content
large_stringlengths
0
6.46M
path
large_stringlengths
3
331
license_type
large_stringclasses
2 values
repo_name
large_stringlengths
5
125
language
large_stringclasses
1 value
is_vendor
bool
2 classes
is_generated
bool
2 classes
length_bytes
int64
4
6.46M
extension
large_stringclasses
75 values
text
stringlengths
0
6.46M
scotpop <- read_excel("./Scotland_midyearpop_est2019.xlsx") # load("casefreqs.RData") ## national cumulative cases and deaths by sex and one year age group ####### incidence and mortality using national population estimates ###################### case.freqs <- data.frame(Age=as.integer(rownames(case.freqs)), Females=as.integer(case.freqs[, 1]), Males=as.integer(case.freqs[, 2])) case.long <- reshape2::melt(case.freqs, id="Age") colnames(case.long) <- c("Age", "Sex", "Cases") death.freqs <- data.frame(Age=as.integer(rownames(death.freqs)), Females=as.integer(death.freqs[, 1]), Males=as.integer(death.freqs[, 2])) death.long <- reshape2::melt(death.freqs, id="Age") colnames(death.long) <- c("Age", "Sex", "Deaths") scotpop.long <- reshape2::melt(scotpop[, -2], id="Age") colnames(scotpop.long) <- c("Age", "Sex", "Population") discrim <- merge(scotpop.long, case.long, by=c("Age", "Sex"), all.x=TRUE) discrim <- merge(discrim, death.long, by=c("Age", "Sex"), all.x=TRUE) discrim$Cases[is.na(discrim$Cases)] <- 0 discrim$Deaths[is.na(discrim$Deaths)] <- 0 discrim$Sex <- as.factor(discrim$Sex) discrim$Noncases <- discrim$Population - discrim$Cases y.cases <- cbind(as.integer(discrim$Cases), as.integer(discrim$Noncases)) discrim$Survivors <- discrim$Population - discrim$Deaths y.deaths <- cbind(as.integer(discrim$Deaths), as.integer(discrim$Survivors)) cases.model <- glm(formula=y.cases ~ Sex + Age, family="binomial", data=discrim) deaths.model <- glm(formula=y.deaths ~ Sex + Age, family="binomial", data=discrim) cases.model.coeffs <- summary(cases.model)$coefficients deaths.model.coeffs <- summary(deaths.model)$coefficients logistic.coeffs <- data.frame(severecase=cases.model.coeffs[, 1], death=deaths.model.coeffs[, 1]) male <- discrim$Sex=="Males" female <- discrim$Sex=="Females" gam.model.MaleDeaths <- gam::gam(formula=y.deaths[male, ] ~ s(Age), family=binomial("logit"), data=discrim[male, ]) gam.model.FemaleDeaths <- gam::gam(formula=y.deaths[female, ] ~ s(Age), family=binomial("logit"), data=discrim[female, ]) gam.model.MaleCases<- gam::gam(formula=y.cases[male, ] ~ s(Age), family=binomial("logit"), data=discrim[male, ]) gam.model.FemaleCases <- gam::gam(formula=y.cases[female, ] ~ s(Age), family=binomial("logit"), data=discrim[female, ]) gam.male <- data.frame(Cases=car::logit(gam.model.MaleCases$fitted.values), Deaths=car::logit(gam.model.MaleDeaths$fitted.values), Age=discrim$Age[male]) gam.male.long <- reshape2::melt(data=gam.male, id="Age") colnames(gam.male.long)[2] <- "Status" gam.male.long$Sex <- "Males" gam.female <- data.frame(Cases=car::logit(gam.model.FemaleCases$fitted.values), Deaths=car::logit(gam.model.FemaleDeaths$fitted.values), Age=discrim$Age[female]) gam.female.long <- reshape2::melt(data=gam.female, id="Age") colnames(gam.female.long)[2] <- "Status" gam.female.long$Sex <- "Females" gam <- rbind(gam.male.long, gam.female.long) ############################################################### logodds.posterior <- predict(object=cases.model, newdata=discrim, type="link") logodds.prior <- log(sum(discrim$Cases) / sum(discrim$Noncases)) log.likratio <- logodds.posterior - logodds.prior discrim$W <- log.likratio / log(2) lambda1 <- sum(discrim$W * discrim$Cases) / sum(discrim$Cases) lambda0 <- sum(-discrim$W * discrim$Noncases) / sum(discrim$Noncases) cases.Lambda.agesex <- 0.5 * (lambda0 + lambda1) logodds.posterior <- predict(object=deaths.model, newdata=discrim, type="link") logodds.prior <- log(sum(discrim$Deaths) / sum(discrim$Survivors)) log.likratio <- logodds.posterior - logodds.prior discrim$W <- log.likratio / log(2) lambda1 <- sum(discrim$W * discrim$Deaths) / sum(discrim$Deaths) lambda0 <- sum(-discrim$W * discrim$Survivors) / sum(discrim$Survivors) deaths.Lambda.agesex <- 0.5 * (lambda0 + lambda1)
/incidencemortality.R
no_license
pmckeigue/covid-scotland_public
R
false
false
4,168
r
scotpop <- read_excel("./Scotland_midyearpop_est2019.xlsx") # load("casefreqs.RData") ## national cumulative cases and deaths by sex and one year age group ####### incidence and mortality using national population estimates ###################### case.freqs <- data.frame(Age=as.integer(rownames(case.freqs)), Females=as.integer(case.freqs[, 1]), Males=as.integer(case.freqs[, 2])) case.long <- reshape2::melt(case.freqs, id="Age") colnames(case.long) <- c("Age", "Sex", "Cases") death.freqs <- data.frame(Age=as.integer(rownames(death.freqs)), Females=as.integer(death.freqs[, 1]), Males=as.integer(death.freqs[, 2])) death.long <- reshape2::melt(death.freqs, id="Age") colnames(death.long) <- c("Age", "Sex", "Deaths") scotpop.long <- reshape2::melt(scotpop[, -2], id="Age") colnames(scotpop.long) <- c("Age", "Sex", "Population") discrim <- merge(scotpop.long, case.long, by=c("Age", "Sex"), all.x=TRUE) discrim <- merge(discrim, death.long, by=c("Age", "Sex"), all.x=TRUE) discrim$Cases[is.na(discrim$Cases)] <- 0 discrim$Deaths[is.na(discrim$Deaths)] <- 0 discrim$Sex <- as.factor(discrim$Sex) discrim$Noncases <- discrim$Population - discrim$Cases y.cases <- cbind(as.integer(discrim$Cases), as.integer(discrim$Noncases)) discrim$Survivors <- discrim$Population - discrim$Deaths y.deaths <- cbind(as.integer(discrim$Deaths), as.integer(discrim$Survivors)) cases.model <- glm(formula=y.cases ~ Sex + Age, family="binomial", data=discrim) deaths.model <- glm(formula=y.deaths ~ Sex + Age, family="binomial", data=discrim) cases.model.coeffs <- summary(cases.model)$coefficients deaths.model.coeffs <- summary(deaths.model)$coefficients logistic.coeffs <- data.frame(severecase=cases.model.coeffs[, 1], death=deaths.model.coeffs[, 1]) male <- discrim$Sex=="Males" female <- discrim$Sex=="Females" gam.model.MaleDeaths <- gam::gam(formula=y.deaths[male, ] ~ s(Age), family=binomial("logit"), data=discrim[male, ]) gam.model.FemaleDeaths <- gam::gam(formula=y.deaths[female, ] ~ s(Age), family=binomial("logit"), data=discrim[female, ]) gam.model.MaleCases<- gam::gam(formula=y.cases[male, ] ~ s(Age), family=binomial("logit"), data=discrim[male, ]) gam.model.FemaleCases <- gam::gam(formula=y.cases[female, ] ~ s(Age), family=binomial("logit"), data=discrim[female, ]) gam.male <- data.frame(Cases=car::logit(gam.model.MaleCases$fitted.values), Deaths=car::logit(gam.model.MaleDeaths$fitted.values), Age=discrim$Age[male]) gam.male.long <- reshape2::melt(data=gam.male, id="Age") colnames(gam.male.long)[2] <- "Status" gam.male.long$Sex <- "Males" gam.female <- data.frame(Cases=car::logit(gam.model.FemaleCases$fitted.values), Deaths=car::logit(gam.model.FemaleDeaths$fitted.values), Age=discrim$Age[female]) gam.female.long <- reshape2::melt(data=gam.female, id="Age") colnames(gam.female.long)[2] <- "Status" gam.female.long$Sex <- "Females" gam <- rbind(gam.male.long, gam.female.long) ############################################################### logodds.posterior <- predict(object=cases.model, newdata=discrim, type="link") logodds.prior <- log(sum(discrim$Cases) / sum(discrim$Noncases)) log.likratio <- logodds.posterior - logodds.prior discrim$W <- log.likratio / log(2) lambda1 <- sum(discrim$W * discrim$Cases) / sum(discrim$Cases) lambda0 <- sum(-discrim$W * discrim$Noncases) / sum(discrim$Noncases) cases.Lambda.agesex <- 0.5 * (lambda0 + lambda1) logodds.posterior <- predict(object=deaths.model, newdata=discrim, type="link") logodds.prior <- log(sum(discrim$Deaths) / sum(discrim$Survivors)) log.likratio <- logodds.posterior - logodds.prior discrim$W <- log.likratio / log(2) lambda1 <- sum(discrim$W * discrim$Deaths) / sum(discrim$Deaths) lambda0 <- sum(-discrim$W * discrim$Survivors) / sum(discrim$Survivors) deaths.Lambda.agesex <- 0.5 * (lambda0 + lambda1)
testlist <- list(lims = structure(c(2.63555450669983e-82, Inf), .Dim = 1:2), points = structure(1.29549941127325e-318, .Dim = c(1L, 1L ))) result <- do.call(palm:::pbc_distances,testlist) str(result)
/palm/inst/testfiles/pbc_distances/libFuzzer_pbc_distances/pbc_distances_valgrind_files/1612987587-test.R
no_license
akhikolla/updatedatatype-list2
R
false
false
208
r
testlist <- list(lims = structure(c(2.63555450669983e-82, Inf), .Dim = 1:2), points = structure(1.29549941127325e-318, .Dim = c(1L, 1L ))) result <- do.call(palm:::pbc_distances,testlist) str(result)
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/utils.R \name{replace_confidential} \alias{replace_confidential} \title{Replace confidential values} \usage{ replace_confidential(.data, replacement_value = NA_integer_) } \arguments{ \item{.data}{The data set to have its confidential values removed.} \item{replacement_value}{The value to replace the confidential ones with. Defaults to NA_integer.} } \description{ The NZ census commonly uses the notation of '..C' when values are below a certain threshold that they may reveal private details of certain individuals. However, it is often required in an analysis to replace these values and convert the column to an integer (to include ..C they need to be character). } \details{ This function takes the data set, and a replacement value and replaces all of the ..C values. Mainly for use within the transform_census function. }
/man/replace_confidential.Rd
permissive
phildonovan/nzcensr
R
false
true
910
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/utils.R \name{replace_confidential} \alias{replace_confidential} \title{Replace confidential values} \usage{ replace_confidential(.data, replacement_value = NA_integer_) } \arguments{ \item{.data}{The data set to have its confidential values removed.} \item{replacement_value}{The value to replace the confidential ones with. Defaults to NA_integer.} } \description{ The NZ census commonly uses the notation of '..C' when values are below a certain threshold that they may reveal private details of certain individuals. However, it is often required in an analysis to replace these values and convert the column to an integer (to include ..C they need to be character). } \details{ This function takes the data set, and a replacement value and replaces all of the ..C values. Mainly for use within the transform_census function. }
# Copyright 2016 Steven E. Pav. All Rights Reserved. # Author: Steven E. Pav # This file is part of fromo. # # fromo is free software: you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # fromo is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public License # along with fromo. If not, see <http://www.gnu.org/licenses/>. # env var: # nb: # see also: # todo: # changelog: # # Created: 2016.03.28 # Copyright: Steven E. Pav, 2016-2016 # Author: Steven E. Pav # Comments: Steven E. Pav # helpers#FOLDUP set.char.seed <- function(str) { set.seed(as.integer(charToRaw(str))) } THOROUGHNESS <- getOption('test.thoroughness',1.0) # slow version of t_running; requires a helper function. slow_op <- function(v,func,outsize=1,missfill=NA, time=NULL,time_deltas=NULL,window=Inf,wts=NULL,lb_time=NULL, na_rm=FALSE,min_df=0,lookahead=0,variable_win=FALSE,wts_as_delta=TRUE,...) { if (is.null(time)) { if (is.null(time_deltas) && !is.null(wts) && wts_as_delta) { time_deltas <- wts } else { stop('bad input') } time <- cumsum(time_deltas) } if (is.null(lb_time)) { lb_time <- time } lb_time <- lb_time + lookahead if (variable_win) { tprev <- c(-Inf,lb_time[1:(length(lb_time)-1)]) } else { tprev <- lb_time - window } # fix weights. sapply(seq_along(lb_time), function(idx) { tf <- lb_time[idx] t0 <- tprev[idx] takeus <- (t0 < time) & (time <= tf) if (na_rm) { takeus <- takeus & !is.na(v) if (!is.null(wts)) { takeus <- takeus & !is.na(wts) } } if (any(takeus)) { vsub <- v[takeus] if (is.null(wts)) { retv <- func(vsub,...) } else { subwts <- wts[takeus] retv <- func(vsub,wts=subwts,...) } } else { retv <- rep(missfill,outsize) } retv }) } slow_t_running_sum <- function(v,...) { func <- function(v,wts=NULL,...) { if (is.null(wts)) { return(prod(sd3(v,...)[c(2:3)])) } return(sum(v*wts)) } as.numeric(slow_op(v=v,func=func,missfill=0,...)) } slow_t_running_mean <- function(v,...) { func <- function(v,...) { sd3(v,...)[2] } as.numeric(slow_op(v=v,func=func,...)) } slow_t_running_sd <- function(v,...) { func <- function(v,...) { sd3(v,...)[1] } matrix(slow_op(v=v,func=func,...),ncol=1) } slow_t_running_skew <- function(v,...) { func <- function(v,...) { return(skew4(v,...)[1]) } matrix(slow_op(v=v,func=func,...),ncol=1) } slow_t_running_kurt <- function(v,...) { func <- function(v,...) { kurt5(v,...)[1] } matrix(slow_op(v=v,func=func,...),ncol=1) } slow_t_running_sd3 <- function(v,...) { func <- function(v,...) { sd3(v,...) } t(slow_op(v=v,func=func,outsize=3,...)) } slow_t_running_skew4 <- function(v,...) { func <- function(v,...) { if (length(v) > 2) { return(skew4(v,...)) } else { return(c(NA,sd3(v,...))) } } t(slow_op(v=v,func=func,outsize=4,...)) } slow_t_running_kurt5 <- function(v,...) { func <- function(v,...) { if (length(v) > 3) { return(kurt5(v,...)) } else if (length(v) > 2) { return(c(NA,skew4(v,...))) } else { return(c(NA,NA,sd3(v,...))) } } t(slow_op(v=v,func=func,outsize=5,...)) } reference_sd <- function(x,wts=NULL,na_rm=FALSE,normalize_wts=FALSE,min_df=0,used_df=1) { if (na_rm) { isok <- !is.na(x) if (!is.null(wts)) { isok <- isok & !is.na(wts) & wts >= 0 } x <- x[isok] if (!is.null(wts)) { wts <- wts[isok] } } if (length(x) < min_df) { return(NA) } if (!is.null(wts)) { wsum <- sum(wts) mu <- sum(x*wts) / wsum deno <- wsum - used_df * ifelse(normalize_wts,wsum / length(x),1) vv <- sum(wts * (x - mu)^2) / deno } else { wsum <- length(x) mu <- sum(x) / wsum vv <- sum((x - mu)^2) / (wsum - used_df) } return(sqrt(vv)) } # not quite the same as slow_t_running_sd above reference_t_running_sd <- function(v,...) { matrix(slow_op(v=v,func=reference_sd,...),ncol=1) } #UNFOLD context("first moments")#FOLDUP test_that("sd, skew, kurt are correct",{#FOLDUP set.char.seed("c4007dba-2010-481e-abe5-f07d3ce94eb4") x <- rnorm(1000) expect_error(sid <- sd3(x),NA) expect_error(ske <- skew4(x),NA) expect_error(krt <- kurt5(x),NA) expect_equal(length(sid),3) expect_equal(length(ske),4) expect_equal(length(krt),5) # compare computations to gold standard # length expect_equal(sid[3],length(x)) expect_equal(sid[3],ske[4]) expect_equal(sid[3],krt[5]) # mean expect_equal(sid[2],mean(x),tolerance=1e-9) expect_equal(sid[2],ske[3],tolerance=1e-9) expect_equal(sid[2],krt[4],tolerance=1e-9) # standard dev expect_equal(sid[1],ske[2],tolerance=1e-9) expect_equal(sid[1],krt[3],tolerance=1e-9) expect_equal(sid[1],sd(x),tolerance=1e-9) # skew expect_equal(ske[1],krt[2],tolerance=1e-9) if (require(moments)) { na_rm <- TRUE dumb_count <- sum(sign(abs(x)+1),na.rm=na_rm) dumb_mean <- mean(x,na.rm=na_rm) dumb_sd <- sd(x,na.rm=na_rm) dumb_skew <- moments::skewness(x,na.rm=na_rm) dumb_exkurt <- moments::kurtosis(x,na.rm=na_rm) - 3.0 dumb_cmom2 <- moments::moment(x,central=TRUE,na.rm=na_rm,order=2) dumb_cmom3 <- moments::moment(x,central=TRUE,na.rm=na_rm,order=3) dumb_cmom4 <- moments::moment(x,central=TRUE,na.rm=na_rm,order=4) dumb_cmom5 <- moments::moment(x,central=TRUE,na.rm=na_rm,order=5) dumb_cmom6 <- moments::moment(x,central=TRUE,na.rm=na_rm,order=6) # skew expect_equal(ske[1],dumb_skew,tolerance=1e-9) # kurtosis expect_equal(krt[1],dumb_exkurt,tolerance=1e-9) # oops. problems with centered moments in terms of the used_df; need a # better test... cmoms <- cent_moments(x,max_order=6,used_df=0) dumbv <- c(dumb_cmom6,dumb_cmom5,dumb_cmom4,dumb_cmom3,dumb_cmom2,dumb_mean,dumb_count) expect_equal(max(abs(cmoms-dumbv)),0,tolerance=1e-9) if (require(PDQutils)) { cumuls <- cent_cumulants(x,max_order=length(cmoms)-1) dumbv0 <- c(dumb_cmom6,dumb_cmom5,dumb_cmom4,dumb_cmom3,dumb_cmom2,dumb_mean,dumb_count) dumbv1 <- PDQutils::moment2cumulant(c(0,rev(dumbv0)[3:length(dumbv0)])) dumbv <- c(rev(dumbv1[2:length(dumbv1)]),dumb_mean,dumb_count) expect_equal(max(abs(cumuls-dumbv)),0,tolerance=1e-12) } } if (require(e1071)) { dumb_skew <- e1071::skewness(x,type=3) equiv_skew <- ske[1] * ((ske[4]-1)/(ske[4]))^(3/2) expect_equal(dumb_skew,equiv_skew,tolerance=1e-12) } # 2FIX: add cent_moments and std_moments # 2FIX: check NA # sentinel expect_true(TRUE) })#UNFOLD test_that("unit weighted sd, skew, kurt are correct",{#FOLDUP set.char.seed("b652ccd2-478b-44d4-90e2-2ca2bad99d25") x <- rnorm(1000) ones <- rep(1,length(x)) expect_equal(sd3(x),sd3(x,wts=ones),tolerance=1e-9) expect_equal(skew4(x),skew4(x,wts=ones),tolerance=1e-9) expect_equal(kurt5(x),kurt5(x,wts=ones),tolerance=1e-9) # 2FIX: probably normalize_wts=FALSE should be the default???? for speed? expect_equal(running_sd(x),running_sd(x,wts=ones,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_skew(x),running_skew(x,wts=ones,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_kurt(x),running_kurt(x,wts=ones,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_sd(x),running_sd(x,wts=ones,normalize_wts=FALSE),tolerance=1e-9) expect_equal(running_skew(x),running_skew(x,wts=ones,normalize_wts=FALSE),tolerance=1e-9) expect_equal(running_kurt(x),running_kurt(x,wts=ones,normalize_wts=FALSE),tolerance=1e-9) # 2FIX: add more. # sentinel expect_true(TRUE) })#UNFOLD test_that("normalize weights works",{#FOLDUP set.char.seed("2694ae87-62d4-4154-9c32-864f9a6e648d") x <- rnorm(25) wts <- runif(length(x)) expect_equal(sd3(x,wts=wts,normalize_wts=TRUE), sd3(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(skew4(x,wts=wts,normalize_wts=TRUE), skew4(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(kurt5(x,wts=wts,normalize_wts=TRUE), kurt5(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_sd(x,wts=wts,normalize_wts=TRUE), running_sd(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_skew(x,wts=wts,normalize_wts=TRUE), running_skew(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_kurt(x,wts=wts,normalize_wts=TRUE), running_kurt(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_sd3(x,wts=wts,normalize_wts=TRUE), running_sd3(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_skew4(x,wts=wts,normalize_wts=TRUE), running_skew4(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_kurt5(x,wts=wts,normalize_wts=TRUE), running_kurt5(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_sharpe(x,wts=wts,normalize_wts=TRUE), running_sharpe(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_sharpe(x,wts=wts,normalize_wts=TRUE,compute_se=TRUE), running_sharpe(x,wts=2*wts,normalize_wts=TRUE,compute_se=TRUE),tolerance=1e-9) expect_equal(running_centered(x,wts=wts,normalize_wts=TRUE), running_centered(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_apx_median(x,wts=wts,normalize_wts=TRUE), running_apx_median(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_tstat(x,wts=wts,normalize_wts=TRUE), running_tstat(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_zscored(x,wts=wts,normalize_wts=TRUE), running_zscored(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_scaled(x,wts=wts,normalize_wts=TRUE), running_scaled(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) ptiles <- c(0.1,0.25,0.5,0.75,0.9) expect_equal(running_apx_quantiles(x,p=ptiles,wts=wts,normalize_wts=TRUE), running_apx_quantiles(x,p=ptiles,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_cent_moments(x,wts=wts,normalize_wts=TRUE), running_cent_moments(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_std_moments(x,wts=wts,normalize_wts=TRUE), running_std_moments(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_cumulants(x,wts=wts,normalize_wts=TRUE), running_cumulants(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) })#UNFOLD test_that("weight scaling what you expect",{#FOLDUP set.char.seed("efaa75ac-bb9e-4e4a-a375-7028f099366e") x <- rnorm(50) wts <- runif(length(x)) expect_error(sid_1 <- sd3(x,wts=wts,normalize_wts=FALSE,sg_df=0),NA) expect_error(ske_1 <- skew4(x,wts=wts,normalize_wts=FALSE,sg_df=0),NA) expect_error(krt_1 <- kurt5(x,wts=wts,normalize_wts=FALSE,sg_df=0),NA) expect_error(sid_2 <- sd3(x,wts=2*wts,normalize_wts=FALSE,sg_df=0),NA) expect_error(ske_2 <- skew4(x,wts=2*wts,normalize_wts=FALSE,sg_df=0),NA) expect_error(krt_2 <- kurt5(x,wts=2*wts,normalize_wts=FALSE,sg_df=0),NA) expect_equal(sid_1 * c(1,1,2),sid_2,tolerance=1e-9) expect_equal(ske_1 * c(1,1,1,2),ske_2,tolerance=1e-9) expect_equal(krt_1 * c(1,1,1,1,2),krt_2,tolerance=1e-9) })#UNFOLD test_that("weighted sd, skew, kurt are correct",{#FOLDUP set.char.seed("4e17d837-69c1-41d1-906f-c82224d7ce41") x <- rnorm(1000) wts <- runif(length(x)) expect_error(sid <- sd3(x,wts=wts,normalize_wts=TRUE),NA) expect_error(ske <- skew4(x,wts=wts,normalize_wts=TRUE),NA) expect_error(krt <- kurt5(x,wts=wts,normalize_wts=TRUE),NA) # 2FIX: add more here to check correctness ... expect_equal(length(sid),3) expect_equal(length(ske),4) expect_equal(length(krt),5) # compare computations to gold standard # length expect_equal(sid[3],length(x)) expect_equal(sid[3],ske[4]) expect_equal(sid[3],krt[5]) # mean expect_equal(sid[2],weighted.mean(x,w=wts),tolerance=1e-9) expect_equal(sid[2],ske[3],tolerance=1e-9) expect_equal(sid[2],krt[4],tolerance=1e-9) # standard dev expect_equal(sid[1],ske[2],tolerance=1e-9) expect_equal(sid[1],krt[3],tolerance=1e-9) wsd <- sqrt(sum(((x - weighted.mean(x,w=wts))^2) * (wts / mean(wts))) / (length(x) - 1)) # 2FIX!!! expect_equal(sid[1],wsd,tolerance=1e-9) # skew expect_equal(ske[1],krt[2],tolerance=1e-9) na_rm <- TRUE dumb_count <- length(x) dumb_mean <- weighted.mean(x,w=wts) dumb_sd <- sqrt(sum(((x - weighted.mean(x,w=wts))^2) * (wts / mean(wts))) / (length(x) - 1)) wcmom <- function(vec,wts,ord) { wz <- wts / mean(wts) mean(wz * ((x - weighted.mean(x,w=wz))^ord)) } dumb_wcmom2 <- wcmom(x,wts,2) dumb_wcmom3 <- wcmom(x,wts,3) dumb_wcmom4 <- wcmom(x,wts,4) dumb_wcmom5 <- wcmom(x,wts,5) dumb_wcmom6 <- wcmom(x,wts,6) cmoms <- cent_moments(x,wts=wts,max_order=6,used_df=0,normalize_wts=TRUE) dumbv <- c(dumb_wcmom6,dumb_wcmom5,dumb_wcmom4,dumb_wcmom3,dumb_wcmom2,dumb_mean,dumb_count) expect_equal(cmoms,dumbv,tolerance=1e-9) dumb_skew <- dumb_wcmom3 / (dumb_wcmom2^(3/2)) dumb_exkurt <- (dumb_wcmom4 / (dumb_wcmom2^(2))) - 3 # skew expect_equal(ske[1],dumb_skew,tolerance=1e-9) # kurtosis expect_equal(krt[1],dumb_exkurt,tolerance=1e-9) })#UNFOLD #UNFOLD tomat <- function(cbound) { dumbv <- as.matrix(cbound) attr(dumbv,'dimnames') <- NULL dumbv } context("running ops are correct") test_that("running ops are correct",{#FOLDUP skip_on_cran() ptiles <- c(0.1,0.25,0.5,0.75,0.9) set.char.seed("7ffe0035-2d0c-4586-a1a5-6321c7cf8694") for (xlen in c(20,100)) { for (xmu in c(1e3,1e6)) { toler <- xmu ^ (1/3) x <- rnorm(xlen,mean=xmu) for (window in c(15,50,Inf)) { for (restart_period in c(20,1000)) { for (na_rm in c(FALSE,TRUE)) { dumb_count <- sapply(seq_along(x),function(iii) { sum(sign(abs(x[max(1,iii-window+1):iii])+1),na.rm=na_rm) },simplify=TRUE) dumb_sum <- sapply(seq_along(x),function(iii) { sum(x[max(1,iii-window+1):iii],na.rm=na_rm) },simplify=TRUE) dumb_mean <- sapply(seq_along(x),function(iii) { mean(x[max(1,iii-window+1):iii],na.rm=na_rm) },simplify=TRUE) dumb_sd <- sapply(seq_along(x),function(iii) { sd(x[max(1,iii-window+1):iii],na.rm=na_rm) },simplify=TRUE) dumb_skew <- sapply(seq_along(x),function(iii) { moments::skewness(x[max(1,iii-window+1):iii],na.rm=na_rm) },simplify=TRUE) dumb_exkurt <- sapply(seq_along(x),function(iii) { moments::kurtosis(x[max(1,iii-window+1):iii],na.rm=na_rm) - 3.0 },simplify=TRUE) dumb_cmom2 <- sapply(seq_along(x),function(iii) { moments::moment(x[max(1,iii-window+1):iii],central=TRUE,na.rm=na_rm,order=2) },simplify=TRUE) dumb_cmom3 <- sapply(seq_along(x),function(iii) { moments::moment(x[max(1,iii-window+1):iii],central=TRUE,na.rm=na_rm,order=3) },simplify=TRUE) dumb_cmom4 <- sapply(seq_along(x),function(iii) { moments::moment(x[max(1,iii-window+1):iii],central=TRUE,na.rm=na_rm,order=4) },simplify=TRUE) dumb_cmom5 <- sapply(seq_along(x),function(iii) { moments::moment(x[max(1,iii-window+1):iii],central=TRUE,na.rm=na_rm,order=5) },simplify=TRUE) dumb_cmom6 <- sapply(seq_along(x),function(iii) { moments::moment(x[max(1,iii-window+1):iii],central=TRUE,na.rm=na_rm,order=6) },simplify=TRUE) # SD expect_error(fastv <- running_sd(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(dumb_sd) expect_equal(dumbv[2:xlen],fastv[2:xlen],tolerance=1e-7 * toler) expect_error(fastv <- running_sd3(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(cbind(dumb_sd,dumb_mean,dumb_count)) expect_equal(dumbv[2:xlen,],fastv[2:xlen,],tolerance=1e-7 * toler) # skew expect_error(fastv <- running_skew(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(dumb_skew) expect_equal(dumbv[3:xlen],fastv[3:xlen],tolerance=1e-6 * toler) expect_error(fastv <- running_skew4(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(cbind(dumb_skew,dumb_sd,dumb_mean,dumb_count)) expect_equal(dumbv[3:xlen,],fastv[3:xlen,],tolerance=1e-7 * toler) # excess kurtosis expect_error(fastv <- running_kurt(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(dumb_exkurt) expect_equal(dumbv[4:xlen],fastv[4:xlen],tolerance=1e-6 * toler) expect_error(fastv <- running_kurt5(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(cbind(dumb_exkurt,dumb_skew,dumb_sd,dumb_mean,dumb_count)) expect_equal(dumbv[4:xlen,],fastv[4:xlen,],tolerance=1e-6 * toler) # higher order moments expect_error(fastv <- running_cent_moments(x,window=window,max_order=6L,used_df=0L,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(cbind(dumb_cmom6,dumb_cmom5,dumb_cmom4,dumb_cmom3,dumb_cmom2,dumb_mean,dumb_count)) expect_equal(dumbv[6:xlen,],fastv[6:xlen,],tolerance=1e-6 * toler) expect_error(fastv <- running_cent_moments(x,window=window,max_order=6L,max_order_only=TRUE,used_df=0L,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(dumb_cmom6) expect_equal(dumbv[6:xlen,],fastv[6:xlen,],tolerance=1e-7 * toler) expect_error(fastv <- running_std_moments(x,window=window,max_order=6L,used_df=0L,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(cbind(dumb_cmom6 / (dumb_cmom2^3),dumb_cmom5 / (dumb_cmom2^2.5),dumb_cmom4 / (dumb_cmom2^2.0),dumb_cmom3 / (dumb_cmom2^1.5),sqrt(dumb_cmom2),dumb_mean,dumb_count)) expect_equal(dumbv[6:xlen,],fastv[6:xlen,],tolerance=1e-7 * toler) # running sum and mean expect_error(fastv <- running_sum(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- dumb_sum expect_equal(dumbv[2:xlen],fastv[2:xlen],tolerance=1e-7 * toler) expect_error(fastv <- running_mean(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- dumb_mean expect_equal(dumbv[2:xlen],fastv[2:xlen],tolerance=1e-7 * toler) if (require(PDQutils)) { # cumulants expect_error(fastv <- running_cumulants(x,window=window,max_order=6L,used_df=0L,restart_period=restart_period,na_rm=na_rm),NA) pre_dumbv <- cbind(dumb_cmom6,dumb_cmom5,dumb_cmom4,dumb_cmom3,dumb_cmom2,dumb_mean,dumb_count) dumbv <- t(sapply(seq_along(x),function(iii) { rv <- rev(PDQutils::moment2cumulant(c(0,rev(pre_dumbv[iii,1:(ncol(pre_dumbv)-2)])))) rv <- rv[-length(rv)] c(rv,pre_dumbv[iii,ncol(pre_dumbv) + (-1:0)]) },simplify='matrix')) expect_equal(max(abs(dumbv[6:xlen,] - fastv[6:xlen,])),0,tolerance=1e-8 * toler) # quantiles expect_error(fastv <- running_apx_quantiles(x,ptiles,max_order=ncol(dumbv)-1,used_df=0L,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbq <- t(sapply(seq_along(x),function(iii) { PDQutils::qapx_cf(ptiles,raw.cumulants=rev(dumbv[iii,1:(ncol(dumbv)-1)])) }, simplify=TRUE)) expect_equal(max(abs(dumbq[8:xlen,] - fastv[8:xlen,])),0,tolerance=1e-8 * toler) } } } } } } })#UNFOLD test_that("running adjustments are correct",{#FOLDUP skip_on_cran() set.char.seed("967d2149-fbff-4d82-b227-ca3e1034bddb") for (xlen in c(20,100)) { x <- rnorm(xlen) for (window in c(5,50,Inf)) { for (restart_period in c(10,1000)) { for (na_rm in c(FALSE,TRUE)) { dumb_count <- sapply(seq_along(x),function(iii) { sum(sign(abs(x[max(1,iii-window+1):iii])+1),na.rm=na_rm) },simplify=TRUE) dumb_mean <- sapply(seq_along(x),function(iii) { mean(x[max(1,iii-window+1):iii],na.rm=na_rm) },simplify=TRUE) dumb_sd <- sapply(seq_along(x),function(iii) { sd(x[max(1,iii-window+1):iii],na.rm=na_rm) },simplify=TRUE) expect_error(fastv <- running_centered(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) # the dumb value: dumbv <- x - dumb_mean; expect_equal(max(abs(dumbv - fastv)),0,tolerance=1e-12) expect_error(fastv <- running_scaled(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) # the dumb value: dumbv <- x / dumb_sd expect_equal(max(abs(dumbv[2:length(x)] - fastv[2:length(x)])),0,tolerance=1e-12) expect_error(fastv <- running_zscored(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) # the dumb value: dumbv <- (x - dumb_mean) / dumb_sd expect_equal(max(abs(dumbv[2:length(x)] - fastv[2:length(x)])),0,tolerance=1e-12) expect_error(fastv <- running_sharpe(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) # the dumb value: dumbv <- dumb_mean / dumb_sd expect_equal(max(abs(dumbv[2:length(x)] - fastv[2:length(x)])),0,tolerance=1e-12) expect_error(fastv <- running_tstat(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) # the dumb value: dumbv <- (dumb_mean * sqrt(dumb_count)) / dumb_sd expect_equal(max(abs(dumbv[2:length(x)] - fastv[2:length(x)])),0,tolerance=1e-12) expect_error(fastv <- running_sharpe(x,window=window,restart_period=restart_period,na_rm=na_rm,compute_se=TRUE),NA) # the dumb value: dumb_sr <- dumb_mean / dumb_sd expect_equal(max(abs(dumb_sr[2:length(x)] - fastv[2:length(x),1])),0,tolerance=1e-12) if (require(moments)) { dumb_skew <- sapply(seq_along(x),function(iii) { moments::skewness(x[max(1,iii-window+1):iii],na.rm=na_rm) },simplify=TRUE) dumb_exkurt <- sapply(seq_along(x),function(iii) { moments::kurtosis(x[max(1,iii-window+1):iii],na.rm=na_rm) - 3.0 },simplify=TRUE) dumb_merse <- sqrt((1 + 0.25 * (2+dumb_exkurt) * dumb_sr^2 - dumb_skew * dumb_sr) / dumb_count) expect_equal(max(abs(dumb_merse[5:length(x)] - fastv[5:length(x),2])),0,tolerance=1e-9) } } } } } })#UNFOLD context("weighted running ops are correct") test_that("running weights work correctly",{#FOLDUP skip_on_cran() set.char.seed("b82d252c-681b-4b98-9bb3-ffd17feeb4a1") na_rm <- FALSE restart_period <- 1000 for (xlen in c(20,50)) { x <- rnorm(xlen) for (wts in list(rep(1L,xlen), runif(xlen,min=2,max=7))) { for (window in c(5,30,Inf)) { # FOLDUP # 2FIX: add to this! slow_count <- sapply(seq_along(x),function(iii) { sum(sign(abs(x[max(1,iii-window+1):iii])+1),na.rm=na_rm) },simplify=TRUE) slow_sumwt <- sapply(seq_along(x),function(iii) { sum(wts[max(1,iii-window+1):iii],na.rm=na_rm) },simplify=TRUE) slow_mean <- sapply(seq_along(x),function(iii) { mydx <- max(1,iii-window+1):iii mywts <- wts[mydx] sum(mywts * x[mydx],na.rm=na_rm) / slow_sumwt[iii] },simplify=TRUE) slow_var <- sapply(seq_along(x),function(iii) { mydx <- max(1,iii-window+1):iii mywts <- wts[mydx] sum(mywts * (x[mydx] - slow_mean[iii])^2,na.rm=na_rm) / (slow_sumwt[iii] - 1) },simplify=TRUE) slow_sd <- sqrt(slow_var) # the normalize version; slow_nvar <- sapply(seq_along(x),function(iii) { mydx <- max(1,iii-window+1):iii mywts <- wts[mydx] (slow_count[iii]/slow_sumwt[iii]) * sum(mywts * (x[mydx] - slow_mean[iii])^2,na.rm=na_rm) / (slow_count[iii] - 1) },simplify=TRUE) slow_nsd <- sqrt(slow_nvar) slow_cent3 <- sapply(seq_along(x),function(iii) { mydx <- max(1,iii-window+1):iii mywts <- wts[mydx] sum(mywts * (x[mydx] - slow_mean[iii])^3,na.rm=na_rm) / (slow_sumwt[iii]) },simplify=TRUE) slow_cent4 <- sapply(seq_along(x),function(iii) { mydx <- max(1,iii-window+1):iii mywts <- wts[mydx] sum(mywts * (x[mydx] - slow_mean[iii])^4,na.rm=na_rm) / (slow_sumwt[iii]) },simplify=TRUE) expect_error(fastv <- running_mean(x,wts=wts,min_df=0,window=window,na_rm=na_rm),NA) expect_equal(fastv,slow_mean,tolerance=1e-8) expect_error(fastv <- running_centered(x,wts=wts,window=window,restart_period=restart_period,na_rm=na_rm),NA) slowv <- x - slow_mean; expect_equal(as.numeric(fastv),slowv,tolerance=1e-8) for (nw in c(TRUE,FALSE)) { if (nw) { use_sd <- slow_nsd use_df <- slow_count } else { use_sd <- slow_sd use_df <- slow_sumwt } expect_error(fastv <- running_sd(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(as.numeric(fastv),use_sd,tolerance=1e-8) expect_error(fastv <- running_sd3(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(as.numeric(fastv[,1]),use_sd,tolerance=1e-8) expect_equal(as.numeric(fastv[,2]),slow_mean,tolerance=1e-8) expect_equal(as.numeric(fastv[,3]),use_df,tolerance=1e-8) expect_error(fastv <- running_scaled(x,wts=wts,window=window,restart_period=restart_period,na_rm=na_rm,normalize_wts=nw),NA) slowv <- x / use_sd expect_equal(as.numeric(fastv[2:length(x)]),slowv[2:length(x)],tolerance=1e-8) expect_error(fastv <- running_zscored(x,wts=wts,window=window,restart_period=restart_period,na_rm=na_rm,normalize_wts=nw),NA) slowv <- (x - slow_mean) / use_sd expect_equal(slowv[2:length(x)],fastv[2:length(x)],tolerance=1e-12) expect_error(fastv <- running_sharpe(x,wts=wts,window=window,restart_period=restart_period,na_rm=na_rm,normalize_wts=nw),NA) slowv <- slow_mean / use_sd expect_equal(slowv[2:length(x)],fastv[2:length(x)],tolerance=1e-12) expect_error(fastv <- running_tstat(x,wts=wts,window=window,restart_period=restart_period,na_rm=na_rm,normalize_wts=nw),NA) slowv <- (slow_mean * sqrt(use_df)) / use_sd expect_equal(slowv[2:length(x)],fastv[2:length(x)],tolerance=1e-12) expect_error(fastv <- running_cent_moments(x,wts=wts,window=window,max_order=3L,max_order_only=TRUE,restart_period=restart_period,na_rm=na_rm,normalize_wts=nw),NA) slowv <- slow_cent3 expect_equal(slowv[3:length(x)],fastv[3:length(x)],tolerance=1e-12) expect_error(fastv <- running_cent_moments(x,wts=wts,window=window,max_order=4L,max_order_only=TRUE,restart_period=restart_period,na_rm=na_rm,normalize_wts=nw),NA) slowv <- slow_cent4 expect_equal(slowv[4:length(x)],fastv[4:length(x)],tolerance=1e-12) } }# UNFOLD } } })#UNFOLD context("t_running for trivial case") test_that("vs running ops",{#FOLDUP skip_on_cran() set.char.seed("712463ec-f266-4de7-89d2-ce3c824327b0") na_rm <- FALSE ptiles <- c(0.1,0.25,0.5,0.75,0.9) for (xlen in c(20,50)) { x <- rnorm(xlen) times <- seq_along(x) for (wts in list(NULL,rep(1L,xlen), runif(xlen,min=1.2,max=3.5))) { # 2FIX? Inf window? for (window in c(5,30,Inf)) { # FOLDUP # to avoid roundoff issues on double times. t_window <- window - 0.1 expect_error(box <- running_sum(x,wts=wts,window=window,na_rm=na_rm),NA) expect_error(tbox <- t_running_sum(x,time=times,wts=wts,window=t_window,na_rm=na_rm),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_mean(x,wts=wts,min_df=0,window=window,na_rm=na_rm),NA) expect_error(tbox <- t_running_mean(x,time=times,wts=wts,min_df=0,window=t_window,na_rm=na_rm),NA) expect_equal(box,tbox,tolerance=1e-8) for (nw in c(TRUE,FALSE)) { expect_error(box <- running_sd(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) expect_error(tbox <- t_running_sd(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_skew(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_skew(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_kurt(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_kurt(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_sd3(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_sd3(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_skew4(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_skew4(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_kurt5(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_kurt5(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_centered(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_centered(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_scaled(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_scaled(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_zscored(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_zscored(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_tstat(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_tstat(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) for (cse in c(TRUE,FALSE)) { expect_error(box <- running_sharpe(x,wts=wts,window=window,na_rm=na_rm,compute_se=cse,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_sharpe(x,time=times,wts=wts,window=t_window,na_rm=na_rm,compute_se=cse,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) } expect_error(box <- running_apx_median(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_apx_median(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_apx_quantiles(x,ptiles,max_order=3,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_apx_quantiles(x,ptiles,max_order=3,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) } }# UNFOLD } } })#UNFOLD context("t_running vs slow version") test_that("check em",{#FOLDUP skip_on_cran() set.char.seed("91b0bd37-0b8e-49d6-8333-039a7d7f7dd5") na_rm <- FALSE for (xlen in c(40,90)) {# FOLDUP x <- rnorm(xlen) for (times in list(NULL,cumsum(runif(length(x),min=0.2,max=0.4)))) { for (wts in list(NULL,rep(1L,xlen),runif(xlen,min=1.1,max=2.1))) { wts_as_delta <- is.null(times) & !is.null(wts) if (!is.null(times) || (wts_as_delta && !is.null(wts))) { for (window in c(11.5,20.5,Inf)) { # FOLDUP for (lb_time in list(NULL,3+cumsum(runif(10,min=0.4,max=1.1)))) { slow <- slow_t_running_sum(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta) expect_error(fast <- t_running_sum(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta),NA) expect_equal(fast,slow,tolerance=1e-8) slow <- slow_t_running_mean(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta) expect_error(fast <- t_running_mean(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta),NA) expect_equal(fast,slow,tolerance=1e-8) for (nw in c(TRUE,FALSE)) { slow <- slow_t_running_sd(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta,normalize_wts=nw) expect_error(fast <- t_running_sd(x,time=times,wts=wts,window=window,lb_time=lb_time,min_df=1,na_rm=na_rm,wts_as_delta=wts_as_delta,normalize_wts=nw),NA) expect_equal(fast,slow,tolerance=1e-8) slow <- slow_t_running_skew(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta,normalize_wts=nw) expect_error(fast <- t_running_skew(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta,normalize_wts=nw),NA) expect_equal(fast,slow,tolerance=1e-8) slow <- slow_t_running_kurt(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta,normalize_wts=nw) expect_error(fast <- t_running_kurt(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta,normalize_wts=nw),NA) expect_equal(fast,slow,tolerance=1e-8) slow <- slow_t_running_sd3(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta,normalize_wts=nw) expect_error(fast <- t_running_sd3(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta,normalize_wts=nw),NA) # ignore the df computation in slow when empty slow[fast[,3]==0,3] <- 0 slow[is.na(fast[,1]),1] <- NA expect_equal(fast,slow,tolerance=1e-8) slow <- slow_t_running_skew4(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,normalize_wts=nw) expect_error(fast <- t_running_skew4(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,normalize_wts=nw),NA) # ignore the df computation in slow when empty okrow <- !is.na(fast[,4]) & fast[,4] > 3 & row(fast)[,4] > 3 expect_equal(fast[okrow,],slow[okrow,],tolerance=1e-8) slow <- slow_t_running_kurt5(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,normalize_wts=nw) expect_error(fast <- t_running_kurt5(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,normalize_wts=nw),NA) okrow <- !is.na(fast[,5]) & fast[,5] > 4 & row(fast)[,5] > 4 expect_equal(fast[okrow,],slow[okrow,],tolerance=1e-8) } } }# UNFOLD } } } }# UNFOLD })#UNFOLD context("t_running_sd") # t_running_sd is a bellwether for the other methods # as it goes, so goes the other Welford based functions test_that("check it",{#FOLDUP skip_on_cran() set.char.seed("79f60eda-7799-46e6-9096-6817b2d4473b") na_rm <- FALSE for (xlen in c(20,50)) {# FOLDUP x <- rnorm(xlen) for (times in list(NULL,cumsum(runif(length(x),min=0.2,max=0.4)))) { for (wts in list(NULL,rep(1L,xlen),runif(xlen,min=1.2,max=2.1))) { wts_as_delta <- is.null(times) & !is.null(wts) if (!is.null(times) || (wts_as_delta && !is.null(wts))) { for (window in c(11.5,20.5,Inf)) { # FOLDUP for (lb_time in list(NULL,cumsum(runif(20,min=0.2,max=1)))) { for (nw in c(TRUE,FALSE)) { expect_error(slow <- reference_t_running_sd(x,time=times,wts=wts,wts_as_delta=TRUE,window=window,lb_time=lb_time,na_rm=na_rm,min_df=1,normalize_wts=nw),NA) expect_error(fast <- t_running_sd(x,time=times,wts=wts,wts_as_delta=TRUE,used_df=1,window=window,lb_time=lb_time,min_df=1,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(fast,slow,tolerance=1e-7) } } }# UNFOLD } } } }# UNFOLD })#UNFOLD #for vim modeline: (do not edit) # vim:ts=2:sw=2:tw=79:fdm=marker:fmr=FOLDUP,UNFOLD:cms=#%s:syn=r:ft=r:ai:si:cin:nu:fo=croql:cino=p0t0c5(0:
/tests/testthat/test-correctness.r
no_license
shabbychef/fromo
R
false
false
36,785
r
# Copyright 2016 Steven E. Pav. All Rights Reserved. # Author: Steven E. Pav # This file is part of fromo. # # fromo is free software: you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # fromo is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public License # along with fromo. If not, see <http://www.gnu.org/licenses/>. # env var: # nb: # see also: # todo: # changelog: # # Created: 2016.03.28 # Copyright: Steven E. Pav, 2016-2016 # Author: Steven E. Pav # Comments: Steven E. Pav # helpers#FOLDUP set.char.seed <- function(str) { set.seed(as.integer(charToRaw(str))) } THOROUGHNESS <- getOption('test.thoroughness',1.0) # slow version of t_running; requires a helper function. slow_op <- function(v,func,outsize=1,missfill=NA, time=NULL,time_deltas=NULL,window=Inf,wts=NULL,lb_time=NULL, na_rm=FALSE,min_df=0,lookahead=0,variable_win=FALSE,wts_as_delta=TRUE,...) { if (is.null(time)) { if (is.null(time_deltas) && !is.null(wts) && wts_as_delta) { time_deltas <- wts } else { stop('bad input') } time <- cumsum(time_deltas) } if (is.null(lb_time)) { lb_time <- time } lb_time <- lb_time + lookahead if (variable_win) { tprev <- c(-Inf,lb_time[1:(length(lb_time)-1)]) } else { tprev <- lb_time - window } # fix weights. sapply(seq_along(lb_time), function(idx) { tf <- lb_time[idx] t0 <- tprev[idx] takeus <- (t0 < time) & (time <= tf) if (na_rm) { takeus <- takeus & !is.na(v) if (!is.null(wts)) { takeus <- takeus & !is.na(wts) } } if (any(takeus)) { vsub <- v[takeus] if (is.null(wts)) { retv <- func(vsub,...) } else { subwts <- wts[takeus] retv <- func(vsub,wts=subwts,...) } } else { retv <- rep(missfill,outsize) } retv }) } slow_t_running_sum <- function(v,...) { func <- function(v,wts=NULL,...) { if (is.null(wts)) { return(prod(sd3(v,...)[c(2:3)])) } return(sum(v*wts)) } as.numeric(slow_op(v=v,func=func,missfill=0,...)) } slow_t_running_mean <- function(v,...) { func <- function(v,...) { sd3(v,...)[2] } as.numeric(slow_op(v=v,func=func,...)) } slow_t_running_sd <- function(v,...) { func <- function(v,...) { sd3(v,...)[1] } matrix(slow_op(v=v,func=func,...),ncol=1) } slow_t_running_skew <- function(v,...) { func <- function(v,...) { return(skew4(v,...)[1]) } matrix(slow_op(v=v,func=func,...),ncol=1) } slow_t_running_kurt <- function(v,...) { func <- function(v,...) { kurt5(v,...)[1] } matrix(slow_op(v=v,func=func,...),ncol=1) } slow_t_running_sd3 <- function(v,...) { func <- function(v,...) { sd3(v,...) } t(slow_op(v=v,func=func,outsize=3,...)) } slow_t_running_skew4 <- function(v,...) { func <- function(v,...) { if (length(v) > 2) { return(skew4(v,...)) } else { return(c(NA,sd3(v,...))) } } t(slow_op(v=v,func=func,outsize=4,...)) } slow_t_running_kurt5 <- function(v,...) { func <- function(v,...) { if (length(v) > 3) { return(kurt5(v,...)) } else if (length(v) > 2) { return(c(NA,skew4(v,...))) } else { return(c(NA,NA,sd3(v,...))) } } t(slow_op(v=v,func=func,outsize=5,...)) } reference_sd <- function(x,wts=NULL,na_rm=FALSE,normalize_wts=FALSE,min_df=0,used_df=1) { if (na_rm) { isok <- !is.na(x) if (!is.null(wts)) { isok <- isok & !is.na(wts) & wts >= 0 } x <- x[isok] if (!is.null(wts)) { wts <- wts[isok] } } if (length(x) < min_df) { return(NA) } if (!is.null(wts)) { wsum <- sum(wts) mu <- sum(x*wts) / wsum deno <- wsum - used_df * ifelse(normalize_wts,wsum / length(x),1) vv <- sum(wts * (x - mu)^2) / deno } else { wsum <- length(x) mu <- sum(x) / wsum vv <- sum((x - mu)^2) / (wsum - used_df) } return(sqrt(vv)) } # not quite the same as slow_t_running_sd above reference_t_running_sd <- function(v,...) { matrix(slow_op(v=v,func=reference_sd,...),ncol=1) } #UNFOLD context("first moments")#FOLDUP test_that("sd, skew, kurt are correct",{#FOLDUP set.char.seed("c4007dba-2010-481e-abe5-f07d3ce94eb4") x <- rnorm(1000) expect_error(sid <- sd3(x),NA) expect_error(ske <- skew4(x),NA) expect_error(krt <- kurt5(x),NA) expect_equal(length(sid),3) expect_equal(length(ske),4) expect_equal(length(krt),5) # compare computations to gold standard # length expect_equal(sid[3],length(x)) expect_equal(sid[3],ske[4]) expect_equal(sid[3],krt[5]) # mean expect_equal(sid[2],mean(x),tolerance=1e-9) expect_equal(sid[2],ske[3],tolerance=1e-9) expect_equal(sid[2],krt[4],tolerance=1e-9) # standard dev expect_equal(sid[1],ske[2],tolerance=1e-9) expect_equal(sid[1],krt[3],tolerance=1e-9) expect_equal(sid[1],sd(x),tolerance=1e-9) # skew expect_equal(ske[1],krt[2],tolerance=1e-9) if (require(moments)) { na_rm <- TRUE dumb_count <- sum(sign(abs(x)+1),na.rm=na_rm) dumb_mean <- mean(x,na.rm=na_rm) dumb_sd <- sd(x,na.rm=na_rm) dumb_skew <- moments::skewness(x,na.rm=na_rm) dumb_exkurt <- moments::kurtosis(x,na.rm=na_rm) - 3.0 dumb_cmom2 <- moments::moment(x,central=TRUE,na.rm=na_rm,order=2) dumb_cmom3 <- moments::moment(x,central=TRUE,na.rm=na_rm,order=3) dumb_cmom4 <- moments::moment(x,central=TRUE,na.rm=na_rm,order=4) dumb_cmom5 <- moments::moment(x,central=TRUE,na.rm=na_rm,order=5) dumb_cmom6 <- moments::moment(x,central=TRUE,na.rm=na_rm,order=6) # skew expect_equal(ske[1],dumb_skew,tolerance=1e-9) # kurtosis expect_equal(krt[1],dumb_exkurt,tolerance=1e-9) # oops. problems with centered moments in terms of the used_df; need a # better test... cmoms <- cent_moments(x,max_order=6,used_df=0) dumbv <- c(dumb_cmom6,dumb_cmom5,dumb_cmom4,dumb_cmom3,dumb_cmom2,dumb_mean,dumb_count) expect_equal(max(abs(cmoms-dumbv)),0,tolerance=1e-9) if (require(PDQutils)) { cumuls <- cent_cumulants(x,max_order=length(cmoms)-1) dumbv0 <- c(dumb_cmom6,dumb_cmom5,dumb_cmom4,dumb_cmom3,dumb_cmom2,dumb_mean,dumb_count) dumbv1 <- PDQutils::moment2cumulant(c(0,rev(dumbv0)[3:length(dumbv0)])) dumbv <- c(rev(dumbv1[2:length(dumbv1)]),dumb_mean,dumb_count) expect_equal(max(abs(cumuls-dumbv)),0,tolerance=1e-12) } } if (require(e1071)) { dumb_skew <- e1071::skewness(x,type=3) equiv_skew <- ske[1] * ((ske[4]-1)/(ske[4]))^(3/2) expect_equal(dumb_skew,equiv_skew,tolerance=1e-12) } # 2FIX: add cent_moments and std_moments # 2FIX: check NA # sentinel expect_true(TRUE) })#UNFOLD test_that("unit weighted sd, skew, kurt are correct",{#FOLDUP set.char.seed("b652ccd2-478b-44d4-90e2-2ca2bad99d25") x <- rnorm(1000) ones <- rep(1,length(x)) expect_equal(sd3(x),sd3(x,wts=ones),tolerance=1e-9) expect_equal(skew4(x),skew4(x,wts=ones),tolerance=1e-9) expect_equal(kurt5(x),kurt5(x,wts=ones),tolerance=1e-9) # 2FIX: probably normalize_wts=FALSE should be the default???? for speed? expect_equal(running_sd(x),running_sd(x,wts=ones,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_skew(x),running_skew(x,wts=ones,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_kurt(x),running_kurt(x,wts=ones,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_sd(x),running_sd(x,wts=ones,normalize_wts=FALSE),tolerance=1e-9) expect_equal(running_skew(x),running_skew(x,wts=ones,normalize_wts=FALSE),tolerance=1e-9) expect_equal(running_kurt(x),running_kurt(x,wts=ones,normalize_wts=FALSE),tolerance=1e-9) # 2FIX: add more. # sentinel expect_true(TRUE) })#UNFOLD test_that("normalize weights works",{#FOLDUP set.char.seed("2694ae87-62d4-4154-9c32-864f9a6e648d") x <- rnorm(25) wts <- runif(length(x)) expect_equal(sd3(x,wts=wts,normalize_wts=TRUE), sd3(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(skew4(x,wts=wts,normalize_wts=TRUE), skew4(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(kurt5(x,wts=wts,normalize_wts=TRUE), kurt5(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_sd(x,wts=wts,normalize_wts=TRUE), running_sd(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_skew(x,wts=wts,normalize_wts=TRUE), running_skew(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_kurt(x,wts=wts,normalize_wts=TRUE), running_kurt(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_sd3(x,wts=wts,normalize_wts=TRUE), running_sd3(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_skew4(x,wts=wts,normalize_wts=TRUE), running_skew4(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_kurt5(x,wts=wts,normalize_wts=TRUE), running_kurt5(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_sharpe(x,wts=wts,normalize_wts=TRUE), running_sharpe(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_sharpe(x,wts=wts,normalize_wts=TRUE,compute_se=TRUE), running_sharpe(x,wts=2*wts,normalize_wts=TRUE,compute_se=TRUE),tolerance=1e-9) expect_equal(running_centered(x,wts=wts,normalize_wts=TRUE), running_centered(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_apx_median(x,wts=wts,normalize_wts=TRUE), running_apx_median(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_tstat(x,wts=wts,normalize_wts=TRUE), running_tstat(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_zscored(x,wts=wts,normalize_wts=TRUE), running_zscored(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_scaled(x,wts=wts,normalize_wts=TRUE), running_scaled(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) ptiles <- c(0.1,0.25,0.5,0.75,0.9) expect_equal(running_apx_quantiles(x,p=ptiles,wts=wts,normalize_wts=TRUE), running_apx_quantiles(x,p=ptiles,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_cent_moments(x,wts=wts,normalize_wts=TRUE), running_cent_moments(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_std_moments(x,wts=wts,normalize_wts=TRUE), running_std_moments(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) expect_equal(running_cumulants(x,wts=wts,normalize_wts=TRUE), running_cumulants(x,wts=2*wts,normalize_wts=TRUE),tolerance=1e-9) })#UNFOLD test_that("weight scaling what you expect",{#FOLDUP set.char.seed("efaa75ac-bb9e-4e4a-a375-7028f099366e") x <- rnorm(50) wts <- runif(length(x)) expect_error(sid_1 <- sd3(x,wts=wts,normalize_wts=FALSE,sg_df=0),NA) expect_error(ske_1 <- skew4(x,wts=wts,normalize_wts=FALSE,sg_df=0),NA) expect_error(krt_1 <- kurt5(x,wts=wts,normalize_wts=FALSE,sg_df=0),NA) expect_error(sid_2 <- sd3(x,wts=2*wts,normalize_wts=FALSE,sg_df=0),NA) expect_error(ske_2 <- skew4(x,wts=2*wts,normalize_wts=FALSE,sg_df=0),NA) expect_error(krt_2 <- kurt5(x,wts=2*wts,normalize_wts=FALSE,sg_df=0),NA) expect_equal(sid_1 * c(1,1,2),sid_2,tolerance=1e-9) expect_equal(ske_1 * c(1,1,1,2),ske_2,tolerance=1e-9) expect_equal(krt_1 * c(1,1,1,1,2),krt_2,tolerance=1e-9) })#UNFOLD test_that("weighted sd, skew, kurt are correct",{#FOLDUP set.char.seed("4e17d837-69c1-41d1-906f-c82224d7ce41") x <- rnorm(1000) wts <- runif(length(x)) expect_error(sid <- sd3(x,wts=wts,normalize_wts=TRUE),NA) expect_error(ske <- skew4(x,wts=wts,normalize_wts=TRUE),NA) expect_error(krt <- kurt5(x,wts=wts,normalize_wts=TRUE),NA) # 2FIX: add more here to check correctness ... expect_equal(length(sid),3) expect_equal(length(ske),4) expect_equal(length(krt),5) # compare computations to gold standard # length expect_equal(sid[3],length(x)) expect_equal(sid[3],ske[4]) expect_equal(sid[3],krt[5]) # mean expect_equal(sid[2],weighted.mean(x,w=wts),tolerance=1e-9) expect_equal(sid[2],ske[3],tolerance=1e-9) expect_equal(sid[2],krt[4],tolerance=1e-9) # standard dev expect_equal(sid[1],ske[2],tolerance=1e-9) expect_equal(sid[1],krt[3],tolerance=1e-9) wsd <- sqrt(sum(((x - weighted.mean(x,w=wts))^2) * (wts / mean(wts))) / (length(x) - 1)) # 2FIX!!! expect_equal(sid[1],wsd,tolerance=1e-9) # skew expect_equal(ske[1],krt[2],tolerance=1e-9) na_rm <- TRUE dumb_count <- length(x) dumb_mean <- weighted.mean(x,w=wts) dumb_sd <- sqrt(sum(((x - weighted.mean(x,w=wts))^2) * (wts / mean(wts))) / (length(x) - 1)) wcmom <- function(vec,wts,ord) { wz <- wts / mean(wts) mean(wz * ((x - weighted.mean(x,w=wz))^ord)) } dumb_wcmom2 <- wcmom(x,wts,2) dumb_wcmom3 <- wcmom(x,wts,3) dumb_wcmom4 <- wcmom(x,wts,4) dumb_wcmom5 <- wcmom(x,wts,5) dumb_wcmom6 <- wcmom(x,wts,6) cmoms <- cent_moments(x,wts=wts,max_order=6,used_df=0,normalize_wts=TRUE) dumbv <- c(dumb_wcmom6,dumb_wcmom5,dumb_wcmom4,dumb_wcmom3,dumb_wcmom2,dumb_mean,dumb_count) expect_equal(cmoms,dumbv,tolerance=1e-9) dumb_skew <- dumb_wcmom3 / (dumb_wcmom2^(3/2)) dumb_exkurt <- (dumb_wcmom4 / (dumb_wcmom2^(2))) - 3 # skew expect_equal(ske[1],dumb_skew,tolerance=1e-9) # kurtosis expect_equal(krt[1],dumb_exkurt,tolerance=1e-9) })#UNFOLD #UNFOLD tomat <- function(cbound) { dumbv <- as.matrix(cbound) attr(dumbv,'dimnames') <- NULL dumbv } context("running ops are correct") test_that("running ops are correct",{#FOLDUP skip_on_cran() ptiles <- c(0.1,0.25,0.5,0.75,0.9) set.char.seed("7ffe0035-2d0c-4586-a1a5-6321c7cf8694") for (xlen in c(20,100)) { for (xmu in c(1e3,1e6)) { toler <- xmu ^ (1/3) x <- rnorm(xlen,mean=xmu) for (window in c(15,50,Inf)) { for (restart_period in c(20,1000)) { for (na_rm in c(FALSE,TRUE)) { dumb_count <- sapply(seq_along(x),function(iii) { sum(sign(abs(x[max(1,iii-window+1):iii])+1),na.rm=na_rm) },simplify=TRUE) dumb_sum <- sapply(seq_along(x),function(iii) { sum(x[max(1,iii-window+1):iii],na.rm=na_rm) },simplify=TRUE) dumb_mean <- sapply(seq_along(x),function(iii) { mean(x[max(1,iii-window+1):iii],na.rm=na_rm) },simplify=TRUE) dumb_sd <- sapply(seq_along(x),function(iii) { sd(x[max(1,iii-window+1):iii],na.rm=na_rm) },simplify=TRUE) dumb_skew <- sapply(seq_along(x),function(iii) { moments::skewness(x[max(1,iii-window+1):iii],na.rm=na_rm) },simplify=TRUE) dumb_exkurt <- sapply(seq_along(x),function(iii) { moments::kurtosis(x[max(1,iii-window+1):iii],na.rm=na_rm) - 3.0 },simplify=TRUE) dumb_cmom2 <- sapply(seq_along(x),function(iii) { moments::moment(x[max(1,iii-window+1):iii],central=TRUE,na.rm=na_rm,order=2) },simplify=TRUE) dumb_cmom3 <- sapply(seq_along(x),function(iii) { moments::moment(x[max(1,iii-window+1):iii],central=TRUE,na.rm=na_rm,order=3) },simplify=TRUE) dumb_cmom4 <- sapply(seq_along(x),function(iii) { moments::moment(x[max(1,iii-window+1):iii],central=TRUE,na.rm=na_rm,order=4) },simplify=TRUE) dumb_cmom5 <- sapply(seq_along(x),function(iii) { moments::moment(x[max(1,iii-window+1):iii],central=TRUE,na.rm=na_rm,order=5) },simplify=TRUE) dumb_cmom6 <- sapply(seq_along(x),function(iii) { moments::moment(x[max(1,iii-window+1):iii],central=TRUE,na.rm=na_rm,order=6) },simplify=TRUE) # SD expect_error(fastv <- running_sd(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(dumb_sd) expect_equal(dumbv[2:xlen],fastv[2:xlen],tolerance=1e-7 * toler) expect_error(fastv <- running_sd3(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(cbind(dumb_sd,dumb_mean,dumb_count)) expect_equal(dumbv[2:xlen,],fastv[2:xlen,],tolerance=1e-7 * toler) # skew expect_error(fastv <- running_skew(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(dumb_skew) expect_equal(dumbv[3:xlen],fastv[3:xlen],tolerance=1e-6 * toler) expect_error(fastv <- running_skew4(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(cbind(dumb_skew,dumb_sd,dumb_mean,dumb_count)) expect_equal(dumbv[3:xlen,],fastv[3:xlen,],tolerance=1e-7 * toler) # excess kurtosis expect_error(fastv <- running_kurt(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(dumb_exkurt) expect_equal(dumbv[4:xlen],fastv[4:xlen],tolerance=1e-6 * toler) expect_error(fastv <- running_kurt5(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(cbind(dumb_exkurt,dumb_skew,dumb_sd,dumb_mean,dumb_count)) expect_equal(dumbv[4:xlen,],fastv[4:xlen,],tolerance=1e-6 * toler) # higher order moments expect_error(fastv <- running_cent_moments(x,window=window,max_order=6L,used_df=0L,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(cbind(dumb_cmom6,dumb_cmom5,dumb_cmom4,dumb_cmom3,dumb_cmom2,dumb_mean,dumb_count)) expect_equal(dumbv[6:xlen,],fastv[6:xlen,],tolerance=1e-6 * toler) expect_error(fastv <- running_cent_moments(x,window=window,max_order=6L,max_order_only=TRUE,used_df=0L,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(dumb_cmom6) expect_equal(dumbv[6:xlen,],fastv[6:xlen,],tolerance=1e-7 * toler) expect_error(fastv <- running_std_moments(x,window=window,max_order=6L,used_df=0L,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- tomat(cbind(dumb_cmom6 / (dumb_cmom2^3),dumb_cmom5 / (dumb_cmom2^2.5),dumb_cmom4 / (dumb_cmom2^2.0),dumb_cmom3 / (dumb_cmom2^1.5),sqrt(dumb_cmom2),dumb_mean,dumb_count)) expect_equal(dumbv[6:xlen,],fastv[6:xlen,],tolerance=1e-7 * toler) # running sum and mean expect_error(fastv <- running_sum(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- dumb_sum expect_equal(dumbv[2:xlen],fastv[2:xlen],tolerance=1e-7 * toler) expect_error(fastv <- running_mean(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbv <- dumb_mean expect_equal(dumbv[2:xlen],fastv[2:xlen],tolerance=1e-7 * toler) if (require(PDQutils)) { # cumulants expect_error(fastv <- running_cumulants(x,window=window,max_order=6L,used_df=0L,restart_period=restart_period,na_rm=na_rm),NA) pre_dumbv <- cbind(dumb_cmom6,dumb_cmom5,dumb_cmom4,dumb_cmom3,dumb_cmom2,dumb_mean,dumb_count) dumbv <- t(sapply(seq_along(x),function(iii) { rv <- rev(PDQutils::moment2cumulant(c(0,rev(pre_dumbv[iii,1:(ncol(pre_dumbv)-2)])))) rv <- rv[-length(rv)] c(rv,pre_dumbv[iii,ncol(pre_dumbv) + (-1:0)]) },simplify='matrix')) expect_equal(max(abs(dumbv[6:xlen,] - fastv[6:xlen,])),0,tolerance=1e-8 * toler) # quantiles expect_error(fastv <- running_apx_quantiles(x,ptiles,max_order=ncol(dumbv)-1,used_df=0L,window=window,restart_period=restart_period,na_rm=na_rm),NA) dumbq <- t(sapply(seq_along(x),function(iii) { PDQutils::qapx_cf(ptiles,raw.cumulants=rev(dumbv[iii,1:(ncol(dumbv)-1)])) }, simplify=TRUE)) expect_equal(max(abs(dumbq[8:xlen,] - fastv[8:xlen,])),0,tolerance=1e-8 * toler) } } } } } } })#UNFOLD test_that("running adjustments are correct",{#FOLDUP skip_on_cran() set.char.seed("967d2149-fbff-4d82-b227-ca3e1034bddb") for (xlen in c(20,100)) { x <- rnorm(xlen) for (window in c(5,50,Inf)) { for (restart_period in c(10,1000)) { for (na_rm in c(FALSE,TRUE)) { dumb_count <- sapply(seq_along(x),function(iii) { sum(sign(abs(x[max(1,iii-window+1):iii])+1),na.rm=na_rm) },simplify=TRUE) dumb_mean <- sapply(seq_along(x),function(iii) { mean(x[max(1,iii-window+1):iii],na.rm=na_rm) },simplify=TRUE) dumb_sd <- sapply(seq_along(x),function(iii) { sd(x[max(1,iii-window+1):iii],na.rm=na_rm) },simplify=TRUE) expect_error(fastv <- running_centered(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) # the dumb value: dumbv <- x - dumb_mean; expect_equal(max(abs(dumbv - fastv)),0,tolerance=1e-12) expect_error(fastv <- running_scaled(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) # the dumb value: dumbv <- x / dumb_sd expect_equal(max(abs(dumbv[2:length(x)] - fastv[2:length(x)])),0,tolerance=1e-12) expect_error(fastv <- running_zscored(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) # the dumb value: dumbv <- (x - dumb_mean) / dumb_sd expect_equal(max(abs(dumbv[2:length(x)] - fastv[2:length(x)])),0,tolerance=1e-12) expect_error(fastv <- running_sharpe(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) # the dumb value: dumbv <- dumb_mean / dumb_sd expect_equal(max(abs(dumbv[2:length(x)] - fastv[2:length(x)])),0,tolerance=1e-12) expect_error(fastv <- running_tstat(x,window=window,restart_period=restart_period,na_rm=na_rm),NA) # the dumb value: dumbv <- (dumb_mean * sqrt(dumb_count)) / dumb_sd expect_equal(max(abs(dumbv[2:length(x)] - fastv[2:length(x)])),0,tolerance=1e-12) expect_error(fastv <- running_sharpe(x,window=window,restart_period=restart_period,na_rm=na_rm,compute_se=TRUE),NA) # the dumb value: dumb_sr <- dumb_mean / dumb_sd expect_equal(max(abs(dumb_sr[2:length(x)] - fastv[2:length(x),1])),0,tolerance=1e-12) if (require(moments)) { dumb_skew <- sapply(seq_along(x),function(iii) { moments::skewness(x[max(1,iii-window+1):iii],na.rm=na_rm) },simplify=TRUE) dumb_exkurt <- sapply(seq_along(x),function(iii) { moments::kurtosis(x[max(1,iii-window+1):iii],na.rm=na_rm) - 3.0 },simplify=TRUE) dumb_merse <- sqrt((1 + 0.25 * (2+dumb_exkurt) * dumb_sr^2 - dumb_skew * dumb_sr) / dumb_count) expect_equal(max(abs(dumb_merse[5:length(x)] - fastv[5:length(x),2])),0,tolerance=1e-9) } } } } } })#UNFOLD context("weighted running ops are correct") test_that("running weights work correctly",{#FOLDUP skip_on_cran() set.char.seed("b82d252c-681b-4b98-9bb3-ffd17feeb4a1") na_rm <- FALSE restart_period <- 1000 for (xlen in c(20,50)) { x <- rnorm(xlen) for (wts in list(rep(1L,xlen), runif(xlen,min=2,max=7))) { for (window in c(5,30,Inf)) { # FOLDUP # 2FIX: add to this! slow_count <- sapply(seq_along(x),function(iii) { sum(sign(abs(x[max(1,iii-window+1):iii])+1),na.rm=na_rm) },simplify=TRUE) slow_sumwt <- sapply(seq_along(x),function(iii) { sum(wts[max(1,iii-window+1):iii],na.rm=na_rm) },simplify=TRUE) slow_mean <- sapply(seq_along(x),function(iii) { mydx <- max(1,iii-window+1):iii mywts <- wts[mydx] sum(mywts * x[mydx],na.rm=na_rm) / slow_sumwt[iii] },simplify=TRUE) slow_var <- sapply(seq_along(x),function(iii) { mydx <- max(1,iii-window+1):iii mywts <- wts[mydx] sum(mywts * (x[mydx] - slow_mean[iii])^2,na.rm=na_rm) / (slow_sumwt[iii] - 1) },simplify=TRUE) slow_sd <- sqrt(slow_var) # the normalize version; slow_nvar <- sapply(seq_along(x),function(iii) { mydx <- max(1,iii-window+1):iii mywts <- wts[mydx] (slow_count[iii]/slow_sumwt[iii]) * sum(mywts * (x[mydx] - slow_mean[iii])^2,na.rm=na_rm) / (slow_count[iii] - 1) },simplify=TRUE) slow_nsd <- sqrt(slow_nvar) slow_cent3 <- sapply(seq_along(x),function(iii) { mydx <- max(1,iii-window+1):iii mywts <- wts[mydx] sum(mywts * (x[mydx] - slow_mean[iii])^3,na.rm=na_rm) / (slow_sumwt[iii]) },simplify=TRUE) slow_cent4 <- sapply(seq_along(x),function(iii) { mydx <- max(1,iii-window+1):iii mywts <- wts[mydx] sum(mywts * (x[mydx] - slow_mean[iii])^4,na.rm=na_rm) / (slow_sumwt[iii]) },simplify=TRUE) expect_error(fastv <- running_mean(x,wts=wts,min_df=0,window=window,na_rm=na_rm),NA) expect_equal(fastv,slow_mean,tolerance=1e-8) expect_error(fastv <- running_centered(x,wts=wts,window=window,restart_period=restart_period,na_rm=na_rm),NA) slowv <- x - slow_mean; expect_equal(as.numeric(fastv),slowv,tolerance=1e-8) for (nw in c(TRUE,FALSE)) { if (nw) { use_sd <- slow_nsd use_df <- slow_count } else { use_sd <- slow_sd use_df <- slow_sumwt } expect_error(fastv <- running_sd(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(as.numeric(fastv),use_sd,tolerance=1e-8) expect_error(fastv <- running_sd3(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(as.numeric(fastv[,1]),use_sd,tolerance=1e-8) expect_equal(as.numeric(fastv[,2]),slow_mean,tolerance=1e-8) expect_equal(as.numeric(fastv[,3]),use_df,tolerance=1e-8) expect_error(fastv <- running_scaled(x,wts=wts,window=window,restart_period=restart_period,na_rm=na_rm,normalize_wts=nw),NA) slowv <- x / use_sd expect_equal(as.numeric(fastv[2:length(x)]),slowv[2:length(x)],tolerance=1e-8) expect_error(fastv <- running_zscored(x,wts=wts,window=window,restart_period=restart_period,na_rm=na_rm,normalize_wts=nw),NA) slowv <- (x - slow_mean) / use_sd expect_equal(slowv[2:length(x)],fastv[2:length(x)],tolerance=1e-12) expect_error(fastv <- running_sharpe(x,wts=wts,window=window,restart_period=restart_period,na_rm=na_rm,normalize_wts=nw),NA) slowv <- slow_mean / use_sd expect_equal(slowv[2:length(x)],fastv[2:length(x)],tolerance=1e-12) expect_error(fastv <- running_tstat(x,wts=wts,window=window,restart_period=restart_period,na_rm=na_rm,normalize_wts=nw),NA) slowv <- (slow_mean * sqrt(use_df)) / use_sd expect_equal(slowv[2:length(x)],fastv[2:length(x)],tolerance=1e-12) expect_error(fastv <- running_cent_moments(x,wts=wts,window=window,max_order=3L,max_order_only=TRUE,restart_period=restart_period,na_rm=na_rm,normalize_wts=nw),NA) slowv <- slow_cent3 expect_equal(slowv[3:length(x)],fastv[3:length(x)],tolerance=1e-12) expect_error(fastv <- running_cent_moments(x,wts=wts,window=window,max_order=4L,max_order_only=TRUE,restart_period=restart_period,na_rm=na_rm,normalize_wts=nw),NA) slowv <- slow_cent4 expect_equal(slowv[4:length(x)],fastv[4:length(x)],tolerance=1e-12) } }# UNFOLD } } })#UNFOLD context("t_running for trivial case") test_that("vs running ops",{#FOLDUP skip_on_cran() set.char.seed("712463ec-f266-4de7-89d2-ce3c824327b0") na_rm <- FALSE ptiles <- c(0.1,0.25,0.5,0.75,0.9) for (xlen in c(20,50)) { x <- rnorm(xlen) times <- seq_along(x) for (wts in list(NULL,rep(1L,xlen), runif(xlen,min=1.2,max=3.5))) { # 2FIX? Inf window? for (window in c(5,30,Inf)) { # FOLDUP # to avoid roundoff issues on double times. t_window <- window - 0.1 expect_error(box <- running_sum(x,wts=wts,window=window,na_rm=na_rm),NA) expect_error(tbox <- t_running_sum(x,time=times,wts=wts,window=t_window,na_rm=na_rm),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_mean(x,wts=wts,min_df=0,window=window,na_rm=na_rm),NA) expect_error(tbox <- t_running_mean(x,time=times,wts=wts,min_df=0,window=t_window,na_rm=na_rm),NA) expect_equal(box,tbox,tolerance=1e-8) for (nw in c(TRUE,FALSE)) { expect_error(box <- running_sd(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) expect_error(tbox <- t_running_sd(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_skew(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_skew(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_kurt(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_kurt(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_sd3(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_sd3(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_skew4(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_skew4(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_kurt5(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_kurt5(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_centered(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_centered(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_scaled(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_scaled(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_zscored(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_zscored(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_tstat(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_tstat(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) for (cse in c(TRUE,FALSE)) { expect_error(box <- running_sharpe(x,wts=wts,window=window,na_rm=na_rm,compute_se=cse,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_sharpe(x,time=times,wts=wts,window=t_window,na_rm=na_rm,compute_se=cse,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) } expect_error(box <- running_apx_median(x,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_apx_median(x,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) expect_error(box <- running_apx_quantiles(x,ptiles,max_order=3,wts=wts,window=window,na_rm=na_rm,normalize_wts=nw),NA) # the 0.1 is to avoid roundoff issues on the double times. expect_error(tbox <- t_running_apx_quantiles(x,ptiles,max_order=3,time=times,wts=wts,window=t_window,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(box,tbox,tolerance=1e-8) } }# UNFOLD } } })#UNFOLD context("t_running vs slow version") test_that("check em",{#FOLDUP skip_on_cran() set.char.seed("91b0bd37-0b8e-49d6-8333-039a7d7f7dd5") na_rm <- FALSE for (xlen in c(40,90)) {# FOLDUP x <- rnorm(xlen) for (times in list(NULL,cumsum(runif(length(x),min=0.2,max=0.4)))) { for (wts in list(NULL,rep(1L,xlen),runif(xlen,min=1.1,max=2.1))) { wts_as_delta <- is.null(times) & !is.null(wts) if (!is.null(times) || (wts_as_delta && !is.null(wts))) { for (window in c(11.5,20.5,Inf)) { # FOLDUP for (lb_time in list(NULL,3+cumsum(runif(10,min=0.4,max=1.1)))) { slow <- slow_t_running_sum(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta) expect_error(fast <- t_running_sum(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta),NA) expect_equal(fast,slow,tolerance=1e-8) slow <- slow_t_running_mean(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta) expect_error(fast <- t_running_mean(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta),NA) expect_equal(fast,slow,tolerance=1e-8) for (nw in c(TRUE,FALSE)) { slow <- slow_t_running_sd(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta,normalize_wts=nw) expect_error(fast <- t_running_sd(x,time=times,wts=wts,window=window,lb_time=lb_time,min_df=1,na_rm=na_rm,wts_as_delta=wts_as_delta,normalize_wts=nw),NA) expect_equal(fast,slow,tolerance=1e-8) slow <- slow_t_running_skew(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta,normalize_wts=nw) expect_error(fast <- t_running_skew(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta,normalize_wts=nw),NA) expect_equal(fast,slow,tolerance=1e-8) slow <- slow_t_running_kurt(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta,normalize_wts=nw) expect_error(fast <- t_running_kurt(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta,normalize_wts=nw),NA) expect_equal(fast,slow,tolerance=1e-8) slow <- slow_t_running_sd3(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta,normalize_wts=nw) expect_error(fast <- t_running_sd3(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,wts_as_delta=wts_as_delta,normalize_wts=nw),NA) # ignore the df computation in slow when empty slow[fast[,3]==0,3] <- 0 slow[is.na(fast[,1]),1] <- NA expect_equal(fast,slow,tolerance=1e-8) slow <- slow_t_running_skew4(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,normalize_wts=nw) expect_error(fast <- t_running_skew4(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,normalize_wts=nw),NA) # ignore the df computation in slow when empty okrow <- !is.na(fast[,4]) & fast[,4] > 3 & row(fast)[,4] > 3 expect_equal(fast[okrow,],slow[okrow,],tolerance=1e-8) slow <- slow_t_running_kurt5(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,normalize_wts=nw) expect_error(fast <- t_running_kurt5(x,time=times,wts=wts,window=window,lb_time=lb_time,na_rm=na_rm,normalize_wts=nw),NA) okrow <- !is.na(fast[,5]) & fast[,5] > 4 & row(fast)[,5] > 4 expect_equal(fast[okrow,],slow[okrow,],tolerance=1e-8) } } }# UNFOLD } } } }# UNFOLD })#UNFOLD context("t_running_sd") # t_running_sd is a bellwether for the other methods # as it goes, so goes the other Welford based functions test_that("check it",{#FOLDUP skip_on_cran() set.char.seed("79f60eda-7799-46e6-9096-6817b2d4473b") na_rm <- FALSE for (xlen in c(20,50)) {# FOLDUP x <- rnorm(xlen) for (times in list(NULL,cumsum(runif(length(x),min=0.2,max=0.4)))) { for (wts in list(NULL,rep(1L,xlen),runif(xlen,min=1.2,max=2.1))) { wts_as_delta <- is.null(times) & !is.null(wts) if (!is.null(times) || (wts_as_delta && !is.null(wts))) { for (window in c(11.5,20.5,Inf)) { # FOLDUP for (lb_time in list(NULL,cumsum(runif(20,min=0.2,max=1)))) { for (nw in c(TRUE,FALSE)) { expect_error(slow <- reference_t_running_sd(x,time=times,wts=wts,wts_as_delta=TRUE,window=window,lb_time=lb_time,na_rm=na_rm,min_df=1,normalize_wts=nw),NA) expect_error(fast <- t_running_sd(x,time=times,wts=wts,wts_as_delta=TRUE,used_df=1,window=window,lb_time=lb_time,min_df=1,na_rm=na_rm,normalize_wts=nw),NA) expect_equal(fast,slow,tolerance=1e-7) } } }# UNFOLD } } } }# UNFOLD })#UNFOLD #for vim modeline: (do not edit) # vim:ts=2:sw=2:tw=79:fdm=marker:fmr=FOLDUP,UNFOLD:cms=#%s:syn=r:ft=r:ai:si:cin:nu:fo=croql:cino=p0t0c5(0:
Example: Multiplication Table # R Program to find the multiplicationtable (from 1 to 10) # take input from the user num = as.integer(readline(prompt = "Enter a number: ")) # use for loop to iterate 10 times for(i in 1:10) { print(paste(num,'x', i, '=', num*i)) } /* Output Enter a number: 7 [1] "7 x 1 = 7" [1] "7 x 2 = 14" [1] "7 x 3 = 21" [1] "7 x 4 = 28" [1] "7 x 5 = 35" [1] "7 x 6 = 42" [1] "7 x 7 = 49" [1] "7 x 8 = 56" [1] "7 x 9 = 63" [1] "7 x 10 = 70" */
/R_Programming/MultiplicationTable.R
no_license
Yaseen549/r-programming-snippets
R
false
false
466
r
Example: Multiplication Table # R Program to find the multiplicationtable (from 1 to 10) # take input from the user num = as.integer(readline(prompt = "Enter a number: ")) # use for loop to iterate 10 times for(i in 1:10) { print(paste(num,'x', i, '=', num*i)) } /* Output Enter a number: 7 [1] "7 x 1 = 7" [1] "7 x 2 = 14" [1] "7 x 3 = 21" [1] "7 x 4 = 28" [1] "7 x 5 = 35" [1] "7 x 6 = 42" [1] "7 x 7 = 49" [1] "7 x 8 = 56" [1] "7 x 9 = 63" [1] "7 x 10 = 70" */
# ---- New Strain Collection ---- #' Create new strain collection #' #' A convenience function to create a new strain collection keyfile #' #' @param id ID of new library. This ID needs to be unique in the database. #' @param nplates Number of plates in the library. #' @param format Size of plates. Defaults to 96. #' @param dim Aspect ratio of rows to columns. Defaults to \code{c(2, 3)}. #' #' @export new_strain_collection <- function(id, nplates, format = 96, dim = c(2, 3)) { nrow <- dim[1] * sqrt(format / prod(dim)) ncol <- dim[2] * sqrt(format / prod(dim)) LETTERS <- expand_letters(nrow, LETTERS) data_frame( strain_collection_id = id, strain_id = '', plate = (1:nplates) %>% rep(each = format), row = (LETTERS[1:(format / ncol)]) %>% rep(times = nplates, each = ncol), column = (1:(format / nrow)) %>% rep(length.out = format * nplates), plate_control = FALSE, strain_collection_notes = '') %>% write.csv(file = paste0(id, '.csv'), row.names = FALSE) }
/R/new-templates.R
no_license
EricBryantPhD/screenmill
R
false
false
1,011
r
# ---- New Strain Collection ---- #' Create new strain collection #' #' A convenience function to create a new strain collection keyfile #' #' @param id ID of new library. This ID needs to be unique in the database. #' @param nplates Number of plates in the library. #' @param format Size of plates. Defaults to 96. #' @param dim Aspect ratio of rows to columns. Defaults to \code{c(2, 3)}. #' #' @export new_strain_collection <- function(id, nplates, format = 96, dim = c(2, 3)) { nrow <- dim[1] * sqrt(format / prod(dim)) ncol <- dim[2] * sqrt(format / prod(dim)) LETTERS <- expand_letters(nrow, LETTERS) data_frame( strain_collection_id = id, strain_id = '', plate = (1:nplates) %>% rep(each = format), row = (LETTERS[1:(format / ncol)]) %>% rep(times = nplates, each = ncol), column = (1:(format / nrow)) %>% rep(length.out = format * nplates), plate_control = FALSE, strain_collection_notes = '') %>% write.csv(file = paste0(id, '.csv'), row.names = FALSE) }
shinyUI( bootstrapPage( verbatimTextOutput("queryText"), p("On this page you can find your personal research data. How would you interpret this?"), plotOutput("plot") ) )
/interface/ui.R
no_license
KarelVerbrugge/loopedlogging
R
false
false
243
r
shinyUI( bootstrapPage( verbatimTextOutput("queryText"), p("On this page you can find your personal research data. How would you interpret this?"), plotOutput("plot") ) )
predict.mpr <- function(object, newdata, type=c("survivor", "hazard", "percentile"), tvec, prob=0.5, ...){ family <- match.arg(object$model$family, names(mprdists)) famlist <- mprdists[family][[1]] ncomp <- famlist$ncomp est <- coef(object) beta <- est$beta alpha <- est$alpha tau <- est$tau formula <- object$formula rhs <- eval(formula[[3]]) formb <- rhs[[1]] forma <- rhs[[2]] formt <- rhs[[3]] xvars <- object$xvars xlevels <- object$xlevels xfac <- names(object$xlevels) newnam <- colnames(newdata) mvars <- match(xvars, newnam) vna <- is.na(mvars) if(any(vna)){ errmess <- paste("The following variables not found:", paste(xvars[vna], collapse=", ") ) stop(errmess) } nums <- match(setdiff(xvars,xfac), newnam) facs <- match(xfac, newnam) if(length(nums) > 0){ for(i in 1:length(nums)){ newdata[,nums[i]] <- as.numeric(newdata[,nums[i]]) } } if(length(facs) > 0){ for(i in 1:length(facs)){ newdata[,facs[i]] <- as.factor(newdata[,facs[i]]) } } blevels <- xlevels[match(attr(terms(formb), "term.labels"), xfac)] alevels <- xlevels[match(attr(terms(forma), "term.labels"), xfac)] tlevels <- xlevels[match(attr(terms(formt), "term.labels"), xfac)] if(!is.null(blevels)){ blevels <- blevels[!is.na(names(blevels))] } if(!is.null(alevels)){ alevels <- alevels[!is.na(names(alevels))] } if(!is.null(tlevels)){ tlevels <- tlevels[!is.na(names(tlevels))] } Xb <- model.matrix(terms(formb), data=newdata, xlev=blevels) Xa <- model.matrix(terms(forma), data=newdata, xlev=alevels) Xt <- model.matrix(terms(formt), data=newdata, xlev=tlevels) parmat <- cbind(Xb%*%beta, Xa%*%alpha, Xt%*%tau) type <- match.arg(type) switch(type, survivor = { mprsurv <- Vectorize(famlist$surv, vectorize.args="ti") out <- mprsurv(parmat, tvec) }, hazard = { mprhaz <- Vectorize(famlist$haz, vectorize.args="ti") out <- mprhaz(parmat, tvec) }, percentile = { out <- as.matrix(famlist$sim(parmat, 1-prob)) }, ) out }
/R/predict.mpr.R
no_license
cran/mpr
R
false
false
2,272
r
predict.mpr <- function(object, newdata, type=c("survivor", "hazard", "percentile"), tvec, prob=0.5, ...){ family <- match.arg(object$model$family, names(mprdists)) famlist <- mprdists[family][[1]] ncomp <- famlist$ncomp est <- coef(object) beta <- est$beta alpha <- est$alpha tau <- est$tau formula <- object$formula rhs <- eval(formula[[3]]) formb <- rhs[[1]] forma <- rhs[[2]] formt <- rhs[[3]] xvars <- object$xvars xlevels <- object$xlevels xfac <- names(object$xlevels) newnam <- colnames(newdata) mvars <- match(xvars, newnam) vna <- is.na(mvars) if(any(vna)){ errmess <- paste("The following variables not found:", paste(xvars[vna], collapse=", ") ) stop(errmess) } nums <- match(setdiff(xvars,xfac), newnam) facs <- match(xfac, newnam) if(length(nums) > 0){ for(i in 1:length(nums)){ newdata[,nums[i]] <- as.numeric(newdata[,nums[i]]) } } if(length(facs) > 0){ for(i in 1:length(facs)){ newdata[,facs[i]] <- as.factor(newdata[,facs[i]]) } } blevels <- xlevels[match(attr(terms(formb), "term.labels"), xfac)] alevels <- xlevels[match(attr(terms(forma), "term.labels"), xfac)] tlevels <- xlevels[match(attr(terms(formt), "term.labels"), xfac)] if(!is.null(blevels)){ blevels <- blevels[!is.na(names(blevels))] } if(!is.null(alevels)){ alevels <- alevels[!is.na(names(alevels))] } if(!is.null(tlevels)){ tlevels <- tlevels[!is.na(names(tlevels))] } Xb <- model.matrix(terms(formb), data=newdata, xlev=blevels) Xa <- model.matrix(terms(forma), data=newdata, xlev=alevels) Xt <- model.matrix(terms(formt), data=newdata, xlev=tlevels) parmat <- cbind(Xb%*%beta, Xa%*%alpha, Xt%*%tau) type <- match.arg(type) switch(type, survivor = { mprsurv <- Vectorize(famlist$surv, vectorize.args="ti") out <- mprsurv(parmat, tvec) }, hazard = { mprhaz <- Vectorize(famlist$haz, vectorize.args="ti") out <- mprhaz(parmat, tvec) }, percentile = { out <- as.matrix(famlist$sim(parmat, 1-prob)) }, ) out }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/cogmapr-indic.R \name{ConceptCentrality} \alias{ConceptCentrality} \title{Centralities of concepts} \usage{ ConceptCentrality(project, filters = NULL, units = "all", weighted.icm = FALSE) } \arguments{ \item{project}{A QDA project, a list as generated by the ProjectCMap function.} \item{filters}{A list of named strings that will filter the relationships showed in the SCM. e.g. =list(coding_class = "A_coding_class", document_part = "A_document_part")=. To date, these filters are linked to the nature of relationships.} \item{units}{A string vector giving the names of the units (i.e. classes linked to documents) that will be include in the SCM. It is a second type of filter.} \item{weighted.icm}{A boolean. If FALSE, the weight of the relationships in the ICM will be fixed to 1.} } \value{ A data frame with the value of the centrality (n) of vertices. } \description{ Compute the centrality of concepts } \details{ Compute the centrality of concepts } \examples{ project_name <- "a_new_project" main_path <- paste0(system.file("testdata", package = "cogmapr"), '/') my.project <- ProjectCMap(main_path, project_name) ConceptCentrality(my.project) }
/man/ConceptCentrality.Rd
no_license
cran/cogmapr
R
false
true
1,240
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/cogmapr-indic.R \name{ConceptCentrality} \alias{ConceptCentrality} \title{Centralities of concepts} \usage{ ConceptCentrality(project, filters = NULL, units = "all", weighted.icm = FALSE) } \arguments{ \item{project}{A QDA project, a list as generated by the ProjectCMap function.} \item{filters}{A list of named strings that will filter the relationships showed in the SCM. e.g. =list(coding_class = "A_coding_class", document_part = "A_document_part")=. To date, these filters are linked to the nature of relationships.} \item{units}{A string vector giving the names of the units (i.e. classes linked to documents) that will be include in the SCM. It is a second type of filter.} \item{weighted.icm}{A boolean. If FALSE, the weight of the relationships in the ICM will be fixed to 1.} } \value{ A data frame with the value of the centrality (n) of vertices. } \description{ Compute the centrality of concepts } \details{ Compute the centrality of concepts } \examples{ project_name <- "a_new_project" main_path <- paste0(system.file("testdata", package = "cogmapr"), '/') my.project <- ProjectCMap(main_path, project_name) ConceptCentrality(my.project) }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/logit.R \name{logit} \alias{logit} \title{logit function} \usage{ logit(p) } \arguments{ \item{p}{a proportion} } \value{ the logit of a proportion } \description{ logit function } \examples{ logit(.5) }
/man/logit.Rd
no_license
AurMad/STOCfree
R
false
true
283
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/logit.R \name{logit} \alias{logit} \title{logit function} \usage{ logit(p) } \arguments{ \item{p}{a proportion} } \value{ the logit of a proportion } \description{ logit function } \examples{ logit(.5) }
context("test-utils.R") test_that("make_atac_cds makes a valid cds object", { #skip_on_bioc() data("cicero_data") #### make_atac_cds #### test_cds <- make_atac_cds(cicero_data) expect_is(test_cds, "CellDataSet") expect_equal(nrow(exprs(test_cds)), 6146) expect_equal(ncol(exprs(test_cds)), 200) expect_match(row.names(test_cds)[1], "chr18_10025_10225") expect_match(colnames(test_cds)[1], "AGCGATAGAACGAATTCGGCGCAATGACCCTATCCT") expect_is(exprs(test_cds), "dgCMatrix") test_cds <-make_atac_cds(cicero_data, binarize=TRUE) expect_is(test_cds, "CellDataSet") expect_equal(nrow(exprs(test_cds)), 6146) expect_equal(ncol(exprs(test_cds)), 200) expect_match(row.names(test_cds)[1], "chr18_10025_10225") expect_match(colnames(test_cds)[1], "AGCGATAGAACGAATTCGGCGCAATGACCCTATCCT") expect_is(exprs(test_cds), "dgCMatrix") expect_error(test_cds <- make_atac_cds(3), "Input must be file path, matrix, or data.frame") test_cds <-make_atac_cds("../cicero_data_sub.txt", binarize=TRUE) expect_is(test_cds, "CellDataSet") expect_equal(nrow(exprs(test_cds)), 2148) expect_equal(ncol(exprs(test_cds)), 7) expect_match(row.names(test_cds)[1], "chr18_10025_10225") expect_match(colnames(test_cds)[1], "AGCGATAGGCGCTATGGTGGAATTCAGTCAGGACGT") expect_is(exprs(test_cds), "dgCMatrix") }) #### ranges_for_coords #### test_that("ranges_for_coords works", { #skip_on_bioc() wn <- ranges_for_coords("chr1:2039-30239", with_names = TRUE) wmd <- ranges_for_coords(c("chr1:2049-203902", "chrX:489249-1389389"), meta_data_df = data.frame(dat = c("1", "X"))) wmdn <- ranges_for_coords(c("chr1:2049-203902", "chrX:489249-1389389"), with_names = TRUE, meta_data_df = data.frame(dat = c("1", "X"), stringsAsFactors = FALSE)) expect_is(ranges_for_coords("chr1_2039_30239"), "GRanges") expect_is(ranges_for_coords("chr1:2039:30239"), "GRanges") expect_is(ranges_for_coords("chr1-2039-30239"), "GRanges") expect_is(ranges_for_coords("chr1:2,039-30,239"), "GRanges") expect_is(ranges_for_coords(c("chr1:2,039-30,239", "chrX:28884:101293")), "GRanges") expect_is(ranges_for_coords(c("chr1:2,039-30,239", "chrX:28884:101293"), with_names = TRUE), "GRanges") expect_is(wn, "GRanges") expect_is(wmd, "GRanges") expect_match(wn$coord_string, "chr1:2039-30239") expect_match(as.character(wmd$dat[2]), "X") expect_match(wmdn$coord_string[1], "chr1:2049-203902") expect_match(as.character(wmdn$dat[2]), "X") }) #### df_for_coords #### test_that("df_for_coords works", { #skip_on_bioc() expect_is(df_for_coords(c("chr1:2,039-30,239", "chrX:28884:101293")), "data.frame") expect_equal(df_for_coords(c("chr1:2,039-30,239", "chrX:28884:101293"))$bp2[1], 30239) }) #### annotate_cds_by_site #### test_that("annotate_cds_by_site works", { #skip_on_bioc() data("cicero_data") #### make_atac_cds #### test_cds <- make_atac_cds(cicero_data) feat <- data.frame(chr = c("chr18", "chr18", "chr18", "chr18"), bp1 = c(10000, 10800, 50000, 100000), bp2 = c(10700, 11000, 60000, 110000), type = c("Acetylated", "Methylated", "Acetylated", "Methylated"), stringsAsFactors = FALSE) test_cds2 <- annotate_cds_by_site(test_cds, feat, verbose = TRUE) test_cds3 <- annotate_cds_by_site(test_cds, feat, all=TRUE, verbose = TRUE) expect_is(test_cds2, "CellDataSet") expect_is(test_cds3, "CellDataSet") expect_equal(nrow(fData(test_cds2)), nrow(fData(test_cds))) expect_equal(nrow(fData(test_cds3)), nrow(fData(test_cds))) expect_equal(ncol(fData(test_cds2)), ncol(fData(test_cds)) + 2) expect_equal(ncol(fData(test_cds3)), ncol(fData(test_cds)) + 2) expect_equal(fData(test_cds2)$overlap[2], 201) expect_equal(fData(test_cds3)$overlap[2], "98,201") expect_equal(fData(test_cds2)$type[2], "Methylated") expect_equal(fData(test_cds3)$type[2], "Acetylated,Methylated") expect_true(is.na(fData(test_cds2)$overlap[3])) expect_true(is.na(fData(test_cds3)$overlap[3])) expect_true(is.na(fData(test_cds2)$type[3])) expect_true(is.na(fData(test_cds3)$type[3])) test_cds2 <- annotate_cds_by_site(test_cds, feat) test_cds3 <- annotate_cds_by_site(test_cds, feat, all=TRUE) expect_is(test_cds2, "CellDataSet") expect_is(test_cds3, "CellDataSet") expect_equal(nrow(fData(test_cds2)), nrow(fData(test_cds))) expect_equal(nrow(fData(test_cds3)), nrow(fData(test_cds))) expect_equal(ncol(fData(test_cds2)), ncol(fData(test_cds)) + 2) expect_equal(ncol(fData(test_cds3)), ncol(fData(test_cds)) + 2) expect_equal(fData(test_cds2)$overlap[2], 201) expect_equal(fData(test_cds3)$overlap[2], "98,201") expect_equal(fData(test_cds2)$type[2], "Methylated") expect_equal(fData(test_cds3)$type[2], "Acetylated,Methylated") expect_true(is.na(fData(test_cds2)$overlap[3])) expect_true(is.na(fData(test_cds3)$overlap[3])) expect_true(is.na(fData(test_cds2)$type[3])) expect_true(is.na(fData(test_cds3)$type[3])) test_cds2 <- annotate_cds_by_site(test_cds, "../feat.txt", verbose =TRUE) test_cds3 <- annotate_cds_by_site(test_cds, "../feat.txt", all=TRUE) expect_is(test_cds2, "CellDataSet") expect_is(test_cds3, "CellDataSet") expect_equal(nrow(fData(test_cds2)), nrow(fData(test_cds))) expect_equal(nrow(fData(test_cds3)), nrow(fData(test_cds))) expect_equal(ncol(fData(test_cds2)), ncol(fData(test_cds)) + 2) expect_equal(ncol(fData(test_cds3)), ncol(fData(test_cds)) + 2) expect_equal(fData(test_cds2)$overlap[2], 201) expect_equal(fData(test_cds3)$overlap[2], "98,201") expect_equal(fData(test_cds2)$V4[2], "Methylated") expect_equal(fData(test_cds3)$V4[2], "Acetylated,Methylated") expect_true(is.na(fData(test_cds2)$overlap[3])) expect_true(is.na(fData(test_cds3)$overlap[3])) expect_true(is.na(fData(test_cds2)$V4[3])) expect_true(is.na(fData(test_cds3)$V4[3])) test_cds2 <- annotate_cds_by_site(test_cds, "../feat_head.txt", header = TRUE) test_cds3 <- annotate_cds_by_site(test_cds, "../feat_head.txt", header = TRUE, all=TRUE) expect_is(test_cds2, "CellDataSet") expect_is(test_cds3, "CellDataSet") expect_equal(nrow(fData(test_cds2)), nrow(fData(test_cds))) expect_equal(nrow(fData(test_cds3)), nrow(fData(test_cds))) expect_equal(ncol(fData(test_cds2)), ncol(fData(test_cds)) + 2) expect_equal(ncol(fData(test_cds3)), ncol(fData(test_cds)) + 2) expect_equal(fData(test_cds2)$overlap[2], 201) expect_equal(fData(test_cds3)$overlap[2], "98,201") expect_equal(fData(test_cds2)$type[2], "Methylated") expect_equal(fData(test_cds3)$type[2], "Acetylated,Methylated") expect_true(is.na(fData(test_cds2)$overlap[3])) expect_true(is.na(fData(test_cds3)$overlap[3])) expect_true(is.na(fData(test_cds2)$type[3])) expect_true(is.na(fData(test_cds3)$type[3])) # check tie feat2 <- data.frame(chr = c("chr18", "chr18", "chr18", "chr18"), bp1 = c(10125, 10125, 50000, 100000), bp2 = c(10703, 10703, 60000, 110000), type = c("Acetylated", "Methylated", "Acetylated", "Methylated"), stringsAsFactors = FALSE) test_cds2 <- annotate_cds_by_site(test_cds, feat2, all=FALSE) expect_equal(fData(test_cds2)$type[2], "Acetylated") test_cds2 <- annotate_cds_by_site(test_cds, feat2, all=FALSE, maxgap = 901) expect_equal(fData(test_cds2)$type[3], "Acetylated") # check maxgap = "nearest" test_cds2 <- annotate_cds_by_site(test_cds, feat2, all=FALSE, maxgap = "nearest") expect_equal(sum(is.na(fData(test_cds2)$type)), 0) }) #### make_sparse_matrix #### test_that("make_sparse_matrix works", { #skip_on_bioc() df <- data.frame(icol = c("chr18_30209631_30210783", "chr18_45820294_45821666", "chr18_32820116_32820994"), jcol = c("chr18_41888433_41890138", "chr18_33038287_33039444", "chr18_25533921_25534483"), xcol = c(1,2,3)) sm <- make_sparse_matrix(df, "icol", "jcol", "xcol") expect_equal(sm["chr18_30209631_30210783", "chr18_41888433_41890138"], 1) expect_equal(sm["chr18_45820294_45821666", "chr18_33038287_33039444"], 2) expect_equal(sm["chr18_25533921_25534483", "chr18_32820116_32820994"], 3) expect_equal(sm["chr18_25533921_25534483", "chr18_30209631_30210783"], 0) expect_error(make_sparse_matrix(df, "icol", "xcol", "jcol"), "x.name column must be numeric") expect_error(make_sparse_matrix(df, "icol", "hannah", "jcol"), "i.name, j.name, and x.name must be columns in data") }) #### compare_connections #### # IN test-runCicero.R #### find_overlapping_coordinates #### test_that("find_overlapping_coordinates works", { #skip_on_bioc() test_coords <- c("chr18_10025_10225", "chr18_10603_11103", "chr18_11604_13986", "chr18_157883_158536", "chr18_217477_218555", "chr18_245734_246234") expect_equal(length(find_overlapping_coordinates(test_coords, "chr18:10,100-1246234")), 6) expect_equal(length(find_overlapping_coordinates(test_coords, "chr18_10227_10601")), 0) expect_equal(length(find_overlapping_coordinates(test_coords, "chr18_10227_10601", maxgap = 1)), 2) expect_equal(length(find_overlapping_coordinates(test_coords, c("chr18_10227_10602", "chr18:11604-246234"))), 5) expect_equal(length(find_overlapping_coordinates(test_coords, c("chr18_10226_10602", "chr18:11604-246234"), maxgap = 1)), 6) expect(all(is.na(find_overlapping_coordinates(test_coords, c("chr19_10226_10602", "chr19:11604-246234"), maxgap = 1)))) expect(all(is.na(find_overlapping_coordinates(test_coords, c("chr18_1022600_1060200", "chr18:1160400-24623400"), maxgap = 1)))) })
/tests/testthat/test-utils.R
permissive
shamoni/cicero-release
R
false
false
10,875
r
