content
stringlengths
6
1.03M
input_ids
listlengths
4
535k
ratio_char_token
float64
0.68
8.61
token_count
int64
4
535k
using ApproxFun, LinearAlgebra, Plots # In this example, we solve the heat equation with left Neumann and # right Dirichlet boundary conditions. # To allow for a solution through matrix exponentiation, we approximate # the initial condition with a basis that automatically constructs # even and odd extensions on the left and right boundaries respectively. (Method of images) n = 100 xlim = 10 xarray = (chebyshevpoints(n) .+ 1) .* xlim/2 # Chebyshev points on 0..xlim r = 1.0 # right boundary value (left is assumed to be zero) S = CosSpace(0..4*xlim) u₀(x) = atan(x)*(π + atan(x-9) + atan(5-x))/π^2 - r # subtract by `r` to homogenise the right BC plot(xarray, u₀) v = u₀.(xarray) # values to use in fitting m = div(n,2) # m << n for regularisation # Create a Vandermonde matrix by evaluating the basis at the grid: # We ensure the basis satisfies the boundary conditions by using # the entries corresponding to {cos(x), cos(3x), cos(5x), ...}. V = zeros(n, m) for k = 1:m V[:,k] = Fun(S,[zeros(2*k-1);1]).(xarray) end c₀ = zeros(2*m) c₀[2:2:end] = V\v # do the fit f = Fun(S, c₀) # Likely not a good approximation due to boundary discontinuities, but high frequencies will disappear quickly anyway plot([xarray.+10; xarray; xarray.-10], f, xlims=(-5, 15)) scatter!(xarray, u₀, markersize=0.2) L = Derivative(S, 2) L = Matrix(L[1:2m,1:2m]) @manipulate for T=[zeros(5); 0.0:0.01:1] u_t = Fun(S, exp(T*L)*c₀) + r # calculate solution and add back homogenisation term plot(-0:0.05:10, u_t, ylims=(0,1), legend=:none) end @gif for T=[zeros(5); 0.0:0.5:50] u_t = Fun(S, exp(T*L)*c₀) + r # calculate solution and add back homogenisation term plot(-0:0.05:10, u_t, ylims=(0,1), legend=:none) end
[ 3500, 2034, 13907, 24629, 11, 44800, 2348, 29230, 11, 1345, 1747, 198, 198, 2, 554, 428, 1672, 11, 356, 8494, 262, 4894, 16022, 351, 1364, 3169, 40062, 290, 198, 2, 826, 36202, 488, 1616, 18645, 3403, 13, 198, 2, 1675, 1249, 329, 25...
2.531479
683
struct MinDomainVariableSelection{TakeObjective} <: AbstractVariableSelection{TakeObjective} end MinDomainVariableSelection(;take_objective=true) = MinDomainVariableSelection{take_objective}() function (::MinDomainVariableSelection{false})(cpmodel::CPModel) selectedVar = nothing minSize = typemax(Int) for (k, x) in branchable_variables(cpmodel) if x !== cpmodel.objective && !isbound(x) && length(x.domain) < minSize selectedVar = x minSize = length(x.domain) end end if isnothing(selectedVar) && !isbound(cpmodel.objective) return cpmodel.objective end return selectedVar end function (::MinDomainVariableSelection{true})(cpmodel::CPModel) selectedVar = nothing minSize = typemax(Int) for (k, x) in branchable_variables(cpmodel) if !isbound(x) && length(x.domain) < minSize selectedVar = x minSize = length(x.domain) end end return selectedVar end
[ 7249, 1855, 43961, 43015, 4653, 1564, 90, 12322, 10267, 425, 92, 1279, 25, 27741, 43015, 4653, 1564, 90, 12322, 10267, 425, 92, 886, 201, 198, 201, 198, 9452, 43961, 43015, 4653, 1564, 7, 26, 20657, 62, 15252, 425, 28, 7942, 8, 796, ...
2.323462
439
<reponame>kogpsy/vpompd<filename>src/playground.jl using StatsFuns: logistic using Plots βs = [0, 0.2, 0.5, 0.8, 1.0, 1.2, 1.5, 2, 3, 5, 7, 8, 10, 20] plot([x -> logistic(β * x) for β in βs], -2, 2, alpha = 0.8, legend = :none, ylims = [0, 1])
[ 27, 7856, 261, 480, 29, 74, 519, 13764, 14, 36133, 3361, 67, 27, 34345, 29, 10677, 14, 1759, 2833, 13, 20362, 198, 3500, 20595, 37, 13271, 25, 2604, 2569, 198, 3500, 1345, 1747, 198, 198, 26638, 82, 796, 685, 15, 11, 657, 13, 17, ...
1.782051
156
<gh_stars>0 function HHG(f::TVF) where {TVF<:AbstractVector{<:AbstractFloat}} n = length(f) spec = fft(f) return abs.(spec) .^ 2 / n^2 end function HHGfreq(f::TVF, ncyc) where {TVF<:AbstractVector{<:AbstractFloat}} x = collect(range(1, length(f), length = length(f))) return x ./ ncyc end
[ 27, 456, 62, 30783, 29, 15, 198, 8818, 47138, 38, 7, 69, 3712, 6849, 37, 8, 810, 1391, 6849, 37, 27, 25, 23839, 38469, 90, 27, 25, 23839, 43879, 11709, 198, 220, 220, 220, 299, 796, 4129, 7, 69, 8, 198, 220, 220, 220, 1020, 79...
2.30597
134
<filename>src/integrators/rk/integrators_iprk.jl "Parameters for right-hand side function of implicit partitioned Runge-Kutta methods." mutable struct ParametersIPRK{DT, TT, D, S, ET <: NamedTuple} <: Parameters{DT,TT} equs::ET tab::PartitionedTableau{TT} Δt::TT t::TT q::Vector{DT} p::Vector{DT} function ParametersIPRK{DT,D}(equs::ET, tab::PartitionedTableau{TT}, Δt::TT) where {D, DT, TT, ET <: NamedTuple} new{DT, TT, D, tab.s, ET}(equs, tab, Δt, zero(TT), zeros(DT,D), zeros(DT,D)) end end @doc raw""" Implicit partitioned Runge-Kutta integrator cache. ### Fields * `q̃`: initial guess of q * `p̃`: initial guess of p * `ṽ`: initial guess of v * `f̃`: initial guess of f * `s̃`: holds shift due to periodicity of solution * `Q`: internal stages of q * `P`: internal stages of p * `V`: internal stages of v * `F`: internal stages of f * `Y`: vector field of internal stages of q * `Z`: vector field of internal stages of p """ struct IntegratorCacheIPRK{ST,D,S} <: PODEIntegratorCache{ST,D} q̃::Vector{ST} p̃::Vector{ST} ṽ::Vector{ST} f̃::Vector{ST} s̃::Vector{ST} Q::Vector{Vector{ST}} P::Vector{Vector{ST}} V::Vector{Vector{ST}} F::Vector{Vector{ST}} Y::Vector{Vector{ST}} Z::Vector{Vector{ST}} function IntegratorCacheIPRK{ST,D,S}() where {ST,D,S} # create temporary vectors q̃ = zeros(ST,D) p̃ = zeros(ST,D) ṽ = zeros(ST,D) f̃ = zeros(ST,D) s̃ = zeros(ST,D) # create internal stage vectors Q = create_internal_stage_vector(ST, D, S) P = create_internal_stage_vector(ST, D, S) V = create_internal_stage_vector(ST, D, S) F = create_internal_stage_vector(ST, D, S) Y = create_internal_stage_vector(ST, D, S) Z = create_internal_stage_vector(ST, D, S) new(q̃, p̃, ṽ, f̃, s̃, Q, P, V, F, Y, Z) end end function IntegratorCache(params::ParametersIPRK{DT,TT,D,S}; kwargs...) where {DT,TT,D,S} IntegratorCacheIPRK{DT,D,S}(; kwargs...) end function IntegratorCache{ST}(params::ParametersIPRK{DT,TT,D,S}; kwargs...) where {ST,DT,TT,D,S} IntegratorCacheIPRK{ST,D,S}(; kwargs...) end @inline CacheType(ST, params::ParametersIPRK{DT,TT,D,S}) where {DT,TT,D,S} = IntegratorCacheIPRK{ST,D,S} @doc raw""" Implicit partitioned Runge-Kutta integrator solving the system ```math \begin{aligned} V_{n,i} &= v (Q_{n,i}, P_{n,i}) , & Q_{n,i} &= q_{n} + h \sum \limits_{j=1}^{s} a_{ij} \, V_{n,j} , & q_{n+1} &= q_{n} + h \sum \limits_{i=1}^{s} b_{i} \, V_{n,i} , \\ F_{n,i} &= f (Q_{n,i}, P_{n,i}) , & P_{n,i} &= p_{n} + h \sum \limits_{i=1}^{s} \bar{a}_{ij} \, F_{n,j} , & p_{n+1} &= p_{n} + h \sum \limits_{i=1}^{s} \bar{b}_{i} \, F_{n,i} , \end{aligned} ``` Usually we are interested in Hamiltonian systems, where ```math \begin{aligned} V_{n,i} &= \dfrac{\partial H}{\partial p} (Q_{n,i}, P_{n,i}) , & F_{n,i} &= - \dfrac{\partial H}{\partial q} (Q_{n,i}, P_{n,i}) , \end{aligned} ``` and tableaus satisfying the symplecticity conditions ```math \begin{aligned} b_{i} \bar{a}_{ij} + \bar{b}_{j} a_{ji} &= b_{i} \bar{b}_{j} , & \bar{b}_i &= b_i . \end{aligned} ``` """ struct IntegratorIPRK{DT, TT, D, S, PT <: ParametersIPRK{DT,TT}, ST <: NonlinearSolver{DT}, IT <: InitialGuessPODE{TT}} <: AbstractIntegratorPRK{DT,TT} params::PT solver::ST iguess::IT caches::CacheDict{PT} function IntegratorIPRK(params::ParametersIPRK{DT,TT,D,S}, solver::ST, iguess::IT, caches) where {DT,TT,D,S,ST,IT} new{DT, TT, D, S, typeof(params), ST, IT}(params, solver, iguess, caches) end function IntegratorIPRK{DT,D}(equations::NamedTuple, tableau::PartitionedTableau{TT}, Δt::TT) where {DT,TT,D} # get number of stages S = tableau.s # create params params = ParametersIPRK{DT,D}(equations, tableau, Δt) # create cache dict caches = CacheDict(params) # create solver solver = create_nonlinear_solver(DT, 2*D*S, params, caches) # create initial guess iguess = InitialGuessPODE(get_config(:ig_extrapolation), equations[:v], equations[:f], Δt) # create integrator IntegratorIPRK(params, solver, iguess, caches) end function IntegratorIPRK{DT,D}(v::Function, f::Function, tableau::PartitionedTableau{TT}, Δt::TT; kwargs...) where {DT,TT,D} IntegratorIPRK{DT,D}(NamedTuple{(:v,:f)}((v,f)), tableau, Δt; kwargs...) end function IntegratorIPRK{DT,D}(v::Function, f::Function, h::Function, tableau::PartitionedTableau{TT}, Δt::TT; kwargs...) where {DT,TT,D} IntegratorIPRK{DT,D}(NamedTuple{(:v,:f,:h)}((v,f,h)), tableau, Δt; kwargs...) end function IntegratorIPRK(equation::Union{PODE{DT}, HODE{DT}}, tableau::PartitionedTableau{TT}, Δt::TT; kwargs...) where {DT,TT} IntegratorIPRK{DT, ndims(equation)}(get_functions(equation), tableau, Δt; kwargs...) end end @inline Base.ndims(::IntegratorIPRK{DT,TT,D,S}) where {DT,TT,D,S} = D function initialize!(int::IntegratorIPRK, sol::AtomicSolutionPODE) sol.t̄ = sol.t - timestep(int) equations(int)[:v](sol.t, sol.q, sol.p, sol.v) equations(int)[:f](sol.t, sol.q, sol.p, sol.f) initialize!(int.iguess, sol.t, sol.q, sol.p, sol.v, sol.f, sol.t̄, sol.q̄, sol.p̄, sol.v̄, sol.f̄) end function update_params!(int::IntegratorIPRK, sol::AtomicSolutionPODE) # set time for nonlinear solver and copy previous solution int.params.t = sol.t int.params.q .= sol.q int.params.p .= sol.p end function initial_guess!(int::IntegratorIPRK{DT}, sol::AtomicSolutionPODE{DT}, cache::IntegratorCacheIPRK{DT}=int.caches[DT]) where {DT} for i in eachstage(int) evaluate!(int.iguess, sol.q̄, sol.p̄, sol.v̄, sol.f̄, sol.q, sol.p, sol.v, sol.f, cache.Q[i], cache.P[i], cache.V[i], cache.F[i], tableau(int).q.c[i], tableau(int).p.c[i]) end for i in eachstage(int) for k in eachdim(int) int.solver.x[2*(ndims(int)*(i-1)+k-1)+1] = 0 int.solver.x[2*(ndims(int)*(i-1)+k-1)+2] = 0 for j in eachstage(int) int.solver.x[2*(ndims(int)*(i-1)+k-1)+1] += tableau(int).q.a[i,j] * cache.V[j][k] int.solver.x[2*(ndims(int)*(i-1)+k-1)+2] += tableau(int).p.a[i,j] * cache.F[j][k] end end end end function compute_stages!(x::Vector{ST}, Q::Vector{Vector{ST}}, V::Vector{Vector{ST}}, Y::Vector{Vector{ST}}, P::Vector{Vector{ST}}, F::Vector{Vector{ST}}, Z::Vector{Vector{ST}}, params::ParametersIPRK{DT,TT,D,S}) where {ST,DT,TT,D,S} local tqᵢ::TT local tpᵢ::TT for i in 1:S for k in 1:D # copy y to Y and Z Y[i][k] = x[2*(D*(i-1)+k-1)+1] Z[i][k] = x[2*(D*(i-1)+k-1)+2] # compute Q and P Q[i][k] = params.q[k] + params.Δt * Y[i][k] P[i][k] = params.p[k] + params.Δt * Z[i][k] end # compute time of internal stage tqᵢ = params.t + params.Δt * params.tab.q.c[i] tpᵢ = params.t + params.Δt * params.tab.p.c[i] # compute v(Q,P) and f(Q,P) params.equs[:v](tqᵢ, Q[i], P[i], V[i]) params.equs[:f](tpᵢ, Q[i], P[i], F[i]) end end # Compute stages of implicit partitioned Runge-Kutta methods. function function_stages!(x::Vector{ST}, b::Vector{ST}, params::ParametersIPRK{DT,TT,D,S}, caches::CacheDict) where {ST,DT,TT,D,S} # get cache for internal stages cache = caches[ST] # compute stages from nonlinear solver solution x compute_stages!(x, cache.Q, cache.V, cache.Y, cache.P, cache.F, cache.Z, params) # compute b = - [(Y-AV), (Z-AF)] for i in 1:S for k in 1:D b[2*(D*(i-1)+k-1)+1] = - cache.Y[i][k] b[2*(D*(i-1)+k-1)+2] = - cache.Z[i][k] for j in 1:S b[2*(D*(i-1)+k-1)+1] += params.tab.q.a[i,j] * cache.V[j][k] b[2*(D*(i-1)+k-1)+2] += params.tab.p.a[i,j] * cache.F[j][k] end end end end function integrate_step!(int::IntegratorIPRK{DT,TT}, sol::AtomicSolutionPODE{DT,TT}, cache::IntegratorCacheIPRK{DT}=int.caches[DT]) where {DT,TT} # update nonlinear solver parameters from atomic solution update_params!(int, sol) # compute initial guess initial_guess!(int, sol, cache) # reset atomic solution reset!(sol, timestep(int)) # call nonlinear solver solve!(int.solver) # print solver status print_solver_status(int.solver.status, int.solver.params) # check if solution contains NaNs or error bounds are violated check_solver_status(int.solver.status, int.solver.params) # compute vector fields at internal stages compute_stages!(int.solver.x, cache.Q, cache.V, cache.Y, cache.P, cache.F, cache.Z, int.params) # compute final update update_solution!(sol.q, sol.q̃, cache.V, tableau(int).q.b, tableau(int).q.b̂, timestep(int)) update_solution!(sol.p, sol.p̃, cache.F, tableau(int).p.b, tableau(int).p.b̂, timestep(int)) # copy solution to initial guess update_vector_fields!(int.iguess, sol.t, sol.q, sol.p, sol.v, sol.f) end
[ 27, 34345, 29, 10677, 14, 18908, 18942, 14, 81, 74, 14, 18908, 18942, 62, 541, 81, 74, 13, 20362, 198, 198, 1, 48944, 329, 826, 12, 4993, 1735, 2163, 286, 16992, 18398, 276, 5660, 469, 12, 42, 315, 8326, 5050, 526, 198, 76, 18187,...
1.979626
4,810
abstract type AbstractTableauSplitting{T <: Real} <: AbstractTableau{T} end function get_splitting_coefficients(r, a::Vector{T}, b::Vector{T}) where {T} @assert length(a) == length(b) s = length(a) f = zeros(Int, 2r*s) c = zeros(T, 2r*s) for i in 1:s for j in 1:r f[(2i-2)*r+j] = j c[(2i-2)*r+j] = a[i] end for j in 1:r f[(2i-1)*r+j] = r-j+1 c[(2i-1)*r+j] = b[i] end end return f, c end @doc raw""" Tableau for general splitting methods for vector fields with two components A and B. Integrator: ```math \varphi_{\tau} = \varphi_{b_s \tau}^{B} \circ \varphi_{a_s \tau}^{A} \circ \dotsc \circ \varphi_{b_1 \tau}^{B} \circ \varphi_{a_1 \tau}^{A} ``` """ struct TableauSplitting{T} <: AbstractTableauSplitting{T} @HeaderTableau a::Vector{T} b::Vector{T} function TableauSplitting{T}(name, o, s, a, b) where {T} @assert s == length(a) == length(b) new(name, o, s, a, b) end end function TableauSplitting(name, o, a::Vector{T}, b::Vector{T}) where {T} TableauSplitting{T}(name, o, length(a), a, b) end function get_splitting_coefficients(nequs, tableau::TableauSplitting{T}) where {T} @assert nequs == 2 @assert length(tableau.a) == length(tableau.b) s = length(tableau.a) f = zeros(Int, 2s) c = zeros(T, 2s) for i in eachindex(tableau.a, tableau.b) f[2*(i-1)+1] = 1 c[2*(i-1)+1] = tableau.a[i] f[2*(i-1)+2] = 2 c[2*(i-1)+2] = tableau.b[i] end # select all entries with non-vanishing coefficients y = c .!= 0 return f[y], c[y] end @doc raw""" Tableau for non-symmetric splitting methods. See <NAME>, 2003, Equ. (4.10). The methods A and B are the composition of all vector fields in the SODE and its adjoint, respectively. Basic method: Lie composition ```math \begin{aligned} \varphi_{\tau}^{A} &= \varphi_{\tau}^{v_1} \circ \varphi_{\tau}^{v_2} \circ \dotsc \circ \varphi_{\tau}^{v_{r-1}} \circ \varphi_{\tau}^{v_r} \\ \varphi_{\tau}^{B} &= \varphi_{\tau}^{v_r} \circ \varphi_{\tau}^{v_{r-1}} \circ \dotsc \circ \varphi_{\tau}^{v_2} \circ \varphi_{\tau}^{v_1} \end{aligned} ``` Integrator: ```math \varphi_{\tau}^{NS} = \varphi_{b_s \tau}^{B} \circ \varphi_{a_s \tau}^{A} \circ \dotsc \circ \varphi_{b_1 \tau}^{B} \circ \varphi_{a_1 \tau}^{A} ``` """ struct TableauSplittingNS{T} <: AbstractTableauSplitting{T} @HeaderTableau a::Vector{T} b::Vector{T} function TableauSplittingNS{T}(name, o, s, a, b) where {T} @assert s == length(a) == length(b) new(name, o, s, a, b) end end function TableauSplittingNS(name, o, a::Vector{T}, b::Vector{T}) where {T} TableauSplittingNS{T}(name, o, length(a), a, b) end function get_splitting_coefficients(nequs, tableau::TableauSplittingNS) # R = length(equation.v) # S = tableau.s # # f = zeros(Int, 2R*S) # c = zeros(TT, 2R*S) # # for i in 1:S # for j in 1:R # f[(2i-2)*R+j] = j # c[(2i-2)*R+j] = tableau.a[i] # end # for j in 1:R # f[(2i-1)*R+j] = R-j+1 # c[(2i-1)*R+j] = tableau.b[i] # end # end get_splitting_coefficients(nequs, tableau.a, tableau.b) end @doc raw""" Tableau for symmetric splitting methods with general stages. See McLachlan, Quispel, 2003, Equ. (4.11). Basic method: Lie composition ```math \begin{aligned} \varphi_{\tau}^{A} &= \varphi_{\tau}^{v_1} \circ \varphi_{\tau}^{v_2} \circ \dotsc \circ \varphi_{\tau}^{v_{r-1}} \circ \varphi_{\tau}^{v_r} \\ \varphi_{\tau}^{B} &= \varphi_{\tau}^{v_r} \circ \varphi_{\tau}^{v_{r-1}} \circ \dotsc \circ \varphi_{\tau}^{v_2} \circ \varphi_{\tau}^{v_1} \end{aligned} ``` Integrator: ```math \varphi_{\tau}^{GS} = \varphi_{a_1 \tau}^{A} \circ \varphi_{b_1 \tau}^{B} \circ \dotsc \circ \varphi_{b_1 \tau}^{B} \circ \varphi_{a_1 \tau}^{A} ``` """ struct TableauSplittingGS{T} <: AbstractTableauSplitting{T} @HeaderTableau a::Vector{T} b::Vector{T} function TableauSplittingGS{T}(name, o, s, a, b) where {T} @assert s == length(a) == length(b) new(name, o, s, a, b) end end function TableauSplittingGS(name, o, a::Vector{T}, b::Vector{T}) where {T} TableauSplittingGS{T}(name, o, length(a), a, b) end function get_splitting_coefficients(nequs, tableau::TableauSplittingGS) # R = nequs # S = tableau.s # # f = zeros(Int, 2R*S) # c = zeros(TT, 2R*S) # # for i in 1:S # for j in 1:R # f[(2i-2)*R+j] = j # c[(2i-2)*R+j] = tableau.a[i] # end # for j in R:-1:1 # f[(2i-1)*R+j] = R-j+1 # c[(2i-1)*R+j] = tableau.b[i] # end # end f, c = get_splitting_coefficients(nequs, tableau.a, tableau.b) vcat(f, f[end:-1:1]), vcat(c, c[end:-1:1]) end @doc raw""" Tableau for symmetric splitting methods with symmetric stages. See <NAME>, 2003, Equ. (4.6). Basic method: symmetric Strang composition ```math \varphi_{\tau}^{A} = \varphi_{\tau/2}^{v_1} \circ \varphi_{\tau/2}^{v_2} \circ \dotsc \circ \varphi_{\tau/2}^{v_{r-1}} \circ \varphi_{\tau/2}^{v_r} \circ \varphi_{\tau/2}^{v_r} \circ \varphi_{\tau/2}^{v_{r-1}} \circ \dotsc \circ \varphi_{\tau/2}^{v_2} \circ \varphi_{\tau/2}^{v_1} ``` Integrator: ```math \varphi_{\tau}^{SS} = \varphi_{a_1 \tau}^{A} \circ \varphi_{a_2 \tau}^{A} \circ \dotsc \circ \varphi_{a_s \tau}^{A} \circ \dotsc \circ \varphi_{a_2 \tau}^{A} \circ \varphi_{a_1 \tau}^{A} ``` """ struct TableauSplittingSS{T} <: AbstractTableauSplitting{T} @HeaderTableau a::Vector{T} function TableauSplittingSS{T}(name, o, s, a) where {T} @assert s == length(a) new(name, o, s, a) end end function TableauSplittingSS(name, o, a::Vector{T}) where {T} TableauSplittingSS{T}(name, o, length(a), a) end function get_splitting_coefficients(nequs, tableau::TableauSplittingSS{T}) where {T} r = nequs a = vcat(tableau.a, tableau.a[end-1:-1:1]) ./ 2 s = length(a) f = zeros(Int, 2r*s) c = zeros(T, 2r*s) for i in 1:s for j in 1:r f[(2i-2)*r+j] = j c[(2i-2)*r+j] = a[i] f[(2i-1)*r+j] = r-j+1 c[(2i-1)*r+j] = a[i] end end f, c end
[ 198, 397, 8709, 2099, 27741, 10962, 559, 26568, 2535, 90, 51, 1279, 25, 6416, 92, 1279, 25, 27741, 10962, 559, 90, 51, 92, 886, 198, 198, 8818, 651, 62, 22018, 2535, 62, 1073, 41945, 7, 81, 11, 257, 3712, 38469, 90, 51, 5512, 275,...
1.933577
3,282
t = Template(; user=me) pkg_dir = joinpath(t.dir, test_pkg) @testset "AppVeyor" begin @testset "Plugin creation" begin p = AppVeyor() @test isempty(p.gitignore) @test p.src == joinpath(PkgTemplates.DEFAULTS_DIR, "appveyor.yml") @test p.dest == ".appveyor.yml" @test p.badges == [ Badge( "Build Status", "https://ci.appveyor.com/api/projects/status/github/{{USER}}/{{PKGNAME}}.jl?svg=true", "https://ci.appveyor.com/project/{{USER}}/{{PKGNAME}}-jl", ), ] @test isempty(p.view) p = AppVeyor(; config_file=nothing) @test p.src === nothing p = AppVeyor(; config_file=test_file) @test p.src == test_file @test_throws ArgumentError AppVeyor(; config_file=fake_path) end @testset "Badge generation" begin p = AppVeyor() @test badges(p, me, test_pkg) == ["[![Build Status](https://ci.appveyor.com/api/projects/status/github/$me/$test_pkg.jl?svg=true)](https://ci.appveyor.com/project/$me/$test_pkg-jl)"] end @testset "File generation" begin # Without a coverage plugin in the template, there should be no post-test step. p = AppVeyor() @test gen_plugin(p, t, test_pkg) == [".appveyor.yml"] @test isfile(joinpath(pkg_dir, ".appveyor.yml")) appveyor = read(joinpath(pkg_dir, ".appveyor.yml"), String) @test !occursin("on_success", appveyor) @test !occursin("%JL_CODECOV_SCRIPT%", appveyor) rm(joinpath(pkg_dir, ".appveyor.yml")) # Generating the plugin with Codecov in the template should create a post-test step. t.plugins[Codecov] = Codecov() gen_plugin(p, t, test_pkg) delete!(t.plugins, Codecov) appveyor = read(joinpath(pkg_dir, ".appveyor.yml"), String) @test occursin("on_success", appveyor) @test occursin("%JL_CODECOV_SCRIPT%", appveyor) rm(joinpath(pkg_dir, ".appveyor.yml")) # TODO: Add Coveralls tests when AppVeyor.jl supports it. p = AppVeyor(; config_file=nothing) @test isempty(gen_plugin(p, t, test_pkg)) @test !isfile(joinpath(pkg_dir, ".appveyor.yml")) end end rm(pkg_dir; recursive=true)
[ 83, 796, 37350, 7, 26, 2836, 28, 1326, 8, 198, 35339, 62, 15908, 796, 4654, 6978, 7, 83, 13, 15908, 11, 1332, 62, 35339, 8, 198, 198, 31, 9288, 2617, 366, 4677, 53, 2959, 273, 1, 2221, 198, 220, 220, 220, 2488, 9288, 2617, 366, ...
2.093002
1,086
<filename>docs/make.jl using Documenter using MPIMeasurements makedocs( sitename = "MPIMeasurements", authors = "<NAME> et al.", format = Documenter.HTML(prettyurls = false), modules = [MPIMeasurements], pages = [ "Home" => "index.md", "Manual" => Any[ "Guide" => "man/guide.md", "Devices" => "man/devices.md", "Protocols" => "man/protocols.md", "Sequences" => "man/sequences.md", "Examples" => "man/examples.md", ], "Library" => Any[ "Public" => "lib/public.md", "Internals" => map( s -> "lib/internals/$(s)", sort(readdir(normpath(@__DIR__, "src/lib/internals"))) ), ], ], ) # deploydocs(repo = "github.com/MagneticParticleImaging/MPIMeasurements.jl.git", # target = "build")
[ 27, 34345, 29, 31628, 14, 15883, 13, 20362, 198, 3500, 16854, 263, 198, 3500, 4904, 3955, 68, 5015, 902, 198, 198, 76, 4335, 420, 82, 7, 198, 220, 220, 220, 1650, 12453, 796, 366, 7378, 3955, 68, 5015, 902, 1600, 198, 220, 220, 22...
1.947137
454
<reponame>ericphanson/GuessworkQuantumSideInfo.jl<filename>test/high_precision_tests/tests.jl using GuessworkQuantumSideInfo using SDPAFamily using Test using LinearAlgebra, GenericLinearAlgebra # Fix a compatibility problem LinearAlgebra.eigmin(A::Hermitian{Complex{BigFloat},Array{Complex{BigFloat},2}}) = minimum(real.(eigvals(A))) function testPOVM(Es; tol = 1e-25) dB = size(first(Es), 1) @test sum(Es) ≈ complex(1.0) * I(dB) atol = tol for E in Es @test E ≈ E' atol = tol end @test all(isposdef, Hermitian(E) + tol * I(dB) for E in Es) end T = BigFloat default_sdp_solver(T) = SDPAFamily.Optimizer{T}(presolve = true) @testset "BB84" begin ρBs = GuessworkQuantumSideInfo.BB84_states(T) p = ones(T, 4) / 4 output = guesswork(p, ρBs; solver = default_sdp_solver(T)) testPOVM(output.Es) relaxed_output = guesswork_upper_bound(p, ρBs; num_constraints = 4, make_solver = () -> default_sdp_solver(T)) true_val = (big(1) / big(4)) * (10 - sqrt(big(10))) @test output.optval ≈ true_val rtol = 1e-25 @test output.optval ≈ relaxed_output.optval rtol = 1e-4 lb = guesswork_lower_bound(p, ρBs; solver = default_sdp_solver(T)).optval @test lb <= output.optval + 1e-4 end
[ 27, 7856, 261, 480, 29, 35626, 746, 23103, 14, 8205, 408, 1818, 24915, 388, 24819, 12360, 13, 20362, 27, 34345, 29, 9288, 14, 8929, 62, 3866, 16005, 62, 41989, 14, 41989, 13, 20362, 198, 3500, 37571, 1818, 24915, 388, 24819, 12360, 19...
2.288321
548
<reponame>dominikkiese/PFFRGSolver.jl """ get_observable_timers() :: Nothing Test performance of current observable implementation by Fourier transforming test correlations on a few 2D and 3D lattices with 50 x 50 x 0 (2D) or 50 x 50 x 50 (3D) momenta. """ function get_observable_timers() :: Nothing # init test dummys l1 = get_lattice("square", 6, verbose = false); r1 = get_reduced_lattice("heisenberg", [[0.0]], l1, verbose = false) l2 = get_lattice("cubic", 6, verbose = false); r2 = get_reduced_lattice("heisenberg", [[0.0]], l2, verbose = false) l3 = get_lattice("kagome", 6, verbose = false); r3 = get_reduced_lattice("heisenberg", [[0.0]], l3, verbose = false) l4 = get_lattice("hyperkagome", 6, verbose = false); r4 = get_reduced_lattice("heisenberg", [[0.0]], l4, verbose = false) χ1 = Float64[exp(-norm(r1.sites[i].vec)) for i in eachindex(r1.sites)] χ2 = Float64[exp(-norm(r2.sites[i].vec)) for i in eachindex(r2.sites)] χ3 = Float64[exp(-norm(r3.sites[i].vec)) for i in eachindex(r3.sites)] χ4 = Float64[exp(-norm(r4.sites[i].vec)) for i in eachindex(r4.sites)] k_2D = get_momenta((0.0, 1.0 * pi), (0.0, 1.0 * pi), (0.0, 0.0), (50, 50, 0)) k_3D = get_momenta((0.0, 1.0 * pi), (0.0, 1.0 * pi), (0.0, 1.0 * pi), (50, 50, 50)) # init timer to = TimerOutput() @timeit to "=> Fourier transform" begin for rep in 1 : 10 @timeit to "-> square" compute_structure_factor(χ1, k_2D, l1, r1) @timeit to "-> cubic" compute_structure_factor(χ2, k_3D, l2, r2) @timeit to "-> kagome" compute_structure_factor(χ3, k_2D, l3, r3) @timeit to "-> hyperkagome" compute_structure_factor(χ4, k_3D, l4, r4) end end show(to) return nothing end
[ 27, 7856, 261, 480, 29, 3438, 259, 36073, 444, 68, 14, 47, 5777, 49, 14313, 14375, 13, 20362, 198, 37811, 198, 220, 220, 220, 651, 62, 672, 3168, 540, 62, 16514, 364, 3419, 7904, 10528, 220, 198, 198, 14402, 2854, 286, 1459, 42550, ...
2.102535
868
# FUNCTION recover_primal """Computes the Ridge regressor INPUT ℓ - LossFunction to use Y - Vector of observed responses Z - Matrix of observed features γ - Regularization parameter OUTPUT w - Optimal regressor""" function recover_primal(ℓ::Regression, Y, Z, γ) CM = Matrix(I, size(Z,2), size(Z,2))/γ + Z'*Z # The capacitance matrix α = -Y + Z*(CM\(Z'*Y)) # Matrix Inversion Lemma return -γ*Z'*α # Regressor end using LIBLINEAR function recover_primal(ℓ::Classification, Y, Z, γ) solverNumber = LibLinearSolver(ℓ) if isa(ℓ, SubsetSelection.Classification) model = LIBLINEAR.linear_train(Y, Z'; verbose=false, C=γ, solver_type=Cint(solverNumber)) return Y[1]*model.w # else # model = linear_train(Y, Z'; verbose=false, C=γ, solver_type=Cint(solverNumber), eps = ℓ.ε) # return model.w end end function LibLinearSolver(ℓ::L1SVR) return 13 end function LibLinearSolver(ℓ::L2SVR) return 12 end function LibLinearSolver(ℓ::LogReg) return 7 end function LibLinearSolver(ℓ::L1SVM) return 3 end function LibLinearSolver(ℓ::L2SVM) return 2 end
[ 2, 29397, 4177, 2849, 8551, 62, 1050, 4402, 198, 37811, 7293, 1769, 262, 20614, 842, 44292, 198, 1268, 30076, 198, 220, 2343, 226, 241, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 22014, 22203, 284, 779, 198, 220, 575, 22...
2.182156
538
<filename>src/equations/euler.jl<gh_stars>0 struct Euler <: Equation end @declare_dofs Euler [:rhou, :rhov, :rho, :e] struct GaussianWaveeuler <: Scenario end struct Sod_shock_tube <: Scenario end function is_periodic_boundary(equation::Euler, scenario::GaussianWaveeuler) # GaussianWave scenario with periodic boundary conditions true end function is_periodic_boundary(equation::Euler, scenario::Sod_shock_tube) # sod_shock_tube scenario doesn't require periodic boundary conditions false end # for Sod_shock_tube Scenario function evaluate_boundary(eq::Euler, scenario::Sod_shock_tube, face, normalidx, dofsface, dofsfaceneigh) # dofsface and dofsfaceneigh have shape (num_2d_quadpoints, dofs) # you need to set dofsfaceneigh dofsfaceneigh .= dofsface if normalidx == 1 dofsfaceneigh[:, 1] = -dofsface[:, 1] else dofsfaceneigh[:, 2] = -dofsface[:, 2] end end function evaluate_energy(eq::Euler, rhou, rhov, rho, p) # value of gamma is 1.4, hence gamma-1 = 0.4 return ( (p/0.4) + (1/(2*rho)) * (rhou^2 + rhov^2) ) end function evaluate_pressure(eq::Euler, rhou, rhov, rho, e) # value of gamma is 1.4, hence gamma-1 = 0.4 return ( (0.4) * ( e - (1/(2*rho)) * (rhou^2 + rhov^2) )) end function get_initial_values(eq::Euler, scenario::GaussianWaveeuler, global_position; t=0.0) x, y = global_position if is_analytical_solution(eq, scenario) println("No analytical solution implemented") else p = exp(-100 * (x - 0.5)^2 - 100 *(y - 0.5)^2) + 1 [0, 0, 1.0, evaluate_energy(eq, 0, 0, 1.0, p)] end end function get_initial_values(eq::Euler, scenario::Sod_shock_tube, global_position; t=0.0) x, y = global_position if is_analytical_solution(eq, scenario) println("No analytical solution implemented") else [ 0, 0, if x<=0.5 0.125 else 1.0 end, if x<= 0.5 evaluate_energy(eq, 0, 0, 0.125, 0.1) else evaluate_energy(eq, 0, 0, 1.0, 1.0) end ] end end function is_analytical_solution(equation::Euler, scenario::GaussianWaveeuler) false end function is_analytical_solution(equation::Euler, scenario::Sod_shock_tube) false end function evaluate_flux(eq::Euler, celldofs, cellflux) # size(cellflux)=(2*order*order, ndof)=(2,5) # size(celldofs)=(order*order, ndof)=(1,5) order_sq, ndof = size(celldofs) for j=1:order_sq # explicit names of dofs for clarity rhou = celldofs[j, 1] rhov = celldofs[j, 2] density = celldofs[j, 3] e = celldofs[j, 4] p=evaluate_pressure(eq,rhou,rhov,density,e) # here flux is computed elementwise cellflux[j,1]= (1/density)*rhou^2 + p cellflux[j + order_sq, 1] = (1/density)*rhou*rhov cellflux[j,2] = (1/density)*rhou*rhov cellflux[j + order_sq, 2] = (1/density)*rhov^2 + p cellflux[j,3] = rhou cellflux[j + order_sq, 3] = rhov cellflux[j,4] = (rhou/density)*(e+p) cellflux[j + order_sq, 4] = (rhov/density)*(e+p) end end function max_eigenval(eq::Euler, celldata, normalidx) # v_n + c, where c = sqrt(gamma*p /rho) maxeigenval = 0. #@info size(celldata) for i in 1:size(celldata)[1] rhou, rhov, density, e = celldata[i, :] pressure = evaluate_pressure(eq,rhou,rhov,density,e) #@info i #@info pressure #@info density #@info e #@info rhou #@info rhov c = sqrt(1.4*pressure/density) if normalidx == 1 vn = rhou / density else vn = rhov / density end maxeigenval_new = vn + c if maxeigenval_new > maxeigenval maxeigenval = maxeigenval_new end end maxeigenval end
[ 27, 34345, 29, 10677, 14, 4853, 602, 14, 68, 18173, 13, 20362, 27, 456, 62, 30783, 29, 15, 198, 7249, 412, 18173, 1279, 25, 7889, 341, 886, 198, 31, 32446, 533, 62, 67, 1659, 82, 412, 18173, 685, 25, 81, 15710, 11, 1058, 17179, ...
2.147915
1,751
# file containing methods for requesting forecast simulations from GEOGloWS """ forecast_stats(parameters::AbstractDict{Symbol,<:Any}) returns statistics calculated from 51 forecast ensemble members. """ function forecast_stats(parameters::AbstractDict{Symbol,<:Any}) endpoint = "ForecastStats" r = _make_request(baseurl, endpoint, parameters) _read_response(r, parameters[:return_format], with_dates = true) end """ forecast_stats(reach_id::Int; return_format::Symbol = :csv) returns statistics calculated from 51 forecast ensemble members. """ function forecast_stats(reach_id::Int; return_format::Symbol = :csv) parameters = Dict(:reach_id => reach_id, :return_format => return_format) forecast_stats(parameters) end """ forecast_stats(reach_id::Int,date::AbstractString; return_format::Symbol = :csv) returns statistics calculated from 51 forecast ensemble members. """ function forecast_stats( reach_id::Int, date::AbstractString; return_format::Symbol = :csv, ) parameters = Dict( :reach_id => reach_id, :date => date, :return_format => return_format, ) forecast_stats(parameters) end """ forecast_stats(reach_id::Int,date::TimeType; return_format::Symbol = :csv) returns statistics calculated from 51 forecast ensemble members. """ function forecast_stats( reach_id::Int, date::TimeType; return_format::Symbol = :csv, ) datestr = try Dates.format(date, "YYYY-m-d") catch Dates.format(date, "yyyymmdd") end parameters = Dict( :reach_id => reach_id, :date => datestr, :return_format => return_format, ) forecast_stats(parameters) end """ forecast_stats(lat::Real, lon::Real; return_format::Symbol = :csv) returns statistics calculated from 51 forecast ensemble members. """ function forecast_stats(lat::Real, lon::Real; return_format::Symbol = :csv) parameters = Dict(:lat => lat, :lon => lon, :return_format => return_format) forecast_stats(parameters) end """ forecast_stats(lat::Real, lon::Real, date::AbstractString; return_format::Symbol = :csv) returns statistics calculated from 51 forecast ensemble members. """ function forecast_stats( lat::Real, lon::Real, date::AbstractString; return_format::Symbol = :csv, ) if occursin("-", date) date = replace(date, "-" => "") end parameters = Dict( :lat => lat, :lon => lon, :date => date, :return_format => return_format, ) forecast_stats(parameters) end """ forecast_stats(lat::Real, lon::Real, date::TimeType; return_format::Symbol = :csv) returns statistics calculated from 51 forecast ensemble members. """ function forecast_stats( lat::Real, lon::Real, date::TimeType; return_format::Symbol = :csv, ) datestr = Dates.format(date, "yyyymmdd") parameters = Dict( :lat => lat, :lon => lon, :date => datestr, :return_format => return_format, ) forecast_stats(parameters) end """ forecast_ensembles(parameters::AbstractDict{Symbol,<:Any}) returns a timeseries for each of the 51 normal forecast ensemble members and the 52nd higher resolution forecast """ function forecast_ensembles(parameters::AbstractDict{Symbol,<:Any}) endpoint = "ForecastEnsembles" r = _make_request(baseurl, endpoint, parameters) _read_response(r, parameters[:return_format], with_dates = true) end """ forecast_ensembles(reach_id::Int; return_format::Symbol = :csv) returns a timeseries for each of the 51 normal forecast ensemble members and the 52nd higher resolution forecast """ function forecast_ensembles(reach_id::Int; return_format::Symbol = :csv) parameters = Dict(:reach_id => reach_id, :return_format => return_format) forecast_ensembles(parameters) end """ forecast_ensembles(reach_id::Int, date::AbstractString; return_format::Symbol = :csv) returns a timeseries for each of the 51 normal forecast ensemble members and the 52nd higher resolution forecast """ function forecast_ensembles( reach_id::Int, date::AbstractString; return_format::Symbol = :csv, ) if occursin("-", date) date = replace(date, "-" => "") end parameters = Dict( :reach_id => reach_id, :date => date, :return_format => return_format, ) forecast_ensembles(parameters) end """ forecast_ensembles(reach_id::Int, date::TimeType; return_format::Symbol = :csv) returns a timeseries for each of the 51 normal forecast ensemble members and the 52nd higher resolution forecast """ function forecast_ensembles( reach_id::Int, date::TimeType; return_format::Symbol = :csv, ) datestr = Dates.format(date, "yyyymmdd") parameters = Dict( :reach_id => reach_id, :date => datestr, :return_format => return_format, ) forecast_ensembles(parameters) end """ forecast_ensembles(lat::Real, lon::Real; return_format::Symbol = :csv) returns a timeseries for each of the 51 normal forecast ensemble members and the 52nd higher resolution forecast """ function forecast_ensembles(lat::Real, lon::Real; return_format::Symbol = :csv) parameters = Dict(:lat => lat, :lon => lon, :return_format => return_format) forecast_ensembles(parameters) end """ forecast_ensembles(lat::Real, lon::Real, date::AbstractString; return_format::Symbol = :csv) returns a timeseries for each of the 51 normal forecast ensemble members and the 52nd higher resolution forecast """ function forecast_ensembles( lat::Real, lon::Real, date::AbstractString; return_format::Symbol = :csv, ) if occursin("-", date) date = replace(date, "-" => "") end parameters = Dict( :lat => lat, :lon => lon, :date => date, :return_format => return_format, ) forecast_ensembles(parameters) end """ forecast_ensembles(lat::Real, lon::Real, date::TimeType; return_format::Symbol = :csv) returns a timeseries for each of the 51 normal forecast ensemble members and the 52nd higher resolution forecast """ function forecast_ensembles( lat::Real, lon::Real, date::TimeType; return_format::Symbol = :csv, ) datestr = Dates.format(date, "yyyymmdd") parameters = Dict( :lat => lat, :lon => lon, :date => datestr, :return_format => return_format, ) forecast_ensembles(parameters) end """ forecast_records(parameters::AbstractDict{Symbol,<:Any}) retrieves the rolling record of the mean of the forecasted streamflow during the first 24 hours of each day's forecast. That is, each day day after the streamflow forecasts are computed, the average of first 8 of the 3-hour timesteps are recorded to a csv. """ function forecast_records(parameters::AbstractDict{Symbol,<:Any}) endpoint = "ForecastRecords" r = _make_request(baseurl, endpoint, parameters) _read_response(r, parameters[:return_format], with_dates = true) end """ forecast_records(reach_id::Int; return_format::Symbol = :csv) retrieves the rolling record of the mean of the forecasted streamflow during the first 24 hours of each day's forecast. That is, each day day after the streamflow forecasts are computed, the average of first 8 of the 3-hour timesteps are recorded to a csv. """ function forecast_records(reach_id::Int; return_format::Symbol = :csv) parameters = Dict(:reach_id => reach_id, :return_format => return_format) forecast_records(parameters) end """ forecast_records(lat::Real, lon::Real; return_format::Symbol = :csv) retrieves the rolling record of the mean of the forecasted streamflow during the first 24 hours of each day's forecast. That is, each day day after the streamflow forecasts are computed, the average of first 8 of the 3-hour timesteps are recorded to a csv. """ function forecast_records(lat::Real, lon::Real; return_format::Symbol = :csv) parameters = Dict(:lat => lat, :lon => lon, :return_format => return_format) forecast_records(parameters) end """ forecast_records(reach_id::Int, start_date::TimeType, end_date::TimeType; return_format::Symbol = :csv,) retrieves the rolling record of the mean of the forecasted streamflow during the first 24 hours of each day's forecast. That is, each day day after the streamflow forecasts are computed, the average of first 8 of the 3-hour timesteps are recorded to a csv. """ function forecast_records( reach_id::Int, start_date::TimeType, end_date::TimeType; return_format::Symbol = :csv, ) start_datestr = Dates.format(start_date, "yyyymmdd") end_datestr = Dates.format(end_date, "yyyymmdd") parameters = Dict( :reach_id => reach_id, :start_date => start_datestr, :end_date => end_datestr, :return_format => return_format, ) forecast_records(parameters) end """ forecast_records(reach_id::Int, start_date::AbstractString, end_date::AbstractString; return_format::Symbol = :csv,) retrieves the rolling record of the mean of the forecasted streamflow during the first 24 hours of each day's forecast. That is, each day day after the streamflow forecasts are computed, the average of first 8 of the 3-hour timesteps are recorded to a csv. """ function forecast_records( reach_id::Int, start_date::AbstractString, end_date::AbstractString; return_format::Symbol = :csv, ) if occursin("-", start_date) start_date = replace(start_date, "-" => "") end if occursin("-", end_date) end_date = replace(end_date, "-" => "") end parameters = Dict( :reach_id => reach_id, :start_date => start_date, :end_date => end_date, :return_format => return_format, ) forecast_records(parameters) end """ forecast_records(lat::Real, lon::Real, start_date::TimeType, end_date::TimeType; return_format::Symbol = :csv,) retrieves the rolling record of the mean of the forecasted streamflow during the first 24 hours of each day's forecast. That is, each day day after the streamflow forecasts are computed, the average of first 8 of the 3-hour timesteps are recorded to a csv. """ function forecast_records( lat::Real, lon::Real, start_date::TimeType, end_date::TimeType; return_format::Symbol = :csv, ) start_datestr = Dates.format(start_date, "yyyymmdd") end_datestr = Dates.format(end_date, "yyyymmdd") parameters = Dict( :lat => lat, :lon => lon, :start_date => start_datestr, :end_date => end_datestr, :return_format => return_format, ) forecast_records(parameters) end """ forecast_records(lat::Real, lon::Real, start_date::AbstractString, end_date::AbstractString; return_format::Symbol = :csv,) retrieves the rolling record of the mean of the forecasted streamflow during the first 24 hours of each day's forecast. That is, each day day after the streamflow forecasts are computed, the average of first 8 of the 3-hour timesteps are recorded to a csv. """ function forecast_records( lat::Real, lon::Real, start_date::AbstractString, end_date::AbstractString; return_format::Symbol = :csv, ) if occursin("-", start_date) start_date = replace(start_date, "-" => "") end if occursin("-", end_date) end_date = replace(end_date, "-" => "") end parameters = Dict( :lat => lat, :lon => lon, :start_date => start_date, :end_date => end_date, :return_format => return_format, ) forecast_records(parameters) end """ forecast_warnings(parameters::AbstractDict{Symbol,<:Any}) returns a csv created to summarize the potential return period level flow events coming to the reaches in a specified region. The CSV contains a column for the reach_id, lat of the reach, lon of the reach, maximum forecasted flow in the next 15 day forecast, and a column for each of the return periods (2, 10, 20, 25, 50, 100) which will contain the date when the forecast is first expected to pass that threshold """ function forecast_warnings(parameters::AbstractDict{Symbol,<:Any}) endpoint = "ForecastWarnings" r = _make_request(baseurl, endpoint, parameters) _read_response(r, parameters[:return_format]) end """ forecast_warnings(; return_format::Symbol = :csv) returns a csv created to summarize the potential return period level flow events coming to the reaches in a specified region. The CSV contains a column for the reach_id, lat of the reach, lon of the reach, maximum forecasted flow in the next 15 day forecast, and a column for each of the return periods (2, 10, 20, 25, 50, 100) which will contain the date when the forecast is first expected to pass that threshold """ function forecast_warnings(; return_format::Symbol = :csv) parameters = Dict(:return_format => return_format) forecast_warnings(parameters) end """ forecast_warnings(date::TimeType; return_format::Symbol = :csv) returns a csv created to summarize the potential return period level flow events coming to the reaches in a specified region. The CSV contains a column for the reach_id, lat of the reach, lon of the reach, maximum forecasted flow in the next 15 day forecast, and a column for each of the return periods (2, 10, 20, 25, 50, 100) which will contain the date when the forecast is first expected to pass that threshold """ function forecast_warnings(date::TimeType; return_format::Symbol = :csv) datestr = Dates.format(date, "yyyymmdd") parameters = Dict(:date => datestr, :return_format => return_format) forecast_warnings(parameters) end """ forecast_warnings(region::AbstractString; return_format::Symbol = :csv) returns a csv created to summarize the potential return period level flow events coming to the reaches in a specified region. The CSV contains a column for the reach_id, lat of the reach, lon of the reach, maximum forecasted flow in the next 15 day forecast, and a column for each of the return periods (2, 10, 20, 25, 50, 100) which will contain the date when the forecast is first expected to pass that threshold """ function forecast_warnings(region::AbstractString; return_format::Symbol = :csv) parameters = Dict(:region => region, :return_format => return_format) forecast_warnings(parameters) end """ forecast_warnings(region::AbstractString, date::TimeType; return_format::Symbol = :csv) returns a csv created to summarize the potential return period level flow events coming to the reaches in a specified region. The CSV contains a column for the reach_id, lat of the reach, lon of the reach, maximum forecasted flow in the next 15 day forecast, and a column for each of the return periods (2, 10, 20, 25, 50, 100) which will contain the date when the forecast is first expected to pass that threshold """ function forecast_warnings( region::AbstractString, date::TimeType; return_format::Symbol = :csv, ) datestr = Dates.format(date, "yyyymmdd") parameters = Dict( :region => region, :date => datestr, :return_format => return_format, ) forecast_warnings(parameters) end """ forecast_warnings(region::AbstractString, date::AbstractString; return_format::Symbol = :csv) returns a csv created to summarize the potential return period level flow events coming to the reaches in a specified region. The CSV contains a column for the reach_id, lat of the reach, lon of the reach, maximum forecasted flow in the next 15 day forecast, and a column for each of the return periods (2, 10, 20, 25, 50, 100) which will contain the date when the forecast is first expected to pass that threshold """ function forecast_warnings( region::AbstractString, date::AbstractString; return_format::Symbol = :csv, ) if occursin("-", date) date = replace(date, "-" => "") end parameters = Dict( region::AbstractString, :date => date, :return_format => return_format, ) forecast_warnings(parameters) end
[ 2, 2393, 7268, 5050, 329, 20623, 11092, 27785, 422, 402, 4720, 38, 5439, 19416, 198, 37811, 198, 220, 220, 220, 11092, 62, 34242, 7, 17143, 7307, 3712, 23839, 35, 713, 90, 13940, 23650, 11, 27, 25, 7149, 30072, 198, 198, 7783, 82, 7...
