n')
file.write(name1 + age3 + age2 + age0 + age1 + '\n')
file.write(name1 + age3 + age1 + age0 + age2 + '\n')
file.write(name1 + age3 + age1 + age2 + age0 + '\n')
file.write(name1 + age3 + age0 + age2 + age1 + '\n')
file.write(name1 + age3 + age0 + age1 + age2 + '\n')
def sigint_handler(signum, frame):
print(os.getpid())
print('CTRL + C/Z Pressed, app is now killed!')
os.kill(os.getpid(),9)
time.sleep(2.4)
sys.exit()
yourfile="hotpass.txt"
print("ERROR: FILE NOT FOUND!" , yourfile, " EXITING...")
elseif:(Fore.RED + "EXITING..........................")
time.sleep(2.4)
sys.exit()
| 48.29813
| 105
| 0.554153
| 12,270
| 87,806
| 3.950774
| 0.009943
| 0.305966
| 0.337487
| 0.194942
| 0.985539
| 0.983023
| 0.98228
| 0.979
| 0.979
| 0.979
| 0
| 0.096488
| 0.2466
| 87,806
| 1,817
| 106
| 48.324711
| 0.636298
| 0.001856
| 0
| 0.980313
| 0
| 0.004632
| 0.062475
| 0.000377
| 0
| 0
| 0
| 0
| 0
| 1
| 0.001737
| false
| 0.001737
| 0.002316
| 0
| 0.004053
| 0.016213
| 0
| 0
| 0
| null | 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 10
|
ba26b676f2f8d33f5ce7a180059ca7bbab664f24
| 27,341
|
py
|
Python
|
analyticcenter/misc/control.py
|
dbacc/analyticcenter
|
86b6d83a82c70926d1a1f505ab4f569bcd4a2b14
|
[
"BSD-3-Clause"
] | null | null | null |
analyticcenter/misc/control.py
|
dbacc/analyticcenter
|
86b6d83a82c70926d1a1f505ab4f569bcd4a2b14
|
[
"BSD-3-Clause"
] | null | null | null |
analyticcenter/misc/control.py
|
dbacc/analyticcenter
|
86b6d83a82c70926d1a1f505ab4f569bcd4a2b14
|
[
"BSD-3-Clause"
] | null | null | null |
##
## Copyright (c) 2019
##
## @author: Daniel Bankmann
## @company: Technische Universität Berlin
##
## This file is part of the python package analyticcenter
## (see https://gitlab.tu-berlin.de/PassivityRadius/analyticcenter/)
##
## License: 3-clause BSD, see https://opensource.org/licenses/BSD-3-Clause
##
""" mateqn.py
Matrix equation solvers (Lyapunov, Riccati)
Implementation of the functions lyap, dlyap, care and dare
for solution of Lyapunov and Riccati equations. """
# Python 3 compatability (needs to go here)
from __future__ import print_function
"""Copyright (c) 2011, All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
are met:
1. Redistributions of source code must retain the above copyright
notice, this list of conditions and the following disclaimer.
2. Redistributions in binary form must reproduce the above copyright
notice, this list of conditions and the following disclaimer in the
documentation and/or other materials provided with the distribution.
3. Neither the name of the project author nor the names of its
contributors may be used to endorse or promote products derived
from this software without specific prior written permission.
THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
"AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS
FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL CALTECH
OR THE CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL,
SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT
LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF
USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND
ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY,
OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT
OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
SUCH DAMAGE.
Author: Bjorn Olofsson
"""
import numpy as np
from numpy.linalg import inv
from scipy import shape, size, asarray, asmatrix, copy, zeros, eye, dot
from scipy.linalg import eigvals, solve_discrete_are
from control.exception import ControlSlycot, ControlArgument, ControlDimension
#### Riccati equation solvers care and dare
def care(A, B, Q, R=None, S=None, E=None, stabilizing=True):
""" (X,L,G) = care(A,B,Q,R=None) solves the continuous-time algebraic Riccati
equation
:math:`A^T X + X A - X B R^{-1} B^T X + Q = 0`
where A and Q are square matrices of the same dimension. Further,
Q and R are a symmetric matrices. If R is None, it is set to the
identity matrix. The function returns the solution X, the gain
matrix G = B^T X and the closed loop eigenvalues L, i.e., the
eigenvalues of A - B G.
(X,L,G) = care(A,B,Q,R,S,E) solves the generalized continuous-time
algebraic Riccati equation
:math:`A^T X E + E^T X A - (E^T X B + S) R^{-1} (B^T X E + S^T) + Q = 0`
where A, Q and E are square matrices of the same
dimension. Further, Q and R are symmetric matrices. If R is None,
it is set to the identity matrix. The function returns the
solution X, the gain matrix G = R^-1 (B^T X E + S^T) and the
closed loop eigenvalues L, i.e., the eigenvalues of A - B G , E."""
# Make sure we can import required slycot routine
try:
from slycot import sb02md
except ImportError:
raise ControlSlycot("can't find slycot module 'sb02md'")
try:
from slycot import sb02mt
except ImportError:
raise ControlSlycot("can't find slycot module 'sb02mt'")
# Make sure we can find the required slycot routine
try:
from slycot import sg02ad
except ImportError:
raise ControlSlycot("can't find slycot module 'sg02ad'")
# Reshape 1-d arrays
if len(shape(A)) == 1:
A = A.reshape(1, A.size)
if len(shape(B)) == 1:
B = B.reshape(1, B.size)
if len(shape(Q)) == 1:
Q = Q.reshape(1, Q.size)
if R is not None and len(shape(R)) == 1:
R = R.reshape(1, R.size)
if S is not None and len(shape(S)) == 1:
S = S.reshape(1, S.size)
if E is not None and len(shape(E)) == 1:
E = E.reshape(1, E.size)
# Determine main dimensions
if size(A) == 1:
n = 1
else:
n = size(A, 0)
if size(B) == 1:
m = 1
else:
m = size(B, 1)
if R is None:
R = eye(m, m)
# Solve the standard algebraic Riccati equation
if S is None and E is None:
# Check input data for consistency
if size(A) > 1 and shape(A)[0] != shape(A)[1]:
raise ControlArgument("A must be a quadratic matrix.")
if (size(Q) > 1 and shape(Q)[0] != shape(Q)[1]) or \
(size(Q) > 1 and shape(Q)[0] != n) or \
size(Q) == 1 and n > 1:
raise ControlArgument("Q must be a quadratic matrix of the same \
dimension as A.")
if (size(B) > 1 and shape(B)[0] != n) or \
size(B) == 1 and n > 1:
raise ControlArgument("Incompatible dimensions of B matrix.")
if not (asarray(Q) == asarray(Q).T).all():
raise ControlArgument("Q must be a symmetric matrix.")
if not (asarray(R) == asarray(R).T).all():
raise ControlArgument("R must be a symmetric matrix.")
# Create back-up of arrays needed for later computations
R_ba = copy(R)
B_ba = copy(B)
# Solve the standard algebraic Riccati equation by calling Slycot
# functions sb02mt and sb02md
try:
A_b, B_b, Q_b, R_b, L_b, ipiv, oufact, G = sb02mt(n, m, B, R)
except ValueError as ve:
if ve.info < 0:
e = ValueError(ve.message)
e.info = ve.info
elif ve.info == m + 1:
e = ValueError("The matrix R is numerically singular.")
e.info = ve.info
else:
e = ValueError("The %i-th element of d in the UdU (LdL) \
factorization is zero." % ve.info)
e.info = ve.info
raise e
try:
if stabilizing:
sort = 'S'
else:
sort = 'U'
X, rcond, w, S_o, U, A_inv = sb02md(n, A, G, Q, 'C', sort=sort)
except ValueError as ve:
if ve.info < 0 or ve.info > 5:
e = ValueError(ve.message)
e.info = ve.info
elif ve.info == 1:
e = ValueError("The matrix A is (numerically) singular in \
continuous-time case.")
e.info = ve.info
elif ve.info == 2:
e = ValueError("The Hamiltonian or symplectic matrix H cannot \
be reduced to real Schur form.")
e.info = ve.info
elif ve.info == 3:
e = ValueError("The real Schur form of the Hamiltonian or \
symplectic matrix H cannot be appropriately ordered.")
e.info = ve.info
elif ve.info == 4:
e = ValueError("The Hamiltonian or symplectic matrix H has \
less than n stable eigenvalues.")
e.info = ve.info
elif ve.info == 5:
e = ValueError("The N-th order system of linear algebraic \
equations is singular to working precision.")
e.info = ve.info
raise e
# Calculate the gain matrix G
if size(R_b) == 1:
G = dot(dot(1 / (R_ba), asarray(B_ba).T), X)
else:
G = dot(dot(inv(R_ba), asarray(B_ba).T), X)
# Return the solution X, the closed-loop eigenvalues L and
# the gain matrix G
return (X, w[:n], G)
# Solve the generalized algebraic Riccati equation
elif S is not None and E is not None:
# Check input data for consistency
if size(A) > 1 and shape(A)[0] != shape(A)[1]:
raise ControlArgument("A must be a quadratic matrix.")
if (size(Q) > 1 and shape(Q)[0] != shape(Q)[1]) or \
(size(Q) > 1 and shape(Q)[0] != n) or \
size(Q) == 1 and n > 1:
raise ControlArgument("Q must be a quadratic matrix of the same \
dimension as A.")
if (size(B) > 1 and shape(B)[0] != n) or \
size(B) == 1 and n > 1:
raise ControlArgument("Incompatible dimensions of B matrix.")
if (size(E) > 1 and shape(E)[0] != shape(E)[1]) or \
(size(E) > 1 and shape(E)[0] != n) or \
size(E) == 1 and n > 1:
raise ControlArgument("E must be a quadratic matrix of the same \
dimension as A.")
if (size(R) > 1 and shape(R)[0] != shape(R)[1]) or \
(size(R) > 1 and shape(R)[0] != m) or \
size(R) == 1 and m > 1:
raise ControlArgument("R must be a quadratic matrix of the same \
dimension as the number of columns in the B matrix.")
if (size(S) > 1 and shape(S)[0] != n) or \
(size(S) > 1 and shape(S)[1] != m) or \
size(S) == 1 and n > 1 or \
size(S) == 1 and m > 1:
raise ControlArgument("Incompatible dimensions of S matrix.")
if not (asarray(Q) == asarray(Q).T).all():
raise ControlArgument("Q must be a symmetric matrix.")
if not (asarray(R) == asarray(R).T).all():
raise ControlArgument("R must be a symmetric matrix.")
# Create back-up of arrays needed for later computations
R_b = copy(R)
B_b = copy(B)
E_b = copy(E)
S_b = copy(S)
# Solve the generalized algebraic Riccati equation by calling the
# Slycot function sg02ad
try:
if stabilizing:
sort = 'S'
else:
sort = 'U'
rcondu, X, alfar, alfai, beta, S_o, T, U, iwarn = \
sg02ad('C', 'B', 'N', 'U', 'N', 'N', sort, 'R', n, m, 0, A, E, B, Q, R, S)
except ValueError as ve:
if ve.info < 0 or ve.info > 7:
e = ValueError(ve.message)
e.info = ve.info
elif ve.info == 1:
e = ValueError("The computed extended matrix pencil is \
singular, possibly due to rounding errors.")
e.info = ve.info
elif ve.info == 2:
e = ValueError("The QZ algorithm failed.")
e.info = ve.info
elif ve.info == 3:
e = ValueError("Reordering of the generalized eigenvalues \
failed.")
e.info = ve.info
elif ve.info == 4:
e = ValueError("After reordering, roundoff changed values of \
some complex eigenvalues so that leading \
eigenvalues in the generalized Schur form no \
longer satisfy the stability condition; this \
could also be caused due to scaling.")
e.info = ve.info
elif ve.info == 5:
e = ValueError("The computed dimension of the solution does \
not equal N.")
e.info = ve.info
elif ve.info == 6:
e = ValueError("The spectrum is too close to the boundary of \
the stability domain.")
e.info = ve.info
elif ve.info == 7:
e = ValueError("A singular matrix was encountered during the \
computation of the solution matrix X.")
e.info = ve.info
raise e
# Calculate the closed-loop eigenvalues L
L = zeros((n, 1))
L.dtype = 'complex64'
for i in range(n):
L[i] = (alfar[i] + alfai[i] * 1j) / beta[i]
# Calculate the gain matrix G
if size(R_b) == 1:
G = dot(1 / (R_b), dot(asarray(B_b).T, dot(X, E_b)) + asarray(S_b).T)
else:
G = dot(inv(R_b), dot(asarray(B_b).T, dot(X, E_b)) + asarray(S_b).T)
# Return the solution X, the closed-loop eigenvalues L and
# the gain matrix G
return (X, L, G)
# Invalid set of input parameters
else:
raise ControlArgument("Invalid set of input parameters.")
def dare(A, B, Q, R, S=None, E=None, stabilizing=True):
""" (X,L,G) = dare(A,B,Q,R) solves the discrete-time algebraic Riccati
equation
:math:`A^T X A - X - A^T X B (B^T X B + R)^{-1} B^T X A + Q = 0`
where A and Q are square matrices of the same dimension. Further, Q
is a symmetric matrix. The function returns the solution X, the gain
matrix G = (B^T X B + R)^-1 B^T X A and the closed loop eigenvalues L,
i.e., the eigenvalues of A - B G.
(X,L,G) = dare(A,B,Q,R,S,E) solves the generalized discrete-time algebraic
Riccati equation
:math:`A^T X A - E^T X E - (A^T X B + S) (B^T X B + R)^{-1} (B^T X A + S^T) + Q = 0`
where A, Q and E are square matrices of the same dimension. Further, Q and
R are symmetric matrices. The function returns the solution X, the gain
matrix :math:`G = (B^T X B + R)^{-1} (B^T X A + S^T)` and the closed loop
eigenvalues L, i.e., the eigenvalues of A - B G , E.
"""
if S is not None or E is not None or not stabilizing:
return dare_old(A, B, Q, R, S, E, stabilizing)
else:
Rmat = asmatrix(R)
Qmat = asmatrix(Q)
X = solve_discrete_are(A, B, Qmat, Rmat)
G = inv(B.T.dot(X).dot(B) + Rmat) * B.T.dot(X).dot(A)
L = eigvals(A - B.dot(G))
return X, L, G
def dare_old(A, B, Q, R, S=None, E=None, stabilizing=True):
# Make sure we can import required slycot routine
try:
from slycot import sb02md
except ImportError:
raise ControlSlycot("can't find slycot module 'sb02md'")
try:
from slycot import sb02mt
except ImportError:
raise ControlSlycot("can't find slycot module 'sb02mt'")
# Make sure we can find the required slycot routine
try:
from slycot import sg02ad
except ImportError:
raise ControlSlycot("can't find slycot module 'sg02ad'")
# Reshape 1-d arrays
if len(shape(A)) == 1:
A = A.reshape(1, A.size)
if len(shape(B)) == 1:
B = B.reshape(1, B.size)
if len(shape(Q)) == 1:
Q = Q.reshape(1, Q.size)
if R is not None and len(shape(R)) == 1:
R = R.reshape(1, R.size)
if S is not None and len(shape(S)) == 1:
S = S.reshape(1, S.size)
if E is not None and len(shape(E)) == 1:
E = E.reshape(1, E.size)
# Determine main dimensions
if size(A) == 1:
n = 1
else:
n = size(A, 0)
if size(B) == 1:
m = 1
else:
m = size(B, 1)
# Solve the standard algebraic Riccati equation
if S is None and E is None:
# Check input data for consistency
if size(A) > 1 and shape(A)[0] != shape(A)[1]:
raise ControlArgument("A must be a quadratic matrix.")
if (size(Q) > 1 and shape(Q)[0] != shape(Q)[1]) or \
(size(Q) > 1 and shape(Q)[0] != n) or \
size(Q) == 1 and n > 1:
raise ControlArgument("Q must be a quadratic matrix of the same \
dimension as A.")
if (size(B) > 1 and shape(B)[0] != n) or \
size(B) == 1 and n > 1:
raise ControlArgument("Incompatible dimensions of B matrix.")
if not (asarray(Q) == asarray(Q).T).all():
raise ControlArgument("Q must be a symmetric matrix.")
if not (asarray(R) == asarray(R).T).all():
raise ControlArgument("R must be a symmetric matrix.")
# Create back-up of arrays needed for later computations
A_ba = copy(A)
R_ba = copy(R)
B_ba = copy(B)
# Solve the standard algebraic Riccati equation by calling Slycot
# functions sb02mt and sb02md
try:
A_b, B_b, Q_b, R_b, L_b, ipiv, oufact, G = sb02mt(n, m, B, R)
except ValueError as ve:
if ve.info < 0:
e = ValueError(ve.message)
e.info = ve.info
elif ve.info == m + 1:
e = ValueError("The matrix R is numerically singular.")
e.info = ve.info
else:
e = ValueError("The %i-th element of d in the UdU (LdL) \
factorization is zero." % ve.info)
e.info = ve.info
raise e
try:
if stabilizing:
sort = 'S'
else:
sort = 'U'
X, rcond, w, S, U, A_inv = sb02md(n, A, G, Q, 'D', sort=sort)
except ValueError as ve:
if ve.info < 0 or ve.info > 5:
e = ValueError(ve.message)
e.info = ve.info
elif ve.info == 1:
e = ValueError("The matrix A is (numerically) singular in \
discrete-time case.")
e.info = ve.info
elif ve.info == 2:
e = ValueError("The Hamiltonian or symplectic matrix H cannot \
be reduced to real Schur form.")
e.info = ve.info
elif ve.info == 3:
e = ValueError("The real Schur form of the Hamiltonian or \
symplectic matrix H cannot be appropriately ordered.")
e.info = ve.info
elif ve.info == 4:
e = ValueError("The Hamiltonian or symplectic matrix H has \
less than n stable eigenvalues.")
e.info = ve.info
elif ve.info == 5:
e = ValueError("The N-th order system of linear algebraic \
equations is singular to working precision.")
e.info = ve.info
raise e
# Calculate the gain matrix G
if size(R_b) == 1:
G = dot(1 / (dot(asarray(B_ba).T, dot(X, B_ba)) + R_ba), \
dot(asarray(B_ba).T, dot(X, A_ba)))
else:
G = dot(inv(dot(asarray(B_ba).T, dot(X, B_ba)) + R_ba), \
dot(asarray(B_ba).T, dot(X, A_ba)))
# Return the solution X, the closed-loop eigenvalues L and
# the gain matrix G
return (X, w[:n], G)
# Solve the generalized algebraic Riccati equation
elif S is not None and E is not None:
# Check input data for consistency
if size(A) > 1 and shape(A)[0] != shape(A)[1]:
raise ControlArgument("A must be a quadratic matrix.")
if (size(Q) > 1 and shape(Q)[0] != shape(Q)[1]) or \
(size(Q) > 1 and shape(Q)[0] != n) or \
size(Q) == 1 and n > 1:
raise ControlArgument("Q must be a quadratic matrix of the same \
dimension as A.")
if (size(B) > 1 and shape(B)[0] != n) or \
size(B) == 1 and n > 1:
raise ControlArgument("Incompatible dimensions of B matrix.")
if (size(E) > 1 and shape(E)[0] != shape(E)[1]) or \
(size(E) > 1 and shape(E)[0] != n) or \
size(E) == 1 and n > 1:
raise ControlArgument("E must be a quadratic matrix of the same \
dimension as A.")
if (size(R) > 1 and shape(R)[0] != shape(R)[1]) or \
(size(R) > 1 and shape(R)[0] != m) or \
size(R) == 1 and m > 1:
raise ControlArgument("R must be a quadratic matrix of the same \
dimension as the number of columns in the B matrix.")
if (size(S) > 1 and shape(S)[0] != n) or \
(size(S) > 1 and shape(S)[1] != m) or \
size(S) == 1 and n > 1 or \
size(S) == 1 and m > 1:
raise ControlArgument("Incompatible dimensions of S matrix.")
if not (asarray(Q) == asarray(Q).T).all():
raise ControlArgument("Q must be a symmetric matrix.")
if not (asarray(R) == asarray(R).T).all():
raise ControlArgument("R must be a symmetric matrix.")
# Create back-up of arrays needed for later computations
A_b = copy(A)
R_b = copy(R)
B_b = copy(B)
E_b = copy(E)
S_b = copy(S)
# Solve the generalized algebraic Riccati equation by calling the
# Slycot function sg02ad
try:
if stabilizing:
sort = 'S'
else:
sort = 'U'
rcondu, X, alfar, alfai, beta, S_o, T, U, iwarn = \
sg02ad('D', 'B', 'N', 'U', 'N', 'N', sort, 'R', n, m, 0, A, E, B, Q, R, S)
except ValueError as ve:
if ve.info < 0 or ve.info > 7:
e = ValueError(ve.message)
e.info = ve.info
elif ve.info == 1:
e = ValueError("The computed extended matrix pencil is \
singular, possibly due to rounding errors.")
e.info = ve.info
elif ve.info == 2:
e = ValueError("The QZ algorithm failed.")
e.info = ve.info
elif ve.info == 3:
e = ValueError("Reordering of the generalized eigenvalues \
failed.")
e.info = ve.info
elif ve.info == 4:
e = ValueError("After reordering, roundoff changed values of \
some complex eigenvalues so that leading \
eigenvalues in the generalized Schur form no \
longer satisfy the stability condition; this \
could also be caused due to scaling.")
e.info = ve.info
elif ve.info == 5:
e = ValueError("The computed dimension of the solution does \
not equal N.")
e.info = ve.info
elif ve.info == 6:
e = ValueError("The spectrum is too close to the boundary of \
the stability domain.")
e.info = ve.info
elif ve.info == 7:
e = ValueError("A singular matrix was encountered during the \
computation of the solution matrix X.")
e.info = ve.info
raise e
L = zeros((n, 1))
L.dtype = 'complex64'
for i in range(n):
L[i] = (alfar[i] + alfai[i] * 1j) / beta[i]
# Calculate the gain matrix G
if size(R_b) == 1:
G = dot(1 / (dot(asarray(B_b).T, dot(X, B_b)) + R_b), \
dot(asarray(B_b).T, dot(X, A_b)) + asarray(S_b).T)
else:
G = dot(inv(dot(asarray(B_b).T, dot(X, B_b)) + R_b), \
dot(asarray(B_b).T, dot(X, A_b)) + asarray(S_b).T)
# Return the solution X, the closed-loop eigenvalues L and
# the gain matrix G
return (X, L, G)
# Invalid set of input parameters
else:
raise ControlArgument("Invalid set of input parameters.")
# def place(A, B, p):
# """Place closed loop eigenvalues
#
# Parameters
# ----------
# A : 2-d array
# Dynamics matrix
# B : 2-d array
# Input matrix
# p : 1-d list
# Desired eigenvalue locations
#
# Returns
# -------
# K : 2-d array
# Gains such that A - B K has given eigenvalues
#
# Examples
# --------
# >>> A = [[-1, -1], [0, 1]]
# >>> B = [[0], [1]]
# >>> K = place(A, B, [-2, -5])
# """
#
# # Make sure that SLICOT is installed
# try:
# from slycot import sb01bd
# except ImportError:
# raise ControlSlycot("can't find slycot module 'sb01bd'")
#
# # Convert the system inputs to NumPy arrays
# A_mat = np.array(A);
# B_mat = np.array(B);
# if (A_mat.shape[0] != A_mat.shape[1] or
# A_mat.shape[0] != B_mat.shape[0]):
# raise ControlDimension("matrix dimensions are incorrect")
#
# # Compute the system eigenvalues and convert poles to numpy array
# system_eigs = np.linalg.eig(A_mat)[0]
# placed_eigs = np.array(p);
#
# # SB01BD sets eigenvalues with real part less than alpha
# # We want to place all poles of the system => set alpha to minimum
# alpha = min(system_eigs.real);
#
# # Call SLICOT routine to place the eigenvalues
# A_z, w, nfp, nap, nup, F, Z, warn = \
# sb01bd(B_mat.shape[0], B_mat.shape[1], len(placed_eigs), alpha,
# A_mat, B_mat, placed_eigs, 'C');
# # Return the gain matrix, with MATLAB gain convention
# return -F, nup, warn
def place(A, B, p): #Taken from python-control package
"""Place closed loop eigenvalues
K = place_varga(A, B, p)
Parameters
----------
A : 2-d array
Dynamics matrix
B : 2-d array
Input matrix
p : 1-d list
Desired eigenvalue locations
Returns
-------
K : 2-d array
Gain such that A - B K has eigenvalues given in p.
Algorithm
---------
This function is a wrapper for the slycot function sb01bd, which
implements the pole placement algorithm of Varga [1]. In contrast to
the algorithm used by place(), the Varga algorithm can place
multiple poles at the same location. The placement, however, may not
be as robust.
[1] Varga A. "A Schur method for pole assignment."
IEEE Trans. Automatic Control, Vol. AC-26, pp. 517-519, 1981.
Examples
--------
>>> A = [[-1, -1], [0, 1]]
>>> B = [[0], [1]]
>>> K = place(A, B, [-2, -5])
See Also:
--------
place, acker
"""
# Make sure that SLICOT is installed
try:
from slycot import sb01bd
except ImportError:
raise ControlSlycot("can't find slycot module 'sb01bd'")
# Convert the system inputs to NumPy arrays
A_mat = np.array(A);
B_mat = np.array(B);
if (A_mat.shape[0] != A_mat.shape[1] or
A_mat.shape[0] != B_mat.shape[0]):
raise ControlDimension("matrix dimensions are incorrect")
# Compute the system eigenvalues and convert poles to numpy array
system_eigs = np.linalg.eig(A_mat)[0]
placed_eigs = np.array(p);
# SB01BD sets eigenvalues with real part less than alpha
# We want to place all poles of the system => set alpha to minimum
alpha = min(system_eigs.real);
# Call SLICOT routine to place the eigenvalues
A_z,w,nfp,nap,nup,F,Z = \
sb01bd(B_mat.shape[0], B_mat.shape[1], len(placed_eigs), alpha,
A_mat, B_mat, placed_eigs, 'C');
# Return the gain matrix, with MATLAB gain convention
return -F, nup
| 37.148098
| 92
| 0.536081
| 3,888
| 27,341
| 3.740741
| 0.111111
| 0.029703
| 0.016364
| 0.025715
| 0.834365
| 0.825495
| 0.821507
| 0.8169
| 0.811537
| 0.795173
| 0
| 0.01902
| 0.355803
| 27,341
| 735
| 93
| 37.198639
| 0.806734
| 0.243993
| 0
| 0.879518
| 0
| 0
| 0.056225
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.009639
| false
| 0
| 0.048193
| 0
| 0.074699
| 0.00241
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
e83e5df59a53c7c9dc2364e1ed7c12c5b54cdf23
| 43,584
|
py
|
Python
|
tests/test_cli/test_run.py
|
lrahmani/agents-aea
|
9bd1d51530fc21bf41b5adea031cda19a94b048b
|
[
"Apache-2.0"
] | null | null | null |
tests/test_cli/test_run.py
|
lrahmani/agents-aea
|
9bd1d51530fc21bf41b5adea031cda19a94b048b
|
[
"Apache-2.0"
] | null | null | null |
tests/test_cli/test_run.py
|
lrahmani/agents-aea
|
9bd1d51530fc21bf41b5adea031cda19a94b048b
|
[
"Apache-2.0"
] | null | null | null |
# -*- coding: utf-8 -*-
# ------------------------------------------------------------------------------
#
# Copyright 2018-2019 Fetch.AI Limited
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
#
# ------------------------------------------------------------------------------
"""This test module contains the tests for the `aea run` sub-command."""
import os
import shutil
import signal
import subprocess # nosec
import sys
import tempfile
import time
from pathlib import Path
from unittest import mock
import pytest
import yaml
import aea.cli.common
from aea.cli import cli
from aea.configurations.base import (
DEFAULT_AEA_CONFIG_FILE,
DEFAULT_CONNECTION_CONFIG_FILE,
PublicId,
)
from ..common.click_testing import CliRunner
from ..conftest import AUTHOR, CLI_LOG_OPTION, CUR_PATH
def test_run(pytestconfig):
"""Test that the command 'aea run' works as expected."""
if pytestconfig.getoption("ci"):
pytest.skip("Skipping the test since it doesn't work in CI.")
runner = CliRunner()
agent_name = "myagent"
cwd = os.getcwd()
t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(t, "packages"))
os.chdir(t)
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = runner.invoke(cli, [*CLI_LOG_OPTION, "create", "--local", agent_name])
assert result.exit_code == 0
os.chdir(Path(t, agent_name))
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "add", "--local", "connection", "fetchai/local:0.1.0"]
)
assert result.exit_code == 0
try:
process = subprocess.Popen( # nosec
[sys.executable, "-m", "aea.cli", "run"],
stdout=subprocess.PIPE,
env=os.environ.copy(),
)
time.sleep(10.0)
process.send_signal(signal.SIGINT)
process.wait(timeout=20)
assert process.returncode == 0
finally:
poll = process.poll()
if poll is None:
process.terminate()
process.wait(2)
os.chdir(cwd)
try:
shutil.rmtree(t)
except (OSError, IOError):
pass
def test_run_with_default_connection(pytestconfig):
"""Test that the command 'aea run' works as expected."""
if pytestconfig.getoption("ci"):
pytest.skip("Skipping the test since it doesn't work in CI.")
runner = CliRunner()
agent_name = "myagent"
cwd = os.getcwd()
t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(t, "packages"))
os.chdir(t)
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = runner.invoke(cli, [*CLI_LOG_OPTION, "create", "--local", agent_name])
assert result.exit_code == 0
os.chdir(Path(t, agent_name))
try:
process = subprocess.Popen( # nosec
[sys.executable, "-m", "aea.cli", "run"],
stdout=subprocess.PIPE,
env=os.environ.copy(),
)
time.sleep(10.0)
process.send_signal(signal.SIGINT)
process.wait(timeout=20)
assert process.returncode == 0
finally:
poll = process.poll()
if poll is None:
process.terminate()
process.wait(2)
os.chdir(cwd)
try:
shutil.rmtree(t)
except (OSError, IOError):
pass
@pytest.mark.parametrize(
argnames=["connection_ids"],
argvalues=[
["fetchai/local:0.1.0,fetchai/stub:0.1.0"],
["'fetchai/local:0.1.0, fetchai/stub:0.1.0'"],
["fetchai/local:0.1.0,,fetchai/stub:0.1.0,"],
],
)
def test_run_multiple_connections(pytestconfig, connection_ids):
"""Test that the command 'aea run' works as expected when specifying multiple connections."""
if pytestconfig.getoption("ci"):
pytest.skip("Skipping the test since it doesn't work in CI.")
runner = CliRunner()
agent_name = "myagent"
cwd = os.getcwd()
t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(t, "packages"))
os.chdir(t)
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = runner.invoke(cli, [*CLI_LOG_OPTION, "create", "--local", agent_name])
assert result.exit_code == 0
os.chdir(Path(t, agent_name))
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "add", "--local", "connection", "fetchai/local:0.1.0"]
)
assert result.exit_code == 0
# stub is the default connection, so it should fail
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "add", "--local", "connection", "fetchai/stub:0.1.0"]
)
assert result.exit_code == 1
try:
process = subprocess.Popen( # nosec
[sys.executable, "-m", "aea.cli", "run", "--connections", connection_ids],
stdout=subprocess.PIPE,
env=os.environ.copy(),
)
time.sleep(5.0)
process.send_signal(signal.SIGINT)
process.wait(timeout=5)
assert process.returncode == 0
finally:
poll = process.poll()
if poll is None:
process.terminate()
process.wait(2)
os.chdir(cwd)
try:
shutil.rmtree(t)
except (OSError, IOError):
pass
def test_run_unknown_private_key(pytestconfig):
"""Test that the command 'aea run' works as expected."""
if pytestconfig.getoption("ci"):
pytest.skip("Skipping the test since it doesn't work in CI.")
patch = mock.patch.object(aea.cli.common.logger, "error")
mocked_logger_error = patch.__enter__()
runner = CliRunner()
agent_name = "myagent"
cwd = os.getcwd()
t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(t, "packages"))
os.chdir(t)
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = runner.invoke(cli, [*CLI_LOG_OPTION, "create", "--local", agent_name])
assert result.exit_code == 0
os.chdir(Path(t, agent_name))
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "add", "--local", "connection", "fetchai/local:0.1.0"]
)
assert result.exit_code == 0
# Load the agent yaml file and manually insert the things we need
file = open("aea-config.yaml", mode="r")
# read all lines at once
whole_file = file.read()
find_text = "private_key_paths: {}"
replace_text = """private_key_paths:
fetchai-not: fet_private_key.txt"""
whole_file = whole_file.replace(find_text, replace_text)
# close the file
file.close()
with open("aea-config.yaml", "w") as f:
f.write(whole_file)
# Private key needs to exist otherwise doesn't get to code path we are interested in testing
with open("fet_private_key.txt", "w") as f:
f.write("3801d3703a1fcef18f6bf393fba89245f36b175f4989d8d6e026300dad21e05d")
try:
cli.main([*CLI_LOG_OPTION, "run", "--connections", "fetchai/local:0.1.0"])
except SystemExit:
pass
mocked_logger_error.assert_called_with(
"Unsupported identifier in private key paths."
)
os.chdir(cwd)
try:
shutil.rmtree(t)
except (OSError, IOError):
pass
def test_run_unknown_ledger(pytestconfig):
"""Test that the command 'aea run' works as expected."""
if pytestconfig.getoption("ci"):
pytest.skip("Skipping the test since it doesn't work in CI.")
patch = mock.patch.object(aea.cli.common.logger, "error")
mocked_logger_error = patch.__enter__()
runner = CliRunner()
agent_name = "myagent"
cwd = os.getcwd()
t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(t, "packages"))
os.chdir(t)
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = runner.invoke(cli, [*CLI_LOG_OPTION, "create", "--local", agent_name])
assert result.exit_code == 0
os.chdir(Path(t, agent_name))
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "add", "--local", "connection", "fetchai/local:0.1.0"]
)
assert result.exit_code == 0
# Load the agent yaml file and manually insert the things we need
file = open("aea-config.yaml", mode="r")
# read all lines at once
whole_file = file.read()
# add in the ledger address
find_text = "ledger_apis: {}"
replace_text = """ledger_apis:
unknown:
address: https://ropsten.infura.io/v3/f00f7b3ba0e848ddbdc8941c527447fe
chain_id: 3
gas_price: 20"""
whole_file = whole_file.replace(find_text, replace_text)
# close the file
file.close()
with open("aea-config.yaml", "w") as f:
f.write(whole_file)
try:
cli.main([*CLI_LOG_OPTION, "run", "--connections", "fetchai/local:0.1.0"])
except SystemExit:
pass
mocked_logger_error.assert_called_with("Unsupported identifier in ledger apis.")
os.chdir(cwd)
try:
shutil.rmtree(t)
except (OSError, IOError):
pass
def test_run_fet_private_key_config(pytestconfig):
"""Test that the command 'aea run' works as expected."""
if pytestconfig.getoption("ci"):
pytest.skip("Skipping the test since it doesn't work in CI.")
runner = CliRunner()
agent_name = "myagent"
cwd = os.getcwd()
t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(t, "packages"))
os.chdir(t)
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = runner.invoke(cli, [*CLI_LOG_OPTION, "create", "--local", agent_name])
assert result.exit_code == 0
os.chdir(Path(t, agent_name))
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "add", "--local", "connection", "fetchai/local:0.1.0"]
)
assert result.exit_code == 0
# Load the agent yaml file and manually insert the things we need
file = open("aea-config.yaml", mode="r")
# read all lines at once
whole_file = file.read()
find_text = "private_key_paths: {}"
replace_text = """private_key_paths:
fetchai: default_private_key_not.txt"""
whole_file = whole_file.replace(find_text, replace_text)
# close the file
file.close()
with open("aea-config.yaml", "w") as f:
f.write(whole_file)
error_msg = ""
try:
cli.main([*CLI_LOG_OPTION, "run", "--connections", "fetchai/local:0.1.0"])
except SystemExit as e:
error_msg = str(e)
assert error_msg == "1"
os.chdir(cwd)
try:
shutil.rmtree(t)
except (OSError, IOError):
pass
def test_run_ethereum_private_key_config(pytestconfig):
"""Test that the command 'aea run' works as expected."""
if pytestconfig.getoption("ci"):
pytest.skip("Skipping the test since it doesn't work in CI.")
runner = CliRunner()
agent_name = "myagent"
cwd = os.getcwd()
t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(t, "packages"))
os.chdir(t)
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = runner.invoke(cli, [*CLI_LOG_OPTION, "create", "--local", agent_name])
assert result.exit_code == 0
os.chdir(Path(t, agent_name))
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "add", "--local", "connection", "fetchai/local:0.1.0"]
)
assert result.exit_code == 0
# Load the agent yaml file and manually insert the things we need
file = open("aea-config.yaml", mode="r")
# read all lines at once
whole_file = file.read()
find_text = "private_key_paths: {}"
replace_text = """private_key_paths:
ethereum: default_private_key_not.txt"""
whole_file = whole_file.replace(find_text, replace_text)
# close the file
file.close()
with open("aea-config.yaml", "w") as f:
f.write(whole_file)
error_msg = ""
try:
cli.main([*CLI_LOG_OPTION, "run", "--connections", "fetchai/local:0.1.0"])
except SystemExit as e:
error_msg = str(e)
assert error_msg == "1"
os.chdir(cwd)
try:
shutil.rmtree(t)
except (OSError, IOError):
pass
def test_run_ledger_apis(pytestconfig):
"""Test that the command 'aea run' works as expected."""
if pytestconfig.getoption("ci"):
pytest.skip("Skipping the test since it doesn't work in CI.")
runner = CliRunner()
agent_name = "myagent"
cwd = os.getcwd()
t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(t, "packages"))
os.chdir(t)
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = runner.invoke(cli, [*CLI_LOG_OPTION, "create", "--local", agent_name])
assert result.exit_code == 0
os.chdir(Path(t, agent_name))
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "add", "--local", "connection", "fetchai/local:0.1.0"]
)
assert result.exit_code == 0
# Load the agent yaml file and manually insert the things we need
file = open("aea-config.yaml", mode="r")
# read all lines at once
whole_file = file.read()
# add in the ledger address
find_text = "ledger_apis: {}"
replace_text = """ledger_apis:
ethereum:
address: https://ropsten.infura.io/v3/f00f7b3ba0e848ddbdc8941c527447fe
chain_id: 3
gas_price: 20
fetchai:
network: testnet"""
whole_file = whole_file.replace(find_text, replace_text)
# close the file
file.close()
with open("aea-config.yaml", "w") as f:
f.write(whole_file)
try:
process = subprocess.Popen( # nosec
[
sys.executable,
"-m",
"aea.cli",
"run",
"--connections",
"fetchai/local:0.1.0",
],
stdout=subprocess.PIPE,
env=os.environ.copy(),
)
time.sleep(10.0)
process.send_signal(signal.SIGINT)
process.wait(timeout=20)
assert process.returncode == 0
finally:
poll = process.poll()
if poll is None:
process.terminate()
process.wait(2)
os.chdir(cwd)
try:
shutil.rmtree(t)
except (OSError, IOError):
pass
def test_run_fet_ledger_apis(pytestconfig):
"""Test that the command 'aea run' works as expected."""
if pytestconfig.getoption("ci"):
pytest.skip("Skipping the test since it doesn't work in CI.")
runner = CliRunner()
agent_name = "myagent"
cwd = os.getcwd()
t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(t, "packages"))
os.chdir(t)
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = runner.invoke(cli, [*CLI_LOG_OPTION, "create", "--local", agent_name])
assert result.exit_code == 0
os.chdir(Path(t, agent_name))
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "add", "--local", "connection", "fetchai/local:0.1.0"]
)
assert result.exit_code == 0
# Load the agent yaml file and manually insert the things we need
file = open("aea-config.yaml", mode="r")
# read all lines at once
whole_file = file.read()
# add in the ledger address
find_text = "ledger_apis: {}"
replace_text = """ledger_apis:
fetchai:
network: testnet"""
whole_file = whole_file.replace(find_text, replace_text)
# close the file
file.close()
with open("aea-config.yaml", "w") as f:
f.write(whole_file)
try:
process = subprocess.Popen( # nosec
[
sys.executable,
"-m",
"aea.cli",
"run",
"--connections",
"fetchai/local:0.1.0",
],
stdout=subprocess.PIPE,
env=os.environ.copy(),
)
time.sleep(10.0)
process.send_signal(signal.SIGINT)
process.wait(timeout=20)
assert process.returncode == 0
finally:
poll = process.poll()
if poll is None:
process.terminate()
process.wait(2)
os.chdir(cwd)
try:
shutil.rmtree(t)
except (OSError, IOError):
pass
def test_run_with_install_deps(pytestconfig):
"""Test that the command 'aea run --install-deps' does not crash."""
if pytestconfig.getoption("ci"):
pytest.skip("Skipping the test since it doesn't work in CI.")
runner = CliRunner()
agent_name = "myagent"
cwd = os.getcwd()
t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
packages_src = os.path.join(cwd, "packages")
packages_dst = os.path.join(t, "packages")
shutil.copytree(packages_src, packages_dst)
os.chdir(t)
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = runner.invoke(cli, [*CLI_LOG_OPTION, "create", "--local", agent_name])
assert result.exit_code == 0
os.chdir(Path(t, agent_name))
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "add", "--local", "connection", "fetchai/local:0.1.0"]
)
assert result.exit_code == 0
try:
process = subprocess.Popen( # nosec
[
sys.executable,
"-m",
"aea.cli",
"run",
"--install-deps",
"--connections",
"fetchai/local:0.1.0",
],
stdout=subprocess.PIPE,
env=os.environ.copy(),
)
time.sleep(10.0)
process.send_signal(signal.SIGINT)
process.communicate(timeout=20)
assert process.returncode == 0
finally:
poll = process.poll()
if poll is None:
process.terminate()
process.wait(2)
os.chdir(cwd)
try:
shutil.rmtree(t)
except (OSError, IOError):
pass
def test_run_with_install_deps_and_requirement_file(pytestconfig):
"""Test that the command 'aea run --install-deps' with requirement file does not crash."""
if pytestconfig.getoption("ci"):
pytest.skip("Skipping the test since it doesn't work in CI.")
runner = CliRunner()
agent_name = "myagent"
cwd = os.getcwd()
t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(t, "packages"))
os.chdir(t)
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = runner.invoke(cli, [*CLI_LOG_OPTION, "create", "--local", agent_name])
assert result.exit_code == 0
os.chdir(Path(t, agent_name))
result = runner.invoke(
cli, [*CLI_LOG_OPTION, "add", "--local", "connection", "fetchai/local:0.1.0"]
)
assert result.exit_code == 0
result = runner.invoke(cli, [*CLI_LOG_OPTION, "freeze"])
assert result.exit_code == 0
Path(t, agent_name, "requirements.txt").write_text(result.output)
try:
process = subprocess.Popen( # nosec
[
sys.executable,
"-m",
"aea.cli",
"run",
"--install-deps",
"--connections",
"fetchai/local:0.1.0",
],
stdout=subprocess.PIPE,
env=os.environ.copy(),
)
time.sleep(10.0)
process.send_signal(signal.SIGINT)
process.wait(timeout=20)
assert process.returncode == 0
finally:
poll = process.poll()
if poll is None:
process.terminate()
process.wait(10)
os.chdir(cwd)
try:
shutil.rmtree(t)
except (OSError, IOError):
pass
class TestRunFailsWhenExceptionOccursInSkill:
"""Test that the command 'aea run' fails when an exception occurs in any skill."""