context("test-utils.R") test_that("make_atac_cds makes a valid cds object", { #skip_on_bioc() data("cicero_data") #### make_atac_cds #### test_cds <- make_atac_cds(cicero_data) expect_is(test_cds, "CellDataSet") expect_equal(nrow(exprs(test_cds)), 6146) expect_equal(ncol(exprs(test_cds)), 200) expect_match(row.names(test_cds)[1], "chr18_10025_10225") expect_match(colnames(test_cds)[1], "AGCGATAGAACGAATTCGGCGCAATGACCCTATCCT") expect_is(exprs(test_cds), "dgCMatrix") test_cds <-make_atac_cds(cicero_data, binarize=TRUE) expect_is(test_cds, "CellDataSet") expect_equal(nrow(exprs(test_cds)), 6146) expect_equal(ncol(exprs(test_cds)), 200) expect_match(row.names(test_cds)[1], "chr18_10025_10225") expect_match(colnames(test_cds)[1], "AGCGATAGAACGAATTCGGCGCAATGACCCTATCCT") expect_is(exprs(test_cds), "dgCMatrix") expect_error(test_cds <- make_atac_cds(3), "Input must be file path, matrix, or data.frame") test_cds <-make_atac_cds("../cicero_data_sub.txt", binarize=TRUE) expect_is(test_cds, "CellDataSet") expect_equal(nrow(exprs(test_cds)), 2148) expect_equal(ncol(exprs(test_cds)), 7) expect_match(row.names(test_cds)[1], "chr18_10025_10225") expect_match(colnames(test_cds)[1], "AGCGATAGGCGCTATGGTGGAATTCAGTCAGGACGT") expect_is(exprs(test_cds), "dgCMatrix") }) #### ranges_for_coords #### test_that("ranges_for_coords works", { #skip_on_bioc() wn <- ranges_for_coords("chr1:2039-30239", with_names = TRUE) wmd <- ranges_for_coords(c("chr1:2049-203902", "chrX:489249-1389389"), meta_data_df = data.frame(dat = c("1", "X"))) wmdn <- ranges_for_coords(c("chr1:2049-203902", "chrX:489249-1389389"), with_names = TRUE, meta_data_df = data.frame(dat = c("1", "X"), stringsAsFactors = FALSE)) expect_is(ranges_for_coords("chr1_2039_30239"), "GRanges") expect_is(ranges_for_coords("chr1:2039:30239"), "GRanges") expect_is(ranges_for_coords("chr1-2039-30239"), "GRanges") expect_is(ranges_for_coords("chr1:2,039-30,239"), "GRanges") expect_is(ranges_for_coords(c("chr1:2,039-30,239", "chrX:28884:101293")), "GRanges") expect_is(ranges_for_coords(c("chr1:2,039-30,239", "chrX:28884:101293"), with_names = TRUE), "GRanges") expect_is(wn, "GRanges") expect_is(wmd, "GRanges") expect_match(wn$coord_string, "chr1:2039-30239") expect_match(as.character(wmd$dat[2]), "X") expect_match(wmdn$coord_string[1], "chr1:2049-203902") expect_match(as.character(wmdn$dat[2]), "X") }) #### df_for_coords #### test_that("df_for_coords works", { #skip_on_bioc() expect_is(df_for_coords(c("chr1:2,039-30,239", "chrX:28884:101293")), "data.frame") expect_equal(df_for_coords(c("chr1:2,039-30,239", "chrX:28884:101293"))$bp2[1], 30239) }) #### annotate_cds_by_site #### test_that("annotate_cds_by_site works", { #skip_on_bioc() data("cicero_data") #### make_atac_cds #### test_cds <- make_atac_cds(cicero_data) feat <- data.frame(chr = c("chr18", "chr18", "chr18", "chr18"), bp1 = c(10000, 10800, 50000, 100000), bp2 = c(10700, 11000, 60000, 110000), type = c("Acetylated", "Methylated", "Acetylated", "Methylated"), stringsAsFactors = FALSE) test_cds2 <- annotate_cds_by_site(test_cds, feat, verbose = TRUE) test_cds3 <- annotate_cds_by_site(test_cds, feat, all=TRUE, verbose = TRUE) expect_is(test_cds2, "CellDataSet") expect_is(test_cds3, "CellDataSet") expect_equal(nrow(fData(test_cds2)), nrow(fData(test_cds))) expect_equal(nrow(fData(test_cds3)), nrow(fData(test_cds))) expect_equal(ncol(fData(test_cds2)), ncol(fData(test_cds)) + 2) expect_equal(ncol(fData(test_cds3)), ncol(fData(test_cds)) + 2) expect_equal(fData(test_cds2)$overlap[2], 201) expect_equal(fData(test_cds3)$overlap[2], "98,201") expect_equal(fData(test_cds2)$type[2], "Methylated") expect_equal(fData(test_cds3)$type[2], "Acetylated,Methylated") expect_true(is.na(fData(test_cds2)$overlap[3])) expect_true(is.na(fData(test_cds3)$overlap[3])) expect_true(is.na(fData(test_cds2)$type[3])) expect_true(is.na(fData(test_cds3)$type[3])) test_cds2 <- annotate_cds_by_site(test_cds, feat) test_cds3 <- annotate_cds_by_site(test_cds, feat, all=TRUE) expect_is(test_cds2, "CellDataSet") expect_is(test_cds3, "CellDataSet") expect_equal(nrow(fData(test_cds2)), nrow(fData(test_cds))) expect_equal(nrow(fData(test_cds3)), nrow(fData(test_cds))) expect_equal(ncol(fData(test_cds2)), ncol(fData(test_cds)) + 2) expect_equal(ncol(fData(test_cds3)), ncol(fData(test_cds)) + 2) expect_equal(fData(test_cds2)$overlap[2], 201) expect_equal(fData(test_cds3)$overlap[2], "98,201") expect_equal(fData(test_cds2)$type[2], "Methylated") expect_equal(fData(test_cds3)$type[2], "Acetylated,Methylated") expect_true(is.na(fData(test_cds2)$overlap[3])) expect_true(is.na(fData(test_cds3)$overlap[3])) expect_true(is.na(fData(test_cds2)$type[3])) expect_true(is.na(fData(test_cds3)$type[3])) test_cds2 <- annotate_cds_by_site(test_cds, "../feat.txt", verbose =TRUE) test_cds3 <- annotate_cds_by_site(test_cds, "../feat.txt", all=TRUE) expect_is(test_cds2, "CellDataSet") expect_is(test_cds3, "CellDataSet") expect_equal(nrow(fData(test_cds2)), nrow(fData(test_cds))) expect_equal(nrow(fData(test_cds3)), nrow(fData(test_cds))) expect_equal(ncol(fData(test_cds2)), ncol(fData(test_cds)) + 2) expect_equal(ncol(fData(test_cds3)), ncol(fData(test_cds)) + 2) expect_equal(fData(test_cds2)$overlap[2], 201) expect_equal(fData(test_cds3)$overlap[2], "98,201") expect_equal(fData(test_cds2)$V4[2], "Methylated") expect_equal(fData(test_cds3)$V4[2], "Acetylated,Methylated") expect_true(is.na(fData(test_cds2)$overlap[3])) expect_true(is.na(fData(test_cds3)$overlap[3])) expect_true(is.na(fData(test_cds2)$V4[3])) expect_true(is.na(fData(test_cds3)$V4[3])) test_cds2 <- annotate_cds_by_site(test_cds, "../feat_head.txt", header = TRUE) test_cds3 <- annotate_cds_by_site(test_cds, "../feat_head.txt", header = TRUE, all=TRUE) expect_is(test_cds2, "CellDataSet") expect_is(test_cds3, "CellDataSet") expect_equal(nrow(fData(test_cds2)), nrow(fData(test_cds))) expect_equal(nrow(fData(test_cds3)), nrow(fData(test_cds))) expect_equal(ncol(fData(test_cds2)), ncol(fData(test_cds)) + 2) expect_equal(ncol(fData(test_cds3)), ncol(fData(test_cds)) + 2) expect_equal(fData(test_cds2)$overlap[2], 201) expect_equal(fData(test_cds3)$overlap[2], "98,201") expect_equal(fData(test_cds2)$type[2], "Methylated") expect_equal(fData(test_cds3)$type[2], "Acetylated,Methylated") expect_true(is.na(fData(test_cds2)$overlap[3])) expect_true(is.na(fData(test_cds3)$overlap[3])) expect_true(is.na(fData(test_cds2)$type[3])) expect_true(is.na(fData(test_cds3)$type[3])) # check tie feat2 <- data.frame(chr = c("chr18", "chr18", "chr18", "chr18"), bp1 = c(10125, 10125, 50000, 100000), bp2 = c(10703, 10703, 60000, 110000), type = c("Acetylated", "Methylated", "Acetylated", "Methylated"), stringsAsFactors = FALSE) test_cds2 <- annotate_cds_by_site(test_cds, feat2, all=FALSE) expect_equal(fData(test_cds2)$type[2], "Acetylated") test_cds2 <- annotate_cds_by_site(test_cds, feat2, all=FALSE, maxgap = 901) expect_equal(fData(test_cds2)$type[3], "Acetylated") # check maxgap = "nearest" test_cds2 <- annotate_cds_by_site(test_cds, feat2, all=FALSE, maxgap = "nearest") expect_equal(sum(is.na(fData(test_cds2)$type)), 0) }) #### make_sparse_matrix #### test_that("make_sparse_matrix works", { #skip_on_bioc() df <- data.frame(icol = c("chr18_30209631_30210783", "chr18_45820294_45821666", "chr18_32820116_32820994"), jcol = c("chr18_41888433_41890138", "chr18_33038287_33039444", "chr18_25533921_25534483"), xcol = c(1,2,3)) sm <- make_sparse_matrix(df, "icol", "jcol", "xcol") expect_equal(sm["chr18_30209631_30210783", "chr18_41888433_41890138"], 1) expect_equal(sm["chr18_45820294_45821666", "chr18_33038287_33039444"], 2) expect_equal(sm["chr18_25533921_25534483", "chr18_32820116_32820994"], 3) expect_equal(sm["chr18_25533921_25534483", "chr18_30209631_30210783"], 0) expect_error(make_sparse_matrix(df, "icol", "xcol", "jcol"), "x.name column must be numeric") expect_error(make_sparse_matrix(df, "icol", "hannah", "jcol"), "i.name, j.name, and x.name must be columns in data") }) #### compare_connections #### # IN test-runCicero.R #### find_overlapping_coordinates #### test_that("find_overlapping_coordinates works", { #skip_on_bioc() test_coords <- c("chr18_10025_10225", "chr18_10603_11103", "chr18_11604_13986", "chr18_157883_158536", "chr18_217477_218555", "chr18_245734_246234") expect_equal(length(find_overlapping_coordinates(test_coords, "chr18:10,100-1246234")), 6) expect_equal(length(find_overlapping_coordinates(test_coords, "chr18_10227_10601")), 0) expect_equal(length(find_overlapping_coordinates(test_coords, "chr18_10227_10601", maxgap = 1)), 2) expect_equal(length(find_overlapping_coordinates(test_coords, c("chr18_10227_10602", "chr18:11604-246234"))), 5) expect_equal(length(find_overlapping_coordinates(test_coords, c("chr18_10226_10602", "chr18:11604-246234"), maxgap = 1)), 6) expect(all(is.na(find_overlapping_coordinates(test_coords, c("chr19_10226_10602", "chr19:11604-246234"), maxgap = 1)))) expect(all(is.na(find_overlapping_coordinates(test_coords, c("chr18_1022600_1060200", "chr18:1160400-24623400"), maxgap = 1)))) })
library(dplyr) questions = readLines("questions") choices = readLines("choices") ids = sprintf("ch05_%04d", 1:length(questions)) title1 = "ch05" title2 = "Get it right" title3 = "Complete the sentences" images = readLines("images") audios = "" audiotexts = "" tags = "joke" t0 = paste(ids, title1, title2, title3, questions, choices, images, audios, audiotexts, tags, sep = ";") writeLines(t0, "anki.txt") print("OUTPUT: anki.txt")
/scripts/paste_files.R
permissive
mertnuhoglu/anki_english
R
false
false
435
r
library(dplyr) questions = readLines("questions") choices = readLines("choices") ids = sprintf("ch05_%04d", 1:length(questions)) title1 = "ch05" title2 = "Get it right" title3 = "Complete the sentences" images = readLines("images") audios = "" audiotexts = "" tags = "joke" t0 = paste(ids, title1, title2, title3, questions, choices, images, audios, audiotexts, tags, sep = ";") writeLines(t0, "anki.txt") print("OUTPUT: anki.txt")
#' Modify column headers in gtsummary tables #' #' Column labels can be modified to include calculated statistics; #' e.g. the N can be dynamically included by wrapping it in curly brackets #' (following [glue::glue] syntax). #' #' @param x gtsummary object, e.g. `tbl_summary` or `tbl_regression` #' @param stat_by String specifying text to include above the summary statistics #' stratified by a variable. Only use with stratified `tbl_summary` objects. #' The following fields are available for use in the #' headers: #' * `{n}` number of observations in each group, #' * `{N}` total number of observations, #' * `{p}` percentage in each group, #' * `{level}` the 'by' variable level, #' * `"fisher.test"` for a Fisher's exact test, #' #' Syntax follows [glue::glue], #' e.g. `stat_by = "**{level}**, N = {n} ({style_percent(p)\%})"`. #' The `by` argument from the parent `tbl_summary()` cannot be `NULL`. #' @param ... Specifies column label of any other column in `.$table_body`. #' Argument is the column name, and the value is the new column header #' (e.g. `p.value = "Model P-values"`). Use #' `print(x$table_body)` to see columns available. #' @param text_interpret indicates whether text will be interpreted as markdown (`"md"`) #' or HTML (`"html"`). The text is interpreted with the {gt} package's `md()` or #' `html()` functions. The default is `"md"`, and is ignored when the print engine #' is not {gt}. #' @family tbl_summary tools #' @family tbl_regression tools #' @family tbl_uvregression tools #' @family tbl_survival tools #' @author Daniel D. Sjoberg #' @examples #' # Example 1 ---------------------------------- #' modify_header_ex1 <- #' trial[c("age", "grade", "response")] %>% #' tbl_summary() %>% #' modify_header(stat_0 = "**All Patients**, N = {N}") #' #' # Example 2 ---------------------------------- #' modify_header_ex2 <- #' trial[c("age", "grade", "response", "trt")] %>% #' tbl_summary(by = trt) %>% #' modify_header( #' stat_by = "**{level}**, N = {n} ({style_percent(p, symbol = TRUE)})" #' ) #' @return Function return the same class of gtsummary object supplied #' @export #' @section Example Output: #' \if{html}{Example 1} #' #' \if{html}{\figure{modify_header_ex1.png}{options: width=31\%}} #' #' \if{html}{Example 2} #' #' \if{html}{\figure{modify_header_ex2.png}{options: width=50\%}} modify_header <- function(x, stat_by = NULL, ..., text_interpret = c("md", "html")) { # converting the passed ... to a list, OR if nothing passed to NULL if (length(list(...)) == 0) { passed_dots <- NULL } else { passed_dots <- list(...) } do.call( modify_header_internal, c(list( x = x, stat_by = stat_by, text_interpret = text_interpret, .save_call = TRUE ), passed_dots) ) }
/R/modify_header.R
permissive
ClinicoPath/gtsummary
R
false
false
2,779
r
#' Modify column headers in gtsummary tables #' #' Column labels can be modified to include calculated statistics; #' e.g. the N can be dynamically included by wrapping it in curly brackets #' (following [glue::glue] syntax). #' #' @param x gtsummary object, e.g. `tbl_summary` or `tbl_regression` #' @param stat_by String specifying text to include above the summary statistics #' stratified by a variable. Only use with stratified `tbl_summary` objects. #' The following fields are available for use in the #' headers: #' * `{n}` number of observations in each group, #' * `{N}` total number of observations, #' * `{p}` percentage in each group, #' * `{level}` the 'by' variable level, #' * `"fisher.test"` for a Fisher's exact test, #' #' Syntax follows [glue::glue], #' e.g. `stat_by = "**{level}**, N = {n} ({style_percent(p)\%})"`. #' The `by` argument from the parent `tbl_summary()` cannot be `NULL`. #' @param ... Specifies column label of any other column in `.$table_body`. #' Argument is the column name, and the value is the new column header #' (e.g. `p.value = "Model P-values"`). Use #' `print(x$table_body)` to see columns available. #' @param text_interpret indicates whether text will be interpreted as markdown (`"md"`) #' or HTML (`"html"`). The text is interpreted with the {gt} package's `md()` or #' `html()` functions. The default is `"md"`, and is ignored when the print engine #' is not {gt}. #' @family tbl_summary tools #' @family tbl_regression tools #' @family tbl_uvregression tools #' @family tbl_survival tools #' @author Daniel D. Sjoberg #' @examples #' # Example 1 ---------------------------------- #' modify_header_ex1 <- #' trial[c("age", "grade", "response")] %>% #' tbl_summary() %>% #' modify_header(stat_0 = "**All Patients**, N = {N}") #' #' # Example 2 ---------------------------------- #' modify_header_ex2 <- #' trial[c("age", "grade", "response", "trt")] %>% #' tbl_summary(by = trt) %>% #' modify_header( #' stat_by = "**{level}**, N = {n} ({style_percent(p, symbol = TRUE)})" #' ) #' @return Function return the same class of gtsummary object supplied #' @export #' @section Example Output: #' \if{html}{Example 1} #' #' \if{html}{\figure{modify_header_ex1.png}{options: width=31\%}} #' #' \if{html}{Example 2} #' #' \if{html}{\figure{modify_header_ex2.png}{options: width=50\%}} modify_header <- function(x, stat_by = NULL, ..., text_interpret = c("md", "html")) { # converting the passed ... to a list, OR if nothing passed to NULL if (length(list(...)) == 0) { passed_dots <- NULL } else { passed_dots <- list(...) } do.call( modify_header_internal, c(list( x = x, stat_by = stat_by, text_interpret = text_interpret, .save_call = TRUE ), passed_dots) ) }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/data.R \docType{data} \name{baseflow_data_used_in_first_round_of_SFR.rds} \alias{baseflow_data_used_in_first_round_of_SFR.rds} \title{[DATASET] Baseflow used in initial MODFLOW/SFR application} \format{A data frame with 874453 rows and 4 variables: \itemize{ \item{\code{siteNo}}{character USGS gage ID.} \item{\code{Date}}{date Date associated with baseflow estimate. } \item{\code{baseFlow}}{double Estimated baseflow, in cubic feet per second.} \item{\code{comment}}{character One of 'estimated gaged', 'estimated ungaged', or 'calculated'.} }} \usage{ readr::read_rds("data/baseflow_data_used_in_first_round_of_SFR.rds") } \description{ Original random forest model output as supplied to the MODFLOW modelers. } \details{ This is the data file used in the initial application of the SFR MODFLOW package as applied to the MERAS study area. The file contains a mix of random forest model forecasts and observed values for baseflow. Values with a comment field value of 'estimated ungaged' or 'estimated gaged' represent outputs from the random forest model. Values with the comment field listed as 'calculated' represent observed values of baseflow as calculated from streamflow records using hydrograph separation methods. } \keyword{datasets}
/man/baseflow_data_used_in_first_round_of_SFR.rds.Rd
no_license
ldecicco-USGS/mapRandomForest
R
false
true
1,333
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/data.R \docType{data} \name{baseflow_data_used_in_first_round_of_SFR.rds} \alias{baseflow_data_used_in_first_round_of_SFR.rds} \title{[DATASET] Baseflow used in initial MODFLOW/SFR application} \format{A data frame with 874453 rows and 4 variables: \itemize{ \item{\code{siteNo}}{character USGS gage ID.} \item{\code{Date}}{date Date associated with baseflow estimate. } \item{\code{baseFlow}}{double Estimated baseflow, in cubic feet per second.} \item{\code{comment}}{character One of 'estimated gaged', 'estimated ungaged', or 'calculated'.} }} \usage{ readr::read_rds("data/baseflow_data_used_in_first_round_of_SFR.rds") } \description{ Original random forest model output as supplied to the MODFLOW modelers. } \details{ This is the data file used in the initial application of the SFR MODFLOW package as applied to the MERAS study area. The file contains a mix of random forest model forecasts and observed values for baseflow. Values with a comment field value of 'estimated ungaged' or 'estimated gaged' represent outputs from the random forest model. Values with the comment field listed as 'calculated' represent observed values of baseflow as calculated from streamflow records using hydrograph separation methods. } \keyword{datasets}
## ============================================================================= ## A descriptive analysis of the SARS-CoV-2 pandemy in 2020 ## ============================================================================= library("openxlsx") # ------------------------------------------------------------------------------ # The data consists of CSV file. Each gives a daily report of the number of # infections, deaths, and so on. They will be read in in the following and # pre-processed to a single data frame. # ------------------------------------------------------------------------------ # Read single date from file. data_20200318 <- read.csv("./data/raw/03-18-2020.csv", stringsAsFactors = FALSE) # Convert Last.Update column from string to date. Daytime is dropped. data_20200318$Last.Update <- as.Date(data_20200318$Last.Update, "%Y-%m-%d") # Sum cases for all regions of one country. sum_country <- aggregate( cbind(Confirmed, Deaths, Recovered) ~ Country.Region, data = data_20200318, sum ) # Select the latest date of update of all regions of one country as the date of # last update for the whole country. update_country <- aggregate( Last.Update ~ Country.Region, data = data_20200318, max ) # Create final processed data frame and ovwerwrite the raw data. data_20200318 <- merge(sum_country, update_country) # ------------------------------------------------------------------------------ # The pre-processed data is written to a file. # ------------------------------------------------------------------------------ # Write to a CSV file. write.csv( data_20200318, "./data/processed/processed_data.csv", row.names = FALSE ) # Write to an Excel file. write.xlsx(data_20200318, "./data/processed/processed_data.xlsx")
/projects/corona/analysis.R
no_license
RSchleutker/RWorkshop
R
false
false
1,764
r
## ============================================================================= ## A descriptive analysis of the SARS-CoV-2 pandemy in 2020 ## ============================================================================= library("openxlsx") # ------------------------------------------------------------------------------ # The data consists of CSV file. Each gives a daily report of the number of # infections, deaths, and so on. They will be read in in the following and # pre-processed to a single data frame. # ------------------------------------------------------------------------------ # Read single date from file. data_20200318 <- read.csv("./data/raw/03-18-2020.csv", stringsAsFactors = FALSE) # Convert Last.Update column from string to date. Daytime is dropped. data_20200318$Last.Update <- as.Date(data_20200318$Last.Update, "%Y-%m-%d") # Sum cases for all regions of one country. sum_country <- aggregate( cbind(Confirmed, Deaths, Recovered) ~ Country.Region, data = data_20200318, sum ) # Select the latest date of update of all regions of one country as the date of # last update for the whole country. update_country <- aggregate( Last.Update ~ Country.Region, data = data_20200318, max ) # Create final processed data frame and ovwerwrite the raw data. data_20200318 <- merge(sum_country, update_country) # ------------------------------------------------------------------------------ # The pre-processed data is written to a file. # ------------------------------------------------------------------------------ # Write to a CSV file. write.csv( data_20200318, "./data/processed/processed_data.csv", row.names = FALSE ) # Write to an Excel file. write.xlsx(data_20200318, "./data/processed/processed_data.xlsx")
install.packages(c("rvest","XML","magrittr")) library(rvest) library(XML) library(magrittr) # Amazon Reviews ############################# aurl <- "https://www.amazon.in/Redmi-Note-Neptune-Blue-128GB/dp/B07SSGJYH3/ref=sr_1_1?dchild=1&keywords=mi+note7pro+reviews&qid=1591598741&sr=8-1#customerReviews" amazon_reviews <- NULL for (i in 1:10){ murl <- read_html(as.character(paste(aurl,i,sep="="))) rev <- murl %>% html_nodes(".review-text") %>% html_text() amazon_reviews <- c(amazon_reviews,rev) } length(amazon_reviews) write.table(amazon_reviews,"apple.txt",row.names = F) install.packages("tm") # for text mining install.packages(c("SnowballC","textstem")) # for text stemming install.packages("wordcloud") # word-cloud generator install.packages("RColorBrewer") # color palettes library('tm') library("SnowballC") library("wordcloud") library("RColorBrewer") library('textstem') # Importing apple reviews data x <- as.character(amazon_reviews) x <- iconv(x, "UTF-8") #Unicode Transformation Format. The '8' means it uses 8-bit blocks to represent a character # Load the data as a corpus x <- Corpus(VectorSource(x)) inspect(x[1]) # Convert the text to lower case x1 <- tm_map(x, tolower) inspect(x1[1]) # Remove numbers x1 <- tm_map(x1, removeNumbers) # Remove punctuations x1 <- tm_map(x1, removePunctuation) # Remove english common stopwords x1 <- tm_map(x1, removeWords, stopwords('english')) # Remove your own stop word # specify your stopwords as a character vector x1 <- tm_map(x1, removeWords, c("phone", "mi","the","will")) #striping white spaces x1 <- tm_map(x1, stripWhitespace) inspect(x1[1]) # Text stemming x1<-lemmatize_words(x1) #x1 <- tm_map(x1, stemDocument) # Term document matrix # converting unstructured data to structured format using TDM tdm <- TermDocumentMatrix(x1) tdm <- as.matrix(tdm) #Frequency v <- sort(rowSums(tdm),decreasing=TRUE) d <- data.frame(word = names(v),freq=v) head(d, 10) # Bar plot w <- rowSums(tdm) w_sub <- subset(w, w >= 10) barplot(w_sub, las=3, col = rainbow(20)) # Term laptop repeats in all most all documents x1 <- tm_map(x1, removeWords, c('phone','air',"mobile",'can','will',"amazon",'phone','mi','product')) x1 <- tm_map(x1, stripWhitespace) tdm <- TermDocumentMatrix(x1) tdm <- as.matrix(tdm) w1 <- rowSums(tdm) # Word cloud #with all the words wordcloud(words = names(w1), freq = w1, random.order = F, colors = rainbow(20), scale=c(2,.2), rot.per = 0.3) # lOADING +VE AND -VE dictonaries pos.words = scan(file.choose(), what="character", comment.char=";") neg.words = scan(file.choose(), what="character", comment.char=";") pos.words = c(pos.words,"wow", "kudos", "hurray") # Positive wordcloud pos.matches = match(names(w), c(pos.words)) pos.matches = !is.na(pos.matches) freq_pos <- w[pos.matches] p_names <- names(freq_pos) wordcloud(p_names,freq_pos,scale=c(3.5,.2),colors = rainbow(20)) # Negative wordcloud neg.matches = match(names(w), c(neg.words)) neg.matches = !is.na(neg.matches) freq_neg <- w[neg.matches] n_names <- names(freq_neg) wordcloud(n_names,freq_neg,scale=c(3.5,.2),colors = brewer.pal(8,"Dark2")) #Association between words tdm <- TermDocumentMatrix(x1) findAssocs(tdm, c("screen"),corlimit = 0.3) # Sentiment Analysis # library(syuzhet) library(lubridate) library(ggplot2) library(scales) library(reshape2) library(dplyr) # Read File amzon_reviews <- read.delim('apple.TXT') reviews <- as.character(amzon_reviews[-1,]) class(reviews) # Obtain Sentiment scores s <- get_nrc_sentiment(reviews) head(s) reviews[6] # on tweet 6, you have 3 for anger,8 for anticipation ,2 for disgust ,4 for fear # 4 for joy, each one for sadness and surprise, 8 for trust , 9 words for negative and 10 positive. get_nrc_sentiment('ridiculous') #ridiculous has 1 anger 1 disgust and 1 negative # barplot barplot(colSums(s), las = 2.5, col = rainbow(10),ylab = 'Count',main= 'Sentiment scores for Amazon Reviews for mobile')
/amazon.r
no_license
Swetapadma94/Text-Mining
R
false
false
4,052
r
install.packages(c("rvest","XML","magrittr")) library(rvest) library(XML) library(magrittr) # Amazon Reviews ############################# aurl <- "https://www.amazon.in/Redmi-Note-Neptune-Blue-128GB/dp/B07SSGJYH3/ref=sr_1_1?dchild=1&keywords=mi+note7pro+reviews&qid=1591598741&sr=8-1#customerReviews" amazon_reviews <- NULL for (i in 1:10){ murl <- read_html(as.character(paste(aurl,i,sep="="))) rev <- murl %>% html_nodes(".review-text") %>% html_text() amazon_reviews <- c(amazon_reviews,rev) } length(amazon_reviews) write.table(amazon_reviews,"apple.txt",row.names = F) install.packages("tm") # for text mining install.packages(c("SnowballC","textstem")) # for text stemming install.packages("wordcloud") # word-cloud generator install.packages("RColorBrewer") # color palettes library('tm') library("SnowballC") library("wordcloud") library("RColorBrewer") library('textstem') # Importing apple reviews data x <- as.character(amazon_reviews) x <- iconv(x, "UTF-8") #Unicode Transformation Format. The '8' means it uses 8-bit blocks to represent a character # Load the data as a corpus x <- Corpus(VectorSource(x)) inspect(x[1]) # Convert the text to lower case x1 <- tm_map(x, tolower) inspect(x1[1]) # Remove numbers x1 <- tm_map(x1, removeNumbers) # Remove punctuations x1 <- tm_map(x1, removePunctuation) # Remove english common stopwords x1 <- tm_map(x1, removeWords, stopwords('english')) # Remove your own stop word # specify your stopwords as a character vector x1 <- tm_map(x1, removeWords, c("phone", "mi","the","will")) #striping white spaces x1 <- tm_map(x1, stripWhitespace) inspect(x1[1]) # Text stemming x1<-lemmatize_words(x1) #x1 <- tm_map(x1, stemDocument) # Term document matrix # converting unstructured data to structured format using TDM tdm <- TermDocumentMatrix(x1) tdm <- as.matrix(tdm) #Frequency v <- sort(rowSums(tdm),decreasing=TRUE) d <- data.frame(word = names(v),freq=v) head(d, 10) # Bar plot w <- rowSums(tdm) w_sub <- subset(w, w >= 10) barplot(w_sub, las=3, col = rainbow(20)) # Term laptop repeats in all most all documents x1 <- tm_map(x1, removeWords, c('phone','air',"mobile",'can','will',"amazon",'phone','mi','product')) x1 <- tm_map(x1, stripWhitespace) tdm <- TermDocumentMatrix(x1) tdm <- as.matrix(tdm) w1 <- rowSums(tdm) # Word cloud #with all the words wordcloud(words = names(w1), freq = w1, random.order = F, colors = rainbow(20), scale=c(2,.2), rot.per = 0.3) # lOADING +VE AND -VE dictonaries pos.words = scan(file.choose(), what="character", comment.char=";") neg.words = scan(file.choose(), what="character", comment.char=";") pos.words = c(pos.words,"wow", "kudos", "hurray") # Positive wordcloud pos.matches = match(names(w), c(pos.words)) pos.matches = !is.na(pos.matches) freq_pos <- w[pos.matches] p_names <- names(freq_pos) wordcloud(p_names,freq_pos,scale=c(3.5,.2),colors = rainbow(20)) # Negative wordcloud neg.matches = match(names(w), c(neg.words)) neg.matches = !is.na(neg.matches) freq_neg <- w[neg.matches] n_names <- names(freq_neg) wordcloud(n_names,freq_neg,scale=c(3.5,.2),colors = brewer.pal(8,"Dark2")) #Association between words tdm <- TermDocumentMatrix(x1) findAssocs(tdm, c("screen"),corlimit = 0.3) # Sentiment Analysis # library(syuzhet) library(lubridate) library(ggplot2) library(scales) library(reshape2) library(dplyr) # Read File amzon_reviews <- read.delim('apple.TXT') reviews <- as.character(amzon_reviews[-1,]) class(reviews) # Obtain Sentiment scores s <- get_nrc_sentiment(reviews) head(s) reviews[6] # on tweet 6, you have 3 for anger,8 for anticipation ,2 for disgust ,4 for fear # 4 for joy, each one for sadness and surprise, 8 for trust , 9 words for negative and 10 positive. get_nrc_sentiment('ridiculous') #ridiculous has 1 anger 1 disgust and 1 negative # barplot barplot(colSums(s), las = 2.5, col = rainbow(10),ylab = 'Count',main= 'Sentiment scores for Amazon Reviews for mobile')
#' @examples #' cols <- c("#FCAE91", "#FB6A4A", "#CB181D", "#BDD7E7", "#6BAED6", "#2171B5") #' ggpar(vars = list("gear", "cyl", "gear"), data=mtcars) + #' # method="hammock", text.angle=0, ratio=0.2) + #' scale_fill_manual(values=cols) + scale_colour_manual(values=cols) + #' theme_bw() #' mtcars$cyl <- factor(mtcars$cyl, levels = c("8","6","4")) #' mtcars$gear <- factor(mtcars$gear) #' ggpar(list("gear", "cyl", "gear"), data=mtcars) #' ggpar(list("cyl", "gear", "cyl"), data=mtcars) ggpar <- function (data, vars, width = 0.25, alpha = 0.6, labels = TRUE, method = "parset", ...) { get_ribbons <- function(xpos, dx, dy) { dframe <- data.frame(dx = dx, dy = dy) dxy <- dframe %>% group_by(dx, dy) %>% tally() dxy$ypos <- sum(dxy$n) - cumsum(dxy$n) dxy$xpos <- xpos + width/2 dyx <- dframe %>% group_by(dy, dx) %>% tally() dyx$ypos <- sum(dyx$n) - cumsum(dyx$n) dyx$xpos <- xpos + 1 - width/2 dfm <- rbind(dxy, dyx) if (method == "parset") { gr <- geom_ribbon(aes(x=xpos, ymin=ypos, ymax= ypos+n, group=interaction(dx, dy), fill=dx, colour=dx), alpha = alpha, data = dfm) } if (method == "hammock") { gr <- geom_ribbon(aes(x=xpos, ymin=ypos, ymax= ypos+n, group=interaction(dx, dy), fill=dx, colour=dx), alpha = alpha, data = dfm) } gr } stopifnot(length(vars) >= 2) data_ <- data[,as.character(vars)] for (i in 1:length(vars)) { data_[,i] <- as.factor(data_[,i]) levels(data_[,i]) <- paste(vars[[i]], levels(data_[,i]), sep=":") } data__ <- suppressWarnings(tidyr::gather(data_, factor_key = TRUE)) bars <- list(geom_bar(data = data__, aes(x = key, color = value, fill=value), width = width, ...), scale_x_discrete("", labels = as.character(vars))) ribbons <- list() for (i in 1:(length(vars)-1)) { ribbons[[i]] <- get_ribbons(i, data_[,i], data_[,i+1]) } label <- list() if (labels) { for (i in 1:(length(vars))) { browser() dx <- data_%>% group_by_(vars[[i]]) %>% tally() dx$xpos <- i dx$ypos <- sum(dx$n) - cumsum(dx$n) + dx$n/2 names(dx)[1] <- "key" # browser() dx <- dx %>% tidyr::separate(key, into=c("key", "value"), sep =":") label[[i]] <- list( geom_text(aes(x = xpos, y = ypos, label = value), colour = "grey10", nudge_x = .01, nudge_y = 1/sum(dx$n), data = dx), geom_text(aes(x = xpos, y = ypos, label = value), colour = "grey90", data = dx)) } } ggplot() +ribbons + bars + label }
/inst/new-try.R
no_license
cran/ggparallel
R
false
false
2,721
r
#' @examples #' cols <- c("#FCAE91", "#FB6A4A", "#CB181D", "#BDD7E7", "#6BAED6", "#2171B5") #' ggpar(vars = list("gear", "cyl", "gear"), data=mtcars) + #' # method="hammock", text.angle=0, ratio=0.2) + #' scale_fill_manual(values=cols) + scale_colour_manual(values=cols) + #' theme_bw() #' mtcars$cyl <- factor(mtcars$cyl, levels = c("8","6","4")) #' mtcars$gear <- factor(mtcars$gear) #' ggpar(list("gear", "cyl", "gear"), data=mtcars) #' ggpar(list("cyl", "gear", "cyl"), data=mtcars) ggpar <- function (data, vars, width = 0.25, alpha = 0.6, labels = TRUE, method = "parset", ...) { get_ribbons <- function(xpos, dx, dy) { dframe <- data.frame(dx = dx, dy = dy) dxy <- dframe %>% group_by(dx, dy) %>% tally() dxy$ypos <- sum(dxy$n) - cumsum(dxy$n) dxy$xpos <- xpos + width/2 dyx <- dframe %>% group_by(dy, dx) %>% tally() dyx$ypos <- sum(dyx$n) - cumsum(dyx$n) dyx$xpos <- xpos + 1 - width/2 dfm <- rbind(dxy, dyx) if (method == "parset") { gr <- geom_ribbon(aes(x=xpos, ymin=ypos, ymax= ypos+n, group=interaction(dx, dy), fill=dx, colour=dx), alpha = alpha, data = dfm) } if (method == "hammock") { gr <- geom_ribbon(aes(x=xpos, ymin=ypos, ymax= ypos+n, group=interaction(dx, dy), fill=dx, colour=dx), alpha = alpha, data = dfm) } gr } stopifnot(length(vars) >= 2) data_ <- data[,as.character(vars)] for (i in 1:length(vars)) { data_[,i] <- as.factor(data_[,i]) levels(data_[,i]) <- paste(vars[[i]], levels(data_[,i]), sep=":") } data__ <- suppressWarnings(tidyr::gather(data_, factor_key = TRUE)) bars <- list(geom_bar(data = data__, aes(x = key, color = value, fill=value), width = width, ...), scale_x_discrete("", labels = as.character(vars))) ribbons <- list() for (i in 1:(length(vars)-1)) { ribbons[[i]] <- get_ribbons(i, data_[,i], data_[,i+1]) } label <- list() if (labels) { for (i in 1:(length(vars))) { browser() dx <- data_%>% group_by_(vars[[i]]) %>% tally() dx$xpos <- i dx$ypos <- sum(dx$n) - cumsum(dx$n) + dx$n/2 names(dx)[1] <- "key" # browser() dx <- dx %>% tidyr::separate(key, into=c("key", "value"), sep =":") label[[i]] <- list( geom_text(aes(x = xpos, y = ypos, label = value), colour = "grey10", nudge_x = .01, nudge_y = 1/sum(dx$n), data = dx), geom_text(aes(x = xpos, y = ypos, label = value), colour = "grey90", data = dx)) } } ggplot() +ribbons + bars + label }
#!/usr/bin/env Rscript #reduce_covSums.R #PARSE ARUGMENTS suppressMessages(library(optparse)) suppressMessages(library(tidyverse)) suppressMessages(library(tidyverse)) suppressMessages(library(plotrix)) suppressMessages(library(EnvStats)) option_list = list( make_option(c("--cov"), type="character", default=NULL, help="covInfile"), make_option(c("--bed"), type="character", default=NULL, help="bedInfile"), make_option(c("--minCount"), type="integer", default=1, help="Minimum number of reads a site must have to be counted"), make_option(c("--minRep"), type="double", default=0, help="Minimum proportion of samples with filter passing data for the site to be kept"), make_option(c("--pFalsePos"), type="double", default=0.01, help="Minimum proportion of samples with filter passing data for the site to be kept"), make_option(c("--methAlpha"), type="double", default=0.05, help="Theshold for type 1 error for calling a site methylated given probability of false methylation call pFalsePos"), make_option(c("--o"), type="character", default='gbm_stats', help="Output name") ) print("Parsing arugments...") opt_parser = OptionParser(option_list=option_list); opt = parse_args(opt_parser); covFile = opt$cov bedFile = opt$bed minCount = opt$minCount minRep = opt$minRep propFalsePos = opt$pFalsePos methAlpha = opt$methAlpha outName = opt$o #function to summarize stats getStats = function(inputDF, gout){ inputDF %>% summarize(chr=uchr, start = s, end = e, name = name, nM = sum(nM, na.rm=TRUE), nU = sum(nU, na.rm=TRUE), NcpgMeasured = n(), Nmcpg = sum(methylated), mCpG_per_CpG = Nmcpg/NcpgMeasured, fracMeth = sum(nM, na.rm=TRUE) / ( sum(nM, na.rm=TRUE) + sum(nU, na.rm=TRUE)), mnMeth = mean(pct.meth, na.rm=TRUE), medMeth = median(pct.meth, na.rm=TRUE), #geoMnMeth = geomMean(mPct, na.rm=TRUE), sdMeth = sd(pct.meth), stdErrMeth = std.error(pct.meth), maxMeth = max(pct.meth), minMeth = min(pct.meth)) } #READ IN DATA print('Reading in bed file...') bdat = read.table(bedFile, stringsAsFactors=FALSE) colnames(bdat)=c('chr', 'start', 'end', 'name') bdat = as_tibble(bdat) print('Reading in cov file...') cdat = read.table(covFile, stringsAsFactors=FALSE) colnames(cdat)=c('chr', 'start', 'end', 'pct.meth', 'nM', 'nU', 'fileName') cdat = as_tibble(cdat) uchrs0 = unique(bdat$chr) uchrs = uchrs0[uchrs0 %in% cdat$chr] if (length(uchrs)==0){ print('No gene regions found in this cov file.') print('Exiting') quit() } res = data.frame() #LOOP THROUGH CHROMOSOMES AND GENES for (chrNum in 1:length(uchrs)){ uchr=uchrs[chrNum] print(paste(uchr, '...', sep='')) if (chrNum %% 100 == 0){ print(paste('chr', chrNum, 'of', length(uchrs))) } csub = cdat %>% filter(chr==uchr) bsub = bdat %>% filter(chr==uchr) if (nrow(csub)==0){ next } for (i in 1:nrow(bsub)){ s=as.numeric(bsub[i,'start']) e=as.numeric(bsub[i,'end']) name=as.character(bsub[i,'name']) wsub = csub %>% filter(start >= s, end <= e) if (nrow(wsub) > 0){ dat=wsub #DO MIN COUNT FILTER # print("Filtering by read count...") f1 = dat %>% mutate(tot=nM+nU) %>% filter(tot>=minCount) before=nrow(dat) after=nrow(f1) pct = round(after/before, digits=3)*100 #print(paste(c(pct, '% of sites passed minCount >= ', minCount), collapse='')) #DO MIN REP FILTER # print('Filtering by representation...') totSamples = length(unique(f1$fileName)) keepSites = f1 %>% group_by(chr, start, end) %>% summarize(N=n(), rep=n()/totSamples, keep= (n()/totSamples) >=minRep) %>% filter(keep) f2 = f1 %>% filter(chr %in% keepSites$chr & start %in% keepSites$start) before = nrow(f1) after = nrow(f2) pct = round(after/before, digits=3)*100 #print(paste(c(pct, '% of sites passed minRep >= ', minRep), collapse='')) #MAKE METHYLATION CALLS FOR EACH SAMPLE # print('Making site methylation calls...') f3 = f2 %>% mutate(pFalsePos = unlist(map2(.x=nM, .y=tot, ~ binom.test(.x, .y, propFalsePos, alternative="greater")$p.value)) ) #CALL METH AND MERGE UP WITH GFF DATA FOR LENGTHS mdat = f3 %>% mutate(methylated = pFalsePos < methAlpha, mPct = nM/(nM+nU)) NcpgMeasured = length((mdat$start)) Nmcpg = sum(mdat$methylated) #funciton to write out stats subres = getStats(mdat) res = rbind(res, subres) } } } print(paste('writing results to', outName)) write_tsv(res, path=outName)
/processing_scripts/basic_methylation_from_bed.R
no_license
grovesdixon/invert_meth_and_transcription
R
false
false
5,003
r
#!/usr/bin/env Rscript #reduce_covSums.R #PARSE ARUGMENTS suppressMessages(library(optparse)) suppressMessages(library(tidyverse)) suppressMessages(library(tidyverse)) suppressMessages(library(plotrix)) suppressMessages(library(EnvStats)) option_list = list( make_option(c("--cov"), type="character", default=NULL, help="covInfile"), make_option(c("--bed"), type="character", default=NULL, help="bedInfile"), make_option(c("--minCount"), type="integer", default=1, help="Minimum number of reads a site must have to be counted"), make_option(c("--minRep"), type="double", default=0, help="Minimum proportion of samples with filter passing data for the site to be kept"), make_option(c("--pFalsePos"), type="double", default=0.01, help="Minimum proportion of samples with filter passing data for the site to be kept"), make_option(c("--methAlpha"), type="double", default=0.05, help="Theshold for type 1 error for calling a site methylated given probability of false methylation call pFalsePos"), make_option(c("--o"), type="character", default='gbm_stats', help="Output name") ) print("Parsing arugments...") opt_parser = OptionParser(option_list=option_list); opt = parse_args(opt_parser); covFile = opt$cov bedFile = opt$bed minCount = opt$minCount minRep = opt$minRep propFalsePos = opt$pFalsePos methAlpha = opt$methAlpha outName = opt$o #function to summarize stats getStats = function(inputDF, gout){ inputDF %>% summarize(chr=uchr, start = s, end = e, name = name, nM = sum(nM, na.rm=TRUE), nU = sum(nU, na.rm=TRUE), NcpgMeasured = n(), Nmcpg = sum(methylated), mCpG_per_CpG = Nmcpg/NcpgMeasured, fracMeth = sum(nM, na.rm=TRUE) / ( sum(nM, na.rm=TRUE) + sum(nU, na.rm=TRUE)), mnMeth = mean(pct.meth, na.rm=TRUE), medMeth = median(pct.meth, na.rm=TRUE), #geoMnMeth = geomMean(mPct, na.rm=TRUE), sdMeth = sd(pct.meth), stdErrMeth = std.error(pct.meth), maxMeth = max(pct.meth), minMeth = min(pct.meth)) } #READ IN DATA print('Reading in bed file...') bdat = read.table(bedFile, stringsAsFactors=FALSE) colnames(bdat)=c('chr', 'start', 'end', 'name') bdat = as_tibble(bdat) print('Reading in cov file...') cdat = read.table(covFile, stringsAsFactors=FALSE) colnames(cdat)=c('chr', 'start', 'end', 'pct.meth', 'nM', 'nU', 'fileName') cdat = as_tibble(cdat) uchrs0 = unique(bdat$chr) uchrs = uchrs0[uchrs0 %in% cdat$chr] if (length(uchrs)==0){ print('No gene regions found in this cov file.') print('Exiting') quit() } res = data.frame() #LOOP THROUGH CHROMOSOMES AND GENES for (chrNum in 1:length(uchrs)){ uchr=uchrs[chrNum] print(paste(uchr, '...', sep='')) if (chrNum %% 100 == 0){ print(paste('chr', chrNum, 'of', length(uchrs))) } csub = cdat %>% filter(chr==uchr) bsub = bdat %>% filter(chr==uchr) if (nrow(csub)==0){ next } for (i in 1:nrow(bsub)){ s=as.numeric(bsub[i,'start']) e=as.numeric(bsub[i,'end']) name=as.character(bsub[i,'name']) wsub = csub %>% filter(start >= s, end <= e) if (nrow(wsub) > 0){ dat=wsub #DO MIN COUNT FILTER # print("Filtering by read count...") f1 = dat %>% mutate(tot=nM+nU) %>% filter(tot>=minCount) before=nrow(dat) after=nrow(f1) pct = round(after/before, digits=3)*100 #print(paste(c(pct, '% of sites passed minCount >= ', minCount), collapse='')) #DO MIN REP FILTER # print('Filtering by representation...') totSamples = length(unique(f1$fileName)) keepSites = f1 %>% group_by(chr, start, end) %>% summarize(N=n(), rep=n()/totSamples, keep= (n()/totSamples) >=minRep) %>% filter(keep) f2 = f1 %>% filter(chr %in% keepSites$chr & start %in% keepSites$start) before = nrow(f1) after = nrow(f2) pct = round(after/before, digits=3)*100 #print(paste(c(pct, '% of sites passed minRep >= ', minRep), collapse='')) #MAKE METHYLATION CALLS FOR EACH SAMPLE # print('Making site methylation calls...') f3 = f2 %>% mutate(pFalsePos = unlist(map2(.x=nM, .y=tot, ~ binom.test(.x, .y, propFalsePos, alternative="greater")$p.value)) ) #CALL METH AND MERGE UP WITH GFF DATA FOR LENGTHS mdat = f3 %>% mutate(methylated = pFalsePos < methAlpha, mPct = nM/(nM+nU)) NcpgMeasured = length((mdat$start)) Nmcpg = sum(mdat$methylated) #funciton to write out stats subres = getStats(mdat) res = rbind(res, subres) } } } print(paste('writing results to', outName)) write_tsv(res, path=outName)
# Function: Format Columns format_cols <- function(cols) { # format cols formatted_cols <- cols %>% # to lower case str_to_lower() %>% # eliminate white space, special characters...etc. str_replace_all(pattern = " ", replacement = "_") %>% str_replace_all(pattern = "\\.", replacement = "_") %>% str_replace_all(pattern = "\\,", replacement = "_") %>% str_replace_all(pattern = "\\-", replacement = "_") %>% str_replace_all(pattern = "\\(", replacement = "") %>% str_replace_all(pattern = "\\)", replacement = "") %>% str_replace_all(pattern = "\\%", replacement = "pct") %>% str_replace_all(pattern = "\\$", replacement = "usd") %>% str_replace_all(pattern = "\\?", replacement = "") %>% str_replace_all(pattern = "\\!", replacement = "") %>% str_replace_all(pattern = "\\#", replacement = "") %>% # add an "_" if starting with a numeric str_replace(pattern = "(^\\d+)(.*)", replacement = "col_\\1\\2") # return formatted cols return(formatted_cols) } # Function: Parse TXT File parse_txt <- function(path) { # reading txt by lines mapping_txt <- readLines(path) # parameters n_row <- length(mapping_txt) flag <- rep(1, n_row) var_name <- vector(mode = "character", length = n_row) var_desc <- vector(mode = "character", length = n_row) level_code <- vector(mode = "character", length = n_row) level_desc <- vector(mode = "character", length = n_row) # parse rows for (i in seq_along(mapping_txt)) { # if blank row then skip if (mapping_txt[i] %in% c("\t\t", "", "\t", " \t", " ", "\t\t\t", " ")) { flag[i] <- 0 } # parsing variable name and description if (str_detect(mapping_txt[i], "^\\w*: .*")) { #flag[i] <- 0 var_name[i] <- str_trim(str_split(string = mapping_txt[i], pattern = ":")[[1]][1]) var_desc[i] <- str_trim(str_split(string = mapping_txt[i], pattern = ":")[[1]][2]) # parsing variable levels } else { var_name[i] <- var_name[i - 1] var_desc[i] <- var_desc[i - 1] level_code[i] <- str_trim(str_split(string = mapping_txt[i], pattern = "\t")[[1]][1]) level_desc[i] <- str_split(string = mapping_txt[i], pattern = "\t")[[1]][2] } } # bind columns into a dataframe output_df <- bind_cols(flag = flag, variable_name = var_name, variable_description = var_desc, level_code = level_code, level_description = level_desc) %>% filter(flag == 1) %>% select(-flag) # output return(output_df) } # Function: recode columns recode_columns <- function(mappin_df, col, col_name) { # recode if (col_name %in% unique(mapping_df[["variable_name"]])) { recoded_col <- plyr::mapvalues(x = col, from = mapping_df[mapping_df[["variable_name"]] == col_name, "level_code", drop = T], to = mapping_df[mapping_df[["variable_name"]] == col_name, "level_description", drop = T], warn_missing = F) %>% as.character() } else{ recoded_col <- col } # output return(recoded_col) } # Function: Calculate R2 calc_r2 <- function(actual, prediction) { # residual sum of squares rss <- sum((prediction - actual)^2) # total sum of squares tss <- sum((actual - mean(actual))^2) ## total sum of squares # r2 r2 <- 1 - rss/tss # output return(r2) } # Function: remove missing levels remove_missing_levels <- function(model, test_df) { # drop empty factor levels in test data test_df <- test_df %>% droplevels() # do nothing if no factors are present if (length(model[["xlevels"]]) == 0) { return(test_df) } # extract model factors and levels model_factors_df <- map2(.x = names(model$xlevels), .y = model$xlevels, .f = function(factor, levels) data.frame(factor, levels, stringsAsFactors = F)) %>% bind_rows() # select column names in test data that are factor predictors in trained model predictors <- names(test_df[names(test_df) %in% model_factors_df[["factor"]]]) # for each factor predictor in your data, if the level is not in the model set the value to NA for (i in seq_along(predictors)) { # identify model levels model_levels <- model_factors_df[model_factors_df[["factor"]] == predictors[i], "levels", drop = T] # identify test levels test_levels <- test_df[, predictors[i]] # found flag found_flag <- test_levels %in% model_levels # if any missing, then set to NA if (any(!found_flag)) { # missing levels missing_levels <- str_c(as.character(unique(test_levels[!found_flag])), collapse = ",") # set to NA test_df[!found_flag, predictors[i]] <- NA # drop empty factor levels in test data test_df <- test_df %>% droplevels() # message console message(glue("In {predictors[i]}: setting missing level(s) {missing_levels} to NA")) } } # output return(test_df) } # Function: find optimal cp find_optimal_cp <- function(cptable, cv_sd_flag) { # define the minimum cross-validated error index_min_error <- which.min(cptable[, 4]) # min error min_error <- cptable[index_min_error, 4] # min error sd sd_min_error <- cptable[index_min_error, 5] # optimum line if (cv_sd_flag == 1) { optimal_line <- min_error + sd_min_error } else { optimal_line <- min_error } # optimal cp index optimal_cp_index <- which.min(abs((cptable[, 4] - optimal_line))) # optimal cp optimal_cp <- cptable[optimal_cp_index, 1] # output return(optimal_cp) } # Function: plot variable importance plot_variable_importance <- function(variable, score, scale = T, top_n, model_type) { # scale if needed if (scale == T) { score <- score/sum(score) * 100 } # create data frame importance_df <- data.frame(variable, score) %>% arrange(desc(score)) # filter if (!is.na(top_n)) { importance_df <- importance_df[1:top_n, ] } # plot ggplot(data = importance_df, mapping = aes(x = reorder(variable, score), y = score)) + geom_bar(stat = "identity") + #labs(title = "Variable Importance - RANGER") + ggtitle(label = str_c("Variable Importance", model_type, sep = " - ")) + xlab("variable") + ylab("importance scores in %") + coord_flip() }
/src/utils.R
no_license
matescharnitzky/regression
R
false
false
6,596
r
# Function: Format Columns format_cols <- function(cols) { # format cols formatted_cols <- cols %>% # to lower case str_to_lower() %>% # eliminate white space, special characters...etc. str_replace_all(pattern = " ", replacement = "_") %>% str_replace_all(pattern = "\\.", replacement = "_") %>% str_replace_all(pattern = "\\,", replacement = "_") %>% str_replace_all(pattern = "\\-", replacement = "_") %>% str_replace_all(pattern = "\\(", replacement = "") %>% str_replace_all(pattern = "\\)", replacement = "") %>% str_replace_all(pattern = "\\%", replacement = "pct") %>% str_replace_all(pattern = "\\$", replacement = "usd") %>% str_replace_all(pattern = "\\?", replacement = "") %>% str_replace_all(pattern = "\\!", replacement = "") %>% str_replace_all(pattern = "\\#", replacement = "") %>% # add an "_" if starting with a numeric str_replace(pattern = "(^\\d+)(.*)", replacement = "col_\\1\\2") # return formatted cols return(formatted_cols) } # Function: Parse TXT File parse_txt <- function(path) { # reading txt by lines mapping_txt <- readLines(path) # parameters n_row <- length(mapping_txt) flag <- rep(1, n_row) var_name <- vector(mode = "character", length = n_row) var_desc <- vector(mode = "character", length = n_row) level_code <- vector(mode = "character", length = n_row) level_desc <- vector(mode = "character", length = n_row) # parse rows for (i in seq_along(mapping_txt)) { # if blank row then skip if (mapping_txt[i] %in% c("\t\t", "", "\t", " \t", " ", "\t\t\t", " ")) { flag[i] <- 0 } # parsing variable name and description if (str_detect(mapping_txt[i], "^\\w*: .*")) { #flag[i] <- 0 var_name[i] <- str_trim(str_split(string = mapping_txt[i], pattern = ":")[[1]][1]) var_desc[i] <- str_trim(str_split(string = mapping_txt[i], pattern = ":")[[1]][2]) # parsing variable levels } else { var_name[i] <- var_name[i - 1] var_desc[i] <- var_desc[i - 1] level_code[i] <- str_trim(str_split(string = mapping_txt[i], pattern = "\t")[[1]][1]) level_desc[i] <- str_split(string = mapping_txt[i], pattern = "\t")[[1]][2] } } # bind columns into a dataframe output_df <- bind_cols(flag = flag, variable_name = var_name, variable_description = var_desc, level_code = level_code, level_description = level_desc) %>% filter(flag == 1) %>% select(-flag) # output return(output_df) } # Function: recode columns recode_columns <- function(mappin_df, col, col_name) { # recode if (col_name %in% unique(mapping_df[["variable_name"]])) { recoded_col <- plyr::mapvalues(x = col, from = mapping_df[mapping_df[["variable_name"]] == col_name, "level_code", drop = T], to = mapping_df[mapping_df[["variable_name"]] == col_name, "level_description", drop = T], warn_missing = F) %>% as.character() } else{ recoded_col <- col } # output return(recoded_col) } # Function: Calculate R2 calc_r2 <- function(actual, prediction) { # residual sum of squares rss <- sum((prediction - actual)^2) # total sum of squares tss <- sum((actual - mean(actual))^2) ## total sum of squares # r2 r2 <- 1 - rss/tss # output return(r2) } # Function: remove missing levels remove_missing_levels <- function(model, test_df) { # drop empty factor levels in test data test_df <- test_df %>% droplevels() # do nothing if no factors are present if (length(model[["xlevels"]]) == 0) { return(test_df) } # extract model factors and levels model_factors_df <- map2(.x = names(model$xlevels), .y = model$xlevels, .f = function(factor, levels) data.frame(factor, levels, stringsAsFactors = F)) %>% bind_rows() # select column names in test data that are factor predictors in trained model predictors <- names(test_df[names(test_df) %in% model_factors_df[["factor"]]]) # for each factor predictor in your data, if the level is not in the model set the value to NA for (i in seq_along(predictors)) { # identify model levels model_levels <- model_factors_df[model_factors_df[["factor"]] == predictors[i], "levels", drop = T] # identify test levels test_levels <- test_df[, predictors[i]] # found flag found_flag <- test_levels %in% model_levels # if any missing, then set to NA if (any(!found_flag)) { # missing levels missing_levels <- str_c(as.character(unique(test_levels[!found_flag])), collapse = ",") # set to NA test_df[!found_flag, predictors[i]] <- NA # drop empty factor levels in test data test_df <- test_df %>% droplevels() # message console message(glue("In {predictors[i]}: setting missing level(s) {missing_levels} to NA")) } } # output return(test_df) } # Function: find optimal cp find_optimal_cp <- function(cptable, cv_sd_flag) { # define the minimum cross-validated error index_min_error <- which.min(cptable[, 4]) # min error min_error <- cptable[index_min_error, 4] # min error sd sd_min_error <- cptable[index_min_error, 5] # optimum line if (cv_sd_flag == 1) { optimal_line <- min_error + sd_min_error } else { optimal_line <- min_error } # optimal cp index optimal_cp_index <- which.min(abs((cptable[, 4] - optimal_line))) # optimal cp optimal_cp <- cptable[optimal_cp_index, 1] # output return(optimal_cp) } # Function: plot variable importance plot_variable_importance <- function(variable, score, scale = T, top_n, model_type) { # scale if needed if (scale == T) { score <- score/sum(score) * 100 } # create data frame importance_df <- data.frame(variable, score) %>% arrange(desc(score)) # filter if (!is.na(top_n)) { importance_df <- importance_df[1:top_n, ] } # plot ggplot(data = importance_df, mapping = aes(x = reorder(variable, score), y = score)) + geom_bar(stat = "identity") + #labs(title = "Variable Importance - RANGER") + ggtitle(label = str_c("Variable Importance", model_type, sep = " - ")) + xlab("variable") + ylab("importance scores in %") + coord_flip() }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/aasim_classes.r \name{addPerson.sim} \alias{addPerson.sim} \title{Add Person to persons list in a simulation} \usage{ addPerson.sim(sim, name, initials, curAge, gender, retireAge, mort.factor = 1) } \arguments{ \item{sim}{Object of type sim (simulation)} \item{name}{Name of person} \item{initials}{Initials or short name, useful for display} \item{curAge}{Current age (simulation assumes person just turned this age)} \item{gender}{'M' or 'Male' or 'F' or 'Female'} \item{retireAge}{Retirement age.} \item{mort.factor}{Mortality factor, default = 1. This is multiplied by each mortality rate. Values >1 decrease life expectancy.} } \value{ sim object with person added to simulation } \description{ Add Person to persons list in a simulation } \examples{ \dontrun{sim1<-addPerson.sim(sim, name, initials, curAge, gender, retireAge, mort.factor)} \dontrun{sim1<-addPerson.sim(sim1,"Rex Macey","RM",56,"M",65,1.0)} }
/man/addPerson.sim.Rd
no_license
ihavenoahidea/aasim
R
false
true
1,001
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/aasim_classes.r \name{addPerson.sim} \alias{addPerson.sim} \title{Add Person to persons list in a simulation} \usage{ addPerson.sim(sim, name, initials, curAge, gender, retireAge, mort.factor = 1) } \arguments{ \item{sim}{Object of type sim (simulation)} \item{name}{Name of person} \item{initials}{Initials or short name, useful for display} \item{curAge}{Current age (simulation assumes person just turned this age)} \item{gender}{'M' or 'Male' or 'F' or 'Female'} \item{retireAge}{Retirement age.} \item{mort.factor}{Mortality factor, default = 1. This is multiplied by each mortality rate. Values >1 decrease life expectancy.} } \value{ sim object with person added to simulation } \description{ Add Person to persons list in a simulation } \examples{ \dontrun{sim1<-addPerson.sim(sim, name, initials, curAge, gender, retireAge, mort.factor)} \dontrun{sim1<-addPerson.sim(sim1,"Rex Macey","RM",56,"M",65,1.0)} }
## ## MCMC sampler for orthogonal data augmentation ## mcmc.pcaMA <- function(Y.list, X.o, H.list, params, tune, epsilon = 0.001){ #Y.new, X.new, for log scoring rule ## ## functions and subroutines ## make.mh <- function(i, sigma.squared, Sigma.t, Sigma.t.inv, gamma, beta.tilde.gamma){ if(sum(gamma[[i]]) == 0){ - n.o[i] / 2 * sigma.squared - 1 / 2 * determinant(Sigma.t[[i]], logarithm = TRUE)[1]$mod[1] - 1 / (2 * sigma.squared) * t(Y.list[[i]]) %*% Sigma.t.inv[[i]] %*% (Y.list[[i]]) } else { - n.o[i] / 2 * sigma.squared - 1 / 2 * determinant(Sigma.t[[i]], logarithm = TRUE)[1]$mod[1] - 1 / (2 * sigma.squared) * t(Y.list[[i]] - HX.o.list[[i]][, gamma[[i]] == 1] %*% beta.tilde.gamma[[i]]) %*% Sigma.t.inv[[i]] %*% (Y.list[[i]] - HX.o.list[[i]][, gamma[[i]] == 1] %*% beta.tilde.gamma[[i]]) } } make.gamma.mh <- function(i, gamma, beta.hat, Sigma.full.inv, Y.c, tX.Sigma.full.inv.X, tX.Sigma.full.inv){ sum(gamma[[i]] * log(pi.prior) + (1 - gamma[[i]]) * log(1 - pi.prior)) - 1 / (2 * sigma.squared) * (t(gamma[[i]] * beta.hat[[i]]) %*% tX.Sigma.full.inv.X %*% (gamma[[i]] * beta.hat[[i]]) - 2 * t(gamma[[i]] * beta.hat[[i]]) %*% tX.Sigma.full.inv %*% Y.c[[i]] + t(gamma[[i]] * beta.hat[[i]]) %*% Lambda %*% (gamma[[i]] * beta.hat[[i]])) } ## ## initialize fixed values ## n.mcmc <- params$n.mcmc alpha <- params$alpha pi.prior <- params$pi.prior lambda <- params$lambda alpha.eta <- params$alpha.eta beta.eta <- params$beta.eta phi.lower <- params$phi.lower phi.upper <- params$phi.upper D <- params$D # sigma.tune <- tune$sigma.tune phi.tune <- tune$phi.tune sigma.eta.tune <- tune$sigma.eta.tune gama.tune <- tune$gamma.tune t <- length(Y.list) X.pca <- prcomp(X.o) X <- X.pca$x tX <- t(X) delta <- X.pca$sdev^2 p <- dim(X)[2] m <- dim(X)[1] n.o <- vector(length = t) n.u <- vector(length = t) for(i in 1:t){ n.o[i] <- length(Y.list[[i]]) n.u[i] <- m - n.o[i] } I.full <- diag(m) I.o <- vector('list', length = t) I.u <- vector('list', length = t) for(i in 1:t){ I.o[[i]] <- diag(n.o[i]) I.u[[i]] <- diag(n.u[i]) } ## initialize random values ## ## choose a better starting value once the code is up and running ## sigma.squared <- 1 ## Psi <- vector('list', length = t) gamma <- vector('list', length = t) for(i in 1:t){ gamma[[i]] <- rbinom(p, 1, pi.prior) } gamma.star <- gamma Lambda <- diag(lambda) Lambda.gamma <- vector('list', length = t) for(i in 1:t){ if(sum(gamma[[i]]) == 0){ Lambda.gamma[[i]] <- 0 } else { Lambda.gamma[[i]] <- diag(lambda[gamma[[i]] == 1]) } } ## H.u.list <- vector('list', length = t) for(i in 1:t){ H.u.list[[i]] <- (1:m)[ - H.list[[i]]] } HX.o.list <- vector('list', length = t) tHX.o.list <- vector('list', length = t) HX.u.list <- vector('list', length = t) tHX.u.list <- vector('list', length = t) for(i in 1:t){ HX.o.list[[i]] <- X[H.list[[i]], ] tHX.o.list[[i]] <- t(HX.o.list[[i]]) HX.u.list[[i]] <- X[H.u.list[[i]], ] tHX.u.list[[i]] <- t(HX.u.list[[i]]) } ## initialize spatial covariance sigma.squared.eta <- 1 / rgamma(1, alpha.eta, beta.eta) phi <- runif(1, phi.lower, phi.upper) D.t <- vector('list', length = t) Sigma.t <- vector('list', length = t) Sigma.t.inv <- vector('list', length = t) Sigma.t.star <- vector('list', length = t) Sigma.t.inv.star <- vector('list', length = t) for(i in 1:t){ D.t[[i]] <- D[H.list[[i]], H.list[[i]]] Sigma.t[[i]] <- I.o[[i]] + sigma.squared.eta * exp( - D.t[[i]] / phi) Sigma.t.inv[[i]] <- solve(Sigma.t[[i]]) } Sigma.full <- I.full + sigma.squared.eta * exp( - D / phi) Sigma.full.inv <- solve(Sigma.full) tX.Sigma.full.inv.X <- tX %*% Sigma.full.inv %*% X tX.Sigma.full.inv <- tX %*% Sigma.full.inv ## initialize Y.u Y.u <- vector('list', length = t) projectXontoY <- solve(t(X) %*% Sigma.full.inv %*% X) %*% t(X) %*% Sigma.full.inv beta.tilde.gamma <- vector('list', length = t) for(i in 1:t){ if(sum(gamma[[i]]) == 0){ ## } else { beta.tilde.gamma[[i]] <- solve(1 / sigma.squared * tHX.o.list[[i]][gamma[[i]] == 1, ] %*% Sigma.t.inv[[i]] %*% HX.o.list[[i]][, gamma[[i]] == 1] + 1 / sigma.squared * Lambda.gamma[[i]]) %*% tHX.o.list[[i]][gamma[[i]] == 1, ] %*% Y.list[[i]] } } ## initialize sigma.squared tmp <- vector(length = t) for(i in 1:t){ if(sum(gamma[[i]]) == 0){ tmp[i] <- t(Y.list[[i]]) %*% Sigma.t.inv[[i]] %*% (Y.list[[i]]) + t(beta.tilde.gamma[[i]]) %*% Lambda.gamma[[i]] %*% beta.tilde.gamma[[i]] } else { tmp[i] <- t(Y.list[[i]] - HX.o.list[[i]][, gamma[[i]] == 1] %*% beta.tilde.gamma[[i]]) %*% Sigma.t.inv[[i]] %*% (Y.list[[i]] - HX.o.list[[i]][, gamma[[i]] == 1] %*% beta.tilde.gamma[[i]]) + t(beta.tilde.gamma[[i]]) %*% Lambda.gamma[[i]] %*% beta.tilde.gamma[[i]] } } sigma.squared <- 1 / rgamma(1, (sum(n.o) + sum(unlist(gamma))) / 2, sum(tmp) / 2) ## initialize variables O <- vector('list', length = t) rho <- vector('list', length = t) ## ## setup save variables ## gamma.save <- array(dim = c(p, t, n.mcmc)) sigma.squared.save <- vector(length = n.mcmc) sigma.squared.eta.save <- vector(length = n.mcmc) phi.save <- vector(length = n.mcmc) beta.save <- array(dim = c(p, t, n.mcmc)) rho.save <- array(dim = c(p, t, n.mcmc)) Y.pred <- array(dim = c(m, t, n.mcmc)) delta.save <- delta phi.accept <- 0 eta.accept <- 0 gamma.accept <- 0 ## ## begin mcmc ## for(k in 1:n.mcmc){ # if(k %% 1000 == 0){ cat(k, ' ') # } ## ## sample Y.u ## for(i in 1:t){ if(sum(gamma[[i]]) == 0){ Y.u[[i]] <- Sigma.full[H.u.list[[i]], H.list[[i]]] %*% Sigma.t.inv[[i]] %*% Y.list[[i]] } else { Y.u[[i]] <- HX.u.list[[i]][, gamma[[i]] == 1] %*% beta.tilde.gamma[[i]] + Sigma.full[H.u.list[[i]], H.list[[i]]] %*% Sigma.t.inv[[i]] %*% (Y.list[[i]] - HX.o.list[[i]][, gamma[[i]] == 1] %*% beta.tilde.gamma[[i]]) } } Y.c <- vector('list', length = t) for(i in 1:t){ Y.c[[i]] <- vector(length = m) Y.c[[i]][H.list[[i]]] <- Y.list[[i]] Y.c[[i]][H.u.list[[i]]] <- Y.u[[i]] } beta.hat <- vector('list', length = t) projectXontoY <- solve(t(X) %*% Sigma.full.inv %*% X) %*% t(X) %*% Sigma.full.inv for(i in 1:t){ beta.hat[[i]] <- projectXontoY %*% Y.c[[i]] } ## ## sample sigma.squared ## tmp <- vector(length = t) for(i in 1:t){ if(sum(gamma[[i]] == 0)){ tmp[i] <- t(Y.list[[i]]) %*% Sigma.t.inv[[i]] %*% (Y.list[[i]]) + t(beta.tilde.gamma[[i]]) %*% Lambda.gamma[[i]] %*% beta.tilde.gamma[[i]] } else { tmp[i] <- t(Y.list[[i]] - HX.o.list[[i]][, gamma[[i]] == 1] %*% beta.tilde.gamma[[i]]) %*% Sigma.t.inv[[i]] %*% (Y.list[[i]] - HX.o.list[[i]][, gamma[[i]] == 1] %*% beta.tilde.gamma[[i]]) + t(beta.tilde.gamma[[i]]) %*% Lambda.gamma[[i]] %*% beta.tilde.gamma[[i]] } } sigma.squared <- 1 / rgamma(1, (sum(n.o) + sum(unlist(gamma))) / 2, sum(tmp) / 2) ## ## sample gammma ## for(i in 1:t){ for(j in 1:p){ if(runif(1) > gamma.tune){ if(gamma[[i]][j] == 0){ gamma.star[[i]][j] <- 1 } else { gamma.star[[i]][j] <- 0 } } } } gamma[[1]] gamma.star mh.gamma.1 <- sum(sapply(1:t, make.gamma.mh, gamma = gamma.star, beta.hat = beta.hat, Sigma.full.inv = Sigma.full.inv, Y.c = Y.c, tX.Sigma.full.inv.X = tX.Sigma.full.inv.X, tX.Sigma.full.inv = tX.Sigma.full.inv)) mh.gamma.2 <- sum(sapply(1:t, make.gamma.mh, gamma = gamma, beta.hat = beta.hat, Sigma.full.inv = Sigma.full.inv, Y.c = Y.c, tX.Sigma.full.inv.X = tX.Sigma.full.inv.X, tX.Sigma.full.inv = tX.Sigma.full.inv)) mh.gamma <- exp(mh.gamma.1 - mh.gamma.2) if(mh.gamma > runif(1)){ gamma <- gamma.star gamma.accept <- 1 / n.mcmc + gamma.accept } # for(i in 1:t){ ## using log scale # Psi[[i]] <- 1 / 2 * log(lambda / sigma.squared) - 1 / (2 * sigma.squared) * (beta.hat[[i]]^2 * (lambda - 1000 * delta)) + log(pi.prior) - log(1 - pi.prior) # rho[[i]] <- exp(Psi[[i]] - log(1 + exp(Psi[[i]]))) # } # for(i in 1:t){ # gamma[[i]] <- rbinom(p, 1, rho[[i]]) if(sum(gamma[[i]]) == 0){ Lambda.gamma[[i]] <- 0 } else { Lambda.gamma[[i]] <- diag(lambda[gamma[[i]] == 1]) } } ## ## sample beta.tilde.gamma ## for(i in 1:t){ if(sum(gamma[[i]]) == 0){ beta.tilde.gamma[[i]] <- 0 } else { beta.tilde.gamma[[i]] <- solve(1 / sigma.squared * tHX.o.list[[i]][gamma[[i]] == 1, ] %*% Sigma.t.inv[[i]] %*% HX.o.list[[i]][, gamma[[i]] == 1] + 1 / sigma.squared * Lambda.gamma[[i]]) %*% tHX.o.list[[i]][gamma[[i]] == 1, ] %*% Sigma.t.inv[[i]] %*% Y.list[[i]] } } ## sample sigma.squared.eta sigma.squared.eta.star <- rnorm(1, sigma.squared.eta, sigma.eta.tune) if(sigma.squared.eta.star > 0){ for(i in 1:t){ Sigma.t.star[[i]] <- I.o[[i]] + sigma.squared.eta.star * exp( - D.t[[i]] / phi) Sigma.t.inv.star[[i]] <- solve(Sigma.t.star[[i]]) } mh.eta.1 <- sum(sapply(1:t, make.mh, sigma.squared = sigma.squared, Sigma.t = Sigma.t.star, Sigma.t.inv = Sigma.t.inv.star, gamma = gamma, beta.tilde.gamma = beta.tilde.gamma)) mh.eta.2 <- sum(sapply(1:t, make.mh, sigma.squared = sigma.squared, Sigma.t = Sigma.t, Sigma.t.inv = Sigma.t.inv, gamma = gamma, beta.tilde.gamma = beta.tilde.gamma)) mh.eta <- exp(mh.eta.1 - mh.eta.2) if(mh.eta > runif(1)){ sigma.squared.eta <- sigma.squared.eta.star Sigma.t <- Sigma.t.star Sigma.t.inv <- Sigma.t.inv.star eta.accept <- 1 / n.mcmc + eta.accept } } ## ## sample phi ## phi.star <- rnorm(1, phi, phi.tune) if(phi.star > phi.lower && phi.star < phi.upper){ for(i in 1:t){ Sigma.t.star[[i]] <- I.o[[i]] + sigma.squared.eta * exp( - D.t[[i]] / phi.star) Sigma.t.inv.star[[i]] <- solve(Sigma.t.star[[i]]) } mh.phi.1 <- sum(sapply(1:t, make.mh, sigma.squared = sigma.squared, Sigma.t = Sigma.t.star, Sigma.t.inv = Sigma.t.inv.star, gamma = gamma, beta.tilde.gamma = beta.tilde.gamma)) mh.phi.2 <- sum(sapply(1:t, make.mh, sigma.squared = sigma.squared, Sigma.t = Sigma.t, Sigma.t.inv = Sigma.t.inv, gamma = gamma, beta.tilde.gamma = beta.tilde.gamma)) mh.phi <- exp(mh.phi.1 - mh.phi.2) if(mh.phi > runif(1)){ phi <- phi.star Sigma.t <- Sigma.t.star Sigma.t.inv <- Sigma.t.inv.star phi.accept <- 1 / n.mcmc + phi.accept } } ## ## Sigma.full ## Sigma.full <- I.full * sigma.squared.eta * exp( - D / phi) Sigma.full.inv <- solve(Sigma.full) tX.Sigma.full.inv.X <- tX %*% Sigma.full.inv %*% X tX.Sigma.full.inv <- tX %*% Sigma.full.inv ## ## log scoring rule ## # log.score <- sum(dnorm(Y.new, mean = cbind(X.new[, 1], X.new[, 2:(p)][, gamma == 1]) %*% beta.tilde.gamma, sd = sqrt(sigma.squared), log = TRUE)) ## ## save samples ## Y.pred[, , k] <- matrix(unlist(Y.c), nrow = m, ncol = t, byrow = FALSE) gamma.save[, , k] <- matrix(unlist(gamma), nrow = p, ncol = t, byrow = FALSE) sigma.squared.save[k] <- sigma.squared sigma.squared.eta.save[k] <- sigma.squared.eta phi.save[k] <- phi beta.save[, , k] <- matrix(unlist(beta.hat), nrow = p, ncol = t, byrow = FALSE) # rho.save[, , k] <- matrix(unlist(rho), nrow = p, ncol = t, byrow = FALSE) # delta.save <- delta # log.score.save[k] <- log.score } list(gamma.save = gamma.save, sigma.squared.save = sigma.squared.save, beta.save = beta.save, rho.save = rho.save, delta.save = delta.save, Y.pred = Y.pred, eta.accept = eta.accept, phi.accept = phi.accept, gamma.accept = gamma.accept, sigma.squared.eta.save = sigma.squared.eta.save, phi.save = phi.save)#, log.score.save = log.score.save) # list(gamma.save = gamma.save, sigma.squared.save = sigma.squared.save, beta.save = beta.save, delta.save = delta.save, Y.pred = Y.pred)#, log.score.save = log.score.save) }
/modelAveraging/mcmc.pcaModelAveraging.spatial.R
no_license
jtipton25/1dSpatialSim
R
false
false
12,323
r
## ## MCMC sampler for orthogonal data augmentation ## mcmc.pcaMA <- function(Y.list, X.o, H.list, params, tune, epsilon = 0.001){ #Y.new, X.new, for log scoring rule ## ## functions and subroutines ## make.mh <- function(i, sigma.squared, Sigma.t, Sigma.t.inv, gamma, beta.tilde.gamma){ if(sum(gamma[[i]]) == 0){ - n.o[i] / 2 * sigma.squared - 1 / 2 * determinant(Sigma.t[[i]], logarithm = TRUE)[1]$mod[1] - 1 / (2 * sigma.squared) * t(Y.list[[i]]) %*% Sigma.t.inv[[i]] %*% (Y.list[[i]]) } else { - n.o[i] / 2 * sigma.squared - 1 / 2 * determinant(Sigma.t[[i]], logarithm = TRUE)[1]$mod[1] - 1 / (2 * sigma.squared) * t(Y.list[[i]] - HX.o.list[[i]][, gamma[[i]] == 1] %*% beta.tilde.gamma[[i]]) %*% Sigma.t.inv[[i]] %*% (Y.list[[i]] - HX.o.list[[i]][, gamma[[i]] == 1] %*% beta.tilde.gamma[[i]]) } } make.gamma.mh <- function(i, gamma, beta.hat, Sigma.full.inv, Y.c, tX.Sigma.full.inv.X, tX.Sigma.full.inv){ sum(gamma[[i]] * log(pi.prior) + (1 - gamma[[i]]) * log(1 - pi.prior)) - 1 / (2 * sigma.squared) * (t(gamma[[i]] * beta.hat[[i]]) %*% tX.Sigma.full.inv.X %*% (gamma[[i]] * beta.hat[[i]]) - 2 * t(gamma[[i]] * beta.hat[[i]]) %*% tX.Sigma.full.inv %*% Y.c[[i]] + t(gamma[[i]] * beta.hat[[i]]) %*% Lambda %*% (gamma[[i]] * beta.hat[[i]])) } ## ## initialize fixed values ## n.mcmc <- params$n.mcmc alpha <- params$alpha pi.prior <- params$pi.prior lambda <- params$lambda alpha.eta <- params$alpha.eta beta.eta <- params$beta.eta phi.lower <- params$phi.lower phi.upper <- params$phi.upper D <- params$D # sigma.tune <- tune$sigma.tune phi.tune <- tune$phi.tune sigma.eta.tune <- tune$sigma.eta.tune gama.tune <- tune$gamma.tune t <- length(Y.list) X.pca <- prcomp(X.o) X <- X.pca$x tX <- t(X) delta <- X.pca$sdev^2 p <- dim(X)[2] m <- dim(X)[1] n.o <- vector(length = t) n.u <- vector(length = t) for(i in 1:t){ n.o[i] <- length(Y.list[[i]]) n.u[i] <- m - n.o[i] } I.full <- diag(m) I.o <- vector('list', length = t) I.u <- vector('list', length = t) for(i in 1:t){ I.o[[i]] <- diag(n.o[i]) I.u[[i]] <- diag(n.u[i]) } ## initialize random values ## ## choose a better starting value once the code is up and running ## sigma.squared <- 1 ## Psi <- vector('list', length = t) gamma <- vector('list', length = t) for(i in 1:t){ gamma[[i]] <- rbinom(p, 1, pi.prior) } gamma.star <- gamma Lambda <- diag(lambda) Lambda.gamma <- vector('list', length = t) for(i in 1:t){ if(sum(gamma[[i]]) == 0){ Lambda.gamma[[i]] <- 0 } else { Lambda.gamma[[i]] <- diag(lambda[gamma[[i]] == 1]) } } ## H.u.list <- vector('list', length = t) for(i in 1:t){ H.u.list[[i]] <- (1:m)[ - H.list[[i]]] } HX.o.list <- vector('list', length = t) tHX.o.list <- vector('list', length = t) HX.u.list <- vector('list', length = t) tHX.u.list <- vector('list', length = t) for(i in 1:t){ HX.o.list[[i]] <- X[H.list[[i]], ] tHX.o.list[[i]] <- t(HX.o.list[[i]]) HX.u.list[[i]] <- X[H.u.list[[i]], ] tHX.u.list[[i]] <- t(HX.u.list[[i]]) } ## initialize spatial covariance sigma.squared.eta <- 1 / rgamma(1, alpha.eta, beta.eta) phi <- runif(1, phi.lower, phi.upper) D.t <- vector('list', length = t) Sigma.t <- vector('list', length = t) Sigma.t.inv <- vector('list', length = t) Sigma.t.star <- vector('list', length = t) Sigma.t.inv.star <- vector('list', length = t) for(i in 1:t){ D.t[[i]] <- D[H.list[[i]], H.list[[i]]] Sigma.t[[i]] <- I.o[[i]] + sigma.squared.eta * exp( - D.t[[i]] / phi) Sigma.t.inv[[i]] <- solve(Sigma.t[[i]]) } Sigma.full <- I.full + sigma.squared.eta * exp( - D / phi) Sigma.full.inv <- solve(Sigma.full) tX.Sigma.full.inv.X <- tX %*% Sigma.full.inv %*% X tX.Sigma.full.inv <- tX %*% Sigma.full.inv ## initialize Y.u Y.u <- vector('list', length = t) projectXontoY <- solve(t(X) %*% Sigma.full.inv %*% X) %*% t(X) %*% Sigma.full.inv beta.tilde.gamma <- vector('list', length = t) for(i in 1:t){ if(sum(gamma[[i]]) == 0){ ## } else { beta.tilde.gamma[[i]] <- solve(1 / sigma.squared * tHX.o.list[[i]][gamma[[i]] == 1, ] %*% Sigma.t.inv[[i]] %*% HX.o.list[[i]][, gamma[[i]] == 1] + 1 / sigma.squared * Lambda.gamma[[i]]) %*% tHX.o.list[[i]][gamma[[i]] == 1, ] %*% Y.list[[i]] } } ## initialize sigma.squared tmp <- vector(length = t) for(i in 1:t){ if(sum(gamma[[i]]) == 0){ tmp[i] <- t(Y.list[[i]]) %*% Sigma.t.inv[[i]] %*% (Y.list[[i]]) + t(beta.tilde.gamma[[i]]) %*% Lambda.gamma[[i]] %*% beta.tilde.gamma[[i]] } else { tmp[i] <- t(Y.list[[i]] - HX.o.list[[i]][, gamma[[i]] == 1] %*% beta.tilde.gamma[[i]]) %*% Sigma.t.inv[[i]] %*% (Y.list[[i]] - HX.o.list[[i]][, gamma[[i]] == 1] %*% beta.tilde.gamma[[i]]) + t(beta.tilde.gamma[[i]]) %*% Lambda.gamma[[i]] %*% beta.tilde.gamma[[i]] } } sigma.squared <- 1 / rgamma(1, (sum(n.o) + sum(unlist(gamma))) / 2, sum(tmp) / 2) ## initialize variables O <- vector('list', length = t) rho <- vector('list', length = t) ## ## setup save variables ## gamma.save <- array(dim = c(p, t, n.mcmc)) sigma.squared.save <- vector(length = n.mcmc) sigma.squared.eta.save <- vector(length = n.mcmc) phi.save <- vector(length = n.mcmc) beta.save <- array(dim = c(p, t, n.mcmc)) rho.save <- array(dim = c(p, t, n.mcmc)) Y.pred <- array(dim = c(m, t, n.mcmc)) delta.save <- delta phi.accept <- 0 eta.accept <- 0 gamma.accept <- 0 ## ## begin mcmc ## for(k in 1:n.mcmc){ # if(k %% 1000 == 0){ cat(k, ' ') # } ## ## sample Y.u ## for(i in 1:t){ if(sum(gamma[[i]]) == 0){ Y.u[[i]] <- Sigma.full[H.u.list[[i]], H.list[[i]]] %*% Sigma.t.inv[[i]] %*% Y.list[[i]] } else { Y.u[[i]] <- HX.u.list[[i]][, gamma[[i]] == 1] %*% beta.tilde.gamma[[i]] + Sigma.full[H.u.list[[i]], H.list[[i]]] %*% Sigma.t.inv[[i]] %*% (Y.list[[i]] - HX.o.list[[i]][, gamma[[i]] == 1] %*% beta.tilde.gamma[[i]]) } } Y.c <- vector('list', length = t) for(i in 1:t){ Y.c[[i]] <- vector(length = m) Y.c[[i]][H.list[[i]]] <- Y.list[[i]] Y.c[[i]][H.u.list[[i]]] <- Y.u[[i]] } beta.hat <- vector('list', length = t) projectXontoY <- solve(t(X) %*% Sigma.full.inv %*% X) %*% t(X) %*% Sigma.full.inv for(i in 1:t){ beta.hat[[i]] <- projectXontoY %*% Y.c[[i]] } ## ## sample sigma.squared ## tmp <- vector(length = t) for(i in 1:t){ if(sum(gamma[[i]] == 0)){ tmp[i] <- t(Y.list[[i]]) %*% Sigma.t.inv[[i]] %*% (Y.list[[i]]) + t(beta.tilde.gamma[[i]]) %*% Lambda.gamma[[i]] %*% beta.tilde.gamma[[i]] } else { tmp[i] <- t(Y.list[[i]] - HX.o.list[[i]][, gamma[[i]] == 1] %*% beta.tilde.gamma[[i]]) %*% Sigma.t.inv[[i]] %*% (Y.list[[i]] - HX.o.list[[i]][, gamma[[i]] == 1] %*% beta.tilde.gamma[[i]]) + t(beta.tilde.gamma[[i]]) %*% Lambda.gamma[[i]] %*% beta.tilde.gamma[[i]] } } sigma.squared <- 1 / rgamma(1, (sum(n.o) + sum(unlist(gamma))) / 2, sum(tmp) / 2) ## ## sample gammma ## for(i in 1:t){ for(j in 1:p){ if(runif(1) > gamma.tune){ if(gamma[[i]][j] == 0){ gamma.star[[i]][j] <- 1 } else { gamma.star[[i]][j] <- 0 } } } } gamma[[1]] gamma.star mh.gamma.1 <- sum(sapply(1:t, make.gamma.mh, gamma = gamma.star, beta.hat = beta.hat, Sigma.full.inv = Sigma.full.inv, Y.c = Y.c, tX.Sigma.full.inv.X = tX.Sigma.full.inv.X, tX.Sigma.full.inv = tX.Sigma.full.inv)) mh.gamma.2 <- sum(sapply(1:t, make.gamma.mh, gamma = gamma, beta.hat = beta.hat, Sigma.full.inv = Sigma.full.inv, Y.c = Y.c, tX.Sigma.full.inv.X = tX.Sigma.full.inv.X, tX.Sigma.full.inv = tX.Sigma.full.inv)) mh.gamma <- exp(mh.gamma.1 - mh.gamma.2) if(mh.gamma > runif(1)){ gamma <- gamma.star gamma.accept <- 1 / n.mcmc + gamma.accept } # for(i in 1:t){ ## using log scale # Psi[[i]] <- 1 / 2 * log(lambda / sigma.squared) - 1 / (2 * sigma.squared) * (beta.hat[[i]]^2 * (lambda - 1000 * delta)) + log(pi.prior) - log(1 - pi.prior) # rho[[i]] <- exp(Psi[[i]] - log(1 + exp(Psi[[i]]))) # } # for(i in 1:t){ # gamma[[i]] <- rbinom(p, 1, rho[[i]]) if(sum(gamma[[i]]) == 0){ Lambda.gamma[[i]] <- 0 } else { Lambda.gamma[[i]] <- diag(lambda[gamma[[i]] == 1]) } } ## ## sample beta.tilde.gamma ## for(i in 1:t){ if(sum(gamma[[i]]) == 0){ beta.tilde.gamma[[i]] <- 0 } else { beta.tilde.gamma[[i]] <- solve(1 / sigma.squared * tHX.o.list[[i]][gamma[[i]] == 1, ] %*% Sigma.t.inv[[i]] %*% HX.o.list[[i]][, gamma[[i]] == 1] + 1 / sigma.squared * Lambda.gamma[[i]]) %*% tHX.o.list[[i]][gamma[[i]] == 1, ] %*% Sigma.t.inv[[i]] %*% Y.list[[i]] } } ## sample sigma.squared.eta sigma.squared.eta.star <- rnorm(1, sigma.squared.eta, sigma.eta.tune) if(sigma.squared.eta.star > 0){ for(i in 1:t){ Sigma.t.star[[i]] <- I.o[[i]] + sigma.squared.eta.star * exp( - D.t[[i]] / phi) Sigma.t.inv.star[[i]] <- solve(Sigma.t.star[[i]]) } mh.eta.1 <- sum(sapply(1:t, make.mh, sigma.squared = sigma.squared, Sigma.t = Sigma.t.star, Sigma.t.inv = Sigma.t.inv.star, gamma = gamma, beta.tilde.gamma = beta.tilde.gamma)) mh.eta.2 <- sum(sapply(1:t, make.mh, sigma.squared = sigma.squared, Sigma.t = Sigma.t, Sigma.t.inv = Sigma.t.inv, gamma = gamma, beta.tilde.gamma = beta.tilde.gamma)) mh.eta <- exp(mh.eta.1 - mh.eta.2) if(mh.eta > runif(1)){ sigma.squared.eta <- sigma.squared.eta.star Sigma.t <- Sigma.t.star Sigma.t.inv <- Sigma.t.inv.star eta.accept <- 1 / n.mcmc + eta.accept } } ## ## sample phi ## phi.star <- rnorm(1, phi, phi.tune) if(phi.star > phi.lower && phi.star < phi.upper){ for(i in 1:t){ Sigma.t.star[[i]] <- I.o[[i]] + sigma.squared.eta * exp( - D.t[[i]] / phi.star) Sigma.t.inv.star[[i]] <- solve(Sigma.t.star[[i]]) } mh.phi.1 <- sum(sapply(1:t, make.mh, sigma.squared = sigma.squared, Sigma.t = Sigma.t.star, Sigma.t.inv = Sigma.t.inv.star, gamma = gamma, beta.tilde.gamma = beta.tilde.gamma)) mh.phi.2 <- sum(sapply(1:t, make.mh, sigma.squared = sigma.squared, Sigma.t = Sigma.t, Sigma.t.inv = Sigma.t.inv, gamma = gamma, beta.tilde.gamma = beta.tilde.gamma)) mh.phi <- exp(mh.phi.1 - mh.phi.2) if(mh.phi > runif(1)){ phi <- phi.star Sigma.t <- Sigma.t.star Sigma.t.inv <- Sigma.t.inv.star phi.accept <- 1 / n.mcmc + phi.accept } } ## ## Sigma.full ## Sigma.full <- I.full * sigma.squared.eta * exp( - D / phi) Sigma.full.inv <- solve(Sigma.full) tX.Sigma.full.inv.X <- tX %*% Sigma.full.inv %*% X tX.Sigma.full.inv <- tX %*% Sigma.full.inv ## ## log scoring rule ## # log.score <- sum(dnorm(Y.new, mean = cbind(X.new[, 1], X.new[, 2:(p)][, gamma == 1]) %*% beta.tilde.gamma, sd = sqrt(sigma.squared), log = TRUE)) ## ## save samples ## Y.pred[, , k] <- matrix(unlist(Y.c), nrow = m, ncol = t, byrow = FALSE) gamma.save[, , k] <- matrix(unlist(gamma), nrow = p, ncol = t, byrow = FALSE) sigma.squared.save[k] <- sigma.squared sigma.squared.eta.save[k] <- sigma.squared.eta phi.save[k] <- phi beta.save[, , k] <- matrix(unlist(beta.hat), nrow = p, ncol = t, byrow = FALSE) # rho.save[, , k] <- matrix(unlist(rho), nrow = p, ncol = t, byrow = FALSE) # delta.save <- delta # log.score.save[k] <- log.score } list(gamma.save = gamma.save, sigma.squared.save = sigma.squared.save, beta.save = beta.save, rho.save = rho.save, delta.save = delta.save, Y.pred = Y.pred, eta.accept = eta.accept, phi.accept = phi.accept, gamma.accept = gamma.accept, sigma.squared.eta.save = sigma.squared.eta.save, phi.save = phi.save)#, log.score.save = log.score.save) # list(gamma.save = gamma.save, sigma.squared.save = sigma.squared.save, beta.save = beta.save, delta.save = delta.save, Y.pred = Y.pred)#, log.score.save = log.score.save) }
\name{MetaDE-package} \alias{MetaDE-package} \alias{MetaDE} \docType{package} \title{MetaDE: Microarray meta-analysis for differentially expressed gene detection } \description{ MetaDE MetaDE package implements 12 major meta-analysis methods for differential expression analysis : Fisher (Rhodes, et al., 2002), Stouffer (Stouffer, 1949), adaptively weighted Fisher (AW) (Li and Tseng, 2011), minimum p-value (minP), maximum p-value (maxP), rth ordered p-value (rOP) (Song and Tseng, 2012), fixed effects model (FEM), random effects model (REM) (Choi, et al., 2003), rank product (rankProd) (Hong, et al., 2006), naive sum of ranks and naive product of ranks (Dreyfuss, et al., 2009). Detailed algorithms, pros and cons of different methods have been discussed in a recent review paper (Tseng, et al., 2012). In addition to selecting a meta-analysis method, two additional considerations are involved in the implementation: (1) Choice of test statistics: Different test statistics are available in the package for each type of outcome variable (e.g. t-statistic or moderated t-statistic for binary outcome, F-statistic for multi-class outcome, regression or correlation for continuous outcome and Cox proportional hazard model for survival outcome). Additionally, a minimum multi-class correlation (min-MCC) has been included for multi-class outcome to only capture concordant expression patterns that F-statistic often fails (Lu, et al., 2010); (2) One-sided test correction: When combining two-sided p-values for binary outcomes, DE genes with discordant DE direction may be identified and the results are difficult to interpret(e.g. up-regulation in one study but down-regulation in another study). One-sided test correction is helpful to guarantee identification of DE genes with concordant DE direction. For example, Pearson's correction has been proposed for Fisher's method (Owen, 2009). In addition to the choices above, MetaDE also provides options for gene matching across studies and gene filtering before meta-analysis. Outputs of the meta-analysis results include DE gene lists with corresponding raw p-value, q-values and various visualization tools. Heatmaps can be plotted across studies. \bold{The \code{ind.analysis} Function}\cr This function is used to perform individual analysis and calculate the p-values frequently used in meta-analysis. Based on the type of outcome variable, \bold{The \code{ind.cal.ES} Function}\cr This function is used for calculating the effect sizes (standardized mean difference) frequently used in meta-analysis. \bold{The \code{MetaDE.rawdata} Function}\cr With the raw gene expression datasets, all the metheds combining the options of \code{ind.method} and \code{meta.method} can be implemented by function \code{MetaDE.rawdata}. \bold{The \code{MetaDE.pvalue} and \code{MetaDE.ES} Function}\cr If p-values or effect sizes (and corresponding variances) have been calculated already, for example by other methods not used in functions, \code{ind.analysis} or \code{ind.cal.ES}, with the help of other software, then the meta-analysis can be implemented by function \code{MetaDE.pvalue}or \code{MetaDE.ES}. } \author{Xingbin Wang<xingbinw@gmail.com>, Jia Li<jiajiaysc@gmail.com> and George C Tseng<ctseng@pitt.edu> } \references{ Jia Li and George C. Tseng. (2011) An adaptively weighted statistic for detecting differential gene expression when combining multiple transcriptomic studies. Annals of Applied Statistics. 5:994-1019. Shuya Lu, Jia Li, Chi Song, Kui Shen and George C Tseng. (2010) Biomarker Detection in the Integration of Multiple Multi-class Genomic Studies. Bioinformatics. 26:333-340. (PMID: 19965884; PMCID: PMC2815659) Xingbin Wang, Yan Lin, Chi Song, Etienne Sibille and George C Tseng. (2012) Detecting disease-associated genes with confounding variable adjustment and the impact on genomic meta-analysis: with application to major depressive disorder. BMC Bioinformatics. 13:52. George C. Tseng, Debashis Ghosh and Eleanor Feingold. (2012) Comprehensive literature review and statistical considerations for microarray meta-analysis. Nucleic Acids Research accepted Xingbin Wang, Dongwan Kang, Kui Shen, Chi Song, Lunching Chang, Serena G. Liao, Zhiguang Huo, Naftali Kaminski, Etienne Sibille, Yan Lin, Jia Li and George C. Tseng. (2012) A Suite of R Packages for Quality Control, Differentially Expressed Gene and Enriched Pathway Detection in Microarray Meta-analysis. In press. } \keyword{ package }
/man/MetaDE-package.Rd
no_license
liuyedao246/MetaDE
R
false
false
4,604
rd
\name{MetaDE-package} \alias{MetaDE-package} \alias{MetaDE} \docType{package} \title{MetaDE: Microarray meta-analysis for differentially expressed gene detection } \description{ MetaDE MetaDE package implements 12 major meta-analysis methods for differential expression analysis : Fisher (Rhodes, et al., 2002), Stouffer (Stouffer, 1949), adaptively weighted Fisher (AW) (Li and Tseng, 2011), minimum p-value (minP), maximum p-value (maxP), rth ordered p-value (rOP) (Song and Tseng, 2012), fixed effects model (FEM), random effects model (REM) (Choi, et al., 2003), rank product (rankProd) (Hong, et al., 2006), naive sum of ranks and naive product of ranks (Dreyfuss, et al., 2009). Detailed algorithms, pros and cons of different methods have been discussed in a recent review paper (Tseng, et al., 2012). In addition to selecting a meta-analysis method, two additional considerations are involved in the implementation: (1) Choice of test statistics: Different test statistics are available in the package for each type of outcome variable (e.g. t-statistic or moderated t-statistic for binary outcome, F-statistic for multi-class outcome, regression or correlation for continuous outcome and Cox proportional hazard model for survival outcome). Additionally, a minimum multi-class correlation (min-MCC) has been included for multi-class outcome to only capture concordant expression patterns that F-statistic often fails (Lu, et al., 2010); (2) One-sided test correction: When combining two-sided p-values for binary outcomes, DE genes with discordant DE direction may be identified and the results are difficult to interpret(e.g. up-regulation in one study but down-regulation in another study). One-sided test correction is helpful to guarantee identification of DE genes with concordant DE direction. For example, Pearson's correction has been proposed for Fisher's method (Owen, 2009). In addition to the choices above, MetaDE also provides options for gene matching across studies and gene filtering before meta-analysis. Outputs of the meta-analysis results include DE gene lists with corresponding raw p-value, q-values and various visualization tools. Heatmaps can be plotted across studies. \bold{The \code{ind.analysis} Function}\cr This function is used to perform individual analysis and calculate the p-values frequently used in meta-analysis. Based on the type of outcome variable, \bold{The \code{ind.cal.ES} Function}\cr This function is used for calculating the effect sizes (standardized mean difference) frequently used in meta-analysis. \bold{The \code{MetaDE.rawdata} Function}\cr With the raw gene expression datasets, all the metheds combining the options of \code{ind.method} and \code{meta.method} can be implemented by function \code{MetaDE.rawdata}. \bold{The \code{MetaDE.pvalue} and \code{MetaDE.ES} Function}\cr If p-values or effect sizes (and corresponding variances) have been calculated already, for example by other methods not used in functions, \code{ind.analysis} or \code{ind.cal.ES}, with the help of other software, then the meta-analysis can be implemented by function \code{MetaDE.pvalue}or \code{MetaDE.ES}. } \author{Xingbin Wang<xingbinw@gmail.com>, Jia Li<jiajiaysc@gmail.com> and George C Tseng<ctseng@pitt.edu> } \references{ Jia Li and George C. Tseng. (2011) An adaptively weighted statistic for detecting differential gene expression when combining multiple transcriptomic studies. Annals of Applied Statistics. 5:994-1019. Shuya Lu, Jia Li, Chi Song, Kui Shen and George C Tseng. (2010) Biomarker Detection in the Integration of Multiple Multi-class Genomic Studies. Bioinformatics. 26:333-340. (PMID: 19965884; PMCID: PMC2815659) Xingbin Wang, Yan Lin, Chi Song, Etienne Sibille and George C Tseng. (2012) Detecting disease-associated genes with confounding variable adjustment and the impact on genomic meta-analysis: with application to major depressive disorder. BMC Bioinformatics. 13:52. George C. Tseng, Debashis Ghosh and Eleanor Feingold. (2012) Comprehensive literature review and statistical considerations for microarray meta-analysis. Nucleic Acids Research accepted Xingbin Wang, Dongwan Kang, Kui Shen, Chi Song, Lunching Chang, Serena G. Liao, Zhiguang Huo, Naftali Kaminski, Etienne Sibille, Yan Lin, Jia Li and George C. Tseng. (2012) A Suite of R Packages for Quality Control, Differentially Expressed Gene and Enriched Pathway Detection in Microarray Meta-analysis. In press. } \keyword{ package }
r=0.07 https://sandbox.dams.library.ucdavis.edu/fcrepo/rest/collection/sherry-lehmann/catalogs/d7z59x/media/images/d7z59x-001/svc:tesseract/full/full/0.07/default.jpg Accept:application/hocr+xml
/ark_87287/d7z59x/d7z59x-001/rotated.r
permissive
ucd-library/wine-price-extraction
R
false
false
195
r
r=0.07 https://sandbox.dams.library.ucdavis.edu/fcrepo/rest/collection/sherry-lehmann/catalogs/d7z59x/media/images/d7z59x-001/svc:tesseract/full/full/0.07/default.jpg Accept:application/hocr+xml
# download and load the data into R download.file('https://d396qusza40orc.cloudfront.net/exdata%2Fdata%2Fhousehold_power_consumption.zip', 'power.zip') unzip('power.zip') power <- read.table('household_power_consumption.txt', sep =';', header=TRUE, stringsAsFactors=FALSE, dec='.') # We will only be using data from the dates 2007-02-01 and 2007-02-02. date1 <- power[power$Date == '2/2/2007', ] date2 <- power[power$Date == '1/2/2007', ] ds <- rbind(date2,date1) esm1 <- as.numeric(ds$Sub_metering_1) esm2 <- as.numeric(ds$Sub_metering_2) esm3 <- as.numeric(ds$Sub_metering_3) times <- strptime(paste(ds$Date, ds$Time), format="%d/%m/%Y%H:%M:%S") # plot 3 png("plot3.png", width = 480, height = 480, units = "px") plot(times, esm1, type='l', xlab = '', ylab="Energy Sub Metering") lines(times, esm2, col='red') lines(times, esm3, col='blue') legend("topright", legend = c('Sub Metering 1', 'Sub Metering 2', 'Sub Metering 3'), col=c('black', 'red', 'blue'), lty=1) dev.off()
/plot3.R
no_license
matthew-kruse/ExData_Plotting1
R
false
false
998
r
# download and load the data into R download.file('https://d396qusza40orc.cloudfront.net/exdata%2Fdata%2Fhousehold_power_consumption.zip', 'power.zip') unzip('power.zip') power <- read.table('household_power_consumption.txt', sep =';', header=TRUE, stringsAsFactors=FALSE, dec='.') # We will only be using data from the dates 2007-02-01 and 2007-02-02. date1 <- power[power$Date == '2/2/2007', ] date2 <- power[power$Date == '1/2/2007', ] ds <- rbind(date2,date1) esm1 <- as.numeric(ds$Sub_metering_1) esm2 <- as.numeric(ds$Sub_metering_2) esm3 <- as.numeric(ds$Sub_metering_3) times <- strptime(paste(ds$Date, ds$Time), format="%d/%m/%Y%H:%M:%S") # plot 3 png("plot3.png", width = 480, height = 480, units = "px") plot(times, esm1, type='l', xlab = '', ylab="Energy Sub Metering") lines(times, esm2, col='red') lines(times, esm3, col='blue') legend("topright", legend = c('Sub Metering 1', 'Sub Metering 2', 'Sub Metering 3'), col=c('black', 'red', 'blue'), lty=1) dev.off()
# This mini-project is based on the K-Means exercise from 'R in Action' # Go here for the original blog post and solutions # http://www.r-bloggers.com/k-means-clustering-from-r-in-action/ # Exercise 0: Install these packages if you don't have them already # install.packages(c("cluster", "rattle","NbClust")) # Now load the data and look at the first few rows data(wine, package="rattle") head(wine) # Exercise 1: Remove the first column from the data and scale # it using the scale() function dataframe <- scale(wine[-1]) # Now we'd like to cluster the data using K-Means. # How do we decide how many clusters to use if you don't know that already? # We'll try two methods. # Method 1: A plot of the total within-groups sums of squares against the # number of clusters in a K-means solution can be helpful. A bend in the # graph can suggest the appropriate number of clusters. wssplot <- function(data, nc=15, seed=1234){ wss <- (nrow(data)-1)*sum(apply(data,2,var)) for (i in 2:nc){ set.seed(seed) wss[i] <- sum(kmeans(data, centers=i)$withinss)} plot(1:nc, wss, type="b", xlab="Number of Clusters", ylab="Within groups sum of squares") } wssplot(df) # Exercise 2: # * How many clusters does this method suggest? #3, because the line stops dropping as significantly after 3 clusters # * Why does this method work? What's the intuition behind it? #After 3 clusters, the varience is less and less explained with each cluster. It's intuitive because there are three types of wine. # * Look at the code for wssplot() and figure out how it works # Method 2: Use the NbClust library, which runs many experiments # and gives a distribution of potential number of clusters. library(NbClust) set.seed(1234) nc <- NbClust(df, min.nc=2, max.nc=15, method="kmeans") barplot(table(nc$Best.n[1,]), xlab="Numer of Clusters", ylab="Number of Criteria", main="Number of Clusters Chosen by 26 Criteria") # Exercise 3: How many clusters does this method suggest? #This method also suggests 3 clusters # Exercise 4: Once you've picked the number of clusters, run k-means # using this number of clusters. Output the result of calling kmeans() # into a variable fit.km set.seed(1234) fit.km <- kmeans(df, 3, nstart=25) fit.km$size fit.km$centers fit.km # Now we want to evaluate how well this clustering does. # Exercise 5: using the table() function, show how the clusters in fit.km$clusters # compares to the actual wine types in wine$Type. Would you consider this a good # clustering? cluster_check <- table(wine$Type, fit.km$cluster) cluster_check #I would considered it pretty good clustering, the clustering seems to follow the wine$types pretty closely # Exercise 6: # * Visualize these clusters using function clusplot() from the cluster library # * Would you consider this a good clustering? #clusplot( ... ) library(cluster) clusplot(pam(dataframe, 3)) #I would consider this good clustering because most of the points visually seem to be contained within their clusters.
/clustering.R
no_license
mseeley3/K-means-clustering
R
false
false
3,149
r
# This mini-project is based on the K-Means exercise from 'R in Action' # Go here for the original blog post and solutions # http://www.r-bloggers.com/k-means-clustering-from-r-in-action/ # Exercise 0: Install these packages if you don't have them already # install.packages(c("cluster", "rattle","NbClust")) # Now load the data and look at the first few rows data(wine, package="rattle") head(wine) # Exercise 1: Remove the first column from the data and scale # it using the scale() function dataframe <- scale(wine[-1]) # Now we'd like to cluster the data using K-Means. # How do we decide how many clusters to use if you don't know that already? # We'll try two methods. # Method 1: A plot of the total within-groups sums of squares against the # number of clusters in a K-means solution can be helpful. A bend in the # graph can suggest the appropriate number of clusters. wssplot <- function(data, nc=15, seed=1234){ wss <- (nrow(data)-1)*sum(apply(data,2,var)) for (i in 2:nc){ set.seed(seed) wss[i] <- sum(kmeans(data, centers=i)$withinss)} plot(1:nc, wss, type="b", xlab="Number of Clusters", ylab="Within groups sum of squares") } wssplot(df) # Exercise 2: # * How many clusters does this method suggest? #3, because the line stops dropping as significantly after 3 clusters # * Why does this method work? What's the intuition behind it? #After 3 clusters, the varience is less and less explained with each cluster. It's intuitive because there are three types of wine. # * Look at the code for wssplot() and figure out how it works # Method 2: Use the NbClust library, which runs many experiments # and gives a distribution of potential number of clusters. library(NbClust) set.seed(1234) nc <- NbClust(df, min.nc=2, max.nc=15, method="kmeans") barplot(table(nc$Best.n[1,]), xlab="Numer of Clusters", ylab="Number of Criteria", main="Number of Clusters Chosen by 26 Criteria") # Exercise 3: How many clusters does this method suggest? #This method also suggests 3 clusters # Exercise 4: Once you've picked the number of clusters, run k-means # using this number of clusters. Output the result of calling kmeans() # into a variable fit.km set.seed(1234) fit.km <- kmeans(df, 3, nstart=25) fit.km$size fit.km$centers fit.km # Now we want to evaluate how well this clustering does. # Exercise 5: using the table() function, show how the clusters in fit.km$clusters # compares to the actual wine types in wine$Type. Would you consider this a good # clustering? cluster_check <- table(wine$Type, fit.km$cluster) cluster_check #I would considered it pretty good clustering, the clustering seems to follow the wine$types pretty closely # Exercise 6: # * Visualize these clusters using function clusplot() from the cluster library # * Would you consider this a good clustering? #clusplot( ... ) library(cluster) clusplot(pam(dataframe, 3)) #I would consider this good clustering because most of the points visually seem to be contained within their clusters.