2.89991
5,565
import Base.LinAlg: A_mul_B!, At_mul_B, A_ldiv_B! import Tulip: Model, PrimalDualPoint """ solve(model, tol, verbose) Solve model m using an infeasible predictor-corrector Interior-Point algorithm. # Arguments - `model::Model`: the optimization model - `tol::Float64`: numerical tolerance - `verbose::Int`: 0 means no output, 1 displays log at each iteration """ function solve!( model::Model; tol::Float64 = 10.0^-8, verbose::Int = 0 ) model.status = :Built N_ITER_MAX = 100 # maximum number of IP iterations niter = 0 # number of IP iterations # TODO: pre-optimization stuff F = symbolic_cholesky(model.A) # Symbolic factorization θ = zeros(model.sol.x) # X = Array{PrimalDualPoint, 1}() # TODO: check stopping criterion for possible early termination # compute starting point # TODO: decide which starting point compute_starting_point!( model.A, F, model.sol, model.b, model.c, model.uind, model.uval ) # IPM log if verbose == 1 println(" Itn Primal Obj Dual Obj Prim Inf Dual Inf UBnd Inf\n") end # main loop # push!(X, copy(model.sol)) while niter < N_ITER_MAX # I. Form and factor Newton System compute_newton!( model.A, model.sol.x, model.sol.s, model.sol.w, model.sol.z, model.uind, θ, F ) # II. Compute and take step compute_next_iterate!(model, F) # III. Book-keeping + display log # compute residuals rb = model.A * model.sol.x - model.b rc = At_mul_B(model.A, model.sol.y) + model.sol.s - model.c spxpay!(-1.0, rc, model.uind, model.sol.z) ru = model.sol.x[model.uind] + model.sol.w - model.uval obj_primal = dot(model.sol.x, model.c) obj_dual = dot(model.b, model.sol.y) - dot(model.uval, model.sol.z) niter += 1 # check stopping criterion eps_p = (norm(rb)) / (1.0 + norm(model.b)) eps_d = (norm(rc)) / (1.0 + norm(model.c)) eps_u = (norm(ru)) / (1.0 + norm(model.uval)) eps_g = abs(obj_primal - obj_dual) / (1.0 + abs(obj_primal)) # if verbose == 1 # print("\teps_p=") # print(@sprintf("%9.2e", eps_p)) # print("\teps_d=") # print(@sprintf("%9.2e", eps_d)) # print("\teps_u=") # print(@sprintf("%9.2e", eps_u)) # print("\teps_g=") # print(@sprintf("%9.2e", eps_g)) # println("\n") # end if verbose == 1 print(@sprintf("%4d", niter)) # iteration count print(@sprintf("%+18.7e", obj_primal)) # primal objective print(@sprintf("%+16.7e", obj_dual)) # dual objective print(@sprintf("%10.2e", norm(rb, Inf))) # primal infeas print(@sprintf("%9.2e", norm(rc, Inf))) # dual infeas print(@sprintf("%9.2e", norm(ru, Inf))) # upper bound infeas print(@sprintf("%9.2e", abs(obj_primal - obj_dual) / (model.nvars + size(model.uind, 1)))) print("\n") end if (eps_p < tol) && (eps_u < tol) && (eps_d < tol) && (eps_g < tol) model.status = :Optimal end # push!(X, copy(model.sol)) # check status if model.status == :Optimal if verbose == 1 println() println("Optimal solution found.") end return model.status end end # return model.status end """ compute_starting_point! Compute a starting point # Arguments -`model::Model` -`F::Factorization`: Cholesky factor of A*A', where A is the constraint matrix of the optimization problem. """ function compute_starting_point!( A::AbstractMatrix{Tv}, F::Factorization{Tv}, Λ::Tulip.PrimalDualPoint{Tv}, b::StridedVector{Tv}, c::StridedVector{Tv}, uind::StridedVector{Ti}, uval::StridedVector{Tv} ) where{Tv<:Real, Ti<:Integer} (m, n) = size(A) p = size(uind, 1) rhs = - 2 * b u_ = zeros(n) spxpay!(1.0, u_, uind, uval) rhs += A* u_ #==============================# # # I. Solve two QPs # #==============================# # Compute x0 v = F \ rhs copy!(Λ.x, -0.5 * At_mul_B(A, v)) spxpay!(0.5, Λ.x, uind, uval) # Compute w0 @inbounds for i in 1:p j = uind[i] Λ.w[i] = uval[i] - Λ.x[j] end # Compute y0 copy!(Λ.y, F \ (A*c)) # Compute s0 copy!(Λ.s, 0.5 * (At_mul_B(A, Λ.y) - c)) # Compute z0 @inbounds for i in 1:p j = uind[i] Λ.z[i] = - Λ.s[j] end #==============================# # # II. Compute correction # #==============================# dp = zero(Tv) dd = zero(Tv) @inbounds for i in 1:n tmp = -1.5 * Λ.x[i] if tmp > dp dp = tmp end end @inbounds for i in 1:p tmp = -1.5 * Λ.w[i] if tmp > dp dp = tmp end end @inbounds for i in 1:n tmp = -1.5 * Λ.s[i] if tmp > dd dd = tmp end end @inbounds for i in 1:p tmp = -1.5 * Λ.z[i] if tmp > dd dd = tmp end end tmp = dot(Λ.x + dp, Λ.s + dd) + dot(Λ.w + dp, Λ.z + dd) dp += 0.5 * tmp / (sum(Λ.s + dd) + sum(Λ.z + dd)) dd += 0.5 * tmp / (sum(Λ.x + dp) + sum(Λ.w + dp)) #==============================# # # III. Apply correction # #==============================# @inbounds for i in 1:n Λ.x[i] += dp end @inbounds for i in 1:n Λ.s[i] += dd end @inbounds for i in 1:p Λ.w[i] += dp end @inbounds for i in 1:p Λ.z[i] += dd end # Done return Λ end function compute_next_iterate!(model::Model, F::Factorization) (x, y, s, w, z) = (model.sol.x, model.sol.y, model.sol.s, model.sol.w, model.sol.z) (m, n, p) = model.nconstr, model.nvars, size(model.uind, 1) d_aff = copy(model.sol) d_cc = copy(model.sol) # compute residuals μ = ( (dot(x, s) + dot(w, z)) / (n + p) ) rb = (model.A * x) - model.b rc = At_mul_B(model.A, y) + s - model.c spxpay!(-1.0, rc, model.uind, model.sol.z) ru = x[model.uind] + w - model.uval rxs = x .* s rwz = w .* z θ = x ./ s update_theta!(θ, x, s, z, w, model.uind) # compute predictor solve_newton!( model.A, θ, F, model.sol, d_aff, model.uind, -rb, -rc, -ru, -rxs, -rwz ) # compute step length (α_pa, α_da) = compute_stepsize(model.sol, d_aff) # update centrality parameter μ_aff = ( ( dot(x + α_pa * d_aff.x, s + α_da * d_aff.s) + dot(w + α_pa * d_aff.w, z + α_da * d_aff.z) ) / (n + p) ) σ = clamp((μ_aff / μ)^3, 10.0^-12, 1.0 - 10.0^-12) # clamped for numerical stability # compute corrector solve_newton!( model.A, θ, F, model.sol, d_cc, model.uind, zeros(m), zeros(n), zeros(p), σ*μ*ones(n) - d_aff.x .* d_aff.s, σ*μ*ones(p) - d_aff.w .* d_aff.z ) # final step size d = d_aff + d_cc (α_p, α_d) = compute_stepsize(model.sol, d, damp=0.99995) # take step model.sol.x += α_p * d.x model.sol.y += α_d * d.y model.sol.s += α_d * d.s model.sol.w += α_p * d.w model.sol.z += α_d * d.z return model.sol end """ symbolic_cholesky Compute Cholesky factorization of A*A' """ function symbolic_cholesky(A::AbstractMatrix{T}) where {T<:Real} F = Cholesky.cholesky(A, ones(A.n)) return F end """ compute_newton! Form and factorize the Newton system, using the normal equations. """ function compute_newton!( A::AbstractMatrix{Ta}, x::AbstractVector{Tx}, s::AbstractVector{Ts}, w::AbstractVector{Tw}, z::AbstractVector{Tz}, uind::AbstractVector{Ti}, θ::AbstractVector{T}, F::Factorization{Ta} ) where {Ta<:Real, Tx<:Real, Ts<:Real, Tw<:Real, Tz<:Real, Ti<:Integer, T<:Real} # Compute Θ = (X^{-1} S + W^{-1} Z)^{-1} θ = x ./ s for i in 1:size(uind, 1) j = uind[i] θ[j] = 1.0 / (s[j] / x[j] + z[i] / w[i]) end # Form the normal equations matrix and compute its factorization Cholesky.cholesky!(A, θ, F) return θ end """ solve_newton Solve Newton system with the given right-hand side. Overwrites the input d """ function solve_newton!( A::AbstractMatrix{Ta}, θ::AbstractVector{T1}, F::Factorization{Ta}, Λ::PrimalDualPoint, d::PrimalDualPoint, uind::AbstractVector{Ti}, ξ_b::AbstractVector{T2}, ξ_c::AbstractVector{T3}, ξ_u::AbstractVector{T4}, ξ_xs::AbstractVector{T5}, ξ_wz::AbstractVector{T6}, ) where {Ta<:Real, T1<:Real, T2<:Real, T3<:Real, T4<:Real, T5<:Real, T6<:Real, Ti<:Integer} ξ_tmp = ξ_c - (ξ_xs ./ Λ.x) ξ_tmp[uind] += (ξ_wz - (Λ.z .* ξ_u)) ./ Λ.w d.y = F \ (ξ_b + A * (θ .* ξ_tmp)) d.x = θ .* (At_mul_B(A, d.y) - ξ_tmp) d.z = (Λ.z .* (-ξ_u + d.x[uind]) + ξ_wz) ./ Λ.w d.s = (ξ_xs - Λ.s .* d.x) ./ Λ.x d.w = (ξ_wz - Λ.w .* d.z) ./ Λ.z # # check if system is solved correctly # rb = ξ_b - A*d.x # rc = ξ_c - (A'*d.y + d.s) # rc[uind] += d.z # ru = ξ_u - (d.x[uind] + d.w) # rxs = ξ_xs - (Λ.s .* d.x + Λ.x .* d.s) # rwz = ξ_wz - (Λ.z .* d.w + Λ.w .* d.z) # println("Residuals\t(normal eqs)") # println("||rb|| \t", @sprintf("%.6e", maximum(abs.(rb)))) # println("||rc|| \t", @sprintf("%.6e", maximum(abs.(rc)))) # println("||ru|| \t", @sprintf("%.6e", maximum(abs.(ru)))) # println("||rxs|| \t", @sprintf("%.6e", maximum(abs.(rxs)))) # println("||rwz|| \t", @sprintf("%.6e", maximum(abs.(rwz)))) # println() return d end function compute_stepsize( tx::AbstractVector{T}, tw::AbstractVector{T}, ts::AbstractVector{T}, tz::AbstractVector{T}, dx::AbstractVector{T}, dw::AbstractVector{T}, ds::AbstractVector{T}, dz::AbstractVector{T}; damp=1.0 ) where T<:Real n = size(tx, 1) p = size(tw, 1) n == size(ts, 1) || throw(DimensionMismatch("t.s is wrong size")) p == size(tz, 1) || throw(DimensionMismatch("t.z is wrong size")) n == size(dx, 1) || throw(DimensionMismatch("d.x is wrong size")) n == size(ds, 1) || throw(DimensionMismatch("d.s is wrong size")) p == size(dw, 1) || throw(DimensionMismatch("d.w is wrong size")) p == size(dz, 1) || throw(DimensionMismatch("d.z is wrong size")) ap, ad = -1.0, -1.0 @inbounds for i in 1:n if dx[i] < 0.0 if (tx[i] / dx[i]) > ap ap = (tx[i] / dx[i]) end end end @inbounds for i in 1:n if ds[i] < 0.0 if (ts[i] / ds[i]) > ad ad = (ts[i] / ds[i]) end end end @inbounds for j in 1:p if dw[j] < 0.0 if (tw[j] / dw[j]) > ap ap = (tw[j] / dw[j]) end end end @inbounds for j in 1:p if dz[j] < 0.0 if (tz[j] / dz[j]) > ad ad = (tz[j] / dz[j]) end end end ap = - damp * ap ad = - damp * ad # println("\t(ap, ad) = ", (ap, ad)) return (ap, ad) end function compute_stepsize(t::PrimalDualPoint{T}, d::PrimalDualPoint{T}; damp=1.0) where T<:Real (ap, ad) = compute_stepsize(t.x, t.w, t.s, t.z, d.x, d.w, d.s, d.z, damp=damp) return (ap, ad) end function update_theta!(θ, x, s, z, w, colind) # only called from within the optimization, so bounds were checked before for i in 1:size(colind, 1) j = colind[i] θ[j] = 1.0 / (s[j] / x[j] + z[i] / w[i]) end return nothing end """ spxpay!(α, x, y_ind, y_val) In-place computation of x += α * y, where y = sparse(y_ind, y_val) # Arguments """ function spxpay!(α::Tv, x::AbstractVector{Tv}, y_ind::AbstractVector{Ti}, y_val::AbstractVector{Tv}) where{Ti<:Integer, Tv<:Real} for i in 1:size(y_ind, 1) j = y_ind[i] x[j] = x[j] + α * y_val[i] end return nothing end
[ 11748, 7308, 13, 14993, 2348, 70, 25, 198, 220, 220, 220, 317, 62, 76, 377, 62, 33, 28265, 1629, 62, 76, 377, 62, 33, 11, 317, 62, 335, 452, 62, 33, 0, 198, 198, 11748, 30941, 541, 25, 198, 220, 220, 220, 9104, 11, 37712, 3624...
1.872774
6,681
<reponame>simonsobs/ps_py # # [Utilities (util.jl)](@id util) # Unlike every other file in the pipeline, this file is not intended to be run directly. # Instead, include this in other files. These utilities provide an interface to the Planck # data products, namely # 1. binning matrix # 2. beam ``W_{\ell}^{XY} = B_{\ell}^X B_{\ell}^{Y}`` # 3. foreground model cross-spectra # 4. ``\texttt{plic}`` reference covariance matrix and reference spectra, for comparison plots using PowerSpectra using DataFrames, CSV using DelimitedFiles using LinearAlgebra using FITSIO # ## Planck Binning # Planck bins the spectra at the very end, and applies an ``\ell (\ell+1)`` relative # weighting inside the bin. This utility function generates the binning operator # ``P_{b\ell}`` such that ``C_b = P_{b \ell} C_{\ell}``. It also returns the mean of the # left and right bin edges, which is what is used when plotting the Planck spectra. """ util_planck_binning(binfile; lmax=6143) Obtain the Planck binning scheme. ### Arguments: - `binfile::String`: filename of the Planck binning, containing left/right bin edges ### Keywords - `lmax::Int=6143`: maximum multipole for one dimension of the binning matrix ### Returns: - `Tuple{Matrix{Float64}, Vector{Float64}`: returns (binning matrix, bin centers) """ function util_planck_binning(binfile; lmax=6143) bin_df = DataFrame(CSV.File(binfile; header=false, delim=" ", ignorerepeated=true)) lb = (bin_df[:,1] .+ bin_df[:,2]) ./ 2 P = binning_matrix(bin_df[:,1], bin_df[:,2], ℓ -> ℓ*(ℓ+1) / (2π); lmax=lmax) return P, lb[1:size(P,1)] end # ## Planck Beam # The Planck effective beams are azimuthally-averaged window functions induced by the # instrumental optics. This utility function reads the Planck beams from the RIMO, which # are of the form `TT_2_TT`, `TT_2_EE` etc. Conventionally, the Planck spectra are stored # with the diagonal of the beam-mixing matrix applied. # # ```math # C_{\ell} = W^{-1}_{\ell} \hat{C}_{\ell} # ``` """ util_planck_beam_Wl([T::Type=Float64], freq1, split1, freq2, split2, spec1_, spec2_; lmax=4000, beamdir=nothing) Returns the Planck beam transfer of [spec1]_to_[spec2], in Wl form. ### Arguments: - `T::Type=Float64`: optional first parameter specifying numerical type - `freq1::String`: frequency of first field - `split1::String`: split of first field (i.e. hm1) - `freq2::String`: frequency of first field - `split2::String`: split of second field (i.e. hm2) - `spec1_`: converted to string, source spectrum like TT - `spec2_`: converted to string, destination spectrum ### Keywords - `lmax=4000`: maximum multipole - `beamdir=nothing`: directory containing beam FITS files. if nothing, will fall back to the PowerSpectra.jl beam files. ### Returns: - `SpectralVector`: the beam Wl, indexed 0:lmax """ function util_planck_beam_Wl(T::Type, freq1, split1, freq2, split2, spec1_, spec2_; lmax=4000, beamdir=nothing) if isnothing(beamdir) @warn "beam directory not specified. switching to PowerSpectra.jl fallback" beamdir = PowerSpectra.planck256_beamdir() end spec1 = String(spec1_) spec2 = String(spec2_) if parse(Int, freq1) > parse(Int, freq2) freq1, freq2 = freq2, freq1 split1, split2 = split2, split1 end if (freq1 == freq2) && ((split1 == "hm2") && (split2 == "hm1")) split1, split2 = split2, split1 end fname = "Wl_R3.01_plikmask_$(freq1)$(split1)x$(freq2)$(split2).fits" f = FITS(joinpath(beamdir, "BeamWf_HFI_R3.01", fname)) Wl = convert(Vector{T}, read(f[spec1], "$(spec1)_2_$(spec2)")[:,1]) if lmax < 4000 Wl = Wl[1:lmax+1] else Wl = vcat(Wl, last(Wl) * ones(T, lmax - 4000)) end return SpectralVector(Wl) end util_planck_beam_Wl(T::Type, freq1, split1, freq2, split2, spec1; kwargs...) = util_planck_beam_Wl(T, freq1, split1, freq2, split2, spec1, spec1; kwargs...) util_planck_beam_Wl(freq1::String, split1, freq2, split2, spec1, spec2; kwargs...) = util_planck_beam_Wl(Float64, freq1, split1, freq2, split2, spec1, spec2; kwargs...) # ## Planck Likelihood Specifics # The Planck likelihood uses a specific choice of spectra and multipole ranges for those # spectra. We provide some utility functions to retrieve a copy of the spectra order and # the multipole minimum and maximum for those spectra. plic_order() = ( (:TT,"100","100"), (:TT,"143","143"), (:TT,"143","217"), (:TT,"217","217"), (:EE,"100","100"), (:EE,"100","143"), (:EE,"100","217"), (:EE,"143","143"), (:EE,"143","217"), (:EE,"217","217"), (:TE,"100","100"), (:TE,"100","143"), (:TE,"100","217"), (:TE,"143","143"), (:TE,"143","217"), (:TE,"217","217") ) const plic_ellranges = Dict( (:TT, "100", "100") => (30, 1197), (:TT, "143", "143") => (30, 1996), (:TT, "143", "217") => (30, 2508), (:TT, "217", "217") => (30, 2508), (:EE, "100", "100") => (30, 999), (:EE, "100", "143") => (30, 999), (:EE, "100", "217") => (505, 999), (:EE, "143", "143") => (30, 1996), (:EE, "143", "217") => (505, 1996), (:EE, "217", "217") => (505, 1996), (:TE, "100", "100") => (30, 999), (:TE, "100", "143") => (30, 999), (:TE, "100", "217") => (505, 999), (:TE, "143", "143") => (30, 1996), (:TE, "143", "217") => (505, 1996), (:TE, "217", "217") => (505, 1996), (:TT, "100", "143") => (30, 999), # not used (:TT, "100", "217") => (505, 999), # not used ) function get_plic_ellrange(spec::Symbol, freq1, freq2) if spec ∈ (:TE, :ET) if parse(Float64, freq1) > parse(Float64, freq2) freq1, freq2 = freq2, freq1 end return plic_ellranges[:TE, freq1, freq2] end return plic_ellranges[spec, freq1, freq2] end # ## Signal Spectra # The covariance matrix calculation and and signal simulations require an assumed signal # spectra. We use the same foreground spectra as used in the ``\text{plic}`` likelihood. # This returns dictionaries for signal and theory ``C_{\ell}`` in ``\mu\mathrm{K}`` # between two frequencies. The data is stored in the `plicref` directory in the config. function signal_and_theory(freq1, freq2, config::Dict) likelihood_data_dir = joinpath(config["scratch"], "plicref") th = read_commented_header(joinpath(likelihood_data_dir,"theory_cl.txt")) fg = read_commented_header(joinpath(likelihood_data_dir, "base_plikHM_TTTEEE_lowl_lowE_lensing.minimum.plik_foregrounds")) for (spec, f1, f2) in plic_order() lmin, lmax = get_plic_ellrange(spec, f1, f2) const_val = fg[lmax-1,"$(spec)$(f1)X$(f2)"] ## constant foreground level after lmax -- there are fitting artifacts otherwise fg[(lmax-1):end, "$(spec)$(f1)X$(f2)"] .= const_val end ## loop over spectra and also fill in the flipped name freqs = ("100", "143", "217") specs = ("TT", "TE", "ET", "EE") for f1 in freqs, f2 in freqs, spec in specs if "$(spec)$(f1)X$(f2)" ∉ names(fg) if "$(reverse(spec))$(f2)X$(f1)" ∈ names(fg) fg[!, "$(spec)$(f1)X$(f2)"] = fg[!, "$(reverse(spec))$(f2)X$(f1)"] else fg[!, "$(spec)$(f1)X$(f2)"] = zeros(nrow(fg)) end end end ap(v) = vcat([0., 0.], v) ell_fac = fg[!, "l"] .* (fg[!, "l"] .+ 1) ./ (2π); signal_dict = Dict{String,Vector{Float64}}() theory_dict = Dict{String,Vector{Float64}}() for XY₀ in specs ## XY₀ is the spectrum to store f₁, f₂ = parse(Int, freq1), parse(Int, freq2) if f₁ <= f₂ XY = XY₀ else ## swap what we're looking for, as fg data only has those cross-spectra XY = XY₀[2] * XY₀[1] f₁, f₂ = f₂, f₁ end if XY == "ET" theory_cl_XY = th[!, "TE"] ./ (th[!, "L"] .* (th[!, "L"] .+ 1) ./ (2π)) else theory_cl_XY = th[!, XY] ./ (th[!, "L"] .* (th[!, "L"] .+ 1) ./ (2π)) end fg_cl_XY = fg[!, "$(XY)$(f₁)X$(f₂)"] ./ (fg[!, "l"] .* (fg[!, "l"] .+ 1) ./ (2π)) signal_dict[XY₀] = ap(theory_cl_XY .+ fg_cl_XY[1:2507]) theory_dict[XY₀] = ap(theory_cl_XY) end return signal_dict, theory_dict end # ## Planck ``\texttt{plic}`` Reference # In various parts of the pipeline, we want to compare our results to the official 2018 # data release. These routines load them from disk. They're automatically downloaded to the # `plicref` directory specified in the configuration TOML. """ PlanckReferenceCov(plicrefpath::String) Stores the spectra and covariances of the reference plic analysis. """ PlanckReferenceCov struct PlanckReferenceCov{T} cov::Array{T,2} ells::Vector{Int} cls::Vector{T} keys::Vector{String} sub_indices::Vector{Int} key_index_dict::Dict{String,Int} end function PlanckReferenceCov(plicrefpath) ellspath = joinpath(plicrefpath, "vec_all_spectra.dat") clpath = joinpath(plicrefpath, "data_extracted.dat") covpath = joinpath(plicrefpath, "covmat.dat") keys = ["<KEY>", "TT_143x143", "TT_143x217", "TT_217x217", "EE_100x100", "EE_100x143", "EE_100x217", "EE_143x143", "EE_143x217", "EE_217x217", "TE_100x100", "TE_100x143", "TE_100x217", "TE_143x143", "TE_143x217", "TE_217x217"] cov = inv(readdlm(covpath)) ells = readdlm(ellspath)[:,1] cls = readdlm(clpath)[:,2] subarray_indices = collect(0:(size(cov,1)-2))[findall(diff(ells) .< 0) .+ 1] .+ 1 sub_indices = [1, subarray_indices..., length(cls)+1] key_ind = 1:length(keys) key_index_dict = Dict(keys .=> key_ind) return PlanckReferenceCov{Float64}(cov, ells, cls, keys, sub_indices, key_index_dict) end """ get_subcov(pl::PlanckReferenceCov, spec1, spec2) Extract the sub-covariance matrix corresponding to spec1 × spec2. ### Arguments: - `pl::PlanckReferenceCov`: data structure storing reference covmat and spectra - `spec1::String`: spectrum of form i.e. "TT_100x100" - `spec2::String`: spectrum of form i.e. "TT_100x100" ### Returns: - `Matrix{Float64}`: subcovariance matrix """ function get_subcov(pl::PlanckReferenceCov, spec1, spec2) i = pl.key_index_dict[spec1] j = pl.key_index_dict[spec2] return pl.cov[ pl.sub_indices[i] : (pl.sub_indices[i + 1] - 1), pl.sub_indices[j] : (pl.sub_indices[j + 1] - 1), ] end """ extract_spec_and_cov(pl::PlanckReferenceCov, spec1) Extract the reference ells, cl, errorbar, and sub-covariance block for a spectrum × itself. ### Arguments: - `pl::PlanckReferenceCov`: data structure storing reference covmat and spectra - `spec1::String`: spectrum of form i.e. "TT_100x100" ### Returns: - `(ells, cl, err, this_subcov)` """ function extract_spec_and_cov(pl::PlanckReferenceCov, spec1) i = pl.key_index_dict[spec1] this_subcov = get_subcov(pl, spec1, spec1) ells = pl.ells[pl.sub_indices[i]:(pl.sub_indices[i + 1] - 1)] cl = pl.cls[pl.sub_indices[i]:(pl.sub_indices[i + 1] - 1)] err = sqrt.(diag(this_subcov)) return ells, cl, err, this_subcov end
[ 27, 7856, 261, 480, 29, 14323, 26666, 1443, 14, 862, 62, 9078, 198, 2, 1303, 685, 18274, 2410, 357, 22602, 13, 20362, 15437, 7, 31, 312, 7736, 8, 198, 2, 12101, 790, 584, 2393, 287, 262, 11523, 11, 428, 2393, 318, 407, 5292, 284, ...
2.280418
4,882
using Revise using AdFem using PyCall using LinearAlgebra using PyPlot using SparseArrays using MAT np = pyimport("numpy") λ = 2.0 μ = 0.5 η = 1/12 β = 1/4; γ = 1/2 a = b = 0.1 m = 10 n = 5 h = 0.01 NT = 20 Δt = 1/NT bdedge = [] for j = 1:n push!(bdedge, [(j-1)*(m+1)+m+1 j*(m+1)+m+1]) end bdedge = vcat(bdedge...) bdnode = Int64[] for j = 1:n+1 push!(bdnode, (j-1)*(m+1)+1) end G = [1/Δt+μ/η -μ/3η 0.0 -μ/3η 1/Δt+μ/η-μ/3η 0.0 0.0 0.0 1/Δt+μ/η] S = [2μ/Δt+λ/Δt λ/Δt 0.0 λ/Δt 2μ/Δt+λ/Δt 0.0 0.0 0.0 μ/Δt] invG = inv(G) H = invG*S M = compute_fem_mass_matrix1(m, n, h) Zero = spzeros((m+1)*(n+1), (m+1)*(n+1)) M = [M Zero;Zero M] K = compute_fem_stiffness_matrix(H, m, n, h) C = a*M + b*K # damping matrix L = M + γ*Δt*C + β*Δt^2*K L, Lbd = fem_impose_Dirichlet_boundary_condition(L, bdnode, m, n, h) Forces = zeros(NT, 2(m+1)*(n+1)) for i = 1:NT T = eval_f_on_boundary_edge((x,y)->0.1, bdedge, m, n, h) T = [T zeros(length(T))] rhs = compute_fem_traction_term(T, bdedge, m, n, h) if i*Δt>0.5 rhs = zero(rhs) end Forces[i, :] = rhs end a = zeros(2(m+1)*(n+1)) v = zeros(2(m+1)*(n+1)) d = zeros(2(m+1)*(n+1)) U = zeros(2(m+1)*(n+1),NT+1) Sigma = zeros(NT+1, 4m*n, 3) Varepsilon = zeros(NT+1, 4m*n, 3) for i = 1:NT @info i global a, v, d F = compute_strain_energy_term(Sigma[i,:,:]*invG/Δt, m, n, h) - K * U[:,i] # @show norm(compute_strain_energy_term(Sigma[i,:,:]*invG/Δt, m, n, h)), norm(K * U[:,i]) rhs = Forces[i,:] - Δt^2 * F td = d + Δt*v + Δt^2/2*(1-2β)*a tv = v + (1-γ)*Δt*a rhs = rhs - C*tv - K*td rhs[[bdnode; bdnode.+(m+1)*(n+1)]] .= 0.0 a = L\rhs d = td + β*Δt^2*a v = tv + γ*Δt*a U[:,i+1] = d Varepsilon[i+1,:,:] = eval_strain_on_gauss_pts(U[:,i+1], m, n, h) Sigma[i+1,:,:] = Sigma[i,:,:]*invG/Δt + (Varepsilon[i+1,:,:]-Varepsilon[i,:,:])*(invG*S) end matwrite("U.mat", Dict("U"=>U'|>Array)) # visualize_displacement(U, m, n, h; name = "_eta$η", xlim_=[-0.01,0.5], ylim_=[-0.05,0.22]) # visualize_displacement(U, m, n, h; name = "_viscoelasticity") # visualize_stress(H, U, m, n, h; name = "_viscoelasticity") close("all") figure(figsize=(15,5)) subplot(1,3,1) idx = div(n,2)*(m+1) + m+1 plot((0:NT)*Δt, U[idx,:]) xlabel("time") ylabel("\$u_x\$") subplot(1,3,2) idx = 4*(div(n,2)*m + m) plot((0:NT)*Δt, Sigma[:,idx,1]) xlabel("time") ylabel("\$\\sigma_{xx}\$") subplot(1,3,3) idx = 4*(div(n,2)*m + m) plot((0:NT)*Δt, Varepsilon[:,idx,1]) xlabel("time") ylabel("\$\\varepsilon_{xx}\$") savefig("visco_eta$η.png")
[ 3500, 5416, 786, 198, 3500, 1215, 37, 368, 198, 3500, 9485, 14134, 198, 3500, 44800, 2348, 29230, 198, 3500, 9485, 43328, 198, 3500, 1338, 17208, 3163, 20477, 198, 3500, 36775, 198, 37659, 796, 12972, 11748, 7203, 77, 32152, 4943, 198, ...
1.679868
1,515
<reponame>itsdfish/Minesweeper.jl<filename>src/Game.jl """ Cell(;has_mine=false, flagged=false, revealed=false, mine_count=0, idx=(0,0)) Cell represents the state of a cell in Minesweeper - `has_mine`: true if cell contains a mine - `flagged`: true if cell has been flagged as having a mine - `revealed`: true if the cell has been revealed - `mine_count`: number of mines in adjecent cells - `idx`: Cartesian indices of cell """ mutable struct Cell has_mine::Bool flagged::Bool revealed::Bool mine_count::Int idx::CartesianIndex end function Cell(;has_mine=false, flagged=false, revealed=false, mine_count=0, idx=(0,0)) coords = CartesianIndex(idx) return Cell(has_mine, flagged, revealed, mine_count, coords) end """ Game(;dims=(12,12), n_mines=40, mines_flagged=0, mine_detonated=false, trials=0) Minesweeper game object - `cells`: an array of cells - `dims`: a Tuple indicating dimensions of cell array - `n_mines`: number of mines in the game - `mines_flagged`: number of mines flagged - `mine_detonated`: indicates whether a mine has been detonated - `score`: score for game, which includes hits, misses, false alarms and correct rejections - `trials`: the number of trials or moves """ mutable struct Game{T} cells::Array{Cell,2} dims::Tuple{Int,Int} n_mines::Int mines_flagged::Int mine_detonated::Bool score::T trials::Int end function Game(;dims=(12,12), n_mines=40, mines_flagged=0, mine_detonated=false, trials=0) score = (hits=0.0,false_alarms=0.0,misses=0.0,correct_rejections=0.0) cells = initilize_cells(dims) add_mines!(cells, n_mines) mine_count!(cells) return Game(cells, dims, n_mines, mines_flagged, mine_detonated, score, trials) end function initilize_cells(dims) return [Cell(idx=(r,c)) for r in 1:dims[1], c in 1:dims[2]] end function add_mines!(cells, n_mines) mines = sample(cells, n_mines, replace=false) for m in mines m.has_mine = true end return nothing end """ mine_count!(cells) For each cell, omputes the number of neighboring cells containing a mine. """ function mine_count!(cells) for cell in cells neighbors = get_neighbors(cells, cell.idx) cell.mine_count = count(x->x.has_mine, neighbors) end return nothing end get_neighbors(game::Game, idx) = get_neighbors(game.cells, idx.I...) get_neighbors(game::Game, cell::Cell) = get_neighbors(game.cells, cell.idx.I...) get_neighbors(game::Game, x, y) = get_neighbors(game.cells, x, y) get_neighbors(cells, idx) = get_neighbors(cells, idx.I...) function get_neighbors(cells, xr, yr) v = [-1,0,1] X = xr .+ v; Y = yr .+ v neighbors = Vector{Cell}() for y in Y, x in X (x == xr) && (y == yr) ? (continue) : nothing in_bounds(cells, x, y) ? push!(neighbors, cells[x,y]) : nothing end return neighbors end get_neighbor_indices(game::Game, idx) = get_neighbor_indices(game.cells, idx.I...) get_neighbor_indices(game::Game, x, y) = get_neighbor_indices(game.cells, x, y) get_neighbor_indices(cells, idx) = get_neighbor_indices(cells, idx.I...) function get_neighbor_indices(cells, xr, yr) v = [-1,0,1] X = xr .+ v; Y = yr .+ v neighbors = Vector{CartesianIndex}() for y in Y, x in X (x == xr) && (y == yr) ? (continue) : nothing in_bounds(cells, x, y) ? push!(neighbors, CartesianIndex(x,y)) : nothing end return neighbors end function in_bounds(cells, x, y) if (x < 1) || (y < 1) return false elseif (x > size(cells, 1)) || (y > size(cells, 2)) return false else return true end end reveal_zeros!(game::Game, x, y) = reveal_zeros!(game.cells, CartesianIndex(x, y)) reveal_zeros!(game::Game, idx) = reveal_zeros!(game.cells, idx) function reveal_zeros!(cells, idx) cells[idx].mine_count ≠ 0 ? (return nothing) : nothing indices = get_neighbor_indices(cells, idx) for i in indices c = cells[i] if !c.has_mine && !c.revealed c.revealed = true c.mine_count == 0 ? reveal_zeros!(cells, i) : nothing end end return nothing end reveal(game::Game) = reveal(game.cells::Array{Cell,2}) """ reveal(cells::Array{Cell,2}) Reveals game state in REPL """ function reveal(cells::Array{Cell,2}) s = "" for x in 1:size(cells,1) for y in 1:size(cells,2) c = cells[x,y] if c.has_mine s *= string(" ", "💣", " ") else s *= string(" ", c.mine_count, " ") end end s *= "\r\n" end println(s) end Base.show(io::IO, game::Game) = Base.show(io::IO, game.cells) function Base.show(io::IO, cells::Array{Cell,2}) s = "" for x in 1:size(cells,1) for y in 1:size(cells,2) c = cells[x,y] if c.flagged s *= string(" ", "🚩", " ") continue end if c.revealed if c.has_mine s *= string(" ", "💣", " ") continue end if c.mine_count == 0 s *= string(" ", "∘", " ") else s *= string(" ", c.mine_count, " ") end else s *= string(" ", "■", " ") end end s *= "\r\n" end println(s) end """ game_over(game) Terminates game if mine is detonated or all cells have been revealed or flagged. """ function game_over(game) if game.mine_detonated return true end return all(x->x.revealed || x.flagged, game.cells) end """ compute_score!(game) Computes hits, false alarms, misses and correct rejections """ function compute_score!(game) cells = game.cells n_mines = game.n_mines no_mines = prod(game.dims) - n_mines hits = count(x->x.flagged && x.has_mine, cells) misses = n_mines - hits false_alarms = count(x->x.flagged && !x.has_mine, cells) cr = no_mines - false_alarms game.score = (hits=hits,false_alarms=false_alarms,misses=misses,correct_rejections=cr) return nothing end """ select_cell!(game, x, y) Select cell given a game and row and column indices. """ select_cell!(game, x, y) = select_cell!(game, CartesianIndex(x, y)) """ select_cell!(game, x, y) Select cell given a game and cell object. """ select_cell!(game, cell::Cell) = select_cell!(game, cell.idx) """ select_cell!(game, idx) Select cell given a game and Cartesian index. """ function select_cell!(game, idx) cell = game.cells[idx] cell.revealed = true reveal_zeros!(game, idx) game.mine_detonated = cell.has_mine return nothing end function flag_cell!(cell, game, gui::Nothing) cell.flagged = true game.mines_flagged += 1 return nothing end function setup() println("Select Difficulty") waiting = true levels = [20,50,70] i = 0 while waiting d = input("1: easy 2: medium, 3: difficult") i = parse(Int, d) if i ∉ 1:3 println("Please select 1, 2, or 3") else waiting = false end end return Game(;dims=(15,15), n_mines=levels[i]) end function play() game = setup() play(game) end """ play(game) Play Minesweeper in REPL Run play() to use with default easy, medium and difficult settings Pass game object to play custom game Enter exit to quit Enter row_index column_index to select cell (e.g. 1 2) """ function play(game) playing = true coords = fill(0, 2) println(game) while playing str = input("select coordinates") str == "exit" ? (return) : nothing try coords = parse.(Int, split(str, " ")) catch error("Please give x and y coordinates e.g. 3 2") end select_cell!(game, coords...) if game.mine_detonated reveal(game) println("Game Over") println(" ") d = input("Press y to play again") d == "y" ? (game = setup()) : (playing = false) else println(game) end end end function input(prompt) println(prompt) return readline() end """ update!(game, gui::Nothing) `update!` is used to display game state during simulations. `update!` can be used with REPL or Gtk GUI if imported via import_gui() """ function update!(game, gui::Nothing) println(game) end """ imports Gtk related code for the GUI """ function import_gui() path = @__DIR__ include(path*"/Gtk_Gui.jl") end
[ 27, 7856, 261, 480, 29, 896, 7568, 680, 14, 44, 1127, 732, 5723, 13, 20362, 27, 34345, 29, 10677, 14, 8777, 13, 20362, 198, 37811, 198, 220, 220, 220, 12440, 7, 26, 10134, 62, 3810, 28, 9562, 11, 34060, 28, 9562, 11, 4602, 28, 9...
2.217022
3,889
<filename>bin/run_equilibration.jl #!/usr/bin/env julia using DelimitedFiles using WaterMeanMeanForce using ArgParse s = ArgParseSettings() s.autofix_names = true models = join(list_models(), ", ") integrators = join(list_integrators(), ", ") @add_arg_table! s begin "--model" metavar = "M" range_tester = in(list_models()) help = "water model ($(models))" required = true "--integrator" metavar = "I" range_tester = in(list_integrators()) help = "molecular dynamics integrator ($(integrators))" required = true "-T" metavar = "T" help = "temperature (K)" arg_type = Float64 required = true "-R" metavar = "R" help = "constraint/restraint distance (nm)" arg_type = Float64 required = true "--num-links" metavar = "P" help = "number of Trotter links" arg_type = Int required = true "--time-step" metavar = "T" help = "time step (ps)" arg_type = Float64 required = true "--centroid-friction" metavar = "G" help = "centroid friction (1 / ps)" arg_type = Float64 required = true "--equil-duration" metavar = "D" help = "duration of equilibration (ps)" arg_type = Float64 required = true "--umbrella-k" metavar = "K" help = "umbrella sampling force constant (kJ / nm^2 mol)" arg_type = Float64 "--initial-configuration" metavar = "FILE" help = "path to initial configuration input file" "--final-configuration" metavar = "FILE" help = "path to final configuration output file" end c = parse_args(ARGS, s, as_symbols=true) if !isnothing(c[:initial_configuration]) qs_init = dropdims(readdlm(c[:initial_configuration]); dims=2) else qs_init = nothing end mdp_equil = MolecularDynamicsParameters(c[:centroid_friction], c[:time_step], c[:equil_duration]) if isnothing(c[:umbrella_k]) s = run_constrained_equilibration(get_model(c[:model]), get_integrator(c[:integrator]), 2, c[:T], c[:R], c[:num_links], mdp_equil; qs_init) else s = run_restrained_equilibration(get_model(c[:model]), get_integrator(c[:integrator]), 2, c[:T], c[:R], c[:num_links], mdp_equil, c[:umbrella_k]; qs_init) end if !isnothing(c[:final_configuration]) writedlm(c[:final_configuration], s.qs) end
[ 27, 34345, 29, 8800, 14, 5143, 62, 4853, 22282, 1358, 13, 20362, 198, 2, 48443, 14629, 14, 8800, 14, 24330, 474, 43640, 198, 198, 3500, 4216, 320, 863, 25876, 198, 198, 3500, 5638, 5308, 272, 5308, 272, 10292, 198, 198, 3500, 20559, ...
1.981495
1,351
<reponame>langfzac/Limbdark.jl<filename>src/deprecated/integrate_transit_cubature.jl # This is code for computing a transit model and derivatives integrated over # a time step, giving the fluence in units of time (since # flux is normalized to unity). using Cubature include("transit_poly_struct.jl") # Now the version with derivatives: function integrate_timestep_gradient!(param::Array{T,1},trans::Transit_Struct{T},t1::T,t2::T,tol::T,maxdepth::Int64) where {T <: Real} function fill_flux!(tmid::T,fmid0::T,trans_mid::Transit_Struct{T}) where {T <: Real} fmid = Array{T}(6+trans_mid.n) fmid[1] = fmid0 # flux fmid[2] = trans_mid.dfdrb[1] # r derivative fmid[3] = trans_mid.dfdrb[2]/trans_mid.b*param[2]^2*(param[1]-tmid) # t0 derivative fmid[4] = trans_mid.dfdrb[2]*param[2]/trans_mid.b*(tmid-param[1])^2 # v derivative fmid[5] = trans_mid.dfdrb[2]*param[3]/trans_mid.b # b0 derivative @inbounds for i=1:trans_mid.n+1 fmid[5+i] = trans_mid.dfdg[i] # d_i derivatives end return fmid end function solver(time::T) where {T <: Real} # This predicts the impact parameter as a function of time in # terms of the transit_struct. # For now, transit is approximated as a straight line, where params are given as: # param[1] = t0 (mid-transit time; units of days/JD) # param[2] = v/R_* (sky velocity in terms of radius of the star - units are day^{-1} # param[3] = b (impact parameter at time t0) return sqrt(param[3]^2+(param[2]*(time-param[1]))^2) end # Function to define the vector integration in cubature: function transit_flux_derivative(tmid::T,fmid::Array{T,1}) where {T <: Real} trans.b = solver(tmid) fmid0 = transit_poly_d!(trans) fmid .= fill_flux!(tmid,fmid0,trans) # println("b: ",trans.b," f/df: ",fmid) return end fint,ferr = hquadrature(trans.n+6,transit_flux_derivative,t1,t2,abstol=tol) return fint end
[ 27, 7856, 261, 480, 29, 17204, 69, 49897, 14, 43, 14107, 21953, 13, 20362, 27, 34345, 29, 10677, 14, 10378, 31023, 14, 18908, 4873, 62, 7645, 270, 62, 66, 549, 1300, 13, 20362, 198, 2, 770, 318, 2438, 329, 14492, 257, 11168, 2746, ...
2.473203
765
<gh_stars>1-10 function update_gam!(i::Int, n::Int, j::Int, s::State, c::Constants, d::Data) k = s.lam[i][n] if k > 0 z = s.Z[j, k] logpriorVec = log.(s.eta[z][i, j, :]) loglikeVec = logpdf.(Normal.(mus(z, s, c, d), sqrt(s.sig2[i])), s.y_imputed[i][n, j]) logPostVec = logpriorVec .+ loglikeVec s.gam[i][n, j] = MCMC.wsample_logprob(logPostVec) else s.gam[i][n, j] = 0 end end function update_gam!(s::State, c::Constants, d::Data) for i in 1:d.I for j in 1:d.J for n in 1:d.N[i] update_gam!(i, n, j, s, c, d) end end end end
[ 27, 456, 62, 30783, 29, 16, 12, 940, 198, 8818, 4296, 62, 28483, 0, 7, 72, 3712, 5317, 11, 299, 3712, 5317, 11, 474, 3712, 5317, 11, 264, 3712, 9012, 11, 269, 3712, 34184, 1187, 11, 288, 3712, 6601, 8, 198, 220, 479, 796, 264, ...
1.835404
322
using Documenter, Jets, LinearAlgebra, Random makedocs( sitename="Jets.jl", modules=[Jets], pages = [ "index.md", "reference.md" ] ) deploydocs( repo = "github.com/ChevronETC/Jets.jl.git" )
[ 3500, 16854, 263, 11, 14728, 11, 44800, 2348, 29230, 11, 14534, 198, 198, 76, 4335, 420, 82, 7, 198, 220, 220, 220, 1650, 12453, 2625, 41, 1039, 13, 20362, 1600, 198, 220, 220, 220, 13103, 41888, 41, 1039, 4357, 198, 220, 220, 220, ...
2.26087
92
module test_stdlib_statistics using Statistics, Test X = rand(5) @test cor(X, 2X) == 1.0 @test cov(X, 2X) - cov(X, X) == var(X) end # module test_stdlib_statistics
[ 21412, 1332, 62, 19282, 8019, 62, 14269, 3969, 198, 198, 3500, 14370, 11, 6208, 198, 198, 55, 796, 43720, 7, 20, 8, 198, 198, 31, 9288, 1162, 7, 55, 11, 362, 55, 8, 6624, 352, 13, 15, 198, 31, 9288, 39849, 7, 55, 11, 362, 55, ...
2.333333
72
# Dispatchable and non-dispatchable generators ## Expressions "Curtailed power of a non-dispatchable generator as the difference between its reference power and the generated power." function expression_gen_curtailment(pm::_PM.AbstractPowerModel; nw::Int=_PM.nw_id_default, report::Bool=true) pgcurt = _PM.var(pm, nw)[:pgcurt] = Dict{Int,Any}( i => ndgen["pmax"] - _PM.var(pm,nw,:pg,i) for (i,ndgen) in _PM.ref(pm,nw,:ndgen) ) if report _IM.sol_component_fixed(pm, _PM.pm_it_sym, nw, :gen, :pgcurt, _PM.ids(pm, nw, :dgen), 0.0) _PM.sol_component_value(pm, nw, :gen, :pgcurt, _PM.ids(pm, nw, :ndgen), pgcurt) end end
[ 2, 35934, 540, 290, 1729, 12, 6381, 17147, 540, 27298, 628, 198, 2235, 10604, 507, 198, 198, 1, 34, 3325, 6255, 1176, 286, 257, 1729, 12, 6381, 17147, 540, 17301, 355, 262, 3580, 1022, 663, 4941, 1176, 290, 262, 7560, 1176, 526, 198...
2.256849
292
# --- # title: 1545. Find Kth Bit in Nth Binary String # id: problem1545 # author: <NAME> # date: 2020-10-31 # difficulty: Medium # categories: String # link: <https://leetcode.com/problems/find-kth-bit-in-nth-binary-string/description/> # hidden: true # --- # # Given two positive integers `n` and `k`, the binary string `Sn` is formed as # follows: # # * `S1 = "0"` # * `Si = Si-1 + "1" + reverse(invert(Si-1))` for `i > 1` # # Where `+` denotes the concatenation operation, `reverse(x)` returns the # reversed string x, and `invert(x)` inverts all the bits in x (0 changes to 1 # and 1 changes to 0). # # For example, the first 4 strings in the above sequence are: # # * `S1 = "0"` # * `S2 = "0 **1** 1"` # * `S3 = "011 **1** 001"` # * `S4 = "0111001 **1** 0110001"` # # Return _the_ `kth` _bit_ _in_ `Sn`. It is guaranteed that `k` is valid for # the given `n`. # # # # **Example 1:** # # # # Input: n = 3, k = 1 # Output: "0" # Explanation: S3 is " ** _0_** 111001". The first bit is "0". # # # **Example 2:** # # # # Input: n = 4, k = 11 # Output: "1" # Explanation: S4 is "0111001101 ** _1_** 0001". The 11th bit is "1". # # # **Example 3:** # # # # Input: n = 1, k = 1 # Output: "0" # # # **Example 4:** # # # # Input: n = 2, k = 3 # Output: "1" # # # # # **Constraints:** # # * `1 <= n <= 20` # * `1 <= k <= 2n - 1` # # ## @lc code=start using LeetCode ## add your code here: ## @lc code=end
[ 2, 11420, 198, 2, 3670, 25, 1315, 2231, 13, 9938, 509, 400, 4722, 287, 399, 400, 45755, 10903, 198, 2, 4686, 25, 1917, 1314, 2231, 198, 2, 1772, 25, 1279, 20608, 29, 198, 2, 3128, 25, 12131, 12, 940, 12, 3132, 198, 2, 8722, 25, ...
2.064257
747
<filename>src/Helpers.jl """copy a FEFunction on a FE Space""" clone_fe_function(space,f)=FEFunction(space,copy(get_free_dof_values(f))) """ Given an arbitrary number of FEFunction arguments, returns a tuple with their corresponding free DoF Values """ function Gridap.get_free_dof_values(functions...) map(get_free_dof_values,functions) end function setup_mixed_spaces(model, order) reffe_rt = ReferenceFE(raviart_thomas, Float64, order) V = FESpace(model, reffe_rt ; conformity=:HDiv) U = TrialFESpace(V) reffe_lgn = ReferenceFE(lagrangian, Float64, order) Q = FESpace(model, reffe_lgn; conformity=:L2) P = TrialFESpace(Q) reffe_lgn = ReferenceFE(lagrangian, Float64, order+1) S = FESpace(model, reffe_lgn; conformity=:H1) R = TrialFESpace(S) R, S, U, V, P, Q end function setup_and_factorize_mass_matrices(dΩ, R, S, U, V, P, Q; mass_matrix_solver=BackslashSolver()) amm(a,b) = ∫(a⋅b)dΩ H1MM = assemble_matrix(amm, R, S) RTMM = assemble_matrix(amm, U, V) L2MM = assemble_matrix(amm, P, Q) ssH1MM = symbolic_setup(mass_matrix_solver,H1MM) nsH1MM = numerical_setup(ssH1MM,H1MM) ssRTMM = symbolic_setup(mass_matrix_solver,RTMM) nsRTMM = numerical_setup(ssRTMM,RTMM) ssL2MM = symbolic_setup(mass_matrix_solver,L2MM) nsL2MM = numerical_setup(ssL2MM,L2MM) H1MM, RTMM, L2MM, nsH1MM, nsRTMM, nsL2MM end function new_vtk_step(Ω,file,_cellfields) n = size(_cellfields)[1] createvtk(Ω, file, cellfields=_cellfields, nsubcells=n) end
[ 27, 34345, 29, 10677, 14, 12621, 19276, 13, 20362, 198, 37811, 30073, 257, 18630, 22203, 319, 257, 18630, 4687, 37811, 198, 21018, 62, 5036, 62, 8818, 7, 13200, 11, 69, 47505, 15112, 22203, 7, 13200, 11, 30073, 7, 1136, 62, 5787, 62, ...
