content
large_stringlengths
0
6.46M
path
large_stringlengths
3
331
license_type
large_stringclasses
2 values
repo_name
large_stringlengths
5
125
language
large_stringclasses
1 value
is_vendor
bool
2 classes
is_generated
bool
2 classes
length_bytes
int64
4
6.46M
extension
large_stringclasses
75 values
text
stringlengths
0
6.46M
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/AllGenerics.R \name{summarize} \alias{summarize} \title{Return programmatically useful summary of a fit} \usage{ summarize(object, ...) } \arguments{ \item{object}{LMlike or subclass} \item{...}{other arguments} } \value{ list of parameters characterizing fit } \description{ Return programmatically useful summary of a fit }
/man/summarize.Rd
no_license
QinLab/MAST
R
false
true
406
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/AllGenerics.R \name{summarize} \alias{summarize} \title{Return programmatically useful summary of a fit} \usage{ summarize(object, ...) } \arguments{ \item{object}{LMlike or subclass} \item{...}{other arguments} } \value{ list of parameters characterizing fit } \description{ Return programmatically useful summary of a fit }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/BayesCTDesigncode.R \name{simple_sim} \alias{simple_sim} \title{Two Arm Bayesian Clinical Trial Simulation without Historical Data} \usage{ simple_sim( trial_reps = 100, outcome_type = "weibull", subj_per_arm = c(50, 100, 150, 200, 250), effect_vals = c(0.6, 1, 1.4), control_parms = NULL, time_vec = NULL, censor_value = NULL, alpha = 0.05, get_var = FALSE, get_bias = FALSE, get_mse = FALSE, seedval = NULL, quietly = TRUE ) } \arguments{ \item{trial_reps}{Number of trials to replicate within each combination of \code{a0_vals}, \code{subj_per_arm}, \code{effect_vals}, and \code{rand_control_parms}. As the number of trials increases, the precision of the estimate will increase. Default is 100.} \item{outcome_type}{Outcome distribution. Must be equal to \code{weibull}, \code{lognormal}, \code{pwe} (Piecewise Exponential), \code{gaussian}, \code{bernoulli}, or \code{poisson}. Default is \code{weibull}.} \item{subj_per_arm}{A vector of sample sizes, all of which must be positive integers. Default is \code{c(50, 100, 150, 200, 250)}.} \item{effect_vals}{A vector of effects that should be reasonable for the outcome_type being studied, hazard ratios for Weibull, odds ratios for Bernoulli, mean ratios for Poisson, etc.. When \code{effect_vals} contain the null effect for a given \code{outcome_type}, the \code{power} component of \code{data} will contain an estimate of Type One Error. In order to have a good set of Type One Error estimates, \code{trial_reps} need to be at least 10,000. In such a case, if the total number of combinations made up from \code{subj_per_arm}, \code{a0_vals}, \code{effect_vals}, and \code{rand_control_diff} is very large, the time to complete the simulation can be substantial. Default is \code{c(0.6, 1, 1.4)}.} \item{control_parms}{A vector of parameter values defining the outcome distribution for randomized controls. See Details for what is required for each \code{outcome_type}.} \item{time_vec}{A vector of time values that are used to create time periods within which the exponential hazard is constant. Only used for piecewise exponential models. Default is \code{NULL}.} \item{censor_value}{A single value at which right censoring occurs when simulating randomized subject outcomes. Used with survival outcomes. Default is \code{NULL}, where \code{NULL} implies no right censoring.} \item{alpha}{A number ranging between 0 and 1 that defines the acceptable Type 1 error rate. Default is 0.05.} \item{get_var}{A TRUE/FALSE indicator of whether an array of variance estimates will be returned. Default is \code{FALSE}.} \item{get_bias}{A TRUE/FALSE indicator of whether an array of bias estimates will be returned. Default is \code{FALSE}.} \item{get_mse}{A TRUE/FALSE indicator of whether an array of MSE estimates will be returned. Default is \code{FALSE}.} \item{seedval}{A seed value for pseudo-random number generation.} \item{quietly}{A TRUE/FALSE indicator of whether notes are printed to output about simulation progress as the simulation runs. If running interactively in RStudio or running in the R console, \code{quietly} can be set to FALSE. If running in a Notebook or knitr document, \code{quietly} needs to be set to TRUE. Otherwise each note will be printed on a separate line and it will take up a lot of output space. Default is \code{TRUE}.} } \value{ \code{simple_sim()} returns an S3 object of class \code{bayes_ctd_array}. As noted in Details, an object of class \code{bayes_ctd_array} has 6 elements: a list containing simulation results (\code{data}), copies of the 4 function arguments \code{subj_per_arm}, \code{a0_vals}, \code{effect_vals}, and \code{rand_control_diff}, and finally \code{objtype} indicating that \code{simple_sim()} was used. See Details for a discussion about the contents of \code{data}. Results from the simulation contained in the \code{bayes_ctd_array} object can be printed or plotted using the \code{print()} and \code{plot()} methods. The results can also be accessed using basic list element identification and array slicing. For example, to get the power results from a simulation, one could use the code \code{bayes_ctd_array$data$power}, where \code{bayes_ctd_array} is replaced with the name of the variable containing the \code{bayes_ctd_array} object. Even though this is a 4-dimensional array, the power results only occupy a single 2-dimensional table. To print this 2-dimensional table, one would use the code \code{bayes_ctd_array$data$power[,1,,1]}, where \code{bayes_ctd_array} is replaced with the name of the variable containing the \code{bayes_ctd_array} object. } \description{ \code{simple_sim()} returns an S3 object of class \code{bayes_ctd_array}, which will contain simulation results for power, statistic estimation, bias, variance, and mse as requested by user. } \details{ The object \code{bayes_ctd_array} has 6 elements: a list containing simulation results (\code{data}), copies of the 4 function arguments \code{subj_per_arm}, \code{a0_vals}, \code{effect_vals}, and \code{rand_control_diff}, and finally a \code{objtype} value indicating that \code{simple_sim()} was used. Each element of \code{data} is a four-dimensional array, where each dimension is determined by the length of parameters \code{subj_per_arm}, \code{a0_vals}, \code{effect_vals}, and \code{rand_control_diff}. The size of \code{data} depends on which results are requested by the user. At a minimum, at least one of \code{subj_per_arm}, \code{a0_vals}, \code{effect_vals}, or \code{rand_control_diff} must contain at least 2 values, while the other three must contain at least 1 value. The \code{data} list will always contain two elements: an array of power results (\code{power}) and an array of estimation results (\code{est}). In addition to \code{power} and \code{est}, \code{data} may also contain elements \code{var}, \code{bias}, or \code{mse}, depending on the values of \code{get_var}, \code{get_bias}, and \code{get_mse}. The values returned in \code{est} are in the form of hazard ratios, mean ratios, odds ratios, or mean differences depending on the value of \code{outcome_type}. For a Gaussian outcome, the estimation results are differences in group means (experimental group minus control group). For a logistic outcome, the estimation results are odds ratios (experimental group over control group). For lognormal and Poisson outcomes, the estimation results are mean ratios (experimental group over control group). For a piecewise exponential or a Weibull outcome, the estimation results are hazard ratios (experimental group over control group). The values returned in \code{bias}, \code{var}, and \code{mse} are on the scale of the values returned in \code{est}. The object \code{bayes_ctd_array} has two primary methods, \code{print()} and \code{plot()}, for printing and plotting slices of the arrays contained in \code{bayes_ctd_array$data}. As dimensions of the four dimensional array increases, the time required to complete the simulation will increase; however, it will be faster than a similar simulation based on repeated calls to MCMC routines to analyze each simulated trial. The meaning of the estimation results, and the test used to generate power results, depends on the outcome used. In all cases, power is based on a two-sided test involving a (1-alpha)100\% credible interval, where the interval is used to determine if the null hypothesis should be rejected (null value outside of the interval) or not rejected (null value inside the interval). For a Gaussian outcome, the 95\% credible interval is an interval for the difference in group means (experimental group minus control group), and the test determines if 0 is in or outside of the interval. For a Bernoulli outcome, the 95\% credible interval is an interval for the odds ratio (experimental group over control group), and the test determines if 1 is in or outside of the interval. For a lognormal or a Poisson outcome, the 95\% credible interval is an interval for the mean ratio (experimental group over control group), and the test determines if 1 is in or outside of the interval. Finally, for a piecewise exponential or a Weibull outcome, the 95\% credible interval is an interval for the hazard ratio (experimental group over control group), and the test determines if 1 is in or outside of the interval. For a Gaussian outcome, the \code{control_parms} values should be \code{(mean, sd)}, where mean is the mean parameter for the control group used in a call to \code{rnorm()}, and sd is the common sd parameter for both groups used in a call to\code{rlnorm()}. For a Bernoulli outcome, the \code{control_parms} values should be \code{(prob)}, where prob is the event probability for the control group used in a call to \code{rbinom()}. For a lognormal outcome, the \code{control_parms} values should be \code{(meanlog, sdlog)}, where meanlog is the meanlog parameter for the control group used in a call to \code{rlnorm()}, and sdlog is the common sdlog parameter for both groups used in a call to \code{rlnorm()}. For a Poisson outcome, the \code{control_parms} value should be \code{(lambda)}, where lambda is the lambda parameter for the control group used in a call to \code{rpois()} and is equal to the mean of a Poisson distribution. For a Weibull outcome, the \code{control_parms} values should be \code{(scale, shape)}, where scale is the scale parameter for the control group used in a call to \code{rweibull()}, and shape is the common shape parameter for both groups used in a call to \code{rweibull()}. For a piecewise exponential outcome, the \code{control_parms} values should be a vector of lambdas used in a call to \code{eha::rpch()}. Each element in \code{control_parms} is a hazard for an interval defined by the \code{time_vec} parameter. Please refer to the examples for illustration of package use. } \examples{ #Run a Weibull simulation, using simple_sim(). #For meaningful results, trial_reps needs to be much larger than 2. weibull_test <- simple_sim(trial_reps = 2, outcome_type = "weibull", subj_per_arm = c(50, 100, 150, 200), effect_vals = c(0.6, 1, 1.4), control_parms = c(2.82487,3), time_vec = NULL, censor_value = NULL, alpha = 0.05, get_var = TRUE, get_bias = TRUE, get_mse = TRUE, seedval=123, quietly=TRUE) #Tabulate the simulation results for power. test_table <- print(x=weibull_test, measure="power", tab_type=NULL, subj_per_arm_val=NULL, a0_val=NULL, effect_val=NULL, rand_control_diff_val=NULL) print(test_table) #Create a plot of the power simulation results. plot(x=weibull_test, measure="power", tab_type=NULL, smooth=FALSE, plot_out=TRUE) #Create a plot of the estimated hazard ratio simulation results. plot(x=weibull_test, measure="est", tab_type=NULL, smooth=FALSE, plot_out=TRUE) #Create a plot of the hazard ratio variance simulation results. plot(x=weibull_test, measure="var", tab_type=NULL, smooth=FALSE, plot_out=TRUE) #Create a plot of the hazard ratio bias simulation results. plot(x=weibull_test, measure="bias", tab_type=NULL, smooth=FALSE, plot_out=TRUE) #Create a plot of the hazard ratio mse simulation results. plot(x=weibull_test, measure="mse", tab_type=NULL, smooth=FALSE, plot_out=TRUE) }
/man/simple_sim.Rd
no_license
begglest/BayesCTDesign
R
false
true
11,574
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/BayesCTDesigncode.R \name{simple_sim} \alias{simple_sim} \title{Two Arm Bayesian Clinical Trial Simulation without Historical Data} \usage{ simple_sim( trial_reps = 100, outcome_type = "weibull", subj_per_arm = c(50, 100, 150, 200, 250), effect_vals = c(0.6, 1, 1.4), control_parms = NULL, time_vec = NULL, censor_value = NULL, alpha = 0.05, get_var = FALSE, get_bias = FALSE, get_mse = FALSE, seedval = NULL, quietly = TRUE ) } \arguments{ \item{trial_reps}{Number of trials to replicate within each combination of \code{a0_vals}, \code{subj_per_arm}, \code{effect_vals}, and \code{rand_control_parms}. As the number of trials increases, the precision of the estimate will increase. Default is 100.} \item{outcome_type}{Outcome distribution. Must be equal to \code{weibull}, \code{lognormal}, \code{pwe} (Piecewise Exponential), \code{gaussian}, \code{bernoulli}, or \code{poisson}. Default is \code{weibull}.} \item{subj_per_arm}{A vector of sample sizes, all of which must be positive integers. Default is \code{c(50, 100, 150, 200, 250)}.} \item{effect_vals}{A vector of effects that should be reasonable for the outcome_type being studied, hazard ratios for Weibull, odds ratios for Bernoulli, mean ratios for Poisson, etc.. When \code{effect_vals} contain the null effect for a given \code{outcome_type}, the \code{power} component of \code{data} will contain an estimate of Type One Error. In order to have a good set of Type One Error estimates, \code{trial_reps} need to be at least 10,000. In such a case, if the total number of combinations made up from \code{subj_per_arm}, \code{a0_vals}, \code{effect_vals}, and \code{rand_control_diff} is very large, the time to complete the simulation can be substantial. Default is \code{c(0.6, 1, 1.4)}.} \item{control_parms}{A vector of parameter values defining the outcome distribution for randomized controls. See Details for what is required for each \code{outcome_type}.} \item{time_vec}{A vector of time values that are used to create time periods within which the exponential hazard is constant. Only used for piecewise exponential models. Default is \code{NULL}.} \item{censor_value}{A single value at which right censoring occurs when simulating randomized subject outcomes. Used with survival outcomes. Default is \code{NULL}, where \code{NULL} implies no right censoring.} \item{alpha}{A number ranging between 0 and 1 that defines the acceptable Type 1 error rate. Default is 0.05.} \item{get_var}{A TRUE/FALSE indicator of whether an array of variance estimates will be returned. Default is \code{FALSE}.} \item{get_bias}{A TRUE/FALSE indicator of whether an array of bias estimates will be returned. Default is \code{FALSE}.} \item{get_mse}{A TRUE/FALSE indicator of whether an array of MSE estimates will be returned. Default is \code{FALSE}.} \item{seedval}{A seed value for pseudo-random number generation.} \item{quietly}{A TRUE/FALSE indicator of whether notes are printed to output about simulation progress as the simulation runs. If running interactively in RStudio or running in the R console, \code{quietly} can be set to FALSE. If running in a Notebook or knitr document, \code{quietly} needs to be set to TRUE. Otherwise each note will be printed on a separate line and it will take up a lot of output space. Default is \code{TRUE}.} } \value{ \code{simple_sim()} returns an S3 object of class \code{bayes_ctd_array}. As noted in Details, an object of class \code{bayes_ctd_array} has 6 elements: a list containing simulation results (\code{data}), copies of the 4 function arguments \code{subj_per_arm}, \code{a0_vals}, \code{effect_vals}, and \code{rand_control_diff}, and finally \code{objtype} indicating that \code{simple_sim()} was used. See Details for a discussion about the contents of \code{data}. Results from the simulation contained in the \code{bayes_ctd_array} object can be printed or plotted using the \code{print()} and \code{plot()} methods. The results can also be accessed using basic list element identification and array slicing. For example, to get the power results from a simulation, one could use the code \code{bayes_ctd_array$data$power}, where \code{bayes_ctd_array} is replaced with the name of the variable containing the \code{bayes_ctd_array} object. Even though this is a 4-dimensional array, the power results only occupy a single 2-dimensional table. To print this 2-dimensional table, one would use the code \code{bayes_ctd_array$data$power[,1,,1]}, where \code{bayes_ctd_array} is replaced with the name of the variable containing the \code{bayes_ctd_array} object. } \description{ \code{simple_sim()} returns an S3 object of class \code{bayes_ctd_array}, which will contain simulation results for power, statistic estimation, bias, variance, and mse as requested by user. } \details{ The object \code{bayes_ctd_array} has 6 elements: a list containing simulation results (\code{data}), copies of the 4 function arguments \code{subj_per_arm}, \code{a0_vals}, \code{effect_vals}, and \code{rand_control_diff}, and finally a \code{objtype} value indicating that \code{simple_sim()} was used. Each element of \code{data} is a four-dimensional array, where each dimension is determined by the length of parameters \code{subj_per_arm}, \code{a0_vals}, \code{effect_vals}, and \code{rand_control_diff}. The size of \code{data} depends on which results are requested by the user. At a minimum, at least one of \code{subj_per_arm}, \code{a0_vals}, \code{effect_vals}, or \code{rand_control_diff} must contain at least 2 values, while the other three must contain at least 1 value. The \code{data} list will always contain two elements: an array of power results (\code{power}) and an array of estimation results (\code{est}). In addition to \code{power} and \code{est}, \code{data} may also contain elements \code{var}, \code{bias}, or \code{mse}, depending on the values of \code{get_var}, \code{get_bias}, and \code{get_mse}. The values returned in \code{est} are in the form of hazard ratios, mean ratios, odds ratios, or mean differences depending on the value of \code{outcome_type}. For a Gaussian outcome, the estimation results are differences in group means (experimental group minus control group). For a logistic outcome, the estimation results are odds ratios (experimental group over control group). For lognormal and Poisson outcomes, the estimation results are mean ratios (experimental group over control group). For a piecewise exponential or a Weibull outcome, the estimation results are hazard ratios (experimental group over control group). The values returned in \code{bias}, \code{var}, and \code{mse} are on the scale of the values returned in \code{est}. The object \code{bayes_ctd_array} has two primary methods, \code{print()} and \code{plot()}, for printing and plotting slices of the arrays contained in \code{bayes_ctd_array$data}. As dimensions of the four dimensional array increases, the time required to complete the simulation will increase; however, it will be faster than a similar simulation based on repeated calls to MCMC routines to analyze each simulated trial. The meaning of the estimation results, and the test used to generate power results, depends on the outcome used. In all cases, power is based on a two-sided test involving a (1-alpha)100\% credible interval, where the interval is used to determine if the null hypothesis should be rejected (null value outside of the interval) or not rejected (null value inside the interval). For a Gaussian outcome, the 95\% credible interval is an interval for the difference in group means (experimental group minus control group), and the test determines if 0 is in or outside of the interval. For a Bernoulli outcome, the 95\% credible interval is an interval for the odds ratio (experimental group over control group), and the test determines if 1 is in or outside of the interval. For a lognormal or a Poisson outcome, the 95\% credible interval is an interval for the mean ratio (experimental group over control group), and the test determines if 1 is in or outside of the interval. Finally, for a piecewise exponential or a Weibull outcome, the 95\% credible interval is an interval for the hazard ratio (experimental group over control group), and the test determines if 1 is in or outside of the interval. For a Gaussian outcome, the \code{control_parms} values should be \code{(mean, sd)}, where mean is the mean parameter for the control group used in a call to \code{rnorm()}, and sd is the common sd parameter for both groups used in a call to\code{rlnorm()}. For a Bernoulli outcome, the \code{control_parms} values should be \code{(prob)}, where prob is the event probability for the control group used in a call to \code{rbinom()}. For a lognormal outcome, the \code{control_parms} values should be \code{(meanlog, sdlog)}, where meanlog is the meanlog parameter for the control group used in a call to \code{rlnorm()}, and sdlog is the common sdlog parameter for both groups used in a call to \code{rlnorm()}. For a Poisson outcome, the \code{control_parms} value should be \code{(lambda)}, where lambda is the lambda parameter for the control group used in a call to \code{rpois()} and is equal to the mean of a Poisson distribution. For a Weibull outcome, the \code{control_parms} values should be \code{(scale, shape)}, where scale is the scale parameter for the control group used in a call to \code{rweibull()}, and shape is the common shape parameter for both groups used in a call to \code{rweibull()}. For a piecewise exponential outcome, the \code{control_parms} values should be a vector of lambdas used in a call to \code{eha::rpch()}. Each element in \code{control_parms} is a hazard for an interval defined by the \code{time_vec} parameter. Please refer to the examples for illustration of package use. } \examples{ #Run a Weibull simulation, using simple_sim(). #For meaningful results, trial_reps needs to be much larger than 2. weibull_test <- simple_sim(trial_reps = 2, outcome_type = "weibull", subj_per_arm = c(50, 100, 150, 200), effect_vals = c(0.6, 1, 1.4), control_parms = c(2.82487,3), time_vec = NULL, censor_value = NULL, alpha = 0.05, get_var = TRUE, get_bias = TRUE, get_mse = TRUE, seedval=123, quietly=TRUE) #Tabulate the simulation results for power. test_table <- print(x=weibull_test, measure="power", tab_type=NULL, subj_per_arm_val=NULL, a0_val=NULL, effect_val=NULL, rand_control_diff_val=NULL) print(test_table) #Create a plot of the power simulation results. plot(x=weibull_test, measure="power", tab_type=NULL, smooth=FALSE, plot_out=TRUE) #Create a plot of the estimated hazard ratio simulation results. plot(x=weibull_test, measure="est", tab_type=NULL, smooth=FALSE, plot_out=TRUE) #Create a plot of the hazard ratio variance simulation results. plot(x=weibull_test, measure="var", tab_type=NULL, smooth=FALSE, plot_out=TRUE) #Create a plot of the hazard ratio bias simulation results. plot(x=weibull_test, measure="bias", tab_type=NULL, smooth=FALSE, plot_out=TRUE) #Create a plot of the hazard ratio mse simulation results. plot(x=weibull_test, measure="mse", tab_type=NULL, smooth=FALSE, plot_out=TRUE) }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/watcher.R \name{watch} \alias{watch} \title{Watch a directory for changes (additions, deletions & modifications).} \usage{ watch(path, callback, pattern = NULL, hash = TRUE) } \arguments{ \item{path}{character vector of paths to watch. Omit trailing backslash.} \item{callback}{function called everytime a change occurs. It should have three parameters: added, deleted, modified, and should return TRUE to keep watching, or FALSE to stop.} \item{pattern}{file pattern passed to \code{\link[=dir]{dir()}}} \item{hash}{hashes are more accurate at detecting changes, but are slower for large files. When FALSE, uses modification time stamps} } \description{ This is used to power the \code{\link[=auto_test]{auto_test()}} and \code{\link[=auto_test_package]{auto_test_package()}} functions which are used to rerun tests whenever source code changes. } \details{ Use Ctrl + break (windows), Esc (mac gui) or Ctrl + C (command line) to stop the watcher. } \keyword{internal}
/man/watch.Rd
permissive
r-lib/testthat
R
false
true
1,054
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/watcher.R \name{watch} \alias{watch} \title{Watch a directory for changes (additions, deletions & modifications).} \usage{ watch(path, callback, pattern = NULL, hash = TRUE) } \arguments{ \item{path}{character vector of paths to watch. Omit trailing backslash.} \item{callback}{function called everytime a change occurs. It should have three parameters: added, deleted, modified, and should return TRUE to keep watching, or FALSE to stop.} \item{pattern}{file pattern passed to \code{\link[=dir]{dir()}}} \item{hash}{hashes are more accurate at detecting changes, but are slower for large files. When FALSE, uses modification time stamps} } \description{ This is used to power the \code{\link[=auto_test]{auto_test()}} and \code{\link[=auto_test_package]{auto_test_package()}} functions which are used to rerun tests whenever source code changes. } \details{ Use Ctrl + break (windows), Esc (mac gui) or Ctrl + C (command line) to stop the watcher. } \keyword{internal}
seed <- 342 log.wt <- 0.0 penalty <- 2.8115950178536287e-8 intervals.send <- c() intervals.recv <- c(56, 112, 225, 450, 900, 1800, 3600, 7200, 14400, 28800, 57600, 115200, 230400, 460800, 921600, 1843200, 3686400, 7372800, 14745600, 29491200, 58982400) dev.null <- 358759.0022669336 df.null <- 35567 dev.resid <- 226167.00235044342 df.resid <- 35402 df <- 165 coefs <- c(6.790845106117373, 5.737098439427963, 5.675782005325002, 5.344653068837055, 5.064705848361622, 4.76500165672019, 4.755429533798208, 4.676561337150504, 4.336734659718355, 4.250245483418125, 4.235804531329551, 4.14638616337982, 3.9839180700026238, 3.945053900124883, 3.7360592293308814, 3.515971547856865, 3.2447737282323055, 2.9448232180854643, 2.4594870808987808, 2.0748797444896754, 1.5216415497294673, 0.9521954179342118, 0.9970221815202441, 0.5079245766326584, 0.204612324952474, -0.9255738647451008, -0.1599709286944946, 1.1229700010531105, 1.0997867611491268, -1.6889468710986568, -2.623383108237885, -2.8036643856726147, -0.35882027893364077, 0.7709098590359476, 1.2336333858737705, -1.1317325047760587, 0.8384422010398739, -1.4331500374507786, 0.23069116676404602, -1.3183210426399556, 1.0195960167600944, 0.8631677168441598, -0.8643596281771939, -2.6625812918775815, -0.8752538165861484, -0.5992808795922524, -0.5906134047994189, 9.944830192057938e-2, 0.4379305048368973, -0.5457675343514404, -0.2707086168073308, 0.7473080181553704, -2.784960777269633, 1.6453134799744773, 0.78480370609113, 1.1247977726147083, -2.1410910219767705, -0.34568287859261165, -0.6918285214733937, 1.2939594221307043, 0.8985938545311535, 0.8971174589940984, -2.0370230848455315, -0.8986636100917562, -0.5665209844082988, 0.25971414717104224, 0.6612809317496768, -7.643986687273446e-2, -1.5838099593994726, -0.5840553960420741, -1.9540264706110246, -0.6139848335789257, 0.4763487419156967, 1.0698581571262944, 0.8301553492593408, -0.45739731488427415, -1.3148867312810297, -1.5491758909274695, 0.14281887936245397, 0.7455872730075669, 1.287517859212263, 2.78556126352994e-2, 0.25175807315216037, -1.6179606007219347, -0.946114544926569, 0.42542149498717774, 1.2710158343817568, 0.48096324380564026, 0.9176889428195724, -1.862826414647925, 0.5181095287408145, 0.8472167617956549, 0.90197106387007, 0.3651519409339762, 0.19417561935858016, 1.4080213903953154, -0.3421518305774009, 9.413935320900704e-3, -0.12758711341393145, -4.121365228629297e-2, 0.23272121025577047, -0.122439973969776, 0.9656475131814233, 0.40729628629759834, 0.5545987384945829, 0.863799642328108, 1.0450603945342596, -0.6246812040210127, -0.6755073221344826, -0.9783290506141454, 0.4050413622988412, 0.55382235951153, 1.6430830490858397, -0.8032538749275443, -0.38175167049647635, -1.1279904421530256, 0.8597609475028455, -0.22592519882820508, 0.5462324486566863, 0.6650577980071637, -0.23881301393731066, -0.4711469026187611, -1.1626988442188138, -0.2567285239055263, 0.34883415449412325, 0.9515135049333393, 9.460948604516535e-2, 1.0565959767686024, -0.5864338880880218, -0.33718161458250573, 0.2983935427998611, 0.9596231131229661, 0.9227898889517011, 0.4810596983455916, 4.666896825990316e-2, 1.091127101514808, -0.2790199199591993, 1.1042343582279388, 0.7506814263685173, 1.0747271562378828, 0.8927328463575381, -0.740893879942483, -1.1086987637761554, 0.7439283296973215, 0.5207691915284437, 0.5792379438702503, -0.2490648858703582, -0.7942053087800607, -1.868268123437045, 1.3494342890793056, 0.16339080513787094, 1.2887268750471617, -0.20400147430858892, -0.14689262528741534, -0.22110848523559484, -1.6896037888088262, -2.096899996180469, 0.8918587011359251, 1.2234807928864462, -0.22966127145260323, 1.5519464017904743, -0.1467344706589123, -0.21184786976551484, 0.12572788480685362, 1.2528289838553173)
/analysis/boot/boot342.R
no_license
patperry/interaction-proc
R
false
false
3,740
r
seed <- 342 log.wt <- 0.0 penalty <- 2.8115950178536287e-8 intervals.send <- c() intervals.recv <- c(56, 112, 225, 450, 900, 1800, 3600, 7200, 14400, 28800, 57600, 115200, 230400, 460800, 921600, 1843200, 3686400, 7372800, 14745600, 29491200, 58982400) dev.null <- 358759.0022669336 df.null <- 35567 dev.resid <- 226167.00235044342 df.resid <- 35402 df <- 165 coefs <- c(6.790845106117373, 5.737098439427963, 5.675782005325002, 5.344653068837055, 5.064705848361622, 4.76500165672019, 4.755429533798208, 4.676561337150504, 4.336734659718355, 4.250245483418125, 4.235804531329551, 4.14638616337982, 3.9839180700026238, 3.945053900124883, 3.7360592293308814, 3.515971547856865, 3.2447737282323055, 2.9448232180854643, 2.4594870808987808, 2.0748797444896754, 1.5216415497294673, 0.9521954179342118, 0.9970221815202441, 0.5079245766326584, 0.204612324952474, -0.9255738647451008, -0.1599709286944946, 1.1229700010531105, 1.0997867611491268, -1.6889468710986568, -2.623383108237885, -2.8036643856726147, -0.35882027893364077, 0.7709098590359476, 1.2336333858737705, -1.1317325047760587, 0.8384422010398739, -1.4331500374507786, 0.23069116676404602, -1.3183210426399556, 1.0195960167600944, 0.8631677168441598, -0.8643596281771939, -2.6625812918775815, -0.8752538165861484, -0.5992808795922524, -0.5906134047994189, 9.944830192057938e-2, 0.4379305048368973, -0.5457675343514404, -0.2707086168073308, 0.7473080181553704, -2.784960777269633, 1.6453134799744773, 0.78480370609113, 1.1247977726147083, -2.1410910219767705, -0.34568287859261165, -0.6918285214733937, 1.2939594221307043, 0.8985938545311535, 0.8971174589940984, -2.0370230848455315, -0.8986636100917562, -0.5665209844082988, 0.25971414717104224, 0.6612809317496768, -7.643986687273446e-2, -1.5838099593994726, -0.5840553960420741, -1.9540264706110246, -0.6139848335789257, 0.4763487419156967, 1.0698581571262944, 0.8301553492593408, -0.45739731488427415, -1.3148867312810297, -1.5491758909274695, 0.14281887936245397, 0.7455872730075669, 1.287517859212263, 2.78556126352994e-2, 0.25175807315216037, -1.6179606007219347, -0.946114544926569, 0.42542149498717774, 1.2710158343817568, 0.48096324380564026, 0.9176889428195724, -1.862826414647925, 0.5181095287408145, 0.8472167617956549, 0.90197106387007, 0.3651519409339762, 0.19417561935858016, 1.4080213903953154, -0.3421518305774009, 9.413935320900704e-3, -0.12758711341393145, -4.121365228629297e-2, 0.23272121025577047, -0.122439973969776, 0.9656475131814233, 0.40729628629759834, 0.5545987384945829, 0.863799642328108, 1.0450603945342596, -0.6246812040210127, -0.6755073221344826, -0.9783290506141454, 0.4050413622988412, 0.55382235951153, 1.6430830490858397, -0.8032538749275443, -0.38175167049647635, -1.1279904421530256, 0.8597609475028455, -0.22592519882820508, 0.5462324486566863, 0.6650577980071637, -0.23881301393731066, -0.4711469026187611, -1.1626988442188138, -0.2567285239055263, 0.34883415449412325, 0.9515135049333393, 9.460948604516535e-2, 1.0565959767686024, -0.5864338880880218, -0.33718161458250573, 0.2983935427998611, 0.9596231131229661, 0.9227898889517011, 0.4810596983455916, 4.666896825990316e-2, 1.091127101514808, -0.2790199199591993, 1.1042343582279388, 0.7506814263685173, 1.0747271562378828, 0.8927328463575381, -0.740893879942483, -1.1086987637761554, 0.7439283296973215, 0.5207691915284437, 0.5792379438702503, -0.2490648858703582, -0.7942053087800607, -1.868268123437045, 1.3494342890793056, 0.16339080513787094, 1.2887268750471617, -0.20400147430858892, -0.14689262528741534, -0.22110848523559484, -1.6896037888088262, -2.096899996180469, 0.8918587011359251, 1.2234807928864462, -0.22966127145260323, 1.5519464017904743, -0.1467344706589123, -0.21184786976551484, 0.12572788480685362, 1.2528289838553173)
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/lactin2_1995.R \name{lactin2_1995} \alias{lactin2_1995} \title{Lactin2 model for fitting thermal performance curves} \usage{ lactin2_1995(temp, a, b, tmax, delta_t) } \arguments{ \item{temp}{temperature in degrees centigrade} \item{a}{constant that determines the steepness of the rising portion of the curve} \item{b}{constant that determines the height of the overall curve} \item{tmax}{the temperature at which the curve begins to decelerate beyond the optimum (ºC)} \item{delta_t}{thermal safety margin (ºC)} } \value{ a numeric vector of rate values based on the temperatures and parameter values provided to the function } \description{ Lactin2 model for fitting thermal performance curves } \details{ Equation: \deqn{rate= = exp^{a \cdot temp} - exp^{a \cdot t_{max} - \bigg(\frac{t_{max} - temp}{\delta _{t}}\bigg)} + b}{% rate = exp(a.temp) - exp(a.tmax - ((tmax - temp) / delta_t)) + b} Start values in \code{get_start_vals} are derived from the data or sensible values from the literature. Limits in \code{get_lower_lims} and \code{get_upper_lims} are derived from the data or based extreme values that are unlikely to occur in ecological settings. } \note{ Generally we found this model easy to fit. } \examples{ # load in ggplot library(ggplot2) # subset for the first TPC curve data('chlorella_tpc') d <- subset(chlorella_tpc, curve_id == 1) # get start values and fit model start_vals <- get_start_vals(d$temp, d$rate, model_name = 'lactin2_1995') # fit model mod <- nls.multstart::nls_multstart(rate~lactin2_1995(temp = temp, a, b, tmax, delta_t), data = d, iter = c(3,3,3,3), start_lower = start_vals - 10, start_upper = start_vals + 10, lower = get_lower_lims(d$temp, d$rate, model_name = 'lactin2_1995'), upper = get_upper_lims(d$temp, d$rate, model_name = 'lactin2_1995'), supp_errors = 'Y', convergence_count = FALSE) # look at model fit summary(mod) # get predictions preds <- data.frame(temp = seq(min(d$temp), max(d$temp), length.out = 100)) preds <- broom::augment(mod, newdata = preds) # plot ggplot(preds) + geom_point(aes(temp, rate), d) + geom_line(aes(temp, .fitted), col = 'blue') + theme_bw() } \references{ Lactin, D.J., Holliday, N.J., Johnson, D.L. & Craigen, R. Improved rate models of temperature-dependent development by arthropods. Environmental Entomology 24, 69-75 (1995) }
/man/lactin2_1995.Rd
no_license
padpadpadpad/rTPC
R
false
true
2,408
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/lactin2_1995.R \name{lactin2_1995} \alias{lactin2_1995} \title{Lactin2 model for fitting thermal performance curves} \usage{ lactin2_1995(temp, a, b, tmax, delta_t) } \arguments{ \item{temp}{temperature in degrees centigrade} \item{a}{constant that determines the steepness of the rising portion of the curve} \item{b}{constant that determines the height of the overall curve} \item{tmax}{the temperature at which the curve begins to decelerate beyond the optimum (ºC)} \item{delta_t}{thermal safety margin (ºC)} } \value{ a numeric vector of rate values based on the temperatures and parameter values provided to the function } \description{ Lactin2 model for fitting thermal performance curves } \details{ Equation: \deqn{rate= = exp^{a \cdot temp} - exp^{a \cdot t_{max} - \bigg(\frac{t_{max} - temp}{\delta _{t}}\bigg)} + b}{% rate = exp(a.temp) - exp(a.tmax - ((tmax - temp) / delta_t)) + b} Start values in \code{get_start_vals} are derived from the data or sensible values from the literature. Limits in \code{get_lower_lims} and \code{get_upper_lims} are derived from the data or based extreme values that are unlikely to occur in ecological settings. } \note{ Generally we found this model easy to fit. } \examples{ # load in ggplot library(ggplot2) # subset for the first TPC curve data('chlorella_tpc') d <- subset(chlorella_tpc, curve_id == 1) # get start values and fit model start_vals <- get_start_vals(d$temp, d$rate, model_name = 'lactin2_1995') # fit model mod <- nls.multstart::nls_multstart(rate~lactin2_1995(temp = temp, a, b, tmax, delta_t), data = d, iter = c(3,3,3,3), start_lower = start_vals - 10, start_upper = start_vals + 10, lower = get_lower_lims(d$temp, d$rate, model_name = 'lactin2_1995'), upper = get_upper_lims(d$temp, d$rate, model_name = 'lactin2_1995'), supp_errors = 'Y', convergence_count = FALSE) # look at model fit summary(mod) # get predictions preds <- data.frame(temp = seq(min(d$temp), max(d$temp), length.out = 100)) preds <- broom::augment(mod, newdata = preds) # plot ggplot(preds) + geom_point(aes(temp, rate), d) + geom_line(aes(temp, .fitted), col = 'blue') + theme_bw() } \references{ Lactin, D.J., Holliday, N.J., Johnson, D.L. & Craigen, R. Improved rate models of temperature-dependent development by arthropods. Environmental Entomology 24, 69-75 (1995) }
#'countsAll #' #'@docType data #'@name countsAll #'@format data.frame NULL
/R/countsAll.R
no_license
mi2-warsaw/directRNAExplorer
R
false
false
74
r
#'countsAll #' #'@docType data #'@name countsAll #'@format data.frame NULL
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/redshift-utils.R \name{temp_table_name} \alias{temp_table_name} \title{Generate names for temp tables} \usage{ temp_table_name(n = 1, prefix = "tt_") } \arguments{ \item{n}{integer. The number of names to generate} \item{prefix}{character. The prefix to use for the table name, defaults to tt_} } \value{ } \description{ Generates uuids (without dashes) to use as names for temp tables and adds a prefix. }
/man/temp_table_name.Rd
permissive
zapier/redshiftTools
R
false
true
487
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/redshift-utils.R \name{temp_table_name} \alias{temp_table_name} \title{Generate names for temp tables} \usage{ temp_table_name(n = 1, prefix = "tt_") } \arguments{ \item{n}{integer. The number of names to generate} \item{prefix}{character. The prefix to use for the table name, defaults to tt_} } \value{ } \description{ Generates uuids (without dashes) to use as names for temp tables and adds a prefix. }
#' Calculate Black-Scholes implied volatility #' #' @param price (vector of) option price #' @param strike (vector of) strike price #' @param spot (vector of) spot price #' @param texp (vector of) time to expiry #' @param intr interest rate #' @param divr dividend rate #' @param cp call/put sign. \code{1} for call, \code{-1} for put. #' @param forward forward price. If given, \code{forward} overrides \code{spot} #' @param df discount factor. If given, \code{df} overrides \code{intr} #' @return Black-Scholes implied volatility #' #' @references Giner, G., & Smyth, G. K. (2016). statmod: Probability Calculations #' for the Inverse Gaussian Distribution. The R Journal, 8(1), 339-351. #' \url{https://doi.org/10.32614/RJ-2016-024} #' #' @export #' #' @examples #' spot <- 100 #' strike <- 100 #' texp <- 1.2 #' sigma <- 0.2 #' intr <- 0.05 #' price <- 20 #' FER::BlackScholesImpvol(price, strike, spot, texp, intr=intr) #' #' @seealso \code{\link{BlackScholesPrice}} #' BlackScholesImpvol <- function( price, strike=forward, spot, texp=1, intr=0, divr=0, cp=1L, forward=spot*exp(-divr*texp)/df, df=exp(-intr*texp) ){ optval <- (price/df - pmax(cp*(forward-strike), 0))/pmin(forward, strike) # we use inverse CDF of inversegaussian distribution mu <- 2/abs(log(strike/forward)) x <- statmod::qinvgauss(optval, mean=mu, lower.tail=F) sig <- 2/sqrt(x*texp) return( sig ) }
/pkg/R/blackscholes_impvol.R
permissive
daifengqi/FE-R
R
false
false
1,398
r
#' Calculate Black-Scholes implied volatility #' #' @param price (vector of) option price #' @param strike (vector of) strike price #' @param spot (vector of) spot price #' @param texp (vector of) time to expiry #' @param intr interest rate #' @param divr dividend rate #' @param cp call/put sign. \code{1} for call, \code{-1} for put. #' @param forward forward price. If given, \code{forward} overrides \code{spot} #' @param df discount factor. If given, \code{df} overrides \code{intr} #' @return Black-Scholes implied volatility #' #' @references Giner, G., & Smyth, G. K. (2016). statmod: Probability Calculations #' for the Inverse Gaussian Distribution. The R Journal, 8(1), 339-351. #' \url{https://doi.org/10.32614/RJ-2016-024} #' #' @export #' #' @examples #' spot <- 100 #' strike <- 100 #' texp <- 1.2 #' sigma <- 0.2 #' intr <- 0.05 #' price <- 20 #' FER::BlackScholesImpvol(price, strike, spot, texp, intr=intr) #' #' @seealso \code{\link{BlackScholesPrice}} #' BlackScholesImpvol <- function( price, strike=forward, spot, texp=1, intr=0, divr=0, cp=1L, forward=spot*exp(-divr*texp)/df, df=exp(-intr*texp) ){ optval <- (price/df - pmax(cp*(forward-strike), 0))/pmin(forward, strike) # we use inverse CDF of inversegaussian distribution mu <- 2/abs(log(strike/forward)) x <- statmod::qinvgauss(optval, mean=mu, lower.tail=F) sig <- 2/sqrt(x*texp) return( sig ) }
