content
large_stringlengths
0
6.46M
path
large_stringlengths
3
331
license_type
large_stringclasses
2 values
repo_name
large_stringlengths
5
125
language
large_stringclasses
1 value
is_vendor
bool
2 classes
is_generated
bool
2 classes
length_bytes
int64
4
6.46M
extension
large_stringclasses
75 values
text
stringlengths
0
6.46M
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/critical_moments.R \name{Critical_Moments_Functions} \alias{Critical_Moments_Functions} \alias{critical_moment_breakage} \alias{critical_moment_overturning} \title{Critical Moments Functions} \usage{ critical_moment_breakage(dbh, ht, cr_depth, mor, fknot) critical_moment_overturning(c_reg, stem_density, stem_vol) } \arguments{ \item{dbh}{The dbh (cm) of a tree.} \item{ht}{The height (m) of a tree.} \item{cr_depth}{The length (m) of the tree crown.} \item{mor}{Modulus of Rupture (MPa) of green wood.} \item{fknot}{Knot factor. Dimensionless.} \item{c_reg}{Regression coefficients (N m kg-1) of uprooting moment against stem weight.} \item{stem_density}{Density (kg m-3) of green wood of the stem.} \item{stem_vol}{Volume (m3) of the stem of the mean tree in the stand.} } \description{ Calculate the critical moments for breakage and overturning }
/man/Critical_Moments_Functions.Rd
no_license
MarineDuperat/fgr
R
false
true
938
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/critical_moments.R \name{Critical_Moments_Functions} \alias{Critical_Moments_Functions} \alias{critical_moment_breakage} \alias{critical_moment_overturning} \title{Critical Moments Functions} \usage{ critical_moment_breakage(dbh, ht, cr_depth, mor, fknot) critical_moment_overturning(c_reg, stem_density, stem_vol) } \arguments{ \item{dbh}{The dbh (cm) of a tree.} \item{ht}{The height (m) of a tree.} \item{cr_depth}{The length (m) of the tree crown.} \item{mor}{Modulus of Rupture (MPa) of green wood.} \item{fknot}{Knot factor. Dimensionless.} \item{c_reg}{Regression coefficients (N m kg-1) of uprooting moment against stem weight.} \item{stem_density}{Density (kg m-3) of green wood of the stem.} \item{stem_vol}{Volume (m3) of the stem of the mean tree in the stand.} } \description{ Calculate the critical moments for breakage and overturning }
# *------------------------------------------------------------------ # | FUNCTION NAME: pca_plot_wrapper # | FILE NAME: pca_plot.R # | DATE: # | CREATED BY: Jim Stagge # *------------------------------------------------------------------ # | Parameter: # | In: data - a dataframe with PCA importance data # | write_folder - location to save plots # | write_file - file name for plots # | # | Out: # | # | Desc: Runs the following three PCA diagnostic plots # | # *------------------------------------------------------------------ pca_plot_wrapper <- function(data, write_folder, write_file){ require(ggplot2) require(svglite) ### Set up output folders dir.create(file.path(file.path(write_folder,"png"), write_file), recursive=TRUE) dir.create(file.path(file.path(write_folder,"pdf"), write_file), recursive=TRUE) dir.create(file.path(file.path(write_folder,"svg"), write_file), recursive=TRUE) ### Run Eigen Plot p <- pca_eigen_plot(importance=data) ### Save Eigen Plot plot_name <- paste0(write_file, "_eigen") ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p, width=4, height=3, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p, width=4, height=3) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p, width=4, height=3) ### Run Variance Explained Plot p <- pca_var_plot(importance=data) ### Save Eigen Plot plot_name <- paste0(write_file, "_var") ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p, width=4, height=3, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p, width=4, height=3) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p, width=4, height=3) ### Run Eigen Plot p <- pca_cum_var_plot(importance=data) ### Save Eigen Plot plot_name <- paste0(write_file, "_cum_var") ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p, width=4, height=3, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p, width=4, height=3) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p, width=4, height=3) } # *------------------------------------------------------------------ # | FUNCTION NAME: pca_loading_plot_wrapper # | FILE NAME: pca_loading_plot_wrapper.R # | DATE: # | CREATED BY: Jim Stagge # *------------------------------------------------------------------ # | Parameter: # | In: pca_loading - a dataframe of loadings # | pc.n - number of pcs to plot # | write_folder - folder to write figures # | write_file - file name to write figures # | Out: # | # | Desc: This function runs through all PC loading figures. # *------------------------------------------------------------------ pca_loading_plot_wrapper <- function(pca_loading, pc.n, write_folder, write_file){ require(ggplot2) require(svglite) ### Calculate contribution of loading to total by first finding absolute value, summing ### and dividing each PC loading by sum abs_load <- abs(pca_loading) load_contrib <- sweep(abs_load, 2, colSums(abs_load), "/") ### Create loop through all PCs for (k in seq(1,pc.n)) { ### Create a data frame for loading map plot_df <- data.frame(ID=rownames(pca_loading), Loading=pca_loading[,k], Contribution=load_contrib[,k]) plot_df <- merge(wadr_site, plot_df, by="ID") ### Re-sort data frame listing biggest contribution first plot_df <- plot_df[order(-plot_df$Contribution),] ### Set the plotting limits based on max and min coordinates lon.lim <- c(min(plot_df$Lon)-0.25,max(plot_df$Lon)+0.25) lat.lim <- c(min(plot_df$Lat)-0.25,max(plot_df$Lat)+0.25) ### Make species uppercase plot_df$genus <- cap_first(as.character(plot_df$genus)) ### Create plot p <- loading_map(plot_data=plot_df, map_underlay=map_big, map_borders=states, site_locations=site_info, lon.lim=lon.lim, lat.lim=lat.lim) ### Save Loading Plot plot_name <- paste0(write_file, "_load_map_PC_",k,"_all") ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p, width=6, height=7, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p, width=6, height=7) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p, width=6, height=7) ### Add labels p <- p + geom_text_repel(data=plot_df, aes(x=Lon, y=Lat, label = ID), size = 3, nudge_x=0.2, nudge_y=0.05, box.padding = unit(0.5, 'lines')) ### Save Loading Plot with Labels plot_name <- paste0(write_file, "_load_map_PC_",k,"_all_labels") ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p, width=6, height=7, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p, width=6, height=7) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p, width=6, height=7) ### Extract a subset of sites plot_subset <- subset(plot_df, Contribution > mean(plot_df$Contribution)*1.2) ### Create subset plot p <- loading_map(plot_data=plot_subset, map_underlay=map_big, map_borders=states, site_locations=site_info, lon.lim=lon.lim, lat.lim=lat.lim) ### Save Loading Plot plot_name <- paste0(write_file, "_load_map_PC_",k,"_subset") ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p, width=6, height=7, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p, width=6, height=7) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p, width=6, height=7) ### Save to publication if (k %in% seq(1,5) & write_file== "pca_impute"){ plot_name <- paste0("fig_4",toupper(letters)[k]) ggsave(file.path(file.path(pub_path,"png"), paste0(plot_name , "_map.png")), p, width=6, height=7, dpi=600) ggsave(file.path(file.path(pub_path,"svg"), paste0(plot_name , "_map.svg")), p, width=6, height=7) ggsave(file.path(file.path(pub_path,"pdf"), paste0(plot_name , "_map.pdf")), p, width=6, height=7) } ### Add labels p <- p + geom_text_repel(data=plot_subset, aes(x=Lon, y=Lat, label = ID), size = 3, nudge_x=0.2, nudge_y=0.05, box.padding = unit(0.5, 'lines')) ### Save Loading Plot with Labels plot_name <- paste0(write_file, "_load_map_PC_",k,"_subset_labels") ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p, width=6, height=7, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p, width=6, height=7) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p, width=6, height=7) ### Create loading plot by genus p <- loading_genus(plot_data=plot_df, pc_number = k) ### Save Loading Plot by species plot_name <- paste0(write_file, "_load_species_PC_",k) ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p$plot, width=8, height=4, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p$plot, width=8, height=4) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p$plot, width=8, height=4) ### Save to publication if (k %in% seq(1,5) & write_file== "pca_impute"){ plot_name <- paste0("fig_4",toupper(letters)[k]) ggsave(file.path(file.path(pub_path,"png"), paste0(plot_name , "_species.png")), p$plot, width=8, height=4, dpi=600) ggsave(file.path(file.path(pub_path,"svg"), paste0(plot_name , "_species.svg")), p$plot, width=8, height=4) ggsave(file.path(file.path(pub_path,"pdf"), paste0(plot_name , "_species.pdf")), p$plot, width=8, height=4) } ### Save Loading Plot by species Legend plot_name <- paste0(write_file, "_load_species_PC_",k,"_legend") ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p$legend, width=3, height=4, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p$legend, width=3, height=4) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p$legend, width=3, height=4) ### Save to publication if (k == 1 & write_file== "pca_impute"){ plot_name <- "fig_4" ggsave(file.path(file.path(pub_path,"png"), paste0(plot_name , "_legend.png")), p$legend, width=3, height=4, dpi=600) ggsave(file.path(file.path(pub_path,"svg"), paste0(plot_name , "_legend.svg")), p$legend, width=3, height=4) ggsave(file.path(file.path(pub_path,"pdf"), paste0(plot_name , "_legend.pdf")), p$legend, width=3, height=4) } } }
/code/functions/pca_plot_wrappers.R
permissive
jstagge/monthly_paleo
R
false
false
9,081
r
# *------------------------------------------------------------------ # | FUNCTION NAME: pca_plot_wrapper # | FILE NAME: pca_plot.R # | DATE: # | CREATED BY: Jim Stagge # *------------------------------------------------------------------ # | Parameter: # | In: data - a dataframe with PCA importance data # | write_folder - location to save plots # | write_file - file name for plots # | # | Out: # | # | Desc: Runs the following three PCA diagnostic plots # | # *------------------------------------------------------------------ pca_plot_wrapper <- function(data, write_folder, write_file){ require(ggplot2) require(svglite) ### Set up output folders dir.create(file.path(file.path(write_folder,"png"), write_file), recursive=TRUE) dir.create(file.path(file.path(write_folder,"pdf"), write_file), recursive=TRUE) dir.create(file.path(file.path(write_folder,"svg"), write_file), recursive=TRUE) ### Run Eigen Plot p <- pca_eigen_plot(importance=data) ### Save Eigen Plot plot_name <- paste0(write_file, "_eigen") ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p, width=4, height=3, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p, width=4, height=3) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p, width=4, height=3) ### Run Variance Explained Plot p <- pca_var_plot(importance=data) ### Save Eigen Plot plot_name <- paste0(write_file, "_var") ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p, width=4, height=3, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p, width=4, height=3) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p, width=4, height=3) ### Run Eigen Plot p <- pca_cum_var_plot(importance=data) ### Save Eigen Plot plot_name <- paste0(write_file, "_cum_var") ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p, width=4, height=3, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p, width=4, height=3) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p, width=4, height=3) } # *------------------------------------------------------------------ # | FUNCTION NAME: pca_loading_plot_wrapper # | FILE NAME: pca_loading_plot_wrapper.R # | DATE: # | CREATED BY: Jim Stagge # *------------------------------------------------------------------ # | Parameter: # | In: pca_loading - a dataframe of loadings # | pc.n - number of pcs to plot # | write_folder - folder to write figures # | write_file - file name to write figures # | Out: # | # | Desc: This function runs through all PC loading figures. # *------------------------------------------------------------------ pca_loading_plot_wrapper <- function(pca_loading, pc.n, write_folder, write_file){ require(ggplot2) require(svglite) ### Calculate contribution of loading to total by first finding absolute value, summing ### and dividing each PC loading by sum abs_load <- abs(pca_loading) load_contrib <- sweep(abs_load, 2, colSums(abs_load), "/") ### Create loop through all PCs for (k in seq(1,pc.n)) { ### Create a data frame for loading map plot_df <- data.frame(ID=rownames(pca_loading), Loading=pca_loading[,k], Contribution=load_contrib[,k]) plot_df <- merge(wadr_site, plot_df, by="ID") ### Re-sort data frame listing biggest contribution first plot_df <- plot_df[order(-plot_df$Contribution),] ### Set the plotting limits based on max and min coordinates lon.lim <- c(min(plot_df$Lon)-0.25,max(plot_df$Lon)+0.25) lat.lim <- c(min(plot_df$Lat)-0.25,max(plot_df$Lat)+0.25) ### Make species uppercase plot_df$genus <- cap_first(as.character(plot_df$genus)) ### Create plot p <- loading_map(plot_data=plot_df, map_underlay=map_big, map_borders=states, site_locations=site_info, lon.lim=lon.lim, lat.lim=lat.lim) ### Save Loading Plot plot_name <- paste0(write_file, "_load_map_PC_",k,"_all") ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p, width=6, height=7, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p, width=6, height=7) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p, width=6, height=7) ### Add labels p <- p + geom_text_repel(data=plot_df, aes(x=Lon, y=Lat, label = ID), size = 3, nudge_x=0.2, nudge_y=0.05, box.padding = unit(0.5, 'lines')) ### Save Loading Plot with Labels plot_name <- paste0(write_file, "_load_map_PC_",k,"_all_labels") ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p, width=6, height=7, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p, width=6, height=7) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p, width=6, height=7) ### Extract a subset of sites plot_subset <- subset(plot_df, Contribution > mean(plot_df$Contribution)*1.2) ### Create subset plot p <- loading_map(plot_data=plot_subset, map_underlay=map_big, map_borders=states, site_locations=site_info, lon.lim=lon.lim, lat.lim=lat.lim) ### Save Loading Plot plot_name <- paste0(write_file, "_load_map_PC_",k,"_subset") ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p, width=6, height=7, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p, width=6, height=7) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p, width=6, height=7) ### Save to publication if (k %in% seq(1,5) & write_file== "pca_impute"){ plot_name <- paste0("fig_4",toupper(letters)[k]) ggsave(file.path(file.path(pub_path,"png"), paste0(plot_name , "_map.png")), p, width=6, height=7, dpi=600) ggsave(file.path(file.path(pub_path,"svg"), paste0(plot_name , "_map.svg")), p, width=6, height=7) ggsave(file.path(file.path(pub_path,"pdf"), paste0(plot_name , "_map.pdf")), p, width=6, height=7) } ### Add labels p <- p + geom_text_repel(data=plot_subset, aes(x=Lon, y=Lat, label = ID), size = 3, nudge_x=0.2, nudge_y=0.05, box.padding = unit(0.5, 'lines')) ### Save Loading Plot with Labels plot_name <- paste0(write_file, "_load_map_PC_",k,"_subset_labels") ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p, width=6, height=7, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p, width=6, height=7) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p, width=6, height=7) ### Create loading plot by genus p <- loading_genus(plot_data=plot_df, pc_number = k) ### Save Loading Plot by species plot_name <- paste0(write_file, "_load_species_PC_",k) ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p$plot, width=8, height=4, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p$plot, width=8, height=4) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p$plot, width=8, height=4) ### Save to publication if (k %in% seq(1,5) & write_file== "pca_impute"){ plot_name <- paste0("fig_4",toupper(letters)[k]) ggsave(file.path(file.path(pub_path,"png"), paste0(plot_name , "_species.png")), p$plot, width=8, height=4, dpi=600) ggsave(file.path(file.path(pub_path,"svg"), paste0(plot_name , "_species.svg")), p$plot, width=8, height=4) ggsave(file.path(file.path(pub_path,"pdf"), paste0(plot_name , "_species.pdf")), p$plot, width=8, height=4) } ### Save Loading Plot by species Legend plot_name <- paste0(write_file, "_load_species_PC_",k,"_legend") ggsave(file.path(file.path(file.path(write_folder,"png"), write_file), paste0(plot_name, ".png")), p$legend, width=3, height=4, dpi=600) ggsave(file.path(file.path(file.path(write_folder,"svg"), write_file), paste0(plot_name, ".svg")), p$legend, width=3, height=4) ggsave(file.path(file.path(file.path(write_folder,"pdf"), write_file), paste0(plot_name, ".pdf")), p$legend, width=3, height=4) ### Save to publication if (k == 1 & write_file== "pca_impute"){ plot_name <- "fig_4" ggsave(file.path(file.path(pub_path,"png"), paste0(plot_name , "_legend.png")), p$legend, width=3, height=4, dpi=600) ggsave(file.path(file.path(pub_path,"svg"), paste0(plot_name , "_legend.svg")), p$legend, width=3, height=4) ggsave(file.path(file.path(pub_path,"pdf"), paste0(plot_name , "_legend.pdf")), p$legend, width=3, height=4) } } }
library('ROCR') # calculate confusion matrix calCM <- function(predictions,references,target){ confusionMatrix <- table(truth = c(predictions==references), prediction = c(predictions==target)) return (confusionMatrix) } calSensitivity <- function(confusionMatrix){ return (confusionMatrix[1]/(confusionMatrix[1]+confusionMatrix[3])) } calSpecificity <- function(confusionMatrix){ return (confusionMatrix[4]/(confusionMatrix[2]+confusionMatrix[4])) } calPrecision <- function(confusionMatrix){ return (confusionMatrix[1]/(confusionMatrix[1]+confusionMatrix[2])) } calF1 <- function(confusionMatrix){ recall <- calSensitivity(confusionMatrix) precision <- calPrecision(confusionMatrix) return (2*precision*recall)/(precision+recall) } calAUC <- function(predscore, reference) { eval <- prediction(predscore, reference) auc <- attributes(performance(eval, 'auc'))$y.values[[1]] return (auc) } predscore_func<-function(predscore, query_m) { pred_score <- c() if(query_m == "male"){ pred_score <- predscore } else if (query_m == "female") { pred_score <- (1-predscore) } else { stop(paste("ERROR: unknown query function", query_m)) } return (pred_score) } # read parameters args = commandArgs(trailingOnly=TRUE) if (length(args)==0) { stop("USAGE: Rscript hw2_105753005.R --target male/female --files method1.csv method2.csv method3.csv method4.csv method5.csv method6.csv method7.csv method8.csv method9.csv method10.csv --out result.csv", call.=FALSE) } # parse parameters i<-1 while(i < length(args)) { if(args[i] == "--target"){ query_m<-args[i+1] i<-i+1 }else if(args[i] == "--files"){ j<-grep("-", c(args[(i+1):length(args)], "-"))[1] files<-args[(i+1):(i+j-1)] i<-i+j-1 }else if(args[i] == "--out"){ out_f<-args[i+1] i<-i+1 }else{ stop(paste("Unknown flag", args[i]), call.=FALSE) } i<-i+1 } print("PROCESS") print(paste("query mode :", query_m)) print(paste("output file:", out_f)) print(paste("files :", files)) # read files methods<-c() sensitivitys <- c() specificitys <- c() F1s <- c() AUCs <- c() for(file in files) { method<-gsub(".csv", "", basename(file)) d<-read.table(file, header=T,sep=",") d$pred.score <- predscore_func(d$pred.score , query_m) cm <- calCM(d$prediction,d$reference,query_m) sensitivity <- round(calSpecificity(cm),digits=2) specificity <- round(calSpecificity(cm),digits=2) F1 <- round(calF1(cm),digits=2) AUC <- round(calAUC(d$pred.score,d$reference),digits=2) methods<-c(methods,method) sensitivitys <- c(sensitivitys,sensitivity) specificitys <- c(specificitys,specificity) F1s <- c(F1s,F1) AUCs <- c(AUCs,AUC) } out_data<-data.frame(method=methods, sensitivity=sensitivitys, specificity=specificitys, F1 = F1s, AUC = AUCs, stringsAsFactors = F) highest <- c("highest") for(x in c(2:5)){ index<-apply(out_data[x], 2, which.max) highest <- c(highest,methods[index]) } print(highest) # output file out_data<-rbind(out_data,highest) write.table(out_data, file=out_f, row.names = F, quote = F)
/hw2/hw2_105753005.R
no_license
cwsu/1052DataScience
R
false
false
3,183
r
library('ROCR') # calculate confusion matrix calCM <- function(predictions,references,target){ confusionMatrix <- table(truth = c(predictions==references), prediction = c(predictions==target)) return (confusionMatrix) } calSensitivity <- function(confusionMatrix){ return (confusionMatrix[1]/(confusionMatrix[1]+confusionMatrix[3])) } calSpecificity <- function(confusionMatrix){ return (confusionMatrix[4]/(confusionMatrix[2]+confusionMatrix[4])) } calPrecision <- function(confusionMatrix){ return (confusionMatrix[1]/(confusionMatrix[1]+confusionMatrix[2])) } calF1 <- function(confusionMatrix){ recall <- calSensitivity(confusionMatrix) precision <- calPrecision(confusionMatrix) return (2*precision*recall)/(precision+recall) } calAUC <- function(predscore, reference) { eval <- prediction(predscore, reference) auc <- attributes(performance(eval, 'auc'))$y.values[[1]] return (auc) } predscore_func<-function(predscore, query_m) { pred_score <- c() if(query_m == "male"){ pred_score <- predscore } else if (query_m == "female") { pred_score <- (1-predscore) } else { stop(paste("ERROR: unknown query function", query_m)) } return (pred_score) } # read parameters args = commandArgs(trailingOnly=TRUE) if (length(args)==0) { stop("USAGE: Rscript hw2_105753005.R --target male/female --files method1.csv method2.csv method3.csv method4.csv method5.csv method6.csv method7.csv method8.csv method9.csv method10.csv --out result.csv", call.=FALSE) } # parse parameters i<-1 while(i < length(args)) { if(args[i] == "--target"){ query_m<-args[i+1] i<-i+1 }else if(args[i] == "--files"){ j<-grep("-", c(args[(i+1):length(args)], "-"))[1] files<-args[(i+1):(i+j-1)] i<-i+j-1 }else if(args[i] == "--out"){ out_f<-args[i+1] i<-i+1 }else{ stop(paste("Unknown flag", args[i]), call.=FALSE) } i<-i+1 } print("PROCESS") print(paste("query mode :", query_m)) print(paste("output file:", out_f)) print(paste("files :", files)) # read files methods<-c() sensitivitys <- c() specificitys <- c() F1s <- c() AUCs <- c() for(file in files) { method<-gsub(".csv", "", basename(file)) d<-read.table(file, header=T,sep=",") d$pred.score <- predscore_func(d$pred.score , query_m) cm <- calCM(d$prediction,d$reference,query_m) sensitivity <- round(calSpecificity(cm),digits=2) specificity <- round(calSpecificity(cm),digits=2) F1 <- round(calF1(cm),digits=2) AUC <- round(calAUC(d$pred.score,d$reference),digits=2) methods<-c(methods,method) sensitivitys <- c(sensitivitys,sensitivity) specificitys <- c(specificitys,specificity) F1s <- c(F1s,F1) AUCs <- c(AUCs,AUC) } out_data<-data.frame(method=methods, sensitivity=sensitivitys, specificity=specificitys, F1 = F1s, AUC = AUCs, stringsAsFactors = F) highest <- c("highest") for(x in c(2:5)){ index<-apply(out_data[x], 2, which.max) highest <- c(highest,methods[index]) } print(highest) # output file out_data<-rbind(out_data,highest) write.table(out_data, file=out_f, row.names = F, quote = F)
context("client") test_that("http(s) clients work as expected", { mlflow_clear_test_dir("mlruns") with_mock(.env = "mlflow", mlflow_rest = function(..., client) { args <- list(...) expect_true(paste(args, collapse = "/") == "experiments/list") list(experiments = c(1, 2, 3)) }, { with_mock(.env = "mlflow", mlflow_register_local_server = function(...) NA, { env <- list( MLFLOW_USERNAME = "DonaldDuck", MLFLOW_PASSWORD = "Quack", MLFLOW_TOKEN = "$$$", MLFLOW_INSECURE = "True" ) with_envvar(env, { http_host <- "http://remote" client1 <- mlflow:::mlflow_client(http_host) config <- client1$get_host_creds() print(config) expect_true(config$host == http_host) expect_true(config$username == "DonaldDuck") expect_true(config$password == "Quack") expect_true(config$token == "$$$") expect_true(config$insecure == "True") https_host <- "https://remote" client2 <- mlflow:::mlflow_client("https://remote") config <- client2$get_host_creds() expect_true(config$host == https_host) env_str <- paste(env, collapse = "|") env_str_2 <- paste(client2$get_cli_env(), collapse = "|") expect_true(env_str == env_str_2) }) with_mock(.env = "mlflow", mlflow_server = function(...) list(server_url = "local_server"), { client3 <- mlflow:::mlflow_client() config <- client3$get_host_creds() expect_true(config$host == "local_server") }) }) }) }) test_that("rest call handles errors correctly", { mlflow_clear_test_dir("mlruns") mock_client <- mlflow:::new_mlflow_client_impl(get_host_creds = function() { mlflow:::new_mlflow_host_creds(host = "localhost") }) with_mock(.env = "httr", POST = function(...) { httr:::response( status_code = 400, content = charToRaw(paste("{\"error_code\":\"INVALID_PARAMETER_VALUE\",", "\"message\":\"experiment_id must be set to a non-zero value\"}", sep = "") ) )}, { error_msg_regexp <- paste( "API request to endpoint \'runs/create\' failed with error code 400", "INVALID_PARAMETER_VALUE", "experiment_id must be set to a non-zero value", sep = ".*") expect_error( mlflow:::mlflow_rest( "runs", "create", client = mock_client, verb = "POST"), error_msg_regexp ) }) with_mock(.env = "httr", GET = function(...) { httr:::response( status_code = 500, content = charToRaw(paste("some text.")) ) }, { error_msg_regexp <- paste( "API request to endpoint \'runs/create\' failed with error code 500", "some text", sep = ".*") expect_error( mlflow:::mlflow_rest( "runs", "create", client = mock_client, verb = "GET"), error_msg_regexp ) }) with_mock(.env = "httr", POST = function(...) { httr:::response( status_code = 503, content = as.raw(c(0, 255)) ) }, { error_msg_regexp <- paste( "API request to endpoint \'runs/create\' failed with error code 503", "00 ff", sep = ".*") expect_error( mlflow:::mlflow_rest( "runs", "create", client = mock_client, verb = "POST"), error_msg_regexp ) }) })
/mlflow/R/mlflow/tests/testthat/test-client.R
permissive
qubole/mlflow
R
false
false
3,549
r
context("client") test_that("http(s) clients work as expected", { mlflow_clear_test_dir("mlruns") with_mock(.env = "mlflow", mlflow_rest = function(..., client) { args <- list(...) expect_true(paste(args, collapse = "/") == "experiments/list") list(experiments = c(1, 2, 3)) }, { with_mock(.env = "mlflow", mlflow_register_local_server = function(...) NA, { env <- list( MLFLOW_USERNAME = "DonaldDuck", MLFLOW_PASSWORD = "Quack", MLFLOW_TOKEN = "$$$", MLFLOW_INSECURE = "True" ) with_envvar(env, { http_host <- "http://remote" client1 <- mlflow:::mlflow_client(http_host) config <- client1$get_host_creds() print(config) expect_true(config$host == http_host) expect_true(config$username == "DonaldDuck") expect_true(config$password == "Quack") expect_true(config$token == "$$$") expect_true(config$insecure == "True") https_host <- "https://remote" client2 <- mlflow:::mlflow_client("https://remote") config <- client2$get_host_creds() expect_true(config$host == https_host) env_str <- paste(env, collapse = "|") env_str_2 <- paste(client2$get_cli_env(), collapse = "|") expect_true(env_str == env_str_2) }) with_mock(.env = "mlflow", mlflow_server = function(...) list(server_url = "local_server"), { client3 <- mlflow:::mlflow_client() config <- client3$get_host_creds() expect_true(config$host == "local_server") }) }) }) }) test_that("rest call handles errors correctly", { mlflow_clear_test_dir("mlruns") mock_client <- mlflow:::new_mlflow_client_impl(get_host_creds = function() { mlflow:::new_mlflow_host_creds(host = "localhost") }) with_mock(.env = "httr", POST = function(...) { httr:::response( status_code = 400, content = charToRaw(paste("{\"error_code\":\"INVALID_PARAMETER_VALUE\",", "\"message\":\"experiment_id must be set to a non-zero value\"}", sep = "") ) )}, { error_msg_regexp <- paste( "API request to endpoint \'runs/create\' failed with error code 400", "INVALID_PARAMETER_VALUE", "experiment_id must be set to a non-zero value", sep = ".*") expect_error( mlflow:::mlflow_rest( "runs", "create", client = mock_client, verb = "POST"), error_msg_regexp ) }) with_mock(.env = "httr", GET = function(...) { httr:::response( status_code = 500, content = charToRaw(paste("some text.")) ) }, { error_msg_regexp <- paste( "API request to endpoint \'runs/create\' failed with error code 500", "some text", sep = ".*") expect_error( mlflow:::mlflow_rest( "runs", "create", client = mock_client, verb = "GET"), error_msg_regexp ) }) with_mock(.env = "httr", POST = function(...) { httr:::response( status_code = 503, content = as.raw(c(0, 255)) ) }, { error_msg_regexp <- paste( "API request to endpoint \'runs/create\' failed with error code 503", "00 ff", sep = ".*") expect_error( mlflow:::mlflow_rest( "runs", "create", client = mock_client, verb = "POST"), error_msg_regexp ) }) })
#these plots were constructed here and copied into the .Rmd #plot 1 -- total hunters plot_total_hunting_licenses <- function(){ #Add main dataframe file <- "./data_tidy/hunting_licenses_by_state_1960_and_2020.csv" colClasses <- c(rep("character", 3), "integer", "character", "numeric") df.00 <- data.table::fread(file = file, data.table = F, colClasses = colClasses) df.01 <- dplyr::filter(df.00, key == "certified_paid_hunting_license_holders") df.02 <- df.01 %>% group_by(year) %>% summarize(total_licenses = sum(value)) df.03 <- tidyr::gather(df.02, key = key, value = value, -year) df.03$key <- "tot_hunters_licenses" # Add FHWAR line plot file <- "./data_pure/usfw/2020-11-20-fw_nat_survey_fhwar_1955_2016.csv" colClasses <- c("integer", "character", "integer", "character", "integer", "character", "numeric") df.fhwar <- read.csv(file = file, header = T, colClasses = colClasses) df.fhwar <- select(df.fhwar, year, total_all_hunters) df.fhwar <- tidyr::gather(df.fhwar, key = key, value = value, -year) df.fhwar$key[which(df.fhwar$year %in% 1955:1990)] <- "tot_hunters_pre_1991" df.fhwar$key[which(df.fhwar$year %in% 1990:2020)] <- "tot_hunters_post_1991" #rbind df.04 <- rbind(df.03, df.fhwar) df.04$key <- factor(df.04$key, levels = c("tot_hunters_licenses", "tot_hunters_pre_1991", "tot_hunters_post_1991") ) #plot total number of hunting licenses p <- ggplot(df.04, aes(year, value, group = key, colour = key)) p <- p + geom_line() p <- p + geom_point() p <- p + scale_y_continuous(limits = c(0, 22000000), name = "", breaks = c(0, 50e5, 100e5, 150e5, 200e5), labels = c("0", "5m", "10m", "15m", "20m") ) p <- p + scale_x_continuous(name = "") p <- p + scale_colour_manual(values = c("#4582ec", "#ffa600", "#ff5ca4")) p <- p + ggtitle("Total U.S. Hunters from License and Surveys \n1955 - 2020") p <- p + theme_gdocs() filename <- "./figs/total_us_hunters_from_license_and_survey_data_1955_2020.jpg" ggsave(p, filename = filename, height = 5, width = 8, dpi = 300, units = "in") p } plot_total_hunting_licenses() #plot 2 -- participaton rate plot_pct_hunters_from_FHWAR_and_hunters_licenses <- function(){ calculate_pct_hunting_licenses <- function(){ #Add main dataframe file <- "./data_tidy/hunting_licenses_by_state_1960_and_2020.csv" colClasses <- c(rep("character", 3), "integer", "character", "numeric") df.00 <- data.table::fread(file = file, data.table = F, colClasses = colClasses) #total up the number of hunting licenses df.01 <- dplyr::filter(df.00, key == "certified_paid_hunting_license_holders") df.02 <- df.01 %>% group_by(year) %>% summarize(total_licenses = sum(value)) #total up the pop among the states df.03 <- dplyr::filter(df.00, key == "pop") df.04 <- df.03 %>% group_by(year) %>% summarize(tot_pop = sum(value)) #figure out a per capita on the totals df.04$pct_hunting_licenses <- round((df.02$total_licenses / df.04$tot_pop) * 100, 2) df.04 <- df.04[, c(1,3)] df.04 <- tidyr::gather(df.04, key = key, value = value, -year) df.04 } calculate_pct_hunters_from_survey <- function(){ # Add FHWAR line plot file <- "./data_pure/usfw/2020-11-20-fw_nat_survey_fhwar_1955_2016.csv" colClasses <- c("integer", "character", "integer", "character", "integer", "character", "numeric") df.fhwar <- read.csv(file = file, header = T, colClasses = colClasses) df.fhwar <- select(df.fhwar, year, "participation_rate_calculated") df.fhwar$participation_rate_calculated <- round(df.fhwar$participation_rate_calculated *100, 2) df.fhwar <- tidyr::gather(df.fhwar, key = key, value = value, -year) df.fhwar$key[which(df.fhwar$year %in% 1955:1990)] <- "part_rate_pre_1991" df.fhwar$key[which(df.fhwar$year %in% 1990:2020)] <- "part_rate_post_1991" df.fhwar } df <- rbind(calculate_pct_hunters_from_survey(), calculate_pct_hunting_licenses()) df$key <- factor(df$key, levels = c("pct_hunting_licenses", "part_rate_pre_1991", "part_rate_post_1991")) p <- ggplot(df, aes(year, value, group = key, colour = key)) p <- p + geom_line()#4582EC p <- p + geom_point(size = 3) p <- p + scale_y_continuous(limits = c(0, 12), name = "", breaks = c(0, 3.0, 6.0, 9.0, 12), labels = c("0.0%", "3.0%", "6.0%", "9.0%", "12.0%") ) p <- p + scale_x_continuous(name = "") p <- p + scale_colour_manual(values = c("#4582ec", "#ffa600", "#ff5ca4")) p <- p + ggtitle("Hunting Licenses vs. Survey Participation Rate") p <- p + theme_gdocs() filename <- "./figs/hunting_licenses_vs_survey_part_rate_1955_2020.jpg" ggsave(p, filename = filename, height = 5, width = 8, dpi = 300, units = "in") p } #plot 3 -- population to hunter growth Plot_change_in_hunters_license_to_population <- function(){ file <- "./data_pure/total_annual_hl_and_pop_1960-2020.csv" colClasses <- c("integer", "integer", "integer", "numeric", "numeric") df.pct <- read.csv(file = file, header = T, colClasses = colClasses) df.pct <- tidyr::gather(df.pct, key = key, value = value, -year) df.pct <- dplyr::filter(df.pct, key == "pct_increase_population" | key == "pct_increase_hunting_lic") p <- ggplot(df.pct, aes(year, value, group = key, color = key)) p <- p + geom_line() p <- p + geom_point(size = 3) p <- p + scale_color_manual(values=c("#4582EC", "#ffa600")) p <- p + theme_gdocs() p <- p + scale_x_continuous(name = "") p <- p + ggtitle("Pct. Increase in Population and Hunting Licenses \nbase year = 1960") filename <- "./figs/pct_increase_in_population_and_hunting_licenses_1960_to_2020.jpg" ggsave(p, filename = filename, height = 5, width = 8, dpi = 300, unit = "in") p } #plot 4 -- plot_cost_per_hunter_idx_for_inflation <- function(){ library(ggthemes) create_df_cost_per_hunter <- function(){ #Add main dataframe file <- "./data_tidy/hunting_licenses_by_state_1960_and_2020.csv" colClasses <- c(rep("character", 3), "integer", "character", "numeric") df.00 <- data.table::fread(file = file, data.table = F, colClasses = colClasses) #total cost to hunters df.01 <- dplyr::filter(df.00, key == "total_gross_cost_to_hunters") df.02 <-df.01 %>% group_by(year) %>% summarize(total_cost = sum(value)) #total hunters by year df.03 <- dplyr::filter(df.00, key == "certified_paid_hunting_license_holders") df.04 <- df.03 %>% group_by(year) %>% summarize(total_hunters = sum(value)) #merge df.05 <- dplyr::left_join(df.02, df.04) #total cost per hunter df.05$cost_per_hunter <- df.05$total_cost / df.05$total_hunters df.05 <- dplyr::select(df.05, year, cost_per_hunter) df.06 <- tidyr::gather(df.05, key = key, value = value, -year) #total cost per person df.07 <- dplyr::filter(df.00, key == "pop") df.08 <- df.07 %>% group_by(year) %>% summarize(total_pop = sum(value)) df.09 <- merge(df.02, df.08) df.09$cost_per_person <- df.09$total_cost / df.09$total_pop df.09 <- dplyr::select(df.09, year, cost_per_person) df.09 <- tidyr::gather(df.09, key = key, value = value, -year) #join cost_per_hunter to cost_per_person df.10 <- rbind(df.06, df.09) df.10 } create_df_for_infl_idx <- function(){ #build inflation adjusted series for comparison source("./R/functions.R") df.infl <- data.frame(total_cost_1970 = 101608879, const_dol_2020 = convert_to_constant_dollars(price = 1010608879, from_date = 1970, to_date = 2019), total_hunt_1970 = 15658318, total_hunt_2020 = 15151724, total_pop_1970 = 202455416, total_pop_2020 = 331794992, infl_adj_cost_per_hunter_1970 = 101608879 / 15658318, infl_adj_cost_per_hunter_2020 = 681900329.51 / 15151724, infl_adj_cost_per_person_1970 = 101608879 / 202455416, infl_adj_cost_per_person_2020 = 681900329.51 / 331794992 ) df.infl <- tidyr::gather(df.infl, key = key, value = value) df.infl$year <- stringr::str_sub(df.infl$key, -4) df.infl$year <- as.integer(df.infl$year) df.infl$key <-gsub("_1970|_2020", "", df.infl$key) df.infl <- df.infl[grep("infl_adj", df.infl$key), ] df.infl } create_plot_for_hunters <- function(){ df.10 <- create_df_cost_per_hunter() df.infl <- create_df_for_infl_idx() #plot library(ggthemes) p <- ggplot(dplyr::filter(df.10, key == "cost_per_hunter"), aes(year, value, group = key, colour = key)) p <- p + geom_line() p <- p + geom_point(size = 3) p <- p + scale_y_continuous(name = "", limits = c(0, 60), breaks = c(0, 15, 30, 45, 60), labels = c("$0", "$15", "$30", "$45", "$60") ) p <- p + scale_color_manual(values=c("#4582EC", "#00d0ff")) df.infl.1 <- dplyr::filter(df.infl, key == "infl_adj_cost_per_hunter") df.infl.1$key <- gsub("_per_hunter", "", df.infl.1$key) p <- p + geom_line(data = df.infl.1, aes(year, value, group = key, colour = key)) p <- p + geom_point(data = df.infl.1, aes(year, value, group = key, colour = key), size = 3) p <- p + theme_gdocs() p <- p + scale_x_continuous(name = "", limits = c(1960, 2020)) p <- p + ggtitle("Gross Cost Per Hunter Indexed to Inflation \n1970-2020") filename <- "./figs/gross_cost_per_hunter_indexed_to_inflation_1970_2020.jpg" ggsave(p, filename = filename, height = 5, width = 8, dpi = 300, units = "in") p } create_plot_for_hunters() } plot_cost_per_hunter_idx_for_inflation() #plot 5 -- plot_cost_per_person_idx_for_inflation <- function(){ library(ggthemes) create_df_cost_per_hunter <- function(){ #Add main dataframe file <- "./data_tidy/hunting_licenses_by_state_1960_and_2020.csv" colClasses <- c(rep("character", 3), "integer", "character", "numeric") df.00 <- data.table::fread(file = file, data.table = F, colClasses = colClasses) #total cost to hunters df.01 <- dplyr::filter(df.00, key == "total_gross_cost_to_hunters") df.02 <-df.01 %>% group_by(year) %>% summarize(total_cost = sum(value)) #total hunters by year df.03 <- dplyr::filter(df.00, key == "certified_paid_hunting_license_holders") df.04 <- df.03 %>% group_by(year) %>% summarize(total_hunters = sum(value)) #merge df.05 <- dplyr::left_join(df.02, df.04) #total cost per hunter df.05$cost_per_hunter <- df.05$total_cost / df.05$total_hunters df.05 <- dplyr::select(df.05, year, cost_per_hunter) df.06 <- tidyr::gather(df.05, key = key, value = value, -year) #total cost per person df.07 <- dplyr::filter(df.00, key == "pop") df.08 <- df.07 %>% group_by(year) %>% summarize(total_pop = sum(value)) df.09 <- merge(df.02, df.08) df.09$cost_per_person <- df.09$total_cost / df.09$total_pop df.09 <- dplyr::select(df.09, year, cost_per_person) df.09 <- tidyr::gather(df.09, key = key, value = value, -year) #join cost_per_hunter to cost_per_person df.10 <- rbind(df.06, df.09) df.10 } create_df_for_infl_idx <- function(){ #build inflation adjusted series for comparison source("./R/functions.R") df.infl <- data.frame(total_cost_1970 = 101608879, const_dol_2020 = convert_to_constant_dollars(price = 1010608879, from_date = 1970, to_date = 2019), total_hunt_1970 = 15658318, total_hunt_2020 = 15151724, total_pop_1970 = 202455416, total_pop_2020 = 331794992, infl_adj_cost_per_hunter_1970 = 101608879 / 15658318, infl_adj_cost_per_hunter_2020 = 681900329.51 / 15151724, infl_adj_cost_per_person_1970 = 101608879 / 202455416, infl_adj_cost_per_person_2020 = 681900329.51 / 331794992 ) df.infl <- tidyr::gather(df.infl, key = key, value = value) df.infl$year <- stringr::str_sub(df.infl$key, -4) df.infl$year <- as.integer(df.infl$year) df.infl$key <-gsub("_1970|_2020", "", df.infl$key) df.infl <- df.infl[grep("infl_adj", df.infl$key), ] df.infl } create_plot_for_person <- function(){ df.10 <- create_df_cost_per_hunter() df.infl <- create_df_for_infl_idx() p <- ggplot(dplyr::filter(df.10, key == "cost_per_person"), aes(year, value, group = key, colour = key)) p <- p + geom_line() p <- p + geom_point(size = 3) p p <- p + scale_y_continuous(name = "", limits = c(0, 3), breaks = c(0, .75, 1.50, 2.25, 3), labels = c("$0.0", "$0.75", "$1.50", "$2.25", "$3.00") ) p <- p + scale_color_manual(values=c("#ffa600", "#ffdc00")) df.infl.2 <- dplyr::filter(df.infl, key == "infl_adj_cost_per_person") df.infl.2$key <- gsub("_per_person", "", df.infl.2$key) p <- p + geom_line(data = df.infl.2, aes(year, value, group = key, colour = key)) p <- p + geom_point(data = df.infl.2, aes(year, value, group = key, colour = key), size = 3) p <- p + theme_gdocs() p <- p + scale_x_continuous(name = "", limits = c(1960, 2020)) p <- p + ggtitle("Gross Cost Per Person Indexed to Inflation\n1970-2020") filename <- "./figs/gross_cost_per_person_indexed_to_inflation_1970_2020.jpg" ggsave(p, filename = filename, height = 5, width = 8, dpi = 300, units = "in") p } create_plot_for_person() } plot_cost_per_person_idx_for_inflation()
/R/plot_national _charts.R
permissive
RobWiederstein/hunting_licenses
R
false
false
16,385
r
#these plots were constructed here and copied into the .Rmd #plot 1 -- total hunters plot_total_hunting_licenses <- function(){ #Add main dataframe file <- "./data_tidy/hunting_licenses_by_state_1960_and_2020.csv" colClasses <- c(rep("character", 3), "integer", "character", "numeric") df.00 <- data.table::fread(file = file, data.table = F, colClasses = colClasses) df.01 <- dplyr::filter(df.00, key == "certified_paid_hunting_license_holders") df.02 <- df.01 %>% group_by(year) %>% summarize(total_licenses = sum(value)) df.03 <- tidyr::gather(df.02, key = key, value = value, -year) df.03$key <- "tot_hunters_licenses" # Add FHWAR line plot file <- "./data_pure/usfw/2020-11-20-fw_nat_survey_fhwar_1955_2016.csv" colClasses <- c("integer", "character", "integer", "character", "integer", "character", "numeric") df.fhwar <- read.csv(file = file, header = T, colClasses = colClasses) df.fhwar <- select(df.fhwar, year, total_all_hunters) df.fhwar <- tidyr::gather(df.fhwar, key = key, value = value, -year) df.fhwar$key[which(df.fhwar$year %in% 1955:1990)] <- "tot_hunters_pre_1991" df.fhwar$key[which(df.fhwar$year %in% 1990:2020)] <- "tot_hunters_post_1991" #rbind df.04 <- rbind(df.03, df.fhwar) df.04$key <- factor(df.04$key, levels = c("tot_hunters_licenses", "tot_hunters_pre_1991", "tot_hunters_post_1991") ) #plot total number of hunting licenses p <- ggplot(df.04, aes(year, value, group = key, colour = key)) p <- p + geom_line() p <- p + geom_point() p <- p + scale_y_continuous(limits = c(0, 22000000), name = "", breaks = c(0, 50e5, 100e5, 150e5, 200e5), labels = c("0", "5m", "10m", "15m", "20m") ) p <- p + scale_x_continuous(name = "") p <- p + scale_colour_manual(values = c("#4582ec", "#ffa600", "#ff5ca4")) p <- p + ggtitle("Total U.S. Hunters from License and Surveys \n1955 - 2020") p <- p + theme_gdocs() filename <- "./figs/total_us_hunters_from_license_and_survey_data_1955_2020.jpg" ggsave(p, filename = filename, height = 5, width = 8, dpi = 300, units = "in") p } plot_total_hunting_licenses() #plot 2 -- participaton rate plot_pct_hunters_from_FHWAR_and_hunters_licenses <- function(){ calculate_pct_hunting_licenses <- function(){ #Add main dataframe file <- "./data_tidy/hunting_licenses_by_state_1960_and_2020.csv" colClasses <- c(rep("character", 3), "integer", "character", "numeric") df.00 <- data.table::fread(file = file, data.table = F, colClasses = colClasses) #total up the number of hunting licenses df.01 <- dplyr::filter(df.00, key == "certified_paid_hunting_license_holders") df.02 <- df.01 %>% group_by(year) %>% summarize(total_licenses = sum(value)) #total up the pop among the states df.03 <- dplyr::filter(df.00, key == "pop") df.04 <- df.03 %>% group_by(year) %>% summarize(tot_pop = sum(value)) #figure out a per capita on the totals df.04$pct_hunting_licenses <- round((df.02$total_licenses / df.04$tot_pop) * 100, 2) df.04 <- df.04[, c(1,3)] df.04 <- tidyr::gather(df.04, key = key, value = value, -year) df.04 } calculate_pct_hunters_from_survey <- function(){ # Add FHWAR line plot file <- "./data_pure/usfw/2020-11-20-fw_nat_survey_fhwar_1955_2016.csv" colClasses <- c("integer", "character", "integer", "character", "integer", "character", "numeric") df.fhwar <- read.csv(file = file, header = T, colClasses = colClasses) df.fhwar <- select(df.fhwar, year, "participation_rate_calculated") df.fhwar$participation_rate_calculated <- round(df.fhwar$participation_rate_calculated *100, 2) df.fhwar <- tidyr::gather(df.fhwar, key = key, value = value, -year) df.fhwar$key[which(df.fhwar$year %in% 1955:1990)] <- "part_rate_pre_1991" df.fhwar$key[which(df.fhwar$year %in% 1990:2020)] <- "part_rate_post_1991" df.fhwar } df <- rbind(calculate_pct_hunters_from_survey(), calculate_pct_hunting_licenses()) df$key <- factor(df$key, levels = c("pct_hunting_licenses", "part_rate_pre_1991", "part_rate_post_1991")) p <- ggplot(df, aes(year, value, group = key, colour = key)) p <- p + geom_line()#4582EC p <- p + geom_point(size = 3) p <- p + scale_y_continuous(limits = c(0, 12), name = "", breaks = c(0, 3.0, 6.0, 9.0, 12), labels = c("0.0%", "3.0%", "6.0%", "9.0%", "12.0%") ) p <- p + scale_x_continuous(name = "") p <- p + scale_colour_manual(values = c("#4582ec", "#ffa600", "#ff5ca4")) p <- p + ggtitle("Hunting Licenses vs. Survey Participation Rate") p <- p + theme_gdocs() filename <- "./figs/hunting_licenses_vs_survey_part_rate_1955_2020.jpg" ggsave(p, filename = filename, height = 5, width = 8, dpi = 300, units = "in") p } #plot 3 -- population to hunter growth Plot_change_in_hunters_license_to_population <- function(){ file <- "./data_pure/total_annual_hl_and_pop_1960-2020.csv" colClasses <- c("integer", "integer", "integer", "numeric", "numeric") df.pct <- read.csv(file = file, header = T, colClasses = colClasses) df.pct <- tidyr::gather(df.pct, key = key, value = value, -year) df.pct <- dplyr::filter(df.pct, key == "pct_increase_population" | key == "pct_increase_hunting_lic") p <- ggplot(df.pct, aes(year, value, group = key, color = key)) p <- p + geom_line() p <- p + geom_point(size = 3) p <- p + scale_color_manual(values=c("#4582EC", "#ffa600")) p <- p + theme_gdocs() p <- p + scale_x_continuous(name = "") p <- p + ggtitle("Pct. Increase in Population and Hunting Licenses \nbase year = 1960") filename <- "./figs/pct_increase_in_population_and_hunting_licenses_1960_to_2020.jpg" ggsave(p, filename = filename, height = 5, width = 8, dpi = 300, unit = "in") p } #plot 4 -- plot_cost_per_hunter_idx_for_inflation <- function(){ library(ggthemes) create_df_cost_per_hunter <- function(){ #Add main dataframe file <- "./data_tidy/hunting_licenses_by_state_1960_and_2020.csv" colClasses <- c(rep("character", 3), "integer", "character", "numeric") df.00 <- data.table::fread(file = file, data.table = F, colClasses = colClasses) #total cost to hunters df.01 <- dplyr::filter(df.00, key == "total_gross_cost_to_hunters") df.02 <-df.01 %>% group_by(year) %>% summarize(total_cost = sum(value)) #total hunters by year df.03 <- dplyr::filter(df.00, key == "certified_paid_hunting_license_holders") df.04 <- df.03 %>% group_by(year) %>% summarize(total_hunters = sum(value)) #merge df.05 <- dplyr::left_join(df.02, df.04) #total cost per hunter df.05$cost_per_hunter <- df.05$total_cost / df.05$total_hunters df.05 <- dplyr::select(df.05, year, cost_per_hunter) df.06 <- tidyr::gather(df.05, key = key, value = value, -year) #total cost per person df.07 <- dplyr::filter(df.00, key == "pop") df.08 <- df.07 %>% group_by(year) %>% summarize(total_pop = sum(value)) df.09 <- merge(df.02, df.08) df.09$cost_per_person <- df.09$total_cost / df.09$total_pop df.09 <- dplyr::select(df.09, year, cost_per_person) df.09 <- tidyr::gather(df.09, key = key, value = value, -year) #join cost_per_hunter to cost_per_person df.10 <- rbind(df.06, df.09) df.10 } create_df_for_infl_idx <- function(){ #build inflation adjusted series for comparison source("./R/functions.R") df.infl <- data.frame(total_cost_1970 = 101608879, const_dol_2020 = convert_to_constant_dollars(price = 1010608879, from_date = 1970, to_date = 2019), total_hunt_1970 = 15658318, total_hunt_2020 = 15151724, total_pop_1970 = 202455416, total_pop_2020 = 331794992, infl_adj_cost_per_hunter_1970 = 101608879 / 15658318, infl_adj_cost_per_hunter_2020 = 681900329.51 / 15151724, infl_adj_cost_per_person_1970 = 101608879 / 202455416, infl_adj_cost_per_person_2020 = 681900329.51 / 331794992 ) df.infl <- tidyr::gather(df.infl, key = key, value = value) df.infl$year <- stringr::str_sub(df.infl$key, -4) df.infl$year <- as.integer(df.infl$year) df.infl$key <-gsub("_1970|_2020", "", df.infl$key) df.infl <- df.infl[grep("infl_adj", df.infl$key), ] df.infl } create_plot_for_hunters <- function(){ df.10 <- create_df_cost_per_hunter() df.infl <- create_df_for_infl_idx() #plot library(ggthemes) p <- ggplot(dplyr::filter(df.10, key == "cost_per_hunter"), aes(year, value, group = key, colour = key)) p <- p + geom_line() p <- p + geom_point(size = 3) p <- p + scale_y_continuous(name = "", limits = c(0, 60), breaks = c(0, 15, 30, 45, 60), labels = c("$0", "$15", "$30", "$45", "$60") ) p <- p + scale_color_manual(values=c("#4582EC", "#00d0ff")) df.infl.1 <- dplyr::filter(df.infl, key == "infl_adj_cost_per_hunter") df.infl.1$key <- gsub("_per_hunter", "", df.infl.1$key) p <- p + geom_line(data = df.infl.1, aes(year, value, group = key, colour = key)) p <- p + geom_point(data = df.infl.1, aes(year, value, group = key, colour = key), size = 3) p <- p + theme_gdocs() p <- p + scale_x_continuous(name = "", limits = c(1960, 2020)) p <- p + ggtitle("Gross Cost Per Hunter Indexed to Inflation \n1970-2020") filename <- "./figs/gross_cost_per_hunter_indexed_to_inflation_1970_2020.jpg" ggsave(p, filename = filename, height = 5, width = 8, dpi = 300, units = "in") p } create_plot_for_hunters() } plot_cost_per_hunter_idx_for_inflation() #plot 5 -- plot_cost_per_person_idx_for_inflation <- function(){ library(ggthemes) create_df_cost_per_hunter <- function(){ #Add main dataframe file <- "./data_tidy/hunting_licenses_by_state_1960_and_2020.csv" colClasses <- c(rep("character", 3), "integer", "character", "numeric") df.00 <- data.table::fread(file = file, data.table = F, colClasses = colClasses) #total cost to hunters df.01 <- dplyr::filter(df.00, key == "total_gross_cost_to_hunters") df.02 <-df.01 %>% group_by(year) %>% summarize(total_cost = sum(value)) #total hunters by year df.03 <- dplyr::filter(df.00, key == "certified_paid_hunting_license_holders") df.04 <- df.03 %>% group_by(year) %>% summarize(total_hunters = sum(value)) #merge df.05 <- dplyr::left_join(df.02, df.04) #total cost per hunter df.05$cost_per_hunter <- df.05$total_cost / df.05$total_hunters df.05 <- dplyr::select(df.05, year, cost_per_hunter) df.06 <- tidyr::gather(df.05, key = key, value = value, -year) #total cost per person df.07 <- dplyr::filter(df.00, key == "pop") df.08 <- df.07 %>% group_by(year) %>% summarize(total_pop = sum(value)) df.09 <- merge(df.02, df.08) df.09$cost_per_person <- df.09$total_cost / df.09$total_pop df.09 <- dplyr::select(df.09, year, cost_per_person) df.09 <- tidyr::gather(df.09, key = key, value = value, -year) #join cost_per_hunter to cost_per_person df.10 <- rbind(df.06, df.09) df.10 } create_df_for_infl_idx <- function(){ #build inflation adjusted series for comparison source("./R/functions.R") df.infl <- data.frame(total_cost_1970 = 101608879, const_dol_2020 = convert_to_constant_dollars(price = 1010608879, from_date = 1970, to_date = 2019), total_hunt_1970 = 15658318, total_hunt_2020 = 15151724, total_pop_1970 = 202455416, total_pop_2020 = 331794992, infl_adj_cost_per_hunter_1970 = 101608879 / 15658318, infl_adj_cost_per_hunter_2020 = 681900329.51 / 15151724, infl_adj_cost_per_person_1970 = 101608879 / 202455416, infl_adj_cost_per_person_2020 = 681900329.51 / 331794992 ) df.infl <- tidyr::gather(df.infl, key = key, value = value) df.infl$year <- stringr::str_sub(df.infl$key, -4) df.infl$year <- as.integer(df.infl$year) df.infl$key <-gsub("_1970|_2020", "", df.infl$key) df.infl <- df.infl[grep("infl_adj", df.infl$key), ] df.infl } create_plot_for_person <- function(){ df.10 <- create_df_cost_per_hunter() df.infl <- create_df_for_infl_idx() p <- ggplot(dplyr::filter(df.10, key == "cost_per_person"), aes(year, value, group = key, colour = key)) p <- p + geom_line() p <- p + geom_point(size = 3) p p <- p + scale_y_continuous(name = "", limits = c(0, 3), breaks = c(0, .75, 1.50, 2.25, 3), labels = c("$0.0", "$0.75", "$1.50", "$2.25", "$3.00") ) p <- p + scale_color_manual(values=c("#ffa600", "#ffdc00")) df.infl.2 <- dplyr::filter(df.infl, key == "infl_adj_cost_per_person") df.infl.2$key <- gsub("_per_person", "", df.infl.2$key) p <- p + geom_line(data = df.infl.2, aes(year, value, group = key, colour = key)) p <- p + geom_point(data = df.infl.2, aes(year, value, group = key, colour = key), size = 3) p <- p + theme_gdocs() p <- p + scale_x_continuous(name = "", limits = c(1960, 2020)) p <- p + ggtitle("Gross Cost Per Person Indexed to Inflation\n1970-2020") filename <- "./figs/gross_cost_per_person_indexed_to_inflation_1970_2020.jpg" ggsave(p, filename = filename, height = 5, width = 8, dpi = 300, units = "in") p } create_plot_for_person() } plot_cost_per_person_idx_for_inflation()
#' Add together two numbers #' @param x A real number #' @param y A real number #' @return the sume of \code{x} and \code{y} #' @examples #' add(1,1) add <- function(x,y){ x + y }
/Reiss/R/add.R
no_license
jordaneissner/Eissner_project
R
false
false
184
r
#' Add together two numbers #' @param x A real number #' @param y A real number #' @return the sume of \code{x} and \code{y} #' @examples #' add(1,1) add <- function(x,y){ x + y }
newlesson <- emajorDV::create_lessonTemplate() newlesson$topic <- "在Rmd knit的html插入Javascript" newlesson$description <- "過去我們在Chrome裡對Rmd的html output進行javascript的測試,然而有時在Chrome可以成功的效果,等到加入Rmd的after_body設定時效果卻出不來。emajorDV的webService模組可以解決這問題。" newlesson$date <- "2020-09-01" newlesson$onlineUrl <- "https://hackmd.io/@fnik77ehTXKTYsEGmxLihA/B1L9P8smv/edit" newlesson$downloadUrl <- list( list(link="https://www.dropbox.com/s/lh2jdvv5623yn8p/storyboard.zip?dl=1", zip=T) ) library(emajorDV) add_lesson(newlesson)
/coursePlan.R
no_license
emajortaiwan/home
R
false
false
629
r
newlesson <- emajorDV::create_lessonTemplate() newlesson$topic <- "在Rmd knit的html插入Javascript" newlesson$description <- "過去我們在Chrome裡對Rmd的html output進行javascript的測試,然而有時在Chrome可以成功的效果,等到加入Rmd的after_body設定時效果卻出不來。emajorDV的webService模組可以解決這問題。" newlesson$date <- "2020-09-01" newlesson$onlineUrl <- "https://hackmd.io/@fnik77ehTXKTYsEGmxLihA/B1L9P8smv/edit" newlesson$downloadUrl <- list( list(link="https://www.dropbox.com/s/lh2jdvv5623yn8p/storyboard.zip?dl=1", zip=T) ) library(emajorDV) add_lesson(newlesson)
## Making a dotplot of LefSe-identified OTUs--UPDATED # 3.18.16 # Anna M. Seekatz # adapted from http://polisci.msu.edu/jacoby/research/dotplots/tpm/Creating%20figures/Creating%20Figure%204.R library(plyr) library(reshape2) library(Hmisc) library(lattice) library(dplyr) # files used: # updated_meta_fromkrishna_03.08.16.txt: updated meta # suberin.relOTUs.txt: relative abundance of OTUs, filtered (same info applicable as before) # erinfmt.new.taxonomy.names.txt: edited taxonomy files with OTU info (same info applicable as before) # updated_erinsubset_all.lefse.results.txt: new lefse results, edited from mothur # meta and OTU files meta<-read.table(file="updated_meta_fromkrishna_03.08.16.txt", header=TRUE) sub.otus<-read.table(file="../suberin.relOTUs.txt", header=TRUE) meta2<-meta[-which(meta$seqID %in% c("DA3240", "DA3260_P", "DA3298", "DA3299", "DA3376")), ] meta<-meta2 tax<-read.table(file="../erinfmt.new.taxonomy.names.txt", header=TRUE) keep<-as.character(colnames(sub.otus[1:506])) filtered.tax<-tax[tax$OTU %in% keep, ] colnames(sub.otus)<-filtered.tax$taxname sub.otus$sampleID<-rownames(sub.otus) # merge meta and OTUs: sub.otus$sampleID<-as.factor(sub.otus$sampleID) sub.all<-merge(meta, sub.otus, by.x="seqID", by.y="sampleID") rownames(sub.all)<-sub.all$seqID # lefse results (filtered file to include only the significant ones) lefse<-read.table(file="updated_erinsubset_all.lefse.results.txt", header=TRUE) # get taxnames for lefse OTU file: keep<-as.character(lefse$OTU) filtered.tax<-tax[tax$OTU %in% keep, ] lefse$otuname<-filtered.tax$taxname lefse <- lefse[order(lefse$clinical_Class, lefse$otuname),] lefse.otus<-as.character(lefse$otuname[1:5]) # for severe ones: #lefse <- lefse[order(lefse$severe_Class, lefse$otuname),] #lefse.otus<-as.character(lefse$otuname[1:7]) # these were all the sign. OTUs in the index samples of recurrent vs. nonrecurrent patients #### Fig. 4B: plotting lefse OTUs by group # these are the OTUs significant between positive and negative samples # let's limit our files to only the lefse results, and whatever category you are using: otus.df<-sub.all[, which(colnames(sub.all) %in% lefse.otus)] otus.df$sampleID<-rownames(otus.df) groups<-sub.all[, c("seqID", "group_reinfection")] otus<-merge(groups, otus.df, by.x="seqID", by.y="sampleID") otus<-otus[,2:7] # now you have your list of significant otus in a dataframe! # create your stats summary dataframe: # column names: Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria # column names, with "": "Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria" x<-otus means<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ group_reinfection,data = x,FUN=function(x) mean =mean(x) ) means2<-melt(means, id.vars = "group_reinfection", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.means<-means2$value sds<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ group_reinfection,data = x,FUN=function(x) sd =sd(x) ) sds2<-melt(sds, id.vars = "group_reinfection", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.sds<-sds2$value otu.highsd<-otu.means+sds2$value otu.lowsd<-otu.means-sds2$value medians<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ group_reinfection,data = x,FUN=function(x) median =median(x) ) medians2<-melt(medians, id.vars = "group_reinfection", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.medians<-medians2$value ses<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ group_reinfection,data = x,FUN=function(x) se=sd(x)/sqrt(length(x)) ) ses2<-melt(ses, id.vars = "group_reinfection", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.ses<-ses2$value otu.highse<-otu.means+ses2$value otu.lowse<-otu.means-ses2$value highq<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ group_reinfection,data = x,FUN=function(x) highq=quantile(x, 0.75) ) highq2<-melt(ses, id.vars = "group_reinfection", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.highq<-otu.medians+highq2$value lowq<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ group_reinfection,data = x,FUN=function(x) lowq=quantile(x, 0.75) ) lowq2<-melt(ses, id.vars = "group_reinfection", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.lowq<-otu.medians-lowq2$value # add all the data together: labels<-paste(as.character(means2$group_reinfection), as.character(means2$variable)) summary<-data.frame(label=labels, mean = otu.means, sd = otu.sds, se = otu.ses, median = otu.medians, highq = otu.highq, lowq = otu.lowq, highse = otu.highse, lowse = otu.lowse, highsd = otu.highsd, lowsd = otu.lowsd ) summary$sequence <- seq(1, length(summary$label)) summary$label <- reorder(summary$label, summary$sequence) summary$otu <- means2$variable summary$group <-means2$group_reinfection # plot it: labels <- summary$otu labels <- gsub("_", ": ", labels) summary$otu<-gsub("_", ": ", summary$otu) averages <- summary$mean ranges <- summary$se groupnames<-as.character(unique(summary$group)) # option 1 (used as manuscript Supplemental Figure S1: dotchart(averages, labels=labels, xlab='relative abundance (mean + se)', pch=20, col=c("chartreuse3", "orange", "darkgoldenrod"), groups=summary$group, cex=0.7, xlim=c(min(averages-ranges)-1, max(averages+ranges)+1)) segments(averages-ranges, c(15, 8, 1, 16, 9, 2, 17, 10, 3, 18, 11, 4, 19, 12, 5), averages+ranges, c(15, 8, 1, 16, 9, 2, 17, 10, 3, 18, 11, 4, 19, 12, 5), col=c("chartreuse3", "orange", "darkgoldenrod"), lwd=2) # note: adding the bars on your graph is a bit confusing # you may have to play around with the ordering, since this is a grouped dotplot # future ways of making this step simpler are appreciated! # option 2: ## this one was used for Fig 4: dotchart(averages, labels="", xlab='relative abundance (mean + se)', pch=20, col=c("chartreuse3", "orange", "darkgoldenrod"), groups=as.factor(summary$otu), cex=0.8, xlim=c(min(averages-ranges)-1, max(averages+ranges)+1)) segments(averages-ranges, c(21:23, 16:18, 11:13, 6:8, 1:3), averages+ranges, c(21:23, 16:18, 11:13, 6:8, 1:3), col=c("chartreuse3", "orange", "darkgoldenrod"), lwd=2) legend("bottomright", groupnames, col=c("chartreuse3", "orange", "darkgoldenrod"), pch=19, cex=0.6, bg="white") #Looks BEAUTIFUL #### Fig. 4A: plotting lefse OTUs by clinical status (negative vs. positive) # these are the OTUs significant between positive and negative samples otus.df<-sub.all[, which(colnames(sub.all) %in% lefse.otus)] otus.df$sampleID<-rownames(otus.df) groups<-sub.all[, c("seqID", "POS_NEG")] otus.clinical<-merge(groups, otus.df, by="sampleID") otus.clinical<-otus.clinical[,2:7] otus.df<-sub.all[, which(colnames(sub.all) %in% lefse.otus)] otus.df$sampleID<-rownames(otus.df) groups<-sub.all[, c("seqID", "POS_NEG")] otus.clinical<-merge(groups, otus.df, by.x="seqID", by.y="sampleID") otus.clinical<-otus.clinical[,2:7] # create your stats summary dataframe: # column names: Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria # column names, with "": "Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria" x<-otus.clinical means<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ POS_NEG,data = x,FUN=function(x) mean =mean(x) ) means2<-melt(means, id.vars = "POS_NEG", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.means<-means2$value sds<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ POS_NEG,data = x,FUN=function(x) sd =sd(x) ) sds2<-melt(sds, id.vars = "POS_NEG", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.sds<-sds2$value otu.highsd<-otu.means+sds2$value otu.lowsd<-otu.means-sds2$value medians<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ POS_NEG,data = x,FUN=function(x) median =median(x) ) medians2<-melt(medians, id.vars = "POS_NEG", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.medians<-medians2$value ses<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ POS_NEG,data = x,FUN=function(x) se=sd(x)/sqrt(length(x)) ) ses2<-melt(ses, id.vars = "POS_NEG", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.ses<-ses2$value otu.highse<-otu.means+ses2$value otu.lowse<-otu.means-ses2$value highq<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ POS_NEG,data = x,FUN=function(x) highq=quantile(x, 0.75) ) highq2<-melt(ses, id.vars = "POS_NEG", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.highq<-otu.medians+highq2$value lowq<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ POS_NEG,data = x,FUN=function(x) lowq=quantile(x, 0.75) ) lowq2<-melt(ses, id.vars = "POS_NEG", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.lowq<-otu.medians-lowq2$value # add all the data together: labels<-paste(as.character(means2$POS_NEG), as.character(means2$variable)) summary<-data.frame(label=labels, mean = otu.means, sd = otu.sds, se = otu.ses, median = otu.medians, highq = otu.highq, lowq = otu.lowq, highse = otu.highse, lowse = otu.lowse, highsd = otu.highsd, lowsd = otu.lowsd ) summary$sequence <- seq(1, length(summary$label)) summary$label <- reorder(summary$label, summary$sequence) summary$otu <- means2$variable summary$group <-means2$POS_NEG # plot it: labels <- summary$otu labels <- gsub("_", ": ", labels) labels <- gsub("000", "", labels) summary$otu<-gsub("_", ": ", summary$otu) summary$otu<-gsub("000", "", summary$otu) averages <- summary$mean ranges <- summary$se groupnames<-as.character(unique(summary$group)) # option 1 (used as manuscript Figure 4): dotchart(averages, labels="", xlab='relative abundance (mean + se)', pch=20, col=c("grey47", "magenta"), groups=as.factor(summary$otu), cex=0.8, cex.lab=0.8, xlim=c(min(averages-ranges)-1, max(averages+ranges)+1)) segments(averages-ranges, c(17:18, 13:14, 9:10, 5:6, 1:2), averages+ranges, c(17:18, 13:14, 9:10, 5:6, 1:2), col=c("grey47", "magenta"), lwd=2) legend("bottomright", groupnames, col=c("grey47", "magenta"), pch=19, cex=0.6, bg="white") # option 2: dotchart(averages, labels=labels, xlab='relative abundance (mean + se)', pch=20, col=c("grey47", "magenta"), groups=summary$group, cex=0.7, xlim=c(min(averages-ranges)-1, max(averages+ranges)+1)) segments(averages-ranges, c(8, 1, 9, 2, 10, 3, 11, 4, 12, 5), averages+ranges, c(8, 1, 9, 2, 10, 3, 11, 4, 12, 5), col=c("grey47", "magenta"), lwd=2) # note: adding the bars on your graph is a bit confusing # you may have to play around with the ordering, since this is a grouped dotplot # future ways of making this step simpler are appreciated! ### #--- ### # for severity: # used the same steps above to get 'lefse.otus' that were different with severity otus.df<-sub.all[, which(colnames(sub.all) %in% lefse.otus)] otus.df$sampleID<-rownames(otus.df) groups<-sub.all[, c("seqID", "severeidsa")] otus.severe<-merge(groups, otus.df, by.x="seqID", by.y="sampleID") otus.severe<-otus.severe[,2:9] # create your stats summary dataframe: # column names: Otu00004_Escherichia, Otu00015_Lachnospiraceae, Otu00017_Bifidobacterium, Otu00030_Blautia, Otu00044_Flavonifractor, Otu00050_Bacteria, Otu00097_Lactococcus # column names, with "": "Otu00004_Escherichia", "Otu00015_Lachnospiraceae", "Otu00017_Bifidobacterium", "Otu00030_Blautia", "Otu00044_Flavonifractor", "Otu00050_Bacteria", "Otu00097_Lactococcus" x<-otus.severe means<-aggregate(cbind(Otu00004_Escherichia, Otu00015_Lachnospiraceae, Otu00017_Bifidobacterium, Otu00030_Blautia, Otu00044_Flavonifractor, Otu00050_Bacteria, Otu00097_Lactococcus) ~ severeidsa,data = x,FUN=function(x) mean =mean(x) ) means2<-melt(means, id.vars = "severeidsa", measure.vars = c("Otu00004_Escherichia", "Otu00015_Lachnospiraceae", "Otu00017_Bifidobacterium", "Otu00030_Blautia", "Otu00044_Flavonifractor", "Otu00050_Bacteria", "Otu00097_Lactococcus")) otu.means<-means2$value sds<-aggregate(cbind(Otu00004_Escherichia, Otu00015_Lachnospiraceae, Otu00017_Bifidobacterium, Otu00030_Blautia, Otu00044_Flavonifractor, Otu00050_Bacteria, Otu00097_Lactococcus) ~ severeidsa,data = x,FUN=function(x) sd =sd(x) ) sds2<-melt(sds, id.vars = "severeidsa", measure.vars = c("Otu00004_Escherichia", "Otu00015_Lachnospiraceae", "Otu00017_Bifidobacterium", "Otu00030_Blautia", "Otu00044_Flavonifractor", "Otu00050_Bacteria", "Otu00097_Lactococcus")) otu.sds<-sds2$value otu.highsd<-otu.means+sds2$value otu.lowsd<-otu.means-sds2$value medians<-aggregate(cbind(Otu00004_Escherichia, Otu00015_Lachnospiraceae, Otu00017_Bifidobacterium, Otu00030_Blautia, Otu00044_Flavonifractor, Otu00050_Bacteria, Otu00097_Lactococcus) ~ severeidsa,data = x,FUN=function(x) median =median(x) ) medians2<-melt(medians, id.vars = "severeidsa", measure.vars = c("Otu00004_Escherichia", "Otu00015_Lachnospiraceae", "Otu00017_Bifidobacterium", "Otu00030_Blautia", "Otu00044_Flavonifractor", "Otu00050_Bacteria", "Otu00097_Lactococcus")) otu.medians<-medians2$value ses<-aggregate(cbind(Otu00004_Escherichia, Otu00015_Lachnospiraceae, Otu00017_Bifidobacterium, Otu00030_Blautia, Otu00044_Flavonifractor, Otu00050_Bacteria, Otu00097_Lactococcus) ~ severeidsa,data = x,FUN=function(x) se=sd(x)/sqrt(length(x)) ) ses2<-melt(ses, id.vars = "severeidsa", measure.vars = c("Otu00004_Escherichia", "Otu00015_Lachnospiraceae", "Otu00017_Bifidobacterium", "Otu00030_Blautia", "Otu00044_Flavonifractor", "Otu00050_Bacteria", "Otu00097_Lactococcus")) otu.ses<-ses2$value otu.highse<-otu.means+ses2$value otu.lowse<-otu.means-ses2$value highq<-aggregate(cbind(Otu00004_Escherichia, Otu00015_Lachnospiraceae, Otu00017_Bifidobacterium, Otu00030_Blautia, Otu00044_Flavonifractor, Otu00050_Bacteria, Otu00097_Lactococcus) ~ severeidsa,data = x,FUN=function(x) highq=quantile(x, 0.75) ) highq2<-melt(ses, id.vars = "severeidsa", measure.vars = c("Otu00004_Escherichia", "Otu00015_Lachnospiraceae", "Otu00017_Bifidobacterium", "Otu00030_Blautia", "Otu00044_Flavonifractor", "Otu00050_Bacteria", "Otu00097_Lactococcus")) otu.highq<-otu.medians+highq2$value lowq<-aggregate(cbind(Otu00004_Escherichia, Otu00015_Lachnospiraceae, Otu00017_Bifidobacterium, Otu00030_Blautia, Otu00044_Flavonifractor, Otu00050_Bacteria, Otu00097_Lactococcus) ~ severeidsa,data = x,FUN=function(x) lowq=quantile(x, 0.75) ) lowq2<-melt(ses, id.vars = "severeidsa", measure.vars = c("Otu00004_Escherichia", "Otu00015_Lachnospiraceae", "Otu00017_Bifidobacterium", "Otu00030_Blautia", "Otu00044_Flavonifractor", "Otu00050_Bacteria", "Otu00097_Lactococcus")) otu.lowq<-otu.medians-lowq2$value # add all the data together: labels<-paste(as.character(means2$severeidsa), as.character(means2$variable)) summary<-data.frame(label=labels, mean = otu.means, sd = otu.sds, se = otu.ses, median = otu.medians, highq = otu.highq, lowq = otu.lowq, highse = otu.highse, lowse = otu.lowse, highsd = otu.highsd, lowsd = otu.lowsd ) summary$sequence <- seq(1, length(summary$label)) summary$label <- reorder(summary$label, summary$sequence) summary$otu <- means2$variable summary$group <-means2$severeidsa # plot it: labels <- summary$otu labels <- gsub("_", ": ", labels) labels <- gsub("000", "", labels) summary$otu<-gsub("_", ": ", summary$otu) summary$otu<-gsub("000", "", summary$otu) averages <- summary$mean ranges <- summary$se groupnames<-as.character(unique(summary$group)) # option 1 (used as manuscript Figure 4): # since the first OTU is significantly more abundant than others, let's split these up into 2 quadrants to emphasize the others... summary1<-summary[1:2, ] labels1 <- summary1$otu labels1 <- gsub("_", ": ", labels) labels1 <- gsub("000", "", labels) summary1$otu<-gsub("_", ": ", summary1$otu) summary1$otu<-gsub("000", "", summary1$otu) averages1 <- summary1$mean ranges1 <- summary1$se groupnames1<-as.character(unique(summary1$group)) summary2<-summary[3:14, ] labels2 <- summary2$otu labels2 <- gsub("_", ": ", labels) labels2 <- gsub("000", "", labels) summary2$otu<-gsub("_", ": ", summary2$otu) summary2$otu<-gsub("000", "", summary2$otu) averages2 <- summary2$mean ranges2 <- summary2$se groupnames2<-as.character(unique(summary2$group)) # summary 1: par(mfrow=c(2,1)) dotchart(averages1, labels="", xlab='relative abundance (mean + se)', pch=20, col=c("blue", "red"), groups=as.factor(summary1$otu), cex=0.8, cex.lab=0.8, xlim=c(min(averages1-ranges1)-1, max(averages1+ranges1)+1)) segments(averages1-ranges1, c(1:2), averages1+ranges1, c(1:2), col=c("blue", "red"), lwd=2) legend("bottomright", c("not severe", "severe"), col=c("blue", "red"), pch=19, cex=0.6, bg="white") # summary 2: dotchart(averages2, labels="", xlab='relative abundance (mean + se)', pch=20, col=c("blue", "red"), groups=as.factor(summary2$otu), cex=0.8, cex.lab=0.8, xlim=c(min(averages2-ranges2)-1, max(averages2+ranges2)+1)) segments(averages2-ranges2, c(21:22, 17:18, 13:14, 9:10, 5:6, 1:2), averages2+ranges2, c(21:22, 17:18, 13:14, 9:10, 5:6, 1:2), col=c("blue", "red"), lwd=2) legend("bottomright", c("not severe", "severe"), col=c("blue", "red"), pch=19, cex=0.6, bg="white") ### this still doesn't give even graphs...just go with summary, and chop it down: # summary (all): dotchart(averages, labels="", xlab='relative abundance (mean + se)', pch=20, col=c("blue", "red"), groups=as.factor(summary$otu), cex=0.8, cex.lab=0.8, xlim=c(0, max(averages+ranges)+1)) segments(averages-ranges, c(25:26, 21:22, 17:18, 13:14, 9:10, 5:6, 1:2), averages+ranges, c(25:26, 21:22, 17:18, 13:14, 9:10, 5:6, 1:2), col=c("blue", "red"), lwd=2) legend("bottomright", c("not severe", "severe"), col=c("blue", "red"), pch=19, cex=0.6, bg="white") # option 2: dotchart(averages, labels=labels, xlab='relative abundance (mean + se)', pch=20, col=c("blue", "red"), groups=summary$group, cex=0.7, xlim=c(min(averages-ranges)-1, max(averages+ranges)+1)) segments(averages-ranges, c(8, 1, 9, 2, 10, 3, 11, 4, 12, 5), averages+ranges, c(8, 1, 9, 2, 10, 3, 11, 4, 12, 5), col=c("blue", "red"), lwd=2) # note: adding the bars on your graph is a bit confusing # you may have to play around with the ordering, since this is a grouped dotplot # future ways of making this step simpler are appreciated!
/REVISED_manuscript.code/UPDATED_Fig3.dotplot.R
no_license
ayitbarek/ERIN.recurrence
R
false
false
20,486
r
## Making a dotplot of LefSe-identified OTUs--UPDATED # 3.18.16 # Anna M. Seekatz # adapted from http://polisci.msu.edu/jacoby/research/dotplots/tpm/Creating%20figures/Creating%20Figure%204.R library(plyr) library(reshape2) library(Hmisc) library(lattice) library(dplyr) # files used: # updated_meta_fromkrishna_03.08.16.txt: updated meta # suberin.relOTUs.txt: relative abundance of OTUs, filtered (same info applicable as before) # erinfmt.new.taxonomy.names.txt: edited taxonomy files with OTU info (same info applicable as before) # updated_erinsubset_all.lefse.results.txt: new lefse results, edited from mothur # meta and OTU files meta<-read.table(file="updated_meta_fromkrishna_03.08.16.txt", header=TRUE) sub.otus<-read.table(file="../suberin.relOTUs.txt", header=TRUE) meta2<-meta[-which(meta$seqID %in% c("DA3240", "DA3260_P", "DA3298", "DA3299", "DA3376")), ] meta<-meta2 tax<-read.table(file="../erinfmt.new.taxonomy.names.txt", header=TRUE) keep<-as.character(colnames(sub.otus[1:506])) filtered.tax<-tax[tax$OTU %in% keep, ] colnames(sub.otus)<-filtered.tax$taxname sub.otus$sampleID<-rownames(sub.otus) # merge meta and OTUs: sub.otus$sampleID<-as.factor(sub.otus$sampleID) sub.all<-merge(meta, sub.otus, by.x="seqID", by.y="sampleID") rownames(sub.all)<-sub.all$seqID # lefse results (filtered file to include only the significant ones) lefse<-read.table(file="updated_erinsubset_all.lefse.results.txt", header=TRUE) # get taxnames for lefse OTU file: keep<-as.character(lefse$OTU) filtered.tax<-tax[tax$OTU %in% keep, ] lefse$otuname<-filtered.tax$taxname lefse <- lefse[order(lefse$clinical_Class, lefse$otuname),] lefse.otus<-as.character(lefse$otuname[1:5]) # for severe ones: #lefse <- lefse[order(lefse$severe_Class, lefse$otuname),] #lefse.otus<-as.character(lefse$otuname[1:7]) # these were all the sign. OTUs in the index samples of recurrent vs. nonrecurrent patients #### Fig. 4B: plotting lefse OTUs by group # these are the OTUs significant between positive and negative samples # let's limit our files to only the lefse results, and whatever category you are using: otus.df<-sub.all[, which(colnames(sub.all) %in% lefse.otus)] otus.df$sampleID<-rownames(otus.df) groups<-sub.all[, c("seqID", "group_reinfection")] otus<-merge(groups, otus.df, by.x="seqID", by.y="sampleID") otus<-otus[,2:7] # now you have your list of significant otus in a dataframe! # create your stats summary dataframe: # column names: Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria # column names, with "": "Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria" x<-otus means<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ group_reinfection,data = x,FUN=function(x) mean =mean(x) ) means2<-melt(means, id.vars = "group_reinfection", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.means<-means2$value sds<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ group_reinfection,data = x,FUN=function(x) sd =sd(x) ) sds2<-melt(sds, id.vars = "group_reinfection", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.sds<-sds2$value otu.highsd<-otu.means+sds2$value otu.lowsd<-otu.means-sds2$value medians<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ group_reinfection,data = x,FUN=function(x) median =median(x) ) medians2<-melt(medians, id.vars = "group_reinfection", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.medians<-medians2$value ses<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ group_reinfection,data = x,FUN=function(x) se=sd(x)/sqrt(length(x)) ) ses2<-melt(ses, id.vars = "group_reinfection", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.ses<-ses2$value otu.highse<-otu.means+ses2$value otu.lowse<-otu.means-ses2$value highq<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ group_reinfection,data = x,FUN=function(x) highq=quantile(x, 0.75) ) highq2<-melt(ses, id.vars = "group_reinfection", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.highq<-otu.medians+highq2$value lowq<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ group_reinfection,data = x,FUN=function(x) lowq=quantile(x, 0.75) ) lowq2<-melt(ses, id.vars = "group_reinfection", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.lowq<-otu.medians-lowq2$value # add all the data together: labels<-paste(as.character(means2$group_reinfection), as.character(means2$variable)) summary<-data.frame(label=labels, mean = otu.means, sd = otu.sds, se = otu.ses, median = otu.medians, highq = otu.highq, lowq = otu.lowq, highse = otu.highse, lowse = otu.lowse, highsd = otu.highsd, lowsd = otu.lowsd ) summary$sequence <- seq(1, length(summary$label)) summary$label <- reorder(summary$label, summary$sequence) summary$otu <- means2$variable summary$group <-means2$group_reinfection # plot it: labels <- summary$otu labels <- gsub("_", ": ", labels) summary$otu<-gsub("_", ": ", summary$otu) averages <- summary$mean ranges <- summary$se groupnames<-as.character(unique(summary$group)) # option 1 (used as manuscript Supplemental Figure S1: dotchart(averages, labels=labels, xlab='relative abundance (mean + se)', pch=20, col=c("chartreuse3", "orange", "darkgoldenrod"), groups=summary$group, cex=0.7, xlim=c(min(averages-ranges)-1, max(averages+ranges)+1)) segments(averages-ranges, c(15, 8, 1, 16, 9, 2, 17, 10, 3, 18, 11, 4, 19, 12, 5), averages+ranges, c(15, 8, 1, 16, 9, 2, 17, 10, 3, 18, 11, 4, 19, 12, 5), col=c("chartreuse3", "orange", "darkgoldenrod"), lwd=2) # note: adding the bars on your graph is a bit confusing # you may have to play around with the ordering, since this is a grouped dotplot # future ways of making this step simpler are appreciated! # option 2: ## this one was used for Fig 4: dotchart(averages, labels="", xlab='relative abundance (mean + se)', pch=20, col=c("chartreuse3", "orange", "darkgoldenrod"), groups=as.factor(summary$otu), cex=0.8, xlim=c(min(averages-ranges)-1, max(averages+ranges)+1)) segments(averages-ranges, c(21:23, 16:18, 11:13, 6:8, 1:3), averages+ranges, c(21:23, 16:18, 11:13, 6:8, 1:3), col=c("chartreuse3", "orange", "darkgoldenrod"), lwd=2) legend("bottomright", groupnames, col=c("chartreuse3", "orange", "darkgoldenrod"), pch=19, cex=0.6, bg="white") #Looks BEAUTIFUL #### Fig. 4A: plotting lefse OTUs by clinical status (negative vs. positive) # these are the OTUs significant between positive and negative samples otus.df<-sub.all[, which(colnames(sub.all) %in% lefse.otus)] otus.df$sampleID<-rownames(otus.df) groups<-sub.all[, c("seqID", "POS_NEG")] otus.clinical<-merge(groups, otus.df, by="sampleID") otus.clinical<-otus.clinical[,2:7] otus.df<-sub.all[, which(colnames(sub.all) %in% lefse.otus)] otus.df$sampleID<-rownames(otus.df) groups<-sub.all[, c("seqID", "POS_NEG")] otus.clinical<-merge(groups, otus.df, by.x="seqID", by.y="sampleID") otus.clinical<-otus.clinical[,2:7] # create your stats summary dataframe: # column names: Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria # column names, with "": "Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria" x<-otus.clinical means<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ POS_NEG,data = x,FUN=function(x) mean =mean(x) ) means2<-melt(means, id.vars = "POS_NEG", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.means<-means2$value sds<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ POS_NEG,data = x,FUN=function(x) sd =sd(x) ) sds2<-melt(sds, id.vars = "POS_NEG", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.sds<-sds2$value otu.highsd<-otu.means+sds2$value otu.lowsd<-otu.means-sds2$value medians<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ POS_NEG,data = x,FUN=function(x) median =median(x) ) medians2<-melt(medians, id.vars = "POS_NEG", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.medians<-medians2$value ses<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ POS_NEG,data = x,FUN=function(x) se=sd(x)/sqrt(length(x)) ) ses2<-melt(ses, id.vars = "POS_NEG", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.ses<-ses2$value otu.highse<-otu.means+ses2$value otu.lowse<-otu.means-ses2$value highq<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ POS_NEG,data = x,FUN=function(x) highq=quantile(x, 0.75) ) highq2<-melt(ses, id.vars = "POS_NEG", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.highq<-otu.medians+highq2$value lowq<-aggregate(cbind(Otu00001_Enterobacteriaceae,Otu00003_Bacteroides,Otu00012_Clostridium_XI,Otu00014_Streptococcus, Otu00050_Bacteria) ~ POS_NEG,data = x,FUN=function(x) lowq=quantile(x, 0.75) ) lowq2<-melt(ses, id.vars = "POS_NEG", measure.vars = c("Otu00001_Enterobacteriaceae","Otu00003_Bacteroides","Otu00012_Clostridium_XI","Otu00014_Streptococcus", "Otu00050_Bacteria")) otu.lowq<-otu.medians-lowq2$value # add all the data together: labels<-paste(as.character(means2$POS_NEG), as.character(means2$variable)) summary<-data.frame(label=labels, mean = otu.means, sd = otu.sds, se = otu.ses, median = otu.medians, highq = otu.highq, lowq = otu.lowq, highse = otu.highse, lowse = otu.lowse, highsd = otu.highsd, lowsd = otu.lowsd ) summary$sequence <- seq(1, length(summary$label)) summary$label <- reorder(summary$label, summary$sequence) summary$otu <- means2$variable summary$group <-means2$POS_NEG # plot it: labels <- summary$otu labels <- gsub("_", ": ", labels) labels <- gsub("000", "", labels) summary$otu<-gsub("_", ": ", summary$otu) summary$otu<-gsub("000", "", summary$otu) averages <- summary$mean ranges <- summary$se groupnames<-as.character(unique(summary$group)) # option 1 (used as manuscript Figure 4): dotchart(averages, labels="", xlab='relative abundance (mean + se)', pch=20, col=c("grey47", "magenta"), groups=as.factor(summary$otu), cex=0.8, cex.lab=0.8, xlim=c(min(averages-ranges)-1, max(averages+ranges)+1)) segments(averages-ranges, c(17:18, 13:14, 9:10, 5:6, 1:2), averages+ranges, c(17:18, 13:14, 9:10, 5:6, 1:2), col=c("grey47", "magenta"), lwd=2) legend("bottomright", groupnames, col=c("grey47", "magenta"), pch=19, cex=0.6, bg="white") # option 2: dotchart(averages, labels=labels, xlab='relative abundance (mean + se)', pch=20, col=c("grey47", "magenta"), groups=summary$group, cex=0.7, xlim=c(min(averages-ranges)-1, max(averages+ranges)+1)) segments(averages-ranges, c(8, 1, 9, 2, 10, 3, 11, 4, 12, 5), averages+ranges, c(8, 1, 9, 2, 10, 3, 11, 4, 12, 5), col=c("grey47", "magenta"), lwd=2) # note: adding the bars on your graph is a bit confusing # you may have to play around with the ordering, since this is a grouped dotplot # future ways of making this step simpler are appreciated! ### #--- ### # for severity: # used the same steps above to get 'lefse.otus' that were different with severity otus.df<-sub.all[, which(colnames(sub.all) %in% lefse.otus)] otus.df$sampleID<-rownames(otus.df) groups<-sub.all[, c("seqID", "severeidsa")] otus.severe<-merge(groups, otus.df, by.x="seqID", by.y="sampleID") otus.severe<-otus.severe[,2:9] # create your stats summary dataframe: # column names: Otu00004_Escherichia, Otu00015_Lachnospiraceae, Otu00017_Bifidobacterium, Otu00030_Blautia, Otu00044_Flavonifractor, Otu00050_Bacteria, Otu00097_Lactococcus # column names, with "": "Otu00004_Escherichia", "Otu00015_Lachnospiraceae", "Otu00017_Bifidobacterium", "Otu00030_Blautia", "Otu00044_Flavonifractor", "Otu00050_Bacteria", "Otu00097_Lactococcus" x<-otus.severe means<-aggregate(cbind(Otu00004_Escherichia, Otu00015_Lachnospiraceae, Otu00017_Bifidobacterium, Otu00030_Blautia, Otu00044_Flavonifractor, Otu00050_Bacteria, Otu00097_Lactococcus) ~ severeidsa,data = x,FUN=function(x) mean =mean(x) ) means2<-melt(means, id.vars = "severeidsa", measure.vars = c("Otu00004_Escherichia", "Otu00015_Lachnospiraceae", "Otu00017_Bifidobacterium", "Otu00030_Blautia", "Otu00044_Flavonifractor", "Otu00050_Bacteria", "Otu00097_Lactococcus")) otu.means<-means2$value sds<-aggregate(cbind(Otu00004_Escherichia, Otu00015_Lachnospiraceae, Otu00017_Bifidobacterium, Otu00030_Blautia, Otu00044_Flavonifractor, Otu00050_Bacteria, Otu00097_Lactococcus) ~ severeidsa,data = x,FUN=function(x) sd =sd(x) ) sds2<-melt(sds, id.vars = "severeidsa", measure.vars = c("Otu00004_Escherichia", "Otu00015_Lachnospiraceae", "Otu00017_Bifidobacterium", "Otu00030_Blautia", "Otu00044_Flavonifractor", "Otu00050_Bacteria", "Otu00097_Lactococcus")) otu.sds<-sds2$value otu.highsd<-otu.means+sds2$value otu.lowsd<-otu.means-sds2$value medians<-aggregate(cbind(Otu00004_Escherichia, Otu00015_Lachnospiraceae, Otu00017_Bifidobacterium, Otu00030_Blautia, Otu00044_Flavonifractor, Otu00050_Bacteria, Otu00097_Lactococcus) ~ severeidsa,data = x,FUN=function(x) median =median(x) ) medians2<-melt(medians, id.vars = "severeidsa", measure.vars = c("Otu00004_Escherichia", "Otu00015_Lachnospiraceae", "Otu00017_Bifidobacterium", "Otu00030_Blautia", "Otu00044_Flavonifractor", "Otu00050_Bacteria", "Otu00097_Lactococcus")) otu.medians<-medians2$value ses<-aggregate(cbind(Otu00004_Escherichia, Otu00015_Lachnospiraceae, Otu00017_Bifidobacterium, Otu00030_Blautia, Otu00044_Flavonifractor, Otu00050_Bacteria, Otu00097_Lactococcus) ~ severeidsa,data = x,FUN=function(x) se=sd(x)/sqrt(length(x)) ) ses2<-melt(ses, id.vars = "severeidsa", measure.vars = c("Otu00004_Escherichia", "Otu00015_Lachnospiraceae", "Otu00017_Bifidobacterium", "Otu00030_Blautia", "Otu00044_Flavonifractor", "Otu00050_Bacteria", "Otu00097_Lactococcus")) otu.ses<-ses2$value otu.highse<-otu.means+ses2$value otu.lowse<-otu.means-ses2$value highq<-aggregate(cbind(Otu00004_Escherichia, Otu00015_Lachnospiraceae, Otu00017_Bifidobacterium, Otu00030_Blautia, Otu00044_Flavonifractor, Otu00050_Bacteria, Otu00097_Lactococcus) ~ severeidsa,data = x,FUN=function(x) highq=quantile(x, 0.75) ) highq2<-melt(ses, id.vars = "severeidsa", measure.vars = c("Otu00004_Escherichia", "Otu00015_Lachnospiraceae", "Otu00017_Bifidobacterium", "Otu00030_Blautia", "Otu00044_Flavonifractor", "Otu00050_Bacteria", "Otu00097_Lactococcus")) otu.highq<-otu.medians+highq2$value lowq<-aggregate(cbind(Otu00004_Escherichia, Otu00015_Lachnospiraceae, Otu00017_Bifidobacterium, Otu00030_Blautia, Otu00044_Flavonifractor, Otu00050_Bacteria, Otu00097_Lactococcus) ~ severeidsa,data = x,FUN=function(x) lowq=quantile(x, 0.75) ) lowq2<-melt(ses, id.vars = "severeidsa", measure.vars = c("Otu00004_Escherichia", "Otu00015_Lachnospiraceae", "Otu00017_Bifidobacterium", "Otu00030_Blautia", "Otu00044_Flavonifractor", "Otu00050_Bacteria", "Otu00097_Lactococcus")) otu.lowq<-otu.medians-lowq2$value # add all the data together: labels<-paste(as.character(means2$severeidsa), as.character(means2$variable)) summary<-data.frame(label=labels, mean = otu.means, sd = otu.sds, se = otu.ses, median = otu.medians, highq = otu.highq, lowq = otu.lowq, highse = otu.highse, lowse = otu.lowse, highsd = otu.highsd, lowsd = otu.lowsd ) summary$sequence <- seq(1, length(summary$label)) summary$label <- reorder(summary$label, summary$sequence) summary$otu <- means2$variable summary$group <-means2$severeidsa # plot it: labels <- summary$otu labels <- gsub("_", ": ", labels) labels <- gsub("000", "", labels) summary$otu<-gsub("_", ": ", summary$otu) summary$otu<-gsub("000", "", summary$otu) averages <- summary$mean ranges <- summary$se groupnames<-as.character(unique(summary$group)) # option 1 (used as manuscript Figure 4): # since the first OTU is significantly more abundant than others, let's split these up into 2 quadrants to emphasize the others... summary1<-summary[1:2, ] labels1 <- summary1$otu labels1 <- gsub("_", ": ", labels) labels1 <- gsub("000", "", labels) summary1$otu<-gsub("_", ": ", summary1$otu) summary1$otu<-gsub("000", "", summary1$otu) averages1 <- summary1$mean ranges1 <- summary1$se groupnames1<-as.character(unique(summary1$group)) summary2<-summary[3:14, ] labels2 <- summary2$otu labels2 <- gsub("_", ": ", labels) labels2 <- gsub("000", "", labels) summary2$otu<-gsub("_", ": ", summary2$otu) summary2$otu<-gsub("000", "", summary2$otu) averages2 <- summary2$mean ranges2 <- summary2$se groupnames2<-as.character(unique(summary2$group)) # summary 1: par(mfrow=c(2,1)) dotchart(averages1, labels="", xlab='relative abundance (mean + se)', pch=20, col=c("blue", "red"), groups=as.factor(summary1$otu), cex=0.8, cex.lab=0.8, xlim=c(min(averages1-ranges1)-1, max(averages1+ranges1)+1)) segments(averages1-ranges1, c(1:2), averages1+ranges1, c(1:2), col=c("blue", "red"), lwd=2) legend("bottomright", c("not severe", "severe"), col=c("blue", "red"), pch=19, cex=0.6, bg="white") # summary 2: dotchart(averages2, labels="", xlab='relative abundance (mean + se)', pch=20, col=c("blue", "red"), groups=as.factor(summary2$otu), cex=0.8, cex.lab=0.8, xlim=c(min(averages2-ranges2)-1, max(averages2+ranges2)+1)) segments(averages2-ranges2, c(21:22, 17:18, 13:14, 9:10, 5:6, 1:2), averages2+ranges2, c(21:22, 17:18, 13:14, 9:10, 5:6, 1:2), col=c("blue", "red"), lwd=2) legend("bottomright", c("not severe", "severe"), col=c("blue", "red"), pch=19, cex=0.6, bg="white") ### this still doesn't give even graphs...just go with summary, and chop it down: # summary (all): dotchart(averages, labels="", xlab='relative abundance (mean + se)', pch=20, col=c("blue", "red"), groups=as.factor(summary$otu), cex=0.8, cex.lab=0.8, xlim=c(0, max(averages+ranges)+1)) segments(averages-ranges, c(25:26, 21:22, 17:18, 13:14, 9:10, 5:6, 1:2), averages+ranges, c(25:26, 21:22, 17:18, 13:14, 9:10, 5:6, 1:2), col=c("blue", "red"), lwd=2) legend("bottomright", c("not severe", "severe"), col=c("blue", "red"), pch=19, cex=0.6, bg="white") # option 2: dotchart(averages, labels=labels, xlab='relative abundance (mean + se)', pch=20, col=c("blue", "red"), groups=summary$group, cex=0.7, xlim=c(min(averages-ranges)-1, max(averages+ranges)+1)) segments(averages-ranges, c(8, 1, 9, 2, 10, 3, 11, 4, 12, 5), averages+ranges, c(8, 1, 9, 2, 10, 3, 11, 4, 12, 5), col=c("blue", "red"), lwd=2) # note: adding the bars on your graph is a bit confusing # you may have to play around with the ordering, since this is a grouped dotplot # future ways of making this step simpler are appreciated!