2.129458
757
<reponame>kdyrhage/GenomicAnnotations.jl using GenomicAnnotations using BioSequences using Test @testset "GenomicAnnotations" begin @testset "GenBank parsing" begin s = " gene 1..1" @test GenBank.parseposition(s) == (:gene, Locus(1:1, '+')) s = " gene complement(order(3300..4037,4047..4052))" @test GenBank.parseposition(s) == (:gene, Locus(3300:4052, '-', true, true, UnitRange{Int}[3300:4037, 4047:4052], false)) chrs = collect(open(GenBank.Reader, "example.gbk")) @test length(chrs) == 2 @test chrs[2].name == "plasmid1" end chr = collect(open(GenBank.Reader, "example.gbk"))[1] @testset "GFF parsing" begin open(GFF.Writer, "example.gff") do w write(w, chr) end gff = collect(open(GFF.Reader, "example.gff"))[1] @test begin gbkbuf = IOBuffer() gffbuf = IOBuffer() print(gbkbuf, chr.genes[2:4]) print(gffbuf, gff.genes[2:4]) String(take!(gbkbuf)) == String(take!(gffbuf)) end end @testset "Extended methods" begin @test length(chr.genes[1]) == length(sequence(chr.genes[1])) @test length(chr.sequence) == length(sequence(chr)) end @testset "Gene properties" begin @test length(propertynames(chr.genes[1])) == 12 @test chr.genes[2].locus_tag == "tag01" @test (chr.genes[2].locus_tag = "tag01") == "tag01" @test begin chr.genes[2].test = "New column" chr.genes[2].test == "New column" && all(ismissing, chr.genes[[1,3,4,5,6]].test) end @test get(chr.genes[1], :locus_tag, "") == "" @test get(chr.genes[2], :locus_tag, "") == "tag01" @test get(chr.genes[2], :locustag, "") == "" @test begin GenomicAnnotations.pushproperty!(chr.genes[2], :db_xref, "GI:123") chr.genes[2].db_xref == ["GI:1293614", "GI:123"] end @test GenomicAnnotations.vectorise(Union{Missing,Int}[1,1,1]) == [[1],[1],[1]] end @testset "Iteration" begin @test length([g.locus_tag for g in chr.genes]) == 7 end @testset "Adding/removing genes" begin addgene!(chr, :CDS, Locus(300:390, '+'), locus_tag = "tag04") @test chr.genes[end].locus_tag == "tag04" delete!(chr.genes[end]) @test chr.genes[end].locus_tag == "reg01" end @testset "@genes" begin @test length(union(@genes(chr, CDS), @genes(chr, !CDS))) == length(chr.genes) @test length(intersect(@genes(chr, CDS), @genes(chr, !CDS))) == 0 @test length(union(@genes(chr, gene), @genes(chr, !gene))) == length(chr.genes) @test length(intersect(@genes(chr, gene), @genes(chr, !gene))) == 0 @test length(@genes(chr)) == length(chr.genes) @test @genes(chr, feature(gene) == $:CDS) == chr.genes[[2,4,6]] @test @genes(chr, feature(gene) == $:CDS) == @genes(chr, CDS) @test @genes(chr, iscomplement(gene)) == chr.genes[[5,6,7]] @test @genes(chr, feature(gene) == $:CDS, !iscomplement(gene)) == chr.genes[[2,4]] @test @genes(chr, length(gene) < 300)[1] == chr.genes[2] @test length(@genes(chr, get(gene, :locus_tag, "") == "")) == 3 gene = chr.genes[3] @test @genes(chr, gene == $gene)[1] == chr.genes[3] d = Dict(:a => "tag01") @test @genes(chr, :locus_tag == d[$:a]) == @genes(chr, :locus_tag == "tag01") end @testset "Broadcast" begin # Broadcasted assignment on existing property chr.genes[3:4].gene .= "AXL2P" @test all(chr.genes[3:4].gene .== "AXL2P") # Broadcasted assignment on previously missing property chr.genes[3:4].newproperty .= true @test all(chr.genes[3:4].newproperty .== true) # Broadcasted assignment with @genes @genes(chr, gene).newproperty .= false @test all(chr.genes[[3,5]].newproperty .== false) end @testset "Locus" begin loc = Locus(1:1, '.', true, true, UnitRange{Int}[], false) @test Locus() == loc @test locus(chr.genes[2]) < locus(chr.genes[4]) @test locus(chr.genes[2]) == locus(chr.genes[2]) @test iscomplement(chr.genes[2]) == false @test iscomplement(chr.genes[5]) == true end seq = dna"atgtccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattgccgacatgagacagttaggtatcgtcgagagttacaagctaaaacgagcagtagtcagctctgcatctgaagccgctgaagttctactaagggtggataacatcatccgtgcaagaccaagaaccgccaatagacaacatatgtaa" @test sequence(chr.genes[2]) == seq @test length(chr.genes[2]) == length(seq) @testset "Empty Record" begin chr = GenBank.Record() @test chr.name == "" @test chr.sequence == dna"" @test chr.header == "" @test chr.genes == Gene[] @test names(chr.genedata) == [] end end
[ 27, 7856, 261, 480, 29, 74, 67, 2417, 71, 496, 14, 13746, 10179, 2025, 30078, 13, 20362, 198, 3500, 5215, 10179, 2025, 30078, 198, 3500, 16024, 44015, 3007, 198, 3500, 6208, 198, 198, 31, 9288, 2617, 366, 13746, 10179, 2025, 30078, 1,...
1.961924
2,495
""" CHELSA{BioClim} <: RasterDataSource Data from CHELSA, currently only the `BioClim` layer is implemented. See: [chelsa-climate.org](https://chelsa-climate.org/) """ struct CHELSA{X} <: RasterDataSource end layers(::Type{CHELSA{BioClim}}) = 1:19 """ getraster(T::Type{CHELSA{BioClim}}, [layer::Integer]) => String Download CHELSA BioClim data, choosing layers from: `$(layers(CHELSA{BioClim}))`. Without a layer argument, all layers will be downloaded, and a tuple of paths is returned. If the data is already downloaded the path will be returned. """ function getraster(T::Type{CHELSA{BioClim}}, layer::Integer) _check_layer(T, layer) path = rasterpath(T, layer) url = rasterurl(T, layer) return _maybe_download(url, path) end rastername(::Type{CHELSA{BioClim}}, layer::Integer) = "CHELSA_bio10_$(lpad(layer, 2, "0")).tif" rasterpath(::Type{CHELSA}) = joinpath(rasterpath(), "CHELSA") rasterpath(::Type{CHELSA{BioClim}}) = joinpath(rasterpath(CHELSA), "BioClim") rasterpath(T::Type{CHELSA{BioClim}}, layer::Integer) = joinpath(rasterpath(T), rastername(T, layer)) # https://os.zhdk.cloud.switch.ch/envicloud/chelsa/chelsa_V1/climatologies/bio/CHELSA_prec_01_V1.2_land.tif rasterurl(::Type{CHELSA}) = URI(scheme="https", host="os.zhdk.cloud.switch.ch", path="/envicloud/chelsa/chelsa_V1/") rasterurl(::Type{CHELSA{BioClim}}) = joinpath(rasterurl(CHELSA), "climatologies/bio/") rasterurl(T::Type{CHELSA{BioClim}}, layer::Integer) = joinpath(rasterurl(T), rastername(T, layer))
[ 37811, 198, 220, 220, 220, 5870, 3698, 4090, 90, 42787, 34, 2475, 92, 1279, 25, 371, 1603, 6601, 7416, 198, 198, 6601, 422, 5870, 3698, 4090, 11, 3058, 691, 262, 4600, 42787, 34, 2475, 63, 7679, 318, 9177, 13, 198, 198, 6214, 25, ...
2.458537
615
if basename(pwd()) == "aoc" cd("2018/10") end using OffsetArrays mutable struct LightPoint position::CartesianIndex{2} velocity::CartesianIndex{2} end struct LightField points end function Base.size(lightfield::LightField) Tuple(-(reverse(extrema(getfield.(lightfield.points, :position)))...)) end Base.length(lightfield::LightField) = prod(size(lightfield)) function Base.in(position::CartesianIndex, lightfield::LightField) any(point.position == position for point in lightfield.points) end function loadpoints(filename::AbstractString) LightField([ begin a, b, c, d = parse.(Int, m.match for m in eachmatch(r"-?\d+", line)) LightPoint(CartesianIndex(a, b), CartesianIndex(c, d)) end for line in eachline(filename) ]) end function step!(lightfield::LightField; rev = false) foreach( if rev point -> point.position -= point.velocity else point -> point.position += point.velocity end, lightfield.points ) lightfield end function Base.show(io::IO, lightfield::LightField) println("LightField with ", length(lightfield.points), " points:") for col in eachcol(range(extrema(getfield.(lightfield.points, :position))...)) println(io, " ", (p in lightfield ? '#' : ' ' for p in col)...) end end part1(filename::AbstractString) = part1(loadpoints(filename)) function part1(lightfield::LightField) len = length(lightfield) minlen = len + 1 steps = -1 while minlen > len minlen = len len = length(step!(lightfield)) steps += 1 end step!(lightfield, rev = true), steps end
[ 361, 1615, 12453, 7, 79, 16993, 28955, 6624, 366, 64, 420, 1, 198, 220, 220, 220, 22927, 7203, 7908, 14, 940, 4943, 198, 437, 198, 3500, 3242, 2617, 3163, 20477, 198, 198, 76, 18187, 2878, 4401, 12727, 198, 220, 220, 220, 2292, 3712...
2.526158
669
<filename>docs/make.jl using memoJuliaClassJa using Documenter ## Adopted from docs/make.jl in Documenter.jl # The DOCSARGS environment variable can be used to pass additional arguments to make.jl. # This is useful on CI, if you need to change the behavior of the build slightly but you # can not change the .travis.yml or make.jl scripts any more (e.g. for a tag build). if haskey(ENV, "DOCSARGS") for arg in split(ENV["DOCSARGS"]) (arg in ARGS) || push!(ARGS, arg) end end makedocs( modules=[memoJuliaClassJa], authors="<NAME> <<EMAIL>>", clean = false, sitename="memoJuliaClassJa.jl", format=Documenter.HTML(; prettyurls=get(ENV, "CI", "false") == "true", canonical="https://hsugawa8651.github.io/memoJuliaClassJa.jl/stable/", assets=String[], ), linkcheck = !("skiplinks" in ARGS), linkcheck_ignore = [ # timelessrepo.com seems to 404 on any CURL request... "http://timelessrepo.com/json-isnt-a-javascript-subset", # We'll ignore links that point to GitHub's edit pages, as they redirect to the # login screen and cause a warning: r"https://github.com/([A-Za-z0-9_.-]+)/([A-Za-z0-9_.-]+)/edit(.*)", ] ∪ (get(ENV, "GITHUB_ACTIONS", nothing) == "true" ? [ # Extra ones we ignore only on CI. # # It seems that CTAN blocks GitHub Actions? "https://ctan.org/pkg/minted", ] : []), pages= [ "Home" => "index.md", "LICENSE.md", "LICENSEja.md", "ch00.md", "ch01.md", "ch02.md", "ch03.md", "ch04.md", "ch05.md", "ch06.md", "ch07.md", "ch08.md", "ch09.md", "ch10.md", "ch11.md", "ch12.md", "ch13.md", "porting.md" ], # strict = !("strict=false" in ARGS), doctest = ("doctest=only" in ARGS) ? :only : true, ) deploydocs( repo="github.com/hsugawa8651/memoJuliaClassJa.jl.git", devbranch="develop", push_preview = true, )
[ 27, 34345, 29, 31628, 14, 15883, 13, 20362, 198, 3500, 16155, 16980, 544, 9487, 33186, 198, 3500, 16854, 263, 198, 198, 2235, 1215, 45256, 422, 34165, 14, 15883, 13, 20362, 287, 16854, 263, 13, 20362, 198, 2, 383, 37760, 50, 1503, 143...
2.22659
865
<filename>test/solutions/test_functions.jl<gh_stars>1-10 function fx(t, x, fx) fx .= x end function fq(t, q, p, fq) fq .= q end function fp(t, q, p, fp) fp .= q.^2 end function fϕ(t, x, fϕ) fϕ .= 0 end function gx(t, x, λ, fx) fx .= x end function gq(t, q, p, λ, fλ) fλ .= q end function gp(t, q, p, λ, fλ) fλ .= q.^2 end function gϕ(t, q, p, gϕ) gϕ .= p - q.^2 end
[ 27, 34345, 29, 9288, 14, 82, 14191, 14, 9288, 62, 12543, 2733, 13, 20362, 27, 456, 62, 30783, 29, 16, 12, 940, 198, 198, 8818, 277, 87, 7, 83, 11, 2124, 11, 277, 87, 8, 198, 220, 220, 220, 277, 87, 764, 28, 2124, 198, 437, 1...
1.624
250
using CompilerOptions using Base.Test JLOptions()
[ 3500, 3082, 5329, 29046, 198, 3500, 7308, 13, 14402, 198, 198, 41, 21982, 8544, 3419, 198 ]
3.1875
16
<filename>src/datasets/ucr_datasets.jl<gh_stars>10-100 # using DelimitedFiles # const UCR_DATASETS = """ # 50words, # Adiac, # ArrowHead, # Beef, # BeetleFly, # BirdChicken, # CBF, # Car, # ChlorineConcentration, # CinC_ECG_torso, # Coffee, # Computers, # Cricket_X, # Cricket_Y, # Cricket_Z, # DiatomSizeReduction, # DistalPhalanxOutlineAgeGroup, # DistalPhalanxOutlineCorrect, # DistalPhalanxTW, # ECG200, # ECG5000, # ECGFiveDays, # Earthquakes, # ElectricDevices, # FISH, # FaceAll, # FaceFour, # FacesUCR, # FordA, # FordB, # Gun_Point, # Ham, # HandOutlines, # Haptics, # Herring, # InlineSkate, # InsectWingbeatSound, # ItalyPowerDemand, # LargeKitchenAppliances, # Lighting2, # Lighting7, # MALLAT, # Meat, # MedicalImages, # MiddlePhalanxOutlineAgeGroup, # MiddlePhalanxOutlineCorrect, # MiddlePhalanxTW, # MoteStrain, # NonInvasiveFatalECG_Thorax1, # NonInvasiveFatalECG_Thorax2, # OSULeaf, # OliveOil, # PhalangesOutlinesCorrect, # Phoneme, # Plane, # ProximalPhalanxOutlineAgeGroup, # ProximalPhalanxOutlineCorrect, # ProximalPhalanxTW, # RefrigerationDevices, # ScreenType, # ShapeletSim, # ShapesAll, # SmallKitchenAppliances, # SonyAIBORobotSurface, # SonyAIBORobotSurfaceII, # StarLightCurves, # Strawberry, # SwedishLeaf, # Symbols, # ToeSegmentation1, # ToeSegmentation2, # Trace, # TwoLeadECG, # Two_Patterns, # UWaveGestureLibraryAll, # Wine, # WordsSynonyms, # Worms, # WormsTwoClass, # synthetic_control, # uWaveGestureLibrary_X, # uWaveGestureLibrary_Y, # uWaveGestureLibrary_Z, # wafer, # yoga # """ # # """ # DynamicAxisWarping.download_data([path="/DynamicAxisWarping/data/"]) # # Downloads the UC Riverside Time Series Classification Archive to # the specified path. # """ # function download_ucr() # # UCR_URL = "http://www.cs.ucr.edu/~eamonn/time_series_data/UCR_TS_Archive_2015.zip" # # # the password is "<PASSWORD>" # @info( # """ # A simple password is required to extract the UCR Time Series Classification. While the # data is downloading, please read the following paper # # <NAME>, <NAME>, <NAME>: Time Series Classification under More Realistic # Assumptions. SDM 2013: 578-586. # http://dx.doi.org/10.1137/1.9781611972832.64 # # Find the following sentence (it's near the end of the first page): # # “Every item that we ******* ## @@@@@@@ belongs to exactly one of our well defined classes” # # Enter the three redacted words (without spaces) to extract the data. The purpose of this # exercise is to encourage you to read the associated paper, see: # # http://www.cs.ucr.edu/~eamonn/time_series_data/ # # """ # ) # # download(UCR_URL, "$DATAPATH/UCR.zip") # # # should unzip the file correctly in platform-specific manner # run(unpack_cmd("UCR", DATAPATH , ".zip", "")) # # # delete the zip file when we're done # rm("$DATAPATH/UCR.zip") # # @info("Download and extraction successful!") # # end # # """ # data,labels = DynamicAxisWarping.traindata(name) # # Loads the training set of the specified dataset. Returns a matrix `data` where each column # holds a 1-dimensional time series. The class label for each column is held `labels` # which is a vector of length `size(data,2)`. # # Available datasets: # # $UCR_DATASETS # """ # function ucr_traindata(name::AbstractString) # try # Y = readdlm(DATAPATH*"/UCR_TS_Archive_2015/"*name*"/"*name*"_TRAIN", ',') # labels = round(Int,vec(Y[:,1])) # data = transpose(Y[:,2:end]) # return data,labels # catch err # showerror(stdout, err, backtrace());println() # @info("You may have recieved this error because you haven't downloaded the database yet.") # @info("Try running download_ucr() first.") # @info("You may also have mispelled the name of the dataset.") # end # end # # """ # data,labels = DynamicAxisWarping.traindata(name) # # Loads the test set of the specified dataset. Returns a matrix `data` where each column # holds a 1-dimensional time series. The class label for each column is held `labels` # which is a vector of length `size(data,2)`. # # Available datasets: # # $UCR_DATASETS # """ # function ucr_testdata(name::AbstractString) # try # Y = return readcsv(DATAPATH*"/UCR_TS_Archive_2015/"*name*"/"*name*"_TEST") # labels = round(Int,vec(Y[:,1])) # data = transpose(Y[:,2:end]) # return data,labels # catch err # showerror(stdout, err, backtrace());println() # @info("You may have recieved this error because you haven't downloaded the database yet.") # @info("Try running download_ucr() first.") # @info("You may also have mispelled the name of the dataset.") # end # end
[ 27, 34345, 29, 10677, 14, 19608, 292, 1039, 14, 1229, 81, 62, 19608, 292, 1039, 13, 20362, 27, 456, 62, 30783, 29, 940, 12, 3064, 198, 2, 1262, 4216, 320, 863, 25876, 198, 2, 1500, 471, 9419, 62, 35, 1404, 1921, 32716, 796, 37227,...
2.472567
1,932
<reponame>mateuszbaran/FunManifolds.jl<gh_stars>1-10 """ CurveWarpingSRSFSpace(knots, quadweights = get_quad_weights(knots)) Space of SRSFs of curve warpings on knots `knots`. Points are represented by vectors in ambient space (ℝ^(N+1) if there are `N` knots). Given quadrature weights are used to compute inner products. """ struct CurveWarpingSRSFSpace{TK<:AbstractVector,TW<:AbstractVector} <: AbstractManifold{ℝ} knots::TK quadweights::TW end function CurveWarpingSRSFSpace(knots::AbstractVector) ws = get_quad_weights(knots) return CurveWarpingSRSFSpace(knots, ws) end function manifold_dimension(M::CurveWarpingSRSFSpace) return length(M.knots) end function representation_size(M::CurveWarpingSRSFSpace) return (length(M.knots) + 1,) end function isapprox(M::CurveWarpingSRSFSpace, p, q; kwargs...) return isapprox(distance(M, p, q), 0; kwargs...) end function isapprox(M::CurveWarpingSRSFSpace, p, X, Y; kwargs...) return isapprox(X, Y; kwargs...) end """ inner_ambient(M::CurveWarpingSRSFSpace, p, q) Inner product in ambient space of points `p` and `q` on `M`. Takes into account quadrature weights. """ function inner_ambient(M::CurveWarpingSRSFSpace, p, q) return sum(M.quadweights .* p .* q) end function distance(M::CurveWarpingSRSFSpace, p, q) pmq = p - q ppq = p + q return 2 * atan(sqrt(inner_ambient(M, pmq, pmq)), sqrt(inner_ambient(M, ppq, ppq))) end function embed!(::CurveWarpingSRSFSpace, q, p) copyto!(q, p) return q end function embed!(M::CurveWarpingSRSFSpace, Y, p, X) copyto!(Y, X) return Y end function project!(M::CurveWarpingSRSFSpace, q, p) scale = sqrt(inner_ambient(M, p, p)) q .= p ./ scale return q end function project!(M::CurveWarpingSRSFSpace, Y, p, X) Y .= X .- inner_ambient(M, p, X) .* p return Y end function get_quad_weights(nodes::AbstractRange) n = length(nodes) dt = 1 / (n - 1) return dt / 2 .* [1; [2 for i in 1:(n - 2)]; 1] # not that precise for some reason #=if n % 2 == 1 # Simpson's rule return dt / 3 .* [1; [i % 2 == 0 ? 2 : 4 for i in 1:(n - 2)]; 1] else # trapezoidal rule return dt / 2 .* [1; [2 for i in 1:(n - 2)]; 1] end=# # Simpson's 3/8 #n%3 == 1 || error("argument mod 3 must be 1") #return 3dt/8 .* [1; [i%3==0 ? 2 : 3 for i in 1:n-2]; 1] end function exp!(M::CurveWarpingSRSFSpace, q, p, X) θ = norm(M, p, X) q .= cos(θ) .* p .+ Manifolds.usinc(θ) .* X return q end function log!(M::CurveWarpingSRSFSpace, X, p, q) cosθ = clamp(inner_ambient(M, p, q), -1, 1) θ = acos(cosθ) X .= (q .- cosθ .* p) ./ Manifolds.usinc(θ) return project!(M, X, p, X) end function inner(M::CurveWarpingSRSFSpace, p, X, Y) return inner_ambient(M, X, Y) end function vector_transport_to!(M::CurveWarpingSRSFSpace, Y, p, X, q, ::ParallelTransport) copyto!(Y, X) X_pq = log(M, p, q) X1 = norm(M, p, X_pq) if X1 > 0 sum_pq = p + q factor = 2 * inner_ambient(M, X, q) / inner_ambient(M, sum_pq, sum_pq) Y .-= factor .* sum_pq end return Y end function zero_vector!(M::CurveWarpingSRSFSpace, X, p) fill!(X, 0) return X end const CurveWarpingSRSFGroup{TCWS<:CurveWarpingSRSFSpace} = GroupManifold{ℝ,TCWS,WarpingCompositionOperation} function CurveWarpingSRSFGroup(cws::CurveWarpingSRSFSpace) return GroupManifold(cws, WarpingCompositionOperation()) end function identity_element(cwg::CurveWarpingSRSFGroup) return ones(length(cwg.manifold.knots)) end function identity_element(cwg::CurveWarpingSRSFGroup, a) return ones(eltype(a), length(cwg.manifold.knots)) end function inv(cwg::CurveWarpingSRSFGroup, p) cws = CurveWarpingSpace(cwg.manifold.knots) pinv = inv(CurveWarpingGroup(cws), reverse_srsf(cws, p)) return srsf(cws, pinv) end inv(::CurveWarpingSRSFGroup, p::Identity{WarpingCompositionOperation}) = p function compose(cwg::CurveWarpingSRSFGroup, p1, p2) knots = cwg.manifold.knots cws = CurveWarpingSpace(knots) p1inv = reverse_srsf(cws, p1) p2w = make_warping(cws, p2) p2warped = map(t -> p2w(p1inv(t)), knots) return p2warped .* p1 end function compose(cwg::CurveWarpingSRSFGroup, p1::Identity{WarpingCompositionOperation}, p2) return p2 end function compose(cwg::CurveWarpingSRSFGroup, p1, p2::Identity{WarpingCompositionOperation}) return p1 end function compose( cwg::CurveWarpingSRSFGroup, p1::Identity{WarpingCompositionOperation}, p2::Identity{WarpingCompositionOperation}, ) return p1 end """ CurveWarpingSRSFAction(M::AbstractManifold, p, cwg::CurveWarpingSRSFGroup) Space of left actions of the group of SRSFs of curve warpings `cwg` on the manifold `M` of TSRVFs of curves at point `p`. """ struct CurveWarpingSRSFAction{TM<:AbstractManifold,TP,TCWG<:CurveWarpingSRSFGroup} <: AbstractGroupAction{LeftAction} manifold::TM point::TP cwg::TCWG end function Manifolds.g_manifold(A::CurveWarpingSRSFAction) return A.manifold end function Manifolds.base_group(A::CurveWarpingSRSFAction) return A.cwg end function apply!(A::CurveWarpingSRSFAction{<:DiscretizedCurves}, q, a, p) itp = make_interpolant(A.manifold, p) a_rev = reverse_srsf(CurveWarpingSpace(A.cwg.manifold.knots), a) ts = map(a_rev, A.cwg.manifold.knots) rep_size = representation_size(A.manifold.manifold) for (i, t) in zip(get_iterator(A.manifold), ts) copyto!(_write(A.manifold, rep_size, q, i), itp(t) * a[i]) end return q end function apply!( A::CurveWarpingSRSFAction{<:DiscretizedCurves}, q, ::Identity{WarpingCompositionOperation}, p, ) copyto!(q, p) return q end function Manifolds.inverse_apply(A::CurveWarpingSRSFAction, a, p) inva = inv(base_group(A), a) return apply(A, inva, p) end function optimal_alignment(A::CurveWarpingSRSFAction, p, q) M = A.manifold return pairwise_optimal_warping(M, M, p, q, A.point)[1] end """ karcher_mean_amplitude(A::CurveWarpingSRSFAction, ps::Vector) Calculate the Karcher mean of amplitudes of given functions `ps` in SRVF form under the action `A`. Roughly follows Algorithm 2 from https://arxiv.org/abs/1103.3817. """ function karcher_mean_amplitude( A::CurveWarpingSRSFAction, ps::Vector; throw_on_divergence=false, progress_update=(x...) -> nothing, max_iter=100, ) M = A.manifold N = length(ps) cur_ps = ps cur_increment = 42.0 prev_increment = 42.0 num_iterations = 0 meanp = project(M, (1.0 / N) * (sum(embed(M, p) for p in cur_ps))) # find intial candidate for the mean min_i = 1 norm_min_i = Inf for i in 1:N cur_norm = distance(M, meanp, cur_ps[i]) if cur_norm < norm_min_i min_i = i norm_min_i = cur_norm end end curμp = cur_ps[min_i] initial_increment = cur_increment while cur_increment > 1e-6 && num_iterations < max_iter warpings = [pairwise_optimal_warping(M, M, curμp, p, A.point) for p in cur_ps] aligned_ps = [apply(A, warpings[i][1], cur_ps[i]) for i in 1:N] mean_aligned_ps = project(M, (1.0 / N) * (sum(embed(M, p) for p in aligned_ps))) prev_increment = cur_increment cur_increment = distance(M, mean_aligned_ps, curμp) progress_update(cur_increment, num_iterations, max_iter) if num_iterations == 0 initial_increment = cur_increment elseif cur_increment > 1.5 * prev_increment if throw_on_divergence error("Divergent mean amplitude calculation.") else break end end cur_ps = aligned_ps curμp = mean_aligned_ps num_iterations += 1 end progress_update(:finish) return curμp end """ phase_amplitude_separation(A::CurveWarpingSRSFAction, ps::Vector) Perform phase-amplitude separation of given functions in SRVF form. Returns mean amplitude, phases and amplitudes. Implements alignment from Section 3.4 of https://arxiv.org/abs/1103.3817. """ function phase_amplitude_separation(A::CurveWarpingSRSFAction, ps::Vector) μp = karcher_mean_amplitude(A, ps) # TODO: use other mean functions? a = center_of_orbit(A, ps, μp) M = A.manifold p̃ = apply(A, a, μp) γs = [pairwise_optimal_warping(M, M, p̃, p, A.point)[1] for p in ps] aligned_ps = [apply(A, γs[i], ps[i]) for i in 1:length(ps)] return (p̃, γs, aligned_ps) end
[ 27, 7856, 261, 480, 29, 9830, 385, 89, 5657, 272, 14, 24629, 5124, 361, 10119, 13, 20362, 27, 456, 62, 30783, 29, 16, 12, 940, 198, 37811, 198, 220, 220, 220, 46300, 54, 5117, 278, 50, 6998, 37, 14106, 7, 74, 1662, 82, 11, 15094...
2.167429
3,936
<gh_stars>1-10 module CanvasWebIO using WebIO, JSExpr, Observables export Canvas, addmovable!, addclickable!, addstatic! mutable struct Canvas w::WebIO.Scope size::Array{Int64, 1} objects::Array{WebIO.Node, 1} getter::Dict id::String handler::Observables.Observable selection::Observables.Observable synced::Bool # synced=true => julia listeners called on mousemove, not just drop end function Canvas(size::Array{Int64,1}, synced=false) w = Scope(imports=["/pkg/CanvasWebIO/helpers.js"]) handler = Observable(w, "handler", ["id", 0, 0]) selection = Observable(w, "selection", "id") getter = Dict() id = WebIO.newid("canvas") on(selection) do val val end on(handler) do val selection[] = val[1] if val[1] in keys(getter) getter[val[1]][] = Int.(floor.(val[2:3])) else println("Failed to assign value $(val[2:3]) to $(val[1])") end end Canvas(w, size, Array{WebIO.Node,1}(), getter, id, handler, selection, synced) end function Canvas() Canvas([800,800]) end function Canvas(synced::Bool) Canvas([800,800], synced) end function Base.getindex(canvas::Canvas, i) canvas.getter[i] end function (canvas::Canvas)() # js function setp sets the position of the object named name to the position of the mouse # returns the [draggable, xpos, ypos] where draggable is whether the object was movable, # and xpos,ypos the new position of the object # # Transform parser from https://stackoverflow.com/a/17838403 canvas_events = Dict() handler = canvas.handler synced = canvas.synced canvas_events["mousemove"] = @js function(event) event.preventDefault() event.stopPropagation() @var name = document.getElementById($(canvas.id)).getAttribute("data-selected") @var pos if name!="" pos = setp(event, name) if(pos[0]) #is dragged document.getElementById($(canvas.id)).setAttribute("is-dragged", true) if($synced) $handler[] = [name, Math.round(pos[1]), Math.round(pos[2])] end end end end canvas_events["mouseup"] = @js function(event) event.preventDefault() event.stopPropagation() console.log("canvas click") @var name = document.getElementById($(canvas.id)).getAttribute("data-selected") @var pos if name!="" pos = setp(event, name) if document.getElementById($(canvas.id)).getAttribute("is-dragged")=="true" $handler[] = [name, parseFloat(pos[1]), parseFloat(pos[2])] document.getElementById(name).style.stroke = "none" document.getElementById($(canvas.id)).setAttribute("data-selected", "") document.getElementById($(canvas.id)).setAttribute("is-dragged", false) end end end canvas.w(dom"svg:svg[id = $(canvas.id), height = $(canvas.size[1]), width = $(canvas.size[2])]"( canvas.objects..., attributes = Dict("data-selected" => "", "is-dragged" => false), events = canvas_events)) end """ addclickable!(canvas::Canvas, svg::WebIO.Node) Adds a clickable (as in, can be clicked but not moved) object to the canvas based on the svg template. If the template has an id, this will be given to the canvas object, and the object will be associated with the id as a string (canvas[id] accesses the associated observable etc). If the template has no id, one will be generated. Note that the stroke property will be overwritten. """ function addclickable!(canvas::Canvas, svg::WebIO.Node) attr = svg.props[:attributes] children = svg.children if "id" in keys(attr) id = attr["id"] else id = WebIO.newid("svg") end selection = canvas.selection clickable_events = Dict() clickable_events["click"] = @js function(event) name = document.getElementById($(canvas.id)).getAttribute("data-selected") #selected_obj if name == this.id this.style.stroke = "none" document.getElementById($(canvas.id)).setAttribute("data-selected", "") else if name != "" selected_obj = document.getElementById(name) selected_obj.style.stroke = "none" end this.style.stroke = "green" #Change this later this.style.strokeWidth = 2 #Change this later document.getElementById($(canvas.id)).setAttribute("data-selected", this.id) $selection[] = this.id end end push!(canvas.objects, Node(svg.instanceof, children..., attributes=attr, events=clickable_events)) end """ addmovable!(canvas::Canvas, svg::WebIO.Node, lock=" ") Adds a movable object to the canvas based on the svg template. If the template has an id, this will be given to the canvas object, and the object will be associated with the id as a string (canvas[id] accesses the associated observable etc). If the template has no id, one will be generated. Note that the stroke property will be overwritten. The optional lock argument allows locking of an axis. Setting lock="x" will lock the movable's x value, so it can only be moved up and down. Similarly, lock="y" will only permit movements to the left and right. """ function addmovable!(canvas::Canvas, svg::WebIO.Node, lock=" ") attr = svg.props[:attributes] if svg.instanceof.tag!=:g newattr = Dict() if "id" in keys(attr) newattr["id"] = attr["id"] else newattr["id"] = WebIO.newid("svg") end attr["id"] = WebIO.newid("subsvg") if haskey(attr, "x") && haskey(attr, "y") #Rectangle etc newattr["transform"] = "translate($(attr["x"]),$(attr["y"]))" attr["x"] = "$(-parse(attr["width"])/2)" attr["y"] = "$(-parse(attr["height"])/2)" elseif haskey(attr, "cx") && haskey(attr, "cy") #Circle newattr["transform"] = "translate($(attr["cx"]),$(attr["cy"]))" attr["cx"] = "0.0" attr["cy"] = "0.0" else newattr["transform"] = "translate($(attr["cx"]),$(attr["cy"]))" #undefined object end return addmovable!(canvas, dom"svg:g"(svg, attributes=newattr), lock) end if :style in keys(svg.props) style = svg.props[:style] else style = Dict() end children = svg.children if "id" in keys(attr) id = attr["id"] else id = WebIO.newid("svg") attr["id"] = id end attr["data-lock"] = lock if svg.instanceof.tag==:g coo = [0.0, 0.0] try coo .= parse.(Float64, match(r"translate\((.*?),(.*?)\)", attr["transform"]).captures) catch println("Failed to get position of $id, setting default") end pos = Observable(canvas.w, id, coo) else error("Only <g> objects allowed") end push!(pos.listeners, (x)->(x)) canvas.getter[id] = pos handler = canvas.handler attr["draggable"] = "true" style[:cursor] = "move" movable_events = Dict() movable_events["mousedown"] = @js function(event) event.stopPropagation() event.preventDefault() console.log("clicking", this.id) @var name = document.getElementById($(canvas.id)).getAttribute("data-selected") @var pos if name == "" this.style.stroke = "red" #Change this later this.style.strokeWidth = 2 #Change this later document.getElementById($(canvas.id)).setAttribute("data-selected", this.id) else selected_obj = document.getElementById(name) selected_obj.style.stroke = "none" pos = setp(event,name) if(pos[0]) #is dragged $handler[] = [name, pos[1], pos[2]] end document.getElementById($(canvas.id)).setAttribute("data-selected", "") document.getElementById($(canvas.id)).setAttribute("is-dragged", false) end end node = Node(svg.instanceof, children..., attributes=attr, style=style, events=movable_events) push!(canvas.objects, node) node end """ addstatic!(canvas::Canvas, svg::WebIO.Node) Adds the svg object directly to the canvas. """ function addstatic!(canvas::Canvas, svg::WebIO.Node) push!(canvas.objects, svg) end """ setindex_(canvas::Canvas, pos, i::String) Sets the position of the object i to pos on the javascript side. """ function setindex_(canvas::Canvas, pos, i::String) evaljs(canvas.w, js""" setp_nonevent($pos, $i)""") end function Base.setindex!(canvas::Canvas, val, i::String) setindex_(canvas::Canvas, val, i) canvas[i][] = val end end
[ 27, 456, 62, 30783, 29, 16, 12, 940, 198, 21412, 1680, 11017, 13908, 9399, 198, 198, 3500, 5313, 9399, 11, 26755, 3109, 1050, 11, 19243, 2977, 198, 198, 39344, 1680, 11017, 11, 751, 76, 21985, 28265, 751, 12976, 540, 28265, 751, 12708...
2.246895
4,026
<gh_stars>0 module Fatou using SyntaxTree,Reduce,LaTeXStrings,Requires,Base.Threads # This file is part of Fatou.jl. It is licensed under the MIT license # Copyright (C) 2017 <NAME> export fatou, juliafill, mandelbrot, newton, basin, plot """ Fatou.Define(E::Any; # primary map, (z, c) -> F Q::Expr = :(abs2(z)), # escape criterion, (z, c) -> Q C::Expr = :((angle(z)/(2π))*n^p)# coloring, (z, n=iter., p=exp.) -> C ∂ = π/2, # Array{Float64,1} # Bounds, [x(a),x(b),y(a),y(b)] n::Integer = 176, # horizontal grid points N::Integer = 35, # max. iterations ϵ::Number = 4, # basin ϵ-Limit criterion iter::Bool = false, # toggle iteration mode p::Number = 0, # iteration color exponent newt::Bool = false, # toggle Newton mode m::Number = 0, # Newton multiplicity factor O::String = F, # original Newton map mandel::Bool= false, # toggle Mandelbrot mode seed::Number= 0.0+0.0im, # Mandelbrot seed value x0 = nothing, # orbit starting point orbit::Int = 0, # orbit cobweb depth depth::Int = 1, # depth of function composition cmap::String= "", # imshow color map plane::Bool = false, # convert input disk to half-plane disk::Bool = false) # convert output half-plane to disk `Define` the metadata for a `Fatou.FilledSet`. """ struct Define{FT<:Function,QT<:Function,CT<:Function,M,N,P,D} E::Any # input expression F::FT # primary map Q::QT # escape criterion C::CT # complex fixed point coloring ∂::Array{Float64,1} # bounds n::UInt16 # number of grid points N::UInt8 # number of iterations ϵ::Float64 # epsilon Limit criterion iter::Bool # toggle iteration mode p::Float64 # iteration color exponent newt::Bool # toggle Newton mode m::Number # newton multiplicity factor mandel::Bool # toggle Mandelbrot mode seed::Number # Mandelbrot seed value x0 # orbit starting point orbit::Int # orbit cobweb depth depth::Int # depth of function composition cmap::String # imshow color map plane::Bool # convert input disk to half-plane disk::Bool # convert output half-plane to disk function Define(E; Q=:(abs2(z)), C=:((angle(z)/(2π))*n^p), ∂=π/2, n::Integer=176, N::Integer=35, ϵ::Number=4, iter::Bool=false, p::Number=0, newt::Bool=false, m::Number=0, mandel::Bool=false, seed::Number=0.0+0.0im, x0=nothing, orbit::Int=0, depth::Int=1, cmap::String="", plane::Bool=false, disk::Bool=false) !(typeof(∂) <: Array) && (∂ = [-float(∂),∂,-∂,∂]) length(∂) == 2 && (∂ = [∂[1],∂[2],∂[1],∂[2]]) !newt ? (f = genfun(E,[:z,:c]); q = genfun(Q,[:z,:c])) : (f = genfun(newton_raphson(E,m),[:z,:c]); q = genfun(Expr(:call,:abs,E),[:z,:c])) c = genfun(C,[:z,:n,:p]) e = typeof(E) == String ? parse(E) : E return new{typeof(f),typeof(q),typeof(c),mandel,newt,plane,disk}(e,f,q,c,convert(Array{Float64,1},∂),UInt16(n),UInt8(N),float(ϵ),iter,float(p),newt,m,mandel,seed,x0,orbit,depth,cmap,plane,disk) end end """ Fatou.FilledSet(::Fatou.Define) Compute the `Fatou.FilledSet` set using `Fatou.Define`. """ struct FilledSet{FT,QT,CT,M,N,P,D} meta::Define{FT,QT,CT,M,N,P,D} set::Matrix{Complex{Float64}} iter::Matrix{UInt8} mix::Matrix{Float64} function FilledSet{FT,QT,CT,M,N,P,D}(K::Define{FT,QT,CT,M,N,P,D}) where {FT,QT,CT,M,N,P,D} (i,s) = Compute(K) return new{FT,QT,CT,M,N,P,D}(K,s,i,broadcast(K.C,s,broadcast(float,i./K.N),K.p)) end end """ fatou(::Fatou.Define) Compute the `Fatou.FilledSet` set using `Fatou.Define`. # Examples ```Julia julia> fatou(K) ``` """ fatou(K::Define{FT,QT,CT,M,N,P,D}) where {FT,QT,CT,M,N,P,D} = FilledSet{FT,QT,CT,M,N,P,D}(K) """ juliafill(::Expr; # primary map, (z, c) -> F Q::Expr = :(abs2(z)), # escape criterion, (z, c) -> Q C::Expr = :((angle(z)/(2π))*n^p)# coloring, (z, n=iter., p=exp.) -> C ∂ = π/2, # Array{Float64,1} # Bounds, [x(a),x(b),y(a),y(b)] n::Integer = 176, # horizontal grid points N::Integer = 35, # max. iterations ϵ::Number = 4, # basin ϵ-Limit criterion iter::Bool = false, # toggle iteration mode p::Number = 0, # iteration color exponent x0 = nothing, # orbit starting point orbit::Int = 0, # orbit cobweb depth depth::Int = 1, # depth of function composition cmap::String= "", # imshow color map plane::Bool = false, # convert input disk to half-plane disk::Bool = false) # convert output half-plane to disk `Define` filled Julia basin in `Fatou` # Exmaples ```Julia julia> juliafill("z^2-0.06+0.67im",∂=[-1.5,1.5,-1,1],N=80,n=1501,cmap="RdGy") ``` """ function juliafill(E; Q=:(abs2(z)), C=:((angle(z)/(2π))*n^p), ∂=π/2, n::Integer=176, N::Integer=35, ϵ::Number=4, iter::Bool=false, p::Number=0, newt::Bool=false, m::Number=0, x0=nothing, orbit::Int=0, depth::Int=1, cmap::String="", plane::Bool=false, disk::Bool=false) return Define(E,Q=Q,C=C,∂=∂,n=n,N=N,ϵ=ϵ,iter=iter,p=p,newt=newt,m=m,x0=x0,orbit=orbit,depth=depth,cmap=cmap,plane=plane,disk=disk) end """ mandelbrot(::Expr; # primary map, (z, c) -> F Q::Expr = :(abs2(z)), # escape criterion, (z, c) -> Q C::Expr = :(exp(-abs(z))*n^p), # coloring, (z, n=iter., p=exp.) -> C ∂ = π/2, # Array{Float64,1} # Bounds, [x(a),x(b),y(a),y(b)] n::Integer = 176, # horizontal grid points N::Integer = 35, # max. iterations ϵ::Number = 4, # basin ϵ-Limit criterion iter::Bool = false, # toggle iteration mode p::Number = 0, # iteration color exponent m::Number = 0, # Newton multiplicity factor seed::Number= 0.0+0.0im, # Mandelbrot seed value x0 = nothing, # orbit starting point orbit::Int = 0, # orbit cobweb depth depth::Int = 1, # depth of function composition cmap::String= "", # imshow color map plane::Bool = false, # convert input disk to half-plane disk::Bool = false) # convert output half-plane to disk `Define` Mandelbrot basin in `Fatou` # Examples ```Julia mandelbrot(:(z^2+c),n=800,N=20,∂=[-1.91,0.51,-1.21,1.21],cmap="nipy_spectral") ``` """ function mandelbrot(E; Q=:(abs2(z)), ∂=π/2, C=:(exp(-abs(z))*n^p), n::Integer=176, N::Integer=35, ϵ::Number=4, iter::Bool=false, p::Number=0, newt::Bool=false, m::Number=0, seed::Number=0.0+0.0im, x0=nothing, orbit::Int=0, depth::Int=1, cmap::String="", plane::Bool=false, disk::Bool=false) m ≠ 0 && (newt = true) return Define(E,Q=Q,C=C,∂=∂,n=n,N=N,ϵ=ϵ,iter=iter,p=p,newt=newt,m=m,mandel=true,seed=seed,x0=x0,orbit=orbit,depth=depth,cmap=cmap,plane=plane,disk=disk) end """ newton(::Expr; # primary map, (z, c) -> F C::Expr = :((angle(z)/(2π))*n^p)# coloring, (z, n=iter., p=exp.) -> C ∂ = π/2, # Array{Float64,1} # Bounds, [x(a),x(b),y(a),y(b)] n::Integer = 176, # horizontal grid points N::Integer = 35, # max. iterations ϵ::Number = 4, # basin ϵ-Limit criterion iter::Bool = false, # toggle iteration mode p::Number = 0, # iteration color exponent m::Number = 0, # Newton multiplicity factor mandel::Bool= false, # toggle Mandelbrot mode seed::Number= 0.0+0.0im, # Mandelbrot seed value x0 = nothing, # orbit starting point orbit::Int = 0, # orbit cobweb depth depth::Int = 1, # depth of function composition cmap::String= "", # imshow color map plane::Bool = false, # convert input disk to half-plane disk::Bool = false) # convert output half-plane to disk `Define` Newton basin in `Fatou` # Examples ```Julia julia> newton("z^3-1",n=800,cmap="brg") ``` """ function newton(E; C=:((angle(z)/(2π))*n^p), ∂=π/2, n::Integer=176, N::Integer=35, ϵ::Number=0.01, iter::Bool=false, p::Number=0, m::Number=1, mandel::Bool=false, seed::Number=0.0+0.0im, x0=nothing, orbit::Int=0, depth::Int=1, cmap::String="", plane::Bool=false, disk::Bool=false) return Define(E,C=C,∂=∂,n=n,N=N,ϵ=ϵ,iter=iter,p=p,newt=true,m=m,mandel=mandel,seed=seed,x0=x0,orbit=orbit,depth=depth,cmap=cmap,plane=plane,disk=disk) end # load additional functionality include("internals.jl"); include("orbitplot.jl") """ basin(::Fatou.Define, ::Integer) Output the `j`-th basin of `Fatou.Define` as LaTeX. Each subsequent iteration of the Newton-Raphson method will yield a more complicated set. # Examples ```Julia julia> basin(newton("z^3-1"),2) L"\$\\displaystyle D_2(\\epsilon) = \\left\\{z\\in\\mathbb{C}:\\left|\\,z - \\frac{\\left(z - \\frac{z^{3} - 1}{3 z^{2}}\\right)^{3} - 1}{3 \\left(z - \\frac{z^{3} - 1}{3 z^{2}}\\right)^{2}} - \\frac{z^{3} - 1}{3 z^{2}} - r_i\\,\\right|<\\epsilon,\\,\\forall r_i(\\,f(r_i)=0 )\\right\\}\$" ``` """ basin(K::Define,j) = K.newt ? nrset(K.E,K.m,j) : jset(K.E,j) plane(z::Complex) = (2z.re/(z.re^2+(1-z.im)^2))+im*(1-z.re^2-z.im^2)/(z.re^2+(1-z.im)^2) disk(z::Complex) = (2z.re/(z.re^2+(1+z.im)^2))+im*(z.re^2+z.im^2-1)/(z.re^2+(1+z.im)^2) # define function for computing orbit of a z0 input function orbit(K::Define{FT,QT,CT,M,N,P,D},z0::Complex{Float64}) where {FT,QT,CT,M,N,P,D} M ? (z = K.seed) : (z = P ? plane(z0) : z0) zn = 0x00 while (N ? (K.Q(z,z0)::Float64>K.ϵ)::Bool : (K.Q(z,z0)::Float64<K.ϵ))::Bool && K.N>zn z = K.F(z,z0)::Complex{Float64} zn+=0x01 end; #end # return the normalized argument of z or iteration count return (zn::UInt8,(D ? disk(z) : z)::Complex{Float64}) end """ Compute(::Fatou.Define)::Union{Matrix{UInt8},Matrix{Float64}} `Compute` the `Array` for `Fatou.FilledSet` as specefied by `Fatou.Define`. """ function Compute(K::Define{FT,QT,CT,M,N,D})::Tuple{Matrix{UInt8},Matrix{Complex{Float64}}} where {FT,QT,CT,M,N,D} # generate coordinate grid Kyn = round(UInt16,(K.∂[4]-K.∂[3])/(K.∂[2]-K.∂[1])*K.n) x = range(K.∂[1]+0.0001,stop=K.∂[2],length=K.n) y = range(K.∂[4],stop=K.∂[3],length=Kyn) Z = x' .+ im*y # apply Newton-Orbit function element-wise to coordinate grid (matU,matF) = (Array{UInt8,2}(undef,Kyn,K.n),Array{Complex{Float64},2}(undef,Kyn,K.n)) @time @threads for j = 1:length(y); for k = 1:length(x); (matU[j,k],matF[j,k]) = orbit(K,Z[j,k])::Tuple{UInt8,Complex{Float64}} end; end return (matU,matF) end function __init__() println("Fatou detected $(Threads.nthreads()) julia threads.") @require PyPlot="d330b81b-6aea-500a-939a-2ce795aea3ee" include("pyplot.jl") @require ImageInTerminal="d8c32880-2388-543b-8c61-d9f865259254" include("term.jl") @require UnicodePlots="b8865327-cd53-5732-bb35-84acbb429228" include("uniplots.jl") end end # module
[ 27, 456, 62, 30783, 29, 15, 198, 21412, 12301, 280, 198, 3500, 26375, 897, 27660, 11, 7738, 7234, 11, 14772, 49568, 13290, 654, 11, 39618, 11, 14881, 13, 16818, 82, 198, 198, 2, 220, 220, 770, 2393, 318, 636, 286, 12301, 280, 13, ...
1.843708
6,699
<gh_stars>1-10 using Requests export PastebinClient, PastebinResponse, PasteKey, NEVER, TEN_M, HOUR, DAY, WEEK, TWO_WEEKS, MONTH, PUBLIC, UNLISTED, PRIVATE @enum Expiration NEVER=1 TEN_M=2 HOUR=3 DAY=4 WEEK=5 TWO_WEEKS=6 MONTH=7 @enum Access PUBLIC=0 UNLISTED=1 PRIVATE=2 immutable PastebinClient devKey::AbstractString userKey::Nullable{AbstractString} PastebinClient(devKey::AbstractString) = new(devKey, Nullable{AbstractString}()) PastebinClient(devKey::AbstractString, userKey::AbstractString) = new(devKey, userKey) # function to auto generate the user key function PastebinClient(devKey::AbstractString, username::AbstractString, password::AbstractString) data = Dict( "api_dev_key" => devKey, "api_user_name" => username, "api_user_password" => password, ) response = readall(Requests.post("http://pastebin.com/api/api_login.php", data=data)) new(devKey, response) end end immutable PastebinResponse successful::Bool response::AbstractString PastebinResponse(successful::Bool, response::AbstractString) = new(successful, response) end immutable PasteKey key::AbstractString PasteKey(key::AbstractString) = new(key) end
[ 27, 456, 62, 30783, 29, 16, 12, 940, 198, 3500, 9394, 3558, 198, 198, 39344, 198, 220, 220, 220, 29582, 11792, 11, 198, 220, 220, 220, 29582, 31077, 11, 198, 220, 220, 220, 23517, 9218, 11, 198, 220, 220, 220, 33602, 11, 309, 1677...
2.668763
477
using Weave using Flux using DataFrames, CSV using Binning using Random:shuffle! using BSON: @save, @load using Plots include("./trainModel.jl") filename = "./evalTemplate.jl" weave(filename; doctype="md2html", out_path=:pwd) weave(filename; doctype="github", out_path=:pwd)
[ 3500, 775, 1015, 198, 3500, 1610, 2821, 198, 3500, 6060, 35439, 11, 44189, 198, 3500, 20828, 768, 198, 3500, 14534, 25, 1477, 18137, 0, 198, 3500, 347, 11782, 25, 2488, 21928, 11, 2488, 2220, 198, 3500, 1345, 1747, 198, 17256, 7, 1911...
2.742574
101
<reponame>SamuelWiqvist/efficient_SDEMEM # load packages using CSV using Random """ set_up(;μ_θ_1::Real = -0.7, τ_θ_1::Real = 1.5, μ_θ_2::Real = 1.5, τ_θ_2::Real = 1.2, μ_θ_3::Real = -0.9, τ_θ_3::Real = 1.5, σ_ϵ::Real = 0.3, dt::Real=0.1, M::Int=5, N::Int=100) Returns ground-truth parameter values and simulated data from the OU SDEMEM model. """ function set_up(;μ_θ_1::Real = -0.7, τ_θ_1::Real = 4, μ_θ_2::Real = 2.3, τ_θ_2::Real = 10, μ_θ_3::Real = -0.9, τ_θ_3::Real = 4, σ_ϵ::Real = 0.3, dt::Real=0.05, M::Int=5, N::Int=100,seed::Int) # sample random effects Random.seed!(seed) ϕ = zeros(M,3) for i = 1:M ϕ[i,1] = μ_θ_1 + sqrt(1/τ_θ_1)*randn() ϕ[i,2] = μ_θ_2 + sqrt(1/τ_θ_2)*randn() ϕ[i,3] = μ_θ_3 + sqrt(1/τ_θ_3)*randn() end # model paramters η = [μ_θ_1; μ_θ_2; μ_θ_3; τ_θ_1; τ_θ_2; τ_θ_3] # define priors μ_0_1 = 0 M_0_1 = 1 α_1 = 2 β_1 = 1 μ_0_2 = 1 M_0_2 = 1 α_2 = 2 β_2 = 1/2 μ_0_3 = 0 M_0_3 = 1 α_3 = 2 β_3 = 1 prior_parameters_η = [μ_0_1 M_0_1 α_1 β_1;μ_0_2 M_0_2 α_2 β_2;μ_0_3 M_0_3 α_3 β_3] prior_parameters_σ_ϵ = [1; 1/0.4] # Gamma with scale parameter α = 1 and rate parameter β = 1/0.4 # generate data Random.seed!(seed) y,x,t_vec = generate_data(N, M, η, ϕ, σ_ϵ,dt) # return: data, model parameteres, and parameteres for priors return y,x,t_vec,dt,η,σ_ϵ,ϕ,prior_parameters_η,prior_parameters_σ_ϵ end """ generate_data(N::Int, M::Int, η::Array, ϕ::Array, σ_ϵ::Real,dt::Real) Generate data from the OU SDEMEM model. """ function generate_data(N::Int, M::Int, η::Array, ϕ::Array, σ_ϵ::Real,dt::Real) x_0 = zeros(M) # pre-allocate matriceis x = zeros(M,N) y = zeros(M,N) t_vec = zeros(N) for m = 1:M x[m,1] = x_0[m] # set start value y[m,1] = x[m,1] + σ_ϵ*randn() θ_1 = exp(ϕ[m,1]) # set parameters for subject m θ_2 = exp(ϕ[m,2]) θ_3 = exp(ϕ[m,3]) σ_cond = sqrt((θ_3^2/(2*θ_1))*(1-exp(-2*θ_1*dt))) # set latent process std for subject m # simulate process for subject m for t = 2:N t_vec[t] = t_vec[t-1] + dt μ_cond = θ_2 + (x[m,t-1]-θ_2)*exp(-θ_1*dt) x[m,t] = μ_cond + σ_cond*randn() y[m,t] = x[m,t] + σ_ϵ*randn() end end # return data return y,x,t_vec end
[ 27, 7856, 261, 480, 29, 16305, 2731, 54, 25011, 85, 396, 14, 16814, 62, 10305, 3620, 3620, 198, 2, 3440, 10392, 198, 3500, 44189, 198, 3500, 14534, 198, 198, 37811, 198, 220, 220, 220, 900, 62, 929, 7, 26, 34703, 62, 138, 116, 62,...
