content
large_stringlengths
0
6.46M
path
large_stringlengths
3
331
license_type
large_stringclasses
2 values
repo_name
large_stringlengths
5
125
language
large_stringclasses
1 value
is_vendor
bool
2 classes
is_generated
bool
2 classes
length_bytes
int64
4
6.46M
extension
large_stringclasses
75 values
text
stringlengths
0
6.46M
#!/usr/bin/env Rscript library(lattice) library(ggplot2) args = commandArgs(TRUE) if (length(args)==0){ stop("\n\nboxPlotFactors title factors.tab outfile.pdf\n\n") } titleRoot = args[1] fileName = args[2] plotOutFile = args[3] #titleRoot = "BLCA" #fileName = "factors.tab" #plotOutFile = "output.pdf" classifiers = read.table(fileName,sep="\t",header=TRUE) #classifiers # Make median ordered factors... bymedianFilter = with(classifiers, reorder(filter, -roc, median)) bymedianclassAttr = with(classifiers, reorder(classAttribute, -roc, median)) bymedianAttrSel = with(classifiers, reorder(attributeSelection, -roc, median)) bymedianNumAttributes = with(classifiers, reorder(factor(numAttributes), -roc, median)) bymedianClassifier = with(classifiers, reorder(classifier, -roc, median)) pdf(file=plotOutFile) q = qplot(bymedianFilter,roc,data=classifiers,geom="boxplot") q+theme(axis.text.x = element_text(angle=45,hjust=1))+labs(title=paste(titleRoot,"Performance by Filter")) q = qplot(bymedianclassAttr,roc,data=classifiers,geom="boxplot") q+theme(axis.text.x = element_text(angle=45,hjust=1))+labs(title=paste(titleRoot,"")) q = qplot(bymedianAttrSel,roc,data=classifiers,geom="boxplot") q+theme(axis.text.x = element_text(angle=45,hjust=1))+labs(title=paste(titleRoot,"Performance by Attribute Selection")) q = qplot(bymedianNumAttributes,roc,data=classifiers,geom="boxplot") q+theme(axis.text.x = element_text(angle=45,hjust=1))+labs(title=paste(titleRoot,"Performance by Number of Attributes")) q = qplot(bymedianClassifier,roc,data=classifiers,geom="boxplot") q+theme(axis.text.x = element_text(angle=45,hjust=1))+labs(title=paste(titleRoot,"Performance by Classifier Type")) garbage = dev.off()
/boxPlotFactors.R
permissive
jdurbin/wekaMine
R
false
false
1,721
r
#!/usr/bin/env Rscript library(lattice) library(ggplot2) args = commandArgs(TRUE) if (length(args)==0){ stop("\n\nboxPlotFactors title factors.tab outfile.pdf\n\n") } titleRoot = args[1] fileName = args[2] plotOutFile = args[3] #titleRoot = "BLCA" #fileName = "factors.tab" #plotOutFile = "output.pdf" classifiers = read.table(fileName,sep="\t",header=TRUE) #classifiers # Make median ordered factors... bymedianFilter = with(classifiers, reorder(filter, -roc, median)) bymedianclassAttr = with(classifiers, reorder(classAttribute, -roc, median)) bymedianAttrSel = with(classifiers, reorder(attributeSelection, -roc, median)) bymedianNumAttributes = with(classifiers, reorder(factor(numAttributes), -roc, median)) bymedianClassifier = with(classifiers, reorder(classifier, -roc, median)) pdf(file=plotOutFile) q = qplot(bymedianFilter,roc,data=classifiers,geom="boxplot") q+theme(axis.text.x = element_text(angle=45,hjust=1))+labs(title=paste(titleRoot,"Performance by Filter")) q = qplot(bymedianclassAttr,roc,data=classifiers,geom="boxplot") q+theme(axis.text.x = element_text(angle=45,hjust=1))+labs(title=paste(titleRoot,"")) q = qplot(bymedianAttrSel,roc,data=classifiers,geom="boxplot") q+theme(axis.text.x = element_text(angle=45,hjust=1))+labs(title=paste(titleRoot,"Performance by Attribute Selection")) q = qplot(bymedianNumAttributes,roc,data=classifiers,geom="boxplot") q+theme(axis.text.x = element_text(angle=45,hjust=1))+labs(title=paste(titleRoot,"Performance by Number of Attributes")) q = qplot(bymedianClassifier,roc,data=classifiers,geom="boxplot") q+theme(axis.text.x = element_text(angle=45,hjust=1))+labs(title=paste(titleRoot,"Performance by Classifier Type")) garbage = dev.off()
#' Haplotype Diversity #' @description This function calculates haplotipe diversity from DNAbin sequence file #' @param x a DNAbin object #' @return Number of haplotypes and haplotype diversity and of x. #' @author Marcelo Gehara #' @references Nei, M., & Tajima, F. (1981). DNA polymorphism detectable by restriction endonucleases. Genetics, 97, 145–163. #' @note requires Pegas package #' @export H.div<-function(x){ h<-pegas::haplotype(x) hap<-attr(h, "index") n.hap<-length(hap) h.freqs<-NULL for(i in 1:n.hap){ freq<-length(hap[[i]])/nrow(x) h.freqs<-c(h.freqs,freq) } H.d = (nrow(x)/(nrow(x)-1))*(1 - sum(h.freqs^2)) return(c(n.hap,H.d)) }
/R/hap.div.R
no_license
gehara/PipeMaster
R
false
false
676
r
#' Haplotype Diversity #' @description This function calculates haplotipe diversity from DNAbin sequence file #' @param x a DNAbin object #' @return Number of haplotypes and haplotype diversity and of x. #' @author Marcelo Gehara #' @references Nei, M., & Tajima, F. (1981). DNA polymorphism detectable by restriction endonucleases. Genetics, 97, 145–163. #' @note requires Pegas package #' @export H.div<-function(x){ h<-pegas::haplotype(x) hap<-attr(h, "index") n.hap<-length(hap) h.freqs<-NULL for(i in 1:n.hap){ freq<-length(hap[[i]])/nrow(x) h.freqs<-c(h.freqs,freq) } H.d = (nrow(x)/(nrow(x)-1))*(1 - sum(h.freqs^2)) return(c(n.hap,H.d)) }
library(DoE.base) ### Name: Class design and accessors ### Title: Class design and its accessor functions ### Aliases: design undesign redesign desnum desnum<- run.order run.order<- ### design.info design.info<- factor.names factor.names<- response.names ### response.names<- col.remove ord ### Keywords: array design ### ** Examples oa12 <- oa.design(nlevels=c(2,2,6)) #### Examples for factor.names and response.names factor.names(oa12) ## rename factors factor.names(oa12) <- c("First.Factor", "Second.Factor", "Third.Factor") ## rename factors and relabel levels of first two factors namen <- c(rep(list(c("current","new")),2),list("")) names(namen) <- c("First.Factor", "Second.Factor", "Third.Factor") factor.names(oa12) <- namen oa12 ## add a few variables to oa12 responses <- cbind(temp=sample(23:34),y1=rexp(12),y2=runif(12)) oa12 <- add.response(oa12, responses) response.names(oa12) ## temp (for temperature) is not meant to be a response ## --> drop it from responselist but not from data response.names(oa12) <- c("y1","y2") ## looking at attributes of the design desnum(oa12) run.order(oa12) design.info(oa12) ## undesign and redesign u.oa12 <- undesign(oa12) str(u.oa12) u.oa12$new <- rnorm(12) r.oa12 <- redesign(oa12, u.oa12) ## make known that new is also a response response.names(r.oa12) <- c(response.names(r.oa12), "new") ## look at design-specific summary summary(r.oa12) ## look at data frame style summary instead summary.data.frame(r.oa12)
/data/genthat_extracted_code/DoE.base/examples/class-design.Rd.R
no_license
surayaaramli/typeRrh
R
false
false
1,538
r
library(DoE.base) ### Name: Class design and accessors ### Title: Class design and its accessor functions ### Aliases: design undesign redesign desnum desnum<- run.order run.order<- ### design.info design.info<- factor.names factor.names<- response.names ### response.names<- col.remove ord ### Keywords: array design ### ** Examples oa12 <- oa.design(nlevels=c(2,2,6)) #### Examples for factor.names and response.names factor.names(oa12) ## rename factors factor.names(oa12) <- c("First.Factor", "Second.Factor", "Third.Factor") ## rename factors and relabel levels of first two factors namen <- c(rep(list(c("current","new")),2),list("")) names(namen) <- c("First.Factor", "Second.Factor", "Third.Factor") factor.names(oa12) <- namen oa12 ## add a few variables to oa12 responses <- cbind(temp=sample(23:34),y1=rexp(12),y2=runif(12)) oa12 <- add.response(oa12, responses) response.names(oa12) ## temp (for temperature) is not meant to be a response ## --> drop it from responselist but not from data response.names(oa12) <- c("y1","y2") ## looking at attributes of the design desnum(oa12) run.order(oa12) design.info(oa12) ## undesign and redesign u.oa12 <- undesign(oa12) str(u.oa12) u.oa12$new <- rnorm(12) r.oa12 <- redesign(oa12, u.oa12) ## make known that new is also a response response.names(r.oa12) <- c(response.names(r.oa12), "new") ## look at design-specific summary summary(r.oa12) ## look at data frame style summary instead summary.data.frame(r.oa12)
trains <- 6 stations <- 27 Args <- commandArgs(); # retrieve args folder = Args[8]; #Go through all train files for(t in 0:trains){ #Create output files reg_outfile <- paste(folder, "/train_", t, "_reg_plot.txt", sep=""); hand_outfile <- paste(folder, "/train_", t, "_hand_plot.txt", sep=""); #Read input files reg_file <- paste(folder, "/train_", t, "_reg.dat", sep=""); hand_file <- paste(folder, "/train_", t, "_hand.dat", sep=""); reg_table <-read.table(reg_file,header=FALSE, sep="\t"); hand_table <-read.table(hand_file,header=FALSE, sep="\t"); mean_reg <- 0; std_reg <- 0; std_error_reg <- 0; mean_hand <- 0; std_hand <- 0; std_error_hand <- 0; for(s in 1:stations){ mean_reg[s] <- mean(reg_table[1:nrow(reg_table),s]); std_reg[s] <- sd(reg_table[1:nrow(reg_table),s]); std_error_reg[s] <- std_reg[s]/sqrt(nrow(reg_table)); mean_hand[s] <- mean(hand_table[1:nrow(hand_table),s]); std_hand[s] <- sd(hand_table[1:nrow(hand_table),s]); std_error_hand[s] <- std_hand[s]/sqrt(nrow(hand_table)); write( c(s, mean_reg[s], (std_error_reg[s]*1.96) ) , file=reg_outfile, append=T, sep=" "); write( c(s, mean_hand[s], (std_error_hand[s]*1.96) ) , file=hand_outfile, append=T, sep=" "); } } q()
/scripts/train_results.R
no_license
DevanR/RailwaySimulator
R
false
false
1,262
r
trains <- 6 stations <- 27 Args <- commandArgs(); # retrieve args folder = Args[8]; #Go through all train files for(t in 0:trains){ #Create output files reg_outfile <- paste(folder, "/train_", t, "_reg_plot.txt", sep=""); hand_outfile <- paste(folder, "/train_", t, "_hand_plot.txt", sep=""); #Read input files reg_file <- paste(folder, "/train_", t, "_reg.dat", sep=""); hand_file <- paste(folder, "/train_", t, "_hand.dat", sep=""); reg_table <-read.table(reg_file,header=FALSE, sep="\t"); hand_table <-read.table(hand_file,header=FALSE, sep="\t"); mean_reg <- 0; std_reg <- 0; std_error_reg <- 0; mean_hand <- 0; std_hand <- 0; std_error_hand <- 0; for(s in 1:stations){ mean_reg[s] <- mean(reg_table[1:nrow(reg_table),s]); std_reg[s] <- sd(reg_table[1:nrow(reg_table),s]); std_error_reg[s] <- std_reg[s]/sqrt(nrow(reg_table)); mean_hand[s] <- mean(hand_table[1:nrow(hand_table),s]); std_hand[s] <- sd(hand_table[1:nrow(hand_table),s]); std_error_hand[s] <- std_hand[s]/sqrt(nrow(hand_table)); write( c(s, mean_reg[s], (std_error_reg[s]*1.96) ) , file=reg_outfile, append=T, sep=" "); write( c(s, mean_hand[s], (std_error_hand[s]*1.96) ) , file=hand_outfile, append=T, sep=" "); } } q()
setwd("/Users/ruchirpatel/Documents/R/Assignment3/ExData_Plotting1/Assignment") data <- read.table("household_power_consumption.txt", sep = ";", header = TRUE, stringsAsFactors = FALSE) data$headerDate <- as.Date(data$headerDate, "%d/%m/%Y") start <- as.Date("2007-02-01") finish <- as.Date("2007-02-02") data1 <- subset(data, data$headerDate== start | data$headerDate == finish) data1$Global_active_power[data1$Global_active_power=="?"] <- "0" data1$Global_active_power <- as.numeric(data1$Global_active_power) datetime <- paste( data1$headerDate, data1$Time) datetime <- as.POSIXct(datetime) data1$date <- datetime data1$Sub_metering_1<- as.numeric(data1$Sub_metering_1) data1$Sub_metering_2 <- as.numeric(data1$Sub_metering_2) data1$Sub_metering_3 <- as.numeric(data1$Sub_metering_3) data1$Votage <- as.numeric((data1$Voltage)) data1[is.na(data1$Sub_metering_2)] <- 0 data1[is.na(data1$Sub_metering_3)] <- 0 png("plot3.png", width = 480, height = 480) plot(data1$Sub_metering_1 ~ data1$date, type="l", ylab = "Energy sub metering", ylim = c(0, max(data1$Sub_metering_1, data1$Sub_metering_2, data1$Sub_metering_3))) lines(data1$Sub_metering_2, type = "l", col = "red") lines(data1$Sub_metering_3, type = "l", col = "blue") legend("topright", c("Sub_metering_1", "Sub_metering_2", "Sub_metering_3"), lty=1, lwd=2.5, col=c("black", "red", "blue")) dev.off()
/Plot3.R
no_license
ruchirpatel22/ExData_Plotting1
R
false
false
1,364
r
setwd("/Users/ruchirpatel/Documents/R/Assignment3/ExData_Plotting1/Assignment") data <- read.table("household_power_consumption.txt", sep = ";", header = TRUE, stringsAsFactors = FALSE) data$headerDate <- as.Date(data$headerDate, "%d/%m/%Y") start <- as.Date("2007-02-01") finish <- as.Date("2007-02-02") data1 <- subset(data, data$headerDate== start | data$headerDate == finish) data1$Global_active_power[data1$Global_active_power=="?"] <- "0" data1$Global_active_power <- as.numeric(data1$Global_active_power) datetime <- paste( data1$headerDate, data1$Time) datetime <- as.POSIXct(datetime) data1$date <- datetime data1$Sub_metering_1<- as.numeric(data1$Sub_metering_1) data1$Sub_metering_2 <- as.numeric(data1$Sub_metering_2) data1$Sub_metering_3 <- as.numeric(data1$Sub_metering_3) data1$Votage <- as.numeric((data1$Voltage)) data1[is.na(data1$Sub_metering_2)] <- 0 data1[is.na(data1$Sub_metering_3)] <- 0 png("plot3.png", width = 480, height = 480) plot(data1$Sub_metering_1 ~ data1$date, type="l", ylab = "Energy sub metering", ylim = c(0, max(data1$Sub_metering_1, data1$Sub_metering_2, data1$Sub_metering_3))) lines(data1$Sub_metering_2, type = "l", col = "red") lines(data1$Sub_metering_3, type = "l", col = "blue") legend("topright", c("Sub_metering_1", "Sub_metering_2", "Sub_metering_3"), lty=1, lwd=2.5, col=c("black", "red", "blue")) dev.off()
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/compareFit.R \name{compareFit} \alias{compareFit} \title{Build an object summarizing fit indices across multiple models} \usage{ compareFit(..., nested = TRUE, argsLRT = list(), indices = TRUE, moreIndices = FALSE, baseline.model = NULL, nPrior = 1) } \arguments{ \item{...}{fitted \code{lavaan} models or list(s) of \code{lavaan} objects. \code{\linkS4class{lavaan.mi}} objects are also accepted, but all models must belong to the same class.} \item{nested}{\code{logical} indicating whether the models in \code{...} are nested. See \code{\link{net}} for an empirical test of nesting.} \item{argsLRT}{\code{list} of arguments to pass to \code{\link[lavaan]{lavTestLRT}}, as well as to \code{\link{lavTestLRT.mi}} and \code{\link{fitMeasures}} when comparing \code{\linkS4class{lavaan.mi}} models.} \item{indices}{\code{logical} indicating whether to return fit indices from the \code{\link[lavaan]{fitMeasures}} function. Selecting particular indices is controlled in the \code{summary} method; see \code{\linkS4class{FitDiff}}.} \item{moreIndices}{\code{logical} indicating whether to return fit indices from the \code{\link{moreFitIndices}} function. Selecting particular indices is controlled in the \code{summary} method; see \code{\linkS4class{FitDiff}}.} \item{baseline.model}{optional fitted \code{\linkS4class{lavaan}} model passed to \code{\link[lavaan]{fitMeasures}} to calculate incremental fit indices.} \item{nPrior}{passed to \code{\link{moreFitIndices}}, if relevant} } \value{ A \code{\linkS4class{FitDiff}} object that saves model fit comparisons across multiple models. If the models are not nested, only fit indices for each model are returned. If the models are nested, the differences in fit indices are additionally returned, as well as test statistics comparing each sequential pair of models (ordered by their degrees of freedom). } \description{ This function will create the template to compare fit indices across multiple fitted lavaan objects. The results can be exported to a clipboard or a file later. } \examples{ HS.model <- ' visual =~ x1 + x2 + x3 textual =~ x4 + x5 + x6 speed =~ x7 + x8 + x9 ' ## non-nested models fit1 <- cfa(HS.model, data = HolzingerSwineford1939) m2 <- ' f1 =~ x1 + x2 + x3 + x4 f2 =~ x5 + x6 + x7 + x8 + x9 ' fit2 <- cfa(m2, data = HolzingerSwineford1939) (out1 <- compareFit(fit1, fit2, nested = FALSE)) summary(out1) ## nested model comparisons: measurement equivalence/invariance fit.config <- cfa(HS.model, data = HolzingerSwineford1939, group = "school") fit.metric <- cfa(HS.model, data = HolzingerSwineford1939, group = "school", group.equal = "loadings") fit.scalar <- cfa(HS.model, data = HolzingerSwineford1939, group = "school", group.equal = c("loadings","intercepts")) fit.strict <- cfa(HS.model, data = HolzingerSwineford1939, group = "school", group.equal = c("loadings","intercepts","residuals")) measEqOut <- compareFit(fit.config, fit.metric, fit.scalar, fit.strict, moreIndices = TRUE) # include moreFitIndices() summary(measEqOut) summary(measEqOut, fit.measures = "all") summary(measEqOut, fit.measures = c("aic", "bic", "sic", "ibic")) \dontrun{ ## also applies to lavaan.mi objects (fit model to multiple imputations) set.seed(12345) HSMiss <- HolzingerSwineford1939[ , paste("x", 1:9, sep = "")] HSMiss$x5 <- ifelse(HSMiss$x1 <= quantile(HSMiss$x1, .3), NA, HSMiss$x5) HSMiss$x9 <- ifelse(is.na(HSMiss$x5), NA, HSMiss$x9) HSMiss$school <- HolzingerSwineford1939$school library(Amelia) HS.amelia <- amelia(HSMiss, m = 20, noms = "school") imps <- HS.amelia$imputations ## request robust test statistics mgfit2 <- cfa.mi(HS.model, data = imps, group = "school", estimator = "mlm") mgfit1 <- cfa.mi(HS.model, data = imps, group = "school", estimator = "mlm", group.equal = "loadings") mgfit0 <- cfa.mi(HS.model, data = imps, group = "school", estimator = "mlm", group.equal = c("loadings","intercepts")) ## request the strictly-positive robust test statistics out2 <- compareFit(scalar = mgfit0, metric = mgfit1, config = mgfit2, argsLRT = list(asymptotic = TRUE, method = "satorra.bentler.2010")) ## note that moreFitIndices() does not work for lavaan.mi objects, but the ## fitMeasures() method for lavaan.mi objects already returns gammaHat(s) summary(out2, fit.measures = c("ariv","fmi","df","crmr","srmr", "cfi.robust","tli.robust", "adjGammaHat.scaled","rmsea.ci.lower.robust", "rmsea.robust","rmsea.ci.upper.robust")) } } \seealso{ \code{\linkS4class{FitDiff}}, \code{\link{clipboard}} } \author{ Terrence D. Jorgensen (University of Amsterdam; \email{TJorgensen314@gmail.com}) Sunthud Pornprasertmanit (\email{psunthud@gmail.com}) }
/semTools/man/compareFit.Rd
no_license
simsem/semTools
R
false
true
5,030
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/compareFit.R \name{compareFit} \alias{compareFit} \title{Build an object summarizing fit indices across multiple models} \usage{ compareFit(..., nested = TRUE, argsLRT = list(), indices = TRUE, moreIndices = FALSE, baseline.model = NULL, nPrior = 1) } \arguments{ \item{...}{fitted \code{lavaan} models or list(s) of \code{lavaan} objects. \code{\linkS4class{lavaan.mi}} objects are also accepted, but all models must belong to the same class.} \item{nested}{\code{logical} indicating whether the models in \code{...} are nested. See \code{\link{net}} for an empirical test of nesting.} \item{argsLRT}{\code{list} of arguments to pass to \code{\link[lavaan]{lavTestLRT}}, as well as to \code{\link{lavTestLRT.mi}} and \code{\link{fitMeasures}} when comparing \code{\linkS4class{lavaan.mi}} models.} \item{indices}{\code{logical} indicating whether to return fit indices from the \code{\link[lavaan]{fitMeasures}} function. Selecting particular indices is controlled in the \code{summary} method; see \code{\linkS4class{FitDiff}}.} \item{moreIndices}{\code{logical} indicating whether to return fit indices from the \code{\link{moreFitIndices}} function. Selecting particular indices is controlled in the \code{summary} method; see \code{\linkS4class{FitDiff}}.} \item{baseline.model}{optional fitted \code{\linkS4class{lavaan}} model passed to \code{\link[lavaan]{fitMeasures}} to calculate incremental fit indices.} \item{nPrior}{passed to \code{\link{moreFitIndices}}, if relevant} } \value{ A \code{\linkS4class{FitDiff}} object that saves model fit comparisons across multiple models. If the models are not nested, only fit indices for each model are returned. If the models are nested, the differences in fit indices are additionally returned, as well as test statistics comparing each sequential pair of models (ordered by their degrees of freedom). } \description{ This function will create the template to compare fit indices across multiple fitted lavaan objects. The results can be exported to a clipboard or a file later. } \examples{ HS.model <- ' visual =~ x1 + x2 + x3 textual =~ x4 + x5 + x6 speed =~ x7 + x8 + x9 ' ## non-nested models fit1 <- cfa(HS.model, data = HolzingerSwineford1939) m2 <- ' f1 =~ x1 + x2 + x3 + x4 f2 =~ x5 + x6 + x7 + x8 + x9 ' fit2 <- cfa(m2, data = HolzingerSwineford1939) (out1 <- compareFit(fit1, fit2, nested = FALSE)) summary(out1) ## nested model comparisons: measurement equivalence/invariance fit.config <- cfa(HS.model, data = HolzingerSwineford1939, group = "school") fit.metric <- cfa(HS.model, data = HolzingerSwineford1939, group = "school", group.equal = "loadings") fit.scalar <- cfa(HS.model, data = HolzingerSwineford1939, group = "school", group.equal = c("loadings","intercepts")) fit.strict <- cfa(HS.model, data = HolzingerSwineford1939, group = "school", group.equal = c("loadings","intercepts","residuals")) measEqOut <- compareFit(fit.config, fit.metric, fit.scalar, fit.strict, moreIndices = TRUE) # include moreFitIndices() summary(measEqOut) summary(measEqOut, fit.measures = "all") summary(measEqOut, fit.measures = c("aic", "bic", "sic", "ibic")) \dontrun{ ## also applies to lavaan.mi objects (fit model to multiple imputations) set.seed(12345) HSMiss <- HolzingerSwineford1939[ , paste("x", 1:9, sep = "")] HSMiss$x5 <- ifelse(HSMiss$x1 <= quantile(HSMiss$x1, .3), NA, HSMiss$x5) HSMiss$x9 <- ifelse(is.na(HSMiss$x5), NA, HSMiss$x9) HSMiss$school <- HolzingerSwineford1939$school library(Amelia) HS.amelia <- amelia(HSMiss, m = 20, noms = "school") imps <- HS.amelia$imputations ## request robust test statistics mgfit2 <- cfa.mi(HS.model, data = imps, group = "school", estimator = "mlm") mgfit1 <- cfa.mi(HS.model, data = imps, group = "school", estimator = "mlm", group.equal = "loadings") mgfit0 <- cfa.mi(HS.model, data = imps, group = "school", estimator = "mlm", group.equal = c("loadings","intercepts")) ## request the strictly-positive robust test statistics out2 <- compareFit(scalar = mgfit0, metric = mgfit1, config = mgfit2, argsLRT = list(asymptotic = TRUE, method = "satorra.bentler.2010")) ## note that moreFitIndices() does not work for lavaan.mi objects, but the ## fitMeasures() method for lavaan.mi objects already returns gammaHat(s) summary(out2, fit.measures = c("ariv","fmi","df","crmr","srmr", "cfi.robust","tli.robust", "adjGammaHat.scaled","rmsea.ci.lower.robust", "rmsea.robust","rmsea.ci.upper.robust")) } } \seealso{ \code{\linkS4class{FitDiff}}, \code{\link{clipboard}} } \author{ Terrence D. Jorgensen (University of Amsterdam; \email{TJorgensen314@gmail.com}) Sunthud Pornprasertmanit (\email{psunthud@gmail.com}) }
# File: 06_samtools_array_job.R # Auth: umar.niazi@kcl.as.uk # DESC: create a parameter file and shell script to run array job on hpc # Date: 18/08/2017 ## set variables and source libraries source('header.R') ## connect to mysql database to get sample information library('RMySQL') ##### connect to mysql database to get samples db = dbConnect(MySQL(), user='rstudio', password='12345', dbname='Projects', host='127.0.0.1') dbListTables(db) # check how many files each sample has g_did q = paste0('select count(File.idSample) as files, Sample.idData, Sample.title, Sample.id as SampleID from File, Sample where (Sample.idData = 15 and File.idSample = Sample.id) group by File.idSample') dfQuery = dbGetQuery(db, q) dfQuery$title = gsub(" ", "", dfQuery$title, fixed = T) dfQuery # get the count of files q = paste0('select File.*, Sample.idData from File, Sample where (Sample.idData = 15) and (File.idSample = Sample.id) and (File.type = "fastq")') dfCounts = dbGetQuery(db, q) head(dfCounts) nrow(dfCounts) # for each sample id, get the corresponding files cvQueries = paste0('select File.*, Sample.title from File, Sample where (Sample.idData = 15 and Sample.id =', dfQuery$SampleID, ') and (File.idSample = Sample.id) and (File.type = "fastq")') # set header variables cvShell = '#!/bin/bash' cvShell.2 = '#$ -S /bin/bash' cvProcessors = '#$ -pe smp 3' cvWorkingDir = '#$ -cwd' cvJobName = '#$ -N samtools-array' cvStdout = '#$ -j y' cvMemoryReserve = '#$ -l h_vmem=19G' cvArrayJob = paste0('#$ -t 1-', nrow(dfCounts)/2) # using high memory queue with one slot and 19 Gigs of memory # set the directory names cvInput = 'input/' cvSam = '/opt/apps/bioinformatics/samtools/1.3.1/bin/samtools' cvPicard = '/opt/apps/bioinformatics/picard-tools/2.2.1/picard.jar' # create a parameter file and shell script dir.create('AutoScripts') oFile.param = file('AutoScripts/samtools_param.txt', 'wt') temp = lapply(cvQueries, function(x){ # get the file names dfFiles = dbGetQuery(db, x) # check for null return if (nrow(dfFiles) == 0) return(); # remove white space from title dfFiles$title = gsub(" ", "", dfFiles$title, fixed=T) # split the file names into paired end 1 and 2, identified by R1 and R2 in the file name f = dfFiles$name d = grepl('_R1_', f) d = as.character(d) d[d == 'TRUE'] = 'R1' d[d == 'FALSE'] = 'R2' lf = split(f, d) ## no sam files made this time by bismark so skip this ## write samtools command variables # in.s1 = paste0(cvInput, lf[[1]], '.sam') # output file in bam format ## bismark creates its own name so add those changes lf[[1]] = gsub('.fastq.gz', '_bismark_bt2_pe.bam', lf[[1]]) lf[[1]] = paste('trim_', lf[[1]], sep='') s2 = paste0(cvInput, lf[[1]]) # remove low quality reads below 10 s3 = paste0(cvInput, lf[[1]], '_q10.bam') # sort the file s4 = paste0(cvInput, lf[[1]], '_q10_sort.bam') # remove duplicates s5 = paste0(cvInput, lf[[1]], '_q10_sort_rd.bam') s6 = paste0(cvInput, lf[[1]], '_q10_sort_rd.report.txt') s7 = paste0(cvInput, lf[[1]], '_q10_sort_rd_sort2.bam') p1 = paste(s2, s3, s4, s5, s6, s7, sep=' ') writeLines(p1, oFile.param) return(data.frame(idSample=dfFiles$idSample[1], name=c(s2, s4, s5), type=c('original bam', 'quality 10 sorted bam', 'quality 10 sorted bam duplicates removed'), group1=dfFiles$group1[1])) }) close(oFile.param) temp[sapply(temp, is.null)] = NULL dfNewData = do.call(rbind, temp) rownames(dfNewData) = NULL # remove the word input/ from file name dfNewData$name = gsub('input/(\\w+)', '\\1', dfNewData$name, perl=T) oFile = file('AutoScripts/samtools.sh', 'wt') writeLines(c('# Autogenerated script from write_samtools_script.R', paste('# date', date())), oFile) writeLines(c('# make sure directory paths exist before running script'), oFile) writeLines(c(cvShell, cvShell.2, cvProcessors, cvWorkingDir, cvJobName, cvStdout, cvMemoryReserve, cvArrayJob), oFile) writeLines('\n\n', oFile) # module load writeLines(c('module load bioinformatics/samtools/1.3.1'), oFile) writeLines(c('module load bioinformatics/picard-tools/2.2.1'), oFile) writeLines('\n\n', oFile) ## write array job lines writeLines("# Parse parameter file to get variables. number=$SGE_TASK_ID paramfile=samtools_param.txt bamfile=`sed -n ${number}p $paramfile | awk '{print $1}'` bamq10=`sed -n ${number}p $paramfile | awk '{print $2}'` bamq10sort=`sed -n ${number}p $paramfile | awk '{print $3}'` bamrd=`sed -n ${number}p $paramfile | awk '{print $4}'` rdreport=`sed -n ${number}p $paramfile | awk '{print $5}'` bamrdsort2=`sed -n ${number}p $paramfile | awk '{print $6}'` # 9. Run the program. NOTE: using Picard tools for coordinate sorting for bismark compatibility", oFile) # remove low quality reads p1 = paste('samtools view -b -q 10', '$bamfile', '>', '$bamq10', sep=' ') com2 = paste(p1) # sort the file p1 = paste('java -Xmx30G -jar', cvPicard, 'SortSam OUTPUT=$bamq10sort', 'INPUT=$bamq10 SORT_ORDER=coordinate VALIDATION_STRINGENCY=SILENT', sep=' ') com3 = paste(p1) # remove duplicates, for paired end reads p1 = paste('java -Xmx30G -jar', cvPicard, 'MarkDuplicates I=$bamq10sort', 'O=$bamrd', 'M=$rdreport', 'REMOVE_DUPLICATES=true VALIDATION_STRINGENCY=SILENT', sep=' ') com4 = paste(p1) # sort the file second time for using with bismark methylation extractor p1 = paste('java -Xmx30G -jar', cvPicard, 'SortSam OUTPUT=$bamrdsort2', 'INPUT=$bamrd SORT_ORDER=queryname VALIDATION_STRINGENCY=SILENT', sep=' ') com5 = paste(p1) # create index ## this step is done only on the coordinate sorted bam files p1 = paste('samtools index', '$bamrd', sep=' ') com6 = paste(p1) writeLines(c(com2, com3, com4, com5, com6), oFile) writeLines('\n\n', oFile) close(oFile) dbDisconnect(db) ### update database with the file names # dfNewData$group1 = 'Generated from Trimmomatic standard input for bisulphite seq data S126' # dbWriteTable(db, name='File', value = dfNewData, append=T, row.names=F) # dbDisconnect(db)
/S126/06_samtools_array_job.R
permissive
uhkniazi/BRC_NeuralTube_Miho
R
false
false
6,162
r
# File: 06_samtools_array_job.R # Auth: umar.niazi@kcl.as.uk # DESC: create a parameter file and shell script to run array job on hpc # Date: 18/08/2017 ## set variables and source libraries source('header.R') ## connect to mysql database to get sample information library('RMySQL') ##### connect to mysql database to get samples db = dbConnect(MySQL(), user='rstudio', password='12345', dbname='Projects', host='127.0.0.1') dbListTables(db) # check how many files each sample has g_did q = paste0('select count(File.idSample) as files, Sample.idData, Sample.title, Sample.id as SampleID from File, Sample where (Sample.idData = 15 and File.idSample = Sample.id) group by File.idSample') dfQuery = dbGetQuery(db, q) dfQuery$title = gsub(" ", "", dfQuery$title, fixed = T) dfQuery # get the count of files q = paste0('select File.*, Sample.idData from File, Sample where (Sample.idData = 15) and (File.idSample = Sample.id) and (File.type = "fastq")') dfCounts = dbGetQuery(db, q) head(dfCounts) nrow(dfCounts) # for each sample id, get the corresponding files cvQueries = paste0('select File.*, Sample.title from File, Sample where (Sample.idData = 15 and Sample.id =', dfQuery$SampleID, ') and (File.idSample = Sample.id) and (File.type = "fastq")') # set header variables cvShell = '#!/bin/bash' cvShell.2 = '#$ -S /bin/bash' cvProcessors = '#$ -pe smp 3' cvWorkingDir = '#$ -cwd' cvJobName = '#$ -N samtools-array' cvStdout = '#$ -j y' cvMemoryReserve = '#$ -l h_vmem=19G' cvArrayJob = paste0('#$ -t 1-', nrow(dfCounts)/2) # using high memory queue with one slot and 19 Gigs of memory # set the directory names cvInput = 'input/' cvSam = '/opt/apps/bioinformatics/samtools/1.3.1/bin/samtools' cvPicard = '/opt/apps/bioinformatics/picard-tools/2.2.1/picard.jar' # create a parameter file and shell script dir.create('AutoScripts') oFile.param = file('AutoScripts/samtools_param.txt', 'wt') temp = lapply(cvQueries, function(x){ # get the file names dfFiles = dbGetQuery(db, x) # check for null return if (nrow(dfFiles) == 0) return(); # remove white space from title dfFiles$title = gsub(" ", "", dfFiles$title, fixed=T) # split the file names into paired end 1 and 2, identified by R1 and R2 in the file name f = dfFiles$name d = grepl('_R1_', f) d = as.character(d) d[d == 'TRUE'] = 'R1' d[d == 'FALSE'] = 'R2' lf = split(f, d) ## no sam files made this time by bismark so skip this ## write samtools command variables # in.s1 = paste0(cvInput, lf[[1]], '.sam') # output file in bam format ## bismark creates its own name so add those changes lf[[1]] = gsub('.fastq.gz', '_bismark_bt2_pe.bam', lf[[1]]) lf[[1]] = paste('trim_', lf[[1]], sep='') s2 = paste0(cvInput, lf[[1]]) # remove low quality reads below 10 s3 = paste0(cvInput, lf[[1]], '_q10.bam') # sort the file s4 = paste0(cvInput, lf[[1]], '_q10_sort.bam') # remove duplicates s5 = paste0(cvInput, lf[[1]], '_q10_sort_rd.bam') s6 = paste0(cvInput, lf[[1]], '_q10_sort_rd.report.txt') s7 = paste0(cvInput, lf[[1]], '_q10_sort_rd_sort2.bam') p1 = paste(s2, s3, s4, s5, s6, s7, sep=' ') writeLines(p1, oFile.param) return(data.frame(idSample=dfFiles$idSample[1], name=c(s2, s4, s5), type=c('original bam', 'quality 10 sorted bam', 'quality 10 sorted bam duplicates removed'), group1=dfFiles$group1[1])) }) close(oFile.param) temp[sapply(temp, is.null)] = NULL dfNewData = do.call(rbind, temp) rownames(dfNewData) = NULL # remove the word input/ from file name dfNewData$name = gsub('input/(\\w+)', '\\1', dfNewData$name, perl=T) oFile = file('AutoScripts/samtools.sh', 'wt') writeLines(c('# Autogenerated script from write_samtools_script.R', paste('# date', date())), oFile) writeLines(c('# make sure directory paths exist before running script'), oFile) writeLines(c(cvShell, cvShell.2, cvProcessors, cvWorkingDir, cvJobName, cvStdout, cvMemoryReserve, cvArrayJob), oFile) writeLines('\n\n', oFile) # module load writeLines(c('module load bioinformatics/samtools/1.3.1'), oFile) writeLines(c('module load bioinformatics/picard-tools/2.2.1'), oFile) writeLines('\n\n', oFile) ## write array job lines writeLines("# Parse parameter file to get variables. number=$SGE_TASK_ID paramfile=samtools_param.txt bamfile=`sed -n ${number}p $paramfile | awk '{print $1}'` bamq10=`sed -n ${number}p $paramfile | awk '{print $2}'` bamq10sort=`sed -n ${number}p $paramfile | awk '{print $3}'` bamrd=`sed -n ${number}p $paramfile | awk '{print $4}'` rdreport=`sed -n ${number}p $paramfile | awk '{print $5}'` bamrdsort2=`sed -n ${number}p $paramfile | awk '{print $6}'` # 9. Run the program. NOTE: using Picard tools for coordinate sorting for bismark compatibility", oFile) # remove low quality reads p1 = paste('samtools view -b -q 10', '$bamfile', '>', '$bamq10', sep=' ') com2 = paste(p1) # sort the file p1 = paste('java -Xmx30G -jar', cvPicard, 'SortSam OUTPUT=$bamq10sort', 'INPUT=$bamq10 SORT_ORDER=coordinate VALIDATION_STRINGENCY=SILENT', sep=' ') com3 = paste(p1) # remove duplicates, for paired end reads p1 = paste('java -Xmx30G -jar', cvPicard, 'MarkDuplicates I=$bamq10sort', 'O=$bamrd', 'M=$rdreport', 'REMOVE_DUPLICATES=true VALIDATION_STRINGENCY=SILENT', sep=' ') com4 = paste(p1) # sort the file second time for using with bismark methylation extractor p1 = paste('java -Xmx30G -jar', cvPicard, 'SortSam OUTPUT=$bamrdsort2', 'INPUT=$bamrd SORT_ORDER=queryname VALIDATION_STRINGENCY=SILENT', sep=' ') com5 = paste(p1) # create index ## this step is done only on the coordinate sorted bam files p1 = paste('samtools index', '$bamrd', sep=' ') com6 = paste(p1) writeLines(c(com2, com3, com4, com5, com6), oFile) writeLines('\n\n', oFile) close(oFile) dbDisconnect(db) ### update database with the file names # dfNewData$group1 = 'Generated from Trimmomatic standard input for bisulphite seq data S126' # dbWriteTable(db, name='File', value = dfNewData, append=T, row.names=F) # dbDisconnect(db)
twin.cells<- function(training_data){ train.tw<-data.frame(not.mut=c(), same=c(), one.mut=c(), both.mut=c(), rf=c()) for(ii in 1:nrow(training_data)){ xx = as.character(training_data[ii,]$ground) x1<-strsplit(xx,"")[[1]] x2<-match(x1,c("_")) x2[is.na(x2)]<-0 for(i in 1:(length(x2)-18)){ if(x2[i]==1 & x2[i+15]==1) { t1<-x1[(i+1):(i+10)] t2<-x1[(i+16):(i+26)] cnt<-c(0,0,0,0) for(j in 1:10){ if(t1[j]==0 & t2[j]==0) cnt[1]<-cnt[1]+1 if(t1[j]==1 & t2[j]==1) cnt[2]<-cnt[2]+1 if(t1[j]==2 & t2[j]==2) cnt[2]<-cnt[2]+1 if(t1[j]==0 & t2[j]==1) cnt[3]<-cnt[3]+1 if(t1[j]==1 & t2[j]==0) cnt[3]<-cnt[3]+1 if(t1[j]==0 & t2[j]==2) cnt[3]<-cnt[3]+1 if(t1[j]==2 & t2[j]==0) cnt[3]<-cnt[3]+1 if(t1[j]==1 & t2[j]==2) cnt[4]<-cnt[4]+1 if(t1[j]==2 & t2[j]==1) cnt[4]<-cnt[4]+1 } train.tw<-rbind(train.tw, data.frame(not.mut=cnt[1], same=cnt[2], one.mut=cnt[3], both.mut=cnt[4], rf=1)) } if(x2[i]==1 & x2[i+16]==1) { t1<-x1[(i+1):(i+10)] t2<-x1[(i+17):(i+27)] cnt<-c(0,0,0,0) for(j in 1:10){ if(t1[j]==0 & t2[j]==0) cnt[1]<-cnt[1]+1 if(t1[j]==1 & t2[j]==1) cnt[2]<-cnt[2]+1 if(t1[j]==2 & t2[j]==2) cnt[2]<-cnt[2]+1 if(t1[j]==0 & t2[j]==1) cnt[3]<-cnt[3]+1 if(t1[j]==1 & t2[j]==0) cnt[3]<-cnt[3]+1 if(t1[j]==0 & t2[j]==2) cnt[3]<-cnt[3]+1 if(t1[j]==2 & t2[j]==0) cnt[3]<-cnt[3]+1 if(t1[j]==1 & t2[j]==2) cnt[4]<-cnt[4]+1 if(t1[j]==2 & t2[j]==1) cnt[4]<-cnt[4]+1 } train.tw<-rbind(train.tw, data.frame(not.mut=cnt[1], same=cnt[2], one.mut=cnt[3], both.mut=cnt[4], rf=1)) } if(x2[i]==1 & x2[i+17]==1) { t1<-x1[(i+1):(i+10)] t2<-x1[(i+18):(i+28)] cnt<-c(0,0,0,0) for(j in 1:10){ if(t1[j]==0 & t2[j]==0) cnt[1]<-cnt[1]+1 if(t1[j]==1 & t2[j]==1) cnt[2]<-cnt[2]+1 if(t1[j]==2 & t2[j]==2) cnt[2]<-cnt[2]+1 if(t1[j]==0 & t2[j]==1) cnt[3]<-cnt[3]+1 if(t1[j]==1 & t2[j]==0) cnt[3]<-cnt[3]+1 if(t1[j]==0 & t2[j]==2) cnt[3]<-cnt[3]+1 if(t1[j]==2 & t2[j]==0) cnt[3]<-cnt[3]+1 if(t1[j]==1 & t2[j]==2) cnt[4]<-cnt[4]+1 if(t1[j]==2 & t2[j]==1) cnt[4]<-cnt[4]+1 } train.tw<-rbind(train.tw, data.frame(not.mut=cnt[1], same=cnt[2], one.mut=cnt[3], both.mut=cnt[4], rf=1)) } } } return(train.tw) } not.twin.cells<-function(train.tw, train){ uniq.train.tw<-unique(train.tw) train.ntw<-data.frame(not.mut=c(), same=c(), one.mut=c(), both.mut=c(), rf=c()) for(ii in 1:length(train)){ xx<-train[[ii]] for(j1 in 1:nrow(xx)){ if(j1<nrow(xx)){ for(j2 in (j1+1):nrow(xx)){ cnt<-c(0,0,0,0) t1<-strsplit(xx[j1,2],"")[[1]] t2<-strsplit(xx[j2,2],"")[[1]] for(j in 1:10){ if(t1[j]==0 & t2[j]==0) cnt[1]<-cnt[1]+1 if(t1[j]==1 & t2[j]==1) cnt[2]<-cnt[2]+1 if(t1[j]==2 & t2[j]==2) cnt[2]<-cnt[2]+1 if(t1[j]==0 & t2[j]==1) cnt[3]<-cnt[3]+1 if(t1[j]==1 & t2[j]==0) cnt[3]<-cnt[3]+1 if(t1[j]==0 & t2[j]==2) cnt[3]<-cnt[3]+1 if(t1[j]==2 & t2[j]==0) cnt[3]<-cnt[3]+1 if(t1[j]==1 & t2[j]==2) cnt[4]<-cnt[4]+1 if(t1[j]==2 & t2[j]==1) cnt[4]<-cnt[4]+1 } ac.tw<-T for(j in 1:nrow(uniq.train.tw)){ if(uniq.train.tw[j,1]==cnt[1] & uniq.train.tw[j,2]==cnt[2] & uniq.train.tw[j,3]==cnt[3] & uniq.train.tw[j,4]==cnt[4]) ac.tw<-F } if(ac.tw) { train.ntw<-rbind(train.ntw, data.frame(not.mut=cnt[1], same=cnt[2], one.mut=cnt[3], both.mut=cnt[4], rf=0)) } } } } } return(train.ntw) }
/train.R
no_license
rretkute/ml_cell_lineage_reconstruction
R
false
false
3,877
r
twin.cells<- function(training_data){ train.tw<-data.frame(not.mut=c(), same=c(), one.mut=c(), both.mut=c(), rf=c()) for(ii in 1:nrow(training_data)){ xx = as.character(training_data[ii,]$ground) x1<-strsplit(xx,"")[[1]] x2<-match(x1,c("_")) x2[is.na(x2)]<-0 for(i in 1:(length(x2)-18)){ if(x2[i]==1 & x2[i+15]==1) { t1<-x1[(i+1):(i+10)] t2<-x1[(i+16):(i+26)] cnt<-c(0,0,0,0) for(j in 1:10){ if(t1[j]==0 & t2[j]==0) cnt[1]<-cnt[1]+1 if(t1[j]==1 & t2[j]==1) cnt[2]<-cnt[2]+1 if(t1[j]==2 & t2[j]==2) cnt[2]<-cnt[2]+1 if(t1[j]==0 & t2[j]==1) cnt[3]<-cnt[3]+1 if(t1[j]==1 & t2[j]==0) cnt[3]<-cnt[3]+1 if(t1[j]==0 & t2[j]==2) cnt[3]<-cnt[3]+1 if(t1[j]==2 & t2[j]==0) cnt[3]<-cnt[3]+1 if(t1[j]==1 & t2[j]==2) cnt[4]<-cnt[4]+1 if(t1[j]==2 & t2[j]==1) cnt[4]<-cnt[4]+1 } train.tw<-rbind(train.tw, data.frame(not.mut=cnt[1], same=cnt[2], one.mut=cnt[3], both.mut=cnt[4], rf=1)) } if(x2[i]==1 & x2[i+16]==1) { t1<-x1[(i+1):(i+10)] t2<-x1[(i+17):(i+27)] cnt<-c(0,0,0,0) for(j in 1:10){ if(t1[j]==0 & t2[j]==0) cnt[1]<-cnt[1]+1 if(t1[j]==1 & t2[j]==1) cnt[2]<-cnt[2]+1 if(t1[j]==2 & t2[j]==2) cnt[2]<-cnt[2]+1 if(t1[j]==0 & t2[j]==1) cnt[3]<-cnt[3]+1 if(t1[j]==1 & t2[j]==0) cnt[3]<-cnt[3]+1 if(t1[j]==0 & t2[j]==2) cnt[3]<-cnt[3]+1 if(t1[j]==2 & t2[j]==0) cnt[3]<-cnt[3]+1 if(t1[j]==1 & t2[j]==2) cnt[4]<-cnt[4]+1 if(t1[j]==2 & t2[j]==1) cnt[4]<-cnt[4]+1 } train.tw<-rbind(train.tw, data.frame(not.mut=cnt[1], same=cnt[2], one.mut=cnt[3], both.mut=cnt[4], rf=1)) } if(x2[i]==1 & x2[i+17]==1) { t1<-x1[(i+1):(i+10)] t2<-x1[(i+18):(i+28)] cnt<-c(0,0,0,0) for(j in 1:10){ if(t1[j]==0 & t2[j]==0) cnt[1]<-cnt[1]+1 if(t1[j]==1 & t2[j]==1) cnt[2]<-cnt[2]+1 if(t1[j]==2 & t2[j]==2) cnt[2]<-cnt[2]+1 if(t1[j]==0 & t2[j]==1) cnt[3]<-cnt[3]+1 if(t1[j]==1 & t2[j]==0) cnt[3]<-cnt[3]+1 if(t1[j]==0 & t2[j]==2) cnt[3]<-cnt[3]+1 if(t1[j]==2 & t2[j]==0) cnt[3]<-cnt[3]+1 if(t1[j]==1 & t2[j]==2) cnt[4]<-cnt[4]+1 if(t1[j]==2 & t2[j]==1) cnt[4]<-cnt[4]+1 } train.tw<-rbind(train.tw, data.frame(not.mut=cnt[1], same=cnt[2], one.mut=cnt[3], both.mut=cnt[4], rf=1)) } } } return(train.tw) } not.twin.cells<-function(train.tw, train){ uniq.train.tw<-unique(train.tw) train.ntw<-data.frame(not.mut=c(), same=c(), one.mut=c(), both.mut=c(), rf=c()) for(ii in 1:length(train)){ xx<-train[[ii]] for(j1 in 1:nrow(xx)){ if(j1<nrow(xx)){ for(j2 in (j1+1):nrow(xx)){ cnt<-c(0,0,0,0) t1<-strsplit(xx[j1,2],"")[[1]] t2<-strsplit(xx[j2,2],"")[[1]] for(j in 1:10){ if(t1[j]==0 & t2[j]==0) cnt[1]<-cnt[1]+1 if(t1[j]==1 & t2[j]==1) cnt[2]<-cnt[2]+1 if(t1[j]==2 & t2[j]==2) cnt[2]<-cnt[2]+1 if(t1[j]==0 & t2[j]==1) cnt[3]<-cnt[3]+1 if(t1[j]==1 & t2[j]==0) cnt[3]<-cnt[3]+1 if(t1[j]==0 & t2[j]==2) cnt[3]<-cnt[3]+1 if(t1[j]==2 & t2[j]==0) cnt[3]<-cnt[3]+1 if(t1[j]==1 & t2[j]==2) cnt[4]<-cnt[4]+1 if(t1[j]==2 & t2[j]==1) cnt[4]<-cnt[4]+1 } ac.tw<-T for(j in 1:nrow(uniq.train.tw)){ if(uniq.train.tw[j,1]==cnt[1] & uniq.train.tw[j,2]==cnt[2] & uniq.train.tw[j,3]==cnt[3] & uniq.train.tw[j,4]==cnt[4]) ac.tw<-F } if(ac.tw) { train.ntw<-rbind(train.ntw, data.frame(not.mut=cnt[1], same=cnt[2], one.mut=cnt[3], both.mut=cnt[4], rf=0)) } } } } } return(train.ntw) }
# install.packages("zoo") # install.packages("ggplot2") # library(ggplot2) # library(zoo) ## Set working directory # setwd("C:/Users/cj5/Desktop/Waste_TS/R") setwd("C:/RWEM_processed_calvin/R") #### STEP 1: IMPORT DATA - Set Zeros as Null Values mydata <- read.csv("Quarterly_Data_v2.csv", na.string = 0, stringsAsFactors = FALSE) # Set Index Class for Quarterly Data library(zoo) mydata$YYYY.QQ <- as.yearqtr(mydata$YYYY.QQ) # Add date field for time-series mydata$ts_date <- as.POSIXct(mydata$YYYY.QQ, tz = "Etc/GMT-1") #### STEP 2: Produce time-series and regression plots require(gridExtra) require(ggplot2) # Return the names of df columns (Remove first and last fields) variables <- colnames(mydata) variables <- variables[2:(length(variables)-1)] # Time-Series Plots p1_name <- paste(variables[1]) ### Site stopped p2_name <- paste(variables[2]) ### Site identified p3_name <- paste(variables[3]) ### Illegal exported waste ### Site stopped p1 <- ggplot(mydata, aes_string("ts_date", p1_name)) + geom_line(colour="black", size=1.5) + # Black lines geom_point(size=3.5, colour="red") + # Red dots theme_bw() + # Change background theme to white with grey grids xlab("") + ylab(p1_name) + ggtitle(p1_name) ### Site identified p2 <- ggplot(mydata, aes_string("ts_date", p2_name)) + geom_line(colour="steelblue", size=1.5) + # Blue lines geom_point(size=3.5, colour="black") + # Black dots theme_bw() + # Change background theme to white with grey grids xlab("") + ylab(p2_name) + ggtitle(p2_name) ### Illegal exported waste p3 <- ggplot(mydata, aes_string("ts_date", p3_name)) + geom_line(colour="red", size=1.5) + # Blue lines geom_point(size=3.5, colour="black") + # Black dots theme_bw() + # Change background theme to white with grey grids xlab("") + ylab(p3_name) + ggtitle(p3_name) Site_Stopped <- p1 Site_Identified <- p2 Ill_Exp_Waste <- p3 ## Linear regression plot eq <- paste(paste("mydata$",p1_name,sep=""),"~", paste("mydata$",p2_name,sep="")) reg <- lm(eq) # R basic regression to obtain performance information fit_lm <- ggplot(mydata, aes_string(p1_name, p2_name)) + geom_point(shape=1, size=5) + # Use hollow circles theme_bw() + # Change background theme to white with grey grid geom_smooth(method=lm, colour="red", size=1) + # Add linear regression line (includes 95% confidence) xlab(p1_name) + ylab(p2_name) + ggtitle(expression(bold("Waste Measurements"))) + # Add regression performance information ot title labs(title = paste("Adj R2 = ",signif(summary(reg)$adj.r.squared, 5), " Intercept =",signif(reg$coef[[1]],5 ), " Slope =",signif(reg$coef[[2]], 5), " P =",signif(summary(reg)$coef[2,4], 5))) ## Export Plots pdf(paste(p2_name,".pdf",sep=""), width = 23.39, height = 16.53) # Output set to A2 sheet dimensions print(grid.arrange(arrangeGrob(p1, p2), fit_lm, ncol=2)) # require(gridExtra) dev.off() #### new Stuff from Federico ###### index <- c(1:22) # LIST_ALL <- list(variables) for (i in 1:22) { p_name <- paste(variables[index[i]]) ### Site stopped mypath <- file.path("C:","RWEM_processed_calvin","R","plots", paste(p_name, index[i], ".jpg", sep = "")) p <- ggplot(mydata, aes_string("ts_date", p_name)) + geom_line(colour="black", size=1.5) + # Black lines geom_point(size=3.5, colour="red") + # Red dots theme_bw() + # Change background theme to white with grey grids xlab("") + ylab(p_name) + ggtitle(p_name) ggsave(mypath, p) }
/Quarterly_Script.r
no_license
karaframe/waste
R
false
false
3,869
r
# install.packages("zoo") # install.packages("ggplot2") # library(ggplot2) # library(zoo) ## Set working directory # setwd("C:/Users/cj5/Desktop/Waste_TS/R") setwd("C:/RWEM_processed_calvin/R") #### STEP 1: IMPORT DATA - Set Zeros as Null Values mydata <- read.csv("Quarterly_Data_v2.csv", na.string = 0, stringsAsFactors = FALSE) # Set Index Class for Quarterly Data library(zoo) mydata$YYYY.QQ <- as.yearqtr(mydata$YYYY.QQ) # Add date field for time-series mydata$ts_date <- as.POSIXct(mydata$YYYY.QQ, tz = "Etc/GMT-1") #### STEP 2: Produce time-series and regression plots require(gridExtra) require(ggplot2) # Return the names of df columns (Remove first and last fields) variables <- colnames(mydata) variables <- variables[2:(length(variables)-1)] # Time-Series Plots p1_name <- paste(variables[1]) ### Site stopped p2_name <- paste(variables[2]) ### Site identified p3_name <- paste(variables[3]) ### Illegal exported waste ### Site stopped p1 <- ggplot(mydata, aes_string("ts_date", p1_name)) + geom_line(colour="black", size=1.5) + # Black lines geom_point(size=3.5, colour="red") + # Red dots theme_bw() + # Change background theme to white with grey grids xlab("") + ylab(p1_name) + ggtitle(p1_name) ### Site identified p2 <- ggplot(mydata, aes_string("ts_date", p2_name)) + geom_line(colour="steelblue", size=1.5) + # Blue lines geom_point(size=3.5, colour="black") + # Black dots theme_bw() + # Change background theme to white with grey grids xlab("") + ylab(p2_name) + ggtitle(p2_name) ### Illegal exported waste p3 <- ggplot(mydata, aes_string("ts_date", p3_name)) + geom_line(colour="red", size=1.5) + # Blue lines geom_point(size=3.5, colour="black") + # Black dots theme_bw() + # Change background theme to white with grey grids xlab("") + ylab(p3_name) + ggtitle(p3_name) Site_Stopped <- p1 Site_Identified <- p2 Ill_Exp_Waste <- p3 ## Linear regression plot eq <- paste(paste("mydata$",p1_name,sep=""),"~", paste("mydata$",p2_name,sep="")) reg <- lm(eq) # R basic regression to obtain performance information fit_lm <- ggplot(mydata, aes_string(p1_name, p2_name)) + geom_point(shape=1, size=5) + # Use hollow circles theme_bw() + # Change background theme to white with grey grid geom_smooth(method=lm, colour="red", size=1) + # Add linear regression line (includes 95% confidence) xlab(p1_name) + ylab(p2_name) + ggtitle(expression(bold("Waste Measurements"))) + # Add regression performance information ot title labs(title = paste("Adj R2 = ",signif(summary(reg)$adj.r.squared, 5), " Intercept =",signif(reg$coef[[1]],5 ), " Slope =",signif(reg$coef[[2]], 5), " P =",signif(summary(reg)$coef[2,4], 5))) ## Export Plots pdf(paste(p2_name,".pdf",sep=""), width = 23.39, height = 16.53) # Output set to A2 sheet dimensions print(grid.arrange(arrangeGrob(p1, p2), fit_lm, ncol=2)) # require(gridExtra) dev.off() #### new Stuff from Federico ###### index <- c(1:22) # LIST_ALL <- list(variables) for (i in 1:22) { p_name <- paste(variables[index[i]]) ### Site stopped mypath <- file.path("C:","RWEM_processed_calvin","R","plots", paste(p_name, index[i], ".jpg", sep = "")) p <- ggplot(mydata, aes_string("ts_date", p_name)) + geom_line(colour="black", size=1.5) + # Black lines geom_point(size=3.5, colour="red") + # Red dots theme_bw() + # Change background theme to white with grey grids xlab("") + ylab(p_name) + ggtitle(p_name) ggsave(mypath, p) }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/importBreakpointBed.R \name{importBreakpointBed} \alias{importBreakpointBed} \title{Import a breakpoint BED file.} \arguments{ \item{breakpoint_fn}{the filename of the breakpoint bed file} } \value{ a Genomic Interactions Object } \description{ Imports a BED file with breakpoints or other interactions, in a dual position format. } \examples{ importBreakpointBed(breakpoint_fn = system.file("extdata", "sample_breakpoints.bed",package = "CNVScope")) closeAllConnections() } \keyword{bed}
/man/importBreakpointBed.Rd
no_license
masoodzaka/CNVScope
R
false
true
567
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/importBreakpointBed.R \name{importBreakpointBed} \alias{importBreakpointBed} \title{Import a breakpoint BED file.} \arguments{ \item{breakpoint_fn}{the filename of the breakpoint bed file} } \value{ a Genomic Interactions Object } \description{ Imports a BED file with breakpoints or other interactions, in a dual position format. } \examples{ importBreakpointBed(breakpoint_fn = system.file("extdata", "sample_breakpoints.bed",package = "CNVScope")) closeAllConnections() } \keyword{bed}
# Ejemplo Inicial --------------------------------------------------------- #Primero simulemos #Vector de probabilidades para las X f<-c(0.9,0.1*0.8,0.1*0.2) regresa.una.S<-function(){ #Genera una N N<-sample(x = c(0,3), #De este vector size = 1, #Toma una muestra de tamaño 1 replace = T,#Con reemplazo (En este caso da igual) prob = c(0.75,0.25))#Con las probabilidades correspondientes. #Verifica si hubo reclamaciones. if(N>0){ #Genera las que hubo. Xi <- sample(x = 0:2, #De este vector size = N, #Toma una muestra de tamaño N replace = T,#Con reemplazo (Puede volver reclamar lo mismo) prob = f)#Con las probabilidades correspondientes. }else{ Xi <- 0 #Si no hubo, el total es cero. } #Regresa una S return(sum(Xi)) } # n = 1000000 set.seed(9) S = replicate(n = n, #Número de veces expr = regresa.una.S()) #Expresión ##Probabilidades reales PrilII <- function(x,n,f,todo=F){ #n := número de pólizas #f := vector de probabilidades de X (ordenadas desde 0) #Creamos un vector auxiliar para las probas de S. g<-0:x names(g)<-0:x #Le ponemos nombres al vector de probas de f. names(f)<-0:(length(f)-1) #Fórmula De Pril II for(s in 0:x){ if(s==0){ g["0"]=f["0"]^n }else{aux = 0 for(j in 1:(min(s,length(f)-1))){ aux = aux + ((j*(n+1))/s - 1)*f[as.character(j)]*g[as.character(s-j)] } g[as.character(s)]=aux/f["0"] } } if(todo){ return(g) }else{ return(g[as.character(x)]) } } #Número de pólizas n<-3 #Vector de probabilidades f<-c(0.9,0.1*0.8,0.1*0.2) #Probabilidades Psd3<-PrilII(x = 6,n = n,f = f,todo = T) ; Psd3 sum(Psd3) #función de densidad de la suma aleatoria S fS <- function(s){ if(s==0){ return(0.75+Psd3[as.character(s)]*0.25) }else if(s %in% 1:6){ return(0.25*Psd3[as.character(s)]) }else{ return(0) } } #Probabilidades pS <- sapply(0:6, fS) ; pS #Proporciones simuladas table(S)/length(S) #¿Suma uno teórico? sum(pS) ##Esperanza de la suma aleatoria S #Teórica 0.25*sum(1:6*Psd3[as.character(1:6)]) mu <- sum(0:6*pS); mu #Muestral mean(S) ##Segundo momento #Teórico 0.25*sum((1:6)^2*Psd3[as.character(1:6)]) mu2 <- sum((0:6)^2*pS) ; mu2 #Muestral mean(S^2) ##Varianza #Teórica varianza <- mu2-mu^2 ; varianza #Muestral var(S) ##Desviación #Teórica sqrt(varianza) #Muestral sd(S) #Con esperanza iterada: EspX <- sum(0:2*f) EspN <- (3*0.25) mu ; EspX * EspN # Modelo Colectivo -------------------------------------------------------- #Los siguientes ejemplos serán considerando Yj~Exp(100) rate<-100 # Modelo Binomial Compuesto ----------------------------------------------- #Debemos generar variables aleatorias provenientes de S n <- 10000 #Número de simulaciones de S p <- 0.8 #parámetro de la binomial (p). size <- 50 #parámetro de la binomial (n). regresa.una.S<-function(){ #Genera una N N<-rbinom(n = 1,size = size,prob = p) #Verifica si hubo reclamaciones. if(N>0){ Yj <- rexp(n = N,rate = rate) #Genera las que hubo. }else{ Yj <- 0 #Si no hubo, el total es cero. } #Regresa una S return(sum(Yj)) } # set.seed(27) S = replicate(n = n, #Número de veces expr = regresa.una.S()) #Expresión #Momentos (Muestral Vs. Teórico) ##Esperanza mean(S) ; size*p/rate ##Segundo momento mean(S^2) ; size*p*(2/rate^2)+size*(size-1)*p^2/rate^2 ##Varianza var(S) ; size*p*(2/rate^2 - p/rate^2) # Modelo Binomial Negativo ------------------------------------------------ library(actuar) ?rcompound #Parámetros de la Binomial Negativa k <- 10 ; p <- 0.8 S <- rcompound(n = n, #Genera n model.freq = rnbinom(size = k,prob = p), #N~BinNeg(k,p) model.sev = rexp(rate = rate)) #Y~Exp(rate) #Momentos (Muestral Vs. Teórico) ##Esperanza mean(S) ; k*(1/p-1)/rate ##Segundo momento mean(S^2) ; k*(1/p-1)*(1/p)/rate^2+k*(1/p-1)*(2/rate^2-1/rate^2)+(k*(1/p-1)/rate)^2 ##Varianza var(S) ; k*(1/p-1)*(1/p)/rate^2+k*(1/p-1)*(2/rate^2-1/rate^2) # Modelo Poisson Compuesto ------------------------------------------------ #Parámetro de la Poisson lambda <- 10 rate=20 S <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda), # N~Poi(lambda) model.sev = rexp(rate = rate)) # Y~Exp(rate) #Momentos (Muestral Vs. Teórico) ##Esperanza mean(S) ; lambda/rate ##Segundo momento mean(S^2) ; lambda*(2/rate^2) + lambda^2*(1/rate^2) ##Varianza var(S) ; lambda * 2/rate^2 # Distribución de la convolución de Poisson Compuesta --------------------- n <- 1000000 ; library(actuar) set.seed(9) # Y's continuas ----------------------------------------------------------- #Parámetro de la Poisson lambda1 <- 7 ; lambda2 <- 4 ; lambda3 <- 21 lambda <- lambda1 + lambda2 + lambda3 #Exponencial rate <- 5 S1 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda1), #N~Poi(lambda1) model.sev = rexp(rate = rate)) #Y~Exp(rate) #Ji cuadrada dfredom <- 20 S2 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda2), #N~Poi(lambda2) model.sev = rchisq(df=dfredom)) #Y~JiCuadrada(dfredom) #Pareto shape <- 6 ; min <- 7 S3 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda3), #N~Poi(lambda3) model.sev = rpareto1(shape = 6,min = 7)) #Y~pareto(shape,scale) S <- S1 + S2 + S3 ##Esperanza #Muestral mean(S) #Teórica mu1<-lambda*(lambda1*(1/rate) + #Esperanza de la Exponencial lambda2*(dfredom) + #Esperanza de la Ji cuadrada lambda3*(shape*min/(shape-1)) #Esperanza de la Pareto )/lambda ; mu1 ##Segundo momento #Suma1 = lambda*E[Y^2] Suma1<-lambda*( #2do momento de la Exponencial lambda1*(2/rate^2) + #2do momento de la Ji cuadrada lambda2*(2*dfredom+dfredom^2) + #2do momento de la Pareto lambda3*((shape*min^2)/((shape-1)^2*(shape-2))+(shape*min/(shape-1))^2) )/lambda #Suma2 = lambda^2*(E[Y])^2 Suma2<- lambda^2*((lambda1*(1/rate) + #Esperanza de la Exponencial lambda2*(dfredom) + #Esperanza de la Ji cuadrada lambda3*(shape*min/(shape-1)) #Esperanza de la Pareto )/lambda)^2 #Teórica: mu2 <- Suma1 + Suma2 ; mu2 #Muestral mean(S^2) ##Varianza #Muestral var(S) #Teórica mu2-mu1^2 Suma1 # Y's discretas ----------------------------------------------------------- set.seed(2) #Parámetro de la Poisson lambda1 <- 7 ; lambda2 <- 4 ; lambda3 <- 21 lambda <- lambda1 + lambda2 + lambda3 #Binomial size = 10 ; prob = 0.3 S1 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda1), #N~Poi(lambda1) model.sev = rbinom(size = size,prob = prob)) #Y~Bin(size,prob) #Poisson bawr = 7 S2 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda2), #N~Poi(lambda2) model.sev = rpois(lambda = bawr)) #Y~Poi(bawr) #Binomial Negativa k = 5 ; p = 0.9 S3 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda3), #N~Poi(lambda3) model.sev = rnbinom(size = k,prob = p)) #Y~BinNeg(k,p) S <- S1 + S2 + S3 ##Esperanza #Muestral mean(S) #Teórica mu1<-lambda*(lambda1*(size*prob) + #Esperanza de la Binomial lambda2*(bawr) + #Esperanza de la Poisson lambda3*(k*(1-p)/p) #Esperanza de la Binomial Negativa )/lambda ; mu1 ##Segundo momento #Suma1 = lambda*E[Y^2] Suma1<-lambda*( #2do momento de la Binomial lambda1*(size*prob*(1-prob)+(size*prob)^2) + #2do momento de la Poisson lambda2*(bawr+bawr^2) + #2do momento de la Binomial Negativa lambda3*(k*(1-p)/p^2+(k*(1-p)/p)^2) )/lambda #Suma2 = lambda^2*(E[Y])^2 Suma2<- lambda^2*((lambda1*(size*prob) + #Esperanza de la Binomial lambda2*(bawr) + #Esperanza de la Poisson lambda3*(k*(1-p)/p) #Esperanza de la Binomial Negativa )/lambda)^2 #Teórica: mu2 <- Suma1 + Suma2 ; mu2 #Muestral mean(S^2) ##Varianza #Muestral var(S) #Teórica mu2-mu1^2 Suma1 #Curiosidad barplot(table(S)) # Y's Continuas & Discretas ----------------------------------------------- n <- 1234567 set.seed(9) #Parámetro de la Poisson lambda1 <- 7 ; lambda2 <- 4 ; lambda3 <- 21 lambda4 <- 10 ; lambda5 <- 9 ; lambda6 <- 6 lambda <- lambda1 + lambda2 + lambda3 + lambda4 + lambda5 + lambda6 ##Continuas #Exponencial rate <- 5 S1 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda1), #N~Poi(lambda1) model.sev = rexp(rate = rate)) #Y~Exp(rate) #Ji cuadrada dfredom <- 20 S2 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda2), #N~Poi(lambda2) model.sev = rchisq(df=dfredom)) #Y~JiCuadrada(dfredom) #Pareto shape <- 6 ; min <- 7 S3 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda3), #N~Poi(lambda3) model.sev = rpareto1(shape = 6,min = 7)) #Y~pareto(shape,scale) ##Discretas #Binomial size = 10 ; prob = 0.3 S4 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda4), #N~Poi(lambda4) model.sev = rbinom(size = size,prob = prob)) #Y~Bin(size,prob) #Poisson bawr = 7 S5 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda5), #N~Poi(lambda5) model.sev = rpois(lambda = bawr)) #Y~Poi(bawr) #Binomial Negativa k = 5 ; p = 0.9 S6 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda6), #N~Poi(lambda6) model.sev = rnbinom(size = k,prob = p)) #Y~BinNeg(k,p) ##Comenzamos: S <- S1 + S2 + S3 + S4 + S5 + S6 ##Esperanza #Teórica mu1<-lambda*(lambda1*(1/rate) + #Esperanza de la Exponencial lambda2*(dfredom) + #Esperanza de la Ji cuadrada lambda3*(shape*min/(shape-1)) + #Esperanza de la Pareto lambda4*(size*prob) + #Esperanza de la Binomial lambda5*(bawr) + #Esperanza de la Poisson lambda6*(k*(1-p)/p) #Esperanza de la Binomial Negativa )/lambda ; mu1 #Muestral mean(S) ##Segundo momento #Suma1 = lambda*E[Y^2] Suma1<-lambda*( #2do momento de la Exponencial lambda1*(2/rate^2) + #2do momento de la Ji cuadrada lambda2*(2*dfredom+dfredom^2) + #2do momento de la Pareto lambda3*((shape*min^2)/((shape-1)^2*(shape-2))+(shape*min/(shape-1))^2) + #2do momento de la Binomial lambda4*(size*prob*(1-prob)+(size*prob)^2) + #2do momento de la Poisson lambda5*(bawr+bawr^2) + #2do momento de la Binomial Negativa lambda6*(k*(1-p)/p^2+(k*(1-p)/p)^2) )/lambda #Suma2 = lambda^2*(E[Y])^2 Suma2<- lambda^2*(( lambda1*(1/rate) + #Esperanza de la Exponencial lambda2*(dfredom) + #Esperanza de la Ji cuadrada lambda3*(shape*min/(shape-1)) + #Esperanza de la Pareto lambda4*(size*prob) + #Esperanza de la Binomial lambda5*(bawr) + #Esperanza de la Poisson lambda6*(k*(1-p)/p) #Esperanza de la Binomial Negativa )/lambda)^2 #Teórica: mu2 <- Suma1 + Suma2 ; mu2 #Muestral mean(S^2) ##Varianza #Muestral var(S) #Teórica mu2-mu1^2 Suma1 ##Desviación #Muestral sd(S) #Teórica sqrt(mu2-mu1^2) #Curiosidad hist(S,col="red",probability = T) abline(v=mu1,col="blue",lwd=2) #¡¿Es normal!? goftest::ad.test(S,pnorm,mean=mu1,sd=sqrt(mu2-mu1^2)) #Uffff... no, eso sería MUY RARO... ¿Será algo..? # Discretas y continuas sobre los reales ---------------------------------- n <- 1234567 set.seed(21) #Parámetro de la Poisson lambda1 <- 7 ; lambda2 <- 4 ; lambda3 <- 21 lambda4 <- 10 ; lambda5 <- 9 ; lambda6 <- 6 lambda7 <- 3.2 lambda <- lambda1 + lambda2 + lambda3 + lambda4 + lambda5 + lambda6 + lambda7 ##Continuas #Exponencial rate <- 5 S1 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda1), #N~Poi(lambda1) model.sev = rexp(rate = rate)) #Y~Exp(rate) #Ji cuadrada dfredom <- 20 S2 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda2), #N~Poi(lambda2) model.sev = rchisq(df=dfredom)) #Y~JiCuadrada(dfredom) #Pareto shape <- 6 ; min <- 7 S3 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda3), #N~Poi(lambda3) model.sev = rpareto1(shape = 6,min = 7)) #Y~pareto(shape,scale) ##Discretas #Binomial size = 10 ; prob = 0.3 S4 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda4), #N~Poi(lambda4) model.sev = rbinom(size = size,prob = prob)) #Y~Bin(size,prob) #Poisson bawr = 7 S5 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda5), #N~Poi(lambda5) model.sev = rpois(lambda = bawr)) #Y~Poi(bawr) #Binomial Negativa k = 5 ; p = 0.9 S6 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda6), #N~Poi(lambda6) model.sev = rnbinom(size = k,prob = p)) #Y~BinNeg(k,p) ##Continuas sobre los reales #Normal media = -40 ; desv = 2 S7 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda7), #N~Poi(lambda6) model.sev = rnorm(mean = media,sd = desv)) #Y~N(media,desv) ##Comenzamos: S <- S1 + S2 + S3 + S4 + S5 + S6 + S7 ##Esperanza #Teórica mu1<-lambda*(lambda1*(1/rate) + #Esperanza de la Exponencial lambda2*(dfredom) + #Esperanza de la Ji cuadrada lambda3*(shape*min/(shape-1)) + #Esperanza de la Pareto lambda4*(size*prob) + #Esperanza de la Binomial lambda5*(bawr) + #Esperanza de la Poisson lambda6*(k*(1-p)/p) + #Esperanza de la Binomial Negativa lambda7*media #Esperanza de la Normal )/lambda ; mu1 #Muestral mean(S) ##Segundo momento #Suma1 = lambda*E[Y^2] Suma1<-lambda*( #2do momento de la Exponencial lambda1*(2/rate^2) + #2do momento de la Ji cuadrada lambda2*(2*dfredom+dfredom^2) + #2do momento de la Pareto lambda3*((shape*min^2)/((shape-1)^2*(shape-2))+(shape*min/(shape-1))^2) + #2do momento de la Binomial lambda4*(size*prob*(1-prob)+(size*prob)^2) + #2do momento de la Poisson lambda5*(bawr+bawr^2) + #2do momento de la Binomial Negativa lambda6*(k*(1-p)/p^2+(k*(1-p)/p)^2) + #2do momento de la Normal lambda7*(desv^2+media^2) )/lambda #Suma2 = lambda^2*(E[Y])^2 Suma2<- lambda^2*(( lambda1*(1/rate) + #Esperanza de la Exponencial lambda2*(dfredom) + #Esperanza de la Ji cuadrada lambda3*(shape*min/(shape-1)) + #Esperanza de la Pareto lambda4*(size*prob) + #Esperanza de la Binomial lambda5*(bawr) + #Esperanza de la Poisson lambda6*(k*(1-p)/p) + #Esperanza de la Binomial Negativa lambda7*media #Esperanza de la Normal )/lambda)^2 #Teórica: mu2 <- Suma1 + Suma2 ; mu2 #Muestral mean(S^2) ##Varianza #Muestral var(S) #Teórica mu2-mu1^2 Suma1 ##Desviación #Muestral sd(S) #Teórica sqrt(mu2-mu1^2) #Curiosidad hist(S,col="red",probability = T) abline(v=mu1,col="blue",lwd=2) #¡¿Es normal!? goftest::ad.test(S,pnorm,mean=mu1,sd=sqrt(mu2-mu1^2)) #Uffff... no, eso sería MUY RARO... ¿Será algo..? # Modelo Colectivo con variables aleatorias de pérdida de una cia. -------- #Consideremos N~Binomial(n,p) & X~Exp(rate) #Y La pérdida de una cia. con un contrato de seguros #con inflación, deducible, monto máximo y deducible #Debemos generar variables aleatorias provenientes de S #Parámetros de la N n <- 10000 #Número de simulaciones de S p <- 0.8 #parámetro de la binomial (p). size <- 50 #parámetro de la binomial (n). #Parámetros de la X rate<-1/100 #Parámetros de la Y #Fijamos deducible y límite máximo D<-25 ; U <- 175 #Tomemos un coeficiente de coaseguro alpha<-0.25 #Fijemos una tasa de inflación r<-0.15 regresa.una.S<-function(){ #Genera una N N<-rbinom(n = 1,size = size,prob = p) #Verifica si hubo reclamaciones. if(N>0){ X <- rexp(n = N,rate = rate) #Genera las que hubo. #Calculemos los pagos Yj<-pmax(alpha*(pmin(X*(1+r),U)-D),0) }else{ Yj <- 0 #Si no hubo, el total es cero. } #Regresa una S return(sum(Yj)) } # set.seed(21) S = replicate(n = n, #Número de veces expr = regresa.una.S()) #Expresión mean(S) #Momentos (Muestral Vs. Teórico) #Esperanza de Y library(actuar) fyL<-coverage(pdf = dexp,cdf = pexp, limit=U,inflation=r,deductible=D,coinsurance=alpha, per.loss=TRUE) f<-function(x,lambda=1/100){fyL(x,lambda)} #Esperanza teórica yfYL<-function(y){ y*f(y) } #Integrando (Esperanza) integral<-integrate(f = yfYL,lower = 0,upper = alpha*(U-D)) integral<-integral$value #Parte continua + parte discreta mu1y<-0*pexp(D/(1+r),rate=rate)+integral+(alpha*(U-D))*(1-pexp(U/(1+r),rate = rate)) #Segundo momento de Y #Esperanza teórica yfYL<-function(y){ y^2*f(y) } #Integrando (Esperanza) integral<-integrate(f = yfYL,lower = 0,upper = alpha*(U-D)) integral<-integral$value #Parte continua + parte discreta mu2y<-integral+(alpha*(U-D))^2*(1-pexp(U/(1+r),rate = rate)) ##Esperanza mean(S) ; size*p*mu1y ##Segundo momento mean(S^2) ; size*p*mu2y+size*(size-1)*p^2*(mu1y^2) ##Varianza var(S) ; size*p*(mu2y - p*mu1y^2) ##Desviación sd(S) ; sqrt(size*p*(mu2y - p*mu1y^2)) ##Consideremos N~Binomial Negativa(n,p) & X~Exp(rate) --- #Parámetros de la Binomial Negativa k <- 10 ; p <- 0.8 #¿Cómo simulo una muestra de pagos Y's? rPagoCia <- function(n){ X<-rexp(n,rate=rate) Y<-pmax(alpha*(pmin(X*(1+r),U)-D),0) return(Y) } #OJO: Estoy asumiendo que los siniestros son X~Exp(rate) set.seed(21) ; n = 1000000 S <- rcompound(n = n, #Genera n model.freq = rnbinom(size = k,prob = p), #N~BinNeg(k,p) model.sev = rPagoCia()) #Y~Pago de una cia con el contrato dado #Momentos (Muestral Vs. Teórico) ##Esperanza mean(S) ; k*(1/p-1)*mu1y ##Segundo momento mean(S^2) k*(1/p-1)*(1/p)*mu1y^2+k*(1/p-1)*(mu2y-mu1y^2)+(k*(1/p-1)*mu1y)^2 ##Varianza var(S) ; k*(1/p-1)*(1/p)*mu1y^2+k*(1/p-1)*(mu2y-mu1y^2) ##Desviación sd(S) ; sqrt(k*(1/p-1)*(1/p)*mu1y^2+k*(1/p-1)*(mu2y-mu1y^2)) ##Consideremos N~Poi(lambda) & X~Exp(rate) --- #Parámetro de la Poisson lambda <- 10 set.seed(21) S <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda), #N~Poi(lambda) model.sev = rPagoCia()) #Y~Exp(rate) #Momentos (Muestral Vs. Teórico) ##Esperanza mean(S) ; lambda*mu1y ##Segundo momento mean(S^2) ; lambda*(mu2y) + lambda^2*(mu1y^2) ##Varianza var(S) ; lambda * mu2y ##Desviación sd(S) ; sqrt(lambda * mu2y)
/Teoría del Riesgo (UNAM)/_Scripts_/6.1 Modelo Colectivo.R
no_license
hejurado/R_Actuarial
R
false
false
19,505
r
# Ejemplo Inicial --------------------------------------------------------- #Primero simulemos #Vector de probabilidades para las X f<-c(0.9,0.1*0.8,0.1*0.2) regresa.una.S<-function(){ #Genera una N N<-sample(x = c(0,3), #De este vector size = 1, #Toma una muestra de tamaño 1 replace = T,#Con reemplazo (En este caso da igual) prob = c(0.75,0.25))#Con las probabilidades correspondientes. #Verifica si hubo reclamaciones. if(N>0){ #Genera las que hubo. Xi <- sample(x = 0:2, #De este vector size = N, #Toma una muestra de tamaño N replace = T,#Con reemplazo (Puede volver reclamar lo mismo) prob = f)#Con las probabilidades correspondientes. }else{ Xi <- 0 #Si no hubo, el total es cero. } #Regresa una S return(sum(Xi)) } # n = 1000000 set.seed(9) S = replicate(n = n, #Número de veces expr = regresa.una.S()) #Expresión ##Probabilidades reales PrilII <- function(x,n,f,todo=F){ #n := número de pólizas #f := vector de probabilidades de X (ordenadas desde 0) #Creamos un vector auxiliar para las probas de S. g<-0:x names(g)<-0:x #Le ponemos nombres al vector de probas de f. names(f)<-0:(length(f)-1) #Fórmula De Pril II for(s in 0:x){ if(s==0){ g["0"]=f["0"]^n }else{aux = 0 for(j in 1:(min(s,length(f)-1))){ aux = aux + ((j*(n+1))/s - 1)*f[as.character(j)]*g[as.character(s-j)] } g[as.character(s)]=aux/f["0"] } } if(todo){ return(g) }else{ return(g[as.character(x)]) } } #Número de pólizas n<-3 #Vector de probabilidades f<-c(0.9,0.1*0.8,0.1*0.2) #Probabilidades Psd3<-PrilII(x = 6,n = n,f = f,todo = T) ; Psd3 sum(Psd3) #función de densidad de la suma aleatoria S fS <- function(s){ if(s==0){ return(0.75+Psd3[as.character(s)]*0.25) }else if(s %in% 1:6){ return(0.25*Psd3[as.character(s)]) }else{ return(0) } } #Probabilidades pS <- sapply(0:6, fS) ; pS #Proporciones simuladas table(S)/length(S) #¿Suma uno teórico? sum(pS) ##Esperanza de la suma aleatoria S #Teórica 0.25*sum(1:6*Psd3[as.character(1:6)]) mu <- sum(0:6*pS); mu #Muestral mean(S) ##Segundo momento #Teórico 0.25*sum((1:6)^2*Psd3[as.character(1:6)]) mu2 <- sum((0:6)^2*pS) ; mu2 #Muestral mean(S^2) ##Varianza #Teórica varianza <- mu2-mu^2 ; varianza #Muestral var(S) ##Desviación #Teórica sqrt(varianza) #Muestral sd(S) #Con esperanza iterada: EspX <- sum(0:2*f) EspN <- (3*0.25) mu ; EspX * EspN # Modelo Colectivo -------------------------------------------------------- #Los siguientes ejemplos serán considerando Yj~Exp(100) rate<-100 # Modelo Binomial Compuesto ----------------------------------------------- #Debemos generar variables aleatorias provenientes de S n <- 10000 #Número de simulaciones de S p <- 0.8 #parámetro de la binomial (p). size <- 50 #parámetro de la binomial (n). regresa.una.S<-function(){ #Genera una N N<-rbinom(n = 1,size = size,prob = p) #Verifica si hubo reclamaciones. if(N>0){ Yj <- rexp(n = N,rate = rate) #Genera las que hubo. }else{ Yj <- 0 #Si no hubo, el total es cero. } #Regresa una S return(sum(Yj)) } # set.seed(27) S = replicate(n = n, #Número de veces expr = regresa.una.S()) #Expresión #Momentos (Muestral Vs. Teórico) ##Esperanza mean(S) ; size*p/rate ##Segundo momento mean(S^2) ; size*p*(2/rate^2)+size*(size-1)*p^2/rate^2 ##Varianza var(S) ; size*p*(2/rate^2 - p/rate^2) # Modelo Binomial Negativo ------------------------------------------------ library(actuar) ?rcompound #Parámetros de la Binomial Negativa k <- 10 ; p <- 0.8 S <- rcompound(n = n, #Genera n model.freq = rnbinom(size = k,prob = p), #N~BinNeg(k,p) model.sev = rexp(rate = rate)) #Y~Exp(rate) #Momentos (Muestral Vs. Teórico) ##Esperanza mean(S) ; k*(1/p-1)/rate ##Segundo momento mean(S^2) ; k*(1/p-1)*(1/p)/rate^2+k*(1/p-1)*(2/rate^2-1/rate^2)+(k*(1/p-1)/rate)^2 ##Varianza var(S) ; k*(1/p-1)*(1/p)/rate^2+k*(1/p-1)*(2/rate^2-1/rate^2) # Modelo Poisson Compuesto ------------------------------------------------ #Parámetro de la Poisson lambda <- 10 rate=20 S <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda), # N~Poi(lambda) model.sev = rexp(rate = rate)) # Y~Exp(rate) #Momentos (Muestral Vs. Teórico) ##Esperanza mean(S) ; lambda/rate ##Segundo momento mean(S^2) ; lambda*(2/rate^2) + lambda^2*(1/rate^2) ##Varianza var(S) ; lambda * 2/rate^2 # Distribución de la convolución de Poisson Compuesta --------------------- n <- 1000000 ; library(actuar) set.seed(9) # Y's continuas ----------------------------------------------------------- #Parámetro de la Poisson lambda1 <- 7 ; lambda2 <- 4 ; lambda3 <- 21 lambda <- lambda1 + lambda2 + lambda3 #Exponencial rate <- 5 S1 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda1), #N~Poi(lambda1) model.sev = rexp(rate = rate)) #Y~Exp(rate) #Ji cuadrada dfredom <- 20 S2 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda2), #N~Poi(lambda2) model.sev = rchisq(df=dfredom)) #Y~JiCuadrada(dfredom) #Pareto shape <- 6 ; min <- 7 S3 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda3), #N~Poi(lambda3) model.sev = rpareto1(shape = 6,min = 7)) #Y~pareto(shape,scale) S <- S1 + S2 + S3 ##Esperanza #Muestral mean(S) #Teórica mu1<-lambda*(lambda1*(1/rate) + #Esperanza de la Exponencial lambda2*(dfredom) + #Esperanza de la Ji cuadrada lambda3*(shape*min/(shape-1)) #Esperanza de la Pareto )/lambda ; mu1 ##Segundo momento #Suma1 = lambda*E[Y^2] Suma1<-lambda*( #2do momento de la Exponencial lambda1*(2/rate^2) + #2do momento de la Ji cuadrada lambda2*(2*dfredom+dfredom^2) + #2do momento de la Pareto lambda3*((shape*min^2)/((shape-1)^2*(shape-2))+(shape*min/(shape-1))^2) )/lambda #Suma2 = lambda^2*(E[Y])^2 Suma2<- lambda^2*((lambda1*(1/rate) + #Esperanza de la Exponencial lambda2*(dfredom) + #Esperanza de la Ji cuadrada lambda3*(shape*min/(shape-1)) #Esperanza de la Pareto )/lambda)^2 #Teórica: mu2 <- Suma1 + Suma2 ; mu2 #Muestral mean(S^2) ##Varianza #Muestral var(S) #Teórica mu2-mu1^2 Suma1 # Y's discretas ----------------------------------------------------------- set.seed(2) #Parámetro de la Poisson lambda1 <- 7 ; lambda2 <- 4 ; lambda3 <- 21 lambda <- lambda1 + lambda2 + lambda3 #Binomial size = 10 ; prob = 0.3 S1 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda1), #N~Poi(lambda1) model.sev = rbinom(size = size,prob = prob)) #Y~Bin(size,prob) #Poisson bawr = 7 S2 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda2), #N~Poi(lambda2) model.sev = rpois(lambda = bawr)) #Y~Poi(bawr) #Binomial Negativa k = 5 ; p = 0.9 S3 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda3), #N~Poi(lambda3) model.sev = rnbinom(size = k,prob = p)) #Y~BinNeg(k,p) S <- S1 + S2 + S3 ##Esperanza #Muestral mean(S) #Teórica mu1<-lambda*(lambda1*(size*prob) + #Esperanza de la Binomial lambda2*(bawr) + #Esperanza de la Poisson lambda3*(k*(1-p)/p) #Esperanza de la Binomial Negativa )/lambda ; mu1 ##Segundo momento #Suma1 = lambda*E[Y^2] Suma1<-lambda*( #2do momento de la Binomial lambda1*(size*prob*(1-prob)+(size*prob)^2) + #2do momento de la Poisson lambda2*(bawr+bawr^2) + #2do momento de la Binomial Negativa lambda3*(k*(1-p)/p^2+(k*(1-p)/p)^2) )/lambda #Suma2 = lambda^2*(E[Y])^2 Suma2<- lambda^2*((lambda1*(size*prob) + #Esperanza de la Binomial lambda2*(bawr) + #Esperanza de la Poisson lambda3*(k*(1-p)/p) #Esperanza de la Binomial Negativa )/lambda)^2 #Teórica: mu2 <- Suma1 + Suma2 ; mu2 #Muestral mean(S^2) ##Varianza #Muestral var(S) #Teórica mu2-mu1^2 Suma1 #Curiosidad barplot(table(S)) # Y's Continuas & Discretas ----------------------------------------------- n <- 1234567 set.seed(9) #Parámetro de la Poisson lambda1 <- 7 ; lambda2 <- 4 ; lambda3 <- 21 lambda4 <- 10 ; lambda5 <- 9 ; lambda6 <- 6 lambda <- lambda1 + lambda2 + lambda3 + lambda4 + lambda5 + lambda6 ##Continuas #Exponencial rate <- 5 S1 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda1), #N~Poi(lambda1) model.sev = rexp(rate = rate)) #Y~Exp(rate) #Ji cuadrada dfredom <- 20 S2 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda2), #N~Poi(lambda2) model.sev = rchisq(df=dfredom)) #Y~JiCuadrada(dfredom) #Pareto shape <- 6 ; min <- 7 S3 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda3), #N~Poi(lambda3) model.sev = rpareto1(shape = 6,min = 7)) #Y~pareto(shape,scale) ##Discretas #Binomial size = 10 ; prob = 0.3 S4 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda4), #N~Poi(lambda4) model.sev = rbinom(size = size,prob = prob)) #Y~Bin(size,prob) #Poisson bawr = 7 S5 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda5), #N~Poi(lambda5) model.sev = rpois(lambda = bawr)) #Y~Poi(bawr) #Binomial Negativa k = 5 ; p = 0.9 S6 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda6), #N~Poi(lambda6) model.sev = rnbinom(size = k,prob = p)) #Y~BinNeg(k,p) ##Comenzamos: S <- S1 + S2 + S3 + S4 + S5 + S6 ##Esperanza #Teórica mu1<-lambda*(lambda1*(1/rate) + #Esperanza de la Exponencial lambda2*(dfredom) + #Esperanza de la Ji cuadrada lambda3*(shape*min/(shape-1)) + #Esperanza de la Pareto lambda4*(size*prob) + #Esperanza de la Binomial lambda5*(bawr) + #Esperanza de la Poisson lambda6*(k*(1-p)/p) #Esperanza de la Binomial Negativa )/lambda ; mu1 #Muestral mean(S) ##Segundo momento #Suma1 = lambda*E[Y^2] Suma1<-lambda*( #2do momento de la Exponencial lambda1*(2/rate^2) + #2do momento de la Ji cuadrada lambda2*(2*dfredom+dfredom^2) + #2do momento de la Pareto lambda3*((shape*min^2)/((shape-1)^2*(shape-2))+(shape*min/(shape-1))^2) + #2do momento de la Binomial lambda4*(size*prob*(1-prob)+(size*prob)^2) + #2do momento de la Poisson lambda5*(bawr+bawr^2) + #2do momento de la Binomial Negativa lambda6*(k*(1-p)/p^2+(k*(1-p)/p)^2) )/lambda #Suma2 = lambda^2*(E[Y])^2 Suma2<- lambda^2*(( lambda1*(1/rate) + #Esperanza de la Exponencial lambda2*(dfredom) + #Esperanza de la Ji cuadrada lambda3*(shape*min/(shape-1)) + #Esperanza de la Pareto lambda4*(size*prob) + #Esperanza de la Binomial lambda5*(bawr) + #Esperanza de la Poisson lambda6*(k*(1-p)/p) #Esperanza de la Binomial Negativa )/lambda)^2 #Teórica: mu2 <- Suma1 + Suma2 ; mu2 #Muestral mean(S^2) ##Varianza #Muestral var(S) #Teórica mu2-mu1^2 Suma1 ##Desviación #Muestral sd(S) #Teórica sqrt(mu2-mu1^2) #Curiosidad hist(S,col="red",probability = T) abline(v=mu1,col="blue",lwd=2) #¡¿Es normal!? goftest::ad.test(S,pnorm,mean=mu1,sd=sqrt(mu2-mu1^2)) #Uffff... no, eso sería MUY RARO... ¿Será algo..? # Discretas y continuas sobre los reales ---------------------------------- n <- 1234567 set.seed(21) #Parámetro de la Poisson lambda1 <- 7 ; lambda2 <- 4 ; lambda3 <- 21 lambda4 <- 10 ; lambda5 <- 9 ; lambda6 <- 6 lambda7 <- 3.2 lambda <- lambda1 + lambda2 + lambda3 + lambda4 + lambda5 + lambda6 + lambda7 ##Continuas #Exponencial rate <- 5 S1 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda1), #N~Poi(lambda1) model.sev = rexp(rate = rate)) #Y~Exp(rate) #Ji cuadrada dfredom <- 20 S2 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda2), #N~Poi(lambda2) model.sev = rchisq(df=dfredom)) #Y~JiCuadrada(dfredom) #Pareto shape <- 6 ; min <- 7 S3 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda3), #N~Poi(lambda3) model.sev = rpareto1(shape = 6,min = 7)) #Y~pareto(shape,scale) ##Discretas #Binomial size = 10 ; prob = 0.3 S4 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda4), #N~Poi(lambda4) model.sev = rbinom(size = size,prob = prob)) #Y~Bin(size,prob) #Poisson bawr = 7 S5 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda5), #N~Poi(lambda5) model.sev = rpois(lambda = bawr)) #Y~Poi(bawr) #Binomial Negativa k = 5 ; p = 0.9 S6 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda6), #N~Poi(lambda6) model.sev = rnbinom(size = k,prob = p)) #Y~BinNeg(k,p) ##Continuas sobre los reales #Normal media = -40 ; desv = 2 S7 <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda7), #N~Poi(lambda6) model.sev = rnorm(mean = media,sd = desv)) #Y~N(media,desv) ##Comenzamos: S <- S1 + S2 + S3 + S4 + S5 + S6 + S7 ##Esperanza #Teórica mu1<-lambda*(lambda1*(1/rate) + #Esperanza de la Exponencial lambda2*(dfredom) + #Esperanza de la Ji cuadrada lambda3*(shape*min/(shape-1)) + #Esperanza de la Pareto lambda4*(size*prob) + #Esperanza de la Binomial lambda5*(bawr) + #Esperanza de la Poisson lambda6*(k*(1-p)/p) + #Esperanza de la Binomial Negativa lambda7*media #Esperanza de la Normal )/lambda ; mu1 #Muestral mean(S) ##Segundo momento #Suma1 = lambda*E[Y^2] Suma1<-lambda*( #2do momento de la Exponencial lambda1*(2/rate^2) + #2do momento de la Ji cuadrada lambda2*(2*dfredom+dfredom^2) + #2do momento de la Pareto lambda3*((shape*min^2)/((shape-1)^2*(shape-2))+(shape*min/(shape-1))^2) + #2do momento de la Binomial lambda4*(size*prob*(1-prob)+(size*prob)^2) + #2do momento de la Poisson lambda5*(bawr+bawr^2) + #2do momento de la Binomial Negativa lambda6*(k*(1-p)/p^2+(k*(1-p)/p)^2) + #2do momento de la Normal lambda7*(desv^2+media^2) )/lambda #Suma2 = lambda^2*(E[Y])^2 Suma2<- lambda^2*(( lambda1*(1/rate) + #Esperanza de la Exponencial lambda2*(dfredom) + #Esperanza de la Ji cuadrada lambda3*(shape*min/(shape-1)) + #Esperanza de la Pareto lambda4*(size*prob) + #Esperanza de la Binomial lambda5*(bawr) + #Esperanza de la Poisson lambda6*(k*(1-p)/p) + #Esperanza de la Binomial Negativa lambda7*media #Esperanza de la Normal )/lambda)^2 #Teórica: mu2 <- Suma1 + Suma2 ; mu2 #Muestral mean(S^2) ##Varianza #Muestral var(S) #Teórica mu2-mu1^2 Suma1 ##Desviación #Muestral sd(S) #Teórica sqrt(mu2-mu1^2) #Curiosidad hist(S,col="red",probability = T) abline(v=mu1,col="blue",lwd=2) #¡¿Es normal!? goftest::ad.test(S,pnorm,mean=mu1,sd=sqrt(mu2-mu1^2)) #Uffff... no, eso sería MUY RARO... ¿Será algo..? # Modelo Colectivo con variables aleatorias de pérdida de una cia. -------- #Consideremos N~Binomial(n,p) & X~Exp(rate) #Y La pérdida de una cia. con un contrato de seguros #con inflación, deducible, monto máximo y deducible #Debemos generar variables aleatorias provenientes de S #Parámetros de la N n <- 10000 #Número de simulaciones de S p <- 0.8 #parámetro de la binomial (p). size <- 50 #parámetro de la binomial (n). #Parámetros de la X rate<-1/100 #Parámetros de la Y #Fijamos deducible y límite máximo D<-25 ; U <- 175 #Tomemos un coeficiente de coaseguro alpha<-0.25 #Fijemos una tasa de inflación r<-0.15 regresa.una.S<-function(){ #Genera una N N<-rbinom(n = 1,size = size,prob = p) #Verifica si hubo reclamaciones. if(N>0){ X <- rexp(n = N,rate = rate) #Genera las que hubo. #Calculemos los pagos Yj<-pmax(alpha*(pmin(X*(1+r),U)-D),0) }else{ Yj <- 0 #Si no hubo, el total es cero. } #Regresa una S return(sum(Yj)) } # set.seed(21) S = replicate(n = n, #Número de veces expr = regresa.una.S()) #Expresión mean(S) #Momentos (Muestral Vs. Teórico) #Esperanza de Y library(actuar) fyL<-coverage(pdf = dexp,cdf = pexp, limit=U,inflation=r,deductible=D,coinsurance=alpha, per.loss=TRUE) f<-function(x,lambda=1/100){fyL(x,lambda)} #Esperanza teórica yfYL<-function(y){ y*f(y) } #Integrando (Esperanza) integral<-integrate(f = yfYL,lower = 0,upper = alpha*(U-D)) integral<-integral$value #Parte continua + parte discreta mu1y<-0*pexp(D/(1+r),rate=rate)+integral+(alpha*(U-D))*(1-pexp(U/(1+r),rate = rate)) #Segundo momento de Y #Esperanza teórica yfYL<-function(y){ y^2*f(y) } #Integrando (Esperanza) integral<-integrate(f = yfYL,lower = 0,upper = alpha*(U-D)) integral<-integral$value #Parte continua + parte discreta mu2y<-integral+(alpha*(U-D))^2*(1-pexp(U/(1+r),rate = rate)) ##Esperanza mean(S) ; size*p*mu1y ##Segundo momento mean(S^2) ; size*p*mu2y+size*(size-1)*p^2*(mu1y^2) ##Varianza var(S) ; size*p*(mu2y - p*mu1y^2) ##Desviación sd(S) ; sqrt(size*p*(mu2y - p*mu1y^2)) ##Consideremos N~Binomial Negativa(n,p) & X~Exp(rate) --- #Parámetros de la Binomial Negativa k <- 10 ; p <- 0.8 #¿Cómo simulo una muestra de pagos Y's? rPagoCia <- function(n){ X<-rexp(n,rate=rate) Y<-pmax(alpha*(pmin(X*(1+r),U)-D),0) return(Y) } #OJO: Estoy asumiendo que los siniestros son X~Exp(rate) set.seed(21) ; n = 1000000 S <- rcompound(n = n, #Genera n model.freq = rnbinom(size = k,prob = p), #N~BinNeg(k,p) model.sev = rPagoCia()) #Y~Pago de una cia con el contrato dado #Momentos (Muestral Vs. Teórico) ##Esperanza mean(S) ; k*(1/p-1)*mu1y ##Segundo momento mean(S^2) k*(1/p-1)*(1/p)*mu1y^2+k*(1/p-1)*(mu2y-mu1y^2)+(k*(1/p-1)*mu1y)^2 ##Varianza var(S) ; k*(1/p-1)*(1/p)*mu1y^2+k*(1/p-1)*(mu2y-mu1y^2) ##Desviación sd(S) ; sqrt(k*(1/p-1)*(1/p)*mu1y^2+k*(1/p-1)*(mu2y-mu1y^2)) ##Consideremos N~Poi(lambda) & X~Exp(rate) --- #Parámetro de la Poisson lambda <- 10 set.seed(21) S <- rcompound(n = n, #Genera n model.freq = rpois(lambda = lambda), #N~Poi(lambda) model.sev = rPagoCia()) #Y~Exp(rate) #Momentos (Muestral Vs. Teórico) ##Esperanza mean(S) ; lambda*mu1y ##Segundo momento mean(S^2) ; lambda*(mu2y) + lambda^2*(mu1y^2) ##Varianza var(S) ; lambda * mu2y ##Desviación sd(S) ; sqrt(lambda * mu2y)
# Name : plotfit.R0.R # Desc : A set of tweaked "plot" functions designed to easily plot R objects # from any of the supported estimation methods. # Date : 2011/11/09 # Update : 2023/03/03 # Author : Boelle, Obadia ############################################################################### #' @title #' Plot a model fit for `R0.R` objects #' #' @description #' Plot the fit of a single model output to epidemic data. #' #' @details #' For internal use. This function is called by the [plotfit()] S3 method. #' Depending on the estimation method, either [plotfitRxx()], [plotfitRAR()] or #' [plotfitRSB()] will be called. #' #' @param x An output of `est.R0.xx()` (class `R0.R`). #' @param xscale Scale to be adjusted on x-axis. Can be `d` (day), `w` (week (default)), `f` (fornight), `m` (month). #' @param SB.dist Boolean. Should the R distirbution throughout the epidemic be plotted for the SB method (defaults to `TRUE`) ? #' @param ... Parameters passed to inner functions. #' #' @return #' This function does not return any data. #' Called for side effect. Draws the fit of one estimation method to the data. #' #' @importFrom grDevices dev.new #' @importFrom graphics abline axis close.screen split.screen screen lines points #' #' @keywords internal #' #' @author Pierre-Yves Boelle, Thomas Obadia # Function declaration plotfit.R0.R <- function( x, xscale = "w", SB.dist = TRUE, ... ) # Code { #Make sure x is of class "R0.R" if (!inherits(x, "R0.R")) stop("'x' must be of class R0.R") if (x$method.code %in% c("EG","ML","TD")) { do.call(plotfitRxx, args=list(x=x, xscale=xscale, ...) ) } else { do.call(paste("plotfitR",x$method.code,sep=""), args=list(x=x, xscale=xscale, SB.dist=SB.dist, ...) ) } } #' @title #' Internal plotfit method for EG, ML and TD estimates #' #' @description #' Plot the fit of a single model output to epidemic data when the method is #' EG, ML or TD. #' #' @details #' For internal use. This function is called by the [plotfit.R0.R()]. #' #' @param x An output of [est.R0.EG()], [est.R0.ML()] or [est.R0.TD()] (class `R0.R`). #' @param xscale Scale to be adjusted on x-axis. Can be `d` (day), `w` (week (default)), `f` (fornight), `m` (month). #' @param ... Parameters passed to inner functions. #' #' @return #' This function does not return any data. #' Called for side effect. Draws the fit of one estimation method to the data. #' #' @keywords internal #' #' @author Pierre-Yves Boelle, Thomas Obadia # Generic EG, ML and TD plotfit plotfitRxx <- function( x, xscale, ... ) # Code { epid <- x$epid #Get data used for the fit begin <- x$begin begin.nb <- x$begin.nb end <- x$end end.nb <- x$end.nb epid.used.for.fit <- list(incid=epid$incid[begin.nb:end.nb], t=epid$t[begin.nb:end.nb]) #Plot the whole original epidemic data plot(epid$t,epid$incid, xlab="Time",ylab="Incidence",t='s', xaxt="n", main=paste("Epidemic curve & model (", x$method,")"), ...) #Add a line showing predicted simulation lines(epid.used.for.fit$t,x$pred,col='red') #Highlight the original points points(epid.used.for.fit$t,epid.used.for.fit$incid,pch=19) #Finally, X-Axis labels div <- get.scale(xscale) #Where should labels be on axis atLab <- pretty(epid$t, n=length(epid$t)/div) #What should labels say lab <- format(pretty(epid$t, n=length(epid$t)/div)) axis(1, at=atLab, labels=lab) } #' @title #' Internal plotfit method for AR estimates #' #' @description #' Plot the fit of a single model output to epidemic data when the method is AR. #' #' @details #' For internal use. This function is called by the [plotfit.R0.R()]. #' #' @param x An output of [est.R0.AR()] (class `R0.R`). #' @param xscale Scale to be adjusted on x-axis. Can be `d` (day), `w` (week (default)), `f` (fornight), `m` (month). #' @param ... Parameters passed to inner functions. #' #' @return #' This function does not return any data. #' Called for side effect. Draws the fit of one estimation method to the data. #' #' @keywords internal #' #' @author Pierre-Yves Boelle, Thomas Obadia # AR plotfit plotfitRAR <- function( x, xscale, ... ) # Code { epid <- x$epid epid.orig <- x$epid.orig epid.used.for.fit <- list(incid=epid.orig$incid, t=epid.orig$t) #Plot the whole original epidemic data plot(epid$t,epid$incid, xlab="Time",ylab="Incidence",t='s', xaxt="n", main="Epidemic curve (Attack Rate)", ...) #Highlight the original points points(epid.used.for.fit$t,epid.used.for.fit$incid,pch=19) #Finally, X-Axis labels div <- get.scale(xscale) #Where should labels be on axis atLab <- pretty(epid$t, n=length(epid$t)/div) #What should labels say lab <- format(pretty(epid$t, n=length(epid$t)/div)) axis(1, at=atLab, labels=lab) } #' @title #' Internal plotfit method for AR estimates #' #' @description #' Plot the fit of a single model output to epidemic data when the method is SB. #' #' @details #' For internal use. This function is called by the [plotfit.R0.R()]. #' #' @param x An output of [est.R0.SB()] (class `R0.R`). #' @param xscale Scale to be adjusted on x-axis. Can be `d` (day), `w` (week (default)), `f` (fornight), `m` (month). #' @param SB.dist Boolean. Should the R distirbution throughout the epidemic be plotted for the SB method (defaults to `TRUE`) ? #' @param ... Parameters passed to inner functions. #' #' @return #' This function does not return any data. #' Called for side effect. Draws the fit of one estimation method to the data. #' #' @keywords internal #' #' @author Pierre-Yves Boelle, Thomas Obadia # SB plotfit plotfitRSB <- function( x, xscale, SB.dist, ... ) # Code { epid <- x$epid #Get data used for the fit begin <- x$begin begin.nb <- x$begin.nb end <- x$end end.nb <- x$end.nb epid.used.for.fit <- list(incid=epid$incid[begin.nb:end.nb], t=epid$t[begin.nb:end.nb]) #Plot the whole original epidemic data plot(epid$t,epid$incid, xlab="Time",ylab="Incidence",t='s', xaxt="n", main=paste("Epidemic curve & model (", x$method,")"), ...) #Add a line showing predicted simulation lines(epid.used.for.fit$t,x$pred,col='red') #Highlight the original points points(epid.used.for.fit$t,epid.used.for.fit$incid,pch=19) #Finally, X-Axis labels div <- get.scale(xscale) #Where should labels be on axis atLab <- pretty(epid$t, n=length(epid$t)/div) #What should labels say lab <- format(pretty(epid$t, n=length(epid$t)/div)) axis(1, at=atLab, labels=lab) #When plotting Bayesian, if SB.dist is enabled, plot some R distributions throughout the epidemic if (SB.dist == TRUE) { #x11() dev.new() split.screen(c(3,3)) if (end.nb-begin.nb>8) { num.to.plot <- c(1, rep(NA, 8)) } else { num.to.plot <- c(begin.nb:end.nb) } for (i in 1:length(num.to.plot)) { if (i == 1) { screen(1) plot(y=x$proba.Rt[[num.to.plot[i]]], x=seq(from=0, to=(length(x$proba.Rt[[num.to.plot[i]]])/100-0.01), by=0.01), xlab="R value", ylab="PDF", type="l", main=paste("t=",num.to.plot[i]), ...) abline(v=(which.max((cumsum(x$proba.Rt[[num.to.plot[i]]])) >= 0.025)-1)/100, col="red", lty="dotted") abline(v=(which.max((cumsum(x$proba.Rt[[num.to.plot[i]]])) >= 0.975)-1)/100, col="red", lty="dotted") next } if (is.na(num.to.plot[i])) { num.to.plot[i] <- num.to.plot[i-1] + floor(length(x$epid$incid[begin.nb:end.nb])/9) } screen(i) plot(x$proba.Rt[[num.to.plot[i]]], x=seq(from=0, to=(length(x$proba.Rt[[num.to.plot[i]]])/100-0.01), by=0.01), xlim=c(0,((length(x$proba.Rt[[num.to.plot[i]]]) - which.max(rev(x$proba.Rt[[num.to.plot[i]]])>0) + 1))/100 - 0.01), xlab="R value", ylab="PDF", pch=NA_integer_, type="l", main=paste("t=",num.to.plot[i]), ...) abline(v=(which.max((cumsum(x$proba.Rt[[num.to.plot[i]]])) >= 0.025)-1)/100, col="red", lty="dotted") abline(v=(which.max((cumsum(x$proba.Rt[[num.to.plot[i]]])) >= 0.975)-1)/100, col="red", lty="dotted") } #Closing devices close.screen(all.screens=TRUE) } }
/R/plotfit.R0.R.R