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/get_aggregate_indicators.R \name{get_aggregate_indicators} \alias{get_aggregate_indicators} \title{retrieve aggregate indicator data} \usage{ get_aggregate_indicators(symbol, resolution, api.key, write.file = FALSE) } \arguments{ \item{symbol}{the stock symbol to retrieve data for} \item{resolution}{intervals for the data} \item{api.key}{your API token from finnhub.io} \item{write.file}{should the table be written to the "aggregate_indicators" folder?} } \value{ a data frame of aggregate indicators and trends } \description{ `get_aggregate_indicators` retrieves aggregate signal of multiple technical indicators (e.g. MACD, RSI, MA) } \examples{ \donttest{ ### Get support and resistance levels with resolution of 1 minute get_aggregate_indicators(symbol = 'AAPL', resolution = 1, api.key = api.key) } }
/man/get_aggregate_indicators.Rd
no_license
atamalu/finntools
R
false
true
891
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/get_aggregate_indicators.R \name{get_aggregate_indicators} \alias{get_aggregate_indicators} \title{retrieve aggregate indicator data} \usage{ get_aggregate_indicators(symbol, resolution, api.key, write.file = FALSE) } \arguments{ \item{symbol}{the stock symbol to retrieve data for} \item{resolution}{intervals for the data} \item{api.key}{your API token from finnhub.io} \item{write.file}{should the table be written to the "aggregate_indicators" folder?} } \value{ a data frame of aggregate indicators and trends } \description{ `get_aggregate_indicators` retrieves aggregate signal of multiple technical indicators (e.g. MACD, RSI, MA) } \examples{ \donttest{ ### Get support and resistance levels with resolution of 1 minute get_aggregate_indicators(symbol = 'AAPL', resolution = 1, api.key = api.key) } }
best <- function(state = 'TX', outcome = "heart failure" ) { library(data.table) library(dplyr) care_measures_data <- data.table(read.csv2('H:\\LITERATURA_i_POBRANE\\R_kurs\\Cursera R\\R-programming-week-4\\outcome-of-care-measures.csv', sep = ',', dec ='.', colClasses = "character" )) hospital_states <- unique(care_measures_data$State) if (!state %in% hospital_states){ msg <- paste0("Error in best(",state , ",", outcome,") : invalid state") return (msg) # Error in best("BB", "heart attack") : invalid state } ## Check that state and outcome are valid # New names old <- c('Hospital.30.Day.Death..Mortality..Rates.from.Heart.Attack', 'Hospital.30.Day.Death..Mortality..Rates.from.Heart.Failure' , 'Hospital.30.Day.Death..Mortality..Rates.from.Pneumonia') new <- c('heart attack' , 'heart failure' , 'pneumonia') setnames(care_measures_data , old , new) care_measures_data_2 <- care_measures_data %>% select( Hospital.Name, State, outcome ) %>% filter(State == state ) # cleaning care_measures_data_2[,3] <- ifelse(care_measures_data_2[,3] == "Not Available", "NA", care_measures_data_2[,3] ) care_measures_data_2[,3] <- as.numeric(care_measures_data_2[,3]) care_measures_data_2 <- na.omit(care_measures_data_2) care_measures_data_2 <- data.table(care_measures_data_2) # min if else if (outcome == 'heart attack'){ care_measures_data_2 <- care_measures_data_2[`heart attack` == min(`heart attack`),] outcome_final <- care_measures_data_2[1,] } else if (outcome == 'heart failure'){ care_measures_data_2 <- care_measures_data_2[`heart failure` == min(`heart failure`),] outcome_final <- care_measures_data_2[1,] } else{ care_measures_data_2 <- care_measures_data_2[`pneumonia` == min(`pneumonia`),] outcome_final <- care_measures_data_2[1,] } # final outcome_final <- outcome_final[,.(Hospital.Name)] return(outcome_final) }
/best.R
no_license
JerzyOtwock/R-programming-week-4
R
false
false
2,174
r
best <- function(state = 'TX', outcome = "heart failure" ) { library(data.table) library(dplyr) care_measures_data <- data.table(read.csv2('H:\\LITERATURA_i_POBRANE\\R_kurs\\Cursera R\\R-programming-week-4\\outcome-of-care-measures.csv', sep = ',', dec ='.', colClasses = "character" )) hospital_states <- unique(care_measures_data$State) if (!state %in% hospital_states){ msg <- paste0("Error in best(",state , ",", outcome,") : invalid state") return (msg) # Error in best("BB", "heart attack") : invalid state } ## Check that state and outcome are valid # New names old <- c('Hospital.30.Day.Death..Mortality..Rates.from.Heart.Attack', 'Hospital.30.Day.Death..Mortality..Rates.from.Heart.Failure' , 'Hospital.30.Day.Death..Mortality..Rates.from.Pneumonia') new <- c('heart attack' , 'heart failure' , 'pneumonia') setnames(care_measures_data , old , new) care_measures_data_2 <- care_measures_data %>% select( Hospital.Name, State, outcome ) %>% filter(State == state ) # cleaning care_measures_data_2[,3] <- ifelse(care_measures_data_2[,3] == "Not Available", "NA", care_measures_data_2[,3] ) care_measures_data_2[,3] <- as.numeric(care_measures_data_2[,3]) care_measures_data_2 <- na.omit(care_measures_data_2) care_measures_data_2 <- data.table(care_measures_data_2) # min if else if (outcome == 'heart attack'){ care_measures_data_2 <- care_measures_data_2[`heart attack` == min(`heart attack`),] outcome_final <- care_measures_data_2[1,] } else if (outcome == 'heart failure'){ care_measures_data_2 <- care_measures_data_2[`heart failure` == min(`heart failure`),] outcome_final <- care_measures_data_2[1,] } else{ care_measures_data_2 <- care_measures_data_2[`pneumonia` == min(`pneumonia`),] outcome_final <- care_measures_data_2[1,] } # final outcome_final <- outcome_final[,.(Hospital.Name)] return(outcome_final) }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/put_wrappers.R \name{update_card_labels} \alias{update_card_labels} \title{Update card labels} \usage{ update_card_labels(card, labels, ...) } \arguments{ \item{card}{Card id} \item{labels}{A character vector of one or more label id} \item{...}{Additional arguments passed to \code{\link{put_model}}} } \description{ Replace currently assigned labels. }
/man/update_card_labels.Rd
no_license
navigate-cgalvao/trelloR
R
false
true
434
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/put_wrappers.R \name{update_card_labels} \alias{update_card_labels} \title{Update card labels} \usage{ update_card_labels(card, labels, ...) } \arguments{ \item{card}{Card id} \item{labels}{A character vector of one or more label id} \item{...}{Additional arguments passed to \code{\link{put_model}}} } \description{ Replace currently assigned labels. }
reshape_description=function(jsons,jsons.names){ a=plyr::mdply(jsons,.fun = function(x) { data.frame(jsonlite::fromJSON(x)[[1]],stringsAsFactors = FALSE)},.progress = 'text') a$ON_CRAN=ifelse(a$Package%in%cran_current[,1],'CRAN_GITHUB','ONLY_GITHUB') a$repo=jsons.names[as.numeric(a$X1)] a1=a%>%dplyr::select(X1,ON_CRAN,repo,Package,Title,Author,Description,VignetteBuilder,BugReports,URL,Depends,Imports,Suggests,LinkingTo)%>% reshape2::melt(.,id= head(names(.),-4))%>%dplyr::filter(!is.na(value)) # clean a bit more.... a2=a1%>%plyr::ddply(head(names(a1),-1),.fun=function(x){ data.frame(value=gsub(pattern = '^\\s+|\\s+$|\\s+\\((.*?)\\)|\\((.*?)\\)|\\b.1\\b|^s: ', replacement = '', x = strsplit(x$value,',')[[1]] ), stringsAsFactors = FALSE) },.progress = 'text')%>%dplyr::filter(!grepl(':|NULL',value)) # reshape for rankings a3<-a2%>%plyr::dlply(.variables = c('ON_CRAN'),.fun=function(df){ df%>%dplyr::count(variable,value)%>%dplyr::arrange(variable,desc(n))%>% dplyr::group_by(variable)%>%dplyr::do(.,cbind(rank=1:nrow(.),.))%>% dplyr::mutate(value=sprintf('%s (%s)',value,n))%>% reshape2::dcast(rank~variable,value.var='value') }) l=list(raw=a,clean=a2,ranking=a3) return(l) }
/R/reshape_description.R
no_license
yonicd/gitLogs
R
false
false
1,325
r
reshape_description=function(jsons,jsons.names){ a=plyr::mdply(jsons,.fun = function(x) { data.frame(jsonlite::fromJSON(x)[[1]],stringsAsFactors = FALSE)},.progress = 'text') a$ON_CRAN=ifelse(a$Package%in%cran_current[,1],'CRAN_GITHUB','ONLY_GITHUB') a$repo=jsons.names[as.numeric(a$X1)] a1=a%>%dplyr::select(X1,ON_CRAN,repo,Package,Title,Author,Description,VignetteBuilder,BugReports,URL,Depends,Imports,Suggests,LinkingTo)%>% reshape2::melt(.,id= head(names(.),-4))%>%dplyr::filter(!is.na(value)) # clean a bit more.... a2=a1%>%plyr::ddply(head(names(a1),-1),.fun=function(x){ data.frame(value=gsub(pattern = '^\\s+|\\s+$|\\s+\\((.*?)\\)|\\((.*?)\\)|\\b.1\\b|^s: ', replacement = '', x = strsplit(x$value,',')[[1]] ), stringsAsFactors = FALSE) },.progress = 'text')%>%dplyr::filter(!grepl(':|NULL',value)) # reshape for rankings a3<-a2%>%plyr::dlply(.variables = c('ON_CRAN'),.fun=function(df){ df%>%dplyr::count(variable,value)%>%dplyr::arrange(variable,desc(n))%>% dplyr::group_by(variable)%>%dplyr::do(.,cbind(rank=1:nrow(.),.))%>% dplyr::mutate(value=sprintf('%s (%s)',value,n))%>% reshape2::dcast(rank~variable,value.var='value') }) l=list(raw=a,clean=a2,ranking=a3) return(l) }
library(shiny) library(ggvis) shiny = shinyUI(fluidPage( titlePanel("Life Expectancy and Income"), mainPanel( uiOutput("ggvis_ui"), ggvisOutput("ggvis") ) ))
/hw6/Bonus/ui.R
no_license
liams32/Stats-133
R
false
false
195
r
library(shiny) library(ggvis) shiny = shinyUI(fluidPage( titlePanel("Life Expectancy and Income"), mainPanel( uiOutput("ggvis_ui"), ggvisOutput("ggvis") ) ))
rm(list = ls()) library(simulator) library(RColorBrewer) source("../plot_functions.R") sim_name <- "speed" sim <- load_simulation(name = sim_name) %>% subset_simulation(subset = c(1, 2, 4, 5)) %>% subset_simulation(methods = c("APL", "sprinter", "sprinter1cv")) # general graphical paramters n_method <- length(evals(sim)[[1]]@method_name) col_seq <- brewer.pal(10, "Paired")[c(2, 6, 5)] lty_seq <- rep(2, n_method) lwd_seq <- rep(2, n_method) pch_seq <- seq(n_method) pdf(file = "./plots/pred_time.pdf", width = 11, height = 5) mat <- matrix(c(1, 2), ncol = 2) layout(mat, c(9, 9, 9), c(1, 1, 1)) par(cex.main = 1.2, cex.lab = 1.6, cex.axis = 1.2) xlab <- "p" xaxis <- c(100, 200, 1000, 2000) par(mar = c(4, 5, 1, 0.2)) ylab <- "Time (s)" plot_aggr_eval_by_model(sim = sim, metric_name = "time", main = NULL, xlab = xlab, xaxis = xaxis, ylab = ylab, method_col = col_seq, method_lty = lty_seq, method_lwd = lwd_seq, method_pch = pch_seq, legend_location = "topleft") par(mar = c(4, 5, 1, 0.2)) ylab <- "Mean squared error" plot_aggr_eval_by_model(sim = sim, metric_name = "mse_pred", main = NULL, xlab = xlab, xaxis = xaxis, ylab = ylab, method_col = col_seq, method_lty = lty_seq, method_lwd = lwd_seq, method_pch = pch_seq, legend_location = NULL) dev.off() pdf(file = "./plots/nnzm_nnzi_pred.pdf", width = 11, height = 5) sim <- subset_simulation(sim, subset = c(4)) mat <- matrix(c(1, 2), ncol = 2) layout(mat, c(9, 9, 9), c(1, 1, 1)) par(cex.main = 1, cex.lab = 1.6, cex.axis = 1.2) plot_main <- "Mixed (p = 1000, snr = 3)" par(mar = c(4, 5, 1, 0.2)) # plot the number of selected main effects vs prediction mse ylab <- "Mean squared error" xlab <- "Number of non-zero main effects" metric_name_1 <- "nnzm" metric_name_2 <- "mse_pred" plot_two_raw_evals(sim = sim, metric_name_1 = metric_name_1, metric_name_2 = metric_name_2, main = plot_main, xlab = xlab, ylab = ylab, method_col = col_seq, method_pch = pch_seq, legend_location = "bottomright") par(mar = c(4, 5, 1, 0.2)) # plot the number of selected interactions vs prediction mse ylab <- "Mean squared error" xlab <- "Number of non-zero interactions" metric_name_1 <- "nnzi" metric_name_2 <- "mse_pred" plot_two_raw_evals(sim = sim, metric_name_1 = metric_name_1, metric_name_2 = metric_name_2, main = plot_main, xlab = xlab, ylab = ylab, method_col = col_seq, method_pch = pch_seq, legend_location = NULL) dev.off()
/sprinter/Gaussian/plot_speed.R
no_license
hugogogo/reproducible
R
false
false
3,182
r
rm(list = ls()) library(simulator) library(RColorBrewer) source("../plot_functions.R") sim_name <- "speed" sim <- load_simulation(name = sim_name) %>% subset_simulation(subset = c(1, 2, 4, 5)) %>% subset_simulation(methods = c("APL", "sprinter", "sprinter1cv")) # general graphical paramters n_method <- length(evals(sim)[[1]]@method_name) col_seq <- brewer.pal(10, "Paired")[c(2, 6, 5)] lty_seq <- rep(2, n_method) lwd_seq <- rep(2, n_method) pch_seq <- seq(n_method) pdf(file = "./plots/pred_time.pdf", width = 11, height = 5) mat <- matrix(c(1, 2), ncol = 2) layout(mat, c(9, 9, 9), c(1, 1, 1)) par(cex.main = 1.2, cex.lab = 1.6, cex.axis = 1.2) xlab <- "p" xaxis <- c(100, 200, 1000, 2000) par(mar = c(4, 5, 1, 0.2)) ylab <- "Time (s)" plot_aggr_eval_by_model(sim = sim, metric_name = "time", main = NULL, xlab = xlab, xaxis = xaxis, ylab = ylab, method_col = col_seq, method_lty = lty_seq, method_lwd = lwd_seq, method_pch = pch_seq, legend_location = "topleft") par(mar = c(4, 5, 1, 0.2)) ylab <- "Mean squared error" plot_aggr_eval_by_model(sim = sim, metric_name = "mse_pred", main = NULL, xlab = xlab, xaxis = xaxis, ylab = ylab, method_col = col_seq, method_lty = lty_seq, method_lwd = lwd_seq, method_pch = pch_seq, legend_location = NULL) dev.off() pdf(file = "./plots/nnzm_nnzi_pred.pdf", width = 11, height = 5) sim <- subset_simulation(sim, subset = c(4)) mat <- matrix(c(1, 2), ncol = 2) layout(mat, c(9, 9, 9), c(1, 1, 1)) par(cex.main = 1, cex.lab = 1.6, cex.axis = 1.2) plot_main <- "Mixed (p = 1000, snr = 3)" par(mar = c(4, 5, 1, 0.2)) # plot the number of selected main effects vs prediction mse ylab <- "Mean squared error" xlab <- "Number of non-zero main effects" metric_name_1 <- "nnzm" metric_name_2 <- "mse_pred" plot_two_raw_evals(sim = sim, metric_name_1 = metric_name_1, metric_name_2 = metric_name_2, main = plot_main, xlab = xlab, ylab = ylab, method_col = col_seq, method_pch = pch_seq, legend_location = "bottomright") par(mar = c(4, 5, 1, 0.2)) # plot the number of selected interactions vs prediction mse ylab <- "Mean squared error" xlab <- "Number of non-zero interactions" metric_name_1 <- "nnzi" metric_name_2 <- "mse_pred" plot_two_raw_evals(sim = sim, metric_name_1 = metric_name_1, metric_name_2 = metric_name_2, main = plot_main, xlab = xlab, ylab = ylab, method_col = col_seq, method_pch = pch_seq, legend_location = NULL) dev.off()
library(lava) ### Name: confband ### Title: Add Confidence limits bar to plot ### Aliases: confband forestplot ### Keywords: iplot ### ** Examples plot(0,0,type="n",xlab="",ylab="") confband(0.5,-0.5,0.5,0,col="darkblue") confband(0.8,-0.5,0.5,0,col="darkred",vert=FALSE,pch=1,cex=1.5) set.seed(1) K <- 20 est <- rnorm(K) se <- runif(K,0.2,0.4) x <- cbind(est,est-2*se,est+2*se,runif(K,0.5,2)) x[c(3:4,10:12),] <- NA rownames(x) <- unlist(lapply(letters[seq(K)],function(x) paste(rep(x,4),collapse=""))) rownames(x)[which(is.na(est))] <- "" signif <- sign(x[,2])==sign(x[,3]) forestplot(x,text.right=FALSE) forestplot(x[,-4],sep=c(2,15),col=signif+1,box1=TRUE,delta=0.2,pch=16,cex=1.5) forestplot(x,vert=TRUE,text=FALSE) forestplot(x,vert=TRUE,text=FALSE,pch=NA) ##forestplot(x,vert=TRUE,text.vert=FALSE) ##forestplot(val,vert=TRUE,add=TRUE) z <- seq(10) zu <- c(z[-1],10) plot(z,type="n") confband(z,zu,rep(0,length(z)),col=Col("darkblue"),polygon=TRUE,step=TRUE) confband(z,zu,zu-2,col=Col("darkred"),polygon=TRUE,step=TRUE) z <- seq(0,1,length.out=100) plot(z,z,type="n") confband(z,z,z^2,polygon="TRUE",col=Col("darkblue")) set.seed(1) k <- 10 x <- seq(k) est <- rnorm(k) sd <- runif(k) val <- cbind(x,est,est-sd,est+sd) par(mfrow=c(1,2)) plot(0,type="n",xlim=c(0,k+1),ylim=range(val[,-1]),axes=FALSE,xlab="",ylab="") axis(2) confband(val[,1],val[,3],val[,4],val[,2],pch=16,cex=2) plot(0,type="n",ylim=c(0,k+1),xlim=range(val[,-1]),axes=FALSE,xlab="",ylab="") axis(1) confband(val[,1],val[,3],val[,4],val[,2],pch=16,cex=2,vert=FALSE)
/data/genthat_extracted_code/lava/examples/confband.Rd.R
no_license
surayaaramli/typeRrh
R
false
false
1,549
r
library(lava) ### Name: confband ### Title: Add Confidence limits bar to plot ### Aliases: confband forestplot ### Keywords: iplot ### ** Examples plot(0,0,type="n",xlab="",ylab="") confband(0.5,-0.5,0.5,0,col="darkblue") confband(0.8,-0.5,0.5,0,col="darkred",vert=FALSE,pch=1,cex=1.5) set.seed(1) K <- 20 est <- rnorm(K) se <- runif(K,0.2,0.4) x <- cbind(est,est-2*se,est+2*se,runif(K,0.5,2)) x[c(3:4,10:12),] <- NA rownames(x) <- unlist(lapply(letters[seq(K)],function(x) paste(rep(x,4),collapse=""))) rownames(x)[which(is.na(est))] <- "" signif <- sign(x[,2])==sign(x[,3]) forestplot(x,text.right=FALSE) forestplot(x[,-4],sep=c(2,15),col=signif+1,box1=TRUE,delta=0.2,pch=16,cex=1.5) forestplot(x,vert=TRUE,text=FALSE) forestplot(x,vert=TRUE,text=FALSE,pch=NA) ##forestplot(x,vert=TRUE,text.vert=FALSE) ##forestplot(val,vert=TRUE,add=TRUE) z <- seq(10) zu <- c(z[-1],10) plot(z,type="n") confband(z,zu,rep(0,length(z)),col=Col("darkblue"),polygon=TRUE,step=TRUE) confband(z,zu,zu-2,col=Col("darkred"),polygon=TRUE,step=TRUE) z <- seq(0,1,length.out=100) plot(z,z,type="n") confband(z,z,z^2,polygon="TRUE",col=Col("darkblue")) set.seed(1) k <- 10 x <- seq(k) est <- rnorm(k) sd <- runif(k) val <- cbind(x,est,est-sd,est+sd) par(mfrow=c(1,2)) plot(0,type="n",xlim=c(0,k+1),ylim=range(val[,-1]),axes=FALSE,xlab="",ylab="") axis(2) confband(val[,1],val[,3],val[,4],val[,2],pch=16,cex=2) plot(0,type="n",ylim=c(0,k+1),xlim=range(val[,-1]),axes=FALSE,xlab="",ylab="") axis(1) confband(val[,1],val[,3],val[,4],val[,2],pch=16,cex=2,vert=FALSE)
library(in2extRemes) ### Name: in2extRemes-package ### Title: Graphical User Interface Dialog Window for EVA ### Aliases: in2extRemes-package in2extRemes ### Keywords: package utilities ### ** Examples ## Not run: ##D in2extRemes() ## End(Not run)
/data/genthat_extracted_code/in2extRemes/examples/in2extRemes-package.Rd.R
no_license
surayaaramli/typeRrh
R
false
false
256
r
library(in2extRemes) ### Name: in2extRemes-package ### Title: Graphical User Interface Dialog Window for EVA ### Aliases: in2extRemes-package in2extRemes ### Keywords: package utilities ### ** Examples ## Not run: ##D in2extRemes() ## End(Not run)
library(BSgenome.Hsapiens.UCSC.hg19) library(ggbio) library(GenomicRanges) library(GenomicFeatures) library(hexbin) setwd('~/Documents/CREB/ChIPseqENCODE/insectBED1000/') data = read.delim('130422_mergedOutput.annotateOneExpt.countMotifs.txt', row.names=1, stringsAsFactors = F) data = data[,1:21] #convert to right type data$PeakScore = as.integer(data$PeakScore) data$Distance.to.TSS = as.integer(data$Distance.to.TSS) data$intervalSize = data$End - data$Start #normalise the tag and motif number for the size of the interval data$tagsPerInterval = (data$PeakScore / data$intervalSize ) data$motifPerInterval = (data$CREBmotifNo / data$intervalSize) #the filters dataPeakScore = subset(data, data$PeakScore >= 12) dataTSSdist = subset(dataPeakScore, dataPeakScore$Distance.to.TSS <= 3000 & dataPeakScore$Distance.to.TSS >= -500) dataMotif = subset(dataTSSdist, dataTSSdist$CREBmotifNo > 0) dataMotifDensity = subset(dataMotif, dataMotif$motifPerInterval <= 1000) #dataProtein = subset(dataMotifDensity, dataMotifDensity$Gene.Type == 'protein-coding') #make some graphs par(mfrow=c(2,1)) plot(data$Distance.to.TSS, data$motifPerInterval, type='h', xlab='Distance to transcriptional start site', ylab='Motifs per base pair', main='Density of CREB motifs', xlim=c(-5e5,5e5)) plot(data$Distance.to.TSS, data$tagsPerInterval, type='h', xlab='Distance to transcriptional start site', ylab='Tags per base pair', main='Density of CREB binding', xlim=c(-5e5,5e5)) par(mfrow=c(2,1)) plot(stats::density(data$Distance.to.TSS,bw='nrd0'), xlim=c(-1e4, 1e4),main="CREB binding at TSS",xlab="Distance from TSS (upstream - downstream)") polygon(density(data$Distance.to.TSS,bw='nrd0'), col="lightblue", border="grey") plot(stats::density(data$intervalSize,bw='nrd0'), xlim=c(0, 1e4),main="Proximal promoter length", xlab="Length of proximal promoter") polygon(density(data$intervalSize,bw='nrd0'), col="lightgreen", border="grey") par(mfrow=c(1,1)) plot(data$CREBmotifNo,data$PeakScore,pch=20, col=rainbow(20),main='Tag count vs CREB motifs', xlab='Number of CREB motifs',ylab='Tag counts') x <- rnorm(data$CREBmotifNo) y <- rnorm(data$PeakScore) bin<-hexbin(x, y, xbins=100) plot(bin, main="Hexagonal Binning") genome <- BSgenome.Hsapiens.UCSC.hg19 len = as.vector(seqlengths(genome)[1:24]) bigRange = GRanges(seqnames=Rle(data$Chr), ranges=IRanges(start=data$Start, end=data$End,names=data$Gene.Name), strand=data$Strand, peakScore=data$PeakScore, TSSdist=data$Distance.to.TSS, motifs=data$CREBmotifNo, motifDensity=data$motifPerInterval, tagDensity=data$tagsPerInterval) #write.table(dataMotifDensity, './130322_CREBchipAnnotationFiltered.txt', sep='\t', row.names=F)
/PhD/130422_crebChipAnnotationFiltering.R
no_license
dvbrown/Rscripts
R
false
false
2,716
r
library(BSgenome.Hsapiens.UCSC.hg19) library(ggbio) library(GenomicRanges) library(GenomicFeatures) library(hexbin) setwd('~/Documents/CREB/ChIPseqENCODE/insectBED1000/') data = read.delim('130422_mergedOutput.annotateOneExpt.countMotifs.txt', row.names=1, stringsAsFactors = F) data = data[,1:21] #convert to right type data$PeakScore = as.integer(data$PeakScore) data$Distance.to.TSS = as.integer(data$Distance.to.TSS) data$intervalSize = data$End - data$Start #normalise the tag and motif number for the size of the interval data$tagsPerInterval = (data$PeakScore / data$intervalSize ) data$motifPerInterval = (data$CREBmotifNo / data$intervalSize) #the filters dataPeakScore = subset(data, data$PeakScore >= 12) dataTSSdist = subset(dataPeakScore, dataPeakScore$Distance.to.TSS <= 3000 & dataPeakScore$Distance.to.TSS >= -500) dataMotif = subset(dataTSSdist, dataTSSdist$CREBmotifNo > 0) dataMotifDensity = subset(dataMotif, dataMotif$motifPerInterval <= 1000) #dataProtein = subset(dataMotifDensity, dataMotifDensity$Gene.Type == 'protein-coding') #make some graphs par(mfrow=c(2,1)) plot(data$Distance.to.TSS, data$motifPerInterval, type='h', xlab='Distance to transcriptional start site', ylab='Motifs per base pair', main='Density of CREB motifs', xlim=c(-5e5,5e5)) plot(data$Distance.to.TSS, data$tagsPerInterval, type='h', xlab='Distance to transcriptional start site', ylab='Tags per base pair', main='Density of CREB binding', xlim=c(-5e5,5e5)) par(mfrow=c(2,1)) plot(stats::density(data$Distance.to.TSS,bw='nrd0'), xlim=c(-1e4, 1e4),main="CREB binding at TSS",xlab="Distance from TSS (upstream - downstream)") polygon(density(data$Distance.to.TSS,bw='nrd0'), col="lightblue", border="grey") plot(stats::density(data$intervalSize,bw='nrd0'), xlim=c(0, 1e4),main="Proximal promoter length", xlab="Length of proximal promoter") polygon(density(data$intervalSize,bw='nrd0'), col="lightgreen", border="grey") par(mfrow=c(1,1)) plot(data$CREBmotifNo,data$PeakScore,pch=20, col=rainbow(20),main='Tag count vs CREB motifs', xlab='Number of CREB motifs',ylab='Tag counts') x <- rnorm(data$CREBmotifNo) y <- rnorm(data$PeakScore) bin<-hexbin(x, y, xbins=100) plot(bin, main="Hexagonal Binning") genome <- BSgenome.Hsapiens.UCSC.hg19 len = as.vector(seqlengths(genome)[1:24]) bigRange = GRanges(seqnames=Rle(data$Chr), ranges=IRanges(start=data$Start, end=data$End,names=data$Gene.Name), strand=data$Strand, peakScore=data$PeakScore, TSSdist=data$Distance.to.TSS, motifs=data$CREBmotifNo, motifDensity=data$motifPerInterval, tagDensity=data$tagsPerInterval) #write.table(dataMotifDensity, './130322_CREBchipAnnotationFiltered.txt', sep='\t', row.names=F)
# This file is auto-generated by h2o-3/h2o-bindings/bin/gen_R.py # Copyright 2016 H2O.ai; Apache License Version 2.0 (see LICENSE for details) #' # -------------------------- H2O Stacked Ensemble -------------------------- # #' #' Build a stacked ensemble (aka. Super Learner) using the H2O base #' learning algorithms specified by the user. #' #' @param x A vector containing the names or indices of the predictor variables to use in building the model. #' If x is missing,then all columns except y are used. #' @param y The name of the response variable in the model.If the data does not contain a header, this is the first column #' index, and increasing from left to right. (The response must be either an integer or a #' categorical variable). #' @param model_id Destination id for this model; auto-generated if not specified. #' @param training_frame Id of the training data frame (Not required, to allow initial validation of model parameters). #' @param validation_frame Id of the validation data frame. #' @param base_models List of model ids which we can stack together. Models must have been cross-validated using nfolds > 1, and #' folds must be identical across models. Defaults to []. #' @examples #' #' # See example R code here: #' # http://docs.h2o.ai/h2o/latest-stable/h2o-docs/data-science/stacked-ensembles.html #' #' @export h2o.stackedEnsemble <- function(x, y, training_frame, model_id = NULL, validation_frame = NULL, base_models = list() ) { # If x is missing, then assume user wants to use all columns as features. if (missing(x)) { if (is.numeric(y)) { x <- setdiff(col(training_frame), y) } else { x <- setdiff(colnames(training_frame), y) } } # Required args: training_frame if (missing(training_frame)) stop("argument 'training_frame' is missing, with no default") # Training_frame must be a key or an H2OFrame object if (!is.H2OFrame(training_frame)) tryCatch(training_frame <- h2o.getFrame(training_frame), error = function(err) { stop("argument 'training_frame' must be a valid H2OFrame or key") }) # Validation_frame must be a key or an H2OFrame object if (!is.null(validation_frame)) { if (!is.H2OFrame(validation_frame)) tryCatch(validation_frame <- h2o.getFrame(validation_frame), error = function(err) { stop("argument 'validation_frame' must be a valid H2OFrame or key") }) } # Parameter list to send to model builder parms <- list() parms$training_frame <- training_frame args <- .verify_dataxy(training_frame, x, y) parms$response_column <- args$y if (length(base_models) == 0) stop('base_models is empty') # If base_models contains models instead of ids, replace with model id for (i in 1:length(base_models)) { if (inherits(base_models[[i]], 'H2OModel')) { base_models[[i]] <- base_models[[i]]@model_id } } if (!missing(model_id)) parms$model_id <- model_id if (!missing(validation_frame)) parms$validation_frame <- validation_frame if (!missing(base_models)) parms$base_models <- base_models # Error check and build model .h2o.modelJob('stackedensemble', parms, h2oRestApiVersion = 99) }
/h2o-r/h2o-package/R/stackedensemble.R
permissive
DEVESHTARASIA/h2o-3
R
false
false
3,403
r
# This file is auto-generated by h2o-3/h2o-bindings/bin/gen_R.py # Copyright 2016 H2O.ai; Apache License Version 2.0 (see LICENSE for details) #' # -------------------------- H2O Stacked Ensemble -------------------------- # #' #' Build a stacked ensemble (aka. Super Learner) using the H2O base #' learning algorithms specified by the user. #' #' @param x A vector containing the names or indices of the predictor variables to use in building the model. #' If x is missing,then all columns except y are used. #' @param y The name of the response variable in the model.If the data does not contain a header, this is the first column #' index, and increasing from left to right. (The response must be either an integer or a #' categorical variable). #' @param model_id Destination id for this model; auto-generated if not specified. #' @param training_frame Id of the training data frame (Not required, to allow initial validation of model parameters). #' @param validation_frame Id of the validation data frame. #' @param base_models List of model ids which we can stack together. Models must have been cross-validated using nfolds > 1, and #' folds must be identical across models. Defaults to []. #' @examples #' #' # See example R code here: #' # http://docs.h2o.ai/h2o/latest-stable/h2o-docs/data-science/stacked-ensembles.html #' #' @export h2o.stackedEnsemble <- function(x, y, training_frame, model_id = NULL, validation_frame = NULL, base_models = list() ) { # If x is missing, then assume user wants to use all columns as features. if (missing(x)) { if (is.numeric(y)) { x <- setdiff(col(training_frame), y) } else { x <- setdiff(colnames(training_frame), y) } } # Required args: training_frame if (missing(training_frame)) stop("argument 'training_frame' is missing, with no default") # Training_frame must be a key or an H2OFrame object if (!is.H2OFrame(training_frame)) tryCatch(training_frame <- h2o.getFrame(training_frame), error = function(err) { stop("argument 'training_frame' must be a valid H2OFrame or key") }) # Validation_frame must be a key or an H2OFrame object if (!is.null(validation_frame)) { if (!is.H2OFrame(validation_frame)) tryCatch(validation_frame <- h2o.getFrame(validation_frame), error = function(err) { stop("argument 'validation_frame' must be a valid H2OFrame or key") }) } # Parameter list to send to model builder parms <- list() parms$training_frame <- training_frame args <- .verify_dataxy(training_frame, x, y) parms$response_column <- args$y if (length(base_models) == 0) stop('base_models is empty') # If base_models contains models instead of ids, replace with model id for (i in 1:length(base_models)) { if (inherits(base_models[[i]], 'H2OModel')) { base_models[[i]] <- base_models[[i]]@model_id } } if (!missing(model_id)) parms$model_id <- model_id if (!missing(validation_frame)) parms$validation_frame <- validation_frame if (!missing(base_models)) parms$base_models <- base_models # Error check and build model .h2o.modelJob('stackedensemble', parms, h2oRestApiVersion = 99) }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/general_use_functions.R \name{sigm} \alias{sigm} \title{Sigmoid function} \usage{ sigm(z) } \description{ Sigmoid function }
/epimapAUX/man/sigm.Rd
no_license
cboix/EPIMAP_ANALYSIS
R
false
true
203
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/general_use_functions.R \name{sigm} \alias{sigm} \title{Sigmoid function} \usage{ sigm(z) } \description{ Sigmoid function }
library(dplyr) library(stringr) # Preparation: Getting the data if (!file.exists("data")) { dir.create("data") } temp <- tempfile() download.file("https://d396qusza40orc.cloudfront.net/getdata%2Fprojectfiles%2FUCI%20HAR%20Dataset.zip", temp) unzip(temp, exdir = "data") unlink(temp) # 1. Merging training and test data # Pulling together training and test data files # including activity (train_Y.txt, test_Y.txt) # and subject id (subject_train.txt, subject_test.txt) data_dir <- file.path("data", "UCI HAR Dataset") # loading the training data x_train <- read.delim(file.path(data_dir, "train", "X_train.txt"), header = FALSE, sep = "") subject_train <- read.delim(file.path(data_dir, "train", "subject_train.txt"), header = FALSE, sep = "") y_train <- read.delim(file.path(data_dir, "train", "y_train.txt"), header = FALSE, sep = "") train_data <- cbind(subject_train, x_train, y_train) # loading the test data x_test <- read.delim(file.path(data_dir, "test", "X_test.txt"), header = FALSE, sep = "") subject_test <- read.delim(file.path(data_dir, "test", "subject_test.txt"), header = FALSE, sep = "") y_test <- read.delim(file.path(data_dir, "test", "y_test.txt"), header = FALSE, sep = "") test_data <- cbind(subject_test, x_test, y_test) # merging train and test data merged_data <- rbind(train_data, test_data) # Retrieving column names # Note: taking only the second column from features.txt x_column_names <- read.delim(file.path(data_dir, "features.txt"), sep = " ", header = FALSE)[, 2] # Fixing column names: 'BodyBody' -> 'Body' (see CodeBook) x_column_names <- sub("BodyBody", "Body", x_column_names) # Disambiguating columns 303-344 x_column_names[303:316] <- paste(x_column_names[303:316], "-X", sep = "") x_column_names[317:330] <- paste(x_column_names[317:330], "-Y", sep = "") x_column_names[331:344] <- paste(x_column_names[331:344], "-Z", sep = "") # Disambiguating columns 382-423 x_column_names[382:395] <- paste(x_column_names[382:395], "-X", sep = "") x_column_names[396:409] <- paste(x_column_names[396:409], "-Y", sep = "") x_column_names[410:423] <- paste(x_column_names[410:423], "-Z", sep = "") # Disambiguating columns 461-502 x_column_names[461:474] <- paste(x_column_names[461:474], "-X", sep = "") x_column_names[475:488] <- paste(x_column_names[475:488], "-Y", sep = "") x_column_names[489:502] <- paste(x_column_names[489:502], "-Z", sep = "") column_names <- append(append("subject_id", x_column_names), "activity") colnames(merged_data) <- column_names # 2. Reducing features reduced_data <- as_tibble(merged_data) %>% select("subject_id", "activity", contains("mean()") | contains("std()")) # 3. Substituting activity labels activity_labels <- read.delim(file.path(data_dir, "activity_labels.txt"), sep = " ", header = FALSE)[, 2] tidy_data <- reduced_data %>% mutate(activity = activity_labels[activity]) # 4. Renaming feature columns source('transform_column_names.R') column_names <- colnames(tidy_data) tidy_column_names <- transform_column_names(column_names) colnames(tidy_data) <- tidy_column_names # 5. Creating a summary data set summary <- tidy_data %>% group_by(subject_id, activity) %>% summarise_all(mean) # 6. Storing generated tables if (!file.exists("output")) { dir.create("output") } write.table(tidy_data, file.path("output", "har-tidy.txt"), row.names = FALSE) write.table(summary, file.path("output", "har-summary.txt"), row.names = FALSE)
/run_analysis.R
no_license
oliver7654/getting-and-cleaning-data-course-project
R
false
false
3,444
r
library(dplyr) library(stringr) # Preparation: Getting the data if (!file.exists("data")) { dir.create("data") } temp <- tempfile() download.file("https://d396qusza40orc.cloudfront.net/getdata%2Fprojectfiles%2FUCI%20HAR%20Dataset.zip", temp) unzip(temp, exdir = "data") unlink(temp) # 1. Merging training and test data # Pulling together training and test data files # including activity (train_Y.txt, test_Y.txt) # and subject id (subject_train.txt, subject_test.txt) data_dir <- file.path("data", "UCI HAR Dataset") # loading the training data x_train <- read.delim(file.path(data_dir, "train", "X_train.txt"), header = FALSE, sep = "") subject_train <- read.delim(file.path(data_dir, "train", "subject_train.txt"), header = FALSE, sep = "") y_train <- read.delim(file.path(data_dir, "train", "y_train.txt"), header = FALSE, sep = "") train_data <- cbind(subject_train, x_train, y_train) # loading the test data x_test <- read.delim(file.path(data_dir, "test", "X_test.txt"), header = FALSE, sep = "") subject_test <- read.delim(file.path(data_dir, "test", "subject_test.txt"), header = FALSE, sep = "") y_test <- read.delim(file.path(data_dir, "test", "y_test.txt"), header = FALSE, sep = "") test_data <- cbind(subject_test, x_test, y_test) # merging train and test data merged_data <- rbind(train_data, test_data) # Retrieving column names # Note: taking only the second column from features.txt x_column_names <- read.delim(file.path(data_dir, "features.txt"), sep = " ", header = FALSE)[, 2] # Fixing column names: 'BodyBody' -> 'Body' (see CodeBook) x_column_names <- sub("BodyBody", "Body", x_column_names) # Disambiguating columns 303-344 x_column_names[303:316] <- paste(x_column_names[303:316], "-X", sep = "") x_column_names[317:330] <- paste(x_column_names[317:330], "-Y", sep = "") x_column_names[331:344] <- paste(x_column_names[331:344], "-Z", sep = "") # Disambiguating columns 382-423 x_column_names[382:395] <- paste(x_column_names[382:395], "-X", sep = "") x_column_names[396:409] <- paste(x_column_names[396:409], "-Y", sep = "") x_column_names[410:423] <- paste(x_column_names[410:423], "-Z", sep = "") # Disambiguating columns 461-502 x_column_names[461:474] <- paste(x_column_names[461:474], "-X", sep = "") x_column_names[475:488] <- paste(x_column_names[475:488], "-Y", sep = "") x_column_names[489:502] <- paste(x_column_names[489:502], "-Z", sep = "") column_names <- append(append("subject_id", x_column_names), "activity") colnames(merged_data) <- column_names # 2. Reducing features reduced_data <- as_tibble(merged_data) %>% select("subject_id", "activity", contains("mean()") | contains("std()")) # 3. Substituting activity labels activity_labels <- read.delim(file.path(data_dir, "activity_labels.txt"), sep = " ", header = FALSE)[, 2] tidy_data <- reduced_data %>% mutate(activity = activity_labels[activity]) # 4. Renaming feature columns source('transform_column_names.R') column_names <- colnames(tidy_data) tidy_column_names <- transform_column_names(column_names) colnames(tidy_data) <- tidy_column_names # 5. Creating a summary data set summary <- tidy_data %>% group_by(subject_id, activity) %>% summarise_all(mean) # 6. Storing generated tables if (!file.exists("output")) { dir.create("output") } write.table(tidy_data, file.path("output", "har-tidy.txt"), row.names = FALSE) write.table(summary, file.path("output", "har-summary.txt"), row.names = FALSE)
# Exam #1: Intro to "R" Programming # Sept 2020 # All questions are worth 1 point each unless otherwise specified. # You have 36h to take the exam. The exam will be due Friday, Sept. 18 at 9pm. #---------------------------------------------------------------------------------- # Creating objects & using proper 'R' syntax ---- #1) please provide the commands that will show the data type of the following objects: x <- c(FALSE,TRUE,FALSE) class(x) #2) Demonstrate the two ways you can assign a sequence of 10 numbers to a vector object. The sequence should start at 5. a = seq(5, 14, 1) b = 5:14 #3) Find the number of values assigned to one of the vector objects created in Question 2. length(a) #4) Create 2 objects and assign each 5 values. (3 POINTS) d = c(1,3,5,7,9) e = c(2,4,6,8,10) #a) Perform inner and outer multiplication on these two objects d%*%e d%o%e #b) Find the mean and standard deviation of each object mean(d) mean(e) sd(d) sd(e) #5) Create four objects, each with a different data type: character, integer, double-numeric, and factor. ## The integer should have at least 3 values. The factor should have at least two levels. character = "Hello" interger = c(2L,4L,5L) Double = c(1,1.5,2,2.5) Factor = factor(c("N","S","E","W"), levels = 4) #6) Using indexing, extract the 1st and 7th values from a sequence your created in Question 2. (3 POINTS) # a) Assign the 1st and 7th values a new object. A = a[1] B = a[7] # b) Apply the "less-than"; "greater-than"; "greater-than-equal to" operators. A<B A>B A>=B # c) Complete the following operations where: # z = 1st value (see 6c); # y = 7th value (see 6c); # x = 5 # (z plus x) * (z + y))/2 # 10 * (x - y) Z=A Y=B x=5 (Z+x)*(Z+Y)/2 10*(x-Y) # 7) In comment, please tell me what is the “R” operator for ‘not’ (or negation)? #The operator for "not" is !. != means not equal. # 8) Using the two objects you created in Question 4, apply the following operators: %%, ^, %/%. (2 POINTS) # In a comment, please explain what each operator is doing. e%%d d^e d%/%e #The %% operator is giving me the remainders from dividing each of the numbers in the first vector by the numbers in the 2nd vector. #The ^ operator is taking the first vector and raising the values with in it by the corresponding values of the 2nd vector. #The %/% vector is dividing each of the values from the first vector by the corresponding value in the 2nd vector without any remainders or fractions. #9) Create an object with a left-to-right assignment operator. X = a<<-b # 10) Create 3 objects that each have a number assigned to them. ## The code for all three objects must exists a single line in the script. ## Print the values of those three objects. O1 = 1 O2 = 2 O3 = 3 print(O1) print(O2) print(O3) # 11) In a series of comments and code, describe and show examples of the special values Inf, -Inf, NaN, and NA. ZA = NA ZA = Inf/-Inf #Inf means infinity, -Inf means negative infiinity, NaN means not a number, and NA means that there is no data (this default fills matrices and data frames) #Ifinity divided by negative infinity is not a number (NaN) # 12) Create a die with six sides and sample it with and without replacement. ## What is the difference between the two methods? die=c(1,2,3,4,5,6) sample(die, replace = FALSE) sample(die, replace = TRUE) #With replacements allows the same side of the die to be sampled while the false method does not allow for resampling. # Creating data storage structures ------ # 13) Create an array with 6 rows, 3 columns, and 2 sheets (or levels). AO = array(data = 1:36, dim = c(6, 3, 2)) # 14) Create a matrix with 10 rows and 4 columns. MAT = matrix(1:40, nrow = 10, ncol = 4) # 15) In a comment, describe the difference between the two data structures. #Arrays are three dimensional in a similar fashion to a book while matrices are two dimensional. # 16) Using indexing, extract the 2nd, 6th, and 9th values from the 3rd column of the matrix your created in Question 14. MAT[c(2,6,9),3] # 17) Create an object that extracts the second value from the second column in the second level (or sheet) in your array. OA = AO[2,2,2] # 18) Create a data frame object with 5 rows and 3 columns. Give the columns the names of your three favorite foods. data.frame("Thai" = c(1,2,3,4,5), "Sushi" = c(1,2,3,4,5), "Mexican" = c(1,2,3,4,5)) # 19) Assign the formula for a linear regression to a new object using the following values: slope = 2, y-intercept = 0.5 LR = as.formula(y~2*x+0.5) # Working with data -------- # Use the data frame “test1_data.Rdata” into RStudio console for the following questions: # 20) Print the structure of the data frame. Insert a comment that describes the five different data types are present. load("~/test1_data.Rdata") print(d) class(d) str(d) #The five types of data present are intergers, characters, Factors, date-time data, and numbers. # 21) Show the the FIRST 6 rows of the data frame "d"? head(d) # 22) Find the number of rows in the data set. nrow(d) # 23) Find the number of columns in the data set. ncol(d) # 24) Change the ‘tow’ field from a character to a factor data type. as.factor(d$tow) is.factor(d$tow) # 25) Change the ‘haul’ field from a numeric to an integer data type. as.integer(d$haul) is.integer(d$haul) # 26) Remove the “sw.density” column from the data frame. d$sw.density=NULL # 27) Print the data type of only the ‘transect.id’ column. class(d$transect.id) #Working with character strings ----- # Use the data frame “test1_data.Rdata” into RStudio console for the following questions: library(stringr) #30) Find the unique values of transect.id and assign those to a new object. UV = unique(d$transect.id) #31) Extract the last 10 unique, character strings from transect.id and assign those strings to a new object length(UV) UVII=UV[32:41] #32) Each value of transect.id has three components, separated by a dash ('-'). ## Break these 3 components apart using the dash as the separator and assign each component to a new object. TID=str_split_fixed(d$transect.id, pattern = "-", n=4) OST = TID[,1] N = TID[,2] I = TID[,3] L = TID[,4] #There were 4 components seperated by "-" I seperated the 4th component as well. #33) Recombine the three components into a single text string. ##Order the components so that the "D, M, S" component is first in the test string. ##Separate with a underscore ("_"). R4=str_c(L, I, N, OST, sep = "_") #I recombined placing the 4th component to the front. #34) Using the first 5 unique transect.id values from transect.id, replace the dash ("-") with a underscore ('_') SUB = gsub(UV[1:5], pattern = "-", replacement = "_") #35) Using the first 5 unique transect.id values, extract the first 5 characters (reading left to right) from the string ## and assign those values to a new object NO = str_sub(UV[1:5], start = 1, end = 5) #Importing data stored in different file types (e.g. .csv, .txt. , .xlsx) into 'R' ---- #36) Import the following files into 'R' and assign each data set its own unique object. #These data sets were shared with you in an accompanying zip file. #"aurelia_15minCell_statareas.Rdata" "aurelia_15minCell_statareas.txt" "Aurelia_SEAMAP_2012-2018_30minCell.xlsx" #"ENVREC.csv" "OST14_1E_d5_frames.csv" library(ncdf4) library(readxl) setwd ("C:/Users/Blaine/Downloads/test1_data_2020") B = load("C:/Users/Blaine/Downloads/test1_data_2020/aurelia_15minCell_statareas.Rdata") ENV = read.csv("C:/Users/Blaine/Downloads/test1_data_2020/ENVREC.csv") A15T = read.table("C:/Users/Blaine/Downloads/test1_data_2020/aurelia_15minCell_statareas.txt", header = T, stringsAsFactors = F, sep = ",") OST14 = read.csv("C:/Users/Blaine/Downloads/test1_data_2020/OST14_1E_d5_frames.csv", header = F) #I looked at this file outside of R using both Excel and Notepad, but I couldn't decide how to seperate the data to make it intelligible. AUR = read_xlsx("C:/Users/Blaine/Downloads/test1_data_2020/Aurelia_SEAMAP_2012-2018_30minCell.xlsx") #Dates---- #37) Convert the following date to a 'R' date-time object. Set it to be in the West Coast (i.e., East Coast) time zone. t <- "9/17/2020 12:05:32" d= as.POSIXct(strptime(x = t, format = "%m/%d/%Y %H:%M:%OS", tz="America/Los_Angeles" ))
/students_scripts/Blaine Novak Pilch/Blaine Novak Pilch Exam 1.R
no_license
Planktos/Intro2R_2020
R
false
false
8,922
r
# Exam #1: Intro to "R" Programming # Sept 2020 # All questions are worth 1 point each unless otherwise specified. # You have 36h to take the exam. The exam will be due Friday, Sept. 18 at 9pm. #---------------------------------------------------------------------------------- # Creating objects & using proper 'R' syntax ---- #1) please provide the commands that will show the data type of the following objects: x <- c(FALSE,TRUE,FALSE) class(x) #2) Demonstrate the two ways you can assign a sequence of 10 numbers to a vector object. The sequence should start at 5. a = seq(5, 14, 1) b = 5:14 #3) Find the number of values assigned to one of the vector objects created in Question 2. length(a) #4) Create 2 objects and assign each 5 values. (3 POINTS) d = c(1,3,5,7,9) e = c(2,4,6,8,10) #a) Perform inner and outer multiplication on these two objects d%*%e d%o%e #b) Find the mean and standard deviation of each object mean(d) mean(e) sd(d) sd(e) #5) Create four objects, each with a different data type: character, integer, double-numeric, and factor. ## The integer should have at least 3 values. The factor should have at least two levels. character = "Hello" interger = c(2L,4L,5L) Double = c(1,1.5,2,2.5) Factor = factor(c("N","S","E","W"), levels = 4) #6) Using indexing, extract the 1st and 7th values from a sequence your created in Question 2. (3 POINTS) # a) Assign the 1st and 7th values a new object. A = a[1] B = a[7] # b) Apply the "less-than"; "greater-than"; "greater-than-equal to" operators. A<B A>B A>=B # c) Complete the following operations where: # z = 1st value (see 6c); # y = 7th value (see 6c); # x = 5 # (z plus x) * (z + y))/2 # 10 * (x - y) Z=A Y=B x=5 (Z+x)*(Z+Y)/2 10*(x-Y) # 7) In comment, please tell me what is the “R” operator for ‘not’ (or negation)? #The operator for "not" is !. != means not equal. # 8) Using the two objects you created in Question 4, apply the following operators: %%, ^, %/%. (2 POINTS) # In a comment, please explain what each operator is doing. e%%d d^e d%/%e #The %% operator is giving me the remainders from dividing each of the numbers in the first vector by the numbers in the 2nd vector. #The ^ operator is taking the first vector and raising the values with in it by the corresponding values of the 2nd vector. #The %/% vector is dividing each of the values from the first vector by the corresponding value in the 2nd vector without any remainders or fractions. #9) Create an object with a left-to-right assignment operator. X = a<<-b # 10) Create 3 objects that each have a number assigned to them. ## The code for all three objects must exists a single line in the script. ## Print the values of those three objects. O1 = 1 O2 = 2 O3 = 3 print(O1) print(O2) print(O3) # 11) In a series of comments and code, describe and show examples of the special values Inf, -Inf, NaN, and NA. ZA = NA ZA = Inf/-Inf #Inf means infinity, -Inf means negative infiinity, NaN means not a number, and NA means that there is no data (this default fills matrices and data frames) #Ifinity divided by negative infinity is not a number (NaN) # 12) Create a die with six sides and sample it with and without replacement. ## What is the difference between the two methods? die=c(1,2,3,4,5,6) sample(die, replace = FALSE) sample(die, replace = TRUE) #With replacements allows the same side of the die to be sampled while the false method does not allow for resampling. # Creating data storage structures ------ # 13) Create an array with 6 rows, 3 columns, and 2 sheets (or levels). AO = array(data = 1:36, dim = c(6, 3, 2)) # 14) Create a matrix with 10 rows and 4 columns. MAT = matrix(1:40, nrow = 10, ncol = 4) # 15) In a comment, describe the difference between the two data structures. #Arrays are three dimensional in a similar fashion to a book while matrices are two dimensional. # 16) Using indexing, extract the 2nd, 6th, and 9th values from the 3rd column of the matrix your created in Question 14. MAT[c(2,6,9),3] # 17) Create an object that extracts the second value from the second column in the second level (or sheet) in your array. OA = AO[2,2,2] # 18) Create a data frame object with 5 rows and 3 columns. Give the columns the names of your three favorite foods. data.frame("Thai" = c(1,2,3,4,5), "Sushi" = c(1,2,3,4,5), "Mexican" = c(1,2,3,4,5)) # 19) Assign the formula for a linear regression to a new object using the following values: slope = 2, y-intercept = 0.5 LR = as.formula(y~2*x+0.5) # Working with data -------- # Use the data frame “test1_data.Rdata” into RStudio console for the following questions: # 20) Print the structure of the data frame. Insert a comment that describes the five different data types are present. load("~/test1_data.Rdata") print(d) class(d) str(d) #The five types of data present are intergers, characters, Factors, date-time data, and numbers. # 21) Show the the FIRST 6 rows of the data frame "d"? head(d) # 22) Find the number of rows in the data set. nrow(d) # 23) Find the number of columns in the data set. ncol(d) # 24) Change the ‘tow’ field from a character to a factor data type. as.factor(d$tow) is.factor(d$tow) # 25) Change the ‘haul’ field from a numeric to an integer data type. as.integer(d$haul) is.integer(d$haul) # 26) Remove the “sw.density” column from the data frame. d$sw.density=NULL # 27) Print the data type of only the ‘transect.id’ column. class(d$transect.id) #Working with character strings ----- # Use the data frame “test1_data.Rdata” into RStudio console for the following questions: library(stringr) #30) Find the unique values of transect.id and assign those to a new object. UV = unique(d$transect.id) #31) Extract the last 10 unique, character strings from transect.id and assign those strings to a new object length(UV) UVII=UV[32:41] #32) Each value of transect.id has three components, separated by a dash ('-'). ## Break these 3 components apart using the dash as the separator and assign each component to a new object. TID=str_split_fixed(d$transect.id, pattern = "-", n=4) OST = TID[,1] N = TID[,2] I = TID[,3] L = TID[,4] #There were 4 components seperated by "-" I seperated the 4th component as well. #33) Recombine the three components into a single text string. ##Order the components so that the "D, M, S" component is first in the test string. ##Separate with a underscore ("_"). R4=str_c(L, I, N, OST, sep = "_") #I recombined placing the 4th component to the front. #34) Using the first 5 unique transect.id values from transect.id, replace the dash ("-") with a underscore ('_') SUB = gsub(UV[1:5], pattern = "-", replacement = "_") #35) Using the first 5 unique transect.id values, extract the first 5 characters (reading left to right) from the string ## and assign those values to a new object NO = str_sub(UV[1:5], start = 1, end = 5) #Importing data stored in different file types (e.g. .csv, .txt. , .xlsx) into 'R' ---- #36) Import the following files into 'R' and assign each data set its own unique object. #These data sets were shared with you in an accompanying zip file. #"aurelia_15minCell_statareas.Rdata" "aurelia_15minCell_statareas.txt" "Aurelia_SEAMAP_2012-2018_30minCell.xlsx" #"ENVREC.csv" "OST14_1E_d5_frames.csv" library(ncdf4) library(readxl) setwd ("C:/Users/Blaine/Downloads/test1_data_2020") B = load("C:/Users/Blaine/Downloads/test1_data_2020/aurelia_15minCell_statareas.Rdata") ENV = read.csv("C:/Users/Blaine/Downloads/test1_data_2020/ENVREC.csv") A15T = read.table("C:/Users/Blaine/Downloads/test1_data_2020/aurelia_15minCell_statareas.txt", header = T, stringsAsFactors = F, sep = ",") OST14 = read.csv("C:/Users/Blaine/Downloads/test1_data_2020/OST14_1E_d5_frames.csv", header = F) #I looked at this file outside of R using both Excel and Notepad, but I couldn't decide how to seperate the data to make it intelligible. AUR = read_xlsx("C:/Users/Blaine/Downloads/test1_data_2020/Aurelia_SEAMAP_2012-2018_30minCell.xlsx") #Dates---- #37) Convert the following date to a 'R' date-time object. Set it to be in the West Coast (i.e., East Coast) time zone. t <- "9/17/2020 12:05:32" d= as.POSIXct(strptime(x = t, format = "%m/%d/%Y %H:%M:%OS", tz="America/Los_Angeles" ))
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/firebasedynamiclinks_objects.R \name{ITunesConnectAnalytics} \alias{ITunesConnectAnalytics} \title{ITunesConnectAnalytics Object} \usage{ ITunesConnectAnalytics(ct = NULL, mt = NULL, pt = NULL, at = NULL) } \arguments{ \item{ct}{Campaign text that developers can optionally add to any link in order to} \item{mt}{iTune media types, including music, podcasts, audiobooks and so on} \item{pt}{Provider token that enables analytics for Dynamic Links from within iTunes} \item{at}{Affiliate token used to create affiliate-coded links} } \value{ ITunesConnectAnalytics object } \description{ ITunesConnectAnalytics Object } \details{ Autogenerated via \code{\link[googleAuthR]{gar_create_api_objects}} Parameters for iTunes Connect App Analytics. }
/googlefirebasedynamiclinksv1.auto/man/ITunesConnectAnalytics.Rd
permissive
GVersteeg/autoGoogleAPI
R
false
true
825
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/firebasedynamiclinks_objects.R \name{ITunesConnectAnalytics} \alias{ITunesConnectAnalytics} \title{ITunesConnectAnalytics Object} \usage{ ITunesConnectAnalytics(ct = NULL, mt = NULL, pt = NULL, at = NULL) } \arguments{ \item{ct}{Campaign text that developers can optionally add to any link in order to} \item{mt}{iTune media types, including music, podcasts, audiobooks and so on} \item{pt}{Provider token that enables analytics for Dynamic Links from within iTunes} \item{at}{Affiliate token used to create affiliate-coded links} } \value{ ITunesConnectAnalytics object } \description{ ITunesConnectAnalytics Object } \details{ Autogenerated via \code{\link[googleAuthR]{gar_create_api_objects}} Parameters for iTunes Connect App Analytics. }
library(sp) library(keras) library(tensorflow) library(tfdatasets) library(purrr) library(ggplot2) library(rsample) library(stars) library(raster) library(reticulate) library(mapview) library(imager) library(raster) library(gdalUtils) library(stars) setwd("./") # ################image based############# first_model <- keras_model_sequential() layer_conv_2d(first_model,filters = 32,kernel_size = 3, activation = "relu",input_shape = c(128,128,3)) layer_max_pooling_2d(first_model, pool_size = c(2, 2)) layer_conv_2d(first_model, filters = 64, kernel_size = c(3, 3), activation = "relu") layer_max_pooling_2d(first_model, pool_size = c(2, 2)) layer_conv_2d(first_model, filters = 128, kernel_size = c(3, 3), activation = "relu") layer_max_pooling_2d(first_model, pool_size = c(2, 2)) layer_conv_2d(first_model, filters = 128, kernel_size = c(3, 3), activation = "relu") layer_max_pooling_2d(first_model, pool_size = c(2, 2)) layer_flatten(first_model) layer_dense(first_model, units = 256, activation = "relu") layer_dense(first_model, units = 1, activation = "sigmoid") # Einladen der Trainingsdaten subset_list <- list.files("Data/Subsets_128/Slices_Muenster/True", full.names = T) data_true <- data.frame(img=subset_list,lbl=rep(1L,length(subset_list))) subset_list <- list.files("Data/Subsets_128/Slices_Muenster/False", full.names = T) data_false <- data.frame(img=subset_list,lbl=rep(0L,length(subset_list))) data <- rbind(data_true,data_false) set.seed(2020) #Verarbeitung der Trainingsdaten data <- initial_split(data,prop = 0.75, strata = "lbl") c(nrow(training(data)[training(data)$lbl==0,]), nrow(training(data)[training(data)$lbl==1,])) training_dataset <- tensor_slices_dataset(training(data)) dataset_iterator <- as_iterator(training_dataset) dataset_list <- iterate(dataset_iterator) head(dataset_list) subset_size <- first_model$input_shape[2:3] training_dataset <- dataset_map(training_dataset, function(.x) list_modify(.x, img = tf$image$decode_jpeg(tf$io$read_file(.x$img)))) training_dataset <- dataset_map(training_dataset, function(.x) list_modify(.x, img = tf$image$convert_image_dtype(.x$img, dtype = tf$float32))) training_dataset <- dataset_map(training_dataset, function(.x) list_modify(.x, img = tf$image$resize(.x$img, size = shape(subset_size[1], subset_size[2])))) training_dataset <- dataset_shuffle(training_dataset, buffer_size = 10L*128) training_dataset <- dataset_batch(training_dataset, 10L) training_dataset <- dataset_map(training_dataset, unname) dataset_iterator <- as_iterator(training_dataset) dataset_list <- iterate(dataset_iterator) dataset_list[[1]][[1]] dataset_list[[1]][[1]]$shape dataset_list[[1]][[2]] validation_dataset <- tensor_slices_dataset(testing(data)) validation_dataset <- dataset_map(validation_dataset, function(.x) list_modify(.x, img = tf$image$decode_jpeg(tf$io$read_file(.x$img)))) validation_dataset <- dataset_map(validation_dataset, function(.x) list_modify(.x, img = tf$image$convert_image_dtype(.x$img, dtype = tf$float32))) validation_dataset <- dataset_map(validation_dataset, function(.x) list_modify(.x, img = tf$image$resize(.x$img, size = shape(subset_size[1], subset_size[2])))) validation_dataset <- dataset_batch(validation_dataset, 10L) validation_dataset <- dataset_map(validation_dataset, unname) # Trainieren des Modells compile( first_model, optimizer = optimizer_rmsprop(lr = 5e-5), loss = "binary_crossentropy", metrics = "accuracy" ) diagnostics <- fit(first_model, training_dataset, epochs = 18, validation_data = validation_dataset) plot(diagnostics) # Vorhersage predictions <- predict(first_model,validation_dataset) par(mfrow=c(1,3),mai=c(0.1,0.1,0.3,0.1),cex=0.8) for(i in 1:3){ sample <- floor(runif(n = 1,min = 1,max = 56)) img_path <- as.character(testing(data)[[sample,1]]) img <- stack(img_path) plotRGB(img,margins=T,main = paste("prediction:",round(predictions[sample],digits=3)," | ","label:",as.character(testing(data)[[sample,2]]))) } # Einladen der Validierungsdaten subset_list <- list.files("Data/Subsets_128/Slices_Berlin/True", full.names = T) dataset <- tensor_slices_dataset(subset_list) dataset <- dataset_map(dataset, function(.x) tf$image$decode_jpeg(tf$io$read_file(.x))) dataset <- dataset_map(dataset, function(.x) tf$image$convert_image_dtype(.x, dtype = tf$float32)) dataset <- dataset_map(dataset, function(.x) tf$image$resize(.x, size = shape(128, 128))) dataset <- dataset_batch(dataset, 10L) dataset <- dataset_map(dataset, unname) #Vorhersage auf den Validierungsdaten predictions <- predict(first_model, dataset) save_model_hdf5(first_model,filepath = "Data/Models/imagebased_model2.h5") # Validierung vgg16_feat_extr <- application_vgg16(include_top = F,input_shape = c(128,128,3),weights = "imagenet") freeze_weights(vgg16_feat_extr) pretrained_model <- keras_model_sequential(vgg16_feat_extr$layers[1:15]) pretrained_model <- layer_flatten(pretrained_model) pretrained_model <- layer_dense(pretrained_model,units = 256,activation = "relu") pretrained_model <- layer_dense(pretrained_model,units = 1,activation = "sigmoid") compile( pretrained_model, optimizer = optimizer_rmsprop(lr = 1e-5), loss = "binary_crossentropy", metrics = c("accuracy") ) diagnostics <- fit(pretrained_model, training_dataset, epochs = 8, validation_data = validation_dataset) plot(diagnostics) diagnostics$metrics #UNET######################################################## input_tensor <- layer_input(shape = c(448,448,3)) unet_tensor <- layer_conv_2d(input_tensor,filters = 64,kernel_size = c(3,3), padding = "same",activation = "relu") conc_tensor2 <- layer_conv_2d(unet_tensor,filters = 64,kernel_size = c(3,3), padding = "same",activation = "relu") unet_tensor <- layer_max_pooling_2d(conc_tensor2) unet_tensor <- layer_conv_2d(unet_tensor,filters = 128,kernel_size = c(3,3), padding = "same",activation = "relu") conc_tensor1 <- layer_conv_2d(unet_tensor,filters = 128,kernel_size = c(3,3), padding = "same",activation = "relu") unet_tensor <- layer_max_pooling_2d(conc_tensor1) unet_tensor <- layer_conv_2d(unet_tensor,filters = 256,kernel_size = c(3,3), padding = "same",activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor,filters = 256,kernel_size = c(3,3), padding = "same",activation = "relu") unet_tensor <- layer_conv_2d_transpose(unet_tensor,filters = 128,kernel_size = c(2,2),strides = 2,padding = "same") unet_tensor <- layer_concatenate(list(conc_tensor1,unet_tensor)) unet_tensor <- layer_conv_2d(unet_tensor, filters = 128, kernel_size = c(3,3),padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor, filters = 128, kernel_size = c(3,3),padding = "same", activation = "relu") unet_tensor <- layer_conv_2d_transpose(unet_tensor,filters = 64,kernel_size = c(2,2),strides = 2,padding = "same") unet_tensor <- layer_concatenate(list(conc_tensor2,unet_tensor)) unet_tensor <- layer_conv_2d(unet_tensor, filters = 64, kernel_size = c(3,3),padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor, filters = 64, kernel_size = c(3,3),padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor,filters = 1,kernel_size = 1, activation = "sigmoid") unet_model <- keras_model(inputs = input_tensor, outputs = unet_tensor) vgg16_feat_extr <- application_vgg16(weights = "imagenet", include_top = FALSE, input_shape = c (448,448,3)) unet_tensor <- vgg16_feat_extr$layers[[15]]$output unet_tensor <- layer_conv_2d(unet_tensor, filters = 1024, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor, filters = 1024, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d_transpose(unet_tensor, filters = 512, kernel_size = 2, strides = 2, padding = "same") unet_tensor <- layer_concatenate(list(vgg16_feat_extr$layers[[14]]$output, unet_tensor)) unet_tensor <- layer_conv_2d(unet_tensor, filters = 512, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor, filters = 512, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d_transpose(unet_tensor, filters = 256, kernel_size = 2, strides = 2, padding = "same") unet_tensor <- layer_concatenate(list(vgg16_feat_extr$layers[[10]]$output, unet_tensor)) unet_tensor <- layer_conv_2d(unet_tensor,filters = 256, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor,filters = 256, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d_transpose(unet_tensor, filters = 128, kernel_size = 2, strides = 2, padding = "same") unet_tensor <- layer_concatenate(list(vgg16_feat_extr$layers[[6]]$output, unet_tensor)) unet_tensor <- layer_conv_2d(unet_tensor, filters = 128, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor, filters = 128, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d_transpose(unet_tensor, filters = 64, kernel_size = 2, strides = 2, padding = "same") unet_tensor <- layer_concatenate(list(vgg16_feat_extr$layers[[3]]$output, unet_tensor)) unet_tensor <- layer_conv_2d(unet_tensor, filters = 64, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor, filters = 64, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor, filters = 1, kernel_size = 1, activation = "sigmoid") pretrained_unet <- keras_model(inputs = vgg16_feat_extr$input, outputs = unet_tensor) spectral_augmentation <- function(img) { img <- tf$image$random_brightness(img, max_delta = 0.3) img <- tf$image$random_contrast(img, lower = 0.8, upper = 1.2) img <- tf$image$random_saturation(img, lower = 0.8, upper = 1.2) img <- tf$clip_by_value(img,0, 1) } dl_prepare_data <- function(files=NULL, train, predict=FALSE, subsets_path=NULL, model_input_shape = c(448,448), batch_size = 10L) { if (!predict){ spectral_augmentation <- function(img) { img <- tf$image$random_brightness(img, max_delta = 0.3) img <- tf$image$random_contrast(img, lower = 0.8, upper = 1.1) img <- tf$image$random_saturation(img, lower = 0.8, upper = 1.1) img <- tf$clip_by_value(img, 0, 1) } dataset <- tensor_slices_dataset(files) dataset <- dataset_map(dataset, function(.x) list_modify(.x,img = tf$image$decode_jpeg(tf$io$read_file(.x$img)), mask = tf$image$decode_jpeg(tf$io$read_file(.x$mask)))) dataset <- dataset_map(dataset, function(.x) list_modify(.x, img = tf$image$convert_image_dtype(.x$img, dtype = tf$float32), mask = tf$image$convert_image_dtype(.x$mask, dtype = tf$float32))) dataset <- dataset_map(dataset, function(.x) list_modify(.x, img = tf$image$resize(.x$img, size = shape(model_input_shape[1], model_input_shape[2])), mask = tf$image$resize(.x$mask, size = shape(model_input_shape[1], model_input_shape[2])))) if (train) { augmentation <- dataset_map(dataset, function(.x) list_modify(.x, img = spectral_augmentation(.x$img))) augmentation <- dataset_map(augmentation, function(.x) list_modify(.x, img = tf$image$flip_left_right(.x$img), mask = tf$image$flip_left_right(.x$mask))) dataset_augmented <- dataset_concatenate(dataset,augmentation) augmentation <- dataset_map(dataset, function(.x) list_modify(.x, img = spectral_augmentation(.x$img))) augmentation <- dataset_map(augmentation, function(.x) list_modify(.x, img = tf$image$flip_up_down(.x$img), mask = tf$image$flip_up_down(.x$mask))) dataset_augmented <- dataset_concatenate(dataset_augmented,augmentation) augmentation <- dataset_map(dataset, function(.x) list_modify(.x, img = spectral_augmentation(.x$img))) augmentation <- dataset_map(augmentation, function(.x) list_modify(.x, img = tf$image$flip_left_right(.x$img), mask = tf$image$flip_left_right(.x$mask))) augmentation <- dataset_map(augmentation, function(.x) list_modify(.x, img = tf$image$flip_up_down(.x$img), mask = tf$image$flip_up_down(.x$mask))) dataset_augmented <- dataset_concatenate(dataset_augmented,augmentation) } if (train) { dataset <- dataset_shuffle(dataset_augmented, buffer_size = batch_size*128) } dataset <- dataset_batch(dataset, batch_size) dataset <- dataset_map(dataset, unname) }else{ o <- order(as.numeric(tools::file_path_sans_ext(basename(list.files(subsets_path))))) subset_list <- list.files(subsets_path, full.names = T)[o] dataset <- tensor_slices_dataset(subset_list) dataset <- dataset_map(dataset, function(.x) tf$image$decode_jpeg(tf$io$read_file(.x))) dataset <- dataset_map(dataset, function(.x) tf$image$convert_image_dtype(.x, dtype = tf$float32)) dataset <- dataset_map(dataset, function(.x) tf$image$resize(.x, size = shape(model_input_shape[1], model_input_shape[2]))) dataset <- dataset_batch(dataset, batch_size) dataset <- dataset_map(dataset, unname) } } # Einladen der Trainingsdaten files <- data.frame( img = list.files("Data/Subsets_448/Slices_Berlin", full.names = TRUE, pattern = "*.jpg"), mask = list.files("Data/Subsets_448/Slices_Berlin_Mask", full.names = TRUE, pattern = "*.jpg") ) files <- initial_split(files, prop = 0.8) training_dataset <- dl_prepare_data(training(files),train = TRUE,model_input_shape = c(448,448),batch_size = 10L) validation_dataset <- dl_prepare_data(testing(files),train = FALSE,model_input_shape = c(448,448),batch_size = 10L) training_tensors <- training_dataset%>%as_iterator()%>%iterate() # Training des Unets compile( pretrained_unet, optimizer = optimizer_rmsprop(lr = 1e-5), loss = "binary_crossentropy", metrics = c(metric_binary_accuracy) ) diagnostics <- fit(pretrained_unet, training_dataset, epochs = 15, validation_data = validation_dataset) plot(diagnostics) save_model_hdf5(pretrained_unet,filepath = "Unets/pretrained_unet_versuch4") pretrained_unet <- load_model_hdf5("Unets/pretrained_unet_versuch4") # Vergleich Maske/Satellitenbild/Vorhersage sample <- floor(runif(n = 1,min = 1,max = 10)) img_path <- as.character(testing(files)[[sample,1]]) mask_path <- as.character(testing(files)[[sample,2]]) img <- magick::image_read(img_path) mask <- magick::image_read(mask_path) pred <- magick::image_read(as.raster(predict(object = pretrained_unet,validation_dataset)[sample,,,])) out <- magick::image_append(c( magick::image_append(mask, stack = TRUE), magick::image_append(img, stack = TRUE), magick::image_append(pred, stack = TRUE) ) ) plot(out) # Einladen der Validierungsdaten test_dataset <- dl_prepare_data(train = F,predict = T,subsets_path="Data/Subsets_448/Slices_Muenster/",model_input_shape = c(448,448),batch_size = 5L) system.time(predictions <- predict(pretrained_unet,test_dataset)) plot_layer_activations <- function(img_path, model, activations_layers,channels){ model_input_size <- c(model$input_shape[[2]], model$input_shape[[3]]) img <- image_load(img_path, target_size = model_input_size) %>% image_to_array() %>% array_reshape(dim = c(1, model_input_size[1], model_input_size[2], 3)) %>% imagenet_preprocess_input() layer_outputs <- lapply(model$layers[activations_layers], function(layer) layer$output) activation_model <- keras_model(inputs = model$input, outputs = layer_outputs) activations <- predict(activation_model,img) if(!is.list(activations)){ activations <- list(activations) } plot_channel <- function(channel,layer_name,channel_name) { rotate <- function(x) t(apply(x, 2, rev)) image(rotate(channel), axes = FALSE, asp = 1, col = terrain.colors(12),main=paste("layer:",layer_name,"channel:",channel_name)) } for (i in 1:length(activations)) { layer_activation <- activations[[i]] layer_name <- model$layers[[activations_layers[i]]]$name n_features <- dim(layer_activation)[[4]] for (c in channels){ channel_image <- layer_activation[1,,,c] plot_channel(channel_image,layer_name,c) } } } par(mfrow=c(1,1)) plot(read_stars("Data/Subsets_448/Slices_Muenster/M_01.jpg"),rgb=c(1,2,3)) plot(read_stars("Data/Subsets_448/Slices_Muenster/M_02.jpg"),rgb=c(1,2,3)) plot(read_stars("Data/Subsets_448/Slices_Muenster/M_03.jpg"),rgb=c(1,2,3)) plot(read_stars("Data/Subsets_448/Slices_Muenster/M_04.jpg"),rgb=c(1,2,3)) plot(read_stars("Data/Subsets_448/Slices_Muenster/M_05.jpg"),rgb=c(1,2,3)) plot(read_stars("Data/Subsets_448/Slices_Muenster/M_06.jpg"),rgb=c(1,2,3)) par(mfrow=c(3,4),mar=c(1,1,1,1),cex=0.5) plot_layer_activations(img_path = "Data/Subsets_448/Slices_Muenster/M_01.jpg", model=pretrained_unet ,activations_layers = c(2,3,5,6,8,9,10,12,13,14), channels = 1:4)
/Detection_of_urban_areas.R
no_license
A-Spork/Cloud_Projekt
R
false
false
17,486
r
library(sp) library(keras) library(tensorflow) library(tfdatasets) library(purrr) library(ggplot2) library(rsample) library(stars) library(raster) library(reticulate) library(mapview) library(imager) library(raster) library(gdalUtils) library(stars) setwd("./") # ################image based############# first_model <- keras_model_sequential() layer_conv_2d(first_model,filters = 32,kernel_size = 3, activation = "relu",input_shape = c(128,128,3)) layer_max_pooling_2d(first_model, pool_size = c(2, 2)) layer_conv_2d(first_model, filters = 64, kernel_size = c(3, 3), activation = "relu") layer_max_pooling_2d(first_model, pool_size = c(2, 2)) layer_conv_2d(first_model, filters = 128, kernel_size = c(3, 3), activation = "relu") layer_max_pooling_2d(first_model, pool_size = c(2, 2)) layer_conv_2d(first_model, filters = 128, kernel_size = c(3, 3), activation = "relu") layer_max_pooling_2d(first_model, pool_size = c(2, 2)) layer_flatten(first_model) layer_dense(first_model, units = 256, activation = "relu") layer_dense(first_model, units = 1, activation = "sigmoid") # Einladen der Trainingsdaten subset_list <- list.files("Data/Subsets_128/Slices_Muenster/True", full.names = T) data_true <- data.frame(img=subset_list,lbl=rep(1L,length(subset_list))) subset_list <- list.files("Data/Subsets_128/Slices_Muenster/False", full.names = T) data_false <- data.frame(img=subset_list,lbl=rep(0L,length(subset_list))) data <- rbind(data_true,data_false) set.seed(2020) #Verarbeitung der Trainingsdaten data <- initial_split(data,prop = 0.75, strata = "lbl") c(nrow(training(data)[training(data)$lbl==0,]), nrow(training(data)[training(data)$lbl==1,])) training_dataset <- tensor_slices_dataset(training(data)) dataset_iterator <- as_iterator(training_dataset) dataset_list <- iterate(dataset_iterator) head(dataset_list) subset_size <- first_model$input_shape[2:3] training_dataset <- dataset_map(training_dataset, function(.x) list_modify(.x, img = tf$image$decode_jpeg(tf$io$read_file(.x$img)))) training_dataset <- dataset_map(training_dataset, function(.x) list_modify(.x, img = tf$image$convert_image_dtype(.x$img, dtype = tf$float32))) training_dataset <- dataset_map(training_dataset, function(.x) list_modify(.x, img = tf$image$resize(.x$img, size = shape(subset_size[1], subset_size[2])))) training_dataset <- dataset_shuffle(training_dataset, buffer_size = 10L*128) training_dataset <- dataset_batch(training_dataset, 10L) training_dataset <- dataset_map(training_dataset, unname) dataset_iterator <- as_iterator(training_dataset) dataset_list <- iterate(dataset_iterator) dataset_list[[1]][[1]] dataset_list[[1]][[1]]$shape dataset_list[[1]][[2]] validation_dataset <- tensor_slices_dataset(testing(data)) validation_dataset <- dataset_map(validation_dataset, function(.x) list_modify(.x, img = tf$image$decode_jpeg(tf$io$read_file(.x$img)))) validation_dataset <- dataset_map(validation_dataset, function(.x) list_modify(.x, img = tf$image$convert_image_dtype(.x$img, dtype = tf$float32))) validation_dataset <- dataset_map(validation_dataset, function(.x) list_modify(.x, img = tf$image$resize(.x$img, size = shape(subset_size[1], subset_size[2])))) validation_dataset <- dataset_batch(validation_dataset, 10L) validation_dataset <- dataset_map(validation_dataset, unname) # Trainieren des Modells compile( first_model, optimizer = optimizer_rmsprop(lr = 5e-5), loss = "binary_crossentropy", metrics = "accuracy" ) diagnostics <- fit(first_model, training_dataset, epochs = 18, validation_data = validation_dataset) plot(diagnostics) # Vorhersage predictions <- predict(first_model,validation_dataset) par(mfrow=c(1,3),mai=c(0.1,0.1,0.3,0.1),cex=0.8) for(i in 1:3){ sample <- floor(runif(n = 1,min = 1,max = 56)) img_path <- as.character(testing(data)[[sample,1]]) img <- stack(img_path) plotRGB(img,margins=T,main = paste("prediction:",round(predictions[sample],digits=3)," | ","label:",as.character(testing(data)[[sample,2]]))) } # Einladen der Validierungsdaten subset_list <- list.files("Data/Subsets_128/Slices_Berlin/True", full.names = T) dataset <- tensor_slices_dataset(subset_list) dataset <- dataset_map(dataset, function(.x) tf$image$decode_jpeg(tf$io$read_file(.x))) dataset <- dataset_map(dataset, function(.x) tf$image$convert_image_dtype(.x, dtype = tf$float32)) dataset <- dataset_map(dataset, function(.x) tf$image$resize(.x, size = shape(128, 128))) dataset <- dataset_batch(dataset, 10L) dataset <- dataset_map(dataset, unname) #Vorhersage auf den Validierungsdaten predictions <- predict(first_model, dataset) save_model_hdf5(first_model,filepath = "Data/Models/imagebased_model2.h5") # Validierung vgg16_feat_extr <- application_vgg16(include_top = F,input_shape = c(128,128,3),weights = "imagenet") freeze_weights(vgg16_feat_extr) pretrained_model <- keras_model_sequential(vgg16_feat_extr$layers[1:15]) pretrained_model <- layer_flatten(pretrained_model) pretrained_model <- layer_dense(pretrained_model,units = 256,activation = "relu") pretrained_model <- layer_dense(pretrained_model,units = 1,activation = "sigmoid") compile( pretrained_model, optimizer = optimizer_rmsprop(lr = 1e-5), loss = "binary_crossentropy", metrics = c("accuracy") ) diagnostics <- fit(pretrained_model, training_dataset, epochs = 8, validation_data = validation_dataset) plot(diagnostics) diagnostics$metrics #UNET######################################################## input_tensor <- layer_input(shape = c(448,448,3)) unet_tensor <- layer_conv_2d(input_tensor,filters = 64,kernel_size = c(3,3), padding = "same",activation = "relu") conc_tensor2 <- layer_conv_2d(unet_tensor,filters = 64,kernel_size = c(3,3), padding = "same",activation = "relu") unet_tensor <- layer_max_pooling_2d(conc_tensor2) unet_tensor <- layer_conv_2d(unet_tensor,filters = 128,kernel_size = c(3,3), padding = "same",activation = "relu") conc_tensor1 <- layer_conv_2d(unet_tensor,filters = 128,kernel_size = c(3,3), padding = "same",activation = "relu") unet_tensor <- layer_max_pooling_2d(conc_tensor1) unet_tensor <- layer_conv_2d(unet_tensor,filters = 256,kernel_size = c(3,3), padding = "same",activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor,filters = 256,kernel_size = c(3,3), padding = "same",activation = "relu") unet_tensor <- layer_conv_2d_transpose(unet_tensor,filters = 128,kernel_size = c(2,2),strides = 2,padding = "same") unet_tensor <- layer_concatenate(list(conc_tensor1,unet_tensor)) unet_tensor <- layer_conv_2d(unet_tensor, filters = 128, kernel_size = c(3,3),padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor, filters = 128, kernel_size = c(3,3),padding = "same", activation = "relu") unet_tensor <- layer_conv_2d_transpose(unet_tensor,filters = 64,kernel_size = c(2,2),strides = 2,padding = "same") unet_tensor <- layer_concatenate(list(conc_tensor2,unet_tensor)) unet_tensor <- layer_conv_2d(unet_tensor, filters = 64, kernel_size = c(3,3),padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor, filters = 64, kernel_size = c(3,3),padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor,filters = 1,kernel_size = 1, activation = "sigmoid") unet_model <- keras_model(inputs = input_tensor, outputs = unet_tensor) vgg16_feat_extr <- application_vgg16(weights = "imagenet", include_top = FALSE, input_shape = c (448,448,3)) unet_tensor <- vgg16_feat_extr$layers[[15]]$output unet_tensor <- layer_conv_2d(unet_tensor, filters = 1024, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor, filters = 1024, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d_transpose(unet_tensor, filters = 512, kernel_size = 2, strides = 2, padding = "same") unet_tensor <- layer_concatenate(list(vgg16_feat_extr$layers[[14]]$output, unet_tensor)) unet_tensor <- layer_conv_2d(unet_tensor, filters = 512, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor, filters = 512, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d_transpose(unet_tensor, filters = 256, kernel_size = 2, strides = 2, padding = "same") unet_tensor <- layer_concatenate(list(vgg16_feat_extr$layers[[10]]$output, unet_tensor)) unet_tensor <- layer_conv_2d(unet_tensor,filters = 256, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor,filters = 256, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d_transpose(unet_tensor, filters = 128, kernel_size = 2, strides = 2, padding = "same") unet_tensor <- layer_concatenate(list(vgg16_feat_extr$layers[[6]]$output, unet_tensor)) unet_tensor <- layer_conv_2d(unet_tensor, filters = 128, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor, filters = 128, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d_transpose(unet_tensor, filters = 64, kernel_size = 2, strides = 2, padding = "same") unet_tensor <- layer_concatenate(list(vgg16_feat_extr$layers[[3]]$output, unet_tensor)) unet_tensor <- layer_conv_2d(unet_tensor, filters = 64, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor, filters = 64, kernel_size = 3, padding = "same", activation = "relu") unet_tensor <- layer_conv_2d(unet_tensor, filters = 1, kernel_size = 1, activation = "sigmoid") pretrained_unet <- keras_model(inputs = vgg16_feat_extr$input, outputs = unet_tensor) spectral_augmentation <- function(img) { img <- tf$image$random_brightness(img, max_delta = 0.3) img <- tf$image$random_contrast(img, lower = 0.8, upper = 1.2) img <- tf$image$random_saturation(img, lower = 0.8, upper = 1.2) img <- tf$clip_by_value(img,0, 1) } dl_prepare_data <- function(files=NULL, train, predict=FALSE, subsets_path=NULL, model_input_shape = c(448,448), batch_size = 10L) { if (!predict){ spectral_augmentation <- function(img) { img <- tf$image$random_brightness(img, max_delta = 0.3) img <- tf$image$random_contrast(img, lower = 0.8, upper = 1.1) img <- tf$image$random_saturation(img, lower = 0.8, upper = 1.1) img <- tf$clip_by_value(img, 0, 1) } dataset <- tensor_slices_dataset(files) dataset <- dataset_map(dataset, function(.x) list_modify(.x,img = tf$image$decode_jpeg(tf$io$read_file(.x$img)), mask = tf$image$decode_jpeg(tf$io$read_file(.x$mask)))) dataset <- dataset_map(dataset, function(.x) list_modify(.x, img = tf$image$convert_image_dtype(.x$img, dtype = tf$float32), mask = tf$image$convert_image_dtype(.x$mask, dtype = tf$float32))) dataset <- dataset_map(dataset, function(.x) list_modify(.x, img = tf$image$resize(.x$img, size = shape(model_input_shape[1], model_input_shape[2])), mask = tf$image$resize(.x$mask, size = shape(model_input_shape[1], model_input_shape[2])))) if (train) { augmentation <- dataset_map(dataset, function(.x) list_modify(.x, img = spectral_augmentation(.x$img))) augmentation <- dataset_map(augmentation, function(.x) list_modify(.x, img = tf$image$flip_left_right(.x$img), mask = tf$image$flip_left_right(.x$mask))) dataset_augmented <- dataset_concatenate(dataset,augmentation) augmentation <- dataset_map(dataset, function(.x) list_modify(.x, img = spectral_augmentation(.x$img))) augmentation <- dataset_map(augmentation, function(.x) list_modify(.x, img = tf$image$flip_up_down(.x$img), mask = tf$image$flip_up_down(.x$mask))) dataset_augmented <- dataset_concatenate(dataset_augmented,augmentation) augmentation <- dataset_map(dataset, function(.x) list_modify(.x, img = spectral_augmentation(.x$img))) augmentation <- dataset_map(augmentation, function(.x) list_modify(.x, img = tf$image$flip_left_right(.x$img), mask = tf$image$flip_left_right(.x$mask))) augmentation <- dataset_map(augmentation, function(.x) list_modify(.x, img = tf$image$flip_up_down(.x$img), mask = tf$image$flip_up_down(.x$mask))) dataset_augmented <- dataset_concatenate(dataset_augmented,augmentation) } if (train) { dataset <- dataset_shuffle(dataset_augmented, buffer_size = batch_size*128) } dataset <- dataset_batch(dataset, batch_size) dataset <- dataset_map(dataset, unname) }else{ o <- order(as.numeric(tools::file_path_sans_ext(basename(list.files(subsets_path))))) subset_list <- list.files(subsets_path, full.names = T)[o] dataset <- tensor_slices_dataset(subset_list) dataset <- dataset_map(dataset, function(.x) tf$image$decode_jpeg(tf$io$read_file(.x))) dataset <- dataset_map(dataset, function(.x) tf$image$convert_image_dtype(.x, dtype = tf$float32)) dataset <- dataset_map(dataset, function(.x) tf$image$resize(.x, size = shape(model_input_shape[1], model_input_shape[2]))) dataset <- dataset_batch(dataset, batch_size) dataset <- dataset_map(dataset, unname) } } # Einladen der Trainingsdaten files <- data.frame( img = list.files("Data/Subsets_448/Slices_Berlin", full.names = TRUE, pattern = "*.jpg"), mask = list.files("Data/Subsets_448/Slices_Berlin_Mask", full.names = TRUE, pattern = "*.jpg") ) files <- initial_split(files, prop = 0.8) training_dataset <- dl_prepare_data(training(files),train = TRUE,model_input_shape = c(448,448),batch_size = 10L) validation_dataset <- dl_prepare_data(testing(files),train = FALSE,model_input_shape = c(448,448),batch_size = 10L) training_tensors <- training_dataset%>%as_iterator()%>%iterate() # Training des Unets compile( pretrained_unet, optimizer = optimizer_rmsprop(lr = 1e-5), loss = "binary_crossentropy", metrics = c(metric_binary_accuracy) ) diagnostics <- fit(pretrained_unet, training_dataset, epochs = 15, validation_data = validation_dataset) plot(diagnostics) save_model_hdf5(pretrained_unet,filepath = "Unets/pretrained_unet_versuch4") pretrained_unet <- load_model_hdf5("Unets/pretrained_unet_versuch4") # Vergleich Maske/Satellitenbild/Vorhersage sample <- floor(runif(n = 1,min = 1,max = 10)) img_path <- as.character(testing(files)[[sample,1]]) mask_path <- as.character(testing(files)[[sample,2]]) img <- magick::image_read(img_path) mask <- magick::image_read(mask_path) pred <- magick::image_read(as.raster(predict(object = pretrained_unet,validation_dataset)[sample,,,])) out <- magick::image_append(c( magick::image_append(mask, stack = TRUE), magick::image_append(img, stack = TRUE), magick::image_append(pred, stack = TRUE) ) ) plot(out) # Einladen der Validierungsdaten test_dataset <- dl_prepare_data(train = F,predict = T,subsets_path="Data/Subsets_448/Slices_Muenster/",model_input_shape = c(448,448),batch_size = 5L) system.time(predictions <- predict(pretrained_unet,test_dataset)) plot_layer_activations <- function(img_path, model, activations_layers,channels){ model_input_size <- c(model$input_shape[[2]], model$input_shape[[3]]) img <- image_load(img_path, target_size = model_input_size) %>% image_to_array() %>% array_reshape(dim = c(1, model_input_size[1], model_input_size[2], 3)) %>% imagenet_preprocess_input() layer_outputs <- lapply(model$layers[activations_layers], function(layer) layer$output) activation_model <- keras_model(inputs = model$input, outputs = layer_outputs) activations <- predict(activation_model,img) if(!is.list(activations)){ activations <- list(activations) } plot_channel <- function(channel,layer_name,channel_name) { rotate <- function(x) t(apply(x, 2, rev)) image(rotate(channel), axes = FALSE, asp = 1, col = terrain.colors(12),main=paste("layer:",layer_name,"channel:",channel_name)) } for (i in 1:length(activations)) { layer_activation <- activations[[i]] layer_name <- model$layers[[activations_layers[i]]]$name n_features <- dim(layer_activation)[[4]] for (c in channels){ channel_image <- layer_activation[1,,,c] plot_channel(channel_image,layer_name,c) } } } par(mfrow=c(1,1)) plot(read_stars("Data/Subsets_448/Slices_Muenster/M_01.jpg"),rgb=c(1,2,3)) plot(read_stars("Data/Subsets_448/Slices_Muenster/M_02.jpg"),rgb=c(1,2,3)) plot(read_stars("Data/Subsets_448/Slices_Muenster/M_03.jpg"),rgb=c(1,2,3)) plot(read_stars("Data/Subsets_448/Slices_Muenster/M_04.jpg"),rgb=c(1,2,3)) plot(read_stars("Data/Subsets_448/Slices_Muenster/M_05.jpg"),rgb=c(1,2,3)) plot(read_stars("Data/Subsets_448/Slices_Muenster/M_06.jpg"),rgb=c(1,2,3)) par(mfrow=c(3,4),mar=c(1,1,1,1),cex=0.5) plot_layer_activations(img_path = "Data/Subsets_448/Slices_Muenster/M_01.jpg", model=pretrained_unet ,activations_layers = c(2,3,5,6,8,9,10,12,13,14), channels = 1:4)
## checking the working directory if (!getwd() == "C:/Users/gauta/Documents/R/data") setwd("C:/Users/gauta/Documents/R/data") getwd() ## reading data - replacing nulls DT <- read.table("household_power_consumption.txt", header = TRUE, sep = ';', na.strings = "?") ## formatting date value to date and subsetting data DT$Date <- as.Date(DT$Date, format="%d/%m/%Y") DT <- subset(DT, DT$Date >="2007-02-01" & DT$Date <="2007-02-01") ## openning the output grpahics file png (file = "plot1.png", height=480, width=480, bg = "white" ) ## histogram of global active power hist(DT$Global_active_power, col = "red", xlab = "Global Active Power (Kilowats)", ylab = "Frequency", main = "Global Active Power") ##closing the graph output dev.off()
/plot1.R
no_license
GautamVarma/ExData_Plotting1
R
false
false
798
r
## checking the working directory if (!getwd() == "C:/Users/gauta/Documents/R/data") setwd("C:/Users/gauta/Documents/R/data") getwd() ## reading data - replacing nulls DT <- read.table("household_power_consumption.txt", header = TRUE, sep = ';', na.strings = "?") ## formatting date value to date and subsetting data DT$Date <- as.Date(DT$Date, format="%d/%m/%Y") DT <- subset(DT, DT$Date >="2007-02-01" & DT$Date <="2007-02-01") ## openning the output grpahics file png (file = "plot1.png", height=480, width=480, bg = "white" ) ## histogram of global active power hist(DT$Global_active_power, col = "red", xlab = "Global Active Power (Kilowats)", ylab = "Frequency", main = "Global Active Power") ##closing the graph output dev.off()
\name{modify_lang} \alias{modify_lang} \title{Recursively modify a language object} \usage{ modify_lang(x, f, ...) } \arguments{ \item{x}{object to modify: should be a call, expression, function or list of the above.} \item{f}{function to apply to leaves} \item{...}{other arguments passed to \code{f}} } \description{ Recursively modify a language object } \examples{ a_to_b <- function(x) { if (is.name(x) && identical(x, quote(a))) return(quote(b)) x } examples <- list( quote(a <- 5), alist(a = 1, c = a), function(a = 1) a * 10, expression(a <- 1, a, f(a), f(a = a)) ) modify_lang(examples, a_to_b) # Modifies all objects called a, but doesn't modify arguments named a }
/man/modify_lang.Rd
no_license
Lingbing/pryr
R
false
false
703
rd
\name{modify_lang} \alias{modify_lang} \title{Recursively modify a language object} \usage{ modify_lang(x, f, ...) } \arguments{ \item{x}{object to modify: should be a call, expression, function or list of the above.} \item{f}{function to apply to leaves} \item{...}{other arguments passed to \code{f}} } \description{ Recursively modify a language object } \examples{ a_to_b <- function(x) { if (is.name(x) && identical(x, quote(a))) return(quote(b)) x } examples <- list( quote(a <- 5), alist(a = 1, c = a), function(a = 1) a * 10, expression(a <- 1, a, f(a), f(a = a)) ) modify_lang(examples, a_to_b) # Modifies all objects called a, but doesn't modify arguments named a }
#' Adjust for batch effects using an empirical Bayes framework #' #' ComBat allows users to adjust for batch effects in datasets where the batch covariate is known, using methodology #' described in Johnson et al. 2007. It uses either parametric or non-parametric empirical Bayes frameworks for adjusting data for #' batch effects. Users are returned an expression matrix that has been corrected for batch effects. The input #' data are assumed to be cleaned and normalized before batch effect removal. #' #' @param dat Genomic measure matrix (dimensions probe x sample) - for example, expression matrix #' @param batch {Batch covariate (only one batch allowed)} #' @param mod Model matrix for outcome of interest and other covariates besides batch #' @param par.prior (Optional) TRUE indicates parametric adjustments will be used, FALSE indicates non-parametric adjustments will be used #' @param prior.plots (Optional) TRUE give prior plots with black as a kernel estimate of the empirical batch effect density and red as the parametric #' @param mean.only (Optional) FALSE If TRUE ComBat only corrects the mean of the batch effect (no scale adjustment) #' @param ref.batch (Optional) NULL If given, will use the selected batch as a reference for batch adjustment. #' @param BPPARAM (Optional) BiocParallelParam for parallel operation #' #' @return data A probe x sample genomic measure matrix, adjusted for batch effects. #' #' @examples #' library(bladderbatch) #' data(bladderdata) #' dat <- bladderEset[1:50,] #' #' pheno = pData(dat) #' edata = exprs(dat) #' batch = pheno$batch #' mod = model.matrix(~as.factor(cancer), data=pheno) #' #' # parametric adjustment #' combat_edata1 = ComBat(dat=edata, batch=batch, mod=NULL, par.prior=TRUE, prior.plots=FALSE) #' #' # non-parametric adjustment, mean-only version #' combat_edata2 = ComBat(dat=edata, batch=batch, mod=NULL, par.prior=FALSE, mean.only=TRUE) #' #' # reference-batch version, with covariates #' combat_edata3 = ComBat(dat=edata, batch=batch, mod=mod, par.prior=TRUE, ref.batch=3) #' #' @export #' ComBat <- function (dat, batch, mod = NULL, par.prior = TRUE, prior.plots = FALSE, mean.only = FALSE, ref.batch = NULL, BPPARAM = bpparam()) { # make batch a factor and make a set of indicators for batch if(mean.only==TRUE){message("Using the 'mean only' version of ComBat.")} if(length(dim(batch))>1){stop("This version of ComBat only allows one batch variable")} ## to be updated soon! batch <- as.factor(batch) batchmod <- model.matrix(~-1+batch) if (!is.null(ref.batch)){ # check for reference batch, check value, and make appropriate changes if (!(ref.batch%in%levels(batch))){stop("reference level ref.batch is not one of the levels of the batch variable")} message(paste0("Using batch =", ref.batch, "as a reference batch (this batch won't change).")) ref = which(levels(as.factor(batch))==ref.batch) # find the reference batchmod[,ref]=1 }else{ref=NULL} message(paste0("Found", nlevels(batch), "batches.")) # A few other characteristics on the batches n.batch <- nlevels(batch) batches <- list() for (i in 1:n.batch){batches[[i]] <- which(batch == levels(batch)[i])} # list of samples in each batch n.batches <- sapply(batches, length) if(any(n.batches==1)){mean.only=TRUE; message("Note: one batch has only one sample, setting mean.only=TRUE.")} n.array <- sum(n.batches) #combine batch variable and covariates design <- cbind(batchmod,mod) # check for intercept in covariates, and drop if present check <- apply(design, 2, function(x) all(x == 1)) if(!is.null(ref)){check[ref]=FALSE} ## except don't throw away the reference batch indicator design <- as.matrix(design[,!check]) # Number of covariates or covariate levels message(paste0("Adjusting for", ncol(design)-ncol(batchmod), "covariate(s) or covariate level(s).") # Check if the design is confounded if(qr(design)$rank<ncol(design)){ #if(ncol(design)<=(n.batch)){stop("Batch variables are redundant! Remove one or more of the batch variables so they are no longer confounded")} if(ncol(design)==(n.batch+1)){stop("The covariate is confounded with batch! Remove the covariate and rerun ComBat")} if(ncol(design)>(n.batch+1)){ if((qr(design[,-c(1:n.batch)])$rank<ncol(design[,-c(1:n.batch)]))){stop('The covariates are confounded! Please remove one or more of the covariates so the design is not confounded') }else{stop("At least one covariate is confounded with batch! Please remove confounded covariates and rerun ComBat")}} } ## Check for missing values NAs = any(is.na(dat)) if(NAs){message(paste0("Found ", sum(is.na(dat)), " Missing Data Values."))} #print(dat[1:2,]) ##Standardize Data across genes message("Standardizing Data across genes.") if (!NAs){ B.hat <- solve(t(design)%*%design)%*%t(design)%*%t(as.matrix(dat)) }else{ B.hat=apply(dat,1,Beta.NA,design) } ######## change grand.mean for ref batch if(!is.null(ref.batch)){ grand.mean <- t(B.hat[ref, ]) }else{ grand.mean <- t(n.batches/n.array)%*%B.hat[1:n.batch,] } ######## change var.pooled for ref batch if (!NAs){ if(!is.null(ref.batch)){ ref.dat <- dat[, batches[[ref]]] var.pooled <- ((ref.dat-t(design[batches[[ref]], ]%*%B.hat))^2)%*%rep(1/n.batches[ref],n.batches[ref]) }else{ var.pooled <- ((dat-t(design%*%B.hat))^2)%*%rep(1/n.array,n.array) } }else{ if(!is.null(ref.batch)){ ref.dat <- dat[, batches[[ref]]] var.pooled <- apply(ref.dat-t(design[batches[[ref]], ]%*%B.hat),1,var,na.rm=TRUE) }else{ var.pooled <- apply(dat-t(design%*%B.hat),1,var,na.rm=TRUE) } } stand.mean <- t(grand.mean)%*%t(rep(1,n.array)) if(!is.null(design)){tmp <- design;tmp[,c(1:n.batch)] <- 0;stand.mean <- stand.mean+t(tmp%*%B.hat)} s.data <- (dat-stand.mean)/(sqrt(var.pooled)%*%t(rep(1,n.array))) ##Get regression batch effect parameters message("Fitting L/S model and finding priors.") batch.design <- design[,1:n.batch] if (!NAs){ gamma.hat <- solve(t(batch.design)%*%batch.design)%*%t(batch.design)%*%t(as.matrix(s.data)) } else{ gamma.hat=apply(s.data,1,Beta.NA,batch.design) } delta.hat <- NULL for (i in batches){ if(mean.only==TRUE){delta.hat <- rbind(delta.hat,rep(1,nrow(s.data)))}else{ delta.hat <- rbind(delta.hat,apply(s.data[,i], 1, var,na.rm=TRUE)) } } ##Find Priors gamma.bar <- apply(gamma.hat, 1, mean) t2 <- apply(gamma.hat, 1, var) a.prior <- apply(delta.hat, 1, aprior) b.prior <- apply(delta.hat, 1, bprior) ##Plot empirical and parametric priors if (prior.plots & par.prior){ par(mfrow=c(2,2)) tmp <- density(gamma.hat[1,]) plot(tmp, type='l', main="Density Plot") xx <- seq(min(tmp$x), max(tmp$x), length=100) lines(xx,dnorm(xx,gamma.bar[1],sqrt(t2[1])), col=2) qqnorm(gamma.hat[1,]) qqline(gamma.hat[1,], col=2) tmp <- density(delta.hat[1,]) xx <- seq(min(tmp$x), max(tmp$x), length=100) tmp1 <- list(x=xx, y=dgamma(xx, a.prior[1], b.prior[1])) plot(tmp, typ="l", main="Density Plot", ylim=c(0, max(tmp$y, tmp1$y))) lines(tmp1, col=2) invgam <- 1/qgamma(ppoints(ncol(delta.hat)), a.prior[1], b.prior[1]) qqplot(delta.hat[1,], invgam, xlab="Sample Quantiles", ylab="Theoretical Quantiles") lines(c(0, max(invgam)), c(0, max(invgam)), col=2) title("Q-Q Plot") } ##Find EB batch adjustments gamma.star <- delta.star <- matrix(NA, nrow=n.batch, ncol=nrow(s.data)) if (par.prior) { message("Finding parametric adjustments.") results <- bplapply(1:n.batch, function(i) { if (mean.only) { gamma.star <- postmean(gamma.hat[i,], gamma.bar[i], 1, 1, t2[i]) delta.star <- rep(1, nrow(s.data)) } else { temp <- it.sol(s.data[, batches[[i]]], gamma.hat[i, ], delta.hat[i, ], gamma.bar[i], t2[i], a.prior[i], b.prior[i]) gamma.star <- temp[1, ] delta.star <- temp[2, ] } list(gamma.star=gamma.star, delta.star=delta.star) }, BPPARAM = BPPARAM) for (i in 1:n.batch) { gamma.star[i,] <- results[[i]]$gamma.star delta.star[i,] <- results[[i]]$delta.star } } else { message("Finding nonparametric adjustments.") results <- bplapply(1:n.batch, function(i) { if (mean.only) { delta.hat[i, ] = 1 } temp <- int.eprior(as.matrix(s.data[, batches[[i]]]), gamma.hat[i, ], delta.hat[i, ]) list(gamma.star=temp[1,], delta.star=temp[2,]) }, BPPARAM = BPPARAM) for (i in 1:n.batch) { gamma.star[i,] <- results[[i]]$gamma.star delta.star[i,] <- results[[i]]$delta.star } } if(!is.null(ref.batch)){ gamma.star[ref,]=0 ## set reference batch mean equal to 0 delta.star[ref,]=1 ## set reference batch variance equal to 1 } ### Normalize the Data ### message("Adjusting the Data.") bayesdata <- s.data j <- 1 for (i in batches){ bayesdata[,i] <- (bayesdata[,i]-t(batch.design[i,]%*%gamma.star))/(sqrt(delta.star[j,])%*%t(rep(1,n.batches[j]))) j <- j+1 } bayesdata <- (bayesdata*(sqrt(var.pooled)%*%t(rep(1,n.array))))+stand.mean ##### tiny change still exist when tested on bladder data #### total sum of change within each batch around 1e-15 ##### (could be computational system error). ##### Do not change ref batch at all in reference version if(!is.null(ref.batch)){ bayesdata[, batches[[ref]]] <- dat[, batches[[ref]]] } return(bayesdata) }
/R/ComBat.R
no_license
abelew/sva-devel
R
false
false
9,635
r
#' Adjust for batch effects using an empirical Bayes framework #' #' ComBat allows users to adjust for batch effects in datasets where the batch covariate is known, using methodology #' described in Johnson et al. 2007. It uses either parametric or non-parametric empirical Bayes frameworks for adjusting data for #' batch effects. Users are returned an expression matrix that has been corrected for batch effects. The input #' data are assumed to be cleaned and normalized before batch effect removal. #' #' @param dat Genomic measure matrix (dimensions probe x sample) - for example, expression matrix #' @param batch {Batch covariate (only one batch allowed)} #' @param mod Model matrix for outcome of interest and other covariates besides batch #' @param par.prior (Optional) TRUE indicates parametric adjustments will be used, FALSE indicates non-parametric adjustments will be used #' @param prior.plots (Optional) TRUE give prior plots with black as a kernel estimate of the empirical batch effect density and red as the parametric #' @param mean.only (Optional) FALSE If TRUE ComBat only corrects the mean of the batch effect (no scale adjustment) #' @param ref.batch (Optional) NULL If given, will use the selected batch as a reference for batch adjustment. #' @param BPPARAM (Optional) BiocParallelParam for parallel operation #' #' @return data A probe x sample genomic measure matrix, adjusted for batch effects. #' #' @examples #' library(bladderbatch) #' data(bladderdata) #' dat <- bladderEset[1:50,] #' #' pheno = pData(dat) #' edata = exprs(dat) #' batch = pheno$batch #' mod = model.matrix(~as.factor(cancer), data=pheno) #' #' # parametric adjustment #' combat_edata1 = ComBat(dat=edata, batch=batch, mod=NULL, par.prior=TRUE, prior.plots=FALSE) #' #' # non-parametric adjustment, mean-only version #' combat_edata2 = ComBat(dat=edata, batch=batch, mod=NULL, par.prior=FALSE, mean.only=TRUE) #' #' # reference-batch version, with covariates #' combat_edata3 = ComBat(dat=edata, batch=batch, mod=mod, par.prior=TRUE, ref.batch=3) #' #' @export #' ComBat <- function (dat, batch, mod = NULL, par.prior = TRUE, prior.plots = FALSE, mean.only = FALSE, ref.batch = NULL, BPPARAM = bpparam()) { # make batch a factor and make a set of indicators for batch if(mean.only==TRUE){message("Using the 'mean only' version of ComBat.")} if(length(dim(batch))>1){stop("This version of ComBat only allows one batch variable")} ## to be updated soon! batch <- as.factor(batch) batchmod <- model.matrix(~-1+batch) if (!is.null(ref.batch)){ # check for reference batch, check value, and make appropriate changes if (!(ref.batch%in%levels(batch))){stop("reference level ref.batch is not one of the levels of the batch variable")} message(paste0("Using batch =", ref.batch, "as a reference batch (this batch won't change).")) ref = which(levels(as.factor(batch))==ref.batch) # find the reference batchmod[,ref]=1 }else{ref=NULL} message(paste0("Found", nlevels(batch), "batches.")) # A few other characteristics on the batches n.batch <- nlevels(batch) batches <- list() for (i in 1:n.batch){batches[[i]] <- which(batch == levels(batch)[i])} # list of samples in each batch n.batches <- sapply(batches, length) if(any(n.batches==1)){mean.only=TRUE; message("Note: one batch has only one sample, setting mean.only=TRUE.")} n.array <- sum(n.batches) #combine batch variable and covariates design <- cbind(batchmod,mod) # check for intercept in covariates, and drop if present check <- apply(design, 2, function(x) all(x == 1)) if(!is.null(ref)){check[ref]=FALSE} ## except don't throw away the reference batch indicator design <- as.matrix(design[,!check]) # Number of covariates or covariate levels message(paste0("Adjusting for", ncol(design)-ncol(batchmod), "covariate(s) or covariate level(s).") # Check if the design is confounded if(qr(design)$rank<ncol(design)){ #if(ncol(design)<=(n.batch)){stop("Batch variables are redundant! Remove one or more of the batch variables so they are no longer confounded")} if(ncol(design)==(n.batch+1)){stop("The covariate is confounded with batch! Remove the covariate and rerun ComBat")} if(ncol(design)>(n.batch+1)){ if((qr(design[,-c(1:n.batch)])$rank<ncol(design[,-c(1:n.batch)]))){stop('The covariates are confounded! Please remove one or more of the covariates so the design is not confounded') }else{stop("At least one covariate is confounded with batch! Please remove confounded covariates and rerun ComBat")}} } ## Check for missing values NAs = any(is.na(dat)) if(NAs){message(paste0("Found ", sum(is.na(dat)), " Missing Data Values."))} #print(dat[1:2,]) ##Standardize Data across genes message("Standardizing Data across genes.") if (!NAs){ B.hat <- solve(t(design)%*%design)%*%t(design)%*%t(as.matrix(dat)) }else{ B.hat=apply(dat,1,Beta.NA,design) } ######## change grand.mean for ref batch if(!is.null(ref.batch)){ grand.mean <- t(B.hat[ref, ]) }else{ grand.mean <- t(n.batches/n.array)%*%B.hat[1:n.batch,] } ######## change var.pooled for ref batch if (!NAs){ if(!is.null(ref.batch)){ ref.dat <- dat[, batches[[ref]]] var.pooled <- ((ref.dat-t(design[batches[[ref]], ]%*%B.hat))^2)%*%rep(1/n.batches[ref],n.batches[ref]) }else{ var.pooled <- ((dat-t(design%*%B.hat))^2)%*%rep(1/n.array,n.array) } }else{ if(!is.null(ref.batch)){ ref.dat <- dat[, batches[[ref]]] var.pooled <- apply(ref.dat-t(design[batches[[ref]], ]%*%B.hat),1,var,na.rm=TRUE) }else{ var.pooled <- apply(dat-t(design%*%B.hat),1,var,na.rm=TRUE) } } stand.mean <- t(grand.mean)%*%t(rep(1,n.array)) if(!is.null(design)){tmp <- design;tmp[,c(1:n.batch)] <- 0;stand.mean <- stand.mean+t(tmp%*%B.hat)} s.data <- (dat-stand.mean)/(sqrt(var.pooled)%*%t(rep(1,n.array))) ##Get regression batch effect parameters message("Fitting L/S model and finding priors.") batch.design <- design[,1:n.batch] if (!NAs){ gamma.hat <- solve(t(batch.design)%*%batch.design)%*%t(batch.design)%*%t(as.matrix(s.data)) } else{ gamma.hat=apply(s.data,1,Beta.NA,batch.design) } delta.hat <- NULL for (i in batches){ if(mean.only==TRUE){delta.hat <- rbind(delta.hat,rep(1,nrow(s.data)))}else{ delta.hat <- rbind(delta.hat,apply(s.data[,i], 1, var,na.rm=TRUE)) } } ##Find Priors gamma.bar <- apply(gamma.hat, 1, mean) t2 <- apply(gamma.hat, 1, var) a.prior <- apply(delta.hat, 1, aprior) b.prior <- apply(delta.hat, 1, bprior) ##Plot empirical and parametric priors if (prior.plots & par.prior){ par(mfrow=c(2,2)) tmp <- density(gamma.hat[1,]) plot(tmp, type='l', main="Density Plot") xx <- seq(min(tmp$x), max(tmp$x), length=100) lines(xx,dnorm(xx,gamma.bar[1],sqrt(t2[1])), col=2) qqnorm(gamma.hat[1,]) qqline(gamma.hat[1,], col=2) tmp <- density(delta.hat[1,]) xx <- seq(min(tmp$x), max(tmp$x), length=100) tmp1 <- list(x=xx, y=dgamma(xx, a.prior[1], b.prior[1])) plot(tmp, typ="l", main="Density Plot", ylim=c(0, max(tmp$y, tmp1$y))) lines(tmp1, col=2) invgam <- 1/qgamma(ppoints(ncol(delta.hat)), a.prior[1], b.prior[1]) qqplot(delta.hat[1,], invgam, xlab="Sample Quantiles", ylab="Theoretical Quantiles") lines(c(0, max(invgam)), c(0, max(invgam)), col=2) title("Q-Q Plot") } ##Find EB batch adjustments gamma.star <- delta.star <- matrix(NA, nrow=n.batch, ncol=nrow(s.data)) if (par.prior) { message("Finding parametric adjustments.") results <- bplapply(1:n.batch, function(i) { if (mean.only) { gamma.star <- postmean(gamma.hat[i,], gamma.bar[i], 1, 1, t2[i]) delta.star <- rep(1, nrow(s.data)) } else { temp <- it.sol(s.data[, batches[[i]]], gamma.hat[i, ], delta.hat[i, ], gamma.bar[i], t2[i], a.prior[i], b.prior[i]) gamma.star <- temp[1, ] delta.star <- temp[2, ] } list(gamma.star=gamma.star, delta.star=delta.star) }, BPPARAM = BPPARAM) for (i in 1:n.batch) { gamma.star[i,] <- results[[i]]$gamma.star delta.star[i,] <- results[[i]]$delta.star } } else { message("Finding nonparametric adjustments.") results <- bplapply(1:n.batch, function(i) { if (mean.only) { delta.hat[i, ] = 1 } temp <- int.eprior(as.matrix(s.data[, batches[[i]]]), gamma.hat[i, ], delta.hat[i, ]) list(gamma.star=temp[1,], delta.star=temp[2,]) }, BPPARAM = BPPARAM) for (i in 1:n.batch) { gamma.star[i,] <- results[[i]]$gamma.star delta.star[i,] <- results[[i]]$delta.star } } if(!is.null(ref.batch)){ gamma.star[ref,]=0 ## set reference batch mean equal to 0 delta.star[ref,]=1 ## set reference batch variance equal to 1 } ### Normalize the Data ### message("Adjusting the Data.") bayesdata <- s.data j <- 1 for (i in batches){ bayesdata[,i] <- (bayesdata[,i]-t(batch.design[i,]%*%gamma.star))/(sqrt(delta.star[j,])%*%t(rep(1,n.batches[j]))) j <- j+1 } bayesdata <- (bayesdata*(sqrt(var.pooled)%*%t(rep(1,n.array))))+stand.mean ##### tiny change still exist when tested on bladder data #### total sum of change within each batch around 1e-15 ##### (could be computational system error). ##### Do not change ref batch at all in reference version if(!is.null(ref.batch)){ bayesdata[, batches[[ref]]] <- dat[, batches[[ref]]] } return(bayesdata) }