1.664622
1,467
<filename>src/module.jl using Tokenize # ––––––––––––––– # Some file utils # ––––––––––––––– function readdir′(dir) try readdir(dir) catch e String[] end end isdir′(f) = try isdir(f) catch e false end isfile′(f) = try isfile(f) catch e false end files(dir) = @as x dir readdir′(x) map!(f->joinpath(dir, f), x ,x) filter!(isfile′, x) dirs(dir) = @as x dir readdir′(x) filter!(f->!startswith(f, "."), x) map!(f->joinpath(dir, f), x, x) filter!(isdir′, x) jl_files(dir::AbstractString) = @>> dir files filter!(f->endswith(f, ".jl")) function jl_files(set) files = Set{String}() for dir in set, file in jl_files(dir) push!(files, file) end return files end # Recursion + Mutable State = Job Security """ Takes a start directory and returns a set of nearby directories. """ function dirsnearby(dir; descend = 1, ascend = 5, set = Set{String}()) push!(set, dir) if descend > 0 for down in dirs(dir) if !(down in set) push!(set, down) descend > 1 && dirsnearby(down, descend = descend-1, ascend = 0, set = set) end end end ascend > 0 && dirname(dir) !== dir && dirsnearby(dirname(dir), descend = descend, ascend = ascend-1, set = set) return set end # –––––––––––––– # The Good Stuff # –––––––––––––– const SCOPE_STARTERS = [Tokens.BEGIN, Tokens.WHILE, Tokens.IF, Tokens.FOR, Tokens.TRY, Tokens.FUNCTION, Tokens.MACRO, Tokens.LET, Tokens.TYPE, Tokens.DO, Tokens.QUOTE, Tokens.STRUCT] const MODULE_STARTERS = [Tokens.MODULE, Tokens.BAREMODULE] """ Takes Julia source code and a line number, gives back the string name of the module at that line. """ function codemodule(code, line) stack = String[] # count all unterminated block openers, brackets, and parens openers = [[0,0,0]] n_openers = 0 n_brackets = 0 n_parens = 0 # index of next modulename token next_modulename = -1 ts = tokenize(code) last_token = nothing for (i, t) in enumerate(ts) Tokens.startpos(t)[1] > line && break # Ignore everything in brackets or parnetheses, because any scope started in # them also needs to be closed in them. That way, we don't need special # handling for comprehensions and `end`-indexing. if Tokens.kind(t) == Tokens.LSQUARE openers[length(stack)+1][2] += 1 elseif openers[length(stack)+1][2] > 0 if Tokens.kind(t) == Tokens.RSQUARE openers[length(stack)+1][2] -= 1 end elseif Tokens.kind(t) == Tokens.LPAREN openers[length(stack)+1][3] += 1 elseif openers[length(stack)+1][3] > 0 if Tokens.kind(t) == Tokens.RPAREN openers[length(stack)+1][3] -= 1 end elseif Tokens.exactkind(t) in MODULE_STARTERS && (last_token == nothing || Tokens.kind(last_token) == Tokens.WHITESPACE) # new module next_modulename = i + 2 elseif i == next_modulename && Tokens.kind(t) == Tokens.IDENTIFIER && Tokens.kind(last_token) == Tokens.WHITESPACE push!(stack, Tokens.untokenize(t)) push!(openers, [0,0,0]) elseif Tokens.exactkind(t) in SCOPE_STARTERS # new non-module scope openers[length(stack)+1][1] += 1 elseif Tokens.exactkind(t) == Tokens.END # scope ended if openers[length(stack)+1][1] == 0 !isempty(stack) && pop!(stack) length(openers) > 1 && pop!(openers) else openers[length(stack)+1][1] -= 1 end end last_token = t end return join(stack, ".") end codemodule(code, pos::Cursor) = codemodule(code, pos.line) """ Takes a given Julia source file and another (absolute) path, gives the line on which the path is included in the file or 0. """ function includeline(file::AbstractString, included_file::AbstractString) # check for erroneous self includes, doesn't detect more complex cycles though file == included_file && return 0 line = 1 tokens = Tokenize.tokenize(read(file, String)) t, state = iterate(tokens) while true if Tokens.kind(t) == Tokens.WHITESPACE line += count(x -> x == '\n', t.val) elseif Tokens.kind(t) == Tokens.IDENTIFIER && t.val == "include" t, state = iterate(tokens, state) if Tokens.kind(t) == Tokens.LPAREN t, state = iterate(tokens, state) if Tokens.kind(t) == Tokens.STRING if normpath(joinpath(dirname(file), chop(t.val, head=1, tail=1))) == included_file return line end end end elseif Tokens.kind(t) == Tokens.ENDMARKER break end t, state = iterate(tokens, state) end return 0 end """ Takes an absolute path to a file and returns the (file, line) where that file is included or nothing. """ function find_include(path::AbstractString) for file in @> path dirname dirsnearby jl_files line = -1 try line = includeline(file, path) catch err return nothing end line > 0 && (return file, line) end end """ Takes an absolute path to a file and returns a string representing the module it belongs to. """ function filemodule_(path::AbstractString) loc = find_include(path) if loc != nothing file, line = loc mod = codemodule(read(file, String), line) super = filemodule(file) if super != "" && mod != "" return "$super.$mod" else return super == "" ? mod : super end end return "" end const filemodule = memoize(filemodule_) # Get all modules function children(m::Module) return @>> [moduleusings(m); getmodule.(Ref(m), string.(_names(m, all=true, imported=true)))] filter(x->isa(x, Module) && x ≠ m) unique end function allchildren(m::Module, cs = Set{Module}()) for c in children(m) c in cs || (push!(cs, c); allchildren(c, cs)) end return cs end
[ 27, 34345, 29, 10677, 14, 21412, 13, 20362, 198, 3500, 29130, 1096, 198, 198, 2, 784, 25608, 25608, 25608, 25608, 25608, 25608, 25608, 198, 2, 2773, 2393, 3384, 4487, 198, 2, 784, 25608, 25608, 25608, 25608, 25608, 25608, 25608, 198, 19...
2.377056
2,493
# This file is auto-generated by AWSMetadata.jl using AWS using AWS.AWSServices: fis using AWS.Compat using AWS.UUIDs """ create_experiment_template(actions, client_token, description, role_arn, stop_conditions) create_experiment_template(actions, client_token, description, role_arn, stop_conditions, params::Dict{String,<:Any}) Creates an experiment template. To create a template, specify the following information: Targets: A target can be a specific resource in your AWS environment, or one or more resources that match criteria that you specify, for example, resources that have specific tags. Actions: The actions to carry out on the target. You can specify multiple actions, the duration of each action, and when to start each action during an experiment. Stop conditions: If a stop condition is triggered while an experiment is running, the experiment is automatically stopped. You can define a stop condition as a CloudWatch alarm. For more information, see the AWS Fault Injection Simulator User Guide. # Arguments - `actions`: The actions for the experiment. - `client_token`: Unique, case-sensitive identifier that you provide to ensure the idempotency of the request. - `description`: A description for the experiment template. Can contain up to 64 letters (A-Z and a-z). - `role_arn`: The Amazon Resource Name (ARN) of an IAM role that grants the AWS FIS service permission to perform service actions on your behalf. - `stop_conditions`: The stop conditions. # Optional Parameters Optional parameters can be passed as a `params::Dict{String,<:Any}`. Valid keys are: - `"tags"`: The tags to apply to the experiment template. - `"targets"`: The targets for the experiment. """ function create_experiment_template( actions, clientToken, description, roleArn, stopConditions; aws_config::AbstractAWSConfig=global_aws_config(), ) return fis( "POST", "/experimentTemplates", Dict{String,Any}( "actions" => actions, "clientToken" => clientToken, "description" => description, "roleArn" => roleArn, "stopConditions" => stopConditions, ); aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end function create_experiment_template( actions, clientToken, description, roleArn, stopConditions, params::AbstractDict{String}; aws_config::AbstractAWSConfig=global_aws_config(), ) return fis( "POST", "/experimentTemplates", Dict{String,Any}( mergewith( _merge, Dict{String,Any}( "actions" => actions, "clientToken" => clientToken, "description" => description, "roleArn" => roleArn, "stopConditions" => stopConditions, ), params, ), ); aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end """ delete_experiment_template(id) delete_experiment_template(id, params::Dict{String,<:Any}) Deletes the specified experiment template. # Arguments - `id`: The ID of the experiment template. """ function delete_experiment_template(id; aws_config::AbstractAWSConfig=global_aws_config()) return fis( "DELETE", "/experimentTemplates/$(id)"; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end function delete_experiment_template( id, params::AbstractDict{String}; aws_config::AbstractAWSConfig=global_aws_config() ) return fis( "DELETE", "/experimentTemplates/$(id)", params; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end """ get_action(id) get_action(id, params::Dict{String,<:Any}) Gets information about the specified AWS FIS action. # Arguments - `id`: The ID of the action. """ function get_action(id; aws_config::AbstractAWSConfig=global_aws_config()) return fis( "GET", "/actions/$(id)"; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET ) end function get_action( id, params::AbstractDict{String}; aws_config::AbstractAWSConfig=global_aws_config() ) return fis( "GET", "/actions/$(id)", params; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end """ get_experiment(id) get_experiment(id, params::Dict{String,<:Any}) Gets information about the specified experiment. # Arguments - `id`: The ID of the experiment. """ function get_experiment(id; aws_config::AbstractAWSConfig=global_aws_config()) return fis( "GET", "/experiments/$(id)"; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET ) end function get_experiment( id, params::AbstractDict{String}; aws_config::AbstractAWSConfig=global_aws_config() ) return fis( "GET", "/experiments/$(id)", params; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end """ get_experiment_template(id) get_experiment_template(id, params::Dict{String,<:Any}) Gets information about the specified experiment template. # Arguments - `id`: The ID of the experiment template. """ function get_experiment_template(id; aws_config::AbstractAWSConfig=global_aws_config()) return fis( "GET", "/experimentTemplates/$(id)"; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end function get_experiment_template( id, params::AbstractDict{String}; aws_config::AbstractAWSConfig=global_aws_config() ) return fis( "GET", "/experimentTemplates/$(id)", params; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end """ list_actions() list_actions(params::Dict{String,<:Any}) Lists the available AWS FIS actions. # Optional Parameters Optional parameters can be passed as a `params::Dict{String,<:Any}`. Valid keys are: - `"maxResults"`: The maximum number of results to return with a single call. To retrieve the remaining results, make another call with the returned nextToken value. - `"nextToken"`: The token for the next page of results. """ function list_actions(; aws_config::AbstractAWSConfig=global_aws_config()) return fis("GET", "/actions"; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET) end function list_actions( params::AbstractDict{String}; aws_config::AbstractAWSConfig=global_aws_config() ) return fis( "GET", "/actions", params; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET ) end """ list_experiment_templates() list_experiment_templates(params::Dict{String,<:Any}) Lists your experiment templates. # Optional Parameters Optional parameters can be passed as a `params::Dict{String,<:Any}`. Valid keys are: - `"maxResults"`: The maximum number of results to return with a single call. To retrieve the remaining results, make another call with the returned nextToken value. - `"nextToken"`: The token for the next page of results. """ function list_experiment_templates(; aws_config::AbstractAWSConfig=global_aws_config()) return fis( "GET", "/experimentTemplates"; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end function list_experiment_templates( params::AbstractDict{String}; aws_config::AbstractAWSConfig=global_aws_config() ) return fis( "GET", "/experimentTemplates", params; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end """ list_experiments() list_experiments(params::Dict{String,<:Any}) Lists your experiments. # Optional Parameters Optional parameters can be passed as a `params::Dict{String,<:Any}`. Valid keys are: - `"maxResults"`: The maximum number of results to return with a single call. To retrieve the remaining results, make another call with the returned nextToken value. - `"nextToken"`: The token for the next page of results. """ function list_experiments(; aws_config::AbstractAWSConfig=global_aws_config()) return fis( "GET", "/experiments"; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET ) end function list_experiments( params::AbstractDict{String}; aws_config::AbstractAWSConfig=global_aws_config() ) return fis( "GET", "/experiments", params; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end """ list_tags_for_resource(resource_arn) list_tags_for_resource(resource_arn, params::Dict{String,<:Any}) Lists the tags for the specified resource. # Arguments - `resource_arn`: The Amazon Resource Name (ARN) of the resource. """ function list_tags_for_resource( resourceArn; aws_config::AbstractAWSConfig=global_aws_config() ) return fis( "GET", "/tags/$(resourceArn)"; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end function list_tags_for_resource( resourceArn, params::AbstractDict{String}; aws_config::AbstractAWSConfig=global_aws_config(), ) return fis( "GET", "/tags/$(resourceArn)", params; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end """ start_experiment(client_token, experiment_template_id) start_experiment(client_token, experiment_template_id, params::Dict{String,<:Any}) Starts running an experiment from the specified experiment template. # Arguments - `client_token`: Unique, case-sensitive identifier that you provide to ensure the idempotency of the request. - `experiment_template_id`: The ID of the experiment template. # Optional Parameters Optional parameters can be passed as a `params::Dict{String,<:Any}`. Valid keys are: - `"tags"`: The tags to apply to the experiment. """ function start_experiment( clientToken, experimentTemplateId; aws_config::AbstractAWSConfig=global_aws_config() ) return fis( "POST", "/experiments", Dict{String,Any}( "clientToken" => clientToken, "experimentTemplateId" => experimentTemplateId ); aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end function start_experiment( clientToken, experimentTemplateId, params::AbstractDict{String}; aws_config::AbstractAWSConfig=global_aws_config(), ) return fis( "POST", "/experiments", Dict{String,Any}( mergewith( _merge, Dict{String,Any}( "clientToken" => clientToken, "experimentTemplateId" => experimentTemplateId, ), params, ), ); aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end """ stop_experiment(id) stop_experiment(id, params::Dict{String,<:Any}) Stops the specified experiment. # Arguments - `id`: The ID of the experiment. """ function stop_experiment(id; aws_config::AbstractAWSConfig=global_aws_config()) return fis( "DELETE", "/experiments/$(id)"; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end function stop_experiment( id, params::AbstractDict{String}; aws_config::AbstractAWSConfig=global_aws_config() ) return fis( "DELETE", "/experiments/$(id)", params; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end """ tag_resource(resource_arn, tags) tag_resource(resource_arn, tags, params::Dict{String,<:Any}) Applies the specified tags to the specified resource. # Arguments - `resource_arn`: The Amazon Resource Name (ARN) of the resource. - `tags`: The tags for the resource. """ function tag_resource(resourceArn, tags; aws_config::AbstractAWSConfig=global_aws_config()) return fis( "POST", "/tags/$(resourceArn)", Dict{String,Any}("tags" => tags); aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end function tag_resource( resourceArn, tags, params::AbstractDict{String}; aws_config::AbstractAWSConfig=global_aws_config(), ) return fis( "POST", "/tags/$(resourceArn)", Dict{String,Any}(mergewith(_merge, Dict{String,Any}("tags" => tags), params)); aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end """ untag_resource(resource_arn) untag_resource(resource_arn, params::Dict{String,<:Any}) Removes the specified tags from the specified resource. # Arguments - `resource_arn`: The Amazon Resource Name (ARN) of the resource. # Optional Parameters Optional parameters can be passed as a `params::Dict{String,<:Any}`. Valid keys are: - `"tagKeys"`: The tag keys to remove. """ function untag_resource(resourceArn; aws_config::AbstractAWSConfig=global_aws_config()) return fis( "DELETE", "/tags/$(resourceArn)"; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end function untag_resource( resourceArn, params::AbstractDict{String}; aws_config::AbstractAWSConfig=global_aws_config(), ) return fis( "DELETE", "/tags/$(resourceArn)", params; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end """ update_experiment_template(id) update_experiment_template(id, params::Dict{String,<:Any}) Updates the specified experiment template. # Arguments - `id`: The ID of the experiment template. # Optional Parameters Optional parameters can be passed as a `params::Dict{String,<:Any}`. Valid keys are: - `"actions"`: The actions for the experiment. - `"description"`: A description for the template. - `"roleArn"`: The Amazon Resource Name (ARN) of an IAM role that grants the AWS FIS service permission to perform service actions on your behalf. - `"stopConditions"`: The stop conditions for the experiment. - `"targets"`: The targets for the experiment. """ function update_experiment_template(id; aws_config::AbstractAWSConfig=global_aws_config()) return fis( "PATCH", "/experimentTemplates/$(id)"; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end function update_experiment_template( id, params::AbstractDict{String}; aws_config::AbstractAWSConfig=global_aws_config() ) return fis( "PATCH", "/experimentTemplates/$(id)", params; aws_config=aws_config, feature_set=SERVICE_FEATURE_SET, ) end
[ 2, 770, 2393, 318, 8295, 12, 27568, 416, 30865, 9171, 14706, 13, 20362, 198, 3500, 30865, 198, 3500, 30865, 13, 12298, 5432, 712, 1063, 25, 277, 271, 198, 3500, 30865, 13, 40073, 198, 3500, 30865, 13, 52, 27586, 82, 198, 198, 37811, ...
2.525315
5,787
<reponame>jpjones76/SeisIO.jl export fill_pbo! # https://www.unavco.org/data/strain-seismic/bsm-data/lib/docs/bottle_format.pdf bottle_chans = Dict{String, Tuple{String,String}}( "BatteryVolts" => ("ABV", "V"), "CalOffsetCH0G3" => ("AO0", "{unknown}"), "CalOffsetCH1G3" => ("AO1", "{unknown}"), "CalOffsetCH2G3" => ("AO2", "{unknown}"), "CalOffsetCH3G3" => ("AO3", "{unknown}"), "CalStepCH0G2" => ("A02", "{unknown}"), "CalStepCH0G3" => ("A03", "{unknown}"), "CalStepCH1G2" => ("A12", "{unknown}"), "CalStepCH1G3" => ("A13", "{unknown}"), "CalStepCH2G2" => ("A22", "{unknown}"), "CalStepCH2G3" => ("A23", "{unknown}"), "CalStepCH3G2" => ("A32", "{unknown}"), "CalStepCH3G3" => ("A33", "{unknown}"), "DownholeDegC" => ("KD", "Cel"), "LoggerDegC" => ("K1", "Cel"), "PowerBoxDegC" => ("K2", "Cel"), "PressureKPa" => ("DI", "kPa"), "Rainfallmm" => ("R0", "mm"), "RTSettingCH0" => ("AR0", "{unknown}"), "RTSettingCH1" => ("AR1", "{unknown}"), "RTSettingCH2" => ("AR2", "{unknown}"), "RTSettingCH3" => ("AR3", "{unknown}"), "SolarAmps" => ("ASO", "A"), "SystemAmps" => ("ASY", "A") ) bottle_nets = Dict{String, String}( "AIRS" => "MC", "TEPE" => "GF", "BUY1" => "GF", "ESN1" => "GF", "TRNT" => "MC", "HALK" => "GF", "B948" => "ARRA", "OLV1" => "MC", "OLV2" => "MC", "GERD" => "MC", "SIV1" => "GF", "BOZ1" => "GF", "B947" => "ARRA" ) function check_bads!(x::AbstractArray, nv::T) where T # Check for bad samples @inbounds for i in x if i == nv return true end end return false end function channel_guess(str::AbstractString, fs::Float64) si = fs >= 1.0 ? 14 : 10 ei = length(str) - (endswith(str, "_20") ? 3 : 0) # name, id, units str = str[si:ei] if length(str) == 3 units = "m/m" else (str, units) = get(bottle_chans, str, ("YY", "{unknown}")) end # form channel string if length(str) == 2 str = (fs > 1.0 ? "B" : fs > 0.1 ? "L" : "R")*str end return (str, units) end function read_bottle!(S::GphysData, fstr::String, nx_new::Int64, nx_add::Int64, memmap::Bool, strict::Bool, v::Integer) buf = BUF.buf files = ls(fstr) for file in files io = memmap ? IOBuffer(Mmap.mmap(file)) : open(file, "r") # Read header ============================================================ fastskip(io, 8) t0 = round(Int64, fastread(io, Float64)*sμ) dt = fastread(io, Float32) nx = fastread(io, Int32) ty = fastread(io, Int32) nv = fastread(io, Int32) fastskip(io, 8) fs = 1.0/dt v > 2 && println("t0 = ", t0, ", fs = ", fs, ", nx = ", nx, ", ty = ", ty, ", nv = ", nv) # Read data ============================================================== T = ty == 0 ? Int16 : ty == 1 ? Int32 : Float32 nb = nx*sizeof(T) checkbuf_8!(buf, nb) fast_readbytes!(io, buf, nb) close(io) # Try to create an ID from the file name ================================= # Assumes fname SSSSyyJJJ... (SSSS = station, yy = year, JJJ = Julian day) fname = splitdir(file)[2] sta = fname[1:4] (cha, units) = channel_guess(fname, fs) # find relevant entry in station data net = get(bottle_nets, sta, "PB") id = net * "." * sta * ".." * cha # Load into S ============================================================ i = findid(id, S.id) if strict i = channel_match(S, i, fs) end if i == 0 # Create C.x x = Array{Float64,1}(undef, max(nx_new, nx)) os = 1 C = SeisChannel() setfield!(C, :id, id) setfield!(C, :fs, fs) setfield!(C, :units, units) mk_t!(C, nx, t0) setfield!(C, :x, x) push!(S, C) else xi = S.t[i][end,1] x = getindex(getfield(S, :x), i) check_for_gap!(S, i, t0, nx, v) Lx = length(x) if xi + nx > Lx resize!(x, Lx + max(nx_add, nx)) end os = xi + 1 end # Check for null values nv = T(nv) y = reinterpret(T, buf) b = T == Int16 ? false : check_bads!(y, nv) if b j = os @inbounds for i = 1:nx if y[i] == nv x[j] = NaN else x[j] = y[i] end j += 1 end else copyto!(x, os, y, 1, nx) end end trunc_x!(S) resize!(buf, 65535) return nothing end function read_bottle(fstr::String, nx_new::Int64, nx_add::Int64, memmap::Bool, strict::Bool, v::Integer) S = SeisData() read_bottle!(S, fstr, nx_new, nx_add, memmap, strict, v) return S end """ fill_pbo!(S) Attempt to fill `:name` and `:loc` fields of S using station names (second field of S.id) cross-referenced against a PBO station info file. """ function fill_pbo!(S::GphysData) sta_data = readdlm(path * "/Formats/PBO_bsm_coords.txt", ',', comments=false) sta_data[:,2] .= strip.(sta_data[:,2]) sta_data[:,6] .= strip.(sta_data[:,6]) n_sta = size(sta_data, 1) for i = 1:S.n sta = split(S.id[i], '.')[2] for j = 1:n_sta if sta_data[j, 1] == sta S.name[i] = String(sta_data[j,2]) lat = sta_data[j,3] lon = sta_data[j,4] el = sta_data[j,5] S.loc[i] = GeoLoc(lat = lat, lon = lon, el = el) break end end end return nothing end
[ 27, 7856, 261, 480, 29, 34523, 73, 1952, 4304, 14, 4653, 271, 9399, 13, 20362, 198, 39344, 6070, 62, 79, 2127, 0, 198, 198, 2, 3740, 1378, 2503, 13, 403, 615, 1073, 13, 2398, 14, 7890, 14, 2536, 391, 12, 325, 1042, 291, 14, 1443...
2.09189
2,503
module FisherPlot using LaTeXStrings using CairoMakie using Makie using Base: @kwdef function ellipseparameterization(a::Float64, b::Float64, θ::Float64) t = LinRange(0,2π, 200) x = Array(a .* sin.(θ) .* cos.(t) + b .* cos.(θ) .* sin.(t)) y = Array(a .* cos.(θ) .* cos.(t) - b .* sin.(θ) .* sin.(t)) return x, y end function gaussian(μ::Float64, σ::Float64, x) return 1/(sqrt(2π*σ^2))*exp(-0.5*(x-μ)^2/σ^2) end function ellipseparameters(covmatrix::Matrix{Float64}, i::Int64, j::Int64) σi = sqrt(covmatrix[i,i]) σj = sqrt(covmatrix[j,j]) σij = covmatrix[i,j] θ = (atan(2σij,(σi^2-σj^2)))/2 a = sqrt((σi^2+σj^2)/2+sqrt(((σi^2-σj^2)^2)/4+σij^2)) if i == j b = 0. else b = sqrt((σi^2+σj^2)/2-sqrt(((σi^2-σj^2)^2)/4+σij^2)) end return σi, σj, a, b, θ end function preparecanvas(LaTeX_array, limits, ticks, probes, colors, PlotPars::Dict) matrix_dim = length(LaTeX_array) #TODO: add the textsize to PlotPars figure = Makie.Figure(textsize = 40, font = PlotPars["font"]) for i in 1:matrix_dim for j in 1:i if i == j ax = Axis(figure[i,i], width = PlotPars["sidesquare"], height = PlotPars["sidesquare"], xticklabelsize = PlotPars["dimticklabel"], yticklabelsize = PlotPars["dimticklabel"], yaxisposition = (:right), xlabel = L"%$((LaTeX_array)[i])", xlabelsize = PlotPars["parslabelsize"], ylabel = L"P/P_\mathrm{max}",ylabelsize = PlotPars["PPmaxlabelsize"], yticks = [0,1], xticklabelrotation = PlotPars["xticklabelrotation"], xticks = ([ticks[i,1], 0.5*(ticks[i,1]+ticks[i,2]), ticks[i,2]], [string(myi) for myi in round.([ticks[i,1], 0.5*(ticks[i,1]+ticks[i,2]), ticks[i,2]], sigdigits = 3)])) Makie.ylims!(ax, (-0.0,1.05)) Makie.xlims!(ax, (limits[i,1],limits[i,2])) Makie.hideydecorations!(ax, ticks = false, ticklabels = false, label = false) if i != matrix_dim ax.alignmode = Mixed(right = MakieLayout.Protrusion(0), bottom = MakieLayout.Protrusion(0), top= MakieLayout.Protrusion(0)) hidexdecorations!(ax, ticks = true, ticklabels = true, label = true) else hidexdecorations!(ax, ticks = false, ticklabels = false, label = false) end else ax = Axis(figure[i,j], width = PlotPars["sidesquare"], height = PlotPars["sidesquare"], xticklabelsize = PlotPars["dimticklabel"], yticklabelsize = PlotPars["dimticklabel"], ylabel = L"%$(LaTeX_array[i])", xlabel = L"%$((LaTeX_array)[j])", ylabelsize = PlotPars["parslabelsize"], xlabelsize = PlotPars["parslabelsize"], xticklabelrotation = PlotPars["xticklabelrotation"], yticks = ([ticks[i,1], 0.5*(ticks[i,1]+ticks[i,2]), ticks[i,2]], [string(myi) for myi in round.([ticks[i,1], 0.5*(ticks[i,1]+ticks[i,2]), ticks[i,2]], sigdigits = 3)]), xticks = ([ticks[j,1], 0.5*(ticks[j,1]+ticks[j,2]), ticks[j,2]], [string(myi) for myi in round.([ticks[j,1], 0.5*(ticks[j,1]+ticks[j,2]), ticks[j,2]], sigdigits = 3)]), yticklabelpad=8) Makie.ylims!(ax, (limits[i,1],limits[i,2])) Makie.xlims!(ax, (limits[j,1],limits[j,2])) if i == matrix_dim hidexdecorations!(ax, ticks = false, ticklabels = false, label = false) else hidexdecorations!(ax, ticks = true, ticklabels = true, label = true) end if j == 1 hideydecorations!(ax, ticks = false, ticklabels = false, label = false) Legend(figure[1,matrix_dim], [PolyElement(color = color, strokecolor = color, strokewidth = 1) for color in colors], probes, tellheight = false, tellwidth = false, rowgap = 10, halign = :right, valign = :top, framecolor = :black, labelsize =55, patchsize = (70, 40), framevisible = true) else hideydecorations!(ax, ticks = true, ticklabels = true, label = true) ax.alignmode = Mixed(right = MakieLayout.Protrusion(0), bottom = MakieLayout.Protrusion(0), top = MakieLayout.Protrusion(0)) end end end end Makie.resize!(figure.scene, figure.layout.layoutobservables.reportedsize[]...) return figure end function drawgaussian!(canvas, σ, i, central, color) ax = canvas[i,i] x = Array(LinRange(-4σ+central,4σ+central, 200)) Makie.lines!(ax, x, gaussian.(central, σ, x)./gaussian.(central, σ, central), color = color, linewidth = 4) Makie.band!(ax, x, 0, gaussian.(central, σ, x)./gaussian.(central, σ, central) , color=(color, 0.2)) x = Array(LinRange(-σ+central,σ+central, 200)) Makie.band!(ax, x, 0, gaussian.(central, σ, x)./gaussian.(central, σ, central) , color=(color, 0.4)) end function drawellipse!(canvas, i, j, x, y, central_values, color) ax = canvas[i,j] Makie.lines!(ax, x .+ central_values[j], y .+ central_values[i], color = color, linewidth = 4) Makie.lines!(ax, 3x .+ central_values[j], 3y .+ central_values[i], color = color, linewidth = 4) Makie.band!(ax, x .+ central_values[j], 0, y .+ central_values[i], color=(color, 0.4)) Makie.band!(ax, 3x .+ central_values[j], 0, 3y .+ central_values[i], color=(color, 0.2)) end function paintcorrmatrix!(canvas, central_values, corr_matrix, color) for i in 1:length(central_values) for j in 1:i if i == j drawgaussian!(canvas, sqrt(corr_matrix[i,i]), i, central_values[i], color) else σi, σj, a, b, θ = ellipseparameters(corr_matrix, i,j) x,y = ellipseparameterization(a, b, θ) drawellipse!(canvas, i, j, x, y, central_values, color) end end end end function save(filename, obj) Makie.save(filename, obj) end end # module
[ 21412, 14388, 43328, 198, 198, 3500, 4689, 49568, 13290, 654, 198, 3500, 23732, 44, 461, 494, 198, 3500, 15841, 494, 198, 3500, 7308, 25, 2488, 46265, 4299, 198, 198, 8818, 30004, 541, 325, 17143, 2357, 1634, 7, 64, 3712, 43879, 2414, ...
1.913136
3,281
<reponame>Wimmerer/SatisfiabilityInterface.jl struct BinaryRelation{O, S, T} x::S y::T end BinaryRelation{O}(x::X, y::Y) where {O,X,Y} = BinaryRelation{O,X,Y}(x, y) x = DiscreteVariable(:x, 1:5) y = DiscreteVariable(:y, 2:6) # BinaryRelation(==, x, y) # BinaryRelation(==, x, 1) # Use NodeVariables to break up binary relations like x + y ~ 3 and ternary such as x + y <= z struct NodeVariable <: Var name op x y domain booleans varmap end Base.show(io::IO, var::NodeVariable) = print(io, "$(var.name) = $(var.op)($(var.x), $(var.y))") find_domain(op, x, y) = sort(collect(Set([op(i, j) for i in domain(x) for j in domain(y)]))) domain(v::Var) = v.domain booleans(v::Var) = v.booleans domain(x::Real) = x:x "All booleans inside an expression that must be added to the encoding" recursive_booleans(v::NodeVariable) = v.booleans ∪ booleans(v.x) ∪ booleans(v.y) function NodeVariable(op, x, y, name=gensym()) domain = find_domain(op, x, y) booleans = [Variable(name, i) for i ∈ indices(domain)] varmap = Dict(i => v for (i, v) in zip(domain, booleans)) NodeVariable(name, op, x, y, domain, booleans, varmap) end Base.:+(x::Var, y) = NodeVariable(+, x, y) Base.:+(x, y::Var) = NodeVariable(+, x, y) Base.:*(x::Var, y) = NodeVariable(*, x, y) Base.:*(x, y::Var) = NodeVariable(*, x, y) Base.:^(x::Var, y) = NodeVariable(^, x, y) Base.:^(x, y::Var) = NodeVariable(^, x, y) function clauses(var::NodeVariable) op = var.op x = var.x y = var.y clauses = exactly_one(var.booleans) # deal with 2 + X if x isa Real for j in domain(var.y) value = op(x, j) # y == j => var == op(x, j) push!(clauses, ¬(y.varmap[j]) ∨ var.varmap[value]) end # deal with x + 2 elseif y isa Real for i in domain(var.x) value = op(i, y) # x == i => var == op(i, y) push!(clauses, ¬(x.varmap[i]) ∨ var.varmap[value]) end else # neither x nor y is real for i in domain(var.x) for j in domain(var.y) value = op(i, j) # x == i && y == j => var == op(i, j) push!(clauses, ¬(x.varmap[i]) ∨ ¬(y.varmap[j]) ∨ var.varmap[value]) end end end return clauses end Base.:(==)(v::Var, w) = BinaryRelation{==}(v, w) Base.:(<=)(v::Var, w) = BinaryRelation{<=}(v, w) "Encode relation like x == 1" function encode(rel::BinaryRelation{==, <:Var, <:Real}) x = rel.x y = rel.y if y ∉ domain(x) error("$y is not in the domain of $x") end boolean = x.varmap[y] return [boolean] end "Encode relation like x != 1" function encode(rel::BinaryRelation{!=, <:Var, <:Real}) x = rel.x y = rel.y if y ∈ domain(x) boolean = ¬(x.varmap[y]) end return [boolean] end "Encode relation like x == y" function encode(rel::BinaryRelation{==, <:Var, <:Var}) x = rel.x y = rel.y clauses = [] for i in domain(x) if i in domain(y) # (x == i) => (y == i) push!(clauses, ¬(x.varmap[i]) ∨ (y.varmap[i])) else push!(clauses, ¬(x.varmap[i])) end end for i in domain(y) if i in domain(x) # (y == i) => (x == i) push!(clauses, ¬(y.varmap[i]) ∨ (x.varmap[i])) else push!(clauses, ¬(y.varmap[i])) end end return clauses end function encode(rel::BinaryRelation{!=, <:Var, <:Var}) x = rel.x y = rel.y clauses = [] for i in domain(x) if i in domain(y) # (x == i) => (y != i) push!(clauses, ¬(x.varmap[i]) ∨ ¬(y.varmap[i])) end end return clauses end function parse_expression(varmap, ex) op = operation(ex) args = arguments(ex) new_args = parse_expression.(Ref(varmap), args) return op, new_args end parse_expression(varmap, ex::Term) = varmap[ex] parse_expression(varmap, ex::Sym) = varmap[ex] parse_expression(varmap, ex::Num) = parse_expression(varmap, value(ex)) parse_expression(varmap, ex::Real) = ex "Parse a symbolic expression into a relation" function parse_relation(varmap, ex) op = operation(ex) args = arguments(ex) lhs = args[1] rhs = args[2] return BinaryRelation{op}(parse_expression(varmap, lhs), parse_expression(varmap, rhs)) end # function parse_relation!(varmap, ex::Equation) # varmap[ex.lhs] = parse_expression(varmap, ex.rhs) # end is_variable(ex) = !istree(ex) || (operation(ex) == getindex) function process(constraint) new_constraints = [] constraint2 = value(constraint) op = operation(constraint2) args = arguments(constraint2) lhs = args[1] rhs = args[2] intermediates_generated = false if !is_variable(lhs) lhs = ReversePropagation.cse_equations(lhs) append!(new_constraints, lhs[1]) lhs = lhs[2] end if !is_variable(rhs) rhs = ReversePropagation.cse_equations(rhs) append!(new_constraints, rhs[1]) rhs = rhs[2] end # @show new_constraints # @show op, lhs, rhs push!(new_constraints, op(lhs, rhs)) return new_constraints end process(constraints::Vector) = reduce(vcat, process(constraint) for constraint in constraints) function parse_constraint!(domains, ex) expr = value(ex) op = operation(expr) new_constraints = [] if op == ∈ # assumes right-hand side is an explicit set specifying the doomain args = arguments(expr) var = args[1] domain = args[2] domains[var] = domain else new_constraints = process(expr) println() # @show expr # @show new_constraints end return domains, new_constraints end function parse_constraints(constraints) # domains = Dict(var => -Inf..Inf for var in vars) additional_vars = [] domains = Dict() all_new_constraints = [] # excluding domain constraints for constraint in constraints # binarize constraints: domains, new_constraints = parse_constraint!(domains, value(constraint)) for statement in new_constraints if statement isa Assignment push!(additional_vars, statement.lhs) end end append!(all_new_constraints, new_constraints) end # append!(additional_vars, keys(domains)) return domains, all_new_constraints, additional_vars end Base.isless(x::Sym, y::Sym) = isless(x.name, y.name) Base.isless(x::Term, y::Term) = isless(string(x), string(y)) Base.isless(x::Term, y::Sym) = isless(string(x), string(y)) Base.isless(x::Sym, y::Term) = isless(string(x), string(y)) struct ConstraintSatisfactionProblem original_vars additional_vars # from binarizing domains constraints end function ConstraintSatisfactionProblem(constraints) domains, new_constraints, additional_vars = parse_constraints(constraints) @show keys(domains) vars = sort(identity.(keys(domains))) additional_vars = sort(identity.(additional_vars)) return ConstraintSatisfactionProblem(vars, additional_vars, domains, new_constraints) end struct DiscreteCSP original_vars additional_vars constraints varmap # maps symbolic variables to the corresponding DiscreteVariable end DiscreteCSP(constraints) = DiscreteCSP(ConstraintSatisfactionProblem(constraints)) function DiscreteCSP(prob::ConstraintSatisfactionProblem) variables = [] varmap = Dict() new_constraints = [] for (var, domain) in prob.domains variable = DiscreteVariable(var, domain) push!(variables, variable) push!(varmap, var => variable) end for constraint in prob.constraints constraint = value(constraint) if constraint isa Assignment lhs = constraint.lhs op, new_args = parse_expression(varmap, constraint.rhs) # makes a NodeVariable # @show op, new_args variable = NodeVariable(op, new_args[1], new_args[2], lhs) push!(variables, variable) push!(varmap, lhs => variable) else # @show constraint push!(new_constraints, parse_relation(varmap, constraint)) end end original_vars = [varmap[var] for var in prob.original_vars] additional_vars = [varmap[var] for var in prob.additional_vars] return DiscreteCSP(original_vars, additional_vars, new_constraints, varmap) end function encode(prob::DiscreteCSP) all_variables = [] all_clauses = [] variables = Any[prob.original_vars; prob.additional_vars] domains = Dict(v.name => v.domain for v in variables) for var in variables append!(all_variables, var.booleans) append!(all_clauses, clauses(var)) end # @show prob.constraints for constraint in prob.constraints # @show constraint append!(all_clauses, encode(constraint)) end # @show all_variables # @show all_clauses return SymbolicSATProblem(identity.(all_variables), identity.(all_clauses)) end function solve(prob::DiscreteCSP) symbolic_sat_problem = encode(prob) status, result_dict = solve(symbolic_sat_problem) (status == :unsat) && return status, missing # variables = Any[prob.original_vars; prob.additional_vars] variables = prob.original_vars return status, decode(prob, result_dict) end decode(prob::DiscreteCSP, result_dict) = Dict(v.name => decode(result_dict, v) for v in prob.original_vars) function all_solutions(prob::DiscreteCSP) sat_problem = encode(prob) # variables = Any[prob.original_vars; prob.additional_vars] variables = prob.original_vars prob2 = encode(prob) prob3 = prob2.p # SATProblem sat_solutions = all_solutions(prob3) if isempty(sat_solutions) return sat_solutions end solutions = [] for solution in sat_solutions push!(solutions, decode(prob, decode(prob2, solution))) end return solutions end
[ 27, 7856, 261, 480, 29, 54, 8608, 11882, 14, 50, 17403, 12455, 39317, 13, 20362, 628, 628, 628, 198, 7249, 45755, 6892, 341, 90, 46, 11, 311, 11, 309, 92, 198, 220, 220, 220, 2124, 3712, 50, 198, 220, 220, 220, 331, 3712, 51, 22...
2.208495
4,638
<reponame>moeinkh88/FdeSolver.jl using Test using FdeSolver @testset "FdeSolver.jl" begin b = FdeSolver.greet() @test @isdefined(b) end
[ 27, 7856, 261, 480, 29, 76, 2577, 676, 71, 3459, 14, 37, 2934, 50, 14375, 13, 20362, 198, 3500, 6208, 198, 3500, 376, 2934, 50, 14375, 198, 198, 31, 9288, 2617, 366, 37, 2934, 50, 14375, 13, 20362, 1, 2221, 198, 220, 220, 220, 2...
2.101449
69
<reponame>clintonTE/CCA<gh_stars>0 struct Characteristic <: AbstractCharacteristic ws::WeightSpec Fξ::Symbol X::Dict{Symbol, Symbol} end #builds a characteristic object, which includes cross-sectional weights and #weight coefficients function Characteristic(ws::WeightSpec, Fξ::Symbol) Fw = Symbol(:w, ws.weightprefix, Fξ) #a couple of helper funtions for consistent renaming lagname(s::Symbol) = Symbol(:L, s) retname(s::Symbol) = Symbol(:R, s) rettname(s::Symbol) = Symbol(:Rt, s) #WARNING: HARDCODE ALERT!!! X = Dict{Symbol, Symbol}() X[:Fw] = Fw X[:FLw] = lagname(X[:Fw]) X[:FLLw] = lagname(X[:FLw]) X[:FLLLw] = lagname(X[:FLLw]) #not used for now X[:FRLw] = retname(X[:FLw]) X[:FRLLw] = retname(X[:FLLw]) X[:FRtw] = rettname(X[:Fw]) return Characteristic(ws, Fξ, X) end weightfields(ξ::Characteristic) = collect(values(ξ.X)) Characteristic(ξ::Characteristic, Fξ::Symbol, X::Dict ) = Characteristic(ξ.ws, Fξ, X) demeanξ(ξraw::AbstractVector{<:Union{Real, Missing}}) = ξraw .- mean(skipmissing(ξraw)) #this gives the quantile fo each value in an array #would have preferred the ecdf function, but it doesn't play nice with #containers that can hold missing values, even if none are actually held #=function quantiles(ξraw::AbstractVector{<:Union{Real,Missing}}) (length(ξraw) .- competerank(ξraw,rev=true) .+ 1)./length(ξraw) end=# function quantiles(ξraw::AbstractVector{<:Union{Real,Missing}}) (length(ξraw) .- competerank(ξraw,rev=true) .+ 1)./length(ξraw) end #alternate procedure #=function quantiles(ξraw::AbstractVector{<:Union{Real,Missing}}) F = ecdf(ξraw |> Vector{Float64}) return map(F, ξraw) end=# #conditions each slice of the panel for a particular characteristic function conditionξ!(F::Function, panel::AbstractDataFrame, Fξraw::Symbol, Fξ::Symbol)::Nothing (sum((!ismissing).(panel[!, Fξ])) > 0) && error("$Fξ in panel already contains data") spanels::GroupedDataFrame = groupby(view(panel, (!ismissing).(panel[!,Fξraw]), :), :date) Threads.@threads for i ∈ 1:length(spanels) spanel::SubDataFrame = spanels[i] Fξsubcol::SubArray = spanel[!, Fξ] Fξsubcol .= F(spanel[!, Fξraw]) end return nothing end #=standard conditioning of a characteristic column function conditionξ!(panel::AbstractDataFrame, Fξraw::Symbol; prefix::Symbol = PARAM[:charprefix], Fξ::Symbol = Symbol(prefix, Fξraw))::Nothing #allocate the data ξtype::Type = Union{eltype(panel[!,Fξraw]), Missing} panel[!, Fξ] = missings(ξtype, size(panel,1)) conditionξ!(demeanξ, panel, Fξraw, Fξ) return nothing end #apply a quantile transformation before demeaning function conditionξquantile!(panel::AbstractDataFrame, Fξraw::Symbol; prefix::Symbol = PARAM[:charprefix], Fξ::Symbol = Symbol(prefix, Fξraw))::Nothing #allocate the data panel[!, Fξ] = Vector{Union{eltype(panel[!,Fξraw])}}(undef, size(panel,1)) conditionξ!(demeanξ ∘ quantiles, panel, Fξraw, Fξ) return nothing end=#
[ 27, 7856, 261, 480, 29, 37821, 9328, 14, 4093, 32, 27, 456, 62, 30783, 29, 15, 198, 198, 7249, 15684, 2569, 1279, 25, 27741, 27275, 2569, 198, 220, 266, 82, 3712, 25844, 22882, 198, 220, 376, 138, 122, 3712, 13940, 23650, 198, 220, ...
2.51602
1,186
# licor_split.jl # # Split Li-7200 TXT files into GHG archives # # <NAME> # Thünen Institut # Institut für Agrarklimaschutz # Junior Research Group NITROSPHERE # Julia 0.7 # 20.05.2014 # Last Edit: 12.04.2019 "# licor_split(source::String,destination::String;verbose::Bool=false) Split an Li-7200 text file into small files in the standard GHG format. If possible, files will start on the usual four hour marks (0000, 0400, 0800, etc.). `licor_split(source,destination)` Split Li7200 files in the source directors\n * **source**::String = Directory of Li-7200 text files with names similar to 2016-03-17T104500.txt * **destination**::String = Destination directory\n\n ---\n #### Keywords:\n * verbose::Bool = Display information as the function runs, TRUE is default \n\n" function licor_split(Dr::String,Dest::String;verbose::Bool=true) ################### ## Definitions ## ################### # Dr = Source Directory # Dest = Destination Directory #################### ## Parse Inputs ## #################### # Check Directory Validity if ~isdir(Dr) | ~isdir(Dest) error("Source or destination directory does not exist") end (files,folders) = dirlist(Dr,regex=r"\d{4}-\d{2}-\d{2}T\d{6}\.txt$",recur=1) # List TXT files ##################### ## Process Files ## ##################### if isempty(files) println("No Metdata files to split") else if verbose println("=== Splitting Metdata Files ===") end end time = DateTime[] starttime = DateTime[] endtime = DateTime[] fname = String[] header = Array{String}(undef,0) # Initialized header array sentinel = 20; # Sentinel value for header while loop for i=1:1:length(files) if verbose println(" " * files[i]) end s = stat(files[i]) # Get file info fid = open(files[i],"r") # Load Header j = 1; l = "Bierchen" # Needs any string at least 5 characters long while l[1:5] != "DATAH" && j < sentinel l = readline(fid,keep=true) header = [header;l] j += 1 end data_pos = position(fid) # Position of where the data starts #Get Start Time l = readline(fid,keep=true) ft = findall(x -> x == '\t',l) starttime = DateTime(l[ft[6]+1:ft[8]-1],"yyyy-mm-dd\tHH:MM:SS:sss") # Get End Time endline = true lastpos = 4 # Characters from the end of the file where the last line begins while endline == true seek(fid,s.size-lastpos) l = readline(fid,keep=true) if eof(fid) == false endline = false else lastpos += 2 end end l = readline(fid,keep=true) ft = findall(x -> x == '\t',l) endtime = DateTime(l[ft[6]+1:ft[8]-1],"yyyy-mm-dd\tHH:MM:SS:sss") # Split the File seek(fid,data_pos) # Move the cursor to the start of the data fid2 = open(files[i]);close(fid2) next_start = [] first_file = true while eof(fid) == false if isopen(fid2) == false # No output stream available # Open new output file from previous line if first_file == true # There is not previously loaded line, load one now l = readline(fid,keep=true) first_file = false end # Calculate last value of file ft = findall(x -> x == '\t',l) temp_start = DateTime(l[ft[6]+1:ft[8]-1],"yyyy-mm-dd\tHH:MM:SS:sss") HH2 = Dates.Hour[] DD2 = Dates.Day(temp_start) if Dates.Hour(0) <= Dates.Hour(temp_start) < Dates.Hour(4) HH2 = Dates.Hour(4) elseif Dates.Hour(4) <= Dates.Hour(temp_start) < Dates.Hour(8) HH2 = Dates.Hour(8) elseif Dates.Hour(8) <= Dates.Hour(temp_start) < Dates.Hour(12) HH2 = Dates.Hour(12) elseif Dates.Hour(12) <= Dates.Hour(temp_start) < Dates.Hour(16) HH2 = Dates.Hour(16) elseif Dates.Hour(16) <= Dates.Hour(temp_start) < Dates.Hour(20) HH2 = Dates.Hour(20) elseif Dates.Hour(20) <= Dates.Hour(temp_start) < Dates.Hour(24) HH2 = Dates.Hour(0) DD2 = DD2 + Dates.Day(1) end next_start = DateTime(Dates.Year(temp_start),Dates.Month(temp_start),DD2,HH2) # Generate File Name for j=1:1:length(header) if occursin(r"^Instrument:",header[j]) fname = joinpath(Dest,Dates.format(temp_start,"yyyy-mm-ddTHHMMSS") * "_" * header[j][13:end-1] * ".data") end end if verbose println("\t\t- " * fname) end fid2 = open(fname,"w+") # Find and replace the Timestamp header line for j=1:1:length(header); if occursin(r"^Timestamp",header[j]) header[j] = "Timestamp: " * Dates.format(temp_start,"yyyy-mm-dd HH:MM:SS:sss") * "\n" end end # Iteratively write the header for j=1:1:length(header) write(fid2,header[j]) end write(fid2,l) # Write the line used to create the file name else # An output stream is available l = readline(fid,keep=true) # Load in another line # Write or Close ft = findall(x -> x == '\t',l) temp_end = DateTime(l[ft[6]+1:ft[8]-1],"yyyy-mm-dd\tHH:MM:SS:sss") if temp_end >= next_start # The current line is newer than the start of the next file, close the current file close(fid2) # Zipped File Name (minus extension) fzip = splitext(fname)[1] # Zip File if verbose println("\t\t\tCompressing...") end fzip = fzip * ".ghg" ziptextfiles(fzip,fname) # Zip file rm(fname) else # Still within range, write the current line write(fid2,l) end end end close(fid2) close(fid) # Zipped File Name (minus extension) fzip = splitext(fname)[1] # Zip the final file if verbose println("\t\t\tCompressing...") end fzip = fzip * ".ghg" fzip2 = fzip * ".ghg" ziptextfiles(fzip,fname) # Zip file rm(fname) end if verbose println("Complete") end end
[ 2, 3476, 273, 62, 35312, 13, 20362, 201, 198, 2, 201, 198, 2, 220, 220, 27758, 7455, 12, 22, 2167, 15326, 51, 3696, 656, 24739, 38, 22415, 201, 198, 2, 201, 198, 2, 1279, 20608, 29, 201, 198, 2, 536, 9116, 38572, 37931, 315, 201...
2.098745
3,028
function CircularFieldOfView(arg0::Vector3D, arg1::jdouble, arg2::jdouble) return CircularFieldOfView((Vector3D, jdouble, jdouble), arg0, arg1, arg2) end function get_center(obj::SmoothFieldOfView) return jcall(obj, "getCenter", Vector3D, ()) end function get_footprint(obj::SmoothFieldOfView, arg0::Transform, arg1::OneAxisEllipsoid, arg2::jdouble) return jcall(obj, "getFootprint", List, (Transform, OneAxisEllipsoid, jdouble), arg0, arg1, arg2) end function get_half_aperture(obj::CircularFieldOfView) return jcall(obj, "getHalfAperture", jdouble, ()) end function get_x(obj::SmoothFieldOfView) return jcall(obj, "getX", Vector3D, ()) end function get_y(obj::SmoothFieldOfView) return jcall(obj, "getY", Vector3D, ()) end function get_z(obj::SmoothFieldOfView) return jcall(obj, "getZ", Vector3D, ()) end function offset_from_boundary(obj::CircularFieldOfView, arg0::Vector3D, arg1::jdouble, arg2::VisibilityTrigger) return jcall(obj, "offsetFromBoundary", jdouble, (Vector3D, jdouble, VisibilityTrigger), arg0, arg1, arg2) end function project_to_boundary(obj::CircularFieldOfView, arg0::Vector3D) return jcall(obj, "projectToBoundary", Vector3D, (Vector3D,), arg0) end
[ 8818, 7672, 934, 15878, 5189, 7680, 7, 853, 15, 3712, 38469, 18, 35, 11, 1822, 16, 3712, 73, 23352, 11, 1822, 17, 3712, 73, 23352, 8, 198, 220, 220, 220, 1441, 7672, 934, 15878, 5189, 7680, 19510, 38469, 18, 35, 11, 474, 23352, 11...
2.65
460
<reponame>rawrgrr/LSystems.jl<filename>examples/draw_dragon.jl using Cairo using LSystems c = CairoRGBSurface(485, 720); cr = CairoContext(c); save(cr); set_source_rgb(cr, 1.0, 1.0, 1.0); rectangle(cr, 0.0, 0.0, 485.0, 720.0); fill(cr); restore(cr); save(cr); x, y, a, d = 310., 560., 90, 15 set_line_width(cr, 1); move_to(cr, x, y); dragon_start = "A" dragon_trans = Dict([ ('A', "A+BF"), ('B', "FA-B") ]) function determine_new_position(x, y, a, d) x -= sind(a) * d y -= cosd(a) * d return x, y end level = 10 drawing_instructions = @task dol_system(dragon_start, dragon_trans, level) for v in drawing_instructions if v == 'F' x, y = determine_new_position(x, y, a, d) line_to(cr, x, y) elseif v == '+' a -= 90 elseif v == '-' a += 90 elseif v == '[' push!(s, [x, y, a]) elseif v == ']' x, y, a = pop!(s) move_to(cr, x, y) end end stroke(cr); write_to_png(c, "dragon_$level.png");
[ 27, 7856, 261, 480, 29, 1831, 81, 2164, 81, 14, 6561, 6781, 82, 13, 20362, 27, 34345, 29, 1069, 12629, 14, 19334, 62, 14844, 13, 20362, 198, 3500, 23732, 198, 3500, 406, 11964, 82, 198, 198, 66, 796, 23732, 48192, 4462, 333, 2550, ...