no_license
tobadia/R0
R
false
false
8,235
r
# Name : plotfit.R0.R # Desc : A set of tweaked "plot" functions designed to easily plot R objects # from any of the supported estimation methods. # Date : 2011/11/09 # Update : 2023/03/03 # Author : Boelle, Obadia ############################################################################### #' @title #' Plot a model fit for `R0.R` objects #' #' @description #' Plot the fit of a single model output to epidemic data. #' #' @details #' For internal use. This function is called by the [plotfit()] S3 method. #' Depending on the estimation method, either [plotfitRxx()], [plotfitRAR()] or #' [plotfitRSB()] will be called. #' #' @param x An output of `est.R0.xx()` (class `R0.R`). #' @param xscale Scale to be adjusted on x-axis. Can be `d` (day), `w` (week (default)), `f` (fornight), `m` (month). #' @param SB.dist Boolean. Should the R distirbution throughout the epidemic be plotted for the SB method (defaults to `TRUE`) ? #' @param ... Parameters passed to inner functions. #' #' @return #' This function does not return any data. #' Called for side effect. Draws the fit of one estimation method to the data. #' #' @importFrom grDevices dev.new #' @importFrom graphics abline axis close.screen split.screen screen lines points #' #' @keywords internal #' #' @author Pierre-Yves Boelle, Thomas Obadia # Function declaration plotfit.R0.R <- function( x, xscale = "w", SB.dist = TRUE, ... ) # Code { #Make sure x is of class "R0.R" if (!inherits(x, "R0.R")) stop("'x' must be of class R0.R") if (x$method.code %in% c("EG","ML","TD")) { do.call(plotfitRxx, args=list(x=x, xscale=xscale, ...) ) } else { do.call(paste("plotfitR",x$method.code,sep=""), args=list(x=x, xscale=xscale, SB.dist=SB.dist, ...) ) } } #' @title #' Internal plotfit method for EG, ML and TD estimates #' #' @description #' Plot the fit of a single model output to epidemic data when the method is #' EG, ML or TD. #' #' @details #' For internal use. This function is called by the [plotfit.R0.R()]. #' #' @param x An output of [est.R0.EG()], [est.R0.ML()] or [est.R0.TD()] (class `R0.R`). #' @param xscale Scale to be adjusted on x-axis. Can be `d` (day), `w` (week (default)), `f` (fornight), `m` (month). #' @param ... Parameters passed to inner functions. #' #' @return #' This function does not return any data. #' Called for side effect. Draws the fit of one estimation method to the data. #' #' @keywords internal #' #' @author Pierre-Yves Boelle, Thomas Obadia # Generic EG, ML and TD plotfit plotfitRxx <- function( x, xscale, ... ) # Code { epid <- x$epid #Get data used for the fit begin <- x$begin begin.nb <- x$begin.nb end <- x$end end.nb <- x$end.nb epid.used.for.fit <- list(incid=epid$incid[begin.nb:end.nb], t=epid$t[begin.nb:end.nb]) #Plot the whole original epidemic data plot(epid$t,epid$incid, xlab="Time",ylab="Incidence",t='s', xaxt="n", main=paste("Epidemic curve & model (", x$method,")"), ...) #Add a line showing predicted simulation lines(epid.used.for.fit$t,x$pred,col='red') #Highlight the original points points(epid.used.for.fit$t,epid.used.for.fit$incid,pch=19) #Finally, X-Axis labels div <- get.scale(xscale) #Where should labels be on axis atLab <- pretty(epid$t, n=length(epid$t)/div) #What should labels say lab <- format(pretty(epid$t, n=length(epid$t)/div)) axis(1, at=atLab, labels=lab) } #' @title #' Internal plotfit method for AR estimates #' #' @description #' Plot the fit of a single model output to epidemic data when the method is AR. #' #' @details #' For internal use. This function is called by the [plotfit.R0.R()]. #' #' @param x An output of [est.R0.AR()] (class `R0.R`). #' @param xscale Scale to be adjusted on x-axis. Can be `d` (day), `w` (week (default)), `f` (fornight), `m` (month). #' @param ... Parameters passed to inner functions. #' #' @return #' This function does not return any data. #' Called for side effect. Draws the fit of one estimation method to the data. #' #' @keywords internal #' #' @author Pierre-Yves Boelle, Thomas Obadia # AR plotfit plotfitRAR <- function( x, xscale, ... ) # Code { epid <- x$epid epid.orig <- x$epid.orig epid.used.for.fit <- list(incid=epid.orig$incid, t=epid.orig$t) #Plot the whole original epidemic data plot(epid$t,epid$incid, xlab="Time",ylab="Incidence",t='s', xaxt="n", main="Epidemic curve (Attack Rate)", ...) #Highlight the original points points(epid.used.for.fit$t,epid.used.for.fit$incid,pch=19) #Finally, X-Axis labels div <- get.scale(xscale) #Where should labels be on axis atLab <- pretty(epid$t, n=length(epid$t)/div) #What should labels say lab <- format(pretty(epid$t, n=length(epid$t)/div)) axis(1, at=atLab, labels=lab) } #' @title #' Internal plotfit method for AR estimates #' #' @description #' Plot the fit of a single model output to epidemic data when the method is SB. #' #' @details #' For internal use. This function is called by the [plotfit.R0.R()]. #' #' @param x An output of [est.R0.SB()] (class `R0.R`). #' @param xscale Scale to be adjusted on x-axis. Can be `d` (day), `w` (week (default)), `f` (fornight), `m` (month). #' @param SB.dist Boolean. Should the R distirbution throughout the epidemic be plotted for the SB method (defaults to `TRUE`) ? #' @param ... Parameters passed to inner functions. #' #' @return #' This function does not return any data. #' Called for side effect. Draws the fit of one estimation method to the data. #' #' @keywords internal #' #' @author Pierre-Yves Boelle, Thomas Obadia # SB plotfit plotfitRSB <- function( x, xscale, SB.dist, ... ) # Code { epid <- x$epid #Get data used for the fit begin <- x$begin begin.nb <- x$begin.nb end <- x$end end.nb <- x$end.nb epid.used.for.fit <- list(incid=epid$incid[begin.nb:end.nb], t=epid$t[begin.nb:end.nb]) #Plot the whole original epidemic data plot(epid$t,epid$incid, xlab="Time",ylab="Incidence",t='s', xaxt="n", main=paste("Epidemic curve & model (", x$method,")"), ...) #Add a line showing predicted simulation lines(epid.used.for.fit$t,x$pred,col='red') #Highlight the original points points(epid.used.for.fit$t,epid.used.for.fit$incid,pch=19) #Finally, X-Axis labels div <- get.scale(xscale) #Where should labels be on axis atLab <- pretty(epid$t, n=length(epid$t)/div) #What should labels say lab <- format(pretty(epid$t, n=length(epid$t)/div)) axis(1, at=atLab, labels=lab) #When plotting Bayesian, if SB.dist is enabled, plot some R distributions throughout the epidemic if (SB.dist == TRUE) { #x11() dev.new() split.screen(c(3,3)) if (end.nb-begin.nb>8) { num.to.plot <- c(1, rep(NA, 8)) } else { num.to.plot <- c(begin.nb:end.nb) } for (i in 1:length(num.to.plot)) { if (i == 1) { screen(1) plot(y=x$proba.Rt[[num.to.plot[i]]], x=seq(from=0, to=(length(x$proba.Rt[[num.to.plot[i]]])/100-0.01), by=0.01), xlab="R value", ylab="PDF", type="l", main=paste("t=",num.to.plot[i]), ...) abline(v=(which.max((cumsum(x$proba.Rt[[num.to.plot[i]]])) >= 0.025)-1)/100, col="red", lty="dotted") abline(v=(which.max((cumsum(x$proba.Rt[[num.to.plot[i]]])) >= 0.975)-1)/100, col="red", lty="dotted") next } if (is.na(num.to.plot[i])) { num.to.plot[i] <- num.to.plot[i-1] + floor(length(x$epid$incid[begin.nb:end.nb])/9) } screen(i) plot(x$proba.Rt[[num.to.plot[i]]], x=seq(from=0, to=(length(x$proba.Rt[[num.to.plot[i]]])/100-0.01), by=0.01), xlim=c(0,((length(x$proba.Rt[[num.to.plot[i]]]) - which.max(rev(x$proba.Rt[[num.to.plot[i]]])>0) + 1))/100 - 0.01), xlab="R value", ylab="PDF", pch=NA_integer_, type="l", main=paste("t=",num.to.plot[i]), ...) abline(v=(which.max((cumsum(x$proba.Rt[[num.to.plot[i]]])) >= 0.025)-1)/100, col="red", lty="dotted") abline(v=(which.max((cumsum(x$proba.Rt[[num.to.plot[i]]])) >= 0.975)-1)/100, col="red", lty="dotted") } #Closing devices close.screen(all.screens=TRUE) } }
####################################################### #apply함수 #apply함수는 행렬의 행 또는 열 방향으로 특정 함수 적용 ####################################################### test <- matrix(1:12, ncol = 3) apply(test, 1, sum) #두번째 인자는 행과 열의 방향을 의미 1은 행, 2는 열 #data.frame도 적용 가능한지 테스트 df_test <- as.data.frame(test) df_test apply(df_test, 1, sum) #matrix와 동일한 결과 ####################################################### #lpply함수 #lpply함수는 벡터, 리스트 함수 적용한 뒤에 리스트로 반환 ####################################################### test2 <- c(5,23,3,1,5,2) test2 <- lapply(test2, function(x){x*10}) unlist(test2) lapply(test2, nchar) ####################################################### #spply함수 #lappy와 비슷하지만 행렬 혹은 벡터 등의 데이터 타입으로 반환 ####################################################### x <- sapply(iris[,1:4], mean) as.data.frame(x) as.data.frame(t(x)) sapply(iris, class) #각 칼럼의 데이터 타입 확인 y <- sapply(iris[,1:4], function(X){x > 3}) y
/Day003/day3.R
no_license
woons/project_woons
R
false
false
1,154
r
####################################################### #apply함수 #apply함수는 행렬의 행 또는 열 방향으로 특정 함수 적용 ####################################################### test <- matrix(1:12, ncol = 3) apply(test, 1, sum) #두번째 인자는 행과 열의 방향을 의미 1은 행, 2는 열 #data.frame도 적용 가능한지 테스트 df_test <- as.data.frame(test) df_test apply(df_test, 1, sum) #matrix와 동일한 결과 ####################################################### #lpply함수 #lpply함수는 벡터, 리스트 함수 적용한 뒤에 리스트로 반환 ####################################################### test2 <- c(5,23,3,1,5,2) test2 <- lapply(test2, function(x){x*10}) unlist(test2) lapply(test2, nchar) ####################################################### #spply함수 #lappy와 비슷하지만 행렬 혹은 벡터 등의 데이터 타입으로 반환 ####################################################### x <- sapply(iris[,1:4], mean) as.data.frame(x) as.data.frame(t(x)) sapply(iris, class) #각 칼럼의 데이터 타입 확인 y <- sapply(iris[,1:4], function(X){x > 3}) y
setwd("E:/EDA with R/coursera") data<-read.csv("household_power_consumption.txt",sep=';') dat<-data dat$Date<-as.Date(dat$Date,"%d/%m/%Y") dat<-subset(dat,Date=="2007-02-01" | Date=="2007-02-02") dat<-subset(dat,!is.na(dat$Date)) x<-as.POSIXct(paste(dat$Date,dat$Time)) png(file="plot1.png",width=480,height=480) hist(as.numeric(dat$Global_active_power)/500,xlab="Global Active power(kilowatts)",col="Red") dev.off()
/plot1.r
no_license
harsha-yel/ExData_Plotting1
R
false
false
422
r
setwd("E:/EDA with R/coursera") data<-read.csv("household_power_consumption.txt",sep=';') dat<-data dat$Date<-as.Date(dat$Date,"%d/%m/%Y") dat<-subset(dat,Date=="2007-02-01" | Date=="2007-02-02") dat<-subset(dat,!is.na(dat$Date)) x<-as.POSIXct(paste(dat$Date,dat$Time)) png(file="plot1.png",width=480,height=480) hist(as.numeric(dat$Global_active_power)/500,xlab="Global Active power(kilowatts)",col="Red") dev.off()
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/PlayByPlayBoxScore.R \name{season_play_by_play} \alias{season_play_by_play} \title{Parsed Descriptive Play-by-Play Function for a Full Season} \usage{ season_play_by_play(Season) } \arguments{ \item{Season}{(numeric) A 4-digit year corresponding to an NFL season of interest} } \value{ A dataframe contains all the play-by-play information for a single season. This includes all the 62 variables collected in our game_play_by_play function (see documentation for game_play_by_play for details) } \description{ This function outputs all plays of an entire season in one dataframe. It calls the game_play_by_play function and applies it over every game in the season by extracting each game ID and url in the specified season. } \details{ This function calls the extracting_gameids, proper_jsonurl_formatting, and game_play_by_play to aggregate all the plays from a given season. This dataframe is prime for use with the dplyr and plyr packages. } \examples{ # Play-by-Play Data from All games in 2010 pbp.data.2010 <- season_play_by_play(2010) # Looking at all Baltimore Ravens Offensive Plays subset(pbp.data.2010, posteam = "BAL") }
/man/season_play_by_play.Rd
no_license
bensoltoff/nflscrapR
R
false
true
1,240
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/PlayByPlayBoxScore.R \name{season_play_by_play} \alias{season_play_by_play} \title{Parsed Descriptive Play-by-Play Function for a Full Season} \usage{ season_play_by_play(Season) } \arguments{ \item{Season}{(numeric) A 4-digit year corresponding to an NFL season of interest} } \value{ A dataframe contains all the play-by-play information for a single season. This includes all the 62 variables collected in our game_play_by_play function (see documentation for game_play_by_play for details) } \description{ This function outputs all plays of an entire season in one dataframe. It calls the game_play_by_play function and applies it over every game in the season by extracting each game ID and url in the specified season. } \details{ This function calls the extracting_gameids, proper_jsonurl_formatting, and game_play_by_play to aggregate all the plays from a given season. This dataframe is prime for use with the dplyr and plyr packages. } \examples{ # Play-by-Play Data from All games in 2010 pbp.data.2010 <- season_play_by_play(2010) # Looking at all Baltimore Ravens Offensive Plays subset(pbp.data.2010, posteam = "BAL") }
# Hsiang-Leng Wang # 2019/11/07 # RStudio Exercise 2 # ------------------------ # Data wrangling # read the data into memory lrn14 <- read.table("http://www.helsinki.fi/~kvehkala/JYTmooc/JYTOPKYS3-data.txt", sep="\t", header=TRUE) # Look at the dimensions of the data dim(lrn14) # Look at the structure of the data str(lrn14) # This data sheet is a 183 rows*60 columns(variables) table. # Columns from 1 to 59 consist of integer numbers, and columns from 57 to 59 display the information about age, attitude and points as shown on the header of the table. # Column 60 display the factor information about gender as "F" and "M". # ------------------------ # The column Attitude in lrn14 is a sum of 10 questions related to students attitude towards statistics, # each measured on the Likert scale (1-5). Here we'll scale the combination variable back to the 1-5 scale. # create column 'attitude' by scaling the column "Attitude" lrn14$attitude <- lrn14$Attitude / 10 # Access the dplyr library library(dplyr) # questions related to deep, surface and strategic learning deep_questions <- c("D03", "D11", "D19", "D27", "D07", "D14", "D22", "D30","D06", "D15", "D23", "D31") surface_questions <- c("SU02","SU10","SU18","SU26", "SU05","SU13","SU21","SU29","SU08","SU16","SU24","SU32") strategic_questions <- c("ST01","ST09","ST17","ST25","ST04","ST12","ST20","ST28") # select the columns related to deep learning and create column 'deep' by averaging deep_columns <- select(lrn14, one_of(deep_questions)) lrn14$deep <- rowMeans(deep_columns) # select the columns related to surface learning and create column 'surf' by averaging surface_columns <- select(lrn14, one_of(surface_questions)) lrn14$surf <- rowMeans(surface_columns) # select the columns related to strategic learning and create column 'stra' by averaging strategic_columns <- select(lrn14, one_of(strategic_questions)) lrn14$stra <- rowMeans(strategic_columns) # choose a handful of columns to keep keep_columns <- c("gender","Age","attitude", "deep", "stra", "surf", "Points") # select the 'keep_columns' to create a new dataset learning2014 <- select(lrn14,one_of(keep_columns)) # select rows where points is greater than zero learning2014 <- filter(learning2014, Points > 0) # see the stucture of the new dataset str(learning2014) # ------------------------ # set working directory setwd("/Users/mac/IODS-project/data") # write and save table to working directory write.table(learning2014, file = "learning2014.txt") # read table again lrn14_2 <- read.table("learning2014.txt", sep = "\t", header=TRUE) lrn14_2
/data/create_learning2014.R
no_license
hlengw/IODS-project
R
false
false
2,594
r
# Hsiang-Leng Wang # 2019/11/07 # RStudio Exercise 2 # ------------------------ # Data wrangling # read the data into memory lrn14 <- read.table("http://www.helsinki.fi/~kvehkala/JYTmooc/JYTOPKYS3-data.txt", sep="\t", header=TRUE) # Look at the dimensions of the data dim(lrn14) # Look at the structure of the data str(lrn14) # This data sheet is a 183 rows*60 columns(variables) table. # Columns from 1 to 59 consist of integer numbers, and columns from 57 to 59 display the information about age, attitude and points as shown on the header of the table. # Column 60 display the factor information about gender as "F" and "M". # ------------------------ # The column Attitude in lrn14 is a sum of 10 questions related to students attitude towards statistics, # each measured on the Likert scale (1-5). Here we'll scale the combination variable back to the 1-5 scale. # create column 'attitude' by scaling the column "Attitude" lrn14$attitude <- lrn14$Attitude / 10 # Access the dplyr library library(dplyr) # questions related to deep, surface and strategic learning deep_questions <- c("D03", "D11", "D19", "D27", "D07", "D14", "D22", "D30","D06", "D15", "D23", "D31") surface_questions <- c("SU02","SU10","SU18","SU26", "SU05","SU13","SU21","SU29","SU08","SU16","SU24","SU32") strategic_questions <- c("ST01","ST09","ST17","ST25","ST04","ST12","ST20","ST28") # select the columns related to deep learning and create column 'deep' by averaging deep_columns <- select(lrn14, one_of(deep_questions)) lrn14$deep <- rowMeans(deep_columns) # select the columns related to surface learning and create column 'surf' by averaging surface_columns <- select(lrn14, one_of(surface_questions)) lrn14$surf <- rowMeans(surface_columns) # select the columns related to strategic learning and create column 'stra' by averaging strategic_columns <- select(lrn14, one_of(strategic_questions)) lrn14$stra <- rowMeans(strategic_columns) # choose a handful of columns to keep keep_columns <- c("gender","Age","attitude", "deep", "stra", "surf", "Points") # select the 'keep_columns' to create a new dataset learning2014 <- select(lrn14,one_of(keep_columns)) # select rows where points is greater than zero learning2014 <- filter(learning2014, Points > 0) # see the stucture of the new dataset str(learning2014) # ------------------------ # set working directory setwd("/Users/mac/IODS-project/data") # write and save table to working directory write.table(learning2014, file = "learning2014.txt") # read table again lrn14_2 <- read.table("learning2014.txt", sep = "\t", header=TRUE) lrn14_2
sea <- read_csv("data-processed/sea_processed2.csv") sea %>% filter(temperature == 5) %>% filter(time_since_innoc_days > 30) %>% summarise(mean_size = mean(cell_volume)) sea %>% filter(temperature < 32) %>% filter(time_since_innoc_days > 25) %>% group_by(rep, temperature) %>% summarise(mean_size = mean(cell_volume)) %>% # ungroup() %>% # ggplot(aes(x = temperature, y = mean_size)) +geom_point() + # geom_smooth(method = "lm") lm(mean_size ~ temperature, data = .) %>% summary() sea %>% filter(temperature < 32) (-15.991 /1173)*100
/Rscripts/21_messing_around.R
no_license
OConnor-Lab-UBC/J-TEMP
R
false
false
569
r
sea <- read_csv("data-processed/sea_processed2.csv") sea %>% filter(temperature == 5) %>% filter(time_since_innoc_days > 30) %>% summarise(mean_size = mean(cell_volume)) sea %>% filter(temperature < 32) %>% filter(time_since_innoc_days > 25) %>% group_by(rep, temperature) %>% summarise(mean_size = mean(cell_volume)) %>% # ungroup() %>% # ggplot(aes(x = temperature, y = mean_size)) +geom_point() + # geom_smooth(method = "lm") lm(mean_size ~ temperature, data = .) %>% summary() sea %>% filter(temperature < 32) (-15.991 /1173)*100
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/model_runner_internal.R \name{update_temporal_params} \alias{update_temporal_params} \title{Updates parameters on a certain date} \usage{ update_temporal_params(pars, pars_to_update, sd_update_metrics = NULL) } \arguments{ \item{pars}{existing parameters} \item{pars_to_update}{one item from pars_temporal which are the parameters to update} \item{sd_update_metrics}{optionally the current metrics for determining sd dynamically} } \value{ updated parameters } \description{ Updates parameters on a certain date }
/HutchCOVID/man/update_temporal_params.Rd
no_license
FredHutch/COVID_modeling_schools
R
false
true
594
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/model_runner_internal.R \name{update_temporal_params} \alias{update_temporal_params} \title{Updates parameters on a certain date} \usage{ update_temporal_params(pars, pars_to_update, sd_update_metrics = NULL) } \arguments{ \item{pars}{existing parameters} \item{pars_to_update}{one item from pars_temporal which are the parameters to update} \item{sd_update_metrics}{optionally the current metrics for determining sd dynamically} } \value{ updated parameters } \description{ Updates parameters on a certain date }
corr <- function(directory, threshold = 0) { fileList <- list.files(directory, pattern = ".csv", full.names = TRUE); df <- complete(directory) # print(str(df)) # 332 obs ids <- df[df["nobs"] > threshold,]$id # select dataframe rows , > threshold # print(ids) # str(ids) # 323 obs corrr <- numeric() for (i in ids) { data <- read.csv(fileList[i]) complete_data <- data[complete.cases(data),] corrr <- c(corrr , cor(complete_data$sulfate, complete_data$nitrate)) } # print(complete_data) return(corrr) } cr <- corr("specdata" , 150) cr # summary(cr)
/corr_week_2.R
no_license
yeasinopu17/r_coursera
R
false
false
589
r
corr <- function(directory, threshold = 0) { fileList <- list.files(directory, pattern = ".csv", full.names = TRUE); df <- complete(directory) # print(str(df)) # 332 obs ids <- df[df["nobs"] > threshold,]$id # select dataframe rows , > threshold # print(ids) # str(ids) # 323 obs corrr <- numeric() for (i in ids) { data <- read.csv(fileList[i]) complete_data <- data[complete.cases(data),] corrr <- c(corrr , cor(complete_data$sulfate, complete_data$nitrate)) } # print(complete_data) return(corrr) } cr <- corr("specdata" , 150) cr # summary(cr)
######################################################################################################## # Process to generate a NetCDF file with raw data (L0 product) using location data # Project: SOCIB Seaturtle # Author: Chloé Dalleau # Co-author: David March # Date: 08/08/2016 # # Description: # This script is the first step of a global processing about the analysis of the turtles' trajectory. # The following steps create a NetCDF file using the raw data of the turtle: # - (1) Data import from CSV files or from Wildlife Computers (WC) data portal: time, latitude (Argos/GPS), # longitude (Argos/GPS), location quality, number of satellites available from GPS, residual from GPS, temperature, depth, battery. # Please note that a variable cannot be chosen several times from different csv files (except time and tagid). # - (2) CSV file (generated by DAP software from Wildlife Computers) merging in a NetCDF file # # The process uses two additional CSV files : # * meta_data: a file with all the information about the turtles such as: name, id, date deployment ... # * allparameter: list of the variables or global attributes which will be created in the NetCDF file. This file allows an # automation of the creation of the NetCDF file. It contains: # - the name of the variable # - the long name # - the unit # - the details # - the NetCDF variable type (NC_DOUBLE,NC_CHAR,NC_INT ...) # - specify if the variable is used in an another process (here : L0product, L1product and L2product) # - if the type is NC_CHAR, specify the dimension # - the dimension used in the NetCDF file in the different processes (here : dimL0product, dimL1product and dimL2product). # Such as : # var_name,long_name,units,details,value_type,L0product,L1product,L2product,dimCHAR,dimL0product,dimL1product,dimL2product # time,time,seconds since 1970-01-01 00:00:00,,NC_INT,x,,,,time,, # source_loc,source of the location,,,NC_CHAR,x,x,,max_string_32,time,time, # NC_GLOBAL,otherTypeLoc,,,NC_CHAR,x,,,,,, # # # WARNING: # - There are differences in date formant between CSV files (eg. Locations vs. Series) and tutles (eg. processed by WC Data portal vs DAP). # Main problem is the name of the month (eg. 'ago' or 'aug' for Spanish or English, respectively). Check this in Step 2. Suggestion: process all tracks in English (check manual for DAP) # - We remove duplicates in time for each CSV file processed. Some duplications in time may have different data. We delete one of them. In future versions, check if we can use any quality control criteria. # - Current script works for tags with temperature and pressure sensors (ie. Series.csv) and with battery information (Status.csv). # # # Sources: # - Michna, P. & Milton Woods. RNetCDF - A Package for Reading and Writing NetCDF Datasets. (2013). # - Michna, P. & Milton Woods. Package 'RNetCDF'. (2016). # - units: http://www.unidata.ucar.edu/software/udunits/udunits-2.2.20/udunits/udunits2-derived.xml # - standard names: http://cfconventions.org/Data/cf-standard-names/34/build/cf-standard-name-table.html ######################################################################################################## ### Remove the previous data rm(list=ls()) ### Import libraries library(RNetCDF) library(lubridate) library(curl) #library(wcUtils) # used in step 1, taken from https://github.com/jmlondon/wcUtils ### Set the turtle ID (Ptt) and if the data should be downloaded from the WC data portal tag_id <- 00000 # modify the tag_id according to your turtle download_from_WCDataPortal <- "no" # if "yes", step 1 will be processed lan.setlocale = "English" # see parse_date_time ############################### Step 1: creation of the CSV file from WC Data Portal ################## if (download_from_WCDataPortal == "yes") { # Define location and file with auth keys keyfile = "keyfile.json" # User ID owner = "xxxxxxxxxxxxxxxxxxxxxx" # this ID was obtained after inspecting the Data Portal with Chrome developer tools # Folder to download data path = paste("data/rawinput/",tag_id,"/.", sep= "") # Argos Platform ID ptt = tag_id ## Define function to dowload data wcGetPttData <- function (keyfile, owner, path, ptt){ # Get deployment information params = paste("action=get_deployments&owner_id=", owner, sep="") wcpost <- wcPOST(keyfile= keyfile, params = params) # Get PPT ID id <- wcGetPttID(wcpost, ptt = ptt)$ids # Download and extract ZIP files to obtain CSV files zipPath <- wcGetZip(id, keyfile = keyfile) # download zip file in a temporal folder unzip(zipPath, exdir = path) # extract all .CSV files from ZIP # file.copy(from = file,to = newfile,overwrite = TRUE) # copy the zip in rawarchive } wcGetPttData(keyfile, owner, path, ptt) } ###################################### Step 2: Import data ########################################### ### Meta data import meta_data <- "data/turtles_metadata.csv" meta_data <- read.csv(meta_data, sep=",", dec=".", header=TRUE, fill=TRUE) colnames(meta_data)<-c("argosid", "name", "dateDeployment","refMaxSeaTemp","refMinSeaTemp","refMaxDepth","refMinDepth", "title", "author", "publisher","fileVersion","otherTypeLoc") meta_data$argosid<-as.character(meta_data$argosid) meta_data$name<-as.character(meta_data$name) meta_data$dateDeployment <- as.POSIXct(meta_data$dateDeployment, "%Y-%m-%d %H:%M:%S", tz="GMT") meta_data$refMaxSeaTemp<-as.numeric(as.character(meta_data$refMaxSeaTemp)) meta_data$refMinSeaTemp<-as.numeric(as.character(meta_data$refMinSeaTemp)) meta_data$refMaxDepth<-as.numeric(as.character(meta_data$refMaxDepth)) meta_data$refMinDepth<-as.numeric(as.character(meta_data$refMinDepth)) meta_data$title<-as.character(meta_data$title) meta_data$author<-as.character(meta_data$author) meta_data$publisher<-as.character(meta_data$publisher) meta_data$fileVersion<-as.character(meta_data$fileVersion) meta_data$otherTypeLoc<-as.character(meta_data$otherTypeLoc) ### Meta data selection using the turtle ID select_data <- meta_data[which((meta_data$argosid == tag_id) == "TRUE"),] ### Select correct CSV file ## Locations : location of the turtle and quality location from Argos ## Series : temperature and depth and their errors ## Status : battery voltage just prior to transmission ## 1-FastGPS : location of the turtle and quality location from GPS if (select_data$otherTypeLoc == "GPS") { name_file <- c("Locations","Status","Series", "1-FastGPS") # Warning : the order is important name_data <- c("loc_data","status_data","series_data","gps_data") # Warning : the order is important } else { name_file <- c("Locations","Status","Series") name_data <- c("loc_data","status_data","series_data") } level <- "L0" ### Data import from CSV files using either WC data portal or the file version. dirfile <- dir(path=paste("data/rawinput/",tag_id,sep=""), pattern="*.csv$") # select all the names of csv files contained in the path chosen file <- c() # Warning locations != Locations # Warning let ".csv", if no select Series and SeriesRange for (i in 1:length(name_file)) file[i] <- dirfile[grep(paste( tag_id,"-",name_file[i],".csv", sep = ""),dirfile)] # select the names of the csv files chosen in "name_file" for (i in 1:length(file)){ if (name_data[i] == "gps_data"){ ff <- paste("data/rawinput/",tag_id,"/",file[i],sep="") data <- read.csv(ff, sep=",", dec=".", header=TRUE, skip = 3) assign(name_data[i],data) rm("data") } else { ff <- paste("data/rawinput/",tag_id,"/",file[i],sep="") data <- read.csv(ff, sep=",", dec=".", header=TRUE) assign(name_data[i],data) rm("data") } } ### Select interesting variables ## Locations.csv loc_data <- loc_data[,c("DeployID","Date","Quality","Latitude","Longitude")] colnames(loc_data)<- c("tagid", "time", "lc", "lat", "lon") loc_data$tagid<-as.numeric(as.character(loc_data$tagid)) loc_data$time <- parse_date_time(loc_data$time, c("HMS dbY", "Ymd HMS"), locale=Sys.setlocale("LC_TIME", "English"), tz="GMT") loc_data$lc<-as.character(loc_data$lc) loc_data$lat<-as.numeric(as.character(loc_data$lat)) loc_data$lon<-as.numeric(as.character(loc_data$lon)) ## Series.csv series_data$Date <- parse_date_time(paste(series_data$Time, series_data$Day, sep=" "), c("HMS dbY", "Ymd HMS"), locale=Sys.setlocale("LC_TIME", lan.setlocale), tz="GMT") series_data <- series_data[,c("DeployID","Date","Temperature","TRange","Depth","DRange")] colnames(series_data) <- c("tagid", "time", "temp", "errorT", "depth", "errorD") series_data$tagid <- as.numeric(as.character(series_data$tagid)) series_data$temp <- as.numeric(as.character(series_data$temp)) series_data$errorT <- as.numeric(as.character(series_data$errorT)) series_data$depth <- as.numeric(as.character(series_data$depth)) series_data$errorD <- as.numeric(as.character(series_data$errorD)) ## Status.csv status_data$Date <- status_data$Received status_data <- status_data[,c("DeployID","Date","BattVoltage")] colnames(status_data) <- c("tagid", "time", "batt") status_data$tagid <- as.numeric(as.character(status_data$tagid)) status_data$time <- parse_date_time(status_data$time, c("HMS dbY", "Ymd HMS"), locale=Sys.setlocale("LC_TIME", "English"), tz="GMT") status_data$batt <- as.numeric(as.character(status_data$batt)) ## GPS.csv if (select_data$otherTypeLoc == "GPS") { gps_data$Date <- parse_date_time(paste(gps_data$Time, gps_data$Day, sep=" "), c("HMS dbY", "Ymd HMS"), locale=Sys.setlocale("LC_TIME", "English"), tz="GMT") gps_data <- gps_data[,c("Name","Date","Satellites","Residual","Latitude","Longitude")] colnames(gps_data) <- c("tagid", "time", "satellites","residual", "lat_gps", "lon_gps") gps_data$tagid <- as.numeric(as.character(gps_data$tagid)) gps_data$time <- parse_date_time(gps_data$time, c("HMS dbY", "Ymd HMS"), locale=Sys.setlocale("LC_TIME", "English"), tz="GMT") gps_data$satellites <- as.numeric(as.character(gps_data$satellites)) gps_data$residual <- as.numeric(as.character(gps_data$residual)) gps_data$lat_gps <- as.numeric(as.character(gps_data$lat_gps)) gps_data$lon_gps <- as.numeric(as.character(gps_data$lon_gps)) } ### Removing locations from testing environments before releasing loc_data <- loc_data[which((loc_data$time > select_data$dateDeployment) == "TRUE"),] series_data <- series_data[which((series_data$time > select_data$dateDeployment) == "TRUE"),] status_data <- status_data[which((status_data$time > select_data$dateDeployment) == "TRUE"),] if (select_data$otherTypeLoc == "GPS") gps_data <- gps_data[which((gps_data$time > select_data$dateDeployment) == "TRUE"),] ### Remove duplicate time measurements if (length(which(duplicated(loc_data$time)))!=0) loc_data <- loc_data[-which(duplicated(loc_data$time)),] if (length(which(duplicated(series_data$time)))!=0) series_data <- series_data[-which(duplicated(series_data$time)),] if (length(which(duplicated(status_data$time)))!=0) status_data <- status_data[-which(duplicated(status_data$time)),] if (select_data$otherTypeLoc == "GPS") { if (length(which(duplicated(gps_data$time)))!=0) gps_data <- gps_data[-which(duplicated(gps_data$time)),] } ### Merge the latitude and longitude observations from Argos and GPS ## If time measurements exist at the Argo and the GPS source, the latitude and the longitude from the GPS source are selected if (select_data$otherTypeLoc == "GPS") { mergeloc <- merge(loc_data,gps_data, all = T) colnames(mergeloc) <- c("tagid","time","lc","lat_argos","lon_argos","satellites","residual","lat_gps","lon_gps") mergeloc$lat <- NA mergeloc$lon <- NA mergeloc$source_loc <- name_file[1] dimmerge <- dim(mergeloc)[1] for (i in 1:dimmerge){ if (length(which(mergeloc$time[i] == gps_data$time)) != 0) { mergeloc[i,c("lat","lon")] <- mergeloc[i,c("lat_gps","lon_gps")] mergeloc[i,c("lc")] <- "gps" mergeloc[i,c("source_loc")] <- name_file[4] # Warning : be careful with the order } else { mergeloc[i,c("lat","lon")] <- mergeloc[i,c("lat_argos","lon_argos")] } } mergeloc <- mergeloc[,c("tagid","time","lc","satellites","residual","lat","lon","source_loc")] } else { mergeloc <- loc_data mergeloc$source_loc <- rep(name_file[1]) # Warning : be careful with the order } ### Add a column to describe the source data type for Series and Status series_data$source_series <- rep(name_file[3]) # Warning : be careful with the order status_data$source_status <- rep(name_file[2]) # Warning : be careful with the order ####################################################################################################### ###################################### Step 3: Merge existing data #################################### ### Merge the observations with the same time - Works only if a variable is chosen only once from csv ## files (except time and tagid) fusion <- merge(mergeloc,series_data, all=TRUE) fusion <- merge(fusion,status_data, all=TRUE) ####################################################################################################### ###################################### Step 4: Data export in a csv file #################################### output.file <- paste("data/output/",tag_id,"/",level,"/",tag_id,"-",level,".csv", sep= "") write.table(fusion, output.file, row.names=FALSE, sep=",", dec=".") ####################################################################################################### ###################################### Step 5: Prepare the data for the NetCDF document ############### ## To add a new variable with attributes (long_name,units,details) in the NetCDF: modify the previous step and the CSV ## file parameter_netcdf ## To add other attributes such as maximum, minimum, add them manualy (see also maximum and minimum for the temperature) ## The dimensions and the details for the NC_Global are inserted manually ### Import parameters from parameter_netcdf.csv ## WARNING the name of the data created in the previous step have to be the same as the var_name in ## allparameter (or long_name for NC_GLOBAL). allparameter <- "data/parameter_netcdf.csv" allparameter <- read.csv(allparameter, sep=",", dec=".", header=TRUE, fill=TRUE) if (select_data$otherTypeLoc != "GPS") { allparameter <- allparameter[-which(allparameter$var_name == "satellites"),] allparameter <- allparameter[-which(allparameter$var_name == "residual"),] } product <- paste(level,"product",sep = "") variables <- allparameter[which(allparameter[[product]] == "x"),] for (i in 1:length(variables)) { variables[,i] <- as.character(variables[,i])} dimvar <- dim(variables)[1] glob_att<- "data/nc_global_att.csv" glob_att <- read.csv(glob_att, sep=",", dec=".", header=TRUE, fill=TRUE) glob_att <- glob_att[which(glob_att[[product]] == "x"),] for (i in 1:length(glob_att)) { glob_att[,i] <- as.character(glob_att[,i])} dimglob <- dim(glob_att)[1] ####################################################################################################### ###################################### Step 6: Creation of NetCDF #################################### ### Creation of new NetCDF file data_type <- "netcdf" filename <- paste("data/output/",tag_id,"/",level,"/",tag_id,"-",level,".nc", sep="") dataset <- create.nc(filename) ### Creation of new NetCDF dimensions, the dimension is defined by the length of the variables ## A NetCDF file may only contain one unlim dimension. We choose the variable with the most observations (time) dim.def.nc(dataset, "time", unlim=TRUE) ## For the variables with characters, there are 2 dimensions: (1) the number of observations (like "time") ## and (2) the maximum length of the string. This second dimension is created here: dim.def.nc(dataset, "max_string_32", 32) dim.def.nc(dataset, "max_string_4", 4) ### Creation of new NetCDF variables ## Definition of the variables in the NetCDF file with the format ## var.def.nc(netcdf_file, "variable_name", "value_type","dimension"), such as: ## - var.def.nc(dataset, "time", "NC_INT","time") ## - var.def.nc(dataset, "lat", "NC_DOUBLE","time") ## - var.def.nc(dataset, "source_loc", "NC_CHAR",c("max_string_32","time")): for the character, ## the UNLIM dimension has to be at last in the dimension vector for ( i in 1:dimvar ) { if (variables$value_type[i]=="NC_CHAR"){ var.def.nc(dataset, variables$var_name[i], variables$value_type[i], c(variables$dimCHAR[i],variables$dimL0product[i])) } else { var.def.nc(dataset, variables$var_name[i], variables$value_type[i], variables$dimL0product[i]) } } ## To view the NetCDF file # print.nc(dataset) # at this step the dimension of the time is NULL, because the observations are not added ### Put attributes in the variables or in the NC_GLOBAL ## The attributes are either the meta data of the variables or the global meta data of the NetCDF (NC_GLOBAL) ## the format is : att.put.nc(netcdf_file, "variables_name-or-NC_GLOBAL", "meta_data_name", "value_type", data), such as: ## - att.put.nc(dataset, "NC_GLOBAL", "title", "NC_CHAR", title) ## - att.put.nc(dataset, "time", "long_name" , "NC_CHAR", name_time) ## - att.put.nc(dataset, "temp", "_FillValue", "NC_DOUBLE", -99999.9), _FillValue has to be added for the creation of the figures # ## For NC_GLOBAL ## WARNING the names of the data in select_data have to be the same as the colomn "att_name" in glob_att for ( i in 1:dimglob ) { if ( length(intersect(colnames(select_data),glob_att$att_name[i])) == 1) { id.glob_att <- which(colnames(select_data) == glob_att$att_name[i]) id.glob_att <- as.numeric(id.glob_att) att.put.nc(dataset, "NC_GLOBAL", glob_att$att_name[i], glob_att$value_type[i], format(select_data[,id.glob_att]) ) # format is to keep the format of the select_data } } ## Other attributes for NC_GLOBAL detail_1 <- "L0 product : raw data." att.put.nc(dataset, "NC_GLOBAL", "detail_1", "NC_CHAR", detail_1 ) if ( download_from_WCDataPortal == "yes"){ DATE <- format(Sys.time(), "%d-%b-%Y %X ") detail_2 <- paste("Data from WC Data Portal (", DATE,").", sep="") att.put.nc(dataset, "NC_GLOBAL", "detail_2", "NC_CHAR", detail_2 ) } # ## For variables for ( i in 1:dimvar ) { if (variables$standard_name[i] != "") { att.put.nc(dataset, variables$var_name[i], "standard name", "NC_CHAR", variables$standard_name[i]) # add standard name } if (variables$long_name[i] != "") { att.put.nc(dataset, variables$var_name[i], "long_name", "NC_CHAR", variables$long_name[i]) # add a long name } if (variables$units[i] != "") { att.put.nc(dataset, variables$var_name[i], "units", "NC_CHAR", variables$units[i]) # add the unit for the variables having an unit } if (variables$value_type[i] == "NC_DOUBLE"){ att.put.nc(dataset, variables$var_name[i], "_FillValue", "NC_DOUBLE", -99999.9) # -99999.9 to see Michna, P. & Milton Woods. RNetCDF - A Package for Reading and Writing NetCDF Datasets. (2013). } if (variables$details[i] != "") { att.put.nc(dataset, variables$var_name[i], "details", "NC_CHAR", variables$details[i]) # add details } } ## Other attributes max_temp <- max(fusion$temp, na.rm = TRUE) min_temp <- min(fusion$temp, na.rm = TRUE) max_depth <- max(fusion$depth, na.rm = TRUE) min_depth <- min(fusion$depth, na.rm = TRUE) att.put.nc(dataset, "temp", "max" , "NC_DOUBLE", max_temp ) att.put.nc(dataset, "temp", "min" , "NC_DOUBLE", min_temp ) att.put.nc(dataset, "depth", "max" , "NC_DOUBLE", max_depth ) att.put.nc(dataset, "depth", "min" , "NC_DOUBLE", min_depth ) ### Write the contents of a NetCDF variable. ## format: var.put.nc(netcdf_file, varialable_name, data), such as: var.put.nc(dataset, "lon", fusion$lon) ## the time variable data must be temporarily converted to a UTC referenced date, format of the convertion: dataconvert <- utinvcal.nc(units, data) ## for CHAR the NA must be replaced by "" ## Warning: the var.put.nc will not work if the format of the data is different from the format given in var.def.nc for (i in 1 : dimvar){ if (variables$var_name[i] =="time"){ mytime <- utinvcal.nc(variables$units[which(variables$var_name == "time")], fusion$time) #conversion of time var.put.nc(dataset, "time", mytime) } else if (variables$value_type[i] == "NC_CHAR"){ id.char <- as.numeric(which(colnames(fusion) == variables$var_name[i])) # select the id of variables using character in fusion mydata <- fusion[,id.char] # select the data mydata <- as.character(mydata) # warning : the "as.character" have to be before ' remplace NA by "" ' mydata[is.na(mydata)] <-"" # remplace NA by "" var.put.nc(dataset, variables$var_name[i], mydata) } else { id.var <- as.numeric(which(colnames(fusion) == variables$var_name[i])) #select the other id var.put.nc(dataset, variables$var_name[i], fusion[,id.var]) } } ### View the NetCDF # print.nc(dataset) # var.get.nc(dataset, "source_loc") ### Close the opened NetCDF file close.nc(dataset) ########################################## END ##############################################
/process_netcdf_L0.R
no_license
cynsky/Gliding-turtles
R
false
false
21,317
r
######################################################################################################## # Process to generate a NetCDF file with raw data (L0 product) using location data # Project: SOCIB Seaturtle # Author: Chloé Dalleau # Co-author: David March # Date: 08/08/2016 # # Description: # This script is the first step of a global processing about the analysis of the turtles' trajectory. # The following steps create a NetCDF file using the raw data of the turtle: # - (1) Data import from CSV files or from Wildlife Computers (WC) data portal: time, latitude (Argos/GPS), # longitude (Argos/GPS), location quality, number of satellites available from GPS, residual from GPS, temperature, depth, battery. # Please note that a variable cannot be chosen several times from different csv files (except time and tagid). # - (2) CSV file (generated by DAP software from Wildlife Computers) merging in a NetCDF file # # The process uses two additional CSV files : # * meta_data: a file with all the information about the turtles such as: name, id, date deployment ... # * allparameter: list of the variables or global attributes which will be created in the NetCDF file. This file allows an # automation of the creation of the NetCDF file. It contains: # - the name of the variable # - the long name # - the unit # - the details # - the NetCDF variable type (NC_DOUBLE,NC_CHAR,NC_INT ...) # - specify if the variable is used in an another process (here : L0product, L1product and L2product) # - if the type is NC_CHAR, specify the dimension # - the dimension used in the NetCDF file in the different processes (here : dimL0product, dimL1product and dimL2product). # Such as : # var_name,long_name,units,details,value_type,L0product,L1product,L2product,dimCHAR,dimL0product,dimL1product,dimL2product # time,time,seconds since 1970-01-01 00:00:00,,NC_INT,x,,,,time,, # source_loc,source of the location,,,NC_CHAR,x,x,,max_string_32,time,time, # NC_GLOBAL,otherTypeLoc,,,NC_CHAR,x,,,,,, # # # WARNING: # - There are differences in date formant between CSV files (eg. Locations vs. Series) and tutles (eg. processed by WC Data portal vs DAP). # Main problem is the name of the month (eg. 'ago' or 'aug' for Spanish or English, respectively). Check this in Step 2. Suggestion: process all tracks in English (check manual for DAP) # - We remove duplicates in time for each CSV file processed. Some duplications in time may have different data. We delete one of them. In future versions, check if we can use any quality control criteria. # - Current script works for tags with temperature and pressure sensors (ie. Series.csv) and with battery information (Status.csv). # # # Sources: # - Michna, P. & Milton Woods. RNetCDF - A Package for Reading and Writing NetCDF Datasets. (2013). # - Michna, P. & Milton Woods. Package 'RNetCDF'. (2016). # - units: http://www.unidata.ucar.edu/software/udunits/udunits-2.2.20/udunits/udunits2-derived.xml # - standard names: http://cfconventions.org/Data/cf-standard-names/34/build/cf-standard-name-table.html ######################################################################################################## ### Remove the previous data rm(list=ls()) ### Import libraries library(RNetCDF) library(lubridate) library(curl) #library(wcUtils) # used in step 1, taken from https://github.com/jmlondon/wcUtils ### Set the turtle ID (Ptt) and if the data should be downloaded from the WC data portal tag_id <- 00000 # modify the tag_id according to your turtle download_from_WCDataPortal <- "no" # if "yes", step 1 will be processed lan.setlocale = "English" # see parse_date_time ############################### Step 1: creation of the CSV file from WC Data Portal ################## if (download_from_WCDataPortal == "yes") { # Define location and file with auth keys keyfile = "keyfile.json" # User ID owner = "xxxxxxxxxxxxxxxxxxxxxx" # this ID was obtained after inspecting the Data Portal with Chrome developer tools # Folder to download data path = paste("data/rawinput/",tag_id,"/.", sep= "") # Argos Platform ID ptt = tag_id ## Define function to dowload data wcGetPttData <- function (keyfile, owner, path, ptt){ # Get deployment information params = paste("action=get_deployments&owner_id=", owner, sep="") wcpost <- wcPOST(keyfile= keyfile, params = params) # Get PPT ID id <- wcGetPttID(wcpost, ptt = ptt)$ids # Download and extract ZIP files to obtain CSV files zipPath <- wcGetZip(id, keyfile = keyfile) # download zip file in a temporal folder unzip(zipPath, exdir = path) # extract all .CSV files from ZIP # file.copy(from = file,to = newfile,overwrite = TRUE) # copy the zip in rawarchive } wcGetPttData(keyfile, owner, path, ptt) } ###################################### Step 2: Import data ########################################### ### Meta data import meta_data <- "data/turtles_metadata.csv" meta_data <- read.csv(meta_data, sep=",", dec=".", header=TRUE, fill=TRUE) colnames(meta_data)<-c("argosid", "name", "dateDeployment","refMaxSeaTemp","refMinSeaTemp","refMaxDepth","refMinDepth", "title", "author", "publisher","fileVersion","otherTypeLoc") meta_data$argosid<-as.character(meta_data$argosid) meta_data$name<-as.character(meta_data$name) meta_data$dateDeployment <- as.POSIXct(meta_data$dateDeployment, "%Y-%m-%d %H:%M:%S", tz="GMT") meta_data$refMaxSeaTemp<-as.numeric(as.character(meta_data$refMaxSeaTemp)) meta_data$refMinSeaTemp<-as.numeric(as.character(meta_data$refMinSeaTemp)) meta_data$refMaxDepth<-as.numeric(as.character(meta_data$refMaxDepth)) meta_data$refMinDepth<-as.numeric(as.character(meta_data$refMinDepth)) meta_data$title<-as.character(meta_data$title) meta_data$author<-as.character(meta_data$author) meta_data$publisher<-as.character(meta_data$publisher) meta_data$fileVersion<-as.character(meta_data$fileVersion) meta_data$otherTypeLoc<-as.character(meta_data$otherTypeLoc) ### Meta data selection using the turtle ID select_data <- meta_data[which((meta_data$argosid == tag_id) == "TRUE"),] ### Select correct CSV file ## Locations : location of the turtle and quality location from Argos ## Series : temperature and depth and their errors ## Status : battery voltage just prior to transmission ## 1-FastGPS : location of the turtle and quality location from GPS if (select_data$otherTypeLoc == "GPS") { name_file <- c("Locations","Status","Series", "1-FastGPS") # Warning : the order is important name_data <- c("loc_data","status_data","series_data","gps_data") # Warning : the order is important } else { name_file <- c("Locations","Status","Series") name_data <- c("loc_data","status_data","series_data") } level <- "L0" ### Data import from CSV files using either WC data portal or the file version. dirfile <- dir(path=paste("data/rawinput/",tag_id,sep=""), pattern="*.csv$") # select all the names of csv files contained in the path chosen file <- c() # Warning locations != Locations # Warning let ".csv", if no select Series and SeriesRange for (i in 1:length(name_file)) file[i] <- dirfile[grep(paste( tag_id,"-",name_file[i],".csv", sep = ""),dirfile)] # select the names of the csv files chosen in "name_file" for (i in 1:length(file)){ if (name_data[i] == "gps_data"){ ff <- paste("data/rawinput/",tag_id,"/",file[i],sep="") data <- read.csv(ff, sep=",", dec=".", header=TRUE, skip = 3) assign(name_data[i],data) rm("data") } else { ff <- paste("data/rawinput/",tag_id,"/",file[i],sep="") data <- read.csv(ff, sep=",", dec=".", header=TRUE) assign(name_data[i],data) rm("data") } } ### Select interesting variables ## Locations.csv loc_data <- loc_data[,c("DeployID","Date","Quality","Latitude","Longitude")] colnames(loc_data)<- c("tagid", "time", "lc", "lat", "lon") loc_data$tagid<-as.numeric(as.character(loc_data$tagid)) loc_data$time <- parse_date_time(loc_data$time, c("HMS dbY", "Ymd HMS"), locale=Sys.setlocale("LC_TIME", "English"), tz="GMT") loc_data$lc<-as.character(loc_data$lc) loc_data$lat<-as.numeric(as.character(loc_data$lat)) loc_data$lon<-as.numeric(as.character(loc_data$lon)) ## Series.csv series_data$Date <- parse_date_time(paste(series_data$Time, series_data$Day, sep=" "), c("HMS dbY", "Ymd HMS"), locale=Sys.setlocale("LC_TIME", lan.setlocale), tz="GMT") series_data <- series_data[,c("DeployID","Date","Temperature","TRange","Depth","DRange")] colnames(series_data) <- c("tagid", "time", "temp", "errorT", "depth", "errorD") series_data$tagid <- as.numeric(as.character(series_data$tagid)) series_data$temp <- as.numeric(as.character(series_data$temp)) series_data$errorT <- as.numeric(as.character(series_data$errorT)) series_data$depth <- as.numeric(as.character(series_data$depth)) series_data$errorD <- as.numeric(as.character(series_data$errorD)) ## Status.csv status_data$Date <- status_data$Received status_data <- status_data[,c("DeployID","Date","BattVoltage")] colnames(status_data) <- c("tagid", "time", "batt") status_data$tagid <- as.numeric(as.character(status_data$tagid)) status_data$time <- parse_date_time(status_data$time, c("HMS dbY", "Ymd HMS"), locale=Sys.setlocale("LC_TIME", "English"), tz="GMT") status_data$batt <- as.numeric(as.character(status_data$batt)) ## GPS.csv if (select_data$otherTypeLoc == "GPS") { gps_data$Date <- parse_date_time(paste(gps_data$Time, gps_data$Day, sep=" "), c("HMS dbY", "Ymd HMS"), locale=Sys.setlocale("LC_TIME", "English"), tz="GMT") gps_data <- gps_data[,c("Name","Date","Satellites","Residual","Latitude","Longitude")] colnames(gps_data) <- c("tagid", "time", "satellites","residual", "lat_gps", "lon_gps") gps_data$tagid <- as.numeric(as.character(gps_data$tagid)) gps_data$time <- parse_date_time(gps_data$time, c("HMS dbY", "Ymd HMS"), locale=Sys.setlocale("LC_TIME", "English"), tz="GMT") gps_data$satellites <- as.numeric(as.character(gps_data$satellites)) gps_data$residual <- as.numeric(as.character(gps_data$residual)) gps_data$lat_gps <- as.numeric(as.character(gps_data$lat_gps)) gps_data$lon_gps <- as.numeric(as.character(gps_data$lon_gps)) } ### Removing locations from testing environments before releasing loc_data <- loc_data[which((loc_data$time > select_data$dateDeployment) == "TRUE"),] series_data <- series_data[which((series_data$time > select_data$dateDeployment) == "TRUE"),] status_data <- status_data[which((status_data$time > select_data$dateDeployment) == "TRUE"),] if (select_data$otherTypeLoc == "GPS") gps_data <- gps_data[which((gps_data$time > select_data$dateDeployment) == "TRUE"),] ### Remove duplicate time measurements if (length(which(duplicated(loc_data$time)))!=0) loc_data <- loc_data[-which(duplicated(loc_data$time)),] if (length(which(duplicated(series_data$time)))!=0) series_data <- series_data[-which(duplicated(series_data$time)),] if (length(which(duplicated(status_data$time)))!=0) status_data <- status_data[-which(duplicated(status_data$time)),] if (select_data$otherTypeLoc == "GPS") { if (length(which(duplicated(gps_data$time)))!=0) gps_data <- gps_data[-which(duplicated(gps_data$time)),] } ### Merge the latitude and longitude observations from Argos and GPS ## If time measurements exist at the Argo and the GPS source, the latitude and the longitude from the GPS source are selected if (select_data$otherTypeLoc == "GPS") { mergeloc <- merge(loc_data,gps_data, all = T) colnames(mergeloc) <- c("tagid","time","lc","lat_argos","lon_argos","satellites","residual","lat_gps","lon_gps") mergeloc$lat <- NA mergeloc$lon <- NA mergeloc$source_loc <- name_file[1] dimmerge <- dim(mergeloc)[1] for (i in 1:dimmerge){ if (length(which(mergeloc$time[i] == gps_data$time)) != 0) { mergeloc[i,c("lat","lon")] <- mergeloc[i,c("lat_gps","lon_gps")] mergeloc[i,c("lc")] <- "gps" mergeloc[i,c("source_loc")] <- name_file[4] # Warning : be careful with the order } else { mergeloc[i,c("lat","lon")] <- mergeloc[i,c("lat_argos","lon_argos")] } } mergeloc <- mergeloc[,c("tagid","time","lc","satellites","residual","lat","lon","source_loc")] } else { mergeloc <- loc_data mergeloc$source_loc <- rep(name_file[1]) # Warning : be careful with the order } ### Add a column to describe the source data type for Series and Status series_data$source_series <- rep(name_file[3]) # Warning : be careful with the order status_data$source_status <- rep(name_file[2]) # Warning : be careful with the order ####################################################################################################### ###################################### Step 3: Merge existing data #################################### ### Merge the observations with the same time - Works only if a variable is chosen only once from csv ## files (except time and tagid) fusion <- merge(mergeloc,series_data, all=TRUE) fusion <- merge(fusion,status_data, all=TRUE) ####################################################################################################### ###################################### Step 4: Data export in a csv file #################################### output.file <- paste("data/output/",tag_id,"/",level,"/",tag_id,"-",level,".csv", sep= "") write.table(fusion, output.file, row.names=FALSE, sep=",", dec=".") ####################################################################################################### ###################################### Step 5: Prepare the data for the NetCDF document ############### ## To add a new variable with attributes (long_name,units,details) in the NetCDF: modify the previous step and the CSV ## file parameter_netcdf ## To add other attributes such as maximum, minimum, add them manualy (see also maximum and minimum for the temperature) ## The dimensions and the details for the NC_Global are inserted manually ### Import parameters from parameter_netcdf.csv ## WARNING the name of the data created in the previous step have to be the same as the var_name in ## allparameter (or long_name for NC_GLOBAL). allparameter <- "data/parameter_netcdf.csv" allparameter <- read.csv(allparameter, sep=",", dec=".", header=TRUE, fill=TRUE) if (select_data$otherTypeLoc != "GPS") { allparameter <- allparameter[-which(allparameter$var_name == "satellites"),] allparameter <- allparameter[-which(allparameter$var_name == "residual"),] } product <- paste(level,"product",sep = "") variables <- allparameter[which(allparameter[[product]] == "x"),] for (i in 1:length(variables)) { variables[,i] <- as.character(variables[,i])} dimvar <- dim(variables)[1] glob_att<- "data/nc_global_att.csv" glob_att <- read.csv(glob_att, sep=",", dec=".", header=TRUE, fill=TRUE) glob_att <- glob_att[which(glob_att[[product]] == "x"),] for (i in 1:length(glob_att)) { glob_att[,i] <- as.character(glob_att[,i])} dimglob <- dim(glob_att)[1] ####################################################################################################### ###################################### Step 6: Creation of NetCDF #################################### ### Creation of new NetCDF file data_type <- "netcdf" filename <- paste("data/output/",tag_id,"/",level,"/",tag_id,"-",level,".nc", sep="") dataset <- create.nc(filename) ### Creation of new NetCDF dimensions, the dimension is defined by the length of the variables ## A NetCDF file may only contain one unlim dimension. We choose the variable with the most observations (time) dim.def.nc(dataset, "time", unlim=TRUE) ## For the variables with characters, there are 2 dimensions: (1) the number of observations (like "time") ## and (2) the maximum length of the string. This second dimension is created here: dim.def.nc(dataset, "max_string_32", 32) dim.def.nc(dataset, "max_string_4", 4) ### Creation of new NetCDF variables ## Definition of the variables in the NetCDF file with the format ## var.def.nc(netcdf_file, "variable_name", "value_type","dimension"), such as: ## - var.def.nc(dataset, "time", "NC_INT","time") ## - var.def.nc(dataset, "lat", "NC_DOUBLE","time") ## - var.def.nc(dataset, "source_loc", "NC_CHAR",c("max_string_32","time")): for the character, ## the UNLIM dimension has to be at last in the dimension vector for ( i in 1:dimvar ) { if (variables$value_type[i]=="NC_CHAR"){ var.def.nc(dataset, variables$var_name[i], variables$value_type[i], c(variables$dimCHAR[i],variables$dimL0product[i])) } else { var.def.nc(dataset, variables$var_name[i], variables$value_type[i], variables$dimL0product[i]) } } ## To view the NetCDF file # print.nc(dataset) # at this step the dimension of the time is NULL, because the observations are not added ### Put attributes in the variables or in the NC_GLOBAL ## The attributes are either the meta data of the variables or the global meta data of the NetCDF (NC_GLOBAL) ## the format is : att.put.nc(netcdf_file, "variables_name-or-NC_GLOBAL", "meta_data_name", "value_type", data), such as: ## - att.put.nc(dataset, "NC_GLOBAL", "title", "NC_CHAR", title) ## - att.put.nc(dataset, "time", "long_name" , "NC_CHAR", name_time) ## - att.put.nc(dataset, "temp", "_FillValue", "NC_DOUBLE", -99999.9), _FillValue has to be added for the creation of the figures # ## For NC_GLOBAL ## WARNING the names of the data in select_data have to be the same as the colomn "att_name" in glob_att for ( i in 1:dimglob ) { if ( length(intersect(colnames(select_data),glob_att$att_name[i])) == 1) { id.glob_att <- which(colnames(select_data) == glob_att$att_name[i]) id.glob_att <- as.numeric(id.glob_att) att.put.nc(dataset, "NC_GLOBAL", glob_att$att_name[i], glob_att$value_type[i], format(select_data[,id.glob_att]) ) # format is to keep the format of the select_data } } ## Other attributes for NC_GLOBAL detail_1 <- "L0 product : raw data." att.put.nc(dataset, "NC_GLOBAL", "detail_1", "NC_CHAR", detail_1 ) if ( download_from_WCDataPortal == "yes"){ DATE <- format(Sys.time(), "%d-%b-%Y %X ") detail_2 <- paste("Data from WC Data Portal (", DATE,").", sep="") att.put.nc(dataset, "NC_GLOBAL", "detail_2", "NC_CHAR", detail_2 ) } # ## For variables for ( i in 1:dimvar ) { if (variables$standard_name[i] != "") { att.put.nc(dataset, variables$var_name[i], "standard name", "NC_CHAR", variables$standard_name[i]) # add standard name } if (variables$long_name[i] != "") { att.put.nc(dataset, variables$var_name[i], "long_name", "NC_CHAR", variables$long_name[i]) # add a long name } if (variables$units[i] != "") { att.put.nc(dataset, variables$var_name[i], "units", "NC_CHAR", variables$units[i]) # add the unit for the variables having an unit } if (variables$value_type[i] == "NC_DOUBLE"){ att.put.nc(dataset, variables$var_name[i], "_FillValue", "NC_DOUBLE", -99999.9) # -99999.9 to see Michna, P. & Milton Woods. RNetCDF - A Package for Reading and Writing NetCDF Datasets. (2013). } if (variables$details[i] != "") { att.put.nc(dataset, variables$var_name[i], "details", "NC_CHAR", variables$details[i]) # add details } } ## Other attributes max_temp <- max(fusion$temp, na.rm = TRUE) min_temp <- min(fusion$temp, na.rm = TRUE) max_depth <- max(fusion$depth, na.rm = TRUE) min_depth <- min(fusion$depth, na.rm = TRUE) att.put.nc(dataset, "temp", "max" , "NC_DOUBLE", max_temp ) att.put.nc(dataset, "temp", "min" , "NC_DOUBLE", min_temp ) att.put.nc(dataset, "depth", "max" , "NC_DOUBLE", max_depth ) att.put.nc(dataset, "depth", "min" , "NC_DOUBLE", min_depth ) ### Write the contents of a NetCDF variable. ## format: var.put.nc(netcdf_file, varialable_name, data), such as: var.put.nc(dataset, "lon", fusion$lon) ## the time variable data must be temporarily converted to a UTC referenced date, format of the convertion: dataconvert <- utinvcal.nc(units, data) ## for CHAR the NA must be replaced by "" ## Warning: the var.put.nc will not work if the format of the data is different from the format given in var.def.nc for (i in 1 : dimvar){ if (variables$var_name[i] =="time"){ mytime <- utinvcal.nc(variables$units[which(variables$var_name == "time")], fusion$time) #conversion of time var.put.nc(dataset, "time", mytime) } else if (variables$value_type[i] == "NC_CHAR"){ id.char <- as.numeric(which(colnames(fusion) == variables$var_name[i])) # select the id of variables using character in fusion mydata <- fusion[,id.char] # select the data mydata <- as.character(mydata) # warning : the "as.character" have to be before ' remplace NA by "" ' mydata[is.na(mydata)] <-"" # remplace NA by "" var.put.nc(dataset, variables$var_name[i], mydata) } else { id.var <- as.numeric(which(colnames(fusion) == variables$var_name[i])) #select the other id var.put.nc(dataset, variables$var_name[i], fusion[,id.var]) } } ### View the NetCDF # print.nc(dataset) # var.get.nc(dataset, "source_loc") ### Close the opened NetCDF file close.nc(dataset) ########################################## END ##############################################
context("sp germplasm_details_study") con <- ba_db()$sweetpotatobase test_that("Germplasm_details study results are present", { res <- ba_germplasm_details_study(con = con, studyDbId = "1207") expect_that(nrow(res) >= 8, is_true()) }) test_that("Germplasm_details out formats work", { res <- ba_germplasm_details_study(con = con, studyDbId = "1207", rclass = "json") expect_that("json" %in% class(res), is_true()) res <- ba_germplasm_details_study(con = con, studyDbId = "1207", rclass = "list") expect_that("list" %in% class(res), is_true()) res <- ba_germplasm_details_study(con = con, studyDbId = "1207", rclass = "data.frame") expect_that("data.frame" %in% class(res), is_true()) })
/tests/sweetpotatobase/test_sp_germplasm_details_study.R
no_license
ClayBirkett/brapi
R
false
false
713
r
context("sp germplasm_details_study") con <- ba_db()$sweetpotatobase test_that("Germplasm_details study results are present", { res <- ba_germplasm_details_study(con = con, studyDbId = "1207") expect_that(nrow(res) >= 8, is_true()) }) test_that("Germplasm_details out formats work", { res <- ba_germplasm_details_study(con = con, studyDbId = "1207", rclass = "json") expect_that("json" %in% class(res), is_true()) res <- ba_germplasm_details_study(con = con, studyDbId = "1207", rclass = "list") expect_that("list" %in% class(res), is_true()) res <- ba_germplasm_details_study(con = con, studyDbId = "1207", rclass = "data.frame") expect_that("data.frame" %in% class(res), is_true()) })
# Exercise 8: Pulitzer Prizes # Read in the data pulitzer <- read.csv("data/pulitzer-circulation-data.csv", stringsAsFactors = FALSE) # Install and load the needed libraries # Be sure to comment out the install.packages function so it won't install it every time it runs # Remeber you only need to install a package once #install.packages(dplyr) # library(dplyr) # View in the data set. Start to understand what the data columns contains # Be sure to comment out the function so it won't view everytime you run the code. # View(pulitzer) # Use 'colnames' to print out the names of the columns colnames(pulitzer) # Use 'str' to print what types of values are contained in each column # Did any value type surprise you? Why do you think they are that type? str(pulitzer) # Add a column in a dataframe called 'Pulitzer.Prize.Change` that contains the diffrence in changes # in Pulitzer Prize Winners from 2004 to 2013 and Pultizer Prize Winners from 1990 to 2003. # What publication gained the most pulitzer prizes from 2004-2014? # Be sure to use the pipe operator! # Which publication with at least 5 Pulitzers won from 2004-2014 had the biggest decrease(negative) in Daily circulation numbers? # This publication should have Pulitzer prizes won a minimum of 5 Pulitzers, as well as the biggest decrease in circulation # Your turn! An important part about being a data scientist is asking questions. # Create a question and use dplyr to figure out the answer.
/exercise-8/exercise.R
permissive
brendanjacobsen/m11-dplyr
R
false
false
1,483
r
# Exercise 8: Pulitzer Prizes # Read in the data pulitzer <- read.csv("data/pulitzer-circulation-data.csv", stringsAsFactors = FALSE) # Install and load the needed libraries # Be sure to comment out the install.packages function so it won't install it every time it runs # Remeber you only need to install a package once #install.packages(dplyr) # library(dplyr) # View in the data set. Start to understand what the data columns contains # Be sure to comment out the function so it won't view everytime you run the code. # View(pulitzer) # Use 'colnames' to print out the names of the columns colnames(pulitzer) # Use 'str' to print what types of values are contained in each column # Did any value type surprise you? Why do you think they are that type? str(pulitzer) # Add a column in a dataframe called 'Pulitzer.Prize.Change` that contains the diffrence in changes # in Pulitzer Prize Winners from 2004 to 2013 and Pultizer Prize Winners from 1990 to 2003. # What publication gained the most pulitzer prizes from 2004-2014? # Be sure to use the pipe operator! # Which publication with at least 5 Pulitzers won from 2004-2014 had the biggest decrease(negative) in Daily circulation numbers? # This publication should have Pulitzer prizes won a minimum of 5 Pulitzers, as well as the biggest decrease in circulation # Your turn! An important part about being a data scientist is asking questions. # Create a question and use dplyr to figure out the answer.