#!/usr/bin/env Rscript library(data.table) library(GagnonMR) library(tidyverse) library(furrr) setwd("/mnt/sda/gagelo01/Projects/small_MR_exploration/replication_will_clean") gwasvcf::set_bcftools() gwasvcf::set_plink() ldref <-"/home/couchr02/Mendel_Commun/Christian/LDlocal/EUR_rs" harm <- fread("Data/Modified/harm_class.txt") harm <- harm[class != "WHRonly-"] #there is no value at doing the analysis on WHRonly- all_mr_methods_safely <- safely(GagnonMR::all_mr_methods) options(future.globals.maxSize= 5e9) plan(multisession, workers = 6, gc = TRUE) #I should try using multicore res <- future_map(split(harm, harm$exposure_outcome),function(x) {all_mr_methods(x)}, .options = furrr_options(seed = TRUE)) %>% rbindlist(.,fill = TRUE) fwrite(res, "Data/Modified/res_class.txt") message("This script finished without errors")
/Analysis/2bb_reswinkler.R
no_license
LaboArsenault/BMI_WC_NAFLD
R
false
false
836
r
#!/usr/bin/env Rscript library(data.table) library(GagnonMR) library(tidyverse) library(furrr) setwd("/mnt/sda/gagelo01/Projects/small_MR_exploration/replication_will_clean") gwasvcf::set_bcftools() gwasvcf::set_plink() ldref <-"/home/couchr02/Mendel_Commun/Christian/LDlocal/EUR_rs" harm <- fread("Data/Modified/harm_class.txt") harm <- harm[class != "WHRonly-"] #there is no value at doing the analysis on WHRonly- all_mr_methods_safely <- safely(GagnonMR::all_mr_methods) options(future.globals.maxSize= 5e9) plan(multisession, workers = 6, gc = TRUE) #I should try using multicore res <- future_map(split(harm, harm$exposure_outcome),function(x) {all_mr_methods(x)}, .options = furrr_options(seed = TRUE)) %>% rbindlist(.,fill = TRUE) fwrite(res, "Data/Modified/res_class.txt") message("This script finished without errors")
# Programmed by Daniel Fuller # Canada Research Chair in Population Physical Activity # School of Human Kinetics and Recreation # Memorial University of Newfoundland # dfuller [AT] mun [DOT] ca | www.walkabilly.ca/home/ # Modified by Javad Rahimipour Anaraki on 28/11/17 updated 21/06/18 # Ph.D. Candidate # Department of Computer Science # Memorial University of Newfoundland # jra066 [AT] mun [DOT] ca | www.cs.mun.ca/~jra066 # Modified by Hui (Henry) Luan # Postdoc Fellow # School of Human Kinetics and Recreation # Memorial University of Newfoundland # hluan [AT] mun [DOT] ca # input: accel_sec_geneav raw CSV data files # output: Clean and collapsed to second level CSV data files rm(list = ls()) #========================Libraries========================= list.of.packages <- c("lubridate", "stringr", "data.table", "dplyr", "car", "kimisc") new.packages <- list.of.packages[!(list.of.packages %in% installed.packages()[, "Package"])] if (length(new.packages)) install.packages(new.packages) library(lubridate) library(stringr) library(data.table) library(dplyr) library(car) library(kimisc) #=========================Variables======================== OS <- Sys.info() if (OS["sysname"] == "Windows") { path <- "Z:/HeroX/data/GENEActiv/" intrPath <- "Z:/HeroX/data/" } else { path <- "/HeroX/data/GENEActiv/" intrPath <- "/HeroX/data/" } setwd(path) wear_loc <- "wrist" #Timezone timeZone <- "America/St_Johns" Sys.setenv(TZ = timeZone) #Required user id to be processed participants <- list.dirs(path = path, full.names = FALSE, recursive = FALSE) #====================Read in data files==================== for (j in 1:length(participants)) { uid <- participants[j] print(uid) filenames <- dir(paste0(path, uid), pattern = "([0-9].csv)", full.names = TRUE) intervals <- read.csv(paste(intrPath, "intervals.csv", sep = ""), sep = ",") #=====================Data prepration====================== nFiles <- length(filenames) if (nFiles > 0) { for (i in 1:nFiles) { if (file.size(filenames[i]) == 0 | file.exists(paste0(path, uid, "/", unlist(strsplit( basename(filenames[i]), "[.]" ))[1], "_labeled.csv"))) { print(paste0("GENEActiv file for ", uid, " exists")) next } accel_data <- fread( filenames[i], skip = 99, header = FALSE, col.names = c( "time", "x_axis", "y_axis", "z_axis", "lux", "button", "temp" ), select = 1:7, sep = ",", data.table = FALSE, nThread = 4 ) #Filtering data out based on uid and start and end date usrInfo <- intervals[intervals[, "userid"] == uid,] startDate <- as.character(usrInfo[, "start"]) endDate <- as.character(usrInfo[, "end"]) #Cut data based on start and end dates accel_data <- accel_data[(substring(format.Date(accel_data[, "time"]), 1, 10) >= format.Date(startDate)),] accel_data <- accel_data[(substring(format.Date(accel_data[, "time"]), 1, 10) <= format.Date(endDate)),] fileName <- paste0(path, uid, "/", unlist(strsplit(basename(filenames), "[.]"))[1], "_labeled.csv") if (nrow(accel_data) == 0) { print(paste0("No data from ", startDate, " to ", endDate)) file.create(fileName) next } #Correct time accel_data$time1 <- str_sub(accel_data$time, 1, str_length(accel_data$time) - 4) ## Remove the milliseconds accel_data$time2 <- ymd_hms(accel_data$time1) ## Create a POSIXct formated variable accel_data$day <- day(accel_data$time2) ## Create a day variable accel_data$hour <- hour(accel_data$time2) ## Create an hour variable accel_data$minute <- minute(accel_data$time2) ## Create a minute variable accel_data$second <- second(accel_data$time2) ## Create a second variable #Calculate vector magnitude accel_data$vec_mag = sqrt(accel_data$x_axis ^ 2 + accel_data$y_axis ^ 2 + accel_data$z_axis ^ 2) accel_data$vec_mag_g = accel_data$vec_mag - 1 #Collapse data to one second accel_sec_genea <- accel_data %>% group_by(day, hour, minute, second) %>% summarise( time = first(time), m_x_axis = mean(x_axis), m_y_axis = mean(y_axis), m_z_axis = mean(z_axis), vec_mag = mean(vec_mag), vec_mag_g = mean(abs(vec_mag_g)), vec_mag_median = median(vec_mag), vec_mag_g_median = median(abs(vec_mag_g)), sd_x_axis = sd(x_axis), sd_y_axis = sd(y_axis), sd_z_axis = sd(z_axis) ) accel_sec_genea$activity_mean <- car::recode( accel_sec_genea$vec_mag_g, "lo:0.190='1.Sedentary'; 0.190:0.314='2.Light'; 0.314:0.9989='3.Moderate'; 0.9989:hi='4.Vigorous';", as.factor = TRUE ) accel_sec_genea$activity_median <- car::recode( accel_sec_genea$vec_mag_g_median, "lo:0.190='1.Sedentary'; 0.190:0.314='2.Light'; 0.314:0.9989='3.Moderate'; 0.9989:hi='4.Vigorous';", as.factor = TRUE ) #===========================Sleep========================== x <- accel_sec_genea$m_x_axis y <- accel_sec_genea$m_y_axis z <- accel_sec_genea$m_z_axis accel_sec_genea$angle <- atan(z / sqrt(x ^ 2 + y ^ 2)) * 180 / pi start_id <- seq.int(1, nrow(accel_sec_genea) - 1, by = 5) end_id <- c((start_id - 1)[2:length(start_id)], nrow(accel_sec_genea)) mean_angle5s <- sapply(1:length(start_id), function(i) { mean(accel_sec_genea$angle[start_id[i]:end_id[i]]) }) flag_s <- seq(1, length(mean_angle5s)) flag_e <- flag_s + 1 flag_e <- flag_e[-length(flag_e)] flag <- sapply(1:length(flag_e), function(i) { ifelse(abs(mean_angle5s[flag_e[i]] - mean_angle5s[flag_s[i]]) <= 5, 1, 0) }) flag_final <- c(1, flag) zero_IDs <- which(flag_final == 0) zero_s <- zero_IDs[-length(zero_IDs)] zero_e <- zero_IDs[-1] for (i in 1:length(zero_s)) { if ((zero_e[i] - zero_s[i]) < 121 && (zero_e[i] - zero_s[i]) > 1) flag_final[(zero_s[i] + 1):(zero_e[i] - 1)] = 0 } # Reverse to second-level flag_second <- rep(flag_final, each = 5) sleep_id <- which(flag_second == 1) activity_final <- as.character(accel_sec_genea$activity_mean) activity_final[sleep_id] <- "0.Sleep" accel_sec_genea$activity_final <- activity_final[1:nrow(accel_sec_genea)] table(accel_sec_genea$activity_final) #=========================Exporting======================== #Save the results as a CSV file write.csv(accel_sec_genea, fileName, row.names = FALSE) } } }
/GENEActiv/GENEActivDataPrep.R
no_license
walkabillylab/wearable_device_classification
R
false
false
7,536
r
# Programmed by Daniel Fuller # Canada Research Chair in Population Physical Activity # School of Human Kinetics and Recreation # Memorial University of Newfoundland # dfuller [AT] mun [DOT] ca | www.walkabilly.ca/home/ # Modified by Javad Rahimipour Anaraki on 28/11/17 updated 21/06/18 # Ph.D. Candidate # Department of Computer Science # Memorial University of Newfoundland # jra066 [AT] mun [DOT] ca | www.cs.mun.ca/~jra066 # Modified by Hui (Henry) Luan # Postdoc Fellow # School of Human Kinetics and Recreation # Memorial University of Newfoundland # hluan [AT] mun [DOT] ca # input: accel_sec_geneav raw CSV data files # output: Clean and collapsed to second level CSV data files rm(list = ls()) #========================Libraries========================= list.of.packages <- c("lubridate", "stringr", "data.table", "dplyr", "car", "kimisc") new.packages <- list.of.packages[!(list.of.packages %in% installed.packages()[, "Package"])] if (length(new.packages)) install.packages(new.packages) library(lubridate) library(stringr) library(data.table) library(dplyr) library(car) library(kimisc) #=========================Variables======================== OS <- Sys.info() if (OS["sysname"] == "Windows") { path <- "Z:/HeroX/data/GENEActiv/" intrPath <- "Z:/HeroX/data/" } else { path <- "/HeroX/data/GENEActiv/" intrPath <- "/HeroX/data/" } setwd(path) wear_loc <- "wrist" #Timezone timeZone <- "America/St_Johns" Sys.setenv(TZ = timeZone) #Required user id to be processed participants <- list.dirs(path = path, full.names = FALSE, recursive = FALSE) #====================Read in data files==================== for (j in 1:length(participants)) { uid <- participants[j] print(uid) filenames <- dir(paste0(path, uid), pattern = "([0-9].csv)", full.names = TRUE) intervals <- read.csv(paste(intrPath, "intervals.csv", sep = ""), sep = ",") #=====================Data prepration====================== nFiles <- length(filenames) if (nFiles > 0) { for (i in 1:nFiles) { if (file.size(filenames[i]) == 0 | file.exists(paste0(path, uid, "/", unlist(strsplit( basename(filenames[i]), "[.]" ))[1], "_labeled.csv"))) { print(paste0("GENEActiv file for ", uid, " exists")) next } accel_data <- fread( filenames[i], skip = 99, header = FALSE, col.names = c( "time", "x_axis", "y_axis", "z_axis", "lux", "button", "temp" ), select = 1:7, sep = ",", data.table = FALSE, nThread = 4 ) #Filtering data out based on uid and start and end date usrInfo <- intervals[intervals[, "userid"] == uid,] startDate <- as.character(usrInfo[, "start"]) endDate <- as.character(usrInfo[, "end"]) #Cut data based on start and end dates accel_data <- accel_data[(substring(format.Date(accel_data[, "time"]), 1, 10) >= format.Date(startDate)),] accel_data <- accel_data[(substring(format.Date(accel_data[, "time"]), 1, 10) <= format.Date(endDate)),] fileName <- paste0(path, uid, "/", unlist(strsplit(basename(filenames), "[.]"))[1], "_labeled.csv") if (nrow(accel_data) == 0) { print(paste0("No data from ", startDate, " to ", endDate)) file.create(fileName) next } #Correct time accel_data$time1 <- str_sub(accel_data$time, 1, str_length(accel_data$time) - 4) ## Remove the milliseconds accel_data$time2 <- ymd_hms(accel_data$time1) ## Create a POSIXct formated variable accel_data$day <- day(accel_data$time2) ## Create a day variable accel_data$hour <- hour(accel_data$time2) ## Create an hour variable accel_data$minute <- minute(accel_data$time2) ## Create a minute variable accel_data$second <- second(accel_data$time2) ## Create a second variable #Calculate vector magnitude accel_data$vec_mag = sqrt(accel_data$x_axis ^ 2 + accel_data$y_axis ^ 2 + accel_data$z_axis ^ 2) accel_data$vec_mag_g = accel_data$vec_mag - 1 #Collapse data to one second accel_sec_genea <- accel_data %>% group_by(day, hour, minute, second) %>% summarise( time = first(time), m_x_axis = mean(x_axis), m_y_axis = mean(y_axis), m_z_axis = mean(z_axis), vec_mag = mean(vec_mag), vec_mag_g = mean(abs(vec_mag_g)), vec_mag_median = median(vec_mag), vec_mag_g_median = median(abs(vec_mag_g)), sd_x_axis = sd(x_axis), sd_y_axis = sd(y_axis), sd_z_axis = sd(z_axis) ) accel_sec_genea$activity_mean <- car::recode( accel_sec_genea$vec_mag_g, "lo:0.190='1.Sedentary'; 0.190:0.314='2.Light'; 0.314:0.9989='3.Moderate'; 0.9989:hi='4.Vigorous';", as.factor = TRUE ) accel_sec_genea$activity_median <- car::recode( accel_sec_genea$vec_mag_g_median, "lo:0.190='1.Sedentary'; 0.190:0.314='2.Light'; 0.314:0.9989='3.Moderate'; 0.9989:hi='4.Vigorous';", as.factor = TRUE ) #===========================Sleep========================== x <- accel_sec_genea$m_x_axis y <- accel_sec_genea$m_y_axis z <- accel_sec_genea$m_z_axis accel_sec_genea$angle <- atan(z / sqrt(x ^ 2 + y ^ 2)) * 180 / pi start_id <- seq.int(1, nrow(accel_sec_genea) - 1, by = 5) end_id <- c((start_id - 1)[2:length(start_id)], nrow(accel_sec_genea)) mean_angle5s <- sapply(1:length(start_id), function(i) { mean(accel_sec_genea$angle[start_id[i]:end_id[i]]) }) flag_s <- seq(1, length(mean_angle5s)) flag_e <- flag_s + 1 flag_e <- flag_e[-length(flag_e)] flag <- sapply(1:length(flag_e), function(i) { ifelse(abs(mean_angle5s[flag_e[i]] - mean_angle5s[flag_s[i]]) <= 5, 1, 0) }) flag_final <- c(1, flag) zero_IDs <- which(flag_final == 0) zero_s <- zero_IDs[-length(zero_IDs)] zero_e <- zero_IDs[-1] for (i in 1:length(zero_s)) { if ((zero_e[i] - zero_s[i]) < 121 && (zero_e[i] - zero_s[i]) > 1) flag_final[(zero_s[i] + 1):(zero_e[i] - 1)] = 0 } # Reverse to second-level flag_second <- rep(flag_final, each = 5) sleep_id <- which(flag_second == 1) activity_final <- as.character(accel_sec_genea$activity_mean) activity_final[sleep_id] <- "0.Sleep" accel_sec_genea$activity_final <- activity_final[1:nrow(accel_sec_genea)] table(accel_sec_genea$activity_final) #=========================Exporting======================== #Save the results as a CSV file write.csv(accel_sec_genea, fileName, row.names = FALSE) } } }
#################### ## Function for visualizing univariate relations #################### VisualizeRelation <- function(data=deer[["summer"]],model=GLMMs[["summer"]],predvar="dist_to_water",type="RF"){ len <- 100 isfac <- is.factor(data[[predvar]]) dataclasses <- sapply(data,class) if(!isfac){ if(type=="GLMM"){ standvar <- sprintf("stand_%s",predvar) }else{ standvar <- predvar } dim <- data[,standvar] range <- seq(min(dim),max(dim),length=len) realmean <- mean(data[,predvar]) realsd <- sd(data[,predvar]) newdata <- data.frame(temp=range) # head(newdata,50) names(newdata) <- c(standvar) if(type=="GLMM"){ allvars <- names(model@frame) }else{ allvars <- pred.names } othervars <- allvars[!allvars%in%c(standvar,"used")] }else{ faclevs <- levels(data[[predvar]]) newdata <- data.frame(temp=factor(faclevs,levels=faclevs)) names(newdata) <- c(predvar) if(type=="GLMM"){ allvars <- names(model@frame) }else{ allvars <- pred.names } othervars <- allvars[!allvars%in%c(predvar,"used")] } var = othervars[2] for(var in othervars){ thisvar <- data[,var] if(is.factor(thisvar)){ tab <- table(thisvar) vals <- names(tab) levs <- levels(thisvar) mostcom <- vals[which.max(tab)] newvec <- factor(rep(mostcom,times=nrow(newdata)),levels=levs) newdata[,var] <- newvec }else{ newdata[,var] <- mean(thisvar) } } if(type=="GLMM"){ pred <- plogis(predict(model,newdata)) }else{ i=pred.names[3] for(i in pred.names){ if(dataclasses[i]=="integer") newdata[,i] <- as.integer(round(newdata[,i])) } pred <- numeric(nrow(newdata)) i=1 for(i in 1:nrow(newdata)){ pred[i]<-as.numeric(predict(model,newdata[i,],OOB=TRUE,type="prob")[[1]][,2]) } } if(!isfac){ plot(range,pred,xlab=predictorNames[pred.names==predvar],ylab="Use probability",type="l",lwd=2,xaxt="n") ats <- seq(min(range),max(range),length=6) if(type=="GLMM"){ axis(1,ats,labels = round(realmean+ats*realsd)) }else{ axis(1,ats,labels = round(ats)) } rug(jitter(data[seq(1,nrow(data),50),standvar]), ticksize = 0.03, side = 1, lwd = 0.5, col = par("fg")) }else{ par(mai=c(1.5,1,1,.2)) plot(pred~newdata[,1],xlab="",main=predictorNames[pred.names==predvar],ylab="Use probability",lwd=2,las=2) } } #################### ## Function for visualizing interactions #################### VisualizeInteraction <- function(data=deer[["summer"]],model=GLMMs[["summer"]],var1="dist_to_water",var2="elevation",type="GLMM"){ len <- 50 if(type=="GLMM"){ standvar1 <- sprintf("stand_%s",var1) standvar2 <- sprintf("stand_%s",var2) realmean1 <- mean(data[,var1]) realsd1 <- sd(data[,var1]) realmean2 <- mean(data[,var2]) realsd2 <- sd(data[,var2]) }else{ standvar1 <- var1 standvar2 <- var2 } firstdim <- data[,standvar1] seconddim <- data[,standvar2] range1 <- seq(min(firstdim),max(firstdim),length=len) range2 <- seq(min(seconddim),max(seconddim),length=len) newdata <- expand.grid(range1,range2) # head(newdata,50) names(newdata) <- c(standvar1,standvar2) if(type=="GLMM"){ allvars <- names(model@frame) }else{ allvars <- pred.names } othervars <- allvars[!allvars%in%c(standvar1,standvar2,"used")] var = othervars[2] for(var in othervars){ thisvar <- data[,var] if(is.factor(thisvar)){ tab <- table(thisvar) vals <- names(tab) levs <- levels(thisvar) mostcom <- vals[which.max(tab)] newvec <- factor(rep(mostcom,times=nrow(newdata)),levels=levs) newdata[,var] <- newvec }else{ newdata[,var] <- mean(thisvar) } } if(type=="GLMM"){ pred <- plogis(predict(model,newdata)) }else{ i=pred.names[3] for(i in pred.names){ if(dataclasses[i]=="integer") newdata[,i] <- as.integer(round(newdata[,i])) } pred <- numeric(nrow(newdata)) i=1 for(i in 1:nrow(newdata)){ pred[i]<-as.numeric(predict(model,newdata[i,],OOB=TRUE,type="prob")[[1]][,2]) } } predmat <- matrix(pred,nrow=len,ncol=len) par(mai=c(0,0,0,0)) if(type=="GLMM"){ persp(realmean1+realsd1*range1,realmean2+realsd2*range2,predmat,xlab=var1,ylab=var2,theta = 55, phi = 40, r = sqrt(10), d = 3, ticktype = "detailed", mgp = c(4, 1, 0)) }else{ persp(range1,range2,predmat,xlab=var1,ylab=var2,theta = 55, phi = 40, r = sqrt(10), d = 3, ticktype = "detailed", mgp = c(4, 1, 0)) } } ##################### ## CROSS VALIDATION ##################### n.folds=3 type= "GLMM" #"RF" season="summer" fullmodel=GLMMs[[season]] #RFs[[season]] CrossValidateByDeer <- function(n.folds,season="summer",type="RF",plot=F){ uniquedeer <- as.character(unique(deer[[season]]$altid)) ndeer <- length(uniquedeer) folds_df <- data.frame( deer = uniquedeer, fold = rep_len(1:n.folds,ndeer) ) foldVector <- folds_df$fold[match(as.character(deer[[season]]$altid),folds_df$deer)] predictCols <- which(names(deer[[season]])%in%pred.names) if(type=="RF"){ fullmodel<-RFs[[season]] }else{ fullmodel <- GLMMs[[season]] } CVresults <- list() CVresults$CVpred <- numeric(nrow(deer[[season]])) CVresults$realpred <- numeric(nrow(deer[[season]])) CVresults$observed <- numeric(nrow(deer[[season]])) if(type=="RF"){ response="used_fac" #"resp_factor" }else{ response="used" #"resp_factor" } counter = 1 i=1 for(i in 1:n.folds){ if(type=="RF"){ model <- cforest(formula1, data = deer[[season]][which(foldVector!=i),], controls=cforestControl) predict_CV <- predict(model,newdata=deer[[season]][which(foldVector==i),],type="prob") predict_real <- predict(fullmodel,newdata=deer[[season]][which(foldVector==i),],type="prob") REAL <- deer[[season]]$used[which(foldVector==i)] j=1 for(j in 1:length(which(foldVector==i))){ CVresults$CVpred[counter] <- as.numeric(predict_CV[[j]][,2]) CVresults$observed[counter] <- as.numeric(REAL[j]) CVresults$realpred[counter] <- as.numeric(predict_real[[j]][,2]) counter = counter + 1 } }else{ if(season=="summer"){ model <- glmer(used~stand_dist_to_water + stand_cos_aspect + stand_sin_aspect + stand_elevation + stand_slope + veg_class + stand_elevation:stand_slope + stand_dist_to_water:stand_slope + stand_dist_to_water:stand_elevation + (1|altid), family="binomial", data=deer[[season]][which(foldVector!=i),],na.action="na.fail") }else{ model <- glmer(used~stand_dist_to_water + stand_cos_aspect + stand_sin_aspect + stand_elevation + stand_slope + veg_class + stand_elevation:stand_slope + stand_dist_to_water:stand_slope + (1|altid), family="binomial", data=deer[[season]][which(foldVector!=i),],na.action="na.fail") } CVresults$CVpred[which(foldVector==i)] <- plogis(predict(model,newdata=deer[[season]][which(foldVector==i),],allow.new.levels = TRUE)) CVresults$realpred[which(foldVector==i)] <- predict(fullmodel,newdata=deer[[season]][which(foldVector==i),],allow.new.levels = TRUE) CVresults$observed[which(foldVector==i)] <- deer[[season]]$used[which(foldVector==i)] } } CVresults$CV_RMSE = sqrt(mean((CVresults$observed-CVresults$CVpred)^2)) # root mean squared error for holdout samples in 10-fold cross-validation ... CVresults$real_RMSE = sqrt(mean((CVresults$observed-CVresults$realpred)^2)) # root mean squared error for residuals from final model # realprediction <- predict(rf_model1,newdata=df,type="prob") if(plot){ graphics.off() par(mfrow=c(2,1)) par(ask=T) pred <- prediction(CVresults$CVpred,CVresults$observed) # for holdout samples in cross-validation perf <- performance(pred,"tpr","fpr") auc <- performance(pred,"auc") plot(perf, main=sprintf("%s Cross Validation",type)) text(.9,.1,paste("AUC = ",round(auc@y.values[[1]],2),sep="")) pred <- prediction(CVresults$realpred,CVresults$observed) # for final model perf <- performance(pred,"tpr","fpr") auc <- performance(pred,"auc") plot(perf, main=sprintf("%s Full Model",type)) text(.9,.1,paste("AUC = ",round(auc@y.values[[1]],2),sep="")) }else{ pred <- prediction(CVresults$CVpred,CVresults$observed) # for holdout samples in cross-validation perf <- performance(pred,"tpr","fpr") CVresults$auc_CV <- performance(pred,"auc") pred <- prediction(CVresults$realpred,CVresults$observed) # for final model perf <- performance(pred,"tpr","fpr") CVresults$auc_full <- performance(pred,"auc") } # COHEN KAPPA statistics thresholds <- seq(0.01,0.99,length=101) # "artificial" extinction thresholds across which to examine performance kappa <- numeric(length(thresholds)) for(i in 1:length(thresholds)){ trueLabels <- CVresults$observed predLabels <- ifelse(CVresults$CVpred>=thresholds[i],1,0) tot <- length(CVresults$observed) tp <- length(which((trueLabels==1)&(predLabels==1))) tn <- length(which((trueLabels==0)&(predLabels==0))) fp <- length(which((trueLabels==0)&(predLabels==1))) fn <- length(which((trueLabels==1)&(predLabels==0))) pr_agree <- (tp+tn)/tot # overall agreement, or accuracy pr_agree_rand <- ((tp+fn)/tot)*((tp+fp)/tot)+((fn+tn)/tot)*((fp+tn)/tot) kappa[i] <- (pr_agree-pr_agree_rand)/(1-pr_agree_rand) } #plot(thresholds,kappa,type="l",xlab="Threshold", ylab="Cohen's Kappa", main="Holdout sample performance") # find threshold value associated with highest Kappa for C-V data CVresults$cutoff_CV <- thresholds[which.max(kappa)] # max kappa cutoff kappa <- numeric(length(thresholds)) for(i in 1:length(thresholds)){ trueLabels <- CVresults$observed predLabels <- ifelse(CVresults$realpred>=thresholds[i],1,0) tot <- length(CVresults$observed) tp <- length(which((trueLabels==1)&(predLabels==1))) tn <- length(which((trueLabels==0)&(predLabels==0))) fp <- length(which((trueLabels==0)&(predLabels==1))) fn <- length(which((trueLabels==1)&(predLabels==0))) pr_agree <- (tp+tn)/tot # overall agreement, or accuracy pr_agree_rand <- ((tp+fn)/tot)*((tp+fp)/tot)+((fn+tn)/tot)*((fp+tn)/tot) kappa[i] <- (pr_agree-pr_agree_rand)/(1-pr_agree_rand) } #plot(thresholds,kappa,type="l",xlab="Threshold", ylab="Cohen's Kappa", main="Performance: full model") CVresults$cutoff_full <- thresholds[which.max(kappa)] # max kappa cutoff ### display confusion matrix and kappa for a single threshold trueLabels <- CVresults$observed predLabels <- ifelse(CVresults$CVpred>=CVresults$cutoff_CV,1,0) tot <- length(CVresults$observed) tp <- length(which((trueLabels==1)&(predLabels==1))) tn <- length(which((trueLabels==0)&(predLabels==0))) fp <- length(which((trueLabels==0)&(predLabels==1))) fn <- length(which((trueLabels==1)&(predLabels==0))) pr_agree <- (tp+tn)/tot # overall agreement, or accuracy pr_agree_rand <- ((tp+fn)/tot)*((tp+fp)/tot)+((fn+tn)/tot)*((fp+tn)/tot) CVresults$bestkappa_CV <- (pr_agree-pr_agree_rand)/(1-pr_agree_rand) CVresults$confusionmat <- matrix(c(tn,fn,fp,tp),nrow=2,ncol=2) rownames(CVresults$confusionmat) <- c("Actual not used","Actual used") colnames(CVresults$confusionmat) <- c("Predicted not used","Predicted used") CVresults$sensitivity <- tp/(tp+fn) CVresults$specificity <- tn/(tn+fp) CVresults$toterror <- (fn+fp)/tot CVresults$CVpred[which(CVresults$CVpred==1)] <- 0.999999 CVresults$CVpred[which(CVresults$CVpred==0)] <- 0.000001 CVresults$realpred[which(CVresults$realpred==1)] <- 0.999999 CVresults$realpred[which(CVresults$realpred==0)] <- 0.000001 realdata = CVresults$observed fit_deviance_CV <- mean(-2*(dbinom(CVresults$observed,1,CVresults$CVpred,log=T)-dbinom(realdata,1,realdata,log=T))) fit_deviance_real <- mean(-2*(dbinom(CVresults$observed,1,CVresults$realpred,log=T)-dbinom(realdata,1,realdata,log=T))) null_deviance <- mean(-2*(dbinom(CVresults$observed,1,mean(CVresults$observed),log=T)-dbinom(realdata,1,realdata,log=T))) CVresults$deviance_explained_CV <- (null_deviance-fit_deviance_CV)/null_deviance # based on holdout samples CVresults$deviance_explained_real <- (null_deviance-fit_deviance_real)/null_deviance # based on full model... return(CVresults) } PlotPerformance <- function(CVresults){ graphics.off() par(mfrow=c(2,1)) #par(ask=T) pred <- prediction(CVresults$CVpred,CVresults$observed) # for holdout samples in cross-validation perf <- performance(pred,"tpr","fpr") auc <- performance(pred,"auc") plot(perf, main=sprintf("%s Cross Validation",type)) text(.9,.1,paste("AUC = ",round(auc@y.values[[1]],2),sep="")) pred <- prediction(CVresults$realpred,CVresults$observed) # for final model perf <- performance(pred,"tpr","fpr") auc <- performance(pred,"auc") plot(perf, main=sprintf("%s Full Model",type)) text(.9,.1,paste("AUC = ",round(auc@y.values[[1]],2),sep="")) }
/METHODS_PAPER_ALLFUNCTIONS.R
no_license
bniebuhr/Mule_Deer_RFvsRSF
R
false
false
13,416
r
#################### ## Function for visualizing univariate relations #################### VisualizeRelation <- function(data=deer[["summer"]],model=GLMMs[["summer"]],predvar="dist_to_water",type="RF"){ len <- 100 isfac <- is.factor(data[[predvar]]) dataclasses <- sapply(data,class) if(!isfac){ if(type=="GLMM"){ standvar <- sprintf("stand_%s",predvar) }else{ standvar <- predvar } dim <- data[,standvar] range <- seq(min(dim),max(dim),length=len) realmean <- mean(data[,predvar]) realsd <- sd(data[,predvar]) newdata <- data.frame(temp=range) # head(newdata,50) names(newdata) <- c(standvar) if(type=="GLMM"){ allvars <- names(model@frame) }else{ allvars <- pred.names } othervars <- allvars[!allvars%in%c(standvar,"used")] }else{ faclevs <- levels(data[[predvar]]) newdata <- data.frame(temp=factor(faclevs,levels=faclevs)) names(newdata) <- c(predvar) if(type=="GLMM"){ allvars <- names(model@frame) }else{ allvars <- pred.names } othervars <- allvars[!allvars%in%c(predvar,"used")] } var = othervars[2] for(var in othervars){ thisvar <- data[,var] if(is.factor(thisvar)){ tab <- table(thisvar) vals <- names(tab) levs <- levels(thisvar) mostcom <- vals[which.max(tab)] newvec <- factor(rep(mostcom,times=nrow(newdata)),levels=levs) newdata[,var] <- newvec }else{ newdata[,var] <- mean(thisvar) } } if(type=="GLMM"){ pred <- plogis(predict(model,newdata)) }else{ i=pred.names[3] for(i in pred.names){ if(dataclasses[i]=="integer") newdata[,i] <- as.integer(round(newdata[,i])) } pred <- numeric(nrow(newdata)) i=1 for(i in 1:nrow(newdata)){ pred[i]<-as.numeric(predict(model,newdata[i,],OOB=TRUE,type="prob")[[1]][,2]) } } if(!isfac){ plot(range,pred,xlab=predictorNames[pred.names==predvar],ylab="Use probability",type="l",lwd=2,xaxt="n") ats <- seq(min(range),max(range),length=6) if(type=="GLMM"){ axis(1,ats,labels = round(realmean+ats*realsd)) }else{ axis(1,ats,labels = round(ats)) } rug(jitter(data[seq(1,nrow(data),50),standvar]), ticksize = 0.03, side = 1, lwd = 0.5, col = par("fg")) }else{ par(mai=c(1.5,1,1,.2)) plot(pred~newdata[,1],xlab="",main=predictorNames[pred.names==predvar],ylab="Use probability",lwd=2,las=2) } } #################### ## Function for visualizing interactions #################### VisualizeInteraction <- function(data=deer[["summer"]],model=GLMMs[["summer"]],var1="dist_to_water",var2="elevation",type="GLMM"){ len <- 50 if(type=="GLMM"){ standvar1 <- sprintf("stand_%s",var1) standvar2 <- sprintf("stand_%s",var2) realmean1 <- mean(data[,var1]) realsd1 <- sd(data[,var1]) realmean2 <- mean(data[,var2]) realsd2 <- sd(data[,var2]) }else{ standvar1 <- var1 standvar2 <- var2 } firstdim <- data[,standvar1] seconddim <- data[,standvar2] range1 <- seq(min(firstdim),max(firstdim),length=len) range2 <- seq(min(seconddim),max(seconddim),length=len) newdata <- expand.grid(range1,range2) # head(newdata,50) names(newdata) <- c(standvar1,standvar2) if(type=="GLMM"){ allvars <- names(model@frame) }else{ allvars <- pred.names } othervars <- allvars[!allvars%in%c(standvar1,standvar2,"used")] var = othervars[2] for(var in othervars){ thisvar <- data[,var] if(is.factor(thisvar)){ tab <- table(thisvar) vals <- names(tab) levs <- levels(thisvar) mostcom <- vals[which.max(tab)] newvec <- factor(rep(mostcom,times=nrow(newdata)),levels=levs) newdata[,var] <- newvec }else{ newdata[,var] <- mean(thisvar) } } if(type=="GLMM"){ pred <- plogis(predict(model,newdata)) }else{ i=pred.names[3] for(i in pred.names){ if(dataclasses[i]=="integer") newdata[,i] <- as.integer(round(newdata[,i])) } pred <- numeric(nrow(newdata)) i=1 for(i in 1:nrow(newdata)){ pred[i]<-as.numeric(predict(model,newdata[i,],OOB=TRUE,type="prob")[[1]][,2]) } } predmat <- matrix(pred,nrow=len,ncol=len) par(mai=c(0,0,0,0)) if(type=="GLMM"){ persp(realmean1+realsd1*range1,realmean2+realsd2*range2,predmat,xlab=var1,ylab=var2,theta = 55, phi = 40, r = sqrt(10), d = 3, ticktype = "detailed", mgp = c(4, 1, 0)) }else{ persp(range1,range2,predmat,xlab=var1,ylab=var2,theta = 55, phi = 40, r = sqrt(10), d = 3, ticktype = "detailed", mgp = c(4, 1, 0)) } } ##################### ## CROSS VALIDATION ##################### n.folds=3 type= "GLMM" #"RF" season="summer" fullmodel=GLMMs[[season]] #RFs[[season]] CrossValidateByDeer <- function(n.folds,season="summer",type="RF",plot=F){ uniquedeer <- as.character(unique(deer[[season]]$altid)) ndeer <- length(uniquedeer) folds_df <- data.frame( deer = uniquedeer, fold = rep_len(1:n.folds,ndeer) ) foldVector <- folds_df$fold[match(as.character(deer[[season]]$altid),folds_df$deer)] predictCols <- which(names(deer[[season]])%in%pred.names) if(type=="RF"){ fullmodel<-RFs[[season]] }else{ fullmodel <- GLMMs[[season]] } CVresults <- list() CVresults$CVpred <- numeric(nrow(deer[[season]])) CVresults$realpred <- numeric(nrow(deer[[season]])) CVresults$observed <- numeric(nrow(deer[[season]])) if(type=="RF"){ response="used_fac" #"resp_factor" }else{ response="used" #"resp_factor" } counter = 1 i=1 for(i in 1:n.folds){ if(type=="RF"){ model <- cforest(formula1, data = deer[[season]][which(foldVector!=i),], controls=cforestControl) predict_CV <- predict(model,newdata=deer[[season]][which(foldVector==i),],type="prob") predict_real <- predict(fullmodel,newdata=deer[[season]][which(foldVector==i),],type="prob") REAL <- deer[[season]]$used[which(foldVector==i)] j=1 for(j in 1:length(which(foldVector==i))){ CVresults$CVpred[counter] <- as.numeric(predict_CV[[j]][,2]) CVresults$observed[counter] <- as.numeric(REAL[j]) CVresults$realpred[counter] <- as.numeric(predict_real[[j]][,2]) counter = counter + 1 } }else{ if(season=="summer"){ model <- glmer(used~stand_dist_to_water + stand_cos_aspect + stand_sin_aspect + stand_elevation + stand_slope + veg_class + stand_elevation:stand_slope + stand_dist_to_water:stand_slope + stand_dist_to_water:stand_elevation + (1|altid), family="binomial", data=deer[[season]][which(foldVector!=i),],na.action="na.fail") }else{ model <- glmer(used~stand_dist_to_water + stand_cos_aspect + stand_sin_aspect + stand_elevation + stand_slope + veg_class + stand_elevation:stand_slope + stand_dist_to_water:stand_slope + (1|altid), family="binomial", data=deer[[season]][which(foldVector!=i),],na.action="na.fail") } CVresults$CVpred[which(foldVector==i)] <- plogis(predict(model,newdata=deer[[season]][which(foldVector==i),],allow.new.levels = TRUE)) CVresults$realpred[which(foldVector==i)] <- predict(fullmodel,newdata=deer[[season]][which(foldVector==i),],allow.new.levels = TRUE) CVresults$observed[which(foldVector==i)] <- deer[[season]]$used[which(foldVector==i)] } } CVresults$CV_RMSE = sqrt(mean((CVresults$observed-CVresults$CVpred)^2)) # root mean squared error for holdout samples in 10-fold cross-validation ... CVresults$real_RMSE = sqrt(mean((CVresults$observed-CVresults$realpred)^2)) # root mean squared error for residuals from final model # realprediction <- predict(rf_model1,newdata=df,type="prob") if(plot){ graphics.off() par(mfrow=c(2,1)) par(ask=T) pred <- prediction(CVresults$CVpred,CVresults$observed) # for holdout samples in cross-validation perf <- performance(pred,"tpr","fpr") auc <- performance(pred,"auc") plot(perf, main=sprintf("%s Cross Validation",type)) text(.9,.1,paste("AUC = ",round(auc@y.values[[1]],2),sep="")) pred <- prediction(CVresults$realpred,CVresults$observed) # for final model perf <- performance(pred,"tpr","fpr") auc <- performance(pred,"auc") plot(perf, main=sprintf("%s Full Model",type)) text(.9,.1,paste("AUC = ",round(auc@y.values[[1]],2),sep="")) }else{ pred <- prediction(CVresults$CVpred,CVresults$observed) # for holdout samples in cross-validation perf <- performance(pred,"tpr","fpr") CVresults$auc_CV <- performance(pred,"auc") pred <- prediction(CVresults$realpred,CVresults$observed) # for final model perf <- performance(pred,"tpr","fpr") CVresults$auc_full <- performance(pred,"auc") } # COHEN KAPPA statistics thresholds <- seq(0.01,0.99,length=101) # "artificial" extinction thresholds across which to examine performance kappa <- numeric(length(thresholds)) for(i in 1:length(thresholds)){ trueLabels <- CVresults$observed predLabels <- ifelse(CVresults$CVpred>=thresholds[i],1,0) tot <- length(CVresults$observed) tp <- length(which((trueLabels==1)&(predLabels==1))) tn <- length(which((trueLabels==0)&(predLabels==0))) fp <- length(which((trueLabels==0)&(predLabels==1))) fn <- length(which((trueLabels==1)&(predLabels==0))) pr_agree <- (tp+tn)/tot # overall agreement, or accuracy pr_agree_rand <- ((tp+fn)/tot)*((tp+fp)/tot)+((fn+tn)/tot)*((fp+tn)/tot) kappa[i] <- (pr_agree-pr_agree_rand)/(1-pr_agree_rand) } #plot(thresholds,kappa,type="l",xlab="Threshold", ylab="Cohen's Kappa", main="Holdout sample performance") # find threshold value associated with highest Kappa for C-V data CVresults$cutoff_CV <- thresholds[which.max(kappa)] # max kappa cutoff kappa <- numeric(length(thresholds)) for(i in 1:length(thresholds)){ trueLabels <- CVresults$observed predLabels <- ifelse(CVresults$realpred>=thresholds[i],1,0) tot <- length(CVresults$observed) tp <- length(which((trueLabels==1)&(predLabels==1))) tn <- length(which((trueLabels==0)&(predLabels==0))) fp <- length(which((trueLabels==0)&(predLabels==1))) fn <- length(which((trueLabels==1)&(predLabels==0))) pr_agree <- (tp+tn)/tot # overall agreement, or accuracy pr_agree_rand <- ((tp+fn)/tot)*((tp+fp)/tot)+((fn+tn)/tot)*((fp+tn)/tot) kappa[i] <- (pr_agree-pr_agree_rand)/(1-pr_agree_rand) } #plot(thresholds,kappa,type="l",xlab="Threshold", ylab="Cohen's Kappa", main="Performance: full model") CVresults$cutoff_full <- thresholds[which.max(kappa)] # max kappa cutoff ### display confusion matrix and kappa for a single threshold trueLabels <- CVresults$observed predLabels <- ifelse(CVresults$CVpred>=CVresults$cutoff_CV,1,0) tot <- length(CVresults$observed) tp <- length(which((trueLabels==1)&(predLabels==1))) tn <- length(which((trueLabels==0)&(predLabels==0))) fp <- length(which((trueLabels==0)&(predLabels==1))) fn <- length(which((trueLabels==1)&(predLabels==0))) pr_agree <- (tp+tn)/tot # overall agreement, or accuracy pr_agree_rand <- ((tp+fn)/tot)*((tp+fp)/tot)+((fn+tn)/tot)*((fp+tn)/tot) CVresults$bestkappa_CV <- (pr_agree-pr_agree_rand)/(1-pr_agree_rand) CVresults$confusionmat <- matrix(c(tn,fn,fp,tp),nrow=2,ncol=2) rownames(CVresults$confusionmat) <- c("Actual not used","Actual used") colnames(CVresults$confusionmat) <- c("Predicted not used","Predicted used") CVresults$sensitivity <- tp/(tp+fn) CVresults$specificity <- tn/(tn+fp) CVresults$toterror <- (fn+fp)/tot CVresults$CVpred[which(CVresults$CVpred==1)] <- 0.999999 CVresults$CVpred[which(CVresults$CVpred==0)] <- 0.000001 CVresults$realpred[which(CVresults$realpred==1)] <- 0.999999 CVresults$realpred[which(CVresults$realpred==0)] <- 0.000001 realdata = CVresults$observed fit_deviance_CV <- mean(-2*(dbinom(CVresults$observed,1,CVresults$CVpred,log=T)-dbinom(realdata,1,realdata,log=T))) fit_deviance_real <- mean(-2*(dbinom(CVresults$observed,1,CVresults$realpred,log=T)-dbinom(realdata,1,realdata,log=T))) null_deviance <- mean(-2*(dbinom(CVresults$observed,1,mean(CVresults$observed),log=T)-dbinom(realdata,1,realdata,log=T))) CVresults$deviance_explained_CV <- (null_deviance-fit_deviance_CV)/null_deviance # based on holdout samples CVresults$deviance_explained_real <- (null_deviance-fit_deviance_real)/null_deviance # based on full model... return(CVresults) } PlotPerformance <- function(CVresults){ graphics.off() par(mfrow=c(2,1)) #par(ask=T) pred <- prediction(CVresults$CVpred,CVresults$observed) # for holdout samples in cross-validation perf <- performance(pred,"tpr","fpr") auc <- performance(pred,"auc") plot(perf, main=sprintf("%s Cross Validation",type)) text(.9,.1,paste("AUC = ",round(auc@y.values[[1]],2),sep="")) pred <- prediction(CVresults$realpred,CVresults$observed) # for final model perf <- performance(pred,"tpr","fpr") auc <- performance(pred,"auc") plot(perf, main=sprintf("%s Full Model",type)) text(.9,.1,paste("AUC = ",round(auc@y.values[[1]],2),sep="")) }
#Download and unzip data if(!file.exists("data.zip")){ print("Downloading data") url<-"https://d396qusza40orc.cloudfront.net/exdata%2Fdata%2FNEI_data.zip" download.file(url,"data.zip",method="curl") unzip("data.zip") } #Read data in NEI <- readRDS("summarySCC_PM25.rds") SCC <- readRDS("Source_Classification_Code.rds") #Total emissions in Baltimore from 1999 to 2008 by type. te<-tapply(NEI[NEI$fips %in% "24510",]$Emission, list(NEI[NEI$fips %in% "24510", ]$year,NEI[NEI$fips %in% "24510", ]$type),sum) #Plot of te using ggplot2 system require(ggplot2) require(reshape) ggplot(melt(te),aes(X2,value,fill=factor(X1)))+ geom_bar(stat="identity", position="dodge") + xlab("Type") + ylab(expression(PM[2.5])) + labs(title="Emissions in Baltimore by type and year, in tons") + scale_fill_discrete(name="Year")+ theme(plot.title=element_text(size=rel(1.4))) #Save plot dev.copy(png,"plots/plot3.png",units="px",height=480,width=480) dev.off()
/Project2/plot3.R
no_license
KobaKhit/Exploratory-Data-Analysis-Projects
R
false
false
976
r
#Download and unzip data if(!file.exists("data.zip")){ print("Downloading data") url<-"https://d396qusza40orc.cloudfront.net/exdata%2Fdata%2FNEI_data.zip" download.file(url,"data.zip",method="curl") unzip("data.zip") } #Read data in NEI <- readRDS("summarySCC_PM25.rds") SCC <- readRDS("Source_Classification_Code.rds") #Total emissions in Baltimore from 1999 to 2008 by type. te<-tapply(NEI[NEI$fips %in% "24510",]$Emission, list(NEI[NEI$fips %in% "24510", ]$year,NEI[NEI$fips %in% "24510", ]$type),sum) #Plot of te using ggplot2 system require(ggplot2) require(reshape) ggplot(melt(te),aes(X2,value,fill=factor(X1)))+ geom_bar(stat="identity", position="dodge") + xlab("Type") + ylab(expression(PM[2.5])) + labs(title="Emissions in Baltimore by type and year, in tons") + scale_fill_discrete(name="Year")+ theme(plot.title=element_text(size=rel(1.4))) #Save plot dev.copy(png,"plots/plot3.png",units="px",height=480,width=480) dev.off()
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/SOcrs.R \name{SOcrs} \alias{SOcrs} \title{SOmap coordinate system} \usage{ SOcrs(crs = NULL) } \arguments{ \item{crs}{provide PROJ string to set the value} } \description{ Set or return the coordinate system currently in use. } \details{ If argument `crs` is NULL, the function returns the current value (which may be `NULL``). } \examples{ \dontrun{ SOmap() SOcrs() } }
/man/SOcrs.Rd
no_license
xichaow/SOmap
R
false
true
449
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/SOcrs.R \name{SOcrs} \alias{SOcrs} \title{SOmap coordinate system} \usage{ SOcrs(crs = NULL) } \arguments{ \item{crs}{provide PROJ string to set the value} } \description{ Set or return the coordinate system currently in use. } \details{ If argument `crs` is NULL, the function returns the current value (which may be `NULL``). } \examples{ \dontrun{ SOmap() SOcrs() } }