# Data manipulations library(dplyr) library(nycflights13) #pada contoh ini akan digunakan contoh data flight ls_data <- list(flights,airlines, airports, planes, weather) #cek data head(ls_data[1]) head(ls_data[2]) head(ls_data[3]) head(ls_data[4]) head(ls_data[5]) #mengambil data dari list #-----to data frame df <- as.data.frame(ls_data[1]) #-----to array arr <- df$tailnum #just an example #-----to obj obj <- arr[12] #just an example ## beberapa fungsi yang sering digunakan pada dplyr #-----select (Memilih kolom) df <- select(flights, year, dep_time) head(df) df <- select(flights, -year) head(df) #-----filter df <- filter(flights, hour>=5) head(df) #-----arange df <- arrange(flights, hour) #-----group by & summirise df <- flights %>% group_by(origin) %>% summarise(flighthour = sum(hour), avdist = mean(distance)) #-----distict distinct(flights, origin) #-----mutate df <- flights %>% group_by(origin) %>% summarise(flighthour = mean(hour), avdist = mean(distance)) %>% mutate(av_a = avdist/flighthour) #----50 Example DPLYR-------- #from URL <- "https://www.listendata.com/2016/08/dplyr-tutorial.html#" mydata = read.csv("https://raw.githubusercontent.com/deepanshu88/data/master/sampledata.csv") ## 1. Random from df sample_n(mydata, 2) ## 2. random in percent sample_frac(mydata, 0.1) #10% ## 3. remove duplicate row x <- distinct(mydata) ## 4. remove duplicate par x <- distinct(mydata, Index, .keep_all = T) ## 5. Select select(mydata, Index, State) ## 6. Select several column select(mydata, Index:Y2005) ## 7.Eliminating some column x <- select(mydata, -Index) ## 8. Select variable start string "Y" x <- select(mydata, -starts_with("Y")) ## 9. Select variable contain string "I" x <- select(mydata, contains("I")) ## 10. Reorder x <- select(mydata, State, everything()) ## 11. Rename variable x1 <- rename(df, origin.flight=origin) names(df) names(x1) ## 12. filter column x1 <- filter(df, origin=="JFK") head(x1) x1 <- filter(df, origin %in% c("JFK","LGA")) head(x1) x1 <- filter(flights, month %in% c(3,5,7) & carrier %in% c("UA", "AA","B6","DL")) #using and view(x1) x1 <- filter(flights, month %in% c(3) | carrier %in% c("UA", "AA")) #using OR View(x1) x1<-filter(flights, !month %in% c(1,12,5)) #exclude some variable distinct(x1, month) x1 <- filter(flights, grepl("AA",tailnum)) #filter tailnum contains AA word View(x1)
/ds2_dplyr.R
no_license
MuhammadBhakti/R_ds_notes
R
false
false
2,471
r
# Data manipulations library(dplyr) library(nycflights13) #pada contoh ini akan digunakan contoh data flight ls_data <- list(flights,airlines, airports, planes, weather) #cek data head(ls_data[1]) head(ls_data[2]) head(ls_data[3]) head(ls_data[4]) head(ls_data[5]) #mengambil data dari list #-----to data frame df <- as.data.frame(ls_data[1]) #-----to array arr <- df$tailnum #just an example #-----to obj obj <- arr[12] #just an example ## beberapa fungsi yang sering digunakan pada dplyr #-----select (Memilih kolom) df <- select(flights, year, dep_time) head(df) df <- select(flights, -year) head(df) #-----filter df <- filter(flights, hour>=5) head(df) #-----arange df <- arrange(flights, hour) #-----group by & summirise df <- flights %>% group_by(origin) %>% summarise(flighthour = sum(hour), avdist = mean(distance)) #-----distict distinct(flights, origin) #-----mutate df <- flights %>% group_by(origin) %>% summarise(flighthour = mean(hour), avdist = mean(distance)) %>% mutate(av_a = avdist/flighthour) #----50 Example DPLYR-------- #from URL <- "https://www.listendata.com/2016/08/dplyr-tutorial.html#" mydata = read.csv("https://raw.githubusercontent.com/deepanshu88/data/master/sampledata.csv") ## 1. Random from df sample_n(mydata, 2) ## 2. random in percent sample_frac(mydata, 0.1) #10% ## 3. remove duplicate row x <- distinct(mydata) ## 4. remove duplicate par x <- distinct(mydata, Index, .keep_all = T) ## 5. Select select(mydata, Index, State) ## 6. Select several column select(mydata, Index:Y2005) ## 7.Eliminating some column x <- select(mydata, -Index) ## 8. Select variable start string "Y" x <- select(mydata, -starts_with("Y")) ## 9. Select variable contain string "I" x <- select(mydata, contains("I")) ## 10. Reorder x <- select(mydata, State, everything()) ## 11. Rename variable x1 <- rename(df, origin.flight=origin) names(df) names(x1) ## 12. filter column x1 <- filter(df, origin=="JFK") head(x1) x1 <- filter(df, origin %in% c("JFK","LGA")) head(x1) x1 <- filter(flights, month %in% c(3,5,7) & carrier %in% c("UA", "AA","B6","DL")) #using and view(x1) x1 <- filter(flights, month %in% c(3) | carrier %in% c("UA", "AA")) #using OR View(x1) x1<-filter(flights, !month %in% c(1,12,5)) #exclude some variable distinct(x1, month) x1 <- filter(flights, grepl("AA",tailnum)) #filter tailnum contains AA word View(x1)
#Kyle Schneider # Chapter 16 & 17 Homework # DATA 320 # 10/23/2019 # Exercises 16.11 #1, 3 #1) A famous athlete has an impressive career, winning 70% of her 500 career matches. However, #this athlete gets criticized because in important events, such as the Olympics, she has a #losing record of 8 wins and 9 losses. Perform a Chi squared test to determine if this losing #record can be simply due to chance as opposed to not performing well under pressure. wins = 500*.7 wins losses = 500*.3 two_by_two <- data.frame(success = c("Win", "Loss"), olympicCount = c(8,9), nonOlympics = c(wins, losses)) two_by_two chisq_test <- two_by_two %>% select(-success) %>% chisq.test() chisq_test # theres an 8% chances that it was obtained by chance alone, so she does preform worse during # important matches #3) Compute the odds ratio of “losing under pressure” along with a confidence interval. odds_important <- (two_by_two$olympicCount[1] / sum(two_by_two$olympicCount)) / (two_by_two$olympicCount[2] / sum(two_by_two$olympicCount)) odds_important odds_normal <- (two_by_two$nonOlympics[1] / sum(two_by_two$nonOlympics)) / (two_by_two$nonOlympics[2] / sum(two_by_two$nonOlympics)) odds_normal log_or <- log( odds_important / odds_normal ) se <- two_by_two %>% select(-success) %>% summarize(se = sqrt(sum(1/olympicCount) + sum(1/nonOlympics))) %>% pull(se) ci <- log_or + c(-1,1) * qnorm(0.975) * se ci exp(ci) # Exercises 17.3 #1-5 library(dslabs) data(heights) x <- heights %>% filter(sex == "Male") %>% pull(height) #1)Mathematically speaking, x is our population. Using the urn analogy, we have an #urn with the values of x in it. What are the average and standard deviation of our #population? mean(x) sd(x) #2)Call the population average computed above μ and the standard deviation σ. Now #take a sample of size 50, with replacement, and construct an estimate for μ and σ. N = 50 X = sample(x, N, replace = TRUE) mean(X) sd(X) #3)What does the theory tell us about the sample average ¯X and how it is related to μ? #B. It is a random variable with expected value μ and standard error σ/√N. #4)So how is this useful? We are going to use an oversimplified yet illustrative example. #Suppose we want to know the average height of our male students, but we only get to #measure 50 of the 708. We will use ¯X as our estimate. We know from the answer to exercise #3 that the standard estimate of our error ¯X−μ is σ/√N. We want to compute this, but we #don’t know σ. Based on what is described in this section, show your estimate of σ. sd(X) #5)Now that we have an estimate of σ, let’s call our estimate s. Construct a 95% confidence #interval for μ. mean(X) + c(-1, 1)*qnorm(1 - 0.05/2) * sd(X) / sqrt(N)
/16-17_HW.R
no_license
Kyleschneiderx/R-for-data-science
R
false
false
2,829
r
#Kyle Schneider # Chapter 16 & 17 Homework # DATA 320 # 10/23/2019 # Exercises 16.11 #1, 3 #1) A famous athlete has an impressive career, winning 70% of her 500 career matches. However, #this athlete gets criticized because in important events, such as the Olympics, she has a #losing record of 8 wins and 9 losses. Perform a Chi squared test to determine if this losing #record can be simply due to chance as opposed to not performing well under pressure. wins = 500*.7 wins losses = 500*.3 two_by_two <- data.frame(success = c("Win", "Loss"), olympicCount = c(8,9), nonOlympics = c(wins, losses)) two_by_two chisq_test <- two_by_two %>% select(-success) %>% chisq.test() chisq_test # theres an 8% chances that it was obtained by chance alone, so she does preform worse during # important matches #3) Compute the odds ratio of “losing under pressure” along with a confidence interval. odds_important <- (two_by_two$olympicCount[1] / sum(two_by_two$olympicCount)) / (two_by_two$olympicCount[2] / sum(two_by_two$olympicCount)) odds_important odds_normal <- (two_by_two$nonOlympics[1] / sum(two_by_two$nonOlympics)) / (two_by_two$nonOlympics[2] / sum(two_by_two$nonOlympics)) odds_normal log_or <- log( odds_important / odds_normal ) se <- two_by_two %>% select(-success) %>% summarize(se = sqrt(sum(1/olympicCount) + sum(1/nonOlympics))) %>% pull(se) ci <- log_or + c(-1,1) * qnorm(0.975) * se ci exp(ci) # Exercises 17.3 #1-5 library(dslabs) data(heights) x <- heights %>% filter(sex == "Male") %>% pull(height) #1)Mathematically speaking, x is our population. Using the urn analogy, we have an #urn with the values of x in it. What are the average and standard deviation of our #population? mean(x) sd(x) #2)Call the population average computed above μ and the standard deviation σ. Now #take a sample of size 50, with replacement, and construct an estimate for μ and σ. N = 50 X = sample(x, N, replace = TRUE) mean(X) sd(X) #3)What does the theory tell us about the sample average ¯X and how it is related to μ? #B. It is a random variable with expected value μ and standard error σ/√N. #4)So how is this useful? We are going to use an oversimplified yet illustrative example. #Suppose we want to know the average height of our male students, but we only get to #measure 50 of the 708. We will use ¯X as our estimate. We know from the answer to exercise #3 that the standard estimate of our error ¯X−μ is σ/√N. We want to compute this, but we #don’t know σ. Based on what is described in this section, show your estimate of σ. sd(X) #5)Now that we have an estimate of σ, let’s call our estimate s. Construct a 95% confidence #interval for μ. mean(X) + c(-1, 1)*qnorm(1 - 0.05/2) * sd(X) / sqrt(N)
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/process_contributions.R \name{process_contributions} \alias{process_contributions} \title{Process contributions data} \usage{ process_contributions(contributions) } \arguments{ \item{contributions}{A dataframe containing Members' contribution data} } \value{ A dataframe containing contributions attributed to single members, including the number of words per contribution } \description{ \code{process_contributions} Processes Members' contributions data }
/man/process_contributions.Rd
permissive
eliseuberoi/clparlysearch
R
false
true
536
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/process_contributions.R \name{process_contributions} \alias{process_contributions} \title{Process contributions data} \usage{ process_contributions(contributions) } \arguments{ \item{contributions}{A dataframe containing Members' contribution data} } \value{ A dataframe containing contributions attributed to single members, including the number of words per contribution } \description{ \code{process_contributions} Processes Members' contributions data }
library(tidyverse) library(fs) library(ComplexHeatmap) # Common definitions ------------------------------------------------------ EXPERIMENT_NAMES <- c( "pnet_original" = "original setup", "pnet_deterministic" = "deterministic inputs", "pnet_shuffled" = "shuffled labels", "mskimpact_nsclc_original_biased" = "lung", "mskimpact_bc_original_biased" = "breast", "mskimpact_cc_original_biased" = "colorectal", "mskimpact_pc_original_biased" = "prostate", "mskimpact_nsclc_original_corrected" = "lung", "mskimpact_bc_original_corrected" = "breast", "mskimpact_cc_original_corrected" = "colorectal", "mskimpact_pc_original_corrected" = "prostate" ) # for MSK-IMPACT from https://wesandersonpalettes.tumblr.com/ # (The deeper you go, the weirder life gets.) EXPERIMENT_COLORS <- c( "pnet_original" = "gray50", "pnet_deterministic" = "#3182bd", "pnet_shuffled" = "#e69f00", "mskimpact_nsclc_original" = "#c5a495", "mskimpact_bc_original" = "#7b6da8", "mskimpact_cc_original" = "#f3d28f", "mskimpact_pc_original" = "#235135" ) ORIGINAL_SEED_COLOR <- "red" # ggplot functions -------------------------------------------------------- BASE_TEXT_SIZE_MM = 1.76 # mm, corresponds to 5 pt, use in geom_text() BASE_TEXT_SIZE_PT = 5 # pt, use in theme() BASE_LINEWIDTH = 0.25 # pt BASE_BOXPLOT_SIZE = 0.5 #' Common theme for figures in the publication. #' #' This theme bases upon `theme_bw()` and ensures #' - common line widths of `BASE_LINEWIDTH` #' - common text sizes of `BASE_TEXT_SIZE_PT` #' - a uniform plot margin of 1 mm #' - a medium strip text, an empty strip background, and #' 1 mm padding between strip text and panel #' #' @param rotate_x_labels If `TRUE`, rotate x-axis tick labels by 90°. #' @param ... Other parameters passed to `theme_bw()`. #' #' @return A theme object. theme_pub <- function(rotate_x_labels = FALSE, ...){ res <- theme_bw(...) + theme( line = element_line(linewidth = BASE_LINEWIDTH), axis.text = element_text(color = "black", size = BASE_TEXT_SIZE_PT), axis.title = element_text(color = "black", size = BASE_TEXT_SIZE_PT), legend.background = element_blank(), legend.text = element_text(color = "black", size = BASE_TEXT_SIZE_PT), legend.title = element_text(size = BASE_TEXT_SIZE_PT), panel.border = element_rect(linewidth = BASE_LINEWIDTH * 2), plot.margin = unit(c(1, 1, 1, 1), "mm"), strip.background = element_blank(), strip.text = element_text( color = "black", size = BASE_TEXT_SIZE_PT ), strip.text.x = element_text(margin = margin(b = 1, unit = "mm")), strip.text.y = element_text(margin = margin(l = 1, unit = "mm")), plot.title = element_text(size = BASE_TEXT_SIZE_PT, face = "bold") ) if (rotate_x_labels) res <- res + theme(axis.text.x = element_text(angle = 90, hjust = 1, vjust = 0.5)) res } #' Save a publication-quality plot. #' #' @param filename Filename, will be saved in subfolder `plots/final`. #' @param plot Plot object. #' @param width Width in cm. #' @param height Height in cm. #' @param type Type of image file. #' @param dpi Resolution. #' @param ... Other parameters passed to the plotting function. ggsave_publication <- function(filename, plot = NULL, width = 4, height = 4, type = "pdf", dpi = 1200, ...) { filename <- str_glue("plots/{filename}.{type}") filename %>% path_dir() %>% dir_create() if (is.null(plot)) { # if last_plot() is available, use ggsave() ggsave( filename, dpi = dpi, units = "cm", limitsize = FALSE, width = width, height = height, ... ) } else { # for non-ggplot objects, use the base R functions directly; # only png and pdf backends are supported if (type == "png") { png( filename, res = dpi, units = "cm", width = width, height = height, ... ) } else if (type == "pdf") { pdf( filename, width = width / 2.54, # dimensions for pdf() must be inches height = height / 2.54, ... ) } else { stop("Type", type, "cannot be saved.") } print(plot) dev.off() } } # shorthand for adding a facet title as secondary axis # use like scale_x_continuous (sec.axis = facet_title("...")) facet_title <- function(name) { dup_axis(name = name, breaks = NULL, labels = NULL) } # Heatmap appearance ------------------------------------------------------ ht_opt( simple_anno_size = unit(1.5, "mm"), COLUMN_ANNO_PADDING = unit(1, "pt"), DENDROGRAM_PADDING = unit(1, "pt"), HEATMAP_LEGEND_PADDING = unit(1, "mm"), ROW_ANNO_PADDING = unit(1, "pt"), TITLE_PADDING = unit(2, "mm"), heatmap_row_title_gp = gpar(fontsize = BASE_TEXT_SIZE_PT), heatmap_row_names_gp = gpar(fontsize = BASE_TEXT_SIZE_PT), heatmap_column_title_gp = gpar(fontsize = BASE_TEXT_SIZE_PT), heatmap_column_names_gp = gpar(fontsize = BASE_TEXT_SIZE_PT), legend_labels_gp = gpar(fontsize = BASE_TEXT_SIZE_PT), legend_title_gp = gpar(fontsize = BASE_TEXT_SIZE_PT), legend_border = FALSE )
/scripts/styling.R
permissive
csbg/pnet_robustness
R
false
false
5,340
r
library(tidyverse) library(fs) library(ComplexHeatmap) # Common definitions ------------------------------------------------------ EXPERIMENT_NAMES <- c( "pnet_original" = "original setup", "pnet_deterministic" = "deterministic inputs", "pnet_shuffled" = "shuffled labels", "mskimpact_nsclc_original_biased" = "lung", "mskimpact_bc_original_biased" = "breast", "mskimpact_cc_original_biased" = "colorectal", "mskimpact_pc_original_biased" = "prostate", "mskimpact_nsclc_original_corrected" = "lung", "mskimpact_bc_original_corrected" = "breast", "mskimpact_cc_original_corrected" = "colorectal", "mskimpact_pc_original_corrected" = "prostate" ) # for MSK-IMPACT from https://wesandersonpalettes.tumblr.com/ # (The deeper you go, the weirder life gets.) EXPERIMENT_COLORS <- c( "pnet_original" = "gray50", "pnet_deterministic" = "#3182bd", "pnet_shuffled" = "#e69f00", "mskimpact_nsclc_original" = "#c5a495", "mskimpact_bc_original" = "#7b6da8", "mskimpact_cc_original" = "#f3d28f", "mskimpact_pc_original" = "#235135" ) ORIGINAL_SEED_COLOR <- "red" # ggplot functions -------------------------------------------------------- BASE_TEXT_SIZE_MM = 1.76 # mm, corresponds to 5 pt, use in geom_text() BASE_TEXT_SIZE_PT = 5 # pt, use in theme() BASE_LINEWIDTH = 0.25 # pt BASE_BOXPLOT_SIZE = 0.5 #' Common theme for figures in the publication. #' #' This theme bases upon `theme_bw()` and ensures #' - common line widths of `BASE_LINEWIDTH` #' - common text sizes of `BASE_TEXT_SIZE_PT` #' - a uniform plot margin of 1 mm #' - a medium strip text, an empty strip background, and #' 1 mm padding between strip text and panel #' #' @param rotate_x_labels If `TRUE`, rotate x-axis tick labels by 90°. #' @param ... Other parameters passed to `theme_bw()`. #' #' @return A theme object. theme_pub <- function(rotate_x_labels = FALSE, ...){ res <- theme_bw(...) + theme( line = element_line(linewidth = BASE_LINEWIDTH), axis.text = element_text(color = "black", size = BASE_TEXT_SIZE_PT), axis.title = element_text(color = "black", size = BASE_TEXT_SIZE_PT), legend.background = element_blank(), legend.text = element_text(color = "black", size = BASE_TEXT_SIZE_PT), legend.title = element_text(size = BASE_TEXT_SIZE_PT), panel.border = element_rect(linewidth = BASE_LINEWIDTH * 2), plot.margin = unit(c(1, 1, 1, 1), "mm"), strip.background = element_blank(), strip.text = element_text( color = "black", size = BASE_TEXT_SIZE_PT ), strip.text.x = element_text(margin = margin(b = 1, unit = "mm")), strip.text.y = element_text(margin = margin(l = 1, unit = "mm")), plot.title = element_text(size = BASE_TEXT_SIZE_PT, face = "bold") ) if (rotate_x_labels) res <- res + theme(axis.text.x = element_text(angle = 90, hjust = 1, vjust = 0.5)) res } #' Save a publication-quality plot. #' #' @param filename Filename, will be saved in subfolder `plots/final`. #' @param plot Plot object. #' @param width Width in cm. #' @param height Height in cm. #' @param type Type of image file. #' @param dpi Resolution. #' @param ... Other parameters passed to the plotting function. ggsave_publication <- function(filename, plot = NULL, width = 4, height = 4, type = "pdf", dpi = 1200, ...) { filename <- str_glue("plots/{filename}.{type}") filename %>% path_dir() %>% dir_create() if (is.null(plot)) { # if last_plot() is available, use ggsave() ggsave( filename, dpi = dpi, units = "cm", limitsize = FALSE, width = width, height = height, ... ) } else { # for non-ggplot objects, use the base R functions directly; # only png and pdf backends are supported if (type == "png") { png( filename, res = dpi, units = "cm", width = width, height = height, ... ) } else if (type == "pdf") { pdf( filename, width = width / 2.54, # dimensions for pdf() must be inches height = height / 2.54, ... ) } else { stop("Type", type, "cannot be saved.") } print(plot) dev.off() } } # shorthand for adding a facet title as secondary axis # use like scale_x_continuous (sec.axis = facet_title("...")) facet_title <- function(name) { dup_axis(name = name, breaks = NULL, labels = NULL) } # Heatmap appearance ------------------------------------------------------ ht_opt( simple_anno_size = unit(1.5, "mm"), COLUMN_ANNO_PADDING = unit(1, "pt"), DENDROGRAM_PADDING = unit(1, "pt"), HEATMAP_LEGEND_PADDING = unit(1, "mm"), ROW_ANNO_PADDING = unit(1, "pt"), TITLE_PADDING = unit(2, "mm"), heatmap_row_title_gp = gpar(fontsize = BASE_TEXT_SIZE_PT), heatmap_row_names_gp = gpar(fontsize = BASE_TEXT_SIZE_PT), heatmap_column_title_gp = gpar(fontsize = BASE_TEXT_SIZE_PT), heatmap_column_names_gp = gpar(fontsize = BASE_TEXT_SIZE_PT), legend_labels_gp = gpar(fontsize = BASE_TEXT_SIZE_PT), legend_title_gp = gpar(fontsize = BASE_TEXT_SIZE_PT), legend_border = FALSE )
% Generated by roxygen2 (4.1.0): do not edit by hand % Please edit documentation in R/AgainStart.R \docType{data} \name{AGGRESSION} \alias{AGGRESSION} \title{TV and Behavior} \format{A data frame with 16 observations on the following two variables: \itemize{ \item \code{violence} (an integer vector) \item \code{noviolence} (an integer vector) }} \source{ Gibbons, J. D. (1977) \emph{Nonparametric Methods for Quantitavie Analysis}. American Science Press. } \usage{ AGGRESSION } \description{ Data regarding the aggressive behavior in relation to exposure to violent television programs. } \details{ This is data regarding aggressive behavior in relation to exposure to violent television programs from Gibbons (1997) with the following exposition: \dQuote{\ldots a group of children are matched as well as possible as regards home environment, genetic factors, intelligence, parental attitudes, and so forth, in an effort to minimize factors other than TV that might influence a tendency for aggressive behavior. In each of the resulting 16 pairs, one child is randomly selected to view the most violent shows on TV, while the other watches cartoons, situation comedies, and the like. The children are then subjected to a series of tests designed to produce an ordinal measure of their aggression factors.} (pages 143-144) } \examples{ AL <- reshape(AGGRESSION, varying = c("violence", "noviolence"), v.names = "aggression", direction = "long") ggplot(data = AL, aes(x = factor(time), y = aggression, fill = factor(time))) + geom_boxplot() + labs(x = "") + scale_x_discrete(breaks = c(1, 2), labels = c("Violence", "No Violence")) + guides(fill = FALSE) + scale_fill_brewer() rm(AL) with(data = AGGRESSION, wilcox.test(violence, noviolence, paired = TRUE, alternative = "greater")) } \references{ Ugarte, M. D., Militino, A. F., and Arnholt, A. T. 2015. \emph{Probability and Statistics with R}, Second Edition. Chapman & Hall / CRC. } \keyword{datasets}
/man/AGGRESSION.Rd
no_license
darokun/PASWR2
R
false
false
1,962
rd
% Generated by roxygen2 (4.1.0): do not edit by hand % Please edit documentation in R/AgainStart.R \docType{data} \name{AGGRESSION} \alias{AGGRESSION} \title{TV and Behavior} \format{A data frame with 16 observations on the following two variables: \itemize{ \item \code{violence} (an integer vector) \item \code{noviolence} (an integer vector) }} \source{ Gibbons, J. D. (1977) \emph{Nonparametric Methods for Quantitavie Analysis}. American Science Press. } \usage{ AGGRESSION } \description{ Data regarding the aggressive behavior in relation to exposure to violent television programs. } \details{ This is data regarding aggressive behavior in relation to exposure to violent television programs from Gibbons (1997) with the following exposition: \dQuote{\ldots a group of children are matched as well as possible as regards home environment, genetic factors, intelligence, parental attitudes, and so forth, in an effort to minimize factors other than TV that might influence a tendency for aggressive behavior. In each of the resulting 16 pairs, one child is randomly selected to view the most violent shows on TV, while the other watches cartoons, situation comedies, and the like. The children are then subjected to a series of tests designed to produce an ordinal measure of their aggression factors.} (pages 143-144) } \examples{ AL <- reshape(AGGRESSION, varying = c("violence", "noviolence"), v.names = "aggression", direction = "long") ggplot(data = AL, aes(x = factor(time), y = aggression, fill = factor(time))) + geom_boxplot() + labs(x = "") + scale_x_discrete(breaks = c(1, 2), labels = c("Violence", "No Violence")) + guides(fill = FALSE) + scale_fill_brewer() rm(AL) with(data = AGGRESSION, wilcox.test(violence, noviolence, paired = TRUE, alternative = "greater")) } \references{ Ugarte, M. D., Militino, A. F., and Arnholt, A. T. 2015. \emph{Probability and Statistics with R}, Second Edition. Chapman & Hall / CRC. } \keyword{datasets}
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/analyse_crps_news.R \name{analyse_crps_news} \alias{analyse_crps_news} \title{Analyses a dataframe with news body for occurences of the each of the currencySymbols} \usage{ analyse_crps_news(databodynews, currencySymbols) } \arguments{ \item{databodynews}{dataframe with news body and their timestamp} \item{currencySymbols}{a vector of characters representing the cryptocurrencys Symbols to be analysed} } \value{ Dataframe with a boolean column per cryptosymbol, representing if the cryptocurrency was cited in the news article } \description{ Analyses a dataframe with news body for occurences of the each of the currencySymbols }
/CryptoShiny/man/analyse_crps_news.Rd
permissive
fernandopf/ThinkRProject
R
false
true
713
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/analyse_crps_news.R \name{analyse_crps_news} \alias{analyse_crps_news} \title{Analyses a dataframe with news body for occurences of the each of the currencySymbols} \usage{ analyse_crps_news(databodynews, currencySymbols) } \arguments{ \item{databodynews}{dataframe with news body and their timestamp} \item{currencySymbols}{a vector of characters representing the cryptocurrencys Symbols to be analysed} } \value{ Dataframe with a boolean column per cryptosymbol, representing if the cryptocurrency was cited in the news article } \description{ Analyses a dataframe with news body for occurences of the each of the currencySymbols }
## Setup and Run FBBmodel ##syntax: nohup env SPECIES=1 LEAF=31 CHAIN=1 R --vanilla < FBB_main.R > log1-31-1 & startTime = proc.time()[3] # Start timer #****************** USER PARAMETERS *********************************** species.id <- as.numeric(system("echo $SPECIES",intern=TRUE)) leaf <- as.numeric(system("echo $LEAF",intern=TRUE)) chain <- as.numeric(system("echo $CHAIN",intern=TRUE)) niter = 100000 # number of MCMC iterations to compute nchains = 3 # number of chains that will be used progressEvery = 10000 # How frequent to print progress ## File parameters filePath = "/home/wolz1/Biomath/" # "/Users/wolzy4u/Desktop/Biomath/" datFile = "Kdata_Project.csv" # "Biomath_Processed_Data.csv" saveDirDat = "FBB_soyface_output_dat/" # "FBB_output_dat/" setupFile = "FBB_setup.R" funcFile = "FBB_functions.R" mcmcFile = "FBB_mcmc.R" datFile = paste(filePath, datFile, sep="") saveDirDat = paste(filePath, saveDirDat, sep="") setupFile = paste(filePath, setupFile,sep="") funcFile = paste(filePath, funcFile, sep="") mcmcFile = paste(filePath, mcmcFile, sep="") dir.create(saveDirDat,showWarnings=FALSE,recursive=TRUE) ## Toggles and parameters compute.pA = TRUE # Whether or not to compute pA compute.pgs = TRUE # Whether or not to compute pgs compute.DA = TRUE # Whether or not to compute DA compute.Dgs = TRUE # Whether or not to compute Dgs track.An.pred = TRUE # Whether or not to track An.pred (TRUE = yes) track.gs.pred = TRUE # Whether or not to track gs.pred (TRUE = yes) sample.Vcmax = TRUE # Whether or not to sample Vcmax (TRUE = yes) prior.mu.Vcmax = 4.61 prior.sd.Vcmax = 0.32 sample.Jmax = TRUE # Whether or not to sample Jmax (TRUE = yes) prior.mu.Jmax = 5.16 prior.sd.Jmax = 0.32 sample.R = TRUE # Whether or not to sample R (TRUE = yes) prior.mu.R = -0.69 prior.sd.R = 1 R.lb = 0 # lower bound on R R.ub = 10 # upper bound on R sample.Gstar = TRUE # Whether or not to sample Gstar (TRUE = yes) prior.mu.Gstar = 3.75 prior.sd.Gstar = 1 sample.alpha = TRUE # Whether or not to sample alpha (TRUE = yes) prior.mu.alpha = -0.15 prior.sd.alpha = 0.1 alpha.lb = 0 # lower bound on alpha alpha.ub = 1 # upper bound on alpha sample.m = TRUE # Whether or not to sample alpha (TRUE = yes) prior.mu.m = 10 prior.sd.m = 10 sample.g0 = TRUE # Whether or not to sample alpha (TRUE = yes) prior.mu.g0 = 0 prior.sd.g0 = 0.1 sample.tauF = TRUE # Whether or not to sample tauF (TRUE = yes) prior.s1.tauF = 0.1 prior.s2.tauF = 0.1 tauF.lb = 0 # lower bound on tauF tauF.ub = 100 # upper bound on tauF sample.tauBB = TRUE # Whether or not to sample tauBB (TRUE = yes) prior.s1.tauBB = 0.1 prior.s2.tauBB = 0.00001 tauBB.lb = 0 # lower bound on tauBB tauBB.ub = 100 # upper bound on tauBB ## Initial conditions Vcmax.ic = c(88.7,200,30) Jmax.ic = c(144.8,300,50) R.ic = c(0.6,2,0.01) Gstar.ic = c(29.8,60,5) alpha.ic = c(0.85,0.99,0.3) m.ic = c(12.8,20,1) g0.ic = c(0,1,-1) tauF.ic = c(0.4,1,0.01) tauBB.ic = c(0.033,0.05,0.001) ## Jump SD jumpSD.Vcmax = 5 jumpSD.Jmax = 10 jumpSD.R = 1 jumpSD.Gstar = 5 jumpSD.alpha = 0.1 jumpSD.m = 3 jumpSD.g0 = 0.05 jumpSD.tauF = 0.01 jumpSD.tauBB = 0.01 ## Constants O = 210 # [02] in ppt (millimol/mol) Kc = 275 # Michaelis-Menton constant of RuBisCO for C02 Ko = 400 # Michaelis-Menton constant of RuBisCO for O phi = 0.85 # maximum dark-adapted quantum yield of PSII beta = 0.5 # fraction of absorbed quanta that reasches PSII theta = 0.7 # empirical curvature factor #********************************************************************** ## FOR EACH LEAF - CHAIN runName = paste(species.id, leaf, chain, sep="-") ## Run setup file source(setupFile) ## Load functions (in separate file for convenience) source(funcFile) ## Initial Conditions Vcmax = Vcmax.ic[chain] # max velocity of carboxylation (micromol/m^2/s) Jmax = Jmax.ic[chain] # max rate of electron transport (micromol/m^2/s) R = R.ic[chain] # day respiration (micromol/m^2/s) Gstar = Gstar.ic[chain] # CO2 compensation pt in the absense of dark resp alpha = alpha.ic[chain] # absorbance of leaves (3.1) m = m.ic[chain] # slope of Ball-Berry model g0 = g0.ic[chain] # y-intercept of Ball-Berry model tauF = tauF.ic[chain] # variance of Farquhar model tauBB = tauBB.ic[chain] # variance of Ball-Berry model ## Run MCMC source(mcmcFile,print.eval=TRUE) save.image(paste(saveDirDat, runName, ".Rdata", sep="")) #********************************************************************** elapsedTime = proc.time()[3] - startTime print(elapsedTime) efficiency = elapsedTime/niter print(paste('Seconds/Iteration:', efficiency))
/modules/photosynthesis/code/FBB_main.R
permissive
PecanProject/pecan
R
false
false
4,756
r
## Setup and Run FBBmodel ##syntax: nohup env SPECIES=1 LEAF=31 CHAIN=1 R --vanilla < FBB_main.R > log1-31-1 & startTime = proc.time()[3] # Start timer #****************** USER PARAMETERS *********************************** species.id <- as.numeric(system("echo $SPECIES",intern=TRUE)) leaf <- as.numeric(system("echo $LEAF",intern=TRUE)) chain <- as.numeric(system("echo $CHAIN",intern=TRUE)) niter = 100000 # number of MCMC iterations to compute nchains = 3 # number of chains that will be used progressEvery = 10000 # How frequent to print progress ## File parameters filePath = "/home/wolz1/Biomath/" # "/Users/wolzy4u/Desktop/Biomath/" datFile = "Kdata_Project.csv" # "Biomath_Processed_Data.csv" saveDirDat = "FBB_soyface_output_dat/" # "FBB_output_dat/" setupFile = "FBB_setup.R" funcFile = "FBB_functions.R" mcmcFile = "FBB_mcmc.R" datFile = paste(filePath, datFile, sep="") saveDirDat = paste(filePath, saveDirDat, sep="") setupFile = paste(filePath, setupFile,sep="") funcFile = paste(filePath, funcFile, sep="") mcmcFile = paste(filePath, mcmcFile, sep="") dir.create(saveDirDat,showWarnings=FALSE,recursive=TRUE) ## Toggles and parameters compute.pA = TRUE # Whether or not to compute pA compute.pgs = TRUE # Whether or not to compute pgs compute.DA = TRUE # Whether or not to compute DA compute.Dgs = TRUE # Whether or not to compute Dgs track.An.pred = TRUE # Whether or not to track An.pred (TRUE = yes) track.gs.pred = TRUE # Whether or not to track gs.pred (TRUE = yes) sample.Vcmax = TRUE # Whether or not to sample Vcmax (TRUE = yes) prior.mu.Vcmax = 4.61 prior.sd.Vcmax = 0.32 sample.Jmax = TRUE # Whether or not to sample Jmax (TRUE = yes) prior.mu.Jmax = 5.16 prior.sd.Jmax = 0.32 sample.R = TRUE # Whether or not to sample R (TRUE = yes) prior.mu.R = -0.69 prior.sd.R = 1 R.lb = 0 # lower bound on R R.ub = 10 # upper bound on R sample.Gstar = TRUE # Whether or not to sample Gstar (TRUE = yes) prior.mu.Gstar = 3.75 prior.sd.Gstar = 1 sample.alpha = TRUE # Whether or not to sample alpha (TRUE = yes) prior.mu.alpha = -0.15 prior.sd.alpha = 0.1 alpha.lb = 0 # lower bound on alpha alpha.ub = 1 # upper bound on alpha sample.m = TRUE # Whether or not to sample alpha (TRUE = yes) prior.mu.m = 10 prior.sd.m = 10 sample.g0 = TRUE # Whether or not to sample alpha (TRUE = yes) prior.mu.g0 = 0 prior.sd.g0 = 0.1 sample.tauF = TRUE # Whether or not to sample tauF (TRUE = yes) prior.s1.tauF = 0.1 prior.s2.tauF = 0.1 tauF.lb = 0 # lower bound on tauF tauF.ub = 100 # upper bound on tauF sample.tauBB = TRUE # Whether or not to sample tauBB (TRUE = yes) prior.s1.tauBB = 0.1 prior.s2.tauBB = 0.00001 tauBB.lb = 0 # lower bound on tauBB tauBB.ub = 100 # upper bound on tauBB ## Initial conditions Vcmax.ic = c(88.7,200,30) Jmax.ic = c(144.8,300,50) R.ic = c(0.6,2,0.01) Gstar.ic = c(29.8,60,5) alpha.ic = c(0.85,0.99,0.3) m.ic = c(12.8,20,1) g0.ic = c(0,1,-1) tauF.ic = c(0.4,1,0.01) tauBB.ic = c(0.033,0.05,0.001) ## Jump SD jumpSD.Vcmax = 5 jumpSD.Jmax = 10 jumpSD.R = 1 jumpSD.Gstar = 5 jumpSD.alpha = 0.1 jumpSD.m = 3 jumpSD.g0 = 0.05 jumpSD.tauF = 0.01 jumpSD.tauBB = 0.01 ## Constants O = 210 # [02] in ppt (millimol/mol) Kc = 275 # Michaelis-Menton constant of RuBisCO for C02 Ko = 400 # Michaelis-Menton constant of RuBisCO for O phi = 0.85 # maximum dark-adapted quantum yield of PSII beta = 0.5 # fraction of absorbed quanta that reasches PSII theta = 0.7 # empirical curvature factor #********************************************************************** ## FOR EACH LEAF - CHAIN runName = paste(species.id, leaf, chain, sep="-") ## Run setup file source(setupFile) ## Load functions (in separate file for convenience) source(funcFile) ## Initial Conditions Vcmax = Vcmax.ic[chain] # max velocity of carboxylation (micromol/m^2/s) Jmax = Jmax.ic[chain] # max rate of electron transport (micromol/m^2/s) R = R.ic[chain] # day respiration (micromol/m^2/s) Gstar = Gstar.ic[chain] # CO2 compensation pt in the absense of dark resp alpha = alpha.ic[chain] # absorbance of leaves (3.1) m = m.ic[chain] # slope of Ball-Berry model g0 = g0.ic[chain] # y-intercept of Ball-Berry model tauF = tauF.ic[chain] # variance of Farquhar model tauBB = tauBB.ic[chain] # variance of Ball-Berry model ## Run MCMC source(mcmcFile,print.eval=TRUE) save.image(paste(saveDirDat, runName, ".Rdata", sep="")) #********************************************************************** elapsedTime = proc.time()[3] - startTime print(elapsedTime) efficiency = elapsedTime/niter print(paste('Seconds/Iteration:', efficiency))
# # Please see: # http://www.cnblogs.com/getong/archive/2013/04/01/2993139.html # png(filename="redis-alloc-benchmarks.png",width=1400, height=900) Sys.setlocale(, "en_US.UTF-8") oldpar <- par(lwd=4) AlphazeroRedis <- read.table("AlphazeroRedis.alloc.tmp") GaryburdRedigo <- read.table("GaryburdRedigo.alloc.tmp") GosexyRedis <- read.table("GosexyRedis.alloc.tmp") Simonz05Godis <- read.table("Simonz05Godis.alloc.tmp") FishRedis <- read.table("FishRedis.alloc.tmp") plot(AlphazeroRedis$V1, type="o", ylim = c(0, 400), col = "black", axes=FALSE, ann=FALSE) text(2, AlphazeroRedis$V1[2], cex=2, pos=3, col="black", "AlphazeroRedis") axis(1, at=1:9, lab=c("Ping","Set","Get","Incr", "LPush", "LRange10", "LRange100", "LRange1000", "")) axis(2, las=0, at=40*0: 400) box() title(xlab="Operation", col = "black") title(ylab="alloc/op", col = "black") title(main = "Go drivers for redis") lines(GaryburdRedigo, col = "red") text(6, GaryburdRedigo$V1[6], cex=2, pos=1, col="red", "GaryburdRedigo") lines(GosexyRedis, col = "blue") text(2, GosexyRedis$V1[2], pos=1,col="blue", cex=2, "GosexyRedis") lines(Simonz05Godis, col = "yellow") text(4, Simonz05Godis$V1[4],pos=3, col="yellow",cex=2, "Simonz05Godis") lines(FishRedis, col = "gray") text(3, FishRedis$V1[3],pos=1,cex=2, col="gray", "FishRedis") par(oldpar) dev.off()
/_benchmarks/go-redis-alloc-data.R
permissive
go-fish/redis
R
false
false
1,317
r
# # Please see: # http://www.cnblogs.com/getong/archive/2013/04/01/2993139.html # png(filename="redis-alloc-benchmarks.png",width=1400, height=900) Sys.setlocale(, "en_US.UTF-8") oldpar <- par(lwd=4) AlphazeroRedis <- read.table("AlphazeroRedis.alloc.tmp") GaryburdRedigo <- read.table("GaryburdRedigo.alloc.tmp") GosexyRedis <- read.table("GosexyRedis.alloc.tmp") Simonz05Godis <- read.table("Simonz05Godis.alloc.tmp") FishRedis <- read.table("FishRedis.alloc.tmp") plot(AlphazeroRedis$V1, type="o", ylim = c(0, 400), col = "black", axes=FALSE, ann=FALSE) text(2, AlphazeroRedis$V1[2], cex=2, pos=3, col="black", "AlphazeroRedis") axis(1, at=1:9, lab=c("Ping","Set","Get","Incr", "LPush", "LRange10", "LRange100", "LRange1000", "")) axis(2, las=0, at=40*0: 400) box() title(xlab="Operation", col = "black") title(ylab="alloc/op", col = "black") title(main = "Go drivers for redis") lines(GaryburdRedigo, col = "red") text(6, GaryburdRedigo$V1[6], cex=2, pos=1, col="red", "GaryburdRedigo") lines(GosexyRedis, col = "blue") text(2, GosexyRedis$V1[2], pos=1,col="blue", cex=2, "GosexyRedis") lines(Simonz05Godis, col = "yellow") text(4, Simonz05Godis$V1[4],pos=3, col="yellow",cex=2, "Simonz05Godis") lines(FishRedis, col = "gray") text(3, FishRedis$V1[3],pos=1,cex=2, col="gray", "FishRedis") par(oldpar) dev.off()
predict.SemiParBIVProbit <- function(object, eq, ...){ if(missing(eq)) stop("You must provide the equation number.") if(eq > object$l.flist) stop("The fitted model has a smaller number of equations.") #if(object$surv == TRUE) predict.gam <- predict.SemiParBIVProbitB if(eq==1){ ss.pred <- object$gam1 ind <- 1:object$X1.d2 } if(eq==2){ ss.pred <- object$gam2 ind <- (object$X1.d2+1):(object$X1.d2+object$X2.d2) } if(eq==3){ ss.pred <- object$gam3 ind <- (object$X1.d2+object$X2.d2+1):(object$X1.d2+object$X2.d2+object$X3.d2) } if(eq==4){ ss.pred <- object$gam4 ind <- (object$X1.d2+object$X2.d2+object$X3.d2+1):(object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2) } if(eq==5){ ss.pred <- object$gam5 ind <- (object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2+1):(object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2+object$X5.d2) } if(eq==6){ ss.pred <- object$gam6 ind <- (object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2+object$X5.d2+1):(object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2+object$X5.d2+object$X6.d2) } if(eq==7){ ss.pred <- object$gam7 ind <- (object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2+object$X5.d2+object$X6.d2+1):(object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2+object$X5.d2+object$X6.d2+object$X7.d2) } if(eq==8){ ss.pred <- object$gam8 ind <- (object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2+object$X5.d2+object$X6.d2+object$X7.d2+1):(object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2+object$X5.d2+object$X6.d2+object$X7.d2+object$X8.d2) } ss.pred$coefficients <- object$coefficients[ind] ss.pred$Vp <- object$Vb[ind,ind] ss.pred$Vp.t <- object$Vb.t[ind,ind] ss.pred$sig2 <- 1 ss.pred$scale.estimated <- FALSE #predict.gam(ss.pred, ...) predict(ss.pred, ...) }
/R/predict.SemiParBIVProbit.r
no_license
cran/SemiParBIVProbit
R
false
false
2,139
r
predict.SemiParBIVProbit <- function(object, eq, ...){ if(missing(eq)) stop("You must provide the equation number.") if(eq > object$l.flist) stop("The fitted model has a smaller number of equations.") #if(object$surv == TRUE) predict.gam <- predict.SemiParBIVProbitB if(eq==1){ ss.pred <- object$gam1 ind <- 1:object$X1.d2 } if(eq==2){ ss.pred <- object$gam2 ind <- (object$X1.d2+1):(object$X1.d2+object$X2.d2) } if(eq==3){ ss.pred <- object$gam3 ind <- (object$X1.d2+object$X2.d2+1):(object$X1.d2+object$X2.d2+object$X3.d2) } if(eq==4){ ss.pred <- object$gam4 ind <- (object$X1.d2+object$X2.d2+object$X3.d2+1):(object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2) } if(eq==5){ ss.pred <- object$gam5 ind <- (object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2+1):(object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2+object$X5.d2) } if(eq==6){ ss.pred <- object$gam6 ind <- (object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2+object$X5.d2+1):(object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2+object$X5.d2+object$X6.d2) } if(eq==7){ ss.pred <- object$gam7 ind <- (object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2+object$X5.d2+object$X6.d2+1):(object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2+object$X5.d2+object$X6.d2+object$X7.d2) } if(eq==8){ ss.pred <- object$gam8 ind <- (object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2+object$X5.d2+object$X6.d2+object$X7.d2+1):(object$X1.d2+object$X2.d2+object$X3.d2+object$X4.d2+object$X5.d2+object$X6.d2+object$X7.d2+object$X8.d2) } ss.pred$coefficients <- object$coefficients[ind] ss.pred$Vp <- object$Vb[ind,ind] ss.pred$Vp.t <- object$Vb.t[ind,ind] ss.pred$sig2 <- 1 ss.pred$scale.estimated <- FALSE #predict.gam(ss.pred, ...) predict(ss.pred, ...) }
x = rnorm(500)
/hard-coded/chart-types/histogram/basic-histogram/init.r
no_license
VukDukic/documentation
R
false
false
14
r
x = rnorm(500)
#Understanding noise pf = read.csv("pseudo_facebook.tsv", sep = '\t') str(pf) library(ggplot2) install.packages("dplyr") library(dplyr) #another method to do the above summarisation age_groups <- group_by(pf, age) pf.fc_by_age <- pf %>% group_by(age) %>% summarise(friend_count_mean = mean(friend_count), friend_count_median = median(friend_count), n = n()) %>% arrange(age) head(pf.fc_by_age) #Understanding noise: Age to Age Months p1 <- ggplot(aes(age, friend_count_mean), data = subset(pf.fc_by_age, age< 71))+ geom_line()+ geom_smooth() head(pf.fc_by_age, 10) #making new variable 'age_with_months' pf$age_with_months <- NULL pf$age_with_months <- pf$age + (12- pf$dob_month)/12 str(pf$age_with_months) #Age with month means pf.fc_by_age_months <- pf %>% group_by(age_with_months)%>% summarise(friend_count_mean = mean(friend_count), friend_count_median = median(friend_count), n = n())%>% arrange(age_with_months) head(pf.fc_by_age_months, 10) # plot between friend_count_mean and the new variable, age_with_months p2 <- ggplot(aes(age_with_months, friend_count_mean), data = subset(pf.fc_by_age_months, age_with_months< 71))+ geom_line()+ geom_smooth()+ ylim(0, 500) jpeg(file = "friend_count_meanvsage_with_months.jpeg") library(gridExtra) grid.arrange(p1, p2, ncol = 1) str(pf.fc_by_age) subset(pf.fc_by_age, age<71) help('geom_smooth')
/UnderstandingNoise.R
no_license
nitish1008/Scatter_plots
R
false
false
1,412
r
#Understanding noise pf = read.csv("pseudo_facebook.tsv", sep = '\t') str(pf) library(ggplot2) install.packages("dplyr") library(dplyr) #another method to do the above summarisation age_groups <- group_by(pf, age) pf.fc_by_age <- pf %>% group_by(age) %>% summarise(friend_count_mean = mean(friend_count), friend_count_median = median(friend_count), n = n()) %>% arrange(age) head(pf.fc_by_age) #Understanding noise: Age to Age Months p1 <- ggplot(aes(age, friend_count_mean), data = subset(pf.fc_by_age, age< 71))+ geom_line()+ geom_smooth() head(pf.fc_by_age, 10) #making new variable 'age_with_months' pf$age_with_months <- NULL pf$age_with_months <- pf$age + (12- pf$dob_month)/12 str(pf$age_with_months) #Age with month means pf.fc_by_age_months <- pf %>% group_by(age_with_months)%>% summarise(friend_count_mean = mean(friend_count), friend_count_median = median(friend_count), n = n())%>% arrange(age_with_months) head(pf.fc_by_age_months, 10) # plot between friend_count_mean and the new variable, age_with_months p2 <- ggplot(aes(age_with_months, friend_count_mean), data = subset(pf.fc_by_age_months, age_with_months< 71))+ geom_line()+ geom_smooth()+ ylim(0, 500) jpeg(file = "friend_count_meanvsage_with_months.jpeg") library(gridExtra) grid.arrange(p1, p2, ncol = 1) str(pf.fc_by_age) subset(pf.fc_by_age, age<71) help('geom_smooth')
#'Picks Fields of Focus #' #'Takes the output of \code{getField()} and squashes down rows that are not of interest to prepare the #'tibble for use as the input to \code{mkNCDB()}. #'@param d Tibble produced by \code{getFields()}. #'@param picks Short names of fields you wish to keep. #'@return Input dataframe with rows not wanted collapsed to strings. This output feeds into \code{mkNCDB()}. #'@note Inspired by a function of the same name in \pkg{SEERaBomb}. #'@examples #' library(NCDBR) #' d=getFields() #' pickFields(d) #'@name pickFields #'@export #' #' #' pickFields<-function(d,picks=c("casenum","facID","fac","facLoc","agedx","sex","race", "ins","inc","educ","urban","crow","charlson","seqnum", "CoC","yrdx","histo3","stage","d2t","radiatn","d2c", "chemo","hct","surv","alive") ) { # head(d,3) nms=NULL #kill check warning that arises 3 line downs (nBytesP1=sum(d$width)+1) ncols=dim(d)[1] d=d%>%filter(nms%in%picks) # rownames(d)<-d$nms # d=d[picks,] (N=length(picks)) # number of columns in our version of interest # if("surv" %in% d$nms) d["surv","type"]="double" # do this in mkNCDB # if("crow" %in% d$nms) d["crow","type"]="double" df=d[1,,drop=F] # assume casenum is always in picks for (i in 2:N) { # print(i) if (d$start[i]==(up<-d$start[i-1]+d$width[i-1]) ) df=rbind(df,d[i,]) else { df=rbind(df,data.frame(start=up,width=(d$start[i]-up),names=" ",nms=" ",type="string",labs="",Levs=NA)) df=rbind(df,d[i,]) } } if ((up<-d$start[i]+d$width[i])<nBytesP1) df=rbind(df,data.frame(start=up,width=(nBytesP1-up),names=" ",nms=" ",type="string",labs="",Levs=NA)) df }
/R/pickFields.R
no_license
ZhuoXI-ai/NCDBR
R
false
false
1,764
r
#'Picks Fields of Focus #' #'Takes the output of \code{getField()} and squashes down rows that are not of interest to prepare the #'tibble for use as the input to \code{mkNCDB()}. #'@param d Tibble produced by \code{getFields()}. #'@param picks Short names of fields you wish to keep. #'@return Input dataframe with rows not wanted collapsed to strings. This output feeds into \code{mkNCDB()}. #'@note Inspired by a function of the same name in \pkg{SEERaBomb}. #'@examples #' library(NCDBR) #' d=getFields() #' pickFields(d) #'@name pickFields #'@export #' #' #' pickFields<-function(d,picks=c("casenum","facID","fac","facLoc","agedx","sex","race", "ins","inc","educ","urban","crow","charlson","seqnum", "CoC","yrdx","histo3","stage","d2t","radiatn","d2c", "chemo","hct","surv","alive") ) { # head(d,3) nms=NULL #kill check warning that arises 3 line downs (nBytesP1=sum(d$width)+1) ncols=dim(d)[1] d=d%>%filter(nms%in%picks) # rownames(d)<-d$nms # d=d[picks,] (N=length(picks)) # number of columns in our version of interest # if("surv" %in% d$nms) d["surv","type"]="double" # do this in mkNCDB # if("crow" %in% d$nms) d["crow","type"]="double" df=d[1,,drop=F] # assume casenum is always in picks for (i in 2:N) { # print(i) if (d$start[i]==(up<-d$start[i-1]+d$width[i-1]) ) df=rbind(df,d[i,]) else { df=rbind(df,data.frame(start=up,width=(d$start[i]-up),names=" ",nms=" ",type="string",labs="",Levs=NA)) df=rbind(df,d[i,]) } } if ((up<-d$start[i]+d$width[i])<nBytesP1) df=rbind(df,data.frame(start=up,width=(nBytesP1-up),names=" ",nms=" ",type="string",labs="",Levs=NA)) df }
#### Assignment 4 #### # 1. [4 Points] The BayesFactor package contains a function regressionBF. Use regressionBF on the dTransform data -- use the threshold values (S, M, L, and so on) to predict RE (refractive error). Look at the Bayes Factor output, what does it seem to tell you? The help shows an example of how the BF for each model can be tested against the full model (all thresholds). Put this line in the script with a comment that notes the best model. How does this model compare to what we saw with the stepwise model selection we did in previous lectures? dFull <- read.csv('https://raw.githubusercontent.com/hashtagcpt/biostats2/master/full_data.csv') make_dTransform <- function(dFull) { # strip thresh values for data frame and log transform t1<-log10(dFull$thr1) t2<-log10(dFull$thr2) t3<-log10(dFull$thr3) t4<-log10(dFull$thr4) t5<-log10(dFull$thr5) t6<-log10(dFull$thr6) # factor will change a numeric variable to a factor which is useful for creating categorical variables dFull$subject <- factor(dFull$subject) # assign RE variable RE <- dFull$RE subject <- dFull$subject # make a data.frame dTransform <- data.frame(subject,RE,t1,t2,t3,t4,t5,t6) colnames(dTransform) <- c('subject','RE','A','L','M','Sneg','Spos','S') return(dTransform) } dTransform <- make_dTransform(dFull) library(BayesFactor) regressionBF(RE ~ A + L +M + Sneg + Spos + S, data = dTransform) output = regressionBF(RE ~ A + L + M + Sneg + Spos + S, data = dTransform) #Bayes Factor value more than 1 indicates that this factor has a higher probability than the null hypothesis in playing a factor for RE. output/output[63] #2. [3 Points] A colleague is going to run an experiment where they are going to compute a correlation test. Beforehand, they ask you how many subjects they need to run. Based on previous work, they believe the r for their experiment could be between .2 and .6, their funders want a *Type II error* probability of no more than 0.4, and they will use a conventional alpha of .05. Calculate what the minimum and the maximum number of subjects they need to run for their experiment to be adequately powered, given their funder's constraints. install.packages('pwr') library(pwr) pwr.r.test(r = 0.2, sig.level = 0.05, power = 1-0.4) pwr.r.test(r = 0.6, sig.level = 0.05, power = 1-0.4) # 3. [3 Points] # This function will help you create some simulated psychometric data... datasim <- function(contrasts, pcorrect, ntrials) { for (tmp in 1:length(contrasts)) { contrast <- rep(contrasts[tmp], ntrials) correct <- rbinom(ntrials, 1, pcorrect[tmp]) if (tmp == 1) { data <- data.frame(contrast, correct) } else { data <- rbind(data, data.frame(contrast, correct)) } } return(data) } # Create some data with contrast levels for the variable "contrasts" 0.01 to 0.1 in 10 steps. Create a vector that goes from 0 to 1 for "pcorrect". Set ntrials equal to 20. Fit and plot the resulting psychometric function. What is 50% threshold level for this resulting function? contrasts <-c(0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1) pcorrect <- c(0, 1) library(tidyverse) library(psyphy) #Create a vector that goes from 0 to 1 for "pcorrect" contrast <- seq(0.01, 0.1, length.out = 10) pcorrect <- seq(0.0, 1.0,length.out = 10) # Create data dat.contast <- datasim(contrast, pcorrect, ntrials=20) dc_summary <- dat.contast %>% group_by(contrast,correct) %>% tally() %>% ungroup() %>% complete(contrast, correct, fill = list(n = 1)) dc_summary <- subset(dc_summary, correct == 1) dc_summary$incorrect <- 20 - dc_summary$n dc_summary$correct <- dc_summary$n # Take the absolute value of negative contrast values dc_summary$contrast <- abs(dc_summary$contrast) # Fit the psychometric function psymet_fit <- glm(formula = cbind(correct, incorrect) ~ log(contrast), family = binomial, data = dc_summary) xseq <- seq(0.01, 0.1, len = 100) psymet_fit.pred <- predict(psymet_fit, newdata = data.frame(contrast = xseq), type = "response", se.fit = TRUE) psymet_pred_df <- data.frame(xseq, psymet_fit.pred$fit) colnames(psymet_pred_df) <- c('contrast','fit') psymet_plot <- ggplot(data = dc_summary, aes(x = contrast, y = correct / 20)) + geom_point(size = 2) + geom_line(data = psymet_pred_df, aes(x = contrast, y = fit), size = 1) + ylab('proportion correct') + theme(text = element_text(size=14), axis.text.x = element_text(size = 14), axis.text.y = element_text(size=14)) psymet_plot # The 50% threshold is around 0.050 based on the graph
/assignment_4/Emily_Jeong_Assignment_4.R
no_license
hashtagcpt/biostats-2
R
false
false
4,574
r
#### Assignment 4 #### # 1. [4 Points] The BayesFactor package contains a function regressionBF. Use regressionBF on the dTransform data -- use the threshold values (S, M, L, and so on) to predict RE (refractive error). Look at the Bayes Factor output, what does it seem to tell you? The help shows an example of how the BF for each model can be tested against the full model (all thresholds). Put this line in the script with a comment that notes the best model. How does this model compare to what we saw with the stepwise model selection we did in previous lectures? dFull <- read.csv('https://raw.githubusercontent.com/hashtagcpt/biostats2/master/full_data.csv') make_dTransform <- function(dFull) { # strip thresh values for data frame and log transform t1<-log10(dFull$thr1) t2<-log10(dFull$thr2) t3<-log10(dFull$thr3) t4<-log10(dFull$thr4) t5<-log10(dFull$thr5) t6<-log10(dFull$thr6) # factor will change a numeric variable to a factor which is useful for creating categorical variables dFull$subject <- factor(dFull$subject) # assign RE variable RE <- dFull$RE subject <- dFull$subject # make a data.frame dTransform <- data.frame(subject,RE,t1,t2,t3,t4,t5,t6) colnames(dTransform) <- c('subject','RE','A','L','M','Sneg','Spos','S') return(dTransform) } dTransform <- make_dTransform(dFull) library(BayesFactor) regressionBF(RE ~ A + L +M + Sneg + Spos + S, data = dTransform) output = regressionBF(RE ~ A + L + M + Sneg + Spos + S, data = dTransform) #Bayes Factor value more than 1 indicates that this factor has a higher probability than the null hypothesis in playing a factor for RE. output/output[63] #2. [3 Points] A colleague is going to run an experiment where they are going to compute a correlation test. Beforehand, they ask you how many subjects they need to run. Based on previous work, they believe the r for their experiment could be between .2 and .6, their funders want a *Type II error* probability of no more than 0.4, and they will use a conventional alpha of .05. Calculate what the minimum and the maximum number of subjects they need to run for their experiment to be adequately powered, given their funder's constraints. install.packages('pwr') library(pwr) pwr.r.test(r = 0.2, sig.level = 0.05, power = 1-0.4) pwr.r.test(r = 0.6, sig.level = 0.05, power = 1-0.4) # 3. [3 Points] # This function will help you create some simulated psychometric data... datasim <- function(contrasts, pcorrect, ntrials) { for (tmp in 1:length(contrasts)) { contrast <- rep(contrasts[tmp], ntrials) correct <- rbinom(ntrials, 1, pcorrect[tmp]) if (tmp == 1) { data <- data.frame(contrast, correct) } else { data <- rbind(data, data.frame(contrast, correct)) } } return(data) } # Create some data with contrast levels for the variable "contrasts" 0.01 to 0.1 in 10 steps. Create a vector that goes from 0 to 1 for "pcorrect". Set ntrials equal to 20. Fit and plot the resulting psychometric function. What is 50% threshold level for this resulting function? contrasts <-c(0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1) pcorrect <- c(0, 1) library(tidyverse) library(psyphy) #Create a vector that goes from 0 to 1 for "pcorrect" contrast <- seq(0.01, 0.1, length.out = 10) pcorrect <- seq(0.0, 1.0,length.out = 10) # Create data dat.contast <- datasim(contrast, pcorrect, ntrials=20) dc_summary <- dat.contast %>% group_by(contrast,correct) %>% tally() %>% ungroup() %>% complete(contrast, correct, fill = list(n = 1)) dc_summary <- subset(dc_summary, correct == 1) dc_summary$incorrect <- 20 - dc_summary$n dc_summary$correct <- dc_summary$n # Take the absolute value of negative contrast values dc_summary$contrast <- abs(dc_summary$contrast) # Fit the psychometric function psymet_fit <- glm(formula = cbind(correct, incorrect) ~ log(contrast), family = binomial, data = dc_summary) xseq <- seq(0.01, 0.1, len = 100) psymet_fit.pred <- predict(psymet_fit, newdata = data.frame(contrast = xseq), type = "response", se.fit = TRUE) psymet_pred_df <- data.frame(xseq, psymet_fit.pred$fit) colnames(psymet_pred_df) <- c('contrast','fit') psymet_plot <- ggplot(data = dc_summary, aes(x = contrast, y = correct / 20)) + geom_point(size = 2) + geom_line(data = psymet_pred_df, aes(x = contrast, y = fit), size = 1) + ylab('proportion correct') + theme(text = element_text(size=14), axis.text.x = element_text(size = 14), axis.text.y = element_text(size=14)) psymet_plot # The 50% threshold is around 0.050 based on the graph
#------------------------------------------------------------------------------- # IBPNEW 2012 # Code to generate the .dat file for input into the ADMB model # Uses Lowestoft format input files # David Miller, some code adapted from FLR-project # Date: 3 Oct 2012 #------------------------------------------------------------------------------- rm(list=ls()) # FLR # install.packages(repos="http://flr-project.org/R") library(FLCore);library(mgcv) library(FLAssess); library(stockassessment) library(FLEDA); library(splines); library(scales); library(gplots);library(grid); library(gridExtra); library(latticeExtra) library(sas7bdat) library(TMB); library(FLSAM) # Set paths to folders Path <- "D:/Repository/Turbot/assessment runs/" dataPath <- paste(Path,"Lowestoft files/",sep="") outPath <- paste(Path,"trial_runs_2017/Output/",sep="") codePath <- paste(Path,"Trial_runs_2017/",sep="") ## Source methods/functions source(paste(codePath,"03a_setupStockIndices.r",sep="")) run <- "lowWeightAge1" sens <- "" ### ------------------------------------------------------------------------------------------------------ ### 2. Read and process assessment input data ### ------------------------------------------------------------------------------------------------------ indices <- FLIndices(list(window(trim(indices[[1]],age=1:6),start=2004),window(indices[[2]],start=1991),indices[[3]])) ### ------------------------------------------------------------------------------------------------------ ### 3. Setup data structure for SAM assessment ### ------------------------------------------------------------------------------------------------------ TUR <- stock TUR.tun <- indices TUR.ctrl <- FLSAM.control(TUR,TUR.tun) TUR.ctrl@states["catch",] <- c(0:6,rep(7,3)) TUR.ctrl@cor.F <- 2 TUR.ctrl@catchabilities["SNS",ac(1:6)] <- c(0:2,rep(3,3)) + 101 TUR.ctrl@catchabilities["BTS-ISIS",ac(1:7)] <- c(0,0,1,1,rep(2,3)) + 201 TUR.ctrl@catchabilities["NL_LPUE",ac(1)] <- 0 + 301 TUR.ctrl@f.vars["catch",] <- c(0,1,2,2,3,3,3,4,4,4) TUR.ctrl@logN.vars[] <- c(0,rep(1,9)) TUR.ctrl@obs.vars["catch",] <- c(0,1,2,2,3,3,4,4,4,4) + 101 TUR.ctrl@obs.vars["SNS",ac(1:6)] <- c(0,0,1,2,3,3) + 201 TUR.ctrl@obs.vars["BTS-ISIS",ac(1:7)] <- c(0,0,0,1,2,3,3) + 301 TUR.ctrl@obs.vars["NL_LPUE",ac(1)] <- 0 + 401 TUR.ctrl@cor.obs[] <- NA TUR.ctrl@cor.obs["SNS",1:5] <- c(0,rep(1,4)) TUR.ctrl@cor.obs.Flag[2] <- af("AR") TUR.ctrl@biomassTreat[4] <- 2 TUR.ctrl <- update(TUR.ctrl) TUR.ctrl@obs.weight[] <- 1; TUR.ctrl@obs.weight[1,1] <- 1/10 ### ------------------------------------------------------------------------------------------------------ ### 4. Run assessment ### ------------------------------------------------------------------------------------------------------ TUR.sam <- FLSAM(TUR,TUR.tun,TUR.ctrl) TUR.ctrl@residuals <- FALSE; TUR.sam@control@residuals <- FALSE TUR.retro <- retro(TUR,TUR.tun,TUR.ctrl,retro=7,base.assess=TUR.sam) ### ------------------------------------------------------------------------------------------------------ ### 5. Diagnostics ### ------------------------------------------------------------------------------------------------------ source(file.path(codePath,"03b_runDiagnostics.r"))
/assessment runs/Trial_runs_2017/03s_lowWeightAge1Run.r
no_license
ices-eg/wg_IBPTur.27.4
R
false
false
3,679
r
#------------------------------------------------------------------------------- # IBPNEW 2012 # Code to generate the .dat file for input into the ADMB model # Uses Lowestoft format input files # David Miller, some code adapted from FLR-project # Date: 3 Oct 2012 #------------------------------------------------------------------------------- rm(list=ls()) # FLR # install.packages(repos="http://flr-project.org/R") library(FLCore);library(mgcv) library(FLAssess); library(stockassessment) library(FLEDA); library(splines); library(scales); library(gplots);library(grid); library(gridExtra); library(latticeExtra) library(sas7bdat) library(TMB); library(FLSAM) # Set paths to folders Path <- "D:/Repository/Turbot/assessment runs/" dataPath <- paste(Path,"Lowestoft files/",sep="") outPath <- paste(Path,"trial_runs_2017/Output/",sep="") codePath <- paste(Path,"Trial_runs_2017/",sep="") ## Source methods/functions source(paste(codePath,"03a_setupStockIndices.r",sep="")) run <- "lowWeightAge1" sens <- "" ### ------------------------------------------------------------------------------------------------------ ### 2. Read and process assessment input data ### ------------------------------------------------------------------------------------------------------ indices <- FLIndices(list(window(trim(indices[[1]],age=1:6),start=2004),window(indices[[2]],start=1991),indices[[3]])) ### ------------------------------------------------------------------------------------------------------ ### 3. Setup data structure for SAM assessment ### ------------------------------------------------------------------------------------------------------ TUR <- stock TUR.tun <- indices TUR.ctrl <- FLSAM.control(TUR,TUR.tun) TUR.ctrl@states["catch",] <- c(0:6,rep(7,3)) TUR.ctrl@cor.F <- 2 TUR.ctrl@catchabilities["SNS",ac(1:6)] <- c(0:2,rep(3,3)) + 101 TUR.ctrl@catchabilities["BTS-ISIS",ac(1:7)] <- c(0,0,1,1,rep(2,3)) + 201 TUR.ctrl@catchabilities["NL_LPUE",ac(1)] <- 0 + 301 TUR.ctrl@f.vars["catch",] <- c(0,1,2,2,3,3,3,4,4,4) TUR.ctrl@logN.vars[] <- c(0,rep(1,9)) TUR.ctrl@obs.vars["catch",] <- c(0,1,2,2,3,3,4,4,4,4) + 101 TUR.ctrl@obs.vars["SNS",ac(1:6)] <- c(0,0,1,2,3,3) + 201 TUR.ctrl@obs.vars["BTS-ISIS",ac(1:7)] <- c(0,0,0,1,2,3,3) + 301 TUR.ctrl@obs.vars["NL_LPUE",ac(1)] <- 0 + 401 TUR.ctrl@cor.obs[] <- NA TUR.ctrl@cor.obs["SNS",1:5] <- c(0,rep(1,4)) TUR.ctrl@cor.obs.Flag[2] <- af("AR") TUR.ctrl@biomassTreat[4] <- 2 TUR.ctrl <- update(TUR.ctrl) TUR.ctrl@obs.weight[] <- 1; TUR.ctrl@obs.weight[1,1] <- 1/10 ### ------------------------------------------------------------------------------------------------------ ### 4. Run assessment ### ------------------------------------------------------------------------------------------------------ TUR.sam <- FLSAM(TUR,TUR.tun,TUR.ctrl) TUR.ctrl@residuals <- FALSE; TUR.sam@control@residuals <- FALSE TUR.retro <- retro(TUR,TUR.tun,TUR.ctrl,retro=7,base.assess=TUR.sam) ### ------------------------------------------------------------------------------------------------------ ### 5. Diagnostics ### ------------------------------------------------------------------------------------------------------ source(file.path(codePath,"03b_runDiagnostics.r"))
## ----options, echo=FALSE, warning=FALSE, message=FALSE------------------- options(width=120) opts_chunk$set(comment=NA, fig.width=6, fig.height=5, size='tiny', out.width='0.6\\textwidth', fig.align='center', message=FALSE) ## ----libraries, message=FALSE, warning=FALSE, echo=FALSE----------------- library("dplyr") library("ggplot2") library("gridExtra") # library("xtable") # library("Sleuth3") ## ----set_seed, echo=FALSE------------------------------------------------ set.seed(2) ## ----echo=FALSE---------------------------------------------------------- tomato = structure(list(Variety = structure(c(1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L), .Label = c("A", "B", "C"), class = "factor"), Density = c(10L, 10L, 10L, 20L, 20L, 20L, 30L, 30L, 30L, 40L, 40L, 40L, 10L, 10L, 10L, 20L, 20L, 20L, 30L, 30L, 30L, 40L, 40L, 40L, 10L, 10L, 10L, 20L, 20L, 20L, 30L, 30L, 30L, 40L, 40L, 40L), Yield = c(7.9, 9.2, 10.5, 11.2, 12.8, 13.3, 12.1, 12.6, 14, 9.1, 10.8, 12.5, 8.1, 8.6, 10.1, 11.5, 12.7, 13.7, 13.7, 14.4, 15.4, 11.3, 12.5, 14.5, 15.3, 16.1, 17.5, 16.6, 18.5, 19.2, 18, 20.8, 21, 17.2, 18.4, 18.9)), .Names = c("Variety", "Density", "Yield"), class = "data.frame", row.names = c(NA, -36L)) tomato$Variety = relevel(tomato$Variety, ref="C") ggplot(tomato, aes(x=Density, y=Yield, color=Variety)) + geom_jitter(height=0, width=0.1) + theme_bw() ## ------------------------------------------------------------------------ sm = tomato %>% group_by(Variety, Density) %>% summarize(n = n(), mean = mean(Yield), sd = sd(Yield)) sm ## ------------------------------------------------------------------------ ggplot(sm, aes(x=Density, y=mean, col=Variety)) + geom_line() + labs(y="Mean Yield") + theme_bw() ## ----echo=TRUE----------------------------------------------------------- tomato$Density = factor(tomato$Density) m = lm(Yield~Variety*Density, tomato) anova(m) ## ----echo=TRUE----------------------------------------------------------- library(emmeans) emmeans(m, pairwise~Variety) ## ----echo=TRUE----------------------------------------------------------- emmeans(m, pairwise~Density) ## ----echo=TRUE----------------------------------------------------------- emmeans(m, pairwise~Variety*Density) ## ------------------------------------------------------------------------ tomato_unbalanced = tomato[-19,] ggplot(tomato_unbalanced, aes(x=Density, y=Yield, color=Variety)) + geom_jitter(height=0, width=0.1) + theme_bw() ## ------------------------------------------------------------------------ sm_unbalanced = tomato_unbalanced %>% group_by(Variety, Density) %>% summarize(n = n(), mean = mean(Yield), sd = sd(Yield)) sm_unbalanced ## ----echo=TRUE----------------------------------------------------------- m = lm(Yield~Variety*Density, tomato_unbalanced) anova(m) ## ----echo=TRUE----------------------------------------------------------- emmeans(m, pairwise~Variety) ## ----echo=TRUE----------------------------------------------------------- emmeans(m, pairwise~Density) ## ----echo=TRUE----------------------------------------------------------- emmeans(m, pairwise~Variety*Density) ## ------------------------------------------------------------------------ tomato_incomplete = tomato %>% filter(!(Variety == "B" & Density == 30)) %>% mutate(VarietyDensity = paste0(Variety,Density)) ggplot(tomato_incomplete, aes(x=Density, y=Yield, color=Variety)) + geom_jitter(height=0, width=0.1) + theme_bw() ## ------------------------------------------------------------------------ sm_incomplete = tomato_incomplete %>% group_by(Variety, Density) %>% summarize(n = n(), mean = mean(Yield), sd = sd(Yield)) sm_incomplete ## ----echo=TRUE----------------------------------------------------------- m <- lm(Yield ~ Variety*Density, data=tomato_incomplete) anova(m) ## ----echo=TRUE----------------------------------------------------------- m = lm(Yield~Variety:Density, tomato_incomplete) anova(m) ## ----echo=TRUE----------------------------------------------------------- # Note the -1 in order to construct the contrast m = lm(Yield ~ VarietyDensity, tomato_incomplete) em <- emmeans(m, ~ VarietyDensity) contrast(em, method = list( # A10 A20 A30 A40 B10 B20 B40 C10 C20 C30 C40 "C-B" = c( 0, 0, 0, 0, -1, -1, -1, 1, 1, 0, 1)/3, "C-A" = c( -1, -1, -1, -1, 0, 0, 0, 1, 1, 1, 1)/4, "B-A" = c( -1, -1, 0, -1, 1, 1, 1, 0, 0, 0, 0)/3)) %>% confint ## ----echo=TRUE----------------------------------------------------------- m = lm(Yield~Variety:Density, tomato_incomplete) emmeans(m, pairwise~Variety:Density) # We could have used the VarietyDensity model, but this looks nicer ## ----echo=FALSE---------------------------------------------------------- ggplot(tomato, aes(x=Density, y=Yield, color=Variety)) + geom_jitter(height=0, width=0.1) + theme_bw() ## ----fig.width=10,out.width='0.9\\textwidth',echo=FALSE------------------ tomato = structure(list(Variety = structure(c(1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L), .Label = c("A", "B", "C"), class = "factor"), Density = c(10L, 10L, 10L, 20L, 20L, 20L, 30L, 30L, 30L, 40L, 40L, 40L, 10L, 10L, 10L, 20L, 20L, 20L, 30L, 30L, 30L, 40L, 40L, 40L, 10L, 10L, 10L, 20L, 20L, 20L, 30L, 30L, 30L, 40L, 40L, 40L), Yield = c(7.9, 9.2, 10.5, 11.2, 12.8, 13.3, 12.1, 12.6, 14, 9.1, 10.8, 12.5, 8.1, 8.6, 10.1, 11.5, 12.7, 13.7, 13.7, 14.4, 15.4, 11.3, 12.5, 14.5, 15.3, 16.1, 17.5, 16.6, 18.5, 19.2, 18, 20.8, 21, 17.2, 18.4, 18.9)), .Names = c("Variety", "Density", "Yield"), class = "data.frame", row.names = c(NA, -36L)) tomato$Variety = relevel(tomato$Variety, ref="C") g1 = ggplot(tomato, aes(x=Density, y=Yield)) + geom_jitter(height=0, width=0.1) + stat_smooth(method="lm", formula=y~x+I(x^2), se=FALSE, color="black") + labs(title="No variety") + theme_bw() # Need to construct the parallel curves lines = with(tomato,expand.grid(Density=seq(min(Density),max(Density),length=41), Variety=levels(Variety))) lines$Yield <- predict(lm(Yield~Density+I(Density^2)+Variety, tomato),lines) g2 = ggplot(tomato, aes(x=Density, y=Yield, color=Variety)) + geom_jitter(height=0, width=0.1) + geom_line(data=lines) + labs(title="Parallel curves") + theme_bw() g3 = ggplot(tomato, aes(x=Density, y=Yield, color=Variety)) + geom_jitter(height=0, width=0.1) + stat_smooth(method="lm", formula=y~x+I(x^2), se=FALSE) + labs(title="Independent curves") + theme_bw() grid.arrange(g1,g2,g3, ncol=3) ## ------------------------------------------------------------------------ summary(lm(Yield~Density+I(Density^2), tomato)) ## ------------------------------------------------------------------------ summary(lm(Yield~Density+I(Density^2) + Variety, tomato)) ## ------------------------------------------------------------------------ summary(lm(Yield~Density*Variety+I(Density^2)*Variety, tomato)) ## ----out.width='0.6\\textwidth', echo=FALSE------------------------------ set.seed(20121204) opar = par(mar=rep(0,4)) plot(0,0, type="n", axes=F, xlab='', ylab='', xlim=c(0.5,6.5), ylim=c(0.5,6.5)) segments(1:7-.5, .5, 1:7-.5, 6.5) segments(.5, 1:7-.5, 6.5, 1:7-.5) trts = rep(paste(rep(c("A","B","C"),each=4), rep(seq(10,40,by=10), 3), sep=""),3) text(rep(1:6, each=6), rep(1:6, 6), sample(trts)) par(opar) ## ----out.width='0.6\\textwidth', echo=FALSE------------------------------ set.seed(20121204) opar = par(mar=rep(0,4)) plot(0,0, type="n", axes=F, xlab='', ylab='', xlim=c(0,8.5), ylim=c(0,7.5)) segments(1:9-.5, .5, 1:9-.5, 6.5) for (i in c(.5, 3.5, 6.5)) segments(i, 1:7-.5, i+2, 1:7-.5) trts = paste(rep(c("A","B","C"),each=4), rep(seq(10,40,by=10), 3), sep="") for (i in c(1, 4, 7)) text(rep(c(i,i+1), each=2), rep(1:6, 2), sample(trts)) text(c(1.5,4.5,7.5), 0, paste("Block", 1:3)) par(opar) ## ----out.width='0.4\\textwidth', fig.width=4, fig.height=3, echo=FALSE---- set.seed(20121204) opar = par(mar=rep(0,4)) plot(0,0, type="n", axes=F, xlab='', ylab='', xlim=c(0,5.5), ylim=c(0,4)) segments(1:6-.5, .5, 1:6-.5, 3.5) for (i in c(.5, 3.5)) segments(i, 1:4-.5, i+2, 1:4-.5) trts = rep(c("A","B","C"),each=2) for (i in c(1, 4)) text(rep(c(i,i+1), each=3), rep(1:3, 2), sample(trts)) text(c(1,2,4,5), .3, paste("Block", 1:2)) text(c(1.5,4.5), 3.7, c("Blocked","Unblocked")) par(opar)
/courses/stat587Eng/slides/Regression/R09-Two-way_ANOVA/R09-Two-way_ANOVA.R
no_license
ChenghaoDing/jarad.github.com
R
false
false
8,606
r
## ----options, echo=FALSE, warning=FALSE, message=FALSE------------------- options(width=120) opts_chunk$set(comment=NA, fig.width=6, fig.height=5, size='tiny', out.width='0.6\\textwidth', fig.align='center', message=FALSE) ## ----libraries, message=FALSE, warning=FALSE, echo=FALSE----------------- library("dplyr") library("ggplot2") library("gridExtra") # library("xtable") # library("Sleuth3") ## ----set_seed, echo=FALSE------------------------------------------------ set.seed(2) ## ----echo=FALSE---------------------------------------------------------- tomato = structure(list(Variety = structure(c(1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L), .Label = c("A", "B", "C"), class = "factor"), Density = c(10L, 10L, 10L, 20L, 20L, 20L, 30L, 30L, 30L, 40L, 40L, 40L, 10L, 10L, 10L, 20L, 20L, 20L, 30L, 30L, 30L, 40L, 40L, 40L, 10L, 10L, 10L, 20L, 20L, 20L, 30L, 30L, 30L, 40L, 40L, 40L), Yield = c(7.9, 9.2, 10.5, 11.2, 12.8, 13.3, 12.1, 12.6, 14, 9.1, 10.8, 12.5, 8.1, 8.6, 10.1, 11.5, 12.7, 13.7, 13.7, 14.4, 15.4, 11.3, 12.5, 14.5, 15.3, 16.1, 17.5, 16.6, 18.5, 19.2, 18, 20.8, 21, 17.2, 18.4, 18.9)), .Names = c("Variety", "Density", "Yield"), class = "data.frame", row.names = c(NA, -36L)) tomato$Variety = relevel(tomato$Variety, ref="C") ggplot(tomato, aes(x=Density, y=Yield, color=Variety)) + geom_jitter(height=0, width=0.1) + theme_bw() ## ------------------------------------------------------------------------ sm = tomato %>% group_by(Variety, Density) %>% summarize(n = n(), mean = mean(Yield), sd = sd(Yield)) sm ## ------------------------------------------------------------------------ ggplot(sm, aes(x=Density, y=mean, col=Variety)) + geom_line() + labs(y="Mean Yield") + theme_bw() ## ----echo=TRUE----------------------------------------------------------- tomato$Density = factor(tomato$Density) m = lm(Yield~Variety*Density, tomato) anova(m) ## ----echo=TRUE----------------------------------------------------------- library(emmeans) emmeans(m, pairwise~Variety) ## ----echo=TRUE----------------------------------------------------------- emmeans(m, pairwise~Density) ## ----echo=TRUE----------------------------------------------------------- emmeans(m, pairwise~Variety*Density) ## ------------------------------------------------------------------------ tomato_unbalanced = tomato[-19,] ggplot(tomato_unbalanced, aes(x=Density, y=Yield, color=Variety)) + geom_jitter(height=0, width=0.1) + theme_bw() ## ------------------------------------------------------------------------ sm_unbalanced = tomato_unbalanced %>% group_by(Variety, Density) %>% summarize(n = n(), mean = mean(Yield), sd = sd(Yield)) sm_unbalanced ## ----echo=TRUE----------------------------------------------------------- m = lm(Yield~Variety*Density, tomato_unbalanced) anova(m) ## ----echo=TRUE----------------------------------------------------------- emmeans(m, pairwise~Variety) ## ----echo=TRUE----------------------------------------------------------- emmeans(m, pairwise~Density) ## ----echo=TRUE----------------------------------------------------------- emmeans(m, pairwise~Variety*Density) ## ------------------------------------------------------------------------ tomato_incomplete = tomato %>% filter(!(Variety == "B" & Density == 30)) %>% mutate(VarietyDensity = paste0(Variety,Density)) ggplot(tomato_incomplete, aes(x=Density, y=Yield, color=Variety)) + geom_jitter(height=0, width=0.1) + theme_bw() ## ------------------------------------------------------------------------ sm_incomplete = tomato_incomplete %>% group_by(Variety, Density) %>% summarize(n = n(), mean = mean(Yield), sd = sd(Yield)) sm_incomplete ## ----echo=TRUE----------------------------------------------------------- m <- lm(Yield ~ Variety*Density, data=tomato_incomplete) anova(m) ## ----echo=TRUE----------------------------------------------------------- m = lm(Yield~Variety:Density, tomato_incomplete) anova(m) ## ----echo=TRUE----------------------------------------------------------- # Note the -1 in order to construct the contrast m = lm(Yield ~ VarietyDensity, tomato_incomplete) em <- emmeans(m, ~ VarietyDensity) contrast(em, method = list( # A10 A20 A30 A40 B10 B20 B40 C10 C20 C30 C40 "C-B" = c( 0, 0, 0, 0, -1, -1, -1, 1, 1, 0, 1)/3, "C-A" = c( -1, -1, -1, -1, 0, 0, 0, 1, 1, 1, 1)/4, "B-A" = c( -1, -1, 0, -1, 1, 1, 1, 0, 0, 0, 0)/3)) %>% confint ## ----echo=TRUE----------------------------------------------------------- m = lm(Yield~Variety:Density, tomato_incomplete) emmeans(m, pairwise~Variety:Density) # We could have used the VarietyDensity model, but this looks nicer ## ----echo=FALSE---------------------------------------------------------- ggplot(tomato, aes(x=Density, y=Yield, color=Variety)) + geom_jitter(height=0, width=0.1) + theme_bw() ## ----fig.width=10,out.width='0.9\\textwidth',echo=FALSE------------------ tomato = structure(list(Variety = structure(c(1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L, 3L), .Label = c("A", "B", "C"), class = "factor"), Density = c(10L, 10L, 10L, 20L, 20L, 20L, 30L, 30L, 30L, 40L, 40L, 40L, 10L, 10L, 10L, 20L, 20L, 20L, 30L, 30L, 30L, 40L, 40L, 40L, 10L, 10L, 10L, 20L, 20L, 20L, 30L, 30L, 30L, 40L, 40L, 40L), Yield = c(7.9, 9.2, 10.5, 11.2, 12.8, 13.3, 12.1, 12.6, 14, 9.1, 10.8, 12.5, 8.1, 8.6, 10.1, 11.5, 12.7, 13.7, 13.7, 14.4, 15.4, 11.3, 12.5, 14.5, 15.3, 16.1, 17.5, 16.6, 18.5, 19.2, 18, 20.8, 21, 17.2, 18.4, 18.9)), .Names = c("Variety", "Density", "Yield"), class = "data.frame", row.names = c(NA, -36L)) tomato$Variety = relevel(tomato$Variety, ref="C") g1 = ggplot(tomato, aes(x=Density, y=Yield)) + geom_jitter(height=0, width=0.1) + stat_smooth(method="lm", formula=y~x+I(x^2), se=FALSE, color="black") + labs(title="No variety") + theme_bw() # Need to construct the parallel curves lines = with(tomato,expand.grid(Density=seq(min(Density),max(Density),length=41), Variety=levels(Variety))) lines$Yield <- predict(lm(Yield~Density+I(Density^2)+Variety, tomato),lines) g2 = ggplot(tomato, aes(x=Density, y=Yield, color=Variety)) + geom_jitter(height=0, width=0.1) + geom_line(data=lines) + labs(title="Parallel curves") + theme_bw() g3 = ggplot(tomato, aes(x=Density, y=Yield, color=Variety)) + geom_jitter(height=0, width=0.1) + stat_smooth(method="lm", formula=y~x+I(x^2), se=FALSE) + labs(title="Independent curves") + theme_bw() grid.arrange(g1,g2,g3, ncol=3) ## ------------------------------------------------------------------------ summary(lm(Yield~Density+I(Density^2), tomato)) ## ------------------------------------------------------------------------ summary(lm(Yield~Density+I(Density^2) + Variety, tomato)) ## ------------------------------------------------------------------------ summary(lm(Yield~Density*Variety+I(Density^2)*Variety, tomato)) ## ----out.width='0.6\\textwidth', echo=FALSE------------------------------ set.seed(20121204) opar = par(mar=rep(0,4)) plot(0,0, type="n", axes=F, xlab='', ylab='', xlim=c(0.5,6.5), ylim=c(0.5,6.5)) segments(1:7-.5, .5, 1:7-.5, 6.5) segments(.5, 1:7-.5, 6.5, 1:7-.5) trts = rep(paste(rep(c("A","B","C"),each=4), rep(seq(10,40,by=10), 3), sep=""),3) text(rep(1:6, each=6), rep(1:6, 6), sample(trts)) par(opar) ## ----out.width='0.6\\textwidth', echo=FALSE------------------------------ set.seed(20121204) opar = par(mar=rep(0,4)) plot(0,0, type="n", axes=F, xlab='', ylab='', xlim=c(0,8.5), ylim=c(0,7.5)) segments(1:9-.5, .5, 1:9-.5, 6.5) for (i in c(.5, 3.5, 6.5)) segments(i, 1:7-.5, i+2, 1:7-.5) trts = paste(rep(c("A","B","C"),each=4), rep(seq(10,40,by=10), 3), sep="") for (i in c(1, 4, 7)) text(rep(c(i,i+1), each=2), rep(1:6, 2), sample(trts)) text(c(1.5,4.5,7.5), 0, paste("Block", 1:3)) par(opar) ## ----out.width='0.4\\textwidth', fig.width=4, fig.height=3, echo=FALSE---- set.seed(20121204) opar = par(mar=rep(0,4)) plot(0,0, type="n", axes=F, xlab='', ylab='', xlim=c(0,5.5), ylim=c(0,4)) segments(1:6-.5, .5, 1:6-.5, 3.5) for (i in c(.5, 3.5)) segments(i, 1:4-.5, i+2, 1:4-.5) trts = rep(c("A","B","C"),each=2) for (i in c(1, 4)) text(rep(c(i,i+1), each=3), rep(1:3, 2), sample(trts)) text(c(1,2,4,5), .3, paste("Block", 1:2)) text(c(1.5,4.5), 3.7, c("Blocked","Unblocked")) par(opar)
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/H4PackagesOfoegbuKingsley-package.R \docType{package} \name{H4PackagesOfoegbuKingsley-package} \alias{H4PackagesOfoegbuKingsley} \alias{H4PackagesOfoegbuKingsley-package} \title{H4PackagesOfoegbuKingsley: Creating a Package} \description{ What the package does (one paragraph). } \author{ \strong{Maintainer}: Kingsley Ofoegbu \email{kd6889a@student.american.edu} (\href{https://orcid.org/YOUR-ORCID-ID}{ORCID}) } \keyword{internal}
/man/H4PackagesOfoegbuKingsley-package.Rd
permissive
Khayy/NewPackageHomework
R
false
true
512
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/H4PackagesOfoegbuKingsley-package.R \docType{package} \name{H4PackagesOfoegbuKingsley-package} \alias{H4PackagesOfoegbuKingsley} \alias{H4PackagesOfoegbuKingsley-package} \title{H4PackagesOfoegbuKingsley: Creating a Package} \description{ What the package does (one paragraph). } \author{ \strong{Maintainer}: Kingsley Ofoegbu \email{kd6889a@student.american.edu} (\href{https://orcid.org/YOUR-ORCID-ID}{ORCID}) } \keyword{internal}
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/waffle.R \name{waffle} \alias{waffle} \title{Composition Waffle Chart.} \usage{ waffle(data, title = NULL, subtitle = NULL, caption = NULL) } \arguments{ \item{data}{input data.frame} \item{title}{input data.frame} \item{subtitle}{date variable} \item{caption}{date variable} } \value{ An object of class \code{ggplot} } \description{ waffle function will draw Waffle Chart for Composition analysis. } \examples{ plot<- waffle(data=mpg$class,title = "Title",caption="caption") plot }
/man/waffle.Rd
permissive
HeeseokMoon/ggedachart
R
false
true
566
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/waffle.R \name{waffle} \alias{waffle} \title{Composition Waffle Chart.} \usage{ waffle(data, title = NULL, subtitle = NULL, caption = NULL) } \arguments{ \item{data}{input data.frame} \item{title}{input data.frame} \item{subtitle}{date variable} \item{caption}{date variable} } \value{ An object of class \code{ggplot} } \description{ waffle function will draw Waffle Chart for Composition analysis. } \examples{ plot<- waffle(data=mpg$class,title = "Title",caption="caption") plot }
#' aggregate the assays with the specific group of sample and fun. #' @rdname mp_aggregate-methods #' @param .data MPSE object, required #' @param .abundance the column names of abundance, default is Abundance. #' @param .group the column names of sample meta-data, required #' @param fun a function to compute the summary statistics, default is sum. #' @param keep_colData logical whether to keep the sample meta-data with \code{.group} as row names, #' default is TRUE. #' @param ... additional parameters, see also \code{\link[stats]{aggregate}}. #' @return a new object with .group as column names in assays #' @export #' @examples #' \dontrun{ #' data(mouse.time.mpse) #' newmpse <- mouse.time.mpse %>% #' mp_aggregate(.group = time) #' newmpse #' } setGeneric("mp_aggregate", function(.data, .abundance, .group, fun=sum, keep_colData=TRUE, ...)standardGeneric("mp_aggregate")) .internal_mp_aggregate <- function(.data, .abundance, .group, fun=sum, keep_colData=TRUE, ...){ .abundance <- rlang::enquo(.abundance) .group <- rlang::enquo(.group) if (rlang::quo_is_missing(.abundance)){ .abundance <- as.symbol("Abundance") } assayda <- .data %>% mp_extract_assays(.abundance=!!.abundance, byRow=FALSE) %>% tibble::as_tibble(rownames="Sample") sampleda <- .data %>% mp_extract_sample() sampleda1 <- sampleda %>% select(!!rlang::sym("Sample"), !!.group) assayda %<>% left_join(sampleda1, by="Sample") %>% dplyr::select(-!!rlang::sym("Sample")) colData(.data) <- NULL fma <- as.formula(paste0(". ~", rlang::as_name(.group))) assayda <- stats::aggregate(fma, data=assayda, FUN=fun, ...) assayda %<>% tibble::column_to_rownames(var=rlang::as_name(.group)) %>% t() newda <- MPSE(assays=list(Abundance=assayda)) taxatree(newda) <- taxatree(.data) otutree(newda) <- otutree(.data) refsequence(newda) <- refsequence(.data) SummarizedExperiment::rowData(newda) <- SummarizedExperiment::rowData(.data) if (keep_colData){ sampleda %<>% dplyr::rename(.Old.Sample=!!rlang::sym("Sample"), Sample=!!.group) %>% .internal_nest_tibble(columns="Sample") if (ncol(sampleda)>1){ colData(newda) <- sampleda %>% tibble::column_to_rownames(var="Sample") %>% S4Vectors::DataFrame(check.names=FALSE) } } return (newda) } #' @rdname mp_aggregate-methods #' @aliases mp_aggregate,MPSE #' @exportMethod mp_aggregate setMethod("mp_aggregate", signature(.data="MPSE"), .internal_mp_aggregate) .internal_nest_tibble <- function(x, columns){ nm <- colnames(x) nm %<>% stats::setNames(nm) nm <- nm[!nm %in% columns] nm %<>% lapply(., function(x)x) x <- do.call(tidyr::nest, c(list(x), nm)) x <- check_single_nrow_in_nest(x, columns) return(x) } check_single_nrow_in_nest <- function(da, columns){ indnm <- da %>% apply(., 2, function(x)all(lapply(x, function(i)nrow(unique(i))==1) %>% unlist())) indnm <- indnm[indnm] %>% names() indnm <- indnm[!indnm %in% columns] if (length(indnm)>0){ for( i in indnm){ da %<>% dplyr::mutate(!!rlang::sym(i):=as.vector(unlist(lapply(!!rlang::sym(i), function(x)unique(x))))) } } return(da) }
/R/method-mp_aggregate.R
no_license
YuLab-SMU/MicrobiotaProcess
R
false
false
3,398
r
#' aggregate the assays with the specific group of sample and fun. #' @rdname mp_aggregate-methods #' @param .data MPSE object, required #' @param .abundance the column names of abundance, default is Abundance. #' @param .group the column names of sample meta-data, required #' @param fun a function to compute the summary statistics, default is sum. #' @param keep_colData logical whether to keep the sample meta-data with \code{.group} as row names, #' default is TRUE. #' @param ... additional parameters, see also \code{\link[stats]{aggregate}}. #' @return a new object with .group as column names in assays #' @export #' @examples #' \dontrun{ #' data(mouse.time.mpse) #' newmpse <- mouse.time.mpse %>% #' mp_aggregate(.group = time) #' newmpse #' } setGeneric("mp_aggregate", function(.data, .abundance, .group, fun=sum, keep_colData=TRUE, ...)standardGeneric("mp_aggregate")) .internal_mp_aggregate <- function(.data, .abundance, .group, fun=sum, keep_colData=TRUE, ...){ .abundance <- rlang::enquo(.abundance) .group <- rlang::enquo(.group) if (rlang::quo_is_missing(.abundance)){ .abundance <- as.symbol("Abundance") } assayda <- .data %>% mp_extract_assays(.abundance=!!.abundance, byRow=FALSE) %>% tibble::as_tibble(rownames="Sample") sampleda <- .data %>% mp_extract_sample() sampleda1 <- sampleda %>% select(!!rlang::sym("Sample"), !!.group) assayda %<>% left_join(sampleda1, by="Sample") %>% dplyr::select(-!!rlang::sym("Sample")) colData(.data) <- NULL fma <- as.formula(paste0(". ~", rlang::as_name(.group))) assayda <- stats::aggregate(fma, data=assayda, FUN=fun, ...) assayda %<>% tibble::column_to_rownames(var=rlang::as_name(.group)) %>% t() newda <- MPSE(assays=list(Abundance=assayda)) taxatree(newda) <- taxatree(.data) otutree(newda) <- otutree(.data) refsequence(newda) <- refsequence(.data) SummarizedExperiment::rowData(newda) <- SummarizedExperiment::rowData(.data) if (keep_colData){ sampleda %<>% dplyr::rename(.Old.Sample=!!rlang::sym("Sample"), Sample=!!.group) %>% .internal_nest_tibble(columns="Sample") if (ncol(sampleda)>1){ colData(newda) <- sampleda %>% tibble::column_to_rownames(var="Sample") %>% S4Vectors::DataFrame(check.names=FALSE) } } return (newda) } #' @rdname mp_aggregate-methods #' @aliases mp_aggregate,MPSE #' @exportMethod mp_aggregate setMethod("mp_aggregate", signature(.data="MPSE"), .internal_mp_aggregate) .internal_nest_tibble <- function(x, columns){ nm <- colnames(x) nm %<>% stats::setNames(nm) nm <- nm[!nm %in% columns] nm %<>% lapply(., function(x)x) x <- do.call(tidyr::nest, c(list(x), nm)) x <- check_single_nrow_in_nest(x, columns) return(x) } check_single_nrow_in_nest <- function(da, columns){ indnm <- da %>% apply(., 2, function(x)all(lapply(x, function(i)nrow(unique(i))==1) %>% unlist())) indnm <- indnm[indnm] %>% names() indnm <- indnm[!indnm %in% columns] if (length(indnm)>0){ for( i in indnm){ da %<>% dplyr::mutate(!!rlang::sym(i):=as.vector(unlist(lapply(!!rlang::sym(i), function(x)unique(x))))) } } return(da) }
setwd("F://R//Rfiles") forestfiles <- read.csv("forestfires (1).csv") View(forestfiles) attach(forestfiles) table(area) #after making the catogorical variable to factor variable #need to normalize the other numerical datas forestfiles[,c(3:11)] <- scale(forestfiles[,c(3:11)]) View(forestfiles) str(forestfiles) #partition of data library(caret) datas <- createDataPartition(forestfiles$size_category, p = 0.75, list = FALSE) Train_data <- forestfiles[datas,] Test_data <- forestfiles[-datas,] View(Train_data) Train_data <- Train_data[,-c(1,2)] View(Train_data) Test_data <- Test_data[,-c(1,2)] #building model library(e1071) model1 <- svm(Train_data$size_category~., data = Train_data, kernel = "linear") summary(model1) pred <- predict(model1, newdata = Test_data[,-31]) table(pred, Test_data$size_category) mean(pred == Test_data$size_category) # 0.8984 library(kernlab) model2 <- ksvm(Train_data$size_category~., data = Train_data, kernel = "anovadot") summary(model2) pred2 <- predict(model2, newdata = Test_data[,-31]) mean(pred2 == Test_data$size_category) #0.92 #anovadot makes a best model install.packages("ElemStatLearn") library(ElemStatLearn) set = Train_data
/forestfiresdummy.R
no_license
ganeshbalajiai/RCodeSupportVectorMachines
R
false
false
1,237
r
setwd("F://R//Rfiles") forestfiles <- read.csv("forestfires (1).csv") View(forestfiles) attach(forestfiles) table(area) #after making the catogorical variable to factor variable #need to normalize the other numerical datas forestfiles[,c(3:11)] <- scale(forestfiles[,c(3:11)]) View(forestfiles) str(forestfiles) #partition of data library(caret) datas <- createDataPartition(forestfiles$size_category, p = 0.75, list = FALSE) Train_data <- forestfiles[datas,] Test_data <- forestfiles[-datas,] View(Train_data) Train_data <- Train_data[,-c(1,2)] View(Train_data) Test_data <- Test_data[,-c(1,2)] #building model library(e1071) model1 <- svm(Train_data$size_category~., data = Train_data, kernel = "linear") summary(model1) pred <- predict(model1, newdata = Test_data[,-31]) table(pred, Test_data$size_category) mean(pred == Test_data$size_category) # 0.8984 library(kernlab) model2 <- ksvm(Train_data$size_category~., data = Train_data, kernel = "anovadot") summary(model2) pred2 <- predict(model2, newdata = Test_data[,-31]) mean(pred2 == Test_data$size_category) #0.92 #anovadot makes a best model install.packages("ElemStatLearn") library(ElemStatLearn) set = Train_data
########################################################################################## ################## Module gestion de table, creation d'une matrice de confusion ####### ########################################################################################## # Points abordes : # - creer un data frame # - manipuler un data frame # - ecrire fichier CSV, TXT #############################################################a############################# # Derniere mise e jour 26/08/2015 # remi.dannunzio@fao.org ########################################################################################## ########################################################################################## ################## Options de base, paquets ########################################################################################## options(stringsAsFactors=FALSE) setwd("/media/xubuntu/data_ofgt/") ### Creer un vecteur: fonctions "<-" et ":" vecteur <- 0:20 ### Repeter des elements: fonction "rep" rep("bonjour",3) ### Creer un vecteur: fonction "c()" code_1990 <- c(0,1,0,1,rep(0,17)) code_2000 <- rep(0,21) code_2015 <- code_2000 code_2000[10]<-1 code_2015[c(7,8,10,17,19)]<-1 ### Creer une table: fonction "data.frame()" df <- data.frame(vecteur) ### Associer des vecteur en colonne: fonction "cbind()" df <- cbind(vecteur,code_1990) df <- cbind(df,code_2000) df <- cbind(df,code_2015) ### Afficher la structure d'un objet: fonction "str" str(df) ### Changer le type d'un objet: fonction "as" df <- as.data.frame(df) str(df) ### Afficher le haut d'une table: fonction "head" head(df) head(df,2) ### Afficher le nom des colonnes d'une table: fonction "names" names(df) ### Changer le nom d'une colonne d'une table names(df)[1] <- "classe_origine" ### Concatener des elements : fonction "paste" paste("je commence "," R",sep="avec") paste("classe",vecteur,sep="") ### Ajouter une colonne dans une table df$colonne_nouvelle <- paste("classe",vecteur,sep="") ### Extraire une colonne d'une table: fonction "$" df2 <- df$classe_origine df2 ### Tester une condition df2 == vecteur ### Suppimer un objet: fonction "rm" rm(df2) ### Afficher la longueur d'un vecteur/table: fonction "length" length(df$classe_origine) ### Afficher la classe d'un vecteur/table: fonction "class" class(df$colonne_nouvelle) class(df$classe_origine) ### Extraire un element / une ligne / une colonne: fonction "[,]" df[5,] df[df$classe_origine > 10,] df[,"classe_origine"] df[df$classe_origine == 13,] ### Determiner les valeurs uniques: fonction "unique" unique(df$code_1990) ### Afficher les niveaux d'une variable: fonction "levels" levels(df$code_1990) ### Changer le type d'une variable: fonction "as.XXXXX" ### NB: plusieurs fonctions imbriquees, l'indentation est automatique (legend <- levels(as.factor(df$code_1990) ) ) ### Afficher un comptage des elements par colonne: fonction "table" table(df$code_1990) table(df$code_1990,df$code_2000) ### Creer un sous-dataset out <- df[,1:4] ### Exporter resultats en CSV write.csv(file="data/table/classes.csv",out,row.names=F)
/modules_R/module_1_table/module1_fichier_table.R
no_license
lecrabe/training_geospatial_rci
R
false
false
3,142
r
########################################################################################## ################## Module gestion de table, creation d'une matrice de confusion ####### ########################################################################################## # Points abordes : # - creer un data frame # - manipuler un data frame # - ecrire fichier CSV, TXT #############################################################a############################# # Derniere mise e jour 26/08/2015 # remi.dannunzio@fao.org ########################################################################################## ########################################################################################## ################## Options de base, paquets ########################################################################################## options(stringsAsFactors=FALSE) setwd("/media/xubuntu/data_ofgt/") ### Creer un vecteur: fonctions "<-" et ":" vecteur <- 0:20 ### Repeter des elements: fonction "rep" rep("bonjour",3) ### Creer un vecteur: fonction "c()" code_1990 <- c(0,1,0,1,rep(0,17)) code_2000 <- rep(0,21) code_2015 <- code_2000 code_2000[10]<-1 code_2015[c(7,8,10,17,19)]<-1 ### Creer une table: fonction "data.frame()" df <- data.frame(vecteur) ### Associer des vecteur en colonne: fonction "cbind()" df <- cbind(vecteur,code_1990) df <- cbind(df,code_2000) df <- cbind(df,code_2015) ### Afficher la structure d'un objet: fonction "str" str(df) ### Changer le type d'un objet: fonction "as" df <- as.data.frame(df) str(df) ### Afficher le haut d'une table: fonction "head" head(df) head(df,2) ### Afficher le nom des colonnes d'une table: fonction "names" names(df) ### Changer le nom d'une colonne d'une table names(df)[1] <- "classe_origine" ### Concatener des elements : fonction "paste" paste("je commence "," R",sep="avec") paste("classe",vecteur,sep="") ### Ajouter une colonne dans une table df$colonne_nouvelle <- paste("classe",vecteur,sep="") ### Extraire une colonne d'une table: fonction "$" df2 <- df$classe_origine df2 ### Tester une condition df2 == vecteur ### Suppimer un objet: fonction "rm" rm(df2) ### Afficher la longueur d'un vecteur/table: fonction "length" length(df$classe_origine) ### Afficher la classe d'un vecteur/table: fonction "class" class(df$colonne_nouvelle) class(df$classe_origine) ### Extraire un element / une ligne / une colonne: fonction "[,]" df[5,] df[df$classe_origine > 10,] df[,"classe_origine"] df[df$classe_origine == 13,] ### Determiner les valeurs uniques: fonction "unique" unique(df$code_1990) ### Afficher les niveaux d'une variable: fonction "levels" levels(df$code_1990) ### Changer le type d'une variable: fonction "as.XXXXX" ### NB: plusieurs fonctions imbriquees, l'indentation est automatique (legend <- levels(as.factor(df$code_1990) ) ) ### Afficher un comptage des elements par colonne: fonction "table" table(df$code_1990) table(df$code_1990,df$code_2000) ### Creer un sous-dataset out <- df[,1:4] ### Exporter resultats en CSV write.csv(file="data/table/classes.csv",out,row.names=F)
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/factors_single.R \name{factors_single} \alias{factors_single} \alias{factors_single.CMF} \alias{factors_single.CMF_implicit} \alias{factors_single.ContentBased} \alias{factors_single.OMF_explicit} \alias{factors_single.OMF_implicit} \title{Calculate latent factors for a new user} \usage{ factors_single(model, ...) \method{factors_single}{CMF}( model, X = NULL, X_col = NULL, X_val = NULL, U = NULL, U_col = NULL, U_val = NULL, U_bin = NULL, weight = NULL, output_bias = FALSE, ... ) \method{factors_single}{CMF_implicit}( model, X = NULL, X_col = NULL, X_val = NULL, U = NULL, U_col = NULL, U_val = NULL, ... ) \method{factors_single}{ContentBased}(model, U = NULL, U_col = NULL, U_val = NULL, ...) \method{factors_single}{OMF_explicit}( model, X = NULL, X_col = NULL, X_val = NULL, U = NULL, U_col = NULL, U_val = NULL, weight = NULL, output_bias = FALSE, output_A = FALSE, exact = FALSE, ... ) \method{factors_single}{OMF_implicit}( model, X = NULL, X_col = NULL, X_val = NULL, U = NULL, U_col = NULL, U_val = NULL, output_A = FALSE, ... ) } \arguments{ \item{model}{A collective matrix factorization model from this package - see \link{fit_models} for details.} \item{...}{Not used.} \item{X}{New `X` data, either as a numeric vector (class `numeric`), or as a sparse vector from package `Matrix` (class `dsparseVector`). If the `X` to which the model was fit was a `data.frame`, the column/item indices will have been reindexed internally, and the numeration can be found under `model$info$item_mapping`. Alternatively, can instead pass the column indices and values and let the model reindex them (see `X_col` and `X_val`). Should pass at most one of `X` or `X_col`+`X_val`.} \item{X_col}{New `X` data in sparse vector format, with `X_col` denoting the items/columns which are not missing. If the `X` to which the model was fit was a `data.frame`, here should pass IDs matching to the second column of that `X`, which will be reindexed internally. Otherwise, should have column indices with numeration starting at 1 (passed as an integer vector). Should pass at most one of `X` or `X_col`+`X_val`.} \item{X_val}{New `X` data in sparse vector format, with `X_val` denoting the associated values to each entry in `X_col` (should be a numeric vector of the same length as `X_col`). Should pass at most one of `X` or `X_col`+`X_val`.} \item{U}{New `U` data, either as a numeric vector (class `numeric`), or as a sparse vector from package `Matrix` (class `dsparseVector`). Alternatively, if `U` is sparse, can instead pass the indices of the non-missing columns and their values separately (see `U_col`). Should pass at most one of `U` or `U_col`+`U_val`.} \item{U_col}{New `U` data in sparse vector format, with `U_col` denoting the attributes/columns which are not missing. Should have numeration starting at 1 (should be an integer vector). Should pass at most one of `U` or `U_col`+`U_val`.} \item{U_val}{New `U` data in sparse vector format, with `U_val` denoting the associated values to each entry in `U_col` (should be a numeric vector of the same length as `U_col`). Should pass at most one of `U` or `U_col`+`U_val`.} \item{U_bin}{Binary columns of `U` on which a sigmoid transformation will be applied. Should be passed as a numeric vector. Note that `U` and `U_bin` are not mutually exclusive.} \item{weight}{(Only for the explicit-feedback models) Associated weight to each non-missing observation in `X`. Must have the same number of entries as `X` - that is, if passing a dense vector of length `n`, `weight` should be a numeric vector of length `n` too, if passing a sparse vector, should have a length corresponding to the number of non-missing elements.} \item{output_bias}{Whether to also return the user bias determined by the model given the data in `X`.} \item{output_A}{Whether to return the raw `A` factors (the free offset).} \item{exact}{(In the `OMF_explicit` model) Whether to calculate `A` and `Am` with the regularization applied to `A` instead of to `Am` (if using the L-BFGS method, this is how the model was fit). This is usually a slower procedure. Only relevant when passing `X` data.} } \value{ If passing `output_bias=FALSE`, `output_A=FALSE`, and in the implicit-feedback models, will return a vector with the obtained latent factors. If passing any of the earlier options, will return a list with the following entries: \itemize{ \item `factors`, which will contain the obtained factors for this new user. \item `bias`, which will contain the obtained bias for this new user (if passing `output_bias=TRUE`). \item `A` (if passing `output_A=TRUE`), which will contain the raw `A` vector (which is added to the factors determined from user attributes in order to obtain the factorization parameters). } } \description{ Determine latent factors for a new user, given either `X` data (a.k.a. "warm-start"), or `U` data (a.k.a. "cold-start"), or both. For example usage, see the main section \link{fit_models}. } \details{ Note that, regardless of whether the model was fit with the L-BFGS or ALS method with CG or Cholesky solver, the new factors will be determined through the Cholesky method or through the precomputed matrices (e.g. a simple matrix-vector multiply for the `ContentBased` model), unless passing `U_bin` in which case they will be determined through the same L-BFGS method with which the model was fit. } \seealso{ \link{factors} \link{topN_new} }
/man/factors_single.Rd
permissive
pandey2000/cmfrec
R
false
true
5,580
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/factors_single.R \name{factors_single} \alias{factors_single} \alias{factors_single.CMF} \alias{factors_single.CMF_implicit} \alias{factors_single.ContentBased} \alias{factors_single.OMF_explicit} \alias{factors_single.OMF_implicit} \title{Calculate latent factors for a new user} \usage{ factors_single(model, ...) \method{factors_single}{CMF}( model, X = NULL, X_col = NULL, X_val = NULL, U = NULL, U_col = NULL, U_val = NULL, U_bin = NULL, weight = NULL, output_bias = FALSE, ... ) \method{factors_single}{CMF_implicit}( model, X = NULL, X_col = NULL, X_val = NULL, U = NULL, U_col = NULL, U_val = NULL, ... ) \method{factors_single}{ContentBased}(model, U = NULL, U_col = NULL, U_val = NULL, ...) \method{factors_single}{OMF_explicit}( model, X = NULL, X_col = NULL, X_val = NULL, U = NULL, U_col = NULL, U_val = NULL, weight = NULL, output_bias = FALSE, output_A = FALSE, exact = FALSE, ... ) \method{factors_single}{OMF_implicit}( model, X = NULL, X_col = NULL, X_val = NULL, U = NULL, U_col = NULL, U_val = NULL, output_A = FALSE, ... ) } \arguments{ \item{model}{A collective matrix factorization model from this package - see \link{fit_models} for details.} \item{...}{Not used.} \item{X}{New `X` data, either as a numeric vector (class `numeric`), or as a sparse vector from package `Matrix` (class `dsparseVector`). If the `X` to which the model was fit was a `data.frame`, the column/item indices will have been reindexed internally, and the numeration can be found under `model$info$item_mapping`. Alternatively, can instead pass the column indices and values and let the model reindex them (see `X_col` and `X_val`). Should pass at most one of `X` or `X_col`+`X_val`.} \item{X_col}{New `X` data in sparse vector format, with `X_col` denoting the items/columns which are not missing. If the `X` to which the model was fit was a `data.frame`, here should pass IDs matching to the second column of that `X`, which will be reindexed internally. Otherwise, should have column indices with numeration starting at 1 (passed as an integer vector). Should pass at most one of `X` or `X_col`+`X_val`.} \item{X_val}{New `X` data in sparse vector format, with `X_val` denoting the associated values to each entry in `X_col` (should be a numeric vector of the same length as `X_col`). Should pass at most one of `X` or `X_col`+`X_val`.} \item{U}{New `U` data, either as a numeric vector (class `numeric`), or as a sparse vector from package `Matrix` (class `dsparseVector`). Alternatively, if `U` is sparse, can instead pass the indices of the non-missing columns and their values separately (see `U_col`). Should pass at most one of `U` or `U_col`+`U_val`.} \item{U_col}{New `U` data in sparse vector format, with `U_col` denoting the attributes/columns which are not missing. Should have numeration starting at 1 (should be an integer vector). Should pass at most one of `U` or `U_col`+`U_val`.} \item{U_val}{New `U` data in sparse vector format, with `U_val` denoting the associated values to each entry in `U_col` (should be a numeric vector of the same length as `U_col`). Should pass at most one of `U` or `U_col`+`U_val`.} \item{U_bin}{Binary columns of `U` on which a sigmoid transformation will be applied. Should be passed as a numeric vector. Note that `U` and `U_bin` are not mutually exclusive.} \item{weight}{(Only for the explicit-feedback models) Associated weight to each non-missing observation in `X`. Must have the same number of entries as `X` - that is, if passing a dense vector of length `n`, `weight` should be a numeric vector of length `n` too, if passing a sparse vector, should have a length corresponding to the number of non-missing elements.} \item{output_bias}{Whether to also return the user bias determined by the model given the data in `X`.} \item{output_A}{Whether to return the raw `A` factors (the free offset).} \item{exact}{(In the `OMF_explicit` model) Whether to calculate `A` and `Am` with the regularization applied to `A` instead of to `Am` (if using the L-BFGS method, this is how the model was fit). This is usually a slower procedure. Only relevant when passing `X` data.} } \value{ If passing `output_bias=FALSE`, `output_A=FALSE`, and in the implicit-feedback models, will return a vector with the obtained latent factors. If passing any of the earlier options, will return a list with the following entries: \itemize{ \item `factors`, which will contain the obtained factors for this new user. \item `bias`, which will contain the obtained bias for this new user (if passing `output_bias=TRUE`). \item `A` (if passing `output_A=TRUE`), which will contain the raw `A` vector (which is added to the factors determined from user attributes in order to obtain the factorization parameters). } } \description{ Determine latent factors for a new user, given either `X` data (a.k.a. "warm-start"), or `U` data (a.k.a. "cold-start"), or both. For example usage, see the main section \link{fit_models}. } \details{ Note that, regardless of whether the model was fit with the L-BFGS or ALS method with CG or Cholesky solver, the new factors will be determined through the Cholesky method or through the precomputed matrices (e.g. a simple matrix-vector multiply for the `ContentBased` model), unless passing `U_bin` in which case they will be determined through the same L-BFGS method with which the model was fit. } \seealso{ \link{factors} \link{topN_new} }
#' Function generates a base dataset from ImmuneSpace #' #' @param assay assay name in ImmuneSpace #' @param con ImmuneSpaceR connection object #' @param studies list of ImmuneSpace studies to use in filtering #' @export #' getImmuneResponseData <- function(assay, con, studies){ dt <- con$getDataset(assay, original_view = TRUE) dt <- dt[ dt$study_accession %in% studies, ] } #' Filter immdata list elements by age filter #' #' @param immdata list of assay data.table(s) #' @param ages age cutoffs, either one or two sets #' @export #' filterImmdataByAge <- function(immdata, ages){ filteredImmdata <- lapply(immdata, function(dt){ if(length(ages) == 2){ dt <- dt[ dt$age_imputed >= ages[[1]] & dt$age_imputed < ages[[2]] ] }else{ dt <- dt[ (dt$age_imputed >= ages[[1]] & dt$age_imputed < ages[[2]]) | (dt$age_imputed >= ages[[3]] & dt$age_imputed < ages[[4]]) ] } return(dt) }) } #' Generate a single response call data.table from multiple assays #' #' @param immdata_age_group list of assay data.table(s) #' @export #' selectResponsesToUse <- function(immdata_age_group){ tmp <- rbindlist(immdata_age_group, fill = TRUE) colsToUse <- c( "participant_id", "study_accession", "arm_accession", "cohort", "race", "ethnicity", "gender", "age_imputed", "vaccine", "vaccine_type", "pathogen", "assay", "adjuvant", "MFC", "maxRBA", "maxStrain_MFC", "maxStrain_RBA", "ImmResp_baseline_value_MFC", "ImmResp_baseline_timepoint_MFC", "ImmResp_postVax_value_MFC", "ImmResp_postVax_timepoint_MFC", "ImmResp_baseline_value_RBA", "ImmResp_baseline_timepoint_RBA", "ImmResp_postVax_value_RBA", "ImmResp_postVax_timepoint_RBA" ) dynamicCols <- grep("_p\\d+$", colnames(tmp), value = TRUE) colsToUse <- c(colsToUse, dynamicCols) tmp <- tmp[, ..colsToUse] tmp <- tmp[ !duplicated(tmp) ] # after rm biosample id and other cols, mostly dupes tmp <- tmp[ , numAssays := .N, by = participant_id ] # select assay to use singleAssay <- tmp[ numAssays == 1 ] needFiltering <- tmp[ numAssays > 1 ] haiSubs <- needFiltering[ assay == "hai" ] nabSubs <- needFiltering[ assay == "neut_ab_titer" & !participant_id %in% unique(haiSubs$participant_id) ] res <- rbindlist(list(singleAssay, haiSubs, nabSubs)) if( length(res$participant_id) != length(unique(res$participant_id)) ){ stop("filtering not done correctly") } return(res) }
/R/immuneResponsePreProcessing.R
no_license
RGLab/ImmuneSignatures2
R
false
false
2,542
r
#' Function generates a base dataset from ImmuneSpace #' #' @param assay assay name in ImmuneSpace #' @param con ImmuneSpaceR connection object #' @param studies list of ImmuneSpace studies to use in filtering #' @export #' getImmuneResponseData <- function(assay, con, studies){ dt <- con$getDataset(assay, original_view = TRUE) dt <- dt[ dt$study_accession %in% studies, ] } #' Filter immdata list elements by age filter #' #' @param immdata list of assay data.table(s) #' @param ages age cutoffs, either one or two sets #' @export #' filterImmdataByAge <- function(immdata, ages){ filteredImmdata <- lapply(immdata, function(dt){ if(length(ages) == 2){ dt <- dt[ dt$age_imputed >= ages[[1]] & dt$age_imputed < ages[[2]] ] }else{ dt <- dt[ (dt$age_imputed >= ages[[1]] & dt$age_imputed < ages[[2]]) | (dt$age_imputed >= ages[[3]] & dt$age_imputed < ages[[4]]) ] } return(dt) }) } #' Generate a single response call data.table from multiple assays #' #' @param immdata_age_group list of assay data.table(s) #' @export #' selectResponsesToUse <- function(immdata_age_group){ tmp <- rbindlist(immdata_age_group, fill = TRUE) colsToUse <- c( "participant_id", "study_accession", "arm_accession", "cohort", "race", "ethnicity", "gender", "age_imputed", "vaccine", "vaccine_type", "pathogen", "assay", "adjuvant", "MFC", "maxRBA", "maxStrain_MFC", "maxStrain_RBA", "ImmResp_baseline_value_MFC", "ImmResp_baseline_timepoint_MFC", "ImmResp_postVax_value_MFC", "ImmResp_postVax_timepoint_MFC", "ImmResp_baseline_value_RBA", "ImmResp_baseline_timepoint_RBA", "ImmResp_postVax_value_RBA", "ImmResp_postVax_timepoint_RBA" ) dynamicCols <- grep("_p\\d+$", colnames(tmp), value = TRUE) colsToUse <- c(colsToUse, dynamicCols) tmp <- tmp[, ..colsToUse] tmp <- tmp[ !duplicated(tmp) ] # after rm biosample id and other cols, mostly dupes tmp <- tmp[ , numAssays := .N, by = participant_id ] # select assay to use singleAssay <- tmp[ numAssays == 1 ] needFiltering <- tmp[ numAssays > 1 ] haiSubs <- needFiltering[ assay == "hai" ] nabSubs <- needFiltering[ assay == "neut_ab_titer" & !participant_id %in% unique(haiSubs$participant_id) ] res <- rbindlist(list(singleAssay, haiSubs, nabSubs)) if( length(res$participant_id) != length(unique(res$participant_id)) ){ stop("filtering not done correctly") } return(res) }
% Generated by roxygen2 (4.0.1): do not edit by hand \name{LinearizedSVRTrain} \alias{LinearizedSVRTrain} \title{LinearizedSVRTrain} \usage{ LinearizedSVRTrain(X, Y, C = 1, epsilon = 0.01, nump = floor(sqrt(N)), ktype = rbfdot, kpar, prototypes = c("kmeans", "random"), clusterY = FALSE, epsilon.up = epsilon, epsilon.down = epsilon, expectile = NULL, scale = TRUE, sigest = sigma.est) } \arguments{ \item{X}{matrix of examples, one example per row.} \item{Y}{vector of target values. Must be the same length as the number of rows in \code{X}.} \item{C}{cost of constraints violation} \item{epsilon}{tolerance of termination criterion for optimization} \item{nump}{number of prototypes by which to represent each example in \code{X}} \item{ktype}{kernel-generating function, typically from the \pkg{kernlab} package} \item{kpar}{a list of any parameters necessary for \code{ktype}. See Details.} \item{prototypes}{the method by which prototypes will be chosen} \item{clusterY}{whether to cluster \code{X} and \code{Y} jointly when using \code{prototypes="kmeans"}. Otherwise \code{X} is clustered without influence from \code{Y}.} \item{epsilon.up}{allows you to use a different setting for \code{epsilon} in the positive direction.} \item{epsilon.down}{allows you to use a different setting for \code{epsilon} in the negative direction.} \item{expectile}{if non-null, do expectile regression using the given expectile value. Currently uses the \code{expectreg} package.} \item{scale}{a boolean value indicating whether \code{X} and \code{Y} should be normalized (to zero-mean and unit-variance) before learning.} \item{sigest}{if the kernel expects a \code{sigma} parameter and none is provided in \code{kpar}, this parameter specifies a function to use to compute it.} } \value{ a model object that can later be used as the first argument for the \code{predict()} method. } \description{ Train a prototype-based Linearized Support-Vector Regression model } \details{ This function trains a new LinearizedSVR model based on \code{X} and \code{Y}. See \link{LinearizedSVR-package} for an explanation of how such models are defined. } \examples{ dat <- rbind(data.frame(y=2, x1=rnorm(500, 1), x2=rnorm(500, 1)), data.frame(y=1, x1=rnorm(500,-1), x2=rnorm(500,-1))) mod <- LinearizedSVRTrain(X=as.matrix(dat[-1]), Y=dat$y, nump=6) res <- predict(mod, newdata=as.matrix(dat[-1])) plot(x2 ~ x1, dat, col=c("red","green")[1+(res>1.5)], pch=c(3,20)[dat$y]) } \seealso{ LinearizedSVR-package }
/man/LinearizedSVRTrain.Rd
no_license
cran/LinearizedSVR
R
false
false
2,596
rd
% Generated by roxygen2 (4.0.1): do not edit by hand \name{LinearizedSVRTrain} \alias{LinearizedSVRTrain} \title{LinearizedSVRTrain} \usage{ LinearizedSVRTrain(X, Y, C = 1, epsilon = 0.01, nump = floor(sqrt(N)), ktype = rbfdot, kpar, prototypes = c("kmeans", "random"), clusterY = FALSE, epsilon.up = epsilon, epsilon.down = epsilon, expectile = NULL, scale = TRUE, sigest = sigma.est) } \arguments{ \item{X}{matrix of examples, one example per row.} \item{Y}{vector of target values. Must be the same length as the number of rows in \code{X}.} \item{C}{cost of constraints violation} \item{epsilon}{tolerance of termination criterion for optimization} \item{nump}{number of prototypes by which to represent each example in \code{X}} \item{ktype}{kernel-generating function, typically from the \pkg{kernlab} package} \item{kpar}{a list of any parameters necessary for \code{ktype}. See Details.} \item{prototypes}{the method by which prototypes will be chosen} \item{clusterY}{whether to cluster \code{X} and \code{Y} jointly when using \code{prototypes="kmeans"}. Otherwise \code{X} is clustered without influence from \code{Y}.} \item{epsilon.up}{allows you to use a different setting for \code{epsilon} in the positive direction.} \item{epsilon.down}{allows you to use a different setting for \code{epsilon} in the negative direction.} \item{expectile}{if non-null, do expectile regression using the given expectile value. Currently uses the \code{expectreg} package.} \item{scale}{a boolean value indicating whether \code{X} and \code{Y} should be normalized (to zero-mean and unit-variance) before learning.} \item{sigest}{if the kernel expects a \code{sigma} parameter and none is provided in \code{kpar}, this parameter specifies a function to use to compute it.} } \value{ a model object that can later be used as the first argument for the \code{predict()} method. } \description{ Train a prototype-based Linearized Support-Vector Regression model } \details{ This function trains a new LinearizedSVR model based on \code{X} and \code{Y}. See \link{LinearizedSVR-package} for an explanation of how such models are defined. } \examples{ dat <- rbind(data.frame(y=2, x1=rnorm(500, 1), x2=rnorm(500, 1)), data.frame(y=1, x1=rnorm(500,-1), x2=rnorm(500,-1))) mod <- LinearizedSVRTrain(X=as.matrix(dat[-1]), Y=dat$y, nump=6) res <- predict(mod, newdata=as.matrix(dat[-1])) plot(x2 ~ x1, dat, col=c("red","green")[1+(res>1.5)], pch=c(3,20)[dat$y]) } \seealso{ LinearizedSVR-package }
# 주사위 (1,2,3,4,5,6) 4번 던져서 나오는 숫자의 합 x에 대한 확률 library(prob) rolldie(5) S <- rolldie(4) dim(S) str(S) x <- apply(S, 1, sum) x x.freq <- table(x) length(x.freq) x.freq <- x.freq / length(x) x.freq plot(x.freq, type="h") # temp <- matrix(c(1,2,3,4), nrow=2) # temp # apply(temp,1,sum) # 이산확률변수 -> 이산확률분포 # 50개 제품중 8개가 불량이 있는 상자로부터 # 10개의 제품을 랜덤 샘플링시 발견되는 불량 개수 x의 확률분포는? npop <- 50 nsamp1 <- 10 ndef <- 8 d <- choose(npop,nsamp1) freq <- choose(ndef, 0:nsamp1) * choose(npop-ndef, nsamp1-(0:nsamp1)) freq fx <- freq /d fx plot(0:10,fx,type="h") # 여덟명이 각각의 모자를 들고 모였는데, 갑자기 정전이 되서 아무 모자나 들고 집으로 감 # 자기 자신의 모자를 들고 간 신사의 수를 x라고 할때, 확률변수 x의 확률은? options(stringsAsFactors = F) hats <- LETTERS[1:8] S <- urnsamples(hats, size=8, ordered = T) str(S) dim(S) rowN <- nrow(S) ncol(S) table(S) checkFunc <- function(x){sum(x==hats)} X <- apply(S,1,checkFunc) X.freq2 <- table(X) X.prob2 <- round(X.freq2/rowN,6) sum(X.prob2) plot(X.prob2, type="h") #주사위 3개를 던짐. 짝수의 개수 S <- rolldie(3) rowN <- nrow(S) S rowN checkFunc <- function(x) sum(1-x%%2) Y <- apply(S,1,checkFunc) table(Y) # 주사위를 두번 던지는 시행. # 눈의 최대치 X, 눈의 최소치 Y # Z=XY 의 기대값은? S1 <- rolldie(2) str(S1) X1 <- apply(S1, 1, max) table(X1) X2 <- apply(S1, 1, min) table(X2) temp <- table(X1,X2)/nrow(S1) temp class(temp) XY <- (1:6 %o% 1:6) XY (as.vector(XY)) %*% as.vector(XY) S3 <- tosscoin(4) S3 nrow(S3) #앞면 뒷면 갯수를 세는 함수 countH <- function(x) sum(x=='H') countT <- function(x) sum(x=='T') # 확률 변수 변수 생성 X3 <- apply(S3, 1, countH) Y3 <- apply(S3, 1, countT) V3 <- Y3 -X3 W3 <- abs(V3) par(mfrow=c(2,3)) plot(X3,Y3) plot(X3,V3) plot(X3,W3) plot(Y3,W3) plot(V3,W3) # 평균, 중앙값(mean, median) # 주사위 4개 던졌을때 # list <- 합, 평균, 최대치, 최소치 S5 <- rolldie(4) N5 <- nrow(S5) X5_sum <- apply(S5, 1, sum) X5_mean <- apply(S5, 1, mean) # 불량률이 0.03인 공정에서 20개의 표본을 추출하여 검사하고 발견한 # 불량 개수를 X 라 할때, X의 확률분포 함수, 2개의 불량률이 발견될 확률. dbinom(0:2, 20, 0.03) # 정규분포와 관련 분포 # 1. 기대값 중심으로 대칭이며, 중심위치는 엎어놓은 종 모양의 분포 # dnorm(), pnorm(), qnorm(), rnorm() # 표준정규분표 기대값 = 0, 표준편차 =1 # x축 -7 ~ 7 x <- (-140:140)/20 dnorm(x, 0, 1) dnorm(x, 0, 2) dnorm(x, 2, 1) dnorm(x, 2, 2) data <- matrix(c(dnorm(x, 0, 1), dnorm(x, 0, 2), dnorm(x, 2, 1), dnorm(x, 2, 2)), ncol=4, byrow = F) data par(mfrow=c(2,2)) plot(x, data[,1], type="l") plot(x, data[,2], type="l") plot(x, data[,3], type="l") plot(x, data[,4], type="l") segments(0,0,0,max(data[,1]), lty=2,col=4) # 확률변수 x가 N(2,2^2)을 따를때, 구간 P(-1<x<4)를 구하시오. x3 <- (-140:140)/70 x3 mu3 <- 2; sig3 <- 2; a3<- -1; b3<- 4 fx3 <- matrix(c(dnorm(x3,0,1), dnorm(x3,mu3,sig3)), ncol=2, byrow=F) fx3 px3 <- pnorm(4, mu3, sig3); px3 px4 <- pnorm(-1, mu3, sig3); px4 px3 - px4 plot(x3, fx3[,2], type='l') x5 <- c(a3, seq(a3, b3, 0.01),b3) # 1. 성공확률이 0.2인 n회의 시행에서 나온 성공횟수를 Xn이라 할때, n=10,20,50 # 각각에 대해 Xn의 확률 분포함수를 그래프로 출력하라. (dbinom) x10 <- 0:10; x20 <- 0:20; x50 <- 0:50 par(mfrow=c(1,3)) plot(x10, dbinom(x10,10,0.2), type="h") plot(x20, dbinom(x20,20,0.2), type="h") plot(x50, dbinom(x50,50,0.2), type="h") # 2. 성공확률이 20%이고 200개의 단위로 구성된 모집단에서 비복원추출한 n개의 # 표본에서 나온 성공회수를 Xn이라고 할때, n=10,20,50 각각에 대해 Xn의 # 확률분포함수를 그래프로 출력하시오.(dhyper) x10 <- 0:10; x20 <- 0:20; x50 <- 0:50 plot(x10, dhyper(x10, 40, 160, 10), type="h") plot(x20, dhyper(x20, 40, 160, 20), type="h") plot(x50, dhyper(x50, 40, 160, 50), type="h") # 3.단위 제품 당 평균 결점수가 3개인 n개의 단위 제품에서 나온 결점수를 Xn이라고 # 할때, n=2,5,10 각각에 대해 Xn의 확률 분포 함수를 그래프로 출력하라.(dpois) x2 <- 0:12; x5 <- 0:30; x10 <- 0:60 par(mfrow=c(1,3)) plot(x2, dpois(x2, 6), type="h") plot(x5, dpois(x5, 15), type="h") #중심 극한정리(central limit theorem) library(ggplot2) install.packages("devtools") install.packages("kassambara/easyGgplot2") library(devtools) library(easyGgplot2) library(data.table) data <- data.table(read.table("ME_2765tmax.txt", header=F)) str(data) class(data) colnames(data) <- c("StateID","YearDay","Year","Month","MonthDay","MaxTemp") colnames(data) .