#' Iteratively query a database for matches to a query vector. #' #' `iterative_select()` returns a tibble with all entries of the database that #' match the query vector in any of the selected columns. #' #' @param query A character vector. #' @param database A data.frame or tibble A database to be queried. #' See [databases()] for a list of included databases. #' @param match_cols A character vector. The columns in the data to look for matches #' with the query. In order of preference, if matches to a column are #' found, matches to subsequent columns are not reported by default, unless #' return_all is `TRUE`. #' @param return_all A logical indicating whether matches to subsequent columns, #' after a match has already been found, should also be returned. #' @return A tibble containing all rows of the dataframe that matched a query. #' The new column `match__` contains the name of the column that matched #' the query for this row. #' @examples #' iterative_select(c("FLG", "SGK2"), #' hgnc, #' c("symbol", "alias_symbol", "prev_symbol")) #' #' @export iterative_select <- function(query, database, match_cols, return_all = FALSE) { if (rlang::is_empty(query)) stop("'query' can not be empty.") database <- database %>% dplyr::mutate(uid__ = 1:n()) orig_query <- query query <- unique(query) remaining_query <- query out_ids <- list() for (i in seq_along(match_cols)) { if (rlang::is_empty(remaining_query)) break() query_cur <- if(return_all) query else remaining_query c <- match_cols[i] if (!(c %in% names(database))) stop("match_col '", c, "' not in database") # For using dplyr programmatically have to turn some of these variables # into symbols or quosures, not exactly sure this is all done correctly, # but seems to work c_sym <- sym(c) # Some columns in the datasets are list column which can have multiple entries # per row. Flatten the list for merging and put back the list column afterwards # Should find better strategy, because this is very slow d <- database %>% dplyr::select(uid__, !!c_sym) %>% tidyr::drop_na(!! c_sym) if (is.list(database[[c]])) { d <- d %>% tidyr::unnest(!! c_sym) } out <- tibble::tibble( query = query_cur, match__ = c ) %>% dplyr::inner_join(d, by = c("query" = c)) remaining_query <- base::setdiff(remaining_query, out$query) out_ids[[i]] <- out } if (!rlang::is_empty(remaining_query)) out_ids[["leftover"]] <- tibble::tibble(query = remaining_query, match__ = "none") out_ids_df <- dplyr::bind_rows(out_ids) # checking if query matched more than one entry in the database multimatch <- out_ids_df %>% dplyr::group_by(.data$match__) %>% dplyr::count(.data$query) %>% dplyr::ungroup() %>% dplyr::filter(.data$n > 1) %>% dplyr::mutate(message = paste0(.data$query, ": ", .data$n)) if (nrow(multimatch) > 0) { warning( "Multiple matches of same priority found for some queries. All matches are reported.\n", paste0(multimatch$message, "\n", collapse = " ") ) } # Warning user when any queries didn't match if (length(remaining_query) > 0) { warning( "No matches found for some queries. Reporting NA for these queries.\n", paste0(remaining_query, collapse = "\n") ) } out_df <- out_ids_df %>% dplyr::left_join(database, by = "uid__") %>% dplyr::select(-uid__) out_df } #' Join results from a database into an existing dataframe. #' #' `join_results()` queries a database for matches to a column in the supplied #' dataset and returns it together with the matches found. #' #' @param df A data.frame or tibble. The data used for querying the database. #' @param query_col A character vector of length one. Name of the column in `df` #' that will be used to query the database. #' @param select_cols A character vector of column names in the database that #' will be merged in the ouput. #' @inheritParams iterative_select #' @return The input dataframe merged with the selected matching columns from #' the database. #' @examples #' d <- data.frame(a = 1:3, b = c("FLG", "SGK2", "CDK1")) #' join_results(d, "b", hgnc, #' match_cols = c("symbol", "alias_symbol", "prev_symbol"), #' select_cols = c("entrez_id", "symbol", "refseq_accession")) #' #' @export join_results <- function (df, query_col, database, match_cols, select_cols = NULL) { hits <- iterative_select(df[[query_col]], database, match_cols) if (!rlang::is_null(select_cols)) { hits <- hits %>% dplyr::select_at(unique(c(select_cols, "query"))) } dplyr::left_join(df, hits, by = rlang::set_names(nm = query_col, x = "query")) }
/R/select.R
no_license
datarail/genebabel
R
false
false
4,779
r
#' Iteratively query a database for matches to a query vector. #' #' `iterative_select()` returns a tibble with all entries of the database that #' match the query vector in any of the selected columns. #' #' @param query A character vector. #' @param database A data.frame or tibble A database to be queried. #' See [databases()] for a list of included databases. #' @param match_cols A character vector. The columns in the data to look for matches #' with the query. In order of preference, if matches to a column are #' found, matches to subsequent columns are not reported by default, unless #' return_all is `TRUE`. #' @param return_all A logical indicating whether matches to subsequent columns, #' after a match has already been found, should also be returned. #' @return A tibble containing all rows of the dataframe that matched a query. #' The new column `match__` contains the name of the column that matched #' the query for this row. #' @examples #' iterative_select(c("FLG", "SGK2"), #' hgnc, #' c("symbol", "alias_symbol", "prev_symbol")) #' #' @export iterative_select <- function(query, database, match_cols, return_all = FALSE) { if (rlang::is_empty(query)) stop("'query' can not be empty.") database <- database %>% dplyr::mutate(uid__ = 1:n()) orig_query <- query query <- unique(query) remaining_query <- query out_ids <- list() for (i in seq_along(match_cols)) { if (rlang::is_empty(remaining_query)) break() query_cur <- if(return_all) query else remaining_query c <- match_cols[i] if (!(c %in% names(database))) stop("match_col '", c, "' not in database") # For using dplyr programmatically have to turn some of these variables # into symbols or quosures, not exactly sure this is all done correctly, # but seems to work c_sym <- sym(c) # Some columns in the datasets are list column which can have multiple entries # per row. Flatten the list for merging and put back the list column afterwards # Should find better strategy, because this is very slow d <- database %>% dplyr::select(uid__, !!c_sym) %>% tidyr::drop_na(!! c_sym) if (is.list(database[[c]])) { d <- d %>% tidyr::unnest(!! c_sym) } out <- tibble::tibble( query = query_cur, match__ = c ) %>% dplyr::inner_join(d, by = c("query" = c)) remaining_query <- base::setdiff(remaining_query, out$query) out_ids[[i]] <- out } if (!rlang::is_empty(remaining_query)) out_ids[["leftover"]] <- tibble::tibble(query = remaining_query, match__ = "none") out_ids_df <- dplyr::bind_rows(out_ids) # checking if query matched more than one entry in the database multimatch <- out_ids_df %>% dplyr::group_by(.data$match__) %>% dplyr::count(.data$query) %>% dplyr::ungroup() %>% dplyr::filter(.data$n > 1) %>% dplyr::mutate(message = paste0(.data$query, ": ", .data$n)) if (nrow(multimatch) > 0) { warning( "Multiple matches of same priority found for some queries. All matches are reported.\n", paste0(multimatch$message, "\n", collapse = " ") ) } # Warning user when any queries didn't match if (length(remaining_query) > 0) { warning( "No matches found for some queries. Reporting NA for these queries.\n", paste0(remaining_query, collapse = "\n") ) } out_df <- out_ids_df %>% dplyr::left_join(database, by = "uid__") %>% dplyr::select(-uid__) out_df } #' Join results from a database into an existing dataframe. #' #' `join_results()` queries a database for matches to a column in the supplied #' dataset and returns it together with the matches found. #' #' @param df A data.frame or tibble. The data used for querying the database. #' @param query_col A character vector of length one. Name of the column in `df` #' that will be used to query the database. #' @param select_cols A character vector of column names in the database that #' will be merged in the ouput. #' @inheritParams iterative_select #' @return The input dataframe merged with the selected matching columns from #' the database. #' @examples #' d <- data.frame(a = 1:3, b = c("FLG", "SGK2", "CDK1")) #' join_results(d, "b", hgnc, #' match_cols = c("symbol", "alias_symbol", "prev_symbol"), #' select_cols = c("entrez_id", "symbol", "refseq_accession")) #' #' @export join_results <- function (df, query_col, database, match_cols, select_cols = NULL) { hits <- iterative_select(df[[query_col]], database, match_cols) if (!rlang::is_null(select_cols)) { hits <- hits %>% dplyr::select_at(unique(c(select_cols, "query"))) } dplyr::left_join(df, hits, by = rlang::set_names(nm = query_col, x = "query")) }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/test_general.R \name{pFtest} \alias{pFtest} \alias{pFtest.formula} \alias{pFtest.plm} \title{F Test for Individual and/or Time Effects} \usage{ pFtest(x, ...) \method{pFtest}{formula}(x, data, ...) \method{pFtest}{plm}(x, z, ...) } \arguments{ \item{x}{an object of class \code{"plm"} or of class \code{"formula"},} \item{\dots}{further arguments.} \item{data}{a \code{data.frame},} \item{z}{an object of class \code{"plm"},} } \value{ An object of class \code{"htest"}. } \description{ Test of individual and/or time effects based on the comparison of the \code{within} and the \code{pooling} model. } \details{ For the \code{plm} method, the argument of this function is two \code{plm} objects, the first being a within model, the second a pooling model. The effects tested are either individual, time or twoways, depending on the effects introduced in the within model. } \examples{ data("Grunfeld", package="plm") gp <- plm(inv ~ value + capital, data = Grunfeld, model = "pooling") gi <- plm(inv ~ value + capital, data = Grunfeld, effect = "individual", model = "within") gt <- plm(inv ~ value + capital, data = Grunfeld, effect = "time", model = "within") gd <- plm(inv ~ value + capital, data = Grunfeld, effect = "twoways", model = "within") pFtest(gi, gp) pFtest(gt, gp) pFtest(gd, gp) pFtest(inv ~ value + capital, data = Grunfeld, effect = "twoways") } \seealso{ \code{\link[=plmtest]{plmtest()}} for Lagrange multiplier tests of individuals and/or time effects. } \author{ Yves Croissant } \keyword{htest}
/man/pFtest.Rd
no_license
cran/plm
R
false
true
1,634
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/test_general.R \name{pFtest} \alias{pFtest} \alias{pFtest.formula} \alias{pFtest.plm} \title{F Test for Individual and/or Time Effects} \usage{ pFtest(x, ...) \method{pFtest}{formula}(x, data, ...) \method{pFtest}{plm}(x, z, ...) } \arguments{ \item{x}{an object of class \code{"plm"} or of class \code{"formula"},} \item{\dots}{further arguments.} \item{data}{a \code{data.frame},} \item{z}{an object of class \code{"plm"},} } \value{ An object of class \code{"htest"}. } \description{ Test of individual and/or time effects based on the comparison of the \code{within} and the \code{pooling} model. } \details{ For the \code{plm} method, the argument of this function is two \code{plm} objects, the first being a within model, the second a pooling model. The effects tested are either individual, time or twoways, depending on the effects introduced in the within model. } \examples{ data("Grunfeld", package="plm") gp <- plm(inv ~ value + capital, data = Grunfeld, model = "pooling") gi <- plm(inv ~ value + capital, data = Grunfeld, effect = "individual", model = "within") gt <- plm(inv ~ value + capital, data = Grunfeld, effect = "time", model = "within") gd <- plm(inv ~ value + capital, data = Grunfeld, effect = "twoways", model = "within") pFtest(gi, gp) pFtest(gt, gp) pFtest(gd, gp) pFtest(inv ~ value + capital, data = Grunfeld, effect = "twoways") } \seealso{ \code{\link[=plmtest]{plmtest()}} for Lagrange multiplier tests of individuals and/or time effects. } \author{ Yves Croissant } \keyword{htest}
# DataScience01c # Data Preparation # Start fresh rm(list=ls()) # Outlier Removal # This is a vector c(1, -1, -5, -1, -1, -19, 3, -1, -1, -5) # assign the vector Vector <- c(1, -1, -5, -1, -1, -19, 3, -1, -1, -5) # Guestimate: -19 is the outlier # Anything less than -6 can be removed # The following indicates whether we want to keep the values: Vector > -6 Vector <- Vector[Vector > -6] Vector # Start fresh rm(list=ls()) Vector <- c(1, -1, -5, -1, -1, -19, 3, -1, -1, -5) # Goal: Remove anything beyond 2 standard deviations from the mean VectorMean <- mean(Vector) VectorSd <- sd(Vector) lowBoundary <- VectorMean - 2*VectorSd HighBoundary <- VectorMean + 2*VectorSd goodFlag <- (Vector > lowBoundary) & (Vector < HighBoundary) Vector <- Vector[goodFlag] Vector # Outlier Removal Vector <- c('a', 'a', 'a', 'a', 'b', 'b', 'b', 'b', 'b', 'c', 'c', 'c', 'c', 'c', 'c', 'c', 'd', 'a', 'a', 'a', 'a') # Category Outlier is 'd' because it occurs less than 5% of the time Vector Vector.modified <- Vector[Vector != 'd'] setdiff(Vector, Vector_mod) # Relabel c('BS', 'MS', 'PhD', 'HS', 'BSc', 'Masters', 'High School', 'Masters', 'Masters', 'BA', 'Bachelors', 'MS', 'MS') Vector <- c('BS', 'MS', 'PhD', 'HS', 'BSc', 'Masters', 'High School', 'Masters', 'Masters', 'BA', 'Bachelors', 'MS', 'MS') unique(Vector) length(unique(Vector)) Vector[Vector == 'Bachelors'] <- 'BS' length(unique(Vector)) Vector[Vector == 'BSc'] <- 'BS' length(unique(Vector)) Vector[Vector == 'BA'] <- 'BS' length(unique(Vector)) Vector[Vector == 'Masters'] <- 'MS' length(unique(Vector)) Vector[Vector == 'High School'] <- 'HS' length(unique(Vector)) Vector # Turn codes into years of college # Exercise #Normalization # Start fresh rm(list=ls()) Vector <- c(1, -1, -5, -1, -1, -19, 3, -1, -1, -5) # Linear normalization maps data in a linear fashion: normalizedVector <- Vector*slope + offset # Min Max normalization maps from 0 to 1. # y = a + bx # OR: # y = (x - c)/d; Where: a = -c/d; b = 1/d # "c" adjusts min value to zero: minValue <- min(Vector) # range adjusts max value to 1 # range is the min subtracted from the max range <- max(Vector) - minValue Vector<- (Vector - minValue)/range min(Vector) max(Vector) Vector rm(list=ls()) # Relabel and cast this vector into a number: c('one', 'two', 3, 4, 5, 6, 7, 8, 9, 0, 1) rm(list=ls()) # Binarization: # Binarization turns columns of categories into a columns of binaries: # You start out with a vector called vehicle that can contain three categories: car, truck, bicycle # Vehicle vector looks like the following: # c(car, bicycle, bicycle, bicycle, car, car, truck, bicycle, truck, bicycle) # You create three columns called car, truck, and bicycle: # car <- c(1,0,0,0,1,1,0,0,0,0) # truck <- c(0,0,0,0,0,0,1,0,1,0) # bicycle <- c(0,1,1,1,0,0,0,1,0,1) # Binning Vector<- c(1, 1:5, 1:10, 1:20, 1:40, 100) # Vector<- c(runif(30)) Vector hist(Vector) numberOfBins <- 7 # Discretization into 4 bins range <- max(Vector) - min(Vector) binWidth <- range / numberOfBins bin1Min <- -Inf bin1Max <- min(Vector) + 1*binWidth bin2Min <- bin1Max bin2Max <- min(Vector) + 2*binWidth bin3Min <- bin1Max bin3Max <- min(Vector) + 3*binWidth bin4Min <- bin3Max bin4Max <- min(Vector) + 4*binWidth bin5Min <- bin4Max bin5Max <- min(Vector) + 5*binWidth bin6Min <- bin5Max bin6Max <- min(Vector) + 6*binWidth bin7Min <- bin6Max bin7Max <- Inf xDiscretized <- rep(NA, length(Vector)) xDiscretized xDiscretized[bin1Min < Vector & Vector <= bin1Max] <- "L1" xDiscretized xDiscretized[bin2Min < Vector & Vector <= bin2Max] <- "L2" xDiscretized xDiscretized[bin3Min < Vector & Vector <= bin3Max] <- "L3" xDiscretized[bin4Min < Vector & Vector <= bin4Max] <- "L4" xDiscretized[bin5Min < Vector & Vector <= bin5Max] <- "L5" xDiscretized[bin6Min < Vector & Vector <= bin6Max] <- "L6" xDiscretized[bin7Min < Vector & Vector <= bin7Max] <- "L7" xDiscretized quantileBinMax <- function(Vector=c(1,1,1,2,2,2,10), numberOfBins=2) { binMax <- NA for (i in 1:(numberOfBins-1)) { binMax[i] <- quantile(Vector, i/numberOfBins) } c(-Inf, binMax,+Inf) } binLimits <- quantileBinMax(Vector, numberOfBins) cut(Vector, binLimits, right=T) ?hist hist(Vector, c(min(Vector), binLimits[2:(length(binLimits)-1)], max(Vector))) quantile(1:11, .49)
/Lesson 01/R files/DataScience01c.R
no_license
samir72/What-is-Data-Science
R
false
false
4,281
r
# DataScience01c # Data Preparation # Start fresh rm(list=ls()) # Outlier Removal # This is a vector c(1, -1, -5, -1, -1, -19, 3, -1, -1, -5) # assign the vector Vector <- c(1, -1, -5, -1, -1, -19, 3, -1, -1, -5) # Guestimate: -19 is the outlier # Anything less than -6 can be removed # The following indicates whether we want to keep the values: Vector > -6 Vector <- Vector[Vector > -6] Vector # Start fresh rm(list=ls()) Vector <- c(1, -1, -5, -1, -1, -19, 3, -1, -1, -5) # Goal: Remove anything beyond 2 standard deviations from the mean VectorMean <- mean(Vector) VectorSd <- sd(Vector) lowBoundary <- VectorMean - 2*VectorSd HighBoundary <- VectorMean + 2*VectorSd goodFlag <- (Vector > lowBoundary) & (Vector < HighBoundary) Vector <- Vector[goodFlag] Vector # Outlier Removal Vector <- c('a', 'a', 'a', 'a', 'b', 'b', 'b', 'b', 'b', 'c', 'c', 'c', 'c', 'c', 'c', 'c', 'd', 'a', 'a', 'a', 'a') # Category Outlier is 'd' because it occurs less than 5% of the time Vector Vector.modified <- Vector[Vector != 'd'] setdiff(Vector, Vector_mod) # Relabel c('BS', 'MS', 'PhD', 'HS', 'BSc', 'Masters', 'High School', 'Masters', 'Masters', 'BA', 'Bachelors', 'MS', 'MS') Vector <- c('BS', 'MS', 'PhD', 'HS', 'BSc', 'Masters', 'High School', 'Masters', 'Masters', 'BA', 'Bachelors', 'MS', 'MS') unique(Vector) length(unique(Vector)) Vector[Vector == 'Bachelors'] <- 'BS' length(unique(Vector)) Vector[Vector == 'BSc'] <- 'BS' length(unique(Vector)) Vector[Vector == 'BA'] <- 'BS' length(unique(Vector)) Vector[Vector == 'Masters'] <- 'MS' length(unique(Vector)) Vector[Vector == 'High School'] <- 'HS' length(unique(Vector)) Vector # Turn codes into years of college # Exercise #Normalization # Start fresh rm(list=ls()) Vector <- c(1, -1, -5, -1, -1, -19, 3, -1, -1, -5) # Linear normalization maps data in a linear fashion: normalizedVector <- Vector*slope + offset # Min Max normalization maps from 0 to 1. # y = a + bx # OR: # y = (x - c)/d; Where: a = -c/d; b = 1/d # "c" adjusts min value to zero: minValue <- min(Vector) # range adjusts max value to 1 # range is the min subtracted from the max range <- max(Vector) - minValue Vector<- (Vector - minValue)/range min(Vector) max(Vector) Vector rm(list=ls()) # Relabel and cast this vector into a number: c('one', 'two', 3, 4, 5, 6, 7, 8, 9, 0, 1) rm(list=ls()) # Binarization: # Binarization turns columns of categories into a columns of binaries: # You start out with a vector called vehicle that can contain three categories: car, truck, bicycle # Vehicle vector looks like the following: # c(car, bicycle, bicycle, bicycle, car, car, truck, bicycle, truck, bicycle) # You create three columns called car, truck, and bicycle: # car <- c(1,0,0,0,1,1,0,0,0,0) # truck <- c(0,0,0,0,0,0,1,0,1,0) # bicycle <- c(0,1,1,1,0,0,0,1,0,1) # Binning Vector<- c(1, 1:5, 1:10, 1:20, 1:40, 100) # Vector<- c(runif(30)) Vector hist(Vector) numberOfBins <- 7 # Discretization into 4 bins range <- max(Vector) - min(Vector) binWidth <- range / numberOfBins bin1Min <- -Inf bin1Max <- min(Vector) + 1*binWidth bin2Min <- bin1Max bin2Max <- min(Vector) + 2*binWidth bin3Min <- bin1Max bin3Max <- min(Vector) + 3*binWidth bin4Min <- bin3Max bin4Max <- min(Vector) + 4*binWidth bin5Min <- bin4Max bin5Max <- min(Vector) + 5*binWidth bin6Min <- bin5Max bin6Max <- min(Vector) + 6*binWidth bin7Min <- bin6Max bin7Max <- Inf xDiscretized <- rep(NA, length(Vector)) xDiscretized xDiscretized[bin1Min < Vector & Vector <= bin1Max] <- "L1" xDiscretized xDiscretized[bin2Min < Vector & Vector <= bin2Max] <- "L2" xDiscretized xDiscretized[bin3Min < Vector & Vector <= bin3Max] <- "L3" xDiscretized[bin4Min < Vector & Vector <= bin4Max] <- "L4" xDiscretized[bin5Min < Vector & Vector <= bin5Max] <- "L5" xDiscretized[bin6Min < Vector & Vector <= bin6Max] <- "L6" xDiscretized[bin7Min < Vector & Vector <= bin7Max] <- "L7" xDiscretized quantileBinMax <- function(Vector=c(1,1,1,2,2,2,10), numberOfBins=2) { binMax <- NA for (i in 1:(numberOfBins-1)) { binMax[i] <- quantile(Vector, i/numberOfBins) } c(-Inf, binMax,+Inf) } binLimits <- quantileBinMax(Vector, numberOfBins) cut(Vector, binLimits, right=T) ?hist hist(Vector, c(min(Vector), binLimits[2:(length(binLimits)-1)], max(Vector))) quantile(1:11, .49)
code <- c( "function [win, aver] = dice(B)", "%Play the dice game B times", "gains = [-1, 2, -3, 4, -5, 6];", "plays = unidrnd(6, B, 1);", "win = sum(gains(plays));", "aver = win;" ) setFunction(matlab, code) evaluate(matlab, "[w, a] = dice(1000);") res <- getVariable(matlab, c("w", "a")) print(res)
/incl/Matlab.setFunction.R
no_license
HenrikBengtsson/R.matlab
R
false
false
314
r
code <- c( "function [win, aver] = dice(B)", "%Play the dice game B times", "gains = [-1, 2, -3, 4, -5, 6];", "plays = unidrnd(6, B, 1);", "win = sum(gains(plays));", "aver = win;" ) setFunction(matlab, code) evaluate(matlab, "[w, a] = dice(1000);") res <- getVariable(matlab, c("w", "a")) print(res)
# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. #' Create a (virtual) DuckDB table from an Arrow object #' #' This will do the necessary configuration to create a (virtual) table in DuckDB #' that is backed by the Arrow object given. No data is copied or modified until #' `collect()` or `compute()` are called or a query is run against the table. #' #' The result is a dbplyr-compatible object that can be used in d(b)plyr pipelines. #' #' If `auto_disconnect = TRUE`, the DuckDB table that is created will be configured #' to be unregistered when the `tbl` object is garbage collected. This is helpful #' if you don't want to have extra table objects in DuckDB after you've finished #' using them. #' #' @param .data the Arrow object (e.g. Dataset, Table) to use for the DuckDB table #' @param con a DuckDB connection to use (default will create one and store it #' in `options("arrow_duck_con")`) #' @param table_name a name to use in DuckDB for this object. The default is a #' unique string `"arrow_"` followed by numbers. #' @param auto_disconnect should the table be automatically cleaned up when the #' resulting object is removed (and garbage collected)? Default: `TRUE` #' #' @return A `tbl` of the new table in DuckDB #' #' @name to_duckdb #' @export #' @examplesIf getFromNamespace("run_duckdb_examples", "arrow")() #' library(dplyr) #' #' ds <- InMemoryDataset$create(mtcars) #' #' ds %>% #' filter(mpg < 30) %>% #' group_by(cyl) %>% #' to_duckdb() %>% #' slice_min(disp) to_duckdb <- function(.data, con = arrow_duck_connection(), table_name = unique_arrow_tablename(), auto_disconnect = TRUE) { .data <- as_adq(.data) if (!requireNamespace("duckdb", quietly = TRUE)) { abort("Please install the `duckdb` package to pass data with `to_duckdb()`.") } duckdb::duckdb_register_arrow(con, table_name, .data) tbl <- dplyr::tbl(con, table_name) groups <- dplyr::groups(.data) if (length(groups)) { tbl <- dplyr::group_by(tbl, groups) } if (auto_disconnect) { # this will add the correct connection disconnection when the tbl is gced. # this is similar to what dbplyr does, though it calls it tbl$src$disco tbl$src$.arrow_finalizer_environment <- duckdb_disconnector(con, table_name) } tbl } arrow_duck_connection <- function() { con <- getOption("arrow_duck_con") if (is.null(con) || !DBI::dbIsValid(con)) { con <- DBI::dbConnect(duckdb::duckdb()) # Use the same CPU count that the arrow library is set to DBI::dbExecute(con, paste0("PRAGMA threads=", cpu_count())) options(arrow_duck_con = con) } con } # helper function to determine if duckdb examples should run # see: https://github.com/r-lib/roxygen2/issues/1242 run_duckdb_examples <- function() { arrow_with_dataset() && requireNamespace("duckdb", quietly = TRUE) && packageVersion("duckdb") > "0.2.7" && requireNamespace("dplyr", quietly = TRUE) && requireNamespace("dbplyr", quietly = TRUE) && getRversion() >= 4 } # Adapted from dbplyr unique_arrow_tablename <- function() { i <- getOption("arrow_table_name", 0) + 1 options(arrow_table_name = i) sprintf("arrow_%03i", i) } # Creates an environment that disconnects the database when it's GC'd duckdb_disconnector <- function(con, tbl_name) { force(tbl_name) reg.finalizer(environment(), function(...) { # remote the table we ephemerally created (though only if the connection is # still valid) duckdb::duckdb_unregister_arrow(con, tbl_name) }) environment() } #' Create an Arrow object from others #' #' This can be used in pipelines that pass data back and forth between Arrow and #' other processes (like DuckDB). #' #' @param .data the object to be converted #' @return A `RecordBatchReader`. #' @export #' #' @examplesIf getFromNamespace("run_duckdb_examples", "arrow")() #' library(dplyr) #' #' ds <- InMemoryDataset$create(mtcars) #' #' ds %>% #' filter(mpg < 30) %>% #' to_duckdb() %>% #' group_by(cyl) %>% #' summarize(mean_mpg = mean(mpg, na.rm = TRUE)) %>% #' to_arrow() %>% #' collect() to_arrow <- function(.data) { # If this is an Arrow object already, return quickly since we're already Arrow if (inherits(.data, c("arrow_dplyr_query", "ArrowObject"))) { return(.data) } # For now, we only handle .data from duckdb, so check that it is that if we've # gotten this far if (!inherits(dbplyr::remote_con(.data), "duckdb_connection")) { stop( "to_arrow() currently only supports Arrow tables, Arrow datasets, ", "Arrow queries, or dbplyr tbls from duckdb connections", call. = FALSE ) } # Run the query res <- DBI::dbSendQuery(dbplyr::remote_con(.data), dbplyr::remote_query(.data), arrow = TRUE) duckdb::duckdb_fetch_record_batch(res) }
/r/R/duckdb.R
permissive
lidavidm/arrow
R
false
false
5,567
r
# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. #' Create a (virtual) DuckDB table from an Arrow object #' #' This will do the necessary configuration to create a (virtual) table in DuckDB #' that is backed by the Arrow object given. No data is copied or modified until #' `collect()` or `compute()` are called or a query is run against the table. #' #' The result is a dbplyr-compatible object that can be used in d(b)plyr pipelines. #' #' If `auto_disconnect = TRUE`, the DuckDB table that is created will be configured #' to be unregistered when the `tbl` object is garbage collected. This is helpful #' if you don't want to have extra table objects in DuckDB after you've finished #' using them. #' #' @param .data the Arrow object (e.g. Dataset, Table) to use for the DuckDB table #' @param con a DuckDB connection to use (default will create one and store it #' in `options("arrow_duck_con")`) #' @param table_name a name to use in DuckDB for this object. The default is a #' unique string `"arrow_"` followed by numbers. #' @param auto_disconnect should the table be automatically cleaned up when the #' resulting object is removed (and garbage collected)? Default: `TRUE` #' #' @return A `tbl` of the new table in DuckDB #' #' @name to_duckdb #' @export #' @examplesIf getFromNamespace("run_duckdb_examples", "arrow")() #' library(dplyr) #' #' ds <- InMemoryDataset$create(mtcars) #' #' ds %>% #' filter(mpg < 30) %>% #' group_by(cyl) %>% #' to_duckdb() %>% #' slice_min(disp) to_duckdb <- function(.data, con = arrow_duck_connection(), table_name = unique_arrow_tablename(), auto_disconnect = TRUE) { .data <- as_adq(.data) if (!requireNamespace("duckdb", quietly = TRUE)) { abort("Please install the `duckdb` package to pass data with `to_duckdb()`.") } duckdb::duckdb_register_arrow(con, table_name, .data) tbl <- dplyr::tbl(con, table_name) groups <- dplyr::groups(.data) if (length(groups)) { tbl <- dplyr::group_by(tbl, groups) } if (auto_disconnect) { # this will add the correct connection disconnection when the tbl is gced. # this is similar to what dbplyr does, though it calls it tbl$src$disco tbl$src$.arrow_finalizer_environment <- duckdb_disconnector(con, table_name) } tbl } arrow_duck_connection <- function() { con <- getOption("arrow_duck_con") if (is.null(con) || !DBI::dbIsValid(con)) { con <- DBI::dbConnect(duckdb::duckdb()) # Use the same CPU count that the arrow library is set to DBI::dbExecute(con, paste0("PRAGMA threads=", cpu_count())) options(arrow_duck_con = con) } con } # helper function to determine if duckdb examples should run # see: https://github.com/r-lib/roxygen2/issues/1242 run_duckdb_examples <- function() { arrow_with_dataset() && requireNamespace("duckdb", quietly = TRUE) && packageVersion("duckdb") > "0.2.7" && requireNamespace("dplyr", quietly = TRUE) && requireNamespace("dbplyr", quietly = TRUE) && getRversion() >= 4 } # Adapted from dbplyr unique_arrow_tablename <- function() { i <- getOption("arrow_table_name", 0) + 1 options(arrow_table_name = i) sprintf("arrow_%03i", i) } # Creates an environment that disconnects the database when it's GC'd duckdb_disconnector <- function(con, tbl_name) { force(tbl_name) reg.finalizer(environment(), function(...) { # remote the table we ephemerally created (though only if the connection is # still valid) duckdb::duckdb_unregister_arrow(con, tbl_name) }) environment() } #' Create an Arrow object from others #' #' This can be used in pipelines that pass data back and forth between Arrow and #' other processes (like DuckDB). #' #' @param .data the object to be converted #' @return A `RecordBatchReader`. #' @export #' #' @examplesIf getFromNamespace("run_duckdb_examples", "arrow")() #' library(dplyr) #' #' ds <- InMemoryDataset$create(mtcars) #' #' ds %>% #' filter(mpg < 30) %>% #' to_duckdb() %>% #' group_by(cyl) %>% #' summarize(mean_mpg = mean(mpg, na.rm = TRUE)) %>% #' to_arrow() %>% #' collect() to_arrow <- function(.data) { # If this is an Arrow object already, return quickly since we're already Arrow if (inherits(.data, c("arrow_dplyr_query", "ArrowObject"))) { return(.data) } # For now, we only handle .data from duckdb, so check that it is that if we've # gotten this far if (!inherits(dbplyr::remote_con(.data), "duckdb_connection")) { stop( "to_arrow() currently only supports Arrow tables, Arrow datasets, ", "Arrow queries, or dbplyr tbls from duckdb connections", call. = FALSE ) } # Run the query res <- DBI::dbSendQuery(dbplyr::remote_con(.data), dbplyr::remote_query(.data), arrow = TRUE) duckdb::duckdb_fetch_record_batch(res) }
# Betting functions even = function(x) { win = (x %% 2 == 0) & (x != 0) ifelse(win, 1, -1) } high = function(x) { win = (18 < x) & (x != 0) ifelse(win, 1, -1) } column1 = function(x) { ifelse(x %% 3 == 1, 2, -1) } single = function(x, n = 1) { ifelse(x == n, 35, -1) } # Construct a simple betting strategy simple_strategy = function(bet = even) { function(x) cumsum(bet(x)) } #' Simulate plays from a betting strategy #' #' @param strategy #' @param nplayers number of players to use this strategy #' @param ntimes number of times each player should play play = function(strategy = simple_strategy() , nplayers = 100L , ntimes = 1000L , ballvalues = 0:36 ){ out = replicate(nplayers , strategy(sample(ballvalues, size = ntimes, replace = TRUE)) , simplify = FALSE ) data.frame(winnings = do.call(base::c, out) , player = rep(seq(nplayers), each = ntimes) , time = rep(seq(ntimes), times = nplayers) ) } doublebet = function(x, initialbet = 1, bet = even) { winnings = rep(NA, length(x)) betsize = initialbet current_winnings = 0 for(i in seq_along(x)){ if(bet(x[i]) == 1){ current_winnings = current_winnings + betsize betsize = initialbet } else { current_winnings = current_winnings - betsize betsize = 2 * betsize } winnings[i] = current_winnings } winnings }
/roulette.R
no_license
clarkfitzg/stat128-fall20
R
false
false
1,484
r
# Betting functions even = function(x) { win = (x %% 2 == 0) & (x != 0) ifelse(win, 1, -1) } high = function(x) { win = (18 < x) & (x != 0) ifelse(win, 1, -1) } column1 = function(x) { ifelse(x %% 3 == 1, 2, -1) } single = function(x, n = 1) { ifelse(x == n, 35, -1) } # Construct a simple betting strategy simple_strategy = function(bet = even) { function(x) cumsum(bet(x)) } #' Simulate plays from a betting strategy #' #' @param strategy #' @param nplayers number of players to use this strategy #' @param ntimes number of times each player should play play = function(strategy = simple_strategy() , nplayers = 100L , ntimes = 1000L , ballvalues = 0:36 ){ out = replicate(nplayers , strategy(sample(ballvalues, size = ntimes, replace = TRUE)) , simplify = FALSE ) data.frame(winnings = do.call(base::c, out) , player = rep(seq(nplayers), each = ntimes) , time = rep(seq(ntimes), times = nplayers) ) } doublebet = function(x, initialbet = 1, bet = even) { winnings = rep(NA, length(x)) betsize = initialbet current_winnings = 0 for(i in seq_along(x)){ if(bet(x[i]) == 1){ current_winnings = current_winnings + betsize betsize = initialbet } else { current_winnings = current_winnings - betsize betsize = 2 * betsize } winnings[i] = current_winnings } winnings }
#' Data for \pkg{brms} Models #' #' Generate data for \pkg{brms} models to be passed to \pkg{Stan} #' #' @inheritParams brm #' @param control A named list currently for internal usage only #' @param ... Other potential arguments #' #' @aliases brmdata #' #' @return A named list of objects containing the required data #' to fit a \pkg{brms} model with \pkg{Stan}. #' #' @author Paul-Christian Buerkner \email{paul.buerkner@@gmail.com} #' #' @examples #' data1 <- make_standata(rating ~ treat + period + carry + (1|subject), #' data = inhaler, family = "cumulative") #' names(data1) #' #' data2 <- make_standata(count ~ log_Age_c + log_Base4_c * Trt_c #' + (1|patient) + (1|visit), #' data = epilepsy, family = "poisson") #' names(data2) #' #' @export make_standata <- function(formula, data = NULL, family = "gaussian", prior = NULL, autocor = NULL, nonlinear = NULL, partial = NULL, cov_ranef = NULL, sample_prior = FALSE, control = NULL, ...) { # internal control arguments: # is_newdata: is make_standata is called with new data? # not4stan: is make_standata called for use in S3 methods? # save_order: should the initial order of the data be saved? # omit_response: omit checking of the response? # ntrials, ncat, Jm: standata based on the original data dots <- list(...) # use deprecated arguments if specified cov_ranef <- use_alias(cov_ranef, dots$cov.ranef, warn = FALSE) # some input checks if (!(is.null(data) || is.list(data))) stop("argument 'data' must be a data.frame or list", call. = FALSE) family <- check_family(family) nonlinear <- nonlinear2list(nonlinear) formula <- update_formula(formula, data = data, family = family, partial = partial, nonlinear = nonlinear) autocor <- check_autocor(autocor) is_linear <- is.linear(family) is_ordinal <- is.ordinal(family) is_count <- is.count(family) is_forked <- is.forked(family) is_categorical <- is.categorical(family) et <- extract_time(autocor$formula) ee <- extract_effects(formula, family = family, et$all, nonlinear = nonlinear) prior <- as.prior_frame(prior) check_prior_content(prior, family = family) na_action <- if (isTRUE(control$is_newdata)) na.pass else na.omit data <- update_data(data, family = family, effects = ee, et$group, drop.unused.levels = !isTRUE(control$is_newdata), na.action = na_action) # sort data in case of autocorrelation models if (has_arma(autocor)) { # amend if zero-inflated and hurdle models ever get # autocorrelation structures as they are also using 'trait' if (is_forked) { stop("no autocorrelation allowed for this model", call. = FALSE) } if (is_linear && length(ee$response) > 1L) { if (!grepl("^trait$|:trait$|^trait:|:trait:", et$group)) { stop(paste("autocorrelation structures for multiple responses must", "contain 'trait' as grouping variable"), call. = FALSE) } else { to_order <- rmNULL(list(data[["trait"]], data[[et$group]], data[[et$time]])) } } else { to_order <- rmNULL(list(data[[et$group]], data[[et$time]])) } if (length(to_order)) { new_order <- do.call(order, to_order) data <- data[new_order, ] # old_order will allow to retrieve the initial order of the data attr(data, "old_order") <- order(new_order) } } # response variable standata <- list(N = nrow(data), Y = unname(model.response(data))) check_response <- !isTRUE(control$omit_response) if (check_response) { if (!(is_ordinal || family$family %in% c("bernoulli", "categorical")) && !is.numeric(standata$Y)) { stop(paste("family", family$family, "expects numeric response variable"), call. = FALSE) } # transform and check response variable for different families regex_pos_int <- "(^|_)(binomial|poisson|negbinomial|geometric)$" if (grepl(regex_pos_int, family$family)) { if (!all(is.wholenumber(standata$Y)) || min(standata$Y) < 0) { stop(paste("family", family$family, "expects response variable", "of non-negative integers"), call. = FALSE) } } else if (family$family == "bernoulli") { standata$Y <- as.numeric(as.factor(standata$Y)) - 1 if (any(!standata$Y %in% c(0,1))) { stop(paste("family", family$family, "expects response variable", "to contain only two different values"), call. = FALSE) } } else if (family$family %in% c("beta", "zero_inflated_beta")) { lower <- if (family$family == "beta") any(standata$Y <= 0) else any(standata$Y < 0) upper <- any(standata$Y >= 1) if (lower || upper) { stop("beta regression requires responses between 0 and 1", call. = FALSE) } } else if (is_categorical) { standata$Y <- as.numeric(as.factor(standata$Y)) if (length(unique(standata$Y)) < 2L) { stop("At least two response categories are required.", call. = FALSE) } } else if (is_ordinal) { if (is.ordered(standata$Y)) { standata$Y <- as.numeric(standata$Y) } else if (all(is.wholenumber(standata$Y))) { standata$Y <- standata$Y - min(standata$Y) + 1 } else { stop(paste("family", family$family, "expects either integers or", "ordered factors as response variables"), call. = FALSE) } if (length(unique(standata$Y)) < 2L) { stop("At least two response categories are required.", call. = FALSE) } } else if (is.skewed(family)) { if (min(standata$Y) <= 0) { stop(paste("family", family$family, "requires response variable", "to be positive"), call. = FALSE) } } else if (is.zero_inflated(family) || is.hurdle(family)) { if (min(standata$Y) < 0) { stop(paste("family", family$family, "requires response variable", "to be non-negative"), call. = FALSE) } } } # data for various kinds of effects if (length(nonlinear)) { nlpars <- names(ee$nonlinear) # matrix of covariates appearing in the non-linear formula C <- get_model_matrix(ee$covars, data = data) if (length(all.vars(ee$covars)) != ncol(C)) { stop("Factors with more than two levels are not allowed as covariates", call. = FALSE) } standata <- c(standata, list(KC = ncol(C), C = C)) for (i in seq_along(nlpars)) { data_fixef <- data_fixef(ee$nonlinear[[i]], data = data, family = family, nlpar = nlpars[i], not4stan = isTRUE(control$not4stan)) data_monef <- data_monef(ee$nonlinear[[i]], data = data, prior = prior, Jm = control[[paste0("Jm_", nlpars[i])]], nlpar = nlpars[i]) data_ranef <- data_ranef(ee$nonlinear[[i]], data = data, family = family, cov_ranef = cov_ranef, is_newdata = isTRUE(control$is_newdata), not4stan = isTRUE(control$not4stan), nlpar = nlpars[i]) standata <- c(standata, data_fixef, data_monef, data_ranef) } } else { data_fixef <- data_fixef(ee, data = data, family = family, not4stan = isTRUE(control$not4stan)) data_monef <- data_monef(ee, data = data, prior = prior, Jm = control$Jm) data_csef <- data_csef(ee, data = data) data_ranef <- data_ranef(ee, data = data, family = family, cov_ranef = cov_ranef, is_newdata = isTRUE(control$is_newdata), not4stan = isTRUE(control$not4stan)) standata <- c(standata, data_fixef, data_monef, data_csef, data_ranef) # offsets are not yet implemented for non-linear models standata$offset <- model.offset(data) } # data for specific families if (has_trials(family)) { if (!length(ee$trials)) { if (!is.null(control$trials)) { standata$trials <- control$trials } else { standata$trials <- max(standata$Y) } } else if (is.wholenumber(ee$trials)) { standata$trials <- ee$trials } else if (is.formula(ee$trials)) { standata$trials <- .addition(formula = ee$trials, data = data) } else stop("Response part of formula is invalid.") standata$max_obs <- standata$trials # for backwards compatibility if (max(standata$trials) == 1L && family$family == "binomial") message(paste("Only 2 levels detected so that family bernoulli", "might be a more efficient choice.")) if (check_response && any(standata$Y > standata$trials)) stop(paste("Number of trials is smaller than the response", "variable would suggest."), call. = FALSE) } if (has_cat(family)) { if (!length(ee$cat)) { if (!is.null(control$ncat)) { standata$ncat <- control$ncat } else { standata$ncat <- max(standata$Y) } } else if (is.wholenumber(ee$cat)) { standata$ncat <- ee$cat } else stop("Addition argument 'cat' is misspecified.", call. = FALSE) standata$max_obs <- standata$ncat # for backwards compatibility if (max(standata$ncat) == 2L) { message(paste("Only 2 levels detected so that family bernoulli", "might be a more efficient choice.")) } if (check_response && any(standata$Y > standata$ncat)) { stop(paste0("Number of categories is smaller than the response", "variable would suggest."), call. = FALSE) } } if (family$family == "inverse.gaussian" && check_response) { # save as data to reduce computation time in Stan if (is.formula(ee[c("weights", "cens")])) { standata$log_Y <- log(standata$Y) } else { standata$log_Y <- sum(log(standata$Y)) } standata$sqrt_Y <- sqrt(standata$Y) } # evaluate even if check_response is FALSE to ensure that N_trait is defined if (is_linear && length(ee$response) > 1L) { standata$Y <- matrix(standata$Y, ncol = length(ee$response)) NC_trait <- ncol(standata$Y) * (ncol(standata$Y) - 1L) / 2L standata <- c(standata, list(N_trait = nrow(standata$Y), K_trait = ncol(standata$Y), NC_trait = NC_trait)) } if (is_forked) { # the second half of Y is only dummy data # that was put into data to make melt_data work correctly standata$N_trait <- nrow(data) / 2L standata$Y <- standata$Y[1L:standata$N_trait] } if (is_categorical && !isTRUE(control$old_cat)) { ncat1m <- standata$ncat - 1L standata$N_trait <- nrow(data) / ncat1m standata$Y <- standata$Y[1L:standata$N_trait] standata$J_trait <- matrix(1L:standata$N, ncol = ncat1m) } # data for addition arguments if (is.formula(ee$se)) { standata <- c(standata, list(se = .addition(formula = ee$se, data = data))) } if (is.formula(ee$weights)) { standata <- c(standata, list(weights = .addition(ee$weights, data = data))) if (is.linear(family) && length(ee$response) > 1 || is_forked) standata$weights <- standata$weights[1:standata$N_trait] } if (is.formula(ee$disp)) { standata <- c(standata, list(disp = .addition(ee$disp, data = data))) } if (is.formula(ee$cens) && check_response) { standata <- c(standata, list(cens = .addition(ee$cens, data = data))) if (is.linear(family) && length(ee$response) > 1 || is_forked) standata$cens <- standata$cens[1:standata$N_trait] } if (is.formula(ee$trunc)) { standata <- c(standata, .addition(ee$trunc)) if (check_response && (min(standata$Y) < standata$lb || max(standata$Y) > standata$ub)) { stop("Some responses are outside of the truncation boundaries.", call. = FALSE) } } # autocorrelation variables if (has_arma(autocor)) { tgroup <- data[[et$group]] if (is.null(tgroup)) { tgroup <- rep(1, standata$N) } Kar <- get_ar(autocor) Kma <- get_ma(autocor) Karr <- get_arr(autocor) if (Kar || Kma) { # ARMA effects (of residuals) standata$tg <- as.numeric(as.factor(tgroup)) standata$Kar <- Kar standata$Kma <- Kma standata$Karma <- max(Kar, Kma) if (use_cov(autocor)) { # Modeling ARMA effects using a special covariance matrix # requires additional data standata$N_tg <- length(unique(standata$tg)) standata$begin_tg <- as.array(with(standata, ulapply(unique(tgroup), match, tgroup))) standata$nobs_tg <- as.array(with(standata, c(if (N_tg > 1L) begin_tg[2:N_tg], N + 1) - begin_tg)) standata$end_tg <- with(standata, begin_tg + nobs_tg - 1) if (!is.null(standata$se)) { standata$se2 <- standata$se^2 } else { standata$se2 <- rep(0, standata$N) } } } if (Karr) { # ARR effects (autoregressive effects of the response) standata$Yarr <- arr_design_matrix(Y = standata$Y, r = Karr, group = tgroup) standata$Karr <- Karr } } if (is(autocor, "cor_fixed")) { V <- autocor$V rmd_rows <- attr(data, "na.action") if (!is.null(rmd_rows)) { V <- V[-rmd_rows, -rmd_rows, drop = FALSE] } if (nrow(V) != nrow(data)) { stop("'V' must have the same number of rows as 'data'", call. = FALSE) } if (min(eigen(V)$values <= 0)) { stop("'V' must be positive definite", call. = FALSE) } standata$V <- V } standata$prior_only <- ifelse(identical(sample_prior, "only"), 1L, 0L) if (isTRUE(control$save_order)) { attr(standata, "old_order") <- attr(data, "old_order") } standata } #' @export brmdata <- function(formula, data = NULL, family = "gaussian", autocor = NULL, partial = NULL, cov_ranef = NULL, ...) { # deprectated alias of make_standata make_standata(formula = formula, data = data, family = family, autocor = autocor, partial = partial, cov_ranef = cov_ranef, ...) }
/brms/R/make_standata.R
no_license
ingted/R-Examples
R
false
false
14,873
r
#' Data for \pkg{brms} Models #' #' Generate data for \pkg{brms} models to be passed to \pkg{Stan} #' #' @inheritParams brm #' @param control A named list currently for internal usage only #' @param ... Other potential arguments #' #' @aliases brmdata #' #' @return A named list of objects containing the required data #' to fit a \pkg{brms} model with \pkg{Stan}. #' #' @author Paul-Christian Buerkner \email{paul.buerkner@@gmail.com} #' #' @examples #' data1 <- make_standata(rating ~ treat + period + carry + (1|subject), #' data = inhaler, family = "cumulative") #' names(data1) #' #' data2 <- make_standata(count ~ log_Age_c + log_Base4_c * Trt_c #' + (1|patient) + (1|visit), #' data = epilepsy, family = "poisson") #' names(data2) #' #' @export make_standata <- function(formula, data = NULL, family = "gaussian", prior = NULL, autocor = NULL, nonlinear = NULL, partial = NULL, cov_ranef = NULL, sample_prior = FALSE, control = NULL, ...) { # internal control arguments: # is_newdata: is make_standata is called with new data? # not4stan: is make_standata called for use in S3 methods? # save_order: should the initial order of the data be saved? # omit_response: omit checking of the response? # ntrials, ncat, Jm: standata based on the original data dots <- list(...) # use deprecated arguments if specified cov_ranef <- use_alias(cov_ranef, dots$cov.ranef, warn = FALSE) # some input checks if (!(is.null(data) || is.list(data))) stop("argument 'data' must be a data.frame or list", call. = FALSE) family <- check_family(family) nonlinear <- nonlinear2list(nonlinear) formula <- update_formula(formula, data = data, family = family, partial = partial, nonlinear = nonlinear) autocor <- check_autocor(autocor) is_linear <- is.linear(family) is_ordinal <- is.ordinal(family) is_count <- is.count(family) is_forked <- is.forked(family) is_categorical <- is.categorical(family) et <- extract_time(autocor$formula) ee <- extract_effects(formula, family = family, et$all, nonlinear = nonlinear) prior <- as.prior_frame(prior) check_prior_content(prior, family = family) na_action <- if (isTRUE(control$is_newdata)) na.pass else na.omit data <- update_data(data, family = family, effects = ee, et$group, drop.unused.levels = !isTRUE(control$is_newdata), na.action = na_action) # sort data in case of autocorrelation models if (has_arma(autocor)) { # amend if zero-inflated and hurdle models ever get # autocorrelation structures as they are also using 'trait' if (is_forked) { stop("no autocorrelation allowed for this model", call. = FALSE) } if (is_linear && length(ee$response) > 1L) { if (!grepl("^trait$|:trait$|^trait:|:trait:", et$group)) { stop(paste("autocorrelation structures for multiple responses must", "contain 'trait' as grouping variable"), call. = FALSE) } else { to_order <- rmNULL(list(data[["trait"]], data[[et$group]], data[[et$time]])) } } else { to_order <- rmNULL(list(data[[et$group]], data[[et$time]])) } if (length(to_order)) { new_order <- do.call(order, to_order) data <- data[new_order, ] # old_order will allow to retrieve the initial order of the data attr(data, "old_order") <- order(new_order) } } # response variable standata <- list(N = nrow(data), Y = unname(model.response(data))) check_response <- !isTRUE(control$omit_response) if (check_response) { if (!(is_ordinal || family$family %in% c("bernoulli", "categorical")) && !is.numeric(standata$Y)) { stop(paste("family", family$family, "expects numeric response variable"), call. = FALSE) } # transform and check response variable for different families regex_pos_int <- "(^|_)(binomial|poisson|negbinomial|geometric)$" if (grepl(regex_pos_int, family$family)) { if (!all(is.wholenumber(standata$Y)) || min(standata$Y) < 0) { stop(paste("family", family$family, "expects response variable", "of non-negative integers"), call. = FALSE) } } else if (family$family == "bernoulli") { standata$Y <- as.numeric(as.factor(standata$Y)) - 1 if (any(!standata$Y %in% c(0,1))) { stop(paste("family", family$family, "expects response variable", "to contain only two different values"), call. = FALSE) } } else if (family$family %in% c("beta", "zero_inflated_beta")) { lower <- if (family$family == "beta") any(standata$Y <= 0) else any(standata$Y < 0) upper <- any(standata$Y >= 1) if (lower || upper) { stop("beta regression requires responses between 0 and 1", call. = FALSE) } } else if (is_categorical) { standata$Y <- as.numeric(as.factor(standata$Y)) if (length(unique(standata$Y)) < 2L) { stop("At least two response categories are required.", call. = FALSE) } } else if (is_ordinal) { if (is.ordered(standata$Y)) { standata$Y <- as.numeric(standata$Y) } else if (all(is.wholenumber(standata$Y))) { standata$Y <- standata$Y - min(standata$Y) + 1 } else { stop(paste("family", family$family, "expects either integers or", "ordered factors as response variables"), call. = FALSE) } if (length(unique(standata$Y)) < 2L) { stop("At least two response categories are required.", call. = FALSE) } } else if (is.skewed(family)) { if (min(standata$Y) <= 0) { stop(paste("family", family$family, "requires response variable", "to be positive"), call. = FALSE) } } else if (is.zero_inflated(family) || is.hurdle(family)) { if (min(standata$Y) < 0) { stop(paste("family", family$family, "requires response variable", "to be non-negative"), call. = FALSE) } } } # data for various kinds of effects if (length(nonlinear)) { nlpars <- names(ee$nonlinear) # matrix of covariates appearing in the non-linear formula C <- get_model_matrix(ee$covars, data = data) if (length(all.vars(ee$covars)) != ncol(C)) { stop("Factors with more than two levels are not allowed as covariates", call. = FALSE) } standata <- c(standata, list(KC = ncol(C), C = C)) for (i in seq_along(nlpars)) { data_fixef <- data_fixef(ee$nonlinear[[i]], data = data, family = family, nlpar = nlpars[i], not4stan = isTRUE(control$not4stan)) data_monef <- data_monef(ee$nonlinear[[i]], data = data, prior = prior, Jm = control[[paste0("Jm_", nlpars[i])]], nlpar = nlpars[i]) data_ranef <- data_ranef(ee$nonlinear[[i]], data = data, family = family, cov_ranef = cov_ranef, is_newdata = isTRUE(control$is_newdata), not4stan = isTRUE(control$not4stan), nlpar = nlpars[i]) standata <- c(standata, data_fixef, data_monef, data_ranef) } } else { data_fixef <- data_fixef(ee, data = data, family = family, not4stan = isTRUE(control$not4stan)) data_monef <- data_monef(ee, data = data, prior = prior, Jm = control$Jm) data_csef <- data_csef(ee, data = data) data_ranef <- data_ranef(ee, data = data, family = family, cov_ranef = cov_ranef, is_newdata = isTRUE(control$is_newdata), not4stan = isTRUE(control$not4stan)) standata <- c(standata, data_fixef, data_monef, data_csef, data_ranef) # offsets are not yet implemented for non-linear models standata$offset <- model.offset(data) } # data for specific families if (has_trials(family)) { if (!length(ee$trials)) { if (!is.null(control$trials)) { standata$trials <- control$trials } else { standata$trials <- max(standata$Y) } } else if (is.wholenumber(ee$trials)) { standata$trials <- ee$trials } else if (is.formula(ee$trials)) { standata$trials <- .addition(formula = ee$trials, data = data) } else stop("Response part of formula is invalid.") standata$max_obs <- standata$trials # for backwards compatibility if (max(standata$trials) == 1L && family$family == "binomial") message(paste("Only 2 levels detected so that family bernoulli", "might be a more efficient choice.")) if (check_response && any(standata$Y > standata$trials)) stop(paste("Number of trials is smaller than the response", "variable would suggest."), call. = FALSE) } if (has_cat(family)) { if (!length(ee$cat)) { if (!is.null(control$ncat)) { standata$ncat <- control$ncat } else { standata$ncat <- max(standata$Y) } } else if (is.wholenumber(ee$cat)) { standata$ncat <- ee$cat } else stop("Addition argument 'cat' is misspecified.", call. = FALSE) standata$max_obs <- standata$ncat # for backwards compatibility if (max(standata$ncat) == 2L) { message(paste("Only 2 levels detected so that family bernoulli", "might be a more efficient choice.")) } if (check_response && any(standata$Y > standata$ncat)) { stop(paste0("Number of categories is smaller than the response", "variable would suggest."), call. = FALSE) } } if (family$family == "inverse.gaussian" && check_response) { # save as data to reduce computation time in Stan if (is.formula(ee[c("weights", "cens")])) { standata$log_Y <- log(standata$Y) } else { standata$log_Y <- sum(log(standata$Y)) } standata$sqrt_Y <- sqrt(standata$Y) } # evaluate even if check_response is FALSE to ensure that N_trait is defined if (is_linear && length(ee$response) > 1L) { standata$Y <- matrix(standata$Y, ncol = length(ee$response)) NC_trait <- ncol(standata$Y) * (ncol(standata$Y) - 1L) / 2L standata <- c(standata, list(N_trait = nrow(standata$Y), K_trait = ncol(standata$Y), NC_trait = NC_trait)) } if (is_forked) { # the second half of Y is only dummy data # that was put into data to make melt_data work correctly standata$N_trait <- nrow(data) / 2L standata$Y <- standata$Y[1L:standata$N_trait] } if (is_categorical && !isTRUE(control$old_cat)) { ncat1m <- standata$ncat - 1L standata$N_trait <- nrow(data) / ncat1m standata$Y <- standata$Y[1L:standata$N_trait] standata$J_trait <- matrix(1L:standata$N, ncol = ncat1m) } # data for addition arguments if (is.formula(ee$se)) { standata <- c(standata, list(se = .addition(formula = ee$se, data = data))) } if (is.formula(ee$weights)) { standata <- c(standata, list(weights = .addition(ee$weights, data = data))) if (is.linear(family) && length(ee$response) > 1 || is_forked) standata$weights <- standata$weights[1:standata$N_trait] } if (is.formula(ee$disp)) { standata <- c(standata, list(disp = .addition(ee$disp, data = data))) } if (is.formula(ee$cens) && check_response) { standata <- c(standata, list(cens = .addition(ee$cens, data = data))) if (is.linear(family) && length(ee$response) > 1 || is_forked) standata$cens <- standata$cens[1:standata$N_trait] } if (is.formula(ee$trunc)) { standata <- c(standata, .addition(ee$trunc)) if (check_response && (min(standata$Y) < standata$lb || max(standata$Y) > standata$ub)) { stop("Some responses are outside of the truncation boundaries.", call. = FALSE) } } # autocorrelation variables if (has_arma(autocor)) { tgroup <- data[[et$group]] if (is.null(tgroup)) { tgroup <- rep(1, standata$N) } Kar <- get_ar(autocor) Kma <- get_ma(autocor) Karr <- get_arr(autocor) if (Kar || Kma) { # ARMA effects (of residuals) standata$tg <- as.numeric(as.factor(tgroup)) standata$Kar <- Kar standata$Kma <- Kma standata$Karma <- max(Kar, Kma) if (use_cov(autocor)) { # Modeling ARMA effects using a special covariance matrix # requires additional data standata$N_tg <- length(unique(standata$tg)) standata$begin_tg <- as.array(with(standata, ulapply(unique(tgroup), match, tgroup))) standata$nobs_tg <- as.array(with(standata, c(if (N_tg > 1L) begin_tg[2:N_tg], N + 1) - begin_tg)) standata$end_tg <- with(standata, begin_tg + nobs_tg - 1) if (!is.null(standata$se)) { standata$se2 <- standata$se^2 } else { standata$se2 <- rep(0, standata$N) } } } if (Karr) { # ARR effects (autoregressive effects of the response) standata$Yarr <- arr_design_matrix(Y = standata$Y, r = Karr, group = tgroup) standata$Karr <- Karr } } if (is(autocor, "cor_fixed")) { V <- autocor$V rmd_rows <- attr(data, "na.action") if (!is.null(rmd_rows)) { V <- V[-rmd_rows, -rmd_rows, drop = FALSE] } if (nrow(V) != nrow(data)) { stop("'V' must have the same number of rows as 'data'", call. = FALSE) } if (min(eigen(V)$values <= 0)) { stop("'V' must be positive definite", call. = FALSE) } standata$V <- V } standata$prior_only <- ifelse(identical(sample_prior, "only"), 1L, 0L) if (isTRUE(control$save_order)) { attr(standata, "old_order") <- attr(data, "old_order") } standata } #' @export brmdata <- function(formula, data = NULL, family = "gaussian", autocor = NULL, partial = NULL, cov_ranef = NULL, ...) { # deprectated alias of make_standata make_standata(formula = formula, data = data, family = family, autocor = autocor, partial = partial, cov_ranef = cov_ranef, ...) }
#' #'@title Complete spatiotemporal normalization #'@description The script imports time series, calculates normalized series, estimates input uncertainty propagation in normalized values and plots normalized series with their uncertainty. #'@param #'@param #'@examples # # #'@author Effie Pavlidou #'@export #' #import data (adjust names and formats depending on available data formats, naming and location) #central<-read.table("central.txt") #un_central<-read.table("un_central.txt") #instead of reading an existing dataframe, possible to call function import: data<-import(n) #data<-read.table("data.txt") #uncertainties<-read.table("uncertainties.txt") normbase<-function(central, data, uncertainties, un_central){ #normalize central pixel with the average of the frame nr<-as.numeric(length(ts(central))) normalized<-normalize(nr, central, data) #uncertainty of normalized series un<-uncert_norm(data, uncertainties, nr, central, un_central) #upper and lower bounds u<-normalized+un l<-normalized-un #plot detail. Just an example for the given dataset, adjust to dataset at-hand display.c<-normalized[4008:4217] display.u<-u[4008:4217] display.l<-l[4008:4217] y<-as.numeric(1:210) y2<-c(y,210,rev(y),1) plot(y,display.u,type="l",bty="L",xlab="time",ylab="Normalized values", ylim=c(0.995, 1.008), col="white", axes=FALSE) par(new=T) plot(y,display.l,type="l",bty="L",xlab="time",ylab="Normalized values", ylim=c(0.995, 1.008), col="white", axes=FALSE) polygon(y2,c(display.u, display.u[210], rev(display.l), display.l[1]),col="skyblue", border="skyblue") par(new=T) plot.ts(display.c, lwd=2, col="black", ylim=c(0.995, 1.008), ylab="", xlab="", axes=FALSE) axis(2) axis(1, at=c(1, 72, 144, 192), labels=c("June 16", "June 19", "June 21", "June 23")) box() }
/R/normbase.R
no_license
effie-pav/detex
R
false
false
1,768
r
#' #'@title Complete spatiotemporal normalization #'@description The script imports time series, calculates normalized series, estimates input uncertainty propagation in normalized values and plots normalized series with their uncertainty. #'@param #'@param #'@examples # # #'@author Effie Pavlidou #'@export #' #import data (adjust names and formats depending on available data formats, naming and location) #central<-read.table("central.txt") #un_central<-read.table("un_central.txt") #instead of reading an existing dataframe, possible to call function import: data<-import(n) #data<-read.table("data.txt") #uncertainties<-read.table("uncertainties.txt") normbase<-function(central, data, uncertainties, un_central){ #normalize central pixel with the average of the frame nr<-as.numeric(length(ts(central))) normalized<-normalize(nr, central, data) #uncertainty of normalized series un<-uncert_norm(data, uncertainties, nr, central, un_central) #upper and lower bounds u<-normalized+un l<-normalized-un #plot detail. Just an example for the given dataset, adjust to dataset at-hand display.c<-normalized[4008:4217] display.u<-u[4008:4217] display.l<-l[4008:4217] y<-as.numeric(1:210) y2<-c(y,210,rev(y),1) plot(y,display.u,type="l",bty="L",xlab="time",ylab="Normalized values", ylim=c(0.995, 1.008), col="white", axes=FALSE) par(new=T) plot(y,display.l,type="l",bty="L",xlab="time",ylab="Normalized values", ylim=c(0.995, 1.008), col="white", axes=FALSE) polygon(y2,c(display.u, display.u[210], rev(display.l), display.l[1]),col="skyblue", border="skyblue") par(new=T) plot.ts(display.c, lwd=2, col="black", ylim=c(0.995, 1.008), ylab="", xlab="", axes=FALSE) axis(2) axis(1, at=c(1, 72, 144, 192), labels=c("June 16", "June 19", "June 21", "June 23")) box() }
#' Title: Hult International Business School Student Spotlight #' Purpose: Is there any bias in the showcased ambassadors' bio and interest? #' Author: Stefania Menini #' E-mail: smenini2019@student.hult.edu #' Date: Mar 1 2021 ################################################################################ # Analysis Objective ########################################################### # The objective of the analysis is to ensure that the bio and the interest of # # the showcased Hult students ambassadors do not present bias towards campuses,# # topics, or other observed information. Achieving this goal will guarantee a # # welcoming, diverse, and inclusive learning atmosphere (Kwartler, 2020). # ################################################################################ ################################################################################ # Initial Set Up ############################################################### ################################################################################ # Setting the working directory setwd("~/R/Git_hult_NLP_student/hult_NLP_student/cases/session II/student ambassadors") # Loading basic packages required for the analysis library(ggplot2) library(ggthemes) library(stringi) library(stringr) library(tm) # Loading additional packages library(lubridate) library(wordcloud) library(RColorBrewer) library(plotrix) library(ggalt) library(tibble) library(dplyr) library(lexicon) library(tidytext) library(radarchart) library(textdata) library(magrittr) library(corpus) # library(hrbrthemes) library(qdap) library(igraph) library(wordcloud2) library(pbapply) # Avoiding strings being counted as factors options(stringsAsFactors = FALSE) # Limiting errors by expanding the accepted number of location in character types Sys.setlocale('LC_ALL','C') # Loading "final_student_data" dataset and collecting dataset general info student_text <- read.csv('final_student_data.csv', header = TRUE) head(student_text,5) # Checking the first five rows of "final_student_data" names(student_text) # Checking columns names of "final_student_data" dim(student_text) # Checking "final_student_data" dimension # Creating stopwords using the 'SMART' stops <- c(stopwords('SMART'), 'hult', 'hult international business school') ################################################################################ # Customized functions ######################################################### ################################################################################ # Defining "tryTolower" tryTolower <- function(x){ # return NA when there is an error y = NA # tryCatch error try_error = tryCatch(tolower(x), error = function(e) e) # if not an error if (!inherits(try_error, 'error')) y = tolower(x) return(y)} # Defining "cleanCorpus" cleanCorpus<-function(corpus, customStopwords){ corpus <- tm_map(corpus, content_transformer(qdapRegex::rm_url)) corpus <- tm_map(corpus, content_transformer(tryTolower)) corpus <- tm_map(corpus, removeWords, customStopwords) corpus <- tm_map(corpus, removePunctuation) corpus <- tm_map(corpus, removeNumbers) corpus <- tm_map(corpus, stripWhitespace) return(corpus)} ################################################################################ # Ambassadors General Info ##################################################### ################################################################################ # Ambassadors by "campus" ggplot(data = student_text, mapping = aes(x = campus, fill = namSorGender.likelyGender)) + geom_bar(position = "dodge", alpha = .9) + labs(title = "Hult Ambassadors", x = "Hult Campuses", y = " ", fill = "Gender") + scale_fill_manual(values = c("hotpink1", "lightgrey")) + theme_tufte() ### # Ambassadors by "programTitle" ggplot(data = student_text, mapping = aes(x = programTitle)) + geom_bar(fill = "hotpink1", position = "dodge", alpha = .9) + labs(title = "Ambassadors per Program Title", x = "", y = " ") + coord_flip() + theme_tufte() ### # Counting Ambassadors per Hult campus table(student_text$campus) # Counting Ambassadors' per gender table(student_text$namSorGender.likelyGender) # Counting Ambassadors per program title table(student_text$programTitle) ################################################################################ # Creating and Organize Dataset Subsets ######################################## ################################################################################ # Concatenating "bio" and "interest" student_text$student_allText <- paste(student_text$bio,student_text$interests) # Renaming "student_text: first column names(student_text)[1] <- 'doc_id' ### # Creating a data subset for the American Hult campuses (Boston & San Francisco) america_campuses <- subset(student_text, student_text$campus == c('Boston') | student_text$campus == c('San Francisco')) # Creating a data subset for the Eurasian Hult campuses (Dubai & London) eurasia_campuses <- subset(student_text, student_text$campus == c('Dubai') | student_text$campus == c('London')) ################################################################################ # Searching for Word Patterns in "america_campuses" ########################### ################################################################################ # Diversity keywords scanning in "america_campuses" diversity_keywordsOR <-"diverse|diversity|variety|mix|multi-cultural| multicultural|global|world|cultures|international" america_diversity <- grepl(diversity_keywordsOR, america_campuses$student_allText, ignore.case=TRUE) # Calculating the % of times diversity keywords have been metioned america_diversity_score <- sum(america_diversity) / nrow(student_text) america_diversity_score # 0.3647059 ### # Thinking (Hult DNA) keywords scanning in "america_campuses" thinking_keywordsOR <-"awareness|self|challenge|growth mindset|" america_thinking <- grepl(thinking_keywordsOR, america_campuses$student_allText, ignore.case=TRUE) # Calculating the % of times thinking keywords have been metioned america_thinking_score <- sum(america_thinking) / nrow(student_text) america_thinking_score # 0.4235294 ### # Communicating (Hult DNA) keywords scanning in "america_campuses" communicating_keywordsOR <-"communication|communicate|confident|sharing| listening|listen|influence" america_communicating <- grepl(communicating_keywordsOR, america_campuses$student_allText,ignore.case=TRUE) # Calculating the % of times communicating keywords have been mentioned america_communicating_score <- sum(america_communicating) / nrow(student_text) america_communicating_score # 0.05882353 ### # Team-Building (Hult DNA) keywords scanning in "america_campuses" teambuilding_keywordsOR <-"team|peers|clubs|community|engage|engagement|network| connection|connecting|cooperation" america_teambuilding <- grepl(teambuilding_keywordsOR, america_campuses$student_allText,ignore.case=TRUE) # Calculating the % of times team-building keywords have been mentioned america_teambuilding_score <- sum(america_teambuilding) / nrow(student_text) america_teambuilding_score # 0.3058824 ################################################################################ # Searching for Word Patterns in "eurasia_campuses" ########################### ################################################################################ # Diversity keywords scanning in "eurasia_campuses" eurasia_diversity <- grepl(diversity_keywordsOR, eurasia_campuses$student_allText, ignore.case=TRUE) # Calculating the % of times diversity keywords have been mentioned eurasia_diversity_score <- sum(eurasia_diversity) / nrow(student_text) eurasia_diversity_score # 0.5411765 ### # Thinking (Hult DNA) keywords scanning in "eurasia_campuses" eurasia_thinking <- grepl(thinking_keywordsOR, eurasia_campuses$student_allText, ignore.case=TRUE) # Calculating the % of times thinking keywords have been mentioned eurasia_thinking_score <- sum(eurasia_thinking) / nrow(student_text) eurasia_thinking_score # 0.5764706 ### # Communicating (Hult DNA) keywords scanning in "eurasia_campuses" eurasia_communicating <- grepl(communicating_keywordsOR, eurasia_campuses$student_allText,ignore.case=TRUE) # Calculating the % of times communicating keywords have been mentioned eurasia_communicating_score <- sum(eurasia_communicating) / nrow(student_text) eurasia_communicating_score # 0.1176471 ### # Team-Building (Hult DNA) keywords scanning in "eurasia_campuses" eurasia_teambuilding <- grepl(teambuilding_keywordsOR, eurasia_campuses$student_allText,ignore.case=TRUE) # Calculating the % of times team-building keywords have been mentioned eurasia_teambuilding_score <- sum(eurasia_teambuilding) / nrow(student_text) eurasia_teambuilding_score # 0.3176471 ################################################################################ # Comparing Results: "america_campuses" vs. "eurasia_campuses" ################# ################################################################################ # Creating a matrix to summarize campuses' scores per category scores_comparison <- matrix(c(america_diversity_score, eurasia_diversity_score, america_thinking_score, eurasia_thinking_score, america_communicating_score, eurasia_communicating_score, america_teambuilding_score, eurasia_teambuilding_score), ncol = 2, byrow = TRUE ) # Defining "scores_comparison" columns' names colnames(scores_comparison ) <- c("America Campuses", "Eurasia Campuses") # Defining "scores_comparison" rows' names rownames(scores_comparison) <- c("Diversity", "Thinking", "Communicating", "Team Building") # Displaying the "scores_comparison" matrix scores_comparison ################################################################################ # String_count() for Hult DNA categories and Diversity (all dataset) ########## ################################################################################ # Counting words based on the Hult DNA categories and diversity diversity <- sum(stri_count(student_text$student_allText, regex = 'diverse|diversity| variety|mix|multi-cultural|multicultural| global|world|cultures|international')) thinking <- sum(stri_count(student_text$student_allText, regex ='awareness|self| challenge|growth mindset')) communicating <- sum(stri_count(student_text$student_allText, regex ='communication| communicate|confident|sharing|listening|listen| influence')) teambuilding <- sum(stri_count(student_text$student_allText, regex ='team|peers| clubs|community|engage|engagement|network| connection|connecting|cooperation')) # Organizing term objects into a data frame all_termFreq <- data.frame(Terms = c('diversity','thinking','communicating', 'teambuilding'), Freq = c(diversity, thinking, communicating, teambuilding)) # Checking the object frequencies all_termFreq # Plotting a geom_bar() for "all_termFreq" ggplot(data = all_termFreq, aes(x = reorder(Terms, Freq), y = Freq)) + geom_bar(stat = "identity", fill = "hotpink1") + labs(title = "Hult DNA and Diversity Words' Categories ", y = "Count", x = " ") + coord_flip() + theme_tufte() ################################################################################ # Volatile Corpus ############################################################## ################################################################################ # Making and cleaning a volatile corpus for "student_text" student_corp <- VCorpus(VectorSource(student_text$student_allText)) student_corp <- cleanCorpus(student_corp, stops) content(student_corp[[1]]) # Checking student_corp ### # Making and cleaning a volatile corpus for "america_campuses" america_corp <- VCorpus(VectorSource(america_campuses$student_allText)) america_corp <- cleanCorpus(america_corp, stops) content(america_corp[[1]]) # Checking america_corp ### # Making and cleaning a volatile corpus for "eurasia_campuses" eurasia_corp <- VCorpus(VectorSource(eurasia_campuses$student_allText)) eurasia_corp <- cleanCorpus(eurasia_corp, stops) content(eurasia_corp[[1]]) # Checking eurasia_corp ################################################################################ # Term Document Matrix ######################################################### ################################################################################ # Making a Term Document Matrix for "america_campuses" america_Tdm <- TermDocumentMatrix(america_corp, control = list(weighting = weightTf)) america_TdmM <- as.matrix(america_Tdm) dim(america_TdmM) # Checking matrix dimensions ### # Making a Term Document Matrix for "eurasia_campuses" eurasia_Tdm <- TermDocumentMatrix(eurasia_corp, control = list(weighting = weightTf)) eurasia_TdmM <- as.matrix(eurasia_Tdm) dim(eurasia_TdmM) # Checking matrix dimensions ### # Making a Term Document Matrix for "eurasia_campuses" student_Tdm <- TermDocumentMatrix(student_corp, control = list(weighting = weightTf)) student_TdmM <- as.matrix(student_Tdm) dim(student_TdmM) # Checking matrix dimensions ################################################################################ # Most Frequent Terms ########################################################## ################################################################################ # Getting the most frequent terms for "america_campuses" america_TopTerms <- rowSums(america_TdmM) america_TopTerms <- data.frame(terms = rownames(america_TdmM), freq = america_TopTerms) rownames(america_TopTerms) <- NULL head(america_TopTerms) # Getting the most frequent term america_idx <- which.max(america_TopTerms$freq) america_TopTerms[america_idx, ] # business ### # Getting the most frequent terms for "eurasia_campuses" eurasia_TopTerms <- rowSums(eurasia_TdmM) eurasia_TopTerms <- data.frame(terms = rownames(eurasia_TdmM), freq = eurasia_TopTerms) rownames(eurasia_TopTerms) <- NULL head(eurasia_TopTerms) # Getting the most frequent term eurasia_idx <- which.max(eurasia_TopTerms$freq) america_TopTerms[eurasia_idx, ] # coming ### # Getting the most frequent terms for all dataset student_all_TopTerms <- rowSums(student_TdmM) student_all_TopTerms <- data.frame(terms = rownames(student_TdmM), freq = student_all_TopTerms) rownames(student_all_TopTerms) <- NULL head(student_all_TopTerms) # Getting the most frequent term student_all_idx <- which.max(student_all_TopTerms$freq) student_all_TopTerms[student_all_idx, ] # business ################################################################################ # Plotting the most Frequent Terms ############################################# ################################################################################ # Creating an "america_TopTerms" subset america_Top_subset <- subset(america_TopTerms, america_TopTerms$freq > 12) america_Top_subset <- america_Top_subset[order(america_Top_subset$freq, decreasing=F),] america_Top_subset[10:30,] # Converting top terms into factors america_Top_subset$terms <- factor(america_Top_subset$terms, levels=unique(as.character(america_Top_subset$terms))) # Plotting top terms for "america_campuses" ggplot(data = america_Top_subset, mapping = aes(x=terms, y=freq)) + geom_bar(stat="identity", fill = "hotpink1") + labs(title = "Top Terms among America Campuses", x = "", y = "Frequency") + coord_flip() + theme_tufte() ### # Creating an "eurasia_TopTerms" subset eurasia_Top_subset <- subset(eurasia_TopTerms, eurasia_TopTerms$freq > 16) eurasia_Top_subset <- eurasia_Top_subset[order(eurasia_Top_subset$freq, decreasing=F),] eurasia_Top_subset[9:31,] # Converting top terms into factors eurasia_Top_subset$terms <- factor(eurasia_Top_subset$terms, levels=unique(as.character(eurasia_Top_subset$terms))) # Plotting top terms for "eurasia_campuses" ggplot(data = eurasia_Top_subset, mapping = aes(x=terms, y=freq)) + geom_bar(stat="identity", fill = "hotpink1") + labs(title = "Top Terms among Eurasia Campuses", x = "", y = "Frequency") + coord_flip() + theme_tufte() ################################################################################ # Association Analysis ######################################################### ################################################################################ # Inspecting word associations for "america_campuses" america_associations <- findAssocs(america_Tdm, 'business', 0.37) america_associations # Checking results # Organizing words for "america_associations" america_assocDF <- data.frame(terms=names(america_associations[[1]]), value=unlist(america_associations)) america_assocDF$terms <- factor(america_assocDF$terms, levels=america_assocDF$terms) rownames(america_assocDF) <- NULL america_assocDF # Displaying associations ggplot(america_assocDF, aes(y=terms)) + geom_point(aes(x=value), data=america_assocDF, col='hotpink1') + labs(title = "Association Analysis for Business in America Campuses", x = "Value", y = " ") + theme_tufte() + geom_text(aes(x=value,label=value), colour="grey",hjust="inward", vjust ="inward" , size=3) ### # Inspecting word associations for "eurasia_campuses" eurasia_associations <- findAssocs(eurasia_Tdm, 'business', 0.37) eurasia_associations # Checking results # Organizing words for "eurasia_associations" eurasia_assocDF <- data.frame(terms=names(eurasia_associations[[1]]), value=unlist(eurasia_associations)) eurasia_assocDF$terms <- factor(eurasia_assocDF$terms, levels=eurasia_assocDF$terms) rownames(eurasia_assocDF) <- NULL eurasia_assocDF # Displaying associations ggplot(eurasia_assocDF, aes(y=terms)) + geom_point(aes(x=value), data=eurasia_assocDF, col='hotpink1') + labs(title = "Association Analysis for Business in Eurasia Campuses", x = "Value", y = " ") + theme_tufte() + geom_text(aes(x=value,label=value), colour="grey",hjust="inward", vjust ="inward" , size=3) ### # Inspecting word associations for all dataset student_associations <- findAssocs(student_Tdm, 'business', 0.30) student_associations # Checking results # Organizing words for all dataset student_assocDF <- data.frame(terms=names(student_associations[[1]]), value=unlist(student_associations)) student_assocDF$terms <- factor(student_assocDF$terms, levels=student_assocDF$terms) rownames(student_assocDF) <- NULL student_assocDF # Displaying associations ggplot(student_assocDF, aes(y=terms)) + geom_point(aes(x=value), data=student_assocDF, col='hotpink1') + labs(title = "Association Analysis for Business (all dataset)", x = "Value", y = " ") + theme_tufte() + geom_text(aes(x=value,label=value), colour="grey",hjust="inward", vjust ="inward" , size=3) ################################################################################ # WorldCloud ################################################################### ################################################################################ # Setting worldcloud palette pal <- brewer.pal(8, "Greys") pal <- pal[-(1:2)] ### # Plotting a worldcloud for "america_campuses" set.seed(1234) wordcloud(america_TopTerms$terms, america_TopTerms$freq, max.words = 50, random.order = FALSE, colors = pal, scale = c(2,1)) ### # Plotting a worldcloud for "eurasia_campuses" set.seed(1234) wordcloud(eurasia_TopTerms$terms, eurasia_TopTerms$freq, max.words = 50, random.order = FALSE, colors = pal, scale = c(2,1)) ### # Plotting a world cloud for all dataset set.seed(1234) wordcloud(student_all_TopTerms$terms, student_all_TopTerms$freq, max.words = 50, random.order = FALSE, colors = pal, scale = c(2,1)) ################################################################################ # Other WorldCloud Type ######################################################## ################################################################################ # Choose a color & drop light ones pal2 <- brewer.pal(8, "Greys") wordcloud2(student_all_TopTerms[1:50,], color = pal2, backgroundColor = "pink") ################################################################################ # Comparison Cloud: "bio" vs "interest" ######################################## ################################################################################ # Defining a vector corpus all_bio <- VCorpus(VectorSource(student_text$bio)) all_interest <- VCorpus(VectorSource(student_text$interest)) # Cleaning up the data all_bio <- cleanCorpus(all_bio, stops) all_interest <- cleanCorpus(all_interest, stops) # Checking the results length(all_bio) length(all_interest) # Collapsing each document into a single "subject" all_bio <- paste(all_bio, collapse = ' ') all_interest <- paste(all_interest, collapse = ' ') # Combining the "all_bio" and "all_interest" bio_interest <- c(all_bio, all_interest) bio_interest <- VCorpus((VectorSource(bio_interest))) # Defining TDM ctrl <- list(weighting = weightTfIdf) bio_interest_TDM <- TermDocumentMatrix(bio_interest, control = ctrl) bio_interest_TDMm <- as.matrix(bio_interest_TDM) # Defining columns order colnames(bio_interest_TDMm) <- c('Bio', 'Interests') # Examining TDM head(bio_interest_TDMm) # Plotting a comparison cloud comparison.cloud(bio_interest_TDMm, max.words= 30, random.order=FALSE, title.size=0.8, colors=brewer.pal(ncol(bio_interest_TDMm),"Paired"), title.colors=FALSE, match.colors=FALSE, scale=c(3,0.2)) # End ##########################################################################
/Stefania_Menini_Student_Spotlight_Case.R
no_license
StefaniaMenini/hult-ambassadors-text-analysis
R
false
false
22,879
r