library(phyloseq) library(dada2) library(ggplot2) library(Biostrings) ## Reading files ## path <- "/Users/fay-weili/Desktop/Hornwort_amplicon/dada2/sample_fastq" # CHANGE ME to location of the fastq file fns <- list.files(path, pattern="fastq.gz", full.names=TRUE) #fn <- file.path(path, "JNP2_6_F01_ccs_demux.BCF1--BCR1.fastq.gz") sample.names <- sapply(strsplit(basename(fns), ".fastq.gz"), '[', 1) # get sample names from fastq file names cw <- "CGTAGCTTCCGGTGGTATCCACGT" # primer 1 cx <- "GGGGCAGGTAAGAAAGGGTTTCGTA" # primer 2 rc <- dada2:::rc theme_set(theme_bw()) ## Remove primers ## nop <- file.path(paste(path,'_deprimers', sep=''), basename(fns)) prim <- removePrimers(fns, nop, primer.fwd=cw, primer.rev=dada2:::rc(cx), orient=TRUE, verbose=TRUE) lens.fn <- lapply(nop, function(fn) nchar(getSequences(fn))) # plot len distribution lens <- do.call(c, lens.fn) hist(lens, 100) ## Filter ## filt <- file.path(paste(path,'_deprimers_lenfiltered', sep=''), basename(fns)) track <- filterAndTrim(nop, filt, minQ=3, minLen=400, maxLen=1200, maxN=0, rm.phix=FALSE, maxEE=2, verbose=TRUE) ## DADA2 ## drp <- derepFastq(filt, verbose=TRUE, qualityType="FastqQuality") # dereplicate err <- learnErrors(drp, BAND_SIZE=32, multithread=TRUE, errorEstimationFunction=PacBioErrfun) # learn error plotErrors(err) dd <- dada(drp, err=err, BAND_SIZE=32, multithread=TRUE) cbind(ccs=prim[,1], primers=prim[,2], filtered=track[,2], denoised=sapply(dd, function(x) sum(x$denoised))) seqtab <- makeSequenceTable(dd); dim(seqtab) ## Save seqtab file ## saveRDS(seqtab, 'rds') ## Check chimera ## bim <- isBimeraDenovo(seqtab, minFoldParentOverAbundance=3.5, multithread=TRUE) table(bim) seqtab.nochim <- removeBimeraDenovo(seqtab, method="consensus", multithread=TRUE, verbose=TRUE) dim(seqtab.nochim) sum(seqtab.nochim)/sum(seqtab) ## Read metadata ## #sample_df <- read.table("/Users/fayweili/Desktop/Hornwort_microbiome/dada2_test/TimeSeriesMeta_lib1.csv", header=TRUE, row.names=1, sep=",", stringsAsFactors=FALSE) ## Make phyloseq object ## ps <- phyloseq(otu_table(seqtab.nochim, taxa_are_rows=FALSE)) #,sample_data(sample_df)) ps <- prune_samples(sample_names(ps) != "mock_community_5taxa_JNP1_5_E01.fastq.gz", ps) ps <- prune_samples(sample_names(ps) != "negative_control_JNP1_5_E01.fastq.gz", ps) ## Rename taxa names from sequences to ASV ## dna <- DNAStringSet(taxa_names(ps)) names(dna) <- taxa_names(ps) ps <- merge_phyloseq(ps, dna) taxa_names(ps) <- paste0("ASV", seq(ntaxa(ps))) writeXStringSet((refseq(ps)), 'ASV.fa') # write sequences to fasta ## Filter out non-rbcLX ASVs based on usearch (ran elsewhere) ## ASV_off_target <- c("ASV1182", "ASV1542", "ASV1614", "ASV1859", "ASV1858", "ASV1278", "ASV1915", "ASV1761", "ASV1760", "ASV1833", "ASV1911", "ASV1912", "ASV1609", "ASV1919", "ASV1252", "ASV1850", "ASV1525", "ASV1527", "ASV1335", "ASV1905", "ASV1409", "ASV1490", "ASV1781", "ASV1393", "ASV1783", "ASV853", "ASV1866", "ASV1541", "ASV1502", "ASV1687", "ASV1568", "ASV1457", "ASV1383", "ASV1907", "ASV1693", "ASV1826", "ASV1605", "ASV1638", "ASV1340", "ASV1779", "ASV1432", "ASV1940", "ASV1828", "ASV1829", "ASV1909", "ASV1867", "ASV1906", "ASV1458", "ASV1825", "ASV1279", "ASV1047", "ASV1606", "ASV1455", "ASV1712", "ASV1910", "ASV1341", "ASV1692", "ASV1218") ps_ontarget <- prune_taxa(!(taxa_names(ps) %in% ASV_off_target), ps) OTU = as(otu_table(ps_ontarget), "matrix") OTUdf = as.data.frame(OTU) write.csv(OTUdf, "ASV_on_target_table.csv") # write OTU table ## Transform otu table #ps.prop <- transform_sample_counts(ps, function(otu) otu/sum(otu)) #ord.nmds.bray <- ordinate(ps.prop, method="NMDS", distance="bray") #plot_ordination(ps.prop, ord.nmds.bray, color="Site", title="Bray NMDS") #plot_ordination(ps.prop, ord.nmds.bray, color="Quadrat", title="Bray NMDS")
/scripts/dada2.R
no_license
fayweili/hornwort_cyano_interaction
R
false
false
3,795
r
library(phyloseq) library(dada2) library(ggplot2) library(Biostrings) ## Reading files ## path <- "/Users/fay-weili/Desktop/Hornwort_amplicon/dada2/sample_fastq" # CHANGE ME to location of the fastq file fns <- list.files(path, pattern="fastq.gz", full.names=TRUE) #fn <- file.path(path, "JNP2_6_F01_ccs_demux.BCF1--BCR1.fastq.gz") sample.names <- sapply(strsplit(basename(fns), ".fastq.gz"), '[', 1) # get sample names from fastq file names cw <- "CGTAGCTTCCGGTGGTATCCACGT" # primer 1 cx <- "GGGGCAGGTAAGAAAGGGTTTCGTA" # primer 2 rc <- dada2:::rc theme_set(theme_bw()) ## Remove primers ## nop <- file.path(paste(path,'_deprimers', sep=''), basename(fns)) prim <- removePrimers(fns, nop, primer.fwd=cw, primer.rev=dada2:::rc(cx), orient=TRUE, verbose=TRUE) lens.fn <- lapply(nop, function(fn) nchar(getSequences(fn))) # plot len distribution lens <- do.call(c, lens.fn) hist(lens, 100) ## Filter ## filt <- file.path(paste(path,'_deprimers_lenfiltered', sep=''), basename(fns)) track <- filterAndTrim(nop, filt, minQ=3, minLen=400, maxLen=1200, maxN=0, rm.phix=FALSE, maxEE=2, verbose=TRUE) ## DADA2 ## drp <- derepFastq(filt, verbose=TRUE, qualityType="FastqQuality") # dereplicate err <- learnErrors(drp, BAND_SIZE=32, multithread=TRUE, errorEstimationFunction=PacBioErrfun) # learn error plotErrors(err) dd <- dada(drp, err=err, BAND_SIZE=32, multithread=TRUE) cbind(ccs=prim[,1], primers=prim[,2], filtered=track[,2], denoised=sapply(dd, function(x) sum(x$denoised))) seqtab <- makeSequenceTable(dd); dim(seqtab) ## Save seqtab file ## saveRDS(seqtab, 'rds') ## Check chimera ## bim <- isBimeraDenovo(seqtab, minFoldParentOverAbundance=3.5, multithread=TRUE) table(bim) seqtab.nochim <- removeBimeraDenovo(seqtab, method="consensus", multithread=TRUE, verbose=TRUE) dim(seqtab.nochim) sum(seqtab.nochim)/sum(seqtab) ## Read metadata ## #sample_df <- read.table("/Users/fayweili/Desktop/Hornwort_microbiome/dada2_test/TimeSeriesMeta_lib1.csv", header=TRUE, row.names=1, sep=",", stringsAsFactors=FALSE) ## Make phyloseq object ## ps <- phyloseq(otu_table(seqtab.nochim, taxa_are_rows=FALSE)) #,sample_data(sample_df)) ps <- prune_samples(sample_names(ps) != "mock_community_5taxa_JNP1_5_E01.fastq.gz", ps) ps <- prune_samples(sample_names(ps) != "negative_control_JNP1_5_E01.fastq.gz", ps) ## Rename taxa names from sequences to ASV ## dna <- DNAStringSet(taxa_names(ps)) names(dna) <- taxa_names(ps) ps <- merge_phyloseq(ps, dna) taxa_names(ps) <- paste0("ASV", seq(ntaxa(ps))) writeXStringSet((refseq(ps)), 'ASV.fa') # write sequences to fasta ## Filter out non-rbcLX ASVs based on usearch (ran elsewhere) ## ASV_off_target <- c("ASV1182", "ASV1542", "ASV1614", "ASV1859", "ASV1858", "ASV1278", "ASV1915", "ASV1761", "ASV1760", "ASV1833", "ASV1911", "ASV1912", "ASV1609", "ASV1919", "ASV1252", "ASV1850", "ASV1525", "ASV1527", "ASV1335", "ASV1905", "ASV1409", "ASV1490", "ASV1781", "ASV1393", "ASV1783", "ASV853", "ASV1866", "ASV1541", "ASV1502", "ASV1687", "ASV1568", "ASV1457", "ASV1383", "ASV1907", "ASV1693", "ASV1826", "ASV1605", "ASV1638", "ASV1340", "ASV1779", "ASV1432", "ASV1940", "ASV1828", "ASV1829", "ASV1909", "ASV1867", "ASV1906", "ASV1458", "ASV1825", "ASV1279", "ASV1047", "ASV1606", "ASV1455", "ASV1712", "ASV1910", "ASV1341", "ASV1692", "ASV1218") ps_ontarget <- prune_taxa(!(taxa_names(ps) %in% ASV_off_target), ps) OTU = as(otu_table(ps_ontarget), "matrix") OTUdf = as.data.frame(OTU) write.csv(OTUdf, "ASV_on_target_table.csv") # write OTU table ## Transform otu table #ps.prop <- transform_sample_counts(ps, function(otu) otu/sum(otu)) #ord.nmds.bray <- ordinate(ps.prop, method="NMDS", distance="bray") #plot_ordination(ps.prop, ord.nmds.bray, color="Site", title="Bray NMDS") #plot_ordination(ps.prop, ord.nmds.bray, color="Quadrat", title="Bray NMDS")
NEI <- readRDS("summarySCC_PM25.rds") SCC <- readRDS("Source_Classification_Code.rds") # question 1 d1999<-NEI[NEI[,6]==1999,] d2002<-NEI[NEI[,6]==2002,] d2005<-NEI[NEI[,6]==2005,] d2008<-NEI[NEI[,6]==2008,] total<-c(sum(d1999[,4]),sum(d2002[,4]),sum(d2005[,4]),sum(d2008[,4])) png("plot1.png") plot(total~c(1999,2002,2005,2008),type='l',ylab="total PM2.5",xlab="year") dev.off()
/plot1.R
no_license
yzhao13tx/ExData_Plotting1
R
false
false
383
r
NEI <- readRDS("summarySCC_PM25.rds") SCC <- readRDS("Source_Classification_Code.rds") # question 1 d1999<-NEI[NEI[,6]==1999,] d2002<-NEI[NEI[,6]==2002,] d2005<-NEI[NEI[,6]==2005,] d2008<-NEI[NEI[,6]==2008,] total<-c(sum(d1999[,4]),sum(d2002[,4]),sum(d2005[,4]),sum(d2008[,4])) png("plot1.png") plot(total~c(1999,2002,2005,2008),type='l',ylab="total PM2.5",xlab="year") dev.off()
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/Student.R \name{n_dist,Student-method} \alias{n_dist,Student-method} \title{Distribution of the Sample Size} \usage{ \S4method{n_dist}{Student}( design, n1, nuisance, summary = TRUE, plot = FALSE, iters = 10000, seed = NULL, range = 0, allocation = c("approximate", "exact"), ... ) } \arguments{ \item{design}{Object of class \code{Student} created by \code{setupStudent}.} \item{n1}{Either the sample size of the first stage (if \code{recalculation = TRUE} or the toal sample size (if \code{recalculation = FALSE}).} \item{nuisance}{Value of the nuisance parameter. For the Student's t-test this is the variance.} \item{summary}{logical - is a summary of the sample size distribution desired? Otherwise, a vector with sample sizes is returned.} \item{plot}{Should a plot of the sample size distribution be drawn?} \item{iters}{Number of simulation iterations.} \item{seed}{Random seed for simulation.} \item{range}{this determines how far the plot whiskers extend out from the box. If range is positive, the whiskers extend to the most extreme data point which is no more than range times the interquartile range from the box. A value of zero causes the whiskers to extend to the data extremes.} \item{allocation}{Whether the allocation ratio should be preserved exactly (\code{exact}) or approximately (\code{approximate}).} \item{...}{Further optional arguments.} } \value{ Summary and/or plot of the sample size distribution for every nuisance parameter and every value of n1. } \description{ Calculates the distribution of the total sample sizes of designs with blinded sample size recalculation for different values of the nuisance parameter or of n1. } \details{ The method is only vectorized in either \code{nuisance} or \code{n1}. } \examples{ d <- setupStudent(alpha = .025, beta = .2, r = 1, delta = 3.5, delta_NI = 0, alternative = "greater", n_max = 156) n_dist(d, n1 = 20, nuisance = 5.5, summary = TRUE, plot = FALSE, seed = 2020) }
/blindrecalc/man/n_dist.Student.Rd
no_license
akhikolla/ClusterTests
R
false
true
2,146
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/Student.R \name{n_dist,Student-method} \alias{n_dist,Student-method} \title{Distribution of the Sample Size} \usage{ \S4method{n_dist}{Student}( design, n1, nuisance, summary = TRUE, plot = FALSE, iters = 10000, seed = NULL, range = 0, allocation = c("approximate", "exact"), ... ) } \arguments{ \item{design}{Object of class \code{Student} created by \code{setupStudent}.} \item{n1}{Either the sample size of the first stage (if \code{recalculation = TRUE} or the toal sample size (if \code{recalculation = FALSE}).} \item{nuisance}{Value of the nuisance parameter. For the Student's t-test this is the variance.} \item{summary}{logical - is a summary of the sample size distribution desired? Otherwise, a vector with sample sizes is returned.} \item{plot}{Should a plot of the sample size distribution be drawn?} \item{iters}{Number of simulation iterations.} \item{seed}{Random seed for simulation.} \item{range}{this determines how far the plot whiskers extend out from the box. If range is positive, the whiskers extend to the most extreme data point which is no more than range times the interquartile range from the box. A value of zero causes the whiskers to extend to the data extremes.} \item{allocation}{Whether the allocation ratio should be preserved exactly (\code{exact}) or approximately (\code{approximate}).} \item{...}{Further optional arguments.} } \value{ Summary and/or plot of the sample size distribution for every nuisance parameter and every value of n1. } \description{ Calculates the distribution of the total sample sizes of designs with blinded sample size recalculation for different values of the nuisance parameter or of n1. } \details{ The method is only vectorized in either \code{nuisance} or \code{n1}. } \examples{ d <- setupStudent(alpha = .025, beta = .2, r = 1, delta = 3.5, delta_NI = 0, alternative = "greater", n_max = 156) n_dist(d, n1 = 20, nuisance = 5.5, summary = TRUE, plot = FALSE, seed = 2020) }
# ------------------------------------------------------------------------------ # Project: SRM - Stochastische Risikomodellierung und statistische Methoden # ------------------------------------------------------------------------------ # Quantlet: SRM_fig2.14 # ------------------------------------------------------------------------------ # Description: Produces the QQ plots for four simulated samples of # N(0,1), N(5,1), N(0,9) and N(5,9). QQ-plots compare empirical # quantiles of a distribution with theoretical quantiles of the # standard normal distribution. # ------------------------------------------------------------------------------ # Keywords: qq-plot, simulation, normal, normal distribution, plot, # graphical representation # ------------------------------------------------------------------------------ # See also: # ------------------------------------------------------------------------------ # Author: Wellisch # ------------------------------------------------------------------------------ ## clear history rm(list = ls(all = TRUE)) graphics.off() ## Q-Q-Normal-Plots mit Sollgeraden ## Mit festem seed zur Reproduktion set.seed(1234) w = rnorm(100) set.seed(1234) x = rnorm(100, mean = 5) set.seed(1234) y = rnorm(100, sd = 3) set.seed(1234) z = rnorm(100, mean = 5, sd = 3) par(mfrow = c(2, 2)) qqnorm(w, main = "Normal Q-Q-Plot der Stichprobe w", xlab = "theoretische Standardnormal-Quantile", ylab = "empirische Quantile") qqline(w) qqnorm(x, main = "Normal Q-Q-Plot der Stichprobe x", xlab = "theoretische Standardnormal-Quantile", ylab = "empirische Quantile") qqline(x) qqnorm(y, main = "Normal Q-Q-Plot der Stichprobe y", xlab = "theoretische Standardnormal-Quantile", ylab = "empirische Quantile") qqline(y) qqnorm(z, main = "Normal Q-Q-Plot der Stichprobe z", xlab = "theoretische Standardnormal-Quantile", ylab = "empirische Quantile") qqline(z)
/SRM_fig2.14/SRM_fig2.14.R
no_license
SHIccc/SRM
R
false
false
1,996
r
# ------------------------------------------------------------------------------ # Project: SRM - Stochastische Risikomodellierung und statistische Methoden # ------------------------------------------------------------------------------ # Quantlet: SRM_fig2.14 # ------------------------------------------------------------------------------ # Description: Produces the QQ plots for four simulated samples of # N(0,1), N(5,1), N(0,9) and N(5,9). QQ-plots compare empirical # quantiles of a distribution with theoretical quantiles of the # standard normal distribution. # ------------------------------------------------------------------------------ # Keywords: qq-plot, simulation, normal, normal distribution, plot, # graphical representation # ------------------------------------------------------------------------------ # See also: # ------------------------------------------------------------------------------ # Author: Wellisch # ------------------------------------------------------------------------------ ## clear history rm(list = ls(all = TRUE)) graphics.off() ## Q-Q-Normal-Plots mit Sollgeraden ## Mit festem seed zur Reproduktion set.seed(1234) w = rnorm(100) set.seed(1234) x = rnorm(100, mean = 5) set.seed(1234) y = rnorm(100, sd = 3) set.seed(1234) z = rnorm(100, mean = 5, sd = 3) par(mfrow = c(2, 2)) qqnorm(w, main = "Normal Q-Q-Plot der Stichprobe w", xlab = "theoretische Standardnormal-Quantile", ylab = "empirische Quantile") qqline(w) qqnorm(x, main = "Normal Q-Q-Plot der Stichprobe x", xlab = "theoretische Standardnormal-Quantile", ylab = "empirische Quantile") qqline(x) qqnorm(y, main = "Normal Q-Q-Plot der Stichprobe y", xlab = "theoretische Standardnormal-Quantile", ylab = "empirische Quantile") qqline(y) qqnorm(z, main = "Normal Q-Q-Plot der Stichprobe z", xlab = "theoretische Standardnormal-Quantile", ylab = "empirische Quantile") qqline(z)
# Economy & Budget Frame Dictionary (fr_eco) # Validated and thus recommended to be used for text annotation of lemmatized English migration-related texts library(data.table) library(stringi) library(dplyr) # Instruction: Please replace "all_text_mt_lemma" with the name of your text column. And "sample_ID" with the name of your text ID column. # A text is coded as economy and budget-related if at least 1 sentence contains a migration-related word and a economy and budget-related word. ################# # read and prepare text data ############## setwd('') # directory corpus <- fread("") # your dataset # lower case text column corpus$all_text_mt_lemma <- tolower(corpus$all_text_mt_lemma) ########### ## dictionary components ########### # migration-related keywords migration <- c('(?:^|\\W)asyl', '(?:^|\\W)immigrant', '(?:^|\\W)immigrat', '(?:^|\\W)migrant', '(?:^|\\W)migrat', '(?:^|\\W)refugee', '(?:^|\\W)people\\W*on\\W*the\\W*run', '(?:^|\\W)foreigner', '(?:^|\\W)foreign\\W*background', '(?:^|\\W)(paperless|undocumented)', '(?:^|\\W)sans\\W*pap(ie|e)r', '(?:^|\\W)guest\\W*worker', '(?:^|\\W)foreign\\W*worker', '(?:^|\\W)emigra','(?:^|\\W)brain\\W*drain', '(?:^|\\W)free\\W*movement', '(?:^|\\W)freedom\\W*of\\W*movement', '(?:^|\\W)movement\\W*of\\W*person', '(?:^|\\W)unaccompanied\\W*child', '(?:^|\\W)unaccompanied\\W*minor') budget <- '(?:^|\\W)budget' cost <- '(?:^|\\W)cost\\W' exclude_cost <- c('(?:^|\\W)human\\W*cost\\W', '(?:^|\\W)humanitarian\\W*cost\\W') econom <- '(?:^|\\W)econom' financ <- '(?:^|\\W)financ(?!ial\\stimes)' fund <- '(?:^|\\W)(funding|funded|funds|fund)\\W' #not fundamentally exclude_fund <- c('(?:^|\\W)charit', '(?:^|\\W)non\\W*governmental\\W*organi(s|z)ation', '(?:^|\\W)ngo\\s', '(?:^|\\W)donat', '(?:^|\\W)humanitarian\\W') gdp <- c('(?:^|\\W)gdp', '(?:^|\\W)gross\\W*domestic\\W*product', '(?:^|\\W)global\\W*domestic\\W*product','(?:^|\\W)gross\\W*national\\W*product') exclude_gdp <- "(?:^|\\W)police\\W*union" money <- c('(?:^|\\W)money', '(?:^|\\W)monetar', '(?:^|\\W)public\\W*money') numbers <- c("(?:^|\\W)(eur|€|\\$|£|gbp|dm|kr|sek|ft|huf|zł|pln|l|rol|ron)\\W*[0-9]{1,6}\\W*(thousand|million|billion|mrd|m)\\W", "(?:^|\\W)(eur|€|\\$|£|gbp|dm|kr|sek|ft|huf|zł|pln|l|rol|ron)\\W*[0-9]{0,6}.?[0-9]{0,3}\\W*(thousand|million|billion|mrd|m)\\W", "(?:^|\\W)(eur|€|\\$|£|gbp|dm|kr|sek|ft|huf|zł|pln|l|rol|ron)\\W*[0-9]{0,6}\\W*(thousand|million|billion|mrd|m)\\W", "(?:^|\\W)(thousand|million|billion|mrd|m)\\W*(euro|dollar|pound|mark|krona|kronor|peseta|zloty|forint|romanian\\Wleu|kronor)\\W", "(?:^|\\W)[0-9]{0,6}.?[0-9]{1,3}\\W*(euro|dollar|pound|mark|krona|kronor|peseta|zloty|forint|romanian\\Wleu|kronor)\\W") tax <- '(?:^|\\W)tax(?!i)' exclude_tax <- '(?:^|\\W)taxi' other <- c('(?:^|\\W)government\\W*spend\\s*', '(?:^|\\W)resource', '(?:^|\\W)public\\W*spend', '(?:^|\\W)remittance') exclude <- c("(?:^|\\W)traffick", "(?:^|\\W)smugg", "(?:^|\\W)arrest", "(?:^|\\W)fraud") #more genral crime/criminal/illegal does not really help ########### ## create dictionary ########### dict_name <- c("migration", "budget", "cost", "exclude_cost", "econom", "financ", "fund", "exclude_fund", "gdp", "exclude_gdp", "money", "numbers","tax", "exclude_tax", "other", "exclude") ########### ## sentence splitting ########### corpus$all_text_mt_lemma <- as.character(corpus$all_text_mt_lemma) corpus$all_text_mt_lemma <- gsub("(www)\\.(.+?)\\.([a-z]+)", "\\1\\2\\3",corpus$all_text_mt_lemma) ## Punkte aus Webseiten entfernen: corpus$all_text_mt_lemma <- gsub("([a-zA-Z])\\.([a-zA-Z])", "\\1. \\2",corpus$all_text_mt_lemma) ## Verbleibende Punkte zwischen Buchstaben, Leerzeichen einfügen: corpus$all_text_mt_lemma <- as.character(corpus$all_text_mt_lemma) list_sent <- strsplit(corpus$all_text_mt_lemma, "(!\\s|\\.\\s|\\?\\s)") corpus_sentence <- data.frame(sample_ID=rep(corpus$sample_ID, sapply(list_sent, length)), sentence=unlist(list_sent)) ####### ## search pattern of dictionary in text corpus ####### n <- length(dict_name) evaluation_sent <- vector("list", n) count <- 0 for (i in dict_name) { count <- count + 1 print(count) print(i) match <- stri_count_regex(corpus_sentence$sentence, paste(get(i), collapse='|')) evaluation_sent[[i]] <- data.frame(name=match) } evaluation_sent <- evaluation_sent[-c(1:n)] count_per_dict_sentence <- do.call("cbind", evaluation_sent) cols <- names(count_per_dict_sentence) == "name" names(count_per_dict_sentence)[cols] <- paste0("name", seq.int(sum(cols))) oldnames <- colnames(count_per_dict_sentence) newnames <- names(evaluation_sent) setnames(count_per_dict_sentence, old = oldnames, new = newnames) head(count_per_dict_sentence) colnames(count_per_dict_sentence) ########### # some recoding ########### count_per_dict_sentence$budget_combi <- case_when( count_per_dict_sentence$budget >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$budget_combi[is.na(count_per_dict_sentence$budget_combi)] <- 0 count_per_dict_sentence$cost_combi <- case_when( count_per_dict_sentence$cost >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude_cost ==1~ 0, count_per_dict_sentence$cost >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude >=1~ 0, count_per_dict_sentence$cost >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$cost_combi[is.na(count_per_dict_sentence$cost_combi)] <- 0 count_per_dict_sentence$econom_combi <- case_when( count_per_dict_sentence$econom >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$econom_combi[is.na(count_per_dict_sentence$econom_combi)] <- 0 count_per_dict_sentence$financ_combi <- case_when( count_per_dict_sentence$financ >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude >=1~ 0, count_per_dict_sentence$financ >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$financ_combi[is.na(count_per_dict_sentence$financ_combi)] <- 0 count_per_dict_sentence$fund_combi <- case_when( count_per_dict_sentence$fund >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude_fund >=1~ 0, count_per_dict_sentence$fund >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$fund_combi[is.na(count_per_dict_sentence$fund_combi)] <- 0 count_per_dict_sentence$gdp_combi <- case_when( count_per_dict_sentence$gdp >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude_gdp >=1~ 0, count_per_dict_sentence$gdp >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$gdp_combi[is.na(count_per_dict_sentence$gdp_combi)] <- 0 count_per_dict_sentence$money_combi <- case_when( count_per_dict_sentence$money >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude >=1~ 0, count_per_dict_sentence$money >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude_fund >=1~ 0, count_per_dict_sentence$money >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$money_combi[is.na(count_per_dict_sentence$money_combi)] <- 0 count_per_dict_sentence$numbers_combi <- case_when( count_per_dict_sentence$numbers >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude >=1~ 0, count_per_dict_sentence$numbers >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$numbers_combi[is.na(count_per_dict_sentence$numbers_combi)] <- 0 count_per_dict_sentence$tax_combi <- case_when( count_per_dict_sentence$tax >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude_tax >=1~ 0, count_per_dict_sentence$tax >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$tax_combi[is.na(count_per_dict_sentence$tax_combi)] <- 0 count_per_dict_sentence$other_combi <- case_when( count_per_dict_sentence$other >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$other_combi[is.na(count_per_dict_sentence$other_combi)] <- 0 #check results on sentence level # add sentence id for merging (order is correct) count_per_dict_sentence$articleid_sent_id <- rownames(count_per_dict_sentence) corpus_sentence$articleid_sent_id <- rownames(corpus_sentence) #merge sentence and hits corpus_sentence_with_dict_hits <- merge(corpus_sentence, count_per_dict_sentence, by = "articleid_sent_id") #aggregate the sentence level hit results on article level (sum up results of several variables per article (doc_id))#all those that were searched for on sentence level df_sent_results_agg <- corpus_sentence_with_dict_hits %>% group_by(sample_ID) %>% summarise_at(vars("migration", "budget_combi", "cost_combi", "exclude_cost", "econom_combi", "financ_combi", "fund_combi", "gdp_combi", "money_combi", "numbers_combi", "tax_combi", "other_combi", "exclude"), sum) corpus_new <- merge(df_sent_results_agg, corpus, by = "sample_ID", all =T) #recode combination of dictionary components that make up the dictionary #calc fr_eco variable corpus_sentence_with_dict_hits$fr_eco <- case_when(corpus_sentence_with_dict_hits$budget_combi >= 1 | corpus_sentence_with_dict_hits$cost_combi >= 1 | corpus_sentence_with_dict_hits$econom_combi >= 1 | corpus_sentence_with_dict_hits$financ_combi >= 1 | corpus_sentence_with_dict_hits$fund_combi >= 1 | corpus_sentence_with_dict_hits$gdp_combi >= 1 | corpus_sentence_with_dict_hits$numbers_combi >= 1 | corpus_sentence_with_dict_hits$money_combi >= 1 |corpus_sentence_with_dict_hits$tax_combi >= 1 | corpus_sentence_with_dict_hits$other_combi >= 1 ~ 1)# #aggregate the sentence level hit results on article level corpus_with_fr_agg <- corpus_sentence_with_dict_hits %>% group_by(sample_ID) %>% summarise_at(vars("fr_eco"), mean) corpus_new <- merge(corpus_with_fr_agg, corpus, by = "sample_ID", all =T) corpus_new <- subset(corpus_new, select = c(sample_ID, fr_eco)) corpus_new <- corpus_new %>% mutate(fr_eco = if_else(is.na(fr_eco), 0, fr_eco)) #set NA to 0 (necessary for sum within group later) table(corpus_new$fr_eco) # descriptive overview ###### #save annotated dataset ########### write.csv(corpus_new, "fr_eco.csv") #
/Economy_Dictionary_Annotation.R
no_license
juliajung11/MultilingualTextAnalysis
R
false
false
10,554
r
# Economy & Budget Frame Dictionary (fr_eco) # Validated and thus recommended to be used for text annotation of lemmatized English migration-related texts library(data.table) library(stringi) library(dplyr) # Instruction: Please replace "all_text_mt_lemma" with the name of your text column. And "sample_ID" with the name of your text ID column. # A text is coded as economy and budget-related if at least 1 sentence contains a migration-related word and a economy and budget-related word. ################# # read and prepare text data ############## setwd('') # directory corpus <- fread("") # your dataset # lower case text column corpus$all_text_mt_lemma <- tolower(corpus$all_text_mt_lemma) ########### ## dictionary components ########### # migration-related keywords migration <- c('(?:^|\\W)asyl', '(?:^|\\W)immigrant', '(?:^|\\W)immigrat', '(?:^|\\W)migrant', '(?:^|\\W)migrat', '(?:^|\\W)refugee', '(?:^|\\W)people\\W*on\\W*the\\W*run', '(?:^|\\W)foreigner', '(?:^|\\W)foreign\\W*background', '(?:^|\\W)(paperless|undocumented)', '(?:^|\\W)sans\\W*pap(ie|e)r', '(?:^|\\W)guest\\W*worker', '(?:^|\\W)foreign\\W*worker', '(?:^|\\W)emigra','(?:^|\\W)brain\\W*drain', '(?:^|\\W)free\\W*movement', '(?:^|\\W)freedom\\W*of\\W*movement', '(?:^|\\W)movement\\W*of\\W*person', '(?:^|\\W)unaccompanied\\W*child', '(?:^|\\W)unaccompanied\\W*minor') budget <- '(?:^|\\W)budget' cost <- '(?:^|\\W)cost\\W' exclude_cost <- c('(?:^|\\W)human\\W*cost\\W', '(?:^|\\W)humanitarian\\W*cost\\W') econom <- '(?:^|\\W)econom' financ <- '(?:^|\\W)financ(?!ial\\stimes)' fund <- '(?:^|\\W)(funding|funded|funds|fund)\\W' #not fundamentally exclude_fund <- c('(?:^|\\W)charit', '(?:^|\\W)non\\W*governmental\\W*organi(s|z)ation', '(?:^|\\W)ngo\\s', '(?:^|\\W)donat', '(?:^|\\W)humanitarian\\W') gdp <- c('(?:^|\\W)gdp', '(?:^|\\W)gross\\W*domestic\\W*product', '(?:^|\\W)global\\W*domestic\\W*product','(?:^|\\W)gross\\W*national\\W*product') exclude_gdp <- "(?:^|\\W)police\\W*union" money <- c('(?:^|\\W)money', '(?:^|\\W)monetar', '(?:^|\\W)public\\W*money') numbers <- c("(?:^|\\W)(eur|€|\\$|£|gbp|dm|kr|sek|ft|huf|zł|pln|l|rol|ron)\\W*[0-9]{1,6}\\W*(thousand|million|billion|mrd|m)\\W", "(?:^|\\W)(eur|€|\\$|£|gbp|dm|kr|sek|ft|huf|zł|pln|l|rol|ron)\\W*[0-9]{0,6}.?[0-9]{0,3}\\W*(thousand|million|billion|mrd|m)\\W", "(?:^|\\W)(eur|€|\\$|£|gbp|dm|kr|sek|ft|huf|zł|pln|l|rol|ron)\\W*[0-9]{0,6}\\W*(thousand|million|billion|mrd|m)\\W", "(?:^|\\W)(thousand|million|billion|mrd|m)\\W*(euro|dollar|pound|mark|krona|kronor|peseta|zloty|forint|romanian\\Wleu|kronor)\\W", "(?:^|\\W)[0-9]{0,6}.?[0-9]{1,3}\\W*(euro|dollar|pound|mark|krona|kronor|peseta|zloty|forint|romanian\\Wleu|kronor)\\W") tax <- '(?:^|\\W)tax(?!i)' exclude_tax <- '(?:^|\\W)taxi' other <- c('(?:^|\\W)government\\W*spend\\s*', '(?:^|\\W)resource', '(?:^|\\W)public\\W*spend', '(?:^|\\W)remittance') exclude <- c("(?:^|\\W)traffick", "(?:^|\\W)smugg", "(?:^|\\W)arrest", "(?:^|\\W)fraud") #more genral crime/criminal/illegal does not really help ########### ## create dictionary ########### dict_name <- c("migration", "budget", "cost", "exclude_cost", "econom", "financ", "fund", "exclude_fund", "gdp", "exclude_gdp", "money", "numbers","tax", "exclude_tax", "other", "exclude") ########### ## sentence splitting ########### corpus$all_text_mt_lemma <- as.character(corpus$all_text_mt_lemma) corpus$all_text_mt_lemma <- gsub("(www)\\.(.+?)\\.([a-z]+)", "\\1\\2\\3",corpus$all_text_mt_lemma) ## Punkte aus Webseiten entfernen: corpus$all_text_mt_lemma <- gsub("([a-zA-Z])\\.([a-zA-Z])", "\\1. \\2",corpus$all_text_mt_lemma) ## Verbleibende Punkte zwischen Buchstaben, Leerzeichen einfügen: corpus$all_text_mt_lemma <- as.character(corpus$all_text_mt_lemma) list_sent <- strsplit(corpus$all_text_mt_lemma, "(!\\s|\\.\\s|\\?\\s)") corpus_sentence <- data.frame(sample_ID=rep(corpus$sample_ID, sapply(list_sent, length)), sentence=unlist(list_sent)) ####### ## search pattern of dictionary in text corpus ####### n <- length(dict_name) evaluation_sent <- vector("list", n) count <- 0 for (i in dict_name) { count <- count + 1 print(count) print(i) match <- stri_count_regex(corpus_sentence$sentence, paste(get(i), collapse='|')) evaluation_sent[[i]] <- data.frame(name=match) } evaluation_sent <- evaluation_sent[-c(1:n)] count_per_dict_sentence <- do.call("cbind", evaluation_sent) cols <- names(count_per_dict_sentence) == "name" names(count_per_dict_sentence)[cols] <- paste0("name", seq.int(sum(cols))) oldnames <- colnames(count_per_dict_sentence) newnames <- names(evaluation_sent) setnames(count_per_dict_sentence, old = oldnames, new = newnames) head(count_per_dict_sentence) colnames(count_per_dict_sentence) ########### # some recoding ########### count_per_dict_sentence$budget_combi <- case_when( count_per_dict_sentence$budget >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$budget_combi[is.na(count_per_dict_sentence$budget_combi)] <- 0 count_per_dict_sentence$cost_combi <- case_when( count_per_dict_sentence$cost >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude_cost ==1~ 0, count_per_dict_sentence$cost >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude >=1~ 0, count_per_dict_sentence$cost >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$cost_combi[is.na(count_per_dict_sentence$cost_combi)] <- 0 count_per_dict_sentence$econom_combi <- case_when( count_per_dict_sentence$econom >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$econom_combi[is.na(count_per_dict_sentence$econom_combi)] <- 0 count_per_dict_sentence$financ_combi <- case_when( count_per_dict_sentence$financ >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude >=1~ 0, count_per_dict_sentence$financ >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$financ_combi[is.na(count_per_dict_sentence$financ_combi)] <- 0 count_per_dict_sentence$fund_combi <- case_when( count_per_dict_sentence$fund >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude_fund >=1~ 0, count_per_dict_sentence$fund >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$fund_combi[is.na(count_per_dict_sentence$fund_combi)] <- 0 count_per_dict_sentence$gdp_combi <- case_when( count_per_dict_sentence$gdp >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude_gdp >=1~ 0, count_per_dict_sentence$gdp >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$gdp_combi[is.na(count_per_dict_sentence$gdp_combi)] <- 0 count_per_dict_sentence$money_combi <- case_when( count_per_dict_sentence$money >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude >=1~ 0, count_per_dict_sentence$money >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude_fund >=1~ 0, count_per_dict_sentence$money >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$money_combi[is.na(count_per_dict_sentence$money_combi)] <- 0 count_per_dict_sentence$numbers_combi <- case_when( count_per_dict_sentence$numbers >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude >=1~ 0, count_per_dict_sentence$numbers >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$numbers_combi[is.na(count_per_dict_sentence$numbers_combi)] <- 0 count_per_dict_sentence$tax_combi <- case_when( count_per_dict_sentence$tax >=1 & count_per_dict_sentence$migration >=1 & count_per_dict_sentence$exclude_tax >=1~ 0, count_per_dict_sentence$tax >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$tax_combi[is.na(count_per_dict_sentence$tax_combi)] <- 0 count_per_dict_sentence$other_combi <- case_when( count_per_dict_sentence$other >=1 & count_per_dict_sentence$migration >=1 ~ 1) count_per_dict_sentence$other_combi[is.na(count_per_dict_sentence$other_combi)] <- 0 #check results on sentence level # add sentence id for merging (order is correct) count_per_dict_sentence$articleid_sent_id <- rownames(count_per_dict_sentence) corpus_sentence$articleid_sent_id <- rownames(corpus_sentence) #merge sentence and hits corpus_sentence_with_dict_hits <- merge(corpus_sentence, count_per_dict_sentence, by = "articleid_sent_id") #aggregate the sentence level hit results on article level (sum up results of several variables per article (doc_id))#all those that were searched for on sentence level df_sent_results_agg <- corpus_sentence_with_dict_hits %>% group_by(sample_ID) %>% summarise_at(vars("migration", "budget_combi", "cost_combi", "exclude_cost", "econom_combi", "financ_combi", "fund_combi", "gdp_combi", "money_combi", "numbers_combi", "tax_combi", "other_combi", "exclude"), sum) corpus_new <- merge(df_sent_results_agg, corpus, by = "sample_ID", all =T) #recode combination of dictionary components that make up the dictionary #calc fr_eco variable corpus_sentence_with_dict_hits$fr_eco <- case_when(corpus_sentence_with_dict_hits$budget_combi >= 1 | corpus_sentence_with_dict_hits$cost_combi >= 1 | corpus_sentence_with_dict_hits$econom_combi >= 1 | corpus_sentence_with_dict_hits$financ_combi >= 1 | corpus_sentence_with_dict_hits$fund_combi >= 1 | corpus_sentence_with_dict_hits$gdp_combi >= 1 | corpus_sentence_with_dict_hits$numbers_combi >= 1 | corpus_sentence_with_dict_hits$money_combi >= 1 |corpus_sentence_with_dict_hits$tax_combi >= 1 | corpus_sentence_with_dict_hits$other_combi >= 1 ~ 1)# #aggregate the sentence level hit results on article level corpus_with_fr_agg <- corpus_sentence_with_dict_hits %>% group_by(sample_ID) %>% summarise_at(vars("fr_eco"), mean) corpus_new <- merge(corpus_with_fr_agg, corpus, by = "sample_ID", all =T) corpus_new <- subset(corpus_new, select = c(sample_ID, fr_eco)) corpus_new <- corpus_new %>% mutate(fr_eco = if_else(is.na(fr_eco), 0, fr_eco)) #set NA to 0 (necessary for sum within group later) table(corpus_new$fr_eco) # descriptive overview ###### #save annotated dataset ########### write.csv(corpus_new, "fr_eco.csv") #
set.seed(1) sims = 3 outmat = sapply(1:sims,function(x){ N0 = 1 times = 50 N = vector(length = times) bi = dbinom(0:2,2,1-exp(-100/(2*N0))) N[1] = N0*(sample(c(0,1,2),1,replace = FALSE,bi)) sum(replicate(100,sample(c(0,1,2),1,replace = FALSE,bi))) for (t in 2:times) { bi = dbinom(0:2,2,1-exp(-100/(2*N[t-1]))) N[t] = sum(replicate(N[t-1],(sample(c(0,1,2),1,replace = FALSE,bi)))) } N }) matplot(1:times, outmat,type = "l",las = 1, ylab = "Population", xlab= "seasons")
/StocasticGrowthOfAPlantPopulation.R
no_license
Geoffrey-Harper/StocasticPlantGrowthModel
R
false
false
504
r
set.seed(1) sims = 3 outmat = sapply(1:sims,function(x){ N0 = 1 times = 50 N = vector(length = times) bi = dbinom(0:2,2,1-exp(-100/(2*N0))) N[1] = N0*(sample(c(0,1,2),1,replace = FALSE,bi)) sum(replicate(100,sample(c(0,1,2),1,replace = FALSE,bi))) for (t in 2:times) { bi = dbinom(0:2,2,1-exp(-100/(2*N[t-1]))) N[t] = sum(replicate(N[t-1],(sample(c(0,1,2),1,replace = FALSE,bi)))) } N }) matplot(1:times, outmat,type = "l",las = 1, ylab = "Population", xlab= "seasons")
# group by individual and measure fraction of each gender not counting the individual # Getting a uniquified view of thread metrics for plotting thread_info = data_thread %>% filter(UniqueContributors>5) %>% select(Year, Title, Link, Type, ThreadId, DebateSize, Female_Contributions, FemaleParticipation, Live, UniqueContributors, UniqueFemaleContributors, UniqueFemaleParticipation, starts_with('Thread_'), -starts_with('Thread_Text')) %>% unique() # test whether unique female participation is segmented to threads in a significant way prop.test(thread_info$UniqueFemaleContributors,thread_info$UniqueContributors) # display results of prp test female_confint0 = binom.confint(sum(thread_info$UniqueFemaleContributors),sum(thread_info$UniqueContributors),methods='wilson')[5:6] female_confint = cbind(as.character(thread_info$ThreadId),thread_info$DebateSize,thread_info$Title,binom.confint(thread_info$UniqueFemaleContributors,thread_info$UniqueContributors,methods='wilson')[,4:6]) names(female_confint)[1]='Thread' names(female_confint)[2]='ThreadSize' names(female_confint)[3]='Title' ggplot(female_confint,aes(reorder(Thread,ThreadSize),mean))+ geom_point()+ geom_errorbar(aes(ymin=lower, ymax=upper))+ geom_hline(yintercept=female_confint0$lower)+ geom_hline(yintercept=female_confint0$upper)+ ylab('Female Fraction')+ xlab('Thread')+ theme(axis.text.x = element_text(angle = 45, hjust=1)) # smae but for all female participation prop.test(thread_info$Female_Contributions,thread_info$DebateSize) # display result female_confint0 = binom.confint(sum(thread_info$Female_Contributions),sum(thread_info$DebateSize),methods='wilson')[5:6] female_confint = cbind(as.character(thread_info$ThreadId),binom.confint(thread_info$Female_Contributions,thread_info$DebateSize,methods='wilson')[,4:6]) names(female_confint)[1]='Thread' ggplot(female_confint,aes(Thread,mean))+ geom_point()+ geom_errorbar(aes(ymin=lower, ymax=upper))+ geom_hline(yintercept=female_confint0$lower)+ geom_hline(yintercept=female_confint0$upper) #
/edge_thread_compare_female.R
no_license
lots-of-things/edge_forum
R
false
false
2,178
r
# group by individual and measure fraction of each gender not counting the individual # Getting a uniquified view of thread metrics for plotting thread_info = data_thread %>% filter(UniqueContributors>5) %>% select(Year, Title, Link, Type, ThreadId, DebateSize, Female_Contributions, FemaleParticipation, Live, UniqueContributors, UniqueFemaleContributors, UniqueFemaleParticipation, starts_with('Thread_'), -starts_with('Thread_Text')) %>% unique() # test whether unique female participation is segmented to threads in a significant way prop.test(thread_info$UniqueFemaleContributors,thread_info$UniqueContributors) # display results of prp test female_confint0 = binom.confint(sum(thread_info$UniqueFemaleContributors),sum(thread_info$UniqueContributors),methods='wilson')[5:6] female_confint = cbind(as.character(thread_info$ThreadId),thread_info$DebateSize,thread_info$Title,binom.confint(thread_info$UniqueFemaleContributors,thread_info$UniqueContributors,methods='wilson')[,4:6]) names(female_confint)[1]='Thread' names(female_confint)[2]='ThreadSize' names(female_confint)[3]='Title' ggplot(female_confint,aes(reorder(Thread,ThreadSize),mean))+ geom_point()+ geom_errorbar(aes(ymin=lower, ymax=upper))+ geom_hline(yintercept=female_confint0$lower)+ geom_hline(yintercept=female_confint0$upper)+ ylab('Female Fraction')+ xlab('Thread')+ theme(axis.text.x = element_text(angle = 45, hjust=1)) # smae but for all female participation prop.test(thread_info$Female_Contributions,thread_info$DebateSize) # display result female_confint0 = binom.confint(sum(thread_info$Female_Contributions),sum(thread_info$DebateSize),methods='wilson')[5:6] female_confint = cbind(as.character(thread_info$ThreadId),binom.confint(thread_info$Female_Contributions,thread_info$DebateSize,methods='wilson')[,4:6]) names(female_confint)[1]='Thread' ggplot(female_confint,aes(Thread,mean))+ geom_point()+ geom_errorbar(aes(ymin=lower, ymax=upper))+ geom_hline(yintercept=female_confint0$lower)+ geom_hline(yintercept=female_confint0$upper) #
############################################### requiredPackages = c('ggplot2','scales', 'gridExtra') package.check <- lapply( requiredPackages, FUN = function(x) { if (!require(x, character.only = TRUE)) { install.packages(x, dependencies = TRUE) library(x, character.only = TRUE) } } ) ############################################### setwd("~/COVID19-Singapore-master/Data") # Setting Working Directory COVID <- read.csv('SortedRecoveryData.csv', sep=",", header = TRUE, fileEncoding="UTF-8-BOM") pdf("~/COVID19-Singapore-master/Loess-Curve.pdf", width = 10, height = 6) # Loess Smoothing p <- qplot(data=COVID,x=as.Date(COVID_Confirm_Date),y=DaysInHospital, label = PatientID, geom=("point"), hjust=0, vjust=0)+ geom_text(check_overlap = TRUE, size = 3, hjust = 0, nudge_x = 0.05)+ scale_x_date(breaks = as.Date(COVID$COVID_Confirm_Date), labels = date_format("%m/%d")) + theme(axis.text.x = element_text(angle = 90)) + geom_vline(xintercept=c(as.numeric(as.Date("2020-01-23")),as.numeric(as.Date("2020-02-03")), as.numeric(as.Date("2020-03-16"))),linetype=5, size =1, colour="red") + xlab("Case-wise Date of +ve Confirmation") + ylab("#Days from +ve-Confirmation to Clinical Recovery") + #ggtitle ("Clinical Recovery") + theme_bw() + theme(axis.text.x = element_text(face="bold", color="black", size=8, angle = 90), axis.text.y = element_text(face="bold", color="black", size=8), axis.title=element_text(size=12,face="bold") ) print(p) p + stat_smooth(color = "#FC4E07", fill = "#FC4E07", method = "loess") p + stat_smooth(aes(outfit=fit<<-..y..), color = "#FC4E07", fill = "#FC4E07", method = "loess") dev.off() rm(list=ls()) ###############################################