@classmethod
def setup_class(cls):
"""Set the test up."""
cls.runner = CliRunner()
cls.agent_name = "myagent"
cls.cwd = os.getcwd()
cls.t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(cls.t, "packages"))
os.chdir(cls.t)
result = cls.runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = cls.runner.invoke(
cli,
[*CLI_LOG_OPTION, "create", "--local", cls.agent_name],
standalone_mode=False,
)
assert result.exit_code == 0
os.chdir(Path(cls.t, cls.agent_name))
result = cls.runner.invoke(
cli,
[*CLI_LOG_OPTION, "add", "--local", "connection", "fetchai/local:0.1.0"],
standalone_mode=False,
)
assert result.exit_code == 0
shutil.copytree(
Path(CUR_PATH, "data", "exception_skill"),
Path(cls.t, cls.agent_name, "vendor", "fetchai", "skills", "exception"),
)
config_path = Path(cls.t, cls.agent_name, DEFAULT_AEA_CONFIG_FILE)
config = yaml.safe_load(open(config_path))
config.setdefault("skills", []).append("fetchai/exception:0.1.0")
yaml.safe_dump(config, open(config_path, "w"))
try:
cli.main([*CLI_LOG_OPTION, "run", "--connections", "fetchai/local:0.1.0"])
except SystemExit as e:
cls.exit_code = e.code
def test_exit_code_equal_to_1(self):
"""Assert that the exit code is equal to 1 (i.e. catchall for general errors)."""
assert self.exit_code == 1
@classmethod
def teardown_class(cls):
"""Tear the test down."""
os.chdir(cls.cwd)
try:
shutil.rmtree(cls.t)
except (OSError, IOError):
pass
class TestRunFailsWhenConfigurationFileNotFound:
"""Test that the command 'aea run' fails when the agent configuration file is not found in the current directory."""
@classmethod
def setup_class(cls):
"""Set the test up."""
cls.runner = CliRunner()
cls.agent_name = "myagent"
cls.patch = mock.patch.object(aea.cli.common.logger, "error")
cls.mocked_logger_error = cls.patch.__enter__()
cls.cwd = os.getcwd()
cls.t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(cls.t, "packages"))
os.chdir(cls.t)
result = cls.runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = cls.runner.invoke(
cli,
[*CLI_LOG_OPTION, "create", "--local", cls.agent_name],
standalone_mode=False,
)
assert result.exit_code == 0
Path(cls.t, cls.agent_name, DEFAULT_AEA_CONFIG_FILE).unlink()
os.chdir(Path(cls.t, cls.agent_name))
try:
cli.main(["--skip-consistency-check", *CLI_LOG_OPTION, "run"])
except SystemExit as e:
cls.exit_code = e.code
def test_exit_code_equal_to_1(self):
"""Assert that the exit code is equal to 1 (i.e. catchall for general errors)."""
assert self.exit_code == 1
def test_log_error_message(self):
"""Test that the log error message is fixed."""
s = "Agent configuration file '{}' not found in the current directory.".format(
DEFAULT_AEA_CONFIG_FILE
)
self.mocked_logger_error.assert_called_once_with(s)
@classmethod
def teardown_class(cls):
"""Tear the test down."""
cls.patch.__exit__()
os.chdir(cls.cwd)
try:
shutil.rmtree(cls.t)
except (OSError, IOError):
pass
class TestRunFailsWhenConfigurationFileInvalid:
"""Test that the command 'aea run' fails when the agent configuration file is invalid."""
@classmethod
def setup_class(cls):
"""Set the test up."""
cls.runner = CliRunner()
cls.agent_name = "myagent"
cls.patch = mock.patch.object(aea.cli.common.logger, "error")
cls.mocked_logger_error = cls.patch.__enter__()
cls.cwd = os.getcwd()
cls.t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(cls.t, "packages"))
os.chdir(cls.t)
result = cls.runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = cls.runner.invoke(
cli,
[*CLI_LOG_OPTION, "create", "--local", cls.agent_name],
standalone_mode=False,
)
assert result.exit_code == 0
Path(cls.t, cls.agent_name, DEFAULT_AEA_CONFIG_FILE).write_text("")
os.chdir(Path(cls.t, cls.agent_name))
try:
cli.main([*CLI_LOG_OPTION, "run"])
except SystemExit as e:
cls.exit_code = e.code
def test_exit_code_equal_to_1(self):
"""Assert that the exit code is equal to 1 (i.e. catchall for general errors)."""
assert self.exit_code == 1
def test_log_error_message(self):
"""Test that the log error message is fixed."""
s = "Agent configuration file '{}' is invalid. Please check the documentation.".format(
DEFAULT_AEA_CONFIG_FILE
)
self.mocked_logger_error.assert_called_once_with(s)
@classmethod
def teardown_class(cls):
"""Tear the test down."""
cls.patch.__exit__()
os.chdir(cls.cwd)
try:
shutil.rmtree(cls.t)
except (OSError, IOError):
pass
class TestRunFailsWhenConnectionNotDeclared:
"""Test that the command 'aea run --connections' fails when the connection is not declared."""
@classmethod
def setup_class(cls):
"""Set the test up."""
cls.runner = CliRunner()
cls.agent_name = "myagent"
cls.connection_id = "author/unknown_connection:0.1.0"
cls.connection_name = "unknown_connection"
cls.patch = mock.patch.object(aea.cli.common.logger, "error")
cls.mocked_logger_error = cls.patch.__enter__()
cls.cwd = os.getcwd()
cls.t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(cls.t, "packages"))
os.chdir(cls.t)
result = cls.runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = cls.runner.invoke(
cli,
[*CLI_LOG_OPTION, "create", "--local", cls.agent_name],
standalone_mode=False,
)
assert result.exit_code == 0
os.chdir(Path(cls.t, cls.agent_name))
try:
cli.main([*CLI_LOG_OPTION, "run", "--connections", cls.connection_id])
except SystemExit as e:
cls.exit_code = e.code
def test_exit_code_equal_to_1(self):
"""Assert that the exit code is equal to 1 (i.e. catchall for general errors)."""
assert self.exit_code == 1
def test_log_error_message(self):
"""Test that the log error message is fixed."""
s = "Connection ids ['{}'] not declared in the configuration file.".format(
self.connection_id
)
self.mocked_logger_error.assert_called_once_with(s)
@classmethod
def teardown_class(cls):
"""Tear the test down."""
cls.patch.__exit__()
os.chdir(cls.cwd)
try:
shutil.rmtree(cls.t)
except (OSError, IOError):
pass
class TestRunFailsWhenConnectionConfigFileNotFound:
"""Test that the command 'aea run --connections' fails when the connection config file is not found."""
@classmethod
def setup_class(cls):
"""Set the test up."""
cls.runner = CliRunner()
cls.agent_name = "myagent"
cls.connection_id = PublicId.from_str("fetchai/local:0.1.0")
cls.connection_name = cls.connection_id.name
cls.connection_author = cls.connection_id.author
cls.patch = mock.patch.object(aea.cli.common.logger, "error")
cls.mocked_logger_error = cls.patch.__enter__()
cls.cwd = os.getcwd()
cls.t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(cls.t, "packages"))
os.chdir(cls.t)
result = cls.runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = cls.runner.invoke(
cli,
[*CLI_LOG_OPTION, "create", "--local", cls.agent_name],
standalone_mode=False,
)
assert result.exit_code == 0
os.chdir(Path(cls.t, cls.agent_name))
result = cls.runner.invoke(
cli,
[*CLI_LOG_OPTION, "add", "--local", "connection", str(cls.connection_id)],
standalone_mode=False,
)
assert result.exit_code == 0
cls.connection_configuration_path = Path(
cls.t,
cls.agent_name,
"vendor",
cls.connection_author,
"connections",
cls.connection_name,
DEFAULT_CONNECTION_CONFIG_FILE,
)
cls.connection_configuration_path.unlink()
cls.relative_connection_configuration_path = cls.connection_configuration_path.relative_to(
Path(cls.t, cls.agent_name)
)
try:
cli.main(
[
"--skip-consistency-check",
*CLI_LOG_OPTION,
"run",
"--connections",
str(cls.connection_id),
]
)
except SystemExit as e:
cls.exit_code = e.code
def test_exit_code_equal_to_1(self):
"""Assert that the exit code is equal to 1 (i.e. catchall for general errors)."""
assert self.exit_code == 1
def test_log_error_message(self):
"""Test that the log error message is fixed."""
s = "Connection configuration not found: {}".format(
self.relative_connection_configuration_path
)
self.mocked_logger_error.assert_called_once_with(s)
@classmethod
def teardown_class(cls):
"""Tear the test down."""
cls.patch.__exit__()
os.chdir(cls.cwd)
try:
shutil.rmtree(cls.t)
except (OSError, IOError):
pass
class TestRunFailsWhenConnectionNotComplete:
"""Test that the command 'aea run --connections' fails when the connection.py module is missing."""
@classmethod
def setup_class(cls):
"""Set the test up."""
cls.runner = CliRunner()
cls.agent_name = "myagent"
cls.connection_id = PublicId.from_str("fetchai/local:0.1.0")
cls.connection_author = cls.connection_id.author
cls.connection_name = cls.connection_id.name
cls.patch = mock.patch.object(aea.cli.common.logger, "error")
cls.mocked_logger_error = cls.patch.__enter__()
cls.cwd = os.getcwd()
cls.t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(cls.t, "packages"))
os.chdir(cls.t)
result = cls.runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = cls.runner.invoke(
cli,
[*CLI_LOG_OPTION, "create", "--local", cls.agent_name],
standalone_mode=False,
)
assert result.exit_code == 0
os.chdir(Path(cls.t, cls.agent_name))
result = cls.runner.invoke(
cli,
[*CLI_LOG_OPTION, "add", "--local", "connection", str(cls.connection_id)],
standalone_mode=False,
)
assert result.exit_code == 0
connection_module_path = Path(
cls.t,
cls.agent_name,
"vendor",
"fetchai",
"connections",
cls.connection_name,
"connection.py",
)
connection_module_path.unlink()
cls.relative_connection_module_path = connection_module_path.relative_to(
Path(cls.t, cls.agent_name)
)
try:
cli.main(
[
"--skip-consistency-check",
*CLI_LOG_OPTION,
"run",
"--connections",
str(cls.connection_id),
]
)
except SystemExit as e:
cls.exit_code = e.code
def test_exit_code_equal_to_1(self):
"""Assert that the exit code is equal to 1 (i.e. catchall for general errors)."""
assert self.exit_code == 1
def test_log_error_message(self):
"""Test that the log error message is fixed."""
s = "An error occurred while loading connection {}: Connection module '{}' not found.".format(
self.connection_id, self.relative_connection_module_path
)
self.mocked_logger_error.assert_called_once_with(s)
@classmethod
def teardown_class(cls):
"""Tear the test down."""
cls.patch.__exit__()
os.chdir(cls.cwd)
try:
shutil.rmtree(cls.t)
except (OSError, IOError):
pass
class TestRunFailsWhenConnectionClassNotPresent:
"""Test that the command 'aea run --connections' fails when the connection class is missing in connection.py."""
@classmethod
def setup_class(cls):
"""Set the test up."""
cls.runner = CliRunner()
cls.agent_name = "myagent"
cls.connection_id = "fetchai/local:0.1.0"
cls.connection_name = "local"
cls.patch = mock.patch.object(aea.cli.common.logger, "error")
cls.mocked_logger_error = cls.patch.__enter__()
cls.cwd = os.getcwd()
cls.t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(cls.t, "packages"))
os.chdir(cls.t)
result = cls.runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = cls.runner.invoke(
cli,
[*CLI_LOG_OPTION, "create", "--local", cls.agent_name],
standalone_mode=False,
)
assert result.exit_code == 0
os.chdir(Path(cls.t, cls.agent_name))
result = cls.runner.invoke(
cli,
[*CLI_LOG_OPTION, "add", "--local", "connection", cls.connection_id],
standalone_mode=False,
)
assert result.exit_code == 0
Path(
cls.t,
cls.agent_name,
"vendor",
"fetchai",
"connections",
cls.connection_name,
"connection.py",
).write_text("")
try:
cli.main(
[
"--skip-consistency-check",
*CLI_LOG_OPTION,
"run",
"--connections",
cls.connection_id,
]
)
except SystemExit as e:
cls.exit_code = e.code
def test_exit_code_equal_to_1(self):
"""Assert that the exit code is equal to 1 (i.e. catchall for general errors)."""
assert self.exit_code == 1
def test_log_error_message(self):
"""Test that the log error message is fixed."""
s = "An error occurred while loading connection {}: Connection class '{}' not found.".format(
self.connection_id, "OEFLocalConnection"
)
self.mocked_logger_error.assert_called_once_with(s)
@classmethod
def teardown_class(cls):
"""Tear the test down."""
cls.patch.__exit__()
os.chdir(cls.cwd)
try:
shutil.rmtree(cls.t)
except (OSError, IOError):
pass
class TestRunFailsWhenProtocolConfigFileNotFound:
"""Test that the command 'aea run' fails when a protocol configuration file is not found."""
@classmethod
def setup_class(cls):
"""Set the test up."""
cls.runner = CliRunner()
cls.agent_name = "myagent"
cls.connection_id = "fetchai/stub:0.1.0"
cls.connection_name = "local"
cls.patch = mock.patch.object(aea.cli.common.logger, "error")
cls.mocked_logger_error = cls.patch.__enter__()
cls.cwd = os.getcwd()
cls.t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(cls.t, "packages"))
os.chdir(cls.t)
result = cls.runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = cls.runner.invoke(
cli,
[*CLI_LOG_OPTION, "create", "--local", cls.agent_name],
standalone_mode=False,
)
assert result.exit_code == 0
os.chdir(Path(cls.t, cls.agent_name))
configuration_file_path = Path(
cls.t,
cls.agent_name,
"vendor",
"fetchai",
"protocols",
"default",
"protocol.yaml",
)
configuration_file_path.unlink()
cls.relative_configuration_file_path = configuration_file_path.relative_to(
Path(cls.t, cls.agent_name)
)
try:
cli.main(
[
"--skip-consistency-check",
*CLI_LOG_OPTION,
"run",
"--connections",
cls.connection_id,
]
)
except SystemExit as e:
cls.exit_code = e.code
def test_exit_code_equal_to_1(self):
"""Assert that the exit code is equal to 1 (i.e. catchall for general errors)."""
assert self.exit_code == 1
def test_log_error_message(self):
"""Test that the log error message is fixed."""
s = "Protocol configuration not found: {}".format(
self.relative_configuration_file_path
)
self.mocked_logger_error.assert_called_once_with(s)
@classmethod
def teardown_class(cls):
"""Tear the test down."""
cls.patch.__exit__()
os.chdir(cls.cwd)
try:
shutil.rmtree(cls.t)
except (OSError, IOError):
pass
class TestRunFailsWhenProtocolNotComplete:
"""Test that the command 'aea run' fails when a protocol directory is not complete."""
@classmethod
def setup_class(cls):
"""Set the test up."""
cls.runner = CliRunner()
cls.agent_name = "myagent"
cls.patch = mock.patch.object(aea.cli.common.logger, "error")
cls.mocked_logger_error = cls.patch.__enter__()
cls.cwd = os.getcwd()
cls.t = tempfile.mkdtemp()
# copy the 'packages' directory in the parent of the agent folder.
shutil.copytree(Path(CUR_PATH, "..", "packages"), Path(cls.t, "packages"))
os.chdir(cls.t)
result = cls.runner.invoke(
cli, [*CLI_LOG_OPTION, "init", "--local", "--author", AUTHOR]
)
assert result.exit_code == 0
result = cls.runner.invoke(
cli,
[*CLI_LOG_OPTION, "create", "--local", cls.agent_name],
standalone_mode=False,
)
assert result.exit_code == 0
os.chdir(os.path.join(cls.t, cls.agent_name))
result = cls.runner.invoke(
cli,
[*CLI_LOG_OPTION, "add", "--local", "protocol", "fetchai/fipa:0.1.0"],
standalone_mode=False,
)
assert result.exit_code == 0
# remove protocol configuration
configuration_path = Path(
cls.t,
cls.agent_name,
"vendor",
"fetchai",
"protocols",
"fipa",
"protocol.yaml",
)
configuration_path.unlink()
cls.relative_configuration_file_path = configuration_path.relative_to(
Path(cls.t, cls.agent_name)
)
try:
cli.main(["--skip-consistency-check", *CLI_LOG_OPTION, "run"])
except SystemExit as e:
cls.exit_code = e.code
def test_exit_code_equal_to_1(self):
"""Assert that the exit code is equal to 1 (i.e. catchall for general errors)."""
assert self.exit_code == 1
def test_log_error_message(self):
"""Test that the log error message is fixed."""
s = "Protocol configuration not found: {}".format(
self.relative_configuration_file_path
)
self.mocked_logger_error.assert_called_once_with(s)
@classmethod
def teardown_class(cls):
"""Tear the test down."""
cls.patch.__exit__()
os.chdir(cls.cwd)
try:
shutil.rmtree(cls.t)
except (OSError, IOError):
pass
| 30.671358
| 120
| 0.583746
| 5,284
| 43,584
| 4.660863
| 0.061696
| 0.03021
| 0.034595
| 0.04166
| 0.891465
| 0.883913
| 0.875508
| 0.874411
| 0.862474
| 0.849034
| 0
| 0.010741
| 0.286527
| 43,584
| 1,420
| 121
| 30.692958
| 0.781258
| 0.134453
| 0
| 0.806142
| 0
| 0.00096
| 0.133542
| 0.011104
| 0
| 0
| 0
| 0
| 0.081574
| 1
| 0.044146
| false
| 0.021113
| 0.015355
| 0
| 0.068138
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
e8cb51d01ce57b5b9f321b79765353910df7f097
| 8,321
|
py
|
Python
|
neuron_simulator_service/DSGC_SAC/olap.py
|
jpm343/RetinaX
|
63f84209b4f8bdcdc88f35c54a03e7b7c56f4ab3
|
[
"MIT"
] | 2
|
2020-12-06T23:04:39.000Z
|
2020-12-29T18:28:20.000Z
|
neuron_simulator_service/DSGC_SAC/olap.py
|
jpm343/RetinaX
|
63f84209b4f8bdcdc88f35c54a03e7b7c56f4ab3
|
[
"MIT"
] | null | null | null |
neuron_simulator_service/DSGC_SAC/olap.py
|
jpm343/RetinaX
|
63f84209b4f8bdcdc88f35c54a03e7b7c56f4ab3
|
[
"MIT"
] | 1
|
2020-10-23T19:40:59.000Z
|
2020-10-23T19:40:59.000Z
|
# -*- coding: utf-8 -*-
"""
Created on Fri Feb 05 20:10:26 2016
@author: Patricio
"""
import numpy as np
from neuron import h
def anglewithin(anglex, anglemin, anglemax):
"""
Checks if anglex is within anglemin and anglemax
"""
if anglemin > anglemax:
if anglex < anglemax:
anglex += np.pi*2
anglemax += np.pi*2
return anglemin < anglex and anglex < anglemax
def olap0(cell2,cell1,dend2,dend1,seg2,seg1,dx=1):
"""
Calculates overlaping area between the arcs assigned to two segments
--------------
cell1: Neuron object. Must be of the DSRGC type
cell2: Neuron object. Must be of SAC type
dend1: Index of dendrite 1. Must be dend0
dend2: Index of dendrite 2.
seg1: Index of segment 1
seg2: index of segment 2
dx: spatial discretization for area calculation (default 1)
returns
-------
Area of overlap
"""
x1=h.x3d(0,sec=cell1.soma)
y1=h.y3d(0,sec=cell1.soma)
x2=h.x3d(0,sec=cell2.soma)
y2=h.y3d(0,sec=cell2.soma)
l1=cell1.dend0[dend1].L
l2=cell2.dend[dend2].L
ns1=cell1.dend0[dend1].nseg
ns2=cell2.dend[dend2].nseg
if (np.sqrt((x1-x2)**2+(y1-y2)**2)>=(l1+l2)):
return 0
ls=l1*(seg1+1)/ns1
limoffset=np.array([[0, ls, -0.71*ls, 0.71*ls],
[-0.71*ls, 0.71*ls, 0, ls],
[-ls, 0, -0.71*ls, 0.71*ls],
[-0.71*ls, 0.71*ls, -ls, 0]])
#Identificamos la posible area cubierta por la dendrita 1
xmin1, xmax1, ymin1, ymax1 = np.array([x1,x1,y1,y1]) + limoffset[dend1]
ls=l2*(seg2+1)/ns2
limoffset=np.array([[0, ls, -0.71*ls, 0.71*ls],
[-0.71*ls, 0.71*ls, 0, ls],
[-ls, 0, -0.71*ls, 0.71*ls],
[-0.71*ls, 0.71*ls, -ls, 0]])
#Identificamos la posible area cubierta por la dendrita 2
xmin2, xmax2, ymin2, ymax2 = np.array([x2,x2,y2,y2]) + limoffset[dend2]
if xmin1>xmax2 or xmin2>xmax1 or ymin1>ymax2 or ymin2>ymax1:
# print " no overlap "
return 0
sumarea = 0
#limites polares del segmento 1
limd1 = seg1*l1/ns1 #limite segmento dendrita 1 (menor)
limd2 = (seg1+1)*l1/ns1 #limite segmento dendrita 1 (mayor)
limang1 = (2*dend1-1)*np.pi/4 #limite angulo dendrita1
limang2 = (2*dend1+1)*np.pi/4 #limite angulo dendrita2 (opuesta)
limang1 -= 2*np.pi*(limang1>np.pi)
limang2 -= 2*np.pi*(limang2>np.pi)
#limites polares del segmento 2
limd3 = seg2*l2/ns2 #limite segmento dendrita 2 (menor)
limd4 = (seg2+1)*l2/ns2 #limite segmento dendrita 2 (mayor)
limang3 = (2*dend2-1)*np.pi/4 #limite angulo dendrita2
limang4 = (2*dend2+1)*np.pi/4 #limite angulo dendrita1 (opuesta)
limang3 -= 2*np.pi*(limang3>np.pi)
limang4 -= 2*np.pi*(limang4>np.pi)
xlim1=max(xmin1,xmin2)
xlim2=min(xmax1,xmax2)
ylim1=max(ymin1,ymin2)
ylim2=min(ymax1,ymax2)
for x in np.arange(xlim1+dx/2,xlim2,dx):
for y in np.arange(ylim1+dx/2,ylim2,dx):
#primero chequear que el punto pertenence al segmento 1
d1 = np.sqrt((x-x1)**2+(y-y1)**2) #radio al segmento 1
ang1 = np.arctan2(y-y1,x-x1) #angulo al segmento 1
if (d1>limd1 and d1<=limd2 and anglewithin(ang1,limang1,limang2)): #Si limd1<d1<=limd2 y limang1 <ang1 <= limang2; osea si se encuentra en el rango
#luego chequear si pertenece al segmento 2
d2 = np.sqrt((x-x2)**2+(y-y2)**2)
ang2 = np.arctan2(y-y2,x-x2)
if (d2>limd3 and d2<=limd4 and anglewithin(ang2,limang3,limang4)):
sumarea += dx**2 # Eureka!! Si limd3<d2<=limd4 y limang3<ang2<=limang4.
#print x,y,d1,d2,ang1,ang2
#print limd1,limd2,limd3,limd4
#print limang1,limang2,limang3,limang4
return sumarea
def olap1(cell2,cell1,dend2,dend1,seg2,seg1,dx=1):
"""
Calculates overlaping area between the arcs assigned to two segments
----------------
cell1: Neuron object. Must be of the DSRGC type
cell2: Neuron object. Must be of SAC type
dend1: Index of dendrite 1. Must be dend1
dend2: Index of dendrite 2.
seg1: Index of segment 1
seg2: index of segment 2
dx: spatial discretization for area calculation (default 1)
returns
-------
Area of overlap
"""
x1=h.x3d(0,sec=cell1.soma)
y1=h.y3d(0,sec=cell1.soma)
x2=h.x3d(0,sec=cell2.soma)
y2=h.y3d(0,sec=cell2.soma)
x10=h.x3d(0,sec=cell1.dend1[dend1])
x11=h.x3d(1,sec=cell1.dend1[dend1])
y10=h.y3d(0,sec=cell1.dend1[dend1])
y11=h.y3d(1,sec=cell1.dend1[dend1])
d1=np.sqrt(x10**2 + y10**2)
d2=np.sqrt(x11**2 + y11**2)
l1=cell1.dend1[dend1].L
l2=cell2.dend[dend2].L
ns1=cell1.dend1[dend1].nseg
ns2=cell2.dend[dend2].nseg
if (np.sqrt((x1-x2)**2+(y1-y2)**2)>=(l1+l2)):
return 0
limoffset=np.array([[d1*0.71, d2, -0.71*d2, 0],
[d1*0.71, d2, 0, 0.71*d2],
[0, 0.71*d2, 0.71*d1, d2],
[-0.71*d2, 0, 0.71*d1, d2],
[-d2, -0.71*d1, 0, 0.71*d2],
[-d2, -0.71*d1, -0.71*d2, 0],
[-0.71*d2, 0, -d2, -0.71*d1],
[0, 0.71*d2, -d2, -0.71*d1]])
#Si distancia entre somas permite sobrelape de area entre dendritas, identificamos la posible area cubierta por la dendrita 1 para iterar ahí
xmin1, xmax1, ymin1, ymax1 = np.array([x1,x1,y1,y1]) + limoffset[dend1]
ls=l2*(seg2+1)/ns2
limoffset=np.array([[0, ls, -0.71*ls, 0.71*ls],
[-0.71*ls, 0.71*ls, 0, ls],
[-ls, 0, -0.71*ls, 0.71*ls],
[-0.71*ls, 0.71*ls, -ls, 0]])
#Si distancia entre somas permite sobrelape de area entre dendritas, identificamos la posible area cubierta por la dendrita 1 para iterar ahí
xmin2, xmax2, ymin2, ymax2 = np.array([x2,x2,y2,y2]) + limoffset[dend2]
if xmin1>xmax2 or xmin2>xmax1 or ymin1>ymax2 or ymin2>ymax1:
# print " no overlap "
return 0
sumarea = 0
#limites polares del segmento 1
limd1 = d1 + (d2-d1)*seg1/ns1 #limite segmento dendrita 1 (menor)
limd2 = d1 + (d2-d1)*(seg1+1)/ns1 #limite segmento dendrita 1 (mayor)
limang1 = (dend1-1)*np.pi/4 #limite angulo dendrita1
limang2 = dend1*np.pi/4 #limite angulo dendrita2 (opuesta)
limang1 -= 2*np.pi*(limang1>np.pi)
limang2 -= 2*np.pi*(limang2>np.pi)
#limites polares del segmento 2
limd3 = seg2*l2/ns2 #limite segmento dendrita 2 (menor)
limd4 = (seg2+1)*l2/ns2 #limite segmento dendrita 2 (mayor)
limang3 = (2*dend2-1)*np.pi/4 #limite angulo dendrita2
limang4 = (2*dend2+1)*np.pi/4 #limite angulo dendrita1 (opuesta)
limang3 -= 2*np.pi*(limang3>np.pi)
limang4 -= 2*np.pi*(limang4>np.pi)
xlim1=max(xmin1,xmin2)
xlim2=min(xmax1,xmax2)
ylim1=max(ymin1,ymin2)
ylim2=min(ymax1,ymax2)
for x in np.arange(xlim1+dx/2,xlim2,dx):
for y in np.arange(ylim1+dx/2,ylim2,dx):
#primero chequear que el punto pertenence al segmento 1
d1 = np.sqrt((x-x1)**2+(y-y1)**2) #radio al segmento 1
ang1 = np.arctan2(y-y1,x-x1) #angulo al segmento 1
#si la suma es menor a 0
if (d1>limd1 and d1<=limd2 and anglewithin(ang1,limang1,limang2)): #Si limd1<d1<=limd2 y limang1 <ang1 <= limang2; osea si se encuentra en el rango
#luego chequear si pertenece al segmento 2
d2 = np.sqrt((x-x2)**2+(y-y2)**2)
ang2 = np.arctan2(y-y2,x-x2)
if (d2>limd3 and d2<=limd4 and anglewithin(ang2,limang3,limang4)):
sumarea += dx**2 # Eureka!! Si limd3<d2<=limd4 y limang3<ang2<=limang4.
#print x,y,d1,d2,ang1,ang2
#print limd1,limd2,limd3,limd4
#print limang1,limang2,limang3,limang4
return sumarea
if __name__ == "__main__":
h.load_file("SACtmp.hoc")
h.load_file("dsrgc_temp.hoc")
sac=h.SAC(4,120,0,0,3,3,1.5)
ds1=h.DSRGC(120,0,0,3,1)
print olap1(ds1,sac,7,3,1,2,1)
| 37.147321
| 159
| 0.576012
| 1,308
| 8,321
| 3.655963
| 0.146789
| 0.025094
| 0.025094
| 0.03074
| 0.88394
| 0.862819
| 0.859682
| 0.828733
| 0.825805
| 0.790882
| 0
| 0.118917
| 0.276409
| 8,321
| 223
| 160
| 37.313901
| 0.675303
| 0.219445
| 0
| 0.661417
| 0
| 0
| 0.005915
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | null | 0
| 0.015748
| null | null | 0.007874
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
2cd71112c44889266428fa8219d71a063a2470e7
| 87
|
py
|
Python
|
Deep Learning Guide/2. Basic python - Structure + OOP and more/gonit/arithmatic.py
|
nomancseku/NSL-HW
|
9a130a97ce0909cff93a77378f95e44c69a8bc7c
|
[
"MIT"
] | 1
|
2020-11-29T20:02:08.000Z
|
2020-11-29T20:02:08.000Z
|
Deep Learning Guide/2. Basic python - Structure + OOP and more/gonit/arithmatic.py
|
nomancseku/NSL-RA-Training
|
9a130a97ce0909cff93a77378f95e44c69a8bc7c
|
[
"MIT"
] | 1
|
2020-10-25T18:59:03.000Z
|
2020-10-25T18:59:21.000Z
|
Deep Learning Guide/2. Basic python - Structure + OOP and more/gonit/arithmatic.py
|
nomancseku/NSL-RA-Training
|
9a130a97ce0909cff93a77378f95e44c69a8bc7c
|
[
"MIT"
] | null | null | null |
OPERATIONS = ['Add', 'Sub']
def add(a, b):
return a + b
def sub(a, b):
return a - b
| 12.428571
| 27
| 0.551724
| 17
| 87
| 2.823529
| 0.411765
| 0.166667
| 0.333333
| 0.375
| 0.416667
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.241379
| 87
| 7
| 28
| 12.428571
| 0.727273
| 0
| 0
| 0
| 0
| 0
| 0.068182
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.4
| false
| 0
| 0
| 0.4
| 0.8
| 0
| 1
| 0
| 0
| null | 0
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 1
| 1
| 0
|
0
| 7
|
2ce96e66a8dee805503c60caad369e76cba6f7e0
| 189
|
py
|
Python
|
utils/__init__.py
|
tzuni/project-organization-tutorial
|
28dfb0c1aa062a3aae13be058d0d9855049eccad
|
[
"MIT"
] | null | null | null |
utils/__init__.py
|
tzuni/project-organization-tutorial
|
28dfb0c1aa062a3aae13be058d0d9855049eccad
|
[
"MIT"
] | null | null | null |
utils/__init__.py
|
tzuni/project-organization-tutorial
|
28dfb0c1aa062a3aae13be058d0d9855049eccad
|
[
"MIT"
] | null | null | null |
from .myfunc import load_data, do_pca, get_colors, cluster_with_my_favorite_settings
__all__ = [
"load_data",
"do_pca",
"get_colors",
"cluster_with_my_favorite_settings",
]
| 23.625
| 84
| 0.73545
| 26
| 189
| 4.653846
| 0.576923
| 0.132231
| 0.165289
| 0.214876
| 0.842975
| 0.842975
| 0.842975
| 0.842975
| 0.842975
| 0.842975
| 0
| 0
| 0.164021
| 189
| 8
| 85
| 23.625
| 0.765823
| 0
| 0
| 0
| 0
| 0
| 0.305263
| 0.173684
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.142857
| 0
| 0.142857
| 0
| 1
| 0
| 0
| null | 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 9
|
fa193c6952e43decd6fb6988b8b53c599547d83d
| 240
|
py
|
Python
|
fused_home/implementations/broadlink.py
|
phntom/fused_home
|
d3399c2200087206dbbf3a14b3b5944352395198
|
[
"MIT"
] | 1
|
2020-09-01T21:50:51.000Z
|
2020-09-01T21:50:51.000Z
|
fused_home/implementations/broadlink.py
|
phntom/fused_home
|
d3399c2200087206dbbf3a14b3b5944352395198
|
[
"MIT"
] | null | null | null |
fused_home/implementations/broadlink.py
|
phntom/fused_home
|
d3399c2200087206dbbf3a14b3b5944352395198
|
[
"MIT"
] | null | null | null |
from dataclasses import field
from interfaces.connection import HostPort
from interfaces.sensor import AirQuality, Noise, Lux, Thermometer
class A1(AirQuality, Noise, Lux, Thermometer):
host_port: HostPort = field(default=HostPort)
| 24
| 65
| 0.8
| 29
| 240
| 6.586207
| 0.586207
| 0.146597
| 0.188482
| 0.303665
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.004808
| 0.133333
| 240
| 9
| 66
| 26.666667
| 0.913462
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 0.6
| 0
| 1
| 0
| 1
| 0
| 0
| null | 0
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
fa4a7d45bd6cf5749288549033a56fa201245d93
| 105
|
py
|
Python
|
domain_adaptation/__init__.py
|
OptimusPrimus/dcase2019_task1b
|
321e10affd47ccecc9dd4d2d327e466481f457c9
|
[
"MIT"
] | 8
|
2019-06-30T10:05:33.000Z
|
2022-01-09T20:40:05.000Z
|
domain_adaptation/__init__.py
|
OptimusPrimus/dcase2019_task1b
|
321e10affd47ccecc9dd4d2d327e466481f457c9
|
[
"MIT"
] | null | null | null |
domain_adaptation/__init__.py
|
OptimusPrimus/dcase2019_task1b
|
321e10affd47ccecc9dd4d2d327e466481f457c9
|
[
"MIT"
] | 3
|
2019-11-06T19:06:53.000Z
|
2020-06-09T16:01:50.000Z
|
from domain_adaptation.mutual_information import MutualInformationDA
from domain_adaptation.mm import MSE
| 52.5
| 68
| 0.914286
| 13
| 105
| 7.153846
| 0.692308
| 0.215054
| 0.430108
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.066667
| 105
| 2
| 69
| 52.5
| 0.94898
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
d7351bcc64a57fbea280fdcefa0aadc9a068f60a
| 89
|
py
|
Python
|
core/algorithms/__init__.py
|
lehduong/Policy-gradient-credit-assignment
|
1d4c102964b985212874c1fe8710a8aa6ff9f328
|
[
"MIT"
] | 8
|
2020-06-29T03:45:14.000Z
|
2022-02-21T03:41:34.000Z
|
core/algorithms/__init__.py
|
lehduong/Policy-gradient-credit-assignment
|
1d4c102964b985212874c1fe8710a8aa6ff9f328
|
[
"MIT"
] | null | null | null |
core/algorithms/__init__.py
|
lehduong/Policy-gradient-credit-assignment
|
1d4c102964b985212874c1fe8710a8aa6ff9f328
|
[
"MIT"
] | null | null | null |
from .a2c_acktr import A2C_ACKTR
from .cpc_a2c import CPC_A2C_ACKTR
from .ppo import PPO
| 22.25
| 34
| 0.831461
| 17
| 89
| 4.058824
| 0.352941
| 0.347826
| 0.347826
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.051948
| 0.134831
| 89
| 3
| 35
| 29.666667
| 0.844156
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
d74a06b68af6035e9538497fa7103a98799cba9d
| 43,435
|
py
|
Python
|
tests/ssh/vectors.py
|
lyft/bless
|
2a12482958b83d4eae7765b29742611d342f0626
|
[
"Apache-2.0"
] | 19
|
2017-01-31T02:20:33.000Z
|
2020-07-22T05:50:38.000Z
|
tests/ssh/vectors.py
|
lyft/bless
|
2a12482958b83d4eae7765b29742611d342f0626
|
[
"Apache-2.0"
] | 35
|
2016-08-03T17:49:35.000Z
|
2021-06-22T18:20:52.000Z
|
tests/ssh/vectors.py
|
lyft/bless
|
2a12482958b83d4eae7765b29742611d342f0626
|
[
"Apache-2.0"