#' Title: Hult International Business School Student Spotlight #' Purpose: Is there any bias in the showcased ambassadors' bio and interest? #' Author: Stefania Menini #' E-mail: smenini2019@student.hult.edu #' Date: Mar 1 2021 ################################################################################ # Analysis Objective ########################################################### # The objective of the analysis is to ensure that the bio and the interest of # # the showcased Hult students ambassadors do not present bias towards campuses,# # topics, or other observed information. Achieving this goal will guarantee a # # welcoming, diverse, and inclusive learning atmosphere (Kwartler, 2020). # ################################################################################ ################################################################################ # Initial Set Up ############################################################### ################################################################################ # Setting the working directory setwd("~/R/Git_hult_NLP_student/hult_NLP_student/cases/session II/student ambassadors") # Loading basic packages required for the analysis library(ggplot2) library(ggthemes) library(stringi) library(stringr) library(tm) # Loading additional packages library(lubridate) library(wordcloud) library(RColorBrewer) library(plotrix) library(ggalt) library(tibble) library(dplyr) library(lexicon) library(tidytext) library(radarchart) library(textdata) library(magrittr) library(corpus) # library(hrbrthemes) library(qdap) library(igraph) library(wordcloud2) library(pbapply) # Avoiding strings being counted as factors options(stringsAsFactors = FALSE) # Limiting errors by expanding the accepted number of location in character types Sys.setlocale('LC_ALL','C') # Loading "final_student_data" dataset and collecting dataset general info student_text <- read.csv('final_student_data.csv', header = TRUE) head(student_text,5) # Checking the first five rows of "final_student_data" names(student_text) # Checking columns names of "final_student_data" dim(student_text) # Checking "final_student_data" dimension # Creating stopwords using the 'SMART' stops <- c(stopwords('SMART'), 'hult', 'hult international business school') ################################################################################ # Customized functions ######################################################### ################################################################################ # Defining "tryTolower" tryTolower <- function(x){ # return NA when there is an error y = NA # tryCatch error try_error = tryCatch(tolower(x), error = function(e) e) # if not an error if (!inherits(try_error, 'error')) y = tolower(x) return(y)} # Defining "cleanCorpus" cleanCorpus<-function(corpus, customStopwords){ corpus <- tm_map(corpus, content_transformer(qdapRegex::rm_url)) corpus <- tm_map(corpus, content_transformer(tryTolower)) corpus <- tm_map(corpus, removeWords, customStopwords) corpus <- tm_map(corpus, removePunctuation) corpus <- tm_map(corpus, removeNumbers) corpus <- tm_map(corpus, stripWhitespace) return(corpus)} ################################################################################ # Ambassadors General Info ##################################################### ################################################################################ # Ambassadors by "campus" ggplot(data = student_text, mapping = aes(x = campus, fill = namSorGender.likelyGender)) + geom_bar(position = "dodge", alpha = .9) + labs(title = "Hult Ambassadors", x = "Hult Campuses", y = " ", fill = "Gender") + scale_fill_manual(values = c("hotpink1", "lightgrey")) + theme_tufte() ### # Ambassadors by "programTitle" ggplot(data = student_text, mapping = aes(x = programTitle)) + geom_bar(fill = "hotpink1", position = "dodge", alpha = .9) + labs(title = "Ambassadors per Program Title", x = "", y = " ") + coord_flip() + theme_tufte() ### # Counting Ambassadors per Hult campus table(student_text$campus) # Counting Ambassadors' per gender table(student_text$namSorGender.likelyGender) # Counting Ambassadors per program title table(student_text$programTitle) ################################################################################ # Creating and Organize Dataset Subsets ######################################## ################################################################################ # Concatenating "bio" and "interest" student_text$student_allText <- paste(student_text$bio,student_text$interests) # Renaming "student_text: first column names(student_text)[1] <- 'doc_id' ### # Creating a data subset for the American Hult campuses (Boston & San Francisco) america_campuses <- subset(student_text, student_text$campus == c('Boston') | student_text$campus == c('San Francisco')) # Creating a data subset for the Eurasian Hult campuses (Dubai & London) eurasia_campuses <- subset(student_text, student_text$campus == c('Dubai') | student_text$campus == c('London')) ################################################################################ # Searching for Word Patterns in "america_campuses" ########################### ################################################################################ # Diversity keywords scanning in "america_campuses" diversity_keywordsOR <-"diverse|diversity|variety|mix|multi-cultural| multicultural|global|world|cultures|international" america_diversity <- grepl(diversity_keywordsOR, america_campuses$student_allText, ignore.case=TRUE) # Calculating the % of times diversity keywords have been metioned america_diversity_score <- sum(america_diversity) / nrow(student_text) america_diversity_score # 0.3647059 ### # Thinking (Hult DNA) keywords scanning in "america_campuses" thinking_keywordsOR <-"awareness|self|challenge|growth mindset|" america_thinking <- grepl(thinking_keywordsOR, america_campuses$student_allText, ignore.case=TRUE) # Calculating the % of times thinking keywords have been metioned america_thinking_score <- sum(america_thinking) / nrow(student_text) america_thinking_score # 0.4235294 ### # Communicating (Hult DNA) keywords scanning in "america_campuses" communicating_keywordsOR <-"communication|communicate|confident|sharing| listening|listen|influence" america_communicating <- grepl(communicating_keywordsOR, america_campuses$student_allText,ignore.case=TRUE) # Calculating the % of times communicating keywords have been mentioned america_communicating_score <- sum(america_communicating) / nrow(student_text) america_communicating_score # 0.05882353 ### # Team-Building (Hult DNA) keywords scanning in "america_campuses" teambuilding_keywordsOR <-"team|peers|clubs|community|engage|engagement|network| connection|connecting|cooperation" america_teambuilding <- grepl(teambuilding_keywordsOR, america_campuses$student_allText,ignore.case=TRUE) # Calculating the % of times team-building keywords have been mentioned america_teambuilding_score <- sum(america_teambuilding) / nrow(student_text) america_teambuilding_score # 0.3058824 ################################################################################ # Searching for Word Patterns in "eurasia_campuses" ########################### ################################################################################ # Diversity keywords scanning in "eurasia_campuses" eurasia_diversity <- grepl(diversity_keywordsOR, eurasia_campuses$student_allText, ignore.case=TRUE) # Calculating the % of times diversity keywords have been mentioned eurasia_diversity_score <- sum(eurasia_diversity) / nrow(student_text) eurasia_diversity_score # 0.5411765 ### # Thinking (Hult DNA) keywords scanning in "eurasia_campuses" eurasia_thinking <- grepl(thinking_keywordsOR, eurasia_campuses$student_allText, ignore.case=TRUE) # Calculating the % of times thinking keywords have been mentioned eurasia_thinking_score <- sum(eurasia_thinking) / nrow(student_text) eurasia_thinking_score # 0.5764706 ### # Communicating (Hult DNA) keywords scanning in "eurasia_campuses" eurasia_communicating <- grepl(communicating_keywordsOR, eurasia_campuses$student_allText,ignore.case=TRUE) # Calculating the % of times communicating keywords have been mentioned eurasia_communicating_score <- sum(eurasia_communicating) / nrow(student_text) eurasia_communicating_score # 0.1176471 ### # Team-Building (Hult DNA) keywords scanning in "eurasia_campuses" eurasia_teambuilding <- grepl(teambuilding_keywordsOR, eurasia_campuses$student_allText,ignore.case=TRUE) # Calculating the % of times team-building keywords have been mentioned eurasia_teambuilding_score <- sum(eurasia_teambuilding) / nrow(student_text) eurasia_teambuilding_score # 0.3176471 ################################################################################ # Comparing Results: "america_campuses" vs. "eurasia_campuses" ################# ################################################################################ # Creating a matrix to summarize campuses' scores per category scores_comparison <- matrix(c(america_diversity_score, eurasia_diversity_score, america_thinking_score, eurasia_thinking_score, america_communicating_score, eurasia_communicating_score, america_teambuilding_score, eurasia_teambuilding_score), ncol = 2, byrow = TRUE ) # Defining "scores_comparison" columns' names colnames(scores_comparison ) <- c("America Campuses", "Eurasia Campuses") # Defining "scores_comparison" rows' names rownames(scores_comparison) <- c("Diversity", "Thinking", "Communicating", "Team Building") # Displaying the "scores_comparison" matrix scores_comparison ################################################################################ # String_count() for Hult DNA categories and Diversity (all dataset) ########## ################################################################################ # Counting words based on the Hult DNA categories and diversity diversity <- sum(stri_count(student_text$student_allText, regex = 'diverse|diversity| variety|mix|multi-cultural|multicultural| global|world|cultures|international')) thinking <- sum(stri_count(student_text$student_allText, regex ='awareness|self| challenge|growth mindset')) communicating <- sum(stri_count(student_text$student_allText, regex ='communication| communicate|confident|sharing|listening|listen| influence')) teambuilding <- sum(stri_count(student_text$student_allText, regex ='team|peers| clubs|community|engage|engagement|network| connection|connecting|cooperation')) # Organizing term objects into a data frame all_termFreq <- data.frame(Terms = c('diversity','thinking','communicating', 'teambuilding'), Freq = c(diversity, thinking, communicating, teambuilding)) # Checking the object frequencies all_termFreq # Plotting a geom_bar() for "all_termFreq" ggplot(data = all_termFreq, aes(x = reorder(Terms, Freq), y = Freq)) + geom_bar(stat = "identity", fill = "hotpink1") + labs(title = "Hult DNA and Diversity Words' Categories ", y = "Count", x = " ") + coord_flip() + theme_tufte() ################################################################################ # Volatile Corpus ############################################################## ################################################################################ # Making and cleaning a volatile corpus for "student_text" student_corp <- VCorpus(VectorSource(student_text$student_allText)) student_corp <- cleanCorpus(student_corp, stops) content(student_corp[[1]]) # Checking student_corp ### # Making and cleaning a volatile corpus for "america_campuses" america_corp <- VCorpus(VectorSource(america_campuses$student_allText)) america_corp <- cleanCorpus(america_corp, stops) content(america_corp[[1]]) # Checking america_corp ### # Making and cleaning a volatile corpus for "eurasia_campuses" eurasia_corp <- VCorpus(VectorSource(eurasia_campuses$student_allText)) eurasia_corp <- cleanCorpus(eurasia_corp, stops) content(eurasia_corp[[1]]) # Checking eurasia_corp ################################################################################ # Term Document Matrix ######################################################### ################################################################################ # Making a Term Document Matrix for "america_campuses" america_Tdm <- TermDocumentMatrix(america_corp, control = list(weighting = weightTf)) america_TdmM <- as.matrix(america_Tdm) dim(america_TdmM) # Checking matrix dimensions ### # Making a Term Document Matrix for "eurasia_campuses" eurasia_Tdm <- TermDocumentMatrix(eurasia_corp, control = list(weighting = weightTf)) eurasia_TdmM <- as.matrix(eurasia_Tdm) dim(eurasia_TdmM) # Checking matrix dimensions ### # Making a Term Document Matrix for "eurasia_campuses" student_Tdm <- TermDocumentMatrix(student_corp, control = list(weighting = weightTf)) student_TdmM <- as.matrix(student_Tdm) dim(student_TdmM) # Checking matrix dimensions ################################################################################ # Most Frequent Terms ########################################################## ################################################################################ # Getting the most frequent terms for "america_campuses" america_TopTerms <- rowSums(america_TdmM) america_TopTerms <- data.frame(terms = rownames(america_TdmM), freq = america_TopTerms) rownames(america_TopTerms) <- NULL head(america_TopTerms) # Getting the most frequent term america_idx <- which.max(america_TopTerms$freq) america_TopTerms[america_idx, ] # business ### # Getting the most frequent terms for "eurasia_campuses" eurasia_TopTerms <- rowSums(eurasia_TdmM) eurasia_TopTerms <- data.frame(terms = rownames(eurasia_TdmM), freq = eurasia_TopTerms) rownames(eurasia_TopTerms) <- NULL head(eurasia_TopTerms) # Getting the most frequent term eurasia_idx <- which.max(eurasia_TopTerms$freq) america_TopTerms[eurasia_idx, ] # coming ### # Getting the most frequent terms for all dataset student_all_TopTerms <- rowSums(student_TdmM) student_all_TopTerms <- data.frame(terms = rownames(student_TdmM), freq = student_all_TopTerms) rownames(student_all_TopTerms) <- NULL head(student_all_TopTerms) # Getting the most frequent term student_all_idx <- which.max(student_all_TopTerms$freq) student_all_TopTerms[student_all_idx, ] # business ################################################################################ # Plotting the most Frequent Terms ############################################# ################################################################################ # Creating an "america_TopTerms" subset america_Top_subset <- subset(america_TopTerms, america_TopTerms$freq > 12) america_Top_subset <- america_Top_subset[order(america_Top_subset$freq, decreasing=F),] america_Top_subset[10:30,] # Converting top terms into factors america_Top_subset$terms <- factor(america_Top_subset$terms, levels=unique(as.character(america_Top_subset$terms))) # Plotting top terms for "america_campuses" ggplot(data = america_Top_subset, mapping = aes(x=terms, y=freq)) + geom_bar(stat="identity", fill = "hotpink1") + labs(title = "Top Terms among America Campuses", x = "", y = "Frequency") + coord_flip() + theme_tufte() ### # Creating an "eurasia_TopTerms" subset eurasia_Top_subset <- subset(eurasia_TopTerms, eurasia_TopTerms$freq > 16) eurasia_Top_subset <- eurasia_Top_subset[order(eurasia_Top_subset$freq, decreasing=F),] eurasia_Top_subset[9:31,] # Converting top terms into factors eurasia_Top_subset$terms <- factor(eurasia_Top_subset$terms, levels=unique(as.character(eurasia_Top_subset$terms))) # Plotting top terms for "eurasia_campuses" ggplot(data = eurasia_Top_subset, mapping = aes(x=terms, y=freq)) + geom_bar(stat="identity", fill = "hotpink1") + labs(title = "Top Terms among Eurasia Campuses", x = "", y = "Frequency") + coord_flip() + theme_tufte() ################################################################################ # Association Analysis ######################################################### ################################################################################ # Inspecting word associations for "america_campuses" america_associations <- findAssocs(america_Tdm, 'business', 0.37) america_associations # Checking results # Organizing words for "america_associations" america_assocDF <- data.frame(terms=names(america_associations[[1]]), value=unlist(america_associations)) america_assocDF$terms <- factor(america_assocDF$terms, levels=america_assocDF$terms) rownames(america_assocDF) <- NULL america_assocDF # Displaying associations ggplot(america_assocDF, aes(y=terms)) + geom_point(aes(x=value), data=america_assocDF, col='hotpink1') + labs(title = "Association Analysis for Business in America Campuses", x = "Value", y = " ") + theme_tufte() + geom_text(aes(x=value,label=value), colour="grey",hjust="inward", vjust ="inward" , size=3) ### # Inspecting word associations for "eurasia_campuses" eurasia_associations <- findAssocs(eurasia_Tdm, 'business', 0.37) eurasia_associations # Checking results # Organizing words for "eurasia_associations" eurasia_assocDF <- data.frame(terms=names(eurasia_associations[[1]]), value=unlist(eurasia_associations)) eurasia_assocDF$terms <- factor(eurasia_assocDF$terms, levels=eurasia_assocDF$terms) rownames(eurasia_assocDF) <- NULL eurasia_assocDF # Displaying associations ggplot(eurasia_assocDF, aes(y=terms)) + geom_point(aes(x=value), data=eurasia_assocDF, col='hotpink1') + labs(title = "Association Analysis for Business in Eurasia Campuses", x = "Value", y = " ") + theme_tufte() + geom_text(aes(x=value,label=value), colour="grey",hjust="inward", vjust ="inward" , size=3) ### # Inspecting word associations for all dataset student_associations <- findAssocs(student_Tdm, 'business', 0.30) student_associations # Checking results # Organizing words for all dataset student_assocDF <- data.frame(terms=names(student_associations[[1]]), value=unlist(student_associations)) student_assocDF$terms <- factor(student_assocDF$terms, levels=student_assocDF$terms) rownames(student_assocDF) <- NULL student_assocDF # Displaying associations ggplot(student_assocDF, aes(y=terms)) + geom_point(aes(x=value), data=student_assocDF, col='hotpink1') + labs(title = "Association Analysis for Business (all dataset)", x = "Value", y = " ") + theme_tufte() + geom_text(aes(x=value,label=value), colour="grey",hjust="inward", vjust ="inward" , size=3) ################################################################################ # WorldCloud ################################################################### ################################################################################ # Setting worldcloud palette pal <- brewer.pal(8, "Greys") pal <- pal[-(1:2)] ### # Plotting a worldcloud for "america_campuses" set.seed(1234) wordcloud(america_TopTerms$terms, america_TopTerms$freq, max.words = 50, random.order = FALSE, colors = pal, scale = c(2,1)) ### # Plotting a worldcloud for "eurasia_campuses" set.seed(1234) wordcloud(eurasia_TopTerms$terms, eurasia_TopTerms$freq, max.words = 50, random.order = FALSE, colors = pal, scale = c(2,1)) ### # Plotting a world cloud for all dataset set.seed(1234) wordcloud(student_all_TopTerms$terms, student_all_TopTerms$freq, max.words = 50, random.order = FALSE, colors = pal, scale = c(2,1)) ################################################################################ # Other WorldCloud Type ######################################################## ################################################################################ # Choose a color & drop light ones pal2 <- brewer.pal(8, "Greys") wordcloud2(student_all_TopTerms[1:50,], color = pal2, backgroundColor = "pink") ################################################################################ # Comparison Cloud: "bio" vs "interest" ######################################## ################################################################################ # Defining a vector corpus all_bio <- VCorpus(VectorSource(student_text$bio)) all_interest <- VCorpus(VectorSource(student_text$interest)) # Cleaning up the data all_bio <- cleanCorpus(all_bio, stops) all_interest <- cleanCorpus(all_interest, stops) # Checking the results length(all_bio) length(all_interest) # Collapsing each document into a single "subject" all_bio <- paste(all_bio, collapse = ' ') all_interest <- paste(all_interest, collapse = ' ') # Combining the "all_bio" and "all_interest" bio_interest <- c(all_bio, all_interest) bio_interest <- VCorpus((VectorSource(bio_interest))) # Defining TDM ctrl <- list(weighting = weightTfIdf) bio_interest_TDM <- TermDocumentMatrix(bio_interest, control = ctrl) bio_interest_TDMm <- as.matrix(bio_interest_TDM) # Defining columns order colnames(bio_interest_TDMm) <- c('Bio', 'Interests') # Examining TDM head(bio_interest_TDMm) # Plotting a comparison cloud comparison.cloud(bio_interest_TDMm, max.words= 30, random.order=FALSE, title.size=0.8, colors=brewer.pal(ncol(bio_interest_TDMm),"Paired"), title.colors=FALSE, match.colors=FALSE, scale=c(3,0.2)) # End ##########################################################################
################################# ### Homework ideas ################################# rm(list=ls()) # remove all options(max.print=80) options(digits=3) par(new=TRUE) # allow new plot on same chart par(las=1) # set text printing to "horizontal" library(zoo) # good package loading script inside functions stopifnot("package:xts" %in% search() || require("xts", quietly=TRUE)) ##################### ### temp stuff ### zoomChart("2010") zoomChart("2010-04/2010-06") ######## reg_model <- lm(range~volume, data=range_volume["2008/2009"]) plot(reg_model) reg_model <- lm(range~volume, data=diff(range_volume)) reg_model <- lm(range~volume, data=diff(range_volume["2010/"], lag=11)) reg_model <- lm(range~volume, data=diff(range_volume["2008/2009"])) summary(reg_model) plot(range~volume, data=diff(range_volume["2010/"])) adf.test(range_volume[, "range"]) adf.test(cumsum(rnorm(nrow(range_volume)))) cor(x=range_volume[, "range"], y=range_volume[, "volume"], method="pearson") cor.test(x=range_volume[, "range"], y=range_volume[, "volume"], method="pearson") cor(x=range_volume[, "range"], y=range_volume[, "volume"], method="kendall") cor.test(x=range_volume[, "range"], y=range_volume[, "volume"], method="kendall") cor(x=range_volume[, "range"], y=range_volume[, "volume"], method="spearman") cor.test(x=range_volume[, "range"], y=range_volume[, "volume"], method="spearman") ##################### ### end temp stuff ### ######################## ### functions ############### # 3. (20pts even without legend) Plot the probability density of DAX returns together with t-distribution returns with four degrees of freedom on a single plot, # plot t-distribution x_var <- seq(-5, 5, length=100) x_var <- seq(-6, -3, length=100) plot(x=x_var, y=dt(x_var, df=4), type="l", lwd=2, xlab="", ylab="", ylim=c(0, 0.03)) # add line for density of DAX returns ts_rets <- 100*diff(log(EuStockMarkets[, 1])) lines(density(ts_rets), col="red", lwd=2) # add legend legend("topright", title="DAX vs t-distr", legend=c("t-distr", "DAX"), inset=0.05, cex=0.8, lwd=2, lty=c(1, 1), col=c("black", "red")) ######################## ### expressions ### while loops ######################## ### dates and times ######################## ### time series ######################## ### stochastic processes ### below are scratch or incorrect - doesn't work properly: ###### # Create a series lagged by one period from "ts_arima", and call it "ts_arima_lag", # The value of "ts_arima_lag" in a given period should be equal to # the value of "ts_arima" in the previous period, # Create a series lagged by two periods from "ts_arima", and call it "ts_arima_lag2", # use function lag() with the proper argument "k", # create ARIMA time series of class "ts" zoo_arima <- arima.sim(n=1000, model=list(ar=c(0.2, 0.3))) # verify that "ts_arima_lag" and "ts_arima_lag2" are correctly lagged by inspecting them, # use functions head() and cbind(), head(cbind(ts_arima, ts_arima_lag, ts_arima_lag2)) tail(cbind(ts_arima, ts_arima_lag, ts_arima_lag2)) ###### # Create a linear combination of "ts_arima_1" and its lag=2 series, and call it "ts_arima_2", # such that the lag=2 autocorrelation of "ts_arima_2" is equal to zero, or is very close to zero, ts_arima_2 <- ts_arima_1 - vec_acf_1[3]*lag(ts_arima_1, k=-2) vec_acf_2 <- drop(acf(ts_arima_2, lag=5, plot=FALSE)$acf) # plot acf_plus(ts_arima_2, lag=5) ###### # Create a linear combination of "zoo_arima" and "zoo_arima_lag", and call it "zoo_arima_1" (decorrelated), # such that its lag=1 autocorrelation coefficient is equal to zero, or is very close to zero, # Extract the lag=5 autocorrelation vector of "zoo_arima_1", and call it "vec_acf_1", # verify that the lag=1 autocorrelation is very close to zero, zoo_arima_1 <- zoo_arima - vec_acf[2]*sd(zoo_arima)*zoo_arima_lag/sd(zoo_arima_lag) vec_acf_1 <- drop(acf(zoo_arima_1, lag=5, plot=FALSE)$acf) # plot acf_plus(zoo_arima_1, lag=5) ########### # classes and inheritance ############### # create new generic function and method for "string" class, based on: "reverse", "trim", "pad", "scramble", # create "stringy" class, derived from "string" class # create new methods for "stringy" class, based on existing generic functions: "length", "+", "print" # create new methods for "stringy" class, based on "string" generic functions: "", "", "" # show that "stringy" inherits methods from "string" class # derive (not create!) new "string" class from "character" object # simply add "string" to class vector as.string <- function(x) { if(!inherits(x, "string")) class(x) <- c("string", class(x)) x # return "x" } # derive (not create!) new "string" class from "character" object # define generic "string" class converter as.string <- function (x, ...) UseMethod("as.string") # default "string" class converter as.string.default <- function (x, ...) { if(!inherits(x, "string")) x <- structure(x, class=c("string", class(x)), ...) x # return "x" } # end as.string.default # numeric "string" class converter as.string.numeric <- function (x, ...) { if(!inherits(x, "string")) x <- structure(as.character(x), class=c("string", class(x)), ...) x # return "x" } # end as.string.numeric is.string <- function (x) inherits(x=x, what="string") # define "string" object obj_string <- as.string("how are you today?") obj_string class(obj_string) is.string(obj_string) is.string("hello") as.string(123) is.string(as.string(123)) # overload "+" function for "string" class "+.string" <- function (a, b, ...) { paste(a, "plus", b) } # end +.string # adds character indices and returns character with index equal to the sum "+.string" <- function (a, b, ...) { in_dex <- (which(letters==substring(a, 1, 1)) + which(letters==substring(b, 1, 1))) %% length(letters) letters[in_dex] } # end +.string methods("+") # view methods for "+" operator string1 <- structure("hello", class="string") string2 <- structure("there", class="string") class(string1) string1 + string2 # add two "string" objects # borrow from "stringr": "check_string", "str_length" # overload "print" function for "string" class print.string <- function (str_ing) { print( paste(strsplit(str_ing, split=" ")[[1]], collapse=" + ")) } # end print.string print(my_string) # define generic "first" function (if not defined by "xts") first <- function (x, ...) UseMethod("first") # define "first" method for "string" class first.string <- function (str_ing, ...) { unclass(substring(str_ing, 1, 1)) } # end first.string first(string1) last.string <- function (str_ing, ...) { unclass(substring(str_ing, nchar(str_ing), nchar(str_ing))) } # end last.string last(string1) ### function that adds "character" class objects add_char <- function (char1, char2) { # test for "character" class and throw error stopifnot(is.character(char1) && is.character(char1)) in_dex <- (which(letters==substr(char1, 1, 1)) + which(letters==substr(char2, 1, 1))) %% length(letters) letters[in_dex] } # end add_char add_char("c", "b") add_char("1", "b") add_char(1, "b") a <- "efg" b <- "opq" add_char(a, b) class(my_stringy) <- c("stringy", "string") "+.stringy" <- function (a, b, ...) { paste(a, "plus", b) } # end +.stringy # create "base5" arithmetic class, derived from "numeric" class # create new methods for "base5" class, based on existing generic functions: "+", "-", "*", "/" baz <- function(x) UseMethod("baz", x) baz.A <- function(x) "A" baz.B <- function(x) "B" ab <- 1 class(ab) <- c("A", "B") ba <- 2 class(ba) <- c("B", "A") ab <- structure(1, class = c("A", "B")) ba <- structure(1, class = c("B", "A")) baz(ab) baz(ba) "+.character" <- function(a, b, ...){ NextMethod() } ################################# ### HW #6 Solution ################################# # Max score 25pts # comment: # Half of the credit for the first part (max 15pts) is from properly calculating # the length (nrow) of the list object, because nrow() returns NULL for one-dimensional objects. # Homework assignment: # 1. (15pts) Create a function called str_ts(), which summarizes time series objects, # The function input is a time series object, # The function should return a named list object with the following information: length (nrow), dimensions, number of rows with bad data, colnames, the object's class, data type, and the first and last rows of data, # The function should validate its argument, and throw an error if it's not a time series object, str_ts <- function(ts_series=NULL) { # check if argument is a time series object stopifnot(is.ts(ts_series) || is.zoo(ts_series)) # create list and return it list( length=ifelse(is.null(nrow(ts_series)), length(ts_series), nrow(ts_series)), dim=dim(ts_series), bad_data=sum(!complete.cases(ts_series)), col_names=colnames(ts_series), ts_class=class(ts_series), ts_type=typeof(ts_series), first_row=head(ts_series, 1), last_row=tail(ts_series, 1) ) # end list } # end str_ts # 2. (10pts) Create a synthetic zoo time series of prices with two named columns, based on random returns equal to "rnorm", # Introduce a few NA values into the time series, and call str_ts() on this time series, library(zoo) # load package zoo ts_var <- zoo(matrix(rnorm(20), ncol=2), order.by=(Sys.Date() - 1:10)) colnames(ts_var) <- paste0("col", 1:2) ts_var[3, 1] <- NA ts_var[6, 2] <- NA str_ts(ts_var)
/FRE_homework_ideas.R
no_license
githubfun/FRE6871
R
false
false
9,441
r
################################# ### Homework ideas ################################# rm(list=ls()) # remove all options(max.print=80) options(digits=3) par(new=TRUE) # allow new plot on same chart par(las=1) # set text printing to "horizontal" library(zoo) # good package loading script inside functions stopifnot("package:xts" %in% search() || require("xts", quietly=TRUE)) ##################### ### temp stuff ### zoomChart("2010") zoomChart("2010-04/2010-06") ######## reg_model <- lm(range~volume, data=range_volume["2008/2009"]) plot(reg_model) reg_model <- lm(range~volume, data=diff(range_volume)) reg_model <- lm(range~volume, data=diff(range_volume["2010/"], lag=11)) reg_model <- lm(range~volume, data=diff(range_volume["2008/2009"])) summary(reg_model) plot(range~volume, data=diff(range_volume["2010/"])) adf.test(range_volume[, "range"]) adf.test(cumsum(rnorm(nrow(range_volume)))) cor(x=range_volume[, "range"], y=range_volume[, "volume"], method="pearson") cor.test(x=range_volume[, "range"], y=range_volume[, "volume"], method="pearson") cor(x=range_volume[, "range"], y=range_volume[, "volume"], method="kendall") cor.test(x=range_volume[, "range"], y=range_volume[, "volume"], method="kendall") cor(x=range_volume[, "range"], y=range_volume[, "volume"], method="spearman") cor.test(x=range_volume[, "range"], y=range_volume[, "volume"], method="spearman") ##################### ### end temp stuff ### ######################## ### functions ############### # 3. (20pts even without legend) Plot the probability density of DAX returns together with t-distribution returns with four degrees of freedom on a single plot, # plot t-distribution x_var <- seq(-5, 5, length=100) x_var <- seq(-6, -3, length=100) plot(x=x_var, y=dt(x_var, df=4), type="l", lwd=2, xlab="", ylab="", ylim=c(0, 0.03)) # add line for density of DAX returns ts_rets <- 100*diff(log(EuStockMarkets[, 1])) lines(density(ts_rets), col="red", lwd=2) # add legend legend("topright", title="DAX vs t-distr", legend=c("t-distr", "DAX"), inset=0.05, cex=0.8, lwd=2, lty=c(1, 1), col=c("black", "red")) ######################## ### expressions ### while loops ######################## ### dates and times ######################## ### time series ######################## ### stochastic processes ### below are scratch or incorrect - doesn't work properly: ###### # Create a series lagged by one period from "ts_arima", and call it "ts_arima_lag", # The value of "ts_arima_lag" in a given period should be equal to # the value of "ts_arima" in the previous period, # Create a series lagged by two periods from "ts_arima", and call it "ts_arima_lag2", # use function lag() with the proper argument "k", # create ARIMA time series of class "ts" zoo_arima <- arima.sim(n=1000, model=list(ar=c(0.2, 0.3))) # verify that "ts_arima_lag" and "ts_arima_lag2" are correctly lagged by inspecting them, # use functions head() and cbind(), head(cbind(ts_arima, ts_arima_lag, ts_arima_lag2)) tail(cbind(ts_arima, ts_arima_lag, ts_arima_lag2)) ###### # Create a linear combination of "ts_arima_1" and its lag=2 series, and call it "ts_arima_2", # such that the lag=2 autocorrelation of "ts_arima_2" is equal to zero, or is very close to zero, ts_arima_2 <- ts_arima_1 - vec_acf_1[3]*lag(ts_arima_1, k=-2) vec_acf_2 <- drop(acf(ts_arima_2, lag=5, plot=FALSE)$acf) # plot acf_plus(ts_arima_2, lag=5) ###### # Create a linear combination of "zoo_arima" and "zoo_arima_lag", and call it "zoo_arima_1" (decorrelated), # such that its lag=1 autocorrelation coefficient is equal to zero, or is very close to zero, # Extract the lag=5 autocorrelation vector of "zoo_arima_1", and call it "vec_acf_1", # verify that the lag=1 autocorrelation is very close to zero, zoo_arima_1 <- zoo_arima - vec_acf[2]*sd(zoo_arima)*zoo_arima_lag/sd(zoo_arima_lag) vec_acf_1 <- drop(acf(zoo_arima_1, lag=5, plot=FALSE)$acf) # plot acf_plus(zoo_arima_1, lag=5) ########### # classes and inheritance ############### # create new generic function and method for "string" class, based on: "reverse", "trim", "pad", "scramble", # create "stringy" class, derived from "string" class # create new methods for "stringy" class, based on existing generic functions: "length", "+", "print" # create new methods for "stringy" class, based on "string" generic functions: "", "", "" # show that "stringy" inherits methods from "string" class # derive (not create!) new "string" class from "character" object # simply add "string" to class vector as.string <- function(x) { if(!inherits(x, "string")) class(x) <- c("string", class(x)) x # return "x" } # derive (not create!) new "string" class from "character" object # define generic "string" class converter as.string <- function (x, ...) UseMethod("as.string") # default "string" class converter as.string.default <- function (x, ...) { if(!inherits(x, "string")) x <- structure(x, class=c("string", class(x)), ...) x # return "x" } # end as.string.default # numeric "string" class converter as.string.numeric <- function (x, ...) { if(!inherits(x, "string")) x <- structure(as.character(x), class=c("string", class(x)), ...) x # return "x" } # end as.string.numeric is.string <- function (x) inherits(x=x, what="string") # define "string" object obj_string <- as.string("how are you today?") obj_string class(obj_string) is.string(obj_string) is.string("hello") as.string(123) is.string(as.string(123)) # overload "+" function for "string" class "+.string" <- function (a, b, ...) { paste(a, "plus", b) } # end +.string # adds character indices and returns character with index equal to the sum "+.string" <- function (a, b, ...) { in_dex <- (which(letters==substring(a, 1, 1)) + which(letters==substring(b, 1, 1))) %% length(letters) letters[in_dex] } # end +.string methods("+") # view methods for "+" operator string1 <- structure("hello", class="string") string2 <- structure("there", class="string") class(string1) string1 + string2 # add two "string" objects # borrow from "stringr": "check_string", "str_length" # overload "print" function for "string" class print.string <- function (str_ing) { print( paste(strsplit(str_ing, split=" ")[[1]], collapse=" + ")) } # end print.string print(my_string) # define generic "first" function (if not defined by "xts") first <- function (x, ...) UseMethod("first") # define "first" method for "string" class first.string <- function (str_ing, ...) { unclass(substring(str_ing, 1, 1)) } # end first.string first(string1) last.string <- function (str_ing, ...) { unclass(substring(str_ing, nchar(str_ing), nchar(str_ing))) } # end last.string last(string1) ### function that adds "character" class objects add_char <- function (char1, char2) { # test for "character" class and throw error stopifnot(is.character(char1) && is.character(char1)) in_dex <- (which(letters==substr(char1, 1, 1)) + which(letters==substr(char2, 1, 1))) %% length(letters) letters[in_dex] } # end add_char add_char("c", "b") add_char("1", "b") add_char(1, "b") a <- "efg" b <- "opq" add_char(a, b) class(my_stringy) <- c("stringy", "string") "+.stringy" <- function (a, b, ...) { paste(a, "plus", b) } # end +.stringy # create "base5" arithmetic class, derived from "numeric" class # create new methods for "base5" class, based on existing generic functions: "+", "-", "*", "/" baz <- function(x) UseMethod("baz", x) baz.A <- function(x) "A" baz.B <- function(x) "B" ab <- 1 class(ab) <- c("A", "B") ba <- 2 class(ba) <- c("B", "A") ab <- structure(1, class = c("A", "B")) ba <- structure(1, class = c("B", "A")) baz(ab) baz(ba) "+.character" <- function(a, b, ...){ NextMethod() } ################################# ### HW #6 Solution ################################# # Max score 25pts # comment: # Half of the credit for the first part (max 15pts) is from properly calculating # the length (nrow) of the list object, because nrow() returns NULL for one-dimensional objects. # Homework assignment: # 1. (15pts) Create a function called str_ts(), which summarizes time series objects, # The function input is a time series object, # The function should return a named list object with the following information: length (nrow), dimensions, number of rows with bad data, colnames, the object's class, data type, and the first and last rows of data, # The function should validate its argument, and throw an error if it's not a time series object, str_ts <- function(ts_series=NULL) { # check if argument is a time series object stopifnot(is.ts(ts_series) || is.zoo(ts_series)) # create list and return it list( length=ifelse(is.null(nrow(ts_series)), length(ts_series), nrow(ts_series)), dim=dim(ts_series), bad_data=sum(!complete.cases(ts_series)), col_names=colnames(ts_series), ts_class=class(ts_series), ts_type=typeof(ts_series), first_row=head(ts_series, 1), last_row=tail(ts_series, 1) ) # end list } # end str_ts # 2. (10pts) Create a synthetic zoo time series of prices with two named columns, based on random returns equal to "rnorm", # Introduce a few NA values into the time series, and call str_ts() on this time series, library(zoo) # load package zoo ts_var <- zoo(matrix(rnorm(20), ncol=2), order.by=(Sys.Date() - 1:10)) colnames(ts_var) <- paste0("col", 1:2) ts_var[3, 1] <- NA ts_var[6, 2] <- NA str_ts(ts_var)
snp_data <- fread("snp_data.csv", verbose = FALSE) %>% tbl_df() my_portfolio <- data_frame( stock_name = c("AAPL", "GOOG", "SBUX", "NKE"), volume = c(1000, 1000, 1000, 1000) ) function(input, output) { my_portfolio <- reactiveValues(data = data_frame( ticker = c("AAPL", "GOOG", "SBUX", "NKE"), volume = c(1000, 1000, 1000, 1000) )) value_portfolio <- function(portfolio_data) { snp_data %>% filter( Date == max(Date) ) %>% right_join(portfolio_data, by = c("Ticker" = "ticker")) %>% mutate( value = Close * volume ) %>% select( Name, volume, value ) } output$portfolio_tbl <- DT::renderDataTable({ my_portfolio$data %>% value_portfolio() %>% DT::datatable(rownames = FALSE, options = list(searching = FALSE), colnames = c("Stock", "Volume", "Value") ) %>% formatCurrency("value") }) }
/server.r
no_license
DrRoad/portfolio_optimization_app
R
false
false
1,078
r
snp_data <- fread("snp_data.csv", verbose = FALSE) %>% tbl_df() my_portfolio <- data_frame( stock_name = c("AAPL", "GOOG", "SBUX", "NKE"), volume = c(1000, 1000, 1000, 1000) ) function(input, output) { my_portfolio <- reactiveValues(data = data_frame( ticker = c("AAPL", "GOOG", "SBUX", "NKE"), volume = c(1000, 1000, 1000, 1000) )) value_portfolio <- function(portfolio_data) { snp_data %>% filter( Date == max(Date) ) %>% right_join(portfolio_data, by = c("Ticker" = "ticker")) %>% mutate( value = Close * volume ) %>% select( Name, volume, value ) } output$portfolio_tbl <- DT::renderDataTable({ my_portfolio$data %>% value_portfolio() %>% DT::datatable(rownames = FALSE, options = list(searching = FALSE), colnames = c("Stock", "Volume", "Value") ) %>% formatCurrency("value") }) }
#' Title: Read TXT files #' Purpose: Read .txt #' Author: Ted Kwartler #' email: edwardkwartler@fas.harvard.edu #' License: GPL>=3 #' Date: Dec 29 2020 #' # Read in a txt file (change this to your file) txt1 <- readLines('https://raw.githubusercontent.com/kwartler/GSERM_TextMining/cacd1d9131fef31309d673b24e744a6fee54269d/E_Friday/data/clinton/C05758905.txt') # Examine txt1 # Collapse all lines to make it like a single giant document txt2 <- paste(txt1, collapse = ' ') # split on a string "Doc No." to demonstrate getting a single document to # individual documents indDocs <- strsplit(txt2, "Doc No.") # The result is a list object so can be worked with this way indDocs[[1]][1] # first doc indDocs[[1]][2] # second doc indDocs[[1]][3] # third doc # or "unlist" the object, but this can be challenging if the list is complex indDocs <- unlist(indDocs) indDocs[1] # first Doc indDocs[2] #second doc indDocs[3] #third doc # End
/lessons/oct22/scripts/E_readTXT_LIVE.R
no_license
Fstips/LUX_NLP_student
R
false
false
940
r
#' Title: Read TXT files #' Purpose: Read .txt #' Author: Ted Kwartler #' email: edwardkwartler@fas.harvard.edu #' License: GPL>=3 #' Date: Dec 29 2020 #' # Read in a txt file (change this to your file) txt1 <- readLines('https://raw.githubusercontent.com/kwartler/GSERM_TextMining/cacd1d9131fef31309d673b24e744a6fee54269d/E_Friday/data/clinton/C05758905.txt') # Examine txt1 # Collapse all lines to make it like a single giant document txt2 <- paste(txt1, collapse = ' ') # split on a string "Doc No." to demonstrate getting a single document to # individual documents indDocs <- strsplit(txt2, "Doc No.") # The result is a list object so can be worked with this way indDocs[[1]][1] # first doc indDocs[[1]][2] # second doc indDocs[[1]][3] # third doc # or "unlist" the object, but this can be challenging if the list is complex indDocs <- unlist(indDocs) indDocs[1] # first Doc indDocs[2] #second doc indDocs[3] #third doc # End
# see https://stats.stackexchange.com/a/67450 # for more on this calc_score <- function(odds, base_odds = 50, base_score = 650, pdo = 15, upper_limit = 1000, lower_limit = 0) { # scale: scale_factor <- pdo / log(2) # intercept: intercept <- base_score - log(base_odds) * scale_factor # score: raw_score <- intercept + scale_factor * log(odds) # clip and integer the score: as.integer(pmax(pmin(raw_score, upper_limit), lower_limit)) }
/src/score_function_example.R
no_license
Johnwood118/eds_modelling
R
false
false
594
r
# see https://stats.stackexchange.com/a/67450 # for more on this calc_score <- function(odds, base_odds = 50, base_score = 650, pdo = 15, upper_limit = 1000, lower_limit = 0) { # scale: scale_factor <- pdo / log(2) # intercept: intercept <- base_score - log(base_odds) * scale_factor # score: raw_score <- intercept + scale_factor * log(odds) # clip and integer the score: as.integer(pmax(pmin(raw_score, upper_limit), lower_limit)) }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/paws.cloudfront_operations.R \name{create_streaming_distribution_with_tags} \alias{create_streaming_distribution_with_tags} \title{Create a new streaming distribution with tags} \usage{ create_streaming_distribution_with_tags(StreamingDistributionConfigWithTags) } \arguments{ \item{StreamingDistributionConfigWithTags}{[required] The streaming distribution's configuration information.} } \description{ Create a new streaming distribution with tags. } \section{Accepted Parameters}{ \preformatted{create_streaming_distribution_with_tags( StreamingDistributionConfigWithTags = list( StreamingDistributionConfig = list( CallerReference = "string", S3Origin = list( DomainName = "string", OriginAccessIdentity = "string" ), Aliases = list( Quantity = 123, Items = list( "string" ) ), Comment = "string", Logging = list( Enabled = TRUE|FALSE, Bucket = "string", Prefix = "string" ), TrustedSigners = list( Enabled = TRUE|FALSE, Quantity = 123, Items = list( "string" ) ), PriceClass = "PriceClass_100"|"PriceClass_200"|"PriceClass_All", Enabled = TRUE|FALSE ), Tags = list( Items = list( list( Key = "string", Value = "string" ) ) ) ) ) } }
/service/paws.cloudfront/man/create_streaming_distribution_with_tags.Rd
permissive
CR-Mercado/paws
R
false
true
1,476
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/paws.cloudfront_operations.R \name{create_streaming_distribution_with_tags} \alias{create_streaming_distribution_with_tags} \title{Create a new streaming distribution with tags} \usage{ create_streaming_distribution_with_tags(StreamingDistributionConfigWithTags) } \arguments{ \item{StreamingDistributionConfigWithTags}{[required] The streaming distribution's configuration information.} } \description{ Create a new streaming distribution with tags. } \section{Accepted Parameters}{ \preformatted{create_streaming_distribution_with_tags( StreamingDistributionConfigWithTags = list( StreamingDistributionConfig = list( CallerReference = "string", S3Origin = list( DomainName = "string", OriginAccessIdentity = "string" ), Aliases = list( Quantity = 123, Items = list( "string" ) ), Comment = "string", Logging = list( Enabled = TRUE|FALSE, Bucket = "string", Prefix = "string" ), TrustedSigners = list( Enabled = TRUE|FALSE, Quantity = 123, Items = list( "string" ) ), PriceClass = "PriceClass_100"|"PriceClass_200"|"PriceClass_All", Enabled = TRUE|FALSE ), Tags = list( Items = list( list( Key = "string", Value = "string" ) ) ) ) ) } }
# These functions create a special "matrix" from a user supplied matrix, that # can be cached, and then computes the inverse. If the inverse is already # available in cache data, it returs the cached inverse and lets the user know cacheSolve <- function(x,...){ ## Return a matrix that is the inverse of 'x' m <- x$get_inv() if(!is.null(m)){ message("getting cached data") return(m) } data <-x$get() m <-solve(data) x$set_inv(m) m }
/cacheSolve.R
no_license
irganomix/Peer-graded-Assignment-Programming-Assignment-2-Lexical-Scoping
R
false
false
486
r
# These functions create a special "matrix" from a user supplied matrix, that # can be cached, and then computes the inverse. If the inverse is already # available in cache data, it returs the cached inverse and lets the user know cacheSolve <- function(x,...){ ## Return a matrix that is the inverse of 'x' m <- x$get_inv() if(!is.null(m)){ message("getting cached data") return(m) } data <-x$get() m <-solve(data) x$set_inv(m) m }
############################################# #Packae is liscnesed by # # KrewnSolotions /< /? [- \/\/ |\| # ############################################# #http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3258155/ m8 <- function(data1){ Cq <- list() Eff <- list() F0 <- list() for(k in 2:length(data1)) { tryCatch({ Cq[[k-1]] <- which.max(diff(diff(data1[[k]]))) #second derviative maximum Eff[[k-1]] <- data1[[k]][[Cq[[k-1]]]]/data1[[k]][[Cq[[k-1]]-1]] F0[[k-1]] <- (data1[[k]][[Cq[[k-1]]]])/((Eff[[k-1]])^Cq[[k-1]]) if(k == 10) { print(data1[[k]]) print(Cq[[k-1]]) print(F0[[k-1]]) } }, error = function(err) { F0[[k-1]] <- 1 }) } printSHIT(F0,"Method: 5PSM", paste("Chamber ID", "Initial Template Fluorescence", sep=","), "5PSM_FULL.ddv") tempCont <- list() tempCounter <- 1 smallFluo <- list() tempCont[[1]] <- "Method: 5PSM" tempCont[[2]] <- paste("Chamber ID", "Initial Template Fluorescence") for(k in 1:length(F0)) { tryCatch({ if(CT[[k]] > 0) { temp223 <- paste(gd[[1]][[2]][[k+2]][1], gd[[1]][[2]][[k+2]][2], sep="-") tempCont[[tempCounter+2]] <- paste(temp223, F0[[k]], sep=",") smallFluo[[tempCounter]] <- F0[[k]] tempCounter <- tempCounter + 1 } }, error = function(err) { }) } writeLines(LOLprint(tempCont), "5PSM.ddv") return(smallFluo) }
/m8.R
permissive
requiem3/Rqpcr
R
false
false
1,733
r
############################################# #Packae is liscnesed by # # KrewnSolotions /< /? [- \/\/ |\| # ############################################# #http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3258155/ m8 <- function(data1){ Cq <- list() Eff <- list() F0 <- list() for(k in 2:length(data1)) { tryCatch({ Cq[[k-1]] <- which.max(diff(diff(data1[[k]]))) #second derviative maximum Eff[[k-1]] <- data1[[k]][[Cq[[k-1]]]]/data1[[k]][[Cq[[k-1]]-1]] F0[[k-1]] <- (data1[[k]][[Cq[[k-1]]]])/((Eff[[k-1]])^Cq[[k-1]]) if(k == 10) { print(data1[[k]]) print(Cq[[k-1]]) print(F0[[k-1]]) } }, error = function(err) { F0[[k-1]] <- 1 }) } printSHIT(F0,"Method: 5PSM", paste("Chamber ID", "Initial Template Fluorescence", sep=","), "5PSM_FULL.ddv") tempCont <- list() tempCounter <- 1 smallFluo <- list() tempCont[[1]] <- "Method: 5PSM" tempCont[[2]] <- paste("Chamber ID", "Initial Template Fluorescence") for(k in 1:length(F0)) { tryCatch({ if(CT[[k]] > 0) { temp223 <- paste(gd[[1]][[2]][[k+2]][1], gd[[1]][[2]][[k+2]][2], sep="-") tempCont[[tempCounter+2]] <- paste(temp223, F0[[k]], sep=",") smallFluo[[tempCounter]] <- F0[[k]] tempCounter <- tempCounter + 1 } }, error = function(err) { }) } writeLines(LOLprint(tempCont), "5PSM.ddv") return(smallFluo) }
dhist <- function(x,fac,col,legend,pos.legend,title.legend=NULL,lab.legend=NULL,xlab,ylab=NULL, drawextaxes=TRUE,drawintaxes=FALSE,xlim=NULL,...) { ymax <- integer(nlevels(fac)) for (i in 1:nlevels(fac)) { ymax[i] <- max(density(x[as.numeric(fac)==i])$y) } h <- suppressWarnings(hist(x,freq=FALSE,plot=FALSE)) oldmar <- par()$mar if (is.null(ylab)) {ylab="Probability density"} if (!drawextaxes) {par(mar=c(3.1,2.1,2.1,0.1))} xlim <- if(!is.null(xlim)) {xlim} else {range(h$breaks)} plot(0,xlim=xlim,ylim=c(0,max(ymax)),xlab="",ylab="",cex=0,axes=FALSE,...) if(drawextaxes) { axis(1) axis(2) } if (drawintaxes) {abline(v=0,col="grey")} lab.line <- c(ifelse(drawextaxes,3,1.2),ifelse(drawextaxes,3,0.6)) mtext(c(xlab,ylab),side=c(1,2),line=lab.line,at=c(mean(range(x)),mean(c(0,max(ymax))))) dens <- tapply(x,fac,function(x) density(x)) if (!is.numeric(col)) { col3 <- col4 <- col } else { col2 <- col2rgb(palette()[col]) col3 <- apply(col2,2,function(x) rgb(x[1],x[2],x[3],alpha=0.4*255,maxColorValue=255)) col4 <- apply(col2,2,function(x) rgb(x[1],x[2],x[3],alpha=255,maxColorValue=255)) } for (i in 1:nlevels(fac)) { d <- dens[[i]] polygon(d$x,d$y,col=col3[i],border=NA) rug(x[as.numeric(fac)==i],col=col4[i]) } box() if (legend) { if (is.null(lab.legend)) {lab.legend <- levels(fac)} if (!is.null(title.legend) && nchar(title.legend)>0) { legend(pos.legend,lab.legend,fill=col3,title=title.legend) } else { legend(pos.legend,lab.legend,fill=col3) } } par(mar=oldmar) }
/R/dhist.R
no_license
SeptiawanAjiP/RVAideMemoire
R
false
false
1,625
r
dhist <- function(x,fac,col,legend,pos.legend,title.legend=NULL,lab.legend=NULL,xlab,ylab=NULL, drawextaxes=TRUE,drawintaxes=FALSE,xlim=NULL,...) { ymax <- integer(nlevels(fac)) for (i in 1:nlevels(fac)) { ymax[i] <- max(density(x[as.numeric(fac)==i])$y) } h <- suppressWarnings(hist(x,freq=FALSE,plot=FALSE)) oldmar <- par()$mar if (is.null(ylab)) {ylab="Probability density"} if (!drawextaxes) {par(mar=c(3.1,2.1,2.1,0.1))} xlim <- if(!is.null(xlim)) {xlim} else {range(h$breaks)} plot(0,xlim=xlim,ylim=c(0,max(ymax)),xlab="",ylab="",cex=0,axes=FALSE,...) if(drawextaxes) { axis(1) axis(2) } if (drawintaxes) {abline(v=0,col="grey")} lab.line <- c(ifelse(drawextaxes,3,1.2),ifelse(drawextaxes,3,0.6)) mtext(c(xlab,ylab),side=c(1,2),line=lab.line,at=c(mean(range(x)),mean(c(0,max(ymax))))) dens <- tapply(x,fac,function(x) density(x)) if (!is.numeric(col)) { col3 <- col4 <- col } else { col2 <- col2rgb(palette()[col]) col3 <- apply(col2,2,function(x) rgb(x[1],x[2],x[3],alpha=0.4*255,maxColorValue=255)) col4 <- apply(col2,2,function(x) rgb(x[1],x[2],x[3],alpha=255,maxColorValue=255)) } for (i in 1:nlevels(fac)) { d <- dens[[i]] polygon(d$x,d$y,col=col3[i],border=NA) rug(x[as.numeric(fac)==i],col=col4[i]) } box() if (legend) { if (is.null(lab.legend)) {lab.legend <- levels(fac)} if (!is.null(title.legend) && nchar(title.legend)>0) { legend(pos.legend,lab.legend,fill=col3,title=title.legend) } else { legend(pos.legend,lab.legend,fill=col3) } } par(mar=oldmar) }
### MIDTERM ### #1 setwd("C:/Users/Marie/Documents/Schools/The New School/Data Visualization/Assignment 3") titanic <- read.csv("titanic.txt") #2. Embarkation ForGraph <- titanic[(titanic$Embarked == '') == FALSE , ] ForGraph$Embarked.f <- factor(ForGraph$Embarked) levels(ForGraph$Embarked.f) <- c("Cherbourg FR", "Queenstown IRE", "Southampton UK") ForGraph$Embarked.f2 <- factor(ForGraph$Embarked.f, levels = c("Southampton UK", "Cherbourg FR", "Queenstown IRE")) #3. Survived ForGraph$Survived.f <- factor(ForGraph$Survived, labels = c("Non-Survivors", "Survivors")) ForGraph$Survived.f2 <- factor(ForGraph$Survived.f, levels = c("Survivors", "Non-Survivors")) #4. Sex levels(ForGraph$Sex) <- c("Female", "Male") #5. Pclass ForGraph$Pclass.f <- factor(ForGraph$Pclass, labels = c("1st Class", "2nd Class", "3rd Class")) #6. Plot Setup library(ggplot2) library(scales) library(gridExtra) #7. Plotting p <- ggplot(ForGraph, aes(x = Sex, fill = Pclass.f))+ geom_bar(aes(y=(..count..)/sum(..count..)), position="dodge", colour="black")+ scale_y_continuous(labels = percent_format(), breaks = c(0.05, 0.10, 0.15, 0.20, 0.25))+ facet_grid(Survived.f2 ~ Embarked.f2)+ labs(fill = "Passenger Class")+ ylab ("% of Total Passengers")+ ggtitle("TITANIC: Survival Rate by Point of Embarkation, Sex & Class \nby Marie Bakke")+ scale_fill_manual(values=c("#FF3399", "#33FFCC", "#FF3300"))+ theme(panel.background = element_rect(fill = "#FFFFFF", colour = "grey"), panel.grid.major.y = element_line(colour = "grey"), panel.grid.minor.y = element_blank(), panel.grid.major.x = element_blank(), panel.grid.minor.x = element_blank(), axis.text.x = element_text(colour = "black"), axis.text.y = element_text(colour = "black"))+ theme(strip.background = element_rect(fill = "#FFFF99", colour = "grey")) p g <- arrangeGrob(p, sub = textGrob("Footnote: Two observations are removed due to lack of data.", x = 0, hjust = -0.1, vjust=0.1, gp = gpar(fontface = "italic", fontsize = 8))) g
/Assignments/midterm/bakke.R
no_license
aaronxhill/dataviz14f
R
false
false
2,043
r
### MIDTERM ### #1 setwd("C:/Users/Marie/Documents/Schools/The New School/Data Visualization/Assignment 3") titanic <- read.csv("titanic.txt") #2. Embarkation ForGraph <- titanic[(titanic$Embarked == '') == FALSE , ] ForGraph$Embarked.f <- factor(ForGraph$Embarked) levels(ForGraph$Embarked.f) <- c("Cherbourg FR", "Queenstown IRE", "Southampton UK") ForGraph$Embarked.f2 <- factor(ForGraph$Embarked.f, levels = c("Southampton UK", "Cherbourg FR", "Queenstown IRE")) #3. Survived ForGraph$Survived.f <- factor(ForGraph$Survived, labels = c("Non-Survivors", "Survivors")) ForGraph$Survived.f2 <- factor(ForGraph$Survived.f, levels = c("Survivors", "Non-Survivors")) #4. Sex levels(ForGraph$Sex) <- c("Female", "Male") #5. Pclass ForGraph$Pclass.f <- factor(ForGraph$Pclass, labels = c("1st Class", "2nd Class", "3rd Class")) #6. Plot Setup library(ggplot2) library(scales) library(gridExtra) #7. Plotting p <- ggplot(ForGraph, aes(x = Sex, fill = Pclass.f))+ geom_bar(aes(y=(..count..)/sum(..count..)), position="dodge", colour="black")+ scale_y_continuous(labels = percent_format(), breaks = c(0.05, 0.10, 0.15, 0.20, 0.25))+ facet_grid(Survived.f2 ~ Embarked.f2)+ labs(fill = "Passenger Class")+ ylab ("% of Total Passengers")+ ggtitle("TITANIC: Survival Rate by Point of Embarkation, Sex & Class \nby Marie Bakke")+ scale_fill_manual(values=c("#FF3399", "#33FFCC", "#FF3300"))+ theme(panel.background = element_rect(fill = "#FFFFFF", colour = "grey"), panel.grid.major.y = element_line(colour = "grey"), panel.grid.minor.y = element_blank(), panel.grid.major.x = element_blank(), panel.grid.minor.x = element_blank(), axis.text.x = element_text(colour = "black"), axis.text.y = element_text(colour = "black"))+ theme(strip.background = element_rect(fill = "#FFFF99", colour = "grey")) p g <- arrangeGrob(p, sub = textGrob("Footnote: Two observations are removed due to lack of data.", x = 0, hjust = -0.1, vjust=0.1, gp = gpar(fontface = "italic", fontsize = 8))) g
# Sepal.Length 값을 예측하는 회귀분석 수행 reg_model <- lm(Sepal.Length ~ ., data=iris) reg_model$coefficients # 계수 reg_model$residuals # 잔차 summary(reg_model) # 회귀분석 결과 정보 # p-value < 0.01이므로 유의미한 모델 # 예측 predict(reg_model)
/R/Machine_Learning_Linear_Regression_Basic.R
no_license
nuno1111/Bigdata-ML-Source
R
false
false
290
r
# Sepal.Length 값을 예측하는 회귀분석 수행 reg_model <- lm(Sepal.Length ~ ., data=iris) reg_model$coefficients # 계수 reg_model$residuals # 잔차 summary(reg_model) # 회귀분석 결과 정보 # p-value < 0.01이므로 유의미한 모델 # 예측 predict(reg_model)
#' Filter predictors according to specified criteria. #' #' @param traindata the train set #' @param testdata the test set #' @param y the response variable. Must be not \code{NULL} if \code{correlationThreshold} is not \code{NULL}. #' @param removeOnlyZeroVariacePredictors \code{TRUE} to remove only zero variance predictors #' @param performVarianceAnalysisOnTrainSetOnly \code{TRUE} to perform the variance analysis on the train set only #' @param correlationThreshold a correlation threshold above which keeping predictors #' (considered only if \code{removeOnlyZeroVariacePredictors} is \code{FALSE}). #' @param removePredictorsMakingIllConditionedSquareMatrix \code{TRUE} to predictors making ill conditioned square matrices #' @param removeHighCorrelatedPredictors \code{TRUE} to remove high correlared predictors #' @param removeIdenticalPredictors \code{TRUE} to remove identical predictors (using \code{base::identical} function) #' @param featureScaling \code{TRUE} to perform feature scaling #' @param verbose \code{TRUE} to set verbose mode #' #' @examples #' Xtrain <- data.frame( a = rep(1:3 , each = 2), b = c(4:1,6,6), c = rep(1,6)) #' Xtest <- Xtrain + runif(nrow(Xtrain)) #' l = ff.featureFilter (traindata = Xtrain, #' testdata = Xtest, #' removeOnlyZeroVariacePredictors=TRUE) #' Xtrain = l$traindata #' Xtest = l$testdata #' @importFrom caret preProcess #' @importFrom caret nearZeroVar #' @importFrom subselect trim.matrix #' @export #' @return the list of trainset and testset after applying the specified filters #' ff.featureFilter <- function(traindata, testdata, y = NULL, removeOnlyZeroVariacePredictors=FALSE, performVarianceAnalysisOnTrainSetOnly = TRUE , correlationThreshold = NULL, removePredictorsMakingIllConditionedSquareMatrix = TRUE, removeIdenticalPredictors = TRUE, removeHighCorrelatedPredictors = TRUE, featureScaling = TRUE, verbose = TRUE) { stopifnot( ! (is.null(testdata) && is.null(traindata)) ) stopifnot( ! (removeOnlyZeroVariacePredictors && (! is.null(correlationThreshold))) ) stopifnot( ! (is.null(y) && (! is.null(correlationThreshold))) ) data = rbind(testdata,traindata) ### removing near zero var predictors if (! removeOnlyZeroVariacePredictors ) { PredToDel = NULL if (performVarianceAnalysisOnTrainSetOnly) { if (verbose) cat(">>> applying caret nearZeroVar performing caret nearZeroVar function on train set only ... \n") PredToDel = caret::nearZeroVar(traindata) } else { if (verbose) cat(">>> applying caret nearZeroVar performing caret nearZeroVar function on both train set and test set ... \n") PredToDel = caret::nearZeroVar(data) } if (! is.null(correlationThreshold) ) { if (verbose) cat(">>> computing correlation ... \n") corrValues <- apply(traindata, MARGIN = 2, FUN = function(x, y) cor(x, y), y = y) PredToReinsert = as.numeric(which(! is.na(corrValues) & corrValues > correlationThreshold)) if (verbose) cat(">> There are high correlated predictors with response variable. N. ",length(PredToReinsert)," - predictors: ", paste(colnames(data) [PredToReinsert] , collapse=" " ) , " ... \n ") PredToDel = PredToDel[! PredToDel %in% PredToReinsert] } if (length(PredToDel) > 0) { if (verbose) cat("removing ",length(PredToDel)," nearZeroVar predictors: ", paste(colnames(data) [PredToDel] , collapse=" " ) , " ... \n ") data = data [,-PredToDel,drop=F] } } else { if (verbose) cat(">>> removing zero variance predictors only ... \n") card = NULL if (performVarianceAnalysisOnTrainSetOnly) { if (verbose) cat(">>> removing zero variance predictors performing variance analysis on train set only ... \n") card = apply(traindata,2,function(x) length(unique(x)) ) } else { if (verbose) cat(">>> removing zero variance predictors performing variance analysis on both train set and test set ... \n") card = apply(data,2,function(x) length(unique(x)) ) } PredToDel = as.numeric(which(card < 2)) if (length(PredToDel) > 0) { if (verbose) cat("removing ",length(PredToDel)," ZeroVariacePredictors predictors: ", paste(colnames(data) [PredToDel] , collapse=" " ) , " ... \n ") data = data [,-PredToDel,drop=F] } } ### removing predictors that make ill-conditioned square matrix if (removePredictorsMakingIllConditionedSquareMatrix) { if (verbose) cat(">>> finding for predictors that make ill-conditioned square matrix ... \n") PredToDel = subselect::trim.matrix( cov( data ) ) if (length(PredToDel$numbers.discarded) > 0) { if (verbose) cat("removing ",length(PredToDel$numbers.discarded)," predictors that make ill-conditioned square matrix: ", paste(colnames(data) [PredToDel$numbers.discarded] , collapse=" " ) , " ... \n ") data = data [,-PredToDel$numbers.discarded,drop=F] } } ## removing identical predictors if (removeIdenticalPredictors) { colToRemove = rep(F,ncol(data)) lapply( 1:(ncol(data)-1) , function(i) { lapply( (i+1):ncol(data) ,function(j) { if (identical(data[,i],data[,j])) { colToRemove[j] <<- T } }) }) if (sum(colToRemove) > 0) { if (verbose) cat("removing ",sum(colToRemove)," identical predictors: ", paste(colnames(data) [colToRemove] , collapse=" " ) , " ... \n ") data = data[,-which(colToRemove),drop=F] } } # removing high correlated predictors if (removeHighCorrelatedPredictors) { if (verbose) cat(">>> finding for high correlated predictors ... \n") PredToDel = caret::findCorrelation(cor( data )) if (length(PredToDel) > 0) { if (verbose) cat("removing ",length(PredToDel), " removing high correlated predictors: ", paste(colnames(data) [PredToDel] , collapse=" " ) , " ... \n ") data = data [,-PredToDel,drop=F] } } ## feature scaling if (featureScaling) { if (verbose) cat(">>> feature scaling ... \n") scaler = caret::preProcess(data,method = c("center","scale")) data = predict(scaler,data) } ## reassembling if ( ! is.null(testdata) && ! is.null(traindata) ) { testdata = data[1:(dim(testdata)[1]),] traindata = data[((dim(testdata)[1])+1):(dim(data)[1]),] } else if (is.null(testdata)) { traindata = data } else if (is.null(traindata)) { testdata = data } return(list(traindata = traindata,testdata = testdata)) } #' Make polynomial terms of a \code{data.frame} #' #' @param x a \code{data.frame} of \code{numeric} #' @param n the polynomial degree #' @param direction if set to \code{0} returns the terms \code{x^(1/n),x^(1/(n-1)),...,x,x^2,...,x^n}. #' If set to \code{-1} returns the terms \code{x^(1/n),x^(1/(n-1)),...,x}. #' If set to \code{1} returns the terms \code{x,x^2,...,x^n}. #' #' @examples #' Xtrain <- data.frame( a = rep(1:3 , each = 2), b = c(4:1,6,6), c = rep(1,6)) #' Xtest <- Xtrain + runif(nrow(Xtrain)) #' data = rbind(Xtrain,Xtest) #' data.poly = ff.poly(x=data,n=3) #' Xtrain.poly = data.poly[1:nrow(Xtrain),] #' Xtest.poly = data.poly[(nrow(Xtrain)+1):nrow(data),] #' @export #' @return the \code{data.frame} with the specified polynomial terms #' ff.poly = function (x,n,direction=0) { stopifnot(identical(class(x),'data.frame') , identical(class(n),'numeric') ) stopifnot( sum(unlist(lapply(x,function(x) { return(! (is.atomic(x) && (! is.character(x)) && ! is.factor(x)) ) }))) == 0 ) if (n == 1) { return (x) } x.poly = NULL x.poly.2 = NULL ## if (direction>=0) { x.poly = as.data.frame(matrix(rep(0 , nrow(x)*ncol(x)*(n-1)) , nrow = nrow(x))) lapply(2:n,function(i){ d = x d[] <- lapply(X = x , FUN = function(x){ return(x^i) }) colnames(d) = paste(colnames(x),'^',i,sep='') x.poly[,((i-2)*ncol(x)+1):((i-1)*ncol(x))] <<- d colnames(x.poly)[((i-2)*ncol(x)+1):((i-1)*ncol(x))] <<- colnames(d) }) } ## if (direction<=0) { x.poly.2 = as.data.frame(matrix(rep(0 , nrow(x)*ncol(x)*(n-1)) , nrow = nrow(x))) lapply(2:n,function(i){ d = x d[] <- lapply(X = x , FUN = function(x){ return(x^(1/i)) }) colnames(d) = paste(colnames(x),'^1/',i,sep='') x.poly.2[,((i-2)*ncol(x)+1):((i-1)*ncol(x))] <<- d colnames(x.poly.2)[((i-2)*ncol(x)+1):((i-1)*ncol(x))] <<- colnames(d) }) } ## if (direction>0) { return (cbind(x,x.poly)) } else if (direction==0) { return (cbind(x,x.poly,x.poly.2)) } else { return (cbind(x,x.poly.2)) } } #' Filter a \code{data.frame} of numeric according to a given threshold of correlation #' #' @param Xtrain a train set \code{data.frame} of \code{numeric} #' @param Xtest a test set \code{data.frame} of \code{numeric} #' @param y the output variable (as numeric vector) #' @param method a character string indicating which correlation method is to be used for the test. One of "pearson", "kendall", or "spearman". #' @param abs_th an absolute threshold (= number of data frame columns) #' @param rel_th a relative threshold (= percentage of data frame columns) #' #' @examples #' Xtrain <- data.frame( a = rep(1:3 , each = 2), b = c(4:1,6,6), c = rep(1,6)) #' Xtest <- Xtrain + runif(nrow(Xtrain)) #' y = 1:6 #' l = ff.corrFilter(Xtrain=Xtrain,Xtest=Xtest,y=y,rel_th=0.5) #' Xtrain.filtered = l$Xtrain #' Xtest.filtered =l$Xtest #' @export #' @return a \code{list} of filtered train set and test set with correlation test results #' ff.corrFilter = function(Xtrain,Xtest,y,abs_th=NULL,rel_th=1,method = 'pearson') { warn_def = getOption('warn') options(warn=-1) #### stopifnot(is.null(rel_th) || is.null(abs_th)) if (! is.null(rel_th) ) stopifnot( rel_th >0 && rel_th <=1 ) if (! is.null(abs_th) ) stopifnot( abs_th >0 && abs_th <=ncol(Xtrain) ) stopifnot( ! (is.null(Xtrain) || is.null(Xtest)) ) stopifnot( ncol(Xtrain) == ncol(Xtest) ) stopifnot( ncol(Xtrain) > 0 ) stopifnot( nrow(Xtrain) > 0 ) stopifnot( nrow(Xtest) > 0 ) stopifnot( sum(unlist(lapply(Xtrain,function(x) { return(! (is.atomic(x) && ! is.character(x) && ! is.factor(x))) }))) == 0 ) stopifnot( sum(unlist(lapply(Xtest,function(x) { return(! (is.atomic(x) && ! is.character(x) && ! is.factor(x))) }))) == 0 ) stopifnot(identical(method,'pearson') || identical(method,'kendall') || identical(method,'spearman')) ### TypeIError test getPvalueTypeIError = function(x,y) { test = method pvalue = NULL estimate = NULL interpretation = NULL ### pearson / kendall / spearman test.corr = cor.test(x = x , y = y , method = method) pvalue = test.corr$p.value estimate = test.corr$estimate if (pvalue < 0.05) { interpretation = 'there is correlation' } else { interpretation = 'data do not give you any reason to conclude that the correlation is real' } return(list(test=test,pvalue=pvalue,estimate=estimate,interpretation=interpretation)) } ## int_rel_th = abs_th if (! is.null(rel_th) ) { int_rel_th = floor(ncol(Xtrain) * rel_th) } ## corr analysis aa = lapply(Xtrain , function(x) { dummy = list( test = method, pvalue=1, estimate = 0, interpretation = "error") setNames(object = dummy , nm = names(x)) ret = plyr::failwith( dummy, getPvalueTypeIError , quiet = TRUE)(x=x,y=y) return (ret) }) ## make data frame test results aadf = data.frame(predictor = rep(NA,length(aa)) , test = rep(NA,length(aa)) , pvalue = rep(NA,length(aa)) , estimate = rep(NA,length(aa)) , interpretation = rep(NA,length(aa))) lapply(seq_along(aa) , function(i) { aadf[i,]$predictor <<- names(aa[i]) aadf[i,]$test <<- aa[[i]]$test aadf[i,]$pvalue <<- aa[[i]]$pvalue aadf[i,]$estimate <<- aa[[i]]$estimate aadf[i,]$interpretation <<- aa[[i]]$interpretation }) aadf = aadf[order(abs(aadf$estimate) , decreasing = T), ] ## cut to the given threshold aadf_cut = aadf[1:int_rel_th,,drop=F] options(warn=warn_def) return(list( Xtrain = Xtrain[,aadf_cut$predictor,drop=F], Xtest = Xtest[,aadf_cut$predictor,drop=F], test.results = aadf )) }
/R-package/R/featureFilter.R
permissive
fxcebx/fast-furious
R
false
false
12,921
r
#' Filter predictors according to specified criteria. #' #' @param traindata the train set #' @param testdata the test set #' @param y the response variable. Must be not \code{NULL} if \code{correlationThreshold} is not \code{NULL}. #' @param removeOnlyZeroVariacePredictors \code{TRUE} to remove only zero variance predictors #' @param performVarianceAnalysisOnTrainSetOnly \code{TRUE} to perform the variance analysis on the train set only #' @param correlationThreshold a correlation threshold above which keeping predictors #' (considered only if \code{removeOnlyZeroVariacePredictors} is \code{FALSE}). #' @param removePredictorsMakingIllConditionedSquareMatrix \code{TRUE} to predictors making ill conditioned square matrices #' @param removeHighCorrelatedPredictors \code{TRUE} to remove high correlared predictors #' @param removeIdenticalPredictors \code{TRUE} to remove identical predictors (using \code{base::identical} function) #' @param featureScaling \code{TRUE} to perform feature scaling #' @param verbose \code{TRUE} to set verbose mode #' #' @examples #' Xtrain <- data.frame( a = rep(1:3 , each = 2), b = c(4:1,6,6), c = rep(1,6)) #' Xtest <- Xtrain + runif(nrow(Xtrain)) #' l = ff.featureFilter (traindata = Xtrain, #' testdata = Xtest, #' removeOnlyZeroVariacePredictors=TRUE) #' Xtrain = l$traindata #' Xtest = l$testdata #' @importFrom caret preProcess #' @importFrom caret nearZeroVar #' @importFrom subselect trim.matrix #' @export #' @return the list of trainset and testset after applying the specified filters #' ff.featureFilter <- function(traindata, testdata, y = NULL, removeOnlyZeroVariacePredictors=FALSE, performVarianceAnalysisOnTrainSetOnly = TRUE , correlationThreshold = NULL, removePredictorsMakingIllConditionedSquareMatrix = TRUE, removeIdenticalPredictors = TRUE, removeHighCorrelatedPredictors = TRUE, featureScaling = TRUE, verbose = TRUE) { stopifnot( ! (is.null(testdata) && is.null(traindata)) ) stopifnot( ! (removeOnlyZeroVariacePredictors && (! is.null(correlationThreshold))) ) stopifnot( ! (is.null(y) && (! is.null(correlationThreshold))) ) data = rbind(testdata,traindata) ### removing near zero var predictors if (! removeOnlyZeroVariacePredictors ) { PredToDel = NULL if (performVarianceAnalysisOnTrainSetOnly) { if (verbose) cat(">>> applying caret nearZeroVar performing caret nearZeroVar function on train set only ... \n") PredToDel = caret::nearZeroVar(traindata) } else { if (verbose) cat(">>> applying caret nearZeroVar performing caret nearZeroVar function on both train set and test set ... \n") PredToDel = caret::nearZeroVar(data) } if (! is.null(correlationThreshold) ) { if (verbose) cat(">>> computing correlation ... \n") corrValues <- apply(traindata, MARGIN = 2, FUN = function(x, y) cor(x, y), y = y) PredToReinsert = as.numeric(which(! is.na(corrValues) & corrValues > correlationThreshold)) if (verbose) cat(">> There are high correlated predictors with response variable. N. ",length(PredToReinsert)," - predictors: ", paste(colnames(data) [PredToReinsert] , collapse=" " ) , " ... \n ") PredToDel = PredToDel[! PredToDel %in% PredToReinsert] } if (length(PredToDel) > 0) { if (verbose) cat("removing ",length(PredToDel)," nearZeroVar predictors: ", paste(colnames(data) [PredToDel] , collapse=" " ) , " ... \n ") data = data [,-PredToDel,drop=F] } } else { if (verbose) cat(">>> removing zero variance predictors only ... \n") card = NULL if (performVarianceAnalysisOnTrainSetOnly) { if (verbose) cat(">>> removing zero variance predictors performing variance analysis on train set only ... \n") card = apply(traindata,2,function(x) length(unique(x)) ) } else { if (verbose) cat(">>> removing zero variance predictors performing variance analysis on both train set and test set ... \n") card = apply(data,2,function(x) length(unique(x)) ) } PredToDel = as.numeric(which(card < 2)) if (length(PredToDel) > 0) { if (verbose) cat("removing ",length(PredToDel)," ZeroVariacePredictors predictors: ", paste(colnames(data) [PredToDel] , collapse=" " ) , " ... \n ") data = data [,-PredToDel,drop=F] } } ### removing predictors that make ill-conditioned square matrix if (removePredictorsMakingIllConditionedSquareMatrix) { if (verbose) cat(">>> finding for predictors that make ill-conditioned square matrix ... \n") PredToDel = subselect::trim.matrix( cov( data ) ) if (length(PredToDel$numbers.discarded) > 0) { if (verbose) cat("removing ",length(PredToDel$numbers.discarded)," predictors that make ill-conditioned square matrix: ", paste(colnames(data) [PredToDel$numbers.discarded] , collapse=" " ) , " ... \n ") data = data [,-PredToDel$numbers.discarded,drop=F] } } ## removing identical predictors if (removeIdenticalPredictors) { colToRemove = rep(F,ncol(data)) lapply( 1:(ncol(data)-1) , function(i) { lapply( (i+1):ncol(data) ,function(j) { if (identical(data[,i],data[,j])) { colToRemove[j] <<- T } }) }) if (sum(colToRemove) > 0) { if (verbose) cat("removing ",sum(colToRemove)," identical predictors: ", paste(colnames(data) [colToRemove] , collapse=" " ) , " ... \n ") data = data[,-which(colToRemove),drop=F] } } # removing high correlated predictors if (removeHighCorrelatedPredictors) { if (verbose) cat(">>> finding for high correlated predictors ... \n") PredToDel = caret::findCorrelation(cor( data )) if (length(PredToDel) > 0) { if (verbose) cat("removing ",length(PredToDel), " removing high correlated predictors: ", paste(colnames(data) [PredToDel] , collapse=" " ) , " ... \n ") data = data [,-PredToDel,drop=F] } } ## feature scaling if (featureScaling) { if (verbose) cat(">>> feature scaling ... \n") scaler = caret::preProcess(data,method = c("center","scale")) data = predict(scaler,data) } ## reassembling if ( ! is.null(testdata) && ! is.null(traindata) ) { testdata = data[1:(dim(testdata)[1]),] traindata = data[((dim(testdata)[1])+1):(dim(data)[1]),] } else if (is.null(testdata)) { traindata = data } else if (is.null(traindata)) { testdata = data } return(list(traindata = traindata,testdata = testdata)) } #' Make polynomial terms of a \code{data.frame} #' #' @param x a \code{data.frame} of \code{numeric} #' @param n the polynomial degree #' @param direction if set to \code{0} returns the terms \code{x^(1/n),x^(1/(n-1)),...,x,x^2,...,x^n}. #' If set to \code{-1} returns the terms \code{x^(1/n),x^(1/(n-1)),...,x}. #' If set to \code{1} returns the terms \code{x,x^2,...,x^n}. #' #' @examples #' Xtrain <- data.frame( a = rep(1:3 , each = 2), b = c(4:1,6,6), c = rep(1,6)) #' Xtest <- Xtrain + runif(nrow(Xtrain)) #' data = rbind(Xtrain,Xtest) #' data.poly = ff.poly(x=data,n=3) #' Xtrain.poly = data.poly[1:nrow(Xtrain),] #' Xtest.poly = data.poly[(nrow(Xtrain)+1):nrow(data),] #' @export #' @return the \code{data.frame} with the specified polynomial terms #' ff.poly = function (x,n,direction=0) { stopifnot(identical(class(x),'data.frame') , identical(class(n),'numeric') ) stopifnot( sum(unlist(lapply(x,function(x) { return(! (is.atomic(x) && (! is.character(x)) && ! is.factor(x)) ) }))) == 0 ) if (n == 1) { return (x) } x.poly = NULL x.poly.2 = NULL ## if (direction>=0) { x.poly = as.data.frame(matrix(rep(0 , nrow(x)*ncol(x)*(n-1)) , nrow = nrow(x))) lapply(2:n,function(i){ d = x d[] <- lapply(X = x , FUN = function(x){ return(x^i) }) colnames(d) = paste(colnames(x),'^',i,sep='') x.poly[,((i-2)*ncol(x)+1):((i-1)*ncol(x))] <<- d colnames(x.poly)[((i-2)*ncol(x)+1):((i-1)*ncol(x))] <<- colnames(d) }) } ## if (direction<=0) { x.poly.2 = as.data.frame(matrix(rep(0 , nrow(x)*ncol(x)*(n-1)) , nrow = nrow(x))) lapply(2:n,function(i){ d = x d[] <- lapply(X = x , FUN = function(x){ return(x^(1/i)) }) colnames(d) = paste(colnames(x),'^1/',i,sep='') x.poly.2[,((i-2)*ncol(x)+1):((i-1)*ncol(x))] <<- d colnames(x.poly.2)[((i-2)*ncol(x)+1):((i-1)*ncol(x))] <<- colnames(d) }) } ## if (direction>0) { return (cbind(x,x.poly)) } else if (direction==0) { return (cbind(x,x.poly,x.poly.2)) } else { return (cbind(x,x.poly.2)) } } #' Filter a \code{data.frame} of numeric according to a given threshold of correlation #' #' @param Xtrain a train set \code{data.frame} of \code{numeric} #' @param Xtest a test set \code{data.frame} of \code{numeric} #' @param y the output variable (as numeric vector) #' @param method a character string indicating which correlation method is to be used for the test. One of "pearson", "kendall", or "spearman". #' @param abs_th an absolute threshold (= number of data frame columns) #' @param rel_th a relative threshold (= percentage of data frame columns) #' #' @examples #' Xtrain <- data.frame( a = rep(1:3 , each = 2), b = c(4:1,6,6), c = rep(1,6)) #' Xtest <- Xtrain + runif(nrow(Xtrain)) #' y = 1:6 #' l = ff.corrFilter(Xtrain=Xtrain,Xtest=Xtest,y=y,rel_th=0.5) #' Xtrain.filtered = l$Xtrain #' Xtest.filtered =l$Xtest #' @export #' @return a \code{list} of filtered train set and test set with correlation test results #' ff.corrFilter = function(Xtrain,Xtest,y,abs_th=NULL,rel_th=1,method = 'pearson') { warn_def = getOption('warn') options(warn=-1) #### stopifnot(is.null(rel_th) || is.null(abs_th)) if (! is.null(rel_th) ) stopifnot( rel_th >0 && rel_th <=1 ) if (! is.null(abs_th) ) stopifnot( abs_th >0 && abs_th <=ncol(Xtrain) ) stopifnot( ! (is.null(Xtrain) || is.null(Xtest)) ) stopifnot( ncol(Xtrain) == ncol(Xtest) ) stopifnot( ncol(Xtrain) > 0 ) stopifnot( nrow(Xtrain) > 0 ) stopifnot( nrow(Xtest) > 0 ) stopifnot( sum(unlist(lapply(Xtrain,function(x) { return(! (is.atomic(x) && ! is.character(x) && ! is.factor(x))) }))) == 0 ) stopifnot( sum(unlist(lapply(Xtest,function(x) { return(! (is.atomic(x) && ! is.character(x) && ! is.factor(x))) }))) == 0 ) stopifnot(identical(method,'pearson') || identical(method,'kendall') || identical(method,'spearman')) ### TypeIError test getPvalueTypeIError = function(x,y) { test = method pvalue = NULL estimate = NULL interpretation = NULL ### pearson / kendall / spearman test.corr = cor.test(x = x , y = y , method = method) pvalue = test.corr$p.value estimate = test.corr$estimate if (pvalue < 0.05) { interpretation = 'there is correlation' } else { interpretation = 'data do not give you any reason to conclude that the correlation is real' } return(list(test=test,pvalue=pvalue,estimate=estimate,interpretation=interpretation)) } ## int_rel_th = abs_th if (! is.null(rel_th) ) { int_rel_th = floor(ncol(Xtrain) * rel_th) } ## corr analysis aa = lapply(Xtrain , function(x) { dummy = list( test = method, pvalue=1, estimate = 0, interpretation = "error") setNames(object = dummy , nm = names(x)) ret = plyr::failwith( dummy, getPvalueTypeIError , quiet = TRUE)(x=x,y=y) return (ret) }) ## make data frame test results aadf = data.frame(predictor = rep(NA,length(aa)) , test = rep(NA,length(aa)) , pvalue = rep(NA,length(aa)) , estimate = rep(NA,length(aa)) , interpretation = rep(NA,length(aa))) lapply(seq_along(aa) , function(i) { aadf[i,]$predictor <<- names(aa[i]) aadf[i,]$test <<- aa[[i]]$test aadf[i,]$pvalue <<- aa[[i]]$pvalue aadf[i,]$estimate <<- aa[[i]]$estimate aadf[i,]$interpretation <<- aa[[i]]$interpretation }) aadf = aadf[order(abs(aadf$estimate) , decreasing = T), ] ## cut to the given threshold aadf_cut = aadf[1:int_rel_th,,drop=F] options(warn=warn_def) return(list( Xtrain = Xtrain[,aadf_cut$predictor,drop=F], Xtest = Xtest[,aadf_cut$predictor,drop=F], test.results = aadf )) }
\name{PRESS} \alias{PRESS} \alias{PRESS.lm} \alias{PRESS.fmo} \title{ PRESS } \description{ Convenience function to calculate the PRESS criterion value of a fitted lm object. } \author{Andrew K. Smith} \keyword{models}
/man/PRESS.Rd
no_license
cran/CombMSC
R
false
false
231
rd
\name{PRESS} \alias{PRESS} \alias{PRESS.lm} \alias{PRESS.fmo} \title{ PRESS } \description{ Convenience function to calculate the PRESS criterion value of a fitted lm object. } \author{Andrew K. Smith} \keyword{models}
\name{tableau_shape_pal} \alias{tableau_shape_pal} \title{Tableau Shape Palettes (discrete)} \usage{ tableau_shape_pal(palette = "default") } \arguments{ \item{palette}{Palette name. One of \Sexpr[results=rd,stage=build]{ggthemes:::charopts(names(ggthemes::ggthemes_data$tableau$shapes))}.} } \description{ Shape palettes used by \href{http://www.tableausoftware.com/}{Tableau}. } \examples{ show_shapes(tableau_shape_pal()(5)) } \seealso{ Other shape tableau: \code{\link{scale_shape_tableau}} }
/man/tableau_shape_pal.Rd
no_license
tomhiatt/ggthemes
R
false
false
510
rd
\name{tableau_shape_pal} \alias{tableau_shape_pal} \title{Tableau Shape Palettes (discrete)} \usage{ tableau_shape_pal(palette = "default") } \arguments{ \item{palette}{Palette name. One of \Sexpr[results=rd,stage=build]{ggthemes:::charopts(names(ggthemes::ggthemes_data$tableau$shapes))}.} } \description{ Shape palettes used by \href{http://www.tableausoftware.com/}{Tableau}. } \examples{ show_shapes(tableau_shape_pal()(5)) } \seealso{ Other shape tableau: \code{\link{scale_shape_tableau}} }
## casecross.R ## time-stratified case-crossover ## Oct 2011 ## assumes date variable is called 'date' ## quicker version casecross<-function(formula, data, exclusion=2, stratalength=28, matchdow=FALSE, usefinalwindow=FALSE, matchconf='', confrange=0,stratamonth=FALSE){ outcome <- dow <- case <-timex <- dow.x <- dow.y <- matchday.x <- matchday.y <- windownum.x <- windownum.y <- NULL # Setting some variables to NULL first (for R CMD check) thisdata<-data ## Checks if (class(thisdata$date)!="Date"){ stop("date variable must be in date format, see ?Dates")} if (exclusion<0){stop("Minimum value for exclusion is zero")} parts<-paste(formula) dep<-parts[2] # dependent variable indep<-parts[3] # dependent variable if (length(formula)<=2){stop("Must be at least one independent variable")} ## original call with defaults (see amer package) ans <- as.list(match.call()) frmls <- formals(deparse(ans[[1]])) add <- which(!(names(frmls) %in% names(ans))) call<-as.call(c(ans, frmls[add])) thisdata$dow<-as.numeric(format(thisdata$date,'%w')); ## Slim down the data f<-as.formula(paste(parts[2],parts[1],parts[3],'+date+dow')) if (substr(matchconf,1,1)!=""){ f<-as.formula(paste(dep,"~",indep,'+date+dow+',matchconf)) } datatouse<-model.frame(f,data=thisdata,na.action=na.omit) # remove cases with missing covariates ## Check for irregularly spaced data if(any(diff(datatouse$date)>1)){ cat('Note, irregularly spaced data...\n') cat('...check your data for missing days\n') } datediff<-as.numeric(datatouse$date)-min(as.numeric(thisdata$date)) # use minimum data in entire sample time<-as.numeric(datediff)+1 # used as strata number ## Create strata if (stratamonth==TRUE){ month<-as.numeric(format(datatouse$date,'%m')); year<-as.numeric(format(datatouse$date,'%Y')); matchday<-as.numeric(format(datatouse$date,'%d')); yrdiff<-year-min(year); windownum<-(yrdiff*12)+month; } if (stratamonth==FALSE){ ## Get the earliest time and difference all dates from this time ## Increase strata windows in jumps of 'stratalength' windownum<-floor(datediff/stratalength)+1 nwindows<-floor(nrow(thisdata)/stratalength)+1 matchday<-datediff-((windownum-1)*stratalength)+1 # Day number in strata ## Exclude the last window if it is less than 'stratalength' lastwindow<-datatouse[datatouse$windownum==nwindows,] if (nrow(lastwindow)>0){ # only apply to data sets with some data in the final window lastlength<-max(time[windownum==nwindows])- min(time[windownum==nwindows])+1 if (lastlength<stratalength&usefinalwindow==FALSE) datatouse <- datatouse[windownum<nwindows,] } } ## Create the case data n<-nrow(datatouse) cases<-datatouse cases$case<-1 # binary indicator of case cases$timex<-1 # Needed for conditional logistic regression cases$windownum<-windownum cases$time<-time cases$diffdays<-NA cases$matchday<-matchday posout<-sum(as.numeric(names(datatouse)==as.character(f[2]))* (1:ncol(datatouse))) # get the position of the dependent variable cases$outcome<-datatouse[,c(posout)] # October 2011, removed nonzerocases # Create a case number for matching if (substr(matchconf,1,1)==""){ cases.tomerge<-subset(cases,select=c(matchday,time,outcome,windownum,dow))} if (substr(matchconf,1,1)!=""){ also<-sum(as.numeric(names(cases)==matchconf)*(1:length(names(cases)))) cases.tomerge<-subset(cases, select=c(matchday,time,outcome,windownum,dow,also)) } ncases<-nrow(cases) cases.tomerge$casenum<-1:ncases # Duplicate case series to make controls maxwindows<-max(cases$windownum) rowstorep<-NA casenum<-NA # Fix for missing windows (thanks to Yuming) windowrange<-as.numeric(levels(as.factor(windownum))) for (k in windowrange){ small=min(cases$time[cases$windownum==k]) large=max(cases$time[cases$windownum==k]) these<-rep(small:large,large-small+1) rowstorep<-c(rowstorep,these) casenum<-c(casenum,these[order(these)]) } controls<-cases[rowstorep[2:length(rowstorep)],] # can fall over if there's missing data controls<-subset(controls,select=c(-case,-timex,-time,-outcome)) # Replace case number controls$casenum<-casenum[2:length(rowstorep)] # Merge cases with controls by case number controls<-merge(controls,cases.tomerge,by='casenum') controls<-controls[controls$windownum.x==controls$windownum.y,] # must be in same stratum window controls$case<-0 # binary indicator of case controls$timex<-2 # Needed for conditional logistic regression controls$diffdays<-abs(controls$matchday.x-controls$matchday.y) controls<-controls[controls$diffdays>exclusion,] # remove the exclusion window # match on day of the week if (matchdow==TRUE){controls<-controls[controls$dow.x==controls$dow.y,]} # match on a confounder if (substr(matchconf,1,1)!=""){ one<- paste(matchconf,'.x',sep='') two<- paste(matchconf,'.y',sep='') find1<-grep(one,names(controls)) find2<-grep(two,names(controls)) matchdiff<-abs(controls[,find1]-controls[,find2]) controls<-controls[matchdiff<=confrange,] controls<-subset(controls,select=c(-casenum,-dow.x,-dow.y,-matchday.x,-matchday.y,-windownum.x,-windownum.y,-find1,-find2)) findc<-sum(as.numeric(names(cases)==matchconf)*(1:length(names(cases)))) final.cases<-subset(cases,select=c(-dow,-matchday,-windownum,-findc)) } if (substr(matchconf,1,1)==""){ controls<-subset(controls,select=c(-casenum,-dow.x,-dow.y,-matchday.x,-matchday.y,-windownum.x,-windownum.y)) final.cases<-subset(cases,select=c(-dow,-matchday,-windownum)) } finished<-rbind(final.cases,controls) ## Remove empty controls finished<-finished[finished$outcome>0,] ## Count the number of control days without a case day, and the total number of cases onlycntl<-finished[finished$case==0,] ncases<-nrow(table(onlycntl$time)) which.times=unique(onlycntl$time) extra.only=final.cases[final.cases$time%in%which.times,] ncontrols<-round(mean(as.numeric(table(onlycntl$time))),1) ## Run the conditional logistic regression finalformula<-as.formula(paste('Surv(timex,case)~',indep,'+strata(time)')) c.model<-coxph(finalformula, weights=outcome, data=finished,method=c("breslow")) toret<-list() toret$call<-call toret$c.model<-c.model class(toret$c.model)<-"coxph" toret$ncases<-sum(extra.only$outcome) toret$ncasedays<-ncases toret$ncontroldays<-ncontrols class(toret)<-'casecross' return(toret) }
/season/R/casecross.R
no_license
ingted/R-Examples
R
false
false
6,815
r
## casecross.R ## time-stratified case-crossover ## Oct 2011 ## assumes date variable is called 'date' ## quicker version casecross<-function(formula, data, exclusion=2, stratalength=28, matchdow=FALSE, usefinalwindow=FALSE, matchconf='', confrange=0,stratamonth=FALSE){ outcome <- dow <- case <-timex <- dow.x <- dow.y <- matchday.x <- matchday.y <- windownum.x <- windownum.y <- NULL # Setting some variables to NULL first (for R CMD check) thisdata<-data ## Checks if (class(thisdata$date)!="Date"){ stop("date variable must be in date format, see ?Dates")} if (exclusion<0){stop("Minimum value for exclusion is zero")} parts<-paste(formula) dep<-parts[2] # dependent variable indep<-parts[3] # dependent variable if (length(formula)<=2){stop("Must be at least one independent variable")} ## original call with defaults (see amer package) ans <- as.list(match.call()) frmls <- formals(deparse(ans[[1]])) add <- which(!(names(frmls) %in% names(ans))) call<-as.call(c(ans, frmls[add])) thisdata$dow<-as.numeric(format(thisdata$date,'%w')); ## Slim down the data f<-as.formula(paste(parts[2],parts[1],parts[3],'+date+dow')) if (substr(matchconf,1,1)!=""){ f<-as.formula(paste(dep,"~",indep,'+date+dow+',matchconf)) } datatouse<-model.frame(f,data=thisdata,na.action=na.omit) # remove cases with missing covariates ## Check for irregularly spaced data if(any(diff(datatouse$date)>1)){ cat('Note, irregularly spaced data...\n') cat('...check your data for missing days\n') } datediff<-as.numeric(datatouse$date)-min(as.numeric(thisdata$date)) # use minimum data in entire sample time<-as.numeric(datediff)+1 # used as strata number ## Create strata if (stratamonth==TRUE){ month<-as.numeric(format(datatouse$date,'%m')); year<-as.numeric(format(datatouse$date,'%Y')); matchday<-as.numeric(format(datatouse$date,'%d')); yrdiff<-year-min(year); windownum<-(yrdiff*12)+month; } if (stratamonth==FALSE){ ## Get the earliest time and difference all dates from this time ## Increase strata windows in jumps of 'stratalength' windownum<-floor(datediff/stratalength)+1 nwindows<-floor(nrow(thisdata)/stratalength)+1 matchday<-datediff-((windownum-1)*stratalength)+1 # Day number in strata ## Exclude the last window if it is less than 'stratalength' lastwindow<-datatouse[datatouse$windownum==nwindows,] if (nrow(lastwindow)>0){ # only apply to data sets with some data in the final window lastlength<-max(time[windownum==nwindows])- min(time[windownum==nwindows])+1 if (lastlength<stratalength&usefinalwindow==FALSE) datatouse <- datatouse[windownum<nwindows,] } } ## Create the case data n<-nrow(datatouse) cases<-datatouse cases$case<-1 # binary indicator of case cases$timex<-1 # Needed for conditional logistic regression cases$windownum<-windownum cases$time<-time cases$diffdays<-NA cases$matchday<-matchday posout<-sum(as.numeric(names(datatouse)==as.character(f[2]))* (1:ncol(datatouse))) # get the position of the dependent variable cases$outcome<-datatouse[,c(posout)] # October 2011, removed nonzerocases # Create a case number for matching if (substr(matchconf,1,1)==""){ cases.tomerge<-subset(cases,select=c(matchday,time,outcome,windownum,dow))} if (substr(matchconf,1,1)!=""){ also<-sum(as.numeric(names(cases)==matchconf)*(1:length(names(cases)))) cases.tomerge<-subset(cases, select=c(matchday,time,outcome,windownum,dow,also)) } ncases<-nrow(cases) cases.tomerge$casenum<-1:ncases # Duplicate case series to make controls maxwindows<-max(cases$windownum) rowstorep<-NA casenum<-NA # Fix for missing windows (thanks to Yuming) windowrange<-as.numeric(levels(as.factor(windownum))) for (k in windowrange){ small=min(cases$time[cases$windownum==k]) large=max(cases$time[cases$windownum==k]) these<-rep(small:large,large-small+1) rowstorep<-c(rowstorep,these) casenum<-c(casenum,these[order(these)]) } controls<-cases[rowstorep[2:length(rowstorep)],] # can fall over if there's missing data controls<-subset(controls,select=c(-case,-timex,-time,-outcome)) # Replace case number controls$casenum<-casenum[2:length(rowstorep)] # Merge cases with controls by case number controls<-merge(controls,cases.tomerge,by='casenum') controls<-controls[controls$windownum.x==controls$windownum.y,] # must be in same stratum window controls$case<-0 # binary indicator of case controls$timex<-2 # Needed for conditional logistic regression controls$diffdays<-abs(controls$matchday.x-controls$matchday.y) controls<-controls[controls$diffdays>exclusion,] # remove the exclusion window # match on day of the week if (matchdow==TRUE){controls<-controls[controls$dow.x==controls$dow.y,]} # match on a confounder if (substr(matchconf,1,1)!=""){ one<- paste(matchconf,'.x',sep='') two<- paste(matchconf,'.y',sep='') find1<-grep(one,names(controls)) find2<-grep(two,names(controls)) matchdiff<-abs(controls[,find1]-controls[,find2]) controls<-controls[matchdiff<=confrange,] controls<-subset(controls,select=c(-casenum,-dow.x,-dow.y,-matchday.x,-matchday.y,-windownum.x,-windownum.y,-find1,-find2)) findc<-sum(as.numeric(names(cases)==matchconf)*(1:length(names(cases)))) final.cases<-subset(cases,select=c(-dow,-matchday,-windownum,-findc)) } if (substr(matchconf,1,1)==""){ controls<-subset(controls,select=c(-casenum,-dow.x,-dow.y,-matchday.x,-matchday.y,-windownum.x,-windownum.y)) final.cases<-subset(cases,select=c(-dow,-matchday,-windownum)) } finished<-rbind(final.cases,controls) ## Remove empty controls finished<-finished[finished$outcome>0,] ## Count the number of control days without a case day, and the total number of cases onlycntl<-finished[finished$case==0,] ncases<-nrow(table(onlycntl$time)) which.times=unique(onlycntl$time) extra.only=final.cases[final.cases$time%in%which.times,] ncontrols<-round(mean(as.numeric(table(onlycntl$time))),1) ## Run the conditional logistic regression finalformula<-as.formula(paste('Surv(timex,case)~',indep,'+strata(time)')) c.model<-coxph(finalformula, weights=outcome, data=finished,method=c("breslow")) toret<-list() toret$call<-call toret$c.model<-c.model class(toret$c.model)<-"coxph" toret$ncases<-sum(extra.only$outcome) toret$ncasedays<-ncases toret$ncontroldays<-ncontrols class(toret)<-'casecross' return(toret) }
m = matrix( c( 1, 2, 3, 4, 11, 22, 33, 44, 111, 222, 333, 444, 1111,2222,3333,4444), nrow=4, ncol=4) is.matrix(m) # [1] TRUE