1.973948
499
<filename>src/convert.jl<gh_stars>1-10 ########### ## asArr ## ########### ## asArr: try conversion to Array, implicitly dealing with NAs ## ## using DataFrames, columns may be of different type and hence are ## possibly not compatible with each other as columns of an array function asArr{T}(da::DataArray{T, 1}, typ::Type=Any, replaceNA=NA) ## convert DataArray to typ and replace NAs with replaceNA vals = convert(Array{typ, 1}, da.data) vals[da.na] = replaceNA return vals end function asArr(df::DataFrame, typ::Type=Any, replaceNA=NA) nObs, nAss = size(df) vals = Array(typ, nObs, nAss) ## copying into this array implicitly forces conversion to this ## type afterwards for ii=1:nAss if isa(df.columns[ii], DataArray) # deal with NAs if eltype(df.columns[ii]) == NAtype # column of NAs only vals[:, ii] = replaceNA else vals[:, ii] = df.columns[ii].data vals[df.columns[ii].na, ii] = replaceNA end else # no NAs in simple Array vals[:, ii] = df.columns[ii] end end return vals end function asArr(dfr::DataFrameRow, typ::Type=Any, replaceNA=NA) nObs = length(dfr) res = Array(typ, 1, nObs) for ii=1:nObs if isna(dfr[ii]) res[1, ii] = replaceNA else res[1, ii] = dfr[ii] end end return res end function asArr(tn::AbstractTimedata, typ::Type=Any, replaceNA=NA) return asArr(tn.vals, typ, replaceNA) end ## problem: columns with NAs only ## problem: NaN in boolean context will be true ## problem: DataArray{Any, 1} also exist: da.data then contains NAs ############# ## Timenum ## ############# import Base.convert ## to Timedata: conversion upwards - always works function convert(::Type{Timedata}, tn::Timenum) return Timedata(tn.vals, tn.idx) end ## to Timematr: conversion downwards - fails for NAs function convert(::Type{Timematr}, tn::Timenum, rmNA = false) if rmNA tm = narm(tn) tm = Timematr(tm.vals, tm.idx) else tm = Timematr(tn.vals, tn.idx) end return tm end ############## ## Timematr ## ############## ## to Timedata: conversion upwards - always works function convert(::Type{Timedata}, tm::Timematr) Timedata(tm.vals, tm.idx) end ## to Timenum: conversion upwards - always works function convert(::Type{Timenum}, tm::Timematr) Timenum(tm.vals, tm.idx) end ############## ## Timedata ## ############## ## to Timenum: conversion downwards - fails for non-numeric values function convert(::Type{Timenum}, td::Timedata) Timenum(td.vals, td.idx) end ## to Timematr: conversion downwards - fails for NAs function convert(::Type{Timematr}, td::Timedata) Timematr(td.vals, td.idx) end ################ ## DataFrames ## ################ ## convert DataFrame with dates column (as String) to TimeData object function convert(::Type{AbstractTimedata}, df::DataFrame) ## test if some column already is of type Date if any(eltypes(df) .== Date) ## take first occuring column dateCol = find(eltypes(df) .== Date)[1] idx = convert(Array, df[dateCol]) delete!(df, [dateCol]) else ## find column that contain dates as String # find columns that have been parsed as Strings by readtable col_to_test = Array(Symbol, 0) nCols = size(df, 2) for ii=1:nCols isa(df[1, ii], String)? push!(col_to_test, names(df)[ii]): nothing end # test each column's data to see if Datetime will parse it col_that_pass = Array(Symbol, 0) for colname in col_to_test d = match(r"[-|\s|\/|.]", df[1, colname]) d !== nothing? (bar = split(df[1, colname], d.match)): (bar = []) if length(bar) == 3 push!(col_that_pass, colname) end end # parse first column that passes the Datetime regex test idx = Date[Date(d) for d in df[col_that_pass[1]]] # without # Date it would fail chkIdx # in constructor delete!(df, [col_that_pass[1]]) end ## try whether DataFrame fits subtypes try td = Timematr(df, idx) return td catch try td = Timenum(df, idx) return td catch td = Timedata(df, idx) return td end end return td end ################ ## TimeArrays ## ################ function convert(::Type{AbstractTimedata}, ta::TimeArray) namesAsSymbols = [DataFrames.identifier(nam) for nam in ta.colnames] df = composeDataFrame(ta.values, namesAsSymbols) idx = ta.timestamp try td = Timematr(df, idx) return td catch try td = Timenum(df, idx) return td catch td = Timedata(df, idx) return td end end td end function convert(::Type{TimeArray}, tn::AbstractTimenum) dats = idx(tn) nams = UTF8String[string(names(tn)[ii]) for ii = 1:size(tn, 2)] return TimeArray(dats, asArr(tn, Float64, NaN), nams) end
[ 27, 34345, 29, 10677, 14, 1102, 1851, 13, 20362, 27, 456, 62, 30783, 29, 16, 12, 940, 198, 7804, 21017, 198, 2235, 355, 3163, 81, 22492, 198, 7804, 21017, 198, 198, 2235, 355, 3163, 81, 25, 1949, 11315, 284, 15690, 11, 31821, 7219, ...
2.176447
2,454
# SINGLE NODE/CORE VERSION import Pkg; Pkg.instantiate() include("/users/yh31/scratch/projects/gigaword_64k/src/gigaword_64k.jl") const path_apw_dir = "/users/yh31/scratch/datasets/entity_linking/raw_data/gigaword/giga5/data/apw_eng" const path_intermed_data = "/users/yh31/scratch/datasets/entity_linking/raw_data/gigaword/giga_topk/intermediate_files" const path_intermed_apw = joinpath(path_intermed_data, "apw") process_part_of_tree(path_apw_dir, path_intermed_apw, 4)
[ 2, 311, 2751, 2538, 399, 16820, 14, 34, 6965, 44156, 2849, 198, 198, 11748, 350, 10025, 26, 350, 10025, 13, 8625, 415, 9386, 3419, 198, 198, 17256, 7203, 14, 18417, 14, 88, 71, 3132, 14, 1416, 36722, 14, 42068, 14, 70, 328, 707, 5...
2.274882
211
<gh_stars>1-10 # fundamental types (expanded below) # nodes in the AST that describe the grammar. all Matcher instances must be # mutable and have an attribute # name::Symbol # which is set automatically to the matcher type by the constructor. # (re-set to a more useful type inside with_names() - see names.jl) abstract type Matcher end abstract type Message end # data sent between trampoline and methods abstract type State end # state associated with Matchers during evaluation # used to configure the parser. all Config subtypes must have associated # dispatch functions (see parser.jl), a parent() function, and have a # constructor that takes the source as first argument and additional arguments # as keywords. the type of the source is exposed and if it's a subclass of # string then the iterator is assumed to be a simple integer index. abstract type Config{S,I} end # important notes on mutability / hash / equality # 1 - immutable types in julia are not "just" immutable. they are # effectively values - they are passed by value. so do not use # "immutable" just because the data should not change. think about # details. # 2 - immutable types have an automatic equality and hash based on # content (which is copied). mutable types have an automatic equality # and hash based on address. so default hash and equality for # immutable types that contain mutable types, and for mutable types, # may not be what is required. # 3 - caching within the parser REQUIRES that both Matcher and State # instances have 'useful' equality and hash values. # 4 - for matchers, which are created when the grammar is defined, and # then unchanged, the default hash and equality are likely just fine, # even for mutable objects (in fact, mutable may be slightly faster # since equality is just a comparison of an Int64 address, # presumably). # 5 - for states, which often includes mutable result objects, more # care is needed: # 5a - whether or not State instances are mutable or immutable, they, # and their contents, must not change during matching. so all arrays, # for example, must be copied when new instances are created with # different values. # 5b - structurally identical states must be equal, and hash equally. # this is critical for efficient caching. so it it likely that # custom hash and equality methods will be needed (see above and # auto.jl). # defaults for mismatching types and types with no content ==(a::Matcher, b::Matcher) = false ==(a::T, b::T) where {T<:Matcher} = true ==(a::State, b::State) = false ==(a::T, b::T) where {T<:State} = true # use an array to handle empty values in a natural way const Value = Vector{Any} const EMPTY = Any[] function flatten(x::Array{Value,1}) where {Value} y::Value = vcat(x...) return y end # Message sub-types # use mutable types here since they are packed and unpacked often # parent and parent_state are popped from the stack. a call is made to # success(config, parent, parent_state, child_state, iter, result) struct Success{CS<:State,I}<:Message child_state::CS # parent to store, passed in next call for backtracking iter::I # advanced as appropriate result::Value # possibly empty end # parent and parent_state are popped from the stack. a call is made to # failure(config, parent, parent_state) struct Failure<:Message end const FAILURE = Failure() # parent and parent_state are pushed to the stack. a call is made to # execute(config, child, child_state, iter) struct Execute{I}<:Message parent::Matcher # stored by trampoline, added to response parent_state::State # stored by trampoline, added to response child::Matcher # the matcher to evaluate child_state::State # needed by for evaluation (was stored by parent) iter::I end # State sub-types # use immutable types because these are simple, magic values # the state used on first call struct Clean<:State end const CLEAN = Clean() # the state used when no further calls should be made struct Dirty<:State end const DIRTY = Dirty() # other stuff # user-generated errors (ie bad input, etc). # internal errors in the library (bugs) may raise Error struct ParserException<:Exception msg end # this cannot be cached (thrown by hash()) struct CacheException<:Exception end # this is equivalent to a matcher returning Failure. used when source # information is not available. abstract type FailureException<:Exception end const Applicable = Union{Function, DataType}
[ 27, 456, 62, 30783, 29, 16, 12, 940, 628, 198, 2, 7531, 3858, 357, 11201, 12249, 2174, 8, 198, 198, 2, 13760, 287, 262, 29273, 326, 6901, 262, 23491, 13, 220, 477, 6550, 2044, 10245, 1276, 307, 198, 2, 4517, 540, 290, 423, 281, ...
3.573007
1,267
<reponame>tomerarnon/julia-1 import Base: == mutable struct Point{T<:Number} x::T y::T end ==(p::Point, q::Point) = p.x == q.x && p.y == q.y @enum Heading NORTH=1 EAST=2 SOUTH=3 WEST=4 mutable struct Robot position::Point heading::Heading end function Robot(position::Tuple{T, T}, heading::Heading) where T<:Number Robot(Point(position...), heading) end heading(r::Robot) = r.heading position(r::Robot) = r.position function turn_right!(r::Robot) r.heading = Heading(mod1(Int(r.heading) + 1, 4)) r end function turn_left!(r::Robot) r.heading = Heading(mod1(Int(r.heading) - 1, 4)) r end function advance!(r::Robot) if heading(r) == NORTH r.position.y += 1 elseif heading(r) == SOUTH r.position.y -= 1 elseif heading(r) == EAST r.position.x += 1 else r.position.x -= 1 end r end function move!(r::Robot, instructions::AbstractString) moves = Dict('A' => advance!, 'R' => turn_right!, 'L' => turn_left!) for move in instructions move in keys(moves) && moves[move](r) end r end
[ 27, 7856, 261, 480, 29, 83, 12057, 1501, 261, 14, 73, 43640, 12, 16, 198, 11748, 7308, 25, 6624, 198, 198, 76, 18187, 2878, 6252, 90, 51, 27, 25, 15057, 92, 198, 220, 220, 220, 2124, 3712, 51, 198, 220, 220, 220, 331, 3712, 51, ...
2.251534
489
# ================================================================================================ # Main API using FixedEffectModels @reexport using FixedEffectModels import StatsModels: width, apply_schema anova(trms::Vararg{TableRegressionModel{<: FixedEffectModel}}; test::Type{<: GoodnessOfFit} = FTest, kwargs...) = anova(test, trms...; kwargs...) # ================================================================================================ # ANOVA by F test function anova(::Type{FTest}, trm::TableRegressionModel{<: FixedEffectModel}; type::Int = 1, kwargs...) type == 2 && throw(ArgumentError("Type 2 anova is not implemented")) type in [1, 2, 3] || throw(ArgumentError("Invalid type")) assign = trm.mm.assign df = dof(assign) filter!(>(0), df) # May exist some floating point error from dof_residual push!(df, round(Int, dof_residual(trm))) df = tuple(df...) if type in [1, 3] # vcov methods varβ = vcov(trm) β = trm.model.coef if type == 1 fs = abs2.(cholesky(Hermitian(inv(varβ))).U * β) offset = first(assign) - 1 fstat = ntuple(last(assign) - offset) do fix sum(fs[findall(==(fix + offset), assign)]) / df[fix] end else # calculate block by block offset = first(assign) - 1 fstat = ntuple(last(assign) - offset) do fix select = findall(==(fix + offset), assign) β[select]' * (varβ[select, select] \ β[select]) / df[fix] end end σ² = rss(trm.model) / last(df) devs = (fstat .* σ²..., σ²) .* df end pvalue = (ccdf.(FDist.(df[1:end - 1], last(df)), abs.(fstat))..., NaN) AnovaResult{FTest}(trm, type, df, devs, (fstat..., NaN), pvalue, NamedTuple()) end # ================================================================================================================= # Nested models function anova(::Type{FTest}, trms::Vararg{TableRegressionModel{<: FixedEffectModel}}; check::Bool = true, isnested::Bool = false) df = dof.(trms) ord = sortperm(collect(df)) df = df[ord] trms = trms[ord] # check comparable and nested check && @warn "Could not check whether models are nested: results may not be meaningful" Δdf = _diff(df) # May exist some floating point error from dof_residual dfr = round.(Int, dof_residual.(trms)) dev = ntuple(length(trms)) do i trms[i].model.rss end msr = _diffn(dev) ./Δdf σ² = last(dev) / last(dfr) fstat = msr ./ σ² pval = map(zip(Δdf, dfr[2:end], fstat)) do (dof, dofr, fs) fs > 0 ? ccdf(FDist(dof, dofr), fs) : NaN end AnovaResult{FTest}(trms, 1, df, dev, (NaN, fstat...), (NaN, pval...), NamedTuple()) end """ lfe(formula::FormulaTerm, df, vcov::CovarianceEstimator = Vcov.simple(); kwargs...) Fit a `FixedEffectModel` and wrap it into `TableRegressionModel`. !!! warn This function currently does not perform well. It re-compiles everytime; may be due to `@nonspecialize` for parameters of `reg`. """ lfe(formula::FormulaTerm, df, vcov::CovarianceEstimator = Vcov.simple(); kwargs...) = to_trm(reg(df, formula, vcov; kwargs...), df) """ to_trm(model, df) Wrap fitted `FixedEffectModel` into `TableRegressionModel`. """ function to_trm(model::FixedEffectModel, df) f = model.formula has_fe_intercept = any(fe_intercept(f)) rhs = vectorize(f.rhs) f = isa(first(rhs), ConstantTerm) ? f : FormulaTerm(f.lhs, (ConstantTerm(1), rhs...)) s = schema(f, df, model.contrasts) f = apply_schema(f, s, FixedEffectModel, has_fe_intercept) mf = ModelFrame(f, s, Tables.columntable(df[!, getproperty.(keys(s), :sym)]), FixedEffectModel) # Fake modelmatrix assign = asgn(f) has_fe_intercept && popfirst!(assign) mm = ModelMatrix(ones(Float64, 1, 1), assign) TableRegressionModel(model, mf, mm) end # ================================================================================================================================= # Fit new models """ anova_lfe(f::FormulaTerm, df, vcov::CovarianceEstimator = Vcov.simple(); test::Type{<: GoodnessOfFit} = FTest, <keyword arguments>) anova_lfe(test::Type{<: GoodnessOfFit}, f::FormulaTerm, df, vcov::CovarianceEstimator = Vcov.simple(); <keyword arguments>) ANOVA for fixed-effect linear regression. * `vcov`: estimator of covariance matrix. * `type`: type of anova. `anova_lfe` generate a `TableRegressionModel{<: FixedEffectModel}`. """ anova_lfe(f::FormulaTerm, df, vcov::CovarianceEstimator = Vcov.simple(); test::Type{<: GoodnessOfFit} = FTest, kwargs...)= anova(test, FixedEffectModel, f, df, vcov; kwargs...) anova_lfe(test::Type{<: GoodnessOfFit}, f::FormulaTerm, df, vcov::CovarianceEstimator = Vcov.simple(); kwargs...) = anova(test, FixedEffectModel, f, df, vcov; kwargs...) function anova(test::Type{<: GoodnessOfFit}, ::Type{FixedEffectModel}, f::FormulaTerm, df, vcov::CovarianceEstimator = Vcov.simple(); type::Int = 1, kwargs...) trm = to_trm(reg(df, f, vcov; kwargs...), df) anova(test, trm; type) end
[ 2, 38093, 4770, 25609, 18604, 198, 2, 8774, 7824, 198, 198, 3500, 10832, 18610, 5841, 1424, 198, 31, 631, 87, 634, 1262, 10832, 18610, 5841, 1424, 198, 11748, 20595, 5841, 1424, 25, 9647, 11, 4174, 62, 15952, 2611, 198, 198, 40993, 7,...
2.387068
2,227
<reponame>ericphanson/Diagonalizations.jl using Diagonalizations, LinearAlgebra, PosDefManifold, Test # Method (1) real t, n, k=10, 20, 10 Xset = [genDataMatrix(t, n) for i = 1:k] Xfixed=randn(t, n)./1 for i=1:length(Xset) Xset[i]+=Xfixed end C1=Hermitian( mean((X'*X)/t for X∈Xset) ) C2=Hermitian( mean((X*X')/n for X∈Xset) ) Xbar=mean(Xset) c=cstp(Xbar, C1, C2; simple=true) @test c.F[1]'*C2*c.F[1]≈I @test c.F[2]'*C1*c.F[2]≈I Z=c.F[1]'*Xbar*c.F[2] n=minimum(size(Z)) @test norm(Z[1:n, 1:n]-Diagonal(Z[1:n, 1:n]))+1. ≈ 1. cX=cstp(Xset; simple=true) @test c==cX # Method (1) complex t, n, k=10, 20, 10 Xcset = [genDataMatrix(ComplexF64, t, n) for i = 1:k] Xcfixed=randn(ComplexF64, t, n)./1 for i=1:length(Xcset) Xcset[i]+=Xcfixed end C1c=Hermitian( mean((Xc'*Xc)/t for Xc∈Xcset) ) C2c=Hermitian( mean((Xc*Xc')/n for Xc∈Xcset) ) Xcbar=mean(Xcset) cc=cstp(Xcbar, C1c, C2c; simple=true) @test cc.F[1]'*C2c*cc.F[1]≈I @test cc.F[2]'*C1c*cc.F[2]≈I Zc=cc.F[1]'*Xcbar*cc.F[2] n=minimum(size(Zc)) @test norm(Zc[1:n, 1:n]-Diagonal(Zc[1:n, 1:n]))+1. ≈ 1. cXc=cstp(Xcset; simple=true) @test cc==cXc # Method (2) real c=cstp(Xset) # ... selecting subspace dimension allowing an explained variance = 0.9 c=cstp(Xset; eVar=0.9) # ... giving weights `w` to the covariance matrices c=cstp(Xset; w=abs2.(randn(k)), eVar=0.9) # ... subtracting the means c=cstp(Xset; meanXd₁=nothing, meanXd₂=nothing, w=abs2.(randn(k)), eVar=0.9) # explained variance c.eVar # name of the filter c.name using Plots # plot the original covariance matrices and the transformed counterpart c=cstp(Xset) C1Max=maximum(abs.(C1)); h1 = heatmap(C1, clim=(-C1Max, C1Max), title="C1", yflip=true, c=:bluesreds); D1=c.F[1]'*C2*c.F[1]; D1Max=maximum(abs.(D1)); h2 = heatmap(D1, clim=(0, D1Max), title="F[1]'*C2*F[1]", yflip=true, c=:amp); C2Max=maximum(abs.(C2)); h3 = heatmap(C2, clim=(-C2Max, C2Max), title="C2", yflip=true, c=:bluesreds); D2=c.F[2]'*C1*c.F[2]; D2Max=maximum(abs.(D2)); h4 = heatmap(D2, clim=(0, D2Max), title="F[2]'*C1*F[2]", yflip=true, c=:amp); XbarMax=maximum(abs.(Xbar)); h5 = heatmap(Xbar, clim=(-XbarMax, XbarMax), title="Xbar", yflip=true, c=:bluesreds); DX=c.F[1]'*Xbar*c.F[2]; DXMax=maximum(abs.(DX)); h6 = heatmap(DX, clim=(0, DXMax), title="F[1]'*Xbar*F[2]", yflip=true, c=:amp); 📈=plot(h1, h3, h5, h2, h4, h6, size=(800,400)) # savefig(📈, homedir()*"\\Documents\\Code\\julia\\Diagonalizations\\docs\\src\\assets\\FigCSTP.png") # Method (2) complex cc=cstp(Xcset) # ... selecting subspace dimension allowing an explained variance = 0.9 cc=cstp(Xcset; eVar=0.9) # ... giving weights `w` to the covariance matrices cc=cstp(Xcset; w=abs2.(randn(k)), eVar=0.9) # ... subtracting the mean cc=cstp(Xcset; meanXd₁=nothing, meanXd₂=nothing, w=abs2.(randn(k)), eVar=0.9) # explained variance c.eVar # name of the filter c.name
[ 27, 7856, 261, 480, 29, 35626, 746, 23103, 14, 18683, 27923, 4582, 13, 20362, 198, 3500, 6031, 27923, 4582, 11, 44800, 2348, 29230, 11, 18574, 7469, 5124, 361, 727, 11, 6208, 198, 198, 2, 11789, 357, 16, 8, 1103, 198, 83, 11, 299, ...
1.949931
1,458
<reponame>lindahua/SparseExtensions.jl using SparseVectors using Base.Test import SparseVectors: exact_equal ### Data rnd_x0 = sprand(50, 0.6) rnd_x0f = full(rnd_x0) rnd_x1 = sprand(50, 0.7) * 4.0 rnd_x1f = full(rnd_x1) spv_x1 = SparseVector(8, [2, 5, 6], [1.25, -0.75, 3.5]) _x2 = SparseVector(8, [1, 2, 6, 7], [3.25, 4.0, -5.5, -6.0]) spv_x2 = view(_x2) ### Arithmetic operations let x = spv_x1, x2 = spv_x2 # negate @test exact_equal(-x, SparseVector(8, [2, 5, 6], [-1.25, 0.75, -3.5])) # abs and abs2 @test exact_equal(abs(x), SparseVector(8, [2, 5, 6], abs([1.25, -0.75, 3.5]))) @test exact_equal(abs2(x), SparseVector(8, [2, 5, 6], abs2([1.25, -0.75, 3.5]))) # plus and minus xa = SparseVector(8, [1,2,5,6,7], [3.25,5.25,-0.75,-2.0,-6.0]) @test exact_equal(x + x, x * 2) @test exact_equal(x + x2, xa) @test exact_equal(x2 + x, xa) xb = SparseVector(8, [1,2,5,6,7], [-3.25,-2.75,-0.75,9.0,6.0]) @test exact_equal(x - x, SparseVector(8, Int[], Float64[])) @test exact_equal(x - x2, xb) @test exact_equal(x2 - x, -xb) @test full(x) + x2 == full(xa) @test full(x) - x2 == full(xb) @test x + full(x2) == full(xa) @test x - full(x2) == full(xb) # multiplies xm = SparseVector(8, [2, 6], [5.0, -19.25]) @test exact_equal(x .* x, abs2(x)) @test exact_equal(x .* x2, xm) @test exact_equal(x2 .* x, xm) @test full(x) .* x2 == full(xm) @test x .* full(x2) == full(xm) # max & min @test exact_equal(max(x, x), x) @test exact_equal(min(x, x), x) @test exact_equal(max(x, x2), SparseVector(8, Int[1, 2, 6], Float64[3.25, 4.0, 3.5])) @test exact_equal(min(x, x2), SparseVector(8, Int[2, 5, 6, 7], Float64[1.25, -0.75, -5.5, -6.0])) end ### Complex let x = spv_x1, x2 = spv_x2 # complex @test exact_equal(complex(x, x), SparseVector(8, [2,5,6], [1.25+1.25im, -0.75-0.75im, 3.5+3.5im])) @test exact_equal(complex(x, x2), SparseVector(8, [1,2,5,6,7], [3.25im, 1.25+4.0im, -0.75+0.im, 3.5-5.5im, -6.0im])) @test exact_equal(complex(x2, x), SparseVector(8, [1,2,5,6,7], [3.25+0.im, 4.0+1.25im, -0.75im, -5.5+3.5im, -6.0+0.im])) # real & imag @test is(real(x), x) @test exact_equal(imag(x), sparsevector(Float64, length(x))) xcp = complex(x, x2) @test exact_equal(real(xcp), x) @test exact_equal(imag(xcp), x2) end ### Zero-preserving math functions: sparse -> sparse function check_nz2z_z2z{T}(f::Function, x::SparseVector{T}, xf::Vector{T}) R = typeof(f(zero(T))) r = f(x) isa(r, AbstractSparseVector) || error("$f(x) is not a sparse vector.") eltype(r) == R || error("$f(x) results in eltype = $(eltype(r)), expect $R") all(r.nzval .!= 0) || error("$f(x) contains zeros in nzval.") full(r) == f(xf) || error("Incorrect results found in $f(x).") end for f in [floor, ceil, trunc, round] check_nz2z_z2z(f, rnd_x1, rnd_x1f) end for f in [log1p, expm1, sin, tan, sinpi, sind, tand, asin, atan, asind, atand, sinh, tanh, asinh, atanh] check_nz2z_z2z(f, rnd_x0, rnd_x0f) end ### Non-zero-preserving math functions: sparse -> dense function check_z2nz{T}(f::Function, x::SparseVector{T}, xf::Vector{T}) R = typeof(f(zero(T))) r = f(x) isa(r, Vector) || error("$f(x) is not a dense vector.") eltype(r) == R || error("$f(x) results in eltype = $(eltype(r)), expect $R") r == f(xf) || error("Incorrect results found in $f(x).") end for f in [exp, exp2, exp10, log, log2, log10, cos, csc, cot, sec, cospi, cosd, cscd, cotd, secd, acos, acot, acosd, acotd, cosh, csch, coth, sech, acsch, asech] check_z2nz(f, rnd_x0, rnd_x0f) end ### Reduction # sum, sumabs, sumabs2, vecnorm let x = spv_x1 @test sum(x) == 4.0 @test sumabs(x) == 5.5 @test sumabs2(x) == 14.375 @test vecnorm(x) == sqrt(14.375) @test vecnorm(x, 1) == 5.5 @test vecnorm(x, 2) == sqrt(14.375) @test vecnorm(x, Inf) == 3.5 end # maximum, minimum, maxabs, minabs let x = spv_x1 @test maximum(x) == 3.5 @test minimum(x) == -0.75 @test maxabs(x) == 3.5 @test minabs(x) == 0.0 end let x = abs(spv_x1) @test maximum(x) == 3.5 @test minimum(x) == 0.0 end let x = -abs(spv_x1) @test maximum(x) == 0.0 @test minimum(x) == -3.5 end let x = SparseVector(3, [1, 2, 3], [-4.5, 2.5, 3.5]) @test maximum(x) == 3.5 @test minimum(x) == -4.5 @test maxabs(x) == 4.5 @test minabs(x) == 2.5 end let x = sparsevector(Float64, 8) @test maximum(x) == 0.0 @test minimum(x) == 0.0 @test maxabs(x) == 0.0 @test minabs(x) == 0.0 end # Issue https://github.com/JuliaLang/julia/issues/14046 let s14046 = sprand(5, 1.0) z = sparsevector(Float64, 5) @test z + s14046 == s14046 @test 2*z == z + z == z end
[ 27, 7856, 261, 480, 29, 75, 521, 993, 6413, 14, 50, 29572, 11627, 5736, 13, 20362, 198, 3500, 1338, 17208, 53, 478, 669, 198, 3500, 7308, 13, 14402, 198, 198, 11748, 1338, 17208, 53, 478, 669, 25, 2748, 62, 40496, 198, 198, 21017, ...
1.919418
2,544
import accrue.cryptoerase.runtime.Condition; class C { int{L} x = 7; final int z = m(); static final Condition c = new Condition(); int m() { int y = ({L /c T}) 42; return y; } public static void main(String[] args) { C obj = new C(); obj.c.set(); } }
[ 11748, 697, 24508, 13, 29609, 78, 263, 589, 13, 43282, 13, 48362, 26, 198, 198, 4871, 327, 1391, 198, 220, 220, 220, 493, 90, 43, 92, 2124, 796, 767, 26, 198, 220, 220, 220, 2457, 493, 1976, 796, 285, 9783, 198, 220, 220, 220, 9...
2.309524
126
<gh_stars>10-100 using Static, Aqua using Test @testset "Static.jl" begin Aqua.test_all(Static) @testset "StaticInt" begin @test static(UInt(8)) === StaticInt(UInt(8)) === StaticInt{8}() @test iszero(StaticInt(0)) @test !iszero(StaticInt(1)) @test !isone(StaticInt(0)) @test isone(StaticInt(1)) @test @inferred(one(StaticInt(1))) === StaticInt(1) @test @inferred(zero(StaticInt(1))) === StaticInt(0) @test @inferred(one(StaticInt)) === StaticInt(1) @test @inferred(zero(StaticInt)) === StaticInt(0) === StaticInt(StaticInt(Val(0))) @test eltype(one(StaticInt)) <: Int x = StaticInt(1) @test @inferred(Bool(x)) isa Bool @test @inferred(BigInt(x)) isa BigInt @test @inferred(Integer(x)) === x @test @inferred(%(x, Integer)) === 1 # test for ambiguities and correctness for i ∈ Any[StaticInt(0), StaticInt(1), StaticInt(2), 3] for j ∈ Any[StaticInt(0), StaticInt(1), StaticInt(2), 3] i === j === 3 && continue for f ∈ [+, -, *, ÷, %, <<, >>, >>>, &, |, ⊻, ==, ≤, ≥] (iszero(j) && ((f === ÷) || (f === %))) && continue # integer division error @test convert(Int, @inferred(f(i,j))) == f(convert(Int, i), convert(Int, j)) end end i == 3 && break for f ∈ [+, -, *, /, ÷, %, ==, ≤, ≥] w = f(convert(Int, i), 1.4) x = f(1.4, convert(Int, i)) @test convert(typeof(w), @inferred(f(i, 1.4))) === w @test convert(typeof(x), @inferred(f(1.4, i))) === x # if f is division and i === StaticInt(0), returns `NaN`; hence use of ==== in check. (((f === ÷) || (f === %)) && (i === StaticInt(0))) && continue y = f(convert(Int, i), 2 // 7) z = f(2 // 7, convert(Int, i)) @test convert(typeof(y), @inferred(f(i, 2 // 7))) === y @test convert(typeof(z), @inferred(f(2 // 7, i))) === z end end @test UnitRange{Int16}(StaticInt(-9), 17) === Int16(-9):Int16(17) @test UnitRange{Int16}(-7, StaticInt(19)) === Int16(-7):Int16(19) @test UnitRange(-11, StaticInt(15)) === -11:15 @test UnitRange(StaticInt(-11), 15) === -11:15 @test UnitRange{Int}(StaticInt(-11), StaticInt(15)) === -11:15 @test UnitRange(StaticInt(-11), StaticInt(15)) === -11:15 @test float(StaticInt(8)) === static(8.0) # test specific promote rules to ensure we don't cause ambiguities SI = StaticInt{1} IR = typeof(1//1) PI = typeof(pi) @test @inferred(convert(SI, SI())) === SI() @test @inferred(promote_rule(SI, PI)) <: promote_type(Int, PI) @test @inferred(promote_rule(SI, IR)) <: promote_type(Int, IR) @test @inferred(promote_rule(SI, SI)) <: Int @test @inferred(promote_rule(Missing, SI)) <: promote_type(Missing, Int) @test @inferred(promote_rule(Nothing, SI)) <: promote_type(Nothing, Int) @test @inferred(promote_rule(SI, Missing)) <: promote_type(Int, Missing) @test @inferred(promote_rule(SI, Nothing)) <: promote_type(Int, Nothing) @test @inferred(promote_rule(Union{Missing,Int}, SI)) <: promote_type(Union{Missing,Int}, Int) @test @inferred(promote_rule(Union{Nothing,Int}, SI)) <: promote_type(Union{Nothing,Int}, Int) @test @inferred(promote_rule(Union{Nothing,Missing,Int}, SI)) <: Union{Nothing,Missing,Int} @test @inferred(promote_rule(Union{Nothing,Missing}, SI)) <: promote_type(Union{Nothing,Missing}, Int) @test @inferred(promote_rule(SI, Missing)) <: promote_type(Int, Missing) @test @inferred(promote_rule(Base.TwicePrecision{Int}, StaticInt{1})) <: Base.TwicePrecision{Int} @test static(Int8(-18)) === static(-18) @test static(0xef) === static(239) @test static(Int16(-18)) === static(-18) @test static(0xffef) === static(65519) if sizeof(Int) == 8 @test static(Int32(-18)) === static(-18) @test static(0xffffffef) === static(4294967279) end end @testset "StaticBool" begin t = static(static(true)) f = StaticBool(static(false)) @test StaticBool{true}() === t @test StaticBool{false}() === f @test @inferred(StaticInt(t)) === StaticInt(1) @test @inferred(StaticInt(f)) === StaticInt(0) @test @inferred(~t) === f @test @inferred(~f) === t @test @inferred(!t) === f @test @inferred(!f) === t @test @inferred(+t) === StaticInt(1) @test @inferred(+f) === StaticInt(0) @test @inferred(-t) === StaticInt(-1) @test @inferred(-f) === StaticInt(0) @test @inferred(sign(t)) === t @test @inferred(abs(t)) === t @test @inferred(abs2(t)) === t @test @inferred(iszero(t)) === f @test @inferred(isone(t)) === t @test @inferred(iszero(f)) === t @test @inferred(isone(f)) === f @test @inferred(xor(true, f)) @test @inferred(xor(f, true)) @test @inferred(xor(f, f)) === f @test @inferred(xor(f, t)) === t @test @inferred(xor(t, f)) === t @test @inferred(xor(t, t)) === f @test @inferred(|(true, f)) @test @inferred(|(true, t)) === t @test @inferred(|(f, true)) @test @inferred(|(t, true)) === t @test @inferred(|(f, f)) === f @test @inferred(|(f, t)) === t @test @inferred(|(t, f)) === t @test @inferred(|(t, t)) === t @test @inferred(Base.:(&)(true, f)) === f @test @inferred(Base.:(&)(true, t)) @test @inferred(Base.:(&)(f, true)) === f @test @inferred(Base.:(&)(t, true)) @test @inferred(Base.:(&)(f, f)) === f @test @inferred(Base.:(&)(f, t)) === f @test @inferred(Base.:(&)(t, f)) === f @test @inferred(Base.:(&)(t, t)) === t @test @inferred(<(f, f)) === false @test @inferred(<(f, t)) === true @test @inferred(<(t, f)) === false @test @inferred(<(t, t)) === false @test @inferred(<=(f, f)) === true @test @inferred(<=(f, t)) === true @test @inferred(<=(t, f)) === false @test @inferred(<=(t, t)) === true @test @inferred(==(f, f)) === true @test @inferred(==(f, t)) === false @test @inferred(==(t, f)) === false @test @inferred(==(t, t)) === true @test @inferred(*(f, t)) === t & f @test @inferred(-(f, t)) === StaticInt(f) - StaticInt(t) @test @inferred(+(f, t)) === StaticInt(f) + StaticInt(t) @test @inferred(^(t, f)) == ^(true, false) @test @inferred(^(t, t)) == ^(true, true) @test @inferred(^(2, f)) == 1 @test @inferred(^(2, t)) == 2 @test @inferred(^(BigInt(2), f)) == 1 @test @inferred(^(BigInt(2), t)) == 2 @test @inferred(div(t, t)) === t @test_throws DivideError div(t, f) @test @inferred(rem(t, t)) === f @test_throws DivideError rem(t, f) @test @inferred(mod(t, t)) === f @test @inferred(all((t, t, t))) @test !@inferred(all((t, f, t))) @test !@inferred(all((f, f, f))) @test @inferred(any((t, t, t))) @test @inferred(any((t, f, t))) @test !@inferred(any((f, f, f))) x = StaticInt(1) y = StaticInt(0) z = StaticInt(-1) @test @inferred(Static.eq(y)(x)) === f @test @inferred(Static.eq(x, x)) === t @test @inferred(Static.ne(y)(x)) === t @test @inferred(Static.ne(x, x)) === f @test @inferred(Static.gt(y)(x)) === t @test @inferred(Static.gt(y, x)) === f @test @inferred(Static.ge(y)(x)) === t @test @inferred(Static.ge(y, x)) === f @test @inferred(Static.lt(x)(y)) === t @test @inferred(Static.lt(x, y)) === f @test @inferred(Static.le(x)(y)) === t @test @inferred(Static.le(x, y)) === f @test @inferred(Static.ifelse(t, x, y)) === x @test @inferred(Static.ifelse(f, x, y)) === y @test @inferred(promote_rule(True, True)) <: StaticBool @test @inferred(promote_rule(True, Bool)) <: Bool @test @inferred(promote_rule(Bool, True)) <: Bool end @testset "StaticSymbol" begin x = StaticSymbol(:x) y = StaticSymbol("y") z = StaticSymbol(1) @test y === StaticSymbol(:y) @test z === StaticSymbol(Symbol(1)) @test @inferred(StaticSymbol(x)) === x @test @inferred(StaticSymbol(x, y)) === StaticSymbol(:x, :y) @test @inferred(StaticSymbol(x, y, z)) === static(:xy1) end @testset "static interface" begin v = Val((:a, 1, true)) @test static(1) === StaticInt(1) @test static(true) === True() @test static(:a) === StaticSymbol{:a}() @test Symbol(static(:a)) === :a @test static((:a, 1, true)) === (static(:a), static(1), static(true)) @test @inferred(static(v)) === (static(:a), static(1), static(true)) @test_throws ErrorException static("a") @test @inferred(Static.is_static(v)) === True() @test @inferred(Static.is_static(typeof(v))) === True() @test @inferred(Static.is_static(typeof(static(true)))) === True() @test @inferred(Static.is_static(typeof(static(1)))) === True() @test @inferred(Static.is_static(typeof(static(:x)))) === True() @test @inferred(Static.is_static(typeof(1))) === False() @test @inferred(Static.is_static(typeof((static(:x),static(:x))))) === True() @test @inferred(Static.is_static(typeof((static(:x),:x)))) === False() @test @inferred(Static.is_static(typeof(static(1.0)))) === True() @test @inferred(Static.known(v)) === (:a, 1, true) @test @inferred(Static.known(typeof(v))) === (:a, 1, true) @test @inferred(Static.known(typeof(static(true)))) @test @inferred(Static.known(typeof(static(false)))) === false @test @inferred(Static.known(typeof(static(1.0)))) === 1.0 @test @inferred(Static.known(typeof(static(1)))) === 1 @test @inferred(Static.known(typeof(static(:x)))) === :x @test @inferred(Static.known(typeof(1))) === missing @test @inferred(Static.known(typeof((static(:x),static(:x))))) === (:x, :x) @test @inferred(Static.known(typeof((static(:x),:x)))) === (:x, missing) @test @inferred(Static.dynamic((static(:a), static(1), true))) === (:a, 1, true) end @testset "tuple utilities" begin x = (static(1), static(2), static(3)) y = (static(3), static(2), static(1)) z = (static(1), static(2), static(3), static(4)) T = Tuple{Int,Float64,String} @test @inferred(Static.invariant_permutation(x, x)) === True() @test @inferred(Static.invariant_permutation(x, y)) === False() @test @inferred(Static.invariant_permutation(x, z)) === False() @test @inferred(Static.permute(x, Val(x))) === x @test @inferred(Static.permute(x, (static(1), static(2)))) === (static(1), static(2)) @test @inferred(Static.permute(x, x)) === x @test @inferred(Static.permute(x, y)) === y @test @inferred(Static.eachop(getindex, x)) === x get_tuple_add(::Type{T}, ::Type{X}, dim::StaticInt) where {T,X} = Tuple{Static._get_tuple(T, dim),X} @test @inferred(Static.eachop_tuple(Static._get_tuple, y, T)) === Tuple{String,Float64,Int} @test @inferred(Static.eachop_tuple(get_tuple_add, y, T, String)) === Tuple{Tuple{String,String},Tuple{Float64,String},Tuple{Int,String}} @test @inferred(Static.find_first_eq(static(1), y)) === static(3) # inferred is Union{Int,Nothing} @test Static.find_first_eq(1, map(Int, y)) === 3 end @testset "NDIndex" begin x = NDIndex((1,2,3)) y = NDIndex((1,static(2),3)) z = NDIndex(static(3), static(3), static(3)) @testset "constructors" begin @test static(CartesianIndex(3, 3, 3)) === z == Base.setindex(Base.setindex(x, 3, 1), 3, 2) @test @inferred(CartesianIndex(z)) === @inferred(Static.dynamic(z)) === CartesianIndex(3, 3, 3) @test @inferred(Static.known(z)) === (3, 3, 3) @test Tuple(@inferred(NDIndex{0}())) === () @test @inferred(NDIndex{3}(1, static(2), 3)) === y @test @inferred(NDIndex{3}((1, static(2), 3))) === y @test @inferred(NDIndex{3}((1, static(2)))) === NDIndex(1, static(2), static(1)) @test @inferred(NDIndex(x, y)) === NDIndex(1, 2, 3, 1, static(2), 3) end @test @inferred(Base.IteratorsMD.split(x, Val(2))) === (NDIndex(1, 2), NDIndex(3,)) @test @inferred(length(x)) === 3 @test @inferred(length(typeof(x))) === 3 @test @inferred(y[2]) === 2 @test @inferred(y[static(2)]) === static(2) @test @inferred(-y) === NDIndex((-1,-static(2),-3)) @test @inferred(y + y) === NDIndex((2,static(4),6)) @test @inferred(y - y) === NDIndex((0,static(0),0)) @test @inferred(zero(x)) === NDIndex(static(0),static(0),static(0)) @test @inferred(oneunit(x)) === NDIndex(static(1),static(1),static(1)) @test @inferred(x * 3) === NDIndex((3,6,9)) @test @inferred(3 * x) === NDIndex((3,6,9)) @test @inferred(min(x, z)) === x @test @inferred(max(x, z)) === NDIndex(3, 3, 3) @test !@inferred(isless(y, x)) @test @inferred(isless(x, z)) @test @inferred(Static.lt(oneunit(z), z)) === static(true) A = rand(3,3,3); @test @inferred(to_indices(A, axes(A), (x,))) === (1, 2, 3) @test @inferred(to_indices(A, axes(A), ([y,y],))) == ([y, y],) end @test repr(static(float(1))) == "static($(float(1)))" @test repr(static(1)) == "static(1)" @test repr(static(:x)) == "static(:x)" @test repr(static(true)) == "static(true)" @test repr(static(CartesianIndex(1,1))) == "NDIndex(static(1), static(1))" end # for some reason this can't be inferred when in the "Static.jl" test set known_length(x) = known_length(typeof(x)) known_length(::Type{T}) where {N,T<:Tuple{Vararg{Any,N}}} = N known_length(::Type{T}) where {T} = missing maybe_static_length(x) = Static.maybe_static(known_length, length, x) x = ntuple(+, 10) y = 1:10 @test @inferred(maybe_static_length(x)) === StaticInt(10) @test @inferred(maybe_static_length(y)) === 10 include("float.jl") #= A = rand(3,4); offset1(x::Base.OneTo) = static(1) offset1(x::AbstractUnitRange) = first(x) offsets(x) = Static._eachop(offset1, (axes(x),), Static.nstatic(Val(ndims(x)))) =#
[ 27, 456, 62, 30783, 29, 940, 12, 3064, 198, 3500, 36125, 11, 24838, 198, 3500, 6208, 198, 198, 31, 9288, 2617, 366, 45442, 13, 20362, 1, 2221, 198, 220, 220, 220, 24838, 13, 9288, 62, 439, 7, 45442, 8, 628, 220, 220, 220, 2488, ...
2.07922
7,132
<filename>BuddhaV2/genimg.jl<gh_stars>0 using JLD, Images function main(dim) points = load("./out/20k.jld", "points") img = zeros(RGB,dim,dim) for c in points z = c while abs(z) < 2 x = trunc(Int,(real(z) + 2)*dim/3); y = trunc(Int,(imag(z) + 1.5)*dim/3) 0<x<dim>y>0 && (img[x,y] += RGB(0.0005,0,0)) z = z^2 + c end end return map(clamp01nan, img) end @time save("./images/t1.png", main(1500))
[ 27, 34345, 29, 33, 4185, 3099, 53, 17, 14, 5235, 9600, 13, 20362, 27, 456, 62, 30783, 29, 15, 198, 3500, 449, 11163, 11, 5382, 201, 198, 201, 198, 8818, 1388, 7, 27740, 8, 201, 198, 220, 220, 220, 2173, 796, 3440, 7, 1911, 14, ...
1.769784
278
<reponame>sonosole/Delta clear() @testset "check pooling op's gradient at single dim" begin for d in [1 2 3] for pool in [maximum minimum sum mean linearpool exppool] @testset "check $pool op's gradient at dim = $d" begin DIMS = d TYPE = Array{Float64}; # [1] prepare input data and its label inputdims = 64; timeSteps = 16; batchsize = 32; x = Variable(rand(inputdims, timeSteps, batchsize); type=TYPE, keepsgrad=true,); if d==1;l = Variable(rand(1, timeSteps, batchsize); type=TYPE);end if d==2;l = Variable(rand(inputdims, 1, batchsize); type=TYPE);end if d==3;l = Variable(rand(inputdims, timeSteps, 1); type=TYPE);end # [2] forward and backward propagation COST1 = cost(mseLoss(pool(x; dims=DIMS), l)); backward(); # [3] with a samll change of a weight GRAD = x.delta[1]; DELTA = 1e-6; x.value[1] += DELTA; # [4] forward and backward propagation COST2 = cost(mseLoss(pool(x; dims=DIMS), l)); backward(); # [5] check if the auto-grad is true or not dLdW = (COST2 - COST1)/DELTA; # numerical gradient err = abs((dLdW-GRAD)/(GRAD+eps(Float32)))*100; # relative error in % err = err < 1e-1 ? 0.0 : err; @test err<1.0 end end end end @testset "check pooling op's gradient at mutiple dims" begin for pool in [maximum minimum sum mean linearpool exppool] @testset "check $pool op's gradient" begin DIMS = (1,2) TYPE = Array{Float64}; # [1] prepare input data and its label inputdims = 64; timeSteps = 16; batchsize = 32; x = Variable(rand(inputdims, timeSteps, batchsize); type=TYPE,keepsgrad=true); l = Variable(rand(1, 1, batchsize); type=TYPE); # [2] forward and backward propagation COST1 = cost(mseLoss(pool(x; dims=DIMS), l)); backward(); # [3] with a samll change of a weight GRAD = x.delta[1]; DELTA = 1e-6; x.value[1] += DELTA; # [4] forward and backward propagation with a samll change of a weight COST2 = cost(mseLoss(pool(x; dims=DIMS), l)); backward(); # [5] check if the auto-grad is true or not dLdW = (COST2 - COST1)/DELTA; # numerical gradient err = abs((dLdW-GRAD)/(GRAD+eps(Float64)))*100; # relative error in % err = err < 1e-1 ? 0.0 : err; @test err<1.0 end end end @testset "check maxmin and minmax op's gradient at mutiple dims" begin for pool in [maxmin minmax] @testset "check $pool op's gradient" begin DIM1 = 1 DIM2 = 2 TYPE = Array{Float64}; # [1] prepare input data and its label inputdims = 64; timeSteps = 16; batchsize = 32; x = Variable(rand(inputdims, timeSteps, batchsize); type=TYPE,keepsgrad=true); l = Variable(rand(1, 1, batchsize); type=TYPE); # [2] forward and backward propagation COST1 = mseLoss(pool(x; dims1=DIM1, dims2=DIM2), l) |> cost backward(); # [3] with a samll change of a weight GRAD = x.delta[1]; DELTA = 1e-6; x.value[1] += DELTA; # [4] forward and backward propagation with a samll change of a weight COST2 = mseLoss(pool(x; dims1=DIM1, dims2=DIM2), l) |> cost backward(); # [5] check if the auto-grad is true or not dLdW = (COST2 - COST1)/DELTA; # numerical gradient err = abs((dLdW-GRAD)/(GRAD+eps(Float64)))*100; # relative error in % err = err < 1e-1 ? 0.0 : err; @test err<1.0 end end end
[ 27, 7856, 261, 480, 29, 1559, 418, 2305, 14, 42430, 198, 20063, 3419, 198, 31, 9288, 2617, 366, 9122, 5933, 278, 1034, 338, 31312, 379, 2060, 5391, 1, 2221, 198, 220, 220, 220, 329, 288, 287, 685, 16, 362, 513, 60, 198, 220, 220, ...
1.889543
2,209
# ==================================================================== # Load Different Logger # ==================================================================== """ load_logger_from_config(file_path::AbstractString)::TeeLogger Create a combined logger from a config file path. ### Note A combined logger is a `TeeLogger` struct that allows to send the same log message to all loggers included in the combined logger at once. """ function load_logger_from_config(file_path::AbstractString) json_string = read(file_path, String) json3_dict = JSON3.read(json_string) #, Dict return load_logger_from_config(json3_dict) end """ load_logger_from_config(config::Dict)::TeeLogger Create a `TeeLoger`, a collection of logger, from a configuration `Dict`. ### Note - A `TeeLogger` struct allows to send the same log message to all loggers included in the `TeeLoger` at once. - The configuration `Dict` requires as `"logging"` field, see example for more details. ### Example ```julia config = Dict( ..., "logging" => [ # logger_type => logger_config_dict, "SeqLogger" => Dict(...), ... ], ... ) ``` ### Returns `TeeLogger` as defined in `config` """ function load_logger_from_config(config::AbstractDict) loggers = [ get_logger(string(logger_type), logger_specs) for (logger_type, logger_specs) in config["logging"] ] return TeeLogger(loggers...) end # ==================================================================== # Load Single Logger # ==================================================================== """ load_seqlogger(logger_config::AbstractDict)::Union{SeqLogger, TransformerLogger} Return a `SeqLogger` or `TransformerLogger` according to `logger_config`. ### Config Parameters - `"server_url"` -- required - `"min_level"` -- required (`"DEBUG", "INFO", "WARN", "ERROR"`) - `"transformation"` -- optional, default `identity` - `"api_key"` -- optional, default `""` - `"batch_size"` -- optional, default `10` All other config parameters are used as global event properties. ### Example ```julia log_dict = Dict( "server_url" => "http://subdn215:5341/", "min_level" => "INFO", "batch_size" => 12, "App" => "SeqLoggers_Test", "Env" => "Test" ) seq_logger = SeqLoggers.load_seqlogger(log_dict) ``` """ function load_seqlogger(logger_config::AbstractDict) server_url = logger_config["server_url"] min_level = logger_config["min_level"] |> get_log_level transformation_str = get(logger_config, "transformation", "identity") transformation = transformation_str |> get_transformation_function # Create a NamedTuple from remaining Config Keyvalue Pairs kwarg_keys = filter( key -> string(key) ∉ ["server_url", "min_level", "transformation"], keys(logger_config) ) kwarg_keys_names = Tuple(Symbol(key) for key in kwarg_keys) kwarg_keys_values = [logger_config[key] for key in kwarg_keys] kwarg_keys = NamedTuple{kwarg_keys_names}(kwarg_keys_values) return SeqLogger( server_url; min_level=min_level, kwarg_keys... ) |> transformation end """ load_consolelogger(logger_config::AbstractDict)::Union{ConsoleLogger, TransformerLogger} Return a `ConsoleLogger` or `TransformerLogger` according to `logger_config`. ### Config Parameters - `"min_level"` -- required (`"DEBUG", "INFO", "WARN", "ERROR"`) - `"transformation"` -- optional, default `identity` ### Example ```julia logging_config = Dict( "min_level" => "ERROR", "transformation" => "add_timestamp", ) seq_logger = SeqLoggers.load_consolelogger(log_dict) ``` """ function load_consolelogger(logger_config::AbstractDict) min_level = logger_config["min_level"] |> get_log_level transformation_str = get(logger_config, "transformation", "identity") transformation = transformation_str |> get_transformation_function return ConsoleLogger(stderr, min_level) |> transformation end """ load_consolelogger(logger_config::AbstractDict)::AbstractLogger Return a `MinLevelLogger{FileLogger}` or `TransformerLogger` according to `logger_config`. ### Config Parameters - `"file_path"` -- required - `"min_level"` -- required (`"DEBUG", "INFO", "WARN", "ERROR"`) - `"append"` -- optional, default `true`, append to file if `true`, otherwise truncate file. (See [`LoggingExtras.FileLogger`](@ref) for more information.) - `"transformation"` -- optional, default `identity` ### Example ```julia logging_config = Dict( "file_path" => "C:/Temp/test.log", "min_level" => "ERROR", "append" => true, "transformation" => "add_timestamp", ) seq_logger = SeqLoggers.load_filelogger(log_dict) ``` """ function load_filelogger(logger_config::AbstractDict) min_level = logger_config["min_level"] |> get_log_level file_path = logger_config["file_path"] append = get(logger_config, "append", true) transformation_str = get(logger_config, "transformation", "identity") transformation = transformation_str |> get_transformation_function return MinLevelLogger(FileLogger(file_path; append=append), min_level) |> transformation end """ load_advanced_filelogger(logger_config::AbstractDict)::AbstractLogger Return a `DatetimeRotatingFileLogger` or `TransformerLogger` according to `logger_config`. ### Config Parameters - `"dir_path"` -- required - `"min_level"` -- required (`"DEBUG", "INFO", "WARN", "ERROR"`) - `"file_name_pattern"` -- required e.g. `"\\a\\c\\c\\e\\s\\s-YYYY-mm-dd-HH-MM.\\l\\o\\g"` - `"transformation"` -- optional, default `identity` ### Example ```julia logging_config = Dict( "dir_path" => "C:/Temp", "min_level" => "ERROR", "file_name_pattern" => "\\a\\c\\c\\e\\s\\s-YYYY-mm-dd-HH-MM.\\l\\o\\g", "transformation" => "add_timestamp", ) seq_logger = SeqLoggers.load_advanced_filelogger(log_dict) ``` """ function load_advanced_filelogger(logger_config::AbstractDict) min_level = logger_config["min_level"] |> get_log_level dir_path = logger_config["dir_path"] file_name_pattern = logger_config["file_name_pattern"] transformation_str = get(logger_config, "transformation", "identity") transformation = transformation_str |> get_transformation_function return AdvancedFileLogger( dir_path, file_name_pattern; log_format_function=print_standard_format, min_level=min_level ) |> transformation end # ==================================================================== # Logger Type Mapping and Register # ==================================================================== """ get_logger(logger_type::AbstractString, logger_config::AbstractDict)::AbstractLogger Create logger struct from logger type name and `Dict` with required parameters. By default, the following logger types are supported: - `"SeqLogger"` → [`SeqLogger`](@ref) - `"ConsoleLogger"` → [`ConsoleLogger`](@ref) - `"FileLogger"` → [`FileLogger`](@ref) Use [`register_logger!`](@ref) to add custom `AbstractLogger`s. """ function get_logger(logger_type::AbstractString, logger_config::AbstractDict) logger_constructor = get(LOGGER_TYPE_MAPPING, logger_type, nothing) if isnothing(logger_constructor) throw( ArgumentError( "There is no logger corresponding to the key `$logger_type`. " * "Available options are $(collect(keys(LOGGER_TYPE_MAPPING))). " * "Use `register_logger!` to add new logger types." ) ) end return logger_constructor(logger_config) end """ register_logger!(logger_type::AbstractString, logger_constructor::Function) Register a new logger type. Registering enables the user to use custom `AbstractLogger` struct, defined outside of `SeqLoggers`, to be used with [`load_logger_from_config`](@ref). """ function register_logger!(logger_type::AbstractString, logger_constructor::Function) if haskey(LOGGER_TYPE_MAPPING, logger_type) @warn "Logger type `$logger_type` already exists and will be overwritten" end LOGGER_TYPE_MAPPING[logger_type] = logger_constructor return nothing end const LOGGER_TYPE_MAPPING = Dict( "SeqLogger" => load_seqlogger, "ConsoleLogger" => load_consolelogger, "FileLogger" => load_filelogger, "AdvancedFileLogger" => load_advanced_filelogger, ) # ==================================================================== # Transformation Function and Register # ==================================================================== """ get_transformation_function(key::String) Convert a string (from config) into a transformation function. By default, the following transformation functions are supported: - `"identity"` → [`identity`](@ref): no transformation - `"add_timestamp"` → [`add_timestamp`](@ref): add timestamp at the beginning of log message Use [`register_transformation_function!`](@ref) to add custom transformation functions. """ function get_transformation_function(key::String) return LOGGER_TRANSFORMATION_MAPPING[key] end """ register_transformation_function!(key::AbstractString, transformation_function::Function) Register new transformation function. Registering enables the user to use custom transformation functions, defined outside of `SeqLoggers`, to be used with [`load_logger_from_config`](@ref). """ function register_transformation_function!(key::AbstractString, transformation_function::Function) LOGGER_TRANSFORMATION_MAPPING[key] = transformation_function return nothing end const STANDARD_DATETIME_FORMAT = "yyyy-mm-dd HH:MM:SS" """ add_timestamp(logger::AbstractLogger) Logger transformation function that prepends a timestamp to a logging message. """ add_timestamp(logger) = TransformerLogger(logger) do log merge(log, (; message="$(Dates.format(now(), STANDARD_DATETIME_FORMAT)): $(log.message)")) end const LOGGER_TRANSFORMATION_MAPPING = Dict( "identity" => identity, "add_timestamp" => add_timestamp, ) # ==================================================================== # Log Level # ==================================================================== """ get_log_level(key::String)::Logging.LogLevel Return the `Loggin.LogLevel` corresponding to the input string. """ function get_log_level(key::String) log_level = get(LOG_LEVEL_MAPPING, uppercase(key), nothing) if isnothing(key) throw( ArgumentError( "There is no log level corresponding to the key $key." * "Available options are $(collect(keys(LOG_LEVEL_MAPPING)))" ) ) end return log_level end const LOG_LEVEL_MAPPING = Dict( "INFO" => Logging.Info, "INFORMATOIN" => Logging.Info, "DEBUG" => Logging.Debug, "WARN" => Logging.Warn, "WARNING" => Logging.Warn, "ERROR" => Logging.Error, )
[ 2, 38093, 18604, 198, 2, 8778, 20615, 5972, 1362, 198, 2, 38093, 18604, 198, 37811, 198, 220, 220, 220, 3440, 62, 6404, 1362, 62, 6738, 62, 11250, 7, 7753, 62, 6978, 3712, 23839, 10100, 2599, 25, 51, 1453, 11187, 1362, 198, 198, 164...