#' Automated analysis of CRISPR experiments. #' #' Main goals: #' \enumerate{ #' \item Flexible pipeline for analysis of the CRISPR Mi-Seq or Hi-Seq data. #' \item Compatible with GRanges and data.table style. #' \item Precise quantification of mutation rates. #' \item Prepare automatic reports as .Rmd files that are flexible #' and open for manipulation. #' \item Provide specialized plots for deletions, insertions, mismatches, #' variants, heterogeneity of the reads. #' } #' #' To learn more about amplican, start with the vignettes: #' \code{browseVignettes(package = "amplican")} #' #' @docType package #' @name amplican #' @useDynLib amplican #' #' @import Rcpp ggthemes waffle knitr methods BiocGenerics Biostrings data.table #' @importFrom Rcpp sourceCpp #' "_PACKAGE" .onAttach <- function(libname, pkgname) { packageStartupMessage( paste0("Pease consider supporting this software by citing:\n\n", "Labun et al. 2019\n", "Accurate analysis of genuine CRISPR editing events with ampliCan.\n", "Genome Res. 2019 Mar 8\n", "doi: 10.1101/gr.244293.118\n", "\nWithout appreciation scientific software is usually abandoned and", " eventually deprecated, but you can easily support authors by ", "citations.")) } amplicanPipe <- function(min_freq_default) { function( config, fastq_folder, results_folder, knit_reports = TRUE, write_alignments_format = "txt", average_quality = 30, min_quality = 0, use_parallel = FALSE, scoring_matrix = Biostrings::nucleotideSubstitutionMatrix( match = 5, mismatch = -4, baseOnly = TRUE, type = "DNA"), gap_opening = 25, gap_extension = 0, fastqfiles = 0.5, primer_mismatch = 0, donor_mismatch = 3, PRIMER_DIMER = 30, event_filter = TRUE, cut_buffer = 5, promiscuous_consensus = TRUE, normalize = c("guideRNA", "Group"), min_freq = min_freq_default) { config <- normalizePath(config) fastq_folder <- normalizePath(fastq_folder) results_folder <- normalizePath(results_folder) message("Checking write access...") checkFileWriteAccess(results_folder) aln <- amplicanAlign(config = config, fastq_folder = fastq_folder, use_parallel = use_parallel, average_quality = average_quality, scoring_matrix = scoring_matrix, gap_opening = gap_opening, gap_extension = gap_extension, min_quality = min_quality, fastqfiles = fastqfiles, primer_mismatch = primer_mismatch, donor_mismatch = donor_mismatch) message("Saving alignments...") resultsFolder <- file.path(results_folder, "alignments") if (!dir.exists(resultsFolder)) { dir.create(resultsFolder) } # save as .rds object saveRDS(aln, file.path(resultsFolder, "AlignmentsExperimentSet.rds")) # save as other formats if (!"None" %in% write_alignments_format) { for (frmt in write_alignments_format) { writeAlignments(aln, file.path(resultsFolder, paste0("alignments.", frmt)), frmt) } } message("Saving parameters...") logFileName <- file.path(results_folder, "RunParameters.txt") if (file.exists(logFileName)) { file.remove(logFileName) } logFileConn <- file(logFileName, open = "at") writeLines(c(paste("Config file: ", config), paste("Average Quality: ", average_quality), paste("Minimum Quality: ", min_quality), paste("Write Alignments: ", toString(write_alignments_format)), paste("Fastq files Mode: ", fastqfiles), paste("Gap Opening: ", gap_opening), paste("Gap Extension: ", gap_extension), paste("Consensus: ", promiscuous_consensus), paste("Normalize: ", toString(normalize)), paste("PRIMER DIMER buffer:", PRIMER_DIMER), paste("Cut buffer:", cut_buffer), "Scoring Matrix:"), logFileConn) utils::write.csv(scoring_matrix, logFileConn, quote = FALSE, row.names = TRUE) close(logFileConn) message("Saving unassigned sequences...") unData <- unassignedData(aln) if (!is.null(unData)) data.table::fwrite( unData, file.path(resultsFolder, "unassigned_reads.csv")) message("Saving barcode statistics...") data.table::fwrite(barcodeData(aln), file.path(results_folder, "barcode_reads_filters.csv")) message("Translating alignments into events...") cfgT <- experimentData(aln) aln <- extractEvents(aln, use_parallel = use_parallel) message("Saving complete events - unfiltered...") data.table::fwrite(aln, file.path(resultsFolder, "raw_events.csv")) data.table::setDT(aln) seqnames <- read_id <- counts <- NULL if (dim(aln)[1] == 0) stop("There are no events.", "Check whether you have correct primers in the config file.") aln$overlaps <- amplicanOverlap(aln, cfgT, cut_buffer = cut_buffer) aln$consensus <- if (fastqfiles <= 0.5) { amplicanConsensus(aln, cfgT, promiscuous = promiscuous_consensus) } else { TRUE } # filter events overlapping primers eOP <- findEOP(aln, cfgT) aln <- aln[!eOP, ] # find PRIMER DIMERS PD <- findPD(aln, cfgT, PRIMER_DIMER = PRIMER_DIMER) # summarize how many PRIMER DIMER reads per ID onlyPD <- aln[PD, ] onlyPD <- unique(onlyPD, by = c("seqnames", "read_id")) data.table::setDT(onlyPD) summaryPD <- onlyPD[, list(counts = sum(counts)), by = c("seqnames")] cfgT$PRIMER_DIMER <- 0 cfgT$PRIMER_DIMER[match(summaryPD$seqnames, cfgT$ID)] <- summaryPD$counts # apply filter - remove all events that come from PD infected reads aln <- aln[!onlyPD, on = list(seqnames, read_id)] # alignment event filter cfgT$Low_Score <- 0 if (event_filter) { for (i in seq_len(dim(cfgT)[1])) { aln_id <- aln[seqnames == cfgT$ID[i], ] if (dim(aln_id)[1] == 0 | cfgT$Donor[i] != "") next() onlyBR <- aln_id[findLQR(aln_id), ] onlyBR <- unique(onlyBR, by = "read_id") cfgT[i, "Low_Score"] <- sum(onlyBR$counts) aln <- aln[!(aln$seqnames == cfgT$ID[i] & aln$read_id %in% onlyBR$read_id), ] } } cfgT$Reads_Filtered <- cfgT$Reads - cfgT$PRIMER_DIMER - cfgT$Low_Score # shift to relative (most left UPPER case is position 0) message("Shifting events as relative...") data.table::setDF(aln) aln <- data.frame(amplicanMap(aln, cfgT), stringsAsFactors = FALSE) message("Saving shifted events - filtered...") data.table::fwrite(aln, file.path(resultsFolder, "events_filtered_shifted.csv")) # revert guides to 5'-3' cfgT$guideRNA[cfgT$Direction] <- revComp(cfgT$guideRNA[cfgT$Direction]) # normalize message("Normalizing events...") aln <- amplicanNormalize(aln, cfgT, min_freq = min_freq, add = normalize) message("Saving normalized events...") data.table::fwrite(aln, file.path(resultsFolder, "events_filtered_shifted_normalized.csv")) # summarize cfgT <- amplicanSummarize(aln[aln$consensus & aln$overlaps, ], cfgT) data.table::fwrite( cfgT[, c("ID", "Barcode", "Forward_Reads_File", "Reverse_Reads_File", "Group", "guideRNA", "Found_Guide", "Control", "Forward_Primer", "Reverse_Primer", "Direction", "Amplicon", "Donor", "fwdPrPosEnd", "rvePrPos", "Reads", "PRIMER_DIMER", "Low_Score", "Reads_Filtered", "Reads_Del", "Reads_In", "Reads_Edited", "Reads_Frameshifted", "HDR")], file.path(results_folder, "config_summary.csv")) # reports reportsFolder <- file.path(results_folder, "reports") if (!dir.exists(reportsFolder)) { dir.create(reportsFolder) } message(paste0("Making reports... \nDue to high quality ", "figures, it is time consuming. Use .Rmd templates for ", "more control.")) amplicanReport(results_folder, knit_reports = knit_reports, cut_buffer = cut_buffer, report_files = file.path(reportsFolder, c("id_report", "barcode_report", "group_report", "guide_report", "amplicon_report", "index"))) message("Finished.") invisible(results_folder) } } #' Wraps main package functionality into one function. #' #' amplicanPipeline is convenient wrapper around all functionality of the #' package with the most robust settings. It will generate all results in the #' \code{result_folder} and also knit prepared reports into 'reports' folder. #' @param results_folder (string) Where do you want to store results? #' The package will create files in that folder so make sure you have writing #' permissions. #' @param config (string) The path to your configuration file. For example: #' \code{system.file("extdata", "config.txt", package = "amplican")}. #' Configuration file can contain additional columns, but first 11 columns #' have to follow the example config specification. #' @param fastq_folder (string) Path to FASTQ files. If not specified, #' FASTQ files should be in the same directory as config file. #' @param knit_reports (boolean) whether function should "knit" all #' reports automatically for you (it is time consuming, be patient), when false #' reports will be prepared, but not knitted #' @param use_parallel (boolean) Set to TRUE, if you have registered #' multicore back-end. #' @param average_quality (numeric) The FASTQ file have a quality for each #' nucleotide, depending on sequencing technology there exist many formats. #' This package uses \code{\link[ShortRead]{readFastq}} to parse the reads. #' If the average quality of the reads fall below value of #' \code{average_quality} then sequence is filtered. Default is 0. #' @param min_quality (numeric) Similar as in average_quality, but depicts #' the minimum quality for ALL nucleotides in given read. If one of nucleotides #' has quality BELLOW \code{min_quality}, then the sequence is filtered. #' Default is 20. #' @param write_alignments_format (character vector) Whether #' \code{amplicanPipeline} should write alignments results to separate files. #' Alignments are also always saved as .rds object of #' \code{\link{AlignmentsExperimentSet}} class. #' Possible options are: #' \itemize{ #' \item{"fasta"}{ outputs alignments in fasta format where header indicates #' experiment ID, read id and number of reads} #' \item{"txt"}{ simple format, read information followed by forward read and #' amplicon sequence followed by reverse read with its amplicon sequence #' eg.: \cr #' \preformatted{ #' ID: ID_1 Count: 7 #' ACTGAAAAA-------- #' ACTG-----ACTGACTG #' #' ------G-ACTG #' ACTGACTGACTG #' }} #' \item{"None"}{ Don't write any alignments to files.} #' \item{c("fasta", "txt")}{ There are also possible combinations of #' above formats, pass a vector to get alignments in multiple formats.} #' } #' @param scoring_matrix (matrix) Default is 'NUC44'. Pass desired matrix using #' \code{\link{nucleotideSubstitutionMatrix}}. #' @param gap_opening (numeric) The opening gap score. #' @param gap_extension (numeric) The gap extension score. #' @param fastqfiles (numeric) Normally you want to use both FASTQ files. But in #' some special cases, you may want to use only the forward file, or only #' the reverse file. Possible options: #' \itemize{ #' \item{0}{ Use both FASTQ files.} #' \item{0.5}{ Use both FASTQ files, but only for one of the reads (forward or #' reverse) is required to have primer perfectly matched to sequence - eg. use #' when reverse reads are trimmed of primers, but forward reads have forward #' primer in the sequence.} #' \item{1}{ Use only the forward FASTQ file.} #' \item{2}{ Use only the reverse FASTQ file.} #' } #' @param primer_mismatch (numeric) Decide how many mismatches are allowed #' during primer matching of the reads, that groups reads by experiments. #' When \code{primer_mismatch = 0} no mismatches are allowed, which can increase #' number of unasssigned read. #' @param donor_mismatch (numeric) How many events of length 1 (mismatches, #' deletions and insertions of length 1) are allowed when aligning toward the #' donor template. This parameter is only used when donor template is specified. #' The higher the parameter the less strict will be algorithm accepting read as #' HDR. Set to 0 if only perfect alignments to the donor template marked as HDR, #' unadvised due to error rate of the sequencers. #' @param PRIMER_DIMER (numeric) Value specifying buffer for PRIMER DIMER #' detection. For a given read it will be recognized as PRIMER DIMER when #' alignment will introduce gap of size bigger than: \cr #' \code{length of amplicon - (lengths of PRIMERS + PRIMER_DIMER value)} #' @param event_filter (logical) Whether detection of offtarget reads, #' should be enabled. #' @param cut_buffer The number of bases by which extend expected cut sites #' (specified as UPPER case letters in the amplicon) in 5' and 3' directions. #' @param promiscuous_consensus (boolean) Whether rules of #' \code{\link{amplicanConsensus}} should be \code{promiscuous}. When #' promiscuous, we allow indels that have no confirmation on the other strand. #' @param normalize (character vector) If column 'Control' in config table #' has all FALSE/0 values then normalization is skipped. Otherwise, #' normalization is strict, which means events that are #' found in 'Control' TRUE group will be removed in 'Control' FALSE group. #' This parameter by default uses columns 'guideRNA' and 'Group' to impose #' additional restrictions on normalized events eg. only events created by the #' same 'guideRNA' in the same 'Group' will be normalized. #' @param min_freq (numeric) All events below this frequency are treated as #' sequencing errors and rejected. This parameter is used during normalization #' through \code{\link{amplicanNormalize}}. #' @include amplicanAlign.R amplicanReport.R #' @return (invisible) results_folder path #' @export #' @family analysis steps #' @examples #' # path to example config file #' config <- system.file("extdata", "config.csv", package = "amplican") #' # path to example fastq files #' fastq_folder <- system.file("extdata", package = "amplican") #' # output folder #' results_folder <- tempdir() #' #' #full analysis, not knitting files automatically #' amplicanPipeline(config, fastq_folder, results_folder, knit_reports = FALSE) #' # config <- system.file("extdata", "config.csv", package = "amplican") # fastq_folder <- system.file("extdata", package = "amplican") # results_folder <- tempdir() # knit_reports = TRUE # write_alignments_format = "txt" # average_quality = 30 # min_quality = 0 # use_parallel = FALSE # scoring_matrix = Biostrings::nucleotideSubstitutionMatrix( # match = 5, mismatch = -4, baseOnly = TRUE, type = "DNA") # gap_opening = 25 # gap_extension = 0 # fastqfiles = 0.5 # PRIMER_DIMER = 30 # event_filter = TRUE # cut_buffer = 5 # primer_mismatch = 1 # promiscuous_consensus = TRUE # normalize = c("guideRNA", "Group") # donor_mismatch = 3 # min_freq = 0.01 amplicanPipeline <- amplicanPipe(0.01) #' Wraps main package functionality into one function. #' #' amplicanPipelineIndexHopping is identical as amplicanPipeline except that #' default \code{min_freq} threshold is set to 0.15. Setting this threshold #' higher will decrease risks of inadequate normalization in cases of potential #' Index Hopping, potentially decreasing precision of true editing rate calling. #' Index Hopping can be mitigated with use of unique dual indexing pooling #' combinations. However, in cases when you might expect Index Hopping to occur #' you should use this function instead of amplicanPipeline. #' #' \code{result_folder} and also knit prepared reports into 'reports' folder. #' @inheritParams amplicanPipeline #' @include amplicanAlign.R amplicanReport.R #' @return (invisible) results_folder path #' @export #' @family analysis steps #' amplicanPipelineConservative <- amplicanPipe(0.15)
/R/amplican.R
no_license
vaofford/amplican
R
false
false
16,685
r
#' Automated analysis of CRISPR experiments. #' #' Main goals: #' \enumerate{ #' \item Flexible pipeline for analysis of the CRISPR Mi-Seq or Hi-Seq data. #' \item Compatible with GRanges and data.table style. #' \item Precise quantification of mutation rates. #' \item Prepare automatic reports as .Rmd files that are flexible #' and open for manipulation. #' \item Provide specialized plots for deletions, insertions, mismatches, #' variants, heterogeneity of the reads. #' } #' #' To learn more about amplican, start with the vignettes: #' \code{browseVignettes(package = "amplican")} #' #' @docType package #' @name amplican #' @useDynLib amplican #' #' @import Rcpp ggthemes waffle knitr methods BiocGenerics Biostrings data.table #' @importFrom Rcpp sourceCpp #' "_PACKAGE" .onAttach <- function(libname, pkgname) { packageStartupMessage( paste0("Pease consider supporting this software by citing:\n\n", "Labun et al. 2019\n", "Accurate analysis of genuine CRISPR editing events with ampliCan.\n", "Genome Res. 2019 Mar 8\n", "doi: 10.1101/gr.244293.118\n", "\nWithout appreciation scientific software is usually abandoned and", " eventually deprecated, but you can easily support authors by ", "citations.")) } amplicanPipe <- function(min_freq_default) { function( config, fastq_folder, results_folder, knit_reports = TRUE, write_alignments_format = "txt", average_quality = 30, min_quality = 0, use_parallel = FALSE, scoring_matrix = Biostrings::nucleotideSubstitutionMatrix( match = 5, mismatch = -4, baseOnly = TRUE, type = "DNA"), gap_opening = 25, gap_extension = 0, fastqfiles = 0.5, primer_mismatch = 0, donor_mismatch = 3, PRIMER_DIMER = 30, event_filter = TRUE, cut_buffer = 5, promiscuous_consensus = TRUE, normalize = c("guideRNA", "Group"), min_freq = min_freq_default) { config <- normalizePath(config) fastq_folder <- normalizePath(fastq_folder) results_folder <- normalizePath(results_folder) message("Checking write access...") checkFileWriteAccess(results_folder) aln <- amplicanAlign(config = config, fastq_folder = fastq_folder, use_parallel = use_parallel, average_quality = average_quality, scoring_matrix = scoring_matrix, gap_opening = gap_opening, gap_extension = gap_extension, min_quality = min_quality, fastqfiles = fastqfiles, primer_mismatch = primer_mismatch, donor_mismatch = donor_mismatch) message("Saving alignments...") resultsFolder <- file.path(results_folder, "alignments") if (!dir.exists(resultsFolder)) { dir.create(resultsFolder) } # save as .rds object saveRDS(aln, file.path(resultsFolder, "AlignmentsExperimentSet.rds")) # save as other formats if (!"None" %in% write_alignments_format) { for (frmt in write_alignments_format) { writeAlignments(aln, file.path(resultsFolder, paste0("alignments.", frmt)), frmt) } } message("Saving parameters...") logFileName <- file.path(results_folder, "RunParameters.txt") if (file.exists(logFileName)) { file.remove(logFileName) } logFileConn <- file(logFileName, open = "at") writeLines(c(paste("Config file: ", config), paste("Average Quality: ", average_quality), paste("Minimum Quality: ", min_quality), paste("Write Alignments: ", toString(write_alignments_format)), paste("Fastq files Mode: ", fastqfiles), paste("Gap Opening: ", gap_opening), paste("Gap Extension: ", gap_extension), paste("Consensus: ", promiscuous_consensus), paste("Normalize: ", toString(normalize)), paste("PRIMER DIMER buffer:", PRIMER_DIMER), paste("Cut buffer:", cut_buffer), "Scoring Matrix:"), logFileConn) utils::write.csv(scoring_matrix, logFileConn, quote = FALSE, row.names = TRUE) close(logFileConn) message("Saving unassigned sequences...") unData <- unassignedData(aln) if (!is.null(unData)) data.table::fwrite( unData, file.path(resultsFolder, "unassigned_reads.csv")) message("Saving barcode statistics...") data.table::fwrite(barcodeData(aln), file.path(results_folder, "barcode_reads_filters.csv")) message("Translating alignments into events...") cfgT <- experimentData(aln) aln <- extractEvents(aln, use_parallel = use_parallel) message("Saving complete events - unfiltered...") data.table::fwrite(aln, file.path(resultsFolder, "raw_events.csv")) data.table::setDT(aln) seqnames <- read_id <- counts <- NULL if (dim(aln)[1] == 0) stop("There are no events.", "Check whether you have correct primers in the config file.") aln$overlaps <- amplicanOverlap(aln, cfgT, cut_buffer = cut_buffer) aln$consensus <- if (fastqfiles <= 0.5) { amplicanConsensus(aln, cfgT, promiscuous = promiscuous_consensus) } else { TRUE } # filter events overlapping primers eOP <- findEOP(aln, cfgT) aln <- aln[!eOP, ] # find PRIMER DIMERS PD <- findPD(aln, cfgT, PRIMER_DIMER = PRIMER_DIMER) # summarize how many PRIMER DIMER reads per ID onlyPD <- aln[PD, ] onlyPD <- unique(onlyPD, by = c("seqnames", "read_id")) data.table::setDT(onlyPD) summaryPD <- onlyPD[, list(counts = sum(counts)), by = c("seqnames")] cfgT$PRIMER_DIMER <- 0 cfgT$PRIMER_DIMER[match(summaryPD$seqnames, cfgT$ID)] <- summaryPD$counts # apply filter - remove all events that come from PD infected reads aln <- aln[!onlyPD, on = list(seqnames, read_id)] # alignment event filter cfgT$Low_Score <- 0 if (event_filter) { for (i in seq_len(dim(cfgT)[1])) { aln_id <- aln[seqnames == cfgT$ID[i], ] if (dim(aln_id)[1] == 0 | cfgT$Donor[i] != "") next() onlyBR <- aln_id[findLQR(aln_id), ] onlyBR <- unique(onlyBR, by = "read_id") cfgT[i, "Low_Score"] <- sum(onlyBR$counts) aln <- aln[!(aln$seqnames == cfgT$ID[i] & aln$read_id %in% onlyBR$read_id), ] } } cfgT$Reads_Filtered <- cfgT$Reads - cfgT$PRIMER_DIMER - cfgT$Low_Score # shift to relative (most left UPPER case is position 0) message("Shifting events as relative...") data.table::setDF(aln) aln <- data.frame(amplicanMap(aln, cfgT), stringsAsFactors = FALSE) message("Saving shifted events - filtered...") data.table::fwrite(aln, file.path(resultsFolder, "events_filtered_shifted.csv")) # revert guides to 5'-3' cfgT$guideRNA[cfgT$Direction] <- revComp(cfgT$guideRNA[cfgT$Direction]) # normalize message("Normalizing events...") aln <- amplicanNormalize(aln, cfgT, min_freq = min_freq, add = normalize) message("Saving normalized events...") data.table::fwrite(aln, file.path(resultsFolder, "events_filtered_shifted_normalized.csv")) # summarize cfgT <- amplicanSummarize(aln[aln$consensus & aln$overlaps, ], cfgT) data.table::fwrite( cfgT[, c("ID", "Barcode", "Forward_Reads_File", "Reverse_Reads_File", "Group", "guideRNA", "Found_Guide", "Control", "Forward_Primer", "Reverse_Primer", "Direction", "Amplicon", "Donor", "fwdPrPosEnd", "rvePrPos", "Reads", "PRIMER_DIMER", "Low_Score", "Reads_Filtered", "Reads_Del", "Reads_In", "Reads_Edited", "Reads_Frameshifted", "HDR")], file.path(results_folder, "config_summary.csv")) # reports reportsFolder <- file.path(results_folder, "reports") if (!dir.exists(reportsFolder)) { dir.create(reportsFolder) } message(paste0("Making reports... \nDue to high quality ", "figures, it is time consuming. Use .Rmd templates for ", "more control.")) amplicanReport(results_folder, knit_reports = knit_reports, cut_buffer = cut_buffer, report_files = file.path(reportsFolder, c("id_report", "barcode_report", "group_report", "guide_report", "amplicon_report", "index"))) message("Finished.") invisible(results_folder) } } #' Wraps main package functionality into one function. #' #' amplicanPipeline is convenient wrapper around all functionality of the #' package with the most robust settings. It will generate all results in the #' \code{result_folder} and also knit prepared reports into 'reports' folder. #' @param results_folder (string) Where do you want to store results? #' The package will create files in that folder so make sure you have writing #' permissions. #' @param config (string) The path to your configuration file. For example: #' \code{system.file("extdata", "config.txt", package = "amplican")}. #' Configuration file can contain additional columns, but first 11 columns #' have to follow the example config specification. #' @param fastq_folder (string) Path to FASTQ files. If not specified, #' FASTQ files should be in the same directory as config file. #' @param knit_reports (boolean) whether function should "knit" all #' reports automatically for you (it is time consuming, be patient), when false #' reports will be prepared, but not knitted #' @param use_parallel (boolean) Set to TRUE, if you have registered #' multicore back-end. #' @param average_quality (numeric) The FASTQ file have a quality for each #' nucleotide, depending on sequencing technology there exist many formats. #' This package uses \code{\link[ShortRead]{readFastq}} to parse the reads. #' If the average quality of the reads fall below value of #' \code{average_quality} then sequence is filtered. Default is 0. #' @param min_quality (numeric) Similar as in average_quality, but depicts #' the minimum quality for ALL nucleotides in given read. If one of nucleotides #' has quality BELLOW \code{min_quality}, then the sequence is filtered. #' Default is 20. #' @param write_alignments_format (character vector) Whether #' \code{amplicanPipeline} should write alignments results to separate files. #' Alignments are also always saved as .rds object of #' \code{\link{AlignmentsExperimentSet}} class. #' Possible options are: #' \itemize{ #' \item{"fasta"}{ outputs alignments in fasta format where header indicates #' experiment ID, read id and number of reads} #' \item{"txt"}{ simple format, read information followed by forward read and #' amplicon sequence followed by reverse read with its amplicon sequence #' eg.: \cr #' \preformatted{ #' ID: ID_1 Count: 7 #' ACTGAAAAA-------- #' ACTG-----ACTGACTG #' #' ------G-ACTG #' ACTGACTGACTG #' }} #' \item{"None"}{ Don't write any alignments to files.} #' \item{c("fasta", "txt")}{ There are also possible combinations of #' above formats, pass a vector to get alignments in multiple formats.} #' } #' @param scoring_matrix (matrix) Default is 'NUC44'. Pass desired matrix using #' \code{\link{nucleotideSubstitutionMatrix}}. #' @param gap_opening (numeric) The opening gap score. #' @param gap_extension (numeric) The gap extension score. #' @param fastqfiles (numeric) Normally you want to use both FASTQ files. But in #' some special cases, you may want to use only the forward file, or only #' the reverse file. Possible options: #' \itemize{ #' \item{0}{ Use both FASTQ files.} #' \item{0.5}{ Use both FASTQ files, but only for one of the reads (forward or #' reverse) is required to have primer perfectly matched to sequence - eg. use #' when reverse reads are trimmed of primers, but forward reads have forward #' primer in the sequence.} #' \item{1}{ Use only the forward FASTQ file.} #' \item{2}{ Use only the reverse FASTQ file.} #' } #' @param primer_mismatch (numeric) Decide how many mismatches are allowed #' during primer matching of the reads, that groups reads by experiments. #' When \code{primer_mismatch = 0} no mismatches are allowed, which can increase #' number of unasssigned read. #' @param donor_mismatch (numeric) How many events of length 1 (mismatches, #' deletions and insertions of length 1) are allowed when aligning toward the #' donor template. This parameter is only used when donor template is specified. #' The higher the parameter the less strict will be algorithm accepting read as #' HDR. Set to 0 if only perfect alignments to the donor template marked as HDR, #' unadvised due to error rate of the sequencers. #' @param PRIMER_DIMER (numeric) Value specifying buffer for PRIMER DIMER #' detection. For a given read it will be recognized as PRIMER DIMER when #' alignment will introduce gap of size bigger than: \cr #' \code{length of amplicon - (lengths of PRIMERS + PRIMER_DIMER value)} #' @param event_filter (logical) Whether detection of offtarget reads, #' should be enabled. #' @param cut_buffer The number of bases by which extend expected cut sites #' (specified as UPPER case letters in the amplicon) in 5' and 3' directions. #' @param promiscuous_consensus (boolean) Whether rules of #' \code{\link{amplicanConsensus}} should be \code{promiscuous}. When #' promiscuous, we allow indels that have no confirmation on the other strand. #' @param normalize (character vector) If column 'Control' in config table #' has all FALSE/0 values then normalization is skipped. Otherwise, #' normalization is strict, which means events that are #' found in 'Control' TRUE group will be removed in 'Control' FALSE group. #' This parameter by default uses columns 'guideRNA' and 'Group' to impose #' additional restrictions on normalized events eg. only events created by the #' same 'guideRNA' in the same 'Group' will be normalized. #' @param min_freq (numeric) All events below this frequency are treated as #' sequencing errors and rejected. This parameter is used during normalization #' through \code{\link{amplicanNormalize}}. #' @include amplicanAlign.R amplicanReport.R #' @return (invisible) results_folder path #' @export #' @family analysis steps #' @examples #' # path to example config file #' config <- system.file("extdata", "config.csv", package = "amplican") #' # path to example fastq files #' fastq_folder <- system.file("extdata", package = "amplican") #' # output folder #' results_folder <- tempdir() #' #' #full analysis, not knitting files automatically #' amplicanPipeline(config, fastq_folder, results_folder, knit_reports = FALSE) #' # config <- system.file("extdata", "config.csv", package = "amplican") # fastq_folder <- system.file("extdata", package = "amplican") # results_folder <- tempdir() # knit_reports = TRUE # write_alignments_format = "txt" # average_quality = 30 # min_quality = 0 # use_parallel = FALSE # scoring_matrix = Biostrings::nucleotideSubstitutionMatrix( # match = 5, mismatch = -4, baseOnly = TRUE, type = "DNA") # gap_opening = 25 # gap_extension = 0 # fastqfiles = 0.5 # PRIMER_DIMER = 30 # event_filter = TRUE # cut_buffer = 5 # primer_mismatch = 1 # promiscuous_consensus = TRUE # normalize = c("guideRNA", "Group") # donor_mismatch = 3 # min_freq = 0.01 amplicanPipeline <- amplicanPipe(0.01) #' Wraps main package functionality into one function. #' #' amplicanPipelineIndexHopping is identical as amplicanPipeline except that #' default \code{min_freq} threshold is set to 0.15. Setting this threshold #' higher will decrease risks of inadequate normalization in cases of potential #' Index Hopping, potentially decreasing precision of true editing rate calling. #' Index Hopping can be mitigated with use of unique dual indexing pooling #' combinations. However, in cases when you might expect Index Hopping to occur #' you should use this function instead of amplicanPipeline. #' #' \code{result_folder} and also knit prepared reports into 'reports' folder. #' @inheritParams amplicanPipeline #' @include amplicanAlign.R amplicanReport.R #' @return (invisible) results_folder path #' @export #' @family analysis steps #' amplicanPipelineConservative <- amplicanPipe(0.15)
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/databICESdiv.R \name{databICESdiv} \alias{databICESdiv} \title{Datos de abundancia por división ICES para una especie resúmen para grupos de trabajo} \usage{ databICESdiv(gr, esp, camp, dns = "Cant", cor.time = TRUE, Nas = FALSE) } \arguments{ \item{gr}{Grupo de la especie: 1 peces, 2 crustáceos 3 moluscos 4 equinodermos 5 invertebrados} \item{esp}{Código de la especie numérico o carácter con tres espacios. 999 para todas las especies del grupo} \item{camp}{Campaña de la que se extraen los datos: un año comcreto (XX): Demersales "NXX", Porcupine "PXX", Arsa primavera "1XX" y Arsa otoño "2XX"} \item{dns}{Elige el origen de las bases de datos: Porcupine "Pnew", Cantábrico "Cant, Golfo de Cádiz "Arsa" (únicamente para sacar datos al IBTS, no gráficos)} \item{cor.time}{Si T corrige las abundancias en función de la duración del lance} \item{Nas}{Permite calcular los errores estándar aunque sólo haya un lance en algún estrato (haciendo varianza =0 en ese estrato, incorrecto pero da una idea cuando sólo un estrato entre varios tiene sólo un lance)} } \value{ Devuelve un número con nombres organizado en dos líneas (biomasa y número) en columnas por subdivisiones ICES por columnas abundancia estratificada media por XIa, 8.cE, 8.cW } \description{ Salida de datos a csv para rellenar los informes de grupo de trabajo, filas con datos ab estratificada (Biomasa y N) y error estándar por subdivisión ICES función para Demersales Norte (saca 9.a, 8.c y total) } \seealso{ {\link{databICES} \link{databEstr} \link{datab}} }
/man/databICESDiv.Rd
no_license
Franvgls/CampR
R
false
true
1,639
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/databICESdiv.R \name{databICESdiv} \alias{databICESdiv} \title{Datos de abundancia por división ICES para una especie resúmen para grupos de trabajo} \usage{ databICESdiv(gr, esp, camp, dns = "Cant", cor.time = TRUE, Nas = FALSE) } \arguments{ \item{gr}{Grupo de la especie: 1 peces, 2 crustáceos 3 moluscos 4 equinodermos 5 invertebrados} \item{esp}{Código de la especie numérico o carácter con tres espacios. 999 para todas las especies del grupo} \item{camp}{Campaña de la que se extraen los datos: un año comcreto (XX): Demersales "NXX", Porcupine "PXX", Arsa primavera "1XX" y Arsa otoño "2XX"} \item{dns}{Elige el origen de las bases de datos: Porcupine "Pnew", Cantábrico "Cant, Golfo de Cádiz "Arsa" (únicamente para sacar datos al IBTS, no gráficos)} \item{cor.time}{Si T corrige las abundancias en función de la duración del lance} \item{Nas}{Permite calcular los errores estándar aunque sólo haya un lance en algún estrato (haciendo varianza =0 en ese estrato, incorrecto pero da una idea cuando sólo un estrato entre varios tiene sólo un lance)} } \value{ Devuelve un número con nombres organizado en dos líneas (biomasa y número) en columnas por subdivisiones ICES por columnas abundancia estratificada media por XIa, 8.cE, 8.cW } \description{ Salida de datos a csv para rellenar los informes de grupo de trabajo, filas con datos ab estratificada (Biomasa y N) y error estándar por subdivisión ICES función para Demersales Norte (saca 9.a, 8.c y total) } \seealso{ {\link{databICES} \link{databEstr} \link{datab}} }
library(glmnet) mydata = read.table("./TrainingSet/LassoBIC/kidney.csv",head=T,sep=",") x = as.matrix(mydata[,4:ncol(mydata)]) y = as.matrix(mydata[,1]) set.seed(123) glm = cv.glmnet(x,y,nfolds=10,type.measure="mae",alpha=0.95,family="gaussian",standardize=TRUE) sink('./Model/EN/Lasso/kidney/kidney_095.txt',append=TRUE) print(glm$glmnet.fit) sink()
/Model/EN/Lasso/kidney/kidney_095.R
no_license
leon1003/QSMART
R
false
false
351
r
library(glmnet) mydata = read.table("./TrainingSet/LassoBIC/kidney.csv",head=T,sep=",") x = as.matrix(mydata[,4:ncol(mydata)]) y = as.matrix(mydata[,1]) set.seed(123) glm = cv.glmnet(x,y,nfolds=10,type.measure="mae",alpha=0.95,family="gaussian",standardize=TRUE) sink('./Model/EN/Lasso/kidney/kidney_095.txt',append=TRUE) print(glm$glmnet.fit) sink()
corr2 <- function(directory, threshold = 0) { corr <- numeric(0) for (i in 1:332) { data <- na.omit(read.csv(paste(directory, '/', sprintf("%03d", i), ".csv", sep=""))) if (nrow(data) >= threshold) { cr <- cor(data["sulfate"], data["nitrate"]) if (!is.na(cr)) { corr <- append(corr, cr) } } } corr }
/week2/corr2.r
permissive
josteinstraume/datasciencecoursera
R
false
false
327
r
corr2 <- function(directory, threshold = 0) { corr <- numeric(0) for (i in 1:332) { data <- na.omit(read.csv(paste(directory, '/', sprintf("%03d", i), ".csv", sep=""))) if (nrow(data) >= threshold) { cr <- cor(data["sulfate"], data["nitrate"]) if (!is.na(cr)) { corr <- append(corr, cr) } } } corr }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/co.R \docType{data} \name{co} \alias{co} \title{Tibble con i dati di co per 6 stazioni della regione TOSCANA} \format{ Un tibble con 8 colonne e 4386 osservazioni } \usage{ co } \description{ Tibble con i dati di co per 6 stazioni della regione TOSCANA } \keyword{datasets}
/man/co.Rd
permissive
progettopulvirus/toscana
R
false
true
352
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/co.R \docType{data} \name{co} \alias{co} \title{Tibble con i dati di co per 6 stazioni della regione TOSCANA} \format{ Un tibble con 8 colonne e 4386 osservazioni } \usage{ co } \description{ Tibble con i dati di co per 6 stazioni della regione TOSCANA } \keyword{datasets}
hierNet <- function(x, y, lam, delta=1e-8, strong=FALSE, diagonal=TRUE, aa=NULL, zz=NULL, center=TRUE, stand.main=TRUE, stand.int=FALSE, rho=nrow(x), niter=100, sym.eps=1e-3, step=1, maxiter=2000, backtrack=0.2, tol=1e-5, trace=0) { # Main Hiernet function for fitting at a single parameter lambda. # Note: L1 penalty terms have parameter lam.l1 = lambda * (1-delta) # and L2 penalty has parameter lam.l2 = lambda * delta. # # stand.main and stand.int refer to scaling stopifnot(nrow(x) == length(y), lam >= 0, delta >= 0, delta <= 1) stopifnot(!is.null(step) && !is.null(maxiter)) if (strong) stopifnot(!is.null(niter)) stopifnot(class(y) == "numeric") stopifnot(class(lam) == "numeric") stopifnot(class(delta) == "numeric") stopifnot(class(step) == "numeric", step > 0, maxiter > 0) stopifnot(is.finite(x), is.finite(y), is.finite(lam), is.finite(delta)) this.call <- match.call() if (!center) cat("WARNING: center=FALSE should almost never be used. This option is available for special uses only.", fill=TRUE) # center and (maybe) scale variables x <- scale(x, center=center, scale=stand.main) mx <- attr(x, "scaled:center") sx <- attr(x, "scaled:scale") # may be NULL if (center) { my <- mean(y) y <- y - my } else my <- NULL if (is.null(zz)) { if (trace > 0) cat("Computing zz...", fill=TRUE) zz <- compute.interactions.c(x, diagonal=diagonal) } if (is.matrix(zz)) { zz <- scale(zz, center=center, scale=stand.int) mzz <- attr(zz, "scaled:center") szz <- attr(zz, "scaled:scale") # may be NULL zz <- as.numeric(zz) } else { mzz <- szz <- NULL #cat("Provided zz is not a matrix, so it's assumed to be already centered.", fill=TRUE) } xnum <- as.numeric(x) p <- ncol(x) lam.l1 <- lam * (1 - delta) lam.l2 <- lam * delta if (strong) { # strong hierarchy -- use ADMM4 if (is.null(rho)) rho <- as.numeric(nrow(x)) stopifnot(is.numeric(rho), is.finite(rho)) aa <- admm4(x, xnum, y, lam.l1=lam.l1, lam.l2=lam.l2, diagonal=diagonal, zz=zz, rho=rho, niter=niter, aa=aa, sym.eps=sym.eps, # ADMM params stepsize=step, backtrack=backtrack, maxiter=maxiter, tol=tol, # GG params trace=trace) # lack of symmetry in theta means that sometimes strong hierarchy will be (very slightly violated) ii <- aa$bp + aa$bn == 0 # note aa$th[ii, ] = 0 since weak hierarchy holds for sure if (sum(ii) > 0 & sum(ii) < p) { thr <- max(abs(aa$th[!ii, ii])) if (thr > 0) { cat(" thr = ",thr, fill=TRUE) if (thr > 1e-3) warning("Had to change ADMM's 'th' by more than 0.001 to make strong hier hold! Increase niter (and/or rho). ") aa$th[abs(aa$th) <= thr] <- 0 } } } else { # weak hierarchy -- a single call to generalized gradient descent if (is.null(aa)) { aa <- list(th=matrix(0, p, p), bp=rep(0, p), bn=rep(0, p)) } else { stopifnot(dim(aa$th) == c(p,p), length(aa$bp) == p, length(aa$bn) == p) } # this could be improved by not actually creating V... V <- matrix(0, p, p) rho <- 0 aa <- ggdescent.c(x=x, xnum=xnum, zz=zz, y=y, lam.l1=lam.l1, lam.l2=lam.l2, diagonal=diagonal, rho=rho, V=V, stepsize=step, backtrack=backtrack, maxiter=maxiter, tol=tol, aa=aa, trace=trace) } aa$lam <- lam aa$delta <- delta aa$type <- "gaussian" aa$diagonal <- diagonal aa$strong <- strong aa$obj <- Objective(aa=aa, x=x, y=y, lam.l1=lam.l1, lam.l2=lam.l2, xnum=xnum, zz=zz, strong=strong, trace = trace-1) aa$step <- step aa$maxiter <- maxiter aa$backtrack <- backtrack aa$tol <- tol if (strong) { # ADMM parameters: aa$rho <- rho aa$niter <- niter aa$sym.eps <- sym.eps } aa$mx <- mx aa$sx <- sx aa$my <- my aa$mzz <- mzz aa$szz <- szz aa$call <- this.call class(aa) <- "hierNet" return(aa) } print.hierNet <- function(x, ...) { cat("Call:\n") dput(x$call) th=(x$th+t(x$th))/2 o2=colSums(th^2)!=0 b=x$bp-x$bn o=b!=0 b=b[o] if (any(o2)) { # model has interactions th=th[o,o2,drop=FALSE] tight <- rowSums(abs(th)) >= x$bp[o] + x$bn[o] - 1e-9 tt <- rep("", length(tight)) tt[tight] <- "*" mat=cbind(b,th) mat=round(mat,4) mat <- cbind(mat, tt) cat("\n") cat("Non-zero coefficients:",fill=T) cat(" (Rows are predictors with nonzero main effects)",fill=T) cat(" (1st column is main effect)", fill=T) cat(" (Next columns are nonzero interactions of row predictor)", fill=T) cat(" (Last column indicates whether hierarchy constraint is tight.)",fill=T) cat("\n") dimnames(mat)=list(as.character(which(o)),c("Main effect",as.character(which(o2)),"Tight?")) print(mat, quote = FALSE) } else { mat <- matrix(round(b,4), length(b), 1) cat("\n") cat("Non-zero coefficients:",fill=T) cat(" (No interactions in this model)",fill=T) cat("\n") dimnames(mat)=list(as.character(which(o)),"Main effect") print(mat, quote = FALSE) } invisible() } print.hierNet.path <- function(x, ...) { cat("Call:\n") dput(x$call) b=x$bp-x$bn mat=cbind(round(x$lam,2),round(x$obj,2),colSums(b!=0),apply(x$th!=0,3,function(a) sum(diag(a)) + sum((a+t(a)!=0)[upper.tri(a)]))) dimnames(mat)=list(NULL,c("Lambda", "Objective", "Number of main effects","Number of interactions")) cat("\n") print(mat, quote = FALSE) invisible() } print.hierNet.cv <- function(x, ...) { cat("Call:\n") dput(x$call) mat=cbind(round(x$lamlist,2),x$nonzero,round(x$cv.err,2),round(x$cv.se,2)) dimnames(mat)=list(NULL,c("Lambda", "Number of nonzero","Mean CV error", "SE")) cat("\n") print(mat, quote = FALSE) cat("\n") cat(c("lamhat=",round(x$lamhat,2),"lamhat.1se=",round(x$lamhat.1se,2)),fill=T) invisible() } hierNet.path <- function(x, y, lamlist=NULL, delta=1e-8, minlam=NULL, maxlam=NULL, nlam=20, flmin=.01, diagonal=TRUE, strong=FALSE, aa=NULL, zz=NULL, stand.main=TRUE, stand.int=FALSE, rho=nrow(x), niter=100, sym.eps=1e-3,# ADMM params step=1, maxiter=2000, backtrack=0.2, tol=1e-5, # GG descent params trace=0) { # Main Hiernet function for fitting at a sequence of lambda values. # Note: L1 penalty terms have parameter lam.l1 = lambda * (1-delta) # and L2 penalty has parameter lam.l2 = lambda * delta. # # Always centers both x and zz (unless zz is provided in as.numeric form) # stand.main and stand.int refer to whether main effects and interactions should have norm sqrt(n-1) # center and (maybe) scale variables this.call <- match.call() x <- scale(x, center=TRUE, scale=stand.main) mx <- attr(x, "scaled:center") sx <- attr(x, "scaled:scale") # may be NULL my <- mean(y) y <- y - my if (is.null(maxlam)) { if (!is.null(minlam)) stop("Cannot have maxlam=NULL if minlam is non-null.") # maxlam <- max(abs(t(x) %*% y)/colSums(x^2)) maxlam <- max(abs(t(x) %*% y)) # temp <- t(scale(t(x), center=FALSE, scale=1/y)) # temp2 <- apply(temp, 2, twonorm) # maxlam <- max(max(temp2), maxlam) minlam <- maxlam * flmin } if (is.null(minlam)) minlam <- maxlam * flmin if (is.null(lamlist)) lamlist <- exp(seq(log(maxlam),log(minlam),length=nlam)) nlam <- length(lamlist) if (is.null(zz)) zz <- compute.interactions.c(x, diagonal=diagonal) else stopifnot(is.matrix(zz)) # center and (maybe) scale zz zz <- scale(zz, center=TRUE, scale=stand.int) mzz <- attr(zz, "scaled:center") szz <- attr(zz, "scaled:scale") # may be NULL zz <- as.numeric(zz) p <- ncol(x) cp2 <- choose(p, 2) bp <- bn <- matrix(NA, nrow=p, ncol=nlam) th <- array(NA, c(p, p, nlam)) obj <- rep(NA, nlam) aa <- NULL for (i in seq(nlam)) { if (trace != 0) { cat(c("i,lam=", i, round(lamlist[i],2)), fill=TRUE) } aa <- hierNet(x, y, lam=lamlist[i], delta=delta, strong=strong, diagonal=diagonal, aa=aa, zz=zz, stand.main=FALSE, stand.int=FALSE, # have already standardized rho=rho, niter=niter, sym.eps=sym.eps, step=step, maxiter=maxiter, backtrack=backtrack, tol=tol, trace=trace) bp[, i] <- aa$bp bn[, i] <- aa$bn th[, , i] <- aa$th obj[i] <- aa$obj } dimnames(bp) <- dimnames(bn) <- list(as.character(1:p), NULL) dimnames(th) <- list(as.character(1:p), as.character(1:p), NULL) out <- list(bp=bp, bn=bn, th=th, obj=obj, lamlist=lamlist, delta=delta, mx=mx, sx=sx, mzz=mzz, szz=szz, my=my, type="gaussian", diagonal=diagonal, strong=strong, step=step, maxiter=maxiter, backtrack=backtrack, tol=tol, call=this.call) if (strong) { # ADMM parameters: out$rho <- rho out$niter <- niter out$sym.eps <- sym.eps } class(out) <- "hierNet.path" out } predict.hierNet <- function(object, newx, newzz=NULL, ...) { n <- nrow(newx) if (is.null(object$sx)) newx <- scale(newx, center=object$mx, scale=FALSE) else newx <- scale(newx, center=object$mx, scale=object$sx) if (is.null(newzz)) newzz <- compute.interactions.c(newx, diagonal=object$diagonal) if (is.null(object$szz)) newzz <- scale(newzz, center=object$mzz, scale=FALSE) else newzz <- scale(newzz, center=object$mzz, scale=object$szz) newzz <- as.numeric(newzz) newx <- as.numeric(newx) stopifnot(is.finite(newzz), is.finite(newx)) if (!("matrix" %in% class(object$bp))) yhatt <- Compute.yhat.c(newx, newzz, object) + object$my else { nlam <- ncol(object$bp) yhat <- matrix(NA, n, nlam) # this could be made more efficient for (i in seq(nlam)) { bb <- list(bp=object$bp[, i], bn=object$bn[, i], th=object$th[, , i], diagonal=object$diagonal) yhat[, i] <- Compute.yhat.c(newx, newzz, bb) } yhatt <- yhat + object$my } if (object$type == "logistic") { # predict from hierNet.logistic object object b0 <- object$b0 if(is.matrix(yhatt)) b0 <- matrix(b0, nrow=nrow(yhatt), ncol=ncol(yhatt), byrow=T) yhatt <- b0 + yhatt pr <- 1 / (1 + exp(-yhatt)) return(list(prob=pr, yhat=1*(pr>.5))) } return(yhatt) } predict.hierNet.path <- function(object, newx, newzz=NULL, ...){ predict.hierNet(object, newx, newzz, ...) } admm4 <- function(x, xnum, y, lam.l1, lam.l2, diagonal, zz=NULL, rho, niter, aa=NULL, sym.eps=1e-3, trace=1, ...) { # Performs ADMM4. # Note: xnum is the matrix x as a numeric. Both are passed to avoid having to call as.numeric too # many times. p <- ncol(x) if (is.null(zz)) { if (trace > 0) cat("Computing zz...", fill=TRUE) zz <- as.numeric(compute.interactions.c(x, diagonal=diagonal)) } else if ("matrix" %in% class(zz)) zz <- as.numeric(zz) if (is.null(aa)) { aa <- list(u=matrix(0, p, p), th=matrix(0, p, p), bp=rep(0, p), bn=rep(0, p), tt=matrix(0, p, p), diagonal=diagonal) } else { stopifnot(diagonal == aa$diagonal) } if (is.null(aa$tt) || is.null(aa$u)) { aa$tt <- 0.5 * (aa$th + t(aa$th)) aa$u <- matrix(0, p, p) } obj <- Objective(aa=aa, x=x, y=y, lam.l1=lam.l1, lam.l2=lam.l2, xnum=xnum, zz=zz, strong=TRUE, sym.eps=sym.eps, trace = trace-1) ll <- NULL for (i in seq(niter)) { if (trace > 0) cat(i, " ") ll <- c(ll, ADMM4.Lagrangian(aa, xnum, zz, y, lam.l1=lam.l1, lam.l2=lam.l2, diagonal=diagonal, rho)) V <- aa$u - rho * aa$tt gg <- ggdescent.c(x, xnum, zz, y, lam.l1=lam.l1, lam.l2=lam.l2, diagonal=diagonal, rho, V, trace=trace-1, aa=aa, ...) aa$th <- gg$th aa$bp <- gg$bp aa$bn <- gg$bn aa$tt <- (aa$th + t(aa$th)) / 2 + (aa$u + t(aa$u)) / (2 * rho) aa$u <- aa$u + rho * (aa$th - aa$tt) obj <- c(obj, Objective(aa=aa, x=x, y=y, lam.l1=lam.l1, lam.l2=lam.l2, xnum=xnum, zz=zz, strong=TRUE, sym.eps=sym.eps, trace = trace-1)) if (trace > 0) cat(obj[i+1], fill=TRUE) } if (max(abs(aa$th-t(aa$th))) > sym.eps) cat("Attention: th not symmetric within the desired sym.eps. Run ADMM for more iterations. And try increasing rho.") aa$obj <- obj aa$lagr <- ll aa } Objective <- function(aa, x, y, lam.l1, lam.l2, xnum=NULL, zz=NULL, strong=TRUE, sym.eps=1e-3, trace = -1) { # evaluates the NewYal objective at aa. if (strong) { if (max(aa$th-t(aa$th)) > sym.eps) { if (trace != -1){ cat("Theta is not symmetric.", fill=TRUE) } return(Inf) } } if (any(rowSums(abs(aa$th)) > aa$bp + aa$bn + 1e-5)) { cat("hierarchy violated.", fill=TRUE) return(Inf) } if (any(aa$bp < -1e-5)||any(aa$bn < -1e-5)) { cat("Non-negative of bp or bn violated.", fill=TRUE) return(Inf) } if (aa$diagonal == FALSE) if (any(abs(diag(aa$th)) > 1e-8)) { cat("Zero diagonal violated.", fill=TRUE) return(Inf) } if (is.null(zz)) { zz <- as.numeric(compute.interactions.c(x, diagonal=aa$diagonal)) } if (is.null(xnum)) xnum <- as.numeric(x) r <- y - Compute.yhat.c(xnum, zz, aa) pen <- lam.l1 * sum(aa$bp + aa$bn) + lam.l1 * sum(abs(aa$th))/2 + lam.l1 * sum(abs(diag(aa$th)))/2 pen <- pen + lam.l2 * (sum(aa$bp^2) + sum(aa$bn^2) + sum(aa$th^2)) sum(r^2)/2 + pen } Objective.logistic <- function(aa, x, y, lam.l1, lam.l2, xnum=NULL, zz=NULL, strong=TRUE, sym.eps=1e-3, trace = -1) { # evaluates the logistic hiernet objective at aa. stopifnot(y %in% c(0,1)) stopifnot("diagonal" %in% names(aa)) if (aa$diagonal == FALSE) if (any(abs(diag(aa$th)) > 1e-8)) { cat("Diagonal of Theta is nonzero.", fill=TRUE) return(Inf) } if (strong) { if (max(aa$th-t(aa$th)) > sym.eps) { if (trace != -1){ cat("Theta is not symmetric.", fill=TRUE) } return(Inf) } } if (any(rowSums(abs(aa$th)) > aa$bp + aa$bn + 1e-5)) { cat("hierarchy violated.", fill=TRUE) return(Inf) } if (any(aa$bp < -1e5)||any(aa$bn < -1e5)) { cat("Non-negative of bp or bn violated.", fill=TRUE) return(Inf) } if (is.null(zz)) { zz <- as.numeric(scale(compute.interactions.c(x, diagonal=aa$diagonal), center=TRUE, scale=FALSE)) } if (is.matrix(zz)) zz <- as.numeric(zz) if (is.null(xnum)) xnum <- as.numeric(x) phat <- Compute.phat.c(xnum, zz, aa) loss <- -sum(y*log(phat)) - sum((1-y)*log(1-phat)) pen <- lam.l1 * sum(aa$bp + aa$bn) + lam.l1 * sum(abs(aa$th))/2 + lam.l1 * sum(abs(diag(aa$th)))/2 pen <- pen + lam.l2 * (sum(aa$bp^2) + sum(aa$bn^2) + sum(aa$th^2)) loss + pen } compute.interactions.c <- function(x, diagonal=TRUE) { # Returns (uncentered) n by cp2 matrix of interactions. # The columns of zz are in standard order (11), 12,13,14,...,(22),23,... # z's (jk)th column is x_j * x_k n <- nrow(x) p <- ncol(x) cp2 <- p * (p - 1) / 2 if (diagonal) { cp2 <- cp2 + p out <- .C("ComputeInteractionsWithDiagWithIndices", as.double(x), as.integer(n), as.integer(p), z=rep(0, n * cp2), i1=as.integer(rep(0, cp2)), i2=as.integer(rep(0, cp2)), PACKAGE="hierNet") } else { out <- .C("ComputeInteractionsWithIndices", as.double(x), as.integer(n), as.integer(p), z=rep(0, n * cp2), i1=as.integer(rep(0, cp2)), i2=as.integer(rep(0, cp2)), PACKAGE="hierNet") } z <- matrix(out$z, n, cp2) rownames(z) <- rownames(x) if (is.null(colnames(x))) { colnames(z) <- paste(out$i1, out$i2, sep=":") } else { colnames(z) <- paste(colnames(x)[out$i1], colnames(x)[out$i2], sep=":") } z } compute.full.interactions.c <- function(x) { # Returns (uncentered) n by p^2 matrix of interactions. # The columns of zz are in standard order 11,12,13,14,...,23,... # z's (jk)th column is x_j * x_k n <- nrow(x) p <- ncol(x) out <- .C("ComputeFullInteractions", as.double(x), as.integer(n), as.integer(p), z=rep(0, n * p^2), PACKAGE="hierNet") matrix(out$z, n, p^2) } Compute.yhat.c <- function(xnum, zz, aa) { # aa: list containing bp, bn, th, diagonal # note: zz is the n by cp2 matrix, whereas z is the n by p^2 one. p <- length(aa$bp) n <- length(xnum) / p stopifnot(n==round(n)) stopifnot("diagonal" %in% names(aa)) if (aa$diagonal) stopifnot(length(zz) == n * (choose(p,2) + p)) else stopifnot(length(zz) == n * choose(p,2)) out <- .C("compute_yhat_zz_R", xnum, as.integer(n), as.integer(p), zz, as.integer(aa$diagonal), as.double(aa$th), aa$bp, aa$bn, yhat=rep(0, n), PACKAGE="hierNet") out$yhat } Compute.phat.c <- function(xnum, zz, aa) { # aa: list containing b0, bp, bn, th # note: zz is the n by cp2 matrix, whereas z is the n by p^2 one. stopifnot(c("b0","bp","bn","th","diagonal") %in% names(aa)) p <- length(aa$bp) n <- length(xnum) / p if (is.matrix(xnum)) xnum <- as.numeric(xnum) stopifnot(n == round(n)) if (aa$diagonal) stopifnot(length(zz) == n * (choose(p,2) + p)) else stopifnot(length(zz) == n * choose(p,2)) #void compute_phat_zz_R(double *x, int *n, int *p, double *zz, int *diagonal, # double *b0, double *th, double *bp, double *bn, double *phat) { out <- .C("compute_phat_zz_R", xnum, as.integer(n), as.integer(p), zz, as.integer(aa$diagonal), as.double(aa$b0), as.double(aa$th), aa$bp, aa$bn, phat=rep(0, n), PACKAGE="hierNet") out$phat } ggdescent.c <- function(x, xnum, zz, y, lam.l1, lam.l2, diagonal, rho, V, stepsize, backtrack=0.2, maxiter=100, tol=1e-5, aa=NULL, trace=1) { # See ADMM4 pdf for the problem this solves. # # x, xnum, zz, y: data (note: zz is a length n*cp2 vector, not a matrix) xnum is x as a vector # lam.l1: l1-penalty parameter # lam.l2: l2-penalty parameter # rho: admm parameter # V: see ADMM4 pdf # stepsize: step size to start backtracking with # backtrack: factor by which step is reduced on each backtrack. # maxiter: number of generalized gradient steps to take. # tol: stop gg descent if change in objective is below tol. # aa: initial estimate of (th, bp, bn) # trace: how verbose to be # # void ggdescent_R(double *x, int *n, int *p, double *zz, int *diagonal, double *y, # double *lamL1, double*lamL2, double *rho, double *V, int *maxiter, # double *curth, double *curbp, double *curbn, # double *t, int *stepwindow, double *backtrack, double *tol, int *trace, # double *th, double *bp, double *bn) { n <- length(y) p <- ncol(x) stepwindow <- 10 if (is.null(aa)) aa <- list(th=matrix(0,p,p), bp=rep(0,p), bn=rep(0,p)) out <- .C("ggdescent_R", xnum, as.integer(n), as.integer(p), zz, as.integer(diagonal), y, as.double(lam.l1), as.double(lam.l2), as.double(rho), as.double(V), as.integer(maxiter), as.double(aa$th), aa$bp, aa$bn, stepsize, as.integer(stepwindow), backtrack, tol, as.integer(trace), th=rep(0, p*p), bp=rep(0, p), bn=rep(0, p), PACKAGE="hierNet") list(bp=out$bp, bn=out$bn, th=matrix(out$th, p, p)) } hierNet.logistic <- function(x, y, lam, delta=1e-8, diagonal=TRUE, strong=FALSE, aa=NULL, zz=NULL, center=TRUE, stand.main=TRUE, stand.int=FALSE, rho=nrow(x), niter=100, sym.eps=1e-3,# ADMM params step=1, maxiter=2000, backtrack=0.2, tol=1e-5, # GG descent params trace=1) { # Solves the logistic regression hiernet. Returns (b0, bp, bn, th) this.call <- match.call() n <- nrow(x) p <- ncol(x) stopifnot(y %in% c(0,1)) stopifnot(length(y) == n, lam >= 0, delta >= 0, delta <= 1) stopifnot(!is.null(step) && !is.null(maxiter)) stopifnot(class(lam) == "numeric") stopifnot(class(delta) == "numeric") stopifnot(class(step) == "numeric", step > 0, maxiter > 0) stopifnot(is.finite(x), is.finite(y), is.finite(lam), is.finite(delta)) lam.l1 <- lam * (1 - delta) lam.l2 <- lam * delta if (!center) cat("WARNING: center=FALSE should almost never be used. This option is available for special uses only.", fill = TRUE) x <- scale(x, center = center, scale = stand.main) mx <- attr(x, "scaled:center") sx <- attr(x, "scaled:scale") if (is.null(aa)) aa <- list(b0=0, bp=rep(0, p), bn=rep(0, p), th=matrix(0, p, p), diagonal=diagonal) if (is.null(zz)) { if (trace > 0) cat("Computing zz...", fill=TRUE) zz <- compute.interactions.c(x, diagonal=diagonal) } if (is.matrix(zz)) { zz <- scale(zz, center=center, scale=stand.int) mzz <- attr(zz, "scaled:center") szz <- attr(zz, "scaled:scale") zz <- as.numeric(zz) } else { mzz <- szz <- NULL #cat("Provided zz is not a matrix, so it's assumed to be already centered.", fill = TRUE) } xnum <- as.numeric(x) if (strong) { # strong hierarchy -- use ADMM4 (logistic regression version) stopifnot(is.numeric(rho), is.finite(rho)) out <- admm4.logistic(x, xnum, y, lam.l1, lam.l2, diagonal=diagonal, zz=zz, rho=rho, niter=niter, aa=aa, sym.eps=sym.eps, # ADMM params stepsize=step, backtrack=backtrack, maxiter=maxiter, tol=tol, # GG params trace=trace) ii <- out$bp + out$bn == 0 # note out$th[ii, ] = 0 since weak hierarchy holds for sure sumii <- sum(ii) if (sumii > 0 && sumii < p) { thr <- max(abs(out$th[!ii, ii])) if (thr > 0) { cat(" thr = ",thr, fill=TRUE) if (thr > 1e-3) warning("Had to change ADMM's 'th' by more than 0.001 to make strong hier hold! Increase niter (and/or rho). ") aa$th[abs(aa$th) <= thr] <- 0 } } } else { out <- ggdescent.logistic(xnum=xnum, zz=zz, y=y, lam.l1=lam.l1, lam.l2=lam.l2, diagonal=diagonal, rho=0, V=matrix(0,p,p), stepsize=step, backtrack=backtrack, maxiter=maxiter, tol=tol, aa=aa, trace=trace) } out$call <- this.call out$lam <- lam out$delta <- delta out$type <- "logistic" out$diagonal <- diagonal out$strong <- strong if (strong) { # ADMM parameters: out$rho <- rho out$niter <- niter out$sym.eps <- sym.eps } out$step <- step out$maxiter <- maxiter out$backtrack <- backtrack out$tol <- tol out$obj <- critf.logistic(x, y, lam.l1, lam.l2, out$b0, out$bp, out$bn, out$th) out$mx <- mx out$my <- 0 out$sx <- sx out$mzz <- mzz class(out) <- "hierNet" return(out) } admm4.logistic <- function(x, xnum, y, lam.l1, lam.l2, diagonal, zz=NULL, rho=10, niter, aa=NULL, sym.eps=1e-3, trace=1, ...) { # Performs ADMM4 for logistic loss. # Note: xnum is the matrix x as a numeric. Both are passed to avoid having to call as.numeric too # many times. p <- ncol(x) if (is.null(zz)) { if (trace > 0) cat("Computing zz...", fill=TRUE) zz <- as.numeric(compute.interactions.c(x, diagonal=diagonal)) } else if ("matrix" %in% class(zz)) zz <- as.numeric(zz) if (is.null(aa)) { aa <- list(u=matrix(0, p, p), th=matrix(0, p, p), bp=rep(0, p), bn=rep(0, p), tt=matrix(0, p, p), diagonal=diagonal) } if (is.null(aa$tt) || is.null(aa$u)) { aa$tt <- 0.5 * (aa$th + t(aa$th)) aa$u <- matrix(0, p, p) } obj <- Objective.logistic(aa=aa, x=x, y=y, lam.l1=lam.l1, lam.l2=lam.l2, xnum=xnum, zz=zz, strong=TRUE, sym.eps=sym.eps, trace = trace-1) for (i in seq(niter)) { if (trace > 0) cat(i, " ") V <- aa$u - rho * aa$tt gg <- ggdescent.logistic(xnum, zz, y, lam.l1=lam.l1, lam.l2=lam.l2, diagonal=diagonal, rho, V, trace=trace-1, aa=aa, ...) aa$th <- gg$th aa$bp <- gg$bp aa$bn <- gg$bn aa$tt <- (aa$th + t(aa$th)) / 2 + (aa$u + t(aa$u)) / (2 * rho) aa$u <- aa$u + rho * (aa$th - aa$tt) obj <- c(obj, Objective.logistic(aa=aa, x=x, y=y, lam.l1=lam.l1, lam.l2=lam.l2, xnum=xnum, zz=zz, strong=TRUE, sym.eps=sym.eps, trace = trace-1)) if (trace > 0) cat(obj[i+1], fill=TRUE) } if (max(abs(aa$th-t(aa$th))) > sym.eps) cat("Attention: th not symmetric within the desired sym.eps. Run ADMM for more iterations. And try increasing rho.") aa$obj <- obj aa } ggdescent.logistic <- function(xnum, zz, y, lam.l1, lam.l2, diagonal, rho, V, stepsize, backtrack=0.2, maxiter=100, tol=1e-5, aa=NULL, trace=1) { # See ADMM4 pdf and logistic.pdf for the problem this solves. # # xnum, zz, y: data (note: zz is a length n*cp2 vector, not a matrix) xnum is x as a (n*p)-vector # lam.l1: l1-penalty parameter # lam.l2: l2-penalty parameter # rho: admm parameter # V: see ADMM4 pdf # stepsize: step size to start backtracking with # backtrack: factor by which step is reduced on each backtrack. # maxiter: number of generalized gradient steps to take. # tol: stop gg descent if change in objective is below tol. # aa: initial estimate of (b0, th, bp, bn) # trace: how verbose to be # #void ggdescent_logistic_R(double *x, int *n, int *p, double *zz, int * diagonal, double *y, # double *lamL1, double *lamL2, double *rho, double *V, int *maxiter, # double *curb0, double *curth, double *curbp, double *curbn, # double *t, int *stepwindow, double *backtrack, double *tol, int *trace, # double *b0, double *th, double *bp, double *bn) { n <- length(y) p <- length(xnum) / n stopifnot(p == round(p)) if (diagonal) stopifnot(length(zz) == n * (choose(p,2)+p)) else stopifnot(length(zz) == n * choose(p,2)) stepwindow <- 10 if (is.null(aa)) aa <- list(b0=0, th=matrix(0,p,p), bp=rep(0,p), bn=rep(0,p)) out <- .C("ggdescent_logistic_R", xnum, as.integer(n), as.integer(p), zz, as.integer(diagonal), as.double(y), # convert from integer to double as.double(lam.l1), as.double(lam.l2), as.double(rho), as.double(V), as.integer(maxiter), as.double(aa$b0), as.double(aa$th), aa$bp, aa$bn, as.double(stepsize), as.integer(stepwindow), as.double(backtrack), as.double(tol), as.integer(trace), b0=as.double(0), th=rep(0, p*p), bp=rep(0, p), bn=rep(0, p), PACKAGE="hierNet") list(b0=out$b0, bp=out$bp, bn=out$bn, th=matrix(out$th, p, p)) } ADMM4.Lagrangian <- function(aa, xnum, zz, y, lam.l1, lam.l2, diagonal, rho) { # aa: list with (th, bp, bn, tt, u) # zz is a vector not a matrix if (aa$diagonal == FALSE) if (any(abs(diag(aa$th)) > 1e-8)) { cat("Diagonal of Theta is nonzero.", fill=TRUE) return(Inf) } if (max(aa$tt-t(aa$tt)) > 1e-8) { cat("Theta is not symmetrik.", fill=TRUE) return(Inf) } if (any(rowSums(abs(aa$th)) > aa$bp + aa$bn + 1e-5)) { cat("hierarchy violated.", fill=TRUE) return(Inf) } if (any(aa$bp < -1e-5)||any(aa$bn < -1e-5)) { cat("Non-negative of bp or bn violated.", fill=TRUE) return(Inf) } if (diagonal == FALSE) if (any(abs(diag(aa$th)) > 1e-5)) { cat("Zero diagonal violated.", fill=TRUE) return(Inf) } V <- aa$u - rho * aa$tt r <- y - Compute.yhat.c(xnum, zz, aa) admm <- sum(aa$u*(aa$th-aa$tt)) + (rho/2) * sum((aa$th-aa$tt)^2) #admm <- sum(V*aa$th) + (rho/2) * sum(aa$th^2) + (rho/2)*sum(aa$tt^2) - sum(aa$u*aa$tt) pen <- lam.l1 * (sum(aa$bp + aa$bn) + sum(abs(aa$th))/2) pen <- pen + lam.l2 * (sum(aa$bp^2) + sum(aa$bn^2) + sum(aa$th^2)) sum(r^2)/2 + pen + admm } predict.hierNet.logistic <- function(object, newx, newzz=NULL, ...) { predict.hierNet(object, newx, newzz, ...) } critf.logistic <- function(x, y, lam.l1, lam.l2, b0, bp, bn, th) { yhat <- b0 + x %*% (bp - bn) + 0.5 * diag(x %*% th %*% t(x)) p <- 1 / (1 + exp(-yhat)) val <- -sum(y * log(p) + (1 - y) * log(1 - p)) val <- val + lam.l1 * sum(bp + bn) + lam.l1 * sum(abs(th))/2 + lam.l1 * sum(abs(diag(th)))/2 val <- val + lam.l2 * (sum(bp^2) + sum(bn^2) + sum(th^2)) return(val) } twonorm <- function(x) {sqrt(sum(x * x))} hierNet.logistic.path <- function (x, y, lamlist=NULL, delta=1e-8, minlam=NULL, maxlam=NULL, flmin=.01, nlam=20, diagonal=TRUE, strong=FALSE, aa=NULL, zz=NULL, stand.main=TRUE, stand.int=FALSE, rho=nrow(x), niter=100, sym.eps=1e-3,# ADMM params step=1, maxiter=2000, backtrack=0.2, tol=1e-5, # GG params trace=0) { this.call=match.call() stopifnot(y %in% c(0, 1)) x <- scale(x, center=TRUE, scale=stand.main) mx <- attr(x, "scaled:center") sx <- attr(x, "scaled:scale") if (is.null(maxlam)) { if (!is.null(minlam)) stop("Cannot have maxlam=NULL if minlam is non-null.") maxlam <- max(abs(t(x) %*% y)) minlam <- maxlam * flmin } if (is.null(minlam)) minlam <- maxlam * flmin if (is.null(lamlist)) lamlist <- exp(seq(log(maxlam), log(minlam), length=nlam)) nlam <- length(lamlist) if (is.null(zz)) zz <- compute.interactions.c(x, diagonal=diagonal) else stopifnot(is.matrix(zz)) zz <- scale(zz, center=TRUE, scale=stand.int) mzz <- attr(zz, "scaled:center") szz <- attr(zz, "scaled:scale") zz <- as.numeric(zz) p <- ncol(x) cp2 <- choose(p, 2) b0 <- rep(NA, nlam) bp <- bn <- matrix(NA, nrow=p, ncol=nlam) th <- array(NA, c(p, p, nlam)) obj <- rep(NA, nlam) aa <- NULL for (i in seq(nlam)) { if (trace != 0) { cat(c("i,lam=", i, round(lamlist[i],2)), fill=TRUE) } aa <- hierNet.logistic(x, y, lam=lamlist[i], delta=delta, diagonal=diagonal, strong=strong, aa=aa, zz=zz, stand.main=FALSE, stand.int=FALSE, rho=rho, niter=niter, sym.eps=sym.eps, step=step, maxiter=maxiter, backtrack=backtrack, tol=tol, trace=trace) b0[i] <- aa$b0 bp[, i] <- aa$bp bn[, i] <- aa$bn th[, , i] <- aa$th obj[i] <- aa$obj } dimnames(bp) <- dimnames(bn) <- list(as.character(1:p), NULL) dimnames(th) <- list(as.character(1:p), as.character(1:p), NULL) out <- list(b0=b0, bp=bp, bn=bn, th=th, obj=obj, lamlist=lamlist, delta=delta, mx=mx, my=0, sx=sx, mzz=mzz, szz=szz, type="logistic", diagonal=diagonal, strong=strong, step=step, maxiter=maxiter, backtrack=backtrack, tol=tol, call=this.call) if (strong) { # ADMM parameters: out$rho <- aa$rho out$niter <- niter out$sym.eps <- sym.eps } class(out) <- "hierNet.path" out } balanced.folds <- function(y, nfolds=min(min(table(y)), 10)) { totals <- table(y) fmax <- max(totals) nfolds <- min(nfolds, fmax) # makes no sense to have more folds than the max class size folds <- as.list(seq(nfolds)) yids <- split(seq(y), y) # nice we to get the ids in a list, split by class ###Make a big matrix, with enough rows to get in all the folds per class bigmat <- matrix(NA, ceiling(fmax/nfolds) * nfolds, length(totals)) for(i in seq(totals)) { bigmat[seq(totals[i]), i] <- sample(yids[[i]]) } smallmat <- matrix(bigmat, nrow = nfolds) # reshape the matrix ### Now do a clever sort to mix up the NAs smallmat <- permute.rows(t(smallmat)) ### Now a clever unlisting # the "clever" unlist doesn't work when there are no N # apply(smallmat, 2, function(x) # x[!is.na(x)]) res <-vector("list", nfolds) for(j in 1:nfolds) { jj <- !is.na(smallmat[, j]) res[[j]] <- smallmat[jj, j] } return(res) } permute.rows <-function(x) { dd <- dim(x) n <- dd[1] p <- dd[2] mm <- runif(length(x)) + rep(seq(n) * 10, rep(p, n)) matrix(t(x)[order(mm)], n, p, byrow = TRUE) } hierNet.cv <- function(fit, x, y, nfolds=10, folds=NULL, trace=0) { this.call <- match.call() stopifnot(class(fit) == "hierNet.path") if(fit$type=="gaussian"){errfun=function(y,yhat){(y-yhat)^2}} if(fit$type=="logistic"){errfun=function(y,yhat){1*(y!=yhat)}} n <- length(y) if(is.null(folds)) { folds <- split(sample(1:n), rep(1:nfolds, length = n)) } else { stopifnot(class(folds)=="list") nfolds <- length(folds) } lamlist=fit$lamlist # get whether fit was standardized based on fit$sx and fit$szz... if (is.null(fit$mx)) stop("hierNet object was not centered. hierNet.cv has not been written for this (unusual) case.") stand.main <- !is.null(fit$sx) stand.int <- !is.null(fit$szz) n.lamlist <- length(lamlist) ### Set up the data structures size <- double(n.lamlist) err2=matrix(NA,nrow=nfolds,ncol=length(lamlist)) for(ii in 1:nfolds) { cat("Fold", ii, ":") if(fit$type=="gaussian"){ a <- hierNet.path(x[-folds[[ii]],],y=y[-folds[[ii]]], lamlist=lamlist, delta=fit$delta, diagonal=fit$diagonal, strong=fit$strong, trace=trace, stand.main=stand.main, stand.int=stand.int, rho=fit$rho, niter=fit$niter, sym.eps=fit$sym.eps, # ADMM parameters (which will be NULL if strong=F) step=fit$step, maxiter=fit$maxiter, backtrack=fit$backtrack, tol=fit$tol) # GG descent params yhatt=predict.hierNet(a,newx=x[folds[[ii]],]) } if(fit$type=="logistic"){ a <- hierNet.logistic.path(x[-folds[[ii]],],y=y[-folds[[ii]]], lamlist=lamlist, delta=fit$delta, diagonal=fit$diagonal, strong=fit$strong, trace=trace, stand.main=stand.main, stand.int=stand.int, rho=fit$rho, niter=fit$niter, sym.eps=fit$sym.eps, # ADMM parameters (which will be NULL if strong=F) step=fit$step, maxiter=fit$maxiter, backtrack=fit$backtrack, tol=fit$tol) # GG descent params yhatt=predict.hierNet.logistic(a,newx=x[folds[[ii]],])$yhat } temp=matrix(y[folds[[ii]]],nrow=length(folds[[ii]]),ncol=n.lamlist) err2[ii,]=colMeans(errfun(yhatt,temp)) cat("\n") } errm=colMeans(err2) errse=sqrt(apply(err2,2,var)/nfolds) o=which.min(errm) lamhat=lamlist[o] oo=errm<= errm[o]+errse[o] lamhat.1se=lamlist[oo & lamlist>=lamhat][1] nonzero=colSums(fit$bp-fit$bn!=0) + apply(fit$th!=0, 3, function(a) sum(diag(a)) + sum((a+t(a)!=0)[upper.tri(a)])) obj <- list(lamlist=lamlist, cv.err=errm,cv.se=errse,lamhat=lamhat, lamhat.1se=lamhat.1se, nonzero=nonzero, folds=folds, call = this.call) class(obj) <- "hierNet.cv" obj } plot.hierNet.cv <- function(x, ...) { par(mar = c(5, 5, 5, 1)) yrang=range(c(x$cv.err-x$cv.se,x$cv.err+x$cv.se)) plot(log(x$lamlist), x$cv.err, xlab="log(lambda)", ylab = "Cross-validation Error", type="n",ylim=yrang) axis(3, at = log(x$lamlist), labels = paste(x$nonzero), srt = 90, adj = 0) mtext("Number of features", 3, 4, cex = 1.2) axis(2, at = c(0, 0.2, 0.4, 0.6, 0.8)) error.bars(log(x$lamlist), x$cv.err - x$cv.se, x$cv.err + x$cv.se, width = 0.01, col = "darkgrey") points(log(x$lamlist), x$cv.err, col=2, pch=19) abline(v=log(x$lamhat), lty=3) abline(v=log(x$lamhat.1se), lty=3) invisible() } error.bars <-function(x, upper, lower, width = 0.02, ...) { xlim <- range(x) barw <- diff(xlim) * width segments(x, upper, x, lower, ...) segments(x - barw, upper, x + barw, upper, ...) segments(x - barw, lower, x + barw, lower, ...) range(upper, lower) } hierNet.varimp <- function(fit,x,y, ...) { # NOTE: uses 0.5 cutoff for logistic case lam=fit$lam if(fit$type=="gaussian"){errfun=function(y,yhat){(y-yhat)^2}} if(fit$type=="logistic"){ errfun=function(y,yhat){ term1=y*log(yhat);term1[yhat==0]=0 term2=(1-y)*log(1-yhat);term2[yhat==1]=0 val=-sum(term1+term2) return(val) }} yhat=predict(fit,x) rss=sum(errfun(y,yhat)) varsum=fit$bp-fit$bn+rowSums(abs(fit$th)) oo=which(abs(varsum)>1e-6) imp=rss2=rep(NA,ncol(x)) for(j in oo){ cat(j) fit0=fit;fit0$bp=fit$bp[-j];fit0$bn=fit$bn[-j];fit0$th=fit$th[-j,-j] if(fit$type=="gaussian"){ fit2=hierNet(x[,-j],y,lam,delta=fit$delta,diagonal=fit$diagonal,aa=fit0)} if(fit$type=="logistic"){ fit2=hierNet.logistic(x[,-j],y,lam,delta=fit$delta,diagonal=fit$diagonal,aa=fit0)} yhat2=predict(fit2,x[,-j]) rss2[j]=sum(errfun(y,yhat2)) imp[j]=(rss2[j]-rss)/rss2[j] } imp[-oo]=0 res=cbind(1:ncol(x),round(imp,3)) ooo=order(-imp) dimnames(res)=list(NULL,c("Predictor","Importance")) cat("",fill=T) return(res[ooo,]) }
/R/funcs.R
no_license
prischen/hierNet
R
false
false
37,504
r
hierNet <- function(x, y, lam, delta=1e-8, strong=FALSE, diagonal=TRUE, aa=NULL, zz=NULL, center=TRUE, stand.main=TRUE, stand.int=FALSE, rho=nrow(x), niter=100, sym.eps=1e-3, step=1, maxiter=2000, backtrack=0.2, tol=1e-5, trace=0) { # Main Hiernet function for fitting at a single parameter lambda. # Note: L1 penalty terms have parameter lam.l1 = lambda * (1-delta) # and L2 penalty has parameter lam.l2 = lambda * delta. # # stand.main and stand.int refer to scaling stopifnot(nrow(x) == length(y), lam >= 0, delta >= 0, delta <= 1) stopifnot(!is.null(step) && !is.null(maxiter)) if (strong) stopifnot(!is.null(niter)) stopifnot(class(y) == "numeric") stopifnot(class(lam) == "numeric") stopifnot(class(delta) == "numeric") stopifnot(class(step) == "numeric", step > 0, maxiter > 0) stopifnot(is.finite(x), is.finite(y), is.finite(lam), is.finite(delta)) this.call <- match.call() if (!center) cat("WARNING: center=FALSE should almost never be used. This option is available for special uses only.", fill=TRUE) # center and (maybe) scale variables x <- scale(x, center=center, scale=stand.main) mx <- attr(x, "scaled:center") sx <- attr(x, "scaled:scale") # may be NULL if (center) { my <- mean(y) y <- y - my } else my <- NULL if (is.null(zz)) { if (trace > 0) cat("Computing zz...", fill=TRUE) zz <- compute.interactions.c(x, diagonal=diagonal) } if (is.matrix(zz)) { zz <- scale(zz, center=center, scale=stand.int) mzz <- attr(zz, "scaled:center") szz <- attr(zz, "scaled:scale") # may be NULL zz <- as.numeric(zz) } else { mzz <- szz <- NULL #cat("Provided zz is not a matrix, so it's assumed to be already centered.", fill=TRUE) } xnum <- as.numeric(x) p <- ncol(x) lam.l1 <- lam * (1 - delta) lam.l2 <- lam * delta if (strong) { # strong hierarchy -- use ADMM4 if (is.null(rho)) rho <- as.numeric(nrow(x)) stopifnot(is.numeric(rho), is.finite(rho)) aa <- admm4(x, xnum, y, lam.l1=lam.l1, lam.l2=lam.l2, diagonal=diagonal, zz=zz, rho=rho, niter=niter, aa=aa, sym.eps=sym.eps, # ADMM params stepsize=step, backtrack=backtrack, maxiter=maxiter, tol=tol, # GG params trace=trace) # lack of symmetry in theta means that sometimes strong hierarchy will be (very slightly violated) ii <- aa$bp + aa$bn == 0 # note aa$th[ii, ] = 0 since weak hierarchy holds for sure if (sum(ii) > 0 & sum(ii) < p) { thr <- max(abs(aa$th[!ii, ii])) if (thr > 0) { cat(" thr = ",thr, fill=TRUE) if (thr > 1e-3) warning("Had to change ADMM's 'th' by more than 0.001 to make strong hier hold! Increase niter (and/or rho). ") aa$th[abs(aa$th) <= thr] <- 0 } } } else { # weak hierarchy -- a single call to generalized gradient descent if (is.null(aa)) { aa <- list(th=matrix(0, p, p), bp=rep(0, p), bn=rep(0, p)) } else { stopifnot(dim(aa$th) == c(p,p), length(aa$bp) == p, length(aa$bn) == p) } # this could be improved by not actually creating V... V <- matrix(0, p, p) rho <- 0 aa <- ggdescent.c(x=x, xnum=xnum, zz=zz, y=y, lam.l1=lam.l1, lam.l2=lam.l2, diagonal=diagonal, rho=rho, V=V, stepsize=step, backtrack=backtrack, maxiter=maxiter, tol=tol, aa=aa, trace=trace) } aa$lam <- lam aa$delta <- delta aa$type <- "gaussian" aa$diagonal <- diagonal aa$strong <- strong aa$obj <- Objective(aa=aa, x=x, y=y, lam.l1=lam.l1, lam.l2=lam.l2, xnum=xnum, zz=zz, strong=strong, trace = trace-1) aa$step <- step aa$maxiter <- maxiter aa$backtrack <- backtrack aa$tol <- tol if (strong) { # ADMM parameters: aa$rho <- rho aa$niter <- niter aa$sym.eps <- sym.eps } aa$mx <- mx aa$sx <- sx aa$my <- my aa$mzz <- mzz aa$szz <- szz aa$call <- this.call class(aa) <- "hierNet" return(aa) } print.hierNet <- function(x, ...) { cat("Call:\n") dput(x$call) th=(x$th+t(x$th))/2 o2=colSums(th^2)!=0 b=x$bp-x$bn o=b!=0 b=b[o] if (any(o2)) { # model has interactions th=th[o,o2,drop=FALSE] tight <- rowSums(abs(th)) >= x$bp[o] + x$bn[o] - 1e-9 tt <- rep("", length(tight)) tt[tight] <- "*" mat=cbind(b,th) mat=round(mat,4) mat <- cbind(mat, tt) cat("\n") cat("Non-zero coefficients:",fill=T) cat(" (Rows are predictors with nonzero main effects)",fill=T) cat(" (1st column is main effect)", fill=T) cat(" (Next columns are nonzero interactions of row predictor)", fill=T) cat(" (Last column indicates whether hierarchy constraint is tight.)",fill=T) cat("\n") dimnames(mat)=list(as.character(which(o)),c("Main effect",as.character(which(o2)),"Tight?")) print(mat, quote = FALSE) } else { mat <- matrix(round(b,4), length(b), 1) cat("\n") cat("Non-zero coefficients:",fill=T) cat(" (No interactions in this model)",fill=T) cat("\n") dimnames(mat)=list(as.character(which(o)),"Main effect") print(mat, quote = FALSE) } invisible() } print.hierNet.path <- function(x, ...) { cat("Call:\n") dput(x$call) b=x$bp-x$bn mat=cbind(round(x$lam,2),round(x$obj,2),colSums(b!=0),apply(x$th!=0,3,function(a) sum(diag(a)) + sum((a+t(a)!=0)[upper.tri(a)]))) dimnames(mat)=list(NULL,c("Lambda", "Objective", "Number of main effects","Number of interactions")) cat("\n") print(mat, quote = FALSE) invisible() } print.hierNet.cv <- function(x, ...) { cat("Call:\n") dput(x$call) mat=cbind(round(x$lamlist,2),x$nonzero,round(x$cv.err,2),round(x$cv.se,2)) dimnames(mat)=list(NULL,c("Lambda", "Number of nonzero","Mean CV error", "SE")) cat("\n") print(mat, quote = FALSE) cat("\n") cat(c("lamhat=",round(x$lamhat,2),"lamhat.1se=",round(x$lamhat.1se,2)),fill=T) invisible() } hierNet.path <- function(x, y, lamlist=NULL, delta=1e-8, minlam=NULL, maxlam=NULL, nlam=20, flmin=.01, diagonal=TRUE, strong=FALSE, aa=NULL, zz=NULL, stand.main=TRUE, stand.int=FALSE, rho=nrow(x), niter=100, sym.eps=1e-3,# ADMM params step=1, maxiter=2000, backtrack=0.2, tol=1e-5, # GG descent params trace=0) { # Main Hiernet function for fitting at a sequence of lambda values. # Note: L1 penalty terms have parameter lam.l1 = lambda * (1-delta) # and L2 penalty has parameter lam.l2 = lambda * delta. # # Always centers both x and zz (unless zz is provided in as.numeric form) # stand.main and stand.int refer to whether main effects and interactions should have norm sqrt(n-1) # center and (maybe) scale variables this.call <- match.call() x <- scale(x, center=TRUE, scale=stand.main) mx <- attr(x, "scaled:center") sx <- attr(x, "scaled:scale") # may be NULL my <- mean(y) y <- y - my if (is.null(maxlam)) { if (!is.null(minlam)) stop("Cannot have maxlam=NULL if minlam is non-null.") # maxlam <- max(abs(t(x) %*% y)/colSums(x^2)) maxlam <- max(abs(t(x) %*% y)) # temp <- t(scale(t(x), center=FALSE, scale=1/y)) # temp2 <- apply(temp, 2, twonorm) # maxlam <- max(max(temp2), maxlam) minlam <- maxlam * flmin } if (is.null(minlam)) minlam <- maxlam * flmin if (is.null(lamlist)) lamlist <- exp(seq(log(maxlam),log(minlam),length=nlam)) nlam <- length(lamlist) if (is.null(zz)) zz <- compute.interactions.c(x, diagonal=diagonal) else stopifnot(is.matrix(zz)) # center and (maybe) scale zz zz <- scale(zz, center=TRUE, scale=stand.int) mzz <- attr(zz, "scaled:center") szz <- attr(zz, "scaled:scale") # may be NULL zz <- as.numeric(zz) p <- ncol(x) cp2 <- choose(p, 2) bp <- bn <- matrix(NA, nrow=p, ncol=nlam) th <- array(NA, c(p, p, nlam)) obj <- rep(NA, nlam) aa <- NULL for (i in seq(nlam)) { if (trace != 0) { cat(c("i,lam=", i, round(lamlist[i],2)), fill=TRUE) } aa <- hierNet(x, y, lam=lamlist[i], delta=delta, strong=strong, diagonal=diagonal, aa=aa, zz=zz, stand.main=FALSE, stand.int=FALSE, # have already standardized rho=rho, niter=niter, sym.eps=sym.eps, step=step, maxiter=maxiter, backtrack=backtrack, tol=tol, trace=trace) bp[, i] <- aa$bp bn[, i] <- aa$bn th[, , i] <- aa$th obj[i] <- aa$obj } dimnames(bp) <- dimnames(bn) <- list(as.character(1:p), NULL) dimnames(th) <- list(as.character(1:p), as.character(1:p), NULL) out <- list(bp=bp, bn=bn, th=th, obj=obj, lamlist=lamlist, delta=delta, mx=mx, sx=sx, mzz=mzz, szz=szz, my=my, type="gaussian", diagonal=diagonal, strong=strong, step=step, maxiter=maxiter, backtrack=backtrack, tol=tol, call=this.call) if (strong) { # ADMM parameters: out$rho <- rho out$niter <- niter out$sym.eps <- sym.eps } class(out) <- "hierNet.path" out } predict.hierNet <- function(object, newx, newzz=NULL, ...) { n <- nrow(newx) if (is.null(object$sx)) newx <- scale(newx, center=object$mx, scale=FALSE) else newx <- scale(newx, center=object$mx, scale=object$sx) if (is.null(newzz)) newzz <- compute.interactions.c(newx, diagonal=object$diagonal) if (is.null(object$szz)) newzz <- scale(newzz, center=object$mzz, scale=FALSE) else newzz <- scale(newzz, center=object$mzz, scale=object$szz) newzz <- as.numeric(newzz) newx <- as.numeric(newx) stopifnot(is.finite(newzz), is.finite(newx)) if (!("matrix" %in% class(object$bp))) yhatt <- Compute.yhat.c(newx, newzz, object) + object$my else { nlam <- ncol(object$bp) yhat <- matrix(NA, n, nlam) # this could be made more efficient for (i in seq(nlam)) { bb <- list(bp=object$bp[, i], bn=object$bn[, i], th=object$th[, , i], diagonal=object$diagonal) yhat[, i] <- Compute.yhat.c(newx, newzz, bb) } yhatt <- yhat + object$my } if (object$type == "logistic") { # predict from hierNet.logistic object object b0 <- object$b0 if(is.matrix(yhatt)) b0 <- matrix(b0, nrow=nrow(yhatt), ncol=ncol(yhatt), byrow=T) yhatt <- b0 + yhatt pr <- 1 / (1 + exp(-yhatt)) return(list(prob=pr, yhat=1*(pr>.5))) } return(yhatt) } predict.hierNet.path <- function(object, newx, newzz=NULL, ...){ predict.hierNet(object, newx, newzz, ...) } admm4 <- function(x, xnum, y, lam.l1, lam.l2, diagonal, zz=NULL, rho, niter, aa=NULL, sym.eps=1e-3, trace=1, ...) { # Performs ADMM4. # Note: xnum is the matrix x as a numeric. Both are passed to avoid having to call as.numeric too # many times. p <- ncol(x) if (is.null(zz)) { if (trace > 0) cat("Computing zz...", fill=TRUE) zz <- as.numeric(compute.interactions.c(x, diagonal=diagonal)) } else if ("matrix" %in% class(zz)) zz <- as.numeric(zz) if (is.null(aa)) { aa <- list(u=matrix(0, p, p), th=matrix(0, p, p), bp=rep(0, p), bn=rep(0, p), tt=matrix(0, p, p), diagonal=diagonal) } else { stopifnot(diagonal == aa$diagonal) } if (is.null(aa$tt) || is.null(aa$u)) { aa$tt <- 0.5 * (aa$th + t(aa$th)) aa$u <- matrix(0, p, p) } obj <- Objective(aa=aa, x=x, y=y, lam.l1=lam.l1, lam.l2=lam.l2, xnum=xnum, zz=zz, strong=TRUE, sym.eps=sym.eps, trace = trace-1) ll <- NULL for (i in seq(niter)) { if (trace > 0) cat(i, " ") ll <- c(ll, ADMM4.Lagrangian(aa, xnum, zz, y, lam.l1=lam.l1, lam.l2=lam.l2, diagonal=diagonal, rho)) V <- aa$u - rho * aa$tt gg <- ggdescent.c(x, xnum, zz, y, lam.l1=lam.l1, lam.l2=lam.l2, diagonal=diagonal, rho, V, trace=trace-1, aa=aa, ...) aa$th <- gg$th aa$bp <- gg$bp aa$bn <- gg$bn aa$tt <- (aa$th + t(aa$th)) / 2 + (aa$u + t(aa$u)) / (2 * rho) aa$u <- aa$u + rho * (aa$th - aa$tt) obj <- c(obj, Objective(aa=aa, x=x, y=y, lam.l1=lam.l1, lam.l2=lam.l2, xnum=xnum, zz=zz, strong=TRUE, sym.eps=sym.eps, trace = trace-1)) if (trace > 0) cat(obj[i+1], fill=TRUE) } if (max(abs(aa$th-t(aa$th))) > sym.eps) cat("Attention: th not symmetric within the desired sym.eps. Run ADMM for more iterations. And try increasing rho.") aa$obj <- obj aa$lagr <- ll aa } Objective <- function(aa, x, y, lam.l1, lam.l2, xnum=NULL, zz=NULL, strong=TRUE, sym.eps=1e-3, trace = -1) { # evaluates the NewYal objective at aa. if (strong) { if (max(aa$th-t(aa$th)) > sym.eps) { if (trace != -1){ cat("Theta is not symmetric.", fill=TRUE) } return(Inf) } } if (any(rowSums(abs(aa$th)) > aa$bp + aa$bn + 1e-5)) { cat("hierarchy violated.", fill=TRUE) return(Inf) } if (any(aa$bp < -1e-5)||any(aa$bn < -1e-5)) { cat("Non-negative of bp or bn violated.", fill=TRUE) return(Inf) } if (aa$diagonal == FALSE) if (any(abs(diag(aa$th)) > 1e-8)) { cat("Zero diagonal violated.", fill=TRUE) return(Inf) } if (is.null(zz)) { zz <- as.numeric(compute.interactions.c(x, diagonal=aa$diagonal)) } if (is.null(xnum)) xnum <- as.numeric(x) r <- y - Compute.yhat.c(xnum, zz, aa) pen <- lam.l1 * sum(aa$bp + aa$bn) + lam.l1 * sum(abs(aa$th))/2 + lam.l1 * sum(abs(diag(aa$th)))/2 pen <- pen + lam.l2 * (sum(aa$bp^2) + sum(aa$bn^2) + sum(aa$th^2)) sum(r^2)/2 + pen } Objective.logistic <- function(aa, x, y, lam.l1, lam.l2, xnum=NULL, zz=NULL, strong=TRUE, sym.eps=1e-3, trace = -1) { # evaluates the logistic hiernet objective at aa. stopifnot(y %in% c(0,1)) stopifnot("diagonal" %in% names(aa)) if (aa$diagonal == FALSE) if (any(abs(diag(aa$th)) > 1e-8)) { cat("Diagonal of Theta is nonzero.", fill=TRUE) return(Inf) } if (strong) { if (max(aa$th-t(aa$th)) > sym.eps) { if (trace != -1){ cat("Theta is not symmetric.", fill=TRUE) } return(Inf) } } if (any(rowSums(abs(aa$th)) > aa$bp + aa$bn + 1e-5)) { cat("hierarchy violated.", fill=TRUE) return(Inf) } if (any(aa$bp < -1e5)||any(aa$bn < -1e5)) { cat("Non-negative of bp or bn violated.", fill=TRUE) return(Inf) } if (is.null(zz)) { zz <- as.numeric(scale(compute.interactions.c(x, diagonal=aa$diagonal), center=TRUE, scale=FALSE)) } if (is.matrix(zz)) zz <- as.numeric(zz) if (is.null(xnum)) xnum <- as.numeric(x) phat <- Compute.phat.c(xnum, zz, aa) loss <- -sum(y*log(phat)) - sum((1-y)*log(1-phat)) pen <- lam.l1 * sum(aa$bp + aa$bn) + lam.l1 * sum(abs(aa$th))/2 + lam.l1 * sum(abs(diag(aa$th)))/2 pen <- pen + lam.l2 * (sum(aa$bp^2) + sum(aa$bn^2) + sum(aa$th^2)) loss + pen } compute.interactions.c <- function(x, diagonal=TRUE) { # Returns (uncentered) n by cp2 matrix of interactions. # The columns of zz are in standard order (11), 12,13,14,...,(22),23,... # z's (jk)th column is x_j * x_k n <- nrow(x) p <- ncol(x) cp2 <- p * (p - 1) / 2 if (diagonal) { cp2 <- cp2 + p out <- .C("ComputeInteractionsWithDiagWithIndices", as.double(x), as.integer(n), as.integer(p), z=rep(0, n * cp2), i1=as.integer(rep(0, cp2)), i2=as.integer(rep(0, cp2)), PACKAGE="hierNet") } else { out <- .C("ComputeInteractionsWithIndices", as.double(x), as.integer(n), as.integer(p), z=rep(0, n * cp2), i1=as.integer(rep(0, cp2)), i2=as.integer(rep(0, cp2)), PACKAGE="hierNet") } z <- matrix(out$z, n, cp2) rownames(z) <- rownames(x) if (is.null(colnames(x))) { colnames(z) <- paste(out$i1, out$i2, sep=":") } else { colnames(z) <- paste(colnames(x)[out$i1], colnames(x)[out$i2], sep=":") } z } compute.full.interactions.c <- function(x) { # Returns (uncentered) n by p^2 matrix of interactions. # The columns of zz are in standard order 11,12,13,14,...,23,... # z's (jk)th column is x_j * x_k n <- nrow(x) p <- ncol(x) out <- .C("ComputeFullInteractions", as.double(x), as.integer(n), as.integer(p), z=rep(0, n * p^2), PACKAGE="hierNet") matrix(out$z, n, p^2) } Compute.yhat.c <- function(xnum, zz, aa) { # aa: list containing bp, bn, th, diagonal # note: zz is the n by cp2 matrix, whereas z is the n by p^2 one. p <- length(aa$bp) n <- length(xnum) / p stopifnot(n==round(n)) stopifnot("diagonal" %in% names(aa)) if (aa$diagonal) stopifnot(length(zz) == n * (choose(p,2) + p)) else stopifnot(length(zz) == n * choose(p,2)) out <- .C("compute_yhat_zz_R", xnum, as.integer(n), as.integer(p), zz, as.integer(aa$diagonal), as.double(aa$th), aa$bp, aa$bn, yhat=rep(0, n), PACKAGE="hierNet") out$yhat } Compute.phat.c <- function(xnum, zz, aa) { # aa: list containing b0, bp, bn, th # note: zz is the n by cp2 matrix, whereas z is the n by p^2 one. stopifnot(c("b0","bp","bn","th","diagonal") %in% names(aa)) p <- length(aa$bp) n <- length(xnum) / p if (is.matrix(xnum)) xnum <- as.numeric(xnum) stopifnot(n == round(n)) if (aa$diagonal) stopifnot(length(zz) == n * (choose(p,2) + p)) else stopifnot(length(zz) == n * choose(p,2)) #void compute_phat_zz_R(double *x, int *n, int *p, double *zz, int *diagonal, # double *b0, double *th, double *bp, double *bn, double *phat) { out <- .C("compute_phat_zz_R", xnum, as.integer(n), as.integer(p), zz, as.integer(aa$diagonal), as.double(aa$b0), as.double(aa$th), aa$bp, aa$bn, phat=rep(0, n), PACKAGE="hierNet") out$phat } ggdescent.c <- function(x, xnum, zz, y, lam.l1, lam.l2, diagonal, rho, V, stepsize, backtrack=0.2, maxiter=100, tol=1e-5, aa=NULL, trace=1) { # See ADMM4 pdf for the problem this solves. # # x, xnum, zz, y: data (note: zz is a length n*cp2 vector, not a matrix) xnum is x as a vector # lam.l1: l1-penalty parameter # lam.l2: l2-penalty parameter # rho: admm parameter # V: see ADMM4 pdf # stepsize: step size to start backtracking with # backtrack: factor by which step is reduced on each backtrack. # maxiter: number of generalized gradient steps to take. # tol: stop gg descent if change in objective is below tol. # aa: initial estimate of (th, bp, bn) # trace: how verbose to be # # void ggdescent_R(double *x, int *n, int *p, double *zz, int *diagonal, double *y, # double *lamL1, double*lamL2, double *rho, double *V, int *maxiter, # double *curth, double *curbp, double *curbn, # double *t, int *stepwindow, double *backtrack, double *tol, int *trace, # double *th, double *bp, double *bn) { n <- length(y) p <- ncol(x) stepwindow <- 10 if (is.null(aa)) aa <- list(th=matrix(0,p,p), bp=rep(0,p), bn=rep(0,p)) out <- .C("ggdescent_R", xnum, as.integer(n), as.integer(p), zz, as.integer(diagonal), y, as.double(lam.l1), as.double(lam.l2), as.double(rho), as.double(V), as.integer(maxiter), as.double(aa$th), aa$bp, aa$bn, stepsize, as.integer(stepwindow), backtrack, tol, as.integer(trace), th=rep(0, p*p), bp=rep(0, p), bn=rep(0, p), PACKAGE="hierNet") list(bp=out$bp, bn=out$bn, th=matrix(out$th, p, p)) } hierNet.logistic <- function(x, y, lam, delta=1e-8, diagonal=TRUE, strong=FALSE, aa=NULL, zz=NULL, center=TRUE, stand.main=TRUE, stand.int=FALSE, rho=nrow(x), niter=100, sym.eps=1e-3,# ADMM params step=1, maxiter=2000, backtrack=0.2, tol=1e-5, # GG descent params trace=1) { # Solves the logistic regression hiernet. Returns (b0, bp, bn, th) this.call <- match.call() n <- nrow(x) p <- ncol(x) stopifnot(y %in% c(0,1)) stopifnot(length(y) == n, lam >= 0, delta >= 0, delta <= 1) stopifnot(!is.null(step) && !is.null(maxiter)) stopifnot(class(lam) == "numeric") stopifnot(class(delta) == "numeric") stopifnot(class(step) == "numeric", step > 0, maxiter > 0) stopifnot(is.finite(x), is.finite(y), is.finite(lam), is.finite(delta)) lam.l1 <- lam * (1 - delta) lam.l2 <- lam * delta if (!center) cat("WARNING: center=FALSE should almost never be used. This option is available for special uses only.", fill = TRUE) x <- scale(x, center = center, scale = stand.main) mx <- attr(x, "scaled:center") sx <- attr(x, "scaled:scale") if (is.null(aa)) aa <- list(b0=0, bp=rep(0, p), bn=rep(0, p), th=matrix(0, p, p), diagonal=diagonal) if (is.null(zz)) { if (trace > 0) cat("Computing zz...", fill=TRUE) zz <- compute.interactions.c(x, diagonal=diagonal) } if (is.matrix(zz)) { zz <- scale(zz, center=center, scale=stand.int) mzz <- attr(zz, "scaled:center") szz <- attr(zz, "scaled:scale") zz <- as.numeric(zz) } else { mzz <- szz <- NULL #cat("Provided zz is not a matrix, so it's assumed to be already centered.", fill = TRUE) } xnum <- as.numeric(x) if (strong) { # strong hierarchy -- use ADMM4 (logistic regression version) stopifnot(is.numeric(rho), is.finite(rho)) out <- admm4.logistic(x, xnum, y, lam.l1, lam.l2, diagonal=diagonal, zz=zz, rho=rho, niter=niter, aa=aa, sym.eps=sym.eps, # ADMM params stepsize=step, backtrack=backtrack, maxiter=maxiter, tol=tol, # GG params trace=trace) ii <- out$bp + out$bn == 0 # note out$th[ii, ] = 0 since weak hierarchy holds for sure sumii <- sum(ii) if (sumii > 0 && sumii < p) { thr <- max(abs(out$th[!ii, ii])) if (thr > 0) { cat(" thr = ",thr, fill=TRUE) if (thr > 1e-3) warning("Had to change ADMM's 'th' by more than 0.001 to make strong hier hold! Increase niter (and/or rho). ") aa$th[abs(aa$th) <= thr] <- 0 } } } else { out <- ggdescent.logistic(xnum=xnum, zz=zz, y=y, lam.l1=lam.l1, lam.l2=lam.l2, diagonal=diagonal, rho=0, V=matrix(0,p,p), stepsize=step, backtrack=backtrack, maxiter=maxiter, tol=tol, aa=aa, trace=trace) } out$call <- this.call out$lam <- lam out$delta <- delta out$type <- "logistic" out$diagonal <- diagonal out$strong <- strong if (strong) { # ADMM parameters: out$rho <- rho out$niter <- niter out$sym.eps <- sym.eps } out$step <- step out$maxiter <- maxiter out$backtrack <- backtrack out$tol <- tol out$obj <- critf.logistic(x, y, lam.l1, lam.l2, out$b0, out$bp, out$bn, out$th) out$mx <- mx out$my <- 0 out$sx <- sx out$mzz <- mzz class(out) <- "hierNet" return(out) } admm4.logistic <- function(x, xnum, y, lam.l1, lam.l2, diagonal, zz=NULL, rho=10, niter, aa=NULL, sym.eps=1e-3, trace=1, ...) { # Performs ADMM4 for logistic loss. # Note: xnum is the matrix x as a numeric. Both are passed to avoid having to call as.numeric too # many times. p <- ncol(x) if (is.null(zz)) { if (trace > 0) cat("Computing zz...", fill=TRUE) zz <- as.numeric(compute.interactions.c(x, diagonal=diagonal)) } else if ("matrix" %in% class(zz)) zz <- as.numeric(zz) if (is.null(aa)) { aa <- list(u=matrix(0, p, p), th=matrix(0, p, p), bp=rep(0, p), bn=rep(0, p), tt=matrix(0, p, p), diagonal=diagonal) } if (is.null(aa$tt) || is.null(aa$u)) { aa$tt <- 0.5 * (aa$th + t(aa$th)) aa$u <- matrix(0, p, p) } obj <- Objective.logistic(aa=aa, x=x, y=y, lam.l1=lam.l1, lam.l2=lam.l2, xnum=xnum, zz=zz, strong=TRUE, sym.eps=sym.eps, trace = trace-1) for (i in seq(niter)) { if (trace > 0) cat(i, " ") V <- aa$u - rho * aa$tt gg <- ggdescent.logistic(xnum, zz, y, lam.l1=lam.l1, lam.l2=lam.l2, diagonal=diagonal, rho, V, trace=trace-1, aa=aa, ...) aa$th <- gg$th aa$bp <- gg$bp aa$bn <- gg$bn aa$tt <- (aa$th + t(aa$th)) / 2 + (aa$u + t(aa$u)) / (2 * rho) aa$u <- aa$u + rho * (aa$th - aa$tt) obj <- c(obj, Objective.logistic(aa=aa, x=x, y=y, lam.l1=lam.l1, lam.l2=lam.l2, xnum=xnum, zz=zz, strong=TRUE, sym.eps=sym.eps, trace = trace-1)) if (trace > 0) cat(obj[i+1], fill=TRUE) } if (max(abs(aa$th-t(aa$th))) > sym.eps) cat("Attention: th not symmetric within the desired sym.eps. Run ADMM for more iterations. And try increasing rho.") aa$obj <- obj aa } ggdescent.logistic <- function(xnum, zz, y, lam.l1, lam.l2, diagonal, rho, V, stepsize, backtrack=0.2, maxiter=100, tol=1e-5, aa=NULL, trace=1) { # See ADMM4 pdf and logistic.pdf for the problem this solves. # # xnum, zz, y: data (note: zz is a length n*cp2 vector, not a matrix) xnum is x as a (n*p)-vector # lam.l1: l1-penalty parameter # lam.l2: l2-penalty parameter # rho: admm parameter # V: see ADMM4 pdf # stepsize: step size to start backtracking with # backtrack: factor by which step is reduced on each backtrack. # maxiter: number of generalized gradient steps to take. # tol: stop gg descent if change in objective is below tol. # aa: initial estimate of (b0, th, bp, bn) # trace: how verbose to be # #void ggdescent_logistic_R(double *x, int *n, int *p, double *zz, int * diagonal, double *y, # double *lamL1, double *lamL2, double *rho, double *V, int *maxiter, # double *curb0, double *curth, double *curbp, double *curbn, # double *t, int *stepwindow, double *backtrack, double *tol, int *trace, # double *b0, double *th, double *bp, double *bn) { n <- length(y) p <- length(xnum) / n stopifnot(p == round(p)) if (diagonal) stopifnot(length(zz) == n * (choose(p,2)+p)) else stopifnot(length(zz) == n * choose(p,2)) stepwindow <- 10 if (is.null(aa)) aa <- list(b0=0, th=matrix(0,p,p), bp=rep(0,p), bn=rep(0,p)) out <- .C("ggdescent_logistic_R", xnum, as.integer(n), as.integer(p), zz, as.integer(diagonal), as.double(y), # convert from integer to double as.double(lam.l1), as.double(lam.l2), as.double(rho), as.double(V), as.integer(maxiter), as.double(aa$b0), as.double(aa$th), aa$bp, aa$bn, as.double(stepsize), as.integer(stepwindow), as.double(backtrack), as.double(tol), as.integer(trace), b0=as.double(0), th=rep(0, p*p), bp=rep(0, p), bn=rep(0, p), PACKAGE="hierNet") list(b0=out$b0, bp=out$bp, bn=out$bn, th=matrix(out$th, p, p)) } ADMM4.Lagrangian <- function(aa, xnum, zz, y, lam.l1, lam.l2, diagonal, rho) { # aa: list with (th, bp, bn, tt, u) # zz is a vector not a matrix if (aa$diagonal == FALSE) if (any(abs(diag(aa$th)) > 1e-8)) { cat("Diagonal of Theta is nonzero.", fill=TRUE) return(Inf) } if (max(aa$tt-t(aa$tt)) > 1e-8) { cat("Theta is not symmetrik.", fill=TRUE) return(Inf) } if (any(rowSums(abs(aa$th)) > aa$bp + aa$bn + 1e-5)) { cat("hierarchy violated.", fill=TRUE) return(Inf) } if (any(aa$bp < -1e-5)||any(aa$bn < -1e-5)) { cat("Non-negative of bp or bn violated.", fill=TRUE) return(Inf) } if (diagonal == FALSE) if (any(abs(diag(aa$th)) > 1e-5)) { cat("Zero diagonal violated.", fill=TRUE) return(Inf) } V <- aa$u - rho * aa$tt r <- y - Compute.yhat.c(xnum, zz, aa) admm <- sum(aa$u*(aa$th-aa$tt)) + (rho/2) * sum((aa$th-aa$tt)^2) #admm <- sum(V*aa$th) + (rho/2) * sum(aa$th^2) + (rho/2)*sum(aa$tt^2) - sum(aa$u*aa$tt) pen <- lam.l1 * (sum(aa$bp + aa$bn) + sum(abs(aa$th))/2) pen <- pen + lam.l2 * (sum(aa$bp^2) + sum(aa$bn^2) + sum(aa$th^2)) sum(r^2)/2 + pen + admm } predict.hierNet.logistic <- function(object, newx, newzz=NULL, ...) { predict.hierNet(object, newx, newzz, ...) } critf.logistic <- function(x, y, lam.l1, lam.l2, b0, bp, bn, th) { yhat <- b0 + x %*% (bp - bn) + 0.5 * diag(x %*% th %*% t(x)) p <- 1 / (1 + exp(-yhat)) val <- -sum(y * log(p) + (1 - y) * log(1 - p)) val <- val + lam.l1 * sum(bp + bn) + lam.l1 * sum(abs(th))/2 + lam.l1 * sum(abs(diag(th)))/2 val <- val + lam.l2 * (sum(bp^2) + sum(bn^2) + sum(th^2)) return(val) } twonorm <- function(x) {sqrt(sum(x * x))} hierNet.logistic.path <- function (x, y, lamlist=NULL, delta=1e-8, minlam=NULL, maxlam=NULL, flmin=.01, nlam=20, diagonal=TRUE, strong=FALSE, aa=NULL, zz=NULL, stand.main=TRUE, stand.int=FALSE, rho=nrow(x), niter=100, sym.eps=1e-3,# ADMM params step=1, maxiter=2000, backtrack=0.2, tol=1e-5, # GG params trace=0) { this.call=match.call() stopifnot(y %in% c(0, 1)) x <- scale(x, center=TRUE, scale=stand.main) mx <- attr(x, "scaled:center") sx <- attr(x, "scaled:scale") if (is.null(maxlam)) { if (!is.null(minlam)) stop("Cannot have maxlam=NULL if minlam is non-null.") maxlam <- max(abs(t(x) %*% y)) minlam <- maxlam * flmin } if (is.null(minlam)) minlam <- maxlam * flmin if (is.null(lamlist)) lamlist <- exp(seq(log(maxlam), log(minlam), length=nlam)) nlam <- length(lamlist) if (is.null(zz)) zz <- compute.interactions.c(x, diagonal=diagonal) else stopifnot(is.matrix(zz)) zz <- scale(zz, center=TRUE, scale=stand.int) mzz <- attr(zz, "scaled:center") szz <- attr(zz, "scaled:scale") zz <- as.numeric(zz) p <- ncol(x) cp2 <- choose(p, 2) b0 <- rep(NA, nlam) bp <- bn <- matrix(NA, nrow=p, ncol=nlam) th <- array(NA, c(p, p, nlam)) obj <- rep(NA, nlam) aa <- NULL for (i in seq(nlam)) { if (trace != 0) { cat(c("i,lam=", i, round(lamlist[i],2)), fill=TRUE) } aa <- hierNet.logistic(x, y, lam=lamlist[i], delta=delta, diagonal=diagonal, strong=strong, aa=aa, zz=zz, stand.main=FALSE, stand.int=FALSE, rho=rho, niter=niter, sym.eps=sym.eps, step=step, maxiter=maxiter, backtrack=backtrack, tol=tol, trace=trace) b0[i] <- aa$b0 bp[, i] <- aa$bp bn[, i] <- aa$bn th[, , i] <- aa$th obj[i] <- aa$obj } dimnames(bp) <- dimnames(bn) <- list(as.character(1:p), NULL) dimnames(th) <- list(as.character(1:p), as.character(1:p), NULL) out <- list(b0=b0, bp=bp, bn=bn, th=th, obj=obj, lamlist=lamlist, delta=delta, mx=mx, my=0, sx=sx, mzz=mzz, szz=szz, type="logistic", diagonal=diagonal, strong=strong, step=step, maxiter=maxiter, backtrack=backtrack, tol=tol, call=this.call) if (strong) { # ADMM parameters: out$rho <- aa$rho out$niter <- niter out$sym.eps <- sym.eps } class(out) <- "hierNet.path" out } balanced.folds <- function(y, nfolds=min(min(table(y)), 10)) { totals <- table(y) fmax <- max(totals) nfolds <- min(nfolds, fmax) # makes no sense to have more folds than the max class size folds <- as.list(seq(nfolds)) yids <- split(seq(y), y) # nice we to get the ids in a list, split by class ###Make a big matrix, with enough rows to get in all the folds per class bigmat <- matrix(NA, ceiling(fmax/nfolds) * nfolds, length(totals)) for(i in seq(totals)) { bigmat[seq(totals[i]), i] <- sample(yids[[i]]) } smallmat <- matrix(bigmat, nrow = nfolds) # reshape the matrix ### Now do a clever sort to mix up the NAs smallmat <- permute.rows(t(smallmat)) ### Now a clever unlisting # the "clever" unlist doesn't work when there are no N # apply(smallmat, 2, function(x) # x[!is.na(x)]) res <-vector("list", nfolds) for(j in 1:nfolds) { jj <- !is.na(smallmat[, j]) res[[j]] <- smallmat[jj, j] } return(res) } permute.rows <-function(x) { dd <- dim(x) n <- dd[1] p <- dd[2] mm <- runif(length(x)) + rep(seq(n) * 10, rep(p, n)) matrix(t(x)[order(mm)], n, p, byrow = TRUE) } hierNet.cv <- function(fit, x, y, nfolds=10, folds=NULL, trace=0) { this.call <- match.call() stopifnot(class(fit) == "hierNet.path") if(fit$type=="gaussian"){errfun=function(y,yhat){(y-yhat)^2}} if(fit$type=="logistic"){errfun=function(y,yhat){1*(y!=yhat)}} n <- length(y) if(is.null(folds)) { folds <- split(sample(1:n), rep(1:nfolds, length = n)) } else { stopifnot(class(folds)=="list") nfolds <- length(folds) } lamlist=fit$lamlist # get whether fit was standardized based on fit$sx and fit$szz... if (is.null(fit$mx)) stop("hierNet object was not centered. hierNet.cv has not been written for this (unusual) case.") stand.main <- !is.null(fit$sx) stand.int <- !is.null(fit$szz) n.lamlist <- length(lamlist) ### Set up the data structures size <- double(n.lamlist) err2=matrix(NA,nrow=nfolds,ncol=length(lamlist)) for(ii in 1:nfolds) { cat("Fold", ii, ":") if(fit$type=="gaussian"){ a <- hierNet.path(x[-folds[[ii]],],y=y[-folds[[ii]]], lamlist=lamlist, delta=fit$delta, diagonal=fit$diagonal, strong=fit$strong, trace=trace, stand.main=stand.main, stand.int=stand.int, rho=fit$rho, niter=fit$niter, sym.eps=fit$sym.eps, # ADMM parameters (which will be NULL if strong=F) step=fit$step, maxiter=fit$maxiter, backtrack=fit$backtrack, tol=fit$tol) # GG descent params yhatt=predict.hierNet(a,newx=x[folds[[ii]],]) } if(fit$type=="logistic"){ a <- hierNet.logistic.path(x[-folds[[ii]],],y=y[-folds[[ii]]], lamlist=lamlist, delta=fit$delta, diagonal=fit$diagonal, strong=fit$strong, trace=trace, stand.main=stand.main, stand.int=stand.int, rho=fit$rho, niter=fit$niter, sym.eps=fit$sym.eps, # ADMM parameters (which will be NULL if strong=F) step=fit$step, maxiter=fit$maxiter, backtrack=fit$backtrack, tol=fit$tol) # GG descent params yhatt=predict.hierNet.logistic(a,newx=x[folds[[ii]],])$yhat } temp=matrix(y[folds[[ii]]],nrow=length(folds[[ii]]),ncol=n.lamlist) err2[ii,]=colMeans(errfun(yhatt,temp)) cat("\n") } errm=colMeans(err2) errse=sqrt(apply(err2,2,var)/nfolds) o=which.min(errm) lamhat=lamlist[o] oo=errm<= errm[o]+errse[o] lamhat.1se=lamlist[oo & lamlist>=lamhat][1] nonzero=colSums(fit$bp-fit$bn!=0) + apply(fit$th!=0, 3, function(a) sum(diag(a)) + sum((a+t(a)!=0)[upper.tri(a)])) obj <- list(lamlist=lamlist, cv.err=errm,cv.se=errse,lamhat=lamhat, lamhat.1se=lamhat.1se, nonzero=nonzero, folds=folds, call = this.call) class(obj) <- "hierNet.cv" obj } plot.hierNet.cv <- function(x, ...) { par(mar = c(5, 5, 5, 1)) yrang=range(c(x$cv.err-x$cv.se,x$cv.err+x$cv.se)) plot(log(x$lamlist), x$cv.err, xlab="log(lambda)", ylab = "Cross-validation Error", type="n",ylim=yrang) axis(3, at = log(x$lamlist), labels = paste(x$nonzero), srt = 90, adj = 0) mtext("Number of features", 3, 4, cex = 1.2) axis(2, at = c(0, 0.2, 0.4, 0.6, 0.8)) error.bars(log(x$lamlist), x$cv.err - x$cv.se, x$cv.err + x$cv.se, width = 0.01, col = "darkgrey") points(log(x$lamlist), x$cv.err, col=2, pch=19) abline(v=log(x$lamhat), lty=3) abline(v=log(x$lamhat.1se), lty=3) invisible() } error.bars <-function(x, upper, lower, width = 0.02, ...) { xlim <- range(x) barw <- diff(xlim) * width segments(x, upper, x, lower, ...) segments(x - barw, upper, x + barw, upper, ...) segments(x - barw, lower, x + barw, lower, ...) range(upper, lower) } hierNet.varimp <- function(fit,x,y, ...) { # NOTE: uses 0.5 cutoff for logistic case lam=fit$lam if(fit$type=="gaussian"){errfun=function(y,yhat){(y-yhat)^2}} if(fit$type=="logistic"){ errfun=function(y,yhat){ term1=y*log(yhat);term1[yhat==0]=0 term2=(1-y)*log(1-yhat);term2[yhat==1]=0 val=-sum(term1+term2) return(val) }} yhat=predict(fit,x) rss=sum(errfun(y,yhat)) varsum=fit$bp-fit$bn+rowSums(abs(fit$th)) oo=which(abs(varsum)>1e-6) imp=rss2=rep(NA,ncol(x)) for(j in oo){ cat(j) fit0=fit;fit0$bp=fit$bp[-j];fit0$bn=fit$bn[-j];fit0$th=fit$th[-j,-j] if(fit$type=="gaussian"){ fit2=hierNet(x[,-j],y,lam,delta=fit$delta,diagonal=fit$diagonal,aa=fit0)} if(fit$type=="logistic"){ fit2=hierNet.logistic(x[,-j],y,lam,delta=fit$delta,diagonal=fit$diagonal,aa=fit0)} yhat2=predict(fit2,x[,-j]) rss2[j]=sum(errfun(y,yhat2)) imp[j]=(rss2[j]-rss)/rss2[j] } imp[-oo]=0 res=cbind(1:ncol(x),round(imp,3)) ooo=order(-imp) dimnames(res)=list(NULL,c("Predictor","Importance")) cat("",fill=T) return(res[ooo,]) }
####################################################### # Update newly received clinical data for UCSF samples. # Date: 2018.11.23 # Author: Kevin J. ####################################################### # Matthew Grimmer provided additional clinical data on November 16th 2018. ucsf_clinical_sheet = '/Users/johnsk/Documents/Life-History/ClinicalData/UCSF/2018-1116_glass_wes_clinic_table-costello_Roel.xlsx' ####################################################### # Necessary packages: library(tidyverse) library(openxlsx) library(DBI) library(stringr) ####################################################### # Establish connection with the database. con <- DBI::dbConnect(odbc::odbc(), "VerhaakDB") ## Load in clinical data, it may require some processing before use. ucsf_clinical = readWorkbook(ucsf_clinical_sheet, sheet = 1, startRow = 1, colNames = TRUE) # Retrieve the case_sources and biospecimen_aliquots from the Database. cases = dbReadTable(con, Id(schema="clinical",table="cases")) surgeries = dbReadTable(con, Id(schema="clinical",table="surgeries")) # Subset the cases and surgeries tables to just the patients from UCSF. ucsf_cases = cases %>% filter(grepl("GLSS-SF-", case_barcode)) ucsf_surgeries = surgeries %>% filter(grepl("GLSS-SF-", case_barcode)) # Gather the format of the variables to be uploaded to the cases table. str(ucsf_cases) # Revise these variables to be uploaded to the database. ucsf_clinical_db = ucsf_clinical %>% filter(tm_sampletype2 == "TP") %>% filter(!(is.na(age.at.diagnosis))) %>% mutate(patient_number = gsub("patient", "", patientid)) %>% mutate_at("patient_number", str_pad, width = 4, side='left', pad = 0) %>% mutate(case_barcode = paste("GLSS-SF", patient_number, sep="-")) %>% left_join(ucsf_cases, by="case_barcode") %>% mutate(revise_case_vital_status = recode(vital.status, "A" = "alive", "D"="dead"), revise_case_overall_survival_mo = round(as.numeric(overall.survival.mo)), revise_case_age_diagnosis_years = floor(age.at.diagnosis)) # First update the `case_age_diagnosis_years` variable. for (i in 1:dim(ucsf_clinical_db)[1]){ if(is.na(ucsf_clinical_db$case_age_diagnosis_years[i])){ rs = dbSendStatement(con, sprintf("UPDATE clinical.cases SET case_age_diagnosis_years = '%s' WHERE case_barcode = '%s'", ucsf_clinical_db$revise_case_age_diagnosis_years[i], ucsf_clinical_db$case_barcode[i])) dbClearResult(rs) print(ucsf_clinical_db$case_barcode[i]) print(ucsf_clinical_db$revise_case_age_diagnosis_years[i]) } } # Next update the `case_vital_status` variable. for (i in 1:dim(ucsf_clinical_db)[1]){ if(is.na(ucsf_clinical_db$case_vital_status[i])){ rs = dbSendStatement(con, sprintf("UPDATE clinical.cases SET case_vital_status = '%s' WHERE case_barcode = '%s'", ucsf_clinical_db$revise_case_vital_status[i], ucsf_clinical_db$case_barcode[i])) dbClearResult(rs) print(ucsf_clinical_db$case_barcode[i]) print(ucsf_clinical_db$revise_case_vital_status[i]) } } # Finally, update the `case_overall_survival_mo` variable. for (i in 1:dim(ucsf_clinical_db)[1]){ if(is.na(ucsf_clinical_db$case_overall_survival_mo[i])){ rs = dbSendStatement(con, sprintf("UPDATE clinical.cases SET case_overall_survival_mo = '%s' WHERE case_barcode = '%s'", ucsf_clinical_db$revise_case_overall_survival_mo[i], ucsf_clinical_db$case_barcode[i])) dbClearResult(rs) print(ucsf_clinical_db$case_barcode[i]) print(ucsf_clinical_db$revise_case_overall_survival_mo[i]) } } # NOTE: GLSS-SF-0081 is still missing the `case_overall_survival_mo` variable. # It's more difficult to amend the surgeries table because of the clinical variables' format. # Instead of using a loop, the objective is to manually enter each field. ucsf_surgery_db = ucsf_clinical %>% mutate(patient_number = gsub("patient", "", patientid)) %>% mutate_at("patient_number", str_pad, width = 4, side='left', pad = 0) %>% mutate(sample_barcode = paste("GLSS-SF", patient_number, tm_sampletype2, sep="-")) ######################### # Manually update values. Use dbClearResult to prevent error. ######################### ### surgical_interval_mo rs = dbSendStatement(con, "UPDATE clinical.surgeries SET surgical_interval_mo = '4' WHERE sample_barcode = 'GLSS-SF-0131-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET surgical_interval_mo = '26' WHERE sample_barcode = 'GLSS-SF-0157-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET surgical_interval_mo = '63' WHERE sample_barcode = 'GLSS-SF-0334-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET surgical_interval_mo = '18' WHERE sample_barcode = 'GLSS-SF-0339-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET surgical_interval_mo = '43' WHERE sample_barcode = 'GLSS-SF-0060-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET surgical_interval_mo = '39' WHERE sample_barcode = 'GLSS-SF-0081-R1'") dbClearResult(rs) ### histology rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Glioblastoma' WHERE sample_barcode = 'GLSS-SF-0131-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Glioblastoma' WHERE sample_barcode = 'GLSS-SF-0131-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Oligoastrocytoma' WHERE sample_barcode = 'GLSS-SF-0157-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Oligoastrocytoma' WHERE sample_barcode = 'GLSS-SF-0157-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Oligodendroglioma' WHERE sample_barcode = 'GLSS-SF-0334-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Oligodendroglioma' WHERE sample_barcode = 'GLSS-SF-0334-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Astrocytoma' WHERE sample_barcode = 'GLSS-SF-0338-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Astrocytoma' WHERE sample_barcode = 'GLSS-SF-0338-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Astrocytoma' WHERE sample_barcode = 'GLSS-SF-0339-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Astrocytoma' WHERE sample_barcode = 'GLSS-SF-0339-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Astrocytoma' WHERE sample_barcode = 'GLSS-SF-0081-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Astrocytoma' WHERE sample_barcode = 'GLSS-SF-0081-R1'") dbClearResult(rs) ### who_classification ### grade rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'IV' WHERE sample_barcode = 'GLSS-SF-0131-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'IV' WHERE sample_barcode = 'GLSS-SF-0131-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0157-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'IV' WHERE sample_barcode = 'GLSS-SF-0157-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0159-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0334-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0334-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0338-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'III' WHERE sample_barcode = 'GLSS-SF-0338-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0339-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0339-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0065-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0081-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0081-R1'") dbClearResult(rs) ### treatment_tmz rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_tmz = '1' WHERE sample_barcode = 'GLSS-SF-0131-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_tmz = '1' WHERE sample_barcode = 'GLSS-SF-0157-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_tmz = '1' WHERE sample_barcode = 'GLSS-SF-0334-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_tmz = '1' WHERE sample_barcode = 'GLSS-SF-0338-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_tmz = '0' WHERE sample_barcode = 'GLSS-SF-0339-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_tmz = '1' WHERE sample_barcode = 'GLSS-SF-0081-TP'") dbClearResult(rs) ### treatment_chemotherapy_other") treatment_chemotherapy_other_cycles rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other = 'Irinotecan, Optune, CBD' WHERE sample_barcode = 'GLSS-SF-0131-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other_cycles = '2' WHERE sample_barcode = 'GLSS-SF-0131-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other = 'Lomustine' WHERE sample_barcode = 'GLSS-SF-0157-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other_cycles = '12' WHERE sample_barcode = 'GLSS-SF-0157-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other = 'Lomustine' WHERE sample_barcode = 'GLSS-SF-0170-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other_cycles = '12, 10' WHERE sample_barcode = 'GLSS-SF-0170-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other = 'Steroids' WHERE sample_barcode = 'GLSS-SF-0032-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other_cycles = '4' WHERE sample_barcode = 'GLSS-SF-0032-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other = 'Everolimus' WHERE sample_barcode = 'GLSS-SF-0039-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other_cycles = '12' WHERE sample_barcode = 'GLSS-SF-0039-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other = 'Lomustine' WHERE sample_barcode = 'GLSS-SF-0081-TP'") dbClearResult(rs) ### treatment_radiotherapy") treatment_radiation_other rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0131-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0157-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiation_other = 'IMRT' WHERE sample_barcode = 'GLSS-SF-0157-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0159-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiation_other = 'IMRT' WHERE sample_barcode = 'GLSS-SF-0159-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0032-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiation_other = 'IMRT' WHERE sample_barcode = 'GLSS-SF-0032-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0338-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0039-TP'") dbClearResult(rs) dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiation_other = 'IMRT' WHERE sample_barcode = 'GLSS-SF-0039-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0060-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiation_other = 'Proton beam' WHERE sample_barcode = 'GLSS-SF-0060-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0069-TP'") dbClearResult(rs) dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiation_other = 'IMRT' WHERE sample_barcode = 'GLSS-SF-0069-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0081-TP'") dbClearResult(rs) ## Update who_classification rs =dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Diffuse Astrocytoma, IDH-mutant' WHERE histology = 'Astrocytoma' AND grade = 'II' AND idh_status = 'IDHmut'") dbClearResult(rs) rs =dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Diffuse Astrocytoma, IDH-wildtype' WHERE histology = 'Astrocytoma' AND grade = 'II' AND idh_status = 'IDHwt'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Astrocytoma, IDH-mutant' WHERE histology = 'Astrocytoma' AND grade = 'III' AND idh_status = 'IDHmut'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Astrocytoma, IDH-wildtype' WHERE histology = 'Astrocytoma' AND grade = 'III' AND idh_status = 'IDHwt'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Glioblastoma, IDH-wildtype' WHERE histology = 'Glioblastoma' AND grade = 'IV' AND idh_status = 'IDHwt'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Glioblastoma, IDH-mutant' WHERE histology = 'Glioblastoma' AND grade = 'IV' AND idh_status = 'IDHmut'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Oligodendroglioma, IDH-mutant and 1p/19q-codeleted' WHERE histology = 'Oligodendroglioma' AND grade = 'II' AND idh_status = 'IDHmut' AND codel_status = 'codel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Oligodendroglioma, IDH-mutant and 1p/19q-codeleted' WHERE histology = 'Oligodendroglioma' AND grade = 'III' AND idh_status = 'IDHmut' AND codel_status = 'codel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Oligodendroglioma, IDH-mutant and 1p/19q-codeleted' WHERE histology IS NOT NULL AND grade = 'II' AND idh_status = 'IDHmut' AND codel_status = 'codel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Oligodendroglioma, IDH-mutant and 1p/19q-codeleted' WHERE histology IS NOT NULL AND (grade = 'III' OR grade = 'IV') AND idh_status = 'IDHmut' AND codel_status = 'codel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Diffuse Astrocytoma, IDH-mutant' WHERE histology = 'Oligoastrocytoma' AND grade = 'II' AND idh_status = 'IDHmut' AND codel_status = 'noncodel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Diffuse Astrocytoma, IDH-wildtype' WHERE histology = 'Oligoastrocytoma' AND grade = 'II' AND idh_status = 'IDHwt' AND codel_status = 'noncodel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Astrocytoma, IDH-mutant' WHERE histology = 'Oligoastrocytoma' AND grade = 'III' AND idh_status = 'IDHmut' AND codel_status = 'noncodel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Astrocytoma, IDH-wildtype' WHERE histology = 'Oligoastrocytoma' AND grade = 'III' AND idh_status = 'IDHwt' AND codel_status = 'noncodel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Diffuse Astrocytoma, IDH-mutant' WHERE histology = 'Oligodendroglioma' AND grade = 'II' AND idh_status = 'IDHmut' AND codel_status = 'noncodel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Diffuse Astrocytoma, IDH-wildtype' WHERE histology = 'Oligodendroglioma' AND grade = 'II' AND idh_status = 'IDHwt' AND codel_status = 'noncodel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Astrocytoma, IDH-mutant' WHERE histology = 'Oligodendroglioma' AND grade = 'III' AND idh_status = 'IDHmut' AND codel_status = 'noncodel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Astrocytoma, IDH-wildtype' WHERE histology = 'Oligodendroglioma' AND grade = 'III' AND idh_status = 'IDHwt' AND codel_status = 'noncodel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Diffuse Astrocytoma, NOS' WHERE histology = 'Astrocytoma' AND grade = 'II' AND idh_status IS NULL AND codel_status IS NULL") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Astrocytoma, NOS' WHERE histology = 'Astrocytoma' AND grade = 'III' AND idh_status IS NULL AND codel_status IS NULL") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Oligodendroglioma, NOS' WHERE histology = 'Oligodendroglioma' AND grade = 'II' AND idh_status IS NULL AND codel_status IS NULL") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Oligodendroglioma, NOS' WHERE histology = 'Oligodendroglioma' AND (grade = 'III' OR grade = 'IV') AND idh_status IS NULL AND codel_status IS NULL") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Glioblastoma, NOS' WHERE histology = 'Glioblastoma' AND grade = 'IV' AND idh_status IS NULL AND codel_status IS NULL") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Oligoastrocytoma, NOS' WHERE histology = 'Oligoastrocytoma' AND grade = 'II' AND idh_status IS NULL AND codel_status IS NULL") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Oligoastrocytoma, NOS' WHERE histology = 'Oligoastrocytoma' AND grade = 'III' AND idh_status IS NULL AND codel_status IS NULL") dbClearResult(rs)
/R/preprocess/ucsf-clinical-update.R
permissive
fpbarthel/GLASS
R
false
false
19,651
r