] | 7
|
2016-12-16T16:54:30.000Z
|
2021-08-30T14:05:31.000Z
|
import base64
# pylint: disable = line-too-long
# These are for the test CA Private Key. Please don't use it for anything other than unit tests. Just don't.
RSA_CA_PRIVATE_KEY_NOT_ENCRYPTED = b'-----BEGIN RSA PRIVATE KEY-----\nMIIJKQIBAAKCAgEA4jQmfF4lJ21Re0e7vHcxVUt0M3aIUKvwHzEJIax2Yn5V0jaw\nEXTFzuXn8dlXIBOAIFO311Pt4brMUKdCE8lRQH66FS70R4rC7c+rD2ZadNfL+xr9\nH77KzAWNTVLLHCz6IFuIb0gbUEipdj5465dp/7yQQWLzvtuNTg2uXRT8ovaqkInC\nEWHe+7lcFDbqKH9NxlVFo/I5MFWo4PQw15VezQmRVz+B3iYsdaAW9witM2aYrBHQ\nc1IM+lhsvGiX7cNt9pj0IT+xR60sDo7E7gQXfw9Ao9j5R3b/LKlzi4L8ZPVV8Rzg\nAtlUJlgLwK63eFhvl5/fF1pvtbiKRcjJTa+09H+fUm7/mddUVfVjQXm7RKFmTPxI\njv8EsXaLhIgyJmE1OCpWPyavYunBIcHTibrx30aw+cPWZBDGVx/Hult84CNeadNX\neZCafhOdbUrEofSfs0kTWO9HLfWfcKuzdownpy6rr6DFsrhyD9fjxDXo+em5jM6J\nO0PmES67hEvhyDzoyLnsOZyE3BvUKy/EUmu54kHrknh58gNOqa6mkNBWORk7MfZR\nHNHMYTZrN1xA+BxXlpBCJm6Kp5nnEb2gTAH/aQ1W7eGwzj26An04EYe2UOh6YLhi\nRCQl7R6MUlVzy4o7MaZd+MZxcqLbUCrmMa8SwNFvcNy4sRx459dGlT/n06kCAwEA\nAQKCAgAphodWJ3ZMoZ3mssl9FKiCzwI6/FST8qx3HWpeuylUdXrNx2pVGgnCLKSC\n2nJLGilYReYm6mpuGPuvBrVzqm53F4yTnPYNOCUGwSvW/OQ4NPFmXJMBQ+Y4xAAn\npL5SotMcI5GNVEBnYZ9ybI+IOFimMPiOeFrku6taG9rZjaO/SucO96sfw8bKkUGd\nGGOuIYimkzrgmPP0spT5Dvr0aKBppYr/6FGv9XQN9+CfYwFgwUHfvLl2oiZtwtPb\nVpwlcs36CiQvAmFKFjlTRtRSGYAyvBsSuR8yBl9b1JO4lcg9xGgNhk59V2ZCT8GA\nktJtjlaWECxFPj3pr0H7A5wo3curCmox0nyP6quGzm27AWoHGL7oiCZ7LYLgLXTH\nR8O2LjypTSmDfk7NfITnOYBv6DW3X1BC2aE69sZQnwp5+XWfJ0Oe96PCeVbHZjJc\nIi+CB9JycNouh+kc5qIv4AgN9HVoytYQadlQl6/tOl4hHFQKTn+PZPnzwlH+1u3e\nvoOOQHTU7PXgHyf+oOLL+cjhCZmYu4CxFITpJGfDi9cXKb/K8wz+aBLV1oQK1BTo\nVuyDVV0ZNZ6VDBpwF685HGV8PnDKPcqahFOuKMZ/BT9F8KdlE9qzQmfpZsLC5SPr\nUp3VJA8xs3mGm4QwnJzrpzbDBlg7EnduNTqDTZwivxSL9AzirQKCAQEA9/PDW6ru\n5piQqplyIxikyKkjYotf5+v+hae9+rCBbW70BCS6n56zKUEaV2Bq9G3KWya+fVki\n1TnpvlF17XErq0s3GiNKH+c85pGW6zxvwkOnXK4z+MYg2IcH5BZ3t89Ai3AzK2UE\nzu/Q2/3W8tOeDDclcctZo8xFfYfPM0TsTCpDvybSsWcKj2R8DhRL8w3YywAe5cB0\n2tlr3PDbKhqu0oRINnR/dHAQVgK8lvME1RXonEtV3/KZhEFoLg2PeqkOo4UV6EvP\n2hX9RhtiQiYiyvI1invXizekS8VwGV84RO2X1Cigsbut6Cny36yDpLcLF68fgKNy\nREWCxfmwgJ/hFwKCAQEA6YutyXchTpU5tP+dGN0LPkzpyRVE9uwmEjZtJpq7kn4/\nrzrjMucn0aRmLlhzIWHwV4kUO1vmI8vDuIJ7EvYt8xx96me9iPkzv/UKjrFHrku9\n46hgOJ+h2tUoqdM2hnrjR/OEdgWTyELLtnsDnamHIk4gBpl6zXM/G46zXUr8J9UG\nGeJhpAXijXLWFHSer8T9SouZ7vzdCBh4BiBK9om+mmHajiZ+vNbUVOmsPxrgcxoh\n0daK4IbQvIbQJYfJJfeAQVSM0gvu8+ThlFj7yk/RnO4h1flomqEt0r0ALuff5XrC\nNun+4Y+n/IRKi3SzcWH08zah59LuSDNjIGxMuMtpPwKCAQEAyfUedhewJtq1Wn9J\nXBTCgz5gt+9V2o157ltGfl4tzXjGAGn6J/EXdM62Kd06wIR8gen41hg4KvzUylOH\nfjLjos3Mv9lmkr3B+Ps0tb2wOcbpFrA9XK/kKPkzEDDMqkaBCBIHW50YYYUr1UPY\nREjhPoncUeeTx7qmDy0DM3s8DH2QWK3ChwSqsUjjUoRtqDbrEc2zXOd5Rpg5Juh3\nWsAJDSb5uoEBH1H3vFbWTQz8LqN9p3AlLhdnuzWbKYeaCgqRBddslJzLW5L1jJjZ\nW4+8XxkRSw677YUQqTbTq5bHOj1boU7GNH3tlGA2lsDpKMx+mHfnbNu0Qq9raN2L\nSfjvWQKCAQBZWlmJRQz3Ndy4RTvjsV6F3YNsrbiPCFagjTZBmN2+9JKFBnC6nvn7\nGX0GqkySLxh3RTj6ZPSuKV2ekD1qScnWw8XhEwPPDhkgji4V3fng05W5LkhyIZEZ\nWoiOQQMRfJ7MfnzlcsjRy8yI6pO9lIjhNSbHn5z+UeOJNZWmUfQbgUMuUBCvYpkF\nKTSC6wNzmFiYVsT0TMZ8PHBfV6eWn6jPBDVMQaonscHXIvgFxNCu+QaLdBv6P1pJ\nZwLn+QWagxEM7b5a9rnbkmxEB699/f/inLFRXnUJBDW19R3G1GwzLj50KB6eSgop\ncKvcoy+sZ6ACFZroSSllclOwqf7IjPqdAoIBAQCqOmf9ds47o1fXBwXMpNXxtX6z\nQ8E4n2L4QbjZBWpaEVZHbJw0XZKqF/3Z9EIHIttBpmNv0NpbJTbnKr5fgPelyX2H\nfN8bplELFlGeZ5cvYKmOvq8kjBpNsbigk9oPVWGfRAtkuoNpOgDsMJLo5BAE8MyC\nlL7x/rwIPpndRytSBqBfZhZhFuDHZGZWZluUAqttTSifuGZDA42+w05xaeR3Z1I+\nyL/Vf09RHzfeKBd/7GXsWBUtnqTMX7KKf1V92rmC7v/+DALxcTtMyYumErHedjxf\nRAYxi2gQ5dqW1ln49C2R9Y76MnUIemx81OWZiFe3U0Ea4yZWWNzjxbgJ+Oyj\n-----END RSA PRIVATE KEY-----\n'
# command: ssh-keygen -t rsa -b 4096 -f ./user_ca -C ./user_ca -m pem
RSA_CA_PRIVATE_KEY = b"""-----BEGIN RSA PRIVATE KEY-----
Proc-Type: 4,ENCRYPTED
DEK-Info: AES-128-CBC,716F86C2D26E01497D6CA3A2A7BDF6B9
Clk/o3ITe7CxMiJSxOGugCK/uP867/XEQxnvPZN+D/0ykbdlR6YuwTeZdg6pYGnw
XsYiiWCNPhAaxMgoh4c03P0l8cbdlbqy3KZypKyRW/fUJDdLhg/Gk6XFK0w8AnL7
4hfrJf0wF4Vx0zQrRh8uKud5iXURkd93MQ72UC+oOkF88SaNyE1Y8V4D74hqfQO2
ghbejilab9sGaoTru3YPalyreFk5qv/Z7WKlhl2RJGIZZKNyo0wDN7MFRMwbtVLk
erpd9bJJ25tllbBTdpm8qkpP2YHun96UbDW6dAOG5kd2nVzT5UmgsbRBRomd1+86
3TQyVvYU4qtxA87erTDDsfwZ8f0Ueb2oSmfUVlorKa4Z4mdezqCm3jaboDrmCdPx
VIu1aixa+aM1ezF+igF31sU4iVBAl9f9wMHuF664wnm6zpmUV/CnfLMXPGw0mb6C
kZwD2ZHBn5XCCDcyf9HefHRgml9uFbOblRsbk/yRvFhqECnvLnO0eaPI/J02ezCR
ybppOzbBgM8ftb2866UaZcxAoBPkZ3ho9/VFDeoqxCXl/YpHt9BF0rRpLi08qfLG
5hJxC0AJOUUaTVplXg0lr7EGEOabbkUbDG8fMMW1HnnTE1eAiylwf4lcOcomaizB
Xdipec6u6KeRkP2FmWfsCiO0fPGp0uISsJmgx6viLIux16dJwQBMPIc5l62pEvzO
I4QbdjC3sjnZ08KMXojMnBjV1Vw3NGz6sTT1Oo6W7Fir6qHlhFO3Ok8yulqexmex
nZ5fYPxd5eKi4W0DdEQiiABj/luYncGm5/Ja4uCXIKla7Hv1Q9Iau5W7poKuh2PZ
3JryZCEwM0YLZNIJ19oJ0nNA31yWavTavkWY78Pvv6GpKvgMjZFkJ4hJgQ6eJQD+
qf9HOLqqX8lKSnvoWOmtm9e9xgnO+lOOFScMmJ9fAD4riSOSJ0ct7AJbw8tCrEqp
YwDYjE0M8PmiQ+GTEvwS2gRxvZcGr5YE0vXYMdTdIH2zFf9HthDzGAZVent/bGM1
fLsXlvc6nWbtJHmU3Uz5bMLvFDGPAM+Znj4CVrPWWqHyxWu1h/LcR9YoO714+s4U
rIpImhcG1kStbqaNgQoaOgIN55BeYJ561pnezDRd/7VwlWP8sARjATa6Sno1Q8dY
oPKkxmRFIfGsMJQZiqFdxYmh7iEMPNhSIGEKVqWVAIrEUNJeN3SP90c29Kz3Ph+w
geyBGn+3mBhRyLZNTE5SgUXnRQwYXd6Md3/Ju4g640PSvIU68TkYTFDXQR1TVNyO
xHfxMF5Pu13pMPCvX8VquawffA9+g4ly3j67TCKn87otSMiMCAmMYxl6dJaDuJjy
x1/fowKKKlu+2xUubFxSu2VFRbsWLebzveAiRXtfJjEdfBSXp5ZQs0r+umy2+Wss
x+P01ngJDq+UyRBpNbCck2UbKJNmL66EVdOcA9u0IJSqsaUOsytgLCWv2xD5O1zr
5kWDP0Kqr6Pry3dz3UljgDl2HL/ODctv/E4VpPTB9GZSekqwuloXFsirCMJVtWVF
RdZ0tZEjT3RVBe8Cl3k/3LNUprXSoI9bBZh4gHGhRPwgWzaVSuqyZnO5/PMqvvie
OBW546wP9nWn92wSmLLhno2pPui1okeoxs9c+2kez/TzbVvUedpgBGjMSpBgNxSP
1urXgh1ah11Bv3eVLNJAkfHg+HNPyyuV6dkT9Jp3wusMtqCK3U4zX56F6Xpb1LDZ
YvIAwSgFVByLCb9n/H49QkDd7prX7ZpCg26bXvuy1eDuIyvH61+22uFJUdsBxZmy
jlM5LcW9lkOJXtbu3jn5z8mQ44pXGLBK1i8yH04GeZu7/F+Ks8fDYB7k0DIt75UT
VFRnDX37N5Uas4eAGW/Q234iU9wyvGLeab1Ro3gSZBFrIZbe28/lMUCYUjtyRl+E
tFJVqhzq9W3u4E1YxcR1dEDj6lI1CyZgg3MRn2a/dd3CBb+SgKajhmEawW8OPgpy
lBdU58yZsaI+NQRttsRYbI4yL3hR339j+lxqnIIwZf5kiwYWjCm87zApID98KU5E
xTNp068fI9hcWCz4k1getTxH62GrWOZSeF/YnL3jSZx9oL5UMhRLlpTj44/nvfeZ
YvEyIlHBIjRvzZP6dDBxuRRx6QcrjSZxv0Onxk/Djcl8a7OQnb2mK8jUIOhXbO+b
G9MF9O6deI+PNdJQPlBUfRhHIUY7eN9Q37lE2e//Oh1icoSs87kxuVX7T2vcxnQX
uooBx5bEc4oKUnJIlIoa41T1442Dns1EOb6uBAqDYFN2sX+tqCP8O39Na+7ATo3j
J8BP2FfDpH9xDjVrg2hFXK1wrJu2cuUOqc4dutqfjToeQMDjshM/x0acI+aqXK+L
W/HWF2YLH2bJdt/2jyNScBd+uotMuRkYKjsyJHCbe+QWJid1iMgdJ0Wlc4sb3RQm
7VsxhM0HgtmMJveIXFm4QG6SveHbn4oAEOE4oBCf2zG29YkwiRLWV7B0ERzaJ7J7
oNxH76hnyf5jcpGUtElqBoKcOtGxwBrs2dfG8M4xxr9z1pdMcpY16v8vzvNuxwTk
TtGToi/c+KG4+ZzPH0FcEkuh33OpQqZMs3/eIp8lfOZ6I8UwHLLOUt9UJ3GptRsE
fpyNr3BXr/6hFlO2o1P+Ap7BpOiIeJWNwv9Ak/SWy9U6q+HgG/91FJjvQ+fM2114
Dh+TlPwzHdzAAdULng0v9zzRaBoDjxpLwrO7w7txu25uZ6w1kVB7B2VcBOJhYm0k
8V0D+H7+EXHTgOyV1Q7bCWGEjvBqKXoaJPAGpI3hv2RDmRjCUJoz7K5P2Nw6GSBB
l1PD0Herg6NSys+B8nFPDcE8lMixzRpc4zs8TBEYKf7dyCcGmyRs8rrDNwu63IZT
mY+YYNP0Kqd31H9qrthcY1jcIzXEtv7BJIk9XONyqiTnRIGcSGRMU+i9z3kO0YWf
8JaCHl3ZdFITuiFEYQ+P/ybiLO1BYGbYPhAjaNpcfRAGHVUVjKulTKy9MpBgEMdk
yykFhMDwK6MpyGTtDU8bgu3T6jD7aMOF9+eWEEYFc8N/wOJKrCIdPUtLfpMQjPrg
BgvW4obhDPkrNa0EilLO/YU6h37E5BDw+6WkEws6evgjK6Vl/V9lngTznivwnxnq
-----END RSA PRIVATE KEY-----"""
RSA_SHA1_CA_PRIVATE_KEY = b'-----BEGIN RSA PRIVATE KEY-----\nProc-Type: 4,ENCRYPTED\nDEK-Info: AES-128-CBC,C534195782F2DD74B6218FFF4D3F7576\n\nslmvJmIAqNGnym41vTcHqdpOaUZJb9e/hRrGl1hqgQRgvfcB9c255w6TK7xWUQnS\n4a66APKv/fcjI/gMYBZNCIeFhgl/QGRZWj5Ls0QejMHM/4BB3iAKGfEFJAWIhoi+\nKhsK7EhYMLcnItAc1WFOzQy9UKQYWZVANwZLDTlgaN2oYh1cQQLgfKUGBmwEarej\noXFeFgvVZevCcIqsBsPTxEyJHdICSuye4Rv2KoSHKwTjzqe5FDm0LEhtp6ERZe4o\nSmilfkmI3bwbhnZpKc40kDGsfTbOwUqAWpgKI6GnTGK8GLN1UHuxJTrIntQZ/TEb\n99w4KPgJDq6PY6yk5cIEAK+VWM/uMsm/XcD432YtX/fKjnFOblJ0M0ARxC/hPdAg\nPzFIz/ErgJo+UjKNXV6wG6D023Wsz5Ei2e8XZK4QvsBNYwPvKqPD45xJO/k3XEyo\nZjKcxJS6696USLtPNjZwahQu+w5VUNot5tkY/ZvNpNTwbPzLBx/Vut5TSBkLlHze\nmEn3DouXKQz7/2iX4sk+ciPSZnnobXiJNlNUWfO/Jh2ATpgMA+aXQFMVe+9eeQNF\nq0Zo2Wk+o4s7DJeo60c+6PzNBypVo2BGM8AOLsK29A72AivwbI2GU8z7tLBrqzF9\n0ANYA++KTK8fEAP6mAPeFHXzoq+qs5+TMSESbl0V9ZheuOgRqsn4mfk2AItmUgXH\nvCpZgoy9R/A3zJdVANo4sEfa5n/2FQ7a3ogR9BRqY+alejmIyUq0fDWchP9dCnec\nRIWjH7dFuuYirEi7SWGRnthtItBXojV0PWvW46li/SFv937Gku89id3441jiilvS\n2TVHuXjgHipYYD8ocSM/ClDHUjSJ/FQwnz9Xlvjh+MX00upUx4ar2NgSFidJZiCV\nk9CBKEgxc0i+jjGfn6F64wwb6GUAnz08ql7exffBwSjzLoRPZxmPXlquOuUsH1De\ntQt2VfY7J2R5qnVZYCcQsnHH32SqOT5ytHGvbSKX8lACnrLPa8jZQI53Q84l+pdF\n0DfTGT8KLa7luAiEoz4LhicVim2J315LMz7G+Al97Bf0qD/4yqjcphItj0ma79OC\nM2qdRACHiGwqsZ75orcLXW153aTOT8etGLMZnuw3t+MZIujtHdpZSoyQMsp6FoHn\nOD2xI5khcJSFiT7OCjDtxCgqQT0HV4C/f/skzFZ8rrublP/2qzHZVgyWwqGFY4vh\ncTkHe1hHUC9x1Fr/xJq+thMqQgkCWnSXkUKGRJcrYOEtI4w/Bh4tfd3ASMQU2/o2\nl7DaXQrHxtgyrP1TB0uhQtTmfjlG7HdxR6ruX1ABJu0Lrp3IPe1f8am57RJnIOTS\nmoqWcFnvGocZHrUTggZW4nOnM9YeVthxDkksL5I0KHSOq56MYr1iutwGKgf9kwFO\nweTm4tnK6z/kKA11iy1k6w3N9s79oCHAjMogoMLjmzCziw+GxVnGzk6BeOzItl+l\nGxk2NpXuHbjIRUbh/JX4ZbNlH2awOkm41hIvUc4dgSPCCFL1ht698Uf48Zyj+Eeu\nNC7iOfnEFBe7YXZrc+DKd2DlP9PjNInnNmdLgjiNyceq8v+6/QcLv6yIVJSxSSYm\nGP+Blm81x0+dz8VBLtxrQXXYA2GpUcRgMIcEsVGYkNhXUg/GnqNShvGZd/2WfPkQ\nwc7Nkh2r+QROTTc1CLz+4PHWheA2UgLct40+jLKk+ebSlek7JOzYzkV908AyhlDe\nW+o5nJSXyjxHoxrEEkeTEOSLI8O1VBJWoky4PHLLZjWtkafgxPsbwZ/24FIC1Nua\nicnEpPBkNm5QcuDmRVWdNvQD2KUvGGH3qlYa0aSFrdzvIcm6GWqXOB8/rJK+nEhh\nVjluuGF+KhwUfqbsCaPGsBk2R7im1aW9CTM0i7GVPQK2RuRnIzWWjPLwEdajeo63\nvnLhi7IWUrFdyFj70DpiddKONb29gY8Uax7Ztq79va0vWwHjty1uu1YSxi1wHPEE\nipl3WN8GakqXW72cSoW5TNwDHni6KWbTZmzK0D/M6rJdCpLaUwd2LWM15fe1zM8E\ntD21je4Ivt03L5eV5BnFTsqkROoZpKRjdaqQ+lcWRyphK/yhj/RvjFAhnrSGiUa4\nA65+9jFtaUeMU9giGBZDG+nlKdii1BU+/HBrjMo+IJIiEKMLXJgAKRyl1qw6mRex\nzji61deQK6DijWAGkWBHrasUaDTpasfctBdZxjxkXb52fD9iliscvfiR3EN0ZLp7\nyBo3E798K/RRaBjRkpW6yzSKrH395n3Ulg27LCPvSDtfqjwE/tYj65zZrah/aQzC\njUFZNycbrlv2QfImXGRV0wHpd624fB0BEZzIki5jYwBPK+laY9hBUNSOeAQDNGUX\nrK/SCdihCYc0YouADYW/SQloXvAuA1iPIAhRkyslnbE+1t7Xiy/SzpSZ26HAQj1L\nY/cVNdmn8RuIbwgPMktrpMKbhTlFwZjMkHo7eRtrigaYWxb4xuE37lEAvd67aGmL\nHAe575VDIXdC8UjaFSKnxziALo3lEzNw3Dhc2WqoZ9EYHes/4XMtK8rEe8BJQueC\nm1dusNoqjtmads/5ONf8mRweppAhBtTn86ebm4U6A99ixIojOLgdVp767liBJaBD\nYm/5G463pUjYN93+DxyLmMQppksNmfnHugIEkS5EN3bp47E/NUZcyiFlvp5URpV4\nbDoiPoNxqph4uR5gwp8m/iSQ+nmuJNGlKReiXDUqiw7tzjmKxmTuW91if26sT/Dr\ne7ZoWWqJVrLBLxOWYRTSGN1sqcU7zGCO+QLPkv4bUJi7lpyBBlgUAMl0PX1tg7pn\nPQFQStNXbWxFigHDvQuynSciXzw5GKgu2qUWvklPMmJvnA2CtalVXEzyop0xz5Dv\nRV4It9y9OHxScR2bWWjllD5DfRxvUwaYsnCBi9grm5XlpkO8VmNpgNxPhzsPTP6b\n0Yk57E794Mt6uhAC9Wqpct0P9CqguT/Wqk3wibT30i2vHDhmglLc4nGeGpiltGUH\npuI3FR6arfsT4ML9QKNDyDizBcLNI2LGaDEbV8tqXWEH9P3CV74C4dFTiZhh8b/y\n0Zj/iOXYC3HFWO5PVOtvmETzbl3elZr9YdbkYhuYpmEtR/mMouWYDuTGAkRR1AX/\n-----END RSA PRIVATE KEY-----\n'
RSA_SHA1_CA_SSH_PUBLIC_KEY = base64.b64decode('AAAAB3NzaC1yc2EAAAADAQABAAACAQDiNCZ8XiUnbVF7R7u8dzFVS3QzdohQq/AfMQkhrHZiflXSNrARdMXO5efx2VcgE4AgU7fXU+3husxQp0ITyVFAfroVLvRHisLtz6sPZlp018v7Gv0fvsrMBY1NUsscLPogW4hvSBtQSKl2Pnjrl2n/vJBBYvO+241ODa5dFPyi9qqQicIRYd77uVwUNuoof03GVUWj8jkwVajg9DDXlV7NCZFXP4HeJix1oBb3CK0zZpisEdBzUgz6WGy8aJftw232mPQhP7FHrSwOjsTuBBd/D0Cj2PlHdv8sqXOLgvxk9VXxHOAC2VQmWAvArrd4WG+Xn98XWm+1uIpFyMlNr7T0f59Sbv+Z11RV9WNBebtEoWZM/EiO/wSxdouEiDImYTU4KlY/Jq9i6cEhwdOJuvHfRrD5w9ZkEMZXH8e6W3zgI15p01d5kJp+E51tSsSh9J+zSRNY70ct9Z9wq7N2jCenLquvoMWyuHIP1+PENej56bmMzok7Q+YRLruES+HIPOjIuew5nITcG9QrL8RSa7niQeuSeHnyA06prqaQ0FY5GTsx9lEc0cxhNms3XED4HFeWkEImboqnmecRvaBMAf9pDVbt4bDOPboCfTgRh7ZQ6HpguGJEJCXtHoxSVXPLijsxpl34xnFyottQKuYxrxLA0W9w3LixHHjn10aVP+fTqQ==')
RSA_CA_PRIVATE_KEY_PASSWORD = b'MdPaveLFOys0hMjL6AQfCdTa7VmzyLkpytuKWAe2RH9zU5KmkOI1P2gjFulGiWg'
RSA_CA_SSH_PUBLIC_KEY = base64.decodebytes(b'AAAAB3NzaC1yc2EAAAADAQABAAACAQDCZaldOPD1RVsjRU7aS4oi7Kn0/i4s22la5teVmGCTheoN\nte3Lw1YZye2C/jylzwodkuvajVp1GcIlLFce+Bg0esizM7lePsGCO6ltH5NTFtcpyRGdTiGBtz5b\nh/DCgOAWxifoCaAmtMKJicxxMiL+JrmKoevrAWS+iPvRqUtv5IEEMbIzEg/yrFvdRnFjFTPJy01+\nis0xg31McLdK5CyaEjEhCXS13/lu8Nn/SwkxSO3nQj8K+LEnI20CDMfN97XTpFlX4yJnp2aSa/jL\na+oJs/c7o90eSQ79grg6fiBxEJvniphZqZLv45n+5DqfkVHQdAWc1PfutNZDaLVZTFDT/fMzpVQD\nR0PyzSzE+mxLCm74gK6kYaT9lCXLxivDDqAQIm1HrOnRmbpMzy+NCp7UGV0KZjyXzNkvMrlpptTd\nl25AkYNxnFkg8Ptck6wmrzb2kJ96DeubXyCu+K5O4Kp5az0a5ru/gsjV2hq9EifqteDc2xBXsPCd\nlUy96KOpYQHdmn7hsuX4EyG6Nh/vrGBRb8/Fh50P0b4viXcWQtSo4VdtkhUkzmiPR/ToPMQyKd9e\nmqCWNZcZsnUTNBnDWeaOTz2FqWVFV2za+AuMpo3LY7IQGZNM2BVtiMOPYH8n9+iwhqOutkUKBp9S\nzwyiFOWRl83+5KNcJnwbfqByVLnAKQ==\n')
EXAMPLE_RSA_PUBLIC_KEY = 'ssh-rsa AAAAB3NzaC1yc2EAAAADAQABAAACAQDCZaldOPD1RVsjRU7aS4oi7Kn0/i4s22la5teVmGCTheoNte3Lw1YZye2C/jylzwodkuvajVp1GcIlLFce+Bg0esizM7lePsGCO6ltH5NTFtcpyRGdTiGBtz5bh/DCgOAWxifoCaAmtMKJicxxMiL+JrmKoevrAWS+iPvRqUtv5IEEMbIzEg/yrFvdRnFjFTPJy01+is0xg31McLdK5CyaEjEhCXS13/lu8Nn/SwkxSO3nQj8K+LEnI20CDMfN97XTpFlX4yJnp2aSa/jLa+oJs/c7o90eSQ79grg6fiBxEJvniphZqZLv45n+5DqfkVHQdAWc1PfutNZDaLVZTFDT/fMzpVQDR0PyzSzE+mxLCm74gK6kYaT9lCXLxivDDqAQIm1HrOnRmbpMzy+NCp7UGV0KZjyXzNkvMrlpptTdl25AkYNxnFkg8Ptck6wmrzb2kJ96DeubXyCu+K5O4Kp5az0a5ru/gsjV2hq9EifqteDc2xBXsPCdlUy96KOpYQHdmn7hsuX4EyG6Nh/vrGBRb8/Fh50P0b4viXcWQtSo4VdtkhUkzmiPR/ToPMQyKd9emqCWNZcZsnUTNBnDWeaOTz2FqWVFV2za+AuMpo3LY7IQGZNM2BVtiMOPYH8n9+iwhqOutkUKBp9SzwyiFOWRl83+5KNcJnwbfqByVLnAKQ== ./user_ca'
EXAMPLE_RSA_PUBLIC_KEY_NO_DESCRIPTION = 'ssh-rsa AAAAB3NzaC1yc2EAAAADAQABAAACAQDTuckaZVjP4tP+xUc5xbmBzX1bdPUA78Zi/J8AGAJHTOBU2hHv6532DwWwXYIIj0nhrYpSEpcOgYUkEv3iH5a+nC11QDiOgO7Fs5xXMLKgZP8AyGoWcEspjw7GxiBn6D29SaVPbSYGsyQBaxSGW+D2TMx3OXiec5MlCzVfiu0FnayvEl/1xs9KPbCQnh+BoavQSn7VnK6lNR/vanbtoaRebVKcn4b78koSiI6FegFH7vaLK5UpfRz2tw+SCFIByGfXeYkbrX23Z3t+dOj0JWxGzW/NA7tlRAmE9stYPlIDU9ldjXPm5YhMvCAUyG26+wC5Inr1/JvvDVYh9i6Z1m98O7fvHlcRuw9eP4/mGsJ3HOvbf/nb/UhdkwIwunPkIY/zYRqZ+YLPDV+mQe2D28P9QIANfoiAK4kueS0LPH0psT2jiz/qqzkaMa7WcUiKwCgrLUggyg/T4Dcd58YD2vXxWXump3GL2ykoOHFYVmgoh030F3jPVJEx5f+7rz5YcxRcRzxE9Cz7L126E6gsN3fifJX4t6VUHfubZd2/isNlE4vZRWQk9S3Ej/wB4k6fSlKy1yStlbXfnDrFnQ//AS+OhsKUyIklUhqpDQE31b21cBYCddndG5gxQD0Apigt6u9HDdBH8NJaPZ52JHB5CFN8h1bpTY3/J6sLVe/MmPLhXw=='
EXAMPLE_RSA_PUBLIC_KEY_N = 793071039260495654562054783570888905580230493121861865368468464988108846593382047089908701793710313171505981102652572364551529796280685296298267053565872367727997018479415301553693399766972065632305274884738770536703401810327442957607798900762961705255892351982531455757952830500176184053313079228442429002266936770878232267320257829620981483265267350002067806889775717132069447969362892941632326291488435698526332214857341601618058099873227616411293756020899402251375766902047430385036606853444862613281536084659763859469805802927690369521241668617399361772759471500271665416168852012496873255376379785406200777657576833271897829804215541919030317406382431498666316992263451988664825046229510630028341664700781818642056225682444695399750612189798917235492628021811240637530069547656077933570027799627292946501568021999768276155620370983636031040918895400197966985345505588134744015073710956850626491630297957216642996008804377433085266562549499990274665550645497328752726565084591181618247823758605054951656130529027591829138240302532843787026703199947743066186957701860923887802272226437357683953007804889499132067532043809718436450899896636594611827833149342860680336848059317745114661959220555791058585114297313235236746241359913
EXAMPLE_RSA_PUBLIC_KEY_N_NO_DESCRIPTION = 863765597390437179936880505555316900679139439563534171378010191103037256891865752287401357532386053704846357061277355058425215781749953909539037751959779297844615696266967812249814741811813214887928783792221522790304297884601112319360723158242982362152538534517792264464776081835168055835189781482682493136923038734624107701903646705547410300883750998647287587929185720484066436341331195925984075699168429357216427056893851459700813345902685631135237388578414270244970778240740795928438846416944644092277106238587968690484934416451408183365968935178112856844073906509362367924503252063127972460845602238192159061426436817335330921795349155206805425009150162732786426778585802637172182106209312890241009071807202705546749148063984549775286112624905112511951652674845607083374421597899302609662133400077385016285752279857194248901093535059948349008431744427219342487822381449072585539524484989393533507171281966556907880034930485429159724230925010429126325954683461210886022933944242055541038221737797142318602403013636630990332566384663121261896469133144198125969293719738317514483451902518238751088148376136388153900264080474983146540911501501723872658100092602399884083442609325830811845748736526156589543373619454484831196371149151
EXAMPLE_RSA_PUBLIC_KEY_E = 65537
EXAMPLE_ED25519_PUBLIC_KEY = 'ssh-ed25519 AAAAC3NzaC1lZDI1NTE5AAAAIG7+cAbT4EFSPs87oS4kDYStQ0KL0xwHWqVSZ2bYHIAp Test ED25519 User Key'
EXAMPLE_ED25519_PUBLIC_KEY_NO_DESCRIPTION = 'ssh-ed25519 AAAAC3NzaC1lZDI1NTE5AAAAIG7+cAbT4EFSPs87oS4kDYStQ0KL0xwHWqVSZ2bYHIAp'
EXAMPLE_ED25519_PUBLIC_KEY_A = base64.b64decode('bv5wBtPgQVI+zzuhLiQNhK1DQovTHAdapVJnZtgcgCk=')
EXAMPLE_ECDSA_PUBLIC_KEY = 'ecdsa-sha2-nistp256 AAAAE2VjZHNhLXNoYTItbmlzdHAyNTYAAAAIbmlzdHAyNTYAAABBBMHnC16D7nbmdS7GtNsIoiRaG8yz1QLzv0IAKfAJ+NsnIxbQSvVa+/wWYmGgkIblPdK3ZrtbzZje61Xq08iDUyE= Test ECDSA User Key'
EXAMPLE_RSA_PUBLIC_KEY_2048 = 'ssh-rsa AAAAB3NzaC1yc2EAAAADAQABAAABAQC9D7rmQAyeSrvKGS1mmBHY0uYjePaorbZHyL7HD2SLYROiuQpdZnNDHCdKZB5fWgKVdszYgZAdQmBOolLS+cRpowv8GXKot4QHi1EaKOb74PEFvLQpxCqlHPqYCArakUamwcj81m9dJeK7VpLLxJno092lC2r50RDVZfi/2X4GM8vkptASJUuLzMLdsrC1MmYnPeJ2vNLUtV3EQ3YX+XVaebB/N6ee/yhwb9JmlXqABTfUrX2L94fU/Ry+4ljHRwLb7DNnM4LfeT0pMviH9wa0TeqIA/A5xLEp83mjyO4+QBDreQDIaBCZSVLF32iH+FMlPeRKZd6oYq80j+iLUH33'
EXAMPLE_RSA_PUBLIC_KEY_1024 = 'ssh-rsa AAAAB3NzaC1yc2EAAAADAQABAAAAgQCxc0Yw+5HMM2h1iPKGp4uoh9rNNbmfDgTmv9nCT9QRo4QgKzX/wrA4JSzpSSZLC2qIHADVESeWsOEi9Ohko7lgPGD+vAHFfNv/TNK8EFTzAbSoM/7eriO3wR5Y668Z0yEWhoCVnUWAHBWCBkQgHTxRYV/feXTirbI4ugp0v35d6w=='
EXAMPLE_RSA_PUBLIC_KEY_SMALLPRIME = 'ssh-rsa AAAAB3NzaC1yc2EAAAADAQABAAABAQI3LzCywCXa4DNeS4gzyDWKeLJqauP6CSLXWjxVLi2iIzroKx8YM1nJVHXfLFseDgfAZGaJhLBXxyDr5vh47U086SP0TFf6JowWofNOerTzotMRNhx9TH/vVu/IGCCPs9P0RVr2g04XcagyA7hjTc26e5jvIkDtczKAMeo/jHoSm2Ot9HA2b+KjZkiZGBIflzJ1uadkNnh+IBlMymJH7GAPbRF9pvbc/XlRT3czwG+AD6d+CHij5pd+91Y8pwpV1QiTxJo1moiea7d7mOmX5RQc6b+YC9CtThN92mzrWsq6wDLCawJZODHL2/hRnjmX6PlvuazfMZv5KA2dr7mh8Xnl'
EXAMPLE_RSA_PUBLIC_KEY_E3 = 'ssh-rsa AAAAB3NzaC1yc2EAAAABAwAAAQEAvQ+65kAMnkq7yhktZpgR2NLmI3j2qK22R8i+xw9ki2ETorkKXWZzQxwnSmQeX1oClXbM2IGQHUJgTqJS0vnEaaML/BlyqLeEB4tRGijm++DxBby0KcQqpRz6mAgK2pFGpsHI/NZvXSXiu1aSy8SZ6NPdpQtq+dEQ1WX4v9l+BjPL5KbQEiVLi8zC3bKwtTJmJz3idrzS1LVdxEN2F/l1Wnmwfzennv8ocG/SZpV6gAU31K19i/eH1P0cvuJYx0cC2+wzZzOC33k9KTL4h/cGtE3qiAPwOcSxKfN5o8juPkAQ63kAyGgQmUlSxd9oh/hTJT3kSmXeqGKvNI/oi1B99w=='
# ssh-keygen -s test-rsa-ca -I user@test -n username -V -5m:+5m test-rsa-user
RSA_USER_CERT = 'ssh-rsa-cert-v01@openssh.com AAAAHHNzaC1yc2EtY2VydC12MDFAb3BlbnNzaC5jb20AAAAgTT+1G4NGB597AOV52iJ+8G4RV8Nqoertt1uc+gFgprsAAAADAQABAAACAQDTuckaZVjP4tP+xUc5xbmBzX1bdPUA78Zi/J8AGAJHTOBU2hHv6532DwWwXYIIj0nhrYpSEpcOgYUkEv3iH5a+nC11QDiOgO7Fs5xXMLKgZP8AyGoWcEspjw7GxiBn6D29SaVPbSYGsyQBaxSGW+D2TMx3OXiec5MlCzVfiu0FnayvEl/1xs9KPbCQnh+BoavQSn7VnK6lNR/vanbtoaRebVKcn4b78koSiI6FegFH7vaLK5UpfRz2tw+SCFIByGfXeYkbrX23Z3t+dOj0JWxGzW/NA7tlRAmE9stYPlIDU9ldjXPm5YhMvCAUyG26+wC5Inr1/JvvDVYh9i6Z1m98O7fvHlcRuw9eP4/mGsJ3HOvbf/nb/UhdkwIwunPkIY/zYRqZ+YLPDV+mQe2D28P9QIANfoiAK4kueS0LPH0psT2jiz/qqzkaMa7WcUiKwCgrLUggyg/T4Dcd58YD2vXxWXump3GL2ykoOHFYVmgoh030F3jPVJEx5f+7rz5YcxRcRzxE9Cz7L126E6gsN3fifJX4t6VUHfubZd2/isNlE4vZRWQk9S3Ej/wB4k6fSlKy1yStlbXfnDrFnQ//AS+OhsKUyIklUhqpDQE31b21cBYCddndG5gxQD0Apigt6u9HDdBH8NJaPZ52JHB5CFN8h1bpTY3/J6sLVe/MmPLhXwAAAAAAAAAAAAAAAQAAAAl1c2VyQHRlc3QAAAAMAAAACHVzZXJuYW1lAAAAAFb8Ck4AAAAAVvwMpgAAAAAAAACCAAAAFXBlcm1pdC1YMTEtZm9yd2FyZGluZwAAAAAAAAAXcGVybWl0LWFnZW50LWZvcndhcmRpbmcAAAAAAAAAFnBlcm1pdC1wb3J0LWZvcndhcmRpbmcAAAAAAAAACnBlcm1pdC1wdHkAAAAAAAAADnBlcm1pdC11c2VyLXJjAAAAAAAAAAAAAAIXAAAAB3NzaC1yc2EAAAADAQABAAACAQDiNCZ8XiUnbVF7R7u8dzFVS3QzdohQq/AfMQkhrHZiflXSNrARdMXO5efx2VcgE4AgU7fXU+3husxQp0ITyVFAfroVLvRHisLtz6sPZlp018v7Gv0fvsrMBY1NUsscLPogW4hvSBtQSKl2Pnjrl2n/vJBBYvO+241ODa5dFPyi9qqQicIRYd77uVwUNuoof03GVUWj8jkwVajg9DDXlV7NCZFXP4HeJix1oBb3CK0zZpisEdBzUgz6WGy8aJftw232mPQhP7FHrSwOjsTuBBd/D0Cj2PlHdv8sqXOLgvxk9VXxHOAC2VQmWAvArrd4WG+Xn98XWm+1uIpFyMlNr7T0f59Sbv+Z11RV9WNBebtEoWZM/EiO/wSxdouEiDImYTU4KlY/Jq9i6cEhwdOJuvHfRrD5w9ZkEMZXH8e6W3zgI15p01d5kJp+E51tSsSh9J+zSRNY70ct9Z9wq7N2jCenLquvoMWyuHIP1+PENej56bmMzok7Q+YRLruES+HIPOjIuew5nITcG9QrL8RSa7niQeuSeHnyA06prqaQ0FY5GTsx9lEc0cxhNms3XED4HFeWkEImboqnmecRvaBMAf9pDVbt4bDOPboCfTgRh7ZQ6HpguGJEJCXtHoxSVXPLijsxpl34xnFyottQKuYxrxLA0W9w3LixHHjn10aVP+fTqQAAAg8AAAAHc3NoLXJzYQAAAgDEuvFBz2iuvJ4ojytisq+t5fgjsKsbfsg6K9djie4FUfvoVbVxU2zRDRBIAmFkjq8+jxSUFz5jA6FZf8AZHY/kbuMhZmXD/QfXDuMbO3ufRdvH+VRn53Rbdu8vOaLAOcDDEl4dritLG0ZNdglOEGiOXfnfs3LgkEErdxq6dK5Tq1eYHBxtchCPnqPHfb9b51gfkI5FUnZJJiSzDhQJWkv/cV4QNJ+otfLrdTNBRCuHyuhnR9JPJYY/fTkEAp/M8xRQZfAMGIO1Gu2rp7vRDjlQO8JHAZ+ckX2f1geF9/YG2tIjOfbKq6DSwC/sh4h4ggd6lL7TfXsFQV3gtjziAbJLgYxA+yuekudIQlXChVszp81f7bV5cMHB4nfb5FnyJU6ld2UiuZps3aBz5fxnt0LDyRLnmOv0JPNcBOc1Xzqw0ZVeCPYAmDueKMJU4jpkfttndAr6rQapc70Xyo8y2G/IOqwEoAg1XolStyRDdRKESK1b5BkTyGUcMejiJ3sRzws6yQPyQLonthnonU/sNbSku5HgIe7yk88hDpbR5M+s0a8IXKermAOZ59vK5CU1SXW0PFqJOtCP6qNeQzn8iwqrealCc7FSOzk5OhS20cnju+GuZci6GLH3Mt95bM9eCyx3nue1oIQJV+UbYf6Y1WLKgLpJ7l6A4bDqx+DJuTlDoA== Test RSA User Key'
# ssh-keygen -s test-rsa-ca -O clear -I "" test-rsa-user-no-extensions.pub
#RSA_USER_CERT_MINIMAL = 'ssh-rsa-cert-v01@openssh.com AAAAHHNzaC1yc2EtY2VydC12MDFAb3BlbnNzaC5jb20AAAAgzRe7F1ElEaqiR2QWRfvsCnHEqt9Pk68wj5TF1vviOAcAAAADAQABAAACAQDTuckaZVjP4tP+xUc5xbmBzX1bdPUA78Zi/J8AGAJHTOBU2hHv6532DwWwXYIIj0nhrYpSEpcOgYUkEv3iH5a+nC11QDiOgO7Fs5xXMLKgZP8AyGoWcEspjw7GxiBn6D29SaVPbSYGsyQBaxSGW+D2TMx3OXiec5MlCzVfiu0FnayvEl/1xs9KPbCQnh+BoavQSn7VnK6lNR/vanbtoaRebVKcn4b78koSiI6FegFH7vaLK5UpfRz2tw+SCFIByGfXeYkbrX23Z3t+dOj0JWxGzW/NA7tlRAmE9stYPlIDU9ldjXPm5YhMvCAUyG26+wC5Inr1/JvvDVYh9i6Z1m98O7fvHlcRuw9eP4/mGsJ3HOvbf/nb/UhdkwIwunPkIY/zYRqZ+YLPDV+mQe2D28P9QIANfoiAK4kueS0LPH0psT2jiz/qqzkaMa7WcUiKwCgrLUggyg/T4Dcd58YD2vXxWXump3GL2ykoOHFYVmgoh030F3jPVJEx5f+7rz5YcxRcRzxE9Cz7L126E6gsN3fifJX4t6VUHfubZd2/isNlE4vZRWQk9S3Ej/wB4k6fSlKy1yStlbXfnDrFnQ//AS+OhsKUyIklUhqpDQE31b21cBYCddndG5gxQD0Apigt6u9HDdBH8NJaPZ52JHB5CFN8h1bpTY3/J6sLVe/MmPLhXwAAAAAAAAAAAAAAAQAAAAAAAAAAAAAAAAAAAAD//////////wAAAAAAAAAAAAAAAAAAAhcAAAAHc3NoLXJzYQAAAAMBAAEAAAIBAOI0JnxeJSdtUXtHu7x3MVVLdDN2iFCr8B8xCSGsdmJ+VdI2sBF0xc7l5/HZVyATgCBTt9dT7eG6zFCnQhPJUUB+uhUu9EeKwu3Pqw9mWnTXy/sa/R++yswFjU1Syxws+iBbiG9IG1BIqXY+eOuXaf+8kEFi877bjU4Nrl0U/KL2qpCJwhFh3vu5XBQ26ih/TcZVRaPyOTBVqOD0MNeVXs0JkVc/gd4mLHWgFvcIrTNmmKwR0HNSDPpYbLxol+3DbfaY9CE/sUetLA6OxO4EF38PQKPY+Ud2/yypc4uC/GT1VfEc4ALZVCZYC8Cut3hYb5ef3xdab7W4ikXIyU2vtPR/n1Ju/5nXVFX1Y0F5u0ShZkz8SI7/BLF2i4SIMiZhNTgqVj8mr2LpwSHB04m68d9GsPnD1mQQxlcfx7pbfOAjXmnTV3mQmn4TnW1KxKH0n7NJE1jvRy31n3Crs3aMJ6cuq6+gxbK4cg/X48Q16PnpuYzOiTtD5hEuu4RL4cg86Mi57DmchNwb1CsvxFJrueJB65J4efIDTqmuppDQVjkZOzH2URzRzGE2azdcQPgcV5aQQiZuiqeZ5xG9oEwB/2kNVu3hsM49ugJ9OBGHtlDoemC4YkQkJe0ejFJVc8uKOzGmXfjGcXKi21Aq5jGvEsDRb3DcuLEceOfXRpU/59OpAAACDwAAAAdzc2gtcnNhAAACAALaIz5s1IqPSqgw0d4hzUQ/tckFEINzSp3GhH2B5N6cvu5PSqqQe7bluxvtfrT/eGydw8nN5GEBlsadALZdHVEYwy+3yNcSzUaKahAMSkMUBHl7iZeGUCs+1U+McXqlZfNFp8S4bG4Q8PWueRcmvlqVjwcwyUcFKdvebEGzYr7lBQlEwShrlVtWQsBqePY1mmOp3yhZpkX8/PhU55OBkYFhznIoCyu0qm0pLwUZTrzzlaQt6T4DtDq6Gsjl2cQb6iXbwtTeoHzSmjghiu1E1fDLlXAjJx0vGJurYGpk00954uZwbmllHJ7ZGHjyBFmdYdNpChQbQZQlh39hlWzheQN++xDWiLXKjMkB4bZsa9Ow8Ig2+R5+J+x/eg3rkM+H9WKFc5ctFuNOqprmc3u1rMcKOgj9NDmGAAywFkpghyQdWfsErrBfITJIzdPrUNexLuanl7frKfJLTDBoJcaQyS3c8v1YzoQuL419c4x+9gJ4Tl9DZVH/0pD20CGqOqniD0Te9mTsme1BNHoLpWMiqRtINWXrvxDg9Wtbr0YWL/kvj4s3YZdeyf+4b2ynikIu3Fca2uNpmUfX6e5GT3CdF4KSZjpTdZEoZVJ7tK/bg9D0B1S/7O9YOM8wbIuHvaA/Mkk7rVV6gEYT6q9gLNO9qaE26VIiXza/saWR+fOX4/h+ Test RSA User Key'