/Scripts/R_Scripts/Loess_SmoothCurve.R
no_license
GVCL/COVID19-Singapore
R
false
false
1,900
r
############################################### requiredPackages = c('ggplot2','scales', 'gridExtra') package.check <- lapply( requiredPackages, FUN = function(x) { if (!require(x, character.only = TRUE)) { install.packages(x, dependencies = TRUE) library(x, character.only = TRUE) } } ) ############################################### setwd("~/COVID19-Singapore-master/Data") # Setting Working Directory COVID <- read.csv('SortedRecoveryData.csv', sep=",", header = TRUE, fileEncoding="UTF-8-BOM") pdf("~/COVID19-Singapore-master/Loess-Curve.pdf", width = 10, height = 6) # Loess Smoothing p <- qplot(data=COVID,x=as.Date(COVID_Confirm_Date),y=DaysInHospital, label = PatientID, geom=("point"), hjust=0, vjust=0)+ geom_text(check_overlap = TRUE, size = 3, hjust = 0, nudge_x = 0.05)+ scale_x_date(breaks = as.Date(COVID$COVID_Confirm_Date), labels = date_format("%m/%d")) + theme(axis.text.x = element_text(angle = 90)) + geom_vline(xintercept=c(as.numeric(as.Date("2020-01-23")),as.numeric(as.Date("2020-02-03")), as.numeric(as.Date("2020-03-16"))),linetype=5, size =1, colour="red") + xlab("Case-wise Date of +ve Confirmation") + ylab("#Days from +ve-Confirmation to Clinical Recovery") + #ggtitle ("Clinical Recovery") + theme_bw() + theme(axis.text.x = element_text(face="bold", color="black", size=8, angle = 90), axis.text.y = element_text(face="bold", color="black", size=8), axis.title=element_text(size=12,face="bold") ) print(p) p + stat_smooth(color = "#FC4E07", fill = "#FC4E07", method = "loess") p + stat_smooth(aes(outfit=fit<<-..y..), color = "#FC4E07", fill = "#FC4E07", method = "loess") dev.off() rm(list=ls()) ###############################################
linearStrand1 <- function(g,maxBetti=vcount(g)) { x <- rep(0,vcount(g)) d <- degree(g) for(i in 0:min(maxBetti,vcount(g))) { x[i+1] <- sum(sapply(d,choose,i+1))-length(cliques(g,i+2,i+2)) if(x[i+1]==0) break } a <- matrix(c(0,x[x>0]),nrow=1) a <- list(graded=cbind(c(1,0),rbind(rep(0,ncol(a)),a))) class(a) <- c("linear.strand","exact") a } linearStrand2 <- function(g,maxBetti=vcount(g)) { n <- vcount(g) x <- rep(0,n) h <- graph.complementer(g) for(i in 1:min(maxBetti,(n-1))) { S <- combn(n,i+1)-1 for(j in 1:ncol(S)){ k <- no.clusters(subgraph(h,S[,j]))-1 x[i+1] <- x[i+1] + k } if(x[i+1]==0) break } a <- matrix(c(0,x[x>0]),nrow=1) a <- list(graded=cbind(c(1,0),rbind(rep(0,ncol(a)),a))) class(a) <- c("linear.strand","exact") a } linearStrandLower <- function(g,maxBetti=vcount(g)) { x <- rep(0,vcount(g)) d <- degree(g) x[1] <- ecount(g) if(maxBetti==1) return(x[1]) x[2] <- count.angles(g)+2*count.triangles(g) if(maxBetti==2) return(x[1:2]) n <- vcount(g) A <- matrix(NA,nrow=100,ncol=100) for(i in 2:min(n,maxBetti)) { x[i+1] <- sum(sapply(d,choose,i+1))-length(cliques(g,i+2,i+2)) j <- floor((i+2)/2) for(a in 2:j){ z <- max(c(a,i+2-a)) if(z>nrow(A)){ B <- matrix(NA,nrow=z,ncol=z) B[1:nrow(A),1:ncol(A)] <- A A <- B } if(is.na(A[a,i+2-a])){ b <- count.bipartite(g,a,i+2-a) A[a,i+2-a] <- b A[i+2-a,a] <- b } else { b <- A[a,i+2-a] } x[i+1] <- x[i+1]+b } if(x[i+1]==0) break } a <- matrix(c(0,x[x>0]),nrow=1) a <- list(graded=cbind(c(1,0),rbind(rep(0,ncol(a)),a))) class(a) <- c("linear.strand","lower.bound") a } linearStrand <- function(g,maxBetti=vcount(g),exact=FALSE) { if(ecount(g)==0) return(0) if(is.chordal(graph.complementer(g))){ a <- mfr(g) class(a) <- c("linear.strand","exact") return(a) } if(count.squares(g)>0) { if(exact) { a <- linearStrand2(g,maxBetti=maxBetti) } else { a <- linearStrandLower(g,maxBetti=maxBetti) } } else { a <- linearStrand1(g,maxBetti=maxBetti) } a } betti2 <- function(g) ecount(g) betti3 <- function(g) { x <- rep(0,2) x[1] <- count.angles(g)+2*count.triangles(g) x[2] <- count.bars(g) x } print.linear.strand <- function(x,...) { cat("Linear Strand of a Minimal Free Resolution:\n") cat(x$graded,"\n") if(inherits(x,"exact")) cat("Betti numbers are exact\n") if(inherits(x,"lower.bound")) cat("Betti numbers are a lower bound\n") }
/R/partial.R
no_license
cran/mfr
R
false
false
2,460
r
linearStrand1 <- function(g,maxBetti=vcount(g)) { x <- rep(0,vcount(g)) d <- degree(g) for(i in 0:min(maxBetti,vcount(g))) { x[i+1] <- sum(sapply(d,choose,i+1))-length(cliques(g,i+2,i+2)) if(x[i+1]==0) break } a <- matrix(c(0,x[x>0]),nrow=1) a <- list(graded=cbind(c(1,0),rbind(rep(0,ncol(a)),a))) class(a) <- c("linear.strand","exact") a } linearStrand2 <- function(g,maxBetti=vcount(g)) { n <- vcount(g) x <- rep(0,n) h <- graph.complementer(g) for(i in 1:min(maxBetti,(n-1))) { S <- combn(n,i+1)-1 for(j in 1:ncol(S)){ k <- no.clusters(subgraph(h,S[,j]))-1 x[i+1] <- x[i+1] + k } if(x[i+1]==0) break } a <- matrix(c(0,x[x>0]),nrow=1) a <- list(graded=cbind(c(1,0),rbind(rep(0,ncol(a)),a))) class(a) <- c("linear.strand","exact") a } linearStrandLower <- function(g,maxBetti=vcount(g)) { x <- rep(0,vcount(g)) d <- degree(g) x[1] <- ecount(g) if(maxBetti==1) return(x[1]) x[2] <- count.angles(g)+2*count.triangles(g) if(maxBetti==2) return(x[1:2]) n <- vcount(g) A <- matrix(NA,nrow=100,ncol=100) for(i in 2:min(n,maxBetti)) { x[i+1] <- sum(sapply(d,choose,i+1))-length(cliques(g,i+2,i+2)) j <- floor((i+2)/2) for(a in 2:j){ z <- max(c(a,i+2-a)) if(z>nrow(A)){ B <- matrix(NA,nrow=z,ncol=z) B[1:nrow(A),1:ncol(A)] <- A A <- B } if(is.na(A[a,i+2-a])){ b <- count.bipartite(g,a,i+2-a) A[a,i+2-a] <- b A[i+2-a,a] <- b } else { b <- A[a,i+2-a] } x[i+1] <- x[i+1]+b } if(x[i+1]==0) break } a <- matrix(c(0,x[x>0]),nrow=1) a <- list(graded=cbind(c(1,0),rbind(rep(0,ncol(a)),a))) class(a) <- c("linear.strand","lower.bound") a } linearStrand <- function(g,maxBetti=vcount(g),exact=FALSE) { if(ecount(g)==0) return(0) if(is.chordal(graph.complementer(g))){ a <- mfr(g) class(a) <- c("linear.strand","exact") return(a) } if(count.squares(g)>0) { if(exact) { a <- linearStrand2(g,maxBetti=maxBetti) } else { a <- linearStrandLower(g,maxBetti=maxBetti) } } else { a <- linearStrand1(g,maxBetti=maxBetti) } a } betti2 <- function(g) ecount(g) betti3 <- function(g) { x <- rep(0,2) x[1] <- count.angles(g)+2*count.triangles(g) x[2] <- count.bars(g) x } print.linear.strand <- function(x,...) { cat("Linear Strand of a Minimal Free Resolution:\n") cat(x$graded,"\n") if(inherits(x,"exact")) cat("Betti numbers are exact\n") if(inherits(x,"lower.bound")) cat("Betti numbers are a lower bound\n") }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/gcx.r \name{gcx} \alias{gcx} \title{GCx of a list of genes} \usage{ gcx(x, pos = 1) } \arguments{ \item{x}{a list of KZsqns objects.} \item{pos}{the position of the codon for which GCx is calculated. 1: GC1; 2:GC2; 3: GC3; 4:GC12} } \value{ a matrix of the GCx of the list of genes } \description{ Calculates the GC1,2,3 and GC12 contents of a list of genes } \examples{ }
/man/gcx.Rd
permissive
HVoltBb/kodonz
R
false
true
453
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/gcx.r \name{gcx} \alias{gcx} \title{GCx of a list of genes} \usage{ gcx(x, pos = 1) } \arguments{ \item{x}{a list of KZsqns objects.} \item{pos}{the position of the codon for which GCx is calculated. 1: GC1; 2:GC2; 3: GC3; 4:GC12} } \value{ a matrix of the GCx of the list of genes } \description{ Calculates the GC1,2,3 and GC12 contents of a list of genes } \examples{ }
theme_Publication <- function(base_size=14, base_family="Helvetica") { library(grid) library(ggthemes) (theme_foundation(base_size=base_size, base_family=base_family) + theme(plot.title = element_text(face = "bold", size = rel(1.2), hjust = 0.5), text = element_text(), panel.background = element_rect(colour = NA), plot.background = element_rect(colour = NA), panel.border = element_rect(colour = NA), axis.title = element_text(face = "bold",size = rel(1)), axis.title.y = element_text(angle=90,vjust =2), axis.title.x = element_text(vjust = -0.2), # axis.title.x=element_blank(), # axis.text.x = element_text(angle=45, hjust=1), axis.text = element_text(), # axis.text.x = element_blank(), axis.line = element_line(colour="black"), axis.ticks = element_line(), # axis.ticks.x = element_blank(), panel.grid.major = element_line(colour="#f0f0f0"), panel.grid.minor = element_blank(), legend.key = element_rect(colour = NA), legend.position = "bottom", # legend.position = "right", legend.direction = "horizontal", # legend.direction = "vertical", legend.key.size = unit(0.2, "cm"), legend.margin = unit(0, "cm"), # legend.title = element_text(face="italic"), legend.title = element_blank(), strip.background = element_rect(colour="#f0f0f0",fill="#f0f0f0"), strip.text = element_text(face="bold"), plot.margin = unit(c(10,5,5,5),"mm"), # plot.margin = unit(c(0.5,4,0.5,8),"cm") )) } scale_fill_Publication <- function(...){ library(scales) discrete_scale("fill", "Publication", manual_pal(values=c("#fb9a99", "#386cb0", "#984ea3", "#ffff33", "#fdb462", "#7fc97f", "#ef3b2c", "#662506", "#a6cee3" )), ...) } scale_colour_Publication <- function(...){ library(scales) discrete_scale("colour", "Publication", manual_pal(values=c("#fb9a99","#386cb0", "#984ea3", "#ffff33", "#fdb462", "#7fc97f", "#ef3b2c", "#662506", "#a6cee3" )), ...) } #fdb462 - dark yellow #984ea3 - purple #386cb0 - blue #7fc97f - green #ef3b2c - red #a6cee3 - light blue #ffff33 - bright yellow #662506 - brown #fb9a99 - pink
/R/~old/R/themePublication.R
permissive
BaderLab/POPPATHR
R
false
false
2,668
r
theme_Publication <- function(base_size=14, base_family="Helvetica") { library(grid) library(ggthemes) (theme_foundation(base_size=base_size, base_family=base_family) + theme(plot.title = element_text(face = "bold", size = rel(1.2), hjust = 0.5), text = element_text(), panel.background = element_rect(colour = NA), plot.background = element_rect(colour = NA), panel.border = element_rect(colour = NA), axis.title = element_text(face = "bold",size = rel(1)), axis.title.y = element_text(angle=90,vjust =2), axis.title.x = element_text(vjust = -0.2), # axis.title.x=element_blank(), # axis.text.x = element_text(angle=45, hjust=1), axis.text = element_text(), # axis.text.x = element_blank(), axis.line = element_line(colour="black"), axis.ticks = element_line(), # axis.ticks.x = element_blank(), panel.grid.major = element_line(colour="#f0f0f0"), panel.grid.minor = element_blank(), legend.key = element_rect(colour = NA), legend.position = "bottom", # legend.position = "right", legend.direction = "horizontal", # legend.direction = "vertical", legend.key.size = unit(0.2, "cm"), legend.margin = unit(0, "cm"), # legend.title = element_text(face="italic"), legend.title = element_blank(), strip.background = element_rect(colour="#f0f0f0",fill="#f0f0f0"), strip.text = element_text(face="bold"), plot.margin = unit(c(10,5,5,5),"mm"), # plot.margin = unit(c(0.5,4,0.5,8),"cm") )) } scale_fill_Publication <- function(...){ library(scales) discrete_scale("fill", "Publication", manual_pal(values=c("#fb9a99", "#386cb0", "#984ea3", "#ffff33", "#fdb462", "#7fc97f", "#ef3b2c", "#662506", "#a6cee3" )), ...) } scale_colour_Publication <- function(...){ library(scales) discrete_scale("colour", "Publication", manual_pal(values=c("#fb9a99","#386cb0", "#984ea3", "#ffff33", "#fdb462", "#7fc97f", "#ef3b2c", "#662506", "#a6cee3" )), ...) } #fdb462 - dark yellow #984ea3 - purple #386cb0 - blue #7fc97f - green #ef3b2c - red #a6cee3 - light blue #ffff33 - bright yellow #662506 - brown #fb9a99 - pink
#' Read in SIBER format data and generate the SIBER object #' #' This function takes raw isotope data and creates a SIBER object which #' contains information in a structured manner that enables other functions to #' loop over groups and communities, fit Bayesian ellipses, and afterwards, #' generate various plots, and additional analyses on the posterior #' distributions. #' #' @param data.in Specified In a basic R data.frame or matrix comprising 4 #' columns. The first two of which are typically isotope tracers, then the #' third is a column that indicates the group membership, and the fourth #' column indicates the community membership of an observation. Communities #' labels should be entered as sequential numbers. As of v2.0.1 group labels #' can be entered as strings and/or numbers and need not be sequential. #' @return A siber list object, that contains data that helps with various model #' fitting and plotting. \itemize{ \item {original.data}{The original data as #' passed into this function} \item {iso.summary}{The max, min, mean and #' median of the isotope data useful for plotting} \item {sample.sizes}{The #' number of observations tabulated by group and community} \item {raw.data}{A #' list object of length equal to the number of communities} } #' @examples #' data(demo.siber.data) #' my.siber.data <- createSiberObject(demo.siber.data) #' names(my.siber.data) #' #' @export createSiberObject <- function (data.in) { # Check that the column headers have exactly the correct string if (!all(names(data.in) == c("iso1", "iso2", "group", "community"))){ stop('The header names in your data file must match c("iso1", "iso2", "group", "community") exactly') } # error if community is not a sequential numeric vector # if (!is.numeric(data.in$community)){ # stop('The community column must be a sequential numeric vector # indicating the community membership of each observation.') # } # force group and community variable to be factors data.in$group <- as.factor(data.in$group) data.in$community <- as.factor(data.in$community) # create an object that is a list, into which the raw data, # its transforms, and various calculated metrics can be stored. siber <- list() # keep the original data in its original format just in case # In fact, it can be easier to work with this format, as tapply # works well on it. I half wonder if i could just keep all the data like this # if i were able to use tapply more effectively on multiple inputs. siber$original.data <- data.in # store all the grouping labels siber$all.groups <- levels(data.in$group) # store all the community labels siber$all.communities <- levels(data.in$community) # some basic summary stats helpful for plotting my.summary <- function(x){ c(min = min(x), max = max(x), mean = mean(x), median = stats::median(x)) } siber$iso.summary <- apply(data.in[,1:2], 2, my.summary) siber$sample.sizes <- tapply(data.in[,1], list(data.in[,4], data.in[,3]), length) if (any(siber$sample.sizes < 5, na.rm = TRUE)){ warning("At least one of your groups has less than 5 observations. The absolute minimum sample size for each group is 3 in order for the various ellipses and corresponding metrics to be calculated. More reasonably though, a minimum of 5 data points are required to calculate the two means and the 2x2 covariance matrix and not run out of degrees of freedom. Check the item named 'sample.sizes' in the object returned by this function in order to locate the offending group. Bear in mind that NAs in the sample.size matrix simply indicate groups that are not present in that community, and is an acceptable data structure for these analyses.") } # store the raw data as list split by the community variable # and rename the list components siber$raw.data <- split(data.in, data.in$community) #names(siber$raw.data) <- paste("community", # unique(data.in$community), sep = "") # how many communities are there siber$n.communities <- length(unique(data.in$community)) # now many groups are in each community siber$n.groups <- matrix(NA, 2, length(siber$raw.data), dimnames = list(c("community", "n.groups"), rep("", siber$n.communities))) siber$n.groups[1, ] <- unique(data.in$community) siber$n.groups[2, ] <- tapply(data.in$group, data.in$community, function(x){length(unique(x))}) # ------------------------------------------------------------------------------ # create empty arrays in which to store the Maximum Likelihood estimates # of the means and covariances for each group. siber$ML.mu <- list() siber$ML.cov <- list() siber$group.names <- list() for (i in 1:siber$n.communities){ siber$ML.mu[[i]] <- array(NA, dim=c(1, 2, siber$n.groups[2,i]) ) siber$ML.cov[[i]] <- array(NA, dim=c(2, 2, siber$n.groups[2,i]) ) } # loop over each community and extract the Maximum Likelihood estimates # of the location (their simple independent means) and covariance # matrix of each group that comprises the community. # I hvae done this as a loop, as I cant see how to be clever # and use some of the apply() or analogue functions. for (i in 1:siber$n.communities) { siber$group.names[[i]] <- unique(siber$raw.data[[i]]$group) for (j in 1:siber$n.groups[2,i]) { # AJ - issue - (group == j) tmp <- subset(siber$raw.data[[i]], siber$raw.data[[i]]$group == siber$group.names[[i]][j]) mu.tmp <- colMeans(cbind(tmp$iso1, tmp$iso2)) cov.tmp <- stats::cov(cbind(tmp$iso1, tmp$iso2)) siber$ML.mu[[i]][,,j] <- mu.tmp siber$ML.cov[[i]][,,j] <- cov.tmp } # end of loop over groups # Add names to the dimensions of the array dimnames(siber$ML.mu[[i]]) <- list(NULL, c("iso1", "iso2"), siber$group.names[[i]]) dimnames(siber$ML.cov[[i]]) <- list(c("iso1", "iso2"), c("iso1", "iso2"), siber$group.names[[i]]) } # end of loop over communities names(siber$ML.mu) <- siber$all.communities names(siber$ML.cov) <- siber$all.communities # ------------------------------------------------------------------------------ # create z-score transformed versions of the raw data. # we can then use the saved information in the mean and # covariances for each group stored in ML.mu and ML.cov # to backtransform them later. # first create a copy of the raw data into a list zscore.data siber$zscore.data <- siber$raw.data for (i in 1:siber$n.communities) { # apply z-score transform to each group within the community via tapply() # using the function scale() siber$zscore.data[[i]][,1] <- unlist(tapply(siber$raw.data[[i]]$iso1, siber$raw.data[[i]]$group, scale)) siber$zscore.data[[i]][,2] <- unlist(tapply(siber$raw.data[[i]]$iso2, siber$raw.data[[i]]$group, scale)) } return(siber) } # end of function
/R/createSiberObject.R
no_license
bsharris381/SIBER
R
false
false
7,361
r
#' Read in SIBER format data and generate the SIBER object #' #' This function takes raw isotope data and creates a SIBER object which #' contains information in a structured manner that enables other functions to #' loop over groups and communities, fit Bayesian ellipses, and afterwards, #' generate various plots, and additional analyses on the posterior #' distributions. #' #' @param data.in Specified In a basic R data.frame or matrix comprising 4 #' columns. The first two of which are typically isotope tracers, then the #' third is a column that indicates the group membership, and the fourth #' column indicates the community membership of an observation. Communities #' labels should be entered as sequential numbers. As of v2.0.1 group labels #' can be entered as strings and/or numbers and need not be sequential. #' @return A siber list object, that contains data that helps with various model #' fitting and plotting. \itemize{ \item {original.data}{The original data as #' passed into this function} \item {iso.summary}{The max, min, mean and #' median of the isotope data useful for plotting} \item {sample.sizes}{The #' number of observations tabulated by group and community} \item {raw.data}{A #' list object of length equal to the number of communities} } #' @examples #' data(demo.siber.data) #' my.siber.data <- createSiberObject(demo.siber.data) #' names(my.siber.data) #' #' @export createSiberObject <- function (data.in) { # Check that the column headers have exactly the correct string if (!all(names(data.in) == c("iso1", "iso2", "group", "community"))){ stop('The header names in your data file must match c("iso1", "iso2", "group", "community") exactly') } # error if community is not a sequential numeric vector # if (!is.numeric(data.in$community)){ # stop('The community column must be a sequential numeric vector # indicating the community membership of each observation.') # } # force group and community variable to be factors data.in$group <- as.factor(data.in$group) data.in$community <- as.factor(data.in$community) # create an object that is a list, into which the raw data, # its transforms, and various calculated metrics can be stored. siber <- list() # keep the original data in its original format just in case # In fact, it can be easier to work with this format, as tapply # works well on it. I half wonder if i could just keep all the data like this # if i were able to use tapply more effectively on multiple inputs. siber$original.data <- data.in # store all the grouping labels siber$all.groups <- levels(data.in$group) # store all the community labels siber$all.communities <- levels(data.in$community) # some basic summary stats helpful for plotting my.summary <- function(x){ c(min = min(x), max = max(x), mean = mean(x), median = stats::median(x)) } siber$iso.summary <- apply(data.in[,1:2], 2, my.summary) siber$sample.sizes <- tapply(data.in[,1], list(data.in[,4], data.in[,3]), length) if (any(siber$sample.sizes < 5, na.rm = TRUE)){ warning("At least one of your groups has less than 5 observations. The absolute minimum sample size for each group is 3 in order for the various ellipses and corresponding metrics to be calculated. More reasonably though, a minimum of 5 data points are required to calculate the two means and the 2x2 covariance matrix and not run out of degrees of freedom. Check the item named 'sample.sizes' in the object returned by this function in order to locate the offending group. Bear in mind that NAs in the sample.size matrix simply indicate groups that are not present in that community, and is an acceptable data structure for these analyses.") } # store the raw data as list split by the community variable # and rename the list components siber$raw.data <- split(data.in, data.in$community) #names(siber$raw.data) <- paste("community", # unique(data.in$community), sep = "") # how many communities are there siber$n.communities <- length(unique(data.in$community)) # now many groups are in each community siber$n.groups <- matrix(NA, 2, length(siber$raw.data), dimnames = list(c("community", "n.groups"), rep("", siber$n.communities))) siber$n.groups[1, ] <- unique(data.in$community) siber$n.groups[2, ] <- tapply(data.in$group, data.in$community, function(x){length(unique(x))}) # ------------------------------------------------------------------------------ # create empty arrays in which to store the Maximum Likelihood estimates # of the means and covariances for each group. siber$ML.mu <- list() siber$ML.cov <- list() siber$group.names <- list() for (i in 1:siber$n.communities){ siber$ML.mu[[i]] <- array(NA, dim=c(1, 2, siber$n.groups[2,i]) ) siber$ML.cov[[i]] <- array(NA, dim=c(2, 2, siber$n.groups[2,i]) ) } # loop over each community and extract the Maximum Likelihood estimates # of the location (their simple independent means) and covariance # matrix of each group that comprises the community. # I hvae done this as a loop, as I cant see how to be clever # and use some of the apply() or analogue functions. for (i in 1:siber$n.communities) { siber$group.names[[i]] <- unique(siber$raw.data[[i]]$group) for (j in 1:siber$n.groups[2,i]) { # AJ - issue - (group == j) tmp <- subset(siber$raw.data[[i]], siber$raw.data[[i]]$group == siber$group.names[[i]][j]) mu.tmp <- colMeans(cbind(tmp$iso1, tmp$iso2)) cov.tmp <- stats::cov(cbind(tmp$iso1, tmp$iso2)) siber$ML.mu[[i]][,,j] <- mu.tmp siber$ML.cov[[i]][,,j] <- cov.tmp } # end of loop over groups # Add names to the dimensions of the array dimnames(siber$ML.mu[[i]]) <- list(NULL, c("iso1", "iso2"), siber$group.names[[i]]) dimnames(siber$ML.cov[[i]]) <- list(c("iso1", "iso2"), c("iso1", "iso2"), siber$group.names[[i]]) } # end of loop over communities names(siber$ML.mu) <- siber$all.communities names(siber$ML.cov) <- siber$all.communities # ------------------------------------------------------------------------------ # create z-score transformed versions of the raw data. # we can then use the saved information in the mean and # covariances for each group stored in ML.mu and ML.cov # to backtransform them later. # first create a copy of the raw data into a list zscore.data siber$zscore.data <- siber$raw.data for (i in 1:siber$n.communities) { # apply z-score transform to each group within the community via tapply() # using the function scale() siber$zscore.data[[i]][,1] <- unlist(tapply(siber$raw.data[[i]]$iso1, siber$raw.data[[i]]$group, scale)) siber$zscore.data[[i]][,2] <- unlist(tapply(siber$raw.data[[i]]$iso2, siber$raw.data[[i]]$group, scale)) } return(siber) } # end of function
#============ DYNAMIC PLOTS ====================== #++++++++++++++++++++++++++++++++++++++++++++++++++ plotShiny <- function(eval, pointOfInterest){ data <- eval$thresholdSummary[eval$thresholdSummary$Eval%in%c('test','validation'),] # pointOfInterest # this is a threshold pointOfInterest <- data[pointOfInterest,] rocobject <- plotly::plot_ly(x = 1-c(0,data$specificity,1)) %>% plotly::add_lines(y = c(1,data$sensitivity,0),name = "hv", text = paste('Risk Threshold:',c(0,data$predictionThreshold,1)), line = list(shape = "hv", color = 'rgb(22, 96, 167)'), fill = 'tozeroy') %>% plotly::add_trace(x= c(0,1), y = c(0,1),mode = 'lines', line = list(dash = "dash"), color = I('black'), type='scatter') %>% plotly::add_trace(x= 1-pointOfInterest$specificity, y=pointOfInterest$sensitivity, mode = 'markers', symbols='x') %>% # change the colour of this! plotly::add_lines(x=c(1-pointOfInterest$specificity, 1-pointOfInterest$specificity), y = c(0,1), line = list(dash ='solid', color = 'black')) %>% plotly::layout(title = "ROC Plot", xaxis = list(title = "1-specificity"), yaxis = list (title = "Sensitivity"), showlegend = FALSE) popAv <- data$trueCount[1]/(data$trueCount[1] + data$falseCount[1]) probject <- plotly::plot_ly(x = data$sensitivity) %>% plotly::add_lines(y = data$positivePredictiveValue, name = "hv", text = paste('Risk Threshold:',data$predictionThreshold), line = list(shape = "hv", color = 'rgb(22, 96, 167)'), fill = 'tozeroy') %>% plotly::add_trace(x= c(0,1), y = c(popAv,popAv),mode = 'lines', line = list(dash = "dash"), color = I('red'), type='scatter') %>% plotly::add_trace(x= pointOfInterest$sensitivity, y=pointOfInterest$positivePredictiveValue, mode = 'markers', symbols='x') %>% plotly::add_lines(x=c(pointOfInterest$sensitivity, pointOfInterest$sensitivity), y = c(0,1), line = list(dash ='solid', color = 'black')) %>% plotly::layout(title = "PR Plot", xaxis = list(title = "Recall"), yaxis = list (title = "Precision"), showlegend = FALSE) # add F1 score f1object <- plotly::plot_ly(x = data$predictionThreshold) %>% plotly::add_lines(y = data$f1Score, name = "hv", text = paste('Risk Threshold:',data$predictionThreshold), line = list(shape = "hv", color = 'rgb(22, 96, 167)'), fill = 'tozeroy') %>% plotly::add_trace(x= pointOfInterest$predictionThreshold, y=pointOfInterest$f1Score, mode = 'markers', symbols='x') %>% plotly::add_lines(x=c(pointOfInterest$predictionThreshold, pointOfInterest$predictionThreshold), y = c(0,1), line = list(dash ='solid', color = 'black')) %>% plotly::layout(title = "F1-Score Plot", xaxis = list(title = "Prediction Threshold"), yaxis = list (title = "F1-Score"), showlegend = FALSE) # create 2x2 table with TP, FP, TN, FN and threshold threshold <- pointOfInterest$predictionThreshold TP <- pointOfInterest$truePositiveCount TN <- pointOfInterest$trueNegativeCount FP <- pointOfInterest$falsePositiveCount FN <- pointOfInterest$falseNegativeCount preferenceThreshold <- pointOfInterest$preferenceThreshold return(list(roc = rocobject, pr = probject, f1score = f1object, threshold = threshold, prefthreshold=preferenceThreshold, TP = TP, TN=TN, FP= FP, FN=FN)) } plotCovariateSummary <- function(covariateSummary){ #writeLines(paste(colnames(covariateSummary))) #writeLines(paste(covariateSummary[1,])) # remove na values covariateSummary$CovariateMeanWithNoOutcome[is.na(covariateSummary$CovariateMeanWithNoOutcome)] <- 0 covariateSummary$CovariateMeanWithOutcome[is.na(covariateSummary$CovariateMeanWithOutcome)] <- 0 if(!'covariateValue'%in%colnames(covariateSummary)){ covariateSummary$covariateValue <- 1 } if(sum(is.na(covariateSummary$covariateValue))>0){ covariateSummary$covariateValue[is.na(covariateSummary$covariateValue)] <- 0 } # SPEED EDIT remove the none model variables covariateSummary <- covariateSummary[covariateSummary$covariateValue!=0,] # save dots based on coef value covariateSummary$size <- abs(covariateSummary$covariateValue) covariateSummary$size[is.na(covariateSummary$size)] <- 4 covariateSummary$size <- 4+4*covariateSummary$size/max(covariateSummary$size) # color based on analysis id covariateSummary$color <- sapply(covariateSummary$covariateName, function(x) ifelse(is.na(x), '', strsplit(as.character(x), ' ')[[1]][1])) l <- list(x = 0.01, y = 1, font = list( family = "sans-serif", size = 10, color = "#000"), bgcolor = "#E2E2E2", bordercolor = "#FFFFFF", borderwidth = 1) #covariateSummary$annotation <- sapply(covariateSummary$covariateName, getName) covariateSummary$annotation <- covariateSummary$covariateName ind <- covariateSummary$CovariateMeanWithNoOutcome <=1 & covariateSummary$CovariateMeanWithOutcome <= 1 # create two plots -1 or less or g1 binary <- plotly::plot_ly(x = covariateSummary$CovariateMeanWithNoOutcome[ind], #size = covariateSummary$size[ind], showlegend = F) %>% plotly::add_markers(y = covariateSummary$CovariateMeanWithOutcome[ind], color=factor(covariateSummary$color[ind]), text = paste(covariateSummary$annotation[ind]), showlegend = T ) %>% plotly::add_trace(x= c(0,1), y = c(0,1),mode = 'lines', line = list(dash = "dash"), color = I('black'), type='scatter', showlegend = FALSE) %>% plotly::layout(#title = 'Prevalance of baseline predictors in persons with and without outcome', xaxis = list(title = "Prevalance in persons without outcome", range = c(0, 1)), yaxis = list(title = "Prevalance in persons with outcome", range = c(0, 1)), legend = l, showlegend = T) if(sum(!ind)>0){ maxValue <- max(c(covariateSummary$CovariateMeanWithNoOutcome[!ind], covariateSummary$CovariateMeanWithOutcome[!ind]), na.rm = T) meas <- plotly::plot_ly(x = covariateSummary$CovariateMeanWithNoOutcome[!ind] ) %>% plotly::add_markers(y = covariateSummary$CovariateMeanWithOutcome[!ind], text = paste(covariateSummary$annotation[!ind])) %>% plotly::add_trace(x= c(0,maxValue), y = c(0,maxValue),mode = 'lines', line = list(dash = "dash"), color = I('black'), type='scatter', showlegend = FALSE) %>% plotly::layout(#title = 'Prevalance of baseline predictors in persons with and without outcome', xaxis = list(title = "Mean in persons without outcome"), yaxis = list(title = "Mean in persons with outcome"), showlegend = FALSE) } else { meas <- NULL } return(list(binary=binary, meas = meas)) } plotPredictedPDF <- function(evaluation, type='test', fileName=NULL){ ind <- evaluation$thresholdSummary$Eval==type x<- evaluation$thresholdSummary[ind,c('predictionThreshold','truePositiveCount','trueNegativeCount', 'falsePositiveCount','falseNegativeCount')] x<- x[order(x$predictionThreshold,-x$truePositiveCount, -x$falsePositiveCount),] x$out <- c(x$truePositiveCount[-length(x$truePositiveCount)]-x$truePositiveCount[-1], x$truePositiveCount[length(x$truePositiveCount)]) x$nout <- c(x$falsePositiveCount[-length(x$falsePositiveCount)]-x$falsePositiveCount[-1], x$falsePositiveCount[length(x$falsePositiveCount)]) vals <- c() for(i in 1:length(x$predictionThreshold)){ if(i!=length(x$predictionThreshold)){ upper <- x$predictionThreshold[i+1]} else {upper <- min(x$predictionThreshold[i]+0.01,1)} val <- x$predictionThreshold[i]+runif(x$out[i])*(upper-x$predictionThreshold[i]) vals <- c(val, vals) } vals[!is.na(vals)] vals2 <- c() for(i in 1:length(x$predictionThreshold)){ if(i!=length(x$predictionThreshold)){ upper <- x$predictionThreshold[i+1]} else {upper <- min(x$predictionThreshold[i]+0.01,1)} val2 <- x$predictionThreshold[i]+runif(x$nout[i])*(upper-x$predictionThreshold[i]) vals2 <- c(val2, vals2) } vals2[!is.na(vals2)] x <- rbind(data.frame(variable=rep('outcome',length(vals)), value=vals), data.frame(variable=rep('No outcome',length(vals2)), value=vals2) ) plot <- ggplot2::ggplot(x, ggplot2::aes(x=x$value, group=x$variable, fill=x$variable)) + ggplot2::geom_density(ggplot2::aes(x=x$value, fill=x$variable), alpha=.3) + ggplot2::scale_x_continuous("Prediction Threshold")+#, limits=c(0,1)) + ggplot2::scale_y_continuous("Density") + ggplot2::guides(fill=ggplot2::guide_legend(title="Class")) if (!is.null(fileName)) ggplot2::ggsave(fileName, plot, width = 5, height = 4.5, dpi = 400) return(plot) } plotPreferencePDF <- function(evaluation, type='test', fileName=NULL){ ind <- evaluation$thresholdSummary$Eval==type x<- evaluation$thresholdSummary[ind,c('preferenceThreshold','truePositiveCount','trueNegativeCount', 'falsePositiveCount','falseNegativeCount')] x<- x[order(x$preferenceThreshold,-x$truePositiveCount),] x$out <- c(x$truePositiveCount[-length(x$truePositiveCount)]-x$truePositiveCount[-1], x$truePositiveCount[length(x$truePositiveCount)]) x$nout <- c(x$falsePositiveCount[-length(x$falsePositiveCount)]-x$falsePositiveCount[-1], x$falsePositiveCount[length(x$falsePositiveCount)]) vals <- c() for(i in 1:length(x$preferenceThreshold)){ if(i!=length(x$preferenceThreshold)){ upper <- x$preferenceThreshold[i+1]} else {upper <- 1} val <- x$preferenceThreshold[i]+runif(x$out[i])*(upper-x$preferenceThreshold[i]) vals <- c(val, vals) } vals[!is.na(vals)] vals2 <- c() for(i in 1:length(x$preferenceThreshold)){ if(i!=length(x$preferenceThreshold)){ upper <- x$preferenceThreshold[i+1]} else {upper <- 1} val2 <- x$preferenceThreshold[i]+runif(x$nout[i])*(upper-x$preferenceThreshold[i]) vals2 <- c(val2, vals2) } vals2[!is.na(vals2)] x <- rbind(data.frame(variable=rep('outcome',length(vals)), value=vals), data.frame(variable=rep('No outcome',length(vals2)), value=vals2) ) plot <- ggplot2::ggplot(x, ggplot2::aes(x=x$value, group=x$variable, fill=x$variable)) + ggplot2::geom_density(ggplot2::aes(x=x$value, fill=x$variable), alpha=.3) + ggplot2::scale_x_continuous("Preference Threshold")+#, limits=c(0,1)) + ggplot2::scale_y_continuous("Density") + ggplot2::guides(fill=ggplot2::guide_legend(title="Class")) if (!is.null(fileName)) ggplot2::ggsave(fileName, plot, width = 5, height = 4.5, dpi = 400) return(plot) } plotDemographicSummary <- function(evaluation, type='test', fileName=NULL){ if (!all(is.na(evaluation$demographicSummary$averagePredictedProbability))){ ind <- evaluation$demographicSummary$Eval==type x<- evaluation$demographicSummary[ind,colnames(evaluation$demographicSummary)%in%c('ageGroup','genGroup','averagePredictedProbability', 'PersonCountAtRisk', 'PersonCountWithOutcome')] # remove -1 values: x <- x[x$PersonCountWithOutcome != -1,] if(nrow(x)==0){ return(NULL) } # end remove -1 values x$observed <- x$PersonCountWithOutcome/x$PersonCountAtRisk x <- x[,colnames(x)%in%c('ageGroup','genGroup','averagePredictedProbability','observed')] # if age or gender missing add if(sum(colnames(x)=='ageGroup')==1 && sum(colnames(x)=='genGroup')==0 ){ x$genGroup = rep('Non', nrow(x)) evaluation$demographicSummary$genGroup = rep('Non', nrow(evaluation$demographicSummary)) } if(sum(colnames(x)=='ageGroup')==0 && sum(colnames(x)=='genGroup')==1 ){ x$ageGroup = rep('-1', nrow(x)) evaluation$demographicSummary$ageGroup = rep('-1', nrow(evaluation$demographicSummary)) } x <- reshape2::melt(x, id.vars=c('ageGroup','genGroup')) # 1.96*StDevPredictedProbability ci <- evaluation$demographicSummary[,colnames(evaluation$demographicSummary)%in%c('ageGroup','genGroup','averagePredictedProbability','StDevPredictedProbability')] ci$StDevPredictedProbability[is.na(ci$StDevPredictedProbability)] <- 1 ci$lower <- ci$averagePredictedProbability-1.96*ci$StDevPredictedProbability ci$lower[ci$lower <0] <- 0 ci$upper <- ci$averagePredictedProbability+1.96*ci$StDevPredictedProbability ci$upper[ci$upper >1] <- max(ci$upper[ci$upper <1]) x$age <- gsub('Age group:','', x$ageGroup) x$age <- factor(x$age,levels=c(" 0-4"," 5-9"," 10-14", " 15-19"," 20-24"," 25-29"," 30-34"," 35-39"," 40-44", " 45-49"," 50-54"," 55-59"," 60-64"," 65-69"," 70-74", " 75-79"," 80-84"," 85-89"," 90-94"," 95-99","-1"),ordered=TRUE) x <- merge(x, ci[,c('ageGroup','genGroup','lower','upper')], by=c('ageGroup','genGroup')) plot <- ggplot2::ggplot(data=x, ggplot2::aes(x=age, group=variable*genGroup)) + ggplot2::geom_line(ggplot2::aes(y=value, group=variable, color=variable, linetype = variable))+ ggplot2::geom_ribbon(data=x[x$variable!='observed',], ggplot2::aes(ymin=lower, ymax=upper , group=genGroup), fill="blue", alpha="0.2") + ggplot2::facet_grid(.~ genGroup, scales = "free") + ggplot2::theme(axis.text.x = ggplot2::element_text(angle = 90, hjust = 1)) + #ggplot2::coord_flip() + ggplot2::scale_y_continuous("Fraction") + ggplot2::scale_x_discrete("Age") + ggplot2::scale_color_manual(values = c("royalblue4","red"), guide = ggplot2::guide_legend(title = NULL), labels = c("Expected", "Observed")) + ggplot2::guides(linetype=FALSE) if (!is.null(fileName)) ggplot2::ggsave(fileName, plot, width = 7, height = 4.5, dpi = 400) return(plot) } } #============= # CALIBRATIONSUMMARY PLOTS #============= #' Plot the calibration #' #' @details #' Create a plot showing the calibration #' #' #' @param evaluation A prediction object as generated using the #' \code{\link{runPlp}} function. #' @param type options: 'train' or test' #' @param fileName Name of the file where the plot should be saved, for example #' 'plot.png'. See the function \code{ggsave} in the ggplot2 package for #' supported file formats. #' #' @return #' A ggplot object. Use the \code{\link[ggplot2]{ggsave}} function to save to file in a different #' format. #' #' @export plotSparseCalibration <- function(evaluation, type='test', fileName=NULL){ ind <- evaluation$calibrationSummary$Eval==type x<- evaluation$calibrationSummary[ind,c('averagePredictedProbability','observedIncidence')] maxVal <- max(x$averagePredictedProbability,x$observedIncidence) model <- stats::lm(observedIncidence~averagePredictedProbability, data=x) res <- model$coefficients names(res) <- c('Intercept','Gradient') # confidence int interceptConf <- stats::confint(model)[1,] gradientConf <- stats::confint(model)[2,] cis <- data.frame(lci = interceptConf[1]+seq(0,1,length.out = nrow(x))*gradientConf[1], uci = interceptConf[2]+seq(0,1,length.out = nrow(x))*gradientConf[2], x=seq(0,1,length.out = nrow(x))) x <- cbind(x, cis) # TODO: CHECK INPUT plot <- ggplot2::ggplot(data=x, ggplot2::aes(x=averagePredictedProbability, y=observedIncidence )) + ggplot2::geom_ribbon(ggplot2::aes(ymin=lci,ymax=uci, x=x), fill="blue", alpha="0.2") + ggplot2::geom_point(size=1, color='darkblue') + ggplot2::coord_cartesian(ylim = c(0, maxVal), xlim =c(0,maxVal)) + ggplot2::geom_abline(intercept = 0, slope = 1, linetype = 2, size=1, show.legend = TRUE) + ggplot2::geom_abline(intercept = res['Intercept'], slope = res['Gradient'], linetype = 1,show.legend = TRUE, color='darkblue') + ggplot2::scale_x_continuous("Average Predicted Probability") + ggplot2::scale_y_continuous("Observed Fraction With Outcome") if (!is.null(fileName)) ggplot2::ggsave(fileName, plot, width = 5, height = 3.5, dpi = 400) return(plot) } #============= # CALIBRATIONSUMMARY PLOTS 2 #============= #' Plot the conventional calibration #' #' @details #' Create a plot showing the calibration #' #' #' @param evaluation A prediction object as generated using the #' \code{\link{runPlp}} function. #' @param type options: 'train' or test' #' @param fileName Name of the file where the plot should be saved, for example #' 'plot.png'. See the function \code{ggsave} in the ggplot2 package for #' supported file formats. #' #' @return #' A ggplot object. Use the \code{\link[ggplot2]{ggsave}} function to save to file in a different #' format. #' #' @export plotSparseCalibration2 <- function(evaluation, type='test', fileName=NULL){ ind <- evaluation$calibrationSummary$Eval==type x<- evaluation$calibrationSummary[ind,c('averagePredictedProbability','observedIncidence', 'PersonCountAtRisk')] cis <- apply(x, 1, function(x) binom.test(x[2]*x[3], x[3], alternative = c("two.sided"), conf.level = 0.95)$conf.int) x$lci <- cis[1,] x$uci <- cis[2,] maxes <- max(max(x$averagePredictedProbability), max(x$observedIncidence))*1.1 # TODO: CHECK INPUT limits <- ggplot2::aes(ymax = x$uci, ymin= x$lci) plot <- ggplot2::ggplot(data=x, ggplot2::aes(x=averagePredictedProbability, y=observedIncidence )) + ggplot2::geom_point(size=2, color='black') + ggplot2::geom_errorbar(limits) + #ggplot2::geom_smooth(method=lm, se=F, colour='darkgrey') + ggplot2::geom_line(colour='darkgrey') + ggplot2::geom_abline(intercept = 0, slope = 1, linetype = 5, size=0.4, show.legend = TRUE) + ggplot2::scale_x_continuous("Average Predicted Probability") + ggplot2::scale_y_continuous("Observed Fraction With Outcome") + ggplot2::coord_cartesian(xlim = c(0, maxes), ylim=c(0,maxes)) if (!is.null(fileName)) ggplot2::ggsave(fileName, plot, width = 5, height = 3.5, dpi = 400) return(plot) } plotPredictionDistribution <- function(evaluation, type='test', fileName=NULL){ ind <- evaluation$predictionDistribution$Eval==type x<- evaluation$predictionDistribution[ind,] #(x=Class, y=predictedProbabllity sequence: min->P05->P25->Median->P75->P95->max) plot <- ggplot2::ggplot(x, ggplot2::aes(x=as.factor(class), ymin=MinPredictedProbability, lower=P25PredictedProbability, middle=MedianPredictedProbability, upper=P75PredictedProbability, ymax=MaxPredictedProbability, color=as.factor(class))) + ggplot2::coord_flip() + ggplot2::geom_boxplot(stat="identity") + ggplot2::scale_x_discrete("Class") + ggplot2::scale_y_continuous("Predicted Probability") + ggplot2::theme(legend.position="none") + ggplot2::geom_segment(ggplot2::aes(x = 0.9, y = x$P05PredictedProbability[x$class==0], xend = 1.1, yend = x$P05PredictedProbability[x$class==0]), color='red') + ggplot2::geom_segment(ggplot2::aes(x = 0.9, y = x$P95PredictedProbability[x$class==0], xend = 1.1, yend = x$P95PredictedProbability[x$class==0]), color='red') + ggplot2::geom_segment(ggplot2::aes(x = 1.9, y = x$P05PredictedProbability[x$class==1], xend = 2.1, yend = x$P05PredictedProbability[x$class==1])) + ggplot2::geom_segment(ggplot2::aes(x = 1.9, y = x$P95PredictedProbability[x$class==1], xend = 2.1, yend = x$P95PredictedProbability[x$class==1])) if (!is.null(fileName)) ggplot2::ggsave(fileName, plot, width = 5, height = 4.5, dpi = 400) return(plot) }