/181010test.R
permissive
EnteLee/RPractice
R
false
false
4,919
r
# 주사위 (1,2,3,4,5,6) 4번 던져서 나오는 숫자의 합 x에 대한 확률 library(prob) rolldie(5) S <- rolldie(4) dim(S) str(S) x <- apply(S, 1, sum) x x.freq <- table(x) length(x.freq) x.freq <- x.freq / length(x) x.freq plot(x.freq, type="h") # temp <- matrix(c(1,2,3,4), nrow=2) # temp # apply(temp,1,sum) # 이산확률변수 -> 이산확률분포 # 50개 제품중 8개가 불량이 있는 상자로부터 # 10개의 제품을 랜덤 샘플링시 발견되는 불량 개수 x의 확률분포는? npop <- 50 nsamp1 <- 10 ndef <- 8 d <- choose(npop,nsamp1) freq <- choose(ndef, 0:nsamp1) * choose(npop-ndef, nsamp1-(0:nsamp1)) freq fx <- freq /d fx plot(0:10,fx,type="h") # 여덟명이 각각의 모자를 들고 모였는데, 갑자기 정전이 되서 아무 모자나 들고 집으로 감 # 자기 자신의 모자를 들고 간 신사의 수를 x라고 할때, 확률변수 x의 확률은? options(stringsAsFactors = F) hats <- LETTERS[1:8] S <- urnsamples(hats, size=8, ordered = T) str(S) dim(S) rowN <- nrow(S) ncol(S) table(S) checkFunc <- function(x){sum(x==hats)} X <- apply(S,1,checkFunc) X.freq2 <- table(X) X.prob2 <- round(X.freq2/rowN,6) sum(X.prob2) plot(X.prob2, type="h") #주사위 3개를 던짐. 짝수의 개수 S <- rolldie(3) rowN <- nrow(S) S rowN checkFunc <- function(x) sum(1-x%%2) Y <- apply(S,1,checkFunc) table(Y) # 주사위를 두번 던지는 시행. # 눈의 최대치 X, 눈의 최소치 Y # Z=XY 의 기대값은? S1 <- rolldie(2) str(S1) X1 <- apply(S1, 1, max) table(X1) X2 <- apply(S1, 1, min) table(X2) temp <- table(X1,X2)/nrow(S1) temp class(temp) XY <- (1:6 %o% 1:6) XY (as.vector(XY)) %*% as.vector(XY) S3 <- tosscoin(4) S3 nrow(S3) #앞면 뒷면 갯수를 세는 함수 countH <- function(x) sum(x=='H') countT <- function(x) sum(x=='T') # 확률 변수 변수 생성 X3 <- apply(S3, 1, countH) Y3 <- apply(S3, 1, countT) V3 <- Y3 -X3 W3 <- abs(V3) par(mfrow=c(2,3)) plot(X3,Y3) plot(X3,V3) plot(X3,W3) plot(Y3,W3) plot(V3,W3) # 평균, 중앙값(mean, median) # 주사위 4개 던졌을때 # list <- 합, 평균, 최대치, 최소치 S5 <- rolldie(4) N5 <- nrow(S5) X5_sum <- apply(S5, 1, sum) X5_mean <- apply(S5, 1, mean) # 불량률이 0.03인 공정에서 20개의 표본을 추출하여 검사하고 발견한 # 불량 개수를 X 라 할때, X의 확률분포 함수, 2개의 불량률이 발견될 확률. dbinom(0:2, 20, 0.03) # 정규분포와 관련 분포 # 1. 기대값 중심으로 대칭이며, 중심위치는 엎어놓은 종 모양의 분포 # dnorm(), pnorm(), qnorm(), rnorm() # 표준정규분표 기대값 = 0, 표준편차 =1 # x축 -7 ~ 7 x <- (-140:140)/20 dnorm(x, 0, 1) dnorm(x, 0, 2) dnorm(x, 2, 1) dnorm(x, 2, 2) data <- matrix(c(dnorm(x, 0, 1), dnorm(x, 0, 2), dnorm(x, 2, 1), dnorm(x, 2, 2)), ncol=4, byrow = F) data par(mfrow=c(2,2)) plot(x, data[,1], type="l") plot(x, data[,2], type="l") plot(x, data[,3], type="l") plot(x, data[,4], type="l") segments(0,0,0,max(data[,1]), lty=2,col=4) # 확률변수 x가 N(2,2^2)을 따를때, 구간 P(-1<x<4)를 구하시오. x3 <- (-140:140)/70 x3 mu3 <- 2; sig3 <- 2; a3<- -1; b3<- 4 fx3 <- matrix(c(dnorm(x3,0,1), dnorm(x3,mu3,sig3)), ncol=2, byrow=F) fx3 px3 <- pnorm(4, mu3, sig3); px3 px4 <- pnorm(-1, mu3, sig3); px4 px3 - px4 plot(x3, fx3[,2], type='l') x5 <- c(a3, seq(a3, b3, 0.01),b3) # 1. 성공확률이 0.2인 n회의 시행에서 나온 성공횟수를 Xn이라 할때, n=10,20,50 # 각각에 대해 Xn의 확률 분포함수를 그래프로 출력하라. (dbinom) x10 <- 0:10; x20 <- 0:20; x50 <- 0:50 par(mfrow=c(1,3)) plot(x10, dbinom(x10,10,0.2), type="h") plot(x20, dbinom(x20,20,0.2), type="h") plot(x50, dbinom(x50,50,0.2), type="h") # 2. 성공확률이 20%이고 200개의 단위로 구성된 모집단에서 비복원추출한 n개의 # 표본에서 나온 성공회수를 Xn이라고 할때, n=10,20,50 각각에 대해 Xn의 # 확률분포함수를 그래프로 출력하시오.(dhyper) x10 <- 0:10; x20 <- 0:20; x50 <- 0:50 plot(x10, dhyper(x10, 40, 160, 10), type="h") plot(x20, dhyper(x20, 40, 160, 20), type="h") plot(x50, dhyper(x50, 40, 160, 50), type="h") # 3.단위 제품 당 평균 결점수가 3개인 n개의 단위 제품에서 나온 결점수를 Xn이라고 # 할때, n=2,5,10 각각에 대해 Xn의 확률 분포 함수를 그래프로 출력하라.(dpois) x2 <- 0:12; x5 <- 0:30; x10 <- 0:60 par(mfrow=c(1,3)) plot(x2, dpois(x2, 6), type="h") plot(x5, dpois(x5, 15), type="h") #중심 극한정리(central limit theorem) library(ggplot2) install.packages("devtools") install.packages("kassambara/easyGgplot2") library(devtools) library(easyGgplot2) library(data.table) data <- data.table(read.table("ME_2765tmax.txt", header=F)) str(data) class(data) colnames(data) <- c("StateID","YearDay","Year","Month","MonthDay","MaxTemp") colnames(data) .
### Table 1 tab1 = hundat %>% group_by(Variable = contract) %>% summarise('Mean East' = wtd.mean(hwage[region2 == 'East'], pb040[region2 == 'East']), 'Mean West' = wtd.mean(hwage[region2 == 'West'], pb040[region2 == 'West']), 'N' = n(), 'N(East)/N' = length(hwage[region2 == 'East']) / n()) tab1 = hundat %>% group_by(Variable = firmsize) %>% summarise('Mean East' = wtd.mean(hwage[region2 == 'East'], pb040[region2 == 'East']), 'Mean West' = wtd.mean(hwage[region2 == 'West'], pb040[region2 == 'West']), 'N' = n(), 'N(East)/N' = length(hwage[region2 == 'East']) / n()) %>% bind_rows(tab1) tab1 = hundat %>% group_by(Variable = sector) %>% summarise('Mean East' = wtd.mean(hwage[region2 == 'East'], pb040[region2 == 'East']), 'Mean West' = wtd.mean(hwage[region2 == 'West'], pb040[region2 == 'West']), 'N' = n(), 'N(East)/N' = length(hwage[region2 == 'East']) / n()) %>% bind_rows(tab1) tab1 = hundat %>% group_by(Variable = isco) %>% summarise('Mean East' = wtd.mean(hwage[region2 == 'East'], pb040[region2 == 'East']), 'Mean West' = wtd.mean(hwage[region2 == 'West'], pb040[region2 == 'West']), 'N' = n(), 'N(East)/N' = length(hwage[region2 == 'East']) / n()) %>% bind_rows(tab1) tab1 = hundat %>% group_by(Variable = urban) %>% summarise('Mean East' = wtd.mean(hwage[region2 == 'East'], pb040[region2 == 'East']), 'Mean West' = wtd.mean(hwage[region2 == 'West'], pb040[region2 == 'West']), 'N' = n(), 'N(East)/N' = length(hwage[region2 == 'East']) / n()) %>% bind_rows(tab1) tab1 = hundat %>% group_by(Variable = union) %>% summarise('Mean East' = wtd.mean(hwage[region2 == 'East'], pb040[region2 == 'East']), 'Mean West' = wtd.mean(hwage[region2 == 'West'], pb040[region2 == 'West']), 'N' = n(), 'N(East)/N' = length(hwage[region2 == 'East']) / n()) %>% bind_rows(tab1) tab1 = hundat %>% group_by(Variable = educ) %>% summarise('Mean East' = wtd.mean(hwage[region2 == 'East'], pb040[region2 == 'East']), 'Mean West' = wtd.mean(hwage[region2 == 'West'], pb040[region2 == 'West']), 'N' = n(), 'N(East)/N' = length(hwage[region2 == 'East']) / n()) %>% bind_rows(tab1) tab1 = hundat %>% group_by(Variable = female) %>% summarise('Mean East' = wtd.mean(hwage[region2 == 'East'], pb040[region2 == 'East']), 'Mean West' = wtd.mean(hwage[region2 == 'West'], pb040[region2 == 'West']), 'N' = n(), 'N(East)/N' = length(hwage[region2 == 'East']) / n()) %>% bind_rows(tab1) tab1 = kable(tab1, 'latex', caption = "Pooled Sample nach Datenfilterung und Stundenlohnunterschiede zwischen Westen und Osten", booktabs = T, escape = F, col.names = c("Variable", linebreak(c("Mean hwage\nEast", "Mean hwage\nWest"), align = "r"), "N", "N(East)/N")) %>% kable_styling(font_size = 10, full_width = F) %>% group_rows("Sex", 1, 2) %>% group_rows("Education", 3, 5) %>% group_rows("Union", 6, 7) %>% group_rows("Urbanisation", 8, 9) %>% group_rows("ISCO", 10, 11) %>% group_rows("Sector", 12, 14) %>% group_rows("Firmsize", 15, 16) %>% group_rows("Contract", 17, 18) %>% footnote(general = 'EU-SILC 2005-2017, eigene Berechnungen.', footnote_as_chunk = T, general_title = "Quelle:") ### Table 2 tab2 = indicators_p1 %>% melt(id = c('rb010', 'stat')) tab2$rb010 = tab2$rb010 tab2 = tab2 %>% spread(rb010, value) tab2$stat = factor(tab2$stat, levels = c('Mean', 'Q50', 'Gini', 'P80/P20', 'Top10')) tab2$variable = factor(tab2$variable, levels = c('pretax_factor_eq', 'pretax_nation_eq', 'posttax_disp_eq'), labels = c('Factor', 'Nation', 'Disposable')) tab2 = tab2[order(tab2$stat, tab2$variable),] tab2 = tab2 %>% select(-stat) %>% kable('latex', booktabs = T, caption = "Ungleichheitsindikatoren nach Eurostat", row.names = FALSE, col.names = c("", c(2005:2017))) %>% kable_styling(latex_options = 'scale_down') %>% group_rows("Mean", 1, 3) %>% group_rows("Median", 4, 6) %>% group_rows("Gini", 7, 9) %>% group_rows("P80/P20", 10, 12) %>% group_rows("Top10", 13, 15) %>% footnote(general = 'EU-SILC 2005-2017, eigene Berechnungen.', footnote_as_chunk = T, general_title = "Quelle:") %>% landscape() ### Table 3 tab3 = indicators_p2 %>% melt(id = c('pb010', 'stat')) tab3$pb010 = tab3$pb010 tab3 = tab3 %>% spread(pb010, value) tab3$stat = factor(tab3$stat, levels = c('Mean', 'Q50', 'Gini', 'P80/P20', 'Top10')) tab3$variable = factor(tab3$variable, levels = c('pretax_factor_20', 'pretax_nation_20', 'posttax_disp_20'), labels = c('Factor', 'Nation', 'Disposable')) tab3 = tab3[order(tab3$stat, tab3$variable),] tab3 = tab3 %>% select(-stat) %>% kable('latex', booktabs = T, caption = "Ungleichheitsindikatoren nach WID World", row.names = FALSE, col.names = c("", c(2005:2017))) %>% kable_styling(latex_options = 'scale_down') %>% group_rows("Mean", 1, 3) %>% group_rows("Median", 4, 6) %>% group_rows("Gini", 7, 9) %>% group_rows("P80/P20", 10, 12) %>% group_rows("Top10", 13, 15) %>% footnote(general = 'EU-SILC 2005-2017, eigene Berechnungen.', footnote_as_chunk = T, general_title = "Quelle:") %>% landscape() ### Table 4 tab4 = results2 tab4$year = tab4$year tab4$lower = round(tab4$lower, digits = 4) tab4$upper = round(tab4$upper, digits = 4) tab4$value = round(tab4$value, digits = 4) tab4 = unite(tab4, CI, lower, upper, sep = "-") tab4 = melt(tab4, id = c('year', 'stat')) tab4 = spread(tab4, year, value) tab4$variable = factor(tab4$variable, levels = c('value', 'CI'), labels = c('Estimate', 'CI')) tab4 = tab4 %>% select(-stat) %>% kable('latex', booktabs = T, caption = "Dekomposition - Einfaches Model", row.names = FALSE, col.names = c("", c(2006:2017))) %>% kable_styling(latex_options = 'scale_down') %>% group_rows('Diffrence (D)', 1, 2) %>% group_rows('Endowment (X)', 3, 4) %>% group_rows('Price (P)', 5, 6) %>% footnote(general = 'EU-SILC 2005-2017, eigene Berechnungen.', footnote_as_chunk = T, general_title = "Quelle:") %>% landscape() ### Table 5 tab5 = results tab5$year = tab5$year tab5$lower = round(tab5$lower, digits = 4) tab5$upper = round(tab5$upper, digits = 4) tab5$value = round(tab5$value, digits = 4) tab5 = unite(tab5, CI, lower, upper, sep = "-") tab5 = melt(tab5, id = c('year', 'stat')) tab5 = spread(tab5, year, value) tab5$variable = factor(tab5$variable, levels = c('value', 'CI'), labels = c('Estimate', 'CI')) tab5 = tab5 %>% select(-stat) %>% kable('latex', booktabs = T, caption = "Dekomposition - Erweitertes Model", row.names = FALSE, col.names = c("", c(2006:2017))) %>% kable_styling(latex_options = 'scale_down') %>% group_rows('Diffrence (D)', 1, 2) %>% group_rows('Endowment (X)', 3, 4) %>% group_rows('Price (P)', 5, 6) %>% footnote(general = 'EU-SILC 2005-2017, eigene Berechnungen.', footnote_as_chunk = T, general_title = "Quelle:") %>% landscape()
/reports/hun/hun_table.R
permissive
Verteilungr/ineq_project
R
false
false
7,968
r
### Table 1 tab1 = hundat %>% group_by(Variable = contract) %>% summarise('Mean East' = wtd.mean(hwage[region2 == 'East'], pb040[region2 == 'East']), 'Mean West' = wtd.mean(hwage[region2 == 'West'], pb040[region2 == 'West']), 'N' = n(), 'N(East)/N' = length(hwage[region2 == 'East']) / n()) tab1 = hundat %>% group_by(Variable = firmsize) %>% summarise('Mean East' = wtd.mean(hwage[region2 == 'East'], pb040[region2 == 'East']), 'Mean West' = wtd.mean(hwage[region2 == 'West'], pb040[region2 == 'West']), 'N' = n(), 'N(East)/N' = length(hwage[region2 == 'East']) / n()) %>% bind_rows(tab1) tab1 = hundat %>% group_by(Variable = sector) %>% summarise('Mean East' = wtd.mean(hwage[region2 == 'East'], pb040[region2 == 'East']), 'Mean West' = wtd.mean(hwage[region2 == 'West'], pb040[region2 == 'West']), 'N' = n(), 'N(East)/N' = length(hwage[region2 == 'East']) / n()) %>% bind_rows(tab1) tab1 = hundat %>% group_by(Variable = isco) %>% summarise('Mean East' = wtd.mean(hwage[region2 == 'East'], pb040[region2 == 'East']), 'Mean West' = wtd.mean(hwage[region2 == 'West'], pb040[region2 == 'West']), 'N' = n(), 'N(East)/N' = length(hwage[region2 == 'East']) / n()) %>% bind_rows(tab1) tab1 = hundat %>% group_by(Variable = urban) %>% summarise('Mean East' = wtd.mean(hwage[region2 == 'East'], pb040[region2 == 'East']), 'Mean West' = wtd.mean(hwage[region2 == 'West'], pb040[region2 == 'West']), 'N' = n(), 'N(East)/N' = length(hwage[region2 == 'East']) / n()) %>% bind_rows(tab1) tab1 = hundat %>% group_by(Variable = union) %>% summarise('Mean East' = wtd.mean(hwage[region2 == 'East'], pb040[region2 == 'East']), 'Mean West' = wtd.mean(hwage[region2 == 'West'], pb040[region2 == 'West']), 'N' = n(), 'N(East)/N' = length(hwage[region2 == 'East']) / n()) %>% bind_rows(tab1) tab1 = hundat %>% group_by(Variable = educ) %>% summarise('Mean East' = wtd.mean(hwage[region2 == 'East'], pb040[region2 == 'East']), 'Mean West' = wtd.mean(hwage[region2 == 'West'], pb040[region2 == 'West']), 'N' = n(), 'N(East)/N' = length(hwage[region2 == 'East']) / n()) %>% bind_rows(tab1) tab1 = hundat %>% group_by(Variable = female) %>% summarise('Mean East' = wtd.mean(hwage[region2 == 'East'], pb040[region2 == 'East']), 'Mean West' = wtd.mean(hwage[region2 == 'West'], pb040[region2 == 'West']), 'N' = n(), 'N(East)/N' = length(hwage[region2 == 'East']) / n()) %>% bind_rows(tab1) tab1 = kable(tab1, 'latex', caption = "Pooled Sample nach Datenfilterung und Stundenlohnunterschiede zwischen Westen und Osten", booktabs = T, escape = F, col.names = c("Variable", linebreak(c("Mean hwage\nEast", "Mean hwage\nWest"), align = "r"), "N", "N(East)/N")) %>% kable_styling(font_size = 10, full_width = F) %>% group_rows("Sex", 1, 2) %>% group_rows("Education", 3, 5) %>% group_rows("Union", 6, 7) %>% group_rows("Urbanisation", 8, 9) %>% group_rows("ISCO", 10, 11) %>% group_rows("Sector", 12, 14) %>% group_rows("Firmsize", 15, 16) %>% group_rows("Contract", 17, 18) %>% footnote(general = 'EU-SILC 2005-2017, eigene Berechnungen.', footnote_as_chunk = T, general_title = "Quelle:") ### Table 2 tab2 = indicators_p1 %>% melt(id = c('rb010', 'stat')) tab2$rb010 = tab2$rb010 tab2 = tab2 %>% spread(rb010, value) tab2$stat = factor(tab2$stat, levels = c('Mean', 'Q50', 'Gini', 'P80/P20', 'Top10')) tab2$variable = factor(tab2$variable, levels = c('pretax_factor_eq', 'pretax_nation_eq', 'posttax_disp_eq'), labels = c('Factor', 'Nation', 'Disposable')) tab2 = tab2[order(tab2$stat, tab2$variable),] tab2 = tab2 %>% select(-stat) %>% kable('latex', booktabs = T, caption = "Ungleichheitsindikatoren nach Eurostat", row.names = FALSE, col.names = c("", c(2005:2017))) %>% kable_styling(latex_options = 'scale_down') %>% group_rows("Mean", 1, 3) %>% group_rows("Median", 4, 6) %>% group_rows("Gini", 7, 9) %>% group_rows("P80/P20", 10, 12) %>% group_rows("Top10", 13, 15) %>% footnote(general = 'EU-SILC 2005-2017, eigene Berechnungen.', footnote_as_chunk = T, general_title = "Quelle:") %>% landscape() ### Table 3 tab3 = indicators_p2 %>% melt(id = c('pb010', 'stat')) tab3$pb010 = tab3$pb010 tab3 = tab3 %>% spread(pb010, value) tab3$stat = factor(tab3$stat, levels = c('Mean', 'Q50', 'Gini', 'P80/P20', 'Top10')) tab3$variable = factor(tab3$variable, levels = c('pretax_factor_20', 'pretax_nation_20', 'posttax_disp_20'), labels = c('Factor', 'Nation', 'Disposable')) tab3 = tab3[order(tab3$stat, tab3$variable),] tab3 = tab3 %>% select(-stat) %>% kable('latex', booktabs = T, caption = "Ungleichheitsindikatoren nach WID World", row.names = FALSE, col.names = c("", c(2005:2017))) %>% kable_styling(latex_options = 'scale_down') %>% group_rows("Mean", 1, 3) %>% group_rows("Median", 4, 6) %>% group_rows("Gini", 7, 9) %>% group_rows("P80/P20", 10, 12) %>% group_rows("Top10", 13, 15) %>% footnote(general = 'EU-SILC 2005-2017, eigene Berechnungen.', footnote_as_chunk = T, general_title = "Quelle:") %>% landscape() ### Table 4 tab4 = results2 tab4$year = tab4$year tab4$lower = round(tab4$lower, digits = 4) tab4$upper = round(tab4$upper, digits = 4) tab4$value = round(tab4$value, digits = 4) tab4 = unite(tab4, CI, lower, upper, sep = "-") tab4 = melt(tab4, id = c('year', 'stat')) tab4 = spread(tab4, year, value) tab4$variable = factor(tab4$variable, levels = c('value', 'CI'), labels = c('Estimate', 'CI')) tab4 = tab4 %>% select(-stat) %>% kable('latex', booktabs = T, caption = "Dekomposition - Einfaches Model", row.names = FALSE, col.names = c("", c(2006:2017))) %>% kable_styling(latex_options = 'scale_down') %>% group_rows('Diffrence (D)', 1, 2) %>% group_rows('Endowment (X)', 3, 4) %>% group_rows('Price (P)', 5, 6) %>% footnote(general = 'EU-SILC 2005-2017, eigene Berechnungen.', footnote_as_chunk = T, general_title = "Quelle:") %>% landscape() ### Table 5 tab5 = results tab5$year = tab5$year tab5$lower = round(tab5$lower, digits = 4) tab5$upper = round(tab5$upper, digits = 4) tab5$value = round(tab5$value, digits = 4) tab5 = unite(tab5, CI, lower, upper, sep = "-") tab5 = melt(tab5, id = c('year', 'stat')) tab5 = spread(tab5, year, value) tab5$variable = factor(tab5$variable, levels = c('value', 'CI'), labels = c('Estimate', 'CI')) tab5 = tab5 %>% select(-stat) %>% kable('latex', booktabs = T, caption = "Dekomposition - Erweitertes Model", row.names = FALSE, col.names = c("", c(2006:2017))) %>% kable_styling(latex_options = 'scale_down') %>% group_rows('Diffrence (D)', 1, 2) %>% group_rows('Endowment (X)', 3, 4) %>% group_rows('Price (P)', 5, 6) %>% footnote(general = 'EU-SILC 2005-2017, eigene Berechnungen.', footnote_as_chunk = T, general_title = "Quelle:") %>% landscape()
## Put comments here that give an overall description of what your ## functions do ## Write a short comment describing this function makeCacheMatrix(): <- function (x = matrix() ) { inv = NULL set = function (y) { x <<- y inv<<- NULL } get = function () x setinv = function (inverse) inv <<- inverse getinv = function() inv list(set=set, get=get, setinv=setinv, getinv=getinv) } cacheSolve <- function (x, ...) { inv=x$getinv() if (!is.null(inv)){ message("getting from cache") return(inv) } mat.data = x$get() inv = solve(mat.data, ...) x$setinv(inv) return(inv) }
/cachematrix.R
no_license
RomanJohnson/ProgrammingAssignment2
R
false
false
663
r
## Put comments here that give an overall description of what your ## functions do ## Write a short comment describing this function makeCacheMatrix(): <- function (x = matrix() ) { inv = NULL set = function (y) { x <<- y inv<<- NULL } get = function () x setinv = function (inverse) inv <<- inverse getinv = function() inv list(set=set, get=get, setinv=setinv, getinv=getinv) } cacheSolve <- function (x, ...) { inv=x$getinv() if (!is.null(inv)){ message("getting from cache") return(inv) } mat.data = x$get() inv = solve(mat.data, ...) x$setinv(inv) return(inv) }
library(MOTE) ### Name: d.dep.t.diff ### Title: d for Dependent t with SD Difference Scores Denominator ### Aliases: d.dep.t.diff ### Keywords: dependent effect size, t-test ### ** Examples #The following example is derived from the "dept_data" dataset included #in the MOTE library. #In a study to test the effects of science fiction movies on people's #belief in the supernatural, seven people completed a measure of belief #in the supernatural before and after watching a popular science fiction movie. #Higher scores indicated higher levels of belief. The mean difference score was 1.14, #while the standard deviation of the difference scores was 2.12. #You can type in the numbers directly as shown below, #or refer to your dataset within the function. d.dep.t.diff(mdiff = 1.14, sddiff = 2.12, n = 7, a = .05) d.dep.t.diff(1.14, 2.12, 7, .05) d.dep.t.diff(mdiff = mean(dept_data$before - dept_data$after), sddiff = sd(dept_data$before - dept_data$after), n = length(dept_data$before), a = .05) #The mean measure of belief on the pretest was 5.57, with a standard #deviation of 1.99. The posttest scores appeared lower (M = 4.43, SD = 2.88) #but the dependent t-test was not significant using alpha = .05, #t(7) = 1.43, p = .203, d_z = 0.54. The effect size was a medium #effect suggesting that the movie may have influenced belief #in the supernatural.
/data/genthat_extracted_code/MOTE/examples/d.dep.t.diff.Rd.R
no_license
surayaaramli/typeRrh
R
false
false
1,437
r
library(MOTE) ### Name: d.dep.t.diff ### Title: d for Dependent t with SD Difference Scores Denominator ### Aliases: d.dep.t.diff ### Keywords: dependent effect size, t-test ### ** Examples #The following example is derived from the "dept_data" dataset included #in the MOTE library. #In a study to test the effects of science fiction movies on people's #belief in the supernatural, seven people completed a measure of belief #in the supernatural before and after watching a popular science fiction movie. #Higher scores indicated higher levels of belief. The mean difference score was 1.14, #while the standard deviation of the difference scores was 2.12. #You can type in the numbers directly as shown below, #or refer to your dataset within the function. d.dep.t.diff(mdiff = 1.14, sddiff = 2.12, n = 7, a = .05) d.dep.t.diff(1.14, 2.12, 7, .05) d.dep.t.diff(mdiff = mean(dept_data$before - dept_data$after), sddiff = sd(dept_data$before - dept_data$after), n = length(dept_data$before), a = .05) #The mean measure of belief on the pretest was 5.57, with a standard #deviation of 1.99. The posttest scores appeared lower (M = 4.43, SD = 2.88) #but the dependent t-test was not significant using alpha = .05, #t(7) = 1.43, p = .203, d_z = 0.54. The effect size was a medium #effect suggesting that the movie may have influenced belief #in the supernatural.
#### Fitting YAMS to hald pike data #### # author: Kim Whoriskey and Henrik Baktoft setwd("~/Desktop/yams") rm(list=ls()) library(data.table) library(ggplot2) library(yaps) library(TMB) library(dplyr) library(gridExtra) library(mgcv) library(sp) source('yapsfunctions.R') source('issmfunctions.R') source("simtrack.R") fmf <- wesanderson::wes_palette("FantasticFox1", type = "discrete") # TMB likelihoods compile("yaps_ssm.cpp") dyn.load(dynlib("yaps_ssm")) compile("yaps_hmm.cpp") dyn.load(dynlib("yaps_hmm")) # bring in sync data to extract hydro positions sync <- readRDS('data/sync.RDS') hydros <- data.table::data.table(sync$pl$TRUE_H) colnames(hydros) <- c('hx','hy','hz') # bring in time of arrival data for model fitting (see yams_prepdata.R) toalist <- readRDS('output/toalist.RDS') # extract toa and burst interval vector toa <- toalist$toa bivec <- toalist$seq # 20,000 pings, so we have to split the data up # manually input rbi_min and _max, which are 10 and 30 for this dataset # burst interval mins and maxes rbi_min <- 10 rbi_max <- 30 ######################################################## ### run all of the mods for the pike # first split the data into five groups modidx <- rep(1:5, each=5000) # 32539 toamats <- split(data.table(toa), factor(modidx)) %>% lapply(as.matrix) bivecs <- split(bivec, factor(modidx)) # going to run models four times # have starting values for hmm at log(1), thats svhmm1 # have starting values of hmm to match ssm, ie at log(60), svhmm60 # each of these for two states and three states, m2 vs m3 # all done with a timescale of 60 # 2 states, hmm at log(1) mods <- list() for(i in 1:length(toamats)){ mods[[i]] <- tryCatch(fit_issm(inp_init = getmodinp(hydros, toamats[[i]], sdInits=1, rbi_min=rbi_min, rbi_max=rbi_max, biTable=bivecs[[i]], m = 1, b = NULL, timescale=60, dstart=60), inp_ssm = getmodinp(hydros, toamats[[i]], sdInits=1, rbi_min=rbi_min, rbi_max=rbi_max, biTable=bivecs[[i]], m=2, b = NULL, timescale=60, dstart=60), maxsteps=10, m=2, logdstart = rep(log(1), 2), # this sets the starting values of the hmm fixsteps=TRUE, allowfc=TRUE, jiggle_fc=0.01, initssmargs = list(inner_control = list(maxit=1500), mapping = list(working_A = factor(matrix(NA)))), ssmargs = list(inner_control = list(maxit=1500), mapping = list(#logD_xy = factor(c(NA, NA)), working_A = factor(matrix(NA, nrow=2, ncol=2))), optimizer='nlminb'), timescalehmm=60, setinitstatdist=1), error=function(e)e) paste('finished mod', i) } saveRDS(mods, file="output/pikemodsm2ts60svhmm1.RDS") # 2 states, hmm at log(60) mods <- list() for(i in 1:length(toamats)){ mods[[i]] <- tryCatch(fit_issm(inp_init = getmodinp(hydros, toamats[[i]], sdInits=1, rbi_min=rbi_min, rbi_max=rbi_max, biTable=bivecs[[i]], m = 1, b = NULL, timescale=60, dstart=60), inp_ssm = getmodinp(hydros, toamats[[i]], sdInits=1, rbi_min=rbi_min, rbi_max=rbi_max, biTable=bivecs[[i]], m=2, b = NULL, timescale=60, dstart=60), maxsteps=10, m=2, logdstart = rep(log(60), 2), # this sets the starting values of the hmm fixsteps=TRUE, allowfc=TRUE, jiggle_fc=0.01, initssmargs = list(inner_control = list(maxit=1500), mapping = list(working_A = factor(matrix(NA)))), ssmargs = list(inner_control = list(maxit=1500), mapping = list(#logD_xy = factor(c(NA, NA)), working_A = factor(matrix(NA, nrow=2, ncol=2))), optimizer='nlminb'), timescalehmm=60, setinitstatdist=1), error=function(e)e) paste('finished mod', i) } saveRDS(mods, file="output/pikemodsm2ts60svhmm60.RDS") # 3 states, hmm at log(1) mods <- list() for(i in 1:length(toamats)){ mods[[i]] <- tryCatch(fit_issm(inp_init = getmodinp(hydros, toamats[[i]], sdInits=1, rbi_min=rbi_min, rbi_max=rbi_max, biTable=bivecs[[i]], m = 1, b = NULL, timescale=60, dstart=60), inp_ssm = getmodinp(hydros, toamats[[i]], sdInits=1, rbi_min=rbi_min, rbi_max=rbi_max, biTable=bivecs[[i]], m=3, b = NULL, timescale=60, dstart=60), maxsteps=10, m=3, logdstart = rep(log(1), 3), # this sets the starting values of the hmm fixsteps=TRUE, allowfc=TRUE, jiggle_fc=0.01, initssmargs = list(inner_control = list(maxit=1500), mapping = list(working_A = factor(matrix(NA)))), ssmargs = list(inner_control = list(maxit=1500), mapping = list(#logD_xy = factor(c(NA, NA)), working_A = factor(matrix(NA, nrow=3, ncol=3))), optimizer='nlminb'), timescalehmm=60, setinitstatdist=1), error=function(e)e) paste('finished mod', i) } saveRDS(mods, file="output/pikemodsm3ts60svhmm1.RDS") # 3 states, hmm at log(60) mods <- list() for(i in 1:length(toamats)){ mods[[i]] <- tryCatch(fit_issm(inp_init = getmodinp(hydros, toamats[[i]], sdInits=1, rbi_min=rbi_min, rbi_max=rbi_max, biTable=bivecs[[i]], m = 1, b = NULL, timescale=60, dstart=60), inp_ssm = getmodinp(hydros, toamats[[i]], sdInits=1, rbi_min=rbi_min, rbi_max=rbi_max, biTable=bivecs[[i]], m=3, b = NULL, timescale=60, dstart=60), maxsteps=10, m=3, logdstart = rep(log(60), 3), # this sets the starting values of the hmm fixsteps=TRUE, allowfc=TRUE, jiggle_fc=0.01, initssmargs = list(inner_control = list(maxit=1500), mapping = list(working_A = factor(matrix(NA)))), ssmargs = list(inner_control = list(maxit=1500), mapping = list(#logD_xy = factor(c(NA, NA)), working_A = factor(matrix(NA, nrow=3, ncol=3))), optimizer='nlminb'), timescalehmm=60, setinitstatdist=1), error=function(e)e) paste('finished mod', i) } saveRDS(mods, file="output/pikemodsm3ts60svhmm60.RDS")
/yams_pike.R
no_license
kimwhoriskey/yams
R
false
false
8,838
r
#### Fitting YAMS to hald pike data #### # author: Kim Whoriskey and Henrik Baktoft setwd("~/Desktop/yams") rm(list=ls()) library(data.table) library(ggplot2) library(yaps) library(TMB) library(dplyr) library(gridExtra) library(mgcv) library(sp) source('yapsfunctions.R') source('issmfunctions.R') source("simtrack.R") fmf <- wesanderson::wes_palette("FantasticFox1", type = "discrete") # TMB likelihoods compile("yaps_ssm.cpp") dyn.load(dynlib("yaps_ssm")) compile("yaps_hmm.cpp") dyn.load(dynlib("yaps_hmm")) # bring in sync data to extract hydro positions sync <- readRDS('data/sync.RDS') hydros <- data.table::data.table(sync$pl$TRUE_H) colnames(hydros) <- c('hx','hy','hz') # bring in time of arrival data for model fitting (see yams_prepdata.R) toalist <- readRDS('output/toalist.RDS') # extract toa and burst interval vector toa <- toalist$toa bivec <- toalist$seq # 20,000 pings, so we have to split the data up # manually input rbi_min and _max, which are 10 and 30 for this dataset # burst interval mins and maxes rbi_min <- 10 rbi_max <- 30 ######################################################## ### run all of the mods for the pike # first split the data into five groups modidx <- rep(1:5, each=5000) # 32539 toamats <- split(data.table(toa), factor(modidx)) %>% lapply(as.matrix) bivecs <- split(bivec, factor(modidx)) # going to run models four times # have starting values for hmm at log(1), thats svhmm1 # have starting values of hmm to match ssm, ie at log(60), svhmm60 # each of these for two states and three states, m2 vs m3 # all done with a timescale of 60 # 2 states, hmm at log(1) mods <- list() for(i in 1:length(toamats)){ mods[[i]] <- tryCatch(fit_issm(inp_init = getmodinp(hydros, toamats[[i]], sdInits=1, rbi_min=rbi_min, rbi_max=rbi_max, biTable=bivecs[[i]], m = 1, b = NULL, timescale=60, dstart=60), inp_ssm = getmodinp(hydros, toamats[[i]], sdInits=1, rbi_min=rbi_min, rbi_max=rbi_max, biTable=bivecs[[i]], m=2, b = NULL, timescale=60, dstart=60), maxsteps=10, m=2, logdstart = rep(log(1), 2), # this sets the starting values of the hmm fixsteps=TRUE, allowfc=TRUE, jiggle_fc=0.01, initssmargs = list(inner_control = list(maxit=1500), mapping = list(working_A = factor(matrix(NA)))), ssmargs = list(inner_control = list(maxit=1500), mapping = list(#logD_xy = factor(c(NA, NA)), working_A = factor(matrix(NA, nrow=2, ncol=2))), optimizer='nlminb'), timescalehmm=60, setinitstatdist=1), error=function(e)e) paste('finished mod', i) } saveRDS(mods, file="output/pikemodsm2ts60svhmm1.RDS") # 2 states, hmm at log(60) mods <- list() for(i in 1:length(toamats)){ mods[[i]] <- tryCatch(fit_issm(inp_init = getmodinp(hydros, toamats[[i]], sdInits=1, rbi_min=rbi_min, rbi_max=rbi_max, biTable=bivecs[[i]], m = 1, b = NULL, timescale=60, dstart=60), inp_ssm = getmodinp(hydros, toamats[[i]], sdInits=1, rbi_min=rbi_min, rbi_max=rbi_max, biTable=bivecs[[i]], m=2, b = NULL, timescale=60, dstart=60), maxsteps=10, m=2, logdstart = rep(log(60), 2), # this sets the starting values of the hmm fixsteps=TRUE, allowfc=TRUE, jiggle_fc=0.01, initssmargs = list(inner_control = list(maxit=1500), mapping = list(working_A = factor(matrix(NA)))), ssmargs = list(inner_control = list(maxit=1500), mapping = list(#logD_xy = factor(c(NA, NA)), working_A = factor(matrix(NA, nrow=2, ncol=2))), optimizer='nlminb'), timescalehmm=60, setinitstatdist=1), error=function(e)e) paste('finished mod', i) } saveRDS(mods, file="output/pikemodsm2ts60svhmm60.RDS") # 3 states, hmm at log(1) mods <- list() for(i in 1:length(toamats)){ mods[[i]] <- tryCatch(fit_issm(inp_init = getmodinp(hydros, toamats[[i]], sdInits=1, rbi_min=rbi_min, rbi_max=rbi_max, biTable=bivecs[[i]], m = 1, b = NULL, timescale=60, dstart=60), inp_ssm = getmodinp(hydros, toamats[[i]], sdInits=1, rbi_min=rbi_min, rbi_max=rbi_max, biTable=bivecs[[i]], m=3, b = NULL, timescale=60, dstart=60), maxsteps=10, m=3, logdstart = rep(log(1), 3), # this sets the starting values of the hmm fixsteps=TRUE, allowfc=TRUE, jiggle_fc=0.01, initssmargs = list(inner_control = list(maxit=1500), mapping = list(working_A = factor(matrix(NA)))), ssmargs = list(inner_control = list(maxit=1500), mapping = list(#logD_xy = factor(c(NA, NA)), working_A = factor(matrix(NA, nrow=3, ncol=3))), optimizer='nlminb'), timescalehmm=60, setinitstatdist=1), error=function(e)e) paste('finished mod', i) } saveRDS(mods, file="output/pikemodsm3ts60svhmm1.RDS") # 3 states, hmm at log(60) mods <- list() for(i in 1:length(toamats)){ mods[[i]] <- tryCatch(fit_issm(inp_init = getmodinp(hydros, toamats[[i]], sdInits=1, rbi_min=rbi_min, rbi_max=rbi_max, biTable=bivecs[[i]], m = 1, b = NULL, timescale=60, dstart=60), inp_ssm = getmodinp(hydros, toamats[[i]], sdInits=1, rbi_min=rbi_min, rbi_max=rbi_max, biTable=bivecs[[i]], m=3, b = NULL, timescale=60, dstart=60), maxsteps=10, m=3, logdstart = rep(log(60), 3), # this sets the starting values of the hmm fixsteps=TRUE, allowfc=TRUE, jiggle_fc=0.01, initssmargs = list(inner_control = list(maxit=1500), mapping = list(working_A = factor(matrix(NA)))), ssmargs = list(inner_control = list(maxit=1500), mapping = list(#logD_xy = factor(c(NA, NA)), working_A = factor(matrix(NA, nrow=3, ncol=3))), optimizer='nlminb'), timescalehmm=60, setinitstatdist=1), error=function(e)e) paste('finished mod', i) } saveRDS(mods, file="output/pikemodsm3ts60svhmm60.RDS")
run_CCInx <- function(path, test, clusters, species) { assertthat::assert_that(assertthat::is.dir(path)) assertthat::assert_that(assertthat::is.readable(path)) assertthat::assert_that(is.character(clusters)) fs::path(path, "INTERACTION", "CCInx") %>% fs::dir_create() species <- switch(species, mouse = "mmusculus", human = "hsapiens" ) DE_type <- "1vsAll" # check if DE_folder exist dir_exist <- fs::path(path, "DIFFERENTIAL_EXPRESSION", DE_type) %>% fs::dir_exists() if (!dir_exist) { stringr::str_c("Differential expression was not run. Please run differential expression with DE_type set to ", DE_type) %>% rlang::abort() } available_test <- fs::path(path, "DIFFERENTIAL_EXPRESSION", DE_type) %>% fs::dir_ls() %>% fs::path_file() if (!is.null(test)) { assertthat::assert_that(is.character(test)) } else { test <- available_test } if (any(!test %in% available_test)) { wrong_test <- test[!test %in% available_test] test <- setdiff(test, wrong_test) warning("The following test are not available, they will be ignored :\n", stringr::str_c(" - ", wrong_test, collapse = "\n")) } # read the different test DE_data <- purrr::map_df(test, ~ fs::path(path, "DIFFERENTIAL_EXPRESSION", DE_type, .x, paste(.x, DE_type, "markers", sep = "_"), ext = "txt") %>% readr::read_table2(col_types = test_cols_spec(.x)) %>% dplyr::select(gene, logFC, adj.P.Val, tested_cluster)) # not filtering allow information in plot on p.value # select unique rows based on genes and cluster DE_data %<>% dplyr::distinct(gene, tested_cluster, .keep_all = TRUE) # check clusters # if clusters is missing available_clust <- DE_data[["tested_cluster"]] %>% unique() %>% as.character() wrong_clust <- !all(clusters %in% available_clust) if (wrong_clust) { stringr::str_c( "One or more of the specified cluster does not exist in differential analysis results.\n", "Available clusters are : ", stringr::str_c(available_clust, collapse = ",") ) %>% rlang::abort() } # make it a named list by cluster GeneStatList <- available_clust %>% purrr::set_names(., nm = .) %>% purrr::map(~ dplyr::filter(DE_data, tested_cluster == .) %>% tibble::column_to_rownames("gene")) %>% purrr::keep(names(.) %in% clusters) # only the requested cluster by the user interaction_network <- CCInx::BuildCCInx(GeneStatList, GeneMagnitude = "logFC", GeneStatistic = "adj.P.Val", Species = species) return(interaction_network) } test_cols_spec <- function(test) { if (any(c("wilcox", "bimod", "t", "poisson", "negbinom", "LR", "MAST", "roc", "DEseq2") == test)) { readr::cols( p_val = readr::col_number(), logFC = readr::col_number(), pct.1 = readr::col_number(), pct.2 = readr::col_number(), adj.P.Val = readr::col_number(), tested_cluster = readr::col_factor(), control_cluster = readr::col_factor(), gene = readr::col_character(), min.pct = readr::col_number(), cluster_conditions = readr::col_character() ) } else if (stringr::str_detect(test, "EdgeR")) { readr::cols( logFC = readr::col_number(), logCPM = readr::col_number(), F = readr::col_number(), adj.P.Val = readr::col_number(), FDR = readr::col_number(), tested_cluster = readr::col_factor(), control_cluster = readr::col_factor(), gene = readr::col_character(), min.pct = readr::col_number(), cluster_conditions = readr::col_character() ) } else if (stringr::str_detect(test, "Limma")) { readr::cols( logFC = readr::col_number(), AveExpr = readr::col_number(), t = readr::col_number(), P.Value = readr::col_number(), adj.P.Val = readr::col_number(), B = readr::col_number(), tested_cluster = readr::col_factor(), control_cluster = readr::col_factor(), gene = readr::col_character(), min.pct = readr::col_number(), cluster_conditions = readr::col_character() ) } } # path <- "/home/aurel/Nextcloud/Documents/Cours/M2_GENIOMHE/Stage/Project/NF1-MPNST/NF1-MPNST_20190212/" # # DE_type <- "1vsAll" # test <- c("t", "bimod") # as many as you want # Result visualization # library(shiny) # CCInx::ViewCCInx(test_ccinx)
/Interaction/test_CCInx.R
no_license
abeaude/M2_report
R
false
false
4,317
r
run_CCInx <- function(path, test, clusters, species) { assertthat::assert_that(assertthat::is.dir(path)) assertthat::assert_that(assertthat::is.readable(path)) assertthat::assert_that(is.character(clusters)) fs::path(path, "INTERACTION", "CCInx") %>% fs::dir_create() species <- switch(species, mouse = "mmusculus", human = "hsapiens" ) DE_type <- "1vsAll" # check if DE_folder exist dir_exist <- fs::path(path, "DIFFERENTIAL_EXPRESSION", DE_type) %>% fs::dir_exists() if (!dir_exist) { stringr::str_c("Differential expression was not run. Please run differential expression with DE_type set to ", DE_type) %>% rlang::abort() } available_test <- fs::path(path, "DIFFERENTIAL_EXPRESSION", DE_type) %>% fs::dir_ls() %>% fs::path_file() if (!is.null(test)) { assertthat::assert_that(is.character(test)) } else { test <- available_test } if (any(!test %in% available_test)) { wrong_test <- test[!test %in% available_test] test <- setdiff(test, wrong_test) warning("The following test are not available, they will be ignored :\n", stringr::str_c(" - ", wrong_test, collapse = "\n")) } # read the different test DE_data <- purrr::map_df(test, ~ fs::path(path, "DIFFERENTIAL_EXPRESSION", DE_type, .x, paste(.x, DE_type, "markers", sep = "_"), ext = "txt") %>% readr::read_table2(col_types = test_cols_spec(.x)) %>% dplyr::select(gene, logFC, adj.P.Val, tested_cluster)) # not filtering allow information in plot on p.value # select unique rows based on genes and cluster DE_data %<>% dplyr::distinct(gene, tested_cluster, .keep_all = TRUE) # check clusters # if clusters is missing available_clust <- DE_data[["tested_cluster"]] %>% unique() %>% as.character() wrong_clust <- !all(clusters %in% available_clust) if (wrong_clust) { stringr::str_c( "One or more of the specified cluster does not exist in differential analysis results.\n", "Available clusters are : ", stringr::str_c(available_clust, collapse = ",") ) %>% rlang::abort() } # make it a named list by cluster GeneStatList <- available_clust %>% purrr::set_names(., nm = .) %>% purrr::map(~ dplyr::filter(DE_data, tested_cluster == .) %>% tibble::column_to_rownames("gene")) %>% purrr::keep(names(.) %in% clusters) # only the requested cluster by the user interaction_network <- CCInx::BuildCCInx(GeneStatList, GeneMagnitude = "logFC", GeneStatistic = "adj.P.Val", Species = species) return(interaction_network) } test_cols_spec <- function(test) { if (any(c("wilcox", "bimod", "t", "poisson", "negbinom", "LR", "MAST", "roc", "DEseq2") == test)) { readr::cols( p_val = readr::col_number(), logFC = readr::col_number(), pct.1 = readr::col_number(), pct.2 = readr::col_number(), adj.P.Val = readr::col_number(), tested_cluster = readr::col_factor(), control_cluster = readr::col_factor(), gene = readr::col_character(), min.pct = readr::col_number(), cluster_conditions = readr::col_character() ) } else if (stringr::str_detect(test, "EdgeR")) { readr::cols( logFC = readr::col_number(), logCPM = readr::col_number(), F = readr::col_number(), adj.P.Val = readr::col_number(), FDR = readr::col_number(), tested_cluster = readr::col_factor(), control_cluster = readr::col_factor(), gene = readr::col_character(), min.pct = readr::col_number(), cluster_conditions = readr::col_character() ) } else if (stringr::str_detect(test, "Limma")) { readr::cols( logFC = readr::col_number(), AveExpr = readr::col_number(), t = readr::col_number(), P.Value = readr::col_number(), adj.P.Val = readr::col_number(), B = readr::col_number(), tested_cluster = readr::col_factor(), control_cluster = readr::col_factor(), gene = readr::col_character(), min.pct = readr::col_number(), cluster_conditions = readr::col_character() ) } } # path <- "/home/aurel/Nextcloud/Documents/Cours/M2_GENIOMHE/Stage/Project/NF1-MPNST/NF1-MPNST_20190212/" # # DE_type <- "1vsAll" # test <- c("t", "bimod") # as many as you want # Result visualization # library(shiny) # CCInx::ViewCCInx(test_ccinx)
library(shiny) library(ggplot2) plotAreaT <- function(section = "upper", q1 = -1.5, label.quantiles=TRUE, dist = "T", xlab=" ") { require(ggplot2) x <- seq(-4, 4, by = 0.01) df <- 10 data <- data.frame(x = x, density = dt(x, df)) p <- ggplot(data, aes(x, y=density)) + geom_line() + xlab(xlab) quantile1 <- annotate("text", label = paste("t* =", q1), x = q1, y = 0, size = 8, colour = "black") quantile2 <- NULL if (section == "upper") { section <- subset(data, x > q1) area <- pt(q1, df, lower.tail = FALSE) p_value <- annotate("text", label = paste("P(", toupper(dist), ">", q1, ") = ", round(area, 4)), x = 2.9, y = 0.3, size = 8, colour = "black") } else if (section == "lower") { section <- subset(data, x < q1) area <- pt(q1, df) p_value <- annotate("text", label = paste("P(", toupper(dist), "<", q1, ") = ", round(area, 4)), x = 2.9, y = 0.3, size = 8, colour = "black") } else if (section == "both"){ section1 <- subset(data, x > abs(q1)) p <- p + geom_ribbon(data=section1, aes(ymin=0, ymax=density, fill="blue", alpha=.4)) section <- subset(data, x < -abs(q1)) area <- pt(abs(q1), df, lower.tail = FALSE) + pt(-abs(q1), df) p_value <- annotate("text", label = paste("2*P(", toupper(dist), ">", abs(q1), ") = ", round(area, 4)), x = 2.9, y = 0.3, size = 8, colour = "black") quantile2 <- annotate("text", label = paste("t* =", -q1), x = -q1, y = 0, size = 8, colour = "black") } p + p_value + quantile1 + quantile2 + #geom_vline(xintercept = 0, color = "blue") + annotate("text", label = "0", x = 0, y = 0, size = 5) + geom_ribbon(data=section, aes(ymin=0, ymax=density, fill="blue", alpha=.4))+theme(legend.position = "none") } shinyServer(function(input, output, session) { output$plot1 <- renderPlot({ #Koshke is the man -- http://stackoverflow.com/questions/14313285/ggplot2-theme-with-no-axes-or-grid library(grid) p <- plotAreaT(section=input$type, q1=input$q1) p <- p + theme(line = element_blank(), text = element_blank(), title = element_blank()) gt <- ggplot_gtable(ggplot_build(p)) ge <- subset(gt$layout, name == "panel") print(grid.draw(gt[ge$t:ge$b, ge$l:ge$r])) }) })
/repos/apps-master/shiny/apps/testing/server.R
permissive
babiato/flaskapp1
R
false
false
2,368
r
library(shiny) library(ggplot2) plotAreaT <- function(section = "upper", q1 = -1.5, label.quantiles=TRUE, dist = "T", xlab=" ") { require(ggplot2) x <- seq(-4, 4, by = 0.01) df <- 10 data <- data.frame(x = x, density = dt(x, df)) p <- ggplot(data, aes(x, y=density)) + geom_line() + xlab(xlab) quantile1 <- annotate("text", label = paste("t* =", q1), x = q1, y = 0, size = 8, colour = "black") quantile2 <- NULL if (section == "upper") { section <- subset(data, x > q1) area <- pt(q1, df, lower.tail = FALSE) p_value <- annotate("text", label = paste("P(", toupper(dist), ">", q1, ") = ", round(area, 4)), x = 2.9, y = 0.3, size = 8, colour = "black") } else if (section == "lower") { section <- subset(data, x < q1) area <- pt(q1, df) p_value <- annotate("text", label = paste("P(", toupper(dist), "<", q1, ") = ", round(area, 4)), x = 2.9, y = 0.3, size = 8, colour = "black") } else if (section == "both"){ section1 <- subset(data, x > abs(q1)) p <- p + geom_ribbon(data=section1, aes(ymin=0, ymax=density, fill="blue", alpha=.4)) section <- subset(data, x < -abs(q1)) area <- pt(abs(q1), df, lower.tail = FALSE) + pt(-abs(q1), df) p_value <- annotate("text", label = paste("2*P(", toupper(dist), ">", abs(q1), ") = ", round(area, 4)), x = 2.9, y = 0.3, size = 8, colour = "black") quantile2 <- annotate("text", label = paste("t* =", -q1), x = -q1, y = 0, size = 8, colour = "black") } p + p_value + quantile1 + quantile2 + #geom_vline(xintercept = 0, color = "blue") + annotate("text", label = "0", x = 0, y = 0, size = 5) + geom_ribbon(data=section, aes(ymin=0, ymax=density, fill="blue", alpha=.4))+theme(legend.position = "none") } shinyServer(function(input, output, session) { output$plot1 <- renderPlot({ #Koshke is the man -- http://stackoverflow.com/questions/14313285/ggplot2-theme-with-no-axes-or-grid library(grid) p <- plotAreaT(section=input$type, q1=input$q1) p <- p + theme(line = element_blank(), text = element_blank(), title = element_blank()) gt <- ggplot_gtable(ggplot_build(p)) ge <- subset(gt$layout, name == "panel") print(grid.draw(gt[ge$t:ge$b, ge$l:ge$r])) }) })
% Generated by roxygen2 (4.0.1): do not edit by hand \name{create_file_structure} \alias{create_file_structure} \alias{within_file_structure} \title{Create a file structure for tests.} \usage{ create_file_structure(files, expr, dir) within_file_structure(files, expr, dir) } \arguments{ \item{files}{character or list or NULL. A nested file structure. The names of the list will decide the names of the files, and the terminal nodes should be strings which will populate the file bodies. One can also specify a character (for example, \code{files = c('a','b','c')} will create three files with those filenames). By default, \code{files = NULL} in which case simply an empty directory will be created.} \item{expr}{expression. An expression to evaluate within which the files should exist, but outside of which the files should be unlinked. If missing, the directory of the will be returned. Otherwise, the value obtained in this expression will be returned.} \item{dir}{character. The directory in which to create the files. If missing, a temporary directory will be created instead using the built-in \code{tempfile()} helper.} } \value{ the directory in which this file structure exists, if \code{expr} is not missing. If \code{expr} was provided, its return value will be returned instead. } \description{ A helper function for creating hierarchical file structures when, e.g., testing functions which rely on presence of files. An alias for create_file_structure that only allows expressions. } \details{ For example, when files need to be present for a function we are testing, it would be very cumbersome to create these files manually. Instead, we can do the following: \code{test_dir <- create_file_structure(list(dir1 = list('file1', file2.r = 'print("Sample R code")'), file3.csv = "a,b,c\n1,2,3"))} with the return value being a test directory containing these structured files. An additional feature is that expressions can be evaluated within the scope of the hierarchical files existing, with the files getting deleted after the expression executes: \code{create_file_structure(list(a = "hello\nworld"), cat(readLines(file.path(tempdir, 'a'))[[2]]))} The above will print \code{"world"}. (\code{tempdir} is set automatically within the scope of the expression to the directory that was created for the temporary files.) } \examples{ \dontrun{ library(testthat) test_dir <- create_file_structure(list(test = 'blah', 'test2')) # Now test_dir is the location of a directory containing a file 'test' # with the string 'blah' and an empty file 'test2'. test_dir <- create_file_structure(list(alphabet = as.list(LETTERS))) # Now test_dir is the location of a directory containing a subdirectory # 'alphabet' with the files 'A', 'B', ..., 'Z' (all empty). test_dir <- create_file_structure(list(a = 'hello'), { cat(readLines(file.path(tempdir, 'a'))) }) } library(testthat) expect_output(within_file_structure(list(a = 'hello'), { cat(readLines(file.path(tempdir, 'a'))) }), 'hello') # The above will create a directory with a file named "a" containing the string # 'hello', print it by reading the file, and then unlink the directory. }
/man/create_file_structure.Rd
no_license
arturochian/testthatsomemore
R
false
false
3,192
rd
% Generated by roxygen2 (4.0.1): do not edit by hand \name{create_file_structure} \alias{create_file_structure} \alias{within_file_structure} \title{Create a file structure for tests.} \usage{ create_file_structure(files, expr, dir) within_file_structure(files, expr, dir) } \arguments{ \item{files}{character or list or NULL. A nested file structure. The names of the list will decide the names of the files, and the terminal nodes should be strings which will populate the file bodies. One can also specify a character (for example, \code{files = c('a','b','c')} will create three files with those filenames). By default, \code{files = NULL} in which case simply an empty directory will be created.} \item{expr}{expression. An expression to evaluate within which the files should exist, but outside of which the files should be unlinked. If missing, the directory of the will be returned. Otherwise, the value obtained in this expression will be returned.} \item{dir}{character. The directory in which to create the files. If missing, a temporary directory will be created instead using the built-in \code{tempfile()} helper.} } \value{ the directory in which this file structure exists, if \code{expr} is not missing. If \code{expr} was provided, its return value will be returned instead. } \description{ A helper function for creating hierarchical file structures when, e.g., testing functions which rely on presence of files. An alias for create_file_structure that only allows expressions. } \details{ For example, when files need to be present for a function we are testing, it would be very cumbersome to create these files manually. Instead, we can do the following: \code{test_dir <- create_file_structure(list(dir1 = list('file1', file2.r = 'print("Sample R code")'), file3.csv = "a,b,c\n1,2,3"))} with the return value being a test directory containing these structured files. An additional feature is that expressions can be evaluated within the scope of the hierarchical files existing, with the files getting deleted after the expression executes: \code{create_file_structure(list(a = "hello\nworld"), cat(readLines(file.path(tempdir, 'a'))[[2]]))} The above will print \code{"world"}. (\code{tempdir} is set automatically within the scope of the expression to the directory that was created for the temporary files.) } \examples{ \dontrun{ library(testthat) test_dir <- create_file_structure(list(test = 'blah', 'test2')) # Now test_dir is the location of a directory containing a file 'test' # with the string 'blah' and an empty file 'test2'. test_dir <- create_file_structure(list(alphabet = as.list(LETTERS))) # Now test_dir is the location of a directory containing a subdirectory # 'alphabet' with the files 'A', 'B', ..., 'Z' (all empty). test_dir <- create_file_structure(list(a = 'hello'), { cat(readLines(file.path(tempdir, 'a'))) }) } library(testthat) expect_output(within_file_structure(list(a = 'hello'), { cat(readLines(file.path(tempdir, 'a'))) }), 'hello') # The above will create a directory with a file named "a" containing the string # 'hello', print it by reading the file, and then unlink the directory. }
### Yule-Walker method yule_walker_algorithm_given_acvs <- function(acvs, p=length(acvs)-1) { blpc <- vector(mode="list", length=p) phis <- acvs[2]/acvs[1] pev <- rep(acvs[1],p+1) blpc[[1]] <- phis pacs <- rep(phis,p) pev[2] <- pev[1]*(1-phis^2) if(p > 1) { for(k in 2:p) { old_phis <- phis phis <- rep(0,k) ## compute kth order pacs (reflection coefficient) phis[k] <- (acvs[k+1] - sum(old_phis*acvs[k:2]))/pev[k] phis[1:(k-1)] <- old_phis - phis[k]*rev(old_phis) blpc[[k]] <- phis pacs[k] <- phis[k] pev[k+1] <- pev[k]*(1-phis[k]^2) } } return(list(coeffs=phis, innov_var=pev[p+1], pev=pev,pacs=pacs, blpc=blpc)) }
/R-code/yule_walker_algorithm_given_acvs.R
no_license
dmn001/sauts
R
false
false
828
r
### Yule-Walker method yule_walker_algorithm_given_acvs <- function(acvs, p=length(acvs)-1) { blpc <- vector(mode="list", length=p) phis <- acvs[2]/acvs[1] pev <- rep(acvs[1],p+1) blpc[[1]] <- phis pacs <- rep(phis,p) pev[2] <- pev[1]*(1-phis^2) if(p > 1) { for(k in 2:p) { old_phis <- phis phis <- rep(0,k) ## compute kth order pacs (reflection coefficient) phis[k] <- (acvs[k+1] - sum(old_phis*acvs[k:2]))/pev[k] phis[1:(k-1)] <- old_phis - phis[k]*rev(old_phis) blpc[[k]] <- phis pacs[k] <- phis[k] pev[k+1] <- pev[k]*(1-phis[k]^2) } } return(list(coeffs=phis, innov_var=pev[p+1], pev=pev,pacs=pacs, blpc=blpc)) }
# CMort LA Pollution and Temperature Study # ARIMA 1 MLR with Cor Errors (no lag, no seasonl categorical variable) #EDA library(tidyverse) library(GGally) library(astsa) library(tswge) CM = read.csv(file.choose(),header = TRUE) head(CM) ggpairs(CM[2:4]) #matrix of scatter plots #forecast Particles plotts.sample.wge(CM$part) #freq near .0192 (annual) CM_52 = artrans.wge(CM$part, c(rep(0,51),1)) plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(2,1) assume stationary aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval #FTR Ho ljung.wge(CM_52, K = 48)$pval #FTR Ho #Going with white noise despite peak at 0 in Spec D. #est = est.arma.wge(CM_52, p = 3, q = 2) #CM_52_AR2_MA1 = artrans.wge(CM_52,est$phi) predsPart = fore.aruma.wge(CM$part,s = 52, n.ahead = 20) plot(predsPart$f, type = "l") plot(seq(1,508,1), CM$part, type = "l",xlim = c(0,528), ylab = "Temperature", main = "20 Week Particulate Forecast") lines(seq(509,528,1), predsPart$f, type = "l", col = "red") #forecast Temp plotts.sample.wge(CM$temp) #freq near .0192 (annual) CM_52 = artrans.wge(CM$temp, c(rep(0,51),1)) plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(0,0) aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval ljung.wge(CM_52, K = 48)$pval #barely rejects acf(CM_52,lag.max = 48) # acf looks consistent with white noise predsTemp = fore.aruma.wge(CM$temp,s = 52, n.ahead = 20) plot(predsTemp$f, type = "l") plot(seq(1,508,1), CM$temp, type = "l",xlim = c(0,528), ylab = "Temperature", main = "20 Week Temperature Forecast") lines(seq(509,528,1), predsTemp$f, type = "l", col = "red") # Model cmort based on predicted part and temp using MLR with Cor Erros #assuming data is loaded in dataframe CM ksfit = lm(cmort~temp+part+Week, data = CM) phi = aic.wge(ksfit$residuals) #AR(2) fit = arima(CM$cmort, order = c(phi$p,0,phi$q), seasonal = list(order = c(1,0,0), period = 52), xreg = cbind(CM$temp, CM$part, CM$Week)) # Check for whiteness of residuals acf(fit$residuals) ljung.wge(fit$residuals) # pval = .059 ljung.wge(fit$residuals, K = 48) # pval = .004 #load the forecasted Part and Temp in a data frame next20 = data.frame(temp = predsTemp$f, part = predsPart$f, Week = seq(509,528,1)) #get predictions predsCMort = predict(fit,newxreg = next20) #plot next 20 cmort wrt time plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), predsCMort$pred, type = "l", col = "red") #Find ASE Need to forecast last 30 of known series. CMsmall = CM[1:478,] ksfit = lm(cmort~temp+part+Week, data = CMsmall) phi = aic.wge(ksfit$residuals) fit = arima(CMsmall$cmort,order = c(phi$p,0,0), seasonal = list(order = c(1,0,0), period = 52), xreg = cbind(CMsmall$temp, CMsmall$part, CMsmall$Week)) last30 = data.frame(temp = CM$temp[479:508], part = CM$part[479:508], CMWeek = seq(479,508,1)) #get predictions predsCMort = predict(fit,newxreg = last30) ASE = mean((CM$cmort[479:508] - predsCMort$pred)^2) ASE plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "Last 30 Week Cardiac Mortality Forecast") lines(seq(479,508,1), predsCMort$pred, type = "l", col = "red") #Find ASE Need to forecast last 30 of known series. With temp lag 1 CMsmall = CM[1:478,] CMsmall$temp_1 = dplyr::lag(CMsmall$temp,1) CM$temp_1 = dplyr::lag(CM$temp,1) ksfit = lm(cmort~temp_1+part+Week, data = CMsmall) phi = aic.wge(ksfit$residuals) fit = arima(CMsmall$cmort,order = c(phi$p,0,0), seasonal = list(order = c(1,0,0), period = 52), xreg = cbind(CMsmall$temp, CMsmall$part, CMsmall$Week)) last30 = data.frame(temp = CM$temp_1[479:508], part = CM$part[479:508], Week = seq(479,508,1)) #get predictions predsCMort = predict(fit,newxreg = last30) plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "Last 30 Week Cardiac Mortality Forecast") lines(seq(479,508,1), predsCMort$pred, type = "l", col = "red") ASE = mean((CM$cmort[479:508] - predsCMort$pred)^2) ASE ###################################################################### #ARIMA 2: attempt at categorical variable for week but arima takes only continuous variables CM = read.csv(file.choose(),header = TRUE) head(CM) #forecast Particles px = plotts.sample.wge(CM$part) #freq near .0192 (annual) CM_52 = artrans.wge(CM$part, c(rep(0,51),1)) px = plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(2,1) assume stationary aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval #FTR Ho ljung.wge(CM_52, K = 48)$pval #FTR Ho #Going with white noise despite peak at 0 in Spec D. #est = est.arma.wge(CM_52, p = 3, q = 2) #CM_52_AR2_MA1 = artrans.wge(CM_52,est$phi) predsPart = fore.aruma.wge(CM$part,s = 52, n.ahead = 20) #forecast Temp px = plotts.sample.wge(CM$temp) #freq near .0192 (annual) CM_52 = artrans.wge(CM$temp, c(rep(0,51),1)) px = plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(0,0) aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval ljung.wge(CM_52, K = 48)$pval #barely rejects acf(CM_52,lag.max = 48) # acf looks consistent with white noise predsTemp = fore.aruma.wge(CM$temp,s = 52, n.ahead = 20) # Model cmort based on predicted part and temp using MLR with Cor Erros #assuming data is loaded in dataframe CM CM$FWeek = as.factor(CM$Week%%52) form = ~ . # Since we are using all variables in the dataframe form = ~ cmort+temp+part+Week+FWeek # or explicitly add variables to use CMexpanded = model.matrix(form, data = CM) %>% as_tibble() %>% dplyr::select(-"(Intercept)") # colnames(CMexpanded) ksfit = lm(cmort~., data = CMexpanded) summary(ksfit) ## Evaluate Residuals px = tswge::plotts.sample.wge(ksfit$residuals) ## Looks stationary AR(1) ,ay be appropriate aic_resids = aic.wge(ksfit$residuals) # Picks AR(2) print(aic_resids) fit = arima(CMexpanded$cmort,order = c(aic_resids$p,0,aic_resids$q), xreg = CMexpanded %>% dplyr::select(-cmort)) print(fit) AIC(fit) #AIC = 3088.997 # Check for whiteness of residuals acf(fit$residuals) ljung.wge(fit$residuals) # pval = .0808 ljung.wge(fit$residuals, K = 48) # pval = 0.123916 #load the forecasted Part and Temp in a data frame next20 = data.frame(temp = predsTemp$f, part = predsPart$f, Week = seq(509,528,1), FWeek = factor(seq(509,528,1)%%52, levels = levels(CM$FWeek))) form = ~ temp + part + Week + FWeek # Remove the dependent variable 'cmort' next20expanded = model.matrix(form, data = next20) %>% as_tibble() %>% dplyr::select(-"(Intercept)") # colnames(next20expanded) #get predictions predsCMort = predict(fit,newxreg = next20expanded) #creates error because of factor #plot next 20 cmort wrt time plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), predsCMort$pred, type = "l", col = "red") ##################################### #predict residuals manually plotts.sample.wge(ksfit$residuals) phi = aic.wge(ksfit$residuals) resids = fore.arma.wge(ksfit$residuals,phi = phi$phi,n.ahead = 20) #predict trend manually preds = predict(ksfit, newdata = next20) predsFinal = preds + resids$f #plot next 20 cmort wrt time plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), predsFinal, type = "l", col = "red") #Find ASE Need to forecast last 30 of known series. CMsmall = CM[1:478,] ksfit = lm(cmort~temp+part+Week+FWeek, data = CMsmall) phi = aic.wge(ksfit$residuals) fit = arima(CMsmall$cmort,order = c(phi$p,0,0), seasonal = list(order = c(1,0,0), period = 52), xreg = cbind(CMsmall$temp, CMsmall$part, CMsmall$Week, CMsmall$FWeek)) AIC(fit) #AIC = 2972 # This is actually cheating. We should forecast the temp and part as before. last30 = data.frame(temp = CM$temp[479:508], part = CM$part[479:508], Week = seq(479,508,1), FWeek = as.factor(seq(479,508,1)%%52)) #get predictions predsCMort = predict(fit,newxreg = last30) #predict residuals manually plotts.sample.wge(ksfit$residuals) phi = aic.wge(ksfit$residuals) resids = fore.arma.wge(ksfit$residuals,phi = phi$phi,n.ahead = 30) #predict trend manually preds = predict(ksfit, newdata = last30) predsFinal = preds + resids$f plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(479,508,1), predsFinal, type = "l", col = "red") ASE = mean((CM$cmort[479:508] - predsFinal)^2,na.rm = TRUE) ASE #ARIMA 3: categorical variable #With Lagged Temp library(dplyr) #Lag Temperature 1 ccf(CM$temp,CM$cmort) CM$temp1 = dplyr::lag(CM$temp,1) #forecast Particles plotts.sample.wge(CM$part) #freq near .0192 (annual) CM_52 = artrans.wge(CM$part, c(rep(0,51),1)) plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(2,1) assume stationary aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval #FTR Ho ljung.wge(CM_52, K = 48)$pval #FTR Ho #Going with white noise despite peak at 0 in Spec D. #est = est.arma.wge(CM_52, p = 3, q = 2) #CM_52_AR2_MA1 = artrans.wge(CM_52,est$phi) predsPart = fore.aruma.wge(CM$part,s = 52, n.ahead = 20) #forecast Temp plotts.sample.wge(CM$temp) #freq near .0192 (annual) CM_52 = artrans.wge(CM$temp, c(rep(0,51),1)) plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(0,0) aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval ljung.wge(CM_52, K = 48)$pval #barely rejects acf(CM_52,lag.max = 48) # acf looks consistent with white noise predsTemp = fore.aruma.wge(CM$temp,s = 52, n.ahead = 20) # Model cmort based on predicted part and temp using MLR with Cor Erros #assuming data is loaded in dataframe CM CM$FWeek = as.factor(CM$Week%%52) ksfit = lm(cmort~temp1+part+Week+FWeek, data = CM) phi = aic.wge(ksfit$residuals) fit = arima(CM$cmort,order = c(phi$p,0,0), xreg = cbind(CM$temp1, CM$part, CM$Week, CM$FWeek)) AIC(fit) #AIC = 3151 # Check for whiteness of residuals acf(fit$residuals) ljung.wge(fit$residuals) # pval = .066 ljung.wge(fit$residuals, K = 48) # pval = .0058 predsTemp$f1 = dplyr::lag(predsTemp$f,1) #load the forecasted Part and Temp in a data frame next20 = data.frame(temp1 = predsTemp$f1, part = predsPart$f, Week = seq(509,528,1), FWeek = as.factor(seq(509,528,1)%%52)) #get predictions predsCMort = predict(fit,newxreg = next20) #creates error because of factor #predict residuals manually plotts.sample.wge(ksfit$residuals) phi = aic.wge(ksfit$residuals) resids = fore.arma.wge(ksfit$residuals,phi = phi$phi,n.ahead = 20) #predict trend manually preds = predict(ksfit, newdata = next20) predsFinal = preds + resids$f #plot next 20 cmort wrt time plot(seq(1,508,1), cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), predsFinal, type = "l", col = "red") #Find ASE Need to forecast last 30 of known series. CMsmall = CM[2:478,] ksfit = lm(cmort~temp1+part+Week+FWeek, data = CMsmall) phi = aic.wge(ksfit$residuals) fit = arima(CMsmall$cmort,order = c(phi$p,0,0), seasonal = list(order = c(1,0,0), period = 52), xreg = cbind(CMsmall$temp1, CMsmall$part, CMsmall$Week, CMsmall$FWeek)) last30 = data.frame(temp1 = CM$temp1[479:508], part = CM$part[479:508], Week = seq(479,508,1), FWeek = as.factor(seq(479,508,1)%%52)) #get predictions predsCMort = predict(fit,newxreg = last30) #Showing Error ... why we have to predict resids manually (next step) #predict residuals manually plotts.sample.wge(ksfit$residuals) phi = aic.wge(ksfit$residuals) resids = fore.arma.wge(ksfit$residuals,phi = phi$phi,n.ahead = 30) #predict trend manually preds = predict(ksfit, newdata = last30) predsFinal = preds + resids$f plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(479,508,1), predsFinal, type = "l", col = "red") ASE = mean((CM$cmort[479:508] - predsFinal)^2,na.rm = TRUE) ASE #ARIMA 4: categorical variable #With Lagged Temp and Part library(dplyr) #Lag Temperature 1 ccf(CM$temp,CM$cmort) CM$temp1 = dplyr::lag(CM$temp,1) #Lag Particles lag 7 on particles ccf(CM$part,CM$cmort) CM$part7 = dplyr::lag(CM$temp,7) #forecast Particles plotts.sample.wge(CM$part) #freq near .0192 (annual) CM_52 = artrans.wge(CM$part, c(rep(0,51),1)) plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(2,1) assume stationary aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval #FTR Ho ljung.wge(CM_52, K = 48)$pval #FTR Ho #Going with white noise despite peak at 0 in Spec D. #est = est.arma.wge(CM_52, p = 3, q = 2) #CM_52_AR2_MA1 = artrans.wge(CM_52,est$phi) predsPart = fore.aruma.wge(CM$part,s = 52, n.ahead = 20) #forecast Temp plotts.sample.wge(CM$temp) #freq near .0192 (annual) CM_52 = artrans.wge(CM$temp, c(rep(0,51),1)) plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(0,0) aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval ljung.wge(CM_52, K = 48)$pval #barely rejects acf(CM_52,lag.max = 48) # acf looks consistent with white noise predsTemp = fore.aruma.wge(CM$temp,s = 52, n.ahead = 20) # Model cmort based on predicted part and temp using MLR with Cor Erros #assuming data is loaded in dataframe CM CM$FWeek = as.factor(CM$Week%%52) ksfit = lm(cmort~temp1+part7+Week+FWeek, data = CM) AIC(ksfit) phi = aic.wge(ksfit$residuals) fit = arima(CM$cmort,order = c(phi$p,0,0), xreg = cbind(CM$temp1, CM$part7, CM$Week, CM$FWeek)) AIC(fit) #AIC = 3151 # Check for whiteness of residuals acf(fit$residuals) ljung.wge(fit$residuals) # pval = .066 ljung.wge(fit$residuals, K = 48) # pval = .0058 predsTemp$f1 = dplyr::lag(predsTemp$f,1) predsPart$f1 = dplyr::lag(predsPart$f,7) #load the forecasted Part and Temp in a data frame next20 = data.frame(temp1 = predsTemp$f1, part = predsPart7$f, Week = seq(509,528,1), FWeek = as.factor(seq(509,528,1)%%52)) #get predictions predsCMort = predict(fit,newxreg = next20) #creates error because of factor #predict residuals manually plotts.sample.wge(ksfit$residuals) phi = aic.wge(ksfit$residuals) resids = fore.arma.wge(ksfit$residuals,phi = phi$phi,n.ahead = 20) #predict trend manually preds = predict(ksfit, newdata = next20) predsFinal = preds + resids$f #plot next 20 cmort wrt time plot(seq(1,508,1), cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), predsFinal, type = "l", col = "red") ####### ASE ####### #Find ASE Need to forecast last 30 of known series. CMsmall = CM[2:478,] ksfit = lm(cmort~temp1+part7+Week+FWeek, data = CMsmall) summary(ksfit) AIC(ksfit) phi = aic.wge(ksfit$residuals) fit = arima(CMsmall$cmort,order = c(phi$p,0,0), seasonal = list(order = c(1,0,0), period = 52), xreg = cbind(CMsmall$temp1, CMsmall$part7, CMsmall$Week, CMsmall$FWeek)) AIC(fit) last30 = data.frame(temp1 = CM$temp1[479:508], part7 = CM$part7[479:508], Week = seq(479,508,1), FWeek = as.factor(seq(479,508,1)%%52)) #get predictions predsCMort = predict(fit,newxreg = last30) #Showing Error ... why we have to predict resids manually (next step) #predict residuals manually plotts.sample.wge(ksfit$residuals) phi = aic.wge(ksfit$residuals) resids = fore.arma.wge(ksfit$residuals,phi = phi$phi,n.ahead = 30) #predict trend manually preds = predict(ksfit, newdata = last30) predsFinal = preds + resids$f plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(479,508,1), predsFinal, type = "l", col = "red") ASE = mean((CM$cmort[479:508] - predsFinal)^2,na.rm = TRUE) ASE ############ VAR MODELS ########################## #VAR Model 1 Forecasts Seasonally Differenced Data #Difference all series to make them stationary (assumptoin of VAR) # Doesn't have to be white... just stationary library(vars) CM = read.csv(file.choose(),header = TRUE) CM_52 = artrans.wge(CM$cmort,c(rep(0,51),1)) Part_52 = artrans.wge(CM$part,c(rep(0,51),1)) Temp_52 = artrans.wge(CM$temp,c(rep(0,51),1)) #VARSelect on Differenced Data chooses 2 VARselect(cbind(CM_52, Part_52, Temp_52),lag.max = 10, type = "both") #VAR with p = 2 CMortDiffVAR = VAR(cbind(CM_52, Part_52, Temp_52),type = "both",p = 2) preds=predict(CMortDiffVAR,n.ahead=20) #We have predicted differences .... calculate actual cardiac mortalities startingPoints = CM$cmort[456:475] CMortForcasts = preds$fcst$CM_52[,1:3] + startingPoints #Plot dev.off() plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), as.data.frame(CMortForcasts)$fcst, type = "l", col = "red") #Find ASE using last 30 CM_52 = artrans.wge(CMsmall$cmort,c(rep(0,51),1)) Part_52 = artrans.wge(CMsmall$part,c(rep(0,51),1)) Temp_52 = artrans.wge(CMsmall$temp,c(rep(0,51),1)) VARselect(cbind(CM_52, Part_52, Temp_52),lag.max = 10, type = "both") CMortDiffVAR = VAR(cbind(CM_52, Part_52, Temp_52),type = "both",p = 2) preds=predict(CMortDiffVAR,n.ahead=30) startingPoints = CM$cmort[428:457] CMortForcasts = preds$fcst$CM_52[,1:3] + startingPoints dev.off() plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,508), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(479,508,1), CMortForcasts[,1], type = "l", col = "red") ASE = mean((CM$cmort[479:508] - CMortForcasts[,1])^2) ASE #Find ASE using last 52 CMsmall = CM[1:456,] # 456 = 508-52 CM_52 = artrans.wge(CMsmall$cmort,c(rep(0,51),1)) Part_52 = artrans.wge(CMsmall$part,c(rep(0,51),1)) Temp_52 = artrans.wge(CMsmall$temp,c(rep(0,51),1)) VARselect(cbind(CM_52, Part_52, Temp_52),lag.max = 10, type = "both") CMortDiffVAR = VAR(cbind(CM_52, Part_52, Temp_52),type = "both",p = 2) preds=predict(CMortDiffVAR,n.ahead=52) startingPoints = CM$cmort[405:456] CMortForcasts = preds$fcst$CM_52[,1:3] + startingPoints dev.off() plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,508), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(457,508,1), CMortForcasts[,1], type = "l", col = "red") ASE = mean((CM$cmort[457:508] - CMortForcasts[,1])^2) ASE #VAR Model 2 Forecasts Seasonal Dummy CM = read.csv(file.choose(),header = TRUE) #VARSelect on Seasonal Data chooses 2 VARselect(cbind(CM$cmort, CM$part, CM$temp),lag.max = 10, season = 52, type = "both") #VAR with p = 2 CMortVAR = VAR(cbind(CM$cmort, CM$part, CM$temp),season = 52, type = "both",p = 2) preds=predict(CMortVAR,n.ahead=20) #Plot plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), preds$fcst$y1[,1], type = "l", col = "red") #Find ASE using last 30 CMsmall = CM[1:478,] VARselect(cbind(CMsmall$cmort, CMsmall$part, CMsmall$temp),lag.max = 10, season = 52, type = "both") CMortVAR = VAR(cbind(CMsmall$cmort, CMsmall$part, CMsmall$temp),season = 52, type = "both",p = 2) preds=predict(CMortVAR,n.ahead=30) #Plot plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,508), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(479,508,1), preds$fcst$y1[,1], type = "l", col = "red") ASE = mean((CM$cmort[479:508] - preds$fcst$y1[,1])^2) ASE #Find ASE using last 52 CMsmall = CM[1:456,] # 456 = 508-52 VARselect(cbind(CMsmall$cmort[2:456], CMsmall$part[2:456], CMsmall$temp[2:456]),lag.max = 10, season = 52, type = "both") CMortVAR = VAR(cbind(CMsmall$cmort[2:456], CMsmall$part[2:456], CMsmall$temp[2:456]),season = 52, type = "both",p = 2) preds=predict(CMortVAR,n.ahead=52) #Plot plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,508), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(457,508,1), preds$fcst$y1[,1], type = "l", col = "red") ASE = mean((CM$cmort[457:508] - preds$fcst$y1[,1])^2) ASE #VAR Model 3 seasonal with Lag 1 Temp CM = read.csv(file.choose(),header = TRUE) CM$temp_1 = dplyr::lag(CM$temp,1) ggpairs(CM[,-7]) VARselect(cbind(CM$cmort[2:479], CM$part[2:479], CM$temp_1[2:479]),lag.max = 10, season = 52, type = "both") #VAR with p = 2 CMortVAR = VAR(cbind(CM$cmort[2:479], CM$part[2:479], CM$temp_1[2:479]),season = 52, type = "both",p = 2) preds=predict(CMortVAR,n.ahead=20) #Plot plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), preds$fcst$y1[,1], type = "l", col = "red") #Find ASE using last 30 CMsmall = CM[1:479,] VARselect(cbind(CMsmall$cmort[2:478], CMsmall$part[2:478], CMsmall$temp_1[2:478]),lag.max = 10, season = 52, type = "both") CMortVAR = VAR(cbind(CMsmall$cmort[2:478], CMsmall$part[2:478], CMsmall$temp_1[2:478]),season = 52, type = "both",p = 2) preds=predict(CMortVAR,n.ahead=30) #Plot plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,508), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(479,508,1), preds$fcst$y1[,1], type = "l", col = "red") ASE = mean((CM$cmort[479:508] - preds$fcst$y1[,1])^2) ASE #Find ASE using last 52 CMsmall = CM[1:456,] # 456 = 508-52 VARselect(cbind(CMsmall$cmort[2:456], CMsmall$part[2:456], CMsmall$temp_1[2:456]),lag.max = 10, season = 52, type = "both") CMortVAR = VAR(cbind(CMsmall$cmort[2:456], CMsmall$part[2:456], CMsmall$temp_1[2:456]),season = 52, type = "both",p = 2) preds=predict(CMortVAR,n.ahead=52) #Plot plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,508), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(457,508,1), preds$fcst$y1[,1], type = "l", col = "red") ASE = mean((CM$cmort[457:508] - preds$fcst$y1[,1])^2) ASE #Sandbox 1 s = 52 #forecast Particles plotts.sample.wge(CM$part) #freq near .0192 (annual) CM_52 = artrans.wge(CM$part, c(rep(0,51),1)) plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(2,1) assume stationary aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval #FTR Ho ljung.wge(CM_52, K = 48)$pval #FTR Ho #Going with white noise despite peak at 0 in Spec D. #est = est.arma.wge(CM_52, p = 3, q = 2) #CM_52_AR2_MA1 = artrans.wge(CM_52,est$phi) predsPart = fore.aruma.wge(CM$part,s = 52, n.ahead = 20) #forecast Temp plotts.sample.wge(CM$temp) #freq near .0192 (annual) CM_52 = artrans.wge(CM$temp, c(rep(0,51),1)) plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(0,0) aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval ljung.wge(CM_52, K = 48)$pval #barely rejects acf(CM_52,lag.max = 48) # acf looks consistent with white noise predsTemp = fore.aruma.wge(CM$temp,s = 52, n.ahead = 20) # Model cmort based on predicted part and temp using MLR with Cor Erros #assuming data is loaded in dataframe CM ksfit = lm(cmort~temp+part+Week, data = CM) phi = aic.wge(ksfit$residuals) attach(CM) fit = arima(cmort,order = c(phi$p,0,0), seasonal = list(order = c(0,1,0), period = 52),xreg = cbind(temp, part, Week)) AIC(fit) # Check for whiteness of residuals acf(fit$residuals) ljung.wge(fit$residuals) # pval = .059 ljung.wge(fit$residuals, K = 48) # pval = .004 #load the forecasted Part and Temp in a data frame next20 = data.frame(temp = predsTemp$f, part = predsPart$f, Week = seq(509,528,1)) #get predictions predsCMort = predict(fit,newxreg = next20) #plot next 20 cmort wrt time plot(seq(1,508,1), cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), predsCMort$pred, type = "l", col = "red") # Univariate foreCmort = fore.aruma.wge(CM$cmort,s = 52, n.ahead = 30, lastn = TRUE, limits = FALSE) ASE = mean((CM$cmort[479:508] - foreCmort$f)^2) ASE # Univariate ASE 50 back foreCmort = fore.aruma.wge(CM$cmort,s = 52, n.ahead = 52, lastn = TRUE, limits = FALSE) ASE = mean((CM$cmort[457:508] - foreCmort$f)^2) ASE #Show the effect of "type = {"const", trend", "both", "none") data(Canada) VAR(Canada, p = 2, type = "const") VAR(Canada, p = 2, type = "trend") VAR(Canada, p = 2, type = "both") VAR(Canada, p = 2, type = "none") VAR(cbind(CM_52, Part_52),type = "const",p = 2, exogen = Temp_52) VAR(cbind(CM_52, Part_52),type = "trend",p = 2, exogen = Temp_52) VAR(cbind(CM_52, Part_52),type = "both",p = 2, exogen = Temp_52) VAR(cbind(CM_52, Part_52),type = "none",p = 2, exogen = Temp_52)
/Code/week12_Cardiac Mortality Forecast.R
no_license
anhnguyendepocen/DS6373_TimeSeries
R
false
false
24,662
r