RSA_USER_CERT_MINIMAL = 'ssh-rsa-cert-v01@openssh.com AAAAHHNzaC1yc2EtY2VydC12MDFAb3BlbnNzaC5jb20AAAAgxviQV6fqa2a+pJ2vQDhKdo0BTQnN0wAl27noDCaQGMwAAAADAQABAAACAQDCZaldOPD1RVsjRU7aS4oi7Kn0/i4s22la5teVmGCTheoNte3Lw1YZye2C/jylzwodkuvajVp1GcIlLFce+Bg0esizM7lePsGCO6ltH5NTFtcpyRGdTiGBtz5bh/DCgOAWxifoCaAmtMKJicxxMiL+JrmKoevrAWS+iPvRqUtv5IEEMbIzEg/yrFvdRnFjFTPJy01+is0xg31McLdK5CyaEjEhCXS13/lu8Nn/SwkxSO3nQj8K+LEnI20CDMfN97XTpFlX4yJnp2aSa/jLa+oJs/c7o90eSQ79grg6fiBxEJvniphZqZLv45n+5DqfkVHQdAWc1PfutNZDaLVZTFDT/fMzpVQDR0PyzSzE+mxLCm74gK6kYaT9lCXLxivDDqAQIm1HrOnRmbpMzy+NCp7UGV0KZjyXzNkvMrlpptTdl25AkYNxnFkg8Ptck6wmrzb2kJ96DeubXyCu+K5O4Kp5az0a5ru/gsjV2hq9EifqteDc2xBXsPCdlUy96KOpYQHdmn7hsuX4EyG6Nh/vrGBRb8/Fh50P0b4viXcWQtSo4VdtkhUkzmiPR/ToPMQyKd9emqCWNZcZsnUTNBnDWeaOTz2FqWVFV2za+AuMpo3LY7IQGZNM2BVtiMOPYH8n9+iwhqOutkUKBp9SzwyiFOWRl83+5KNcJnwbfqByVLnAKQAAAAAAAAAAAAAAAQAAAAAAAAAAAAAAAAAAAAD//////////wAAAAAAAAAAAAAAAAAAAhcAAAAHc3NoLXJzYQAAAAMBAAEAAAIBAMJlqV048PVFWyNFTtpLiiLsqfT+LizbaVrm15WYYJOF6g217cvDVhnJ7YL+PKXPCh2S69qNWnUZwiUsVx74GDR6yLMzuV4+wYI7qW0fk1MW1ynJEZ1OIYG3PluH8MKA4BbGJ+gJoCa0womJzHEyIv4muYqh6+sBZL6I+9GpS2/kgQQxsjMSD/KsW91GcWMVM8nLTX6KzTGDfUxwt0rkLJoSMSEJdLXf+W7w2f9LCTFI7edCPwr4sScjbQIMx833tdOkWVfjImenZpJr+Mtr6gmz9zuj3R5JDv2CuDp+IHEQm+eKmFmpku/jmf7kOp+RUdB0BZzU9+601kNotVlMUNP98zOlVANHQ/LNLMT6bEsKbviArqRhpP2UJcvGK8MOoBAibUes6dGZukzPL40KntQZXQpmPJfM2S8yuWmm1N2XbkCRg3GcWSDw+1yTrCavNvaQn3oN65tfIK74rk7gqnlrPRrmu7+CyNXaGr0SJ+q14NzbEFew8J2VTL3oo6lhAd2afuGy5fgTIbo2H++sYFFvz8WHnQ/Rvi+JdxZC1KjhV22SFSTOaI9H9Og8xDIp316aoJY1lxmydRM0GcNZ5o5PPYWpZUVXbNr4C4ymjctjshAZk0zYFW2Iw49gfyf36LCGo662RQoGn1LPDKIU5ZGXzf7ko1wmfBt+oHJUucApAAACFAAAAAxyc2Etc2hhMi01MTIAAAIAPhGTPARytXIuqdD8+X5Vcp2hnsN+jYcR2UqYpU53h0FYonW+NXsOyODTBMO7e3xtmKxZfQJ3UWJSM4e6Ye7n7RjeNPBtBuBLkYEVrIONaku/WJ/ZimRB6j1LbbX0NKJOWjz9l29z1j5jTPiNw46xCfT7rKncqmeaKv3Mt0cGriFnzWWtH0xKGofV9RJ9dzlIlewO+KuR9LrDZMF8Xx6rUJuBsza3OPUNNmxn4Fgjk3KQ75QGfztG6491RGBf3axrtw4BM16bEeTb+7yNBswSeftUbaTFV95eVfEbBOpgdxJ5U868EXpXS9VJB013D7OjUBTdapJSwSRQgyIb/yxp/nsDm14I9AYiC2MzJKKeE4afQEvz7OwKA3sEIebie1m7sFdjl0Xp/9WfzclUcihUpsvoNx0I1B2X/p2EnpgfKRSggHijH0tvZiU/gsJf0WmiuWfZlqm2CspvGCFw6fFeBnWiZbHlJW10IHHOteuJ5u2UmI+qZnl1lK4+ZLt2/wVTrW/MDB59etPTZl+FV/H9NEC8MFDGcJgq3xHtBFFm2dmf16ip0xt1E9xikEretSTRDo6PiJm0rR3TSHFLxRod+J/x69DJ7YUF8edW9unELsccCiaL3suFFVK1r4tjk8kqrFMWWGNWY3mbzkBDY3lvdBnYQPlnD4TVfjawiXuDLpI= ./user_ca'
# ssh-keygen -s test-rsa-ca -I "ssh-keygen -s test-rsa-ca -I '' test-rsa-user-all-defaults.pub" test-rsa-user-all-defaults.pub
RSA_USER_CERT_DEFAULTS = 'ssh-rsa-cert-v01@openssh.com AAAAHHNzaC1yc2EtY2VydC12MDFAb3BlbnNzaC5jb20AAAAgjK2qHMgSOZdciBtG4HJT/cZ1Q2Rl5Sf8IBMNmrJTTuYAAAADAQABAAACAQDCZaldOPD1RVsjRU7aS4oi7Kn0/i4s22la5teVmGCTheoNte3Lw1YZye2C/jylzwodkuvajVp1GcIlLFce+Bg0esizM7lePsGCO6ltH5NTFtcpyRGdTiGBtz5bh/DCgOAWxifoCaAmtMKJicxxMiL+JrmKoevrAWS+iPvRqUtv5IEEMbIzEg/yrFvdRnFjFTPJy01+is0xg31McLdK5CyaEjEhCXS13/lu8Nn/SwkxSO3nQj8K+LEnI20CDMfN97XTpFlX4yJnp2aSa/jLa+oJs/c7o90eSQ79grg6fiBxEJvniphZqZLv45n+5DqfkVHQdAWc1PfutNZDaLVZTFDT/fMzpVQDR0PyzSzE+mxLCm74gK6kYaT9lCXLxivDDqAQIm1HrOnRmbpMzy+NCp7UGV0KZjyXzNkvMrlpptTdl25AkYNxnFkg8Ptck6wmrzb2kJ96DeubXyCu+K5O4Kp5az0a5ru/gsjV2hq9EifqteDc2xBXsPCdlUy96KOpYQHdmn7hsuX4EyG6Nh/vrGBRb8/Fh50P0b4viXcWQtSo4VdtkhUkzmiPR/ToPMQyKd9emqCWNZcZsnUTNBnDWeaOTz2FqWVFV2za+AuMpo3LY7IQGZNM2BVtiMOPYH8n9+iwhqOutkUKBp9SzwyiFOWRl83+5KNcJnwbfqByVLnAKQAAAAAAAAAAAAAAAQAAAD5zc2gta2V5Z2VuIC1zIHRlc3QtcnNhLWNhIC1JICcnIHRlc3QtcnNhLXVzZXItYWxsLWRlZmF1bHRzLnB1YgAAAAAAAAAAAAAAAP//////////AAAAAAAAAIIAAAAVcGVybWl0LVgxMS1mb3J3YXJkaW5nAAAAAAAAABdwZXJtaXQtYWdlbnQtZm9yd2FyZGluZwAAAAAAAAAWcGVybWl0LXBvcnQtZm9yd2FyZGluZwAAAAAAAAAKcGVybWl0LXB0eQAAAAAAAAAOcGVybWl0LXVzZXItcmMAAAAAAAAAAAAAAhcAAAAHc3NoLXJzYQAAAAMBAAEAAAIBAMJlqV048PVFWyNFTtpLiiLsqfT+LizbaVrm15WYYJOF6g217cvDVhnJ7YL+PKXPCh2S69qNWnUZwiUsVx74GDR6yLMzuV4+wYI7qW0fk1MW1ynJEZ1OIYG3PluH8MKA4BbGJ+gJoCa0womJzHEyIv4muYqh6+sBZL6I+9GpS2/kgQQxsjMSD/KsW91GcWMVM8nLTX6KzTGDfUxwt0rkLJoSMSEJdLXf+W7w2f9LCTFI7edCPwr4sScjbQIMx833tdOkWVfjImenZpJr+Mtr6gmz9zuj3R5JDv2CuDp+IHEQm+eKmFmpku/jmf7kOp+RUdB0BZzU9+601kNotVlMUNP98zOlVANHQ/LNLMT6bEsKbviArqRhpP2UJcvGK8MOoBAibUes6dGZukzPL40KntQZXQpmPJfM2S8yuWmm1N2XbkCRg3GcWSDw+1yTrCavNvaQn3oN65tfIK74rk7gqnlrPRrmu7+CyNXaGr0SJ+q14NzbEFew8J2VTL3oo6lhAd2afuGy5fgTIbo2H++sYFFvz8WHnQ/Rvi+JdxZC1KjhV22SFSTOaI9H9Og8xDIp316aoJY1lxmydRM0GcNZ5o5PPYWpZUVXbNr4C4ymjctjshAZk0zYFW2Iw49gfyf36LCGo662RQoGn1LPDKIU5ZGXzf7ko1wmfBt+oHJUucApAAACFAAAAAxyc2Etc2hhMi01MTIAAAIAFVW5F944pYY1535780bArQZoJme2KCd7pg58MyjAluMyLAAYep6r0gNXKpHxlTIUgOqIAPKIYkyJcn4F/hsrPtyZ8RPvgn0qe8qk1NYmIDawCiuRFWPg6+0VCW9xSO3veqcMR9UUIk0wLA6QDaAOp0DDb0Pdh4EXsGKEp+ferFMhQSKgU8CGJoxDmpI6e4ghUX295zakp4VKX8qof3C3yqMBWyenDExRK3+Cs2fSZvCQ9+1xICb9zZTun+KyNkrnYaSGFspzwl7Isx4MXidGmpC+RScX8J3IfEbL7+asYVVzbgxy+JgjGv33T6c4R/2DdP9KagrqNtjYz3pKbymZcrQWqEDgLqs1kraahOR8ubNIpxfcTAY88m5IKUxRJuFDXZwhu1kiytOgNz7iZ2GEvP5wkRzmCRQtuQOFXD//Y/IbE6I4RHWl8e2quQciO6I6b9vjhpoy+kMXRsNcWaRhx73Lj/Br1Pld4pOwZEdSEDtEsSU9Y0GzQIx0CXuR6QGc7jbQpDDmUJ+vyy5ptMo7syOqpNzsaoEqW03OC8x8yh2Tmf9f26JQma6AbpQrfruF4+KcN2g/ndjWmsrsiBYqrl0lNSrG75D/Evtmo59kdm82Re8pVHYxlZhCdCQz93Z9wjDJVIoMqZxvGR4CTqktdPF9fSFDryJrUi46kqW4yDs= ./user_ca'
RSA_USER_CERT_DEFAULTS_KEY_ID = 'ssh-keygen -s test-rsa-ca -I \'\' test-rsa-user-all-defaults.pub'
# ssh-keygen -s test-rsa-ca -I "ssh-keygen -s test-rsa-ca -I '' test-rsa-user-all-defaults.pub" test-rsa-user-all-defaults.pub
RSA_USER_CERT_DEFAULTS_NO_PUBLIC_KEY_COMMENT = "ssh-rsa-cert-v01@openssh.com AAAAHHNzaC1yc2EtY2VydC12MDFAb3BlbnNzaC5jb20AAAAgjK2qHMgSOZdciBtG4HJT/cZ1Q2Rl5Sf8IBMNmrJTTuYAAAADAQABAAACAQDTuckaZVjP4tP+xUc5xbmBzX1bdPUA78Zi/J8AGAJHTOBU2hHv6532DwWwXYIIj0nhrYpSEpcOgYUkEv3iH5a+nC11QDiOgO7Fs5xXMLKgZP8AyGoWcEspjw7GxiBn6D29SaVPbSYGsyQBaxSGW+D2TMx3OXiec5MlCzVfiu0FnayvEl/1xs9KPbCQnh+BoavQSn7VnK6lNR/vanbtoaRebVKcn4b78koSiI6FegFH7vaLK5UpfRz2tw+SCFIByGfXeYkbrX23Z3t+dOj0JWxGzW/NA7tlRAmE9stYPlIDU9ldjXPm5YhMvCAUyG26+wC5Inr1/JvvDVYh9i6Z1m98O7fvHlcRuw9eP4/mGsJ3HOvbf/nb/UhdkwIwunPkIY/zYRqZ+YLPDV+mQe2D28P9QIANfoiAK4kueS0LPH0psT2jiz/qqzkaMa7WcUiKwCgrLUggyg/T4Dcd58YD2vXxWXump3GL2ykoOHFYVmgoh030F3jPVJEx5f+7rz5YcxRcRzxE9Cz7L126E6gsN3fifJX4t6VUHfubZd2/isNlE4vZRWQk9S3Ej/wB4k6fSlKy1yStlbXfnDrFnQ//AS+OhsKUyIklUhqpDQE31b21cBYCddndG5gxQD0Apigt6u9HDdBH8NJaPZ52JHB5CFN8h1bpTY3/J6sLVe/MmPLhXwAAAAAAAAAAAAAAAQAAAD5zc2gta2V5Z2VuIC1zIHRlc3QtcnNhLWNhIC1JICcnIHRlc3QtcnNhLXVzZXItYWxsLWRlZmF1bHRzLnB1YgAAAAAAAAAAAAAAAP//////////AAAAAAAAAIIAAAAVcGVybWl0LVgxMS1mb3J3YXJkaW5nAAAAAAAAABdwZXJtaXQtYWdlbnQtZm9yd2FyZGluZwAAAAAAAAAWcGVybWl0LXBvcnQtZm9yd2FyZGluZwAAAAAAAAAKcGVybWl0LXB0eQAAAAAAAAAOcGVybWl0LXVzZXItcmMAAAAAAAAAAAAAAhcAAAAHc3NoLXJzYQAAAAMBAAEAAAIBAMJlqV048PVFWyNFTtpLiiLsqfT+LizbaVrm15WYYJOF6g217cvDVhnJ7YL+PKXPCh2S69qNWnUZwiUsVx74GDR6yLMzuV4+wYI7qW0fk1MW1ynJEZ1OIYG3PluH8MKA4BbGJ+gJoCa0womJzHEyIv4muYqh6+sBZL6I+9GpS2/kgQQxsjMSD/KsW91GcWMVM8nLTX6KzTGDfUxwt0rkLJoSMSEJdLXf+W7w2f9LCTFI7edCPwr4sScjbQIMx833tdOkWVfjImenZpJr+Mtr6gmz9zuj3R5JDv2CuDp+IHEQm+eKmFmpku/jmf7kOp+RUdB0BZzU9+601kNotVlMUNP98zOlVANHQ/LNLMT6bEsKbviArqRhpP2UJcvGK8MOoBAibUes6dGZukzPL40KntQZXQpmPJfM2S8yuWmm1N2XbkCRg3GcWSDw+1yTrCavNvaQn3oN65tfIK74rk7gqnlrPRrmu7+CyNXaGr0SJ+q14NzbEFew8J2VTL3oo6lhAd2afuGy5fgTIbo2H++sYFFvz8WHnQ/Rvi+JdxZC1KjhV22SFSTOaI9H9Og8xDIp316aoJY1lxmydRM0GcNZ5o5PPYWpZUVXbNr4C4ymjctjshAZk0zYFW2Iw49gfyf36LCGo662RQoGn1LPDKIU5ZGXzf7ko1wmfBt+oHJUucApAAACFAAAAAxyc2Etc2hhMi01MTIAAAIAruvGSlblhrVhaKcioicJOMZ8qv9gDe58ExWdCP/V94WD/JlECm2B2alrBMSX7zkuS4MJ9yKEjDuDwjqZa83LhcnMG2B/t/Ar3PW6TJxj0ppfY0xyWKEKd8/ayjWnAKqATvYbv8dw4kU0DPzZxyBVyT/G7qNzxkmuGN8/3M22+ezfGdrkrLYZ8402yViSvCefywZiD+K9qa2C3E8vKjkZcjTrfMqmEloWw/Qcaqu+O/243T/dmMcER9p0ZsKimI21mXHrF90i8RmLyNGP+vHBtfHfZbOP5prr+P3yG45sHsiLjbRq+dC0jsH/QTacW1pdJIEuP6MMDmYKxS82nYyUq1Z3s0CsSlJvY68Puj3QINyhiIWB2VuN0/zKeCS5o/ZQLJ6ukyIhuPV5/j+LAuedkDuOhrNhfmsDfZSVDptYXcIVfZpx9P7dVcT26ujgY66QqguN/OB1FmkUzS/FRcHKZ47vAmqWj7MKGPF3ZWDmomHCNEVskKD0jlyxvwXaIGnA+oa7vt0BeUqOhtyulgWzR9Vb/fg30RzcsAjHvthc1+8F/BVr8dmh3er4cQQDIZ21eTuTbQ4irxLO0ebrxIlGBL8q1AmxbiFc3aGCNA/r71PQYg9cRRD5v5W1qTNOSa8vdT8ckDBGbTnbcNXX8dOGn95VcWwS/dlEsFGKN5eIhTk= Certificate type[1] principals[] with the id[ssh-keygen -s test-rsa-ca -I '' test-rsa-user-all-defaults.pub]"
RSA_USER_CERT_DEFAULTS_NO_PUBLIC_KEY_COMMENT_KEY_ID = 'ssh-keygen -s test-rsa-ca -I \'\' test-rsa-user-all-defaults.pub'
# ssh-keygen -s test-rsa-ca -n user1,user2,other_user1,other_user2 -I "ssh-keygen -s test-rsa-ca -n user1,user2,other_user1,other_user2 -I '' test-rsa-user-many-principals.pub" test-rsa-user-many-principals.pub
RSA_USER_CERT_MANY_PRINCIPALS = 'ssh-rsa-cert-v01@openssh.com AAAAHHNzaC1yc2EtY2VydC12MDFAb3BlbnNzaC5jb20AAAAghNc3Zx05f13blJmDwkU3MEf/NuxBTWs2VKki8KOhr/oAAAADAQABAAACAQDCZaldOPD1RVsjRU7aS4oi7Kn0/i4s22la5teVmGCTheoNte3Lw1YZye2C/jylzwodkuvajVp1GcIlLFce+Bg0esizM7lePsGCO6ltH5NTFtcpyRGdTiGBtz5bh/DCgOAWxifoCaAmtMKJicxxMiL+JrmKoevrAWS+iPvRqUtv5IEEMbIzEg/yrFvdRnFjFTPJy01+is0xg31McLdK5CyaEjEhCXS13/lu8Nn/SwkxSO3nQj8K+LEnI20CDMfN97XTpFlX4yJnp2aSa/jLa+oJs/c7o90eSQ79grg6fiBxEJvniphZqZLv45n+5DqfkVHQdAWc1PfutNZDaLVZTFDT/fMzpVQDR0PyzSzE+mxLCm74gK6kYaT9lCXLxivDDqAQIm1HrOnRmbpMzy+NCp7UGV0KZjyXzNkvMrlpptTdl25AkYNxnFkg8Ptck6wmrzb2kJ96DeubXyCu+K5O4Kp5az0a5ru/gsjV2hq9EifqteDc2xBXsPCdlUy96KOpYQHdmn7hsuX4EyG6Nh/vrGBRb8/Fh50P0b4viXcWQtSo4VdtkhUkzmiPR/ToPMQyKd9emqCWNZcZsnUTNBnDWeaOTz2FqWVFV2za+AuMpo3LY7IQGZNM2BVtiMOPYH8n9+iwhqOutkUKBp9SzwyiFOWRl83+5KNcJnwbfqByVLnAKQAAAAAAAAAAAAAAAQAAAGlzc2gta2V5Z2VuIC1zIHRlc3QtcnNhLWNhIC1uIHVzZXIxLHVzZXIyLG90aGVyX3VzZXIxLG90aGVyX3VzZXIyIC1JICcnICB0ZXN0LXJzYS11c2VyLW1hbnktcHJpbmNpcGFscy5wdWIAAAAwAAAABXVzZXIxAAAABXVzZXIyAAAAC290aGVyX3VzZXIxAAAAC290aGVyX3VzZXIyAAAAAAAAAAD//////////wAAAAAAAACCAAAAFXBlcm1pdC1YMTEtZm9yd2FyZGluZwAAAAAAAAAXcGVybWl0LWFnZW50LWZvcndhcmRpbmcAAAAAAAAAFnBlcm1pdC1wb3J0LWZvcndhcmRpbmcAAAAAAAAACnBlcm1pdC1wdHkAAAAAAAAADnBlcm1pdC11c2VyLXJjAAAAAAAAAAAAAAIXAAAAB3NzaC1yc2EAAAADAQABAAACAQDCZaldOPD1RVsjRU7aS4oi7Kn0/i4s22la5teVmGCTheoNte3Lw1YZye2C/jylzwodkuvajVp1GcIlLFce+Bg0esizM7lePsGCO6ltH5NTFtcpyRGdTiGBtz5bh/DCgOAWxifoCaAmtMKJicxxMiL+JrmKoevrAWS+iPvRqUtv5IEEMbIzEg/yrFvdRnFjFTPJy01+is0xg31McLdK5CyaEjEhCXS13/lu8Nn/SwkxSO3nQj8K+LEnI20CDMfN97XTpFlX4yJnp2aSa/jLa+oJs/c7o90eSQ79grg6fiBxEJvniphZqZLv45n+5DqfkVHQdAWc1PfutNZDaLVZTFDT/fMzpVQDR0PyzSzE+mxLCm74gK6kYaT9lCXLxivDDqAQIm1HrOnRmbpMzy+NCp7UGV0KZjyXzNkvMrlpptTdl25AkYNxnFkg8Ptck6wmrzb2kJ96DeubXyCu+K5O4Kp5az0a5ru/gsjV2hq9EifqteDc2xBXsPCdlUy96KOpYQHdmn7hsuX4EyG6Nh/vrGBRb8/Fh50P0b4viXcWQtSo4VdtkhUkzmiPR/ToPMQyKd9emqCWNZcZsnUTNBnDWeaOTz2FqWVFV2za+AuMpo3LY7IQGZNM2BVtiMOPYH8n9+iwhqOutkUKBp9SzwyiFOWRl83+5KNcJnwbfqByVLnAKQAAAhQAAAAMcnNhLXNoYTItNTEyAAACAGhXE2MD/JosHmE4nDrTclQfQK1hNJJZhczdSBO3M3t5uvqsnNgAvFfcbiWfkfUdO2lbTZr16FmROoq6PPzwtBXwZxGcVbG7JqVLC6FZgMDgFu4XJ2JK33iHTHVySMuqHFge2uVtyu5DSjROv03cEn0C6aUKLMYbjdoiKUIzEQqfdhdd3ByL8llPrxd+bwE6/ui+twOkEStYVTmi3nxJCE+7ROh9HFOJsKhpdT7WmpJsaAX4K5JDhp3UBiXGDF4ISAIPIqUjty1UPAil5d6blUYmFwo+0a2MqOUlUbAJ+pA2kE6alGrBYZpYeAIcZZNi/LlDCy/lgheqVhNpYhNc3hN97sUvnuzhacBhvFSDkULxASiM3vAsSPbi/gTomKAqcYOWSQuCfztA4Qfzua9f8hFAo1LRGxSwPbvXtmNOZMea8lSNIrFECSqbgB0KH25W9x22wu/yO4jCKY/rmTWcYDEQ6XQPP3eCsppMLbITRwgxxUXhb9INOdYSvTb4UOEGkUmI2ZpqLbklPy01nSZq2iDJy9AX40j+1fPDA1il2jO9xSppLoS9p0jO4DDOkyBomkVtzjoWE4AwFZ9gTDevc3XJtIQeyYWo+YIDpCoVWN2f22iIQolRs/p7Gr9/ISV0ygLoPSo/28cLytZh/xJKf/m0Ns5c5xb6aQ961rDpzzPr ./user_ca'
RSA_USER_CERT_MANY_PRINCIPALS_KEY_ID = 'ssh-keygen -s test-rsa-ca -n user1,user2,other_user1,other_user2 -I \'\' test-rsa-user-many-principals.pub'
# ssh-keygen -s test-rsa-ca -O source-address=192.168.1.0/24 -O force-command=/bin/ls -I "ssh-keygen -s test-rsa-ca -O source-address=192.168.1.0/24 -O force-command=/bin/ls -I '' test-rsa-user-force-command-and-source-address.pub" test-rsa-user-force-command-and-source-address.pub
RSA_USER_CERT_FORCE_COMMAND_AND_SOURCE_ADDRESS = 'ssh-rsa-cert-v01@openssh.com AAAAHHNzaC1yc2EtY2VydC12MDFAb3BlbnNzaC5jb20AAAAgB9dzkKX2n/6ytCY/n0qsU9sc5dxUPKip34VOER3y21wAAAADAQABAAACAQDCZaldOPD1RVsjRU7aS4oi7Kn0/i4s22la5teVmGCTheoNte3Lw1YZye2C/jylzwodkuvajVp1GcIlLFce+Bg0esizM7lePsGCO6ltH5NTFtcpyRGdTiGBtz5bh/DCgOAWxifoCaAmtMKJicxxMiL+JrmKoevrAWS+iPvRqUtv5IEEMbIzEg/yrFvdRnFjFTPJy01+is0xg31McLdK5CyaEjEhCXS13/lu8Nn/SwkxSO3nQj8K+LEnI20CDMfN97XTpFlX4yJnp2aSa/jLa+oJs/c7o90eSQ79grg6fiBxEJvniphZqZLv45n+5DqfkVHQdAWc1PfutNZDaLVZTFDT/fMzpVQDR0PyzSzE+mxLCm74gK6kYaT9lCXLxivDDqAQIm1HrOnRmbpMzy+NCp7UGV0KZjyXzNkvMrlpptTdl25AkYNxnFkg8Ptck6wmrzb2kJ96DeubXyCu+K5O4Kp5az0a5ru/gsjV2hq9EifqteDc2xBXsPCdlUy96KOpYQHdmn7hsuX4EyG6Nh/vrGBRb8/Fh50P0b4viXcWQtSo4VdtkhUkzmiPR/ToPMQyKd9emqCWNZcZsnUTNBnDWeaOTz2FqWVFV2za+AuMpo3LY7IQGZNM2BVtiMOPYH8n9+iwhqOutkUKBp9SzwyiFOWRl83+5KNcJnwbfqByVLnAKQAAAAAAAAAAAAAAAQAAAIxzc2gta2V5Z2VuIC1zIHRlc3QtcnNhLWNhIC1PIHNvdXJjZS1hZGRyZXNzPTE5Mi4xNjguMS4wLzI0IC1PIGZvcmNlLWNvbW1hbmQ9L2Jpbi9scyAtSSAnJyB0ZXN0LXJzYS11c2VyLWZvcmNlLWNvbW1hbmQtYW5kLXNvdXJjZS1hZGRyZXNzLnB1YgAAAAAAAAAAAAAAAP//////////AAAASAAAAA1mb3JjZS1jb21tYW5kAAAACwAAAAcvYmluL2xzAAAADnNvdXJjZS1hZGRyZXNzAAAAEgAAAA4xOTIuMTY4LjEuMC8yNAAAAIIAAAAVcGVybWl0LVgxMS1mb3J3YXJkaW5nAAAAAAAAABdwZXJtaXQtYWdlbnQtZm9yd2FyZGluZwAAAAAAAAAWcGVybWl0LXBvcnQtZm9yd2FyZGluZwAAAAAAAAAKcGVybWl0LXB0eQAAAAAAAAAOcGVybWl0LXVzZXItcmMAAAAAAAAAAAAAAhcAAAAHc3NoLXJzYQAAAAMBAAEAAAIBAMJlqV048PVFWyNFTtpLiiLsqfT+LizbaVrm15WYYJOF6g217cvDVhnJ7YL+PKXPCh2S69qNWnUZwiUsVx74GDR6yLMzuV4+wYI7qW0fk1MW1ynJEZ1OIYG3PluH8MKA4BbGJ+gJoCa0womJzHEyIv4muYqh6+sBZL6I+9GpS2/kgQQxsjMSD/KsW91GcWMVM8nLTX6KzTGDfUxwt0rkLJoSMSEJdLXf+W7w2f9LCTFI7edCPwr4sScjbQIMx833tdOkWVfjImenZpJr+Mtr6gmz9zuj3R5JDv2CuDp+IHEQm+eKmFmpku/jmf7kOp+RUdB0BZzU9+601kNotVlMUNP98zOlVANHQ/LNLMT6bEsKbviArqRhpP2UJcvGK8MOoBAibUes6dGZukzPL40KntQZXQpmPJfM2S8yuWmm1N2XbkCRg3GcWSDw+1yTrCavNvaQn3oN65tfIK74rk7gqnlrPRrmu7+CyNXaGr0SJ+q14NzbEFew8J2VTL3oo6lhAd2afuGy5fgTIbo2H++sYFFvz8WHnQ/Rvi+JdxZC1KjhV22SFSTOaI9H9Og8xDIp316aoJY1lxmydRM0GcNZ5o5PPYWpZUVXbNr4C4ymjctjshAZk0zYFW2Iw49gfyf36LCGo662RQoGn1LPDKIU5ZGXzf7ko1wmfBt+oHJUucApAAACFAAAAAxyc2Etc2hhMi01MTIAAAIAp1/bxLxJAFMj82abuCJdgp/nti9bh+q/D0C8PFsfjTUqSsIMyqqw7MH7h5moIFJ57LCQGT/80yLnxwmydH8R15xHbf7XC/akATZs0Va09Ka6NTC/kpCpasZ3FcGmOw7C3QTvokKl0DIvBcC/VVodNlPOu6/lPYwreWnV6tmXSPHFET4j8t/lT1OxZ+h7+qmR3yvVIXB6YuHWsqS1T/KheGh3kDcjEe5WY8NNh+jjQxuvaGx9Jr9kjzDCfKS4fHWp56bgYht+EE67697pO7c2qrMsuMzEMrsoCOK52YUaTYmue0Zy2WB4P1Ox7ifFRVLbSvV6M1MHpwpugcxUVJcvoI+mudVENwaYES33MuRU+arwr2+8KiDNlSDIlAgAgFkLV+dlWX1S/YGA1airCDHFqkvQWzjiWY5U5ubBOuiiZ0CXLcsfItaENOCG6g6cprifUF0pHHDFH3PQPK6DBloGO0gea6WCBueLNJTbcfw/uS7/Bo14aDV2bPD9CmAJjJoPROhVwKow1ciiPSfujPa58JKd6jOaYP0rRRk2ktjzilo/7pwei2pjMwkrL19/+HMAKqmPuVocFCqUl0HedFHOeXJ0Itljfx5bq17UAy5erJwZl3DBZbwq32omFgmQgazSDIrwdWOG/MVW/QMXlKeWb/XvnkC2cmuDqVfWBZwRv88= ./user_ca'
RSA_USER_CERT_FORCE_COMMAND_AND_SOURCE_ADDRESS_KEY_ID = 'ssh-keygen -s test-rsa-ca -O source-address=192.168.1.0/24 -O force-command=/bin/ls -I \'\' test-rsa-user-force-command-and-source-address.pub'
# ssh-keygen -s test-rsa-ca -h -n host.example.com,192.168.1.1,host2.example.com -I "ssh-keygen -s test-rsa-ca -h -n host.example.com,192.168.1.1,host2.example.com -I '' test-rsa-host-many-principals.pub" test-rsa-host-many-principals.pub
RSA_HOST_CERT_MANY_PRINCIPALS = 'ssh-rsa-cert-v01@openssh.com AAAAHHNzaC1yc2EtY2VydC12MDFAb3BlbnNzaC5jb20AAAAgHVxg9D86qX09+U+TKN8z2Snmd6Fc5b1FPEaBEC8I6a0AAAADAQABAAACAQDCZaldOPD1RVsjRU7aS4oi7Kn0/i4s22la5teVmGCTheoNte3Lw1YZye2C/jylzwodkuvajVp1GcIlLFce+Bg0esizM7lePsGCO6ltH5NTFtcpyRGdTiGBtz5bh/DCgOAWxifoCaAmtMKJicxxMiL+JrmKoevrAWS+iPvRqUtv5IEEMbIzEg/yrFvdRnFjFTPJy01+is0xg31McLdK5CyaEjEhCXS13/lu8Nn/SwkxSO3nQj8K+LEnI20CDMfN97XTpFlX4yJnp2aSa/jLa+oJs/c7o90eSQ79grg6fiBxEJvniphZqZLv45n+5DqfkVHQdAWc1PfutNZDaLVZTFDT/fMzpVQDR0PyzSzE+mxLCm74gK6kYaT9lCXLxivDDqAQIm1HrOnRmbpMzy+NCp7UGV0KZjyXzNkvMrlpptTdl25AkYNxnFkg8Ptck6wmrzb2kJ96DeubXyCu+K5O4Kp5az0a5ru/gsjV2hq9EifqteDc2xBXsPCdlUy96KOpYQHdmn7hsuX4EyG6Nh/vrGBRb8/Fh50P0b4viXcWQtSo4VdtkhUkzmiPR/ToPMQyKd9emqCWNZcZsnUTNBnDWeaOTz2FqWVFV2za+AuMpo3LY7IQGZNM2BVtiMOPYH8n9+iwhqOutkUKBp9SzwyiFOWRl83+5KNcJnwbfqByVLnAKQAAAAAAAAAAAAAAAgAAAHZzc2gta2V5Z2VuIC1zIHRlc3QtcnNhLWNhIC1oIC1uIGhvc3QuZXhhbXBsZS5jb20sMTkyLjE2OC4xLjEsaG9zdDIuZXhhbXBsZS5jb20gLUkgJycgdGVzdC1yc2EtaG9zdC1tYW55LXByaW5jaXBhbHMucHViAAAAOAAAABBob3N0LmV4YW1wbGUuY29tAAAACzE5Mi4xNjguMS4xAAAAEWhvc3QyLmV4YW1wbGUuY29tAAAAAAAAAAD//////////wAAAAAAAAAAAAAAAAAAAhcAAAAHc3NoLXJzYQAAAAMBAAEAAAIBAMJlqV048PVFWyNFTtpLiiLsqfT+LizbaVrm15WYYJOF6g217cvDVhnJ7YL+PKXPCh2S69qNWnUZwiUsVx74GDR6yLMzuV4+wYI7qW0fk1MW1ynJEZ1OIYG3PluH8MKA4BbGJ+gJoCa0womJzHEyIv4muYqh6+sBZL6I+9GpS2/kgQQxsjMSD/KsW91GcWMVM8nLTX6KzTGDfUxwt0rkLJoSMSEJdLXf+W7w2f9LCTFI7edCPwr4sScjbQIMx833tdOkWVfjImenZpJr+Mtr6gmz9zuj3R5JDv2CuDp+IHEQm+eKmFmpku/jmf7kOp+RUdB0BZzU9+601kNotVlMUNP98zOlVANHQ/LNLMT6bEsKbviArqRhpP2UJcvGK8MOoBAibUes6dGZukzPL40KntQZXQpmPJfM2S8yuWmm1N2XbkCRg3GcWSDw+1yTrCavNvaQn3oN65tfIK74rk7gqnlrPRrmu7+CyNXaGr0SJ+q14NzbEFew8J2VTL3oo6lhAd2afuGy5fgTIbo2H++sYFFvz8WHnQ/Rvi+JdxZC1KjhV22SFSTOaI9H9Og8xDIp316aoJY1lxmydRM0GcNZ5o5PPYWpZUVXbNr4C4ymjctjshAZk0zYFW2Iw49gfyf36LCGo662RQoGn1LPDKIU5ZGXzf7ko1wmfBt+oHJUucApAAACFAAAAAxyc2Etc2hhMi01MTIAAAIAB1qImrMU7e8oW3sTEA4cLXSIqZyk9B3fDcZihdn4V68z23bZM9KHmhgy7FSJFg2/JD9QTTNfeZsWYblsB4Kd+Nv/pXv/ulrJ24u+mpRQ2iJmkGYRE0YX/2h3niyD+V2Df6F5I8IXpEnOnuGN0b2sVsOg0uuoUGwLoYJKF2kd3qQ1Yp2Q2yEkHPsZvhGURdo2M/2do9cR3C+R1IZBaq7AQutDlgT5JpeeXFgl0BE+kVXRH7qIKNbuI1ZebJGu2LwoYQk6vK0z/+OSKLCBh6jVBARev8JxRZtZtKgTIOu9yE+QqIrYAwoNj/G3Fb+0gsIUMRTNGtyqUkdzTo0ooIM3mF2i0rKOvDXyWIXXz5lzv7/YhBYUcLR6EMN6QFVSxHD8ev0WVB/6V74G5GR5FSsDQbwSMG+NQsszBhNXywOVFNmzX0ouqMbJJZ22saMkRlkFTPgfrqYCSNUdnNpUZzKcqr+4qbxdQgVtTC3TMcDvLcFhkzfoCfdzgo/SdnfXswRwr1g/cAVYOvKOGr/iOzaALckcRHgUOOR35uxCGw5R/rZ15x4b3lxt8ARlXEtcIDmnVteD94i8ed2+Vw673EnUno0I0Jh+YXWE1avBVhRX4INoiGub2cZaZPURg0WM94UdHVcj/kHYSGMmZQC0vER2S9sNMh4SGlxBAdxPd9Am4uc= ./user_ca'
RSA_HOST_CERT_MANY_PRINCIPALS_KEY_ID = 'ssh-keygen -s test-rsa-ca -h -n host.example.com,192.168.1.1,host2.example.com -I \'\' test-rsa-host-many-principals.pub'
SSH_CERT_DEFAULT_EXTENSIONS = base64.b64decode(
'AAAAFXBlcm1pdC1YMTEtZm9yd2FyZGluZwAAAAAAAAAXcGVybWl0LWFnZW50LWZvcndhcmRpbmcAAAAAAAAAFnBlcm1pdC1wb3J0LWZvcndhcmRpbmcAAAAAAAAACnBlcm1pdC1wdHkAAAAAAAAADnBlcm1pdC11c2VyLXJjAAAAAA=='
)
SSH_CERT_CUSTOM_EXTENSIONS = base64.b64decode(
'AAAAFnBlcm1pdC1wb3J0LWZvcndhcmRpbmcAAAAAAAAACnBlcm1pdC1wdHkAAAAAAAAADnBlcm1pdC11c2VyLXJjAAAAAA==')
# ssh-keygen -s test-rsa-ca -I "ssh-keygen -s test-rsa-ca -I '' test-ed25519-user-all-defaults.pub" test-ed25519-user-all-defaults.pub
ED25519_USER_CERT_DEFAULTS = 'ssh-ed25519-cert-v01@openssh.com AAAAIHNzaC1lZDI1NTE5LWNlcnQtdjAxQG9wZW5zc2guY29tAAAAINa9ZmyR9YBRNfC464IJE2AlDa0xU02tVbY37AlRr79/AAAAIG7+cAbT4EFSPs87oS4kDYStQ0KL0xwHWqVSZ2bYHIApAAAAAAAAAAAAAAABAAAAQnNzaC1rZXlnZW4gLXMgdGVzdC1yc2EtY2EgLUkgJycgdGVzdC1lZDI1NTE5LXVzZXItYWxsLWRlZmF1bHRzLnB1YgAAAAAAAAAAAAAAAP//////////AAAAAAAAAIIAAAAVcGVybWl0LVgxMS1mb3J3YXJkaW5nAAAAAAAAABdwZXJtaXQtYWdlbnQtZm9yd2FyZGluZwAAAAAAAAAWcGVybWl0LXBvcnQtZm9yd2FyZGluZwAAAAAAAAAKcGVybWl0LXB0eQAAAAAAAAAOcGVybWl0LXVzZXItcmMAAAAAAAAAAAAAAhcAAAAHc3NoLXJzYQAAAAMBAAEAAAIBAMJlqV048PVFWyNFTtpLiiLsqfT+LizbaVrm15WYYJOF6g217cvDVhnJ7YL+PKXPCh2S69qNWnUZwiUsVx74GDR6yLMzuV4+wYI7qW0fk1MW1ynJEZ1OIYG3PluH8MKA4BbGJ+gJoCa0womJzHEyIv4muYqh6+sBZL6I+9GpS2/kgQQxsjMSD/KsW91GcWMVM8nLTX6KzTGDfUxwt0rkLJoSMSEJdLXf+W7w2f9LCTFI7edCPwr4sScjbQIMx833tdOkWVfjImenZpJr+Mtr6gmz9zuj3R5JDv2CuDp+IHEQm+eKmFmpku/jmf7kOp+RUdB0BZzU9+601kNotVlMUNP98zOlVANHQ/LNLMT6bEsKbviArqRhpP2UJcvGK8MOoBAibUes6dGZukzPL40KntQZXQpmPJfM2S8yuWmm1N2XbkCRg3GcWSDw+1yTrCavNvaQn3oN65tfIK74rk7gqnlrPRrmu7+CyNXaGr0SJ+q14NzbEFew8J2VTL3oo6lhAd2afuGy5fgTIbo2H++sYFFvz8WHnQ/Rvi+JdxZC1KjhV22SFSTOaI9H9Og8xDIp316aoJY1lxmydRM0GcNZ5o5PPYWpZUVXbNr4C4ymjctjshAZk0zYFW2Iw49gfyf36LCGo662RQoGn1LPDKIU5ZGXzf7ko1wmfBt+oHJUucApAAACFAAAAAxyc2Etc2hhMi01MTIAAAIAXlWnl8BCFF/w2qAQ54sRMwhHjfRRYODVX2Gwc1aX/i3omleDzuq+QtJz5Bbxwno6ZIDVP+L2QzqmnOfig72yeFCrCKhF9UeOleezu3gF02xmKoV0T07kX2bQPm9fER1gAnzk2xkGL8WtxYePY9AjpYwX2PHEOERa6/PqBUPCeeXmw1lsSkCGTokW3061VCtypeWwOJ2gOrd1fvRWwBNmE39/uuorYt7Ub5v8GDtGpr8eMHeBmdqyZujlswtfZb1kVF5eXgjpvuFGEzI5AXjpWmJV1CwS9+hGXnjyv0jNrFvvZsyrwXTmzkVGbKAFc5MjPu5slO+yvwpnuyQqTb4LV2AtRBvaoNAJIURyJPWWvrRSlxucoo9ZLHarp+WhFUqcwoi1YAMHKkIxsv9wx96PTip8QscDgyWCqaNpC8k1/zPXDjJc2dS1V02Q6bUs9O33DIJ9TnqCLYtMALAM2FJ7HcMNBrxWDcgq6iM1UJ0Yyy8MUL71fcx4ugNT1dt1kNj9MbSREgQJ/H8B1EvKu7DWCH3x9wPG/5MM/9qDYF6dTxWZTgvtuVqc5zH+/LLXT6UKXDxaPIaspyALY/3jk6IHjrkD0tVjnp/kex6pAeN6oafVhThTPCAbYbWGsnWokERALRO+DnC3PmaLip9IsWg2/Va1WQ1PqkhUEW/pjMu9e6M= Test ED25519 User Key'
ED25519_USER_CERT_DEFAULTS_KEY_ID = 'ssh-keygen -s test-rsa-ca -I \'\' test-ed25519-user-all-defaults.pub'
| 339.335938
| 3,409
| 0.943778
| 2,034
| 43,435
| 20.068338
| 0.466568
| 0.007031
| 0.005145
| 0.007203
| 0.368358
| 0.363507
| 0.359416
| 0.353977
| 0.350425
| 0.347387
| 0
| 0.186782
| 0.011327
| 43,435
| 128
| 3,410
| 339.335938
| 0.763757
| 0.088017
| 0
| 0
| 0
| 0.21978
| 0.900909
| 0.881086
| 0
| 1
| 0
| 0
| 0
| 1
| 0
| false
| 0.010989
| 0.010989
| 0
| 0.010989
| 0
| 0
| 0
| 1
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 1
| null | 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
d7580cda971ccf9042647c8581e1eb941423787a
| 9,153
|
py
|
Python
|
untitled0.py
|
bassignana/Blood-Glucose-Prediction
|
10bfc4512d4e9fd364cfd3fde485e193496131ce
|
[
"MIT"
] | null | null | null |
untitled0.py
|
bassignana/Blood-Glucose-Prediction
|
10bfc4512d4e9fd364cfd3fde485e193496131ce
|
[
"MIT"
] | null | null | null |
untitled0.py
|
bassignana/Blood-Glucose-Prediction
|
10bfc4512d4e9fd364cfd3fde485e193496131ce
|
[
"MIT"
] | null | null | null |
#!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""
Created on Sat Sep 26 12:26:32 2020
@author: tommasobassignana
"""
import numpy as np
X = np.array([[1, 2], [3, 4], [1, 2], [3, 4], [1, 2], [3, 4]])
# y = np.array([1, 2, 3, 4, 5, 6])
# tscv = expanding_window()
# for train_index, test_index in tscv.split(X):
# print(train_index)
# print(test_index)
initial= 1
horizon = 1
period = 1
gap = 1
data = X
counter = 0 # for us to iterate and track later, like i?