/functions/is.matrix.R
no_license
ReneNyffenegger/about-r
R
false
false
209
r
m = matrix( c( 1, 2, 3, 4, 11, 22, 33, 44, 111, 222, 333, 444, 1111,2222,3333,4444), nrow=4, ncol=4) is.matrix(m) # [1] TRUE
## ---- eval = FALSE--------------------------------------------------------- # crispr_set <- readsToTarget(reads, target = target, reference = reference, # target.loc = target.loc) # plotVariants(crispr_set) # # or use plotVariants(crispr_set, txdb) to additionally show the target # # location with respect to the transcripts if a Transcript Database # # txdb is available ## ---- message=FALSE, warning=FALSE----------------------------------------- library(CrispRVariants) library(sangerseqR) # List AB1 filenames, get sequence names, make names for the fastq files # Note that we only include one ab1 file with CrispRVariants because # of space constraints. All bam files are included data_dir <- system.file(package="CrispRVariants", "extdata/ab1/ptena") fq_dir <- tempdir() ab1_fnames <- dir(data_dir, "ab1$", recursive=TRUE, full=TRUE) sq_nms <- gsub(".ab1","",basename(ab1_fnames)) # Replace spaces and slashes in filename with underscores fq_fnames <- paste0(gsub("[\ |\\/]", "_", dirname(ab1_fnames)), ".fastq") # abifToFastq to read AB1 files and write to FASTQ dummy <- mapply( function(u,v,w) { abifToFastq(u,v,file.path(fq_dir,w)) }, sq_nms, ab1_fnames, fq_fnames) ## ---- message=FALSE, warning = FALSE--------------------------------------- length(unique(ab1_fnames)) length(unique(fq_fnames)) ## ---- message = FALSE, warning=FALSE, eval=FALSE--------------------------- # library("Rsamtools") # # # BWA indices were generated using bwa version 0.7.10 # bwa_index <- "GRCHz10.fa.gz" # bam_dir <- system.file(package="CrispRVariants", "extdata/bam") # fq_fnames <- file.path(fq_dir,unique(fq_fnames)) # bm_fnames <- gsub(".fastq$",".bam",basename(fq_fnames)) # srt_bm_fnames <- file.path(bam_dir, gsub(".bam","_s",bm_fnames)) # # # Map, sort and index the bam files, remove the unsorted bams # for(i in 1:length(fq_fnames)) { # cmd <- paste0("bwa mem ", bwa_index, " ", fq_fnames[i], # " | samtools view -Sb - > ", bm_fnames[i]) # message(cmd, "\n"); system(cmd) # indexBam(sortBam(bm_fnames[i],srt_bm_fnames[i])) # unlink(bm_fnames[i]) # } ## ---- message=FALSE-------------------------------------------------------- # The metadata and bam files for this experiment are included with CrispRVariants library("gdata") md_fname <- system.file(package="CrispRVariants", "extdata/metadata/metadata.xls") md <- gdata::read.xls(md_fname, 1) md # Get the bam filenames from the metadata table bam_dir <- system.file(package="CrispRVariants", "extdata/bam") bam_fnames <- file.path(bam_dir, md$bamfile) # check that all files exist all( file.exists(bam_fnames) ) ## ---- message=FALSE-------------------------------------------------------- library(rtracklayer) # Represent the guide as a GenomicRanges::GRanges object gd_fname <- system.file(package="CrispRVariants", "extdata/bed/guide.bed") gd <- rtracklayer::import(gd_fname) gd ## ---- message=FALSE-------------------------------------------------------- gdl <- GenomicRanges::resize(gd, width(gd) + 10, fix = "center") ## ---- eval=FALSE----------------------------------------------------------- # system("samtools faidx GRCHz10.fa.gz") # # reference=system(sprintf("samtools faidx GRCHz10.fa.gz %s:%s-%s", # seqnames(gdl)[1], start(gdl)[1], end(gdl)[1]), # intern = TRUE)[[2]] # # # The guide is on the negative strand, so the reference needs to be reverse complemented # reference=Biostrings::reverseComplement(Biostrings::DNAString(reference)) # save(reference, file = "ptena_GRCHz10_ref.rda") ## -------------------------------------------------------------------------- ref_fname <- system.file(package="CrispRVariants", "extdata/ptena_GRCHz10_ref.rda") load(ref_fname) reference ## ---- tidy = FALSE--------------------------------------------------------- # First read the alignments into R. The alignments must include # the read sequences and the MD tag alns <- GenomicAlignments::readGAlignments(bam_fnames[[1]], param = Rsamtools::ScanBamParam(tag = "MD", what = c("seq", "flag")), use.names = TRUE) # Then reconstruct the reference for the target region. # If no target region is given, this function will reconstruct # the complete reference sequence for all reads. rfa <- refFromAlns(alns, gdl) # The reconstructed reference sequence is identical to the sequence # extracted from the reference above print(rfa == reference) ## ---- message=FALSE-------------------------------------------------------- # Note that the zero point (target.loc parameter) is 22 crispr_set <- readsToTarget(bam_fnames, target = gdl, reference = reference, names = md$Short.name, target.loc = 22) crispr_set # The counts table can be accessed with the "variantCounts" function vc <- variantCounts(crispr_set) print(class(vc)) ## ---- eval = FALSE--------------------------------------------------------- # # In R # library(GenomicFeatures) # gtf_fname <- "Danio_rerio.GRCz10.81_chr17.gtf" # txdb <- GenomicFeatures::makeTxDbFromGFF(gtf_fname, format = "gtf") # saveDb(txdb, file= "GRCz10_81_chr17_txdb.sqlite") ## ---- echo=FALSE, message=FALSE-------------------------------------------- library(GenomicFeatures) txdb_fname <- system.file("extdata/GRCz10_81_ptena_txdb.sqlite", package="CrispRVariants") txdb <- loadDb(txdb_fname) ## ---- message = FALSE------------------------------------------------------ # The gridExtra package is required to specify the legend.key.height # as a "unit" object. It is not needed to call plotVariants() with defaults library(gridExtra) # Match the clutch id to the column names of the variants group <- md$Group ## ----ptena-plot, fig.width = 8.5, fig.height = 7.5, message = FALSE, fig.cap = "(Top) schematic of gene structure showing guide location (left) consensus sequences for variants (right) variant counts in each embryo."---- p <- plotVariants(crispr_set, txdb = txdb, gene.text.size = 8, row.ht.ratio = c(1,8), col.wdth.ratio = c(4,2), plotAlignments.args = list(line.weight = 0.5, ins.size = 2, legend.symbol.size = 4), plotFreqHeatmap.args = list(plot.text.size = 3, x.size = 8, group = group, legend.text.size = 8, legend.key.height = grid::unit(0.5, "lines"))) ## -------------------------------------------------------------------------- # Calculate the mutation efficiency, excluding indels that occur in the "control" sample # and further excluding the "control" sample from the efficiency calculation eff <- mutationEfficiency(crispr_set, filter.cols = "control", exclude.cols = "control") eff # Suppose we just wanted to filter particular variants, not an entire sample. # This can be done using the "filter.vars" argument eff2 <- mutationEfficiency(crispr_set, filter.vars = "6:1D", exclude.cols = "control") # The results are the same in this case as only one variant was filtered from the control identical(eff,eff2) ## -------------------------------------------------------------------------- sqs <- consensusSeqs(crispr_set) sqs # The ptena guide is on the negative strand. # Confirm that the reverse complement of the "no variant" allele # matches the reference sequence: Biostrings::reverseComplement(sqs[["no variant"]]) == reference ## -------------------------------------------------------------------------- ch <- getChimeras(crispr_set, sample = "ptena 4") # Confirm that all chimeric alignments are part of the same read length(unique(names(ch))) == 1 # Set up points to annotate on the plot annotations <- c(resize(gd, 1, fix = "start"), resize(gd, 1, fix = "end")) annotations$name <- c("ptena_start", "ptena_end") plotChimeras(ch, annotations = annotations) ## -------------------------------------------------------------------------- mutationEfficiency(crispr_set, filter.cols = "control", exclude.cols = "control", include.chimeras = FALSE) ## ---- fig.width = 8.5, fig.height = 7.5, message = FALSE, warning = FALSE---- crispr_set_rev <- readsToTarget(bam_fnames, target = gdl, reference = reference, names = md$Short.name, target.loc = 22, orientation = "opposite") plotVariants(crispr_set_rev) ## ---- warning = FALSE------------------------------------------------------ # We create a longer region to use as the "target" # and the corresponding reference sequence gdl <- GenomicRanges::resize(gd, width(gd) + 20, fix = "center") reference <- Biostrings::DNAString("TCATTGCCATGGGCTTTCCAGCCGAACGATTGGAAGGTGTTTA") # At this stage, target should be the entire region to display and target.loc should # be the zero point with respect to this region crispr_set <- readsToTarget(bam_fnames, target = gdl, reference = reference, names = md$Short.name, target.loc = 10, verbose = FALSE) # Multiple guides are added at the stage of plotting # The boundaries of the guide regions must be specified with respect to the # given target region p <- plotVariants(crispr_set, plotAlignments.args = list(pam.start = c(6,35), target.loc = c(10, 32), guide.loc = IRanges::IRanges(c(6, 25),c(20, 37)))) p ## ---- message = FALSE------------------------------------------------------ # Setup for ptena data set library("CrispRVariants") library("rtracklayer") library("GenomicFeatures") library("gdata") # Load the guide location gd_fname <- system.file(package="CrispRVariants", "extdata/bed/guide.bed") gd <- rtracklayer::import(gd_fname) gdl <- resize(gd, width(gd) + 10, fix = "center") # The saved reference sequence corresponds to the guide # plus 5 bases on either side, i.e. gdl ref_fname <- system.file(package="CrispRVariants", "extdata/ptena_GRCHz10_ref.rda") load(ref_fname) # Load the metadata table, which gives the sample names md_fname <- system.file(package="CrispRVariants", "extdata/metadata/metadata.xls") md <- gdata::read.xls(md_fname, 1) # Get the list of bam files bam_dir <- system.file(package="CrispRVariants", "extdata/bam") bam_fnames <- file.path(bam_dir, md$bamfile) # Check that all files were found all(file.exists(bam_fnames)) crispr_set <- readsToTarget(bam_fnames, target = gdl, reference = reference, names = md$Short.name, target.loc = 22, verbose = FALSE) # Load the transcript database txdb_fname <- system.file("extdata/GRCz10_81_ptena_txdb.sqlite", package="CrispRVariants") txdb <- AnnotationDbi::loadDb(txdb_fname) ## ---- fig.height = 5, warning = FALSE-------------------------------------- p <- plotVariants(crispr_set, txdb = txdb) ## ---- fig.height = 5, warning = FALSE-------------------------------------- p <- plotVariants(crispr_set, txdb = txdb, row.ht.ratio = c(1,3)) ## ---- fig.height = 5, message = FALSE, warning = FALSE--------------------- p <- plotVariants(crispr_set, txdb = txdb, col.wdth.ratio = c(4,1)) ## -------------------------------------------------------------------------- # Load gol data set library("CrispRVariants") data("gol_clutch1") ## ---- fig.height = 2.5, message = FALSE, warning = FALSE------------------- library(GenomicFeatures) p <- plotVariants(gol, plotAlignments.args = list(top.n = 3), plotFreqHeatmap.args = list(top.n = 3), left.plot.margin = ggplot2::unit(c(0.1,0,5,0.2), "lines")) ## ---- fig.height = 2.5, message = FALSE, warning = FALSE------------------- plotVariants(gol, plotAlignments.args = list(top.n = 3), plotFreqHeatmap.args = list(top.n = 3, order = c(1,5,3)), left.plot.margin = ggplot2::unit(c(0.1,0,5,0.2), "lines")) ## ---- fig.height = 2.5, warning = FALSE------------------------------------ plotAlignments(gol, top.n = 3, ins.size = 6) ## ---- fig.height = 2.5----------------------------------------------------- plotAlignments(gol, top.n = 3, legend.symbol.size = 6) ## ---- fig.height = 3, warning = FALSE-------------------------------------- plotAlignments(gol, top.n = 5, max.insertion.size = 25) ## ---- fig.height = 3, warning = FALSE-------------------------------------- # Here we set a fairly high value of 50% for min.insertion.freq # As ambiguous nucleotides occur frequently in this data set, # there are no alleles passing this cutoff. plotAlignments(gol, top.n = 5, min.insertion.freq = 50) ## ---- fig.height = 3, warning = FALSE-------------------------------------- plotAlignments(gol, top.n = 5, max.insertion.size = 25, min.insertion.freq = 50) ## ---- fig.height = 2.5, warning = FALSE------------------------------------ # No white space between rows plotAlignments(gol, top.n = 3, tile.height = 1) ## ---- fig.height = 3, warning = FALSE-------------------------------------- # More white space between rows plotAlignments(gol, top.n = 3, tile.height = 0.3) ## ---- fig.height = 2.5, warning = FALSE------------------------------------ plotAlignments(gol, top.n = 3, highlight.guide = FALSE) ## ---- fig.height = 3, message = FALSE-------------------------------------- library(IRanges) guide <- IRanges::IRanges(15,28) plotAlignments(gol, top.n = 3, guide.loc = guide) ## ---- fig.height = 2.5----------------------------------------------------- # Here we increase the size of the axis labels and make # two columns for the legend plotAlignments(gol, top.n = 5, axis.text.size = 12, legend.text.size = 12, legend.cols = 2) ## ---- fig.height = 3, warning = FALSE-------------------------------------- # Don't highlight the PAM sequence plotAlignments(gol, top.n = 3, highlight.pam = FALSE) ## ---- fig.height = 3, warning = FALSE-------------------------------------- # Highlight 3 bases upstream to 3 bases downstream of the target.loc plotAlignments(gol, top.n = 3, pam.start = 19, pam.end = 25) ## ---- fig.height = 3, warning = FALSE-------------------------------------- plotAlignments(gol, top.n = 3, guide.loc = IRanges(5,10), pam.start = 8, pam.end = 13) ## ---- fig.height = 3, warning = FALSE-------------------------------------- plotAlignments(gol, top.n = 3, line.weight = 3) ## ---- fig.height = 3, warning = FALSE-------------------------------------- plotAlignments(gol, top.n = 3, codon.frame = 1) ## ---- eval = FALSE--------------------------------------------------------- # plot_data <- plotAlignments(gol, top.n = 3, create.plot = FALSE) # names(plot_data) # # This data can be modified as required, then replotted using: # do.call(plotAlignments, plot_data) ## ----hmap-default, fig.height = 3, fig.width = 4, fig.align='center', fig.cap = "plotFreqHeatmap with default options"---- # Save the plot to a variable then add a title using ggplot2 syntax. # If the plot is not saved to a variable the unmodified plot is displayed. p <- plotFreqHeatmap(gol, top.n = 3) p + labs(title = "A. plotFreqHeatmap with default options") ## ---- fig.height = 2.5, fig.width = 5, fig.align='center', fig.cap = "plotFreqHeatmap showing allele proportions"---- plotFreqHeatmap(gol, top.n = 3, type = "proportions") ## ---- fig.height = 2.5, fig.width = 4, fig.align='center', fig.cap = "plotFreqHeatmap with X-axis labels coloured by experimental group and tiles coloured by count instead of proportion"---- ncolumns <- ncol(variantCounts(gol)) ncolumns grp <- rep(c(1,2), each = ncolumns/2) p <- plotFreqHeatmap(gol, top.n = 3, group = grp, as.percent = FALSE) p + labs(title = "B. coloured X labels with tiles coloured by count") ## ---- fig.height = 2.5, fig.width = 5, fig.align='center', fig.cap = "plotFreqHeatmap with labels showing allele proportions, header showing counts per sample and modified legend position."---- grp_clrs <- c("red", "purple") p <- plotFreqHeatmap(gol, top.n = 3, group = grp, group.colours = grp_clrs, type = "proportions", header = "counts", legend.position = "bottom") p <- p + labs(title = "C. Modified plotFreqHeatmap") p ## ---- fig.height = 2.5, fig.width = 4, fig.align='center'------------------ plotFreqHeatmap(gol, top.n = 3, legend.key.height = ggplot2::unit(1.5, "lines")) ## ---- eval = FALSE--------------------------------------------------------- # var_counts <- variantCounts(gol, top.n = 3) # # (additional modifications to var_counts can be added here) # plotFreqHeatmap(var_counts) ## ---- fig.height = 2.5----------------------------------------------------- barplotAlleleFreqs(crispr_set, txdb = txdb) ## ---- fig.height = 2.5, message = FALSE------------------------------------ barplotAlleleFreqs(crispr_set, txdb = txdb, palette = "bluered") ## ---- fig.height = 2.5, message = FALSE------------------------------------ barplotAlleleFreqs(crispr_set, txdb = txdb, include.table = FALSE) ## ---- fig.height = 2.5----------------------------------------------------- var_counts <- variantCounts(crispr_set) barplotAlleleFreqs(var_counts) ## ---- fig.height = 2.5----------------------------------------------------- rainbowPal9 <- c("#781C81","#3F4EA1","#4683C1", "#57A3AD","#6DB388","#B1BE4E", "#DFA53A","#E7742F","#D92120") barplotAlleleFreqs(var_counts, classify = FALSE, bar.colours = rainbowPal9) ## ---- fig.height = 2.5----------------------------------------------------- # Classify variants as insertion/deletion/mixed byType <- crispr_set$classifyVariantsByType() byType # Classify variants by their location, without considering size byLoc <- crispr_set$classifyVariantsByLoc(txdb=txdb) byLoc # Coding variants can then be classified by setting a size cutoff byLoc <- crispr_set$classifyCodingBySize(byLoc, cutoff = 6) byLoc # Combine filtering and variant classification, using barplotAlleleFreqs.matrix vc <- variantCounts(crispr_set) # Select variants that occur in at least two samples keep <- names(which(rowSums(vc > 0) > 1)) keep # Use this classification and the selected variants barplotAlleleFreqs(vc[keep,], category.labels = byLoc[keep]) ## ---- fig.height = 2.5----------------------------------------------------- p <- plotAlignments(gol, top.n = 3) p + theme(legend.margin = ggplot2::unit(0, "cm")) ## ---- fig.height = 1------------------------------------------------------- # Get a reference sequence library("CrispRVariants") data("gol_clutch1") ref <- gol$ref #Then to make the plot: plotAlignments(ref, alns = NULL, target.loc = 22, ins.sites = data.frame()) ## ---- message = FALSE, warning = FALSE------------------------------------- library(Biostrings) library(CrispRVariants) library(rtracklayer) ## ---- warning = FALSE------------------------------------------------------ # This is a small, manually generated data set with a variety of different mutations bam_fname <- system.file("extdata", "cntnap2b_test_data_s.bam", package = "CrispRVariants") guide_fname <- system.file("extdata", "cntnap2b_test_data_guide.bed", package = "CrispRVariants") guide <- rtracklayer::import(guide_fname) guide <- guide + 5 reference <- Biostrings::DNAString("TAGGCGAATGAAGTCGGGGTTGCCCAGGTTCTC") cset <- readsToTarget(bam_fname, guide, reference = reference, verbose = FALSE, name = "Default") cset2 <- readsToTarget(bam_fname, guide, reference = reference, verbose = FALSE, chimera.to.target = 100, name = "Including long dels") default_var_counts <- variantCounts(cset) print(default_var_counts) print(c("Total number of reads: ", colSums(default_var_counts))) # With chimera.to.target = 100, an additional read representing a large deletion is # reported in the "Other" category. var_counts_inc_long_dels <- variantCounts(cset2) print(var_counts_inc_long_dels) print(c("Total number of reads: ", colSums(var_counts_inc_long_dels))) # This alignment can be viewed using `plotChimeras` ch <- getChimeras(cset2, sample = 1) plotChimeras(ch, annotations = cset2$target)
/inst/doc/user_guide.R
no_license
HLindsay/CrispRVariants
R
false
false
20,184
r
## ---- eval = FALSE--------------------------------------------------------- # crispr_set <- readsToTarget(reads, target = target, reference = reference, # target.loc = target.loc) # plotVariants(crispr_set) # # or use plotVariants(crispr_set, txdb) to additionally show the target # # location with respect to the transcripts if a Transcript Database # # txdb is available ## ---- message=FALSE, warning=FALSE----------------------------------------- library(CrispRVariants) library(sangerseqR) # List AB1 filenames, get sequence names, make names for the fastq files # Note that we only include one ab1 file with CrispRVariants because # of space constraints. All bam files are included data_dir <- system.file(package="CrispRVariants", "extdata/ab1/ptena") fq_dir <- tempdir() ab1_fnames <- dir(data_dir, "ab1$", recursive=TRUE, full=TRUE) sq_nms <- gsub(".ab1","",basename(ab1_fnames)) # Replace spaces and slashes in filename with underscores fq_fnames <- paste0(gsub("[\ |\\/]", "_", dirname(ab1_fnames)), ".fastq") # abifToFastq to read AB1 files and write to FASTQ dummy <- mapply( function(u,v,w) { abifToFastq(u,v,file.path(fq_dir,w)) }, sq_nms, ab1_fnames, fq_fnames) ## ---- message=FALSE, warning = FALSE--------------------------------------- length(unique(ab1_fnames)) length(unique(fq_fnames)) ## ---- message = FALSE, warning=FALSE, eval=FALSE--------------------------- # library("Rsamtools") # # # BWA indices were generated using bwa version 0.7.10 # bwa_index <- "GRCHz10.fa.gz" # bam_dir <- system.file(package="CrispRVariants", "extdata/bam") # fq_fnames <- file.path(fq_dir,unique(fq_fnames)) # bm_fnames <- gsub(".fastq$",".bam",basename(fq_fnames)) # srt_bm_fnames <- file.path(bam_dir, gsub(".bam","_s",bm_fnames)) # # # Map, sort and index the bam files, remove the unsorted bams # for(i in 1:length(fq_fnames)) { # cmd <- paste0("bwa mem ", bwa_index, " ", fq_fnames[i], # " | samtools view -Sb - > ", bm_fnames[i]) # message(cmd, "\n"); system(cmd) # indexBam(sortBam(bm_fnames[i],srt_bm_fnames[i])) # unlink(bm_fnames[i]) # } ## ---- message=FALSE-------------------------------------------------------- # The metadata and bam files for this experiment are included with CrispRVariants library("gdata") md_fname <- system.file(package="CrispRVariants", "extdata/metadata/metadata.xls") md <- gdata::read.xls(md_fname, 1) md # Get the bam filenames from the metadata table bam_dir <- system.file(package="CrispRVariants", "extdata/bam") bam_fnames <- file.path(bam_dir, md$bamfile) # check that all files exist all( file.exists(bam_fnames) ) ## ---- message=FALSE-------------------------------------------------------- library(rtracklayer) # Represent the guide as a GenomicRanges::GRanges object gd_fname <- system.file(package="CrispRVariants", "extdata/bed/guide.bed") gd <- rtracklayer::import(gd_fname) gd ## ---- message=FALSE-------------------------------------------------------- gdl <- GenomicRanges::resize(gd, width(gd) + 10, fix = "center") ## ---- eval=FALSE----------------------------------------------------------- # system("samtools faidx GRCHz10.fa.gz") # # reference=system(sprintf("samtools faidx GRCHz10.fa.gz %s:%s-%s", # seqnames(gdl)[1], start(gdl)[1], end(gdl)[1]), # intern = TRUE)[[2]] # # # The guide is on the negative strand, so the reference needs to be reverse complemented # reference=Biostrings::reverseComplement(Biostrings::DNAString(reference)) # save(reference, file = "ptena_GRCHz10_ref.rda") ## -------------------------------------------------------------------------- ref_fname <- system.file(package="CrispRVariants", "extdata/ptena_GRCHz10_ref.rda") load(ref_fname) reference ## ---- tidy = FALSE--------------------------------------------------------- # First read the alignments into R. The alignments must include # the read sequences and the MD tag alns <- GenomicAlignments::readGAlignments(bam_fnames[[1]], param = Rsamtools::ScanBamParam(tag = "MD", what = c("seq", "flag")), use.names = TRUE) # Then reconstruct the reference for the target region. # If no target region is given, this function will reconstruct # the complete reference sequence for all reads. rfa <- refFromAlns(alns, gdl) # The reconstructed reference sequence is identical to the sequence # extracted from the reference above print(rfa == reference) ## ---- message=FALSE-------------------------------------------------------- # Note that the zero point (target.loc parameter) is 22 crispr_set <- readsToTarget(bam_fnames, target = gdl, reference = reference, names = md$Short.name, target.loc = 22) crispr_set # The counts table can be accessed with the "variantCounts" function vc <- variantCounts(crispr_set) print(class(vc)) ## ---- eval = FALSE--------------------------------------------------------- # # In R # library(GenomicFeatures) # gtf_fname <- "Danio_rerio.GRCz10.81_chr17.gtf" # txdb <- GenomicFeatures::makeTxDbFromGFF(gtf_fname, format = "gtf") # saveDb(txdb, file= "GRCz10_81_chr17_txdb.sqlite") ## ---- echo=FALSE, message=FALSE-------------------------------------------- library(GenomicFeatures) txdb_fname <- system.file("extdata/GRCz10_81_ptena_txdb.sqlite", package="CrispRVariants") txdb <- loadDb(txdb_fname) ## ---- message = FALSE------------------------------------------------------ # The gridExtra package is required to specify the legend.key.height # as a "unit" object. It is not needed to call plotVariants() with defaults library(gridExtra) # Match the clutch id to the column names of the variants group <- md$Group ## ----ptena-plot, fig.width = 8.5, fig.height = 7.5, message = FALSE, fig.cap = "(Top) schematic of gene structure showing guide location (left) consensus sequences for variants (right) variant counts in each embryo."---- p <- plotVariants(crispr_set, txdb = txdb, gene.text.size = 8, row.ht.ratio = c(1,8), col.wdth.ratio = c(4,2), plotAlignments.args = list(line.weight = 0.5, ins.size = 2, legend.symbol.size = 4), plotFreqHeatmap.args = list(plot.text.size = 3, x.size = 8, group = group, legend.text.size = 8, legend.key.height = grid::unit(0.5, "lines"))) ## -------------------------------------------------------------------------- # Calculate the mutation efficiency, excluding indels that occur in the "control" sample # and further excluding the "control" sample from the efficiency calculation eff <- mutationEfficiency(crispr_set, filter.cols = "control", exclude.cols = "control") eff # Suppose we just wanted to filter particular variants, not an entire sample. # This can be done using the "filter.vars" argument eff2 <- mutationEfficiency(crispr_set, filter.vars = "6:1D", exclude.cols = "control") # The results are the same in this case as only one variant was filtered from the control identical(eff,eff2) ## -------------------------------------------------------------------------- sqs <- consensusSeqs(crispr_set) sqs # The ptena guide is on the negative strand. # Confirm that the reverse complement of the "no variant" allele # matches the reference sequence: Biostrings::reverseComplement(sqs[["no variant"]]) == reference ## -------------------------------------------------------------------------- ch <- getChimeras(crispr_set, sample = "ptena 4") # Confirm that all chimeric alignments are part of the same read length(unique(names(ch))) == 1 # Set up points to annotate on the plot annotations <- c(resize(gd, 1, fix = "start"), resize(gd, 1, fix = "end")) annotations$name <- c("ptena_start", "ptena_end") plotChimeras(ch, annotations = annotations) ## -------------------------------------------------------------------------- mutationEfficiency(crispr_set, filter.cols = "control", exclude.cols = "control", include.chimeras = FALSE) ## ---- fig.width = 8.5, fig.height = 7.5, message = FALSE, warning = FALSE---- crispr_set_rev <- readsToTarget(bam_fnames, target = gdl, reference = reference, names = md$Short.name, target.loc = 22, orientation = "opposite") plotVariants(crispr_set_rev) ## ---- warning = FALSE------------------------------------------------------ # We create a longer region to use as the "target" # and the corresponding reference sequence gdl <- GenomicRanges::resize(gd, width(gd) + 20, fix = "center") reference <- Biostrings::DNAString("TCATTGCCATGGGCTTTCCAGCCGAACGATTGGAAGGTGTTTA") # At this stage, target should be the entire region to display and target.loc should # be the zero point with respect to this region crispr_set <- readsToTarget(bam_fnames, target = gdl, reference = reference, names = md$Short.name, target.loc = 10, verbose = FALSE) # Multiple guides are added at the stage of plotting # The boundaries of the guide regions must be specified with respect to the # given target region p <- plotVariants(crispr_set, plotAlignments.args = list(pam.start = c(6,35), target.loc = c(10, 32), guide.loc = IRanges::IRanges(c(6, 25),c(20, 37)))) p ## ---- message = FALSE------------------------------------------------------ # Setup for ptena data set library("CrispRVariants") library("rtracklayer") library("GenomicFeatures") library("gdata") # Load the guide location gd_fname <- system.file(package="CrispRVariants", "extdata/bed/guide.bed") gd <- rtracklayer::import(gd_fname) gdl <- resize(gd, width(gd) + 10, fix = "center") # The saved reference sequence corresponds to the guide # plus 5 bases on either side, i.e. gdl ref_fname <- system.file(package="CrispRVariants", "extdata/ptena_GRCHz10_ref.rda") load(ref_fname) # Load the metadata table, which gives the sample names md_fname <- system.file(package="CrispRVariants", "extdata/metadata/metadata.xls") md <- gdata::read.xls(md_fname, 1) # Get the list of bam files bam_dir <- system.file(package="CrispRVariants", "extdata/bam") bam_fnames <- file.path(bam_dir, md$bamfile) # Check that all files were found all(file.exists(bam_fnames)) crispr_set <- readsToTarget(bam_fnames, target = gdl, reference = reference, names = md$Short.name, target.loc = 22, verbose = FALSE) # Load the transcript database txdb_fname <- system.file("extdata/GRCz10_81_ptena_txdb.sqlite", package="CrispRVariants") txdb <- AnnotationDbi::loadDb(txdb_fname) ## ---- fig.height = 5, warning = FALSE-------------------------------------- p <- plotVariants(crispr_set, txdb = txdb) ## ---- fig.height = 5, warning = FALSE-------------------------------------- p <- plotVariants(crispr_set, txdb = txdb, row.ht.ratio = c(1,3)) ## ---- fig.height = 5, message = FALSE, warning = FALSE--------------------- p <- plotVariants(crispr_set, txdb = txdb, col.wdth.ratio = c(4,1)) ## -------------------------------------------------------------------------- # Load gol data set library("CrispRVariants") data("gol_clutch1") ## ---- fig.height = 2.5, message = FALSE, warning = FALSE------------------- library(GenomicFeatures) p <- plotVariants(gol, plotAlignments.args = list(top.n = 3), plotFreqHeatmap.args = list(top.n = 3), left.plot.margin = ggplot2::unit(c(0.1,0,5,0.2), "lines")) ## ---- fig.height = 2.5, message = FALSE, warning = FALSE------------------- plotVariants(gol, plotAlignments.args = list(top.n = 3), plotFreqHeatmap.args = list(top.n = 3, order = c(1,5,3)), left.plot.margin = ggplot2::unit(c(0.1,0,5,0.2), "lines")) ## ---- fig.height = 2.5, warning = FALSE------------------------------------ plotAlignments(gol, top.n = 3, ins.size = 6) ## ---- fig.height = 2.5----------------------------------------------------- plotAlignments(gol, top.n = 3, legend.symbol.size = 6) ## ---- fig.height = 3, warning = FALSE-------------------------------------- plotAlignments(gol, top.n = 5, max.insertion.size = 25) ## ---- fig.height = 3, warning = FALSE-------------------------------------- # Here we set a fairly high value of 50% for min.insertion.freq # As ambiguous nucleotides occur frequently in this data set, # there are no alleles passing this cutoff. plotAlignments(gol, top.n = 5, min.insertion.freq = 50) ## ---- fig.height = 3, warning = FALSE-------------------------------------- plotAlignments(gol, top.n = 5, max.insertion.size = 25, min.insertion.freq = 50) ## ---- fig.height = 2.5, warning = FALSE------------------------------------ # No white space between rows plotAlignments(gol, top.n = 3, tile.height = 1) ## ---- fig.height = 3, warning = FALSE-------------------------------------- # More white space between rows plotAlignments(gol, top.n = 3, tile.height = 0.3) ## ---- fig.height = 2.5, warning = FALSE------------------------------------ plotAlignments(gol, top.n = 3, highlight.guide = FALSE) ## ---- fig.height = 3, message = FALSE-------------------------------------- library(IRanges) guide <- IRanges::IRanges(15,28) plotAlignments(gol, top.n = 3, guide.loc = guide) ## ---- fig.height = 2.5----------------------------------------------------- # Here we increase the size of the axis labels and make # two columns for the legend plotAlignments(gol, top.n = 5, axis.text.size = 12, legend.text.size = 12, legend.cols = 2) ## ---- fig.height = 3, warning = FALSE-------------------------------------- # Don't highlight the PAM sequence plotAlignments(gol, top.n = 3, highlight.pam = FALSE) ## ---- fig.height = 3, warning = FALSE-------------------------------------- # Highlight 3 bases upstream to 3 bases downstream of the target.loc plotAlignments(gol, top.n = 3, pam.start = 19, pam.end = 25) ## ---- fig.height = 3, warning = FALSE-------------------------------------- plotAlignments(gol, top.n = 3, guide.loc = IRanges(5,10), pam.start = 8, pam.end = 13) ## ---- fig.height = 3, warning = FALSE-------------------------------------- plotAlignments(gol, top.n = 3, line.weight = 3) ## ---- fig.height = 3, warning = FALSE-------------------------------------- plotAlignments(gol, top.n = 3, codon.frame = 1) ## ---- eval = FALSE--------------------------------------------------------- # plot_data <- plotAlignments(gol, top.n = 3, create.plot = FALSE) # names(plot_data) # # This data can be modified as required, then replotted using: # do.call(plotAlignments, plot_data) ## ----hmap-default, fig.height = 3, fig.width = 4, fig.align='center', fig.cap = "plotFreqHeatmap with default options"---- # Save the plot to a variable then add a title using ggplot2 syntax. # If the plot is not saved to a variable the unmodified plot is displayed. p <- plotFreqHeatmap(gol, top.n = 3) p + labs(title = "A. plotFreqHeatmap with default options") ## ---- fig.height = 2.5, fig.width = 5, fig.align='center', fig.cap = "plotFreqHeatmap showing allele proportions"---- plotFreqHeatmap(gol, top.n = 3, type = "proportions") ## ---- fig.height = 2.5, fig.width = 4, fig.align='center', fig.cap = "plotFreqHeatmap with X-axis labels coloured by experimental group and tiles coloured by count instead of proportion"---- ncolumns <- ncol(variantCounts(gol)) ncolumns grp <- rep(c(1,2), each = ncolumns/2) p <- plotFreqHeatmap(gol, top.n = 3, group = grp, as.percent = FALSE) p + labs(title = "B. coloured X labels with tiles coloured by count") ## ---- fig.height = 2.5, fig.width = 5, fig.align='center', fig.cap = "plotFreqHeatmap with labels showing allele proportions, header showing counts per sample and modified legend position."---- grp_clrs <- c("red", "purple") p <- plotFreqHeatmap(gol, top.n = 3, group = grp, group.colours = grp_clrs, type = "proportions", header = "counts", legend.position = "bottom") p <- p + labs(title = "C. Modified plotFreqHeatmap") p ## ---- fig.height = 2.5, fig.width = 4, fig.align='center'------------------ plotFreqHeatmap(gol, top.n = 3, legend.key.height = ggplot2::unit(1.5, "lines")) ## ---- eval = FALSE--------------------------------------------------------- # var_counts <- variantCounts(gol, top.n = 3) # # (additional modifications to var_counts can be added here) # plotFreqHeatmap(var_counts) ## ---- fig.height = 2.5----------------------------------------------------- barplotAlleleFreqs(crispr_set, txdb = txdb) ## ---- fig.height = 2.5, message = FALSE------------------------------------ barplotAlleleFreqs(crispr_set, txdb = txdb, palette = "bluered") ## ---- fig.height = 2.5, message = FALSE------------------------------------ barplotAlleleFreqs(crispr_set, txdb = txdb, include.table = FALSE) ## ---- fig.height = 2.5----------------------------------------------------- var_counts <- variantCounts(crispr_set) barplotAlleleFreqs(var_counts) ## ---- fig.height = 2.5----------------------------------------------------- rainbowPal9 <- c("#781C81","#3F4EA1","#4683C1", "#57A3AD","#6DB388","#B1BE4E", "#DFA53A","#E7742F","#D92120") barplotAlleleFreqs(var_counts, classify = FALSE, bar.colours = rainbowPal9) ## ---- fig.height = 2.5----------------------------------------------------- # Classify variants as insertion/deletion/mixed byType <- crispr_set$classifyVariantsByType() byType # Classify variants by their location, without considering size byLoc <- crispr_set$classifyVariantsByLoc(txdb=txdb) byLoc # Coding variants can then be classified by setting a size cutoff byLoc <- crispr_set$classifyCodingBySize(byLoc, cutoff = 6) byLoc # Combine filtering and variant classification, using barplotAlleleFreqs.matrix vc <- variantCounts(crispr_set) # Select variants that occur in at least two samples keep <- names(which(rowSums(vc > 0) > 1)) keep # Use this classification and the selected variants barplotAlleleFreqs(vc[keep,], category.labels = byLoc[keep]) ## ---- fig.height = 2.5----------------------------------------------------- p <- plotAlignments(gol, top.n = 3) p + theme(legend.margin = ggplot2::unit(0, "cm")) ## ---- fig.height = 1------------------------------------------------------- # Get a reference sequence library("CrispRVariants") data("gol_clutch1") ref <- gol$ref #Then to make the plot: plotAlignments(ref, alns = NULL, target.loc = 22, ins.sites = data.frame()) ## ---- message = FALSE, warning = FALSE------------------------------------- library(Biostrings) library(CrispRVariants) library(rtracklayer) ## ---- warning = FALSE------------------------------------------------------ # This is a small, manually generated data set with a variety of different mutations bam_fname <- system.file("extdata", "cntnap2b_test_data_s.bam", package = "CrispRVariants") guide_fname <- system.file("extdata", "cntnap2b_test_data_guide.bed", package = "CrispRVariants") guide <- rtracklayer::import(guide_fname) guide <- guide + 5 reference <- Biostrings::DNAString("TAGGCGAATGAAGTCGGGGTTGCCCAGGTTCTC") cset <- readsToTarget(bam_fname, guide, reference = reference, verbose = FALSE, name = "Default") cset2 <- readsToTarget(bam_fname, guide, reference = reference, verbose = FALSE, chimera.to.target = 100, name = "Including long dels") default_var_counts <- variantCounts(cset) print(default_var_counts) print(c("Total number of reads: ", colSums(default_var_counts))) # With chimera.to.target = 100, an additional read representing a large deletion is # reported in the "Other" category. var_counts_inc_long_dels <- variantCounts(cset2) print(var_counts_inc_long_dels) print(c("Total number of reads: ", colSums(var_counts_inc_long_dels))) # This alignment can be viewed using `plotChimeras` ch <- getChimeras(cset2, sample = 1) plotChimeras(ch, annotations = cset2$target)
get_tablename <- function(x) { UseMethod("get_tablename") } get_tablename.default <- function(x) { x } get_tablename.character <- function(x) { x } get_tablename.aws_dynamodb_table <- function(x) { x$TableName } map_attributes <- function(item) { item_formatted <- list() for (i in seq_along(item)) { if (is.null(item[[i]])) { item_formatted[[i]] <- list(NULL = TRUE) } else if (is.list(item[[i]])) { if (any(names(item[[i]]) %in% "")) { item_formatted[[i]] <- list(L = unname(item[[i]])) } else { item_formatted[[i]] <- list(M = item[[i]]) } } else if (is.raw(item[[i]])) { item_formatted[[i]] <- list(B = jsonlite::base64_enc(item[[i]])) } else if (is.logical(item[[i]])) { item_formatted[[i]] <- list(BOOL = item[[i]]) } else if (is.numeric(item[[i]])) { if (length(item[[i]]) == 1L) { item_formatted[[i]] <- list(N = item[[i]]) } else { item_formatted[[i]] <- list(NS = item[[i]]) } } else { if (length(item[[i]]) == 1L) { item_formatted[[i]] <- list(S = as.character(item[[i]])) } else { item_formatted[[i]] <- list(SS = as.character(item[[i]])) } } } names(item_formatted) <- names(item) return(item_formatted) }
/R/utils.R
no_license
peetermeos/aws.dynamodb
R
false
false
1,456
r
get_tablename <- function(x) { UseMethod("get_tablename") } get_tablename.default <- function(x) { x } get_tablename.character <- function(x) { x } get_tablename.aws_dynamodb_table <- function(x) { x$TableName } map_attributes <- function(item) { item_formatted <- list() for (i in seq_along(item)) { if (is.null(item[[i]])) { item_formatted[[i]] <- list(NULL = TRUE) } else if (is.list(item[[i]])) { if (any(names(item[[i]]) %in% "")) { item_formatted[[i]] <- list(L = unname(item[[i]])) } else { item_formatted[[i]] <- list(M = item[[i]]) } } else if (is.raw(item[[i]])) { item_formatted[[i]] <- list(B = jsonlite::base64_enc(item[[i]])) } else if (is.logical(item[[i]])) { item_formatted[[i]] <- list(BOOL = item[[i]]) } else if (is.numeric(item[[i]])) { if (length(item[[i]]) == 1L) { item_formatted[[i]] <- list(N = item[[i]]) } else { item_formatted[[i]] <- list(NS = item[[i]]) } } else { if (length(item[[i]]) == 1L) { item_formatted[[i]] <- list(S = as.character(item[[i]])) } else { item_formatted[[i]] <- list(SS = as.character(item[[i]])) } } } names(item_formatted) <- names(item) return(item_formatted) }
test_that("build_sql() requires connection", { x <- ident("TABLE") expect_snapshot(error = TRUE, build_sql("SELECT * FROM ", x)) })
/tests/testthat/test-build-sql.R
permissive
mgirlich/dbplyr
R
false
false
136
r
test_that("build_sql() requires connection", { x <- ident("TABLE") expect_snapshot(error = TRUE, build_sql("SELECT * FROM ", x)) })
library(shiny) library(forcer) ui <- fluidPage( titlePanel("reactR HTMLWidget Example"), forcerOutput('widgetOutput') ) server <- function(input, output, session) { output$widgetOutput <- renderForcer( forcer("Hello world!") ) } shinyApp(ui, server)
/app.R
permissive
react-R/forcer
R
false
false
264
r
library(shiny) library(forcer) ui <- fluidPage( titlePanel("reactR HTMLWidget Example"), forcerOutput('widgetOutput') ) server <- function(input, output, session) { output$widgetOutput <- renderForcer( forcer("Hello world!") ) } shinyApp(ui, server)
\name{Data} \alias{Data} \alias{DataCodominant} \alias{DataDominant} \alias{DataContingency} \title{Data preparation} \description{Read a text file with coordinates and markers in columns and individuals in rows.} \usage{DataDominant(input_file,conversion,nb_x,nb_y,output_coords="coord_km.txt") DataCodominant(input_file,conversion,nb_x,nb_y,output_coords="coord_km.txt") DataContingency(input_file,conversion,nb_x,nb_y,output_coords="coord_km.txt")} \arguments{ \item{input_file}{Path of the input text file. For dominant or codominant data, each row contains the name of the individual, the two coordinates (either abscissa and ordinates, or longitude and latitude), and the genetic data in succession. For contingency table, each row corresponds to a sampled point, with the name of the point, its coordinates, and the number of individuals for each modality of each variable.} \item{conversion}{0 if the coordinates are cartesians, 1 if they are in degree and therefore need to be converted to cartesians.} \item{nb_x,nb_y}{number of pixels in width and length of the grid.} \item{output_coords}{the name of the file where the kilometer coordinates will be saved in. Default value is "coord\_indiv.txt".} } \value{a list of six items : \item{spatial coordinates of individuals}{a matrix with one line per individual, and two columns containing abscissa and ordinates of individuals, (x,y).} \item{genetic_encoded}{the genetic data, containing one column per locus. If data are dominant, it's the same table as the input file.} \item{grid}{a list of the vector of x, and the vector of y.} \item{cvx_vertices}{the vertices of the convex hull of sampling area (same format than individuals coordinates).} \item{cvx_matrix}{a matrix containing a 1 if the corresponding point of the grid is in the convex hull, and a 0 otherwise.} \item{nb_individual}{the number of individuals in the dataset.} } \keyword{manip}
/man/Data.Rd
no_license
cran/wombsoft
R
false
false
1,949
rd
\name{Data} \alias{Data} \alias{DataCodominant} \alias{DataDominant} \alias{DataContingency} \title{Data preparation} \description{Read a text file with coordinates and markers in columns and individuals in rows.} \usage{DataDominant(input_file,conversion,nb_x,nb_y,output_coords="coord_km.txt") DataCodominant(input_file,conversion,nb_x,nb_y,output_coords="coord_km.txt") DataContingency(input_file,conversion,nb_x,nb_y,output_coords="coord_km.txt")} \arguments{ \item{input_file}{Path of the input text file. For dominant or codominant data, each row contains the name of the individual, the two coordinates (either abscissa and ordinates, or longitude and latitude), and the genetic data in succession. For contingency table, each row corresponds to a sampled point, with the name of the point, its coordinates, and the number of individuals for each modality of each variable.} \item{conversion}{0 if the coordinates are cartesians, 1 if they are in degree and therefore need to be converted to cartesians.} \item{nb_x,nb_y}{number of pixels in width and length of the grid.} \item{output_coords}{the name of the file where the kilometer coordinates will be saved in. Default value is "coord\_indiv.txt".} } \value{a list of six items : \item{spatial coordinates of individuals}{a matrix with one line per individual, and two columns containing abscissa and ordinates of individuals, (x,y).} \item{genetic_encoded}{the genetic data, containing one column per locus. If data are dominant, it's the same table as the input file.} \item{grid}{a list of the vector of x, and the vector of y.} \item{cvx_vertices}{the vertices of the convex hull of sampling area (same format than individuals coordinates).} \item{cvx_matrix}{a matrix containing a 1 if the corresponding point of the grid is in the convex hull, and a 0 otherwise.} \item{nb_individual}{the number of individuals in the dataset.} } \keyword{manip}
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/analytics-dashboard.R \name{sf_dashboard_refresh} \alias{sf_dashboard_refresh} \title{Refresh an existing dashboard} \usage{ sf_dashboard_refresh(dashboard_id, dashboard_filters = c(character(0))) } \arguments{ \item{dashboard_id}{\code{character}; the Salesforce Id assigned to a created dashboard. It will start with \code{"01Z"}.} \item{dashboard_filters}{\code{character}; Dashboard results are always unfiltered, unless you have specified filter parameters in your request. Use this argument to include up to three optional filter Ids. You can obtain the list of defined filter Ids from the dashboard metadata using \link{sf_dashboard_describe}.} } \value{ \code{list} } \description{ \ifelse{html}{\href{https://lifecycle.r-lib.org/articles/stages.html#experimental}{\figure{lifecycle-experimental.svg}{options: alt='[Experimental]'}}}{\strong{[Experimental]}} }
/man/sf_dashboard_refresh.Rd
permissive
jfer2pi/salesforcer
R
false
true
948
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/analytics-dashboard.R \name{sf_dashboard_refresh} \alias{sf_dashboard_refresh} \title{Refresh an existing dashboard} \usage{ sf_dashboard_refresh(dashboard_id, dashboard_filters = c(character(0))) } \arguments{ \item{dashboard_id}{\code{character}; the Salesforce Id assigned to a created dashboard. It will start with \code{"01Z"}.} \item{dashboard_filters}{\code{character}; Dashboard results are always unfiltered, unless you have specified filter parameters in your request. Use this argument to include up to three optional filter Ids. You can obtain the list of defined filter Ids from the dashboard metadata using \link{sf_dashboard_describe}.} } \value{ \code{list} } \description{ \ifelse{html}{\href{https://lifecycle.r-lib.org/articles/stages.html#experimental}{\figure{lifecycle-experimental.svg}{options: alt='[Experimental]'}}}{\strong{[Experimental]}} }
if(FALSE){ tab_res <- table_results(fit, columns = NULL) mm <- tab_res[tab_res$op == "=~", ] sem <- tab_res[tab_res$op == "~" | (tab_res$op == "~~" & !(tab_res$lhs == tab_res$rhs)), ] selected = list("") if(!any(sem$op == "~")){ selected[[1]] <- unique(c(sem$lhs, sem$rhs)) } else { # Drop correlations reg_only <- sem[!sem$op == "~~", ] remaining <- unique(c(reg_only$lhs, reg_only$rhs)) maxit <- 0 while(length(selected[[length(selected)]]) > 0 & maxit < 100){ reg_only <- reg_only[!reg_only$lhs %in% unlist(selected), ] selected <- c(selected, list( unique(reg_only$lhs[!(reg_only$lhs %in% reg_only$rhs)]) )) maxit <- maxit + 1 } if(maxit == 100){ stop("Maximum number of iterations exceeded in recursive layout algorithm.") } selected[[1]] <- NULL selected[[length(selected)]] <- unique(remaining[!remaining %in% unlist(selected)]) selected <- selected[length(selected):1] } if(nrow(mm) > 0){ # If there is a measurement model items_per_col <- lapply(selected, function(thisvar){unique(mm$rhs[mm$lhs == thisvar])}) lvs_per_col <- lapply(selected, function(thiscol){ unique(mm$lhs[mm$lhs %in% thiscol]) }) max_cells <- max(max(sapply(selected, length)), max(sapply(items_per_col, length))) if(length(selected) == 1){ mm_col <- unlist(items_per_col) lv_col <- space_these(selected[[1]], max_cells) out <- rbind(mm_col, lv_col) } else { # If there are multiple cols in the layout for(this_col in 1:length(selected)){ if(this_col == 1){ } if(this_col == length(selected)){ } } lapply(selected, function(this_col){ }) } } # Remove rownames rownames(out) <- NULL return(out) } space_these <- function(these, n){ #these <- letters[1:3] #n = 9 out <- rep(NA, n) cellsper <- n/length(these) is_int <- (cellsper %% 1) == 0 if(is_int){ is_odd <- (cellsper %% 2) == 1 if(is_odd){ the_seq <- seq(from = ceiling(cellsper/2), to = n-floor(cellsper/2), length.out = length(these)) } else { the_seq <- seq(from = floor(cellsper/2), to = n-floor(cellsper/2), length.out = length(these)) } } else { browser() # Fix this } out[the_seq] <- these out } # @title Generate a rudimentary layout from a model object # @description This is a wrapper function to the # \code{\link[igraph]{layout_as_tree}} function, or other layout # functions from the \code{\link[igraph]{igraph-package}}. It returns a layout # in matrix format. # @param x A model for which a method exists. # @param layout_algorithm Which algorithm to use, from the # \code{\link[igraph]{igraph-package}}. The default Reingold-Tilford algorithm # is most suitable for SEM graphs. # @return Matrix # @examples # \dontrun{ # library(lavaan) # fit <- sem("Sepal.Length ~ Petal.Width", data = iris) # generate_layout(fit) # } # @rdname generate_layout #' @method get_layout lavaan #' @rdname get_layout #' @param layout_algorithm Optional argument for fit model objects. Character #' string, indicating which \code{igraph} #' layout algorithm to apply to position the nodes. Defaults to #' \code{"layout_as_tree"}; see details for more options. #' @export get_layout.lavaan <- function(x, ..., layout_algorithm = "layout_as_tree"){ Args <- as.list(match.call()[-1]) Args$x <- table_results(x, columns = NULL) do.call(get_layout, Args) } #' @method get_layout mplus.model #' @export get_layout.mplus.model <- get_layout.lavaan #' @method get_layout tidy_results #' @export #' @importFrom igraph graph.data.frame vertex.attributes #' layout_as_star layout_as_tree layout_in_circle layout_nicely #' layout_on_grid layout_randomly layout_with_dh layout_with_fr layout_with_gem #' layout_with_graphopt layout_with_kk layout_with_lgl layout_with_mds get_layout.tidy_results <- function(x, ..., layout_algorithm = "layout_as_tree"){ tab_res <- x df <- tab_res[tab_res$op %in% c("~~", "~", "=~"), c("lhs", "rhs")] g <- graph.data.frame(df, directed = TRUE) lo <- do.call(layout_algorithm, list(g)) lo <- round(lo) if(any(duplicated(lo))){ lo <- resolve_dups(lo) #stop("Could not snap to grid, some nodes were in the same location.") } lo <- sweep(lo, 2, (apply(lo, 2, min)-1), "-") out <- matrix(nrow = max(lo[,2]), ncol = max(lo[, 1])) vnames <- vertex.attributes(g)$name for(this_var in 1:length(vnames)){ out[lo[this_var, 2], lo[this_var, 1]] <- vnames[this_var] } if(dim(out)[2] < dim(out)[1]){ out <- t(out) } else { out <- out[nrow(out):1, ] } class(out) <- c("layout_matrix", class(out)) return(out) } #' @importFrom utils tail resolve_dups <- function(lo){ new_lo <- lo first_dup <- which(duplicated(lo))[1] dup_row <- lo[first_dup,] neighboring_locs <- t(apply(expand.grid(c(-1,0,1), c(-1,0,1)), 1, `+`, dup_row)) free_locs <- neighboring_locs[tail(!duplicated(rbind(lo, neighboring_locs)), 9), ] if(nrow(free_locs) == 0) stop("Could not generate layout automatically. Please specify a layout manually.") new_lo[first_dup, ] <- free_locs[sample.int(nrow(free_locs), 1), ] if(any(duplicated(new_lo))){ resolve_dups(new_lo) } else { return(new_lo) } } #' @title Generate graph layout #' @description Generate a tidy_layout for a SEM graph. #' @param x An object for which a method exists; currently, methods exist for #' \code{character}, \code{lavaan}, and \code{mplus.model} objects. #' @param ... Character arguments corresponding to layout elements. Use node #' names, empty strings (""), or NA values. #' @details There are three ways to generate a layout: #' \enumerate{ #' \item Specify the layout in the call to \code{get_layout()} by providing #' node names and the number of #' rows to create a layout matrix. Empty strings (\code{""}) #' or \code{NA} can be used for empty cells. See Example 1. #' \item Call \code{get_layout()} on a model object or \code{tidy_results} #' object. It will use the function #' \code{\link[igraph]{layout_as_tree}}, or any other layout function #' from the \code{igraph} package, to generate a rudimentary layout. See #' Example 2. #' \item Instead of using \code{get_layout()}, just use a \code{matrix} or #' \code{data.frame} with your layout. For example, specify the layout in a #' spreadsheet program, and load it into R (see Example 3). Or, copy the #' layout to the clipboard from your spreadsheet program, and load it from the #' clipboard (see Example 4) #' } #' The layout algorithms imported from \code{igraph} are: #' \code{c("layout_as_star", #' "layout_as_tree", "layout_in_circle", "layout_nicely", #' "layout_on_grid", "layout_randomly", "layout_with_dh", "layout_with_fr", #' "layout_with_gem", #' "layout_with_graphopt", "layout_with_kk", "layout_with_lgl", #' "layout_with_mds")}. These can be used by specifying the optional argument #' \code{layout_algorithm = ""}. #' @return Object of class 'tidy_layout' #' @examples #' # Example 1 #' get_layout("c", NA, "d", #' NA, "e", NA, rows = 2) #' #' # Example 2 #' library(lavaan) #' fit <- cfa(' visual =~ x1 + x2 + x3 ', #' data = HolzingerSwineford1939[1:50, ]) #' get_layout(fit) #' #' \dontrun{ #' # Example 3 #' # Here, we first write the layout to .csv, but you could create it in a #' # spreadsheet program, and save the spreadsheet to .csv: #' write.csv(matrix(c("c", "", "d", "", "e", ""), nrow = 2, byrow = TRUE), #' file = file.path(tempdir(), "example3.csv"), row.names = FALSE) #' # Now, we load the .csv: #' read.csv(file.path(tempdir(), "example3.csv")) #' #' # Example 4 #' # For this example, make your layout in a spreadsheet program, select it, and #' # copy to clipboard. Reading from the clipboard works differently in Windows #' # and Mac. For this example, I used Microsoft Excel. #' # On Windows, run: #' read.table("clipboard", sep = "\t") #' # On Mac, run: #' read.table(pipe("pbpaste"), sep="\t") #' } #' @rdname get_layout #' @keywords tidy_graph # @seealso long_layout #' @export get_layout <- function(x, ...){ UseMethod("get_layout", x) } # @title Generate graph layout # @description Generate a tidy_layout for a SEM graph by specifying node names, # and empty strings or \code{NA} values for spaces. # @param ... Character arguments corresponding to layout elements. Use node # names, empty strings (""), or NA values. # @param rows Numeric, indicating the number of rows of the graph. # @return Object of class 'tidy_layout' # @examples # get_layout("c", "", "d", # "", "e", "", rows = 2) # @rdname layout # @keywords tidy_graph # @seealso long_layout #' @param rows Numeric, indicating the number of rows of the graph. #' @rdname get_layout #' @method get_layout default #' @export get_layout.default <- function(x, ..., rows = NULL){ Args <- as.list(match.call()[-1]) if("rows" %in% names(Args)){ Args$rows <- NULL } else { if(length(sapply(Args, is.numeric)) == 1){ Args[which(sapply(Args, is.numeric))] <- NULL } else { stop("Provide 'rows' argument.", call. = FALSE) } } if(!(length(Args) %% rows == 0)){ stop("Number of arguments is not a multiple of rows = ", rows, call. = FALSE) } vec <- do.call(c, Args) out <- do.call(matrix, list( data = vec, nrow = rows, byrow = TRUE )) class(out) <- c("layout_matrix", class(out)) return(out) } # @title Convert object to layout # @description Convert an object to a tidy_layout for a SEM graph. # @param x Object to convert to a tidy_layout. The default argument reads a # selected matrix from the clipboard. # To use this functionality, specify your layout in a spreadsheet program, # select the block of cells, and copy it to the clipboard. # @return Object of class 'tidy_layout' # @examples # \dontrun{ # if(interactive()){ # #EXAMPLE1 # } # } # @rdname long_layout # @keywords tidy_graph # @export long_layout <- function(x){ UseMethod("long_layout") } #' @method long_layout data.frame #' @export long_layout.data.frame <- function(x){ Args <- as.list(match.call()[-1]) Args$x <- as.matrix(x) do.call(long_layout, Args) } #' @method long_layout matrix #' @export long_layout.matrix <- function(x){ mat <- x mat[is.na(mat)] <- "" nodes_long <- setNames(as.data.frame.table(mat), c("y", "x", "name")) nodes_long[1:2] <- lapply(nodes_long[1:2], as.numeric) nodes_long$y <- (max(nodes_long$y)+1)-nodes_long$y nodes_long$name <- as.character(nodes_long$name) nodes_long <- nodes_long[!nodes_long$name == "", ] row.names(nodes_long) <- NULL class(nodes_long) <- c("tidy_layout", class(nodes_long)) nodes_long }
/R/plot-generate_layout.R
no_license
stjordanis/tidySEM
R
false
false
11,015
r
if(FALSE){ tab_res <- table_results(fit, columns = NULL) mm <- tab_res[tab_res$op == "=~", ] sem <- tab_res[tab_res$op == "~" | (tab_res$op == "~~" & !(tab_res$lhs == tab_res$rhs)), ] selected = list("") if(!any(sem$op == "~")){ selected[[1]] <- unique(c(sem$lhs, sem$rhs)) } else { # Drop correlations reg_only <- sem[!sem$op == "~~", ] remaining <- unique(c(reg_only$lhs, reg_only$rhs)) maxit <- 0 while(length(selected[[length(selected)]]) > 0 & maxit < 100){ reg_only <- reg_only[!reg_only$lhs %in% unlist(selected), ] selected <- c(selected, list( unique(reg_only$lhs[!(reg_only$lhs %in% reg_only$rhs)]) )) maxit <- maxit + 1 } if(maxit == 100){ stop("Maximum number of iterations exceeded in recursive layout algorithm.") } selected[[1]] <- NULL selected[[length(selected)]] <- unique(remaining[!remaining %in% unlist(selected)]) selected <- selected[length(selected):1] } if(nrow(mm) > 0){ # If there is a measurement model items_per_col <- lapply(selected, function(thisvar){unique(mm$rhs[mm$lhs == thisvar])}) lvs_per_col <- lapply(selected, function(thiscol){ unique(mm$lhs[mm$lhs %in% thiscol]) }) max_cells <- max(max(sapply(selected, length)), max(sapply(items_per_col, length))) if(length(selected) == 1){ mm_col <- unlist(items_per_col) lv_col <- space_these(selected[[1]], max_cells) out <- rbind(mm_col, lv_col) } else { # If there are multiple cols in the layout for(this_col in 1:length(selected)){ if(this_col == 1){ } if(this_col == length(selected)){ } } lapply(selected, function(this_col){ }) } } # Remove rownames rownames(out) <- NULL return(out) } space_these <- function(these, n){ #these <- letters[1:3] #n = 9 out <- rep(NA, n) cellsper <- n/length(these) is_int <- (cellsper %% 1) == 0 if(is_int){ is_odd <- (cellsper %% 2) == 1 if(is_odd){ the_seq <- seq(from = ceiling(cellsper/2), to = n-floor(cellsper/2), length.out = length(these)) } else { the_seq <- seq(from = floor(cellsper/2), to = n-floor(cellsper/2), length.out = length(these)) } } else { browser() # Fix this } out[the_seq] <- these out } # @title Generate a rudimentary layout from a model object # @description This is a wrapper function to the # \code{\link[igraph]{layout_as_tree}} function, or other layout # functions from the \code{\link[igraph]{igraph-package}}. It returns a layout # in matrix format. # @param x A model for which a method exists. # @param layout_algorithm Which algorithm to use, from the # \code{\link[igraph]{igraph-package}}. The default Reingold-Tilford algorithm # is most suitable for SEM graphs. # @return Matrix # @examples # \dontrun{ # library(lavaan) # fit <- sem("Sepal.Length ~ Petal.Width", data = iris) # generate_layout(fit) # } # @rdname generate_layout #' @method get_layout lavaan #' @rdname get_layout #' @param layout_algorithm Optional argument for fit model objects. Character #' string, indicating which \code{igraph} #' layout algorithm to apply to position the nodes. Defaults to #' \code{"layout_as_tree"}; see details for more options. #' @export get_layout.lavaan <- function(x, ..., layout_algorithm = "layout_as_tree"){ Args <- as.list(match.call()[-1]) Args$x <- table_results(x, columns = NULL) do.call(get_layout, Args) } #' @method get_layout mplus.model #' @export get_layout.mplus.model <- get_layout.lavaan #' @method get_layout tidy_results #' @export #' @importFrom igraph graph.data.frame vertex.attributes #' layout_as_star layout_as_tree layout_in_circle layout_nicely #' layout_on_grid layout_randomly layout_with_dh layout_with_fr layout_with_gem #' layout_with_graphopt layout_with_kk layout_with_lgl layout_with_mds get_layout.tidy_results <- function(x, ..., layout_algorithm = "layout_as_tree"){ tab_res <- x df <- tab_res[tab_res$op %in% c("~~", "~", "=~"), c("lhs", "rhs")] g <- graph.data.frame(df, directed = TRUE) lo <- do.call(layout_algorithm, list(g)) lo <- round(lo) if(any(duplicated(lo))){ lo <- resolve_dups(lo) #stop("Could not snap to grid, some nodes were in the same location.") } lo <- sweep(lo, 2, (apply(lo, 2, min)-1), "-") out <- matrix(nrow = max(lo[,2]), ncol = max(lo[, 1])) vnames <- vertex.attributes(g)$name for(this_var in 1:length(vnames)){ out[lo[this_var, 2], lo[this_var, 1]] <- vnames[this_var] } if(dim(out)[2] < dim(out)[1]){ out <- t(out) } else { out <- out[nrow(out):1, ] } class(out) <- c("layout_matrix", class(out)) return(out) } #' @importFrom utils tail resolve_dups <- function(lo){ new_lo <- lo first_dup <- which(duplicated(lo))[1] dup_row <- lo[first_dup,] neighboring_locs <- t(apply(expand.grid(c(-1,0,1), c(-1,0,1)), 1, `+`, dup_row)) free_locs <- neighboring_locs[tail(!duplicated(rbind(lo, neighboring_locs)), 9), ] if(nrow(free_locs) == 0) stop("Could not generate layout automatically. Please specify a layout manually.") new_lo[first_dup, ] <- free_locs[sample.int(nrow(free_locs), 1), ] if(any(duplicated(new_lo))){ resolve_dups(new_lo) } else { return(new_lo) } } #' @title Generate graph layout #' @description Generate a tidy_layout for a SEM graph. #' @param x An object for which a method exists; currently, methods exist for #' \code{character}, \code{lavaan}, and \code{mplus.model} objects. #' @param ... Character arguments corresponding to layout elements. Use node #' names, empty strings (""), or NA values. #' @details There are three ways to generate a layout: #' \enumerate{ #' \item Specify the layout in the call to \code{get_layout()} by providing #' node names and the number of #' rows to create a layout matrix. Empty strings (\code{""}) #' or \code{NA} can be used for empty cells. See Example 1. #' \item Call \code{get_layout()} on a model object or \code{tidy_results} #' object. It will use the function #' \code{\link[igraph]{layout_as_tree}}, or any other layout function #' from the \code{igraph} package, to generate a rudimentary layout. See #' Example 2. #' \item Instead of using \code{get_layout()}, just use a \code{matrix} or #' \code{data.frame} with your layout. For example, specify the layout in a #' spreadsheet program, and load it into R (see Example 3). Or, copy the #' layout to the clipboard from your spreadsheet program, and load it from the #' clipboard (see Example 4) #' } #' The layout algorithms imported from \code{igraph} are: #' \code{c("layout_as_star", #' "layout_as_tree", "layout_in_circle", "layout_nicely", #' "layout_on_grid", "layout_randomly", "layout_with_dh", "layout_with_fr", #' "layout_with_gem", #' "layout_with_graphopt", "layout_with_kk", "layout_with_lgl", #' "layout_with_mds")}. These can be used by specifying the optional argument #' \code{layout_algorithm = ""}. #' @return Object of class 'tidy_layout' #' @examples #' # Example 1 #' get_layout("c", NA, "d", #' NA, "e", NA, rows = 2) #' #' # Example 2 #' library(lavaan) #' fit <- cfa(' visual =~ x1 + x2 + x3 ', #' data = HolzingerSwineford1939[1:50, ]) #' get_layout(fit) #' #' \dontrun{ #' # Example 3 #' # Here, we first write the layout to .csv, but you could create it in a #' # spreadsheet program, and save the spreadsheet to .csv: #' write.csv(matrix(c("c", "", "d", "", "e", ""), nrow = 2, byrow = TRUE), #' file = file.path(tempdir(), "example3.csv"), row.names = FALSE) #' # Now, we load the .csv: #' read.csv(file.path(tempdir(), "example3.csv")) #' #' # Example 4 #' # For this example, make your layout in a spreadsheet program, select it, and #' # copy to clipboard. Reading from the clipboard works differently in Windows #' # and Mac. For this example, I used Microsoft Excel. #' # On Windows, run: #' read.table("clipboard", sep = "\t") #' # On Mac, run: #' read.table(pipe("pbpaste"), sep="\t") #' } #' @rdname get_layout #' @keywords tidy_graph # @seealso long_layout #' @export get_layout <- function(x, ...){ UseMethod("get_layout", x) } # @title Generate graph layout # @description Generate a tidy_layout for a SEM graph by specifying node names, # and empty strings or \code{NA} values for spaces. # @param ... Character arguments corresponding to layout elements. Use node # names, empty strings (""), or NA values. # @param rows Numeric, indicating the number of rows of the graph. # @return Object of class 'tidy_layout' # @examples # get_layout("c", "", "d", # "", "e", "", rows = 2) # @rdname layout # @keywords tidy_graph # @seealso long_layout #' @param rows Numeric, indicating the number of rows of the graph. #' @rdname get_layout #' @method get_layout default #' @export get_layout.default <- function(x, ..., rows = NULL){ Args <- as.list(match.call()[-1]) if("rows" %in% names(Args)){ Args$rows <- NULL } else { if(length(sapply(Args, is.numeric)) == 1){ Args[which(sapply(Args, is.numeric))] <- NULL } else { stop("Provide 'rows' argument.", call. = FALSE) } } if(!(length(Args) %% rows == 0)){ stop("Number of arguments is not a multiple of rows = ", rows, call. = FALSE) } vec <- do.call(c, Args) out <- do.call(matrix, list( data = vec, nrow = rows, byrow = TRUE )) class(out) <- c("layout_matrix", class(out)) return(out) } # @title Convert object to layout # @description Convert an object to a tidy_layout for a SEM graph. # @param x Object to convert to a tidy_layout. The default argument reads a # selected matrix from the clipboard. # To use this functionality, specify your layout in a spreadsheet program, # select the block of cells, and copy it to the clipboard. # @return Object of class 'tidy_layout' # @examples # \dontrun{ # if(interactive()){ # #EXAMPLE1 # } # } # @rdname long_layout # @keywords tidy_graph # @export long_layout <- function(x){ UseMethod("long_layout") } #' @method long_layout data.frame #' @export long_layout.data.frame <- function(x){ Args <- as.list(match.call()[-1]) Args$x <- as.matrix(x) do.call(long_layout, Args) } #' @method long_layout matrix #' @export long_layout.matrix <- function(x){ mat <- x mat[is.na(mat)] <- "" nodes_long <- setNames(as.data.frame.table(mat), c("y", "x", "name")) nodes_long[1:2] <- lapply(nodes_long[1:2], as.numeric) nodes_long$y <- (max(nodes_long$y)+1)-nodes_long$y nodes_long$name <- as.character(nodes_long$name) nodes_long <- nodes_long[!nodes_long$name == "", ] row.names(nodes_long) <- NULL class(nodes_long) <- c("tidy_layout", class(nodes_long)) nodes_long }
context("Frequencies are calculates correctly") test_that("Stop frequencies (headways) for included data are as expected", { gtfs_obj <- get_stop_frequency(gtfs_obj, by_route=FALSE) stop_frequency_summary <- gtfs_obj$stops_frequency_df fifteenth_st_at_hillsborough_rd <- stop_frequency_summary[stop_frequency_summary$stop_id==778123,]$headway expect_equal(as.integer(7.8688), as.integer(fifteenth_st_at_hillsborough_rd)) }) test_that("Route frequencies (headways) for included data are as expected", { gtfs_obj <- get_route_frequency(gtfs_obj) rf <- gtfs_obj$routes_frequency_df expect_equal(rf[rf$route_id==1679,]$median_headways, 26) })
/tests/testthat/test_headways.R
no_license
walkerke/tidytransit
R
false
false
654
r
context("Frequencies are calculates correctly") test_that("Stop frequencies (headways) for included data are as expected", { gtfs_obj <- get_stop_frequency(gtfs_obj, by_route=FALSE) stop_frequency_summary <- gtfs_obj$stops_frequency_df fifteenth_st_at_hillsborough_rd <- stop_frequency_summary[stop_frequency_summary$stop_id==778123,]$headway expect_equal(as.integer(7.8688), as.integer(fifteenth_st_at_hillsborough_rd)) }) test_that("Route frequencies (headways) for included data are as expected", { gtfs_obj <- get_route_frequency(gtfs_obj) rf <- gtfs_obj$routes_frequency_df expect_equal(rf[rf$route_id==1679,]$median_headways, 26) })
# calculate the temperature response multiplier for Vcmax and Jmax (Kattge and Knorr 2007) calc_tresp_mult = function(tleaf, tmean, tref){ temp <- tleaf + 273.15 Ha <- 71513 # Activation Energy (J mol^-1) Massad 2007 Hd <- 200000 # Deactivaiton energy (J mol^-1) Massad 2007 adelS <- 668.39 bdelS <- -1.07 trefK <- tref + 273.15 R <- 8.314 # Universal Gas constant (J mol^-1 K^-1) kbeg <- exp(Ha*(temp-trefK)/(trefK*R*temp)) kend <-((1+exp((trefK*(adelS+bdelS*tmean)-Hd)/(trefK*R)))/(1+exp((temp*(adelS+bdelS*tmean)-Hd)/(temp*R)))) ktotal <- kbeg*kend # Equation 20 in Smith 2019 return(ktotal) }
/functions/calc_tresp_mult.R
no_license
hgscott/C4model
R
false
false
635
r
# calculate the temperature response multiplier for Vcmax and Jmax (Kattge and Knorr 2007) calc_tresp_mult = function(tleaf, tmean, tref){ temp <- tleaf + 273.15 Ha <- 71513 # Activation Energy (J mol^-1) Massad 2007 Hd <- 200000 # Deactivaiton energy (J mol^-1) Massad 2007 adelS <- 668.39 bdelS <- -1.07 trefK <- tref + 273.15 R <- 8.314 # Universal Gas constant (J mol^-1 K^-1) kbeg <- exp(Ha*(temp-trefK)/(trefK*R*temp)) kend <-((1+exp((trefK*(adelS+bdelS*tmean)-Hd)/(trefK*R)))/(1+exp((temp*(adelS+bdelS*tmean)-Hd)/(temp*R)))) ktotal <- kbeg*kend # Equation 20 in Smith 2019 return(ktotal) }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/aggregation.R \name{ckde} \alias{ckde} \title{Composite Kernel Density Estimates of Radiocarbon Dates} \usage{ ckde(x, timeRange, bw, normalised = FALSE) } \arguments{ \item{x}{A \code{simdates} class object, generated using \code{\link{sampleDates}}.} \item{timeRange}{A vector of length 2 indicating the start and end date of the analysis in cal BP.} \item{bw}{Kernel bandwith to be used.} \item{normalised}{A logical variable indicating whether the contribution of individual dates should be equal (TRUE), or weighted based on the area under the curve of non-normalised calibration (FALSE). Default is TRUE.} } \value{ An object of class \code{ckdeSPD} with the following elements \itemize{ \item{\code{timeRange}} {The \code{timeRange} setting used.} \item{\code{res.matrix}} {A matrix containing the KDE values with rows representing calendar dates.} } } \description{ Computes a Composite Kernel Density Estimate (CKDE) from multiple sets of randomly sampled calendar dates. } \details{ The function computes Kernel Density Estimates using randomly sampled calendar dates contained in a \code{simdates} class object (generated using the \code{simulate.dates()} function). The output contains \code{nsim} KDEs, where \code{nsim} is the argument used in \code{simulate.dates()}. The resulting object can be plotted to visualise a CKDE (cf Brown 2017), and if \code{boot} was set to \code{TRUE} in \code{sampleDates} its bootstraped variant (cf McLaughlin 2018 for a similar analysis). The shape of the CKDE is comparable to an SPD generated from non-normalised dates when the argument \code{normalised} is set to FALSE. } \examples{ data(emedyd) x = calibrate(x=emedyd$CRA, errors=emedyd$Error,normalised=FALSE) bins = binPrep(sites=emedyd$SiteName, ages=emedyd$CRA,h=50) s = sampleDates(x,bins=bins,nsim=100,boot=FALSE) ckdeNorm = ckde(s1,timeRange=c(16000,9000),bw=100,normalised=TRUE) plot(ckdeNorm,type='multiline',cal='BCAD') } \references{ Brown, W. A. 2017. The past and future of growth rate estimation in demographic temporal frequency analysis: Biodemographic interpretability and the ascendance of dynamic growth models. \emph{Journal of Archaeological Science}, 80: 96–108. DOI: https://doi.org/10.1016/j.jas.2017.02.003 \cr McLaughlin, T. R. 2018. On Applications of Space–Time Modelling with Open-Source 14C Age Calibration. \emph{Journal of Archaeological Method and Theory}. DOI https://doi.org/10.1007/s10816-018-9381-3 } \seealso{ \code{\link{sampleDates}} }
/man/ckde.Rd
no_license
f-silva-archaeo/rcarbon
R
false
true
2,567
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/aggregation.R \name{ckde} \alias{ckde} \title{Composite Kernel Density Estimates of Radiocarbon Dates} \usage{ ckde(x, timeRange, bw, normalised = FALSE) } \arguments{ \item{x}{A \code{simdates} class object, generated using \code{\link{sampleDates}}.} \item{timeRange}{A vector of length 2 indicating the start and end date of the analysis in cal BP.} \item{bw}{Kernel bandwith to be used.} \item{normalised}{A logical variable indicating whether the contribution of individual dates should be equal (TRUE), or weighted based on the area under the curve of non-normalised calibration (FALSE). Default is TRUE.} } \value{ An object of class \code{ckdeSPD} with the following elements \itemize{ \item{\code{timeRange}} {The \code{timeRange} setting used.} \item{\code{res.matrix}} {A matrix containing the KDE values with rows representing calendar dates.} } } \description{ Computes a Composite Kernel Density Estimate (CKDE) from multiple sets of randomly sampled calendar dates. } \details{ The function computes Kernel Density Estimates using randomly sampled calendar dates contained in a \code{simdates} class object (generated using the \code{simulate.dates()} function). The output contains \code{nsim} KDEs, where \code{nsim} is the argument used in \code{simulate.dates()}. The resulting object can be plotted to visualise a CKDE (cf Brown 2017), and if \code{boot} was set to \code{TRUE} in \code{sampleDates} its bootstraped variant (cf McLaughlin 2018 for a similar analysis). The shape of the CKDE is comparable to an SPD generated from non-normalised dates when the argument \code{normalised} is set to FALSE. } \examples{ data(emedyd) x = calibrate(x=emedyd$CRA, errors=emedyd$Error,normalised=FALSE) bins = binPrep(sites=emedyd$SiteName, ages=emedyd$CRA,h=50) s = sampleDates(x,bins=bins,nsim=100,boot=FALSE) ckdeNorm = ckde(s1,timeRange=c(16000,9000),bw=100,normalised=TRUE) plot(ckdeNorm,type='multiline',cal='BCAD') } \references{ Brown, W. A. 2017. The past and future of growth rate estimation in demographic temporal frequency analysis: Biodemographic interpretability and the ascendance of dynamic growth models. \emph{Journal of Archaeological Science}, 80: 96–108. DOI: https://doi.org/10.1016/j.jas.2017.02.003 \cr McLaughlin, T. R. 2018. On Applications of Space–Time Modelling with Open-Source 14C Age Calibration. \emph{Journal of Archaeological Method and Theory}. DOI https://doi.org/10.1007/s10816-018-9381-3 } \seealso{ \code{\link{sampleDates}} }
x <- rnorm(100) hist(x)
/test.r
no_license
kkondo1981/R-tutorial
R
false
false
25
r
x <- rnorm(100) hist(x)
# Assignment 7 Problem 1 # install.packages("ggplot2") # install.packages("maps") # install.packages("ggmap") library(ggplot2) library(maps) library(ggmap) statesMap = map_data("state") polling = read.csv("PollingImputed.csv") Train = subset(polling, Year == 2004 | Year == 2008) Test = subset(polling, Year == 2012) mod2 = glm(Republican~SurveyUSA+DiffCount, data=Train, family="binomial") TestPrediction = predict(mod2, newdata=Test, type="response") TestPredictionBinary = as.numeric(TestPrediction > 0.5) predictionDataFrame = data.frame(TestPrediction, TestPredictionBinary, Test$State) predictionDataFrame$region = tolower(predictionDataFrame$Test.State) predictionMap = merge(statesMap, predictionDataFrame, by = "region") predictionMap = predictionMap[order(predictionMap$order),] ggplot(predictionMap, aes(x = long, y = lat, group = group, fill = TestPredictionBinary)) + geom_polygon(color = "black") # Read in data polling = read.csv("PollingData.csv") str(polling) table(polling$Year) summary(polling) # Install and load mice package # install.packages("mice") library(mice) # Multiple imputation simple = polling[c("Rasmussen", "SurveyUSA", "PropR", "DiffCount")] summary(simple) set.seed(144) imputed = complete(mice(simple)) summary(imputed) polling$Rasmussen = imputed$Rasmussen polling$SurveyUSA = imputed$SurveyUSA summary(polling) # Video 3 # Subset data into training set and test set Train = subset(polling, Year == 2004 | Year == 2008) Test = subset(polling, Year == 2012) # Smart Baseline table(Train$Republican) sign(20) sign(-10) sign(0) table(sign(Train$Rasmussen)) table(Train$Republican, sign(Train$Rasmussen)) # Video 4 # Multicollinearity cor(Train) str(Train) cor(Train[c("Rasmussen", "SurveyUSA", "PropR", "DiffCount", "Republican")]) # Logistic Regression Model mod1 = glm(Republican~PropR, data=Train, family="binomial") summary(mod1) # Training set predictions pred1 = predict(mod1, type="response") table(Train$Republican, pred1 >= 0.5) # Two-variable model mod2 = glm(Republican~SurveyUSA+DiffCount, data=Train, family="binomial") pred2 = predict(mod2, type="response") table(Train$Republican, pred2 >= 0.5) summary(mod2) # Video 5 # Smart baseline accuracy table(Test$Republican, sign(Test$Rasmussen)) # Test set predictions TestPrediction = predict(mod2, newdata=Test, type="response") table(Test$Republican, TestPrediction >= 0.5) # Analyze mistake subset(Test, TestPrediction >= 0.5 & Republican == 0)
/Assignment 7 Problem 1.R
no_license
ankitbhargava62/MITx-15.071x-The-Analytics-Edge
R
false
false
2,469
r
# Assignment 7 Problem 1 # install.packages("ggplot2") # install.packages("maps") # install.packages("ggmap") library(ggplot2) library(maps) library(ggmap) statesMap = map_data("state") polling = read.csv("PollingImputed.csv") Train = subset(polling, Year == 2004 | Year == 2008) Test = subset(polling, Year == 2012) mod2 = glm(Republican~SurveyUSA+DiffCount, data=Train, family="binomial") TestPrediction = predict(mod2, newdata=Test, type="response") TestPredictionBinary = as.numeric(TestPrediction > 0.5) predictionDataFrame = data.frame(TestPrediction, TestPredictionBinary, Test$State) predictionDataFrame$region = tolower(predictionDataFrame$Test.State) predictionMap = merge(statesMap, predictionDataFrame, by = "region") predictionMap = predictionMap[order(predictionMap$order),] ggplot(predictionMap, aes(x = long, y = lat, group = group, fill = TestPredictionBinary)) + geom_polygon(color = "black") # Read in data polling = read.csv("PollingData.csv") str(polling) table(polling$Year) summary(polling) # Install and load mice package # install.packages("mice") library(mice) # Multiple imputation simple = polling[c("Rasmussen", "SurveyUSA", "PropR", "DiffCount")] summary(simple) set.seed(144) imputed = complete(mice(simple)) summary(imputed) polling$Rasmussen = imputed$Rasmussen polling$SurveyUSA = imputed$SurveyUSA summary(polling) # Video 3 # Subset data into training set and test set Train = subset(polling, Year == 2004 | Year == 2008) Test = subset(polling, Year == 2012) # Smart Baseline table(Train$Republican) sign(20) sign(-10) sign(0) table(sign(Train$Rasmussen)) table(Train$Republican, sign(Train$Rasmussen)) # Video 4 # Multicollinearity cor(Train) str(Train) cor(Train[c("Rasmussen", "SurveyUSA", "PropR", "DiffCount", "Republican")]) # Logistic Regression Model mod1 = glm(Republican~PropR, data=Train, family="binomial") summary(mod1) # Training set predictions pred1 = predict(mod1, type="response") table(Train$Republican, pred1 >= 0.5) # Two-variable model mod2 = glm(Republican~SurveyUSA+DiffCount, data=Train, family="binomial") pred2 = predict(mod2, type="response") table(Train$Republican, pred2 >= 0.5) summary(mod2) # Video 5 # Smart baseline accuracy table(Test$Republican, sign(Test$Rasmussen)) # Test set predictions TestPrediction = predict(mod2, newdata=Test, type="response") table(Test$Republican, TestPrediction >= 0.5) # Analyze mistake subset(Test, TestPrediction >= 0.5 & Republican == 0)
library(gratia) ### Name: evaluate_smooth ### Title: Evaluate a smooth ### Aliases: evaluate_smooth evaluate_smooth.gam evaluate_smooth.gamm ### evaluate_parametric_term evaluate_parametric_term.gam ### ** Examples library("mgcv") ## Don't show: set.seed(2) op <- options(cli.unicode = FALSE, digits = 6) ## End(Don't show) dat <- gamSim(1, n = 400, dist = "normal", scale = 2) m1 <- gam(y ~ s(x0) + s(x1) + s(x2) + s(x3), data = dat, method = "REML") evaluate_smooth(m1, "s(x1)") ## 2d example set.seed(2) dat <- gamSim(2, n = 1000, dist = "normal", scale = 1) m2 <- gam(y ~ s(x, z, k = 30), data = dat$data, method = "REML") evaluate_smooth(m2, "s(x,z)", n = 100) ## Don't show: options(op) ## End(Don't show)
/data/genthat_extracted_code/gratia/examples/evaluate_smooth.Rd.R
no_license
surayaaramli/typeRrh
R
false
false
726
r
library(gratia) ### Name: evaluate_smooth ### Title: Evaluate a smooth ### Aliases: evaluate_smooth evaluate_smooth.gam evaluate_smooth.gamm ### evaluate_parametric_term evaluate_parametric_term.gam ### ** Examples library("mgcv") ## Don't show: set.seed(2) op <- options(cli.unicode = FALSE, digits = 6) ## End(Don't show) dat <- gamSim(1, n = 400, dist = "normal", scale = 2) m1 <- gam(y ~ s(x0) + s(x1) + s(x2) + s(x3), data = dat, method = "REML") evaluate_smooth(m1, "s(x1)") ## 2d example set.seed(2) dat <- gamSim(2, n = 1000, dist = "normal", scale = 1) m2 <- gam(y ~ s(x, z, k = 30), data = dat$data, method = "REML") evaluate_smooth(m2, "s(x,z)", n = 100) ## Don't show: options(op) ## End(Don't show)
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/aggregate.baseflow.R \name{aggregate.baseflow} \alias{aggregate.baseflow} \title{Baseflow Summary} \usage{ \method{aggregate}{baseflow}(x, by = "months", index = FALSE, ...) } \arguments{ \item{x}{an object of class "baseflow."} \item{by}{the time period to aggregate by. See \bold{Details}.} \item{index}{compute the baseflow index (proportion of baseflow to total flow) rather than baseflow?} \item{\dots}{not used, required for other methods.} } \value{ The baseflow for each period specified in \code{by}. The units are the same as for \code{x}. } \description{ Computes baseflow statistics for user-specified periods of time. } \details{ The aregument \code{by} can be either a character indicating the period, or a list created by \code{setSeasons}. If a character , then must be "months," "years," "calendar years," "water years," "climate years," or "total." May be abbreviated; and "years" is the same as "calendar years." } \examples{ \dontrun{ library(smwrData) data(GlacialRidge) G12.hysep <- with(ChoptankFlow, hysep(Flow, datetime, da=113, STAID="01491000")) # monthly summary of recharge in feet aggregate(G12.hysep) } } \seealso{ \code{\link{part}}, \code{\link{hysep}}, \code{\link{bfi}}, \code{\link{setSeasons}} } \keyword{baseflow}
/man/aggregate.baseflow.Rd
permissive
ggurjar333/DVstats
R
false
true
1,336
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/aggregate.baseflow.R \name{aggregate.baseflow} \alias{aggregate.baseflow} \title{Baseflow Summary} \usage{ \method{aggregate}{baseflow}(x, by = "months", index = FALSE, ...) } \arguments{ \item{x}{an object of class "baseflow."} \item{by}{the time period to aggregate by. See \bold{Details}.} \item{index}{compute the baseflow index (proportion of baseflow to total flow) rather than baseflow?} \item{\dots}{not used, required for other methods.} } \value{ The baseflow for each period specified in \code{by}. The units are the same as for \code{x}. } \description{ Computes baseflow statistics for user-specified periods of time. } \details{ The aregument \code{by} can be either a character indicating the period, or a list created by \code{setSeasons}. If a character , then must be "months," "years," "calendar years," "water years," "climate years," or "total." May be abbreviated; and "years" is the same as "calendar years." } \examples{ \dontrun{ library(smwrData) data(GlacialRidge) G12.hysep <- with(ChoptankFlow, hysep(Flow, datetime, da=113, STAID="01491000")) # monthly summary of recharge in feet aggregate(G12.hysep) } } \seealso{ \code{\link{part}}, \code{\link{hysep}}, \code{\link{bfi}}, \code{\link{setSeasons}} } \keyword{baseflow}