2.877757
3,763
<filename>julia/make_regex.jl #= A port of my Perl/Java/Python MakeRegex in Julia. make_regex(words) generates a regex for words. It use a simple approach which combined common prefixes in generating the regex. Some examples: * words = ["a", "al", "all", "alla", "an", "ann", "anna", "annas", "ananas"] regex: a(l(la?)?|n(anas|n(as?)?)?)? * words: ["and", "at", "do", "end", "for", "in", "is", "not", "of", "or", "use"] regex: (a(nd|t)|do|end|for|i[ns]|not|o[fr]|use) There is a simple way of handling character classes * words: ["price1", "price2", "price3", "price4"] regex: price[1234] If there is no common prefix then it just put '|' between the words * words: ["this", "is", "a", "very", "boring", "example", "with", "no", "common", "prefix"] regex: (a|boring|common|example|is|no|prefix|this|very|with) Also, see the (very old) page for my Perl package MakeRegex: http://hakank.org/makeregex/index.html The REAME file in that package states: """ The Perl package MakeRegex composes a regex-expression from a list of words. It had been inspired by the emacs elisp module make-regex.el, by Simon Marshall. """ This Julia program was created by <NAME>, <EMAIL> See also my Julia page: http://www.hakank.org/julia/ =# # # common_prefix(p, list) # # Here is where the main work is done. It's somewhat magically ported from my # Perl/Java/Python versions... # function common_prefix(p, list) list_len = length(list) if list_len == 0 return "" end if list_len == 1 return p * join(list,"") end # # fix for some - as of now - unknown bug. To fix in later version! # if p == "" && list[1] == "" && list[2] == "" return "" end # # * Collect all the strings with the same prefix-char # hash = Dict() for word in sort(list) prefix = suffixed_word = "" if length(word) > 0 prefix, suffixed_word... = word end # put the suffix in the list of other suffixes for # the this prefix hash[prefix] = push!(get(hash,prefix,[]),suffixed_word) end # # And recurse this list # all = [] for key in keys(hash) comm = "" values = hash[key] if length(key) > 0 sort!(values) comm = common_prefix(key, values) end # hack to be able to use the '?' char . Should be re-written! if comm == "" comm = " " end push!(all,comm) end sort!(all) # paren: what to put in parenthesis ('()' or '[]') if anything paren = "" all_len = length(all) if all_len == 1 paren = join(all,"") else len = maximum(length.(all)) joinChar = len != 1 ? '|' : "" # joins all entries except for " " join_str = mark = "" count = 0 for w in all got_hack_mark = w == " " ? true : false # This is a hack for handling '?' if length(w) > 0 && w != " " join_str *= w if count < all_len-1 join_str *= joinChar end end if got_hack_mark mark = '?' end count = count + 1 end paren = "" if length(join_str) === 1 paren = join_str * mark else if len == 1 paren = '[' * join_str * ']' * mark else paren = '(' * join_str * ')' * mark end end end return p * paren end function make_regex(words) replace.(words,r"([*?+])"=>s"\\\1") # replace meta characters # We sort the words to induce more common prefixes return common_prefix("", sort(words)) end # # check_regex(regex, words) # # Checks the regex againts a list of words. # function check_regex(regex, words) p = Regex(regex) for word in words println(word, " matches", !occursin(p,word) ? " NOT!" : "") end end tests = [ ["all","alla"], # A lot of Swedish words [ "all", "alla", "alle", "alls", "palle", "palla", "pelle", "perkele", "ann", "anna", "annas", "anders", "håkan", "ångest", "ärlig", "solsken", "sture", "stina", "hörapparat", "hörsel", "hårig"], ["alla", "palla", "balla", "kalla", "all", "pall", "ball", "kall"], # "ananas" is the Swedish word for pineapple ["a", "al", "all", "alla", "an", "ann", "anna", "annas", "ananas"], ["a", "an", "ann", "anna", "annan", "annas", "annans", "ananas", "ananasens"], ["a", "ab", "abc", "abcd", "abcde", "abcdef", "b", "bc", "bcd", "bcde", "bcdef", "bcdefg", "abb", "abbc", "abbcc", "abbccdd"], ["this", "is", "a", "very", "boring", "example", "with", "no", "common", "prefix"], ["price1","price2","price3","price4"], # This is from Marshall's make-regex.el ["and", "at", "do", "end", "for", "in", "is", "not", "of", "or", "use"], # This is from Marshall's make-regex.el ["cond", "if", "while", "let*?", "prog1", "prog2", "progn", "catch", "throw", "save-restriction", "save-excursion", "save-window-excursion", "save-match-data", "unwind-protect", "condition-case", "track-mouse"], # This is from Marshall's make-regex.el ["abort", "abs", "accept", "access", "array", "begin", "body", "case", "constant", "declare", "delay", "delta", "digits", "else", "elsif", "entry", "exception", "exit", "function", "generic", "goto", "if", "others", "limited", "loop", "mod", "new", "null", "out", "subtype", "package", "pragma", "private", "procedure", "raise", "range", "record", "rem", "renames", "return", "reverse", "select", "separate", "task", "terminate", "then", "type", "when", "while", "with", "xor"] ] for t in tests println("testing $t") println(make_regex(t)) println() end #= words = last(tests) rx = make_regex(words) println(words) println("regex:$rx") check_regex(rx,words) =#
[ 27, 34345, 29, 73, 43640, 14, 15883, 62, 260, 25636, 13, 20362, 198, 2, 28, 198, 220, 220, 220, 317, 2493, 286, 616, 24316, 14, 29584, 14, 37906, 6889, 3041, 25636, 287, 22300, 13, 628, 220, 220, 220, 787, 62, 260, 25636, 7, 10879...
2.197158
2,815
<gh_stars>0 const olm_pomc_c = 1e5 # exploration parameter for MCTS const olm_pomc_iterations = 300 # exploration parameter for MCTS const olm_pomc_dt = 0.5 # exploration parameter for MCTS mutable struct PomcNode x::AbstractArray{Float64, 1} u::AbstractArray{Float64, 1} b::AbstractArray{Float64, 1} adv_x::AbstractArray{Float64, 1} c::pomdp.Collision q::Float64 N::Int Ns::Int PomcNode() = new(Float64[], Float64[], Float64[], Float64[], pomdp.Collision(), 0.0, 1, 1) end function plan_pomc(x::AbstractArray{Float64, 1}, b::AbstractArray{Float64, 1}, agent::Agent, adv_agent::Agent, world::World, reward::Function, ctrl_d::Discretization, depth::Int) #backup variables adv_agent_controller! = adv_agent.controller! adv_agent_custom = adv_agent.custom x = copy(x) x[1] = mod(x[1], world.road.path.S[end]) value = PomcNode() value.x = x value.b = b value.adv_x = adv_agent.x adv_agent.controller! = pomdp.adv_controller! (c, _) = adv.predict_collision(adv_agent.x, agent.x, world) value.c = c node = GroupTree(value) num_iterations = round(Int, olm_pomc_iterations / 4 * depth) visited = Set{PomcNode}() for i in 1:num_iterations simulate_pomc(node, agent, adv_agent, world, reward, ctrl_d, visited, depth) end us = Float64[] qs = -Inf ret = nothing (adv_c, _) = predict_collision(adv_agent.x, x, world) P = map(o -> reduce(+, map(i -> node.value.b[i] * pomdp.P_adv(o, adv_c, pomdp.DRIVERS[i]), 1:length(pomdp.DRIVERS))), pomdp.ACTIONS) for a in 1:length(node.next) q = reduce(+, map(o -> node.next[a][o].value.q * P[o], 1:length(pomdp.ACTIONS))) if q > qs qs = q us = node.next[a][1].value.u ret = node end end # revert variables adv_agent.controller! = adv_agent_controller! adv_agent.custom = adv_agent_custom return (us, node) end function simulate_pomc(node::GroupTree, agent::Agent, adv_agent::Agent, world::World, reward::Function, ctrl_d::Discretization, visited::Set{PomcNode}, depth::Int) if depth <= 0 return 0.0 end node.value.x[1] = mod(node.value.x[1], world.road.path.S[end]) (adv_c, _) = predict_collision(node.value.adv_x, node.value.x, world) if !(node.value in visited) push!(visited, node.value) # predict adv agent doing three possible actions adv_NX = Array{Array{Float64, 1}, 1}(undef, length(pomdp.ACTIONS)) for o in pomdp.ACTIONS oidx = Int(o) adv_nx = copy(node.value.adv_x) adv_agent.custom[3] = o sim.advance!(sim.default_dynamics!, adv_nx, Pair(adv_agent, world), 0.0, olm_pomc_dt, olm_h) adv_nx[1] = mod(adv_nx[1], world.road.path.S[end]) adv_NX[oidx] = adv_nx end # allocate next level of the tree la_len = ctrl_d.thr[end] * ctrl_d.pt[end] # number of actions to survey node.next = Array{Array{GroupTree, 1}, 1}(undef, la_len) for aidx in 1:la_len node.next[aidx] = Array{GroupTree, 1}(undef, length(pomdp.ACTIONS)) end for la in 0:(la_len - 1) u = dis.ls2x(ctrl_d, la) agent.custom = u nx = copy(node.value.x) sim.advance!(sim.default_dynamics!, nx, Pair(agent, world), 0.0, olm_pomc_dt, olm_h) nx[1] = mod(nx[1], world.road.path.S[end]) ra = 0.0 for o in pomdp.ACTIONS oidx = Int(o) adv_nx = adv_NX[oidx] (nc, _) = adv.predict_collision(nx, adv_nx, world) custom = agent.custom agent.custom = nc r = reward(node.value.x, u, nx, agent, world) agent.custom = custom bp = pomdp.update_belief(node.value.b, o, adv_c) value = PomcNode() value.x = nx value.adv_x = adv_nx value.u = u value.b = bp value.c = nc value.q = r next_node = GroupTree(value) node.next[la + 1][oidx] = next_node end end return 0.0 end # probability of each observation P = map(o -> reduce(+, map(i -> node.value.b[i] * pomdp.P_adv(o, adv_c, pomdp.DRIVERS[i]), 1:length(pomdp.DRIVERS))), pomdp.ACTIONS) # find the best action for value and exploration as = -1 vs = -Inf for a in 1:length(node.next) # expected reward ra = reduce(+, map(o -> node.next[a][o].value.q * P[o], 1:length(pomdp.ACTIONS))) v = ra + olm_pomc_c * sqrt(log(node.value.Ns) / reduce(+, map(o -> node.next[a][o].value.N, 1:length(pomdp.ACTIONS)))) if v > vs vs = v as = a end end # sample a transition cP = cumsum(P) rnd = rand() oidx = findfirst(i -> cP[i] >= rnd, 1:length(cP)) x = node.value.x adv_nx = node.next[as][oidx].value.adv_x u = node.next[as][oidx].value.u nx = node.next[as][oidx].value.x bp = node.next[as][oidx].value.b (nc, _) = adv.predict_collision(nx, adv_nx, world) custom = agent.custom agent.custom = nc r = reward(node.value.x, u, nx, agent, world) agent.custom = custom q = r + olm_gamma * simulate_pomc(node.next[as][oidx], agent, adv_agent, world, reward, ctrl_d, visited, depth - 1) # update Qsa for fuck's sake ---------------------------------------------- # dq = (q - node.next[as][oidx].value.q) node.next[as][oidx].value.q += dq / node.next[as][oidx].value.N # this works best BY FAR #node.next[as].value.q = max(q, node.next[as].value.q) #alpha = 0.5 #Qsa = node.next[as].value.q #Qsa = Qsa * (1 - alpha) + q * alpha #node.next[as].value.q = Qsa # ------------------------------------------------------------------------- # node.next[as][oidx].value.N += 1 node.value.Ns += 1 return q end function rollout(x::AbstractArray{Float64, 1}, adv_x::AbstractArray{Float64, 1}, b::AbstractArray{Float64, 1}, agent::Agent, adv_agent::Agent, world::World, reward::Function, ctrl_d::Discretization, depth::Int) if depth <= 0 return 0.0 end return 0.0 # choose middle action, generally reasonable end function controller_pomc!(u::AbstractArray{Float64}, x::AbstractArray{Float64}, dx::AbstractArray{Float64}, agent_world::Pair{Agent, World}, t::Float64) agent = agent_world.first u[1] = agent.custom[1] u[2] = agent.custom[2] end
[ 27, 456, 62, 30783, 29, 15, 198, 9979, 25776, 76, 62, 79, 296, 66, 62, 66, 796, 352, 68, 20, 1303, 13936, 11507, 329, 337, 4177, 50, 198, 9979, 25776, 76, 62, 79, 296, 66, 62, 2676, 602, 796, 5867, 1303, 13936, 11507, 329, 337, ...
2.059293
3,255
<filename>O9/O9-praksis.jl # Question 1 function findset(x::DisjointSetNode) if (x !=x.p ) x.p = findset(x.p) end x.p end # Question 2 function link!(x,y) if (x.rank > y.rank) y.p=x else (x.p =y) if (x.rank == y.rank) y.rank = y.rank + 1 end end end function union!(x::DisjointSetNode,y::DisjointSetNode) link!(findset(x),findset(y)) end # Question 3 function hammingdistance(s1::String,s2::String) teller = 0 for i = 1:length(s1) if s1[i] != s2[i] teller +=1 end end teller end
[ 27, 34345, 29, 46, 24, 14, 46, 24, 12, 79, 430, 591, 271, 13, 20362, 198, 2, 18233, 352, 198, 8818, 1064, 2617, 7, 87, 3712, 7279, 73, 1563, 7248, 19667, 8, 198, 220, 220, 220, 611, 357, 87, 14512, 87, 13, 79, 1267, 198, 220, ...
1.817073
328
<reponame>astrieanna/GitHub.jl module GitHub import Base.show using Requests import JSON using HttpCommon abstract GitHubType abstract Owner <: GitHubType # types export User, Organization, Repo, Issue, HttpError, AuthError, StatsError # methods export authenticate, set_api_endpoint, set_web_endpoint, user, star, unstar, stargazers, starred, forks, fork, contributors, commit_activity, code_frequency, participation, punch_card, collaborators, iscollaborator, add_collaborator, remove_collaborator, watchers, watched, watching, watch, unwatch, followers, following, org, orgs, repo, issue, create_issue, edit_issue, issues include("utils.jl") include("endpoint.jl") include("error.jl") include("auth.jl") include("users.jl") include("organizations.jl") include("repos.jl") include("issues.jl") include("starring.jl") include("forks.jl") include("statistics.jl") include("collaborators.jl") include("watching.jl") end
[ 27, 7856, 261, 480, 29, 459, 5034, 7697, 14, 38, 270, 16066, 13, 20362, 198, 198, 21412, 21722, 198, 198, 11748, 7308, 13, 12860, 198, 198, 3500, 9394, 3558, 198, 11748, 19449, 198, 3500, 367, 29281, 17227, 628, 198, 397, 8709, 21722,...
2.158559
555
<filename>src/gridmodule/gridreader.jl<gh_stars>0 export readgrid if VERSION < v"0.4.0-dev+1419" stringtoint(s) = int(s); stringtofloat(s) = float(s); else stringtoint(s) = parse(Int64,s); stringtofloat(s) = parse(Float64,s); end """ **Summary:** ``` xyz,vert,pattr,ele,eattr,nd=function readgrid(fname::String) ``` **Description:** Reads a *1D,2D,3D* topology grid from the file `fname` and stores data in intermediate structure consisting of - `xyz ::Array{Float64,2}` vertices positions - `vert ::Array{Int64,2}` vertex numbers - `pattr::Array{Int64,2}` vertex attributes - `ele ::Array{Int64,2}` element connectivity - `eattr::Array{Int64,2}` element attributes - `nd::Int64` spatial dimension (<=topological dimension) xyz,vert,pattr,ele,eattr,nd as read from node and ele files. Can handle meshes generated with *triangle*, *tetgen*, and the corresponding *1D* equivalent. The type of mesh (intervals, triangles, tetraeders etc.) should be known by the caller of readgrid, when creating the proper derived objects, i.e. topologies. """ function readgrid(fname::String) # read vertex related stuff fid = open(fname * ".node","r") mesh_header = split(strip(readline(fid))) # read file header nvert = stringtoint(mesh_header[1]) # number of vertices nd = stringtoint(mesh_header[2]) # spatial dimension npattr = stringtoint(mesh_header[3]) # number of point attributes nidv = stringtoint(mesh_header[4]) # number of boundary markers # allocate xyz = zeros(Float64,nvert,nd) vert = zeros(Int64, nvert, 2 ) pattr = zeros(Int64, nvert, nidv + npattr) # read vertex positions, enumeration, and attributes for i=1:nvert data = split(strip(readline(fid))) for j=1:nd xyz[i,j] = stringtofloat(data[1+j]) end vert[i,1] = i vert[i,2] = stringtoint(data[1]) for j=1:nidv+npattr pattr[i,j] = stringtoint(data[1+nd+j]) end end close(fid) # read element related stuff fid = open(fname * ".ele","r") mesh_header = split(strip(readline(fid))) nele = stringtoint(mesh_header[1]) # number of elements ntop = stringtoint(mesh_header[2]) # number of entities per element nide = stringtoint(mesh_header[3]) # number of element attributes # allocate ele = zeros(Int64,nele,ntop+1) eattr = zeros(Int64,nele,nide) # read element enumeration, connectivity and attributes for k=1:nele data = split(strip(readline(fid))) for i=1:(ntop+1) ele[k,i] = stringtoint(data[i]) end for i=1:nide eattr[k,i] = stringtoint(data[ntop+1+i]) end end close(fid) return xyz,vert,pattr,ele,eattr,nd end # see http://userpages.umbc.edu/~squire/UCD_Form.htm # readable with ParaView function readgrid_avs(fname::String) # read vertex related stuff fid = open(fname * ".inp","r") mesh_header = split(strip(readline(fid))) # read file header nvert = stringtoint(mesh_header[1]) # number of vertices nele = stringtoint(mesh_header[2]) # number of elements npattr = stringtoint(mesh_header[3]) # number of point attributes nide = stringtoint(mesh_header[4]) # number of element attributes nmodel = stringtoint(mesh_header[5]) # model data (assume this is zero) nd = 3 # spatial dimension nide = 1 # overwrite above ntop = 3 # allocate xyz = zeros(Float64,nvert,nd) vert = zeros(Int64, nvert, 2 ) # read vertex positions, enumeration, and attributes for i=1:nvert data = split(strip(readline(fid))) for j=1:nd xyz[i,j] = stringtofloat(data[1+j]) end vert[i,1] = i vert[i,2] = stringtoint(data[1]) end ele = zeros(Int64,nele,4) eattr = zeros(Int64,nele,nide) # ==1? for k=1:nele data = split(strip(readline(fid))) if data[3]=="tri" ele[k,1] = stringtoint(data[1]) for i=1:3 ele[k,1+i] = stringtoint(data[3+i]) end for i=1:nide eattr[k,i] = stringtoint(data[1+i]) end end end # read from INP file? pattr = zeros(Int64,nvert,1) close(fid) return xyz,vert,pattr,ele,eattr,nd end
[ 27, 34345, 29, 10677, 14, 25928, 21412, 14, 25928, 46862, 13, 20362, 27, 456, 62, 30783, 29, 15, 198, 39344, 1100, 25928, 198, 198, 361, 44156, 2849, 1279, 410, 1, 15, 13, 19, 13, 15, 12, 7959, 10, 1415, 1129, 1, 198, 220, 4731, ...
2.353837
1,772
""" 将三角切分的结果再进行切分 """ module Refine using ..Basics export split_triangle, refine_triangles, find_adjs_by_adjoint """ 将三角形重新切分成四个,可以用在直角三角形上 依旧保证出来的四个是直角三角形,且第一个角是直角 """ @generated function split_triangle(rtri::Basics.AbstractTriangle{T}) where T type2func = Dict( :COM => Triangle, :RT => RtTriangle, :EQ => EqTriangle ) func = type2func[T] if T == :RT return quote #新的四个直角三角形的四个直角 rtvexs = Vector{Point2D}(undef, 4) rtvexs[1] = rtri.vertex[1] rtvexs[2] = middle_point(rtri.vertex[1], rtri.vertex[2]) rtvexs[3] = middle_point(rtri.vertex[2], rtri.vertex[3]) rtvexs[4] = middle_point(rtri.vertex[3], rtri.vertex[1]) # newtris = Vector{Basics.AbstractTriangle{T}}(undef, 4) newtris[1] = RtTriangle(rtvexs[2], rtvexs[3], rtvexs[1]) newtris[2] = RtTriangle(rtvexs[2], rtri.vertex[2], rtvexs[3]) newtris[3] = RtTriangle(rtvexs[4], rtvexs[3], rtri.vertex[3]) newtris[4] = RtTriangle(rtvexs[4], rtvexs[3], rtvexs[1]) return newtris end end return quote #新的四个直角三角形的四个直角 rtvexs = Vector{Point2D}(undef, 4) rtvexs[1] = rtri.vertex[1] rtvexs[2] = middle_point(rtri.vertex[1], rtri.vertex[2]) rtvexs[3] = middle_point(rtri.vertex[2], rtri.vertex[3]) rtvexs[4] = middle_point(rtri.vertex[3], rtri.vertex[1]) # newtris = Vector{Basics.AbstractTriangle{T}}(undef, 4) newtris[1] = ($func)(rtvexs[1], rtvexs[2], rtvexs[4]) newtris[2] = ($func)(rtvexs[2], rtri.vertex[2], rtvexs[3]) newtris[3] = ($func)(rtvexs[3], rtvexs[4], rtvexs[2]) newtris[4] = ($func)(rtvexs[4], rtvexs[3], rtri.vertex[3]) return newtris end # end quote end """ 将一组的三角形细化 """ function refine_triangles(ltris::Vector{T}) where T <: Basics.AbstractTriangle newtris = Matrix{T}(undef, length(ltris), 4) for (idx, tri) in enumerate(ltris) newtris[idx, :] = split_triangle(tri) end newtris = reshape(newtris, length(ltris)*4) return newtris end """ 判断一条边是不是某个三角形的 """ macro isedge(edge, tri) return esc(quote topt1 = [vex - ($edge).pt1 for vex in ($tri).vertex] topt1 = [sqrt(pt.x^2 + pt.y^2) for pt in topt1] haspt1 = isapprox(minimum(topt1), 0., atol=1e-6) topt2 = [vex - ($edge).pt2 for vex in ($tri).vertex] topt2 = [sqrt(pt.x^2 + pt.y^2) for pt in topt2] haspt2 = isapprox(minimum(topt2), 0., atol=1e-6) haspt1 && haspt2 end) end """ 通过判断边是否重合来判断两个三角形是否挨在一起 """ function find_adjs_by_adjoint(ltris::Vector{T}) where T <: Basics.AbstractTriangle ladjs = Vector{Tuple{ Union{Missing, T}, Union{Missing, T}, Union{Missing, T} }}(undef, length(ltris)) for idx in 1:1:length(ltris) ladjs[idx] = (missing, missing, missing) end @Threads.threads for idx in 1:1:length(ltris) tri = ltris[idx] fadjs = Vector{Union{Missing, T}}(undef, 3) fadjs[:] = [missing, missing, missing] for (adjidx, adjtri) in enumerate(ltris) if idx == adjidx continue end if @isedge tri.edges[1] adjtri fadjs[1] = adjtri continue end if @isedge tri.edges[2] adjtri fadjs[2] = adjtri continue end if @isedge tri.edges[3] adjtri fadjs[3] = adjtri continue end end ladjs[idx] = Tuple(fadjs) end return ladjs end end # end module
[ 37811, 198, 49546, 49011, 164, 100, 240, 26344, 229, 26344, 228, 21410, 163, 119, 241, 162, 252, 250, 37863, 235, 32573, 249, 26193, 234, 26344, 229, 26344, 228, 198, 37811, 198, 21412, 6524, 500, 198, 220, 220, 220, 220, 198, 3500, 1...
1.659613
2,221
<gh_stars>10-100 #!/usr/bin/env julia # Copyright 2018 IBM Corp. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import SemanticFlowGraphs: CLI function expand_paths(path::String)::Vector{String} if isfile(path); [ path ] elseif isdir(path); readdir(path) else String[] end end cmds, cmd_args = CLI.parse(ARGS) # XXX: Reduce load time by only importing extra packages as needed. # Julia really needs a better solution to this problem... if first(cmds) == "record" paths = expand_paths(cmd_args["path"]) if any(endswith(path, ".py") for path in paths) import PyCall end if any(endswith(path, ".R") for path in paths) import RCall end end CLI.invoke(cmds, cmd_args)
[ 27, 456, 62, 30783, 29, 940, 12, 3064, 198, 2, 48443, 14629, 14, 8800, 14, 24330, 474, 43640, 198, 198, 2, 15069, 2864, 19764, 11421, 13, 198, 2, 198, 2, 49962, 739, 262, 24843, 13789, 11, 10628, 362, 13, 15, 357, 1169, 366, 34156...
3.187166
374
<filename>src/entities/summitbackgroundmanager.jl module SummitBackgroundManager using ..Ahorn, Maple const placements = Ahorn.PlacementDict( "Summit Background Manager" => Ahorn.EntityPlacement( Maple.SummitBackgroundManager ) ) function Ahorn.selection(entity::Maple.SummitBackgroundManager) x, y = Ahorn.position(entity) return Ahorn.Rectangle[Ahorn.Rectangle(x - 12, y - 12, 24, 24)] end Ahorn.render(ctx::Ahorn.Cairo.CairoContext, entity::Maple.SummitBackgroundManager, room::Maple.Room) = Ahorn.drawImage(ctx, Ahorn.Assets.summitBackgroundManager, -12, -12) end
[ 27, 34345, 29, 10677, 14, 298, 871, 14, 16345, 2781, 25249, 37153, 13, 20362, 198, 21412, 20014, 21756, 13511, 198, 198, 3500, 11485, 10910, 1211, 11, 21249, 198, 198, 9979, 21957, 3196, 796, 7900, 1211, 13, 3646, 5592, 35, 713, 7, 19...
2.856459
209
########################################################################## # Copyright 2017 <NAME>. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. ########################################################################## # Dynamic Double Standard Model, with some modifications # From paper: "A dynamic model and parallel tabu search heuristic for real-time ambulance relocation" # Modifications (compared with original ddsm): # - Added slack variables to coverage constraints, to avoid infeasibility. Cost of slack per unit is given by slackWeight. # - Redeployment cost only depends on travel time, not on: ambulance history, avoiding round trips. # initialise data relevant to move up function initDdsm!(sim::Simulation; coverFractionTargetT1::Float = 0.5, travelTimeCost::Float = 50.0, slackWeight::Float = 1e9, coverTimeDemandPriorities::Vector{Priority} = [highPriority, lowPriority], options::Dict{Symbol,Any} = Dict{Symbol,Any}()) # slackWeight is the weight to apply to slack variables, needs to be sufficiently large so that the slack variables are zero when possible # coverTimeDemandPriorities[i] is demand priority for coverTimes[i], where coverTimes[1] and [2] are the targets for ddsm @assert(0 <= coverFractionTargetT1 <= 1) @assert(length(coverTimeDemandPriorities) == 2) # initialise demand and demand coverage data if not already initialised sim.demand.initialised || initDemand!(sim) sim.demandCoverage.initialised || initDemandCoverage!(sim) demand = sim.demand # shorthand @assert(all([demandMode.rasterIndex for demandMode in demand.modes[demand.modeLookup[i,:]]] |> unique |> length == 1 for i = 1:demand.numSets)) # distribution of demand must be same for all demand priorities, in any given time period # two target cover times for ddsm coverTimes = [sim.demandCoverage.coverTimes[p] for p in coverTimeDemandPriorities] @assert(length(coverTimes) == 2) @assert(coverTimes[1] < coverTimes[2]) # change to warning? # set options ddsmd = sim.moveUpData.ddsmData # shorthand ddsmd.options[:solver] = "cbc" # can be slower than glpk, but more reliable for some reason ddsmd.options[:solver_args] = [] ddsmd.options[:solver_kwargs] = [] ddsmd.options[:v] = v"1" ddsmd.options[:z_var] = true ddsmd.options[:bin_tol] = 1e-5 merge!(ddsmd.options, Dict([:x_bin => true, :y11_bin => true, :y12_bin => true, :y2_bin => true])) ddsmOptions!(sim, options) ddsmd.coverFractionTargetT1 = coverFractionTargetT1 ddsmd.travelTimeCost = travelTimeCost ddsmd.slackWeight = slackWeight ddsmd.coverTimeDemandPriorities = coverTimeDemandPriorities # coverTimeDemandPriorities[i] is demand priority for coverTimes[i] ddsmd.coverTimes = coverTimes end # change the options for ddsm function ddsmOptions!(sim, options::Dict{Symbol,T}) where T <: Any options = merge!(sim.moveUpData.ddsmData.options, options) # update options @assert(in(options[:solver], ["cbc", "glpk", "gurobi"])) @assert(typeof(options[:v]) == VersionNumber) @assert(typeof(options[:z_var]) == Bool) @assert(0 < options[:bin_tol] < 0.1) if options[:solver] == "gurobi" try Gurobi; catch; options[:solver] = "cbc"; @warn("Failed to use Gurobi, using Cbc instead.") end end # options[:v] == v"0" # do nothing, values should already be set in options if using this options[:v] == v"1" && merge!(options, Dict([:x_bin => true, :y11_bin => true, :y12_bin => true, :y2_bin => true])) options[:v] == v"2" && merge!(options, Dict([:x_bin => true, :y11_bin => true, :y12_bin => false, :y2_bin => false])) options[:v] == v"3" && merge!(options, Dict([:x_bin => false, :y11_bin => true, :y12_bin => false, :y2_bin => false])) options[:v] == v"4" && merge!(options, Dict([:x_bin => false, :y11_bin => true, :y12_bin => true, :y2_bin => true])) if options[:y11_bin] == false && in(options[:solver], ["cbc", "glpk"]) @warn("Removing binary constraint for `y11` may not work with CBC or GLPK.") end if options[:x_bin] == false && options[:solver] == "gurobi" @warn("Removing binary constraint for `x` may not work with Gurobi.") end @assert(all(key -> haskey(options, key), [:x_bin, :y11_bin, :y12_bin, :y2_bin])) if isdefined(sim, :backup) sim.backup.moveUpData.ddsmData.options = options end # to keep options if sim is reset return options end function ddsmMoveUp(sim::Simulation) @assert(sim.moveUpData.useMoveUp) # shorthand: @unpack ambulances, stations, numStations, demand = sim currentTime = sim.time ddsmd = sim.moveUpData.ddsmData @unpack coverTimes, coverTimeDemandPriorities, coverFractionTargetT1, slackWeight, options = ddsmd # get movable ambulances (movableAmbs) ambMovable = [isAmbMovable(amb) for amb in ambulances] movableAmbs = ambulances[ambMovable] numMovableAmbs = length(movableAmbs) if numMovableAmbs == 0 return moveUpNull() end # calculate travel time for each movable ambulance ambToStationTimes = zeros(Float, numMovableAmbs, numStations) # ambToStationTimes[i,j] = time for movable ambulance i to travel to station j for i = 1:numMovableAmbs ambToStationTimes[i,:] = ambMoveUpTravelTimes!(sim, movableAmbs[i]) end ambToStationCosts = ambToStationTimes * ddsmd.travelTimeCost # get demand point coverage data for the two target cover times # for coverTimes[ti], point j has demand pointDemands[ti][j] and is covered by stations pointStations[ti][j] pointStations = [] # pointStations[ti][j] is coverTimes[ti] pointDemands = [] numPoints = Int[] # can have different number of points (really point sets) for each cover time demandPriorityArrivalRates = [getDemandMode!(demand, demandPriority, currentTime).arrivalRate for demandPriority in priorities] for demandPriority in coverTimeDemandPriorities # get demand point coverage data pointsCoverageMode = getPointsCoverageMode!(sim, demandPriority, currentTime) demandMode = getDemandMode!(demand, demandPriority, currentTime) pointSetsDemands = getPointSetsDemands!(sim, demandPriority, currentTime; pointsCoverageMode = pointsCoverageMode) * demandMode.rasterMultiplier pointSetsDemands *= sum(demandPriorityArrivalRates) / demandPriorityArrivalRates[Int(demandPriority)] # scale demand to be for all priorities, not just current demandPriority push!(pointStations, pointsCoverageMode.stationSets) push!(pointDemands, pointSetsDemands) push!(numPoints, length(pointSetsDemands)) end @assert(isapprox(sum(pointDemands[1]), sum(pointDemands[2]))) # could have it so that pointStations, pointDemands, and numPoints are only updated if the demandSet has changed since last query, # but this may only shave off a couple of seconds per 100 sim days, which is not the current bottleneck ###################### # IP # shorthand a = numMovableAmbs np = numPoints # np[ti] is number of points for coverTimes[i] s = numStations t = coverTimes # using JuMP model = Model() solver = options[:solver] # shorthand args = options[:solver_args] # shorthand kwargs = options[:solver_kwargs] # shorthand if solver == "cbc" set_optimizer(model, with_optimizer(Cbc.Optimizer, logLevel=0, args...; kwargs...)) elseif solver == "glpk" set_optimizer(model, with_optimizer(GLPK.Optimizer, args...; kwargs...)) elseif solver == "gurobi" @stdout_silent(set_optimizer(model, with_optimizer(Gurobi.Optimizer, OutputFlag=0, args...; kwargs...))) end m = model # shorthand options[:x_bin] ? @variable(m, x[i=1:a,j=1:s], Bin) : @variable(m, 0 <= x[i=1:a,j=1:s] <= 1) options[:y11_bin] ? @variable(m, y11[p=1:np[1]], Bin) : @variable(m, 0 <= y11[p=1:np[1]] <= 1) options[:y12_bin] ? @variable(m, y12[p=1:np[1]], Bin) : @variable(m, 0 <= y12[p=1:np[1]] <= 1) options[:y2_bin] ? @variable(m, y2[p=1:np[2]], Bin) : @variable(m, 0 <= y2[p=1:np[2]] <= 1) # x[i,j] = 1 if ambulance: movableAmbs[i] should be moved to station: stations[j], 0 otherwise # y11[p,k] = 1 if demand point p is covered at least once within t[1], 0 otherwise # y12[p,k] = 1 if demand point p is covered at least twice within t[1], 0 otherwise # y2[p] = 1 if demand point p is covered at least once within t[2], 0 otherwise @variables(model, begin (s1 >= 0) # slack (s2 >= 0) # slack end) @constraints(model, begin (ambAtOneStation[i=1:a], sum(x[i,:]) == 1) # each ambulance must be assigned to one station (pointCoverOrderY1[p=1:np[1]], y11[p] >= y12[p]) # single coverage before double coverage; not needed for y2 (demandCoveredOnceT1, sum(y11[p] * pointDemands[1][p] for p=1:np[1]) + s1 >= coverFractionTargetT1 * sum(pointDemands[1])) # fraction of demand covered once within t[1] (demandCoveredOnceT2, sum(y2[p] * pointDemands[2][p] for p=1:np[2]) + s2 >= sum(pointDemands[2])) # all demand covered once within t[2] end) if options[:z_var] @variable(model, z[j=1:s], Int) # z[j] = number of ambulances to assign to station j @constraints(model, begin (stationAmbCount[j=1:s], z[j] == sum(x[:,j])) (pointCoverCountY1[p=1:np[1]], y11[p] + y12[p] <= sum(z[pointStations[1][p]])) (pointCoverCountY2[p=1:np[2]], y2[p] <= sum(z[pointStations[2][p]])) end) else @constraints(model, begin (pointCoverCountY1[p=1:np[1]], y11[p] + y12[p] <= sum(x[:,pointStations[1][p]])) (pointCoverCountY2[p=1:np[2]], y2[p] <= sum(x[:,pointStations[2][p]])) end) end @expressions(model, begin demandCoveredTwiceT1, sum(y12[p] * pointDemands[1][p] for p=1:np[1]) totalAmbTravelCost, sum(x[i,j] * ambToStationCosts[i,j] for i=1:a, j=1:s) slackCost, (s1 + s2) * slackWeight end) # solve @objective(model, Max, demandCoveredTwiceT1 - totalAmbTravelCost - slackCost) @stdout_silent optimize!(model) @assert(termination_status(model) == MOI.OPTIMAL) # get solution vals = Dict() vals[:x] = JuMP.value.(x) vals[:y11] = JuMP.value.(y11) vals[:y12] = JuMP.value.(y12) vals[:y2] = JuMP.value.(y2) sol = convert(Array{Bool,2}, round.(vals[:x])) if checkMode @assert(all(sum(sol, dims=2) .== 1)) # check constraint: ambAtOneStation # check that values are binary for sym in [:x, :y11, :y12, :y2] err = maximum(abs.(vals[sym] - round.(vals[sym]))) @assert(err <= options[:bin_tol], (sym, err)) end end ambStations = [stations[findfirst(sol[i,:])] for i=1:a] return movableAmbs, ambStations end
[ 29113, 29113, 7804, 2235, 198, 2, 15069, 2177, 1279, 20608, 28401, 198, 2, 198, 2, 49962, 739, 262, 24843, 13789, 11, 10628, 362, 13, 15, 357, 1169, 366, 34156, 15341, 198, 2, 345, 743, 407, 779, 428, 2393, 2845, 287, 11846, 351, 26...
2.752702
3,886
module Criterion include("stats.jl") include("analysis.jl") include("types.jl") include("measurement.jl") include("environment.jl") include("run.jl") include("report.jl") end
[ 21412, 10056, 28019, 198, 198, 17256, 7203, 34242, 13, 20362, 4943, 198, 17256, 7203, 20930, 13, 20362, 4943, 198, 17256, 7203, 19199, 13, 20362, 4943, 198, 17256, 7203, 1326, 5015, 434, 13, 20362, 4943, 198, 17256, 7203, 38986, 13, 20362...
3.034483
58
#= *** rewrite for import purposes *** This is a resnet implementation by <NAME>uret (https://github.com/denizyuret/Knet.jl/blob/master/examples/resnet/resnet.jl) with minor changes: Copyright (c) 2015: <NAME>. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: julia resnet.jl image-file-or-url This example implements the ResNet-50, ResNet-101 and ResNet-152 models from 'Deep Residual Learning for Image Regocnition', <NAME>, <NAME>, <NAME>, <NAME>, arXiv technical report 1512.03385, 2015. * Paper url: https://arxiv.org/abs/1512.03385 * Project page: https://github.com/KaimingHe/deep-residual-networks * MatConvNet weights used here: http://www.vlfeat.org/matconvnet/pretrained =# # mode, 0=>train, 1=>test function resnet50(w,x,ms; mode=1) # layer 1 conv1 = conv4(w[1],x; padding=3, stride=2) .+ w[2] bn1 = batchnorm(w[3:4],conv1,ms; mode=mode) pool1 = pool(bn1; window=3, stride=2) # layer 2,3,4,5 r2 = reslayerx5(w[5:34], pool1, ms; strides=[1,1,1,1], mode=mode) r3 = reslayerx5(w[35:73], r2, ms; mode=mode) r4 = reslayerx5(w[74:130], r3, ms; mode=mode) # 5 r5 = reslayerx5(w[131:160], r4, ms; mode=mode) # fully connected layer pool5 = pool(r5; stride=1, window=7, mode=2) fc1000 = w[161] * mat(pool5) .+ w[162] end # mode, 0=>train, 1=>test function resnet101(w,x,ms; mode=1) # layer 1 conv1 = reslayerx1(w[1:3],x,ms; padding=3, stride=2, mode=mode) pool1 = pool(conv1; window=3, stride=2) # layer 2,3,4,5 r2 = reslayerx5(w[4:33], pool1, ms; strides=[1,1,1,1], mode=mode) r3 = reslayerx5(w[34:72], r2, ms; mode=mode) r4 = reslayerx5(w[73:282], r3, ms; mode=mode) r5 = reslayerx5(w[283:312], r4, ms; mode=mode) # fully connected layer pool5 = pool(r5; stride=1, window=7, mode=2) fc1000 = w[313] * mat(pool5) .+ w[314] end # mode, 0=>train, 1=>test function resnet152(w,x,ms; mode=1) # layer 1 conv1 = reslayerx1(w[1:3],x,ms; padding=3, stride=2, mode=mode) pool1 = pool(conv1; window=3, stride=2) # layer 2,3,4,5 r2 = reslayerx5(w[4:33], pool1, ms; strides=[1,1,1,1], mode=mode) r3 = reslayerx5(w[34:108], r2, ms; mode=mode) r4 = reslayerx5(w[109:435], r3, ms; mode=mode) r5 = reslayerx5(w[436:465], r4, ms; mode=mode) # fully connected layer pool5 = pool(r5; stride=1, window=7, mode=2) fc1000 = w[466] * mat(pool5) .+ w[467] end # Batch Normalization Layer # works both for convolutional and fully connected layers # mode, 0=>train, 1=>test function batchnorm(w, x, ms; mode=1, epsilon=1e-5) mu, sigma = nothing, nothing if mode == 0 d = ndims(x) == 4 ? (1,2,4) : (2,) s = prod(size(x,d...)) mu = sum(x,d) / s x0 = x .- mu x1 = x0 .* x0 sigma = sqrt(epsilon + (sum(x1, d)) / s) elseif mode == 1 mu = popfirst!(ms) sigma = popfirst!(ms) end # we need value in backpropagation push!(ms, value(mu), value(sigma)) xhat = (x.-mu) ./ sigma return w[1] .* xhat .+ w[2] end function reslayerx0(w,x,ms; padding=0, stride=1, mode=1) b = conv4(w[1],x; padding=padding, stride=stride) bx = batchnorm(w[2:3],b,ms; mode=mode) end function reslayerx1(w,x,ms; padding=0, stride=1, mode=1) relu.(reslayerx0(w,x,ms; padding=padding, stride=stride, mode=mode)) end function reslayerx2(w,x,ms; pads=[0,1,0], strides=[1,1,1], mode=1) ba = reslayerx1(w[1:3],x,ms; padding=pads[1], stride=strides[1], mode=mode) bb = reslayerx1(w[4:6],ba,ms; padding=pads[2], stride=strides[2], mode=mode) bc = reslayerx0(w[7:9],bb,ms; padding=pads[3], stride=strides[3], mode=mode) end function reslayerx3(w,x,ms; pads=[0,0,1,0], strides=[2,2,1,1], mode=1) # 12 a = reslayerx0(w[1:3],x,ms; stride=strides[1], padding=pads[1], mode=mode) b = reslayerx2(w[4:12],x,ms; strides=strides[2:4], pads=pads[2:4], mode=mode) relu.(a .+ b) end function reslayerx4(w,x,ms; pads=[0,1,0], strides=[1,1,1], mode=1) relu.(x .+ reslayerx2(w,x,ms; pads=pads, strides=strides, mode=mode)) end function reslayerx5(w,x,ms; strides=[2,2,1,1], mode=1) x = reslayerx3(w[1:12],x,ms; strides=strides, mode=mode) for k = 13:9:length(w) x = reslayerx4(w[k:k+8],x,ms; mode=mode) end return x end function get_params(params, atype) len = length(params["value"]) ws, ms = [], [] for k = 1:len name = params["name"][k] value = convert(Array{Float32}, params["value"][k]) if endswith(name, "moments") push!(ms, reshape(value[:,1], (1,1,size(value,1),1))) push!(ms, reshape(value[:,2], (1,1,size(value,1),1))) elseif startswith(name, "bn") push!(ws, reshape(value, (1,1,length(value),1))) elseif startswith(name, "fc") && endswith(name, "filter") push!(ws, transpose(reshape(value,(size(value,3),size(value,4))))) elseif startswith(name, "conv") && endswith(name, "bias") push!(ws, reshape(value, (1,1,length(value),1))) else push!(ws, value) end end map(wi->convert(atype, wi), ws), map(mi->convert(atype, mi), ms) end # This allows both non-interactive (shell command) and interactive calls like: # $ julia vgg.jl cat.jpg # julia> ResNet.main("cat.jpg") #PROGRAM_FILE=="resnet.jl" && main(ARGS)
[ 2, 28, 198, 8162, 28183, 329, 1330, 4959, 17202, 198, 198, 1212, 318, 257, 581, 3262, 7822, 416, 1279, 20608, 29, 495, 83, 357, 5450, 1378, 12567, 13, 785, 14, 6559, 528, 88, 495, 83, 14, 42, 3262, 13, 20362, 14, 2436, 672, 14, ...
2.179389
2,620
<filename>utils/install.jl<gh_stars>1-10 #!/usr/bin/env julia # Usage # # You can execute this file directly as long as the `julia` executable is # in your PATH and if you are on a Linux/macOS system. If `julia` is not in # your PATH or if you are on a Windows system, call Julia and explicitly # provide this file as a command line parameter, e.g., `path/to/julia # Trixi.jl/utils/install.jl`. import Pkg # Get Trixi root directory trixi_root_dir = dirname(@__DIR__) # Install Trixi dependencies println("*"^80) println("Installing dependencies for Trixi...") Pkg.activate(trixi_root_dir) Pkg.instantiate() # Install Trixi2Img dependencies println("*"^80) println("Installing dependencies for Trixi2Img...") Pkg.activate(joinpath(trixi_root_dir, "postprocessing", "pkg", "Trixi2Img")) Pkg.instantiate() # Install Trixi2Vtk dependencies println("*"^80) println("Installing dependencies for Trixi2Vtk...") Pkg.activate(joinpath(trixi_root_dir, "postprocessing", "pkg", "Trixi2Vtk")) Pkg.instantiate() println("*"^80) println("Done.")
[ 27, 34345, 29, 26791, 14, 17350, 13, 20362, 27, 456, 62, 30783, 29, 16, 12, 940, 198, 2, 48443, 14629, 14, 8800, 14, 24330, 474, 43640, 198, 198, 2, 29566, 198, 2, 198, 2, 921, 460, 12260, 428, 2393, 3264, 355, 890, 355, 262, 46...
2.857143
364
<gh_stars>10-100 # Energy function NbodyEnergy(u,Gm) """ Nbody problem Hamiltonian (Cartesian Coordinates) """ dim=2 nbody=length(Gm) @inbounds begin x = view(u,1:7) # x y = view(u,8:14) # y v = view(u,15:21) # x′ w = view(u,22:28) # y′ H=zero(eltype(u)) P=zero(eltype(u)) for i in 1:nbody H+=Gm[i]*(v[i]*v[i]+w[i]*w[i]) for j in i+1:nbody r = ((x[i]-x[j])^2+(y[i]-y[j])^2)^(1/2) P+=(Gm[i]/r)*Gm[j] end end return(H/2-P) end end # OdeProblem function f(du,u,p,t) @inbounds begin x = view(u,1:7) # x y = view(u,8:14) # y v = view(u,15:21) # x′ w = view(u,22:28) # y′ du[1:7] .= v du[8:14].= w for i in 15:28 du[i] = zero(u[1]) end for i=1:7,j=1:7 if i != j r = ((x[i]-x[j])^2 + (y[i] - y[j])^2)^(3/2) du[14+i] += j*(x[j] - x[i])/r du[21+i] += j*(y[j] - y[i])/r end end end end # DynamicalOdeProblem function dotv(dv,q,v,par,t) @inbounds begin x = view(q,1:7) # x y = view(q,8:14) # y vx = view(v,1:7) # x′ vy = view(v,8:14) # y′ for i in 1:14 dv[i] = zero(x[1]) end for i=1:7,j=1:7 if i != j r = ((x[i]-x[j])^2 + (y[i] - y[j])^2)^(3/2) dv[i] += j*(x[j] - x[i])/r dv[7+i] += j*(y[j] - y[i])/r end end end end function dotq(dq,q,v,par,t) @inbounds begin x = view(q,1:7) # x y = view(q,8:14) # y vx = view(v,1:7) # x′ vy = view(v,8:14) # y′ dq[1:7] .= vx dq[8:14].= vy end end # # Second Order Problem # function f2nd!(ddu,du,u,p,t) @inbounds begin x = view(u,1:7) # x y = view(u,8:14) # y vx = view(du,1:7) # x′ vy = view(du,8:14) # y′ for i in 1:14 ddu[i] = zero(x[1]) end for i=1:7,j=1:7 if i != j r = ((x[i]-x[j])^2 + (y[i] - y[j])^2)^(3/2) ddu[i] += j*(x[j] - x[i])/r ddu[7+i] += j*(y[j] - y[i])/r end end end end
[ 27, 456, 62, 30783, 29, 940, 12, 3064, 198, 198, 2, 6682, 198, 198, 8818, 399, 2618, 28925, 7, 84, 11, 38, 76, 8, 198, 37811, 198, 220, 220, 220, 220, 399, 2618, 1917, 11582, 666, 357, 43476, 35610, 22819, 17540, 8, 198, 37811, ...