/OhdsiEurope2019/plots.R
no_license
OHDSI/ShinyDeploy
R
false
false
22,096
r
#============ DYNAMIC PLOTS ====================== #++++++++++++++++++++++++++++++++++++++++++++++++++ plotShiny <- function(eval, pointOfInterest){ data <- eval$thresholdSummary[eval$thresholdSummary$Eval%in%c('test','validation'),] # pointOfInterest # this is a threshold pointOfInterest <- data[pointOfInterest,] rocobject <- plotly::plot_ly(x = 1-c(0,data$specificity,1)) %>% plotly::add_lines(y = c(1,data$sensitivity,0),name = "hv", text = paste('Risk Threshold:',c(0,data$predictionThreshold,1)), line = list(shape = "hv", color = 'rgb(22, 96, 167)'), fill = 'tozeroy') %>% plotly::add_trace(x= c(0,1), y = c(0,1),mode = 'lines', line = list(dash = "dash"), color = I('black'), type='scatter') %>% plotly::add_trace(x= 1-pointOfInterest$specificity, y=pointOfInterest$sensitivity, mode = 'markers', symbols='x') %>% # change the colour of this! plotly::add_lines(x=c(1-pointOfInterest$specificity, 1-pointOfInterest$specificity), y = c(0,1), line = list(dash ='solid', color = 'black')) %>% plotly::layout(title = "ROC Plot", xaxis = list(title = "1-specificity"), yaxis = list (title = "Sensitivity"), showlegend = FALSE) popAv <- data$trueCount[1]/(data$trueCount[1] + data$falseCount[1]) probject <- plotly::plot_ly(x = data$sensitivity) %>% plotly::add_lines(y = data$positivePredictiveValue, name = "hv", text = paste('Risk Threshold:',data$predictionThreshold), line = list(shape = "hv", color = 'rgb(22, 96, 167)'), fill = 'tozeroy') %>% plotly::add_trace(x= c(0,1), y = c(popAv,popAv),mode = 'lines', line = list(dash = "dash"), color = I('red'), type='scatter') %>% plotly::add_trace(x= pointOfInterest$sensitivity, y=pointOfInterest$positivePredictiveValue, mode = 'markers', symbols='x') %>% plotly::add_lines(x=c(pointOfInterest$sensitivity, pointOfInterest$sensitivity), y = c(0,1), line = list(dash ='solid', color = 'black')) %>% plotly::layout(title = "PR Plot", xaxis = list(title = "Recall"), yaxis = list (title = "Precision"), showlegend = FALSE) # add F1 score f1object <- plotly::plot_ly(x = data$predictionThreshold) %>% plotly::add_lines(y = data$f1Score, name = "hv", text = paste('Risk Threshold:',data$predictionThreshold), line = list(shape = "hv", color = 'rgb(22, 96, 167)'), fill = 'tozeroy') %>% plotly::add_trace(x= pointOfInterest$predictionThreshold, y=pointOfInterest$f1Score, mode = 'markers', symbols='x') %>% plotly::add_lines(x=c(pointOfInterest$predictionThreshold, pointOfInterest$predictionThreshold), y = c(0,1), line = list(dash ='solid', color = 'black')) %>% plotly::layout(title = "F1-Score Plot", xaxis = list(title = "Prediction Threshold"), yaxis = list (title = "F1-Score"), showlegend = FALSE) # create 2x2 table with TP, FP, TN, FN and threshold threshold <- pointOfInterest$predictionThreshold TP <- pointOfInterest$truePositiveCount TN <- pointOfInterest$trueNegativeCount FP <- pointOfInterest$falsePositiveCount FN <- pointOfInterest$falseNegativeCount preferenceThreshold <- pointOfInterest$preferenceThreshold return(list(roc = rocobject, pr = probject, f1score = f1object, threshold = threshold, prefthreshold=preferenceThreshold, TP = TP, TN=TN, FP= FP, FN=FN)) } plotCovariateSummary <- function(covariateSummary){ #writeLines(paste(colnames(covariateSummary))) #writeLines(paste(covariateSummary[1,])) # remove na values covariateSummary$CovariateMeanWithNoOutcome[is.na(covariateSummary$CovariateMeanWithNoOutcome)] <- 0 covariateSummary$CovariateMeanWithOutcome[is.na(covariateSummary$CovariateMeanWithOutcome)] <- 0 if(!'covariateValue'%in%colnames(covariateSummary)){ covariateSummary$covariateValue <- 1 } if(sum(is.na(covariateSummary$covariateValue))>0){ covariateSummary$covariateValue[is.na(covariateSummary$covariateValue)] <- 0 } # SPEED EDIT remove the none model variables covariateSummary <- covariateSummary[covariateSummary$covariateValue!=0,] # save dots based on coef value covariateSummary$size <- abs(covariateSummary$covariateValue) covariateSummary$size[is.na(covariateSummary$size)] <- 4 covariateSummary$size <- 4+4*covariateSummary$size/max(covariateSummary$size) # color based on analysis id covariateSummary$color <- sapply(covariateSummary$covariateName, function(x) ifelse(is.na(x), '', strsplit(as.character(x), ' ')[[1]][1])) l <- list(x = 0.01, y = 1, font = list( family = "sans-serif", size = 10, color = "#000"), bgcolor = "#E2E2E2", bordercolor = "#FFFFFF", borderwidth = 1) #covariateSummary$annotation <- sapply(covariateSummary$covariateName, getName) covariateSummary$annotation <- covariateSummary$covariateName ind <- covariateSummary$CovariateMeanWithNoOutcome <=1 & covariateSummary$CovariateMeanWithOutcome <= 1 # create two plots -1 or less or g1 binary <- plotly::plot_ly(x = covariateSummary$CovariateMeanWithNoOutcome[ind], #size = covariateSummary$size[ind], showlegend = F) %>% plotly::add_markers(y = covariateSummary$CovariateMeanWithOutcome[ind], color=factor(covariateSummary$color[ind]), text = paste(covariateSummary$annotation[ind]), showlegend = T ) %>% plotly::add_trace(x= c(0,1), y = c(0,1),mode = 'lines', line = list(dash = "dash"), color = I('black'), type='scatter', showlegend = FALSE) %>% plotly::layout(#title = 'Prevalance of baseline predictors in persons with and without outcome', xaxis = list(title = "Prevalance in persons without outcome", range = c(0, 1)), yaxis = list(title = "Prevalance in persons with outcome", range = c(0, 1)), legend = l, showlegend = T) if(sum(!ind)>0){ maxValue <- max(c(covariateSummary$CovariateMeanWithNoOutcome[!ind], covariateSummary$CovariateMeanWithOutcome[!ind]), na.rm = T) meas <- plotly::plot_ly(x = covariateSummary$CovariateMeanWithNoOutcome[!ind] ) %>% plotly::add_markers(y = covariateSummary$CovariateMeanWithOutcome[!ind], text = paste(covariateSummary$annotation[!ind])) %>% plotly::add_trace(x= c(0,maxValue), y = c(0,maxValue),mode = 'lines', line = list(dash = "dash"), color = I('black'), type='scatter', showlegend = FALSE) %>% plotly::layout(#title = 'Prevalance of baseline predictors in persons with and without outcome', xaxis = list(title = "Mean in persons without outcome"), yaxis = list(title = "Mean in persons with outcome"), showlegend = FALSE) } else { meas <- NULL } return(list(binary=binary, meas = meas)) } plotPredictedPDF <- function(evaluation, type='test', fileName=NULL){ ind <- evaluation$thresholdSummary$Eval==type x<- evaluation$thresholdSummary[ind,c('predictionThreshold','truePositiveCount','trueNegativeCount', 'falsePositiveCount','falseNegativeCount')] x<- x[order(x$predictionThreshold,-x$truePositiveCount, -x$falsePositiveCount),] x$out <- c(x$truePositiveCount[-length(x$truePositiveCount)]-x$truePositiveCount[-1], x$truePositiveCount[length(x$truePositiveCount)]) x$nout <- c(x$falsePositiveCount[-length(x$falsePositiveCount)]-x$falsePositiveCount[-1], x$falsePositiveCount[length(x$falsePositiveCount)]) vals <- c() for(i in 1:length(x$predictionThreshold)){ if(i!=length(x$predictionThreshold)){ upper <- x$predictionThreshold[i+1]} else {upper <- min(x$predictionThreshold[i]+0.01,1)} val <- x$predictionThreshold[i]+runif(x$out[i])*(upper-x$predictionThreshold[i]) vals <- c(val, vals) } vals[!is.na(vals)] vals2 <- c() for(i in 1:length(x$predictionThreshold)){ if(i!=length(x$predictionThreshold)){ upper <- x$predictionThreshold[i+1]} else {upper <- min(x$predictionThreshold[i]+0.01,1)} val2 <- x$predictionThreshold[i]+runif(x$nout[i])*(upper-x$predictionThreshold[i]) vals2 <- c(val2, vals2) } vals2[!is.na(vals2)] x <- rbind(data.frame(variable=rep('outcome',length(vals)), value=vals), data.frame(variable=rep('No outcome',length(vals2)), value=vals2) ) plot <- ggplot2::ggplot(x, ggplot2::aes(x=x$value, group=x$variable, fill=x$variable)) + ggplot2::geom_density(ggplot2::aes(x=x$value, fill=x$variable), alpha=.3) + ggplot2::scale_x_continuous("Prediction Threshold")+#, limits=c(0,1)) + ggplot2::scale_y_continuous("Density") + ggplot2::guides(fill=ggplot2::guide_legend(title="Class")) if (!is.null(fileName)) ggplot2::ggsave(fileName, plot, width = 5, height = 4.5, dpi = 400) return(plot) } plotPreferencePDF <- function(evaluation, type='test', fileName=NULL){ ind <- evaluation$thresholdSummary$Eval==type x<- evaluation$thresholdSummary[ind,c('preferenceThreshold','truePositiveCount','trueNegativeCount', 'falsePositiveCount','falseNegativeCount')] x<- x[order(x$preferenceThreshold,-x$truePositiveCount),] x$out <- c(x$truePositiveCount[-length(x$truePositiveCount)]-x$truePositiveCount[-1], x$truePositiveCount[length(x$truePositiveCount)]) x$nout <- c(x$falsePositiveCount[-length(x$falsePositiveCount)]-x$falsePositiveCount[-1], x$falsePositiveCount[length(x$falsePositiveCount)]) vals <- c() for(i in 1:length(x$preferenceThreshold)){ if(i!=length(x$preferenceThreshold)){ upper <- x$preferenceThreshold[i+1]} else {upper <- 1} val <- x$preferenceThreshold[i]+runif(x$out[i])*(upper-x$preferenceThreshold[i]) vals <- c(val, vals) } vals[!is.na(vals)] vals2 <- c() for(i in 1:length(x$preferenceThreshold)){ if(i!=length(x$preferenceThreshold)){ upper <- x$preferenceThreshold[i+1]} else {upper <- 1} val2 <- x$preferenceThreshold[i]+runif(x$nout[i])*(upper-x$preferenceThreshold[i]) vals2 <- c(val2, vals2) } vals2[!is.na(vals2)] x <- rbind(data.frame(variable=rep('outcome',length(vals)), value=vals), data.frame(variable=rep('No outcome',length(vals2)), value=vals2) ) plot <- ggplot2::ggplot(x, ggplot2::aes(x=x$value, group=x$variable, fill=x$variable)) + ggplot2::geom_density(ggplot2::aes(x=x$value, fill=x$variable), alpha=.3) + ggplot2::scale_x_continuous("Preference Threshold")+#, limits=c(0,1)) + ggplot2::scale_y_continuous("Density") + ggplot2::guides(fill=ggplot2::guide_legend(title="Class")) if (!is.null(fileName)) ggplot2::ggsave(fileName, plot, width = 5, height = 4.5, dpi = 400) return(plot) } plotDemographicSummary <- function(evaluation, type='test', fileName=NULL){ if (!all(is.na(evaluation$demographicSummary$averagePredictedProbability))){ ind <- evaluation$demographicSummary$Eval==type x<- evaluation$demographicSummary[ind,colnames(evaluation$demographicSummary)%in%c('ageGroup','genGroup','averagePredictedProbability', 'PersonCountAtRisk', 'PersonCountWithOutcome')] # remove -1 values: x <- x[x$PersonCountWithOutcome != -1,] if(nrow(x)==0){ return(NULL) } # end remove -1 values x$observed <- x$PersonCountWithOutcome/x$PersonCountAtRisk x <- x[,colnames(x)%in%c('ageGroup','genGroup','averagePredictedProbability','observed')] # if age or gender missing add if(sum(colnames(x)=='ageGroup')==1 && sum(colnames(x)=='genGroup')==0 ){ x$genGroup = rep('Non', nrow(x)) evaluation$demographicSummary$genGroup = rep('Non', nrow(evaluation$demographicSummary)) } if(sum(colnames(x)=='ageGroup')==0 && sum(colnames(x)=='genGroup')==1 ){ x$ageGroup = rep('-1', nrow(x)) evaluation$demographicSummary$ageGroup = rep('-1', nrow(evaluation$demographicSummary)) } x <- reshape2::melt(x, id.vars=c('ageGroup','genGroup')) # 1.96*StDevPredictedProbability ci <- evaluation$demographicSummary[,colnames(evaluation$demographicSummary)%in%c('ageGroup','genGroup','averagePredictedProbability','StDevPredictedProbability')] ci$StDevPredictedProbability[is.na(ci$StDevPredictedProbability)] <- 1 ci$lower <- ci$averagePredictedProbability-1.96*ci$StDevPredictedProbability ci$lower[ci$lower <0] <- 0 ci$upper <- ci$averagePredictedProbability+1.96*ci$StDevPredictedProbability ci$upper[ci$upper >1] <- max(ci$upper[ci$upper <1]) x$age <- gsub('Age group:','', x$ageGroup) x$age <- factor(x$age,levels=c(" 0-4"," 5-9"," 10-14", " 15-19"," 20-24"," 25-29"," 30-34"," 35-39"," 40-44", " 45-49"," 50-54"," 55-59"," 60-64"," 65-69"," 70-74", " 75-79"," 80-84"," 85-89"," 90-94"," 95-99","-1"),ordered=TRUE) x <- merge(x, ci[,c('ageGroup','genGroup','lower','upper')], by=c('ageGroup','genGroup')) plot <- ggplot2::ggplot(data=x, ggplot2::aes(x=age, group=variable*genGroup)) + ggplot2::geom_line(ggplot2::aes(y=value, group=variable, color=variable, linetype = variable))+ ggplot2::geom_ribbon(data=x[x$variable!='observed',], ggplot2::aes(ymin=lower, ymax=upper , group=genGroup), fill="blue", alpha="0.2") + ggplot2::facet_grid(.~ genGroup, scales = "free") + ggplot2::theme(axis.text.x = ggplot2::element_text(angle = 90, hjust = 1)) + #ggplot2::coord_flip() + ggplot2::scale_y_continuous("Fraction") + ggplot2::scale_x_discrete("Age") + ggplot2::scale_color_manual(values = c("royalblue4","red"), guide = ggplot2::guide_legend(title = NULL), labels = c("Expected", "Observed")) + ggplot2::guides(linetype=FALSE) if (!is.null(fileName)) ggplot2::ggsave(fileName, plot, width = 7, height = 4.5, dpi = 400) return(plot) } } #============= # CALIBRATIONSUMMARY PLOTS #============= #' Plot the calibration #' #' @details #' Create a plot showing the calibration #' #' #' @param evaluation A prediction object as generated using the #' \code{\link{runPlp}} function. #' @param type options: 'train' or test' #' @param fileName Name of the file where the plot should be saved, for example #' 'plot.png'. See the function \code{ggsave} in the ggplot2 package for #' supported file formats. #' #' @return #' A ggplot object. Use the \code{\link[ggplot2]{ggsave}} function to save to file in a different #' format. #' #' @export plotSparseCalibration <- function(evaluation, type='test', fileName=NULL){ ind <- evaluation$calibrationSummary$Eval==type x<- evaluation$calibrationSummary[ind,c('averagePredictedProbability','observedIncidence')] maxVal <- max(x$averagePredictedProbability,x$observedIncidence) model <- stats::lm(observedIncidence~averagePredictedProbability, data=x) res <- model$coefficients names(res) <- c('Intercept','Gradient') # confidence int interceptConf <- stats::confint(model)[1,] gradientConf <- stats::confint(model)[2,] cis <- data.frame(lci = interceptConf[1]+seq(0,1,length.out = nrow(x))*gradientConf[1], uci = interceptConf[2]+seq(0,1,length.out = nrow(x))*gradientConf[2], x=seq(0,1,length.out = nrow(x))) x <- cbind(x, cis) # TODO: CHECK INPUT plot <- ggplot2::ggplot(data=x, ggplot2::aes(x=averagePredictedProbability, y=observedIncidence )) + ggplot2::geom_ribbon(ggplot2::aes(ymin=lci,ymax=uci, x=x), fill="blue", alpha="0.2") + ggplot2::geom_point(size=1, color='darkblue') + ggplot2::coord_cartesian(ylim = c(0, maxVal), xlim =c(0,maxVal)) + ggplot2::geom_abline(intercept = 0, slope = 1, linetype = 2, size=1, show.legend = TRUE) + ggplot2::geom_abline(intercept = res['Intercept'], slope = res['Gradient'], linetype = 1,show.legend = TRUE, color='darkblue') + ggplot2::scale_x_continuous("Average Predicted Probability") + ggplot2::scale_y_continuous("Observed Fraction With Outcome") if (!is.null(fileName)) ggplot2::ggsave(fileName, plot, width = 5, height = 3.5, dpi = 400) return(plot) } #============= # CALIBRATIONSUMMARY PLOTS 2 #============= #' Plot the conventional calibration #' #' @details #' Create a plot showing the calibration #' #' #' @param evaluation A prediction object as generated using the #' \code{\link{runPlp}} function. #' @param type options: 'train' or test' #' @param fileName Name of the file where the plot should be saved, for example #' 'plot.png'. See the function \code{ggsave} in the ggplot2 package for #' supported file formats. #' #' @return #' A ggplot object. Use the \code{\link[ggplot2]{ggsave}} function to save to file in a different #' format. #' #' @export plotSparseCalibration2 <- function(evaluation, type='test', fileName=NULL){ ind <- evaluation$calibrationSummary$Eval==type x<- evaluation$calibrationSummary[ind,c('averagePredictedProbability','observedIncidence', 'PersonCountAtRisk')] cis <- apply(x, 1, function(x) binom.test(x[2]*x[3], x[3], alternative = c("two.sided"), conf.level = 0.95)$conf.int) x$lci <- cis[1,] x$uci <- cis[2,] maxes <- max(max(x$averagePredictedProbability), max(x$observedIncidence))*1.1 # TODO: CHECK INPUT limits <- ggplot2::aes(ymax = x$uci, ymin= x$lci) plot <- ggplot2::ggplot(data=x, ggplot2::aes(x=averagePredictedProbability, y=observedIncidence )) + ggplot2::geom_point(size=2, color='black') + ggplot2::geom_errorbar(limits) + #ggplot2::geom_smooth(method=lm, se=F, colour='darkgrey') + ggplot2::geom_line(colour='darkgrey') + ggplot2::geom_abline(intercept = 0, slope = 1, linetype = 5, size=0.4, show.legend = TRUE) + ggplot2::scale_x_continuous("Average Predicted Probability") + ggplot2::scale_y_continuous("Observed Fraction With Outcome") + ggplot2::coord_cartesian(xlim = c(0, maxes), ylim=c(0,maxes)) if (!is.null(fileName)) ggplot2::ggsave(fileName, plot, width = 5, height = 3.5, dpi = 400) return(plot) } plotPredictionDistribution <- function(evaluation, type='test', fileName=NULL){ ind <- evaluation$predictionDistribution$Eval==type x<- evaluation$predictionDistribution[ind,] #(x=Class, y=predictedProbabllity sequence: min->P05->P25->Median->P75->P95->max) plot <- ggplot2::ggplot(x, ggplot2::aes(x=as.factor(class), ymin=MinPredictedProbability, lower=P25PredictedProbability, middle=MedianPredictedProbability, upper=P75PredictedProbability, ymax=MaxPredictedProbability, color=as.factor(class))) + ggplot2::coord_flip() + ggplot2::geom_boxplot(stat="identity") + ggplot2::scale_x_discrete("Class") + ggplot2::scale_y_continuous("Predicted Probability") + ggplot2::theme(legend.position="none") + ggplot2::geom_segment(ggplot2::aes(x = 0.9, y = x$P05PredictedProbability[x$class==0], xend = 1.1, yend = x$P05PredictedProbability[x$class==0]), color='red') + ggplot2::geom_segment(ggplot2::aes(x = 0.9, y = x$P95PredictedProbability[x$class==0], xend = 1.1, yend = x$P95PredictedProbability[x$class==0]), color='red') + ggplot2::geom_segment(ggplot2::aes(x = 1.9, y = x$P05PredictedProbability[x$class==1], xend = 2.1, yend = x$P05PredictedProbability[x$class==1])) + ggplot2::geom_segment(ggplot2::aes(x = 1.9, y = x$P95PredictedProbability[x$class==1], xend = 2.1, yend = x$P95PredictedProbability[x$class==1])) if (!is.null(fileName)) ggplot2::ggsave(fileName, plot, width = 5, height = 4.5, dpi = 400) return(plot) }
MBF=function(data,group){ n=tapply(data, group, length) k=length(tapply(data, group, length)) xbar=tapply(data, group, mean) var=tapply(data, group, var) N=sum(n); B=sum(n*(xbar-mean(data))^2)/sum((1-(n/sum(n)))*var); df11=(sum((1-(n-sum(n)))*var)^2); df12=sum(((1-(n-sum(n)))^2*(var)^2)/(n-1)); df2=(df11/df12); df1=((sum((1-n/N)*var))^2)/((sum(var^2))+(sum(n*var/N))^2-(2*sum(n*var^2/N))); pvalue=1-pf(B,df1,df2); result=matrix(c(round(B,digits=4),round(df1),round(df2),round(pvalue,digits=4))) rownames(result)=c("Test Statistic","df1","df2","p-value") colnames(result)=c("Modified Welch") return(t(result)) }
/R/modifiedBrownForsythe.R
no_license
cran/doex
R
false
false
646
r
MBF=function(data,group){ n=tapply(data, group, length) k=length(tapply(data, group, length)) xbar=tapply(data, group, mean) var=tapply(data, group, var) N=sum(n); B=sum(n*(xbar-mean(data))^2)/sum((1-(n/sum(n)))*var); df11=(sum((1-(n-sum(n)))*var)^2); df12=sum(((1-(n-sum(n)))^2*(var)^2)/(n-1)); df2=(df11/df12); df1=((sum((1-n/N)*var))^2)/((sum(var^2))+(sum(n*var/N))^2-(2*sum(n*var^2/N))); pvalue=1-pf(B,df1,df2); result=matrix(c(round(B,digits=4),round(df1),round(df2),round(pvalue,digits=4))) rownames(result)=c("Test Statistic","df1","df2","p-value") colnames(result)=c("Modified Welch") return(t(result)) }
###################################################################################### ######## SENTIMENTAL ANALYSIS FOR NAMED ENTITIES COLLECTED FROM API-1 & API-2 ######## #Reference Source website : https://github.com/rOpenGov/rtimes ###################################################################################### #Importing the common positive and negative words lists into data sets pos.words = scan('C:/DESKTOP/Home/twitter-sentiment-analysis-tutorial-201107-master/twitter-sentiment-analysis-tutorial-201107-master/data/opinion-lexicon-English/positive-words.txt', what='character', comment.char=';') neg.words = scan('C:/DESKTOP/Home/twitter-sentiment-analysis-tutorial-201107-master/twitter-sentiment-analysis-tutorial-201107-master/data/opinion-lexicon-English/negative-words.txt', what='character', comment.char=';') #Adding more common words to positive and negative databases pos.words=c(pos.words, 'Congrats', 'prizes', 'prize', 'thanks', 'thnx', 'Grt', 'gr8', 'plz', 'trending', 'recovering', 'brainstorm', 'leader') neg.words = c(neg.words, 'Fight', 'fighting', 'wtf', 'arrest', 'no', 'not') #list of named entities available from API 1 #View(person_entity_API_1) #View(location_entity_API_1) #View(organization_entity_API_1) #View(date_entity_API_1) #View(money_entity_API_1) #list of named entities available from API 2 #View(person_entity_API_2_final) #View(location_entity_API_2_final) #View(organization_entity_API_2_final) #View(money_entity_API_2_final) #View(date_entity_API_2_final) # Initialising the variables sentences <- NULL sentence <- NULL #Function to provide score of a sentense as per the frequency of negative and positive words score.sentiment = function(sentences, pos.words, neg.words, .progress='none') { require(plyr) require(stringr) list=lapply(sentences, function(sentence, pos.words, neg.words) { sentence = gsub('[[:punct:]]',' ',sentence) sentence = gsub('[[:cntrl:]]','',sentence) sentence = gsub('\\d+','',sentence) sentence = gsub('\n','',sentence) sentence = tolower(sentence) word.list = str_split(sentence, '\\s+') words = unlist(word.list) pos.matches = match(words, pos.words) neg.matches = match(words, neg.words) pos.matches = !is.na(pos.matches) neg.matches = !is.na(neg.matches) pp=sum(pos.matches) nn = sum(neg.matches) score = sum(pos.matches) - sum(neg.matches) list1=c(score, pp, nn) return (list1) }, pos.words, neg.words) score_new=lapply(list, `[[`, 1) pp1=score=lapply(list, `[[`, 2) nn1=score=lapply(list, `[[`, 3) scores.df = data.frame(score=score_new, text=sentences) positive.df = data.frame(Positive=pp1, text=sentences) negative.df = data.frame(Negative=nn1, text=sentences) list_df=list(scores.df, positive.df, negative.df) return(list_df) } ########################################################################################################## ########################### SENTIMENTAL ANALYSIS FOR NAMED ENTITY FROM API - 1 ########################### ########################################################################################################## #Assigning the sentiment obtained for each named entity from API-1 person_entity_API_1_result = score.sentiment(person_entity_API_1, pos.words, neg.words) location_entity_API_1_result = score.sentiment(location_entity_API_1, pos.words, neg.words) organization_entity_API_1_result = score.sentiment(organization_entity_API_1, pos.words, neg.words) date_entity_API_1_result = score.sentiment(date_entity_API_1, pos.words, neg.words) money_entity_API_1_result = score.sentiment(money_entity_API_1, pos.words, neg.words) #View(person_entity_API_1_result) #View(location_entity_API_1_result) #View(organization_entity_API_1_result) #View(date_entity_API_1_result) #View(money_entity_API_1_result) #list of named entities available from API 1 #View(person_entity_API_1) #View(location_entity_API_1) #View(organization_entity_API_1) #View(date_entity_API_1) #View(money_entity_API_1) ########################################### ###### SENTIMENTAL ANALYSIS FOR PERSON ###### ########################################### #Creating a copy of result data frame person_entity_API_1_result_Column_1=person_entity_API_1_result[[1]] person_entity_API_1_result_Column_2=person_entity_API_1_result[[2]] person_entity_API_1_result_Column_3=person_entity_API_1_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q person_entity_API_1_result_Score=person_entity_API_1_result_Column_1[1,] person_entity_API_1_result_Positive=person_entity_API_1_result_Column_2[1,] person_entity_API_1_result_Negative=person_entity_API_1_result_Column_3[1,] person_entity_API_1_result_Score_1=melt(person_entity_API_1_result_Score, ,var='Score') person_entity_API_1_result_Positive_2=melt(person_entity_API_1_result_Positive, ,var='Positive') person_entity_API_1_result_Negative_3=melt(person_entity_API_1_result_Negative, ,var='Negative') person_entity_API_1_result_Score_1['Score'] = NULL person_entity_API_1_result_Positive_2['Positive'] = NULL person_entity_API_1_result_Negative_3['Negative'] = NULL #Creating data frame person_entity_API_1_result_table1 = data.frame(Text=person_entity_API_1_result[1], Score=person_entity_API_1_result_Score_1) person_entity_API_1_result_table2 = data.frame(Text=person_entity_API_1_result[2], Score=person_entity_API_1_result_Positive_2) person_entity_API_1_result_table3 = data.frame(Text=person_entity_API_1_result[3], Score=person_entity_API_1_result_Negative_3) #Merging three data frames into one person_entity_API_1_result_table_final=data.frame(Text=person_entity_API_1_result_table1, Score=person_entity_API_1_result_table1, Positive=person_entity_API_1_result_table2, Negative=person_entity_API_1_result_table3) #person_entity_API_1_result_table_final person_entity_API_1_result_table_final=data.frame(Text=person_entity_API_1_result_table1$Text.person.1, Score=person_entity_API_1_result_table1$Score.value, Positive=person_entity_API_1_result_table2$Score.value, Negative=person_entity_API_1_result_table3$Score.value) #View(person_entity_API_1_result_table_final) ########################################### ###### SENTIMENTAL ANALYSIS FOR LOCATION ###### ########################################### #Creating a copy of result data frame location_entity_API_1_result_Column_1=location_entity_API_1_result[[1]] location_entity_API_1_result_Column_2=location_entity_API_1_result[[2]] location_entity_API_1_result_Column_3=location_entity_API_1_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q location_entity_API_1_result_Score=location_entity_API_1_result_Column_1[1,] location_entity_API_1_result_Positive=location_entity_API_1_result_Column_2[1,] location_entity_API_1_result_Negative=location_entity_API_1_result_Column_3[1,] location_entity_API_1_result_Score_1=melt(location_entity_API_1_result_Score, ,var='Score') location_entity_API_1_result_Positive_2=melt(location_entity_API_1_result_Positive, ,var='Positive') location_entity_API_1_result_Negative_3=melt(location_entity_API_1_result_Negative, ,var='Negative') location_entity_API_1_result_Score_1['Score'] = NULL location_entity_API_1_result_Positive_2['Positive'] = NULL location_entity_API_1_result_Negative_3['Negative'] = NULL #Creating data frame location_entity_API_1_result_table1 = data.frame(Text=location_entity_API_1_result[1], Score=location_entity_API_1_result_Score_1) location_entity_API_1_result_table2 = data.frame(Text=location_entity_API_1_result[2], Score=location_entity_API_1_result_Positive_2) location_entity_API_1_result_table3 = data.frame(Text=location_entity_API_1_result[3], Score=location_entity_API_1_result_Negative_3) #Merging three data frames into one location_entity_API_1_result_table_final=data.frame(Text=location_entity_API_1_result_table1, Score=location_entity_API_1_result_table1, Positive=location_entity_API_1_result_table2, Negative=location_entity_API_1_result_table3) #location_entity_API_1_result_table_final location_entity_API_1_result_table_final=data.frame(Text=location_entity_API_1_result_table1$Text.location.1, Score=location_entity_API_1_result_table1$Score.value, Positive=location_entity_API_1_result_table2$Score.value, Negative=location_entity_API_1_result_table3$Score.value) #View(location_entity_API_1_result_table_final) ################################################# ###### SENTIMENTAL ANALYSIS FOR ORGANIZATION ###### ################################################# #Creating a copy of result data frame organization_entity_API_1_result_Column_1=organization_entity_API_1_result[[1]] organization_entity_API_1_result_Column_2=organization_entity_API_1_result[[2]] organization_entity_API_1_result_Column_3=organization_entity_API_1_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q organization_entity_API_1_result_Score=organization_entity_API_1_result_Column_1[1,] organization_entity_API_1_result_Positive=organization_entity_API_1_result_Column_2[1,] organization_entity_API_1_result_Negative=organization_entity_API_1_result_Column_3[1,] organization_entity_API_1_result_Score_1=melt(organization_entity_API_1_result_Score, ,var='Score') organization_entity_API_1_result_Positive_2=melt(organization_entity_API_1_result_Positive, ,var='Positive') organization_entity_API_1_result_Negative_3=melt(organization_entity_API_1_result_Negative, ,var='Negative') organization_entity_API_1_result_Score_1['Score'] = NULL organization_entity_API_1_result_Positive_2['Positive'] = NULL organization_entity_API_1_result_Negative_3['Negative'] = NULL #Creating data frame organization_entity_API_1_result_table1 = data.frame(Text=organization_entity_API_1_result[1], Score=organization_entity_API_1_result_Score_1) organization_entity_API_1_result_table2 = data.frame(Text=organization_entity_API_1_result[2], Score=organization_entity_API_1_result_Positive_2) organization_entity_API_1_result_table3 = data.frame(Text=organization_entity_API_1_result[3], Score=organization_entity_API_1_result_Negative_3) #Merging three data frames into one organization_entity_API_1_result_table_final=data.frame(Text=organization_entity_API_1_result_table1, Score=organization_entity_API_1_result_table1, Positive=organization_entity_API_1_result_table2, Negative=organization_entity_API_1_result_table3) #organization_entity_API_1_result_table_final organization_entity_API_1_result_table_final=data.frame(Text=organization_entity_API_1_result_table1$Text.organization.1, Score=organization_entity_API_1_result_table1$Score.value, Positive=organization_entity_API_1_result_table2$Score.value, Negative=organization_entity_API_1_result_table3$Score.value) #View(organization_entity_API_1_result_table_final) ########################################### ###### SENTIMENTAL ANALYSIS FOR MONEY ###### ########################################### #Creating a copy of result data frame money_entity_API_1_result_Column_1=money_entity_API_1_result[[1]] money_entity_API_1_result_Column_2=money_entity_API_1_result[[2]] money_entity_API_1_result_Column_3=money_entity_API_1_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q money_entity_API_1_result_Score=money_entity_API_1_result_Column_1[1,] money_entity_API_1_result_Positive=money_entity_API_1_result_Column_2[1,] money_entity_API_1_result_Negative=money_entity_API_1_result_Column_3[1,] money_entity_API_1_result_Score_1=melt(money_entity_API_1_result_Score, ,var='Score') money_entity_API_1_result_Positive_2=melt(money_entity_API_1_result_Positive, ,var='Positive') money_entity_API_1_result_Negative_3=melt(money_entity_API_1_result_Negative, ,var='Negative') money_entity_API_1_result_Score_1['Score'] = NULL money_entity_API_1_result_Positive_2['Positive'] = NULL money_entity_API_1_result_Negative_3['Negative'] = NULL #Creating data frame money_entity_API_1_result_table1 = data.frame(Text=money_entity_API_1_result[1], Score=money_entity_API_1_result_Score_1) money_entity_API_1_result_table2 = data.frame(Text=money_entity_API_1_result[2], Score=money_entity_API_1_result_Positive_2) money_entity_API_1_result_table3 = data.frame(Text=money_entity_API_1_result[3], Score=money_entity_API_1_result_Negative_3) #Merging three data frames into one money_entity_API_1_result_table_final=data.frame(Text=money_entity_API_1_result_table1, Score=money_entity_API_1_result_table1, Positive=money_entity_API_1_result_table2, Negative=money_entity_API_1_result_table3) #money_entity_API_1_result_table_final money_entity_API_1_result_table_final=data.frame(Text=money_entity_API_1_result_table1$Text.money.1, Score=money_entity_API_1_result_table1$Score.value, Positive=money_entity_API_1_result_table2$Score.value, Negative=money_entity_API_1_result_table3$Score.value) #View(money_entity_API_1_result_table_final) ########################################### ###### SENTIMENTAL ANALYSIS FOR DATE ###### ########################################### #Creating a copy of result data frame date_entity_API_1_result_Column_1=date_entity_API_1_result[[1]] date_entity_API_1_result_Column_2=date_entity_API_1_result[[2]] date_entity_API_1_result_Column_3=date_entity_API_1_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q date_entity_API_1_result_Score=date_entity_API_1_result_Column_1[1,] date_entity_API_1_result_Positive=date_entity_API_1_result_Column_2[1,] date_entity_API_1_result_Negative=date_entity_API_1_result_Column_3[1,] date_entity_API_1_result_Score_1=melt(date_entity_API_1_result_Score, ,var='Score') date_entity_API_1_result_Positive_2=melt(date_entity_API_1_result_Positive, ,var='Positive') date_entity_API_1_result_Negative_3=melt(date_entity_API_1_result_Negative, ,var='Negative') date_entity_API_1_result_Score_1['Score'] = NULL date_entity_API_1_result_Positive_2['Positive'] = NULL date_entity_API_1_result_Negative_3['Negative'] = NULL #Creating data frame date_entity_API_1_result_table1 = data.frame(Text=date_entity_API_1_result[1], Score=date_entity_API_1_result_Score_1) date_entity_API_1_result_table2 = data.frame(Text=date_entity_API_1_result[2], Score=date_entity_API_1_result_Positive_2) date_entity_API_1_result_table3 = data.frame(Text=date_entity_API_1_result[3], Score=date_entity_API_1_result_Negative_3) #Merging three data frames into one date_entity_API_1_result_table_final=data.frame(Text=date_entity_API_1_result_table1, Score=date_entity_API_1_result_table1, Positive=date_entity_API_1_result_table2, Negative=date_entity_API_1_result_table3) #date_entity_API_1_result_table_final date_entity_API_1_result_table_final=data.frame(Text=date_entity_API_1_result_table1$Text.date.1, Score=date_entity_API_1_result_table1$Score.value, Positive=date_entity_API_1_result_table2$Score.value, Negative=date_entity_API_1_result_table3$Score.value) #View(date_entity_API_1_result_table_final) ########################################################################################################## ########################### SENTIMENTAL ANALYSIS FOR NAMED ENTITY FROM API - 2 ########################### ########################################################################################################## #Assigning the sentiment obtained for each named entity from API-2 person_entity_API_2_result = score.sentiment(person_entity_API_2, pos.words, neg.words) location_entity_API_2_result = score.sentiment(location_entity_API_2, pos.words, neg.words) organization_entity_API_2_result = score.sentiment(organization_entity_API_2, pos.words, neg.words) date_entity_API_2_result = score.sentiment(date_entity_API_2, pos.words, neg.words) money_entity_API_2_result = score.sentiment(money_entity_API_2, pos.words, neg.words) #View(person_entity_API_2_result) #View(location_entity_API_2_result) #View(organization_entity_API_2_result) #View(date_entity_API_2_result) #View(money_entity_API_2_result) #list of named entities available from API 1 #View(person_entity_API_2) #View(location_entity_API_2) #View(organization_entity_API_2) #View(date_entity_API_2) #View(money_entity_API_2) ########################################### ###### SENTIMENTAL ANALYSIS FOR PERSON ###### ########################################### #Creating a copy of result data frame person_entity_API_2_result_Column_1=person_entity_API_2_result[[1]] person_entity_API_2_result_Column_2=person_entity_API_2_result[[2]] person_entity_API_2_result_Column_3=person_entity_API_2_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q person_entity_API_2_result_Score=person_entity_API_2_result_Column_1[1,] person_entity_API_2_result_Positive=person_entity_API_2_result_Column_2[1,] person_entity_API_2_result_Negative=person_entity_API_2_result_Column_3[1,] person_entity_API_2_result_Score_1=melt(person_entity_API_2_result_Score, ,var='Score') person_entity_API_2_result_Positive_2=melt(person_entity_API_2_result_Positive, ,var='Positive') person_entity_API_2_result_Negative_3=melt(person_entity_API_2_result_Negative, ,var='Negative') person_entity_API_2_result_Score_1['Score'] = NULL person_entity_API_2_result_Positive_2['Positive'] = NULL person_entity_API_2_result_Negative_3['Negative'] = NULL #Creating data frame person_entity_API_2_result_table1 = data.frame(Text=person_entity_API_2_result[1], Score=person_entity_API_2_result_Score_1) person_entity_API_2_result_table2 = data.frame(Text=person_entity_API_2_result[2], Score=person_entity_API_2_result_Positive_2) person_entity_API_2_result_table3 = data.frame(Text=person_entity_API_2_result[3], Score=person_entity_API_2_result_Negative_3) #Merging three data frames into one person_entity_API_2_result_table_final=data.frame(Text=person_entity_API_2_result_table1, Score=person_entity_API_2_result_table1, Positive=person_entity_API_2_result_table2, Negative=person_entity_API_2_result_table3) #person_entity_API_2_result_table_final person_entity_API_2_result_table_final=data.frame(Text=person_entity_API_2_result_table1$Text.person.1, Score=person_entity_API_2_result_table1$Score.value, Positive=person_entity_API_2_result_table2$Score.value, Negative=person_entity_API_2_result_table3$Score.value) #View(person_entity_API_2_result_table_final) ########################################### ###### SENTIMENTAL ANALYSIS FOR LOCATION ###### ########################################### #Creating a copy of result data frame location_entity_API_2_result_Column_1=location_entity_API_2_result[[1]] location_entity_API_2_result_Column_2=location_entity_API_2_result[[2]] location_entity_API_2_result_Column_3=location_entity_API_2_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q location_entity_API_2_result_Score=location_entity_API_2_result_Column_1[1,] location_entity_API_2_result_Positive=location_entity_API_2_result_Column_2[1,] location_entity_API_2_result_Negative=location_entity_API_2_result_Column_3[1,] location_entity_API_2_result_Score_1=melt(location_entity_API_2_result_Score, ,var='Score') location_entity_API_2_result_Positive_2=melt(location_entity_API_2_result_Positive, ,var='Positive') location_entity_API_2_result_Negative_3=melt(location_entity_API_2_result_Negative, ,var='Negative') location_entity_API_2_result_Score_1['Score'] = NULL location_entity_API_2_result_Positive_2['Positive'] = NULL location_entity_API_2_result_Negative_3['Negative'] = NULL #Creating data frame location_entity_API_2_result_table1 = data.frame(Text=location_entity_API_2_result[1], Score=location_entity_API_2_result_Score_1) location_entity_API_2_result_table2 = data.frame(Text=location_entity_API_2_result[2], Score=location_entity_API_2_result_Positive_2) location_entity_API_2_result_table3 = data.frame(Text=location_entity_API_2_result[3], Score=location_entity_API_2_result_Negative_3) #Merging three data frames into one location_entity_API_2_result_table_final=data.frame(Text=location_entity_API_2_result_table1, Score=location_entity_API_2_result_table1, Positive=location_entity_API_2_result_table2, Negative=location_entity_API_2_result_table3) #location_entity_API_2_result_table_final location_entity_API_2_result_table_final=data.frame(Text=location_entity_API_2_result_table1$Text.location.1, Score=location_entity_API_2_result_table1$Score.value, Positive=location_entity_API_2_result_table2$Score.value, Negative=location_entity_API_2_result_table3$Score.value) #View(location_entity_API_2_result_table_final) ################################################# ###### SENTIMENTAL ANALYSIS FOR ORGANIZATION ###### ################################################# #Creating a copy of result data frame organization_entity_API_2_result_Column_1=organization_entity_API_2_result[[1]] organization_entity_API_2_result_Column_2=organization_entity_API_2_result[[2]] organization_entity_API_2_result_Column_3=organization_entity_API_2_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q organization_entity_API_2_result_Score=organization_entity_API_2_result_Column_1[1,] organization_entity_API_2_result_Positive=organization_entity_API_2_result_Column_2[1,] organization_entity_API_2_result_Negative=organization_entity_API_2_result_Column_3[1,] organization_entity_API_2_result_Score_1=melt(organization_entity_API_2_result_Score, ,var='Score') organization_entity_API_2_result_Positive_2=melt(organization_entity_API_2_result_Positive, ,var='Positive') organization_entity_API_2_result_Negative_3=melt(organization_entity_API_2_result_Negative, ,var='Negative') organization_entity_API_2_result_Score_1['Score'] = NULL organization_entity_API_2_result_Positive_2['Positive'] = NULL organization_entity_API_2_result_Negative_3['Negative'] = NULL #Creating data frame organization_entity_API_2_result_table1 = data.frame(Text=organization_entity_API_2_result[1], Score=organization_entity_API_2_result_Score_1) organization_entity_API_2_result_table2 = data.frame(Text=organization_entity_API_2_result[2], Score=organization_entity_API_2_result_Positive_2) organization_entity_API_2_result_table3 = data.frame(Text=organization_entity_API_2_result[3], Score=organization_entity_API_2_result_Negative_3) #Merging three data frames into one organization_entity_API_2_result_table_final=data.frame(Text=organization_entity_API_2_result_table1, Score=organization_entity_API_2_result_table1, Positive=organization_entity_API_2_result_table2, Negative=organization_entity_API_2_result_table3) #organization_entity_API_2_result_table_final organization_entity_API_2_result_table_final=data.frame(Text=organization_entity_API_2_result_table1$Text.organization.1, Score=organization_entity_API_2_result_table1$Score.value, Positive=organization_entity_API_2_result_table2$Score.value, Negative=organization_entity_API_2_result_table3$Score.value) #View(organization_entity_API_2_result_table_final) ########################################### ###### SENTIMENTAL ANALYSIS FOR MONEY ###### ########################################### #Creating a copy of result data frame money_entity_API_2_result_Column_1=money_entity_API_2_result[[1]] money_entity_API_2_result_Column_2=money_entity_API_2_result[[2]] money_entity_API_2_result_Column_3=money_entity_API_2_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q money_entity_API_2_result_Score=money_entity_API_2_result_Column_1[1,] money_entity_API_2_result_Positive=money_entity_API_2_result_Column_2[1,] money_entity_API_2_result_Negative=money_entity_API_2_result_Column_3[1,] money_entity_API_2_result_Score_1=melt(money_entity_API_2_result_Score, ,var='Score') money_entity_API_2_result_Positive_2=melt(money_entity_API_2_result_Positive, ,var='Positive') money_entity_API_2_result_Negative_3=melt(money_entity_API_2_result_Negative, ,var='Negative') money_entity_API_2_result_Score_1['Score'] = NULL money_entity_API_2_result_Positive_2['Positive'] = NULL money_entity_API_2_result_Negative_3['Negative'] = NULL #Creating data frame money_entity_API_2_result_table1 = data.frame(Text=money_entity_API_2_result[1], Score=money_entity_API_2_result_Score_1) money_entity_API_2_result_table2 = data.frame(Text=money_entity_API_2_result[2], Score=money_entity_API_2_result_Positive_2) money_entity_API_2_result_table3 = data.frame(Text=money_entity_API_2_result[3], Score=money_entity_API_2_result_Negative_3) #Merging three data frames into one money_entity_API_2_result_table_final=data.frame(Text=money_entity_API_2_result_table1, Score=money_entity_API_2_result_table1, Positive=money_entity_API_2_result_table2, Negative=money_entity_API_2_result_table3) #money_entity_API_2_result_table_final money_entity_API_2_result_table_final=data.frame(Text=money_entity_API_2_result_table1$Text.money.1, Score=money_entity_API_2_result_table1$Score.value, Positive=money_entity_API_2_result_table2$Score.value, Negative=money_entity_API_2_result_table3$Score.value) #View(money_entity_API_2_result_table_final) ########################################### ###### SENTIMENTAL ANALYSIS FOR DATE ###### ########################################### #Creating a copy of result data frame date_entity_API_2_result_Column_1=date_entity_API_2_result[[1]] date_entity_API_2_result_Column_2=date_entity_API_2_result[[2]] date_entity_API_2_result_Column_3=date_entity_API_2_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q date_entity_API_2_result_Score=date_entity_API_2_result_Column_1[1,] date_entity_API_2_result_Positive=date_entity_API_2_result_Column_2[1,] date_entity_API_2_result_Negative=date_entity_API_2_result_Column_3[1,] date_entity_API_2_result_Score_1=melt(date_entity_API_2_result_Score, ,var='Score') date_entity_API_2_result_Positive_2=melt(date_entity_API_2_result_Positive, ,var='Positive') date_entity_API_2_result_Negative_3=melt(date_entity_API_2_result_Negative, ,var='Negative') date_entity_API_2_result_Score_1['Score'] = NULL date_entity_API_2_result_Positive_2['Positive'] = NULL date_entity_API_2_result_Negative_3['Negative'] = NULL #Creating data frame date_entity_API_2_result_table1 = data.frame(Text=date_entity_API_2_result[1], Score=date_entity_API_2_result_Score_1) date_entity_API_2_result_table2 = data.frame(Text=date_entity_API_2_result[2], Score=date_entity_API_2_result_Positive_2) date_entity_API_2_result_table3 = data.frame(Text=date_entity_API_2_result[3], Score=date_entity_API_2_result_Negative_3) #Merging three data frames into one date_entity_API_2_result_table_final=data.frame(Text=date_entity_API_2_result_table1, Score=date_entity_API_2_result_table1, Positive=date_entity_API_2_result_table2, Negative=date_entity_API_2_result_table3) #date_entity_API_2_result_table_final date_entity_API_2_result_table_final=data.frame(Text=date_entity_API_2_result_table1$Text.date.1, Score=date_entity_API_2_result_table1$Score.value, Positive=date_entity_API_2_result_table2$Score.value, Negative=date_entity_API_2_result_table3$Score.value) #View(date_entity_API_2_result_table_final) ##################################### #Pie Chart for Sentimental Analysis API-1 ##################################### #Pie Chart for Sentimental Analysis for person_entity_API_1 person_entity_API_1_result_table_final_slices <- c(sum(person_entity_API_1_result_table_final$Positive), sum(person_entity_API_1_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(person_entity_API_1_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") #Pie Chart for Sentimental Analysis for location_entity_API_1 location_entity_API_1_result_table_final_slices <- c(sum(location_entity_API_1_result_table_final$Positive), sum(location_entity_API_1_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(location_entity_API_1_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") #Pie Chart for Sentimental Analysis for organization_entity_API_1 organization_entity_API_1_result_table_final_slices <- c(sum(organization_entity_API_1_result_table_final$Positive), sum(organization_entity_API_1_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(organization_entity_API_1_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") #Pie Chart for Sentimental Analysis for money_entity_API_1 money_entity_API_1_result_table_final_slices <- c(sum(money_entity_API_1_result_table_final$Positive), sum(money_entity_API_1_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(money_entity_API_1_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") #Pie Chart for Sentimental Analysis for date_entity_API_1 date_entity_API_1_result_table_final_slices <- c(sum(date_entity_API_1_result_table_final$Positive), sum(date_entity_API_1_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(date_entity_API_1_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") ##################################### #Pie Chart for Sentimental Analysis API-2 ##################################### #Pie Chart for Sentimental Analysis person_entity_API_2_result_table_final_slices <- c(sum(person_entity_API_2_result_table_final$Positive), sum(person_entity_API_2_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(person_entity_API_2_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") #Pie Chart for Sentimental Analysis location_entity_API_2_result_table_final_slices <- c(sum(location_entity_API_2_result_table_final$Positive), sum(location_entity_API_2_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(location_entity_API_2_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") #Pie Chart for Sentimental Analysis organization_entity_API_2_result_table_final_slices <- c(sum(organization_entity_API_2_result_table_final$Positive), sum(organization_entity_API_2_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(organization_entity_API_2_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") #Pie Chart for Sentimental Analysis money_entity_API_2_result_table_final_slices <- c(sum(money_entity_API_2_result_table_final$Positive), sum(money_entity_API_2_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(money_entity_API_2_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") #Pie Chart for Sentimental Analysis date_entity_API_2_result_table_final_slices <- c(sum(date_entity_API_2_result_table_final$Positive), sum(date_entity_API_2_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(date_entity_API_2_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis")
/03_SENTIMENT_ANALYSIS.R
no_license
adash92/Sentimental-Analysis-Twitter
R
false
false
32,503
r
###################################################################################### ######## SENTIMENTAL ANALYSIS FOR NAMED ENTITIES COLLECTED FROM API-1 & API-2 ######## #Reference Source website : https://github.com/rOpenGov/rtimes ###################################################################################### #Importing the common positive and negative words lists into data sets pos.words = scan('C:/DESKTOP/Home/twitter-sentiment-analysis-tutorial-201107-master/twitter-sentiment-analysis-tutorial-201107-master/data/opinion-lexicon-English/positive-words.txt', what='character', comment.char=';') neg.words = scan('C:/DESKTOP/Home/twitter-sentiment-analysis-tutorial-201107-master/twitter-sentiment-analysis-tutorial-201107-master/data/opinion-lexicon-English/negative-words.txt', what='character', comment.char=';') #Adding more common words to positive and negative databases pos.words=c(pos.words, 'Congrats', 'prizes', 'prize', 'thanks', 'thnx', 'Grt', 'gr8', 'plz', 'trending', 'recovering', 'brainstorm', 'leader') neg.words = c(neg.words, 'Fight', 'fighting', 'wtf', 'arrest', 'no', 'not') #list of named entities available from API 1 #View(person_entity_API_1) #View(location_entity_API_1) #View(organization_entity_API_1) #View(date_entity_API_1) #View(money_entity_API_1) #list of named entities available from API 2 #View(person_entity_API_2_final) #View(location_entity_API_2_final) #View(organization_entity_API_2_final) #View(money_entity_API_2_final) #View(date_entity_API_2_final) # Initialising the variables sentences <- NULL sentence <- NULL #Function to provide score of a sentense as per the frequency of negative and positive words score.sentiment = function(sentences, pos.words, neg.words, .progress='none') { require(plyr) require(stringr) list=lapply(sentences, function(sentence, pos.words, neg.words) { sentence = gsub('[[:punct:]]',' ',sentence) sentence = gsub('[[:cntrl:]]','',sentence) sentence = gsub('\\d+','',sentence) sentence = gsub('\n','',sentence) sentence = tolower(sentence) word.list = str_split(sentence, '\\s+') words = unlist(word.list) pos.matches = match(words, pos.words) neg.matches = match(words, neg.words) pos.matches = !is.na(pos.matches) neg.matches = !is.na(neg.matches) pp=sum(pos.matches) nn = sum(neg.matches) score = sum(pos.matches) - sum(neg.matches) list1=c(score, pp, nn) return (list1) }, pos.words, neg.words) score_new=lapply(list, `[[`, 1) pp1=score=lapply(list, `[[`, 2) nn1=score=lapply(list, `[[`, 3) scores.df = data.frame(score=score_new, text=sentences) positive.df = data.frame(Positive=pp1, text=sentences) negative.df = data.frame(Negative=nn1, text=sentences) list_df=list(scores.df, positive.df, negative.df) return(list_df) } ########################################################################################################## ########################### SENTIMENTAL ANALYSIS FOR NAMED ENTITY FROM API - 1 ########################### ########################################################################################################## #Assigning the sentiment obtained for each named entity from API-1 person_entity_API_1_result = score.sentiment(person_entity_API_1, pos.words, neg.words) location_entity_API_1_result = score.sentiment(location_entity_API_1, pos.words, neg.words) organization_entity_API_1_result = score.sentiment(organization_entity_API_1, pos.words, neg.words) date_entity_API_1_result = score.sentiment(date_entity_API_1, pos.words, neg.words) money_entity_API_1_result = score.sentiment(money_entity_API_1, pos.words, neg.words) #View(person_entity_API_1_result) #View(location_entity_API_1_result) #View(organization_entity_API_1_result) #View(date_entity_API_1_result) #View(money_entity_API_1_result) #list of named entities available from API 1 #View(person_entity_API_1) #View(location_entity_API_1) #View(organization_entity_API_1) #View(date_entity_API_1) #View(money_entity_API_1) ########################################### ###### SENTIMENTAL ANALYSIS FOR PERSON ###### ########################################### #Creating a copy of result data frame person_entity_API_1_result_Column_1=person_entity_API_1_result[[1]] person_entity_API_1_result_Column_2=person_entity_API_1_result[[2]] person_entity_API_1_result_Column_3=person_entity_API_1_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q person_entity_API_1_result_Score=person_entity_API_1_result_Column_1[1,] person_entity_API_1_result_Positive=person_entity_API_1_result_Column_2[1,] person_entity_API_1_result_Negative=person_entity_API_1_result_Column_3[1,] person_entity_API_1_result_Score_1=melt(person_entity_API_1_result_Score, ,var='Score') person_entity_API_1_result_Positive_2=melt(person_entity_API_1_result_Positive, ,var='Positive') person_entity_API_1_result_Negative_3=melt(person_entity_API_1_result_Negative, ,var='Negative') person_entity_API_1_result_Score_1['Score'] = NULL person_entity_API_1_result_Positive_2['Positive'] = NULL person_entity_API_1_result_Negative_3['Negative'] = NULL #Creating data frame person_entity_API_1_result_table1 = data.frame(Text=person_entity_API_1_result[1], Score=person_entity_API_1_result_Score_1) person_entity_API_1_result_table2 = data.frame(Text=person_entity_API_1_result[2], Score=person_entity_API_1_result_Positive_2) person_entity_API_1_result_table3 = data.frame(Text=person_entity_API_1_result[3], Score=person_entity_API_1_result_Negative_3) #Merging three data frames into one person_entity_API_1_result_table_final=data.frame(Text=person_entity_API_1_result_table1, Score=person_entity_API_1_result_table1, Positive=person_entity_API_1_result_table2, Negative=person_entity_API_1_result_table3) #person_entity_API_1_result_table_final person_entity_API_1_result_table_final=data.frame(Text=person_entity_API_1_result_table1$Text.person.1, Score=person_entity_API_1_result_table1$Score.value, Positive=person_entity_API_1_result_table2$Score.value, Negative=person_entity_API_1_result_table3$Score.value) #View(person_entity_API_1_result_table_final) ########################################### ###### SENTIMENTAL ANALYSIS FOR LOCATION ###### ########################################### #Creating a copy of result data frame location_entity_API_1_result_Column_1=location_entity_API_1_result[[1]] location_entity_API_1_result_Column_2=location_entity_API_1_result[[2]] location_entity_API_1_result_Column_3=location_entity_API_1_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q location_entity_API_1_result_Score=location_entity_API_1_result_Column_1[1,] location_entity_API_1_result_Positive=location_entity_API_1_result_Column_2[1,] location_entity_API_1_result_Negative=location_entity_API_1_result_Column_3[1,] location_entity_API_1_result_Score_1=melt(location_entity_API_1_result_Score, ,var='Score') location_entity_API_1_result_Positive_2=melt(location_entity_API_1_result_Positive, ,var='Positive') location_entity_API_1_result_Negative_3=melt(location_entity_API_1_result_Negative, ,var='Negative') location_entity_API_1_result_Score_1['Score'] = NULL location_entity_API_1_result_Positive_2['Positive'] = NULL location_entity_API_1_result_Negative_3['Negative'] = NULL #Creating data frame location_entity_API_1_result_table1 = data.frame(Text=location_entity_API_1_result[1], Score=location_entity_API_1_result_Score_1) location_entity_API_1_result_table2 = data.frame(Text=location_entity_API_1_result[2], Score=location_entity_API_1_result_Positive_2) location_entity_API_1_result_table3 = data.frame(Text=location_entity_API_1_result[3], Score=location_entity_API_1_result_Negative_3) #Merging three data frames into one location_entity_API_1_result_table_final=data.frame(Text=location_entity_API_1_result_table1, Score=location_entity_API_1_result_table1, Positive=location_entity_API_1_result_table2, Negative=location_entity_API_1_result_table3) #location_entity_API_1_result_table_final location_entity_API_1_result_table_final=data.frame(Text=location_entity_API_1_result_table1$Text.location.1, Score=location_entity_API_1_result_table1$Score.value, Positive=location_entity_API_1_result_table2$Score.value, Negative=location_entity_API_1_result_table3$Score.value) #View(location_entity_API_1_result_table_final) ################################################# ###### SENTIMENTAL ANALYSIS FOR ORGANIZATION ###### ################################################# #Creating a copy of result data frame organization_entity_API_1_result_Column_1=organization_entity_API_1_result[[1]] organization_entity_API_1_result_Column_2=organization_entity_API_1_result[[2]] organization_entity_API_1_result_Column_3=organization_entity_API_1_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q organization_entity_API_1_result_Score=organization_entity_API_1_result_Column_1[1,] organization_entity_API_1_result_Positive=organization_entity_API_1_result_Column_2[1,] organization_entity_API_1_result_Negative=organization_entity_API_1_result_Column_3[1,] organization_entity_API_1_result_Score_1=melt(organization_entity_API_1_result_Score, ,var='Score') organization_entity_API_1_result_Positive_2=melt(organization_entity_API_1_result_Positive, ,var='Positive') organization_entity_API_1_result_Negative_3=melt(organization_entity_API_1_result_Negative, ,var='Negative') organization_entity_API_1_result_Score_1['Score'] = NULL organization_entity_API_1_result_Positive_2['Positive'] = NULL organization_entity_API_1_result_Negative_3['Negative'] = NULL #Creating data frame organization_entity_API_1_result_table1 = data.frame(Text=organization_entity_API_1_result[1], Score=organization_entity_API_1_result_Score_1) organization_entity_API_1_result_table2 = data.frame(Text=organization_entity_API_1_result[2], Score=organization_entity_API_1_result_Positive_2) organization_entity_API_1_result_table3 = data.frame(Text=organization_entity_API_1_result[3], Score=organization_entity_API_1_result_Negative_3) #Merging three data frames into one organization_entity_API_1_result_table_final=data.frame(Text=organization_entity_API_1_result_table1, Score=organization_entity_API_1_result_table1, Positive=organization_entity_API_1_result_table2, Negative=organization_entity_API_1_result_table3) #organization_entity_API_1_result_table_final organization_entity_API_1_result_table_final=data.frame(Text=organization_entity_API_1_result_table1$Text.organization.1, Score=organization_entity_API_1_result_table1$Score.value, Positive=organization_entity_API_1_result_table2$Score.value, Negative=organization_entity_API_1_result_table3$Score.value) #View(organization_entity_API_1_result_table_final) ########################################### ###### SENTIMENTAL ANALYSIS FOR MONEY ###### ########################################### #Creating a copy of result data frame money_entity_API_1_result_Column_1=money_entity_API_1_result[[1]] money_entity_API_1_result_Column_2=money_entity_API_1_result[[2]] money_entity_API_1_result_Column_3=money_entity_API_1_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q money_entity_API_1_result_Score=money_entity_API_1_result_Column_1[1,] money_entity_API_1_result_Positive=money_entity_API_1_result_Column_2[1,] money_entity_API_1_result_Negative=money_entity_API_1_result_Column_3[1,] money_entity_API_1_result_Score_1=melt(money_entity_API_1_result_Score, ,var='Score') money_entity_API_1_result_Positive_2=melt(money_entity_API_1_result_Positive, ,var='Positive') money_entity_API_1_result_Negative_3=melt(money_entity_API_1_result_Negative, ,var='Negative') money_entity_API_1_result_Score_1['Score'] = NULL money_entity_API_1_result_Positive_2['Positive'] = NULL money_entity_API_1_result_Negative_3['Negative'] = NULL #Creating data frame money_entity_API_1_result_table1 = data.frame(Text=money_entity_API_1_result[1], Score=money_entity_API_1_result_Score_1) money_entity_API_1_result_table2 = data.frame(Text=money_entity_API_1_result[2], Score=money_entity_API_1_result_Positive_2) money_entity_API_1_result_table3 = data.frame(Text=money_entity_API_1_result[3], Score=money_entity_API_1_result_Negative_3) #Merging three data frames into one money_entity_API_1_result_table_final=data.frame(Text=money_entity_API_1_result_table1, Score=money_entity_API_1_result_table1, Positive=money_entity_API_1_result_table2, Negative=money_entity_API_1_result_table3) #money_entity_API_1_result_table_final money_entity_API_1_result_table_final=data.frame(Text=money_entity_API_1_result_table1$Text.money.1, Score=money_entity_API_1_result_table1$Score.value, Positive=money_entity_API_1_result_table2$Score.value, Negative=money_entity_API_1_result_table3$Score.value) #View(money_entity_API_1_result_table_final) ########################################### ###### SENTIMENTAL ANALYSIS FOR DATE ###### ########################################### #Creating a copy of result data frame date_entity_API_1_result_Column_1=date_entity_API_1_result[[1]] date_entity_API_1_result_Column_2=date_entity_API_1_result[[2]] date_entity_API_1_result_Column_3=date_entity_API_1_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q date_entity_API_1_result_Score=date_entity_API_1_result_Column_1[1,] date_entity_API_1_result_Positive=date_entity_API_1_result_Column_2[1,] date_entity_API_1_result_Negative=date_entity_API_1_result_Column_3[1,] date_entity_API_1_result_Score_1=melt(date_entity_API_1_result_Score, ,var='Score') date_entity_API_1_result_Positive_2=melt(date_entity_API_1_result_Positive, ,var='Positive') date_entity_API_1_result_Negative_3=melt(date_entity_API_1_result_Negative, ,var='Negative') date_entity_API_1_result_Score_1['Score'] = NULL date_entity_API_1_result_Positive_2['Positive'] = NULL date_entity_API_1_result_Negative_3['Negative'] = NULL #Creating data frame date_entity_API_1_result_table1 = data.frame(Text=date_entity_API_1_result[1], Score=date_entity_API_1_result_Score_1) date_entity_API_1_result_table2 = data.frame(Text=date_entity_API_1_result[2], Score=date_entity_API_1_result_Positive_2) date_entity_API_1_result_table3 = data.frame(Text=date_entity_API_1_result[3], Score=date_entity_API_1_result_Negative_3) #Merging three data frames into one date_entity_API_1_result_table_final=data.frame(Text=date_entity_API_1_result_table1, Score=date_entity_API_1_result_table1, Positive=date_entity_API_1_result_table2, Negative=date_entity_API_1_result_table3) #date_entity_API_1_result_table_final date_entity_API_1_result_table_final=data.frame(Text=date_entity_API_1_result_table1$Text.date.1, Score=date_entity_API_1_result_table1$Score.value, Positive=date_entity_API_1_result_table2$Score.value, Negative=date_entity_API_1_result_table3$Score.value) #View(date_entity_API_1_result_table_final) ########################################################################################################## ########################### SENTIMENTAL ANALYSIS FOR NAMED ENTITY FROM API - 2 ########################### ########################################################################################################## #Assigning the sentiment obtained for each named entity from API-2 person_entity_API_2_result = score.sentiment(person_entity_API_2, pos.words, neg.words) location_entity_API_2_result = score.sentiment(location_entity_API_2, pos.words, neg.words) organization_entity_API_2_result = score.sentiment(organization_entity_API_2, pos.words, neg.words) date_entity_API_2_result = score.sentiment(date_entity_API_2, pos.words, neg.words) money_entity_API_2_result = score.sentiment(money_entity_API_2, pos.words, neg.words) #View(person_entity_API_2_result) #View(location_entity_API_2_result) #View(organization_entity_API_2_result) #View(date_entity_API_2_result) #View(money_entity_API_2_result) #list of named entities available from API 1 #View(person_entity_API_2) #View(location_entity_API_2) #View(organization_entity_API_2) #View(date_entity_API_2) #View(money_entity_API_2) ########################################### ###### SENTIMENTAL ANALYSIS FOR PERSON ###### ########################################### #Creating a copy of result data frame person_entity_API_2_result_Column_1=person_entity_API_2_result[[1]] person_entity_API_2_result_Column_2=person_entity_API_2_result[[2]] person_entity_API_2_result_Column_3=person_entity_API_2_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q person_entity_API_2_result_Score=person_entity_API_2_result_Column_1[1,] person_entity_API_2_result_Positive=person_entity_API_2_result_Column_2[1,] person_entity_API_2_result_Negative=person_entity_API_2_result_Column_3[1,] person_entity_API_2_result_Score_1=melt(person_entity_API_2_result_Score, ,var='Score') person_entity_API_2_result_Positive_2=melt(person_entity_API_2_result_Positive, ,var='Positive') person_entity_API_2_result_Negative_3=melt(person_entity_API_2_result_Negative, ,var='Negative') person_entity_API_2_result_Score_1['Score'] = NULL person_entity_API_2_result_Positive_2['Positive'] = NULL person_entity_API_2_result_Negative_3['Negative'] = NULL #Creating data frame person_entity_API_2_result_table1 = data.frame(Text=person_entity_API_2_result[1], Score=person_entity_API_2_result_Score_1) person_entity_API_2_result_table2 = data.frame(Text=person_entity_API_2_result[2], Score=person_entity_API_2_result_Positive_2) person_entity_API_2_result_table3 = data.frame(Text=person_entity_API_2_result[3], Score=person_entity_API_2_result_Negative_3) #Merging three data frames into one person_entity_API_2_result_table_final=data.frame(Text=person_entity_API_2_result_table1, Score=person_entity_API_2_result_table1, Positive=person_entity_API_2_result_table2, Negative=person_entity_API_2_result_table3) #person_entity_API_2_result_table_final person_entity_API_2_result_table_final=data.frame(Text=person_entity_API_2_result_table1$Text.person.1, Score=person_entity_API_2_result_table1$Score.value, Positive=person_entity_API_2_result_table2$Score.value, Negative=person_entity_API_2_result_table3$Score.value) #View(person_entity_API_2_result_table_final) ########################################### ###### SENTIMENTAL ANALYSIS FOR LOCATION ###### ########################################### #Creating a copy of result data frame location_entity_API_2_result_Column_1=location_entity_API_2_result[[1]] location_entity_API_2_result_Column_2=location_entity_API_2_result[[2]] location_entity_API_2_result_Column_3=location_entity_API_2_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q location_entity_API_2_result_Score=location_entity_API_2_result_Column_1[1,] location_entity_API_2_result_Positive=location_entity_API_2_result_Column_2[1,] location_entity_API_2_result_Negative=location_entity_API_2_result_Column_3[1,] location_entity_API_2_result_Score_1=melt(location_entity_API_2_result_Score, ,var='Score') location_entity_API_2_result_Positive_2=melt(location_entity_API_2_result_Positive, ,var='Positive') location_entity_API_2_result_Negative_3=melt(location_entity_API_2_result_Negative, ,var='Negative') location_entity_API_2_result_Score_1['Score'] = NULL location_entity_API_2_result_Positive_2['Positive'] = NULL location_entity_API_2_result_Negative_3['Negative'] = NULL #Creating data frame location_entity_API_2_result_table1 = data.frame(Text=location_entity_API_2_result[1], Score=location_entity_API_2_result_Score_1) location_entity_API_2_result_table2 = data.frame(Text=location_entity_API_2_result[2], Score=location_entity_API_2_result_Positive_2) location_entity_API_2_result_table3 = data.frame(Text=location_entity_API_2_result[3], Score=location_entity_API_2_result_Negative_3) #Merging three data frames into one location_entity_API_2_result_table_final=data.frame(Text=location_entity_API_2_result_table1, Score=location_entity_API_2_result_table1, Positive=location_entity_API_2_result_table2, Negative=location_entity_API_2_result_table3) #location_entity_API_2_result_table_final location_entity_API_2_result_table_final=data.frame(Text=location_entity_API_2_result_table1$Text.location.1, Score=location_entity_API_2_result_table1$Score.value, Positive=location_entity_API_2_result_table2$Score.value, Negative=location_entity_API_2_result_table3$Score.value) #View(location_entity_API_2_result_table_final) ################################################# ###### SENTIMENTAL ANALYSIS FOR ORGANIZATION ###### ################################################# #Creating a copy of result data frame organization_entity_API_2_result_Column_1=organization_entity_API_2_result[[1]] organization_entity_API_2_result_Column_2=organization_entity_API_2_result[[2]] organization_entity_API_2_result_Column_3=organization_entity_API_2_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q organization_entity_API_2_result_Score=organization_entity_API_2_result_Column_1[1,] organization_entity_API_2_result_Positive=organization_entity_API_2_result_Column_2[1,] organization_entity_API_2_result_Negative=organization_entity_API_2_result_Column_3[1,] organization_entity_API_2_result_Score_1=melt(organization_entity_API_2_result_Score, ,var='Score') organization_entity_API_2_result_Positive_2=melt(organization_entity_API_2_result_Positive, ,var='Positive') organization_entity_API_2_result_Negative_3=melt(organization_entity_API_2_result_Negative, ,var='Negative') organization_entity_API_2_result_Score_1['Score'] = NULL organization_entity_API_2_result_Positive_2['Positive'] = NULL organization_entity_API_2_result_Negative_3['Negative'] = NULL #Creating data frame organization_entity_API_2_result_table1 = data.frame(Text=organization_entity_API_2_result[1], Score=organization_entity_API_2_result_Score_1) organization_entity_API_2_result_table2 = data.frame(Text=organization_entity_API_2_result[2], Score=organization_entity_API_2_result_Positive_2) organization_entity_API_2_result_table3 = data.frame(Text=organization_entity_API_2_result[3], Score=organization_entity_API_2_result_Negative_3) #Merging three data frames into one organization_entity_API_2_result_table_final=data.frame(Text=organization_entity_API_2_result_table1, Score=organization_entity_API_2_result_table1, Positive=organization_entity_API_2_result_table2, Negative=organization_entity_API_2_result_table3) #organization_entity_API_2_result_table_final organization_entity_API_2_result_table_final=data.frame(Text=organization_entity_API_2_result_table1$Text.organization.1, Score=organization_entity_API_2_result_table1$Score.value, Positive=organization_entity_API_2_result_table2$Score.value, Negative=organization_entity_API_2_result_table3$Score.value) #View(organization_entity_API_2_result_table_final) ########################################### ###### SENTIMENTAL ANALYSIS FOR MONEY ###### ########################################### #Creating a copy of result data frame money_entity_API_2_result_Column_1=money_entity_API_2_result[[1]] money_entity_API_2_result_Column_2=money_entity_API_2_result[[2]] money_entity_API_2_result_Column_3=money_entity_API_2_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q money_entity_API_2_result_Score=money_entity_API_2_result_Column_1[1,] money_entity_API_2_result_Positive=money_entity_API_2_result_Column_2[1,] money_entity_API_2_result_Negative=money_entity_API_2_result_Column_3[1,] money_entity_API_2_result_Score_1=melt(money_entity_API_2_result_Score, ,var='Score') money_entity_API_2_result_Positive_2=melt(money_entity_API_2_result_Positive, ,var='Positive') money_entity_API_2_result_Negative_3=melt(money_entity_API_2_result_Negative, ,var='Negative') money_entity_API_2_result_Score_1['Score'] = NULL money_entity_API_2_result_Positive_2['Positive'] = NULL money_entity_API_2_result_Negative_3['Negative'] = NULL #Creating data frame money_entity_API_2_result_table1 = data.frame(Text=money_entity_API_2_result[1], Score=money_entity_API_2_result_Score_1) money_entity_API_2_result_table2 = data.frame(Text=money_entity_API_2_result[2], Score=money_entity_API_2_result_Positive_2) money_entity_API_2_result_table3 = data.frame(Text=money_entity_API_2_result[3], Score=money_entity_API_2_result_Negative_3) #Merging three data frames into one money_entity_API_2_result_table_final=data.frame(Text=money_entity_API_2_result_table1, Score=money_entity_API_2_result_table1, Positive=money_entity_API_2_result_table2, Negative=money_entity_API_2_result_table3) #money_entity_API_2_result_table_final money_entity_API_2_result_table_final=data.frame(Text=money_entity_API_2_result_table1$Text.money.1, Score=money_entity_API_2_result_table1$Score.value, Positive=money_entity_API_2_result_table2$Score.value, Negative=money_entity_API_2_result_table3$Score.value) #View(money_entity_API_2_result_table_final) ########################################### ###### SENTIMENTAL ANALYSIS FOR DATE ###### ########################################### #Creating a copy of result data frame date_entity_API_2_result_Column_1=date_entity_API_2_result[[1]] date_entity_API_2_result_Column_2=date_entity_API_2_result[[2]] date_entity_API_2_result_Column_3=date_entity_API_2_result[[3]] #Creating three different data frames for Score, Positive and Negative #Storing the first row(Containing the sentiment scores) in variable q date_entity_API_2_result_Score=date_entity_API_2_result_Column_1[1,] date_entity_API_2_result_Positive=date_entity_API_2_result_Column_2[1,] date_entity_API_2_result_Negative=date_entity_API_2_result_Column_3[1,] date_entity_API_2_result_Score_1=melt(date_entity_API_2_result_Score, ,var='Score') date_entity_API_2_result_Positive_2=melt(date_entity_API_2_result_Positive, ,var='Positive') date_entity_API_2_result_Negative_3=melt(date_entity_API_2_result_Negative, ,var='Negative') date_entity_API_2_result_Score_1['Score'] = NULL date_entity_API_2_result_Positive_2['Positive'] = NULL date_entity_API_2_result_Negative_3['Negative'] = NULL #Creating data frame date_entity_API_2_result_table1 = data.frame(Text=date_entity_API_2_result[1], Score=date_entity_API_2_result_Score_1) date_entity_API_2_result_table2 = data.frame(Text=date_entity_API_2_result[2], Score=date_entity_API_2_result_Positive_2) date_entity_API_2_result_table3 = data.frame(Text=date_entity_API_2_result[3], Score=date_entity_API_2_result_Negative_3) #Merging three data frames into one date_entity_API_2_result_table_final=data.frame(Text=date_entity_API_2_result_table1, Score=date_entity_API_2_result_table1, Positive=date_entity_API_2_result_table2, Negative=date_entity_API_2_result_table3) #date_entity_API_2_result_table_final date_entity_API_2_result_table_final=data.frame(Text=date_entity_API_2_result_table1$Text.date.1, Score=date_entity_API_2_result_table1$Score.value, Positive=date_entity_API_2_result_table2$Score.value, Negative=date_entity_API_2_result_table3$Score.value) #View(date_entity_API_2_result_table_final) ##################################### #Pie Chart for Sentimental Analysis API-1 ##################################### #Pie Chart for Sentimental Analysis for person_entity_API_1 person_entity_API_1_result_table_final_slices <- c(sum(person_entity_API_1_result_table_final$Positive), sum(person_entity_API_1_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(person_entity_API_1_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") #Pie Chart for Sentimental Analysis for location_entity_API_1 location_entity_API_1_result_table_final_slices <- c(sum(location_entity_API_1_result_table_final$Positive), sum(location_entity_API_1_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(location_entity_API_1_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") #Pie Chart for Sentimental Analysis for organization_entity_API_1 organization_entity_API_1_result_table_final_slices <- c(sum(organization_entity_API_1_result_table_final$Positive), sum(organization_entity_API_1_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(organization_entity_API_1_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") #Pie Chart for Sentimental Analysis for money_entity_API_1 money_entity_API_1_result_table_final_slices <- c(sum(money_entity_API_1_result_table_final$Positive), sum(money_entity_API_1_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(money_entity_API_1_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") #Pie Chart for Sentimental Analysis for date_entity_API_1 date_entity_API_1_result_table_final_slices <- c(sum(date_entity_API_1_result_table_final$Positive), sum(date_entity_API_1_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(date_entity_API_1_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") ##################################### #Pie Chart for Sentimental Analysis API-2 ##################################### #Pie Chart for Sentimental Analysis person_entity_API_2_result_table_final_slices <- c(sum(person_entity_API_2_result_table_final$Positive), sum(person_entity_API_2_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(person_entity_API_2_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") #Pie Chart for Sentimental Analysis location_entity_API_2_result_table_final_slices <- c(sum(location_entity_API_2_result_table_final$Positive), sum(location_entity_API_2_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(location_entity_API_2_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") #Pie Chart for Sentimental Analysis organization_entity_API_2_result_table_final_slices <- c(sum(organization_entity_API_2_result_table_final$Positive), sum(organization_entity_API_2_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(organization_entity_API_2_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") #Pie Chart for Sentimental Analysis money_entity_API_2_result_table_final_slices <- c(sum(money_entity_API_2_result_table_final$Positive), sum(money_entity_API_2_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(money_entity_API_2_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis") #Pie Chart for Sentimental Analysis date_entity_API_2_result_table_final_slices <- c(sum(date_entity_API_2_result_table_final$Positive), sum(date_entity_API_2_result_table_final$Negative)) labels <- c("Positive", "Negative") pie3D(date_entity_API_2_result_table_final_slices, labels = labels, col=rainbow(length(labels)),explode=0.00, main="Sentiment Analysis")
#List all the downloaded files if the table has been updated a new file will be downloaded, #then delete the old file to save space annotation.Names = list.files(".","Job-*") #delete.files <- annotation.Names[-which.max(file.mtime(annotation.Names))] #unlink(delete.files) unlink(annotation.Names) #static content grantdf.Rdata <- synGet("syn5574249") load(grantdf.Rdata@filePath) #Static content #grant.df <- read.csv("all_grants_posterior_prob.csv",stringsAsFactors = F) #grant.df <- grant.df[!duplicated(grant.df$AwardTitle),] #Change to yes and no grant.df$Metastasis_YN[grant.df$Metastasis_YN == 'y'] <- 'yes' grant.df$Metastasis_YN[grant.df$Metastasis_YN == 'n'] <- 'no' grant.df$Predicted_metaYN[grant.df$Predicted_metaYN == 'y'] <- 'yes' grant.df$Predicted_metaYN[grant.df$Predicted_metaYN == 'n'] <- 'no' #grant.df$ROW_INDEX <- paste(grant.df$ROW_ID,grant.df$ROW_VERSION,sep="_") Breast <- as.numeric(grant.df$Breast_Cancer) Breast[is.na(Breast)] <- 0 grant.MBC <- grant.df[grant.df$Metastasis_YN == 'yes' & Breast >= 50,] allTitles <- grant.MBC$AwardTitle allPathways <- grant.MBC$Pathway allmetaStage <-grant.MBC$Metastasis_stage
/load.R
permissive
Sage-Bionetworks/AvonMBCShiny
R
false
false
1,147
r
#List all the downloaded files if the table has been updated a new file will be downloaded, #then delete the old file to save space annotation.Names = list.files(".","Job-*") #delete.files <- annotation.Names[-which.max(file.mtime(annotation.Names))] #unlink(delete.files) unlink(annotation.Names) #static content grantdf.Rdata <- synGet("syn5574249") load(grantdf.Rdata@filePath) #Static content #grant.df <- read.csv("all_grants_posterior_prob.csv",stringsAsFactors = F) #grant.df <- grant.df[!duplicated(grant.df$AwardTitle),] #Change to yes and no grant.df$Metastasis_YN[grant.df$Metastasis_YN == 'y'] <- 'yes' grant.df$Metastasis_YN[grant.df$Metastasis_YN == 'n'] <- 'no' grant.df$Predicted_metaYN[grant.df$Predicted_metaYN == 'y'] <- 'yes' grant.df$Predicted_metaYN[grant.df$Predicted_metaYN == 'n'] <- 'no' #grant.df$ROW_INDEX <- paste(grant.df$ROW_ID,grant.df$ROW_VERSION,sep="_") Breast <- as.numeric(grant.df$Breast_Cancer) Breast[is.na(Breast)] <- 0 grant.MBC <- grant.df[grant.df$Metastasis_YN == 'yes' & Breast >= 50,] allTitles <- grant.MBC$AwardTitle allPathways <- grant.MBC$Pathway allmetaStage <-grant.MBC$Metastasis_stage
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/flowlayers.R \name{get_bp} \alias{get_bp} \title{get_bp} \usage{ get_bp(city) } \arguments{ \item{city}{Name of city for which to obtain bounding polygon} } \value{ Matrix of coordinates of bounding polygon } \description{ get bounding polygons for cities (Accra, Kathmandu) }
/man/get_bp.Rd
no_license
atfutures-labs/flowlayers2
R
false
true
355
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/flowlayers.R \name{get_bp} \alias{get_bp} \title{get_bp} \usage{ get_bp(city) } \arguments{ \item{city}{Name of city for which to obtain bounding polygon} } \value{ Matrix of coordinates of bounding polygon } \description{ get bounding polygons for cities (Accra, Kathmandu) }
#' @param Costs A vector containing the costs each coalition has to pay.
/CoopGame/man-roxygen/param/Costs.R
no_license
anwanjohannes/CoopGame
R
false
false
75
r
#' @param Costs A vector containing the costs each coalition has to pay.