data
data_length = data.shape[0] # rows
print(data_length)
data_index = list(np.arange(data_length))
print(data_index)
output_train = []
output_test = []
# append initial index
output_train.append(list(np.arange(initial)))
print(output_train)
progress = [x for x in data_index if x not in list(np.arange(initial))] #indexes left to append to train
print(progress)
output_train[counter]
output_test.append([x for x in data_index if x not in output_train[counter]][:horizon])
print(output_test)
# clip initial indexes from progress since that is what we are left
while len(progress) != 0:
print(" len progress is")
print(len(progress))
print("progress is")
print(progress)
temp = progress[:period]
print("period is")
print(period)
print("temp is")
print(temp)
print("counter is")
print(counter)
print("output_train[counter]")
print(output_train[counter])
to_add = output_train[counter] + temp
print("to add is")
print(to_add)
# update the train index
print("train_index before adding")
print(output_train)
output_train.append(to_add)
print("train_index after adding")
print(output_train)
# increment counter
counter +=1
# then we update the test index
print("test_index before adding")
print(output_test)
print("what to add to test")
#to_add_test = [x for x in data_index if x not in output_train[counter] ][:(horizon + gap)]
to_add_test = [x for x in data_index if x not in output_train[counter] ][:horizon]
if len(to_add_test) == 0:
break
to_add_test = int(to_add_test[-1])+gap
print(to_add_test)
output_test.append(to_add_test)
print("test_index after adding")
print(output_test)
# update progress
progress = [x for x in data_index if x not in output_train[counter]]
# clip the last element of output_train and output_test
#output_train = output_train[:-1]
#output_test = output_test[:-1]
output_train = output_train[:-gap]
output_test = output_test[:-gap]
print("final")
print(output_train)
print(output_test)
# mimic sklearn output
#index_output = [(train,test) for train,test in zip(output_train,output_test)]
X = np.array([[1, 2], [3, 4], [1, 2], [3, 4], [1, 2], [3, 4],[1, 2], [3, 4], [1, 2], [3, 4], [1, 2], [3, 4]])
# y = np.array([1, 2, 3, 4, 5, 6])
# tscv = expanding_window()
# for train_index, test_index in tscv.split(X):
# print(train_index)
# print(test_index)
initial= 1
horizon = 1
period = 1
gap = 0
#è problematico per gap = 0 e gap = 1??
data = X
counter = 0 # for us to iterate and track later, like i?
data
data_length = data.shape[0] # rows
print(data_length)
data_index = list(np.arange(data_length))
print(data_index)
output_train = []
output_test = []
# append initial index
output_train.append(list(np.arange(initial)))
print(output_train)
progress = [x for x in data_index if x not in list(np.arange(initial))] #indexes left to append to train
print(progress)
output_train[counter]
output_test.append([x for x in data_index if x not in output_train[counter]][:horizon])
print(output_test)
# clip initial indexes from progress since that is what we are left
while len(progress) != 0:
print(" len progress is")
print(len(progress))
print("progress is")
print(progress)
temp = progress[:period]
print("period is")
print(period)
print("temp is")
print(temp)
print("counter is")
print(counter)
print("output_train[counter]")
print(output_train[counter])
to_add = output_train[counter] + temp
print("to add is")
print(to_add)
# update the train index
print("train_index before adding")
print(output_train)
output_train.append(to_add)
print("train_index after adding")
print(output_train)
# increment counter
counter +=1
# then we update the test index
print("test_index before adding")
print(output_test)
print("what to add to test")
#to_add_test = [x for x in data_index if x not in output_train[counter] ][:(horizon + gap)]
to_add_test = [x for x in data_index if x not in output_train[counter] ][:horizon]
if len(to_add_test) == 0:
break
to_add_test = int(to_add_test[-1])+gap
print(to_add_test)
output_test.append(to_add_test)
print("test_index after adding")
print(output_test)
# update progress
progress = [x for x in data_index if x not in output_train[counter]]
# clip the last element of output_train and output_test
#output_train = output_train[:-1]
#output_test = output_test[:-1]
if gap != 0:
output_train = output_train[:-gap]
output_test = output_test[:-gap]
output_train = output_train[:len(output_test)]
print("final")
print(output_train)
print(output_test)
############
# X = np.array([[1, 2], [3, 4], [1, 2], [3, 4], [1, 2], [3, 4],[1, 2], [3, 4], [1, 2], [3, 4], [1, 2], [3, 4]])
# initial= 1
# horizon = 1
# period = 1
# gap = 0
# #è problematico per gap = 0 e gap = 1??
# data = X
# counter = 0 # for us to iterate and track later, like i?
# data
# data_length = data.shape[0] # rows
# print(data_length)
# data_index = list(np.arange(data_length))
# print(data_index)
# output_train = []
# output_test = []
# real_output_train = []
# # append initial index
# output_train.append(list(np.arange(initial)))
# print(output_train)
# progress = [x for x in data_index if x not in list(np.arange(initial))] #indexes left to append to train
# print(progress)
# output_train[counter]
# output_test.append([x for x in data_index if x not in output_train[counter]][:horizon])
# print(output_test)
# # clip initial indexes from progress since that is what we are left
# cut = period
# while len(progress) != 0:
# print(" len progress is")
# print(len(progress))
# print("progress is")
# print(progress)
# temp = progress[:period]#period è quanti indici aggiungo ogni volta
# print("period is")
# print(period)
# print("temp is")
# print(temp)
# print("counter is")
# print(counter)
# print("output_train[counter]")
# print(output_train[counter])
# to_add = output_train[counter] + temp
# print("QUELLO CHE VORREI")
# print("cut is")
# print(cut)
# print(to_add[cut:])
# cut += 1
# print("to add is")
# print(to_add)
# # update the train index
# print("train_index before adding")
# print(output_train)
# output_train.append(to_add)
# print("train_index after adding")
# print(output_train)
# # increment counter
# counter +=1
# # then we update the test index
# print("test_index before adding")
# print(output_test)
# print("what to add to test")
# #to_add_test = [x for x in data_index if x not in output_train[counter] ][:(horizon + gap)]
# to_add_test = [x for x in data_index if x not in output_train[counter] ][:horizon]
# if len(to_add_test) == 0:
# break
# to_add_test = int(to_add_test[-1])+gap
# print(to_add_test)
# output_test.append(to_add_test)
# print("test_index after adding")
# print(output_test)
# # update progress
# progress = [x for x in data_index if x not in output_train[counter]]
# # clip the last element of output_train and output_test
# #output_train = output_train[:-1]
# #output_test = output_test[:-1]
# if gap != 0:
# output_train = output_train[:-gap]
# output_test = output_test[:-gap]
# output_train = output_train[:len(output_test)]
# print("final")
# print(output_train)
# print(output_test)
| 30.51
| 111
| 0.581558
| 1,253
| 9,153
| 4.079808
| 0.086991
| 0.144171
| 0.084507
| 0.013302
| 0.94777
| 0.94777
| 0.94777
| 0.94777
| 0.93975
| 0.93975
| 0
| 0.020134
| 0.300011
| 9,153
| 300
| 112
| 30.51
| 0.777743
| 0.482246
| 0
| 0.944
| 0
| 0
| 0.088569
| 0.009162
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.008
| 0
| 0.008
| 0.512
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
|
0
| 8
|
d781e25d757f628a418ea07c72469668b1228a13
| 10,455
|
py
|
Python
|
openapi_server/controllers/addresses_controller.py
|
graphsense/graphsense-REST
|
2e4a9c20835e54d971e3fc3aae5780bc87d48647
|
[
"MIT"
] | 14
|
2017-11-25T18:27:14.000Z
|
2022-02-22T09:42:09.000Z
|
openapi_server/controllers/addresses_controller.py
|
graphsense/graphsense-REST
|
2e4a9c20835e54d971e3fc3aae5780bc87d48647
|
[
"MIT"
] | 64
|
2019-03-29T08:15:05.000Z
|
2022-02-24T10:28:34.000Z
|
openapi_server/controllers/addresses_controller.py
|
graphsense/graphsense-REST
|
2e4a9c20835e54d971e3fc3aae5780bc87d48647
|
[
"MIT"
] | 12
|
2018-10-20T22:29:29.000Z
|
2022-02-16T10:12:30.000Z
|
import connexion
import six
import traceback
from openapi_server.models.address import Address # noqa: E501
from openapi_server.models.address_tag import AddressTag # noqa: E501
from openapi_server.models.address_txs import AddressTxs # noqa: E501
from openapi_server.models.addresses import Addresses # noqa: E501
from openapi_server.models.entity import Entity # noqa: E501
from openapi_server.models.link import Link # noqa: E501
from openapi_server.models.neighbors import Neighbors # noqa: E501
import gsrest.service.addresses_service as service
from gsrest.service.problems import notfound, badrequest, internalerror
def get_address(currency, address, include_tags=None): # noqa: E501
"""Get an address, optionally with tags
# noqa: E501
:param currency: The cryptocurrency (e.g., btc)
:type currency: str
:param address: The cryptocurrency address
:type address: str
:param include_tags: Whether tags should be included
:type include_tags: bool
:rtype: Address
"""
try:
return service.get_address(
currency=currency,
address=address,
include_tags=include_tags)
except RuntimeError as e:
return notfound(str(e))
except ValueError as e:
return badrequest(str(e))
except Exception as e:
traceback.print_exception(type(e), e, e.__traceback__)
return internalerror(str(e))
def get_address_entity(currency, address, include_tags=None, tag_coherence=None): # noqa: E501
"""Get the entity of an address
# noqa: E501
:param currency: The cryptocurrency (e.g., btc)
:type currency: str
:param address: The cryptocurrency address
:type address: str
:param include_tags: Whether tags should be included
:type include_tags: bool
:param tag_coherence: Whether to calculate coherence of address tags
:type tag_coherence: bool
:rtype: Entity
"""
try:
return service.get_address_entity(
currency=currency,
address=address,
include_tags=include_tags,
tag_coherence=tag_coherence)
except RuntimeError as e:
return notfound(str(e))
except ValueError as e:
return badrequest(str(e))
except Exception as e:
traceback.print_exception(type(e), e, e.__traceback__)
return internalerror(str(e))
def list_address_links(currency, address, neighbor): # noqa: E501
"""Get transactions between two addresses
# noqa: E501
:param currency: The cryptocurrency (e.g., btc)
:type currency: str
:param address: The cryptocurrency address
:type address: str
:param neighbor: Neighbor address
:type neighbor: str
:rtype: List[Link]
"""
try:
return service.list_address_links(
currency=currency,
address=address,
neighbor=neighbor)
except RuntimeError as e:
return notfound(str(e))
except ValueError as e:
return badrequest(str(e))
except Exception as e:
traceback.print_exception(type(e), e, e.__traceback__)
return internalerror(str(e))
def list_address_links_csv(currency, address, neighbor): # noqa: E501
"""Get transactions between two addresses as CSV
# noqa: E501
:param currency: The cryptocurrency (e.g., btc)
:type currency: str
:param address: The cryptocurrency address
:type address: str
:param neighbor: Neighbor address
:type neighbor: str
:rtype: str
"""
try:
return service.list_address_links_csv(
currency=currency,
address=address,
neighbor=neighbor)
except RuntimeError as e:
return notfound(str(e))
except ValueError as e:
return badrequest(str(e))
except Exception as e:
traceback.print_exception(type(e), e, e.__traceback__)
return internalerror(str(e))
def list_address_neighbors(currency, address, direction, include_labels=None, page=None, pagesize=None): # noqa: E501
"""Get an addresses' neighbors in the address graph
# noqa: E501
:param currency: The cryptocurrency (e.g., btc)
:type currency: str
:param address: The cryptocurrency address
:type address: str
:param direction: Incoming or outgoing neighbors
:type direction: str
:param include_labels: Whether labels of tags should be included
:type include_labels: bool
:param page: Resumption token for retrieving the next page
:type page: str
:param pagesize: Number of items returned in a single page
:type pagesize: int
:rtype: Neighbors
"""
try:
return service.list_address_neighbors(
currency=currency,
address=address,
direction=direction,
include_labels=include_labels,
page=page,
pagesize=pagesize)
except RuntimeError as e:
return notfound(str(e))
except ValueError as e:
return badrequest(str(e))
except Exception as e:
traceback.print_exception(type(e), e, e.__traceback__)
return internalerror(str(e))
def list_address_neighbors_csv(currency, address, direction): # noqa: E501
"""Get an addresses' neighbors in the address graph as CSV
# noqa: E501
:param currency: The cryptocurrency (e.g., btc)
:type currency: str
:param address: The cryptocurrency address
:type address: str
:param direction: Incoming or outgoing neighbors
:type direction: str
:rtype: str
"""
try:
return service.list_address_neighbors_csv(
currency=currency,
address=address,
direction=direction)
except RuntimeError as e:
return notfound(str(e))
except ValueError as e:
return badrequest(str(e))
except Exception as e:
traceback.print_exception(type(e), e, e.__traceback__)
return internalerror(str(e))
def list_address_txs(currency, address, page=None, pagesize=None): # noqa: E501
"""Get all transactions an address has been involved in
# noqa: E501
:param currency: The cryptocurrency (e.g., btc)
:type currency: str
:param address: The cryptocurrency address
:type address: str
:param page: Resumption token for retrieving the next page
:type page: str
:param pagesize: Number of items returned in a single page
:type pagesize: int
:rtype: AddressTxs
"""
try:
return service.list_address_txs(
currency=currency,
address=address,
page=page,
pagesize=pagesize)
except RuntimeError as e:
return notfound(str(e))
except ValueError as e:
return badrequest(str(e))
except Exception as e:
traceback.print_exception(type(e), e, e.__traceback__)
return internalerror(str(e))
def list_address_txs_csv(currency, address): # noqa: E501
"""Get all transactions an address has been involved in as CSV
# noqa: E501
:param currency: The cryptocurrency (e.g., btc)
:type currency: str
:param address: The cryptocurrency address
:type address: str
:rtype: str
"""
try:
return service.list_address_txs_csv(
currency=currency,
address=address)
except RuntimeError as e:
return notfound(str(e))
except ValueError as e:
return badrequest(str(e))
except Exception as e:
traceback.print_exception(type(e), e, e.__traceback__)
return internalerror(str(e))
def list_addresses(currency, ids=None, page=None, pagesize=None): # noqa: E501
"""Get addresses
# noqa: E501
:param currency: The cryptocurrency (e.g., btc)
:type currency: str
:param ids: Restrict result to given set of comma separated IDs
:type ids: List[str]
:param page: Resumption token for retrieving the next page
:type page: str
:param pagesize: Number of items returned in a single page
:type pagesize: int
:rtype: Addresses
"""
try:
return service.list_addresses(
currency=currency,
ids=ids,
page=page,
pagesize=pagesize)
except RuntimeError as e:
return notfound(str(e))
except ValueError as e:
return badrequest(str(e))
except Exception as e:
traceback.print_exception(type(e), e, e.__traceback__)
return internalerror(str(e))
def list_addresses_csv(currency, ids): # noqa: E501
"""Get addresses as CSV
# noqa: E501
:param currency: The cryptocurrency (e.g., btc)
:type currency: str
:param ids: Set of comma separated IDs
:type ids: List[str]
:rtype: str
"""
try:
return service.list_addresses_csv(
currency=currency,
ids=ids)
except RuntimeError as e:
return notfound(str(e))
except ValueError as e:
return badrequest(str(e))
except Exception as e:
traceback.print_exception(type(e), e, e.__traceback__)
return internalerror(str(e))
def list_tags_by_address(currency, address): # noqa: E501
"""Get attribution tags for a given address
# noqa: E501
:param currency: The cryptocurrency (e.g., btc)
:type currency: str
:param address: The cryptocurrency address
:type address: str
:rtype: List[AddressTag]
"""
try:
return service.list_tags_by_address(
currency=currency,
address=address)
except RuntimeError as e:
return notfound(str(e))
except ValueError as e:
return badrequest(str(e))
except Exception as e:
traceback.print_exception(type(e), e, e.__traceback__)
return internalerror(str(e))
def list_tags_by_address_csv(currency, address): # noqa: E501
"""Get attribution tags for a given address
# noqa: E501
:param currency: The cryptocurrency (e.g., btc)
:type currency: str
:param address: The cryptocurrency address
:type address: str
:rtype: str
"""
try:
return service.list_tags_by_address_csv(
currency=currency,
address=address)
except RuntimeError as e:
return notfound(str(e))
except ValueError as e:
return badrequest(str(e))
except Exception as e:
traceback.print_exception(type(e), e, e.__traceback__)
return internalerror(str(e))
| 29.367978
| 118
| 0.657963
| 1,278
| 10,455
| 5.268388
| 0.07903
| 0.01604
| 0.032081
| 0.037428
| 0.876875
| 0.84524
| 0.787762
| 0.762513
| 0.72761
| 0.717362
| 0
| 0.012524
| 0.259206
| 10,455
| 355
| 119
| 29.450704
| 0.856811
| 0.356863
| 0
| 0.741176
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.070588
| false
| 0
| 0.070588
| 0
| 0.423529
| 0.070588
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
ad2c2b7167c0bedb8a559ca082f8b511152eae93
| 7,971
|
py
|
Python
|
tests/api/service/test_vuln.py
|
hoominkani/dagda
|
8818ab96807c9755955b66ac6db6847ee4001c81
|
[
"Apache-2.0"
] | 947
|
2016-11-25T10:48:30.000Z
|
2022-03-30T20:09:00.000Z
|
tests/api/service/test_vuln.py
|
hoominkani/dagda
|
8818ab96807c9755955b66ac6db6847ee4001c81
|
[
"Apache-2.0"
] | 96
|
2016-11-28T10:58:50.000Z
|
2021-10-19T18:32:12.000Z
|
tests/api/service/test_vuln.py
|
hoominkani/dagda
|
8818ab96807c9755955b66ac6db6847ee4001c81
|
[
"Apache-2.0"
] | 148
|
2016-11-28T12:33:46.000Z
|
2022-03-02T01:57:21.000Z
|
#
# Licensed to Dagda under one or more contributor
# license agreements. See the NOTICE file distributed with
# this work for additional information regarding copyright
# ownership. Dagda licenses this file to you under
# the Apache License, Version 2.0 (the "License"); you may
# not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing,
# software distributed under the License is distributed on an
# "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
# KIND, either express or implied. See the License for the
# specific language governing permissions and limitations
# under the License.
#
import unittest
from unittest.mock import patch
from dagda.api.service.vuln import get_vulns_by_product_and_version
from dagda.api.service.vuln import get_products_by_cve
from dagda.api.service.vuln import get_products_by_bid
from dagda.api.service.vuln import get_products_by_exploit_id
from dagda.api.service.vuln import get_products_by_rhsa
from dagda.api.service.vuln import get_products_by_rhba
from dagda.api.service.vuln import init_or_update_db
from dagda.api.service.vuln import get_init_or_update_db_status
# -- Test suite
class VulnApiTestCase(unittest.TestCase):
# -- Mock internal classes
class MockMongoDriverEmptyLists():
def get_vulnerabilities(self, product, version):
return []
def get_products_by_cve(self, cve_id):
return []
def get_products_by_bid(self, bid_id):
return []
def get_products_by_exploit_db_id(self, exploit_id):
return []
def get_products_by_rhba(self, rhba_id):
return []
def get_products_by_rhsa(self, rhsa_id):
return []
def get_init_db_process_status(self):
return {'timestamp': None}
class MockMongoDriverWithContent():
def get_vulnerabilities(self, product, version):
return ['CVE-2002-2002']
def get_products_by_cve(self, cve_id):
return [{'product':'product_name', 'version': '1.0.0'}]
def get_products_by_bid(self, bid_id):
return [{'product':'product_name', 'version': '1.0.0'}]
def get_products_by_exploit_db_id(self, exploit_id):
return [{'product':'product_name', 'version': '1.0.0'}]
def get_products_by_rhba(self, rhba_id):
return [{'product':'product_name', 'version': '1.0.0'}]
def get_products_by_rhsa(self, rhsa_id):
return [{'product':'product_name', 'version': '1.0.0'}]
def get_init_db_process_status(self):
return {'timestamp': 123456789}
class MockDagdaEdn():
def put(self, msg):
return
# -- Tests
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverEmptyLists())
def test_get_vulns_by_product_and_version_404(self, m):
response, code = get_vulns_by_product_and_version('product')
self.assertEqual(code, 404)
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverEmptyLists())
def test_get_products_by_cve_400(self, m):
response, code = get_products_by_cve('product')
self.assertEqual(code, 400)
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverEmptyLists())
def test_get_products_by_rhba_400(self, m):
response, code = get_products_by_rhba('product')
self.assertEqual(code, 400)
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverEmptyLists())
def test_get_products_by_rhsa_400(self, m):
response, code = get_products_by_rhsa('product')
self.assertEqual(code, 400)
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverEmptyLists())
def test_get_products_by_cve_404(self, m):
response, code = get_products_by_cve('CVE-2002-2002')
self.assertEqual(code, 404)
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverEmptyLists())
def test_get_products_by_bid_404(self, m):
response, code = get_products_by_bid(1)
self.assertEqual(code, 404)
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverEmptyLists())
def test_get_products_by_exploit_id_404(self, m):
response, code = get_products_by_exploit_id(1)
self.assertEqual(code, 404)
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverEmptyLists())
def test_get_products_by_rhba_404(self, m):
response, code = get_products_by_rhba('RHBA-2012:2002')
self.assertEqual(code, 404)
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverEmptyLists())
def test_get_products_by_rhsa_404(self, m):
response, code = get_products_by_rhsa('RHSA-2012:2002')
self.assertEqual(code, 404)
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverWithContent())
def test_get_vulns_by_product_and_version_200(self, m):
response = get_vulns_by_product_and_version('product')
self.assertEqual(response, '["CVE-2002-2002"]')
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverWithContent())
def test_get_products_by_cve_200(self, m):
response = get_products_by_cve('CVE-2002-2002')
self.assertEqual(response, '[{"product": "product_name", "version": "1.0.0"}]')
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverWithContent())
def test_get_products_by_bid_200(self, m):
response = get_products_by_bid(1)
self.assertEqual(response, '[{"product": "product_name", "version": "1.0.0"}]')
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverWithContent())
def test_get_products_by_exploit_id_200(self, m):
response = get_products_by_exploit_id(1)
self.assertEqual(response, '[{"product": "product_name", "version": "1.0.0"}]')
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverWithContent())
def test_get_products_by_rhba_200(self, m):
response = get_products_by_rhba('RHBA-2012:2002')
self.assertEqual(response, '[{"product": "product_name", "version": "1.0.0"}]')
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverWithContent())
def test_get_products_by_rhsa_200(self, m):
response = get_products_by_rhsa('RHSA-2012:2002')
self.assertEqual(response, '[{"product": "product_name", "version": "1.0.0"}]')
@patch('api.internal.internal_server.InternalServer.get_dagda_edn', return_value=MockDagdaEdn())
def test_init_or_update_db_202(self, m):
response, code = init_or_update_db()
self.assertEqual(code, 202)
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverEmptyLists())
def test_get_init_or_update_db_status_empty_timestamp(self, m):
response = get_init_or_update_db_status()
self.assertEqual(response, '{"timestamp": "-"}')
@patch('api.internal.internal_server.InternalServer.get_mongodb_driver', return_value=MockMongoDriverWithContent())
def test_get_init_or_update_db_status_with_timestamp(self, m):
response = get_init_or_update_db_status()
self.assertEqual(response, '{"timestamp": "1973-11-29 21:33:09"}')
if __name__ == '__main__':
unittest.main()
| 44.283333
| 119
| 0.72952
| 1,036
| 7,971
| 5.285714
| 0.1361
| 0.082359
| 0.097334
| 0.07889
| 0.815194
| 0.810628
| 0.790541
| 0.741052
| 0.676224
| 0.54748
| 0
| 0.030348
| 0.160833
| 7,971
| 179
| 120
| 44.530726
| 0.788309
| 0.095973
| 0
| 0.491525
| 0
| 0
| 0.241927
| 0.154649
| 0
| 0
| 0
| 0
| 0.152542
| 1
| 0.279661
| false
| 0
| 0.084746
| 0.127119
| 0.525424
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 1
| 1
| 0
|
0
| 7
|
a8f9c97fcc4081f0a96af9f5a61bf8d638d2b6f4
| 22,810
|
py
|
Python
|
sdk/python/pulumi_azure/sql/managed_instance_active_directory_administrator.py
|
henriktao/pulumi-azure
|
f1cbcf100b42b916da36d8fe28be3a159abaf022
|
[
"ECL-2.0",
"Apache-2.0"
] | 109
|
2018-06-18T00:19:44.000Z
|
2022-02-20T05:32:57.000Z
|
sdk/python/pulumi_azure/sql/managed_instance_active_directory_administrator.py
|
henriktao/pulumi-azure
|
f1cbcf100b42b916da36d8fe28be3a159abaf022
|
[
"ECL-2.0",
"Apache-2.0"
] | 663
|
2018-06-18T21:08:46.000Z
|
2022-03-31T20:10:11.000Z
|
sdk/python/pulumi_azure/sql/managed_instance_active_directory_administrator.py
|
henriktao/pulumi-azure
|
f1cbcf100b42b916da36d8fe28be3a159abaf022
|
[
"ECL-2.0",
"Apache-2.0"
] | 41
|
2018-07-19T22:37:38.000Z
|
2022-03-14T10:56:26.000Z
|
# coding=utf-8
# *** WARNING: this file was generated by the Pulumi Terraform Bridge (tfgen) Tool. ***
# *** Do not edit by hand unless you're certain you know what you are doing! ***
import warnings
import pulumi
import pulumi.runtime
from typing import Any, Mapping, Optional, Sequence, Union, overload
from .. import _utilities
__all__ = ['ManagedInstanceActiveDirectoryAdministratorArgs', 'ManagedInstanceActiveDirectoryAdministrator']
@pulumi.input_type
class ManagedInstanceActiveDirectoryAdministratorArgs:
def __init__(__self__, *,
login: pulumi.Input[str],
managed_instance_name: pulumi.Input[str],
object_id: pulumi.Input[str],
resource_group_name: pulumi.Input[str],
tenant_id: pulumi.Input[str],
azuread_authentication_only: Optional[pulumi.Input[bool]] = None):
"""
The set of arguments for constructing a ManagedInstanceActiveDirectoryAdministrator resource.
:param pulumi.Input[str] login: The login name of the principal to set as the Managed Instance administrator
:param pulumi.Input[str] managed_instance_name: The name of the SQL Managed Instance on which to set the administrator. Changing this forces a new resource to be created.
:param pulumi.Input[str] object_id: The ID of the principal to set as the Managed Instance administrator
:param pulumi.Input[str] resource_group_name: The name of the resource group for the SQL Managed Instance. Changing this forces a new resource to be created.
:param pulumi.Input[str] tenant_id: The Azure Tenant ID
:param pulumi.Input[bool] azuread_authentication_only: Specifies whether only AD Users and administrators can be used to login (`true`) or also local database users (`false`). Defaults to `false`.
"""
pulumi.set(__self__, "login", login)
pulumi.set(__self__, "managed_instance_name", managed_instance_name)
pulumi.set(__self__, "object_id", object_id)
pulumi.set(__self__, "resource_group_name", resource_group_name)
pulumi.set(__self__, "tenant_id", tenant_id)
if azuread_authentication_only is not None:
pulumi.set(__self__, "azuread_authentication_only", azuread_authentication_only)
@property
@pulumi.getter
def login(self) -> pulumi.Input[str]:
"""
The login name of the principal to set as the Managed Instance administrator
"""
return pulumi.get(self, "login")
@login.setter
def login(self, value: pulumi.Input[str]):
pulumi.set(self, "login", value)
@property
@pulumi.getter(name="managedInstanceName")
def managed_instance_name(self) -> pulumi.Input[str]:
"""
The name of the SQL Managed Instance on which to set the administrator. Changing this forces a new resource to be created.
"""
return pulumi.get(self, "managed_instance_name")
@managed_instance_name.setter
def managed_instance_name(self, value: pulumi.Input[str]):
pulumi.set(self, "managed_instance_name", value)
@property
@pulumi.getter(name="objectId")
def object_id(self) -> pulumi.Input[str]:
"""
The ID of the principal to set as the Managed Instance administrator
"""
return pulumi.get(self, "object_id")
@object_id.setter
def object_id(self, value: pulumi.Input[str]):
pulumi.set(self, "object_id", value)
@property
@pulumi.getter(name="resourceGroupName")
def resource_group_name(self) -> pulumi.Input[str]:
"""
The name of the resource group for the SQL Managed Instance. Changing this forces a new resource to be created.
"""
return pulumi.get(self, "resource_group_name")
@resource_group_name.setter
def resource_group_name(self, value: pulumi.Input[str]):
pulumi.set(self, "resource_group_name", value)
@property
@pulumi.getter(name="tenantId")
def tenant_id(self) -> pulumi.Input[str]:
"""
The Azure Tenant ID
"""
return pulumi.get(self, "tenant_id")
@tenant_id.setter
def tenant_id(self, value: pulumi.Input[str]):
pulumi.set(self, "tenant_id", value)
@property
@pulumi.getter(name="azureadAuthenticationOnly")
def azuread_authentication_only(self) -> Optional[pulumi.Input[bool]]:
"""
Specifies whether only AD Users and administrators can be used to login (`true`) or also local database users (`false`). Defaults to `false`.
"""
return pulumi.get(self, "azuread_authentication_only")
@azuread_authentication_only.setter
def azuread_authentication_only(self, value: Optional[pulumi.Input[bool]]):
pulumi.set(self, "azuread_authentication_only", value)
@pulumi.input_type
class _ManagedInstanceActiveDirectoryAdministratorState:
def __init__(__self__, *,
azuread_authentication_only: Optional[pulumi.Input[bool]] = None,
login: Optional[pulumi.Input[str]] = None,
managed_instance_name: Optional[pulumi.Input[str]] = None,
object_id: Optional[pulumi.Input[str]] = None,
resource_group_name: Optional[pulumi.Input[str]] = None,
tenant_id: Optional[pulumi.Input[str]] = None):
"""
Input properties used for looking up and filtering ManagedInstanceActiveDirectoryAdministrator resources.
:param pulumi.Input[bool] azuread_authentication_only: Specifies whether only AD Users and administrators can be used to login (`true`) or also local database users (`false`). Defaults to `false`.
:param pulumi.Input[str] login: The login name of the principal to set as the Managed Instance administrator
:param pulumi.Input[str] managed_instance_name: The name of the SQL Managed Instance on which to set the administrator. Changing this forces a new resource to be created.
:param pulumi.Input[str] object_id: The ID of the principal to set as the Managed Instance administrator
:param pulumi.Input[str] resource_group_name: The name of the resource group for the SQL Managed Instance. Changing this forces a new resource to be created.
:param pulumi.Input[str] tenant_id: The Azure Tenant ID
"""
if azuread_authentication_only is not None:
pulumi.set(__self__, "azuread_authentication_only", azuread_authentication_only)
if login is not None:
pulumi.set(__self__, "login", login)
if managed_instance_name is not None:
pulumi.set(__self__, "managed_instance_name", managed_instance_name)
if object_id is not None:
pulumi.set(__self__, "object_id", object_id)
if resource_group_name is not None:
pulumi.set(__self__, "resource_group_name", resource_group_name)
if tenant_id is not None:
pulumi.set(__self__, "tenant_id", tenant_id)
@property
@pulumi.getter(name="azureadAuthenticationOnly")
def azuread_authentication_only(self) -> Optional[pulumi.Input[bool]]:
"""
Specifies whether only AD Users and administrators can be used to login (`true`) or also local database users (`false`). Defaults to `false`.
"""
return pulumi.get(self, "azuread_authentication_only")
@azuread_authentication_only.setter
def azuread_authentication_only(self, value: Optional[pulumi.Input[bool]]):
pulumi.set(self, "azuread_authentication_only", value)
@property
@pulumi.getter
def login(self) -> Optional[pulumi.Input[str]]:
"""
The login name of the principal to set as the Managed Instance administrator
"""
return pulumi.get(self, "login")
@login.setter
def login(self, value: Optional[pulumi.Input[str]]):
pulumi.set(self, "login", value)
@property
@pulumi.getter(name="managedInstanceName")
def managed_instance_name(self) -> Optional[pulumi.Input[str]]:
"""
The name of the SQL Managed Instance on which to set the administrator. Changing this forces a new resource to be created.
"""
return pulumi.get(self, "managed_instance_name")
@managed_instance_name.setter
def managed_instance_name(self, value: Optional[pulumi.Input[str]]):
pulumi.set(self, "managed_instance_name", value)
@property
@pulumi.getter(name="objectId")
def object_id(self) -> Optional[pulumi.Input[str]]:
"""
The ID of the principal to set as the Managed Instance administrator
"""
return pulumi.get(self, "object_id")
@object_id.setter
def object_id(self, value: Optional[pulumi.Input[str]]):
pulumi.set(self, "object_id", value)
@property
@pulumi.getter(name="resourceGroupName")
def resource_group_name(self) -> Optional[pulumi.Input[str]]:
"""
The name of the resource group for the SQL Managed Instance. Changing this forces a new resource to be created.
"""
return pulumi.get(self, "resource_group_name")
@resource_group_name.setter
def resource_group_name(self, value: Optional[pulumi.Input[str]]):
pulumi.set(self, "resource_group_name", value)
@property
@pulumi.getter(name="tenantId")
def tenant_id(self) -> Optional[pulumi.Input[str]]:
"""
The Azure Tenant ID
"""
return pulumi.get(self, "tenant_id")
@tenant_id.setter
def tenant_id(self, value: Optional[pulumi.Input[str]]):
pulumi.set(self, "tenant_id", value)
class ManagedInstanceActiveDirectoryAdministrator(pulumi.CustomResource):
@overload
def __init__(__self__,
resource_name: str,
opts: Optional[pulumi.ResourceOptions] = None,
azuread_authentication_only: Optional[pulumi.Input[bool]] = None,
login: Optional[pulumi.Input[str]] = None,
managed_instance_name: Optional[pulumi.Input[str]] = None,
object_id: Optional[pulumi.Input[str]] = None,
resource_group_name: Optional[pulumi.Input[str]] = None,
tenant_id: Optional[pulumi.Input[str]] = None,
__props__=None):
"""
Allows you to set a user or group as the AD administrator for an Azure SQL Managed Instance
## Example Usage
```python
import pulumi
import pulumi_azure as azure
example_managed_instance = azure.sql.ManagedInstance("exampleManagedInstance",
resource_group_name=azurerm_resource_group["example"]["name"],
location=azurerm_resource_group["example"]["location"],
administrator_login="mradministrator",
administrator_login_password="thisIsDog11",
license_type="BasePrice",
subnet_id=azurerm_subnet["example"]["id"],
sku_name="GP_Gen5",
vcores=4,
storage_size_in_gb=32,
opts=pulumi.ResourceOptions(depends_on=[
azurerm_subnet_network_security_group_association["example"],
azurerm_subnet_route_table_association["example"],
]))
current = azure.core.get_client_config()
example_managed_instance_active_directory_administrator = azure.sql.ManagedInstanceActiveDirectoryAdministrator("exampleManagedInstanceActiveDirectoryAdministrator",
managed_instance_name=example_managed_instance.name,
resource_group_name=azurerm_resource_group["example"]["name"],
login="sqladmin",
tenant_id=current.tenant_id,
object_id=current.object_id)
```
## Import
A SQL Active Directory Administrator can be imported using the `resource id`, e.g.
```sh
$ pulumi import azure:sql/managedInstanceActiveDirectoryAdministrator:ManagedInstanceActiveDirectoryAdministrator administrator /subscriptions/00000000-0000-0000-0000-000000000000/resourceGroups/myresourcegroup/providers/Microsoft.Sql/managedInstances/mymanagedinstance/administrators/activeDirectory
```
:param str resource_name: The name of the resource.
:param pulumi.ResourceOptions opts: Options for the resource.
:param pulumi.Input[bool] azuread_authentication_only: Specifies whether only AD Users and administrators can be used to login (`true`) or also local database users (`false`). Defaults to `false`.
:param pulumi.Input[str] login: The login name of the principal to set as the Managed Instance administrator
:param pulumi.Input[str] managed_instance_name: The name of the SQL Managed Instance on which to set the administrator. Changing this forces a new resource to be created.
:param pulumi.Input[str] object_id: The ID of the principal to set as the Managed Instance administrator
:param pulumi.Input[str] resource_group_name: The name of the resource group for the SQL Managed Instance. Changing this forces a new resource to be created.
:param pulumi.Input[str] tenant_id: The Azure Tenant ID
"""
...
@overload
def __init__(__self__,
resource_name: str,
args: ManagedInstanceActiveDirectoryAdministratorArgs,
opts: Optional[pulumi.ResourceOptions] = None):
"""
Allows you to set a user or group as the AD administrator for an Azure SQL Managed Instance
## Example Usage
```python
import pulumi
import pulumi_azure as azure
example_managed_instance = azure.sql.ManagedInstance("exampleManagedInstance",
resource_group_name=azurerm_resource_group["example"]["name"],
location=azurerm_resource_group["example"]["location"],
administrator_login="mradministrator",
administrator_login_password="thisIsDog11",
license_type="BasePrice",
subnet_id=azurerm_subnet["example"]["id"],
sku_name="GP_Gen5",
vcores=4,
storage_size_in_gb=32,
opts=pulumi.ResourceOptions(depends_on=[
azurerm_subnet_network_security_group_association["example"],
azurerm_subnet_route_table_association["example"],
]))
current = azure.core.get_client_config()
example_managed_instance_active_directory_administrator = azure.sql.ManagedInstanceActiveDirectoryAdministrator("exampleManagedInstanceActiveDirectoryAdministrator",
managed_instance_name=example_managed_instance.name,
resource_group_name=azurerm_resource_group["example"]["name"],
login="sqladmin",
tenant_id=current.tenant_id,
object_id=current.object_id)
```
## Import
A SQL Active Directory Administrator can be imported using the `resource id`, e.g.
```sh
$ pulumi import azure:sql/managedInstanceActiveDirectoryAdministrator:ManagedInstanceActiveDirectoryAdministrator administrator /subscriptions/00000000-0000-0000-0000-000000000000/resourceGroups/myresourcegroup/providers/Microsoft.Sql/managedInstances/mymanagedinstance/administrators/activeDirectory
```
:param str resource_name: The name of the resource.
:param ManagedInstanceActiveDirectoryAdministratorArgs args: The arguments to use to populate this resource's properties.
:param pulumi.ResourceOptions opts: Options for the resource.
"""
...
def __init__(__self__, resource_name: str, *args, **kwargs):
resource_args, opts = _utilities.get_resource_args_opts(ManagedInstanceActiveDirectoryAdministratorArgs, pulumi.ResourceOptions, *args, **kwargs)
if resource_args is not None:
__self__._internal_init(resource_name, opts, **resource_args.__dict__)
else:
__self__._internal_init(resource_name, *args, **kwargs)
def _internal_init(__self__,
resource_name: str,
opts: Optional[pulumi.ResourceOptions] = None,
azuread_authentication_only: Optional[pulumi.Input[bool]] = None,
login: Optional[pulumi.Input[str]] = None,
managed_instance_name: Optional[pulumi.Input[str]] = None,
object_id: Optional[pulumi.Input[str]] = None,
resource_group_name: Optional[pulumi.Input[str]] = None,
tenant_id: Optional[pulumi.Input[str]] = None,
__props__=None):
if opts is None:
opts = pulumi.ResourceOptions()
if not isinstance(opts, pulumi.ResourceOptions):
raise TypeError('Expected resource options to be a ResourceOptions instance')
if opts.version is None:
opts.version = _utilities.get_version()
if opts.id is None:
if __props__ is not None:
raise TypeError('__props__ is only valid when passed in combination with a valid opts.id to get an existing resource')
__props__ = ManagedInstanceActiveDirectoryAdministratorArgs.__new__(ManagedInstanceActiveDirectoryAdministratorArgs)
__props__.__dict__["azuread_authentication_only"] = azuread_authentication_only
if login is None and not opts.urn:
raise TypeError("Missing required property 'login'")
__props__.__dict__["login"] = login
if managed_instance_name is None and not opts.urn:
raise TypeError("Missing required property 'managed_instance_name'")
__props__.__dict__["managed_instance_name"] = managed_instance_name
if object_id is None and not opts.urn:
raise TypeError("Missing required property 'object_id'")
__props__.__dict__["object_id"] = object_id
if resource_group_name is None and not opts.urn:
raise TypeError("Missing required property 'resource_group_name'")
__props__.__dict__["resource_group_name"] = resource_group_name
if tenant_id is None and not opts.urn:
raise TypeError("Missing required property 'tenant_id'")
__props__.__dict__["tenant_id"] = tenant_id
super(ManagedInstanceActiveDirectoryAdministrator, __self__).__init__(
'azure:sql/managedInstanceActiveDirectoryAdministrator:ManagedInstanceActiveDirectoryAdministrator',
resource_name,
__props__,
opts)
@staticmethod
def get(resource_name: str,
id: pulumi.Input[str],
opts: Optional[pulumi.ResourceOptions] = None,
azuread_authentication_only: Optional[pulumi.Input[bool]] = None,
login: Optional[pulumi.Input[str]] = None,
managed_instance_name: Optional[pulumi.Input[str]] = None,
object_id: Optional[pulumi.Input[str]] = None,
resource_group_name: Optional[pulumi.Input[str]] = None,
tenant_id: Optional[pulumi.Input[str]] = None) -> 'ManagedInstanceActiveDirectoryAdministrator':
"""
Get an existing ManagedInstanceActiveDirectoryAdministrator resource's state with the given name, id, and optional extra
properties used to qualify the lookup.
:param str resource_name: The unique name of the resulting resource.
:param pulumi.Input[str] id: The unique provider ID of the resource to lookup.
:param pulumi.ResourceOptions opts: Options for the resource.
:param pulumi.Input[bool] azuread_authentication_only: Specifies whether only AD Users and administrators can be used to login (`true`) or also local database users (`false`). Defaults to `false`.
:param pulumi.Input[str] login: The login name of the principal to set as the Managed Instance administrator
:param pulumi.Input[str] managed_instance_name: The name of the SQL Managed Instance on which to set the administrator. Changing this forces a new resource to be created.
:param pulumi.Input[str] object_id: The ID of the principal to set as the Managed Instance administrator
:param pulumi.Input[str] resource_group_name: The name of the resource group for the SQL Managed Instance. Changing this forces a new resource to be created.
:param pulumi.Input[str] tenant_id: The Azure Tenant ID
"""
opts = pulumi.ResourceOptions.merge(opts, pulumi.ResourceOptions(id=id))
__props__ = _ManagedInstanceActiveDirectoryAdministratorState.__new__(_ManagedInstanceActiveDirectoryAdministratorState)
__props__.__dict__["azuread_authentication_only"] = azuread_authentication_only
__props__.__dict__["login"] = login
__props__.__dict__["managed_instance_name"] = managed_instance_name
__props__.__dict__["object_id"] = object_id
__props__.__dict__["resource_group_name"] = resource_group_name
__props__.__dict__["tenant_id"] = tenant_id
return ManagedInstanceActiveDirectoryAdministrator(resource_name, opts=opts, __props__=__props__)
@property
@pulumi.getter(name="azureadAuthenticationOnly")
def azuread_authentication_only(self) -> pulumi.Output[Optional[bool]]:
"""
Specifies whether only AD Users and administrators can be used to login (`true`) or also local database users (`false`). Defaults to `false`.
"""
return pulumi.get(self, "azuread_authentication_only")
@property
@pulumi.getter
def login(self) -> pulumi.Output[str]:
"""
The login name of the principal to set as the Managed Instance administrator
"""
return pulumi.get(self, "login")
@property
@pulumi.getter(name="managedInstanceName")
def managed_instance_name(self) -> pulumi.Output[str]:
"""
The name of the SQL Managed Instance on which to set the administrator. Changing this forces a new resource to be created.
"""
return pulumi.get(self, "managed_instance_name")
@property
@pulumi.getter(name="objectId")
def object_id(self) -> pulumi.Output[str]:
"""
The ID of the principal to set as the Managed Instance administrator
"""
return pulumi.get(self, "object_id")
@property
@pulumi.getter(name="resourceGroupName")
def resource_group_name(self) -> pulumi.Output[str]:
"""
The name of the resource group for the SQL Managed Instance. Changing this forces a new resource to be created.