# CMort LA Pollution and Temperature Study # ARIMA 1 MLR with Cor Errors (no lag, no seasonl categorical variable) #EDA library(tidyverse) library(GGally) library(astsa) library(tswge) CM = read.csv(file.choose(),header = TRUE) head(CM) ggpairs(CM[2:4]) #matrix of scatter plots #forecast Particles plotts.sample.wge(CM$part) #freq near .0192 (annual) CM_52 = artrans.wge(CM$part, c(rep(0,51),1)) plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(2,1) assume stationary aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval #FTR Ho ljung.wge(CM_52, K = 48)$pval #FTR Ho #Going with white noise despite peak at 0 in Spec D. #est = est.arma.wge(CM_52, p = 3, q = 2) #CM_52_AR2_MA1 = artrans.wge(CM_52,est$phi) predsPart = fore.aruma.wge(CM$part,s = 52, n.ahead = 20) plot(predsPart$f, type = "l") plot(seq(1,508,1), CM$part, type = "l",xlim = c(0,528), ylab = "Temperature", main = "20 Week Particulate Forecast") lines(seq(509,528,1), predsPart$f, type = "l", col = "red") #forecast Temp plotts.sample.wge(CM$temp) #freq near .0192 (annual) CM_52 = artrans.wge(CM$temp, c(rep(0,51),1)) plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(0,0) aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval ljung.wge(CM_52, K = 48)$pval #barely rejects acf(CM_52,lag.max = 48) # acf looks consistent with white noise predsTemp = fore.aruma.wge(CM$temp,s = 52, n.ahead = 20) plot(predsTemp$f, type = "l") plot(seq(1,508,1), CM$temp, type = "l",xlim = c(0,528), ylab = "Temperature", main = "20 Week Temperature Forecast") lines(seq(509,528,1), predsTemp$f, type = "l", col = "red") # Model cmort based on predicted part and temp using MLR with Cor Erros #assuming data is loaded in dataframe CM ksfit = lm(cmort~temp+part+Week, data = CM) phi = aic.wge(ksfit$residuals) #AR(2) fit = arima(CM$cmort, order = c(phi$p,0,phi$q), seasonal = list(order = c(1,0,0), period = 52), xreg = cbind(CM$temp, CM$part, CM$Week)) # Check for whiteness of residuals acf(fit$residuals) ljung.wge(fit$residuals) # pval = .059 ljung.wge(fit$residuals, K = 48) # pval = .004 #load the forecasted Part and Temp in a data frame next20 = data.frame(temp = predsTemp$f, part = predsPart$f, Week = seq(509,528,1)) #get predictions predsCMort = predict(fit,newxreg = next20) #plot next 20 cmort wrt time plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), predsCMort$pred, type = "l", col = "red") #Find ASE Need to forecast last 30 of known series. CMsmall = CM[1:478,] ksfit = lm(cmort~temp+part+Week, data = CMsmall) phi = aic.wge(ksfit$residuals) fit = arima(CMsmall$cmort,order = c(phi$p,0,0), seasonal = list(order = c(1,0,0), period = 52), xreg = cbind(CMsmall$temp, CMsmall$part, CMsmall$Week)) last30 = data.frame(temp = CM$temp[479:508], part = CM$part[479:508], CMWeek = seq(479,508,1)) #get predictions predsCMort = predict(fit,newxreg = last30) ASE = mean((CM$cmort[479:508] - predsCMort$pred)^2) ASE plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "Last 30 Week Cardiac Mortality Forecast") lines(seq(479,508,1), predsCMort$pred, type = "l", col = "red") #Find ASE Need to forecast last 30 of known series. With temp lag 1 CMsmall = CM[1:478,] CMsmall$temp_1 = dplyr::lag(CMsmall$temp,1) CM$temp_1 = dplyr::lag(CM$temp,1) ksfit = lm(cmort~temp_1+part+Week, data = CMsmall) phi = aic.wge(ksfit$residuals) fit = arima(CMsmall$cmort,order = c(phi$p,0,0), seasonal = list(order = c(1,0,0), period = 52), xreg = cbind(CMsmall$temp, CMsmall$part, CMsmall$Week)) last30 = data.frame(temp = CM$temp_1[479:508], part = CM$part[479:508], Week = seq(479,508,1)) #get predictions predsCMort = predict(fit,newxreg = last30) plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "Last 30 Week Cardiac Mortality Forecast") lines(seq(479,508,1), predsCMort$pred, type = "l", col = "red") ASE = mean((CM$cmort[479:508] - predsCMort$pred)^2) ASE ###################################################################### #ARIMA 2: attempt at categorical variable for week but arima takes only continuous variables CM = read.csv(file.choose(),header = TRUE) head(CM) #forecast Particles px = plotts.sample.wge(CM$part) #freq near .0192 (annual) CM_52 = artrans.wge(CM$part, c(rep(0,51),1)) px = plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(2,1) assume stationary aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval #FTR Ho ljung.wge(CM_52, K = 48)$pval #FTR Ho #Going with white noise despite peak at 0 in Spec D. #est = est.arma.wge(CM_52, p = 3, q = 2) #CM_52_AR2_MA1 = artrans.wge(CM_52,est$phi) predsPart = fore.aruma.wge(CM$part,s = 52, n.ahead = 20) #forecast Temp px = plotts.sample.wge(CM$temp) #freq near .0192 (annual) CM_52 = artrans.wge(CM$temp, c(rep(0,51),1)) px = plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(0,0) aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval ljung.wge(CM_52, K = 48)$pval #barely rejects acf(CM_52,lag.max = 48) # acf looks consistent with white noise predsTemp = fore.aruma.wge(CM$temp,s = 52, n.ahead = 20) # Model cmort based on predicted part and temp using MLR with Cor Erros #assuming data is loaded in dataframe CM CM$FWeek = as.factor(CM$Week%%52) form = ~ . # Since we are using all variables in the dataframe form = ~ cmort+temp+part+Week+FWeek # or explicitly add variables to use CMexpanded = model.matrix(form, data = CM) %>% as_tibble() %>% dplyr::select(-"(Intercept)") # colnames(CMexpanded) ksfit = lm(cmort~., data = CMexpanded) summary(ksfit) ## Evaluate Residuals px = tswge::plotts.sample.wge(ksfit$residuals) ## Looks stationary AR(1) ,ay be appropriate aic_resids = aic.wge(ksfit$residuals) # Picks AR(2) print(aic_resids) fit = arima(CMexpanded$cmort,order = c(aic_resids$p,0,aic_resids$q), xreg = CMexpanded %>% dplyr::select(-cmort)) print(fit) AIC(fit) #AIC = 3088.997 # Check for whiteness of residuals acf(fit$residuals) ljung.wge(fit$residuals) # pval = .0808 ljung.wge(fit$residuals, K = 48) # pval = 0.123916 #load the forecasted Part and Temp in a data frame next20 = data.frame(temp = predsTemp$f, part = predsPart$f, Week = seq(509,528,1), FWeek = factor(seq(509,528,1)%%52, levels = levels(CM$FWeek))) form = ~ temp + part + Week + FWeek # Remove the dependent variable 'cmort' next20expanded = model.matrix(form, data = next20) %>% as_tibble() %>% dplyr::select(-"(Intercept)") # colnames(next20expanded) #get predictions predsCMort = predict(fit,newxreg = next20expanded) #creates error because of factor #plot next 20 cmort wrt time plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), predsCMort$pred, type = "l", col = "red") ##################################### #predict residuals manually plotts.sample.wge(ksfit$residuals) phi = aic.wge(ksfit$residuals) resids = fore.arma.wge(ksfit$residuals,phi = phi$phi,n.ahead = 20) #predict trend manually preds = predict(ksfit, newdata = next20) predsFinal = preds + resids$f #plot next 20 cmort wrt time plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), predsFinal, type = "l", col = "red") #Find ASE Need to forecast last 30 of known series. CMsmall = CM[1:478,] ksfit = lm(cmort~temp+part+Week+FWeek, data = CMsmall) phi = aic.wge(ksfit$residuals) fit = arima(CMsmall$cmort,order = c(phi$p,0,0), seasonal = list(order = c(1,0,0), period = 52), xreg = cbind(CMsmall$temp, CMsmall$part, CMsmall$Week, CMsmall$FWeek)) AIC(fit) #AIC = 2972 # This is actually cheating. We should forecast the temp and part as before. last30 = data.frame(temp = CM$temp[479:508], part = CM$part[479:508], Week = seq(479,508,1), FWeek = as.factor(seq(479,508,1)%%52)) #get predictions predsCMort = predict(fit,newxreg = last30) #predict residuals manually plotts.sample.wge(ksfit$residuals) phi = aic.wge(ksfit$residuals) resids = fore.arma.wge(ksfit$residuals,phi = phi$phi,n.ahead = 30) #predict trend manually preds = predict(ksfit, newdata = last30) predsFinal = preds + resids$f plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(479,508,1), predsFinal, type = "l", col = "red") ASE = mean((CM$cmort[479:508] - predsFinal)^2,na.rm = TRUE) ASE #ARIMA 3: categorical variable #With Lagged Temp library(dplyr) #Lag Temperature 1 ccf(CM$temp,CM$cmort) CM$temp1 = dplyr::lag(CM$temp,1) #forecast Particles plotts.sample.wge(CM$part) #freq near .0192 (annual) CM_52 = artrans.wge(CM$part, c(rep(0,51),1)) plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(2,1) assume stationary aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval #FTR Ho ljung.wge(CM_52, K = 48)$pval #FTR Ho #Going with white noise despite peak at 0 in Spec D. #est = est.arma.wge(CM_52, p = 3, q = 2) #CM_52_AR2_MA1 = artrans.wge(CM_52,est$phi) predsPart = fore.aruma.wge(CM$part,s = 52, n.ahead = 20) #forecast Temp plotts.sample.wge(CM$temp) #freq near .0192 (annual) CM_52 = artrans.wge(CM$temp, c(rep(0,51),1)) plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(0,0) aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval ljung.wge(CM_52, K = 48)$pval #barely rejects acf(CM_52,lag.max = 48) # acf looks consistent with white noise predsTemp = fore.aruma.wge(CM$temp,s = 52, n.ahead = 20) # Model cmort based on predicted part and temp using MLR with Cor Erros #assuming data is loaded in dataframe CM CM$FWeek = as.factor(CM$Week%%52) ksfit = lm(cmort~temp1+part+Week+FWeek, data = CM) phi = aic.wge(ksfit$residuals) fit = arima(CM$cmort,order = c(phi$p,0,0), xreg = cbind(CM$temp1, CM$part, CM$Week, CM$FWeek)) AIC(fit) #AIC = 3151 # Check for whiteness of residuals acf(fit$residuals) ljung.wge(fit$residuals) # pval = .066 ljung.wge(fit$residuals, K = 48) # pval = .0058 predsTemp$f1 = dplyr::lag(predsTemp$f,1) #load the forecasted Part and Temp in a data frame next20 = data.frame(temp1 = predsTemp$f1, part = predsPart$f, Week = seq(509,528,1), FWeek = as.factor(seq(509,528,1)%%52)) #get predictions predsCMort = predict(fit,newxreg = next20) #creates error because of factor #predict residuals manually plotts.sample.wge(ksfit$residuals) phi = aic.wge(ksfit$residuals) resids = fore.arma.wge(ksfit$residuals,phi = phi$phi,n.ahead = 20) #predict trend manually preds = predict(ksfit, newdata = next20) predsFinal = preds + resids$f #plot next 20 cmort wrt time plot(seq(1,508,1), cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), predsFinal, type = "l", col = "red") #Find ASE Need to forecast last 30 of known series. CMsmall = CM[2:478,] ksfit = lm(cmort~temp1+part+Week+FWeek, data = CMsmall) phi = aic.wge(ksfit$residuals) fit = arima(CMsmall$cmort,order = c(phi$p,0,0), seasonal = list(order = c(1,0,0), period = 52), xreg = cbind(CMsmall$temp1, CMsmall$part, CMsmall$Week, CMsmall$FWeek)) last30 = data.frame(temp1 = CM$temp1[479:508], part = CM$part[479:508], Week = seq(479,508,1), FWeek = as.factor(seq(479,508,1)%%52)) #get predictions predsCMort = predict(fit,newxreg = last30) #Showing Error ... why we have to predict resids manually (next step) #predict residuals manually plotts.sample.wge(ksfit$residuals) phi = aic.wge(ksfit$residuals) resids = fore.arma.wge(ksfit$residuals,phi = phi$phi,n.ahead = 30) #predict trend manually preds = predict(ksfit, newdata = last30) predsFinal = preds + resids$f plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(479,508,1), predsFinal, type = "l", col = "red") ASE = mean((CM$cmort[479:508] - predsFinal)^2,na.rm = TRUE) ASE #ARIMA 4: categorical variable #With Lagged Temp and Part library(dplyr) #Lag Temperature 1 ccf(CM$temp,CM$cmort) CM$temp1 = dplyr::lag(CM$temp,1) #Lag Particles lag 7 on particles ccf(CM$part,CM$cmort) CM$part7 = dplyr::lag(CM$temp,7) #forecast Particles plotts.sample.wge(CM$part) #freq near .0192 (annual) CM_52 = artrans.wge(CM$part, c(rep(0,51),1)) plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(2,1) assume stationary aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval #FTR Ho ljung.wge(CM_52, K = 48)$pval #FTR Ho #Going with white noise despite peak at 0 in Spec D. #est = est.arma.wge(CM_52, p = 3, q = 2) #CM_52_AR2_MA1 = artrans.wge(CM_52,est$phi) predsPart = fore.aruma.wge(CM$part,s = 52, n.ahead = 20) #forecast Temp plotts.sample.wge(CM$temp) #freq near .0192 (annual) CM_52 = artrans.wge(CM$temp, c(rep(0,51),1)) plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(0,0) aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval ljung.wge(CM_52, K = 48)$pval #barely rejects acf(CM_52,lag.max = 48) # acf looks consistent with white noise predsTemp = fore.aruma.wge(CM$temp,s = 52, n.ahead = 20) # Model cmort based on predicted part and temp using MLR with Cor Erros #assuming data is loaded in dataframe CM CM$FWeek = as.factor(CM$Week%%52) ksfit = lm(cmort~temp1+part7+Week+FWeek, data = CM) AIC(ksfit) phi = aic.wge(ksfit$residuals) fit = arima(CM$cmort,order = c(phi$p,0,0), xreg = cbind(CM$temp1, CM$part7, CM$Week, CM$FWeek)) AIC(fit) #AIC = 3151 # Check for whiteness of residuals acf(fit$residuals) ljung.wge(fit$residuals) # pval = .066 ljung.wge(fit$residuals, K = 48) # pval = .0058 predsTemp$f1 = dplyr::lag(predsTemp$f,1) predsPart$f1 = dplyr::lag(predsPart$f,7) #load the forecasted Part and Temp in a data frame next20 = data.frame(temp1 = predsTemp$f1, part = predsPart7$f, Week = seq(509,528,1), FWeek = as.factor(seq(509,528,1)%%52)) #get predictions predsCMort = predict(fit,newxreg = next20) #creates error because of factor #predict residuals manually plotts.sample.wge(ksfit$residuals) phi = aic.wge(ksfit$residuals) resids = fore.arma.wge(ksfit$residuals,phi = phi$phi,n.ahead = 20) #predict trend manually preds = predict(ksfit, newdata = next20) predsFinal = preds + resids$f #plot next 20 cmort wrt time plot(seq(1,508,1), cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), predsFinal, type = "l", col = "red") ####### ASE ####### #Find ASE Need to forecast last 30 of known series. CMsmall = CM[2:478,] ksfit = lm(cmort~temp1+part7+Week+FWeek, data = CMsmall) summary(ksfit) AIC(ksfit) phi = aic.wge(ksfit$residuals) fit = arima(CMsmall$cmort,order = c(phi$p,0,0), seasonal = list(order = c(1,0,0), period = 52), xreg = cbind(CMsmall$temp1, CMsmall$part7, CMsmall$Week, CMsmall$FWeek)) AIC(fit) last30 = data.frame(temp1 = CM$temp1[479:508], part7 = CM$part7[479:508], Week = seq(479,508,1), FWeek = as.factor(seq(479,508,1)%%52)) #get predictions predsCMort = predict(fit,newxreg = last30) #Showing Error ... why we have to predict resids manually (next step) #predict residuals manually plotts.sample.wge(ksfit$residuals) phi = aic.wge(ksfit$residuals) resids = fore.arma.wge(ksfit$residuals,phi = phi$phi,n.ahead = 30) #predict trend manually preds = predict(ksfit, newdata = last30) predsFinal = preds + resids$f plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(479,508,1), predsFinal, type = "l", col = "red") ASE = mean((CM$cmort[479:508] - predsFinal)^2,na.rm = TRUE) ASE ############ VAR MODELS ########################## #VAR Model 1 Forecasts Seasonally Differenced Data #Difference all series to make them stationary (assumptoin of VAR) # Doesn't have to be white... just stationary library(vars) CM = read.csv(file.choose(),header = TRUE) CM_52 = artrans.wge(CM$cmort,c(rep(0,51),1)) Part_52 = artrans.wge(CM$part,c(rep(0,51),1)) Temp_52 = artrans.wge(CM$temp,c(rep(0,51),1)) #VARSelect on Differenced Data chooses 2 VARselect(cbind(CM_52, Part_52, Temp_52),lag.max = 10, type = "both") #VAR with p = 2 CMortDiffVAR = VAR(cbind(CM_52, Part_52, Temp_52),type = "both",p = 2) preds=predict(CMortDiffVAR,n.ahead=20) #We have predicted differences .... calculate actual cardiac mortalities startingPoints = CM$cmort[456:475] CMortForcasts = preds$fcst$CM_52[,1:3] + startingPoints #Plot dev.off() plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), as.data.frame(CMortForcasts)$fcst, type = "l", col = "red") #Find ASE using last 30 CM_52 = artrans.wge(CMsmall$cmort,c(rep(0,51),1)) Part_52 = artrans.wge(CMsmall$part,c(rep(0,51),1)) Temp_52 = artrans.wge(CMsmall$temp,c(rep(0,51),1)) VARselect(cbind(CM_52, Part_52, Temp_52),lag.max = 10, type = "both") CMortDiffVAR = VAR(cbind(CM_52, Part_52, Temp_52),type = "both",p = 2) preds=predict(CMortDiffVAR,n.ahead=30) startingPoints = CM$cmort[428:457] CMortForcasts = preds$fcst$CM_52[,1:3] + startingPoints dev.off() plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,508), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(479,508,1), CMortForcasts[,1], type = "l", col = "red") ASE = mean((CM$cmort[479:508] - CMortForcasts[,1])^2) ASE #Find ASE using last 52 CMsmall = CM[1:456,] # 456 = 508-52 CM_52 = artrans.wge(CMsmall$cmort,c(rep(0,51),1)) Part_52 = artrans.wge(CMsmall$part,c(rep(0,51),1)) Temp_52 = artrans.wge(CMsmall$temp,c(rep(0,51),1)) VARselect(cbind(CM_52, Part_52, Temp_52),lag.max = 10, type = "both") CMortDiffVAR = VAR(cbind(CM_52, Part_52, Temp_52),type = "both",p = 2) preds=predict(CMortDiffVAR,n.ahead=52) startingPoints = CM$cmort[405:456] CMortForcasts = preds$fcst$CM_52[,1:3] + startingPoints dev.off() plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,508), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(457,508,1), CMortForcasts[,1], type = "l", col = "red") ASE = mean((CM$cmort[457:508] - CMortForcasts[,1])^2) ASE #VAR Model 2 Forecasts Seasonal Dummy CM = read.csv(file.choose(),header = TRUE) #VARSelect on Seasonal Data chooses 2 VARselect(cbind(CM$cmort, CM$part, CM$temp),lag.max = 10, season = 52, type = "both") #VAR with p = 2 CMortVAR = VAR(cbind(CM$cmort, CM$part, CM$temp),season = 52, type = "both",p = 2) preds=predict(CMortVAR,n.ahead=20) #Plot plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), preds$fcst$y1[,1], type = "l", col = "red") #Find ASE using last 30 CMsmall = CM[1:478,] VARselect(cbind(CMsmall$cmort, CMsmall$part, CMsmall$temp),lag.max = 10, season = 52, type = "both") CMortVAR = VAR(cbind(CMsmall$cmort, CMsmall$part, CMsmall$temp),season = 52, type = "both",p = 2) preds=predict(CMortVAR,n.ahead=30) #Plot plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,508), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(479,508,1), preds$fcst$y1[,1], type = "l", col = "red") ASE = mean((CM$cmort[479:508] - preds$fcst$y1[,1])^2) ASE #Find ASE using last 52 CMsmall = CM[1:456,] # 456 = 508-52 VARselect(cbind(CMsmall$cmort[2:456], CMsmall$part[2:456], CMsmall$temp[2:456]),lag.max = 10, season = 52, type = "both") CMortVAR = VAR(cbind(CMsmall$cmort[2:456], CMsmall$part[2:456], CMsmall$temp[2:456]),season = 52, type = "both",p = 2) preds=predict(CMortVAR,n.ahead=52) #Plot plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,508), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(457,508,1), preds$fcst$y1[,1], type = "l", col = "red") ASE = mean((CM$cmort[457:508] - preds$fcst$y1[,1])^2) ASE #VAR Model 3 seasonal with Lag 1 Temp CM = read.csv(file.choose(),header = TRUE) CM$temp_1 = dplyr::lag(CM$temp,1) ggpairs(CM[,-7]) VARselect(cbind(CM$cmort[2:479], CM$part[2:479], CM$temp_1[2:479]),lag.max = 10, season = 52, type = "both") #VAR with p = 2 CMortVAR = VAR(cbind(CM$cmort[2:479], CM$part[2:479], CM$temp_1[2:479]),season = 52, type = "both",p = 2) preds=predict(CMortVAR,n.ahead=20) #Plot plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), preds$fcst$y1[,1], type = "l", col = "red") #Find ASE using last 30 CMsmall = CM[1:479,] VARselect(cbind(CMsmall$cmort[2:478], CMsmall$part[2:478], CMsmall$temp_1[2:478]),lag.max = 10, season = 52, type = "both") CMortVAR = VAR(cbind(CMsmall$cmort[2:478], CMsmall$part[2:478], CMsmall$temp_1[2:478]),season = 52, type = "both",p = 2) preds=predict(CMortVAR,n.ahead=30) #Plot plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,508), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(479,508,1), preds$fcst$y1[,1], type = "l", col = "red") ASE = mean((CM$cmort[479:508] - preds$fcst$y1[,1])^2) ASE #Find ASE using last 52 CMsmall = CM[1:456,] # 456 = 508-52 VARselect(cbind(CMsmall$cmort[2:456], CMsmall$part[2:456], CMsmall$temp_1[2:456]),lag.max = 10, season = 52, type = "both") CMortVAR = VAR(cbind(CMsmall$cmort[2:456], CMsmall$part[2:456], CMsmall$temp_1[2:456]),season = 52, type = "both",p = 2) preds=predict(CMortVAR,n.ahead=52) #Plot plot(seq(1,508,1), CM$cmort, type = "l",xlim = c(0,508), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(457,508,1), preds$fcst$y1[,1], type = "l", col = "red") ASE = mean((CM$cmort[457:508] - preds$fcst$y1[,1])^2) ASE #Sandbox 1 s = 52 #forecast Particles plotts.sample.wge(CM$part) #freq near .0192 (annual) CM_52 = artrans.wge(CM$part, c(rep(0,51),1)) plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(2,1) assume stationary aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval #FTR Ho ljung.wge(CM_52, K = 48)$pval #FTR Ho #Going with white noise despite peak at 0 in Spec D. #est = est.arma.wge(CM_52, p = 3, q = 2) #CM_52_AR2_MA1 = artrans.wge(CM_52,est$phi) predsPart = fore.aruma.wge(CM$part,s = 52, n.ahead = 20) #forecast Temp plotts.sample.wge(CM$temp) #freq near .0192 (annual) CM_52 = artrans.wge(CM$temp, c(rep(0,51),1)) plotts.sample.wge(CM_52) #looks like some low freq? aic5.wge(CM_52) #picks ARMA(0,0) aic5.wge(CM_52,type = "bic") #picks ARMA(0,0) ljung.wge(CM_52)$pval ljung.wge(CM_52, K = 48)$pval #barely rejects acf(CM_52,lag.max = 48) # acf looks consistent with white noise predsTemp = fore.aruma.wge(CM$temp,s = 52, n.ahead = 20) # Model cmort based on predicted part and temp using MLR with Cor Erros #assuming data is loaded in dataframe CM ksfit = lm(cmort~temp+part+Week, data = CM) phi = aic.wge(ksfit$residuals) attach(CM) fit = arima(cmort,order = c(phi$p,0,0), seasonal = list(order = c(0,1,0), period = 52),xreg = cbind(temp, part, Week)) AIC(fit) # Check for whiteness of residuals acf(fit$residuals) ljung.wge(fit$residuals) # pval = .059 ljung.wge(fit$residuals, K = 48) # pval = .004 #load the forecasted Part and Temp in a data frame next20 = data.frame(temp = predsTemp$f, part = predsPart$f, Week = seq(509,528,1)) #get predictions predsCMort = predict(fit,newxreg = next20) #plot next 20 cmort wrt time plot(seq(1,508,1), cmort, type = "l",xlim = c(0,528), ylab = "Cardiac Mortality", main = "20 Week Cardiac Mortality Forecast") lines(seq(509,528,1), predsCMort$pred, type = "l", col = "red") # Univariate foreCmort = fore.aruma.wge(CM$cmort,s = 52, n.ahead = 30, lastn = TRUE, limits = FALSE) ASE = mean((CM$cmort[479:508] - foreCmort$f)^2) ASE # Univariate ASE 50 back foreCmort = fore.aruma.wge(CM$cmort,s = 52, n.ahead = 52, lastn = TRUE, limits = FALSE) ASE = mean((CM$cmort[457:508] - foreCmort$f)^2) ASE #Show the effect of "type = {"const", trend", "both", "none") data(Canada) VAR(Canada, p = 2, type = "const") VAR(Canada, p = 2, type = "trend") VAR(Canada, p = 2, type = "both") VAR(Canada, p = 2, type = "none") VAR(cbind(CM_52, Part_52),type = "const",p = 2, exogen = Temp_52) VAR(cbind(CM_52, Part_52),type = "trend",p = 2, exogen = Temp_52) VAR(cbind(CM_52, Part_52),type = "both",p = 2, exogen = Temp_52) VAR(cbind(CM_52, Part_52),type = "none",p = 2, exogen = Temp_52)
########### Prereqs ########### # Begin always run: options(stringsAsFactors=FALSE,scipen=600) library(tidyverse) library(gridExtra) library(emmeans) library(multcomp) library(corrplot) # Ensembl library() # End always run setwd("~/gdrive/AthroProteomics/data") peptides<-read.csv('peptide_table_20180514.csv') proteins<-read.csv('protein_table_20180514.csv') reg1<-regexpr("JVE.",text=names(peptides)) reg2<-regexpr(".File.Area.s.",text=names(peptides)) reg1DF<-data.frame(include=reg1>0,start=as.integer(reg1)+attr(reg1,"match.length"), stop=as.integer(reg2)-1L) names1<-substr(names(peptides),start=reg1DF$start,stop=reg1DF$stop) names2<-str_split(names1,"\\.",simplify=TRUE) pheno<-data.frame(oldName=names(peptides)[names1!=""],ptid=names2[names1!="",1], timept=names2[names1!="",2],replicate=as.integer(names2[names1!="",3])) pheno$newName<-paste0("rep_",1L:length(pheno$oldName)) names(peptides)[match(pheno$oldName,names(peptides))]<-pheno$newName names(proteins)[match(pheno$oldName,names(proteins))]<-pheno$newName pheno$uSamp<-paste(pheno$ptid,pheno$timept,sep="_") # Phenotype data: groups<-read.csv(file="~/gdrive/Athro/groups_20180515.csv") groups$ptid<-as.character(groups$ptid) groups$Group<-"sCAD" groups$Group[!is.na(groups$MIGroup)]<-groups$MIGroup[!is.na(groups$MIGroup)] pheno<-pheno %>% left_join(groups) # Remove 2010_T0 because there are 4 replicates! peptides<-peptides[,!(colnames(peptides) %in% pheno$newName[pheno$uSamp=="2010_T0"])] pheno<-pheno %>% filter(uSamp != "2010_T0") # Wide data: makeWideFun<-function(data){ peptidesL<-data %>% dplyr::select(-Quality.Score,-(Parent.Protein:Percent.Files.With.Good.Quant)) %>% gather(key="rep",value="Intensity",-Name) peptidesL<-pheno %>% left_join(groups) %>% left_join(peptidesL,by=c("newName"="rep")) peptidesL$GroupTime<-paste(peptidesL$Group,peptidesL$timept,sep=".") peptidesL$GroupTime<-factor(peptidesL$GroupTime, levels=c("sCAD.FU","sCAD.T0","Type 1.FU","Type 1.T0","Type 2.FU","Type 2.T0", "Indeterminate.FU","Indeterminate.T0")) peptidesL<-peptidesL %>% arrange(GroupTime,ptid,replicate) temp1<-peptidesL %>% dplyr::select(GroupTime,ptid,replicate) %>% unique() temp1$uID<-as.factor(1L:nrow(temp1)) peptidesL<-temp1 %>% left_join(peptidesL) return(peptidesL) } # Export peptide sequences for protein query: pepSeqs<-peptides$Name pepSeqs<-gsub("(\\[.*?\\])","",pepSeqs) pepSeqsStr<-paste(pepSeqs,collapse=",") # write.table(pepSeqsStr,file="pepSeqsStr.txt",quote=FALSE,row.names=FALSE) # Export other peptide annotation: pepAnno<-peptides %>% dplyr::select(Name,Quality.Score,ParentProtein.FullName,Use.For.Quant, Percent.Files.With.Good.Quant) # save(pepAnno,file="pepAnno.RData") setwd("~/gdrive/AthroProteomics/") ########### Normalization ########### m0<-as.matrix(peptides[,grepl("rep",names(peptides))]) # Minimum value imputation: mins<-apply(m0,2,function(x) min(x[x>0])) for(i in 1:ncol(m0)){ m0[,i][m0[,i]<1e-6]<-mins[i] } # Log-transform: m00<-m0 peptides00<-peptides peptides00[,grepl("rep",names(peptides00))]<-m00 m0<-log2(m0) peptides[,grepl("rep",names(peptides))]<-m0 peptidesL<-makeWideFun(peptides) # png(file="Plots/peptideNoNorm.png",height=5,width=10,units="in",res=300) p0<-ggplot(data=peptidesL,aes(x=uID,group=newName,color=GroupTime,y=Intensity))+ geom_boxplot()+theme_bw()+xlab("")+ylab("Intensity (log scale)")+ theme(axis.text.x=element_blank()) show(p0) # dev.off() # Columnwise total intensity normalization: cSums<-apply(m00,2,sum) cFac<-cSums/mean(cSums) m1<-m00 for(i in 1:ncol(m1)) m1[,i]<-m1[,i]/cFac[i] m1b<-m1 # Median normalization cMed<-apply(m1,2,median) cFac2<-cMed/mean(cMed) for(i in 1:ncol(m1b)) m1b[,i]<-m1b[,i]/cFac2[i] peptides1b<-peptides1<-peptides00 peptides1[,grepl("rep",names(peptides1))]<-log2(m1) peptides1b[,grepl("rep",names(peptides1b))]<-log2(m1b) peptidesL1<-makeWideFun(peptides1) peptidesL1b<-makeWideFun(peptides1b) # png(file="Plots/peptideColNorm.png",height=5,width=10,units="in",res=300) p1<-ggplot(data=peptidesL1,aes(x=uID,group=newName,color=GroupTime,y=Intensity))+ geom_boxplot()+theme_bw()+xlab("")+ylab("Intensity (log scale)")+ theme(axis.text.x=element_blank()) show(p1) # dev.off() # png(file="Plots/peptideColMedNorm.png",height=5,width=10,units="in",res=300) p1b<-ggplot(data=peptidesL1b,aes(x=uID,group=newName,color=GroupTime,y=Intensity))+ geom_boxplot()+theme_bw()+xlab("")+ylab("Intensity (log scale)")+ theme(axis.text.x=element_blank()) show(p1b) # dev.off() # png(file="Plots/peptideNoneVColNorm.png",height=10,width=10,units="in",res=300) grid.arrange(p0,p1,nrow=2) # dev.off() # Quantile normalization: m2<-preprocessCore::normalize.quantiles(m0) peptides2<-peptides peptides2[,grepl("rep",names(peptides2))]<-m2 peptidesL2<-makeWideFun(peptides2) # png(file="Plots/peptideQuantNorm.png",height=5,width=10,units="in",res=300) p2<-ggplot(data=peptidesL2,aes(x=uID,group=newName,color=GroupTime,y=Intensity))+ geom_boxplot()+theme_bw()+xlab("")+ylab("Intensity (log scale)")+ theme(axis.text.x=element_blank()) show(p2) # dev.off() # Cyclic loess: m3<-limma::normalizeCyclicLoess(m0) peptides3<-peptides peptides3[,grepl("rep",names(peptides3))]<-m3 peptidesL3<-makeWideFun(peptides3) # png(file="Plots/peptideFastCyclicLoess.png",height=5,width=10,units="in",res=300) p3<-ggplot(data=peptidesL3,aes(x=uID,group=newName,color=GroupTime,y=Intensity))+ geom_boxplot()+theme_bw()+xlab("")+ylab("Intensity (log scale)")+ theme(axis.text.x=element_blank()) show(p3) # dev.off() # Cyclic loess bGal only: bGalWeights<-as.numeric(grepl("P00722",peptides$Parent.Protein) & peptides$Percent.Files.With.Good.Quant>.99) m4<-limma::normalizeCyclicLoess(m0,weights = bGalWeights) peptides4<-peptides peptides4[,grepl("rep",names(peptides4))]<-m4 peptidesL4<-makeWideFun(peptides4) # png(file="Plots/peptideFastCyclicLoessbGalOnly.png",height=5,width=10,units="in",res=300) p4<-ggplot(data=peptidesL4,aes(x=uID,group=newName,color=GroupTime,y=Intensity))+ geom_boxplot()+theme_bw()+xlab("")+ylab("Intensity (log scale)")+ theme(axis.text.x=element_blank()) show(p4) # dev.off() # Cyclic loess half & half bGal only: bGalWeights2<-bGalWeights+.2 bGalWeights2<-ifelse(bGalWeights2>1,1.0,bGalWeights2) m5<-limma::normalizeCyclicLoess(m0,weights = bGalWeights2) peptides5<-peptides peptides5[,grepl("rep",names(peptides5))]<-m5 peptidesL5<-makeWideFun(peptides5) # png(file="Plots/peptideFastCyclicLoessbGalHeavy.png",height=5,width=10,units="in",res=300) p5<-ggplot(data=peptidesL5,aes(x=uID,group=newName,color=GroupTime,y=Intensity))+ geom_boxplot()+theme_bw()+xlab("")+ylab("Intensity (log scale)")+ theme(axis.text.x=element_blank()) show(p5) # dev.off() # MAD: m6<-limma::normalizeMedianAbsValues(m0) peptides6<-peptides peptides6[,grepl("rep",names(peptides6))]<-m6 peptidesL6<-makeWideFun(peptides6) # png(file="Plots/peptideMAD.png",height=5,width=10,units="in",res=300) p6<-ggplot(data=peptidesL6,aes(x=uID,group=newName,color=GroupTime,y=Intensity))+ geom_boxplot()+theme_bw()+xlab("")+ylab("Intensity (log scale)")+ theme(axis.text.x=element_blank()) show(p6) # dev.off() # Beta gal: bGalFun<-function(data,method){ # betaGal data: bGal<-data %>% filter(grepl("P00722",ParentProtein.FullName) & Percent.Files.With.Good.Quant>.99) set.seed(3) bGalShort<-sample(bGal$Name,8) bGalL<-bGal %>% dplyr::select(-Quality.Score,-(Parent.Protein:Percent.Files.With.Good.Quant)) %>% gather(key="rep",value="Intensity",-Name) bGalLNames<-bGalL %>% dplyr::select(Name) %>% unique() bGalLNames$id<-as.factor(1:nrow(bGalLNames)) bGalL<-bGalLNames %>% left_join(bGalL) # CVs: cv<-bGalL %>% group_by(Name) %>% summarize(cv=sd(2**Intensity)/mean(2**Intensity)*100) names(cv)[names(cv)=="cv"]<-paste0(method,"CV") # Plots: fName<-paste0("Plots/bGalPeptides_",method,"_Full.png") # png(filename=fName,height=5,width=8,units="in",res=300) bGalp<-ggplot(bGalL,aes(x=rep,y=Intensity,group=Name,color=id))+ geom_line()+ylim(23,32)+theme_bw()+xlab("Replicate")+ylab("Intensity (log scale)") print(bGalp) # dev.off() fName2<-paste0("Plots/bGalPeptides_",method,"_Samp.png") # png(filename=fName2,height=5,width=8,units="in",res=300) bGalp2<-ggplot(bGalL %>% filter(Name %in% bGalShort), aes(x=rep,y=Intensity,group=Name,color=id))+ geom_line()+ylim(26,31.75)+theme_bw()+xlab("Replicate")+ylab("Intensity (log scale)") print(bGalp2) # dev.off() return(cv) } bGalCVs<-cbind( bGalFun(data=peptides,method="none"), bGalFun(data=peptides1,method="columnTI")[,-1], bGalFun(data=peptides1b,method="columnTIMed")[,-1], bGalFun(peptides2,method="Quant")[,-1], bGalFun(peptides3,method="FCycLoess")[,-1], bGalFun(peptides4,method="FCycLoessbGal")[,-1], bGalFun(peptides5,method="FCycLoessbGalLight")[,-1], bGalFun(peptides6,method="MAD")[,-1] ) # write.csv(bGalCVs,file="bGalCVs.csv",row.names=FALSE) ########### Un log-transform ########### peptides1[,grepl("rep_",names(peptides1))]<- 2**peptides1[,grepl("rep_",names(peptides1))] peptides2[,grepl("rep_",names(peptides2))]<- 2**peptides2[,grepl("rep_",names(peptides2))] peptides3[,grepl("rep_",names(peptides3))]<- 2**peptides3[,grepl("rep_",names(peptides3))] peptides4[,grepl("rep_",names(peptides4))]<- 2**peptides4[,grepl("rep_",names(peptides4))] peptides5[,grepl("rep_",names(peptides5))]<- 2**peptides5[,grepl("rep_",names(peptides5))] peptides6[,grepl("rep_",names(peptides6))]<- 2**peptides6[,grepl("rep_",names(peptides6))] ########### Rownames ########### rownames(peptides00)<-peptides00$Name rownames(peptides1)<-peptides1$Name rownames(peptides2)<-peptides2$Name rownames(peptides3)<-peptides3$Name rownames(peptides4)<-peptides4$Name rownames(peptides5)<-peptides5$Name rownames(peptides6)<-peptides6$Name ########### My beta-gal protein normalization ########### load("~/gdrive/AthroProteomics/data/pepAnno2.RData") pinEcoli<-pepAnno2 %>% filter(grepl("P00722",proteins) & goodQuant>.99 & pinUseQuant=="Yes") myEColi<-pepAnno2 %>% filter(grepl("P00722",proteins) & goodQuant>.99 & !grepl("(\\[.*?\\])",pepSeq)) myEColiIntensPep00<-peptides00[peptides00$Name %in% myEColi$pepSeq, grepl("rep_",names(peptides00))] myEColiIntensPep1<-peptides1[peptides1$Name %in% myEColi$pepSeq, grepl("rep_",names(peptides1))] myEColiIntensPep2<-peptides2[peptides2$Name %in% myEColi$pepSeq, grepl("rep_",names(peptides2))] myEColiIntensPep3<-peptides3[peptides3$Name %in% myEColi$pepSeq, grepl("rep_",names(peptides3))] myEColiIntensPep4<-peptides4[peptides4$Name %in% myEColi$pepSeq, grepl("rep_",names(peptides4))] myEColiIntensPep5<-peptides5[peptides5$Name %in% myEColi$pepSeq, grepl("rep_",names(peptides5))] myEColiIntensPep6<-peptides6[peptides6$Name %in% myEColi$pepSeq, grepl("rep_",names(peptides6))] cvFun1<-function(data){ return(sd(apply(data,2,sum))/mean(apply(data,2,sum))) } bGalProtCVs<- data.frame(technique=c("None","Column TI","Quantile","CyclicLoess","CyclicLoessBGal", "CyclicLoessBGalLt","MAD"), cv=c(cvFun1(myEColiIntensPep00),cvFun1(myEColiIntensPep1), cvFun1(myEColiIntensPep2),cvFun1(myEColiIntensPep3), cvFun1(myEColiIntensPep4),cvFun1(myEColiIntensPep5), cvFun1(myEColiIntensPep6))) # write.csv(bGalProtCVs,file="bGalProtCVs.csv",row.names=FALSE) ########### Beta gal peptide correlations ########### myEColiIntensPep1<-rbind(myEColiIntensPep1,apply(myEColiIntensPep1,2,sum)) rownames(myEColiIntensPep1)[nrow(myEColiIntensPep1)]<-"Total" cor1<-cor(t(myEColiIntensPep1)) # png("Plots/cor1.png",height=6,width=6,units="in",res=300) corrplot(cor1,type="upper",tl.cex=.4,is.corr=FALSE,cl.lim=c(-.4,1)) # dev.off() myEColiIntensPep5<-rbind(myEColiIntensPep5,apply(myEColiIntensPep5,2,sum)) rownames(myEColiIntensPep5)[nrow(myEColiIntensPep5)]<-"Total" cor5<-cor(t(myEColiIntensPep5)) # png("Plots/cor5.png",height=6,width=6,units="in",res=300) corrplot(cor5,type="upper",tl.cex=.4,is.corr=FALSE,cl.lim=c(-.4,1)) # dev.off() ########### Combine injections ########### combFun<-function(Names,data){ # Output dataframe: df2<-data.frame(Name=Names) # Combine injections for(uSamp in unique(pheno$uSamp)){ df1<-data.frame(value=apply(data[,pheno$newName[pheno$uSamp==uSamp]],1,mean)) names(df1)[names(df1)=="value"]<-paste0("rep_",uSamp) df2<-cbind(df2,df1) } # Median scale & log-transform meds<-apply(df2[,grepl("rep",names(df2))],1,median) for(i in 1:nrow(df2[,grepl("rep",names(df2))])){ df2[,grepl("rep",names(df2))][i,]<-log2(df2[,grepl("rep",names(df2))][i,]/meds[i]) } return(df2) } pep1<-combFun(Names=peptides1$Name,data=peptides1) # Major cleanup: rm(bGalCVs,bGalProtCVs,cor1,cor5,m0,m00,m1,m1b,m2,m3,m4,m5,m6, myEColi,myEColiIntensPep00,myEColiIntensPep1,myEColiIntensPep2, myEColiIntensPep3,myEColiIntensPep4,myEColiIntensPep5,myEColiIntensPep6, names2,p0,p1,p1b,p2,p3,p4,p5,p6,peptides,peptides00,peptides1b, peptides2,peptides3,peptides4,peptides5,peptides6,peptidesL,peptidesL1b, peptidesL2,peptidesL3,peptidesL4,peptidesL5,peptidesL6,proteins, reg1DF,bGalWeights,bGalWeights2,cFac,cFac2,cMed,cSums,i,mins,names1, pepSeqs,pepSeqsStr,reg1,reg2,bGalFun,combFun,cvFun1,makeWideFun, pinEcoli) ########### Peptide difference at baseline ########### pepDF<-pep1 %>% gather(key="rep",value="Intensity",-Name) pepDF$ptid<-str_split(pepDF$rep,"_",simplify=TRUE)[,2] pepDF$timept<-str_split(pepDF$rep,"_",simplify=TRUE)[,3] pepDF<-pepDF %>% left_join(groups) unqPep<-unique(pepDF$Name) pepDFT0Res<-data.frame(unqPep=unqPep,T0_sCAD=NA,T0_Type1=NA,T0_Type2=NA, T0_Anova=NA,T0_Type1_sCAD=NA,T0_Type2_sCAD=NA,T0_Type1_Type2=NA, T0_Type1_sCAD_p=NA,T0_Type2_sCAD_p=NA,T0_Type1_Type2_p=NA) for(i in 1:length(unqPep)){ # Linear Model lm1<-lm(Intensity~Group,data=pepDF %>% filter(Name==unqPep[i] & Group!="Indeterminate" & timept=="T0")) # Overall T0 ANOVA: lm1FStat<-summary(lm1)$fstatistic pepDFT0Res$T0_Anova[i]<-pf(lm1FStat[1],lm1FStat[2],lm1FStat[3],lower.tail=FALSE) # T0 Means: lm1Emmeans<-as.data.frame(emmeans(lm1,~Group)) pepDFT0Res$T0_sCAD[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="sCAD"] pepDFT0Res$T0_Type1[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="Type 1"] pepDFT0Res$T0_Type2[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="Type 2"] # Pairwise T0: lm1Pairs<-as.data.frame(pairs(emmeans(lm1,~Group),adjust="none")) pepDFT0Res$T0_Type1_sCAD[i]<- (-lm1Pairs$estimate[lm1Pairs$contrast=="sCAD - Type 1"]) pepDFT0Res$T0_Type2_sCAD[i]<- (-lm1Pairs$estimate[lm1Pairs$contrast=="sCAD - Type 2"]) pepDFT0Res$T0_Type1_Type2[i]<- (lm1Pairs$estimate[lm1Pairs$contrast=="Type 1 - Type 2"]) # Pairwise T0 p-value pepDFT0Res$T0_Type1_sCAD_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="sCAD - Type 1"]) pepDFT0Res$T0_Type2_sCAD_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="sCAD - Type 2"]) pepDFT0Res$T0_Type1_Type2_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="Type 1 - Type 2"]) print(i) } pepDFT0Res<-pepDFT0Res %>% left_join(pepAnno2,by=c("unqPep"="pepSeq")) pepDFT0ResGood<-pepDFT0Res %>% filter(goodQuant>.8 & T0_Type1_sCAD_p<.1 & T0_Type1_Type2_p<.1) ########### Peptide Temporal Difference analysis ########### pepDFw<-pepDF %>% dplyr::select(-rep) %>% tidyr::spread(key="timept",value="Intensity") pepDFw$d<-pepDFw$T0-pepDFw$FU pepDFDRes<-data.frame(unqPep=unqPep,D_sCAD=NA,D_Type1=NA,D_Type2=NA, D_Anova=NA,D_Type1_sCAD=NA,D_Type2_sCAD=NA,D_Type1_Type2=NA, D_Type1_sCAD_p=NA,D_Type2_sCAD_p=NA,D_Type1_Type2_p=NA) for(i in 1:length(unqPep)){ # Linear Model lm1<-lm(d~Group,data=pepDFw %>% filter(Name==unqPep[i] & Group!="Indeterminate")) # Overall T0 ANOVA: lm1FStat<-summary(lm1)$fstatistic pepDFDRes$D_Anova[i]<-pf(lm1FStat[1],lm1FStat[2],lm1FStat[3],lower.tail=FALSE) # Time-point Means: lm1Emmeans<-as.data.frame(emmeans(lm1,~Group)) pepDFDRes$D_sCAD[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="sCAD"] pepDFDRes$D_Type1[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="Type 1"] pepDFDRes$D_Type2[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="Type 2"] # Pairwise D: lm1Pairs<-as.data.frame(pairs(emmeans(lm1,~Group),adjust="none")) pepDFDRes$D_Type1_sCAD[i]<- (-lm1Pairs$estimate[lm1Pairs$contrast=="sCAD - Type 1"]) pepDFDRes$D_Type2_sCAD[i]<- (-lm1Pairs$estimate[lm1Pairs$contrast=="sCAD - Type 2"]) pepDFDRes$D_Type1_Type2[i]<- (lm1Pairs$estimate[lm1Pairs$contrast=="Type 1 - Type 2"]) # Pairwise T0 p-value pepDFDRes$D_Type1_sCAD_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="sCAD - Type 1"]) pepDFDRes$D_Type2_sCAD_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="sCAD - Type 2"]) pepDFDRes$D_Type1_Type2_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="Type 1 - Type 2"]) print(i) } pepDFDRes<-pepDFDRes %>% left_join(pepAnno2,by=c("unqPep"="pepSeq")) pepDFDResGood<-pepDFDRes %>% filter(goodQuant>.8 & D_Type1_sCAD_p<.1 & D_Type1_Type2_p<.1) rm(lm1,lm1Emmeans,lm1Pairs,i,lm1FStat,unqPep) ########### Protein Aggregation ########### protList<-paste(pepAnno2$proteins,collapse=";") protList<-unique(unlist(str_split(protList,";"))) Prot<-data.frame(prot=protList,lvl=NA,nPep=NA,peps=NA) for(prot in Prot$prot){ peps<-pepAnno2$pepSeq[grepl(prot,pepAnno2$proteins,fixed=TRUE) & pepAnno2$protN==1 & pepAnno2$goodQuant>.3] pepsAll<-pepAnno2$pepSeq[grepl(prot,pepAnno2$proteins,fixed=TRUE)] if(length(peps)>0){ Prot$peps[Prot$prot==prot]<-paste(peps,collapse=";") Prot$nPep[Prot$prot==prot]<-length(peps) } if(length(pepsAll)>0){ Prot$pepsAll[Prot$prot==prot]<-paste(pepsAll,collapse=";") Prot$nPepAll[Prot$prot==prot]<-length(pepsAll) } } Prot0<-Prot ProtOut<-Prot[is.na(Prot$nPep),] Prot<-Prot[!is.na(Prot$nPep),] # Calculate mean to make the protein abundances pepsInProtList<-list() for(i in 1:nrow(Prot)){ pepsInProt<-unlist(str_split(Prot$peps[i],";")) pepsInProtDF<-pep1[pep1$Name %in% pepsInProt,] pepsInProtDF$Name<-NULL pepsInProtDF<-t(t(apply(pepsInProtDF,2,mean))) pepsInProtDF<-as.data.frame(pepsInProtDF) names(pepsInProtDF)[1]<-"value" pepsInProtDF$prot<-Prot$prot[i] pepsInProtDF$rep<-rownames(pepsInProtDF) pepsInProtList[[i]]<-pepsInProtDF } prots<-do.call("rbind",pepsInProtList) # Add sample annotation: prots$rep<-gsub("rep_","",prots$rep) prots<-prots %>% left_join(pheno %>% dplyr::select(uSamp,Group,ptid,timept) %>% unique(), by=c("rep"="uSamp")) unqProts<-unique(prots$prot) ########### Join prot data to peptide data ########### # Baseline abundances: pepDFT0Res$OtherPepGood<-pepDFT0Res$OtherPepTotal<-pepDFT0Res$otherCor<-pepDFT0Res$otherGoodCor<-NA for(i in 1:nrow(pepDFT0Res)){ tempProts<-pepDFT0Res$proteins[i] tempProts<-unlist(str_split(tempProts,";")) tempProts<-str_split(str_split(tempProts,"\\|",simplify=TRUE)[,2], "-",simplify=TRUE)[,1] allPepsDF<-pepDFT0Res[grepl(paste(tempProts,collapse="|"), pepDFT0Res$proteins),] allPeps<-unique(allPepsDF$unqPep) allPepsGood<-unique(allPepsDF[allPepsDF$goodQuant>.3,]$unqPep) pepDFT0Res$OtherPepTotal[i]<-length(allPeps) pepDFT0Res$OtherPepGood[i]<-length(allPepsGood) # Correlation analysis: mat1<-as.matrix(pep1[pep1$Name %in% allPeps,names(pep1)!="Name"]) mat2<-as.matrix(pep1[pep1$Name %in% allPepsGood,names(pep1)!="Name"]) corMat1<-cor(t(mat1)) corMat2<-cor(t(mat2)) pepDFT0Res$otherCor[i]<-mean(corMat1[rownames(corMat1)!=pepDFT0Res$unqPep[i], colnames(corMat1)==pepDFT0Res$unqPep[i]]) pepDFT0Res$otherGoodCor[i]<-mean(corMat2[rownames(corMat2)!=pepDFT0Res$unqPep[i], colnames(corMat2)==pepDFT0Res$unqPep[i]]) print(i) } # Change across time: pepDFDRes$OtherPepGood<-pepDFDRes$OtherPepTotal<-pepDFDRes$otherCor<-pepDFDRes$otherGoodCor<-NA for(i in 1:nrow(pepDFDRes)){ tempProts<-pepDFDRes$proteins[i] tempProts<-unlist(str_split(tempProts,";")) tempProts<-str_split(str_split(tempProts,"\\|",simplify=TRUE)[,2], "-",simplify=TRUE)[,1] allPepsDF<-pepDFDRes[grepl(paste(tempProts,collapse="|"), pepDFDRes$proteins),] allPeps<-unique(allPepsDF$unqPep) allPepsGood<-unique(allPepsDF[allPepsDF$goodQuant>.3,]$unqPep) pepDFDRes$OtherPepTotal[i]<-length(allPeps) pepDFDRes$OtherPepGood[i]<-length(allPepsGood) # Correlation analysis: mat1<-as.matrix(pep1[pep1$Name %in% allPeps,names(pep1)!="Name"]) mat2<-as.matrix(pep1[pep1$Name %in% allPepsGood,names(pep1)!="Name"]) corMat1<-cor(t(mat1)) corMat2<-cor(t(mat2)) pepDFDRes$otherCor[i]<-median(corMat1[rownames(corMat1)!=pepDFDRes$unqPep[i], colnames(corMat1)==pepDFDRes$unqPep[i]]) pepDFDRes$otherGoodCor[i]<-median(corMat2[rownames(corMat2)!=pepDFDRes$unqPep[i], colnames(corMat2)==pepDFDRes$unqPep[i]]) print(i) } # Join: pepDFRes<-pepDFT0Res %>% full_join( pepDFDRes %>% dplyr::select("unqPep","D_sCAD","D_Type1","D_Type2","D_Anova", "D_Type1_sCAD","D_Type2_sCAD","D_Type1_Type2", "D_Type1_sCAD_p","D_Type2_sCAD_p","D_Type1_Type2_p"), by=c("unqPep")) ########### Add peptide criteria ########### # Criteria 1: Fold change across time in Type 1 (ln-scale) > 1; # Diff between sCAD and Type 1 fold change across time (ln-scale) > 0.75 # pepDFRes$crit1 <- abs(pepDFRes$D_Type1 > 1) & abs(pepDFRes$D_Type1_sCAD > .75) # New Criteria 1: pepDFRes$crit1<-pepDFRes$D_Type1_sCAD_p<.05 # Criteria 2: If >1 other peptide from protein or family, correlation > .5? pepDFRes$crit2 <- FALSE pepDFRes$crit2[(pepDFRes$OtherPepTotal > 1 & pepDFRes$otherCor > .5) | (pepDFRes$OtherPepTotal ==1)] <- TRUE # Criteria 3: No missed cleavages pepDFRes$crit3 <- pepDFRes$miss == 1 # Criteria 4: No oxidized Met pepDFRes$crit4 <- !grepl("M\\[Oxid\\]",pepDFRes$unqPep) # Criteria 5: If #1-#4 pepDFRes$crit5 <- pepDFRes$crit1 & pepDFRes$crit2 & pepDFRes$crit3 & pepDFRes$crit4 # Criteria 6: If different between type 1 MI and sCAD at T0: # pepDFRes$crit6 <- abs(pepDFRes$T0_Type1_sCAD)>.5 # New Criteria 6: pepDFRes$crit6<-pepDFRes$T0_Type1_sCAD_p<.1 # Criteria 7: Criteria 5 and 6: pepDFRes$crit7 <- pepDFRes$crit5 & pepDFRes$crit6 # Export peptide results: # write.csv(pepDFRes,"pepDFResV2.csv") ########### Protein level analysis ########### # Baseline protDFT0Res<-data.frame(prot=unqProts,T0_sCAD=NA,T0_Type1=NA,T0_Type2=NA, T0_Anova=NA,T0_Type1_sCAD=NA,T0_Type2_sCAD=NA,T0_Type1_Type2=NA, T0_Type1_sCAD_p=NA,T0_Type2_sCAD_p=NA,T0_Type1_Type2_p=NA) for(i in 1:nrow(protDFT0Res)){ # Linear Model lm1<-lm(value~Group,data=prots %>% filter(prot==protDFT0Res$prot[i] & Group!="Indeterminate" & timept=="T0")) # Overall T0 ANOVA: lm1FStat<-summary(lm1)$fstatistic protDFT0Res$T0_Anova[i]<-pf(lm1FStat[1],lm1FStat[2],lm1FStat[3],lower.tail=FALSE) # T0 Means: lm1Emmeans<-as.data.frame(emmeans(lm1,~Group)) protDFT0Res$T0_sCAD[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="sCAD"] protDFT0Res$T0_Type1[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="Type 1"] protDFT0Res$T0_Type2[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="Type 2"] # Pairwise T0: lm1Pairs<-as.data.frame(pairs(emmeans(lm1,~Group),adjust="none")) protDFT0Res$T0_Type1_sCAD[i]<- (-lm1Pairs$estimate[lm1Pairs$contrast=="sCAD - Type 1"]) protDFT0Res$T0_Type2_sCAD[i]<- (-lm1Pairs$estimate[lm1Pairs$contrast=="sCAD - Type 2"]) protDFT0Res$T0_Type1_Type2[i]<- (lm1Pairs$estimate[lm1Pairs$contrast=="Type 1 - Type 2"]) # Pairwise T0 p-value protDFT0Res$T0_Type1_sCAD_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="sCAD - Type 1"]) protDFT0Res$T0_Type2_sCAD_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="sCAD - Type 2"]) protDFT0Res$T0_Type1_Type2_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="Type 1 - Type 2"]) print(i) } ############ Protein Change across time ############ protsW<-prots %>% dplyr::select(-rep) %>% tidyr::spread(key="timept",value="value") protsW$d<-protsW$T0-protsW$FU protDFDRes<-data.frame(prot=unqProts,D_sCAD=NA,D_Type1=NA,D_Type2=NA, D_Anova=NA,D_Type1_sCAD=NA,D_Type2_sCAD=NA,D_Type1_Type2=NA, D_Type1_sCAD_p=NA,D_Type2_sCAD_p=NA,D_Type1_Type2_p=NA) for(i in 1:nrow(protDFDRes)){ # Linear Model lm1<-lm(d~Group,data=protsW %>% filter(prot==protDFDRes$prot[i] & Group!="Indeterminate")) # Overall T0 ANOVA: lm1FStat<-summary(lm1)$fstatistic protDFDRes$D_Anova[i]<-pf(lm1FStat[1],lm1FStat[2],lm1FStat[3],lower.tail=FALSE) # D Means: lm1Emmeans<-as.data.frame(emmeans(lm1,~Group)) protDFDRes$D_sCAD[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="sCAD"] protDFDRes$D_Type1[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="Type 1"] protDFDRes$D_Type2[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="Type 2"] # Pairwise D: lm1Pairs<-as.data.frame(pairs(emmeans(lm1,~Group),adjust="none")) protDFDRes$D_Type1_sCAD[i]<- (-lm1Pairs$estimate[lm1Pairs$contrast=="sCAD - Type 1"]) protDFDRes$D_Type2_sCAD[i]<- (-lm1Pairs$estimate[lm1Pairs$contrast=="sCAD - Type 2"]) protDFDRes$D_Type1_Type2[i]<- (lm1Pairs$estimate[lm1Pairs$contrast=="Type 1 - Type 2"]) # Pairwise D p-value protDFDRes$D_Type1_sCAD_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="sCAD - Type 1"]) protDFDRes$D_Type2_sCAD_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="sCAD - Type 2"]) protDFDRes$D_Type1_Type2_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="Type 1 - Type 2"]) print(i) } # Save rm(corMat1,corMat2,lm1,lm1Emmeans,lm1FStat,lm1Pairs,mat1,mat2,allPeps, allPepsGood,i,peps,pepsAll,pepsInProt,prot,protList,tempProts,unqProts) save.image(file="working_20181007.RData") ########### Peptide plots ########### load(file="working_20181007.RData") sigPeps<-pepDFRes$unqPep[pepDFRes$crit7 & pepDFRes$length<25 & pepDFRes$goodQuant > .05] sigPeps2<-pepDFRes$unqPep[grepl("P04275",pepDFRes$proteins)] sigPeps<-c(sigPeps,sigPeps2) pepsSig<-pepDFRes[pepDFRes$unqPep %in% sigPeps,] customTitles<-matrix(c( "NSEEFAAAMSR","Apolipoprotein B-100", "YYTYLIMNK","Complement C3", "C[Carboxymethyl]EWETPEGC[Carboxymethyl]EQVLTGK","C4b-binding protein alpha chain", "LQQVLHAGSGPC[Carboxymethyl]LPHLLSR","Alpha-2-antiplasmin", "LC[Carboxymethyl]MGSGLNLC[Carboxymethyl]EPNNK","Serotransferrin", "KPVAFSDYIHPVC[Carboxymethyl]LPDR","Prothrombin", "YEITTIHNLFR","Heparin cofactor 2", "EVVADSVWVDVK","Complement C3", "TVMVNIENPEGIPVK","Complement C3", "TSSFALNLPTLPEVK","Apolipoprotein B-100", "NFVASHIANILNSEELDIQDLK","Apolipoprotein B-100", "YTIAALLSPYSYSTTAVVTNPK","Transthyretin", "EALQGVGDMGR","Serum amyloid A-4 protein", "EWFSETFQK","Apolipoprotein C-I", "NIQEYLSILTDPDGK","Apolipoprotein B-100", "SGSSTASWIQNVDTK","Apolipoprotein B-100", "AGPHC[Carboxymethyl]PTAQLIATLK","Platelet Factor 4", "AASGTTGTYQEWK","Apolipoprotein B-100", "GTHC[Carboxymethyl]NQVEVIATLK","Platelet basic protein", "LIVAMSSWLQK","Apolipoprotein B-100", "HIQNIDIQHLAGK","Apolipoprotein B-100", "EDVYVVGTVLR","C4b-binding protein alpha chain", "EELC[Carboxymethyl]TMFIR","Apolipoprotein B-100", "HITSLEVIK","Platelet factor 4", "SLMLHYEFLQR","Complement component C8 beta chain", "ALVEQGFTVPEIK","Apolipoprotein B-100", "AVLTIDEK","Alpha-1-antitrypsin", "LC[Carboxymethyl]GC[Carboxymethyl]LELLLQFDQK","RUN and FYVE domain-containing protein 4", "NIQSLEVIGK","Platelet basic protein", "ATAVVDGAFK","Peroxiredoxin-2", "VIVIPVGIGPHANLK","von Willebrand factor", "YTLFQIFSK","von Willebrand factor" ), ncol=2,byrow=TRUE) customTitles<-as.data.frame(customTitles) names(customTitles)<-c("unqPep","Title") pepsSig<-pepsSig %>% left_join(customTitles) # Plot function: pFun1<-function(iter,ylower,yupper){ temp1<-pepDF[pepDF$Name==pepsSig$unqPep[iter] & pepDF$Group != "Indeterminate",] ggplot(temp1,aes(timept,Intensity,color=Group,group=ptid))+ geom_point()+geom_line()+ylim(ylower,yupper)+theme_bw()+facet_grid(~Group)+ ggtitle(pepsSig$unqPep[iter], subtitle=paste0(pepsSig$Title[iter],". cor = ",round(pepsSig$otherCor[iter],3)))+ xlab("Time-point")+ylab("Abundance")+ theme(plot.title = element_text(hjust = 0.5), plot.subtitle = element_text(hjust = 0.5)) } pepsSig<-pepsSig %>% arrange(Title,unqPep) # pFun1(1,-2,2) # pFun1(2,-3,3) pFun1(3,-1.5,1.75) pFun1(4,-3,3) pFun1(5,-3,4) pFun1(6,-1.25,2.1) pFun1(7,-2,2.25) pFun1(8,-1,1.25) pFun1(9,-1.5,3) pFun1(10,-1.1,1.5) pFun1(11,-3,3) pFun1(12,-1.1,1.3) pFun1(13,-1.2,1) # pFun1(14,-3,3) # pFun1(15,-3,3) # pFun1(16,-3,3) # pFun1(17,-3,3) # pFun1(18,-3,3) # pFun1(19,-3,3) pFun1(20,-1.1,1) # pFun1(21,-3,3) pFun1(22,-7.5,5.25) pFun1(23,-2,3) pFun1(24,-6.5,5.25) pFun1(25,-5,5) pFun1(26,-.9,.7) # pFun1(27,-3,3) # pFun1(28,-3,3) # pFun1(29,-3,3) pFun1(30,-1.2,1) pFun1(31,-5,3) pFun1(32,-4.5,3.2) ########### Peptide pull protein analysis ########### setwd("~/gdrive/AthroProteomics") load(file="working_20180821.RData") # Which proteins: str_split(pepDFRes$proteins,";")
/analysis.R
no_license
trainorp/atheroProteomics
R
false
false
29,793
r
########### Prereqs ########### # Begin always run: options(stringsAsFactors=FALSE,scipen=600) library(tidyverse) library(gridExtra) library(emmeans) library(multcomp) library(corrplot) # Ensembl library() # End always run setwd("~/gdrive/AthroProteomics/data") peptides<-read.csv('peptide_table_20180514.csv') proteins<-read.csv('protein_table_20180514.csv') reg1<-regexpr("JVE.",text=names(peptides)) reg2<-regexpr(".File.Area.s.",text=names(peptides)) reg1DF<-data.frame(include=reg1>0,start=as.integer(reg1)+attr(reg1,"match.length"), stop=as.integer(reg2)-1L) names1<-substr(names(peptides),start=reg1DF$start,stop=reg1DF$stop) names2<-str_split(names1,"\\.",simplify=TRUE) pheno<-data.frame(oldName=names(peptides)[names1!=""],ptid=names2[names1!="",1], timept=names2[names1!="",2],replicate=as.integer(names2[names1!="",3])) pheno$newName<-paste0("rep_",1L:length(pheno$oldName)) names(peptides)[match(pheno$oldName,names(peptides))]<-pheno$newName names(proteins)[match(pheno$oldName,names(proteins))]<-pheno$newName pheno$uSamp<-paste(pheno$ptid,pheno$timept,sep="_") # Phenotype data: groups<-read.csv(file="~/gdrive/Athro/groups_20180515.csv") groups$ptid<-as.character(groups$ptid) groups$Group<-"sCAD" groups$Group[!is.na(groups$MIGroup)]<-groups$MIGroup[!is.na(groups$MIGroup)] pheno<-pheno %>% left_join(groups) # Remove 2010_T0 because there are 4 replicates! peptides<-peptides[,!(colnames(peptides) %in% pheno$newName[pheno$uSamp=="2010_T0"])] pheno<-pheno %>% filter(uSamp != "2010_T0") # Wide data: makeWideFun<-function(data){ peptidesL<-data %>% dplyr::select(-Quality.Score,-(Parent.Protein:Percent.Files.With.Good.Quant)) %>% gather(key="rep",value="Intensity",-Name) peptidesL<-pheno %>% left_join(groups) %>% left_join(peptidesL,by=c("newName"="rep")) peptidesL$GroupTime<-paste(peptidesL$Group,peptidesL$timept,sep=".") peptidesL$GroupTime<-factor(peptidesL$GroupTime, levels=c("sCAD.FU","sCAD.T0","Type 1.FU","Type 1.T0","Type 2.FU","Type 2.T0", "Indeterminate.FU","Indeterminate.T0")) peptidesL<-peptidesL %>% arrange(GroupTime,ptid,replicate) temp1<-peptidesL %>% dplyr::select(GroupTime,ptid,replicate) %>% unique() temp1$uID<-as.factor(1L:nrow(temp1)) peptidesL<-temp1 %>% left_join(peptidesL) return(peptidesL) } # Export peptide sequences for protein query: pepSeqs<-peptides$Name pepSeqs<-gsub("(\\[.*?\\])","",pepSeqs) pepSeqsStr<-paste(pepSeqs,collapse=",") # write.table(pepSeqsStr,file="pepSeqsStr.txt",quote=FALSE,row.names=FALSE) # Export other peptide annotation: pepAnno<-peptides %>% dplyr::select(Name,Quality.Score,ParentProtein.FullName,Use.For.Quant, Percent.Files.With.Good.Quant) # save(pepAnno,file="pepAnno.RData") setwd("~/gdrive/AthroProteomics/") ########### Normalization ########### m0<-as.matrix(peptides[,grepl("rep",names(peptides))]) # Minimum value imputation: mins<-apply(m0,2,function(x) min(x[x>0])) for(i in 1:ncol(m0)){ m0[,i][m0[,i]<1e-6]<-mins[i] } # Log-transform: m00<-m0 peptides00<-peptides peptides00[,grepl("rep",names(peptides00))]<-m00 m0<-log2(m0) peptides[,grepl("rep",names(peptides))]<-m0 peptidesL<-makeWideFun(peptides) # png(file="Plots/peptideNoNorm.png",height=5,width=10,units="in",res=300) p0<-ggplot(data=peptidesL,aes(x=uID,group=newName,color=GroupTime,y=Intensity))+ geom_boxplot()+theme_bw()+xlab("")+ylab("Intensity (log scale)")+ theme(axis.text.x=element_blank()) show(p0) # dev.off() # Columnwise total intensity normalization: cSums<-apply(m00,2,sum) cFac<-cSums/mean(cSums) m1<-m00 for(i in 1:ncol(m1)) m1[,i]<-m1[,i]/cFac[i] m1b<-m1 # Median normalization cMed<-apply(m1,2,median) cFac2<-cMed/mean(cMed) for(i in 1:ncol(m1b)) m1b[,i]<-m1b[,i]/cFac2[i] peptides1b<-peptides1<-peptides00 peptides1[,grepl("rep",names(peptides1))]<-log2(m1) peptides1b[,grepl("rep",names(peptides1b))]<-log2(m1b) peptidesL1<-makeWideFun(peptides1) peptidesL1b<-makeWideFun(peptides1b) # png(file="Plots/peptideColNorm.png",height=5,width=10,units="in",res=300) p1<-ggplot(data=peptidesL1,aes(x=uID,group=newName,color=GroupTime,y=Intensity))+ geom_boxplot()+theme_bw()+xlab("")+ylab("Intensity (log scale)")+ theme(axis.text.x=element_blank()) show(p1) # dev.off() # png(file="Plots/peptideColMedNorm.png",height=5,width=10,units="in",res=300) p1b<-ggplot(data=peptidesL1b,aes(x=uID,group=newName,color=GroupTime,y=Intensity))+ geom_boxplot()+theme_bw()+xlab("")+ylab("Intensity (log scale)")+ theme(axis.text.x=element_blank()) show(p1b) # dev.off() # png(file="Plots/peptideNoneVColNorm.png",height=10,width=10,units="in",res=300) grid.arrange(p0,p1,nrow=2) # dev.off() # Quantile normalization: m2<-preprocessCore::normalize.quantiles(m0) peptides2<-peptides peptides2[,grepl("rep",names(peptides2))]<-m2 peptidesL2<-makeWideFun(peptides2) # png(file="Plots/peptideQuantNorm.png",height=5,width=10,units="in",res=300) p2<-ggplot(data=peptidesL2,aes(x=uID,group=newName,color=GroupTime,y=Intensity))+ geom_boxplot()+theme_bw()+xlab("")+ylab("Intensity (log scale)")+ theme(axis.text.x=element_blank()) show(p2) # dev.off() # Cyclic loess: m3<-limma::normalizeCyclicLoess(m0) peptides3<-peptides peptides3[,grepl("rep",names(peptides3))]<-m3 peptidesL3<-makeWideFun(peptides3) # png(file="Plots/peptideFastCyclicLoess.png",height=5,width=10,units="in",res=300) p3<-ggplot(data=peptidesL3,aes(x=uID,group=newName,color=GroupTime,y=Intensity))+ geom_boxplot()+theme_bw()+xlab("")+ylab("Intensity (log scale)")+ theme(axis.text.x=element_blank()) show(p3) # dev.off() # Cyclic loess bGal only: bGalWeights<-as.numeric(grepl("P00722",peptides$Parent.Protein) & peptides$Percent.Files.With.Good.Quant>.99) m4<-limma::normalizeCyclicLoess(m0,weights = bGalWeights) peptides4<-peptides peptides4[,grepl("rep",names(peptides4))]<-m4 peptidesL4<-makeWideFun(peptides4) # png(file="Plots/peptideFastCyclicLoessbGalOnly.png",height=5,width=10,units="in",res=300) p4<-ggplot(data=peptidesL4,aes(x=uID,group=newName,color=GroupTime,y=Intensity))+ geom_boxplot()+theme_bw()+xlab("")+ylab("Intensity (log scale)")+ theme(axis.text.x=element_blank()) show(p4) # dev.off() # Cyclic loess half & half bGal only: bGalWeights2<-bGalWeights+.2 bGalWeights2<-ifelse(bGalWeights2>1,1.0,bGalWeights2) m5<-limma::normalizeCyclicLoess(m0,weights = bGalWeights2) peptides5<-peptides peptides5[,grepl("rep",names(peptides5))]<-m5 peptidesL5<-makeWideFun(peptides5) # png(file="Plots/peptideFastCyclicLoessbGalHeavy.png",height=5,width=10,units="in",res=300) p5<-ggplot(data=peptidesL5,aes(x=uID,group=newName,color=GroupTime,y=Intensity))+ geom_boxplot()+theme_bw()+xlab("")+ylab("Intensity (log scale)")+ theme(axis.text.x=element_blank()) show(p5) # dev.off() # MAD: m6<-limma::normalizeMedianAbsValues(m0) peptides6<-peptides peptides6[,grepl("rep",names(peptides6))]<-m6 peptidesL6<-makeWideFun(peptides6) # png(file="Plots/peptideMAD.png",height=5,width=10,units="in",res=300) p6<-ggplot(data=peptidesL6,aes(x=uID,group=newName,color=GroupTime,y=Intensity))+ geom_boxplot()+theme_bw()+xlab("")+ylab("Intensity (log scale)")+ theme(axis.text.x=element_blank()) show(p6) # dev.off() # Beta gal: bGalFun<-function(data,method){ # betaGal data: bGal<-data %>% filter(grepl("P00722",ParentProtein.FullName) & Percent.Files.With.Good.Quant>.99) set.seed(3) bGalShort<-sample(bGal$Name,8) bGalL<-bGal %>% dplyr::select(-Quality.Score,-(Parent.Protein:Percent.Files.With.Good.Quant)) %>% gather(key="rep",value="Intensity",-Name) bGalLNames<-bGalL %>% dplyr::select(Name) %>% unique() bGalLNames$id<-as.factor(1:nrow(bGalLNames)) bGalL<-bGalLNames %>% left_join(bGalL) # CVs: cv<-bGalL %>% group_by(Name) %>% summarize(cv=sd(2**Intensity)/mean(2**Intensity)*100) names(cv)[names(cv)=="cv"]<-paste0(method,"CV") # Plots: fName<-paste0("Plots/bGalPeptides_",method,"_Full.png") # png(filename=fName,height=5,width=8,units="in",res=300) bGalp<-ggplot(bGalL,aes(x=rep,y=Intensity,group=Name,color=id))+ geom_line()+ylim(23,32)+theme_bw()+xlab("Replicate")+ylab("Intensity (log scale)") print(bGalp) # dev.off() fName2<-paste0("Plots/bGalPeptides_",method,"_Samp.png") # png(filename=fName2,height=5,width=8,units="in",res=300) bGalp2<-ggplot(bGalL %>% filter(Name %in% bGalShort), aes(x=rep,y=Intensity,group=Name,color=id))+ geom_line()+ylim(26,31.75)+theme_bw()+xlab("Replicate")+ylab("Intensity (log scale)") print(bGalp2) # dev.off() return(cv) } bGalCVs<-cbind( bGalFun(data=peptides,method="none"), bGalFun(data=peptides1,method="columnTI")[,-1], bGalFun(data=peptides1b,method="columnTIMed")[,-1], bGalFun(peptides2,method="Quant")[,-1], bGalFun(peptides3,method="FCycLoess")[,-1], bGalFun(peptides4,method="FCycLoessbGal")[,-1], bGalFun(peptides5,method="FCycLoessbGalLight")[,-1], bGalFun(peptides6,method="MAD")[,-1] ) # write.csv(bGalCVs,file="bGalCVs.csv",row.names=FALSE) ########### Un log-transform ########### peptides1[,grepl("rep_",names(peptides1))]<- 2**peptides1[,grepl("rep_",names(peptides1))] peptides2[,grepl("rep_",names(peptides2))]<- 2**peptides2[,grepl("rep_",names(peptides2))] peptides3[,grepl("rep_",names(peptides3))]<- 2**peptides3[,grepl("rep_",names(peptides3))] peptides4[,grepl("rep_",names(peptides4))]<- 2**peptides4[,grepl("rep_",names(peptides4))] peptides5[,grepl("rep_",names(peptides5))]<- 2**peptides5[,grepl("rep_",names(peptides5))] peptides6[,grepl("rep_",names(peptides6))]<- 2**peptides6[,grepl("rep_",names(peptides6))] ########### Rownames ########### rownames(peptides00)<-peptides00$Name rownames(peptides1)<-peptides1$Name rownames(peptides2)<-peptides2$Name rownames(peptides3)<-peptides3$Name rownames(peptides4)<-peptides4$Name rownames(peptides5)<-peptides5$Name rownames(peptides6)<-peptides6$Name ########### My beta-gal protein normalization ########### load("~/gdrive/AthroProteomics/data/pepAnno2.RData") pinEcoli<-pepAnno2 %>% filter(grepl("P00722",proteins) & goodQuant>.99 & pinUseQuant=="Yes") myEColi<-pepAnno2 %>% filter(grepl("P00722",proteins) & goodQuant>.99 & !grepl("(\\[.*?\\])",pepSeq)) myEColiIntensPep00<-peptides00[peptides00$Name %in% myEColi$pepSeq, grepl("rep_",names(peptides00))] myEColiIntensPep1<-peptides1[peptides1$Name %in% myEColi$pepSeq, grepl("rep_",names(peptides1))] myEColiIntensPep2<-peptides2[peptides2$Name %in% myEColi$pepSeq, grepl("rep_",names(peptides2))] myEColiIntensPep3<-peptides3[peptides3$Name %in% myEColi$pepSeq, grepl("rep_",names(peptides3))] myEColiIntensPep4<-peptides4[peptides4$Name %in% myEColi$pepSeq, grepl("rep_",names(peptides4))] myEColiIntensPep5<-peptides5[peptides5$Name %in% myEColi$pepSeq, grepl("rep_",names(peptides5))] myEColiIntensPep6<-peptides6[peptides6$Name %in% myEColi$pepSeq, grepl("rep_",names(peptides6))] cvFun1<-function(data){ return(sd(apply(data,2,sum))/mean(apply(data,2,sum))) } bGalProtCVs<- data.frame(technique=c("None","Column TI","Quantile","CyclicLoess","CyclicLoessBGal", "CyclicLoessBGalLt","MAD"), cv=c(cvFun1(myEColiIntensPep00),cvFun1(myEColiIntensPep1), cvFun1(myEColiIntensPep2),cvFun1(myEColiIntensPep3), cvFun1(myEColiIntensPep4),cvFun1(myEColiIntensPep5), cvFun1(myEColiIntensPep6))) # write.csv(bGalProtCVs,file="bGalProtCVs.csv",row.names=FALSE) ########### Beta gal peptide correlations ########### myEColiIntensPep1<-rbind(myEColiIntensPep1,apply(myEColiIntensPep1,2,sum)) rownames(myEColiIntensPep1)[nrow(myEColiIntensPep1)]<-"Total" cor1<-cor(t(myEColiIntensPep1)) # png("Plots/cor1.png",height=6,width=6,units="in",res=300) corrplot(cor1,type="upper",tl.cex=.4,is.corr=FALSE,cl.lim=c(-.4,1)) # dev.off() myEColiIntensPep5<-rbind(myEColiIntensPep5,apply(myEColiIntensPep5,2,sum)) rownames(myEColiIntensPep5)[nrow(myEColiIntensPep5)]<-"Total" cor5<-cor(t(myEColiIntensPep5)) # png("Plots/cor5.png",height=6,width=6,units="in",res=300) corrplot(cor5,type="upper",tl.cex=.4,is.corr=FALSE,cl.lim=c(-.4,1)) # dev.off() ########### Combine injections ########### combFun<-function(Names,data){ # Output dataframe: df2<-data.frame(Name=Names) # Combine injections for(uSamp in unique(pheno$uSamp)){ df1<-data.frame(value=apply(data[,pheno$newName[pheno$uSamp==uSamp]],1,mean)) names(df1)[names(df1)=="value"]<-paste0("rep_",uSamp) df2<-cbind(df2,df1) } # Median scale & log-transform meds<-apply(df2[,grepl("rep",names(df2))],1,median) for(i in 1:nrow(df2[,grepl("rep",names(df2))])){ df2[,grepl("rep",names(df2))][i,]<-log2(df2[,grepl("rep",names(df2))][i,]/meds[i]) } return(df2) } pep1<-combFun(Names=peptides1$Name,data=peptides1) # Major cleanup: rm(bGalCVs,bGalProtCVs,cor1,cor5,m0,m00,m1,m1b,m2,m3,m4,m5,m6, myEColi,myEColiIntensPep00,myEColiIntensPep1,myEColiIntensPep2, myEColiIntensPep3,myEColiIntensPep4,myEColiIntensPep5,myEColiIntensPep6, names2,p0,p1,p1b,p2,p3,p4,p5,p6,peptides,peptides00,peptides1b, peptides2,peptides3,peptides4,peptides5,peptides6,peptidesL,peptidesL1b, peptidesL2,peptidesL3,peptidesL4,peptidesL5,peptidesL6,proteins, reg1DF,bGalWeights,bGalWeights2,cFac,cFac2,cMed,cSums,i,mins,names1, pepSeqs,pepSeqsStr,reg1,reg2,bGalFun,combFun,cvFun1,makeWideFun, pinEcoli) ########### Peptide difference at baseline ########### pepDF<-pep1 %>% gather(key="rep",value="Intensity",-Name) pepDF$ptid<-str_split(pepDF$rep,"_",simplify=TRUE)[,2] pepDF$timept<-str_split(pepDF$rep,"_",simplify=TRUE)[,3] pepDF<-pepDF %>% left_join(groups) unqPep<-unique(pepDF$Name) pepDFT0Res<-data.frame(unqPep=unqPep,T0_sCAD=NA,T0_Type1=NA,T0_Type2=NA, T0_Anova=NA,T0_Type1_sCAD=NA,T0_Type2_sCAD=NA,T0_Type1_Type2=NA, T0_Type1_sCAD_p=NA,T0_Type2_sCAD_p=NA,T0_Type1_Type2_p=NA) for(i in 1:length(unqPep)){ # Linear Model lm1<-lm(Intensity~Group,data=pepDF %>% filter(Name==unqPep[i] & Group!="Indeterminate" & timept=="T0")) # Overall T0 ANOVA: lm1FStat<-summary(lm1)$fstatistic pepDFT0Res$T0_Anova[i]<-pf(lm1FStat[1],lm1FStat[2],lm1FStat[3],lower.tail=FALSE) # T0 Means: lm1Emmeans<-as.data.frame(emmeans(lm1,~Group)) pepDFT0Res$T0_sCAD[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="sCAD"] pepDFT0Res$T0_Type1[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="Type 1"] pepDFT0Res$T0_Type2[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="Type 2"] # Pairwise T0: lm1Pairs<-as.data.frame(pairs(emmeans(lm1,~Group),adjust="none")) pepDFT0Res$T0_Type1_sCAD[i]<- (-lm1Pairs$estimate[lm1Pairs$contrast=="sCAD - Type 1"]) pepDFT0Res$T0_Type2_sCAD[i]<- (-lm1Pairs$estimate[lm1Pairs$contrast=="sCAD - Type 2"]) pepDFT0Res$T0_Type1_Type2[i]<- (lm1Pairs$estimate[lm1Pairs$contrast=="Type 1 - Type 2"]) # Pairwise T0 p-value pepDFT0Res$T0_Type1_sCAD_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="sCAD - Type 1"]) pepDFT0Res$T0_Type2_sCAD_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="sCAD - Type 2"]) pepDFT0Res$T0_Type1_Type2_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="Type 1 - Type 2"]) print(i) } pepDFT0Res<-pepDFT0Res %>% left_join(pepAnno2,by=c("unqPep"="pepSeq")) pepDFT0ResGood<-pepDFT0Res %>% filter(goodQuant>.8 & T0_Type1_sCAD_p<.1 & T0_Type1_Type2_p<.1) ########### Peptide Temporal Difference analysis ########### pepDFw<-pepDF %>% dplyr::select(-rep) %>% tidyr::spread(key="timept",value="Intensity") pepDFw$d<-pepDFw$T0-pepDFw$FU pepDFDRes<-data.frame(unqPep=unqPep,D_sCAD=NA,D_Type1=NA,D_Type2=NA, D_Anova=NA,D_Type1_sCAD=NA,D_Type2_sCAD=NA,D_Type1_Type2=NA, D_Type1_sCAD_p=NA,D_Type2_sCAD_p=NA,D_Type1_Type2_p=NA) for(i in 1:length(unqPep)){ # Linear Model lm1<-lm(d~Group,data=pepDFw %>% filter(Name==unqPep[i] & Group!="Indeterminate")) # Overall T0 ANOVA: lm1FStat<-summary(lm1)$fstatistic pepDFDRes$D_Anova[i]<-pf(lm1FStat[1],lm1FStat[2],lm1FStat[3],lower.tail=FALSE) # Time-point Means: lm1Emmeans<-as.data.frame(emmeans(lm1,~Group)) pepDFDRes$D_sCAD[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="sCAD"] pepDFDRes$D_Type1[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="Type 1"] pepDFDRes$D_Type2[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="Type 2"] # Pairwise D: lm1Pairs<-as.data.frame(pairs(emmeans(lm1,~Group),adjust="none")) pepDFDRes$D_Type1_sCAD[i]<- (-lm1Pairs$estimate[lm1Pairs$contrast=="sCAD - Type 1"]) pepDFDRes$D_Type2_sCAD[i]<- (-lm1Pairs$estimate[lm1Pairs$contrast=="sCAD - Type 2"]) pepDFDRes$D_Type1_Type2[i]<- (lm1Pairs$estimate[lm1Pairs$contrast=="Type 1 - Type 2"]) # Pairwise T0 p-value pepDFDRes$D_Type1_sCAD_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="sCAD - Type 1"]) pepDFDRes$D_Type2_sCAD_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="sCAD - Type 2"]) pepDFDRes$D_Type1_Type2_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="Type 1 - Type 2"]) print(i) } pepDFDRes<-pepDFDRes %>% left_join(pepAnno2,by=c("unqPep"="pepSeq")) pepDFDResGood<-pepDFDRes %>% filter(goodQuant>.8 & D_Type1_sCAD_p<.1 & D_Type1_Type2_p<.1) rm(lm1,lm1Emmeans,lm1Pairs,i,lm1FStat,unqPep) ########### Protein Aggregation ########### protList<-paste(pepAnno2$proteins,collapse=";") protList<-unique(unlist(str_split(protList,";"))) Prot<-data.frame(prot=protList,lvl=NA,nPep=NA,peps=NA) for(prot in Prot$prot){ peps<-pepAnno2$pepSeq[grepl(prot,pepAnno2$proteins,fixed=TRUE) & pepAnno2$protN==1 & pepAnno2$goodQuant>.3] pepsAll<-pepAnno2$pepSeq[grepl(prot,pepAnno2$proteins,fixed=TRUE)] if(length(peps)>0){ Prot$peps[Prot$prot==prot]<-paste(peps,collapse=";") Prot$nPep[Prot$prot==prot]<-length(peps) } if(length(pepsAll)>0){ Prot$pepsAll[Prot$prot==prot]<-paste(pepsAll,collapse=";") Prot$nPepAll[Prot$prot==prot]<-length(pepsAll) } } Prot0<-Prot ProtOut<-Prot[is.na(Prot$nPep),] Prot<-Prot[!is.na(Prot$nPep),] # Calculate mean to make the protein abundances pepsInProtList<-list() for(i in 1:nrow(Prot)){ pepsInProt<-unlist(str_split(Prot$peps[i],";")) pepsInProtDF<-pep1[pep1$Name %in% pepsInProt,] pepsInProtDF$Name<-NULL pepsInProtDF<-t(t(apply(pepsInProtDF,2,mean))) pepsInProtDF<-as.data.frame(pepsInProtDF) names(pepsInProtDF)[1]<-"value" pepsInProtDF$prot<-Prot$prot[i] pepsInProtDF$rep<-rownames(pepsInProtDF) pepsInProtList[[i]]<-pepsInProtDF } prots<-do.call("rbind",pepsInProtList) # Add sample annotation: prots$rep<-gsub("rep_","",prots$rep) prots<-prots %>% left_join(pheno %>% dplyr::select(uSamp,Group,ptid,timept) %>% unique(), by=c("rep"="uSamp")) unqProts<-unique(prots$prot) ########### Join prot data to peptide data ########### # Baseline abundances: pepDFT0Res$OtherPepGood<-pepDFT0Res$OtherPepTotal<-pepDFT0Res$otherCor<-pepDFT0Res$otherGoodCor<-NA for(i in 1:nrow(pepDFT0Res)){ tempProts<-pepDFT0Res$proteins[i] tempProts<-unlist(str_split(tempProts,";")) tempProts<-str_split(str_split(tempProts,"\\|",simplify=TRUE)[,2], "-",simplify=TRUE)[,1] allPepsDF<-pepDFT0Res[grepl(paste(tempProts,collapse="|"), pepDFT0Res$proteins),] allPeps<-unique(allPepsDF$unqPep) allPepsGood<-unique(allPepsDF[allPepsDF$goodQuant>.3,]$unqPep) pepDFT0Res$OtherPepTotal[i]<-length(allPeps) pepDFT0Res$OtherPepGood[i]<-length(allPepsGood) # Correlation analysis: mat1<-as.matrix(pep1[pep1$Name %in% allPeps,names(pep1)!="Name"]) mat2<-as.matrix(pep1[pep1$Name %in% allPepsGood,names(pep1)!="Name"]) corMat1<-cor(t(mat1)) corMat2<-cor(t(mat2)) pepDFT0Res$otherCor[i]<-mean(corMat1[rownames(corMat1)!=pepDFT0Res$unqPep[i], colnames(corMat1)==pepDFT0Res$unqPep[i]]) pepDFT0Res$otherGoodCor[i]<-mean(corMat2[rownames(corMat2)!=pepDFT0Res$unqPep[i], colnames(corMat2)==pepDFT0Res$unqPep[i]]) print(i) } # Change across time: pepDFDRes$OtherPepGood<-pepDFDRes$OtherPepTotal<-pepDFDRes$otherCor<-pepDFDRes$otherGoodCor<-NA for(i in 1:nrow(pepDFDRes)){ tempProts<-pepDFDRes$proteins[i] tempProts<-unlist(str_split(tempProts,";")) tempProts<-str_split(str_split(tempProts,"\\|",simplify=TRUE)[,2], "-",simplify=TRUE)[,1] allPepsDF<-pepDFDRes[grepl(paste(tempProts,collapse="|"), pepDFDRes$proteins),] allPeps<-unique(allPepsDF$unqPep) allPepsGood<-unique(allPepsDF[allPepsDF$goodQuant>.3,]$unqPep) pepDFDRes$OtherPepTotal[i]<-length(allPeps) pepDFDRes$OtherPepGood[i]<-length(allPepsGood) # Correlation analysis: mat1<-as.matrix(pep1[pep1$Name %in% allPeps,names(pep1)!="Name"]) mat2<-as.matrix(pep1[pep1$Name %in% allPepsGood,names(pep1)!="Name"]) corMat1<-cor(t(mat1)) corMat2<-cor(t(mat2)) pepDFDRes$otherCor[i]<-median(corMat1[rownames(corMat1)!=pepDFDRes$unqPep[i], colnames(corMat1)==pepDFDRes$unqPep[i]]) pepDFDRes$otherGoodCor[i]<-median(corMat2[rownames(corMat2)!=pepDFDRes$unqPep[i], colnames(corMat2)==pepDFDRes$unqPep[i]]) print(i) } # Join: pepDFRes<-pepDFT0Res %>% full_join( pepDFDRes %>% dplyr::select("unqPep","D_sCAD","D_Type1","D_Type2","D_Anova", "D_Type1_sCAD","D_Type2_sCAD","D_Type1_Type2", "D_Type1_sCAD_p","D_Type2_sCAD_p","D_Type1_Type2_p"), by=c("unqPep")) ########### Add peptide criteria ########### # Criteria 1: Fold change across time in Type 1 (ln-scale) > 1; # Diff between sCAD and Type 1 fold change across time (ln-scale) > 0.75 # pepDFRes$crit1 <- abs(pepDFRes$D_Type1 > 1) & abs(pepDFRes$D_Type1_sCAD > .75) # New Criteria 1: pepDFRes$crit1<-pepDFRes$D_Type1_sCAD_p<.05 # Criteria 2: If >1 other peptide from protein or family, correlation > .5? pepDFRes$crit2 <- FALSE pepDFRes$crit2[(pepDFRes$OtherPepTotal > 1 & pepDFRes$otherCor > .5) | (pepDFRes$OtherPepTotal ==1)] <- TRUE # Criteria 3: No missed cleavages pepDFRes$crit3 <- pepDFRes$miss == 1 # Criteria 4: No oxidized Met pepDFRes$crit4 <- !grepl("M\\[Oxid\\]",pepDFRes$unqPep) # Criteria 5: If #1-#4 pepDFRes$crit5 <- pepDFRes$crit1 & pepDFRes$crit2 & pepDFRes$crit3 & pepDFRes$crit4 # Criteria 6: If different between type 1 MI and sCAD at T0: # pepDFRes$crit6 <- abs(pepDFRes$T0_Type1_sCAD)>.5 # New Criteria 6: pepDFRes$crit6<-pepDFRes$T0_Type1_sCAD_p<.1 # Criteria 7: Criteria 5 and 6: pepDFRes$crit7 <- pepDFRes$crit5 & pepDFRes$crit6 # Export peptide results: # write.csv(pepDFRes,"pepDFResV2.csv") ########### Protein level analysis ########### # Baseline protDFT0Res<-data.frame(prot=unqProts,T0_sCAD=NA,T0_Type1=NA,T0_Type2=NA, T0_Anova=NA,T0_Type1_sCAD=NA,T0_Type2_sCAD=NA,T0_Type1_Type2=NA, T0_Type1_sCAD_p=NA,T0_Type2_sCAD_p=NA,T0_Type1_Type2_p=NA) for(i in 1:nrow(protDFT0Res)){ # Linear Model lm1<-lm(value~Group,data=prots %>% filter(prot==protDFT0Res$prot[i] & Group!="Indeterminate" & timept=="T0")) # Overall T0 ANOVA: lm1FStat<-summary(lm1)$fstatistic protDFT0Res$T0_Anova[i]<-pf(lm1FStat[1],lm1FStat[2],lm1FStat[3],lower.tail=FALSE) # T0 Means: lm1Emmeans<-as.data.frame(emmeans(lm1,~Group)) protDFT0Res$T0_sCAD[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="sCAD"] protDFT0Res$T0_Type1[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="Type 1"] protDFT0Res$T0_Type2[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="Type 2"] # Pairwise T0: lm1Pairs<-as.data.frame(pairs(emmeans(lm1,~Group),adjust="none")) protDFT0Res$T0_Type1_sCAD[i]<- (-lm1Pairs$estimate[lm1Pairs$contrast=="sCAD - Type 1"]) protDFT0Res$T0_Type2_sCAD[i]<- (-lm1Pairs$estimate[lm1Pairs$contrast=="sCAD - Type 2"]) protDFT0Res$T0_Type1_Type2[i]<- (lm1Pairs$estimate[lm1Pairs$contrast=="Type 1 - Type 2"]) # Pairwise T0 p-value protDFT0Res$T0_Type1_sCAD_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="sCAD - Type 1"]) protDFT0Res$T0_Type2_sCAD_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="sCAD - Type 2"]) protDFT0Res$T0_Type1_Type2_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="Type 1 - Type 2"]) print(i) } ############ Protein Change across time ############ protsW<-prots %>% dplyr::select(-rep) %>% tidyr::spread(key="timept",value="value") protsW$d<-protsW$T0-protsW$FU protDFDRes<-data.frame(prot=unqProts,D_sCAD=NA,D_Type1=NA,D_Type2=NA, D_Anova=NA,D_Type1_sCAD=NA,D_Type2_sCAD=NA,D_Type1_Type2=NA, D_Type1_sCAD_p=NA,D_Type2_sCAD_p=NA,D_Type1_Type2_p=NA) for(i in 1:nrow(protDFDRes)){ # Linear Model lm1<-lm(d~Group,data=protsW %>% filter(prot==protDFDRes$prot[i] & Group!="Indeterminate")) # Overall T0 ANOVA: lm1FStat<-summary(lm1)$fstatistic protDFDRes$D_Anova[i]<-pf(lm1FStat[1],lm1FStat[2],lm1FStat[3],lower.tail=FALSE) # D Means: lm1Emmeans<-as.data.frame(emmeans(lm1,~Group)) protDFDRes$D_sCAD[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="sCAD"] protDFDRes$D_Type1[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="Type 1"] protDFDRes$D_Type2[i]<-lm1Emmeans$emmean[lm1Emmeans$Group=="Type 2"] # Pairwise D: lm1Pairs<-as.data.frame(pairs(emmeans(lm1,~Group),adjust="none")) protDFDRes$D_Type1_sCAD[i]<- (-lm1Pairs$estimate[lm1Pairs$contrast=="sCAD - Type 1"]) protDFDRes$D_Type2_sCAD[i]<- (-lm1Pairs$estimate[lm1Pairs$contrast=="sCAD - Type 2"]) protDFDRes$D_Type1_Type2[i]<- (lm1Pairs$estimate[lm1Pairs$contrast=="Type 1 - Type 2"]) # Pairwise D p-value protDFDRes$D_Type1_sCAD_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="sCAD - Type 1"]) protDFDRes$D_Type2_sCAD_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="sCAD - Type 2"]) protDFDRes$D_Type1_Type2_p[i]<- (lm1Pairs$p.value[lm1Pairs$contrast=="Type 1 - Type 2"]) print(i) } # Save rm(corMat1,corMat2,lm1,lm1Emmeans,lm1FStat,lm1Pairs,mat1,mat2,allPeps, allPepsGood,i,peps,pepsAll,pepsInProt,prot,protList,tempProts,unqProts) save.image(file="working_20181007.RData") ########### Peptide plots ########### load(file="working_20181007.RData") sigPeps<-pepDFRes$unqPep[pepDFRes$crit7 & pepDFRes$length<25 & pepDFRes$goodQuant > .05] sigPeps2<-pepDFRes$unqPep[grepl("P04275",pepDFRes$proteins)] sigPeps<-c(sigPeps,sigPeps2) pepsSig<-pepDFRes[pepDFRes$unqPep %in% sigPeps,] customTitles<-matrix(c( "NSEEFAAAMSR","Apolipoprotein B-100", "YYTYLIMNK","Complement C3", "C[Carboxymethyl]EWETPEGC[Carboxymethyl]EQVLTGK","C4b-binding protein alpha chain", "LQQVLHAGSGPC[Carboxymethyl]LPHLLSR","Alpha-2-antiplasmin", "LC[Carboxymethyl]MGSGLNLC[Carboxymethyl]EPNNK","Serotransferrin", "KPVAFSDYIHPVC[Carboxymethyl]LPDR","Prothrombin", "YEITTIHNLFR","Heparin cofactor 2", "EVVADSVWVDVK","Complement C3", "TVMVNIENPEGIPVK","Complement C3", "TSSFALNLPTLPEVK","Apolipoprotein B-100", "NFVASHIANILNSEELDIQDLK","Apolipoprotein B-100", "YTIAALLSPYSYSTTAVVTNPK","Transthyretin", "EALQGVGDMGR","Serum amyloid A-4 protein", "EWFSETFQK","Apolipoprotein C-I", "NIQEYLSILTDPDGK","Apolipoprotein B-100", "SGSSTASWIQNVDTK","Apolipoprotein B-100", "AGPHC[Carboxymethyl]PTAQLIATLK","Platelet Factor 4", "AASGTTGTYQEWK","Apolipoprotein B-100", "GTHC[Carboxymethyl]NQVEVIATLK","Platelet basic protein", "LIVAMSSWLQK","Apolipoprotein B-100", "HIQNIDIQHLAGK","Apolipoprotein B-100", "EDVYVVGTVLR","C4b-binding protein alpha chain", "EELC[Carboxymethyl]TMFIR","Apolipoprotein B-100", "HITSLEVIK","Platelet factor 4", "SLMLHYEFLQR","Complement component C8 beta chain", "ALVEQGFTVPEIK","Apolipoprotein B-100", "AVLTIDEK","Alpha-1-antitrypsin", "LC[Carboxymethyl]GC[Carboxymethyl]LELLLQFDQK","RUN and FYVE domain-containing protein 4", "NIQSLEVIGK","Platelet basic protein", "ATAVVDGAFK","Peroxiredoxin-2", "VIVIPVGIGPHANLK","von Willebrand factor", "YTLFQIFSK","von Willebrand factor" ), ncol=2,byrow=TRUE) customTitles<-as.data.frame(customTitles) names(customTitles)<-c("unqPep","Title") pepsSig<-pepsSig %>% left_join(customTitles) # Plot function: pFun1<-function(iter,ylower,yupper){ temp1<-pepDF[pepDF$Name==pepsSig$unqPep[iter] & pepDF$Group != "Indeterminate",] ggplot(temp1,aes(timept,Intensity,color=Group,group=ptid))+ geom_point()+geom_line()+ylim(ylower,yupper)+theme_bw()+facet_grid(~Group)+ ggtitle(pepsSig$unqPep[iter], subtitle=paste0(pepsSig$Title[iter],". cor = ",round(pepsSig$otherCor[iter],3)))+ xlab("Time-point")+ylab("Abundance")+ theme(plot.title = element_text(hjust = 0.5), plot.subtitle = element_text(hjust = 0.5)) } pepsSig<-pepsSig %>% arrange(Title,unqPep) # pFun1(1,-2,2) # pFun1(2,-3,3) pFun1(3,-1.5,1.75) pFun1(4,-3,3) pFun1(5,-3,4) pFun1(6,-1.25,2.1) pFun1(7,-2,2.25) pFun1(8,-1,1.25) pFun1(9,-1.5,3) pFun1(10,-1.1,1.5) pFun1(11,-3,3) pFun1(12,-1.1,1.3) pFun1(13,-1.2,1) # pFun1(14,-3,3) # pFun1(15,-3,3) # pFun1(16,-3,3) # pFun1(17,-3,3) # pFun1(18,-3,3) # pFun1(19,-3,3) pFun1(20,-1.1,1) # pFun1(21,-3,3) pFun1(22,-7.5,5.25) pFun1(23,-2,3) pFun1(24,-6.5,5.25) pFun1(25,-5,5) pFun1(26,-.9,.7) # pFun1(27,-3,3) # pFun1(28,-3,3) # pFun1(29,-3,3) pFun1(30,-1.2,1) pFun1(31,-5,3) pFun1(32,-4.5,3.2) ########### Peptide pull protein analysis ########### setwd("~/gdrive/AthroProteomics") load(file="working_20180821.RData") # Which proteins: str_split(pepDFRes$proteins,";")
# install.packages("jpeg",dependencies = TRUE) # install.packages("ggplot2",dependencies = TRUE) library(jpeg) library(ggplot2) img1 = "image1.jpg" img2 = "image2.jpg" img3 = "image3.jpg" img4 = "image4.jpg" img5 = "image5.jpg" images <- c(img1, img2, img3, img4, img5) # images <- c("image1.jpg") # print(images) for(img in images){ img_name = img; img = readJPEG(img) # print(img) dimensions <- dim(img) img_rgb <- data.frame( x = rep(1:dimensions[2], each = dimensions[1]), y = rep(dimensions[1]:1, dimensions[2]), R = as.vector(img[,,1]), G = as.vector(img[,,2]), B = as.vector(img[,,3]) ) ggplot(data = img_rgb, aes(x = x, y = y)) + geom_point(colour = rgb(img_rgb[c("R", "G", "B")])) + labs(title = "Original Image") + xlab("x") + ylab("y") k <- 2 kmeans_img <- kmeans(img_rgb[,c("R","G","B")], centers = k, iter.max = 5, nstart = 3) clustered_img <- rgb(kmeans_img$centers[kmeans_img$cluster,]) diag_path = file.path(getwd(),"Clustered_Images",paste(k,"-clustered-",img_name,".jpeg",sep="")) jpeg(file=diag_path) pl <- ggplot(data = img_rgb, aes(x = x, y = y)) + geom_point(colour = clustered_img) + labs(title = paste(k, "color cluster on ",img)) + xlab("x") + ylab("y") plot(pl) dev.off() }
/K-Means & Clustering Images/Part-III/ImageSeg.R
no_license
SravaniLingam/Machine-Learning
R
false
false
1,384
r
# install.packages("jpeg",dependencies = TRUE) # install.packages("ggplot2",dependencies = TRUE) library(jpeg) library(ggplot2) img1 = "image1.jpg" img2 = "image2.jpg" img3 = "image3.jpg" img4 = "image4.jpg" img5 = "image5.jpg" images <- c(img1, img2, img3, img4, img5) # images <- c("image1.jpg") # print(images) for(img in images){ img_name = img; img = readJPEG(img) # print(img) dimensions <- dim(img) img_rgb <- data.frame( x = rep(1:dimensions[2], each = dimensions[1]), y = rep(dimensions[1]:1, dimensions[2]), R = as.vector(img[,,1]), G = as.vector(img[,,2]), B = as.vector(img[,,3]) ) ggplot(data = img_rgb, aes(x = x, y = y)) + geom_point(colour = rgb(img_rgb[c("R", "G", "B")])) + labs(title = "Original Image") + xlab("x") + ylab("y") k <- 2 kmeans_img <- kmeans(img_rgb[,c("R","G","B")], centers = k, iter.max = 5, nstart = 3) clustered_img <- rgb(kmeans_img$centers[kmeans_img$cluster,]) diag_path = file.path(getwd(),"Clustered_Images",paste(k,"-clustered-",img_name,".jpeg",sep="")) jpeg(file=diag_path) pl <- ggplot(data = img_rgb, aes(x = x, y = y)) + geom_point(colour = clustered_img) + labs(title = paste(k, "color cluster on ",img)) + xlab("x") + ylab("y") plot(pl) dev.off() }
library(radiant.data) ### Name: make_train ### Title: Generate a variable used to selected a training sample ### Aliases: make_train ### ** Examples make_train(.5, 10)
/data/genthat_extracted_code/radiant.data/examples/make_train.Rd.R
no_license
surayaaramli/typeRrh
R
false
false
176
r
library(radiant.data) ### Name: make_train ### Title: Generate a variable used to selected a training sample ### Aliases: make_train ### ** Examples make_train(.5, 10)
#' An ecological niche model created with Maxent #' #' A RasterLayer containing an ecological niche model for the a tick #' (*Amblyomma americanum*). #' #' @format A RasterLayer with 150 rows, 249 columns, and 37350 cells: #' \describe{ #' \item{Suitability}{suitability, in probability values.} #' } #' #' @source \url{https://kuscholarworks.ku.edu/handle/1808/26376} #' #' @name sp_model #' #' @examples #' model <- raster::raster(system.file("extdata", "sp_model.tif", #' package = "rangemap")) #' #' raster::plot(model) NULL #' A set of environmental variables for examples #' #' A RasterStack containing four bioclimatic variables downloaded from the #' WorldClim database 1.4. #' #' @format A RasterStack with 180 rows, 218 columns, 39240 cells, and 4 layers: #' \describe{ #' \item{variables.1}{bio5.} #' \item{variables.2}{bio6.} #' \item{variables.3}{bio13.} #' \item{variables.4}{bio14.} #' } #' #' @source \url{https://www.worldclim.org/data/v1.4/worldclim14.html} #' #' @name variables #' #' @examples #' vars <- raster::stack(system.file("extdata", "variables.tif", #' package = "rangemap")) #' names(vars) <- c("bio5", "bio6", "bio13", "bio14") #' #' raster::plot(vars) NULL
/R/raster_doc.R
no_license
claununez/rangemap
R
false
false
1,271
r
#' An ecological niche model created with Maxent #' #' A RasterLayer containing an ecological niche model for the a tick #' (*Amblyomma americanum*). #' #' @format A RasterLayer with 150 rows, 249 columns, and 37350 cells: #' \describe{ #' \item{Suitability}{suitability, in probability values.} #' } #' #' @source \url{https://kuscholarworks.ku.edu/handle/1808/26376} #' #' @name sp_model #' #' @examples #' model <- raster::raster(system.file("extdata", "sp_model.tif", #' package = "rangemap")) #' #' raster::plot(model) NULL #' A set of environmental variables for examples #' #' A RasterStack containing four bioclimatic variables downloaded from the #' WorldClim database 1.4. #' #' @format A RasterStack with 180 rows, 218 columns, 39240 cells, and 4 layers: #' \describe{ #' \item{variables.1}{bio5.} #' \item{variables.2}{bio6.} #' \item{variables.3}{bio13.} #' \item{variables.4}{bio14.} #' } #' #' @source \url{https://www.worldclim.org/data/v1.4/worldclim14.html} #' #' @name variables #' #' @examples #' vars <- raster::stack(system.file("extdata", "variables.tif", #' package = "rangemap")) #' names(vars) <- c("bio5", "bio6", "bio13", "bio14") #' #' raster::plot(vars) NULL
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/data.R \docType{data} \name{peace} \alias{peace} \title{Data on Public Support for War in a Sample of US Respondents} \format{ A data frame with 1,273 rows and 17 columns: \describe{ \item{threatc}{number of adverse events respondents considered probable if the US did not engage in war} \item{ally}{a dummy variable indicating whether the country had signed a military alliance with the US} \item{trade}{a dummy variable indicating whether the country had high levels of trade with the US} \item{h1}{an index measuring respondent's attitude toward militarism} \item{i1}{an index measuring respondent's attitude toward internationalism} \item{p1}{an index measuring respondent's identification with the Republican party} \item{e1}{an index measuring respondent's attitude toward ethnocentrism} \item{r1}{an index measuring respondent's attitude toward religiosity} \item{male}{a dummy variable indicating whether the respondent is male} \item{white}{a dummy variable indicating whether the respondent is white} \item{age}{respondent's age} \item{ed4}{respondent's education with categories ranging from high school or less to postgraduate degree} \item{democ}{a dummy variable indicating whether the country was a democracy} \item{strike}{a measure of support for war on a five-point scale} \item{cost}{number of negative consequences anticipated if the US engaged in war} \item{successc}{whether the respondent thought the operation would succeed. 0: less than 50-50 chance of working even in the short run; 1: efficacious only in the short run; 2: successful both in the short and long run} \item{immoral}{a dummy variable indicating whether respondents thought it would be morally wrong to strike the country} } } \usage{ peace } \description{ A dataset containing 17 variables on the views of 1,273 US adults about their support for war against countries that were hypothetically developing nuclear weapons. The data include several variables on the country's features and respondents' demographic and attitudinal characteristics (Tomz and Weeks 2013; Zhou and Wodtke 2020). } \references{ Tomz, Michael R., and Jessica L. P. Weeks. 2013. Public Opinion and the Democratic Peace. The American Political Science Review 107(4):849-65. Zhou, Xiang, and Geoffrey T. Wodtke. 2020. Residual Balancing: A Method of Constructing Weights for Marginal Structural Models. Political Analysis 28(4):487-506. } \keyword{datasets}
/man/peace.Rd
no_license
xiangzhou09/rbw
R
false
true
2,539
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/data.R \docType{data} \name{peace} \alias{peace} \title{Data on Public Support for War in a Sample of US Respondents} \format{ A data frame with 1,273 rows and 17 columns: \describe{ \item{threatc}{number of adverse events respondents considered probable if the US did not engage in war} \item{ally}{a dummy variable indicating whether the country had signed a military alliance with the US} \item{trade}{a dummy variable indicating whether the country had high levels of trade with the US} \item{h1}{an index measuring respondent's attitude toward militarism} \item{i1}{an index measuring respondent's attitude toward internationalism} \item{p1}{an index measuring respondent's identification with the Republican party} \item{e1}{an index measuring respondent's attitude toward ethnocentrism} \item{r1}{an index measuring respondent's attitude toward religiosity} \item{male}{a dummy variable indicating whether the respondent is male} \item{white}{a dummy variable indicating whether the respondent is white} \item{age}{respondent's age} \item{ed4}{respondent's education with categories ranging from high school or less to postgraduate degree} \item{democ}{a dummy variable indicating whether the country was a democracy} \item{strike}{a measure of support for war on a five-point scale} \item{cost}{number of negative consequences anticipated if the US engaged in war} \item{successc}{whether the respondent thought the operation would succeed. 0: less than 50-50 chance of working even in the short run; 1: efficacious only in the short run; 2: successful both in the short and long run} \item{immoral}{a dummy variable indicating whether respondents thought it would be morally wrong to strike the country} } } \usage{ peace } \description{ A dataset containing 17 variables on the views of 1,273 US adults about their support for war against countries that were hypothetically developing nuclear weapons. The data include several variables on the country's features and respondents' demographic and attitudinal characteristics (Tomz and Weeks 2013; Zhou and Wodtke 2020). } \references{ Tomz, Michael R., and Jessica L. P. Weeks. 2013. Public Opinion and the Democratic Peace. The American Political Science Review 107(4):849-65. Zhou, Xiang, and Geoffrey T. Wodtke. 2020. Residual Balancing: A Method of Constructing Weights for Marginal Structural Models. Political Analysis 28(4):487-506. } \keyword{datasets}
generateu <- function(mat){ names=colnames(mat) r=length(names) U=list(r) for(i in 1:r){ U[[i]]=IndMatrix(mat[,i]) colnames(U[[i]])=paste(names[i],"(",colnames(U[[i]]),")",sep="") } names(U)=names class(U)="Umatrix" return(U) }
/minque/R/generateu.R
no_license
ingted/R-Examples
R
false
false
265
r
generateu <- function(mat){ names=colnames(mat) r=length(names) U=list(r) for(i in 1:r){ U[[i]]=IndMatrix(mat[,i]) colnames(U[[i]])=paste(names[i],"(",colnames(U[[i]]),")",sep="") } names(U)=names class(U)="Umatrix" return(U) }
#' Create flow diagram of model #' #' @author Christopher J. Brown #' @rdname create_model_diagram #' @export create_model_diagram <- function(){ par(mar = c(rep(0.5, 4))) plot(0,0, xlim = c(0,1), ylim = c(0,1), type = 'n', xlab = '', ylab = '', xaxt = 'n', yaxt = 'n', bty = 'n') points(0.25, 0.5, cex = 20) points(0.75, 0.5, cex = 20) points(0.25, 0.1, cex = 15, pch = 0) points(0.55, 0.1, cex = 15, pch = 0) points(0.25, 0.9, cex = 15, pch = 0) points(0.5, 0.9, cex = 15, pch = 0) points(0.75, 0.9, cex = 15, pch = 0) alwd <- 2 alen <- 0.2 acol <- 'grey' arrows(0.75, 0.65, 0.25, 0.79, lwd = alwd, len = alen, col = acol) arrows(0.75, 0.65, 0.55, 0.79, lwd = alwd, len = alen, col = acol) arrows(0.75, 0.65, 0.75, 0.79, lwd = alwd, len = alen, col = acol) arrows(0.25, 0.65, 0.25, 0.79, lwd = alwd, len = alen) arrows(0.25, 0.65, 0.55, 0.79, lwd = alwd, len = alen) arrows(0.25, 0.65, 0.75, 0.79, lwd = alwd, len = alen) arrows(0.25, 0.21, 0.25, 0.35, lwd = alwd, len = alen) arrows(0.55, 0.21, 0.28, 0.35, lwd = alwd, len = alen) text(0.25, 0.1, paste('Distance to','\n','nearest sediment','\n','source'), cex = 0.8) text(0.55, 0.1, 'Flow strength') text(0.25, 0.5, 'Latent variable 1') text(0.75, 0.5, 'Latent variable 2') text(0.25, 0.89, 'Turf algae', font = 3) text(0.5, 0.89, paste('Branching','\n','coral'), font = 3) text(0.75, 0.89, 'Silt', font = 3) }
/R/create_model_diagram.R
no_license
cbrown5/BenthicLatent
R
false
false
1,387
r
#' Create flow diagram of model #' #' @author Christopher J. Brown #' @rdname create_model_diagram #' @export create_model_diagram <- function(){ par(mar = c(rep(0.5, 4))) plot(0,0, xlim = c(0,1), ylim = c(0,1), type = 'n', xlab = '', ylab = '', xaxt = 'n', yaxt = 'n', bty = 'n') points(0.25, 0.5, cex = 20) points(0.75, 0.5, cex = 20) points(0.25, 0.1, cex = 15, pch = 0) points(0.55, 0.1, cex = 15, pch = 0) points(0.25, 0.9, cex = 15, pch = 0) points(0.5, 0.9, cex = 15, pch = 0) points(0.75, 0.9, cex = 15, pch = 0) alwd <- 2 alen <- 0.2 acol <- 'grey' arrows(0.75, 0.65, 0.25, 0.79, lwd = alwd, len = alen, col = acol) arrows(0.75, 0.65, 0.55, 0.79, lwd = alwd, len = alen, col = acol) arrows(0.75, 0.65, 0.75, 0.79, lwd = alwd, len = alen, col = acol) arrows(0.25, 0.65, 0.25, 0.79, lwd = alwd, len = alen) arrows(0.25, 0.65, 0.55, 0.79, lwd = alwd, len = alen) arrows(0.25, 0.65, 0.75, 0.79, lwd = alwd, len = alen) arrows(0.25, 0.21, 0.25, 0.35, lwd = alwd, len = alen) arrows(0.55, 0.21, 0.28, 0.35, lwd = alwd, len = alen) text(0.25, 0.1, paste('Distance to','\n','nearest sediment','\n','source'), cex = 0.8) text(0.55, 0.1, 'Flow strength') text(0.25, 0.5, 'Latent variable 1') text(0.75, 0.5, 'Latent variable 2') text(0.25, 0.89, 'Turf algae', font = 3) text(0.5, 0.89, paste('Branching','\n','coral'), font = 3) text(0.75, 0.89, 'Silt', font = 3) }
\name{bowlerPerfForecast} \alias{bowlerPerfForecast} \title{ Forecast the bowler performance based on past performances using Holt-Winters forecasting } \description{ This function forecasts the performance of the bowler based on past performances using HoltWinters forecasting model } \usage{ bowlerPerfForecast(file, name = "A Googly") } %- maybe also 'usage' for other objects documented here. \arguments{ \item{file}{ This is the <bowler>.csv file obtained with an initial getPlayerData() } \item{name}{ Name of the bowler } } \details{ More details can be found in my short video tutorial in Youtube https://www.youtube.com/watch?v=q9uMPFVsXsI } \value{ None } \references{ http://www.espncricinfo.com/ci/content/stats/index.html\cr https://gigadom.wordpress.com/ } \author{ Tinniam V Ganesh } \note{ Maintainer: Tinniam V Ganesh <tvganesh.85@gmail.com> } %% ~Make other sections like Warning with \section{Warning }{....} ~ \seealso{ \code{\link{bowlerEconRate}}, \code{\link{bowlerMovingAverage}}, \code{\link{bowlerContributionWonLost}} } \examples{ # Get or use the <bowler>.csv obtained with getPlayerData() # a <- getPlayerData(30176,file="kumble.csv",type="batting", homeOrAway=c(1,2),result=c(1,2,4)) bowlerPerfForecast("../cricketr/data/kumble.csv","Anil Kumble") } % Add one or more standard keywords, see file 'KEYWORDS' in the % R documentation directory. \keyword{ ~kwd1 } \keyword{ ~kwd2 }% __ONLY ONE__ keyword per line