####################################################### # Update newly received clinical data for UCSF samples. # Date: 2018.11.23 # Author: Kevin J. ####################################################### # Matthew Grimmer provided additional clinical data on November 16th 2018. ucsf_clinical_sheet = '/Users/johnsk/Documents/Life-History/ClinicalData/UCSF/2018-1116_glass_wes_clinic_table-costello_Roel.xlsx' ####################################################### # Necessary packages: library(tidyverse) library(openxlsx) library(DBI) library(stringr) ####################################################### # Establish connection with the database. con <- DBI::dbConnect(odbc::odbc(), "VerhaakDB") ## Load in clinical data, it may require some processing before use. ucsf_clinical = readWorkbook(ucsf_clinical_sheet, sheet = 1, startRow = 1, colNames = TRUE) # Retrieve the case_sources and biospecimen_aliquots from the Database. cases = dbReadTable(con, Id(schema="clinical",table="cases")) surgeries = dbReadTable(con, Id(schema="clinical",table="surgeries")) # Subset the cases and surgeries tables to just the patients from UCSF. ucsf_cases = cases %>% filter(grepl("GLSS-SF-", case_barcode)) ucsf_surgeries = surgeries %>% filter(grepl("GLSS-SF-", case_barcode)) # Gather the format of the variables to be uploaded to the cases table. str(ucsf_cases) # Revise these variables to be uploaded to the database. ucsf_clinical_db = ucsf_clinical %>% filter(tm_sampletype2 == "TP") %>% filter(!(is.na(age.at.diagnosis))) %>% mutate(patient_number = gsub("patient", "", patientid)) %>% mutate_at("patient_number", str_pad, width = 4, side='left', pad = 0) %>% mutate(case_barcode = paste("GLSS-SF", patient_number, sep="-")) %>% left_join(ucsf_cases, by="case_barcode") %>% mutate(revise_case_vital_status = recode(vital.status, "A" = "alive", "D"="dead"), revise_case_overall_survival_mo = round(as.numeric(overall.survival.mo)), revise_case_age_diagnosis_years = floor(age.at.diagnosis)) # First update the `case_age_diagnosis_years` variable. for (i in 1:dim(ucsf_clinical_db)[1]){ if(is.na(ucsf_clinical_db$case_age_diagnosis_years[i])){ rs = dbSendStatement(con, sprintf("UPDATE clinical.cases SET case_age_diagnosis_years = '%s' WHERE case_barcode = '%s'", ucsf_clinical_db$revise_case_age_diagnosis_years[i], ucsf_clinical_db$case_barcode[i])) dbClearResult(rs) print(ucsf_clinical_db$case_barcode[i]) print(ucsf_clinical_db$revise_case_age_diagnosis_years[i]) } } # Next update the `case_vital_status` variable. for (i in 1:dim(ucsf_clinical_db)[1]){ if(is.na(ucsf_clinical_db$case_vital_status[i])){ rs = dbSendStatement(con, sprintf("UPDATE clinical.cases SET case_vital_status = '%s' WHERE case_barcode = '%s'", ucsf_clinical_db$revise_case_vital_status[i], ucsf_clinical_db$case_barcode[i])) dbClearResult(rs) print(ucsf_clinical_db$case_barcode[i]) print(ucsf_clinical_db$revise_case_vital_status[i]) } } # Finally, update the `case_overall_survival_mo` variable. for (i in 1:dim(ucsf_clinical_db)[1]){ if(is.na(ucsf_clinical_db$case_overall_survival_mo[i])){ rs = dbSendStatement(con, sprintf("UPDATE clinical.cases SET case_overall_survival_mo = '%s' WHERE case_barcode = '%s'", ucsf_clinical_db$revise_case_overall_survival_mo[i], ucsf_clinical_db$case_barcode[i])) dbClearResult(rs) print(ucsf_clinical_db$case_barcode[i]) print(ucsf_clinical_db$revise_case_overall_survival_mo[i]) } } # NOTE: GLSS-SF-0081 is still missing the `case_overall_survival_mo` variable. # It's more difficult to amend the surgeries table because of the clinical variables' format. # Instead of using a loop, the objective is to manually enter each field. ucsf_surgery_db = ucsf_clinical %>% mutate(patient_number = gsub("patient", "", patientid)) %>% mutate_at("patient_number", str_pad, width = 4, side='left', pad = 0) %>% mutate(sample_barcode = paste("GLSS-SF", patient_number, tm_sampletype2, sep="-")) ######################### # Manually update values. Use dbClearResult to prevent error. ######################### ### surgical_interval_mo rs = dbSendStatement(con, "UPDATE clinical.surgeries SET surgical_interval_mo = '4' WHERE sample_barcode = 'GLSS-SF-0131-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET surgical_interval_mo = '26' WHERE sample_barcode = 'GLSS-SF-0157-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET surgical_interval_mo = '63' WHERE sample_barcode = 'GLSS-SF-0334-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET surgical_interval_mo = '18' WHERE sample_barcode = 'GLSS-SF-0339-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET surgical_interval_mo = '43' WHERE sample_barcode = 'GLSS-SF-0060-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET surgical_interval_mo = '39' WHERE sample_barcode = 'GLSS-SF-0081-R1'") dbClearResult(rs) ### histology rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Glioblastoma' WHERE sample_barcode = 'GLSS-SF-0131-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Glioblastoma' WHERE sample_barcode = 'GLSS-SF-0131-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Oligoastrocytoma' WHERE sample_barcode = 'GLSS-SF-0157-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Oligoastrocytoma' WHERE sample_barcode = 'GLSS-SF-0157-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Oligodendroglioma' WHERE sample_barcode = 'GLSS-SF-0334-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Oligodendroglioma' WHERE sample_barcode = 'GLSS-SF-0334-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Astrocytoma' WHERE sample_barcode = 'GLSS-SF-0338-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Astrocytoma' WHERE sample_barcode = 'GLSS-SF-0338-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Astrocytoma' WHERE sample_barcode = 'GLSS-SF-0339-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Astrocytoma' WHERE sample_barcode = 'GLSS-SF-0339-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Astrocytoma' WHERE sample_barcode = 'GLSS-SF-0081-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET histology = 'Astrocytoma' WHERE sample_barcode = 'GLSS-SF-0081-R1'") dbClearResult(rs) ### who_classification ### grade rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'IV' WHERE sample_barcode = 'GLSS-SF-0131-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'IV' WHERE sample_barcode = 'GLSS-SF-0131-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0157-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'IV' WHERE sample_barcode = 'GLSS-SF-0157-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0159-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0334-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0334-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0338-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'III' WHERE sample_barcode = 'GLSS-SF-0338-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0339-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0339-R1'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0065-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0081-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET grade = 'II' WHERE sample_barcode = 'GLSS-SF-0081-R1'") dbClearResult(rs) ### treatment_tmz rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_tmz = '1' WHERE sample_barcode = 'GLSS-SF-0131-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_tmz = '1' WHERE sample_barcode = 'GLSS-SF-0157-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_tmz = '1' WHERE sample_barcode = 'GLSS-SF-0334-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_tmz = '1' WHERE sample_barcode = 'GLSS-SF-0338-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_tmz = '0' WHERE sample_barcode = 'GLSS-SF-0339-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_tmz = '1' WHERE sample_barcode = 'GLSS-SF-0081-TP'") dbClearResult(rs) ### treatment_chemotherapy_other") treatment_chemotherapy_other_cycles rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other = 'Irinotecan, Optune, CBD' WHERE sample_barcode = 'GLSS-SF-0131-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other_cycles = '2' WHERE sample_barcode = 'GLSS-SF-0131-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other = 'Lomustine' WHERE sample_barcode = 'GLSS-SF-0157-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other_cycles = '12' WHERE sample_barcode = 'GLSS-SF-0157-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other = 'Lomustine' WHERE sample_barcode = 'GLSS-SF-0170-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other_cycles = '12, 10' WHERE sample_barcode = 'GLSS-SF-0170-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other = 'Steroids' WHERE sample_barcode = 'GLSS-SF-0032-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other_cycles = '4' WHERE sample_barcode = 'GLSS-SF-0032-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other = 'Everolimus' WHERE sample_barcode = 'GLSS-SF-0039-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other_cycles = '12' WHERE sample_barcode = 'GLSS-SF-0039-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_chemotherapy_other = 'Lomustine' WHERE sample_barcode = 'GLSS-SF-0081-TP'") dbClearResult(rs) ### treatment_radiotherapy") treatment_radiation_other rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0131-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0157-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiation_other = 'IMRT' WHERE sample_barcode = 'GLSS-SF-0157-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0159-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiation_other = 'IMRT' WHERE sample_barcode = 'GLSS-SF-0159-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0032-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiation_other = 'IMRT' WHERE sample_barcode = 'GLSS-SF-0032-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0338-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0039-TP'") dbClearResult(rs) dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiation_other = 'IMRT' WHERE sample_barcode = 'GLSS-SF-0039-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0060-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiation_other = 'Proton beam' WHERE sample_barcode = 'GLSS-SF-0060-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0069-TP'") dbClearResult(rs) dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiation_other = 'IMRT' WHERE sample_barcode = 'GLSS-SF-0069-TP'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET treatment_radiotherapy = '1' WHERE sample_barcode = 'GLSS-SF-0081-TP'") dbClearResult(rs) ## Update who_classification rs =dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Diffuse Astrocytoma, IDH-mutant' WHERE histology = 'Astrocytoma' AND grade = 'II' AND idh_status = 'IDHmut'") dbClearResult(rs) rs =dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Diffuse Astrocytoma, IDH-wildtype' WHERE histology = 'Astrocytoma' AND grade = 'II' AND idh_status = 'IDHwt'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Astrocytoma, IDH-mutant' WHERE histology = 'Astrocytoma' AND grade = 'III' AND idh_status = 'IDHmut'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Astrocytoma, IDH-wildtype' WHERE histology = 'Astrocytoma' AND grade = 'III' AND idh_status = 'IDHwt'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Glioblastoma, IDH-wildtype' WHERE histology = 'Glioblastoma' AND grade = 'IV' AND idh_status = 'IDHwt'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Glioblastoma, IDH-mutant' WHERE histology = 'Glioblastoma' AND grade = 'IV' AND idh_status = 'IDHmut'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Oligodendroglioma, IDH-mutant and 1p/19q-codeleted' WHERE histology = 'Oligodendroglioma' AND grade = 'II' AND idh_status = 'IDHmut' AND codel_status = 'codel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Oligodendroglioma, IDH-mutant and 1p/19q-codeleted' WHERE histology = 'Oligodendroglioma' AND grade = 'III' AND idh_status = 'IDHmut' AND codel_status = 'codel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Oligodendroglioma, IDH-mutant and 1p/19q-codeleted' WHERE histology IS NOT NULL AND grade = 'II' AND idh_status = 'IDHmut' AND codel_status = 'codel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Oligodendroglioma, IDH-mutant and 1p/19q-codeleted' WHERE histology IS NOT NULL AND (grade = 'III' OR grade = 'IV') AND idh_status = 'IDHmut' AND codel_status = 'codel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Diffuse Astrocytoma, IDH-mutant' WHERE histology = 'Oligoastrocytoma' AND grade = 'II' AND idh_status = 'IDHmut' AND codel_status = 'noncodel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Diffuse Astrocytoma, IDH-wildtype' WHERE histology = 'Oligoastrocytoma' AND grade = 'II' AND idh_status = 'IDHwt' AND codel_status = 'noncodel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Astrocytoma, IDH-mutant' WHERE histology = 'Oligoastrocytoma' AND grade = 'III' AND idh_status = 'IDHmut' AND codel_status = 'noncodel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Astrocytoma, IDH-wildtype' WHERE histology = 'Oligoastrocytoma' AND grade = 'III' AND idh_status = 'IDHwt' AND codel_status = 'noncodel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Diffuse Astrocytoma, IDH-mutant' WHERE histology = 'Oligodendroglioma' AND grade = 'II' AND idh_status = 'IDHmut' AND codel_status = 'noncodel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Diffuse Astrocytoma, IDH-wildtype' WHERE histology = 'Oligodendroglioma' AND grade = 'II' AND idh_status = 'IDHwt' AND codel_status = 'noncodel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Astrocytoma, IDH-mutant' WHERE histology = 'Oligodendroglioma' AND grade = 'III' AND idh_status = 'IDHmut' AND codel_status = 'noncodel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Astrocytoma, IDH-wildtype' WHERE histology = 'Oligodendroglioma' AND grade = 'III' AND idh_status = 'IDHwt' AND codel_status = 'noncodel'") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Diffuse Astrocytoma, NOS' WHERE histology = 'Astrocytoma' AND grade = 'II' AND idh_status IS NULL AND codel_status IS NULL") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Astrocytoma, NOS' WHERE histology = 'Astrocytoma' AND grade = 'III' AND idh_status IS NULL AND codel_status IS NULL") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Oligodendroglioma, NOS' WHERE histology = 'Oligodendroglioma' AND grade = 'II' AND idh_status IS NULL AND codel_status IS NULL") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Oligodendroglioma, NOS' WHERE histology = 'Oligodendroglioma' AND (grade = 'III' OR grade = 'IV') AND idh_status IS NULL AND codel_status IS NULL") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Glioblastoma, NOS' WHERE histology = 'Glioblastoma' AND grade = 'IV' AND idh_status IS NULL AND codel_status IS NULL") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Oligoastrocytoma, NOS' WHERE histology = 'Oligoastrocytoma' AND grade = 'II' AND idh_status IS NULL AND codel_status IS NULL") dbClearResult(rs) rs = dbSendStatement(con, "UPDATE clinical.surgeries SET who_classification = 'Anaplastic Oligoastrocytoma, NOS' WHERE histology = 'Oligoastrocytoma' AND grade = 'III' AND idh_status IS NULL AND codel_status IS NULL") dbClearResult(rs)
# test_helper.R # test some of the helper functions test_that("Check if sortIndex and rankIndex offset each other", { u = matrix(runif(12), nrow=4, ncol=3) expect_true(all(sortIndex(-rankIndex(sortIndex(u))) == sortIndex(u))) }) test_that("Check if sortIndex works", { u = matrix(c(3, 2, 8, 1, 12, 2, 9, 2, 13, 5, 3.1, 2.1), nrow=4, ncol=3) expect_true(all(sortIndex(u) == c(3,1,2,4,1,3,2,4,1,2,3,4)-1)) }) test_that("Check if rankIndex works", { u = matrix(c(2, 2, 1, 2, 1, 0, 0, 1, 0, 1, 2, 0), nrow=3, ncol=4, byrow = TRUE) expect_true(all(rankIndex(u) == matrix(c(2, 1, 1, 2, 1, 2, 0, 1, 0, 0, 2, 0), nrow=3, ncol=4, byrow = TRUE))) }) test_that("Check reprow", { x = matrix(c(2, 4, 5, 3, 2, 1), ncol = 3, byrow = TRUE) y = reprow(x, 2) expect_true(identical(y, rbind(x[1,], x[1,], x[2,], x[2,]))) y = reprow(x, c(2, 2)) expect_true(identical(y, rbind(x[1,], x[1,], x[2,], x[2,]))) y = reprow(x, c(2, 1)) expect_true(identical(y, rbind(x[1,], x[1,], x[2,]))) }) test_that("Check repcol", { x = matrix(c(2, 4, 5, 3, 2, 1), ncol = 3, byrow = TRUE) y = repcol(x, 2) expect_true(identical(y, cbind(x[,1], x[,1], x[,2], x[,2], x[,3], x[,3]))) y = repcol(x, c(2, 2, 2)) expect_true(identical(y, cbind(x[,1], x[,1], x[,2], x[,2], x[,3], x[,3]))) y = repcol(x, c(2, 3, 1)) expect_true(identical(y, cbind(x[,1], x[,1], x[,2], x[,2], x[,2], x[,3]))) })
/data/genthat_extracted_code/matchingR/tests/test_helper.R
no_license
surayaaramli/typeRrh
R
false
false
1,507
r
# test_helper.R # test some of the helper functions test_that("Check if sortIndex and rankIndex offset each other", { u = matrix(runif(12), nrow=4, ncol=3) expect_true(all(sortIndex(-rankIndex(sortIndex(u))) == sortIndex(u))) }) test_that("Check if sortIndex works", { u = matrix(c(3, 2, 8, 1, 12, 2, 9, 2, 13, 5, 3.1, 2.1), nrow=4, ncol=3) expect_true(all(sortIndex(u) == c(3,1,2,4,1,3,2,4,1,2,3,4)-1)) }) test_that("Check if rankIndex works", { u = matrix(c(2, 2, 1, 2, 1, 0, 0, 1, 0, 1, 2, 0), nrow=3, ncol=4, byrow = TRUE) expect_true(all(rankIndex(u) == matrix(c(2, 1, 1, 2, 1, 2, 0, 1, 0, 0, 2, 0), nrow=3, ncol=4, byrow = TRUE))) }) test_that("Check reprow", { x = matrix(c(2, 4, 5, 3, 2, 1), ncol = 3, byrow = TRUE) y = reprow(x, 2) expect_true(identical(y, rbind(x[1,], x[1,], x[2,], x[2,]))) y = reprow(x, c(2, 2)) expect_true(identical(y, rbind(x[1,], x[1,], x[2,], x[2,]))) y = reprow(x, c(2, 1)) expect_true(identical(y, rbind(x[1,], x[1,], x[2,]))) }) test_that("Check repcol", { x = matrix(c(2, 4, 5, 3, 2, 1), ncol = 3, byrow = TRUE) y = repcol(x, 2) expect_true(identical(y, cbind(x[,1], x[,1], x[,2], x[,2], x[,3], x[,3]))) y = repcol(x, c(2, 2, 2)) expect_true(identical(y, cbind(x[,1], x[,1], x[,2], x[,2], x[,3], x[,3]))) y = repcol(x, c(2, 3, 1)) expect_true(identical(y, cbind(x[,1], x[,1], x[,2], x[,2], x[,2], x[,3]))) })
library(NISTunits) ### Name: NISTinchPerSecTOmeterPerSec ### Title: Convert inch per second to meter per second ### Aliases: NISTinchPerSecTOmeterPerSec ### Keywords: programming ### ** Examples NISTinchPerSecTOmeterPerSec(10)
/data/genthat_extracted_code/NISTunits/examples/NISTinchPerSecTOmeterPerSec.Rd.R
no_license
surayaaramli/typeRrh
R
false
false
234
r
library(NISTunits) ### Name: NISTinchPerSecTOmeterPerSec ### Title: Convert inch per second to meter per second ### Aliases: NISTinchPerSecTOmeterPerSec ### Keywords: programming ### ** Examples NISTinchPerSecTOmeterPerSec(10)
#' @export populateShinyApp <- function(outputDirectory = './ShinyApp', shinyDirectory, resultDirectory, minCellCount = 10, databaseName = 'sharable name of development data'){ #check inputs if(missing(shinyDirectory)){ shinyDirectory <- system.file("shiny", "PLPViewer", package = "ABCgentamicin") } if(missing(resultDirectory)){ stop('Need to enter the resultDirectory') } if(!dir.exists(resultDirectory)){ stop('resultDirectory does not exist') } # create the shiny data folder if(!dir.exists(outputDirectory)){ dir.create(outputDirectory, recursive = T) } # copy shiny folder to outputDirectory R.utils::copyDirectory(from = shinyDirectory, to= outputDirectory, recursive=TRUE) outputDirectory <- file.path(outputDirectory,'data') if(!dir.exists(outputDirectory)){ dir.create(outputDirectory, recursive = T) } #outputDirectory <- file.path(shinyDirectory,'data') # copy the settings csv file <- utils::read.csv(file.path(resultDirectory,'settings.csv')) utils::write.csv(file, file.path(outputDirectory,'settings.csv'), row.names = F) # copy each analysis as a rds file and copy the log files <- dir(resultDirectory, full.names = F) files <- files[grep('Analysis', files)] for(file in files){ if(!dir.exists(file.path(outputDirectory,file))){ dir.create(file.path(outputDirectory,file)) } if(dir.exists(file.path(resultDirectory,file, 'plpResult'))){ res <- PatientLevelPrediction::loadPlpResult(file.path(resultDirectory,file, 'plpResult')) res <- PatientLevelPrediction::transportPlp(res, n= minCellCount, save = F, dataName = databaseName) saveRDS(res, file.path(outputDirectory,file, 'plpResult.rds')) } if(file.exists(file.path(resultDirectory,file, 'plpLog.txt'))){ file.copy(from = file.path(resultDirectory,file, 'plpLog.txt'), to = file.path(outputDirectory,file, 'plpLog.txt')) } } # copy any validation results if(dir.exists(file.path(resultDirectory,'Validation'))){ valFolders <- dir(file.path(resultDirectory,'Validation'), full.names = F) if(length(valFolders)>0){ # move each of the validation rds for(valFolder in valFolders){ # get the analysisIds valSubfolders <- dir(file.path(resultDirectory,'Validation',valFolder), full.names = F) if(length(valSubfolders)!=0){ for(valSubfolder in valSubfolders ){ valOut <- file.path(valFolder,valSubfolder) if(!dir.exists(file.path(outputDirectory,'Validation',valOut))){ dir.create(file.path(outputDirectory,'Validation',valOut), recursive = T) } if(file.exists(file.path(resultDirectory,'Validation',valOut, 'validationResult.rds'))){ res <- readRDS(file.path(resultDirectory,'Validation',valOut, 'validationResult.rds')) res <- PatientLevelPrediction::transportPlp(res, n= minCellCount, save = F, dataName = databaseName) saveRDS(res, file.path(outputDirectory,'Validation',valOut, 'validationResult.rds')) } } } } } } ParallelLogger::logInfo(paste0('Shiny App created at: ', outputDirectory)) ParallelLogger::logInfo(paste0('Upload the folder ', outputDirectory, ' to the shinyDeploy OHDSI github to share the results with others.')) return(outputDirectory) }
/AbxBetterChoice/ABCgentamicin/R/populateShinyApp.R
no_license
ABMI/AbxBetterChoice
R
false
false
3,762
r
#' @export populateShinyApp <- function(outputDirectory = './ShinyApp', shinyDirectory, resultDirectory, minCellCount = 10, databaseName = 'sharable name of development data'){ #check inputs if(missing(shinyDirectory)){ shinyDirectory <- system.file("shiny", "PLPViewer", package = "ABCgentamicin") } if(missing(resultDirectory)){ stop('Need to enter the resultDirectory') } if(!dir.exists(resultDirectory)){ stop('resultDirectory does not exist') } # create the shiny data folder if(!dir.exists(outputDirectory)){ dir.create(outputDirectory, recursive = T) } # copy shiny folder to outputDirectory R.utils::copyDirectory(from = shinyDirectory, to= outputDirectory, recursive=TRUE) outputDirectory <- file.path(outputDirectory,'data') if(!dir.exists(outputDirectory)){ dir.create(outputDirectory, recursive = T) } #outputDirectory <- file.path(shinyDirectory,'data') # copy the settings csv file <- utils::read.csv(file.path(resultDirectory,'settings.csv')) utils::write.csv(file, file.path(outputDirectory,'settings.csv'), row.names = F) # copy each analysis as a rds file and copy the log files <- dir(resultDirectory, full.names = F) files <- files[grep('Analysis', files)] for(file in files){ if(!dir.exists(file.path(outputDirectory,file))){ dir.create(file.path(outputDirectory,file)) } if(dir.exists(file.path(resultDirectory,file, 'plpResult'))){ res <- PatientLevelPrediction::loadPlpResult(file.path(resultDirectory,file, 'plpResult')) res <- PatientLevelPrediction::transportPlp(res, n= minCellCount, save = F, dataName = databaseName) saveRDS(res, file.path(outputDirectory,file, 'plpResult.rds')) } if(file.exists(file.path(resultDirectory,file, 'plpLog.txt'))){ file.copy(from = file.path(resultDirectory,file, 'plpLog.txt'), to = file.path(outputDirectory,file, 'plpLog.txt')) } } # copy any validation results if(dir.exists(file.path(resultDirectory,'Validation'))){ valFolders <- dir(file.path(resultDirectory,'Validation'), full.names = F) if(length(valFolders)>0){ # move each of the validation rds for(valFolder in valFolders){ # get the analysisIds valSubfolders <- dir(file.path(resultDirectory,'Validation',valFolder), full.names = F) if(length(valSubfolders)!=0){ for(valSubfolder in valSubfolders ){ valOut <- file.path(valFolder,valSubfolder) if(!dir.exists(file.path(outputDirectory,'Validation',valOut))){ dir.create(file.path(outputDirectory,'Validation',valOut), recursive = T) } if(file.exists(file.path(resultDirectory,'Validation',valOut, 'validationResult.rds'))){ res <- readRDS(file.path(resultDirectory,'Validation',valOut, 'validationResult.rds')) res <- PatientLevelPrediction::transportPlp(res, n= minCellCount, save = F, dataName = databaseName) saveRDS(res, file.path(outputDirectory,'Validation',valOut, 'validationResult.rds')) } } } } } } ParallelLogger::logInfo(paste0('Shiny App created at: ', outputDirectory)) ParallelLogger::logInfo(paste0('Upload the folder ', outputDirectory, ' to the shinyDeploy OHDSI github to share the results with others.')) return(outputDirectory) }
a=5 x=rnorm(100) plot(x) vec1 = c(1,4,6,8,10) vec2 = seq(from=0, to=1.1, by=0.25) sum(vec1) mat=matrix(data=c(9,2,3,4,5,6),ncol=3) t = data.frame(x = c(11,12,14), y = c(19,20,21), z = c(10,9,7)) L = list(one=1, two=c(1,2), five=seq(0, 1, length=5)) plot(rnorm(100), type="l", col="gold") d = data.frame(a = c(3,4,5), b = c(12,43,54)) write.table(d, file="tst0.txt", row.names=FALSE) d2 = read.table(file="tst0.txt", header=TRUE) j = c(1,2,NA) max(j, na.rm=TRUE) m = "apples" date1=strptime( c("20100225230000", "20100226000000", "20100226010000"), format="%Y%m%d%H%M%S") dt = as.Date('1915-6-16') dt1 = as.Date('1/15/2001',format='%m/%d/%Y') h = seq(from=1, to=8) s = c() for(i in 2:10) { s[i] = h[i] * 10 } fun1 = function(arg1, arg2) { w = arg1 ^ 2 return(arg2 + w) }
/_MIT_math_fin/intro_R.r
no_license
quant108/MIT-Math-Finance
R
false
false
976
r
a=5 x=rnorm(100) plot(x) vec1 = c(1,4,6,8,10) vec2 = seq(from=0, to=1.1, by=0.25) sum(vec1) mat=matrix(data=c(9,2,3,4,5,6),ncol=3) t = data.frame(x = c(11,12,14), y = c(19,20,21), z = c(10,9,7)) L = list(one=1, two=c(1,2), five=seq(0, 1, length=5)) plot(rnorm(100), type="l", col="gold") d = data.frame(a = c(3,4,5), b = c(12,43,54)) write.table(d, file="tst0.txt", row.names=FALSE) d2 = read.table(file="tst0.txt", header=TRUE) j = c(1,2,NA) max(j, na.rm=TRUE) m = "apples" date1=strptime( c("20100225230000", "20100226000000", "20100226010000"), format="%Y%m%d%H%M%S") dt = as.Date('1915-6-16') dt1 = as.Date('1/15/2001',format='%m/%d/%Y') h = seq(from=1, to=8) s = c() for(i in 2:10) { s[i] = h[i] * 10 } fun1 = function(arg1, arg2) { w = arg1 ^ 2 return(arg2 + w) }
# @knitr setup fillcolor <- "gray90" # @knitr Fig1 ------------------------------------------------------------------- library(VGAM) ## Variant A svg("figs/Taavi1a.svg", width = 4, height = 2.76, pointsize = 12) Scale <- 0.3 par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(0, 1.2), ylim = c(0, 2)) qq <- qrayleigh(0.2, scale = Scale) coord.x <- c(0, seq(0, qq, 0.01), qq) coord.y <- c(0, drayleigh(seq(0, qq, 0.01), scale = Scale), 0) polygon(coord.x, coord.y, col = fillcolor, border = NA) curve(drayleigh(x, Scale), xlim = c(0, 1.2), ylab = NA, xlab = NA, add = T) text(c(0.12, 0.45), y = 0.4, c(expression(alpha), expression(1 - alpha))) axis(side = 1, at = qq, labels = expression(x[alpha]), pos = 0) axis(side = 2, labels = NA, lwd.ticks = 0) lines(qq, drayleigh(qq, scale = Scale), lty = 3, type = "h") abline(h = 0, lty = 1) loc <- par("usr") text(loc[1], loc[4], labels = expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off() ## Variant B svg("figs/Taavi1b.svg", width = 4, height = 2.76, pointsize = 12) par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(0, 1.2), ylim = c(0, 2)) qq <- qrayleigh(0.2, scale = Scale) coord.x <- c(0, seq(0, qq, 0.01), qq) coord.y <- c(0, drayleigh(seq(0, qq, 0.01), scale = Scale), 0) polygon(coord.x, coord.y, col = fillcolor, border = NA) curve(drayleigh(x, Scale), xlim = c(0, 1.2), ylab = NA, xlab = NA, add = T) axis(side = 1, at = qq, labels = expression(x[0.2]), pos = 0) # Kas tavalise fondiga või italicus? axis(side = 2, labels = NA, lwd.ticks = 0) lines(qq, drayleigh(qq, scale = Scale), lty = 3, type = "h") abline(h = 0, lty = 1) text(c(0.12, 0.45), y = 0.4, c(0.2, 0.8)) loc <- par("usr") text(loc[1], loc[4], expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off() # @knitr Fig2 ------------------------------------------------------------------- svg("figs/Taavi2.svg", width = 4, height = 2.76, pointsize = 12) par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(-3, 3), ylim = c(0, .4)) qq <- round(qnorm(c(0.025, 0.975)), 2) coord.x <- c(-3, seq(-3, qq[1], 0.01), qq[1]) coord.y <- c(0, dnorm(seq(-3, qq[1], 0.01)), 0) polygon(coord.x, coord.y, col = 'gray90', border = NA, density = NA) coord.x <- c(qq[2], seq(qq[2], 3, 0.01), 3) coord.y <- c(0, dnorm(seq(qq[2], 3, 0.01)), 0) polygon(coord.x, coord.y, col = fillcolor, border = NA, density = NA) text(0, y = dnorm(0.5)/2, 0.95) curve(dnorm(x), xlim = c(-3, 3), ylab = NA, xlab = NA, add = T) axis(side = 1, at = qq, pos = 0) lines(qq, dnorm(qq), lty = 3, type = "h") arrows(0, 0, 0, 5, lwd = 1, length = 0.15) abline(h = 0, lty = 1) loc <- par("usr") text(0, dnorm(0) + 0.02, expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off() # @knitr Fig3 ------------------------------------------------------------------- # two-tailed svg("figs/Taavi3_two-tailed.svg", width = 4, height = 2.76, pointsize = 12) par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(-3, 3), ylim = c(0, .4)) qq <- round(qnorm(c(0.025, 0.975)), 2) coord.x <- c(-3, seq(-3, qq[1], 0.01), qq[1]) coord.y <- c(0, dnorm(seq(-3, qq[1], 0.01)), 0) polygon(coord.x, coord.y, col = 'gray90', border = NA, density = NA) coord.x <- c(qq[2], seq(qq[2], 3, 0.01), 3) coord.y <- c(0, dnorm(seq(qq[2], 3, 0.01)), 0) polygon(coord.x, coord.y, col = fillcolor, border = NA, density = NA) text(qnorm(c(0.025, 0.975)), y = 0.017, labels = expression(p), pos = c(2, 4)) # U+1D4D7 axis(side = 1, at = qq, labels = c(expression(-t), expression(t)), pos = 0, font = 3) lines(qq, dnorm(qq), lty = 3, type = "h") arrows(0, 0, 0, 5, lwd = 1, length = 0.15) abline(h = 0, lty = 1) curve(dnorm(x), xlim = c(-3, 3), ylab = NA, xlab = NA, add = T) loc <- par("usr") text(0, dnorm(0) + 0.02, expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off() ## Right svg("figs/Taavi3_right-tailed.svg", width = 4, height = 2.76, pointsize = 12) par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(-3, 3), ylim = c(0, .4)) qq <- round(qnorm(0.95), 2) coord.x <- c(qq, seq(qq, 3, 0.01), 3) coord.y <- c(0, dnorm(seq(qq, 3, 0.01)), 0) polygon(coord.x, coord.y, col = fillcolor, border = NA, density = NA) text(qnorm(0.95), y = 0.035, labels = expression(p), pos = 4) # U+1D4D7 axis(side = 1, at = qq, labels = expression(t), pos = 0) lines(qq, dnorm(qq), lty = 3, type = "h") arrows(0, 0, 0, 5, lwd = 1, length = 0.15) abline(h = 0, lty = 1) curve(dnorm(x), xlim = c(-3, 3), ylab = NA, xlab = NA, add = T) loc <- par("usr") text(0, dnorm(0) + 0.02, expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off() ## Left svg("figs/Taavi3_left-tailed.svg", width = 4, height = 2.76, pointsize = 12) par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(-3, 3), ylim = c(0, .4)) qq <- round(qnorm(0.05), 2) coord.x <- c(-3, seq(-3, qq, 0.01), qq) coord.y <- c(0, dnorm(seq(-3, qq, 0.01)), 0) polygon(coord.x, coord.y, col = 'gray90', border = NA, density = NA) text(qnorm(0.05), y = 0.035, labels = expression(p), pos = 2) # U+1D4D7 axis(side = 1, at = qq, labels = expression(-t), pos = 0) lines(qq, dnorm(qq), lty = 3, type = "h") arrows(0, 0, 0, 5, lwd = 1, length = 0.15) abline(h = 0, lty = 1) curve(dnorm(x), xlim = c(-3, 3), ylab = NA, xlab = NA, add = T) loc <- par("usr") text(0, dnorm(0) + 0.02, expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off() # @knitr Fig4 ------------------------------------------------------------------- ## left svg("figs/Taavi4_left.svg", width = 4, height = 2.76, pointsize = 12) par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(0, 30), ylim = c(0, .1)) df <- 4 ncp <- 4 qq <- round(qchisq(0.05, df = df, ncp = ncp), 2) coord.x <- c(0, seq(0, qq, 0.01), qq) coord.y <- c(0, dchisq(seq(0, qq, 0.01), df = df, ncp = ncp), 0) polygon(coord.x, coord.y, col = 'gray90', border = NA, density = NA) text(qchisq(0.01, df = df, ncp = ncp), y = 0.018, labels = expression(p), pos = 1) axis(side = 1, at = qq, labels = expression(t), pos = 0) axis(side = 2, labels = NA, lwd.ticks = 0) lines(qq, dchisq(qq, df = df, ncp = ncp), lty = 3, type = "h") abline(h = 0, lty = 1) curve(dchisq(x, df = df, ncp = ncp), xlim = c(0, 30), ylab = NA, xlab = NA, add = T) loc <- par("usr") text(loc[1], loc[4], expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off() ## right svg("figs/Taavi4_right.svg", width = 4, height = 2.76, pointsize = 12) par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(0, 30), ylim = c(0, .1)) qq <- round(qchisq(0.95, df = df, ncp = ncp), 2) coord.x <- c(qq, seq(qq, 30, 0.01), 30) coord.y <- c(0, dchisq(seq(qq, 30, 0.01), df = df, ncp = ncp), 0) polygon(coord.x, coord.y, col = 'gray90', border = NA, density = NA) text(qchisq(0.96, df = df, ncp = ncp), y = 0.005, labels = expression(p)) axis(side = 1, at = qq, labels = expression(t), pos = 0) axis(side = 2, labels = NA, lwd.ticks = 0) lines(qq, dchisq(qq, df = df, ncp = ncp), lty = 3, type = "h") abline(h = 0, lty = 1) curve(dchisq(x, df = df, ncp = ncp), xlim = c(0, 30), ylab = NA, xlab = NA, add = T) loc <- par("usr") text(loc[1], loc[4], expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off() # @knitr Fig6 ------------------------------------------------------------------- svg("figs/Taavi6.svg", width = 5, height = 2.76, pointsize = 12) df <- 5 ncp <- 0 par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(0, 20), ylim = c(0, .15)) qq <- round(qchisq(c(0.708, 0.95), df = df, ncp = ncp), 2) coord.x <- c(qq[1], seq(qq[1], 20, 0.01), 20) coord.y <- c(0, dchisq(seq(qq[1], 20, 0.01), df = df, ncp = ncp), 0) polygon(coord.x, coord.y, col = 'gray90', border = NA, density = NA) text(qchisq(mean(c(0.708, 0.95)), df = df, ncp = ncp) + 0.8, y = dchisq(mean(c(0.708, 0.95)), df = df, ncp = ncp)/3.2, labels = round(1 - 0.708, 2)) axis(side = 1, at = qq, labels = qq, pos = 0) axis(side = 2, labels = NA, lwd.ticks = 0) abline(h = 0, lty = 1) lines(qq, dchisq(qq, df = df, ncp = ncp), lty = 3, type = "h") curve(dchisq(x, df = df, ncp = ncp), xlim = c(0, 20), ylab = NA, xlab = NA, add = T) loc <- par("usr") text(loc[1], loc[4], expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off()
/R/figs.R
no_license
tpall/book-figs
R
false
false
8,734
r
# @knitr setup fillcolor <- "gray90" # @knitr Fig1 ------------------------------------------------------------------- library(VGAM) ## Variant A svg("figs/Taavi1a.svg", width = 4, height = 2.76, pointsize = 12) Scale <- 0.3 par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(0, 1.2), ylim = c(0, 2)) qq <- qrayleigh(0.2, scale = Scale) coord.x <- c(0, seq(0, qq, 0.01), qq) coord.y <- c(0, drayleigh(seq(0, qq, 0.01), scale = Scale), 0) polygon(coord.x, coord.y, col = fillcolor, border = NA) curve(drayleigh(x, Scale), xlim = c(0, 1.2), ylab = NA, xlab = NA, add = T) text(c(0.12, 0.45), y = 0.4, c(expression(alpha), expression(1 - alpha))) axis(side = 1, at = qq, labels = expression(x[alpha]), pos = 0) axis(side = 2, labels = NA, lwd.ticks = 0) lines(qq, drayleigh(qq, scale = Scale), lty = 3, type = "h") abline(h = 0, lty = 1) loc <- par("usr") text(loc[1], loc[4], labels = expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off() ## Variant B svg("figs/Taavi1b.svg", width = 4, height = 2.76, pointsize = 12) par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(0, 1.2), ylim = c(0, 2)) qq <- qrayleigh(0.2, scale = Scale) coord.x <- c(0, seq(0, qq, 0.01), qq) coord.y <- c(0, drayleigh(seq(0, qq, 0.01), scale = Scale), 0) polygon(coord.x, coord.y, col = fillcolor, border = NA) curve(drayleigh(x, Scale), xlim = c(0, 1.2), ylab = NA, xlab = NA, add = T) axis(side = 1, at = qq, labels = expression(x[0.2]), pos = 0) # Kas tavalise fondiga või italicus? axis(side = 2, labels = NA, lwd.ticks = 0) lines(qq, drayleigh(qq, scale = Scale), lty = 3, type = "h") abline(h = 0, lty = 1) text(c(0.12, 0.45), y = 0.4, c(0.2, 0.8)) loc <- par("usr") text(loc[1], loc[4], expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off() # @knitr Fig2 ------------------------------------------------------------------- svg("figs/Taavi2.svg", width = 4, height = 2.76, pointsize = 12) par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(-3, 3), ylim = c(0, .4)) qq <- round(qnorm(c(0.025, 0.975)), 2) coord.x <- c(-3, seq(-3, qq[1], 0.01), qq[1]) coord.y <- c(0, dnorm(seq(-3, qq[1], 0.01)), 0) polygon(coord.x, coord.y, col = 'gray90', border = NA, density = NA) coord.x <- c(qq[2], seq(qq[2], 3, 0.01), 3) coord.y <- c(0, dnorm(seq(qq[2], 3, 0.01)), 0) polygon(coord.x, coord.y, col = fillcolor, border = NA, density = NA) text(0, y = dnorm(0.5)/2, 0.95) curve(dnorm(x), xlim = c(-3, 3), ylab = NA, xlab = NA, add = T) axis(side = 1, at = qq, pos = 0) lines(qq, dnorm(qq), lty = 3, type = "h") arrows(0, 0, 0, 5, lwd = 1, length = 0.15) abline(h = 0, lty = 1) loc <- par("usr") text(0, dnorm(0) + 0.02, expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off() # @knitr Fig3 ------------------------------------------------------------------- # two-tailed svg("figs/Taavi3_two-tailed.svg", width = 4, height = 2.76, pointsize = 12) par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(-3, 3), ylim = c(0, .4)) qq <- round(qnorm(c(0.025, 0.975)), 2) coord.x <- c(-3, seq(-3, qq[1], 0.01), qq[1]) coord.y <- c(0, dnorm(seq(-3, qq[1], 0.01)), 0) polygon(coord.x, coord.y, col = 'gray90', border = NA, density = NA) coord.x <- c(qq[2], seq(qq[2], 3, 0.01), 3) coord.y <- c(0, dnorm(seq(qq[2], 3, 0.01)), 0) polygon(coord.x, coord.y, col = fillcolor, border = NA, density = NA) text(qnorm(c(0.025, 0.975)), y = 0.017, labels = expression(p), pos = c(2, 4)) # U+1D4D7 axis(side = 1, at = qq, labels = c(expression(-t), expression(t)), pos = 0, font = 3) lines(qq, dnorm(qq), lty = 3, type = "h") arrows(0, 0, 0, 5, lwd = 1, length = 0.15) abline(h = 0, lty = 1) curve(dnorm(x), xlim = c(-3, 3), ylab = NA, xlab = NA, add = T) loc <- par("usr") text(0, dnorm(0) + 0.02, expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off() ## Right svg("figs/Taavi3_right-tailed.svg", width = 4, height = 2.76, pointsize = 12) par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(-3, 3), ylim = c(0, .4)) qq <- round(qnorm(0.95), 2) coord.x <- c(qq, seq(qq, 3, 0.01), 3) coord.y <- c(0, dnorm(seq(qq, 3, 0.01)), 0) polygon(coord.x, coord.y, col = fillcolor, border = NA, density = NA) text(qnorm(0.95), y = 0.035, labels = expression(p), pos = 4) # U+1D4D7 axis(side = 1, at = qq, labels = expression(t), pos = 0) lines(qq, dnorm(qq), lty = 3, type = "h") arrows(0, 0, 0, 5, lwd = 1, length = 0.15) abline(h = 0, lty = 1) curve(dnorm(x), xlim = c(-3, 3), ylab = NA, xlab = NA, add = T) loc <- par("usr") text(0, dnorm(0) + 0.02, expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off() ## Left svg("figs/Taavi3_left-tailed.svg", width = 4, height = 2.76, pointsize = 12) par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(-3, 3), ylim = c(0, .4)) qq <- round(qnorm(0.05), 2) coord.x <- c(-3, seq(-3, qq, 0.01), qq) coord.y <- c(0, dnorm(seq(-3, qq, 0.01)), 0) polygon(coord.x, coord.y, col = 'gray90', border = NA, density = NA) text(qnorm(0.05), y = 0.035, labels = expression(p), pos = 2) # U+1D4D7 axis(side = 1, at = qq, labels = expression(-t), pos = 0) lines(qq, dnorm(qq), lty = 3, type = "h") arrows(0, 0, 0, 5, lwd = 1, length = 0.15) abline(h = 0, lty = 1) curve(dnorm(x), xlim = c(-3, 3), ylab = NA, xlab = NA, add = T) loc <- par("usr") text(0, dnorm(0) + 0.02, expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off() # @knitr Fig4 ------------------------------------------------------------------- ## left svg("figs/Taavi4_left.svg", width = 4, height = 2.76, pointsize = 12) par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(0, 30), ylim = c(0, .1)) df <- 4 ncp <- 4 qq <- round(qchisq(0.05, df = df, ncp = ncp), 2) coord.x <- c(0, seq(0, qq, 0.01), qq) coord.y <- c(0, dchisq(seq(0, qq, 0.01), df = df, ncp = ncp), 0) polygon(coord.x, coord.y, col = 'gray90', border = NA, density = NA) text(qchisq(0.01, df = df, ncp = ncp), y = 0.018, labels = expression(p), pos = 1) axis(side = 1, at = qq, labels = expression(t), pos = 0) axis(side = 2, labels = NA, lwd.ticks = 0) lines(qq, dchisq(qq, df = df, ncp = ncp), lty = 3, type = "h") abline(h = 0, lty = 1) curve(dchisq(x, df = df, ncp = ncp), xlim = c(0, 30), ylab = NA, xlab = NA, add = T) loc <- par("usr") text(loc[1], loc[4], expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off() ## right svg("figs/Taavi4_right.svg", width = 4, height = 2.76, pointsize = 12) par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(0, 30), ylim = c(0, .1)) qq <- round(qchisq(0.95, df = df, ncp = ncp), 2) coord.x <- c(qq, seq(qq, 30, 0.01), 30) coord.y <- c(0, dchisq(seq(qq, 30, 0.01), df = df, ncp = ncp), 0) polygon(coord.x, coord.y, col = 'gray90', border = NA, density = NA) text(qchisq(0.96, df = df, ncp = ncp), y = 0.005, labels = expression(p)) axis(side = 1, at = qq, labels = expression(t), pos = 0) axis(side = 2, labels = NA, lwd.ticks = 0) lines(qq, dchisq(qq, df = df, ncp = ncp), lty = 3, type = "h") abline(h = 0, lty = 1) curve(dchisq(x, df = df, ncp = ncp), xlim = c(0, 30), ylab = NA, xlab = NA, add = T) loc <- par("usr") text(loc[1], loc[4], expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off() # @knitr Fig6 ------------------------------------------------------------------- svg("figs/Taavi6.svg", width = 5, height = 2.76, pointsize = 12) df <- 5 ncp <- 0 par(mar = rep(2, 4)) plot.new() plot.window(xlim = c(0, 20), ylim = c(0, .15)) qq <- round(qchisq(c(0.708, 0.95), df = df, ncp = ncp), 2) coord.x <- c(qq[1], seq(qq[1], 20, 0.01), 20) coord.y <- c(0, dchisq(seq(qq[1], 20, 0.01), df = df, ncp = ncp), 0) polygon(coord.x, coord.y, col = 'gray90', border = NA, density = NA) text(qchisq(mean(c(0.708, 0.95)), df = df, ncp = ncp) + 0.8, y = dchisq(mean(c(0.708, 0.95)), df = df, ncp = ncp)/3.2, labels = round(1 - 0.708, 2)) axis(side = 1, at = qq, labels = qq, pos = 0) axis(side = 2, labels = NA, lwd.ticks = 0) abline(h = 0, lty = 1) lines(qq, dchisq(qq, df = df, ncp = ncp), lty = 3, type = "h") curve(dchisq(x, df = df, ncp = ncp), xlim = c(0, 20), ylab = NA, xlab = NA, add = T) loc <- par("usr") text(loc[1], loc[4], expression(f(x)), pos = 2, xpd = T) text(loc[2], loc[3], expression(x), pos = 4, xpd = T) dev.off()
#' @name get_mon #' @export get_mon_attributes <- function(...) { x <- simmer::get_mon_attributes(...) class(x) <- c("attributes", class(x)) x } #' @name plot.mon #' @param keys attributes to plot (if left empty, all attributes are shown). #' #' @details The S3 method for 'attributes' does not support any metric. It simply #' shows a stairstep graph of the values throughout the simulation for the keys #' provided (or all the collected attributes if no key is provided). #' #' @export plot.attributes <- function(x, metric=NULL, keys, ...) { if (!missing(keys)) x <- x %>% dplyr::filter(.data$key %in% keys) %>% dplyr::mutate(key = factor(.data$key, levels = keys)) if (nrow(x) == 0) stop("no data available or 'keys' not found") plot_obj <- ggplot(x) + aes_(x = ~time, y = ~value) + geom_step(aes_(group = ~replication), alpha = set_alpha(x)) + stat_smooth() + xlab("simulation time") + ylab("value") + expand_limits(y = 0) if (length(unique(x$key)) > 1) { plot_obj <- plot_obj + ggtitle("Attribute evolution") + facet_wrap(~key, scales = "free_y") } else { plot_obj <- plot_obj + ggtitle(paste0("Attribute evolution: ", x$key[[1]])) } plot_obj }
/R/plot.attributes.R
no_license
gridl/simmer.plot
R
false
false
1,246
r
#' @name get_mon #' @export get_mon_attributes <- function(...) { x <- simmer::get_mon_attributes(...) class(x) <- c("attributes", class(x)) x } #' @name plot.mon #' @param keys attributes to plot (if left empty, all attributes are shown). #' #' @details The S3 method for 'attributes' does not support any metric. It simply #' shows a stairstep graph of the values throughout the simulation for the keys #' provided (or all the collected attributes if no key is provided). #' #' @export plot.attributes <- function(x, metric=NULL, keys, ...) { if (!missing(keys)) x <- x %>% dplyr::filter(.data$key %in% keys) %>% dplyr::mutate(key = factor(.data$key, levels = keys)) if (nrow(x) == 0) stop("no data available or 'keys' not found") plot_obj <- ggplot(x) + aes_(x = ~time, y = ~value) + geom_step(aes_(group = ~replication), alpha = set_alpha(x)) + stat_smooth() + xlab("simulation time") + ylab("value") + expand_limits(y = 0) if (length(unique(x$key)) > 1) { plot_obj <- plot_obj + ggtitle("Attribute evolution") + facet_wrap(~key, scales = "free_y") } else { plot_obj <- plot_obj + ggtitle(paste0("Attribute evolution: ", x$key[[1]])) } plot_obj }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/main.R \name{get_mer_data} \alias{get_mer_data} \title{MER} \usage{ get_mer_data(api_key, compnum) } \arguments{ \item{api_key}{API Key object (see also, setapi())} \item{compnum}{company number (see also, compdata)} } \description{ https://www.quandl.com/databases/MF1/documentation Mergent Global Fundamental Data에서 제공한 데이터를 검색할 수 있습니다. Quandly의 api_key를 첫번째 인자로, compdata의 compnumber를 두번째 인자로 입력합니다. }
/man/get_mer_data.Rd
no_license
drtagkim/quandlWrapper
R
false
true
560
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/main.R \name{get_mer_data} \alias{get_mer_data} \title{MER} \usage{ get_mer_data(api_key, compnum) } \arguments{ \item{api_key}{API Key object (see also, setapi())} \item{compnum}{company number (see also, compdata)} } \description{ https://www.quandl.com/databases/MF1/documentation Mergent Global Fundamental Data에서 제공한 데이터를 검색할 수 있습니다. Quandly의 api_key를 첫번째 인자로, compdata의 compnumber를 두번째 인자로 입력합니다. }
library(glmnet) mydata = read.table("./TrainingSet/RF/endometrium.csv",head=T,sep=",") x = as.matrix(mydata[,4:ncol(mydata)]) y = as.matrix(mydata[,1]) set.seed(123) glm = cv.glmnet(x,y,nfolds=10,type.measure="mse",alpha=1,family="gaussian",standardize=FALSE) sink('./Model/EN/Classifier/endometrium/endometrium_098.txt',append=TRUE) print(glm$glmnet.fit) sink()
/Model/EN/Classifier/endometrium/endometrium_098.R
no_license
leon1003/QSMART
R
false
false
363
r
library(glmnet) mydata = read.table("./TrainingSet/RF/endometrium.csv",head=T,sep=",") x = as.matrix(mydata[,4:ncol(mydata)]) y = as.matrix(mydata[,1]) set.seed(123) glm = cv.glmnet(x,y,nfolds=10,type.measure="mse",alpha=1,family="gaussian",standardize=FALSE) sink('./Model/EN/Classifier/endometrium/endometrium_098.txt',append=TRUE) print(glm$glmnet.fit) sink()
# Read data data1 = read.csv("Zomnumeric.csv") View(data1) # load library library(caret) library(e1071) # Transforming the dependent variable to a factor data1$Has.Table.booking = as.factor(data1$Has.Table.booking) #Partitioning the data into training and validation data set.seed(101) index = createDataPartition(data1$Has.Table.booking, p = 0.7, list = F ) train = data1[index,] validation = data1[-index,] # Explore data dim(train) dim(validation) names(train) head(train) head(validation) # Setting levels for both training and validation data levels(train$Has.Table.booking) <- make.names(levels(factor(train$Has.Table.booking))) levels(validation$Has.Table.booking) <- make.names(levels(factor(validation$Has.Table.booking))) # Setting up train controls repeats = 3 numbers = 10 tunel = 10 set.seed(1234) x = trainControl(method = "repeatedcv", number = numbers, repeats = repeats, classProbs = TRUE, summaryFunction = twoClassSummary) model1 <- train(Has.Table.booking~. , data = train, method = "knn", preProcess = c("center","scale"), trControl = x, metric = "ROC", tuneLength = tunel) # Summary of model model1 plot(model1) # Validation valid_pred <- predict(model1,validation, type = "prob") #Storing Model Performance Scores library(ROCR) pred_val <-prediction(valid_pred[,2],validation$Has.Table.booking) # Calculating Area under Curve (AUC) perf_val <- performance(pred_val,"auc") perf_val # Plot AUC perf_val <- performance(pred_val, "tpr", "fpr") plot(perf_val, col = "green", lwd = 1.5) #Calculating KS statistics ks <- max(attr(perf_val, "y.values")[[1]] - (attr(perf_val, "x.values")[[1]])) ks
/knearestwrkng.R
no_license
Madumitha-S/da
R
false
false
1,815
r
# Read data data1 = read.csv("Zomnumeric.csv") View(data1) # load library library(caret) library(e1071) # Transforming the dependent variable to a factor data1$Has.Table.booking = as.factor(data1$Has.Table.booking) #Partitioning the data into training and validation data set.seed(101) index = createDataPartition(data1$Has.Table.booking, p = 0.7, list = F ) train = data1[index,] validation = data1[-index,] # Explore data dim(train) dim(validation) names(train) head(train) head(validation) # Setting levels for both training and validation data levels(train$Has.Table.booking) <- make.names(levels(factor(train$Has.Table.booking))) levels(validation$Has.Table.booking) <- make.names(levels(factor(validation$Has.Table.booking))) # Setting up train controls repeats = 3 numbers = 10 tunel = 10 set.seed(1234) x = trainControl(method = "repeatedcv", number = numbers, repeats = repeats, classProbs = TRUE, summaryFunction = twoClassSummary) model1 <- train(Has.Table.booking~. , data = train, method = "knn", preProcess = c("center","scale"), trControl = x, metric = "ROC", tuneLength = tunel) # Summary of model model1 plot(model1) # Validation valid_pred <- predict(model1,validation, type = "prob") #Storing Model Performance Scores library(ROCR) pred_val <-prediction(valid_pred[,2],validation$Has.Table.booking) # Calculating Area under Curve (AUC) perf_val <- performance(pred_val,"auc") perf_val # Plot AUC perf_val <- performance(pred_val, "tpr", "fpr") plot(perf_val, col = "green", lwd = 1.5) #Calculating KS statistics ks <- max(attr(perf_val, "y.values")[[1]] - (attr(perf_val, "x.values")[[1]])) ks
# This file is generated by make.paws. Please do not edit here. #' @importFrom paws.common get_config new_operation new_request send_request #' @include schemas_service.R NULL #' Creates a discoverer #' #' @description #' Creates a discoverer. #' #' @usage #' schemas_create_discoverer(Description, SourceArn, Tags) #' #' @param Description A description for the discoverer. #' @param SourceArn &#91;required&#93; The ARN of the event bus. #' @param Tags Tags associated with the resource. #' #' @section Request syntax: #' ``` #' svc$create_discoverer( #' Description = "string", #' SourceArn = "string", #' Tags = list( #' "string" #' ) #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_create_discoverer schemas_create_discoverer <- function(Description = NULL, SourceArn, Tags = NULL) { op <- new_operation( name = "CreateDiscoverer", http_method = "POST", http_path = "/v1/discoverers", paginator = list() ) input <- .schemas$create_discoverer_input(Description = Description, SourceArn = SourceArn, Tags = Tags) output <- .schemas$create_discoverer_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$create_discoverer <- schemas_create_discoverer #' Creates a registry #' #' @description #' Creates a registry. #' #' @usage #' schemas_create_registry(Description, RegistryName, Tags) #' #' @param Description A description of the registry to be created. #' @param RegistryName &#91;required&#93; The name of the registry. #' @param Tags Tags to associate with the registry. #' #' @section Request syntax: #' ``` #' svc$create_registry( #' Description = "string", #' RegistryName = "string", #' Tags = list( #' "string" #' ) #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_create_registry schemas_create_registry <- function(Description = NULL, RegistryName, Tags = NULL) { op <- new_operation( name = "CreateRegistry", http_method = "POST", http_path = "/v1/registries/name/{registryName}", paginator = list() ) input <- .schemas$create_registry_input(Description = Description, RegistryName = RegistryName, Tags = Tags) output <- .schemas$create_registry_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$create_registry <- schemas_create_registry #' Creates a schema definition #' #' @description #' Creates a schema definition. #' #' Inactive schemas will be deleted after two years. #' #' @usage #' schemas_create_schema(Content, Description, RegistryName, SchemaName, #' Tags, Type) #' #' @param Content &#91;required&#93; The source of the schema definition. #' @param Description A description of the schema. #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' @param Tags Tags associated with the schema. #' @param Type &#91;required&#93; The type of schema. #' #' @section Request syntax: #' ``` #' svc$create_schema( #' Content = "string", #' Description = "string", #' RegistryName = "string", #' SchemaName = "string", #' Tags = list( #' "string" #' ), #' Type = "OpenApi3"|"JSONSchemaDraft4" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_create_schema schemas_create_schema <- function(Content, Description = NULL, RegistryName, SchemaName, Tags = NULL, Type) { op <- new_operation( name = "CreateSchema", http_method = "POST", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}", paginator = list() ) input <- .schemas$create_schema_input(Content = Content, Description = Description, RegistryName = RegistryName, SchemaName = SchemaName, Tags = Tags, Type = Type) output <- .schemas$create_schema_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$create_schema <- schemas_create_schema #' Deletes a discoverer #' #' @description #' Deletes a discoverer. #' #' @usage #' schemas_delete_discoverer(DiscovererId) #' #' @param DiscovererId &#91;required&#93; The ID of the discoverer. #' #' @section Request syntax: #' ``` #' svc$delete_discoverer( #' DiscovererId = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_delete_discoverer schemas_delete_discoverer <- function(DiscovererId) { op <- new_operation( name = "DeleteDiscoverer", http_method = "DELETE", http_path = "/v1/discoverers/id/{discovererId}", paginator = list() ) input <- .schemas$delete_discoverer_input(DiscovererId = DiscovererId) output <- .schemas$delete_discoverer_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$delete_discoverer <- schemas_delete_discoverer #' Deletes a Registry #' #' @description #' Deletes a Registry. #' #' @usage #' schemas_delete_registry(RegistryName) #' #' @param RegistryName &#91;required&#93; The name of the registry. #' #' @section Request syntax: #' ``` #' svc$delete_registry( #' RegistryName = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_delete_registry schemas_delete_registry <- function(RegistryName) { op <- new_operation( name = "DeleteRegistry", http_method = "DELETE", http_path = "/v1/registries/name/{registryName}", paginator = list() ) input <- .schemas$delete_registry_input(RegistryName = RegistryName) output <- .schemas$delete_registry_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$delete_registry <- schemas_delete_registry #' Delete the resource-based policy attached to the specified registry #' #' @description #' Delete the resource-based policy attached to the specified registry. #' #' @usage #' schemas_delete_resource_policy(RegistryName) #' #' @param RegistryName The name of the registry. #' #' @section Request syntax: #' ``` #' svc$delete_resource_policy( #' RegistryName = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_delete_resource_policy schemas_delete_resource_policy <- function(RegistryName = NULL) { op <- new_operation( name = "DeleteResourcePolicy", http_method = "DELETE", http_path = "/v1/policy", paginator = list() ) input <- .schemas$delete_resource_policy_input(RegistryName = RegistryName) output <- .schemas$delete_resource_policy_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$delete_resource_policy <- schemas_delete_resource_policy #' Delete a schema definition #' #' @description #' Delete a schema definition. #' #' @usage #' schemas_delete_schema(RegistryName, SchemaName) #' #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' #' @section Request syntax: #' ``` #' svc$delete_schema( #' RegistryName = "string", #' SchemaName = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_delete_schema schemas_delete_schema <- function(RegistryName, SchemaName) { op <- new_operation( name = "DeleteSchema", http_method = "DELETE", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}", paginator = list() ) input <- .schemas$delete_schema_input(RegistryName = RegistryName, SchemaName = SchemaName) output <- .schemas$delete_schema_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$delete_schema <- schemas_delete_schema #' Delete the schema version definition #' #' @description #' Delete the schema version definition #' #' @usage #' schemas_delete_schema_version(RegistryName, SchemaName, SchemaVersion) #' #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' @param SchemaVersion &#91;required&#93; The version number of the schema #' #' @section Request syntax: #' ``` #' svc$delete_schema_version( #' RegistryName = "string", #' SchemaName = "string", #' SchemaVersion = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_delete_schema_version schemas_delete_schema_version <- function(RegistryName, SchemaName, SchemaVersion) { op <- new_operation( name = "DeleteSchemaVersion", http_method = "DELETE", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}/version/{schemaVersion}", paginator = list() ) input <- .schemas$delete_schema_version_input(RegistryName = RegistryName, SchemaName = SchemaName, SchemaVersion = SchemaVersion) output <- .schemas$delete_schema_version_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$delete_schema_version <- schemas_delete_schema_version #' Describe the code binding URI #' #' @description #' Describe the code binding URI. #' #' @usage #' schemas_describe_code_binding(Language, RegistryName, SchemaName, #' SchemaVersion) #' #' @param Language &#91;required&#93; The language of the code binding. #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' @param SchemaVersion Specifying this limits the results to only this schema version. #' #' @section Request syntax: #' ``` #' svc$describe_code_binding( #' Language = "string", #' RegistryName = "string", #' SchemaName = "string", #' SchemaVersion = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_describe_code_binding schemas_describe_code_binding <- function(Language, RegistryName, SchemaName, SchemaVersion = NULL) { op <- new_operation( name = "DescribeCodeBinding", http_method = "GET", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}/language/{language}", paginator = list() ) input <- .schemas$describe_code_binding_input(Language = Language, RegistryName = RegistryName, SchemaName = SchemaName, SchemaVersion = SchemaVersion) output <- .schemas$describe_code_binding_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$describe_code_binding <- schemas_describe_code_binding #' Describes the discoverer #' #' @description #' Describes the discoverer. #' #' @usage #' schemas_describe_discoverer(DiscovererId) #' #' @param DiscovererId &#91;required&#93; The ID of the discoverer. #' #' @section Request syntax: #' ``` #' svc$describe_discoverer( #' DiscovererId = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_describe_discoverer schemas_describe_discoverer <- function(DiscovererId) { op <- new_operation( name = "DescribeDiscoverer", http_method = "GET", http_path = "/v1/discoverers/id/{discovererId}", paginator = list() ) input <- .schemas$describe_discoverer_input(DiscovererId = DiscovererId) output <- .schemas$describe_discoverer_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$describe_discoverer <- schemas_describe_discoverer #' Describes the registry #' #' @description #' Describes the registry. #' #' @usage #' schemas_describe_registry(RegistryName) #' #' @param RegistryName &#91;required&#93; The name of the registry. #' #' @section Request syntax: #' ``` #' svc$describe_registry( #' RegistryName = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_describe_registry schemas_describe_registry <- function(RegistryName) { op <- new_operation( name = "DescribeRegistry", http_method = "GET", http_path = "/v1/registries/name/{registryName}", paginator = list() ) input <- .schemas$describe_registry_input(RegistryName = RegistryName) output <- .schemas$describe_registry_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$describe_registry <- schemas_describe_registry #' Retrieve the schema definition #' #' @description #' Retrieve the schema definition. #' #' @usage #' schemas_describe_schema(RegistryName, SchemaName, SchemaVersion) #' #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' @param SchemaVersion Specifying this limits the results to only this schema version. #' #' @section Request syntax: #' ``` #' svc$describe_schema( #' RegistryName = "string", #' SchemaName = "string", #' SchemaVersion = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_describe_schema schemas_describe_schema <- function(RegistryName, SchemaName, SchemaVersion = NULL) { op <- new_operation( name = "DescribeSchema", http_method = "GET", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}", paginator = list() ) input <- .schemas$describe_schema_input(RegistryName = RegistryName, SchemaName = SchemaName, SchemaVersion = SchemaVersion) output <- .schemas$describe_schema_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$describe_schema <- schemas_describe_schema #' Export schema #' #' @description #' Export schema #' #' @usage #' schemas_export_schema(RegistryName, SchemaName, SchemaVersion, Type) #' #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' @param SchemaVersion Specifying this limits the results to only this schema version. #' @param Type &#91;required&#93; #' #' @section Request syntax: #' ``` #' svc$export_schema( #' RegistryName = "string", #' SchemaName = "string", #' SchemaVersion = "string", #' Type = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_export_schema schemas_export_schema <- function(RegistryName, SchemaName, SchemaVersion = NULL, Type) { op <- new_operation( name = "ExportSchema", http_method = "GET", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}/export", paginator = list() ) input <- .schemas$export_schema_input(RegistryName = RegistryName, SchemaName = SchemaName, SchemaVersion = SchemaVersion, Type = Type) output <- .schemas$export_schema_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$export_schema <- schemas_export_schema #' Get the code binding source URI #' #' @description #' Get the code binding source URI. #' #' @usage #' schemas_get_code_binding_source(Language, RegistryName, SchemaName, #' SchemaVersion) #' #' @param Language &#91;required&#93; The language of the code binding. #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' @param SchemaVersion Specifying this limits the results to only this schema version. #' #' @section Request syntax: #' ``` #' svc$get_code_binding_source( #' Language = "string", #' RegistryName = "string", #' SchemaName = "string", #' SchemaVersion = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_get_code_binding_source schemas_get_code_binding_source <- function(Language, RegistryName, SchemaName, SchemaVersion = NULL) { op <- new_operation( name = "GetCodeBindingSource", http_method = "GET", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}/language/{language}/source", paginator = list() ) input <- .schemas$get_code_binding_source_input(Language = Language, RegistryName = RegistryName, SchemaName = SchemaName, SchemaVersion = SchemaVersion) output <- .schemas$get_code_binding_source_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$get_code_binding_source <- schemas_get_code_binding_source #' Get the discovered schema that was generated based on sampled events #' #' @description #' Get the discovered schema that was generated based on sampled events. #' #' @usage #' schemas_get_discovered_schema(Events, Type) #' #' @param Events &#91;required&#93; An array of strings where each string is a JSON event. These are the #' events that were used to generate the schema. The array includes a #' single type of event and has a maximum size of 10 events. #' @param Type &#91;required&#93; The type of event. #' #' @section Request syntax: #' ``` #' svc$get_discovered_schema( #' Events = list( #' "string" #' ), #' Type = "OpenApi3"|"JSONSchemaDraft4" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_get_discovered_schema schemas_get_discovered_schema <- function(Events, Type) { op <- new_operation( name = "GetDiscoveredSchema", http_method = "POST", http_path = "/v1/discover", paginator = list() ) input <- .schemas$get_discovered_schema_input(Events = Events, Type = Type) output <- .schemas$get_discovered_schema_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$get_discovered_schema <- schemas_get_discovered_schema #' Retrieves the resource-based policy attached to a given registry #' #' @description #' Retrieves the resource-based policy attached to a given registry. #' #' @usage #' schemas_get_resource_policy(RegistryName) #' #' @param RegistryName The name of the registry. #' #' @section Request syntax: #' ``` #' svc$get_resource_policy( #' RegistryName = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_get_resource_policy schemas_get_resource_policy <- function(RegistryName = NULL) { op <- new_operation( name = "GetResourcePolicy", http_method = "GET", http_path = "/v1/policy", paginator = list() ) input <- .schemas$get_resource_policy_input(RegistryName = RegistryName) output <- .schemas$get_resource_policy_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$get_resource_policy <- schemas_get_resource_policy #' List the discoverers #' #' @description #' List the discoverers. #' #' @usage #' schemas_list_discoverers(DiscovererIdPrefix, Limit, NextToken, #' SourceArnPrefix) #' #' @param DiscovererIdPrefix Specifying this limits the results to only those discoverer IDs that #' start with the specified prefix. #' @param Limit #' @param NextToken The token that specifies the next page of results to return. To request #' the first page, leave NextToken empty. The token will expire in 24 #' hours, and cannot be shared with other accounts. #' @param SourceArnPrefix Specifying this limits the results to only those ARNs that start with #' the specified prefix. #' #' @section Request syntax: #' ``` #' svc$list_discoverers( #' DiscovererIdPrefix = "string", #' Limit = 123, #' NextToken = "string", #' SourceArnPrefix = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_list_discoverers schemas_list_discoverers <- function(DiscovererIdPrefix = NULL, Limit = NULL, NextToken = NULL, SourceArnPrefix = NULL) { op <- new_operation( name = "ListDiscoverers", http_method = "GET", http_path = "/v1/discoverers", paginator = list() ) input <- .schemas$list_discoverers_input(DiscovererIdPrefix = DiscovererIdPrefix, Limit = Limit, NextToken = NextToken, SourceArnPrefix = SourceArnPrefix) output <- .schemas$list_discoverers_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$list_discoverers <- schemas_list_discoverers #' List the registries #' #' @description #' List the registries. #' #' @usage #' schemas_list_registries(Limit, NextToken, RegistryNamePrefix, Scope) #' #' @param Limit #' @param NextToken The token that specifies the next page of results to return. To request #' the first page, leave NextToken empty. The token will expire in 24 #' hours, and cannot be shared with other accounts. #' @param RegistryNamePrefix Specifying this limits the results to only those registry names that #' start with the specified prefix. #' @param Scope Can be set to Local or AWS to limit responses to your custom registries, #' or the ones provided by AWS. #' #' @section Request syntax: #' ``` #' svc$list_registries( #' Limit = 123, #' NextToken = "string", #' RegistryNamePrefix = "string", #' Scope = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_list_registries schemas_list_registries <- function(Limit = NULL, NextToken = NULL, RegistryNamePrefix = NULL, Scope = NULL) { op <- new_operation( name = "ListRegistries", http_method = "GET", http_path = "/v1/registries", paginator = list() ) input <- .schemas$list_registries_input(Limit = Limit, NextToken = NextToken, RegistryNamePrefix = RegistryNamePrefix, Scope = Scope) output <- .schemas$list_registries_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$list_registries <- schemas_list_registries #' Provides a list of the schema versions and related information #' #' @description #' Provides a list of the schema versions and related information. #' #' @usage #' schemas_list_schema_versions(Limit, NextToken, RegistryName, SchemaName) #' #' @param Limit #' @param NextToken The token that specifies the next page of results to return. To request #' the first page, leave NextToken empty. The token will expire in 24 #' hours, and cannot be shared with other accounts. #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' #' @section Request syntax: #' ``` #' svc$list_schema_versions( #' Limit = 123, #' NextToken = "string", #' RegistryName = "string", #' SchemaName = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_list_schema_versions schemas_list_schema_versions <- function(Limit = NULL, NextToken = NULL, RegistryName, SchemaName) { op <- new_operation( name = "ListSchemaVersions", http_method = "GET", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}/versions", paginator = list() ) input <- .schemas$list_schema_versions_input(Limit = Limit, NextToken = NextToken, RegistryName = RegistryName, SchemaName = SchemaName) output <- .schemas$list_schema_versions_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$list_schema_versions <- schemas_list_schema_versions #' List the schemas #' #' @description #' List the schemas. #' #' @usage #' schemas_list_schemas(Limit, NextToken, RegistryName, SchemaNamePrefix) #' #' @param Limit #' @param NextToken The token that specifies the next page of results to return. To request #' the first page, leave NextToken empty. The token will expire in 24 #' hours, and cannot be shared with other accounts. #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaNamePrefix Specifying this limits the results to only those schema names that start #' with the specified prefix. #' #' @section Request syntax: #' ``` #' svc$list_schemas( #' Limit = 123, #' NextToken = "string", #' RegistryName = "string", #' SchemaNamePrefix = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_list_schemas schemas_list_schemas <- function(Limit = NULL, NextToken = NULL, RegistryName, SchemaNamePrefix = NULL) { op <- new_operation( name = "ListSchemas", http_method = "GET", http_path = "/v1/registries/name/{registryName}/schemas", paginator = list() ) input <- .schemas$list_schemas_input(Limit = Limit, NextToken = NextToken, RegistryName = RegistryName, SchemaNamePrefix = SchemaNamePrefix) output <- .schemas$list_schemas_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$list_schemas <- schemas_list_schemas #' Get tags for resource #' #' @description #' Get tags for resource. #' #' @usage #' schemas_list_tags_for_resource(ResourceArn) #' #' @param ResourceArn &#91;required&#93; The ARN of the resource. #' #' @section Request syntax: #' ``` #' svc$list_tags_for_resource( #' ResourceArn = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_list_tags_for_resource schemas_list_tags_for_resource <- function(ResourceArn) { op <- new_operation( name = "ListTagsForResource", http_method = "GET", http_path = "/tags/{resource-arn}", paginator = list() ) input <- .schemas$list_tags_for_resource_input(ResourceArn = ResourceArn) output <- .schemas$list_tags_for_resource_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$list_tags_for_resource <- schemas_list_tags_for_resource #' Put code binding URI #' #' @description #' Put code binding URI #' #' @usage #' schemas_put_code_binding(Language, RegistryName, SchemaName, #' SchemaVersion) #' #' @param Language &#91;required&#93; The language of the code binding. #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' @param SchemaVersion Specifying this limits the results to only this schema version. #' #' @section Request syntax: #' ``` #' svc$put_code_binding( #' Language = "string", #' RegistryName = "string", #' SchemaName = "string", #' SchemaVersion = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_put_code_binding schemas_put_code_binding <- function(Language, RegistryName, SchemaName, SchemaVersion = NULL) { op <- new_operation( name = "PutCodeBinding", http_method = "POST", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}/language/{language}", paginator = list() ) input <- .schemas$put_code_binding_input(Language = Language, RegistryName = RegistryName, SchemaName = SchemaName, SchemaVersion = SchemaVersion) output <- .schemas$put_code_binding_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$put_code_binding <- schemas_put_code_binding #' The name of the policy #' #' @description #' The name of the policy. #' #' @usage #' schemas_put_resource_policy(Policy, RegistryName, RevisionId) #' #' @param Policy &#91;required&#93; The resource-based policy. #' @param RegistryName The name of the registry. #' @param RevisionId The revision ID of the policy. #' #' @section Request syntax: #' ``` #' svc$put_resource_policy( #' Policy = "string", #' RegistryName = "string", #' RevisionId = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_put_resource_policy schemas_put_resource_policy <- function(Policy, RegistryName = NULL, RevisionId = NULL) { op <- new_operation( name = "PutResourcePolicy", http_method = "PUT", http_path = "/v1/policy", paginator = list() ) input <- .schemas$put_resource_policy_input(Policy = Policy, RegistryName = RegistryName, RevisionId = RevisionId) output <- .schemas$put_resource_policy_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$put_resource_policy <- schemas_put_resource_policy #' Search the schemas #' #' @description #' Search the schemas #' #' @usage #' schemas_search_schemas(Keywords, Limit, NextToken, RegistryName) #' #' @param Keywords &#91;required&#93; Specifying this limits the results to only schemas that include the #' provided keywords. #' @param Limit #' @param NextToken The token that specifies the next page of results to return. To request #' the first page, leave NextToken empty. The token will expire in 24 #' hours, and cannot be shared with other accounts. #' @param RegistryName &#91;required&#93; The name of the registry. #' #' @section Request syntax: #' ``` #' svc$search_schemas( #' Keywords = "string", #' Limit = 123, #' NextToken = "string", #' RegistryName = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_search_schemas schemas_search_schemas <- function(Keywords, Limit = NULL, NextToken = NULL, RegistryName) { op <- new_operation( name = "SearchSchemas", http_method = "GET", http_path = "/v1/registries/name/{registryName}/schemas/search", paginator = list() ) input <- .schemas$search_schemas_input(Keywords = Keywords, Limit = Limit, NextToken = NextToken, RegistryName = RegistryName) output <- .schemas$search_schemas_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$search_schemas <- schemas_search_schemas #' Starts the discoverer #' #' @description #' Starts the discoverer #' #' @usage #' schemas_start_discoverer(DiscovererId) #' #' @param DiscovererId &#91;required&#93; The ID of the discoverer. #' #' @section Request syntax: #' ``` #' svc$start_discoverer( #' DiscovererId = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_start_discoverer schemas_start_discoverer <- function(DiscovererId) { op <- new_operation( name = "StartDiscoverer", http_method = "POST", http_path = "/v1/discoverers/id/{discovererId}/start", paginator = list() ) input <- .schemas$start_discoverer_input(DiscovererId = DiscovererId) output <- .schemas$start_discoverer_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$start_discoverer <- schemas_start_discoverer #' Stops the discoverer #' #' @description #' Stops the discoverer #' #' @usage #' schemas_stop_discoverer(DiscovererId) #' #' @param DiscovererId &#91;required&#93; The ID of the discoverer. #' #' @section Request syntax: #' ``` #' svc$stop_discoverer( #' DiscovererId = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_stop_discoverer schemas_stop_discoverer <- function(DiscovererId) { op <- new_operation( name = "StopDiscoverer", http_method = "POST", http_path = "/v1/discoverers/id/{discovererId}/stop", paginator = list() ) input <- .schemas$stop_discoverer_input(DiscovererId = DiscovererId) output <- .schemas$stop_discoverer_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$stop_discoverer <- schemas_stop_discoverer #' Add tags to a resource #' #' @description #' Add tags to a resource. #' #' @usage #' schemas_tag_resource(ResourceArn, Tags) #' #' @param ResourceArn &#91;required&#93; The ARN of the resource. #' @param Tags &#91;required&#93; Tags associated with the resource. #' #' @section Request syntax: #' ``` #' svc$tag_resource( #' ResourceArn = "string", #' Tags = list( #' "string" #' ) #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_tag_resource schemas_tag_resource <- function(ResourceArn, Tags) { op <- new_operation( name = "TagResource", http_method = "POST", http_path = "/tags/{resource-arn}", paginator = list() ) input <- .schemas$tag_resource_input(ResourceArn = ResourceArn, Tags = Tags) output <- .schemas$tag_resource_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$tag_resource <- schemas_tag_resource #' Removes tags from a resource #' #' @description #' Removes tags from a resource. #' #' @usage #' schemas_untag_resource(ResourceArn, TagKeys) #' #' @param ResourceArn &#91;required&#93; The ARN of the resource. #' @param TagKeys &#91;required&#93; Keys of key-value pairs. #' #' @section Request syntax: #' ``` #' svc$untag_resource( #' ResourceArn = "string", #' TagKeys = list( #' "string" #' ) #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_untag_resource schemas_untag_resource <- function(ResourceArn, TagKeys) { op <- new_operation( name = "UntagResource", http_method = "DELETE", http_path = "/tags/{resource-arn}", paginator = list() ) input <- .schemas$untag_resource_input(ResourceArn = ResourceArn, TagKeys = TagKeys) output <- .schemas$untag_resource_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$untag_resource <- schemas_untag_resource #' Updates the discoverer #' #' @description #' Updates the discoverer #' #' @usage #' schemas_update_discoverer(Description, DiscovererId) #' #' @param Description The description of the discoverer to update. #' @param DiscovererId &#91;required&#93; The ID of the discoverer. #' #' @section Request syntax: #' ``` #' svc$update_discoverer( #' Description = "string", #' DiscovererId = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_update_discoverer schemas_update_discoverer <- function(Description = NULL, DiscovererId) { op <- new_operation( name = "UpdateDiscoverer", http_method = "PUT", http_path = "/v1/discoverers/id/{discovererId}", paginator = list() ) input <- .schemas$update_discoverer_input(Description = Description, DiscovererId = DiscovererId) output <- .schemas$update_discoverer_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$update_discoverer <- schemas_update_discoverer #' Updates a registry #' #' @description #' Updates a registry. #' #' @usage #' schemas_update_registry(Description, RegistryName) #' #' @param Description The description of the registry to update. #' @param RegistryName &#91;required&#93; The name of the registry. #' #' @section Request syntax: #' ``` #' svc$update_registry( #' Description = "string", #' RegistryName = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_update_registry schemas_update_registry <- function(Description = NULL, RegistryName) { op <- new_operation( name = "UpdateRegistry", http_method = "PUT", http_path = "/v1/registries/name/{registryName}", paginator = list() ) input <- .schemas$update_registry_input(Description = Description, RegistryName = RegistryName) output <- .schemas$update_registry_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$update_registry <- schemas_update_registry #' Updates the schema definition Inactive schemas will be deleted after two #' years #' #' @description #' Updates the schema definition #' #' Inactive schemas will be deleted after two years. #' #' @usage #' schemas_update_schema(ClientTokenId, Content, Description, RegistryName, #' SchemaName, Type) #' #' @param ClientTokenId The ID of the client token. #' @param Content The source of the schema definition. #' @param Description The description of the schema. #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' @param Type The schema type for the events schema. #' #' @section Request syntax: #' ``` #' svc$update_schema( #' ClientTokenId = "string", #' Content = "string", #' Description = "string", #' RegistryName = "string", #' SchemaName = "string", #' Type = "OpenApi3"|"JSONSchemaDraft4" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_update_schema schemas_update_schema <- function(ClientTokenId = NULL, Content = NULL, Description = NULL, RegistryName, SchemaName, Type = NULL) { op <- new_operation( name = "UpdateSchema", http_method = "PUT", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}", paginator = list() ) input <- .schemas$update_schema_input(ClientTokenId = ClientTokenId, Content = Content, Description = Description, RegistryName = RegistryName, SchemaName = SchemaName, Type = Type) output <- .schemas$update_schema_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$update_schema <- schemas_update_schema
/paws/R/schemas_operations.R
permissive
sanchezvivi/paws
R
false
false
38,469
r
# This file is generated by make.paws. Please do not edit here. #' @importFrom paws.common get_config new_operation new_request send_request #' @include schemas_service.R NULL #' Creates a discoverer #' #' @description #' Creates a discoverer. #' #' @usage #' schemas_create_discoverer(Description, SourceArn, Tags) #' #' @param Description A description for the discoverer. #' @param SourceArn &#91;required&#93; The ARN of the event bus. #' @param Tags Tags associated with the resource. #' #' @section Request syntax: #' ``` #' svc$create_discoverer( #' Description = "string", #' SourceArn = "string", #' Tags = list( #' "string" #' ) #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_create_discoverer schemas_create_discoverer <- function(Description = NULL, SourceArn, Tags = NULL) { op <- new_operation( name = "CreateDiscoverer", http_method = "POST", http_path = "/v1/discoverers", paginator = list() ) input <- .schemas$create_discoverer_input(Description = Description, SourceArn = SourceArn, Tags = Tags) output <- .schemas$create_discoverer_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$create_discoverer <- schemas_create_discoverer #' Creates a registry #' #' @description #' Creates a registry. #' #' @usage #' schemas_create_registry(Description, RegistryName, Tags) #' #' @param Description A description of the registry to be created. #' @param RegistryName &#91;required&#93; The name of the registry. #' @param Tags Tags to associate with the registry. #' #' @section Request syntax: #' ``` #' svc$create_registry( #' Description = "string", #' RegistryName = "string", #' Tags = list( #' "string" #' ) #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_create_registry schemas_create_registry <- function(Description = NULL, RegistryName, Tags = NULL) { op <- new_operation( name = "CreateRegistry", http_method = "POST", http_path = "/v1/registries/name/{registryName}", paginator = list() ) input <- .schemas$create_registry_input(Description = Description, RegistryName = RegistryName, Tags = Tags) output <- .schemas$create_registry_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$create_registry <- schemas_create_registry #' Creates a schema definition #' #' @description #' Creates a schema definition. #' #' Inactive schemas will be deleted after two years. #' #' @usage #' schemas_create_schema(Content, Description, RegistryName, SchemaName, #' Tags, Type) #' #' @param Content &#91;required&#93; The source of the schema definition. #' @param Description A description of the schema. #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' @param Tags Tags associated with the schema. #' @param Type &#91;required&#93; The type of schema. #' #' @section Request syntax: #' ``` #' svc$create_schema( #' Content = "string", #' Description = "string", #' RegistryName = "string", #' SchemaName = "string", #' Tags = list( #' "string" #' ), #' Type = "OpenApi3"|"JSONSchemaDraft4" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_create_schema schemas_create_schema <- function(Content, Description = NULL, RegistryName, SchemaName, Tags = NULL, Type) { op <- new_operation( name = "CreateSchema", http_method = "POST", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}", paginator = list() ) input <- .schemas$create_schema_input(Content = Content, Description = Description, RegistryName = RegistryName, SchemaName = SchemaName, Tags = Tags, Type = Type) output <- .schemas$create_schema_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$create_schema <- schemas_create_schema #' Deletes a discoverer #' #' @description #' Deletes a discoverer. #' #' @usage #' schemas_delete_discoverer(DiscovererId) #' #' @param DiscovererId &#91;required&#93; The ID of the discoverer. #' #' @section Request syntax: #' ``` #' svc$delete_discoverer( #' DiscovererId = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_delete_discoverer schemas_delete_discoverer <- function(DiscovererId) { op <- new_operation( name = "DeleteDiscoverer", http_method = "DELETE", http_path = "/v1/discoverers/id/{discovererId}", paginator = list() ) input <- .schemas$delete_discoverer_input(DiscovererId = DiscovererId) output <- .schemas$delete_discoverer_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$delete_discoverer <- schemas_delete_discoverer #' Deletes a Registry #' #' @description #' Deletes a Registry. #' #' @usage #' schemas_delete_registry(RegistryName) #' #' @param RegistryName &#91;required&#93; The name of the registry. #' #' @section Request syntax: #' ``` #' svc$delete_registry( #' RegistryName = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_delete_registry schemas_delete_registry <- function(RegistryName) { op <- new_operation( name = "DeleteRegistry", http_method = "DELETE", http_path = "/v1/registries/name/{registryName}", paginator = list() ) input <- .schemas$delete_registry_input(RegistryName = RegistryName) output <- .schemas$delete_registry_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$delete_registry <- schemas_delete_registry #' Delete the resource-based policy attached to the specified registry #' #' @description #' Delete the resource-based policy attached to the specified registry. #' #' @usage #' schemas_delete_resource_policy(RegistryName) #' #' @param RegistryName The name of the registry. #' #' @section Request syntax: #' ``` #' svc$delete_resource_policy( #' RegistryName = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_delete_resource_policy schemas_delete_resource_policy <- function(RegistryName = NULL) { op <- new_operation( name = "DeleteResourcePolicy", http_method = "DELETE", http_path = "/v1/policy", paginator = list() ) input <- .schemas$delete_resource_policy_input(RegistryName = RegistryName) output <- .schemas$delete_resource_policy_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$delete_resource_policy <- schemas_delete_resource_policy #' Delete a schema definition #' #' @description #' Delete a schema definition. #' #' @usage #' schemas_delete_schema(RegistryName, SchemaName) #' #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' #' @section Request syntax: #' ``` #' svc$delete_schema( #' RegistryName = "string", #' SchemaName = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_delete_schema schemas_delete_schema <- function(RegistryName, SchemaName) { op <- new_operation( name = "DeleteSchema", http_method = "DELETE", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}", paginator = list() ) input <- .schemas$delete_schema_input(RegistryName = RegistryName, SchemaName = SchemaName) output <- .schemas$delete_schema_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$delete_schema <- schemas_delete_schema #' Delete the schema version definition #' #' @description #' Delete the schema version definition #' #' @usage #' schemas_delete_schema_version(RegistryName, SchemaName, SchemaVersion) #' #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' @param SchemaVersion &#91;required&#93; The version number of the schema #' #' @section Request syntax: #' ``` #' svc$delete_schema_version( #' RegistryName = "string", #' SchemaName = "string", #' SchemaVersion = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_delete_schema_version schemas_delete_schema_version <- function(RegistryName, SchemaName, SchemaVersion) { op <- new_operation( name = "DeleteSchemaVersion", http_method = "DELETE", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}/version/{schemaVersion}", paginator = list() ) input <- .schemas$delete_schema_version_input(RegistryName = RegistryName, SchemaName = SchemaName, SchemaVersion = SchemaVersion) output <- .schemas$delete_schema_version_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$delete_schema_version <- schemas_delete_schema_version #' Describe the code binding URI #' #' @description #' Describe the code binding URI. #' #' @usage #' schemas_describe_code_binding(Language, RegistryName, SchemaName, #' SchemaVersion) #' #' @param Language &#91;required&#93; The language of the code binding. #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' @param SchemaVersion Specifying this limits the results to only this schema version. #' #' @section Request syntax: #' ``` #' svc$describe_code_binding( #' Language = "string", #' RegistryName = "string", #' SchemaName = "string", #' SchemaVersion = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_describe_code_binding schemas_describe_code_binding <- function(Language, RegistryName, SchemaName, SchemaVersion = NULL) { op <- new_operation( name = "DescribeCodeBinding", http_method = "GET", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}/language/{language}", paginator = list() ) input <- .schemas$describe_code_binding_input(Language = Language, RegistryName = RegistryName, SchemaName = SchemaName, SchemaVersion = SchemaVersion) output <- .schemas$describe_code_binding_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$describe_code_binding <- schemas_describe_code_binding #' Describes the discoverer #' #' @description #' Describes the discoverer. #' #' @usage #' schemas_describe_discoverer(DiscovererId) #' #' @param DiscovererId &#91;required&#93; The ID of the discoverer. #' #' @section Request syntax: #' ``` #' svc$describe_discoverer( #' DiscovererId = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_describe_discoverer schemas_describe_discoverer <- function(DiscovererId) { op <- new_operation( name = "DescribeDiscoverer", http_method = "GET", http_path = "/v1/discoverers/id/{discovererId}", paginator = list() ) input <- .schemas$describe_discoverer_input(DiscovererId = DiscovererId) output <- .schemas$describe_discoverer_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$describe_discoverer <- schemas_describe_discoverer #' Describes the registry #' #' @description #' Describes the registry. #' #' @usage #' schemas_describe_registry(RegistryName) #' #' @param RegistryName &#91;required&#93; The name of the registry. #' #' @section Request syntax: #' ``` #' svc$describe_registry( #' RegistryName = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_describe_registry schemas_describe_registry <- function(RegistryName) { op <- new_operation( name = "DescribeRegistry", http_method = "GET", http_path = "/v1/registries/name/{registryName}", paginator = list() ) input <- .schemas$describe_registry_input(RegistryName = RegistryName) output <- .schemas$describe_registry_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$describe_registry <- schemas_describe_registry #' Retrieve the schema definition #' #' @description #' Retrieve the schema definition. #' #' @usage #' schemas_describe_schema(RegistryName, SchemaName, SchemaVersion) #' #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' @param SchemaVersion Specifying this limits the results to only this schema version. #' #' @section Request syntax: #' ``` #' svc$describe_schema( #' RegistryName = "string", #' SchemaName = "string", #' SchemaVersion = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_describe_schema schemas_describe_schema <- function(RegistryName, SchemaName, SchemaVersion = NULL) { op <- new_operation( name = "DescribeSchema", http_method = "GET", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}", paginator = list() ) input <- .schemas$describe_schema_input(RegistryName = RegistryName, SchemaName = SchemaName, SchemaVersion = SchemaVersion) output <- .schemas$describe_schema_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$describe_schema <- schemas_describe_schema #' Export schema #' #' @description #' Export schema #' #' @usage #' schemas_export_schema(RegistryName, SchemaName, SchemaVersion, Type) #' #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' @param SchemaVersion Specifying this limits the results to only this schema version. #' @param Type &#91;required&#93; #' #' @section Request syntax: #' ``` #' svc$export_schema( #' RegistryName = "string", #' SchemaName = "string", #' SchemaVersion = "string", #' Type = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_export_schema schemas_export_schema <- function(RegistryName, SchemaName, SchemaVersion = NULL, Type) { op <- new_operation( name = "ExportSchema", http_method = "GET", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}/export", paginator = list() ) input <- .schemas$export_schema_input(RegistryName = RegistryName, SchemaName = SchemaName, SchemaVersion = SchemaVersion, Type = Type) output <- .schemas$export_schema_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$export_schema <- schemas_export_schema #' Get the code binding source URI #' #' @description #' Get the code binding source URI. #' #' @usage #' schemas_get_code_binding_source(Language, RegistryName, SchemaName, #' SchemaVersion) #' #' @param Language &#91;required&#93; The language of the code binding. #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' @param SchemaVersion Specifying this limits the results to only this schema version. #' #' @section Request syntax: #' ``` #' svc$get_code_binding_source( #' Language = "string", #' RegistryName = "string", #' SchemaName = "string", #' SchemaVersion = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_get_code_binding_source schemas_get_code_binding_source <- function(Language, RegistryName, SchemaName, SchemaVersion = NULL) { op <- new_operation( name = "GetCodeBindingSource", http_method = "GET", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}/language/{language}/source", paginator = list() ) input <- .schemas$get_code_binding_source_input(Language = Language, RegistryName = RegistryName, SchemaName = SchemaName, SchemaVersion = SchemaVersion) output <- .schemas$get_code_binding_source_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$get_code_binding_source <- schemas_get_code_binding_source #' Get the discovered schema that was generated based on sampled events #' #' @description #' Get the discovered schema that was generated based on sampled events. #' #' @usage #' schemas_get_discovered_schema(Events, Type) #' #' @param Events &#91;required&#93; An array of strings where each string is a JSON event. These are the #' events that were used to generate the schema. The array includes a #' single type of event and has a maximum size of 10 events. #' @param Type &#91;required&#93; The type of event. #' #' @section Request syntax: #' ``` #' svc$get_discovered_schema( #' Events = list( #' "string" #' ), #' Type = "OpenApi3"|"JSONSchemaDraft4" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_get_discovered_schema schemas_get_discovered_schema <- function(Events, Type) { op <- new_operation( name = "GetDiscoveredSchema", http_method = "POST", http_path = "/v1/discover", paginator = list() ) input <- .schemas$get_discovered_schema_input(Events = Events, Type = Type) output <- .schemas$get_discovered_schema_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$get_discovered_schema <- schemas_get_discovered_schema #' Retrieves the resource-based policy attached to a given registry #' #' @description #' Retrieves the resource-based policy attached to a given registry. #' #' @usage #' schemas_get_resource_policy(RegistryName) #' #' @param RegistryName The name of the registry. #' #' @section Request syntax: #' ``` #' svc$get_resource_policy( #' RegistryName = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_get_resource_policy schemas_get_resource_policy <- function(RegistryName = NULL) { op <- new_operation( name = "GetResourcePolicy", http_method = "GET", http_path = "/v1/policy", paginator = list() ) input <- .schemas$get_resource_policy_input(RegistryName = RegistryName) output <- .schemas$get_resource_policy_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$get_resource_policy <- schemas_get_resource_policy #' List the discoverers #' #' @description #' List the discoverers. #' #' @usage #' schemas_list_discoverers(DiscovererIdPrefix, Limit, NextToken, #' SourceArnPrefix) #' #' @param DiscovererIdPrefix Specifying this limits the results to only those discoverer IDs that #' start with the specified prefix. #' @param Limit #' @param NextToken The token that specifies the next page of results to return. To request #' the first page, leave NextToken empty. The token will expire in 24 #' hours, and cannot be shared with other accounts. #' @param SourceArnPrefix Specifying this limits the results to only those ARNs that start with #' the specified prefix. #' #' @section Request syntax: #' ``` #' svc$list_discoverers( #' DiscovererIdPrefix = "string", #' Limit = 123, #' NextToken = "string", #' SourceArnPrefix = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_list_discoverers schemas_list_discoverers <- function(DiscovererIdPrefix = NULL, Limit = NULL, NextToken = NULL, SourceArnPrefix = NULL) { op <- new_operation( name = "ListDiscoverers", http_method = "GET", http_path = "/v1/discoverers", paginator = list() ) input <- .schemas$list_discoverers_input(DiscovererIdPrefix = DiscovererIdPrefix, Limit = Limit, NextToken = NextToken, SourceArnPrefix = SourceArnPrefix) output <- .schemas$list_discoverers_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$list_discoverers <- schemas_list_discoverers #' List the registries #' #' @description #' List the registries. #' #' @usage #' schemas_list_registries(Limit, NextToken, RegistryNamePrefix, Scope) #' #' @param Limit #' @param NextToken The token that specifies the next page of results to return. To request #' the first page, leave NextToken empty. The token will expire in 24 #' hours, and cannot be shared with other accounts. #' @param RegistryNamePrefix Specifying this limits the results to only those registry names that #' start with the specified prefix. #' @param Scope Can be set to Local or AWS to limit responses to your custom registries, #' or the ones provided by AWS. #' #' @section Request syntax: #' ``` #' svc$list_registries( #' Limit = 123, #' NextToken = "string", #' RegistryNamePrefix = "string", #' Scope = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_list_registries schemas_list_registries <- function(Limit = NULL, NextToken = NULL, RegistryNamePrefix = NULL, Scope = NULL) { op <- new_operation( name = "ListRegistries", http_method = "GET", http_path = "/v1/registries", paginator = list() ) input <- .schemas$list_registries_input(Limit = Limit, NextToken = NextToken, RegistryNamePrefix = RegistryNamePrefix, Scope = Scope) output <- .schemas$list_registries_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$list_registries <- schemas_list_registries #' Provides a list of the schema versions and related information #' #' @description #' Provides a list of the schema versions and related information. #' #' @usage #' schemas_list_schema_versions(Limit, NextToken, RegistryName, SchemaName) #' #' @param Limit #' @param NextToken The token that specifies the next page of results to return. To request #' the first page, leave NextToken empty. The token will expire in 24 #' hours, and cannot be shared with other accounts. #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' #' @section Request syntax: #' ``` #' svc$list_schema_versions( #' Limit = 123, #' NextToken = "string", #' RegistryName = "string", #' SchemaName = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_list_schema_versions schemas_list_schema_versions <- function(Limit = NULL, NextToken = NULL, RegistryName, SchemaName) { op <- new_operation( name = "ListSchemaVersions", http_method = "GET", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}/versions", paginator = list() ) input <- .schemas$list_schema_versions_input(Limit = Limit, NextToken = NextToken, RegistryName = RegistryName, SchemaName = SchemaName) output <- .schemas$list_schema_versions_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$list_schema_versions <- schemas_list_schema_versions #' List the schemas #' #' @description #' List the schemas. #' #' @usage #' schemas_list_schemas(Limit, NextToken, RegistryName, SchemaNamePrefix) #' #' @param Limit #' @param NextToken The token that specifies the next page of results to return. To request #' the first page, leave NextToken empty. The token will expire in 24 #' hours, and cannot be shared with other accounts. #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaNamePrefix Specifying this limits the results to only those schema names that start #' with the specified prefix. #' #' @section Request syntax: #' ``` #' svc$list_schemas( #' Limit = 123, #' NextToken = "string", #' RegistryName = "string", #' SchemaNamePrefix = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_list_schemas schemas_list_schemas <- function(Limit = NULL, NextToken = NULL, RegistryName, SchemaNamePrefix = NULL) { op <- new_operation( name = "ListSchemas", http_method = "GET", http_path = "/v1/registries/name/{registryName}/schemas", paginator = list() ) input <- .schemas$list_schemas_input(Limit = Limit, NextToken = NextToken, RegistryName = RegistryName, SchemaNamePrefix = SchemaNamePrefix) output <- .schemas$list_schemas_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$list_schemas <- schemas_list_schemas #' Get tags for resource #' #' @description #' Get tags for resource. #' #' @usage #' schemas_list_tags_for_resource(ResourceArn) #' #' @param ResourceArn &#91;required&#93; The ARN of the resource. #' #' @section Request syntax: #' ``` #' svc$list_tags_for_resource( #' ResourceArn = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_list_tags_for_resource schemas_list_tags_for_resource <- function(ResourceArn) { op <- new_operation( name = "ListTagsForResource", http_method = "GET", http_path = "/tags/{resource-arn}", paginator = list() ) input <- .schemas$list_tags_for_resource_input(ResourceArn = ResourceArn) output <- .schemas$list_tags_for_resource_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$list_tags_for_resource <- schemas_list_tags_for_resource #' Put code binding URI #' #' @description #' Put code binding URI #' #' @usage #' schemas_put_code_binding(Language, RegistryName, SchemaName, #' SchemaVersion) #' #' @param Language &#91;required&#93; The language of the code binding. #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' @param SchemaVersion Specifying this limits the results to only this schema version. #' #' @section Request syntax: #' ``` #' svc$put_code_binding( #' Language = "string", #' RegistryName = "string", #' SchemaName = "string", #' SchemaVersion = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_put_code_binding schemas_put_code_binding <- function(Language, RegistryName, SchemaName, SchemaVersion = NULL) { op <- new_operation( name = "PutCodeBinding", http_method = "POST", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}/language/{language}", paginator = list() ) input <- .schemas$put_code_binding_input(Language = Language, RegistryName = RegistryName, SchemaName = SchemaName, SchemaVersion = SchemaVersion) output <- .schemas$put_code_binding_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$put_code_binding <- schemas_put_code_binding #' The name of the policy #' #' @description #' The name of the policy. #' #' @usage #' schemas_put_resource_policy(Policy, RegistryName, RevisionId) #' #' @param Policy &#91;required&#93; The resource-based policy. #' @param RegistryName The name of the registry. #' @param RevisionId The revision ID of the policy. #' #' @section Request syntax: #' ``` #' svc$put_resource_policy( #' Policy = "string", #' RegistryName = "string", #' RevisionId = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_put_resource_policy schemas_put_resource_policy <- function(Policy, RegistryName = NULL, RevisionId = NULL) { op <- new_operation( name = "PutResourcePolicy", http_method = "PUT", http_path = "/v1/policy", paginator = list() ) input <- .schemas$put_resource_policy_input(Policy = Policy, RegistryName = RegistryName, RevisionId = RevisionId) output <- .schemas$put_resource_policy_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$put_resource_policy <- schemas_put_resource_policy #' Search the schemas #' #' @description #' Search the schemas #' #' @usage #' schemas_search_schemas(Keywords, Limit, NextToken, RegistryName) #' #' @param Keywords &#91;required&#93; Specifying this limits the results to only schemas that include the #' provided keywords. #' @param Limit #' @param NextToken The token that specifies the next page of results to return. To request #' the first page, leave NextToken empty. The token will expire in 24 #' hours, and cannot be shared with other accounts. #' @param RegistryName &#91;required&#93; The name of the registry. #' #' @section Request syntax: #' ``` #' svc$search_schemas( #' Keywords = "string", #' Limit = 123, #' NextToken = "string", #' RegistryName = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_search_schemas schemas_search_schemas <- function(Keywords, Limit = NULL, NextToken = NULL, RegistryName) { op <- new_operation( name = "SearchSchemas", http_method = "GET", http_path = "/v1/registries/name/{registryName}/schemas/search", paginator = list() ) input <- .schemas$search_schemas_input(Keywords = Keywords, Limit = Limit, NextToken = NextToken, RegistryName = RegistryName) output <- .schemas$search_schemas_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$search_schemas <- schemas_search_schemas #' Starts the discoverer #' #' @description #' Starts the discoverer #' #' @usage #' schemas_start_discoverer(DiscovererId) #' #' @param DiscovererId &#91;required&#93; The ID of the discoverer. #' #' @section Request syntax: #' ``` #' svc$start_discoverer( #' DiscovererId = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_start_discoverer schemas_start_discoverer <- function(DiscovererId) { op <- new_operation( name = "StartDiscoverer", http_method = "POST", http_path = "/v1/discoverers/id/{discovererId}/start", paginator = list() ) input <- .schemas$start_discoverer_input(DiscovererId = DiscovererId) output <- .schemas$start_discoverer_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$start_discoverer <- schemas_start_discoverer #' Stops the discoverer #' #' @description #' Stops the discoverer #' #' @usage #' schemas_stop_discoverer(DiscovererId) #' #' @param DiscovererId &#91;required&#93; The ID of the discoverer. #' #' @section Request syntax: #' ``` #' svc$stop_discoverer( #' DiscovererId = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_stop_discoverer schemas_stop_discoverer <- function(DiscovererId) { op <- new_operation( name = "StopDiscoverer", http_method = "POST", http_path = "/v1/discoverers/id/{discovererId}/stop", paginator = list() ) input <- .schemas$stop_discoverer_input(DiscovererId = DiscovererId) output <- .schemas$stop_discoverer_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$stop_discoverer <- schemas_stop_discoverer #' Add tags to a resource #' #' @description #' Add tags to a resource. #' #' @usage #' schemas_tag_resource(ResourceArn, Tags) #' #' @param ResourceArn &#91;required&#93; The ARN of the resource. #' @param Tags &#91;required&#93; Tags associated with the resource. #' #' @section Request syntax: #' ``` #' svc$tag_resource( #' ResourceArn = "string", #' Tags = list( #' "string" #' ) #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_tag_resource schemas_tag_resource <- function(ResourceArn, Tags) { op <- new_operation( name = "TagResource", http_method = "POST", http_path = "/tags/{resource-arn}", paginator = list() ) input <- .schemas$tag_resource_input(ResourceArn = ResourceArn, Tags = Tags) output <- .schemas$tag_resource_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$tag_resource <- schemas_tag_resource #' Removes tags from a resource #' #' @description #' Removes tags from a resource. #' #' @usage #' schemas_untag_resource(ResourceArn, TagKeys) #' #' @param ResourceArn &#91;required&#93; The ARN of the resource. #' @param TagKeys &#91;required&#93; Keys of key-value pairs. #' #' @section Request syntax: #' ``` #' svc$untag_resource( #' ResourceArn = "string", #' TagKeys = list( #' "string" #' ) #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_untag_resource schemas_untag_resource <- function(ResourceArn, TagKeys) { op <- new_operation( name = "UntagResource", http_method = "DELETE", http_path = "/tags/{resource-arn}", paginator = list() ) input <- .schemas$untag_resource_input(ResourceArn = ResourceArn, TagKeys = TagKeys) output <- .schemas$untag_resource_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$untag_resource <- schemas_untag_resource #' Updates the discoverer #' #' @description #' Updates the discoverer #' #' @usage #' schemas_update_discoverer(Description, DiscovererId) #' #' @param Description The description of the discoverer to update. #' @param DiscovererId &#91;required&#93; The ID of the discoverer. #' #' @section Request syntax: #' ``` #' svc$update_discoverer( #' Description = "string", #' DiscovererId = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_update_discoverer schemas_update_discoverer <- function(Description = NULL, DiscovererId) { op <- new_operation( name = "UpdateDiscoverer", http_method = "PUT", http_path = "/v1/discoverers/id/{discovererId}", paginator = list() ) input <- .schemas$update_discoverer_input(Description = Description, DiscovererId = DiscovererId) output <- .schemas$update_discoverer_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$update_discoverer <- schemas_update_discoverer #' Updates a registry #' #' @description #' Updates a registry. #' #' @usage #' schemas_update_registry(Description, RegistryName) #' #' @param Description The description of the registry to update. #' @param RegistryName &#91;required&#93; The name of the registry. #' #' @section Request syntax: #' ``` #' svc$update_registry( #' Description = "string", #' RegistryName = "string" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_update_registry schemas_update_registry <- function(Description = NULL, RegistryName) { op <- new_operation( name = "UpdateRegistry", http_method = "PUT", http_path = "/v1/registries/name/{registryName}", paginator = list() ) input <- .schemas$update_registry_input(Description = Description, RegistryName = RegistryName) output <- .schemas$update_registry_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$update_registry <- schemas_update_registry #' Updates the schema definition Inactive schemas will be deleted after two #' years #' #' @description #' Updates the schema definition #' #' Inactive schemas will be deleted after two years. #' #' @usage #' schemas_update_schema(ClientTokenId, Content, Description, RegistryName, #' SchemaName, Type) #' #' @param ClientTokenId The ID of the client token. #' @param Content The source of the schema definition. #' @param Description The description of the schema. #' @param RegistryName &#91;required&#93; The name of the registry. #' @param SchemaName &#91;required&#93; The name of the schema. #' @param Type The schema type for the events schema. #' #' @section Request syntax: #' ``` #' svc$update_schema( #' ClientTokenId = "string", #' Content = "string", #' Description = "string", #' RegistryName = "string", #' SchemaName = "string", #' Type = "OpenApi3"|"JSONSchemaDraft4" #' ) #' ``` #' #' @keywords internal #' #' @rdname schemas_update_schema schemas_update_schema <- function(ClientTokenId = NULL, Content = NULL, Description = NULL, RegistryName, SchemaName, Type = NULL) { op <- new_operation( name = "UpdateSchema", http_method = "PUT", http_path = "/v1/registries/name/{registryName}/schemas/name/{schemaName}", paginator = list() ) input <- .schemas$update_schema_input(ClientTokenId = ClientTokenId, Content = Content, Description = Description, RegistryName = RegistryName, SchemaName = SchemaName, Type = Type) output <- .schemas$update_schema_output() config <- get_config() svc <- .schemas$service(config) request <- new_request(svc, op, input, output) response <- send_request(request) return(response) } .schemas$operations$update_schema <- schemas_update_schema
bib2acad2 <-function (bibfile = "", copybib = TRUE, abstract = TRUE, overwrite = FALSE) { msg1 <- "You must specify a .bib file as input for the conversion." msg2 <- paste0("Cannot find file '", bibfile, "'. Check path and/or file name.") if (bibfile == "") { return(message(msg1)) } if (!file.exists(bibfile)) { return(message(msg2)) } outfold <- "my-md-folder" pubfold <- "my-pdf-folder" if (copybib) { bibfold <- "my-bib-folder" } dir.create("my-md-folder", showWarnings = FALSE) dir.create("my-pdf-folder", showWarnings = FALSE) dir.create("my-bib-folder", showWarnings = FALSE) mypubs <- RefManageR::ReadBib(bibfile, check = "warn", .Encoding = "UTF-8") mypubs <- as.data.frame(mypubs) mypubs$key <- rownames(mypubs) mypubs <- dplyr::mutate(mypubs, pubtype = dplyr::case_when(bibtype == "Article" ~ "2", bibtype == "Article in Press" ~ "2", bibtype == "InProceedings" ~ "1", bibtype == "Proceedings" ~ "1", bibtype == "Conference" ~ "1", bibtype == "Conference Paper" ~ "1", bibtype == "MastersThesis" ~ "3", bibtype == "PhdThesis" ~ "3", bibtype == "Manual" ~ "4", bibtype == "TechReport" ~ "4", bibtype == "Book" ~ "5", bibtype == "InCollection" ~ "6", bibtype == "InBook" ~ "6", bibtype == "Book Chapter" ~ "6", bibtype == "Misc" ~ "0", TRUE ~ "0")) create_md <- function(x) { if (!is.na(x[["date"]])) { if(nchar(x[["date"]]) == 4){ x[["date"]] <- paste0(substr(x[["date"]],1,4), "-01-01") } if(nchar(x[["date"]]) == 7){ x[["date"]] <- paste0(substr(x[["date"]],1,7), "-01") } if(nchar(x[["date"]]) == 10){ x[["date"]] <- x[["date"]] } } else { x[["date"]] <- "2999-01-01" } filename_md <- paste0(x[["key"]], ".md") if (!file.exists(file.path(outfold, filename_md)) | overwrite) { fileConn <- file.path(outfold, filename_md) write("+++", fileConn) write(paste0("title = \"", cleanStr(x[["title"]]), "\""), fileConn, append = T) write(paste0("date = \"", x[["date"]], "\""), fileConn, append = T) write(paste0("publication_types = [\"", x[["pubtype"]], "\"]"), fileConn, append = T) if (!is.na(x[["author"]])) { authors <- stringr::str_replace_all(stringr::str_squish(x["author"]), " and ", "\", \"") #authors <- stringr::str_remove_all(authors, "{") #authors <- stringr::str_remove_all(authors, "}") authors <- stringr::str_replace(authors, "Thomas P. C. Dorlo", "**Thomas P. C. Dorlo**") authors <- stringr::str_replace(authors, "T. P. C. Dorlo", "**T. P. C. Dorlo**") authors <- stringi::stri_trans_general(authors, "latin-ascii") write(paste0("authors = [\"", cleanStrA(authors), "\"]"), fileConn, append = T) } else { editors <- stringr::str_replace_all(stringr::str_squish(x["editor"]), " and ", "\", \"") editors <- stringi::stri_trans_general(editors, "latin-ascii") write(paste0("editors = [\"", editors, "\"]"), fileConn, append = T) } publication <- NULL if ("booktitle" %in% names(x) && !is.na(x[["booktitle"]])) { publication <- paste0(publication, "In: ", cleanStr(x[["booktitle"]])) if ("publisher" %in% names(x) && !is.na(x[["publisher"]])) { publication <- paste0(publication, ", ", cleanStr(x[["publisher"]])) } if ("address" %in% names(x) && !is.na(x[["address"]])) { publication <- paste0(publication, ", ", cleanStr(x[["address"]])) } if ("pages" %in% names(x) && !is.na(x[["pages"]])) { publication <- paste0(publication, ", _pp. ", cleanStr(x[["pages"]]), "_") } } if ("journaltitle" %in% names(x) && !is.na(x[["journaltitle"]])) { publication <- paste0(publication, "_", cleanStr(x[["journaltitle"]]), "_") #if ("number" %in% names(x) && !is.na(x[["number"]])) { # publication <- paste0(publication, " ", cleanStr(x[["number"]])) #} #if ("volume" %in% names(x) && !is.na(x[["volume"]])) { # publication <- paste0(publication, " (", cleanStr(x[["volume"]]), # ") ") #} #if ("pages" %in% names(x) && !is.na(x[["pages"]])) { # publication <- paste0(publication, ": ", # cleanStr(x[["pages"]]), "_") #} #if ("doi" %in% names(x) && !is.na(x[["doi"]])) { # publication <- paste0(publication, ", ", paste0("https://doi.org/", # cleanStr(x[["doi"]]))) #} #if ("url" %in% names(x) && !is.na(x[["url"]])) { # publication <- paste0(publication, ", ", cleanStr(x[["url"]])) #} } write(paste0("publication = \"", publication, "\""), fileConn, append = T) if ((abstract) && "abstract" %in% names(x) && !is.na(x[["abstract"]])) { write(paste0("abstract = \"", cleanStr(x[["abstract"]]), "\""), fileConn, append = T) } else { write("abstract = \"\"", fileConn, append = T) } if ("doi" %in% names(x) && !is.na(x[["doi"]])) { write(paste0("doi = \"", cleanStr(x[["doi"]]), "\""), fileConn, append = T) } else { write("doi = \"\"", fileConn, append = T) } if ("pmid" %in% names(x) && !is.na(x[["pmid"]])) { write(paste0("links = [{name = \"PubMed\", url = \"https://www.ncbi.nlm.nih.gov/pubmed/", cleanStr(x[["pmid"]]), "\"}]"), fileConn, append = T) } if ("url" %in% names(x) && !is.na(x[["url"]])) { write(paste0("links = [{name = \"Web\", url = \"",x[["url"]], "\"}]"), fileConn, append = T) } # url_custom = [{name = "Custom Link", url = "http://example.org"}] filename_pdf <- (gsub(".md", ".pdf", filename_md)) if (file.exists(file.path("static/pdf", filename_pdf))) { write(paste0("url_pdf = \"pdf/", filename_pdf,"\""), fileConn, append = T) } else if ("file" %in% names(x) && !is.na(x[["file"]])) { write(paste0("url_pdf = \"pdf/", filename_pdf,"\""), fileConn, append = T) } else { write("url_pdf = \"\"", fileConn, append = T) } write(paste0("abstract_short = \"", "\""), fileConn, append = T) write("image_preview = \"\"", fileConn, append = T) write("selected = false", fileConn, append = T) write("projects = []", fileConn, append = T) write("tags = []", fileConn, append = T) write("url_preprint = \"\"", fileConn, append = T) write("url_code = \"\"", fileConn, append = T) write("url_dataset = \"\"", fileConn, append = T) write("url_project = \"\"", fileConn, append = T) write("url_slides = \"\"", fileConn, append = T) write("url_video = \"\"", fileConn, append = T) write("url_poster = \"\"", fileConn, append = T) write("url_source = \"\"", fileConn, append = T) write("math = true", fileConn, append = T) write("highlight = true", fileConn, append = T) write("[header]", fileConn, append = T) write("image = \"\"", fileConn, append = T) write("caption = \"\"", fileConn, append = T) write("+++", fileConn, append = T) } if (copybib) { filename_bib <- (gsub(".md", ".bib", filename_md)) y <- as.list(x) y["pubtype"] <- NULL y <- RefManageR::as.BibEntry(y) if (!file.exists(file.path(bibfold, filename_bib)) | overwrite) { RefManageR::WriteBib(y, file = file.path(bibfold, filename_bib), verbose = FALSE) } } if ("file" %in% names(x) && !is.na(x[["file"]])) { filename_pdf <- (gsub(".md", ".pdf", filename_md)) pdfloc <- gsub("Full Text:", "", x[["file"]]) pdfloc <- gsub("Accepted Version:", "", pdfloc, fixed=TRUE) pdfloc <- gsub("C\\:", "C:", pdfloc, fixed=TRUE) pdfloc <- gsub(":application/pdf","", pdfloc, fixed=TRUE) file.rename(from = pdfloc, to = file.path(pubfold, filename_pdf)) } } pb <- pbapply::startpb(min = 0, max = nrow(mypubs)) pbapply::pbapply(mypubs, FUN = function(x) create_md(x), MARGIN = 1) pbapply::closepb(pb) } cleanStr <- function(str) { # if special character has in front a "\": replace it with "\\\\" str <- gsub('\\', '\\\\', str, fixed = TRUE) # delete all "{" and "}" in old bibtex files str <- gsub("[{}]", '', str) # replace all inline quotes '"' with "four '\\\\"' str <- gsub('"', '\\\\"', str) # delete extra lines, tabs and spaces # (especially important with field 'abstract') # and return the cleaned string return(stringr::str_squish(str)) } cleanStrA <- function(str) { # if special character has in front a "\": replace it with "\\\\" str <- gsub('\\', '\\\\', str, fixed = TRUE) # delete all "{" and "}" in old bibtex files str <- gsub("[{}]", '', str) # replace all inline quotes '"' with "four '\\\\"' #str <- gsub('"', '\\\\"', str) # delete extra lines, tabs and spaces # (especially important with field 'abstract') # and return the cleaned string return(stringr::str_squish(str)) } opendir <- function(dir = getwd()){ if (.Platform['OS.type'] == "windows"){ shell.exec(dir) } else { system(paste(Sys.getenv("R_BROWSER"), dir)) } } #bib2acad2(bibfile="C:/Users/thoma/Dropbox/Site/academic-kickstart-master/content/publication/bibtex/Dorlo10.bib", overwrite=T) #f <- "Full Text:C\:\\Users\\thoma\\Zotero\\storage\\8PE97TAN\\de Souza and Dorlo - 2018 - Safe mass drug administration for neglected tropic.pdf:application\pdf"