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/svm.r \name{svm} \alias{svm} \title{svm} \usage{ svm(x, y, maxiter = 500) } \arguments{ \item{x, y}{The input data \code{x} and response \code{y}. Each must be a shaq, and each must be distributed in an identical fashion. See the details section for more information.} \item{maxiter}{The maximum number of iterations.} } \value{ The return is the output of an \code{optim()} call. } \description{ Support vector machine. The internals are nearly identical to that of the logistic regression fitter, except that here we use the "hinged loss". } \details{ The optimization uses Nelder-Mead. Both of \code{x} and \code{y} must be distributed in an identical fashion. This means that the number of rows owned by each MPI rank should match, and the data rows \code{x} and response rows \code{y} should be aligned. Additionally, each MPI rank should own at least one row. Ideally they should be load balanced, so that each MPI rank owns roughly the same amount of data. } \section{Communication}{ The communication consists of an allreduce of 1 double (the local cost/objective function value) at each iteration of the optimization. } \examples{ \dontrun{ library(kazaam) comm.set.seed(1234, diff=TRUE) x = ranshaq(rnorm, 10, 3) y = ranshaq(function(i) sample(0:1, size=i, replace=TRUE), 10) fit = svm(x, y) comm.print(fit) finalize() } } \references{ Efron, B. and Hastie, T., 2016. Computer Age Statistical Inference (Vol. 5). Cambridge University Press. } \seealso{ \code{\link{glm}} }
/man/svm.Rd
permissive
RBigData/kazaam
R
false
true
1,573
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/svm.r \name{svm} \alias{svm} \title{svm} \usage{ svm(x, y, maxiter = 500) } \arguments{ \item{x, y}{The input data \code{x} and response \code{y}. Each must be a shaq, and each must be distributed in an identical fashion. See the details section for more information.} \item{maxiter}{The maximum number of iterations.} } \value{ The return is the output of an \code{optim()} call. } \description{ Support vector machine. The internals are nearly identical to that of the logistic regression fitter, except that here we use the "hinged loss". } \details{ The optimization uses Nelder-Mead. Both of \code{x} and \code{y} must be distributed in an identical fashion. This means that the number of rows owned by each MPI rank should match, and the data rows \code{x} and response rows \code{y} should be aligned. Additionally, each MPI rank should own at least one row. Ideally they should be load balanced, so that each MPI rank owns roughly the same amount of data. } \section{Communication}{ The communication consists of an allreduce of 1 double (the local cost/objective function value) at each iteration of the optimization. } \examples{ \dontrun{ library(kazaam) comm.set.seed(1234, diff=TRUE) x = ranshaq(rnorm, 10, 3) y = ranshaq(function(i) sample(0:1, size=i, replace=TRUE), 10) fit = svm(x, y) comm.print(fit) finalize() } } \references{ Efron, B. and Hastie, T., 2016. Computer Age Statistical Inference (Vol. 5). Cambridge University Press. } \seealso{ \code{\link{glm}} }
library(ggplot2) library(plyr) library(RColorBrewer) library(reshape2) options(digits=15) setwd("/Users/stephanf/SCP/randomSplitResults") files <- list.files() data <- data.frame() for (file in files) { tmp <- read.table(file, sep=";", header=T) tmp$cls <- "rf" data <- rbind(data, tmp) } data$metric <- gsub("_mean", "", data$metric) data$ratio <- paste(data$c_miss, data$c_action, sep=":") base_size <- 36 line_size <- 1 point_size <- 4 data <- subset(data, dataset != "bpic2018") data <- subset(data, dataset != "uwv") data$method <- as.character(data$method) data$dataset <- as.character(data$dataset) #data$method[data$method=="single_threshold"] <- "Single Alarm" data$dataset[data$dataset=="uwv_all"] <- "uwv" data$dataset[data$dataset=="traffic_fines_1"] <- "traffic_fines" data$ratio <- as.factor(data$ratio) data$ratio_com <- as.factor(data$c_com) data <- subset(data, cls=="rf") head(data) dt_multi <- subset(data, metric=="cost_avg" & method=="same_time_nonmyopic") dt_alarm1 <- subset(data, metric=="cost_avg" & method=="opt_threshold") dt_alarm2 <- subset(data, metric=="cost_avg" & method=="alarm2") dt_single <- merge(dt_alarm1, dt_alarm2, by=c("dataset", "c_miss", "c_action", "c_postpone", "c_com", "early_type", "cls", "ratio"), suffixes=c("_alarm1", "_alarm2")) dt_single$value_single <- dt_single$value_alarm1 dt_single$value_single <- ifelse(dt_single$value_single > dt_single$value_alarm2, dt_single$value_alarm2 ,dt_single$value_single) dt_merged <- merge(dt_multi, dt_single, by=c("dataset", "c_miss", "c_action", "c_postpone", "c_com", "early_type", "cls", "ratio"), suffixes=c("_multi", "_single")) print(subset(dt_merged,c_com > 19)) dt_merged$benefit <- dt_merged$value/dt_merged$value_single min_value = 0.9 max_value = 1.1 dt_merged$benefit <- ifelse(dt_merged$benefit < min_value,min_value,dt_merged$benefit) dt_merged$benefit <- ifelse(dt_merged$benefit > max_value,max_value,dt_merged$benefit) dt_merged$benefit <-ifelse(((dt_merged$c_action * 1.2) + (dt_merged$c_com * 0.5)) < 0.9*(dt_merged$c_action + dt_merged$c_com),dt_merged$benefit,3000) ggplot(subset(dt_merged, cls=="rf" & c_com > 0), aes(factor(ratio_com_alarm1), factor(ratio))) + geom_tile(aes(fill = benefit), colour = "black") + theme_bw(base_size=base_size) + scale_fill_gradientn(colours=c("green4","green3","green2","white","red2","red3","red4"),breaks=c(0.95,1.0,1.05), limits=c(min_value,max_value),name="ratio") + xlab("c_com") + ylab("c_out : c_in") + theme(axis.text.x = element_text(size=20)) + facet_wrap( ~ dataset, ncol=3) ggsave("/Users/stephanf/Dropbox/Dokumente/Masterstudium/Masterthesis/testresults/MultiAlarm/result_cost_avg_randomSplit_same_time_nonmyopic_vs_single.pdf", width = 20, height = 13)
/plot_1_vs_1_results.R
permissive
samadeusfp/prescriptiveProcessMonitoring
R
false
false
2,750
r
library(ggplot2) library(plyr) library(RColorBrewer) library(reshape2) options(digits=15) setwd("/Users/stephanf/SCP/randomSplitResults") files <- list.files() data <- data.frame() for (file in files) { tmp <- read.table(file, sep=";", header=T) tmp$cls <- "rf" data <- rbind(data, tmp) } data$metric <- gsub("_mean", "", data$metric) data$ratio <- paste(data$c_miss, data$c_action, sep=":") base_size <- 36 line_size <- 1 point_size <- 4 data <- subset(data, dataset != "bpic2018") data <- subset(data, dataset != "uwv") data$method <- as.character(data$method) data$dataset <- as.character(data$dataset) #data$method[data$method=="single_threshold"] <- "Single Alarm" data$dataset[data$dataset=="uwv_all"] <- "uwv" data$dataset[data$dataset=="traffic_fines_1"] <- "traffic_fines" data$ratio <- as.factor(data$ratio) data$ratio_com <- as.factor(data$c_com) data <- subset(data, cls=="rf") head(data) dt_multi <- subset(data, metric=="cost_avg" & method=="same_time_nonmyopic") dt_alarm1 <- subset(data, metric=="cost_avg" & method=="opt_threshold") dt_alarm2 <- subset(data, metric=="cost_avg" & method=="alarm2") dt_single <- merge(dt_alarm1, dt_alarm2, by=c("dataset", "c_miss", "c_action", "c_postpone", "c_com", "early_type", "cls", "ratio"), suffixes=c("_alarm1", "_alarm2")) dt_single$value_single <- dt_single$value_alarm1 dt_single$value_single <- ifelse(dt_single$value_single > dt_single$value_alarm2, dt_single$value_alarm2 ,dt_single$value_single) dt_merged <- merge(dt_multi, dt_single, by=c("dataset", "c_miss", "c_action", "c_postpone", "c_com", "early_type", "cls", "ratio"), suffixes=c("_multi", "_single")) print(subset(dt_merged,c_com > 19)) dt_merged$benefit <- dt_merged$value/dt_merged$value_single min_value = 0.9 max_value = 1.1 dt_merged$benefit <- ifelse(dt_merged$benefit < min_value,min_value,dt_merged$benefit) dt_merged$benefit <- ifelse(dt_merged$benefit > max_value,max_value,dt_merged$benefit) dt_merged$benefit <-ifelse(((dt_merged$c_action * 1.2) + (dt_merged$c_com * 0.5)) < 0.9*(dt_merged$c_action + dt_merged$c_com),dt_merged$benefit,3000) ggplot(subset(dt_merged, cls=="rf" & c_com > 0), aes(factor(ratio_com_alarm1), factor(ratio))) + geom_tile(aes(fill = benefit), colour = "black") + theme_bw(base_size=base_size) + scale_fill_gradientn(colours=c("green4","green3","green2","white","red2","red3","red4"),breaks=c(0.95,1.0,1.05), limits=c(min_value,max_value),name="ratio") + xlab("c_com") + ylab("c_out : c_in") + theme(axis.text.x = element_text(size=20)) + facet_wrap( ~ dataset, ncol=3) ggsave("/Users/stephanf/Dropbox/Dokumente/Masterstudium/Masterthesis/testresults/MultiAlarm/result_cost_avg_randomSplit_same_time_nonmyopic_vs_single.pdf", width = 20, height = 13)
testlist <- list(m = NULL, repetitions = 0L, in_m = structure(c(2.31584307392677e+77, 9.53818252170341e+295, 4.0343042887248e-305, 4.12396251261199e-221, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0), .Dim = c(10L, 3L))) result <- do.call(CNull:::communities_individual_based_sampling_alpha,testlist) str(result)
/CNull/inst/testfiles/communities_individual_based_sampling_alpha/AFL_communities_individual_based_sampling_alpha/communities_individual_based_sampling_alpha_valgrind_files/1615780497-test.R
no_license
akhikolla/updatedatatype-list2
R
false
false
347
r
testlist <- list(m = NULL, repetitions = 0L, in_m = structure(c(2.31584307392677e+77, 9.53818252170341e+295, 4.0343042887248e-305, 4.12396251261199e-221, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0), .Dim = c(10L, 3L))) result <- do.call(CNull:::communities_individual_based_sampling_alpha,testlist) str(result)
#' List to array. #' #' Reduce/simplify a list of homogenous objects to an array #' #' @param res list of input data #' @param labels a data frame of labels, one row for each element of res #' @param .drop should extra dimensions be dropped (TRUE) or preserved (FALSE) #' @family list simplification functions #' @keywords internal list_to_array <- function(res, labels = NULL, .drop = FALSE) { if (length(res) == 0) return(vector()) n <- length(res) atomic <- sapply(res, is.atomic) if (all(atomic)) { # Atomics need to be same size dlength <- unique.default(llply(res, dims)) if (length(dlength) != 1) stop("Results must have the same number of dimensions.") dims <- unique(do.call("rbind", llply(res, amv_dim))) if (is.null(dims) || !all(dims > 0)) stop("Results must have one or more dimensions.", call. = FALSE) if (nrow(dims) != 1) stop("Results must have the same dimensions.", call. = FALSE) res_dim <- amv_dim(res[[1]]) res_labels <- amv_dimnames(res[[1]]) res_index <- expand.grid(res_labels) res <- unname(unlist(res)) } else { # Lists are degenerate case where every element is a singleton res_index <- as.data.frame(matrix(0, 1, 0)) res_dim <- numeric() res_labels <- NULL attr(res, "split_type") <- NULL attr(res, "split_labels") <- NULL class(res) <- class(res)[2] } if (is.null(labels)) { labels <- data.frame(X = seq_len(n)) in_labels <- list(NULL) in_dim <- n } else { in_labels <- lapply(labels, function(x) if(is.factor(x)) levels(x) else sort(unique(x))) in_dim <- sapply(in_labels, length) } # Work out where each result should go in the new array index_old <- rep(id(rev(labels)), each = nrow(res_index)) index_new <- rep(id(rev(res_index)), nrow(labels)) index <- (index_new - 1) * prod(in_dim) + index_old out_dim <- unname(c(in_dim, res_dim)) out_labels <- c(in_labels, res_labels) n <- prod(out_dim) if (length(index) < n) { overall <- match(1:n, index, nomatch = NA) } else { overall <- order(index) } out_array <- res[overall] dim(out_array) <- out_dim dimnames(out_array) <- out_labels if (.drop) reduce_dim(out_array) else out_array }
/R/simplify-array.r
no_license
vspinu/plyr
R
false
false
2,276
r
#' List to array. #' #' Reduce/simplify a list of homogenous objects to an array #' #' @param res list of input data #' @param labels a data frame of labels, one row for each element of res #' @param .drop should extra dimensions be dropped (TRUE) or preserved (FALSE) #' @family list simplification functions #' @keywords internal list_to_array <- function(res, labels = NULL, .drop = FALSE) { if (length(res) == 0) return(vector()) n <- length(res) atomic <- sapply(res, is.atomic) if (all(atomic)) { # Atomics need to be same size dlength <- unique.default(llply(res, dims)) if (length(dlength) != 1) stop("Results must have the same number of dimensions.") dims <- unique(do.call("rbind", llply(res, amv_dim))) if (is.null(dims) || !all(dims > 0)) stop("Results must have one or more dimensions.", call. = FALSE) if (nrow(dims) != 1) stop("Results must have the same dimensions.", call. = FALSE) res_dim <- amv_dim(res[[1]]) res_labels <- amv_dimnames(res[[1]]) res_index <- expand.grid(res_labels) res <- unname(unlist(res)) } else { # Lists are degenerate case where every element is a singleton res_index <- as.data.frame(matrix(0, 1, 0)) res_dim <- numeric() res_labels <- NULL attr(res, "split_type") <- NULL attr(res, "split_labels") <- NULL class(res) <- class(res)[2] } if (is.null(labels)) { labels <- data.frame(X = seq_len(n)) in_labels <- list(NULL) in_dim <- n } else { in_labels <- lapply(labels, function(x) if(is.factor(x)) levels(x) else sort(unique(x))) in_dim <- sapply(in_labels, length) } # Work out where each result should go in the new array index_old <- rep(id(rev(labels)), each = nrow(res_index)) index_new <- rep(id(rev(res_index)), nrow(labels)) index <- (index_new - 1) * prod(in_dim) + index_old out_dim <- unname(c(in_dim, res_dim)) out_labels <- c(in_labels, res_labels) n <- prod(out_dim) if (length(index) < n) { overall <- match(1:n, index, nomatch = NA) } else { overall <- order(index) } out_array <- res[overall] dim(out_array) <- out_dim dimnames(out_array) <- out_labels if (.drop) reduce_dim(out_array) else out_array }
context("sampling") library(tidyverse) library(metasim) big <- runif(3, 5, 100) small <- runif(3, 0.1, 0.9) test_sample_norm <- sim_sample(10, 0, "norm", list(mean = 20, sd = 1)) test_sample_norm_another <- sim_sample(10, 0, "norm", list(mean = 104, sd = 0.3)) test_sample_pareto <- sim_sample(10, 0, "pareto", list(1, 2)) test_that("samples are plausible", { expect_is(test_sample_norm, "numeric") expect_lt(test_sample_norm %>% mean(), 50) expect_gt(test_sample_norm %>% mean(), 5) expect_lt(test_sample_norm %>% mean(), 22) expect_gt(test_sample_norm %>% mean(), 18) expect_is(test_sample_norm_another, "numeric") expect_lt(test_sample_norm_another %>% mean(), 200) expect_gt(test_sample_norm_another %>% mean(), 5) expect_lt(test_sample_norm_another %>% mean(), 106) expect_gt(test_sample_norm_another %>% mean(), 102) expect_is(test_sample_pareto, "numeric") expect_lt(test_sample_pareto %>% mean(), 100) expect_gt(test_sample_pareto %>% mean(), 0) # test the exponetial expect_is(sim_sample(rdist = "norm", par = list(mean = 437, sd = 0.7)), "numeric") expect_is(sim_sample(rdist = "exp", par = list(rate = 2)), "numeric") expect_is(sim_sample(rdist = "lnorm", par = list(meanlog = 49, sd = 0.2)), "numeric") expect_gt(sim_sample(rdist = "norm", par = list(mean = 437, sd = 0.7)) %>% length, 2) expect_gt(sim_sample(rdist = "exp", par = list(rate = 2)) %>% length, 2) expect_gt(sim_sample(rdist = "lnorm", par = list(meanlog = 49, sd = 0.2)) %>% length, 2) expect_gt(sim_sample(rdist = "norm", par = list(mean = 437, sd = 0.7)) %>% unique %>% length, 2) expect_gt(sim_sample(rdist = "exp", par = list(rate = 2)) %>% unique %>% length, 2) expect_gt(sim_sample(rdist = "lnorm", par = list(meanlog = 49, sd = 0.2)) %>% unique %>% length, 2) expect_is(sim_sample(rdist = "lnorm", par = list(meanlog = big[[1]], sd = small[1])), "numeric") expect_gt(sim_sample(rdist = "lnorm", par = list(meanlog = big[[1]], sd = small[1])) %>% length, 2) }) test_that("sim stats gives non-empty dataframe",{ expect_is(sim_stats(), "data.frame") expect_gt(sim_stats() %>% nrow(), 2) # test distributions # norm expect_is(sim_stats(rdist = "norm", par = list(mean = 57, sd = 0.2)), "data.frame") expect_gt(sim_stats(rdist = "norm", par = list(mean = 57, sd = 0.2)) %>% nrow(), 2) expect_is(sim_stats(rdist = "norm", par = list(mean = big[[1]], sd = small[[1]])), "data.frame") expect_gt(sim_stats(rdist = "norm", par = list(mean = big[[1]], sd = small[[1]])) %>% nrow(), 2) # lnorm expect_is(sim_stats(rdist = "lnorm", par = list(mean = 57, sd = 0.2)), "data.frame") expect_gt(sim_stats(rdist = "lnorm", par = list(mean = 57, sd = 0.2)) %>% nrow(), 2) expect_is(sim_stats(rdist = "lnorm", par = list(mean = big[[1]], sd = small[[1]])), "data.frame") expect_gt(sim_stats(rdist = "lnorm", par = list(mean = big[[1]], sd = small[[1]])) %>% nrow(), 2) # exp expect_is(sim_stats(rdist = "exp", par = list(rate = 3)), "data.frame") expect_gt(sim_stats(rdist = "exp", par = list(rate = 3)) %>% nrow(), 2) expect_is(sim_stats(rdist = "exp", par = list(rate = round(big[[1]]))), "data.frame") expect_gt(sim_stats(rdist = "exp", par = list(rate = round(big[[1]]))) %>% nrow(), 2) # pareto expect_is(sim_stats(rdist = "pareto", par = list(shape = 3, scale = 2)), "data.frame") expect_gt(sim_stats(rdist = "pareto", par = list(shape = 3, scale = 2)) %>% nrow(), 2) })
/tests/testthat/test-sampling.R
no_license
kylehamilton/metasim
R
false
false
3,679
r
context("sampling") library(tidyverse) library(metasim) big <- runif(3, 5, 100) small <- runif(3, 0.1, 0.9) test_sample_norm <- sim_sample(10, 0, "norm", list(mean = 20, sd = 1)) test_sample_norm_another <- sim_sample(10, 0, "norm", list(mean = 104, sd = 0.3)) test_sample_pareto <- sim_sample(10, 0, "pareto", list(1, 2)) test_that("samples are plausible", { expect_is(test_sample_norm, "numeric") expect_lt(test_sample_norm %>% mean(), 50) expect_gt(test_sample_norm %>% mean(), 5) expect_lt(test_sample_norm %>% mean(), 22) expect_gt(test_sample_norm %>% mean(), 18) expect_is(test_sample_norm_another, "numeric") expect_lt(test_sample_norm_another %>% mean(), 200) expect_gt(test_sample_norm_another %>% mean(), 5) expect_lt(test_sample_norm_another %>% mean(), 106) expect_gt(test_sample_norm_another %>% mean(), 102) expect_is(test_sample_pareto, "numeric") expect_lt(test_sample_pareto %>% mean(), 100) expect_gt(test_sample_pareto %>% mean(), 0) # test the exponetial expect_is(sim_sample(rdist = "norm", par = list(mean = 437, sd = 0.7)), "numeric") expect_is(sim_sample(rdist = "exp", par = list(rate = 2)), "numeric") expect_is(sim_sample(rdist = "lnorm", par = list(meanlog = 49, sd = 0.2)), "numeric") expect_gt(sim_sample(rdist = "norm", par = list(mean = 437, sd = 0.7)) %>% length, 2) expect_gt(sim_sample(rdist = "exp", par = list(rate = 2)) %>% length, 2) expect_gt(sim_sample(rdist = "lnorm", par = list(meanlog = 49, sd = 0.2)) %>% length, 2) expect_gt(sim_sample(rdist = "norm", par = list(mean = 437, sd = 0.7)) %>% unique %>% length, 2) expect_gt(sim_sample(rdist = "exp", par = list(rate = 2)) %>% unique %>% length, 2) expect_gt(sim_sample(rdist = "lnorm", par = list(meanlog = 49, sd = 0.2)) %>% unique %>% length, 2) expect_is(sim_sample(rdist = "lnorm", par = list(meanlog = big[[1]], sd = small[1])), "numeric") expect_gt(sim_sample(rdist = "lnorm", par = list(meanlog = big[[1]], sd = small[1])) %>% length, 2) }) test_that("sim stats gives non-empty dataframe",{ expect_is(sim_stats(), "data.frame") expect_gt(sim_stats() %>% nrow(), 2) # test distributions # norm expect_is(sim_stats(rdist = "norm", par = list(mean = 57, sd = 0.2)), "data.frame") expect_gt(sim_stats(rdist = "norm", par = list(mean = 57, sd = 0.2)) %>% nrow(), 2) expect_is(sim_stats(rdist = "norm", par = list(mean = big[[1]], sd = small[[1]])), "data.frame") expect_gt(sim_stats(rdist = "norm", par = list(mean = big[[1]], sd = small[[1]])) %>% nrow(), 2) # lnorm expect_is(sim_stats(rdist = "lnorm", par = list(mean = 57, sd = 0.2)), "data.frame") expect_gt(sim_stats(rdist = "lnorm", par = list(mean = 57, sd = 0.2)) %>% nrow(), 2) expect_is(sim_stats(rdist = "lnorm", par = list(mean = big[[1]], sd = small[[1]])), "data.frame") expect_gt(sim_stats(rdist = "lnorm", par = list(mean = big[[1]], sd = small[[1]])) %>% nrow(), 2) # exp expect_is(sim_stats(rdist = "exp", par = list(rate = 3)), "data.frame") expect_gt(sim_stats(rdist = "exp", par = list(rate = 3)) %>% nrow(), 2) expect_is(sim_stats(rdist = "exp", par = list(rate = round(big[[1]]))), "data.frame") expect_gt(sim_stats(rdist = "exp", par = list(rate = round(big[[1]]))) %>% nrow(), 2) # pareto expect_is(sim_stats(rdist = "pareto", par = list(shape = 3, scale = 2)), "data.frame") expect_gt(sim_stats(rdist = "pareto", par = list(shape = 3, scale = 2)) %>% nrow(), 2) })
library(QCSimulator) ### Name: CNOT4_03 ### Title: 4 qubit CNOT gate (control-0,target-3) ### Aliases: CNOT4_03 ### ** Examples # Initialze global variables init() CNOT4_03(q1001_) CNOT4_03(I16)
/data/genthat_extracted_code/QCSimulator/examples/CNOT4_03.Rd.R
no_license
surayaaramli/typeRrh
R
false
false
203
r
library(QCSimulator) ### Name: CNOT4_03 ### Title: 4 qubit CNOT gate (control-0,target-3) ### Aliases: CNOT4_03 ### ** Examples # Initialze global variables init() CNOT4_03(q1001_) CNOT4_03(I16)
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/model_predict.R \name{h2o_predict_binary} \alias{h2o_predict_binary} \title{H2O Predict using Binary file} \usage{ h2o_predict_binary(df, model_path, sample = NA) } \arguments{ \item{df}{Dataframe. Data to insert into the model.} \item{model_path}{Character. Relative model path directory or zip file.} \item{sample}{Integer. How many rows should the function predict?} } \value{ vector with predicted results. } \description{ This function lets the user predict using the h2o binary file. Note that it works with the files generated when using the function export_results(). Recommendation: use the h2o_predict_MOJO() function when possible - it let's you change h2o's version without problem. } \seealso{ Other Machine Learning: \code{\link{ROC}()}, \code{\link{conf_mat}()}, \code{\link{export_results}()}, \code{\link{gain_lift}()}, \code{\link{h2o_automl}()}, \code{\link{h2o_predict_API}()}, \code{\link{h2o_predict_MOJO}()}, \code{\link{h2o_predict_model}()}, \code{\link{h2o_selectmodel}()}, \code{\link{impute}()}, \code{\link{iter_seeds}()}, \code{\link{lasso_vars}()}, \code{\link{model_metrics}()}, \code{\link{model_preprocess}()}, \code{\link{msplit}()} Other H2O: \code{\link{h2o_predict_API}()}, \code{\link{h2o_predict_MOJO}()}, \code{\link{h2o_predict_model}()} } \concept{H2O} \concept{Machine Learning}
/man/h2o_predict_binary.Rd
no_license
laresbernardo/lares
R
false
true
1,406
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/model_predict.R \name{h2o_predict_binary} \alias{h2o_predict_binary} \title{H2O Predict using Binary file} \usage{ h2o_predict_binary(df, model_path, sample = NA) } \arguments{ \item{df}{Dataframe. Data to insert into the model.} \item{model_path}{Character. Relative model path directory or zip file.} \item{sample}{Integer. How many rows should the function predict?} } \value{ vector with predicted results. } \description{ This function lets the user predict using the h2o binary file. Note that it works with the files generated when using the function export_results(). Recommendation: use the h2o_predict_MOJO() function when possible - it let's you change h2o's version without problem. } \seealso{ Other Machine Learning: \code{\link{ROC}()}, \code{\link{conf_mat}()}, \code{\link{export_results}()}, \code{\link{gain_lift}()}, \code{\link{h2o_automl}()}, \code{\link{h2o_predict_API}()}, \code{\link{h2o_predict_MOJO}()}, \code{\link{h2o_predict_model}()}, \code{\link{h2o_selectmodel}()}, \code{\link{impute}()}, \code{\link{iter_seeds}()}, \code{\link{lasso_vars}()}, \code{\link{model_metrics}()}, \code{\link{model_preprocess}()}, \code{\link{msplit}()} Other H2O: \code{\link{h2o_predict_API}()}, \code{\link{h2o_predict_MOJO}()}, \code{\link{h2o_predict_model}()} } \concept{H2O} \concept{Machine Learning}
#' Liver protein expression dataset #' #' Data for mediation analysis of liver protein expression. #' Dataset is a list of objects for target, mediator, annotation, covar (covariates), #' qtl.geno. #' There are 192 diversity outbred mice and 8050 genes with measured mRNA expression. #' The 'target' is the level of expression of gene 'Tmem68'. #' The mRNA transcript expression is measured for 8050 genes in 'mediator'. #' The 'annotation' has positional information for each of the genes. #' The 'covar' has Sex and Diet information for the 192 mice. #' The 'driver' object has the driver as allele probabilities for the 8 founder genotypes for the 192 mice #' at the location of the Tmem68 gene. #' #' @docType data #' #' @usage data(Tmem68) #' #' @format An object of class \code{"cross"}; see \code{\link[qtl]{read.cross}}. #' #' @keywords datasets #' #' @references Chick et al. (2016) #' (\href{https://dx.org/10.1038/nature18270}{Nature 534: 500-505}) #' #' @source \href{https://github.com/churchill-lab/intermediate}{Churchill GitHub} #' #' @examples #' data(Tmem68) #' str(Tmem68) "Tmem68"
/R/Tmem68.R
no_license
byandell/Tmem68
R
false
false
1,102
r
#' Liver protein expression dataset #' #' Data for mediation analysis of liver protein expression. #' Dataset is a list of objects for target, mediator, annotation, covar (covariates), #' qtl.geno. #' There are 192 diversity outbred mice and 8050 genes with measured mRNA expression. #' The 'target' is the level of expression of gene 'Tmem68'. #' The mRNA transcript expression is measured for 8050 genes in 'mediator'. #' The 'annotation' has positional information for each of the genes. #' The 'covar' has Sex and Diet information for the 192 mice. #' The 'driver' object has the driver as allele probabilities for the 8 founder genotypes for the 192 mice #' at the location of the Tmem68 gene. #' #' @docType data #' #' @usage data(Tmem68) #' #' @format An object of class \code{"cross"}; see \code{\link[qtl]{read.cross}}. #' #' @keywords datasets #' #' @references Chick et al. (2016) #' (\href{https://dx.org/10.1038/nature18270}{Nature 534: 500-505}) #' #' @source \href{https://github.com/churchill-lab/intermediate}{Churchill GitHub} #' #' @examples #' data(Tmem68) #' str(Tmem68) "Tmem68"
library(assertthat) library(dplyr) library(readxl) library(stringr) library(tibble) library(tidyr) ## 出典 data source : 総務省 ## 【総計】平成30年住民基本台帳人口・世帯数、平成29年人口動態(市区町村別) ## https://www.soumu.go.jp/menu_news/s-news/01gyosei02_02000177.html ## https://www.soumu.go.jp/main_content/000563140.xls ## から抜粋 ## 神奈川県の政令指定都市の人口を取り出す in_filename <- 'city/incoming/000563140.xls' all_df <- readxl::read_excel(in_filename) all_df <- all_df[5:NROW(all_df), c(2,3,6)] names(all_df) <- c('pref', 'city_ward', 'population') all_df <- as_tibble(all_df) all_df$population <- as.integer(all_df$population) kanagawa_df <- all_df %>% dplyr::filter(pref=='神奈川県') city_df <- kanagawa_df[!is.na(kanagawa_df$city_ward %>% stringr::str_extract('^.+市.+区$')),] %>% tidyr::separate('city_ward', into=c('city', 'ward'), sep='市') %>% dplyr::mutate(city=paste0(city, '市')) ## 横浜市、川崎市、相模原市の人口 expected <- c(3737845, 1488031, 718192) ## 列名をべた書きする(シンボル) actual <- city_df %>% dplyr::select(-ward) %>% dplyr::group_by(pref, city) %>% dplyr::summarize_each(list(sum)) %>% ungroup() assertthat::assert_that(assertthat::are_equal(expected, actual$population)) summary_df <- actual ## selectに文字列リテラルを渡す actual <- city_df %>% dplyr::select(-'ward') %>% dplyr::group_by(pref, city) %>% dplyr::summarize_each(list(sum)) %>% ungroup() assertthat::assert_that(assertthat::are_equal(expected, actual$population)) ## selectに文字列変数を渡す。これができないとハードコーディングだらけで辛い。 name <- 'ward' actual <- city_df %>% dplyr::select(-(!!name)) %>% dplyr::group_by(pref, city) %>% dplyr::summarize_each(list(sum)) %>% ungroup() assertthat::assert_that(assertthat::are_equal(expected, actual$population)) name_set <- c('pref', 'ward') actual <- city_df %>% dplyr::select(-(!!(name_set))) %>% dplyr::group_by(city) %>% dplyr::summarize_each(list(sum)) %>% ungroup() assertthat::assert_that(assertthat::are_equal(expected, actual$population)) ## group_byに文字列変数を渡す。これができないとハードコーディングだらけで辛い。 name <- c('city') actual <- city_df %>% dplyr::select(-c('pref', 'ward')) %>% dplyr::group_by(!!(rlang::sym(name))) %>% dplyr::summarize_each(list(sum)) %>% ungroup() assertthat::assert_that(assertthat::are_equal(expected, actual$population)) name_set <- c('pref', 'city') actual <- city_df %>% dplyr::select(-'ward') %>% dplyr::group_by(!!!(rlang::syms(name_set))) %>% dplyr::summarize_each(list(sum)) %>% ungroup() assertthat::assert_that(assertthat::are_equal(expected, actual$population)) ## mutate先の列名をべた書きする(シンボル) actual <- summary_df %>% dplyr::mutate(n=population) assertthat::assert_that(assertthat::are_equal(expected, actual$population)) ## mutate先の列名として文字列変数を渡す。これができないとハードコーディングだらけで辛い。 name <- c('n') actual <- summary_df %>% dplyr::mutate(!!(name):=population) assertthat::assert_that(assertthat::are_equal(expected, actual$n)) x_name <- c('population') y_name <- c('y') actual <- summary_df %>% dplyr::mutate(!!(y_name):=!!(rlang::sym(x_name))) assertthat::assert_that(assertthat::are_equal(expected, actual$y)) ## 指定した列から特定の要素を抜き出す pattern <- '横浜市.+区' n_wards <- 18 ## 列名をハードコーディングする actual <- na.omit(kanagawa_df$city_ward %>% str_extract(pattern)) assertthat::assert_that(n_wards == NROW(actual)) actual <- na.omit(kanagawa_df[['city_ward']] %>% str_extract(pattern)) assertthat::assert_that(n_wards == NROW(actual)) name <- 'city_ward' actual <- na.omit(kanagawa_df[[name]] %>% str_extract(pattern)) assertthat::assert_that(n_wards == NROW(actual))
/scripts/stock_price/variable_column_name.R
permissive
zettsu-t/cPlusPlusFriend
R
false
false
4,127
r
library(assertthat) library(dplyr) library(readxl) library(stringr) library(tibble) library(tidyr) ## 出典 data source : 総務省 ## 【総計】平成30年住民基本台帳人口・世帯数、平成29年人口動態(市区町村別) ## https://www.soumu.go.jp/menu_news/s-news/01gyosei02_02000177.html ## https://www.soumu.go.jp/main_content/000563140.xls ## から抜粋 ## 神奈川県の政令指定都市の人口を取り出す in_filename <- 'city/incoming/000563140.xls' all_df <- readxl::read_excel(in_filename) all_df <- all_df[5:NROW(all_df), c(2,3,6)] names(all_df) <- c('pref', 'city_ward', 'population') all_df <- as_tibble(all_df) all_df$population <- as.integer(all_df$population) kanagawa_df <- all_df %>% dplyr::filter(pref=='神奈川県') city_df <- kanagawa_df[!is.na(kanagawa_df$city_ward %>% stringr::str_extract('^.+市.+区$')),] %>% tidyr::separate('city_ward', into=c('city', 'ward'), sep='市') %>% dplyr::mutate(city=paste0(city, '市')) ## 横浜市、川崎市、相模原市の人口 expected <- c(3737845, 1488031, 718192) ## 列名をべた書きする(シンボル) actual <- city_df %>% dplyr::select(-ward) %>% dplyr::group_by(pref, city) %>% dplyr::summarize_each(list(sum)) %>% ungroup() assertthat::assert_that(assertthat::are_equal(expected, actual$population)) summary_df <- actual ## selectに文字列リテラルを渡す actual <- city_df %>% dplyr::select(-'ward') %>% dplyr::group_by(pref, city) %>% dplyr::summarize_each(list(sum)) %>% ungroup() assertthat::assert_that(assertthat::are_equal(expected, actual$population)) ## selectに文字列変数を渡す。これができないとハードコーディングだらけで辛い。 name <- 'ward' actual <- city_df %>% dplyr::select(-(!!name)) %>% dplyr::group_by(pref, city) %>% dplyr::summarize_each(list(sum)) %>% ungroup() assertthat::assert_that(assertthat::are_equal(expected, actual$population)) name_set <- c('pref', 'ward') actual <- city_df %>% dplyr::select(-(!!(name_set))) %>% dplyr::group_by(city) %>% dplyr::summarize_each(list(sum)) %>% ungroup() assertthat::assert_that(assertthat::are_equal(expected, actual$population)) ## group_byに文字列変数を渡す。これができないとハードコーディングだらけで辛い。 name <- c('city') actual <- city_df %>% dplyr::select(-c('pref', 'ward')) %>% dplyr::group_by(!!(rlang::sym(name))) %>% dplyr::summarize_each(list(sum)) %>% ungroup() assertthat::assert_that(assertthat::are_equal(expected, actual$population)) name_set <- c('pref', 'city') actual <- city_df %>% dplyr::select(-'ward') %>% dplyr::group_by(!!!(rlang::syms(name_set))) %>% dplyr::summarize_each(list(sum)) %>% ungroup() assertthat::assert_that(assertthat::are_equal(expected, actual$population)) ## mutate先の列名をべた書きする(シンボル) actual <- summary_df %>% dplyr::mutate(n=population) assertthat::assert_that(assertthat::are_equal(expected, actual$population)) ## mutate先の列名として文字列変数を渡す。これができないとハードコーディングだらけで辛い。 name <- c('n') actual <- summary_df %>% dplyr::mutate(!!(name):=population) assertthat::assert_that(assertthat::are_equal(expected, actual$n)) x_name <- c('population') y_name <- c('y') actual <- summary_df %>% dplyr::mutate(!!(y_name):=!!(rlang::sym(x_name))) assertthat::assert_that(assertthat::are_equal(expected, actual$y)) ## 指定した列から特定の要素を抜き出す pattern <- '横浜市.+区' n_wards <- 18 ## 列名をハードコーディングする actual <- na.omit(kanagawa_df$city_ward %>% str_extract(pattern)) assertthat::assert_that(n_wards == NROW(actual)) actual <- na.omit(kanagawa_df[['city_ward']] %>% str_extract(pattern)) assertthat::assert_that(n_wards == NROW(actual)) name <- 'city_ward' actual <- na.omit(kanagawa_df[[name]] %>% str_extract(pattern)) assertthat::assert_that(n_wards == NROW(actual))
library(dplyr) library(shiny) library(leaflet) load('app.rdata') ui <- bootstrapPage( tags$style(type = "text/css", "html, body {width:100%;height:100%}"), leafletOutput("map", width = "100%", height = "100%"), # slider panel absolutePanel( id = 'controls', class = 'panel panel-default', fixed = T, height = 'auto', top=50, right = 50, left = 'auto', bottom = 'auto', width = 'auto', draggable = T, selectInput('map', "Map Type", choices = c( "CartoDB.Positron", "Esri.WorldImagery"), selected = "CartoDB.Positron"), sliderInput( "range", "year Range", min=min(df$year), max = max(df$year), value = range(df$year), step=1 ) ) ) # SHiny server server <- function(input, output, session) { filteredData <- reactive({ df[df$year >= input$range[1] & df$year <= input$range[2],] }) # Map output output$map <- renderLeaflet({ leaflet(df) %>% fitBounds(~min(longitude), ~min(latitude), ~max(longitude), ~max(latitude)) %>% addProviderTiles(input$map) }) # plot points on the map observe({ leafletProxy("map", data = filteredData()) %>% clearShapes() %>% clearPopups() %>% clearMarkers() %>% clearMarkerClusters() %>% addCircleMarkers(lng=~longitude, lat=~latitude, popup = ~paste(paste("<h3>", filteredData()$conflict_name, "</h3>"), paste("<b>Side A:</b>", side_a, "<br>", "<b>Side B:</b>", side_b, "<br>", "<b>Date:</b>", paste(date_start, date_end, sep = " - "), '<br>', "<b>Casualties:</b>", best , sep = " ")), clusterOptions = markerClusterOptions()) }) } # Run the application shinyApp(ui = ui, server = server)
/app.R
no_license
MikeKozelMSU/final
R
false
false
1,950
r
library(dplyr) library(shiny) library(leaflet) load('app.rdata') ui <- bootstrapPage( tags$style(type = "text/css", "html, body {width:100%;height:100%}"), leafletOutput("map", width = "100%", height = "100%"), # slider panel absolutePanel( id = 'controls', class = 'panel panel-default', fixed = T, height = 'auto', top=50, right = 50, left = 'auto', bottom = 'auto', width = 'auto', draggable = T, selectInput('map', "Map Type", choices = c( "CartoDB.Positron", "Esri.WorldImagery"), selected = "CartoDB.Positron"), sliderInput( "range", "year Range", min=min(df$year), max = max(df$year), value = range(df$year), step=1 ) ) ) # SHiny server server <- function(input, output, session) { filteredData <- reactive({ df[df$year >= input$range[1] & df$year <= input$range[2],] }) # Map output output$map <- renderLeaflet({ leaflet(df) %>% fitBounds(~min(longitude), ~min(latitude), ~max(longitude), ~max(latitude)) %>% addProviderTiles(input$map) }) # plot points on the map observe({ leafletProxy("map", data = filteredData()) %>% clearShapes() %>% clearPopups() %>% clearMarkers() %>% clearMarkerClusters() %>% addCircleMarkers(lng=~longitude, lat=~latitude, popup = ~paste(paste("<h3>", filteredData()$conflict_name, "</h3>"), paste("<b>Side A:</b>", side_a, "<br>", "<b>Side B:</b>", side_b, "<br>", "<b>Date:</b>", paste(date_start, date_end, sep = " - "), '<br>', "<b>Casualties:</b>", best , sep = " ")), clusterOptions = markerClusterOptions()) }) } # Run the application shinyApp(ui = ui, server = server)
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/adonis_pairwise.R \name{adonis_pairwise} \alias{adonis_pairwise} \title{Pairwise comparisons for permutational multivariate analysis of variance using distance matrices} \usage{ adonis_pairwise( x, dd, group.var, add_permdisp = TRUE, permut = 999, p.adj = "fdr", all_results = T, comparison_sep = ".", permdisp_type = "median", ... ) } \arguments{ \item{x}{Sample meta-data (data frame for the independent variables)} \item{dd}{Dissimilarity matrix between samples} \item{group.var}{Name of the independent variable to test (RHS in adonis formula)} \item{add_permdisp}{Logical; if TRUE (default), results of tests for homogeneity of multivariate dispersions will be added to output (see \code{\link[vegan]{betadisper}})} \item{permut}{Number of permutations required} \item{p.adj}{Logical or character; if TRUE, adjust P-values for multiple comparisons with FDR; if character, specify correction method from \code{\link{p.adjust}} ("holm", "hochberg", "hommel", "bonferroni", "BH", "BY", "fdr", or "none")} \item{all_results}{Logical, return results of adonis and data subsets for each pairwise comparison} \item{comparison_sep}{Character string to separate the levels of independent variable the in the pairwise comparison names (default, ".")} \item{permdisp_type}{Use the spatial median (default) or the group centroid for the analysis for homogeneity of multivariate dispersions (see \code{\link[vegan]{betadisper}})} \item{...}{Additional arguments will be passed to \code{\link[vegan]{adonis}} and \code{\link[vegan]{permutest}}} } \value{ List with adinonis and betadisper results. } \description{ Pairwise comparisons for permutational multivariate analysis of variance using distance matrices } \examples{ library(vegan) data(dune) data(dune.env) # Compare all Management levels adonis2(dune ~ Management, data = dune.env) # Pairwise comparisons between Management levels tst <- adonis_pairwise(x = dune.env, dd = vegdist(dune), group.var = "Management") tst$Adonis.tab tst$Betadisper.tab } \seealso{ \code{\link[vegan]{adonis}}, \code{\link[vegan]{betadisper}} }
/man/adonis_pairwise.Rd
permissive
vmikk/metagMisc
R
false
true
2,183
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/adonis_pairwise.R \name{adonis_pairwise} \alias{adonis_pairwise} \title{Pairwise comparisons for permutational multivariate analysis of variance using distance matrices} \usage{ adonis_pairwise( x, dd, group.var, add_permdisp = TRUE, permut = 999, p.adj = "fdr", all_results = T, comparison_sep = ".", permdisp_type = "median", ... ) } \arguments{ \item{x}{Sample meta-data (data frame for the independent variables)} \item{dd}{Dissimilarity matrix between samples} \item{group.var}{Name of the independent variable to test (RHS in adonis formula)} \item{add_permdisp}{Logical; if TRUE (default), results of tests for homogeneity of multivariate dispersions will be added to output (see \code{\link[vegan]{betadisper}})} \item{permut}{Number of permutations required} \item{p.adj}{Logical or character; if TRUE, adjust P-values for multiple comparisons with FDR; if character, specify correction method from \code{\link{p.adjust}} ("holm", "hochberg", "hommel", "bonferroni", "BH", "BY", "fdr", or "none")} \item{all_results}{Logical, return results of adonis and data subsets for each pairwise comparison} \item{comparison_sep}{Character string to separate the levels of independent variable the in the pairwise comparison names (default, ".")} \item{permdisp_type}{Use the spatial median (default) or the group centroid for the analysis for homogeneity of multivariate dispersions (see \code{\link[vegan]{betadisper}})} \item{...}{Additional arguments will be passed to \code{\link[vegan]{adonis}} and \code{\link[vegan]{permutest}}} } \value{ List with adinonis and betadisper results. } \description{ Pairwise comparisons for permutational multivariate analysis of variance using distance matrices } \examples{ library(vegan) data(dune) data(dune.env) # Compare all Management levels adonis2(dune ~ Management, data = dune.env) # Pairwise comparisons between Management levels tst <- adonis_pairwise(x = dune.env, dd = vegdist(dune), group.var = "Management") tst$Adonis.tab tst$Betadisper.tab } \seealso{ \code{\link[vegan]{adonis}}, \code{\link[vegan]{betadisper}} }
library(shiny) library(timevis) library(plotly) library(RColorBrewer) library(leaflet) library(visNetwork) library(rsconnect) data<- data.frame( id = 1:11, content = c("Ecole Spéciale des Travaux Publics<br>du Bâtiment et de l'Industrie - Paris" ,"Stage et vacation au<br>bureau du Patrimoine Immobilier<br>CNRS","Stage en<br>conduite de travaux<br>Vinci Construction","Stage Correspondante<br>Systèmes d'information<br>Bouygues Construction", "<b>Ingénieur d'études - BONNA SABLA</b>" , "Fondation Louis Vuitton","Chantier Ligne à Grande Vitesse SEA","<b>Responsable bureau d'études - BONNA SABLA</b>","Mise en place<br>du BIM en interne", "Projet de<br>standardisation<br>des produits<br>Bonna Sabla","<b>Certificat<br>Data Scientist<br>CEPE Formation<br>continue<br>ENSAE ENSAI</b>"), start = c( "2006-09-01", "2007-03-01" , "2008-07-01" ,"2009-06-01", "2009-09-01", "2010-02-01","2012-03-01","2014-01-01", "2015-07-01" ,"2017-03-01" , "2021-03-22"), end = c( "2009-08-01", NA , NA, NA, "2013-12-31", NA,NA, "2021-05-01", NA,NA, NA), group = c(3, 2,2,2,2, 1, 1,2,1,1,3), style=(c("background-color: #A8DDB5;","background-color:#7BCCC4;","background-color:#7BCCC4;","background-color:#7BCCC4;","background-color:#08589E;","","","background-color:#08589E;","","","background-color: #A8DDB5;")) ) groupes = data.frame(id = 1:3, content = c("Projets", "Experience<br>professionnelle","Formation")) systeme_expl<-c("Windows","MacOS","Ubuntu") progr<-c("R","Python","VBA") packagesRutilisés<-c("shiny","ggplot2","caret","tidymodel","dplyr","officeR") datascience<-c("Text mining","Graph mining","Webscraping","Visualisation","Machine learning","Deep learning","Application interactive") fig<-data.frame(labels = c("Systèmes<br>d'exploitation","Langages<br>de programmation","Data science","Compétences<br>générales","Soft<br>skills","Windows","MacOS","Ubuntu","R","Python","VBA","Text mining","Graph mining","Webscraping","Visualisation","Machine<br>learning","Deep<br>learning","Application<br>interactive","Gestion<br>de projets","Management","Communication orale<br>et écrite","Rigueur","Motivation","Organisation","Efficacité"), parents = c("","","","","","Systèmes<br>d'exploitation","Systèmes<br>d'exploitation","Systèmes<br>d'exploitation","Langages<br>de programmation","Langages<br>de programmation","Langages<br>de programmation","Data science","Data science","Data science","Data science","Data science","Data science","Data science","Compétences<br>générales","Compétences<br>générales","Compétences<br>générales","Soft<br>skills","Soft<br>skills","Soft<br>skills","Soft<br>skills"), colors = c("#A8DDB5","#7BCCC4","#4EB3D3","#2B8CBE","#08589E")) nodes <- data.frame(id=c(1:17), label=c("python","R","panda","numpy","matplotlib","Pandas","scikit-learn","nltk","textBlob","plotly","leaflet","tidymodel","ggplot2","caret","dplyr","shiny","officeR" ), shape=c("diamond","diamond","star","star","star","star","star","star","star","star","star","star","star","star","star","star","star"), color = c("#08589E", "#2B8CBE", "#7BCCC4", "#7BCCC4", "#7BCCC4","#7BCCC4", "#7BCCC4", "#7BCCC4","#7BCCC4", "#7BCCC4", "#7BCCC4","#7BCCC4", "#7BCCC4", "#7BCCC4","#7BCCC4", "#7BCCC4", "#7BCCC4"), shadow = c(TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE) ) edges <- data.frame(from=c(1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2 ,2 ,2, 2), to=c(3,4, 5 , 6, 7, 8, 9, 10, 11, 12, 13, 11, 10, 14, 15 ,16, 17))
/global.R
no_license
agnes-me/AppliCV
R
false
false
3,821
r
library(shiny) library(timevis) library(plotly) library(RColorBrewer) library(leaflet) library(visNetwork) library(rsconnect) data<- data.frame( id = 1:11, content = c("Ecole Spéciale des Travaux Publics<br>du Bâtiment et de l'Industrie - Paris" ,"Stage et vacation au<br>bureau du Patrimoine Immobilier<br>CNRS","Stage en<br>conduite de travaux<br>Vinci Construction","Stage Correspondante<br>Systèmes d'information<br>Bouygues Construction", "<b>Ingénieur d'études - BONNA SABLA</b>" , "Fondation Louis Vuitton","Chantier Ligne à Grande Vitesse SEA","<b>Responsable bureau d'études - BONNA SABLA</b>","Mise en place<br>du BIM en interne", "Projet de<br>standardisation<br>des produits<br>Bonna Sabla","<b>Certificat<br>Data Scientist<br>CEPE Formation<br>continue<br>ENSAE ENSAI</b>"), start = c( "2006-09-01", "2007-03-01" , "2008-07-01" ,"2009-06-01", "2009-09-01", "2010-02-01","2012-03-01","2014-01-01", "2015-07-01" ,"2017-03-01" , "2021-03-22"), end = c( "2009-08-01", NA , NA, NA, "2013-12-31", NA,NA, "2021-05-01", NA,NA, NA), group = c(3, 2,2,2,2, 1, 1,2,1,1,3), style=(c("background-color: #A8DDB5;","background-color:#7BCCC4;","background-color:#7BCCC4;","background-color:#7BCCC4;","background-color:#08589E;","","","background-color:#08589E;","","","background-color: #A8DDB5;")) ) groupes = data.frame(id = 1:3, content = c("Projets", "Experience<br>professionnelle","Formation")) systeme_expl<-c("Windows","MacOS","Ubuntu") progr<-c("R","Python","VBA") packagesRutilisés<-c("shiny","ggplot2","caret","tidymodel","dplyr","officeR") datascience<-c("Text mining","Graph mining","Webscraping","Visualisation","Machine learning","Deep learning","Application interactive") fig<-data.frame(labels = c("Systèmes<br>d'exploitation","Langages<br>de programmation","Data science","Compétences<br>générales","Soft<br>skills","Windows","MacOS","Ubuntu","R","Python","VBA","Text mining","Graph mining","Webscraping","Visualisation","Machine<br>learning","Deep<br>learning","Application<br>interactive","Gestion<br>de projets","Management","Communication orale<br>et écrite","Rigueur","Motivation","Organisation","Efficacité"), parents = c("","","","","","Systèmes<br>d'exploitation","Systèmes<br>d'exploitation","Systèmes<br>d'exploitation","Langages<br>de programmation","Langages<br>de programmation","Langages<br>de programmation","Data science","Data science","Data science","Data science","Data science","Data science","Data science","Compétences<br>générales","Compétences<br>générales","Compétences<br>générales","Soft<br>skills","Soft<br>skills","Soft<br>skills","Soft<br>skills"), colors = c("#A8DDB5","#7BCCC4","#4EB3D3","#2B8CBE","#08589E")) nodes <- data.frame(id=c(1:17), label=c("python","R","panda","numpy","matplotlib","Pandas","scikit-learn","nltk","textBlob","plotly","leaflet","tidymodel","ggplot2","caret","dplyr","shiny","officeR" ), shape=c("diamond","diamond","star","star","star","star","star","star","star","star","star","star","star","star","star","star","star"), color = c("#08589E", "#2B8CBE", "#7BCCC4", "#7BCCC4", "#7BCCC4","#7BCCC4", "#7BCCC4", "#7BCCC4","#7BCCC4", "#7BCCC4", "#7BCCC4","#7BCCC4", "#7BCCC4", "#7BCCC4","#7BCCC4", "#7BCCC4", "#7BCCC4"), shadow = c(TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE,TRUE) ) edges <- data.frame(from=c(1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2 ,2 ,2, 2), to=c(3,4, 5 , 6, 7, 8, 9, 10, 11, 12, 13, 11, 10, 14, 15 ,16, 17))