# # load data, extract variables, initialize ------------------------------------------------ # # number of bootstrap iterations R <- 100000 # load data table (includes biomass and se) dat <- read.csv("/Users/nicolekinlock/Documents/Plant Ecology/NetworkMetaAnalysis/Networks/106-Costa-2003.csv") name <- c("106-Costa-2003") # number of spp sp <- max(unique(dat$Target)) # calculate sd from se (using number of replicates) SD <- dat$SE * sqrt(dat$N) dat$SD <- SD # # RII ------------------------------------------------ # # calculate RII using bootstrap, biomass mean and sd # assume normally distributed biomass, sample using mean and sd from paper # generate distribution of possible RIIs and calculate mean and sd of this distribution (SE) one.one <- c() two.one <- c() three.one <- c() one.two <- c() two.two <- c() three.two <- c() one.three <- c() two.three <- c() three.three <- c() for (i in 1:R) { temp <- rtruncnorm(n = nrow(dat), mean = dat$Metric, sd = dat$SD, a = 0) one.one[i] <- (temp[11] - temp[8]) / (temp[11] + temp[8]) two.one[i] <- (temp[10] - temp[7]) / (temp[10] + temp[7]) three.one[i] <- (temp[12] - temp[9]) / (temp[12] + temp[9]) one.two[i] <- (temp[5] - temp[1]) / (temp[5] + temp[1]) two.two[i] <- (temp[4] - temp[2]) / (temp[4] + temp[2]) three.two[i] <- (temp[6] - temp[3]) / (temp[6] + temp[3]) one.three[i] <- (temp[17] - temp[14]) / (temp[17] + temp[14]) two.three[i] <- (temp[16] - temp[13]) / (temp[16] + temp[13]) three.three[i] <- (temp[18] - temp[15]) / (temp[18] + temp[15]) } boot.rii <- as.matrix(data.frame(one.one, one.two, one.three, two.one, two.two, two.three, three.one, three.two, three.three)) rii.vec <- c() rii.sd.vec <- c() rii.fit <- apply(boot.rii, 2, function(x) fitdist(data = x, distr = "norm", method = "mme")) for (w in 1:length(rii.fit)) { rii.vec[w] <- unname(rii.fit[[w]][[1]][1]) rii.sd.vec[w] <- unname(rii.fit[[w]][[1]][2]) } rii <- matrix(rii.vec, nrow = sp, ncol = sp, byrow = TRUE) rii.sd <- matrix(rii.sd.vec, nrow = sp, ncol = sp, byrow = TRUE) # save matrices of mean RII and sd RII write.table(x = rii, file = paste("/Users/nicolekinlock/Documents/Plant Ecology/NetworkMetaAnalysis/Networks/Complete/RII/Cntrl/", name, "-RII.csv", sep = ""), sep = ",", row.names = FALSE, col.names = FALSE) write.table(x = rii.sd, file = paste("/Users/nicolekinlock/Documents/Plant Ecology/NetworkMetaAnalysis/Networks/Complete/RII/Cntrl/", name, "-RIIsd.csv", sep = ""), sep = ",", row.names = FALSE, col.names = FALSE) # # RY ------------------------------------------------ # # calculate RY, yield mean and sd one.one <- c() two.one <- c() three.one <- c() one.two <- c() two.two <- c() three.two <- c() one.three <- c() two.three <- c() three.three <- c() for (i in 1:R) { temp <- rtruncnorm(n = nrow(dat), mean = dat$Metric, sd = dat$SD, a = 0) one.one[i] <- temp[11] / temp[8] two.one[i] <- temp[10] / temp[7] three.one[i] <- temp[12] / temp[9] one.two[i] <- temp[5] / temp[1] two.two[i] <- temp[4] / temp[2] three.two[i] <- temp[6] / temp[3] one.three[i] <- temp[17] / temp[14] two.three[i] <- temp[16] / temp[13] three.three[i] <- temp[18] / temp[15] } boot.ry <- as.matrix(data.frame(one.one, one.two, one.three, two.one, two.two, two.three, three.one, three.two, three.three)) ry.vec <- c() ry.sd.vec <- c() ry.fit <- apply(boot.ry, 2, function(x) fitdist(data = x, distr = "norm", method = "mme")) for (w in 1:length(ry.fit)) { ry.vec[w] <- unname(ry.fit[[w]][[1]][1]) ry.sd.vec[w] <- unname(ry.fit[[w]][[1]][2]) } ry <- matrix(ry.vec, nrow = sp, ncol = sp, byrow = TRUE) ry.sd <- matrix(ry.sd.vec, nrow = sp, ncol = sp, byrow = TRUE) write.table(x = ry, file = paste("/Users/nicolekinlock/Documents/Plant Ecology/NetworkMetaAnalysis/Networks/Complete/RY/Cntrl/", name, "-RY.csv", sep = ""), sep = ",", row.names = FALSE, col.names = FALSE) write.table(x = ry.sd, paste("/Users/nicolekinlock/Documents/Plant Ecology/NetworkMetaAnalysis/Networks/Complete/RY/Cntrl/", name, "-RYsd.csv", sep = ""), sep = ",", row.names = FALSE, col.names = FALSE)
/spcase106Costa.R
no_license
IbrahimRadwan/NetworkMetaAnalysis
R
false
false
4,071
r
# # load data, extract variables, initialize ------------------------------------------------ # # number of bootstrap iterations R <- 100000 # load data table (includes biomass and se) dat <- read.csv("/Users/nicolekinlock/Documents/Plant Ecology/NetworkMetaAnalysis/Networks/106-Costa-2003.csv") name <- c("106-Costa-2003") # number of spp sp <- max(unique(dat$Target)) # calculate sd from se (using number of replicates) SD <- dat$SE * sqrt(dat$N) dat$SD <- SD # # RII ------------------------------------------------ # # calculate RII using bootstrap, biomass mean and sd # assume normally distributed biomass, sample using mean and sd from paper # generate distribution of possible RIIs and calculate mean and sd of this distribution (SE) one.one <- c() two.one <- c() three.one <- c() one.two <- c() two.two <- c() three.two <- c() one.three <- c() two.three <- c() three.three <- c() for (i in 1:R) { temp <- rtruncnorm(n = nrow(dat), mean = dat$Metric, sd = dat$SD, a = 0) one.one[i] <- (temp[11] - temp[8]) / (temp[11] + temp[8]) two.one[i] <- (temp[10] - temp[7]) / (temp[10] + temp[7]) three.one[i] <- (temp[12] - temp[9]) / (temp[12] + temp[9]) one.two[i] <- (temp[5] - temp[1]) / (temp[5] + temp[1]) two.two[i] <- (temp[4] - temp[2]) / (temp[4] + temp[2]) three.two[i] <- (temp[6] - temp[3]) / (temp[6] + temp[3]) one.three[i] <- (temp[17] - temp[14]) / (temp[17] + temp[14]) two.three[i] <- (temp[16] - temp[13]) / (temp[16] + temp[13]) three.three[i] <- (temp[18] - temp[15]) / (temp[18] + temp[15]) } boot.rii <- as.matrix(data.frame(one.one, one.two, one.three, two.one, two.two, two.three, three.one, three.two, three.three)) rii.vec <- c() rii.sd.vec <- c() rii.fit <- apply(boot.rii, 2, function(x) fitdist(data = x, distr = "norm", method = "mme")) for (w in 1:length(rii.fit)) { rii.vec[w] <- unname(rii.fit[[w]][[1]][1]) rii.sd.vec[w] <- unname(rii.fit[[w]][[1]][2]) } rii <- matrix(rii.vec, nrow = sp, ncol = sp, byrow = TRUE) rii.sd <- matrix(rii.sd.vec, nrow = sp, ncol = sp, byrow = TRUE) # save matrices of mean RII and sd RII write.table(x = rii, file = paste("/Users/nicolekinlock/Documents/Plant Ecology/NetworkMetaAnalysis/Networks/Complete/RII/Cntrl/", name, "-RII.csv", sep = ""), sep = ",", row.names = FALSE, col.names = FALSE) write.table(x = rii.sd, file = paste("/Users/nicolekinlock/Documents/Plant Ecology/NetworkMetaAnalysis/Networks/Complete/RII/Cntrl/", name, "-RIIsd.csv", sep = ""), sep = ",", row.names = FALSE, col.names = FALSE) # # RY ------------------------------------------------ # # calculate RY, yield mean and sd one.one <- c() two.one <- c() three.one <- c() one.two <- c() two.two <- c() three.two <- c() one.three <- c() two.three <- c() three.three <- c() for (i in 1:R) { temp <- rtruncnorm(n = nrow(dat), mean = dat$Metric, sd = dat$SD, a = 0) one.one[i] <- temp[11] / temp[8] two.one[i] <- temp[10] / temp[7] three.one[i] <- temp[12] / temp[9] one.two[i] <- temp[5] / temp[1] two.two[i] <- temp[4] / temp[2] three.two[i] <- temp[6] / temp[3] one.three[i] <- temp[17] / temp[14] two.three[i] <- temp[16] / temp[13] three.three[i] <- temp[18] / temp[15] } boot.ry <- as.matrix(data.frame(one.one, one.two, one.three, two.one, two.two, two.three, three.one, three.two, three.three)) ry.vec <- c() ry.sd.vec <- c() ry.fit <- apply(boot.ry, 2, function(x) fitdist(data = x, distr = "norm", method = "mme")) for (w in 1:length(ry.fit)) { ry.vec[w] <- unname(ry.fit[[w]][[1]][1]) ry.sd.vec[w] <- unname(ry.fit[[w]][[1]][2]) } ry <- matrix(ry.vec, nrow = sp, ncol = sp, byrow = TRUE) ry.sd <- matrix(ry.sd.vec, nrow = sp, ncol = sp, byrow = TRUE) write.table(x = ry, file = paste("/Users/nicolekinlock/Documents/Plant Ecology/NetworkMetaAnalysis/Networks/Complete/RY/Cntrl/", name, "-RY.csv", sep = ""), sep = ",", row.names = FALSE, col.names = FALSE) write.table(x = ry.sd, paste("/Users/nicolekinlock/Documents/Plant Ecology/NetworkMetaAnalysis/Networks/Complete/RY/Cntrl/", name, "-RYsd.csv", sep = ""), sep = ",", row.names = FALSE, col.names = FALSE)
######################################################### # Matrix I used for testing purposes ######################################################### # m <- matrix(c(4:7), nrow = 2, ncol = 2, byrow = TRUE) ######################################################### # makeCacheMatrix ######################################################### makeCacheMatrix <- function(x = matrix()) { m<-NULL set<-function(y) ### define set function { x <<- y m <<- NULL } ### define get, setmatrix and getmatrix functions get<-function() x setmatrix<-function(solve) m <<- solve getmatrix<-function() m ### return functions as a list ### list(set=set, get=get, setmatrix=setmatrix, getmatrix=getmatrix) } ######################################################### # cacheSolve function ######################################################### cacheSolve <- function(x=matrix()) { m<-x$getmatrix(x) ### R is throwing me an error message here ### "Error in x$getmatrix : $ operator is invalid for atomic vectors" ### Turning in what I've done ### if the matrix is not NULL, retrive it and return it ### if(!is.null(m)) { message("getting cached data") ### let the user know cached matrix is being retrieved return(m) ### return m and exit function cacheSolve } ### if the matrix is NULL, then get the matrix, invert it, and cache it ### matrix<-x$get m<-solve(matrix) x$setmatrix(m) ### return the inverse of the matrix ### m }
/cacheSolve.R
no_license
npCoursera/ProgrammingAssignment2
R
false
false
1,518
r
######################################################### # Matrix I used for testing purposes ######################################################### # m <- matrix(c(4:7), nrow = 2, ncol = 2, byrow = TRUE) ######################################################### # makeCacheMatrix ######################################################### makeCacheMatrix <- function(x = matrix()) { m<-NULL set<-function(y) ### define set function { x <<- y m <<- NULL } ### define get, setmatrix and getmatrix functions get<-function() x setmatrix<-function(solve) m <<- solve getmatrix<-function() m ### return functions as a list ### list(set=set, get=get, setmatrix=setmatrix, getmatrix=getmatrix) } ######################################################### # cacheSolve function ######################################################### cacheSolve <- function(x=matrix()) { m<-x$getmatrix(x) ### R is throwing me an error message here ### "Error in x$getmatrix : $ operator is invalid for atomic vectors" ### Turning in what I've done ### if the matrix is not NULL, retrive it and return it ### if(!is.null(m)) { message("getting cached data") ### let the user know cached matrix is being retrieved return(m) ### return m and exit function cacheSolve } ### if the matrix is NULL, then get the matrix, invert it, and cache it ### matrix<-x$get m<-solve(matrix) x$setmatrix(m) ### return the inverse of the matrix ### m }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/tar_crew.R \name{tar_crew} \alias{tar_crew} \title{Get crew worker info.} \usage{ tar_crew(store = targets::tar_config_get("store")) } \arguments{ \item{store}{Character of length 1, path to the \code{targets} data store. Defaults to \code{tar_config_get("store")}, which in turn defaults to \verb{_targets/}. When you set this argument, the value of \code{tar_config_get("store")} is temporarily changed for the current function call. See \code{\link[=tar_config_get]{tar_config_get()}} and \code{\link[=tar_config_set]{tar_config_set()}} for details about how to set the data store path persistently for a project.} } \value{ A data frame one row per \code{crew} worker and the following columns: \itemize{ \item \code{controller}: name of the \code{crew} controller. \item \code{launches}: number of times the worker was launched. \item \code{seconds}: number of seconds the worker spent running tasks. \item \code{targets}: number of targets the worker completed and delivered. } } \description{ For the most recent run of the pipeline with \code{\link[=tar_make]{tar_make()}} where a \code{crew} controller was started, get summary-level information of the workers. } \section{Storage access}{ Several functions like \code{tar_make()}, \code{tar_read()}, \code{tar_load()}, \code{tar_meta()}, and \code{tar_progress()} read or modify the local data store of the pipeline. The local data store is in flux while a pipeline is running, and depending on how distributed computing or cloud computing is set up, not all targets can even reach it. So please do not call these functions from inside a target as part of a running pipeline. The only exception is literate programming target factories in the \code{tarchetypes} package such as \code{tar_render()} and \code{tar_quarto()}. Several functions like \code{tar_make()}, \code{tar_read()}, \code{tar_load()}, \code{tar_meta()}, and \code{tar_progress()} read or modify the local data store of the pipeline. The local data store is in flux while a pipeline is running, and depending on how distributed computing or cloud computing is set up, not all targets can even reach it. So please do not call these functions from inside a target as part of a running pipeline. The only exception is literate programming target factories in the \code{tarchetypes} package such as \code{tar_render()} and \code{tar_quarto()}. } \examples{ if (identical(Sys.getenv("TAR_EXAMPLES"), "true")) { # for CRAN tar_dir({ # tar_dir() runs code from a temp dir for CRAN. if (requireNamespace("crew", quietly = TRUE)) { tar_script({ tar_option_set(controller = crew::crew_controller_local()) list( tar_target(x, seq_len(2)), tar_target(y, 2 * x, pattern = map(x)) ) }, ask = FALSE) tar_make() tar_process() tar_process(pid) } }) } } \seealso{ Other data: \code{\link{tar_load_everything}()}, \code{\link{tar_load_raw}()}, \code{\link{tar_load}()}, \code{\link{tar_objects}()}, \code{\link{tar_pid}()}, \code{\link{tar_process}()}, \code{\link{tar_read_raw}()}, \code{\link{tar_read}()} } \concept{data}
/man/tar_crew.Rd
permissive
ropensci/targets
R
false
true
3,130
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/tar_crew.R \name{tar_crew} \alias{tar_crew} \title{Get crew worker info.} \usage{ tar_crew(store = targets::tar_config_get("store")) } \arguments{ \item{store}{Character of length 1, path to the \code{targets} data store. Defaults to \code{tar_config_get("store")}, which in turn defaults to \verb{_targets/}. When you set this argument, the value of \code{tar_config_get("store")} is temporarily changed for the current function call. See \code{\link[=tar_config_get]{tar_config_get()}} and \code{\link[=tar_config_set]{tar_config_set()}} for details about how to set the data store path persistently for a project.} } \value{ A data frame one row per \code{crew} worker and the following columns: \itemize{ \item \code{controller}: name of the \code{crew} controller. \item \code{launches}: number of times the worker was launched. \item \code{seconds}: number of seconds the worker spent running tasks. \item \code{targets}: number of targets the worker completed and delivered. } } \description{ For the most recent run of the pipeline with \code{\link[=tar_make]{tar_make()}} where a \code{crew} controller was started, get summary-level information of the workers. } \section{Storage access}{ Several functions like \code{tar_make()}, \code{tar_read()}, \code{tar_load()}, \code{tar_meta()}, and \code{tar_progress()} read or modify the local data store of the pipeline. The local data store is in flux while a pipeline is running, and depending on how distributed computing or cloud computing is set up, not all targets can even reach it. So please do not call these functions from inside a target as part of a running pipeline. The only exception is literate programming target factories in the \code{tarchetypes} package such as \code{tar_render()} and \code{tar_quarto()}. Several functions like \code{tar_make()}, \code{tar_read()}, \code{tar_load()}, \code{tar_meta()}, and \code{tar_progress()} read or modify the local data store of the pipeline. The local data store is in flux while a pipeline is running, and depending on how distributed computing or cloud computing is set up, not all targets can even reach it. So please do not call these functions from inside a target as part of a running pipeline. The only exception is literate programming target factories in the \code{tarchetypes} package such as \code{tar_render()} and \code{tar_quarto()}. } \examples{ if (identical(Sys.getenv("TAR_EXAMPLES"), "true")) { # for CRAN tar_dir({ # tar_dir() runs code from a temp dir for CRAN. if (requireNamespace("crew", quietly = TRUE)) { tar_script({ tar_option_set(controller = crew::crew_controller_local()) list( tar_target(x, seq_len(2)), tar_target(y, 2 * x, pattern = map(x)) ) }, ask = FALSE) tar_make() tar_process() tar_process(pid) } }) } } \seealso{ Other data: \code{\link{tar_load_everything}()}, \code{\link{tar_load_raw}()}, \code{\link{tar_load}()}, \code{\link{tar_objects}()}, \code{\link{tar_pid}()}, \code{\link{tar_process}()}, \code{\link{tar_read_raw}()}, \code{\link{tar_read}()} } \concept{data}
# Generated by using Rcpp::compileAttributes() -> do not edit by hand # Generator token: 10BE3573-1514-4C36-9D1C-5A225CD40393 import_fasta_to_vector_each_nt <- function(file) { .Call('_pairsnp_import_fasta_to_vector_each_nt', PACKAGE = 'pairsnp', file) }
/R/RcppExports.R
permissive
gtonkinhill/pairsnp-r
R
false
false
261
r
# Generated by using Rcpp::compileAttributes() -> do not edit by hand # Generator token: 10BE3573-1514-4C36-9D1C-5A225CD40393 import_fasta_to_vector_each_nt <- function(file) { .Call('_pairsnp_import_fasta_to_vector_each_nt', PACKAGE = 'pairsnp', file) }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/N_CVInfoLambda.R \name{CVInfoLambda-methods} \alias{CVInfoLambda-methods} \title{Methods Available for Objects of Class \code{CVInfoLambda}} \description{ Methods Available for Objects of Class \code{CVInfoLambda} } \keyword{internal}
/man/CVInfoLambda-methods.Rd
no_license
cran/DynTxRegime
R
false
true
313
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/N_CVInfoLambda.R \name{CVInfoLambda-methods} \alias{CVInfoLambda-methods} \title{Methods Available for Objects of Class \code{CVInfoLambda}} \description{ Methods Available for Objects of Class \code{CVInfoLambda} } \keyword{internal}
# TO DO - check all data for correct datetime - e.g. current cont_obs are running on winter time, while all the rest of data runs on summer time {# INFO #ALT+0 # when birds arrive to nioz #### !!! if blood not indicated in what, it is asumed that we have no clue whether blood was taken - if blood was taken upon capture, please indicate this, as well as whether biometry and ful, crc done #### enter fields f_mass, project,species, age and subspecies when birds brought in } # Luc please install: #install.packages('scales') #### START HERE # Luc or Martin Luc = FALSE # indicate in DB_LOG dblog = TRUE {# TOOLS {# define working directories if(Luc == TRUE){ wd0 = "C:/Users/ldemonte/Dropbox/data_entry/" wd = "C:/Users/ldemonte/Dropbox/data_entry/ready_for_DB_upload/" outdir = "C:/Users/ldemonte/Dropbox/data_entry/uploaded_to_DB/" wd2 = "C:/Users/ldemonte/Dropbox/AVESatNIOZ/" }else{ wd0 = "C:/Users/mbulla/Documents/Dropbox/Science/Projects/MC/Data/data_entry/" wd = "C:/Users/mbulla/Documents/Dropbox/Science/Projects/MC/Data/data_entry/ready_for_DB_upload/" outdir = "C:/Users/mbulla/Documents/Dropbox/Science/Projects/MC/Data/data_entry/uploaded_to_DB/" wd2 = "C:/Users/mbulla/Documents/Dropbox/Science/Projects/MC/Data/AVESatNIOZ/" } } {# load packages require(plyr) require(XLConnect) require("RSQLite") #require("DBI") require('Hmisc') } {# DB connection db=paste(wd2,"AVESatNIOZ.sqlite",sep="") #db=paste(wd2,"test.sqlite",sep="") #db=paste(wd2,"test2.sqlite",sep="") } {# metadata # birds table con = dbConnect(dbDriver("SQLite"),dbname = db) b = dbGetQuery(con, "SELECT*FROM BIRDS") dbDisconnect(con) # captures table con = dbConnect(dbDriver("SQLite"),dbname = db) z = dbGetQuery(con, "SELECT*FROM CAPTURES") dbDisconnect(con) # biometry o = readWorksheetFromFile(paste(wd2, 'Biometry captive red knots 2017.xlsx', sep = ''), sheet=1) v = readWorksheetFromFile(paste(wd2, 'morphometrics+sex_2016.xlsx', sep = ''), sheet=1) v$RNR[v$RNR%in%o$RINGNR] # locations g = readWorksheetFromFile(paste(wd2, 'catch_locations.xlsx', sep = ''), sheet=1) } {# !!!! DEFINE CONSTANTS catch = c('Richel', 'Schier','Griend','Vistula', 'Mokbaai') # define off NIOZ catching locations } } # CHECK BEFORE UPLOAD {# prepare con = dbConnect(dbDriver("SQLite"),dbname = db) #dbGetQuery(con, "DROP TABLE IF EXISTS CAPTURES") a = dbGetQuery(con, "SELECT*FROM CAPTURES") oo = dbGetQuery(con, "SELECT*FROM DBLOG where DBLOG.'table' = 'CAPTURES'") dbDisconnect(con) f = list.files(path=paste(wd,sep =''),pattern='data_entry', recursive=TRUE,full.names=TRUE) f2 = list.files(path=paste(wd,sep =''),pattern='data_entry', recursive=TRUE,full.names=FALSE) } {# check WHAT entries to know whether additional uploads needed l = list() j =NA for(i in 1:length(f)){#{2){# #i = 1 m = readWorksheetFromFile(f[i], sheet=1) {#### if this part does not work hashtag it out #m[m==""] = NA #m[m==" "] = NA #m[m=="NA"] = NA #### } #print(i) #print(unique(m$what)[!is.na(unique(m$what))]) l[[i]] = data.frame(f = i , what = if(length(unique(m$what)[!is.na(unique(m$what))])==0){NA}else{unique(m$what)[!is.na(unique(m$what))]}, stringsAsFactors = FALSE) j = c(j,unique(m$what)[!is.na(unique(m$what))]) } #ll = do.call(rbind,l) #f2[i] print( unique(j)) } {# check HEALTH entries to know whether additional uploads needed - FINISH CLEANING l = list() j =NA for(i in 1:length(f)){#{2){# #i = 20 m = readWorksheetFromFile(f[i], sheet=1) #print(i) #print(unique(m$health)[!is.na(unique(m$health))]) l[[i]] = data.frame(f = i , health = if(length(unique(m$health)[!is.na(unique(m$health))])==0){NA}else{unique(m$health)[!is.na(unique(m$health))]}, stringsAsFactors = FALSE) j = c(j,unique(m$health)[!is.na(unique(m$health))]) } #ll = do.call(rbind,l) #f2[i] print(unique(j)) } {# UPLOAD CAPTURES f = list.files(path=paste(wd,sep =''),pattern='data_entry', recursive=TRUE,full.names=TRUE) f2 = list.files(path=paste(wd,sep =''),pattern='data_entry', recursive=TRUE,full.names=FALSE) #for(i in 1:length(f)){#length(f)){#{2){# i = 1 f2[i] {# prepare print(i) m = readWorksheetFromFile(f[i], sheet=1, colTypes = 'character') #names(m)[names(m) == 'now'] = 'at' names(m)[names(m) == 'CGF'] = 'molt_col' names(m)[names(m) == 'pk'] = 'c_pk' print(names(a)[!names(a)%in%names(m) & !names(a)%in%c('year_')]) # names that are in the DB but not in the data_entry file (with exception of year_) print(names(m)[!names(m)%in%names(a) & !names(m)%in%c('m_p','f_p','home')]) # names that are in the data_entry file but not in the DB (with exception of 'm_p','f_p','home') #m$capture = as.character(m$capture) #m$release = as.character(m$release) m$year_ = substring(m$capture, 1,4) {#### if this part does not work, hashtag it out m[m==""] = NA m[m==" "] = NA m[m=="NA"] = NA #### } if(length(names(m)[names(m)=='c_pk'])==0){m$c_pk = NA} if(length(names(m)[names(m)=='pic'])==0){m$pic = NA} if(length(names(m)[names(m)=='with'])==0){m$with = NA} #m$capture = as.POSIXct(m$capture) #m$release = as.POSIXct(m$release) } {# upload to captures #print(names(m)[!names(m)%in%c("year_", "capture", "at","release", "where", "bird_ID", "what", "what_ID", "health", "feet","mass", "remarks", "author", "plum", "molt","molt_col", "L01","L02","L03","L04","L05","L06","L07","L08","L09","L10","R01","R02","R03","R04","R05","R06","R07","R08","R09","R10","crc_now", "capture_pk")]) mm = m[,c("year_", "capture", "at","release", "where", "bird_ID", "what", "what_ID", "health", "feet","mass", "with", "remarks", "author", "plum", "molt","molt_col", "L01","L02","L03","L04","L05","L06","L07","L08","L09","L10","R01","R02","R03","R04","R05","R06","R07","R08","R09","R10","crc_now","pic", "c_pk")] #mm$capture = as.character(mm$capture) #mm$release = as.character(mm$release) if(f2[i]%in%oo$remarks){print('NO UPLOAD!!! - data already in DB - see DBLOG table')}else{ con = dbConnect(dbDriver("SQLite"),dbname = db) #print(names(z)[!names(z)%in%names(mm)]) #print(names(mm)[!names(mm)%in%names(z)]) dbWriteTable(con, name = "CAPTURES", value = mm, row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'CAPTURES', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = f2[i], stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste(f2[i],'uploaded to captures')) } } #} } {# create/update BIRDS entries f = list.files(path=paste(wd,sep =''),pattern='data_entry', recursive=TRUE,full.names=TRUE) f2 = list.files(path=paste(wd,sep =''),pattern='data_entry', recursive=TRUE,full.names=FALSE) #for(i in 1:length(f)){#{2){# i = 1 {# prepare print(i) m = readWorksheetFromFile(f[i], sheet=1, colTypes = 'character') #names(m)[names(m) == 'now'] = 'at' names(m)[names(m) == 'CGF'] = 'molt_col' names(m)[names(m) == 'pk'] = 'c_pk' #print(names(a)[!names(a)%in%names(m) & !names(a)%in%c('year_')]) # names that are in the DB but not in the data_entry file (with exception of year_) #print(names(m)[!names(m)%in%names(a) & !names(m)%in%c('m_p','f_p','home')]) # names that are in the data_entry file but not in the DB (with exception of 'm_p','f_p','home') m$year_ = substring(m$capture, 1,4) m[m==""] = NA m[m==" "] = NA m[m=="NA"] = NA if(length(names(m)[names(m)=='pic'])==0){m$pic = NA} if(length(names(m)[names(m)=='with'])==0){m$with = NA} #m$capture = as.POSIXct(m$capture) #m$release = as.POSIXct(m$release) } {# IF BIRD ARRIVES to NIOZ - create its data entry line and if data missing create TO_DO mm = m[m$at%in%catch | grepl("capt",m$what, perl = TRUE),] if(nrow(mm)==0){print('no capt in what')}else{ # TO_DO entry if data missing mass_f = length(names(mm)[names(mm)=='mass_f']) project = length(names(mm)[names(mm)=='project']) species = length(names(mm)[names(mm)=='species']) subspecies = length(names(mm)[names(mm)=='subspecies']) age = length(names(mm)[names(mm)=='age']) if((mass_f+project+species+subspecies+age) < 5){ mx = mm[,c('capture', 'bird_ID', 'what')] mx$what = paste(if(mass_f==0){'mass_f'}, if(age==0){'age'},if(species==0){'species'},if(subspecies==0){'subspecies'},if(project==0){'project'}, sep =",") mx$capture = as.character(mx$capture) mx$datetime_solved = mx$remarks = mx$todo_pk = NA con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "TO_DO", value = mx[,c('capture','bird_ID','what','datetime_solved','remarks','todo_pk')], row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste('no', paste(if(mass_f==0){'mass_f'}, if(age==0){'age'},if(species==0){'species'},if(subspecies==0){'subspecies'},if(project==0){'project'},sep=","), 'column names and data entry despite capt in what in capture sheet, to do created')) } # add data to birds mm$capture = as.character(mm$capture) mm$release = as.character(mm$release) mm$year_ = substring(mm$capture, 1,4) mm$blood = ifelse(grepl("blood",mm$what, perl = TRUE), 'yes',NA) #### !!! if blood not indicated in what, it is asumed that we have no clue whether blood taken mm$sex_method = ifelse(grepl("blood",mm$what, perl = TRUE), 'blood',NA) if(length(names(mm)[names(mm)=='wing']) == 0){mm$wing = mm$bill = mm$totalhead = mm$tarsus = mm$tartoe = mm$bio_datetime = mm$bio_author = NA}else{mm$bio_datetime == mm$capture; mm$bio_author = mm$author} if(length(names(mm)[names(mm)=='mass_f']) == 0){mm$mass_f = NA} if(length(names(mm)[names(mm)=='project']) == 0){mm$project = NA} if(length(names(mm)[names(mm)=='subspecies']) == 0){mm$subspecies = NA} if(length(names(mm)[names(mm)=='species']) == 0){mm$species = NA} if(length(names(mm)[names(mm)=='age']) == 0){mm$age = NA} if(length(names(mm)[names(mm)=='height_1']) == 0){mm$muscle = mm$height_1 = mm$width_1 = mm$height_2 = mm$width_2 = mm$ful_datetime = mm$ful_author = NA}else{mm$ful_datetime == mm$capture; mm$ful_author = mm$author} mm$end_ = mm$end_type = mm$site_r = mm$bird_pk = mm$sex = mm$lat_r = mm$lon_r = mm$site_r = NA # UPDATE CATCHING LOCATIONS names(mm)[names(mm)=='capture'] = 'caught' names(mm)[names(mm)=='release'] = 'start_' names(mm)[names(mm)=='at'] = 'site_c' names(mm)[names(mm)=='where'] = 'current_av' names(mm)[names(mm)=='mass'] = 'mass_c' mm$site_c = capitalize(tolower(mm$site_c)) mm$home_av = mm$current_av mm$crc = mm$crc_now mm$lat_c = g$lat[match(mm$site_c,g$abb)] mm$lon_c = g$lon[match(mm$site_c,g$abb)] #x = c("year_","species","subspecies","bird_ID","crc","crc_now","home_av","current_av","age","sex" ,"start_","end_","end_type","caught", "lat_c","lon_c", "site_c", "lat_r", "lon_r", "site_r","muscle", "height_1","width_1", "height_2","width_2","mass_f", "mass_c", "wing","bill","totalhead", "tarsus", "tartoe", "blood","sex_method","bio_datetime","bio_author","ful_datetime","ful_author","remarks", 'bird_pk') #x[!x%in%names(mm)] v = mm[,c("year_","species","subspecies","bird_ID","crc","crc_now","home_av","current_av","age","sex" ,"start_","end_","end_type","caught", "lat_c","lon_c", "site_c", "lat_r", "lon_r", "site_r","muscle", "height_1","width_1", "height_2","width_2","mass_f", "mass_c", "wing","bill","totalhead", "tarsus", "tartoe", "blood","sex_method","bio_datetime","bio_author","ful_datetime","ful_author","project","remarks", 'bird_pk')] con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "BIRDS", value = v, row.names = FALSE, append = TRUE) #dbGetQuery(con, "UPDATE BIRDS SET caught = (SELECT temp.capture FROM temp WHERE temp.bird_ID = BIRDS.bird_ID, # start_ = (SELECT temp.release FROM temp WHERE temp.bird_ID = BIRDS.bird_ID, # site_c = (SELECT temp.at FROM temp WHERE temp.bird_ID = BIRDS.bird_ID # ") dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIRDS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'major', script = 'DB_upload.R', remarks = 'new birds', stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste('capt info uploaded to BIRDS for', mm$bird_ID)) } } {# IF BIRD ENDS at NIOZ mm = m[m$at%in%catch | grepl("free",m$what, perl = TRUE) | grepl("died",m$what, perl = TRUE) | grepl("dead",m$what, perl = TRUE) | grepl("killed",m$what, perl = TRUE) | grepl("killed",m$health, perl = TRUE) | grepl("died",m$health, perl = TRUE) | grepl("dead",m$health, perl = TRUE),] if(nrow(mm) > 0){ mm$what = ifelse(!mm$what%in%c("free","died","killed"), mm$health, mm$what) mm$release = as.character(mm$release) mm$type = ifelse(grepl("free",mm$what, perl = TRUE), 'released', ifelse(grepl("dead",mm$what, perl = TRUE), 'died', ifelse(grepl("died",mm$what, perl = TRUE), 'died', ifelse(grepl("killed",mm$what, perl = TRUE), 'killed', NA)))) mm$where = capitalize(tolower(mm$where)) mm$lat_r = g$lat[match(mm$where,g$abb)] mm$lon_r = g$lon[match(mm$where,g$abb)] con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm[,c('bird_ID','release','where','type', 'lat_r', 'lon_r')], row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET end_ = (SELECT temp.release FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), site_r = (SELECT temp.'where' FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), lat_r = (SELECT temp.lat_r FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), lon_r = (SELECT temp.lon_r FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), end_type = (SELECT temp.type FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print(paste('end info uploaded to BIRDS', mm$bird_ID)) }else{print('no free, killed, died in what or health')} } {# IF WHAT = SWITCH THEN UPDATE HOME AVIARY FROM WHERE mm = m[which(!is.na(m$what)),] mm = mm[grepl("switch",mm$what, perl = TRUE),c('bird_ID', 'capture','where', 'what','home')] mm = ddply(mm,.(bird_ID), summarise, where = where[capture == max(capture)]) if(nrow(mm) > 0){ con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm, row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET home_av = (SELECT temp.'where' FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS (SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print(paste('home_av updated in BIRDS for',mm$bird_ID)) }else{print('no switch in what')} } {# update current aviary and mass values {# update current aviary mm = m[!grepl("obs",m$what, perl = TRUE)| !grepl("cons",m$what, perl = TRUE),] mm = ddply(mm,.(bird_ID), summarise, where = where[capture == max(capture)]) mm$where = ifelse(tolower(mm$where)%in%tolower(unique(g$abb[!is.na(g$abb)])), NA, mm$where) con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm, row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET current_av = (SELECT temp.'where' FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS (SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print('current_av updated in BIRDS') } {# update current mass m2=m m2$mass[is.na(m2$mass)] = m2$with[is.na(m2$mass)] m2 = ddply(m2[!is.na(m2$mass),],.(bird_ID), summarise, mass = mass[capture == max(capture)]) con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = m2, row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET mass_c = (SELECT temp.'mass' FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS (SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print('mass_c updated in BIRDS') } } {# update BIRDS, if data present, or TO_DO where data missing but what is cr,blood,bio,ul,ful- note that blood means that update to SEX is needed # upadate crc_now mm = m[!(is.na(m$crc_now)| m$crc_now%in%c('yes_flag','no_flag','no_metal','',' ')),c('bird_ID', 'crc_now')] if(nrow(mm) > 0){ if(nrow(mm[!is.na(mm$crc_now),]) == 0){ mx = mm[,c('capture', 'bird_ID', 'crc_now')] mx$what = 'cr' mx$capture = as.character(mx$capture) mx$datetime_solved = mx$remarks = mx$todo_pk = NA con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "TO_DO", value = mx[,c('capture','bird_ID','what','datetime_solved','remarks','todo_pk')], row.names = FALSE, append = TRUE) print('cr in what but not data in crc_now, TODO created') }else{ con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm[!is.na(mm$crc_now),], row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET crc_now = (SELECT temp.crc_now FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS (SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print(paste('crc_now updated in birds for',mm$bird_ID)) } }else{print('no crc_now change')} # update blood mm = m[which(grepl("blood",m$what, perl = TRUE)) ,] if(nrow(mm) > 0){ mm = mm[,c('capture', 'bird_ID', 'what')] mm$what = 'sex' mm$capture = as.character(mm$capture) mm$datetime_solved = mm$remarks = mm$todo_pk = NA mm$blood = 'yes' con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "TO_DO", value = mm[,c('capture','bird_ID','what','datetime_solved','remarks','todo_pk')], row.names = FALSE, append = TRUE) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm, row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET blood = (SELECT temp.blood FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") #dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'TO_DO', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = f2[i], stringsAsFactors = FALSE) #dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste('blood updated in BIRDS and TO_DO for sex created', mm$bird_ID)) }else{print('no blood in what')} # update bio mm = m[ which(grepl("bio",m$what, perl = TRUE) & !grepl("capt",m$what, perl = TRUE)) ,] if(nrow(mm)==0){print('no bio in what')}else{ if(length(names(mm)[names(mm)=='wing']) == 0){ con = dbConnect(dbDriver("SQLite"),dbname = db) mm = mm[,c('capture', 'bird_ID', 'what','author')] mm$what = 'bio' mm$capture = as.character(mm$capture) #mm$author = 'jh' mm$datetime_solved = mm$remarks = mm$todo_pk = NA dbWriteTable(con, name = "TO_DO", value = mm[,c('capture','bird_ID','what','datetime_solved','remarks','todo_pk')], row.names = FALSE, append = TRUE) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm, row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET bio_author = (SELECT temp.author FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), bio_datetime = (SELECT temp.capture FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print('no bio columns in capture sheet; to do created') print(paste('bio_datetime and bio_author updated in BIRDS for', mm$bird_ID)) }else{ con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm[,c('author','capture','bird_ID','wing','bill','totalhead', 'tarsus', 'tartoe')], row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET bio_author = (SELECT temp.author FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), bio_datetime = (SELECT temp.capture FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), wing = (SELECT temp.wing FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), bill = (SELECT temp.'bill' FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), totalhead = (SELECT temp.totalhead FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), tarsus = (SELECT temp.tarsus FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), tartoe = (SELECT temp.tartoe FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print(paste('bio updated in BIRDS for', mm$bird_ID)) } } # update cr mm = m[ which(grepl("cr",m$what, perl = TRUE)& !grepl("capt",m$what, perl = TRUE) & !grepl("crc",m$what, perl = TRUE)) ,] if(nrow(mm)==0){print('no cr in what')}else{ if(nrow(mm[is.na(mm$crc_now),]) > 0){ mm = mm[,c('capture', 'bird_ID', 'what')] mm$what = 'cr' mm$capture = as.character(mm$capture) mm$datetime_solved = mm$remarks = mm$todo_pk = NA con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "TO_DO", value = mm[,c('capture','bird_ID','what','datetime_solved','remarks','todo_pk')], row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste('no crc_now entry despite cr in what in capture sheet, to do created for', mm$bird_ID)) }else{ con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm[,c('bird_ID','crc_now')], row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET crc = (SELECT temp.crc_now FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print(paste('crc updated in birds', mm$bird_ID)) } } # update ful mm = m[ grepl("ful",m$what, perl = TRUE) & !grepl("capt",m$what, perl = TRUE) ,] if(nrow(mm)==0){print('no ful in what')}else{ if(length(names(mm)[names(mm)=='height_1']) == 0){ mm = mm[,c('capture', 'bird_ID', 'what')] mm$what = 'ful' mm$capture = as.character(mm$capture) mm$datetime_solved = mm$remarks = mm$todo_pk = NA con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "TO_DO", value = mm[,c('capture','bird_ID','what','datetime_solved','remarks','todo_pk')], row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste('no ful column names and data entry despite ful in what in capture sheet, to do created', mm$bird_ID)) }else{ con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm[,c('author','capture','bird_ID','muscle','height_1','width_1','height_2', 'width_2')], row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET ful_author = (SELECT temp.author FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), ful_datetime = (SELECT temp.capture FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), muscle = (SELECT temp.muscle FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), height_1 = (SELECT temp.'height_1' FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), width_1 = (SELECT temp.width_1 FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), height_2 = (SELECT temp.height_2 FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), width_2 = (SELECT temp.width_2 FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print(paste('ful updated in birds for', mm$bird_ID)) } } } {# make entry in DB_LOG con = dbConnect(dbDriver("SQLite"),dbname = db) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIRDS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = f2[i], stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) dbDisconnect(con) } print(paste(f2[i],'updated BIRDS')) } {# update SPECIAL tables {# prepare f = list.files(path=paste(wd,sep =''),pattern='data_entry', recursive=TRUE,full.names=TRUE) f2 = list.files(path=paste(wd,sep =''),pattern='data_entry', recursive=TRUE,full.names=FALSE) #f = list.files(path=paste(outdir,sep =''),pattern='data_entry', recursive=TRUE,full.names=TRUE) #f2 = list.files(path=paste(outdir,sep =''),pattern='data_entry', recursive=TRUE,full.names=FALSE) con = dbConnect(dbDriver("SQLite"),dbname = db) #dbGetQuery(con, "DROP TABLE IF EXISTS CAPTURES") a = dbGetQuery(con, "SELECT*FROM CAPTURES") oo = dbGetQuery(con, "SELECT*FROM DBLOG where DBLOG.'table' = 'CAPTURES'") dbDisconnect(con) i = 1 #for(i in 1:length(f)){#{2){# print(i) m = readWorksheetFromFile(f[i], sheet=1, colTypes = 'character') #names(m)[names(m) == 'now'] = 'at' names(m)[names(m) == 'CGF'] = 'molt_col' names(m)[names(m) == 'pk'] = 'c_pk' print(names(a)[!names(a)%in%names(m) & !names(a)%in%c('year_')]) # names that are in the DB but not in the data_entry file (with exception of year_) print(names(m)[!names(m)%in%names(a) & !names(m)%in%c('m_p','f_p','home')]) # names that are in the data_entry file but not in the DB (with exception of 'm_p','f_p','home') m$year_ = substring(m$capture, 1,4) #m[m==""] = NA #m[m==" "] = NA #m[m=="NA"] = NA if(length(names(m)[names(m)=='c_pk'])==0){m$c_pk = NA} if(length(names(m)[names(m)=='pic'])==0){m$pic = NA} if(length(names(m)[names(m)=='with'])==0){m$with = NA} #m$capture = as.POSIXct(m$capture) #m$release = as.POSIXct(m$release) } {# update BIO_TRAIN if btrain or utrain or ult in WHAT mm = m[ grepl("btrain",m$what, perl = TRUE) | grepl("utrain",m$what, perl = TRUE) ,] mm = mm[ !is.na(mm$what) ,] if(nrow(mm)>0){ mm$datetime_ = as.character(mm$capture) mm$year_ = substring(mm$capture, 1,4) if(TRUE%in%unique(grepl("btrain",mm$what, perl = TRUE)) & TRUE%in%unique(grepl("utrain",mm$what, perl = TRUE))){ mm = mm[,c('year_','author', 'datetime_', 'bird_ID','wing', 'bill', 'totalhead','tarsus','tartoe','muscle','height_1','width_1','height_2','width_2')] mm$remarks = mm$bio_pk = NA }else{ if(TRUE%in%unique(grepl("btrain",mm$what, perl = TRUE))){ mm = mm[,c('year_','author', 'datetime_', 'bird_ID','wing', 'bill', 'totalhead','tarsus','tartoe')] mm$muscle = mm$height_1 = mm$width_1 = mm$height_2 = mm$width_2 = mm$remarks = mm$bio_pk = NA }else{ if(TRUE%in%unique(grepl("utrain",mm$what, perl = TRUE))){ mm$wing = mm$tarsus = mm$tartoe = mm$bill = mm$totalhead = NA mm = mm[,c('year_','author', 'datetime_', 'bird_ID','wing', 'bill', 'totalhead','tarsus','tartoe','muscle','height_1','width_1','height_2','width_2')] mm$remarks = mm$bio_pk = NA }}} con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "BIO_TRAIN", value = mm[,c('year_','author', 'datetime_', 'bird_ID','wing', 'bill', 'totalhead','tarsus','tartoe','muscle', 'height_1','width_1','height_2','width_2','remarks','bio_pk')], row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIO_TRAIN', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = f2[i], stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste(mm$capture,'BIO_TRAIN data added for', mm$bird_ID)) dbDisconnect(con) }else{print("no btrain or utrain in WHAT")} } {# update ULTRASOUND table if UL present mm = m[ grepl("ul",m$what, perl = TRUE) ,] mm = mm[ !is.na(mm$what) ,] mm = mm[ !grepl("ful",mm$what, perl = TRUE) ,] if(nrow(mm)==0){print('no ul in what')}else{ con = dbConnect(dbDriver("SQLite"),dbname = db) u = dbGetQuery(con, "SELECT*FROM DBLOG where DBLOG.'table' = 'ULTRASOUND'") dbDisconnect(con) if(nrow(u)==0 | !f2[i]%in%u$remarks){ if(length(names(mm)[names(mm)=='height_1']) == 0){ con = dbConnect(dbDriver("SQLite"),dbname = db) mm = mm[,c('capture', 'bird_ID', 'what')] mm$what = 'ul' mm$capture = as.character(mm$capture) mm$datetime_solved = mm$remarks = mm$todo_pk = NA dbWriteTable(con, name = "TO_DO", value = mm[,c('capture','bird_ID','what','datetime_solved','remarks','todo_pk')], row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste('no ul column names and data entry despite ul in what in capture sheet, to do created for', mm$bird_ID)) }else{ mm$ultra_pk=NA con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "ULTRASOUND", value = mm[,c('author','capture','bird_ID','muscle','height_1','width_1','height_2', 'width_2','remarks','ultra_pk')], row.names = FALSE, append = FALSE) v = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'ULTRASOUND', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = f2[i], stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste('ul added to ULTRASOUND for', mm$bird_ID)) } }else{print('NO UPLOAD!!! - data already in ULTRASOUND table - see DBLOG table')} } } {# update SAMPLE table mm = m[ which((grepl("blood",m$what, perl = TRUE) & !is.na(m$what_ID))| (grepl("skin",m$what, perl = TRUE) & !is.na(m$what_ID))),] mm = mm[ !is.na(mm$what) ,] if(nrow(mm)==0){print('no blood or skin in what or no what_ID')}else{ con = dbConnect(dbDriver("SQLite"),dbname = db) u = dbGetQuery(con, "SELECT*FROM DBLOG where DBLOG.'table' = 'SAMPLES'") dbDisconnect(con) if(nrow(u)==0 | !f2[i]%in%u$remarks){ mm$sample_pk=NA mm$datetime_=as.character(mm$capture) mm$type = ifelse(grepl("blood",mm$what, perl = TRUE), 'blood', ifelse(grepl("skin",mm$what, perl = TRUE), 'skin',NA)) mm$where = ifelse(mm$type == 'blood', 'NIOZ','MPIO') mm$remarks = NA con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "SAMPLES", value = mm[,c('datetime_','type','what_ID','where','remarks','sample_pk')], row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'SAMPLES', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = f2[i], stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste('samples added to samples for', mm$bird_ID)) }else{print('NO UPLOAD!!! - data already in SAMPLES table - see DBLOG table')} } } {# update HARN table if all HARN columns present and 'neck' value entered if(length(names(m)[names(m)=='neck']) == 1){ mm = m[!is.na(m$neck) & !m$neck %in% c(""," "),] if(nrow(mm)>0){ mm = mm[,c('capture', 'bird_ID','what', 'what_ID', 'tilt','neck','armpit','back','size')] mm$harn_pk= NA mm$capture = as.character(mm$capture) con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "HARN", value = mm, row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'HARN', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = f2[i], stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste(mm$capture,'HARN data added for', mm$bird_ID)) dbDisconnect(con) }else{print('no harn data although neck column present')}}else{print('no harn additional data = no neck columnt')} } } {# MOVE THE FILE TO DONE file.rename(f[i], paste(outdir,f2[i], sep = '')) } print(paste('uploaded',f2[i])) ###} ##### AFTER UPLOAD GREY OUT THE DATA IN THE SHEETS OF VISITS FILE {# UPLOAD VISITS - current way or date time based ---- NA what check {# prepare # current visits data from DB con = dbConnect(dbDriver("SQLite"),dbname = db) d = dbGetQuery(con, "SELECT*FROM VISITS") dbDisconnect(con) d = d[ !grepl("session", d$remarks, perl = TRUE) ,] if(nrow(d)> 0){d$v_pk = 1:nrow(d)} # current visits data_entry file v = readWorksheetFromFile(paste(wd0, 'VISITS_cons_devices_aviary_ENTRY.xlsx', sep = ''), sheet='visits') v$v_pk = 1:nrow(v) if(nrow(d)>0){ v = v[v$v_pk>max(d$v_pk),] # select only rows that are not in DB yet if(nrow(v)==0){'no need to check/upload - no new data'} } } {# check # NAs in authors v[is.na(v$author),] # author field - show those that are not in authors con = dbConnect(dbDriver("SQLite"),dbname = db) a = dbGetQuery(con, "SELECT*FROM AUTHORS") a = unique(a$initials[a$initials!=""]) dbDisconnect(con) g = unique(unlist(strsplit(v$author, ','))) g[!g%in%c(a)] # "drew" "ih" "ms" "kc" "others" # check whether 'where' field has only allowed values v[!v$where%in%c(paste('o', seq(1,8,1), sep=""),paste('w', seq(1,7,1), sep=""), 'wu','out', 'hall', 'front', 'back','tech','attic'),] # datetimes v[is.na(v$start),] # check if start time is NA v[is.na(v$end),] # check if start time is NA v[which((!is.na(v$start) | !is.na(v$end)) & v$start>v$end), ] # check whether end happened before start v[which(as.numeric(difftime(v$start,trunc(v$start,"day"), units = "hours"))<6),] # visits before 6:00 v[which(as.numeric(difftime(v$end,trunc(v$end,"day"), units = "hours"))<6),] # visits before 6:00 v[which(as.numeric(difftime(v$start,trunc(v$start,"day"), units = "hours"))>22),] # visits after 22:00 v[which(as.numeric(difftime(v$end,trunc(v$end,"day"), units = "hours"))>22),] # visits after 22:00 # check rows with NA in what v[is.na(v$what),] # check rows with multiple what info #v[!v$what%in%c(NA,"check","floor","feather","food","fff", "catch", "release", "process", "clean", "bleach","clhall", "logger","harness","dummies", "things", "obs", "cons","ul"),] # check whether all in what is defined and show the entries which are not g = unique(unlist(strsplit(v$what, ','))) gg = g[!g%in%c(NA,"check","dcheck","floor","feather","food","fff", "flood","catch", "release", "process", "clean", "bleach","clhall", "logger","harness","dummies", "things", "obs", "cons","ul","repair", "prep","light_off","set","water","rinse","noise")] #gg if(length(gg)>0){ for(i in 1:length(gg)){ print(v[grepl(gg[i],v$what, perl = TRUE),]) } }else{print('no undefined what')} } {# upload if(nrow(v)>0){ v$v_pk = NA v$start = as.character(v$start) v$end = as.character(v$end) con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "VISITS", value = v[,c("author","where","start","what","end","comments","v_pk")], row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'VISITS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_uploda.R', remarks = '', stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste('VISITS data uploaded from', v$start[1], 'to', v$start[nrow(v)])) dbDisconnect(con) }else{print('no new data, no upload')} } } {# UPLOAD CONTINUOUS OBSERVATIONS - Z080710 needs SLEEP {# prepare # current CONS data from DB con = dbConnect(dbDriver("SQLite"),dbname = db) d = dbGetQuery(con, "SELECT*FROM CONT_OBS") dbDisconnect(con) # current con_obs data_entry file v = readWorksheetFromFile(paste(wd0, 'VISITS_cons_devices_aviary_ENTRY.xlsx', sep = ''), sheet='continuous_observations') v$cont_pk = 1:nrow(v) if(nrow(d)>0){ v = v[v$cont_pk>max(d$cont_pk),] # select only rows that are not in DB yet if(nrow(v)==0){'no need to check/upload - no new data'} } } {# check # NAs in authors v[is.na(v$author),] # author field - show those that are not in authors con = dbConnect(dbDriver("SQLite"),dbname = db) a = dbGetQuery(con, "SELECT*FROM AUTHORS") a = unique(a$initials[a$initials!=""]) dbDisconnect(con) g = unique(unlist(strsplit(v$author, ','))) g[!g%in%a] # "drew" "ih" "ms" "kc" "others" # check aviary v[!v$aviary%in%c(paste('o', seq(1,8,1), sep=""),paste('w', seq(1,7,1), sep="")),] # check unique new sessions unique(v$session) # check if bird_ID correct # birds table con = dbConnect(dbDriver("SQLite"),dbname = db) b = dbGetQuery(con, "SELECT*FROM BIRDS") dbDisconnect(con) v[!v$bird_ID%in%c(b$bird_ID),] # check that each session has only one bird_ID vv = ddply(v,.(session, bird_ID), summarise, n = length(bird_ID)) vv[duplicated(vv$session),] # datetimes v[is.na(v$datetime_),] # check if datetime_ is NA # check rows with NA in beh v[is.na(v$beh),] # check whether 'beh' field has only allowed values v[!v$beh%in%c('sleep', 'rest', 'stand', 'preen','stretch','hop', 'hh', 'walk','fly', 'run', 'active', 'eat', 'prob', 'peck','drink', 'ruffle'),] # sure - y,n v[!v$sure%in%c('n','y'),] # check whether all birds observed have rest or sleep OR not wrong time and hence too long sleep v=ddply(v,.(session), transform, prev = c(datetime_[1],datetime_[-length(datetime_)])) v$dur = difftime(v$datetime_,v$prev, units = 'secs') v[as.numeric(v$dur)>5*60,] # shows lines with behaviour that lasted longer than 5 min #v[v$bird_ID == 'Z080704',] vv = ddply(v,.(bird_ID), summarise, sleep = length(sure[beh%in%c('sleep','rest')]),dur = sum(dur[beh%in%c('sleep','rest')])) vv # shows duration of sleep/rest observation per bird } {# upload if(nrow(v)>0){ v$cont_pk = NA v$dur = v$prev = NULL v$datetime_ = as.character(v$datetime_) con = dbConnect(dbDriver("SQLite"),dbname = db) # to CONT_OBS dbWriteTable(con, name = "CONT_OBS", value = v, row.names = FALSE, append = TRUE) # to VISITS names(v)[names(v)=='aviary'] = 'where' vv = ddply(v,.(author, where, session, bird_ID), summarise, start = min(datetime_), what = 'cons', 'general_check' = 'n', end = max(datetime_), comments = NA) vv$comments = paste('session', vv$session, 'bird_ID', vv$bird_ID) vv$session = vv$bird_ID = NULL vv$v_pk = NA dbWriteTable(con, name = "VISITS", value = vv[,c("author","where","start","what","end","comments","v_pk")], row.names = FALSE, append = TRUE) # update DBLOG dv1 = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'CONT_OBS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = NA, stringsAsFactors = FALSE) dv2 = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'VISITS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'cons', script = 'DB_uploda.R', remarks = NA, stringsAsFactors = FALSE) dv = rbind(dv1, dv2) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste('CONT_OBS and VISITS data uploaded from', min(as.POSIXct(v$datetime_)), 'to', max(as.POSIXct(v$datetime)))) dbDisconnect(con) }else{print('no new data, no upload')} } } {# UPLOAD AUTHORS {# prepare # current visits data from DB con = dbConnect(dbDriver("SQLite"),dbname = db) d = dbGetQuery(con, "SELECT*FROM AUTHORS") dbDisconnect(con) # current visits data_entry file v = readWorksheetFromFile(paste(wd0, 'VISITS_cons_devices_aviary_ENTRY.xlsx', sep = ''), sheet='authors') v$authors_pk = 1:nrow(v) if(nrow(d)>0){ v = v[v$authors_pk>max(d$authors_pk),] # select only rows that are not in DB yet if(nrow(v)==0){'no need to check/upload - no new data'} } } {# check # NAs in initials v[is.na(v$initials),] # NAs in initials v[is.na(v$name),] # NAs in initials v[is.na(v$surname),] # NAs in contact v[is.na(v$contact),] # alias and project unique(unlist(strsplit(v$alias, ','))) unique(unlist(strsplit(v$project, ','))) # datetimes v$start_ = as.POSIXct(v$start_, format="%Y-%m-%d") v$end_ = as.POSIXct(v$end_, format="%Y-%m-%d") v[is.na(v$start_),] # check if start time is NA v[is.na(v$end_),] # check if start time is NA v[which((!is.na(v$start_) | !is.na(v$end_)) & v$start_>v$end_), ] # check whether end happened before start } {# upload if(nrow(v)>0){ v$v_pk = NA v$start_ = as.character(v$start_) v$end_ = as.character(v$end_) con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "VISITS", value = v, row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'AUTHORS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'updated', script = 'DB_uploda.R', remarks = NA, stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste('AUTHORS data uploaded')) dbDisconnect(con) }else{print('no new data, no upload')} } } {# UPLOAD DEVICE {# prepare # current CONS data from DB con = dbConnect(dbDriver("SQLite"),dbname = db) d = dbGetQuery(con, "SELECT*FROM DEVICES") dbDisconnect(con) # current con_obs data_entry file v = readWorksheetFromFile(paste(wd0, 'VISITS_cons_devices_aviary_ENTRY.xlsx', sep = ''), sheet='devices') v$devices_pk = 1:nrow(v) if(nrow(d)>0){ v = v[v$devices_pk>max(d$devices_pk),] # select only rows that are not in DB yet if(nrow(v)==0){'no need to check/upload - no new data'} } } {# check # datetimes v[is.na(v$datetime_),] # check if datetime_ is NA # NAs in devices v[is.na(v$device),] # check whether 'devices' field has only allowed values v[!v$device%in%c('acc', 'toa', 'harn', 'dummie'),] # check ID # # of characters shall be 3 v[nchar(v$ID)!=3,] # fist letter unique(substring(v$ID,1,1)) # numbers unique(substring(v$ID,2,3)) # what v[!v$what%in%c('on', 'off', 'dd','fail'),] # batt unique(v$batt) } {# upload if(nrow(v)>0){ v$devices_pk = NA v$datetime_ = as.character(v$datetime_) con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "DEVICES", value = v, row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'DEVICES', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_uploda.R', remarks = NA, stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste('DEVICES data uploaded from', min(as.POSIXct(v$datetime_)), 'to', max(as.POSIXct(v$datetime)))) dbDisconnect(con) }else{print('no new data, no upload')} } } {# UPLOAD AVIARIES {# prepare # current CONS data from DB con = dbConnect(dbDriver("SQLite"),dbname = db) d = dbGetQuery(con, "SELECT*FROM AVIARIES") dbDisconnect(con) # current con_obs data_entry file v = readWorksheetFromFile(paste(wd0, 'VISITS_cons_devices_aviary_ENTRY.xlsx', sep = ''), sheet='aviaries') v$av_pk = 1:nrow(v) if(nrow(d)>0){ v = v[v$av_pk>max(d$av_pk),] # select only rows that are not in DB yet if(nrow(v)==0){'no need to check/upload - no new data'} } } {# check # datetimes v[is.na(v$datetime_),] # check if datetime_ is NA # NAs in authors v[is.na(v$author),] # author field - show those that are not in authors con = dbConnect(dbDriver("SQLite"),dbname = db) a = dbGetQuery(con, "SELECT*FROM AUTHORS") a = unique(a$initials[a$initials!=""]) dbDisconnect(con) g = unique(unlist(strsplit(v$author, ','))) g[!g%in%a] # "drew" "ih" "ms" "kc" "others" # NAs in aviary v[is.na(v$aviary),] # check aviary v[!v$aviary%in%paste('w', seq(1,7,1), sep=""),] # check light_cycle v[!v$light_cycle%in%c('constant','natural', '12'),] # check T_cycle v[!v$T_cycle%in%c('constant_seewater','natural', '12'),] # light and T values summary(v) } {# upload if(nrow(v)>0){ v$av_pk = NA v$datetime_ = as.character(v$datetime_) con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "AVIARIES", value = v, row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'AVIARIES', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_uploda.R', remarks = NA, stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste('AVIARIES data uploaded from', min(as.POSIXct(v$datetime_)), 'to', max(as.POSIXct(v$datetime)))) dbDisconnect(con) }else{print('no new data, no upload')} } } {# UPLOAD TAGS {# prepare # current CONS data from DB con = dbConnect(dbDriver("SQLite"),dbname = db) d = dbGetQuery(con, "SELECT*FROM TAGS") dbDisconnect(con) # current con_obs data_entry file v = readWorksheetFromFile(paste(wd0, 'VISITS_cons_devices_aviary_ENTRY.xlsx', sep = ''), sheet='tags') v$tag_pk = 1:nrow(v) if(nrow(d)>0){ v = v[v$tag_pk>max(d$tag_pk),] # select only rows that are not in DB yet #v = v[!is.na(v$start),] if(nrow(v)==0){'no need to check/upload - no new data'} } } {# check # NAs in type v[is.na(v$type),] # types unique(v$type) # NAs in coating v[is.na(v$coating),] # coating unique(v$coating) # NAs in memmory v[is.na(v$memmory),] # memmory unique(v$memmory) # batt and mass values summary(v) } {# upload if(nrow(v)>0){ v$tag_pk = NA con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "TAGS", value = v, row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'TAGS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_uploda.R', remarks = NA, stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste('TAGS data uploaded')) dbDisconnect(con) }else{print('no new data, no upload')} } } ##### DONE 2018-01-31 13:45:29 # if re-run needed - please use first BIRD TABLE, then above CAPTURE BIRDS update and only then the remaining 2 {# 1. BIRDS TABLE - first upload 2015 - 2017 #con = dbConnect(dbDriver("SQLite"),dbname = db) #dbGetQuery(con, "DROP TABLE IF EXISTS BIRDS") #bDisconnect(con) # then make the table a new directly in SQLiteStudio {# upload EVA's catches + RUFAs v = readWorksheetFromFile(paste(wd2, 'morphometrics+sex_2016.xlsx', sep = ''), sheet=1) v$RNR[v$RNR%in%o$RINGNR] r = readWorksheetFromFile(paste(wd2, 'ColourRings2016.xlsx', sep = ''), sheet=1) r$RNR = toupper(r$RNR) v$colcom = r$complete_cr[match(v$RNR,r$RNR)] v$colcom_now = r$actual_cr[match(v$RNR,r$RNR)] v$year_ = substring(v$CatchDate,1,4) v$CatchLocation[v$CatchLocation == 'Vistula Mouth'] = 'Vistula' v = data.frame(year_ = v$year_, species = 'REKN', subspecies = v$Species, bird_ID = v$RNR, crc = v$colcom, crc_now = v$colcom_no, age = v$Age, sex = v$Sex, caught = v$CatchDate, site_c = v$CatchLocation, wing = v$WING, bill = v$BILL, totalhead = v$TOTHD, tarsus = v$TARS, tartoe = v$TATO, stringsAsFactors = FALSE) v$home_av = v$current_av = v$start_ = v$end_ = v$end_type = v$lat_c = v$lon_c = v$lat_r = v$lon_r = v$site_r = v$muscle = v$height_1 = v$width_1 = v$height_2 = v$width_2 = v$mass_f = v$mass_c = v$bio_author = v$ful_datetime = v$ful_author = v$remarks = v$bird_pk = v$blood = v$sex_method = v$bio_datetime = NA v$project = 'MigrationOnthogeny' #v[duplicated(v$RNR),] xx =c("year_","species","subspecies","bird_ID","crc","crc_now","home_av","current_av","age","sex" ,"start_", "end_", "end_type","caught", "lat_c","lon_c", "site_c", "lat_r", "lon_r", "site_r","muscle", "height_1","width_1", "height_2","width_2","mass_f", "mass_c", "wing","bill","totalhead", "tarsus", "tartoe", "blood","sex_method","bio_datetime","bio_author","ful_datetime","ful_author","project","remarks", "bird_pk") xx[!xx%in%names(v)] v$caught = as.character(v$caught) v$site_c = capitalize(tolower(v$site_c)) v$lat_c = g$lat[match(v$site_c,g$abb)] v$lon_c = g$lon[match(v$site_c,g$abb)] vr = data.frame(species = 'REKN', subspecies = 'ruf', bird_ID = as.character(c('982284830', '982284831')), stringsAsFactors = FALSE) vx = merge(v,vr,all=TRUE) vx = vx[,c("year_","species","subspecies","bird_ID","crc","crc_now","home_av","current_av","age","sex" ,"start_", "end_", "end_type","caught", "lat_c","lon_c", "site_c", "lat_r", "lon_r", "site_r","muscle", "height_1","width_1", "height_2","width_2","mass_f", "mass_c", "wing","bill","totalhead", "tarsus", "tartoe", "blood","sex_method","bio_datetime","bio_author","ful_datetime","ful_author","project","remarks", "bird_pk")] #vr = vx[vx$bird_ID%in%c('982284830', '982284831'),] con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "BIRDS", value = vx , row.names = FALSE, append = TRUE) if(dblog == TRUE){ dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIRDS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'major', script = 'DB_upload.R', remarks = '2015-2016 catches') dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) } dbDisconnect(con) } {# upload 2017 catches (except for last one) v = readWorksheetFromFile(paste(wd2, 'Biometry captive red knots 2017.xlsx', sep = ''), sheet=1) v = v[which(v$Nioz == 'Yes'),] v$DNA = ifelse(v$DNA==TRUE, 'yes', NA) v$CATCH_MONTH = ifelse(nchar(v$CATCH_MONTH)==1, paste(0, v$CATCH_MONTH, sep=""), v$CATCH_MONTH) vv = v[nchar(v$ULTRASOUN)>2,] u1 = data.frame(measured = paste(vv$CATCH_YEAR,'08',vv$CATCH_DAY, sep = '-'), bird_ID = vv$RINGNR, muscle = vv$PECTORAL.MUSCLE, height_1 = vv$SH1 , width_1 = vv$SW1, height_2 = vv$SH2 , width_2 = vv$SW2, stringsAsFactors = FALSE) u1$muscle = gsub(",", ".", u1$muscle) u1$height_1 = gsub(",", ".", u1$height_1) u1$width_1 = gsub(",", ".", u1$width_1) u1$width_2 = gsub(",", ".", u1$width_2) u1$height_2 = gsub(",", ".", u1$height_2) u2 = readWorksheetFromFile(paste(wd2, 'ultrasound.xlsx', sep = ''), sheet=1) u2$mass = u2$age = u2$comments = u2$where = u2$released = NULL u2$measured = as.character(u2$measured) u = rbind(u1,u2) v = merge(v,u, by.x = 'RINGNR', by.y = 'bird_ID', all.x = TRUE) v$bio_datetime = ifelse(v$CATCH_MONTH == '09', '2017-10-04', ifelse(v$CATCH_MONTH == '08', '2017-09-04', paste(v$CATCH_YEAR,v$CATCH_MONTH,v$CATCH_DAY, sep = '-'))) v$start_ = ifelse(v$CATCH_MONTH == '09', '2017-09-22', NA) v=v[v$CATCH_MONTH != '09',] v = data.frame(bird_pk = v$BIOKLRI_ID, year_ = v$CATCH_YEAR, species = 'REKN', subspecies = 'isl', bird_ID = v$RINGNR, crc = v$CR_CODE, crc_now = NA, age = v$AGE, sex = NA, caught = paste(v$CATCH_YEAR,v$CATCH_MONTH,v$CATCH_DAY, sep = '-'), site_c = v$CATCH_LOCATION, wing = v$WING, bill = v$BILL, totalhead = v$TOTHD, tarsus = v$TARS, tartoe = v$TATO, mass_f = v$MASS, giz_author = 'ad', bio_author = 'jth', blood = v$DNA, muscle = v$muscle, height_1 = v$height_1, width_1 = v$width_1, height_2 = v$height_2, width_2 = v$width_2, giz_datetime = v$measured, bio_datetime = v$bio_datetime, start_ = v$start_ , stringsAsFactors = FALSE) v$home_av = v$current_av = v$end_ = v$end_type = v$lat_c = v$lon_c = v$lat_r = v$lon_r = v$site_r = v$mass_c = v$remarks = v$sex_method = NA v$site_c = ifelse(v$site_c == 'GRIEND', 'Griend', ifelse( v$site_c == 'DE RICHEL', 'Richel', 'Schier')) v$lat_c = g$lat[match(v$site_c,g$abb)] v$lon_c = g$lon[match(v$site_c,g$abb)] x = readWorksheetFromFile(paste(wd2, 'captive_knots_2017_12+moving_2018_01.xlsx', sep = ''), sheet=1) x = x[x$X2 == 'Martin',] v$project = ifelse(v$bird_ID%in%x$ID,'SocialJetLag','MigrationOnthogeny') xx =c("year_","species","subspecies","bird_ID","crc","crc_now","home_av","current_av","age","sex" ,"start_", "end_", "end_type","caught", "lat_c","lon_c", "site_c", "lat_r", "lon_r", "site_r","muscle", "height_1","width_1", "height_2","width_2","mass_f", "mass_c", "wing","bill","totalhead", "tarsus", "tartoe", "blood","sex_method","bio_datetime","bio_author","giz_datetime","giz_author","project","remarks", "bird_pk") xx[!xx%in%names(v)] v1 = v[c("year_","species","subspecies","bird_ID","crc","crc_now","home_av","current_av","age","sex" ,"start_", "end_", "end_type","caught", "lat_c","lon_c", "site_c", "lat_r", "lon_r", "site_r","muscle", "height_1","width_1", "height_2","width_2","mass_f", "mass_c", "wing","bill","totalhead", "tarsus", "tartoe", "blood","sex_method","bio_datetime","bio_author","giz_datetime","giz_author","project","remarks", "bird_pk")] con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "BIRDS", value = v1, row.names = FALSE, append = TRUE) if(dblog == TRUE){ dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIRDS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'major', script = 'DB_upload.R', remarks = '2017-07 and 08 catches') dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) } dbDisconnect(con) } } # 2. capture BIRDs above {# 3. update FUL from file, which has to have following info 'author','measured','bird_ID','muscle','height_1','width_1','height_2', 'width_2' ul_date = '2017-09-23' # DEFINE u = readWorksheetFromFile(paste(wd2, 'ultrasound_',ul_date,'.xlsx', sep = ''), sheet=1) u$measured = as.character(u$measured) con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = u[,c('author','measured','bird_ID','muscle','height_1','width_1','height_2', 'width_2')], row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET ful_author = (SELECT temp.author FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), ful_datetime = (SELECT temp.measured FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), muscle = (SELECT temp.muscle FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), height_1 = (SELECT temp.'height_1' FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), width_1 = (SELECT temp.width_1 FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), height_2 = (SELECT temp.height_2 FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), width_2 = (SELECT temp.width_2 FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") # update DBLOG x = data.frame(bird_ID = u$bird_ID, datetime_ = as.character(Sys.time()), stringsAsFactors=FALSE) dbWriteTable(con, name = "temp", value = x, row.names = FALSE) dbExecute(con, "UPDATE TO_DO SET datetime_solved = (SELECT temp.datetime_ FROM temp WHERE temp.bird_ID = TO_DO.bird_ID and TO_DO.what like '%ful%') WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = TO_DO.bird_ID and TO_DO.what like '%ful%') ") dbWriteTable(con, name = "TO_DO", value = mx[,c('capture','bird_ID','what','datetime_solved','remarks','todo_pk')], row.names = FALSE, append = TRUE) dbDisconnect(con) dbGetQuery(con, "DROP TABLE IF EXISTS temp") if(dblog == TRUE){ dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIRDS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'major', script = 'DB_upload.R', remarks = 'ful of 2017-09 catch') dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) } dbDisconnect(con) print('ful updated in birds') } {# 4. DONE update biometrics and other info from JOBs DB for BIRDS 2017-09 catch DATA v = readWorksheetFromFile(paste(wd2, 'Biometry captive red knots 2017.xlsx', sep = ''), sheet=1) v = v[which(v$Nioz == 'Yes'),] v$DNA = ifelse(v$DNA==TRUE, 'yes', NA) v$CATCH_MONTH = ifelse(nchar(v$CATCH_MONTH)==1, paste(0, v$CATCH_MONTH, sep=""), v$CATCH_MONTH) v = v[v$CATCH_MONT=='09',] v$site_c = ifelse(v$CATCH_LOCATION == 'GRIEND', 'Griend', ifelse( v$CATCH_LOCATION == 'DE RICHEL', 'Richel', 'Schier')) v$lat_c = g$lat[match(v$site_c,g$abb)] v$lon_c = g$lon[match(v$site_c,g$abb)] v$project = 'SocialJetLag' v$age = ifelse(v$AGE == 3, 'A', v$AGE) v$bio_author = 'jh' v$bird_ID = v$RINGNR v$species = 'REKN' v$subspecies = 'isl' # UPDATE BIRDS con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = v[,c('bio_author','bird_ID','TOTHD','BILL','WING','TARS','TATO', 'age','project','site_c','lat_c','lon_c','DNA','MASS','species','subspecies')], row.names = FALSE, append = FALSE) #bio_datetime = (SELECT temp.capture FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), dbExecute(con, "UPDATE BIRDS SET bio_author = (SELECT temp.bio_author FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), species = (SELECT temp.species FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), subspecies = (SELECT temp.subspecies FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), mass_f = (SELECT temp.MASS FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), age = (SELECT temp.age FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), blood = (SELECT temp.DNA FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), project = (SELECT temp.project FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), site_c = (SELECT temp.site_c FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), lat_c = (SELECT temp.lat_c FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), lon_c = (SELECT temp.lon_c FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), wing = (SELECT temp.WING FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), bill = (SELECT temp.'BILL' FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), totalhead = (SELECT temp.TOTHD FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), tarsus = (SELECT temp.TARS FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), tartoe = (SELECT temp.TATO FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") # UPDATE TO_DO x = data.frame(bird_ID = v$bird_ID, datetime_ = as.character(Sys.time()), stringsAsFactors=FALSE) dbWriteTable(con, name = "temp", value = x, row.names = FALSE) dbExecute(con, "UPDATE TO_DO SET datetime_solved = (SELECT temp.datetime_ FROM temp WHERE temp.bird_ID = TO_DO.bird_ID and TO_DO.what like '%mass_f%') WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = TO_DO.bird_ID and TO_DO.what like '%mass_f%') ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") if(dblog == TRUE){ dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIRDS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'major', script = 'DB_upload.R', remarks = 'ful of 2017-09 bio, age, species, etc') dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) } dbDisconnect(con) print('bio updated in birds') } {# update HARN table if 'harn' or 'on'/'off' and what_ID starting with 'H', 'P','D' mm = m[grepl("harn",m$what, perl = TRUE)| grepl("on",m$what, perl = TRUE) & substring(m$what_ID,1,1) %in%c('H','D','P') | grepl("off",m$what, perl = TRUE) & substring(m$what_ID,1,1) %in%c('H','D','P'),] mm = mm[!is.na(mm$what),] if(nrow(mm)==0){print('no harn in what')}else{ if(length(names(mm)[names(mm)=='tilt']) == 0){ mm = mm[,c('capture', 'bird_ID','what', 'what_ID')] mm$tilt = mm$neck = mm$armpit = mm$back = mm$size = mm$harn_pk= NA mm$capture = as.character(mm$capture) }else{ mm = mm[,c('capture', 'bird_ID', 'what','what_ID','tilt', 'neck', 'armpit','back','size')] mm$harn_pk=NA mm$capture = as.character(mm$capture) } con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "HARN", value = mm, row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'HARN', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = f2[i], stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste(mm$capture,'HARN data added for', mm$bird_ID)) dbDisconnect(con) } } {# 5. update positions to decimals v = readWorksheetFromFile(paste(wd2, 'catch_locations.xlsx', sep = ''), sheet=1) v[v==""] = NA v[v==" "] = NA v[v=="NA"] = NA #conv_unit("6 13 51", from = 'deg_min_sec', to = 'dec_deg') #conv_unit("5 16 40", from = 'deg_min_sec', to = 'dec_deg') #v$lat_deg = gsub('.', ' ', v$lat_deg, fixed = TRUE) #v$lon_deg = gsub('.', ' ', v$lon_deg, fixed = TRUE) #v$lat = ifelse(is.na(v$lat_deg), v$lat, conv_unit(v$lat_deg, from = 'deg_min_sec', to = 'dec_deg')) con = dbConnect(dbDriver("SQLite"),dbname = db) b = dbGetQuery(con, "SELECT*FROM BIRDS") dbDisconnect(con) b$lat_c = v$lat[match(b$site_c, v$abb)] b$lon_c = v$lon[match(b$site_c, v$abb)] b$lat_r = v$lat[match(b$site_r, v$abb)] b$lon_r = v$lon[match(b$site_r, v$abb)] con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = b, row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET lat_c = (SELECT temp.lat_c FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), lon_c = (SELECT temp.lon_c FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), lat_r = (SELECT temp.lat_r FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), lon_r = (SELECT temp.lon_r FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIRDS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'minor', script = 'DB_upload.R: 5. update positions to decimals', remarks = 'updated lat and lon', stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) dbDisconnect(con) } {# 6. update color combos m = read.csv(paste(wd2,'BIOKLRI.csv', sep=""), stringsAsFactors=FALSE) con = dbConnect(dbDriver("SQLite"),dbname = db) b = dbGetQuery(con, "SELECT*FROM BIRDS where crc is null") dbDisconnect(con) b$crc = m$CR_CODE[match(b$bird_ID, m$RINGNR)] #b[,c('bird_ID','crc')] con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = b[,c('bird_ID','crc')], row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET crc = (SELECT temp.crc FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIRDS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'minor', script = 'DB_upload.R: update color combos', remarks = 'updated crc', stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) dbDisconnect(con) }
/Data/AVESatNIOZ/DB_upload.R
no_license
MartinBulla/SocialJetLag
R
false
false
67,262
r
# TO DO - check all data for correct datetime - e.g. current cont_obs are running on winter time, while all the rest of data runs on summer time {# INFO #ALT+0 # when birds arrive to nioz #### !!! if blood not indicated in what, it is asumed that we have no clue whether blood was taken - if blood was taken upon capture, please indicate this, as well as whether biometry and ful, crc done #### enter fields f_mass, project,species, age and subspecies when birds brought in } # Luc please install: #install.packages('scales') #### START HERE # Luc or Martin Luc = FALSE # indicate in DB_LOG dblog = TRUE {# TOOLS {# define working directories if(Luc == TRUE){ wd0 = "C:/Users/ldemonte/Dropbox/data_entry/" wd = "C:/Users/ldemonte/Dropbox/data_entry/ready_for_DB_upload/" outdir = "C:/Users/ldemonte/Dropbox/data_entry/uploaded_to_DB/" wd2 = "C:/Users/ldemonte/Dropbox/AVESatNIOZ/" }else{ wd0 = "C:/Users/mbulla/Documents/Dropbox/Science/Projects/MC/Data/data_entry/" wd = "C:/Users/mbulla/Documents/Dropbox/Science/Projects/MC/Data/data_entry/ready_for_DB_upload/" outdir = "C:/Users/mbulla/Documents/Dropbox/Science/Projects/MC/Data/data_entry/uploaded_to_DB/" wd2 = "C:/Users/mbulla/Documents/Dropbox/Science/Projects/MC/Data/AVESatNIOZ/" } } {# load packages require(plyr) require(XLConnect) require("RSQLite") #require("DBI") require('Hmisc') } {# DB connection db=paste(wd2,"AVESatNIOZ.sqlite",sep="") #db=paste(wd2,"test.sqlite",sep="") #db=paste(wd2,"test2.sqlite",sep="") } {# metadata # birds table con = dbConnect(dbDriver("SQLite"),dbname = db) b = dbGetQuery(con, "SELECT*FROM BIRDS") dbDisconnect(con) # captures table con = dbConnect(dbDriver("SQLite"),dbname = db) z = dbGetQuery(con, "SELECT*FROM CAPTURES") dbDisconnect(con) # biometry o = readWorksheetFromFile(paste(wd2, 'Biometry captive red knots 2017.xlsx', sep = ''), sheet=1) v = readWorksheetFromFile(paste(wd2, 'morphometrics+sex_2016.xlsx', sep = ''), sheet=1) v$RNR[v$RNR%in%o$RINGNR] # locations g = readWorksheetFromFile(paste(wd2, 'catch_locations.xlsx', sep = ''), sheet=1) } {# !!!! DEFINE CONSTANTS catch = c('Richel', 'Schier','Griend','Vistula', 'Mokbaai') # define off NIOZ catching locations } } # CHECK BEFORE UPLOAD {# prepare con = dbConnect(dbDriver("SQLite"),dbname = db) #dbGetQuery(con, "DROP TABLE IF EXISTS CAPTURES") a = dbGetQuery(con, "SELECT*FROM CAPTURES") oo = dbGetQuery(con, "SELECT*FROM DBLOG where DBLOG.'table' = 'CAPTURES'") dbDisconnect(con) f = list.files(path=paste(wd,sep =''),pattern='data_entry', recursive=TRUE,full.names=TRUE) f2 = list.files(path=paste(wd,sep =''),pattern='data_entry', recursive=TRUE,full.names=FALSE) } {# check WHAT entries to know whether additional uploads needed l = list() j =NA for(i in 1:length(f)){#{2){# #i = 1 m = readWorksheetFromFile(f[i], sheet=1) {#### if this part does not work hashtag it out #m[m==""] = NA #m[m==" "] = NA #m[m=="NA"] = NA #### } #print(i) #print(unique(m$what)[!is.na(unique(m$what))]) l[[i]] = data.frame(f = i , what = if(length(unique(m$what)[!is.na(unique(m$what))])==0){NA}else{unique(m$what)[!is.na(unique(m$what))]}, stringsAsFactors = FALSE) j = c(j,unique(m$what)[!is.na(unique(m$what))]) } #ll = do.call(rbind,l) #f2[i] print( unique(j)) } {# check HEALTH entries to know whether additional uploads needed - FINISH CLEANING l = list() j =NA for(i in 1:length(f)){#{2){# #i = 20 m = readWorksheetFromFile(f[i], sheet=1) #print(i) #print(unique(m$health)[!is.na(unique(m$health))]) l[[i]] = data.frame(f = i , health = if(length(unique(m$health)[!is.na(unique(m$health))])==0){NA}else{unique(m$health)[!is.na(unique(m$health))]}, stringsAsFactors = FALSE) j = c(j,unique(m$health)[!is.na(unique(m$health))]) } #ll = do.call(rbind,l) #f2[i] print(unique(j)) } {# UPLOAD CAPTURES f = list.files(path=paste(wd,sep =''),pattern='data_entry', recursive=TRUE,full.names=TRUE) f2 = list.files(path=paste(wd,sep =''),pattern='data_entry', recursive=TRUE,full.names=FALSE) #for(i in 1:length(f)){#length(f)){#{2){# i = 1 f2[i] {# prepare print(i) m = readWorksheetFromFile(f[i], sheet=1, colTypes = 'character') #names(m)[names(m) == 'now'] = 'at' names(m)[names(m) == 'CGF'] = 'molt_col' names(m)[names(m) == 'pk'] = 'c_pk' print(names(a)[!names(a)%in%names(m) & !names(a)%in%c('year_')]) # names that are in the DB but not in the data_entry file (with exception of year_) print(names(m)[!names(m)%in%names(a) & !names(m)%in%c('m_p','f_p','home')]) # names that are in the data_entry file but not in the DB (with exception of 'm_p','f_p','home') #m$capture = as.character(m$capture) #m$release = as.character(m$release) m$year_ = substring(m$capture, 1,4) {#### if this part does not work, hashtag it out m[m==""] = NA m[m==" "] = NA m[m=="NA"] = NA #### } if(length(names(m)[names(m)=='c_pk'])==0){m$c_pk = NA} if(length(names(m)[names(m)=='pic'])==0){m$pic = NA} if(length(names(m)[names(m)=='with'])==0){m$with = NA} #m$capture = as.POSIXct(m$capture) #m$release = as.POSIXct(m$release) } {# upload to captures #print(names(m)[!names(m)%in%c("year_", "capture", "at","release", "where", "bird_ID", "what", "what_ID", "health", "feet","mass", "remarks", "author", "plum", "molt","molt_col", "L01","L02","L03","L04","L05","L06","L07","L08","L09","L10","R01","R02","R03","R04","R05","R06","R07","R08","R09","R10","crc_now", "capture_pk")]) mm = m[,c("year_", "capture", "at","release", "where", "bird_ID", "what", "what_ID", "health", "feet","mass", "with", "remarks", "author", "plum", "molt","molt_col", "L01","L02","L03","L04","L05","L06","L07","L08","L09","L10","R01","R02","R03","R04","R05","R06","R07","R08","R09","R10","crc_now","pic", "c_pk")] #mm$capture = as.character(mm$capture) #mm$release = as.character(mm$release) if(f2[i]%in%oo$remarks){print('NO UPLOAD!!! - data already in DB - see DBLOG table')}else{ con = dbConnect(dbDriver("SQLite"),dbname = db) #print(names(z)[!names(z)%in%names(mm)]) #print(names(mm)[!names(mm)%in%names(z)]) dbWriteTable(con, name = "CAPTURES", value = mm, row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'CAPTURES', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = f2[i], stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste(f2[i],'uploaded to captures')) } } #} } {# create/update BIRDS entries f = list.files(path=paste(wd,sep =''),pattern='data_entry', recursive=TRUE,full.names=TRUE) f2 = list.files(path=paste(wd,sep =''),pattern='data_entry', recursive=TRUE,full.names=FALSE) #for(i in 1:length(f)){#{2){# i = 1 {# prepare print(i) m = readWorksheetFromFile(f[i], sheet=1, colTypes = 'character') #names(m)[names(m) == 'now'] = 'at' names(m)[names(m) == 'CGF'] = 'molt_col' names(m)[names(m) == 'pk'] = 'c_pk' #print(names(a)[!names(a)%in%names(m) & !names(a)%in%c('year_')]) # names that are in the DB but not in the data_entry file (with exception of year_) #print(names(m)[!names(m)%in%names(a) & !names(m)%in%c('m_p','f_p','home')]) # names that are in the data_entry file but not in the DB (with exception of 'm_p','f_p','home') m$year_ = substring(m$capture, 1,4) m[m==""] = NA m[m==" "] = NA m[m=="NA"] = NA if(length(names(m)[names(m)=='pic'])==0){m$pic = NA} if(length(names(m)[names(m)=='with'])==0){m$with = NA} #m$capture = as.POSIXct(m$capture) #m$release = as.POSIXct(m$release) } {# IF BIRD ARRIVES to NIOZ - create its data entry line and if data missing create TO_DO mm = m[m$at%in%catch | grepl("capt",m$what, perl = TRUE),] if(nrow(mm)==0){print('no capt in what')}else{ # TO_DO entry if data missing mass_f = length(names(mm)[names(mm)=='mass_f']) project = length(names(mm)[names(mm)=='project']) species = length(names(mm)[names(mm)=='species']) subspecies = length(names(mm)[names(mm)=='subspecies']) age = length(names(mm)[names(mm)=='age']) if((mass_f+project+species+subspecies+age) < 5){ mx = mm[,c('capture', 'bird_ID', 'what')] mx$what = paste(if(mass_f==0){'mass_f'}, if(age==0){'age'},if(species==0){'species'},if(subspecies==0){'subspecies'},if(project==0){'project'}, sep =",") mx$capture = as.character(mx$capture) mx$datetime_solved = mx$remarks = mx$todo_pk = NA con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "TO_DO", value = mx[,c('capture','bird_ID','what','datetime_solved','remarks','todo_pk')], row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste('no', paste(if(mass_f==0){'mass_f'}, if(age==0){'age'},if(species==0){'species'},if(subspecies==0){'subspecies'},if(project==0){'project'},sep=","), 'column names and data entry despite capt in what in capture sheet, to do created')) } # add data to birds mm$capture = as.character(mm$capture) mm$release = as.character(mm$release) mm$year_ = substring(mm$capture, 1,4) mm$blood = ifelse(grepl("blood",mm$what, perl = TRUE), 'yes',NA) #### !!! if blood not indicated in what, it is asumed that we have no clue whether blood taken mm$sex_method = ifelse(grepl("blood",mm$what, perl = TRUE), 'blood',NA) if(length(names(mm)[names(mm)=='wing']) == 0){mm$wing = mm$bill = mm$totalhead = mm$tarsus = mm$tartoe = mm$bio_datetime = mm$bio_author = NA}else{mm$bio_datetime == mm$capture; mm$bio_author = mm$author} if(length(names(mm)[names(mm)=='mass_f']) == 0){mm$mass_f = NA} if(length(names(mm)[names(mm)=='project']) == 0){mm$project = NA} if(length(names(mm)[names(mm)=='subspecies']) == 0){mm$subspecies = NA} if(length(names(mm)[names(mm)=='species']) == 0){mm$species = NA} if(length(names(mm)[names(mm)=='age']) == 0){mm$age = NA} if(length(names(mm)[names(mm)=='height_1']) == 0){mm$muscle = mm$height_1 = mm$width_1 = mm$height_2 = mm$width_2 = mm$ful_datetime = mm$ful_author = NA}else{mm$ful_datetime == mm$capture; mm$ful_author = mm$author} mm$end_ = mm$end_type = mm$site_r = mm$bird_pk = mm$sex = mm$lat_r = mm$lon_r = mm$site_r = NA # UPDATE CATCHING LOCATIONS names(mm)[names(mm)=='capture'] = 'caught' names(mm)[names(mm)=='release'] = 'start_' names(mm)[names(mm)=='at'] = 'site_c' names(mm)[names(mm)=='where'] = 'current_av' names(mm)[names(mm)=='mass'] = 'mass_c' mm$site_c = capitalize(tolower(mm$site_c)) mm$home_av = mm$current_av mm$crc = mm$crc_now mm$lat_c = g$lat[match(mm$site_c,g$abb)] mm$lon_c = g$lon[match(mm$site_c,g$abb)] #x = c("year_","species","subspecies","bird_ID","crc","crc_now","home_av","current_av","age","sex" ,"start_","end_","end_type","caught", "lat_c","lon_c", "site_c", "lat_r", "lon_r", "site_r","muscle", "height_1","width_1", "height_2","width_2","mass_f", "mass_c", "wing","bill","totalhead", "tarsus", "tartoe", "blood","sex_method","bio_datetime","bio_author","ful_datetime","ful_author","remarks", 'bird_pk') #x[!x%in%names(mm)] v = mm[,c("year_","species","subspecies","bird_ID","crc","crc_now","home_av","current_av","age","sex" ,"start_","end_","end_type","caught", "lat_c","lon_c", "site_c", "lat_r", "lon_r", "site_r","muscle", "height_1","width_1", "height_2","width_2","mass_f", "mass_c", "wing","bill","totalhead", "tarsus", "tartoe", "blood","sex_method","bio_datetime","bio_author","ful_datetime","ful_author","project","remarks", 'bird_pk')] con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "BIRDS", value = v, row.names = FALSE, append = TRUE) #dbGetQuery(con, "UPDATE BIRDS SET caught = (SELECT temp.capture FROM temp WHERE temp.bird_ID = BIRDS.bird_ID, # start_ = (SELECT temp.release FROM temp WHERE temp.bird_ID = BIRDS.bird_ID, # site_c = (SELECT temp.at FROM temp WHERE temp.bird_ID = BIRDS.bird_ID # ") dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIRDS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'major', script = 'DB_upload.R', remarks = 'new birds', stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste('capt info uploaded to BIRDS for', mm$bird_ID)) } } {# IF BIRD ENDS at NIOZ mm = m[m$at%in%catch | grepl("free",m$what, perl = TRUE) | grepl("died",m$what, perl = TRUE) | grepl("dead",m$what, perl = TRUE) | grepl("killed",m$what, perl = TRUE) | grepl("killed",m$health, perl = TRUE) | grepl("died",m$health, perl = TRUE) | grepl("dead",m$health, perl = TRUE),] if(nrow(mm) > 0){ mm$what = ifelse(!mm$what%in%c("free","died","killed"), mm$health, mm$what) mm$release = as.character(mm$release) mm$type = ifelse(grepl("free",mm$what, perl = TRUE), 'released', ifelse(grepl("dead",mm$what, perl = TRUE), 'died', ifelse(grepl("died",mm$what, perl = TRUE), 'died', ifelse(grepl("killed",mm$what, perl = TRUE), 'killed', NA)))) mm$where = capitalize(tolower(mm$where)) mm$lat_r = g$lat[match(mm$where,g$abb)] mm$lon_r = g$lon[match(mm$where,g$abb)] con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm[,c('bird_ID','release','where','type', 'lat_r', 'lon_r')], row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET end_ = (SELECT temp.release FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), site_r = (SELECT temp.'where' FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), lat_r = (SELECT temp.lat_r FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), lon_r = (SELECT temp.lon_r FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), end_type = (SELECT temp.type FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print(paste('end info uploaded to BIRDS', mm$bird_ID)) }else{print('no free, killed, died in what or health')} } {# IF WHAT = SWITCH THEN UPDATE HOME AVIARY FROM WHERE mm = m[which(!is.na(m$what)),] mm = mm[grepl("switch",mm$what, perl = TRUE),c('bird_ID', 'capture','where', 'what','home')] mm = ddply(mm,.