/r/bibtex_alt.r
permissive
thomasdorlo/thomasdorlo
R
false
false
10,594
r
bib2acad2 <-function (bibfile = "", copybib = TRUE, abstract = TRUE, overwrite = FALSE) { msg1 <- "You must specify a .bib file as input for the conversion." msg2 <- paste0("Cannot find file '", bibfile, "'. Check path and/or file name.") if (bibfile == "") { return(message(msg1)) } if (!file.exists(bibfile)) { return(message(msg2)) } outfold <- "my-md-folder" pubfold <- "my-pdf-folder" if (copybib) { bibfold <- "my-bib-folder" } dir.create("my-md-folder", showWarnings = FALSE) dir.create("my-pdf-folder", showWarnings = FALSE) dir.create("my-bib-folder", showWarnings = FALSE) mypubs <- RefManageR::ReadBib(bibfile, check = "warn", .Encoding = "UTF-8") mypubs <- as.data.frame(mypubs) mypubs$key <- rownames(mypubs) mypubs <- dplyr::mutate(mypubs, pubtype = dplyr::case_when(bibtype == "Article" ~ "2", bibtype == "Article in Press" ~ "2", bibtype == "InProceedings" ~ "1", bibtype == "Proceedings" ~ "1", bibtype == "Conference" ~ "1", bibtype == "Conference Paper" ~ "1", bibtype == "MastersThesis" ~ "3", bibtype == "PhdThesis" ~ "3", bibtype == "Manual" ~ "4", bibtype == "TechReport" ~ "4", bibtype == "Book" ~ "5", bibtype == "InCollection" ~ "6", bibtype == "InBook" ~ "6", bibtype == "Book Chapter" ~ "6", bibtype == "Misc" ~ "0", TRUE ~ "0")) create_md <- function(x) { if (!is.na(x[["date"]])) { if(nchar(x[["date"]]) == 4){ x[["date"]] <- paste0(substr(x[["date"]],1,4), "-01-01") } if(nchar(x[["date"]]) == 7){ x[["date"]] <- paste0(substr(x[["date"]],1,7), "-01") } if(nchar(x[["date"]]) == 10){ x[["date"]] <- x[["date"]] } } else { x[["date"]] <- "2999-01-01" } filename_md <- paste0(x[["key"]], ".md") if (!file.exists(file.path(outfold, filename_md)) | overwrite) { fileConn <- file.path(outfold, filename_md) write("+++", fileConn) write(paste0("title = \"", cleanStr(x[["title"]]), "\""), fileConn, append = T) write(paste0("date = \"", x[["date"]], "\""), fileConn, append = T) write(paste0("publication_types = [\"", x[["pubtype"]], "\"]"), fileConn, append = T) if (!is.na(x[["author"]])) { authors <- stringr::str_replace_all(stringr::str_squish(x["author"]), " and ", "\", \"") #authors <- stringr::str_remove_all(authors, "{") #authors <- stringr::str_remove_all(authors, "}") authors <- stringr::str_replace(authors, "Thomas P. C. Dorlo", "**Thomas P. C. Dorlo**") authors <- stringr::str_replace(authors, "T. P. C. Dorlo", "**T. P. C. Dorlo**") authors <- stringi::stri_trans_general(authors, "latin-ascii") write(paste0("authors = [\"", cleanStrA(authors), "\"]"), fileConn, append = T) } else { editors <- stringr::str_replace_all(stringr::str_squish(x["editor"]), " and ", "\", \"") editors <- stringi::stri_trans_general(editors, "latin-ascii") write(paste0("editors = [\"", editors, "\"]"), fileConn, append = T) } publication <- NULL if ("booktitle" %in% names(x) && !is.na(x[["booktitle"]])) { publication <- paste0(publication, "In: ", cleanStr(x[["booktitle"]])) if ("publisher" %in% names(x) && !is.na(x[["publisher"]])) { publication <- paste0(publication, ", ", cleanStr(x[["publisher"]])) } if ("address" %in% names(x) && !is.na(x[["address"]])) { publication <- paste0(publication, ", ", cleanStr(x[["address"]])) } if ("pages" %in% names(x) && !is.na(x[["pages"]])) { publication <- paste0(publication, ", _pp. ", cleanStr(x[["pages"]]), "_") } } if ("journaltitle" %in% names(x) && !is.na(x[["journaltitle"]])) { publication <- paste0(publication, "_", cleanStr(x[["journaltitle"]]), "_") #if ("number" %in% names(x) && !is.na(x[["number"]])) { # publication <- paste0(publication, " ", cleanStr(x[["number"]])) #} #if ("volume" %in% names(x) && !is.na(x[["volume"]])) { # publication <- paste0(publication, " (", cleanStr(x[["volume"]]), # ") ") #} #if ("pages" %in% names(x) && !is.na(x[["pages"]])) { # publication <- paste0(publication, ": ", # cleanStr(x[["pages"]]), "_") #} #if ("doi" %in% names(x) && !is.na(x[["doi"]])) { # publication <- paste0(publication, ", ", paste0("https://doi.org/", # cleanStr(x[["doi"]]))) #} #if ("url" %in% names(x) && !is.na(x[["url"]])) { # publication <- paste0(publication, ", ", cleanStr(x[["url"]])) #} } write(paste0("publication = \"", publication, "\""), fileConn, append = T) if ((abstract) && "abstract" %in% names(x) && !is.na(x[["abstract"]])) { write(paste0("abstract = \"", cleanStr(x[["abstract"]]), "\""), fileConn, append = T) } else { write("abstract = \"\"", fileConn, append = T) } if ("doi" %in% names(x) && !is.na(x[["doi"]])) { write(paste0("doi = \"", cleanStr(x[["doi"]]), "\""), fileConn, append = T) } else { write("doi = \"\"", fileConn, append = T) } if ("pmid" %in% names(x) && !is.na(x[["pmid"]])) { write(paste0("links = [{name = \"PubMed\", url = \"https://www.ncbi.nlm.nih.gov/pubmed/", cleanStr(x[["pmid"]]), "\"}]"), fileConn, append = T) } if ("url" %in% names(x) && !is.na(x[["url"]])) { write(paste0("links = [{name = \"Web\", url = \"",x[["url"]], "\"}]"), fileConn, append = T) } # url_custom = [{name = "Custom Link", url = "http://example.org"}] filename_pdf <- (gsub(".md", ".pdf", filename_md)) if (file.exists(file.path("static/pdf", filename_pdf))) { write(paste0("url_pdf = \"pdf/", filename_pdf,"\""), fileConn, append = T) } else if ("file" %in% names(x) && !is.na(x[["file"]])) { write(paste0("url_pdf = \"pdf/", filename_pdf,"\""), fileConn, append = T) } else { write("url_pdf = \"\"", fileConn, append = T) } write(paste0("abstract_short = \"", "\""), fileConn, append = T) write("image_preview = \"\"", fileConn, append = T) write("selected = false", fileConn, append = T) write("projects = []", fileConn, append = T) write("tags = []", fileConn, append = T) write("url_preprint = \"\"", fileConn, append = T) write("url_code = \"\"", fileConn, append = T) write("url_dataset = \"\"", fileConn, append = T) write("url_project = \"\"", fileConn, append = T) write("url_slides = \"\"", fileConn, append = T) write("url_video = \"\"", fileConn, append = T) write("url_poster = \"\"", fileConn, append = T) write("url_source = \"\"", fileConn, append = T) write("math = true", fileConn, append = T) write("highlight = true", fileConn, append = T) write("[header]", fileConn, append = T) write("image = \"\"", fileConn, append = T) write("caption = \"\"", fileConn, append = T) write("+++", fileConn, append = T) } if (copybib) { filename_bib <- (gsub(".md", ".bib", filename_md)) y <- as.list(x) y["pubtype"] <- NULL y <- RefManageR::as.BibEntry(y) if (!file.exists(file.path(bibfold, filename_bib)) | overwrite) { RefManageR::WriteBib(y, file = file.path(bibfold, filename_bib), verbose = FALSE) } } if ("file" %in% names(x) && !is.na(x[["file"]])) { filename_pdf <- (gsub(".md", ".pdf", filename_md)) pdfloc <- gsub("Full Text:", "", x[["file"]]) pdfloc <- gsub("Accepted Version:", "", pdfloc, fixed=TRUE) pdfloc <- gsub("C\\:", "C:", pdfloc, fixed=TRUE) pdfloc <- gsub(":application/pdf","", pdfloc, fixed=TRUE) file.rename(from = pdfloc, to = file.path(pubfold, filename_pdf)) } } pb <- pbapply::startpb(min = 0, max = nrow(mypubs)) pbapply::pbapply(mypubs, FUN = function(x) create_md(x), MARGIN = 1) pbapply::closepb(pb) } cleanStr <- function(str) { # if special character has in front a "\": replace it with "\\\\" str <- gsub('\\', '\\\\', str, fixed = TRUE) # delete all "{" and "}" in old bibtex files str <- gsub("[{}]", '', str) # replace all inline quotes '"' with "four '\\\\"' str <- gsub('"', '\\\\"', str) # delete extra lines, tabs and spaces # (especially important with field 'abstract') # and return the cleaned string return(stringr::str_squish(str)) } cleanStrA <- function(str) { # if special character has in front a "\": replace it with "\\\\" str <- gsub('\\', '\\\\', str, fixed = TRUE) # delete all "{" and "}" in old bibtex files str <- gsub("[{}]", '', str) # replace all inline quotes '"' with "four '\\\\"' #str <- gsub('"', '\\\\"', str) # delete extra lines, tabs and spaces # (especially important with field 'abstract') # and return the cleaned string return(stringr::str_squish(str)) } opendir <- function(dir = getwd()){ if (.Platform['OS.type'] == "windows"){ shell.exec(dir) } else { system(paste(Sys.getenv("R_BROWSER"), dir)) } } #bib2acad2(bibfile="C:/Users/thoma/Dropbox/Site/academic-kickstart-master/content/publication/bibtex/Dorlo10.bib", overwrite=T) #f <- "Full Text:C\:\\Users\\thoma\\Zotero\\storage\\8PE97TAN\\de Souza and Dorlo - 2018 - Safe mass drug administration for neglected tropic.pdf:application\pdf"
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/gamesManagement_functions.R \docType{package} \name{gamesManagement_googleAuthR} \alias{gamesManagement_googleAuthR} \alias{gamesManagement_googleAuthR-package} \title{Google Play Game Services Management API The Management API for Google Play Game Services.} \description{ Auto-generated code by googleAuthR::gar_create_api_skeleton at 2017-03-05 19:52:53 filename: /Users/mark/dev/R/autoGoogleAPI/googlegamesManagementv1management.auto/R/gamesManagement_functions.R api_json: api_json } \details{ Authentication scopes used are: \itemize{ \item https://www.googleapis.com/auth/games \item https://www.googleapis.com/auth/plus.login } }
/googlegamesManagementv1management.auto/man/gamesManagement_googleAuthR.Rd
permissive
GVersteeg/autoGoogleAPI
R
false
true
719
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/gamesManagement_functions.R \docType{package} \name{gamesManagement_googleAuthR} \alias{gamesManagement_googleAuthR} \alias{gamesManagement_googleAuthR-package} \title{Google Play Game Services Management API The Management API for Google Play Game Services.} \description{ Auto-generated code by googleAuthR::gar_create_api_skeleton at 2017-03-05 19:52:53 filename: /Users/mark/dev/R/autoGoogleAPI/googlegamesManagementv1management.auto/R/gamesManagement_functions.R api_json: api_json } \details{ Authentication scopes used are: \itemize{ \item https://www.googleapis.com/auth/games \item https://www.googleapis.com/auth/plus.login } }
#Reading the data #Read partial sample for identifying classes by columns data<-read.table("household_power_consumption.txt",header=TRUE,nrows=50,na.strings="?",sep=";") classes<-sapply(data,class) #Reading the whole sample using obtained classes (for less time) dataAll<-read.table("household_power_consumption.txt",header=TRUE, na.strings="?", sep=";",comment.char="",colClasses=classes) dataSub<-dataAll[dataAll$Date %in% c("1/2/2007","2/2/2007"),] #Converting dates to POSIXlt for appropriate x axis values datesStrSub<-paste(dataSub$Date,dataSub$Time,sep=' ') datesFullSub<-strptime(datesStrSub,format = "%d/%m/%Y %T") #Building graphic txt_reduce = 0.8 plot(datesFullSub,dataSub$Sub_metering_1,type="l",xlab="",ylab="Energy sub metering", cex.axis=txt_reduce, cex.lab=txt_reduce) points(datesFullSub,dataSub$Sub_metering_2,type="l",col="red") points(datesFullSub,dataSub$Sub_metering_3,type="l",col="blue") dataSubColNamesLength<-length(colnames(dataSub)) legendNames<-colnames(dataSub)[(dataSubColNamesLength-2):dataSubColNamesLength] legend("topright",col=c("black","red","blue"), legend=legendNames, lty = 1, cex = txt_reduce) dev.copy(png,"plot3.png") dev.off()
/plot3.R
no_license
omaksymov/ExData_Plotting1
R
false
false
1,171
r
#Reading the data #Read partial sample for identifying classes by columns data<-read.table("household_power_consumption.txt",header=TRUE,nrows=50,na.strings="?",sep=";") classes<-sapply(data,class) #Reading the whole sample using obtained classes (for less time) dataAll<-read.table("household_power_consumption.txt",header=TRUE, na.strings="?", sep=";",comment.char="",colClasses=classes) dataSub<-dataAll[dataAll$Date %in% c("1/2/2007","2/2/2007"),] #Converting dates to POSIXlt for appropriate x axis values datesStrSub<-paste(dataSub$Date,dataSub$Time,sep=' ') datesFullSub<-strptime(datesStrSub,format = "%d/%m/%Y %T") #Building graphic txt_reduce = 0.8 plot(datesFullSub,dataSub$Sub_metering_1,type="l",xlab="",ylab="Energy sub metering", cex.axis=txt_reduce, cex.lab=txt_reduce) points(datesFullSub,dataSub$Sub_metering_2,type="l",col="red") points(datesFullSub,dataSub$Sub_metering_3,type="l",col="blue") dataSubColNamesLength<-length(colnames(dataSub)) legendNames<-colnames(dataSub)[(dataSubColNamesLength-2):dataSubColNamesLength] legend("topright",col=c("black","red","blue"), legend=legendNames, lty = 1, cex = txt_reduce) dev.copy(png,"plot3.png") dev.off()
.libPaths("E:/library") library(magrittr) # HOME ----- data_path<-"Z:/WD Backup.swstor/MyPC/MDNkNjQ2ZjE0ZTcwNGM0Mz/Volume{3cf9130b-f942-4f48-a322-418d1c20f05f}/study/ENCODE-TCGA-LUAD/芯片-免疫组化/data" # E Zhou ----- data_path<-"H:/WD Backup.swstor/MyPC/MDNkNjQ2ZjE0ZTcwNGM0Mz/Volume{3cf9130b-f942-4f48-a322-418d1c20f05f}/study/ENCODE-TCGA-LUAD/芯片-免疫组化/data" result_path<-"H:/WD Backup.swstor/MyPC/MDNkNjQ2ZjE0ZTcwNGM0Mz/Volume{3cf9130b-f942-4f48-a322-418d1c20f05f}/study/ENCODE-TCGA-LUAD/芯片-免疫组化/result" # HUST ---- data_path<-"G:/WD Backup.swstor/MyPC/MDNkNjQ2ZjE0ZTcwNGM0Mz/Volume{3cf9130b-f942-4f48-a322-418d1c20f05f}/study/ENCODE-TCGA-LUAD/芯片-免疫组化/data" result_path<-"G:/WD Backup.swstor/MyPC/MDNkNjQ2ZjE0ZTcwNGM0Mz/Volume{3cf9130b-f942-4f48-a322-418d1c20f05f}/study/ENCODE-TCGA-LUAD/芯片-免疫组化/result" immune_histone <- read.table(file.path(data_path,"immune_histone.txt"),sep = "\t",header = T) %>% dplyr::mutate(stage = as.character(stage)) %>% dplyr::mutate(stage = ifelse(is.na(stage),"N",stage)) %>% tidyr::drop_na() %>% dplyr::mutate(sample_type=ifelse(sample_type=="T","Tumor","Normal")) %>% # dplyr::mutate(EZH2_cytoplsm=ifelse(is.na(EZH2_cytoplsm),0,EZH2_cytoplsm)) %>% # dplyr::mutate(EZH2_karyon=ifelse(is.na(EZH2_karyon),0,EZH2_karyon)) %>% # dplyr::mutate(CBX2_cytoplsm=ifelse(is.na(CBX2_cytoplsm),0,CBX2_cytoplsm)) %>% # dplyr::mutate(CBX2_karyon=ifelse(is.na(CBX2_karyon),0,CBX2_karyon)) %>% dplyr::mutate(CBX2_mean = (CBX2_cytoplsm+CBX2_karyon)/2) %>% dplyr::mutate(EZH2_mean = (EZH2_karyon+EZH2_cytoplsm)/2) %>% dplyr::mutate(CBX2_max = ifelse(CBX2_cytoplsm > CBX2_karyon, CBX2_cytoplsm, CBX2_karyon)) %>% dplyr::mutate(EZH2_max = ifelse(EZH2_cytoplsm > EZH2_karyon, EZH2_cytoplsm, EZH2_karyon)) # Preleminary test to check the test assumptions shapiro.test(immune_histone$EZH2_mean) # p-value < 0.05, don't follow a normal distribution. shapiro.test(immune_histone$CBX2_mean) # p-value < 0.05, don't follow a normal distribution. # do correlation for tumor and normal samples, respectively ## data precessing immune_histone %>% dplyr::filter(sample_type=="Tumor") -> immune_histone.T immune_histone %>% dplyr::filter(sample_type=="Normal") -> immune_histone.N ## function to get scientific numeric human_read <- function(.x){ if (.x > 0.1) { .x %>% signif(digits = 2) %>% toString() } else if (.x < 0.1 && .x > 0.001 ) { .x %>% signif(digits = 1) %>% toString() } else { .x %>% format(digits = 2, scientific = TRUE) } } ## do broom::tidy( cor.test(immune_histone.T$CBX2_mean,immune_histone.T$EZH2_mean,method = "pearson")) %>% dplyr::as_tibble() %>% dplyr::mutate(fdr=p.adjust(p.value,method = "fdr")) %>% dplyr::mutate(p.value = purrr::map_chr(p.value,human_read)) %>% dplyr::mutate(x=1,y=1.8,sample_type="1Tumor",n=nrow(immune_histone.T), estimate = signif(estimate,2)) %>% dplyr::mutate(label=purrr::map2( .x=p.value, .y=estimate, .z=n, .f=function(.x,.y,.z){ if(grepl(pattern = "e",x=.x)){ sub("-0", "-", strsplit(split = "e", x = .x, fixed = TRUE)[[1]]) -> .xx latex2exp::TeX(glue::glue("r = <<.y>>, p = $<<.xx[1]>> \\times 10^{<<.xx[2]>>}$, n = <<.z>>", .open = "<<", .close = ">>")) } else { latex2exp::TeX(glue::glue("r = {.y}, p = {.x}, n = {.z}")) } } )) ->CBX2_EZH2.T broom::tidy( cor.test(immune_histone.N$CBX2_max,immune_histone.N$EZH2_max,method = "kendall")) %>% dplyr::as_tibble() %>% dplyr::mutate(fdr=p.adjust(p.value,method = "fdr")) %>% dplyr::mutate(p.value = purrr::map_chr(p.value,human_read)) %>% dplyr::mutate(x=0.41,y=0.8,sample_type="2Normal",n=nrow(immune_histone.N), estimate = signif(estimate,2)) %>% dplyr::mutate(label=purrr::map2( .x=p.value, .y=estimate, .z=n, .f=function(.x,.y,.z){ if(grepl(pattern = "e",x=.x)){ sub("-0", "-", strsplit(split = "e", x = .x, fixed = TRUE)[[1]]) -> .xx latex2exp::TeX(glue::glue("r = <<.y>>, p = $<<.xx[1]>> \\times 10^{<<.xx[2]>>}$, n = <<.z>>", .open = "<<", .close = ">>")) } else { latex2exp::TeX(glue::glue("r = {.y}, p = {.x}, n = {.z}")) } } )) ->CBX2_EZH2.N rbind(CBX2_EZH2.T,CBX2_EZH2.N) %>% dplyr::as.tbl() ->CBX2_EZH2;CBX2_EZH2 facet_names <- list( '1Tumor'="Tumor", '2Normal'="Normal" ) facet_labeller <- function(variable,value){ return(facet_names[value]) } immune_histone %>% ggplot(aes(x=EZH2_mean,y=CBX2_mean)) + geom_point(aes(color = sample_type)) + geom_smooth(se = FALSE, fullrange=TRUE, color = "#039BE5") + theme_bw() + theme(panel.border = element_blank(), panel.grid.major = element_blank(), panel.grid.minor = element_blank(), axis.line = element_line(color = "black") ) + scale_color_manual( values = c("#EE6363","#00C5CD"), labels = CBX2_EZH2$label ) + labs( x = "EZH2 cytoplsm", y = "CBX2 cytoplsm" ) + facet_wrap(~sample_type,scales = "free",labeller=facet_labeller) -> p1;p1
/7.immune_histochemical/correlation_new.R
no_license
Huffyphenix/LUAD_pic_code
R
false
false
5,035
r
.libPaths("E:/library") library(magrittr) # HOME ----- data_path<-"Z:/WD Backup.swstor/MyPC/MDNkNjQ2ZjE0ZTcwNGM0Mz/Volume{3cf9130b-f942-4f48-a322-418d1c20f05f}/study/ENCODE-TCGA-LUAD/芯片-免疫组化/data" # E Zhou ----- data_path<-"H:/WD Backup.swstor/MyPC/MDNkNjQ2ZjE0ZTcwNGM0Mz/Volume{3cf9130b-f942-4f48-a322-418d1c20f05f}/study/ENCODE-TCGA-LUAD/芯片-免疫组化/data" result_path<-"H:/WD Backup.swstor/MyPC/MDNkNjQ2ZjE0ZTcwNGM0Mz/Volume{3cf9130b-f942-4f48-a322-418d1c20f05f}/study/ENCODE-TCGA-LUAD/芯片-免疫组化/result" # HUST ---- data_path<-"G:/WD Backup.swstor/MyPC/MDNkNjQ2ZjE0ZTcwNGM0Mz/Volume{3cf9130b-f942-4f48-a322-418d1c20f05f}/study/ENCODE-TCGA-LUAD/芯片-免疫组化/data" result_path<-"G:/WD Backup.swstor/MyPC/MDNkNjQ2ZjE0ZTcwNGM0Mz/Volume{3cf9130b-f942-4f48-a322-418d1c20f05f}/study/ENCODE-TCGA-LUAD/芯片-免疫组化/result" immune_histone <- read.table(file.path(data_path,"immune_histone.txt"),sep = "\t",header = T) %>% dplyr::mutate(stage = as.character(stage)) %>% dplyr::mutate(stage = ifelse(is.na(stage),"N",stage)) %>% tidyr::drop_na() %>% dplyr::mutate(sample_type=ifelse(sample_type=="T","Tumor","Normal")) %>% # dplyr::mutate(EZH2_cytoplsm=ifelse(is.na(EZH2_cytoplsm),0,EZH2_cytoplsm)) %>% # dplyr::mutate(EZH2_karyon=ifelse(is.na(EZH2_karyon),0,EZH2_karyon)) %>% # dplyr::mutate(CBX2_cytoplsm=ifelse(is.na(CBX2_cytoplsm),0,CBX2_cytoplsm)) %>% # dplyr::mutate(CBX2_karyon=ifelse(is.na(CBX2_karyon),0,CBX2_karyon)) %>% dplyr::mutate(CBX2_mean = (CBX2_cytoplsm+CBX2_karyon)/2) %>% dplyr::mutate(EZH2_mean = (EZH2_karyon+EZH2_cytoplsm)/2) %>% dplyr::mutate(CBX2_max = ifelse(CBX2_cytoplsm > CBX2_karyon, CBX2_cytoplsm, CBX2_karyon)) %>% dplyr::mutate(EZH2_max = ifelse(EZH2_cytoplsm > EZH2_karyon, EZH2_cytoplsm, EZH2_karyon)) # Preleminary test to check the test assumptions shapiro.test(immune_histone$EZH2_mean) # p-value < 0.05, don't follow a normal distribution. shapiro.test(immune_histone$CBX2_mean) # p-value < 0.05, don't follow a normal distribution. # do correlation for tumor and normal samples, respectively ## data precessing immune_histone %>% dplyr::filter(sample_type=="Tumor") -> immune_histone.T immune_histone %>% dplyr::filter(sample_type=="Normal") -> immune_histone.N ## function to get scientific numeric human_read <- function(.x){ if (.x > 0.1) { .x %>% signif(digits = 2) %>% toString() } else if (.x < 0.1 && .x > 0.001 ) { .x %>% signif(digits = 1) %>% toString() } else { .x %>% format(digits = 2, scientific = TRUE) } } ## do broom::tidy( cor.test(immune_histone.T$CBX2_mean,immune_histone.T$EZH2_mean,method = "pearson")) %>% dplyr::as_tibble() %>% dplyr::mutate(fdr=p.adjust(p.value,method = "fdr")) %>% dplyr::mutate(p.value = purrr::map_chr(p.value,human_read)) %>% dplyr::mutate(x=1,y=1.8,sample_type="1Tumor",n=nrow(immune_histone.T), estimate = signif(estimate,2)) %>% dplyr::mutate(label=purrr::map2( .x=p.value, .y=estimate, .z=n, .f=function(.x,.y,.z){ if(grepl(pattern = "e",x=.x)){ sub("-0", "-", strsplit(split = "e", x = .x, fixed = TRUE)[[1]]) -> .xx latex2exp::TeX(glue::glue("r = <<.y>>, p = $<<.xx[1]>> \\times 10^{<<.xx[2]>>}$, n = <<.z>>", .open = "<<", .close = ">>")) } else { latex2exp::TeX(glue::glue("r = {.y}, p = {.x}, n = {.z}")) } } )) ->CBX2_EZH2.T broom::tidy( cor.test(immune_histone.N$CBX2_max,immune_histone.N$EZH2_max,method = "kendall")) %>% dplyr::as_tibble() %>% dplyr::mutate(fdr=p.adjust(p.value,method = "fdr")) %>% dplyr::mutate(p.value = purrr::map_chr(p.value,human_read)) %>% dplyr::mutate(x=0.41,y=0.8,sample_type="2Normal",n=nrow(immune_histone.N), estimate = signif(estimate,2)) %>% dplyr::mutate(label=purrr::map2( .x=p.value, .y=estimate, .z=n, .f=function(.x,.y,.z){ if(grepl(pattern = "e",x=.x)){ sub("-0", "-", strsplit(split = "e", x = .x, fixed = TRUE)[[1]]) -> .xx latex2exp::TeX(glue::glue("r = <<.y>>, p = $<<.xx[1]>> \\times 10^{<<.xx[2]>>}$, n = <<.z>>", .open = "<<", .close = ">>")) } else { latex2exp::TeX(glue::glue("r = {.y}, p = {.x}, n = {.z}")) } } )) ->CBX2_EZH2.N rbind(CBX2_EZH2.T,CBX2_EZH2.N) %>% dplyr::as.tbl() ->CBX2_EZH2;CBX2_EZH2 facet_names <- list( '1Tumor'="Tumor", '2Normal'="Normal" ) facet_labeller <- function(variable,value){ return(facet_names[value]) } immune_histone %>% ggplot(aes(x=EZH2_mean,y=CBX2_mean)) + geom_point(aes(color = sample_type)) + geom_smooth(se = FALSE, fullrange=TRUE, color = "#039BE5") + theme_bw() + theme(panel.border = element_blank(), panel.grid.major = element_blank(), panel.grid.minor = element_blank(), axis.line = element_line(color = "black") ) + scale_color_manual( values = c("#EE6363","#00C5CD"), labels = CBX2_EZH2$label ) + labs( x = "EZH2 cytoplsm", y = "CBX2 cytoplsm" ) + facet_wrap(~sample_type,scales = "free",labeller=facet_labeller) -> p1;p1
testlist <- list(doy = -1.72131968218895e+83, latitude = c(0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0), temp = c(8.5728629954997e-312, 1.56898424065867e+82, 8.96970809549085e-158, -1.3258495253834e-113, 2.79620616433656e-119, -6.80033518839696e+41, 2.68298522855314e-211, 1444042902784.06, 6.68889884134308e+51, -4.05003163986346e-308, -3.52601820453991e+43, -1.49815227045093e+197, -2.61605817623304e+76, -1.18078903777423e-90, 1.86807199752012e+112, -5.58551357556946e+160, 2.00994342527714e-162, 1.81541609400943e-79, 7.89363005545926e+139, 2.3317908961407e-93, 1.73250065464873e+162)) result <- do.call(meteor:::ET0_ThornthwaiteWilmott,testlist) str(result)
/meteor/inst/testfiles/ET0_ThornthwaiteWilmott/AFL_ET0_ThornthwaiteWilmott/ET0_ThornthwaiteWilmott_valgrind_files/1615828645-test.R
no_license
akhikolla/updatedatatype-list3
R
false
false
734
r
testlist <- list(doy = -1.72131968218895e+83, latitude = c(0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0), temp = c(8.5728629954997e-312, 1.56898424065867e+82, 8.96970809549085e-158, -1.3258495253834e-113, 2.79620616433656e-119, -6.80033518839696e+41, 2.68298522855314e-211, 1444042902784.06, 6.68889884134308e+51, -4.05003163986346e-308, -3.52601820453991e+43, -1.49815227045093e+197, -2.61605817623304e+76, -1.18078903777423e-90, 1.86807199752012e+112, -5.58551357556946e+160, 2.00994342527714e-162, 1.81541609400943e-79, 7.89363005545926e+139, 2.3317908961407e-93, 1.73250065464873e+162)) result <- do.call(meteor:::ET0_ThornthwaiteWilmott,testlist) str(result)
extent_to_bbox <- function(ras){ bb <- bbox(ras) bbx <- list(p1 = list(long=bb[1,1],lat=bb[2,1]), p2 = list(long=bb[1,2],lat=bb[2,2])) return(bbx) } convert_extent_to_utm <- function(longlat_extent,zone = "18T"){ sp_geo <- SpatialPoints(longlat_extent, CRS("+proj=longlat +datum=WGS84")) sp_utm <- spTransform(sp_geo,CRS(glue::glue("+proj=utm +zone={zone} +datum=WGS84"))) return(extent(sp_utm)) } # reduce elevations in map border to zero # totally screwed kup # I do not know why I have to transpose matrix back and forth # top and and bottom are still backwards zero_out_border <- function(elev_matrix,full_extent,borderless_extent){ ras1 <- raster::raster(elev_matrix) extent(ras1) <- borderless_extent ras2 <- raster::crop(ras1,borderless_extent) %>% raster::extend(full_extent,value=0) return(as.matrix(ras2)) } # # convert a lat/long to pixels on an image # house_pos <- find_image_coordinates(latlon_house$long, # latlon_house$lat, # bbox = bbox, # image_width=image_size$width, # image_height=image_size$height) #get the ratio of x and y bounding box sizes # your bbox structure and variable names might vary bbox_size_ratio <- function(bbox1,bbox2) { x <- (bbox1$p1$long-bbox1$p2$long) / (bbox2$p1$long-bbox2$p2$long) y <- (bbox1$p1$lat-bbox1$p2$lat) / (bbox2$p1$lat-bbox2$p2$lat) return (c(x,y)) } # enlarge matrix, putting original in center of new # set border to init_value border_matrix <-function(m,size_ratio=c(x=1,y=1),init_value=0){ d <- dim(m) new_m <- matrix(data=init_value, nrow = round(d[1]*size_ratio[1]), ncol = round(d[2]*size_ratio[2])) new_d <- dim(new_m) insert_start <- c(round((new_d[1]-d[1])/2+1), round((new_d[2]-d[2])/2)+1) insert_end <- c(insert_start[1]+d[1]-1, insert_start[2]+d[2]-1) new_m[insert_start[1]:insert_end[1], insert_start[2]:insert_end[2]] <- m return(new_m) } # pad evevation matrix with zero height border # to overlay an image larger than the raster such # as a map # takes a lat/long bbox make_elev_matrix_border <- function(elev_matrix, bbox_big,bbox_sm) { new_m <- enlarge_matrix(m, bbox_size_ratio(bbox_big,bbox_sm)) return(new_m) } # normalize an object normalize <- function(x) { return ((x - min(x)) / (max(x) - min(x))) } dms_to_dec <- function(deg=0, min=0, sec=0) { return(deg + min / 60 + sec / 3600) } # Change zero depths to fake depth based on distance to shore fake_depth <- function(elev_depth_matrix, depth_step = 5) { zeroes <- which(elev_depth_matrix == 0, arr.ind = T) maxrow <- dim(elev_depth_matrix)[1] maxcol <- dim(elev_depth_matrix)[2] for (i in 1:nrow(zeroes)) { row <- zeroes[i, 1] col <- zeroes[i, 2] found_shore = FALSE distance_to_shore = 1 adjacent_level <- c(0, 0, 0, 0) while (!found_shore) { if (row > distance_to_shore) adjacent_level[1] <- elev_depth_matrix[row - distance_to_shore, col] # south if (col > distance_to_shore) adjacent_level[2] <- elev_depth_matrix[row , col - distance_to_shore] # west if (row < maxrow - distance_to_shore) adjacent_level[3] <- elev_depth_matrix[row + distance_to_shore, col] # north if (col < maxcol - distance_to_shore) adjacent_level[4] <- elev_depth_matrix[row , col + distance_to_shore] # east found_shore <- (max(adjacent_level) > 0) if (found_shore) { elev_depth_matrix[row, col] <- -depth_step * distance_to_shore } else { distance_to_shore <- distance_to_shore + 1 } } } return(elev_depth_matrix) } # ------------------------------------------------------------------- # Crop raster image crop_img <- function(elev_img, bbox) { new_extent <- unlist(bbox) %>% matrix(nrow = 2, ncol = 2) %>% extent() elev_img <- elev_img %>% crop(new_extent) return(elev_img) } # Downscale elevation matrix downscale_elev <- function(elev_matrix, target_image_size) { spacing_w = dim(elev_matrix)[1] / target_image_size$width spacing_h = dim(elev_matrix)[2] / target_image_size$height # downsample but truncate items if rounding returns more points than target # this breaks if rounding dimensions LESS than target_image_size sample_w <- round(seq(1, dim(elev_matrix)[1], by = spacing_w)) sample_h <- round(seq(1, dim(elev_matrix)[2], by = spacing_h)) return(elev_matrix[sample_w, sample_h]) } #rayshader utilities from Will Bishop @wcmbiship #' Translate the given long/lat coordinates into an image position (x, y). #' #' @param long longitude value #' @param lat latitude value #' @param bbox bounding box coordinates (list of 2 points with long/lat values) #' @param image_width image width, in pixels #' @param image_height image height, in pixels #' #' @return named list with elements "x" and "y" defining an image position #' find_image_coordinates <- function(long, lat, bbox, image_width, image_height) { x_img <- round(image_width * (long - min(bbox$p1$long, bbox$p2$long)) / abs(bbox$p1$long - bbox$p2$long)) y_img <- round(image_height * (lat - min(bbox$p1$lat, bbox$p2$lat)) / abs(bbox$p1$lat - bbox$p2$lat)) list(x = x_img, y = y_img) } #' Define image size variables from the given bounding box coordinates. #' #' @param bbox bounding box coordinates (list of 2 points with long/lat values) #' @param major_dim major image dimension, in pixels. #' Default is 400 (meaning larger dimension will be 400 pixels) #' #' @return list with items "width", "height", and "size" (string of format "<width>,<height>") #' #' @examples #' bbox <- list( #' p1 = list(long = -122.522, lat = 37.707), #' p2 = list(long = -122.354, lat = 37.84) #' ) #' image_size <- define_image_size(bbox, 600) #' define_image_size <- function(bbox, major_dim = 400) { # calculate aspect ration (width/height) from lat/long bounding box aspect_ratio <- abs((bbox$p1$long - bbox$p2$long) / (bbox$p1$lat - bbox$p2$lat)) # define dimensions img_width <- ifelse(aspect_ratio > 1, major_dim, major_dim * aspect_ratio) %>% round() img_height <- ifelse(aspect_ratio < 1, major_dim, major_dim / aspect_ratio) %>% round() size_str <- paste(img_width, img_height, sep = ",") list(height = img_height, width = img_width, size = size_str) } #' Download USGS elevation data from the ArcGIS REST API. #' #' @param bbox bounding box coordinates (list of 2 points with long/lat values) #' @param size image size as a string with format "<width>,<height>" #' @param file file path to save to. Default is NULL, which will create a temp file. #' @param sr_bbox Spatial Reference code for bounding box #' @param sr_image Spatial Reference code for elevation image #' #' @details This function uses the ArcGIS REST API, specifically the #' exportImage task. You can find links below to a web UI for this #' rest endpoint and API documentation. #' #' Web UI: https://elevation.nationalmap.gov/arcgis/rest/services/3DEPElevation/ImageServer/exportImage #' API docs: https://developers.arcgis.com/rest/services-reference/export-image.htm #' #' @return file path for downloaded elevation .tif file. This can be read with #' \code{read_elevation_file()}. #' #' @examples #' bbox <- list( #' p1 = list(long = -122.522, lat = 37.707), #' p2 = list(long = -122.354, lat = 37.84) #' ) #' image_size <- define_image_size(bbox, 600) #' elev_file <- get_usgs_elevation_data(bbox, size = image_size$size) #' get_usgs_elevation_data <- function(bbox, size = "400,400", file = NULL, sr_bbox = 4326, sr_image = 4326) { require(httr) # TODO - validate inputs url <- parse_url( "https://elevation.nationalmap.gov/arcgis/rest/services/3DEPElevation/ImageServer/exportImage" ) res <- GET( url, query = list( bbox = paste(bbox$p1$long, bbox$p1$lat, bbox$p2$long, bbox$p2$lat, sep = ","), bboxSR = sr_bbox, imageSR = sr_image, size = size, format = "tiff", pixelType = "F32", noDataInterpretation = "esriNoDataMatchAny", interpolation = "+RSP_BilinearInterpolation", f = "json" ) ) if (status_code(res) == 200) { body <- content(res, type = "application/json") # TODO - check that bbox values are correct # message(jsonlite::toJSON(body, auto_unbox = TRUE, pretty = TRUE)) img_res <- GET(body$href) img_bin <- content(img_res, "raw") if (is.null(file)) file <- tempfile("elev_matrix", fileext = ".tif") writeBin(img_bin, file) message(paste("image saved to file:", file)) } else { warning(res) } invisible(file) } #' Download a map image from the ArcGIS REST API #' #' @param bbox bounding box coordinates (list of 2 points with long/lat values) #' @param map_type map type to download - options are World_Street_Map, World_Imagery, World_Topo_Map #' @param file file path to save to. Default is NULL, which will create a temp file. #' @param width image width (pixels) #' @param height image height (pixels) #' @param sr_bbox Spatial Reference code for bounding box #' #' @details This function uses the ArcGIS REST API, specifically the #' "Execute Web Map Task" task. You can find links below to a web UI for this #' rest endpoint and API documentation. #' #' Web UI: https://utility.arcgisonline.com/arcgis/rest/services/Utilities/PrintingTools/GPServer/Export%20Web%20Map%20Task/execute #' API docs: https://developers.arcgis.com/rest/services-reference/export-web-map-task.htm #' #' @return file path for the downloaded .png map image #' #' @examples #' bbox <- list( #' p1 = list(long = -122.522, lat = 37.707), #' p2 = list(long = -122.354, lat = 37.84) #' ) #' image_size <- define_image_size(bbox, 600) #' overlay_file <- get_arcgis_map_image(bbox, width = image_size$width, #' height = image_size$height) #' get_arcgis_map_image <- function(bbox, map_type = "World_Street_Map", file = NULL, width = 400, height = 400, sr_bbox = 4326) { require(httr) require(glue) require(jsonlite) url <- parse_url( "https://utility.arcgisonline.com/arcgis/rest/services/Utilities/PrintingTools/GPServer/Export%20Web%20Map%20Task/execute" ) # define JSON query parameter web_map_param <- list( baseMap = list(baseMapLayers = list(list( url = jsonlite::unbox( glue( "https://services.arcgisonline.com/ArcGIS/rest/services/{map_type}/MapServer", map_type = map_type ) ) ))), exportOptions = list(outputSize = c(width, height)), mapOptions = list( extent = list( spatialReference = list(wkid = jsonlite::unbox(sr_bbox)), xmax = jsonlite::unbox(max(bbox$p1$long, bbox$p2$long)), xmin = jsonlite::unbox(min(bbox$p1$long, bbox$p2$long)), ymax = jsonlite::unbox(max(bbox$p1$lat, bbox$p2$lat)), ymin = jsonlite::unbox(min(bbox$p1$lat, bbox$p2$lat)) ) ) ) res <- GET( url, query = list( f = "json", Format = "PNG32", Layout_Template = "MAP_ONLY", Web_Map_as_JSON = jsonlite::toJSON(web_map_param) ) ) if (status_code(res) == 200) { body <- content(res, type = "application/json") message(jsonlite::toJSON(body, auto_unbox = TRUE, pretty = TRUE)) if (is.null(file)) file <- tempfile("overlay_img", fileext = ".png") img_res <- GET(body$results[[1]]$value$url) img_bin <- content(img_res, "raw") writeBin(img_bin, file) message(paste("image saved to file:", file)) } else { message(res) } invisible(file) }
/utilities_ray.R
no_license
apsteinmetz/rays
R
false
false
12,205
r
extent_to_bbox <- function(ras){ bb <- bbox(ras) bbx <- list(p1 = list(long=bb[1,1],lat=bb[2,1]), p2 = list(long=bb[1,2],lat=bb[2,2])) return(bbx) } convert_extent_to_utm <- function(longlat_extent,zone = "18T"){ sp_geo <- SpatialPoints(longlat_extent, CRS("+proj=longlat +datum=WGS84")) sp_utm <- spTransform(sp_geo,CRS(glue::glue("+proj=utm +zone={zone} +datum=WGS84"))) return(extent(sp_utm)) } # reduce elevations in map border to zero # totally screwed kup # I do not know why I have to transpose matrix back and forth # top and and bottom are still backwards zero_out_border <- function(elev_matrix,full_extent,borderless_extent){ ras1 <- raster::raster(elev_matrix) extent(ras1) <- borderless_extent ras2 <- raster::crop(ras1,borderless_extent) %>% raster::extend(full_extent,value=0) return(as.matrix(ras2)) } # # convert a lat/long to pixels on an image # house_pos <- find_image_coordinates(latlon_house$long, # latlon_house$lat, # bbox = bbox, # image_width=image_size$width, # image_height=image_size$height) #get the ratio of x and y bounding box sizes # your bbox structure and variable names might vary bbox_size_ratio <- function(bbox1,bbox2) { x <- (bbox1$p1$long-bbox1$p2$long) / (bbox2$p1$long-bbox2$p2$long) y <- (bbox1$p1$lat-bbox1$p2$lat) / (bbox2$p1$lat-bbox2$p2$lat) return (c(x,y)) } # enlarge matrix, putting original in center of new # set border to init_value border_matrix <-function(m,size_ratio=c(x=1,y=1),init_value=0){ d <- dim(m) new_m <- matrix(data=init_value, nrow = round(d[1]*size_ratio[1]), ncol = round(d[2]*size_ratio[2])) new_d <- dim(new_m) insert_start <- c(round((new_d[1]-d[1])/2+1), round((new_d[2]-d[2])/2)+1) insert_end <- c(insert_start[1]+d[1]-1, insert_start[2]+d[2]-1) new_m[insert_start[1]:insert_end[1], insert_start[2]:insert_end[2]] <- m return(new_m) } # pad evevation matrix with zero height border # to overlay an image larger than the raster such # as a map # takes a lat/long bbox make_elev_matrix_border <- function(elev_matrix, bbox_big,bbox_sm) { new_m <- enlarge_matrix(m, bbox_size_ratio(bbox_big,bbox_sm)) return(new_m) } # normalize an object normalize <- function(x) { return ((x - min(x)) / (max(x) - min(x))) } dms_to_dec <- function(deg=0, min=0, sec=0) { return(deg + min / 60 + sec / 3600) } # Change zero depths to fake depth based on distance to shore fake_depth <- function(elev_depth_matrix, depth_step = 5) { zeroes <- which(elev_depth_matrix == 0, arr.ind = T) maxrow <- dim(elev_depth_matrix)[1] maxcol <- dim(elev_depth_matrix)[2] for (i in 1:nrow(zeroes)) { row <- zeroes[i, 1] col <- zeroes[i, 2] found_shore = FALSE distance_to_shore = 1 adjacent_level <- c(0, 0, 0, 0) while (!found_shore) { if (row > distance_to_shore) adjacent_level[1] <- elev_depth_matrix[row - distance_to_shore, col] # south if (col > distance_to_shore) adjacent_level[2] <- elev_depth_matrix[row , col - distance_to_shore] # west if (row < maxrow - distance_to_shore) adjacent_level[3] <- elev_depth_matrix[row + distance_to_shore, col] # north if (col < maxcol - distance_to_shore) adjacent_level[4] <- elev_depth_matrix[row , col + distance_to_shore] # east found_shore <- (max(adjacent_level) > 0) if (found_shore) { elev_depth_matrix[row, col] <- -depth_step * distance_to_shore } else { distance_to_shore <- distance_to_shore + 1 } } } return(elev_depth_matrix) } # ------------------------------------------------------------------- # Crop raster image crop_img <- function(elev_img, bbox) { new_extent <- unlist(bbox) %>% matrix(nrow = 2, ncol = 2) %>% extent() elev_img <- elev_img %>% crop(new_extent) return(elev_img) } # Downscale elevation matrix downscale_elev <- function(elev_matrix, target_image_size) { spacing_w = dim(elev_matrix)[1] / target_image_size$width spacing_h = dim(elev_matrix)[2] / target_image_size$height # downsample but truncate items if rounding returns more points than target # this breaks if rounding dimensions LESS than target_image_size sample_w <- round(seq(1, dim(elev_matrix)[1], by = spacing_w)) sample_h <- round(seq(1, dim(elev_matrix)[2], by = spacing_h)) return(elev_matrix[sample_w, sample_h]) } #rayshader utilities from Will Bishop @wcmbiship #' Translate the given long/lat coordinates into an image position (x, y). #' #' @param long longitude value #' @param lat latitude value #' @param bbox bounding box coordinates (list of 2 points with long/lat values) #' @param image_width image width, in pixels #' @param image_height image height, in pixels #' #' @return named list with elements "x" and "y" defining an image position #' find_image_coordinates <- function(long, lat, bbox, image_width, image_height) { x_img <- round(image_width * (long - min(bbox$p1$long, bbox$p2$long)) / abs(bbox$p1$long - bbox$p2$long)) y_img <- round(image_height * (lat - min(bbox$p1$lat, bbox$p2$lat)) / abs(bbox$p1$lat - bbox$p2$lat)) list(x = x_img, y = y_img) } #' Define image size variables from the given bounding box coordinates. #' #' @param bbox bounding box coordinates (list of 2 points with long/lat values) #' @param major_dim major image dimension, in pixels. #' Default is 400 (meaning larger dimension will be 400 pixels) #' #' @return list with items "width", "height", and "size" (string of format "<width>,<height>") #' #' @examples #' bbox <- list( #' p1 = list(long = -122.522, lat = 37.707), #' p2 = list(long = -122.354, lat = 37.84) #' ) #' image_size <- define_image_size(bbox, 600) #' define_image_size <- function(bbox, major_dim = 400) { # calculate aspect ration (width/height) from lat/long bounding box aspect_ratio <- abs((bbox$p1$long - bbox$p2$long) / (bbox$p1$lat - bbox$p2$lat)) # define dimensions img_width <- ifelse(aspect_ratio > 1, major_dim, major_dim * aspect_ratio) %>% round() img_height <- ifelse(aspect_ratio < 1, major_dim, major_dim / aspect_ratio) %>% round() size_str <- paste(img_width, img_height, sep = ",") list(height = img_height, width = img_width, size = size_str) } #' Download USGS elevation data from the ArcGIS REST API. #' #' @param bbox bounding box coordinates (list of 2 points with long/lat values) #' @param size image size as a string with format "<width>,<height>" #' @param file file path to save to. Default is NULL, which will create a temp file. #' @param sr_bbox Spatial Reference code for bounding box #' @param sr_image Spatial Reference code for elevation image #' #' @details This function uses the ArcGIS REST API, specifically the #' exportImage task. You can find links below to a web UI for this #' rest endpoint and API documentation. #' #' Web UI: https://elevation.nationalmap.gov/arcgis/rest/services/3DEPElevation/ImageServer/exportImage #' API docs: https://developers.arcgis.com/rest/services-reference/export-image.htm #' #' @return file path for downloaded elevation .tif file. This can be read with #' \code{read_elevation_file()}. #' #' @examples #' bbox <- list( #' p1 = list(long = -122.522, lat = 37.707), #' p2 = list(long = -122.354, lat = 37.84) #' ) #' image_size <- define_image_size(bbox, 600) #' elev_file <- get_usgs_elevation_data(bbox, size = image_size$size) #' get_usgs_elevation_data <- function(bbox, size = "400,400", file = NULL, sr_bbox = 4326, sr_image = 4326) { require(httr) # TODO - validate inputs url <- parse_url( "https://elevation.nationalmap.gov/arcgis/rest/services/3DEPElevation/ImageServer/exportImage" ) res <- GET( url, query = list( bbox = paste(bbox$p1$long, bbox$p1$lat, bbox$p2$long, bbox$p2$lat, sep = ","), bboxSR = sr_bbox, imageSR = sr_image, size = size, format = "tiff", pixelType = "F32", noDataInterpretation = "esriNoDataMatchAny", interpolation = "+RSP_BilinearInterpolation", f = "json" ) ) if (status_code(res) == 200) { body <- content(res, type = "application/json") # TODO - check that bbox values are correct # message(jsonlite::toJSON(body, auto_unbox = TRUE, pretty = TRUE)) img_res <- GET(body$href) img_bin <- content(img_res, "raw") if (is.null(file)) file <- tempfile("elev_matrix", fileext = ".tif") writeBin(img_bin, file) message(paste("image saved to file:", file)) } else { warning(res) } invisible(file) } #' Download a map image from the ArcGIS REST API #' #' @param bbox bounding box coordinates (list of 2 points with long/lat values) #' @param map_type map type to download - options are World_Street_Map, World_Imagery, World_Topo_Map #' @param file file path to save to. Default is NULL, which will create a temp file. #' @param width image width (pixels) #' @param height image height (pixels) #' @param sr_bbox Spatial Reference code for bounding box #' #' @details This function uses the ArcGIS REST API, specifically the #' "Execute Web Map Task" task. You can find links below to a web UI for this #' rest endpoint and API documentation. #' #' Web UI: https://utility.arcgisonline.com/arcgis/rest/services/Utilities/PrintingTools/GPServer/Export%20Web%20Map%20Task/execute #' API docs: https://developers.arcgis.com/rest/services-reference/export-web-map-task.htm #' #' @return file path for the downloaded .png map image #' #' @examples #' bbox <- list( #' p1 = list(long = -122.522, lat = 37.707), #' p2 = list(long = -122.354, lat = 37.84) #' ) #' image_size <- define_image_size(bbox, 600) #' overlay_file <- get_arcgis_map_image(bbox, width = image_size$width, #' height = image_size$height) #' get_arcgis_map_image <- function(bbox, map_type = "World_Street_Map", file = NULL, width = 400, height = 400, sr_bbox = 4326) { require(httr) require(glue) require(jsonlite) url <- parse_url( "https://utility.arcgisonline.com/arcgis/rest/services/Utilities/PrintingTools/GPServer/Export%20Web%20Map%20Task/execute" ) # define JSON query parameter web_map_param <- list( baseMap = list(baseMapLayers = list(list( url = jsonlite::unbox( glue( "https://services.arcgisonline.com/ArcGIS/rest/services/{map_type}/MapServer", map_type = map_type ) ) ))), exportOptions = list(outputSize = c(width, height)), mapOptions = list( extent = list( spatialReference = list(wkid = jsonlite::unbox(sr_bbox)), xmax = jsonlite::unbox(max(bbox$p1$long, bbox$p2$long)), xmin = jsonlite::unbox(min(bbox$p1$long, bbox$p2$long)), ymax = jsonlite::unbox(max(bbox$p1$lat, bbox$p2$lat)), ymin = jsonlite::unbox(min(bbox$p1$lat, bbox$p2$lat)) ) ) ) res <- GET( url, query = list( f = "json", Format = "PNG32", Layout_Template = "MAP_ONLY", Web_Map_as_JSON = jsonlite::toJSON(web_map_param) ) ) if (status_code(res) == 200) { body <- content(res, type = "application/json") message(jsonlite::toJSON(body, auto_unbox = TRUE, pretty = TRUE)) if (is.null(file)) file <- tempfile("overlay_img", fileext = ".png") img_res <- GET(body$results[[1]]$value$url) img_bin <- content(img_res, "raw") writeBin(img_bin, file) message(paste("image saved to file:", file)) } else { message(res) } invisible(file) }
library(lubridate) ##Read the data ds <- read.table("household_power_consumption.txt",header = T,sep = ";", na.strings = "?",colClasses = c("character","character","numeric","numeric","numeric","numeric","numeric","numeric","numeric")) myData <- ds[ds$Date %in% c("1/2/2007","2/2/2007"),] ##Making plot par(mfrow = c(1,1)) with(myData,plot(as.integer(dmy_hms(paste(Date, Time))),Global_active_power,type = "l", xaxt = "n", yaxt = "n", xlab = "",ylab = "Global Active Power (kilowatts)")) axis(1, at=c(1170288000,1170374400,1170460800), labels = c("Thu","Fri","Sat")) axis(2, at=c(0,2,4,6),labels = c(0,2,4,6)) ##Copy the plot to png file dev.copy(png,file = "plot2.png") dev.off()
/plot2.R
no_license
quietseason/ExData_Plotting1
R
false
false
684
r
library(lubridate) ##Read the data ds <- read.table("household_power_consumption.txt",header = T,sep = ";", na.strings = "?",colClasses = c("character","character","numeric","numeric","numeric","numeric","numeric","numeric","numeric")) myData <- ds[ds$Date %in% c("1/2/2007","2/2/2007"),] ##Making plot par(mfrow = c(1,1)) with(myData,plot(as.integer(dmy_hms(paste(Date, Time))),Global_active_power,type = "l", xaxt = "n", yaxt = "n", xlab = "",ylab = "Global Active Power (kilowatts)")) axis(1, at=c(1170288000,1170374400,1170460800), labels = c("Thu","Fri","Sat")) axis(2, at=c(0,2,4,6),labels = c(0,2,4,6)) ##Copy the plot to png file dev.copy(png,file = "plot2.png") dev.off()
#' Encode a local favicon image to be passed to the API #' #' This function takes a local image path and returns a formatted list expected by the JSON request #' @param image_path character; path to the image #' @return list; list containing the embedded image and required extra parameters needed for the JSON request #' @export local_image <- function(image_path) { image <- readBin(image_path, what = "raw", n = fs::file_info(image_path)$size) list( type = "inline", content = openssl::base64_encode(image) ) } #' Provide an image via url to be passed to the API #' #' This function takes a url to an image and returns a formatted list needed by the JSON request #' @param url character; url to image #' @return list; list containing the url and required extra parameters needed for the JSON request #' @export url_image <- function(url) { list( type = "url", url = url ) } #' Create a list and remove NULLs #' #' Useful to remove NULL values when creating the favicon_design #' @param ... values to be added to list #' @return list; list without NULL values #' @export remove_null_list <- function(...) { raw_list <- list(...) plyr::compact(raw_list) } #' Create a list excluding empty elements #' #' @param ... values to be coerced to a list #' @return list; list without empty values #' @export remove_empty_list <- function(...) { raw_list <- list(...) raw_list[!vapply(raw_list, Negate(length), NA)] }
/R/utility.R
no_license
ARawles/faviconR
R
false
false
1,449
r
#' Encode a local favicon image to be passed to the API #' #' This function takes a local image path and returns a formatted list expected by the JSON request #' @param image_path character; path to the image #' @return list; list containing the embedded image and required extra parameters needed for the JSON request #' @export local_image <- function(image_path) { image <- readBin(image_path, what = "raw", n = fs::file_info(image_path)$size) list( type = "inline", content = openssl::base64_encode(image) ) } #' Provide an image via url to be passed to the API #' #' This function takes a url to an image and returns a formatted list needed by the JSON request #' @param url character; url to image #' @return list; list containing the url and required extra parameters needed for the JSON request #' @export url_image <- function(url) { list( type = "url", url = url ) } #' Create a list and remove NULLs #' #' Useful to remove NULL values when creating the favicon_design #' @param ... values to be added to list #' @return list; list without NULL values #' @export remove_null_list <- function(...) { raw_list <- list(...) plyr::compact(raw_list) } #' Create a list excluding empty elements #' #' @param ... values to be coerced to a list #' @return list; list without empty values #' @export remove_empty_list <- function(...) { raw_list <- list(...) raw_list[!vapply(raw_list, Negate(length), NA)] }
rm(list=ls()) source("function_DY.R") #Set data datname="managed sample data.txt" rawdatamat=read.table(datname,encoding="UTF-8") subjlabels=rawdatamat[,257] #reads extra information in datafile if available subjgroup= rawdatamat[,258] #Set simulation conditions maxiter <- 50 maxsubj <- 88 lengthvec <- 128-rowSums(rawdatamat[,1:128]==0) modelstorun <- 5 parbounds <- c(0,0,.01,.01,1,1,5,5) #boundaries for r, p, d, i lb=parbounds[1:4] ub=parbounds[5:8] stretchpars=function(opars) -log((ub-lb)/(opars-lb)-1) #opars=original pars contractpars=function(spars) (ub-lb)/(exp(-spars)+1)+lb #spars=stretched pars #Generate Model Names freeparsmat <- expand.grid(r=c("r",""),i=c("i","0","1"),d=c("d",""),p=c("p","")) freeparsmat <- as.matrix(freeparsmat) freeparsmat <- freeparsmat[,c(1,4,3,2)] #Needed to match the sequence as the original one. fixedvalsmat <- expand.grid(r=c(-1,1),i=c(-1,0.0001,1-1e-8),d=c(-1,1),p=c(-1,1)) # -1 means free parameter fixedvalsmat <- as.matrix(fixedvalsmat) fixedvalsmat <- fixedvalsmat[,c(1,4,3,2)] pequalsrmat <- fixedvalsmat[,"p"] pequalsrmat[pequalsrmat==-1] <- 0 modnames <- apply(freeparsmat, 1, paste, collapse="") #Initailize stacks twoLLstack <- array(rep(NA,(maxsubj*maxiter*24)),dim=c(maxsubj,maxiter,24)) #row is subj, col is LL, dim is number of models BICstack=array(rep(NA,(maxsubj*maxiter*24)),dim=c(maxsubj,maxiter,24)) parstack <- array(NA, c(maxsubj, 4, 24)) #col is parameters finalLLstack <- array(NA, dim=c(maxsubj,1,24)) finalBICstack <- array(NA, dim=c(maxsubj,1,24)) ##For hypothesized models #Run simulations for (cursubj in 50:88){ #for 88 subjects curlength=lengthvec[cursubj] curchoices=data.frame(rawdatamat[cursubj,1:curlength]) curreinf=data.frame(rawdatamat[cursubj,129:(128+curlength)]) for (curmod in modelstorun){ #for 24 models temppars <- runif(4)*ub setmod <- optim(temppars, vattG2overarchfun, freeletters=freeparsmat[curmod,],fixedvals=fixedvalsmat[curmod,], pequalsr=pequalsrmat[curmod],tempchoices=curchoices,tempreinf=curreinf,predpfun=vattpredpfun9, method="Nelder-Mead") #abnormal termination happens with L-BFGS-B. have to manually re-range parameters for (curiter in 1:maxiter){ #run 100 iterations. Optimize the -LL from MLE model temppars <- runif(4)*ub tempmod <- optim(temppars, vattG2overarchfun, freeletters=freeparsmat[curmod,],fixedvals=fixedvalsmat[curmod,], pequalsr=pequalsrmat[curmod],tempchoices=curchoices,tempreinf=curreinf,predpfun=vattpredpfun9, method="Nelder-Mead") #abnormal termination happens with L-BFGS-B. have to manually re-range parameters twoLLstack[cursubj,curiter,curmod] <- tempmod$value BICstack[cursubj,curiter,curmod] <- tempmod$value+sum(freeparsmat[curmod,]!="")*log(curlength-1) if (tempmod$value < setmod$value){ #Stack parameters setmod <- tempmod} roundpars <- round(contractpars(tempmod$par),3) print(noquote(c("subj#=",cursubj," iter=",curiter," model=",modnames[curmod], " -2LL=",round(tempmod$value,3) ))) print(noquote(c("r=",roundpars[1]," p=",roundpars[2]," d=",roundpars[3]," i=",roundpars[4]))) print(noquote("")) flush.console() } #iteration loop #Calculate information criteria parstack[cursubj,,curmod] <- contractpars(setmod$par) finalLLstack[cursubj,,curmod] <- setmod$value finalBICstack[cursubj,,curmod] <- tempmod$value+sum(freeparsmat[curmod,]!="")*log(curlength-1) } #model loop } #subject loop ##For baseline model #Calculate information criteria for baseline model. case3로 해보자! deckbaseG2 <- c() deckbaseG2_DY <- c() catt33G2 <- c() deckbaseBIC <- c() for(cursubj in 1:maxsubj){ curlength=lengthvec[cursubj] curchoices=data.frame(rawdatamat[cursubj,1:curlength]) curreinf=data.frame(rawdatamat[cursubj,129:(128+curlength)]) deckobsf <- c() for (i in 1:4){deckobsf[i] <- c(sum(curchoices==i))} deckexpf <- sum(deckobsf)*c(1/4,1/4,1/4,1/4) #Expected frequency assuming independence deckobsp <- deckobsf/lengthvec[cursubj] deckbaseG2[cursubj]=-2*sum(deckobsf*log(deckobsp)) #original code 지금 이건 loglikelihood랑 g2를 섞은것 같은데... deckbaseG2_DY[cursubj] <- -2*lengthvec[cursubj]*log(0.25) catt33G2[cursubj]=cattG2fun(rep((1/3),3),curchoices) #G2 아니고 2LL임. attention에 따라 deckchoice probability를 준 뒤, 그 probability를 case3 deckbaseBIC[cursubj]=deckbaseG2[cursubj]+3*log(curlength-1) #왜 1개 빼지? cattg2fun에서도 그러던데..그럼 deckbaseg2에서도 빼야하는거 아님? } ########여기서부터 내 실습 cursubj <- 1 curlength=lengthvec[cursubj] curchoices=data.frame(rawdatamat[cursubj,1:curlength]) curreinf=data.frame(rawdatamat[cursubj,129:(128+curlength)]) deckbaseG2 <- c() catt33G2 <- c() deckbaseBIC <- c() deckobsf <- c() for (i in 1:4){deckobsf[i] <- c(sum(curchoices==i))} deckexpf <- sum(deckobsf)*c(1/4,1/4,1/4,1/4) #Expected frequency assuming independence deckobsp <- deckobsf/lengthvec[cursubj] ##Case1. original code deckbaseG2[cursubj]=-2*sum(deckobsf*log(deckobsp)) #original code 지금 이건 loglikelihood랑 g2를 섞은것 같은데... catt33G2[cursubj]=cattG2fun(rep((1/3),3),curchoices) #G2 아니고 2LL임. attention에 따라 deckchoice probability를 준 뒤, 그 probability를 case3 deckbaseBIC[cursubj]=deckbaseG2[cursubj]+3*log(curlength-1) #왜 1개 빼지? cattg2fun에서도 그러던데..그럼 deckbaseg2에서도 빼야하는거 아님? ##Case3. choice에 대한 probability sum. lengthvec*log(0.25) 이게 single trial에 대한 multinomial을 우도함수로 사용한 것인듯? -2*lengthvec[cursubj]*log(0.25) ## curmod <- 5 catt33G2 <- array(NA, c(maxsubj, 1, 24)) catt33BIC <- array(NA, c(maxsubj, 1, 24)) for(cursubj in 1:88){ curlength=lengthvec[cursubj] curchoices=data.frame(rawdatamat[cursubj,1:curlength]) curreinf=data.frame(rawdatamat[cursubj,129:(128+curlength)]) catt33G2[cursubj,1,curmod] <- cattG2fun(rep(1/3,3),curchoices) catt33BIC[cursubj,1,curmod] <-catt33G2[cursubj,1,curmod]+3*log(curlength-1) } ####summarize tables 1:49, 50:88 control/sdi r_BIC <- finalBICstack[,,5] r_LL <- finalLLstack[,,5] r_par <- parstack[,,5] r_baseLL <- catt33G2[,,5] r_baseBIc <- catt33BIC[,,5] mean_par <- rbind(control=colMeans(r_par[1:49,]), sdi=colMeans(r_par[50:88,])) median_par <- rbind(control=apply(r_par[1:49,],2,median), sdi=apply(r_par[50:88,],2,median)) sd_par <- rbind(control=apply(r_par[1:49,],2,sd), sdi=apply(r_par[50:88,],2,sd)) BIC_5 <- mean(r_BIC) LL_base <- mean(r_baseLL) BIC_base <- mean(r_baseBIc)
/code/body_rpd1_DY.R
no_license
mindy2801/WCST
R
false
false
6,777
r
rm(list=ls()) source("function_DY.R") #Set data datname="managed sample data.txt" rawdatamat=read.table(datname,encoding="UTF-8") subjlabels=rawdatamat[,257] #reads extra information in datafile if available subjgroup= rawdatamat[,258] #Set simulation conditions maxiter <- 50 maxsubj <- 88 lengthvec <- 128-rowSums(rawdatamat[,1:128]==0) modelstorun <- 5 parbounds <- c(0,0,.01,.01,1,1,5,5) #boundaries for r, p, d, i lb=parbounds[1:4] ub=parbounds[5:8] stretchpars=function(opars) -log((ub-lb)/(opars-lb)-1) #opars=original pars contractpars=function(spars) (ub-lb)/(exp(-spars)+1)+lb #spars=stretched pars #Generate Model Names freeparsmat <- expand.grid(r=c("r",""),i=c("i","0","1"),d=c("d",""),p=c("p","")) freeparsmat <- as.matrix(freeparsmat) freeparsmat <- freeparsmat[,c(1,4,3,2)] #Needed to match the sequence as the original one. fixedvalsmat <- expand.grid(r=c(-1,1),i=c(-1,0.0001,1-1e-8),d=c(-1,1),p=c(-1,1)) # -1 means free parameter fixedvalsmat <- as.matrix(fixedvalsmat) fixedvalsmat <- fixedvalsmat[,c(1,4,3,2)] pequalsrmat <- fixedvalsmat[,"p"] pequalsrmat[pequalsrmat==-1] <- 0 modnames <- apply(freeparsmat, 1, paste, collapse="") #Initailize stacks twoLLstack <- array(rep(NA,(maxsubj*maxiter*24)),dim=c(maxsubj,maxiter,24)) #row is subj, col is LL, dim is number of models BICstack=array(rep(NA,(maxsubj*maxiter*24)),dim=c(maxsubj,maxiter,24)) parstack <- array(NA, c(maxsubj, 4, 24)) #col is parameters finalLLstack <- array(NA, dim=c(maxsubj,1,24)) finalBICstack <- array(NA, dim=c(maxsubj,1,24)) ##For hypothesized models #Run simulations for (cursubj in 50:88){ #for 88 subjects curlength=lengthvec[cursubj] curchoices=data.frame(rawdatamat[cursubj,1:curlength]) curreinf=data.frame(rawdatamat[cursubj,129:(128+curlength)]) for (curmod in modelstorun){ #for 24 models temppars <- runif(4)*ub setmod <- optim(temppars, vattG2overarchfun, freeletters=freeparsmat[curmod,],fixedvals=fixedvalsmat[curmod,], pequalsr=pequalsrmat[curmod],tempchoices=curchoices,tempreinf=curreinf,predpfun=vattpredpfun9, method="Nelder-Mead") #abnormal termination happens with L-BFGS-B. have to manually re-range parameters for (curiter in 1:maxiter){ #run 100 iterations. Optimize the -LL from MLE model temppars <- runif(4)*ub tempmod <- optim(temppars, vattG2overarchfun, freeletters=freeparsmat[curmod,],fixedvals=fixedvalsmat[curmod,], pequalsr=pequalsrmat[curmod],tempchoices=curchoices,tempreinf=curreinf,predpfun=vattpredpfun9, method="Nelder-Mead") #abnormal termination happens with L-BFGS-B. have to manually re-range parameters twoLLstack[cursubj,curiter,curmod] <- tempmod$value BICstack[cursubj,curiter,curmod] <- tempmod$value+sum(freeparsmat[curmod,]!="")*log(curlength-1) if (tempmod$value < setmod$value){ #Stack parameters setmod <- tempmod} roundpars <- round(contractpars(tempmod$par),3) print(noquote(c("subj#=",cursubj," iter=",curiter," model=",modnames[curmod], " -2LL=",round(tempmod$value,3) ))) print(noquote(c("r=",roundpars[1]," p=",roundpars[2]," d=",roundpars[3]," i=",roundpars[4]))) print(noquote("")) flush.console() } #iteration loop #Calculate information criteria parstack[cursubj,,curmod] <- contractpars(setmod$par) finalLLstack[cursubj,,curmod] <- setmod$value finalBICstack[cursubj,,curmod] <- tempmod$value+sum(freeparsmat[curmod,]!="")*log(curlength-1) } #model loop } #subject loop ##For baseline model #Calculate information criteria for baseline model. case3로 해보자! deckbaseG2 <- c() deckbaseG2_DY <- c() catt33G2 <- c() deckbaseBIC <- c() for(cursubj in 1:maxsubj){ curlength=lengthvec[cursubj] curchoices=data.frame(rawdatamat[cursubj,1:curlength]) curreinf=data.frame(rawdatamat[cursubj,129:(128+curlength)]) deckobsf <- c() for (i in 1:4){deckobsf[i] <- c(sum(curchoices==i))} deckexpf <- sum(deckobsf)*c(1/4,1/4,1/4,1/4) #Expected frequency assuming independence deckobsp <- deckobsf/lengthvec[cursubj] deckbaseG2[cursubj]=-2*sum(deckobsf*log(deckobsp)) #original code 지금 이건 loglikelihood랑 g2를 섞은것 같은데... deckbaseG2_DY[cursubj] <- -2*lengthvec[cursubj]*log(0.25) catt33G2[cursubj]=cattG2fun(rep((1/3),3),curchoices) #G2 아니고 2LL임. attention에 따라 deckchoice probability를 준 뒤, 그 probability를 case3 deckbaseBIC[cursubj]=deckbaseG2[cursubj]+3*log(curlength-1) #왜 1개 빼지? cattg2fun에서도 그러던데..그럼 deckbaseg2에서도 빼야하는거 아님? } ########여기서부터 내 실습 cursubj <- 1 curlength=lengthvec[cursubj] curchoices=data.frame(rawdatamat[cursubj,1:curlength]) curreinf=data.frame(rawdatamat[cursubj,129:(128+curlength)]) deckbaseG2 <- c() catt33G2 <- c() deckbaseBIC <- c() deckobsf <- c() for (i in 1:4){deckobsf[i] <- c(sum(curchoices==i))} deckexpf <- sum(deckobsf)*c(1/4,1/4,1/4,1/4) #Expected frequency assuming independence deckobsp <- deckobsf/lengthvec[cursubj] ##Case1. original code deckbaseG2[cursubj]=-2*sum(deckobsf*log(deckobsp)) #original code 지금 이건 loglikelihood랑 g2를 섞은것 같은데... catt33G2[cursubj]=cattG2fun(rep((1/3),3),curchoices) #G2 아니고 2LL임. attention에 따라 deckchoice probability를 준 뒤, 그 probability를 case3 deckbaseBIC[cursubj]=deckbaseG2[cursubj]+3*log(curlength-1) #왜 1개 빼지? cattg2fun에서도 그러던데..그럼 deckbaseg2에서도 빼야하는거 아님? ##Case3. choice에 대한 probability sum. lengthvec*log(0.25) 이게 single trial에 대한 multinomial을 우도함수로 사용한 것인듯? -2*lengthvec[cursubj]*log(0.25) ## curmod <- 5 catt33G2 <- array(NA, c(maxsubj, 1, 24)) catt33BIC <- array(NA, c(maxsubj, 1, 24)) for(cursubj in 1:88){ curlength=lengthvec[cursubj] curchoices=data.frame(rawdatamat[cursubj,1:curlength]) curreinf=data.frame(rawdatamat[cursubj,129:(128+curlength)]) catt33G2[cursubj,1,curmod] <- cattG2fun(rep(1/3,3),curchoices) catt33BIC[cursubj,1,curmod] <-catt33G2[cursubj,1,curmod]+3*log(curlength-1) } ####summarize tables 1:49, 50:88 control/sdi r_BIC <- finalBICstack[,,5] r_LL <- finalLLstack[,,5] r_par <- parstack[,,5] r_baseLL <- catt33G2[,,5] r_baseBIc <- catt33BIC[,,5] mean_par <- rbind(control=colMeans(r_par[1:49,]), sdi=colMeans(r_par[50:88,])) median_par <- rbind(control=apply(r_par[1:49,],2,median), sdi=apply(r_par[50:88,],2,median)) sd_par <- rbind(control=apply(r_par[1:49,],2,sd), sdi=apply(r_par[50:88,],2,sd)) BIC_5 <- mean(r_BIC) LL_base <- mean(r_baseLL) BIC_base <- mean(r_baseBIc)
#-----------------------------------------------------------------------------# # # Author: Logan Stundal # Date: April 09, 2021 # Purpose: 5.0: Table Construction # # # Copyright (c): Logan Stundal, 2021 # Email: stund005@umn.edu # #-----------------------------------------------------------------------------# # # Notes: # Create tables for SPDE model results # #-----------------------------------------------------------------------------# #-----------------------------------------------------------------------------# # ADMINISTRATIVE ---- #-----------------------------------------------------------------------------# #---------------------------# # Clear working environment #---------------------------# rm(list = ls()) #---------------------------# # Load required packages #---------------------------# library(tidyverse) library(magrittr) # library(sf) library(INLA) library(kableExtra) #---------------------------# # Load data #---------------------------# load("Results/inla-mods.Rdata") #---------------------------# # Functions #---------------------------# qoi <- function(mod_list, centrality = "mean"){ # Takes an inla model list and returns a list containing quantities # of interest # ----------------------------------- # # Extract partials from structural model # ----------------------------------- # inla_betas <- lapply(mod_list, function(mod){ tmp <- round(mod$summary.fixed[,c(ifelse(centrality == "mean", "mean", "0.5quant"), "0.025quant","0.975quant")],3) %>% as.data.frame() if(centrality == "mean"){ tmp %<>% rename(mean = `mean`, lb = `0.025quant`, ub = `0.975quant`) %>% rownames_to_column(var = "variable") } else if(centrality == "median"){ tmp %<>% rename(median = `0.5quant`, lb = `0.025quant`, ub = `0.975quant`) %>% rownames_to_column(var = "variable") } else{ stop("Centrality parameter must be one of: 'median' or 'mean'.") } }) # ----------------------------------- # # ----------------------------------- # # Extract hyper-parameters # ----------------------------------- # inla_hyper <- lapply(mod_list, function(mod, round_digits = 3){ spde_pars <- inla.spde2.result(inla = mod, name = "spatial.field", spde,do.transform = TRUE) # ----------------------------------- # # ----------------------------------- # # Tidy hyper-parameter centrality measures # ----------------------------------- # if(centrality == "median"){ Kappa <- inla.qmarginal(0.50, spde_pars$marginals.kappa[[1]]) # kappa (median) Sigma <- inla.qmarginal(0.50, spde_pars$marginals.variance.nominal[[1]]) # variance (median) Range <- inla.qmarginal(0.50, spde_pars$marginals.range.nominal[[1]]) # range (median) } else if(centrality == "mean"){ Kappa <- inla.emarginal(function(x) x, spde_pars$marginals.kappa[[1]]) # kappa (mean) Sigma <- inla.emarginal(function(x) x, spde_pars$marginals.variance.nominal[[1]]) # variance (mean) Range <- inla.emarginal(function(x) x, spde_pars$marginals.range.nominal[[1]]) # range (mean) } else{ stop("Centrality parameter must be one of: 'median' or 'mean'.") } # ----------------------------------- # # ----------------------------------- # # Extract HPDs # ----------------------------------- # Kappahpd <- inla.hpdmarginal(0.95, spde_pars$marginals.kappa[[1]]) # kappa (hpd 95%) Sigmahpd <- inla.hpdmarginal(0.95, spde_pars$marginals.variance.nominal[[1]]) # variance (hpd 95%) Rangehpd <- inla.hpdmarginal(0.95, spde_pars$marginals.range.nominal[[1]]) # range (hpd 95%) # ----------------------------------- # # ----------------------------------- # # Convert range to km (degrees = 2*pi*6371/360) # ----------------------------------- # Range <- Range * 2*pi*6371/360 Rangehpd <- Rangehpd * 2*pi*6371/360 # ----------------------------------- # # ----------------------------------- # # Tidy up return object # ----------------------------------- # df <- rbind(cbind(Kappa, Kappahpd), cbind(Sigma, Sigmahpd), cbind(Range, Rangehpd)) %>% as.data.frame() colnames(df) <- c(centrality,"lb","ub") rownames(df) <- 1:nrow(df) df$variable <- c("Kappa","Sigma","Range") # ----------------------------------- # return(df) }) inla_lliks <- lapply(mod_list, function(mod){ mod$mlik[1] }) return(list("betas" = inla_betas, "hyper" = inla_hyper, "lliks" = inla_lliks)) } #-----------------------------------------------------------------------------# #-----------------------------------------------------------------------------# # SPECIFY PREFERRED CENTRALITY MEASURE ---- #-----------------------------------------------------------------------------# cent <- "median" #-----------------------------------------------------------------------------# #-----------------------------------------------------------------------------# # QOI ---- #-----------------------------------------------------------------------------# # Extract quantities-of-interest: regression coefficients and hyperparameters res_vals <- sapply(yr_grp, function(x){ qoi(inla_mods[[x]], centrality = cent) }, simplify = F) #-----------------------------------------------------------------------------# #-----------------------------------------------------------------------------# # TIDY PARAMS ---- #-----------------------------------------------------------------------------# tidy_vals <- list() for(yr in yr_grp){ for(dv in dvs){ bs <- res_vals[[yr]][["betas"]][[dv]] hy <- res_vals[[yr]][["hyper"]][[dv]] llik <- res_vals[[yr]][["lliks"]][[dv]] vl <- bind_rows(bs, hy) vl <- bind_cols(vl, "model" = dv, "years" = yr, "lliks" = llik, "n" = "1116") id <- paste(dv, yr, sep = "_._") tidy_vals[[id]] <- vl } };rm(yr, dv, bs, hy, llik, vl, id) # Bind parameters to DF tidy_vals <- bind_rows(tidy_vals) #-----------------------------------------------------------------------------# #-----------------------------------------------------------------------------# # MODEL TIDY PARAMS ---- #-----------------------------------------------------------------------------# tab_vals <- tidy_vals %>% mutate(across(c(!!cent, lb, ub, lliks), ~format(round(.x, 3), nsmall = 3))) %>% mutate(hpd = sprintf("[%s, %s]", lb, ub)) %>% dplyr::select(variable, !!cent, hpd, model, years) %>% pivot_longer(., cols = c(!!cent, hpd), names_to = "type") %>% pivot_wider(., id_cols = c(variable, type, years), names_from = model, values_from = value) lliks_n <- tidy_vals %>% group_by(model, years) %>% summarize(lliks = lliks[1], n = n[1], .groups = "keep") %>% ungroup() %>% mutate(across(c(lliks), ~format(round(.x, 3), nsmall = 3))) %>% dplyr::select(lliks, n, model, years) %>% pivot_longer(., cols = c(lliks, n), names_to = "variable") %>% pivot_wider(., id_cols = c(variable, years), names_from = model, values_from = value) %>% mutate(type = NA) tab_vals <- bind_rows(tab_vals, lliks_n) %>% dplyr::select(-type) %>% mutate(variable = case_when(variable == "intercept" ~ "Intercept", variable == "dist" ~ "Dist. Bogota, km (log)", variable == "pop" ~ "Population (log)", variable == "tri" ~ "TRI", variable == "lliks" ~ "LogLik", variable == "n" ~ "N", TRUE ~ variable)) rm(lliks_n) #-----------------------------------------------------------------------------# #-----------------------------------------------------------------------------# # SAVE ---- #-----------------------------------------------------------------------------# save(tab_vals, cent, model_colors, file = "Results/Tables/tidy-mods.Rdata") rm(list = ls()) #-----------------------------------------------------------------------------#
/Scripts/5.0-Results-Tables-Continuous.R
no_license
loganstundal/EventData-Space-Colombia
R
false
false
9,024
r
#-----------------------------------------------------------------------------# # # Author: Logan Stundal # Date: April 09, 2021 # Purpose: 5.0: Table Construction # # # Copyright (c): Logan Stundal, 2021 # Email: stund005@umn.edu # #-----------------------------------------------------------------------------# # # Notes: # Create tables for SPDE model results # #-----------------------------------------------------------------------------# #-----------------------------------------------------------------------------# # ADMINISTRATIVE ---- #-----------------------------------------------------------------------------# #---------------------------# # Clear working environment #---------------------------# rm(list = ls()) #---------------------------# # Load required packages #---------------------------# library(tidyverse) library(magrittr) # library(sf) library(INLA) library(kableExtra) #---------------------------# # Load data #---------------------------# load("Results/inla-mods.Rdata") #---------------------------# # Functions #---------------------------# qoi <- function(mod_list, centrality = "mean"){ # Takes an inla model list and returns a list containing quantities # of interest # ----------------------------------- # # Extract partials from structural model # ----------------------------------- # inla_betas <- lapply(mod_list, function(mod){ tmp <- round(mod$summary.fixed[,c(ifelse(centrality == "mean", "mean", "0.5quant"), "0.025quant","0.975quant")],3) %>% as.data.frame() if(centrality == "mean"){ tmp %<>% rename(mean = `mean`, lb = `0.025quant`, ub = `0.975quant`) %>% rownames_to_column(var = "variable") } else if(centrality == "median"){ tmp %<>% rename(median = `0.5quant`, lb = `0.025quant`, ub = `0.975quant`) %>% rownames_to_column(var = "variable") } else{ stop("Centrality parameter must be one of: 'median' or 'mean'.") } }) # ----------------------------------- # # ----------------------------------- # # Extract hyper-parameters # ----------------------------------- # inla_hyper <- lapply(mod_list, function(mod, round_digits = 3){ spde_pars <- inla.spde2.result(inla = mod, name = "spatial.field", spde,do.transform = TRUE) # ----------------------------------- # # ----------------------------------- # # Tidy hyper-parameter centrality measures # ----------------------------------- # if(centrality == "median"){ Kappa <- inla.qmarginal(0.50, spde_pars$marginals.kappa[[1]]) # kappa (median) Sigma <- inla.qmarginal(0.50, spde_pars$marginals.variance.nominal[[1]]) # variance (median) Range <- inla.qmarginal(0.50, spde_pars$marginals.range.nominal[[1]]) # range (median) } else if(centrality == "mean"){ Kappa <- inla.emarginal(function(x) x, spde_pars$marginals.kappa[[1]]) # kappa (mean) Sigma <- inla.emarginal(function(x) x, spde_pars$marginals.variance.nominal[[1]]) # variance (mean) Range <- inla.emarginal(function(x) x, spde_pars$marginals.range.nominal[[1]]) # range (mean) } else{ stop("Centrality parameter must be one of: 'median' or 'mean'.") } # ----------------------------------- # # ----------------------------------- # # Extract HPDs # ----------------------------------- # Kappahpd <- inla.hpdmarginal(0.95, spde_pars$marginals.kappa[[1]]) # kappa (hpd 95%) Sigmahpd <- inla.hpdmarginal(0.95, spde_pars$marginals.variance.nominal[[1]]) # variance (hpd 95%) Rangehpd <- inla.hpdmarginal(0.95, spde_pars$marginals.range.nominal[[1]]) # range (hpd 95%) # ----------------------------------- # # ----------------------------------- # # Convert range to km (degrees = 2*pi*6371/360) # ----------------------------------- # Range <- Range * 2*pi*6371/360 Rangehpd <- Rangehpd * 2*pi*6371/360 # ----------------------------------- # # ----------------------------------- # # Tidy up return object # ----------------------------------- # df <- rbind(cbind(Kappa, Kappahpd), cbind(Sigma, Sigmahpd), cbind(Range, Rangehpd)) %>% as.data.frame() colnames(df) <- c(centrality,"lb","ub") rownames(df) <- 1:nrow(df) df$variable <- c("Kappa","Sigma","Range") # ----------------------------------- # return(df) }) inla_lliks <- lapply(mod_list, function(mod){ mod$mlik[1] }) return(list("betas" = inla_betas, "hyper" = inla_hyper, "lliks" = inla_lliks)) } #-----------------------------------------------------------------------------# #-----------------------------------------------------------------------------# # SPECIFY PREFERRED CENTRALITY MEASURE ---- #-----------------------------------------------------------------------------# cent <- "median" #-----------------------------------------------------------------------------# #-----------------------------------------------------------------------------# # QOI ---- #-----------------------------------------------------------------------------# # Extract quantities-of-interest: regression coefficients and hyperparameters res_vals <- sapply(yr_grp, function(x){ qoi(inla_mods[[x]], centrality = cent) }, simplify = F) #-----------------------------------------------------------------------------# #-----------------------------------------------------------------------------# # TIDY PARAMS ---- #-----------------------------------------------------------------------------# tidy_vals <- list() for(yr in yr_grp){ for(dv in dvs){ bs <- res_vals[[yr]][["betas"]][[dv]] hy <- res_vals[[yr]][["hyper"]][[dv]] llik <- res_vals[[yr]][["lliks"]][[dv]] vl <- bind_rows(bs, hy) vl <- bind_cols(vl, "model" = dv, "years" = yr, "lliks" = llik, "n" = "1116") id <- paste(dv, yr, sep = "_._") tidy_vals[[id]] <- vl } };rm(yr, dv, bs, hy, llik, vl, id) # Bind parameters to DF tidy_vals <- bind_rows(tidy_vals) #-----------------------------------------------------------------------------# #-----------------------------------------------------------------------------# # MODEL TIDY PARAMS ---- #-----------------------------------------------------------------------------# tab_vals <- tidy_vals %>% mutate(across(c(!!cent, lb, ub, lliks), ~format(round(.x, 3), nsmall = 3))) %>% mutate(hpd = sprintf("[%s, %s]", lb, ub)) %>% dplyr::select(variable, !!cent, hpd, model, years) %>% pivot_longer(., cols = c(!!cent, hpd), names_to = "type") %>% pivot_wider(., id_cols = c(variable, type, years), names_from = model, values_from = value) lliks_n <- tidy_vals %>% group_by(model, years) %>% summarize(lliks = lliks[1], n = n[1], .groups = "keep") %>% ungroup() %>% mutate(across(c(lliks), ~format(round(.x, 3), nsmall = 3))) %>% dplyr::select(lliks, n, model, years) %>% pivot_longer(., cols = c(lliks, n), names_to = "variable") %>% pivot_wider(., id_cols = c(variable, years), names_from = model, values_from = value) %>% mutate(type = NA) tab_vals <- bind_rows(tab_vals, lliks_n) %>% dplyr::select(-type) %>% mutate(variable = case_when(variable == "intercept" ~ "Intercept", variable == "dist" ~ "Dist. Bogota, km (log)", variable == "pop" ~ "Population (log)", variable == "tri" ~ "TRI", variable == "lliks" ~ "LogLik", variable == "n" ~ "N", TRUE ~ variable)) rm(lliks_n) #-----------------------------------------------------------------------------# #-----------------------------------------------------------------------------# # SAVE ---- #-----------------------------------------------------------------------------# save(tab_vals, cent, model_colors, file = "Results/Tables/tidy-mods.Rdata") rm(list = ls()) #-----------------------------------------------------------------------------#
# Demonstration of maRketSim capabilities on the bond side # - Simple bonds - # mkt1 <- market(market.bond(i=.05),t=0) # All that is required to specify a bond market is an interest rate mkt1C <- market(market.bond(i=.1),t=0) bnd.A <- bond(mkt=mkt1,mat=5) # Bonds can be specified by maturity bnd.B <- bond(mkt=mkt1,dur=2.5) # or duration, in which case the maturity under prevailing interest rates is calculated bnd.C <- bond(mkt=mkt1C,mat=15) bnd.A # You can display the basic characteristics of a bond summary(bnd.A,mkt1) # Or more sophisticated information like duration and convexity # - Bonds in time and yield curves - # mkt2 <- market(market.bond(yield.curve=quote(0.01 + log10( mat + 1 )/ 20),MMrate=.01),t=2) #yield curve must be in format specified here. t=2 implies this is a rate change in the future mkt1B <- market(market.bond(yield.curve=quote(0.01 + log10( mat + 1 )/ 20),MMrate=.01),t=0) # we'll need this guy later to demonstrate automatic portfolio generation sum.bnd.A <- summary(bnd.A,mkt2) # Now we're evaluating the same bond two years later, with the intervening coupon payments disappearing into the ether (accounts will address that) str(sum.bnd.A) # The summary object has structure with useful quantities to be extracted # Example of extracting duration durs <- c() ts <- seq(0,15,.5) for(t in ts) { d <- summary(bnd.C,market(market.bond(i=.1),t=t))$dur durs <- c(durs,d) } plot(durs~ts,main="Duration vs. the passage of time",xlab="Time",ylab="Duration") # - Portfolios of bonds - # prt1 <- portfolio(name="bond1",bonds=list(bnd.A,bnd.B,bnd.C),mkt=mkt1) prt1 # Display the bonds in the portfolio summary(prt1) # Display the portfolio's characteristics under its original market conditions summary(prt1,mkt=mkt2) # Display the portfolio's characteristics under new market conditions as.data.frame(prt1) #Another way of looking at the portfolio. Useful for exporting to user-written functions or spreadsheets. # Create random portfolios of bonds with certain portfolio characteristics prt2 <- genPortfolio.bond(10,mkt=mkt1B,dur=5,dur.sd=2,name="bond2",type="random.constrained") prt2 summary(prt2) cat("Duration of our generated portfolio is",round(abs(5-summary(prt2)$portfolio.sum$dur),2),"away from 5.\n") # - Market histories - # mkt3 <- market(market.bond(yield.curve=quote(mat/75+0.02),MMrate=.02),t=3) h.mkt.simple <- history.market(list(mkt1,mkt2,mkt3)) plot(h.mkt.simple) # Shows how yield curves are handled plot(h.mkt.simple,plot.mats=c(1,3,5),start.t=0,end.t=5,plot.MMrate=FALSE) # Shows how to change time period plotted, how to change the maturities plotted, and how to turn off plotting the money market rate h.mkt.updown <- genHistory.market( i.fxn=quote(1/(10*exp(t))*t^2+.02), start.t=0,end.t=5,f=.5 ) plot(h.mkt.updown) # Note that it automatically jitters the coordinates so they are visible # - Accounts - # # Creating accounts prts <- list(prt1,prt2,cash(name="cash1",value=300,mkt=mkt1)) acct1 <- account(prts=prts,hist.mkt=h.mkt.updown) acct2 <- account(prts=prts,hist.mkt=h.mkt.simple) # Looking at account acct1 cat("Observe that the value invested doesn't equal the sum of the par values of the bonds plus the cash holdings!\n") cat("What happened? Recall that bnd.C we created somewhat nonsensibly with a different prevailing interest rate.\n") cat("Therefore, although its par is $1000, its coupon is higher, and it immediately became worth more.\n") cat("pv() will calculate the present value of a particular object, such as our bond: $",pv(bnd.C,mkt=mkt1),"\n") cat("It works for other objects too. Here's the present value of prt1: $",pv(prt1,mkt=mkt1),"\n") # Seeing what happens in the future summary(acct1,t=5,rebal.function.args=list(min.bond.size=1000,new.bond.dur=5,new.bond.mat=NA)) # this is using the default rebalance function ### More examples ### # Flat yield curve mkt1 <- market(market.bond(i=.05),t=0) mkt2 <- market(market.bond(i=.07),t=0) bonds.ladder <- list( bond(mkt=mkt1,mat=1), bond(mkt=mkt1,mat=2), bond(mkt=mkt1,mat=3), bond(mkt=mkt1,mat=4), bond(mkt=mkt1,mat=5), bond(mkt=mkt1,mat=6), bond(mkt=mkt1,mat=7), bond(mkt=mkt1,mat=8), bond(mkt=mkt1,mat=9), bond(mkt=mkt1,mat=10) ) prt.ladder <- portfolio(name="Ladder",bonds=bonds.ladder,mkt=mkt1) prt.bul <- portfolio(name="Bullet",bonds=list( bond(mkt=mkt1,mat=4), bond(mkt=mkt1,mat=4), bond(mkt=mkt1,mat=5), bond(mkt=mkt1,mat=5), bond(mkt=mkt1,mat=6), bond(mkt=mkt1,mat=6), bond(mkt=mkt1,mat=7), bond(mkt=mkt1,mat=7), bond(mkt=mkt1,mat=4), bond(mkt=mkt1,mat=5) ),mkt=mkt1) prt.ladder prt.bul summary(prt.ladder) summary(prt.bul) cat("After changing interest rates from 5% to 7%:\n") summary(prt.ladder,mkt=mkt2) summary(prt.bul,mkt=mkt2) # Sharply upward-sloping yield curve (MMrate=.026, 1-year 5%, 5-year 9.5%, 10-year 12%, 20-year 15%) mkt.bond.up <- market.bond(yield.curve=quote(log(mat+1.7)/20)) ##mkt.bond.up <- market.bond(i=.05) mkt.up0 <- market(mkt.bond.up,t=0) prt.ladder <- portfolio(name="Ladder",bonds=list( bond(mkt=mkt.up0,mat=1), bond(mkt=mkt.up0,mat=2), bond(mkt=mkt.up0,mat=3), bond(mkt=mkt.up0,mat=4), bond(mkt=mkt.up0,mat=5), bond(mkt=mkt.up0,mat=6), bond(mkt=mkt.up0,mat=7), bond(mkt=mkt.up0,mat=8), bond(mkt=mkt.up0,mat=9), bond(mkt=mkt.up0,mat=10) ),mkt=mkt.up0) prt.bul <- portfolio(name="Bullet",bonds=list( bond(mkt=mkt.up0,mat=4), bond(mkt=mkt.up0,mat=4), bond(mkt=mkt.up0,mat=5), bond(mkt=mkt.up0,mat=5), bond(mkt=mkt.up0,mat=6), bond(mkt=mkt.up0,mat=6), bond(mkt=mkt.up0,mat=5), bond(mkt=mkt.up0,mat=5), bond(mkt=mkt.up0,mat=4), bond(mkt=mkt.up0,mat=5) ),mkt=mkt.up0) mkt.up.hist <- history.market(list( market(mkt.bond.up,t=0), market(mkt.bond.up,t=40) )) #plot(mkt.up.hist,end.t=50) acct.ladder <- account(prts=list(prt.ladder),hist.mkt=mkt.up.hist) acct.bul <- account(prts=list(prt.bul),hist.mkt=mkt.up.hist) #sum.ladder <- summary(acct.ladder,t=20,rebal.function.args=list(min.bond.size=1000,new.bond.mat=10,new.bond.dur=NA,sell.mat=NA)) sum.bul <- summary(acct.bul,t=20,rebal.function.args=list(min.bond.size=1000,new.bond.mat=NA,new.bond.dur=3.8,sell.mat=0)) #plot(sum.ladder,main="Ladder") plot(sum.bul,main="Bullet", which="pv") plot(sum.bul,main="Bullet", which="duration") plot(sum.bul,main="Bullet", which=c("pv","duration")) ## Still another example: Portfolio values under rising interest rates # Generate a market history with rising interest rate (10 percentage point total gain over 20 years), starting at a low value, with parallel yield curve shifts # Yield curve from 7/1/13, fit with lognormal regression with no intercept mkt3070113list <- lapply( seq(0,19), function(t) { market(market.bond( yield.curve=eval(substitute(quote(.005*t + log(mat)*1.005 / 100),list(t=t))), MMrate=.0001+0.005*t ),t=t) } ) h.mkt.risingParallelYC <- history.market(mkt3070113list) plot(h.mkt.risingParallelYC) prt.ladder <- portfolio(bonds=bonds.ladder,mkt=mkt3070113list[[1]]) dur.ladder <- duration(prt.ladder,mkt=mkt3070113list[[1]]) acct.ladder <- account( list( prt.ladder, cash(name="cash1",value=0,mkt=mkt3070113list[[1]]) ), hist.mkt=h.mkt.risingParallelYC ) sum.acct.risingParallelYC <- summary(acct.ladder,t=20,rebal.function.args=list(min.bond.size=1000,new.bond.mat=NA,new.bond.dur=dur.ladder,sell.mat=0)) # With falling interest rate mkt3070113listRev <- lapply( seq(0,19), function(t) { market(market.bond( yield.curve=eval(substitute(quote(.005*(19-t) + log(mat)*1.005 / 100),list(t=t))), MMrate=.0001+0.005*(19-t) ),t=t) } ) h.mkt.fallingParallelYC <- history.market(mkt3070113listRev) plot(h.mkt.fallingParallelYC) prt.ladder <- portfolio(bonds=bonds.ladder,mkt=mkt3070113listRev[[1]]) dur.ladder <- duration(prt.ladder,mkt=mkt3070113listRev[[1]]) acct.ladder <- account( list( prt.ladder, cash(name="cash1",value=0,mkt=mkt3070113listRev[[1]]) ), hist.mkt=h.mkt.fallingParallelYC ) sum.acct.fallingParallelYC <- summary(acct.ladder,t=1,rebal.function.args=list(min.bond.size=1000,new.bond.mat=NA,new.bond.dur=dur.ladder,sell.mat=0)) sum.acct.fallingParallelYC
/demo/demo_bond.R
no_license
arturochian/maRketSim
R
false
false
8,128
r
# Demonstration of maRketSim capabilities on the bond side # - Simple bonds - # mkt1 <- market(market.bond(i=.05),t=0) # All that is required to specify a bond market is an interest rate mkt1C <- market(market.bond(i=.1),t=0) bnd.A <- bond(mkt=mkt1,mat=5) # Bonds can be specified by maturity bnd.B <- bond(mkt=mkt1,dur=2.5) # or duration, in which case the maturity under prevailing interest rates is calculated bnd.C <- bond(mkt=mkt1C,mat=15) bnd.A # You can display the basic characteristics of a bond summary(bnd.A,mkt1) # Or more sophisticated information like duration and convexity # - Bonds in time and yield curves - # mkt2 <- market(market.bond(yield.curve=quote(0.01 + log10( mat + 1 )/ 20),MMrate=.01),t=2) #yield curve must be in format specified here. t=2 implies this is a rate change in the future mkt1B <- market(market.bond(yield.curve=quote(0.01 + log10( mat + 1 )/ 20),MMrate=.01),t=0) # we'll need this guy later to demonstrate automatic portfolio generation sum.bnd.A <- summary(bnd.A,mkt2) # Now we're evaluating the same bond two years later, with the intervening coupon payments disappearing into the ether (accounts will address that) str(sum.bnd.A) # The summary object has structure with useful quantities to be extracted # Example of extracting duration durs <- c() ts <- seq(0,15,.5) for(t in ts) { d <- summary(bnd.C,market(market.bond(i=.1),t=t))$dur durs <- c(durs,d) } plot(durs~ts,main="Duration vs. the passage of time",xlab="Time",ylab="Duration") # - Portfolios of bonds - # prt1 <- portfolio(name="bond1",bonds=list(bnd.A,bnd.B,bnd.C),mkt=mkt1) prt1 # Display the bonds in the portfolio summary(prt1) # Display the portfolio's characteristics under its original market conditions summary(prt1,mkt=mkt2) # Display the portfolio's characteristics under new market conditions as.data.frame(prt1) #Another way of looking at the portfolio. Useful for exporting to user-written functions or spreadsheets. # Create random portfolios of bonds with certain portfolio characteristics prt2 <- genPortfolio.bond(10,mkt=mkt1B,dur=5,dur.sd=2,name="bond2",type="random.constrained") prt2 summary(prt2) cat("Duration of our generated portfolio is",round(abs(5-summary(prt2)$portfolio.sum$dur),2),"away from 5.\n") # - Market histories - # mkt3 <- market(market.bond(yield.curve=quote(mat/75+0.02),MMrate=.02),t=3) h.mkt.simple <- history.market(list(mkt1,mkt2,mkt3)) plot(h.mkt.simple) # Shows how yield curves are handled plot(h.mkt.simple,plot.mats=c(1,3,5),start.t=0,end.t=5,plot.MMrate=FALSE) # Shows how to change time period plotted, how to change the maturities plotted, and how to turn off plotting the money market rate h.mkt.updown <- genHistory.market( i.fxn=quote(1/(10*exp(t))*t^2+.02), start.t=0,end.t=5,f=.5 ) plot(h.mkt.updown) # Note that it automatically jitters the coordinates so they are visible # - Accounts - # # Creating accounts prts <- list(prt1,prt2,cash(name="cash1",value=300,mkt=mkt1)) acct1 <- account(prts=prts,hist.mkt=h.mkt.updown) acct2 <- account(prts=prts,hist.mkt=h.mkt.simple) # Looking at account acct1 cat("Observe that the value invested doesn't equal the sum of the par values of the bonds plus the cash holdings!\n") cat("What happened? Recall that bnd.C we created somewhat nonsensibly with a different prevailing interest rate.\n") cat("Therefore, although its par is $1000, its coupon is higher, and it immediately became worth more.\n") cat("pv() will calculate the present value of a particular object, such as our bond: $",pv(bnd.C,mkt=mkt1),"\n") cat("It works for other objects too. Here's the present value of prt1: $",pv(prt1,mkt=mkt1),"\n") # Seeing what happens in the future summary(acct1,t=5,rebal.function.args=list(min.bond.size=1000,new.bond.dur=5,new.bond.mat=NA)) # this is using the default rebalance function ### More examples ### # Flat yield curve mkt1 <- market(market.bond(i=.05),t=0) mkt2 <- market(market.bond(i=.07),t=0) bonds.ladder <- list( bond(mkt=mkt1,mat=1), bond(mkt=mkt1,mat=2), bond(mkt=mkt1,mat=3), bond(mkt=mkt1,mat=4), bond(mkt=mkt1,mat=5), bond(mkt=mkt1,mat=6), bond(mkt=mkt1,mat=7), bond(mkt=mkt1,mat=8), bond(mkt=mkt1,mat=9), bond(mkt=mkt1,mat=10) ) prt.ladder <- portfolio(name="Ladder",bonds=bonds.ladder,mkt=mkt1) prt.bul <- portfolio(name="Bullet",bonds=list( bond(mkt=mkt1,mat=4), bond(mkt=mkt1,mat=4), bond(mkt=mkt1,mat=5), bond(mkt=mkt1,mat=5), bond(mkt=mkt1,mat=6), bond(mkt=mkt1,mat=6), bond(mkt=mkt1,mat=7), bond(mkt=mkt1,mat=7), bond(mkt=mkt1,mat=4), bond(mkt=mkt1,mat=5) ),mkt=mkt1) prt.ladder prt.bul summary(prt.ladder) summary(prt.bul) cat("After changing interest rates from 5% to 7%:\n") summary(prt.ladder,mkt=mkt2) summary(prt.bul,mkt=mkt2) # Sharply upward-sloping yield curve (MMrate=.026, 1-year 5%, 5-year 9.5%, 10-year 12%, 20-year 15%) mkt.bond.up <- market.bond(yield.curve=quote(log(mat+1.7)/20)) ##mkt.bond.up <- market.bond(i=.05) mkt.up0 <- market(mkt.bond.up,t=0) prt.ladder <- portfolio(name="Ladder",bonds=list( bond(mkt=mkt.up0,mat=1), bond(mkt=mkt.up0,mat=2), bond(mkt=mkt.up0,mat=3), bond(mkt=mkt.up0,mat=4), bond(mkt=mkt.up0,mat=5), bond(mkt=mkt.up0,mat=6), bond(mkt=mkt.up0,mat=7), bond(mkt=mkt.up0,mat=8), bond(mkt=mkt.up0,mat=9), bond(mkt=mkt.up0,mat=10) ),mkt=mkt.up0) prt.bul <- portfolio(name="Bullet",bonds=list( bond(mkt=mkt.up0,mat=4), bond(mkt=mkt.up0,mat=4), bond(mkt=mkt.up0,mat=5), bond(mkt=mkt.up0,mat=5), bond(mkt=mkt.up0,mat=6), bond(mkt=mkt.up0,mat=6), bond(mkt=mkt.up0,mat=5), bond(mkt=mkt.up0,mat=5), bond(mkt=mkt.up0,mat=4), bond(mkt=mkt.up0,mat=5) ),mkt=mkt.up0) mkt.up.hist <- history.market(list( market(mkt.bond.up,t=0), market(mkt.bond.up,t=40) )) #plot(mkt.up.hist,end.t=50) acct.ladder <- account(prts=list(prt.ladder),hist.mkt=mkt.up.hist) acct.bul <- account(prts=list(prt.bul),hist.mkt=mkt.up.hist) #sum.ladder <- summary(acct.ladder,t=20,rebal.function.args=list(min.bond.size=1000,new.bond.mat=10,new.bond.dur=NA,sell.mat=NA)) sum.bul <- summary(acct.bul,t=20,rebal.function.args=list(min.bond.size=1000,new.bond.mat=NA,new.bond.dur=3.8,sell.mat=0)) #plot(sum.ladder,main="Ladder") plot(sum.bul,main="Bullet", which="pv") plot(sum.bul,main="Bullet", which="duration") plot(sum.bul,main="Bullet", which=c("pv","duration")) ## Still another example: Portfolio values under rising interest rates # Generate a market history with rising interest rate (10 percentage point total gain over 20 years), starting at a low value, with parallel yield curve shifts # Yield curve from 7/1/13, fit with lognormal regression with no intercept mkt3070113list <- lapply( seq(0,19), function(t) { market(market.bond( yield.curve=eval(substitute(quote(.005*t + log(mat)*1.005 / 100),list(t=t))), MMrate=.0001+0.005*t ),t=t) } ) h.mkt.risingParallelYC <- history.market(mkt3070113list) plot(h.mkt.risingParallelYC) prt.ladder <- portfolio(bonds=bonds.ladder,mkt=mkt3070113list[[1]]) dur.ladder <- duration(prt.ladder,mkt=mkt3070113list[[1]]) acct.ladder <- account( list( prt.ladder, cash(name="cash1",value=0,mkt=mkt3070113list[[1]]) ), hist.mkt=h.mkt.risingParallelYC ) sum.acct.risingParallelYC <- summary(acct.ladder,t=20,rebal.function.args=list(min.bond.size=1000,new.bond.mat=NA,new.bond.dur=dur.ladder,sell.mat=0)) # With falling interest rate mkt3070113listRev <- lapply( seq(0,19), function(t) { market(market.bond( yield.curve=eval(substitute(quote(.005*(19-t) + log(mat)*1.005 / 100),list(t=t))), MMrate=.0001+0.005*(19-t) ),t=t) } ) h.mkt.fallingParallelYC <- history.market(mkt3070113listRev) plot(h.mkt.fallingParallelYC) prt.ladder <- portfolio(bonds=bonds.ladder,mkt=mkt3070113listRev[[1]]) dur.ladder <- duration(prt.ladder,mkt=mkt3070113listRev[[1]]) acct.ladder <- account( list( prt.ladder, cash(name="cash1",value=0,mkt=mkt3070113listRev[[1]]) ), hist.mkt=h.mkt.fallingParallelYC ) sum.acct.fallingParallelYC <- summary(acct.ladder,t=1,rebal.function.args=list(min.bond.size=1000,new.bond.mat=NA,new.bond.dur=dur.ladder,sell.mat=0)) sum.acct.fallingParallelYC
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/covariance.R \name{getCormatFirstOrder} \alias{getCormatFirstOrder} \title{get rho matrix first order} \usage{ getCormatFirstOrder(rho, time.step = as.difftime(1, units = "hours"), max.tao = as.difftime(1, units = "days")) } \arguments{ \item{rho}{the covariance asdefined as difference between the times divided by the time step} \item{time.step}{default is 1 hour} \item{max.tao}{don't consider covariance for values further apart then this.} } \value{ covariance defined as difference between the times divided by the time step don't calculate covariance for values further away then max.tao. } \description{ get rho matrix first order }
/man/getCormatFirstOrder.Rd
no_license
jordansread/loadflex
R
false
true
734
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/covariance.R \name{getCormatFirstOrder} \alias{getCormatFirstOrder} \title{get rho matrix first order} \usage{ getCormatFirstOrder(rho, time.step = as.difftime(1, units = "hours"), max.tao = as.difftime(1, units = "days")) } \arguments{ \item{rho}{the covariance asdefined as difference between the times divided by the time step} \item{time.step}{default is 1 hour} \item{max.tao}{don't consider covariance for values further apart then this.} } \value{ covariance defined as difference between the times divided by the time step don't calculate covariance for values further away then max.tao. } \description{ get rho matrix first order }
plot4 <- function() { ## Project 1 Exploratory Data Analysis ## Use strptime() and as.Date() to convert the text entries ## to date data types ## Note that in this dataset missing values are coded as ?. library(lubridate) library(dplyr) ## Reads whole UC Irvine householdx power data set in & ## reeadies data for plotting dataPlotTotal <- data.frame() dataPlotTarget <- data.frame() dataSubs <- vector() ## Read file fileUrl <- "./household_power_consumption.txt" dateDownloaded <- "2015-06-06" list.files() ## Read data into table; colClasses = char to suppress conversions dataPlotTotal <- read.table(fileUrl, header=TRUE, sep=";", na.strings="?", colClasses = "character") ## Remove incomplete data dataPlotTotal <- dataPlotTotal[complete.cases(dataPlotTotal), ] ## Subset data to just the dates requested in Project 1: 2/01-2/02/2007 dataPlotTarget <- dataPlotTotal[((dataPlotTotal$Date == "1/2/2007") | (dataPlotTotal$Date == "2/2/2007")), ] ## Merge Date & Time variables into Date dataPlotTarget <- mutate(dataPlotTarget, Date = paste(Date, Time, sep=' ')) ## Convert Date from text to date type dataPlotTarget$Date <- strptime(dataPlotTarget$Date, format="%d/%m/%Y %H:%M:%S", tz="America/Los_Angeles") ## Remove unneeded Time variable dataPlotTarget <- dataPlotTarget[ , c(1, 3:9)] date <- dataPlotTarget$Date weekday <- wday(date, label=TRUE, abbr=TRUE) lineColors <- c("black", "red", "blue") plotLayout <- c(2,2) innerMargins <- c(5,4,2,2) outerMargins <- c(2,2,2,2) ## open connection to png file device png(filename="./plot4.png", width=480, height=480, units="px") par(mfcol=plotLayout, mar=innerMargins, oma=outerMargins) ## First plot in layout - same as Prog Assignment 1 - Plot 2 with(dataPlotTarget, plot(date, Global_active_power, type="l", xlab="", ylab="Global Active Power")) ## Second plot in layout - same as Prog Assignment 1 - Plot 3 with(dataPlotTarget, plot(date, Sub_metering_1, type="n", xlab="", ylab="Energy sub metering")) with(subset(dataPlotTarget, dataPlotTarget$Sub_metering_1>0), points(date, Sub_metering_1, col="black", type="l")) with(subset(dataPlotTarget, dataPlotTarget$Sub_metering_2>0), points(date, Sub_metering_2, col="red", type="l")) with(subset(dataPlotTarget, dataPlotTarget$Sub_metering_3>0), points(date, Sub_metering_3, col="blue", type="l")) legend("topright", col=lineColors, lty=1, bty="n", cex=0.70, legend=c("Sub_metering_1", "Sub_metering_2", "Sub_metering_3")) ## Third plot in layout with(dataPlotTarget, plot(date, Voltage, type="l", xlab="date/time")) ## Fourth plot in layout with(dataPlotTarget, plot(date, Global_reactive_power, type="l", xlab="date/time")) ## close connection to png file device dev.off() ## print(head(dataPlotTarget[1:4], n=5)) ## test ## print(tail(dataPlotTarget[1:4], n=5)) ## test return("done plot4") }
/plot4.R
no_license
wiju/ExData_Plotting1
R
false
false
3,487
r
plot4 <- function() { ## Project 1 Exploratory Data Analysis ## Use strptime() and as.Date() to convert the text entries ## to date data types ## Note that in this dataset missing values are coded as ?. library(lubridate) library(dplyr) ## Reads whole UC Irvine householdx power data set in & ## reeadies data for plotting dataPlotTotal <- data.frame() dataPlotTarget <- data.frame() dataSubs <- vector() ## Read file fileUrl <- "./household_power_consumption.txt" dateDownloaded <- "2015-06-06" list.files() ## Read data into table; colClasses = char to suppress conversions dataPlotTotal <- read.table(fileUrl, header=TRUE, sep=";", na.strings="?", colClasses = "character") ## Remove incomplete data dataPlotTotal <- dataPlotTotal[complete.cases(dataPlotTotal), ] ## Subset data to just the dates requested in Project 1: 2/01-2/02/2007 dataPlotTarget <- dataPlotTotal[((dataPlotTotal$Date == "1/2/2007") | (dataPlotTotal$Date == "2/2/2007")), ] ## Merge Date & Time variables into Date dataPlotTarget <- mutate(dataPlotTarget, Date = paste(Date, Time, sep=' ')) ## Convert Date from text to date type dataPlotTarget$Date <- strptime(dataPlotTarget$Date, format="%d/%m/%Y %H:%M:%S", tz="America/Los_Angeles") ## Remove unneeded Time variable dataPlotTarget <- dataPlotTarget[ , c(1, 3:9)] date <- dataPlotTarget$Date weekday <- wday(date, label=TRUE, abbr=TRUE) lineColors <- c("black", "red", "blue") plotLayout <- c(2,2) innerMargins <- c(5,4,2,2) outerMargins <- c(2,2,2,2) ## open connection to png file device png(filename="./plot4.png", width=480, height=480, units="px") par(mfcol=plotLayout, mar=innerMargins, oma=outerMargins) ## First plot in layout - same as Prog Assignment 1 - Plot 2 with(dataPlotTarget, plot(date, Global_active_power, type="l", xlab="", ylab="Global Active Power")) ## Second plot in layout - same as Prog Assignment 1 - Plot 3 with(dataPlotTarget, plot(date, Sub_metering_1, type="n", xlab="", ylab="Energy sub metering")) with(subset(dataPlotTarget, dataPlotTarget$Sub_metering_1>0), points(date, Sub_metering_1, col="black", type="l")) with(subset(dataPlotTarget, dataPlotTarget$Sub_metering_2>0), points(date, Sub_metering_2, col="red", type="l")) with(subset(dataPlotTarget, dataPlotTarget$Sub_metering_3>0), points(date, Sub_metering_3, col="blue", type="l")) legend("topright", col=lineColors, lty=1, bty="n", cex=0.70, legend=c("Sub_metering_1", "Sub_metering_2", "Sub_metering_3")) ## Third plot in layout with(dataPlotTarget, plot(date, Voltage, type="l", xlab="date/time")) ## Fourth plot in layout with(dataPlotTarget, plot(date, Global_reactive_power, type="l", xlab="date/time")) ## close connection to png file device dev.off() ## print(head(dataPlotTarget[1:4], n=5)) ## test ## print(tail(dataPlotTarget[1:4], n=5)) ## test return("done plot4") }
t=0:10 z= t*t plot(t,z)
/19_n^2.r
no_license
maxangelo987/CCS614-PL-MSCS2-19-20
R
false
false
24
r
t=0:10 z= t*t plot(t,z)
cat("==========================================\n") cat(" SUMA DE NÚMEROS \n") cat("==========================================\n\n") cat("¿Cuántos números va a ingresar?\n") n <- scan("stdin", n = 1, quiet = TRUE) cat("\nIngrese los números, presionando Enter luego de cada uno:\n") v <- scan("stdin", n = n, quiet = TRUE) suma <- 0 for (i in 1:length(v)) { suma <- suma + v[i] } cat("\nLa suma de los números es:", suma, "\n")
/archivos/suma.R
no_license
mpru/introprog
R
false
false
460
r
cat("==========================================\n") cat(" SUMA DE NÚMEROS \n") cat("==========================================\n\n") cat("¿Cuántos números va a ingresar?\n") n <- scan("stdin", n = 1, quiet = TRUE) cat("\nIngrese los números, presionando Enter luego de cada uno:\n") v <- scan("stdin", n = n, quiet = TRUE) suma <- 0 for (i in 1:length(v)) { suma <- suma + v[i] } cat("\nLa suma de los números es:", suma, "\n")
#' @title Function for DIb #' @description The function computes the binomial dispersion index for a given number of trials \eqn{N\in \{1,2,\ldots\}}. #' @param X A count random variable #' @param N The number of trials of binomial distribution #' @details #' \code{dib.fun} computes the dispersion index with respect to the binomial distribution. See Touré et al. (2020) and Weiss (2018) for more details. #' @importFrom stats var #' @return Returns #' \item{dib}{The binomial dispersion index} #' @author #' Aboubacar Y. Touré and Célestin C. Kokonendji #' @references #' Touré, A.Y., Dossou-Gbété, S. and Kokonendji, C.C. (2020). Asymptotic normality of the test statistics for relative dispersion and relative variation indexes, \emph{Journal of Applied Statistics} \bold{47}, 2479-2491.\cr #' \cr #' Weiss, C.H. (2018). An Introduction to Discrete-Valued Times Series. \emph{Wiley}, Hoboken NJ. #' @export dib.fun #' #' @examples #' X<-c(12,9,0,8,5,7,6,5,3,4,9,4) #' dib.fun(X,12) #' Y<-c(0,0,1,1,0,1,1) #' dib.fun(Y,7) dib.fun<-function(X,N){ data.frame(dib=var(X)/(mean(X)*(1-mean(X)/N))) }
/R/diB.R
no_license
cran/GWI
R
false
false
1,133
r
#' @title Function for DIb #' @description The function computes the binomial dispersion index for a given number of trials \eqn{N\in \{1,2,\ldots\}}. #' @param X A count random variable #' @param N The number of trials of binomial distribution #' @details #' \code{dib.fun} computes the dispersion index with respect to the binomial distribution. See Touré et al. (2020) and Weiss (2018) for more details. #' @importFrom stats var #' @return Returns #' \item{dib}{The binomial dispersion index} #' @author #' Aboubacar Y. Touré and Célestin C. Kokonendji #' @references #' Touré, A.Y., Dossou-Gbété, S. and Kokonendji, C.C. (2020). Asymptotic normality of the test statistics for relative dispersion and relative variation indexes, \emph{Journal of Applied Statistics} \bold{47}, 2479-2491.\cr #' \cr #' Weiss, C.H. (2018). An Introduction to Discrete-Valued Times Series. \emph{Wiley}, Hoboken NJ. #' @export dib.fun #' #' @examples #' X<-c(12,9,0,8,5,7,6,5,3,4,9,4) #' dib.fun(X,12) #' Y<-c(0,0,1,1,0,1,1) #' dib.fun(Y,7) dib.fun<-function(X,N){ data.frame(dib=var(X)/(mean(X)*(1-mean(X)/N))) }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/pred.acc.R \name{pred.acc} \alias{pred.acc} \title{Predictive error and accuracy measures for predictive models based on cross-validation} \usage{ pred.acc(obs, pred) } \arguments{ \item{obs}{a vector of observation values of validation samples.} \item{pred}{a vector of prediction values of predictive models for validation samples.} } \value{ A list with the following components: me, rme, mae, rmae, mse, rmse, rrmse, vecv and e1 for numerical data; ccr, kappa, sens, spec and tss for categorical data with two levels; and ccr, kappa for categorical data with more than two levels. } \description{ This function is used to calculate the mean error (me), mean absolute error (mae), mean squared error (mse), relative me (rme), relative mae (rmae), root mse (rmse), relative rmse (rrmse), variance explained by predictive models based on cross-validation (vecv), and Legates and McCabe's E1 (e1) for numerical data; and it also calculates correct classification rate (ccr), kappa (kappa), sensitivity (sens), specificity (spec), and true skill statistic (tss) for categorical data with the observed (obs) data specified as factor. They are based on the differences between the predicted values for and the observed values of validation samples for cross-validation. For 0 and 1 data, the observed values need to be specified as factor in order to use accuracy measures for categorical data. Moreover, sens, spec, tss and rmse are for categorical data with two levels (e.g. presence and absence data). } \examples{ set.seed(1234) x <- sample(1:30, 30) e <- rnorm(30, 1) y <- x + e pred.acc(x, y) y <- 0.8 * x + e pred.acc(x, y) } \references{ Li, J., 2016. Assessing spatial predictive models in the environmental sciences: accuracy measures, data variation and variance explained. Environmental Modelling & Software 80 1-8. Li, J., 2017. Assessing the accuracy of predictive models for numerical data: Not r nor r2, why not? Then what? PLOS ONE 12 (8): e0183250. Allouche, O., Tsoar, A., Kadmon, R., 2006. Assessing the accuracy of species distribution models: prevalence, kappa and true skill statistic (TSS). Journal of Applied Ecology 43 1223-1232. } \author{ Jin Li }
/man/pred.acc.Rd
no_license
cran/spm