/man/bowlerPerfForecast.Rd
no_license
tvganesh/pkg
R
false
false
1,449
rd
\name{bowlerPerfForecast} \alias{bowlerPerfForecast} \title{ Forecast the bowler performance based on past performances using Holt-Winters forecasting } \description{ This function forecasts the performance of the bowler based on past performances using HoltWinters forecasting model } \usage{ bowlerPerfForecast(file, name = "A Googly") } %- maybe also 'usage' for other objects documented here. \arguments{ \item{file}{ This is the <bowler>.csv file obtained with an initial getPlayerData() } \item{name}{ Name of the bowler } } \details{ More details can be found in my short video tutorial in Youtube https://www.youtube.com/watch?v=q9uMPFVsXsI } \value{ None } \references{ http://www.espncricinfo.com/ci/content/stats/index.html\cr https://gigadom.wordpress.com/ } \author{ Tinniam V Ganesh } \note{ Maintainer: Tinniam V Ganesh <tvganesh.85@gmail.com> } %% ~Make other sections like Warning with \section{Warning }{....} ~ \seealso{ \code{\link{bowlerEconRate}}, \code{\link{bowlerMovingAverage}}, \code{\link{bowlerContributionWonLost}} } \examples{ # Get or use the <bowler>.csv obtained with getPlayerData() # a <- getPlayerData(30176,file="kumble.csv",type="batting", homeOrAway=c(1,2),result=c(1,2,4)) bowlerPerfForecast("../cricketr/data/kumble.csv","Anil Kumble") } % Add one or more standard keywords, see file 'KEYWORDS' in the % R documentation directory. \keyword{ ~kwd1 } \keyword{ ~kwd2 }% __ONLY ONE__ keyword per line
generateFriedmanData <- function(n, ranef = FALSE, causal = FALSE, binary = FALSE) { f <- function(x) 10 * sin(pi * x[,1] * x[,2]) + 20 * (x[,3] - 0.5)^2 + 10 * x[,4] + 5 * x[,5] set.seed(99) sigma <- 1.0 x <- matrix(runif(n * 10), n, 10) mu <- f(x) result <- list(x = x, sigma = sigma) if (ranef) { n.g.1 <- 5L n.g.2 <- 8L result <- within(result, { g.1 <- sample(n.g.1, n, replace = TRUE) Sigma.b.1 <- matrix(c(1.5^2, .2, .2, 1^2), 2) R.b <- chol(Sigma.b.1) b.1 <- matrix(rnorm(2 * n.g.1), n.g.1) %*% R.b rm(R.b) g.2 <- sample(n.g.2, n, replace = TRUE) Sigma.b.2 <- as.matrix(1.2) b.2 <- rnorm(n.g.2, 0, sqrt(Sigma.b.2)) mu.fixef <- x[,4] * 10 mu.bart <- mu - mu.fixef mu.ranef <- b.1[g.1,1] + x[,4] * b.1[g.1,2] + b.2[g.2] mu <- mu + mu.ranef }) } else { mu.fixef <- x[,4] * 10 mu.bart <- mu - mu.fixef } if (causal) { result <- within(result, { tau <- 5 z <- rbinom(n, 1, 0.2) }) if (ranef) { result <- within(result, { mu.fixef.0 <- mu.fixef mu.fixef.1 <- mu.fixef.0 + tau mu.bart.0 <- mu.bart.1 <- mu.bart mu.ranef.0 <- mu.ranef.1 <- mu.ranef mu.0 <- mu.bart.0 + mu.fixef.0 + mu.ranef.0 mu.1 <- mu.bart.1 + mu.fixef.1 + mu.ranef.1 }) } else { result <- within(result, { mu.fixef.0 <- mu.fixef mu.fixef.1 <- mu.fixef.0 + tau mu.bart.0 <- mu.bart.1 <- mu.bart mu.0 <- mu.bart.0 + mu.fixef.0 mu.1 <- mu.bart.1 + mu.fixef.1 }) } if (binary) { result <- within(result, { loc <- mean(c(mu.0, mu.1)) scale <- sd(c(mu.0, mu.1)) / qnorm(0.15) mu.0 <- (mu.0 - loc) / scale mu.1 <- (mu.1 - loc) / scale mu.fixef.0 <- (mu.fixef.0 - loc) / scale mu.fixef.1 <- (mu.fixef.1 - loc) / scale mu.bart.0 <- mu.bart.0 / scale mu.bart.1 <- mu.bart.1 / scale if (ranef) { mu.ranef.0 <- mu.ranef.0 / scale mu.ranef.1 <- mu.ranef.1 / scale } rm(loc, scale) y.0 <- rbinom(n, 1L, pnorm(mu.0)) y.1 <- rbinom(n, 1L, pnorm(mu.1)) y <- y.1 * z + y.0 * (1 - z) }) } else { result <- within(result, { y.0 <- mu.0 + rnorm(n, 0, sigma) y.1 <- mu.1 + rnorm(n, 0, sigma) y <- y.1 * z + y.0 * (1 - z) }) } result$mu <- NULL result$mu.fixef <- NULL result$mu.ranef <- NULL } else { if (binary) { result <- within(result, { loc <- mean(mu) scale <- sd(mu) / qnorm(0.15) mu <- (mu - loc) / scale mu.fixef <- (mu.fixef - loc) / scale mu.bart <- mu.bart / scale if (ranef) mu.ranef <- mu.ranef / scale rm(loc, scale) y <- rbinom(n, 1L, pnorm(mu)) }) } else { result <- within(result, { y <- mu + rnorm(n, 0, sigma) }) } } result }
/inst/common/friedmanData.R
no_license
cran/bartCause
R
false
false
3,137
r
generateFriedmanData <- function(n, ranef = FALSE, causal = FALSE, binary = FALSE) { f <- function(x) 10 * sin(pi * x[,1] * x[,2]) + 20 * (x[,3] - 0.5)^2 + 10 * x[,4] + 5 * x[,5] set.seed(99) sigma <- 1.0 x <- matrix(runif(n * 10), n, 10) mu <- f(x) result <- list(x = x, sigma = sigma) if (ranef) { n.g.1 <- 5L n.g.2 <- 8L result <- within(result, { g.1 <- sample(n.g.1, n, replace = TRUE) Sigma.b.1 <- matrix(c(1.5^2, .2, .2, 1^2), 2) R.b <- chol(Sigma.b.1) b.1 <- matrix(rnorm(2 * n.g.1), n.g.1) %*% R.b rm(R.b) g.2 <- sample(n.g.2, n, replace = TRUE) Sigma.b.2 <- as.matrix(1.2) b.2 <- rnorm(n.g.2, 0, sqrt(Sigma.b.2)) mu.fixef <- x[,4] * 10 mu.bart <- mu - mu.fixef mu.ranef <- b.1[g.1,1] + x[,4] * b.1[g.1,2] + b.2[g.2] mu <- mu + mu.ranef }) } else { mu.fixef <- x[,4] * 10 mu.bart <- mu - mu.fixef } if (causal) { result <- within(result, { tau <- 5 z <- rbinom(n, 1, 0.2) }) if (ranef) { result <- within(result, { mu.fixef.0 <- mu.fixef mu.fixef.1 <- mu.fixef.0 + tau mu.bart.0 <- mu.bart.1 <- mu.bart mu.ranef.0 <- mu.ranef.1 <- mu.ranef mu.0 <- mu.bart.0 + mu.fixef.0 + mu.ranef.0 mu.1 <- mu.bart.1 + mu.fixef.1 + mu.ranef.1 }) } else { result <- within(result, { mu.fixef.0 <- mu.fixef mu.fixef.1 <- mu.fixef.0 + tau mu.bart.0 <- mu.bart.1 <- mu.bart mu.0 <- mu.bart.0 + mu.fixef.0 mu.1 <- mu.bart.1 + mu.fixef.1 }) } if (binary) { result <- within(result, { loc <- mean(c(mu.0, mu.1)) scale <- sd(c(mu.0, mu.1)) / qnorm(0.15) mu.0 <- (mu.0 - loc) / scale mu.1 <- (mu.1 - loc) / scale mu.fixef.0 <- (mu.fixef.0 - loc) / scale mu.fixef.1 <- (mu.fixef.1 - loc) / scale mu.bart.0 <- mu.bart.0 / scale mu.bart.1 <- mu.bart.1 / scale if (ranef) { mu.ranef.0 <- mu.ranef.0 / scale mu.ranef.1 <- mu.ranef.1 / scale } rm(loc, scale) y.0 <- rbinom(n, 1L, pnorm(mu.0)) y.1 <- rbinom(n, 1L, pnorm(mu.1)) y <- y.1 * z + y.0 * (1 - z) }) } else { result <- within(result, { y.0 <- mu.0 + rnorm(n, 0, sigma) y.1 <- mu.1 + rnorm(n, 0, sigma) y <- y.1 * z + y.0 * (1 - z) }) } result$mu <- NULL result$mu.fixef <- NULL result$mu.ranef <- NULL } else { if (binary) { result <- within(result, { loc <- mean(mu) scale <- sd(mu) / qnorm(0.15) mu <- (mu - loc) / scale mu.fixef <- (mu.fixef - loc) / scale mu.bart <- mu.bart / scale if (ranef) mu.ranef <- mu.ranef / scale rm(loc, scale) y <- rbinom(n, 1L, pnorm(mu)) }) } else { result <- within(result, { y <- mu + rnorm(n, 0, sigma) }) } } result }
/man/point.est.crMh.Rd
no_license
DistanceDevelopment/WiSP
R
false
false
3,042
rd
# R for Everyone, ch 7, Statistical Graphics # install 'ggplot2', 'lubridate' **** # Base graphics require(ggplot2) data() diamonds head(diamonds) dim(diamonds) summary(diamonds) # base histogram hist(diamonds$carat, main="Carat Histogram", xlab="Carat") # base scatterplot plot(price~carat, data=diamonds) plot(diamonds$carat,diamonds$price) # boxplot boxplot(diamonds$carat) #ggplot2 ggplot(data=diamonds) + geom_histogram(aes(x=carat)) ggplot(data=diamonds) + geom_density(aes(x=carat), fill="grey50") #ggplot2 scatterplot ggplot(data=diamonds, aes(x=carat,y=price)) + geom_point() g <- ggplot(diamonds, aes(x=carat,y=price)) g + geom_point(aes(color=color)) g + geom_point(aes(color=color)) + facet_wrap(~color) g + geom_point(aes(color=color)) + facet_grid(cut~clarity) ggplot(diamonds, aes(x=carat)) + geom_histogram() + facet_wrap(~color) ggplot(diamonds, aes(y=carat, x=1)) + geom_boxplot() ggplot(diamonds, aes(y=carat, x=cut)) + geom_boxplot() ggplot(diamonds, aes(y=carat, x=cut)) + geom_violin() ggplot(diamonds, aes(y=carat, x=cut)) + geom_point() + geom_violin() ggplot(diamonds, aes(y=carat, x=cut)) + geom_violin() + geom_point() ggplot(economics, aes(x=date,y=pop)) + geom_line() require(lubridate) head(economics) economics$year <- year(economics$date) head(economics) economics$month <- month(economics$date, label=TRUE) head(economics) econ2000 <- economics[which(economics$year > 2000),] dim(econ2000) require(scales) g <- ggplot(econ2000, aes(x=month,y=pop)) g <- g + geom_line(aes(color=factor(year), group=year)) g <- g + scale_color_discrete(name="Year") g <- g + scale_y_continuous(labels=comma) g <- g + labs(title="Population Growth",x="Month",y="Population") g # themes require(ggthemes) g2 <- ggplot(diamonds, aes(x=carat,y=price)) + geom_point(aes(color=color)) g2 + theme_economist() + scale_colour_economist() g2 + theme_excel() + scale_colour_excel() g2 + theme_tufte() g2 + theme_wsj()
/Desktop/R/rfe_ch7.R
no_license
Thanatat-CPE0621/Todolist
R
false
false
1,981
r
# R for Everyone, ch 7, Statistical Graphics # install 'ggplot2', 'lubridate' **** # Base graphics require(ggplot2) data() diamonds head(diamonds) dim(diamonds) summary(diamonds) # base histogram hist(diamonds$carat, main="Carat Histogram", xlab="Carat") # base scatterplot plot(price~carat, data=diamonds) plot(diamonds$carat,diamonds$price) # boxplot boxplot(diamonds$carat) #ggplot2 ggplot(data=diamonds) + geom_histogram(aes(x=carat)) ggplot(data=diamonds) + geom_density(aes(x=carat), fill="grey50") #ggplot2 scatterplot ggplot(data=diamonds, aes(x=carat,y=price)) + geom_point() g <- ggplot(diamonds, aes(x=carat,y=price)) g + geom_point(aes(color=color)) g + geom_point(aes(color=color)) + facet_wrap(~color) g + geom_point(aes(color=color)) + facet_grid(cut~clarity) ggplot(diamonds, aes(x=carat)) + geom_histogram() + facet_wrap(~color) ggplot(diamonds, aes(y=carat, x=1)) + geom_boxplot() ggplot(diamonds, aes(y=carat, x=cut)) + geom_boxplot() ggplot(diamonds, aes(y=carat, x=cut)) + geom_violin() ggplot(diamonds, aes(y=carat, x=cut)) + geom_point() + geom_violin() ggplot(diamonds, aes(y=carat, x=cut)) + geom_violin() + geom_point() ggplot(economics, aes(x=date,y=pop)) + geom_line() require(lubridate) head(economics) economics$year <- year(economics$date) head(economics) economics$month <- month(economics$date, label=TRUE) head(economics) econ2000 <- economics[which(economics$year > 2000),] dim(econ2000) require(scales) g <- ggplot(econ2000, aes(x=month,y=pop)) g <- g + geom_line(aes(color=factor(year), group=year)) g <- g + scale_color_discrete(name="Year") g <- g + scale_y_continuous(labels=comma) g <- g + labs(title="Population Growth",x="Month",y="Population") g # themes require(ggthemes) g2 <- ggplot(diamonds, aes(x=carat,y=price)) + geom_point(aes(color=color)) g2 + theme_economist() + scale_colour_economist() g2 + theme_excel() + scale_colour_excel() g2 + theme_tufte() g2 + theme_wsj()
## This project contains two functions 1) makeCacheMatrix (creates a special "matrix" object that can cache its inverse) ## and 2) cacheSolve (computes the inverse of the special "matrix" returned by makeCacheMatrix). ## The makeCacheMatrix function creates a special "matrix" which is really a list containing #other functions to perform the following tasks: # 1) Set the value of the matrix # 2) Get the value if the matrix # 3) Set the inverse of the matrix # 4) Get the inverse of the matrix makeCacheMatrix<- function(x=matrix()) { inv<-NULL # 1) Set the value of the matrix set <- function(y) { x<<-y inv<<-NULL } # 2) Get the value if the matrix get<- function() x # 3) Set the inverse of the matrix setinverse<-function(inverse) inv <<- inverse # 4) Get the inverse of the matrix getinverse <- function() inv list(set=set,get=get,setinverse=setinverse,getinverse=getinverse) } ##cacheSolve function calculates the inverse of the special “matrix” created with the makeCacheMatrix function. #It first checks to see if the inverse of the matrix has already been calculated. cacheSolve <- function(x, ...) { #Return a matrix that is the inverse of x inv <- x$getinverse() #In this case, it gets the inverse from the cache and skips the computation. If not, it calculates the inverse of #the data and sets the inverse matrix in the cache via the setinverse function. if(!is.null(inv)) { message("getting cached data") return(inv) } data <- x$get() inv <- solve(data, ...) x$setinverse(inv) inv }
/cachematrix.R
no_license
felipao-skecht/ProgrammingAssignment2
R
false
false
1,859
r
## This project contains two functions 1) makeCacheMatrix (creates a special "matrix" object that can cache its inverse) ## and 2) cacheSolve (computes the inverse of the special "matrix" returned by makeCacheMatrix). ## The makeCacheMatrix function creates a special "matrix" which is really a list containing #other functions to perform the following tasks: # 1) Set the value of the matrix # 2) Get the value if the matrix # 3) Set the inverse of the matrix # 4) Get the inverse of the matrix makeCacheMatrix<- function(x=matrix()) { inv<-NULL # 1) Set the value of the matrix set <- function(y) { x<<-y inv<<-NULL } # 2) Get the value if the matrix get<- function() x # 3) Set the inverse of the matrix setinverse<-function(inverse) inv <<- inverse # 4) Get the inverse of the matrix getinverse <- function() inv list(set=set,get=get,setinverse=setinverse,getinverse=getinverse) } ##cacheSolve function calculates the inverse of the special “matrix” created with the makeCacheMatrix function. #It first checks to see if the inverse of the matrix has already been calculated. cacheSolve <- function(x, ...) { #Return a matrix that is the inverse of x inv <- x$getinverse() #In this case, it gets the inverse from the cache and skips the computation. If not, it calculates the inverse of #the data and sets the inverse matrix in the cache via the setinverse function. if(!is.null(inv)) { message("getting cached data") return(inv) } data <- x$get() inv <- solve(data, ...) x$setinverse(inv) inv }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/agree.coeff2.r \name{kappa2.table} \alias{kappa2.table} \title{Kappa coefficient for 2 raters} \usage{ kappa2.table(ratings, weights = identity.weights(1:ncol(ratings)), conflev = 0.95, N = Inf) } \arguments{ \item{ratings}{A square table of ratings (assume no missing ratings).} \item{weights}{An optional matrix that contains the weights used in the weighted analysis.} \item{conflev}{An optional confidence level for confidence intervals. The default value is the traditional 0.95.} \item{N}{An optional population size. The default value is infinity.} } \value{ A data frame containing the following 5 variables: coeff.name coeff.val coeff.se coeff.ci coeff.pval. } \description{ Kappa coefficient for 2 raters }
/man/kappa2.table.Rd
no_license
hapu66/irrCAC
R
false
true
801
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/agree.coeff2.r \name{kappa2.table} \alias{kappa2.table} \title{Kappa coefficient for 2 raters} \usage{ kappa2.table(ratings, weights = identity.weights(1:ncol(ratings)), conflev = 0.95, N = Inf) } \arguments{ \item{ratings}{A square table of ratings (assume no missing ratings).} \item{weights}{An optional matrix that contains the weights used in the weighted analysis.} \item{conflev}{An optional confidence level for confidence intervals. The default value is the traditional 0.95.} \item{N}{An optional population size. The default value is infinity.} } \value{ A data frame containing the following 5 variables: coeff.name coeff.val coeff.se coeff.ci coeff.pval. } \description{ Kappa coefficient for 2 raters }
# The function plotKMeans returns a plot of clustered data using k-means # # Author: Kaihua Liu ########################################################################################################### source('LSDD.R') source('LSDDsegmentation.R') segMerge <- function(data, segResults, segLSDDPars, throttle = 100){ # result newSeg <- data.frame() # book keeping mergedRight <- FALSE for(i in 1:nrow(segResults)){ # check if previous seg was merged to the right if(mergedRight == TRUE) { mergedRight <- FALSE next } # sorry you are too small we have to kill you if(segResults[i, "segEnd"] - segResults[i, "segStart"] + 1 <= throttle){ # if it is the first seg or the last seg # it only can be merged to one direction # so stop calling the function if(i == 1){ mergeDirection <- 'right' } else if(i == nrow(segResults)){ mergeDirection <- 'left' } # use LSDD fast function to calculate similarity else { mergeDirection <- LSDDCompare( L = segResults[i-1, ], G = segResults[i, ], R = segResults[i+1, ], data = data, segLSDDPars = segLSDDPars ) } if(mergeDirection == "left"){ # merge to left # edit last seg newSeg[nrow(newSeg), "segEnd"] <- segResults[i, "segEnd"] }else{ # merge to right # push to new vector newSeg <- rbind(newSeg, list( "segStart" = segResults[i,"segStart"], "segEnd" = segResults[i+1, "segEnd"] ) ) # skip seg to be deal in next loop mergedRight <- TRUE } } # You are long enough to pass else{ newSeg <- rbind(newSeg, segResults[i,]) } } newSeg <- unique(newSeg) return(newSeg) } ####################################### ######### LSDDCompare ########## ####################################### # # |------------|-----|-----------| # L G R # Compare Gap with two different time sequences # And return the one with higher similarity # ####################################### # Input: # # L, G, R:three time sequences to deal with. list("segStart" = , "segEnd" = ) # G is the gap (seg size below the minimum) # # data: dataset # # segLSDDPars: sigma and lambdas matrices ####################################### # Output: # # "left"/"right", the side to merge LSDDCompare <- function(L, G, R, data, segLSDDPars){ sum_LSDD_G2L <- 0 sum_LSDD_G2R <- 0 # under some extrme conditions # the size of G could be 1, which means only 1 data point # in this segments, # but LSDD requires at least 2 data points to carry on. # so just merge G to the shorter side if( G$segEnd - G$segStart > 1 && L$segEnd - L$segStart > 1 && R$segEnd - R$segStart > 1 ){ for(i in 1:ncol(data)){ # 1 x n matrix Gmatrix <- t(matrix(data[G$segStart:G$segEnd, i])) Lmatrix <- t(matrix(data[L$segStart:L$segEnd, i])) Rmatrix <- t(matrix(data[R$segStart:R$segEnd, i])) # cat(dim(Gmatrix), dim(Lmatrix), dim(Rmatrix)) sum_LSDD_G2L <- sum(sum_LSDD_G2L, LSDDfast( X1 = Gmatrix, X2 = Lmatrix, sigma = segLSDDPars[i, "sigma"], #sigma lambda = segLSDDPars[i, "lambda"] #lambda )) sum_LSDD_G2R <- sum(sum_LSDD_G2R, LSDDfast( X1 = Gmatrix, X2 = Rmatrix, sigma = segLSDDPars[i, "sigma"], #sigma lambda = segLSDDPars[i, "lambda"] #lambda )) } } # cat("Similary to left is: ", sum_LSDD_G2L, "\n") # cat("Similary to right is: ", sum_LSDD_G2R, "\n") if(sum_LSDD_G2R < sum_LSDD_G2L){ result <- 'right' }else if(sum_LSDD_G2L < sum_LSDD_G2R){ result <- 'left' }else{ # this is equal, very rare situation, then merge with shorter segResults if(L$segEnd - L$segStart < R$segEnd - R$segStart){ result <- 'left' } else{ result <- 'right' } } # cat("Merge to ", result, "\n") result } ####### test ####### # data <- data.frame( read.csv('./data/test5000.csv')) # data <- data[-1] # segResults <- data.frame( read.csv('./data/segs5000.csv')) # segLSDDPars <- data.frame( read.csv('./data/pars5000.csv')) # segMerge(data = data, segResults = segResults, segLSDDPars = segLSDDPars, throttle = 100)
/segMerge.R
no_license
lkaihua/Bipeline
R
false
false
4,547
r
# The function plotKMeans returns a plot of clustered data using k-means # # Author: Kaihua Liu ########################################################################################################### source('LSDD.R') source('LSDDsegmentation.R') segMerge <- function(data, segResults, segLSDDPars, throttle = 100){ # result newSeg <- data.frame() # book keeping mergedRight <- FALSE for(i in 1:nrow(segResults)){ # check if previous seg was merged to the right if(mergedRight == TRUE) { mergedRight <- FALSE next } # sorry you are too small we have to kill you if(segResults[i, "segEnd"] - segResults[i, "segStart"] + 1 <= throttle){ # if it is the first seg or the last seg # it only can be merged to one direction # so stop calling the function if(i == 1){ mergeDirection <- 'right' } else if(i == nrow(segResults)){ mergeDirection <- 'left' } # use LSDD fast function to calculate similarity else { mergeDirection <- LSDDCompare( L = segResults[i-1, ], G = segResults[i, ], R = segResults[i+1, ], data = data, segLSDDPars = segLSDDPars ) } if(mergeDirection == "left"){ # merge to left # edit last seg newSeg[nrow(newSeg), "segEnd"] <- segResults[i, "segEnd"] }else{ # merge to right # push to new vector newSeg <- rbind(newSeg, list( "segStart" = segResults[i,"segStart"], "segEnd" = segResults[i+1, "segEnd"] ) ) # skip seg to be deal in next loop mergedRight <- TRUE } } # You are long enough to pass else{ newSeg <- rbind(newSeg, segResults[i,]) } } newSeg <- unique(newSeg) return(newSeg) } ####################################### ######### LSDDCompare ########## ####################################### # # |------------|-----|-----------| # L G R # Compare Gap with two different time sequences # And return the one with higher similarity # ####################################### # Input: # # L, G, R:three time sequences to deal with. list("segStart" = , "segEnd" = ) # G is the gap (seg size below the minimum) # # data: dataset # # segLSDDPars: sigma and lambdas matrices ####################################### # Output: # # "left"/"right", the side to merge LSDDCompare <- function(L, G, R, data, segLSDDPars){ sum_LSDD_G2L <- 0 sum_LSDD_G2R <- 0 # under some extrme conditions # the size of G could be 1, which means only 1 data point # in this segments, # but LSDD requires at least 2 data points to carry on. # so just merge G to the shorter side if( G$segEnd - G$segStart > 1 && L$segEnd - L$segStart > 1 && R$segEnd - R$segStart > 1 ){ for(i in 1:ncol(data)){ # 1 x n matrix Gmatrix <- t(matrix(data[G$segStart:G$segEnd, i])) Lmatrix <- t(matrix(data[L$segStart:L$segEnd, i])) Rmatrix <- t(matrix(data[R$segStart:R$segEnd, i])) # cat(dim(Gmatrix), dim(Lmatrix), dim(Rmatrix)) sum_LSDD_G2L <- sum(sum_LSDD_G2L, LSDDfast( X1 = Gmatrix, X2 = Lmatrix, sigma = segLSDDPars[i, "sigma"], #sigma lambda = segLSDDPars[i, "lambda"] #lambda )) sum_LSDD_G2R <- sum(sum_LSDD_G2R, LSDDfast( X1 = Gmatrix, X2 = Rmatrix, sigma = segLSDDPars[i, "sigma"], #sigma lambda = segLSDDPars[i, "lambda"] #lambda )) } } # cat("Similary to left is: ", sum_LSDD_G2L, "\n") # cat("Similary to right is: ", sum_LSDD_G2R, "\n") if(sum_LSDD_G2R < sum_LSDD_G2L){ result <- 'right' }else if(sum_LSDD_G2L < sum_LSDD_G2R){ result <- 'left' }else{ # this is equal, very rare situation, then merge with shorter segResults if(L$segEnd - L$segStart < R$segEnd - R$segStart){ result <- 'left' } else{ result <- 'right' } } # cat("Merge to ", result, "\n") result } ####### test ####### # data <- data.frame( read.csv('./data/test5000.csv')) # data <- data[-1] # segResults <- data.frame( read.csv('./data/segs5000.csv')) # segLSDDPars <- data.frame( read.csv('./data/pars5000.csv')) # segMerge(data = data, segResults = segResults, segLSDDPars = segLSDDPars, throttle = 100)
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/xmu.R \name{xmu_summary_RAM_group_parameters} \alias{xmu_summary_RAM_group_parameters} \title{Order and group the parameters in a RAM summary} \usage{ xmu_summary_RAM_group_parameters( model, paramTable, means = FALSE, residuals = FALSE ) } \arguments{ \item{model}{the model containing the parameters.} \item{paramTable}{The parameter table.} \item{means}{Whether to show the means (FALSE)} \item{residuals}{Whether to show the residuals (FALSE)} } \value{ \itemize{ \item Sorted parameter table } } \description{ Makes understanding complex model output easier by grouping parameters are type: residuals, latent variance, factor loading etc. } \examples{ \dontrun{ data(demoOneFactor) manifests = names(demoOneFactor) m1 = umxRAM("One Factor", data = demoOneFactor, umxPath("G", to = manifests), umxPath(v.m. = manifests), umxPath(v1m0 = "G") ) tmp = umxSummary(m1, means=FALSE, residuals = FALSE) xmu_summary_RAM_group_parameters(m1, paramTable = tmp, means= FALSE, residuals= FALSE) } } \seealso{ \itemize{ \item \code{\link[=umxSummary]{umxSummary()}} } Other xmu internal not for end user: \code{\link{umxModel}()}, \code{\link{umxRenameMatrix}()}, \code{\link{umx_APA_pval}()}, \code{\link{umx_fun_mean_sd}()}, \code{\link{umx_get_bracket_addresses}()}, \code{\link{umx_make}()}, \code{\link{umx_standardize}()}, \code{\link{umx_string_to_algebra}()}, \code{\link{umx}}, \code{\link{xmuHasSquareBrackets}()}, \code{\link{xmuLabel_MATRIX_Model}()}, \code{\link{xmuLabel_Matrix}()}, \code{\link{xmuLabel_RAM_Model}()}, \code{\link{xmuMI}()}, \code{\link{xmuMakeDeviationThresholdsMatrices}()}, \code{\link{xmuMakeOneHeadedPathsFromPathList}()}, \code{\link{xmuMakeTwoHeadedPathsFromPathList}()}, \code{\link{xmuMaxLevels}()}, \code{\link{xmuMinLevels}()}, \code{\link{xmuPropagateLabels}()}, \code{\link{xmuRAM2Ordinal}()}, \code{\link{xmuTwinSuper_Continuous}()}, \code{\link{xmuTwinSuper_NoBinary}()}, \code{\link{xmuTwinUpgradeMeansToCovariateModel}()}, \code{\link{xmu_CI_merge}()}, \code{\link{xmu_CI_stash}()}, \code{\link{xmu_DF_to_mxData_TypeCov}()}, \code{\link{xmu_PadAndPruneForDefVars}()}, \code{\link{xmu_bracket_address2rclabel}()}, \code{\link{xmu_cell_is_on}()}, \code{\link{xmu_check_levels_identical}()}, \code{\link{xmu_check_needs_means}()}, \code{\link{xmu_check_variance}()}, \code{\link{xmu_clean_label}()}, \code{\link{xmu_data_missing}()}, \code{\link{xmu_data_swap_a_block}()}, \code{\link{xmu_describe_data_WLS}()}, \code{\link{xmu_dot_make_paths}()}, \code{\link{xmu_dot_make_residuals}()}, \code{\link{xmu_dot_maker}()}, \code{\link{xmu_dot_move_ranks}()}, \code{\link{xmu_dot_rank_str}()}, \code{\link{xmu_extract_column}()}, \code{\link{xmu_get_CI}()}, \code{\link{xmu_lavaan_process_group}()}, \code{\link{xmu_make_TwinSuperModel}()}, \code{\link{xmu_make_bin_cont_pair_data}()}, \code{\link{xmu_make_mxData}()}, \code{\link{xmu_match.arg}()}, \code{\link{xmu_name_from_lavaan_str}()}, \code{\link{xmu_path2twin}()}, \code{\link{xmu_path_regex}()}, \code{\link{xmu_print_algebras}()}, \code{\link{xmu_rclabel_2_bracket_address}()}, \code{\link{xmu_safe_run_summary}()}, \code{\link{xmu_set_sep_from_suffix}()}, \code{\link{xmu_show_fit_or_comparison}()}, \code{\link{xmu_simplex_corner}()}, \code{\link{xmu_standardize_ACEcov}()}, \code{\link{xmu_standardize_ACEv}()}, \code{\link{xmu_standardize_ACE}()}, \code{\link{xmu_standardize_CP}()}, \code{\link{xmu_standardize_IP}()}, \code{\link{xmu_standardize_RAM}()}, \code{\link{xmu_standardize_SexLim}()}, \code{\link{xmu_standardize_Simplex}()}, \code{\link{xmu_start_value_list}()}, \code{\link{xmu_starts}()}, \code{\link{xmu_twin_add_WeightMatrices}()}, \code{\link{xmu_twin_check}()}, \code{\link{xmu_twin_get_var_names}()}, \code{\link{xmu_twin_make_def_means_mats_and_alg}()}, \code{\link{xmu_twin_upgrade_selDvs2SelVars}()} } \concept{xmu internal not for end user}
/man/xmu_summary_RAM_group_parameters.Rd
no_license
MATA62N/umx
R
false
true
3,956
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/xmu.R \name{xmu_summary_RAM_group_parameters} \alias{xmu_summary_RAM_group_parameters} \title{Order and group the parameters in a RAM summary} \usage{ xmu_summary_RAM_group_parameters( model, paramTable, means = FALSE, residuals = FALSE ) } \arguments{ \item{model}{the model containing the parameters.} \item{paramTable}{The parameter table.} \item{means}{Whether to show the means (FALSE)} \item{residuals}{Whether to show the residuals (FALSE)} } \value{ \itemize{ \item Sorted parameter table } } \description{ Makes understanding complex model output easier by grouping parameters are type: residuals, latent variance, factor loading etc. } \examples{ \dontrun{ data(demoOneFactor) manifests = names(demoOneFactor) m1 = umxRAM("One Factor", data = demoOneFactor, umxPath("G", to = manifests), umxPath(v.m. = manifests), umxPath(v1m0 = "G") ) tmp = umxSummary(m1, means=FALSE, residuals = FALSE) xmu_summary_RAM_group_parameters(m1, paramTable = tmp, means= FALSE, residuals= FALSE) } } \seealso{ \itemize{ \item \code{\link[=umxSummary]{umxSummary()}} } Other xmu internal not for end user: \code{\link{umxModel}()}, \code{\link{umxRenameMatrix}()}, \code{\link{umx_APA_pval}()}, \code{\link{umx_fun_mean_sd}()}, \code{\link{umx_get_bracket_addresses}()}, \code{\link{umx_make}()}, \code{\link{umx_standardize}()}, \code{\link{umx_string_to_algebra}()}, \code{\link{umx}}, \code{\link{xmuHasSquareBrackets}()}, \code{\link{xmuLabel_MATRIX_Model}()}, \code{\link{xmuLabel_Matrix}()}, \code{\link{xmuLabel_RAM_Model}()}, \code{\link{xmuMI}()}, \code{\link{xmuMakeDeviationThresholdsMatrices}()}, \code{\link{xmuMakeOneHeadedPathsFromPathList}()}, \code{\link{xmuMakeTwoHeadedPathsFromPathList}()}, \code{\link{xmuMaxLevels}()}, \code{\link{xmuMinLevels}()}, \code{\link{xmuPropagateLabels}()}, \code{\link{xmuRAM2Ordinal}()}, \code{\link{xmuTwinSuper_Continuous}()}, \code{\link{xmuTwinSuper_NoBinary}()}, \code{\link{xmuTwinUpgradeMeansToCovariateModel}()}, \code{\link{xmu_CI_merge}()}, \code{\link{xmu_CI_stash}()}, \code{\link{xmu_DF_to_mxData_TypeCov}()}, \code{\link{xmu_PadAndPruneForDefVars}()}, \code{\link{xmu_bracket_address2rclabel}()}, \code{\link{xmu_cell_is_on}()}, \code{\link{xmu_check_levels_identical}()}, \code{\link{xmu_check_needs_means}()}, \code{\link{xmu_check_variance}()}, \code{\link{xmu_clean_label}()}, \code{\link{xmu_data_missing}()}, \code{\link{xmu_data_swap_a_block}()}, \code{\link{xmu_describe_data_WLS}()}, \code{\link{xmu_dot_make_paths}()}, \code{\link{xmu_dot_make_residuals}()}, \code{\link{xmu_dot_maker}()}, \code{\link{xmu_dot_move_ranks}()}, \code{\link{xmu_dot_rank_str}()}, \code{\link{xmu_extract_column}()}, \code{\link{xmu_get_CI}()}, \code{\link{xmu_lavaan_process_group}()}, \code{\link{xmu_make_TwinSuperModel}()}, \code{\link{xmu_make_bin_cont_pair_data}()}, \code{\link{xmu_make_mxData}()}, \code{\link{xmu_match.arg}()}, \code{\link{xmu_name_from_lavaan_str}()}, \code{\link{xmu_path2twin}()}, \code{\link{xmu_path_regex}()}, \code{\link{xmu_print_algebras}()}, \code{\link{xmu_rclabel_2_bracket_address}()}, \code{\link{xmu_safe_run_summary}()}, \code{\link{xmu_set_sep_from_suffix}()}, \code{\link{xmu_show_fit_or_comparison}()}, \code{\link{xmu_simplex_corner}()}, \code{\link{xmu_standardize_ACEcov}()}, \code{\link{xmu_standardize_ACEv}()}, \code{\link{xmu_standardize_ACE}()}, \code{\link{xmu_standardize_CP}()}, \code{\link{xmu_standardize_IP}()}, \code{\link{xmu_standardize_RAM}()}, \code{\link{xmu_standardize_SexLim}()}, \code{\link{xmu_standardize_Simplex}()}, \code{\link{xmu_start_value_list}()}, \code{\link{xmu_starts}()}, \code{\link{xmu_twin_add_WeightMatrices}()}, \code{\link{xmu_twin_check}()}, \code{\link{xmu_twin_get_var_names}()}, \code{\link{xmu_twin_make_def_means_mats_and_alg}()}, \code{\link{xmu_twin_upgrade_selDvs2SelVars}()} } \concept{xmu internal not for end user}
\docType{class} \name{AllPosible_MV} \alias{AllPosible_MV} \alias{R6_AllPosible_MV} \title{AllPosible_MV KEEL Preprocess Algorithm} \description{ AllPosible_MV Preprocess Algorithm from KEEL. } \usage{ AllPosible_MV(train, test) } \arguments{ \item{train}{Train dataset as a data.frame object} \item{test}{Test dataset as a data.frame object} } \value{ A data.frame with the preprocessed data for both \code{train} and \code{test} datasets. } \examples{ #data_train <- RKEEL::loadKeelDataset("car_train") #data_test <- RKEEL::loadKeelDataset("car_test") #Create algorithm #algorithm <- RKEEL::AllPosible_MV(data_train, data_test) #Run algorithm #algorithm$run() #See results #algorithm$preprocessed_test } \keyword{preprocess}
/RKEEL/man/AllPosible-MV.Rd
no_license
i02momuj/RKEEL
R
false
false
732
rd
\docType{class} \name{AllPosible_MV} \alias{AllPosible_MV} \alias{R6_AllPosible_MV} \title{AllPosible_MV KEEL Preprocess Algorithm} \description{ AllPosible_MV Preprocess Algorithm from KEEL. } \usage{ AllPosible_MV(train, test) } \arguments{ \item{train}{Train dataset as a data.frame object} \item{test}{Test dataset as a data.frame object} } \value{ A data.frame with the preprocessed data for both \code{train} and \code{test} datasets. } \examples{ #data_train <- RKEEL::loadKeelDataset("car_train") #data_test <- RKEEL::loadKeelDataset("car_test") #Create algorithm #algorithm <- RKEEL::AllPosible_MV(data_train, data_test) #Run algorithm #algorithm$run() #See results #algorithm$preprocessed_test } \keyword{preprocess}
Sys.setenv("PKG_CXXFLAGS"="-std=c++11") ## required so that armadillo uses c++11 for gamma random number generation library(MCMCpack) library(truncnorm) ## rtruncnorm() is faster than rtnorm() in the msm package library(ars) library(compiler) library(aster) library(Rcpp) library(RcppArmadillo) source("overflowmcmc.R") sourceCpp("overflowmcmcC.cpp") overtrendmcmcCwrap <- function(niter, data, initial, prior, rwsds){ ## Initial values tau <- as.numeric(c(initial$tau)) nblocks <- length(tau) sigma <- as.numeric(initial$sigma) gam <- as.numeric(c(initial$gam)) phi <- as.numeric(initial$phi) N <- as.numeric(c(initial$N)) Dbar <- as.numeric(c(initial$Dbar)) alpha <- as.numeric(initial$alpha) beta <- as.numeric(initial$beta) ## RW sds and bookkeeping taulogrwsd <- as.numeric(rwsds$taulogrwsd) gamlogrwsds <- as.numeric(rwsds$gamlogrwsds) alphalogrwsd <- as.numeric(rwsds$alphalogrwsd) rwc <- rwsds$rwc H <- rwsds$H tune <- (rwsds$tune)*1 lowtarget <- rwsds$lowtarget hightarget <- rwsds$hightarget tauchol <- rwsds$tauchol ## Priors vsigma <- prior$vsigma ssigma <- prior$ssigma aphi <- prior$aphi bphi <- prior$bphi mugam <- prior$mugamma sig2gam <- prior$sig2gamma Dbars <- prior$Dbars aalpha <- prior$aalpha balpha <- prior$balpha abeta <- prior$abeta bbeta <- prior$bbeta ## Data tobs <- data$tobs m <- data$m M <- data$M D <- data$D out <- overtrendmcmcCPP(niter, tobs, D, M, m, tau, sigma, gam, phi, N, Dbar, alpha, beta, vsigma, ssigma, aphi, bphi, mugam, sig2gam, Dbars, aalpha, balpha, abeta, bbeta, taulogrwsd, gamlogrwsds, alphalogrwsd, rwc, H, tune, lowtarget, hightarget, tauchol, rtruncnorm, rktnb, rbetarejC) return(out) } ## List overtrendmcmcC(int niter, arma::vec tobs, arma::vec D, arma::vec M, arma::vec m, ## arma::vec tau, double sigma, arma::vec gam, double phi, arma::vec N, ## arma::vec Dbar, double alpha, double beta, ## double vsigma, double ssigma, double aphi, double bphi, ## arma::vec mugam, arma::vec sig2gam, arma::vec Dbars, double aalpha, ## double balpha, double abeta, double bbeta, ## double taulogrwsd, arma::vec gamlogrwsds, double alphalogrwsd, ## double rwc, int H, int tune, ## arma::vec lowtarget, arma::vec hightarget, arma::mat tauchol, ## Function rtruncnorm, Function rktnb, Function rbetarejC){
/model/old/overflowmcmcCwrap.R
no_license
simpsonm/bitcointrans
R
false
false
2,465
r
Sys.setenv("PKG_CXXFLAGS"="-std=c++11") ## required so that armadillo uses c++11 for gamma random number generation library(MCMCpack) library(truncnorm) ## rtruncnorm() is faster than rtnorm() in the msm package library(ars) library(compiler) library(aster) library(Rcpp) library(RcppArmadillo) source("overflowmcmc.R") sourceCpp("overflowmcmcC.cpp") overtrendmcmcCwrap <- function(niter, data, initial, prior, rwsds){ ## Initial values tau <- as.numeric(c(initial$tau)) nblocks <- length(tau) sigma <- as.numeric(initial$sigma) gam <- as.numeric(c(initial$gam)) phi <- as.numeric(initial$phi) N <- as.numeric(c(initial$N)) Dbar <- as.numeric(c(initial$Dbar)) alpha <- as.numeric(initial$alpha) beta <- as.numeric(initial$beta) ## RW sds and bookkeeping taulogrwsd <- as.numeric(rwsds$taulogrwsd) gamlogrwsds <- as.numeric(rwsds$gamlogrwsds) alphalogrwsd <- as.numeric(rwsds$alphalogrwsd) rwc <- rwsds$rwc H <- rwsds$H tune <- (rwsds$tune)*1 lowtarget <- rwsds$lowtarget hightarget <- rwsds$hightarget tauchol <- rwsds$tauchol ## Priors vsigma <- prior$vsigma ssigma <- prior$ssigma aphi <- prior$aphi bphi <- prior$bphi mugam <- prior$mugamma sig2gam <- prior$sig2gamma Dbars <- prior$Dbars aalpha <- prior$aalpha balpha <- prior$balpha abeta <- prior$abeta bbeta <- prior$bbeta ## Data tobs <- data$tobs m <- data$m M <- data$M D <- data$D out <- overtrendmcmcCPP(niter, tobs, D, M, m, tau, sigma, gam, phi, N, Dbar, alpha, beta, vsigma, ssigma, aphi, bphi, mugam, sig2gam, Dbars, aalpha, balpha, abeta, bbeta, taulogrwsd, gamlogrwsds, alphalogrwsd, rwc, H, tune, lowtarget, hightarget, tauchol, rtruncnorm, rktnb, rbetarejC) return(out) } ## List overtrendmcmcC(int niter, arma::vec tobs, arma::vec D, arma::vec M, arma::vec m, ## arma::vec tau, double sigma, arma::vec gam, double phi, arma::vec N, ## arma::vec Dbar, double alpha, double beta, ## double vsigma, double ssigma, double aphi, double bphi, ## arma::vec mugam, arma::vec sig2gam, arma::vec Dbars, double aalpha, ## double balpha, double abeta, double bbeta, ## double taulogrwsd, arma::vec gamlogrwsds, double alphalogrwsd, ## double rwc, int H, int tune, ## arma::vec lowtarget, arma::vec hightarget, arma::mat tauchol, ## Function rtruncnorm, Function rktnb, Function rbetarejC){
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/datasets.R \docType{data} \name{geexex} \alias{geexex} \title{Dataset used to illustrate Stefanski and Boos examples.} \format{ a dataset with 9 variables and 100 observations \itemize{ \item{Y1}{ rnorm(mean = 5, sd = 4)} \item{Y2}{ rnorm(mean = 2, sd = 1)} \item{X1}{ rgamma(shape =5)} \item{Y3}{ 2 + 3*X1 + 1*rnorm(0, 1)} \item{W1}{ X1 + 0.25 * rnorm(0, 1)} \item{Z1}{ 2 + 1.5*X1 + 1*rnorm(0, 1)} \item{X2}{ 0 for first 50 observation, 1 for rest} \item{Y4}{ 0.1 + 0.1*X1 + 0.5*X2 + rnorm(0, 1)} \item{Y5}{ rbinom(prob = plogis(0.1 + 0.1*X1 + 0.5*X2))} } } \description{ The data used to illustrate examples 1-9 of Stefanski and Boos (2002). } \references{ Stefanski, L. A., & Boos, D. D. (2002). The calculus of m-estimation. The American Statistician, 56(1), 29-38. } \keyword{datasets}
/man/geexex.Rd
permissive
bsaul/geex
R
false
true
897
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/datasets.R \docType{data} \name{geexex} \alias{geexex} \title{Dataset used to illustrate Stefanski and Boos examples.} \format{ a dataset with 9 variables and 100 observations \itemize{ \item{Y1}{ rnorm(mean = 5, sd = 4)} \item{Y2}{ rnorm(mean = 2, sd = 1)} \item{X1}{ rgamma(shape =5)} \item{Y3}{ 2 + 3*X1 + 1*rnorm(0, 1)} \item{W1}{ X1 + 0.25 * rnorm(0, 1)} \item{Z1}{ 2 + 1.5*X1 + 1*rnorm(0, 1)} \item{X2}{ 0 for first 50 observation, 1 for rest} \item{Y4}{ 0.1 + 0.1*X1 + 0.5*X2 + rnorm(0, 1)} \item{Y5}{ rbinom(prob = plogis(0.1 + 0.1*X1 + 0.5*X2))} } } \description{ The data used to illustrate examples 1-9 of Stefanski and Boos (2002). } \references{ Stefanski, L. A., & Boos, D. D. (2002). The calculus of m-estimation. The American Statistician, 56(1), 29-38. } \keyword{datasets}
# DataUtil.r # Functions to get data for selection and analysis. # From Micah Altman 20170726 # Adapted RBLlandau 20171002 library(tidyverse) # H A C K S # Absurd hack in here to make lifem print reasonably. # Increase the penalty for printing in scientific # (exponential) format, and limit the number of digits # so that there are no places after the radix point. options("scipen"=100, "digits"=1) # End of absurd hack. # Enable printing wide tables. options("width"=120) # Add an infix concatenation operator for strings. `%+%` <- function(a,b) paste0(a,b) # U T I L I T Y F U N C T I O N S # Better functions for summarizing the loss data. # These are more robust than just mean, and more broadly estimated # than median. # midmean is just a trimmed mean of the middle half of the sample. # trimean is a less efficient but easier trimmed central measure, # and was a JWT favorite. # trimmedmean is a 10% trimmed mean, i.e., mean of the middle 80% of the data. trimean <- function(vect) { foo <- fivenum(vect); ans <- 0.5*foo[3] + 0.25*foo[2] + 0.25*foo[4]; ans } midmean <- function(vect) { ans <- mean(vect, trim=0.25, na.rm=TRUE); ans } trimmedmean <- function(vect) { ans <- mean(vect, trim=0.10, na.rm=TRUE); ans } # Select only the dataframe rows with N copies. fnSelectCopies <- function(dfIn, nCopies) { dfIn[dfIn$copies==nCopies,] } # Safe functions for plotting. # Note that safelog(0) returns 0, as needed for sensible axis labeling. safelog <- function(x) {return(log10(x+1))} safe <- function(x) {return(x+0.001)} # Shock tabulation functions. fntShockTab <- function(input, freq, impact, duration) { res1 <- input[input$copies>1 & input$shockfreq==freq & input$shockimpact==impact & input$shockmaxlife==duration,] assign("res.shocktdat", res1, envir=globalenv()) #print(paste("res.shockdat",length(res.shockdat$copies))) restab <- dcast(res1, copies~lifem, value.var="mdmlosspct") return(restab) } # f n d f G e t G i a n t D a t a fndfGetGiantData <- function(dir.string) { # L O A D F I L E S # Load & merge all files in directory if (dir.string == "") {dir.string <- "./"} filesList <- grep(pattern="^Giant.*\\.txt$", dir(dir.string), perl=TRUE, value = TRUE) # !!! I need to get fully qualified names out of grep here. How? # !!! As it is, works only for current directory. sims.df.ls <- lapply( filesList, function(x)read.table(x, header=TRUE,sep=" ", na.strings="nolinefound") ) # NOTE MISSING PARAMETER ENTRIES in na.strings sims.merged.df <- bind_rows(sims.df.ls) # Set up namesets for dependent, independent, ignored vars. # Many of the columns are not relevant to data analysis, only tracking. allVarNames <- colnames(sims.merged.df) ignoreVarNames <- c("timestamp","seed","walltime","cputime","logfilename", "logfilesize","instructionfilename","todaysdatetime","extractorversion", "cpuinfo","mongoid","audittype") resultVarNames <- c("docslost","docsrepairedmajority","docsrepairedminority", "lost","nshocks","nglitches","deadserversactive","deadserversall", "docsokay","auditmajority","auditminority","auditlost","auditrepairs", "auditcycles") coreResultVarNames <- c("docslost","docsrepairedmajority", "docsrepairedminority") paramVarNames <- setdiff(setdiff(allVarNames, resultVarNames), ignoreVarNames) testVarNames <- c("copies", "lifem") nonIgnoreVarNames <- setdiff(allVarNames, ignoreVarNames) # Select, group, and aggregate. sims.selected.df <- sims.merged.df[nonIgnoreVarNames] gp_sims.merged<-eval(parse(text=paste("group_by(sims.selected.df,", paste(collapse=",", paramVarNames),")"))) results <- summarise(gp_sims.merged, mdmlosspct=round(midmean(docslost/docstotal)*100,1), n=n()) selectedresults <- results[which(results[["copies"]]!=1),] return(results) } # f n d f G e t S u b s e t D a t a fndfGetSubsetData <- function(results, lColumnNames) { subset <- results[lColumnNames] return(subset) } # f n d f G e t A u d i t D a t a fndfGetAuditData <- function(results) { # Specific to audit analyses: lNamesIWant <- c("copies","lifem","mdmlosspct", "auditfrequency","auditsegments", #"audittype", too, needs fixed, but is not in data! "docsize","shelfsize") results.narrow <- fndfGetSubsetData(results, lNamesIWant) results.plausible <- results.narrow[results.narrow$lifem>=2,] return(results.plausible) } # f n d f G e t S h o c k D a t a fndfGetShockData <- function(results) { # Specific to shock analyses: lNamesIWant <- c("copies","lifem","mdmlosspct", "shockfreq","shockimpact","shockmaxlife","shockspan" ) shockresults <- results[lNamesIWant] return(shockresults) } # f n d f G e t G l i t c h D a t a fndfGetGlitchData <- function(results) { # Specific to shock analyses: lNamesIWant <- c("copies","lifem","mdmlosspct", "glitchfreq","glitchspan","glitchimpact","glitchmaxlife", "docsize","shelfsize") shockresults <- results[lNamesIWant] return(shockresults) } # f n d f G e t D o c s i z e D a t a fndfGetDocsizeData <- function(results) { lNamesIWant <- c("copies","lifem","mdmlosspct", "auditfreq","auditsegments", #"audittype", too, needs fixed "docsize","shelfsize") } # f n d f G e t S h e l f s i z e D a t a fndfGetShelfsizeData <- function(results) { lNamesIWant <- c("copies","lifem","mdmlosspct", "auditfreq","auditsegments", #"audittype", too, needs fixed "docsize","shelfsize") } # Edit history: # 20171002 RBL Copy from Altman original ExploreGiantOutputs.r. # Add functions to select data for specific analyses. # 20171103 RBL Start on audit work. # TODO: Add audittype to the extracted data in GiantOutput files, # and then we can use it here. # 20171129 RBL Add audittype to ignore column list. # Add 10% trimmed mean as a stat. # 20171211 RBL Narrow the list of columns for shock data. # # #END
/veryoldpictures/shocks/low/span1/1yr/DataUtil.r
permissive
MIT-Informatics/PreservationSimulation
R
false
false
6,519
r
# DataUtil.r # Functions to get data for selection and analysis. # From Micah Altman 20170726 # Adapted RBLlandau 20171002 library(tidyverse) # H A C K S # Absurd hack in here to make lifem print reasonably. # Increase the penalty for printing in scientific # (exponential) format, and limit the number of digits # so that there are no places after the radix point. options("scipen"=100, "digits"=1) # End of absurd hack. # Enable printing wide tables. options("width"=120) # Add an infix concatenation operator for strings. `%+%` <- function(a,b) paste0(a,b) # U T I L I T Y F U N C T I O N S # Better functions for summarizing the loss data. # These are more robust than just mean, and more broadly estimated # than median. # midmean is just a trimmed mean of the middle half of the sample. # trimean is a less efficient but easier trimmed central measure, # and was a JWT favorite. # trimmedmean is a 10% trimmed mean, i.e., mean of the middle 80% of the data. trimean <- function(vect) { foo <- fivenum(vect); ans <- 0.5*foo[3] + 0.25*foo[2] + 0.25*foo[4]; ans } midmean <- function(vect) { ans <- mean(vect, trim=0.25, na.rm=TRUE); ans } trimmedmean <- function(vect) { ans <- mean(vect, trim=0.10, na.rm=TRUE); ans } # Select only the dataframe rows with N copies. fnSelectCopies <- function(dfIn, nCopies) { dfIn[dfIn$copies==nCopies,] } # Safe functions for plotting. # Note that safelog(0) returns 0, as needed for sensible axis labeling. safelog <- function(x) {return(log10(x+1))} safe <- function(x) {return(x+0.001)} # Shock tabulation functions. fntShockTab <- function(input, freq, impact, duration) { res1 <- input[input$copies>1 & input$shockfreq==freq & input$shockimpact==impact & input$shockmaxlife==duration,] assign("res.shocktdat", res1, envir=globalenv()) #print(paste("res.shockdat",length(res.shockdat$copies))) restab <- dcast(res1, copies~lifem, value.var="mdmlosspct") return(restab) } # f n d f G e t G i a n t D a t a fndfGetGiantData <- function(dir.string) { # L O A D F I L E S # Load & merge all files in directory if (dir.string == "") {dir.string <- "./"} filesList <- grep(pattern="^Giant.*\\.txt$", dir(dir.string), perl=TRUE, value = TRUE) # !!! I need to get fully qualified names out of grep here. How? # !!! As it is, works only for current directory. sims.df.ls <- lapply( filesList, function(x)read.table(x, header=TRUE,sep=" ", na.strings="nolinefound") ) # NOTE MISSING PARAMETER ENTRIES in na.strings sims.merged.df <- bind_rows(sims.df.ls) # Set up namesets for dependent, independent, ignored vars. # Many of the columns are not relevant to data analysis, only tracking. allVarNames <- colnames(sims.merged.df) ignoreVarNames <- c("timestamp","seed","walltime","cputime","logfilename", "logfilesize","instructionfilename","todaysdatetime","extractorversion", "cpuinfo","mongoid","audittype") resultVarNames <- c("docslost","docsrepairedmajority","docsrepairedminority", "lost","nshocks","nglitches","deadserversactive","deadserversall", "docsokay","auditmajority","auditminority","auditlost","auditrepairs", "auditcycles") coreResultVarNames <- c("docslost","docsrepairedmajority", "docsrepairedminority") paramVarNames <- setdiff(setdiff(allVarNames, resultVarNames), ignoreVarNames) testVarNames <- c("copies", "lifem") nonIgnoreVarNames <- setdiff(allVarNames, ignoreVarNames) # Select, group, and aggregate. sims.selected.df <- sims.merged.df[nonIgnoreVarNames] gp_sims.merged<-eval(parse(text=paste("group_by(sims.selected.df,", paste(collapse=",", paramVarNames),")"))) results <- summarise(gp_sims.merged, mdmlosspct=round(midmean(docslost/docstotal)*100,1), n=n()) selectedresults <- results[which(results[["copies"]]!=1),] return(results) } # f n d f G e t S u b s e t D a t a fndfGetSubsetData <- function(results, lColumnNames) { subset <- results[lColumnNames] return(subset) } # f n d f G e t A u d i t D a t a fndfGetAuditData <- function(results) { # Specific to audit analyses: lNamesIWant <- c("copies","lifem","mdmlosspct", "auditfrequency","auditsegments", #"audittype", too, needs fixed, but is not in data! "docsize","shelfsize") results.narrow <- fndfGetSubsetData(results, lNamesIWant) results.plausible <- results.narrow[results.narrow$lifem>=2,] return(results.plausible) } # f n d f G e t S h o c k D a t a fndfGetShockData <- function(results) { # Specific to shock analyses: lNamesIWant <- c("copies","lifem","mdmlosspct", "shockfreq","shockimpact","shockmaxlife","shockspan" ) shockresults <- results[lNamesIWant] return(shockresults) } # f n d f G e t G l i t c h D a t a fndfGetGlitchData <- function(results) { # Specific to shock analyses: lNamesIWant <- c("copies","lifem","mdmlosspct", "glitchfreq","glitchspan","glitchimpact","glitchmaxlife", "docsize","shelfsize") shockresults <- results[lNamesIWant] return(shockresults) } # f n d f G e t D o c s i z e D a t a fndfGetDocsizeData <- function(results) { lNamesIWant <- c("copies","lifem","mdmlosspct", "auditfreq","auditsegments", #"audittype", too, needs fixed "docsize","shelfsize") } # f n d f G e t S h e l f s i z e D a t a fndfGetShelfsizeData <- function(results) { lNamesIWant <- c("copies","lifem","mdmlosspct", "auditfreq","auditsegments", #"audittype", too, needs fixed "docsize","shelfsize") } # Edit history: # 20171002 RBL Copy from Altman original ExploreGiantOutputs.r. # Add functions to select data for specific analyses. # 20171103 RBL Start on audit work. # TODO: Add audittype to the extracted data in GiantOutput files, # and then we can use it here. # 20171129 RBL Add audittype to ignore column list. # Add 10% trimmed mean as a stat. # 20171211 RBL Narrow the list of columns for shock data. # # #END
netgraph <- function(x, seq = x$seq, labels = rownames(x$TE.fixed), cex = 1, col = "slateblue", offset = 0.0175, scale = 1.10, plastic, thickness, lwd = 5, lwd.min = lwd / 2.5, lwd.max = lwd * 4, dim = "2d", ## highlight = NULL, col.highlight = "red2", lwd.highlight = lwd, highlight.split = ":", ## multiarm = any(x$narms > 2), col.multiarm = NULL, alpha.transparency = 0.5, ## points = FALSE, col.points = "red", cex.points = 1, pch.points = 20, ## start.layout = ifelse(dim == "2d", "circle", "eigen"), eig1 = 2, eig2 = 3, eig3 = 4, iterate, tol = 0.0001, maxit = 500, allfigures = FALSE, A.matrix = x$A.matrix, N.matrix = sign(A.matrix), ## xpos = NULL, ypos = NULL, zpos = NULL, ...) { if (!inherits(x, "netmeta")) stop("Argument 'x' must be an object of class \"netmeta\"") dim <- meta:::setchar(dim, c("2d", "3d")) is_2d <- dim == "2d" is_3d <- !is_2d ## start.layout <- meta:::setchar(start.layout, c("eigen", "prcomp", "circle", "random")) ## if (!missing(seq) & is.null(seq)) stop("Argument 'seq' must be not NULL.") ## if (!missing(labels) & is.null(labels)) stop("Argument 'labels' must be not NULL.") if (missing(iterate)) iterate <- ifelse(start.layout == "circle", FALSE, TRUE) if (missing(plastic)) if (start.layout == "circle" & iterate == FALSE & is_2d) plastic <- TRUE else plastic <- FALSE if (missing(thickness)) { if (start.layout == "circle" & iterate == FALSE & plastic == TRUE) { thick <- "se.fixed" thickness <- "se.fixed" } else { thick <- "equal" thickness <- "equal" } } else { if (!is.matrix(thickness)) { if (length(thickness) == 1 & is.character(thickness)) thick <- meta:::setchar(thickness, c("equal", "number.of.studies", "se.fixed", "se.random", "w.fixed", "w.random")) ## else if (length(thickness) == 1 & is.logical(thickness)) { if (thickness) thick <- "se.fixed" else thick <- "equal" } } else { if ((dim(thickness)[1] != dim(A.matrix)[1]) | (dim(thickness)[2] != dim(A.matrix)[2])) stop("Dimension of argument 'A.matrix' and 'thickness' are different.") if (is.null(dimnames(thickness))) stop("Matrix 'thickness' must have row and column names identical to argument 'A.matrix'.") else { if (any(rownames(thickness) != rownames(A.matrix))) stop("Row names of matrix 'thickness' must be identical to argument 'A.matrix'.") if (any(colnames(thickness) != colnames(A.matrix))) stop("Column names of matrix 'thickness' must be identical to argument 'A.matrix'.") } ## W.matrix <- thickness thick <- "matrix" } } if (allfigures & is_3d) { warning("Argument 'allfigures' set to FALSE for 3-D network plot.") allfigures <- FALSE } if (is.null(seq) | !(start.layout == "circle" & iterate == FALSE)) { seq1 <- 1:length(labels) if (!missing(seq) & !is.null(seq) & (is.null(xpos) & is.null(ypos))) warning("Argument 'seq' only considered if start.layout=\"circle\" and iterate=FALSE.") } else { rn <- rownames(x$TE.fixed) seq1 <- charmatch(setseq(seq, rn), rn) } ## A.matrix <- A.matrix[seq1, seq1] N.matrix <- N.matrix[seq1, seq1] ## if (thick == "matrix") W.matrix <- W.matrix[seq1, seq1] ## labels <- labels[seq1] A.sign <- sign(A.matrix) if ((is_2d & (is.null(xpos) & is.null(ypos))) | (is_3d & (is.null(xpos) & is.null(ypos) & is.null(zpos)))) { stressdata <- stress(x, A.matrix = A.matrix, N.matrix = N.matrix, ## dim = dim, start.layout = start.layout, iterate = iterate, eig1 = eig1, eig2 = eig2, eig3 = eig3, tol = tol, maxit = maxit, ## allfigures = allfigures, ## seq = seq, ## labels = labels, cex = cex, col = col, offset = offset, scale = scale, ## plastic = plastic, thickness = thickness, lwd = lwd, lwd.min = lwd.min, lwd.max = lwd.max, ## highlight = highlight, col.highlight = col.highlight, lwd.highlight = lwd.highlight, highlight.split = highlight.split, ## multiarm col.multiarm = col.multiarm, alpha.transparency = alpha.transparency, ## points = points, col.points = col.points, cex.points = cex.points, pch.points = pch.points, ## ...) ## xpos <- stressdata$x ypos <- stressdata$y if (is_3d) zpos <- stressdata$z } if (allfigures) return(invisible(NULL)) n <- dim(A.matrix)[1] d <- scale * max(abs(c(min(c(xpos, ypos), na.rm = TRUE), max(c(xpos, ypos), na.rm = TRUE)))) ## Generate dataset for plotting ## if (is_2d) pd <- data.frame(xpos, ypos, labels, seq) else pd <- data.frame(xpos, ypos, zpos, labels, seq) ## pd$adj1 <- NA pd$adj2 <- NA pd$adj3 <- NA ## pd$adj1[pd$xpos >= 0] <- 0 pd$adj1[pd$xpos < 0] <- 1 ## pd$adj2[pd$ypos > 0] <- 0 pd$adj2[pd$ypos <= 0] <- 1 ## if (!is_2d) { pd$adj3[pd$zpos > 0] <- 0 pd$adj3[pd$zpos <= 0] <- 1 } ## offset <- offset * 2 * d ## if (is_2d) { pd$xpos.labels <- pd$xpos - offset + 2 * (pd$adj1 == 0) * offset pd$ypos.labels <- pd$ypos - offset + 2 * (pd$adj2 == 0) * offset } else { pd$xpos.labels <- pd$xpos pd$ypos.labels <- pd$ypos pd$zpos.labels <- pd$zpos } ## ## Define coloured regions for multi-arm studies ## if (multiarm) { td1 <- data.frame(studies = x$studies, narms = x$narms) td1 <- td1[rev(order(td1$narms)), ] td1 <- td1[td1$narms > 2, ] multiarm.studies <- td1$studies ## n.multi <- length(multiarm.studies) ## missing.col.multiarm <- missing(col.multiarm) ## if (missing.col.multiarm | is.null(col.multiarm)) { ## Check for R package colorspace & use various gray values if ## not installed packages if (!any(as.data.frame(installed.packages())$Package == "colorspace")) col.polygon <- grDevices::rainbow(n.multi, alpha = alpha.transparency) else col.polygon <- colorspace::sequential_hcl(n.multi, alpha = alpha.transparency) } else { ## if (is.function(col.multiarm)) { mcname <- deparse(substitute(col.multiarm)) ## csfun <- function(fcall, fname) { is.cs <- length(grep(fname, fcall)) > 0 if (is.cs) meta:::is.installed.package("colorspace") is.cs } ## if (csfun(mcname, "rainbow_hcl")) col.polygon <- colorspace::rainbow_hcl(n.multi, start = 240, end = 60, alpha = alpha.transparency) else if (csfun(mcname, "sequential_hcl")) col.polygon <- colorspace::sequential_hcl(n.multi, alpha = alpha.transparency) else if (csfun(mcname, "diverge_hcl")) col.polygon <- colorspace::diverge_hcl(n.multi, alpha = alpha.transparency) else if (csfun(mcname, "heat_hcl")) col.polygon <- colorspace::heat_hcl(n.multi, alpha = alpha.transparency) else if (csfun(mcname, "terrain_hcl")) col.polygon <- colorspace::terrain_hcl(n.multi, alpha = alpha.transparency) else if (csfun(mcname, "diverge_hsv")) col.polygon <- colorspace::diverge_hsv(n.multi, alpha = alpha.transparency) else if (csfun(mcname, "choose_palette")) { fcolm <- colorspace::choose_palette(n = n.multi) col.polygon <- fcolm(n = n.multi) } else col.polygon <- sapply(n.multi, col.multiarm, alpha = alpha.transparency) ## if (csfun(mcname, "sequential_hcl") | csfun(mcname, "diverge_hcl") | csfun(mcname, "heat_hcl")) col.polygon <- rev(col.polygon) } } ## if (!missing.col.multiarm & is.character(col.multiarm)) { if (length(col.multiarm) > 1 & length(col.multiarm) != n.multi) stop("Length of argument 'col.multiarm' must be equal to one or the number of multi-arm studies: ", n.multi) col.polygon <- col.multiarm } } ## ## Define line width ## if (thick == "number.of.studies") { W.matrix <- lwd.max * A.matrix / max(A.matrix) W.matrix[W.matrix < lwd.min & W.matrix != 0] <- lwd.min } else if (thick == "equal") { W.matrix <- lwd * A.sign } else if (thick == "se.fixed") { IV.matrix <- x$seTE.direct.fixed[seq1, seq1] IV.matrix[is.infinite(IV.matrix)] <- NA W.matrix <- lwd.max * min(IV.matrix, na.rm = TRUE) / IV.matrix W.matrix[W.matrix < lwd.min & W.matrix != 0] <- lwd.min } else if (thick == "se.random") { IV.matrix <- x$seTE.direct.random[seq1, seq1] IV.matrix[is.infinite(IV.matrix)] <- NA W.matrix <- lwd.max * min(IV.matrix, na.rm = TRUE) / IV.matrix W.matrix[W.matrix < lwd.min & W.matrix != 0] <- lwd.min } else if (thick == "w.fixed") { IV.matrix <- 1 / x$seTE.direct.fixed[seq1, seq1]^2 IV.matrix[is.infinite(IV.matrix)] <- NA W.matrix <- lwd.max * IV.matrix / max(IV.matrix, na.rm = TRUE) W.matrix[W.matrix < lwd.min & W.matrix != 0] <- lwd.min } else if (thick == "w.random") { IV.matrix <- 1 / x$seTE.direct.random[seq1, seq1]^2 IV.matrix[is.infinite(IV.matrix)] <- NA W.matrix <- lwd.max * IV.matrix / max(IV.matrix, na.rm = TRUE) W.matrix[W.matrix < lwd.min & W.matrix != 0] <- lwd.min } else if (thick == "matrix") { W.matrix[is.infinite(W.matrix)] <- NA if (min(W.matrix[W.matrix != 0], na.rm = TRUE) == max(W.matrix[W.matrix != 0], na.rm = TRUE)) W.matrix <- lwd * W.matrix else W.matrix <- lwd.max * W.matrix / max(W.matrix, na.rm = TRUE) W.matrix[W.matrix < lwd.min & W.matrix != 0] <- lwd.min } ## ## ## Plot graph ## ## range <- c(-d, d) ## if (is_2d) { oldpar <- par(xpd = TRUE, pty = "s") on.exit(par(oldpar)) ## plot(xpos, ypos, xlim = range, ylim = range, type = "n", axes = FALSE, bty = "n", xlab = "", ylab = "", ...) ## ## Add coloured regions for multi-arm studies ## if (multiarm) { ## if (n.multi > 0) { multiarm.labels <- vector("list", n.multi) if (length(col.polygon) == 1) col.polygon <- rep(col.polygon, n.multi) for (i in 1:n.multi) { treat1 <- x$treat1[x$studlab %in% multiarm.studies[i]] treat2 <- x$treat2[x$studlab %in% multiarm.studies[i]] multiarm.labels[[i]] <- sort(unique(c(treat2, treat1))) ## pdm <- pd[pd$seq %in% multiarm.labels[[i]], ] if (nrow(pdm) == 0) pdm <- pd[pd$labels %in% multiarm.labels[[i]], ] ## ## Clockwise ordering of polygon coordinates ## polysort <- function(x, y) { xnorm <- (x - mean(x)) / sd(x) # Normalise coordinate x ynorm <- (y - mean(y)) / sd(y) # Normalise coordinate y r <- sqrt(xnorm^2 + ynorm^2) # Calculate polar coordinates cosphi <- xnorm / r sinphi <- ynorm / r s <- as.numeric(sinphi > 0) # Define angles to lie in [0, 2 * pi] phi <- acos(cosphi) alpha <- s * phi + (1 - s) * (2 * pi - phi) ## res <- order(alpha) res } ## pdm <- pdm[polysort(pdm$xpos, pdm$ypos), ] ## polygon(pdm$xpos, pdm$ypos, col = col.polygon[i], border = NA) } } } ## ## Draw lines ## if (plastic) { n.plastic <- 30 lwd.multiply <- rep(NA, n.plastic) cols <- rep("", n.plastic) j <- 0 for (i in n.plastic:1) { j <- j + 1 lwd.multiply[j] <- sin(pi * i / 2 / n.plastic) cols[j] <- paste("gray", round(100 * (1 - i / n.plastic)), sep = "") } } else { lwd.multiply <- 1 cols <- col } ## for (n.plines in 1:length(lwd.multiply)) { for (i in 1:(n - 1)) { for (j in (i + 1):n) { if (A.sign[i, j] > 0) { lines(c(xpos[i], xpos[j]), c(ypos[i], ypos[j]), lwd = W.matrix[i, j] * lwd.multiply[n.plines], col = cols[n.plines]) } } } } ## ## Add highlighted comparisons ## if (!is.null(highlight)) { for (high in highlight) { highs <- unlist(strsplit(high, split = highlight.split)) if (length(highs) != 2) stop("Wrong format for argument 'highlight' (see helpfile of plotgraph command).") ## if (sum(pd$labels %in% highs) != 2) stop(paste("Argument 'highlight' must contain two of the following values (separated by \":\"):\n ", paste(paste("'", pd$labels, "'", sep = ""), collapse = " - "), sep = "")) ## pdh <- pd[pd$labels %in% highs, ] ## if (is_2d) { lines(pdh$xpos, pdh$ypos, lwd = W.matrix[labels == highs[1], labels == highs[2]], col = col.highlight) } } } ## ## Add points for labels ## if (points) points(xpos, ypos, pch = pch.points, cex = cex.points, col = col.points) ## ## Print treatment labels ## if (!is.null(labels)) for (i in 1:n) text(pd$xpos.labels[i], pd$ypos.labels[i], labels = pd$labels[i], cex = cex, adj = c(pd$adj1[i], pd$adj2[i])) } else { plot3d(xpos, ypos, zpos, size = 10, col = col.points, cex = cex.points, axes = FALSE, box = FALSE, xlab = "", ylab = "", zlab = "") ## ## Add points for labels ## if (points) points3d(xpos, ypos, zpos, pch = pch.points, cex = cex.points, col = col.points) ## ## Print treatment labels ## if (!is.null(labels)) for (i in 1:n) text3d(pd$xpos.labels[i], pd$ypos.labels[i], pd$zpos.labels[i], texts = pd$labels[i], cex = cex, adj = c(pd$adj1[i], pd$adj2[i])) ## ## Add highlighted comparisons ## if (!is.null(highlight)) { for (high in highlight) { highs <- unlist(strsplit(high, split = highlight.split)) if (length(highs) != 2) stop("Wrong format for argument 'highlight' (see helpfile of plotgraph command).") ## if (sum(pd$labels %in% highs) != 2) stop(paste("Argument 'highlight' must contain two of the following values (separated by \":\"):\n ", paste(paste("'", pd$labels, "'", sep = ""), collapse = " - "), sep = "")) ## pdh <- pd[pd$labels %in% highs, ] ## lines3d(pdh$xpos*(1+1e-4), pdh$ypos*(1+1e-4), pdh$zpos*(1+1e-4), lwd = W.matrix[labels == highs[1], labels == highs[2]], col = col.highlight) } } ## ## Add coloured regions for multi-arm studies ## if (multiarm) { ## morethan3 <- FALSE ## if (n.multi > 0) { multiarm.labels <- vector("list", n.multi) if (length(col.polygon) == 1) col.polygon <- rep(col.polygon, n.multi) for (i in 1:n.multi) { treat1 <- x$treat1[x$studlab %in% multiarm.studies[i]] treat2 <- x$treat2[x$studlab %in% multiarm.studies[i]] multiarm.labels[[i]] <- sort(unique(c(treat2, treat1))) ## pdm <- pd[pd$seq %in% multiarm.labels[[i]], ] if (nrow(pdm) == 0) pdm <- pd[pd$labels %in% multiarm.labels[[i]], ] if (nrow(pdm) == 3) triangles3d(pdm$xpos, pdm$ypos, pdm$zpos, col = col.polygon[i]) else morethan3 <- TRUE } } if (morethan3) warning("Multi-arm studies with more than three treatments not shown in 3-D plot.") } ## ## Draw lines ## for (i in 1:(n - 1)) { for (j in (i + 1):n) { if (A.sign[i, j] > 0) { lines3d(c(xpos[i], xpos[j]), c(ypos[i], ypos[j]), c(zpos[i], zpos[j]), lwd = W.matrix[i, j], col = col) } } } } invisible(NULL) }
/netmeta/R/netgraph.R
no_license
ingted/R-Examples
R
false
false
17,779
r
netgraph <- function(x, seq = x$seq, labels = rownames(x$TE.fixed), cex = 1, col = "slateblue", offset = 0.0175, scale = 1.10, plastic, thickness, lwd = 5, lwd.min = lwd / 2.5, lwd.max = lwd * 4, dim = "2d", ## highlight = NULL, col.highlight = "red2", lwd.highlight = lwd, highlight.split = ":", ## multiarm = any(x$narms > 2), col.multiarm = NULL, alpha.transparency = 0.5, ## points = FALSE, col.points = "red", cex.points = 1, pch.points = 20, ## start.layout = ifelse(dim == "2d", "circle", "eigen"), eig1 = 2, eig2 = 3, eig3 = 4, iterate, tol = 0.0001, maxit = 500, allfigures = FALSE, A.matrix = x$A.matrix, N.matrix = sign(A.matrix), ## xpos = NULL, ypos = NULL, zpos = NULL, ...) { if (!inherits(x, "netmeta")) stop("Argument 'x' must be an object of class \"netmeta\"") dim <- meta:::setchar(dim, c("2d", "3d")) is_2d <- dim == "2d" is_3d <- !is_2d ## start.layout <- meta:::setchar(start.layout, c("eigen", "prcomp", "circle", "random")) ## if (!missing(seq) & is.null(seq)) stop("Argument 'seq' must be not NULL.") ## if (!missing(labels) & is.null(labels)) stop("Argument 'labels' must be not NULL.") if (missing(iterate)) iterate <- ifelse(start.layout == "circle", FALSE, TRUE) if (missing(plastic)) if (start.layout == "circle" & iterate == FALSE & is_2d) plastic <- TRUE else plastic <- FALSE if (missing(thickness)) { if (start.layout == "circle" & iterate == FALSE & plastic == TRUE) { thick <- "se.fixed" thickness <- "se.fixed" } else { thick <- "equal" thickness <- "equal" } } else { if (!is.matrix(thickness)) { if (length(thickness) == 1 & is.character(thickness)) thick <- meta:::setchar(thickness, c("equal", "number.of.studies", "se.fixed", "se.random", "w.fixed", "w.random")) ## else if (length(thickness) == 1 & is.logical(thickness)) { if (thickness) thick <- "se.fixed" else thick <- "equal" } } else { if ((dim(thickness)[1] != dim(A.matrix)[1]) | (dim(thickness)[2] != dim(A.matrix)[2])) stop("Dimension of argument 'A.matrix' and 'thickness' are different.") if (is.null(dimnames(thickness))) stop("Matrix 'thickness' must have row and column names identical to argument 'A.matrix'.") else { if (any(rownames(thickness) != rownames(A.matrix))) stop("Row names of matrix 'thickness' must be identical to argument 'A.matrix'.") if (any(colnames(thickness) != colnames(A.matrix))) stop("Column names of matrix 'thickness' must be identical to argument 'A.matrix'.") } ## W.matrix <- thickness thick <- "matrix" } } if (allfigures & is_3d) { warning("Argument 'allfigures' set to FALSE for 3-D network plot.") allfigures <- FALSE } if (is.null(seq) | !(start.layout == "circle" & iterate == FALSE)) { seq1 <- 1:length(labels) if (!missing(seq) & !is.null(seq) & (is.null(xpos) & is.null(ypos))) warning("Argument 'seq' only considered if start.layout=\"circle\" and iterate=FALSE.") } else { rn <- rownames(x$TE.fixed) seq1 <- charmatch(setseq(seq, rn), rn) } ## A.matrix <- A.matrix[seq1, seq1] N.matrix <- N.matrix[seq1, seq1] ## if (thick == "matrix") W.matrix <- W.matrix[seq1, seq1] ## labels <- labels[seq1] A.sign <- sign(A.matrix) if ((is_2d & (is.null(xpos) & is.null(ypos))) | (is_3d & (is.null(xpos) & is.null(ypos) & is.null(zpos)))) { stressdata <- stress(x, A.matrix = A.matrix, N.matrix = N.matrix, ## dim = dim, start.layout = start.layout, iterate = iterate, eig1 = eig1, eig2 = eig2, eig3 = eig3, tol = tol, maxit = maxit, ## allfigures = allfigures, ## seq = seq, ## labels = labels, cex = cex, col = col, offset = offset, scale = scale, ## plastic = plastic, thickness = thickness, lwd = lwd, lwd.min = lwd.min, lwd.max = lwd.max, ## highlight = highlight, col.highlight = col.highlight, lwd.highlight = lwd.highlight, highlight.split = highlight.split, ## multiarm col.multiarm = col.multiarm, alpha.transparency = alpha.transparency, ## points = points, col.points = col.points, cex.points = cex.points, pch.points = pch.points, ## ...) ## xpos <- stressdata$x ypos <- stressdata$y if (is_3d) zpos <- stressdata$z } if (allfigures) return(invisible(NULL)) n <- dim(A.matrix)[1] d <- scale * max(abs(c(min(c(xpos, ypos), na.rm = TRUE), max(c(xpos, ypos), na.rm = TRUE)))) ## Generate dataset for plotting ## if (is_2d) pd <- data.frame(xpos, ypos, labels, seq) else pd <- data.frame(xpos, ypos, zpos, labels, seq) ## pd$adj1 <- NA pd$adj2 <- NA pd$adj3 <- NA ## pd$adj1[pd$xpos >= 0] <- 0 pd$adj1[pd$xpos < 0] <- 1 ## pd$adj2[pd$ypos > 0] <- 0 pd$adj2[pd$ypos <= 0] <- 1 ## if (!is_2d) { pd$adj3[pd$zpos > 0] <- 0 pd$adj3[pd$zpos <= 0] <- 1 } ## offset <- offset * 2 * d ## if (is_2d) { pd$xpos.labels <- pd$xpos - offset + 2 * (pd$adj1 == 0) * offset pd$ypos.labels <- pd$ypos - offset + 2 * (pd$adj2 == 0) * offset } else { pd$xpos.labels <- pd$xpos pd$ypos.labels <- pd$ypos pd$zpos.labels <- pd$zpos } ## ## Define coloured regions for multi-arm studies ## if (multiarm) { td1 <- data.frame(studies = x$studies, narms = x$narms) td1 <- td1[rev(order(td1$narms)), ] td1 <- td1[td1$narms > 2, ] multiarm.studies <- td1$studies ## n.multi <- length(multiarm.studies) ## missing.col.multiarm <- missing(col.multiarm) ## if (missing.col.multiarm | is.null(col.multiarm)) { ## Check for R package colorspace & use various gray values if ## not installed packages if (!any(as.data.frame(installed.packages())$Package == "colorspace")) col.polygon <- grDevices::rainbow(n.multi, alpha = alpha.transparency) else col.polygon <- colorspace::sequential_hcl(n.multi, alpha = alpha.transparency) } else { ## if (is.function(col.multiarm)) { mcname <- deparse(substitute(col.multiarm)) ## csfun <- function(fcall, fname) { is.cs <- length(grep(fname, fcall)) > 0 if (is.cs) meta:::is.installed.package("colorspace") is.cs } ## if (csfun(mcname, "rainbow_hcl")) col.polygon <- colorspace::rainbow_hcl(n.multi, start = 240, end = 60, alpha = alpha.transparency) else if (csfun(mcname, "sequential_hcl")) col.polygon <- colorspace::sequential_hcl(n.multi, alpha = alpha.transparency) else if (csfun(mcname, "diverge_hcl")) col.polygon <- colorspace::diverge_hcl(n.multi, alpha = alpha.transparency) else if (csfun(mcname, "heat_hcl")) col.polygon <- colorspace::heat_hcl(n.multi, alpha = alpha.transparency) else if (csfun(mcname, "terrain_hcl")) col.polygon <- colorspace::terrain_hcl(n.multi, alpha = alpha.transparency) else if (csfun(mcname, "diverge_hsv")) col.polygon <- colorspace::diverge_hsv(n.multi, alpha = alpha.transparency) else if (csfun(mcname, "choose_palette")) { fcolm <- colorspace::choose_palette(n = n.multi) col.polygon <- fcolm(n = n.multi) } else col.polygon <- sapply(n.multi, col.multiarm, alpha = alpha.transparency) ## if (csfun(mcname, "sequential_hcl") | csfun(mcname, "diverge_hcl") | csfun(mcname, "heat_hcl")) col.polygon <- rev(col.polygon) } } ## if (!missing.col.multiarm & is.character(col.multiarm)) { if (length(col.multiarm) > 1 & length(col.multiarm) != n.multi) stop("Length of argument 'col.multiarm' must be equal to one or the number of multi-arm studies: ", n.multi) col.polygon <- col.multiarm } } ## ## Define line width ## if (thick == "number.of.studies") { W.matrix <- lwd.max * A.matrix / max(A.matrix) W.matrix[W.matrix < lwd.min & W.matrix != 0] <- lwd.min } else if (thick == "equal") { W.matrix <- lwd * A.sign } else if (thick == "se.fixed") { IV.matrix <- x$seTE.direct.fixed[seq1, seq1] IV.matrix[is.infinite(IV.matrix)] <- NA W.matrix <- lwd.max * min(IV.matrix, na.rm = TRUE) / IV.matrix W.matrix[W.matrix < lwd.min & W.matrix != 0] <- lwd.min } else if (thick == "se.random") { IV.matrix <- x$seTE.direct.random[seq1, seq1] IV.matrix[is.infinite(IV.matrix)] <- NA W.matrix <- lwd.max * min(IV.matrix, na.rm = TRUE) / IV.matrix W.matrix[W.matrix < lwd.min & W.matrix != 0] <- lwd.min } else if (thick == "w.fixed") { IV.matrix <- 1 / x$seTE.direct.fixed[seq1, seq1]^2 IV.matrix[is.infinite(IV.matrix)] <- NA W.matrix <- lwd.max * IV.matrix / max(IV.matrix, na.rm = TRUE) W.matrix[W.matrix < lwd.min & W.matrix != 0] <- lwd.min } else if (thick == "w.random") { IV.matrix <- 1 / x$seTE.direct.random[seq1, seq1]^2 IV.matrix[is.infinite(IV.matrix)] <- NA W.matrix <- lwd.max * IV.matrix / max(IV.matrix, na.rm = TRUE) W.matrix[W.matrix < lwd.min & W.matrix != 0] <- lwd.min } else if (thick == "matrix") { W.matrix[is.infinite(W.matrix)] <- NA if (min(W.matrix[W.matrix != 0], na.rm = TRUE) == max(W.matrix[W.matrix != 0], na.rm = TRUE)) W.matrix <- lwd * W.matrix else W.matrix <- lwd.max * W.matrix / max(W.matrix, na.rm = TRUE) W.matrix[W.matrix < lwd.min & W.matrix != 0] <- lwd.min } ## ## ## Plot graph ## ## range <- c(-d, d) ## if (is_2d) { oldpar <- par(xpd = TRUE, pty = "s") on.exit(par(oldpar)) ## plot(xpos, ypos, xlim = range, ylim = range, type = "n", axes = FALSE, bty = "n", xlab = "", ylab = "", ...) ## ## Add coloured regions for multi-arm studies ## if (multiarm) { ## if (n.multi > 0) { multiarm.labels <- vector("list", n.multi) if (length(col.polygon) == 1) col.polygon <- rep(col.polygon, n.multi) for (i in 1:n.multi) { treat1 <- x$treat1[x$studlab %in% multiarm.studies[i]] treat2 <- x$treat2[x$studlab %in% multiarm.studies[i]] multiarm.labels[[i]] <- sort(unique(c(treat2, treat1))) ## pdm <- pd[pd$seq %in% multiarm.labels[[i]], ] if (nrow(pdm) == 0) pdm <- pd[pd$labels %in% multiarm.labels[[i]], ] ## ## Clockwise ordering of polygon coordinates ## polysort <- function(x, y) { xnorm <- (x - mean(x)) / sd(x) # Normalise coordinate x ynorm <- (y - mean(y)) / sd(y) # Normalise coordinate y r <- sqrt(xnorm^2 + ynorm^2) # Calculate polar coordinates cosphi <- xnorm / r sinphi <- ynorm / r s <- as.numeric(sinphi > 0) # Define angles to lie in [0, 2 * pi] phi <- acos(cosphi) alpha <- s * phi + (1 - s) * (2 * pi - phi) ## res <- order(alpha) res } ## pdm <- pdm[polysort(pdm$xpos, pdm$ypos), ] ## polygon(pdm$xpos, pdm$ypos, col = col.polygon[i], border = NA) } } } ## ## Draw lines ## if (plastic) { n.plastic <- 30 lwd.multiply <- rep(NA, n.plastic) cols <- rep("", n.plastic) j <- 0 for (i in n.plastic:1) { j <- j + 1 lwd.multiply[j] <- sin(pi * i / 2 / n.plastic) cols[j] <- paste("gray", round(100 * (1 - i / n.plastic)), sep = "") } } else { lwd.multiply <- 1 cols <- col } ## for (n.plines in 1:length(lwd.multiply)) { for (i in 1:(n - 1)) { for (j in (i + 1):n) { if (A.sign[i, j] > 0) { lines(c(xpos[i], xpos[j]), c(ypos[i], ypos[j]), lwd = W.matrix[i, j] * lwd.multiply[n.plines], col = cols[n.plines]) } } } } ## ## Add highlighted comparisons ## if (!is.null(highlight)) { for (high in highlight) { highs <- unlist(strsplit(high, split = highlight.split)) if (length(highs) != 2) stop("Wrong format for argument 'highlight' (see helpfile of plotgraph command).") ## if (sum(pd$labels %in% highs) != 2) stop(paste("Argument 'highlight' must contain two of the following values (separated by \":\"):\n ", paste(paste("'", pd$labels, "'", sep = ""), collapse = " - "), sep = "")) ## pdh <- pd[pd$labels %in% highs, ] ## if (is_2d) { lines(pdh$xpos, pdh$ypos, lwd = W.matrix[labels == highs[1], labels == highs[2]], col = col.highlight) } } } ## ## Add points for labels ## if (points) points(xpos, ypos, pch = pch.points, cex = cex.points, col = col.points) ## ## Print treatment labels ## if (!is.null(labels)) for (i in 1:n) text(pd$xpos.labels[i], pd$ypos.labels[i], labels = pd$labels[i], cex = cex, adj = c(pd$adj1[i], pd$adj2[i])) } else { plot3d(xpos, ypos, zpos, size = 10, col = col.points, cex = cex.points, axes = FALSE, box = FALSE, xlab = "", ylab = "", zlab = "") ## ## Add points for labels ## if (points) points3d(xpos, ypos, zpos, pch = pch.points, cex = cex.points, col = col.points) ## ## Print treatment labels ## if (!is.null(labels)) for (i in 1:n) text3d(pd$xpos.labels[i], pd$ypos.labels[i], pd$zpos.labels[i], texts = pd$labels[i], cex = cex, adj = c(pd$adj1[i], pd$adj2[i])) ## ## Add highlighted comparisons ## if (!is.null(highlight)) { for (high in highlight) { highs <- unlist(strsplit(high, split = highlight.split)) if (length(highs) != 2) stop("Wrong format for argument 'highlight' (see helpfile of plotgraph command).") ## if (sum(pd$labels %in% highs) != 2) stop(paste("Argument 'highlight' must contain two of the following values (separated by \":\"):\n ", paste(paste("'", pd$labels, "'", sep = ""), collapse = " - "), sep = "")) ## pdh <- pd[pd$labels %in% highs, ] ## lines3d(pdh$xpos*(1+1e-4), pdh$ypos*(1+1e-4), pdh$zpos*(1+1e-4), lwd = W.matrix[labels == highs[1], labels == highs[2]], col = col.highlight) } } ## ## Add coloured regions for multi-arm studies ## if (multiarm) { ## morethan3 <- FALSE ## if (n.multi > 0) { multiarm.labels <- vector("list", n.multi) if (length(col.polygon) == 1) col.polygon <- rep(col.polygon, n.multi) for (i in 1:n.multi) { treat1 <- x$treat1[x$studlab %in% multiarm.studies[i]] treat2 <- x$treat2[x$studlab %in% multiarm.studies[i]] multiarm.labels[[i]] <- sort(unique(c(treat2, treat1))) ## pdm <- pd[pd$seq %in% multiarm.labels[[i]], ] if (nrow(pdm) == 0) pdm <- pd[pd$labels %in% multiarm.labels[[i]], ] if (nrow(pdm) == 3) triangles3d(pdm$xpos, pdm$ypos, pdm$zpos, col = col.polygon[i]) else morethan3 <- TRUE } } if (morethan3) warning("Multi-arm studies with more than three treatments not shown in 3-D plot.") } ## ## Draw lines ## for (i in 1:(n - 1)) { for (j in (i + 1):n) { if (A.sign[i, j] > 0) { lines3d(c(xpos[i], xpos[j]), c(ypos[i], ypos[j]), c(zpos[i], zpos[j]), lwd = W.matrix[i, j], col = col) } } } } invisible(NULL) }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/sort_p.R \name{sort_p.tbl_regression} \alias{sort_p.tbl_regression} \title{Sort variables in table by ascending p-values} \usage{ \method{sort_p}{tbl_regression}(x, ...) } \arguments{ \item{x}{An object created using \code{tbl_regression} function} \item{...}{Not used} } \value{ A \code{tbl_regression} object } \description{ Sort variables in tables created by \link{tbl_regression} by ascending p-values } \section{Example Output}{ \if{html}{\figure{tbl_lm_sort_p_ex.png}{options: width=50\%}} } \examples{ tbl_lm_sort_p_ex <- glm(response ~ trt + grade, trial, family = binomial(link = "logit")) \%>\% tbl_regression(exponentiate = TRUE) \%>\% sort_p() } \seealso{ Other tbl_regression tools: \code{\link{add_global_p.tbl_regression}}, \code{\link{add_nevent.tbl_regression}}, \code{\link{bold_italicize_labels_levels}}, \code{\link{bold_p.tbl_regression}}, \code{\link{bold_p.tbl_stack}}, \code{\link{inline_text.tbl_regression}}, \code{\link{modify_header}}, \code{\link{tbl_merge}}, \code{\link{tbl_regression}}, \code{\link{tbl_stack}} } \author{ Karissa Whiting } \concept{tbl_regression tools}
/man/sort_p.tbl_regression.Rd
permissive
Glewando/gtsummary
R
false
true
1,205
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/sort_p.R \name{sort_p.tbl_regression} \alias{sort_p.tbl_regression} \title{Sort variables in table by ascending p-values} \usage{ \method{sort_p}{tbl_regression}(x, ...) } \arguments{ \item{x}{An object created using \code{tbl_regression} function} \item{...}{Not used} } \value{ A \code{tbl_regression} object } \description{ Sort variables in tables created by \link{tbl_regression} by ascending p-values } \section{Example Output}{ \if{html}{\figure{tbl_lm_sort_p_ex.png}{options: width=50\%}} } \examples{ tbl_lm_sort_p_ex <- glm(response ~ trt + grade, trial, family = binomial(link = "logit")) \%>\% tbl_regression(exponentiate = TRUE) \%>\% sort_p() } \seealso{ Other tbl_regression tools: \code{\link{add_global_p.tbl_regression}}, \code{\link{add_nevent.tbl_regression}}, \code{\link{bold_italicize_labels_levels}}, \code{\link{bold_p.tbl_regression}}, \code{\link{bold_p.tbl_stack}}, \code{\link{inline_text.tbl_regression}}, \code{\link{modify_header}}, \code{\link{tbl_merge}}, \code{\link{tbl_regression}}, \code{\link{tbl_stack}} } \author{ Karissa Whiting } \concept{tbl_regression tools}
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/empirical.controls.R \name{empirical.controls} \alias{empirical.controls} \title{A function for estimating the probability that each gene is an empirical control} \usage{ empirical.controls(dat, mod, mod0 = NULL, n.sv, B = 5, type = c("norm", "counts")) } \arguments{ \item{dat}{The transformed data matrix with the variables in rows and samples in columns} \item{mod}{The model matrix being used to fit the data} \item{mod0}{The null model being compared when fitting the data} \item{n.sv}{The number of surogate variables to estimate} \item{B}{The number of iterations of the irwsva algorithm to perform} \item{type}{If type is norm then standard irwsva is applied, if type is counts, then the moderated log transform is applied first} } \value{ pcontrol A vector of probabilites that each gene is a control. } \description{ This function uses the iteratively reweighted surrogate variable analysis approach to estimate the probability that each gene is an empirical control. } \examples{ library(bladderbatch) data(bladderdata) dat <- bladderEset[1:5000,] pheno = pData(dat) edata = exprs(dat) mod = model.matrix(~as.factor(cancer), data=pheno) n.sv = num.sv(edata,mod,method="leek") pcontrol <- empirical.controls(edata,mod,mod0=NULL,n.sv=n.sv,type="norm") }
/man/empirical.controls.Rd
no_license
DongyueXie/sva-devel
R
false
true
1,351
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/empirical.controls.R \name{empirical.controls} \alias{empirical.controls} \title{A function for estimating the probability that each gene is an empirical control} \usage{ empirical.controls(dat, mod, mod0 = NULL, n.sv, B = 5, type = c("norm", "counts")) } \arguments{ \item{dat}{The transformed data matrix with the variables in rows and samples in columns} \item{mod}{The model matrix being used to fit the data} \item{mod0}{The null model being compared when fitting the data} \item{n.sv}{The number of surogate variables to estimate} \item{B}{The number of iterations of the irwsva algorithm to perform} \item{type}{If type is norm then standard irwsva is applied, if type is counts, then the moderated log transform is applied first} } \value{ pcontrol A vector of probabilites that each gene is a control. } \description{ This function uses the iteratively reweighted surrogate variable analysis approach to estimate the probability that each gene is an empirical control. } \examples{ library(bladderbatch) data(bladderdata) dat <- bladderEset[1:5000,] pheno = pData(dat) edata = exprs(dat) mod = model.matrix(~as.factor(cancer), data=pheno) n.sv = num.sv(edata,mod,method="leek") pcontrol <- empirical.controls(edata,mod,mod0=NULL,n.sv=n.sv,type="norm") }
#Day 16 setwd("C:/Users/David.simons/Documents/advent of code") dance <- unlist(strsplit(readLines("day16.txt"), ",")) moves <- substr(dance, 1, 1) args <- strsplit(substr(dance, 2, nchar(dance)), "/") #part 1 ---- danceRound <- function(progs){ N <- length(progs) for (i in seq_along(moves)) { if (moves[i] == "s") { n <- as.integer(args[[i]]) progs <- progs[c((N-n+1):N, 1:(N-n))] } else if (moves[i] == "x") { x <- as.integer(args[[i]]) + 1 progs[x] <- progs[rev(x)] } else if (moves[i] == "p") { x <- args[[i]] progs[match(x, progs)] <- rev(x) } } progs } progs <- danceRound(letters[1:16]) print(do.call(paste0, as.list(progs))) #part 2 ---- #try it but see if there's a loop anywhere progs <- letters[1:16] history <- do.call(paste0, as.list(progs)) for (round in seq(1e9)) { progs <- danceRound(progs) arrangement <- do.call(paste0, as.list(progs)) if (arrangement %in% history) { print(sprintf("Repeat found after moves %d and %d", match(arrangement, history) - 1, round)) break } else history <- c(history, arrangement) } #therefore only need to go dance 1e9 %% 60 times (and already recorded in our history) print(history[1e9%%60 + 1])
/day16.R
no_license
d-sci/Advent-of-Code-2017
R
false
false
1,274
r
#Day 16 setwd("C:/Users/David.simons/Documents/advent of code") dance <- unlist(strsplit(readLines("day16.txt"), ",")) moves <- substr(dance, 1, 1) args <- strsplit(substr(dance, 2, nchar(dance)), "/") #part 1 ---- danceRound <- function(progs){ N <- length(progs) for (i in seq_along(moves)) { if (moves[i] == "s") { n <- as.integer(args[[i]]) progs <- progs[c((N-n+1):N, 1:(N-n))] } else if (moves[i] == "x") { x <- as.integer(args[[i]]) + 1 progs[x] <- progs[rev(x)] } else if (moves[i] == "p") { x <- args[[i]] progs[match(x, progs)] <- rev(x) } } progs } progs <- danceRound(letters[1:16]) print(do.call(paste0, as.list(progs))) #part 2 ---- #try it but see if there's a loop anywhere progs <- letters[1:16] history <- do.call(paste0, as.list(progs)) for (round in seq(1e9)) { progs <- danceRound(progs) arrangement <- do.call(paste0, as.list(progs)) if (arrangement %in% history) { print(sprintf("Repeat found after moves %d and %d", match(arrangement, history) - 1, round)) break } else history <- c(history, arrangement) } #therefore only need to go dance 1e9 %% 60 times (and already recorded in our history) print(history[1e9%%60 + 1])