"""
return pulumi.get(self, "resource_group_name")
@property
@pulumi.getter(name="tenantId")
def tenant_id(self) -> pulumi.Output[str]:
"""
The Azure Tenant ID
"""
return pulumi.get(self, "tenant_id")
| 49.372294
| 309
| 0.681456
| 2,617
| 22,810
| 5.694689
| 0.081009
| 0.060525
| 0.06294
| 0.044286
| 0.846608
| 0.82943
| 0.814668
| 0.796216
| 0.777494
| 0.755284
| 0
| 0.004393
| 0.231609
| 22,810
| 461
| 310
| 49.479393
| 0.845895
| 0.402104
| 0
| 0.627119
| 1
| 0
| 0.132118
| 0.063264
| 0
| 0
| 0
| 0
| 0
| 1
| 0.15678
| false
| 0.004237
| 0.021186
| 0
| 0.271186
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
d15add738c10303aaba76a70d00edb3eccc18ea1
| 227
|
py
|
Python
|
clase 6/prueba_unitaria2/app/circunferencia.py
|
amedina14/uip-iq17-pc3
|
89f04c0670079384cee40736d5c92175a8c586a5
|
[
"MIT"
] | null | null | null |
clase 6/prueba_unitaria2/app/circunferencia.py
|
amedina14/uip-iq17-pc3
|
89f04c0670079384cee40736d5c92175a8c586a5
|
[
"MIT"
] | null | null | null |
clase 6/prueba_unitaria2/app/circunferencia.py
|
amedina14/uip-iq17-pc3
|
89f04c0670079384cee40736d5c92175a8c586a5
|
[
"MIT"
] | null | null | null |
class circunferencia:
def __init__(self, radio):
self.radio = radio
def calcular_area(self):
return 3.1416 * self.radio * self.radio
def calcular_diametro(self):
return self.radio*2
| 25.222222
| 48
| 0.625551
| 28
| 227
| 4.857143
| 0.464286
| 0.330882
| 0.191176
| 0.264706
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.037037
| 0.286344
| 227
| 9
| 49
| 25.222222
| 0.802469
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.428571
| false
| 0
| 0
| 0.285714
| 0.857143
| 0
| 1
| 0
| 0
| null | 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 1
| 0
| 0
|
0
| 7
|
66f9c10f8af77cf1b0ba076d17661c8ab1441b38
| 6,297
|
py
|
Python
|
example/test/core/geometry/blobby/unit.py
|
dmilos/IceRay
|
4e01f141363c0d126d3c700c1f5f892967e3d520
|
[
"MIT-0"
] | 2
|
2020-09-04T12:27:15.000Z
|
2022-01-17T14:49:40.000Z
|
example/test/core/geometry/blobby/unit.py
|
dmilos/IceRay
|
4e01f141363c0d126d3c700c1f5f892967e3d520
|
[
"MIT-0"
] | null | null | null |
example/test/core/geometry/blobby/unit.py
|
dmilos/IceRay
|
4e01f141363c0d126d3c700c1f5f892967e3d520
|
[
"MIT-0"
] | 1
|
2020-09-04T12:27:52.000Z
|
2020-09-04T12:27:52.000Z
|
import IceRayCpp
def name( ):
return "blobby"
def make():
return make_affine_affine_sphere()
def make_USphere_solo():
cargo={}
cargo['this']=IceRayCpp.GeometryBlobbySystem()
cargo['1'] = IceRayCpp.GeometryBlobbyUSphere( 0.5 )
cargo['rtss'] = IceRayCpp.GeometryRTSSList()
cargo['this'].add( cargo['1'] )
cargo['this'].rtss( cargo['rtss'] )
return cargo
def make_UCylinderZ_solo():
cargo={}
cargo['this']=IceRayCpp.GeometryBlobbySystem()
cargo['1'] = IceRayCpp.GeometryBlobbyUCylinderZ( 0.5 )
cargo['rtss'] = IceRayCpp.GeometryRTSSList()
cargo['this'].add( cargo['1'] )
cargo['this'].rtss( cargo['rtss'] )
return cargo
def make_UWaterZ_solo():
cargo={}
cargo['this']=IceRayCpp.GeometryBlobbySystem()
cargo['1'] = IceRayCpp.GeometryBlobbyUWaterZ( 0.5 )
cargo['rtss'] = IceRayCpp.GeometryRTSSList()
cargo['this'].add( cargo['1'] )
cargo['this'].rtss( cargo['rtss'] )
return cargo
def make_affine_solo():
cargo={}
cargo['this']=IceRayCpp.GeometryBlobbySystem()
cargo['c1'] = IceRayCpp.GeometryBlobbyUSphere( 0.5 )
cargo['1'] = IceRayCpp.GeometryBlobbyAffine( cargo['c1'] )
cargo['1'].scale( IceRayCpp.MathTypeCoord3D().fill(0), IceRayCpp.MathTypeCoord3D().load(1,1,0.3) )
cargo['rtss'] = IceRayCpp.GeometryRTSSList()
cargo['this'].add( cargo['1'] )
cargo['this'].rtss( cargo['rtss'] )
return cargo
def make_sphere_Usphere():
cargo={}
cargo['this']=IceRayCpp.GeometryBlobbySystem()
cargo['1'] = IceRayCpp.GeometryBlobbyUSphere( 0.5 )
cargo['2'] = IceRayCpp.GeometryBlobbySphere( IceRayCpp.MathTypeCoord3D().load(0.5,-0.5,0.5), 0.5, 1 )
cargo['rtss'] = IceRayCpp.GeometryRTSSList()
cargo['this'].add( cargo['1'] )
cargo['this'].add( cargo['2'] )
cargo['this'].rtss( cargo['rtss'] )
return cargo
def make_sphere_UCylinderZ():
cargo={}
cargo['this']=IceRayCpp.GeometryBlobbySystem()
cargo['1'] = IceRayCpp.GeometryBlobbyUCylinderZ( 0.5 )
cargo['2'] = IceRayCpp.GeometryBlobbySphere( IceRayCpp.MathTypeCoord3D().load(1,0.5,0.5), 0.5, 1 )
cargo['rtss'] = IceRayCpp.GeometryRTSSList()
cargo['this'].add( cargo['1'] )
cargo['this'].add( cargo['2'] )
cargo['this'].rtss( cargo['rtss'] )
return cargo
def make_sphere_UWaterZ():
cargo={}
cargo['this']=IceRayCpp.GeometryBlobbySystem()
cargo['1'] = IceRayCpp.GeometryBlobbyUWaterZ( 0.5 )
cargo['2'] = IceRayCpp.GeometryBlobbySphere( IceRayCpp.MathTypeCoord3D().load(1,0,1), 0.5, 1 )
cargo['rtss'] = IceRayCpp.GeometryRTSSList()
cargo['this'].add( cargo['1'] )
cargo['this'].add( cargo['2'] )
cargo['this'].rtss( cargo['rtss'] )
return cargo
def make_sphere_translate_sphere():
cargo={}
cargo['this']=IceRayCpp.GeometryBlobbySystem()
cargo['c1'] = IceRayCpp.GeometryBlobbySphere( IceRayCpp.MathTypeCoord3D().load(0,0,0), 0.4, 1 )
cargo['1'] = IceRayCpp.GeometryBlobbyTranslate( cargo['c1'], IceRayCpp.MathTypeCoord3D().load(-0.6,0,-0.1) )
cargo['2'] = IceRayCpp.GeometryBlobbySphere( IceRayCpp.MathTypeCoord3D().load(+0.6,0,+0.1), 0.4, 1 )
cargo['rtss'] = IceRayCpp.GeometryRTSSList()
cargo['this'].add( cargo['1'] )
cargo['this'].add( cargo['2'] )
cargo['this'].rtss( cargo['rtss'] )
return cargo
def make_sphere_translate_USphere():
cargo={}
cargo['this']=IceRayCpp.GeometryBlobbySystem()
cargo['c1'] = IceRayCpp.GeometryBlobbyUSphere( 0.5 )
cargo['1'] = IceRayCpp.GeometryBlobbyTranslate( cargo['c1'], IceRayCpp.MathTypeCoord3D().load(-0.6,0,-0.1) )
cargo['2'] = IceRayCpp.GeometryBlobbySphere( IceRayCpp.MathTypeCoord3D().load(+0.6,0,+0.1), 0.4, 1 )
cargo['rtss'] = IceRayCpp.GeometryRTSSList()
cargo['this'].add( cargo['1'] )
cargo['this'].add( cargo['2'] )
cargo['this'].rtss( cargo['rtss'] )
return cargo
def make_sphere_translate_UCylinderZ():
cargo={}
cargo['this']=IceRayCpp.GeometryBlobbySystem()
cargo['c1'] = IceRayCpp.GeometryBlobbyUCylinderZ( 0.5 )
cargo['1'] = IceRayCpp.GeometryBlobbyTranslate( cargo['c1'], IceRayCpp.MathTypeCoord3D().load(-0.6,0,-0.1) )
cargo['2'] = IceRayCpp.GeometryBlobbySphere( IceRayCpp.MathTypeCoord3D().load(+0.6,0,+0.1), 0.4, 1 )
cargo['rtss'] = IceRayCpp.GeometryRTSSList()
cargo['this'].add( cargo['1'] )
cargo['this'].add( cargo['2'] )
cargo['this'].rtss( cargo['rtss'] )
return cargo
def make_sphere_translate_UWaterZ():
cargo={}
cargo['this']=IceRayCpp.GeometryBlobbySystem()
cargo['c1'] = IceRayCpp.GeometryBlobbyUWaterZ( 0.5 )
cargo['1'] = IceRayCpp.GeometryBlobbyTranslate( cargo['c1'], IceRayCpp.MathTypeCoord3D().load(-0.6,0,-0.1) )
cargo['2'] = IceRayCpp.GeometryBlobbySphere( IceRayCpp.MathTypeCoord3D().load(+0.6,0,+0.1), 0.4, 1 )
cargo['rtss'] = IceRayCpp.GeometryRTSSList()
cargo['this'].add( cargo['1'] )
cargo['this'].add( cargo['2'] )
cargo['this'].rtss( cargo['rtss'] )
return cargo
def make_affine_affine_sphere():
cargo={}
cargo['this']=IceRayCpp.GeometryBlobbySystem()
cargo['c1'] = IceRayCpp.GeometryBlobbyUSphere( 0.5 )
cargo['1'] = IceRayCpp.GeometryBlobbyAffine( cargo['c1'] )
cargo['1'].scale( IceRayCpp.MathTypeCoord3D().fill(0), IceRayCpp.MathTypeCoord3D().load(1,1,0.3) )
cargo['1'].rotate( IceRayCpp.MathTypeCoord3D().fill(0), IceRayCpp.MathTypeCoord3D().load(1,0,0), 3.14159/2.0 )
cargo['1'].translate( IceRayCpp.MathTypeCoord3D().load(0.4,0,0), )
cargo['c2'] = IceRayCpp.GeometryBlobbyUSphere( 0.5 )
cargo['2'] = IceRayCpp.GeometryBlobbyAffine( cargo['c2'] )
cargo['2'].scale( IceRayCpp.MathTypeCoord3D().fill(0), IceRayCpp.MathTypeCoord3D().load(1,1,0.3) )
cargo['2'].translate( IceRayCpp.MathTypeCoord3D().load(-0.4,0,0), )
cargo['rtss'] = IceRayCpp.GeometryRTSSList()
cargo['this'].add( cargo['1'] )
cargo['this'].add( cargo['2'] )
cargo['this'].rtss( cargo['rtss'] )
return cargo
| 31.485
| 121
| 0.623471
| 700
| 6,297
| 5.562857
| 0.058571
| 0.101695
| 0.061633
| 0.087314
| 0.956343
| 0.94453
| 0.93169
| 0.906266
| 0.860812
| 0.80226
| 0
| 0.043529
| 0.190091
| 6,297
| 199
| 122
| 31.643216
| 0.72
| 0
| 0
| 0.776923
| 0
| 0
| 0.057724
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.107692
| false
| 0
| 0.007692
| 0.015385
| 0.223077
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
0f3daa18124a3ed6bd7bc1d09eb82a3ef9861c87
| 6,407
|
py
|
Python
|
loldib/getratings/models/NA/na_urgot/na_urgot_bot.py
|
koliupy/loldib
|
c9ab94deb07213cdc42b5a7c26467cdafaf81b7f
|
[
"Apache-2.0"
] | null | null | null |
loldib/getratings/models/NA/na_urgot/na_urgot_bot.py
|
koliupy/loldib
|
c9ab94deb07213cdc42b5a7c26467cdafaf81b7f
|
[
"Apache-2.0"
] | null | null | null |
loldib/getratings/models/NA/na_urgot/na_urgot_bot.py
|
koliupy/loldib
|
c9ab94deb07213cdc42b5a7c26467cdafaf81b7f
|
[
"Apache-2.0"
] | null | null | null |
from getratings.models.ratings import Ratings
class NA_Urgot_Bot_Aatrox(Ratings):
pass
class NA_Urgot_Bot_Ahri(Ratings):
pass
class NA_Urgot_Bot_Akali(Ratings):
pass
class NA_Urgot_Bot_Alistar(Ratings):
pass
class NA_Urgot_Bot_Amumu(Ratings):
pass
class NA_Urgot_Bot_Anivia(Ratings):
pass
class NA_Urgot_Bot_Annie(Ratings):
pass
class NA_Urgot_Bot_Ashe(Ratings):
pass
class NA_Urgot_Bot_AurelionSol(Ratings):
pass
class NA_Urgot_Bot_Azir(Ratings):
pass
class NA_Urgot_Bot_Bard(Ratings):
pass
class NA_Urgot_Bot_Blitzcrank(Ratings):
pass
class NA_Urgot_Bot_Brand(Ratings):
pass
class NA_Urgot_Bot_Braum(Ratings):
pass
class NA_Urgot_Bot_Caitlyn(Ratings):
pass
class NA_Urgot_Bot_Camille(Ratings):
pass
class NA_Urgot_Bot_Cassiopeia(Ratings):
pass
class NA_Urgot_Bot_Chogath(Ratings):
pass
class NA_Urgot_Bot_Corki(Ratings):
pass
class NA_Urgot_Bot_Darius(Ratings):
pass
class NA_Urgot_Bot_Diana(Ratings):
pass
class NA_Urgot_Bot_Draven(Ratings):
pass
class NA_Urgot_Bot_DrMundo(Ratings):
pass
class NA_Urgot_Bot_Ekko(Ratings):
pass
class NA_Urgot_Bot_Elise(Ratings):
pass
class NA_Urgot_Bot_Evelynn(Ratings):
pass
class NA_Urgot_Bot_Ezreal(Ratings):
pass
class NA_Urgot_Bot_Fiddlesticks(Ratings):
pass
class NA_Urgot_Bot_Fiora(Ratings):
pass
class NA_Urgot_Bot_Fizz(Ratings):
pass
class NA_Urgot_Bot_Galio(Ratings):
pass
class NA_Urgot_Bot_Gangplank(Ratings):
pass
class NA_Urgot_Bot_Garen(Ratings):
pass
class NA_Urgot_Bot_Gnar(Ratings):
pass
class NA_Urgot_Bot_Gragas(Ratings):
pass
class NA_Urgot_Bot_Graves(Ratings):
pass
class NA_Urgot_Bot_Hecarim(Ratings):
pass
class NA_Urgot_Bot_Heimerdinger(Ratings):
pass
class NA_Urgot_Bot_Illaoi(Ratings):
pass
class NA_Urgot_Bot_Irelia(Ratings):
pass
class NA_Urgot_Bot_Ivern(Ratings):
pass
class NA_Urgot_Bot_Janna(Ratings):
pass
class NA_Urgot_Bot_JarvanIV(Ratings):
pass
class NA_Urgot_Bot_Jax(Ratings):
pass
class NA_Urgot_Bot_Jayce(Ratings):
pass
class NA_Urgot_Bot_Jhin(Ratings):
pass
class NA_Urgot_Bot_Jinx(Ratings):
pass
class NA_Urgot_Bot_Kalista(Ratings):
pass
class NA_Urgot_Bot_Karma(Ratings):
pass
class NA_Urgot_Bot_Karthus(Ratings):
pass
class NA_Urgot_Bot_Kassadin(Ratings):
pass
class NA_Urgot_Bot_Katarina(Ratings):
pass
class NA_Urgot_Bot_Kayle(Ratings):
pass
class NA_Urgot_Bot_Kayn(Ratings):
pass
class NA_Urgot_Bot_Kennen(Ratings):
pass
class NA_Urgot_Bot_Khazix(Ratings):
pass
class NA_Urgot_Bot_Kindred(Ratings):
pass
class NA_Urgot_Bot_Kled(Ratings):
pass
class NA_Urgot_Bot_KogMaw(Ratings):
pass
class NA_Urgot_Bot_Leblanc(Ratings):
pass
class NA_Urgot_Bot_LeeSin(Ratings):
pass
class NA_Urgot_Bot_Leona(Ratings):
pass
class NA_Urgot_Bot_Lissandra(Ratings):
pass
class NA_Urgot_Bot_Lucian(Ratings):
pass
class NA_Urgot_Bot_Lulu(Ratings):
pass
class NA_Urgot_Bot_Lux(Ratings):
pass
class NA_Urgot_Bot_Malphite(Ratings):
pass
class NA_Urgot_Bot_Malzahar(Ratings):
pass
class NA_Urgot_Bot_Maokai(Ratings):
pass
class NA_Urgot_Bot_MasterYi(Ratings):
pass
class NA_Urgot_Bot_MissFortune(Ratings):
pass
class NA_Urgot_Bot_MonkeyKing(Ratings):
pass
class NA_Urgot_Bot_Mordekaiser(Ratings):
pass
class NA_Urgot_Bot_Morgana(Ratings):
pass
class NA_Urgot_Bot_Nami(Ratings):
pass
class NA_Urgot_Bot_Nasus(Ratings):
pass
class NA_Urgot_Bot_Nautilus(Ratings):
pass
class NA_Urgot_Bot_Nidalee(Ratings):
pass
class NA_Urgot_Bot_Nocturne(Ratings):
pass
class NA_Urgot_Bot_Nunu(Ratings):
pass
class NA_Urgot_Bot_Olaf(Ratings):
pass
class NA_Urgot_Bot_Orianna(Ratings):
pass
class NA_Urgot_Bot_Ornn(Ratings):
pass
class NA_Urgot_Bot_Pantheon(Ratings):
pass
class NA_Urgot_Bot_Poppy(Ratings):
pass
class NA_Urgot_Bot_Quinn(Ratings):
pass
class NA_Urgot_Bot_Rakan(Ratings):
pass
class NA_Urgot_Bot_Rammus(Ratings):
pass
class NA_Urgot_Bot_RekSai(Ratings):
pass
class NA_Urgot_Bot_Renekton(Ratings):
pass
class NA_Urgot_Bot_Rengar(Ratings):
pass
class NA_Urgot_Bot_Riven(Ratings):
pass
class NA_Urgot_Bot_Rumble(Ratings):
pass
class NA_Urgot_Bot_Ryze(Ratings):
pass
class NA_Urgot_Bot_Sejuani(Ratings):
pass
class NA_Urgot_Bot_Shaco(Ratings):
pass
class NA_Urgot_Bot_Shen(Ratings):
pass
class NA_Urgot_Bot_Shyvana(Ratings):
pass
class NA_Urgot_Bot_Singed(Ratings):
pass
class NA_Urgot_Bot_Sion(Ratings):
pass
class NA_Urgot_Bot_Sivir(Ratings):
pass
class NA_Urgot_Bot_Skarner(Ratings):
pass
class NA_Urgot_Bot_Sona(Ratings):
pass
class NA_Urgot_Bot_Soraka(Ratings):
pass
class NA_Urgot_Bot_Swain(Ratings):
pass
class NA_Urgot_Bot_Syndra(Ratings):
pass
class NA_Urgot_Bot_TahmKench(Ratings):
pass
class NA_Urgot_Bot_Taliyah(Ratings):
pass
class NA_Urgot_Bot_Talon(Ratings):
pass
class NA_Urgot_Bot_Taric(Ratings):
pass
class NA_Urgot_Bot_Teemo(Ratings):
pass
class NA_Urgot_Bot_Thresh(Ratings):
pass
class NA_Urgot_Bot_Tristana(Ratings):
pass
class NA_Urgot_Bot_Trundle(Ratings):
pass
class NA_Urgot_Bot_Tryndamere(Ratings):
pass
class NA_Urgot_Bot_TwistedFate(Ratings):
pass
class NA_Urgot_Bot_Twitch(Ratings):
pass
class NA_Urgot_Bot_Udyr(Ratings):
pass
class NA_Urgot_Bot_Urgot(Ratings):
pass
class NA_Urgot_Bot_Varus(Ratings):
pass
class NA_Urgot_Bot_Vayne(Ratings):
pass
class NA_Urgot_Bot_Veigar(Ratings):
pass
class NA_Urgot_Bot_Velkoz(Ratings):
pass
class NA_Urgot_Bot_Vi(Ratings):
pass
class NA_Urgot_Bot_Viktor(Ratings):
pass
class NA_Urgot_Bot_Vladimir(Ratings):
pass
class NA_Urgot_Bot_Volibear(Ratings):
pass
class NA_Urgot_Bot_Warwick(Ratings):
pass
class NA_Urgot_Bot_Xayah(Ratings):
pass
class NA_Urgot_Bot_Xerath(Ratings):
pass
class NA_Urgot_Bot_XinZhao(Ratings):
pass
class NA_Urgot_Bot_Yasuo(Ratings):
pass
class NA_Urgot_Bot_Yorick(Ratings):
pass
class NA_Urgot_Bot_Zac(Ratings):
pass
class NA_Urgot_Bot_Zed(Ratings):
pass
class NA_Urgot_Bot_Ziggs(Ratings):
pass
class NA_Urgot_Bot_Zilean(Ratings):
pass
class NA_Urgot_Bot_Zyra(Ratings):
pass
| 15.364508
| 46
| 0.761667
| 972
| 6,407
| 4.59465
| 0.151235
| 0.216301
| 0.370802
| 0.463502
| 0.797582
| 0.797582
| 0
| 0
| 0
| 0
| 0
| 0
| 0.173404
| 6,407
| 416
| 47
| 15.401442
| 0.843278
| 0
| 0
| 0.498195
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0.498195
| 0.00361
| 0
| 0.501805
| 0
| 0
| 0
| 0
| null | 1
| 1
| 1
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 1
| 0
|
0
| 7
|
0f4b6aee4dfa56a3e8a36d9b38f20f1d6e3285ca
| 200
|
py
|
Python
|
main.py
|
SrikanthVelpuri/path_planning_demo_live-master
|
347bafa27004b872e476ce626cdf1a7a15c2e30e
|
[
"MIT"
] | 1
|
2018-05-19T16:13:02.000Z
|
2018-05-19T16:13:02.000Z
|
main.py
|
SrikanthVelpuri/path_planning_demo_live-master
|
347bafa27004b872e476ce626cdf1a7a15c2e30e
|
[
"MIT"
] | null | null | null |
main.py
|
SrikanthVelpuri/path_planning_demo_live-master
|
347bafa27004b872e476ce626cdf1a7a15c2e30e
|
[
"MIT"
] | 1
|
2020-04-23T02:05:43.000Z
|
2020-04-23T02:05:43.000Z
|
import process_image
occupied_grids, planned_path = process_image.main("test_images/test_image2.jpg")
print ("Occupied Grids : ")
print (occupied_grids)
print ("Planned Path :")
print (planned_path)
| 25
| 80
| 0.785
| 27
| 200
| 5.518519
| 0.481481
| 0.261745
| 0.241611
| 0.308725
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.005556
| 0.1
| 200
| 7
| 81
| 28.571429
| 0.822222
| 0
| 0
| 0
| 0
| 0
| 0.291457
| 0.135678
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 0.166667
| 0
| 0.166667
| 0.666667
| 1
| 0
| 0
| null | 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 1
|
0
| 7
|
0f548a545f8c5291da16ca79865958ab75928a9f
| 4,839
|
py
|
Python
|
env/lib/python3.6/site-packages/heroku_connect/migrations/0001_initial.py
|
anthowen/duplify
|
846d01c1b21230937fdf0281b0cf8c0b08a8c24e
|
[
"MIT"
] | 1
|
2019-04-21T18:57:57.000Z
|
2019-04-21T18:57:57.000Z
|
env/lib/python3.6/site-packages/heroku_connect/migrations/0001_initial.py
|
anthowen/duplify
|
846d01c1b21230937fdf0281b0cf8c0b08a8c24e
|
[
"MIT"
] | null | null | null |
env/lib/python3.6/site-packages/heroku_connect/migrations/0001_initial.py
|
anthowen/duplify
|
846d01c1b21230937fdf0281b0cf8c0b08a8c24e
|
[
"MIT"
] | null | null | null |
# -*- coding: utf-8 -*-
# Generated by Django 1.11.11 on 2018-03-15 15:41
from __future__ import unicode_literals
import django.contrib.postgres.fields.hstore
from django.db import migrations, models
class Migration(migrations.Migration):
initial = True
dependencies = [
]
operations = [
# TriggerLog models and operations use the postgres hstore extension
# Heroku (Connect) should take care that it's installed, however we need to create it
# manually in the test database.
migrations.CreateModel(
name='TriggerLog',
fields=[
('id', models.BigAutoField(editable=False, primary_key=True, serialize=False)),
('created_at', models.DateTimeField(editable=False, null=True)),
('updated_at', models.DateTimeField(editable=False, null=True)),
('processed_at', models.DateTimeField(editable=False, null=True)),
('table_name', models.CharField(editable=False, max_length=128)),
('record_id', models.BigIntegerField(editable=False)),
('sf_id',
models.CharField(db_column='sfid', editable=False, max_length=18, null=True)),
('action', models.CharField(
choices=[('DELETE', 'DELETE'), ('INSERT', 'INSERT'), ('UPDATE', 'UPDATE')],
editable=False, max_length=7)),
('sf_message', models.TextField(blank=True, editable=False, null=True)),
('values',
django.contrib.postgres.fields.hstore.HStoreField(blank=True, editable=False,
null=True)),
('old',
django.contrib.postgres.fields.hstore.HStoreField(blank=True, editable=False,
null=True)),
('state', models.CharField(
choices=[('FAILED', 'FAILED'), ('IGNORE', 'IGNORE'), ('IGNORED', 'IGNORED'),
('MERGED', 'MERGED'), ('NEW', 'NEW'), ('PENDING', 'PENDING'),
('READONLY', 'READONLY'), ('REQUEUE', 'REQUEUE'),
('REQUEUED', 'REQUEUED'), ('SUCCESS', 'SUCCESS')], max_length=8)),
],
options={
'verbose_name': 'Trigger Log',
'db_table': 'salesforce"."_trigger_log',
'ordering': ('id',),
'get_latest_by': 'created_at',
'abstract': False,
'managed': False,
},
),
migrations.CreateModel(
name='TriggerLogArchive',
fields=[
('id', models.BigAutoField(editable=False, primary_key=True, serialize=False)),
('created_at', models.DateTimeField(editable=False, null=True)),
('updated_at', models.DateTimeField(editable=False, null=True)),
('processed_at', models.DateTimeField(editable=False, null=True)),
('table_name', models.CharField(editable=False, max_length=128)),
('record_id', models.BigIntegerField(editable=False)),
('sf_id',
models.CharField(db_column='sfid', editable=False, max_length=18, null=True)),
('action', models.CharField(
choices=[('DELETE', 'DELETE'), ('INSERT', 'INSERT'), ('UPDATE', 'UPDATE')],
editable=False, max_length=7)),
('sf_message', models.TextField(blank=True, editable=False, null=True)),
('values',
django.contrib.postgres.fields.hstore.HStoreField(blank=True, editable=False,
null=True)),
('old',
django.contrib.postgres.fields.hstore.HStoreField(blank=True, editable=False,
null=True)),
('state', models.CharField(
choices=[('FAILED', 'FAILED'), ('IGNORE', 'IGNORE'), ('IGNORED', 'IGNORED'),
('MERGED', 'MERGED'), ('NEW', 'NEW'), ('PENDING', 'PENDING'),
('READONLY', 'READONLY'), ('REQUEUE', 'REQUEUE'),
('REQUEUED', 'REQUEUED'), ('SUCCESS', 'SUCCESS')], max_length=8)),
],
options={
'verbose_name': 'Trigger Log (archived)',
'verbose_name_plural': 'Trigger Logs (archived)',
'db_table': 'salesforce"."_trigger_log_archive',
'ordering': ('id',),
'get_latest_by': 'created_at',
'abstract': False,
'managed': False,
},
),
]
| 52.032258
| 96
| 0.502377
| 411
| 4,839
| 5.798054
| 0.287105
| 0.120017
| 0.085606
| 0.105749
| 0.806966
| 0.770457
| 0.770457
| 0.770457
| 0.770457
| 0.770457
| 0
| 0.010214
| 0.352552
| 4,839
| 92
| 97
| 52.597826
| 0.750399
| 0.05187
| 0
| 0.780488
| 1
| 0
| 0.177215
| 0.012658
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.036585
| 0
| 0.085366
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
7e59bf27fd1b8cd43f4373be1faece7950c6eff6
| 10,650
|
py
|
Python
|
random_peptide_sampling/models.py
|
IdoSpringer/TCR-PEP-Classification
|
1cca1551ca71359239a5f5caea7f13ec01f4982b
|
[
"MIT"
] | 1
|
2019-04-30T12:31:44.000Z
|
2019-04-30T12:31:44.000Z
|
random_peptide_sampling/models.py
|
IdoSpringer/TCR-PEP-Classification
|
1cca1551ca71359239a5f5caea7f13ec01f4982b
|
[
"MIT"
] | null | null | null |
random_peptide_sampling/models.py
|
IdoSpringer/TCR-PEP-Classification
|
1cca1551ca71359239a5f5caea7f13ec01f4982b
|
[
"MIT"
] | null | null | null |
import torch
import torch.autograd as autograd
import torch.nn as nn
import torch.nn.functional as F
from torch.nn.utils.rnn import pack_padded_sequence, pad_packed_sequence
class LSTMClassifierSimple(nn.Module):
def __init__(self, embedding_dim, hidden_dim, vocab_size, tagset_size, vocab_size2, device_):
super(LSTMClassifierSimple, self).__init__()
# GPU
self.device = device_
self.hidden_dim = hidden_dim
# embedding matrix
self.word_embeddings = nn.Embedding(vocab_size, embedding_dim, padding_idx=0)
self.word_embeddings_2 = nn.Embedding(vocab_size2, embedding_dim, padding_idx=0)
# LStm
self.lstm = nn.LSTM(embedding_dim, hidden_dim, num_layers=1)
# The linear layer that connected to dense
self.hidden1 = nn.Linear(hidden_dim + hidden_dim, hidden_dim // 2)
self.relu = torch.nn.LeakyReLU()
# The linear layer that maps from hidden state space to tag space
self.hidden2tag = nn.Linear(hidden_dim // 2, tagset_size)
self.hidden = self.init_hidden()
def init_hidden(self, size_batch=1):
if self.device.type != 'cpu':
return (autograd.Variable(torch.zeros(1, size_batch, self.hidden_dim)).to(self.device),
autograd.Variable(torch.zeros(1, size_batch, self.hidden_dim)).to(self.device))
else:
return (autograd.Variable(torch.zeros(1, size_batch, self.hidden_dim)),
autograd.Variable(torch.zeros(1, size_batch, self.hidden_dim)))
def forward(self, inputs, sequences_len, input_pep, peptides_len):
batch_s = input_pep.size()[-1]
# PEPTIDE net
self.hidden = self.init_hidden(batch_s)
# embed your sequences
embedding_pep = self.word_embeddings_2(input_pep)
# pack them up nicely
packed_input = pack_padded_sequence(embedding_pep, peptides_len)
# now run through LSTM
packed_output, (self.hidden, ct) = self.lstm(packed_input, self.hidden)
# undo the packing operation
output_pep, length_s = pad_packed_sequence(packed_output)
output_pep = output_pep.transpose(0, 1)
# taking the last LSTM cell for each
pep_to_concat = torch.cat([output_pep[i, j.data - 1] for i, j in enumerate(length_s)]).view(len(length_s), self.hidden_dim)
# SEQUENCE net
self.hidden = self.init_hidden(batch_s)
# embed your sequences
embedding_seq = self.word_embeddings(inputs)
# pack them up nicely
packed_input = pack_padded_sequence(embedding_seq, sequences_len)
# now run through LSTM
packed_output, (self.hidden, ct) = self.lstm(packed_input, self.hidden)
# undo the packing operation
output_seq, length_s = pad_packed_sequence(packed_output)
output_seq = output_seq.transpose(0, 1)
seq_to_concat = torch.cat([output_seq[i, j.data - 1] for i, j in enumerate(length_s)]).view(len(length_s), self.hidden_dim)
# MLP
combined_tensor = torch.cat((seq_to_concat, pep_to_concat), 1)
l1 = self.relu(self.hidden1(combined_tensor))
score = self.hidden2tag(l1)
soft_score = F.sigmoid(score)
return soft_score
def name_model(self):
return 'Two embedding matrix '+str(self.word_embeddings)+' '+str(self.hidden_dim)+' '
class DoubleLSTMClassifier(nn.Module):
def __init__(self, embedding_dim, hidden_dim, vocab_size, tagset_size, vocab_size2, device_):
super(DoubleLSTMClassifier, self).__init__()
# GPU
self.device = device_
self.hidden_dim = hidden_dim
# embedding matrix
self.word_embeddings = nn.Embedding(vocab_size, embedding_dim, padding_idx=0)
self.word_embeddings_2 = nn.Embedding(vocab_size2, embedding_dim, padding_idx=0)
# LStm
self.lstm = nn.LSTM(embedding_dim, hidden_dim, num_layers=1)
self.lstm_pep = nn.LSTM(embedding_dim, hidden_dim, num_layers=1)
# The linear layer that connected to dense
self.hidden1 = nn.Linear(hidden_dim + hidden_dim, hidden_dim // 2)
self.relu = torch.nn.LeakyReLU()
# The linear layer that maps from hidden state space to tag space
self.hidden2tag = nn.Linear(hidden_dim // 2, tagset_size)
self.hidden = self.init_hidden()
def init_hidden(self, size_batch=1):
if self.device.type != 'cpu':
return (autograd.Variable(torch.zeros(1, size_batch, self.hidden_dim)).to(self.device),
autograd.Variable(torch.zeros(1, size_batch, self.hidden_dim)).to(self.device))
else:
return (autograd.Variable(torch.zeros(1, size_batch, self.hidden_dim)),
autograd.Variable(torch.zeros(1, size_batch, self.hidden_dim)))
def forward(self, inputs, sequences_len, input_pep, peptides_len):
batch_s = input_pep.size()[-1]
# PEPTIDE net
self.hidden = self.init_hidden(batch_s)
# embed your sequences
embedding_pep = self.word_embeddings_2(input_pep)
# pack them up nicely
packed_input = pack_padded_sequence(embedding_pep, peptides_len)
# now run through LSTM
packed_output, (self.hidden, ct) = self.lstm_pep(packed_input, self.hidden)
# undo the packing operation
output_pep, length_s = pad_packed_sequence(packed_output)
output_pep = output_pep.transpose(0, 1)
# taking the last LSTM cell for each
pep_to_concat = torch.cat([output_pep[i, j.data - 1] for i, j in enumerate(length_s)]).view(len(length_s), self.hidden_dim)
# SEQUENCE net
self.hidden = self.init_hidden(batch_s)
# embed your sequences
embedding_seq = self.word_embeddings(inputs)
# pack them up nicely
packed_input = pack_padded_sequence(embedding_seq, sequences_len)
# now run through LSTM
packed_output, (self.hidden, ct) = self.lstm(packed_input, self.hidden)
# undo the packing operation
output_seq, length_s = pad_packed_sequence(packed_output)
output_seq = output_seq.transpose(0, 1)
seq_to_concat = torch.cat([output_seq[i, j.data - 1] for i, j in enumerate(length_s)]).view(len(length_s), self.hidden_dim)
# MLP
combined_tensor = torch.cat((seq_to_concat, pep_to_concat), 1)
l1 = self.relu(self.hidden1(combined_tensor))
score = self.hidden2tag(l1)
soft_score = F.sigmoid(score)
return soft_score
def name_model(self):
return 'Two embedding matrix and two lstm'+str(self.word_embeddings)+' '+str(self.hidden_dim)+' '
class DoubleLSTMClassifierUpgrade(nn.Module):
def __init__(self, embedding_dim, hidden_dim, vocab_size, tagset_size, vocab_size2, device_, n_layers=1,
bi_lstm=False, drop=0):
super(DoubleLSTMClassifierUpgrade, self).__init__()
# GPU
self.device = device_
self.hidden_dim = hidden_dim
self.num_layers = n_layers
self.drop = drop
self.bi_lstm = bi_lstm
self.num_direction = 2 if bi_lstm else 1
# embedding matrix
self.word_embeddings = nn.Embedding(vocab_size, embedding_dim, padding_idx=0)
self.word_embeddings_2 = nn.Embedding(vocab_size2, embedding_dim, padding_idx=0)
# LStm
self.lstm = nn.LSTM(embedding_dim, hidden_dim, num_layers=self.num_layers, bidirectional=self.bi_lstm, dropout=self.drop)
self.lstm_pep = nn.LSTM(embedding_dim, hidden_dim, num_layers=self.num_layers, bidirectional=self.bi_lstm, dropout=self.drop)
# The linear layer that connected to dense
self.hidden1 = nn.Linear((hidden_dim + hidden_dim)*self.num_direction, hidden_dim // 2)
self.relu = torch.nn.LeakyReLU()
# The linear layer that maps from hidden state space to tag space
self.hidden2tag = nn.Linear(hidden_dim // 2, tagset_size)
self.hidden = self.init_hidden()
def init_hidden(self, size_batch=1):
hidden_dim1 = self.num_direction * self.num_layers
if self.device.type != 'cpu':
return (autograd.Variable(torch.zeros(hidden_dim1, size_batch, self.hidden_dim)).to(self.device),
autograd.Variable(torch.zeros(hidden_dim1, size_batch, self.hidden_dim)).to(self.device))
else:
return (autograd.Variable(torch.zeros(hidden_dim1, size_batch, self.hidden_dim)),
autograd.Variable(torch.zeros(hidden_dim1, size_batch, self.hidden_dim)))
def forward(self, inputs, sequences_len, input_pep, peptides_len):
batch_s = input_pep.size()[-1]
# PEPTIDE net
self.hidden = self.init_hidden(batch_s)
# embed your sequences
embedding_pep = self.word_embeddings_2(input_pep)
# pack them up nicely
packed_input = pack_padded_sequence(embedding_pep, peptides_len)
# now run through LSTM
packed_output, (self.hidden, ct) = self.lstm_pep(packed_input, self.hidden)
# undo the packing operation
output_pep, length_s = pad_packed_sequence(packed_output)
output_pep = output_pep.transpose(0, 1)
# taking the last LSTM cell for each
pep_to_concat = torch.cat([output_pep[i, j.data - 1] for i, j in enumerate(length_s)])\
.view(len(length_s), self.num_direction*self.hidden_dim)
# SEQUENCE net
self.hidden = self.init_hidden(batch_s)
# embed your sequences
embedding_seq = self.word_embeddings(inputs)
# pack them up nicely
packed_input = pack_padded_sequence(embedding_seq, sequences_len)
# now run through LSTM
packed_output, (self.hidden, ct) = self.lstm(packed_input, self.hidden)
# undo the packing operation
output_seq, length_s = pad_packed_sequence(packed_output)
output_seq = output_seq.transpose(0, 1)
seq_to_concat = torch.cat([output_seq[i, j.data - 1] for i, j in enumerate(length_s)])\
.view(len(length_s), self.num_direction*self.hidden_dim)
# MLP
combined_tensor = torch.cat((seq_to_concat, pep_to_concat), 1)
l1 = self.relu(self.hidden1(combined_tensor))
score = self.hidden2tag(l1)
soft_score = F.sigmoid(score)
return soft_score
def name_model(self):
return 'Two embedding matrix and two lstm with {} num layers and {} directions'.format(self.num_layers,
self.num_direction)+\
str(self.word_embeddings)+' '+str(self.hidden_dim)+' '
| 48.630137
| 133
| 0.665164
| 1,445
| 10,650
| 4.645675
| 0.089273
| 0.063012
| 0.046477
| 0.046477
| 0.926858
| 0.926858
| 0.924773
| 0.924773
| 0.919261
| 0.906748
| 0
| 0.010963
| 0.237746
| 10,650
| 218
| 134
| 48.853211
| 0.815965
| 0.104977
| 0
| 0.769231
| 0
| 0
| 0.014662
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.083916
| false
| 0
| 0.034965
| 0.020979
| 0.223776
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
7e9aed64e89ae6134624bc77a31dbc15a2890006
| 25,723
|
py
|
Python
|
p2p/views.py
|
saideepchandg/oracle-r12-accounting
|
2b4fa1ae272397a595391b7f9a0dbee7657253f5
|
[
"BSD-3-Clause"
] | null | null | null |
p2p/views.py
|
saideepchandg/oracle-r12-accounting
|
2b4fa1ae272397a595391b7f9a0dbee7657253f5
|
[
"BSD-3-Clause"
] | null | null | null |
p2p/views.py
|
saideepchandg/oracle-r12-accounting
|
2b4fa1ae272397a595391b7f9a0dbee7657253f5
|
[
"BSD-3-Clause"