R
false
true
2,311
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/pred.acc.R \name{pred.acc} \alias{pred.acc} \title{Predictive error and accuracy measures for predictive models based on cross-validation} \usage{ pred.acc(obs, pred) } \arguments{ \item{obs}{a vector of observation values of validation samples.} \item{pred}{a vector of prediction values of predictive models for validation samples.} } \value{ A list with the following components: me, rme, mae, rmae, mse, rmse, rrmse, vecv and e1 for numerical data; ccr, kappa, sens, spec and tss for categorical data with two levels; and ccr, kappa for categorical data with more than two levels. } \description{ This function is used to calculate the mean error (me), mean absolute error (mae), mean squared error (mse), relative me (rme), relative mae (rmae), root mse (rmse), relative rmse (rrmse), variance explained by predictive models based on cross-validation (vecv), and Legates and McCabe's E1 (e1) for numerical data; and it also calculates correct classification rate (ccr), kappa (kappa), sensitivity (sens), specificity (spec), and true skill statistic (tss) for categorical data with the observed (obs) data specified as factor. They are based on the differences between the predicted values for and the observed values of validation samples for cross-validation. For 0 and 1 data, the observed values need to be specified as factor in order to use accuracy measures for categorical data. Moreover, sens, spec, tss and rmse are for categorical data with two levels (e.g. presence and absence data). } \examples{ set.seed(1234) x <- sample(1:30, 30) e <- rnorm(30, 1) y <- x + e pred.acc(x, y) y <- 0.8 * x + e pred.acc(x, y) } \references{ Li, J., 2016. Assessing spatial predictive models in the environmental sciences: accuracy measures, data variation and variance explained. Environmental Modelling & Software 80 1-8. Li, J., 2017. Assessing the accuracy of predictive models for numerical data: Not r nor r2, why not? Then what? PLOS ONE 12 (8): e0183250. Allouche, O., Tsoar, A., Kadmon, R., 2006. Assessing the accuracy of species distribution models: prevalence, kappa and true skill statistic (TSS). Journal of Applied Ecology 43 1223-1232. } \author{ Jin Li }
## This file will read in each of the source corpus files ## and then split them into Training and Test datasets ## as well as making some smaller sets for development. ## ## intermediate datasets will be saved into ./datawork ## ## files will be named source-group.txt ## where source is the tag for the source file - blog, news, twit ## and group is the subset of the original data ## train100 - 100% of training portion - 70% of original ## train50 - 50% of training portion ## train10 - 10% of training portion ## train1 - 1% of training portion ## test1 - 50% of test portion - 30% of original ## test2 - other 50% of test portion ## # set up vectors for data loading tag <- c("news", "blog", "twit") path <- "./Coursera-SwiftKey/final/en_US/" file <- c("en_US.news.txt", "en_US.blogs.txt", "en_US.twitter.txt") # load the files for (i in 1:length(file)){ assign(paste(tag[i]), readLines(con=paste(path,file[i],sep=""), warn=FALSE, encoding='UTF-8' )) } # set up vectors for splitting and saving spath <- "./datawork" # set up function for making a vector with splits to the dataset splits <- function(n, blocks=c(train=0.70, test1=0.15, test2=0.15) ){ sp <- as.integer(n*blocks) err <- n - sum(sp) sp[1] <- sp[1] + err names(sp) <- names(blocks) sample(c(rep(names(sp),sp))) } # create split vector for each dataset news.s <- splits(length(news)) blog.s <- splits(length(blog)) twit.s <- splits(length(twit)) bl <- c("train", "test1", "test2") # split and write for (i in 1:length(tag)){ for (j in 1:length(bl)){ fname <- paste(spath,"/",tag[i],"-",bl[j],".txt", sep="") dataf <- paste(tag[i],"[",tag[i],".s=='",bl[j],"']",sep="") datas <- eval(parse(text=dataf)) writeLines(datas, fname) close(file(fname)) } } # now create the training subsets for (i in 1:length(tag)){ assign(paste(tag[i],".train",sep=""), eval(parse(text=paste(tag[i],"[",tag[i],".s=='train']",sep=""))) ) } # set up the split block bl2 <- c(train50=0.5, train25=0.25, train10=0.10, train01=0.01, trainrest=0.14) bl2n <- names(bl2) # create the split vectors for each dataset for (i in 1:length(tag)){ expr <- paste(tag[i],".t <- splits(length(",tag[i],".train), bl2)", sep="") print(expr) eval(parse(text=expr)) } # split and write for (i in 1:length(tag)){ for (j in 1:length(bl2n)){ fname <- paste(spath,"/",tag[i],"-",bl2n[j],".txt", sep="") dataf <- paste(tag[i],".train[",tag[i],".t=='",bl2n[j],"']",sep="") datas <- eval(parse(text=dataf)) writeLines(datas, fname) close(file(fname)) } }
/3-SourceFileSplitting.R
no_license
MrCheerful/NLP-Project
R
false
false
2,757
r
## This file will read in each of the source corpus files ## and then split them into Training and Test datasets ## as well as making some smaller sets for development. ## ## intermediate datasets will be saved into ./datawork ## ## files will be named source-group.txt ## where source is the tag for the source file - blog, news, twit ## and group is the subset of the original data ## train100 - 100% of training portion - 70% of original ## train50 - 50% of training portion ## train10 - 10% of training portion ## train1 - 1% of training portion ## test1 - 50% of test portion - 30% of original ## test2 - other 50% of test portion ## # set up vectors for data loading tag <- c("news", "blog", "twit") path <- "./Coursera-SwiftKey/final/en_US/" file <- c("en_US.news.txt", "en_US.blogs.txt", "en_US.twitter.txt") # load the files for (i in 1:length(file)){ assign(paste(tag[i]), readLines(con=paste(path,file[i],sep=""), warn=FALSE, encoding='UTF-8' )) } # set up vectors for splitting and saving spath <- "./datawork" # set up function for making a vector with splits to the dataset splits <- function(n, blocks=c(train=0.70, test1=0.15, test2=0.15) ){ sp <- as.integer(n*blocks) err <- n - sum(sp) sp[1] <- sp[1] + err names(sp) <- names(blocks) sample(c(rep(names(sp),sp))) } # create split vector for each dataset news.s <- splits(length(news)) blog.s <- splits(length(blog)) twit.s <- splits(length(twit)) bl <- c("train", "test1", "test2") # split and write for (i in 1:length(tag)){ for (j in 1:length(bl)){ fname <- paste(spath,"/",tag[i],"-",bl[j],".txt", sep="") dataf <- paste(tag[i],"[",tag[i],".s=='",bl[j],"']",sep="") datas <- eval(parse(text=dataf)) writeLines(datas, fname) close(file(fname)) } } # now create the training subsets for (i in 1:length(tag)){ assign(paste(tag[i],".train",sep=""), eval(parse(text=paste(tag[i],"[",tag[i],".s=='train']",sep=""))) ) } # set up the split block bl2 <- c(train50=0.5, train25=0.25, train10=0.10, train01=0.01, trainrest=0.14) bl2n <- names(bl2) # create the split vectors for each dataset for (i in 1:length(tag)){ expr <- paste(tag[i],".t <- splits(length(",tag[i],".train), bl2)", sep="") print(expr) eval(parse(text=expr)) } # split and write for (i in 1:length(tag)){ for (j in 1:length(bl2n)){ fname <- paste(spath,"/",tag[i],"-",bl2n[j],".txt", sep="") dataf <- paste(tag[i],".train[",tag[i],".t=='",bl2n[j],"']",sep="") datas <- eval(parse(text=dataf)) writeLines(datas, fname) close(file(fname)) } }
simulatorRRW1 = function(tree, rates, sigmas=c(0.1,0.1), cor=0, envVariables=list(), mostRecentSamplingDatum, ancestPosition, reciprocalRates=TRUE, n1=100, n2=0, showingPlots=FALSE, newPlot=TRUE, fixedNodes=c()) { rotation = function(pt1, pt2, angle) { s = sin(angle); c = cos(angle) x = pt2[1]-pt1[1]; y = pt2[2]-pt1[2] x_new = (x*c)-(y*s); y_new = (x*s)+(y*c) x_new = x_new+pt1[1]; y_new = y_new+pt1[2] return(c(x_new,y_new)) } nodesOnly = FALSE; pointCol = "red" colNames= c("node1","node2","length","startLat","startLon","endLat","endLon", "endNodeL","startNodeL","startYear","endYear","greatCircleDist_km") simulation = matrix(nrow=length(tree$edge.length), ncol=length(colNames)) colnames(simulation) = colNames # if (model == "fixed") phi_b = rep(1, length(tree$edge.length)) # if (model == "cauchy") phi_b = rgamma(length(tree$edge.length), shape=0.5, scale=0.5) # if (model == "gamma") phi_b = rgamma(length(tree$edge.length), shape=halfDF, scale=halfDF) # if (model == "logN") phi_b = rlnorm(length(tree$edge.length), meanlog=1, sdlog=sdLogN) # if (model == "cauchy") sd_BM = sqrt(tree$edge.length/phi_b) # corresponds to BEAST reciprocalRates="true" # if (model == "gamma") sd_BM = sqrt(tree$edge.length/phi_b) # corresponds to BEAST reciprocalRates="true" # if (model == "logN") sd_BM = sqrt(tree$edge.length*phi_b) # corresponds to BEAST reciprocalRates="false" phi_b = rates if (reciprocalRates == FALSE) sd_BM = sqrt(tree$edge.length*phi_b) if (reciprocalRates == TRUE) sd_BM = sqrt(tree$edge.length/phi_b) nd = node.depth(tree); nd_max = max(nd) t1 = rep(ancestPosition[2], length(tree$tip.label)+tree$Nnode) t2 = rep(ancestPosition[1], length(tree$tip.label)+tree$Nnode) if (showingPlots == TRUE) { if ((newPlot == TRUE)&(length(envVariables) > 0)) { plotRaster(rast=envVariables[[1]], cols="gray90", colNA="white", addBox=F) } points(cbind(ancestPosition[1],ancestPosition[2]), pch=16, col=pointCol, cex=0.5) } i = 0 while (i != (nd_max-1)) { i = i+1 my_nodes = which(nd==nd_max-i) if (length(my_nodes) > 0) { for (j in 1:length(my_nodes)) { my_node = my_nodes[j]; # print(c(i,my_nodes[j])) parent_branch = match(my_node, tree$edge[,2]) parent_node = tree$edge[parent_branch,1] simulatingNode = TRUE if (my_node%in%fixedNodes) { simulatingNode = FALSE index = which(tree$edge[,2] == my_node) new_t1 = tree$annotations[[index]]$location[[1]] new_t2 = tree$annotations[[index]]$location[[2]] } if (simulatingNode == TRUE) { onTheArea = FALSE sd_bm = sd_BM[parent_branch] increment1 = rnorm(1)*sd_bm increment2 = rnorm(1)*sd_bm increment2 = sigmas[2]*((cor*increment1)+(sqrt(1-cor^2)*increment2)) increment1 = sigmas[1]*increment1 new_t1 = t1[parent_node] + increment1 new_t2 = t2[parent_node] + increment2 if (length(envVariables) > 0) { onTheArea = TRUE for (k in 1:length(envVariables)) { if (is.na(raster::extract(envVariables[[k]],cbind(new_t2,new_t1)))) { onTheArea = FALSE } } } else { onTheArea = TRUE } if (onTheArea == FALSE) { c2 = 0; c1 = 0 pt1 = cbind(t2[parent_node],t1[parent_node]) pt2 = cbind(new_t2,new_t1) while (onTheArea == FALSE) { c2 = c2+1; # print(c(c2,c1)) if (n1 > 0) { angle = (2*pi)*runif(1) pt2_rotated = rotation(pt1, pt2, angle) onTheArea = TRUE for (k in 1:length(envVariables)) { if (is.na(raster::extract(envVariables[[k]],cbind(pt2_rotated[1],pt2_rotated[2])))) { onTheArea = FALSE } else { new_t1 = pt2_rotated[2] new_t2 = pt2_rotated[1] } } } if (c2 > n1) { c2 = 0; c1 = c1+1 if (c1 > n2) { onTheArea = TRUE; i = 0 } else { # print(paste0("...re-simulating a branch - node:", my_node)) increment1 = rnorm(1)*sd_bm increment2 = rnorm(1)*sd_bm increment2 = sigmas[2]*((cor*increment1)+(sqrt(1-cor^2)*increment2)) increment1 = sigmas[1]*increment1 new_t1 = t1[parent_node] + increment1 new_t2 = t2[parent_node] + increment2 onTheArea = TRUE for (k in 1:length(envVariables)) { if (is.na(raster::extract(envVariables[[k]],cbind(new_t2,new_t1)))) { onTheArea = FALSE } } } } } } } t1[my_node] = new_t1 t2[my_node] = new_t2 if (showingPlots == TRUE) { if (nodesOnly == FALSE) { segments(t2[parent_node], t1[parent_node], new_t2, new_t1, col=pointCol, lwd=0.2) points(cbind(new_t2,new_t1), pch=16, col=pointCol, cex=0.25) } else { points(cbind(new_t2,new_t1), pch=16, col=pointCol, cex=0.25) } } } if (i == 0) { cat(paste0("...re-starting the simulation\n")) t1 = rep(ancestPosition[2], length(tree$tip.label)+tree$Nnode) t2 = rep(ancestPosition[1], length(tree$tip.label)+tree$Nnode) if (showingPlots == TRUE) { plotRaster(rast=envVariables[[1]], cols="gray90", colNA="white", addBox=F, new=F) points(cbind(ancestPosition[1],ancestPosition[2]), pch=16, col=pointCol, cex=0.5) } } } } x = t2; y = t1 for (i in 1:dim(tree$edge)[1]) { node_i = tree$edge[i,1] node_f = tree$edge[i,2] simulation[i,"node1"] = node_i simulation[i,"node2"] = node_f simulation[i,"length"] = tree$edge.length[i] simulation[i,"startLat"] = y[node_i] simulation[i,"startLon"] = x[node_i] simulation[i,"endLat"] = y[node_f] simulation[i,"endLon"] = x[node_f] x1 = cbind(x[node_i],y[node_i]); x2 = cbind(x[node_f],y[node_f]) simulation[i,"greatCircleDist_km"] = rdist.earth(x1, x2, miles=FALSE, R=NULL) } l = length(simulation[,1]) ll = matrix(1:l,nrow=l,ncol=l); ll[] = 0 for (j in 1:l) { subMat = simulation[j,2] subMat = subset(simulation,simulation[,2]==subMat) ll[j,1] = subMat[,3] subMat = subMat[1,1] subMat1 = subset(simulation,simulation[,2]==subMat) for (k in 1:l) { if (nrow(subMat1) > 0) { ll[j,k+1] = subMat1[,3] subMat2 = subMat1[1,1] subMat1 = subset(simulation,simulation[,2]==subMat2) } } } endNodeL = rowSums(ll) # root to node distance for each node simulation[,"endNodeL"] = endNodeL startNodeL = matrix(1:l,nrow=l,ncol=1) startNodeL[] = 0 for (j in 1:l) { r = simulation[j,1] s = subset(simulation,simulation[,2]==r) for (k in 1:l) { if (nrow(s) > 0) { startNodeL[j,1] = s[,"endNodeL"] } } } simulation[,"startNodeL"] = startNodeL maxEndLIndice = which.max(simulation[,"endNodeL"]) maxEndL = simulation[maxEndLIndice,"endNodeL"] endYear = matrix(simulation[,"endNodeL"]-maxEndL) endYear = matrix(mostRecentSamplingDatum+(endYear[,1])) startYear = matrix(simulation[,"startNodeL"]-maxEndL) startYear = matrix(mostRecentSamplingDatum+(startYear[,1])) simulation[,c("startYear","endYear")] = cbind(startYear,endYear) if (showingPlots == TRUE) dev.off() return(simulation) }
/windows/R/simulatorRRW1.r
no_license
sdellicour/seraphim
R
false
false
7,914
r
simulatorRRW1 = function(tree, rates, sigmas=c(0.1,0.1), cor=0, envVariables=list(), mostRecentSamplingDatum, ancestPosition, reciprocalRates=TRUE, n1=100, n2=0, showingPlots=FALSE, newPlot=TRUE, fixedNodes=c()) { rotation = function(pt1, pt2, angle) { s = sin(angle); c = cos(angle) x = pt2[1]-pt1[1]; y = pt2[2]-pt1[2] x_new = (x*c)-(y*s); y_new = (x*s)+(y*c) x_new = x_new+pt1[1]; y_new = y_new+pt1[2] return(c(x_new,y_new)) } nodesOnly = FALSE; pointCol = "red" colNames= c("node1","node2","length","startLat","startLon","endLat","endLon", "endNodeL","startNodeL","startYear","endYear","greatCircleDist_km") simulation = matrix(nrow=length(tree$edge.length), ncol=length(colNames)) colnames(simulation) = colNames # if (model == "fixed") phi_b = rep(1, length(tree$edge.length)) # if (model == "cauchy") phi_b = rgamma(length(tree$edge.length), shape=0.5, scale=0.5) # if (model == "gamma") phi_b = rgamma(length(tree$edge.length), shape=halfDF, scale=halfDF) # if (model == "logN") phi_b = rlnorm(length(tree$edge.length), meanlog=1, sdlog=sdLogN) # if (model == "cauchy") sd_BM = sqrt(tree$edge.length/phi_b) # corresponds to BEAST reciprocalRates="true" # if (model == "gamma") sd_BM = sqrt(tree$edge.length/phi_b) # corresponds to BEAST reciprocalRates="true" # if (model == "logN") sd_BM = sqrt(tree$edge.length*phi_b) # corresponds to BEAST reciprocalRates="false" phi_b = rates if (reciprocalRates == FALSE) sd_BM = sqrt(tree$edge.length*phi_b) if (reciprocalRates == TRUE) sd_BM = sqrt(tree$edge.length/phi_b) nd = node.depth(tree); nd_max = max(nd) t1 = rep(ancestPosition[2], length(tree$tip.label)+tree$Nnode) t2 = rep(ancestPosition[1], length(tree$tip.label)+tree$Nnode) if (showingPlots == TRUE) { if ((newPlot == TRUE)&(length(envVariables) > 0)) { plotRaster(rast=envVariables[[1]], cols="gray90", colNA="white", addBox=F) } points(cbind(ancestPosition[1],ancestPosition[2]), pch=16, col=pointCol, cex=0.5) } i = 0 while (i != (nd_max-1)) { i = i+1 my_nodes = which(nd==nd_max-i) if (length(my_nodes) > 0) { for (j in 1:length(my_nodes)) { my_node = my_nodes[j]; # print(c(i,my_nodes[j])) parent_branch = match(my_node, tree$edge[,2]) parent_node = tree$edge[parent_branch,1] simulatingNode = TRUE if (my_node%in%fixedNodes) { simulatingNode = FALSE index = which(tree$edge[,2] == my_node) new_t1 = tree$annotations[[index]]$location[[1]] new_t2 = tree$annotations[[index]]$location[[2]] } if (simulatingNode == TRUE) { onTheArea = FALSE sd_bm = sd_BM[parent_branch] increment1 = rnorm(1)*sd_bm increment2 = rnorm(1)*sd_bm increment2 = sigmas[2]*((cor*increment1)+(sqrt(1-cor^2)*increment2)) increment1 = sigmas[1]*increment1 new_t1 = t1[parent_node] + increment1 new_t2 = t2[parent_node] + increment2 if (length(envVariables) > 0) { onTheArea = TRUE for (k in 1:length(envVariables)) { if (is.na(raster::extract(envVariables[[k]],cbind(new_t2,new_t1)))) { onTheArea = FALSE } } } else { onTheArea = TRUE } if (onTheArea == FALSE) { c2 = 0; c1 = 0 pt1 = cbind(t2[parent_node],t1[parent_node]) pt2 = cbind(new_t2,new_t1) while (onTheArea == FALSE) { c2 = c2+1; # print(c(c2,c1)) if (n1 > 0) { angle = (2*pi)*runif(1) pt2_rotated = rotation(pt1, pt2, angle) onTheArea = TRUE for (k in 1:length(envVariables)) { if (is.na(raster::extract(envVariables[[k]],cbind(pt2_rotated[1],pt2_rotated[2])))) { onTheArea = FALSE } else { new_t1 = pt2_rotated[2] new_t2 = pt2_rotated[1] } } } if (c2 > n1) { c2 = 0; c1 = c1+1 if (c1 > n2) { onTheArea = TRUE; i = 0 } else { # print(paste0("...re-simulating a branch - node:", my_node)) increment1 = rnorm(1)*sd_bm increment2 = rnorm(1)*sd_bm increment2 = sigmas[2]*((cor*increment1)+(sqrt(1-cor^2)*increment2)) increment1 = sigmas[1]*increment1 new_t1 = t1[parent_node] + increment1 new_t2 = t2[parent_node] + increment2 onTheArea = TRUE for (k in 1:length(envVariables)) { if (is.na(raster::extract(envVariables[[k]],cbind(new_t2,new_t1)))) { onTheArea = FALSE } } } } } } } t1[my_node] = new_t1 t2[my_node] = new_t2 if (showingPlots == TRUE) { if (nodesOnly == FALSE) { segments(t2[parent_node], t1[parent_node], new_t2, new_t1, col=pointCol, lwd=0.2) points(cbind(new_t2,new_t1), pch=16, col=pointCol, cex=0.25) } else { points(cbind(new_t2,new_t1), pch=16, col=pointCol, cex=0.25) } } } if (i == 0) { cat(paste0("...re-starting the simulation\n")) t1 = rep(ancestPosition[2], length(tree$tip.label)+tree$Nnode) t2 = rep(ancestPosition[1], length(tree$tip.label)+tree$Nnode) if (showingPlots == TRUE) { plotRaster(rast=envVariables[[1]], cols="gray90", colNA="white", addBox=F, new=F) points(cbind(ancestPosition[1],ancestPosition[2]), pch=16, col=pointCol, cex=0.5) } } } } x = t2; y = t1 for (i in 1:dim(tree$edge)[1]) { node_i = tree$edge[i,1] node_f = tree$edge[i,2] simulation[i,"node1"] = node_i simulation[i,"node2"] = node_f simulation[i,"length"] = tree$edge.length[i] simulation[i,"startLat"] = y[node_i] simulation[i,"startLon"] = x[node_i] simulation[i,"endLat"] = y[node_f] simulation[i,"endLon"] = x[node_f] x1 = cbind(x[node_i],y[node_i]); x2 = cbind(x[node_f],y[node_f]) simulation[i,"greatCircleDist_km"] = rdist.earth(x1, x2, miles=FALSE, R=NULL) } l = length(simulation[,1]) ll = matrix(1:l,nrow=l,ncol=l); ll[] = 0 for (j in 1:l) { subMat = simulation[j,2] subMat = subset(simulation,simulation[,2]==subMat) ll[j,1] = subMat[,3] subMat = subMat[1,1] subMat1 = subset(simulation,simulation[,2]==subMat) for (k in 1:l) { if (nrow(subMat1) > 0) { ll[j,k+1] = subMat1[,3] subMat2 = subMat1[1,1] subMat1 = subset(simulation,simulation[,2]==subMat2) } } } endNodeL = rowSums(ll) # root to node distance for each node simulation[,"endNodeL"] = endNodeL startNodeL = matrix(1:l,nrow=l,ncol=1) startNodeL[] = 0 for (j in 1:l) { r = simulation[j,1] s = subset(simulation,simulation[,2]==r) for (k in 1:l) { if (nrow(s) > 0) { startNodeL[j,1] = s[,"endNodeL"] } } } simulation[,"startNodeL"] = startNodeL maxEndLIndice = which.max(simulation[,"endNodeL"]) maxEndL = simulation[maxEndLIndice,"endNodeL"] endYear = matrix(simulation[,"endNodeL"]-maxEndL) endYear = matrix(mostRecentSamplingDatum+(endYear[,1])) startYear = matrix(simulation[,"startNodeL"]-maxEndL) startYear = matrix(mostRecentSamplingDatum+(startYear[,1])) simulation[,c("startYear","endYear")] = cbind(startYear,endYear) if (showingPlots == TRUE) dev.off() return(simulation) }
\name{DistanceMatrix} \alias{DistanceMatrix} \title{Pairwise distances between points in X and X.out} \usage{ DistanceMatrix(X, X.out = X) } \arguments{ \item{X}{A numeric matrix of input points.} \item{X.out}{A matrix of output points, whose distance to every point in 'X' is desired.} } \value{ A matrix whose [i, j] component gives the Euclidean distance from X.out[i, ] to X[j, ]. } \description{ Computes the distance from every point in X to every point in X.out. Both arguments are assumed to be numeric matrices with as many columns as the dimensionality of the space. (i.e., N 2D points would be represented by an (N x 2) matrix, etc.) Vector arguments are assumed to be 1D points, and are automatically converted to matrices. }
/man/DistanceMatrix.Rd
no_license
chiphogg/gppois
R
false
false
767
rd
\name{DistanceMatrix} \alias{DistanceMatrix} \title{Pairwise distances between points in X and X.out} \usage{ DistanceMatrix(X, X.out = X) } \arguments{ \item{X}{A numeric matrix of input points.} \item{X.out}{A matrix of output points, whose distance to every point in 'X' is desired.} } \value{ A matrix whose [i, j] component gives the Euclidean distance from X.out[i, ] to X[j, ]. } \description{ Computes the distance from every point in X to every point in X.out. Both arguments are assumed to be numeric matrices with as many columns as the dimensionality of the space. (i.e., N 2D points would be represented by an (N x 2) matrix, etc.) Vector arguments are assumed to be 1D points, and are automatically converted to matrices. }
library(tidyverse) download.file(url = "https://raw.githubusercontent.com/dmi3kno/SWC-tidyverse/master/data/gapminder_plus.csv", destfile = "Data/gapminder_plus.csv") #this containes the joint data of the files on fertility and mortality gapminder_plus <- read_csv(file = 'Data/gapminder_plus.csv') gapminder_plus %>% filter(continent=='Africa',year==2007) %>% mutate(babies_dead=infantMort*pop/10^3) %>% filter(babies_dead>2*10^6) %>% select(country) %>% left_join(gapminder_plus) %>% mutate(babies_dead=infantMort*pop/10^3,gdp_bln=gdpPercap/1e9,pop_mln=pop/1e6) %>% select(-c(continent,pop,babies_dead)) %>% gather(key=variable,value=values, -c(country,year)) %>% ggplot()+ #. plece the data dropped by the pipe in that position. In this case is superfluos since if absent it always drop it in the first position, that in this case is data geom_text(data=. %>% filter(year==2007) %>% group_by(variable) %>% mutate(max_value=max(values)) %>% filter(values==max_value),mapping=aes(x=year-10,y=values,color=country,label=country))+#the shift is for the sake of visualisation geom_line(mapping=aes(x=year,y=values,color=country))+ facet_wrap(~variable,scales = 'free_y')+ labs(title='adfd',subtitle='xc',caption='gdhs',y=NULL,x='Year')+ theme_bw()+ theme(legend.position = 'none')
/Scripts/ExerciseBeginningSecondDay.R
no_license
alecapg/R_tidyverse_Workshop_06_06_2017
R
false
false
1,373
r
library(tidyverse) download.file(url = "https://raw.githubusercontent.com/dmi3kno/SWC-tidyverse/master/data/gapminder_plus.csv", destfile = "Data/gapminder_plus.csv") #this containes the joint data of the files on fertility and mortality gapminder_plus <- read_csv(file = 'Data/gapminder_plus.csv') gapminder_plus %>% filter(continent=='Africa',year==2007) %>% mutate(babies_dead=infantMort*pop/10^3) %>% filter(babies_dead>2*10^6) %>% select(country) %>% left_join(gapminder_plus) %>% mutate(babies_dead=infantMort*pop/10^3,gdp_bln=gdpPercap/1e9,pop_mln=pop/1e6) %>% select(-c(continent,pop,babies_dead)) %>% gather(key=variable,value=values, -c(country,year)) %>% ggplot()+ #. plece the data dropped by the pipe in that position. In this case is superfluos since if absent it always drop it in the first position, that in this case is data geom_text(data=. %>% filter(year==2007) %>% group_by(variable) %>% mutate(max_value=max(values)) %>% filter(values==max_value),mapping=aes(x=year-10,y=values,color=country,label=country))+#the shift is for the sake of visualisation geom_line(mapping=aes(x=year,y=values,color=country))+ facet_wrap(~variable,scales = 'free_y')+ labs(title='adfd',subtitle='xc',caption='gdhs',y=NULL,x='Year')+ theme_bw()+ theme(legend.position = 'none')
library(shiny) library(dplyr) library(readr) library(ggplot2) library(ggvis) tradeA <- read_csv('tradeA.csv') tradeA$ID <- as.character(seq(1, length(tradeA$ccode))) tradeA$tau_imput <- as.factor(tradeA$tau_imput) # Country mapping C <- read_csv('IDE_ISIC.csv') c <- C %>% group_by(ccode, name) %>% summarise(n = n()) shinyServer(function(input, output) { trade_dat <- reactive({ t <- tradeA t <- filter(tradeA, inv_imp_pen_elast < input$maxxval) if (input$imp_comp == 'yes') { t <- filter(t, net_imp_tv > 0) } if (input$tar_type == 'MFN') { if (input$ntb == 'yes') { t$tauhat <- (t$tar_iwmfn + t$ave_core_wgt - 2) / (t$tar_iwmfn + t$ave_core_wgt - 1) } else { t$tauhat <- (t$tar_iwmfn - 1) / t$tar_iwmfn } } if (input$tar_type == 'Applied') { if (input$ntb == 'yes') { t$tauhat <- (t$tar_iwahs + t$ave_core_wgt - 2) / (t$tar_iwahs + t$ave_core_wgt - 1) } else { t$tauhat <- (t$tar_iwahs - 1) / t$tar_iwahs } } t$indicator <- as.factor(ifelse(t$ccode == input$country, 1, 0)) t$imput_col <- ifelse(t$tau_imput == 0, 'darkorange', 'red') t <- as.data.frame(t) t }) country <- reactive ({ }) trade_tooltip <- function(x) { if (is.null(x)) return(NULL) ttemp <- isolate(trade_dat()) obs <- ttemp[ttemp$ID == x$ID, ] paste0("<b>", obs$ccode, "</b>", ", ", obs$year, "<br>", obs$isicnames, "<br>", paste('alpha = ', round(obs$alpha,3), sep = "") ) } tradePlotA <- reactive({ tradeC <- filter(trade_dat, indicator == 1) tradeNC <- filter(trade_dat, indicator == 0) trade_dat %>% ggvis(x = ~inv_imp_pen_elast, y = ~tauhat) %>% layer_points(size = ~alpha, size.hover := 200, fillOpacity := 0.2, fillOpacity.hover := 0.5, stroke := 'steelblue', key := ~ID, data = tradeNC) %>% layer_points(size = ~alpha, size.hover := 200, fillOpacity := 0.2, fillOpacity.hover := 0.5, stroke := 'darkorange', key := ~ID, data = tradeC) %>% add_tooltip(trade_tooltip, "hover") %>% add_axis("x", title = 'Inverse Import Penetration * Inverse Elasticity') %>% add_axis("y", title = 'Magnitude of Tariff and Nontariff Barriers') }) output$plot1head <- renderText({'All Observations'}) tradePlotA %>% bind_shiny('all') tradePlotC <- reactive({ tradec <- filter(trade_dat, indicator == 1) tradec %>% ggvis(x = ~inv_imp_pen_elast, y = ~tauhat) %>% layer_points(size = ~alpha, size.hover := 500, fillOpacity := 0.2, fillOpacity.hover := 0.5, stroke := ~imput_col, key := ~ID) %>% layer_model_predictions(model = 'lm', formula = tauhat ~ inv_imp_pen - 1) %>% add_tooltip(trade_tooltip, "hover") %>% add_axis("x", title = 'Inverse Import Penetration * Inverse Elasticity') %>% add_axis("y", title = 'Magnitude of Tariff and Nontariff Barriers') %>% hide_legend('stroke') }) country <- reactive({ n <- filter(c, ccode == input$country) n$name }) output$plot2head <- renderText({country()}) tradePlotC %>% bind_shiny('n') }) ## next steps: # 1) allow for elasticity adjustment # 2) look at different combinations of tariff types
/server.R
no_license
brendancooley/tpp-explorer
R
false
false
3,418
r
library(shiny) library(dplyr) library(readr) library(ggplot2) library(ggvis) tradeA <- read_csv('tradeA.csv') tradeA$ID <- as.character(seq(1, length(tradeA$ccode))) tradeA$tau_imput <- as.factor(tradeA$tau_imput) # Country mapping C <- read_csv('IDE_ISIC.csv') c <- C %>% group_by(ccode, name) %>% summarise(n = n()) shinyServer(function(input, output) { trade_dat <- reactive({ t <- tradeA t <- filter(tradeA, inv_imp_pen_elast < input$maxxval) if (input$imp_comp == 'yes') { t <- filter(t, net_imp_tv > 0) } if (input$tar_type == 'MFN') { if (input$ntb == 'yes') { t$tauhat <- (t$tar_iwmfn + t$ave_core_wgt - 2) / (t$tar_iwmfn + t$ave_core_wgt - 1) } else { t$tauhat <- (t$tar_iwmfn - 1) / t$tar_iwmfn } } if (input$tar_type == 'Applied') { if (input$ntb == 'yes') { t$tauhat <- (t$tar_iwahs + t$ave_core_wgt - 2) / (t$tar_iwahs + t$ave_core_wgt - 1) } else { t$tauhat <- (t$tar_iwahs - 1) / t$tar_iwahs } } t$indicator <- as.factor(ifelse(t$ccode == input$country, 1, 0)) t$imput_col <- ifelse(t$tau_imput == 0, 'darkorange', 'red') t <- as.data.frame(t) t }) country <- reactive ({ }) trade_tooltip <- function(x) { if (is.null(x)) return(NULL) ttemp <- isolate(trade_dat()) obs <- ttemp[ttemp$ID == x$ID, ] paste0("<b>", obs$ccode, "</b>", ", ", obs$year, "<br>", obs$isicnames, "<br>", paste('alpha = ', round(obs$alpha,3), sep = "") ) } tradePlotA <- reactive({ tradeC <- filter(trade_dat, indicator == 1) tradeNC <- filter(trade_dat, indicator == 0) trade_dat %>% ggvis(x = ~inv_imp_pen_elast, y = ~tauhat) %>% layer_points(size = ~alpha, size.hover := 200, fillOpacity := 0.2, fillOpacity.hover := 0.5, stroke := 'steelblue', key := ~ID, data = tradeNC) %>% layer_points(size = ~alpha, size.hover := 200, fillOpacity := 0.2, fillOpacity.hover := 0.5, stroke := 'darkorange', key := ~ID, data = tradeC) %>% add_tooltip(trade_tooltip, "hover") %>% add_axis("x", title = 'Inverse Import Penetration * Inverse Elasticity') %>% add_axis("y", title = 'Magnitude of Tariff and Nontariff Barriers') }) output$plot1head <- renderText({'All Observations'}) tradePlotA %>% bind_shiny('all') tradePlotC <- reactive({ tradec <- filter(trade_dat, indicator == 1) tradec %>% ggvis(x = ~inv_imp_pen_elast, y = ~tauhat) %>% layer_points(size = ~alpha, size.hover := 500, fillOpacity := 0.2, fillOpacity.hover := 0.5, stroke := ~imput_col, key := ~ID) %>% layer_model_predictions(model = 'lm', formula = tauhat ~ inv_imp_pen - 1) %>% add_tooltip(trade_tooltip, "hover") %>% add_axis("x", title = 'Inverse Import Penetration * Inverse Elasticity') %>% add_axis("y", title = 'Magnitude of Tariff and Nontariff Barriers') %>% hide_legend('stroke') }) country <- reactive({ n <- filter(c, ccode == input$country) n$name }) output$plot2head <- renderText({country()}) tradePlotC %>% bind_shiny('n') }) ## next steps: # 1) allow for elasticity adjustment # 2) look at different combinations of tariff types
mes <- function(x) { dmy(paste("1", month(x), year(x))) } p<-ggplot(lll, aes(x=fch_a1, y=total)) + geom_line() fff %>% group_by(fch_a1) %>% summarise(total=sum(a1)) select(hhh, matches("(^a\\d)|(^fch_)"), Sexo, edad, UAP, grupo, Identificador_de_Paciente)->sss gather(sss, key, val, -c(Sexo, edad, UAP, grupo, Identificador_de_Paciente), -matches("^a\\d"))->ddd
/PVS/mes.R
no_license
arturiax/shiny-server
R
false
false
368
r
mes <- function(x) { dmy(paste("1", month(x), year(x))) } p<-ggplot(lll, aes(x=fch_a1, y=total)) + geom_line() fff %>% group_by(fch_a1) %>% summarise(total=sum(a1)) select(hhh, matches("(^a\\d)|(^fch_)"), Sexo, edad, UAP, grupo, Identificador_de_Paciente)->sss gather(sss, key, val, -c(Sexo, edad, UAP, grupo, Identificador_de_Paciente), -matches("^a\\d"))->ddd
library("aroma.core"); verbose <- Arguments$getVerbose(-8, timestamp=TRUE); ar <- AromaRepository(verbose=TRUE); verbose && enter(verbose, "Downloading annotation data"); chipType <- "Mapping10K_Xba142"; verbose && cat(verbose, "Chip type: ", chipType); pathname <- downloadCDF(ar, chipType); verbose && cat(verbose, "CDF: ", pathname); pathname <- downloadACS(ar, chipType, tags=".*"); verbose && cat(verbose, "ACS: ", pathname); pathname <- downloadUGP(ar, chipType, tags=".*"); verbose && cat(verbose, "UGP: ", pathname); pathname <- downloadUFL(ar, chipType, tags=".*"); verbose && cat(verbose, "UFL: ", pathname); verbose && exit(verbose);
/aroma.affymetrix/inst/testScripts/robustness/chipTypes/Mapping10K_Xba142/01a.downloadAnnotData.R
no_license
ingted/R-Examples
R
false
false
674
r
library("aroma.core"); verbose <- Arguments$getVerbose(-8, timestamp=TRUE); ar <- AromaRepository(verbose=TRUE); verbose && enter(verbose, "Downloading annotation data"); chipType <- "Mapping10K_Xba142"; verbose && cat(verbose, "Chip type: ", chipType); pathname <- downloadCDF(ar, chipType); verbose && cat(verbose, "CDF: ", pathname); pathname <- downloadACS(ar, chipType, tags=".*"); verbose && cat(verbose, "ACS: ", pathname); pathname <- downloadUGP(ar, chipType, tags=".*"); verbose && cat(verbose, "UGP: ", pathname); pathname <- downloadUFL(ar, chipType, tags=".*"); verbose && cat(verbose, "UFL: ", pathname); verbose && exit(verbose);
# Copyright 2022 Province of British Columbia # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and limitations under the License. # ================ #' This function retrieves hourly data from aswe sites, including both archived and current year data #' @param parameter Defines the parameter (type of data) your want to retrieve #' @param get_year Define the year that you want to retrieve. Defaults to "All" #' @param id Station ID you are looking for #' @keywords internal #' @importFrom magrittr %>% #' @importFrom bcdata bcdc_get_data #' @export #' @examples \dontrun{} daily_archive <- function(parameter = c("swe", "snow_depth", "precipitation", "temperature"), get_year = "All", id) { yr <- get_year # Knit the current year with past year data if you need both current and archived data if (any(yr %in% c("all", "All", "ALL")) | any(yr %in% wtr_yr(Sys.Date()))) { if (parameter == "swe") { # knit the daily swe archive with daily SWE for this water year data_i <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "666b7263-6111-488c-89aa-7480031f74cd") %>% dplyr::select(contains(c("DATE(UTC)", id))) colnames(data_i) <- gsub( " .*$", "", colnames(data_i)) # Melt dataframe data <- data.frame(data_i, check.names = FALSE) %>% reshape::melt(id = "DATE(UTC)") %>% dplyr::mutate(parameter = parameter) %>% dplyr::rename(date_utc = "DATE(UTC)") if ("variable" %in% colnames(data)) { data <- data %>% dplyr::rename(id = "variable") %>% dplyr::full_join(daily_current(parameter, id)) %>% dplyr::arrange(id, date_utc) %>% dplyr::filter(!is.na(value)) } else { data <- data %>% dplyr::mutate(value = NA) %>% dplyr::full_join(daily_current(parameter, id)) %>% dplyr::arrange(id, date_utc) %>% dplyr::filter(!is.na(value)) } } else if (parameter == "snow_depth") { # Get snow depth from historic daily data - not always complete to present water year historic_daily <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "945c144a-d094-4a20-a3c6-9fe74cad368a") %>% dplyr::filter(variable == "SD", Pillow_ID %in% paste0("_", id)) %>% dplyr::rename(id = "Pillow_ID", date_utc = "Date") %>% dplyr::mutate(parameter = "snow_depth", id = stringr::str_replace(id, "_", "")) %>% dplyr::select(-code, -variable) # knit the daily snow depth available pre 2003 with hourly 2003-current data <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "204f91d4-b136-41d2-98b3-125ecefd6887") %>% dplyr::select(contains(c(id, "DATE(UTC)"))) colnames(data) <- gsub( " .*$", "", colnames(data)) # Needs to be a dataframe to melt + melt dataframe data <- data.frame(data, check.names = FALSE) %>% reshape::melt(id = "DATE(UTC)") %>% dplyr::mutate(parameter = parameter) %>% dplyr::rename(date_utc = "DATE(UTC)") if ("variable" %in% colnames(data)) { data <- data %>% dplyr::rename(id = "variable") %>% dplyr::mutate(date = as.Date(date_utc)) %>% dplyr::group_by(id, date, parameter) %>% dplyr::summarise(value = mean(value, na.rm = TRUE)) %>% # cut out the data that is available within daily archive and knit together dplyr::rename(date_utc = "date") %>% dplyr::filter(date_utc > max(historic_daily$date_utc, na.rm = TRUE)) %>% dplyr::full_join(historic_daily) %>% dplyr::arrange(id, date_utc) %>% # get current year sd dplyr::full_join(daily_current(parameter = parameter, id = id)) %>% dplyr::arrange(id, date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) } else ( data <- data %>% dplyr::mutate(value = NA) %>% dplyr::mutate(date = as.Date(date_utc), parameter = "snow_depth") %>% dplyr::group_by(date, parameter) %>% dplyr::summarise(value = mean(value, na.rm = TRUE)) %>% # cut out the data that is available within daily archive and knit together dplyr::rename(date_utc = "date") %>% dplyr::filter(date_utc > max(historic_daily$date_utc)) %>% dplyr::full_join(historic_daily) %>% dplyr::arrange(date_utc) %>% # get current year sd dplyr::full_join(daily_current(parameter = parameter, id = id)) %>% dplyr::arrange(date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) ) } else if (parameter == "precipitation") { # Get t max and t min from historic daily data - not always complete to present water year historic_daily <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "945c144a-d094-4a20-a3c6-9fe74cad368a") %>% dplyr::filter(variable %in% c("AccumP"), Pillow_ID %in% paste0("_", id)) %>% dplyr::rename(id = "Pillow_ID", date_utc = "Date") %>% dplyr::mutate(parameter = "cum_precip", id = stringr::str_replace(id, "_", "")) %>% dplyr::select(-code, -variable) # knit the precipitation available until 2003 to the current year data. # Note that precip data is only hourly from the data catalog. # ************* WILL NEED TO CHANGE UTC BEFORE TAKING DAILY MEAN******************** data <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "371a0479-1c6a-4f15-a456-11d778824f38") %>% dplyr::select(contains(c(id, "DATE(UTC)"))) colnames(data) <- gsub( " .*$", "", colnames(data)) data <- data.frame(data, check.names = FALSE) %>% reshape::melt(id = "DATE(UTC)") %>% dplyr::mutate(parameter = "cum_precip") %>% dplyr::rename(date_utc = "DATE(UTC)") if ("variable" %in% colnames(data)) { data <- data %>% dplyr::rename(id = "variable") %>% dplyr::mutate(date = as.Date(date_utc)) %>% dplyr::filter(date > max(historic_daily$date_utc)) %>% dplyr::group_by(id, date, parameter) %>% dplyr::summarise(value = mean(value, na.rm = TRUE)) %>% dplyr::rename(date_utc = date) %>% # Join with the daily mean dplyr::full_join(historic_daily) %>% # join with current year daily mean precip dplyr::full_join(daily_current(parameter = parameter, id = id)) %>% dplyr::arrange(id, date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) } else ( data <- data %>% dplyr::mutate(value = NA) %>% dplyr::mutate(date = as.Date(date_utc)) %>% dplyr::filter(date > max(historic_daily$date_utc)) %>% dplyr::group_by(date, parameter) %>% dplyr::summarise(value = mean(value, na.rm = TRUE)) %>% dplyr::rename(date_utc = date) %>% # Join with the daily mean dplyr::full_join(historic_daily) %>% # join with current year daily mean precip dplyr::full_join(daily_current(parameter = parameter, id = id)) %>% dplyr::arrange(date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) ) } else if (parameter == "temperature") { # Get t max and t min from historic daily data - not always complete to present water year historic_daily <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "945c144a-d094-4a20-a3c6-9fe74cad368a") %>% dplyr::filter(variable %in% c("T_Max", "T_Min"), Pillow_ID %in% paste0("_", id)) %>% dplyr::rename(id = "Pillow_ID", date_utc = "Date") %>% dplyr::mutate(parameter = as.character(ifelse(variable == "T_Max", "t_max", "t_min")), id = as.character(stringr::str_replace(id, "_", ""))) %>% dplyr::select(-code, -variable) # knit the daily snow depth available pre 2003 with hourly 2003-current data <- bcdata::bcdc_get_data(record = "5e7acd31-b242-4f09-8a64-000af872d68f", resource = "fba88311-34b9-4422-b5ae-572fd23b2a00") %>% dplyr::select(contains(c(id, "DATE(UTC)"))) colnames(data) <- gsub( " .*$", "", colnames(data)) # Needs to be a dataframe to melt data <- data.frame(data, check.names = FALSE) %>% reshape::melt(id = "DATE(UTC)") %>% dplyr::mutate(parameter = parameter) %>% dplyr::rename(date_utc = "DATE(UTC)") if ("variable" %in% colnames(data)) { data <- data %>% dplyr::rename(id = "variable") %>% dplyr::arrange(id, date_utc) %>% dplyr::mutate(date = as.Date(date_utc), "id" = id) %>% dplyr::filter(date > max(historic_daily$date_utc)) %>% dplyr::group_by(id, date) %>% dplyr::summarise(t_max = max(value, na.rm = TRUE), t_min = min(value, na.rm = TRUE)) %>% dplyr::rename(date_utc = date) %>% reshape2::melt(id = c("date_utc", "id")) %>% dplyr::rename(parameter = "variable") %>% dplyr::full_join(historic_daily) %>% # get current year temperature dplyr::full_join(daily_current(parameter = parameter, id = id)) %>% dplyr::arrange(id, date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) %>% dplyr::filter(!is.infinite(value)) } else ( data <- data %>% dplyr::mutate(value = NA) %>% dplyr::mutate(date = as.Date(date_utc), "id" = id) %>% dplyr::filter(date > max(historic_daily$date_utc)) %>% dplyr::group_by(id, date) %>% dplyr::summarise(t_max = max(value, na.rm = TRUE), t_min = min(value, na.rm = TRUE)) %>% dplyr::rename(date_utc = date) %>% reshape2::melt(id = c("date_utc", "id")) %>% dplyr::rename(parameter = "variable") %>% dplyr::full_join(historic_daily) %>% # get current year temperature dplyr::full_join(daily_current(parameter = parameter, id = id)) %>% dplyr::arrange(date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) ) } } else { if (parameter == "swe") { # get only the archived data # knit the daily swe archive with daily SWE for this water year data_i <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "666b7263-6111-488c-89aa-7480031f74cd") %>% dplyr::select(contains(c(id, "DATE(UTC)"))) colnames(data_i) <- gsub( " .*$", "", colnames(data_i)) # Melt dataframe data <- data.frame(data_i, check.names = FALSE) %>% reshape::melt(id = "DATE(UTC)") %>% dplyr::mutate(parameter = parameter) %>% dplyr::rename(date_utc = "DATE(UTC)") if ("variable" %in% colnames(data)) { data <- data %>% dplyr::filter(!is.na(value)) %>% dplyr::rename(id = "variable") } else ( data <- data %>% dplyr::mutate(value = NA) %>% dplyr::filter(!is.na(value)) ) } else if (parameter == "snow_depth") { # Get snow depth from historic daily data - not always complete to present water year historic_daily <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "945c144a-d094-4a20-a3c6-9fe74cad368a") %>% dplyr::filter(variable == "SD", Pillow_ID %in% paste0("_", id)) %>% dplyr::rename(id = "Pillow_ID", date_utc = "Date") %>% dplyr::mutate(parameter = "snow_depth", id = stringr::str_replace(id, "_", "")) %>% dplyr::select(-code, -variable) # knit the daily snow depth available pre 2003 with hourly 2003-current data <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "204f91d4-b136-41d2-98b3-125ecefd6887") %>% dplyr::select(contains(c(id, "DATE(UTC)"))) #dplyr::mutate(date = as.Date(`DATE(UTC)`)) %>% #dplyr::rename(value = contains(id), date_utc = "DATE(UTC)") colnames(data) <- gsub( " .*$", "", colnames(data)) # Needs to be a dataframe to melt data <- data.frame(data, check.names = FALSE) %>% reshape::melt(id = "DATE(UTC)") %>% dplyr::mutate(parameter = parameter) %>% dplyr::rename(date_utc = "DATE(UTC)", id = "variable") if ("value" %in% colnames(data)) { data <- data %>% dplyr::mutate(date = as.Date(date_utc)) %>% dplyr::group_by(id, date, parameter) %>% dplyr::summarise(value = mean(value, na.rm = TRUE)) %>% # cut out the data that is available within daily archive and knit together dplyr::rename(date_utc = "date") %>% dplyr::filter(date_utc > max(historic_daily$date_utc, na.rm = TRUE)) %>% dplyr::full_join(historic_daily) %>% dplyr::arrange(id, date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) } else ( data <- data %>% dplyr::mutate(value = NA) %>% dplyr::mutate(date = as.Date(date_utc), parameter = "snow_depth") %>% dplyr::group_by(id, date, parameter) %>% dplyr::summarise(value = mean(value, na.rm = TRUE)) %>% # cut out the data that is available within daily archive and knit together dplyr::rename(date_utc = "date") %>% dplyr::filter(date_utc > max(historic_daily$date_utc)) %>% dplyr::full_join(historic_daily) %>% dplyr::arrange(id, date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) ) } else if (parameter == "precipitation") { # Get precipitation from historic daily data - not always complete to present water year historic_daily <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "945c144a-d094-4a20-a3c6-9fe74cad368a") %>% dplyr::filter(variable %in% c("AccumP"), Pillow_ID %in% paste0("_", id)) %>% dplyr::rename(id = "Pillow_ID", date_utc = "Date") %>% dplyr::mutate(parameter = "cum_precip", id = stringr::str_replace(id, "_", "")) %>% dplyr::select(-code, -variable) # knit the precipitation available until 2003 to the current year data. # Note that precip data is only hourly from the data catalog. # ************* WILL NEED TO CHANGE UTC BEFORE TAKING DAILY MEAN******************** data <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "371a0479-1c6a-4f15-a456-11d778824f38") %>% dplyr::select(contains(c(id, "DATE(UTC)"))) colnames(data) <- gsub( " .*$", "", colnames(data)) # Needs to be a dataframe to melt data <- data.frame(data, check.names = FALSE) %>% reshape::melt(id = "DATE(UTC)") %>% dplyr::mutate(parameter = "cum_precip") %>% dplyr::rename(date_utc = "DATE(UTC", id = "variable") if ("value" %in% colnames(data)) { data <- data %>% dplyr::mutate(date = as.Date(date_utc)) %>% dplyr::filter(date > max(historic_daily$date_utc)) %>% dplyr::group_by(id, date, parameter) %>% dplyr::summarise(value = mean(value, na.rm = TRUE)) %>% dplyr::rename(date_utc = date) %>% # Join with the daily mean dplyr::full_join(historic_daily) %>% dplyr::arrange(id, date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) } else ( data <- data %>% dplyr::mutate(value = NA) %>% dplyr::mutate(date = as.Date(date_utc)) %>% dplyr::filter(date > max(historic_daily$date_utc)) %>% dplyr::group_by(id, date, parameter) %>% dplyr::summarise(value = mean(value, na.rm = TRUE)) %>% dplyr::rename(date_utc = date) %>% # Join with the daily mean dplyr::full_join(historic_daily) %>% # join with current year daily mean precip dplyr::arrange(id, date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) ) } else if (parameter == "temperature") { # Get t max and t min from historic daily data - not always complete to present water year historic_daily <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "945c144a-d094-4a20-a3c6-9fe74cad368a") %>% dplyr::filter(variable %in% c("T_Max", "T_Min"), Pillow_ID %in% paste0("_", id)) %>% dplyr::rename(id = "Pillow_ID", date_utc = "Date") %>% dplyr::mutate(parameter = as.character(ifelse(variable == "T_Max", "t_max", "t_min")), id = as.character(stringr::str_replace(id, "_", ""))) %>% dplyr::select(-code, -variable) # knit the daily snow depth available pre 2003 with hourly 2003-current data <- bcdata::bcdc_get_data(record = "5e7acd31-b242-4f09-8a64-000af872d68f", resource = "fba88311-34b9-4422-b5ae-572fd23b2a00") %>% dplyr::select(contains(c(id, "DATE(UTC)"))) colnames(data) <- gsub( " .*$", "", colnames(data)) # Needs to be a dataframe to melt data <- data.frame(data, check.names = FALSE) %>% reshape::melt(id = "DATE(UTC)") %>% dplyr::mutate(parameter = parameter) %>% dplyr::rename(date_utc = "DATE(UTC)", id = "variable") if ("value" %in% colnames(data)) { data <- data %>% dplyr::mutate(date = as.Date(date_utc), "id" = id) %>% dplyr::filter(date > max(historic_daily$date_utc)) %>% dplyr::group_by(id, date) %>% dplyr::summarise(t_max = max(value, na.rm = TRUE), t_min = min(value, na.rm = TRUE)) %>% dplyr::rename(date_utc = date) %>% reshape2::melt(id = c("date_utc", "id")) %>% dplyr::rename(parameter = "variable") %>% dplyr::full_join(historic_daily) %>% # get current year temperature dplyr::arrange(id, date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) %>% dplyr::filter(!is.infinite(value)) } else ( data <- data %>% dplyr::mutate(value = NA) %>% dplyr::mutate(date = as.Date(date_utc), "id" = id) %>% dplyr::filter(date > max(historic_daily$date_utc)) %>% dplyr::group_by(id, date) %>% dplyr::summarise(t_max = max(value, na.rm = TRUE), t_min = min(value, na.rm = TRUE)) %>% dplyr::rename(date_utc = date) %>% reshape2::melt(id = c("date_utc", "id")) %>% dplyr::rename(parameter = "variable") %>% dplyr::full_join(historic_daily) %>% # get current year temperature dplyr::arrange(date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) ) } } # filter for specified years and check that the DAILY data only is present - slight glitch in some stations that data catalogue has some hourly data if (any(yr %in% c("ALL", "all", "All"))) { data_o <- data %>% dplyr::filter(lubridate::hour(date_utc) == "16") } else { # Filter for the years your specify data_o <- data %>% dplyr::filter(lubridate::year(date_utc) %in% yr) %>% dplyr::filter(lubridate::hour(date_utc) == "16") } return(data_o) }
/R/daily_archive_function.R
permissive
bcgov/bcsnowdata
R
false
false
20,032
r
# Copyright 2022 Province of British Columbia # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and limitations under the License. # ================ #' This function retrieves hourly data from aswe sites, including both archived and current year data #' @param parameter Defines the parameter (type of data) your want to retrieve #' @param get_year Define the year that you want to retrieve. Defaults to "All" #' @param id Station ID you are looking for #' @keywords internal #' @importFrom magrittr %>% #' @importFrom bcdata bcdc_get_data #' @export #' @examples \dontrun{} daily_archive <- function(parameter = c("swe", "snow_depth", "precipitation", "temperature"), get_year = "All", id) { yr <- get_year # Knit the current year with past year data if you need both current and archived data if (any(yr %in% c("all", "All", "ALL")) | any(yr %in% wtr_yr(Sys.Date()))) { if (parameter == "swe") { # knit the daily swe archive with daily SWE for this water year data_i <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "666b7263-6111-488c-89aa-7480031f74cd") %>% dplyr::select(contains(c("DATE(UTC)", id))) colnames(data_i) <- gsub( " .*$", "", colnames(data_i)) # Melt dataframe data <- data.frame(data_i, check.names = FALSE) %>% reshape::melt(id = "DATE(UTC)") %>% dplyr::mutate(parameter = parameter) %>% dplyr::rename(date_utc = "DATE(UTC)") if ("variable" %in% colnames(data)) { data <- data %>% dplyr::rename(id = "variable") %>% dplyr::full_join(daily_current(parameter, id)) %>% dplyr::arrange(id, date_utc) %>% dplyr::filter(!is.na(value)) } else { data <- data %>% dplyr::mutate(value = NA) %>% dplyr::full_join(daily_current(parameter, id)) %>% dplyr::arrange(id, date_utc) %>% dplyr::filter(!is.na(value)) } } else if (parameter == "snow_depth") { # Get snow depth from historic daily data - not always complete to present water year historic_daily <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "945c144a-d094-4a20-a3c6-9fe74cad368a") %>% dplyr::filter(variable == "SD", Pillow_ID %in% paste0("_", id)) %>% dplyr::rename(id = "Pillow_ID", date_utc = "Date") %>% dplyr::mutate(parameter = "snow_depth", id = stringr::str_replace(id, "_", "")) %>% dplyr::select(-code, -variable) # knit the daily snow depth available pre 2003 with hourly 2003-current data <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "204f91d4-b136-41d2-98b3-125ecefd6887") %>% dplyr::select(contains(c(id, "DATE(UTC)"))) colnames(data) <- gsub( " .*$", "", colnames(data)) # Needs to be a dataframe to melt + melt dataframe data <- data.frame(data, check.names = FALSE) %>% reshape::melt(id = "DATE(UTC)") %>% dplyr::mutate(parameter = parameter) %>% dplyr::rename(date_utc = "DATE(UTC)") if ("variable" %in% colnames(data)) { data <- data %>% dplyr::rename(id = "variable") %>% dplyr::mutate(date = as.Date(date_utc)) %>% dplyr::group_by(id, date, parameter) %>% dplyr::summarise(value = mean(value, na.rm = TRUE)) %>% # cut out the data that is available within daily archive and knit together dplyr::rename(date_utc = "date") %>% dplyr::filter(date_utc > max(historic_daily$date_utc, na.rm = TRUE)) %>% dplyr::full_join(historic_daily) %>% dplyr::arrange(id, date_utc) %>% # get current year sd dplyr::full_join(daily_current(parameter = parameter, id = id)) %>% dplyr::arrange(id, date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) } else ( data <- data %>% dplyr::mutate(value = NA) %>% dplyr::mutate(date = as.Date(date_utc), parameter = "snow_depth") %>% dplyr::group_by(date, parameter) %>% dplyr::summarise(value = mean(value, na.rm = TRUE)) %>% # cut out the data that is available within daily archive and knit together dplyr::rename(date_utc = "date") %>% dplyr::filter(date_utc > max(historic_daily$date_utc)) %>% dplyr::full_join(historic_daily) %>% dplyr::arrange(date_utc) %>% # get current year sd dplyr::full_join(daily_current(parameter = parameter, id = id)) %>% dplyr::arrange(date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) ) } else if (parameter == "precipitation") { # Get t max and t min from historic daily data - not always complete to present water year historic_daily <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "945c144a-d094-4a20-a3c6-9fe74cad368a") %>% dplyr::filter(variable %in% c("AccumP"), Pillow_ID %in% paste0("_", id)) %>% dplyr::rename(id = "Pillow_ID", date_utc = "Date") %>% dplyr::mutate(parameter = "cum_precip", id = stringr::str_replace(id, "_", "")) %>% dplyr::select(-code, -variable) # knit the precipitation available until 2003 to the current year data. # Note that precip data is only hourly from the data catalog. # ************* WILL NEED TO CHANGE UTC BEFORE TAKING DAILY MEAN******************** data <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "371a0479-1c6a-4f15-a456-11d778824f38") %>% dplyr::select(contains(c(id, "DATE(UTC)"))) colnames(data) <- gsub( " .*$", "", colnames(data)) data <- data.frame(data, check.names = FALSE) %>% reshape::melt(id = "DATE(UTC)") %>% dplyr::mutate(parameter = "cum_precip") %>% dplyr::rename(date_utc = "DATE(UTC)") if ("variable" %in% colnames(data)) { data <- data %>% dplyr::rename(id = "variable") %>% dplyr::mutate(date = as.Date(date_utc)) %>% dplyr::filter(date > max(historic_daily$date_utc)) %>% dplyr::group_by(id, date, parameter) %>% dplyr::summarise(value = mean(value, na.rm = TRUE)) %>% dplyr::rename(date_utc = date) %>% # Join with the daily mean dplyr::full_join(historic_daily) %>% # join with current year daily mean precip dplyr::full_join(daily_current(parameter = parameter, id = id)) %>% dplyr::arrange(id, date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) } else ( data <- data %>% dplyr::mutate(value = NA) %>% dplyr::mutate(date = as.Date(date_utc)) %>% dplyr::filter(date > max(historic_daily$date_utc)) %>% dplyr::group_by(date, parameter) %>% dplyr::summarise(value = mean(value, na.rm = TRUE)) %>% dplyr::rename(date_utc = date) %>% # Join with the daily mean dplyr::full_join(historic_daily) %>% # join with current year daily mean precip dplyr::full_join(daily_current(parameter = parameter, id = id)) %>% dplyr::arrange(date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) ) } else if (parameter == "temperature") { # Get t max and t min from historic daily data - not always complete to present water year historic_daily <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "945c144a-d094-4a20-a3c6-9fe74cad368a") %>% dplyr::filter(variable %in% c("T_Max", "T_Min"), Pillow_ID %in% paste0("_", id)) %>% dplyr::rename(id = "Pillow_ID", date_utc = "Date") %>% dplyr::mutate(parameter = as.character(ifelse(variable == "T_Max", "t_max", "t_min")), id = as.character(stringr::str_replace(id, "_", ""))) %>% dplyr::select(-code, -variable) # knit the daily snow depth available pre 2003 with hourly 2003-current data <- bcdata::bcdc_get_data(record = "5e7acd31-b242-4f09-8a64-000af872d68f", resource = "fba88311-34b9-4422-b5ae-572fd23b2a00") %>% dplyr::select(contains(c(id, "DATE(UTC)"))) colnames(data) <- gsub( " .*$", "", colnames(data)) # Needs to be a dataframe to melt data <- data.frame(data, check.names = FALSE) %>% reshape::melt(id = "DATE(UTC)") %>% dplyr::mutate(parameter = parameter) %>% dplyr::rename(date_utc = "DATE(UTC)") if ("variable" %in% colnames(data)) { data <- data %>% dplyr::rename(id = "variable") %>% dplyr::arrange(id, date_utc) %>% dplyr::mutate(date = as.Date(date_utc), "id" = id) %>% dplyr::filter(date > max(historic_daily$date_utc)) %>% dplyr::group_by(id, date) %>% dplyr::summarise(t_max = max(value, na.rm = TRUE), t_min = min(value, na.rm = TRUE)) %>% dplyr::rename(date_utc = date) %>% reshape2::melt(id = c("date_utc", "id")) %>% dplyr::rename(parameter = "variable") %>% dplyr::full_join(historic_daily) %>% # get current year temperature dplyr::full_join(daily_current(parameter = parameter, id = id)) %>% dplyr::arrange(id, date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) %>% dplyr::filter(!is.infinite(value)) } else ( data <- data %>% dplyr::mutate(value = NA) %>% dplyr::mutate(date = as.Date(date_utc), "id" = id) %>% dplyr::filter(date > max(historic_daily$date_utc)) %>% dplyr::group_by(id, date) %>% dplyr::summarise(t_max = max(value, na.rm = TRUE), t_min = min(value, na.rm = TRUE)) %>% dplyr::rename(date_utc = date) %>% reshape2::melt(id = c("date_utc", "id")) %>% dplyr::rename(parameter = "variable") %>% dplyr::full_join(historic_daily) %>% # get current year temperature dplyr::full_join(daily_current(parameter = parameter, id = id)) %>% dplyr::arrange(date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) ) } } else { if (parameter == "swe") { # get only the archived data # knit the daily swe archive with daily SWE for this water year data_i <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "666b7263-6111-488c-89aa-7480031f74cd") %>% dplyr::select(contains(c(id, "DATE(UTC)"))) colnames(data_i) <- gsub( " .*$", "", colnames(data_i)) # Melt dataframe data <- data.frame(data_i, check.names = FALSE) %>% reshape::melt(id = "DATE(UTC)") %>% dplyr::mutate(parameter = parameter) %>% dplyr::rename(date_utc = "DATE(UTC)") if ("variable" %in% colnames(data)) { data <- data %>% dplyr::filter(!is.na(value)) %>% dplyr::rename(id = "variable") } else ( data <- data %>% dplyr::mutate(value = NA) %>% dplyr::filter(!is.na(value)) ) } else if (parameter == "snow_depth") { # Get snow depth from historic daily data - not always complete to present water year historic_daily <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "945c144a-d094-4a20-a3c6-9fe74cad368a") %>% dplyr::filter(variable == "SD", Pillow_ID %in% paste0("_", id)) %>% dplyr::rename(id = "Pillow_ID", date_utc = "Date") %>% dplyr::mutate(parameter = "snow_depth", id = stringr::str_replace(id, "_", "")) %>% dplyr::select(-code, -variable) # knit the daily snow depth available pre 2003 with hourly 2003-current data <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "204f91d4-b136-41d2-98b3-125ecefd6887") %>% dplyr::select(contains(c(id, "DATE(UTC)"))) #dplyr::mutate(date = as.Date(`DATE(UTC)`)) %>% #dplyr::rename(value = contains(id), date_utc = "DATE(UTC)") colnames(data) <- gsub( " .*$", "", colnames(data)) # Needs to be a dataframe to melt data <- data.frame(data, check.names = FALSE) %>% reshape::melt(id = "DATE(UTC)") %>% dplyr::mutate(parameter = parameter) %>% dplyr::rename(date_utc = "DATE(UTC)", id = "variable") if ("value" %in% colnames(data)) { data <- data %>% dplyr::mutate(date = as.Date(date_utc)) %>% dplyr::group_by(id, date, parameter) %>% dplyr::summarise(value = mean(value, na.rm = TRUE)) %>% # cut out the data that is available within daily archive and knit together dplyr::rename(date_utc = "date") %>% dplyr::filter(date_utc > max(historic_daily$date_utc, na.rm = TRUE)) %>% dplyr::full_join(historic_daily) %>% dplyr::arrange(id, date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) } else ( data <- data %>% dplyr::mutate(value = NA) %>% dplyr::mutate(date = as.Date(date_utc), parameter = "snow_depth") %>% dplyr::group_by(id, date, parameter) %>% dplyr::summarise(value = mean(value, na.rm = TRUE)) %>% # cut out the data that is available within daily archive and knit together dplyr::rename(date_utc = "date") %>% dplyr::filter(date_utc > max(historic_daily$date_utc)) %>% dplyr::full_join(historic_daily) %>% dplyr::arrange(id, date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) ) } else if (parameter == "precipitation") { # Get precipitation from historic daily data - not always complete to present water year historic_daily <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "945c144a-d094-4a20-a3c6-9fe74cad368a") %>% dplyr::filter(variable %in% c("AccumP"), Pillow_ID %in% paste0("_", id)) %>% dplyr::rename(id = "Pillow_ID", date_utc = "Date") %>% dplyr::mutate(parameter = "cum_precip", id = stringr::str_replace(id, "_", "")) %>% dplyr::select(-code, -variable) # knit the precipitation available until 2003 to the current year data. # Note that precip data is only hourly from the data catalog. # ************* WILL NEED TO CHANGE UTC BEFORE TAKING DAILY MEAN******************** data <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "371a0479-1c6a-4f15-a456-11d778824f38") %>% dplyr::select(contains(c(id, "DATE(UTC)"))) colnames(data) <- gsub( " .*$", "", colnames(data)) # Needs to be a dataframe to melt data <- data.frame(data, check.names = FALSE) %>% reshape::melt(id = "DATE(UTC)") %>% dplyr::mutate(parameter = "cum_precip") %>% dplyr::rename(date_utc = "DATE(UTC", id = "variable") if ("value" %in% colnames(data)) { data <- data %>% dplyr::mutate(date = as.Date(date_utc)) %>% dplyr::filter(date > max(historic_daily$date_utc)) %>% dplyr::group_by(id, date, parameter) %>% dplyr::summarise(value = mean(value, na.rm = TRUE)) %>% dplyr::rename(date_utc = date) %>% # Join with the daily mean dplyr::full_join(historic_daily) %>% dplyr::arrange(id, date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) } else ( data <- data %>% dplyr::mutate(value = NA) %>% dplyr::mutate(date = as.Date(date_utc)) %>% dplyr::filter(date > max(historic_daily$date_utc)) %>% dplyr::group_by(id, date, parameter) %>% dplyr::summarise(value = mean(value, na.rm = TRUE)) %>% dplyr::rename(date_utc = date) %>% # Join with the daily mean dplyr::full_join(historic_daily) %>% # join with current year daily mean precip dplyr::arrange(id, date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) ) } else if (parameter == "temperature") { # Get t max and t min from historic daily data - not always complete to present water year historic_daily <- bcdata::bcdc_get_data("5e7acd31-b242-4f09-8a64-000af872d68f", resource = "945c144a-d094-4a20-a3c6-9fe74cad368a") %>% dplyr::filter(variable %in% c("T_Max", "T_Min"), Pillow_ID %in% paste0("_", id)) %>% dplyr::rename(id = "Pillow_ID", date_utc = "Date") %>% dplyr::mutate(parameter = as.character(ifelse(variable == "T_Max", "t_max", "t_min")), id = as.character(stringr::str_replace(id, "_", ""))) %>% dplyr::select(-code, -variable) # knit the daily snow depth available pre 2003 with hourly 2003-current data <- bcdata::bcdc_get_data(record = "5e7acd31-b242-4f09-8a64-000af872d68f", resource = "fba88311-34b9-4422-b5ae-572fd23b2a00") %>% dplyr::select(contains(c(id, "DATE(UTC)"))) colnames(data) <- gsub( " .*$", "", colnames(data)) # Needs to be a dataframe to melt data <- data.frame(data, check.names = FALSE) %>% reshape::melt(id = "DATE(UTC)") %>% dplyr::mutate(parameter = parameter) %>% dplyr::rename(date_utc = "DATE(UTC)", id = "variable") if ("value" %in% colnames(data)) { data <- data %>% dplyr::mutate(date = as.Date(date_utc), "id" = id) %>% dplyr::filter(date > max(historic_daily$date_utc)) %>% dplyr::group_by(id, date) %>% dplyr::summarise(t_max = max(value, na.rm = TRUE), t_min = min(value, na.rm = TRUE)) %>% dplyr::rename(date_utc = date) %>% reshape2::melt(id = c("date_utc", "id")) %>% dplyr::rename(parameter = "variable") %>% dplyr::full_join(historic_daily) %>% # get current year temperature dplyr::arrange(id, date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) %>% dplyr::filter(!is.infinite(value)) } else ( data <- data %>% dplyr::mutate(value = NA) %>% dplyr::mutate(date = as.Date(date_utc), "id" = id) %>% dplyr::filter(date > max(historic_daily$date_utc)) %>% dplyr::group_by(id, date) %>% dplyr::summarise(t_max = max(value, na.rm = TRUE), t_min = min(value, na.rm = TRUE)) %>% dplyr::rename(date_utc = date) %>% reshape2::melt(id = c("date_utc", "id")) %>% dplyr::rename(parameter = "variable") %>% dplyr::full_join(historic_daily) %>% # get current year temperature dplyr::arrange(date_utc) %>% unique() %>% dplyr::filter(!is.na(value)) ) } } # filter for specified years and check that the DAILY data only is present - slight glitch in some stations that data catalogue has some hourly data if (any(yr %in% c("ALL", "all", "All"))) { data_o <- data %>% dplyr::filter(lubridate::hour(date_utc) == "16") } else { # Filter for the years your specify data_o <- data %>% dplyr::filter(lubridate::year(date_utc) %in% yr) %>% dplyr::filter(lubridate::hour(date_utc) == "16") } return(data_o) }
% Generated by roxygen2 (4.1.1): do not edit by hand % Please edit documentation in R/bess.sph.r \name{bess.sph} \alias{bess.sph} \title{Calculates Spherical Bessel functions from 0 to nmax.} \usage{ bess.sph(nmax, x, code = "C") } \arguments{ \item{nmax}{The maximum order of \eqn{j_n(x)}} \item{x}{The argument of \eqn{j_n(x)}} \item{code}{If you prefer to use native R or C language. The algorithm is the same.} } \value{ An array of Spherical Bessel functions and its derivatives from 0 to \code{nmax} at point \code{x}, and also the logarithmic derivative \eqn{c_n=j_n'/j_n} and the ratio \eqn{\rho_n=j_n/j_{n+1}}. } \description{ Calculates Spherical Bessel functions from 0 to nmax. } \details{ \code{bess.sph} calculates the Spherical Bessel functions using downward recurrence, from \eqn{j_nmax(x)} to \eqn{j_0(x)}. The system of equations is given by \eqn{S_n(x)=n/x}, \eqn{\rho_n=j_n(x)/j_{n+1}(x)}{r[n]=j_n/j_{n+1}} and \eqn{c_n=j_n'(x)/j_n(x)}. The system can be solved by means of the recurrence relations of the Spherical Bessel functions \deqn{ \rho_{n-1}+\frac{1 }{\rho_n}=S_{2n+1} }{ r[n-1]+ 1/r[n]=S[2n+1]} \deqn{n\rho_{n-1}-\frac{n+1}{\rho_n}=(2n+1)c_{n}}{nr[n-1]-(n+1)/r[n]=(2n+1)c[n]} that can be rewriten \deqn{\rho_n=S_{n+2}+c_{n+1} }{ r[n]=S[n+2]+c[n+1]} \deqn{\frac{1}{\rho_n}=S_n-c_n. }{1/r[n]=S[n ]-c[n ].} The logarithmic derivatives obeys the relation, \deqn{(S_{n+2}-c_{n+1})(S_n+c_n)=1. }{(S[n+2]-c[n])(S[n]+C[n])=1.} The values can be calculated upward or downward. } \examples{ x<-30 nmax<-50 a<-bess.sph(nmax,x,code="C") b<-bess.sph(nmax,x,code="R") d<-sqrt(pi/(2*x))*besselJ(x=x,nu=.5+(0:nmax)) plot(a$jn,type='b') points(b$jn,col='red',pch=4) points(d,col='blue',pch=3) }
/man/bess.sph.Rd
no_license
wendellopes/rvswf
R
false
false
1,738
rd
% Generated by roxygen2 (4.1.1): do not edit by hand % Please edit documentation in R/bess.sph.r \name{bess.sph} \alias{bess.sph} \title{Calculates Spherical Bessel functions from 0 to nmax.} \usage{ bess.sph(nmax, x, code = "C") } \arguments{ \item{nmax}{The maximum order of \eqn{j_n(x)}} \item{x}{The argument of \eqn{j_n(x)}} \item{code}{If you prefer to use native R or C language. The algorithm is the same.} } \value{ An array of Spherical Bessel functions and its derivatives from 0 to \code{nmax} at point \code{x}, and also the logarithmic derivative \eqn{c_n=j_n'/j_n} and the ratio \eqn{\rho_n=j_n/j_{n+1}}. } \description{ Calculates Spherical Bessel functions from 0 to nmax. } \details{ \code{bess.sph} calculates the Spherical Bessel functions using downward recurrence, from \eqn{j_nmax(x)} to \eqn{j_0(x)}. The system of equations is given by \eqn{S_n(x)=n/x}, \eqn{\rho_n=j_n(x)/j_{n+1}(x)}{r[n]=j_n/j_{n+1}} and \eqn{c_n=j_n'(x)/j_n(x)}. The system can be solved by means of the recurrence relations of the Spherical Bessel functions \deqn{ \rho_{n-1}+\frac{1 }{\rho_n}=S_{2n+1} }{ r[n-1]+ 1/r[n]=S[2n+1]} \deqn{n\rho_{n-1}-\frac{n+1}{\rho_n}=(2n+1)c_{n}}{nr[n-1]-(n+1)/r[n]=(2n+1)c[n]} that can be rewriten \deqn{\rho_n=S_{n+2}+c_{n+1} }{ r[n]=S[n+2]+c[n+1]} \deqn{\frac{1}{\rho_n}=S_n-c_n. }{1/r[n]=S[n ]-c[n ].} The logarithmic derivatives obeys the relation, \deqn{(S_{n+2}-c_{n+1})(S_n+c_n)=1. }{(S[n+2]-c[n])(S[n]+C[n])=1.} The values can be calculated upward or downward. } \examples{ x<-30 nmax<-50 a<-bess.sph(nmax,x,code="C") b<-bess.sph(nmax,x,code="R") d<-sqrt(pi/(2*x))*besselJ(x=x,nu=.5+(0:nmax)) plot(a$jn,type='b') points(b$jn,col='red',pch=4) points(d,col='blue',pch=3) }
setwd("/Users/Dipendra/Desktop/Coursera/ExData_Plotting1") #Loading lubridate package to library library(lubridate) # Seggregating the data of two days from the entire dataset varclass <- c(rep('character',2),rep('numeric',7)) pwrconsumption <-read.table("household_power_consumption.txt",header=TRUE, sep = ";", na.strings = "?",colClasses=varclass) pwrconsumption <- pwrconsumption[pwrconsumption$Date=="1/2/2007" | pwrconsumption$Date=="2/2/2007",] # clean up the variable names and convert date/time fields cols <-c('Date','Time','GlobalActivePower','GlobalReactivePower','Voltage','GlobalIntensity', 'SubMetering1','SubMetering2','SubMetering3') colnames(pwrconsumption) <- cols pwrconsumption$DateTime <- dmy(pwrconsumption$Date)+hms(pwrconsumption$Time) pwrconsumption <- pwrconsumption[,c(10,3:9)] #Plot Data plot(pwrconsumption$DateTime, pwrconsumption$SubMetering1,type='l', col='black',xlab='',ylab='Energy sub metering') lines (pwrconsumption$DateTime, pwrconsumption$SubMetering2, col='Red') lines(pwrconsumption$DateTime, pwrconsumption$SubMetering3,col='Blue') legend('topright',legend=c('Sub_metering_1','Sub_metering_2','Sub_metering_3'),col= c('black','red','blue') ,lty='solid') #Copy from screen to the file dev.copy(png, file='plot3.png', width = 480, height = 480, units = 'px') # Turn off device dev.off()
/plot3.R
no_license
kcdipendra/ExData_Plotting1
R
false
false
1,339
r
setwd("/Users/Dipendra/Desktop/Coursera/ExData_Plotting1") #Loading lubridate package to library library(lubridate) # Seggregating the data of two days from the entire dataset varclass <- c(rep('character',2),rep('numeric',7)) pwrconsumption <-read.table("household_power_consumption.txt",header=TRUE, sep = ";", na.strings = "?",colClasses=varclass) pwrconsumption <- pwrconsumption[pwrconsumption$Date=="1/2/2007" | pwrconsumption$Date=="2/2/2007",] # clean up the variable names and convert date/time fields cols <-c('Date','Time','GlobalActivePower','GlobalReactivePower','Voltage','GlobalIntensity', 'SubMetering1','SubMetering2','SubMetering3') colnames(pwrconsumption) <- cols pwrconsumption$DateTime <- dmy(pwrconsumption$Date)+hms(pwrconsumption$Time) pwrconsumption <- pwrconsumption[,c(10,3:9)] #Plot Data plot(pwrconsumption$DateTime, pwrconsumption$SubMetering1,type='l', col='black',xlab='',ylab='Energy sub metering') lines (pwrconsumption$DateTime, pwrconsumption$SubMetering2, col='Red') lines(pwrconsumption$DateTime, pwrconsumption$SubMetering3,col='Blue') legend('topright',legend=c('Sub_metering_1','Sub_metering_2','Sub_metering_3'),col= c('black','red','blue') ,lty='solid') #Copy from screen to the file dev.copy(png, file='plot3.png', width = 480, height = 480, units = 'px') # Turn off device dev.off()
#' @title plot the deficit hydrique from Ernage data for the period of interest #' @param data dataframe #' @param int boolean #' @import ggplot2 #' @return ggplot graph #' @export dhw_plot <- function(data, int){ plot = ggplot(data, aes(x = Décade, y = Déficit)) + geom_line(aes(color = Année), na.rm = TRUE) + geom_point(aes(color = Année, shape = Année), na.rm = TRUE) + scale_color_manual(values = c("#377eb8", "#4daf4a", "#984ea3", "#ff7f00", "#e41a1c")) + scale_x_continuous(breaks = round(seq(0, 40, by = 4)), limits = c(0,40)) + scale_y_continuous(breaks = round(seq(-160,0, by = 20)), limits = c(-160,0)) + ylab("Déficit hydrique (mm)") + ggtitle("Déficit hydrique (Station Ernage, Belgique)") + theme(panel.background = element_rect(fill = NA), panel.border = element_rect(color = "black", fill = NA), legend.justification = c(0, 0), legend.position = c(0.01, 0.02), legend.background = element_rect(color = "black")) if (int == FALSE) { return(plot) }else { return(plotly::ggplotly(plot)) } }
/R/dhw_plot.R
no_license
pokyah/defHydWal
R
false
false
1,082
r
#' @title plot the deficit hydrique from Ernage data for the period of interest #' @param data dataframe #' @param int boolean #' @import ggplot2 #' @return ggplot graph #' @export dhw_plot <- function(data, int){ plot = ggplot(data, aes(x = Décade, y = Déficit)) + geom_line(aes(color = Année), na.rm = TRUE) + geom_point(aes(color = Année, shape = Année), na.rm = TRUE) + scale_color_manual(values = c("#377eb8", "#4daf4a", "#984ea3", "#ff7f00", "#e41a1c")) + scale_x_continuous(breaks = round(seq(0, 40, by = 4)), limits = c(0,40)) + scale_y_continuous(breaks = round(seq(-160,0, by = 20)), limits = c(-160,0)) + ylab("Déficit hydrique (mm)") + ggtitle("Déficit hydrique (Station Ernage, Belgique)") + theme(panel.background = element_rect(fill = NA), panel.border = element_rect(color = "black", fill = NA), legend.justification = c(0, 0), legend.position = c(0.01, 0.02), legend.background = element_rect(color = "black")) if (int == FALSE) { return(plot) }else { return(plotly::ggplotly(plot)) } }
#' @name nh_analysis_generateR #' @title NewHybrids analysis file maker #' #' @description \code{nh_analysis_GenerateR} Merges simulated genotypes with the genotypes of unknown/experimental individuals, producing a file to be analyzed by NewHybrids. Will also output a dataframe containing the names of the individuals (including those that were simulated) in the NewHybrids formatted file. #' @param ReferencePopsData A file path to a either a NewHybrids or GENEPOP formatted file containing genotypes from the simulated ancestral populations. This can be the result of any of the freqbasedsim functions, or a file created using the function genepop_newhybrids from the package genepopedit #' @param UnknownIndivs A file path to a file containing the genotypes of the individuals to be analyzed for possible hybrid ancestry. This can either be a genepop format file, or a NewHybrids format file. Note - the number of loci and the names of the loci in ReferencePopsData and UnknownIndivs must be the same #' @param sim.pops.include Optional character vector list denoting which hybrid categories from the simulatedd data should be included in the output. The default is Pure Population 1 and Pure Population 2. #' @param outputName A character vector to be applied as the name of the output. #' @export #' @importFrom genepopedit subset_genepop genepop_flatten genepop_detective subset_genepop_aggregate #' @importFrom stringr str_split str_detect #' @import plyr nh_analysis_generateR <- function(ReferencePopsData, UnknownIndivs, sim.pops.include = c("Pure1", "Pure2"), output.name){ ### read in the simulated data sim.file <- read.table(ReferencePopsData, header = FALSE, sep = "\t", stringsAsFactors = FALSE) path.start <- getwd() ## check if the simulated data is GENEPOP or NewHybrids format. This will make a difference. header.sim <- sim.file[1,] ## if it is genepop, it will have a single entry in the first position if(str_detect(string = header.sim, pattern = "NumIndivs")==FALSE){ cats <- genepopedit::genepop_detective(GenePop = ReferencePopsData) ### get the names of the populations -- not sure if strictly needed - ask Ryan if can use numeric pop ID writeLines("GENEPOP format detected for SIMULATED DATA. Assuming hybrid category order = Pure 1, Pure 2, F1, F2, Back Cross to Pure 1, Back Cross to Pure 2") ### warn that assuming this order pop.no.convert <- c("Pure1", "Pure2", "F1", "F2", "BC1", "BC2") ### make a dataframe that matches up to the order of hybrid categories assumed inds.get <- which(pop.no.convert %in% sim.pops.include) ### numeric value of which pops assumed match those requested genepopedit::subset_genepop(GenePop = ReferencePopsData, keep = TRUE, sPop = inds.get, path = paste0(path.start, "/", "sim.subset.txt")) ## subset sim.inds.include <- genepopedit::genepop_flatten(GenePop = paste0(path.start, "/", "sim.subset.txt")) ### read back in and flatten sim.inds.include <- sim.inds.include[,-c(2,3)] file.remove(paste0(path.start, "/", "sim.subset.txt")) ### remove the file that was made by subset_genepop sim.inds.include.vector <- sim.inds.include[,1] ### get a vector of individual IDs sim.inds.Loci <- colnames(sim.inds.include) } ## if the input file is NewHybrids format, it should have two items in the first row if(str_detect(string = header.sim, pattern = "NumIndivs")==TRUE){ sim.file <- read.table(ReferencePopsData, header = FALSE, skip = 4, stringsAsFactors = FALSE) ## read it in, but skip the first 4 rows because these are not needed - makes a flattened DF sim.inds.Loci <- sim.file[1,] ### the first row will ahve the loci names, sim.file <- sim.file[-1,] ## remove the loci names colnames(sim.file) <- sim.inds.Loci ## add them back in as column names NHResultsDir_Split <- unlist(str_split(string = ReferencePopsData, pattern = "/")) ### need to get the directory in which the file is so can get the idnvidual file to get the number of inds in each cat NHResultsDir_Split <- NHResultsDir_Split[-grep(x = NHResultsDir_Split, pattern = ".txt")] NHResultsDir <- paste0(paste(NHResultsDir_Split, collapse = "/"), "/") get.files.list <- list.files(NHResultsDir) indiv.file <- read.table(paste0(NHResultsDir, "/", get.files.list[grep(x = get.files.list, pattern = "individuals")])) ## read in the individual file Output <- n_class(x = paste0(NHResultsDir, "/", get.files.list[grep(x = get.files.list, pattern = "individuals")])) ## get the # of inds in each cat ### Need to determine the range of rows that represent each hybrid category, the subset the requested individuals Pure1 <- Output[1,2] Pure2 <- Output[2,2] F1 <- Output[3,2] F2 <- Output[4,2] BC1 <- Output[5,2] BC2 <- Output[6,2] Pure1.inds <- 1:Pure1 Pure2.inds <- (Pure1 + 1):(Pure1 + Pure2) F1.inds <- (Pure1 + Pure2 + 1):(Pure1 + Pure2 + F1) F2.inds <- (Pure1 + Pure2 + F1 + 1):(Pure1 + Pure2 + F1 + F2) BC1.inds <- (Pure1 + Pure2 + F1 + F2 + 1):(Pure1 + Pure2 + F1 + F2 + BC1) BC2.inds <- (Pure1 + Pure2 + F1 + F2 + BC1 + 1):sum(Output$n) pop.location.vec <- list(Pure1.inds, Pure2.inds, F1.inds, F2.inds, BC1.inds, BC2.inds) Output$Class <- c("Pure1", "Pure2", "F1", "F2", "BC1", "BC2") inds.get <- which(Output$Class %in% sim.pops.include) inds.get.subset.vec <- unlist(pop.location.vec[inds.get]) sim.inds.include <- sim.file[inds.get.subset.vec,] sim.inds.include.vector <- indiv.file[inds.get.subset.vec, 1] } ## END IF Simulated data is NH format ### end of input section for simulated data ### meow read in the unknown/experimental data ## as was done for the simulated data, need to check if entry is a NewHybrids or GENEPOP format file unknown.file <- read.table(UnknownIndivs, header = FALSE, sep = "\t", stringsAsFactors = FALSE) header.unknown <- unknown.file[1,] if(stringr::str_detect(string = header.unknown, pattern = "NumIndivs")==FALSE){ ### if a GenePop format file then will have a single entry in the first row unknown.indivs.exist <- genepopedit::genepop_detective(GenePop = UnknownIndivs, variable = "Inds") ## get a list of individuals pops.exist <- genepopedit::genepop_detective(GenePop = UnknownIndivs) ## ag.frame <- data.frame(Exits=pops.exist, ag.to = rep("Pop1", times = length(pops.exist))) genepopedit::subset_genepop_aggregate(GenePop = UnknownIndivs, keep = TRUE, agPopFrame = ag.frame, path = paste0(path.start, "/", "unknown.agged.txt")) unknown.flattened <- genepopedit::genepop_flatten(GenePop = paste0(path.start, "/", "unknown.agged.txt")) unknown.flattened <- unknown.flattened[,-c(2,3)] unknown.inds.include <- unknown.flattened unknown.Loci <- colnames(unknown.flattened) file.remove(paste0(path.start, "/", "unknown.agged.txt")) } #### if it is a NewHybrids format file if(stringr::str_detect(string = header.unknown, pattern = "NumIndivs")==TRUE){ unknown.file <- read.table(UnknownIndivs, header = FALSE, skip = 4, stringsAsFactors = FALSE) ## skip the first 4 lines, will build these after anyways unknown.Loci <- unknown.file[1,] ## the loci are in the first row unknown.file <- unknown.file[-1,] ### remove the first row, these are the loci names - not needed here colnames(unknown.file) <- unknown.Loci ## now make them the column names unknown.inds.include <- unknown.file ### data to include ## if the data are read in as a NH file, then there should be an associated individual file - modify the path to the NH file to get the individual file NHResultsDir_Split <- unlist(stringr::str_split(string = ReferencePopsData, pattern = "/")) NHResultsDir_Split <- NHResultsDir_Split[-grep(x = NHResultsDir_Split, pattern = ".txt")] NHResultsDir <- paste0(paste(NHResultsDir_Split, collapse = "/"), "/") get.files.list <- list.files(NHResultsDir) unknown.indivs.exist <- as.matrix(read.table(paste0(NHResultsDir, "/", get.files.list[grep(x = get.files.list, pattern = "individuals")]))) ### hold the individual file to appened to teh simulated individuals Output <- n_class(x = paste0(NHResultsDir, "/", get.files.list[grep(x = get.files.list, pattern = "individuals")])) ## also want to have the numbers of individuals in each population } ### error check that the simulated individuals and the unknown individuals have the same number of alleles - if not, fail and return error message if(length(setdiff(unknown.Loci[-1], sim.inds.Loci[-1])) > 0){stop("The Simulated and Unknown datasets must contain the same marker names.")} ### indivs.in.dataset <- c(as.character(sim.inds.include.vector), unknown.indivs.exist) insertNumIndivs <- paste("NumIndivs", length(indivs.in.dataset)) insertNumLoci <- paste("NumLoci", length(sim.inds.Loci[-1])) ## will probably have to be -1 ### hard coded stuff insertDigits <- "Digits 3" insertFormat <- "Format Lumped" LociNames <- paste(sim.inds.Loci[-1], collapse = " ") insertLociName <- paste("LocusNames", LociNames) insert.meta.data <- c(insertNumIndivs, insertNumLoci, insertDigits, insertFormat, insertLociName) sim.unknown.combined <- rbind(sim.inds.include[,-1], unknown.inds.include[,-1]) sim.ind.renameforNH <- c(1:nrow(sim.unknown.combined)) sim.unknown.combined <- data.frame(sim.ind.renameforNH, sim.unknown.combined) sim.unknown.output <- do.call(paste, c(data.frame(sim.unknown.combined[,]), sep = " ")) data.out <- c(insert.meta.data, sim.unknown.output) write(x = data.out, file = output.name) indivs.out.file <- gsub(x = output.name, pattern = ".txt", replacement = "") indivs.out.file <- paste0(indivs.out.file, "_individuals.txt") write(x = indivs.in.dataset, file = indivs.out.file) }
/R/nh_analysis_GenerateR.R
no_license
anne-laureferchaud/hybriddetective
R
false
false
9,814
r
#' @name nh_analysis_generateR #' @title NewHybrids analysis file maker #' #' @description \code{nh_analysis_GenerateR} Merges simulated genotypes with the genotypes of unknown/experimental individuals, producing a file to be analyzed by NewHybrids. Will also output a dataframe containing the names of the individuals (including those that were simulated) in the NewHybrids formatted file. #' @param ReferencePopsData A file path to a either a NewHybrids or GENEPOP formatted file containing genotypes from the simulated ancestral populations. This can be the result of any of the freqbasedsim functions, or a file created using the function genepop_newhybrids from the package genepopedit #' @param UnknownIndivs A file path to a file containing the genotypes of the individuals to be analyzed for possible hybrid ancestry. This can either be a genepop format file, or a NewHybrids format file. Note - the number of loci and the names of the loci in ReferencePopsData and UnknownIndivs must be the same #' @param sim.pops.include Optional character vector list denoting which hybrid categories from the simulatedd data should be included in the output. The default is Pure Population 1 and Pure Population 2. #' @param outputName A character vector to be applied as the name of the output. #' @export #' @importFrom genepopedit subset_genepop genepop_flatten genepop_detective subset_genepop_aggregate #' @importFrom stringr str_split str_detect #' @import plyr nh_analysis_generateR <- function(ReferencePopsData, UnknownIndivs, sim.pops.include = c("Pure1", "Pure2"), output.name){ ### read in the simulated data sim.file <- read.table(ReferencePopsData, header = FALSE, sep = "\t", stringsAsFactors = FALSE) path.start <- getwd() ## check if the simulated data is GENEPOP or NewHybrids format. This will make a difference. header.sim <- sim.file[1,] ## if it is genepop, it will have a single entry in the first position if(str_detect(string = header.sim, pattern = "NumIndivs")==FALSE){ cats <- genepopedit::genepop_detective(GenePop = ReferencePopsData) ### get the names of the populations -- not sure if strictly needed - ask Ryan if can use numeric pop ID writeLines("GENEPOP format detected for SIMULATED DATA. Assuming hybrid category order = Pure 1, Pure 2, F1, F2, Back Cross to Pure 1, Back Cross to Pure 2") ### warn that assuming this order pop.no.convert <- c("Pure1", "Pure2", "F1", "F2", "BC1", "BC2") ### make a dataframe that matches up to the order of hybrid categories assumed inds.get <- which(pop.no.convert %in% sim.pops.include) ### numeric value of which pops assumed match those requested genepopedit::subset_genepop(GenePop = ReferencePopsData, keep = TRUE, sPop = inds.get, path = paste0(path.start, "/", "sim.subset.txt")) ## subset sim.inds.include <- genepopedit::genepop_flatten(GenePop = paste0(path.start, "/", "sim.subset.txt")) ### read back in and flatten sim.inds.include <- sim.inds.include[,-c(2,3)] file.remove(paste0(path.start, "/", "sim.subset.txt")) ### remove the file that was made by subset_genepop sim.inds.include.vector <- sim.inds.include[,1] ### get a vector of individual IDs sim.inds.Loci <- colnames(sim.inds.include) } ## if the input file is NewHybrids format, it should have two items in the first row if(str_detect(string = header.sim, pattern = "NumIndivs")==TRUE){ sim.file <- read.table(ReferencePopsData, header = FALSE, skip = 4, stringsAsFactors = FALSE) ## read it in, but skip the first 4 rows because these are not needed - makes a flattened DF sim.inds.Loci <- sim.file[1,] ### the first row will ahve the loci names, sim.file <- sim.file[-1,] ## remove the loci names colnames(sim.file) <- sim.inds.Loci ## add them back in as column names NHResultsDir_Split <- unlist(str_split(string = ReferencePopsData, pattern = "/")) ### need to get the directory in which the file is so can get the idnvidual file to get the number of inds in each cat NHResultsDir_Split <- NHResultsDir_Split[-grep(x = NHResultsDir_Split, pattern = ".txt")] NHResultsDir <- paste0(paste(NHResultsDir_Split, collapse = "/"), "/") get.files.list <- list.files(NHResultsDir) indiv.file <- read.table(paste0(NHResultsDir, "/", get.files.list[grep(x = get.files.list, pattern = "individuals")])) ## read in the individual file Output <- n_class(x = paste0(NHResultsDir, "/", get.files.list[grep(x = get.files.list, pattern = "individuals")])) ## get the # of inds in each cat ### Need to determine the range of rows that represent each hybrid category, the subset the requested individuals Pure1 <- Output[1,2] Pure2 <- Output[2,2] F1 <- Output[3,2] F2 <- Output[4,2] BC1 <- Output[5,2] BC2 <- Output[6,2] Pure1.inds <- 1:Pure1 Pure2.inds <- (Pure1 + 1):(Pure1 + Pure2) F1.inds <- (Pure1 + Pure2 + 1):(Pure1 + Pure2 + F1) F2.inds <- (Pure1 + Pure2 + F1 + 1):(Pure1 + Pure2 + F1 + F2) BC1.inds <- (Pure1 + Pure2 + F1 + F2 + 1):(Pure1 + Pure2 + F1 + F2 + BC1) BC2.inds <- (Pure1 + Pure2 + F1 + F2 + BC1 + 1):sum(Output$n) pop.location.vec <- list(Pure1.inds, Pure2.inds, F1.inds, F2.inds, BC1.inds, BC2.inds) Output$Class <- c("Pure1", "Pure2", "F1", "F2", "BC1", "BC2") inds.get <- which(Output$Class %in% sim.pops.include) inds.get.subset.vec <- unlist(pop.location.vec[inds.get]) sim.inds.include <- sim.file[inds.get.subset.vec,] sim.inds.include.vector <- indiv.file[inds.get.subset.vec, 1] } ## END IF Simulated data is NH format ### end of input section for simulated data ### meow read in the unknown/experimental data ## as was done for the simulated data, need to check if entry is a NewHybrids or GENEPOP format file unknown.file <- read.table(UnknownIndivs, header = FALSE, sep = "\t", stringsAsFactors = FALSE) header.unknown <- unknown.file[1,] if(stringr::str_detect(string = header.unknown, pattern = "NumIndivs")==FALSE){ ### if a GenePop format file then will have a single entry in the first row unknown.indivs.exist <- genepopedit::genepop_detective(GenePop = UnknownIndivs, variable = "Inds") ## get a list of individuals pops.exist <- genepopedit::genepop_detective(GenePop = UnknownIndivs) ## ag.frame <- data.frame(Exits=pops.exist, ag.to = rep("Pop1", times = length(pops.exist))) genepopedit::subset_genepop_aggregate(GenePop = UnknownIndivs, keep = TRUE, agPopFrame = ag.frame, path = paste0(path.start, "/", "unknown.agged.txt")) unknown.flattened <- genepopedit::genepop_flatten(GenePop = paste0(path.start, "/", "unknown.agged.txt")) unknown.flattened <- unknown.flattened[,-c(2,3)] unknown.inds.include <- unknown.flattened unknown.Loci <- colnames(unknown.flattened) file.remove(paste0(path.start, "/", "unknown.agged.txt")) } #### if it is a NewHybrids format file if(stringr::str_detect(string = header.unknown, pattern = "NumIndivs")==TRUE){ unknown.file <- read.table(UnknownIndivs, header = FALSE, skip = 4, stringsAsFactors = FALSE) ## skip the first 4 lines, will build these after anyways unknown.Loci <- unknown.file[1,] ## the loci are in the first row unknown.file <- unknown.file[-1,] ### remove the first row, these are the loci names - not needed here colnames(unknown.file) <- unknown.Loci ## now make them the column names unknown.inds.include <- unknown.file ### data to include ## if the data are read in as a NH file, then there should be an associated individual file - modify the path to the NH file to get the individual file NHResultsDir_Split <- unlist(stringr::str_split(string = ReferencePopsData, pattern = "/")) NHResultsDir_Split <- NHResultsDir_Split[-grep(x = NHResultsDir_Split, pattern = ".txt")] NHResultsDir <- paste0(paste(NHResultsDir_Split, collapse = "/"), "/") get.files.list <- list.files(NHResultsDir) unknown.indivs.exist <- as.matrix(read.table(paste0(NHResultsDir, "/", get.files.list[grep(x = get.files.list, pattern = "individuals")]))) ### hold the individual file to appened to teh simulated individuals Output <- n_class(x = paste0(NHResultsDir, "/", get.files.list[grep(x = get.files.list, pattern = "individuals")])) ## also want to have the numbers of individuals in each population } ### error check that the simulated individuals and the unknown individuals have the same number of alleles - if not, fail and return error message if(length(setdiff(unknown.Loci[-1], sim.inds.Loci[-1])) > 0){stop("The Simulated and Unknown datasets must contain the same marker names.")} ### indivs.in.dataset <- c(as.character(sim.inds.include.vector), unknown.indivs.exist) insertNumIndivs <- paste("NumIndivs", length(indivs.in.dataset)) insertNumLoci <- paste("NumLoci", length(sim.inds.Loci[-1])) ## will probably have to be -1 ### hard coded stuff insertDigits <- "Digits 3" insertFormat <- "Format Lumped" LociNames <- paste(sim.inds.Loci[-1], collapse = " ") insertLociName <- paste("LocusNames", LociNames) insert.meta.data <- c(insertNumIndivs, insertNumLoci, insertDigits, insertFormat, insertLociName) sim.unknown.combined <- rbind(sim.inds.include[,-1], unknown.inds.include[,-1]) sim.ind.renameforNH <- c(1:nrow(sim.unknown.combined)) sim.unknown.combined <- data.frame(sim.ind.renameforNH, sim.unknown.combined) sim.unknown.output <- do.call(paste, c(data.frame(sim.unknown.combined[,]), sep = " ")) data.out <- c(insert.meta.data, sim.unknown.output) write(x = data.out, file = output.name) indivs.out.file <- gsub(x = output.name, pattern = ".txt", replacement = "") indivs.out.file <- paste0(indivs.out.file, "_individuals.txt") write(x = indivs.in.dataset, file = indivs.out.file) }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/toy.R \name{toy_example} \alias{toy_example} \title{Access to toy examples bundled in this package} \usage{ toy_example(name = NULL) } \arguments{ \item{name}{Name of the example, default: return all} } \value{ A named vector of file system paths. } \description{ Returns the paths to all available toy examples, or to a specific toy example. Load via \code{\link[=readRDS]{readRDS()}}. }
/man/toy_example.Rd
no_license
castillag/MultiLevelIPF
R
false
true
468
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/toy.R \name{toy_example} \alias{toy_example} \title{Access to toy examples bundled in this package} \usage{ toy_example(name = NULL) } \arguments{ \item{name}{Name of the example, default: return all} } \value{ A named vector of file system paths. } \description{ Returns the paths to all available toy examples, or to a specific toy example. Load via \code{\link[=readRDS]{readRDS()}}. }
## Phantom - Data ## Phantom - VMatrix PhantomCoreBase <- CoreBuilder(ActSkills=c("Joker", "BlackJack", "MarkofPhantom", "LiftBreak", CommonV("Thief", "Heroes")[2:5]), ActSkillsLv=c(25, 25, 25, 25, 25, 1, 25, 25), UsefulSkills=c("SharpEyes", "CombatOrders"), SpecSet=get(DPMCalcOption$SpecSet), VPassiveList=PhantomVPassive, VPassivePrior=PhantomVPrior, SelfBind=F) PhantomCore <- MatrixSet(PasSkills=PhantomCoreBase$PasSkills$Skills, PasLvs=PhantomCoreBase$PasSkills$Lv, PasMP=PhantomCoreBase$PasSkills$MP, ActSkills=PhantomCoreBase$ActSkills$Skills, ActLvs=PhantomCoreBase$ActSkills$Lv, ActMP=PhantomCoreBase$ActSkills$MP, UsefulSkills=PhantomCoreBase$UsefulSkills, UsefulLvs=20, UsefulMP=0, SpecSet=get(DPMCalcOption$SpecSet), SpecialCore=PhantomCoreBase$SpecialCoreUse) ## Phantom - Basic Info PhantomBase <- JobBase(ChrInfo=ChrInfo, MobInfo=get(DPMCalcOption$MobSet), SpecSet=get(DPMCalcOption$SpecSet), Job="Phantom", CoreData=PhantomCore, BuffDurationNeeded=57, AbilList=FindJob(get(paste(DPMCalcOption$SpecSet, "Ability", sep="")), "Phantom"), LinkList=FindJob(get(paste(DPMCalcOption$SpecSet, "Link", sep="")), "Phantom"), MonsterLife=get(FindJob(MonsterLifePreSet, "Phantom")[DPMCalcOption$MonsterLifeLevel][1, 1]), Weapon=WeaponUpgrade(1, DPMCalcOption$WeaponSF, 4, 0, 0, 0, 0, 3, 0, 0, "Cane", get(DPMCalcOption$SpecSet)$WeaponType)[, 1:16], WeaponType=get(DPMCalcOption$SpecSet)$WeaponType, SubWeapon=SubWeapon[rownames(SubWeapon)=="Card", ], Emblem=Emblem[rownames(Emblem)=="Heroes", ], CoolReduceHat=as.logical(FindJob(get(paste(DPMCalcOption$SpecSet, "CoolReduceHat", sep="")), "Phantom"))) ## Phantom - Passive {option <- factor(c("SubStat1"), levels=PSkill) value <- c(40) HighDexterity <- data.frame(option, value) option <- factor(c("MainStat"), levels=PSkill) value <- c(60) LuckMonopoly <- data.frame(option, value) option <- factor(c("ATKSpeed", "MainStat"), levels=PSkill) value <- c(2, 20) CaneAcceleration <- data.frame(option, value) option <- factor(c("MainStat"), levels=PSkill) value <- c(60) LuckofPhantomThief <- data.frame(option, value) option <- factor(c("ATK"), levels=PSkill) value <- c(40) MoonLight <- data.frame(option, value) option <- factor(c("FDR", "CRR"), levels=PSkill) value <- c(30, 35) AcuteSense <- data.frame(option, value) option <- factor(c("BDR", "IGR"), levels=PSkill) value <- c(30 + PhantomBase$PSkillLv, 30 + PhantomBase$PSkillLv) PrayofAria <- data.frame(option, value) option <- factor(c("Mastery", "ATK", "CDMR", "FDR"), levels=PSkill) value <- c(70 + ceiling(PhantomBase$PSkillLv/2), 40 + PhantomBase$PSkillLv, 15, 25 + floor(PhantomBase$PSkillLv/2)) CaneExpert <- data.frame(option, value) option <- factor(c("ATK"), levels=PSkill) value <- c(GetCoreLv(PhantomCore, "ReadyToDie")) ReadytoDiePassive <- data.frame(option, value) option <- factor(c("ATK"), levels=PSkill) value <- c(GetCoreLv(PhantomCore, "Blink")) BlinkPassive <- data.frame(option, value) option <- factor(c("MainStat", "SubStat1"), levels=PSkill) value <- c(rep(GetCoreLv(PhantomCore, "RopeConnect"), 2)) RopeConnectPassive <- data.frame(option, value)} PhantomPassive <- Passive(list(HighDexterity=HighDexterity, LuckMonopoly=LuckMonopoly, CaneAcceleration=CaneAcceleration, LuckofPhantomThief=LuckofPhantomThief, MoonLight=MoonLight, AcuteSense=AcuteSense, PrayofAria=PrayofAria, CaneExpert=CaneExpert, ReadytoDiePassive=ReadytoDiePassive, BlinkPassive=BlinkPassive, RopeConnectPassive=RopeConnectPassive)) ## Phantom - Buff {option <- factor("ATK", levels=BSkill) value <- c(30) info <- c(180 * (100 + PhantomBase$BuffDurationNeeded + 10) / 100, NA, 0, F, NA, NA, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") Fury <- rbind(data.frame(option, value), info) option <- factor("FDR", levels=BSkill) value <- c(20) info <- c(200 * (100 + PhantomBase$BuffDurationNeeded + 10) / 100, NA, 0, F, NA, NA, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") CrossOverChain <- rbind(data.frame(option, value), info) option <- factor("MainStat", levels=BSkill) value <- c(floor((PhantomBase$ChrLv * 5 + 18) * (0.15 + 0.01 * ceiling(PhantomBase$SkillLv/2)))) info <- c(900 + 30 * PhantomBase$SkillLv, NA, 0, T, NA, NA, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") MapleSoldier <- rbind(data.frame(option, value), info) option <- factor("FDR", levels=BSkill) value <- c(40 + PhantomBase$SkillLv) info <- c(60 * (100 + PhantomBase$BuffDurationNeeded + 10) / 100, 90, 0, F, NA, NA, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") FinalCutBuff <- rbind(data.frame(option, value), info) option <- factor(c("IGR"), levels=BSkill) value <- c(20 + floor(PhantomBase$SkillLv/2)) info <- c(15, 240, 0, F, NA, NA, F) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") TwilightDebuff <- rbind(data.frame(option, value), info) option <- factor("BDR", levels=BSkill) value <- c(5) info <- c(120, 120, 0, F, F, F, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") HeroesOath <- rbind(data.frame(option, value), info) option <- factor(c("CRR", "CDMR", "IGR", "BDR"), levels=BSkill) value <- c(20, 10, 20, 20) info <- c(30, 180, 960, F, F, F, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") Bullseye <- rbind(data.frame(option, value), info) Useful <- UsefulSkills(PhantomCore) UsefulSharpEyes <- Useful$UsefulSharpEyes UsefulCombatOrders <- Useful$UsefulCombatOrders if(sum(names(Useful)=="UsefulAdvancedBless") >= 1) { UsefulAdvancedBless <- Useful$UsefulAdvancedBless } option <- factor(c("FDR"), levels=BSkill) value <- c(ceiling(GetCoreLv(PhantomCore, "Joker")/5)) info <- c(30, 150, 1620, F, T, F, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") JokerBuff <- rbind(data.frame(option, value), info) option <- factor(levels=BSkill) value <- c() info <- c(30, 150, 1620, F, T, F, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") JokerBuffFail <- rbind(data.frame(option, value), info) option <- factor("FDR", levels=BSkill) value <- c(10 + floor(GetCoreLv(PhantomCore, "ReadyToDie")/10)) info <- c(30, 90 - floor(GetCoreLv(PhantomCore, "ReadyToDie")/2), 780, F, T, F, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") ReadyToDie1Stack <- rbind(data.frame(option, value), info) option <- factor("FDR", levels=BSkill) value <- c(30 + floor(GetCoreLv(PhantomCore, "ReadyToDie")/5)) info <- c((30 - 0.78)/2 + 0.78, 90 - floor(GetCoreLv(PhantomCore, "ReadyToDie")/2), 1560, F, T, F, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") ReadyToDie2Stack <- rbind(data.frame(option, value), info) option <- factor(c("MainStat", "BDR"), levels=BSkill) value <- c(floor(((1 + 0.1 * GetCoreLv(PhantomCore, "MapleWarriors2")) * MapleSoldier[1, 2]) * PhantomBase$MainStatP), 5 + floor(GetCoreLv(PhantomCore, "MapleWarriors2")/2)) info <- c(60, 180, 630, F, T, F, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") MapleWarriors2 <- rbind(data.frame(option, value), info) option <- factor(levels=BSkill) value <- c() info <- c(0, 1, 0, F, F, F, F) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") NoirCarteStack <- rbind(data.frame(option, value), info)} PhantomBuff <- list(Fury=Fury, CrossOverChain=CrossOverChain, MapleSoldier=MapleSoldier, FinalCutBuff=FinalCutBuff, TwilightDebuff=TwilightDebuff, HeroesOath=HeroesOath, Bullseye=Bullseye, UsefulSharpEyes=UsefulSharpEyes, UsefulCombatOrders=UsefulCombatOrders, JokerBuff=JokerBuff, JokerBuffFail=JokerBuffFail, ReadyToDie1Stack=ReadyToDie1Stack, ReadyToDie2Stack=ReadyToDie2Stack, MapleWarriors2=MapleWarriors2, NoirCarteStack=NoirCarteStack, Restraint4=Restraint4, SoulContractLink=SoulContractLink) if(sum(names(Useful)=="UsefulAdvancedBless") >= 1) { PhantomBuff[[length(PhantomBuff)+1]] <- UsefulAdvancedBless names(PhantomBuff)[[length(PhantomBuff)]] <- "UsefulAdvancedBless" } PhantomBuff <- Buff(PhantomBuff) PhantomAllTimeBuff <- AllTimeBuff(PhantomBuff) ## PetBuff : Fury(1080ms), CrossOverChain(720ms), MapleSoldier(0ms), UsefulCombatOrders(1500ms), UsefulSharpEyes(900ms), (UsefulAdvancedBless) ## Phantom - Union & HyperStat & SoulWeapon PhantomSpec <- JobSpec(JobBase=PhantomBase, Passive=PhantomPassive, AllTimeBuff=PhantomAllTimeBuff, MobInfo=get(DPMCalcOption$MobSet), SpecSet=get(DPMCalcOption$SpecSet), WeaponName="Cane", UnionStance=0) PhantomUnionRemained <- PhantomSpec$UnionRemained PhantomHyperStatBase <- PhantomSpec$HyperStatBase PhantomCoolReduceType <- PhantomSpec$CoolReduceType PhantomSpec <- PhantomSpec$Spec ## Phantom - Spider In Mirror SIM <- SIMData(GetCoreLv(PhantomCore, "SpiderInMirror")) SpiderInMirror <- SIM$SpiderInMirror SpiderInMirrorStart <- SIM$SpiderInMirrorStart SpiderInMirror1 <- SIM$SpiderInMirror1 SpiderInMirror2 <- SIM$SpiderInMirror2 SpiderInMirror3 <- SIM$SpiderInMirror3 SpiderInMirror4 <- SIM$SpiderInMirror4 SpiderInMirror5 <- SIM$SpiderInMirror5 SpiderInMirrorWait <- SIM$SpiderInMirrorWait ## Phantom - Attacks {option <- factor(c("IGR", "BDR", "FDR"), levels=ASkill) value <- c(IGRCalc(c(20, ifelse(GetCoreLv(PhantomCore, "UltimateDrive")>=40, 20, 0))), 20, 2 * GetCoreLv(PhantomCore, "UltimateDrive")) info <- c(140 + PhantomSpec$SkillLv, 3, 150, NA, NA, NA, NA, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") UltimateDrive <- rbind(data.frame(option, value), info) option <- factor(c("IGR", "BDR", "FDR"), levels=ASkill) value <- c(ifelse(GetCoreLv(PhantomCore, "TempestofCard")>=40, 20, 0), 20, 2 * GetCoreLv(PhantomCore, "TempestofCard")) info <- c(200 + 2 * PhantomSpec$SkillLv, 3, 10000, 180, 10 + Cooldown(18, T, 20 + PhantomSpec$CoolReduceP, PhantomSpec$CoolReduce), F, T, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") TempestofCard <- rbind(data.frame(option, value), info) option <- factor(c("IGR", "FDR"), levels=ASkill) value <- c(ifelse(GetCoreLv(PhantomCore, "NoirCarte")>=40, 20, 0), 2 * GetCoreLv(PhantomCore, "NoirCarte")) info <- c(270, 1, 0, NA, NA, NA, NA, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") NoirCarte <- rbind(data.frame(option, value), info) option <- factor(c("IGR", "FDR"), levels=ASkill) value <- c(ifelse(GetCoreLv(PhantomCore, "NoirCarte")>=40, 20, 0), 2 * GetCoreLv(PhantomCore, "NoirCarte")) info <- c(270, 10, 0, NA, NA, NA, NA, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") NoirCarteJudgement <- rbind(data.frame(option, value), info) option <- factor(c("IGR", "FDR"), levels=ASkill) value <- c(ifelse(GetCoreLv(PhantomCore, "Twilight")>=40, 20, 0), 2 * GetCoreLv(PhantomCore, "Twilight")) info <- c(450 + 3 * PhantomBase$SkillLv, 3, 180, NA, NA, NA, NA, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") Twilight1 <- rbind(data.frame(option, value), info) option <- factor(levels=ASkill) value <- c() info <- c(0, 0, 540, NA, NA, NA, NA, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") Twilight2 <- rbind(data.frame(option, value), info) option <- factor(c("IGR", "FDR"), levels=ASkill) value <- c(ifelse(GetCoreLv(PhantomCore, "RoseCarteFinale")>=40, 20, 0), 2 * GetCoreLv(PhantomCore, "RoseCarteFinale")) info <- c(700, 6, 1200, NA, 30, F, F, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") RoseCarteFinale <- rbind(data.frame(option, value), info) option <- factor(c("IGR", "FDR"), levels=ASkill) value <- c(ifelse(GetCoreLv(PhantomCore, "RoseCarteFinale")>=40, 20, 0), 2 * GetCoreLv(PhantomCore, "RoseCarteFinale")) info <- c(200, 2, 0, 930, 30, F, F, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") RoseCarteFinaleAdd <- rbind(data.frame(option, value), info) ## 12 Hits, FirstATK : 2400 option <- factor(levels=ASkill) value <- c() info <- c(0, 0, 1000, NA, NA, NA, NA, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") FinalCutPre <- rbind(data.frame(option, value), info) option <- factor(c("IGR", "FDR"), levels=ASkill) value <- c(ifelse(GetCoreLv(PhantomCore, "TalentofPhantomThief4")>=40, 20, 0), 2 * GetCoreLv(PhantomCore, "TalentofPhantomThief4")) info <- c((2000 + 20 * PhantomSpec$SkillLv)/ 1.3 * 1.2, 1, 180, NA, NA, NA, NA, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") FinalCut <- rbind(data.frame(option, value), info) option <- factor(levels=ASkill) value <- c() info <- c(240 + 9 * GetCoreLv(PhantomCore, "Joker"), 3, 6000 + floor(GetCoreLv(PhantomCore, "Joker")/25) * 1000, 50, 150, T, F, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") Joker <- rbind(data.frame(option, value), info) option <- factor(levels=ASkill) value <- c() info <- c(600 + 24 * GetCoreLv(PhantomCore, "BlackJack"), 3, 760, 450, 15, T, F, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") BlackJack <- rbind(data.frame(option, value), info) ## FirstATK : 1200 option <- factor(levels=ASkill) value <- c() info <- c(800 + 32 * GetCoreLv(PhantomCore, "BlackJack"), 18, 0, 0, 15, T, F, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") BlackJackLast <- rbind(data.frame(option, value), info) option <- factor(levels=ASkill) value <- c() info <- c(300 + 12 * GetCoreLv(PhantomCore, "MarkofPhantom"), 6, 900, 75, 30, T, F, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") MarkofPhantom <- rbind(data.frame(option, value), info) ## FirstATK : 660 option <- factor(levels=ASkill) value <- c() info <- c(485 + 19 * GetCoreLv(PhantomCore, "MarkofPhantom"), 15, 0, 30, 30, T, F, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") MarkofPhantomFinal <- rbind(data.frame(option, value), info) ## FirstATK : 1440 option <- factor(levels=ASkill) value <- c() info <- c(400 + 16 * GetCoreLv(PhantomCore, "LiftBreak"), 7, 990, 0, 30, T, F, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") LiftBreak <- rbind(data.frame(option, value), info) ## FirstATK : 0, Delays : 270, 270, 1230, 30, 30, 30 } PhantomATK <- Attack(list(UltimateDrive=UltimateDrive, TempestofCard=TempestofCard, NoirCarte=NoirCarte, NoirCarteJudgement=NoirCarteJudgement, Twilight1=Twilight1, Twilight2=Twilight2, RoseCarteFinale=RoseCarteFinale, RoseCarteFinaleAdd=RoseCarteFinaleAdd, FinalCutPre=FinalCutPre, FinalCut=FinalCut, Joker=Joker, BlackJack=BlackJack, BlackJackLast=BlackJackLast, MarkofPhantom=MarkofPhantom, MarkofPhantomFinal=MarkofPhantomFinal, LiftBreak=LiftBreak, SpiderInMirror=SpiderInMirror)) ## Phantom - Summoned PhantomSummoned <- Summoned(list(SpiderInMirrorStart=SpiderInMirrorStart, SpiderInMirror1=SpiderInMirror1, SpiderInMirror2=SpiderInMirror2, SpiderInMirror3=SpiderInMirror3, SpiderInMirror4=SpiderInMirror4, SpiderInMirror5=SpiderInMirror5, SpiderInMirrorWait=SpiderInMirrorWait)) ## Phantom - DealCycle & Deal Calculation ATKFinal <- data.frame(PhantomATK) ATKFinal$Delay[c(-1, -2, -9, -11)] <- Delay(ATKFinal$Delay, PhantomSpec$ATKSpeed)[c(-1, -2, -9, -11)] ATKFinal$CoolTime <- Cooldown(ATKFinal$CoolTime, ATKFinal$CoolReduceAvailable, PhantomSpec$CoolReduceP, PhantomSpec$CoolReduce) BuffFinal <- data.frame(PhantomBuff) BuffFinal$CoolTime <- Cooldown(BuffFinal$CoolTime, BuffFinal$CoolReduceAvailable, PhantomSpec$CoolReduceP, PhantomSpec$CoolReduce) BuffFinal$Duration <- BuffFinal$Duration + BuffFinal$Duration * ifelse(BuffFinal$BuffDurationAvailable==T, PhantomSpec$BuffDuration / 100, 0) + ifelse(BuffFinal$ServerLag==T, General$General$Serverlag, 0) SummonedFinal <- data.frame(PhantomSummoned) SummonedFinal$CoolTime <- Cooldown(SummonedFinal$CoolTime, SummonedFinal$CoolReduceAvailable, PhantomSpec$CoolReduceP, PhantomSpec$CoolReduce) SummonedFinal$Duration <- SummonedFinal$Duration + ifelse(SummonedFinal$SummonedDurationAvailable==T, SummonedFinal$Duration * PhantomSpec$SummonedDuration / 100, 0) ## Phantom - DealCycle DealCycle <- c("Skills", "Time", rownames(PhantomBuff)) PhantomDealCycle <- t(rep(0, length(DealCycle))) colnames(PhantomDealCycle) <- DealCycle PhantomDealCycle <- data.frame(PhantomDealCycle) PhantomCycle <- function(PreDealCycle, ATKFinal, BuffFinal, SummonedFinal, Spec, Period=180, CycleTime=360) { BuffSummonedPrior <- c("Fury", "CrossOverChain", "UsefulSharpEyes", "UsefulCombatOrders", "UsefulAdvancedBless", "HeroesOath", "FinalCutBuff", "MapleWarriors2", "Bullseye", "ReadyToDie2Stack", "SoulContractLink", "Restraint4") Times180 <- c(0, 0, 0, 0, 0, 0, 2, 1, 1, 2, 2, 1) if(nrow(BuffFinal[rownames(BuffFinal)=="UsefulAdvancedBless", ]) == 0) { Times180 <- Times180[BuffSummonedPrior!="UsefulAdvancedBless"] BuffSummonedPrior <- BuffSummonedPrior[BuffSummonedPrior!="UsefulAdvancedBless"] } SubTime <- rep(Period, length(BuffSummonedPrior)) TotalTime <- CycleTime for(i in 1:length(BuffSummonedPrior)) { SubTime[i] <- SubTime[i] / ifelse(Times180[i]==0, Inf, Times180[i]) } SubTimeUniques <- unique(SubTime) SubTimeUniques <- SubTimeUniques[SubTimeUniques > 0] TimeTypes <- c() for(i in 1:length(SubTimeUniques)) { Time <- 0 ; r <- 1 while(Time < TotalTime) { Time <- SubTimeUniques[i] * r r <- r + 1 TimeTypes <- c(TimeTypes, Time) } } TimeTypes <- TimeTypes[TimeTypes < TotalTime] TimeTypes <- unique(TimeTypes) TimeTypes <- TimeTypes[order(TimeTypes)] Buffs <- data.frame(Buff=BuffSummonedPrior, SubTime=SubTime, stringsAsFactors=F) Buffs <- subset(Buffs, Buffs$SubTime > 0) BuffList <- list() BuffList[[1]] <- BuffSummonedPrior for(i in 1:length(TimeTypes)) { s <- c() for(j in 1:nrow(Buffs)) { if(round(TimeTypes[i] / Buffs[j, 2]) == TimeTypes[i] / Buffs[j, 2]) { s <- c(s, Buffs[j, 1]) } } BuffList[[i+1]] <- s } DelayDataB <- data.frame(Name=rownames(BuffFinal), Delay=BuffFinal$Delay) DelayDataS <- data.frame(Name=rownames(SummonedFinal), Delay=SummonedFinal$Delay) DelayData <- rbind(DelayDataB, DelayDataS) BuffDelays <- list() for(i in 1:length(BuffList)) { t <- c() for(j in 1:length(BuffList[[i]])) { for(k in 1:nrow(DelayData)) { if(DelayData$Name[k]==BuffList[[i]][j]) { t <- c(t, k) } } } BuffDelays[[i]] <- DelayData$Delay[t] } TotalTime <- TotalTime * 1000 DealCycle <- PreDealCycle for(i in 1:length(BuffList[[1]])) { if(sum(rownames(BuffFinal)==BuffList[[1]][i]) > 0) { if(BuffList[[1]][i]=="FinalCutBuff") { DealCycle <- DCATK(DealCycle, "FinalCutPre", ATKFinal) } DealCycle <- DCBuff(DealCycle, BuffList[[1]][i], BuffFinal) if(DealCycle$Skills[nrow(DealCycle)] == "FinalCutBuff") { DealCycle <- DCATK(DealCycle, "FinalCut", ATKFinal) } else if(DealCycle$Skills[nrow(DealCycle)] == "HeroesOath") { DealCycle <- DCATK(DealCycle, "SpiderInMirror", ATKFinal) } } else { DealCycle <- DCSummoned(DealCycle, BuffList[[1]][i], SummonedFinal) } } SubTimeList <- data.frame(Skills=BuffSummonedPrior, SubTime=SubTime, stringsAsFactors=F) NoSubTime <- subset(SubTimeList, SubTimeList$SubTime==0)$Skills NoSubTimeBuff <- c() for(i in 1:length(NoSubTime)) { NoSubTimeBuff <- c(NoSubTimeBuff, NoSubTime[i]) } ColNums <- c() for(i in 1:length(NoSubTimeBuff)) { for(j in 1:length(colnames(DealCycle))) { if(NoSubTimeBuff[i]==colnames(DealCycle)[j]) { ColNums[i] <- j } } } BuffList[[length(BuffList)+1]] <- BuffList[[1]] BuffDelays[[length(BuffDelays)+1]] <- BuffDelays[[1]] TimeTypes <- c(0, TimeTypes, TotalTime/1000) BJCool <- subset(ATKFinal, rownames(ATKFinal)=="MarkofPhantom")$CoolTime * 1000 / 2 MPCool <- subset(ATKFinal, rownames(ATKFinal)=="MarkofPhantom")$CoolTime * 1000 RCCool <- subset(ATKFinal, rownames(ATKFinal)=="RoseCarteFinale")$CoolTime * 1000 BJRemain <- 0 ; RCRemain <- 0 ; MOPDummy <- 0 ; TOCDummy <- 0 for(k in 2:length(BuffList)) { CycleBuffList <- data.frame(Skills=BuffList[[k]], Delay=BuffDelays[[k]]) BuffEndTime <- c() for(i in 1:length(BuffList[[k]])) { a <- subset(DealCycle, BuffList[[k]][i]==DealCycle$Skills) a <- rbind(a, subset(DealCycle, paste(BuffList[[k]][i], "Summoned", sep="")==DealCycle$Skills)) for(j in 1:nrow(CycleBuffList)) { if(CycleBuffList$Skills[j]==BuffList[[k]][i]) { Idx <- j break } } BuffEndTime[i] <- max(a$Time) + min(subset(SubTimeList, SubTimeList$Skills==BuffList[[k]][i])$SubTime * 1000, subset(BuffFinal, rownames(BuffFinal)==BuffList[[k]][i])$CoolTime * 1000, subset(SummonedFinal, rownames(SummonedFinal)==BuffList[[k]][i])$CoolTime * 1000) + sum(CycleBuffList$Delay[Idx:nrow(CycleBuffList)]) } BuffEndTime <- max(BuffEndTime) BuffEndTime <- max(BuffEndTime, TimeTypes[k] * 1000) BuffStartTime <- BuffEndTime - sum(CycleBuffList$Delay) while(DealCycle$Time[nrow(DealCycle)] + DealCycle$Time[1] < BuffStartTime) { for(i in 1:length(ColNums)) { if(DealCycle[nrow(DealCycle), ColNums[i]] - DealCycle$Time[1] < 3000) { DealCycle <- DCBuff(DealCycle, colnames(DealCycle)[ColNums[i]], BuffFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) } } ## BlackJack, Mark of Phantom, Lift Break if(BJRemain == 0 & MOPDummy == 0 & k==length(BuffList) & DealCycle$Time[nrow(DealCycle)] + DealCycle$Time[1] + MPCool <= BuffStartTime + 8000 | BJRemain == 0 & MOPDummy == 0 & k!=length(BuffList)) { DealCycle <- DCATK(DealCycle, "BlackJack", ATKFinal) BJRemain <- BJCool - DealCycle$Time[1] RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCBuff(DealCycle, "TwilightDebuff", BuffFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCATK(DealCycle, "Twilight1", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCATK(DealCycle, "Twilight2", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCATK(DealCycle, "MarkofPhantomFinal", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCATK(DealCycle, "MarkofPhantom", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCATK(DealCycle, "LiftBreak", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) if(DealCycle$Restraint4[nrow(DealCycle)] >= 7000) { DealCycle <- DCATK(DealCycle, "Joker", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCBuff(DealCycle, "JokerBuffFail", BuffFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) TOCDummy <- 0 } else if(TOCDummy == 0 & DealCycle$Time[nrow(DealCycle)] + DealCycle$Time[1] <= BuffStartTime - 10000) { DealCycle <- DCATK(DealCycle, "TempestofCard", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) TOCDummy <- 1 } else { TOCDummy <- 0 } MOPDummy <- 1 } else if(BJRemain == 0 & MOPDummy == 1 & k==length(BuffList) & DealCycle$Time[nrow(DealCycle)] + DealCycle$Time[1] + BJCool <= BuffStartTime + 8000 | BJRemain == 0 & MOPDummy == 1 & k!=length(BuffList)) { DealCycle <- DCATK(DealCycle, "BlackJack", ATKFinal) BJRemain <- BJCool - DealCycle$Time[1] RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCBuff(DealCycle, "TwilightDebuff", BuffFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCATK(DealCycle, "Twilight1", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCATK(DealCycle, "Twilight2", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) if(DealCycle$Restraint4[nrow(DealCycle)] >= 7000) { DealCycle <- DCATK(DealCycle, "Joker", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCBuff(DealCycle, "JokerBuffFail", BuffFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) TOCDummy <- 0 } else if(TOCDummy == 0 & DealCycle$Time[nrow(DealCycle)] + DealCycle$Time[1] <= BuffStartTime - 10000) { DealCycle <- DCATK(DealCycle, "TempestofCard", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) TOCDummy <- 1 } else { TOCDummy <- 0 } MOPDummy <- 0 } ## Rose Carte Finale else if(RCRemain == 0 & DealCycle$Time[nrow(DealCycle)] + DealCycle$Time[1] <= 350000) { DealCycle <- DCATK(DealCycle, "RoseCarteFinaleAdd", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- RCCool - DealCycle$Time[1] DealCycle <- DCATK(DealCycle, "RoseCarteFinale", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) } ## Ultimate Drive else { DealCycle <- DCATK(DealCycle, c("UltimateDrive"), ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) } } if(k != length(BuffList)) { for(i in 1:length(BuffList[[k]])) { if(sum(rownames(BuffFinal)==BuffList[[k]][i]) > 0) { if(BuffList[[k]][i]=="FinalCutBuff") { DealCycle <- DCATK(DealCycle, "FinalCutPre", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) } DealCycle <- DCBuff(DealCycle, BuffList[[k]][i], BuffFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) if(DealCycle$Skills[nrow(DealCycle)] == "FinalCutBuff") { DealCycle <- DCATK(DealCycle, "FinalCut", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) } } else { DealCycle <- DCSummoned(DealCycle, BuffList[[k]][i], SummonedFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) } } } } return(DealCycle) } PhantomAddATK <- function(DealCycle, ATKFinal, BuffFinal, SummonedFinal, Spec) { ## Joker DealCycle <- RepATKCycle(DealCycle, "Joker", 140, 0, ATKFinal) ## BlackJack DealCycle <- RepATKCycle(DealCycle, "BlackJack", 7, 1200, ATKFinal) ## BlackJack (Last) BJ <- 1 for(i in 1:nrow(DealCycle)) { if(DealCycle$Skills[i]=="BlackJack") { if(BJ==7) { DealCycle$Skills[i] <- "BlackJackLast" BJ <- 1 } else { BJ <- BJ + 1 } } } ## Mark of Phantom DealCycle <- RepATKCycle(DealCycle, "MarkofPhantom", 7, 660, ATKFinal) DealCycle <- RepATKCycle(DealCycle, "MarkofPhantomFinal", 2, 1440, ATKFinal) ## Lift Break LiftBreakTime <- c(0, 270, 540, 1770, 1800, 1830, 1860) DealCycle[DealCycle$Skills=="LiftBreak", ]$Skills <- "LiftBreakStart" DC2 <- subset(DealCycle, DealCycle$Skills=="LiftBreakStart") for(i in 1:nrow(DC2)) { for(j in 1:length(LiftBreakTime)) { DC2 <- rbind(DC2, DC2[i, ]) DC2$Time[nrow(DC2)] <- DC2$Time[i] + LiftBreakTime[j] DC2$Skills[nrow(DC2)] <- "LiftBreak" } } DC2 <- subset(DC2, DC2$Skills=="LiftBreak") DC2 <- subset(DC2, DC2$Time <= max(DealCycle$Time)) DealCycle <- rbind(DealCycle, DC2) DealCycle <- DealCycle[order(DealCycle$Time), ] rownames(DealCycle) <- 1:nrow(DealCycle) for(i in 3:nrow(DealCycle)) { if("LiftBreak"==DealCycle[i, 1]) { DealCycle[i, 3:ncol(DealCycle)] <- DealCycle[i-1, 3:ncol(DealCycle)] - (DealCycle[i, 2] - DealCycle[i-1, 2]) DealCycle[i, 3:ncol(DealCycle)] <- ifelse(DealCycle[i, 3:ncol(DealCycle)]<0, 0, DealCycle[i, 3:ncol(DealCycle)]) } } ## Rose Carte Finale (AddATK) DealCycle <- RepATKCycle(DealCycle, "RoseCarteFinaleAdd", 12, 2400, ATKFinal) ## Tempest of Card DealCycle <- RepATKCycle(DealCycle, "TempestofCard", 56, 0, ATKFinal) ## Spider In Mirror DealCycle <- DCSpiderInMirror(DealCycle, SummonedFinal) ## Noir Carte DealCycle$NoirCarteStack[1] <- 0 for(i in 2:nrow(DealCycle)) { if(sum(DealCycle$Skills[i]==c("UltimateDrive", "TempestofCard", "Joker", "LiftBreak", "MarkofPhantom", "MarkofPhantomFinal", "RoseCarteFinale", "Twilight1", "FinalCut", "SpiderInMirror"))==1) { DealCycle$NoirCarteStack[i] <- DealCycle$NoirCarteStack[i-1] + 1 DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarte" if(DealCycle$NoirCarteStack[i] == 40) { DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarteJudgement" DealCycle$NoirCarteStack[i] <- 0 } } else if(DealCycle$Skills[i]=="BlackJack") { DealCycle$NoirCarteStack[i] <- DealCycle$NoirCarteStack[i-1] + 3 DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarte" DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarte" DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarte" if(DealCycle$NoirCarteStack[i] >= 40) { DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarteJudgement" DealCycle$NoirCarteStack[i] <- DealCycle$NoirCarteStack[i] - 40 } } else if(DealCycle$Skills[i]=="BlackJackLast") { DealCycle$NoirCarteStack[i] <- DealCycle$NoirCarteStack[i-1] + 3 DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarte" DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarte" DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarte" if(DealCycle$NoirCarteStack[i] >= 40) { DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarteJudgement" DealCycle$NoirCarteStack[i] <- DealCycle$NoirCarteStack[i] - 40 } } else { DealCycle$NoirCarteStack[i] <- DealCycle$NoirCarteStack[i-1] } } DealCycle <- DealCycle[order(DealCycle$Time), ] rownames(DealCycle) <- 1:nrow(DealCycle) DealCycle$NoirCarteStack <- 0 return(DealCycle) } PhantomDealCycle <- PhantomCycle(PreDealCycle=PhantomDealCycle, ATKFinal=ATKFinal, BuffFinal=BuffFinal, SummonedFinal=SummonedFinal, Spec=PhantomSpec, Period=180, CycleTime=360) PhantomDealCycle <- DealCycleFinal(PhantomDealCycle) PhantomDealCycle <- PhantomAddATK(PhantomDealCycle, ATKFinal, BuffFinal, SummonedFinal, PhantomSpec) PhantomDealCycleReduction1 <- DealCycleReduction(PhantomDealCycle) PhantomDealCycle2 <- PhantomDealCycle PhantomDealCycle2$JokerBuff <- PhantomDealCycle2$JokerBuffFail PhantomDealCycle2$JokerBuffFail <- 0 PhantomDealCycleReduction2 <- DealCycleReduction(PhantomDealCycle2) Idx1 <- c() ; Idx2 <- c() for(i in 1:length(PotentialOpt)) { if(names(PotentialOpt)[i]==DPMCalcOption$SpecSet) { Idx1 <- i } } for(i in 1:nrow(PotentialOpt[[Idx1]])) { if(rownames(PotentialOpt[[Idx1]])[i]=="Phantom") { Idx2 <- i } } if(DPMCalcOption$Optimization==T) { PhantomSpecOpt1 <- ResetOptimization1(list(PhantomDealCycleReduction1, PhantomDealCycleReduction2), ATKFinal, BuffFinal, SummonedFinal, PhantomSpec, PhantomUnionRemained, rep(max(PhantomDealCycle$Time), 2), c(0.6, 0.4)) PotentialOpt[[Idx1]][Idx2, ] <- PhantomSpecOpt1[1, 1:3] } else { PhantomSpecOpt1 <- PotentialOpt[[Idx1]][Idx2, ] } PhantomSpecOpt <- OptDataAdd(PhantomSpec, PhantomSpecOpt1, "Potential", PhantomBase$CRROver, DemonAvenger=F) if(DPMCalcOption$Optimization==T) { PhantomSpecOpt2 <- ResetOptimization2(list(PhantomDealCycleReduction1, PhantomDealCycleReduction2), ATKFinal, BuffFinal, SummonedFinal, PhantomSpecOpt, PhantomHyperStatBase, PhantomBase$ChrLv, PhantomBase$CRROver, HyperStanceLv=0, rep(max(PhantomDealCycle$Time), 2), c(0.6, 0.4)) HyperStatOpt[[Idx1]][Idx2, c(1, 3:10)] <- PhantomSpecOpt2[1, ] } else { PhantomSpecOpt2 <- HyperStatOpt[[Idx1]][Idx2, ] } PhantomSpecOpt <- OptDataAdd(PhantomSpecOpt, PhantomSpecOpt2, "HyperStat", PhantomBase$CRROver, DemonAvenger=F) PhantomFinalDPM <- ResetDealCalc(DealCycles=list(PhantomDealCycleReduction1, PhantomDealCycleReduction2), ATKFinal, BuffFinal, SummonedFinal, PhantomSpecOpt, rep(max(PhantomDealCycle$Time), 2), c(0.6, 0.4)) PhantomFinalDPMwithMax <- ResetDealCalcWithMaxDMR(DealCycles=list(PhantomDealCycleReduction1, PhantomDealCycleReduction2), ATKFinal, BuffFinal, SummonedFinal, PhantomSpecOpt, rep(max(PhantomDealCycle$Time), 2), c(0.6, 0.4)) PhantomDeal1 <- DealCalcWithMaxDMR(PhantomDealCycle, ATKFinal, BuffFinal, SummonedFinal, PhantomSpecOpt) PhantomDeal2 <- DealCalcWithMaxDMR(PhantomDealCycle2, ATKFinal, BuffFinal, SummonedFinal, PhantomSpecOpt) set(get(DPMCalcOption$DataName), as.integer(1), "Phantom", sum(na.omit(PhantomFinalDPMwithMax)) / (max(PhantomDealCycle$Time) / 60000)) set(get(DPMCalcOption$DataName), as.integer(2), "Phantom", sum(na.omit(PhantomFinalDPM)) / (max(PhantomDealCycle$Time) / 60000) - sum(na.omit(PhantomFinalDPMwithMax)) / (max(PhantomDealCycle$Time) / 60000)) PhantomDealRatio <- ResetDealRatio(DealCycles=list(PhantomDealCycle, PhantomDealCycle2), DealDatas=list(PhantomDeal1, PhantomDeal2), rep(max(PhantomDealCycle$Time), 2), c(0.6, 0.4)) PhantomDealData <- data.frame(PhantomDealCycle$Skills, PhantomDealCycle$Time, PhantomDealCycle$Restraint4, PhantomDeal1) colnames(PhantomDealData) <- c("Skills", "Time", "R4", "Deal") set(get(DPMCalcOption$DataName), as.integer(3), "Phantom", Deal_RR(PhantomDealData)) set(get(DPMCalcOption$DataName), as.integer(4), "Phantom", Deal_40s(PhantomDealData))
/job/Phantom.R