# R Script to interpolate model variable onto pressure # grid and generate zonal mean. # Takes input's: # "var", "nc1" and "pres" from calling script # Alex Archibald, February, 2012 # This version also includes a call to a routine to do a # 2d interpolation of the model field (lon, lat) to the obs # grid (i.e. N96-N48 transform) source("/home/ata27/R/interp2d.R") # Arguments --------------------------------------------------------------------------------------- # pmax <- length(pres) # extract model co-ords lonp <- get.var.ncdf(nc1, "longitude") latp <- get.var.ncdf(nc1, "latitude") levp <- get.var.ncdf(nc1, "hybrid_ht") timep <- get.var.ncdf(nc1, "t") lonv <- get.var.ncdf(nc1, "longitude") latv <- get.var.ncdf(nc1, "latitude") levv <- get.var.ncdf(nc1, "hybrid_ht") timev <- get.var.ncdf(nc1, "t") # check that the two variables have the same lengths if ( length(lonp) == length(lonv) ) xmax <- length(lonp) else print("Longitudes not equal") if ( length(latp) == length(latv) ) ymax <- length(latp) else print("Latitudes not equal") if ( length(levp) == length(levv) ) zmax <- length(levp) else print("Levels not equal") if ( length(timep) == length(timev) ) tmax <- length(timep) else print("Times not equal") # set counters to NULL it <- NULL; iy <- NULL; ix <- NULL; ip <- NULL i <- NULL; j <- NULL # set variables p1 <- NULL; p2 <- NULL; zm <- FALSE # hard code the N48/Obs co-ords xmax <- 96; ymax <- 73 # create empty array's to fill with data newvv <- array(as.numeric(NA), dim=c(ymax,pmax,tmax)) pp <- array(as.numeric(NA), dim=c(ymax,zmax,tmax)) vv <- array(as.numeric(NA), dim=c(ymax,zmax,tmax)) pp.rgd2<- array(as.numeric(NA), dim=c(xmax,ymax,zmax,tmax)) vv.rgd2<- array(as.numeric(NA), dim=c(xmax,ymax,zmax,tmax)) # check for dimension missmatches source(paste(script.dir, "/interp_error_checks.R", sep="")) # extract the model variables and regrid onto the same grid as the obs vv.rgd <- get.var.ncdf( nc1,var) for (i in 1:length(levv) ) { for (j in 1:length(timev) ) { vv.rgd2[,,i,j] <- interp2d(vv.rgd[,,i,j], newx=xmax, newy=ymax) } } pp.rgd <- get.var.ncdf( nc1,"p") for (i in 1:length(levv) ) { for (j in 1:length(timev) ) { pp.rgd2[,,i,j] <- interp2d(pp.rgd[,,i,j], newx=xmax, newy=ymax) } } # Main code here -------------------------------------------------------------------------------------- # # loop over all time steps print ("start loop over pressure") for (it in 1:tmax) { print (paste("Time step: ",it,sep="")) # read pressure and variable pp <- pp.rgd2[,,,it:1] pp <- apply(pp,c(2,3),mean) print(str(pp)) vv <- vv.rgd2[,,,it:1] vv <- apply(vv,c(2,3),mean) print(str(vv)) # loop over longitude and latitude for (iy in 1:ymax) { # loop over pressure for (ip in 1:pmax) { # determine the interval, loop over model levels and interpolate linear in log(p) ptarget = log(pres[ip]) for (iz in 2:zmax) { p1=log(pp[iy,iz-1]/100.) # NOTE conversion to hPa p2=log(pp[iy,iz ]/100.) if ( ptarget <= p1 ) { if ( ptarget >= p2 ) { newvv[iy,ip,it] = vv[iy,iz-1] + ( ( (vv[iy,iz] - vv[iy,iz-1] )/(p2-p1))*(ptarget-p1) ) } # end if } # end if/while }# end do model level loop } # end do pressure loop } # end do latitude loop } # end do loop over time # end of main code ----------------------------------------------------------------------------------- #
/interpolate_zm_n96_eval.R
no_license
paultgriffiths/R_pyle
R
false
false
3,514
r
# R Script to interpolate model variable onto pressure # grid and generate zonal mean. # Takes input's: # "var", "nc1" and "pres" from calling script # Alex Archibald, February, 2012 # This version also includes a call to a routine to do a # 2d interpolation of the model field (lon, lat) to the obs # grid (i.e. N96-N48 transform) source("/home/ata27/R/interp2d.R") # Arguments --------------------------------------------------------------------------------------- # pmax <- length(pres) # extract model co-ords lonp <- get.var.ncdf(nc1, "longitude") latp <- get.var.ncdf(nc1, "latitude") levp <- get.var.ncdf(nc1, "hybrid_ht") timep <- get.var.ncdf(nc1, "t") lonv <- get.var.ncdf(nc1, "longitude") latv <- get.var.ncdf(nc1, "latitude") levv <- get.var.ncdf(nc1, "hybrid_ht") timev <- get.var.ncdf(nc1, "t") # check that the two variables have the same lengths if ( length(lonp) == length(lonv) ) xmax <- length(lonp) else print("Longitudes not equal") if ( length(latp) == length(latv) ) ymax <- length(latp) else print("Latitudes not equal") if ( length(levp) == length(levv) ) zmax <- length(levp) else print("Levels not equal") if ( length(timep) == length(timev) ) tmax <- length(timep) else print("Times not equal") # set counters to NULL it <- NULL; iy <- NULL; ix <- NULL; ip <- NULL i <- NULL; j <- NULL # set variables p1 <- NULL; p2 <- NULL; zm <- FALSE # hard code the N48/Obs co-ords xmax <- 96; ymax <- 73 # create empty array's to fill with data newvv <- array(as.numeric(NA), dim=c(ymax,pmax,tmax)) pp <- array(as.numeric(NA), dim=c(ymax,zmax,tmax)) vv <- array(as.numeric(NA), dim=c(ymax,zmax,tmax)) pp.rgd2<- array(as.numeric(NA), dim=c(xmax,ymax,zmax,tmax)) vv.rgd2<- array(as.numeric(NA), dim=c(xmax,ymax,zmax,tmax)) # check for dimension missmatches source(paste(script.dir, "/interp_error_checks.R", sep="")) # extract the model variables and regrid onto the same grid as the obs vv.rgd <- get.var.ncdf( nc1,var) for (i in 1:length(levv) ) { for (j in 1:length(timev) ) { vv.rgd2[,,i,j] <- interp2d(vv.rgd[,,i,j], newx=xmax, newy=ymax) } } pp.rgd <- get.var.ncdf( nc1,"p") for (i in 1:length(levv) ) { for (j in 1:length(timev) ) { pp.rgd2[,,i,j] <- interp2d(pp.rgd[,,i,j], newx=xmax, newy=ymax) } } # Main code here -------------------------------------------------------------------------------------- # # loop over all time steps print ("start loop over pressure") for (it in 1:tmax) { print (paste("Time step: ",it,sep="")) # read pressure and variable pp <- pp.rgd2[,,,it:1] pp <- apply(pp,c(2,3),mean) print(str(pp)) vv <- vv.rgd2[,,,it:1] vv <- apply(vv,c(2,3),mean) print(str(vv)) # loop over longitude and latitude for (iy in 1:ymax) { # loop over pressure for (ip in 1:pmax) { # determine the interval, loop over model levels and interpolate linear in log(p) ptarget = log(pres[ip]) for (iz in 2:zmax) { p1=log(pp[iy,iz-1]/100.) # NOTE conversion to hPa p2=log(pp[iy,iz ]/100.) if ( ptarget <= p1 ) { if ( ptarget >= p2 ) { newvv[iy,ip,it] = vv[iy,iz-1] + ( ( (vv[iy,iz] - vv[iy,iz-1] )/(p2-p1))*(ptarget-p1) ) } # end if } # end if/while }# end do model level loop } # end do pressure loop } # end do latitude loop } # end do loop over time # end of main code ----------------------------------------------------------------------------------- #
# Exercise 3: writing and executing functions # Define a function `add_three` that takes a single argument and # returns a value 3 greater than the input add_three <- function(value) { value + 3 } # Create a variable `ten` that is the result of passing 7 to your `add_three` # function ten <- add_three(7) # Define a function `imperial_to_metric` that takes in two arguments: a number # of feet and a number of inches # The function should return the equivalent length in meters imperial_to_metric <- function(feet, inches) { ((feet * 12) + inches) * .0254 } # Create a variable `height_in_meters` by passing your height in imperial to the # `imperial_to_metric` function height_in_meters <- imperial_to_metric(5, 11)
/chapter-06-exercises/exercise-3/exercise.R
permissive
akoltko-1763595/book-exercises
R
false
false
728
r
# Exercise 3: writing and executing functions # Define a function `add_three` that takes a single argument and # returns a value 3 greater than the input add_three <- function(value) { value + 3 } # Create a variable `ten` that is the result of passing 7 to your `add_three` # function ten <- add_three(7) # Define a function `imperial_to_metric` that takes in two arguments: a number # of feet and a number of inches # The function should return the equivalent length in meters imperial_to_metric <- function(feet, inches) { ((feet * 12) + inches) * .0254 } # Create a variable `height_in_meters` by passing your height in imperial to the # `imperial_to_metric` function height_in_meters <- imperial_to_metric(5, 11)
#' @title Extract JSON #' @description Checks if two dataframes are equal. #' @param df1 A dataframe #' @param df2 The second dataframe #' @return TRUE if the dataframes are equal else FALSE #' @export extract_json <- \(df){ check_key = \(dict, key) ifelse(key %in% names(fromJSON(dict)), fromJSON(dict)[key], NA) df %>% mutate( col_new = unlist(future_map(col, ~ check_key(.x, ""))) ) }
/R/extract_json.r
no_license
gfleetwood/sansor
R
false
false
427
r
#' @title Extract JSON #' @description Checks if two dataframes are equal. #' @param df1 A dataframe #' @param df2 The second dataframe #' @return TRUE if the dataframes are equal else FALSE #' @export extract_json <- \(df){ check_key = \(dict, key) ifelse(key %in% names(fromJSON(dict)), fromJSON(dict)[key], NA) df %>% mutate( col_new = unlist(future_map(col, ~ check_key(.x, ""))) ) }
#' # [EXP_76](https://github.com/JoshuaHarris391/Lab_Notebook_Cunliffe_2018/blob/master/Experimental_Log/Logs/EXP_76.md) obtaining primer query sequences #' Primers flanking the two sgRNA target sites from EXP_73 will be determined by first obtaining a query sequence for each target site to put through to primer BLAST #' #' ## Installing package # source("http://bioconductor.org/biocLite.R") # biocLite("Biostrings") # biocLite("seqinr") #' ## loading Packages #+ message=FALSE library('Biostrings') library('seqinr') # library('rstudioapi') library('tidyverse') #' ## Setting WD # setwd('~/Dropbox/Research/PhD/Experiments/EXP_76/EXP_76_Fn14_Primer_Design/scripts/') #' ## Reading in fasta files #' These sequences contain 1kB upstream and 1kb downstream of the first and last exon #' Sequence includes introns and 4 exons #' fasta file was obtained from UCSC genome browser. [link to entry](https://genome.ucsc.edu/cgi-bin/hgGene?hgg_gene=ENST00000326577.8&hgg_prot=ENST00000326577.8&hgg_chrom=chr16&hgg_start=3020311&hgg_end=3022383&hgg_type=knownGene&db=hg38&hgsid=712319617_zMV9zkvqyZxeyCewSf3qflc4CiR1) #' #' #### Whole Sequence (including 1kB up and downstream) Fn14_whole_seq_fasta <- read.fasta(file = "../sequence/TNFRSF12A_Whole_Seq.fa", seqtype = 'DNA', as.string = TRUE) Fn14_whole_seq_fasta <- Fn14_whole_seq_fasta[[1]] Fn14_whole_seq_fasta %>% print() #' #### Creating character string Fn14_whole_seq_char <- Fn14_whole_seq_fasta %>% as.character() Fn14_whole_seq_char %>% class() %>% print() #' #### Converting to DNAstring Fn14_whole_seq_dnastring <- DNAString(Fn14_whole_seq_char) Fn14_whole_seq_dnastring %>% class() %>% print() #' ## Sequences by Region #' Note, first and last region are not part of the Fn14 gene Fn14_Region_seq <- read.fasta(file = "../sequence/TNFRSF12A_Region_Seq.fa", seqtype = 'DNA', as.string = TRUE) for (i in 1:length(Fn14_Region_seq)) { Fn14_Region_seq[[i]] %>% head() %>% print() } #' ## Loading in sgRNA target sequences #' Sequences are 5' to 3' sgRNA_1 <- 'CGGGCGCAGGACGTGCACTA' sgRNA_2 <- 'AGCTTGGCTCCCGCCGCGTC' #' *sgRNA_2 targets the 3' UTR on the antisense strand, therefore it needs to be converted to the reverse complement #' #' ## Converting sgRNA_2 to rev comp sgRNA_2 <- DNAString(sgRNA_2) %>% reverseComplement() %>% as.character() print(sgRNA_2) #' #### Match position for sgRNA_1 to Fn14 whole sequence sgRNA_1_match <- matchPattern(sgRNA_1, Fn14_whole_seq_dnastring) print(sgRNA_1_match) #' #### Match position for sgRNA_2 to Fn14 whole sequence sgRNA_2_match <- matchPattern(as.character(sgRNA_2), Fn14_whole_seq_dnastring) print(sgRNA_2_match) #' # Printing query sequence and printing match sequence #' ## sgRNA_1 sequence sgRNA_1 %>% as.character() %>% print() #' #### Fn14 whole sequence lookup Fn14_whole_seq_dnastring[start(sgRNA_1_match) : end(sgRNA_1_match)] %>% as.character() %>% print() #' #### Testing for a match Fn14_whole_seq_dnastring[start(sgRNA_1_match) : end(sgRNA_1_match)] %>% as.character() %in% sgRNA_1 %>% as.character() #' ## sgRNA_2 sequence sgRNA_2 %>% as.character() %>% print() #' #### Fn14 whole sequence lookup Fn14_whole_seq_dnastring[start(sgRNA_2_match) : end(sgRNA_2_match)] %>% as.character() %>% print() #' #### Testing for a match Fn14_whole_seq_dnastring[start(sgRNA_2_match) : end(sgRNA_2_match)] %>% as.character() %in% sgRNA_2 %>% as.character() #' # Creating a query sequence for Fn14 primer blast #' Query sequences will have 'buffer_bp' number of base pairs upstream of the 5' end and 'buffer_bp' number of base pairs downstream from the 3' end of the matching sgRNA sequence #' # Defining number of buffer base pairs buffer_bp <- 800 #' ## sgRNA_1 Primer Query Sequence EXP_76_sgRNA_1_Query <- Fn14_whole_seq_dnastring[(start(sgRNA_1_match)-buffer_bp) : end(sgRNA_1_match+buffer_bp)] %>% as.character() print(EXP_76_sgRNA_1_Query) print(nchar(EXP_76_sgRNA_1_Query)) #' ## sgRNA_2 Primer Query Sequence EXP_76_sgRNA_2_Query <- Fn14_whole_seq_dnastring[(start(sgRNA_2_match)-buffer_bp) : end(sgRNA_2_match+buffer_bp)] %>% as.character() print(EXP_76_sgRNA_2_Query) print(nchar(EXP_76_sgRNA_2_Query)) #' ## CRISPR-CAS9 clevage sites #' Base pair position is relative to the query sequence sgRNA_1_match_query <- matchPattern(sgRNA_1, EXP_76_sgRNA_1_Query) paste("EXP_76_sgRNA_1_Query Clevage site is between base pairs:", end(sgRNA_1_match_query), "and", end(sgRNA_1_match_query)+1) sgRNA_2_match_query <- matchPattern(sgRNA_2, EXP_76_sgRNA_2_Query) paste("EXP_76_sgRNA_2_Query Clevage site is between base pairs:", end(sgRNA_2_match_query), "and", end(sgRNA_2_match_query)+1) #' ## Exporting query sequences as fasta files write.fasta(EXP_76_sgRNA_1_Query, "EXP_76_sgRNA_1_Query", "../output/EXP_76_sgRNA_1_Query.fa", as.string = TRUE) write.fasta(EXP_76_sgRNA_2_Query, "EXP_76_sgRNA_2_Query", "../output/EXP_76_sgRNA_2_Query.fa", as.string = TRUE)
/scripts/Primer_Query_Sequence.R
no_license
JoshuaHarris391/EXP_76_Fn14_Primer_Design
R
false
false
5,063
r
#' # [EXP_76](https://github.com/JoshuaHarris391/Lab_Notebook_Cunliffe_2018/blob/master/Experimental_Log/Logs/EXP_76.md) obtaining primer query sequences #' Primers flanking the two sgRNA target sites from EXP_73 will be determined by first obtaining a query sequence for each target site to put through to primer BLAST #' #' ## Installing package # source("http://bioconductor.org/biocLite.R") # biocLite("Biostrings") # biocLite("seqinr") #' ## loading Packages #+ message=FALSE library('Biostrings') library('seqinr') # library('rstudioapi') library('tidyverse') #' ## Setting WD # setwd('~/Dropbox/Research/PhD/Experiments/EXP_76/EXP_76_Fn14_Primer_Design/scripts/') #' ## Reading in fasta files #' These sequences contain 1kB upstream and 1kb downstream of the first and last exon #' Sequence includes introns and 4 exons #' fasta file was obtained from UCSC genome browser. [link to entry](https://genome.ucsc.edu/cgi-bin/hgGene?hgg_gene=ENST00000326577.8&hgg_prot=ENST00000326577.8&hgg_chrom=chr16&hgg_start=3020311&hgg_end=3022383&hgg_type=knownGene&db=hg38&hgsid=712319617_zMV9zkvqyZxeyCewSf3qflc4CiR1) #' #' #### Whole Sequence (including 1kB up and downstream) Fn14_whole_seq_fasta <- read.fasta(file = "../sequence/TNFRSF12A_Whole_Seq.fa", seqtype = 'DNA', as.string = TRUE) Fn14_whole_seq_fasta <- Fn14_whole_seq_fasta[[1]] Fn14_whole_seq_fasta %>% print() #' #### Creating character string Fn14_whole_seq_char <- Fn14_whole_seq_fasta %>% as.character() Fn14_whole_seq_char %>% class() %>% print() #' #### Converting to DNAstring Fn14_whole_seq_dnastring <- DNAString(Fn14_whole_seq_char) Fn14_whole_seq_dnastring %>% class() %>% print() #' ## Sequences by Region #' Note, first and last region are not part of the Fn14 gene Fn14_Region_seq <- read.fasta(file = "../sequence/TNFRSF12A_Region_Seq.fa", seqtype = 'DNA', as.string = TRUE) for (i in 1:length(Fn14_Region_seq)) { Fn14_Region_seq[[i]] %>% head() %>% print() } #' ## Loading in sgRNA target sequences #' Sequences are 5' to 3' sgRNA_1 <- 'CGGGCGCAGGACGTGCACTA' sgRNA_2 <- 'AGCTTGGCTCCCGCCGCGTC' #' *sgRNA_2 targets the 3' UTR on the antisense strand, therefore it needs to be converted to the reverse complement #' #' ## Converting sgRNA_2 to rev comp sgRNA_2 <- DNAString(sgRNA_2) %>% reverseComplement() %>% as.character() print(sgRNA_2) #' #### Match position for sgRNA_1 to Fn14 whole sequence sgRNA_1_match <- matchPattern(sgRNA_1, Fn14_whole_seq_dnastring) print(sgRNA_1_match) #' #### Match position for sgRNA_2 to Fn14 whole sequence sgRNA_2_match <- matchPattern(as.character(sgRNA_2), Fn14_whole_seq_dnastring) print(sgRNA_2_match) #' # Printing query sequence and printing match sequence #' ## sgRNA_1 sequence sgRNA_1 %>% as.character() %>% print() #' #### Fn14 whole sequence lookup Fn14_whole_seq_dnastring[start(sgRNA_1_match) : end(sgRNA_1_match)] %>% as.character() %>% print() #' #### Testing for a match Fn14_whole_seq_dnastring[start(sgRNA_1_match) : end(sgRNA_1_match)] %>% as.character() %in% sgRNA_1 %>% as.character() #' ## sgRNA_2 sequence sgRNA_2 %>% as.character() %>% print() #' #### Fn14 whole sequence lookup Fn14_whole_seq_dnastring[start(sgRNA_2_match) : end(sgRNA_2_match)] %>% as.character() %>% print() #' #### Testing for a match Fn14_whole_seq_dnastring[start(sgRNA_2_match) : end(sgRNA_2_match)] %>% as.character() %in% sgRNA_2 %>% as.character() #' # Creating a query sequence for Fn14 primer blast #' Query sequences will have 'buffer_bp' number of base pairs upstream of the 5' end and 'buffer_bp' number of base pairs downstream from the 3' end of the matching sgRNA sequence #' # Defining number of buffer base pairs buffer_bp <- 800 #' ## sgRNA_1 Primer Query Sequence EXP_76_sgRNA_1_Query <- Fn14_whole_seq_dnastring[(start(sgRNA_1_match)-buffer_bp) : end(sgRNA_1_match+buffer_bp)] %>% as.character() print(EXP_76_sgRNA_1_Query) print(nchar(EXP_76_sgRNA_1_Query)) #' ## sgRNA_2 Primer Query Sequence EXP_76_sgRNA_2_Query <- Fn14_whole_seq_dnastring[(start(sgRNA_2_match)-buffer_bp) : end(sgRNA_2_match+buffer_bp)] %>% as.character() print(EXP_76_sgRNA_2_Query) print(nchar(EXP_76_sgRNA_2_Query)) #' ## CRISPR-CAS9 clevage sites #' Base pair position is relative to the query sequence sgRNA_1_match_query <- matchPattern(sgRNA_1, EXP_76_sgRNA_1_Query) paste("EXP_76_sgRNA_1_Query Clevage site is between base pairs:", end(sgRNA_1_match_query), "and", end(sgRNA_1_match_query)+1) sgRNA_2_match_query <- matchPattern(sgRNA_2, EXP_76_sgRNA_2_Query) paste("EXP_76_sgRNA_2_Query Clevage site is between base pairs:", end(sgRNA_2_match_query), "and", end(sgRNA_2_match_query)+1) #' ## Exporting query sequences as fasta files write.fasta(EXP_76_sgRNA_1_Query, "EXP_76_sgRNA_1_Query", "../output/EXP_76_sgRNA_1_Query.fa", as.string = TRUE) write.fasta(EXP_76_sgRNA_2_Query, "EXP_76_sgRNA_2_Query", "../output/EXP_76_sgRNA_2_Query.fa", as.string = TRUE)
#' Calculate the Profile Likelihood #' #' Calculate the Profile Likelihood based on initial covariance parameters (not including sigma2) #' @param theta0 initial covariance paramters (not including sigma2) #' @param CovStructure the covariance structure, 1 - a separable covariance matrix, 2 - a nonseparable covariance matrix #' @param Ds the distance matrix of location #' @param Dt the distance matrix of time #' @param P the dimension of data #' @param Xprime transformed X, Xprime = (I-S)X #' @param Zprime transformed Z, Zprime = (I-S)Z #' @return the value of log profile likelihood. #' @export log.profile = function(theta0,CovStructure,loctim,Ds,Dt,Xprime,Zprime,Sigma=NULL) { P = nrow(Xprime) if (CovStructure == 1) { psi = (1-theta0[1])*exp(-Ds/theta0[2]-Dt/theta0[3]) diag(psi) = 1 } else if (CovStructure == 2) { psi = (1-theta0[1])/(theta0[2]*(Dt)^2 + 1)*exp(- theta0[3]*Ds^2/(theta0[2]*(Dt)^2 + 1)) diag(psi) = 1 } else if (CovStructure == 3) { psi <- (1-theta0[1])/(theta0[2]^2*(Dt)^2+1)^(3/2)*exp(-theta0[3]*Ds) diag(psi) = 1 } else if (CovStructure == 4) { DD1 = theta0[4]*loctim[,3] + 1 psi <- DD1%*%t(DD1)/(theta0[2]^2*(Dt)^2+1)^(3/2)*exp(-theta0[3]*Ds) diag(psi) = diag(DD1%*% t(DD1))+theta0[1] } else if (CovStructure == 5) { DD1 = theta0[4]*loctim[,3]+theta0[5]*loctim[,1]+theta0[6]*loctim[,2] + 1 psi <- DD1%*%t(DD1)/(theta0[2]^2*(Dt)^2+1)^(3/2)*exp(-theta0[3]*Ds) diag(psi) = diag(DD1%*% t(DD1))+theta0[1] } else if (CovStructure == 6) { DD1 =1 + theta0[4]*loctim[,3]+theta0[5]*loctim[,3]^2+ theta0[6]*loctim[,3]^3+theta0[7]*(ifelse((loctim[,3]-truncate.t)>0,(loctim[,3]-truncate.t),0))^3 psi <- DD1%*%t(DD1)/(theta0[2]^2*(Dt)^2+1)^(3/2)*exp(-theta0[3]*Ds) diag(psi) = diag(DD1%*% t(DD1)) +theta0[1] } else stop("Please provide a valid covariance structure identification code (1-3).") U = base::chol(psi) sx = solve(t(U),Xprime) sz = solve(t(U),Zprime) beta = solve(t(sx)%*%sx,t(sx)%*%sz) ress = (sz - sx%*%beta) sigma2 = t(ress)%*%ress/P log.prof = P/2*log(sigma2) + sum(log(diag(U))) + P/2 return(log.prof) # U <- chol(psi) # U.inv <- backsolve(U, diag(1, nrow = P)) # psi.inv <- U.inv %*% t(U.inv) # # Compute the MLE for beta. # beta <- solve(t(Xprime) %*% psi.inv %*% Xprime) %*% t(Xprime) %*% psi.inv %*% Zprime # # Compute the MLE for sigma. # resid <- Zprime - Xprime %*% beta # sigma2 <- t(resid) %*% psi.inv %*% resid/P # # Evaluate -log-profile likelihood. # log.U.det <- sum(log(diag(U))) # # Log of the determinant of U. # prof <- log.U.det + (P * log(sigma2))/2 + P/2 # return(prof) }
/R/CalculateProfile.R
no_license
liujl93/STplm
R
false
false
2,636
r
#' Calculate the Profile Likelihood #' #' Calculate the Profile Likelihood based on initial covariance parameters (not including sigma2) #' @param theta0 initial covariance paramters (not including sigma2) #' @param CovStructure the covariance structure, 1 - a separable covariance matrix, 2 - a nonseparable covariance matrix #' @param Ds the distance matrix of location #' @param Dt the distance matrix of time #' @param P the dimension of data #' @param Xprime transformed X, Xprime = (I-S)X #' @param Zprime transformed Z, Zprime = (I-S)Z #' @return the value of log profile likelihood. #' @export log.profile = function(theta0,CovStructure,loctim,Ds,Dt,Xprime,Zprime,Sigma=NULL) { P = nrow(Xprime) if (CovStructure == 1) { psi = (1-theta0[1])*exp(-Ds/theta0[2]-Dt/theta0[3]) diag(psi) = 1 } else if (CovStructure == 2) { psi = (1-theta0[1])/(theta0[2]*(Dt)^2 + 1)*exp(- theta0[3]*Ds^2/(theta0[2]*(Dt)^2 + 1)) diag(psi) = 1 } else if (CovStructure == 3) { psi <- (1-theta0[1])/(theta0[2]^2*(Dt)^2+1)^(3/2)*exp(-theta0[3]*Ds) diag(psi) = 1 } else if (CovStructure == 4) { DD1 = theta0[4]*loctim[,3] + 1 psi <- DD1%*%t(DD1)/(theta0[2]^2*(Dt)^2+1)^(3/2)*exp(-theta0[3]*Ds) diag(psi) = diag(DD1%*% t(DD1))+theta0[1] } else if (CovStructure == 5) { DD1 = theta0[4]*loctim[,3]+theta0[5]*loctim[,1]+theta0[6]*loctim[,2] + 1 psi <- DD1%*%t(DD1)/(theta0[2]^2*(Dt)^2+1)^(3/2)*exp(-theta0[3]*Ds) diag(psi) = diag(DD1%*% t(DD1))+theta0[1] } else if (CovStructure == 6) { DD1 =1 + theta0[4]*loctim[,3]+theta0[5]*loctim[,3]^2+ theta0[6]*loctim[,3]^3+theta0[7]*(ifelse((loctim[,3]-truncate.t)>0,(loctim[,3]-truncate.t),0))^3 psi <- DD1%*%t(DD1)/(theta0[2]^2*(Dt)^2+1)^(3/2)*exp(-theta0[3]*Ds) diag(psi) = diag(DD1%*% t(DD1)) +theta0[1] } else stop("Please provide a valid covariance structure identification code (1-3).") U = base::chol(psi) sx = solve(t(U),Xprime) sz = solve(t(U),Zprime) beta = solve(t(sx)%*%sx,t(sx)%*%sz) ress = (sz - sx%*%beta) sigma2 = t(ress)%*%ress/P log.prof = P/2*log(sigma2) + sum(log(diag(U))) + P/2 return(log.prof) # U <- chol(psi) # U.inv <- backsolve(U, diag(1, nrow = P)) # psi.inv <- U.inv %*% t(U.inv) # # Compute the MLE for beta. # beta <- solve(t(Xprime) %*% psi.inv %*% Xprime) %*% t(Xprime) %*% psi.inv %*% Zprime # # Compute the MLE for sigma. # resid <- Zprime - Xprime %*% beta # sigma2 <- t(resid) %*% psi.inv %*% resid/P # # Evaluate -log-profile likelihood. # log.U.det <- sum(log(diag(U))) # # Log of the determinant of U. # prof <- log.U.det + (P * log(sigma2))/2 + P/2 # return(prof) }
## ------------------------------------------------------------------------- # Take average weighted methylation level of feature across bio replicates ## ------------------------------------------------------------------------- library(sqldf) library(readr) library(doBy) library(dplyr) library(reshape2) # Make one file covering all samples file.list = list.files(("./"),pattern="*weighted_meth.txt") read_file1 <- function(x){ read_delim(x, "\t", escape_double = F, col_names = T, trim_ws = T) } samples <- lapply(file.list, read_file1) # Make one dataframe for each population females <- samples[1:6] males <- samples[7:12] for(i in seq_along(females)){ females[[i]]$sex <- "female" } females_all <- as.data.frame(bind_rows(females)) females_merged <- summaryBy(weightedMeth ~ chr + feature + gene_id + start + end + cpg_count + sex, data = females_all, FUN=mean) for(i in seq_along(males)){ males[[i]]$sex <- "male" } males_all <- as.data.frame(bind_rows(males)) males_merged <- summaryBy(weightedMeth ~ chr + feature + gene_id + start + end + cpg_count + sex, data = males_all, FUN=mean) all_data <- rbind(females_merged, males_merged) all_data2 <- dcast(all_data, chr + feature + gene_id + start + end + cpg_count ~ sex, value.var = "weightedMeth.mean") write.table(all_data2, file="Dcitri_weighted_meth_annotation_by_sex.txt", col.names = T, row.names = F, quote = F, sep = "\t")
/Differential_methylation/13_mean_weighted_meth_by_sex.R
no_license
MooHoll/Asian_Psyllid_Methylation
R
false
false
1,499
r
## ------------------------------------------------------------------------- # Take average weighted methylation level of feature across bio replicates ## ------------------------------------------------------------------------- library(sqldf) library(readr) library(doBy) library(dplyr) library(reshape2) # Make one file covering all samples file.list = list.files(("./"),pattern="*weighted_meth.txt") read_file1 <- function(x){ read_delim(x, "\t", escape_double = F, col_names = T, trim_ws = T) } samples <- lapply(file.list, read_file1) # Make one dataframe for each population females <- samples[1:6] males <- samples[7:12] for(i in seq_along(females)){ females[[i]]$sex <- "female" } females_all <- as.data.frame(bind_rows(females)) females_merged <- summaryBy(weightedMeth ~ chr + feature + gene_id + start + end + cpg_count + sex, data = females_all, FUN=mean) for(i in seq_along(males)){ males[[i]]$sex <- "male" } males_all <- as.data.frame(bind_rows(males)) males_merged <- summaryBy(weightedMeth ~ chr + feature + gene_id + start + end + cpg_count + sex, data = males_all, FUN=mean) all_data <- rbind(females_merged, males_merged) all_data2 <- dcast(all_data, chr + feature + gene_id + start + end + cpg_count ~ sex, value.var = "weightedMeth.mean") write.table(all_data2, file="Dcitri_weighted_meth_annotation_by_sex.txt", col.names = T, row.names = F, quote = F, sep = "\t")
## load library library(googleAnalyticsR) library(dplyr) ## source the authentication file source("options.R") ## get account info account_list <- google_analytics_account_list() # account_main <- account_list %>% filter(viewName == "All Web Site Data") ## get another set of accounts account_curated <- read.csv("account_list_verified.csv",stringsAsFactors = F) %>% mutate( Profile.ID = as.character(Profile.ID) ) %>% unique() ## find common profile ids in account_curated and account_list account_common <- account_list %>% semi_join(account_curated,c("viewId"="Profile.ID")) account_common <- merge(account_curated,account_common,by.x = "Profile.ID",by.y = "viewId") %>% select(-accountId,-UA.number,-Url,-accountName) account_common_focus <- account_common %>% select(Profile.ID,webPropertyName,Brand,Super.Category,Sub.Category,Market,Region.Market) write.csv(account_common_focus,"account_common_focus.csv",row.names = F) ## set up the analytics call ## it uses tryCatch since sometimes the analytics call fails for(i in 1:nrow(account_common_focus)) { print(i) errTrp <- tryCatch({ flag = TRUE tmp <- google_analytics_4(viewId = account_common_focus$Profile.ID[i], date_range = c("2016-01-03","2016-10-29"), metrics = c("users","sessions","bounces"), dimensions = c("week","medium","country"), max = -1 ) }, warning = function(w){ print("warning") }, error = function(e){ print("error") flag = FALSE }, finally = { if(flag) { # tmp$ProfileName <- paste0(account_common_focus$accountName[i],": ",account_common_focus$webPropertyName[i]) tmp$ViewID <- account_common_focus$Profile.ID[i] if(i == 1){ df1 <- tmp }else if(i > 1 && length(tmp) > 1){ df1 <- rbind(df1,tmp) print(paste0("Total Rows: ",nrow(df1))) } } }) } ## remove temp variables rm(errTrp,tmp) ## save the result write.csv(df1,"allBrands_medium_weekly_curated.csv",row.names = F)
/01_data_fetch_ga.r
no_license
engti/unilever-reporting
R
false
false
2,565
r
## load library library(googleAnalyticsR) library(dplyr) ## source the authentication file source("options.R") ## get account info account_list <- google_analytics_account_list() # account_main <- account_list %>% filter(viewName == "All Web Site Data") ## get another set of accounts account_curated <- read.csv("account_list_verified.csv",stringsAsFactors = F) %>% mutate( Profile.ID = as.character(Profile.ID) ) %>% unique() ## find common profile ids in account_curated and account_list account_common <- account_list %>% semi_join(account_curated,c("viewId"="Profile.ID")) account_common <- merge(account_curated,account_common,by.x = "Profile.ID",by.y = "viewId") %>% select(-accountId,-UA.number,-Url,-accountName) account_common_focus <- account_common %>% select(Profile.ID,webPropertyName,Brand,Super.Category,Sub.Category,Market,Region.Market) write.csv(account_common_focus,"account_common_focus.csv",row.names = F) ## set up the analytics call ## it uses tryCatch since sometimes the analytics call fails for(i in 1:nrow(account_common_focus)) { print(i) errTrp <- tryCatch({ flag = TRUE tmp <- google_analytics_4(viewId = account_common_focus$Profile.ID[i], date_range = c("2016-01-03","2016-10-29"), metrics = c("users","sessions","bounces"), dimensions = c("week","medium","country"), max = -1 ) }, warning = function(w){ print("warning") }, error = function(e){ print("error") flag = FALSE }, finally = { if(flag) { # tmp$ProfileName <- paste0(account_common_focus$accountName[i],": ",account_common_focus$webPropertyName[i]) tmp$ViewID <- account_common_focus$Profile.ID[i] if(i == 1){ df1 <- tmp }else if(i > 1 && length(tmp) > 1){ df1 <- rbind(df1,tmp) print(paste0("Total Rows: ",nrow(df1))) } } }) } ## remove temp variables rm(errTrp,tmp) ## save the result write.csv(df1,"allBrands_medium_weekly_curated.csv",row.names = F)
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/bioRad.R \name{readvp.table} \alias{readvp.table} \title{Read vertical profiles from vol2bird stdout} \usage{ readvp.table(file, radar, wavelength = "C") } \arguments{ \item{file}{A text file containing the standard output (stdout) generated by vol2bird} \item{radar}{string containing a radar identifier} \item{wavelength}{radar wavelength in cm, or one of 'C' or 'S' for C-band and S-band radar, respectively} } \value{ an object inhereting from class "\code{vpts}", see \link{vpts} for details } \description{ Read vertical profiles from vol2bird stdout } \examples{ # locate example file: VPtable <- system.file("extdata", "VPtable.txt", package="bioRad") # load time series: ts=readvp.table(VPtable,radar="KBGM", wavelength='S') ts }
/man/readvp.table.Rd
permissive
macheng94/bioRad
R
false
true
819
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/bioRad.R \name{readvp.table} \alias{readvp.table} \title{Read vertical profiles from vol2bird stdout} \usage{ readvp.table(file, radar, wavelength = "C") } \arguments{ \item{file}{A text file containing the standard output (stdout) generated by vol2bird} \item{radar}{string containing a radar identifier} \item{wavelength}{radar wavelength in cm, or one of 'C' or 'S' for C-band and S-band radar, respectively} } \value{ an object inhereting from class "\code{vpts}", see \link{vpts} for details } \description{ Read vertical profiles from vol2bird stdout } \examples{ # locate example file: VPtable <- system.file("extdata", "VPtable.txt", package="bioRad") # load time series: ts=readvp.table(VPtable,radar="KBGM", wavelength='S') ts }
% Generated by roxygen2 (4.0.1): do not edit by hand \name{SNF} \alias{SNF} \alias{SNF.dynamic.mcmc} \alias{SNF.static.maxLik} \alias{SNF.static.mcmc} \title{SNF} \usage{ SNF(data, method = c("static.maxLik", "static.mcmc", "dynamic.mcmc"), ...) SNF.static.maxLik(data, ...) SNF.static.mcmc(data, m = 1000, last_estimation, ...) SNF.dynamic.mcmc(m, data, last_estimation, update_tau = TRUE, tau = 0.005) } \arguments{ \item{data}{data} \item{method}{Estimation method, either "static.maxLik","static.mcmc","dynamic.mcmc". Default is "static.maxLik"} \item{m}{m} \item{last_estimation}{last_estimation} \item{update_tau}{update_tau} \item{tau}{tau} \item{...}{others argument.} } \value{ SNF object } \description{ Strategy Network Formation } \author{ TszKin Julian Chan \email{ctszkin@gmail.com} }
/simmen/man/SNF.Rd
no_license
ctszkin/simmen
R
false
false
809
rd
% Generated by roxygen2 (4.0.1): do not edit by hand \name{SNF} \alias{SNF} \alias{SNF.dynamic.mcmc} \alias{SNF.static.maxLik} \alias{SNF.static.mcmc} \title{SNF} \usage{ SNF(data, method = c("static.maxLik", "static.mcmc", "dynamic.mcmc"), ...) SNF.static.maxLik(data, ...) SNF.static.mcmc(data, m = 1000, last_estimation, ...) SNF.dynamic.mcmc(m, data, last_estimation, update_tau = TRUE, tau = 0.005) } \arguments{ \item{data}{data} \item{method}{Estimation method, either "static.maxLik","static.mcmc","dynamic.mcmc". Default is "static.maxLik"} \item{m}{m} \item{last_estimation}{last_estimation} \item{update_tau}{update_tau} \item{tau}{tau} \item{...}{others argument.} } \value{ SNF object } \description{ Strategy Network Formation } \author{ TszKin Julian Chan \email{ctszkin@gmail.com} }
library(tidyr) library(tidyverse) library(caret) library(h2o) library(lubridate) library(keras) library(chron) library(magrittr) train <- read_csv('train.csv') test <- read_csv('test.csv') sample <- read_csv('sample_submission.csv') summary(train) train$is_train <- 1 test$is_train <- 0 test$amount_spent_per_room_night_scaled <- NA full <- bind_rows(train,test) sapply(train,function(x)sum(is.na(x))) sapply(test,function(x)sum(is.na(x))) full <- full %>% mutate(booking_date=as.Date(booking_date,"%d/%m/%y"), checkin_date=as.Date(checkin_date,"%d/%m/%y"), checkout_date=as.Date(checkout_date,"%d/%m/%y"), advance_booking = as.numeric(checkin_date-booking_date), resort_id=str_trunc(resort_id,10), memberid=str_trunc(memberid,10)) #advance bookings full %>% group_by(memberid) %>% mutate(d=n(),r=sum(amount_spent_per_room_night_scaled)) %>% ungroup() %>% filter(advance_booking<0) %>% View() #total of 14 members. here we cannot remove these users id because, #there are 2 users in test with negative advance booking date. #take either same day booking, 15 days mode and 33 days median full %>% group_by(advance_booking) %>% count(sort=TRUE) #since 0 is 3rd highest, lets take same day booking full <- full %>% mutate(booking_date=case_when(advance_booking<0~checkin_date, TRUE~booking_date), advance_booking=case_when(advance_booking<0~0, TRUE~advance_booking)) full <- full %>% mutate(booking_month=month(booking_date),booking_day=day(booking_date), checkin_month=month(checkin_date),checkin_day=day(checkin_date), booking_d=weekdays(booking_date),checkin_d=weekdays(checkin_date), checkout_d=weekdays(checkout_date),checkin_quarter=quarter(checkin_date), checkin_weekend=is.weekend(checkin_date)) full %>% group_by(total_pax) %>% count(sort=TRUE) full %>% filter(total_pax>11) %>% View() full <- full %>% mutate(pax=case_when(total_pax>4~'others', total_pax<2~'others', total_pax==2~'couple', TRUE~'family')) full %>% group_by(pax) %>% count(sort=TRUE) full %>% ggplot(aes(factor(roomnights),advance_booking))+geom_boxplot() full %>% group_by(roomnights) %>% count(sort=TRUE) full %>% filter(roomnights<1) %>% View() #cleaning the room night stay full <- full %>% mutate(roomnights=case_when(roomnights<1~as.integer(checkout_date-checkin_date), TRUE~roomnights)) full <- full %>% mutate(room_stay=case_when(roomnights<=2~'VShort', roomnights>2&roomnights<=4~'Normal', roomnights>4&roomnights<8~'Week', roomnights>7~'Long')) full %>% group_by(room_stay) %>% count(sort=TRUE) full %>% ggplot(aes(season_holidayed_code,fill=factor(checkin_quarter)))+geom_bar(stat='count') top_season_quaterly <- full %>% filter(!is.na(season_holidayed_code)) %>% group_by(checkin_quarter,season_holidayed_code) %>% tally() %>% top_n(1) full <- full %>% mutate(season_holidayed_code=case_when( is.na(season_holidayed_code)&checkin_quarter==2~as.integer(2), is.na(season_holidayed_code)&checkin_quarter==3~as.integer(4), is.na(season_holidayed_code)&checkin_quarter==4~as.integer(2), TRUE~season_holidayed_code)) full <- full %>% mutate(adv_booking=case_when(advance_booking<=2~'Sudden', advance_booking>2&advance_booking<=15~'Fortnite', advance_booking>15&advance_booking<=31~'Amonth', advance_booking>31~"Long Booking")) full %>% filter(!is.na(amount_spent_per_room_night_scaled))%>% group_by(adv_booking) %>% summarise(mean(amount_spent_per_room_night_scaled)) %>% View() full %>% group_by(state_code_residence,) %>% count(sort=TRUE) full %>% ggplot(aes(factor(state_code_residence),fill=factor(cluster_code)))+ geom_bar(stat='count') full <- full %>% mutate(state_code_residence=replace_na(state_code_residence,8)) #now lets get the count full <- full %>% group_by(memberid) %>% mutate(max_total_pax=max(total_pax),min_total_pax=min(total_pax), max_roomnight=max(roomnights),min_roomnight=min(roomnights), total_visit=n(),max_adult=max(numberofadults), min_adult=min(numberofadults),max_children=max(numberofchildren), min_children=min(numberofchildren)) %>% ungroup() full <- full %>% group_by(memberid,resort_region_code,resort_type_code) %>% mutate(max_roomnight_rrc=max(roomnights),min_roomnight_rrc=min(roomnights),total_visit_rrc=n(), min_adult_rrc=max(numberofadults),min_adult_rrc=min(numberofadults), max_children_rrc=max(numberofchildren),min_children_rrc=min(numberofchildren)) %>% ungroup() prac <- full %>% filter(is_train==1) %>% group_by(pax,room_stay,adv_booking,checkin_d) %>% summarize(prac_spent=n(), prac_min=min(amount_spent_per_room_night_scaled)/prac_spent, prac_max=max(amount_spent_per_room_night_scaled)/prac_spent, prac_avg=mean(amount_spent_per_room_night_scaled)/prac_spent) %>% ungroup() cmpr <- full %>% filter(is_train==1) %>% group_by(cluster_code,member_age_buckets,pax,room_type_booked_code) %>% summarise(cmpr_spent=n(), cmpr_min=min(amount_spent_per_room_night_scaled)/cmpr_spent, cmpr_max=max(amount_spent_per_room_night_scaled)/cmpr_spent, cmpr_avg=mean(amount_spent_per_room_night_scaled)/cmpr_spent) %>% ungroup() sssr <- full %>% filter(is_train==1) %>% group_by(season_holidayed_code,state_code_residence,state_code_resort,reservationstatusid_code) %>% summarise(sssr_spent=n(), sssr_min=min(amount_spent_per_room_night_scaled)/sssr_spent, sssr_max=max(amount_spent_per_room_night_scaled)/sssr_spent, sssr_avg=mean(amount_spent_per_room_night_scaled)/sssr_spent) %>% ungroup() # #lets get mode details on memeber # full %>% group_by(memberid) %>% count(sort=TRUE) # full %>% group_by(memberid,persontravellingid) %>% count(sort=TRUE) # # full %>% ggplot(aes(factor(resort_region_code),amount_spent_per_room_night_scaled))+geom_boxplot() # # full %>% ggplot(aes(factor(main_product_code),amount_spent_per_room_night_scaled))+geom_boxplot() # # full %>% filter(total_pax>12) %>% group_by(memberid) %>% count(sort=TRUE) # full %>% ggplot(aes(factor(main_product_code),total_pax))+geom_boxplot() # full %>% ggplot(aes(factor(channel_code),total_pax))+geom_boxplot() # # full %>% filter(total_pax>15)%>% group_by(main_product_code,total_pax) %>% count() # # # full %>% group_by(resort_id,checkin_month) %>% count(sort=TRUE) # full %>% group_by(resort_id,season_holidayed_code) %>% count(sort=TRUE) # # train %>% ggplot(aes(resort_region_code))+geom_bar(stat='count') # train %>% ggplot(aes(resort_type_code))+geom_bar(stat='count') # train %>% ggplot(aes(season_holidayed_code))+geom_bar(stat='count') # # train %>% group_by(season_holidayed_code) %>% count(sort=TRUE) # # full %>% filter(is_train==1) %>% ggplot(aes(resort_region_code,fill=factor(cluster_code)))+ # geom_bar(stat="count") # # full %>% filter(is_train==1) %>% ggplot(aes(resort_type_code,fill=factor(cluster_code)))+ # geom_bar(stat="count") # full %>% filter(is_train==1) %>% ggplot(aes(resort_type_code,fill=factor(resort_region_code)))+ # geom_bar(stat="count") # # full %>% filter(is_train==1) %>% ggplot(aes(cluster_code,fill=factor(state_code_resort)))+ # geom_bar(stat="count") # # train %>% group_by(resort_id) %>% count(sort = TRUE) full <- full %>% left_join(cmpr) full <- full %>% left_join(sssr) %>% left_join(.,prac) full <- full %>% mutate(channel_code=factor(channel_code), main_product_code = factor(main_product_code), persontravellingid=factor(persontravellingid), resort_region_code=factor(resort_region_code), resort_type_code=factor(resort_type_code), season_holidayed_code=factor(season_holidayed_code), state_code_residence=factor(state_code_residence), state_code_resort=factor(state_code_resort), room_type_booked_code=factor(room_type_booked_code), member_age_buckets=factor(member_age_buckets), cluster_code=factor(cluster_code),memberid=factor(memberid), reservationstatusid_code = factor(reservationstatusid_code)) colls <- c('booking_month','booking_day','checkin_month','checkin_day','booking_d','checkin_d', 'checkout_d','checkin_quarter','checkin_weekend','pax','room_stay','adv_booking') full %<>% mutate_at(colls,funs(factor(.))) X <- colnames(full)[c(5:16,18,19,21,22,26:53,55:57,59:61,63:65)] Y <- colnames(train)[c(24)] str(full[,X]) X1 <- X[c(13,14,15,16,18,20,22:53)] X2 <- X[c(27:53)] tr<- full %>% filter(is_train==1) te <- full %>% filter(is_train==0) h2o.init() tr <- as.h2o(tr[c(X,Y)]) te <- as.h2o(te[c(X)]) almname <- paste('ak_h2o_automl',format(Sys.time(),"%d%H%M%S"),sep = '_') autoML <- h2o.automl(X,Y,training_frame = tr,seed=2019,stopping_metric=c("RMSE"),max_models = 10) autoML glmML <- h2o.glm(X,Y,training_frame = tr,seed=2019,nfolds = 5,family = "gaussian",lambda_search = T, standardize = F,remove_collinear_columns = T,alpha = 0) glmML save(glmML,file="glmmlv3.rda") g2<-h2o.gbm(X,Y,training_frame = tr,ntrees = 400 ,score_tree_interval = 50 #,nfolds = 4,stopping_rounds = 4,stopping_tolerance = 0 ,learn_rate = 0.001,max_depth = 8,sample_rate = 0.6,col_sample_rate = 0.6 ,model_id = "g2") g2 save(g2, file="gbmv2.rda") aml_test_pred <- h2o.predict(autoML,te) prediction <- as.vector(aml_test_pred) glm_pred <- h2o.predict(glmML,te) glm_pred <- as.vector(glm_pred) g2_pred <- h2o.predict(g2,te) g2_pred <- as.vector(g2_pred) sample$amount_spent_per_room_night_scaled <- g2_pred*0.55+prediction*0.4+glm_pred*0.05 filename <- paste('ak_ensemble_4',format(Sys.time(),"%Y%m%d%H%M%s"),sep = '_') write.csv(sample,paste0(filename,'.csv',collapse = ''),row.names = FALSE)
/ClubMahindra/FinalModel_AK.R
no_license
aka7h/Analytics-Hackathon
R
false
false
11,034
r
library(tidyr) library(tidyverse) library(caret) library(h2o) library(lubridate) library(keras) library(chron) library(magrittr) train <- read_csv('train.csv') test <- read_csv('test.csv') sample <- read_csv('sample_submission.csv') summary(train) train$is_train <- 1 test$is_train <- 0 test$amount_spent_per_room_night_scaled <- NA full <- bind_rows(train,test) sapply(train,function(x)sum(is.na(x))) sapply(test,function(x)sum(is.na(x))) full <- full %>% mutate(booking_date=as.Date(booking_date,"%d/%m/%y"), checkin_date=as.Date(checkin_date,"%d/%m/%y"), checkout_date=as.Date(checkout_date,"%d/%m/%y"), advance_booking = as.numeric(checkin_date-booking_date), resort_id=str_trunc(resort_id,10), memberid=str_trunc(memberid,10)) #advance bookings full %>% group_by(memberid) %>% mutate(d=n(),r=sum(amount_spent_per_room_night_scaled)) %>% ungroup() %>% filter(advance_booking<0) %>% View() #total of 14 members. here we cannot remove these users id because, #there are 2 users in test with negative advance booking date. #take either same day booking, 15 days mode and 33 days median full %>% group_by(advance_booking) %>% count(sort=TRUE) #since 0 is 3rd highest, lets take same day booking full <- full %>% mutate(booking_date=case_when(advance_booking<0~checkin_date, TRUE~booking_date), advance_booking=case_when(advance_booking<0~0, TRUE~advance_booking)) full <- full %>% mutate(booking_month=month(booking_date),booking_day=day(booking_date), checkin_month=month(checkin_date),checkin_day=day(checkin_date), booking_d=weekdays(booking_date),checkin_d=weekdays(checkin_date), checkout_d=weekdays(checkout_date),checkin_quarter=quarter(checkin_date), checkin_weekend=is.weekend(checkin_date)) full %>% group_by(total_pax) %>% count(sort=TRUE) full %>% filter(total_pax>11) %>% View() full <- full %>% mutate(pax=case_when(total_pax>4~'others', total_pax<2~'others', total_pax==2~'couple', TRUE~'family')) full %>% group_by(pax) %>% count(sort=TRUE) full %>% ggplot(aes(factor(roomnights),advance_booking))+geom_boxplot() full %>% group_by(roomnights) %>% count(sort=TRUE) full %>% filter(roomnights<1) %>% View() #cleaning the room night stay full <- full %>% mutate(roomnights=case_when(roomnights<1~as.integer(checkout_date-checkin_date), TRUE~roomnights)) full <- full %>% mutate(room_stay=case_when(roomnights<=2~'VShort', roomnights>2&roomnights<=4~'Normal', roomnights>4&roomnights<8~'Week', roomnights>7~'Long')) full %>% group_by(room_stay) %>% count(sort=TRUE) full %>% ggplot(aes(season_holidayed_code,fill=factor(checkin_quarter)))+geom_bar(stat='count') top_season_quaterly <- full %>% filter(!is.na(season_holidayed_code)) %>% group_by(checkin_quarter,season_holidayed_code) %>% tally() %>% top_n(1) full <- full %>% mutate(season_holidayed_code=case_when( is.na(season_holidayed_code)&checkin_quarter==2~as.integer(2), is.na(season_holidayed_code)&checkin_quarter==3~as.integer(4), is.na(season_holidayed_code)&checkin_quarter==4~as.integer(2), TRUE~season_holidayed_code)) full <- full %>% mutate(adv_booking=case_when(advance_booking<=2~'Sudden', advance_booking>2&advance_booking<=15~'Fortnite', advance_booking>15&advance_booking<=31~'Amonth', advance_booking>31~"Long Booking")) full %>% filter(!is.na(amount_spent_per_room_night_scaled))%>% group_by(adv_booking) %>% summarise(mean(amount_spent_per_room_night_scaled)) %>% View() full %>% group_by(state_code_residence,) %>% count(sort=TRUE) full %>% ggplot(aes(factor(state_code_residence),fill=factor(cluster_code)))+ geom_bar(stat='count') full <- full %>% mutate(state_code_residence=replace_na(state_code_residence,8)) #now lets get the count full <- full %>% group_by(memberid) %>% mutate(max_total_pax=max(total_pax),min_total_pax=min(total_pax), max_roomnight=max(roomnights),min_roomnight=min(roomnights), total_visit=n(),max_adult=max(numberofadults), min_adult=min(numberofadults),max_children=max(numberofchildren), min_children=min(numberofchildren)) %>% ungroup() full <- full %>% group_by(memberid,resort_region_code,resort_type_code) %>% mutate(max_roomnight_rrc=max(roomnights),min_roomnight_rrc=min(roomnights),total_visit_rrc=n(), min_adult_rrc=max(numberofadults),min_adult_rrc=min(numberofadults), max_children_rrc=max(numberofchildren),min_children_rrc=min(numberofchildren)) %>% ungroup() prac <- full %>% filter(is_train==1) %>% group_by(pax,room_stay,adv_booking,checkin_d) %>% summarize(prac_spent=n(), prac_min=min(amount_spent_per_room_night_scaled)/prac_spent, prac_max=max(amount_spent_per_room_night_scaled)/prac_spent, prac_avg=mean(amount_spent_per_room_night_scaled)/prac_spent) %>% ungroup() cmpr <- full %>% filter(is_train==1) %>% group_by(cluster_code,member_age_buckets,pax,room_type_booked_code) %>% summarise(cmpr_spent=n(), cmpr_min=min(amount_spent_per_room_night_scaled)/cmpr_spent, cmpr_max=max(amount_spent_per_room_night_scaled)/cmpr_spent, cmpr_avg=mean(amount_spent_per_room_night_scaled)/cmpr_spent) %>% ungroup() sssr <- full %>% filter(is_train==1) %>% group_by(season_holidayed_code,state_code_residence,state_code_resort,reservationstatusid_code) %>% summarise(sssr_spent=n(), sssr_min=min(amount_spent_per_room_night_scaled)/sssr_spent, sssr_max=max(amount_spent_per_room_night_scaled)/sssr_spent, sssr_avg=mean(amount_spent_per_room_night_scaled)/sssr_spent) %>% ungroup() # #lets get mode details on memeber # full %>% group_by(memberid) %>% count(sort=TRUE) # full %>% group_by(memberid,persontravellingid) %>% count(sort=TRUE) # # full %>% ggplot(aes(factor(resort_region_code),amount_spent_per_room_night_scaled))+geom_boxplot() # # full %>% ggplot(aes(factor(main_product_code),amount_spent_per_room_night_scaled))+geom_boxplot() # # full %>% filter(total_pax>12) %>% group_by(memberid) %>% count(sort=TRUE) # full %>% ggplot(aes(factor(main_product_code),total_pax))+geom_boxplot() # full %>% ggplot(aes(factor(channel_code),total_pax))+geom_boxplot() # # full %>% filter(total_pax>15)%>% group_by(main_product_code,total_pax) %>% count() # # # full %>% group_by(resort_id,checkin_month) %>% count(sort=TRUE) # full %>% group_by(resort_id,season_holidayed_code) %>% count(sort=TRUE) # # train %>% ggplot(aes(resort_region_code))+geom_bar(stat='count') # train %>% ggplot(aes(resort_type_code))+geom_bar(stat='count') # train %>% ggplot(aes(season_holidayed_code))+geom_bar(stat='count') # # train %>% group_by(season_holidayed_code) %>% count(sort=TRUE) # # full %>% filter(is_train==1) %>% ggplot(aes(resort_region_code,fill=factor(cluster_code)))+ # geom_bar(stat="count") # # full %>% filter(is_train==1) %>% ggplot(aes(resort_type_code,fill=factor(cluster_code)))+ # geom_bar(stat="count") # full %>% filter(is_train==1) %>% ggplot(aes(resort_type_code,fill=factor(resort_region_code)))+ # geom_bar(stat="count") # # full %>% filter(is_train==1) %>% ggplot(aes(cluster_code,fill=factor(state_code_resort)))+ # geom_bar(stat="count") # # train %>% group_by(resort_id) %>% count(sort = TRUE) full <- full %>% left_join(cmpr) full <- full %>% left_join(sssr) %>% left_join(.,prac) full <- full %>% mutate(channel_code=factor(channel_code), main_product_code = factor(main_product_code), persontravellingid=factor(persontravellingid), resort_region_code=factor(resort_region_code), resort_type_code=factor(resort_type_code), season_holidayed_code=factor(season_holidayed_code), state_code_residence=factor(state_code_residence), state_code_resort=factor(state_code_resort), room_type_booked_code=factor(room_type_booked_code), member_age_buckets=factor(member_age_buckets), cluster_code=factor(cluster_code),memberid=factor(memberid), reservationstatusid_code = factor(reservationstatusid_code)) colls <- c('booking_month','booking_day','checkin_month','checkin_day','booking_d','checkin_d', 'checkout_d','checkin_quarter','checkin_weekend','pax','room_stay','adv_booking') full %<>% mutate_at(colls,funs(factor(.))) X <- colnames(full)[c(5:16,18,19,21,22,26:53,55:57,59:61,63:65)] Y <- colnames(train)[c(24)] str(full[,X]) X1 <- X[c(13,14,15,16,18,20,22:53)] X2 <- X[c(27:53)] tr<- full %>% filter(is_train==1) te <- full %>% filter(is_train==0) h2o.init() tr <- as.h2o(tr[c(X,Y)]) te <- as.h2o(te[c(X)]) almname <- paste('ak_h2o_automl',format(Sys.time(),"%d%H%M%S"),sep = '_') autoML <- h2o.automl(X,Y,training_frame = tr,seed=2019,stopping_metric=c("RMSE"),max_models = 10) autoML glmML <- h2o.glm(X,Y,training_frame = tr,seed=2019,nfolds = 5,family = "gaussian",lambda_search = T, standardize = F,remove_collinear_columns = T,alpha = 0) glmML save(glmML,file="glmmlv3.rda") g2<-h2o.gbm(X,Y,training_frame = tr,ntrees = 400 ,score_tree_interval = 50 #,nfolds = 4,stopping_rounds = 4,stopping_tolerance = 0 ,learn_rate = 0.001,max_depth = 8,sample_rate = 0.6,col_sample_rate = 0.6 ,model_id = "g2") g2 save(g2, file="gbmv2.rda") aml_test_pred <- h2o.predict(autoML,te) prediction <- as.vector(aml_test_pred) glm_pred <- h2o.predict(glmML,te) glm_pred <- as.vector(glm_pred) g2_pred <- h2o.predict(g2,te) g2_pred <- as.vector(g2_pred) sample$amount_spent_per_room_night_scaled <- g2_pred*0.55+prediction*0.4+glm_pred*0.05 filename <- paste('ak_ensemble_4',format(Sys.time(),"%Y%m%d%H%M%s"),sep = '_') write.csv(sample,paste0(filename,'.csv',collapse = ''),row.names = FALSE)
% Generated by roxygen2 (4.0.1): do not edit by hand \name{vennplot} \alias{vennplot} \title{vennplot} \usage{ vennplot(Sets, by = "gplots") } \arguments{ \item{Sets}{a list of object, can be vector or GRanges object} \item{by}{one of gplots or Vennerable} } \value{ venn plot that summarize the overlap of peaks from different experiments or gene annotation from different peak files. } \description{ plot the overlap of a list of object } \examples{ require(TxDb.Hsapiens.UCSC.hg19.knownGene) txdb <- TxDb.Hsapiens.UCSC.hg19.knownGene peakfile <- system.file("extdata", "sample_peaks.txt", package="ChIPseeker") peakAnno <- annotatePeak(peakfile, TranscriptDb=txdb) peakAnnoList <- lapply(1:3, function(i) peakAnno[sample(1:length(peakAnno), 100),]) names(peakAnnoList) <- paste("peak", 1:3, sep="_") genes= lapply(peakAnnoList, function(i) unlist(i$geneId)) vennplot(genes) } \author{ G Yu }
/2X/2.14/ChIPseeker/man/vennplot.Rd
no_license
GuangchuangYu/bioc-release
R
false
false
897
rd
% Generated by roxygen2 (4.0.1): do not edit by hand \name{vennplot} \alias{vennplot} \title{vennplot} \usage{ vennplot(Sets, by = "gplots") } \arguments{ \item{Sets}{a list of object, can be vector or GRanges object} \item{by}{one of gplots or Vennerable} } \value{ venn plot that summarize the overlap of peaks from different experiments or gene annotation from different peak files. } \description{ plot the overlap of a list of object } \examples{ require(TxDb.Hsapiens.UCSC.hg19.knownGene) txdb <- TxDb.Hsapiens.UCSC.hg19.knownGene peakfile <- system.file("extdata", "sample_peaks.txt", package="ChIPseeker") peakAnno <- annotatePeak(peakfile, TranscriptDb=txdb) peakAnnoList <- lapply(1:3, function(i) peakAnno[sample(1:length(peakAnno), 100),]) names(peakAnnoList) <- paste("peak", 1:3, sep="_") genes= lapply(peakAnnoList, function(i) unlist(i$geneId)) vennplot(genes) } \author{ G Yu }
a109e44b7976499aef07aced76364af4 dungeon_i10-m5-u10-v0.pddl_planlen=174.qdimacs 36021 97353
/code/dcnf-ankit-optimized/Results/QBFLIB-2018/A1/Database/Kronegger-Pfandler-Pichler/dungeon/dungeon_i10-m5-u10-v0.pddl_planlen=174/dungeon_i10-m5-u10-v0.pddl_planlen=174.R
no_license
arey0pushpa/dcnf-autarky
R
false
false
91
r
a109e44b7976499aef07aced76364af4 dungeon_i10-m5-u10-v0.pddl_planlen=174.qdimacs 36021 97353
# Choose your own! Wines # Script to accompany the final report on my Capstone project # Author: Christian Mast # Date: 23.6.2020 # Date Source: # Original Owners: # Forina, M. et al, PARVUS - # An Extendible Package for Data Exploration, Classification and Correlation. # Institute of Pharmaceutical and Food Analysis and Technologies, Via Brigata Salerno, 16147 Genoa, Italy # # Donor: # Stefan Aeberhard, email: stefan '@' coral.cs.jcu.edu.au # Installing packages if required if(!require(tidyverse)) install.packages("tidyverse", repos = "http://cran.us.r-project.org") if(!require(ggplot2)) install.packages("ggplot2", repos = "http://cran.us.r-project.org") if(!require(caret)) install.packages("caret", repos = "http://cran.us.r-project.org") if(!require(data.table)) install.packages("data.table", repos = "http://cran.us.r-project.org") if(!require(corrplot)) install.packages("corrplot", repos = "http://cran.us.r-project.org") if(!require(randomForest)) install.packages("randomForest", repos = "http://cran.us.r-project.org") if(!require(rpart)) install.packages("rpart", repos = "http://cran.us.r-project.org") if(!require(Rborist)) install.packages("Rborist", repos = "http://cran.us.r-project.org") if(!require(kernlab)) install.packages("kernlab", repos = "http://cran.us.r-project.org") # Getting the data # Define the urls wine_data_url <- "https://archive.ics.uci.edu/ml/machine-learning-databases/wine/wine.data" wine_names_url <- "https://archive.ics.uci.edu/ml/machine-learning-databases/wine/wine.names" #Download and rename files download.file(wine_data_url, ".\\wine-data.csv") download.file(wine_names_url, ".\\wine-names.txt") #Creating a data frame from wine-data.csv wines <- read.csv(".\\wine-data.csv", header=FALSE, sep=",") #Adding column names - for the ease of life, this is done manually #"OD280/OD315 of diluted wines" was shortened to OD280.OD315 #"Nonflavanoid phenols" was shortened to Nonflav. phenols #Slashes and spaces were removed to make rpart happy - thx to Stackoverflow for the tip! colnames(wines) <- c("Winery", "Alcohol", "Malic_acid", "Ash", "Alcalinity_of_ash", "Magnesium", "Total_phenols", "Flavanoids", "Nonflav._phenols", "Proanthocyanins", "Color_intensity", "Hue", "OD280.OD315", "Proline") #Show the first 6 rows of the data frame head(wines) #Show Min, 1st Quartile, Median, Mean, 3rd quartile and max of wines summary(wines) # Create a grid of histogramms gather(wines, variable, value) %>% ggplot (aes(value)) + geom_histogram(bins=18)+ facet_wrap(~variable, ncol=4, scales="free")+ ggtitle("Histograms of variables in 'wines' data frame")+ xlab("Values")+ ylab("Count") #Removing winery, then calling corrplot() wines %>% subset(select=-Winery) %>% cor(.) %>% corrplot(tl.col="black", tl.cex=0.7, number.cex=0.6, title="Correlation Plot", type="lower", addCoef.col="black",mar=c(0,0,1,0)) #scaling wines, then rebuilding the winery column scaled_wines <- as.data.frame(scale(wines)) scaled_wines$Winery <- as.factor(wines$Winery) # Set a seed to get reproducible train & test sets set.seed(101, sample.kind = "Rounding") index <- createDataPartition(scaled_wines$Winery, p = 0.5, list = FALSE) train_set <- scaled_wines[-index, ] test_set <- scaled_wines[+index, ] # Train a knn model fit_knn <- train(Winery ~., method="knn", tuneGrid = data.frame(k=seq(3,31,2)), data = train_set) # Output the fit results fit_knn # Plot the fit results to show the best k plot(fit_knn) # Create a prediction, calculate the confusion matrix and print the accuracy prediction_knn <- predict(fit_knn, test_set) cm_knn <- confusionMatrix(prediction_knn, test_set$Winery) cat("Accuracy of the knn model:", cm_knn$overall["Accuracy"],"\n\n") # Train a rf model fit_rpart <- train(Winery ~., method="rpart", tuneGrid = data.frame(cp = seq(0.0, 0.05, len = 16)), data = train_set) # Output the fit results fit_rpart # Plot the fit results to show the best k plot(fit_rpart) # Create a prediction, calculate the confusion matrix and print the accuracy prediction_rpart <- predict(fit_rpart, test_set) cm_rpart <- confusionMatrix(prediction_rpart, test_set$Winery) cat("Accuracy of the rpart model:", cm_rpart$overall["Accuracy"],"\n\n") #create a plot of the classification tree and add text labels plot(fit_rpart$finalModel, margin = 0.1, main="Classification tree") text(fit_rpart$finalModel, cex = 0.75, pos=3, offset=0) #Create a randomForest fit and plot it to show the number of trees needed later on fit_rf <- randomForest(Winery~., data = train_set) plot(fit_rf, main="Error of randomForest vs number of trees") # Train a rborist model fit_rb <- train(Winery ~., method="Rborist", tuneGrid = data.frame(predFixed=2, minNode=seq(3,9,1)), nTree=100, data = train_set) # Output the fit results fit_rb # Plot the fit results to show the best k plot(fit_rb) # Create a prediction, calculate the confusion matrix and print the accuracy prediction_rb <- predict(fit_rb, test_set) cm_rb <- confusionMatrix(prediction_rb, test_set$Winery) cat("Accuracy of the Rborist model:", cm_rb$overall["Accuracy"],"\n\n") # Train a "Support Vector Machine with linear Kernel" model fit_svml <- train(Winery ~., method="svmLinear", tuneGrid = expand.grid(C = c(0.001, 0.01, 0.1, 1, 10)), data = train_set) # Output the fit results fit_svml # Create a prediction, calculate the confusion matrix and print the accuracy prediction_svml <- predict(fit_svml, test_set) cm_svml <- confusionMatrix(prediction_svml, test_set$Winery) cat("Accuracy of the svmLinear model:", cm_svml$overall["Accuracy"],"\n\n") #Convert predictions to numbers, calculate the average prediction_ensemble <- as.factor(round(( as.numeric(prediction_knn)+ as.numeric(prediction_rb)+ as.numeric(prediction_svml))/3)) # Calculate the confusion matrix and print the accuracy cm_ensemble <- confusionMatrix(prediction_ensemble, test_set$Winery) cat("Accuracy of the Ensemble:", cm_ensemble$overall["Accuracy"],"\n\n")
/CYO-wine-script.r
no_license
CokeSpirit/ChoseYourOwn
R
false
false
6,413
r
# Choose your own! Wines # Script to accompany the final report on my Capstone project # Author: Christian Mast # Date: 23.6.2020 # Date Source: # Original Owners: # Forina, M. et al, PARVUS - # An Extendible Package for Data Exploration, Classification and Correlation. # Institute of Pharmaceutical and Food Analysis and Technologies, Via Brigata Salerno, 16147 Genoa, Italy # # Donor: # Stefan Aeberhard, email: stefan '@' coral.cs.jcu.edu.au # Installing packages if required if(!require(tidyverse)) install.packages("tidyverse", repos = "http://cran.us.r-project.org") if(!require(ggplot2)) install.packages("ggplot2", repos = "http://cran.us.r-project.org") if(!require(caret)) install.packages("caret", repos = "http://cran.us.r-project.org") if(!require(data.table)) install.packages("data.table", repos = "http://cran.us.r-project.org") if(!require(corrplot)) install.packages("corrplot", repos = "http://cran.us.r-project.org") if(!require(randomForest)) install.packages("randomForest", repos = "http://cran.us.r-project.org") if(!require(rpart)) install.packages("rpart", repos = "http://cran.us.r-project.org") if(!require(Rborist)) install.packages("Rborist", repos = "http://cran.us.r-project.org") if(!require(kernlab)) install.packages("kernlab", repos = "http://cran.us.r-project.org") # Getting the data # Define the urls wine_data_url <- "https://archive.ics.uci.edu/ml/machine-learning-databases/wine/wine.data" wine_names_url <- "https://archive.ics.uci.edu/ml/machine-learning-databases/wine/wine.names" #Download and rename files download.file(wine_data_url, ".\\wine-data.csv") download.file(wine_names_url, ".\\wine-names.txt") #Creating a data frame from wine-data.csv wines <- read.csv(".\\wine-data.csv", header=FALSE, sep=",") #Adding column names - for the ease of life, this is done manually #"OD280/OD315 of diluted wines" was shortened to OD280.OD315 #"Nonflavanoid phenols" was shortened to Nonflav. phenols #Slashes and spaces were removed to make rpart happy - thx to Stackoverflow for the tip! colnames(wines) <- c("Winery", "Alcohol", "Malic_acid", "Ash", "Alcalinity_of_ash", "Magnesium", "Total_phenols", "Flavanoids", "Nonflav._phenols", "Proanthocyanins", "Color_intensity", "Hue", "OD280.OD315", "Proline") #Show the first 6 rows of the data frame head(wines) #Show Min, 1st Quartile, Median, Mean, 3rd quartile and max of wines summary(wines) # Create a grid of histogramms gather(wines, variable, value) %>% ggplot (aes(value)) + geom_histogram(bins=18)+ facet_wrap(~variable, ncol=4, scales="free")+ ggtitle("Histograms of variables in 'wines' data frame")+ xlab("Values")+ ylab("Count") #Removing winery, then calling corrplot() wines %>% subset(select=-Winery) %>% cor(.) %>% corrplot(tl.col="black", tl.cex=0.7, number.cex=0.6, title="Correlation Plot", type="lower", addCoef.col="black",mar=c(0,0,1,0)) #scaling wines, then rebuilding the winery column scaled_wines <- as.data.frame(scale(wines)) scaled_wines$Winery <- as.factor(wines$Winery) # Set a seed to get reproducible train & test sets set.seed(101, sample.kind = "Rounding") index <- createDataPartition(scaled_wines$Winery, p = 0.5, list = FALSE) train_set <- scaled_wines[-index, ] test_set <- scaled_wines[+index, ] # Train a knn model fit_knn <- train(Winery ~., method="knn", tuneGrid = data.frame(k=seq(3,31,2)), data = train_set) # Output the fit results fit_knn # Plot the fit results to show the best k plot(fit_knn) # Create a prediction, calculate the confusion matrix and print the accuracy prediction_knn <- predict(fit_knn, test_set) cm_knn <- confusionMatrix(prediction_knn, test_set$Winery) cat("Accuracy of the knn model:", cm_knn$overall["Accuracy"],"\n\n") # Train a rf model fit_rpart <- train(Winery ~., method="rpart", tuneGrid = data.frame(cp = seq(0.0, 0.05, len = 16)), data = train_set) # Output the fit results fit_rpart # Plot the fit results to show the best k plot(fit_rpart) # Create a prediction, calculate the confusion matrix and print the accuracy prediction_rpart <- predict(fit_rpart, test_set) cm_rpart <- confusionMatrix(prediction_rpart, test_set$Winery) cat("Accuracy of the rpart model:", cm_rpart$overall["Accuracy"],"\n\n") #create a plot of the classification tree and add text labels plot(fit_rpart$finalModel, margin = 0.1, main="Classification tree") text(fit_rpart$finalModel, cex = 0.75, pos=3, offset=0) #Create a randomForest fit and plot it to show the number of trees needed later on fit_rf <- randomForest(Winery~., data = train_set) plot(fit_rf, main="Error of randomForest vs number of trees") # Train a rborist model fit_rb <- train(Winery ~., method="Rborist", tuneGrid = data.frame(predFixed=2, minNode=seq(3,9,1)), nTree=100, data = train_set) # Output the fit results fit_rb # Plot the fit results to show the best k plot(fit_rb) # Create a prediction, calculate the confusion matrix and print the accuracy prediction_rb <- predict(fit_rb, test_set) cm_rb <- confusionMatrix(prediction_rb, test_set$Winery) cat("Accuracy of the Rborist model:", cm_rb$overall["Accuracy"],"\n\n") # Train a "Support Vector Machine with linear Kernel" model fit_svml <- train(Winery ~., method="svmLinear", tuneGrid = expand.grid(C = c(0.001, 0.01, 0.1, 1, 10)), data = train_set) # Output the fit results fit_svml # Create a prediction, calculate the confusion matrix and print the accuracy prediction_svml <- predict(fit_svml, test_set) cm_svml <- confusionMatrix(prediction_svml, test_set$Winery) cat("Accuracy of the svmLinear model:", cm_svml$overall["Accuracy"],"\n\n") #Convert predictions to numbers, calculate the average prediction_ensemble <- as.factor(round(( as.numeric(prediction_knn)+ as.numeric(prediction_rb)+ as.numeric(prediction_svml))/3)) # Calculate the confusion matrix and print the accuracy cm_ensemble <- confusionMatrix(prediction_ensemble, test_set$Winery) cat("Accuracy of the Ensemble:", cm_ensemble$overall["Accuracy"],"\n\n")
glean.prelim <- function(choice = 1) { ### Purpose:- ALCM data collection ### ---------------------------------------------------------------------- ### Modified from:- ### ---------------------------------------------------------------------- ### Arguments:- ### ---------------------------------------------------------------------- ### Author:- Patrick Connolly, Date:- 10 Apr 2013, 13:29 ### ---------------------------------------------------------------------- ### Revisions:- prelim.df <- within(prelim.df, Efppm[is.na(Efppm)] <- 0) prelim.df <- prelim.df[, -4] alcm.df <- prelim.df[prelim.df$Species == "ALCM",] alcm.df$Lifestage = "diap" latania.df <- prelim.df[prelim.df$Species == "Latania scale",] latania.df$Species <- "LS" latania.df <- df.sort(latania.df, c("Efppm", "Lifestage")) mb.df <- prelim.df[prelim.df$Species == "Mealybug",] mb.df$Lifestage <- "all" ## add lifestages mb.sum <- unique(mb.df[, 1:5]) mb.sum$Live <- aggregate(Live~ Efppm, data = mb.df, sum)$Live mb.sum$Dead <- aggregate(Dead~ Efppm, data = mb.df, sum)$Dead mb.sum$Total <-aggregate(Total~ Efppm, data = mb.df, sum)$Total ## names(mb.sum) <- names(mb.df) thrip.df <- prelim.df[prelim.df$Species == "Onion thrips",] thrip.df <- df.sort(thrip.df, c("Efppm", "Lifestage")) sjs.df <- prelim.df[prelim.df$Species == "San Jose",] sjs.df$Lifestage <- "all" sjs.sum <- unique(sjs.df[, 1:5]) sjs.sum$Live <- aggregate(Live~ Efppm, data = sjs.df, sum)$Live sjs.sum$Dead <- aggregate(Dead~ Efppm, data = sjs.df, sum)$Dead sjs.sum$Total <- aggregate(Total~ Efppm, data = sjs.df, sum)$Total ## names(sjs.sum) <- names(sjs.df) ## add into one dataframe use.df <- rbind(alcm.df, latania.df, mb.sum, thrip.df, sjs.sum) ## attach(alcm.df) ## on.exit(detach("alcm.df")) idset <- with(use.df, make.id(Efppm)) cutx <- NULL leg.brief <- with(use.df, unique(paste(Species, Lifestage))) maint <- "Mortality of various in ethyl formate" xlabels <- c(0, 0) xaxtitle <- "Dose (ppm)" with(use.df, list(id = idset, times = Efppm, total = unlist(Dead) + unlist(Live), dead = Dead, cutx = cutx, offset = 0, xaxtitle = xaxtitle, maint = maint, legend = leg.brief, xlabels = xlabels, takelog = FALSE)) }
/.tmp/hrapgc.glean.prelim.R
no_license
Tuxkid/PNZ_EF
R
false
false
2,293
r
glean.prelim <- function(choice = 1) { ### Purpose:- ALCM data collection ### ---------------------------------------------------------------------- ### Modified from:- ### ---------------------------------------------------------------------- ### Arguments:- ### ---------------------------------------------------------------------- ### Author:- Patrick Connolly, Date:- 10 Apr 2013, 13:29 ### ---------------------------------------------------------------------- ### Revisions:- prelim.df <- within(prelim.df, Efppm[is.na(Efppm)] <- 0) prelim.df <- prelim.df[, -4] alcm.df <- prelim.df[prelim.df$Species == "ALCM",] alcm.df$Lifestage = "diap" latania.df <- prelim.df[prelim.df$Species == "Latania scale",] latania.df$Species <- "LS" latania.df <- df.sort(latania.df, c("Efppm", "Lifestage")) mb.df <- prelim.df[prelim.df$Species == "Mealybug",] mb.df$Lifestage <- "all" ## add lifestages mb.sum <- unique(mb.df[, 1:5]) mb.sum$Live <- aggregate(Live~ Efppm, data = mb.df, sum)$Live mb.sum$Dead <- aggregate(Dead~ Efppm, data = mb.df, sum)$Dead mb.sum$Total <-aggregate(Total~ Efppm, data = mb.df, sum)$Total ## names(mb.sum) <- names(mb.df) thrip.df <- prelim.df[prelim.df$Species == "Onion thrips",] thrip.df <- df.sort(thrip.df, c("Efppm", "Lifestage")) sjs.df <- prelim.df[prelim.df$Species == "San Jose",] sjs.df$Lifestage <- "all" sjs.sum <- unique(sjs.df[, 1:5]) sjs.sum$Live <- aggregate(Live~ Efppm, data = sjs.df, sum)$Live sjs.sum$Dead <- aggregate(Dead~ Efppm, data = sjs.df, sum)$Dead sjs.sum$Total <- aggregate(Total~ Efppm, data = sjs.df, sum)$Total ## names(sjs.sum) <- names(sjs.df) ## add into one dataframe use.df <- rbind(alcm.df, latania.df, mb.sum, thrip.df, sjs.sum) ## attach(alcm.df) ## on.exit(detach("alcm.df")) idset <- with(use.df, make.id(Efppm)) cutx <- NULL leg.brief <- with(use.df, unique(paste(Species, Lifestage))) maint <- "Mortality of various in ethyl formate" xlabels <- c(0, 0) xaxtitle <- "Dose (ppm)" with(use.df, list(id = idset, times = Efppm, total = unlist(Dead) + unlist(Live), dead = Dead, cutx = cutx, offset = 0, xaxtitle = xaxtitle, maint = maint, legend = leg.brief, xlabels = xlabels, takelog = FALSE)) }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/get_admissions.R \name{get_admissions} \alias{get_admissions} \title{Get Hospital Admissions} \usage{ get_admissions( keep_vars = "new_adm", level = "trust", release_date = Sys.Date(), mapping, geo_names ) } \arguments{ \item{keep_vars}{Character string, defaulting to "new_adm" (first-time COVID-19 hospital admissions). Defines which variables to keep from the raw data. Other supported options are: "all_adm" (for all COVID-19 hospital admissions), and "all_bed" (for all COVID-19 beds occupied). Multiple values allowed.} \item{level}{Character string, defaulting to "trust". Defines the level of aggregation at which to return the data. Other supported options are "utla" for UTLA level admissions or "ltla" for LTLA level admissions.} \item{release_date}{Date, release date of data to download. Will automatically find the Thursday prior to the date specified.} \item{mapping}{A data.frame containing geo_code, trust_code, p_geo and p_trust.} \item{geo_names}{A data.frame containing \code{geo_code} and \code{geo_name}. Used to assign meaningful to geographies.} } \value{ A data.frame of daily admissions and/or bed occupancy data, reported at the Trust, LTLA or UTLA level. Note that new admissions ("new_adm") are called "admissions" in the data.frame to be consistent with a previous version of this function. } \description{ Downloads hospital admissions by Hospital trust using \code{download_trust_data} and then optionally aggregates to either LTLA or UTLA level. This can be done either with the built in mapping or a user supplied mapping. }
/man/get_admissions.Rd
permissive
epiforecasts/covid19.nhs.data
R
false
true
1,651
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/get_admissions.R \name{get_admissions} \alias{get_admissions} \title{Get Hospital Admissions} \usage{ get_admissions( keep_vars = "new_adm", level = "trust", release_date = Sys.Date(), mapping, geo_names ) } \arguments{ \item{keep_vars}{Character string, defaulting to "new_adm" (first-time COVID-19 hospital admissions). Defines which variables to keep from the raw data. Other supported options are: "all_adm" (for all COVID-19 hospital admissions), and "all_bed" (for all COVID-19 beds occupied). Multiple values allowed.} \item{level}{Character string, defaulting to "trust". Defines the level of aggregation at which to return the data. Other supported options are "utla" for UTLA level admissions or "ltla" for LTLA level admissions.} \item{release_date}{Date, release date of data to download. Will automatically find the Thursday prior to the date specified.} \item{mapping}{A data.frame containing geo_code, trust_code, p_geo and p_trust.} \item{geo_names}{A data.frame containing \code{geo_code} and \code{geo_name}. Used to assign meaningful to geographies.} } \value{ A data.frame of daily admissions and/or bed occupancy data, reported at the Trust, LTLA or UTLA level. Note that new admissions ("new_adm") are called "admissions" in the data.frame to be consistent with a previous version of this function. } \description{ Downloads hospital admissions by Hospital trust using \code{download_trust_data} and then optionally aggregates to either LTLA or UTLA level. This can be done either with the built in mapping or a user supplied mapping. }
#' Run Seurat Integration #' #' run batch correction, followed by: #' 1) stashing of batches in metadata 'batch' #' 2) clustering with resolution 0.2 to 2.0 in increments of 0.2 #' 3) saving to <proj_dir>/output/sce/<feature>_seu_<suffix>.rds #' #' @param suffix a suffix to be appended to a file save in output dir #' @param seu_list #' @param resolution #' @param feature #' @param algorithm #' @param organism #' @param ... #' #' @return #' @export #' #' #' @examples seurat_integration_pipeline <- function(seu_list, feature, resolution, suffix = '', algorithm = 1, organism, annotate_cell_cycle = FALSE, annotate_percent_mito = FALSE, ...) { integrated_seu <- seurat_integrate(seu_list, ...) # cluster merged seurat objects integrated_seu <- seurat_cluster(integrated_seu, resolution = resolution, algorithm = algorithm, ...) integrated_seu <- find_all_markers(integrated_seu) integrated_seu <- getEnrichedPathways(integrated_seu) # add read count column integrated_seu <- add_read_count_col(integrated_seu) # annotate cell cycle scoring to seurat objects if (annotate_cell_cycle){ integrated_seu <- annotate_cell_cycle(integrated_seu, feature, ...) } # annotate mitochondrial percentage in seurat metadata if (annotate_percent_mito){ integrated_seu <- add_percent_mito(integrated_seu, feature, ...) } #annotate excluded cells # integrated_seu <- annotate_excluded(integrated_seu, excluded_cells) return(integrated_seu) } #' Run Seurat Pipeline #' #' Preprocess, Cluster and Reduce Dimensions for a single seurat object #' #' @param seu #' @param resolution #' #' @return #' @export #' #' @examples seurat_pipeline <- function(seu, feature = "gene", resolution=0.6, reduction = "pca", annotate_cell_cycle = TRUE, annotate_percent_mito = TRUE, ...){ seu <- seurat_preprocess(seu, scale = T, ...) # PCA seu <- seurat_reduce_dimensions(seu, check_duplicates = FALSE, reduction = reduction, ...) seu <- seurat_cluster(seu = seu, resolution = resolution, reduction = reduction, ...) seu <- find_all_markers(seu, resolution = resolution, reduction = reduction) seu <- getEnrichedPathways(seu) # annotate low read count category in seurat metadata seu <- seuratTools::add_read_count_col(seu) # annotate cell cycle scoring to seurat objects if (annotate_cell_cycle){ seu <- annotate_cell_cycle(seu, feature, ...) } # annotate mitochondrial percentage in seurat metadata if (annotate_percent_mito){ seu <- add_percent_mito(seu, feature, ...) } return(seu) }
/R/pipeline.R
permissive
mitsingh/seuratTools
R
false
false
2,552
r
#' Run Seurat Integration #' #' run batch correction, followed by: #' 1) stashing of batches in metadata 'batch' #' 2) clustering with resolution 0.2 to 2.0 in increments of 0.2 #' 3) saving to <proj_dir>/output/sce/<feature>_seu_<suffix>.rds #' #' @param suffix a suffix to be appended to a file save in output dir #' @param seu_list #' @param resolution #' @param feature #' @param algorithm #' @param organism #' @param ... #' #' @return #' @export #' #' #' @examples seurat_integration_pipeline <- function(seu_list, feature, resolution, suffix = '', algorithm = 1, organism, annotate_cell_cycle = FALSE, annotate_percent_mito = FALSE, ...) { integrated_seu <- seurat_integrate(seu_list, ...) # cluster merged seurat objects integrated_seu <- seurat_cluster(integrated_seu, resolution = resolution, algorithm = algorithm, ...) integrated_seu <- find_all_markers(integrated_seu) integrated_seu <- getEnrichedPathways(integrated_seu) # add read count column integrated_seu <- add_read_count_col(integrated_seu) # annotate cell cycle scoring to seurat objects if (annotate_cell_cycle){ integrated_seu <- annotate_cell_cycle(integrated_seu, feature, ...) } # annotate mitochondrial percentage in seurat metadata if (annotate_percent_mito){ integrated_seu <- add_percent_mito(integrated_seu, feature, ...) } #annotate excluded cells # integrated_seu <- annotate_excluded(integrated_seu, excluded_cells) return(integrated_seu) } #' Run Seurat Pipeline #' #' Preprocess, Cluster and Reduce Dimensions for a single seurat object #' #' @param seu #' @param resolution #' #' @return #' @export #' #' @examples seurat_pipeline <- function(seu, feature = "gene", resolution=0.6, reduction = "pca", annotate_cell_cycle = TRUE, annotate_percent_mito = TRUE, ...){ seu <- seurat_preprocess(seu, scale = T, ...) # PCA seu <- seurat_reduce_dimensions(seu, check_duplicates = FALSE, reduction = reduction, ...) seu <- seurat_cluster(seu = seu, resolution = resolution, reduction = reduction, ...) seu <- find_all_markers(seu, resolution = resolution, reduction = reduction) seu <- getEnrichedPathways(seu) # annotate low read count category in seurat metadata seu <- seuratTools::add_read_count_col(seu) # annotate cell cycle scoring to seurat objects if (annotate_cell_cycle){ seu <- annotate_cell_cycle(seu, feature, ...) } # annotate mitochondrial percentage in seurat metadata if (annotate_percent_mito){ seu <- add_percent_mito(seu, feature, ...) } return(seu) }
Kruskal-Wallis rank sum test data: ARRAY and categs Kruskal-Wallis chi-squared = 59.482, df = 3, p-value = 7.585e-13 AMPDEA BCEIBEA CVEA3 BCEIBEA 2.1e-07 - - CVEA3 0.99 4.8e-08 - HHCORandomLPNORM 1.9e-06 0.98 4.6e-07
/MaFMethodology/R/cec/IGD/10/kruskaloutput.R
no_license
fritsche/hhcopreliminaryresults
R
false
false
286
r
Kruskal-Wallis rank sum test data: ARRAY and categs Kruskal-Wallis chi-squared = 59.482, df = 3, p-value = 7.585e-13 AMPDEA BCEIBEA CVEA3 BCEIBEA 2.1e-07 - - CVEA3 0.99 4.8e-08 - HHCORandomLPNORM 1.9e-06 0.98 4.6e-07