1.580328
1,220
f (1)
[ 69, 357, 16, 8, 198 ]
1.2
5
<reponame>alenskorobogatova/ImPlot.jl # Histogram (Bar) plots # Vertical bars function PlotBars(label_id, x::AbstractArray{T1}, y::AbstractArray{T2}, args...) where {T1<:Real,T2<:Real} return PlotBars(label_id, promote(x, y)..., args...) end function PlotBars(values::AbstractArray{T}; count::Integer=length(values), label_id::String="", width=0.67, shift=0.0, offset::Integer=0, stride::Integer=1) where {T<:ImPlotData} return PlotBars(label_id, values, count, width, shift, offset, stride * sizeof(T)) end function PlotBars(x::AbstractArray{T}, y::AbstractArray{T}; count::Integer=min(length(x), length(y)), label_id::String="", width=0.67, offset::Integer=0, stride::Integer=1) where {T<:ImPlotData} return PlotBars(label_id, x, y, count, width, offset, stride * sizeof(T)) end function PlotBars(x::AbstractArray{T1}, y::AbstractArray{T2}; kwargs...) where {T1<:Real,T2<:Real} return PlotBars(promote(x, y)..., kwargs...) end # Horizontal bars function PlotBarsH(label_id, x::AbstractArray{T1}, y::AbstractArray{T2}, args...) where {T1<:Real,T2<:Real} return PlotBarsH(label_id, promote(x, y)..., args...) end function PlotBarsH(values::AbstractArray{T}; count::Integer=length(values), label_id::String="", width=0.67, shift=0.0, offset::Integer=0, stride::Integer=1) where {T<:ImPlotData} return PlotBarsH(label_id, values, count, width, shift, offset, stride * sizeof(T)) end function PlotBarsH(x::AbstractArray{T}, y::AbstractArray{T}; count::Integer=min(length(x), length(y)), label_id::String="", width=0.67, offset::Integer=0, stride::Integer=1) where {T<:ImPlotData} return PlotBarsH(label_id, x, y, count, width, offset, stride * sizeof(T)) end function PlotBarsH(x::AbstractArray{T1}, y::AbstractArray{T2}; kwargs...) where {T1<:Real,T2<:Real} return PlotBarsH(promote(x, y)..., kwargs...) end
[ 27, 7856, 261, 480, 29, 282, 641, 74, 273, 672, 519, 265, 10071, 14, 3546, 43328, 13, 20362, 198, 2, 5590, 21857, 357, 10374, 8, 21528, 198, 2, 38937, 9210, 198, 8818, 28114, 33, 945, 7, 18242, 62, 312, 11, 2124, 3712, 23839, 1918...
2.263965
913
using RecipesBase export SeqPlot export TestPlot export rectangle_corners function rectangle_corners(x::Real,y::Real,w,h; anchor=:bottomright) if anchor == :botttomright [x,x+w,x+w,x], [y,y,y+h,y+h] elseif anchor == :center [x-w/2, x+w/2, x+w/2, x-w/2], [y-h/2, y-h/2, y+h/2, y+h/2] else error("Anchor not recognised.") end end function rectangle_corners( x_vec::Vector{T},y_vec::Vector{T}, w,h; anchor=:bottomleft ) where {T<:Real} x_out = Vector{Real}[] y_out = Vector{Real}[] if anchor == :bottomleft for (x,y) in zip(x_vec, y_vec) push!(x_out, [x,x+w,x+w,x]) push!(y_out, [y,y,y+h,y+h]) end elseif anchor == :center for (x,y) in zip(x_vec, y_vec) push!(x_out, [x-w/2, x+w/2, x+w/2, x-w/2]) push!(y_out, [y-h/2, y-h/2, y+h/2, y+h/2]) end else error("Anchor not recognised.") end x_out, y_out end @userplot SeqPlot @recipe function f( h::SeqPlot; entrymargin=0.1, entryfontsize=20 ) seq = h.args[1] w,h = (1,1) y = fill(0.0, length(seq)) x = [0.0 + i*(w+entrymargin) for i in 0:(length(seq)-1)] annotations := [(x,y,string(i)) for (x,y,i) in zip(x,y,seq)] annotationfontsize := entryfontsize x_cords, y_cords = rectangle_corners(x,y, w, h; anchor=:center) showaxis --> false axis --> nothing aspect_ratio --> 1 legend --> false @series begin seriestype := :shape x_cords,y_cords end end @userplot TestPlot @recipe function f( h::TestPlot ) aspect_ratio --> 1 showaxis --> false @series begin seriestype := :shape 1:4,1:4 end @series begin seriestype := :line 1:4, 1:4 annotations := [[];[(i,i,string(i)) for i in 1:4]] annotationhalign --> :right end end
[ 3500, 44229, 14881, 198, 39344, 1001, 80, 43328, 198, 39344, 6208, 43328, 198, 39344, 35991, 62, 20772, 364, 198, 198, 8818, 35991, 62, 20772, 364, 7, 87, 3712, 15633, 11, 88, 3712, 15633, 11, 86, 11, 71, 26, 18021, 28, 25, 22487, 3...
1.892399
1,013
<filename>Chapter4/ex8.jl ## Exercise 4-8 ## Enter the code in this chapter in a notebook. ## 1. Draw a stack diagram that shows the state of the program while executing circle(🐢, radius). ## You can do the arithmetic by hand or add print statements to the code. println("Ans 1: ") println(" turtle --> Turtle") println(" turtle --> Turtle") println(" radius --> 100") println(" circumference --> 628.318...") println(" n --> 212") println(" len --> 2") println(" turtle --> Turtle") println(" nsides --> 212") println(" len --> 2") println(" i --> 1:212") println(" return") ## 2. The version of arc in Refactoring is not very accurate because the linear approximation of the circle ## is always outside the true circle. As a result, the turtle ends up a few pixels away from the correct destination. ## My solution shows a way to reduce the effect of this error. Read the code and see if it makes sense to you. ## If you draw a diagram, you might see how it works. using ThinkJulia function polyline(t, n, len, angle) for i in 1:n forward(t, len) turn(t, -angle) end end """ arc(t, r, angle) Draws an arc with the given radius and angle: t: turtle r: radius angle: angle subtended by the arc, in degrees """ function arc(t, r, angle) arc_len = 2 * π * r * abs(angle) / 360 n = trunc(arc_len / 4) + 3 step_len = arc_len / n step_angle = angle / n # making a slight left turn before starting reduces # the error caused by the linear approximation of the arc turn(t, -step_angle/2) polyline(t, n, step_len, step_angle) turn(t, step_angle/2) end println("Ans 2: ") @svg begin turtle = Turtle() # forward(turtle, 30) # for checking the position of the turtle arc(turtle, 100, 125) end ## println("End.")
[ 27, 34345, 29, 14126, 19, 14, 1069, 23, 13, 20362, 198, 2235, 32900, 604, 12, 23, 198, 2235, 6062, 262, 2438, 287, 428, 6843, 287, 257, 20922, 13, 198, 198, 2235, 352, 13, 15315, 257, 8931, 16362, 326, 2523, 262, 1181, 286, 262, 1...
2.845092
652
include("ctqw/ctqw.jl") include("szegedy/szegedy.jl")
[ 17256, 7203, 310, 80, 86, 14, 310, 80, 86, 13, 20362, 4943, 198, 17256, 7203, 82, 89, 1533, 4716, 14, 82, 89, 1533, 4716, 13, 20362, 4943, 198 ]
1.928571
28
<filename>scripts/01_check_biomass_richness_shapes.jl ########## ########## # A check of the distribution of shapes of biomass and richness # in relevant paper ########## ########## # AUTHOR: <NAME> # DATE OF CREATION: 2021-05-17 ########## ########## # set up ======================================================================= using DrWatson @quickactivate "trait-based-rewiring" # set packages using DataFrames, Plots, StatsPlots include(srcdir("01_eqn_component_functions.jl")) # set all positional values organism_id_pos = 1 organism_type_pos = 2 body_size_pos = 3 lower_prey_limit_pos = 4 upper_prey_limit_pos = 5 habitat_midpoint_pos = 6 habitat_lower_limit_pos = 7 habitat_upper_limit_pos = 8 nutritional_value_pos = 9 biomass_pos = 10 network_id_pos = 11 alive_pos = 12 # perform loop to grab all values ============================================== # draw 100 networks of the biomass/richness shapes and look at how they group richness_biomass_comp = Array{Any}(undef, (450000, 5)) j = 1 for i in 1:1000 for richness in ["top-heavy", "bottom-heavy", "uniform"] for biomass in ["pyramid", "uniform", "inverted"] temp = Array{Any}(undef, (50, 5)) species_list = network_draw(50, richness)[1] species_list = initialize_biomass(species_list, biomass) for k in 1:size(species_list, 1) temp[k, 1] = richness temp[k, 2] = biomass temp[k, 3] = species_list[k, body_size_pos] temp[k, 4] = species_list[k, habitat_midpoint_pos] temp[k, 5] = species_list[k, organism_type_pos] end richness_biomass_comp[(j:j+49), :] = temp j = j + 50 end end end # turn array into dataframe richness_biomass_comp = DataFrame( richness_biomass_comp, [:richness_shape, :biomass_shape, :body_size, :biomass, :org_type] ) # make plots of the 9 combos =================================================== # top-heavy & pyramid topheavy_pryamid_data = DataFrame(filter( (row -> row.richness_shape == "top-heavy" && row.biomass_shape == "pyramid"), richness_biomass_comp )) topheavy_pryamid_plot = @df topheavy_pryamid_data plot( :body_size, :biomass, group = :org_type, seriestype = :scatter, xlabel = "body size", ylabel = "biomass", legend = false #title = "Richness = top-heavy, biomass = pyramid" ) # top-heavy & uniform topheavy_uniform_data = filter( (row -> row.richness_shape == "top-heavy" && row.biomass_shape == "uniform"), richness_biomass_comp ) topheavy_uniform_plot = @df topheavy_uniform_data plot( :body_size, :biomass, group = :org_type, seriestype = :scatter, xlabel = "body size", ylabel = "biomass", legend = false #title = "Richness = top-heavy, biomass = uniform" ) # top-heavy and inverted topheavy_inverted_data = filter( (row -> row.richness_shape == "top-heavy" && row.biomass_shape == "inverted"), richness_biomass_comp ) topheavy_inverted_plot = @df topheavy_inverted_data plot( :body_size, :biomass, group = :org_type, seriestype = :scatter, xlabel = "body size", ylabel = "biomass", legend = false #title = "Richness = top-heavy, biomass = inverted" ) # uniform and pyramid uniform_pyramid_data = filter( (row -> row.richness_shape == "uniform" && row.biomass_shape == "pyramid"), richness_biomass_comp ) uniform_pyramid_plot = @df uniform_pyramid_data plot( :body_size, :biomass, group = :org_type, seriestype = :scatter, xlabel = "body size", ylabel = "biomass", legend = false #title = "Richness = uniform, biomass = pyramid" ) # uniform and uniform uniform_uniform_data = filter( (row -> row.richness_shape == "uniform" && row.biomass_shape == "uniform"), richness_biomass_comp ) uniform_uniform_plot = @df uniform_uniform_data plot( :body_size, :biomass, group = :org_type, seriestype = :scatter, xlabel = "body size", ylabel = "biomass", legend = false #title = "Richness = uniform, biomass = uniform" ) # uniform and inverted uniform_inverted_data = filter( (row -> row.richness_shape == "uniform" && row.biomass_shape == "inverted"), richness_biomass_comp ) uniform_inverted_plot = @df uniform_inverted_data plot( :body_size, :biomass, group = :org_type, seriestype = :scatter, xlabel = "body size", ylabel = "biomass", legend = false #title = "Richness = uniform, biomass = inverted" ) # bottom-heavy and pyramid bottomheavy_pryamid_data = filter( (row -> row.richness_shape == "bottom-heavy" && row.biomass_shape == "pyramid"), richness_biomass_comp ) bottomheavy_pryamid_plot = @df bottomheavy_pryamid_data plot( :body_size, :biomass, group = :org_type, seriestype = :scatter, xlabel = "body size", ylabel = "biomass", legend = false #title = "Richness = bottom-heavy, biomass = pyramid" ) # bottom-heavy and uniform bottomheavy_uniform_data = filter( (row -> row.richness_shape == "bottom-heavy" && row.biomass_shape == "uniform"), richness_biomass_comp ) bottomheavy_uniform_plot = @df bottomheavy_uniform_data plot( :body_size, :biomass, group = :org_type, seriestype = :scatter, xlabel = "body size", ylabel = "biomass", legend = false #title = "Richness = bottom-heavy, biomass = uniform" ) # bottom-heavy and inverted bottomheavy_inverted_data = filter( (row -> row.richness_shape == "bottom-heavy" && row.biomass_shape == "inverted"), richness_biomass_comp ) bottomheavy_inverted_plot = @df bottomheavy_inverted_data plot( :body_size, :biomass, group = :org_type, seriestype = :scatter, xlabel = "body size", ylabel = "biomass", #title = "Richness = bottom-heavy, biomass = inverted", legend = false ) # put all plots together all_shapes_plots = Plots.plot( topheavy_pryamid_plot, topheavy_uniform_plot, topheavy_inverted_plot, uniform_pyramid_plot, uniform_uniform_plot, uniform_inverted_plot, bottomheavy_pryamid_plot, bottomheavy_uniform_plot, bottomheavy_inverted_plot, layout = (3,3), #legend = false, #layout = Plots.grid(3,3, heights = [0.3, 0.3, 0.3]), #xlabel = "body size", #ylabel = "biomass" title = ["1", "2", "3", "4", "5", "6", "7", "8", "9"] ) Plots.savefig(all_shapes_plots, "./figs/all_shapes_plots.png")
[ 27, 34345, 29, 46521, 14, 486, 62, 9122, 62, 8482, 296, 562, 62, 7527, 1108, 62, 1477, 7916, 13, 20362, 198, 7804, 2235, 220, 198, 7804, 2235, 198, 2, 317, 2198, 286, 262, 6082, 286, 15268, 286, 42584, 290, 46792, 198, 2, 287, 598...
2.413299
2,722
######################################## ## File Name: control_types.jl ## Author: <NAME> (<EMAIL>) ## Date Created: 2020/05/12 ## Description: Control Type Definitions for SACBP ######################################## import Base.vec abstract type Control end struct PosControl{T<:Real} <: Control t::Float64 vel::Vector{T} dim::Int64 function PosControl{T}(t,vel,dim) where {T<:Real} if dim != length(vel) error(ArgumentError("Invalid control vector length.")); else return new(t,vel,dim); end end end PosControl(t::Real,vel::Vector{T},dim::Int64=length(vel)) where {T<:Real} = PosControl{T}(t,vel,dim); PosControl(t::Real,vel::T) where {T<:Real} = PosControl{T}(t,[vel],1); vec(u::PosControl) = u.vel; struct MControl2D{T<:Real} <: Control t::Float64 fx::T # Force x fy::T # Force y tr::T # Torque end function MControl2D(t::Real,params::Vector{T}) where {T<:Real} if length(params) != 3 error(ArgumentError("Invalid parameter vector length.")) else return MControl2D{T}(t,params[1],params[2],params[3]); end end vec(u::MControl2D) = [u.fx,u.fy,u.tr];
[ 29113, 7804, 198, 2235, 9220, 6530, 25, 1630, 62, 19199, 13, 20362, 198, 2235, 6434, 25, 1279, 20608, 29, 38155, 27630, 4146, 43734, 198, 2235, 7536, 15622, 25, 12131, 14, 2713, 14, 1065, 198, 2235, 12489, 25, 6779, 5994, 45205, 329, ...
2.444906
481
<reponame>sdangelis/GenomePermutations.jl using GenomePermutations using GenomicFeatures using Documenter push!(LOAD_PATH,"../src/") DocMeta.setdocmeta!(GenomePermutations, :DocTestSetup, :(using GenomePermutations); recursive=true) makedocs(; modules=[GenomePermutations], authors="<NAME> <<EMAIL>> <<EMAIL>>", repo="https://github.com/sdangelis/GenomePermutations.jl/blob/{commit}{path}#{line}", sitename="GenomePermutations.jl", format=Documenter.HTML(; prettyurls=get(ENV, "CI", "false") == "true", canonical="https://sdangelis.github.io/GenomePermutations.jl", assets=String[], ), pages=[ "Home" => "index.md", ], ) deploydocs(; repo="github.com/sdangelis/GenomePermutations.jl", devbranch="main", )
[ 27, 7856, 261, 480, 29, 21282, 8368, 271, 14, 13746, 462, 5990, 21973, 602, 13, 20362, 198, 3500, 5215, 462, 5990, 21973, 602, 198, 3500, 5215, 10179, 23595, 198, 3500, 16854, 263, 198, 198, 14689, 0, 7, 35613, 62, 34219, 553, 40720, ...
2.407407
324
# --- # title: 688. Knight Probability in Chessboard # id: problem688 # author: Indigo # date: 2021-06-29 # difficulty: Medium # categories: Dynamic Programming # link: <https://leetcode.com/problems/knight-probability-in-chessboard/description/> # hidden: true # --- # # On an `N`x`N` chessboard, a knight starts at the `r`-th row and `c`-th column # and attempts to make exactly `K` moves. The rows and columns are 0 indexed, so # the top-left square is `(0, 0)`, and the bottom-right square is `(N-1, N-1)`. # # A chess knight has 8 possible moves it can make, as illustrated below. Each # move is two squares in a cardinal direction, then one square in an orthogonal # direction. # # # # ![](https://assets.leetcode.com/uploads/2018/10/12/knight.png) # # # # Each time the knight is to move, it chooses one of eight possible moves # uniformly at random (even if the piece would go off the chessboard) and moves # there. # # The knight continues moving until it has made exactly `K` moves or has moved # off the chessboard. Return the probability that the knight remains on the # board after it has stopped moving. # # # # **Example:** # # # # Input: 3, 2, 0, 0 # Output: 0.0625 # Explanation: There are two moves (to (1,2), (2,1)) that will keep the knight on the board. # From each of those positions, there are also two moves that will keep the knight on the board. # The total probability the knight stays on the board is 0.0625. # # # # # **Note:** # # * `N` will be between 1 and 25. # * `K` will be between 0 and 100. # * The knight always initially starts on the board. # # ## @lc code=start using LeetCode function knight_probability(n::Int, k::Int, row::Int, col::Int) dp = fill(0, n, n, 2) dp[row + 1, col + 1, 1] = 1 for i in 1:k dp1 = @view(dp[:, :, mod1(i, 2)]) dp2 = @view(dp[:, :, mod1(i + 1, 2)]) idcs = CartesianIndices(dp2) for I in idcs, hop in ((1, 2), (2, 1), (-1, 2), (2, -1), (1, -2), (-2, 1), (-1, -2), (-2, -1)) new_I = I + CartesianIndex(hop) new_I ∈ idcs && (dp2[new_I] += dp1[I]) end fill!(dp1, 0) end return sum(dp) / 8 ^ k end ## @lc code=end
[ 2, 11420, 198, 2, 3670, 25, 718, 3459, 13, 6700, 30873, 1799, 287, 25774, 3526, 198, 2, 4686, 25, 1917, 34427, 198, 2, 1772, 25, 40673, 198, 2, 3128, 25, 33448, 12, 3312, 12, 1959, 198, 2, 8722, 25, 13398, 198, 2, 9376, 25, 2697...
2.464835
910
using Test using NCDatasets using DataStructures function example_file(i,array) fname = tempname() @debug "fname $fname" Dataset(fname,"c") do ds # Dimensions ds.dim["lon"] = size(array,1) ds.dim["lat"] = size(array,2) ds.dim["time"] = Inf # Declare variables ncvar = defVar(ds,"var", Float64, ("lon", "lat", "time")) ncvar.attrib["field"] = "u-wind, scalar, series" ncvar.attrib["units"] = "meter second-1" ncvar.attrib["long_name"] = "surface u-wind component" ncvar.attrib["time"] = "time" ncvar.attrib["coordinates"] = "lon lat" nclat = defVar(ds,"lat", Float64, ("lat",)) nclat.attrib["units"] = "degrees_north" nclon = defVar(ds,"lon", Float64, ("lon",)) nclon.attrib["units"] = "degrees_east" nclon.attrib["modulo"] = 360.0 nctime = defVar(ds,"time", Float64, ("time",)) nctime.attrib["long_name"] = "surface wind time" nctime.attrib["field"] = "time, scalar, series" nctime.attrib["units"] = "days since 2000-01-01 00:00:00 GMT" # Global attributes ds.attrib["history"] = "foo" # Define variables g = defGroup(ds,"mygroup") ncvarg = defVar(g,"var", Float64, ("lon", "lat", "time")) ncvarg.attrib["field"] = "u-wind, scalar, series" ncvarg.attrib["units"] = "meter second-1" ncvarg.attrib["long_name"] = "surface u-wind component" ncvarg.attrib["time"] = "time" ncvarg.attrib["coordinates"] = "lon lat" ncvar[:,:,1] = array ncvarg[:,:,1] = array.+1 #nclon[:] = 1:size(array,1) #nclat[:] = 1:size(array,2) nctime[:] = i end return fname end A = randn(2,3,1) fname = example_file(1,A) ds = Dataset(fname) info = NCDatasets.metadata(ds) #@show info dds = DeferDataset(fname); varname = "var" datavar = variable(dds,varname); data = datavar[:,:,:] @test A == datavar[:,:,:] @test dds.attrib["history"] == "foo" @test datavar.attrib["units"] == "meter second-1" @test dimnames(datavar) == ("lon", "lat", "time") lon = variable(dds,"lon"); @test lon.attrib["units"] == "degrees_east" @test size(lon) == (size(data,1),) datavar = dds[varname] @test A == datavar[:,:,:] @test dimnames(datavar) == ("lon", "lat", "time") @test dds.dim["lon"] == size(A,1) @test dds.dim["lat"] == size(A,2) @test dds.dim["time"] == size(A,3) @test dds.dim["time"] == size(A,3) close(dds) # show dds_buf = IOBuffer() show(dds_buf,dds) ds_buf = IOBuffer() show(ds_buf,dds) @test String(take!(dds_buf)) == String(take!(ds_buf)) #= # write dds = Dataset(fnames,"a"); dds["datavar"][2,2,:] = 1:length(fnames) for n = 1:length(fnames) Dataset(fnames[n]) do ds @test ds["datavar"][2,2,1] == n end end dds.attrib["history"] = "foo2" sync(dds) Dataset(fnames[1]) do ds @test ds.attrib["history"] == "foo2" end @test_throws NCDatasets.NetCDFError Dataset(fnames,"not-a-mode") @test keys(dds) == ["datavar", "lat", "lon", "time"] @test keys(dds.dim) == ["lon", "lat", "time"] @test NCDatasets.groupname(dds) == "/" @test size(dds["var"]) == (2, 3, 3) @test size(dds["var"].var) == (2, 3, 3) @test name(dds["var"].var) == "var" @test NCDatasets.groupname(dds.group["mygroup"]) == "mygroup" # create new dimension in all files dds.dim["newdim"] = 123; sync(dds); Dataset(fnames[1]) do ds @test ds.dim["newdim"] == 123 end close(dds) =# nothing
[ 3500, 6208, 198, 3500, 399, 8610, 265, 292, 1039, 198, 3500, 6060, 44909, 942, 198, 198, 8818, 1672, 62, 7753, 7, 72, 11, 18747, 8, 198, 220, 220, 220, 277, 3672, 796, 20218, 3672, 3419, 198, 220, 220, 220, 2488, 24442, 366, 69, 3...
2.107273
1,650
<filename>JuliaFactorial/BasicSwingFactorial.jl # Copyright <NAME>. License is MIT. module BasicSwingFactorial export SwingFactorial """ Return the factorial of ``n``. Implementation of the swing algorithm using no primes. An advanced version based on prime-factorization which is much faster is available as the prime-swing factorial. However the claim is that this is the fastest algorithm not using prime-factorization. It has the same recursive structure as his big brother. """ function SwingFactorial(n::Int)::BigInt smallOddFactorial = BigInt[ 0x0000000000000000000000000000001, 0x0000000000000000000000000000001, 0x0000000000000000000000000000001, 0x0000000000000000000000000000003, 0x0000000000000000000000000000003, 0x000000000000000000000000000000f, 0x000000000000000000000000000002d, 0x000000000000000000000000000013b, 0x000000000000000000000000000013b, 0x0000000000000000000000000000b13, 0x000000000000000000000000000375f, 0x0000000000000000000000000026115, 0x000000000000000000000000007233f, 0x00000000000000000000000005cca33, 0x0000000000000000000000002898765, 0x00000000000000000000000260eeeeb, 0x00000000000000000000000260eeeeb, 0x0000000000000000000000286fddd9b, 0x00000000000000000000016beecca73, 0x000000000000000000001b02b930689, 0x00000000000000000000870d9df20ad, 0x0000000000000000000b141df4dae31, 0x00000000000000000079dd498567c1b, 0x00000000000000000af2e19afc5266d, 0x000000000000000020d8a4d0f4f7347, 0x000000000000000335281867ec241ef, 0x0000000000000029b3093d46fdd5923, 0x0000000000000465e1f9767cc5866b1, 0x0000000000001ec92dd23d6966aced7, 0x0000000000037cca30d0f4f0a196e5b, 0x0000000000344fd8dc3e5a1977d7755, 0x000000000655ab42ab8ce915831734b, 0x000000000655ab42ab8ce915831734b, 0x00000000d10b13981d2a0bc5e5fdcab, 0x0000000de1bc4d19efcac82445da75b, 0x000001e5dcbe8a8bc8b95cf58cde171, 0x00001114c2b2deea0e8444a1f3cecf9, 0x0002780023da37d4191deb683ce3ffd, 0x002ee802a93224bddd3878bc84ebfc7, 0x07255867c6a398ecb39a64b83ff3751, 0x23baba06e131fc9f8203f7993fc1495] function oddProduct(m, len) if len < 24 p = BigInt(m) for k in 2:2:2(len-1) p *= (m - k) end return p end hlen = len >> 1 oddProduct(m - 2 * hlen, len - hlen) * oddProduct(m, hlen) end function oddFactorial(n) if n < 41 oddFact = smallOddFactorial[1+n] sqrOddFact = smallOddFactorial[1+div(n, 2)] else sqrOddFact, oldOddFact = oddFactorial(div(n, 2)) len = div(n - 1, 4) (n % 4) != 2 && (len += 1) high = n - ((n + 1) & 1) oddSwing = div(oddProduct(high, len), oldOddFact) oddFact = sqrOddFact^2 * oddSwing end (oddFact, sqrOddFact) end n < 0 && ArgumentError("n must be ≥ 0") if n == 0 return 1 end sh = n - count_ones(n) oddFactorial(n)[1] << sh end #START-TEST-################################################ using Test function main() @testset "SwingFactorial" begin for n in 0:999 S = SwingFactorial(n) B = Base.factorial(BigInt(n)) @test S == B end end GC.gc() n = 1000000 @time SwingFactorial(n) end main() end # module
[ 27, 34345, 29, 16980, 544, 29054, 5132, 14, 26416, 50, 5469, 29054, 5132, 13, 20362, 198, 2, 15069, 1279, 20608, 28401, 13789, 318, 17168, 13, 198, 198, 21412, 14392, 50, 5469, 29054, 5132, 198, 39344, 43650, 29054, 5132, 198, 198, 3781...
2.335894
1,432
#This script calculates the squeezing for different quadratures. using LinearAlgebra using Plots; pyplot() using NPZ using LaTeXStrings include("MagnusExpansion.jl") include("boson.jl") include("HarmonicCorrectionBoson.jl") """ Calculate the uncertainties on the x(θ) and y(θ) quadratures for a range imax values of θ in the interval [θi, θi+θrange]. """ function quadrature_scan(moments, imax; θi=-pi/4, θrange=pi/2) θ_vec, Δx2_vec, Δy2_vec = zeros(imax), zeros(imax), zeros(imax) for i = 1: imax θ = θi + (i - 1)*θrange/(imax - 1) θ_vec[i] = θ Δx2_vec[i] = (moments[3] + cos(2*θ)*moments[1] + sin(2*θ)*moments[2])/2 Δy2_vec[i] = (moments[3] - cos(2*θ)*moments[1] - sin(2*θ)*moments[2])/2 end return θ_vec, Δx2_vec, Δy2_vec end """ Apply the function quadrature_scan a couple of times, always around the value of θ where maximum squeezing has been found. """ function fine_quadrature_scan(moments, imax) θ_vec, Δx2_vec, Δy2_vec = quadrature_scan(moments, imax) for i = 1: 4 k = argmin(Δy2_vec) θi = θ_vec[k - 1] θrange = θ_vec[k + 1] - θ_vec[k - 1] output = quadrature_scan(moments, imax; θi=θi, θrange=θrange) θ_vec .= output[1] Δx2_vec .= output[2] Δy2_vec .= output[3] end return θ_vec, Δx2_vec, Δy2_vec end #array with different gate times tf tf0, tf1 = 2.0, 15.0 nt = 200 tf_vec = zeros(nt) nt = size(tf_vec)[1] dB_vec = zeros(nt, 3) moments = zeros(nt, 3) coeffs_array = zeros(nt, 3) imax = 10 θopt = zeros(nt,2) for j = 1: nt println(j) tf = tf0*(tf1/tf0)^((j - 1)/(nt - 1)) tf_vec[j] = tf κ = 0.0 # solution in the absence of counter-rotating terms cr_terms = false moments[j, :] = solve_2moments(tf, κ, cr_terms, zeros(3)) Δx2 = (moments[j, 3] + moments[j, 1])/2 Δy2 = (moments[j, 3] - moments[j, 1])/2 dB_vec[j, 1] = -10.0*log10(2*Δy2) # solution in the presence of counter-rotating terms cr_terms = true moments[j, :] = solve_2moments(tf, κ, cr_terms, zeros(3)) Δx2 = (moments[j, 3] + moments[j, 1])/2 Δy2 = (moments[j, 3] - moments[j, 1])/2 dB_vec[j, 2] = -10.0*log10(2*Δy2) θ_vec, Δx2_vec, Δy2_vec = fine_quadrature_scan(moments[j, :], imax) k = argmin(Δy2_vec) θopt[j, 1] = θ_vec[k] # solution in the presence of counter-rotating terms and correction. cr_terms = true M = correction_matrix(tf) order = 6 coeffs = get_coeffs(M, order, tf) coeffs_array[j, :] = coeffs moments[j, :] = solve_2moments(tf, κ, cr_terms, coeffs) Δx2 = (moments[j, 3] + moments[j, 1])/2 Δy2 = (moments[j, 3] - moments[j, 1])/2 dB_vec[j, 3] = -10.0*log10(2*Δy2) θ_vec, Δx2_vec, Δy2_vec = fine_quadrature_scan(moments[j, :], imax) k = argmin(Δy2_vec) θopt[j, 2] = θ_vec[k] end # save figures plot(tf_vec, dB_vec, linewidth = 2, labels = ["No correction" "6th order\nMagnus" "RWA"]) plot!(tickfont = font(12, "Serif"), xlabel = "Pulse width "*L"\omega_\mathrm{a} t_\mathrm{f}", ylabel = "Squeezing (dB)", guidefont = font(14, "Serif"), legendfont = font(12, "Serif"), background_color_legend = false, margin = 5Plots.mm) savefig("squeezing.pdf") y = hcat(θopt, zeros(size(θopt)[1])) plot(tf_vec, y, linewidth = 2, labels = ["No correction" "6th order\nMagnus" "RWA"]) plot!(tickfont = font(12, "Serif"), xlabel = "Pulse width "*L"\omega_\mathrm{a} t_\mathrm{f}", ylabel = L"\varphi", guidefont = font(14, "Serif"), legendfont = font(12, "Serif"), background_color_legend = false, margin = 5Plots.mm) savefig("squeezing_angle.pdf") y = hcat(1.0./tf_vec, abs.(coeffs_array)) plot(tf_vec, y, linewidth = 2, labels = [L"1/t_\mathrm{f}" L"|c_{x,1}|" L"|c_{y,1}|" L"|\Delta|"]) plot!(yaxis = :log, tickfont = font(12, "Serif"), xlabel = "Pulse width "*L"\omega_\mathrm{a} t_\mathrm{f}", ylabel = "coeff."*L"\times \omega_\mathrm{a}^{-1}", guidefont = font(14, "Serif"), legendfont = font(12, "Serif"), background_color_legend = false, margin = 5Plots.mm) savefig("coeffs.pdf") # save data files output = zeros(nt,4) output[:, 1] = tf_vec output[:, 2: end] = dB_vec npzwrite("dB.npy", output) output = zeros(nt,3) output[:, 1] = tf_vec output[:, 2: end] = θopt npzwrite("angle.npy", output) output = zeros(nt,4) output[:, 1] = tf_vec output[:, 2: end] = coeffs_array npzwrite("coeffs.npy", output)
[ 2, 1212, 4226, 43707, 262, 40237, 329, 1180, 15094, 81, 6691, 13, 198, 3500, 44800, 2348, 29230, 198, 3500, 1345, 1747, 26, 12972, 29487, 3419, 198, 3500, 28498, 57, 198, 3500, 4689, 49568, 13290, 654, 198, 198, 17256, 7203, 48017, 385,...
2.059512
2,050
<filename>test/runtests.jl using LinearAlgebra, SparseArrays, Test using MultivariatePolynomials using SumOfSquares # Taken from JuMP/test/solvers.jl function try_import(name::Symbol) try @eval import $name return true catch e return false end end if try_import(:DynamicPolynomials) import DynamicPolynomials.@polyvar import DynamicPolynomials.@ncpolyvar else if try_import(:TypedPolynomials) import TypedPolynomials.@polyvar else error("No polynomial implementation installed : Please install TypedPolynomials or DynamicPolynomials") end end include("certificate.jl") include("gram_matrix.jl") include("variable.jl") include("constraint.jl") include("Mock/mock_tests.jl") # Tests needing a solver # FIXME these tests should be converted to Literate and moved to `examples` or # converted to be used with `MockOptimizer` and moved to `test/Tests` include("solvers.jl") include("sospoly.jl") include("sosquartic.jl") include("equalitypolyconstr.jl")
[ 27, 34345, 29, 9288, 14, 81, 2797, 3558, 13, 20362, 198, 3500, 44800, 2348, 29230, 11, 1338, 17208, 3163, 20477, 11, 6208, 198, 198, 3500, 7854, 42524, 34220, 26601, 8231, 198, 3500, 5060, 5189, 22266, 3565, 198, 198, 2, 30222, 422, 1...
2.781081
370
<gh_stars>0 # ------------------------------------------------------------------ # Licensed under the MIT License. See LICENSE in the project root. # ------------------------------------------------------------------ """ DensityRatioWeighting(tdata, [vars]; [options]) Density ratio weights based on empirical distribution of variables in target data `tdata`. Default to all variables. ## Optional parameters * `estimator` - Density ratio estimator (default to `LSIF()`) * `optlib` - Optimization library (default to `default_optlib(estimator)`) ### Notes Estimators from `DensityRatioEstimation.jl` are supported. """ struct DensityRatioWeighting <: WeightingMethod tdata vars dre optlib end function DensityRatioWeighting(tdata, vars=nothing; estimator=LSIF(), optlib=default_optlib(estimator)) validvars = collect(name.(variables(tdata))) wvars = isnothing(vars) ? validvars : vars @assert wvars ⊆ validvars "invalid variables ($wvars) for spatial data" DensityRatioWeighting(tdata, wvars, estimator, optlib) end function weight(sdata, method::DensityRatioWeighting) # retrieve method parameters tdata = method.tdata vars = method.vars dre = method.dre optlib = method.optlib @assert vars ⊆ name.(variables(sdata)) "invalid variables ($vars) for spatial data" # numerator and denominator samples Ωnu = view(tdata, vars) Ωde = view(sdata, vars) xnu = collect(Tables.rows(values(Ωnu))) xde = collect(Tables.rows(values(Ωde))) # perform denstiy ratio estimation ratios = densratio(xnu, xde, dre, optlib=optlib) SpatialWeights(domain(sdata), ratios) end
[ 27, 456, 62, 30783, 29, 15, 198, 2, 16529, 438, 198, 2, 49962, 739, 262, 17168, 13789, 13, 4091, 38559, 24290, 287, 262, 1628, 6808, 13, 198, 2, 16529, 438, 198, 198, 37811, 198, 220, 220, 220, 360, 6377, 29665, 952, 25844, 278, 7...
2.951786
560
function eval_ast(interpstate::InterpState, mod, expr) interpstate.options.debug && @show :eval_ast mod expr try # ans = Core.eval(mod, expr) ans = @eval mod $expr interpstate.options.debug && @show :eval_ast ans return ans catch exception interpstate.options.debug && @show :eval_ast mod expr exception rethrow() end end function eval_lower_ast(interpstate::InterpState, mod, expr) interpstate.options.debug && @show :eval_lower_ast mod expr try lwr = Meta.lower(mod, expr)::Expr if lwr.head == :thunk codestate = code_state_from_thunk(interpstate, mod, lwr.args[1]::Core.CodeInfo) ans = interpret_lower(codestate) else @show lwr mod expr # ans = Core.eval(mod, expr) ans = @eval mod $expr end interpstate.options.debug && @show :eval_lower_ast ans return ans catch exception interpstate.options.debug && @show :eval_lower_ast mod expr exception rethrow() end end function interpret_ast_comparison(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :comparison args expr = Expr(:comparison, args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_or(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :(||) args expr = Expr(:(||), args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_and(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :(&&) args expr = Expr(:(&&), args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_primitive(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :primitive args expr = Expr(:primitive, args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_call(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :call args expr = Expr(:call, args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_macrocall(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :macrocall args expr = Expr(:macrocall, args...) # Macros be better handled by the compiler? eval_ast(interpstate, mod, expr) end function interpret_ast_broadcast(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :(.=) args expr = Expr(:(.=), args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_assign(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :(=) args expr = Expr(:(=), args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_const(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :const args expr = Expr(:const, args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_local(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :local args expr = Expr(:local, args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_global(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :global args expr = Expr(:global, args...) eval_ast(interpstate, mod, expr) end function interpret_ast_let(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :let args expr = Expr(:let, args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_block(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :block args local linenumbernode try local ans for arg in args ans = interpret_ast_node(interpstate, mod, arg) if ans isa LineNumberNode linenumbernode = ans end end ans catch @show linenumbernode rethrow() end end function interpret_ast_try(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :try args expr = Expr(:try, args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_do(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :do args expr = Expr(:do, args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_if(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :if args expr = Expr(:if, args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_for(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :for args expr = Expr(:for, args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_while(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :while args expr = Expr(:while, args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_function(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :function args expr = Expr(:function, args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_where(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :function args expr = Expr(:where, args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_macro(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :macro args expr = Expr(:macro, args...) # Macros be better handled by the compiler? eval_ast(interpstate, mod, expr) end function interpret_ast_struct(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :struct args expr = Expr(:struct, args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_curly(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :curly args expr = Expr(:curly, args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_abstract(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :abstract args expr = Expr(:abstract, args...) eval_lower_ast(interpstate, mod, expr) end function interpret_ast_using(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :using args expr = Expr(:using, args...) eval_ast(interpstate, mod, expr) end function interpret_ast_import(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :import args expr = Expr(:import, args...) eval_ast(interpstate, mod, expr) end function interpret_ast_export(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :export args expr = Expr(:export, args...) # Can we really lower exports? eval_lower_ast(interpstate, mod, expr) end function interpret_ast_error(interpstate::InterpState, mod, args) @show mod :error args end function interpret_ast_incomplete(interpstate, mod, args) @show mod :incomplete args end function interpret_ast_toplevel(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :toplevel args local linenumbernode try local ans for arg in args ans = interpret_ast_node(interpstate, mod, arg) if ans isa LineNumberNode linenumbernode = ans end end ans catch @show linenumbernode rethrow() end end function interpret_ast_module(interpstate::InterpState, mod, args) interpstate.options.debug && @show mod :module args expr = Expr(:module, args...) eval_ast(interpstate, mod, expr) end function interpret_ast_expr(interpstate::InterpState, mod, expr::Expr) if expr.head == :comparison interpret_ast_comparison(interpstate, mod, expr.args) elseif expr.head == :(||) interpret_ast_or(interpstate, mod, expr.args) elseif expr.head == :(&&) interpret_ast_and(interpstate, mod, expr.args) elseif expr.head == :primitive interpret_ast_primitive(interpstate, mod, expr.args) elseif expr.head == :call interpret_ast_call(interpstate, mod, expr.args) elseif expr.head == :macrocall interpret_ast_macrocall(interpstate, mod, expr.args) elseif expr.head == :(.=) interpret_ast_broadcast(interpstate, mod, expr.args) elseif expr.head == :(=) interpret_ast_assign(interpstate, mod, expr.args) elseif expr.head == :const interpret_ast_const(interpstate, mod, expr.args) elseif expr.head == :local interpret_ast_local(interpstate, mod, expr.args) elseif expr.head == :global interpret_ast_global(interpstate, mod, expr.args) elseif expr.head == :let interpret_ast_let(interpstate, mod, expr.args) elseif expr.head == :block interpret_ast_block(interpstate, mod, expr.args) elseif expr.head == :try interpret_ast_try(interpstate, mod, expr.args) elseif expr.head == :do interpret_ast_do(interpstate, mod, expr.args) elseif expr.head == :if interpret_ast_if(interpstate, mod, expr.args) elseif expr.head == :for interpret_ast_for(interpstate, mod, expr.args) elseif expr.head == :while interpret_ast_while(interpstate, mod, expr.args) elseif expr.head == :function interpret_ast_function(interpstate, mod, expr.args) elseif expr.head == :where interpret_ast_where(interpstate, mod, expr.args) elseif expr.head == :macro interpret_ast_macro(interpstate, mod, expr.args) elseif expr.head == :struct interpret_ast_struct(interpstate, mod, expr.args) elseif expr.head == :curly interpret_ast_curly(interpstate, mod, expr.args) elseif expr.head == :abstract interpret_ast_abstract(interpstate, mod, expr.args) elseif expr.head == :using interpret_ast_using(interpstate, mod, expr.args) elseif expr.head == :import interpret_ast_import(interpstate, mod, expr.args) elseif expr.head == :export interpret_ast_export(interpstate, mod, expr.args) elseif expr.head == :error interpret_ast_error(interpstate, mod, expr.args) elseif expr.head == :incomplete interpret_ast_incomplete(interpstate, mod, expr.args) elseif expr.head == :toplevel interpret_ast_toplevel(interpstate, mod, expr.args) elseif expr.head == :module interpret_ast_module(interpstate, mod, expr.args) else @show expr @assert false end end function interpret_ast_node(interpstate::InterpState, mod, node) @nospecialize node if node isa Expr expr = node interpret_ast_expr(interpstate, mod, expr) elseif node isa Symbol symbol = node eval_ast(interpstate, mod, symbol) elseif node isa LineNumberNode linenumbernode = node linenumbernode else @show typeof(node) node @assert false end end function interpret_ast(mod, expr, options) interpstate = interp_state(mod, options) try interpret_ast_node(interpstate, mod, expr) finally #= for (wt, (meth, sparam_vals, src)) in interpstate.meths @show wt meth sparam_vals end =# if interpstate.options.stats for (mod_or_meth, stats) in sort(collect(interpstate.stats), by=kv -> kv[2].elapsed) @show mod_or_meth Int(stats.calls) Int(stats.elapsed) end end end end
[ 8818, 5418, 62, 459, 7, 3849, 79, 5219, 3712, 9492, 79, 9012, 11, 953, 11, 44052, 8, 198, 220, 220, 220, 987, 79, 5219, 13, 25811, 13, 24442, 11405, 2488, 12860, 1058, 18206, 62, 459, 953, 44052, 198, 220, 220, 220, 1949, 198, 220...
2.49515
4,639
module Apply export apply, offset_apply using Base: tail apply(f::F, a::Tuple{A,Vararg}, args...) where {F,A} = (f(a[1], args...), apply(f, tail(a), args...)...) apply(f::F, a::Tuple{A,Vararg}, b::Tuple{B,Vararg}, args...) where {F,A,B} = (f(a[1], b[1], args...), apply(f, tail(a), tail(b), args...)...) apply(f::F, a::Tuple{A,Vararg}, b::Tuple{B,Vararg}, c::Tuple{C,Vararg}, args...) where {F,A,B,C} = (f(a[1], b[1], c[1], args...), apply(f, tail(a), tail(b), tail(c), args...)...) apply(f, ::Tuple{}, ::Tuple{}, ::Tuple{}, args...) = () apply(f, a, ::Tuple{}, ::Tuple{}, args...) = () apply(f, ::Tuple{}, b, ::Tuple{}, args...) = () apply(f, a, b, ::Tuple{}, args...) = () apply(f, ::Tuple{}, ::Tuple{}, args...) = () apply(f, a, ::Tuple{}, args...) = () apply(f, ::Tuple{}, args...) = () offset_apply(f, o::Tuple{O,Vararg}, a::AbstractArray, offset::Int, args...) where O = begin offset = f(o[1], a, offset, args...) offset_apply(f, tail(o), a, offset::Int, args...) nothing end offset_apply(f, a::AbstractArray, o::Tuple{O,Vararg}, offset::Int, args...) where O = begin offset = f(a, o[1], offset, args...) offset_apply(f, a, tail(o), offset::Int, args...) nothing end offset_apply(f, o::Tuple{O,Vararg}, offset::Int, args...) where O = begin offset = f(o[1], offset, args...) offset_apply(f, tail(o), offset::Int, args...) nothing end offset_apply(f, o::Tuple{}, offset::Int, args...) = nothing offset_apply(f, a::AbstractArray, o::Tuple{}, offset::Int, args...) = nothing offset_apply(f, o::Tuple{}, a::AbstractArray, offset::Int, args...) = nothing end # module
[ 21412, 27967, 198, 198, 39344, 4174, 11, 11677, 62, 39014, 198, 3500, 7308, 25, 7894, 198, 198, 39014, 7, 69, 3712, 37, 11, 257, 3712, 51, 29291, 90, 32, 11, 19852, 853, 5512, 26498, 23029, 810, 1391, 37, 11, 32, 92, 796, 220, 198...
2.412463
674
using Documenter, ICD10Utilities makedocs( sitename = "ICD-10 Utilities", modules=[ICD10Utilities], pages=[ "ICD-10" => "index.md", "icdo3.md", "icd10am.md", "icd10cm.md" ]) deploydocs( repo = "github.com/timbp/ICD10Utilities.jl.git", devbranch = "main", )
[ 3500, 16854, 263, 11, 314, 8610, 940, 18274, 2410, 198, 198, 76, 4335, 420, 82, 7, 198, 197, 1650, 12453, 796, 366, 2149, 35, 12, 940, 41086, 1600, 198, 197, 13103, 41888, 2149, 35, 940, 18274, 2410, 4357, 198, 220, 220, 5468, 41888...
2.020408
147
function ShortPeriodicsInterpolatedCoefficient(arg0::jint) return ShortPeriodicsInterpolatedCoefficient((jint,), arg0) end function add_grid_point(obj::ShortPeriodicsInterpolatedCoefficient, arg0::AbsoluteDate, arg1::Vector{jdouble}) return jcall(obj, "addGridPoint", void, (AbsoluteDate, Vector{jdouble}), arg0, arg1) end function clear_history(obj::ShortPeriodicsInterpolatedCoefficient) return jcall(obj, "clearHistory", void, ()) end function value(obj::ShortPeriodicsInterpolatedCoefficient, arg0::AbsoluteDate) return jcall(obj, "value", Vector{jdouble}, (AbsoluteDate,), arg0) end
[ 8818, 10073, 5990, 2101, 873, 9492, 16104, 515, 34, 2577, 5632, 7, 853, 15, 3712, 73, 600, 8, 198, 220, 220, 220, 1441, 10073, 5990, 2101, 873, 9492, 16104, 515, 34, 2577, 5632, 19510, 73, 600, 11, 828, 1822, 15, 8, 198, 437, 198,...
2.895238
210
function cartesianmoveindex(direction) directiondict = Dict("UP" => (-1, 0), "DOWN" => (1, 0), "LEFT" => (0, -1), "RIGHT" => (0, 1)) return CartesianIndex(directiondict[direction]) end function swaptiles!(board, x, y) temp = board[x] board[x] = board[y] board[y] = temp end function moves(board) first = findfirst(iszero, board) movedict = Dict("UP" => "DOWN", "DOWN" => "UP", "LEFT" => "RIGHT", "RIGHT" => "LEFT") directions = [] for i in ("UP", "DOWN", "LEFT", "RIGHT") index = first + cartesianmoveindex(i) if checkbounds(Bool, board, index) action = (index, movedict[i]) push!(directions, action) end end return directions end function copyboard(action, board) newboard = copy(board) index1 = action[1] index2 = index1 + cartesianmoveindex(action[2]) swaptiles!(newboard, index1, index2) return newboard end ## determine all options for move states function expansion(board) states = [] possacts = moves(board) for act in possacts push!(states, copyboard(act, board)) end return states end
[ 8818, 6383, 35610, 21084, 9630, 7, 37295, 8, 198, 220, 220, 220, 4571, 11600, 796, 360, 713, 7203, 8577, 1, 5218, 13841, 16, 11, 657, 828, 366, 41925, 1, 5218, 357, 16, 11, 657, 828, 366, 2538, 9792, 1, 5218, 357, 15, 11, 532, 1...
2.452991
468
<filename>src/weierstrasspoints.jl ###################################################################### # weierstrasspoints.jl: Addition laws for projective points on Weierstrass curves ###################################################################### export infinity, projective_add, projective_scalar_mul ###################################################################### # Basic methods ###################################################################### """ Get the point at infinity on an elliptic curve in Weierstrass form. """ function infinity(E::AbstractWeierstrass) R = base_ring(E) return EllipticPoint(Nemo.zero(R), Nemo.one(R), Nemo.zero(R), E) end function zero(E::AbstractWeierstrass) return infinity(E) end ###################################################################### # Addition law ###################################################################### """ Get the opposite of a point on an elliptic curve in Weierstrass form. """ function -(P::EllipticPoint) E = P.curve x, y, z = coordinates(P) a1, _, a3, _, _ = a_invariants(E) return EllipticPoint(x, - y - a1 * x - a3 * z, z, E) end """ Get the sum of two normalized projective points on the same Weierstrass curve, assuming they are not equal and not inverse of each other. """ function _addgeneric(P::EllipticPoint{T}, Q::EllipticPoint{T}) where T<:Nemo.FieldElem E = P.curve a1, a2, a3, _, _ = a_invariants(E) xq, yq, zq = coordinates(Q) @assert zq == 1 xp, yp, zp = coordinates(P) @assert zp == 1 #sanity check @assert xp != xq denom = xq - xp inverse = 1//denom lambda = (yq - yp) * inverse nu = (yp * xq - xp * yq) * inverse Xplus = lambda^2 + a1 * lambda - a2 - xp - xq Yplus = -(lambda + a1) * Xplus - nu - a3 Zplus = Nemo.one(base_ring(P)) return EllipticPoint(Xplus, Yplus, Zplus, E) end """ Get the sum of two normalized projective points on the same Weierstrass curve, assuming they have equal x-coordinate. """ function _addequalx(P::EllipticPoint{T}, Q::EllipticPoint{T}) where T<:Nemo.FieldElem E = P.curve a1, a2, a3, a4, a6 = a_invariants(E) xp, yp, zp = coordinates(P) @assert zp == 1 xq, yq, zq = coordinates(Q) @assert zq == 1 #sanity check @assert xp == xq denom = yp + yq + a1 * xq + a3 if iszero(denom) return infinity(E) else inverse = 1//denom lambda = (3 * xp^2 + 2 * a2 * xp + a4 - a1 * yp) * inverse nu = (- xp^3 + a4 * xp + 2 * a6 - a3 * yp) * inverse Xplus = lambda^2 + a1 * lambda - a2 - xp - xq Yplus = -(lambda + a1) * Xplus - nu - a3 Zplus = one(base_ring(P)) return EllipticPoint(Xplus, Yplus, Zplus, E) end end """ Get the double of a normalized point. """ function _double(P::EllipticPoint) if isinfinity(P) return infinity(P.curve) else return _addequalx(P, P) end end """ Get the sum of two projective points on the same Weierstrass curve. """ function +(P::EllipticPoint{T}, Q::EllipticPoint{T}) where T<:Nemo.FieldElem P = normalized(P) Q = normalized(Q) xp, _, _ = coordinates(P) xq, _, _ = coordinates(Q) if isinfinity(P) return Q elseif isinfinity(Q) return P elseif xp == xq return _addequalx(P,Q) else return _addgeneric(P,Q) end end function -(P::EllipticPoint{T}, Q::EllipticPoint{T}) where T<:FieldElem return P + (-Q) end """ Get a scalar multiple of a point on a Weierstrass curve. """ function *(k::Integer, P::EllipticPoint) E = P.curve P = normalized(P) if k == 0 return infinity(E) elseif k<0 return (-k) * (-P) else if isinfinity(P) return infinity(E) else return _ladder(k, P) end end end # function *(k::Integer, P::EllipticPoint) # return k * P # end function _ladder(m::Integer, P::EllipticPoint) p0 = P for b in Iterators.drop(Iterators.reverse(digits(Int8, m, base=2)), 1) if (b == 0) p0 = _double(p0) else p0 = P + _double(p0) end end return p0 end ###################################################################### # Projective addition law for Short Weierstrass curves ###################################################################### # P = (x1, y1, z1) # Q = (x2, y2, z2) # P + Q = (x3, y3, z3) # if P != Q then # x3 = (x2 z1 - x1 z2) [ (y2 z1 - y1 z2)^2 z1 z2 - (x2 z1 - x1 z2)^2 (x2 z1 + x1 z2) ] # y3 = (y2 z1 - y1 z2) [ (x2 z1 - x1 z2)^2 (x2 z1 + 2 x1 z2) - (y2 z1 - y1 z2)^2 z1 z2 ] - (x2 z1 - x1 z2)^3 y1 z2 # z3 = (x2 z1 - x1 z2)^3 z1 z2 # if P = Q then # x3 = 2 y1 z1 [ (a z1^2 + 3 x1^2)^2 - 8 x1 y1^2 z1 ] # y3 = (a z1^2 + 3 x1^2 ) [ 12 x1 y1^2 z1 - a^2 (z1^2 + 3 x1^2)^2 ] - 8 y1^4 z1^2 # z3 = (2 y1 z1)^3 #This function is only to be used with distinct points on the same short Weierstrass curve #xdet is x2 z1 - x1 z2, and ydet is y2 z1 - y1 z2 function _projective_add_neq(P::EllipticPoint{T}, Q::EllipticPoint{T}, xdet::T, ydet::T) where T x1, y1, z1 = coordinates(P) x2, y2, z2 = coordinates(Q) xdet2 = xdet^2 xdet3 = xdet2 * xdet ydet2 = ydet^2 z1z2 = z1 * z2 #we could save a few multiplications in what follows x3 = xdet * ( ydet2 * z1z2 - xdet2 * (x2 * z1 + x1 * z2) ) y3 = ydet * ( xdet2 * (x2 * z1 + 2 * x1 * z2) - ydet2 * z1z2 ) - xdet3 * y1 * z2 z3 = xdet3 * z1z2 res = Point(x3, y3, z3, base_curve(P)) #@assert isvalid(res) #sanity check return res end #This function is only to be used with a point on a short Weierstrass curve function _projective_dbl(P::EllipticPoint{T}) where T x, y, z = coordinates(P) _, _, _, a, b = a_invariants(base_curve(P)) factor = a * z^2 + 3 * x^2 factor2 = factor^2 yz = y * z xy2z = x * y * yz #we could save again a few multiplications in what follows xprime = 2 * yz * ( factor2 - 8 * xy2z ) yprime = factor * ( 12 * xy2z - factor2 ) - 8 * (yz)^2 * y^2 zprime = 8 * (yz)^3 res = Point(xprime, yprime, zprime, base_curve(P)) #@assert isvalid(res) #sanity check return res end #This function is only to be used with two points on the same short Weierstrass curve #Compute xdet and ydet, if they are both zero go to _projective_dbl function projective_add(P::EllipticPoint{T}, Q::EllipticPoint{T}) where T x1, y1, z1 = coordinates(P) x2, y2, z2 = coordinates(Q) xdet = x2 * z1 - x1 * z2 ydet = y2 * z1 - y1 * z2 if ((xdet == 0) & (ydet == 0)) return _projective_dbl(P) else return _projective_add_neq(P, Q, xdet, ydet) end end #Here we assume v is a positive integer and P lives on a short Weierstrass curve function _projective_scalar_mul(P::EllipticPoint, v::Integer) P0 = P for b in Iterators.drop(Iterators.reverse(digits(Int8, v, base=2)), 1) P0 = _projective_dbl(P0) if (b == 1) P0 = projective_add(P0, P) end end return P0 end function projective_scalar_mul(P::EllipticPoint, v::Integer) if v == 0 return infinity(base_curve(E)) elseif v < 0 return - _projective_scalar_mul(P, -v) else return _projective_scalar_mul(P, v) end end
[ 27, 34345, 29, 10677, 14, 732, 959, 2536, 562, 13033, 13, 20362, 198, 198, 29113, 29113, 4242, 2235, 198, 2, 356, 959, 2536, 562, 13033, 13, 20362, 25, 3060, 653, 3657, 329, 1628, 425, 2173, 319, 775, 959, 2536, 562, 23759, 198, 291...