] | null | null | null |
# Copyright 2015 Google Inc. All rights reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
from django.shortcuts import render
from p2p.forms import P2PForm
# Create your views here.
# Create your views here.
def p2p_accounting(request):
# A HTTP POST?
if request.method == 'POST':
form = P2PForm(request.POST)
if form.is_valid(): # All validation rules pass
item_type_val = form.cleaned_data ['item_type']
period_end_accrual_val = form.cleaned_data ['period_end_accrual']
allow_recon_accounting = form.cleaned_data ['allow_recon_accounting']
# setting allow recon accounting as a Boolean
if allow_recon_accounting == 'True':
allow_recon_accounting = True
else:
allow_recon_accounting = False
else:
#this is fallback and usually not used since we are using 'Choices' in our form
item_type_val ='Expense'
period_end_accrual_val ='At Receipt'
allow_recon_accounting = False
else:
#Initial load when the request != POST (e.g. GET)
form=P2PForm()
#setting form variables to default values for a != POST (e.g. GET request)
item_type_val ='Expense'
period_end_accrual_val ='At Receipt'
allow_recon_accounting = False
print(period_end_accrual_val)
receipt_accting= tuple(field for field in p2p_accting_list if ( field['accounting_entry']=='PO Receipt' and
field['item_type']==item_type_val and
field['period_end_accrual']== period_end_accrual_val
) )
deliver_accting = (field for field in p2p_accting_list if ( field['accounting_entry']=='PO Deliver' and
field['item_type']==item_type_val
) )
invoice_accting = (field for field in p2p_accting_list if (field['accounting_entry']=='AP Invoice' and
field ['period_end_accrual']==period_end_accrual_val and
(field['item_type']==item_type_val or
field['item_type']=='Not Relevant') and field ['accounting_class'] !='IPV'
) )
payment_accting = (field for field in p2p_accting_list if (field['accounting_entry']=='AP Payment' and
field ['allow_recon_accounting']==allow_recon_accounting
) )
recon_accting = tuple(field for field in p2p_accting_list if (field['accounting_entry']=='AP Payment Reco' and
field ['allow_recon_accounting']==allow_recon_accounting
) )
pe_accrual_accting = tuple(field for field in p2p_accting_list if (
field['accounting_entry']=='PO Receipt Accruals - Period End' and
field['item_type']==item_type_val and
field ['period_end_accrual']==period_end_accrual_val
) )
#list_accounting = (d for d in list_accounting_expense if d['accounting_entry']=='PO Receipt' )
return render(request, 'p2p/p2p_accounting.html',
{'po_receipt_accting': receipt_accting, 'po_deliver_accting' : deliver_accting,
'ap_invoice_accting':invoice_accting, 'ap_payment_accting':payment_accting,
'ap_payment_recon_accting': recon_accting,'po_pe_accrual_accting': pe_accrual_accting,
'form': form})
def ipv_accounting(request):
# A HTTP POST?
if request.method == 'POST':
form = P2PForm(request.POST)
if form.is_valid(): # All validation rules pass
item_type_val = form.cleaned_data ['item_type']
period_end_accrual_val = form.cleaned_data ['period_end_accrual']
allow_recon_accounting = form.cleaned_data ['allow_recon_accounting']
# setting allow recon accounting as a Boolean
if allow_recon_accounting == 'True':
allow_recon_accounting = True
else:
allow_recon_accounting = False
else:
#this is fallback and usually not used since we are using 'Choices' in our form
item_type_val ='Expense'
period_end_accrual_val ='At Receipt'
allow_recon_accounting = False
else:
#Initial load when the request != POST (e.g. GET)
form=P2PForm()
#setting form variables to default values for a != POST (e.g. GET request)
item_type_val ='Expense'
period_end_accrual_val ='At Receipt'
allow_recon_accounting = False
print(period_end_accrual_val)
receipt_accting= tuple(field for field in p2p_accting_list if ( field['accounting_entry']=='PO Receipt' and
field['item_type']==item_type_val and
field['period_end_accrual']== period_end_accrual_val
) )
deliver_accting = (field for field in p2p_accting_list if ( field['accounting_entry']=='PO Deliver' and
field['item_type']==item_type_val
) )
invoice_accting = (field for field in p2p_accting_list if (field['accounting_entry']=='AP Invoice' and
field ['period_end_accrual']==period_end_accrual_val and
(field['item_type']==item_type_val or
field['item_type']=='Not Relevant')
) )
payment_accting = (field for field in p2p_accting_list if (field['accounting_entry']=='AP Payment' and
field ['allow_recon_accounting']==allow_recon_accounting
) )
recon_accting = tuple(field for field in p2p_accting_list if (field['accounting_entry']=='AP Payment Reco' and
field ['allow_recon_accounting']==allow_recon_accounting
) )
pe_accrual_accting = tuple(field for field in p2p_accting_list if (
field['accounting_entry']=='PO Receipt Accruals - Period End' and
field['item_type']==item_type_val and
field ['period_end_accrual']==period_end_accrual_val
) )
#list_accounting = (d for d in list_accounting_expense if d['accounting_entry']=='PO Receipt' )
return render(request, 'p2p/ipv_accounting.html',
{'po_receipt_accting': receipt_accting, 'po_deliver_accting' : deliver_accting,
'ap_invoice_accting':invoice_accting, 'ap_payment_accting':payment_accting,
'ap_payment_recon_accting': recon_accting,'po_pe_accrual_accting': pe_accrual_accting,
'form': form})
p2p_accting_list = [
{
"id":1,
"dr_cr":"DEBIT",
"account_description":"Receiving Inventory A/c",
"accounting_entry":"PO Receipt",
"item_type":"Expense",
"stream":"P2P",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Receiving Options",
"journal_source":"Cost Management",
"journal_category":"Receipts",
"accounting_class":"Receiving Inspection",
"notes":"NA",
"period_end_accrual":"At Receipt"
},
{
"id":2,
"dr_cr":"CREDIT",
"account_description":"Expense AP Accrual A/c",
"accounting_entry":"PO Receipt",
"item_type":"Expense",
"stream":"P2P",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Purchasing Options",
"journal_source":"Cost Management",
"journal_category":"Receiving",
"accounting_class":"Accrual",
"notes":"NA",
"period_end_accrual":"At Receipt"
},
{
"id":3,
"dr_cr":"DEBIT",
"account_description":"Expense/PO Charge A/c",
"accounting_entry":"PO Deliver",
"item_type":"Expense",
"stream":"P2P",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"PO Distributions",
"journal_source":"Cost Management",
"journal_category":"Receiving",
"accounting_class":"Charge",
"notes":"NA",
"period_end_accrual":"At Receipt"
},
{
"id":4,
"dr_cr":"CREDIT",
"account_description":"Receiving Inventory A/c",
"accounting_entry":"PO Deliver",
"item_type":"Expense",
"stream":"P2P",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Receiving Options",
"journal_source":"Cost Management",
"journal_category":"Receiving",
"accounting_class":"Receiving Inspection",
"notes":"NA",
"period_end_accrual":"At Receipt"
},
{
"id":5,
"dr_cr":"DEBIT",
"account_description":"Receiving Inventory A/c",
"accounting_entry":"PO Receipt",
"item_type":"Inventory",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"PO Distributions",
"journal_source":"Cost Management",
"journal_category":"Receiving",
"accounting_class":"Receiving Inspection",
"notes":"NA",
"period_end_accrual":"At Receipt"
},
{
"id":6,
"dr_cr":"CREDIT",
"account_description":"Inventory AP Accrual A/c",
"accounting_entry":"PO Receipt",
"item_type":"Inventory",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Organization Parameters",
"journal_source":"Cost Management",
"journal_category":"Receiving",
"accounting_class":"Accrual",
"notes":"NA",
"period_end_accrual":"At Receipt"
},
{
"id":7,
"dr_cr":"DEBIT",
"account_description":"Inventory Material A/c",
"accounting_entry":"PO Deliver",
"item_type":"Inventory",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Organization Parameters",
"journal_source":"Cost Management",
"journal_category":"Inventory",
"accounting_class":"Inventory Valuation",
"notes":"NA",
"period_end_accrual":"At Receipt"
},
{
"id":8,
"dr_cr":"CREDIT",
"account_description":"Receiving Inventory A/c",
"accounting_entry":"PO Deliver",
"item_type":"Inventory",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Receiving Options",
"journal_source":"Cost Management",
"journal_category":"Inventory",
"accounting_class":"Receiving Inspection",
"notes":"NA",
"period_end_accrual":"At Receipt"
},
{
"id":9,
"dr_cr":"DEBIT",
"account_description":"Expense AP Accrual A/c",
"accounting_entry":"AP Invoice",
"item_type":"Expense",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Purchasing Options",
"journal_source":"Payables",
"journal_category":"Standard Invoices",
"accounting_class":"Accrual",
"notes":"NA",
"period_end_accrual":"At Receipt"
},
{
"id":10,
"dr_cr":"CREDIT",
"account_description":"AP Liability A/c",
"accounting_entry":"AP Invoice - Delete",
"item_type":"Expense",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Supplier Site",
"journal_source":"Payables",
"journal_category":"Standard Invoices",
"accounting_class":"Liability",
"notes":"NA",
"period_end_accrual":"0"
},
{
"id":11,
"dr_cr":"DEBIT",
"account_description":"Cash/Bank A/c",
"accounting_entry":"AP Payment",
"item_type":"Not Relevant",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Bank Accounts",
"journal_source":"Payables",
"journal_category":"Reconciled Payments",
"accounting_class":"Cash",
"notes":"NA",
"period_end_accrual":"Not Relevant"
},
{
"id":12,
"dr_cr":"CREDIT",
"account_description":"AP Liability A/c",
"accounting_entry":"AP Payment",
"item_type":"Not Relevant",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"AP Invoice Header",
"journal_source":"Payables",
"journal_category":"Payments",
"accounting_class":"Liability",
"notes":"NA",
"period_end_accrual":"Not Relevant"
},
{
"id":13,
"dr_cr":"DEBIT",
"account_description":"Expense/PO Charge A/c",
"accounting_entry":"AP Invoice",
"item_type":"Expense",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"PO Distributions",
"journal_source":"Payables",
"journal_category":"Standard Invoices",
"accounting_class":"Item Expense",
"notes":"#verify accounting Class and Defaults",
"period_end_accrual":"Period End"
},
{
"id":14,
"dr_cr":"CREDIT",
"account_description":"AP Liability A/c",
"accounting_entry":"AP Invoice",
"item_type":"Not Relevant",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Supplier Site",
"journal_source":"Payables",
"journal_category":"Standard Invoices",
"accounting_class":"Liability",
"notes":"NA",
"period_end_accrual":"Period End"
},
{
"id":15,
"dr_cr":"DEBIT",
"account_description":"Cash/Bank A/c",
"accounting_entry":"AP Payment Reco",
"item_type":"Not Relevant",
"stream":"",
"allow_recon_accounting":1,
"oe_line_flow":"Bill Only",
"defaults_from":"Bank Accounts",
"journal_source":"Payables",
"journal_category":"Reconciled Payments",
"accounting_class":"Cash",
"notes":"NA",
"period_end_accrual":"0"
},
{
"id":16,
"dr_cr":"CREDIT",
"account_description":"Cash Clearing A/c",
"accounting_entry":"AP Payment Reco",
"item_type":"Not Relevant",
"stream":"",
"allow_recon_accounting":1,
"oe_line_flow":"Bill Only",
"defaults_from":"Bank Accounts",
"journal_source":"Payables",
"journal_category":"Reconciled Payments",
"accounting_class":"Cash Clearing",
"notes":"NA",
"period_end_accrual":"0"
},
{
"id":17,
"dr_cr":"DEBIT",
"account_description":"AP Liability A/c",
"accounting_entry":"AP Payment",
"item_type":"Not Relevant",
"stream":"",
"allow_recon_accounting":1,
"oe_line_flow":"Bill Only",
"defaults_from":"AP Invoice Header",
"journal_source":"Payables",
"journal_category":"Payments",
"accounting_class":"Liability",
"notes":"NA",
"period_end_accrual":"0"
},
{
"id":18,
"dr_cr":"CREDIT",
"account_description":"Cash Clearing A/c",
"accounting_entry":"AP Payment",
"item_type":"Not Relevant",
"stream":"",
"allow_recon_accounting":1,
"oe_line_flow":"Bill Only",
"defaults_from":"Bank Accounts",
"journal_source":"Payables",
"journal_category":"Reconciled Payments",
"accounting_class":"Cash Clearing",
"notes":"NA",
"period_end_accrual":"0"
},
{
"id":19,
"dr_cr":"DEBIT",
"account_description":"Inventory Material A/c",
"accounting_entry":"Misc. Receipt",
"item_type":"Inventory",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Organization Parameters",
"journal_source":"Cost Management",
"journal_category":"Inventory",
"accounting_class":"Inventory Valuation",
"notes":"NA",
"period_end_accrual":"At Receipt"
},
{
"id":20,
"dr_cr":"CREDIT",
"account_description":"Inventory Offset A/c",
"accounting_entry":"Misc. Receipt",
"item_type":"Inventory",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Manually Entered",
"journal_source":"Cost Management",
"journal_category":"Inventory",
"accounting_class":"Offset",
"notes":"NA",
"period_end_accrual":"At Receipt"
},
{
"id":21,
"dr_cr":"DEBIT",
"account_description":"Inventory A/c",
"accounting_entry":"Pick Confirm",
"item_type":"Inventory",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"",
"journal_source":"",
"journal_category":"",
"accounting_class":"",
"notes":"NA",
"period_end_accrual":"0"
},
{
"id":22,
"dr_cr":"CREDIT",
"account_description":"Inventory A/c",
"accounting_entry":"Pick Confirm",
"item_type":"Inventory",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"",
"journal_source":"",
"journal_category":"",
"accounting_class":"",
"notes":"NA",
"period_end_accrual":"0"
},
{
"id":23,
"dr_cr":"DEBIT",
"account_description":"Deferred COGS A/c",
"accounting_entry":"Ship Confirm",
"item_type":"Inventory",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"",
"journal_source":"",
"journal_category":"",
"accounting_class":"",
"notes":"NA",
"period_end_accrual":"0"
},
{
"id":24,
"dr_cr":"CREDIT",
"account_description":"Inventory A/c",
"accounting_entry":"Ship Confirm",
"item_type":"Inventory",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"",
"journal_source":"",
"journal_category":"",
"accounting_class":"",
"notes":"NA",
"period_end_accrual":"0"
},
{
"id":25,
"dr_cr":"DEBIT",
"account_description":"COGS A/c",
"accounting_entry":"Revenue Recognition",
"item_type":"Inventory",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"",
"journal_source":"",
"journal_category":"",
"accounting_class":"",
"notes":"NA",
"period_end_accrual":"0"
},
{
"id":26,
"dr_cr":"CREDIT",
"account_description":"Deferred COGS A/c",
"accounting_entry":"Revenue Recognition",
"item_type":"Inventory",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"",
"journal_source":"",
"journal_category":"",
"accounting_class":"",
"notes":"NA",
"period_end_accrual":"0"
},
{
"id":27,
"dr_cr":"DEBIT",
"account_description":"Receivable A/c",
"accounting_entry":"AR Invoice",
"item_type":"Not Relevant",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Auto-Accounting Rules",
"journal_source":"Receivables",
"journal_category":"Sales Invoices",
"accounting_class":"Receivable",
"notes":"NA",
"period_end_accrual":"0"
},
{
"id":28,
"dr_cr":"CREDIT",
"account_description":"Revenue A/c",
"accounting_entry":"AR Invoice",
"item_type":"Not Relevant",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Auto-Accounting Rules",
"journal_source":"Receivables",
"journal_category":"Sales Invoices",
"accounting_class":"Revenue",
"notes":"NA",
"period_end_accrual":"0"
},
{
"id":29,
"dr_cr":"DEBIT",
"account_description":"Cash Clearing A/c",
"accounting_entry":"AR Receipt",
"item_type":"Not Relevant",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Payment Method",
"journal_source":"Receivables",
"journal_category":"Receipts",
"accounting_class":"Remitted Cash",
"notes":"NA",
"period_end_accrual":"Not Relevant"
},
{
"id":30,
"dr_cr":"CREDIT",
"account_description":"Receivable A/c",
"accounting_entry":"AR Receipt",
"item_type":"Inventory",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Auto-Accounting Rules",
"journal_source":"Receivables",
"journal_category":"Receipts",
"accounting_class":"Receivable",
"notes":"NA",
"period_end_accrual":"Not Relevant"
},
{
"id":31,
"dr_cr":"DEBIT",
"account_description":"Cash/Bank A/c",
"accounting_entry":"AR Receipt Recon",
"item_type":"Not Relevant",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"#",
"journal_source":"Receivables",
"journal_category":"Receipts",
"accounting_class":"Cash",
"notes":"NA",
"period_end_accrual":"Not Relevant"
},
{
"id":32,
"dr_cr":"CREDIT",
"account_description":"Cash Clearing A/c",
"accounting_entry":"AR Receipt Recon",
"item_type":"Not Relevant",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"NA",
"journal_source":"Payables",
"journal_category":"Receipts",
"accounting_class":"Remitted Cash",
"notes":"NA",
"period_end_accrual":"Not Relevant"
},
{
"id":33,
"dr_cr":"DEBIT",
"account_description":"Charge A/c #",
"accounting_entry":"WIP Issue",
"item_type":"Inventory",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"WIP Accounting Class",
"journal_source":"Cost Management",
"journal_category":"Inventory",
"accounting_class":"WIP Valuation",
"notes":"NA",
"period_end_accrual":"Not Relevant"
},
{
"id":34,
"dr_cr":"CREDIT",
"account_description":"Inventory Valuation A/c",
"accounting_entry":"WIP Issue",
"item_type":"Inventory",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Organization Parameters",
"journal_source":"Cost Management",
"journal_category":"Inventory",
"accounting_class":"Inventory Valuation",
"notes":"NA",
"period_end_accrual":"Not Relevant"
},
{
"id":35,
"dr_cr":"DEBIT",
"account_description":"Inventory AP Accrual A/c",
"accounting_entry":"AP Invoice",
"item_type":"Inventory",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Organization Parameters",
"journal_source":"Payables",
"journal_category":"Standard Invoices",
"accounting_class":"Accrual",
"notes":"NA",
"period_end_accrual":"At Receipt"
},
{
"id":36,
"dr_cr":"CREDIT",
"account_description":"AP Liability A/c",
"accounting_entry":"AP Invoice",
"item_type":"Not Relevant",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Supplier Site",
"journal_source":"Payables",
"journal_category":"Standard Invoices",
"accounting_class":"Liability",
"notes":"NA",
"period_end_accrual":"At Receipt"
},
{
"id":37,
"dr_cr":"DEBIT",
"account_description":"Expense/ PO Charge A/c",
"accounting_entry":"PO Receipt Accruals - Period End",
"item_type":"Expense",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"PO Distributions",
"journal_source":"Cash Management",
"journal_category":"Receiving",
"accounting_class":"Charge",
"notes":"#Check Journal category & Accting class",
"period_end_accrual":"Period End"
},
{
"id":38,
"dr_cr":"CREDIT",
"account_description":"Expense AP Accrual A/c",
"accounting_entry":"PO Receipt Accruals - Period End",
"item_type":"Expense",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Purchasing Options",
"journal_source":"Payables",
"journal_category":"Receiving",
"accounting_class":"Accrual",
"notes":"#Check Journal category",
"period_end_accrual":"Period End"
},
{
"id":39,
"dr_cr":"DEBIT",
"account_description":"Invoice Price Variance A/c",
"accounting_entry":"AP Invoice",
"item_type":"Expense",
"stream":"",
"allow_recon_accounting":0,
"oe_line_flow":"Bill Only",
"defaults_from":"Organization Parameters",
"journal_source":"Payables",
"journal_category":"Standard Invoices",
"accounting_class":"IPV",
"notes":"NA",
"period_end_accrual":"At Receipt"
}
]
| 33.406494
| 138
| 0.595032
| 2,783
| 25,723
| 5.211283
| 0.090909
| 0.042819
| 0.086879
| 0.045715
| 0.938151
| 0.924981
| 0.910363
| 0.903468
| 0.872509
| 0.849617
| 0
| 0.008137
| 0.254675
| 25,723
| 769
| 139
| 33.449935
| 0.748331
| 0.053299
| 0
| 0.796143
| 0
| 0
| 0.500946
| 0.046296
| 0
| 0
| 0
| 0
| 0
| 1
| 0.002755
| false
| 0
| 0.002755
| 0
| 0.008264
| 0.002755
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
0e558087d981cbae874ff42e5daa3068e9977a6a
| 1,395
|
py
|
Python
|
build/navigation-melodic-devel/costmap_2d/catkin_generated/pkg.develspace.context.pc.py
|
Louis-AD-git/racecar_ws
|
3c5cb561d1aee11d80a7f3847e0334e93f345513
|
[
"MIT"
] | null | null | null |
build/navigation-melodic-devel/costmap_2d/catkin_generated/pkg.develspace.context.pc.py
|
Louis-AD-git/racecar_ws
|
3c5cb561d1aee11d80a7f3847e0334e93f345513
|
[
"MIT"
] | null | null | null |
build/navigation-melodic-devel/costmap_2d/catkin_generated/pkg.develspace.context.pc.py
|
Louis-AD-git/racecar_ws
|
3c5cb561d1aee11d80a7f3847e0334e93f345513
|
[
"MIT"
] | null | null | null |
# generated from catkin/cmake/template/pkg.context.pc.in
CATKIN_PACKAGE_PREFIX = ""
PROJECT_PKG_CONFIG_INCLUDE_DIRS = "/home/lzh/racecar_ws/devel/include;/home/lzh/racecar_ws/src/navigation-melodic-devel/costmap_2d/include;/usr/include/eigen3;/usr/include".split(';') if "/home/lzh/racecar_ws/devel/include;/home/lzh/racecar_ws/src/navigation-melodic-devel/costmap_2d/include;/usr/include/eigen3;/usr/include" != "" else []
PROJECT_CATKIN_DEPENDS = "dynamic_reconfigure;geometry_msgs;laser_geometry;map_msgs;message_filters;message_runtime;nav_msgs;pluginlib;roscpp;sensor_msgs;std_msgs;tf2_ros;visualization_msgs;voxel_grid".replace(';', ' ')
PKG_CONFIG_LIBRARIES_WITH_PREFIX = "-lcostmap_2d;-llayers;/usr/lib/x86_64-linux-gnu/libboost_system.so;/usr/lib/x86_64-linux-gnu/libboost_thread.so;/usr/lib/x86_64-linux-gnu/libboost_chrono.so;/usr/lib/x86_64-linux-gnu/libboost_date_time.so;/usr/lib/x86_64-linux-gnu/libboost_atomic.so;/usr/lib/x86_64-linux-gnu/libpthread.so".split(';') if "-lcostmap_2d;-llayers;/usr/lib/x86_64-linux-gnu/libboost_system.so;/usr/lib/x86_64-linux-gnu/libboost_thread.so;/usr/lib/x86_64-linux-gnu/libboost_chrono.so;/usr/lib/x86_64-linux-gnu/libboost_date_time.so;/usr/lib/x86_64-linux-gnu/libboost_atomic.so;/usr/lib/x86_64-linux-gnu/libpthread.so" != "" else []
PROJECT_NAME = "costmap_2d"
PROJECT_SPACE_DIR = "/home/lzh/racecar_ws/devel"
PROJECT_VERSION = "1.16.7"
| 155
| 646
| 0.807168
| 233
| 1,395
| 4.566524
| 0.32618
| 0.067669
| 0.101504
| 0.12406
| 0.651316
| 0.631579
| 0.631579
| 0.631579
| 0.631579
| 0.631579
| 0
| 0.044248
| 0.027957
| 1,395
| 8
| 647
| 174.375
| 0.740413
| 0.03871
| 0
| 0
| 1
| 0.714286
| 0.799104
| 0.784167
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 0
| 0
| 0
| 1
| 1
| 1
| 1
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
0e7cd87deb824d9f8f216c4c7e465b83bc29a660
| 134
|
py
|
Python
|
keras/engine/input_layer.py
|
ikingye/keras
|
1a3ee8441933fc007be6b2beb47af67998d50737
|
[
"MIT"
] | 5
|
2020-11-30T22:26:03.000Z
|
2020-12-01T22:34:25.000Z
|
keras/engine/input_layer.py
|
ikingye/keras
|
1a3ee8441933fc007be6b2beb47af67998d50737
|
[
"MIT"
] | 10
|
2020-12-01T22:55:29.000Z
|
2020-12-11T18:31:46.000Z
|
keras/engine/input_layer.py
|
ikingye/keras
|
1a3ee8441933fc007be6b2beb47af67998d50737
|
[
"MIT"
] | 15
|
2020-11-30T22:12:22.000Z
|
2020-12-09T01:32:48.000Z
|
"""Input layer code (`Input` and `InputLayer`)."""
from tensorflow.keras.layers import InputLayer
from tensorflow.keras import Input
| 26.8
| 50
| 0.768657
| 17
| 134
| 6.058824
| 0.588235
| 0.271845
| 0.466019
| 0.563107
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.11194
| 134
| 4
| 51
| 33.5
| 0.865546
| 0.328358
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 8
|
7efd52b8148d9c5bafd6f454727d2502bf2d571e
| 1,067
|
py
|
Python
|
orchestra/contrib/webapps/fields.py
|
udm88/django-orchestra
|
49c84f13a8f92427b01231615136549fb5be3a78
|
[
"Unlicense"
] | 68
|
2015-02-09T10:28:44.000Z
|
2022-03-12T11:08:36.000Z
|
orchestra/contrib/webapps/fields.py
|
ferminhg/django-orchestra
|
49c84f13a8f92427b01231615136549fb5be3a78
|
[
"Unlicense"
] | 17
|
2015-05-01T18:10:03.000Z
|
2021-03-19T21:52:55.000Z
|
orchestra/contrib/webapps/fields.py
|
ferminhg/django-orchestra
|
49c84f13a8f92427b01231615136549fb5be3a78
|
[
"Unlicense"
] | 29
|
2015-03-31T04:51:03.000Z
|
2022-02-17T02:58:50.000Z
|
from django.contrib.contenttypes.fields import GenericRelation
from django.db import DEFAULT_DB_ALIAS
class VirtualDatabaseRelation(GenericRelation):
""" Delete related databases if any """
def bulk_related_objects(self, objs, using=DEFAULT_DB_ALIAS):
pks = []
for obj in objs:
db_id = obj.data.get('db_id')
if db_id:
pks.append(db_id)
if not pks:
return []
# TODO renamed to self.remote_field in django 1.8
return self.rel.to._base_manager.db_manager(using).filter(pk__in=pks)
class VirtualDatabaseUserRelation(GenericRelation):
""" Delete related databases if any """
def bulk_related_objects(self, objs, using=DEFAULT_DB_ALIAS):
pks = []
for obj in objs:
db_id = obj.data.get('db_user_id')
if db_id:
pks.append(db_id)
if not pks:
return []
# TODO renamed to self.remote_field in django 1.8
return self.rel.to._base_manager.db_manager(using).filter(pk__in=pks)
| 34.419355
| 77
| 0.634489
| 143
| 1,067
| 4.517483
| 0.328671
| 0.043344
| 0.065015
| 0.114551
| 0.764706
| 0.764706
| 0.764706
| 0.764706
| 0.764706
| 0.764706
| 0
| 0.005175
| 0.275539
| 1,067
| 30
| 78
| 35.566667
| 0.83053
| 0.151828
| 0
| 0.727273
| 0
| 0
| 0.016835
| 0
| 0
| 0
| 0
| 0.033333
| 0
| 1
| 0.090909
| false
| 0
| 0.090909
| 0
| 0.454545
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
7d0ab062b6badf10aab645b7c7a7bfaa13ed4cb5
| 4,599
|
py
|
Python
|
Python/Rosalind/1 - Counting DNA Nucleotides.py
|
Jac21/GistsCollection
|
4200b0cecf00af443711ca127028fccbbe8cfbf5
|
[
"MIT"
] | 5
|
2015-09-11T15:02:54.000Z
|
2020-10-14T05:16:18.000Z
|
Python/Rosalind/1 - Counting DNA Nucleotides.py
|
Jac21/GistsCollection
|
4200b0cecf00af443711ca127028fccbbe8cfbf5
|
[
"MIT"
] | 21
|
2019-12-28T11:18:09.000Z
|
2022-01-02T10:32:36.000Z
|
Python/Rosalind/1 - Counting DNA Nucleotides.py
|
Jac21/GistsCollection
|
4200b0cecf00af443711ca127028fccbbe8cfbf5
|
[
"MIT"
] | 2
|
2016-11-07T23:16:56.000Z
|
2020-10-14T05:16:49.000Z
|
"""
Problem
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of a length 21 DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG."
Given: A DNA string ss of length at most 1000 nt.
Return: Four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in ss.
"""
import re
def countNucleotides(dna_seq, symbol):
return len(re.findall(symbol, dna_seq))
if __name__ == "__main__":
result_set = []
result_set.append(countNucleotides("ATTTCAGAGTTCACATCCTACCCAACTCCCCAACGTGGGGCTTCCGTCACTTAATGGCGTCCATAGCAGAAGAGGATGTTATTAGGATCGAAGCGCCCTTAAGCGACGCCCTAGATACTACATGTCGCCAGATTTTCCTGACACGAAACTCCCTGCACTTTTCTGGAGTAACTAGAAGTACGGTGGCTTAAAAATTGGTCGTCAGGTCGTGAACGCGCATAAAGTCCACGATTGCGTGTGTTCGCACTACGGCACCGAGCATGTCAAATGAACCCGCGTACAGCCTACCCCCTTGCGCGTCTCTAACTAATTGACCCTCTCGCATAGCTATTTTCAGTGTTTATTAAGTAGGCGAGGTGGGTCTTCTCTTAAAGCTCCTTTGGTCCGTAAACATTTAATGGGAGTGCTTACAAGATTTCTAGATCTGACAGTGGGCCACGTGGCTCGGGATACATGCCGCGGCCGTATTTAACGTCCGACAGCGGCTACCGAGCCTCCGCTCTGGCCCTGGTCAGGGTTTTGTGTACCTCAAACGCCTATTGAGCCGAAGTCTAGACAGCATACGCGCCCTTTTAGCCTAGAATATGTCAAACGTATCTTCTATGGCGCCCTGATTGTACACTTTTGTGCGTTCCCTCTGACTGAAAATTCCCTGGGGGTTCAGAGGCAGTCAGTCATGTTGCACCCCAGATCATCGCGTGATTGATCGGACATGTGAGAGCTATTTGGTCTGCTGACCAAGGTACACCTGCGAAGTCAGCCTATATCTACGCACAGATACGGCGCCGCTGCGAACCTTAGAGATTTACAATTAATAATATTCGTTTTACGTGGCCAAGTAGGTATCCCTAACCTGCACACTGCGCTGCTCTTGCCATGTTTGAGGGATGGTATTTACGGTGGTAAGAGC", 'A'))
result_set.append(countNucleotides("ATTTCAGAGTTCACATCCTACCCAACTCCCCAACGTGGGGCTTCCGTCACTTAATGGCGTCCATAGCAGAAGAGGATGTTATTAGGATCGAAGCGCCCTTAAGCGACGCCCTAGATACTACATGTCGCCAGATTTTCCTGACACGAAACTCCCTGCACTTTTCTGGAGTAACTAGAAGTACGGTGGCTTAAAAATTGGTCGTCAGGTCGTGAACGCGCATAAAGTCCACGATTGCGTGTGTTCGCACTACGGCACCGAGCATGTCAAATGAACCCGCGTACAGCCTACCCCCTTGCGCGTCTCTAACTAATTGACCCTCTCGCATAGCTATTTTCAGTGTTTATTAAGTAGGCGAGGTGGGTCTTCTCTTAAAGCTCCTTTGGTCCGTAAACATTTAATGGGAGTGCTTACAAGATTTCTAGATCTGACAGTGGGCCACGTGGCTCGGGATACATGCCGCGGCCGTATTTAACGTCCGACAGCGGCTACCGAGCCTCCGCTCTGGCCCTGGTCAGGGTTTTGTGTACCTCAAACGCCTATTGAGCCGAAGTCTAGACAGCATACGCGCCCTTTTAGCCTAGAATATGTCAAACGTATCTTCTATGGCGCCCTGATTGTACACTTTTGTGCGTTCCCTCTGACTGAAAATTCCCTGGGGGTTCAGAGGCAGTCAGTCATGTTGCACCCCAGATCATCGCGTGATTGATCGGACATGTGAGAGCTATTTGGTCTGCTGACCAAGGTACACCTGCGAAGTCAGCCTATATCTACGCACAGATACGGCGCCGCTGCGAACCTTAGAGATTTACAATTAATAATATTCGTTTTACGTGGCCAAGTAGGTATCCCTAACCTGCACACTGCGCTGCTCTTGCCATGTTTGAGGGATGGTATTTACGGTGGTAAGAGC", 'C'))
result_set.append(countNucleotides("ATTTCAGAGTTCACATCCTACCCAACTCCCCAACGTGGGGCTTCCGTCACTTAATGGCGTCCATAGCAGAAGAGGATGTTATTAGGATCGAAGCGCCCTTAAGCGACGCCCTAGATACTACATGTCGCCAGATTTTCCTGACACGAAACTCCCTGCACTTTTCTGGAGTAACTAGAAGTACGGTGGCTTAAAAATTGGTCGTCAGGTCGTGAACGCGCATAAAGTCCACGATTGCGTGTGTTCGCACTACGGCACCGAGCATGTCAAATGAACCCGCGTACAGCCTACCCCCTTGCGCGTCTCTAACTAATTGACCCTCTCGCATAGCTATTTTCAGTGTTTATTAAGTAGGCGAGGTGGGTCTTCTCTTAAAGCTCCTTTGGTCCGTAAACATTTAATGGGAGTGCTTACAAGATTTCTAGATCTGACAGTGGGCCACGTGGCTCGGGATACATGCCGCGGCCGTATTTAACGTCCGACAGCGGCTACCGAGCCTCCGCTCTGGCCCTGGTCAGGGTTTTGTGTACCTCAAACGCCTATTGAGCCGAAGTCTAGACAGCATACGCGCCCTTTTAGCCTAGAATATGTCAAACGTATCTTCTATGGCGCCCTGATTGTACACTTTTGTGCGTTCCCTCTGACTGAAAATTCCCTGGGGGTTCAGAGGCAGTCAGTCATGTTGCACCCCAGATCATCGCGTGATTGATCGGACATGTGAGAGCTATTTGGTCTGCTGACCAAGGTACACCTGCGAAGTCAGCCTATATCTACGCACAGATACGGCGCCGCTGCGAACCTTAGAGATTTACAATTAATAATATTCGTTTTACGTGGCCAAGTAGGTATCCCTAACCTGCACACTGCGCTGCTCTTGCCATGTTTGAGGGATGGTATTTACGGTGGTAAGAGC", 'G'))
result_set.append(countNucleotides("ATTTCAGAGTTCACATCCTACCCAACTCCCCAACGTGGGGCTTCCGTCACTTAATGGCGTCCATAGCAGAAGAGGATGTTATTAGGATCGAAGCGCCCTTAAGCGACGCCCTAGATACTACATGTCGCCAGATTTTCCTGACACGAAACTCCCTGCACTTTTCTGGAGTAACTAGAAGTACGGTGGCTTAAAAATTGGTCGTCAGGTCGTGAACGCGCATAAAGTCCACGATTGCGTGTGTTCGCACTACGGCACCGAGCATGTCAAATGAACCCGCGTACAGCCTACCCCCTTGCGCGTCTCTAACTAATTGACCCTCTCGCATAGCTATTTTCAGTGTTTATTAAGTAGGCGAGGTGGGTCTTCTCTTAAAGCTCCTTTGGTCCGTAAACATTTAATGGGAGTGCTTACAAGATTTCTAGATCTGACAGTGGGCCACGTGGCTCGGGATACATGCCGCGGCCGTATTTAACGTCCGACAGCGGCTACCGAGCCTCCGCTCTGGCCCTGGTCAGGGTTTTGTGTACCTCAAACGCCTATTGAGCCGAAGTCTAGACAGCATACGCGCCCTTTTAGCCTAGAATATGTCAAACGTATCTTCTATGGCGCCCTGATTGTACACTTTTGTGCGTTCCCTCTGACTGAAAATTCCCTGGGGGTTCAGAGGCAGTCAGTCATGTTGCACCCCAGATCATCGCGTGATTGATCGGACATGTGAGAGCTATTTGGTCTGCTGACCAAGGTACACCTGCGAAGTCAGCCTATATCTACGCACAGATACGGCGCCGCTGCGAACCTTAGAGATTTACAATTAATAATATTCGTTTTACGTGGCCAAGTAGGTATCCCTAACCTGCACACTGCGCTGCTCTTGCCATGTTTGAGGGATGGTATTTACGGTGGTAAGAGC", 'T'))
# new dataset output
f = open('workfile.txt', 'w')
for result in result_set:
print result
f.writelines(str(result) + '\n')
| 135.264706
| 955
| 0.940857
| 149
| 4,599
| 28.932886
| 0.516779
| 0.012526
| 0.013918
| 0.028764
| 0.881002
| 0.007887
| 0.007887
| 0
| 0
| 0
| 0
| 0.00135
| 0.033268
| 4,599
| 33
| 956
| 139.363636
| 0.968286
| 0.003914
| 0
| 0
| 0
| 0
| 0.899436
| 0.892813
| 0
| 1
| 0
| 0
| 0
| 0
| null | null | 0
| 0.076923
| null | null | 0.076923
| 0
| 0
| 1
| null | 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| null | 1
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
7d0fa147cbf3f065f074f529bfa0a03a74b6e431
| 43,335
|
py
|
Python
|
three_player_games/util_functions.py
|
Gorov/three_player_for_emnlp
|
d8cd74efeaf8c36304a9179690b384dbe88dbc6b
|
[
"MIT"
] | 10
|
2019-09-19T12:01:58.000Z
|
2021-02-14T04:33:33.000Z
|
three_player_games/util_functions.py
|
Gorov/three_player_for_emnlp
|
d8cd74efeaf8c36304a9179690b384dbe88dbc6b
|
[
"MIT"
] | null | null | null |
three_player_games/util_functions.py
|
Gorov/three_player_for_emnlp
|
d8cd74efeaf8c36304a9179690b384dbe88dbc6b
|
[
"MIT"
] | 3
|
2019-12-17T16:06:58.000Z
|
2020-11-15T08:59:08.000Z
|
# coding: utf-8
# In[ ]:
import torch
import torch
import torch.nn as nn
import torch.nn.functional as F
from torch.autograd import Variable
import numpy as np
import copy, random, sys, os
import tqdm
# In[ ]:
def _get_sparsity(z, mask):
mask_z = z * mask
seq_lengths = torch.sum(mask, dim=1)
sparsity_ratio = torch.sum(mask_z, dim=-1) / seq_lengths #(batch_size,)
sparsity_count = torch.sum(mask_z, dim=-1)
return sparsity_ratio, sparsity_count
def _get_continuity(z, mask):
mask_z = z * mask
seq_lengths = torch.sum(mask, dim=1)
mask_z_ = torch.cat([mask_z[:, 1:], mask_z[:, -1:]], dim=-1)
continuity_ratio = torch.sum(torch.abs(mask_z - mask_z_), dim=-1) / seq_lengths #(batch_size,)
continuity_count = torch.sum(torch.abs(mask_z - mask_z_), dim=-1)
return continuity_ratio, continuity_count
def _get_pos_neg_sparsity(z, mask, none_relation):
mask_z = z * mask
seq_lengths = torch.sum(mask, dim=1)
sparsity_ratio = torch.sum(mask_z, dim=-1) / seq_lengths #(batch_size,)
pos_sparsity_ratio = sparsity_ratio * (1 - none_relation)
neg_sparsity_ratio = sparsity_ratio * none_relation
pos_count = (1 - none_relation).sum()
neg_count = none_relation.sum()
return pos_sparsity_ratio, neg_sparsity_ratio, pos_count, neg_count
# In[ ]:
def copy_classifier_module(trg_module, enc_path, pred_path):
trg_module.encoder = torch.load(enc_path)
trg_module.predictor = torch.load(pred_path)
# In[ ]:
# def evaluate_rationale_model(classification_model, beer_data, args, dev_accs, dev_anti_accs, dev_cls_accs, best_dev_acc, eval_accs, print_train_flag=True):
# classification_model.eval()
# eval_sets = ['dev']
# for set_id, set_name in enumerate(eval_sets):
# output = ''
# output2 = ''
# start_id = 8001
# dev_correct = 0.0
# dev_anti_correct = 0.0
# dev_cls_correct = 0.0
# dev_total = 0.0
# sparsity_total = 0.0
# dev_count = 0
# pos_sparsity_total = 0.0
# neg_sparsity_total = 0.0
# pos_dev_count = 0
# neg_dev_count = 0
# num_dev_instance = beer_data.data_sets[set_name].size()
# for start in range(num_dev_instance / args.batch_size):
# x_mat, y_vec, x_mask = beer_data.get_batch(set_name, batch_idx=range(start * args.batch_size, (start + 1) * args.batch_size),
# sort=True)
# batch_x_ = Variable(torch.from_numpy(x_mat))
# batch_m_ = Variable(torch.from_numpy(x_mask)).type(torch.FloatTensor)
# batch_y_ = Variable(torch.from_numpy(y_vec))
# if args.cuda:
# batch_x_ = batch_x_.cuda()
# batch_m_ = batch_m_.cuda()
# batch_y_ = batch_y_.cuda()
# predict, anti_predict, z, neg_log_probs = classification_model(batch_x_, batch_m_)
# cls_predict = classification_model.get_C_model_pred(batch_x_, batch_m_)
# # calculate classification accuarcy
# _, y_pred = torch.max(predict, dim=1)
# _, anti_y_pred = torch.max(anti_predict, dim=1)
# _, y_cls_pred = torch.max(cls_predict, dim=1)
# dev_correct += np.float((y_pred == batch_y_).sum().cpu().data[0])
# dev_anti_correct += np.float((anti_y_pred == batch_y_).sum().cpu().data[0])
# dev_cls_correct += np.float((y_cls_pred == batch_y_).sum().cpu().data[0])
# dev_total += args.batch_size
# if len(z.shape) == 3:
# mask_expand_ = batch_m_.unsqueeze(1).expand(batch_m_.size(0), z.size(1), batch_m_.size(1)).contiguous() #(batch_size, num_label, length)
# mask_expand_ = mask_expand_.view(-1, batch_m_.size(1)) #(batch_size*num_label, length)
# sparsity_ratio, sparsity_count = _get_sparsity(z.view(-1, z.size(2)), mask_expand_)
# sparsity_total += sparsity_ratio.cpu().data.numpy().sum() / z.size(0)
# else:
# sparsity_ratio, sparsity_count = _get_sparsity(z, batch_m_)
# sparsity_total += sparsity_ratio.cpu().data.numpy().sum()
# continuity_ratio, continuity_count = _get_continuity(z, batch_m_)
# continuity_total += continuity_ratio.cpu().data.numpy().sum()
# dev_count += args.batch_size
# if set_name == 'dev':
# dev_accs.append(dev_correct / dev_total)
# dev_anti_accs.append(dev_anti_correct / dev_total)
# dev_cls_accs.append(dev_cls_correct / dev_total)
# if dev_correct / dev_total > best_dev_acc and sparsity_total / dev_count < args.highlight_percentage + 0.05:
# best_dev_acc = dev_correct / dev_total
# else:
# test_accs.append(dev_correct / dev_total)
# # if (i+1) % display_iteration == 0:
# if print_train_flag:
# print('train:', train_accs[-1], 'consistency_loss:', torch.mean(consistency_loss).cpu().data[0],
# 'sparsity_loss:', torch.mean(sparsity_loss).cpu().data[0],
# 'continuity_loss:', torch.mean(continuity_loss).cpu().data[0])
# print 'dev:', dev_accs[-1], 'best dev:', best_dev_acc, 'anti dev acc:', dev_anti_accs[-1], 'cls dev acc:', dev_cls_accs[-1], 'sparsity:', sparsity_total / dev_count, 'continuity:', continuity_total / dev_count
# eval_sets = ['eval']
# for set_id, set_name in enumerate(eval_sets):
# dev_correct = 0.0
# dev_anti_correct = 0.0
# dev_cls_correct = 0.0
# dev_total = 0.0
# sparsity_total = 0.0
# dev_count = 0
# start_id = 0
# z_total = 0.0
# z_correct = 0.0
# z_predict = 0.0
# pos_sparsity_total = 0.0
# neg_sparsity_total = 0.0
# pos_dev_count = 0
# neg_dev_count = 0
# num_dev_instance = beer_data.data_sets[set_name].size()
# for start in range(num_dev_instance / args.batch_size):
# x_mat, y_vec, z_mat, x_mask = beer_data.get_eval_batch(batch_idx=range(start * args.batch_size, (start + 1) * args.batch_size), sort=True)
# batch_x_ = Variable(torch.from_numpy(x_mat))
# batch_z_ = Variable(torch.from_numpy(z_mat)).type(torch.FloatTensor)
# batch_m_ = Variable(torch.from_numpy(x_mask)).type(torch.FloatTensor)
# batch_y_ = Variable(torch.from_numpy(y_vec))
# if args.cuda:
# batch_x_ = batch_x_.cuda()
# batch_z_ = batch_z_.cuda()
# batch_m_ = batch_m_.cuda()
# batch_y_ = batch_y_.cuda()
# predict, anti_predict, z, neg_log_probs = classification_model(batch_x_, batch_m_)
# cls_predict = classification_model.get_C_model_pred(batch_x_, batch_m_)
# # calculate classification accuarcy
# _, y_pred = torch.max(predict, dim=1)
# _, anti_y_pred = torch.max(anti_predict, dim=1)
# _, y_cls_pred = torch.max(cls_predict, dim=1)
# z_correct += torch.sum(batch_z_ * z).cpu().data[0]
# z_predict += torch.sum(z).cpu().data[0]
# z_total += torch.sum(batch_z_).cpu().data[0]
# dev_correct += np.float((y_pred == batch_y_).sum().cpu().data[0])
# dev_anti_correct += np.float((anti_y_pred == batch_y_).sum().cpu().data[0])
# dev_cls_correct += np.float((y_cls_pred == batch_y_).sum().cpu().data[0])
# dev_total += args.batch_size
# if len(z.shape) == 3:
# mask_expand_ = batch_m_.unsqueeze(1).expand(batch_m_.size(0), z.size(1), batch_m_.size(1)).contiguous() #(batch_size, num_label, length)
# mask_expand_ = mask_expand_.view(-1, batch_m_.size(1)) #(batch_size*num_label, length)
# sparsity_ratio = _get_sparsity(z.view(-1, z.size(2)), mask_expand_)
# sparsity_total += sparsity_ratio.cpu().data.numpy().sum() / z.size(0)
# else:
# sparsity_ratio = _get_sparsity(z, batch_m_)
# sparsity_total += sparsity_ratio.cpu().data.numpy().sum()
# dev_count += args.batch_size
# eval_accs.append(dev_correct / dev_total)
# print 'dev:', eval_accs[-1], 'sparsity:', sparsity_total / dev_count
# if z_predict == 0.0:
# print 'highlighted:', z_predict, 'correct:', z_predict, 'precision:', z_predict, 'recall:', z_predict
# else:
# print('highlighted:', z_predict, 'correct:', z_correct,
# 'precision:', z_correct/z_predict, 'recall:', z_correct/z_total)
# return best_dev_acc
# In[ ]:
def evaluate_rationale_model_glue_for_acl(classification_model, beer_data, args, dev_accs, dev_anti_accs, dev_cls_accs, best_dev_acc, print_train_flag=True, eval_test=False):