(bird_ID), summarise, where = where[capture == max(capture)]) if(nrow(mm) > 0){ con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm, row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET home_av = (SELECT temp.'where' FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS (SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print(paste('home_av updated in BIRDS for',mm$bird_ID)) }else{print('no switch in what')} } {# update current aviary and mass values {# update current aviary mm = m[!grepl("obs",m$what, perl = TRUE)| !grepl("cons",m$what, perl = TRUE),] mm = ddply(mm,.(bird_ID), summarise, where = where[capture == max(capture)]) mm$where = ifelse(tolower(mm$where)%in%tolower(unique(g$abb[!is.na(g$abb)])), NA, mm$where) con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm, row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET current_av = (SELECT temp.'where' FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS (SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print('current_av updated in BIRDS') } {# update current mass m2=m m2$mass[is.na(m2$mass)] = m2$with[is.na(m2$mass)] m2 = ddply(m2[!is.na(m2$mass),],.(bird_ID), summarise, mass = mass[capture == max(capture)]) con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = m2, row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET mass_c = (SELECT temp.'mass' FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS (SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print('mass_c updated in BIRDS') } } {# update BIRDS, if data present, or TO_DO where data missing but what is cr,blood,bio,ul,ful- note that blood means that update to SEX is needed # upadate crc_now mm = m[!(is.na(m$crc_now)| m$crc_now%in%c('yes_flag','no_flag','no_metal','',' ')),c('bird_ID', 'crc_now')] if(nrow(mm) > 0){ if(nrow(mm[!is.na(mm$crc_now),]) == 0){ mx = mm[,c('capture', 'bird_ID', 'crc_now')] mx$what = 'cr' mx$capture = as.character(mx$capture) mx$datetime_solved = mx$remarks = mx$todo_pk = NA con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "TO_DO", value = mx[,c('capture','bird_ID','what','datetime_solved','remarks','todo_pk')], row.names = FALSE, append = TRUE) print('cr in what but not data in crc_now, TODO created') }else{ con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm[!is.na(mm$crc_now),], row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET crc_now = (SELECT temp.crc_now FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS (SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print(paste('crc_now updated in birds for',mm$bird_ID)) } }else{print('no crc_now change')} # update blood mm = m[which(grepl("blood",m$what, perl = TRUE)) ,] if(nrow(mm) > 0){ mm = mm[,c('capture', 'bird_ID', 'what')] mm$what = 'sex' mm$capture = as.character(mm$capture) mm$datetime_solved = mm$remarks = mm$todo_pk = NA mm$blood = 'yes' con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "TO_DO", value = mm[,c('capture','bird_ID','what','datetime_solved','remarks','todo_pk')], row.names = FALSE, append = TRUE) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm, row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET blood = (SELECT temp.blood FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") #dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'TO_DO', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = f2[i], stringsAsFactors = FALSE) #dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste('blood updated in BIRDS and TO_DO for sex created', mm$bird_ID)) }else{print('no blood in what')} # update bio mm = m[ which(grepl("bio",m$what, perl = TRUE) & !grepl("capt",m$what, perl = TRUE)) ,] if(nrow(mm)==0){print('no bio in what')}else{ if(length(names(mm)[names(mm)=='wing']) == 0){ con = dbConnect(dbDriver("SQLite"),dbname = db) mm = mm[,c('capture', 'bird_ID', 'what','author')] mm$what = 'bio' mm$capture = as.character(mm$capture) #mm$author = 'jh' mm$datetime_solved = mm$remarks = mm$todo_pk = NA dbWriteTable(con, name = "TO_DO", value = mm[,c('capture','bird_ID','what','datetime_solved','remarks','todo_pk')], row.names = FALSE, append = TRUE) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm, row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET bio_author = (SELECT temp.author FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), bio_datetime = (SELECT temp.capture FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print('no bio columns in capture sheet; to do created') print(paste('bio_datetime and bio_author updated in BIRDS for', mm$bird_ID)) }else{ con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm[,c('author','capture','bird_ID','wing','bill','totalhead', 'tarsus', 'tartoe')], row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET bio_author = (SELECT temp.author FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), bio_datetime = (SELECT temp.capture FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), wing = (SELECT temp.wing FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), bill = (SELECT temp.'bill' FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), totalhead = (SELECT temp.totalhead FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), tarsus = (SELECT temp.tarsus FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), tartoe = (SELECT temp.tartoe FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print(paste('bio updated in BIRDS for', mm$bird_ID)) } } # update cr mm = m[ which(grepl("cr",m$what, perl = TRUE)& !grepl("capt",m$what, perl = TRUE) & !grepl("crc",m$what, perl = TRUE)) ,] if(nrow(mm)==0){print('no cr in what')}else{ if(nrow(mm[is.na(mm$crc_now),]) > 0){ mm = mm[,c('capture', 'bird_ID', 'what')] mm$what = 'cr' mm$capture = as.character(mm$capture) mm$datetime_solved = mm$remarks = mm$todo_pk = NA con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "TO_DO", value = mm[,c('capture','bird_ID','what','datetime_solved','remarks','todo_pk')], row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste('no crc_now entry despite cr in what in capture sheet, to do created for', mm$bird_ID)) }else{ con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm[,c('bird_ID','crc_now')], row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET crc = (SELECT temp.crc_now FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print(paste('crc updated in birds', mm$bird_ID)) } } # update ful mm = m[ grepl("ful",m$what, perl = TRUE) & !grepl("capt",m$what, perl = TRUE) ,] if(nrow(mm)==0){print('no ful in what')}else{ if(length(names(mm)[names(mm)=='height_1']) == 0){ mm = mm[,c('capture', 'bird_ID', 'what')] mm$what = 'ful' mm$capture = as.character(mm$capture) mm$datetime_solved = mm$remarks = mm$todo_pk = NA con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "TO_DO", value = mm[,c('capture','bird_ID','what','datetime_solved','remarks','todo_pk')], row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste('no ful column names and data entry despite ful in what in capture sheet, to do created', mm$bird_ID)) }else{ con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = mm[,c('author','capture','bird_ID','muscle','height_1','width_1','height_2', 'width_2')], row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET ful_author = (SELECT temp.author FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), ful_datetime = (SELECT temp.capture FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), muscle = (SELECT temp.muscle FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), height_1 = (SELECT temp.'height_1' FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), width_1 = (SELECT temp.width_1 FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), height_2 = (SELECT temp.height_2 FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), width_2 = (SELECT temp.width_2 FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbDisconnect(con) print(paste('ful updated in birds for', mm$bird_ID)) } } } {# make entry in DB_LOG con = dbConnect(dbDriver("SQLite"),dbname = db) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIRDS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = f2[i], stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) dbDisconnect(con) } print(paste(f2[i],'updated BIRDS')) } {# update SPECIAL tables {# prepare f = list.files(path=paste(wd,sep =''),pattern='data_entry', recursive=TRUE,full.names=TRUE) f2 = list.files(path=paste(wd,sep =''),pattern='data_entry', recursive=TRUE,full.names=FALSE) #f = list.files(path=paste(outdir,sep =''),pattern='data_entry', recursive=TRUE,full.names=TRUE) #f2 = list.files(path=paste(outdir,sep =''),pattern='data_entry', recursive=TRUE,full.names=FALSE) con = dbConnect(dbDriver("SQLite"),dbname = db) #dbGetQuery(con, "DROP TABLE IF EXISTS CAPTURES") a = dbGetQuery(con, "SELECT*FROM CAPTURES") oo = dbGetQuery(con, "SELECT*FROM DBLOG where DBLOG.'table' = 'CAPTURES'") dbDisconnect(con) i = 1 #for(i in 1:length(f)){#{2){# print(i) m = readWorksheetFromFile(f[i], sheet=1, colTypes = 'character') #names(m)[names(m) == 'now'] = 'at' names(m)[names(m) == 'CGF'] = 'molt_col' names(m)[names(m) == 'pk'] = 'c_pk' print(names(a)[!names(a)%in%names(m) & !names(a)%in%c('year_')]) # names that are in the DB but not in the data_entry file (with exception of year_) print(names(m)[!names(m)%in%names(a) & !names(m)%in%c('m_p','f_p','home')]) # names that are in the data_entry file but not in the DB (with exception of 'm_p','f_p','home') m$year_ = substring(m$capture, 1,4) #m[m==""] = NA #m[m==" "] = NA #m[m=="NA"] = NA if(length(names(m)[names(m)=='c_pk'])==0){m$c_pk = NA} if(length(names(m)[names(m)=='pic'])==0){m$pic = NA} if(length(names(m)[names(m)=='with'])==0){m$with = NA} #m$capture = as.POSIXct(m$capture) #m$release = as.POSIXct(m$release) } {# update BIO_TRAIN if btrain or utrain or ult in WHAT mm = m[ grepl("btrain",m$what, perl = TRUE) | grepl("utrain",m$what, perl = TRUE) ,] mm = mm[ !is.na(mm$what) ,] if(nrow(mm)>0){ mm$datetime_ = as.character(mm$capture) mm$year_ = substring(mm$capture, 1,4) if(TRUE%in%unique(grepl("btrain",mm$what, perl = TRUE)) & TRUE%in%unique(grepl("utrain",mm$what, perl = TRUE))){ mm = mm[,c('year_','author', 'datetime_', 'bird_ID','wing', 'bill', 'totalhead','tarsus','tartoe','muscle','height_1','width_1','height_2','width_2')] mm$remarks = mm$bio_pk = NA }else{ if(TRUE%in%unique(grepl("btrain",mm$what, perl = TRUE))){ mm = mm[,c('year_','author', 'datetime_', 'bird_ID','wing', 'bill', 'totalhead','tarsus','tartoe')] mm$muscle = mm$height_1 = mm$width_1 = mm$height_2 = mm$width_2 = mm$remarks = mm$bio_pk = NA }else{ if(TRUE%in%unique(grepl("utrain",mm$what, perl = TRUE))){ mm$wing = mm$tarsus = mm$tartoe = mm$bill = mm$totalhead = NA mm = mm[,c('year_','author', 'datetime_', 'bird_ID','wing', 'bill', 'totalhead','tarsus','tartoe','muscle','height_1','width_1','height_2','width_2')] mm$remarks = mm$bio_pk = NA }}} con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "BIO_TRAIN", value = mm[,c('year_','author', 'datetime_', 'bird_ID','wing', 'bill', 'totalhead','tarsus','tartoe','muscle', 'height_1','width_1','height_2','width_2','remarks','bio_pk')], row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIO_TRAIN', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = f2[i], stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste(mm$capture,'BIO_TRAIN data added for', mm$bird_ID)) dbDisconnect(con) }else{print("no btrain or utrain in WHAT")} } {# update ULTRASOUND table if UL present mm = m[ grepl("ul",m$what, perl = TRUE) ,] mm = mm[ !is.na(mm$what) ,] mm = mm[ !grepl("ful",mm$what, perl = TRUE) ,] if(nrow(mm)==0){print('no ul in what')}else{ con = dbConnect(dbDriver("SQLite"),dbname = db) u = dbGetQuery(con, "SELECT*FROM DBLOG where DBLOG.'table' = 'ULTRASOUND'") dbDisconnect(con) if(nrow(u)==0 | !f2[i]%in%u$remarks){ if(length(names(mm)[names(mm)=='height_1']) == 0){ con = dbConnect(dbDriver("SQLite"),dbname = db) mm = mm[,c('capture', 'bird_ID', 'what')] mm$what = 'ul' mm$capture = as.character(mm$capture) mm$datetime_solved = mm$remarks = mm$todo_pk = NA dbWriteTable(con, name = "TO_DO", value = mm[,c('capture','bird_ID','what','datetime_solved','remarks','todo_pk')], row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste('no ul column names and data entry despite ul in what in capture sheet, to do created for', mm$bird_ID)) }else{ mm$ultra_pk=NA con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "ULTRASOUND", value = mm[,c('author','capture','bird_ID','muscle','height_1','width_1','height_2', 'width_2','remarks','ultra_pk')], row.names = FALSE, append = FALSE) v = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'ULTRASOUND', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = f2[i], stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste('ul added to ULTRASOUND for', mm$bird_ID)) } }else{print('NO UPLOAD!!! - data already in ULTRASOUND table - see DBLOG table')} } } {# update SAMPLE table mm = m[ which((grepl("blood",m$what, perl = TRUE) & !is.na(m$what_ID))| (grepl("skin",m$what, perl = TRUE) & !is.na(m$what_ID))),] mm = mm[ !is.na(mm$what) ,] if(nrow(mm)==0){print('no blood or skin in what or no what_ID')}else{ con = dbConnect(dbDriver("SQLite"),dbname = db) u = dbGetQuery(con, "SELECT*FROM DBLOG where DBLOG.'table' = 'SAMPLES'") dbDisconnect(con) if(nrow(u)==0 | !f2[i]%in%u$remarks){ mm$sample_pk=NA mm$datetime_=as.character(mm$capture) mm$type = ifelse(grepl("blood",mm$what, perl = TRUE), 'blood', ifelse(grepl("skin",mm$what, perl = TRUE), 'skin',NA)) mm$where = ifelse(mm$type == 'blood', 'NIOZ','MPIO') mm$remarks = NA con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "SAMPLES", value = mm[,c('datetime_','type','what_ID','where','remarks','sample_pk')], row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'SAMPLES', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = f2[i], stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) dbDisconnect(con) print(paste('samples added to samples for', mm$bird_ID)) }else{print('NO UPLOAD!!! - data already in SAMPLES table - see DBLOG table')} } } {# update HARN table if all HARN columns present and 'neck' value entered if(length(names(m)[names(m)=='neck']) == 1){ mm = m[!is.na(m$neck) & !m$neck %in% c(""," "),] if(nrow(mm)>0){ mm = mm[,c('capture', 'bird_ID','what', 'what_ID', 'tilt','neck','armpit','back','size')] mm$harn_pk= NA mm$capture = as.character(mm$capture) con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "HARN", value = mm, row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'HARN', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = f2[i], stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste(mm$capture,'HARN data added for', mm$bird_ID)) dbDisconnect(con) }else{print('no harn data although neck column present')}}else{print('no harn additional data = no neck columnt')} } } {# MOVE THE FILE TO DONE file.rename(f[i], paste(outdir,f2[i], sep = '')) } print(paste('uploaded',f2[i])) ###} ##### AFTER UPLOAD GREY OUT THE DATA IN THE SHEETS OF VISITS FILE {# UPLOAD VISITS - current way or date time based ---- NA what check {# prepare # current visits data from DB con = dbConnect(dbDriver("SQLite"),dbname = db) d = dbGetQuery(con, "SELECT*FROM VISITS") dbDisconnect(con) d = d[ !grepl("session", d$remarks, perl = TRUE) ,] if(nrow(d)> 0){d$v_pk = 1:nrow(d)} # current visits data_entry file v = readWorksheetFromFile(paste(wd0, 'VISITS_cons_devices_aviary_ENTRY.xlsx', sep = ''), sheet='visits') v$v_pk = 1:nrow(v) if(nrow(d)>0){ v = v[v$v_pk>max(d$v_pk),] # select only rows that are not in DB yet if(nrow(v)==0){'no need to check/upload - no new data'} } } {# check # NAs in authors v[is.na(v$author),] # author field - show those that are not in authors con = dbConnect(dbDriver("SQLite"),dbname = db) a = dbGetQuery(con, "SELECT*FROM AUTHORS") a = unique(a$initials[a$initials!=""]) dbDisconnect(con) g = unique(unlist(strsplit(v$author, ','))) g[!g%in%c(a)] # "drew" "ih" "ms" "kc" "others" # check whether 'where' field has only allowed values v[!v$where%in%c(paste('o', seq(1,8,1), sep=""),paste('w', seq(1,7,1), sep=""), 'wu','out', 'hall', 'front', 'back','tech','attic'),] # datetimes v[is.na(v$start),] # check if start time is NA v[is.na(v$end),] # check if start time is NA v[which((!is.na(v$start) | !is.na(v$end)) & v$start>v$end), ] # check whether end happened before start v[which(as.numeric(difftime(v$start,trunc(v$start,"day"), units = "hours"))<6),] # visits before 6:00 v[which(as.numeric(difftime(v$end,trunc(v$end,"day"), units = "hours"))<6),] # visits before 6:00 v[which(as.numeric(difftime(v$start,trunc(v$start,"day"), units = "hours"))>22),] # visits after 22:00 v[which(as.numeric(difftime(v$end,trunc(v$end,"day"), units = "hours"))>22),] # visits after 22:00 # check rows with NA in what v[is.na(v$what),] # check rows with multiple what info #v[!v$what%in%c(NA,"check","floor","feather","food","fff", "catch", "release", "process", "clean", "bleach","clhall", "logger","harness","dummies", "things", "obs", "cons","ul"),] # check whether all in what is defined and show the entries which are not g = unique(unlist(strsplit(v$what, ','))) gg = g[!g%in%c(NA,"check","dcheck","floor","feather","food","fff", "flood","catch", "release", "process", "clean", "bleach","clhall", "logger","harness","dummies", "things", "obs", "cons","ul","repair", "prep","light_off","set","water","rinse","noise")] #gg if(length(gg)>0){ for(i in 1:length(gg)){ print(v[grepl(gg[i],v$what, perl = TRUE),]) } }else{print('no undefined what')} } {# upload if(nrow(v)>0){ v$v_pk = NA v$start = as.character(v$start) v$end = as.character(v$end) con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "VISITS", value = v[,c("author","where","start","what","end","comments","v_pk")], row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'VISITS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_uploda.R', remarks = '', stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste('VISITS data uploaded from', v$start[1], 'to', v$start[nrow(v)])) dbDisconnect(con) }else{print('no new data, no upload')} } } {# UPLOAD CONTINUOUS OBSERVATIONS - Z080710 needs SLEEP {# prepare # current CONS data from DB con = dbConnect(dbDriver("SQLite"),dbname = db) d = dbGetQuery(con, "SELECT*FROM CONT_OBS") dbDisconnect(con) # current con_obs data_entry file v = readWorksheetFromFile(paste(wd0, 'VISITS_cons_devices_aviary_ENTRY.xlsx', sep = ''), sheet='continuous_observations') v$cont_pk = 1:nrow(v) if(nrow(d)>0){ v = v[v$cont_pk>max(d$cont_pk),] # select only rows that are not in DB yet if(nrow(v)==0){'no need to check/upload - no new data'} } } {# check # NAs in authors v[is.na(v$author),] # author field - show those that are not in authors con = dbConnect(dbDriver("SQLite"),dbname = db) a = dbGetQuery(con, "SELECT*FROM AUTHORS") a = unique(a$initials[a$initials!=""]) dbDisconnect(con) g = unique(unlist(strsplit(v$author, ','))) g[!g%in%a] # "drew" "ih" "ms" "kc" "others" # check aviary v[!v$aviary%in%c(paste('o', seq(1,8,1), sep=""),paste('w', seq(1,7,1), sep="")),] # check unique new sessions unique(v$session) # check if bird_ID correct # birds table con = dbConnect(dbDriver("SQLite"),dbname = db) b = dbGetQuery(con, "SELECT*FROM BIRDS") dbDisconnect(con) v[!v$bird_ID%in%c(b$bird_ID),] # check that each session has only one bird_ID vv = ddply(v,.(session, bird_ID), summarise, n = length(bird_ID)) vv[duplicated(vv$session),] # datetimes v[is.na(v$datetime_),] # check if datetime_ is NA # check rows with NA in beh v[is.na(v$beh),] # check whether 'beh' field has only allowed values v[!v$beh%in%c('sleep', 'rest', 'stand', 'preen','stretch','hop', 'hh', 'walk','fly', 'run', 'active', 'eat', 'prob', 'peck','drink', 'ruffle'),] # sure - y,n v[!v$sure%in%c('n','y'),] # check whether all birds observed have rest or sleep OR not wrong time and hence too long sleep v=ddply(v,.(session), transform, prev = c(datetime_[1],datetime_[-length(datetime_)])) v$dur = difftime(v$datetime_,v$prev, units = 'secs') v[as.numeric(v$dur)>5*60,] # shows lines with behaviour that lasted longer than 5 min #v[v$bird_ID == 'Z080704',] vv = ddply(v,.(bird_ID), summarise, sleep = length(sure[beh%in%c('sleep','rest')]),dur = sum(dur[beh%in%c('sleep','rest')])) vv # shows duration of sleep/rest observation per bird } {# upload if(nrow(v)>0){ v$cont_pk = NA v$dur = v$prev = NULL v$datetime_ = as.character(v$datetime_) con = dbConnect(dbDriver("SQLite"),dbname = db) # to CONT_OBS dbWriteTable(con, name = "CONT_OBS", value = v, row.names = FALSE, append = TRUE) # to VISITS names(v)[names(v)=='aviary'] = 'where' vv = ddply(v,.(author, where, session, bird_ID), summarise, start = min(datetime_), what = 'cons', 'general_check' = 'n', end = max(datetime_), comments = NA) vv$comments = paste('session', vv$session, 'bird_ID', vv$bird_ID) vv$session = vv$bird_ID = NULL vv$v_pk = NA dbWriteTable(con, name = "VISITS", value = vv[,c("author","where","start","what","end","comments","v_pk")], row.names = FALSE, append = TRUE) # update DBLOG dv1 = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'CONT_OBS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = NA, stringsAsFactors = FALSE) dv2 = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'VISITS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'cons', script = 'DB_uploda.R', remarks = NA, stringsAsFactors = FALSE) dv = rbind(dv1, dv2) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste('CONT_OBS and VISITS data uploaded from', min(as.POSIXct(v$datetime_)), 'to', max(as.POSIXct(v$datetime)))) dbDisconnect(con) }else{print('no new data, no upload')} } } {# UPLOAD AUTHORS {# prepare # current visits data from DB con = dbConnect(dbDriver("SQLite"),dbname = db) d = dbGetQuery(con, "SELECT*FROM AUTHORS") dbDisconnect(con) # current visits data_entry file v = readWorksheetFromFile(paste(wd0, 'VISITS_cons_devices_aviary_ENTRY.xlsx', sep = ''), sheet='authors') v$authors_pk = 1:nrow(v) if(nrow(d)>0){ v = v[v$authors_pk>max(d$authors_pk),] # select only rows that are not in DB yet if(nrow(v)==0){'no need to check/upload - no new data'} } } {# check # NAs in initials v[is.na(v$initials),] # NAs in initials v[is.na(v$name),] # NAs in initials v[is.na(v$surname),] # NAs in contact v[is.na(v$contact),] # alias and project unique(unlist(strsplit(v$alias, ','))) unique(unlist(strsplit(v$project, ','))) # datetimes v$start_ = as.POSIXct(v$start_, format="%Y-%m-%d") v$end_ = as.POSIXct(v$end_, format="%Y-%m-%d") v[is.na(v$start_),] # check if start time is NA v[is.na(v$end_),] # check if start time is NA v[which((!is.na(v$start_) | !is.na(v$end_)) & v$start_>v$end_), ] # check whether end happened before start } {# upload if(nrow(v)>0){ v$v_pk = NA v$start_ = as.character(v$start_) v$end_ = as.character(v$end_) con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "VISITS", value = v, row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'AUTHORS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'updated', script = 'DB_uploda.R', remarks = NA, stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste('AUTHORS data uploaded')) dbDisconnect(con) }else{print('no new data, no upload')} } } {# UPLOAD DEVICE {# prepare # current CONS data from DB con = dbConnect(dbDriver("SQLite"),dbname = db) d = dbGetQuery(con, "SELECT*FROM DEVICES") dbDisconnect(con) # current con_obs data_entry file v = readWorksheetFromFile(paste(wd0, 'VISITS_cons_devices_aviary_ENTRY.xlsx', sep = ''), sheet='devices') v$devices_pk = 1:nrow(v) if(nrow(d)>0){ v = v[v$devices_pk>max(d$devices_pk),] # select only rows that are not in DB yet if(nrow(v)==0){'no need to check/upload - no new data'} } } {# check # datetimes v[is.na(v$datetime_),] # check if datetime_ is NA # NAs in devices v[is.na(v$device),] # check whether 'devices' field has only allowed values v[!v$device%in%c('acc', 'toa', 'harn', 'dummie'),] # check ID # # of characters shall be 3 v[nchar(v$ID)!=3,] # fist letter unique(substring(v$ID,1,1)) # numbers unique(substring(v$ID,2,3)) # what v[!v$what%in%c('on', 'off', 'dd','fail'),] # batt unique(v$batt) } {# upload if(nrow(v)>0){ v$devices_pk = NA v$datetime_ = as.character(v$datetime_) con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "DEVICES", value = v, row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'DEVICES', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_uploda.R', remarks = NA, stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste('DEVICES data uploaded from', min(as.POSIXct(v$datetime_)), 'to', max(as.POSIXct(v$datetime)))) dbDisconnect(con) }else{print('no new data, no upload')} } } {# UPLOAD AVIARIES {# prepare # current CONS data from DB con = dbConnect(dbDriver("SQLite"),dbname = db) d = dbGetQuery(con, "SELECT*FROM AVIARIES") dbDisconnect(con) # current con_obs data_entry file v = readWorksheetFromFile(paste(wd0, 'VISITS_cons_devices_aviary_ENTRY.xlsx', sep = ''), sheet='aviaries') v$av_pk = 1:nrow(v) if(nrow(d)>0){ v = v[v$av_pk>max(d$av_pk),] # select only rows that are not in DB yet if(nrow(v)==0){'no need to check/upload - no new data'} } } {# check # datetimes v[is.na(v$datetime_),] # check if datetime_ is NA # NAs in authors v[is.na(v$author),] # author field - show those that are not in authors con = dbConnect(dbDriver("SQLite"),dbname = db) a = dbGetQuery(con, "SELECT*FROM AUTHORS") a = unique(a$initials[a$initials!=""]) dbDisconnect(con) g = unique(unlist(strsplit(v$author, ','))) g[!g%in%a] # "drew" "ih" "ms" "kc" "others" # NAs in aviary v[is.na(v$aviary),] # check aviary v[!v$aviary%in%paste('w', seq(1,7,1), sep=""),] # check light_cycle v[!v$light_cycle%in%c('constant','natural', '12'),] # check T_cycle v[!v$T_cycle%in%c('constant_seewater','natural', '12'),] # light and T values summary(v) } {# upload if(nrow(v)>0){ v$av_pk = NA v$datetime_ = as.character(v$datetime_) con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "AVIARIES", value = v, row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'AVIARIES', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_uploda.R', remarks = NA, stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste('AVIARIES data uploaded from', min(as.POSIXct(v$datetime_)), 'to', max(as.POSIXct(v$datetime)))) dbDisconnect(con) }else{print('no new data, no upload')} } } {# UPLOAD TAGS {# prepare # current CONS data from DB con = dbConnect(dbDriver("SQLite"),dbname = db) d = dbGetQuery(con, "SELECT*FROM TAGS") dbDisconnect(con) # current con_obs data_entry file v = readWorksheetFromFile(paste(wd0, 'VISITS_cons_devices_aviary_ENTRY.xlsx', sep = ''), sheet='tags') v$tag_pk = 1:nrow(v) if(nrow(d)>0){ v = v[v$tag_pk>max(d$tag_pk),] # select only rows that are not in DB yet #v = v[!is.na(v$start),] if(nrow(v)==0){'no need to check/upload - no new data'} } } {# check # NAs in type v[is.na(v$type),] # types unique(v$type) # NAs in coating v[is.na(v$coating),] # coating unique(v$coating) # NAs in memmory v[is.na(v$memmory),] # memmory unique(v$memmory) # batt and mass values summary(v) } {# upload if(nrow(v)>0){ v$tag_pk = NA con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "TAGS", value = v, row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'TAGS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_uploda.R', remarks = NA, stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste('TAGS data uploaded')) dbDisconnect(con) }else{print('no new data, no upload')} } } ##### DONE 2018-01-31 13:45:29 # if re-run needed - please use first BIRD TABLE, then above CAPTURE BIRDS update and only then the remaining 2 {# 1. BIRDS TABLE - first upload 2015 - 2017 #con = dbConnect(dbDriver("SQLite"),dbname = db) #dbGetQuery(con, "DROP TABLE IF EXISTS BIRDS") #bDisconnect(con) # then make the table a new directly in SQLiteStudio {# upload EVA's catches + RUFAs v = readWorksheetFromFile(paste(wd2, 'morphometrics+sex_2016.xlsx', sep = ''), sheet=1) v$RNR[v$RNR%in%o$RINGNR] r = readWorksheetFromFile(paste(wd2, 'ColourRings2016.xlsx', sep = ''), sheet=1) r$RNR = toupper(r$RNR) v$colcom = r$complete_cr[match(v$RNR,r$RNR)] v$colcom_now = r$actual_cr[match(v$RNR,r$RNR)] v$year_ = substring(v$CatchDate,1,4) v$CatchLocation[v$CatchLocation == 'Vistula Mouth'] = 'Vistula' v = data.frame(year_ = v$year_, species = 'REKN', subspecies = v$Species, bird_ID = v$RNR, crc = v$colcom, crc_now = v$colcom_no, age = v$Age, sex = v$Sex, caught = v$CatchDate, site_c = v$CatchLocation, wing = v$WING, bill = v$BILL, totalhead = v$TOTHD, tarsus = v$TARS, tartoe = v$TATO, stringsAsFactors = FALSE) v$home_av = v$current_av = v$start_ = v$end_ = v$end_type = v$lat_c = v$lon_c = v$lat_r = v$lon_r = v$site_r = v$muscle = v$height_1 = v$width_1 = v$height_2 = v$width_2 = v$mass_f = v$mass_c = v$bio_author = v$ful_datetime = v$ful_author = v$remarks = v$bird_pk = v$blood = v$sex_method = v$bio_datetime = NA v$project = 'MigrationOnthogeny' #v[duplicated(v$RNR),] xx =c("year_","species","subspecies","bird_ID","crc","crc_now","home_av","current_av","age","sex" ,"start_", "end_", "end_type","caught", "lat_c","lon_c", "site_c", "lat_r", "lon_r", "site_r","muscle", "height_1","width_1", "height_2","width_2","mass_f", "mass_c", "wing","bill","totalhead", "tarsus", "tartoe", "blood","sex_method","bio_datetime","bio_author","ful_datetime","ful_author","project","remarks", "bird_pk") xx[!xx%in%names(v)] v$caught = as.character(v$caught) v$site_c = capitalize(tolower(v$site_c)) v$lat_c = g$lat[match(v$site_c,g$abb)] v$lon_c = g$lon[match(v$site_c,g$abb)] vr = data.frame(species = 'REKN', subspecies = 'ruf', bird_ID = as.character(c('982284830', '982284831')), stringsAsFactors = FALSE) vx = merge(v,vr,all=TRUE) vx = vx[,c("year_","species","subspecies","bird_ID","crc","crc_now","home_av","current_av","age","sex" ,"start_", "end_", "end_type","caught", "lat_c","lon_c", "site_c", "lat_r", "lon_r", "site_r","muscle", "height_1","width_1", "height_2","width_2","mass_f", "mass_c", "wing","bill","totalhead", "tarsus", "tartoe", "blood","sex_method","bio_datetime","bio_author","ful_datetime","ful_author","project","remarks", "bird_pk")] #vr = vx[vx$bird_ID%in%c('982284830', '982284831'),] con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "BIRDS", value = vx , row.names = FALSE, append = TRUE) if(dblog == TRUE){ dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIRDS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'major', script = 'DB_upload.R', remarks = '2015-2016 catches') dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) } dbDisconnect(con) } {# upload 2017 catches (except for last one) v = readWorksheetFromFile(paste(wd2, 'Biometry captive red knots 2017.xlsx', sep = ''), sheet=1) v = v[which(v$Nioz == 'Yes'),] v$DNA = ifelse(v$DNA==TRUE, 'yes', NA) v$CATCH_MONTH = ifelse(nchar(v$CATCH_MONTH)==1, paste(0, v$CATCH_MONTH, sep=""), v$CATCH_MONTH) vv = v[nchar(v$ULTRASOUN)>2,] u1 = data.frame(measured = paste(vv$CATCH_YEAR,'08',vv$CATCH_DAY, sep = '-'), bird_ID = vv$RINGNR, muscle = vv$PECTORAL.MUSCLE, height_1 = vv$SH1 , width_1 = vv$SW1, height_2 = vv$SH2 , width_2 = vv$SW2, stringsAsFactors = FALSE) u1$muscle = gsub(",", ".", u1$muscle) u1$height_1 = gsub(",", ".", u1$height_1) u1$width_1 = gsub(",", ".", u1$width_1) u1$width_2 = gsub(",", ".", u1$width_2) u1$height_2 = gsub(",", ".", u1$height_2) u2 = readWorksheetFromFile(paste(wd2, 'ultrasound.xlsx', sep = ''), sheet=1) u2$mass = u2$age = u2$comments = u2$where = u2$released = NULL u2$measured = as.character(u2$measured) u = rbind(u1,u2) v = merge(v,u, by.x = 'RINGNR', by.y = 'bird_ID', all.x = TRUE) v$bio_datetime = ifelse(v$CATCH_MONTH == '09', '2017-10-04', ifelse(v$CATCH_MONTH == '08', '2017-09-04', paste(v$CATCH_YEAR,v$CATCH_MONTH,v$CATCH_DAY, sep = '-'))) v$start_ = ifelse(v$CATCH_MONTH == '09', '2017-09-22', NA) v=v[v$CATCH_MONTH != '09',] v = data.frame(bird_pk = v$BIOKLRI_ID, year_ = v$CATCH_YEAR, species = 'REKN', subspecies = 'isl', bird_ID = v$RINGNR, crc = v$CR_CODE, crc_now = NA, age = v$AGE, sex = NA, caught = paste(v$CATCH_YEAR,v$CATCH_MONTH,v$CATCH_DAY, sep = '-'), site_c = v$CATCH_LOCATION, wing = v$WING, bill = v$BILL, totalhead = v$TOTHD, tarsus = v$TARS, tartoe = v$TATO, mass_f = v$MASS, giz_author = 'ad', bio_author = 'jth', blood = v$DNA, muscle = v$muscle, height_1 = v$height_1, width_1 = v$width_1, height_2 = v$height_2, width_2 = v$width_2, giz_datetime = v$measured, bio_datetime = v$bio_datetime, start_ = v$start_ , stringsAsFactors = FALSE) v$home_av = v$current_av = v$end_ = v$end_type = v$lat_c = v$lon_c = v$lat_r = v$lon_r = v$site_r = v$mass_c = v$remarks = v$sex_method = NA v$site_c = ifelse(v$site_c == 'GRIEND', 'Griend', ifelse( v$site_c == 'DE RICHEL', 'Richel', 'Schier')) v$lat_c = g$lat[match(v$site_c,g$abb)] v$lon_c = g$lon[match(v$site_c,g$abb)] x = readWorksheetFromFile(paste(wd2, 'captive_knots_2017_12+moving_2018_01.xlsx', sep = ''), sheet=1) x = x[x$X2 == 'Martin',] v$project = ifelse(v$bird_ID%in%x$ID,'SocialJetLag','MigrationOnthogeny') xx =c("year_","species","subspecies","bird_ID","crc","crc_now","home_av","current_av","age","sex" ,"start_", "end_", "end_type","caught", "lat_c","lon_c", "site_c", "lat_r", "lon_r", "site_r","muscle", "height_1","width_1", "height_2","width_2","mass_f", "mass_c", "wing","bill","totalhead", "tarsus", "tartoe", "blood","sex_method","bio_datetime","bio_author","giz_datetime","giz_author","project","remarks", "bird_pk") xx[!xx%in%names(v)] v1 = v[c("year_","species","subspecies","bird_ID","crc","crc_now","home_av","current_av","age","sex" ,"start_", "end_", "end_type","caught", "lat_c","lon_c", "site_c", "lat_r", "lon_r", "site_r","muscle", "height_1","width_1", "height_2","width_2","mass_f", "mass_c", "wing","bill","totalhead", "tarsus", "tartoe", "blood","sex_method","bio_datetime","bio_author","giz_datetime","giz_author","project","remarks", "bird_pk")] con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "BIRDS", value = v1, row.names = FALSE, append = TRUE) if(dblog == TRUE){ dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIRDS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'major', script = 'DB_upload.R', remarks = '2017-07 and 08 catches') dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) } dbDisconnect(con) } } # 2. capture BIRDs above {# 3. update FUL from file, which has to have following info 'author','measured','bird_ID','muscle','height_1','width_1','height_2', 'width_2' ul_date = '2017-09-23' # DEFINE u = readWorksheetFromFile(paste(wd2, 'ultrasound_',ul_date,'.xlsx', sep = ''), sheet=1) u$measured = as.character(u$measured) con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = u[,c('author','measured','bird_ID','muscle','height_1','width_1','height_2', 'width_2')], row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET ful_author = (SELECT temp.author FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), ful_datetime = (SELECT temp.measured FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), muscle = (SELECT temp.muscle FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), height_1 = (SELECT temp.'height_1' FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), width_1 = (SELECT temp.width_1 FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), height_2 = (SELECT temp.height_2 FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), width_2 = (SELECT temp.width_2 FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") # update DBLOG x = data.frame(bird_ID = u$bird_ID, datetime_ = as.character(Sys.time()), stringsAsFactors=FALSE) dbWriteTable(con, name = "temp", value = x, row.names = FALSE) dbExecute(con, "UPDATE TO_DO SET datetime_solved = (SELECT temp.datetime_ FROM temp WHERE temp.bird_ID = TO_DO.bird_ID and TO_DO.what like '%ful%') WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = TO_DO.bird_ID and TO_DO.what like '%ful%') ") dbWriteTable(con, name = "TO_DO", value = mx[,c('capture','bird_ID','what','datetime_solved','remarks','todo_pk')], row.names = FALSE, append = TRUE) dbDisconnect(con) dbGetQuery(con, "DROP TABLE IF EXISTS temp") if(dblog == TRUE){ dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIRDS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'major', script = 'DB_upload.R', remarks = 'ful of 2017-09 catch') dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) } dbDisconnect(con) print('ful updated in birds') } {# 4. DONE update biometrics and other info from JOBs DB for BIRDS 2017-09 catch DATA v = readWorksheetFromFile(paste(wd2, 'Biometry captive red knots 2017.xlsx', sep = ''), sheet=1) v = v[which(v$Nioz == 'Yes'),] v$DNA = ifelse(v$DNA==TRUE, 'yes', NA) v$CATCH_MONTH = ifelse(nchar(v$CATCH_MONTH)==1, paste(0, v$CATCH_MONTH, sep=""), v$CATCH_MONTH) v = v[v$CATCH_MONT=='09',] v$site_c = ifelse(v$CATCH_LOCATION == 'GRIEND', 'Griend', ifelse( v$CATCH_LOCATION == 'DE RICHEL', 'Richel', 'Schier')) v$lat_c = g$lat[match(v$site_c,g$abb)] v$lon_c = g$lon[match(v$site_c,g$abb)] v$project = 'SocialJetLag' v$age = ifelse(v$AGE == 3, 'A', v$AGE) v$bio_author = 'jh' v$bird_ID = v$RINGNR v$species = 'REKN' v$subspecies = 'isl' # UPDATE BIRDS con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = v[,c('bio_author','bird_ID','TOTHD','BILL','WING','TARS','TATO', 'age','project','site_c','lat_c','lon_c','DNA','MASS','species','subspecies')], row.names = FALSE, append = FALSE) #bio_datetime = (SELECT temp.capture FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), dbExecute(con, "UPDATE BIRDS SET bio_author = (SELECT temp.bio_author FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), species = (SELECT temp.species FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), subspecies = (SELECT temp.subspecies FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), mass_f = (SELECT temp.MASS FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), age = (SELECT temp.age FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), blood = (SELECT temp.DNA FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), project = (SELECT temp.project FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), site_c = (SELECT temp.site_c FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), lat_c = (SELECT temp.lat_c FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), lon_c = (SELECT temp.lon_c FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), wing = (SELECT temp.WING FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), bill = (SELECT temp.'BILL' FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), totalhead = (SELECT temp.TOTHD FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), tarsus = (SELECT temp.TARS FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), tartoe = (SELECT temp.TATO FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") # UPDATE TO_DO x = data.frame(bird_ID = v$bird_ID, datetime_ = as.character(Sys.time()), stringsAsFactors=FALSE) dbWriteTable(con, name = "temp", value = x, row.names = FALSE) dbExecute(con, "UPDATE TO_DO SET datetime_solved = (SELECT temp.datetime_ FROM temp WHERE temp.bird_ID = TO_DO.bird_ID and TO_DO.what like '%mass_f%') WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = TO_DO.bird_ID and TO_DO.what like '%mass_f%') ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") if(dblog == TRUE){ dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIRDS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'major', script = 'DB_upload.R', remarks = 'ful of 2017-09 bio, age, species, etc') dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) } dbDisconnect(con) print('bio updated in birds') } {# update HARN table if 'harn' or 'on'/'off' and what_ID starting with 'H', 'P','D' mm = m[grepl("harn",m$what, perl = TRUE)| grepl("on",m$what, perl = TRUE) & substring(m$what_ID,1,1) %in%c('H','D','P') | grepl("off",m$what, perl = TRUE) & substring(m$what_ID,1,1) %in%c('H','D','P'),] mm = mm[!is.na(mm$what),] if(nrow(mm)==0){print('no harn in what')}else{ if(length(names(mm)[names(mm)=='tilt']) == 0){ mm = mm[,c('capture', 'bird_ID','what', 'what_ID')] mm$tilt = mm$neck = mm$armpit = mm$back = mm$size = mm$harn_pk= NA mm$capture = as.character(mm$capture) }else{ mm = mm[,c('capture', 'bird_ID', 'what','what_ID','tilt', 'neck', 'armpit','back','size')] mm$harn_pk=NA mm$capture = as.character(mm$capture) } con = dbConnect(dbDriver("SQLite"),dbname = db) dbWriteTable(con, name = "HARN", value = mm, row.names = FALSE, append = TRUE) dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'HARN', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'weekly', script = 'DB_upload.R', remarks = f2[i], stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) print(paste(mm$capture,'HARN data added for', mm$bird_ID)) dbDisconnect(con) } } {# 5. update positions to decimals v = readWorksheetFromFile(paste(wd2, 'catch_locations.xlsx', sep = ''), sheet=1) v[v==""] = NA v[v==" "] = NA v[v=="NA"] = NA #conv_unit("6 13 51", from = 'deg_min_sec', to = 'dec_deg') #conv_unit("5 16 40", from = 'deg_min_sec', to = 'dec_deg') #v$lat_deg = gsub('.', ' ', v$lat_deg, fixed = TRUE) #v$lon_deg = gsub('.', ' ', v$lon_deg, fixed = TRUE) #v$lat = ifelse(is.na(v$lat_deg), v$lat, conv_unit(v$lat_deg, from = 'deg_min_sec', to = 'dec_deg')) con = dbConnect(dbDriver("SQLite"),dbname = db) b = dbGetQuery(con, "SELECT*FROM BIRDS") dbDisconnect(con) b$lat_c = v$lat[match(b$site_c, v$abb)] b$lon_c = v$lon[match(b$site_c, v$abb)] b$lat_r = v$lat[match(b$site_r, v$abb)] b$lon_r = v$lon[match(b$site_r, v$abb)] con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = b, row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET lat_c = (SELECT temp.lat_c FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), lon_c = (SELECT temp.lon_c FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), lat_r = (SELECT temp.lat_r FROM temp WHERE temp.bird_ID = BIRDS.bird_ID), lon_r = (SELECT temp.lon_r FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIRDS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'minor', script = 'DB_upload.R: 5. update positions to decimals', remarks = 'updated lat and lon', stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) dbDisconnect(con) } {# 6. update color combos m = read.csv(paste(wd2,'BIOKLRI.csv', sep=""), stringsAsFactors=FALSE) con = dbConnect(dbDriver("SQLite"),dbname = db) b = dbGetQuery(con, "SELECT*FROM BIRDS where crc is null") dbDisconnect(con) b$crc = m$CR_CODE[match(b$bird_ID, m$RINGNR)] #b[,c('bird_ID','crc')] con = dbConnect(dbDriver("SQLite"),dbname = db) dbGetQuery(con, "DROP TABLE IF EXISTS temp") dbWriteTable(con, name = "temp", value = b[,c('bird_ID','crc')], row.names = FALSE, append = FALSE) dbExecute(con, "UPDATE BIRDS SET crc = (SELECT temp.crc FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) WHERE EXISTS ( SELECT * FROM temp WHERE temp.bird_ID = BIRDS.bird_ID) ") dbGetQuery(con, "DROP TABLE IF EXISTS temp") dv = data.frame(pk = NA, db = 'AVESatNIOZ', table = 'BIRDS', datetime_ = as.character(Sys.time()), author = if(Luc == TRUE){'lm'}else{'mb'}, type = 'minor', script = 'DB_upload.R: update color combos', remarks = 'updated crc', stringsAsFactors = FALSE) dbWriteTable(con, name = "DBLOG", value = dv, row.names = FALSE, append = TRUE) dbDisconnect(con) }
detectionPval.filter <- function(methLumi_data, detectionPval.threshold=0.01, detectionPval.perc.threshold=80, projectName = NULL, PATH="./"){ #get detection p-values detectPval <- assayDataElement(methLumi_data, "detection") #get sample names samples <- colnames(detectPval) nbSignifPval <- vector() percentSignifPval <- vector() #for each sample compute the number and % or relevant signal (detection p-value < detectionPval.threshold) for(i in 1:length(samples)){ nb <- length(which(detectPval[,i] <= detectionPval.threshold)) percent <- nb*100/length(detectPval[,i]) nbSignifPval <- c(nbSignifPval,nb) percentSignifPval <- c(percentSignifPval, percent) } rm(detectPval) #get "bad" samples indices index2remove <- which(percentSignifPval < detectionPval.perc.threshold) #remove "bad" samples from methylumi object if(length(index2remove)>0) methLumi_data <- methLumi_data[,-index2remove] index <- sort(percentSignifPval, index.return=TRUE)$ix # save sample quality report as text file if(!is.null(projectName)) write.table(list(samples=samples[index], nbSignifPval=nbSignifPval[index], percentSignifPval=percentSignifPval[index]), file=paste(PATH, projectName, "_signifPvalStats_threshold", detectionPval.threshold, ".txt", sep=""), sep="\t", row.names=FALSE, col.names=TRUE) return(methLumi_data) }
/R/detectionPval.filter.R
no_license
schalkwyk/wateRmelon
R
false
false
1,373
r
detectionPval.filter <- function(methLumi_data, detectionPval.threshold=0.01, detectionPval.perc.threshold=80, projectName = NULL, PATH="./"){ #get detection p-values detectPval <- assayDataElement(methLumi_data, "detection") #get sample names samples <- colnames(detectPval) nbSignifPval <- vector() percentSignifPval <- vector() #for each sample compute the number and % or relevant signal (detection p-value < detectionPval.threshold) for(i in 1:length(samples)){ nb <- length(which(detectPval[,i] <= detectionPval.threshold)) percent <- nb*100/length(detectPval[,i]) nbSignifPval <- c(nbSignifPval,nb) percentSignifPval <- c(percentSignifPval, percent) } rm(detectPval) #get "bad" samples indices index2remove <- which(percentSignifPval < detectionPval.perc.threshold) #remove "bad" samples from methylumi object if(length(index2remove)>0) methLumi_data <- methLumi_data[,-index2remove] index <- sort(percentSignifPval, index.return=TRUE)$ix # save sample quality report as text file if(!is.null(projectName)) write.table(list(samples=samples[index], nbSignifPval=nbSignifPval[index], percentSignifPval=percentSignifPval[index]), file=paste(PATH, projectName, "_signifPvalStats_threshold", detectionPval.threshold, ".txt", sep=""), sep="\t", row.names=FALSE, col.names=TRUE) return(methLumi_data) }
#' Plot segmentation profile #' #' Creates an IGV-like graphical representation of the copy-number segments across the samples in a segmentation object, as output by \code{run_facets}. #' #' @param segs FACETS segment output, IGV formatted. #' @param plotX If \code{TRUE}, includes chromosome X. #' @param sample_order Manual order of samples. #' @param cap_log_ratios Cap log-ratios at the absolute value. #' @param colors Vector of three colors, giving the low-, mid- and high-point of the color scale. #' @param return_object If \code{TRUE}, returns \code{ggplot2} object instead of printing plot. #' #' @return Output plots in viewer, unless \code{return_object} is used and \code{ggplot2} objects are returned. #' #' @importFrom dplyr mutate left_join #' @importFrom purrr map_dfr #' @import ggplot2 #' @export plot_segmentation = function(segs, plotX = FALSE, sample_order = NULL, cap_log_ratios = TRUE, colors = c('darkblue', 'white', 'red'), return_object = FALSE) { if (!plotX) { segs = filter(segs, chrom != 23) chrom_order = seq(1:23) } else { chrom_order = seq(1:22) } segs = mutate(segs, chrom = factor(chrom, levels = chrom_order, ordered = T)) if (!is.null(sample_order)) { if (!all(segs$ID %in% sample_order)) stop('Samples missing from provided sample order', call. = FALSE) segs = mutate(segs, ID = factor(ID, levels = sample_order, ordered = T)) } # Determine lengths of chromosomes and adjust X-axis accordingly chrom_lengths = map_dfr(unique(segs$chrom), function(x) { chrom_max = max(segs$loc.end[segs$chrom == x], na.rm = T) chrom_min = min(segs$loc.end[segs$chrom == x], na.rm = T) list(chrom = x, chrom_length = as.numeric(chrom_max - chrom_min)) }) %>% mutate(.data, rel_length = chrom_length/sum(chrom_length)) segs = left_join(segs, chrom_lengths, by = 'chrom') # Cap log-ratios and set colorlegend if (cap_log_ratios != FALSE) { if (is.numeric(cap_log_ratios)) { segs$seg.mean[which(segs$seg.mean > cap_log_ratios)] = cap_log_ratios segs$seg.mean[which(segs$seg.mean < -cap_log_ratios)] = -cap_log_ratios legend_breaks = c(-cap_log_ratios, -cap_log_ratios/2, 0, cap_log_ratios/2, cap_log_ratios) } else { segs$seg.mean[which(segs$seg.mean > 2)] = 2 segs$seg.mean[which(segs$seg.mean < -2)] = -2 legend_breaks = seq(-2, 2, 1) } } else { legend_breaks = c(min(segs$seg.mean), min(segs$seg.mean)/2, 0, max(segs$seg.mean)/2, max(segs$seg.mean)) } # Set Y-axis sample_number = length(unique(segs$ID)) increments = 100 / sample_number max_vec = cumsum(rep(increments, sample_number)) min_vec = c(0, max_vec[-length(max_vec)]) segs = mutate(segs, y_min = min_vec[match(ID, factor(unique(segs$ID)))], y_max = max_vec[match(ID, factor(unique(segs$ID)))]) y_labs = distinct(segs, ID, .keep_all = T) %>% mutate(pos = (y_max-y_min)/2 + y_min) # Plot seg_plot = ggplot(segs, aes(xmin = loc.start, xmax = loc.end, ymin = y_min, ymax = y_max, fill = seg.mean)) + geom_rect() + scale_fill_gradient2(low = colors[1], mid = colors[2], high = colors[3], guide = 'colourbar', 'Log ratio', breaks = legend_breaks, labels = round(legend_breaks)) + scale_y_continuous(expand = c(0,0), breaks = y_labs$pos, labels = y_labs$ID) + facet_grid(.~chrom, space = 'free_x', scales = 'free_x', switch = 'x') + theme( axis.text.x = element_blank(), axis.ticks.x = element_blank(), axis.ticks.y = element_blank(), panel.spacing.x = unit(-.5, 'lines'), panel.spacing.y = unit(0, 'lines'), strip.background = element_rect(fill = 'white'), panel.background = element_rect(fill = 'white') ) if (return_object == TRUE) { seg_plot } else { print(seg_plot) } }
/R/plot-segmentation.R
permissive
mskcc/facets-suite
R
false
false
4,249
r
#' Plot segmentation profile #' #' Creates an IGV-like graphical representation of the copy-number segments across the samples in a segmentation object, as output by \code{run_facets}. #' #' @param segs FACETS segment output, IGV formatted. #' @param plotX If \code{TRUE}, includes chromosome X. #' @param sample_order Manual order of samples. #' @param cap_log_ratios Cap log-ratios at the absolute value. #' @param colors Vector of three colors, giving the low-, mid- and high-point of the color scale. #' @param return_object If \code{TRUE}, returns \code{ggplot2} object instead of printing plot. #' #' @return Output plots in viewer, unless \code{return_object} is used and \code{ggplot2} objects are returned. #' #' @importFrom dplyr mutate left_join #' @importFrom purrr map_dfr #' @import ggplot2 #' @export plot_segmentation = function(segs, plotX = FALSE, sample_order = NULL, cap_log_ratios = TRUE, colors = c('darkblue', 'white', 'red'), return_object = FALSE) { if (!plotX) { segs = filter(segs, chrom != 23) chrom_order = seq(1:23) } else { chrom_order = seq(1:22) } segs = mutate(segs, chrom = factor(chrom, levels = chrom_order, ordered = T)) if (!is.null(sample_order)) { if (!all(segs$ID %in% sample_order)) stop('Samples missing from provided sample order', call. = FALSE) segs = mutate(segs, ID = factor(ID, levels = sample_order, ordered = T)) } # Determine lengths of chromosomes and adjust X-axis accordingly chrom_lengths = map_dfr(unique(segs$chrom), function(x) { chrom_max = max(segs$loc.end[segs$chrom == x], na.rm = T) chrom_min = min(segs$loc.end[segs$chrom == x], na.rm = T) list(chrom = x, chrom_length = as.numeric(chrom_max - chrom_min)) }) %>% mutate(.data, rel_length = chrom_length/sum(chrom_length)) segs = left_join(segs, chrom_lengths, by = 'chrom') # Cap log-ratios and set colorlegend if (cap_log_ratios != FALSE) { if (is.numeric(cap_log_ratios)) { segs$seg.mean[which(segs$seg.mean > cap_log_ratios)] = cap_log_ratios segs$seg.mean[which(segs$seg.mean < -cap_log_ratios)] = -cap_log_ratios legend_breaks = c(-cap_log_ratios, -cap_log_ratios/2, 0, cap_log_ratios/2, cap_log_ratios) } else { segs$seg.mean[which(segs$seg.mean > 2)] = 2 segs$seg.mean[which(segs$seg.mean < -2)] = -2 legend_breaks = seq(-2, 2, 1) } } else { legend_breaks = c(min(segs$seg.mean), min(segs$seg.mean)/2, 0, max(segs$seg.mean)/2, max(segs$seg.mean)) } # Set Y-axis sample_number = length(unique(segs$ID)) increments = 100 / sample_number max_vec = cumsum(rep(increments, sample_number)) min_vec = c(0, max_vec[-length(max_vec)]) segs = mutate(segs, y_min = min_vec[match(ID, factor(unique(segs$ID)))], y_max = max_vec[match(ID, factor(unique(segs$ID)))]) y_labs = distinct(segs, ID, .keep_all = T) %>% mutate(pos = (y_max-y_min)/2 + y_min) # Plot seg_plot = ggplot(segs, aes(xmin = loc.start, xmax = loc.end, ymin = y_min, ymax = y_max, fill = seg.mean)) + geom_rect() + scale_fill_gradient2(low = colors[1], mid = colors[2], high = colors[3], guide = 'colourbar', 'Log ratio', breaks = legend_breaks, labels = round(legend_breaks)) + scale_y_continuous(expand = c(0,0), breaks = y_labs$pos, labels = y_labs$ID) + facet_grid(.~chrom, space = 'free_x', scales = 'free_x', switch = 'x') + theme( axis.text.x = element_blank(), axis.ticks.x = element_blank(), axis.ticks.y = element_blank(), panel.spacing.x = unit(-.5, 'lines'), panel.spacing.y = unit(0, 'lines'), strip.background = element_rect(fill = 'white'), panel.background = element_rect(fill = 'white') ) if (return_object == TRUE) { seg_plot } else { print(seg_plot) } }
if ("rmarkdown" %in% rownames(installed.packages()) == FALSE) { install.packages("rmarkdown") } setwd("C:/Users/Tess/Desktop/analytics-portfolio-t/ML sandbox/fraud_detection") setwd("C:/Users/Tess/Desktop/analytics-portfolio-t/ML sandbox/fraud_detection") Sys.setenv(RSTUDIO_PANDOC = "/usr/lib/rstudio/bin/pandoc") ## render HTML output rmarkdown::render("fraud.Rmd", output_file = "fraud.html")
/ML_sandbox/fraud_detection/fraud.R
no_license
Tlarot/analytics-projects-ts
R
false
false
400
r
if ("rmarkdown" %in% rownames(installed.packages()) == FALSE) { install.packages("rmarkdown") } setwd("C:/Users/Tess/Desktop/analytics-portfolio-t/ML sandbox/fraud_detection") setwd("C:/Users/Tess/Desktop/analytics-portfolio-t/ML sandbox/fraud_detection") Sys.setenv(RSTUDIO_PANDOC = "/usr/lib/rstudio/bin/pandoc") ## render HTML output rmarkdown::render("fraud.Rmd", output_file = "fraud.html")
#' read key pause for plotting #' @export readkey<-function(){ cat ("Press [enter] to continue") line <- readline() }
/R/readkey.R
no_license
arcolombo/rToolKit
R
false
false
129
r
#' read key pause for plotting #' @export readkey<-function(){ cat ("Press [enter] to continue") line <- readline() }
# =================================================================== # Title: HW02 # Description: # This script performs cleaning tasks and transformations on # various columns of the raw data file. # Input(s): court picture # Output(s): txt files; csv files, pdf # Author: Molly Li # Date: 03-01-2018 # =================================================================== #load packages library(ggplot2) library(dplyr) library(tibble) library("jpeg") library("grid") #read data stephen <- read.csv("data/stephen-curry.csv", stringsAsFactors = FALSE) klay <- read.csv("data/klay-thompson.csv", stringsAsFactors = FALSE) kevin <- read.csv("data/kevin-durant.csv", stringsAsFactors = FALSE) draymond <- read.csv("data/draymond-green.csv", stringsAsFactors = FALSE) andre <- read.csv("data/andre-iguodala.csv", stringsAsFactors = FALSE) # scatterplot klay_scatterplot <- ggplot(data = klay) + geom_point(aes(x = x, y = y, color = shot_made_flag)) # court image (to be used as background of plot) court_file <- download.file("https://raw.githubusercontent.com/ucb-stat133/stat133-spring-2018/master/images/nba-court.jpg", '/Users/XuewenLi/desktop/133/hw02/images/nba-court.jpeg') # create raste object court_image <- rasterGrob(readJPEG( '/Users/XuewenLi/desktop/133/hw02/images/nba-court.jpeg'), width = unit(1, "npc"), height = unit(1, "npc")) #4.1) Shot charts of each player (10 pts) #example klay_shot_chart <- ggplot(data = klay) + annotation_custom(court_image, -250, 250, -50, 420) + geom_point(aes(x = x, y = y, color = shot_made_flag)) + ylim(-50, 420) + ggtitle('Shot Chart: Klay Thompson (2016 season)') + theme_minimal() # andre-iguodala-shot-chart.pdf andre_shot_chart <- ggplot(data = andre) + annotation_custom(court_image, -250, 250, -50, 420) + geom_point(aes(x = x, y = y, color = shot_made_flag)) + ylim(-50, 420) + ggtitle('Shot Chart: Andre Iguodala (2016 season)') + theme_minimal() pdf(file = "images/andre-iguodala-shot-chart.pdf ", width = 6.5, height = 5) plot(andre_shot_chart) dev.off() # draymond-green-shot-chart.pdf draymond_shot_chart <- ggplot(data = draymond) + annotation_custom(court_image, -250, 250, -50, 420) + geom_point(aes(x = x, y = y, color = shot_made_flag)) + ylim(-50, 420) + ggtitle('Shot Chart: Draymond Green (2016 season)') + theme_minimal() pdf(file = "images/draymond-green-shot-chart.pdf ", width = 6.5, height = 5) plot(draymond_shot_chart) dev.off() # kevin-durant-shot-chart.pdf kevin_shot_chart <- ggplot(data = kevin) + annotation_custom(court_image, -250, 250, -50, 420) + geom_point(aes(x = x, y = y, color = shot_made_flag)) + ylim(-50, 420) + ggtitle('Shot Chart:Kevin Durant (2016 season)') + theme_minimal() pdf(file = "images/kevin-durant-shot-chart.pdf ", width = 6.5, height = 5) plot(kevin_shot_chart) dev.off() # klay-thompson-shot-chart.pdf klay_shot_chart <- ggplot(data = klay) + annotation_custom(court_image, -250, 250, -50, 420) + geom_point(aes(x = x, y = y, color = shot_made_flag)) + ylim(-50, 420) + ggtitle('Shot Chart: Klay Thompson (2016 season)') + theme_minimal() pdf(file = "images/klay-thompson-shot-chart.pdf", width = 6.5, height = 5) plot(klay_shot_chart) dev.off() # stephen-curry-shot-chart.pdf stephen_shot_chart <- ggplot(data = stephen) + annotation_custom(court_image, -250, 250, -50, 420) + geom_point(aes(x = x, y = y, color = shot_made_flag)) + ylim(-50, 420) + ggtitle('Shot Chart: Stephen Curry (2016 season)') + theme_minimal() pdf(file = "images/stephen-curry-shot-chart.pdf", width = 6.5, height = 5) plot(stephen_shot_chart) dev.off() # 4.2) Facetted Shot Chart (10 pts)????? igdtc <- rbind(andre,draymond,kevin,klay,stephen) gsw_shot_charts <- ggplot(igdtc) + annotation_custom(court_image, -250, 250, -50, 420) + geom_point(aes(x = x, y = y, color = shot_made_flag)) + ylim(-50, 420) + ggtitle('Shot Chart: GSW (2016 season)') + theme_minimal()+ facet_wrap(~name) pdf(file = "images/stephen-curry-shot-chart.pdf", width = 8, height = 7) plot(gsw_shot_charts) dev.off()
/code/make-shot-charts-script.R
no_license
mollyli96/hw2
R
false
false
4,130
r
# =================================================================== # Title: HW02 # Description: # This script performs cleaning tasks and transformations on # various columns of the raw data file. # Input(s): court picture # Output(s): txt files; csv files, pdf # Author: Molly Li # Date: 03-01-2018 # =================================================================== #load packages library(ggplot2) library(dplyr) library(tibble) library("jpeg") library("grid") #read data stephen <- read.csv("data/stephen-curry.csv", stringsAsFactors = FALSE) klay <- read.csv("data/klay-thompson.csv", stringsAsFactors = FALSE) kevin <- read.csv("data/kevin-durant.csv", stringsAsFactors = FALSE) draymond <- read.csv("data/draymond-green.csv", stringsAsFactors = FALSE) andre <- read.csv("data/andre-iguodala.csv", stringsAsFactors = FALSE) # scatterplot klay_scatterplot <- ggplot(data = klay) + geom_point(aes(x = x, y = y, color = shot_made_flag)) # court image (to be used as background of plot) court_file <- download.file("https://raw.githubusercontent.com/ucb-stat133/stat133-spring-2018/master/images/nba-court.jpg", '/Users/XuewenLi/desktop/133/hw02/images/nba-court.jpeg') # create raste object court_image <- rasterGrob(readJPEG( '/Users/XuewenLi/desktop/133/hw02/images/nba-court.jpeg'), width = unit(1, "npc"), height = unit(1, "npc")) #4.1) Shot charts of each player (10 pts) #example klay_shot_chart <- ggplot(data = klay) + annotation_custom(court_image, -250, 250, -50, 420) + geom_point(aes(x = x, y = y, color = shot_made_flag)) + ylim(-50, 420) + ggtitle('Shot Chart: Klay Thompson (2016 season)') + theme_minimal() # andre-iguodala-shot-chart.pdf andre_shot_chart <- ggplot(data = andre) + annotation_custom(court_image, -250, 250, -50, 420) + geom_point(aes(x = x, y = y, color = shot_made_flag)) + ylim(-50, 420) + ggtitle('Shot Chart: Andre Iguodala (2016 season)') + theme_minimal() pdf(file = "images/andre-iguodala-shot-chart.pdf ", width = 6.5, height = 5) plot(andre_shot_chart) dev.off() # draymond-green-shot-chart.pdf draymond_shot_chart <- ggplot(data = draymond) + annotation_custom(court_image, -250, 250, -50, 420) + geom_point(aes(x = x, y = y, color = shot_made_flag)) + ylim(-50, 420) + ggtitle('Shot Chart: Draymond Green (2016 season)') + theme_minimal() pdf(file = "images/draymond-green-shot-chart.pdf ", width = 6.5, height = 5) plot(draymond_shot_chart) dev.off() # kevin-durant-shot-chart.pdf kevin_shot_chart <- ggplot(data = kevin) + annotation_custom(court_image, -250, 250, -50, 420) + geom_point(aes(x = x, y = y, color = shot_made_flag)) + ylim(-50, 420) + ggtitle('Shot Chart:Kevin Durant (2016 season)') + theme_minimal() pdf(file = "images/kevin-durant-shot-chart.pdf ", width = 6.5, height = 5) plot(kevin_shot_chart) dev.off() # klay-thompson-shot-chart.pdf klay_shot_chart <- ggplot(data = klay) + annotation_custom(court_image, -250, 250, -50, 420) + geom_point(aes(x = x, y = y, color = shot_made_flag)) + ylim(-50, 420) + ggtitle('Shot Chart: Klay Thompson (2016 season)') + theme_minimal() pdf(file = "images/klay-thompson-shot-chart.pdf", width = 6.5, height = 5) plot(klay_shot_chart) dev.off() # stephen-curry-shot-chart.pdf stephen_shot_chart <- ggplot(data = stephen) + annotation_custom(court_image, -250, 250, -50, 420) + geom_point(aes(x = x, y = y, color = shot_made_flag)) + ylim(-50, 420) + ggtitle('Shot Chart: Stephen Curry (2016 season)') + theme_minimal() pdf(file = "images/stephen-curry-shot-chart.pdf", width = 6.5, height = 5) plot(stephen_shot_chart) dev.off() # 4.2) Facetted Shot Chart (10 pts)????? igdtc <- rbind(andre,draymond,kevin,klay,stephen) gsw_shot_charts <- ggplot(igdtc) + annotation_custom(court_image, -250, 250, -50, 420) + geom_point(aes(x = x, y = y, color = shot_made_flag)) + ylim(-50, 420) + ggtitle('Shot Chart: GSW (2016 season)') + theme_minimal()+ facet_wrap(~name) pdf(file = "images/stephen-curry-shot-chart.pdf", width = 8, height = 7) plot(gsw_shot_charts) dev.off()
N <- 1000000 X <- rpois(N, lambda = 2) X.2 <- X*(X-1)
/test.R
no_license
youknowwhatmynameis/myrepo
R
false
false
53
r
N <- 1000000 X <- rpois(N, lambda = 2) X.2 <- X*(X-1)
## Read electricity data from the local text file residing in the working directory electricData <- read.table("./household_power_consumption.txt", header = TRUE, sep = ";", colClasses = c(rep("character", 2), rep("numeric", 7)), na.strings = c("NA", "?")) electricData$Date <- as.Date(electricData$Date, "%d/%m/%Y") ## Subset the dataframe to include only the wanted date range electricData <- electricData[(electricData$Date >= "2007-02-01" & electricData$Date <= "2007-02-02"), ] ## Convert the datetime variables electricData$DateTime <- paste(electricData$Date, electricData$Time) electricData$DateTime <- strptime(electricData$DateTime, "%Y-%m-%d %H:%M:%S") ## Plot the plot2.png png(filename = "plot2.png", bg = "transparent", width = 480, height = 480, units = "px") with(electricData, plot(DateTime, Global_active_power, type = 'l', xlab = "", ylab = "Global Active Power (kilowatts)")) dev.off()
/plot2.R
no_license
siowmeng/ExData_Plotting1
R
false
false
909
r
## Read electricity data from the local text file residing in the working directory electricData <- read.table("./household_power_consumption.txt", header = TRUE, sep = ";", colClasses = c(rep("character", 2), rep("numeric", 7)), na.strings = c("NA", "?")) electricData$Date <- as.Date(electricData$Date, "%d/%m/%Y") ## Subset the dataframe to include only the wanted date range electricData <- electricData[(electricData$Date >= "2007-02-01" & electricData$Date <= "2007-02-02"), ] ## Convert the datetime variables electricData$DateTime <- paste(electricData$Date, electricData$Time) electricData$DateTime <- strptime(electricData$DateTime, "%Y-%m-%d %H:%M:%S") ## Plot the plot2.png png(filename = "plot2.png", bg = "transparent", width = 480, height = 480, units = "px") with(electricData, plot(DateTime, Global_active_power, type = 'l', xlab = "", ylab = "Global Active Power (kilowatts)")) dev.off()
#' Estimate Lagging and Leading Times and Concentrations #' #' Estimates lagging and leading times and concentrations. #' Used by correct.xx functions to estimate lagging and leading timepoints #' and concentrations for each timepoint. #' @param x data.frame #' @param nomtimevar1 column name in x indicating nominal time after dose #' @param depvar1 column name in x indicating concentration #' @param timevar1 column name in x indicating actual time after dose #' @param lagc concentration at previous sampling time #' @param lagt previous sampling time #' @param leadc concentration at next sampling time #' @param leadt next sampling time #' @param ... ignored #' @return data.frame #' @importFrom dplyr last lead lag left_join lag_lead <- function( x,nomtimevar1=NA,depvar1=NA,timevar1=NA, lagc=NA,lagt=NA,leadc=NA,leadt=NA,... ){ # original <- x %>% # mutate(depvar = !!depvar1, # dependent variable (internal) # timevar = !!timevar1, # actual time variable (internal) # ptime = !!nomtimevar1 # nominal time (internal) # ) %>% # mutate(flag=ifelse(!is.na(depvar),0,1)) %>% # flags type of missing value (in between or at the end) # mutate(flag=ifelse(is.na(depvar)&timevar>last(timevar[!is.na(depvar)]),2,flag)) original <- x original$depvar <- original[[depvar1]] original$timevar <- original[[timevar1]] original$ptime <- original[[nomtimevar1]] original %<>% mutate(flag=ifelse(!is.na(depvar),0,1)) %>% # flags type of missing value (in between or at the end) mutate(flag=ifelse(is.na(depvar)&timevar>last(timevar[!is.na(depvar)]),2,flag)) #1 delete NA's no.na=original %>%filter(!is.na(depvar)) #2 calc lead and lag no.na=no.na %>% arrange(ptime) %>% mutate(leadc=lead(depvar), # concentration at next sampling time (internal) lagc=lag(depvar), # concentration at previous sampling time (internal) leadt=lead(timevar), # next sampling time (internal) lagt=lag(timevar) # previous sampling time (internal) ) %>% select(ptime,leadc,lagc,leadt,lagt) #3 merge with original # newdata=left_join(original,no.na,by="ptime") newdata=left_join(original,no.na) newdata = newdata %>% arrange(ptime) %>% mutate(leadc =ifelse(flag==1,locf(leadc),leadc), leadt =ifelse(flag==1,locf(leadt),leadt), lagc =ifelse(flag==2,last(depvar[!is.na(depvar)]),lagc), lagt =ifelse(flag==2,last(timevar[!is.na(depvar)]),lagt) ) newdata = newdata %>% arrange(-ptime) newdata = newdata %>% mutate(lagc =ifelse(flag==1,locf(lagc),lagc), lagt =ifelse(flag==1,locf(lagt),lagt) ) newdata = newdata %>% arrange(ptime) %>% mutate(leadc =ifelse(ptime==last(ptime),NA,leadc), leadt =ifelse(ptime==last(ptime),NA,leadt) ) names(newdata)[names(newdata)=="lagc"]=lagc names(newdata)[names(newdata)=="lagt"]=lagt names(newdata)[names(newdata)=="leadc"]=leadc names(newdata)[names(newdata)=="leadt"]=leadt return(newdata) }
/R/lag.lead.r
no_license
billdenney/qpNCA
R
false
false
3,162
r
#' Estimate Lagging and Leading Times and Concentrations #' #' Estimates lagging and leading times and concentrations. #' Used by correct.xx functions to estimate lagging and leading timepoints #' and concentrations for each timepoint. #' @param x data.frame #' @param nomtimevar1 column name in x indicating nominal time after dose #' @param depvar1 column name in x indicating concentration #' @param timevar1 column name in x indicating actual time after dose #' @param lagc concentration at previous sampling time #' @param lagt previous sampling time #' @param leadc concentration at next sampling time #' @param leadt next sampling time #' @param ... ignored #' @return data.frame #' @importFrom dplyr last lead lag left_join lag_lead <- function( x,nomtimevar1=NA,depvar1=NA,timevar1=NA, lagc=NA,lagt=NA,leadc=NA,leadt=NA,... ){ # original <- x %>% # mutate(depvar = !!depvar1, # dependent variable (internal) # timevar = !!timevar1, # actual time variable (internal) # ptime = !!nomtimevar1 # nominal time (internal) # ) %>% # mutate(flag=ifelse(!is.na(depvar),0,1)) %>% # flags type of missing value (in between or at the end) # mutate(flag=ifelse(is.na(depvar)&timevar>last(timevar[!is.na(depvar)]),2,flag)) original <- x original$depvar <- original[[depvar1]] original$timevar <- original[[timevar1]] original$ptime <- original[[nomtimevar1]] original %<>% mutate(flag=ifelse(!is.na(depvar),0,1)) %>% # flags type of missing value (in between or at the end) mutate(flag=ifelse(is.na(depvar)&timevar>last(timevar[!is.na(depvar)]),2,flag)) #1 delete NA's no.na=original %>%filter(!is.na(depvar)) #2 calc lead and lag no.na=no.na %>% arrange(ptime) %>% mutate(leadc=lead(depvar), # concentration at next sampling time (internal) lagc=lag(depvar), # concentration at previous sampling time (internal) leadt=lead(timevar), # next sampling time (internal) lagt=lag(timevar) # previous sampling time (internal) ) %>% select(ptime,leadc,lagc,leadt,lagt) #3 merge with original # newdata=left_join(original,no.na,by="ptime") newdata=left_join(original,no.na) newdata = newdata %>% arrange(ptime) %>% mutate(leadc =ifelse(flag==1,locf(leadc),leadc), leadt =ifelse(flag==1,locf(leadt),leadt), lagc =ifelse(flag==2,last(depvar[!is.na(depvar)]),lagc), lagt =ifelse(flag==2,last(timevar[!is.na(depvar)]),lagt) ) newdata = newdata %>% arrange(-ptime) newdata = newdata %>% mutate(lagc =ifelse(flag==1,locf(lagc),lagc), lagt =ifelse(flag==1,locf(lagt),lagt) ) newdata = newdata %>% arrange(ptime) %>% mutate(leadc =ifelse(ptime==last(ptime),NA,leadc), leadt =ifelse(ptime==last(ptime),NA,leadt) ) names(newdata)[names(newdata)=="lagc"]=lagc names(newdata)[names(newdata)=="lagt"]=lagt names(newdata)[names(newdata)=="leadc"]=leadc names(newdata)[names(newdata)=="leadt"]=leadt return(newdata) }
testlist <- list(data = structure(c(1.269748709812e-320, 1.49121849020985e-312, 6.92383063338793e-251, 3.49284541244692e+30, 3.5295369653595e+30, 6.31151507988387e-28, 9.93476335118854e+44, 3.52953664162775e+30, 7.24774526323231e+43, 2.4173705217461e+35, 6.74730202138664e+38, 2.55318533568062e-310, 8.28904605845809e-317, 5.41108926696144e-312, 3.8174704291228e-310, 2.80698452022019e-307, 3.3229862250991e+36, 1.44438129484958e-134), .Dim = c(9L, 2L)), q = 2.71615493501101e-312) result <- do.call(biwavelet:::rcpp_row_quantile,testlist) str(result)
/biwavelet/inst/testfiles/rcpp_row_quantile/libFuzzer_rcpp_row_quantile/rcpp_row_quantile_valgrind_files/1610556731-test.R
no_license
akhikolla/updated-only-Issues
R
false
false
557
r
testlist <- list(data = structure(c(1.269748709812e-320, 1.49121849020985e-312, 6.92383063338793e-251, 3.49284541244692e+30, 3.5295369653595e+30, 6.31151507988387e-28, 9.93476335118854e+44, 3.52953664162775e+30, 7.24774526323231e+43, 2.4173705217461e+35, 6.74730202138664e+38, 2.55318533568062e-310, 8.28904605845809e-317, 5.41108926696144e-312, 3.8174704291228e-310, 2.80698452022019e-307, 3.3229862250991e+36, 1.44438129484958e-134), .Dim = c(9L, 2L)), q = 2.71615493501101e-312) result <- do.call(biwavelet:::rcpp_row_quantile,testlist) str(result)
##URL: https://github.com/garciarb/ProgrammingAssignment2 ## The makeCacheMatrix function creates a special "matrix", ## which is really a list containing a function to: ## 1. set the value of the matrix ## 2. get the value of the matrix ## 3. set the value of the inverse of the matrix ## 4. get the value of the inverse of the matrix #makeCacheMatrix makeCacheMatrix <- function(x = matrix()) { i <- NULL set <- function(y) { x <<- y i <<- NULL } get <- function() x setinverse <- function(inverse) i <<- inverse getinverse <- function() i list(set = set, get = get, setinverse = setinverse, getinverse = getinverse) } ## The cacheSolve function calculates the inverse of the special "matrix" ## that is returned by makeCacheMatrix. ##cacheSolve checks to see if the inverse has previously been caclculated. ##If it has been calculated and the matrix did not change, then cacheSolve ##retrieves the inverse from the cache. ##If it was not solved, it calculates the inverse of the matrix and sets ##the value through the usage of the setinverse function. #cacheSolve cacheSolve <- function(x, ...) { i <- x$getinverse() if(!is.null(i)) { message("getting cached data") return(i) } data <- x$get() i <- solve(data, ...) x$setinverse(i) i }
/cachematrix.R
no_license
garciarb/ProgrammingAssignment2
R
false
false
1,351
r
##URL: https://github.com/garciarb/ProgrammingAssignment2 ## The makeCacheMatrix function creates a special "matrix", ## which is really a list containing a function to: ## 1. set the value of the matrix ## 2. get the value of the matrix ## 3. set the value of the inverse of the matrix ## 4. get the value of the inverse of the matrix #makeCacheMatrix makeCacheMatrix <- function(x = matrix()) { i <- NULL set <- function(y) { x <<- y i <<- NULL } get <- function() x setinverse <- function(inverse) i <<- inverse getinverse <- function() i list(set = set, get = get, setinverse = setinverse, getinverse = getinverse) } ## The cacheSolve function calculates the inverse of the special "matrix" ## that is returned by makeCacheMatrix. ##cacheSolve checks to see if the inverse has previously been caclculated. ##If it has been calculated and the matrix did not change, then cacheSolve ##retrieves the inverse from the cache. ##If it was not solved, it calculates the inverse of the matrix and sets ##the value through the usage of the setinverse function. #cacheSolve cacheSolve <- function(x, ...) { i <- x$getinverse() if(!is.null(i)) { message("getting cached data") return(i) } data <- x$get() i <- solve(data, ...) x$setinverse(i) i }
library(shiny) shinyUI(fluidPage( # Descriptive main title titlePanel("Carbon Dioxide Uptake in Grass Plants"), sidebarLayout( # Ask the user which locations they want data from sidebarPanel( helpText("This Shiny application uses the CO2 dataset in R to display carbon dioxide uptake data for grass plants. Simply pick which locations you want data from and which color you want the histogram to be created in."), checkboxInput(inputId="quebecBox", label="Show Quebec plants data", value=TRUE), checkboxInput(inputId="mississippiBox", label="Show Mississippi plants data", value=TRUE), selectInput(inputId="colorBox", label="What color do you want the plot in?", choices=c("Blue", "Green", "Purple", "Orange", "Cyan", "Maroon")) ), # Display the histogram of the gas uptake for the selected data mainPanel( plotOutput("histogram") ) ) ))
/ui.R
no_license
sulaksh555/developing-data-products-week-4-assignment
R
false
false
1,044
r
library(shiny) shinyUI(fluidPage( # Descriptive main title titlePanel("Carbon Dioxide Uptake in Grass Plants"), sidebarLayout( # Ask the user which locations they want data from sidebarPanel( helpText("This Shiny application uses the CO2 dataset in R to display carbon dioxide uptake data for grass plants. Simply pick which locations you want data from and which color you want the histogram to be created in."), checkboxInput(inputId="quebecBox", label="Show Quebec plants data", value=TRUE), checkboxInput(inputId="mississippiBox", label="Show Mississippi plants data", value=TRUE), selectInput(inputId="colorBox", label="What color do you want the plot in?", choices=c("Blue", "Green", "Purple", "Orange", "Cyan", "Maroon")) ), # Display the histogram of the gas uptake for the selected data mainPanel( plotOutput("histogram") ) ) ))
# This is the absolute bare minimum of what I need to create a shiny app. # Beware! ... This alone will be a REALLY boring app. A blank page :( # You will create an app to compare states' cumulative number of COVID cases over time. # The x-axis will be number of days since 20+ cases and the y-axis will be cumulative cases on the # log scale (`scale_y_log10()`). We use number of days since 20+ cases on the x-axis so we can make # better comparisons of the curve trajectories. You will have an input box where the user can choose # which states to compare (`selectInput()`) and have a submit button to click once the user has chosen # all states they're interested in comparing. The graph should display a different line for each state, # with labels either on the graph or in a legend. Color can be used if needed. library(shiny) library(tidyverse) ui <- fluidPage( selectInput(inputId = "states", label = "Choose a State", choices = unique(covid19$state), multiple = TRUE), #submitButton(text = "Create Plot!"), plotOutput(outputId = "covidtimeplot") ) server <- function(input, output) { output$covidtimeplot <- renderPlot({ covid19 %>% group_by(state) %>% filter(cases >= 20) %>% mutate(days_since = as.numeric(difftime(date, lag(date, 1))), Between = ifelse(is.na(days_since), 0, days_since), days_since20 = cumsum(as.numeric(between))) %>% select(~days_since, ~Between) %>% filter(state %in% input$state) %>% ggplot(aes(x = days_since20 , y = cases, color = state)) + geom_line() + scale_y_log10() + scale_x_discrete() + labs(title = "Days Since 20 Covid Cases by State", x = "Days Since 20 Cases", y = "Total Cases") }) } shinyApp(ui = ui, server = server)
/Exercise_six_shiny/app.R
no_license
mpolemen/matt_excersize_six
R
false
false
1,843
r
# This is the absolute bare minimum of what I need to create a shiny app. # Beware! ... This alone will be a REALLY boring app. A blank page :( # You will create an app to compare states' cumulative number of COVID cases over time. # The x-axis will be number of days since 20+ cases and the y-axis will be cumulative cases on the # log scale (`scale_y_log10()`). We use number of days since 20+ cases on the x-axis so we can make # better comparisons of the curve trajectories. You will have an input box where the user can choose # which states to compare (`selectInput()`) and have a submit button to click once the user has chosen # all states they're interested in comparing. The graph should display a different line for each state, # with labels either on the graph or in a legend. Color can be used if needed. library(shiny) library(tidyverse) ui <- fluidPage( selectInput(inputId = "states", label = "Choose a State", choices = unique(covid19$state), multiple = TRUE), #submitButton(text = "Create Plot!"), plotOutput(outputId = "covidtimeplot") ) server <- function(input, output) { output$covidtimeplot <- renderPlot({ covid19 %>% group_by(state) %>% filter(cases >= 20) %>% mutate(days_since = as.numeric(difftime(date, lag(date, 1))), Between = ifelse(is.na(days_since), 0, days_since), days_since20 = cumsum(as.numeric(between))) %>% select(~days_since, ~Between) %>% filter(state %in% input$state) %>% ggplot(aes(x = days_since20 , y = cases, color = state)) + geom_line() + scale_y_log10() + scale_x_discrete() + labs(title = "Days Since 20 Covid Cases by State", x = "Days Since 20 Cases", y = "Total Cases") }) } shinyApp(ui = ui, server = server)
############################################################################ ## Wrapper function for Fitting multiple factor DM model. ## Take a bsseq object and a design matrix ############################################################################ DMLfit.multiFactor <- function(BSobj, design, formula, smoothing=FALSE, smoothing.span=500) { ## some checking to make sure input data is correct if(length(sampleNames(BSobj)) != nrow(design)) stop("Dimension of data and design don't match. ") ## make design matrix out of formula X <- model.matrix(formula, design) if(nrow(X) <= ncol(X)+1) stop("No enough degree of freedom to fit the linear model. Drop some terms in formula.") ## take counts from BSobj N0 <- getBSseq(BSobj, "Cov") Y0 <- getBSseq(BSobj, "M") ## compute the response variable Z, which is transformed methylation level c0 = 0.1 if(smoothing) { ## with smoothing. The mean methylation levels are smoothed allchr <- as.character(seqnames(BSobj)) allpos <- start(BSobj) N0.sm = N0; Y0.sm = Y0 for(i in 1:ncol(N0)) { N0.sm[,i] <- round(smooth.chr(as.double(N0[,i]), smoothing.span, allchr, allpos, "avg")) Y0.sm[,i] <- round(smooth.chr(as.double(Y0[,i]), smoothing.span, allchr, allpos, "avg")) } Z0 = asin(2*(Y0.sm+c0)/(N0.sm+2*c0) - 1) } else { ## no smoothing Z0 = asin(2*(Y0+c0)/(N0+2*c0) - 1) } ## fit the model fit <- DMLfit.multiFactor.engine(as.array(Y0), as.array(N0), X, as.array(Z0)) ## return list(gr=getBSseq(BSobj, "gr"), design=design, formula=formula, X=X, fit=fit) } ############################################################################ ## Engine function for Fitting multiple factor DM model. ############################################################################ DMLfit.multiFactor.engine <- function(Y0, N0, X0, Z0) { if( (!is.matrix(Y0) | !is.matrix(N0)) & (class(Y0)!="DelayedMatrix" | class(N0)!="DelayedMatrix") ) stop("Y and N need to be matrices.\n") ## get dimensions p = NCOL(X0) n = NROW(X0) C = nrow(Y0) ## loop over CpG sites beta = matrix(NA, nrow=C, ncol=p) var.beta = matrix(NA, nrow=C, ncol=p*p) cat("Fitting DML model for CpG site: ") for( i in 1:C ) { if(i %% 1e5 == 0) cat(i, ", ") ## take counts for current CpG and fit model tmp = DMLfit.oneCG(Y0[i,], N0[i,], X0, Z0[i,], n, p) if(is.null(tmp)) next ## save point estimates and SE for this CpG beta[i,] = tmp$beta0 var.beta[i,] = tmp$var.beta0 } list(beta=beta, var.beta=var.beta) } ############################################################## ## DML model fitting for one CpG ## This is the "core" function and all methods are in here!! ############################################################## DMLfit.oneCG <- function(Y, N, X, Z, n, p) { ## small constants to bound p and phi c1 = 0.001 ## check to make sure data is complete ix <- N > 0 if(mean(ix) < 1) { ## has missing entries X <- X[ix,,drop=FALSE] Y <- Y[ix] N <- N[ix] ## check design if(nrow(X) < ncol(X) + 1) ## not enough df for regression return(NULL) if(any(abs(svd(X)$d) <1e-8)) ## design is not of full rank because of missing. Skip return(NULL) Z <- Z[ix] } ## Transform the methylation levels. Add a small constant to bound away from 0/1. # Z = asin(2*(Y+c0)/(N+2*c0) - 1) ## First round of weighted least square. ## QR decomposition has to be performed for each CpG because it's WLS!!! XTVinv = t(X * N) beta0 = solve(XTVinv %*% X) %*% (XTVinv %*% Z) ### this parenthesis is also helpful to speed up ## get dispersion estimates, and restrict a bit to bound away from 0/1. phiHat = (sum( (Z - X %*% beta0)^2 * N) - (n - p)) * n / (n - p) / sum(N-1) phiHat = min(max(c1, phiHat),1-c1) ## Shrinkage phiHat a bit --- how to do this??? ## second round of regression. XTVinv = t(X * (N/(1+(N-1)*phiHat))) ###t(X)%*%VInv XTVinvX.inv = solve(XTVinv %*% X) beta0 = solve(XTVinv %*% X) %*% (XTVinv %*% Z) se.beta0 = sqrt(diag(XTVinvX.inv)) ## return. I'll flatten the var/cov matrix for easy storing. list(beta0=beta0, se.beta0=se.beta0, var.beta0 = as.vector(XTVinvX.inv)) } ############################################################## ### hypothesis testing function ############################################################## DMLtest.multiFactor <- function(DMLfit, coef=2, term, Contrast) { ## figure out index of the factor to be tested ## coef = find.factor(DMLfit$design, DMLfit$formula, factor) ## check inputs flag = 0 if(!missing(coef)) flag = flag + 1 if(!missing(term)) flag = flag + 1 if(!missing(Contrast)) flag = flag + 1 if(flag == 0) stop("Must specify one of the following parameter for testing: coef, term, or Contrast.\n") if(flag > 1) stop("You can only specify one of the following parameter for testing: coef, term, or Contrast.\n") if(!missing(coef)) { # specified coef res = DMLtest.multiFactor.coef(DMLfit, coef) } else if(!missing(term)) { # specify term ## create a contrast matrix for testing the term Contrast = makeContrast(DMLfit, term) ## testing res = DMLtest.multiFactor.Contrast(DMLfit, Contrast) } else if(!missing(Contrast)) { # specify contrast ## check contrast matrix if( nrow(Contrast) != ncol(DMLfit$X) ) stop("Input Contrast matrix has wrong dimension: its number of rows must match the number of columns of the design matrix.\n") ## testing res = DMLtest.multiFactor.Contrast(DMLfit, Contrast) } class(res)[2] = "DMLtest.multiFactor" invisible(res) } ############################################################## ## Hypothesis testing when specify a coef for testing. ## This only tests one column in the design matrix. ## Wald test will be used. ############################################################## DMLtest.multiFactor.coef <- function(DMLfit, coef) { if(is.character(coef)) { tmp = which(colnames(DMLfit$X) == coef) if(length(tmp) == 0) stop(paste0("Can't find terms to be tested: ", coef, ". Make sure it matches a column name in design matrix.")) coef = tmp } ## hypothesis testing p = ncol(DMLfit$X) fit = DMLfit$fit betas = fit$beta[,coef] ## take out SE estimates from var/cov matrix tmp = t(apply(fit$var.beta, 1, function(x) diag(matrix(x, ncol=p)))) ses = sqrt(tmp[,coef]) ## Wald test, get p-values and FDR stat = betas / ses pvals = 2*pnorm(-abs(stat)) #2*(1- pnorm(abs(stat))) fdrs = p.adjust(pvals, method="BH") ## return a data frame gr = DMLfit$gr res = data.frame(chr=seqnames(gr), pos=start(gr), stat, pvals, fdrs) invisible(res) } ############################################################## ## Hypothesis testing when specify a contrast matrix. ## This tests multiple columns in the design matrix. ## F-test will be used. ############################################################## DMLtest.multiFactor.Contrast <- function(DMLfit, Contrast) { p = ncol(DMLfit$X) fit = DMLfit$fit betas = fit$beta ## A^T * beta Abeta = betas %*% Contrast ## loop through CpG sites -- have to do this since the var/cov matrices of the beta estimates ## are different for each site stat = rep( NA, nrow(betas) ) for( i in 1:nrow(betas) ) { Sigma = matrix(fit$var.beta[i,], ncol=p) tmp = solve(t(Contrast) %*% Sigma %*% Contrast) thisAbeta = Abeta[i,,drop=FALSE] stat[i] = thisAbeta %*% tmp %*% t(thisAbeta) } ## get the sign of the contrast if there's only one contrast. ## This is to be added to test statistics ## When Contrast has multiple rows, there won't be a sign for test statistics. if(nrow(Contrast) == 1) signs = sign(betas %*% Contrast) else signs = 1 ## get p-values. Stat follows F_{r, R} ## I found that using F distribution, the p-values are pretty large. ## Use sqrt(f) and normal gives much smaller p-values, ## and this is consistent with the Wald test in two-group comparison. r = ncol(Contrast) ## R = nrow(DMLfit$X) - ncol(DMLfit$X) ## stat = stat / r ## pvals = 1 - pf(stat, r, R) stat = sqrt(stat / r) * signs pvals = 2*pnorm(-abs(stat)) fdrs = p.adjust(pvals, method="BH") ## return a data frame gr = DMLfit$gr res = data.frame(chr=seqnames(gr), pos=start(gr), stat, pvals, fdrs) attr(res, "Contrast") = Contrast invisible(res) } ############################################################## ## make contrast matrix given a model and a term to be tested ## Input term can be a vector (testing multiple terms) ############################################################## makeContrast <- function(fit, term) { formula.terms = terms(fit$formula) ix = match(term, attr(formula.terms, "term.labels")) if( length(ix) == 0 ) stop("term(s) to be tested can't be found in the formula.\n") if( any(is.na(ix)) ) warning("Some term(s) to be tested can't be found in the formula. Will proceed to test the locatable terms.\n") ## make contrast matrix. All columns in the design matrix related to ## the provided term (including interactions) should be tested. allcolnam = colnames(fit$X) ix.term = NULL for( t in term ) { ix.term = c(ix.term, grep(t, allcolnam)) ## using grep is dangerous is two terms has similar names, such as aa and aaa. ## I need to find a better way for this } ## make matrix. L = matrix(0, ncol=ncol(fit$X), nrow=length(ix.term)) for(i in 1:nrow(L)) L[i, ix.term[i]] = 1 return(t(L)) }