2.340261
2,983
<gh_stars>0 ### A Pluto.jl notebook ### # v0.16.1 using Markdown using InteractiveUtils # ╔═╡ 6f9a94bd-dd28-4110-a7ca-0ed84e9c7c3f begin import Pkg # activate the shared project environment Pkg.activate(Base.current_project()) using Interpolations using Plots using Dierckx using GasChromatographySimulator using GasChromatographyTools using Plots using PlutoUI TableOfContents() end # ╔═╡ 0b51a792-d9b8-4c29-928f-57aaf41f1c20 plotly() # ╔═╡ 93ba6afc-4e9a-11ec-08d9-81c0a9bc502e md""" # Test of the RT lock functions The test is necessary, because of failing (infinit loop in case of opt_ipt="linear", NaN abort in case of opt_itp="spline"). """ # ╔═╡ 51ec0223-199a-4a25-8768-cd0b7e9f864d begin function stretched_program(n::Float64, par::GasChromatographySimulator.Parameters) # stretch the temperature program in 'par' by a factor 'n' if isa(par, Array)==true error("Select an element of the array of GC-system parameters.") else new_tsteps = n.*par.prog.time_steps new_T_itp = GasChromatographySimulator.temperature_interpolation(new_tsteps, par.prog.temp_steps, par.prog.gf, par.col.L) new_pin_itp = GasChromatographySimulator.pressure_interpolation(new_tsteps, par.prog.pin_steps) new_pout_itp = GasChromatographySimulator.pressure_interpolation(new_tsteps, par.prog.pout_steps) new_prog = GasChromatographySimulator.Program(new_tsteps, par.prog.temp_steps, par.prog.pin_steps, par.prog.pout_steps, par.prog.gf, par.prog.a_gf, new_T_itp, new_pin_itp, new_pout_itp) new_par = GasChromatographySimulator.Parameters(par.col, new_prog, par.sub, par.opt) return new_par end end function initial_n(n::Float64, tR_lock::Float64, ii::Int, par::GasChromatographySimulator.Parameters) par_n = stretched_program(n, par) sol_n = GasChromatographySimulator.solve_system_multithreads(par_n) tR_n = sol_n[ii].u[end][1] if n>1 while tR_n-tR_lock<0 && n<130.0 n = n*2.0 par_n = stretched_program(n, par) sol_n = GasChromatographySimulator.solve_system_multithreads(par_n) tR_n = sol_n[ii].u[end][1] end elseif n<1 while tR_n-tR_lock>0 && n>0.01 n = n*0.5 par_n = stretched_program(n, par) sol_n = GasChromatographySimulator.solve_system_multithreads(par_n) tR_n = sol_n[ii].u[end][1] end end if n>130.0 error("The choosen retention time for locking is to big.") elseif n<0.01 error("The choosen retention time for locking is to small.") else return n end end function RT_locking(par::GasChromatographySimulator.Parameters, tR_lock::Float64, tR_tol::Float64, solute_RT::String; opt_itp="linear") # estimate the factor 'n' for the temperature program to achieve the retention time 'tR_lock' for 'solute_RT' with the GC-system defined by 'par' if isa(par, Array)==true error("Select an element of the array of GC-systems.") else # find 'solute_RT' in the substances of 'par' name = Array{String}(undef, length(par.sub)) for i=1:length(par.sub) name[i] = par.sub[i].name end ii = findfirst(name.==solute_RT) # calculate the retention time for the original (un-stretched) program sol₀ = GasChromatographySimulator.solving_odesystem_r(par.col, par.prog, par.sub[ii], par.opt) tR₀ = sol₀.u[end][1] # start value for the factor 'n' if tR₀-tR_lock<0 n₁ = initial_n(2.0, tR_lock, ii, par) else n₁ = initial_n(0.5, tR_lock, ii, par) end # using a recursive function to estimate 'n' n = recur_RT_locking(n₁, [1.0], [tR₀], par, tR_lock, tR_tol, ii; opt_itp=opt_itp) end return n end function recur_RT_locking(n::Float64, n_vec::Array{Float64,1}, tR_vec::Array{Float64,1}, par::GasChromatographySimulator.Parameters, tR_lock::Float64, tR_tol::Float64, ii::Int64; opt_itp="linear") # recursive function to find the factor 'n' for the temperature program to achieve the retention time 'tR_lock' for solute index 'ii' with the GC-system defined by 'par' # calculate the retention time with the input guess 'n' par₁ = stretched_program(n, par) if par.opt.odesys==true sol₁ = GasChromatographySimulator.solving_odesystem_r(par₁.col, par₁.prog, par₁.sub[ii], par₁.opt) tR₁ = sol₁.u[end][1] else sol₁ = GasChromatographySimulator.solving_migration(par₁.col, par₁.prog, par₁.sub[ii], par₁.opt) tR₁ = sol₁.u[end] end if abs(tR₁-tR_lock)<tR_tol # if retention time is less than 'tR_tol' from 'tR_lock' we found the factor 'n' return n else # estimate a new factor 'new_n' by linear interpolation of the factors 'n_vec' + 'n' over the corresponding retention times new_n_vec = sort([n_vec; n]) new_tR_vec = sort([tR_vec; tR₁]) if opt_itp=="spline" # Dierckx.jl if length(new_tR_vec)<4 k = length(new_tR_vec)-1 else k = 3 end itp = Spline1D(new_tR_vec, new_n_vec, k=k) else # opt_itp=="linear" # Interpolations.jl itp = LinearInterpolation(sort([tR_vec; tR₁]), sort([n_vec; n])) end new_n = itp(tR_lock) #println("new_n=$(new_n), tR₁=$(tR₁)") # use the new factor 'new_n' and call the recursive function again return recur_RT_locking(new_n, new_n_vec, new_tR_vec, par, tR_lock, tR_tol, ii; opt_itp=opt_itp) end end md""" ## Copies of the RT lock functions In the package GasChromatographyTools.jl the functions where adapted to solve this problem. """ end # ╔═╡ 5e642f09-9a8f-4cca-b61f-b27c8433a2e5 begin opt = GasChromatographySimulator.Options(OwrenZen5(), 1e-6, 1e-3, "inlet", true) L = 4.0 d = 0.1e-3 df = 0.1e-6 sp = "SLB5ms" # ["Rxi17SilMS" -> ok, "SLB5ms" -> ERR, "SPB50" -> ok, "Wax" -> ok, "DB5ms" -> ok, "Rxi5MS" -> ok, "genericLB", "genericJL"] gas = "He" col = GasChromatographySimulator.constructor_System(L, d, df, sp, gas) db_path = "/Users/janleppert/Documents/GitHub/Publication_GCsim/data/Databases/" db_file = "Database_append.csv" first_alkane = "C8" last_alkane = "C15" sub = GasChromatographySimulator.load_solute_database(db_path, db_file, sp, gas, [first_alkane, last_alkane], zeros(2), zeros(2)) Tst = 273.15 Tref = 150.0 + Tst pn = 101300.0 pin = 300000.0 + pn pout = 0.0 dimless_rate = 0.4 Theat = 1000.0 Tshift = 40.0 tMref = GasChromatographySimulator.holdup_time(Tref, pin, pout, L, d, gas) rate = dimless_rate*30/tMref theat = Theat/rate Tstart = sub[1].Tchar-Tst-Tshift ΔT = 30.0 α = -3.0 prog0 = GasChromatographySimulator.constructor_Program([0.0, theat],[Tstart, Tstart+Theat], [pin, pin],[pout, pout],[ΔT, ΔT], [0.0, 0.0], [L, L], [α, α], opt.Tcontrol, L) par0 = GasChromatographySimulator.Parameters(col, prog0, sub, opt) tR_lock = 12*tMref tR_tol = 1e-3 md""" ## Settings The following settings produce the problem: """ end # ╔═╡ 3de48bb6-8eb7-4a33-9a98-d5fe3a19f6c6 md""" ## The ERROR """ # ╔═╡ 19d1abb6-32b6-414f-bc95-55635cbaa73a n = RT_locking(par0, tR_lock, 1e-3, last_alkane; opt_itp="spline") # ╔═╡ 2cad8185-4fc5-4009-98df-07a2be2133c6 md""" ## Reproducing the error by stepwise calculations """ # ╔═╡ 30207849-cafe-4ec6-af8d-ee7b2e2e6de0 begin # initial simulation sol₀ = GasChromatographySimulator.solving_odesystem_r(par0.col, par0.prog, par0.sub[2], par0.opt) tR₀ = sol₀.u[end][1] end # ╔═╡ 84e7e869-0fbf-4590-a8de-28855856661f tR₀-tR_lock # ╔═╡ c5ace7ce-cfa3-4c15-bcc1-8b66ad1c16e9 begin # first stretch of the program if tR₀-tR_lock<0 n₁ = initial_n(2.0, tR_lock, 2, par0) else n₁ = initial_n(0.5, tR_lock, 2, par0) end # recur function par₁ = stretched_program(n₁, par0) sol₁ = GasChromatographySimulator.solving_odesystem_r(par₁.col, par₁.prog, par₁.sub[2], par₁.opt) tR₁ = sol₁.u[end][1] n_vec₁ = sort([1.0; n₁]) tR_vec₁ = sort([tR₀; tR₁]) # first interpolation itp₁ = Spline1D(tR_vec₁, n_vec₁, k=1) end # ╔═╡ c4d53222-03b1-4ce4-a49a-690945347432 tR₁-tR_lock # ╔═╡ 6acfbf9b-f8ac-4483-8c93-17920d0d9f0e begin # second stretch n₂ = itp₁(tR_lock) par₂ = stretched_program(n₂, par0) sol₂ = GasChromatographySimulator.solving_odesystem_r(par₂.col, par₂.prog, par₂.sub[2], par₂.opt) tR₂ = sol₂.u[end][1] n_vec₂ = sort([n_vec₁; n₂]) tR_vec₂ = sort([tR_vec₁; tR₂]) itp₂ = Spline1D(tR_vec₂, n_vec₂, k=2) p1 = plot([tR_lock, tR_lock], [0.95, 0.98], label="tR_lock") scatter!(p1, [tR₂, tR₂], [n₂, n₂], label="2") plot!(p1, 51.0:0.001:52.0, itp₂.(51.0:0.001:52.0), xlims=(51.0,52.0), ylims=(0.95, 0.98), label="itp₂") p1 end # ╔═╡ 3b31f580-efe2-4a7a-89dc-228b38f2a71e tR₂-tR_lock # ╔═╡ b6c5126a-3d41-4809-ab9b-d554262e0668 begin n₃ = itp₂(tR_lock) par₃ = stretched_program(n₃, par0) sol₃ = GasChromatographySimulator.solving_odesystem_r(par₃.col, par₃.prog, par₃.sub[2], par₃.opt) tR₃ = sol₃.u[end][1] n_vec₃ = sort([n_vec₂; n₃]) tR_vec₃ = sort([tR_vec₂; tR₃]) k = length(tR_vec₃)-1 itp₃ = Spline1D(tR_vec₃, n_vec₃, k=k) scatter!(p1, [tR₃, tR₃], [n₃, n₃], label="3") plot!(p1, 51.0:0.001:52.0, itp₃.(51.0:0.001:52.0), label="itp₃") end # ╔═╡ 6c5443bc-3dab-4317-99c9-1bb32b184fbc tR₃-tR_lock # ╔═╡ 3b1bb187-66f9-40bd-a0a5-a3c4e1a23819 begin n₄ = itp₃(tR_lock) par₄ = stretched_program(n₄, par0) sol₄ = GasChromatographySimulator.solving_odesystem_r(par₄.col, par₄.prog, par₄.sub[2], par₄.opt) tR₄ = sol₄.u[end][1] n_vec₄ = sort([n_vec₃; n₄]) tR_vec₄ = sort([tR_vec₃; tR₄]) itp₄ = Spline1D(tR_vec₄, n_vec₄, k=3) scatter!(p1, [tR₄, tR₄], [n₄, n₄], label="4") plot!(p1, 51.0:0.001:52.0, itp₄.(51.0:0.001:52.0), label="itp₄") end # ╔═╡ b81b2905-6756-445b-b1be-c54298df8b3f tR₄-tR_lock # ╔═╡ eb2d9f6a-8384-427a-a036-b4f0019d8251 md""" The proposed settings seam to lead to jumping estimations around the searched retention time. """ # ╔═╡ 734bae50-12fa-4717-8446-addb963b8673 begin n₅ = itp₄(tR_lock) par₅ = GasChromatographyTools.stretched_program(n₅, par0) sol₅ = GasChromatographySimulator.solving_odesystem_r(par₅.col, par₅.prog, par₅.sub[2], par₅.opt) tR₅ = sol₅.u[end][1] n_vec₅ = sort([n_vec₄; n₅]) tR_vec₅ = sort([tR_vec₄; tR₅]) itp₅ = Spline1D(tR_vec₅, n_vec₅, k=3) scatter!(p1, [tR₅, tR₅], [n₅, n₅], label="5") plot!(p1, 51.0:0.001:52.0, itp₅.(51.0:0.001:52.0), xlims=(51.45,51.55), ylims=(0.969, 0.972), label="itp₅") end # ╔═╡ 8de716b9-ca56-42f5-aebf-39ad467f4613 tR₅-tR_lock # ╔═╡ dadbefbf-a107-4c89-a4ef-0eb756517c1e begin n₆ = itp₅(tR_lock) par₆ = GasChromatographyTools.stretched_program(n₆, par0) sol₆ = GasChromatographySimulator.solving_odesystem_r(par₆.col, par₆.prog, par₆.sub[2], par₆.opt) tR₆ = sol₆.u[end][1] n_vec₆ = sort([n_vec₅; n₆]) tR_vec₆ = sort([tR_vec₅; tR₆]) tR_vec₆.-tR_lock itp₆ = Spline1D(tR_vec₆, n_vec₆, k=3) scatter!(p1, [tR₆, tR₆], [n₆, n₆], label="6") plot!(p1, 51.0:0.001:52.0, itp₆.(51.0:0.001:52.0), xlims=(51.45,51.55), ylims=(0.969, 0.972), label="itp₆") end # ╔═╡ 313d1431-ec39-4d1e-91fd-e025efc1f5c3 tR₆-tR_lock # ╔═╡ fab59b1e-ba32-49d3-b0f1-564db037400c begin n₇ = itp₆(tR_lock) par₇ = GasChromatographyTools.stretched_program(n₇, par0) sol₇ = GasChromatographySimulator.solving_odesystem_r(par₇.col, par₇.prog, par₇.sub[2], par₇.opt) tR₇ = sol₇.u[end][1] n_vec₇ = sort([n_vec₆; n₇]) tR_vec₇ = sort([tR_vec₆; tR₇]) tR_vec₇.-tR_lock itp₇ = Spline1D(tR_vec₇, n_vec₇, k=3) scatter!(p1, [tR₇, tR₇], [n₇, n₇], label="7") plot!(p1, 51.0:0.001:52.0, itp₇.(51.0:0.001:52.0), xlims=(51.47,51.49), ylims=(0.9699, 0.9701), label="itp₇") end # ╔═╡ 25725568-ae9a-4ab0-8f98-87fec12c867a begin n₈ = itp₇(tR_lock) par₈ = GasChromatographyTools.stretched_program(n₈, par0) sol₈ = GasChromatographySimulator.solving_odesystem_r(par₈.col, par₈.prog, par₈.sub[2], par₈.opt) tR₈ = sol₈.u[end][1] n_vec₈ = sort([n_vec₇; n₈]) tR_vec₈ = sort([tR_vec₇; tR₈]) tR_vec₈.-tR_lock itp₈ = Spline1D(tR_vec₈, n_vec₈, k=3) scatter!(p1, [tR₈, tR₈], [n₈, n₈], label="8") plot!(p1, 51.0:0.001:52.0, itp₈.(51.0:0.001:52.0), xlims=(51.47,51.49), ylims=(0.9699, 0.9701), label="itp₈") end # ╔═╡ 404c1d12-5217-485e-b3a6-6f024d29b544 md""" The estimates continue to jump around tR_lock. The last estimate is further away than the one before. Also, there seems to be some form of discontiuity of the simulation result around tR_lock, which produces the problem in the first place. """ # ╔═╡ 57634f00-45d5-4cf9-94f5-76319d4e5436 begin n₉ = itp₈(tR_lock) par₉ = GasChromatographyTools.stretched_program(n₉, par0) sol₉ = GasChromatographySimulator.solving_odesystem_r(par₉.col, par₉.prog, par₉.sub[2], par₉.opt) tR₉ = sol₉.u[end][1] n_vec₉ = sort([n_vec₈; n₉]) tR_vec₉ = sort([tR_vec₈; tR₉]) tR_vec₉.-tR_lock itp₉ = Spline1D(tR_vec₉, n_vec₉, k=3) scatter!(p1, [tR₉, tR₉], [n₉, n₉], label="9") plot!(p1, 51.0:0.001:52.0, itp₉.(51.0:0.001:52.0), xlims=(51.47,51.49), ylims=(0.9699, 0.9701), label="itp₉") end # ╔═╡ ae803a26-c436-497a-b245-a0afec92e46f md""" Make simulations for a range of stretch factors ``n``. """ # ╔═╡ 1983258e-e84b-4f39-9ce8-0e20e78a0893 begin nn = [0.969970, 0.969971, 0.969972, 0.969973, 0.969974, 0.969975, 0.969976, 0.969977] ttR = Array{Float64}(undef, length(nn)) for i=1:length(nn) pars = stretched_program(nn[i], par0) sols = GasChromatographySimulator.solving_odesystem_r(pars.col, pars.prog, pars.sub[2], pars.opt) ttR[i] = sols.u[end][1] end p2 = plot([tR_lock, tR_lock], [0.95, 0.98], label="tR_lock") plot!(p2, ttR, nn, line=(2,:solid), markers=:square, xlims=(51.479, 51.484), ylims=(0.969969,0.96998)) end # ╔═╡ 89cbd5c0-0df6-43d3-bd5c-d3d55d669f33 begin nnn = 0.969974.+collect(0.0000001:0.0000001:0.0000009) tttR = Array{Float64}(undef, length(nnn)) for i=1:length(nnn) pars = stretched_program(nnn[i], par0) sols = GasChromatographySimulator.solving_odesystem_r(pars.col, pars.prog, pars.sub[2], pars.opt) tttR[i] = sols.u[end][1] end plot!(p2, tttR, nnn, ylims=(0.9699739,0.9699751), markers=:circle) end # ╔═╡ f541b210-3ef8-4003-b358-065e5c5949ad par8 = stretched_program(nnn[8], par0) # ╔═╡ 524b256b-0c1e-48bc-ac0b-2ee7fc1eab2b par9 = stretched_program(nnn[9], par0) # ╔═╡ 6d15c2a4-6d1e-4b89-b9e8-ecff004c4730 sol8 = GasChromatographySimulator.solving_odesystem_r(par8.col, par8.prog, par8.sub[2], par8.opt) # ╔═╡ 665f302d-204b-47ac-90df-c5979350707c sol9 = GasChromatographySimulator.solving_odesystem_r(par9.col, par9.prog, par9.sub[2], par9.opt) # ╔═╡ 56095d71-6169-44b3-89d1-7ea7f1b6ddfb sol8.destats # ╔═╡ a51cd1dc-50bb-4444-a0f7-c0e4229b1257 sol9.destats # ╔═╡ 225434d5-c753-4476-8f68-f5761a454852 sol8.retcode # ╔═╡ 9a6f436e-e50e-4697-a1d1-3d2d43fc62fc sol9.retcode # ╔═╡ 8a6eccf0-8740-4d69-b96b-1248557d4c4d begin nnnn = sort!(rand(0.9699745:0.000000001:0.9699755, 100)) ttttR = Array{Float64}(undef, length(nnnn)) for i=1:length(nnnn) pars = stretched_program(nnnn[i], par0) sols = GasChromatographySimulator.solving_odesystem_r(pars.col, pars.prog, pars.sub[2], pars.opt) ttttR[i] = sols.u[end][1] end plot!(p2, ttttR, nnnn, ylims=(0.9699739,0.9699756), markers=:circle) md""" In the range around tR_lock the solution seems to be unstable. A small change in the temperature program leads to a bigger change in the retention time. There seem to be two branches of n(tR), which does not meet. $(embed_display(p2)) """ end # ╔═╡ 08a0972a-55ff-42c9-838b-1a649afe9a46 md""" ## Decreased relative tolerance The problem is not originated in the RT_lock algorithm but in the simulation itself. For certain settings a small change (like small strectch in the program) can result in bigger changes in retention time. """ # ╔═╡ 2d7da55e-2711-44a4-b8b9-bda6321a4c48 begin # decrease the relative tolerance opt_1 = GasChromatographySimulator.Options(OwrenZen5(), 1e-6, 1e-4, "inlet", true) par_1 = GasChromatographySimulator.Parameters(col, prog0, sub, opt_1) # repeat the simulation from above nnnn_1 = sort!(rand(0.9699745:0.000000001:0.9699755, 100)) ttttR_1 = Array{Float64}(undef, length(nnnn_1)) for i=1:length(nnnn_1) pars = stretched_program(nnnn_1[i], par_1) sols = GasChromatographySimulator.solving_odesystem_r(pars.col, pars.prog, pars.sub[2], pars.opt) ttttR_1[i] = sols.u[end][1] end plot!(p2, ttttR_1, nnnn_1, ylims=(0.9699739,0.9699756), markers=:v, label="reltol=1e-4") end # ╔═╡ 89fa3139-1d10-4dd3-90b1-d9c0f65745c6 begin n_1 = RT_locking(par_1, tR_lock, 1e-3, last_alkane; opt_itp="spline") par_1_s = stretched_program(n_1, par_1) sol_1_s = GasChromatographySimulator.solving_odesystem_r(par_1_s.col, par_1_s.prog, par_1_s.sub[2], par_1_s.opt) tR_1_s = sol_1_s.u[end][1] scatter!(p2, [tR_1_s, tR_1_s], [n_1, n_1], ylims=(0.9699739, n_1*1.000001)) end # ╔═╡ e9accaac-587f-498d-ab0c-a8064f573678 begin # simulation arround n_1 n_range = (n_1-0.0001):0.000001:(n_1+0.0001) tR_range = Array{Float64}(undef, length(n_range)) for i=1:length(n_range) pars = stretched_program(n_range[i], par_1) sols = GasChromatographySimulator.solving_odesystem_r(pars.col, pars.prog, pars.sub[2], pars.opt) tR_range[i] = sols.u[end][1] end plot!(p2, tR_range, n_range, ylims=(n_range[1], n_range[end]), xlims=(tR_range[1], tR_range[end])) end # ╔═╡ 4cd795b1-efeb-430b-a025-77d0ee9d2b1b md""" ## Modified Functions with relative difference """ # ╔═╡ 0bf4903c-074d-41b8-a4e8-5834ce8659d5 function recur_RT_locking_rel(n::Float64, n_vec::Array{Float64,1}, tR_vec::Array{Float64,1}, par::GasChromatographySimulator.Parameters, tR_lock::Float64, tR_tol::Float64, ii::Int64; opt_itp="linear") # recursive function to find the factor 'n' for the temperature program to achieve the retention time 'tR_lock' for solute index 'ii' with the GC-system defined by 'par' # calculate the retention time with the input guess 'n' par₁ = stretched_program(n, par) if par.opt.odesys==true sol₁ = GasChromatographySimulator.solving_odesystem_r(par₁.col, par₁.prog, par₁.sub[ii], par₁.opt) tR₁ = sol₁.u[end][1] else sol₁ = GasChromatographySimulator.solving_migration(par₁.col, par₁.prog, par₁.sub[ii], par₁.opt) tR₁ = sol₁.u[end] end if abs(tR₁-tR_lock)/tR_lock<tR_tol # if retention time is less than 'tR_tol' from 'tR_lock' we found the factor 'n' return n else # estimate a new factor 'new_n' by linear interpolation of the factors 'n_vec' + 'n' over the corresponding retention times new_n_vec = sort([n_vec; n]) new_tR_vec = sort([tR_vec; tR₁]) if opt_itp=="spline" # Dierckx.jl if length(new_tR_vec)<4 k = length(new_tR_vec)-1 else k = 3 end itp = Spline1D(new_tR_vec, new_n_vec, k=k) else # opt_itp=="linear" # Interpolations.jl itp = LinearInterpolation(sort([tR_vec; tR₁]), sort([n_vec; n])) end new_n = itp(tR_lock) #println("new_n=$(new_n), tR₁=$(tR₁)") # use the new factor 'new_n' and call the recursive function again return recur_RT_locking_rel(new_n, new_n_vec, new_tR_vec, par, tR_lock, tR_tol, ii; opt_itp=opt_itp) end end # ╔═╡ be7d3bf5-d682-40e7-8161-4243354373f8 function RT_locking_rel(par::GasChromatographySimulator.Parameters, tR_lock::Float64, tR_tol::Float64, solute_RT::String; opt_itp="linear") # estimate the factor 'n' for the temperature program to achieve the retention time 'tR_lock' for 'solute_RT' with the GC-system defined by 'par' if isa(par, Array)==true error("Select an element of the array of GC-systems.") elseif tR_tol<par.opt.reltol error("The relative tolerance for retention time locking tR_tol is to small. Use tR_tol > par.opt.reltol ($(par.opt.reltol)).") else # find 'solute_RT' in the substances of 'par' name = Array{String}(undef, length(par.sub)) for i=1:length(par.sub) name[i] = par.sub[i].name end ii = findfirst(name.==solute_RT) # calculate the retention time for the original (un-stretched) program sol₀ = GasChromatographySimulator.solving_odesystem_r(par.col, par.prog, par.sub[ii], par.opt) tR₀ = sol₀.u[end][1] # start value for the factor 'n' if tR₀-tR_lock<0 n₁ = initial_n(2.0, tR_lock, ii, par) else n₁ = initial_n(0.5, tR_lock, ii, par) end # using a recursive function to estimate 'n' n = recur_RT_locking_rel(n₁, [1.0], [tR₀], par, tR_lock, tR_tol, ii; opt_itp=opt_itp) end return n end # ╔═╡ 8a7a24e3-3896-4012-8e50-473a70ec3a44 n_rel = RT_locking_rel(par0, tR_lock, 1e-3, last_alkane; opt_itp="spline") # ╔═╡ 4cbd8054-d1c7-4132-ae61-ef09ce6ba9e7 par0_rel = stretched_program(n_rel, par0) # ╔═╡ b842960f-ef61-4a70-8a17-5405ec3e5ed3 sol_rel = GasChromatographySimulator.solving_odesystem_r(par0_rel.col, par0_rel.prog, par0_rel.sub[2], par0_rel.opt) # ╔═╡ 24269e34-fc1d-4ee2-87b6-afb6a3081596 tR_rel = sol_rel.u[end][1] # ╔═╡ 0f7e36cb-c4a7-43b5-928f-d364b82d218b tR_rel-tR_lock # ╔═╡ 3bdf621e-969b-42b8-85f8-5ecd261646d3 (tR_rel-tR_lock)/tR_lock # ╔═╡ 42a1fccd-e782-42fb-91de-18c8b33d507d md""" # End """ # ╔═╡ Cell order: # ╠═6f9a94bd-dd28-4110-a7ca-0ed84e9c7c3f # ╠═0b51a792-d9b8-4c29-928f-57aaf41f1c20 # ╠═93ba6afc-4e9a-11ec-08d9-81c0a9bc502e # ╠═51ec0223-199a-4a25-8768-cd0b7e9f864d # ╠═5e642f09-9a8f-4cca-b61f-b27c8433a2e5 # ╠═3de48bb6-8eb7-4a33-9a98-d5fe3a19f6c6 # ╠═19d1abb6-32b6-414f-bc95-55635cbaa73a # ╠═2cad8185-4fc5-4009-98df-07a2be2133c6 # ╠═30207849-cafe-4ec6-af8d-ee7b2e2e6de0 # ╠═84e7e869-0fbf-4590-a8de-28855856661f # ╠═c5ace7ce-cfa3-4c15-bcc1-8b66ad1c16e9 # ╠═c4d53222-03b1-4ce4-a49a-690945347432 # ╠═6acfbf9b-f8ac-4483-8c93-17920d0d9f0e # ╠═3b31f580-efe2-4a7a-89dc-228b38f2a71e # ╠═b6c5126a-3d41-4809-ab9b-d554262e0668 # ╠═6c5443bc-3dab-4317-99c9-1bb32b184fbc # ╠═3b1bb187-66f9-40bd-a0a5-a3c4e1a23819 # ╠═b81b2905-6756-445b-b1be-c54298df8b3f # ╟─eb2d9f6a-8384-427a-a036-b4f0019d8251 # ╠═734bae50-12fa-4717-8446-addb963b8673 # ╠═8de716b9-ca56-42f5-aebf-39ad467f4613 # ╠═dadbefbf-a107-4c89-a4ef-0eb756517c1e # ╠═313d1431-ec39-4d1e-91fd-e025efc1f5c3 # ╠═fab59b1e-ba32-49d3-b0f1-564db037400c # ╠═25725568-ae9a-4ab0-8f98-87fec12c867a # ╠═404c1d12-5217-485e-b3a6-6f024d29b544 # ╠═57634f00-45d5-4cf9-94f5-76319d4e5436 # ╠═ae803a26-c436-497a-b245-a0afec92e46f # ╠═1983258e-e84b-4f39-9ce8-0e20e78a0893 # ╠═89cbd5c0-0df6-43d3-bd5c-d3d55d669f33 # ╠═f541b210-3ef8-4003-b358-065e5c5949ad # ╠═524b256b-0c1e-48bc-ac0b-2ee7fc1eab2b # ╠═6d15c2a4-6d1e-4b89-b9e8-ecff004c4730 # ╠═665f302d-204b-47ac-90df-c5979350707c # ╠═56095d71-6169-44b3-89d1-7ea7f1b6ddfb # ╠═a51cd1dc-50bb-4444-a0f7-c0e4229b1257 # ╠═225434d5-c753-4476-8f68-f5761a454852 # ╠═9a6f436e-e50e-4697-a1d1-3d2d43fc62fc # ╠═8a6eccf0-8740-4d69-b96b-1248557d4c4d # ╟─08a0972a-55ff-42c9-838b-1a649afe9a46 # ╠═2d7da55e-2711-44a4-b8b9-bda6321a4c48 # ╠═89fa3139-1d10-4dd3-90b1-d9c0f65745c6 # ╠═e9accaac-587f-498d-ab0c-a8064f573678 # ╠═4cd795b1-efeb-430b-a025-77d0ee9d2b1b # ╠═be7d3bf5-d682-40e7-8161-4243354373f8 # ╠═0bf4903c-074d-41b8-a4e8-5834ce8659d5 # ╠═8a7a24e3-3896-4012-8e50-473a70ec3a44 # ╠═4cbd8054-d1c7-4132-ae61-ef09ce6ba9e7 # ╠═b842960f-ef61-4a70-8a17-5405ec3e5ed3 # ╠═24269e34-fc1d-4ee2-87b6-afb6a3081596 # ╠═0f7e36cb-c4a7-43b5-928f-d364b82d218b # ╠═3bdf621e-969b-42b8-85f8-5ecd261646d3 # ╠═42a1fccd-e782-42fb-91de-18c8b33d507d
[ 27, 456, 62, 30783, 29, 15, 198, 21017, 317, 32217, 13, 20362, 20922, 44386, 198, 2, 410, 15, 13, 1433, 13, 16, 198, 198, 3500, 2940, 2902, 198, 3500, 21365, 18274, 4487, 198, 198, 2, 2343, 243, 242, 28670, 22880, 94, 718, 69, 24,...
1.828211
12,527
# MGH problem 35 - Chebyquad function # # Source: # <NAME>, <NAME> and <NAME> # Testing Unconstrained Optimization Software # ACM Transactions on Mathematical Software, 7(1):17-41, 1981 # # <NAME>, Montreal, 05/2018. export mgh35 "Chebyquad function" function mgh35(m :: Int = 10, n :: Int = 10) if m < n warn(": number of function must be ≥ number of variables. Adjusting to m = n") m = n end nls = Model() x0 = collect(1:n)/(n+1) @variable(nls, x[i=1:n], start = x0[i]) function Tsim(x, n) if n == 0 return 1 elseif n == 1 return x else return 2*x*Tsim(x,n-1) - Tsim(x,n-2) end end Ts = Vector{Function}(undef, n) Tnames = Vector{Symbol}(undef, n) for i = 1:n Ts[i] = x -> Tsim(2*x-1, i) Tnames[i] = gensym() JuMP.register(nls, Tnames[i], 1, Ts[i], autodiff=true) end I = [i%2 == 0 ? -1/(i^2-1) : 0 for i = 1:n] @NLexpression(nls, F[i=1:n], sum($(Tnames[i])(x[j]) for j = 1:n)/n - I[i]) return MathProgNLSModel(nls, F, name="mgh35") end
[ 2, 337, 17511, 1917, 3439, 532, 2580, 1525, 47003, 2163, 198, 2, 198, 2, 220, 220, 8090, 25, 198, 2, 220, 220, 1279, 20608, 22330, 1279, 20608, 29, 290, 1279, 20608, 29, 198, 2, 220, 220, 23983, 791, 1102, 2536, 1328, 30011, 1634, ...
2.13347
487
using MAT, JuMP, Ipopt include("../benchmark.jl") function read_lp2(dir, name) lp_data = matopen("$(dir)/$(name).mat") problem = read(lp_data,"Problem") A = problem["A"] b = problem["b"][:] c = problem["aux"]["c"][:] lb = problem["aux"]["lo"][:] ub = problem["aux"]["hi"][:] n = length(c) m = Model() @variable(m, lb[i] <= x[i=1:n] <= ub[i]) @NLobjective(m, Min, sum(c[i] * x[i] for i = 1:n)) @constraint(m, A * x .== b) return m end function get_file_names(dir::String,ext::String) name_list = readdir(dir) cleaned_name_list = [] for name_full in name_list try if name_full[(end-3):end] == ext name = name_full[1:(end-4)] end cleaned_name_list = [cleaned_name_list; name] catch(e) @show e println("ERROR in running " * name_full) end end return cleaned_name_list end function run_infeas_netlib(test_name, my_par, solve_func!) summary = Dict{String, problem_summary2}() dir = "../data/netlib-infeas" problem_list = get_file_names(dir,".mat") if_mkdir("../results/$test_name") if_mkdir("../results/$test_name/log") if_mkdir("../results/$test_name/jld") for problem_name in problem_list if problem_name != "lpi_cplex2" m = read_lp2(dir, problem_name) nlp = MathProgNLPModel(m); #if nlp.meta.ncon < 2000 summary[problem_name] = solve_func!(nlp, problem_name, test_name, my_par) #end end write_summary("../results/$(test_name)/summary.txt", summary) save("../results/$(test_name)/summary.jld","summary",summary, "pars", my_par) end end my_par = Class_parameters() run_infeas_netlib("one_phase/Jan4/infeas-netlib", my_par, one_phase_run_and_store) run_infeas_netlib("ipopt/Jan4/infeas-netlib", my_par, ipopt_solve_run_and_store)
[ 3500, 36775, 11, 12585, 7378, 11, 314, 79, 8738, 198, 17256, 7203, 40720, 26968, 4102, 13, 20362, 4943, 198, 198, 8818, 1100, 62, 34431, 17, 7, 15908, 11, 1438, 8, 198, 220, 220, 220, 300, 79, 62, 7890, 796, 2603, 9654, 7203, 3, 7...
2.160508
866
<filename>src/genotypes.jl<gh_stars>0 import GZip """ function gt600() --- 1. Phase the genotypes with beagle 2. Convert results to array 3. """ function gt600() rst = joinpath(dat_dir, "run") fra = joinpath(dat_dir, "real/nofima/for_CMSEdit") Nₑ = 100 @info join(["", "Remove SNP of duplicates and unknown postions", " - See data/real/nofima/plink.sh"], "\n") @info "Phasing with beagle.jar" # make alleles to C/T, and replace positions, so that beagle can phase them GZip.open("$rst/b.vcf.gz", "w") do io i = 0 for line in eachline(GZip.open("$rst/a.vcf.gz", "r")) if line[1] == '#' write(io, line, "\n") else i += 1 t = split(line) t[4] = "T" t[5] = "C" write(io, join(t, "\t"), "\n") end end end # phasing run(`java -jar $beagle gt=$rst/b.vcf.gz ne=$Nₑ out=$rst/c`) end """ function vcf2dic(vcf) --- Read chromosome and haplotypes from a `vcf` file of **gzip** format. Returns a Dictionary: pos=>[chr, bp], hap=>hap of chr8[][]. Each column of hap is a haplotype across genome. """ function vcf2dic(vcf) GZip.open(vcf, "r") do io # skip vcf header and determine N_ID nid = 0 for line in eachline(io) if line[2] != '#' nid = length(split(line)) - 9 break end end pos = Int[] hap = Int8[] for line in eachline(io) f = split(line) append!(pos, parse.(Int, f[1:2])) append!(hap, parse.(Int8, collect(join(f[10:end], ' ')[1:2:end]))) end pos = reshape(pos, (2, :))' r = haldane(pos) hap = reshape(hap, (nid*2, :))' Dict(:pos => pos, :r => r, :hap => Bool.(hap)) end end
[ 27, 34345, 29, 10677, 14, 5235, 13567, 13, 20362, 27, 456, 62, 30783, 29, 15, 198, 11748, 402, 41729, 198, 37811, 198, 220, 220, 220, 2163, 308, 83, 8054, 3419, 198, 6329, 198, 16, 13, 18983, 262, 2429, 13567, 351, 307, 19345, 198, ...
1.826291
1,065
<reponame>jekbradbury/ChainRules.jl ##### ##### `Thunk` ##### macro thunk(body) return :(Thunk(() -> $(esc(body)))) end struct Thunk{F} f::F end @inline (thunk::Thunk{F})() where {F} = (thunk.f)() ##### ##### `forward_chain` ##### forward_chain(args...) = materialize(_forward_chain(args...)) @inline _forward_chain(ẋ::Nothing, ∂::Thunk) = false @inline _forward_chain(ẋ, ∂::Thunk) = broadcasted(*, ẋ, ∂()) _forward_chain(ẋ, ∂::Thunk, args...) = broadcasted(+, _forward_chain(ẋ, ∂), _forward_chain(args...)) ##### ##### `reverse_chain!` ##### @inline reverse_chain!(x̄::Nothing, ∂::Thunk) = false @inline function reverse_chain!(x̄, ∂::Thunk) thunk = ∂() x̄_value = adjoint_value(x̄) casted = should_increment(x̄) ? broadcasted(+, x̄_value, thunk) : thunk if should_materialize_into(x̄) return materialize!(x̄_value, casted) else return materialize(casted) end end adjoint_value(x̄) = x̄ should_increment(::Any) = true should_materialize_into(::Any) = false ##### ##### miscellanous defaults ##### # TODO: More defaults, obviously! markup(::Any) = Ignore() markup(::Real) = RealScalar() markup(::Complex) = ComplexScalar() markup(x::Tuple{Vararg{<:Real}}) = RealTensor(layout(x)) markup(x::Tuple{Vararg{<:Complex}}) = ComplexTensor(layout(x)) markup(x::AbstractArray{<:Real}) = RealTensor(layout(x)) markup(x::AbstractArray{<:Complex}) = ComplexTensor(layout(x)) markup(x::AbstractArray) = error("Cannot infer domain of array from eltype", x) layout(x::Tuple) = Layout(length(x), (length(x),), CPUDevice(), false) layout(x::Array) = Layout(length(x), size(x), CPUDevice(), true) should_materialize_into(::Array) = true
[ 27, 7856, 261, 480, 29, 73, 988, 1671, 324, 10711, 14, 35491, 37766, 13, 20362, 198, 4242, 2, 198, 4242, 2, 4600, 817, 2954, 63, 198, 4242, 2, 198, 198, 20285, 305, 294, 2954, 7, 2618, 8, 198, 220, 220, 220, 1441, 36147, 817, 29...
2.392351
706
<filename>src/SignalsAPI.jl module Signals using JSON, HTTP, Dates, TimeZones include("Utils.jl") include("BaseAPI.jl") export SignalsAPI, get_leaderboard, upload_predictions, submission_status, public_user_profile, daily_user_performances, daily_submissions_performances, ticker_universe, download_validation_data, stake_get const SIGNALS_DOM = "https://numerai-signals-public-data.s3-us-west-2.amazonaws.com" const TOURNAMENT = 11 struct SignalsAPI <: BaseAPI public_id::Union{String,Nothing} secret_key::Union{String,Nothing} tournament::Int signals_dom::String ticker_universe_url::String historical_data_url::String end function SignalsAPI(public_id::Union{String,Nothing}, secret_key::Union{String,Nothing}; tournament=TOURNAMENT) return SignalsAPI(public_id, secret_key, tournament, SIGNALS_DOM, "$(SIGNALS_DOM)/latest_universe.csv", "$(SIGNALS_DOM)/signals_train_val_bbg.csv") end """ get_account(api::SignalsAPI)::Dict{String,Any} Get all information about your account """ get_account(api::SignalsAPI)::Dict{String,Any} = _get_account(api) """ get_models(api::SignalsAPI)::Dict{String,String} Get mapping of account model names to model ids for convenience """ get_models(api::SignalsAPI)::Dict{String,String} = _get_models(api) """ get_current_round(api::SignalsAPI)::Union{Real,Nothing} Get number of the current active round """ get_current_round(api::SignalsAPI)::Union{Real,Nothing} = _get_current_round(api) """ get_account_transactions(api::SignalsAPI)::Dict{String,Vector} Get all your account deposits and withdrawals """ get_account_transactions(api::SignalsAPI)::Dict{String,Vector} = _get_account_transactions(api) """ get_leaderboard(api::SignalsAPI; limit::Int=50, offset::Int=0)::Vector{Dict} Get the current Numerai Signals leaderboard # Arguments - `limit::Int=50`: number of items to return (optional, defaults to 50) - `offset::Int=0`: number of items to skip (optional, defaults to 0) # Example ```julia-repl julia> get_leaderboard(signal_api) ``` """ function get_leaderboard(api::SignalsAPI; limit::Int=50, offset::Int=0)::Vector{Dict} query = """ query(\$limit: Int! \$offset: Int!) { signalsLeaderboard(limit: \$limit offset: \$offset) { prevRank rank sharpe today username mmc mmcRank nmrStaked } } """ variables = Dict( "limit" => limit, "offset" => offset ) data = raw_query(api, query, variables=variables)["data"]["signalsLeaderboard"] return data end """ upload_predictions(api::SignalsAPI, file_path::String; model_id::Union{String,Nothing}=nothing)::String Upload predictions from file """ function upload_predictions(api::SignalsAPI, file_path::String; model_id::Union{String,Nothing}=nothing)::String @info "uploading predictions..." auth_query = """ query(\$filename: String! \$modelId: String) { submissionUploadSignalsAuth(filename: \$filename modelId: \$modelId) { filename url } } """ variables = Dict( "filename" => basename(file_path), "modelId" => model_id ) submission_resp = raw_query(api, auth_query, variables=variables, authorization=true) submission_auth = submission_resp["data"]["submissionUploadSignalsAuth"] headers = haskey(ENV, "NUMERAI_COMPUTE_ID") ? ["x_compute_id"=>ENV["NUMERAI_COMPUTE_ID"],] : [] open(file_path, "r") do io HTTP.request("PUT", submission_auth["url"], headers, read(io)) end create_query = """ mutation(\$filename: String! \$modelId: String) { createSignalsSubmission(filename: \$filename modelId: \$modelId) { id firstEffectiveDate } } """ variables = Dict( "filename" => submission_auth["filename"], "modelId" => model_id ) create = raw_query(api, create_query, variables=variables, authorization=true) return create["data"]["createSignalsSubmission"]["id"] end """ submission_status(api::SignalsAPI; model_id::Union{String,Nothing}=nothing)::Dict Submission status of the last submission associated with the account """ function submission_status(api::SignalsAPI; model_id::Union{String,Nothing}=nothing)::Vector{Dict} query = """ query(\$modelId: String) { model(modelId: \$modelId) { latestSignalsSubmission { id filename firstEffectiveDate userId submissionIp submittedCount filteredCount invalidTickers hasHistoric historicMean historicStd historicSharpe historicMaxDrawdown } } } """ variables = Dict( "modelId" => model_id ) data = raw_query(api, query, variables=variables, authorization=true) return data["data"]["model"]["latestSignalsSubmission"] end """ public_user_profile(api::SignalsAPI, username::String)::Dict Fetch the public Numerai Signals profile of a user """ function public_user_profile(api::SignalsAPI, username::String)::Dict query = """ query(\$username: String!) { signalsUserProfile(username: \$username) { rank id startDate username bio sharpe totalStake } } """ variables = Dict( "username" => username ) profile = raw_query(api, query, variables=variables)["data"]["signalsUserProfile"] profile["startDate"] = parse_datetime_string(profile["startDate"]) profile["totalStake"] = parse_float_string(profile["totalStake"]) return profile end """ daily_user_performances(api::SignalsAPI, username::String)::Vector{Dict} Fetch daily Numerai Signals performance of a user """ function daily_user_performances(api::SignalsAPI, username::String)::Vector{Dict} query = """ query(\$username: String!) { signalsUserProfile(username: \$username) { dailyUserPerformances { rank date sharpe mmcRep reputation } } } """ variables = Dict( "username" => username ) data = raw_query(api, query, variables=variables)["data"]["signalsUserProfile"] performances = data["dailyUserPerformances"] for perf in performances perf["date"] = parse_datetime_string(perf["date"]) end return performances end """ daily_submissions_performances(api::SignalsAPI, username::String)::Vector{Dict} Fetch daily Numerai Signals performance of a user's submissions """ function daily_submissions_performances(api::SignalsAPI, username::String)::Vector{Dict} query = """ query(\$username: String!) { signalsUserProfile(username: \$username) { dailySubmissionPerformances { date returns submissionTime correlation mmc roundNumber corrRep mmcRep } } } """ variables = Dict( "username" => username ) data = raw_query(api, query, variables=variables)["data"]["signalsUserProfile"] performances = data["dailySubmissionPerformances"] for perf in performances perf["date"] = parse_datetime_string(perf["date"]) perf["submissionTime"] = parse_datetime_string(perf["submissionTime"]) end performances = filter(perf -> !isnothing(perf["date"]), performances) sort!(performances, by=x -> (x["roundNumber"], x["date"]), rev=true) return performances end """ ticker_universe(api::SignalsAPI)::Vector{String} Fetch universe of accepted tickers """ function ticker_universe(api::SignalsAPI)::Vector{String} result = HTTP.request("GET", api.ticker_universe_url) tickers = String(result.body) tickers = split(tickers, "\n") tickers = [strip(ticker) for ticker in tickers if (strip(ticker) ≠ "bloomberg_ticker") & (strip(ticker) ≠ "")] return tickers end """ download_validation_data(api::SignalsAPI; dest_path::String=".", dest_filename::Union{String,Nothing}=nothing, show_progress_bar::Bool=true)::String Download CSV file with historical targets and ticker universe """ function download_validation_data(api::SignalsAPI; dest_path::String=".", dest_filename::Union{String,Nothing}=nothing, show_progress_bar::Bool=true)::String if isnothing(dest_filename) dest_filename = "numerai_signals_historical.csv" end dataset_path = joinpath(dest_path, dest_filename) ensure_directory_exists(dest_path) download_file(api.historical_data_url, dataset_path, show_progress_bar=show_progress_bar) return dataset_path end """ stake_get(api::SignalsAPI, username::String)::Real Get current stake for a given users """ function stake_get(api::SignalsAPI, username::String)::Real data = public_user_profile(api, username) return data["totalStake"] end end # module
[ 27, 34345, 29, 10677, 14, 11712, 874, 17614, 13, 20362, 198, 21412, 5865, 874, 198, 220, 220, 198, 220, 1262, 19449, 11, 14626, 11, 44712, 11, 3862, 57, 1952, 198, 220, 220, 198, 220, 2291, 7203, 18274, 4487, 13, 20362, 4943, 198, 2...
2.334294
4,164
using GLVisualize, GeometryTypes, GLAbstraction using Colors, Reactive, FileIO if !isdefined(:runtests) window = glscreen() timesignal = bounce(linspace(0f0, 1f0, 360)) end description = """ Showing off the flexibility of the particle system by animating all kind of atributes for an arbitrary mesh as the particle. """ cat = GLNormalMesh(loadasset("cat.obj")) sphere = GLNormalMesh(Sphere{Float32}(Vec3f0(0), 1f0), 12) function scale_gen(v0, nv) l = length(v0) @inbounds for i=1:l v0[i] = Vec3f0(1,1,sin((nv*l)/i))/2 end v0 end function color_gen(v0, t) l = length(v0) @inbounds for x=1:l v0[x] = RGBA{N0f8}(x/l,(cos(t)+1)/2,(sin(x/l/3)+1)/2.,1.) end v0 end t = const_lift(x->x+0.1, timesignal) ps = sphere.vertices scale_start = Vec3f0[Vec3f0(1,1,rand()) for i=1:length(ps)] scale = foldp(scale_gen, scale_start, t) colorstart = color_gen(zeros(RGBA{N0f8}, length(ps)), value(t)) color = foldp(color_gen, colorstart, t) rotation = sphere.normals cats = visualize((cat, ps), scale = scale, color = color, rotation = rotation) _view(cats, window) if !isdefined(:runtests) renderloop(window) end
[ 3500, 10188, 36259, 1096, 11, 2269, 15748, 31431, 11, 10188, 4826, 301, 7861, 198, 3500, 29792, 11, 797, 5275, 11, 9220, 9399, 198, 361, 5145, 271, 23211, 7, 25, 81, 2797, 3558, 8, 198, 220, 220, 220, 4324, 796, 1278, 9612, 3419, 19...
2.184783
552