classification_model.eval()
eval_sets = ['dev']
if eval_test:
eval_sets = ['test']
for set_id, set_name in enumerate(eval_sets):
output = ''
output2 = ''
start_id = 8001
dev_correct = 0.0
dev_anti_correct = 0.0
dev_cls_correct = 0.0
dev_total = 0.0
sparsity_total = 0.0
continuity_total = 0.0
sparsity_count_total = 0.0
continuity_count_total = 0.0
dev_count = 0
pos_sparsity_total = 0.0
neg_sparsity_total = 0.0
pos_dev_count = 0
neg_dev_count = 0
num_dev_instance = beer_data.data_sets[set_name].size()
for start in range(num_dev_instance / args.batch_size):
x_mat, y_vec, x_mask = beer_data.get_batch(set_name, batch_idx=range(start * args.batch_size, (start + 1) * args.batch_size),
sort=True)
batch_x_ = Variable(torch.from_numpy(x_mat))
batch_m_ = Variable(torch.from_numpy(x_mask)).type(torch.FloatTensor)
batch_y_ = Variable(torch.from_numpy(y_vec))
if args.cuda:
batch_x_ = batch_x_.cuda()
batch_m_ = batch_m_.cuda()
batch_y_ = batch_y_.cuda()
predict, anti_predict, z, neg_log_probs = classification_model(batch_x_, batch_m_)
# cls_predict = classification_model.get_C_model_pred(batch_x_, batch_m_)
cls_predict = predict
# calculate classification accuarcy
_, y_pred = torch.max(predict, dim=1)
_, anti_y_pred = torch.max(anti_predict, dim=1)
_, y_cls_pred = torch.max(cls_predict, dim=1)
dev_correct += np.float((y_pred == batch_y_).sum().cpu().data[0])
dev_anti_correct += np.float((anti_y_pred == batch_y_).sum().cpu().data[0])
dev_cls_correct += np.float((y_cls_pred == batch_y_).sum().cpu().data[0])
dev_total += args.batch_size
if len(z.shape) == 3:
mask_expand_ = batch_m_.unsqueeze(1).expand(batch_m_.size(0), z.size(1), batch_m_.size(1)).contiguous() #(batch_size, num_label, length)
mask_expand_ = mask_expand_.view(-1, batch_m_.size(1)) #(batch_size*num_label, length)
sparsity_ratio = _get_sparsity(z.view(-1, z.size(2)), mask_expand_)
sparsity_total += sparsity_ratio.cpu().data.numpy().sum() / z.size(0)
else:
sparsity_ratio, sparsity_count = _get_sparsity(z, batch_m_)
sparsity_total += sparsity_ratio.cpu().data.numpy().sum()
sparsity_count_total += sparsity_count.cpu().data.numpy().sum()
continuity_ratio, continuity_count = _get_continuity(z, batch_m_)
continuity_total += continuity_ratio.cpu().data.numpy().sum()
continuity_count_total += continuity_count.cpu().data.numpy().sum()
dev_count += args.batch_size
if set_name == 'dev':
dev_accs.append(dev_correct / dev_total)
dev_anti_accs.append(dev_anti_correct / dev_total)
dev_cls_accs.append(dev_cls_correct / dev_total)
if dev_correct / dev_total > best_dev_acc and sparsity_total / dev_count < args.highlight_percentage + 0.05:
best_dev_acc = dev_correct / dev_total
else:
dev_accs.append(dev_correct / dev_total)
dev_anti_accs.append(dev_anti_correct / dev_total)
dev_cls_accs.append(dev_cls_correct / dev_total)
if dev_correct / dev_total > best_dev_acc and sparsity_total / dev_count < args.highlight_percentage + 0.05:
best_dev_acc = dev_correct / dev_total
# test_accs.append(dev_correct / dev_total)
# test_anti_accs.append(dev_anti_correct / dev_total)
# dev_cls_accs.append(dev_cls_correct / dev_total)
# if (i+1) % display_iteration == 0:
if print_train_flag:
print('train:', train_accs[-1], 'consistency_loss:', torch.mean(consistency_loss).cpu().data[0],
'sparsity_loss:', torch.mean(sparsity_loss).cpu().data[0],
'continuity_loss:', torch.mean(continuity_loss).cpu().data[0])
if not eval_test:
print 'dev:', dev_accs[-1], 'best dev:', best_dev_acc, 'anti dev acc:', dev_anti_accs[-1], 'cls dev acc:', dev_cls_accs[-1], 'sparsity:', sparsity_total / dev_count, 'continuity:', continuity_total / dev_count
else:
print 'test:', dev_accs[-1], 'best test:', best_dev_acc, 'anti test acc:', dev_anti_accs[-1], 'cls test acc:', dev_cls_accs[-1], 'sparsity:', sparsity_total / dev_count, 'continuity:', continuity_total / dev_count
print 'sparsity count:', sparsity_count_total / dev_count, 'continuity count:', continuity_count_total / dev_count
return best_dev_acc
# In[ ]:
def evaluate_rationale_model_glue_for_acl_with_test(classification_model, beer_data, args, dev_accs, test_accs, dev_anti_accs, test_anti_accs, dev_cls_accs, best_dev_acc, eval_accs, print_train_flag=True):
classification_model.eval()
eval_sets = ['dev', 'test']
for set_id, set_name in enumerate(eval_sets):
output = ''
output2 = ''
start_id = 8001
dev_correct = 0.0
dev_anti_correct = 0.0
dev_cls_correct = 0.0
dev_total = 0.0
sparsity_total = 0.0
continuity_total = 0.0
sparsity_count_total = 0.0
continuity_count_total = 0.0
dev_count = 0
pos_sparsity_total = 0.0
neg_sparsity_total = 0.0
pos_dev_count = 0
neg_dev_count = 0
num_dev_instance = beer_data.data_sets[set_name].size()
for start in range(num_dev_instance / args.batch_size):
x_mat, y_vec, x_mask = beer_data.get_batch(set_name, batch_idx=range(start * args.batch_size, (start + 1) * args.batch_size),
sort=True)
batch_x_ = Variable(torch.from_numpy(x_mat))
batch_m_ = Variable(torch.from_numpy(x_mask)).type(torch.FloatTensor)
batch_y_ = Variable(torch.from_numpy(y_vec))
if args.cuda:
batch_x_ = batch_x_.cuda()
batch_m_ = batch_m_.cuda()
batch_y_ = batch_y_.cuda()
predict, anti_predict, z, neg_log_probs = classification_model(batch_x_, batch_m_)
# cls_predict = classification_model.get_C_model_pred(batch_x_, batch_m_)
cls_predict = predict
# calculate classification accuarcy
_, y_pred = torch.max(predict, dim=1)
_, anti_y_pred = torch.max(anti_predict, dim=1)
_, y_cls_pred = torch.max(cls_predict, dim=1)
dev_correct += np.float((y_pred == batch_y_).sum().cpu().data[0])
dev_anti_correct += np.float((anti_y_pred == batch_y_).sum().cpu().data[0])
dev_cls_correct += np.float((y_cls_pred == batch_y_).sum().cpu().data[0])
dev_total += args.batch_size
if len(z.shape) == 3:
mask_expand_ = batch_m_.unsqueeze(1).expand(batch_m_.size(0), z.size(1), batch_m_.size(1)).contiguous() #(batch_size, num_label, length)
mask_expand_ = mask_expand_.view(-1, batch_m_.size(1)) #(batch_size*num_label, length)
sparsity_ratio = _get_sparsity(z.view(-1, z.size(2)), mask_expand_)
sparsity_total += sparsity_ratio.cpu().data.numpy().sum() / z.size(0)
else:
sparsity_ratio, sparsity_count = _get_sparsity(z, batch_m_)
sparsity_total += sparsity_ratio.cpu().data.numpy().sum()
sparsity_count_total += sparsity_count.cpu().data.numpy().sum()
continuity_ratio, continuity_count = _get_continuity(z, batch_m_)
continuity_total += continuity_ratio.cpu().data.numpy().sum()
continuity_count_total += continuity_count.cpu().data.numpy().sum()
dev_count += args.batch_size
if set_name == 'dev':
dev_accs.append(dev_correct / dev_total)
dev_anti_accs.append(dev_anti_correct / dev_total)
dev_cls_accs.append(dev_cls_correct / dev_total)
if dev_correct / dev_total > best_dev_acc and sparsity_total / dev_count < args.highlight_percentage + 0.05:
best_dev_acc = dev_correct / dev_total
else:
test_accs.append(dev_correct / dev_total)
test_anti_accs.append(dev_anti_correct / dev_total)
# if (i+1) % display_iteration == 0:
if print_train_flag:
print('train:', train_accs[-1], 'consistency_loss:', torch.mean(consistency_loss).cpu().data[0],
'sparsity_loss:', torch.mean(sparsity_loss).cpu().data[0],
'continuity_loss:', torch.mean(continuity_loss).cpu().data[0])
print 'dev:', dev_accs[-1], 'test:', test_accs[-1], 'best dev:', best_dev_acc, 'anti dev acc:', dev_anti_accs[-1], 'anti test acc:', test_anti_accs[-1], 'cls dev acc:', dev_cls_accs[-1], 'sparsity:', sparsity_total / dev_count, 'continuity:', continuity_total / dev_count
print 'sparsity count:', sparsity_count_total / dev_count, 'continuity count:', continuity_count_total / dev_count
return best_dev_acc
# In[ ]:
# def output_rationale(batch_x, batch_z, batch_y, idx2word, idx2label, inverse=False, threshold=0.9):
# outputs = []
# for (x, z, y) in zip(batch_x, batch_z, batch_y):
# condition = z >= threshold
# if inverse:
# condition = z <= threshold
# output_tokens = []
# prev_flag = False
# for word_index, display_flag in zip(x, condition):
# word = idx2word[word_index]
# if display_flag:
# if not prev_flag:
# output_tokens.append([])
# # print len(output_tokens), output_tokens
# output_tokens[-1].append(word)
# # sys.stdout.write(output_word.encode('ascii', 'ignore'))
# prev_flag = display_flag
# output_sequences = [' '.join(output_seq) for output_seq in output_tokens]
# # outputs.append(' '.join(output_tokens) + '\t' + idx2label[y])
# outputs.append(' <s> '.join(output_sequences) + '\t' + idx2label[y])
# return outputs
def output_rationale(batch_x, batch_z, batch_y, idx2word, idx2label, inverse=False, threshold=0.9):
outputs = []
for (x, z, y) in zip(batch_x, batch_z, batch_y):
condition = z >= threshold
if inverse:
condition = z <= threshold
output_tokens = []
for word_index, display_flag in zip(x, condition):
word = idx2word[word_index]
if display_flag:
output_tokens.append(word)
else:
output_tokens.append('*')
# outputs.append(' '.join(output_tokens) + '\t' + idx2label[y])
outputs.append(' '.join(output_tokens) + '\t' + idx2label[y])
return outputs
def predict_rationale_model_glue_for_acl(classification_model, beer_data, args, dev_accs, dev_anti_accs, dev_cls_accs, best_dev_acc):
classification_model.eval()
eval_sets = ['dev']
for set_id, set_name in enumerate(eval_sets):
output = ''
output2 = ''
start_id = 8001
dev_correct = 0.0
dev_anti_correct = 0.0
dev_cls_correct = 0.0
dev_total = 0.0
sparsity_total = 0.0
continuity_total = 0.0
sparsity_count_total = 0.0
continuity_count_total = 0.0
dev_count = 0
outputs_rationale = []
outputs_non_rationale = []
outputs_full = []
pos_sparsity_total = 0.0
neg_sparsity_total = 0.0
pos_dev_count = 0
neg_dev_count = 0
num_dev_instance = beer_data.data_sets[set_name].size()
for start in tqdm.tqdm(range(num_dev_instance / args.batch_size)):
x_mat, y_vec, x_mask = beer_data.get_batch(set_name, batch_idx=range(start * args.batch_size, (start + 1) * args.batch_size),
sort=True)
batch_x_ = Variable(torch.from_numpy(x_mat))
batch_m_ = Variable(torch.from_numpy(x_mask)).type(torch.FloatTensor)
batch_y_ = Variable(torch.from_numpy(y_vec))
if args.cuda:
batch_x_ = batch_x_.cuda()
batch_m_ = batch_m_.cuda()
batch_y_ = batch_y_.cuda()
predict, anti_predict, z, neg_log_probs = classification_model(batch_x_, batch_m_)
# cls_predict = classification_model.get_C_model_pred(batch_x_, batch_m_)
cls_predict = predict
outputs_rationale += output_rationale(batch_x_.cpu().data, z.cpu().data,
batch_y_.cpu().data, beer_data.idx_2_word,
beer_data.idx2label, inverse=False)
outputs_non_rationale += output_rationale(batch_x_.cpu().data, z.cpu().data,
batch_y_.cpu().data, beer_data.idx_2_word,
beer_data.idx2label, inverse=True)
outputs_full += output_rationale(batch_x_.cpu().data, z.cpu().data,
batch_y_.cpu().data, beer_data.idx_2_word,
beer_data.idx2label, inverse=False, threshold=0.0)
# calculate classification accuarcy
_, y_pred = torch.max(predict, dim=1)
_, anti_y_pred = torch.max(anti_predict, dim=1)
_, y_cls_pred = torch.max(cls_predict, dim=1)
dev_correct += np.float((y_pred == batch_y_).sum().cpu().data[0])
dev_anti_correct += np.float((anti_y_pred == batch_y_).sum().cpu().data[0])
dev_cls_correct += np.float((y_cls_pred == batch_y_).sum().cpu().data[0])
dev_total += args.batch_size
if len(z.shape) == 3:
mask_expand_ = batch_m_.unsqueeze(1).expand(batch_m_.size(0), z.size(1), batch_m_.size(1)).contiguous() #(batch_size, num_label, length)
mask_expand_ = mask_expand_.view(-1, batch_m_.size(1)) #(batch_size*num_label, length)
sparsity_ratio = _get_sparsity(z.view(-1, z.size(2)), mask_expand_)
sparsity_total += sparsity_ratio.cpu().data.numpy().sum() / z.size(0)
else:
sparsity_ratio, sparsity_count = _get_sparsity(z, batch_m_)
sparsity_total += sparsity_ratio.cpu().data.numpy().sum()
sparsity_count_total += sparsity_count.cpu().data.numpy().sum()
continuity_ratio, continuity_count = _get_continuity(z, batch_m_)
continuity_total += continuity_ratio.cpu().data.numpy().sum()
continuity_count_total += continuity_count.cpu().data.numpy().sum()
dev_count += args.batch_size
if set_name == 'dev':
dev_accs.append(dev_correct / dev_total)
dev_anti_accs.append(dev_anti_correct / dev_total)
dev_cls_accs.append(dev_cls_correct / dev_total)
if dev_correct / dev_total > best_dev_acc and sparsity_total / dev_count < args.highlight_percentage + 0.05:
best_dev_acc = dev_correct / dev_total
else:
test_accs.append(dev_correct / dev_total)
print 'dev:', dev_accs[-1], 'best dev:', best_dev_acc, 'anti dev acc:', dev_anti_accs[-1], 'cls dev acc:', dev_cls_accs[-1], 'sparsity:', sparsity_total / dev_count, 'continuity:', continuity_total / dev_count
print 'sparsity count:', sparsity_count_total / dev_count, 'continuity count:', continuity_count_total / dev_count
return best_dev_acc, outputs_rationale, outputs_non_rationale, outputs_full
# In[ ]:
def evaluate_introspection_model_glue_for_acl(classification_model, beer_data, args, dev_accs, dev_anti_accs, dev_cls_accs, best_dev_acc, print_train_flag=True, eval_test=False):
classification_model.eval()
eval_sets = ['dev']
if eval_test:
eval_sets = ['test']
for set_id, set_name in enumerate(eval_sets):
output = ''
output2 = ''
start_id = 8001
dev_correct = 0.0
dev_anti_correct = 0.0
dev_cls_correct = 0.0
dev_total = 0.0
sparsity_total = 0.0
continuity_total = 0.0
sparsity_count_total = 0.0
continuity_count_total = 0.0
dev_count = 0
pos_sparsity_total = 0.0
neg_sparsity_total = 0.0
pos_dev_count = 0
neg_dev_count = 0
num_dev_instance = beer_data.data_sets[set_name].size()
for start in range(num_dev_instance / args.batch_size):
x_mat, y_vec, x_mask = beer_data.get_batch(set_name, batch_idx=range(start * args.batch_size, (start + 1) * args.batch_size),
sort=True)
batch_x_ = Variable(torch.from_numpy(x_mat))
batch_m_ = Variable(torch.from_numpy(x_mask)).type(torch.FloatTensor)
batch_y_ = Variable(torch.from_numpy(y_vec))
if args.cuda:
batch_x_ = batch_x_.cuda()
batch_m_ = batch_m_.cuda()
batch_y_ = batch_y_.cuda()
predict, anti_predict, cls_predict, z, neg_log_probs = classification_model(batch_x_, batch_m_)
# calculate classification accuarcy
_, y_pred = torch.max(predict, dim=1)
_, anti_y_pred = torch.max(anti_predict, dim=1)
_, y_cls_pred = torch.max(cls_predict, dim=1)
dev_correct += np.float((y_pred == batch_y_).sum().cpu().data[0])
dev_anti_correct += np.float((anti_y_pred == batch_y_).sum().cpu().data[0])
dev_cls_correct += np.float((y_cls_pred == batch_y_).sum().cpu().data[0])
dev_total += args.batch_size
if len(z.shape) == 3:
mask_expand_ = batch_m_.unsqueeze(1).expand(batch_m_.size(0), z.size(1), batch_m_.size(1)).contiguous() #(batch_size, num_label, length)
mask_expand_ = mask_expand_.view(-1, batch_m_.size(1)) #(batch_size*num_label, length)
sparsity_ratio = _get_sparsity(z.view(-1, z.size(2)), mask_expand_)
sparsity_total += sparsity_ratio.cpu().data.numpy().sum() / z.size(0)
else:
sparsity_ratio, sparsity_count = _get_sparsity(z, batch_m_)
sparsity_total += sparsity_ratio.cpu().data.numpy().sum()
sparsity_count_total += sparsity_count.cpu().data.numpy().sum()
continuity_ratio, continuity_count = _get_continuity(z, batch_m_)
continuity_total += continuity_ratio.cpu().data.numpy().sum()
continuity_count_total += continuity_count.cpu().data.numpy().sum()
dev_count += args.batch_size
if set_name == 'dev':
dev_accs.append(dev_correct / dev_total)
dev_anti_accs.append(dev_anti_correct / dev_total)
dev_cls_accs.append(dev_cls_correct / dev_total)
if dev_correct / dev_total > best_dev_acc and sparsity_total / dev_count < args.highlight_percentage + 0.05:
best_dev_acc = dev_correct / dev_total
else:
dev_accs.append(dev_correct / dev_total)
dev_anti_accs.append(dev_anti_correct / dev_total)
dev_cls_accs.append(dev_cls_correct / dev_total)
if dev_correct / dev_total > best_dev_acc and sparsity_total / dev_count < args.highlight_percentage + 0.05:
best_dev_acc = dev_correct / dev_total
# test_accs.append(dev_correct / dev_total)
# test_anti_accs.append(dev_anti_correct / dev_total)
# dev_cls_accs.append(dev_cls_correct / dev_total)
# if (i+1) % display_iteration == 0:
if print_train_flag:
print('train:', train_accs[-1], 'consistency_loss:', torch.mean(consistency_loss).cpu().data[0],
'sparsity_loss:', torch.mean(sparsity_loss).cpu().data[0],
'continuity_loss:', torch.mean(continuity_loss).cpu().data[0])
if not eval_test:
print 'dev:', dev_accs[-1], 'best dev:', best_dev_acc, 'anti dev acc:', dev_anti_accs[-1], 'cls dev acc:', dev_cls_accs[-1], 'sparsity:', sparsity_total / dev_count, 'continuity:', continuity_total / dev_count
else:
print 'test:', dev_accs[-1], 'best test:', best_dev_acc, 'anti test acc:', dev_anti_accs[-1], 'cls test acc:', dev_cls_accs[-1], 'sparsity:', sparsity_total / dev_count, 'continuity:', continuity_total / dev_count
print 'sparsity count:', sparsity_count_total / dev_count, 'continuity count:', continuity_count_total / dev_count
return best_dev_acc
# In[ ]:
def predict_introspection_model_glue_for_acl(classification_model, beer_data, args, dev_accs, dev_anti_accs, dev_cls_accs, best_dev_acc):
classification_model.eval()
eval_sets = ['dev']
for set_id, set_name in enumerate(eval_sets):
output = ''
output2 = ''
start_id = 8001
dev_correct = 0.0
dev_anti_correct = 0.0
dev_cls_correct = 0.0
dev_total = 0.0
sparsity_total = 0.0
continuity_total = 0.0
sparsity_count_total = 0.0
continuity_count_total = 0.0
dev_count = 0
outputs_rationale = []
outputs_non_rationale = []
outputs_full = []
pos_sparsity_total = 0.0
neg_sparsity_total = 0.0
pos_dev_count = 0
neg_dev_count = 0
num_dev_instance = beer_data.data_sets[set_name].size()
for start in tqdm.tqdm(range(num_dev_instance / args.batch_size)):
x_mat, y_vec, x_mask = beer_data.get_batch(set_name, batch_idx=range(start * args.batch_size, (start + 1) * args.batch_size),
sort=True)
batch_x_ = Variable(torch.from_numpy(x_mat))
batch_m_ = Variable(torch.from_numpy(x_mask)).type(torch.FloatTensor)
batch_y_ = Variable(torch.from_numpy(y_vec))
if args.cuda:
batch_x_ = batch_x_.cuda()
batch_m_ = batch_m_.cuda()
batch_y_ = batch_y_.cuda()
predict, anti_predict, cls_predict, z, neg_log_probs = classification_model(batch_x_, batch_m_)
# cls_predict = classification_model.get_C_model_pred(batch_x_, batch_m_)
outputs_rationale += output_rationale(batch_x_.cpu().data, z.cpu().data,
batch_y_.cpu().data, beer_data.idx_2_word,
beer_data.idx2label, inverse=False)
outputs_non_rationale += output_rationale(batch_x_.cpu().data, z.cpu().data,
batch_y_.cpu().data, beer_data.idx_2_word,
beer_data.idx2label, inverse=True)
outputs_full += output_rationale(batch_x_.cpu().data, z.cpu().data,
batch_y_.cpu().data, beer_data.idx_2_word,
beer_data.idx2label, inverse=False, threshold=0.0)
# calculate classification accuarcy
_, y_pred = torch.max(predict, dim=1)
_, anti_y_pred = torch.max(anti_predict, dim=1)
_, y_cls_pred = torch.max(cls_predict, dim=1)
dev_correct += np.float((y_pred == batch_y_).sum().cpu().data[0])
dev_anti_correct += np.float((anti_y_pred == batch_y_).sum().cpu().data[0])
dev_cls_correct += np.float((y_cls_pred == batch_y_).sum().cpu().data[0])
dev_total += args.batch_size
if len(z.shape) == 3:
mask_expand_ = batch_m_.unsqueeze(1).expand(batch_m_.size(0), z.size(1), batch_m_.size(1)).contiguous() #(batch_size, num_label, length)
mask_expand_ = mask_expand_.view(-1, batch_m_.size(1)) #(batch_size*num_label, length)
sparsity_ratio = _get_sparsity(z.view(-1, z.size(2)), mask_expand_)
sparsity_total += sparsity_ratio.cpu().data.numpy().sum() / z.size(0)
else:
sparsity_ratio, sparsity_count = _get_sparsity(z, batch_m_)
sparsity_total += sparsity_ratio.cpu().data.numpy().sum()
sparsity_count_total += sparsity_count.cpu().data.numpy().sum()
continuity_ratio, continuity_count = _get_continuity(z, batch_m_)
continuity_total += continuity_ratio.cpu().data.numpy().sum()
continuity_count_total += continuity_count.cpu().data.numpy().sum()
dev_count += args.batch_size
if set_name == 'dev':
dev_accs.append(dev_correct / dev_total)
dev_anti_accs.append(dev_anti_correct / dev_total)
dev_cls_accs.append(dev_cls_correct / dev_total)
if dev_correct / dev_total > best_dev_acc and sparsity_total / dev_count < args.highlight_percentage + 0.05:
best_dev_acc = dev_correct / dev_total
else:
test_accs.append(dev_correct / dev_total)
print 'dev:', dev_accs[-1], 'best dev:', best_dev_acc, 'anti dev acc:', dev_anti_accs[-1], 'cls dev acc:', dev_cls_accs[-1], 'sparsity:', sparsity_total / dev_count, 'continuity:', continuity_total / dev_count
print 'sparsity count:', sparsity_count_total / dev_count, 'continuity count:', continuity_count_total / dev_count
return best_dev_acc, outputs_rationale, outputs_non_rationale, outputs_full
# In[ ]:
def evaluate_model(classification_model, beer_data, args, dev_accs, dev_anti_accs, dev_cls_accs, dev_rewards,
best_dev_acc, best_dev_reward, eval_accs, print_train_flag=True, introspection_mode=True):
classification_model.eval()
eval_sets = ['dev']
for set_id, set_name in enumerate(eval_sets):
output = ''
output2 = ''
start_id = 8001
dev_correct = 0.0
dev_anti_correct = 0.0
dev_cls_correct = 0.0
dev_total = 0.0
sparsity_total = 0.0
dev_count = 0
dev_reward = 0
pos_sparsity_total = 0.0
neg_sparsity_total = 0.0
pos_dev_count = 0
neg_dev_count = 0
num_dev_instance = beer_data.data_sets[set_name].size()
for start in range(num_dev_instance / args.batch_size):
x_mat, y_vec, x_mask = beer_data.get_batch(set_name, batch_idx=range(start * args.batch_size, (start + 1) * args.batch_size),
sort=True)
batch_x_ = Variable(torch.from_numpy(x_mat))
batch_m_ = Variable(torch.from_numpy(x_mask)).type(torch.FloatTensor)
batch_y_ = Variable(torch.from_numpy(y_vec))
if args.cuda:
batch_x_ = batch_x_.cuda()
batch_m_ = batch_m_.cuda()
batch_y_ = batch_y_.cuda()
if introspection_mode:
predict, anti_predict, cls_predict, z, neg_log_probs = classification_model(batch_x_, batch_m_)
else:
predict, anti_predict, z, neg_log_probs = classification_model(batch_x_, batch_m_)
cls_predict = classification_model.forward_cls(batch_x_, batch_m_)
# calculate classification accuarcy
_, y_pred = torch.max(predict, dim=1)
_, anti_y_pred = torch.max(anti_predict, dim=1)
_, y_cls_pred = torch.max(cls_predict, dim=1)
masked_logits = predict - anti_predict
_, masked_y_pred = torch.max(masked_logits, dim=1) # (batch_size,)
masked_prediction = (masked_y_pred == batch_y_).type(torch.cuda.FloatTensor)
anti_prediction = (anti_y_pred == batch_y_).type(torch.cuda.FloatTensor)
pred_rewards = masked_prediction - anti_prediction
dev_reward += np.float(pred_rewards.sum().cpu().data[0])
dev_correct += np.float((y_pred == batch_y_).sum().cpu().data[0])
dev_anti_correct += np.float((anti_y_pred == batch_y_).sum().cpu().data[0])
dev_cls_correct += np.float((y_cls_pred == batch_y_).sum().cpu().data[0])
dev_total += args.batch_size
if len(z.shape) == 3:
mask_expand_ = batch_m_.unsqueeze(1).expand(batch_m_.size(0), z.size(1), batch_m_.size(1)).contiguous() #(batch_size, num_label, length)
mask_expand_ = mask_expand_.view(-1, batch_m_.size(1)) #(batch_size*num_label, length)
sparsity_ratio = _get_sparsity(z.view(-1, z.size(2)), mask_expand_)
sparsity_total += sparsity_ratio.cpu().data.numpy().sum() / z.size(0)
else:
sparsity_ratio, _ = _get_sparsity(z, batch_m_)
sparsity_total += sparsity_ratio.cpu().data.numpy().sum()
dev_count += args.batch_size
if set_name == 'dev':
dev_accs.append(dev_correct / dev_total)
dev_anti_accs.append(dev_anti_correct / dev_total)
dev_cls_accs.append(dev_cls_correct / dev_total)
dev_rewards.append(dev_reward / dev_total)
if dev_correct / dev_total > best_dev_acc and sparsity_total / dev_count < args.highlight_percentage + 0.05:
best_dev_acc = dev_correct / dev_total
if dev_reward / dev_total > best_dev_reward and sparsity_total / dev_count < args.highlight_percentage + 0.05:
best_dev_reward = dev_reward / dev_total
else:
test_accs.append(dev_correct / dev_total)
# if (i+1) % display_iteration == 0:
if print_train_flag:
print('train:', train_accs[-1], 'consistency_loss:', torch.mean(consistency_loss).cpu().data[0],
'sparsity_loss:', torch.mean(sparsity_loss).cpu().data[0],
'continuity_loss:', torch.mean(continuity_loss).cpu().data[0])
print 'dev:', dev_accs[-1], 'best dev:', best_dev_acc, 'anti dev acc:', dev_anti_accs[-1], 'cls dev acc:', dev_cls_accs[-1], 'sparsity:', sparsity_total / dev_count
print 'dev reward:', dev_rewards[-1], 'best dev reward:', best_dev_reward, 'sparsity:', sparsity_total / dev_count
eval_sets = ['eval']
for set_id, set_name in enumerate(eval_sets):
dev_correct = 0.0
dev_anti_correct = 0.0
dev_cls_correct = 0.0
dev_total = 0.0
sparsity_total = 0.0
dev_count = 0
start_id = 0
z_total = 0.0
z_correct = 0.0
z_predict = 0.0
pos_sparsity_total = 0.0
neg_sparsity_total = 0.0
pos_dev_count = 0
neg_dev_count = 0
num_dev_instance = beer_data.data_sets[set_name].size()
for start in range(num_dev_instance / args.batch_size):
x_mat, y_vec, z_mat, x_mask = beer_data.get_eval_batch(batch_idx=range(start * args.batch_size, (start + 1) * args.batch_size), sort=True)
batch_x_ = Variable(torch.from_numpy(x_mat))
batch_z_ = Variable(torch.from_numpy(z_mat)).type(torch.FloatTensor)
batch_m_ = Variable(torch.from_numpy(x_mask)).type(torch.FloatTensor)
batch_y_ = Variable(torch.from_numpy(y_vec))
if args.cuda:
batch_x_ = batch_x_.cuda()
batch_z_ = batch_z_.cuda()
batch_m_ = batch_m_.cuda()
batch_y_ = batch_y_.cuda()
# predict, anti_predict, cls_predict, z, neg_log_probs = classification_model(batch_x_, batch_m_)
if introspection_mode:
predict, anti_predict, cls_predict, z, neg_log_probs = classification_model(batch_x_, batch_m_)
else:
predict, anti_predict, z, neg_log_probs = classification_model(batch_x_, batch_m_)
cls_predict = classification_model.forward_cls(batch_x_, batch_m_)
# calculate classification accuarcy
_, y_pred = torch.max(predict, dim=1)
_, anti_y_pred = torch.max(anti_predict, dim=1)
_, y_cls_pred = torch.max(cls_predict, dim=1)
z_correct += torch.sum(batch_z_ * z).cpu().data[0]
z_predict += torch.sum(z).cpu().data[0]
z_total += torch.sum(batch_z_).cpu().data[0]
dev_correct += np.float((y_pred == batch_y_).sum().cpu().data[0])
dev_anti_correct += np.float((anti_y_pred == batch_y_).sum().cpu().data[0])
dev_cls_correct += np.float((y_cls_pred == batch_y_).sum().cpu().data[0])
dev_total += args.batch_size
if len(z.shape) == 3:
mask_expand_ = batch_m_.unsqueeze(1).expand(batch_m_.size(0), z.size(1), batch_m_.size(1)).contiguous() #(batch_size, num_label, length)
mask_expand_ = mask_expand_.view(-1, batch_m_.size(1)) #(batch_size*num_label, length)
sparsity_ratio = _get_sparsity(z.view(-1, z.size(2)), mask_expand_)
sparsity_total += sparsity_ratio.cpu().data.numpy().sum() / z.size(0)
else:
sparsity_ratio, _ = _get_sparsity(z, batch_m_)
sparsity_total += sparsity_ratio.cpu().data.numpy().sum()
dev_count += args.batch_size
eval_accs.append(dev_correct / dev_total)
# print 'dev:', eval_accs[-1], 'sparsity:', sparsity_total / dev_count
# if z_predict == 0.0:
# print 'highlighted:', z_predict, 'correct:', z_predict, 'precision:', z_predict
# else:
# print 'highlighted:', z_predict, 'correct:', z_correct, 'precision:', z_correct/z_predict
print 'dev:', eval_accs[-1], 'sparsity:', sparsity_total / dev_count
if z_predict == 0.0:
print 'highlighted:', z_predict, 'correct:', z_predict, 'precision:', z_predict, 'recall:', z_predict
else:
print 'highlighted:', z_predict, 'correct:', z_correct, 'precision:', z_correct/z_predict, 'recall:', z_correct/z_total
return best_dev_acc, best_dev_reward
| 47.001085
| 275
| 0.608446
| 5,797
| 43,335
| 4.149733
| 0.028808
| 0.02939
| 0.036789
| 0.026937
| 0.944795
| 0.942218
| 0.937271
| 0.935151
| 0.930329
| 0.930329
| 0
| 0.0171
| 0.273982
| 43,335
| 921
| 276
| 47.052117
| 0.747505
| 0.232053
| 0
| 0.862816
| 0
| 0
| 0.031179
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | null | 0
| 0.01444
| null | null | 0.052347
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
7d2e21705bcf176a886ac86544106c4fb015a195
| 2,488
|
py
|
Python
|
classes/my_math.py
|
cjwoodruff/Python_Tutorials
|
d9a3b61a651fe38a8be421260fb18a5787d88f08
|
[
"Apache-2.0"
] | null | null | null |
classes/my_math.py
|
cjwoodruff/Python_Tutorials
|
d9a3b61a651fe38a8be421260fb18a5787d88f08
|
[
"Apache-2.0"
] | null | null | null |
classes/my_math.py
|
cjwoodruff/Python_Tutorials
|
d9a3b61a651fe38a8be421260fb18a5787d88f08
|
[
"Apache-2.0"
] | null | null | null |
class MyMath:
def myAdd(num1, num2):
"""Add two numbers together (num1, num2)"""
if isinstance(num1, str):
try:
num1 = float(num1)
except ValueError:
print('The first value needs to be a number.')
return
else:
num1 = float(num1)
if isinstance(num2, str):
try:
num2 = float(num2)
return num1 + num2
except ValueError:
print('The second value needs to be a number.')
else:
num2 = float(num2)
return num1 + num2
def mySubtract(num1, num2):
"""Subtract num2 from num1"""
if isinstance(num1, str):
try:
num1 = flaot(num1)
except ValueError:
print('The first value needs to be a number.')
return
else:
num1 = float(num1)
if isinstance(num2, str):
try:
num2 = float(num2)
return num1 - num2
except ValueError:
print('The second value needs to be a number.')
else:
num2 = float(num2)
return num1 - num2
def myMultiply(num1, num2):
"""Multiply num1 by num2"""
if isinstance(num1, str):
try:
num1 = float(num1)
except ValueError:
print('The first value needs to be a number.')
return
else:
num1 = float(num1)
if isinstance(num2, str):
try:
num2 = float(num2)
return num1 * num2
except ValueError:
print('The second value needs to be a number,')
else:
num2 = float(num2)
return num1 * num2
def myDivide(num1, num2):
"""Divide num1 by num2"""
if isinstance(num1, str):
try:
num1 = float(num1)
except ValueError:
print('This first value needs to be a number.')
return
else:
num1 = float(num1)
if isinstance(num2, str):
try:
num2 = float(num2)
return num1 / num2
except ValueError:
print('The second value needs to be number.')
else:
num2 = float(num2)
return num1 / num2
| 28.272727
| 63
| 0.452974
| 247
| 2,488
| 4.562753
| 0.157895
| 0.09228
| 0.149068
| 0.099379
| 0.869565
| 0.869565
| 0.846495
| 0.846495
| 0.813665
| 0.813665
| 0
| 0.054422
| 0.468248
| 2,488
| 87
| 64
| 28.597701
| 0.79743
| 0.041399
| 0
| 0.876712
| 0
| 0
| 0.126481
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.054795
| false
| 0
| 0
| 0
| 0.232877
| 0.109589
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
cb06094f0b8af78bddd02b8373763bfd06b3a02f
| 6,649
|
py
|
Python
|
scripts/models.py
|
dspaccapeli/autoencoder-clustering
|
b06c86b9a088bc7acdcd59f4be9d9f7b08e5a911
|
[
"Apache-2.0"
] | 1
|
2018-06-08T22:08:04.000Z
|
2018-06-08T22:08:04.000Z
|
scripts/models.py
|
dspaccapeli/autoencoder-clustering
|
b06c86b9a088bc7acdcd59f4be9d9f7b08e5a911
|
[
"Apache-2.0"
] | null | null | null |
scripts/models.py
|
dspaccapeli/autoencoder-clustering
|
b06c86b9a088bc7acdcd59f4be9d9f7b08e5a911
|
[
"Apache-2.0"
] | null | null | null |
# ------- IMPORTS ----- #
# import keras
import keras.layers
import keras.models
# import numpy (linspace)
import numpy
# --------------------- #
# class containing a collection of the used models
class Autoencoder:
def dense(self, input_dim, reduc_dim, activation_function, layers_num):
'''
Autoencoder model where every layer is fully connected to the other.
'''
# ------------------------- MODEL DEFINITION ------------------------ #
# creating the input object for the autoencoder
autoencoder_input = keras.layers.Input(shape=(input_dim,))
# stacking the encoder layers
# scale the dimensionality reduction as a linspace
dim_progression = numpy.linspace(input_dim, \
reduc_dim, layers_num+1)[1:]
# you must keep the named reference for the first layer
autoencoder_part = keras.layers.Dense(int(dim_progression[0]), \
activation=activation_function)(autoencoder_input)
for size in dim_progression[1:]:
autoencoder_part = keras.layers.Dense(int(size), \
activation=activation_function)(autoencoder_part)
# stacking the decoder layers
for size in numpy.linspace(reduc_dim, input_dim, layers_num+1)[1:]:
autoencoder_part = keras.layers.Dense(int(size), \
activation=activation_function)(autoencoder_part)
# this model maps an input to its reconstruction
autoencoder_model = keras.models.Model(autoencoder_input, \
autoencoder_part)
# return the instanciated autoencoder model
return autoencoder_model
#--------------------------------------------------------------------------#
def sparse(self, input_dim, reduc_dim, activation_function, layers_num):
'''
Autoencoder model with regularization.
'''
# ------------------------- MODEL DEFINITION ------------------------ #
# creating the input object for the autoencoder
autoencoder_input = keras.layers.Input(shape=(input_dim,))
# stacking the encoder layers
# scale the dimensionality reduction as a linspace
dim_progression = numpy.linspace(input_dim, \
reduc_dim, layers_num+1)[1:]
# you must keep the named reference for the first layer
autoencoder_part = keras.layers.Dense(int(dim_progression[0]), \
activation=activation_function, \
activity_regularizer=keras.regularizers.l1(10e-7))(autoencoder_input)
for size in dim_progression[1:]:
autoencoder_part = keras.layers.Dense(int(size), \
activation=activation_function, \
activity_regularizer=keras.regularizers.l1(10e-7))(autoencoder_part)
# stacking the decoder layers
for size in numpy.linspace(reduc_dim, input_dim, layers_num+1)[1:]:
autoencoder_part = keras.layers.Dense(int(size), \
activation=activation_function, \
activity_regularizer=keras.regularizers.l1(10e-7))(autoencoder_part)
# this model maps an input to its reconstruction
autoencoder_model = keras.models.Model(autoencoder_input, \
autoencoder_part)
# return the instanciated autoencoder model
return autoencoder_model
#--------------------------------------------------------------------------#
def batch_normalized(self, input_dim, reduc_dim, activation_function, layers_num):
'''
Autoencoder model where in-between every layer
there is a normalization layer.
'''
# ------------------------- MODEL DEFINITION ------------------------ #
# creating the input object for the autoencoder
autoencoder_inputs = keras.layers.Input(shape=(input_dim,))
# stacking the encoder layers
# scale the dimensionality reduction as a linspace
dim_progression = numpy.linspace(input_dim, reduc_dim, \
layers_num+1)[1:]
# you must keep the named reference for the first layer
autoencoder_part = keras.layers.Dense(int(dim_progression[0]), \
activation=activation_function)(autoencoder_input)
autoencoder_part = keras.layers.BatchNormalization()(autoencoder_part)
for size in dim_progression[1:]:
autoencoder_part = keras.layers.Dense(int(size), \
activation=activation_function)(autoencoder_part)
if (int(size) != reduc_dim):
autoencoder_part = keras.layers.BatchNormalization()(autoencoder_part)
# this model maps an input to its reconstruction
autoencoder_model = keras.models.Model(keras.layers.Input( \
shape=(input_dim,)), autoencoder_part)
# return the instanciated autoencoder model
return autoencoder_model
#--------------------------------------------------------------------------#
def sparse_mid(self, input_dim, reduc_dim, activation_function, layers_num):
'''
Autoencoder model with regularization.
'''
# ------------------------- MODEL DEFINITION ------------------------ #
# creating the input object for the autoencoder
autoencoder_input = keras.layers.Input(shape=(input_dim,))
# stacking the encoder layers
# scale the dimensionality reduction as a linspace
dim_progression = numpy.linspace(input_dim, \
reduc_dim, layers_num+1)[1:]
# you must keep the named reference for the first layer
autoencoder_part = keras.layers.Dense(int(dim_progression[0]), \
activation=activation_function)(autoencoder_input)
for size in dim_progression[1:-1]:
autoencoder_part = keras.layers.Dense(int(size), \
activation=activation_function)(autoencoder_part)
# MID LAYER
autoencoder_part = keras.layers.Dense(int(dim_progression[-1]), \
activation=activation_function, \
activity_regularizer=keras.regularizers.l1(10e-3))(autoencoder_part)
# stacking the decoder layers
for size in numpy.linspace(reduc_dim, input_dim, layers_num+1)[1:]:
autoencoder_part = keras.layers.Dense(int(size), \
activation=activation_function)(autoencoder_part)
# this model maps an input to its reconstruction
autoencoder_model = keras.models.Model(autoencoder_input, \
autoencoder_part)
# return the instanciated autoencoder model
return autoencoder_model
#--------------------------------------------------------------------------#
| 52.769841
| 86
| 0.609716
| 684
| 6,649
| 5.75
| 0.122807
| 0.106789
| 0.071192
| 0.09255
| 0.930333
| 0.930333
| 0.92296
| 0.896771
| 0.896771
| 0.865751
| 0
| 0.0079
| 0.238532
| 6,649
| 125
| 87
| 53.192
| 0.768912
| 0.314032
| 0
| 0.742857
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.057143
| false
| 0
| 0.042857
| 0
| 0.171429
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.