#import libraries library(dplyr) library(imputeTS) library(tidyverse) library(ggplot2) library(reshape) library(GGally) library(forecast) #import the dataset to the workspace dataset.df <- read.csv("googleplaystore.csv") #Clean data, convert from factor to num type data.clean <- dataset.df %>% mutate( # Eliminate some characters to transform Installs to numeric Installs = gsub("\\+", "", as.character(Installs)), Installs = as.numeric(gsub(",", "", Installs)), # Eliminate M to transform Size to numeric Size = gsub("M", "", Size), # Replace cells with k to 0 since it is < 1MB Size = ifelse(grepl("k", Size), 0, as.numeric(Size)), # Transform reviews to numeric Reviews = as.numeric(Reviews), # Remove currency symbol from Price, change it to numeric Price = as.numeric(gsub("\\$", "", as.character(Price))), # Replace "Varies with device" to NA since it is unknown Min.Android.Ver = gsub("Varies with device", NA, Android.Ver), # Keep only version number to 1 decimal Min.Android.Ver = as.numeric(substr(Min.Android.Ver, start = 1, stop = 3)), # Drop old Android version column Android.Ver = NULL ) #check if their are any duplicate records. nrow(data.clean %>% distinct()) #Omit duplicate records data.clean <- data.clean %>% distinct() #Replace NA or missing values with mean data.clean$Rating <- na.mean(data.clean$Rating) data.clean$Size <- na.mean(data.clean$Size) #check the missing values sum(is.na(data.clean$Reviews)) #Descriptive statistics summary(data.clean) #BoxPlot ggplot(data.clean,aes(x=Content.Rating, y=log10(Installs))) + scale_y_continuous("Installs, log10-scaling") + geom_boxplot(outlier.colour = "red")+ geom_point() ggplot(data.clean,aes(x=Type, y=log10(Installs))) + scale_y_continuous("Type, log10-scaling") + geom_boxplot(outlier.colour = "red")+ geom_point() #copy dataframe and standardize on that dataframe data.final <- data.clean #create dummy variable for Type i.e. free or paid dummy_type <- as.data.frame(model.matrix(~ 0 + Type, data=data.final)) dummy_Content.Rating <- as.data.frame(model.matrix(~ 0 + Content.Rating, data=data.final)) dummy_Category <- as.data.frame(model.matrix(~ 0 + Category, data=data.final)) data.final <- cbind(data.final[,-7], dummy_type[,]) data.final <- cbind(data.final[,-8], dummy_Content.Rating[,]) data.final <- cbind(data.final[,-2], dummy_Category[,]) data.final <- data.final[,-12]#drop one dummy type data.final <- data.final[,-12]#drop one dummy content rating data.final <- data.final[,-34]#drop one dummy category #standardize data options(scipen=999, digits = 5) #data.final[,c(3,4,5,6,7,12,13,14,15,16,17)] <- scale(data.final[,c(3,4,5,6,7,12,13,14,15,16,17)]) #choose data for Linear modelling data.final.new <- data.final[-c(1,8,9,10)] data.final.new <- data.final.new[-c(6)] #Heat map between various predictors and target variable cor.mat <- round(cor(data.final.new),2) heatmap(as.matrix(cor.mat),Colv = NA,Rowv = NA) melted.cor.mat <- melt(cor.mat) ggplot(melted.cor.mat, aes(x = X1, y = X2, fill = value)) + geom_tile() + geom_text(aes(x = X1, y = X2, label = value)) # select variables for regression selected.var <- data.final.new # partition data set.seed(3) # set seed for reproducing the partition numberOfRows <- nrow(selected.var) train.index <- sample(numberOfRows, numberOfRows*0.6) train.df <- selected.var[train.index, ] valid.df <- selected.var[-train.index, ] # use lm() to run a linear regression of Ratings on all predictors in the # use . after ~ to include all the remaining columns in train.df as predictors. data.final.lm <- lm(Rating ~ ., data = train.df) # use options() to ensure numbers are not displayed in scientific notation. options(scipen = 999) summary(data.final.lm) # use predict() to make predictions on a new set. data.final.lm.pred <- predict(data.final.lm, valid.df) options(scipen=999, digits = 5) some.residuals <- valid.df$Rating[1:20] - data.final.lm.pred[1:20] data.frame("Predicted" = data.final.lm.pred[1:20], "Actual" = valid.df$Rating[1:20], "Residual" = some.residuals) #accurcy of the model with all the predictors accuracy(data.final.lm.pred, valid.df$Rating) plot(data.final.lm) plot(data.final.lm.pred, valid.df$Rating,xlab = "Actual", ylab = "Predcited") # use step() to run stepwise regression. # model - 1 Using backward regression data.final.lm.backward <- step(data.final.lm, direction = "backward") summary(data.final.lm.backward) # Which variables were dropped? data.final.lm.backward.pred <- predict(data.final.lm.backward, valid.df) accuracy(data.final.lm.backward.pred, valid.df$Rating) # model 1 - using forward regression # create model with no predictors data.final.lm.null <- lm(Rating~1, data = train.df) # use step() to run forward regression. data.final.lm.forward <- step(data.final.lm.null, scope=list(lower=data.final.lm.null, upper=data.final.lm), direction = "forward") summary(data.final.lm.forward) # Which variables were added? data.final.lm.forward.pred <- predict(data.final.lm.forward, valid.df) accuracy(data.final.lm.forward.pred, valid.df$Rating) # model 1 - using stepwise # use step() to run stepwise regression. data.final.lm.stepwise <- step(data.final.lm, direction = "both") summary(data.final.lm.stepwise) # Which variables were dropped/added? data.final.lm.stepwise.pred <- predict(data.final.lm.stepwise, valid.df) accuracy(data.final.lm.step.pred, valid.df$Rating) # coefficient round(coefficients(data.final.lm.stepwise),5) #Second model Reviews+Size+CategoryGame # use lm() to run a linear regression of Ratings on all predictors in the # use . after ~ to include all the remaining columns in train.df as predictors. data.final.lm2 <- lm(Rating ~ Reviews+Size+CategoryFAMILY+Price+Content.RatingTeen+TypeFree, data = train.df) # use options() to ensure numbers are not displayed in scientific notation. options(scipen = 999) summary(data.final.lm2) # use predict() to make predictions on a new set. data.final.lm.pred2 <- predict(data.final.lm2, valid.df) options(scipen=999, digits = 5) some.residuals <- valid.df$Rating[1:20] - data.final.lm.pred2[1:20] data.frame("Predicted" = data.final.lm.pred2[1:20], "Actual" = valid.df$Rating[1:20], "Residual" = some.residuals) #accurcy of the model with all the predictors accuracy(data.final.lm.pred2, valid.df$Rating) plot(data.final.lm2) plot(data.final.lm.pred2, valid.df$Rating,xlab = "Actual", ylab = "Predcited") # use step() to run stepwise regression. # model - 2 Using backward regression data.final.lm.backward2 <- step(data.final.lm2, direction = "backward") summary(data.final.lm.backward2) # Which variables were dropped? data.final.lm.backward2.pred <- predict(data.final.lm.backward2, valid.df) accuracy(data.final.lm.backward2.pred, valid.df$Rating) # model 2 - using stepwise # use step() to run stepwise regression. data.final.lm.stepwise2 <- step(data.final.lm2, direction = "both") summary(data.final.lm.stepwise2) # Which variables were dropped/added? data.final.lm.stepwise2.pred <- predict(data.final.lm.stepwise2, valid.df) accuracy(data.final.lm.stepwise2.pred, valid.df$Rating) #Third model Reviews+Size+CategoryGame+CategorySPORTS+Price+CategoryTravel_and_local # use lm() to run a linear regression of Ratings on all predictors in the # use . after ~ to include all the remaining columns in train.df as predictors. data.final.lm3 <- lm(Rating ~ Reviews+Size+CategoryGAME+Price+Content.RatingTeen+TypeFree, data = train.df) # use options() to ensure numbers are not displayed in scientific notation. options(scipen = 999) summary(data.final.lm3) # use predict() to make predictions on a new set. data.final.lm.pred3 <- predict(data.final.lm3, valid.df) options(scipen=999, digits = 5) some.residuals <- valid.df$Rating[1:20] - data.final.lm.pred[1:20] data.frame("Predicted" = data.final.lm.pred3[1:20], "Actual" = valid.df$Rating[1:20], "Residual" = some.residuals) #accurcy of the model with all the predictors accuracy(data.final.lm.pred3, valid.df$Rating) coefficients(data.final.lm3) plot(data.final.lm3) #plot(data.final.lm.pred2, valid.df$Rating, xlab = "Actual", ylab = "Predcited") # use step() to run stepwise regression. # model - 3 Using backward regression data.final.lm.backward3 <- step(data.final.lm3, direction = "backward") summary(data.final.lm.backward3) # Which variables were dropped? data.final.lm.backward3.pred <- predict(data.final.lm.backward3, valid.df) accuracy(data.final.lm.backward3.pred, valid.df$Rating) # model 3 - using stepwise # use step() to run stepwise regression. data.final.lm.stepwise3 <- step(data.final.lm3, direction = "both") summary(data.final.lm.stepwise3) # Which variables were dropped/added? data.final.lm.stepwise3.pred <- predict(data.final.lm.stepwise3, valid.df) accuracy(data.final.lm.stepwise3.pred, valid.df$Rating) #Fourth Model #Third model Reviews+Size+CategoryGame+CategorySPORTS+Price+CategoryTravel_and_local # use lm() to run a linear regression of Ratings on all predictors in the # use . after ~ to include all the remaining columns in train.df as predictors. data.final.lm4 <- lm(Rating ~ Reviews+Size+CategoryGAME+Price+Content.RatingEveryone+TypeFree, data = train.df) #CategoryFAMILY+CategoryART_AND_DESIGN # use options() to ensure numbers are not displayed in scientific notation. options(scipen = 999) summary(data.final.lm4) # use predict() to make predictions on a new set. data.final.lm.pred4 <- predict(data.final.lm4, valid.df) options(scipen=999, digits = 5) some.residuals <- valid.df$Rating[1:20] - data.final.lm.pred[1:20] data.frame("Predicted" = data.final.lm.pred4[1:20], "Actual" = valid.df$Rating[1:20], "Residual" = some.residuals) #accurcay of the model with all the predictors accuracy(data.final.lm.pred4, valid.df$Rating) plot(data.final.lm4) plot(data.final.lm.pred4, valid.df$Rating, xlab = "Actual", ylab = "Predcited") # use step() to run stepwise regression. # model - 4 Using backward regression data.final.lm.backward4 <- step(data.final.lm4, direction = "backward") summary(data.final.lm.backward4) # Which variables were dropped? data.final.lm.backward4.pred <- predict(data.final.lm.backward4, valid.df) accuracy(data.final.lm.backward4.pred, valid.df$Rating) # model 4 - using stepwise # use step() to run stepwise regression. data.final.lm.stepwise4 <- step(data.final.lm4, direction = "both") summary(data.final.lm.stepwise4) # Which variables were dropped/added? data.final.lm.stepwise4.pred <- predict(data.final.lm.stepwise4, valid.df) accuracy(data.final.lm.stepwise4.pred, valid.df$Rating)
/ProjectFinal.R
no_license
neelimayeddula/Googlereviewanalysis
R
false
false
10,958
r
#import libraries library(dplyr) library(imputeTS) library(tidyverse) library(ggplot2) library(reshape) library(GGally) library(forecast) #import the dataset to the workspace dataset.df <- read.csv("googleplaystore.csv") #Clean data, convert from factor to num type data.clean <- dataset.df %>% mutate( # Eliminate some characters to transform Installs to numeric Installs = gsub("\\+", "", as.character(Installs)), Installs = as.numeric(gsub(",", "", Installs)), # Eliminate M to transform Size to numeric Size = gsub("M", "", Size), # Replace cells with k to 0 since it is < 1MB Size = ifelse(grepl("k", Size), 0, as.numeric(Size)), # Transform reviews to numeric Reviews = as.numeric(Reviews), # Remove currency symbol from Price, change it to numeric Price = as.numeric(gsub("\\$", "", as.character(Price))), # Replace "Varies with device" to NA since it is unknown Min.Android.Ver = gsub("Varies with device", NA, Android.Ver), # Keep only version number to 1 decimal Min.Android.Ver = as.numeric(substr(Min.Android.Ver, start = 1, stop = 3)), # Drop old Android version column Android.Ver = NULL ) #check if their are any duplicate records. nrow(data.clean %>% distinct()) #Omit duplicate records data.clean <- data.clean %>% distinct() #Replace NA or missing values with mean data.clean$Rating <- na.mean(data.clean$Rating) data.clean$Size <- na.mean(data.clean$Size) #check the missing values sum(is.na(data.clean$Reviews)) #Descriptive statistics summary(data.clean) #BoxPlot ggplot(data.clean,aes(x=Content.Rating, y=log10(Installs))) + scale_y_continuous("Installs, log10-scaling") + geom_boxplot(outlier.colour = "red")+ geom_point() ggplot(data.clean,aes(x=Type, y=log10(Installs))) + scale_y_continuous("Type, log10-scaling") + geom_boxplot(outlier.colour = "red")+ geom_point() #copy dataframe and standardize on that dataframe data.final <- data.clean #create dummy variable for Type i.e. free or paid dummy_type <- as.data.frame(model.matrix(~ 0 + Type, data=data.final)) dummy_Content.Rating <- as.data.frame(model.matrix(~ 0 + Content.Rating, data=data.final)) dummy_Category <- as.data.frame(model.matrix(~ 0 + Category, data=data.final)) data.final <- cbind(data.final[,-7], dummy_type[,]) data.final <- cbind(data.final[,-8], dummy_Content.Rating[,]) data.final <- cbind(data.final[,-2], dummy_Category[,]) data.final <- data.final[,-12]#drop one dummy type data.final <- data.final[,-12]#drop one dummy content rating data.final <- data.final[,-34]#drop one dummy category #standardize data options(scipen=999, digits = 5) #data.final[,c(3,4,5,6,7,12,13,14,15,16,17)] <- scale(data.final[,c(3,4,5,6,7,12,13,14,15,16,17)]) #choose data for Linear modelling data.final.new <- data.final[-c(1,8,9,10)] data.final.new <- data.final.new[-c(6)] #Heat map between various predictors and target variable cor.mat <- round(cor(data.final.new),2) heatmap(as.matrix(cor.mat),Colv = NA,Rowv = NA) melted.cor.mat <- melt(cor.mat) ggplot(melted.cor.mat, aes(x = X1, y = X2, fill = value)) + geom_tile() + geom_text(aes(x = X1, y = X2, label = value)) # select variables for regression selected.var <- data.final.new # partition data set.seed(3) # set seed for reproducing the partition numberOfRows <- nrow(selected.var) train.index <- sample(numberOfRows, numberOfRows*0.6) train.df <- selected.var[train.index, ] valid.df <- selected.var[-train.index, ] # use lm() to run a linear regression of Ratings on all predictors in the # use . after ~ to include all the remaining columns in train.df as predictors. data.final.lm <- lm(Rating ~ ., data = train.df) # use options() to ensure numbers are not displayed in scientific notation. options(scipen = 999) summary(data.final.lm) # use predict() to make predictions on a new set. data.final.lm.pred <- predict(data.final.lm, valid.df) options(scipen=999, digits = 5) some.residuals <- valid.df$Rating[1:20] - data.final.lm.pred[1:20] data.frame("Predicted" = data.final.lm.pred[1:20], "Actual" = valid.df$Rating[1:20], "Residual" = some.residuals) #accurcy of the model with all the predictors accuracy(data.final.lm.pred, valid.df$Rating) plot(data.final.lm) plot(data.final.lm.pred, valid.df$Rating,xlab = "Actual", ylab = "Predcited") # use step() to run stepwise regression. # model - 1 Using backward regression data.final.lm.backward <- step(data.final.lm, direction = "backward") summary(data.final.lm.backward) # Which variables were dropped? data.final.lm.backward.pred <- predict(data.final.lm.backward, valid.df) accuracy(data.final.lm.backward.pred, valid.df$Rating) # model 1 - using forward regression # create model with no predictors data.final.lm.null <- lm(Rating~1, data = train.df) # use step() to run forward regression. data.final.lm.forward <- step(data.final.lm.null, scope=list(lower=data.final.lm.null, upper=data.final.lm), direction = "forward") summary(data.final.lm.forward) # Which variables were added? data.final.lm.forward.pred <- predict(data.final.lm.forward, valid.df) accuracy(data.final.lm.forward.pred, valid.df$Rating) # model 1 - using stepwise # use step() to run stepwise regression. data.final.lm.stepwise <- step(data.final.lm, direction = "both") summary(data.final.lm.stepwise) # Which variables were dropped/added? data.final.lm.stepwise.pred <- predict(data.final.lm.stepwise, valid.df) accuracy(data.final.lm.step.pred, valid.df$Rating) # coefficient round(coefficients(data.final.lm.stepwise),5) #Second model Reviews+Size+CategoryGame # use lm() to run a linear regression of Ratings on all predictors in the # use . after ~ to include all the remaining columns in train.df as predictors. data.final.lm2 <- lm(Rating ~ Reviews+Size+CategoryFAMILY+Price+Content.RatingTeen+TypeFree, data = train.df) # use options() to ensure numbers are not displayed in scientific notation. options(scipen = 999) summary(data.final.lm2) # use predict() to make predictions on a new set. data.final.lm.pred2 <- predict(data.final.lm2, valid.df) options(scipen=999, digits = 5) some.residuals <- valid.df$Rating[1:20] - data.final.lm.pred2[1:20] data.frame("Predicted" = data.final.lm.pred2[1:20], "Actual" = valid.df$Rating[1:20], "Residual" = some.residuals) #accurcy of the model with all the predictors accuracy(data.final.lm.pred2, valid.df$Rating) plot(data.final.lm2) plot(data.final.lm.pred2, valid.df$Rating,xlab = "Actual", ylab = "Predcited") # use step() to run stepwise regression. # model - 2 Using backward regression data.final.lm.backward2 <- step(data.final.lm2, direction = "backward") summary(data.final.lm.backward2) # Which variables were dropped? data.final.lm.backward2.pred <- predict(data.final.lm.backward2, valid.df) accuracy(data.final.lm.backward2.pred, valid.df$Rating) # model 2 - using stepwise # use step() to run stepwise regression. data.final.lm.stepwise2 <- step(data.final.lm2, direction = "both") summary(data.final.lm.stepwise2) # Which variables were dropped/added? data.final.lm.stepwise2.pred <- predict(data.final.lm.stepwise2, valid.df) accuracy(data.final.lm.stepwise2.pred, valid.df$Rating) #Third model Reviews+Size+CategoryGame+CategorySPORTS+Price+CategoryTravel_and_local # use lm() to run a linear regression of Ratings on all predictors in the # use . after ~ to include all the remaining columns in train.df as predictors. data.final.lm3 <- lm(Rating ~ Reviews+Size+CategoryGAME+Price+Content.RatingTeen+TypeFree, data = train.df) # use options() to ensure numbers are not displayed in scientific notation. options(scipen = 999) summary(data.final.lm3) # use predict() to make predictions on a new set. data.final.lm.pred3 <- predict(data.final.lm3, valid.df) options(scipen=999, digits = 5) some.residuals <- valid.df$Rating[1:20] - data.final.lm.pred[1:20] data.frame("Predicted" = data.final.lm.pred3[1:20], "Actual" = valid.df$Rating[1:20], "Residual" = some.residuals) #accurcy of the model with all the predictors accuracy(data.final.lm.pred3, valid.df$Rating) coefficients(data.final.lm3) plot(data.final.lm3) #plot(data.final.lm.pred2, valid.df$Rating, xlab = "Actual", ylab = "Predcited") # use step() to run stepwise regression. # model - 3 Using backward regression data.final.lm.backward3 <- step(data.final.lm3, direction = "backward") summary(data.final.lm.backward3) # Which variables were dropped? data.final.lm.backward3.pred <- predict(data.final.lm.backward3, valid.df) accuracy(data.final.lm.backward3.pred, valid.df$Rating) # model 3 - using stepwise # use step() to run stepwise regression. data.final.lm.stepwise3 <- step(data.final.lm3, direction = "both") summary(data.final.lm.stepwise3) # Which variables were dropped/added? data.final.lm.stepwise3.pred <- predict(data.final.lm.stepwise3, valid.df) accuracy(data.final.lm.stepwise3.pred, valid.df$Rating) #Fourth Model #Third model Reviews+Size+CategoryGame+CategorySPORTS+Price+CategoryTravel_and_local # use lm() to run a linear regression of Ratings on all predictors in the # use . after ~ to include all the remaining columns in train.df as predictors. data.final.lm4 <- lm(Rating ~ Reviews+Size+CategoryGAME+Price+Content.RatingEveryone+TypeFree, data = train.df) #CategoryFAMILY+CategoryART_AND_DESIGN # use options() to ensure numbers are not displayed in scientific notation. options(scipen = 999) summary(data.final.lm4) # use predict() to make predictions on a new set. data.final.lm.pred4 <- predict(data.final.lm4, valid.df) options(scipen=999, digits = 5) some.residuals <- valid.df$Rating[1:20] - data.final.lm.pred[1:20] data.frame("Predicted" = data.final.lm.pred4[1:20], "Actual" = valid.df$Rating[1:20], "Residual" = some.residuals) #accurcay of the model with all the predictors accuracy(data.final.lm.pred4, valid.df$Rating) plot(data.final.lm4) plot(data.final.lm.pred4, valid.df$Rating, xlab = "Actual", ylab = "Predcited") # use step() to run stepwise regression. # model - 4 Using backward regression data.final.lm.backward4 <- step(data.final.lm4, direction = "backward") summary(data.final.lm.backward4) # Which variables were dropped? data.final.lm.backward4.pred <- predict(data.final.lm.backward4, valid.df) accuracy(data.final.lm.backward4.pred, valid.df$Rating) # model 4 - using stepwise # use step() to run stepwise regression. data.final.lm.stepwise4 <- step(data.final.lm4, direction = "both") summary(data.final.lm.stepwise4) # Which variables were dropped/added? data.final.lm.stepwise4.pred <- predict(data.final.lm.stepwise4, valid.df) accuracy(data.final.lm.stepwise4.pred, valid.df$Rating)
library(caTools) library(caret) library(naivebayes) train <- cd[indices, ] test <- cd[!indices, ] train$flag<-as.factor(train$flag) test$flag<-as.factor(test$flag) nb <- naive_bayes(flag ~ ., train) summary(nb) predict(nb, test[,-1], type = "class") ControlParamteres <- trainControl(method = "cv", number = 5, laplace = 0, usekernel=TRUE, usepoisson = TRUE, search = "grid" ) parametersGrid <- expand.grid(eta = 0.1, colsample_bytree=c(0.5,0.7), max_depth=c(50,100), nrounds=100, gamma=1, min_child_weight=2,subsample = c(0.5, 0.6)) train$flag <- as.factor(ifelse(train$flag == 1, "Yes", "No")) test$flag <- as.factor(ifelse(test$flag == 1, "Yes", "No")) library(doParallel) library(foreach) ### Register parallel backend cl <- makeCluster(detectCores()) registerDoParallel(cl) getDoParWorkers() modelxgboost <- caret::train(flag~., data = train, method = "naive_bayes", trControl = ControlParamteres, tuneGrid=parametersGrid) stopCluster(cl) modelxgboost prediction<-stats::predict(modelxgboost,test[,-1],positive="Yes") test_conf <- caret::confusionMatrix(data=as.factor(prediction), reference=as.factor(test$flag),positive="Yes") test_conf #Accuracy : 0.7912 #Sensitivity : 0.7143 #Specificity : 0.8571 library(ROCR) library(Comp2ROC) test_cutoff_churn <- ifelse(prediction=="Yes",1,0) test_actual_churn <- ifelse(test$flag=="Yes",1,0) modeltests(test_cutoff_churn , test_actual_churn) # KS Statistics Score: 0.57 # Area Under ROC Curve: 0.79 # GINI: 0.57 #F1 Score round(F1_Score(test_actual_churn, test_cutoff_churn),digits = 2) #0.82 # Lift & Gain Chart actual_response <- factor(test_actual_churn) test_cutoff_churn<-factor(test_cutoff_churn) Churn_decile = lift(actual_response, test_cutoff_churn, groups = 10) Churn_decile #6 9 3 34 81.0 1.35
/naive_bayes-gridsearch.R
no_license
yogesh-ds/msc
R
false
false
2,296
r
library(caTools) library(caret) library(naivebayes) train <- cd[indices, ] test <- cd[!indices, ] train$flag<-as.factor(train$flag) test$flag<-as.factor(test$flag) nb <- naive_bayes(flag ~ ., train) summary(nb) predict(nb, test[,-1], type = "class") ControlParamteres <- trainControl(method = "cv", number = 5, laplace = 0, usekernel=TRUE, usepoisson = TRUE, search = "grid" ) parametersGrid <- expand.grid(eta = 0.1, colsample_bytree=c(0.5,0.7), max_depth=c(50,100), nrounds=100, gamma=1, min_child_weight=2,subsample = c(0.5, 0.6)) train$flag <- as.factor(ifelse(train$flag == 1, "Yes", "No")) test$flag <- as.factor(ifelse(test$flag == 1, "Yes", "No")) library(doParallel) library(foreach) ### Register parallel backend cl <- makeCluster(detectCores()) registerDoParallel(cl) getDoParWorkers() modelxgboost <- caret::train(flag~., data = train, method = "naive_bayes", trControl = ControlParamteres, tuneGrid=parametersGrid) stopCluster(cl) modelxgboost prediction<-stats::predict(modelxgboost,test[,-1],positive="Yes") test_conf <- caret::confusionMatrix(data=as.factor(prediction), reference=as.factor(test$flag),positive="Yes") test_conf #Accuracy : 0.7912 #Sensitivity : 0.7143 #Specificity : 0.8571 library(ROCR) library(Comp2ROC) test_cutoff_churn <- ifelse(prediction=="Yes",1,0) test_actual_churn <- ifelse(test$flag=="Yes",1,0) modeltests(test_cutoff_churn , test_actual_churn) # KS Statistics Score: 0.57 # Area Under ROC Curve: 0.79 # GINI: 0.57 #F1 Score round(F1_Score(test_actual_churn, test_cutoff_churn),digits = 2) #0.82 # Lift & Gain Chart actual_response <- factor(test_actual_churn) test_cutoff_churn<-factor(test_cutoff_churn) Churn_decile = lift(actual_response, test_cutoff_churn, groups = 10) Churn_decile #6 9 3 34 81.0 1.35
# -*- tab-width:2;indent-tabs-mode:t;show-trailing-whitespace:t;rm-trailing-spaces:t -*- # vi: set ts=2 noet: # # (c) Copyright Rosetta Commons Member Institutions. # (c) This file is part of the Rosetta software suite and is made available under license. # (c) The Rosetta software is developed by the contributing members of the Rosetta Commons. # (c) For more information, see http://www.rosettacommons.org. Questions about this can be # (c) addressed to University of Washington UW TechTransfer, email: license@u.washington.edu. library(reshape2) library(ggplot2) source("../../plots/hbonds/hbond_geo_dim_scales.R") feature_analyses <- c(feature_analyses, methods::new("FeaturesAnalysis", id = "AHD_cdf_75", author = "Matthew O'Meara", brief_description = "", feature_reporter_dependencies = c("HBondFeatures"), run=function(self, sample_sources, output_dir, output_formats){ sele <-" SELECT geom.cosAHD, acc.HBChemType AS acc_chem_type, don.HBChemType AS don_chem_type FROM hbonds AS hb, hbond_geom_coords AS geom, hbond_sites AS don, hbond_sites AS acc, hbond_sites_pdb AS don_pdb, hbond_sites_pdb AS acc_pdb WHERE geom.struct_id = hb.struct_id AND geom.hbond_id = hb.hbond_id AND don.struct_id = hb.struct_id AND don.site_id = hb.don_id AND acc.struct_id = hb.struct_id AND acc.site_id = hb.acc_id AND don_pdb.struct_id = hb.struct_id AND don_pdb.site_id = hb.don_id AND don_pdb.heavy_atom_temperature < 30 AND acc_pdb.struct_id = hb.struct_id AND acc_pdb.site_id = hb.acc_id AND acc_pdb.heavy_atom_temperature < 30 AND ABS(don.resNum - acc.resNum) > 4;" f <- query_sample_sources(sample_sources, sele) f <- transform(f, don_chem_type_name = don_chem_type_name_linear(don_chem_type), acc_chem_type_name = acc_chem_type_name_linear(acc_chem_type), AHD=acos(cosAHD)) f <- na.omit(f, method="r") ref_ss <- sample_sources[sample_sources$reference, "sample_source"] if(length(ref_ss) != 1) { stop("ERROR: This analysis script requires a single reference sample source") } new_ss <- sample_sources[!sample_sources$reference,"sample_source"] cdf.don <- compute_quantiles(f[f$acc_chem_type != "hbacc_PBA",], c("sample_source", "don_chem_type_name"), "AHD") names(cdf.don)[2] <- "chem_type_name" cdf.acc <- compute_quantiles(f[f$don_chem_type != "hbdon_PBA",], c("sample_source", "acc_chem_type_name"), "AHD") names(cdf.acc)[2] <- "chem_type_name" cdf.chem <- rbind(cdf.don, cdf.acc) cdf.chem$quantiles <- cdf.chem$quantiles * 180/pi t <- dcast(cdf.chem, chem_type_name + probs ~ sample_source, value="quantiles") table_id <- "AHD_cdf_don_or_acc_chem_type" table_title <- "A-H-D Angle containing 75% of H-Bonds (Degrees)\nB-Factor < 30, SeqSep > 4, SC-Partner" save_tables(self, t, table_id, sample_sources, output_dir, output_formats, caption=table_title, caption.placement="top") ########################## cdf.ref <- cdf.chem[cdf.chem$sample_source == ref_ss,c("sample_source", "chem_type_name", "quantiles")] names(cdf.ref)[1] <- "ref_sample_source" names(cdf.ref)[3] <- "ref_quantile" cdf.new <- cdf.chem[cdf.chem$sample_source %in% new_ss,c("sample_source", "chem_type_name", "quantiles")] names(cdf.new)[1] <- "new_sample_source" names(cdf.new)[3] <- "new_quantile" cdf.chem_ref_new <- merge(cdf.new, cdf.ref) plot_id <- "AHD_cdf_don_or_acc_chem_type_qq" p <- ggplot(data=cdf.chem_ref_new) + theme_bw() + geom_abline(slope=1) + geom_point(aes(x=ref_quantile, y=new_quantile, colour=new_sample_source)) + coord_equal(ratio=1) + scale_x_continuous( paste("A-H-D Angle (Degrees), Ref: ", ref_ss, sep="")) + scale_y_continuous(paste("A-H-D Angle Candidate", sep="")) + scale_colour_discrete("") + ggtitle("A-H-D Angle Containing 75% of H-Bonds\n\nB-Factor < 30, SeqSep > 4, SC-Partner") if(length(new_ss) <= 3){ p <- p + theme(legend.position="bottom", legend.direction="horizontal") } alt_output_formats <- transform(output_formats, width=height*.65) save_plots(self, plot_id, sample_sources, output_dir, alt_output_formats) plot_id <- "AHD_cdf_don_or_acc_chem_type_qq_text" p <- ggplot(data=cdf.chem_ref_new) + theme_bw() + geom_abline(slope=1) + geom_text(aes(x=ref_quantile, y=new_quantile, colour=new_sample_source, label=chem_type_name), size=2) + # coord_equal(ratio=1) + scale_x_continuous( paste("A-H-D Angle (Degrees), Ref: ", ref_ss, sep="")) + scale_y_continuous(paste("A-H-D Angle Candidate", sep="")) + scale_colour_discrete("") + ggtitle("A-H-D Angle Containing 75% of H-Bonds\n\nB-Factor < 30, SeqSep > 4, SC-Partner") if(length(new_ss) <= 3){ p <- p + theme(legend.position="bottom", legend.direction="horizontal") } #alt_output_formats <- transform(output_formats, width=height*.65) save_plots(self, plot_id, sample_sources, output_dir, output_formats) # ####################################### # #modes.all <- estimate_primary_modes_1d(f, c("sample_source", "don_chem_type_name", "acc_chem_type_name"), "AHdist") # #t <- dcast(modes.all, don_chem_type_name + acc_chem_type_name ~ sample_source, value="primary_mode") # #ref_ss <- sample_sources[sample_sources$reference, "sample_source"] #if(length(ref_ss) != 1) { # stop("ERROR: This analysis script requires a single reference sample source") #} #new_ss <- sample_sources[!sample_sources$reference,"sample_source"] # #modes.all.ref <- modes.all[modes.all$sample_source == ref_ss,] #names(modes.all.ref)[1] <- "ref_sample_source" #names(modes.all.ref)[4] <- "ref_primary_mode" #modes.all.new <- modes.all[modes.all$sample_source %in% new_ss,] #names(modes.all.new)[1] <- "new_sample_source" #names(modes.all.new)[4] <- "new_primary_mode" #modes.all <- merge(modes.all.new, modes.all.ref) # #plot_id <- "AHdist_primary_mode_by_don_acc_chem_type" #p <- ggplot(data=modes.all) + theme_bw() + # geom_abline(slope=1) + # geom_point(aes(x=ref_primary_mode, y=new_primary_mode, colour=new_sample_source)) + # coord_equal(ratio=1) + # scale_x_continuous( # paste("A-H Length (A), Ref: ", ref_ss, sep="")) + # scale_y_continuous(paste("A-H Length (A) Candidate", sep="")) + # scale_colour_discrete("") + # ggtitle("A-H Lengths: Reference vs Candidate Sample Source\nGrouped by Donor and Acceptor Chemical Types") # #if(length(new_ss) <= 3){ # p <- p + theme(legend.position="bottom", legend.direction="horizontal") #} # #alt_output_formats <- transform(output_formats, width=height*.8) #save_plots(self, plot_id, sample_sources, output_dir, alt_output_formats) # # #plot_id <- "AHdist_primary_mode_by_don_acc_chem_type_text" #p <- ggplot(data=modes.all) + theme_bw() + # geom_abline(slope=1) + # geom_text(aes(x=ref_primary_mode, y=new_primary_mode, colour=new_sample_source, label=interaction(don_chem_type_name, acc_chem_type_name, sep="\n")), size=2) + # coord_equal(ratio=1) + # scale_x_continuous( # paste("A-H Length (A), Ref: ", ref_ss, sep="")) + # scale_y_continuous(paste("A-H Length (A) Candidate", sep="")) + # scale_colour_discrete("") + # ggtitle("A-H Lengths: Reference vs Candidate Sample Source\nGrouped by Donor and Acceptor Chemical Types") # #if(length(new_ss) <= 3){ # p <- p + theme(legend.position="bottom", legend.direction="horizontal") #} # #alt_output_formats <- transform(output_formats, width=height*.8) #save_plots(self, plot_id, sample_sources, output_dir, alt_output_formats) })) # end FeaturesAnalysis
/inst/scripts/analysis/statistics/hbonds/AHD_cdf_75.R
no_license
momeara/RosettaFeatures
R
false
false
7,276
r
# -*- tab-width:2;indent-tabs-mode:t;show-trailing-whitespace:t;rm-trailing-spaces:t -*- # vi: set ts=2 noet: # # (c) Copyright Rosetta Commons Member Institutions. # (c) This file is part of the Rosetta software suite and is made available under license. # (c) The Rosetta software is developed by the contributing members of the Rosetta Commons. # (c) For more information, see http://www.rosettacommons.org. Questions about this can be # (c) addressed to University of Washington UW TechTransfer, email: license@u.washington.edu. library(reshape2) library(ggplot2) source("../../plots/hbonds/hbond_geo_dim_scales.R") feature_analyses <- c(feature_analyses, methods::new("FeaturesAnalysis", id = "AHD_cdf_75", author = "Matthew O'Meara", brief_description = "", feature_reporter_dependencies = c("HBondFeatures"), run=function(self, sample_sources, output_dir, output_formats){ sele <-" SELECT geom.cosAHD, acc.HBChemType AS acc_chem_type, don.HBChemType AS don_chem_type FROM hbonds AS hb, hbond_geom_coords AS geom, hbond_sites AS don, hbond_sites AS acc, hbond_sites_pdb AS don_pdb, hbond_sites_pdb AS acc_pdb WHERE geom.struct_id = hb.struct_id AND geom.hbond_id = hb.hbond_id AND don.struct_id = hb.struct_id AND don.site_id = hb.don_id AND acc.struct_id = hb.struct_id AND acc.site_id = hb.acc_id AND don_pdb.struct_id = hb.struct_id AND don_pdb.site_id = hb.don_id AND don_pdb.heavy_atom_temperature < 30 AND acc_pdb.struct_id = hb.struct_id AND acc_pdb.site_id = hb.acc_id AND acc_pdb.heavy_atom_temperature < 30 AND ABS(don.resNum - acc.resNum) > 4;" f <- query_sample_sources(sample_sources, sele) f <- transform(f, don_chem_type_name = don_chem_type_name_linear(don_chem_type), acc_chem_type_name = acc_chem_type_name_linear(acc_chem_type), AHD=acos(cosAHD)) f <- na.omit(f, method="r") ref_ss <- sample_sources[sample_sources$reference, "sample_source"] if(length(ref_ss) != 1) { stop("ERROR: This analysis script requires a single reference sample source") } new_ss <- sample_sources[!sample_sources$reference,"sample_source"] cdf.don <- compute_quantiles(f[f$acc_chem_type != "hbacc_PBA",], c("sample_source", "don_chem_type_name"), "AHD") names(cdf.don)[2] <- "chem_type_name" cdf.acc <- compute_quantiles(f[f$don_chem_type != "hbdon_PBA",], c("sample_source", "acc_chem_type_name"), "AHD") names(cdf.acc)[2] <- "chem_type_name" cdf.chem <- rbind(cdf.don, cdf.acc) cdf.chem$quantiles <- cdf.chem$quantiles * 180/pi t <- dcast(cdf.chem, chem_type_name + probs ~ sample_source, value="quantiles") table_id <- "AHD_cdf_don_or_acc_chem_type" table_title <- "A-H-D Angle containing 75% of H-Bonds (Degrees)\nB-Factor < 30, SeqSep > 4, SC-Partner" save_tables(self, t, table_id, sample_sources, output_dir, output_formats, caption=table_title, caption.placement="top") ########################## cdf.ref <- cdf.chem[cdf.chem$sample_source == ref_ss,c("sample_source", "chem_type_name", "quantiles")] names(cdf.ref)[1] <- "ref_sample_source" names(cdf.ref)[3] <- "ref_quantile" cdf.new <- cdf.chem[cdf.chem$sample_source %in% new_ss,c("sample_source", "chem_type_name", "quantiles")] names(cdf.new)[1] <- "new_sample_source" names(cdf.new)[3] <- "new_quantile" cdf.chem_ref_new <- merge(cdf.new, cdf.ref) plot_id <- "AHD_cdf_don_or_acc_chem_type_qq" p <- ggplot(data=cdf.chem_ref_new) + theme_bw() + geom_abline(slope=1) + geom_point(aes(x=ref_quantile, y=new_quantile, colour=new_sample_source)) + coord_equal(ratio=1) + scale_x_continuous( paste("A-H-D Angle (Degrees), Ref: ", ref_ss, sep="")) + scale_y_continuous(paste("A-H-D Angle Candidate", sep="")) + scale_colour_discrete("") + ggtitle("A-H-D Angle Containing 75% of H-Bonds\n\nB-Factor < 30, SeqSep > 4, SC-Partner") if(length(new_ss) <= 3){ p <- p + theme(legend.position="bottom", legend.direction="horizontal") } alt_output_formats <- transform(output_formats, width=height*.65) save_plots(self, plot_id, sample_sources, output_dir, alt_output_formats) plot_id <- "AHD_cdf_don_or_acc_chem_type_qq_text" p <- ggplot(data=cdf.chem_ref_new) + theme_bw() + geom_abline(slope=1) + geom_text(aes(x=ref_quantile, y=new_quantile, colour=new_sample_source, label=chem_type_name), size=2) + # coord_equal(ratio=1) + scale_x_continuous( paste("A-H-D Angle (Degrees), Ref: ", ref_ss, sep="")) + scale_y_continuous(paste("A-H-D Angle Candidate", sep="")) + scale_colour_discrete("") + ggtitle("A-H-D Angle Containing 75% of H-Bonds\n\nB-Factor < 30, SeqSep > 4, SC-Partner") if(length(new_ss) <= 3){ p <- p + theme(legend.position="bottom", legend.direction="horizontal") } #alt_output_formats <- transform(output_formats, width=height*.65) save_plots(self, plot_id, sample_sources, output_dir, output_formats) # ####################################### # #modes.all <- estimate_primary_modes_1d(f, c("sample_source", "don_chem_type_name", "acc_chem_type_name"), "AHdist") # #t <- dcast(modes.all, don_chem_type_name + acc_chem_type_name ~ sample_source, value="primary_mode") # #ref_ss <- sample_sources[sample_sources$reference, "sample_source"] #if(length(ref_ss) != 1) { # stop("ERROR: This analysis script requires a single reference sample source") #} #new_ss <- sample_sources[!sample_sources$reference,"sample_source"] # #modes.all.ref <- modes.all[modes.all$sample_source == ref_ss,] #names(modes.all.ref)[1] <- "ref_sample_source" #names(modes.all.ref)[4] <- "ref_primary_mode" #modes.all.new <- modes.all[modes.all$sample_source %in% new_ss,] #names(modes.all.new)[1] <- "new_sample_source" #names(modes.all.new)[4] <- "new_primary_mode" #modes.all <- merge(modes.all.new, modes.all.ref) # #plot_id <- "AHdist_primary_mode_by_don_acc_chem_type" #p <- ggplot(data=modes.all) + theme_bw() + # geom_abline(slope=1) + # geom_point(aes(x=ref_primary_mode, y=new_primary_mode, colour=new_sample_source)) + # coord_equal(ratio=1) + # scale_x_continuous( # paste("A-H Length (A), Ref: ", ref_ss, sep="")) + # scale_y_continuous(paste("A-H Length (A) Candidate", sep="")) + # scale_colour_discrete("") + # ggtitle("A-H Lengths: Reference vs Candidate Sample Source\nGrouped by Donor and Acceptor Chemical Types") # #if(length(new_ss) <= 3){ # p <- p + theme(legend.position="bottom", legend.direction="horizontal") #} # #alt_output_formats <- transform(output_formats, width=height*.8) #save_plots(self, plot_id, sample_sources, output_dir, alt_output_formats) # # #plot_id <- "AHdist_primary_mode_by_don_acc_chem_type_text" #p <- ggplot(data=modes.all) + theme_bw() + # geom_abline(slope=1) + # geom_text(aes(x=ref_primary_mode, y=new_primary_mode, colour=new_sample_source, label=interaction(don_chem_type_name, acc_chem_type_name, sep="\n")), size=2) + # coord_equal(ratio=1) + # scale_x_continuous( # paste("A-H Length (A), Ref: ", ref_ss, sep="")) + # scale_y_continuous(paste("A-H Length (A) Candidate", sep="")) + # scale_colour_discrete("") + # ggtitle("A-H Lengths: Reference vs Candidate Sample Source\nGrouped by Donor and Acceptor Chemical Types") # #if(length(new_ss) <= 3){ # p <- p + theme(legend.position="bottom", legend.direction="horizontal") #} # #alt_output_formats <- transform(output_formats, width=height*.8) #save_plots(self, plot_id, sample_sources, output_dir, alt_output_formats) })) # end FeaturesAnalysis
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/binomial.R \name{bin_mode} \alias{bin_mode} \title{bin_mode} \usage{ bin_mode(trials, prob) } \arguments{ \item{trials}{the number of (fixed) trials} \item{prob}{the probability of success on each trial} } \value{ the mode of the binomial distribution } \description{ calculates the mode of the binomial distribution } \examples{ bin_mode(10, 0.3) }
/binomial/man/bin_mode.Rd
no_license
stat133-sp19/hw-stat133-ycycchen
R
false
true
429
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/binomial.R \name{bin_mode} \alias{bin_mode} \title{bin_mode} \usage{ bin_mode(trials, prob) } \arguments{ \item{trials}{the number of (fixed) trials} \item{prob}{the probability of success on each trial} } \value{ the mode of the binomial distribution } \description{ calculates the mode of the binomial distribution } \examples{ bin_mode(10, 0.3) }
library(raster) library(sp) reprojectAndCrop <- function(raster, boundary, epsg, resolution) { # crs in proj.4 format coordSys <- paste("+init=epsg:", epsg, sep = "") ## crop for 30 m resolution to reduce needed computation resources boundaries_reproj <- spTransform(boundary, crs(raster)) ext <- extent(boundaries_reproj) raster_cropped <- crop(raster, c(ext[1]-500, ext[2]+500, ext[3]-500, ext[4]+500)) # reproject reprojectedRaster <- projectRaster(raster_cropped, res=resolution, crs = coordSys, method = 'ngb') return(reprojectedRaster) } makeBinary <- function(ghsl, threshold) { # determine binary threshold class.m <- c(0, threshold, 0, threshold, 100, 1) rcl.m <- matrix(class.m, ncol = 3, byrow = T) # reclassify ghsl_threshold <- reclassify(ghsl, rcl.m) return(ghsl_threshold) } getChange <- function(ghsl_early, ghsl_late, boundary, epsg, resolution, threshold) { # reproject, crop and use threshold on ghsl data ghsl_e_crop_bin <- makeBinary(reprojectAndCrop(ghsl_early, boundary, epsg, resolution), threshold) ghsl_l_crop_bin <- makeBinary(reprojectAndCrop(ghsl_late, boundary, epsg, resolution), threshold) # find built-up change builtUpChange <- (ghsl_l_crop_bin - ghsl_e_crop_bin) plot(builtUpChange) return(builtUpChange) } getChangeFromMultitemp <- function(ghsl, boundary, epsg, resolution) { ghsl_crop <- reprojectAndCrop(ghsl, boundary, epsg, resolution) # 3-4: changed from 1990 to 2014 -> 1 # 2: not built up in any epoch -> 0 # 0, 1, 5, 6: no data, water, built up before class.m <- c(0, 1, NA, # 0-1 1, 2, 0, # 2 2, 4, 1, # 3-4 4, 6, NA) # 5-6 rcl.m <- matrix(class.m, ncol = 3, byrow = T) # reclassify ghsl_changed <- reclassify(ghsl_crop, rcl.m, include.lowest = T) plot(ghsl_changed) return(ghsl_changed) } DNtoPercentage <- function(DN) { # convert pixel values to radians rad <- (acos(DN/250)) # convert radians to percentage slope percentage <- (tan(rad)*100) return(percentage) } citySlopeAsPercentage <- function(slope_raster, boundary, epsg) { # clip and reproject slope dataset slope_reprojected <- reprojectAndCrop(slope_raster, boundary, epsg, 25) # convert to percentage slope_per <- DNtoPercentage(slope_reprojected) plot(slope_per) return(slope_per) } reclassify_landuse <- function(landuse_raster, year = 1990) { # 1: artificial # 2: crop # 3: pasture # 4: forest # 5: open / bare land # 6: water if(year == 2000) { class.m <- c(111, 142, 1, 211, 223, 2, 241, 244, 2, 231, 231, 3, 311, 313, 4, 323, 324, 4, 321, 322, 5, 331, 335, 5, 411, 422, 5, 423, 523, 6) } else { class.m <- c(1, 11, 1, 12, 17, 2, 19, 22, 2, 18, 18, 3, 23, 25, 4, 28, 29, 4, 26, 27, 5, 30, 34, 5, 35, 38, 5, 39, 44, 6) } rcl.m <- matrix(class.m, ncol = 3, byrow = T) # +1 in the 'to' column to include this value (interval will be open on the right, to be closed left) rcl.m[,2] <- rcl.m[,2]+1 # reclassify landuse_reclassified <- reclassify(landuse_raster, rcl.m, include.lowest=T, right=FALSE) return(landuse_reclassified) } cropAndReclassify_landuse <- function(landuse, boundary, epsg, resolution) { landuse_crop <- reprojectAndCrop(landuse, boundary, epsg, resolution) landuse_recl <- reclassify_landuse(landuse_crop) plot(landuse_recl) return(landuse_recl) } calc_dist_raster <- function(osm, boundaries, resolution, epsg) { # reproject vector data coordSys <- paste("+init=epsg:", epsg, sep = "") osm_reproj <- spTransform(osm, coordSys) boundaries_reproj <- spTransform(boundaries, coordSys) # get and increase extent of osm (or other vector) data ext <- extent(c(extent(boundaries_reproj)[1]-5000, extent(boundaries_reproj)[2]+5000,extent(boundaries_reproj)[3]-5000,extent(boundaries_reproj)[4]+5000)) # create raster template raster_template <- raster(ext, resolution = resolution, crs = coordSys) # rasterize vector data rasterized <- rasterize(osm_reproj, raster_template, field = 1) # calculate euclidean distances distances <- distance(rasterized) city_dist <- reprojectAndCrop(distances, boundaries, epsg, resolution) plot(city_dist) return(city_dist) } calc_builtup_density <- function(ghsl_30m, boundary, epsg, window_size) { ghsl_reprojected <- reprojectAndCrop(ghsl_30m, boundary, epsg, 30) ### reclassify to (not) built-up # 5-6: built before 1990 # 0-4: not built-up berfore 1990 class.m <- c(0, 4, 0, 4, 6, 1) rcl.m <- matrix(class.m, ncol = 3, byrow = T) ghsl_changed <- reclassify(ghsl_reprojected, rcl.m, include.lowest = T) # count cells within 7 x 7 window builtupCells <- focal(ghsl_changed, w=matrix(1, nc=window_size, nr=window_size)) builtupDensity <- (builtupCells/(window_size*window_size-1))*100 plot(builtupDensity) return(builtupDensity) } create_stack <- function(ghsl_30m, epsg, boundary, ghsl_pop, builtupDens_windowSizw, slope, landuse, road, primary_road, river, train_stations, city_center, airport) { change <- getChangeFromMultitemp(ghsl_30m, boundary, epsg, 30) builtup_density <- calc_builtup_density(ghsl_30m, boundary, epsg, builtupDens_windowSizw) pop_density <- reprojectAndCrop(ghsl_pop, boundary, epsg, 250) slope <- citySlopeAsPercentage(slope, boundary, epsg) landuse <- cropAndReclassify_landuse(landuse, boundary, epsg, 100) dist_mRoad <- calc_dist_raster(road, boundary, 120, epsg) dist_pRoad <- calc_dist_raster(primary_road, boundary, 120, epsg) dist_river <- calc_dist_raster(river, boundary, 120, epsg) dist_train <- calc_dist_raster(train_stations, boundary, 120, epsg) dist_center <- calc_dist_raster(city_center, boundary, 120, epsg) dist_airport <- calc_dist_raster(airport, boundary, 120, epsg) builtup_density <- projectRaster(builtup_density, change) pop_density <- projectRaster(pop_density, change) slope <- projectRaster(slope, change) landuse <- projectRaster(landuse, change, method = 'ngb') dist_mRoad <- projectRaster(dist_mRoad, change) dist_pRoad <- projectRaster(dist_pRoad, change) dist_river <- projectRaster(dist_river, change) dist_train <- projectRaster(dist_train, change) dist_center <- projectRaster(dist_center, change) dist_airport <- projectRaster(dist_airport, change) change_stack <- stack(change, builtup_density, pop_density, slope, landuse, dist_mRoad, dist_pRoad, dist_river, dist_train, dist_center, dist_airport) # crop and mask coordSys <- paste("+init=epsg:", epsg, sep = "") boundaries_reproj <- spTransform(boundary, coordSys) change_stack <- crop(change_stack, boundaries_reproj) change_stack <- mask(change_stack, boundaries_reproj) names(change_stack) <- c("change", "built_dens", "pop_dens", "slope", "landuse", "mRoads_dist", "pRoads_dist", "river_dist", "train_dist", "center_dist", "airport_dist") return(change_stack) }
/preparation_functions.R
no_license
jsten07/BachelorThesis
R
false
false
7,303
r
library(raster) library(sp) reprojectAndCrop <- function(raster, boundary, epsg, resolution) { # crs in proj.4 format coordSys <- paste("+init=epsg:", epsg, sep = "") ## crop for 30 m resolution to reduce needed computation resources boundaries_reproj <- spTransform(boundary, crs(raster)) ext <- extent(boundaries_reproj) raster_cropped <- crop(raster, c(ext[1]-500, ext[2]+500, ext[3]-500, ext[4]+500)) # reproject reprojectedRaster <- projectRaster(raster_cropped, res=resolution, crs = coordSys, method = 'ngb') return(reprojectedRaster) } makeBinary <- function(ghsl, threshold) { # determine binary threshold class.m <- c(0, threshold, 0, threshold, 100, 1) rcl.m <- matrix(class.m, ncol = 3, byrow = T) # reclassify ghsl_threshold <- reclassify(ghsl, rcl.m) return(ghsl_threshold) } getChange <- function(ghsl_early, ghsl_late, boundary, epsg, resolution, threshold) { # reproject, crop and use threshold on ghsl data ghsl_e_crop_bin <- makeBinary(reprojectAndCrop(ghsl_early, boundary, epsg, resolution), threshold) ghsl_l_crop_bin <- makeBinary(reprojectAndCrop(ghsl_late, boundary, epsg, resolution), threshold) # find built-up change builtUpChange <- (ghsl_l_crop_bin - ghsl_e_crop_bin) plot(builtUpChange) return(builtUpChange) } getChangeFromMultitemp <- function(ghsl, boundary, epsg, resolution) { ghsl_crop <- reprojectAndCrop(ghsl, boundary, epsg, resolution) # 3-4: changed from 1990 to 2014 -> 1 # 2: not built up in any epoch -> 0 # 0, 1, 5, 6: no data, water, built up before class.m <- c(0, 1, NA, # 0-1 1, 2, 0, # 2 2, 4, 1, # 3-4 4, 6, NA) # 5-6 rcl.m <- matrix(class.m, ncol = 3, byrow = T) # reclassify ghsl_changed <- reclassify(ghsl_crop, rcl.m, include.lowest = T) plot(ghsl_changed) return(ghsl_changed) } DNtoPercentage <- function(DN) { # convert pixel values to radians rad <- (acos(DN/250)) # convert radians to percentage slope percentage <- (tan(rad)*100) return(percentage) } citySlopeAsPercentage <- function(slope_raster, boundary, epsg) { # clip and reproject slope dataset slope_reprojected <- reprojectAndCrop(slope_raster, boundary, epsg, 25) # convert to percentage slope_per <- DNtoPercentage(slope_reprojected) plot(slope_per) return(slope_per) } reclassify_landuse <- function(landuse_raster, year = 1990) { # 1: artificial # 2: crop # 3: pasture # 4: forest # 5: open / bare land # 6: water if(year == 2000) { class.m <- c(111, 142, 1, 211, 223, 2, 241, 244, 2, 231, 231, 3, 311, 313, 4, 323, 324, 4, 321, 322, 5, 331, 335, 5, 411, 422, 5, 423, 523, 6) } else { class.m <- c(1, 11, 1, 12, 17, 2, 19, 22, 2, 18, 18, 3, 23, 25, 4, 28, 29, 4, 26, 27, 5, 30, 34, 5, 35, 38, 5, 39, 44, 6) } rcl.m <- matrix(class.m, ncol = 3, byrow = T) # +1 in the 'to' column to include this value (interval will be open on the right, to be closed left) rcl.m[,2] <- rcl.m[,2]+1 # reclassify landuse_reclassified <- reclassify(landuse_raster, rcl.m, include.lowest=T, right=FALSE) return(landuse_reclassified) } cropAndReclassify_landuse <- function(landuse, boundary, epsg, resolution) { landuse_crop <- reprojectAndCrop(landuse, boundary, epsg, resolution) landuse_recl <- reclassify_landuse(landuse_crop) plot(landuse_recl) return(landuse_recl) } calc_dist_raster <- function(osm, boundaries, resolution, epsg) { # reproject vector data coordSys <- paste("+init=epsg:", epsg, sep = "") osm_reproj <- spTransform(osm, coordSys) boundaries_reproj <- spTransform(boundaries, coordSys) # get and increase extent of osm (or other vector) data ext <- extent(c(extent(boundaries_reproj)[1]-5000, extent(boundaries_reproj)[2]+5000,extent(boundaries_reproj)[3]-5000,extent(boundaries_reproj)[4]+5000)) # create raster template raster_template <- raster(ext, resolution = resolution, crs = coordSys) # rasterize vector data rasterized <- rasterize(osm_reproj, raster_template, field = 1) # calculate euclidean distances distances <- distance(rasterized) city_dist <- reprojectAndCrop(distances, boundaries, epsg, resolution) plot(city_dist) return(city_dist) } calc_builtup_density <- function(ghsl_30m, boundary, epsg, window_size) { ghsl_reprojected <- reprojectAndCrop(ghsl_30m, boundary, epsg, 30) ### reclassify to (not) built-up # 5-6: built before 1990 # 0-4: not built-up berfore 1990 class.m <- c(0, 4, 0, 4, 6, 1) rcl.m <- matrix(class.m, ncol = 3, byrow = T) ghsl_changed <- reclassify(ghsl_reprojected, rcl.m, include.lowest = T) # count cells within 7 x 7 window builtupCells <- focal(ghsl_changed, w=matrix(1, nc=window_size, nr=window_size)) builtupDensity <- (builtupCells/(window_size*window_size-1))*100 plot(builtupDensity) return(builtupDensity) } create_stack <- function(ghsl_30m, epsg, boundary, ghsl_pop, builtupDens_windowSizw, slope, landuse, road, primary_road, river, train_stations, city_center, airport) { change <- getChangeFromMultitemp(ghsl_30m, boundary, epsg, 30) builtup_density <- calc_builtup_density(ghsl_30m, boundary, epsg, builtupDens_windowSizw) pop_density <- reprojectAndCrop(ghsl_pop, boundary, epsg, 250) slope <- citySlopeAsPercentage(slope, boundary, epsg) landuse <- cropAndReclassify_landuse(landuse, boundary, epsg, 100) dist_mRoad <- calc_dist_raster(road, boundary, 120, epsg) dist_pRoad <- calc_dist_raster(primary_road, boundary, 120, epsg) dist_river <- calc_dist_raster(river, boundary, 120, epsg) dist_train <- calc_dist_raster(train_stations, boundary, 120, epsg) dist_center <- calc_dist_raster(city_center, boundary, 120, epsg) dist_airport <- calc_dist_raster(airport, boundary, 120, epsg) builtup_density <- projectRaster(builtup_density, change) pop_density <- projectRaster(pop_density, change) slope <- projectRaster(slope, change) landuse <- projectRaster(landuse, change, method = 'ngb') dist_mRoad <- projectRaster(dist_mRoad, change) dist_pRoad <- projectRaster(dist_pRoad, change) dist_river <- projectRaster(dist_river, change) dist_train <- projectRaster(dist_train, change) dist_center <- projectRaster(dist_center, change) dist_airport <- projectRaster(dist_airport, change) change_stack <- stack(change, builtup_density, pop_density, slope, landuse, dist_mRoad, dist_pRoad, dist_river, dist_train, dist_center, dist_airport) # crop and mask coordSys <- paste("+init=epsg:", epsg, sep = "") boundaries_reproj <- spTransform(boundary, coordSys) change_stack <- crop(change_stack, boundaries_reproj) change_stack <- mask(change_stack, boundaries_reproj) names(change_stack) <- c("change", "built_dens", "pop_dens", "slope", "landuse", "mRoads_dist", "pRoads_dist", "river_dist", "train_dist", "center_dist", "airport_dist") return(change_stack) }
library(data.table) # Unzip Data # unzip("exdata_data_household_power_consumption.zip") # Read Data power <- fread("household_power_consumption.txt", na.strings=c("?")) # Note: na.strings ="?" does not work. This is a documented flaw in fread, see: # http://r.789695.n4.nabble.com/fread-coercing-to-character-when-seeing-NA-td4677209.html # Subset Data to days of interest psub <- subset(power, Date %in% c("1/2/2007", "2/2/2007")) # Coerce Data to Numeric psub$Global_active_power <- as.numeric(psub$Global_active_power) # Plot PNG file png("plot1.png", width=480, height=480) with(psub, hist(Global_active_power, col="red", xlab="Global Active Power (kilowatts)", main="Global Active Power")) dev.off()
/plot1.R
no_license
bjurban/ExData_Plotting1
R
false
false
738
r
library(data.table) # Unzip Data # unzip("exdata_data_household_power_consumption.zip") # Read Data power <- fread("household_power_consumption.txt", na.strings=c("?")) # Note: na.strings ="?" does not work. This is a documented flaw in fread, see: # http://r.789695.n4.nabble.com/fread-coercing-to-character-when-seeing-NA-td4677209.html # Subset Data to days of interest psub <- subset(power, Date %in% c("1/2/2007", "2/2/2007")) # Coerce Data to Numeric psub$Global_active_power <- as.numeric(psub$Global_active_power) # Plot PNG file png("plot1.png", width=480, height=480) with(psub, hist(Global_active_power, col="red", xlab="Global Active Power (kilowatts)", main="Global Active Power")) dev.off()
## ---- include = FALSE--------------------------------------------------------- knitr::opts_chunk$set( collapse = TRUE, comment = "#>" ) ## ---- eval = FALSE------------------------------------------------------------ # devtools::install_github("ipeaGIT/r5r", subdir = "r-package") # ## ---- message = FALSE--------------------------------------------------------- library(r5r) library(sf) library(data.table) library(ggplot2) library(mapview) ## ----------------------------------------------------------------------------- data_path <- system.file("extdata", package = "r5r") list.files(data_path) ## ----------------------------------------------------------------------------- points <- fread(system.file("extdata/poa_hexgrid.csv", package = "r5r")) points <- points[ c(sample(1:nrow(points), 10, replace=TRUE)), ] head(points) ## ---- message = FALSE, eval = FALSE------------------------------------------- # options(java.parameters = "-Xmx2G") ## ---- message = FALSE, eval = FALSE------------------------------------------- # # Indicate the path where OSM and GTFS data are stored # r5r_core <- setup_r5(data_path = data_path, verbose = FALSE) # ## ---- message = FALSE, eval = FALSE------------------------------------------- # # calculate a travel time matrix # ttm <- travel_time_matrix(r5r_core = r5r_core, # origins = points, # destinations = points, # departure_datetime = lubridate::as_datetime("2019-03-20 14:00:00", # tz = "America/Sao_Paulo"), # mode = c("WALK", "TRANSIT"), # max_walk_dist = 5000, # max_trip_duration = 120, # verbose = FALSE) # # head(ttm) ## ----ttm head, echo = FALSE, message = FALSE---------------------------------- knitr::include_graphics(system.file("img", "vig_output_ttm.png", package="r5r")) ## ---- message = FALSE, eval = FALSE------------------------------------------- # # inputs # points <- read.csv(file.path(data_path, "poa_points_of_interest.csv")) # origins <- points[10,] # destinations <- points[12,] # mode = c("WALK", "TRANSIT") # max_walk_dist <- 10000 # departure_datetime <- lubridate::as_datetime("2019-03-20 14:00:00", # tz = "America/Sao_Paulo") # # df <- detailed_itineraries(r5r_core = r5r_core, # origins, # destinations, # mode, # departure_datetime, # max_walk_dist, # shortest_path = FALSE, # verbose = FALSE) # # head(df) ## ----detailed head, echo = FALSE, message = FALSE----------------------------- knitr::include_graphics(system.file("img", "vig_output_detailed.png", package="r5r")) ## ---- message = FALSE, eval = FALSE------------------------------------------- # # extract OSM network # street_net <- street_network_to_sf(r5r_core) # # # plot # ggplot() + # geom_sf(data = street_net$edges, color='gray85') + # geom_sf(data = df, aes(color=mode)) + # facet_wrap(.~option) + # theme_void() # ## ----ggplot2 output, echo = FALSE, message = FALSE---------------------------- knitr::include_graphics(system.file("img", "vig_detailed_ggplot.png", package="r5r")) ## ---- message = FALSE, eval = FALSE------------------------------------------- # mapviewOptions(platform = 'leafgl') # mapview(df, zcol = 'option') # ## ----mapview output, echo = FALSE, message = FALSE---------------------------- knitr::include_graphics(system.file("img", "vig_detailed_mapview.png", package="r5r"))
/r-package/doc/intro_to_r5r.R
no_license
juliafagundescoc/r5r
R
false
false
3,820
r
## ---- include = FALSE--------------------------------------------------------- knitr::opts_chunk$set( collapse = TRUE, comment = "#>" ) ## ---- eval = FALSE------------------------------------------------------------ # devtools::install_github("ipeaGIT/r5r", subdir = "r-package") # ## ---- message = FALSE--------------------------------------------------------- library(r5r) library(sf) library(data.table) library(ggplot2) library(mapview) ## ----------------------------------------------------------------------------- data_path <- system.file("extdata", package = "r5r") list.files(data_path) ## ----------------------------------------------------------------------------- points <- fread(system.file("extdata/poa_hexgrid.csv", package = "r5r")) points <- points[ c(sample(1:nrow(points), 10, replace=TRUE)), ] head(points) ## ---- message = FALSE, eval = FALSE------------------------------------------- # options(java.parameters = "-Xmx2G") ## ---- message = FALSE, eval = FALSE------------------------------------------- # # Indicate the path where OSM and GTFS data are stored # r5r_core <- setup_r5(data_path = data_path, verbose = FALSE) # ## ---- message = FALSE, eval = FALSE------------------------------------------- # # calculate a travel time matrix # ttm <- travel_time_matrix(r5r_core = r5r_core, # origins = points, # destinations = points, # departure_datetime = lubridate::as_datetime("2019-03-20 14:00:00", # tz = "America/Sao_Paulo"), # mode = c("WALK", "TRANSIT"), # max_walk_dist = 5000, # max_trip_duration = 120, # verbose = FALSE) # # head(ttm) ## ----ttm head, echo = FALSE, message = FALSE---------------------------------- knitr::include_graphics(system.file("img", "vig_output_ttm.png", package="r5r")) ## ---- message = FALSE, eval = FALSE------------------------------------------- # # inputs # points <- read.csv(file.path(data_path, "poa_points_of_interest.csv")) # origins <- points[10,] # destinations <- points[12,] # mode = c("WALK", "TRANSIT") # max_walk_dist <- 10000 # departure_datetime <- lubridate::as_datetime("2019-03-20 14:00:00", # tz = "America/Sao_Paulo") # # df <- detailed_itineraries(r5r_core = r5r_core, # origins, # destinations, # mode, # departure_datetime, # max_walk_dist, # shortest_path = FALSE, # verbose = FALSE) # # head(df) ## ----detailed head, echo = FALSE, message = FALSE----------------------------- knitr::include_graphics(system.file("img", "vig_output_detailed.png", package="r5r")) ## ---- message = FALSE, eval = FALSE------------------------------------------- # # extract OSM network # street_net <- street_network_to_sf(r5r_core) # # # plot # ggplot() + # geom_sf(data = street_net$edges, color='gray85') + # geom_sf(data = df, aes(color=mode)) + # facet_wrap(.~option) + # theme_void() # ## ----ggplot2 output, echo = FALSE, message = FALSE---------------------------- knitr::include_graphics(system.file("img", "vig_detailed_ggplot.png", package="r5r")) ## ---- message = FALSE, eval = FALSE------------------------------------------- # mapviewOptions(platform = 'leafgl') # mapview(df, zcol = 'option') # ## ----mapview output, echo = FALSE, message = FALSE---------------------------- knitr::include_graphics(system.file("img", "vig_detailed_mapview.png", package="r5r"))
s1 = 10 s2 = "Hello" s3 = FALSE s4 = 1 - 3i v1 = c(3, 10 ,12) v2 = c("Taylor", "Hyuna") v3 = c(TRUE, FALSE, TRUE) v4 = c(v1 ,20, 30) v1 = 1:5 v2 = 5:1 v3 = -3.3:5 v1 = seq(from=1, to=5, by=1) v5 = sequence(10) v4 = sequence(0) v1 = rep("a", times=5) v1 = rep("a", each=5) v2 = rep(c("a", "b"), times=5, each=5) v1 = c(20, 46, 51) names(v1) = c("Hyuna", "Maria", "Taeguen") v1 weight = c(11,12,13,14) weight[1:3] weight[c(1,2)] gender = c('f','m','f','f') gender gender_factor = factor(gender) gender_factor levels(gender_factor) gender_factor2 = factor(gender, levels = c('f','m'), labels=c('female','male')) gender_factor2 gender_factor3 = factor(gender, ordered=TRUE) gender_factor3 #Matrix v1 = 1:3 v2 = 4:6 m1 = rbind(v1, v2) m2 = cbind(v1, v2) m2 m3 = matrix(1:4, nrow=2, ncol=2) m3 m4 = matrix(1:4, nrow=2, ncol=2, byrow=TRUE) m4 # v1 =1:5 m1 = matrix(1:6, nrow=2, ncol=3)
/rbind,cbind,matrix.R
no_license
Hyuna13/Rstudio
R
false
false
903
r
s1 = 10 s2 = "Hello" s3 = FALSE s4 = 1 - 3i v1 = c(3, 10 ,12) v2 = c("Taylor", "Hyuna") v3 = c(TRUE, FALSE, TRUE) v4 = c(v1 ,20, 30) v1 = 1:5 v2 = 5:1 v3 = -3.3:5 v1 = seq(from=1, to=5, by=1) v5 = sequence(10) v4 = sequence(0) v1 = rep("a", times=5) v1 = rep("a", each=5) v2 = rep(c("a", "b"), times=5, each=5) v1 = c(20, 46, 51) names(v1) = c("Hyuna", "Maria", "Taeguen") v1 weight = c(11,12,13,14) weight[1:3] weight[c(1,2)] gender = c('f','m','f','f') gender gender_factor = factor(gender) gender_factor levels(gender_factor) gender_factor2 = factor(gender, levels = c('f','m'), labels=c('female','male')) gender_factor2 gender_factor3 = factor(gender, ordered=TRUE) gender_factor3 #Matrix v1 = 1:3 v2 = 4:6 m1 = rbind(v1, v2) m2 = cbind(v1, v2) m2 m3 = matrix(1:4, nrow=2, ncol=2) m3 m4 = matrix(1:4, nrow=2, ncol=2, byrow=TRUE) m4 # v1 =1:5 m1 = matrix(1:6, nrow=2, ncol=3)
corr <- function(directory, threshold = 0) { ## 'directory' is a character vector of length 1 indicating ## the location of the CSV files ## 'threshold' is a numeric vector of length 1 indicating the ## number of completely observed observations (on all ## variables) required to compute the correlation between ## nitrate and sulfate; the default is 0 ## Return a numeric vector of correlations ## NOTE: Do not round the result! id<-1:332 path<-paste(directory,"/",sprintf("%03d",id),".csv",sep="") crr<-vector(mode="numeric",length = 0) for (i in 1:length(id)) { temp<-read.csv(path[i]) nobs=nrow(temp[complete.cases(temp),]) if (nobs>threshold) { crr<-c(crr,cor(temp["sulfate"],temp["nitrate"],use="complete.obs")) } } return(crr) }
/corr.R
no_license
arjun-gndu-2003/rcourseera
R
false
false
812
r
corr <- function(directory, threshold = 0) { ## 'directory' is a character vector of length 1 indicating ## the location of the CSV files ## 'threshold' is a numeric vector of length 1 indicating the ## number of completely observed observations (on all ## variables) required to compute the correlation between ## nitrate and sulfate; the default is 0 ## Return a numeric vector of correlations ## NOTE: Do not round the result! id<-1:332 path<-paste(directory,"/",sprintf("%03d",id),".csv",sep="") crr<-vector(mode="numeric",length = 0) for (i in 1:length(id)) { temp<-read.csv(path[i]) nobs=nrow(temp[complete.cases(temp),]) if (nobs>threshold) { crr<-c(crr,cor(temp["sulfate"],temp["nitrate"],use="complete.obs")) } } return(crr) }
library(pdftools) library(tidyverse) library(tabulizer) library(haven) library(geojsonio) library(sf) # Proof of concept pdf scraping # extract table sections chosen for extract_areas only include data within "Governorates" section excluding the line with "Governorates" # File is available in google docs https://drive.google.com/file/d/1jJwf9u04yqiG6GYfIVaBJJqLPXGyobtu/view?usp=sharing pdf_file <- "Iraq/Iraq 2018 MICS SFR English Volume I - 22 Sep 20.pdf" wealth_index_quantiles <- extract_areas(pdf_file, pages = 51) # wealth_index_quantiles <- extract_tables(pdf_file, pages = 51) wealth_index_quantiles <- wealth_index_quantiles[[1]] wealth_index_quantiles <- as.data.frame(wealth_index_quantiles) wealth_index_quantiles <- wealth_index_quantiles %>% rename(poorest = V2, second = V3, middle = V4, fourth = V5, richest = V6, total_wealth = V7, number_of_household_members = V8, governorates = V1) %>% filter_all(all_vars(!is.na(.))) woman_literacy <- as.data.frame(extract_areas(pdf_file, pages = 60)[[1]]) woman_literacy <- woman_literacy %>% rename(governorates = V1, pre_primary_literate = V2, pre_primary_illiterate = V3, primary_literate = V4, primary_illiterate = V5, lower_secondary_literate = V6, secondary_or_higher_literate = V7, total_woman_literacy = V8, total_percentage_woman_literate = V9, number_of_women_15_to_49_years = V10 ) childhood_mortality <- as.data.frame(extract_areas(pdf_file, pages = 86)[[1]]) childhood_mortality <- childhood_mortality %>% rename( governorates = V1, neonatal_mortality_rate = V2, post_natal_mortality_rate = V3, infant_mortality_rate = V4, child_mortality_rate = V5, under_5_mortality_rate = V6 ) df <- wealth_index_quantiles %>% full_join(woman_literacy, by = "governorates") %>% full_join(childhood_mortality, by = "governorates") %>% filter(governorates != "Kerbala") %>% mutate( governorates = case_when( governorates == "Duhok" ~ "Dohuk", governorates == "Nainawa" ~ "Nineveh", governorates == "Sulaimaniya" ~ "Sulaymaniyah", governorates == "Diala" ~ "Diyala", governorates == "Anbar" ~ "Al Anbar", governorates == "Karbalah" ~ "Karbala", governorates == "Salahaddin" ~ "Saladin", governorates == "Qadissiyah" ~ "Al-Qadisiyah", governorates == "Muthana" ~ "Muthanna", governorates == "Thiqar" ~ "Dhi Qar", governorates == "Missan" ~ "Maysan", TRUE ~ governorates ) ) write.csv(df, "Iraq/subset_mics.csv") # From MakeCountryBoundaries.R -------------------------------------------- worldadm1<-topojson_read("https://www.geoboundaries.org/data/geoBoundariesCGAZ-3_0_0/ADM1/simplifyRatio_25/geoBoundariesCGAZ_ADM1.topojson") IRQ1<-worldadm1%>% filter(shapeGroup=="IRQ") IRQ1 <- IRQ1 %>% left_join(df, by = c("shapeName" = "governorates")) # %>% # pivot_longer( # cols = !!(names(df)[2:length(names(df))]), # names_to = "variable", # values_to = "measure" # ) %>% # mutate( # var_type = case_when( # variable %in% names(woman_literacy) ~ "woman_literacy", # variable %in% names(wealth_index_quantiles) ~ "wealth_index_quantiles", # variable %in% names(childhood_mortality) ~ "childhood_mortality" # ) # ) ggplot(IRQ1) + geom_sf(aes(fill = as.numeric(total_percentage_woman_literate))) + ggtitle("Total Percentage of Literate Woman") + labs(fill = "% Womany Literate") ggplot(IRQ1) + geom_sf(aes(fill = as.numeric(poorest))) + ggtitle("% of Goverorate in Poorest Wealth Quinitile") + labs(fill = "% in Poorest Quintile") ggplot(IRQ1) + geom_sf(aes(fill = as.numeric(neonatal_mortality_rate))) + ggtitle("Neonatal mortality") + labs(fill = "Neonatal mortality rate") # woman <- read_sav("Iraq/wm.sav") # child <- read_sav("Iraq/ch.sav") # births <- read_sav("Iraq/bh.sav") # womanchild <- read_sav("Iraq/fs.sav") # female_mut <- read_sav("Iraq/fg.sav") # household <- read_sav("Iraq/hh.sav") # members <- read_sav("Iraq/hl.sav") # mort <- read_sav("Iraq/mm.sav")
/Scripts/mics_survey_scraping_iraq.R
permissive
luigi-0/Mar21-humanitarian-data
R
false
false
4,185
r
library(pdftools) library(tidyverse) library(tabulizer) library(haven) library(geojsonio) library(sf) # Proof of concept pdf scraping # extract table sections chosen for extract_areas only include data within "Governorates" section excluding the line with "Governorates" # File is available in google docs https://drive.google.com/file/d/1jJwf9u04yqiG6GYfIVaBJJqLPXGyobtu/view?usp=sharing pdf_file <- "Iraq/Iraq 2018 MICS SFR English Volume I - 22 Sep 20.pdf" wealth_index_quantiles <- extract_areas(pdf_file, pages = 51) # wealth_index_quantiles <- extract_tables(pdf_file, pages = 51) wealth_index_quantiles <- wealth_index_quantiles[[1]] wealth_index_quantiles <- as.data.frame(wealth_index_quantiles) wealth_index_quantiles <- wealth_index_quantiles %>% rename(poorest = V2, second = V3, middle = V4, fourth = V5, richest = V6, total_wealth = V7, number_of_household_members = V8, governorates = V1) %>% filter_all(all_vars(!is.na(.))) woman_literacy <- as.data.frame(extract_areas(pdf_file, pages = 60)[[1]]) woman_literacy <- woman_literacy %>% rename(governorates = V1, pre_primary_literate = V2, pre_primary_illiterate = V3, primary_literate = V4, primary_illiterate = V5, lower_secondary_literate = V6, secondary_or_higher_literate = V7, total_woman_literacy = V8, total_percentage_woman_literate = V9, number_of_women_15_to_49_years = V10 ) childhood_mortality <- as.data.frame(extract_areas(pdf_file, pages = 86)[[1]]) childhood_mortality <- childhood_mortality %>% rename( governorates = V1, neonatal_mortality_rate = V2, post_natal_mortality_rate = V3, infant_mortality_rate = V4, child_mortality_rate = V5, under_5_mortality_rate = V6 ) df <- wealth_index_quantiles %>% full_join(woman_literacy, by = "governorates") %>% full_join(childhood_mortality, by = "governorates") %>% filter(governorates != "Kerbala") %>% mutate( governorates = case_when( governorates == "Duhok" ~ "Dohuk", governorates == "Nainawa" ~ "Nineveh", governorates == "Sulaimaniya" ~ "Sulaymaniyah", governorates == "Diala" ~ "Diyala", governorates == "Anbar" ~ "Al Anbar", governorates == "Karbalah" ~ "Karbala", governorates == "Salahaddin" ~ "Saladin", governorates == "Qadissiyah" ~ "Al-Qadisiyah", governorates == "Muthana" ~ "Muthanna", governorates == "Thiqar" ~ "Dhi Qar", governorates == "Missan" ~ "Maysan", TRUE ~ governorates ) ) write.csv(df, "Iraq/subset_mics.csv") # From MakeCountryBoundaries.R -------------------------------------------- worldadm1<-topojson_read("https://www.geoboundaries.org/data/geoBoundariesCGAZ-3_0_0/ADM1/simplifyRatio_25/geoBoundariesCGAZ_ADM1.topojson") IRQ1<-worldadm1%>% filter(shapeGroup=="IRQ") IRQ1 <- IRQ1 %>% left_join(df, by = c("shapeName" = "governorates")) # %>% # pivot_longer( # cols = !!(names(df)[2:length(names(df))]), # names_to = "variable", # values_to = "measure" # ) %>% # mutate( # var_type = case_when( # variable %in% names(woman_literacy) ~ "woman_literacy", # variable %in% names(wealth_index_quantiles) ~ "wealth_index_quantiles", # variable %in% names(childhood_mortality) ~ "childhood_mortality" # ) # ) ggplot(IRQ1) + geom_sf(aes(fill = as.numeric(total_percentage_woman_literate))) + ggtitle("Total Percentage of Literate Woman") + labs(fill = "% Womany Literate") ggplot(IRQ1) + geom_sf(aes(fill = as.numeric(poorest))) + ggtitle("% of Goverorate in Poorest Wealth Quinitile") + labs(fill = "% in Poorest Quintile") ggplot(IRQ1) + geom_sf(aes(fill = as.numeric(neonatal_mortality_rate))) + ggtitle("Neonatal mortality") + labs(fill = "Neonatal mortality rate") # woman <- read_sav("Iraq/wm.sav") # child <- read_sav("Iraq/ch.sav") # births <- read_sav("Iraq/bh.sav") # womanchild <- read_sav("Iraq/fs.sav") # female_mut <- read_sav("Iraq/fg.sav") # household <- read_sav("Iraq/hh.sav") # members <- read_sav("Iraq/hl.sav") # mort <- read_sav("Iraq/mm.sav")
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/eval_forecasts.R \name{eval_forecasts} \alias{eval_forecasts} \title{Evaluate forecasts} \usage{ eval_forecasts( true_values, predictions, prediction_type = "probabilistic", outcome_type = "integer", metrics = NULL, output = "df" ) } \arguments{ \item{true_values}{A vector with the true observed values of size n} \item{predictions}{a list of appropriate predictions. Every item in the list corresponds to the predictions made by one model. Appropriate dimensions and input types are: \itemize{ \item for probabilistic integer and continuous forecasts: a matrix or data.frame of size nxN of predictive samples. n (number of rows) being the number of observed values to predict and N (number of columns) the number of Monte Carlo samples \item for probabilistic binary forecasts: a vector of length n that gives the probability that the corresponding element in \code{true_values} will be equal to one. \item for all point estimates: a vector of size n with predictions for the corresponding entries of \code{true_values}}} \item{prediction_type}{Type of the prediction made. Can be eitehr "probabilitic" or "point" for point predictions.} \item{outcome_type}{type of the variable to be predicted. Can be either "integer" or "continuous" or "binary".} \item{metrics}{what metrics to include. Currently not used, as all metrics are displayed} \item{output}{specify the format of the output. Can be either "df" (returns a single data.frame) or anything else (returns a list of data.frames)} } \value{ output option "df" returns a single data.frame with the prediction results. Rownames of the data.frame correspond to the metric applied for the scoring. \code{mean} and \code{sd} are the mean and standard deviations of the scores achieved by the predictions for every single value of \code{true_values}. Only in the case of the \code{\link{pit}}, \code{mean} and \code{sd} return the mean and standard deviation of the Replicates of the Randomised PIT. If everything else than "df" is specified, the above results are returned as a list of data.frames for the different metrics. } \description{ The function \code{eval_forecasts} is a wrapper that provides an interface to lower-level functions. It can be used to assess the goodness of probabilistic or point forecasts to continues, integer-valued or binary variables. The lower-level functions accessed are: \enumerate{ \item \code{\link{eval_forecasts_prob_int}} \item \code{\link{eval_forecasts_prob_cont}} \item \code{\link{eval_forecasts_prob_bin}} \item \code{\link{eval_forecasts_point_int}} \item \code{\link{eval_forecasts_point_cont}} \item \code{\link{eval_forecasts_point_bin}} } } \references{ Funk S, Camacho A, Kucharski AJ, Lowe R, Eggo RM, Edmunds WJ (2019) Assessing the performance of real-time epidemic forecasts: A case study of Ebola in the Western Area region of Sierra Leone, 2014-15. PLoS Comput Biol 15(2): e1006785. \url{https://doi.org/10.1371/journal.pcbi.1006785} } \author{ Nikos Bosse \email{nikosbosse@gmail.com} }
/man/eval_forecasts.Rd
permissive
laasousa/scoringutils
R
false
true
3,126
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/eval_forecasts.R \name{eval_forecasts} \alias{eval_forecasts} \title{Evaluate forecasts} \usage{ eval_forecasts( true_values, predictions, prediction_type = "probabilistic", outcome_type = "integer", metrics = NULL, output = "df" ) } \arguments{ \item{true_values}{A vector with the true observed values of size n} \item{predictions}{a list of appropriate predictions. Every item in the list corresponds to the predictions made by one model. Appropriate dimensions and input types are: \itemize{ \item for probabilistic integer and continuous forecasts: a matrix or data.frame of size nxN of predictive samples. n (number of rows) being the number of observed values to predict and N (number of columns) the number of Monte Carlo samples \item for probabilistic binary forecasts: a vector of length n that gives the probability that the corresponding element in \code{true_values} will be equal to one. \item for all point estimates: a vector of size n with predictions for the corresponding entries of \code{true_values}}} \item{prediction_type}{Type of the prediction made. Can be eitehr "probabilitic" or "point" for point predictions.} \item{outcome_type}{type of the variable to be predicted. Can be either "integer" or "continuous" or "binary".} \item{metrics}{what metrics to include. Currently not used, as all metrics are displayed} \item{output}{specify the format of the output. Can be either "df" (returns a single data.frame) or anything else (returns a list of data.frames)} } \value{ output option "df" returns a single data.frame with the prediction results. Rownames of the data.frame correspond to the metric applied for the scoring. \code{mean} and \code{sd} are the mean and standard deviations of the scores achieved by the predictions for every single value of \code{true_values}. Only in the case of the \code{\link{pit}}, \code{mean} and \code{sd} return the mean and standard deviation of the Replicates of the Randomised PIT. If everything else than "df" is specified, the above results are returned as a list of data.frames for the different metrics. } \description{ The function \code{eval_forecasts} is a wrapper that provides an interface to lower-level functions. It can be used to assess the goodness of probabilistic or point forecasts to continues, integer-valued or binary variables. The lower-level functions accessed are: \enumerate{ \item \code{\link{eval_forecasts_prob_int}} \item \code{\link{eval_forecasts_prob_cont}} \item \code{\link{eval_forecasts_prob_bin}} \item \code{\link{eval_forecasts_point_int}} \item \code{\link{eval_forecasts_point_cont}} \item \code{\link{eval_forecasts_point_bin}} } } \references{ Funk S, Camacho A, Kucharski AJ, Lowe R, Eggo RM, Edmunds WJ (2019) Assessing the performance of real-time epidemic forecasts: A case study of Ebola in the Western Area region of Sierra Leone, 2014-15. PLoS Comput Biol 15(2): e1006785. \url{https://doi.org/10.1371/journal.pcbi.1006785} } \author{ Nikos Bosse \email{nikosbosse@gmail.com} }
\name{rp.univar} \alias{rp.univar} \title{Descriptive Statistics} \usage{ rp.univar(x, subset = NULL, fn, na.rm = TRUE, ...) } \arguments{ \item{x}{a numeric variable to be summarised} \item{subset}{an expression that evaluates to logical vector (defaults to \code{NULL}, in which case the function specified in \code{fun} is applied on a vector)} \item{fn}{a function or a function name to be applied on a variable or it's subset} \item{na.rm}{a logical value indicating whether NA's should be removed (defaults to \code{TRUE})} \item{...}{additional arguments for function specified in \code{fn}} } \value{ a numeric } \description{ This function operates only on vectors or their subsets, by calculating a descriptive statistic specified in \code{fn} argument. Yielded result is rounded to 3 decimal places by default (which can be changed by passing an integer to \code{decimals} argument). }
/man/rp.univar.Rd
no_license
ramnathv/rapport
R
false
false
936
rd
\name{rp.univar} \alias{rp.univar} \title{Descriptive Statistics} \usage{ rp.univar(x, subset = NULL, fn, na.rm = TRUE, ...) } \arguments{ \item{x}{a numeric variable to be summarised} \item{subset}{an expression that evaluates to logical vector (defaults to \code{NULL}, in which case the function specified in \code{fun} is applied on a vector)} \item{fn}{a function or a function name to be applied on a variable or it's subset} \item{na.rm}{a logical value indicating whether NA's should be removed (defaults to \code{TRUE})} \item{...}{additional arguments for function specified in \code{fn}} } \value{ a numeric } \description{ This function operates only on vectors or their subsets, by calculating a descriptive statistic specified in \code{fn} argument. Yielded result is rounded to 3 decimal places by default (which can be changed by passing an integer to \code{decimals} argument). }
arg_subscript <- function(value, n, names, get) { if (missing(value) || is.null(value)) { return(NULL) } r <- length(dim(value)) if (r >= 2) { stop(sprintf("subscript is a rank-%.0f array", r)) } if (is.object(value)) { vnames <- names(value) if (is.numeric(value)) { value <- as.numeric(value) } else if (is.logical(value)) { value <- as.logical(value) } else { value <- as.character(value) } names(value) <- vnames } if (!is.character(value)) { value <- .Call(rframe_subscript, value, n, names, get) } else { index <- match(value, names, 0L) if (get) { vnames <- names(value) if (is.null(vnames)) { vnames <- value } else { empty <- is.na(vnames) | !nzchar(vnames) vnames[empty] <- value[empty] } } else { vnames <- value } names(index) <- vnames new <- which(index == 0L) nnew <- length(new) if (nnew > 0) { if (get) { i <- new[[1]] vi <- value[[i]] if (is.na(vi)) { stop("unknown name <NA>") } else { stop(sprintf("unknown name \"%s\"", vi)) } } else { inew <- (n + 1L):(n + nnew) vnew <- value[new] index[new] <- inew[match(vnew, vnew, 0)] # handle duplicates } } value <- index } value } arg_row_subscript <- function(value, n, keys, get) { if (is.record(value)) { value <- as.dataset(value) keys2 <- keys(value) value <- rowid(keys, value) if (anyNA(value)) { i <- which(is.na(value))[[1]] stop(sprintf("unknown key (row subscript %.0f)", i)) } } else { keys2 <- NULL value <- arg_subscript(value, n, NULL, get) } if (get) { if (!is.null(keys2)) { keys <- keys2 } else if (!is.null(keys)) { keys <- keys[value, , drop = FALSE] if (anyDuplicated(value)) { keys <- append_copy_num(keys, n, value) } keys <- as.keyset(keys) } attr(value, "keys") <- keys } value } append_copy_num <- function(x, nkey, id) { # TODO: implement in C? copy <- integer(nkey) newkey <- integer(length(id)) for (i in seq_along(id)) { k <- id[[i]] copy[[k]] <- copy[[k]] + 1L newkey[[i]] <- copy[[k]] } names <- names(x) if (is.null(names)) { names <- character(length(x)) } x[[length(x) + 1L]] <- newkey names(x) <- c(names, "#") x }
/R/arg-subscript.R
permissive
patperry/r-frame
R
false
false
2,864
r
arg_subscript <- function(value, n, names, get) { if (missing(value) || is.null(value)) { return(NULL) } r <- length(dim(value)) if (r >= 2) { stop(sprintf("subscript is a rank-%.0f array", r)) } if (is.object(value)) { vnames <- names(value) if (is.numeric(value)) { value <- as.numeric(value) } else if (is.logical(value)) { value <- as.logical(value) } else { value <- as.character(value) } names(value) <- vnames } if (!is.character(value)) { value <- .Call(rframe_subscript, value, n, names, get) } else { index <- match(value, names, 0L) if (get) { vnames <- names(value) if (is.null(vnames)) { vnames <- value } else { empty <- is.na(vnames) | !nzchar(vnames) vnames[empty] <- value[empty] } } else { vnames <- value } names(index) <- vnames new <- which(index == 0L) nnew <- length(new) if (nnew > 0) { if (get) { i <- new[[1]] vi <- value[[i]] if (is.na(vi)) { stop("unknown name <NA>") } else { stop(sprintf("unknown name \"%s\"", vi)) } } else { inew <- (n + 1L):(n + nnew) vnew <- value[new] index[new] <- inew[match(vnew, vnew, 0)] # handle duplicates } } value <- index } value } arg_row_subscript <- function(value, n, keys, get) { if (is.record(value)) { value <- as.dataset(value) keys2 <- keys(value) value <- rowid(keys, value) if (anyNA(value)) { i <- which(is.na(value))[[1]] stop(sprintf("unknown key (row subscript %.0f)", i)) } } else { keys2 <- NULL value <- arg_subscript(value, n, NULL, get) } if (get) { if (!is.null(keys2)) { keys <- keys2 } else if (!is.null(keys)) { keys <- keys[value, , drop = FALSE] if (anyDuplicated(value)) { keys <- append_copy_num(keys, n, value) } keys <- as.keyset(keys) } attr(value, "keys") <- keys } value } append_copy_num <- function(x, nkey, id) { # TODO: implement in C? copy <- integer(nkey) newkey <- integer(length(id)) for (i in seq_along(id)) { k <- id[[i]] copy[[k]] <- copy[[k]] + 1L newkey[[i]] <- copy[[k]] } names <- names(x) if (is.null(names)) { names <- character(length(x)) } x[[length(x) + 1L]] <- newkey names(x) <- c(names, "#") x }