no_license
SouICry/Maplestory_DPM
R
false
false
36,656
r
## Phantom - Data ## Phantom - VMatrix PhantomCoreBase <- CoreBuilder(ActSkills=c("Joker", "BlackJack", "MarkofPhantom", "LiftBreak", CommonV("Thief", "Heroes")[2:5]), ActSkillsLv=c(25, 25, 25, 25, 25, 1, 25, 25), UsefulSkills=c("SharpEyes", "CombatOrders"), SpecSet=get(DPMCalcOption$SpecSet), VPassiveList=PhantomVPassive, VPassivePrior=PhantomVPrior, SelfBind=F) PhantomCore <- MatrixSet(PasSkills=PhantomCoreBase$PasSkills$Skills, PasLvs=PhantomCoreBase$PasSkills$Lv, PasMP=PhantomCoreBase$PasSkills$MP, ActSkills=PhantomCoreBase$ActSkills$Skills, ActLvs=PhantomCoreBase$ActSkills$Lv, ActMP=PhantomCoreBase$ActSkills$MP, UsefulSkills=PhantomCoreBase$UsefulSkills, UsefulLvs=20, UsefulMP=0, SpecSet=get(DPMCalcOption$SpecSet), SpecialCore=PhantomCoreBase$SpecialCoreUse) ## Phantom - Basic Info PhantomBase <- JobBase(ChrInfo=ChrInfo, MobInfo=get(DPMCalcOption$MobSet), SpecSet=get(DPMCalcOption$SpecSet), Job="Phantom", CoreData=PhantomCore, BuffDurationNeeded=57, AbilList=FindJob(get(paste(DPMCalcOption$SpecSet, "Ability", sep="")), "Phantom"), LinkList=FindJob(get(paste(DPMCalcOption$SpecSet, "Link", sep="")), "Phantom"), MonsterLife=get(FindJob(MonsterLifePreSet, "Phantom")[DPMCalcOption$MonsterLifeLevel][1, 1]), Weapon=WeaponUpgrade(1, DPMCalcOption$WeaponSF, 4, 0, 0, 0, 0, 3, 0, 0, "Cane", get(DPMCalcOption$SpecSet)$WeaponType)[, 1:16], WeaponType=get(DPMCalcOption$SpecSet)$WeaponType, SubWeapon=SubWeapon[rownames(SubWeapon)=="Card", ], Emblem=Emblem[rownames(Emblem)=="Heroes", ], CoolReduceHat=as.logical(FindJob(get(paste(DPMCalcOption$SpecSet, "CoolReduceHat", sep="")), "Phantom"))) ## Phantom - Passive {option <- factor(c("SubStat1"), levels=PSkill) value <- c(40) HighDexterity <- data.frame(option, value) option <- factor(c("MainStat"), levels=PSkill) value <- c(60) LuckMonopoly <- data.frame(option, value) option <- factor(c("ATKSpeed", "MainStat"), levels=PSkill) value <- c(2, 20) CaneAcceleration <- data.frame(option, value) option <- factor(c("MainStat"), levels=PSkill) value <- c(60) LuckofPhantomThief <- data.frame(option, value) option <- factor(c("ATK"), levels=PSkill) value <- c(40) MoonLight <- data.frame(option, value) option <- factor(c("FDR", "CRR"), levels=PSkill) value <- c(30, 35) AcuteSense <- data.frame(option, value) option <- factor(c("BDR", "IGR"), levels=PSkill) value <- c(30 + PhantomBase$PSkillLv, 30 + PhantomBase$PSkillLv) PrayofAria <- data.frame(option, value) option <- factor(c("Mastery", "ATK", "CDMR", "FDR"), levels=PSkill) value <- c(70 + ceiling(PhantomBase$PSkillLv/2), 40 + PhantomBase$PSkillLv, 15, 25 + floor(PhantomBase$PSkillLv/2)) CaneExpert <- data.frame(option, value) option <- factor(c("ATK"), levels=PSkill) value <- c(GetCoreLv(PhantomCore, "ReadyToDie")) ReadytoDiePassive <- data.frame(option, value) option <- factor(c("ATK"), levels=PSkill) value <- c(GetCoreLv(PhantomCore, "Blink")) BlinkPassive <- data.frame(option, value) option <- factor(c("MainStat", "SubStat1"), levels=PSkill) value <- c(rep(GetCoreLv(PhantomCore, "RopeConnect"), 2)) RopeConnectPassive <- data.frame(option, value)} PhantomPassive <- Passive(list(HighDexterity=HighDexterity, LuckMonopoly=LuckMonopoly, CaneAcceleration=CaneAcceleration, LuckofPhantomThief=LuckofPhantomThief, MoonLight=MoonLight, AcuteSense=AcuteSense, PrayofAria=PrayofAria, CaneExpert=CaneExpert, ReadytoDiePassive=ReadytoDiePassive, BlinkPassive=BlinkPassive, RopeConnectPassive=RopeConnectPassive)) ## Phantom - Buff {option <- factor("ATK", levels=BSkill) value <- c(30) info <- c(180 * (100 + PhantomBase$BuffDurationNeeded + 10) / 100, NA, 0, F, NA, NA, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") Fury <- rbind(data.frame(option, value), info) option <- factor("FDR", levels=BSkill) value <- c(20) info <- c(200 * (100 + PhantomBase$BuffDurationNeeded + 10) / 100, NA, 0, F, NA, NA, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") CrossOverChain <- rbind(data.frame(option, value), info) option <- factor("MainStat", levels=BSkill) value <- c(floor((PhantomBase$ChrLv * 5 + 18) * (0.15 + 0.01 * ceiling(PhantomBase$SkillLv/2)))) info <- c(900 + 30 * PhantomBase$SkillLv, NA, 0, T, NA, NA, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") MapleSoldier <- rbind(data.frame(option, value), info) option <- factor("FDR", levels=BSkill) value <- c(40 + PhantomBase$SkillLv) info <- c(60 * (100 + PhantomBase$BuffDurationNeeded + 10) / 100, 90, 0, F, NA, NA, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") FinalCutBuff <- rbind(data.frame(option, value), info) option <- factor(c("IGR"), levels=BSkill) value <- c(20 + floor(PhantomBase$SkillLv/2)) info <- c(15, 240, 0, F, NA, NA, F) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") TwilightDebuff <- rbind(data.frame(option, value), info) option <- factor("BDR", levels=BSkill) value <- c(5) info <- c(120, 120, 0, F, F, F, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") HeroesOath <- rbind(data.frame(option, value), info) option <- factor(c("CRR", "CDMR", "IGR", "BDR"), levels=BSkill) value <- c(20, 10, 20, 20) info <- c(30, 180, 960, F, F, F, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") Bullseye <- rbind(data.frame(option, value), info) Useful <- UsefulSkills(PhantomCore) UsefulSharpEyes <- Useful$UsefulSharpEyes UsefulCombatOrders <- Useful$UsefulCombatOrders if(sum(names(Useful)=="UsefulAdvancedBless") >= 1) { UsefulAdvancedBless <- Useful$UsefulAdvancedBless } option <- factor(c("FDR"), levels=BSkill) value <- c(ceiling(GetCoreLv(PhantomCore, "Joker")/5)) info <- c(30, 150, 1620, F, T, F, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") JokerBuff <- rbind(data.frame(option, value), info) option <- factor(levels=BSkill) value <- c() info <- c(30, 150, 1620, F, T, F, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") JokerBuffFail <- rbind(data.frame(option, value), info) option <- factor("FDR", levels=BSkill) value <- c(10 + floor(GetCoreLv(PhantomCore, "ReadyToDie")/10)) info <- c(30, 90 - floor(GetCoreLv(PhantomCore, "ReadyToDie")/2), 780, F, T, F, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") ReadyToDie1Stack <- rbind(data.frame(option, value), info) option <- factor("FDR", levels=BSkill) value <- c(30 + floor(GetCoreLv(PhantomCore, "ReadyToDie")/5)) info <- c((30 - 0.78)/2 + 0.78, 90 - floor(GetCoreLv(PhantomCore, "ReadyToDie")/2), 1560, F, T, F, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") ReadyToDie2Stack <- rbind(data.frame(option, value), info) option <- factor(c("MainStat", "BDR"), levels=BSkill) value <- c(floor(((1 + 0.1 * GetCoreLv(PhantomCore, "MapleWarriors2")) * MapleSoldier[1, 2]) * PhantomBase$MainStatP), 5 + floor(GetCoreLv(PhantomCore, "MapleWarriors2")/2)) info <- c(60, 180, 630, F, T, F, T) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") MapleWarriors2 <- rbind(data.frame(option, value), info) option <- factor(levels=BSkill) value <- c() info <- c(0, 1, 0, F, F, F, F) info <- data.frame(BInfo, info) colnames(info) <- c("option", "value") NoirCarteStack <- rbind(data.frame(option, value), info)} PhantomBuff <- list(Fury=Fury, CrossOverChain=CrossOverChain, MapleSoldier=MapleSoldier, FinalCutBuff=FinalCutBuff, TwilightDebuff=TwilightDebuff, HeroesOath=HeroesOath, Bullseye=Bullseye, UsefulSharpEyes=UsefulSharpEyes, UsefulCombatOrders=UsefulCombatOrders, JokerBuff=JokerBuff, JokerBuffFail=JokerBuffFail, ReadyToDie1Stack=ReadyToDie1Stack, ReadyToDie2Stack=ReadyToDie2Stack, MapleWarriors2=MapleWarriors2, NoirCarteStack=NoirCarteStack, Restraint4=Restraint4, SoulContractLink=SoulContractLink) if(sum(names(Useful)=="UsefulAdvancedBless") >= 1) { PhantomBuff[[length(PhantomBuff)+1]] <- UsefulAdvancedBless names(PhantomBuff)[[length(PhantomBuff)]] <- "UsefulAdvancedBless" } PhantomBuff <- Buff(PhantomBuff) PhantomAllTimeBuff <- AllTimeBuff(PhantomBuff) ## PetBuff : Fury(1080ms), CrossOverChain(720ms), MapleSoldier(0ms), UsefulCombatOrders(1500ms), UsefulSharpEyes(900ms), (UsefulAdvancedBless) ## Phantom - Union & HyperStat & SoulWeapon PhantomSpec <- JobSpec(JobBase=PhantomBase, Passive=PhantomPassive, AllTimeBuff=PhantomAllTimeBuff, MobInfo=get(DPMCalcOption$MobSet), SpecSet=get(DPMCalcOption$SpecSet), WeaponName="Cane", UnionStance=0) PhantomUnionRemained <- PhantomSpec$UnionRemained PhantomHyperStatBase <- PhantomSpec$HyperStatBase PhantomCoolReduceType <- PhantomSpec$CoolReduceType PhantomSpec <- PhantomSpec$Spec ## Phantom - Spider In Mirror SIM <- SIMData(GetCoreLv(PhantomCore, "SpiderInMirror")) SpiderInMirror <- SIM$SpiderInMirror SpiderInMirrorStart <- SIM$SpiderInMirrorStart SpiderInMirror1 <- SIM$SpiderInMirror1 SpiderInMirror2 <- SIM$SpiderInMirror2 SpiderInMirror3 <- SIM$SpiderInMirror3 SpiderInMirror4 <- SIM$SpiderInMirror4 SpiderInMirror5 <- SIM$SpiderInMirror5 SpiderInMirrorWait <- SIM$SpiderInMirrorWait ## Phantom - Attacks {option <- factor(c("IGR", "BDR", "FDR"), levels=ASkill) value <- c(IGRCalc(c(20, ifelse(GetCoreLv(PhantomCore, "UltimateDrive")>=40, 20, 0))), 20, 2 * GetCoreLv(PhantomCore, "UltimateDrive")) info <- c(140 + PhantomSpec$SkillLv, 3, 150, NA, NA, NA, NA, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") UltimateDrive <- rbind(data.frame(option, value), info) option <- factor(c("IGR", "BDR", "FDR"), levels=ASkill) value <- c(ifelse(GetCoreLv(PhantomCore, "TempestofCard")>=40, 20, 0), 20, 2 * GetCoreLv(PhantomCore, "TempestofCard")) info <- c(200 + 2 * PhantomSpec$SkillLv, 3, 10000, 180, 10 + Cooldown(18, T, 20 + PhantomSpec$CoolReduceP, PhantomSpec$CoolReduce), F, T, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") TempestofCard <- rbind(data.frame(option, value), info) option <- factor(c("IGR", "FDR"), levels=ASkill) value <- c(ifelse(GetCoreLv(PhantomCore, "NoirCarte")>=40, 20, 0), 2 * GetCoreLv(PhantomCore, "NoirCarte")) info <- c(270, 1, 0, NA, NA, NA, NA, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") NoirCarte <- rbind(data.frame(option, value), info) option <- factor(c("IGR", "FDR"), levels=ASkill) value <- c(ifelse(GetCoreLv(PhantomCore, "NoirCarte")>=40, 20, 0), 2 * GetCoreLv(PhantomCore, "NoirCarte")) info <- c(270, 10, 0, NA, NA, NA, NA, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") NoirCarteJudgement <- rbind(data.frame(option, value), info) option <- factor(c("IGR", "FDR"), levels=ASkill) value <- c(ifelse(GetCoreLv(PhantomCore, "Twilight")>=40, 20, 0), 2 * GetCoreLv(PhantomCore, "Twilight")) info <- c(450 + 3 * PhantomBase$SkillLv, 3, 180, NA, NA, NA, NA, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") Twilight1 <- rbind(data.frame(option, value), info) option <- factor(levels=ASkill) value <- c() info <- c(0, 0, 540, NA, NA, NA, NA, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") Twilight2 <- rbind(data.frame(option, value), info) option <- factor(c("IGR", "FDR"), levels=ASkill) value <- c(ifelse(GetCoreLv(PhantomCore, "RoseCarteFinale")>=40, 20, 0), 2 * GetCoreLv(PhantomCore, "RoseCarteFinale")) info <- c(700, 6, 1200, NA, 30, F, F, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") RoseCarteFinale <- rbind(data.frame(option, value), info) option <- factor(c("IGR", "FDR"), levels=ASkill) value <- c(ifelse(GetCoreLv(PhantomCore, "RoseCarteFinale")>=40, 20, 0), 2 * GetCoreLv(PhantomCore, "RoseCarteFinale")) info <- c(200, 2, 0, 930, 30, F, F, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") RoseCarteFinaleAdd <- rbind(data.frame(option, value), info) ## 12 Hits, FirstATK : 2400 option <- factor(levels=ASkill) value <- c() info <- c(0, 0, 1000, NA, NA, NA, NA, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") FinalCutPre <- rbind(data.frame(option, value), info) option <- factor(c("IGR", "FDR"), levels=ASkill) value <- c(ifelse(GetCoreLv(PhantomCore, "TalentofPhantomThief4")>=40, 20, 0), 2 * GetCoreLv(PhantomCore, "TalentofPhantomThief4")) info <- c((2000 + 20 * PhantomSpec$SkillLv)/ 1.3 * 1.2, 1, 180, NA, NA, NA, NA, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") FinalCut <- rbind(data.frame(option, value), info) option <- factor(levels=ASkill) value <- c() info <- c(240 + 9 * GetCoreLv(PhantomCore, "Joker"), 3, 6000 + floor(GetCoreLv(PhantomCore, "Joker")/25) * 1000, 50, 150, T, F, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") Joker <- rbind(data.frame(option, value), info) option <- factor(levels=ASkill) value <- c() info <- c(600 + 24 * GetCoreLv(PhantomCore, "BlackJack"), 3, 760, 450, 15, T, F, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") BlackJack <- rbind(data.frame(option, value), info) ## FirstATK : 1200 option <- factor(levels=ASkill) value <- c() info <- c(800 + 32 * GetCoreLv(PhantomCore, "BlackJack"), 18, 0, 0, 15, T, F, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") BlackJackLast <- rbind(data.frame(option, value), info) option <- factor(levels=ASkill) value <- c() info <- c(300 + 12 * GetCoreLv(PhantomCore, "MarkofPhantom"), 6, 900, 75, 30, T, F, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") MarkofPhantom <- rbind(data.frame(option, value), info) ## FirstATK : 660 option <- factor(levels=ASkill) value <- c() info <- c(485 + 19 * GetCoreLv(PhantomCore, "MarkofPhantom"), 15, 0, 30, 30, T, F, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") MarkofPhantomFinal <- rbind(data.frame(option, value), info) ## FirstATK : 1440 option <- factor(levels=ASkill) value <- c() info <- c(400 + 16 * GetCoreLv(PhantomCore, "LiftBreak"), 7, 990, 0, 30, T, F, F) info <- data.frame(AInfo, info) colnames(info) <- c("option", "value") LiftBreak <- rbind(data.frame(option, value), info) ## FirstATK : 0, Delays : 270, 270, 1230, 30, 30, 30 } PhantomATK <- Attack(list(UltimateDrive=UltimateDrive, TempestofCard=TempestofCard, NoirCarte=NoirCarte, NoirCarteJudgement=NoirCarteJudgement, Twilight1=Twilight1, Twilight2=Twilight2, RoseCarteFinale=RoseCarteFinale, RoseCarteFinaleAdd=RoseCarteFinaleAdd, FinalCutPre=FinalCutPre, FinalCut=FinalCut, Joker=Joker, BlackJack=BlackJack, BlackJackLast=BlackJackLast, MarkofPhantom=MarkofPhantom, MarkofPhantomFinal=MarkofPhantomFinal, LiftBreak=LiftBreak, SpiderInMirror=SpiderInMirror)) ## Phantom - Summoned PhantomSummoned <- Summoned(list(SpiderInMirrorStart=SpiderInMirrorStart, SpiderInMirror1=SpiderInMirror1, SpiderInMirror2=SpiderInMirror2, SpiderInMirror3=SpiderInMirror3, SpiderInMirror4=SpiderInMirror4, SpiderInMirror5=SpiderInMirror5, SpiderInMirrorWait=SpiderInMirrorWait)) ## Phantom - DealCycle & Deal Calculation ATKFinal <- data.frame(PhantomATK) ATKFinal$Delay[c(-1, -2, -9, -11)] <- Delay(ATKFinal$Delay, PhantomSpec$ATKSpeed)[c(-1, -2, -9, -11)] ATKFinal$CoolTime <- Cooldown(ATKFinal$CoolTime, ATKFinal$CoolReduceAvailable, PhantomSpec$CoolReduceP, PhantomSpec$CoolReduce) BuffFinal <- data.frame(PhantomBuff) BuffFinal$CoolTime <- Cooldown(BuffFinal$CoolTime, BuffFinal$CoolReduceAvailable, PhantomSpec$CoolReduceP, PhantomSpec$CoolReduce) BuffFinal$Duration <- BuffFinal$Duration + BuffFinal$Duration * ifelse(BuffFinal$BuffDurationAvailable==T, PhantomSpec$BuffDuration / 100, 0) + ifelse(BuffFinal$ServerLag==T, General$General$Serverlag, 0) SummonedFinal <- data.frame(PhantomSummoned) SummonedFinal$CoolTime <- Cooldown(SummonedFinal$CoolTime, SummonedFinal$CoolReduceAvailable, PhantomSpec$CoolReduceP, PhantomSpec$CoolReduce) SummonedFinal$Duration <- SummonedFinal$Duration + ifelse(SummonedFinal$SummonedDurationAvailable==T, SummonedFinal$Duration * PhantomSpec$SummonedDuration / 100, 0) ## Phantom - DealCycle DealCycle <- c("Skills", "Time", rownames(PhantomBuff)) PhantomDealCycle <- t(rep(0, length(DealCycle))) colnames(PhantomDealCycle) <- DealCycle PhantomDealCycle <- data.frame(PhantomDealCycle) PhantomCycle <- function(PreDealCycle, ATKFinal, BuffFinal, SummonedFinal, Spec, Period=180, CycleTime=360) { BuffSummonedPrior <- c("Fury", "CrossOverChain", "UsefulSharpEyes", "UsefulCombatOrders", "UsefulAdvancedBless", "HeroesOath", "FinalCutBuff", "MapleWarriors2", "Bullseye", "ReadyToDie2Stack", "SoulContractLink", "Restraint4") Times180 <- c(0, 0, 0, 0, 0, 0, 2, 1, 1, 2, 2, 1) if(nrow(BuffFinal[rownames(BuffFinal)=="UsefulAdvancedBless", ]) == 0) { Times180 <- Times180[BuffSummonedPrior!="UsefulAdvancedBless"] BuffSummonedPrior <- BuffSummonedPrior[BuffSummonedPrior!="UsefulAdvancedBless"] } SubTime <- rep(Period, length(BuffSummonedPrior)) TotalTime <- CycleTime for(i in 1:length(BuffSummonedPrior)) { SubTime[i] <- SubTime[i] / ifelse(Times180[i]==0, Inf, Times180[i]) } SubTimeUniques <- unique(SubTime) SubTimeUniques <- SubTimeUniques[SubTimeUniques > 0] TimeTypes <- c() for(i in 1:length(SubTimeUniques)) { Time <- 0 ; r <- 1 while(Time < TotalTime) { Time <- SubTimeUniques[i] * r r <- r + 1 TimeTypes <- c(TimeTypes, Time) } } TimeTypes <- TimeTypes[TimeTypes < TotalTime] TimeTypes <- unique(TimeTypes) TimeTypes <- TimeTypes[order(TimeTypes)] Buffs <- data.frame(Buff=BuffSummonedPrior, SubTime=SubTime, stringsAsFactors=F) Buffs <- subset(Buffs, Buffs$SubTime > 0) BuffList <- list() BuffList[[1]] <- BuffSummonedPrior for(i in 1:length(TimeTypes)) { s <- c() for(j in 1:nrow(Buffs)) { if(round(TimeTypes[i] / Buffs[j, 2]) == TimeTypes[i] / Buffs[j, 2]) { s <- c(s, Buffs[j, 1]) } } BuffList[[i+1]] <- s } DelayDataB <- data.frame(Name=rownames(BuffFinal), Delay=BuffFinal$Delay) DelayDataS <- data.frame(Name=rownames(SummonedFinal), Delay=SummonedFinal$Delay) DelayData <- rbind(DelayDataB, DelayDataS) BuffDelays <- list() for(i in 1:length(BuffList)) { t <- c() for(j in 1:length(BuffList[[i]])) { for(k in 1:nrow(DelayData)) { if(DelayData$Name[k]==BuffList[[i]][j]) { t <- c(t, k) } } } BuffDelays[[i]] <- DelayData$Delay[t] } TotalTime <- TotalTime * 1000 DealCycle <- PreDealCycle for(i in 1:length(BuffList[[1]])) { if(sum(rownames(BuffFinal)==BuffList[[1]][i]) > 0) { if(BuffList[[1]][i]=="FinalCutBuff") { DealCycle <- DCATK(DealCycle, "FinalCutPre", ATKFinal) } DealCycle <- DCBuff(DealCycle, BuffList[[1]][i], BuffFinal) if(DealCycle$Skills[nrow(DealCycle)] == "FinalCutBuff") { DealCycle <- DCATK(DealCycle, "FinalCut", ATKFinal) } else if(DealCycle$Skills[nrow(DealCycle)] == "HeroesOath") { DealCycle <- DCATK(DealCycle, "SpiderInMirror", ATKFinal) } } else { DealCycle <- DCSummoned(DealCycle, BuffList[[1]][i], SummonedFinal) } } SubTimeList <- data.frame(Skills=BuffSummonedPrior, SubTime=SubTime, stringsAsFactors=F) NoSubTime <- subset(SubTimeList, SubTimeList$SubTime==0)$Skills NoSubTimeBuff <- c() for(i in 1:length(NoSubTime)) { NoSubTimeBuff <- c(NoSubTimeBuff, NoSubTime[i]) } ColNums <- c() for(i in 1:length(NoSubTimeBuff)) { for(j in 1:length(colnames(DealCycle))) { if(NoSubTimeBuff[i]==colnames(DealCycle)[j]) { ColNums[i] <- j } } } BuffList[[length(BuffList)+1]] <- BuffList[[1]] BuffDelays[[length(BuffDelays)+1]] <- BuffDelays[[1]] TimeTypes <- c(0, TimeTypes, TotalTime/1000) BJCool <- subset(ATKFinal, rownames(ATKFinal)=="MarkofPhantom")$CoolTime * 1000 / 2 MPCool <- subset(ATKFinal, rownames(ATKFinal)=="MarkofPhantom")$CoolTime * 1000 RCCool <- subset(ATKFinal, rownames(ATKFinal)=="RoseCarteFinale")$CoolTime * 1000 BJRemain <- 0 ; RCRemain <- 0 ; MOPDummy <- 0 ; TOCDummy <- 0 for(k in 2:length(BuffList)) { CycleBuffList <- data.frame(Skills=BuffList[[k]], Delay=BuffDelays[[k]]) BuffEndTime <- c() for(i in 1:length(BuffList[[k]])) { a <- subset(DealCycle, BuffList[[k]][i]==DealCycle$Skills) a <- rbind(a, subset(DealCycle, paste(BuffList[[k]][i], "Summoned", sep="")==DealCycle$Skills)) for(j in 1:nrow(CycleBuffList)) { if(CycleBuffList$Skills[j]==BuffList[[k]][i]) { Idx <- j break } } BuffEndTime[i] <- max(a$Time) + min(subset(SubTimeList, SubTimeList$Skills==BuffList[[k]][i])$SubTime * 1000, subset(BuffFinal, rownames(BuffFinal)==BuffList[[k]][i])$CoolTime * 1000, subset(SummonedFinal, rownames(SummonedFinal)==BuffList[[k]][i])$CoolTime * 1000) + sum(CycleBuffList$Delay[Idx:nrow(CycleBuffList)]) } BuffEndTime <- max(BuffEndTime) BuffEndTime <- max(BuffEndTime, TimeTypes[k] * 1000) BuffStartTime <- BuffEndTime - sum(CycleBuffList$Delay) while(DealCycle$Time[nrow(DealCycle)] + DealCycle$Time[1] < BuffStartTime) { for(i in 1:length(ColNums)) { if(DealCycle[nrow(DealCycle), ColNums[i]] - DealCycle$Time[1] < 3000) { DealCycle <- DCBuff(DealCycle, colnames(DealCycle)[ColNums[i]], BuffFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) } } ## BlackJack, Mark of Phantom, Lift Break if(BJRemain == 0 & MOPDummy == 0 & k==length(BuffList) & DealCycle$Time[nrow(DealCycle)] + DealCycle$Time[1] + MPCool <= BuffStartTime + 8000 | BJRemain == 0 & MOPDummy == 0 & k!=length(BuffList)) { DealCycle <- DCATK(DealCycle, "BlackJack", ATKFinal) BJRemain <- BJCool - DealCycle$Time[1] RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCBuff(DealCycle, "TwilightDebuff", BuffFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCATK(DealCycle, "Twilight1", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCATK(DealCycle, "Twilight2", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCATK(DealCycle, "MarkofPhantomFinal", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCATK(DealCycle, "MarkofPhantom", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCATK(DealCycle, "LiftBreak", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) if(DealCycle$Restraint4[nrow(DealCycle)] >= 7000) { DealCycle <- DCATK(DealCycle, "Joker", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCBuff(DealCycle, "JokerBuffFail", BuffFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) TOCDummy <- 0 } else if(TOCDummy == 0 & DealCycle$Time[nrow(DealCycle)] + DealCycle$Time[1] <= BuffStartTime - 10000) { DealCycle <- DCATK(DealCycle, "TempestofCard", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) TOCDummy <- 1 } else { TOCDummy <- 0 } MOPDummy <- 1 } else if(BJRemain == 0 & MOPDummy == 1 & k==length(BuffList) & DealCycle$Time[nrow(DealCycle)] + DealCycle$Time[1] + BJCool <= BuffStartTime + 8000 | BJRemain == 0 & MOPDummy == 1 & k!=length(BuffList)) { DealCycle <- DCATK(DealCycle, "BlackJack", ATKFinal) BJRemain <- BJCool - DealCycle$Time[1] RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCBuff(DealCycle, "TwilightDebuff", BuffFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCATK(DealCycle, "Twilight1", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCATK(DealCycle, "Twilight2", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) if(DealCycle$Restraint4[nrow(DealCycle)] >= 7000) { DealCycle <- DCATK(DealCycle, "Joker", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) DealCycle <- DCBuff(DealCycle, "JokerBuffFail", BuffFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) TOCDummy <- 0 } else if(TOCDummy == 0 & DealCycle$Time[nrow(DealCycle)] + DealCycle$Time[1] <= BuffStartTime - 10000) { DealCycle <- DCATK(DealCycle, "TempestofCard", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) TOCDummy <- 1 } else { TOCDummy <- 0 } MOPDummy <- 0 } ## Rose Carte Finale else if(RCRemain == 0 & DealCycle$Time[nrow(DealCycle)] + DealCycle$Time[1] <= 350000) { DealCycle <- DCATK(DealCycle, "RoseCarteFinaleAdd", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- RCCool - DealCycle$Time[1] DealCycle <- DCATK(DealCycle, "RoseCarteFinale", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) } ## Ultimate Drive else { DealCycle <- DCATK(DealCycle, c("UltimateDrive"), ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) } } if(k != length(BuffList)) { for(i in 1:length(BuffList[[k]])) { if(sum(rownames(BuffFinal)==BuffList[[k]][i]) > 0) { if(BuffList[[k]][i]=="FinalCutBuff") { DealCycle <- DCATK(DealCycle, "FinalCutPre", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) } DealCycle <- DCBuff(DealCycle, BuffList[[k]][i], BuffFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) if(DealCycle$Skills[nrow(DealCycle)] == "FinalCutBuff") { DealCycle <- DCATK(DealCycle, "FinalCut", ATKFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) } } else { DealCycle <- DCSummoned(DealCycle, BuffList[[k]][i], SummonedFinal) BJRemain <- max(0, BJRemain - DealCycle$Time[1]) RCRemain <- max(0, RCRemain - DealCycle$Time[1]) } } } } return(DealCycle) } PhantomAddATK <- function(DealCycle, ATKFinal, BuffFinal, SummonedFinal, Spec) { ## Joker DealCycle <- RepATKCycle(DealCycle, "Joker", 140, 0, ATKFinal) ## BlackJack DealCycle <- RepATKCycle(DealCycle, "BlackJack", 7, 1200, ATKFinal) ## BlackJack (Last) BJ <- 1 for(i in 1:nrow(DealCycle)) { if(DealCycle$Skills[i]=="BlackJack") { if(BJ==7) { DealCycle$Skills[i] <- "BlackJackLast" BJ <- 1 } else { BJ <- BJ + 1 } } } ## Mark of Phantom DealCycle <- RepATKCycle(DealCycle, "MarkofPhantom", 7, 660, ATKFinal) DealCycle <- RepATKCycle(DealCycle, "MarkofPhantomFinal", 2, 1440, ATKFinal) ## Lift Break LiftBreakTime <- c(0, 270, 540, 1770, 1800, 1830, 1860) DealCycle[DealCycle$Skills=="LiftBreak", ]$Skills <- "LiftBreakStart" DC2 <- subset(DealCycle, DealCycle$Skills=="LiftBreakStart") for(i in 1:nrow(DC2)) { for(j in 1:length(LiftBreakTime)) { DC2 <- rbind(DC2, DC2[i, ]) DC2$Time[nrow(DC2)] <- DC2$Time[i] + LiftBreakTime[j] DC2$Skills[nrow(DC2)] <- "LiftBreak" } } DC2 <- subset(DC2, DC2$Skills=="LiftBreak") DC2 <- subset(DC2, DC2$Time <= max(DealCycle$Time)) DealCycle <- rbind(DealCycle, DC2) DealCycle <- DealCycle[order(DealCycle$Time), ] rownames(DealCycle) <- 1:nrow(DealCycle) for(i in 3:nrow(DealCycle)) { if("LiftBreak"==DealCycle[i, 1]) { DealCycle[i, 3:ncol(DealCycle)] <- DealCycle[i-1, 3:ncol(DealCycle)] - (DealCycle[i, 2] - DealCycle[i-1, 2]) DealCycle[i, 3:ncol(DealCycle)] <- ifelse(DealCycle[i, 3:ncol(DealCycle)]<0, 0, DealCycle[i, 3:ncol(DealCycle)]) } } ## Rose Carte Finale (AddATK) DealCycle <- RepATKCycle(DealCycle, "RoseCarteFinaleAdd", 12, 2400, ATKFinal) ## Tempest of Card DealCycle <- RepATKCycle(DealCycle, "TempestofCard", 56, 0, ATKFinal) ## Spider In Mirror DealCycle <- DCSpiderInMirror(DealCycle, SummonedFinal) ## Noir Carte DealCycle$NoirCarteStack[1] <- 0 for(i in 2:nrow(DealCycle)) { if(sum(DealCycle$Skills[i]==c("UltimateDrive", "TempestofCard", "Joker", "LiftBreak", "MarkofPhantom", "MarkofPhantomFinal", "RoseCarteFinale", "Twilight1", "FinalCut", "SpiderInMirror"))==1) { DealCycle$NoirCarteStack[i] <- DealCycle$NoirCarteStack[i-1] + 1 DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarte" if(DealCycle$NoirCarteStack[i] == 40) { DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarteJudgement" DealCycle$NoirCarteStack[i] <- 0 } } else if(DealCycle$Skills[i]=="BlackJack") { DealCycle$NoirCarteStack[i] <- DealCycle$NoirCarteStack[i-1] + 3 DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarte" DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarte" DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarte" if(DealCycle$NoirCarteStack[i] >= 40) { DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarteJudgement" DealCycle$NoirCarteStack[i] <- DealCycle$NoirCarteStack[i] - 40 } } else if(DealCycle$Skills[i]=="BlackJackLast") { DealCycle$NoirCarteStack[i] <- DealCycle$NoirCarteStack[i-1] + 3 DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarte" DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarte" DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarte" if(DealCycle$NoirCarteStack[i] >= 40) { DealCycle <- rbind(DealCycle, DealCycle[i, ]) DealCycle$Skills[nrow(DealCycle)] <- "NoirCarteJudgement" DealCycle$NoirCarteStack[i] <- DealCycle$NoirCarteStack[i] - 40 } } else { DealCycle$NoirCarteStack[i] <- DealCycle$NoirCarteStack[i-1] } } DealCycle <- DealCycle[order(DealCycle$Time), ] rownames(DealCycle) <- 1:nrow(DealCycle) DealCycle$NoirCarteStack <- 0 return(DealCycle) } PhantomDealCycle <- PhantomCycle(PreDealCycle=PhantomDealCycle, ATKFinal=ATKFinal, BuffFinal=BuffFinal, SummonedFinal=SummonedFinal, Spec=PhantomSpec, Period=180, CycleTime=360) PhantomDealCycle <- DealCycleFinal(PhantomDealCycle) PhantomDealCycle <- PhantomAddATK(PhantomDealCycle, ATKFinal, BuffFinal, SummonedFinal, PhantomSpec) PhantomDealCycleReduction1 <- DealCycleReduction(PhantomDealCycle) PhantomDealCycle2 <- PhantomDealCycle PhantomDealCycle2$JokerBuff <- PhantomDealCycle2$JokerBuffFail PhantomDealCycle2$JokerBuffFail <- 0 PhantomDealCycleReduction2 <- DealCycleReduction(PhantomDealCycle2) Idx1 <- c() ; Idx2 <- c() for(i in 1:length(PotentialOpt)) { if(names(PotentialOpt)[i]==DPMCalcOption$SpecSet) { Idx1 <- i } } for(i in 1:nrow(PotentialOpt[[Idx1]])) { if(rownames(PotentialOpt[[Idx1]])[i]=="Phantom") { Idx2 <- i } } if(DPMCalcOption$Optimization==T) { PhantomSpecOpt1 <- ResetOptimization1(list(PhantomDealCycleReduction1, PhantomDealCycleReduction2), ATKFinal, BuffFinal, SummonedFinal, PhantomSpec, PhantomUnionRemained, rep(max(PhantomDealCycle$Time), 2), c(0.6, 0.4)) PotentialOpt[[Idx1]][Idx2, ] <- PhantomSpecOpt1[1, 1:3] } else { PhantomSpecOpt1 <- PotentialOpt[[Idx1]][Idx2, ] } PhantomSpecOpt <- OptDataAdd(PhantomSpec, PhantomSpecOpt1, "Potential", PhantomBase$CRROver, DemonAvenger=F) if(DPMCalcOption$Optimization==T) { PhantomSpecOpt2 <- ResetOptimization2(list(PhantomDealCycleReduction1, PhantomDealCycleReduction2), ATKFinal, BuffFinal, SummonedFinal, PhantomSpecOpt, PhantomHyperStatBase, PhantomBase$ChrLv, PhantomBase$CRROver, HyperStanceLv=0, rep(max(PhantomDealCycle$Time), 2), c(0.6, 0.4)) HyperStatOpt[[Idx1]][Idx2, c(1, 3:10)] <- PhantomSpecOpt2[1, ] } else { PhantomSpecOpt2 <- HyperStatOpt[[Idx1]][Idx2, ] } PhantomSpecOpt <- OptDataAdd(PhantomSpecOpt, PhantomSpecOpt2, "HyperStat", PhantomBase$CRROver, DemonAvenger=F) PhantomFinalDPM <- ResetDealCalc(DealCycles=list(PhantomDealCycleReduction1, PhantomDealCycleReduction2), ATKFinal, BuffFinal, SummonedFinal, PhantomSpecOpt, rep(max(PhantomDealCycle$Time), 2), c(0.6, 0.4)) PhantomFinalDPMwithMax <- ResetDealCalcWithMaxDMR(DealCycles=list(PhantomDealCycleReduction1, PhantomDealCycleReduction2), ATKFinal, BuffFinal, SummonedFinal, PhantomSpecOpt, rep(max(PhantomDealCycle$Time), 2), c(0.6, 0.4)) PhantomDeal1 <- DealCalcWithMaxDMR(PhantomDealCycle, ATKFinal, BuffFinal, SummonedFinal, PhantomSpecOpt) PhantomDeal2 <- DealCalcWithMaxDMR(PhantomDealCycle2, ATKFinal, BuffFinal, SummonedFinal, PhantomSpecOpt) set(get(DPMCalcOption$DataName), as.integer(1), "Phantom", sum(na.omit(PhantomFinalDPMwithMax)) / (max(PhantomDealCycle$Time) / 60000)) set(get(DPMCalcOption$DataName), as.integer(2), "Phantom", sum(na.omit(PhantomFinalDPM)) / (max(PhantomDealCycle$Time) / 60000) - sum(na.omit(PhantomFinalDPMwithMax)) / (max(PhantomDealCycle$Time) / 60000)) PhantomDealRatio <- ResetDealRatio(DealCycles=list(PhantomDealCycle, PhantomDealCycle2), DealDatas=list(PhantomDeal1, PhantomDeal2), rep(max(PhantomDealCycle$Time), 2), c(0.6, 0.4)) PhantomDealData <- data.frame(PhantomDealCycle$Skills, PhantomDealCycle$Time, PhantomDealCycle$Restraint4, PhantomDeal1) colnames(PhantomDealData) <- c("Skills", "Time", "R4", "Deal") set(get(DPMCalcOption$DataName), as.integer(3), "Phantom", Deal_RR(PhantomDealData)) set(get(DPMCalcOption$DataName), as.integer(4), "Phantom", Deal_40s(PhantomDealData))
function (x, window) { e <- get("data.env", .GlobalEnv) e[["blocksums_i_max"]][[length(e[["blocksums_i_max"]]) + 1]] <- list(x = x, window = window) .Call("_accelerometry_blocksums_i_max", x, window) }
/valgrind_test_dir/blocksums_i_max-test.R
no_license
akhikolla/RcppDeepStateTest
R
false
false
224
r
function (x, window) { e <- get("data.env", .GlobalEnv) e[["blocksums_i_max"]][[length(e[["blocksums_i_max"]]) + 1]] <- list(x = x, window = window) .Call("_accelerometry_blocksums_i_max", x, window) }
\name{estimated.sGD} \alias{estimated.sGD} \title{Calculated Sum Activity of Step-Up Deiodinases (SPINA-GD) in standardised form} \description{Calculate total step-up deiodinase activity (SPINA-GD) from equilibrium free hormone concentrations in standardised form resulting from z-transformation. } \usage{ estimated.sGD(FT4, FT3, mean = 30, sd = 5) } \arguments{ \item{FT4}{Free thyroxine (FT4) concentration in pmol/L.} \item{FT3}{Free triiodothyronine (FT3) concentation in pmol/L} \item{mean}{mean value of population sample for standardised (z-transformed) tests} \item{sd}{standard deviation of population sample for standardised (ztransformed) tests} } \details{This function is able to do vectorised calculations. } \value{This function returns step-up deiodinase activity in standardised form representing a single value or a vector, depending on the vector length of the arguments. Results are z-transformed and therefore without unit of measurement. } \references{ Dietrich J. W., Landgrafe G., Fotiadou E. H. 2012 TSH and Thyrotropic Agonists: Key Actors in Thyroid Homeostasis. \emph{J Thyroid Res}. 2012;2012:351864. doi: 10.1155/2012/351864. PMID: 23365787; PMCID: PMC3544290. Dietrich J. W., Landgrafe-Mende G., Wiora E., Chatzitomaris A., Klein H. H., Midgley J. E., Hoermann R. 2016 Calculated Parameters of Thyroid Homeostasis: Emerging Tools for Differential Diagnosis and Clinical Research. \emph{Front Endocrinol (Lausanne)}. 2016 Jun 9;7:57. doi: 10.3389/fendo.2016.00057. PMID: 27375554; PMCID: PMC4899439. } \author{Johannes W. Dietrich} \note{The software functions described in this document are intended for research use only. Hormone levels should have been obtained simultaneously in order to avoid bias by transition effects.} \seealso{ \code{\link{SPINA.GT}}, \code{\link{estimated.GT}}, \code{\link{SPINA.GTT}}, \code{\link{estimated.GTT}}, \code{\link{SPINA.GD}}, \code{\link{estimated.GD}}, \code{\link{SPINA.GDTT}}, \code{\link{estimated.GDTT}}, \code{\link{SPINA.sGD}}, \code{\link{estimated.TSHI}}, \code{\link{estimated.sTSHI}}, \code{\link{estimated.TTSI}} } \examples{ TSH <- c(1, 3.24, 0.7); FT4 <- c(16.5, 7.7, 9); FT3 <- c(4.5, 28, 6.2); print(paste("GT^:", SPINA.GT(TSH, FT4))); print(paste("GD^:", SPINA.GD(FT4, FT3))); print(paste("sGD^:", SPINA.sGD(FT4, FT3))); } \keyword{SPINA}
/S functions/R Package/SPINA/man/estimated.sGD.Rd
no_license
jwdietrich21/spina
R
false
false
2,341
rd
\name{estimated.sGD} \alias{estimated.sGD} \title{Calculated Sum Activity of Step-Up Deiodinases (SPINA-GD) in standardised form} \description{Calculate total step-up deiodinase activity (SPINA-GD) from equilibrium free hormone concentrations in standardised form resulting from z-transformation. } \usage{ estimated.sGD(FT4, FT3, mean = 30, sd = 5) } \arguments{ \item{FT4}{Free thyroxine (FT4) concentration in pmol/L.} \item{FT3}{Free triiodothyronine (FT3) concentation in pmol/L} \item{mean}{mean value of population sample for standardised (z-transformed) tests} \item{sd}{standard deviation of population sample for standardised (ztransformed) tests} } \details{This function is able to do vectorised calculations. } \value{This function returns step-up deiodinase activity in standardised form representing a single value or a vector, depending on the vector length of the arguments. Results are z-transformed and therefore without unit of measurement. } \references{ Dietrich J. W., Landgrafe G., Fotiadou E. H. 2012 TSH and Thyrotropic Agonists: Key Actors in Thyroid Homeostasis. \emph{J Thyroid Res}. 2012;2012:351864. doi: 10.1155/2012/351864. PMID: 23365787; PMCID: PMC3544290. Dietrich J. W., Landgrafe-Mende G., Wiora E., Chatzitomaris A., Klein H. H., Midgley J. E., Hoermann R. 2016 Calculated Parameters of Thyroid Homeostasis: Emerging Tools for Differential Diagnosis and Clinical Research. \emph{Front Endocrinol (Lausanne)}. 2016 Jun 9;7:57. doi: 10.3389/fendo.2016.00057. PMID: 27375554; PMCID: PMC4899439. } \author{Johannes W. Dietrich} \note{The software functions described in this document are intended for research use only. Hormone levels should have been obtained simultaneously in order to avoid bias by transition effects.} \seealso{ \code{\link{SPINA.GT}}, \code{\link{estimated.GT}}, \code{\link{SPINA.GTT}}, \code{\link{estimated.GTT}}, \code{\link{SPINA.GD}}, \code{\link{estimated.GD}}, \code{\link{SPINA.GDTT}}, \code{\link{estimated.GDTT}}, \code{\link{SPINA.sGD}}, \code{\link{estimated.TSHI}}, \code{\link{estimated.sTSHI}}, \code{\link{estimated.TTSI}} } \examples{ TSH <- c(1, 3.24, 0.7); FT4 <- c(16.5, 7.7, 9); FT3 <- c(4.5, 28, 6.2); print(paste("GT^:", SPINA.GT(TSH, FT4))); print(paste("GD^:", SPINA.GD(FT4, FT3))); print(paste("sGD^:", SPINA.sGD(FT4, FT3))); } \keyword{SPINA}
library(tidyverse) mtcars %>% filter(mpg >= 24.4) %>% arrange(desc(mpg)) arrange(mtcars, mpg) mtcars %>% select(mpg,disp) mtcars %>% select(wt:gear) mtcars %>% mutate(wtkg=wt*.48) mtcars %>% group_by(cyl) %>% summarise(cyl_n = n(), cyl_mean=mean(mpg)) # deberes mpg %>% filter(manufacturer == 'toyota' & model == 'camry') mpg %>% group_by(manufacturer) %>% summarise(prom=mean(cty)) %>% arrange(prom) %>% mutate(sdm='sd(cty)') mpg %>% group_by(manufacturer) %>% summarise(prom=mean(cty), sd=sd(cty), n=n(), rango=max(cty)-min(cty)) %>% mutate(sdm = sd/sqrt(n)) %>% select(manufacturer, prom, sdm, rango) cbind( mpg %>% filter(year<2004) %>% group_by(manufacturer) %>% summarise(prom99=mean(cty)), mpg %>% filter(year>2004) %>% group_by(manufacturer) %>% summarise(prom08=mean(cty)) %>% select(prom08)) %>% mutate(mejora=prom08-prom99) %>% arrange(mejora)
/tidyverse-dplyr/1-dplyr.r
no_license
jjgoye/cursoIESTA
R
false
false
884
r
library(tidyverse) mtcars %>% filter(mpg >= 24.4) %>% arrange(desc(mpg)) arrange(mtcars, mpg) mtcars %>% select(mpg,disp) mtcars %>% select(wt:gear) mtcars %>% mutate(wtkg=wt*.48) mtcars %>% group_by(cyl) %>% summarise(cyl_n = n(), cyl_mean=mean(mpg)) # deberes mpg %>% filter(manufacturer == 'toyota' & model == 'camry') mpg %>% group_by(manufacturer) %>% summarise(prom=mean(cty)) %>% arrange(prom) %>% mutate(sdm='sd(cty)') mpg %>% group_by(manufacturer) %>% summarise(prom=mean(cty), sd=sd(cty), n=n(), rango=max(cty)-min(cty)) %>% mutate(sdm = sd/sqrt(n)) %>% select(manufacturer, prom, sdm, rango) cbind( mpg %>% filter(year<2004) %>% group_by(manufacturer) %>% summarise(prom99=mean(cty)), mpg %>% filter(year>2004) %>% group_by(manufacturer) %>% summarise(prom08=mean(cty)) %>% select(prom08)) %>% mutate(mejora=prom08-prom99) %>% arrange(mejora)
## ---- initialise ---- # Main 'driver' script to create the unit sources # # Gareth Davies, Geoscience Australia 2015/16 # library(rptha) library(raster) ############################################################################### # # Main input parameters # ############################################################################### source('config.R') ## ---- takeCommandLineParameter ---- if(interactive() == FALSE){ # # Optionally take an input argument when run from Rscript. This should be # an integer giving the index of the shapefile we want to run # # This can be useful to allow the code to be run in batch on NCI # with 1 job per shapefile. # input_arguments = commandArgs(trailingOnly=TRUE) if(length(input_arguments) != 1){ print('Problem with input arguments') print(input_arguments) stop() }else{ source_index = as.numeric(input_arguments) } # Get a vector with all contours that we want to convert to unit sources all_sourcezone_shapefiles = all_sourcezone_shapefiles[source_index] all_sourcezone_downdip_shapefiles = all_sourcezone_downdip_shapefiles[source_index] sourcezone_rake = sourcezone_rake[source_index] } ## ---- makeDiscretizedSources ---- # Capture plots that occur as source is made in pdf pdf('UnitSources.pdf', width=10, height=10) # Loop over all source contour shapefiles, and make the discretized source zone discretized_sources = list() discretized_sources_statistics = list() print('Making discretized sources ...') for(source_shapefile_index in 1:length(all_sourcezone_shapefiles)){ source_shapefile = all_sourcezone_shapefiles[source_shapefile_index] source_downdip_lines = all_sourcezone_downdip_shapefiles[source_shapefile_index] # Extract a name for the source sourcename = gsub('.shp', '', basename(source_shapefile)) # Create unit sources for source_shapefile discretized_sources[[sourcename]] = discretized_source_from_source_contours(source_shapefile, desired_subfault_length, desired_subfault_width, make_plot=TRUE, downdip_lines = source_downdip_lines) # Get unit source summary stats #discretized_sources_statistics[[sourcename]] = # #discretized_source_approximate_summary_statistics( # discretized_source_summary_statistics( # discretized_sources[[sourcename]], # default_rake = sourcezone_rake[source_shapefile_index], # make_plot=TRUE) usg = unit_source_grid_to_SpatialPolygonsDataFrame( discretized_sources[[sourcename]]$unit_source_grid) proj4string(usg) = '+init=epsg:4326' writeOGR(usg, dsn=paste0(output_base_dir, 'unit_source_grid'), layer=sourcename, driver='ESRI Shapefile', overwrite=TRUE) } saveRDS(discretized_sources, paste0(output_base_dir, 'all_discretized_sources.RDS')) dev.off() # Save pdf plot ## ---- makeTsunamiSources ---- ############################################################################### # # Step 2: Make tsunami unit sources # ############################################################################### dir.create('Unit_source_data', showWarnings=FALSE) for(sourcename_index in 1:length(names(discretized_sources))){ sourcename = names(discretized_sources)[sourcename_index] # Get the discretized source ds1 = discretized_sources[[sourcename]] ## Get surface points for tsunami source source_lonlat_extent = extent(ds1$depth_contours) # Ensure tsunami extent exactly aligns with a degree # (in practice this will help us align pixels with our propagation model) tsunami_extent = rbind(floor(source_lonlat_extent[c(1,3)] - c(2,2)), ceiling(source_lonlat_extent[c(2,4)] + c(2,2))) tsunami_surface_points_lonlat = expand.grid( seq(tsunami_extent[1,1], tsunami_extent[2,1], by = tsunami_source_cellsize), seq(tsunami_extent[1,2], tsunami_extent[2,2], by = tsunami_source_cellsize)) # If elevation data is provided, lookup the depths at the tsunami surface points. if(!is.null(elevation_raster)){ use_kajiura_filter = TRUE # Need to ensure that we look up points at longitudes which are within # the raster longitude range raster_longitude_midpoint = 0.5 * (extent(elevation_raster)@xmin + extent(elevation_raster)@xmax) ltspl = length(tsunami_surface_points_lonlat[,1]) tmp_tsp = adjust_longitude_by_360_deg(tsunami_surface_points_lonlat, matrix(raster_longitude_midpoint, ncol=2, nrow=ltspl)) # Process in chunks to reduce memory usage chunk_inds = floor(seq(1, ltspl + 1, len=10)) surface_point_ocean_depths = tmp_tsp[,1]*NA for(i in 1:(length(chunk_inds)-1)){ inds = chunk_inds[i]:(chunk_inds[i+1]-1) surface_point_ocean_depths[inds] = extract(elevation_raster, tmp_tsp[inds,1:2]) gc() } # Convert negative elevation to depth, and ensure a minimum depth of 10m # for Kajiura filter. NOTE: When sources are on-land it may be better to increase # this 10m limit to avoid running out of memory (because it affects the spacing of points # in the kajiura filter). The only time I saw this was the 'makran2' source in PTHA18 surface_point_ocean_depths = pmax(-surface_point_ocean_depths, 10) rm(tmp_tsp); gc() }else{ # In this case depths are not provided, and Kajiura filtering is not used use_kajiura_filter = FALSE surface_point_ocean_depths = NULL } # Make indices for unit sources in parallel computation. # If j varies fastest then the shallow unit sources # will be submitted early, which will be efficient if # they have more interior points (if the spacing is based on the depth) ij = expand.grid(j = 1:ds1$discretized_source_dim[2], i = 1:ds1$discretized_source_dim[1]) print('Making tsunami sources in parallel...') myrake = sourcezone_rake[sourcename_index] gc() source_output_dir = paste0(output_base_dir, 'Unit_source_data/', sourcename, '/') dir.create(source_output_dir, showWarnings=FALSE, recursive=TRUE) library(parallel) # Function to facilitate running in parallel with mcmapply parallel_fun<-function(ind){ # Make a single tsunami unit source down_dip_index = ij$i[ind] along_strike_index = ij$j[ind] # Set the sub-unit-source point spacing based on the minimum sourcezone depth di = down_dip_index:(down_dip_index+1) sj = along_strike_index:(along_strike_index+1) depth_range = range(ds1$unit_source_grid[di,3,sj])*1000 approx_dx = min( max(shallow_subunitsource_point_spacing, min(depth_range)), deep_subunitsource_point_spacing) approx_dy = approx_dx # Use within-pixel integration for Okada along the top-row of unit-sources local_cell_integration_scale = cell_integration_scale * (down_dip_index == 1) tsunami_ = make_tsunami_unit_source( down_dip_index, along_strike_index, discrete_source=ds1, rake=myrake, tsunami_surface_points_lonlat = tsunami_surface_points_lonlat, approx_dx = approx_dx, approx_dy = approx_dy, depths_in_km=TRUE, kajiura_smooth=use_kajiura_filter, surface_point_ocean_depths=surface_point_ocean_depths, kajiura_grid_spacing=kajiura_grid_spacing, kajiura_where_deformation_exceeds_threshold=kajiura_use_threshold, minimal_output=minimise_tsunami_unit_source_output, verbose=FALSE, dstmx=okada_distance_factor, edge_taper_width=slip_edge_taper_width, cell_integration_scale=local_cell_integration_scale) # Save as RDS output_RDS_file = paste0(source_output_dir, sourcename, '_', down_dip_index, '_', along_strike_index, '.RDS') saveRDS(tsunami_, file = output_RDS_file) tsunami_source_raster_filename = paste0(source_output_dir, sourcename, '_', down_dip_index, '_', along_strike_index, '.tif') # Make a raster tsunami_unit_source_2_raster( tsunami_, tsunami_source_raster_filename, saveonly=TRUE, tsunami_surface_points_lonlat = tsunami_surface_points_lonlat, res=c(tsunami_source_cellsize, tsunami_source_cellsize)) gc() return(output_RDS_file) } if(MC_CORES > 1){ all_tsunami_files = mcmapply(parallel_fun, ind=as.list(1:length(ij[,1])), mc.cores=MC_CORES, mc.preschedule=TRUE, SIMPLIFY=FALSE) }else{ all_tsunami_files = mapply(parallel_fun, ind=as.list(1:length(ij[,1])), SIMPLIFY=FALSE) } if(make_pdf_plot){ # Finally -- read in all the results and make some plots all_tsunami = lapply(as.list(all_tsunami_files), f<-function(x) readRDS(x)) all_rasters = paste0(source_output_dir, '/', gsub('.RDS', '', basename(unlist(all_tsunami_files))), '.tif') all_tsunami_rast = lapply(as.list(all_rasters), f<-function(x) raster(x)) # Plotting -- make a pdf for checking the sources if(make_pdf_plot) plot_all_tsunami_unit_sources(sourcename, all_tsunami, all_tsunami_rast, ds1) rm(all_tsunami, all_tsunami_rast); gc() } } ############################################################################### # # Optional plotting (interactive) # ############################################################################### scatter3d<-function(x, y, z, add=FALSE, ...){ library(rgl) colfun = colorRamp(rainbow(255)) col_01 = (z - min(z))/(max(z) - min(z)+1.0e-20) colz = colfun(col_01) colz = rgb(colz[,1],colz[,2], colz[,3], maxColorValue=255) plot3d(x, y, z, col = colz, add=add, ...) } if(make_3d_interactive_plot){ # NOTE: The next line will need to be changed interactively sourcename = site_name #### 'alaska' all_tsunami = lapply( Sys.glob(paste0(output_base_dir, sourcename, '/Unit_source_data/', sourcename , '/', sourcename, '*.RDS')), readRDS) print('Computing unit sources for plotting in parallel...') ds1 = discretized_sources[[sourcename]] origin = ds1$unit_source_grid[1,1:2,1] source_lonlat_extent = extent(ds1$depth_contours) ## Get surface points for tsunami source tsunami_extent = rbind(floor(source_lonlat_extent[c(1,3)] - c(2,2)), ceiling(source_lonlat_extent[c(2,4)] + c(2,2))) tsunami_surface_points_lonlat = expand.grid( seq(tsunami_extent[1,1], tsunami_extent[2,1], by = tsunami_source_cellsize), seq(tsunami_extent[1,2], tsunami_extent[2,2], by = tsunami_source_cellsize)) ## Compute interior points for all unit sources for plotting purposes unit_source_indices = expand.grid(1:ds1$discretized_source_dim[1], 1:ds1$discretized_source_dim[2]) unit_source_index_list = list() for(i in 1:length(unit_source_indices[,1])){ unit_source_index_list[[i]] = c(unit_source_indices[i,1], unit_source_indices[i,2]) } library(parallel) # Make extra unit source points 'for show' us = mcmapply(unit_source_interior_points_cartesian, discretized_source=list(ds1), unit_source_index = unit_source_index_list, origin=list(origin), approx_dx = list(5000), approx_dy = list(5000), mc.preschedule=TRUE, mc.cores=MC_CORES, SIMPLIFY=FALSE) ## Make a 3D plot of the points inside the unit source #for(i in 1:length(us)){ # plot3d_unit_source_interior_points_cartesian(us[[i]], add=(i>1)) #} ## Make points of tsunami source FOR PLOTTING. ## Origin is the same as unit sources above tsunami_source_points_4plot = spherical_to_cartesian2d_coordinates( tsunami_surface_points_lonlat, origin_lonlat = origin) ## Combine all unit sources zstore = all_tsunami[[1]]$smooth_tsunami_displacement*0 for(i in 1:length(all_tsunami)){ zstore = zstore + all_tsunami[[i]]$smooth_tsunami_displacement } # Make a 3D plot of the points inside the unit source for(i in 1:length(us)){ plot3d_unit_source_interior_points_cartesian(us[[i]], add=(i>1), add_zero_plane=FALSE) } #ti = 1 scatter3d(tsunami_source_points_4plot[,1], tsunami_source_points_4plot[,2], zstore*1.0e+05, add=TRUE, size=7) }
/R/examples/austptha_template/SOURCE_ZONES/TEMPLATE/EQ_SOURCE/produce_unit_sources.R
permissive
GeoscienceAustralia/ptha
R
false
false
12,713
r
## ---- initialise ---- # Main 'driver' script to create the unit sources # # Gareth Davies, Geoscience Australia 2015/16 # library(rptha) library(raster) ############################################################################### # # Main input parameters # ############################################################################### source('config.R') ## ---- takeCommandLineParameter ---- if(interactive() == FALSE){ # # Optionally take an input argument when run from Rscript. This should be # an integer giving the index of the shapefile we want to run # # This can be useful to allow the code to be run in batch on NCI # with 1 job per shapefile. # input_arguments = commandArgs(trailingOnly=TRUE) if(length(input_arguments) != 1){ print('Problem with input arguments') print(input_arguments) stop() }else{ source_index = as.numeric(input_arguments) } # Get a vector with all contours that we want to convert to unit sources all_sourcezone_shapefiles = all_sourcezone_shapefiles[source_index] all_sourcezone_downdip_shapefiles = all_sourcezone_downdip_shapefiles[source_index] sourcezone_rake = sourcezone_rake[source_index] } ## ---- makeDiscretizedSources ---- # Capture plots that occur as source is made in pdf pdf('UnitSources.pdf', width=10, height=10) # Loop over all source contour shapefiles, and make the discretized source zone discretized_sources = list() discretized_sources_statistics = list() print('Making discretized sources ...') for(source_shapefile_index in 1:length(all_sourcezone_shapefiles)){ source_shapefile = all_sourcezone_shapefiles[source_shapefile_index] source_downdip_lines = all_sourcezone_downdip_shapefiles[source_shapefile_index] # Extract a name for the source sourcename = gsub('.shp', '', basename(source_shapefile)) # Create unit sources for source_shapefile discretized_sources[[sourcename]] = discretized_source_from_source_contours(source_shapefile, desired_subfault_length, desired_subfault_width, make_plot=TRUE, downdip_lines = source_downdip_lines) # Get unit source summary stats #discretized_sources_statistics[[sourcename]] = # #discretized_source_approximate_summary_statistics( # discretized_source_summary_statistics( # discretized_sources[[sourcename]], # default_rake = sourcezone_rake[source_shapefile_index], # make_plot=TRUE) usg = unit_source_grid_to_SpatialPolygonsDataFrame( discretized_sources[[sourcename]]$unit_source_grid) proj4string(usg) = '+init=epsg:4326' writeOGR(usg, dsn=paste0(output_base_dir, 'unit_source_grid'), layer=sourcename, driver='ESRI Shapefile', overwrite=TRUE) } saveRDS(discretized_sources, paste0(output_base_dir, 'all_discretized_sources.RDS')) dev.off() # Save pdf plot ## ---- makeTsunamiSources ---- ############################################################################### # # Step 2: Make tsunami unit sources # ############################################################################### dir.create('Unit_source_data', showWarnings=FALSE) for(sourcename_index in 1:length(names(discretized_sources))){ sourcename = names(discretized_sources)[sourcename_index] # Get the discretized source ds1 = discretized_sources[[sourcename]] ## Get surface points for tsunami source source_lonlat_extent = extent(ds1$depth_contours) # Ensure tsunami extent exactly aligns with a degree # (in practice this will help us align pixels with our propagation model) tsunami_extent = rbind(floor(source_lonlat_extent[c(1,3)] - c(2,2)), ceiling(source_lonlat_extent[c(2,4)] + c(2,2))) tsunami_surface_points_lonlat = expand.grid( seq(tsunami_extent[1,1], tsunami_extent[2,1], by = tsunami_source_cellsize), seq(tsunami_extent[1,2], tsunami_extent[2,2], by = tsunami_source_cellsize)) # If elevation data is provided, lookup the depths at the tsunami surface points. if(!is.null(elevation_raster)){ use_kajiura_filter = TRUE # Need to ensure that we look up points at longitudes which are within # the raster longitude range raster_longitude_midpoint = 0.5 * (extent(elevation_raster)@xmin + extent(elevation_raster)@xmax) ltspl = length(tsunami_surface_points_lonlat[,1]) tmp_tsp = adjust_longitude_by_360_deg(tsunami_surface_points_lonlat, matrix(raster_longitude_midpoint, ncol=2, nrow=ltspl)) # Process in chunks to reduce memory usage chunk_inds = floor(seq(1, ltspl + 1, len=10)) surface_point_ocean_depths = tmp_tsp[,1]*NA for(i in 1:(length(chunk_inds)-1)){ inds = chunk_inds[i]:(chunk_inds[i+1]-1) surface_point_ocean_depths[inds] = extract(elevation_raster, tmp_tsp[inds,1:2]) gc() } # Convert negative elevation to depth, and ensure a minimum depth of 10m # for Kajiura filter. NOTE: When sources are on-land it may be better to increase # this 10m limit to avoid running out of memory (because it affects the spacing of points # in the kajiura filter). The only time I saw this was the 'makran2' source in PTHA18 surface_point_ocean_depths = pmax(-surface_point_ocean_depths, 10) rm(tmp_tsp); gc() }else{ # In this case depths are not provided, and Kajiura filtering is not used use_kajiura_filter = FALSE surface_point_ocean_depths = NULL } # Make indices for unit sources in parallel computation. # If j varies fastest then the shallow unit sources # will be submitted early, which will be efficient if # they have more interior points (if the spacing is based on the depth) ij = expand.grid(j = 1:ds1$discretized_source_dim[2], i = 1:ds1$discretized_source_dim[1]) print('Making tsunami sources in parallel...') myrake = sourcezone_rake[sourcename_index] gc() source_output_dir = paste0(output_base_dir, 'Unit_source_data/', sourcename, '/') dir.create(source_output_dir, showWarnings=FALSE, recursive=TRUE) library(parallel) # Function to facilitate running in parallel with mcmapply parallel_fun<-function(ind){ # Make a single tsunami unit source down_dip_index = ij$i[ind] along_strike_index = ij$j[ind] # Set the sub-unit-source point spacing based on the minimum sourcezone depth di = down_dip_index:(down_dip_index+1) sj = along_strike_index:(along_strike_index+1) depth_range = range(ds1$unit_source_grid[di,3,sj])*1000 approx_dx = min( max(shallow_subunitsource_point_spacing, min(depth_range)), deep_subunitsource_point_spacing) approx_dy = approx_dx # Use within-pixel integration for Okada along the top-row of unit-sources local_cell_integration_scale = cell_integration_scale * (down_dip_index == 1) tsunami_ = make_tsunami_unit_source( down_dip_index, along_strike_index, discrete_source=ds1, rake=myrake, tsunami_surface_points_lonlat = tsunami_surface_points_lonlat, approx_dx = approx_dx, approx_dy = approx_dy, depths_in_km=TRUE, kajiura_smooth=use_kajiura_filter, surface_point_ocean_depths=surface_point_ocean_depths, kajiura_grid_spacing=kajiura_grid_spacing, kajiura_where_deformation_exceeds_threshold=kajiura_use_threshold, minimal_output=minimise_tsunami_unit_source_output, verbose=FALSE, dstmx=okada_distance_factor, edge_taper_width=slip_edge_taper_width, cell_integration_scale=local_cell_integration_scale) # Save as RDS output_RDS_file = paste0(source_output_dir, sourcename, '_', down_dip_index, '_', along_strike_index, '.RDS') saveRDS(tsunami_, file = output_RDS_file) tsunami_source_raster_filename = paste0(source_output_dir, sourcename, '_', down_dip_index, '_', along_strike_index, '.tif') # Make a raster tsunami_unit_source_2_raster( tsunami_, tsunami_source_raster_filename, saveonly=TRUE, tsunami_surface_points_lonlat = tsunami_surface_points_lonlat, res=c(tsunami_source_cellsize, tsunami_source_cellsize)) gc() return(output_RDS_file) } if(MC_CORES > 1){ all_tsunami_files = mcmapply(parallel_fun, ind=as.list(1:length(ij[,1])), mc.cores=MC_CORES, mc.preschedule=TRUE, SIMPLIFY=FALSE) }else{ all_tsunami_files = mapply(parallel_fun, ind=as.list(1:length(ij[,1])), SIMPLIFY=FALSE) } if(make_pdf_plot){ # Finally -- read in all the results and make some plots all_tsunami = lapply(as.list(all_tsunami_files), f<-function(x) readRDS(x)) all_rasters = paste0(source_output_dir, '/', gsub('.RDS', '', basename(unlist(all_tsunami_files))), '.tif') all_tsunami_rast = lapply(as.list(all_rasters), f<-function(x) raster(x)) # Plotting -- make a pdf for checking the sources if(make_pdf_plot) plot_all_tsunami_unit_sources(sourcename, all_tsunami, all_tsunami_rast, ds1) rm(all_tsunami, all_tsunami_rast); gc() } } ############################################################################### # # Optional plotting (interactive) # ############################################################################### scatter3d<-function(x, y, z, add=FALSE, ...){ library(rgl) colfun = colorRamp(rainbow(255)) col_01 = (z - min(z))/(max(z) - min(z)+1.0e-20) colz = colfun(col_01) colz = rgb(colz[,1],colz[,2], colz[,3], maxColorValue=255) plot3d(x, y, z, col = colz, add=add, ...) } if(make_3d_interactive_plot){ # NOTE: The next line will need to be changed interactively sourcename = site_name #### 'alaska' all_tsunami = lapply( Sys.glob(paste0(output_base_dir, sourcename, '/Unit_source_data/', sourcename , '/', sourcename, '*.RDS')), readRDS) print('Computing unit sources for plotting in parallel...') ds1 = discretized_sources[[sourcename]] origin = ds1$unit_source_grid[1,1:2,1] source_lonlat_extent = extent(ds1$depth_contours) ## Get surface points for tsunami source tsunami_extent = rbind(floor(source_lonlat_extent[c(1,3)] - c(2,2)), ceiling(source_lonlat_extent[c(2,4)] + c(2,2))) tsunami_surface_points_lonlat = expand.grid( seq(tsunami_extent[1,1], tsunami_extent[2,1], by = tsunami_source_cellsize), seq(tsunami_extent[1,2], tsunami_extent[2,2], by = tsunami_source_cellsize)) ## Compute interior points for all unit sources for plotting purposes unit_source_indices = expand.grid(1:ds1$discretized_source_dim[1], 1:ds1$discretized_source_dim[2]) unit_source_index_list = list() for(i in 1:length(unit_source_indices[,1])){ unit_source_index_list[[i]] = c(unit_source_indices[i,1], unit_source_indices[i,2]) } library(parallel) # Make extra unit source points 'for show' us = mcmapply(unit_source_interior_points_cartesian, discretized_source=list(ds1), unit_source_index = unit_source_index_list, origin=list(origin), approx_dx = list(5000), approx_dy = list(5000), mc.preschedule=TRUE, mc.cores=MC_CORES, SIMPLIFY=FALSE) ## Make a 3D plot of the points inside the unit source #for(i in 1:length(us)){ # plot3d_unit_source_interior_points_cartesian(us[[i]], add=(i>1)) #} ## Make points of tsunami source FOR PLOTTING. ## Origin is the same as unit sources above tsunami_source_points_4plot = spherical_to_cartesian2d_coordinates( tsunami_surface_points_lonlat, origin_lonlat = origin) ## Combine all unit sources zstore = all_tsunami[[1]]$smooth_tsunami_displacement*0 for(i in 1:length(all_tsunami)){ zstore = zstore + all_tsunami[[i]]$smooth_tsunami_displacement } # Make a 3D plot of the points inside the unit source for(i in 1:length(us)){ plot3d_unit_source_interior_points_cartesian(us[[i]], add=(i>1), add_zero_plane=FALSE) } #ti = 1 scatter3d(tsunami_source_points_4plot[,1], tsunami_source_points_4plot[,2], zstore*1.0e+05, add=TRUE, size=7) }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/hierarchy.R \name{hierarchy} \alias{hierarchy} \title{The Hierarchy class} \usage{ hierarchy(..., .list = NULL) } \arguments{ \item{...}{Any number of object of class \code{Taxon} or taxonomic names as character strings} \item{.list}{An alternate to the \code{...} input. Any number of object of class \code{\link[=taxon]{taxon()}} or character vectors in a list. Cannot be used with \code{...}.} } \value{ An \code{R6Class} object of class \code{Hierarchy} } \description{ A class containing an ordered list of \code{\link[=taxon]{taxon()}} objects that represent a hierarchical classification. } \details{ On initialization, taxa are sorted if they have ranks with a known order. \strong{Methods} \describe{ \item{\code{pop(rank_names)}}{ Remove \code{Taxon} elements by rank name, taxon name or taxon ID. The change happens in place, so you don't need to assign output to a new object. returns self - rank_names (character) a vector of rank names } \item{\code{pick(rank_names)}}{ Select \code{Taxon} elements by rank name, taxon name or taxon ID. The change happens in place, so you don't need to assign output to a new object. returns self - rank_names (character) a vector of rank names } } } \examples{ (x <- taxon( name = taxon_name("Poaceae"), rank = taxon_rank("family"), id = taxon_id(4479) )) (y <- taxon( name = taxon_name("Poa"), rank = taxon_rank("genus"), id = taxon_id(4544) )) (z <- taxon( name = taxon_name("Poa annua"), rank = taxon_rank("species"), id = taxon_id(93036) )) (res <- hierarchy(z, y, x)) res$taxa res$ranklist # pop off a rank pop(res, ranks("family")) # pick a rank (res <- hierarchy(z, y, x)) pick(res, ranks("family")) # null taxa x <- taxon(NULL) (res <- hierarchy(x, x, x)) ## similar to hierarchy(), but `taxa` slot is not empty } \seealso{ Other classes: \code{\link{hierarchies}}, \code{\link{taxa}}, \code{\link{taxmap}}, \code{\link{taxon_database}}, \code{\link{taxon_id}}, \code{\link{taxon_name}}, \code{\link{taxon_rank}}, \code{\link{taxonomy}}, \code{\link{taxon}} }
/man/hierarchy.Rd
permissive
xpingli/taxa
R
false
true
2,131
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/hierarchy.R \name{hierarchy} \alias{hierarchy} \title{The Hierarchy class} \usage{ hierarchy(..., .list = NULL) } \arguments{ \item{...}{Any number of object of class \code{Taxon} or taxonomic names as character strings} \item{.list}{An alternate to the \code{...} input. Any number of object of class \code{\link[=taxon]{taxon()}} or character vectors in a list. Cannot be used with \code{...}.} } \value{ An \code{R6Class} object of class \code{Hierarchy} } \description{ A class containing an ordered list of \code{\link[=taxon]{taxon()}} objects that represent a hierarchical classification. } \details{ On initialization, taxa are sorted if they have ranks with a known order. \strong{Methods} \describe{ \item{\code{pop(rank_names)}}{ Remove \code{Taxon} elements by rank name, taxon name or taxon ID. The change happens in place, so you don't need to assign output to a new object. returns self - rank_names (character) a vector of rank names } \item{\code{pick(rank_names)}}{ Select \code{Taxon} elements by rank name, taxon name or taxon ID. The change happens in place, so you don't need to assign output to a new object. returns self - rank_names (character) a vector of rank names } } } \examples{ (x <- taxon( name = taxon_name("Poaceae"), rank = taxon_rank("family"), id = taxon_id(4479) )) (y <- taxon( name = taxon_name("Poa"), rank = taxon_rank("genus"), id = taxon_id(4544) )) (z <- taxon( name = taxon_name("Poa annua"), rank = taxon_rank("species"), id = taxon_id(93036) )) (res <- hierarchy(z, y, x)) res$taxa res$ranklist # pop off a rank pop(res, ranks("family")) # pick a rank (res <- hierarchy(z, y, x)) pick(res, ranks("family")) # null taxa x <- taxon(NULL) (res <- hierarchy(x, x, x)) ## similar to hierarchy(), but `taxa` slot is not empty } \seealso{ Other classes: \code{\link{hierarchies}}, \code{\link{taxa}}, \code{\link{taxmap}}, \code{\link{taxon_database}}, \code{\link{taxon_id}}, \code{\link{taxon_name}}, \code{\link{taxon_rank}}, \code{\link{taxonomy}}, \code{\link{taxon}} }
### Name: USIncExp ### Title: Income and Expenditures in the US ### Aliases: USIncExp ### Keywords: datasets ### ** Examples ## These example are presented in the vignette distributed with this ## package, the code was generated by Stangle("strucchange-intro.Rnw") ################################################### ### chunk number 1: data ################################################### library(strucchange) data(USIncExp) plot(USIncExp, plot.type = "single", col = 1:2, ylab = "billion US$") legend(1960, max(USIncExp), c("income", "expenditures"), lty = c(1,1), col = 1:2, bty = "n") ################################################### ### chunk number 2: subset ################################################### library(strucchange) data(USIncExp) library(ts) USIncExp2 <- window(USIncExp, start = c(1985,12)) ################################################### ### chunk number 3: ecm-setup ################################################### coint.res <- residuals(lm(expenditure ~ income, data = USIncExp2)) coint.res <- lag(ts(coint.res, start = c(1985,12), freq = 12), k = -1) USIncExp2 <- cbind(USIncExp2, diff(USIncExp2), coint.res) USIncExp2 <- window(USIncExp2, start = c(1986,1), end = c(2001,2)) colnames(USIncExp2) <- c("income", "expenditure", "diff.income", "diff.expenditure", "coint.res") ecm.model <- diff.expenditure ~ coint.res + diff.income ################################################### ### chunk number 4: ts-used ################################################### plot(USIncExp2[,3:5], main = "") ################################################### ### chunk number 5: efp ################################################### ocus <- efp(ecm.model, type="OLS-CUSUM", data=USIncExp2) me <- efp(ecm.model, type="ME", data=USIncExp2, h=0.2) ################################################### ### chunk number 6: efp-boundary ################################################### bound.ocus <- boundary(ocus, alpha=0.05) ################################################### ### chunk number 7: OLS-CUSUM ################################################### plot(ocus) ################################################### ### chunk number 8: efp-boundary2 ################################################### plot(ocus, boundary = FALSE) lines(bound.ocus, col = 4) lines(-bound.ocus, col = 4) ################################################### ### chunk number 9: ME-null ################################################### plot(me, functional = NULL) ################################################### ### chunk number 10: efp-sctest ################################################### sctest(ocus) ################################################### ### chunk number 11: efp-sctest2 ################################################### sctest(ecm.model, type="OLS-CUSUM", data=USIncExp2) ################################################### ### chunk number 12: Fstats ################################################### fs <- Fstats(ecm.model, from = c(1990, 1), to = c(1999,6), data = USIncExp2) ################################################### ### chunk number 13: Fstats-plot ################################################### plot(fs) ################################################### ### chunk number 14: pval-plot ################################################### plot(fs, pval=TRUE) ################################################### ### chunk number 15: aveF-plot ################################################### plot(fs, aveF=TRUE) ################################################### ### chunk number 16: Fstats-sctest ################################################### sctest(fs, type="expF") ################################################### ### chunk number 17: Fstats-sctest2 ################################################### sctest(ecm.model, type = "expF", from = 49, to = 162, data = USIncExp2) ################################################### ### chunk number 18: mefp ################################################### USIncExp3 <- window(USIncExp2, start = c(1986, 1), end = c(1989,12)) me.mefp <- mefp(ecm.model, type = "ME", data = USIncExp3, alpha = 0.05) ################################################### ### chunk number 19: monitor1 ################################################### USIncExp3 <- window(USIncExp2, start = c(1986, 1), end = c(1990,12)) me.mefp <- monitor(me.mefp) ################################################### ### chunk number 20: monitor2 ################################################### USIncExp3 <- window(USIncExp2, start = c(1986, 1)) me.mefp <- monitor(me.mefp) me.mefp ################################################### ### chunk number 21: monitor-plot ################################################### plot(me.mefp) ################################################### ### chunk number 22: mefp2 ################################################### USIncExp3 <- window(USIncExp2, start = c(1986, 1), end = c(1989,12)) me.efp <- efp(ecm.model, type = "ME", data = USIncExp3, h = 0.5) me.mefp <- mefp(me.efp, alpha=0.05) ################################################### ### chunk number 23: monitor3 ################################################### USIncExp3 <- window(USIncExp2, start = c(1986, 1)) me.mefp <- monitor(me.mefp) ################################################### ### chunk number 24: monitor-plot2 ################################################### plot(me.mefp)
/code/strucchange_1.1-1/strucchange/R-ex/USIncExp.R
no_license
ethorondor/BSPT
R
false
false
5,621
r
### Name: USIncExp ### Title: Income and Expenditures in the US ### Aliases: USIncExp ### Keywords: datasets ### ** Examples ## These example are presented in the vignette distributed with this ## package, the code was generated by Stangle("strucchange-intro.Rnw") ################################################### ### chunk number 1: data ################################################### library(strucchange) data(USIncExp) plot(USIncExp, plot.type = "single", col = 1:2, ylab = "billion US$") legend(1960, max(USIncExp), c("income", "expenditures"), lty = c(1,1), col = 1:2, bty = "n") ################################################### ### chunk number 2: subset ################################################### library(strucchange) data(USIncExp) library(ts) USIncExp2 <- window(USIncExp, start = c(1985,12)) ################################################### ### chunk number 3: ecm-setup ################################################### coint.res <- residuals(lm(expenditure ~ income, data = USIncExp2)) coint.res <- lag(ts(coint.res, start = c(1985,12), freq = 12), k = -1) USIncExp2 <- cbind(USIncExp2, diff(USIncExp2), coint.res) USIncExp2 <- window(USIncExp2, start = c(1986,1), end = c(2001,2)) colnames(USIncExp2) <- c("income", "expenditure", "diff.income", "diff.expenditure", "coint.res") ecm.model <- diff.expenditure ~ coint.res + diff.income ################################################### ### chunk number 4: ts-used ################################################### plot(USIncExp2[,3:5], main = "") ################################################### ### chunk number 5: efp ################################################### ocus <- efp(ecm.model, type="OLS-CUSUM", data=USIncExp2) me <- efp(ecm.model, type="ME", data=USIncExp2, h=0.2) ################################################### ### chunk number 6: efp-boundary ################################################### bound.ocus <- boundary(ocus, alpha=0.05) ################################################### ### chunk number 7: OLS-CUSUM ################################################### plot(ocus) ################################################### ### chunk number 8: efp-boundary2 ################################################### plot(ocus, boundary = FALSE) lines(bound.ocus, col = 4) lines(-bound.ocus, col = 4) ################################################### ### chunk number 9: ME-null ################################################### plot(me, functional = NULL) ################################################### ### chunk number 10: efp-sctest ################################################### sctest(ocus) ################################################### ### chunk number 11: efp-sctest2 ################################################### sctest(ecm.model, type="OLS-CUSUM", data=USIncExp2) ################################################### ### chunk number 12: Fstats ################################################### fs <- Fstats(ecm.model, from = c(1990, 1), to = c(1999,6), data = USIncExp2) ################################################### ### chunk number 13: Fstats-plot ################################################### plot(fs) ################################################### ### chunk number 14: pval-plot ################################################### plot(fs, pval=TRUE) ################################################### ### chunk number 15: aveF-plot ################################################### plot(fs, aveF=TRUE) ################################################### ### chunk number 16: Fstats-sctest ################################################### sctest(fs, type="expF") ################################################### ### chunk number 17: Fstats-sctest2 ################################################### sctest(ecm.model, type = "expF", from = 49, to = 162, data = USIncExp2) ################################################### ### chunk number 18: mefp ################################################### USIncExp3 <- window(USIncExp2, start = c(1986, 1), end = c(1989,12)) me.mefp <- mefp(ecm.model, type = "ME", data = USIncExp3, alpha = 0.05) ################################################### ### chunk number 19: monitor1 ################################################### USIncExp3 <- window(USIncExp2, start = c(1986, 1), end = c(1990,12)) me.mefp <- monitor(me.mefp) ################################################### ### chunk number 20: monitor2 ################################################### USIncExp3 <- window(USIncExp2, start = c(1986, 1)) me.mefp <- monitor(me.mefp) me.mefp ################################################### ### chunk number 21: monitor-plot ################################################### plot(me.mefp) ################################################### ### chunk number 22: mefp2 ################################################### USIncExp3 <- window(USIncExp2, start = c(1986, 1), end = c(1989,12)) me.efp <- efp(ecm.model, type = "ME", data = USIncExp3, h = 0.5) me.mefp <- mefp(me.efp, alpha=0.05) ################################################### ### chunk number 23: monitor3 ################################################### USIncExp3 <- window(USIncExp2, start = c(1986, 1)) me.mefp <- monitor(me.mefp) ################################################### ### chunk number 24: monitor-plot2 ################################################### plot(me.mefp)
library(qfa) library(data.table) # Standardise FIT data ###################### folder="BIR1_17" skip=1 flist=file.path(folder,"ANALYSISOUT",list.files(file.path(folder,"ANALYSISOUT"),pattern="*.txt")) fdf=do.call(rbind, lapply(flist, data.table::fread,header=TRUE,sep="\t",skip=skip,stringsAsFactors=FALSE)) fdf$g=fdf$"Trimmed G(0)" fdf$r=fdf$"Trimmed r" fdf$K=fdf$"Trimmed K" fdf$v=1 fdf[,c("Area G(0)", "Area r", "Area K", "Area Error", "Greyscale G(0)", "Greyscale r", "Greyscale K", "Greyscale Error", "Trimmed G(0)", "Trimmed r", "Trimmed K", "Trimmed Error")]=NULL fdf=makeFitness(fdf) write.table(fdf,file.path(folder,"ANALYSISOUT",paste(folder,"_FIT.out",sep="")),quote=FALSE,row.names=FALSE,sep="\t") folder="cSGA" skip=0 flist=file.path(folder,"ANALYSISOUT",list.files(file.path(folder,"ANALYSISOUT"),pattern="*.txt")) fdf=do.call(rbind, lapply(flist, data.table::fread,header=TRUE,sep="\t",skip=skip,stringsAsFactors=FALSE)) fdf$v=1 fdf=makeFitness(fdf) write.table(fdf,file.path(folder,"ANALYSISOUT",paste(folder,"_FIT.out",sep="")),quote=FALSE,row.names=FALSE,sep="\t") # Create GIS.txt files ###################### o2g=fread("F:\\LOGS3\\CommonAUXILIARY\\ORF2GENEv2.txt",header=TRUE,stringsAsFactors=FALSE) genes=o2g$Gene names(genes)=o2g$ORF commonStrip=c("YDR173C","YER069W","YHR018C","YJL071W","YJL088W","YML099C","YMR042W","YMR062C","YOL058W","YOL140W","YBR248C","YCL030C","YFR025C","YER055C", "YIL020C","YIL116W","YCL018W","YGL009C","YHR002W","YLR451W","YNL104C","YOR108W","YBR115C","YDL131W","YDL182W","YDR034C","YDR234W","YGL154C", "YIL094C","YIR034C","YNR050C","YMR038C") sgd=readSGD() neighbs=getNeighbours(c("YJR089W","YEL021W"),20,sgd) StripListLink=unique(neighbs$FName) strip=c(commonStrip,StripListLink) bdf=data.table::fread("BIR1_17/ANALYSISOUT/BIR1_17_FIT.out",header=TRUE,stringsAsFactors=FALSE,sep="\t") cdf=data.table::fread("cSGA/ANALYSISOUT/cSGA_FIT.out",header=TRUE,stringsAsFactors=FALSE,sep="\t") bdf=bdf[!bdf$ORF%in%strip,] cdf=cdf[!cdf$ORF%in%strip,] bdf$Gene=genes[bdf$ORF] cdf$Gene=genes[cdf$ORF] bdf$Medium="SDM_rhl_CNGHT" cdf$Medium="SDM_rhl_CNGT" bdf$ScreenID="bir1-17" cdf$ScreenID="cSGA" bdf$PI="DAL" cdf$PI="DAL" bdf$Client="MS" cdf$Client="MS" bdf$Inoc="DIL" cdf$Inoc="DIL" bdf$Screen.Name="bir1-17" cdf$Screen.Name="cSGA" bdf$Library="SDLv2" cdf$Library="SDLv2" bdf$User="AC" cdf$User="SGA" bdf$ExptDate="2010" cdf$ExptDate="2009" bdf$TrtMed=paste(bdf$Treatment,bdf$Medium,sep="_") cdf$TrtMed=paste(cdf$Treatment,cdf$Medium,sep="_") unique(cdf$TrtMed) unique(bdf$TrtMed) ctms=c("20_SDM_rhl_CNGT","27_SDM_rhl_CNGT","37_SDM_rhl_CNGT") btms=c("20_SDM_rhl_CNGHT","27_SDM_rhl_CNGHT","37_SDM_rhl_CNGHT") bootstrap=NULL reg="lmreg" normalised=c("FALSE") fdef="MDRMDP" pdf("FitnessPlots.pdf") for(fdef in c("MDRMDP","r","K","AUC","MDR","MDP")){ bdf$fit=bdf[[fdef]] cdf$fit=cdf[[fdef]] for(wctest in c(TRUE,FALSE)){ if(wctest) {tlab="WILCOX"}else{tlab="TTEST"} for(i in seq_along(ctms)){ a=bdf[bdf$TrtMed==btms[i],] b=cdf[cdf$TrtMed==ctms[i],] clab = paste(unique(b$ScreenID),unique(b$Inoc),unique(b$Library),unique(b$User),unique(b$Screen.Name),unique(b$ExptDate),unique(b$TrtMed),collapse=" ") qlab = paste(unique(a$ScreenID),unique(a$Inoc),unique(a$Library),unique(a$User),unique(a$Screen.Name),unique(a$ExptDate),unique(a$TrtMed),collapse=" ") #root = paste(unique(QUER$Client),qfolder[1],unique(QUER$Screen.Name),qTrtMed,"vs",cfolder[1],unique(CONT$Screen.Name),cTrtMed,sep="_") #if (fileID!="") root=paste(root,fileID,sep="_") if (wctest) {testlab="Wilcoxon"}else{testlab="t-test"} #if (!is.null(bootstrap)) testlab="bootstrap" # Calculate genetic interactions and produce epistasis plot epi=qfa.epi(a,b,0.05,plot=FALSE,wctest=wctest,bootstrap=bootstrap,modcheck=FALSE,reg=reg) flab=paste("Fitness plot (",testlab,")",sep="") mmain=paste("Normalised =",normalised[1],fdef,flab,sep=" ") qfa.epiplot(epi,0.05,xxlab=clab,yylab=qlab,mmain=mmain,fmax=0) report.epi(epi$Results,file=paste(fdef,ctms[i],tlab,"GIS.txt",sep="_")) } } } dev.off()
/updateFiles.R
no_license
CnrLwlss/BIR1_17
R
false
false
4,365
r
library(qfa) library(data.table) # Standardise FIT data ###################### folder="BIR1_17" skip=1 flist=file.path(folder,"ANALYSISOUT",list.files(file.path(folder,"ANALYSISOUT"),pattern="*.txt")) fdf=do.call(rbind, lapply(flist, data.table::fread,header=TRUE,sep="\t",skip=skip,stringsAsFactors=FALSE)) fdf$g=fdf$"Trimmed G(0)" fdf$r=fdf$"Trimmed r" fdf$K=fdf$"Trimmed K" fdf$v=1 fdf[,c("Area G(0)", "Area r", "Area K", "Area Error", "Greyscale G(0)", "Greyscale r", "Greyscale K", "Greyscale Error", "Trimmed G(0)", "Trimmed r", "Trimmed K", "Trimmed Error")]=NULL fdf=makeFitness(fdf) write.table(fdf,file.path(folder,"ANALYSISOUT",paste(folder,"_FIT.out",sep="")),quote=FALSE,row.names=FALSE,sep="\t") folder="cSGA" skip=0 flist=file.path(folder,"ANALYSISOUT",list.files(file.path(folder,"ANALYSISOUT"),pattern="*.txt")) fdf=do.call(rbind, lapply(flist, data.table::fread,header=TRUE,sep="\t",skip=skip,stringsAsFactors=FALSE)) fdf$v=1 fdf=makeFitness(fdf) write.table(fdf,file.path(folder,"ANALYSISOUT",paste(folder,"_FIT.out",sep="")),quote=FALSE,row.names=FALSE,sep="\t") # Create GIS.txt files ###################### o2g=fread("F:\\LOGS3\\CommonAUXILIARY\\ORF2GENEv2.txt",header=TRUE,stringsAsFactors=FALSE) genes=o2g$Gene names(genes)=o2g$ORF commonStrip=c("YDR173C","YER069W","YHR018C","YJL071W","YJL088W","YML099C","YMR042W","YMR062C","YOL058W","YOL140W","YBR248C","YCL030C","YFR025C","YER055C", "YIL020C","YIL116W","YCL018W","YGL009C","YHR002W","YLR451W","YNL104C","YOR108W","YBR115C","YDL131W","YDL182W","YDR034C","YDR234W","YGL154C", "YIL094C","YIR034C","YNR050C","YMR038C") sgd=readSGD() neighbs=getNeighbours(c("YJR089W","YEL021W"),20,sgd) StripListLink=unique(neighbs$FName) strip=c(commonStrip,StripListLink) bdf=data.table::fread("BIR1_17/ANALYSISOUT/BIR1_17_FIT.out",header=TRUE,stringsAsFactors=FALSE,sep="\t") cdf=data.table::fread("cSGA/ANALYSISOUT/cSGA_FIT.out",header=TRUE,stringsAsFactors=FALSE,sep="\t") bdf=bdf[!bdf$ORF%in%strip,] cdf=cdf[!cdf$ORF%in%strip,] bdf$Gene=genes[bdf$ORF] cdf$Gene=genes[cdf$ORF] bdf$Medium="SDM_rhl_CNGHT" cdf$Medium="SDM_rhl_CNGT" bdf$ScreenID="bir1-17" cdf$ScreenID="cSGA" bdf$PI="DAL" cdf$PI="DAL" bdf$Client="MS" cdf$Client="MS" bdf$Inoc="DIL" cdf$Inoc="DIL" bdf$Screen.Name="bir1-17" cdf$Screen.Name="cSGA" bdf$Library="SDLv2" cdf$Library="SDLv2" bdf$User="AC" cdf$User="SGA" bdf$ExptDate="2010" cdf$ExptDate="2009" bdf$TrtMed=paste(bdf$Treatment,bdf$Medium,sep="_") cdf$TrtMed=paste(cdf$Treatment,cdf$Medium,sep="_") unique(cdf$TrtMed) unique(bdf$TrtMed) ctms=c("20_SDM_rhl_CNGT","27_SDM_rhl_CNGT","37_SDM_rhl_CNGT") btms=c("20_SDM_rhl_CNGHT","27_SDM_rhl_CNGHT","37_SDM_rhl_CNGHT") bootstrap=NULL reg="lmreg" normalised=c("FALSE") fdef="MDRMDP" pdf("FitnessPlots.pdf") for(fdef in c("MDRMDP","r","K","AUC","MDR","MDP")){ bdf$fit=bdf[[fdef]] cdf$fit=cdf[[fdef]] for(wctest in c(TRUE,FALSE)){ if(wctest) {tlab="WILCOX"}else{tlab="TTEST"} for(i in seq_along(ctms)){ a=bdf[bdf$TrtMed==btms[i],] b=cdf[cdf$TrtMed==ctms[i],] clab = paste(unique(b$ScreenID),unique(b$Inoc),unique(b$Library),unique(b$User),unique(b$Screen.Name),unique(b$ExptDate),unique(b$TrtMed),collapse=" ") qlab = paste(unique(a$ScreenID),unique(a$Inoc),unique(a$Library),unique(a$User),unique(a$Screen.Name),unique(a$ExptDate),unique(a$TrtMed),collapse=" ") #root = paste(unique(QUER$Client),qfolder[1],unique(QUER$Screen.Name),qTrtMed,"vs",cfolder[1],unique(CONT$Screen.Name),cTrtMed,sep="_") #if (fileID!="") root=paste(root,fileID,sep="_") if (wctest) {testlab="Wilcoxon"}else{testlab="t-test"} #if (!is.null(bootstrap)) testlab="bootstrap" # Calculate genetic interactions and produce epistasis plot epi=qfa.epi(a,b,0.05,plot=FALSE,wctest=wctest,bootstrap=bootstrap,modcheck=FALSE,reg=reg) flab=paste("Fitness plot (",testlab,")",sep="") mmain=paste("Normalised =",normalised[1],fdef,flab,sep=" ") qfa.epiplot(epi,0.05,xxlab=clab,yylab=qlab,mmain=mmain,fmax=0) report.epi(epi$Results,file=paste(fdef,ctms[i],tlab,"GIS.txt",sep="_")) } } } dev.off()
#' Determine temporal resolution #' #' @description Performs minimum time step standardization, #' gap filling and start/end time selection. This function #' provides the option to select the minimum temporal step size of an #' \code{\link{is.trex}} object. Additionally, the user can define the #' start and end time of the series and select the minimum size under #' which gaps should be filled, using linear interpolation. #' #' @usage dt.steps(input, start, #' end, time.int = 10, max.gap = 60, #' decimals = 10, df = FALSE) #' #' @param input An \code{\link{is.trex}}-compliant (output) object #' @param start Character string providing the start time for the series. #' Format has to be provided in "UTC" (e.g., "2012-05-28 00:00" or #' Year-Month-Day Hour:Minute). Starting time should not be earlier #' than the start of the series. #' @param end Character string providing the start time for the series. #' Format has to be provided in "UTC" (e.g., "2012-06-28 00:50" or #' Year-Month-Day Hour:Minute). End time should be earlier than #' the end time and not later than that of the series. #' @param time.int Numeric value providing the number of minutes for the #' minimum time step. When \code{time.int} is smaller than the minimum time step #' of the series, a linear interpolation is applied. If \code{time.int} is #' larger than the minimum time step of the series values are averaged to the chosen #' value of \code{time.int} (after performing a linear interpolation #' to obtain a one-minute resolution). #' @param max.gap Numeric value providing the maximum size of a gap in minutes, #' which can be filled by performing a linear interpolation. #' @param decimals Integer value defining the number of decimals of the output #' (default = 10). #' @param df Logical; if \code{TRUE}, output is provided in a \code{data.frame} #' format with a timestamp and a value (\eqn{\Delta T} or \eqn{\Delta V}) column. #' If \code{FALSE}, output is provided as a \code{zoo} object (default = FALSE). #' #' @description Time series have different temporal resolutions. #' This function provides the option to standardize the minimum time step by #' either performing a linear interpolation when the requested time step #' is smaller than the minimum time step of the series or average values when #' the requested time step is larger than the minimum time step of the series. #' Before this process, the entire time series is converted to a one-minute time #' step by applying a linear interpolation (excluding gap \eqn{periods > \code{max.gap}}). #' #' @return A \code{zoo} object or \code{data.frame} in the appropriate #' format for further processing. #' #' @export #' #' @examples #' \dontrun{ #' input <- is.trex(example.data(type="doy"), #' tz="GMT",time.format="%H:%M", solar.time=TRUE, #' long.deg=7.7459,ref.add=FALSE) #' in.ts <- dt.steps(input=input,start='2012-06-28 00:00',end='2012-07-28 00:00', #' time.int=60,max.gap=120,decimals=6,df=FALSE) #' plot(in.ts) #' head(in.ts) #' } dt.steps <- function(input, start, end, time.int = 10, max.gap = 60, decimals = 10, df = FALSE) { #test #input=add1 #time.int=60 #max.gap=120 #decimals=10 #df=FALSE #length(input) #tail(input) #start=as.character(zoo::index(head(t, 1))) #end=as.character(zoo::index(tail(t, 1))) #time.int=15 #max.gap=15 #decimals=10 #df=FALSE #tz="UTC" #p= process if (attributes(input)$class == "data.frame") { #e if (is.numeric(input$value) == F) stop("Invalid input data, values within the data.frame are not numeric.") if (is.character(input$timestamp) == F) stop("Invalid input data, timestamp within the data.frame are not numeric.") #p input <- zoo::zoo( input$value, order.by = base::as.POSIXct(input$timestamp, format = "%Y-%m-%d %H:%M:%S", tz = "UTC") ) #e if (as.character(zoo::index(input)[1]) == "(NA NA)" | is.na(zoo::index(input)[1]) == T) stop("No timestamp present, time.format is likely incorrect.") } #d= default conditions if (missing(start)) { start = as.character(zoo::index(input))[1] } if (missing(end)) { end = as.character(zoo::index(input))[length(input)] } if (missing(time.int)) { time.int <- 15 } if (missing(max.gap)) { max.gap <- 60 } if (missing(decimals)) { decimals <- 10 } if (missing(df)) { df = F } if (df != T & df != F) stop("Unused argument, df needs to be TRUE|FALSE.") #e= errors if (zoo::is.zoo(input) == F) stop( "Invalid input data, use a zoo file from is.trex or a zoo vector containing numeric values (tz= UTC)." ) if (is.numeric(input) == F) stop("Invalid input data, values within the vector are not numeric.") if (is.character(start) == F) stop("Unused argument, start is not a character (format= %Y-%m-%d %H:%M:%S).") if (is.character(end) == F) stop("Unused argument, end is not a character (format= %Y-%m-%d %H:%M:%S).") if (is.numeric(max.gap) == F) stop("Unused argument, max.gap is not numeric.") if (is.numeric(time.int) == F) stop("Unused argument, time.int is not numeric.") if (is.numeric(decimals) == F) stop("Unused argument, decimals is not numeric.") if (decimals < 3 | decimals > 15) stop("Unused argument, decimals can only fall between 3-15.") if (nchar(start)==16){start<-base::paste0(start,":00")} if (nchar(end)==16){end<-base::paste0(end,":00")} #p ts.start <- as.POSIXct(as.character(base::paste0(start)), format = "%Y-%m-%d %H:%M:%S", tz = "UTC") - 1 ts.end <- as.POSIXct(as.character(base::paste0(end)), format = "%Y-%m-%d %H:%M:%S", tz = "UTC") + 1 #e if (is.na(ts.start) == TRUE) stop("Unused argument, start is not in the correct format (%Y-%m-%d %H:%M:%S).") if (is.na(ts.end) == TRUE) stop("Unused argument, end is not in the correct format (%Y-%m-%d %H:%M:%S).") if (round(as.numeric(ts.start - zoo::index(input[1]))) < -1) stop("Unused argument, start is earlier than start of the timestamp.") if (round(as.numeric(zoo::index(input[length(input)]) - ts.end)) < -1) stop("Unused argument, end is later than end of the timestamp.") #p value <- stats::na.omit(stats::window(input, start = ts.start, end = ts.end)) value <- (stats::na.omit(value)) raw.gap <- as.numeric(difftime( zoo::index(value)[-1], zoo::index(value[-length(value)]), tz = "UTC", units = c("mins") )) gap <- c(raw.gap, NA) #minimum gap in minutes #d if (missing(max.gap)) { max.gap <- min(raw.gap) } #e if (min(gap, na.rm = TRUE) > max.gap) stop("Unused argument, min.gap is smaller the minimum timestep.") #w= warnings if (time.int > (60 * 24)) { warning("Selected time.int is larger than a day.") } #c if (time.int > min(gap, na.rm = TRUE)) { #p gap <- zoo::zoo(gap, order.by = zoo::index(value)) dummy <- zoo::zoo(NA, order.by = seq( from = ts.start + 1, to = ts.end - 1, by = (60 * 1) )) #*time.int proc.1 <- zoo::cbind.zoo(value, gap, dummy) proc.1[which(is.na(proc.1$value) == F), "dummy"] <- 0 proc.1$value <- zoo::na.approx(proc.1$value, na.rm = F) proc.1$gap <- zoo::na.locf(proc.1$gap, na.rm = F) proc.1[which(is.na(proc.1$value) == TRUE), "gap"] <- NA proc.1[which(proc.1$dummy == 0), "gap"] <- 0 add <- zoo::rollapply( proc.1$value, time.int, align = "center", FUN = mean, na.rm = TRUE, partial = TRUE ) add[which(as.character(add) == "NaN")] <- NA proc.1$value <- add }else{ #p gap <- zoo::zoo(gap, order.by = zoo::index(value)) dummy <- zoo::zoo(NA, order.by = seq( from = ts.start + 1, to = ts.end - 1, by = (60 * time.int) )) proc.1 <- zoo::cbind.zoo(value, gap, dummy) proc.1[which(is.na(proc.1$value) == F), "dummy"] <- 0 proc.1$value <- zoo::na.approx(proc.1$value, na.rm = F) proc.1$gap <- zoo::na.locf(proc.1$gap, na.rm = F) proc.1[which(is.na(proc.1$value) == TRUE), "gap"] <- NA proc.1[which(proc.1$dummy == 0), "gap"] <- 0 } #p proc.1$value <- zoo::na.locf(zoo::na.locf(proc.1$value, na.rm = F), fromLast = TRUE) proc.1[which(proc.1$gap > max.gap), "value"] <- NA proc.1$value <- round(proc.1$value, decimals) #o= output output.data <- proc.1[which(as.character(zoo::index(proc.1)) %in% as.character(seq( from = ts.start + 1, to = ts.end - 1, by = (60 * time.int) ))), "value"] length(output.data) #remove values outside of the range start.input<-zoo::index(na.omit(input))[1]-1 start.output<-zoo::index(na.omit(output.data))[1] if(start.input!=start.output){ window(output.data,start=start.output,end=start.input)<-NA } end.input<-zoo::index(na.omit(input))[length(zoo::index(na.omit(input)))]+1 end.output<-zoo::index(na.omit(output.data))[length(zoo::index(na.omit(output.data)))] if(end.input!=end.output){ window(output.data,start=end.input,end=end.output)<-NA } if (df == T) { output.data <- data.frame(timestamp = as.character(zoo::index(output.data)), value = as.numeric(as.character(output.data))) output.data$timestamp <- as.character(output.data$timestamp) output.data$value <- as.numeric(output.data$value) } return(output.data) }
/R/dt.steps.R
permissive
the-Hull/TREX
R
false
false
11,118
r
#' Determine temporal resolution #' #' @description Performs minimum time step standardization, #' gap filling and start/end time selection. This function #' provides the option to select the minimum temporal step size of an #' \code{\link{is.trex}} object. Additionally, the user can define the #' start and end time of the series and select the minimum size under #' which gaps should be filled, using linear interpolation. #' #' @usage dt.steps(input, start, #' end, time.int = 10, max.gap = 60, #' decimals = 10, df = FALSE) #' #' @param input An \code{\link{is.trex}}-compliant (output) object #' @param start Character string providing the start time for the series. #' Format has to be provided in "UTC" (e.g., "2012-05-28 00:00" or #' Year-Month-Day Hour:Minute). Starting time should not be earlier #' than the start of the series. #' @param end Character string providing the start time for the series. #' Format has to be provided in "UTC" (e.g., "2012-06-28 00:50" or #' Year-Month-Day Hour:Minute). End time should be earlier than #' the end time and not later than that of the series. #' @param time.int Numeric value providing the number of minutes for the #' minimum time step. When \code{time.int} is smaller than the minimum time step #' of the series, a linear interpolation is applied. If \code{time.int} is #' larger than the minimum time step of the series values are averaged to the chosen #' value of \code{time.int} (after performing a linear interpolation #' to obtain a one-minute resolution). #' @param max.gap Numeric value providing the maximum size of a gap in minutes, #' which can be filled by performing a linear interpolation. #' @param decimals Integer value defining the number of decimals of the output #' (default = 10). #' @param df Logical; if \code{TRUE}, output is provided in a \code{data.frame} #' format with a timestamp and a value (\eqn{\Delta T} or \eqn{\Delta V}) column. #' If \code{FALSE}, output is provided as a \code{zoo} object (default = FALSE). #' #' @description Time series have different temporal resolutions. #' This function provides the option to standardize the minimum time step by #' either performing a linear interpolation when the requested time step #' is smaller than the minimum time step of the series or average values when #' the requested time step is larger than the minimum time step of the series. #' Before this process, the entire time series is converted to a one-minute time #' step by applying a linear interpolation (excluding gap \eqn{periods > \code{max.gap}}). #' #' @return A \code{zoo} object or \code{data.frame} in the appropriate #' format for further processing. #' #' @export #' #' @examples #' \dontrun{ #' input <- is.trex(example.data(type="doy"), #' tz="GMT",time.format="%H:%M", solar.time=TRUE, #' long.deg=7.7459,ref.add=FALSE) #' in.ts <- dt.steps(input=input,start='2012-06-28 00:00',end='2012-07-28 00:00', #' time.int=60,max.gap=120,decimals=6,df=FALSE) #' plot(in.ts) #' head(in.ts) #' } dt.steps <- function(input, start, end, time.int = 10, max.gap = 60, decimals = 10, df = FALSE) { #test #input=add1 #time.int=60 #max.gap=120 #decimals=10 #df=FALSE #length(input) #tail(input) #start=as.character(zoo::index(head(t, 1))) #end=as.character(zoo::index(tail(t, 1))) #time.int=15 #max.gap=15 #decimals=10 #df=FALSE #tz="UTC" #p= process if (attributes(input)$class == "data.frame") { #e if (is.numeric(input$value) == F) stop("Invalid input data, values within the data.frame are not numeric.") if (is.character(input$timestamp) == F) stop("Invalid input data, timestamp within the data.frame are not numeric.") #p input <- zoo::zoo( input$value, order.by = base::as.POSIXct(input$timestamp, format = "%Y-%m-%d %H:%M:%S", tz = "UTC") ) #e if (as.character(zoo::index(input)[1]) == "(NA NA)" | is.na(zoo::index(input)[1]) == T) stop("No timestamp present, time.format is likely incorrect.") } #d= default conditions if (missing(start)) { start = as.character(zoo::index(input))[1] } if (missing(end)) { end = as.character(zoo::index(input))[length(input)] } if (missing(time.int)) { time.int <- 15 } if (missing(max.gap)) { max.gap <- 60 } if (missing(decimals)) { decimals <- 10 } if (missing(df)) { df = F } if (df != T & df != F) stop("Unused argument, df needs to be TRUE|FALSE.") #e= errors if (zoo::is.zoo(input) == F) stop( "Invalid input data, use a zoo file from is.trex or a zoo vector containing numeric values (tz= UTC)." ) if (is.numeric(input) == F) stop("Invalid input data, values within the vector are not numeric.") if (is.character(start) == F) stop("Unused argument, start is not a character (format= %Y-%m-%d %H:%M:%S).") if (is.character(end) == F) stop("Unused argument, end is not a character (format= %Y-%m-%d %H:%M:%S).") if (is.numeric(max.gap) == F) stop("Unused argument, max.gap is not numeric.") if (is.numeric(time.int) == F) stop("Unused argument, time.int is not numeric.") if (is.numeric(decimals) == F) stop("Unused argument, decimals is not numeric.") if (decimals < 3 | decimals > 15) stop("Unused argument, decimals can only fall between 3-15.") if (nchar(start)==16){start<-base::paste0(start,":00")} if (nchar(end)==16){end<-base::paste0(end,":00")} #p ts.start <- as.POSIXct(as.character(base::paste0(start)), format = "%Y-%m-%d %H:%M:%S", tz = "UTC") - 1 ts.end <- as.POSIXct(as.character(base::paste0(end)), format = "%Y-%m-%d %H:%M:%S", tz = "UTC") + 1 #e if (is.na(ts.start) == TRUE) stop("Unused argument, start is not in the correct format (%Y-%m-%d %H:%M:%S).") if (is.na(ts.end) == TRUE) stop("Unused argument, end is not in the correct format (%Y-%m-%d %H:%M:%S).") if (round(as.numeric(ts.start - zoo::index(input[1]))) < -1) stop("Unused argument, start is earlier than start of the timestamp.") if (round(as.numeric(zoo::index(input[length(input)]) - ts.end)) < -1) stop("Unused argument, end is later than end of the timestamp.") #p value <- stats::na.omit(stats::window(input, start = ts.start, end = ts.end)) value <- (stats::na.omit(value)) raw.gap <- as.numeric(difftime( zoo::index(value)[-1], zoo::index(value[-length(value)]), tz = "UTC", units = c("mins") )) gap <- c(raw.gap, NA) #minimum gap in minutes #d if (missing(max.gap)) { max.gap <- min(raw.gap) } #e if (min(gap, na.rm = TRUE) > max.gap) stop("Unused argument, min.gap is smaller the minimum timestep.") #w= warnings if (time.int > (60 * 24)) { warning("Selected time.int is larger than a day.") } #c if (time.int > min(gap, na.rm = TRUE)) { #p gap <- zoo::zoo(gap, order.by = zoo::index(value)) dummy <- zoo::zoo(NA, order.by = seq( from = ts.start + 1, to = ts.end - 1, by = (60 * 1) )) #*time.int proc.1 <- zoo::cbind.zoo(value, gap, dummy) proc.1[which(is.na(proc.1$value) == F), "dummy"] <- 0 proc.1$value <- zoo::na.approx(proc.1$value, na.rm = F) proc.1$gap <- zoo::na.locf(proc.1$gap, na.rm = F) proc.1[which(is.na(proc.1$value) == TRUE), "gap"] <- NA proc.1[which(proc.1$dummy == 0), "gap"] <- 0 add <- zoo::rollapply( proc.1$value, time.int, align = "center", FUN = mean, na.rm = TRUE, partial = TRUE ) add[which(as.character(add) == "NaN")] <- NA proc.1$value <- add }else{ #p gap <- zoo::zoo(gap, order.by = zoo::index(value)) dummy <- zoo::zoo(NA, order.by = seq( from = ts.start + 1, to = ts.end - 1, by = (60 * time.int) )) proc.1 <- zoo::cbind.zoo(value, gap, dummy) proc.1[which(is.na(proc.1$value) == F), "dummy"] <- 0 proc.1$value <- zoo::na.approx(proc.1$value, na.rm = F) proc.1$gap <- zoo::na.locf(proc.1$gap, na.rm = F) proc.1[which(is.na(proc.1$value) == TRUE), "gap"] <- NA proc.1[which(proc.1$dummy == 0), "gap"] <- 0 } #p proc.1$value <- zoo::na.locf(zoo::na.locf(proc.1$value, na.rm = F), fromLast = TRUE) proc.1[which(proc.1$gap > max.gap), "value"] <- NA proc.1$value <- round(proc.1$value, decimals) #o= output output.data <- proc.1[which(as.character(zoo::index(proc.1)) %in% as.character(seq( from = ts.start + 1, to = ts.end - 1, by = (60 * time.int) ))), "value"] length(output.data) #remove values outside of the range start.input<-zoo::index(na.omit(input))[1]-1 start.output<-zoo::index(na.omit(output.data))[1] if(start.input!=start.output){ window(output.data,start=start.output,end=start.input)<-NA } end.input<-zoo::index(na.omit(input))[length(zoo::index(na.omit(input)))]+1 end.output<-zoo::index(na.omit(output.data))[length(zoo::index(na.omit(output.data)))] if(end.input!=end.output){ window(output.data,start=end.input,end=end.output)<-NA } if (df == T) { output.data <- data.frame(timestamp = as.character(zoo::index(output.data)), value = as.numeric(as.character(output.data))) output.data$timestamp <- as.character(output.data$timestamp) output.data$value <- as.numeric(output.data$value) } return(output.data) }
% Generated by roxygen2 (4.1.1): do not edit by hand % Please edit documentation in R/czas.R \name{czas} \alias{czas} \title{Funkcja sprawdza czy dwie wartosci liczbowe sa "podobne"} \usage{ czas(czas_glowny, czas_por) } \arguments{ \item{czas_glowny}{pierwsza wartosc numeryczna, liczba naturalna} \item{czas_por}{druga wartosc numeryczna, liczba naturalna} } \value{ wartosc numeryczna 1, jesli istnieje istotne podobienstwo miedzy wartosciami, 0 wpp } \description{ Funkcja \code{czas} sprawdza czy dwie wartosci liczbowe sa "podobne" (w domysle chodzi o czas trwania filmu) } \author{ Emilia Momotko }
/faza2JMS/pakiet/FilmyJMS/man/czas.Rd
no_license
Emomotko/Filmy
R
false
false
608
rd
% Generated by roxygen2 (4.1.1): do not edit by hand % Please edit documentation in R/czas.R \name{czas} \alias{czas} \title{Funkcja sprawdza czy dwie wartosci liczbowe sa "podobne"} \usage{ czas(czas_glowny, czas_por) } \arguments{ \item{czas_glowny}{pierwsza wartosc numeryczna, liczba naturalna} \item{czas_por}{druga wartosc numeryczna, liczba naturalna} } \value{ wartosc numeryczna 1, jesli istnieje istotne podobienstwo miedzy wartosciami, 0 wpp } \description{ Funkcja \code{czas} sprawdza czy dwie wartosci liczbowe sa "podobne" (w domysle chodzi o czas trwania filmu) } \author{ Emilia Momotko }