/R/DML.multiFactor.R
no_license
hmyh1202/DSS
R
false
false
10,072
r
############################################################################ ## Wrapper function for Fitting multiple factor DM model. ## Take a bsseq object and a design matrix ############################################################################ DMLfit.multiFactor <- function(BSobj, design, formula, smoothing=FALSE, smoothing.span=500) { ## some checking to make sure input data is correct if(length(sampleNames(BSobj)) != nrow(design)) stop("Dimension of data and design don't match. ") ## make design matrix out of formula X <- model.matrix(formula, design) if(nrow(X) <= ncol(X)+1) stop("No enough degree of freedom to fit the linear model. Drop some terms in formula.") ## take counts from BSobj N0 <- getBSseq(BSobj, "Cov") Y0 <- getBSseq(BSobj, "M") ## compute the response variable Z, which is transformed methylation level c0 = 0.1 if(smoothing) { ## with smoothing. The mean methylation levels are smoothed allchr <- as.character(seqnames(BSobj)) allpos <- start(BSobj) N0.sm = N0; Y0.sm = Y0 for(i in 1:ncol(N0)) { N0.sm[,i] <- round(smooth.chr(as.double(N0[,i]), smoothing.span, allchr, allpos, "avg")) Y0.sm[,i] <- round(smooth.chr(as.double(Y0[,i]), smoothing.span, allchr, allpos, "avg")) } Z0 = asin(2*(Y0.sm+c0)/(N0.sm+2*c0) - 1) } else { ## no smoothing Z0 = asin(2*(Y0+c0)/(N0+2*c0) - 1) } ## fit the model fit <- DMLfit.multiFactor.engine(as.array(Y0), as.array(N0), X, as.array(Z0)) ## return list(gr=getBSseq(BSobj, "gr"), design=design, formula=formula, X=X, fit=fit) } ############################################################################ ## Engine function for Fitting multiple factor DM model. ############################################################################ DMLfit.multiFactor.engine <- function(Y0, N0, X0, Z0) { if( (!is.matrix(Y0) | !is.matrix(N0)) & (class(Y0)!="DelayedMatrix" | class(N0)!="DelayedMatrix") ) stop("Y and N need to be matrices.\n") ## get dimensions p = NCOL(X0) n = NROW(X0) C = nrow(Y0) ## loop over CpG sites beta = matrix(NA, nrow=C, ncol=p) var.beta = matrix(NA, nrow=C, ncol=p*p) cat("Fitting DML model for CpG site: ") for( i in 1:C ) { if(i %% 1e5 == 0) cat(i, ", ") ## take counts for current CpG and fit model tmp = DMLfit.oneCG(Y0[i,], N0[i,], X0, Z0[i,], n, p) if(is.null(tmp)) next ## save point estimates and SE for this CpG beta[i,] = tmp$beta0 var.beta[i,] = tmp$var.beta0 } list(beta=beta, var.beta=var.beta) } ############################################################## ## DML model fitting for one CpG ## This is the "core" function and all methods are in here!! ############################################################## DMLfit.oneCG <- function(Y, N, X, Z, n, p) { ## small constants to bound p and phi c1 = 0.001 ## check to make sure data is complete ix <- N > 0 if(mean(ix) < 1) { ## has missing entries X <- X[ix,,drop=FALSE] Y <- Y[ix] N <- N[ix] ## check design if(nrow(X) < ncol(X) + 1) ## not enough df for regression return(NULL) if(any(abs(svd(X)$d) <1e-8)) ## design is not of full rank because of missing. Skip return(NULL) Z <- Z[ix] } ## Transform the methylation levels. Add a small constant to bound away from 0/1. # Z = asin(2*(Y+c0)/(N+2*c0) - 1) ## First round of weighted least square. ## QR decomposition has to be performed for each CpG because it's WLS!!! XTVinv = t(X * N) beta0 = solve(XTVinv %*% X) %*% (XTVinv %*% Z) ### this parenthesis is also helpful to speed up ## get dispersion estimates, and restrict a bit to bound away from 0/1. phiHat = (sum( (Z - X %*% beta0)^2 * N) - (n - p)) * n / (n - p) / sum(N-1) phiHat = min(max(c1, phiHat),1-c1) ## Shrinkage phiHat a bit --- how to do this??? ## second round of regression. XTVinv = t(X * (N/(1+(N-1)*phiHat))) ###t(X)%*%VInv XTVinvX.inv = solve(XTVinv %*% X) beta0 = solve(XTVinv %*% X) %*% (XTVinv %*% Z) se.beta0 = sqrt(diag(XTVinvX.inv)) ## return. I'll flatten the var/cov matrix for easy storing. list(beta0=beta0, se.beta0=se.beta0, var.beta0 = as.vector(XTVinvX.inv)) } ############################################################## ### hypothesis testing function ############################################################## DMLtest.multiFactor <- function(DMLfit, coef=2, term, Contrast) { ## figure out index of the factor to be tested ## coef = find.factor(DMLfit$design, DMLfit$formula, factor) ## check inputs flag = 0 if(!missing(coef)) flag = flag + 1 if(!missing(term)) flag = flag + 1 if(!missing(Contrast)) flag = flag + 1 if(flag == 0) stop("Must specify one of the following parameter for testing: coef, term, or Contrast.\n") if(flag > 1) stop("You can only specify one of the following parameter for testing: coef, term, or Contrast.\n") if(!missing(coef)) { # specified coef res = DMLtest.multiFactor.coef(DMLfit, coef) } else if(!missing(term)) { # specify term ## create a contrast matrix for testing the term Contrast = makeContrast(DMLfit, term) ## testing res = DMLtest.multiFactor.Contrast(DMLfit, Contrast) } else if(!missing(Contrast)) { # specify contrast ## check contrast matrix if( nrow(Contrast) != ncol(DMLfit$X) ) stop("Input Contrast matrix has wrong dimension: its number of rows must match the number of columns of the design matrix.\n") ## testing res = DMLtest.multiFactor.Contrast(DMLfit, Contrast) } class(res)[2] = "DMLtest.multiFactor" invisible(res) } ############################################################## ## Hypothesis testing when specify a coef for testing. ## This only tests one column in the design matrix. ## Wald test will be used. ############################################################## DMLtest.multiFactor.coef <- function(DMLfit, coef) { if(is.character(coef)) { tmp = which(colnames(DMLfit$X) == coef) if(length(tmp) == 0) stop(paste0("Can't find terms to be tested: ", coef, ". Make sure it matches a column name in design matrix.")) coef = tmp } ## hypothesis testing p = ncol(DMLfit$X) fit = DMLfit$fit betas = fit$beta[,coef] ## take out SE estimates from var/cov matrix tmp = t(apply(fit$var.beta, 1, function(x) diag(matrix(x, ncol=p)))) ses = sqrt(tmp[,coef]) ## Wald test, get p-values and FDR stat = betas / ses pvals = 2*pnorm(-abs(stat)) #2*(1- pnorm(abs(stat))) fdrs = p.adjust(pvals, method="BH") ## return a data frame gr = DMLfit$gr res = data.frame(chr=seqnames(gr), pos=start(gr), stat, pvals, fdrs) invisible(res) } ############################################################## ## Hypothesis testing when specify a contrast matrix. ## This tests multiple columns in the design matrix. ## F-test will be used. ############################################################## DMLtest.multiFactor.Contrast <- function(DMLfit, Contrast) { p = ncol(DMLfit$X) fit = DMLfit$fit betas = fit$beta ## A^T * beta Abeta = betas %*% Contrast ## loop through CpG sites -- have to do this since the var/cov matrices of the beta estimates ## are different for each site stat = rep( NA, nrow(betas) ) for( i in 1:nrow(betas) ) { Sigma = matrix(fit$var.beta[i,], ncol=p) tmp = solve(t(Contrast) %*% Sigma %*% Contrast) thisAbeta = Abeta[i,,drop=FALSE] stat[i] = thisAbeta %*% tmp %*% t(thisAbeta) } ## get the sign of the contrast if there's only one contrast. ## This is to be added to test statistics ## When Contrast has multiple rows, there won't be a sign for test statistics. if(nrow(Contrast) == 1) signs = sign(betas %*% Contrast) else signs = 1 ## get p-values. Stat follows F_{r, R} ## I found that using F distribution, the p-values are pretty large. ## Use sqrt(f) and normal gives much smaller p-values, ## and this is consistent with the Wald test in two-group comparison. r = ncol(Contrast) ## R = nrow(DMLfit$X) - ncol(DMLfit$X) ## stat = stat / r ## pvals = 1 - pf(stat, r, R) stat = sqrt(stat / r) * signs pvals = 2*pnorm(-abs(stat)) fdrs = p.adjust(pvals, method="BH") ## return a data frame gr = DMLfit$gr res = data.frame(chr=seqnames(gr), pos=start(gr), stat, pvals, fdrs) attr(res, "Contrast") = Contrast invisible(res) } ############################################################## ## make contrast matrix given a model and a term to be tested ## Input term can be a vector (testing multiple terms) ############################################################## makeContrast <- function(fit, term) { formula.terms = terms(fit$formula) ix = match(term, attr(formula.terms, "term.labels")) if( length(ix) == 0 ) stop("term(s) to be tested can't be found in the formula.\n") if( any(is.na(ix)) ) warning("Some term(s) to be tested can't be found in the formula. Will proceed to test the locatable terms.\n") ## make contrast matrix. All columns in the design matrix related to ## the provided term (including interactions) should be tested. allcolnam = colnames(fit$X) ix.term = NULL for( t in term ) { ix.term = c(ix.term, grep(t, allcolnam)) ## using grep is dangerous is two terms has similar names, such as aa and aaa. ## I need to find a better way for this } ## make matrix. L = matrix(0, ncol=ncol(fit$X), nrow=length(ix.term)) for(i in 1:nrow(L)) L[i, ix.term[i]] = 1 return(t(L)) }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/run-source.R \name{source_gist} \alias{source_gist} \title{Run a script on gist} \usage{ source_gist(id, ..., filename = NULL, sha1 = NULL, quiet = FALSE) } \arguments{ \item{id}{either full url (character), gist ID (numeric or character of numeric).} \item{...}{other options passed to \code{\link[=source]{source()}}} \item{filename}{if there is more than one R file in the gist, which one to source (filename ending in '.R')? Default \code{NULL} will source the first file.} \item{sha1}{The SHA-1 hash of the file at the remote URL. This is highly recommend as it prevents you from accidentally running code that's not what you expect. See \code{\link[=source_url]{source_url()}} for more information on using a SHA-1 hash.} \item{quiet}{if \code{FALSE}, the default, prints informative messages.} } \description{ \dQuote{Gist is a simple way to share snippets and pastes with others. All gists are git repositories, so they are automatically versioned, forkable and usable as a git repository.} \url{https://gist.github.com/} } \examples{ \dontrun{ # You can run gists given their id source_gist(6872663) source_gist("6872663") # Or their html url source_gist("https://gist.github.com/hadley/6872663") source_gist("gist.github.com/hadley/6872663") # It's highly recommend that you run source_gist with the optional # sha1 argument - this will throw an error if the file has changed since # you first ran it source_gist(6872663, sha1 = "54f1db27e60") # Wrong hash will result in error source_gist(6872663, sha1 = "54f1db27e61") #' # You can speficy a particular R file in the gist source_gist(6872663, filename = "hi.r") source_gist(6872663, filename = "hi.r", sha1 = "54f1db27e60") } } \seealso{ \code{\link[=source_url]{source_url()}} }
/man/source_gist.Rd
permissive
r-lib/devtools
R
false
true
1,827
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/run-source.R \name{source_gist} \alias{source_gist} \title{Run a script on gist} \usage{ source_gist(id, ..., filename = NULL, sha1 = NULL, quiet = FALSE) } \arguments{ \item{id}{either full url (character), gist ID (numeric or character of numeric).} \item{...}{other options passed to \code{\link[=source]{source()}}} \item{filename}{if there is more than one R file in the gist, which one to source (filename ending in '.R')? Default \code{NULL} will source the first file.} \item{sha1}{The SHA-1 hash of the file at the remote URL. This is highly recommend as it prevents you from accidentally running code that's not what you expect. See \code{\link[=source_url]{source_url()}} for more information on using a SHA-1 hash.} \item{quiet}{if \code{FALSE}, the default, prints informative messages.} } \description{ \dQuote{Gist is a simple way to share snippets and pastes with others. All gists are git repositories, so they are automatically versioned, forkable and usable as a git repository.} \url{https://gist.github.com/} } \examples{ \dontrun{ # You can run gists given their id source_gist(6872663) source_gist("6872663") # Or their html url source_gist("https://gist.github.com/hadley/6872663") source_gist("gist.github.com/hadley/6872663") # It's highly recommend that you run source_gist with the optional # sha1 argument - this will throw an error if the file has changed since # you first ran it source_gist(6872663, sha1 = "54f1db27e60") # Wrong hash will result in error source_gist(6872663, sha1 = "54f1db27e61") #' # You can speficy a particular R file in the gist source_gist(6872663, filename = "hi.r") source_gist(6872663, filename = "hi.r", sha1 = "54f1db27e60") } } \seealso{ \code{\link[=source_url]{source_url()}} }
VB_exp <- function(k,n,nrow,ncol,p,q,r){ # This Function calculated the value of element of exponential n by n matrix to the kth power # This is for Markov process exp^{Qt} where Q is nxn matrix # n = dimension of the matrix # k = power of matrix # p = forward probability # q = backward probabiity # r = returning probability # nrow = the row of the matrix # ncol = the column of the matrix # Initialize lambda and A lambda <- rep(0,n) A <- rep(0, n) for (nMatrix in 1:n){ if ((2 * nMatrix / (n + 1)) %% 2 == 1){ lambda[nMatrix] = r } else{ lambda[nMatrix] = r + 2 * sqrt(q * p) * cos((pi * nMatrix) / (n+1)) } # end else A[nMatrix] = findAj(nrow, ncol, nMatrix, n, p, q, r) } #end for loop # Initialize running sum afSum = 0 ; # Calculate the element of the matrix for (nSum in 1:n){ afSum = A[nSum] * exp(lambda[nSum] * k) + afSum } return(afSum) } # end function
/VB_exp.R
no_license
JeremyJosephLin/markovcpp
R
false
false
983
r
VB_exp <- function(k,n,nrow,ncol,p,q,r){ # This Function calculated the value of element of exponential n by n matrix to the kth power # This is for Markov process exp^{Qt} where Q is nxn matrix # n = dimension of the matrix # k = power of matrix # p = forward probability # q = backward probabiity # r = returning probability # nrow = the row of the matrix # ncol = the column of the matrix # Initialize lambda and A lambda <- rep(0,n) A <- rep(0, n) for (nMatrix in 1:n){ if ((2 * nMatrix / (n + 1)) %% 2 == 1){ lambda[nMatrix] = r } else{ lambda[nMatrix] = r + 2 * sqrt(q * p) * cos((pi * nMatrix) / (n+1)) } # end else A[nMatrix] = findAj(nrow, ncol, nMatrix, n, p, q, r) } #end for loop # Initialize running sum afSum = 0 ; # Calculate the element of the matrix for (nSum in 1:n){ afSum = A[nSum] * exp(lambda[nSum] * k) + afSum } return(afSum) } # end function
% % Copyright (c) 2013, 2014, IBM Corp. All rights reserved. % % This program is free software: you can redistribute it and/or modify % it under the terms of the GNU General Public License as published by % the Free Software Foundation, either version 3 of the License, or % (at your option) any later version. % % This program is distributed in the hope that it will be useful, % but WITHOUT ANY WARRANTY; without even the implied warranty of % MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the % GNU General Public License for more details. % % You should have received a copy of the GNU General Public License % along with this program. If not, see <http://www.gnu.org/licenses/>. % % \name{ibmdbR-package} \alias{ibmdbR-package} \alias{ibmdbR} \docType{package} \title{ IBM In-Database Analytics } \description{ In-database analytics functions operate directly on data in a database, rather than requiring that the data first be extracted to working memory. This lets you analyze large amounts of data that would be impractical or impossible to extract. It also avoids security issues associated with extracting data, and ensures that the data being analyzed is as current as possible. Some functions additionally use lazy loading to load only those parts of the data that are actually required, to further increase efficiency. This package also contains a data structure called a \code{\link{ida.list}}, which you can use to store R objects in the database. This simplifies the sharing of R objects among users. Each user is assigned two tables for R object storage: a private table, to which only that user has access, and a public table, which can be read by other users. Use a IDA list to generate a pointer to either of these tables, and use the pointer to list, store, or retrieve R objects.}
/man/overview.Rd
no_license
cran/ibmdbR
R
false
false
1,845
rd
% % Copyright (c) 2013, 2014, IBM Corp. All rights reserved. % % This program is free software: you can redistribute it and/or modify % it under the terms of the GNU General Public License as published by % the Free Software Foundation, either version 3 of the License, or % (at your option) any later version. % % This program is distributed in the hope that it will be useful, % but WITHOUT ANY WARRANTY; without even the implied warranty of % MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the % GNU General Public License for more details. % % You should have received a copy of the GNU General Public License % along with this program. If not, see <http://www.gnu.org/licenses/>. % % \name{ibmdbR-package} \alias{ibmdbR-package} \alias{ibmdbR} \docType{package} \title{ IBM In-Database Analytics } \description{ In-database analytics functions operate directly on data in a database, rather than requiring that the data first be extracted to working memory. This lets you analyze large amounts of data that would be impractical or impossible to extract. It also avoids security issues associated with extracting data, and ensures that the data being analyzed is as current as possible. Some functions additionally use lazy loading to load only those parts of the data that are actually required, to further increase efficiency. This package also contains a data structure called a \code{\link{ida.list}}, which you can use to store R objects in the database. This simplifies the sharing of R objects among users. Each user is assigned two tables for R object storage: a private table, to which only that user has access, and a public table, which can be read by other users. Use a IDA list to generate a pointer to either of these tables, and use the pointer to list, store, or retrieve R objects.}
# Verified 1.3.18 # Version 4.0 panomapa <- function(collection, main, axis = TRUE, xlab = "Long", ylab = "Lat", lab.col = 'black', bg = NA, map.bg = NA, map.col = 'black', col.ramp = c("Green3", "darkorange1","red"), arrow.cex = 4.5, arrow.plot = TRUE, pt.col = rgb(0, 0, 0, 0.75), pt.cex = 4.5, pt.pch = 21, leg.pt.bg = pt.bg, leg.bg = NA, leg.title = "Lengevity\n(years)",# "Longevidad\n(años)", leg.offset = c(0,0), leg.y.intersp = 1.75) { colf = function(x) { colorRamp(col.ramp)(x) } print_ramp <- function (ColorLevels, pal, mar = c(1,2.5,2.5,2), xlab="", ylab="", ...) { par(mar=mar) image(1, ColorLevels, matrix(data = ColorLevels, ncol = length(ColorLevels), nrow = 1), col = pal, xaxt = "n", ylab = ylab, xlab = xlab, ...) title(...) } # Function start #### if ( length(names(collection$catalog)) != 0 ) { cat = collection$catalog; catalogo = list(); catalogo[[1]] = cat; rm("cat") dat = collection$data; datos = list(); datos[[1]] = dat; rm("dat") } else { catalogo = collection$catalog datos = collection$data } map.abb = unique(unlist(lapply( catalogo, function(x){x$State} ))) if ( length(catalogo) != length(datos) ) { stop("In collection: catalogo and datos lengths differ.") } n = length(catalogo) pos = plyr::ldply(catalogo, function(x) { c(x$Longitude, x$Latitude) }) D = matrix(c(range(pos[,1]), range(pos[,2])), ncol=2) dpa = list() for (k in 1:n) { dpa[[k]] = list(qty.disp = length(catalogo[[k]]$Avble.yrs), m = length(datos[[k]]), frac.na = sum(is.na(datos[[k]]))/length(datos[[k]]), frac.ag = sum(datos[[k]] < 0, na.rm = T)/length(datos[[k]])) } pta = plyr::ldply(dpa, function(x) { c(x$qty.disp, x$m, x$frac.na, x$frac.ag) }) m.disp = max(pta[, 1]) pta[, 1] = pta[, 1]/m.disp pta[pta[, 1] <= 0.1, 1] = 0.1 pt.bg = rgb(colf(pta[, 3])/255, alpha = 0.75) leg.pt.bg = rgb(colf(rev(c(0.1, 0.25, 0.5, 0.75, 1)))/255, alpha = 0.75) par.save <- par(no.readonly = TRUE) layout(mat = matrix(c(1,1,1,2,3,4), ncol=2), widths = c(4,1), heights = c(2,2,1)) ptatruescale = par()$fin[1] * 0.66 if (!is.na(map.abb)) { ESS <- get.shape.state(map.abb) SHP.range = matrix(ncol = 4, nrow = length(ESS)) for (i in 1:length(ESS)) { d = slot(ESS, "polygons")[[i]] SHP.sub = matrix(ncol = 4, nrow = length(slot(d,"Polygons"))) for (j in 1:length(slot(d, "Polygons"))) { d.sub = slot(d, "Polygons")[[j]] d.sub = slot(d.sub, "coords") SHP.sub[j, 1:2] = range(d.sub[, 1]) SHP.sub[j, 3:4] = range(d.sub[, 2]) } d = matrix(apply(SHP.sub, 2, range), ncol = 4) SHP.range[i, 1:2] = diag(d[1:2, 1:2]) SHP.range[i, 3:4] = diag(d[1:2, 3:4]) } d = matrix(apply(SHP.range, 2, range), ncol = 2) D = rbind(d, D) # max betwen points and shape border } plot(axes = F, asp = 1, bty = "n", type = "n", range(D[,1]), range(D[, 2]), ylab = ylab, xlab = xlab) if (!is.na(map.abb)) { plot(add = T, axes = F, ESS, bg = map.bg, border = map.col, asp = 1) } points(pos, cex = ptatruescale * pt.cex * pta[, 1], bg = pt.bg, pch = pt.pch, col = pt.col) if (axis == T) { axis(1, col = lab.col, col.axis = lab.col) axis(2, col = lab.col, col.axis = lab.col) } if (missing(main)) { if ( length(catalogo) == 1) { main = "Station longevity" } else { main = "Stations longevity" } if ( ! is.na(map.abb) ) { estados.venezuela <- get.shape.state() main = paste(main, "for", paste(estados.venezuela[map.abb, "shape.name"], collapse = ", ")) } } title(main = main, col.main = lab.col,cex.main=2.5) long = round(c(0.1, 0.25, 0.5, 0.75, 1) * m.disp, 0) long = apply(cbind(c("<", "<", "<", "<", "<"), long), 1, paste0, collapse = "") par(mar = c(0.5,0.5,0,0.5) + 0.1, mai=c(0,0,1,0)) plot(c(-1,1), c(-1,6), typ='n', asp=1, axes=F, xlab=NA, ylab=NA) legend(x = -1, y = 5.9, legend = long, pt.cex = pt.cex * ptatruescale * c(0.2,0.25, 0.5, 0.75, 1), pch = 21, bg = leg.bg, pt.bg = NA, cex = 1.25, bty = "n", text.col = lab.col, y.intersp = leg.y.intersp, ) title(main = leg.title, cex.main = 1.45, font.main = 2) leg.lvl = seq(0, 100, by=5) leg.col = rgb(colf(rev(leg.lvl/100))/255, alpha = 0.75) print_ramp(leg.lvl, leg.col, main="Data %",mar = c(1,5,7.5,3.5)) par(mar = rep(0.5,4) + 0.1) plot(c(-1,1), c(-1,5), typ = 'n', asp = 1, axes = F, xlab = NA, ylab = NA) if (arrow.plot){ plotArrow(cex = arrow.cex) } par(par.save) }
/vetools/R/panomapa.R
no_license
ingted/R-Examples
R
false
false
5,085
r
# Verified 1.3.18 # Version 4.0 panomapa <- function(collection, main, axis = TRUE, xlab = "Long", ylab = "Lat", lab.col = 'black', bg = NA, map.bg = NA, map.col = 'black', col.ramp = c("Green3", "darkorange1","red"), arrow.cex = 4.5, arrow.plot = TRUE, pt.col = rgb(0, 0, 0, 0.75), pt.cex = 4.5, pt.pch = 21, leg.pt.bg = pt.bg, leg.bg = NA, leg.title = "Lengevity\n(years)",# "Longevidad\n(años)", leg.offset = c(0,0), leg.y.intersp = 1.75) { colf = function(x) { colorRamp(col.ramp)(x) } print_ramp <- function (ColorLevels, pal, mar = c(1,2.5,2.5,2), xlab="", ylab="", ...) { par(mar=mar) image(1, ColorLevels, matrix(data = ColorLevels, ncol = length(ColorLevels), nrow = 1), col = pal, xaxt = "n", ylab = ylab, xlab = xlab, ...) title(...) } # Function start #### if ( length(names(collection$catalog)) != 0 ) { cat = collection$catalog; catalogo = list(); catalogo[[1]] = cat; rm("cat") dat = collection$data; datos = list(); datos[[1]] = dat; rm("dat") } else { catalogo = collection$catalog datos = collection$data } map.abb = unique(unlist(lapply( catalogo, function(x){x$State} ))) if ( length(catalogo) != length(datos) ) { stop("In collection: catalogo and datos lengths differ.") } n = length(catalogo) pos = plyr::ldply(catalogo, function(x) { c(x$Longitude, x$Latitude) }) D = matrix(c(range(pos[,1]), range(pos[,2])), ncol=2) dpa = list() for (k in 1:n) { dpa[[k]] = list(qty.disp = length(catalogo[[k]]$Avble.yrs), m = length(datos[[k]]), frac.na = sum(is.na(datos[[k]]))/length(datos[[k]]), frac.ag = sum(datos[[k]] < 0, na.rm = T)/length(datos[[k]])) } pta = plyr::ldply(dpa, function(x) { c(x$qty.disp, x$m, x$frac.na, x$frac.ag) }) m.disp = max(pta[, 1]) pta[, 1] = pta[, 1]/m.disp pta[pta[, 1] <= 0.1, 1] = 0.1 pt.bg = rgb(colf(pta[, 3])/255, alpha = 0.75) leg.pt.bg = rgb(colf(rev(c(0.1, 0.25, 0.5, 0.75, 1)))/255, alpha = 0.75) par.save <- par(no.readonly = TRUE) layout(mat = matrix(c(1,1,1,2,3,4), ncol=2), widths = c(4,1), heights = c(2,2,1)) ptatruescale = par()$fin[1] * 0.66 if (!is.na(map.abb)) { ESS <- get.shape.state(map.abb) SHP.range = matrix(ncol = 4, nrow = length(ESS)) for (i in 1:length(ESS)) { d = slot(ESS, "polygons")[[i]] SHP.sub = matrix(ncol = 4, nrow = length(slot(d,"Polygons"))) for (j in 1:length(slot(d, "Polygons"))) { d.sub = slot(d, "Polygons")[[j]] d.sub = slot(d.sub, "coords") SHP.sub[j, 1:2] = range(d.sub[, 1]) SHP.sub[j, 3:4] = range(d.sub[, 2]) } d = matrix(apply(SHP.sub, 2, range), ncol = 4) SHP.range[i, 1:2] = diag(d[1:2, 1:2]) SHP.range[i, 3:4] = diag(d[1:2, 3:4]) } d = matrix(apply(SHP.range, 2, range), ncol = 2) D = rbind(d, D) # max betwen points and shape border } plot(axes = F, asp = 1, bty = "n", type = "n", range(D[,1]), range(D[, 2]), ylab = ylab, xlab = xlab) if (!is.na(map.abb)) { plot(add = T, axes = F, ESS, bg = map.bg, border = map.col, asp = 1) } points(pos, cex = ptatruescale * pt.cex * pta[, 1], bg = pt.bg, pch = pt.pch, col = pt.col) if (axis == T) { axis(1, col = lab.col, col.axis = lab.col) axis(2, col = lab.col, col.axis = lab.col) } if (missing(main)) { if ( length(catalogo) == 1) { main = "Station longevity" } else { main = "Stations longevity" } if ( ! is.na(map.abb) ) { estados.venezuela <- get.shape.state() main = paste(main, "for", paste(estados.venezuela[map.abb, "shape.name"], collapse = ", ")) } } title(main = main, col.main = lab.col,cex.main=2.5) long = round(c(0.1, 0.25, 0.5, 0.75, 1) * m.disp, 0) long = apply(cbind(c("<", "<", "<", "<", "<"), long), 1, paste0, collapse = "") par(mar = c(0.5,0.5,0,0.5) + 0.1, mai=c(0,0,1,0)) plot(c(-1,1), c(-1,6), typ='n', asp=1, axes=F, xlab=NA, ylab=NA) legend(x = -1, y = 5.9, legend = long, pt.cex = pt.cex * ptatruescale * c(0.2,0.25, 0.5, 0.75, 1), pch = 21, bg = leg.bg, pt.bg = NA, cex = 1.25, bty = "n", text.col = lab.col, y.intersp = leg.y.intersp, ) title(main = leg.title, cex.main = 1.45, font.main = 2) leg.lvl = seq(0, 100, by=5) leg.col = rgb(colf(rev(leg.lvl/100))/255, alpha = 0.75) print_ramp(leg.lvl, leg.col, main="Data %",mar = c(1,5,7.5,3.5)) par(mar = rep(0.5,4) + 0.1) plot(c(-1,1), c(-1,5), typ = 'n', asp = 1, axes = F, xlab = NA, ylab = NA) if (arrow.plot){ plotArrow(cex = arrow.cex) } par(par.save) }
testlist <- list(a = -2L, b = -11206656L, x = c(-63998L, NA, -49153L, 656801545L, -1L, 1560737791L, -12961222L, 976894522L, 691681850L, 976894522L, 976894522L, 976894522L, 976894522L, -1886417009L, -1886417009L, -1886417009L, -1886417009L, -1886417009L, -1886417009L, -1886388474L, -1886417009L, NA, -1886417009L, -1886417009L, -1886417009L, -1886417009L, -1886453513L, -1L, -53505L, -14804225L, -10872294L, -14745746L, 1028992767L, -65707L, 0L, 0L, 851967L, -215L, -250L, -20481L, -1L, -1L, 505085951L, -67207168L, 2097164L, 16777215L, 505085951L, 16777216L, 16383225L)) result <- do.call(grattan:::anyOutside,testlist) str(result)
/grattan/inst/testfiles/anyOutside/libFuzzer_anyOutside/anyOutside_valgrind_files/1610130805-test.R
no_license
akhikolla/updated-only-Issues
R
false
false
640
r
testlist <- list(a = -2L, b = -11206656L, x = c(-63998L, NA, -49153L, 656801545L, -1L, 1560737791L, -12961222L, 976894522L, 691681850L, 976894522L, 976894522L, 976894522L, 976894522L, -1886417009L, -1886417009L, -1886417009L, -1886417009L, -1886417009L, -1886417009L, -1886388474L, -1886417009L, NA, -1886417009L, -1886417009L, -1886417009L, -1886417009L, -1886453513L, -1L, -53505L, -14804225L, -10872294L, -14745746L, 1028992767L, -65707L, 0L, 0L, 851967L, -215L, -250L, -20481L, -1L, -1L, 505085951L, -67207168L, 2097164L, 16777215L, 505085951L, 16777216L, 16383225L)) result <- do.call(grattan:::anyOutside,testlist) str(result)
#file header #date #title #purpose #authors #assignment for class #required packages library(tidyverse) #set directory setwd("/Users/nicholashuron/Google Drive/") #read in pa invasives data invasives <- read_csv("./QuantSci_GP/data/PA_Invasive_Species/all_obs_imap_18Dec17_v2_0.csv") dim(invasives) #################################################################################################### ##Make a barchart of the proportional number of records for each species name. #Make this figure neat, clean and titled. Use aesthetics that are unique. #Note, I do not require you to plot all the species if you cannot get a good figure with so many species. #Hint: Use your title to explain what you are plotting. #################################################################################################### #check colnames to figure out where species names are found colnames(invasives) #state_scientific_name is a reliable name convention #find the number of unique species names in this column and order them for easy dups check by sight sort(unique(invasives$state_scientific_name)) #subset to only aquatic species aqua.invasives <- filter(invasives, invasives$natlhabitat=="Aquatic") #find the 25 aquatic species with the most observations aqua <- aqua.invasives %>% count(state_scientific_name, sort = T) %>% .[1:25,] #store in a new object aqua.invasives.top <- aqua.invasives %>% filter(state_scientific_name %in% aqua$state_scientific_name) #reorder the summary object aqua for plotting aqua$state_scientific_name <- factor(aqua$state_scientific_name, levels = aqua$state_scientific_name[order(-aqua$n)]) #plot relative proportional number of records for the top 25 species (version with counts) ggplot(data = aqua.invasives.top) + geom_bar(mapping = aes(x = reorder(x = state_scientific_name,X = -table(state_scientific_name)[state_scientific_name]), group=factor(0), y = ..prop.., fill = factor(..x..)), show.legend=FALSE) + coord_flip() + labs(y = "Proportion of Observations", x = "Invasive Species", title = "Proportional Prevalance Among the Top Twenty-Five \nMost Sighted Invasive Aquatic Species in PA") #version with summary table instead (minus sign is missing in reorder to do descending order) ggplot(data = aqua) + geom_bar(mapping = aes(x = reorder(state_scientific_name, n), y = (n/sum(n)), fill = factor(..x..)), stat = "identity", show.legend=FALSE) + coord_flip() + labs(y = "Proportion of Observations", x = "Invasive Species", title = "Proportional Prevalance Among the Top Twenty-Five \nMost Sighted Invasive Aquatic Species in PA") #################################################################################################### ##In a single plot (facets are encouraged), summarize the relationship between two or more variables of your choosing. #Use color, shape changes or other techniques you learned in Chapter 3. #Make your figures unique as it is unlikely that two people would code the exact same thing... #################################################################################################### invasives.co <- invasives %>% count(County, sort=T) invasives.sc <- invasives %>% count(state_scientific_name, sort = T) invasives.na <- invasives %>% count(natlhabitat, sort=T) invasives$County <- factor(invasives$County, levels = unique(invasives$County[order(invasives$County, decreasing = T)])) ggplot(data = invasives) + geom_bar(mapping = aes(x = reorder(County, table(County)[County]), group = factor(0), fill= factor(..x..)), show.legend = FALSE) + coord_flip() + facet_wrap(~natlhabitat) + labs(y = "Invasive Species Observations", x = "County (Pennsylvania)", title ="Aquatic and Terrestrial Invasive Species Sightings by County") ggplot(data = invasives) + geom_bar(mapping = aes(x = County, group = factor(0), fill= factor(..x..)), show.legend = FALSE) + coord_flip() + facet_wrap(~natlhabitat) + labs(y = "Invasive Species Observations", x = "County (Pennsylvania)", title ="Aquatic and Terrestrial Invasive Species Sightings by County")
/invasives_.R
no_license
nahuron/QSGP
R
false
false
4,059
r
#file header #date #title #purpose #authors #assignment for class #required packages library(tidyverse) #set directory setwd("/Users/nicholashuron/Google Drive/") #read in pa invasives data invasives <- read_csv("./QuantSci_GP/data/PA_Invasive_Species/all_obs_imap_18Dec17_v2_0.csv") dim(invasives) #################################################################################################### ##Make a barchart of the proportional number of records for each species name. #Make this figure neat, clean and titled. Use aesthetics that are unique. #Note, I do not require you to plot all the species if you cannot get a good figure with so many species. #Hint: Use your title to explain what you are plotting. #################################################################################################### #check colnames to figure out where species names are found colnames(invasives) #state_scientific_name is a reliable name convention #find the number of unique species names in this column and order them for easy dups check by sight sort(unique(invasives$state_scientific_name)) #subset to only aquatic species aqua.invasives <- filter(invasives, invasives$natlhabitat=="Aquatic") #find the 25 aquatic species with the most observations aqua <- aqua.invasives %>% count(state_scientific_name, sort = T) %>% .[1:25,] #store in a new object aqua.invasives.top <- aqua.invasives %>% filter(state_scientific_name %in% aqua$state_scientific_name) #reorder the summary object aqua for plotting aqua$state_scientific_name <- factor(aqua$state_scientific_name, levels = aqua$state_scientific_name[order(-aqua$n)]) #plot relative proportional number of records for the top 25 species (version with counts) ggplot(data = aqua.invasives.top) + geom_bar(mapping = aes(x = reorder(x = state_scientific_name,X = -table(state_scientific_name)[state_scientific_name]), group=factor(0), y = ..prop.., fill = factor(..x..)), show.legend=FALSE) + coord_flip() + labs(y = "Proportion of Observations", x = "Invasive Species", title = "Proportional Prevalance Among the Top Twenty-Five \nMost Sighted Invasive Aquatic Species in PA") #version with summary table instead (minus sign is missing in reorder to do descending order) ggplot(data = aqua) + geom_bar(mapping = aes(x = reorder(state_scientific_name, n), y = (n/sum(n)), fill = factor(..x..)), stat = "identity", show.legend=FALSE) + coord_flip() + labs(y = "Proportion of Observations", x = "Invasive Species", title = "Proportional Prevalance Among the Top Twenty-Five \nMost Sighted Invasive Aquatic Species in PA") #################################################################################################### ##In a single plot (facets are encouraged), summarize the relationship between two or more variables of your choosing. #Use color, shape changes or other techniques you learned in Chapter 3. #Make your figures unique as it is unlikely that two people would code the exact same thing... #################################################################################################### invasives.co <- invasives %>% count(County, sort=T) invasives.sc <- invasives %>% count(state_scientific_name, sort = T) invasives.na <- invasives %>% count(natlhabitat, sort=T) invasives$County <- factor(invasives$County, levels = unique(invasives$County[order(invasives$County, decreasing = T)])) ggplot(data = invasives) + geom_bar(mapping = aes(x = reorder(County, table(County)[County]), group = factor(0), fill= factor(..x..)), show.legend = FALSE) + coord_flip() + facet_wrap(~natlhabitat) + labs(y = "Invasive Species Observations", x = "County (Pennsylvania)", title ="Aquatic and Terrestrial Invasive Species Sightings by County") ggplot(data = invasives) + geom_bar(mapping = aes(x = County, group = factor(0), fill= factor(..x..)), show.legend = FALSE) + coord_flip() + facet_wrap(~natlhabitat) + labs(y = "Invasive Species Observations", x = "County (Pennsylvania)", title ="Aquatic and Terrestrial Invasive Species Sightings by County")
# 1. Reading in data # Define variables specific to input files and plots input <- "../household_power_consumption.txt" time.format <- "%d/%m/%Y %H:%M:%S" start <- "01/02/2007 00:00:00" end <- "02/02/2007 23:59:00" col.classes <- c(rep("character", 2), rep("numeric", 7)) # Read the first line of the file & find the first recorded date and time dat0 <- read.csv(input, header = T, sep = ";", na.strings = "?", colClasses = col.classes, nrows = 1) date0 <- dat0$Date[1] time0 <- dat0$Time[1] d0 <- strptime(paste(c(date0, time0), collapse = " "), time.format) var.names <- colnames(dat0) # save column names # Calculate the corresponding rows for the target date and time from difference # in minute because data are recorded with a one-minute sampling rate. d1 <- strptime(start, time.format) # start point d2 <- strptime(end, time.format) # end point row.skip <- as.integer(difftime(d1, d0, units = "mins")) row.read <- as.integer(difftime(d2, d1, units = "mins") + 1) # Read the rows between the specified start and end dates & times dat <- read.csv(input, header = T, sep = ";", na.strings = "?", colClasses = col.classes, col.names = var.names, skip = row.skip, nrows = row.read) # 2. data transformations # Combine "Date" and "Time" columns and convert it to POSIXlt format dat$Date <- paste(dat$Date, dat$Time, sep = " ") dat$Date <- strptime(dat$Date, time.format) # 3. plotting graph png(file = "plot3.png", width = 480, height = 480, units = "px") with(dat, plot(Date, Sub_metering_1, type = "l", col = "black", xlab = NA, ylab = "Energy sub metering")) with(dat, lines(Date, Sub_metering_2, type = "l", col = "red")) with(dat, lines(Date, Sub_metering_3, type = "l", col = "blue")) legend("topright", lty = 1, col = c("black", "red", "blue"), legend = c("Sub_metering_1", "Sub_metering_2", "Sub_metering_3")) dev.off()
/plot3.R
no_license
ZZen427/ExData_Plotting1
R
false
false
1,915
r
# 1. Reading in data # Define variables specific to input files and plots input <- "../household_power_consumption.txt" time.format <- "%d/%m/%Y %H:%M:%S" start <- "01/02/2007 00:00:00" end <- "02/02/2007 23:59:00" col.classes <- c(rep("character", 2), rep("numeric", 7)) # Read the first line of the file & find the first recorded date and time dat0 <- read.csv(input, header = T, sep = ";", na.strings = "?", colClasses = col.classes, nrows = 1) date0 <- dat0$Date[1] time0 <- dat0$Time[1] d0 <- strptime(paste(c(date0, time0), collapse = " "), time.format) var.names <- colnames(dat0) # save column names # Calculate the corresponding rows for the target date and time from difference # in minute because data are recorded with a one-minute sampling rate. d1 <- strptime(start, time.format) # start point d2 <- strptime(end, time.format) # end point row.skip <- as.integer(difftime(d1, d0, units = "mins")) row.read <- as.integer(difftime(d2, d1, units = "mins") + 1) # Read the rows between the specified start and end dates & times dat <- read.csv(input, header = T, sep = ";", na.strings = "?", colClasses = col.classes, col.names = var.names, skip = row.skip, nrows = row.read) # 2. data transformations # Combine "Date" and "Time" columns and convert it to POSIXlt format dat$Date <- paste(dat$Date, dat$Time, sep = " ") dat$Date <- strptime(dat$Date, time.format) # 3. plotting graph png(file = "plot3.png", width = 480, height = 480, units = "px") with(dat, plot(Date, Sub_metering_1, type = "l", col = "black", xlab = NA, ylab = "Energy sub metering")) with(dat, lines(Date, Sub_metering_2, type = "l", col = "red")) with(dat, lines(Date, Sub_metering_3, type = "l", col = "blue")) legend("topright", lty = 1, col = c("black", "red", "blue"), legend = c("Sub_metering_1", "Sub_metering_2", "Sub_metering_3")) dev.off()
library(yaml) library(tidyverse) library(glue) library(rprojroot) score_submission <- function(submission_filename) { answers <- yaml.load_file(submission_filename) high_cellline <- answers$high_cellline cms_match <- answers$cms_match if (high_cellline == "T-47D" & cms_match == "no") { msg <- glue( "Your interpretation matches what I found — T-47D appears to have a ", "greater abundance of clutches and motors, based on the expression of ", "37 cell adhesion and 68 myosin genes, respectively. Based on this ", "assumption, I would expect this cell line to exhibit greater motility ", "in the higher stiffness condition — but that's not the case." ) } else if (high_cellline == "MDA-MB-231" & cms_match == "yes") { msg <- glue( "I can see how, if you interpreted MDA-MB-231 as the 'high motors and ", "clutches' cell line, then the fact that this cell line to exhibits ", "greater motility in the higher stiffness condition would indeed match ", "the CMS predictions. However, it's tough to justify that assumption ", "based on the expression of 37 cell adhesion and 68 myosin genes, ", "respectively, that we examined here." ) } else { msg <- glue( "I'm not sure how you reached that particular conclusion. Check out ", "some of the other submissions for a couple interpretations that we'd ", "expect to see, given the data used." ) } answers["comment"] <- msg answers }
/modules/module7/.eval/eval_fxn.R
permissive
milen-sage/minidream-challenge
R
false
false
1,516
r
library(yaml) library(tidyverse) library(glue) library(rprojroot) score_submission <- function(submission_filename) { answers <- yaml.load_file(submission_filename) high_cellline <- answers$high_cellline cms_match <- answers$cms_match if (high_cellline == "T-47D" & cms_match == "no") { msg <- glue( "Your interpretation matches what I found — T-47D appears to have a ", "greater abundance of clutches and motors, based on the expression of ", "37 cell adhesion and 68 myosin genes, respectively. Based on this ", "assumption, I would expect this cell line to exhibit greater motility ", "in the higher stiffness condition — but that's not the case." ) } else if (high_cellline == "MDA-MB-231" & cms_match == "yes") { msg <- glue( "I can see how, if you interpreted MDA-MB-231 as the 'high motors and ", "clutches' cell line, then the fact that this cell line to exhibits ", "greater motility in the higher stiffness condition would indeed match ", "the CMS predictions. However, it's tough to justify that assumption ", "based on the expression of 37 cell adhesion and 68 myosin genes, ", "respectively, that we examined here." ) } else { msg <- glue( "I'm not sure how you reached that particular conclusion. Check out ", "some of the other submissions for a couple interpretations that we'd ", "expect to see, given the data used." ) } answers["comment"] <- msg answers }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/chromfx.R \name{readPeakSummits} \alias{readPeakSummits} \title{readPeakSummits} \usage{ readPeakSummits(psum, genome = "hg38") } \arguments{ \item{psum}{paths to sample peak summits bed file} \item{genome}{reference genome, either "hg38 (default) or "mm10"} } \value{ GRanges } \description{ function that reads ATAC peaks summits } \keyword{peaks}
/man/readPeakSummits.Rd
no_license
DoaneAS/chromfx
R
false
true
429
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/chromfx.R \name{readPeakSummits} \alias{readPeakSummits} \title{readPeakSummits} \usage{ readPeakSummits(psum, genome = "hg38") } \arguments{ \item{psum}{paths to sample peak summits bed file} \item{genome}{reference genome, either "hg38 (default) or "mm10"} } \value{ GRanges } \description{ function that reads ATAC peaks summits } \keyword{peaks}
#MINISTERIO DEL TRABAJO Y PROMOCIÓN DEL EMPLEO rm(list = ls()) # limpia la memoria de trabajo library(tidyverse) #instala además 8 paquetes adicionales #library(readr) #library(stringr) # manejador de string (objeto, patron) #library(dplyr) #library(tidyr) #library(purrr) #library(ggplot2) #library(forcats) #library(tibble) library(xml2) library(rvest) library(RSelenium) #escrapea paginas dinámicas library(wdman) # Navegación fantasma para rselenium library(robotstxt) library(binman) library(tm) # text mining library(NLP) library(pdftools) library(tesseract) library(magick) URL<-"http://69.10.39.53/SISCAS/externo/portal/ConvocatoriasPortal.aspx" # Defrente al Iframe vamos #Preguntar si esta premitio bajar los datos de la web #paths_allowed(paths = c(URL)) # get_robotstxt(URL) # otra forma de preguntar # #acceptAlert() #Acepta el cuadro de diálogo de alerta que se muestra actualmente #equivale a hacer clic el botón "Aceptar" en el cuadro de diálogo #dismissAlert() #Descarta el cuadro de diálogo de alerta que se muestra actualmente en la página #Para los cuadros de diálogo confirmar () y preguntar (),esto equivale a hacer clic en el botón "Cancelar" #Para los cuadros de diálogo alert (), esto es equivalente hacer clic en el botón "Aceptar" # Asignamos como encondig a UTF-8 options(encoding = "utf-8") #Abrimos una sesion en la web # Ejecutamos el servidor phantomjs -creamos un navegador fantasma server<-phantomjs(port=5011L) #Abrimos el navegador Browser <- remoteDriver(browserName = "phantomjs", port=5011L) Browser$open() #Navegar la página web que guardamos Browser$navigate(URL) Browser$screenshot(display=TRUE) #Muéstrame en foto de la página # No hay boton de alerta, por lo tanto, # Eligimos los años NodoYears<-Browser$findElement(using = 'xpath', value='//*[@id="ddlanio"]') Year<-NodoYears$selectTag() Year$value[7] # año 2019 #Years<-NodoYears$getElementText() # Introducimos el año que queremos txtYear<- Browser$findElement(using = 'css', "#ddlanio") txtYear$clickElement() txtYear$sendKeysToElement(list(Year$value[7])) # le dije el año 2019 Browser$screenshot(display = TRUE) # Eligimos los meses NodoMonths<-Browser$findElement(using = 'xpath', value='//*[@id="ddlmes"]') Meses<-NodoMonths$selectTag() Meses$text[1] # Me da el mes que elijo #Ver previamente en que meses hacer click y buscar información #Meses: Febrero(2Hojas),Abril(4), Mayo(7), junio(3), Julio(10),Agosto(10), #Setiembre(10),Octubre(10),Noviembre(9) y Diciembre(2) #Nos ingeniamos para buscar solo lo que queremos, para el bucle Mesclick<-c(2,4,5:12) # Creamos el numero que corresponde a los meses Mesclick<-as.list(Mesclick) # convertimos a lista para indexar Meses$text[Mesclick[[1]]] # Probamos la indexación length(Mesclick) # Para saber cuántas veces indexar el mes #Introducimos el mes txtMes<- Browser$findElement(using = 'css', "#ddlmes") txtMes$clickElement() txtMes$sendKeysToElement(list(Meses$text[Mesclick[[1]]])) # le dije el mes que está indexada Browser$screenshot(display = TRUE) # Hacer clic en Buscar y ver cuántas hojas tiene cada mes Buscar<- Browser$findElement(using = 'xpath', value = "//input[@id='btnbuscar']") Buscar$clickElement() Browser$screenshot(display = TRUE) #Hacer clic en siguiente y anterior, es indistinto, pero es lógico, inicia con siguente Siguiente<-Browser$findElement(using = "xpath", value = "//*[@id='PaginadoControl1']") Siguiente$clickElement() Browser$screenshot(display = TRUE) # Hacer clic en anterior ##Anterior<-browser$findElement(using = "xpath", ## value = "//input[@id='ctl00_cphBodyMain_reserva1_btnanterior']") ##Anterior$clickElement() ##browser$screenshot(display = TRUE) #----Parte Rvest individual #---- # Ahora podemos bajar información con rvest sobre la web actual Pagina_actual<-Browser$getPageSource() # Extraemos sólo el texto de la hoja N° 01 Hoja1<-read_html(Pagina_actual[[1]])%>% # el elemento 1 de la lista esta la url de la página actual html_nodes(css = ".etiketa")%>% html_text()%>% str_remove("AÑO")%>% str_remove("MES")%>% str_remove_all("Bases")%>% str_remove_all("Anexos")%>% str_remove_all("Resultado Final")%>% str_remove_all("Resultado de Evaluación Curricular")%>% str_subset("[:alnum:]")%>%# Extrea sólo los afanúmericos, sin los saltos str_replace_all("\n","")%>% str_trim() #Meses: Febrero(2Hojas),Abril(4), Mayo(7), junio(3), Julio(10),Agosto(10), #Setiembre(10),Octubre(10),Noviembre(9) y Diciembre(2) Hojas<-c(2,4,7,3,10,10,10,10,9,2) Hojas<-as.list(Hojas) # Servirá para el bucle que extraiga información de las hojas de cada mes # Extraemos los link de los pdf para leerlos (Hoja 1) #CAS%20008-2019%20-%20SECRETARIA%20REGIONAL%20-%20CAJAMARCA.pdf #PDF DE REQUISITOS Hoja1_linkPdf<-read_html(Pagina_actual[[1]])%>% html_nodes(".etiketa")%>% html_nodes("input")%>% html_attr("value")%>% str_subset("[:alnum:]")%>% str_trim() Hoja1_linkPdf[1] # No podemos acceder a los pdfs desde R, ¿? #De aquí para adelante ya no funciona UrlMadrePdf<-"http://sdv.midis.gob.pe/sis_rrhh/externo/portal/convocatoriasportal.aspx/" ReadPDF_MIDIS<-pdf_ocr_text(paste0(UrlMadrePdf,Hoja1_linkPdf[1]),pages = c(1:2),language = "spa") #Pagina_actual<-Browser$getPageSource() #obtener de la página actual # Nos quedamos aquí # siempre cerrar la sesión Browser$close() server$stop()
/R script/ScriptMTPE19_Rs.R
no_license
manosaladata/DataSet-CAS-PERU
R
false
false
5,538
r
#MINISTERIO DEL TRABAJO Y PROMOCIÓN DEL EMPLEO rm(list = ls()) # limpia la memoria de trabajo library(tidyverse) #instala además 8 paquetes adicionales #library(readr) #library(stringr) # manejador de string (objeto, patron) #library(dplyr) #library(tidyr) #library(purrr) #library(ggplot2) #library(forcats) #library(tibble) library(xml2) library(rvest) library(RSelenium) #escrapea paginas dinámicas library(wdman) # Navegación fantasma para rselenium library(robotstxt) library(binman) library(tm) # text mining library(NLP) library(pdftools) library(tesseract) library(magick) URL<-"http://69.10.39.53/SISCAS/externo/portal/ConvocatoriasPortal.aspx" # Defrente al Iframe vamos #Preguntar si esta premitio bajar los datos de la web #paths_allowed(paths = c(URL)) # get_robotstxt(URL) # otra forma de preguntar # #acceptAlert() #Acepta el cuadro de diálogo de alerta que se muestra actualmente #equivale a hacer clic el botón "Aceptar" en el cuadro de diálogo #dismissAlert() #Descarta el cuadro de diálogo de alerta que se muestra actualmente en la página #Para los cuadros de diálogo confirmar () y preguntar (),esto equivale a hacer clic en el botón "Cancelar" #Para los cuadros de diálogo alert (), esto es equivalente hacer clic en el botón "Aceptar" # Asignamos como encondig a UTF-8 options(encoding = "utf-8") #Abrimos una sesion en la web # Ejecutamos el servidor phantomjs -creamos un navegador fantasma server<-phantomjs(port=5011L) #Abrimos el navegador Browser <- remoteDriver(browserName = "phantomjs", port=5011L) Browser$open() #Navegar la página web que guardamos Browser$navigate(URL) Browser$screenshot(display=TRUE) #Muéstrame en foto de la página # No hay boton de alerta, por lo tanto, # Eligimos los años NodoYears<-Browser$findElement(using = 'xpath', value='//*[@id="ddlanio"]') Year<-NodoYears$selectTag() Year$value[7] # año 2019 #Years<-NodoYears$getElementText() # Introducimos el año que queremos txtYear<- Browser$findElement(using = 'css', "#ddlanio") txtYear$clickElement() txtYear$sendKeysToElement(list(Year$value[7])) # le dije el año 2019 Browser$screenshot(display = TRUE) # Eligimos los meses NodoMonths<-Browser$findElement(using = 'xpath', value='//*[@id="ddlmes"]') Meses<-NodoMonths$selectTag() Meses$text[1] # Me da el mes que elijo #Ver previamente en que meses hacer click y buscar información #Meses: Febrero(2Hojas),Abril(4), Mayo(7), junio(3), Julio(10),Agosto(10), #Setiembre(10),Octubre(10),Noviembre(9) y Diciembre(2) #Nos ingeniamos para buscar solo lo que queremos, para el bucle Mesclick<-c(2,4,5:12) # Creamos el numero que corresponde a los meses Mesclick<-as.list(Mesclick) # convertimos a lista para indexar Meses$text[Mesclick[[1]]] # Probamos la indexación length(Mesclick) # Para saber cuántas veces indexar el mes #Introducimos el mes txtMes<- Browser$findElement(using = 'css', "#ddlmes") txtMes$clickElement() txtMes$sendKeysToElement(list(Meses$text[Mesclick[[1]]])) # le dije el mes que está indexada Browser$screenshot(display = TRUE) # Hacer clic en Buscar y ver cuántas hojas tiene cada mes Buscar<- Browser$findElement(using = 'xpath', value = "//input[@id='btnbuscar']") Buscar$clickElement() Browser$screenshot(display = TRUE) #Hacer clic en siguiente y anterior, es indistinto, pero es lógico, inicia con siguente Siguiente<-Browser$findElement(using = "xpath", value = "//*[@id='PaginadoControl1']") Siguiente$clickElement() Browser$screenshot(display = TRUE) # Hacer clic en anterior ##Anterior<-browser$findElement(using = "xpath", ## value = "//input[@id='ctl00_cphBodyMain_reserva1_btnanterior']") ##Anterior$clickElement() ##browser$screenshot(display = TRUE) #----Parte Rvest individual #---- # Ahora podemos bajar información con rvest sobre la web actual Pagina_actual<-Browser$getPageSource() # Extraemos sólo el texto de la hoja N° 01 Hoja1<-read_html(Pagina_actual[[1]])%>% # el elemento 1 de la lista esta la url de la página actual html_nodes(css = ".etiketa")%>% html_text()%>% str_remove("AÑO")%>% str_remove("MES")%>% str_remove_all("Bases")%>% str_remove_all("Anexos")%>% str_remove_all("Resultado Final")%>% str_remove_all("Resultado de Evaluación Curricular")%>% str_subset("[:alnum:]")%>%# Extrea sólo los afanúmericos, sin los saltos str_replace_all("\n","")%>% str_trim() #Meses: Febrero(2Hojas),Abril(4), Mayo(7), junio(3), Julio(10),Agosto(10), #Setiembre(10),Octubre(10),Noviembre(9) y Diciembre(2) Hojas<-c(2,4,7,3,10,10,10,10,9,2) Hojas<-as.list(Hojas) # Servirá para el bucle que extraiga información de las hojas de cada mes # Extraemos los link de los pdf para leerlos (Hoja 1) #CAS%20008-2019%20-%20SECRETARIA%20REGIONAL%20-%20CAJAMARCA.pdf #PDF DE REQUISITOS Hoja1_linkPdf<-read_html(Pagina_actual[[1]])%>% html_nodes(".etiketa")%>% html_nodes("input")%>% html_attr("value")%>% str_subset("[:alnum:]")%>% str_trim() Hoja1_linkPdf[1] # No podemos acceder a los pdfs desde R, ¿? #De aquí para adelante ya no funciona UrlMadrePdf<-"http://sdv.midis.gob.pe/sis_rrhh/externo/portal/convocatoriasportal.aspx/" ReadPDF_MIDIS<-pdf_ocr_text(paste0(UrlMadrePdf,Hoja1_linkPdf[1]),pages = c(1:2),language = "spa") #Pagina_actual<-Browser$getPageSource() #obtener de la página actual # Nos quedamos aquí # siempre cerrar la sesión Browser$close() server$stop()
moving_average_plot <- function(mavg_data){ ggplot(mavg_data, aes(x=Index, ymax=Average, ymin=AVG)) + geom_ribbon(fill="blue") + theme_minimal() }
/R/moving_average_plot.R
no_license
bayesball/BayesTestStreak
R
false
false
165
r
moving_average_plot <- function(mavg_data){ ggplot(mavg_data, aes(x=Index, ymax=Average, ymin=AVG)) + geom_ribbon(fill="blue") + theme_minimal() }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/plotmclust.R \name{plotmclust} \alias{plotmclust} \title{plotmclust} \usage{ plotmclust( mclustobj, x = 1, y = 2, MSTorder = NULL, show_tree = T, show_full_tree = F, show_cell_names = F, cell_name_size = 3, cell_point_size = 3, markerexpr = NULL, showcluster = T ) } \arguments{ \item{mclustobj}{The exact output of \code{\link{exprmclust}} function.} \item{x}{The column of data after dimension reduction to be plotted on the horizontal axis.} \item{y}{The column of data after dimension reduction to be plotted on the vertical axis.} \item{MSTorder}{The arbitrary order of cluster to be shown on the plot.} \item{show_tree}{Whether to show the links between cells connected in the minimum spanning tree.} \item{show_full_tree}{Whether to show the full tree or not. Only useful when show_tree=T. Overrides MSTorder.} \item{show_cell_names}{Whether to draw the name of each cell in the plot.} \item{cell_name_size}{The size of cell name labels if show_cell_names is TRUE.} \item{cell_point_size}{The size of cell point.} \item{markerexpr}{The gene expression used to define the size of nodes.} } \value{ A ggplot2 object. } \description{ Plot the model-based clustering results } \details{ This function will plot the gene expression data after dimension reduction and show the clustering results. } \examples{ data(lpsdata) procdata <- preprocess(lpsdata) lpsmclust <- exprmclust(procdata) plotmclust(lpsmclust) } \author{ Zhicheng Ji, Hongkai Ji <zji4@zji4.edu> }
/man/plotmclust.Rd
no_license
wangyadong-bio/TSCAN
R
false
true
1,575
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/plotmclust.R \name{plotmclust} \alias{plotmclust} \title{plotmclust} \usage{ plotmclust( mclustobj, x = 1, y = 2, MSTorder = NULL, show_tree = T, show_full_tree = F, show_cell_names = F, cell_name_size = 3, cell_point_size = 3, markerexpr = NULL, showcluster = T ) } \arguments{ \item{mclustobj}{The exact output of \code{\link{exprmclust}} function.} \item{x}{The column of data after dimension reduction to be plotted on the horizontal axis.} \item{y}{The column of data after dimension reduction to be plotted on the vertical axis.} \item{MSTorder}{The arbitrary order of cluster to be shown on the plot.} \item{show_tree}{Whether to show the links between cells connected in the minimum spanning tree.} \item{show_full_tree}{Whether to show the full tree or not. Only useful when show_tree=T. Overrides MSTorder.} \item{show_cell_names}{Whether to draw the name of each cell in the plot.} \item{cell_name_size}{The size of cell name labels if show_cell_names is TRUE.} \item{cell_point_size}{The size of cell point.} \item{markerexpr}{The gene expression used to define the size of nodes.} } \value{ A ggplot2 object. } \description{ Plot the model-based clustering results } \details{ This function will plot the gene expression data after dimension reduction and show the clustering results. } \examples{ data(lpsdata) procdata <- preprocess(lpsdata) lpsmclust <- exprmclust(procdata) plotmclust(lpsmclust) } \author{ Zhicheng Ji, Hongkai Ji <zji4@zji4.edu> }
c DCNF-Autarky [version 0.0.1]. c Copyright (c) 2018-2019 Swansea University. c c Input Clause Count: 2195 c Performing E1-Autarky iteration. c Remaining clauses count after E-Reduction: 2195 c c Input Parameter (command line, file): c input filename QBFLIB/Jordan-Kaiser/reduction-finding-full-set-params-k1c3n4/query50_query71_1344n.qdimacs c output filename /tmp/dcnfAutarky.dimacs c autarky level 1 c conformity level 0 c encoding type 2 c no.of var 913 c no.of clauses 2195 c no.of taut cls 0 c c Output Parameters: c remaining no.of clauses 2195 c c QBFLIB/Jordan-Kaiser/reduction-finding-full-set-params-k1c3n4/query50_query71_1344n.qdimacs 913 2195 E1 [] 0 70 843 2195 NONE
/code/dcnf-ankit-optimized/Results/QBFLIB-2018/E1/Experiments/Jordan-Kaiser/reduction-finding-full-set-params-k1c3n4/query50_query71_1344n/query50_query71_1344n.R
no_license
arey0pushpa/dcnf-autarky
R
false
false
710
r
c DCNF-Autarky [version 0.0.1]. c Copyright (c) 2018-2019 Swansea University. c c Input Clause Count: 2195 c Performing E1-Autarky iteration. c Remaining clauses count after E-Reduction: 2195 c c Input Parameter (command line, file): c input filename QBFLIB/Jordan-Kaiser/reduction-finding-full-set-params-k1c3n4/query50_query71_1344n.qdimacs c output filename /tmp/dcnfAutarky.dimacs c autarky level 1 c conformity level 0 c encoding type 2 c no.of var 913 c no.of clauses 2195 c no.of taut cls 0 c c Output Parameters: c remaining no.of clauses 2195 c c QBFLIB/Jordan-Kaiser/reduction-finding-full-set-params-k1c3n4/query50_query71_1344n.qdimacs 913 2195 E1 [] 0 70 843 2195 NONE
#' bio17: Calculate precipitation of the driest quarter. #' #' @description `bio17` is used to calculate the total precipitation in the #' driest quarter of the year #' #' @param prec a vector of precipitation values, normally for one year (see #' details). #' @param tme a `POSIXlt` object representing the date and time of each `prec` #' value. #' #' @return a single numeric value of total precipitation of the driest quarter. #' @export #' #' @details Precipitation in quarter is calculated and total #' precipitation in the driest quarter returned. If data span more than one #' year, calculations are performed on all data and single value returned. #' #' @seealso the [tmecreate()] function can be used to create a POSIXlt object. #' #' @examples #' tme <- tmecreate(2010, 1) #' plot(hourly_precip~as.POSIXct(tme), type = "l", xlab = "Month", #' ylab = "Precipitation") #' bio17(hourly_precip, tme) bio17 <- function(prec, tme) { if (is.na(sd(prec, na.rm = TRUE))) pdry <- NA else { if (length(unique(tme$year)) > 1) warnb() qtr <- function(i, int) { pw <- c(prec, prec) su <- sum(pw[i: (i + int)], na.rm = TRUE) su } id <- (as.numeric(tme[2]) - as.numeric(tme[1])) / 86400 int <- 91 / id dq <- sapply(c(1:length(prec)), qtr, int) i <- which(dq == min(dq, na.rm = TRUE))[1] pre2 <- c(prec, prec) pdry <- sum(pre2[i:(i + int)], na.rm = TRUE) } return(pdry) }
/R/bio17.R
no_license
everydayduffy/climvars
R
false
false
1,432
r
#' bio17: Calculate precipitation of the driest quarter. #' #' @description `bio17` is used to calculate the total precipitation in the #' driest quarter of the year #' #' @param prec a vector of precipitation values, normally for one year (see #' details). #' @param tme a `POSIXlt` object representing the date and time of each `prec` #' value. #' #' @return a single numeric value of total precipitation of the driest quarter. #' @export #' #' @details Precipitation in quarter is calculated and total #' precipitation in the driest quarter returned. If data span more than one #' year, calculations are performed on all data and single value returned. #' #' @seealso the [tmecreate()] function can be used to create a POSIXlt object. #' #' @examples #' tme <- tmecreate(2010, 1) #' plot(hourly_precip~as.POSIXct(tme), type = "l", xlab = "Month", #' ylab = "Precipitation") #' bio17(hourly_precip, tme) bio17 <- function(prec, tme) { if (is.na(sd(prec, na.rm = TRUE))) pdry <- NA else { if (length(unique(tme$year)) > 1) warnb() qtr <- function(i, int) { pw <- c(prec, prec) su <- sum(pw[i: (i + int)], na.rm = TRUE) su } id <- (as.numeric(tme[2]) - as.numeric(tme[1])) / 86400 int <- 91 / id dq <- sapply(c(1:length(prec)), qtr, int) i <- which(dq == min(dq, na.rm = TRUE))[1] pre2 <- c(prec, prec) pdry <- sum(pre2[i:(i + int)], na.rm = TRUE) } return(pdry) }
par(family = "serif", font = 2) pacman::p_load(teachingApps) library(SMRD) ShockAbsorber.ld <- frame.to.ld(shockabsorber, response.column = 1, censor.column = 3, time.units = "Kilometers")
/inst/apps/shock_absorber8/global.R
no_license
Ammar-K/SMRD
R
false
false
237
r
par(family = "serif", font = 2) pacman::p_load(teachingApps) library(SMRD) ShockAbsorber.ld <- frame.to.ld(shockabsorber, response.column = 1, censor.column = 3, time.units = "Kilometers")
### type 1 error args <- commandArgs(TRUE) core.i <- as.numeric(args) # load packages, functions path="/users/PAS1149/osu10039/PAS1149/qldeng/AF_data/june_simulations" setwd(paste0(path,"/","code","/","functions")) source("af_functions_noz.R") n = 1000 # sample size betaz = 0 # effect of covariates t <- 100 # traits cor_matrix = "cs" # correlation structure rho = 0.3 # correlation strength rep <- 50 # permutation for each core # matrix/vectors save results pval_AF_comb <- matrix(NA,nrow = rep,ncol = 3) pval_minP <- rep(NA,rep) pval_MANOVA <- rep(NA,rep) pval_SPU <- matrix(NA,nrow = rep,ncol = 10) pval_SPU_ex <- matrix(NA,nrow = rep,ncol = 10) pval_MSKAT <- matrix(NA,nrow = rep,ncol = 2) pval_TATES <- rep(NA,rep) pval_MultiPhen <- rep(NA,rep) for(i in (1:rep)){ print(i) set.seed(core.i*1000 + i) # random seed # type1: null beta beta <- rep(0,t) sim <- SIM_covariate_power_Z(betaz=betaz,constr = cor_matrix,beta,traits = t,cat_ratio =0,cor=rho,n.cov = 2, MAF = 0.3) # do PCA Y.res <- sim$Y X.res <- sim$X Y.pca <- Y_PCA(Y.res) ## Score test score <- score_test(cbind(Y.pca,Y.res),X.res,n) ###################### Original AF ###################### ## AF w./ PCA PCA_res <- AdaptiveFisher_combo(score$p_l[,1:t],score$p_u[,1:t]) p_perm_pcares <- matrix(PCA_res$P_vector,ncol = 1) # AF w.o. PCA AF <- AdaptiveFisher_combo(score$p_l[,-(1:t)],score$p_u[,-(1:t)]) p_perm_af <- matrix(AF$P_vector,ncol = 1) # combine combo <- AdaptiveFisher_compute(cbind(p_perm_af,p_perm_pcares)) pval_AF_comb[i,1] <- combo$`AF P_value` # record each method's p-value and min pval_AF_comb[i,2] <- PCA_res$AF_pvalue pval_AF_comb[i,3] <- AF$AF_pvalue #################### Other Methods ####################### ### minP ### p_matrix_2side <- 2*pnorm(abs(qnorm(score$p_l[,-(1:t)])),lower.tail = FALSE) pval_minP[i] <- min_p(p_matrix_2side)$p.min ### SPUs & aSPU ### invisible(capture.output(suppressMessages(pan<-GEEaSPU(traits = sim$Y,geno = sim$X,model = "gaussian")))) pval_SPU[i,] <- pan[1:10] invisible(capture.output(suppressMessages(pan<-GEEaSPU(traits = sim$Y,geno = sim$X,model = "gaussian",corstr = "exchangeable")))) pval_SPU_ex[i,] <- pan[1:10] ### MSKAT ### X_matrix <- matrix(sim$X,ncol = 1) SKAT <- MSKAT(MSKAT.cnull(sim$Y,X=NULL), X_matrix, W.beta=c(1,25)) pval_MSKAT[i,] <- SKAT #### MANOVA #### man <- manova(sim$Y~sim$X) pval_MANOVA[i] <- summary(man)$stats["sim$X","Pr(>F)"] ### TATES ### TATEs <- TATES(sim$Y,score$p_l[,-(1:t)],t,n.snp = 1) pval_TATES[i] <- TATEs[t+1] #### MultiPhen ### X = as.matrix(sim$X) dimnames(X) <- list(1:n,1) Y = as.matrix(sim$Y) dimnames(Y) <- list(1:n,1:t) opts = mPhen.options(c("regression","pheno.input")) opts$mPhen.scoreTest = TRUE invisible(capture.output(suppressMessages(m <- mPhen(X[,1,drop=FALSE],Y,phenotypes = "all", opts = opts)))) pval_MultiPhen[i] <- m$Results[,,,"pvalue"] ["JointModel"] } print(paste("type1_cont_noz",t,rho,sep = "_")) colMeans(pval_AF_comb<0.05,na.rm = TRUE) colMeans(pval_MSKAT<0.05,na.rm = TRUE) colMeans(pval_SPU<0.05,na.rm = TRUE) colMeans(pval_SPU_ex<0.05,na.rm = TRUE) mean(pval_MANOVA<0.05,na.rm = TRUE) mean(pval_minP<0.05,na.rm = TRUE) mean(pval_MultiPhen<0.05,na.rm = TRUE) mean(pval_TATES<0.05,na.rm = TRUE) setwd(paste0(path,"/","type1/continuous/no_covariates/trait",t)) save(list = ls(all.names = TRUE), file = paste0("type1_cont_noz","_",t,"_",rho,"_",core.i,".RData"), envir = .GlobalEnv)
/type1/sim_cont_noz.R
no_license
songbiostat/MTAF
R
false
false
3,552
r
### type 1 error args <- commandArgs(TRUE) core.i <- as.numeric(args) # load packages, functions path="/users/PAS1149/osu10039/PAS1149/qldeng/AF_data/june_simulations" setwd(paste0(path,"/","code","/","functions")) source("af_functions_noz.R") n = 1000 # sample size betaz = 0 # effect of covariates t <- 100 # traits cor_matrix = "cs" # correlation structure rho = 0.3 # correlation strength rep <- 50 # permutation for each core # matrix/vectors save results pval_AF_comb <- matrix(NA,nrow = rep,ncol = 3) pval_minP <- rep(NA,rep) pval_MANOVA <- rep(NA,rep) pval_SPU <- matrix(NA,nrow = rep,ncol = 10) pval_SPU_ex <- matrix(NA,nrow = rep,ncol = 10) pval_MSKAT <- matrix(NA,nrow = rep,ncol = 2) pval_TATES <- rep(NA,rep) pval_MultiPhen <- rep(NA,rep) for(i in (1:rep)){ print(i) set.seed(core.i*1000 + i) # random seed # type1: null beta beta <- rep(0,t) sim <- SIM_covariate_power_Z(betaz=betaz,constr = cor_matrix,beta,traits = t,cat_ratio =0,cor=rho,n.cov = 2, MAF = 0.3) # do PCA Y.res <- sim$Y X.res <- sim$X Y.pca <- Y_PCA(Y.res) ## Score test score <- score_test(cbind(Y.pca,Y.res),X.res,n) ###################### Original AF ###################### ## AF w./ PCA PCA_res <- AdaptiveFisher_combo(score$p_l[,1:t],score$p_u[,1:t]) p_perm_pcares <- matrix(PCA_res$P_vector,ncol = 1) # AF w.o. PCA AF <- AdaptiveFisher_combo(score$p_l[,-(1:t)],score$p_u[,-(1:t)]) p_perm_af <- matrix(AF$P_vector,ncol = 1) # combine combo <- AdaptiveFisher_compute(cbind(p_perm_af,p_perm_pcares)) pval_AF_comb[i,1] <- combo$`AF P_value` # record each method's p-value and min pval_AF_comb[i,2] <- PCA_res$AF_pvalue pval_AF_comb[i,3] <- AF$AF_pvalue #################### Other Methods ####################### ### minP ### p_matrix_2side <- 2*pnorm(abs(qnorm(score$p_l[,-(1:t)])),lower.tail = FALSE) pval_minP[i] <- min_p(p_matrix_2side)$p.min ### SPUs & aSPU ### invisible(capture.output(suppressMessages(pan<-GEEaSPU(traits = sim$Y,geno = sim$X,model = "gaussian")))) pval_SPU[i,] <- pan[1:10] invisible(capture.output(suppressMessages(pan<-GEEaSPU(traits = sim$Y,geno = sim$X,model = "gaussian",corstr = "exchangeable")))) pval_SPU_ex[i,] <- pan[1:10] ### MSKAT ### X_matrix <- matrix(sim$X,ncol = 1) SKAT <- MSKAT(MSKAT.cnull(sim$Y,X=NULL), X_matrix, W.beta=c(1,25)) pval_MSKAT[i,] <- SKAT #### MANOVA #### man <- manova(sim$Y~sim$X) pval_MANOVA[i] <- summary(man)$stats["sim$X","Pr(>F)"] ### TATES ### TATEs <- TATES(sim$Y,score$p_l[,-(1:t)],t,n.snp = 1) pval_TATES[i] <- TATEs[t+1] #### MultiPhen ### X = as.matrix(sim$X) dimnames(X) <- list(1:n,1) Y = as.matrix(sim$Y) dimnames(Y) <- list(1:n,1:t) opts = mPhen.options(c("regression","pheno.input")) opts$mPhen.scoreTest = TRUE invisible(capture.output(suppressMessages(m <- mPhen(X[,1,drop=FALSE],Y,phenotypes = "all", opts = opts)))) pval_MultiPhen[i] <- m$Results[,,,"pvalue"] ["JointModel"] } print(paste("type1_cont_noz",t,rho,sep = "_")) colMeans(pval_AF_comb<0.05,na.rm = TRUE) colMeans(pval_MSKAT<0.05,na.rm = TRUE) colMeans(pval_SPU<0.05,na.rm = TRUE) colMeans(pval_SPU_ex<0.05,na.rm = TRUE) mean(pval_MANOVA<0.05,na.rm = TRUE) mean(pval_minP<0.05,na.rm = TRUE) mean(pval_MultiPhen<0.05,na.rm = TRUE) mean(pval_TATES<0.05,na.rm = TRUE) setwd(paste0(path,"/","type1/continuous/no_covariates/trait",t)) save(list = ls(all.names = TRUE), file = paste0("type1_cont_noz","_",t,"_",rho,"_",core.i,".RData"), envir = .GlobalEnv)
\name{adj2mat} \alias{adj2mat} \title{Convert adjacency list into an adjacency matrix.} \description{ Converts an adjacency-like list (which may or may not contain all the gene IDs in the network) into an adjacency matrix. This function is originally from ENA R package and the pathDESeq package uses this as an internal function for the \code{neibMat} function. } \author{ Jeffrey D. Allen \email{Jeffrey.Allen@UTSouthwestern.edu} } \seealso{\code{\link{neibMat}}} \references{ Jeffrey, D. A., & Guanghua, X. (2014). ENA:Ensemble Network Aggregation R package version 1.3-0. }
/man/adj2mat.Rd
no_license
MalathiSIDona/pathDESeq
R
false
false
580
rd
\name{adj2mat} \alias{adj2mat} \title{Convert adjacency list into an adjacency matrix.} \description{ Converts an adjacency-like list (which may or may not contain all the gene IDs in the network) into an adjacency matrix. This function is originally from ENA R package and the pathDESeq package uses this as an internal function for the \code{neibMat} function. } \author{ Jeffrey D. Allen \email{Jeffrey.Allen@UTSouthwestern.edu} } \seealso{\code{\link{neibMat}}} \references{ Jeffrey, D. A., & Guanghua, X. (2014). ENA:Ensemble Network Aggregation R package version 1.3-0. }
# This shiny user interface file is a work-in-progress, initially # designed for Johns Hopkins Data Products class. It will ultimately try # to teach an uninitiated adult learner the subject of Algebra. # # Cynthia Davies Cunha # Johns Hopkins Developing Data Products # October 2014 # library(shiny) shinyUI(fluidPage( titlePanel("Learning Algebra"), sidebarLayout( sidebarPanel( h2("Lesson One: Containers"), helpText("A container is a representation of an unknown value. In the equation x + 3 = 7, x is the unknown value, a container. Select a container and an operator and we will build an equation to solve."), selectInput("var", label = "Choose a container to represent an unknown value", choices = c("?", "x", "a", "y"), selected = "" ), selectInput("op", label = "Choose an operation to perform:", choices = c("+","-","/","*"), selected = "" ), numericInput("num", label = "Choose a number:", 0) ), mainPanel( p("Sometimes the nomenclature of a new subject can be intimidating. In Algebra, we often use a ", strong(em("container")), " for an unknown value."), br(), p("Let's start with the familiar."), br(), p("If I were to ask:"), p("What do you have to add to the number 3 to get 7, I'm sure you would readily answer 4."), br(), p("Suppose I write the above problem like this:"), p(strong("?"), " + 3 = 7", style = "color:blue"), br(), p("You would still answer 4, right? The ", strong("?"), " is just a container, it represents and holds an unknown value."), br(), p("What if I wrote the problem like this: "), p(strong("x"), " + 3 = 7", style = "color:blue"), br(), p("The letter ", strong("x"), "here is still just ", em("a container"), " for an unknown value."), p("Your answer is still 4, as in x = 4, which means you substitute 4 into the container x to get: "), p("4 + 3 = 7", style = "color:blue"), h3(textOutput("text1")), h3(textOutput("text2")) ) ) ))
/algebraVis/ui.R
no_license
CDCwrites/BuildingDataProducts
R
false
false
2,754
r
# This shiny user interface file is a work-in-progress, initially # designed for Johns Hopkins Data Products class. It will ultimately try # to teach an uninitiated adult learner the subject of Algebra. # # Cynthia Davies Cunha # Johns Hopkins Developing Data Products # October 2014 # library(shiny) shinyUI(fluidPage( titlePanel("Learning Algebra"), sidebarLayout( sidebarPanel( h2("Lesson One: Containers"), helpText("A container is a representation of an unknown value. In the equation x + 3 = 7, x is the unknown value, a container. Select a container and an operator and we will build an equation to solve."), selectInput("var", label = "Choose a container to represent an unknown value", choices = c("?", "x", "a", "y"), selected = "" ), selectInput("op", label = "Choose an operation to perform:", choices = c("+","-","/","*"), selected = "" ), numericInput("num", label = "Choose a number:", 0) ), mainPanel( p("Sometimes the nomenclature of a new subject can be intimidating. In Algebra, we often use a ", strong(em("container")), " for an unknown value."), br(), p("Let's start with the familiar."), br(), p("If I were to ask:"), p("What do you have to add to the number 3 to get 7, I'm sure you would readily answer 4."), br(), p("Suppose I write the above problem like this:"), p(strong("?"), " + 3 = 7", style = "color:blue"), br(), p("You would still answer 4, right? The ", strong("?"), " is just a container, it represents and holds an unknown value."), br(), p("What if I wrote the problem like this: "), p(strong("x"), " + 3 = 7", style = "color:blue"), br(), p("The letter ", strong("x"), "here is still just ", em("a container"), " for an unknown value."), p("Your answer is still 4, as in x = 4, which means you substitute 4 into the container x to get: "), p("4 + 3 = 7", style = "color:blue"), h3(textOutput("text1")), h3(textOutput("text2")) ) ) ))
\name{are.parrice.valid} \alias{are.parrice.valid} \title{Are the Distribution Parameters Consistent with the Rice Distribution} \description{ Is the distribution parameter object consistent with the corresponding distribution? The distribution functions (\code{\link{cdfrice}}, \code{\link{pdfrice}}, \code{\link{quarice}}, and \code{\link{lmomrice}}) require consistent parameters to return the cumulative probability (nonexceedance), density, quantile, and L-moments of the distribution, respectively. These functions internally use the \code{\link{are.parrice.valid}} function. } \usage{ are.parrice.valid(para, nowarn=FALSE) } \arguments{ \item{para}{A distribution parameter list returned by \code{\link{parrice}} or \code{\link{vec2par}}.} \item{nowarn}{A logical switch on warning suppression. If \code{TRUE} then \code{options(warn=-1)} is made and restored on return. This switch is to permit calls in which warnings are not desired as the user knows how to handle the returned value---say in an optimization algorithm.} } \value{ \item{TRUE}{If the parameters are \code{rice} consistent.} \item{FALSE}{If the parameters are not \code{rice} consistent.} } \note{ This function calls \code{\link{is.rice}} to verify consistency between the distribution parameter object and the intent of the user. } \author{W.H. Asquith} \references{ Asquith, W.H., 2011, Distributional analysis with L-moment statistics using the R environment for statistical computing: Createspace Independent Publishing Platform, ISBN 978--146350841--8. } \seealso{\code{\link{is.rice}}, \code{\link{parrice}} } \examples{ #para <- parrice(lmoms(c(123,34,4,654,37,78))) #if(are.parrice.valid(para)) Q <- quarice(0.5,para) } \keyword{utility (distribution)} \keyword{Distribution: Rice} \keyword{utility (distribution/parameter validation)}
/man/are.parrice.valid.Rd
no_license
wasquith/lmomco
R
false
false
1,832
rd
\name{are.parrice.valid} \alias{are.parrice.valid} \title{Are the Distribution Parameters Consistent with the Rice Distribution} \description{ Is the distribution parameter object consistent with the corresponding distribution? The distribution functions (\code{\link{cdfrice}}, \code{\link{pdfrice}}, \code{\link{quarice}}, and \code{\link{lmomrice}}) require consistent parameters to return the cumulative probability (nonexceedance), density, quantile, and L-moments of the distribution, respectively. These functions internally use the \code{\link{are.parrice.valid}} function. } \usage{ are.parrice.valid(para, nowarn=FALSE) } \arguments{ \item{para}{A distribution parameter list returned by \code{\link{parrice}} or \code{\link{vec2par}}.} \item{nowarn}{A logical switch on warning suppression. If \code{TRUE} then \code{options(warn=-1)} is made and restored on return. This switch is to permit calls in which warnings are not desired as the user knows how to handle the returned value---say in an optimization algorithm.} } \value{ \item{TRUE}{If the parameters are \code{rice} consistent.} \item{FALSE}{If the parameters are not \code{rice} consistent.} } \note{ This function calls \code{\link{is.rice}} to verify consistency between the distribution parameter object and the intent of the user. } \author{W.H. Asquith} \references{ Asquith, W.H., 2011, Distributional analysis with L-moment statistics using the R environment for statistical computing: Createspace Independent Publishing Platform, ISBN 978--146350841--8. } \seealso{\code{\link{is.rice}}, \code{\link{parrice}} } \examples{ #para <- parrice(lmoms(c(123,34,4,654,37,78))) #if(are.parrice.valid(para)) Q <- quarice(0.5,para) } \keyword{utility (distribution)} \keyword{Distribution: Rice} \keyword{utility (distribution/parameter validation)}
#' Align two functions #' #' This function aligns two SRSF functions using Dynamic Programming #' #' @param Q1 srsf of function 1 #' @param T1 sample points of function 1 #' @param Q2 srsf of function 2 #' @param T2 sample points of function 2 #' @param lambda controls amount of warping (default = 0) #' @param method controls which optimization method (default="DP") options are #' Dynamic Programming ("DP"), Coordinate Descent ("DP2"), and Riemannian BFGS #' ("RBFGS") #' @param w controls LRBFGS (default = 0.01) #' @param f1o initial value of f1, vector or scalar depending on q1, defaults to zero #' @param f2o initial value of f2, vector or scalar depending on q1, defaults to zero #' @return gam warping function #' @keywords srsf alignment #' @references Srivastava, A., Wu, W., Kurtek, S., Klassen, E., Marron, J. S., #' May 2011. Registration of functional data using fisher-rao metric, #' arXiv:1103.3817v2 [math.ST]. #' @references Tucker, J. D., Wu, W., Srivastava, A., #' Generative Models for Function Data using Phase and Amplitude Separation, #' Computational Statistics and Data Analysis (2012), 10.1016/j.csda.2012.12.001. #' @export #' @examples #' data("simu_data") #' q = f_to_srvf(simu_data$f,simu_data$time) #' gam = optimum.reparam(q[,1],simu_data$time,q[,2],simu_data$time) optimum.reparam <- function(Q1,T1,Q2,T2,lambda=0,method="DP",w=0.01,f1o=0.0, f2o=0.0){ n = length(T1) if (method=="DPo" && all(T1!=T2)) method = "DP" Q1=(Q1/pvecnorm(Q1,2)) Q2=(Q2/pvecnorm(Q2,2)) C1=srsf_to_f(Q1,T1,f1o) C2=srsf_to_f(Q2,T2,f2o) rotated = FALSE isclosed = FALSE skipm = 0 auto = 0 if (method=="DP"){ G = rep(0,n) T = rep(0,n) size = 0; ret = .Call('DPQ2', PACKAGE = 'fdasrvf', Q1, T1, Q2, T2, 1, n, n, T1, T2, n, n, G, T, size, lambda); G = ret$G[1:ret$size] Tf = ret$T[1:ret$size] gam0 = approx(Tf,G,xout=T2)$y } else if (method=="DPo"){ gam0 = .Call('DPQ', PACKAGE = 'fdasrvf', Q2, Q1, 1, n, lambda, 0, rep(0,n)) } else if (method=="SIMUL"){ out = simul_align(C1,C2) u = seq(0,1,length.out=length(out$g1)) tmin = min(T1) tmax = max(T1) timet2 = T1 timet2 = (timet2-tmin)/(tmax-tmin) gam0 = simul_gam(u,out$g1,out$g2,timet2,out$s1,out$s2,timet2) } else if (method=="DP2") { opt = rep(0,n+1+1); swap = FALSE fopts = rep(0,5) comtime = rep(0,5) out = .Call('opt_reparam', PACKAGE = 'fdasrvf', C1,C2,n,1,0.0,TRUE, rotated,isclosed,skipm,auto,opt,swap,fopts,comtime) gam0 = out$opt gam0 = gam0[1:(length(gam0)-2)] if (out$swap){ gam0 = invertGamma(gam0); } } else { opt = rep(0,n+1+1); swap = FALSE fopts = rep(0,5) comtime = rep(0,5) out = .Call('opt_reparam', PACKAGE = 'fdasrvf', C1,C2,n,1,w,FALSE, rotated,isclosed,skipm,auto,opt,swap,fopts,comtime) if (out$fopts[1] == 1000){ out = .Call('opt_reparam', PACKAGE = 'fdasrvf', C1,C2,n,1,0.0,TRUE, rotated,isclosed,skipm,auto,opt,swap,fopts,comtime) } gam0 = out$opt gam0 = gam0[1:(length(gam0)-2)] if (out$swap){ gam0 = invertGamma(gam0); } } gam = (gam0-gam0[1])/(gam0[length(gam0)]-gam0[1]) # slight change on scale return(gam) }
/R/optimum.reparam.R
no_license
jasonradams47/fdasrvf_R
R
false
false
3,498
r
#' Align two functions #' #' This function aligns two SRSF functions using Dynamic Programming #' #' @param Q1 srsf of function 1 #' @param T1 sample points of function 1 #' @param Q2 srsf of function 2 #' @param T2 sample points of function 2 #' @param lambda controls amount of warping (default = 0) #' @param method controls which optimization method (default="DP") options are #' Dynamic Programming ("DP"), Coordinate Descent ("DP2"), and Riemannian BFGS #' ("RBFGS") #' @param w controls LRBFGS (default = 0.01) #' @param f1o initial value of f1, vector or scalar depending on q1, defaults to zero #' @param f2o initial value of f2, vector or scalar depending on q1, defaults to zero #' @return gam warping function #' @keywords srsf alignment #' @references Srivastava, A., Wu, W., Kurtek, S., Klassen, E., Marron, J. S., #' May 2011. Registration of functional data using fisher-rao metric, #' arXiv:1103.3817v2 [math.ST]. #' @references Tucker, J. D., Wu, W., Srivastava, A., #' Generative Models for Function Data using Phase and Amplitude Separation, #' Computational Statistics and Data Analysis (2012), 10.1016/j.csda.2012.12.001. #' @export #' @examples #' data("simu_data") #' q = f_to_srvf(simu_data$f,simu_data$time) #' gam = optimum.reparam(q[,1],simu_data$time,q[,2],simu_data$time) optimum.reparam <- function(Q1,T1,Q2,T2,lambda=0,method="DP",w=0.01,f1o=0.0, f2o=0.0){ n = length(T1) if (method=="DPo" && all(T1!=T2)) method = "DP" Q1=(Q1/pvecnorm(Q1,2)) Q2=(Q2/pvecnorm(Q2,2)) C1=srsf_to_f(Q1,T1,f1o) C2=srsf_to_f(Q2,T2,f2o) rotated = FALSE isclosed = FALSE skipm = 0 auto = 0 if (method=="DP"){ G = rep(0,n) T = rep(0,n) size = 0; ret = .Call('DPQ2', PACKAGE = 'fdasrvf', Q1, T1, Q2, T2, 1, n, n, T1, T2, n, n, G, T, size, lambda); G = ret$G[1:ret$size] Tf = ret$T[1:ret$size] gam0 = approx(Tf,G,xout=T2)$y } else if (method=="DPo"){ gam0 = .Call('DPQ', PACKAGE = 'fdasrvf', Q2, Q1, 1, n, lambda, 0, rep(0,n)) } else if (method=="SIMUL"){ out = simul_align(C1,C2) u = seq(0,1,length.out=length(out$g1)) tmin = min(T1) tmax = max(T1) timet2 = T1 timet2 = (timet2-tmin)/(tmax-tmin) gam0 = simul_gam(u,out$g1,out$g2,timet2,out$s1,out$s2,timet2) } else if (method=="DP2") { opt = rep(0,n+1+1); swap = FALSE fopts = rep(0,5) comtime = rep(0,5) out = .Call('opt_reparam', PACKAGE = 'fdasrvf', C1,C2,n,1,0.0,TRUE, rotated,isclosed,skipm,auto,opt,swap,fopts,comtime) gam0 = out$opt gam0 = gam0[1:(length(gam0)-2)] if (out$swap){ gam0 = invertGamma(gam0); } } else { opt = rep(0,n+1+1); swap = FALSE fopts = rep(0,5) comtime = rep(0,5) out = .Call('opt_reparam', PACKAGE = 'fdasrvf', C1,C2,n,1,w,FALSE, rotated,isclosed,skipm,auto,opt,swap,fopts,comtime) if (out$fopts[1] == 1000){ out = .Call('opt_reparam', PACKAGE = 'fdasrvf', C1,C2,n,1,0.0,TRUE, rotated,isclosed,skipm,auto,opt,swap,fopts,comtime) } gam0 = out$opt gam0 = gam0[1:(length(gam0)-2)] if (out$swap){ gam0 = invertGamma(gam0); } } gam = (gam0-gam0[1])/(gam0[length(gam0)]-gam0[1]) # slight change on scale return(gam) }
systemContentDistribution <- function(lambda,m,buffer_size) { #a total of buffer_size + m jobs can be in the system, at max m can be in service in at any moment. matrix_size = m+buffer_size+1; P = matrix(0, nrow = matrix_size, ncol = matrix_size); # index i contains probability that there are less than i arrivals (not less than equal to) # i.e. cumulative_prob[i] = Pr(X < i) cumulative_prob = rep_len(0,2*matrix_size) cumulative_prob[1] = prob_n_arrivals(0,lambda) for( i in 2:length(cumulative_prob)) { cumulative_prob[i] = cumulative_prob[i-1] + prob_n_arrivals(i-1,lambda); } for(from in 1:matrix_size) { for( to in 1:matrix_size) { P[from,to] = prob_transition(from,to,lambda,m, matrix_size, cumulative_prob); } } nthP = P%^%1000; systemContentDistribution = nthP[1,1:matrix_size] } eSystemContent <- function(distribution) { eSystemContent = 0; for(i in 1:length(distribution)) { eSystemContent = eSystemContent + (i-1)*distribution[i]; } eSystemContent = eSystemContent } eResponseTime <- function(lambda,distribution) { blocking_probability = distribution[length(distribution)]; eResponseTime = eSystemContent(distribution)/(lambda*(1-blocking_probability)); } eBlockingProbability <-function(lambda,distribution) { eBlockingProbability = distribution[length(distribution)]; }
/performance_measures.R
permissive
saxe405/edge
R
false
false
1,371
r
systemContentDistribution <- function(lambda,m,buffer_size) { #a total of buffer_size + m jobs can be in the system, at max m can be in service in at any moment. matrix_size = m+buffer_size+1; P = matrix(0, nrow = matrix_size, ncol = matrix_size); # index i contains probability that there are less than i arrivals (not less than equal to) # i.e. cumulative_prob[i] = Pr(X < i) cumulative_prob = rep_len(0,2*matrix_size) cumulative_prob[1] = prob_n_arrivals(0,lambda) for( i in 2:length(cumulative_prob)) { cumulative_prob[i] = cumulative_prob[i-1] + prob_n_arrivals(i-1,lambda); } for(from in 1:matrix_size) { for( to in 1:matrix_size) { P[from,to] = prob_transition(from,to,lambda,m, matrix_size, cumulative_prob); } } nthP = P%^%1000; systemContentDistribution = nthP[1,1:matrix_size] } eSystemContent <- function(distribution) { eSystemContent = 0; for(i in 1:length(distribution)) { eSystemContent = eSystemContent + (i-1)*distribution[i]; } eSystemContent = eSystemContent } eResponseTime <- function(lambda,distribution) { blocking_probability = distribution[length(distribution)]; eResponseTime = eSystemContent(distribution)/(lambda*(1-blocking_probability)); } eBlockingProbability <-function(lambda,distribution) { eBlockingProbability = distribution[length(distribution)]; }