##### Defining global objects#### # source functions source("2_load_libraries.R") library(tidyverse) library(plotly) library(d3heatmap) library(fields) library(shinyBS) library(markdown) library(scales) master=read.csv("data/All_bycatch_data_2010_2015.csv") %>% select(-c(CV,FOOTNOTE.S.,FISHERY.TYPE.GENERAL,FISHERY.TYPE.SPECIFIC)) %>% .[complete.cases(.[,c(6,9,10)]),] %>% mutate(NUM.FISH=rep(1,nrow(.))) # master_raw=read.csv("data/All_bycatch_data_2010_2015.csv") %>% select(-c(CV,FOOTNOTE.S.,FISHERY.TYPE.GENERAL,FISHERY.TYPE.SPECIFIC)) %>% .[complete.cases(.[,c(6,9,10)]),] %>% mutate(NUM.FISH=rep(1,nrow(.))) master[master=="Pot"]<-"pot" master[master=="NW"]<-"WC" master[master=="SW"]<-"WC" # cleaning for resubmission master[master=="combined gears"]<-"longline gears" master=master %>% mutate(FISHERY=gsub("West Coast Mid-Water Trawl for Whiting","West Coast Mid-Water Trawl for Hake",FISHERY)) %>% mutate(FISHERY=gsub("Oregon/California Pink Shrimp","Washington/Oregon/California Pink Shrimp",FISHERY)) # cleaning for resubmission master_extra_raw=read.csv("data/All_bycatch_data_2010_2015.csv")%>% mutate(YEAR=replace_na(YEAR,replace="2006-2010")) master_extra_raw[master_extra_raw=="combined gears"]<-"longline gears" master_extra_raw=master_extra_raw %>% mutate(FISHERY=gsub("West Coast Mid-Water Trawl for Whiting","West Coast Mid-Water Trawl for Hake",FISHERY)) %>% mutate(FISHERY=gsub("Oregon/California Pink Shrimp","Washington/Oregon/California Pink Shrimp",FISHERY)) ### code to split mammals by year #### # a=master %>% filter(GROUP=="marine mammal") %>% filter(UNIT=="INDIVIDUAL") # new=list() # for(i in 1:nrow(a)){ # print(i) # if(nchar(as.character(a$YEAR[i]))>4){ # b=strsplit(as.character(a$YEAR[i]),"-") # c=lapply(b,function(x)paste0(x,"-01-01")) # d=interval(c[[1]][1],c[[1]][2]) # e=time_length(d,unit="year")+1 # bycatch=a$TOTAL.FISHERY.BYCATCH.MM[i]/e # f=a %>% slice(rep(i,each=e)) # f$TOTAL.FISHERY.BYCATCH.MM=bycatch # f$YEAR=seq(b[[1]][1],b[[1]][2]) # new[[length(new)+1]] <- f # } # } # # test=do.call("rbind",new) # other=master%>% filter(GROUP=="marine mammal") %>% filter(UNIT=="INDIVIDUAL") %>% filter(nchar(as.character(YEAR))==4) # final=rbind(test,other) # write.csv(final,"data/mammals_by_year.csv",row.names = F) ##### mammals=read.csv("data/mammals_by_year.csv") rbi=read.csv("data/SummaryData_December2019_AllFisheryYears_AnalysisExport.csv") group=unique(master$GROUP)%>% .[complete.cases(.)] year=c(2010,2011,2012,2013,2014,2015) region=as.factor(master$REGION) %>% unique() fishery=unique(master$FISHERY)%>% .[complete.cases(.)] %>% as.character() %>% sort() fishery=c("Don't filter",fishery) species=unique(master$SCIENTIFIC.NAME) %>% .[complete.cases(.)] %>% as.character()%>% sort() species=c("Don't filter",species) gear=unique(master$FISHERY.TYPE)%>% .[complete.cases(.)] %>% as.character()%>% sort() gear=c("Don't filter",gear) ui <- dashboardPage(skin = "black", dashboardHeader( title = "National Bycatch Database Explorer", titleWidth = 350 ), dashboardSidebar( width = 280, sidebarMenu(id = 'sidebarmenu', menuItem("Visualize by species group", tabName='species',icon=icon("fish")), conditionalPanel("input.sidebarmenu ==='species'", #checkboxInput("sp_region", "Subdivide by region",value=FALSE), radioButtons(inputId="choice_sp", label="How would you like to subdivide the data?", selected = "Don't subdivide", choices=c("Region","Gear type", "Don't subdivide"))), #checkboxInput("sp_region", "Subdivide by fishing type",value=FALSE)), menuItem("Visualize by gear type", tabName='fishing',icon=icon("ship",lib='font-awesome')), conditionalPanel("input.sidebarmenu ==='fishing'", checkboxInput("Free_y", "Fixed y axis scale",value=T), radioButtons(inputId="choice_gear", label="How would you like to subdivide the data?", selected = "Don't subdivide", choices=c("Region", "Don't subdivide")), radioButtons(inputId="choice_metric", label="What metric would you like to see?", selected = "FISHERY.BYCATCH.RATIO", choices=c("Bycatch ratio"="FISHERY.BYCATCH.RATIO", "Total catch"="TOTAL.CATCH", "Total landings"="TOTAL.FISHERY.LANDINGS", "Number of fisheries"="NUM.FISH"))), menuItem("Relative Bycatch Index",tabName = 'rbi',icon=icon("award")), conditionalPanel("input.sidebarmenu==='rbi'", bsButton("q1", label = "", icon = icon("question"), style = "info", size = "extra-small"), bsPopover(id = "q1", title = "", content = "Unlike other taxonomic groups bycatch impacts of a fishery on marine mammals was only represented by MMPA weighting, therefore our default ranking doubled the weighting of the MMPA category relative to the other criteria. You can adjust the slider to see how changing the criteria weightings influences the final RBI of each fishery in each year.", placement = "right", trigger = "hover", options = list(container = "body")), radioButtons("display","Select display metric",choices = list("Relative Bycatch Index","Inter-criteria variance"),width = "100%",selected = "Relative Bycatch Index"), conditionalPanel("input.display ==='Relative Bycatch Index'", sliderInput("mmpa","Adjust MMPA weighting",min=1,max=5,step=1,value=2), # shinyBS::bsTooltip("mmpa", "The wait times will be broken into this many equally spaced bins", # "right", options = list(container = "body")) sliderInput("TB_lbs","Adjust Total Bycatch (lbs) weighting",min=1,max=5,step=1,value=1), sliderInput("TB_indv","Adjust Total Bycatch (indv) weighting",min=1,max=5,step=1,value=1), sliderInput("BR","Adjust Bycatch Ratio weighting",min=1,max=5,step=1,value=1), sliderInput("ESA_n","Adjust ESA (#) weighting",min=1,max=5,step=1,value=1), sliderInput("ESA_lbs","Adjust ESA (lbs) weighting",min=1,max=5,step=1,value=1), sliderInput("ESA_bt","Adjust ESA (birds and turtles) weighting",min=1,max=5,step=1,value=1), sliderInput("IUCN_n","Adjust IUCN (#) weighting",min=1,max=5,step=1,value=1), sliderInput("IUCN_lbs","Adjust IUCN (lbs) weighting",min=1,max=5,step=1,value=1), sliderInput("IUCN_bt","Adjust IUCN (bids and turtles) weighting",min=1,max=5,step=1,value=1), sliderInput("Tier","Adjust Tier weighting",min=1,max=5,step=1,value=1), sliderInput("CV","Adjust CV weighting",min=1,max=5,step=1,value=1) )), menuItem("Explore raw data", tabName='raw',icon=icon("database",lib='font-awesome')), conditionalPanel("input.sidebarmenu ==='raw'", selectInput("raw_species","Filter species",species,width = "100%"), selectInput("raw_fishery","Filter fishery",fishery,width = "100%"), selectInput("raw_gear","Filter gear",gear,width = "100%"), div(style="text-align:center",downloadButton("downloadDataF", label = h6(style="color:black","Download dataset"))), div(style="text-align:center",downloadButton("downloadDataM", label = h6(style="color:black","Download metadata"))) )#, # div(style="text-align:center",url <- a(tags$span(style="color:dodgerblue",h4("Read the paper")), href="https://media.giphy.com/media/qaoutfIYJYxr2/source.gif")) )), dashboardBody( tabItems( tabItem(tabName = "rbi", fluidRow( column(h4(style="text-align:center;","This app explores relative bycatch performance in US fisheries with bycatch estimates published in the National Bycatch Report."),width = 12), column(h5(""),width=1,plotOutput("scale",height = '800px'),style = "background-color:white;"), column(h5(""),width=10,d3heatmapOutput("heatmap",height = '800px'),style = "background-color:white;", absolutePanel(draggable=F,top = 300, left = 0, right = 0,tags$div(h2(style="background-color:white;opacity:0.6;text-align:center;color:red;padding:0px;border-radius: 0px;transform: rotate(45deg); ",tags$b(tags$em("EXPLORATORY ONLY. Output does not necessarily align with results in Savoca et al.")))))), # column(h5(""),width=1,plotOutput("scale_SD",height = '800px'),style = "background-color:white;"), # column(h5("Inter-criteria variance"),width=5,d3heatmapOutput("heatmap_SD",height = '800px'),style = "background-color:white;"), column(h6(style="font-style: italic;","App developed by Heather Welch (UCSC/NOAA)"),width = 12) # absolutePanel(div(style="text-align:center;color:red;padding:0px;border-radius: 0px; ",tags$b(tags$em("placeholder"))),draggable=T,top=350, right=50) # absolutePanel(draggable=T,top = 0, left = 0, right = 0,div(style="padding: 8px; border-bottom: 1px solid #CCC; background: #FFFFEE;",HTML(markdownToHTML(fragment.only=TRUE,text="placeholder")))) )), tabItem(tabName = "species", fluidRow( column(h4(style="text-align:center;","This app explores relative bycatch performance in US fisheries with bycatch estimates published in the National Bycatch Report."),width = 12), column(h5("Fish and invertebrates"),width=4,plotOutput("Fish")), column(h5("Mammals"),width=4,plotOutput("Mammals")), column(h5("Seabirds and sea turtles"),width=4,plotOutput("SBST")), column(h6(style="font-style: italic;","App developed by Heather Welch (UCSC/NOAA)"),width = 12) )), tabItem(tabName = "fishing", fluidRow( column(h4(style="text-align:center;","This app explores relative bycatch performance in US fisheries with bycatch estimates published in the National Bycatch Report."),width = 12), column(h5(""),width=12,plotOutput("gear_ll",height = '800px'))), column(h6(style="font-style: italic;","App developed by Heather Welch (UCSC/NOAA)"),width = 12) ), tabItem(tabName = "raw", fluidRow( column(h4(style="text-align:center;","This app explores relative bycatch performance in US fisheries with bycatch estimates published in the National Bycatch Report."),width = 12), column(h5(""),width=12,DT::dataTableOutput("rawTable")), column(h6(style="font-style: italic;","App developed by Heather Welch (UCSC/NOAA)"),width = 12) )) )) ) server <- shinyServer(function(input, output,session) { output$heatmap<-renderD3heatmap({ if(input$display=="Relative Bycatch Index"){ a=rbi %>% mutate(mean_criteria = apply(.[,37:48],1,function(x) weighted.mean(x,w=c(input$TB_lbs,input$TB_indv,input$BR,input$ESA_n,input$ESA_lbs,input$ESA_bt,input$IUCN_n,input$IUCN_lbs,input$IUCN_bt,input$mmpa,input$Tier,input$CV),na.rm=T)))#Here 'w' refers to the weights. # a=rbi %>% mutate(mean_criteria = apply(.[,29:40],1,function(x) weighted.mean(x,w=c(rep(1,9),input$mmpa,rep(1,2)),na.rm=T)))#Here 'w' refers to the weights. # a=rbi %>% mutate(mean_criteria = apply(.[,29:40],1,function(x) weighted.mean(x,w=c(rep(1,9),2,rep(1,2)),na.rm=T)))# delete this before launching q=a %>% select(Year,mean_criteria,Fishery) %>% spread(Year,mean_criteria) %>% mutate(Fishery=as.character(Fishery)) %>% arrange(desc(Fishery)) rownames(q)=q$Fishery q=q %>% .[,2:ncol(.)] d3heatmap(q, na.rm=T,Rowv = FALSE, Colv=FALSE, colors=c("#053061" ,"#2166AC", "#4393C3", "#D1E5F0" , "#FDDBC7", "#F4A582" ,"#D6604D" ,"#B2182B","#B2182B","#67001F"), xlab=w, show_grid=F, yaxis_width=400,show_color_legend=T,na_color="white",row_side_palette=c("#053061" ,"#2166AC", "#4393C3", "#D1E5F0" , "#FDDBC7", "#F4A582" ,"#D6604D" ,"#B2182B","#B2182B","#67001F") ) } else if(input$display=="Inter-criteria variance"){ a=rbi %>% mutate(mean_criteria = apply(.[,37:48],1,function(x) weighted.mean(x,w=c(rep(1,9),2,rep(1,2)),na.rm=T)))# delete this before launching q=rbi %>% select(Year,criteria_sd,Fishery)%>% mutate(criteria_sd=criteria_sd^2) %>% spread(Year,criteria_sd) %>% mutate(Fishery=as.character(Fishery)) %>% arrange(desc(Fishery)) rownames(q)=q$Fishery q=q %>% .[,2:ncol(.)] d3heatmap(q, na.rm=T,Rowv = FALSE, Colv=FALSE, colors=c("#440154FF", "#31688EFF" ,"#35B779FF", "#FDE725FF"), xlab=w, show_grid=F, yaxis_width=400,show_color_legend=T,na_color="white",row_side_palette=c("#440154FF", "#31688EFF" ,"#35B779FF", "#FDE725FF") ) } }) output$scale<-renderPlot({ if(input$display=="Relative Bycatch Index"){ # par(mar=c(1,.1,.1,.1)) a=rbi %>% mutate(mean_criteria = apply(.[,37:48],1,function(x) weighted.mean(x,w=c(input$TB_lbs,input$TB_indv,input$BR,input$ESA_n,input$ESA_lbs,input$ESA_bt,input$IUCN_n,input$IUCN_lbs,input$IUCN_bt,input$mmpa,input$Tier,input$CV),na.rm=T)))#Here 'w' refers to the weights. col.pal <- colorRampPalette(c("#053061" ,"#2166AC", "#4393C3", "#D1E5F0" , "#FDDBC7", "#F4A582" ,"#D6604D" ,"#B2182B","#B2182B","#67001F")) ncolors <- 100 #breaks <- seq(min(a$mean_criteria,na.rm = T),max(a$mean_criteria,na.rm = T),,ncolors+1) breaks <- seq(0,.51,,ncolors+1) levs <- breaks[-1] - diff(breaks)/2 # image(x=levs, y=1, z=as.matrix(levs), col=col.pal(ncolors), breaks=breaks, ylab="", xlab="", yaxt="n") par(mar=c(.1,.1,.1,.1)) image.plot(x=levs, y=1,smallplot= c(0,.2,.2,1), z=as.matrix(levs), legend.only = TRUE,col=col.pal(ncolors), breaks=breaks, ylab="", xlab="", yaxt="n",axis.args = list(cex.axis = .6)) } else if(input$display=="Inter-criteria variance"){ col.pal <- colorRampPalette(c("#440154FF", "#31688EFF" ,"#35B779FF", "#FDE725FF")) ncolors <- 100 breaks <- seq(min((rbi$criteria_sd)^2,na.rm = T),max(.31,na.rm = T),,ncolors+1) levs <- breaks[-1] - diff(breaks)/2 # image(x=levs, y=1, z=as.matrix(levs), col=col.pal(ncolors), breaks=breaks, ylab="", xlab="", yaxt="n") par(mar=c(.1,.1,.1,.1)) image.plot(x=levs, y=1,smallplot= c(0,.2,.2,1), z=as.matrix(levs), legend.only = TRUE,col=col.pal(ncolors), breaks=breaks, ylab="", xlab="", yaxt="n",axis.args = list(cex.axis = .6)) } }) # output$heatmap_SD<-renderD3heatmap({ # a=rbi %>% mutate(mean_criteria = apply(.[,29:40],1,function(x) weighted.mean(x,w=c(input$TB_lbs,input$TB_indv,input$BR,input$ESA_n,input$ESA_lbs,input$ESA_bt,input$IUCN_n,input$IUCN_lbs,input$IUCN_bt,input$mmpa,input$Tier,input$CV),na.rm=T)))#Here 'w' refers to the weights. # # a=rbi %>% mutate(mean_criteria = apply(.[,29:40],1,function(x) weighted.mean(x,w=c(rep(1,9),input$mmpa,rep(1,2)),na.rm=T)))#Here 'w' refers to the weights. # # a=rbi %>% mutate(mean_criteria = apply(.[,29:40],1,function(x) weighted.mean(x,w=c(rep(1,9),2,rep(1,2)),na.rm=T)))# delete this before launching # # q=a %>% select(Year,mean_criteria,Fishery) %>% spread(Year,mean_criteria) %>% mutate(Fishery=as.character(Fishery)) %>% arrange(desc(Fishery)) # rownames(q)=q$Fishery # q=q %>% .[,2:ncol(.)] # # d3heatmap(q, na.rm=T,Rowv = FALSE, Colv=FALSE, colors=c("#053061" ,"#2166AC", "#4393C3", "#D1E5F0" , "#FDDBC7", "#F4A582" ,"#D6604D" ,"#B2182B","#B2182B","#67001F"), # xlab=w, # show_grid=F, yaxis_width=400,show_color_legend=T,na_color="white",row_side_palette=c("#053061" ,"#2166AC", "#4393C3", "#D1E5F0" , "#FDDBC7", "#F4A582" ,"#D6604D" ,"#B2182B","#B2182B","#67001F") # # ) # }) # output$scale_SD<-renderPlot({ # # par(mar=c(1,.1,.1,.1)) # # a=rbi %>% mutate(mean_criteria = apply(.[,29:40],1,function(x) weighted.mean(x,w=c(rep(1,9),input$mmpa,rep(1,2)),na.rm=T))) # col.pal <- colorRampPalette(c("#440154FF", "#31688EFF" ,"#35B779FF", "#FDE725FF")) # ncolors <- 100 # breaks <- seq(min((rbi$criteria_sd)^2,na.rm = T),max(.31,na.rm = T),,ncolors+1) # levs <- breaks[-1] - diff(breaks)/2 # # image(x=levs, y=1, z=as.matrix(levs), col=col.pal(ncolors), breaks=breaks, ylab="", xlab="", yaxt="n") # par(mar=c(.1,.1,.1,.1)) # image.plot(x=levs, y=1,smallplot= c(0,.2,.2,1), z=as.matrix(levs), legend.only = TRUE,col=col.pal(ncolors), breaks=breaks, ylab="", xlab="", yaxt="n",axis.args = list(cex.axis = .6)) # # }) # output$placeholder=renderText({ # "test" # }) output$Fish<-renderPlot({ value=input$choice_sp if(value=="Don't subdivide"){ a=master %>% filter(GROUP=="invertebrate"|GROUP=="fish") %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% filter(UNIT=="POUND") %>% group_by(YEAR,FISHERY) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.FISH.INVERT)) %>% group_by(YEAR) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol),stat="identity")+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (lbs)")+xlab("Year")+ scale_y_log10(labels = scales::comma) b } if(value=="Region"){ a=master %>% filter(GROUP=="invertebrate"|GROUP=="fish") %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% filter(UNIT=="POUND") %>% group_by(YEAR,FISHERY,REGION) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.FISH.INVERT)) %>% group_by(YEAR,REGION) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol,fill=REGION),stat="identity", position = position_dodge())+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (lbs)")+xlab("Year")+ scale_fill_manual("",values=c("AK"="#7489ff","PI"="#c2c700","SE"="#00683b","WC"="#b45300","NE"="#afcf9d"),labels=c("AK"="Alaska","PI"="Pacific Islands","SE"="Southeast","WC"="Westcoast","NE"="Northeast"))+ scale_y_continuous(labels = comma) } if(value=="Gear type"){ a=master %>% filter(GROUP=="invertebrate"|GROUP=="fish") %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% filter(UNIT=="POUND") %>% group_by(YEAR,FISHERY,FISHERY.TYPE) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.FISH.INVERT)) %>% group_by(YEAR,FISHERY.TYPE) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol,fill=FISHERY.TYPE),stat="identity", position = position_dodge())+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (lbs)")+xlab("Year")+ scale_fill_manual("",values=c("jig"="#9f7bb2","dredge"="#7dac33","gillnet"="#c64f79","line"="#93ccaf","longline"="#8e97ee","pot"="#59663e","seine"="#ffca33","trawl"="#c5703f","troll"="#4d304b"))+ scale_y_continuous(labels = comma) } b }) output$Mammals<-renderPlot({ value=input$choice_sp if(value=="Don't subdivide"){ a=mammals %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.MM)) %>% group_by(YEAR) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol),stat="identity")+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (individuals)")+xlab("Year")+ scale_y_continuous(labels = comma) } if(value=="Region"){ a=mammals %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY,REGION) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.MM)) %>% group_by(YEAR,REGION) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol,fill=REGION),stat="identity", position = position_dodge())+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (individuals)")+xlab("Year")+ scale_fill_manual("",values=c("AK"="#7489ff","PI"="#c2c700","SE"="#00683b","WC"="#b45300","NE"="#afcf9d"),labels=c("AK"="Alaska","PI"="Pacific Islands","SE"="Southeast","WC"="Westcoast","NE"="Northeast"))+ scale_y_continuous(labels = comma) } if(value=="Gear type"){ a=mammals %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY,FISHERY.TYPE) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.MM)) %>% group_by(YEAR,FISHERY.TYPE) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol,fill=FISHERY.TYPE),stat="identity", position = position_dodge())+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (individuals)")+xlab("Year")+ scale_fill_manual("",values=c("jig"="#9f7bb2","dredge"="#7dac33","gillnet"="#c64f79","line"="#93ccaf","longline"="#8e97ee","pot"="#59663e","seine"="#ffca33","trawl"="#c5703f","troll"="#4d304b"))+ scale_y_continuous(labels = comma) } b }) output$SBST<-renderPlot({ value=input$choice_sp if(value=="Don't subdivide"){ a=master %>% filter(GROUP=="seabird"|GROUP=="sea turtle") %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015)%>% filter(UNIT=="INDIVIDUAL") %>% group_by(YEAR,FISHERY) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.SBST)) %>% group_by(YEAR) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol),stat="identity")+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (individuals)")+xlab("Year")+ scale_y_continuous(labels = comma) } if(value=="Region"){ a=master %>% filter(GROUP=="seabird"|GROUP=="sea turtle") %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015)%>% filter(UNIT=="INDIVIDUAL") %>% group_by(YEAR,FISHERY,REGION) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.SBST)) %>% group_by(YEAR,REGION) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol,fill=REGION),stat="identity", position = position_dodge())+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (individuals)")+xlab("Year")+ scale_fill_manual("",values=c("AK"="#7489ff","PI"="#c2c700","SE"="#00683b","WC"="#b45300","NE"="#afcf9d"),labels=c("AK"="Alaska","PI"="Pacific Islands","SE"="Southeast","WC"="Westcoast","NE"="Northeast"))+ scale_y_continuous(labels = comma) } if(value=="Gear type"){ a=master %>% filter(GROUP=="seabird"|GROUP=="sea turtle") %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015)%>% filter(UNIT=="INDIVIDUAL") %>% group_by(YEAR,FISHERY,FISHERY.TYPE) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.SBST)) %>% group_by(YEAR,FISHERY.TYPE) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol,fill=FISHERY.TYPE),stat="identity", position = position_dodge())+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (individuals)")+xlab("Year")+ scale_fill_manual("",values=c("jig"="#9f7bb2","dredge"="#7dac33","gillnet"="#c64f79","line"="#93ccaf","longline"="#8e97ee","pot"="#59663e","seine"="#ffca33","trawl"="#c5703f","troll"="#4d304b"))+ scale_y_continuous(labels = comma) } b }) metric=reactive({ a=input$choice_metric b=grep(a,colnames(master),value=T) return(b) }) output$gear_ll<-renderPlot({ value=input$choice_gear if(metric()=="FISHERY.BYCATCH.RATIO"){ a=master %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY.TYPE) %>% summarise(newcol=mean(FISHERY.BYCATCH.RATIO,na.rm=T)) aa=master %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY.TYPE,REGION) %>% summarise(newcol=mean(FISHERY.BYCATCH.RATIO,na.rm=T)) if(value=="Don't subdivide"){ b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol),stat="identity")+facet_wrap(~FISHERY.TYPE,scales = "free_y")+ theme_bw() + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Bycatch ratio")+xlab("Year") } if(value=="Region"){ b=ggplot(aa) +geom_bar(aes(x=YEAR,y=newcol,fill=REGION),stat="identity", position = position_dodge())+facet_wrap(~FISHERY.TYPE,scales = "free_y")+ theme_bw() + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Bycatch ratio")+xlab("Year")+ scale_fill_manual("",values=c("AK"="#7489ff","PI"="#c2c700","SE"="#00683b","WC"="#b45300","NE"="#afcf9d"),labels=c("AK"="Alaska","PI"="Pacific Islands","SE"="Southeast","WC"="Westcoast","NE"="Northeast")) } } if(metric()=="TOTAL.FISHERY.LANDINGS"){ a=master %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY.TYPE) %>% summarise(newcol=sum(TOTAL.FISHERY.LANDINGS,na.rm=T)) aa=master %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY.TYPE,REGION) %>% summarise(newcol=sum(TOTAL.FISHERY.LANDINGS,na.rm=T)) if(value=="Don't subdivide"){ options(scipen=10000) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol),stat="identity")+facet_wrap(~FISHERY.TYPE,scales = "free_y")+ theme_bw() + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total landings")+xlab("Year")+scale_y_log10(labels = scales::comma) } if(value=="Region"){ options(scipen=10000) b=ggplot(aa) +geom_bar(aes(x=YEAR,y=newcol,fill=REGION),stat="identity", position = position_dodge())+facet_wrap(~FISHERY.TYPE,scales = "free_y")+ theme_bw() + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total landings")+xlab("Year")+scale_y_log10(labels = scales::comma)+ scale_fill_manual("",values=c("AK"="#7489ff","PI"="#c2c700","SE"="#00683b","WC"="#b45300","NE"="#afcf9d"),labels=c("AK"="Alaska","PI"="Pacific Islands","SE"="Southeast","WC"="Westcoast","NE"="Northeast")) } } if(metric()=="TOTAL.CATCH"){ a=master %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY.TYPE) %>% summarise(newcol=sum(TOTAL.CATCH,na.rm=T)) aa=master %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY.TYPE,REGION) %>% summarise(newcol=sum(TOTAL.CATCH,na.rm=T)) if(value=="Don't subdivide"){ options(scipen=10000) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol),stat="identity")+facet_wrap(~FISHERY.TYPE,scales = "free_y")+ theme_bw() + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total catch")+xlab("Year")+scale_y_log10(labels = scales::comma) } if(value=="Region"){ options(scipen=10000) b=ggplot(aa) +geom_bar(aes(x=YEAR,y=newcol,fill=REGION),stat="identity", position = position_dodge())+facet_wrap(~FISHERY.TYPE,scales = "free_y")+ theme_bw() + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total catch")+xlab("Year")+scale_y_log10(labels = scales::comma)+ scale_fill_manual("",values=c("AK"="#7489ff","PI"="#c2c700","SE"="#00683b","WC"="#b45300","NE"="#afcf9d"),labels=c("AK"="Alaska","PI"="Pacific Islands","SE"="Southeast","WC"="Westcoast","NE"="Northeast")) } } if(metric()=="NUM.FISH"){ a=master %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY.TYPE,FISHERY) %>% summarise(newcol=n()) %>% distinct() %>% group_by(YEAR,FISHERY.TYPE)%>% summarise(newcol=n()) aa=master %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY.TYPE,REGION,FISHERY) %>% summarise(newcol=n()) %>% distinct() %>% group_by(YEAR,FISHERY.TYPE,REGION)%>% summarise(newcol=n()) if(value=="Don't subdivide"){ options(scipen=10000) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol),stat="identity")+facet_wrap(~FISHERY.TYPE,scales = "free_y")+ theme_bw() + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Number of fisheries")+xlab("Year") } if(value=="Region"){ options(scipen=10000) b=ggplot(aa) +geom_bar(aes(x=YEAR,y=newcol,fill=REGION),stat="identity", position = position_dodge())+facet_wrap(~FISHERY.TYPE,scales = "free_y")+ theme_bw() + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Number of fisheries")+xlab("Year")+ scale_fill_manual("",values=c("AK"="#7489ff","PI"="#c2c700","SE"="#00683b","WC"="#b45300","NE"="#afcf9d"),labels=c("AK"="Alaska","PI"="Pacific Islands","SE"="Southeast","WC"="Westcoast","NE"="Northeast")) } } if(input$Free_y==T){ b=b+facet_wrap(~FISHERY.TYPE,scales = "fixed") } b }) # }, height = function() { # session$clientData$output_gear_ll_width # }) output$rawTable<-DT::renderDataTable({ a=master_extra_raw #%>% select(-c(TOTAL.FISHERY.BYCATCH.MM,TOTAL.FISHERY.BYCATCH.SBST,NUM.FISH,TOTAL.FISHERY.BYCATCH.FISH.INVERT,OBSERVER.COVERAGE,TOTAL.FISHERY.LANDINGS,TOTAL.CATCH)) fish=input$raw_fishery sp=input$raw_species # # if(input$raw_species=="Don't filter" & input$raw_fishery=="Don't filter"& input$raw_gear=="Don't filter"){ # b=a # } else if(input$raw_species=="Don't filter" & input$raw_fishery!="Don't filter"& input$raw_gear!="Don't filter"){ # b=a %>% filter(FISHERY==input$raw_fishery) # } else if(input$raw_species!="Don't filter" & input$raw_fishery=="Don't filter"& input$raw_gear!="Don't filter"){ # b=a %>% filter(SCIENTIFIC.NAME==input$raw_species) # } else if(input$raw_species!="Don't filter" & input$raw_fishery!="Don't filter"){ # b=a %>% filter(FISHERY==input$raw_fishery & SCIENTIFIC.NAME==input$raw_species) # } if(input$raw_species!="Don't filter"){ a=a %>% filter(SCIENTIFIC.NAME==input$raw_species) } if(input$raw_fishery!="Don't filter"){ a=a %>% filter(FISHERY==input$raw_fishery) } if(input$raw_gear!="Don't filter"){ a=a %>% filter(FISHERY.TYPE==input$raw_gear) } datatable(a,options=list(scrollX=TRUE)) }) filtered_data=reactive({ a=master_extra_raw if(input$raw_species!="Don't filter"){ a=a %>% filter(SCIENTIFIC.NAME==input$raw_species) } if(input$raw_fishery!="Don't filter"){ a=a %>% filter(FISHERY==input$raw_fishery) } if(input$raw_gear!="Don't filter"){ a=a %>% filter(FISHERY.TYPE==input$raw_gear) } return(a) }) output$downloadDataF <- downloadHandler( filename = function() { paste("National_Bycatch_Database", ".csv", sep = "") }, content = function(file) { write.csv(filtered_data(), file, row.names = FALSE) }) output$downloadDataM <- downloadHandler( filename = "US_Bycatch_analysis_Raw_data_metadata.pdf", content = function(file) { file.copy("data/US_Bycatch_analysis_Raw_data_metadata.pdf", file) }) }) shinyApp(ui = ui, server = server)
/NBR_bycatch_explorer/app_V9.R
no_license
mssavoca/DOM_fisheries-analysis
R
false
false
36,191
r
##### Defining global objects#### # source functions source("2_load_libraries.R") library(tidyverse) library(plotly) library(d3heatmap) library(fields) library(shinyBS) library(markdown) library(scales) master=read.csv("data/All_bycatch_data_2010_2015.csv") %>% select(-c(CV,FOOTNOTE.S.,FISHERY.TYPE.GENERAL,FISHERY.TYPE.SPECIFIC)) %>% .[complete.cases(.[,c(6,9,10)]),] %>% mutate(NUM.FISH=rep(1,nrow(.))) # master_raw=read.csv("data/All_bycatch_data_2010_2015.csv") %>% select(-c(CV,FOOTNOTE.S.,FISHERY.TYPE.GENERAL,FISHERY.TYPE.SPECIFIC)) %>% .[complete.cases(.[,c(6,9,10)]),] %>% mutate(NUM.FISH=rep(1,nrow(.))) master[master=="Pot"]<-"pot" master[master=="NW"]<-"WC" master[master=="SW"]<-"WC" # cleaning for resubmission master[master=="combined gears"]<-"longline gears" master=master %>% mutate(FISHERY=gsub("West Coast Mid-Water Trawl for Whiting","West Coast Mid-Water Trawl for Hake",FISHERY)) %>% mutate(FISHERY=gsub("Oregon/California Pink Shrimp","Washington/Oregon/California Pink Shrimp",FISHERY)) # cleaning for resubmission master_extra_raw=read.csv("data/All_bycatch_data_2010_2015.csv")%>% mutate(YEAR=replace_na(YEAR,replace="2006-2010")) master_extra_raw[master_extra_raw=="combined gears"]<-"longline gears" master_extra_raw=master_extra_raw %>% mutate(FISHERY=gsub("West Coast Mid-Water Trawl for Whiting","West Coast Mid-Water Trawl for Hake",FISHERY)) %>% mutate(FISHERY=gsub("Oregon/California Pink Shrimp","Washington/Oregon/California Pink Shrimp",FISHERY)) ### code to split mammals by year #### # a=master %>% filter(GROUP=="marine mammal") %>% filter(UNIT=="INDIVIDUAL") # new=list() # for(i in 1:nrow(a)){ # print(i) # if(nchar(as.character(a$YEAR[i]))>4){ # b=strsplit(as.character(a$YEAR[i]),"-") # c=lapply(b,function(x)paste0(x,"-01-01")) # d=interval(c[[1]][1],c[[1]][2]) # e=time_length(d,unit="year")+1 # bycatch=a$TOTAL.FISHERY.BYCATCH.MM[i]/e # f=a %>% slice(rep(i,each=e)) # f$TOTAL.FISHERY.BYCATCH.MM=bycatch # f$YEAR=seq(b[[1]][1],b[[1]][2]) # new[[length(new)+1]] <- f # } # } # # test=do.call("rbind",new) # other=master%>% filter(GROUP=="marine mammal") %>% filter(UNIT=="INDIVIDUAL") %>% filter(nchar(as.character(YEAR))==4) # final=rbind(test,other) # write.csv(final,"data/mammals_by_year.csv",row.names = F) ##### mammals=read.csv("data/mammals_by_year.csv") rbi=read.csv("data/SummaryData_December2019_AllFisheryYears_AnalysisExport.csv") group=unique(master$GROUP)%>% .[complete.cases(.)] year=c(2010,2011,2012,2013,2014,2015) region=as.factor(master$REGION) %>% unique() fishery=unique(master$FISHERY)%>% .[complete.cases(.)] %>% as.character() %>% sort() fishery=c("Don't filter",fishery) species=unique(master$SCIENTIFIC.NAME) %>% .[complete.cases(.)] %>% as.character()%>% sort() species=c("Don't filter",species) gear=unique(master$FISHERY.TYPE)%>% .[complete.cases(.)] %>% as.character()%>% sort() gear=c("Don't filter",gear) ui <- dashboardPage(skin = "black", dashboardHeader( title = "National Bycatch Database Explorer", titleWidth = 350 ), dashboardSidebar( width = 280, sidebarMenu(id = 'sidebarmenu', menuItem("Visualize by species group", tabName='species',icon=icon("fish")), conditionalPanel("input.sidebarmenu ==='species'", #checkboxInput("sp_region", "Subdivide by region",value=FALSE), radioButtons(inputId="choice_sp", label="How would you like to subdivide the data?", selected = "Don't subdivide", choices=c("Region","Gear type", "Don't subdivide"))), #checkboxInput("sp_region", "Subdivide by fishing type",value=FALSE)), menuItem("Visualize by gear type", tabName='fishing',icon=icon("ship",lib='font-awesome')), conditionalPanel("input.sidebarmenu ==='fishing'", checkboxInput("Free_y", "Fixed y axis scale",value=T), radioButtons(inputId="choice_gear", label="How would you like to subdivide the data?", selected = "Don't subdivide", choices=c("Region", "Don't subdivide")), radioButtons(inputId="choice_metric", label="What metric would you like to see?", selected = "FISHERY.BYCATCH.RATIO", choices=c("Bycatch ratio"="FISHERY.BYCATCH.RATIO", "Total catch"="TOTAL.CATCH", "Total landings"="TOTAL.FISHERY.LANDINGS", "Number of fisheries"="NUM.FISH"))), menuItem("Relative Bycatch Index",tabName = 'rbi',icon=icon("award")), conditionalPanel("input.sidebarmenu==='rbi'", bsButton("q1", label = "", icon = icon("question"), style = "info", size = "extra-small"), bsPopover(id = "q1", title = "", content = "Unlike other taxonomic groups bycatch impacts of a fishery on marine mammals was only represented by MMPA weighting, therefore our default ranking doubled the weighting of the MMPA category relative to the other criteria. You can adjust the slider to see how changing the criteria weightings influences the final RBI of each fishery in each year.", placement = "right", trigger = "hover", options = list(container = "body")), radioButtons("display","Select display metric",choices = list("Relative Bycatch Index","Inter-criteria variance"),width = "100%",selected = "Relative Bycatch Index"), conditionalPanel("input.display ==='Relative Bycatch Index'", sliderInput("mmpa","Adjust MMPA weighting",min=1,max=5,step=1,value=2), # shinyBS::bsTooltip("mmpa", "The wait times will be broken into this many equally spaced bins", # "right", options = list(container = "body")) sliderInput("TB_lbs","Adjust Total Bycatch (lbs) weighting",min=1,max=5,step=1,value=1), sliderInput("TB_indv","Adjust Total Bycatch (indv) weighting",min=1,max=5,step=1,value=1), sliderInput("BR","Adjust Bycatch Ratio weighting",min=1,max=5,step=1,value=1), sliderInput("ESA_n","Adjust ESA (#) weighting",min=1,max=5,step=1,value=1), sliderInput("ESA_lbs","Adjust ESA (lbs) weighting",min=1,max=5,step=1,value=1), sliderInput("ESA_bt","Adjust ESA (birds and turtles) weighting",min=1,max=5,step=1,value=1), sliderInput("IUCN_n","Adjust IUCN (#) weighting",min=1,max=5,step=1,value=1), sliderInput("IUCN_lbs","Adjust IUCN (lbs) weighting",min=1,max=5,step=1,value=1), sliderInput("IUCN_bt","Adjust IUCN (bids and turtles) weighting",min=1,max=5,step=1,value=1), sliderInput("Tier","Adjust Tier weighting",min=1,max=5,step=1,value=1), sliderInput("CV","Adjust CV weighting",min=1,max=5,step=1,value=1) )), menuItem("Explore raw data", tabName='raw',icon=icon("database",lib='font-awesome')), conditionalPanel("input.sidebarmenu ==='raw'", selectInput("raw_species","Filter species",species,width = "100%"), selectInput("raw_fishery","Filter fishery",fishery,width = "100%"), selectInput("raw_gear","Filter gear",gear,width = "100%"), div(style="text-align:center",downloadButton("downloadDataF", label = h6(style="color:black","Download dataset"))), div(style="text-align:center",downloadButton("downloadDataM", label = h6(style="color:black","Download metadata"))) )#, # div(style="text-align:center",url <- a(tags$span(style="color:dodgerblue",h4("Read the paper")), href="https://media.giphy.com/media/qaoutfIYJYxr2/source.gif")) )), dashboardBody( tabItems( tabItem(tabName = "rbi", fluidRow( column(h4(style="text-align:center;","This app explores relative bycatch performance in US fisheries with bycatch estimates published in the National Bycatch Report."),width = 12), column(h5(""),width=1,plotOutput("scale",height = '800px'),style = "background-color:white;"), column(h5(""),width=10,d3heatmapOutput("heatmap",height = '800px'),style = "background-color:white;", absolutePanel(draggable=F,top = 300, left = 0, right = 0,tags$div(h2(style="background-color:white;opacity:0.6;text-align:center;color:red;padding:0px;border-radius: 0px;transform: rotate(45deg); ",tags$b(tags$em("EXPLORATORY ONLY. Output does not necessarily align with results in Savoca et al.")))))), # column(h5(""),width=1,plotOutput("scale_SD",height = '800px'),style = "background-color:white;"), # column(h5("Inter-criteria variance"),width=5,d3heatmapOutput("heatmap_SD",height = '800px'),style = "background-color:white;"), column(h6(style="font-style: italic;","App developed by Heather Welch (UCSC/NOAA)"),width = 12) # absolutePanel(div(style="text-align:center;color:red;padding:0px;border-radius: 0px; ",tags$b(tags$em("placeholder"))),draggable=T,top=350, right=50) # absolutePanel(draggable=T,top = 0, left = 0, right = 0,div(style="padding: 8px; border-bottom: 1px solid #CCC; background: #FFFFEE;",HTML(markdownToHTML(fragment.only=TRUE,text="placeholder")))) )), tabItem(tabName = "species", fluidRow( column(h4(style="text-align:center;","This app explores relative bycatch performance in US fisheries with bycatch estimates published in the National Bycatch Report."),width = 12), column(h5("Fish and invertebrates"),width=4,plotOutput("Fish")), column(h5("Mammals"),width=4,plotOutput("Mammals")), column(h5("Seabirds and sea turtles"),width=4,plotOutput("SBST")), column(h6(style="font-style: italic;","App developed by Heather Welch (UCSC/NOAA)"),width = 12) )), tabItem(tabName = "fishing", fluidRow( column(h4(style="text-align:center;","This app explores relative bycatch performance in US fisheries with bycatch estimates published in the National Bycatch Report."),width = 12), column(h5(""),width=12,plotOutput("gear_ll",height = '800px'))), column(h6(style="font-style: italic;","App developed by Heather Welch (UCSC/NOAA)"),width = 12) ), tabItem(tabName = "raw", fluidRow( column(h4(style="text-align:center;","This app explores relative bycatch performance in US fisheries with bycatch estimates published in the National Bycatch Report."),width = 12), column(h5(""),width=12,DT::dataTableOutput("rawTable")), column(h6(style="font-style: italic;","App developed by Heather Welch (UCSC/NOAA)"),width = 12) )) )) ) server <- shinyServer(function(input, output,session) { output$heatmap<-renderD3heatmap({ if(input$display=="Relative Bycatch Index"){ a=rbi %>% mutate(mean_criteria = apply(.[,37:48],1,function(x) weighted.mean(x,w=c(input$TB_lbs,input$TB_indv,input$BR,input$ESA_n,input$ESA_lbs,input$ESA_bt,input$IUCN_n,input$IUCN_lbs,input$IUCN_bt,input$mmpa,input$Tier,input$CV),na.rm=T)))#Here 'w' refers to the weights. # a=rbi %>% mutate(mean_criteria = apply(.[,29:40],1,function(x) weighted.mean(x,w=c(rep(1,9),input$mmpa,rep(1,2)),na.rm=T)))#Here 'w' refers to the weights. # a=rbi %>% mutate(mean_criteria = apply(.[,29:40],1,function(x) weighted.mean(x,w=c(rep(1,9),2,rep(1,2)),na.rm=T)))# delete this before launching q=a %>% select(Year,mean_criteria,Fishery) %>% spread(Year,mean_criteria) %>% mutate(Fishery=as.character(Fishery)) %>% arrange(desc(Fishery)) rownames(q)=q$Fishery q=q %>% .[,2:ncol(.)] d3heatmap(q, na.rm=T,Rowv = FALSE, Colv=FALSE, colors=c("#053061" ,"#2166AC", "#4393C3", "#D1E5F0" , "#FDDBC7", "#F4A582" ,"#D6604D" ,"#B2182B","#B2182B","#67001F"), xlab=w, show_grid=F, yaxis_width=400,show_color_legend=T,na_color="white",row_side_palette=c("#053061" ,"#2166AC", "#4393C3", "#D1E5F0" , "#FDDBC7", "#F4A582" ,"#D6604D" ,"#B2182B","#B2182B","#67001F") ) } else if(input$display=="Inter-criteria variance"){ a=rbi %>% mutate(mean_criteria = apply(.[,37:48],1,function(x) weighted.mean(x,w=c(rep(1,9),2,rep(1,2)),na.rm=T)))# delete this before launching q=rbi %>% select(Year,criteria_sd,Fishery)%>% mutate(criteria_sd=criteria_sd^2) %>% spread(Year,criteria_sd) %>% mutate(Fishery=as.character(Fishery)) %>% arrange(desc(Fishery)) rownames(q)=q$Fishery q=q %>% .[,2:ncol(.)] d3heatmap(q, na.rm=T,Rowv = FALSE, Colv=FALSE, colors=c("#440154FF", "#31688EFF" ,"#35B779FF", "#FDE725FF"), xlab=w, show_grid=F, yaxis_width=400,show_color_legend=T,na_color="white",row_side_palette=c("#440154FF", "#31688EFF" ,"#35B779FF", "#FDE725FF") ) } }) output$scale<-renderPlot({ if(input$display=="Relative Bycatch Index"){ # par(mar=c(1,.1,.1,.1)) a=rbi %>% mutate(mean_criteria = apply(.[,37:48],1,function(x) weighted.mean(x,w=c(input$TB_lbs,input$TB_indv,input$BR,input$ESA_n,input$ESA_lbs,input$ESA_bt,input$IUCN_n,input$IUCN_lbs,input$IUCN_bt,input$mmpa,input$Tier,input$CV),na.rm=T)))#Here 'w' refers to the weights. col.pal <- colorRampPalette(c("#053061" ,"#2166AC", "#4393C3", "#D1E5F0" , "#FDDBC7", "#F4A582" ,"#D6604D" ,"#B2182B","#B2182B","#67001F")) ncolors <- 100 #breaks <- seq(min(a$mean_criteria,na.rm = T),max(a$mean_criteria,na.rm = T),,ncolors+1) breaks <- seq(0,.51,,ncolors+1) levs <- breaks[-1] - diff(breaks)/2 # image(x=levs, y=1, z=as.matrix(levs), col=col.pal(ncolors), breaks=breaks, ylab="", xlab="", yaxt="n") par(mar=c(.1,.1,.1,.1)) image.plot(x=levs, y=1,smallplot= c(0,.2,.2,1), z=as.matrix(levs), legend.only = TRUE,col=col.pal(ncolors), breaks=breaks, ylab="", xlab="", yaxt="n",axis.args = list(cex.axis = .6)) } else if(input$display=="Inter-criteria variance"){ col.pal <- colorRampPalette(c("#440154FF", "#31688EFF" ,"#35B779FF", "#FDE725FF")) ncolors <- 100 breaks <- seq(min((rbi$criteria_sd)^2,na.rm = T),max(.31,na.rm = T),,ncolors+1) levs <- breaks[-1] - diff(breaks)/2 # image(x=levs, y=1, z=as.matrix(levs), col=col.pal(ncolors), breaks=breaks, ylab="", xlab="", yaxt="n") par(mar=c(.1,.1,.1,.1)) image.plot(x=levs, y=1,smallplot= c(0,.2,.2,1), z=as.matrix(levs), legend.only = TRUE,col=col.pal(ncolors), breaks=breaks, ylab="", xlab="", yaxt="n",axis.args = list(cex.axis = .6)) } }) # output$heatmap_SD<-renderD3heatmap({ # a=rbi %>% mutate(mean_criteria = apply(.[,29:40],1,function(x) weighted.mean(x,w=c(input$TB_lbs,input$TB_indv,input$BR,input$ESA_n,input$ESA_lbs,input$ESA_bt,input$IUCN_n,input$IUCN_lbs,input$IUCN_bt,input$mmpa,input$Tier,input$CV),na.rm=T)))#Here 'w' refers to the weights. # # a=rbi %>% mutate(mean_criteria = apply(.[,29:40],1,function(x) weighted.mean(x,w=c(rep(1,9),input$mmpa,rep(1,2)),na.rm=T)))#Here 'w' refers to the weights. # # a=rbi %>% mutate(mean_criteria = apply(.[,29:40],1,function(x) weighted.mean(x,w=c(rep(1,9),2,rep(1,2)),na.rm=T)))# delete this before launching # # q=a %>% select(Year,mean_criteria,Fishery) %>% spread(Year,mean_criteria) %>% mutate(Fishery=as.character(Fishery)) %>% arrange(desc(Fishery)) # rownames(q)=q$Fishery # q=q %>% .[,2:ncol(.)] # # d3heatmap(q, na.rm=T,Rowv = FALSE, Colv=FALSE, colors=c("#053061" ,"#2166AC", "#4393C3", "#D1E5F0" , "#FDDBC7", "#F4A582" ,"#D6604D" ,"#B2182B","#B2182B","#67001F"), # xlab=w, # show_grid=F, yaxis_width=400,show_color_legend=T,na_color="white",row_side_palette=c("#053061" ,"#2166AC", "#4393C3", "#D1E5F0" , "#FDDBC7", "#F4A582" ,"#D6604D" ,"#B2182B","#B2182B","#67001F") # # ) # }) # output$scale_SD<-renderPlot({ # # par(mar=c(1,.1,.1,.1)) # # a=rbi %>% mutate(mean_criteria = apply(.[,29:40],1,function(x) weighted.mean(x,w=c(rep(1,9),input$mmpa,rep(1,2)),na.rm=T))) # col.pal <- colorRampPalette(c("#440154FF", "#31688EFF" ,"#35B779FF", "#FDE725FF")) # ncolors <- 100 # breaks <- seq(min((rbi$criteria_sd)^2,na.rm = T),max(.31,na.rm = T),,ncolors+1) # levs <- breaks[-1] - diff(breaks)/2 # # image(x=levs, y=1, z=as.matrix(levs), col=col.pal(ncolors), breaks=breaks, ylab="", xlab="", yaxt="n") # par(mar=c(.1,.1,.1,.1)) # image.plot(x=levs, y=1,smallplot= c(0,.2,.2,1), z=as.matrix(levs), legend.only = TRUE,col=col.pal(ncolors), breaks=breaks, ylab="", xlab="", yaxt="n",axis.args = list(cex.axis = .6)) # # }) # output$placeholder=renderText({ # "test" # }) output$Fish<-renderPlot({ value=input$choice_sp if(value=="Don't subdivide"){ a=master %>% filter(GROUP=="invertebrate"|GROUP=="fish") %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% filter(UNIT=="POUND") %>% group_by(YEAR,FISHERY) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.FISH.INVERT)) %>% group_by(YEAR) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol),stat="identity")+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (lbs)")+xlab("Year")+ scale_y_log10(labels = scales::comma) b } if(value=="Region"){ a=master %>% filter(GROUP=="invertebrate"|GROUP=="fish") %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% filter(UNIT=="POUND") %>% group_by(YEAR,FISHERY,REGION) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.FISH.INVERT)) %>% group_by(YEAR,REGION) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol,fill=REGION),stat="identity", position = position_dodge())+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (lbs)")+xlab("Year")+ scale_fill_manual("",values=c("AK"="#7489ff","PI"="#c2c700","SE"="#00683b","WC"="#b45300","NE"="#afcf9d"),labels=c("AK"="Alaska","PI"="Pacific Islands","SE"="Southeast","WC"="Westcoast","NE"="Northeast"))+ scale_y_continuous(labels = comma) } if(value=="Gear type"){ a=master %>% filter(GROUP=="invertebrate"|GROUP=="fish") %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% filter(UNIT=="POUND") %>% group_by(YEAR,FISHERY,FISHERY.TYPE) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.FISH.INVERT)) %>% group_by(YEAR,FISHERY.TYPE) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol,fill=FISHERY.TYPE),stat="identity", position = position_dodge())+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (lbs)")+xlab("Year")+ scale_fill_manual("",values=c("jig"="#9f7bb2","dredge"="#7dac33","gillnet"="#c64f79","line"="#93ccaf","longline"="#8e97ee","pot"="#59663e","seine"="#ffca33","trawl"="#c5703f","troll"="#4d304b"))+ scale_y_continuous(labels = comma) } b }) output$Mammals<-renderPlot({ value=input$choice_sp if(value=="Don't subdivide"){ a=mammals %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.MM)) %>% group_by(YEAR) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol),stat="identity")+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (individuals)")+xlab("Year")+ scale_y_continuous(labels = comma) } if(value=="Region"){ a=mammals %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY,REGION) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.MM)) %>% group_by(YEAR,REGION) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol,fill=REGION),stat="identity", position = position_dodge())+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (individuals)")+xlab("Year")+ scale_fill_manual("",values=c("AK"="#7489ff","PI"="#c2c700","SE"="#00683b","WC"="#b45300","NE"="#afcf9d"),labels=c("AK"="Alaska","PI"="Pacific Islands","SE"="Southeast","WC"="Westcoast","NE"="Northeast"))+ scale_y_continuous(labels = comma) } if(value=="Gear type"){ a=mammals %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY,FISHERY.TYPE) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.MM)) %>% group_by(YEAR,FISHERY.TYPE) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol,fill=FISHERY.TYPE),stat="identity", position = position_dodge())+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (individuals)")+xlab("Year")+ scale_fill_manual("",values=c("jig"="#9f7bb2","dredge"="#7dac33","gillnet"="#c64f79","line"="#93ccaf","longline"="#8e97ee","pot"="#59663e","seine"="#ffca33","trawl"="#c5703f","troll"="#4d304b"))+ scale_y_continuous(labels = comma) } b }) output$SBST<-renderPlot({ value=input$choice_sp if(value=="Don't subdivide"){ a=master %>% filter(GROUP=="seabird"|GROUP=="sea turtle") %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015)%>% filter(UNIT=="INDIVIDUAL") %>% group_by(YEAR,FISHERY) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.SBST)) %>% group_by(YEAR) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol),stat="identity")+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (individuals)")+xlab("Year")+ scale_y_continuous(labels = comma) } if(value=="Region"){ a=master %>% filter(GROUP=="seabird"|GROUP=="sea turtle") %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015)%>% filter(UNIT=="INDIVIDUAL") %>% group_by(YEAR,FISHERY,REGION) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.SBST)) %>% group_by(YEAR,REGION) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol,fill=REGION),stat="identity", position = position_dodge())+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (individuals)")+xlab("Year")+ scale_fill_manual("",values=c("AK"="#7489ff","PI"="#c2c700","SE"="#00683b","WC"="#b45300","NE"="#afcf9d"),labels=c("AK"="Alaska","PI"="Pacific Islands","SE"="Southeast","WC"="Westcoast","NE"="Northeast"))+ scale_y_continuous(labels = comma) } if(value=="Gear type"){ a=master %>% filter(GROUP=="seabird"|GROUP=="sea turtle") %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015)%>% filter(UNIT=="INDIVIDUAL") %>% group_by(YEAR,FISHERY,FISHERY.TYPE) %>% summarise(newcol=mean(TOTAL.FISHERY.BYCATCH.SBST)) %>% group_by(YEAR,FISHERY.TYPE) %>% summarise(newcol=sum(newcol)) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol,fill=FISHERY.TYPE),stat="identity", position = position_dodge())+ theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total bycatch (individuals)")+xlab("Year")+ scale_fill_manual("",values=c("jig"="#9f7bb2","dredge"="#7dac33","gillnet"="#c64f79","line"="#93ccaf","longline"="#8e97ee","pot"="#59663e","seine"="#ffca33","trawl"="#c5703f","troll"="#4d304b"))+ scale_y_continuous(labels = comma) } b }) metric=reactive({ a=input$choice_metric b=grep(a,colnames(master),value=T) return(b) }) output$gear_ll<-renderPlot({ value=input$choice_gear if(metric()=="FISHERY.BYCATCH.RATIO"){ a=master %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY.TYPE) %>% summarise(newcol=mean(FISHERY.BYCATCH.RATIO,na.rm=T)) aa=master %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY.TYPE,REGION) %>% summarise(newcol=mean(FISHERY.BYCATCH.RATIO,na.rm=T)) if(value=="Don't subdivide"){ b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol),stat="identity")+facet_wrap(~FISHERY.TYPE,scales = "free_y")+ theme_bw() + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Bycatch ratio")+xlab("Year") } if(value=="Region"){ b=ggplot(aa) +geom_bar(aes(x=YEAR,y=newcol,fill=REGION),stat="identity", position = position_dodge())+facet_wrap(~FISHERY.TYPE,scales = "free_y")+ theme_bw() + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Bycatch ratio")+xlab("Year")+ scale_fill_manual("",values=c("AK"="#7489ff","PI"="#c2c700","SE"="#00683b","WC"="#b45300","NE"="#afcf9d"),labels=c("AK"="Alaska","PI"="Pacific Islands","SE"="Southeast","WC"="Westcoast","NE"="Northeast")) } } if(metric()=="TOTAL.FISHERY.LANDINGS"){ a=master %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY.TYPE) %>% summarise(newcol=sum(TOTAL.FISHERY.LANDINGS,na.rm=T)) aa=master %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY.TYPE,REGION) %>% summarise(newcol=sum(TOTAL.FISHERY.LANDINGS,na.rm=T)) if(value=="Don't subdivide"){ options(scipen=10000) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol),stat="identity")+facet_wrap(~FISHERY.TYPE,scales = "free_y")+ theme_bw() + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total landings")+xlab("Year")+scale_y_log10(labels = scales::comma) } if(value=="Region"){ options(scipen=10000) b=ggplot(aa) +geom_bar(aes(x=YEAR,y=newcol,fill=REGION),stat="identity", position = position_dodge())+facet_wrap(~FISHERY.TYPE,scales = "free_y")+ theme_bw() + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total landings")+xlab("Year")+scale_y_log10(labels = scales::comma)+ scale_fill_manual("",values=c("AK"="#7489ff","PI"="#c2c700","SE"="#00683b","WC"="#b45300","NE"="#afcf9d"),labels=c("AK"="Alaska","PI"="Pacific Islands","SE"="Southeast","WC"="Westcoast","NE"="Northeast")) } } if(metric()=="TOTAL.CATCH"){ a=master %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY.TYPE) %>% summarise(newcol=sum(TOTAL.CATCH,na.rm=T)) aa=master %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY.TYPE,REGION) %>% summarise(newcol=sum(TOTAL.CATCH,na.rm=T)) if(value=="Don't subdivide"){ options(scipen=10000) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol),stat="identity")+facet_wrap(~FISHERY.TYPE,scales = "free_y")+ theme_bw() + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total catch")+xlab("Year")+scale_y_log10(labels = scales::comma) } if(value=="Region"){ options(scipen=10000) b=ggplot(aa) +geom_bar(aes(x=YEAR,y=newcol,fill=REGION),stat="identity", position = position_dodge())+facet_wrap(~FISHERY.TYPE,scales = "free_y")+ theme_bw() + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Total catch")+xlab("Year")+scale_y_log10(labels = scales::comma)+ scale_fill_manual("",values=c("AK"="#7489ff","PI"="#c2c700","SE"="#00683b","WC"="#b45300","NE"="#afcf9d"),labels=c("AK"="Alaska","PI"="Pacific Islands","SE"="Southeast","WC"="Westcoast","NE"="Northeast")) } } if(metric()=="NUM.FISH"){ a=master %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY.TYPE,FISHERY) %>% summarise(newcol=n()) %>% distinct() %>% group_by(YEAR,FISHERY.TYPE)%>% summarise(newcol=n()) aa=master %>% filter(YEAR==2010|YEAR==2011|YEAR==2012|YEAR==2013|YEAR==2014|YEAR==2015) %>% group_by(YEAR,FISHERY.TYPE,REGION,FISHERY) %>% summarise(newcol=n()) %>% distinct() %>% group_by(YEAR,FISHERY.TYPE,REGION)%>% summarise(newcol=n()) if(value=="Don't subdivide"){ options(scipen=10000) b=ggplot(a) +geom_bar(aes(x=YEAR,y=newcol),stat="identity")+facet_wrap(~FISHERY.TYPE,scales = "free_y")+ theme_bw() + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Number of fisheries")+xlab("Year") } if(value=="Region"){ options(scipen=10000) b=ggplot(aa) +geom_bar(aes(x=YEAR,y=newcol,fill=REGION),stat="identity", position = position_dodge())+facet_wrap(~FISHERY.TYPE,scales = "free_y")+ theme_bw() + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), strip.background = element_blank(), panel.border = element_rect(colour = "black"))+ylab("Number of fisheries")+xlab("Year")+ scale_fill_manual("",values=c("AK"="#7489ff","PI"="#c2c700","SE"="#00683b","WC"="#b45300","NE"="#afcf9d"),labels=c("AK"="Alaska","PI"="Pacific Islands","SE"="Southeast","WC"="Westcoast","NE"="Northeast")) } } if(input$Free_y==T){ b=b+facet_wrap(~FISHERY.TYPE,scales = "fixed") } b }) # }, height = function() { # session$clientData$output_gear_ll_width # }) output$rawTable<-DT::renderDataTable({ a=master_extra_raw #%>% select(-c(TOTAL.FISHERY.BYCATCH.MM,TOTAL.FISHERY.BYCATCH.SBST,NUM.FISH,TOTAL.FISHERY.BYCATCH.FISH.INVERT,OBSERVER.COVERAGE,TOTAL.FISHERY.LANDINGS,TOTAL.CATCH)) fish=input$raw_fishery sp=input$raw_species # # if(input$raw_species=="Don't filter" & input$raw_fishery=="Don't filter"& input$raw_gear=="Don't filter"){ # b=a # } else if(input$raw_species=="Don't filter" & input$raw_fishery!="Don't filter"& input$raw_gear!="Don't filter"){ # b=a %>% filter(FISHERY==input$raw_fishery) # } else if(input$raw_species!="Don't filter" & input$raw_fishery=="Don't filter"& input$raw_gear!="Don't filter"){ # b=a %>% filter(SCIENTIFIC.NAME==input$raw_species) # } else if(input$raw_species!="Don't filter" & input$raw_fishery!="Don't filter"){ # b=a %>% filter(FISHERY==input$raw_fishery & SCIENTIFIC.NAME==input$raw_species) # } if(input$raw_species!="Don't filter"){ a=a %>% filter(SCIENTIFIC.NAME==input$raw_species) } if(input$raw_fishery!="Don't filter"){ a=a %>% filter(FISHERY==input$raw_fishery) } if(input$raw_gear!="Don't filter"){ a=a %>% filter(FISHERY.TYPE==input$raw_gear) } datatable(a,options=list(scrollX=TRUE)) }) filtered_data=reactive({ a=master_extra_raw if(input$raw_species!="Don't filter"){ a=a %>% filter(SCIENTIFIC.NAME==input$raw_species) } if(input$raw_fishery!="Don't filter"){ a=a %>% filter(FISHERY==input$raw_fishery) } if(input$raw_gear!="Don't filter"){ a=a %>% filter(FISHERY.TYPE==input$raw_gear) } return(a) }) output$downloadDataF <- downloadHandler( filename = function() { paste("National_Bycatch_Database", ".csv", sep = "") }, content = function(file) { write.csv(filtered_data(), file, row.names = FALSE) }) output$downloadDataM <- downloadHandler( filename = "US_Bycatch_analysis_Raw_data_metadata.pdf", content = function(file) { file.copy("data/US_Bycatch_analysis_Raw_data_metadata.pdf", file) }) }) shinyApp(ui = ui, server = server)
#' Launch precisely Shiny app #' #' `launch_precisely_app()` launches a Shiny app to calculate and plot #' precision, sample size, and upper limit calculations. #' #' @export launch_precisely_app <- function() { app_dir <- system.file("shiny_app", "precisely", package = "precisely") if (app_dir == "") { stop("Shiny app not found. Try re-installing `precisely`.", call. = FALSE) } shiny::runApp(app_dir, display.mode = "normal") }
/R/shiny_precisely.R
permissive
malcolmbarrett/precisely
R
false
false
445
r
#' Launch precisely Shiny app #' #' `launch_precisely_app()` launches a Shiny app to calculate and plot #' precision, sample size, and upper limit calculations. #' #' @export launch_precisely_app <- function() { app_dir <- system.file("shiny_app", "precisely", package = "precisely") if (app_dir == "") { stop("Shiny app not found. Try re-installing `precisely`.", call. = FALSE) } shiny::runApp(app_dir, display.mode = "normal") }
### test subsample ### LU decomposition and singular subsamples handling require(robustbase) source(system.file("xtraR/subsample-fns.R", package = "robustbase", mustWork=TRUE)) ## instead of relying on system.file("test-tools-1.R", package="Matrix"): source(system.file("xtraR/test-tools.R", package = "robustbase")) # assert.EQ(), showProc.time() .. options(nwarnings = 4e4) cat("doExtras:", doExtras <- robustbase:::doExtras(),"\n") showProc.time() A <- rbind(c(0.001, 1), c(1, 2)) set.seed(11) str(sa <- tstSubsample(A)) A <- rbind(c(3, 17, 10), c(2, 4, -2), c(6, 18, 12)) tstSubsample(A) ## test some random matrix set.seed(1002) A <- matrix(rnorm(100), 10) tstSubsample(A) ## test singular matrix handling A <- rbind(c(1, 0, 0), c(0, 1, 0), c(0, 1, 0), c(0, 0, 1)) tstSubsample(A) ## test subsample with mts > 0 data <- data.frame(y = rnorm(9), expand.grid(A = letters[1:3], B = letters[1:3])) x <- model.matrix(y ~ ., data) y <- data$y ## this should produce a warning and return status == 2 showSys.time(z <- Rsubsample(x, y, mts=2)) stopifnot(z$status == 2) ## test equilibration ## columns only X <- rbind(c(1e-7, 1e-10), c(2 , 0.2)) y <- 1:2 tstSubsample(t(X), y) ## rows only X <- rbind(c(1e-7, 1e+10), c(2 , 0.2)) y <- 1:2 tstSubsample(X, y) ## both X <- rbind(c(1e-7, 2 ), c(1e10, 2e12)) y <- 1:2 tstSubsample(X, y) showProc.time() ## test real data example data(possumDiv)## 151 * 9; the last two variables are factors with(possumDiv, table(eucalyptus, aspect)) mf <- model.frame(Diversity ~ .^2, possumDiv) X <- model.matrix(mf, possumDiv) y <- model.response(mf) stopifnot(qr(X)$rank == ncol(X)) ## this used to fail: different pivots in step 37 str(s1 <- tstSubsample(X, y)) s2 <- tstSubsample(X / max(abs(X)), y / max(abs(X))) s3 <- tstSubsample(X * 2^-50, y * 2^-50) ## all components *BUT* x, y, lu, Dr, Dc, rowequ, colequ : nm <- names(s1); nm <- nm[is.na(match(nm, c("x","y","lu", "Dr", "Dc", "rowequ", "colequ")))] stopifnot(all.equal(s1[nm], s2[nm], tolerance=1e-10), all.equal(s1[nm], s3[nm], tolerance=1e-10)) showProc.time() set.seed(10) nsing <- sum(replicate(if(doExtras) 200 else 20, tstSubsampleSing(X, y))) stopifnot(nsing == 0) showProc.time() ## test example with many categorical predictors - 2 different random seeds: set.seed(10) ; r1 <- lmrob(Diversity ~ .^2 , data = possumDiv, cov="none") set.seed(108); r2 <- lmrob(Diversity ~ .^2 , data = possumDiv, cov="none")# lmrob.S() failed (i1 <- r1$init) # print(<lmrob.S>) (i2 <- r1$init) # ... and they are "somewhat" close: stopifnot(all.equal(r1[names(r1) != "init.S"], r2[names(r2) != "init.S"], tol = 0.40)) c1 <- coef(r1) c2 <- coef(r2) relD <- (c1-c2)*2/(c1+c2) xCf <- which(abs(relD) >= 10) stopifnot(exprs = { identical(xCf, c(`Bark:aspectSW-NW` = 46L)) all.equal(c1[-xCf], c2[-xCf], tol = 0.35) # 0.3418 sign(c1[-xCf]) == sign(c2[-xCf]) }) showProc.time() ## investigate problematic subsample: idc <- 1 + c(140, 60, 12, 13, 89, 90, 118, 80, 17, 134, 59, 94, 36, 43, 46, 93, 107, 62, 57, 116, 11, 45, 35, 38, 120, 34, 29, 33, 147, 105, 115, 92, 61, 91, 104, 141, 138, 129, 130, 84, 119, 132, 6, 135, 112, 16, 67, 41, 102, 76, 111, 82, 148, 24, 131, 10, 96, 0, 87, 21, 127, 56, 124) rc <- lm(Diversity ~ .^2 , data = possumDiv, subset = idc) X <- model.matrix(rc) y <- possumDiv$Diversity[idc] tstSubsample(X, y)## have different pivots ... could not find non-singular lu <- LU.gaxpy(t(X)) stopifnot(lu$sing) zc <- Rsubsample(X, y) stopifnot(zc$status > 0) ## column 52 is linearly dependent and should have been discarded ## qr(t(X))$pivot image(as(round(zc$lu - (lu$L + lu$U - diag(nrow(lu$U))), 10), "Matrix")) image(as( sign(zc$lu) - sign(lu$L + lu$U - diag(nrow(lu$U))), "Matrix")) showProc.time() ## test equilibration ## colequ only X <- matrix(c(1e-7, 2, 1e-10, 0.2), 2) y <- 1:2 tstSubsample(t(X), y) ## rowequ only X <- matrix(c(1e-7, 2, 1e10, 0.2), 2) y <- 1:2 tstSubsample(X, y) ## both X <- matrix(c(1e-7, 1e10, 2, 2e12), 2) y <- 1:2 tstSubsample(X, y) showProc.time() ### real data, see MM's ~/R/MM/Pkg-ex/robustbase/hedlmrob.R ## close to singular cov(): attach(system.file("external", "d1k27.rda", package="robustbase", mustWork=TRUE)) fm1 <- lmrob(y ~ a + I(a^2) + tf + I(tf^2) + A + I(A^2) + . , data = d1k27) ## ^^^^^ gave error, earlier, now with a warning -- use ".vcov.w" ## --> cov = ".vcov.w" fm2 <- lmrob(y ~ a + I(a^2) + tf + I(tf^2) + A + I(A^2) + . , data = d1k27, cov = ".vcov.w", trace = TRUE) showProc.time()# 2.77 if(doExtras) withAutoprint({##--------------------------------------------------------- ## Q: does it change to use numeric instead of binary factors ? ## A: not really .. d1k.n <- d1k27 d1k.n[-(1:5)] <- lapply(d1k27[,-(1:5)], as.numeric) fm1.n <- lmrob(y ~ a + I(a^2) + tf + I(tf^2) + A + I(A^2) + . , data = d1k.n) fm2.n <- lmrob(y ~ a + I(a^2) + tf + I(tf^2) + A + I(A^2) + . , data = d1k.n, cov = ".vcov.w", trace = 2) summary(weights(fm1, type="robustness")) hist(weights(fm1, type="robustness"), main="robustness weights of fm1") rug(weights(fm1, type="robustness")) showProc.time()## 2.88 ## fmc <- lm (y ~ poly(a,2)-a + poly(tf, 2)-tf + poly(A, 2)-A + . , data = d1k27) summary(fmc) ## -> has NA's for 'a, tf, A' --- bad that it did *not* work to remove them nform <- update(formula(fm1), ~ . +poly(A,2) -A -I(A^2) +poly(a,2) -a -I(a^2) +poly(tf,2) -tf -I(tf^2)) fm1. <- lmrob(nform, data = d1k27)# now w/o warning !? !! fm2. <- lmrob(nform, data = d1k27, cov = ".vcov.w", trace = TRUE) ## now lmrob takes care of NA coefficients automatically lmrob(y ~ poly(a,2)-a + poly(tf, 2)-tf + poly(A, 2)-A + . , data = d1k27) showProc.time() ## 4.24 }) ## only if(doExtras) ----------------------------------------------------- ## test exact fit property set.seed(20) data <- data.frame(y=c(rep.int(0, 20), round(100*rnorm(5))), group=rep(letters[1:5], each=5)) x <- model.matrix(y ~ group, data) (ini <- lmrob.S(x, data$y, lmrob.control())) (ret <- lmrob(y ~ group, data)) summary(ret) showProc.time() ## 4.24 ##--- continuous x -- exact fit -- inspired by Thomas Mang's real data example mkD9 <- function(iN, dN = 1:m) { stopifnot((length(iN) -> m) == length(dN), 1 <= m, m <= 5, iN == as.integer(iN), is.numeric(dN), !is.na(dN)) x <- c(-3:0,0:1,1:3) # {n=9; sorted; x= 0, 1 are "doubled"} y <- x+5 y[iN] <- y[iN] + dN data.frame(x,y) } mkRS <- function(...) { set.seed(...); .Random.seed } d <- mkD9(c(1L,3:4, 7L)) rs2 <- mkRS(2) Se <- tryCatch(error = identity, with(d, lmrob.S(cbind(1,x), y, lmrob.control("KS2014", seed=rs2)))) ## gave DGELS rank error {for lmrob.c+wg..} if(inherits(Se, "error")) { cat("Caught ") print(Se) } else withAutoprint({ ## no error coef(Se) stopifnot(coef(Se) == c(5, 1)) # was (0 0) residuals(Se) # was == y ---- FIXME }) ## try 100 different seeds repS <- lapply(1:100, function(ii) tryCatch(error = identity, with(d, lmrob.S(cbind(1,x), y, lmrob.control("KS2014", seed = mkRS(ii)))))) if(FALSE) ## was str(unique(repS))## ==> 100 times the same error ## now completely different: *all* returned properly str(cfS <- t(sapply(repS, coef))) # all numeric -- not *one* error -- ## even all the *same* (5 1) solution: (ucfS <- unique(cfS)) stopifnot(identical(ucfS, array(c(5, 1), dim = 1:2, dimnames = list(NULL, c("", "x"))))) ## *Not* "KS2014" but the defaults works *all the time* (!) repS0 <- lapply(1:100, function(ii) tryCatch(error = identity, with(d, lmrob.S(cbind(1,x), y, lmrob.control(seed = mkRS(ii)))))) summary(warnings()) ## 100 identical warnings: ## In lmrob.S(cbind(1, x), y, lmrob.control(seed = mkRS(ii))) : ## S-estimated scale == 0: Probably exact fit; check your data str(cfS0 <- t(sapply(repS0, coef))) # all numeric -- not *one* error ## even all the same *and* the same as "KS2014" (ucfS0 <- unique(cfS0)) stopifnot(nrow(ucfS0) == 1L, ucfS0 == c(5,1)) d9L <- list( mkD9(c(1L,3L, 5L, 7L)) , mkD9(c(1L,3L, 8:9)) , mkD9(2L*(1:4)) ) if(doExtras) { sfsmisc::mult.fig(length(d9L)); invisible(lapply(d9L, function(d) plot(y ~ x, data=d))) } dorob <- function(dat, control=lmrob.control(...), meth = c("S", "MM"), doPl=interactive(), cex=1, ...) { meth <- match.arg(meth) stopifnot(is.data.frame(dat), c("x","y") %in% names(dat), is.list(control)) if(doPl) plot(y ~ x, data=dat) ## with(dat, n.plot(x, y, cex=cex)) ans <- tryCatch(error = identity, switch(meth , "S" = with(dat, lmrob.S(cbind(1,x), y, control)) , "MM"= lmrob(y ~ x, data = dat, control=control) , stop("invalid 'meth'"))) if(!doPl) return(ans) ## else if(!inherits(ans, "error")) { abline(coef(ans)) } else { # error mtext(paste(paste0("lmrob.", meth), "Error:", conditionMessage(ans))) } invisible(ans) } ## a bad case -- much better new robustbase >= 0.99-0 Se <- dorob(d9L[[1]], lmrob.control("KS2014", mkRS(2), trace.lev=4)) ## was really bad -- ended returning coef = (0 0); fitted == 0, residuals == 0 !! if(doExtras) sfsmisc::mult.fig(length(d9L)) r0 <- lapply(d9L, dorob, seed=rs2, doPl=doExtras) # 3 x ".. exact fit" warning if(doExtras) print(r0) ## back to 3 identical fits: (5 1) (cf0 <- sapply(r0, coef)) stopifnot(cf0 == c(5,1)) if(doExtras) sfsmisc::mult.fig(length(d9L)) ### Here, all 3 were "0-models" r14 <- lapply(d9L, dorob, control=lmrob.control("KS2014", seed=rs2), doPl=doExtras) ## --> 3 (identical) warnings: In lmrob.S(cbind(1, x), y, control) :# ## S-estimated scale == 0: Probably exact fit; check your data ## now *does* plot if(doExtras) print(r14) ## all 3 are "identical" (cf14 <- sapply(r14, coef)) identical(cf0, cf14) # see TRUE; test a bit less: stopifnot(all.equal(cf0, cf14, tol=1e-15)) ## use "large n" ctrl.LRG.n <- lmrob.control("KS2014", seed=rs2, trace.lev = if(doExtras) 2 else 1, # 3: too much (for now), nResample = 60, fast.s.large.n = 7, n.group = 3, groups = 2) rLrg.n <- lapply(d9L, \(d) lmrob.S(cbind(1,d$x), d$y, ctrl.LRG.n)) summary(warnings()) sapply(rLrg.n, coef) ## currently ... .... really would want always (5 1) ## [,1] [,2] [,3] ## [1,] 5 5 7.333333 ## [2,] 1 1 1.666667 ## ==> use lmrob() instead of lmrob.S(): mm0 <- lapply(d9L, dorob, meth = "MM", seed=rs2, doPl=doExtras) # looks all fine -- no longer: error in [[3]] if(doExtras) print(mm0) ## now, the 3rd one errors (on Linux, not on M1 mac!) (cm0 <- sapply(mm0, function(.) if(inherits(.,"error")) noquote(paste("Caught", as.character(.))) else coef(.))) ## no longer needed c0.12 <- rbind(`(Intercept)` = c(5.7640215, 6.0267156), x = c(0.85175883, 1.3823841)) if(is.list(cm0)) { ## after error {was on Linux+Win, not on M1 mac}: ## NB: This does *not* happen on Macbuilder -- there the result it cf = (5 1) !! stopifnot(all.equal(tol = 1e-8, # seen 4.4376e-9 c0.12, simplify2array(cm0[1:2]))) print(cm0[[3]]) ## FIXME?: Caught Error in eigen(ret, symmetric = TRUE): infinite or missing values in 'x'\n } else if(is.matrix(cm0)) { # when no error happened k <- ncol(cm0) stopifnot(all.equal(tol = 1e-8, rbind(`(Intercept)` = rep(5,k), "x" = rep(1,k)), cm0)) } else warning("not yet encountered this case {and it should not happen}") se3 <- lmrob(y ~ x, data=d9L[[3]], init = r0[[3]], seed=rs2, trace.lev=6) if(doExtras) sfsmisc::mult.fig(length(d9L)) ### Here, all 3 were "0-models" ## now, have 3 *different* cases {with this seed} ## [1] : init fails (-> r14[[1]] above) ## [2] : init s=0, b=(5,1) .. but residuals(),fitted() wrong ## [3] : init s=0, b=(5,1) ..*and* residuals(),fitted() are good cm14 <- lapply(d9L, dorob, meth = "MM", control=lmrob.control("KS2014", seed=rs2), doPl=doExtras) ## now, first is error; for others, coef = (5, 1) are correct: stopifnot(exprs = { sapply(cm14[-1], coef) == c(5,1) sapply(cm14[-1], sigma) == 0 }) m2 <- cm14[[2]] summary(m2) # prints quite nicely; and this is perfect (for scale=0), too: ## {residual != 0 <==> weights = 0}: cbind(rwgt = weights(m2, "rob"), res = residuals(m2), fit = fitted(m2), y = d9L[[2]][,"y"]) sapply(cm14, residuals) ## now, [2] is good; [3] still wrong - FIXME sapply(cm14, fitted) sapply(cm14, weights, "robust")## [2]: 0 1 0 1 1 1 1 0 0; [3]: all 0 ## (unfinished ... do *test* once we've checked platform consistency) summary(warnings()) showProc.time()
/tests/subsample.R
no_license
cran/robustbase
R
false
false
12,864
r
### test subsample ### LU decomposition and singular subsamples handling require(robustbase) source(system.file("xtraR/subsample-fns.R", package = "robustbase", mustWork=TRUE)) ## instead of relying on system.file("test-tools-1.R", package="Matrix"): source(system.file("xtraR/test-tools.R", package = "robustbase")) # assert.EQ(), showProc.time() .. options(nwarnings = 4e4) cat("doExtras:", doExtras <- robustbase:::doExtras(),"\n") showProc.time() A <- rbind(c(0.001, 1), c(1, 2)) set.seed(11) str(sa <- tstSubsample(A)) A <- rbind(c(3, 17, 10), c(2, 4, -2), c(6, 18, 12)) tstSubsample(A) ## test some random matrix set.seed(1002) A <- matrix(rnorm(100), 10) tstSubsample(A) ## test singular matrix handling A <- rbind(c(1, 0, 0), c(0, 1, 0), c(0, 1, 0), c(0, 0, 1)) tstSubsample(A) ## test subsample with mts > 0 data <- data.frame(y = rnorm(9), expand.grid(A = letters[1:3], B = letters[1:3])) x <- model.matrix(y ~ ., data) y <- data$y ## this should produce a warning and return status == 2 showSys.time(z <- Rsubsample(x, y, mts=2)) stopifnot(z$status == 2) ## test equilibration ## columns only X <- rbind(c(1e-7, 1e-10), c(2 , 0.2)) y <- 1:2 tstSubsample(t(X), y) ## rows only X <- rbind(c(1e-7, 1e+10), c(2 , 0.2)) y <- 1:2 tstSubsample(X, y) ## both X <- rbind(c(1e-7, 2 ), c(1e10, 2e12)) y <- 1:2 tstSubsample(X, y) showProc.time() ## test real data example data(possumDiv)## 151 * 9; the last two variables are factors with(possumDiv, table(eucalyptus, aspect)) mf <- model.frame(Diversity ~ .^2, possumDiv) X <- model.matrix(mf, possumDiv) y <- model.response(mf) stopifnot(qr(X)$rank == ncol(X)) ## this used to fail: different pivots in step 37 str(s1 <- tstSubsample(X, y)) s2 <- tstSubsample(X / max(abs(X)), y / max(abs(X))) s3 <- tstSubsample(X * 2^-50, y * 2^-50) ## all components *BUT* x, y, lu, Dr, Dc, rowequ, colequ : nm <- names(s1); nm <- nm[is.na(match(nm, c("x","y","lu", "Dr", "Dc", "rowequ", "colequ")))] stopifnot(all.equal(s1[nm], s2[nm], tolerance=1e-10), all.equal(s1[nm], s3[nm], tolerance=1e-10)) showProc.time() set.seed(10) nsing <- sum(replicate(if(doExtras) 200 else 20, tstSubsampleSing(X, y))) stopifnot(nsing == 0) showProc.time() ## test example with many categorical predictors - 2 different random seeds: set.seed(10) ; r1 <- lmrob(Diversity ~ .^2 , data = possumDiv, cov="none") set.seed(108); r2 <- lmrob(Diversity ~ .^2 , data = possumDiv, cov="none")# lmrob.S() failed (i1 <- r1$init) # print(<lmrob.S>) (i2 <- r1$init) # ... and they are "somewhat" close: stopifnot(all.equal(r1[names(r1) != "init.S"], r2[names(r2) != "init.S"], tol = 0.40)) c1 <- coef(r1) c2 <- coef(r2) relD <- (c1-c2)*2/(c1+c2) xCf <- which(abs(relD) >= 10) stopifnot(exprs = { identical(xCf, c(`Bark:aspectSW-NW` = 46L)) all.equal(c1[-xCf], c2[-xCf], tol = 0.35) # 0.3418 sign(c1[-xCf]) == sign(c2[-xCf]) }) showProc.time() ## investigate problematic subsample: idc <- 1 + c(140, 60, 12, 13, 89, 90, 118, 80, 17, 134, 59, 94, 36, 43, 46, 93, 107, 62, 57, 116, 11, 45, 35, 38, 120, 34, 29, 33, 147, 105, 115, 92, 61, 91, 104, 141, 138, 129, 130, 84, 119, 132, 6, 135, 112, 16, 67, 41, 102, 76, 111, 82, 148, 24, 131, 10, 96, 0, 87, 21, 127, 56, 124) rc <- lm(Diversity ~ .^2 , data = possumDiv, subset = idc) X <- model.matrix(rc) y <- possumDiv$Diversity[idc] tstSubsample(X, y)## have different pivots ... could not find non-singular lu <- LU.gaxpy(t(X)) stopifnot(lu$sing) zc <- Rsubsample(X, y) stopifnot(zc$status > 0) ## column 52 is linearly dependent and should have been discarded ## qr(t(X))$pivot image(as(round(zc$lu - (lu$L + lu$U - diag(nrow(lu$U))), 10), "Matrix")) image(as( sign(zc$lu) - sign(lu$L + lu$U - diag(nrow(lu$U))), "Matrix")) showProc.time() ## test equilibration ## colequ only X <- matrix(c(1e-7, 2, 1e-10, 0.2), 2) y <- 1:2 tstSubsample(t(X), y) ## rowequ only X <- matrix(c(1e-7, 2, 1e10, 0.2), 2) y <- 1:2 tstSubsample(X, y) ## both X <- matrix(c(1e-7, 1e10, 2, 2e12), 2) y <- 1:2 tstSubsample(X, y) showProc.time() ### real data, see MM's ~/R/MM/Pkg-ex/robustbase/hedlmrob.R ## close to singular cov(): attach(system.file("external", "d1k27.rda", package="robustbase", mustWork=TRUE)) fm1 <- lmrob(y ~ a + I(a^2) + tf + I(tf^2) + A + I(A^2) + . , data = d1k27) ## ^^^^^ gave error, earlier, now with a warning -- use ".vcov.w" ## --> cov = ".vcov.w" fm2 <- lmrob(y ~ a + I(a^2) + tf + I(tf^2) + A + I(A^2) + . , data = d1k27, cov = ".vcov.w", trace = TRUE) showProc.time()# 2.77 if(doExtras) withAutoprint({##--------------------------------------------------------- ## Q: does it change to use numeric instead of binary factors ? ## A: not really .. d1k.n <- d1k27 d1k.n[-(1:5)] <- lapply(d1k27[,-(1:5)], as.numeric) fm1.n <- lmrob(y ~ a + I(a^2) + tf + I(tf^2) + A + I(A^2) + . , data = d1k.n) fm2.n <- lmrob(y ~ a + I(a^2) + tf + I(tf^2) + A + I(A^2) + . , data = d1k.n, cov = ".vcov.w", trace = 2) summary(weights(fm1, type="robustness")) hist(weights(fm1, type="robustness"), main="robustness weights of fm1") rug(weights(fm1, type="robustness")) showProc.time()## 2.88 ## fmc <- lm (y ~ poly(a,2)-a + poly(tf, 2)-tf + poly(A, 2)-A + . , data = d1k27) summary(fmc) ## -> has NA's for 'a, tf, A' --- bad that it did *not* work to remove them nform <- update(formula(fm1), ~ . +poly(A,2) -A -I(A^2) +poly(a,2) -a -I(a^2) +poly(tf,2) -tf -I(tf^2)) fm1. <- lmrob(nform, data = d1k27)# now w/o warning !? !! fm2. <- lmrob(nform, data = d1k27, cov = ".vcov.w", trace = TRUE) ## now lmrob takes care of NA coefficients automatically lmrob(y ~ poly(a,2)-a + poly(tf, 2)-tf + poly(A, 2)-A + . , data = d1k27) showProc.time() ## 4.24 }) ## only if(doExtras) ----------------------------------------------------- ## test exact fit property set.seed(20) data <- data.frame(y=c(rep.int(0, 20), round(100*rnorm(5))), group=rep(letters[1:5], each=5)) x <- model.matrix(y ~ group, data) (ini <- lmrob.S(x, data$y, lmrob.control())) (ret <- lmrob(y ~ group, data)) summary(ret) showProc.time() ## 4.24 ##--- continuous x -- exact fit -- inspired by Thomas Mang's real data example mkD9 <- function(iN, dN = 1:m) { stopifnot((length(iN) -> m) == length(dN), 1 <= m, m <= 5, iN == as.integer(iN), is.numeric(dN), !is.na(dN)) x <- c(-3:0,0:1,1:3) # {n=9; sorted; x= 0, 1 are "doubled"} y <- x+5 y[iN] <- y[iN] + dN data.frame(x,y) } mkRS <- function(...) { set.seed(...); .Random.seed } d <- mkD9(c(1L,3:4, 7L)) rs2 <- mkRS(2) Se <- tryCatch(error = identity, with(d, lmrob.S(cbind(1,x), y, lmrob.control("KS2014", seed=rs2)))) ## gave DGELS rank error {for lmrob.c+wg..} if(inherits(Se, "error")) { cat("Caught ") print(Se) } else withAutoprint({ ## no error coef(Se) stopifnot(coef(Se) == c(5, 1)) # was (0 0) residuals(Se) # was == y ---- FIXME }) ## try 100 different seeds repS <- lapply(1:100, function(ii) tryCatch(error = identity, with(d, lmrob.S(cbind(1,x), y, lmrob.control("KS2014", seed = mkRS(ii)))))) if(FALSE) ## was str(unique(repS))## ==> 100 times the same error ## now completely different: *all* returned properly str(cfS <- t(sapply(repS, coef))) # all numeric -- not *one* error -- ## even all the *same* (5 1) solution: (ucfS <- unique(cfS)) stopifnot(identical(ucfS, array(c(5, 1), dim = 1:2, dimnames = list(NULL, c("", "x"))))) ## *Not* "KS2014" but the defaults works *all the time* (!) repS0 <- lapply(1:100, function(ii) tryCatch(error = identity, with(d, lmrob.S(cbind(1,x), y, lmrob.control(seed = mkRS(ii)))))) summary(warnings()) ## 100 identical warnings: ## In lmrob.S(cbind(1, x), y, lmrob.control(seed = mkRS(ii))) : ## S-estimated scale == 0: Probably exact fit; check your data str(cfS0 <- t(sapply(repS0, coef))) # all numeric -- not *one* error ## even all the same *and* the same as "KS2014" (ucfS0 <- unique(cfS0)) stopifnot(nrow(ucfS0) == 1L, ucfS0 == c(5,1)) d9L <- list( mkD9(c(1L,3L, 5L, 7L)) , mkD9(c(1L,3L, 8:9)) , mkD9(2L*(1:4)) ) if(doExtras) { sfsmisc::mult.fig(length(d9L)); invisible(lapply(d9L, function(d) plot(y ~ x, data=d))) } dorob <- function(dat, control=lmrob.control(...), meth = c("S", "MM"), doPl=interactive(), cex=1, ...) { meth <- match.arg(meth) stopifnot(is.data.frame(dat), c("x","y") %in% names(dat), is.list(control)) if(doPl) plot(y ~ x, data=dat) ## with(dat, n.plot(x, y, cex=cex)) ans <- tryCatch(error = identity, switch(meth , "S" = with(dat, lmrob.S(cbind(1,x), y, control)) , "MM"= lmrob(y ~ x, data = dat, control=control) , stop("invalid 'meth'"))) if(!doPl) return(ans) ## else if(!inherits(ans, "error")) { abline(coef(ans)) } else { # error mtext(paste(paste0("lmrob.", meth), "Error:", conditionMessage(ans))) } invisible(ans) } ## a bad case -- much better new robustbase >= 0.99-0 Se <- dorob(d9L[[1]], lmrob.control("KS2014", mkRS(2), trace.lev=4)) ## was really bad -- ended returning coef = (0 0); fitted == 0, residuals == 0 !! if(doExtras) sfsmisc::mult.fig(length(d9L)) r0 <- lapply(d9L, dorob, seed=rs2, doPl=doExtras) # 3 x ".. exact fit" warning if(doExtras) print(r0) ## back to 3 identical fits: (5 1) (cf0 <- sapply(r0, coef)) stopifnot(cf0 == c(5,1)) if(doExtras) sfsmisc::mult.fig(length(d9L)) ### Here, all 3 were "0-models" r14 <- lapply(d9L, dorob, control=lmrob.control("KS2014", seed=rs2), doPl=doExtras) ## --> 3 (identical) warnings: In lmrob.S(cbind(1, x), y, control) :# ## S-estimated scale == 0: Probably exact fit; check your data ## now *does* plot if(doExtras) print(r14) ## all 3 are "identical" (cf14 <- sapply(r14, coef)) identical(cf0, cf14) # see TRUE; test a bit less: stopifnot(all.equal(cf0, cf14, tol=1e-15)) ## use "large n" ctrl.LRG.n <- lmrob.control("KS2014", seed=rs2, trace.lev = if(doExtras) 2 else 1, # 3: too much (for now), nResample = 60, fast.s.large.n = 7, n.group = 3, groups = 2) rLrg.n <- lapply(d9L, \(d) lmrob.S(cbind(1,d$x), d$y, ctrl.LRG.n)) summary(warnings()) sapply(rLrg.n, coef) ## currently ... .... really would want always (5 1) ## [,1] [,2] [,3] ## [1,] 5 5 7.333333 ## [2,] 1 1 1.666667 ## ==> use lmrob() instead of lmrob.S(): mm0 <- lapply(d9L, dorob, meth = "MM", seed=rs2, doPl=doExtras) # looks all fine -- no longer: error in [[3]] if(doExtras) print(mm0) ## now, the 3rd one errors (on Linux, not on M1 mac!) (cm0 <- sapply(mm0, function(.) if(inherits(.,"error")) noquote(paste("Caught", as.character(.))) else coef(.))) ## no longer needed c0.12 <- rbind(`(Intercept)` = c(5.7640215, 6.0267156), x = c(0.85175883, 1.3823841)) if(is.list(cm0)) { ## after error {was on Linux+Win, not on M1 mac}: ## NB: This does *not* happen on Macbuilder -- there the result it cf = (5 1) !! stopifnot(all.equal(tol = 1e-8, # seen 4.4376e-9 c0.12, simplify2array(cm0[1:2]))) print(cm0[[3]]) ## FIXME?: Caught Error in eigen(ret, symmetric = TRUE): infinite or missing values in 'x'\n } else if(is.matrix(cm0)) { # when no error happened k <- ncol(cm0) stopifnot(all.equal(tol = 1e-8, rbind(`(Intercept)` = rep(5,k), "x" = rep(1,k)), cm0)) } else warning("not yet encountered this case {and it should not happen}") se3 <- lmrob(y ~ x, data=d9L[[3]], init = r0[[3]], seed=rs2, trace.lev=6) if(doExtras) sfsmisc::mult.fig(length(d9L)) ### Here, all 3 were "0-models" ## now, have 3 *different* cases {with this seed} ## [1] : init fails (-> r14[[1]] above) ## [2] : init s=0, b=(5,1) .. but residuals(),fitted() wrong ## [3] : init s=0, b=(5,1) ..*and* residuals(),fitted() are good cm14 <- lapply(d9L, dorob, meth = "MM", control=lmrob.control("KS2014", seed=rs2), doPl=doExtras) ## now, first is error; for others, coef = (5, 1) are correct: stopifnot(exprs = { sapply(cm14[-1], coef) == c(5,1) sapply(cm14[-1], sigma) == 0 }) m2 <- cm14[[2]] summary(m2) # prints quite nicely; and this is perfect (for scale=0), too: ## {residual != 0 <==> weights = 0}: cbind(rwgt = weights(m2, "rob"), res = residuals(m2), fit = fitted(m2), y = d9L[[2]][,"y"]) sapply(cm14, residuals) ## now, [2] is good; [3] still wrong - FIXME sapply(cm14, fitted) sapply(cm14, weights, "robust")## [2]: 0 1 0 1 1 1 1 0 0; [3]: all 0 ## (unfinished ... do *test* once we've checked platform consistency) summary(warnings()) showProc.time()
context("checkbox_suffixes.R") load(test_path("testdata", "RedcapProject_RedcapTestApi.Rdata")) purgeProject(rcon, purge_all = TRUE) rcon$flush_all() restoreProject(RedcapProject_RedcapTestApi, rcon) CheckboxMetaData <- exportMetaData(rcon) CheckboxMetaData <- CheckboxMetaData[CheckboxMetaData$field_name %in% c("prereq_checkbox"), ] # For the purpose of testing, we are going to add a couple more options to these meta data # Doing it this way allows us to add tests for any code/label mapping without having to # alter the testing database. CheckboxMetaData$select_choices_or_calculations <- paste0(CheckboxMetaData$select_choices_or_calculations, " | lowercase, Lowercase code | mixedCase, Mixed case code | 12ab, alpha, numeric | use_underscore, Use an underscore") test_that( "Checkbox suffixes are correctly generated", { expect_equal( checkbox_suffixes(fields = c("prereq_checkbox"), meta_data = CheckboxMetaData), list(name_suffix = c(prereq_checkbox1 = "prereq_checkbox___1", prereq_checkbox2 = "prereq_checkbox___2", prereq_checkbox3 = "prereq_checkbox___abc", prereq_checkbox4 = "prereq_checkbox___4", prereq_checkbox5 = "prereq_checkbox___lowercase", prereq_checkbox6 = "prereq_checkbox___mixedcase", prereq_checkbox7 = "prereq_checkbox___12ab", prereq_checkbox8 = "prereq_checkbox___use_underscore"), label_suffix = c(prereq_checkbox1 = "Pre-requisite as a checkbox: Checkbox1", prereq_checkbox2 = "Pre-requisite as a checkbox: Checkbox2", prereq_checkbox3 = "Pre-requisite as a checkbox: CheckboxABC", prereq_checkbox4 = "Pre-requisite as a checkbox: Do not use in branching logic", prereq_checkbox5 = "Pre-requisite as a checkbox: Lowercase code", prereq_checkbox6 = "Pre-requisite as a checkbox: Mixed case code", prereq_checkbox7 = "Pre-requisite as a checkbox: alpha, numeric", prereq_checkbox8 = "Pre-requisite as a checkbox: Use an underscore")) ) } )
/tests/testthat/test-checkbox_suffixes.R
no_license
cran/redcapAPI
R
false
false
2,369
r
context("checkbox_suffixes.R") load(test_path("testdata", "RedcapProject_RedcapTestApi.Rdata")) purgeProject(rcon, purge_all = TRUE) rcon$flush_all() restoreProject(RedcapProject_RedcapTestApi, rcon) CheckboxMetaData <- exportMetaData(rcon) CheckboxMetaData <- CheckboxMetaData[CheckboxMetaData$field_name %in% c("prereq_checkbox"), ] # For the purpose of testing, we are going to add a couple more options to these meta data # Doing it this way allows us to add tests for any code/label mapping without having to # alter the testing database. CheckboxMetaData$select_choices_or_calculations <- paste0(CheckboxMetaData$select_choices_or_calculations, " | lowercase, Lowercase code | mixedCase, Mixed case code | 12ab, alpha, numeric | use_underscore, Use an underscore") test_that( "Checkbox suffixes are correctly generated", { expect_equal( checkbox_suffixes(fields = c("prereq_checkbox"), meta_data = CheckboxMetaData), list(name_suffix = c(prereq_checkbox1 = "prereq_checkbox___1", prereq_checkbox2 = "prereq_checkbox___2", prereq_checkbox3 = "prereq_checkbox___abc", prereq_checkbox4 = "prereq_checkbox___4", prereq_checkbox5 = "prereq_checkbox___lowercase", prereq_checkbox6 = "prereq_checkbox___mixedcase", prereq_checkbox7 = "prereq_checkbox___12ab", prereq_checkbox8 = "prereq_checkbox___use_underscore"), label_suffix = c(prereq_checkbox1 = "Pre-requisite as a checkbox: Checkbox1", prereq_checkbox2 = "Pre-requisite as a checkbox: Checkbox2", prereq_checkbox3 = "Pre-requisite as a checkbox: CheckboxABC", prereq_checkbox4 = "Pre-requisite as a checkbox: Do not use in branching logic", prereq_checkbox5 = "Pre-requisite as a checkbox: Lowercase code", prereq_checkbox6 = "Pre-requisite as a checkbox: Mixed case code", prereq_checkbox7 = "Pre-requisite as a checkbox: alpha, numeric", prereq_checkbox8 = "Pre-requisite as a checkbox: Use an underscore")) ) } )
library(graphics) #Define headers header <- read.table("household_power_consumption.txt", nrows = 1, sep = ";") #Read table with all column values read as characters HHPwConsump <- read.table("household_power_consumption.txt", header = FALSE, sep = ";", skip = 1, colClasses = rep("character", 9)) #Set headers as column names colnames(HHPwConsump) <- unlist(header) #Find and subset relevant data HHPwConsump_sub <- HHPwConsump[which(HHPwConsump$Date == "1/2/2007" | HHPwConsump$Date == "2/2/2007"), ] #For columns that should be numeric, replace "?" (for missing data) with NA HHPwConsump_sub[, 3:9][HHPwConsump_sub[, 3:9] == "?"] <- NA #For columns that should be numeric, set their value type to numeric HHPwConsump_sub[, 3:9] <- as.numeric(unlist(HHPwConsump_sub[, 3:9])) #Concatenate Date and Time columns for simplicity DateTime <- paste(HHPwConsump_sub$Date, HHPwConsump_sub$Time, sep = " ") #Change Date/Time data from character representation to a POSIXlt object DataTimes <- strptime(DateTime, "%d/%m/%Y %H:%M:%S") #Create png file of the plot png(filename = "plot4.png", width = 480, height = 480, units = "px") #Set graphical parameters such that more than one graph can appear in a plot par(mfcol = c(2, 2)) #Plot 2 plot(DataTimes, HHPwConsump_sub$Global_active_power, type = "l", xlab = "", ylab = "Global Active Power") #Plot 3 plot(DataTimes, HHPwConsump_sub$Sub_metering_1, type = "l", ylab = "Energy sub metering", xlab = "", col = "black") lines(DataTimes, HHPwConsump_sub$Sub_metering_2, col = "red") lines(DataTimes, HHPwConsump_sub$Sub_metering_3, col = "blue") legend("topright", legend = c("Sub_metering_1", "Sub_metering_2", "Sub_metering_3"), lty = 1, col = c("black", "red", "blue"), bty = "n") #A new plot plot(DataTimes, HHPwConsump_sub$Voltage, type = "l", xlab = "datetime", ylab = "Voltage") #A second new plot plot(DataTimes, HHPwConsump_sub$Global_reactive_power, type = "l", xlab = "datetime", ylab = "Global_reactive_power") dev.off()
/plot4.R
no_license
sng0616/ExData_Plotting1
R
false
false
1,975
r
library(graphics) #Define headers header <- read.table("household_power_consumption.txt", nrows = 1, sep = ";") #Read table with all column values read as characters HHPwConsump <- read.table("household_power_consumption.txt", header = FALSE, sep = ";", skip = 1, colClasses = rep("character", 9)) #Set headers as column names colnames(HHPwConsump) <- unlist(header) #Find and subset relevant data HHPwConsump_sub <- HHPwConsump[which(HHPwConsump$Date == "1/2/2007" | HHPwConsump$Date == "2/2/2007"), ] #For columns that should be numeric, replace "?" (for missing data) with NA HHPwConsump_sub[, 3:9][HHPwConsump_sub[, 3:9] == "?"] <- NA #For columns that should be numeric, set their value type to numeric HHPwConsump_sub[, 3:9] <- as.numeric(unlist(HHPwConsump_sub[, 3:9])) #Concatenate Date and Time columns for simplicity DateTime <- paste(HHPwConsump_sub$Date, HHPwConsump_sub$Time, sep = " ") #Change Date/Time data from character representation to a POSIXlt object DataTimes <- strptime(DateTime, "%d/%m/%Y %H:%M:%S") #Create png file of the plot png(filename = "plot4.png", width = 480, height = 480, units = "px") #Set graphical parameters such that more than one graph can appear in a plot par(mfcol = c(2, 2)) #Plot 2 plot(DataTimes, HHPwConsump_sub$Global_active_power, type = "l", xlab = "", ylab = "Global Active Power") #Plot 3 plot(DataTimes, HHPwConsump_sub$Sub_metering_1, type = "l", ylab = "Energy sub metering", xlab = "", col = "black") lines(DataTimes, HHPwConsump_sub$Sub_metering_2, col = "red") lines(DataTimes, HHPwConsump_sub$Sub_metering_3, col = "blue") legend("topright", legend = c("Sub_metering_1", "Sub_metering_2", "Sub_metering_3"), lty = 1, col = c("black", "red", "blue"), bty = "n") #A new plot plot(DataTimes, HHPwConsump_sub$Voltage, type = "l", xlab = "datetime", ylab = "Voltage") #A second new plot plot(DataTimes, HHPwConsump_sub$Global_reactive_power, type = "l", xlab = "datetime", ylab = "Global_reactive_power") dev.off()
\name{is.basis} \alias{is.basis} \title{ Confirm Object is Class "Basisfd" } \description{ Check that an argument is a basis object. } \usage{ is.basis(basisobj) } \arguments{ \item{basisobj}{ an object to be checked. } } \value{ a logical value: \code{TRUE} if the class is correct, \code{FALSE} otherwise. } \seealso{ \code{\link{is.fd}}, \code{\link{is.fdPar}}, \code{\link{is.Lfd}} } % docclass is function \keyword{smooth}
/man/is.basis.Rd
no_license
cran/fda
R
false
false
432
rd
\name{is.basis} \alias{is.basis} \title{ Confirm Object is Class "Basisfd" } \description{ Check that an argument is a basis object. } \usage{ is.basis(basisobj) } \arguments{ \item{basisobj}{ an object to be checked. } } \value{ a logical value: \code{TRUE} if the class is correct, \code{FALSE} otherwise. } \seealso{ \code{\link{is.fd}}, \code{\link{is.fdPar}}, \code{\link{is.Lfd}} } % docclass is function \keyword{smooth}