url <- paste("https://api.tfl.gov.uk/Journey/JourneyResults/", start_lat, ",", start_lon, "/to/", end_lat, ",", end_lon, "?time=1000&journeyPreference=LeastTime&mode=tube&app_id=", tfl_app_id, "&app_key=", tfl_app_key ,sep="") json_data <- fromJSON(RCurl::getURL(url), simplify = FALSE) if (json_data$`$type` == 'Tfl.Api.Presentation.Entities.JourneyPlanner.ItineraryResult, Tfl.Api.Presentation.Entities') { temp_results_frame <- data.frame(unique_id = numeric(), lat = numeric(), lon = numeric(), mode = character(), line = character(), stringsAsFactors = FALSE) for (r in 1:length(json_data$journeys[[1]]$legs)) { line <- json_data$journeys[[1]]$legs[[r]]$routeOptions[[1]]$name linestring <- json_data$journeys[[1]]$legs[[r]]$path$lineString linestring <- gsub(" ", "", linestring, fixed=TRUE) linestring <- gsub("[", "", linestring, fixed = TRUE) linestring <- gsub("]", "", linestring, fixed = TRUE) linestring <- unlist(strsplit(linestring, split = ",")) per_leg_results <- data.frame(unique_id = numeric(), lat = numeric(), lon = numeric(), mode = character(), line = character(), stringsAsFactors = FALSE) l <- 2 m <- 1 for (k in 1:(length(linestring)/2)){ per_leg_results[k,] <- c(as.numeric(i), as.numeric(linestring[m]), as.numeric(linestring[l]), mode, line) l <- l+2 m <- m+2 } temp_results_frame <- rbindlist(list(temp_results_frame, per_leg_results), use.names=TRUE) rm(per_leg_results) temp_results_frame$unique_id <- as.numeric(temp_results_frame$unique_id) temp_results_frame$lat <- as.numeric(temp_results_frame$lat) temp_results_frame$lon <- as.numeric(temp_results_frame$lon) } temp_results_frame[temp_results_frame$line == "","line"] <- NA temp_results_frame$line <- fill_missing_info(temp_results_frame$line) results <- rbindlist(list(results, temp_results_frame), use.names=TRUE) print(paste("At", Sys.time(), "routing unique journey id", i, "was completed using TfL tube mode")) rm(temp_results_frame, k, l, m, r, line, linestring, url, json_data) unique_journeys[i,]$status <- 'tfl' } else { print(paste("At", Sys.time(), "routing unique journey id", i, "was NOT completed using TfL tube mode, the error id will be logged")) error_ids[j,] <- i j <- j+1 } rm(tfl_app_id, tfl_app_key)
/routing/tube_routing.R
permissive
JimShady/one-person-simple-lhem
R
false
false
2,747
r
url <- paste("https://api.tfl.gov.uk/Journey/JourneyResults/", start_lat, ",", start_lon, "/to/", end_lat, ",", end_lon, "?time=1000&journeyPreference=LeastTime&mode=tube&app_id=", tfl_app_id, "&app_key=", tfl_app_key ,sep="") json_data <- fromJSON(RCurl::getURL(url), simplify = FALSE) if (json_data$`$type` == 'Tfl.Api.Presentation.Entities.JourneyPlanner.ItineraryResult, Tfl.Api.Presentation.Entities') { temp_results_frame <- data.frame(unique_id = numeric(), lat = numeric(), lon = numeric(), mode = character(), line = character(), stringsAsFactors = FALSE) for (r in 1:length(json_data$journeys[[1]]$legs)) { line <- json_data$journeys[[1]]$legs[[r]]$routeOptions[[1]]$name linestring <- json_data$journeys[[1]]$legs[[r]]$path$lineString linestring <- gsub(" ", "", linestring, fixed=TRUE) linestring <- gsub("[", "", linestring, fixed = TRUE) linestring <- gsub("]", "", linestring, fixed = TRUE) linestring <- unlist(strsplit(linestring, split = ",")) per_leg_results <- data.frame(unique_id = numeric(), lat = numeric(), lon = numeric(), mode = character(), line = character(), stringsAsFactors = FALSE) l <- 2 m <- 1 for (k in 1:(length(linestring)/2)){ per_leg_results[k,] <- c(as.numeric(i), as.numeric(linestring[m]), as.numeric(linestring[l]), mode, line) l <- l+2 m <- m+2 } temp_results_frame <- rbindlist(list(temp_results_frame, per_leg_results), use.names=TRUE) rm(per_leg_results) temp_results_frame$unique_id <- as.numeric(temp_results_frame$unique_id) temp_results_frame$lat <- as.numeric(temp_results_frame$lat) temp_results_frame$lon <- as.numeric(temp_results_frame$lon) } temp_results_frame[temp_results_frame$line == "","line"] <- NA temp_results_frame$line <- fill_missing_info(temp_results_frame$line) results <- rbindlist(list(results, temp_results_frame), use.names=TRUE) print(paste("At", Sys.time(), "routing unique journey id", i, "was completed using TfL tube mode")) rm(temp_results_frame, k, l, m, r, line, linestring, url, json_data) unique_journeys[i,]$status <- 'tfl' } else { print(paste("At", Sys.time(), "routing unique journey id", i, "was NOT completed using TfL tube mode, the error id will be logged")) error_ids[j,] <- i j <- j+1 } rm(tfl_app_id, tfl_app_key)
library(rockchalk) ### Name: rbindFill ### Title: Stack together data frames ### Aliases: rbindFill ### ** Examples set.seed(123123) N <- 10000 dat <- genCorrelatedData2(N, means = c(10, 20, 5, 5, 6, 7, 9), sds = 3, stde = 3, rho = .2, beta = c(1, 1, -1, 0.5)) dat1 <- dat dat1$xcat1 <- factor(sample(c("a", "b", "c", "d"), N, replace=TRUE)) dat1$xcat2 <- factor(sample(c("M", "F"), N, replace=TRUE), levels = c("M", "F"), labels = c("Male", "Female")) dat1$y <- dat$y + as.vector(contrasts(dat1$xcat1)[dat1$xcat1, ] %*% c(0.1, 0.2, 0.3)) dat1$xchar1 <- rep(letters[1:26], length.out = N) dat2 <- dat dat1$x3 <- NULL dat2$x2 <- NULL dat2$xcat2 <- factor(sample(c("M", "F"), N, replace=TRUE), levels = c("M", "F"), labels = c("Male", "Female")) dat2$xcat3 <- factor(sample(c("K1", "K2", "K3", "K4"), N, replace=TRUE)) dat2$xchar1 <- "1" dat3 <- dat dat3$x1 <- NULL dat3$xcat3 <- factor(sample(c("L1", "L2", "L3", "L4"), N, replace=TRUE)) dat.stack <- rbindFill(dat1, dat2, dat3) str(dat.stack) ## Possible BUG alert about base::rbind and plyr::rbind.fill ## Demonstrate the problem of a same-named variable that is factor in one and ## an ordered variable in the other dat5 <- data.frame(ds = "5", x1 = rnorm(N), xcat1 = gl(20, 5, labels = LETTERS[20:1])) dat6 <- data.frame(ds = "6", x1 = rnorm(N), xcat1 = gl(20, 5, labels = LETTERS[1:20], ordered = TRUE)) ## rbind reduces xcat1 to factor, whether we bind dat5 or dat6 first. stack1 <- base::rbind(dat5, dat6) str(stack1) ## note xcat1 levels are ordered T, S, R, Q stack2 <- base::rbind(dat6, dat5) str(stack2) ## xcat1 levels are A, B, C, D ## stack3 <- plyr::rbind.fill(dat5, dat6) ## str(stack3) ## xcat1 is a factor with levels T, S, R, Q ... ## stack4 <- plyr::rbind.fill(dat6, dat5) ## str(stack4) ## oops, xcat1 is ordinal with levels A < B < C < D ## stack5 <- rbindFill(dat5, dat6)
/data/genthat_extracted_code/rockchalk/examples/rbindFill.Rd.R
no_license
surayaaramli/typeRrh
R
false
false
1,955
r
library(rockchalk) ### Name: rbindFill ### Title: Stack together data frames ### Aliases: rbindFill ### ** Examples set.seed(123123) N <- 10000 dat <- genCorrelatedData2(N, means = c(10, 20, 5, 5, 6, 7, 9), sds = 3, stde = 3, rho = .2, beta = c(1, 1, -1, 0.5)) dat1 <- dat dat1$xcat1 <- factor(sample(c("a", "b", "c", "d"), N, replace=TRUE)) dat1$xcat2 <- factor(sample(c("M", "F"), N, replace=TRUE), levels = c("M", "F"), labels = c("Male", "Female")) dat1$y <- dat$y + as.vector(contrasts(dat1$xcat1)[dat1$xcat1, ] %*% c(0.1, 0.2, 0.3)) dat1$xchar1 <- rep(letters[1:26], length.out = N) dat2 <- dat dat1$x3 <- NULL dat2$x2 <- NULL dat2$xcat2 <- factor(sample(c("M", "F"), N, replace=TRUE), levels = c("M", "F"), labels = c("Male", "Female")) dat2$xcat3 <- factor(sample(c("K1", "K2", "K3", "K4"), N, replace=TRUE)) dat2$xchar1 <- "1" dat3 <- dat dat3$x1 <- NULL dat3$xcat3 <- factor(sample(c("L1", "L2", "L3", "L4"), N, replace=TRUE)) dat.stack <- rbindFill(dat1, dat2, dat3) str(dat.stack) ## Possible BUG alert about base::rbind and plyr::rbind.fill ## Demonstrate the problem of a same-named variable that is factor in one and ## an ordered variable in the other dat5 <- data.frame(ds = "5", x1 = rnorm(N), xcat1 = gl(20, 5, labels = LETTERS[20:1])) dat6 <- data.frame(ds = "6", x1 = rnorm(N), xcat1 = gl(20, 5, labels = LETTERS[1:20], ordered = TRUE)) ## rbind reduces xcat1 to factor, whether we bind dat5 or dat6 first. stack1 <- base::rbind(dat5, dat6) str(stack1) ## note xcat1 levels are ordered T, S, R, Q stack2 <- base::rbind(dat6, dat5) str(stack2) ## xcat1 levels are A, B, C, D ## stack3 <- plyr::rbind.fill(dat5, dat6) ## str(stack3) ## xcat1 is a factor with levels T, S, R, Q ... ## stack4 <- plyr::rbind.fill(dat6, dat5) ## str(stack4) ## oops, xcat1 is ordinal with levels A < B < C < D ## stack5 <- rbindFill(dat5, dat6)
# Extract Data from RBSN Stations: # Address: http://reports.irimo.ir/jasperserver/login.html # User Name: user # Password: user rm(list = ls()) # Load library: library(dplyr) library(ggplot2) # Set Current Directori to RBSN_Data Folder: setwd(dir = choose.dir(default = getwd(), caption = "Select RBSN Data Folder (*.csv): ")) # Read Data: Data <- read.csv(file = "Mashhad_40745.csv", header = TRUE, skip = 2) # Modified Data: # remove X cloumn: Data$X <- NULL # remove empty rows: Data <- Data[-which(x = Data$station_i == "" | Data$station_i == "station_i"), ] # reset row names: row.names(Data) <- NULL # Remove "null", "nul" and "n" from Data: Data[Data == "null"] <- NA Data[Data == "n"] <- NA Data[Data == "nul"] <- NA # Reset Factor Level: Data <- droplevels.data.frame(Data) # Rename of date column: colnames(Data)[5] <- "date" # Change Class of date Cloumn: Data$date <- as.POSIXct(x = as.character(x = Data$date), format = "%m/%d/%Y %H:%M") # Change Class of Clumns: Column.Names <- colnames(Data)[-c(1,5)] for (ColName in Column.Names) { eval(expr = parse(text = paste("Data$", ColName, " <- as.numeric(as.character(x = Data$", ColName, "))", sep = ""))) } # Group Date Variable into Day/Month/Year: A <- Data %>% mutate(month = format(x = date, "%m"), year = format(x = date, "%Y")) %>% group_by(month, year) %>% summarise(total = sum(rrr, na.rm = TRUE)) B <- Data %>% mutate(year = format(x = date, "%Y")) %>% group_by(year) %>% summarise(total = sum(rrr, na.rm = TRUE)) # Order Data by the Year: A <- A[order(A$year),] A$date <- seq(from = as.Date("1951/01/01"), to = as.Date("2017/12/01"), by = "month") B <- B[order(A$year),] B$date <- seq(from = as.Date("1951/01/01"), to = as.Date("2017/12/01"), by = "year") ggplot(data = B, mapping = aes(x = year, y = total, group = 1)) + geom_point() + geom_line(linetype = "dashed", color="red")
/CODE_RBSN.r
permissive
shirazipooya/CODE_RBSN
R
false
false
1,934
r
# Extract Data from RBSN Stations: # Address: http://reports.irimo.ir/jasperserver/login.html # User Name: user # Password: user rm(list = ls()) # Load library: library(dplyr) library(ggplot2) # Set Current Directori to RBSN_Data Folder: setwd(dir = choose.dir(default = getwd(), caption = "Select RBSN Data Folder (*.csv): ")) # Read Data: Data <- read.csv(file = "Mashhad_40745.csv", header = TRUE, skip = 2) # Modified Data: # remove X cloumn: Data$X <- NULL # remove empty rows: Data <- Data[-which(x = Data$station_i == "" | Data$station_i == "station_i"), ] # reset row names: row.names(Data) <- NULL # Remove "null", "nul" and "n" from Data: Data[Data == "null"] <- NA Data[Data == "n"] <- NA Data[Data == "nul"] <- NA # Reset Factor Level: Data <- droplevels.data.frame(Data) # Rename of date column: colnames(Data)[5] <- "date" # Change Class of date Cloumn: Data$date <- as.POSIXct(x = as.character(x = Data$date), format = "%m/%d/%Y %H:%M") # Change Class of Clumns: Column.Names <- colnames(Data)[-c(1,5)] for (ColName in Column.Names) { eval(expr = parse(text = paste("Data$", ColName, " <- as.numeric(as.character(x = Data$", ColName, "))", sep = ""))) } # Group Date Variable into Day/Month/Year: A <- Data %>% mutate(month = format(x = date, "%m"), year = format(x = date, "%Y")) %>% group_by(month, year) %>% summarise(total = sum(rrr, na.rm = TRUE)) B <- Data %>% mutate(year = format(x = date, "%Y")) %>% group_by(year) %>% summarise(total = sum(rrr, na.rm = TRUE)) # Order Data by the Year: A <- A[order(A$year),] A$date <- seq(from = as.Date("1951/01/01"), to = as.Date("2017/12/01"), by = "month") B <- B[order(A$year),] B$date <- seq(from = as.Date("1951/01/01"), to = as.Date("2017/12/01"), by = "year") ggplot(data = B, mapping = aes(x = year, y = total, group = 1)) + geom_point() + geom_line(linetype = "dashed", color="red")
library(testthat) library(NGSexpressionSet) test_check("RFclust.SGE")
/tests/testthat.R
permissive
stela2502/RFclust.SGE
R
false
false
71
r
library(testthat) library(NGSexpressionSet) test_check("RFclust.SGE")
### R code from vignette source 'multivariate-birth2.Rnw' ################################################### ### code chunk number 1: multivariate-birth2.Rnw:13-14 (eval = FALSE) ################################################### ## options(width=80) ################################################### ### code chunk number 2: multivariate-birth2.Rnw:19-22 (eval = FALSE) ################################################### ## library(catdata) ## data(birth) ## attach(birth) ################################################### ### code chunk number 3: multivariate-birth2.Rnw:29-36 (eval = FALSE) ################################################### ## intensive <- rep(0,length(Intensive)) ## intensive[Intensive>0] <- 1 ## Intensive <- intensive ## ## previous <- Previous ## previous[previous>1] <- 2 ## Previous <- previous ################################################### ### code chunk number 4: multivariate-birth2.Rnw:41-42 (eval = FALSE) ################################################### ## library(gee) ################################################### ### code chunk number 5: multivariate-birth2.Rnw:47-54 (eval = FALSE) ################################################### ## library(VGAM) ## Birth <- as.data.frame(na.omit(cbind(Intensive, Cesarean, Sex, Weight, Previous, ## AgeMother))) ## detach(birth) ## bivarlogit <- vglm(cbind(Intensive , Cesarean) ~ Weight + AgeMother + ## as.factor(Sex) + as.factor(Previous), binom2.or(zero=NULL), data=Birth) ## summary(bivarlogit) ################################################### ### code chunk number 6: multivariate-birth2.Rnw:59-82 (eval = FALSE) ################################################### ## n <- dim(Birth)[1] ## ID <- rep(1:n,2) ## ## InterceptInt <- InterceptCes <- rep(1, 2*n) ## InterceptInt[(n+1):(2*n)] <- InterceptCes[1:n] <- 0 ## ## AgeMotherInt <- AgeMotherCes <- rep(Birth$AgeMother,2) ## AgeMotherInt[(n+1):(2*n)] <- AgeMotherCes[1:n] <- 0 ## ## SexInt <- SexCes <- rep(Birth$Sex,2) ## SexInt[SexInt==1] <- SexCes[SexCes==1] <- 0 ## SexInt[SexInt==2] <- SexCes[SexCes==2] <- 1 ## SexInt[(n+1):(2*n)] <- SexCes[1:n] <- 0 ## ## PrevBase <- rep(Birth$Previous,2) ## PreviousInt1 <- PreviousCes1 <- PreviousInt2 <- PreviousCes2 <- rep(0, 2*n) ## PreviousInt1[PrevBase==1] <- PreviousCes1[PrevBase==1] <- 1 ## PreviousInt2[PrevBase>=2] <- PreviousCes2[PrevBase>=2] <- 1 ## PreviousInt1[(n+1):(2*n)] <- PreviousInt2[(n+1):(2*n)] <- PreviousCes1[1:n] <- ## PreviousCes2[1:n] <- 0 ## ## WeightInt <- WeightCes <- rep(Birth$Weight,2) ## WeightInt[(n+1):(2*n)] <- WeightCes[1:n] <- 0 ################################################### ### code chunk number 7: multivariate-birth2.Rnw:87-91 (eval = FALSE) ################################################### ## GeeDat <- as.data.frame(cbind(ID, InterceptInt, InterceptCes, SexInt , SexCes , ## WeightInt , WeightCes , PreviousInt1 , PreviousInt2, PreviousCes1, ## PreviousCes2, AgeMotherInt , AgeMotherCes, Response= ## c(Birth$Intensive, Birth$Cesarean))) ################################################### ### code chunk number 8: multivariate-birth2.Rnw:96-102 (eval = FALSE) ################################################### ## gee1 <- gee (Response ~ -1 + InterceptInt + InterceptCes + WeightInt + WeightCes ## + AgeMotherInt + AgeMotherCes + SexInt + SexCes + ## PreviousInt1 + PreviousCes1 + PreviousInt2 + PreviousCes2, ## family=binomial(link=logit), id=ID, data=GeeDat) ## ## summary(gee1) ################################################### ### code chunk number 9: multivariate-birth2.Rnw:107-124 (eval = FALSE) ################################################### ## coefficients(bivarlogit)[1:2] ## coefficients(gee1)[1:2] ## ## coefficients(bivarlogit)[4:5] ## coefficients(gee1)[3:4] ## ## coefficients(bivarlogit)[7:8] ## coefficients(gee1)[5:6] ## ## coefficients(bivarlogit)[10:11] ## coefficients(gee1)[7:8] ## ## coefficients(bivarlogit)[13:14] ## coefficients(gee1)[9:10] ## ## coefficients(bivarlogit)[16:17] ## coefficients(gee1)[11:12] ################################################### ### code chunk number 10: multivariate-birth2.Rnw:127-128 (eval = FALSE) ################################################### ## detach(package:VGAM)
/data/genthat_extracted_code/catdata/vignettes/multivariate-birth2.R
no_license
surayaaramli/typeRrh
R
false
false
4,377
r
### R code from vignette source 'multivariate-birth2.Rnw' ################################################### ### code chunk number 1: multivariate-birth2.Rnw:13-14 (eval = FALSE) ################################################### ## options(width=80) ################################################### ### code chunk number 2: multivariate-birth2.Rnw:19-22 (eval = FALSE) ################################################### ## library(catdata) ## data(birth) ## attach(birth) ################################################### ### code chunk number 3: multivariate-birth2.Rnw:29-36 (eval = FALSE) ################################################### ## intensive <- rep(0,length(Intensive)) ## intensive[Intensive>0] <- 1 ## Intensive <- intensive ## ## previous <- Previous ## previous[previous>1] <- 2 ## Previous <- previous ################################################### ### code chunk number 4: multivariate-birth2.Rnw:41-42 (eval = FALSE) ################################################### ## library(gee) ################################################### ### code chunk number 5: multivariate-birth2.Rnw:47-54 (eval = FALSE) ################################################### ## library(VGAM) ## Birth <- as.data.frame(na.omit(cbind(Intensive, Cesarean, Sex, Weight, Previous, ## AgeMother))) ## detach(birth) ## bivarlogit <- vglm(cbind(Intensive , Cesarean) ~ Weight + AgeMother + ## as.factor(Sex) + as.factor(Previous), binom2.or(zero=NULL), data=Birth) ## summary(bivarlogit) ################################################### ### code chunk number 6: multivariate-birth2.Rnw:59-82 (eval = FALSE) ################################################### ## n <- dim(Birth)[1] ## ID <- rep(1:n,2) ## ## InterceptInt <- InterceptCes <- rep(1, 2*n) ## InterceptInt[(n+1):(2*n)] <- InterceptCes[1:n] <- 0 ## ## AgeMotherInt <- AgeMotherCes <- rep(Birth$AgeMother,2) ## AgeMotherInt[(n+1):(2*n)] <- AgeMotherCes[1:n] <- 0 ## ## SexInt <- SexCes <- rep(Birth$Sex,2) ## SexInt[SexInt==1] <- SexCes[SexCes==1] <- 0 ## SexInt[SexInt==2] <- SexCes[SexCes==2] <- 1 ## SexInt[(n+1):(2*n)] <- SexCes[1:n] <- 0 ## ## PrevBase <- rep(Birth$Previous,2) ## PreviousInt1 <- PreviousCes1 <- PreviousInt2 <- PreviousCes2 <- rep(0, 2*n) ## PreviousInt1[PrevBase==1] <- PreviousCes1[PrevBase==1] <- 1 ## PreviousInt2[PrevBase>=2] <- PreviousCes2[PrevBase>=2] <- 1 ## PreviousInt1[(n+1):(2*n)] <- PreviousInt2[(n+1):(2*n)] <- PreviousCes1[1:n] <- ## PreviousCes2[1:n] <- 0 ## ## WeightInt <- WeightCes <- rep(Birth$Weight,2) ## WeightInt[(n+1):(2*n)] <- WeightCes[1:n] <- 0 ################################################### ### code chunk number 7: multivariate-birth2.Rnw:87-91 (eval = FALSE) ################################################### ## GeeDat <- as.data.frame(cbind(ID, InterceptInt, InterceptCes, SexInt , SexCes , ## WeightInt , WeightCes , PreviousInt1 , PreviousInt2, PreviousCes1, ## PreviousCes2, AgeMotherInt , AgeMotherCes, Response= ## c(Birth$Intensive, Birth$Cesarean))) ################################################### ### code chunk number 8: multivariate-birth2.Rnw:96-102 (eval = FALSE) ################################################### ## gee1 <- gee (Response ~ -1 + InterceptInt + InterceptCes + WeightInt + WeightCes ## + AgeMotherInt + AgeMotherCes + SexInt + SexCes + ## PreviousInt1 + PreviousCes1 + PreviousInt2 + PreviousCes2, ## family=binomial(link=logit), id=ID, data=GeeDat) ## ## summary(gee1) ################################################### ### code chunk number 9: multivariate-birth2.Rnw:107-124 (eval = FALSE) ################################################### ## coefficients(bivarlogit)[1:2] ## coefficients(gee1)[1:2] ## ## coefficients(bivarlogit)[4:5] ## coefficients(gee1)[3:4] ## ## coefficients(bivarlogit)[7:8] ## coefficients(gee1)[5:6] ## ## coefficients(bivarlogit)[10:11] ## coefficients(gee1)[7:8] ## ## coefficients(bivarlogit)[13:14] ## coefficients(gee1)[9:10] ## ## coefficients(bivarlogit)[16:17] ## coefficients(gee1)[11:12] ################################################### ### code chunk number 10: multivariate-birth2.Rnw:127-128 (eval = FALSE) ################################################### ## detach(package:VGAM)
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/sqlite.r \name{sqodbc_executeqy} \alias{sqodbc_executeqy} \title{sqodbc_executeqy wrapper on sqlQuery} \usage{ sqodbc_executeqy(qy, db, ...) } \arguments{ \item{db:}{list of [dsn] srv usr pwd and dbn} } \description{ sqodbc_executeqy wrapper on sqlQuery }
/man/sqodbc_executeqy.Rd
no_license
gyang274/yg
R
false
true
335
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/sqlite.r \name{sqodbc_executeqy} \alias{sqodbc_executeqy} \title{sqodbc_executeqy wrapper on sqlQuery} \usage{ sqodbc_executeqy(qy, db, ...) } \arguments{ \item{db:}{list of [dsn] srv usr pwd and dbn} } \description{ sqodbc_executeqy wrapper on sqlQuery }
#load csv test <- read.csv("~/Desktop/test.csv", header=FALSE) #load ggplot lib library(ggplot2) # create variable names effortTime=test$V1 dateOfEffort=test$V2 #change dates from factor to character dateOfEffort=as.character(dateOfEffort) str(dateOfEffort) #convert from character to R date object dateOfEffort=as.Date(dateOfEffort,"%m/%d/%y") # make plot using ggplot geom_line ggplot(test, aes(dateOfEffort,effortTime))+geom_line(color='orange')+geom_point(color='dark orange')+ggtitle("Whirlwind Koms over Time")+ labs(x="Date",y="Segment time")
/komplot.R
no_license
wnowak10/strava
R
false
false
552
r
#load csv test <- read.csv("~/Desktop/test.csv", header=FALSE) #load ggplot lib library(ggplot2) # create variable names effortTime=test$V1 dateOfEffort=test$V2 #change dates from factor to character dateOfEffort=as.character(dateOfEffort) str(dateOfEffort) #convert from character to R date object dateOfEffort=as.Date(dateOfEffort,"%m/%d/%y") # make plot using ggplot geom_line ggplot(test, aes(dateOfEffort,effortTime))+geom_line(color='orange')+geom_point(color='dark orange')+ggtitle("Whirlwind Koms over Time")+ labs(x="Date",y="Segment time")
#' Spatial data of white-tailed deer GPS locations #' #' Spatial layer of GPS locations from white-tailed (*Odocoileus virginianus*) in North and South Carolina, United States. #' #' @docType data #' #' @usage data(wtdeer_locations) #' #' @format An object of class \code{"SpatialPointsDataFrame"} #' #' @keywords datasets #' #' #' #' @examples #' library(sp) #' data(wtdeer_locations) #' plot(wtdeer_locations) "wtdeer_locations"
/R/wtdeer_locations-data.R
no_license
cghaase/GARPTools
R
false
false
432
r
#' Spatial data of white-tailed deer GPS locations #' #' Spatial layer of GPS locations from white-tailed (*Odocoileus virginianus*) in North and South Carolina, United States. #' #' @docType data #' #' @usage data(wtdeer_locations) #' #' @format An object of class \code{"SpatialPointsDataFrame"} #' #' @keywords datasets #' #' #' #' @examples #' library(sp) #' data(wtdeer_locations) #' plot(wtdeer_locations) "wtdeer_locations"
library( knitr ) opts_chunk$set( cache=FALSE, echo=TRUE, message=TRUE, warning=FALSE, highlight=TRUE, sanitize=FALSE, tidy=TRUE, dev='tikz', tab.env='table', fig.env='figure', fig.lp='fig:', fig.align='center', fig.pos='tbp', out.width='.75\\textwidth' ) knit( "example_under_construction.rnw" ) quit( save = "no", status = 0, runLast = TRUE )
/example_under_construction.R
no_license
dhanya1/cyclist_detection_thesis
R
false
false
552
r
library( knitr ) opts_chunk$set( cache=FALSE, echo=TRUE, message=TRUE, warning=FALSE, highlight=TRUE, sanitize=FALSE, tidy=TRUE, dev='tikz', tab.env='table', fig.env='figure', fig.lp='fig:', fig.align='center', fig.pos='tbp', out.width='.75\\textwidth' ) knit( "example_under_construction.rnw" ) quit( save = "no", status = 0, runLast = TRUE )
% Generated by roxygen2 (4.1.1): do not edit by hand % Please edit documentation in R/FuncionesAuxiliares.R \name{ordenar_porconteo} \alias{ordenar_porconteo} \title{Ordenar por conteo de factores} \usage{ ordenar_porconteo(df, col) } \arguments{ \item{df}{Data.frame a condensar} \item{col}{Columna con factores. Se pone sin parentesis.} } \value{ Data.frame } \description{ Wrapper para ordenar rapidamente de mayor a menor por grupos un data.frame. } \examples{ df<-data.frame(factores=c("A","A","B","C","C","D","A","A"),otros=c(1,3,2,4,5,1,2,7)) #Ordenar, de mayor a menor, por conteo de factores PorConteo<-ordenar_porconteo(df, factores) } \author{ Eduardo Flores } \seealso{ denue_varios_stats }
/man/ordenar_porconteo.Rd
no_license
fdzul/inegiR
R
false
false
706
rd
% Generated by roxygen2 (4.1.1): do not edit by hand % Please edit documentation in R/FuncionesAuxiliares.R \name{ordenar_porconteo} \alias{ordenar_porconteo} \title{Ordenar por conteo de factores} \usage{ ordenar_porconteo(df, col) } \arguments{ \item{df}{Data.frame a condensar} \item{col}{Columna con factores. Se pone sin parentesis.} } \value{ Data.frame } \description{ Wrapper para ordenar rapidamente de mayor a menor por grupos un data.frame. } \examples{ df<-data.frame(factores=c("A","A","B","C","C","D","A","A"),otros=c(1,3,2,4,5,1,2,7)) #Ordenar, de mayor a menor, por conteo de factores PorConteo<-ordenar_porconteo(df, factores) } \author{ Eduardo Flores } \seealso{ denue_varios_stats }
#' Soybean data from Zobel, Wright and Gauch (1988) and #' is subset from the \code{"gauch.soy"} dataset included in the \code{"agridat"} package #' containing 7 genotypes evaluated in 10 environments #' #' @name soy #' @docType data #' #' @usage data(soy) #' #' @format #' soy An object of class \code{"data.frame"} containing plot values. The blocks (or reps) are randomly assigned as explained from the documentation of \code{"gauch.soy"} data from \code{"agridat"} #' #' @keywords soy #' #' @references Zobel, R. W., Wright, M. J., & Gauch, H. G. (1988). #' Statistical analysis of a yield trial. Agronomy Journal, 80(3), 388-393. #' (\href{https://dl.sciencesocieties.org/publications/aj/abstracts/80/3/AJ0800030388}{Agronomy Journal}) #' #' @source \href{https://cran.r-project.org/web/packages/agridat/index.html}{agridat} #' #' @examples #' data(soy) #' summary(soy) #' print(soy) NULL
/R/soy.R
no_license
nsantantonio/Bilinear
R
false
false
900
r
#' Soybean data from Zobel, Wright and Gauch (1988) and #' is subset from the \code{"gauch.soy"} dataset included in the \code{"agridat"} package #' containing 7 genotypes evaluated in 10 environments #' #' @name soy #' @docType data #' #' @usage data(soy) #' #' @format #' soy An object of class \code{"data.frame"} containing plot values. The blocks (or reps) are randomly assigned as explained from the documentation of \code{"gauch.soy"} data from \code{"agridat"} #' #' @keywords soy #' #' @references Zobel, R. W., Wright, M. J., & Gauch, H. G. (1988). #' Statistical analysis of a yield trial. Agronomy Journal, 80(3), 388-393. #' (\href{https://dl.sciencesocieties.org/publications/aj/abstracts/80/3/AJ0800030388}{Agronomy Journal}) #' #' @source \href{https://cran.r-project.org/web/packages/agridat/index.html}{agridat} #' #' @examples #' data(soy) #' summary(soy) #' print(soy) NULL
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/main.R \name{pm_project} \alias{pm_project} \title{Define empty PlasmoMAPI project} \usage{ pm_project() } \description{ Define empty PlasmoMAPI project. } \details{ #------------------------------------------------ }
/man/pm_project.Rd
permissive
mrc-ide/PlasmoMAPI
R
false
true
296
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/main.R \name{pm_project} \alias{pm_project} \title{Define empty PlasmoMAPI project} \usage{ pm_project() } \description{ Define empty PlasmoMAPI project. } \details{ #------------------------------------------------ }
################################################################################ rm(list = ls()) library(survival) library(survey) ################################################################################ load("../data/data4Demo.RData") #Input data: "data4Demo.RData" contains a data frame "dataPheno" and a list "distMatList" #"dataPheno" is a subject by covariates table, it contains the variable needed in the survival analysis #str(dataPheno) #"distMatList" is a list of distance matrix, each component in this list is a n_i by n_i (n_i is the number of tumor samples of the i_th subject) symmetric matrix with all zeroes in diagonal #These distance matrix can be calculated from any source of data (i.e. SCNA profiles, methylation profiles) by user's own definition #str(distMatList) #names of "distMatList" match the rownames of "dataPheno" #table(rownames(dataPheno) == names(distMatList)) #column "nTumor" (number of tumor samples of that subject) in "dataPheno" matchs the size of distance matrix in "distMatList" #table(dataPheno$nTumor == unlist(lapply(distMatList, nrow))) ################################################################################ #Calculate the APITH index from distMatList (average distance of each sample pair) dataPheno$APITH <- unlist(lapply(distMatList, function(distMat)mean(distMat[lower.tri(distMat)]))) #hist(dataPheno$APITH, seq(0, 1, 0.05)) ################################################################################ #Function to calculate weights for survival anlaysis using the inverse of the estimated variance of APITH index #(Please refer to the supplementary notes for details of the algorithm in this function) funWeight <- function(distMatList){ tempFun <- function(distMat){ k <- nrow(distMat) if(k <= 1)stop("Something is wrong!") distVec <- distMat[lower.tri(distMat)] k2 <- cbind(distVec, distVec) k3 <- NULL if(k >= 3){ tempCombn <- combn(k, 3) for(i in 1:ncol(tempCombn)){ tempIdx <- tempCombn[, i] tempMat <- cbind(c(distMat[tempIdx[1], tempIdx[2]], distMat[tempIdx[1], tempIdx[2]], distMat[tempIdx[1], tempIdx[3]]), c(distMat[tempIdx[1], tempIdx[3]], distMat[tempIdx[2], tempIdx[3]], distMat[tempIdx[2], tempIdx[3]])) k3 <- rbind(k3, tempMat) } } k4 <- NULL if(k >= 4){ tempCombn <- combn(k, 4) for(i in 1:ncol(tempCombn)){ tempIdx <- tempCombn[, i] tempMat <- cbind(c(distMat[tempIdx[1], tempIdx[2]], distMat[tempIdx[1], tempIdx[3]], distMat[tempIdx[1], tempIdx[4]]), c(distMat[tempIdx[3], tempIdx[4]], distMat[tempIdx[2], tempIdx[4]], distMat[tempIdx[2], tempIdx[3]])) k4 <- rbind(k4, tempMat) } } return(list(k2 = k2, k3 = k3, k4 = k4)) } tempList <- lapply(distMatList, tempFun) k2 <- k3 <- k4 <- NULL for(i in 1:length(tempList)){ k2 <- rbind(k2, tempList[[i]]$k2) k3 <- rbind(k3, tempList[[i]]$k3) k4 <- rbind(k4, tempList[[i]]$k4) } kk <- NULL for(i in 1:(length(distMatList) - 1)){ for(j in (i + 1):length(distMatList)){ tempDistMat1 <- distMatList[[i]] tempDistMat2 <- distMatList[[j]] tempDistVec1 <- tempDistMat1[lower.tri(tempDistMat1)] tempDistVec2 <- tempDistMat2[lower.tri(tempDistMat2)] tempMat <- cbind(rep(tempDistVec1, each = length(tempDistVec2)), rep(tempDistVec2, length(tempDistVec1))) kk <- rbind(kk, tempMat) } } a1 <- mean((k4[, 1] - k4[, 2])^2) a2 <- mean((k3[, 1] - k3[, 2])^2) a3 <- mean((kk[, 1] - kk[, 2])^2) b1 <- a1 / 2 b2 <- (a1 - a2) / 2 b3 <- (a3 - a1) / 2 m <- unlist(lapply(distMatList, nrow)) w <- 1 / (b3 + 2 / m /(m - 1) * b1 + 4 * (m - 2) / m / (m - 1) * b2) attr(w, "par") <- c(b1, b2, b3) return(w) } #Calculate the weights: dataPheno$w <- funWeight(distMatList) #str(dataPheno$w) ################################################################################ #Make "exp(coef)" as "odds ratio per 10% increase" of the APITH from SCNA dataPheno$x <- dataPheno$APITH * 10 #Cox proportional hazard model without weight: s1 <- summary(m1 <- coxph(SURVIVAL ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + x, data = dataPheno)) s2 <- summary(m2 <- coxph(METASTASIS ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + x, data = dataPheno)) #Cox proportional-hazard model without weight:with weight: tempDesign <- svydesign(ids = ~ 1, data = dataPheno, weights = dataPheno$w) s3 <- summary(m3 <- svycoxph(SURVIVAL ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + x, design = tempDesign, data = dataPheno)) s4 <- summary(m4 <- svycoxph(METASTASIS ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + x, design = tempDesign, data = dataPheno)) ################################################################################ #Survival analysis of subjects with at least 3 tumor samples per subject subDataPheno <- dataPheno[dataPheno$nTumor > 2, ] #Cox proportional hazard model without weight: s5 <- summary(m5 <- coxph(SURVIVAL ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + x, data = subDataPheno)) s6 <- summary(m6 <- coxph(METASTASIS ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + x, data = subDataPheno)) #Cox proportional-hazard model without weight:with weight: tempDesign <- svydesign(ids = ~ 1, data = subDataPheno, weights = subDataPheno$w) s7 <- summary(m7 <- svycoxph(SURVIVAL ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + x, design = tempDesign, data = subDataPheno)) s8 <- summary(m8 <- svycoxph(METASTASIS ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + x, design = tempDesign, data = subDataPheno)) ################################################################################ # output tables tempFun <- function(s)c(s$conf.int["x", c("exp(coef)", "lower .95", "upper .95")], P = s$coefficients["x", "Pr(>|z|)"]) tempWrite <- matrix(unlist(lapply(list(s1, s2, s3, s4, s5, s6, s7, s8), tempFun)), byrow = TRUE, ncol = 4) dimnames(tempWrite) <- list( c("Survival_80subjects_no_weight", "METASTASIS_80subjects_no_weight", "Survival_80subjects_weight", "METASTASIS_80subjects_weight", "Survival_48subjects_no_weight", "METASTASIS_48subjects_no_weight", "Survival_48subjects_weight", "METASTASIS_48subjects_weight"), c("P", "OR", "Lower .95", "upper .95") ) write.csv(tempWrite, file = "../table/table4Demo.csv", quote = FALSE) ################################################################################ # output figures subDataPheno$x_cat3 <- cut(subDataPheno$APITH, c(0, 0.1, 0.3, 1)) #table(subDataPheno$x_cat3) s <- summary(m <- coxph(SURVIVAL ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + strata(x_cat3), data = subDataPheno)) pdf("../figure/figure4Demo.pdf", width = 10, height = 10) par(cex.lab = 2, cex.axis = 2, mar = c(5, 6, 2, 2)) plot(survfit(m), col = c("blue", "green", "red"), lwd = 2, xlab = "Survival Weeks", ylab = "Survival Rate") legend("topright", c("Low ITH (16)", "Medium ITH (24)", "High ITH (8)"), lwd = 2, col = c("blue", "green", "red"), cex = 1.5) dev.off() ################################################################################
/code/code4Demo.R
permissive
zhangyupisa/EAGLE_LUAD
R
false
false
7,028
r
################################################################################ rm(list = ls()) library(survival) library(survey) ################################################################################ load("../data/data4Demo.RData") #Input data: "data4Demo.RData" contains a data frame "dataPheno" and a list "distMatList" #"dataPheno" is a subject by covariates table, it contains the variable needed in the survival analysis #str(dataPheno) #"distMatList" is a list of distance matrix, each component in this list is a n_i by n_i (n_i is the number of tumor samples of the i_th subject) symmetric matrix with all zeroes in diagonal #These distance matrix can be calculated from any source of data (i.e. SCNA profiles, methylation profiles) by user's own definition #str(distMatList) #names of "distMatList" match the rownames of "dataPheno" #table(rownames(dataPheno) == names(distMatList)) #column "nTumor" (number of tumor samples of that subject) in "dataPheno" matchs the size of distance matrix in "distMatList" #table(dataPheno$nTumor == unlist(lapply(distMatList, nrow))) ################################################################################ #Calculate the APITH index from distMatList (average distance of each sample pair) dataPheno$APITH <- unlist(lapply(distMatList, function(distMat)mean(distMat[lower.tri(distMat)]))) #hist(dataPheno$APITH, seq(0, 1, 0.05)) ################################################################################ #Function to calculate weights for survival anlaysis using the inverse of the estimated variance of APITH index #(Please refer to the supplementary notes for details of the algorithm in this function) funWeight <- function(distMatList){ tempFun <- function(distMat){ k <- nrow(distMat) if(k <= 1)stop("Something is wrong!") distVec <- distMat[lower.tri(distMat)] k2 <- cbind(distVec, distVec) k3 <- NULL if(k >= 3){ tempCombn <- combn(k, 3) for(i in 1:ncol(tempCombn)){ tempIdx <- tempCombn[, i] tempMat <- cbind(c(distMat[tempIdx[1], tempIdx[2]], distMat[tempIdx[1], tempIdx[2]], distMat[tempIdx[1], tempIdx[3]]), c(distMat[tempIdx[1], tempIdx[3]], distMat[tempIdx[2], tempIdx[3]], distMat[tempIdx[2], tempIdx[3]])) k3 <- rbind(k3, tempMat) } } k4 <- NULL if(k >= 4){ tempCombn <- combn(k, 4) for(i in 1:ncol(tempCombn)){ tempIdx <- tempCombn[, i] tempMat <- cbind(c(distMat[tempIdx[1], tempIdx[2]], distMat[tempIdx[1], tempIdx[3]], distMat[tempIdx[1], tempIdx[4]]), c(distMat[tempIdx[3], tempIdx[4]], distMat[tempIdx[2], tempIdx[4]], distMat[tempIdx[2], tempIdx[3]])) k4 <- rbind(k4, tempMat) } } return(list(k2 = k2, k3 = k3, k4 = k4)) } tempList <- lapply(distMatList, tempFun) k2 <- k3 <- k4 <- NULL for(i in 1:length(tempList)){ k2 <- rbind(k2, tempList[[i]]$k2) k3 <- rbind(k3, tempList[[i]]$k3) k4 <- rbind(k4, tempList[[i]]$k4) } kk <- NULL for(i in 1:(length(distMatList) - 1)){ for(j in (i + 1):length(distMatList)){ tempDistMat1 <- distMatList[[i]] tempDistMat2 <- distMatList[[j]] tempDistVec1 <- tempDistMat1[lower.tri(tempDistMat1)] tempDistVec2 <- tempDistMat2[lower.tri(tempDistMat2)] tempMat <- cbind(rep(tempDistVec1, each = length(tempDistVec2)), rep(tempDistVec2, length(tempDistVec1))) kk <- rbind(kk, tempMat) } } a1 <- mean((k4[, 1] - k4[, 2])^2) a2 <- mean((k3[, 1] - k3[, 2])^2) a3 <- mean((kk[, 1] - kk[, 2])^2) b1 <- a1 / 2 b2 <- (a1 - a2) / 2 b3 <- (a3 - a1) / 2 m <- unlist(lapply(distMatList, nrow)) w <- 1 / (b3 + 2 / m /(m - 1) * b1 + 4 * (m - 2) / m / (m - 1) * b2) attr(w, "par") <- c(b1, b2, b3) return(w) } #Calculate the weights: dataPheno$w <- funWeight(distMatList) #str(dataPheno$w) ################################################################################ #Make "exp(coef)" as "odds ratio per 10% increase" of the APITH from SCNA dataPheno$x <- dataPheno$APITH * 10 #Cox proportional hazard model without weight: s1 <- summary(m1 <- coxph(SURVIVAL ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + x, data = dataPheno)) s2 <- summary(m2 <- coxph(METASTASIS ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + x, data = dataPheno)) #Cox proportional-hazard model without weight:with weight: tempDesign <- svydesign(ids = ~ 1, data = dataPheno, weights = dataPheno$w) s3 <- summary(m3 <- svycoxph(SURVIVAL ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + x, design = tempDesign, data = dataPheno)) s4 <- summary(m4 <- svycoxph(METASTASIS ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + x, design = tempDesign, data = dataPheno)) ################################################################################ #Survival analysis of subjects with at least 3 tumor samples per subject subDataPheno <- dataPheno[dataPheno$nTumor > 2, ] #Cox proportional hazard model without weight: s5 <- summary(m5 <- coxph(SURVIVAL ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + x, data = subDataPheno)) s6 <- summary(m6 <- coxph(METASTASIS ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + x, data = subDataPheno)) #Cox proportional-hazard model without weight:with weight: tempDesign <- svydesign(ids = ~ 1, data = subDataPheno, weights = subDataPheno$w) s7 <- summary(m7 <- svycoxph(SURVIVAL ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + x, design = tempDesign, data = subDataPheno)) s8 <- summary(m8 <- svycoxph(METASTASIS ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + x, design = tempDesign, data = subDataPheno)) ################################################################################ # output tables tempFun <- function(s)c(s$conf.int["x", c("exp(coef)", "lower .95", "upper .95")], P = s$coefficients["x", "Pr(>|z|)"]) tempWrite <- matrix(unlist(lapply(list(s1, s2, s3, s4, s5, s6, s7, s8), tempFun)), byrow = TRUE, ncol = 4) dimnames(tempWrite) <- list( c("Survival_80subjects_no_weight", "METASTASIS_80subjects_no_weight", "Survival_80subjects_weight", "METASTASIS_80subjects_weight", "Survival_48subjects_no_weight", "METASTASIS_48subjects_no_weight", "Survival_48subjects_weight", "METASTASIS_48subjects_weight"), c("P", "OR", "Lower .95", "upper .95") ) write.csv(tempWrite, file = "../table/table4Demo.csv", quote = FALSE) ################################################################################ # output figures subDataPheno$x_cat3 <- cut(subDataPheno$APITH, c(0, 0.1, 0.3, 1)) #table(subDataPheno$x_cat3) s <- summary(m <- coxph(SURVIVAL ~ STAGE + AGE_FIRST_DIAGNOSIS + SEX + strata(x_cat3), data = subDataPheno)) pdf("../figure/figure4Demo.pdf", width = 10, height = 10) par(cex.lab = 2, cex.axis = 2, mar = c(5, 6, 2, 2)) plot(survfit(m), col = c("blue", "green", "red"), lwd = 2, xlab = "Survival Weeks", ylab = "Survival Rate") legend("topright", c("Low ITH (16)", "Medium ITH (24)", "High ITH (8)"), lwd = 2, col = c("blue", "green", "red"), cex = 1.5) dev.off() ################################################################################
suppressMessages({ library(rpart) #library(rattle) library(rpart.plot) library(RColorBrewer) library(Amelia) library(prediction) library(plyr) library(aod) library(ROCR) }) ``` ### Load and check data ```{r} train <- read.csv("train_titanic.csv", header=T, na.strings=c("")) test <- read.csv("test_titanic.csv", header=T, na.strings=c("")) test$Survived <- 0 data <- rbind(train, test, fill = TRUE) ``` ### missing value ```{r} missmap(data, main = "NA vs. Observed") ``` ```{r} summary(data) ``` ```{r} summary(data$Age) ``` ### Distribution plot ```{r} z <- data$Age s <- 2 * z + 4 + rnorm(length(data$Age)) par(mfrow = c(2, 2)) hist(z) plot(s, z) qqnorm(z) qqline(z) plot(1:length(z),log(z), lty = 1) ``` ```{r} data$Age[is.na(data$Age)] <- mean(data$Age, na.rm = T) plot(density(data$Age)) ``` ```{r} mode <- function(x) { ux <- unique(x) ux[which.max(tabulate(match(x, ux)))] } train$Embarked[is.na(train$Embarked)] <- mode(train$Embarked) ``` ```{r} # Grab title from passenger names data$Title <- gsub('(.*, )|(\\..*)', '', data$Name) # Show title counts by sex table(data$Sex, data$Title) ``` ```{r} rare_title <- c('Dona', 'Lady', 'the Countess','Capt', 'Col', 'Don', 'Dr', 'Major', 'Rev', 'Sir', 'Jonkheer') # Also reassign mlle, ms, and mme accordingly data$Title[data$Title == 'Mlle'] <- 'Miss' data$Title[data$Title == 'Ms'] <- 'Miss' data$Title[data$Title == 'Mme'] <- 'Mrs' data$Title[data$Title %in% rare_title] <- 'Rare Title' # Show title counts by sex again table(data$Sex, data$Title) ``` ### Split into training & test sets ```{r} train <- data[1:891,] test <- data[892:1309,] ``` ```{r} table(train$Sex, train$Survived) prop.table(table(train$Sex, train$Survived)) prop.table(table(train$Sex, train$Survived),1) ``` ```{r} test$Survived <- 0 test$Survived[test$Sex == 'female'] <- 1 train$Child <- 0 train$Child[train$Age < 18] <- 1 table(train$Child, train$Survived) prop.table(table(train$Child, train$Survived),1) ``` ```{r} aggregate(Survived ~ Child + Sex, data=train, FUN=sum) aggregate(Survived ~ Child + Sex, data=train, FUN=length) aggregate(Survived ~ Child + Sex, data=train, FUN=function(x) {sum(x)/length(x)}) ``` ```{r} summary(train$Pclass) summary(train$Fare) ``` ```{r} train$Fare2 <- '30+' train$Fare2[train$Fare < 30 & train$Fare >= 20] <- '20-30' train$Fare2[train$Fare < 20 & train$Fare >= 10] <- '10-20' train$Fare2[train$Fare < 10] <- '<10' ``` ```{r} aggregate(Survived ~ Fare2 + Pclass + Sex, data=train, FUN=function(x) {sum(x)/length(x)}) ``` ```{r} test$Child <- 0 test$Child[test$Age < 18] <- 1 test$Fare2 <- '30+' test$Fare2[test$Fare < 30 & test$Fare >= 20] <- '20-30' test$Fare2[test$Fare < 20 & test$Fare >= 10] <- '10-20' test$Fare2[test$Fare < 10] <- '<10' ``` ### logit ```{r} model <- glm(Survived ~ Title + Child + Sex + Pclass + Fare2 + Embarked, family=binomial(link='logit'), data=train) summary(model) ``` ```{r} anova(model, test="Chisq") ``` ## Predict ```{r} fitted.results <- predict(model, newdata = subset(test, select = c('Title','Child', 'Sex', 'Pclass', 'Fare2', 'Embarked')), type = 'response') fitted.results <- ifelse(fitted.results > 0.5,1,0) misClasificError <- mean(fitted.results != test$Survived) print(paste('Accuracy',1-misClasificError)) ``` ```{r} p <- predict(model, newdata = subset(test), type="response") pr <- prediction(fitted.results, test$Survived) perf <- performance(pr, measure = "tpr", x.measure = "fpr") plot(perf) ``` ```{r} auc <- performance(pr, measure = "auc") auc <- auc@y.values[[1]] auc ``` ```{r} #submit <- data.frame(PassengerId = test$PassengerId, Survived = Prediction) #write.csv(submit, file = "titanic_logit.csv", row.names = FALSE) ```
/r/kernels/heysilver-titanic-test/script/titanic-test.R
no_license
helenaK/trustworthy-titanic
R
false
false
3,749
r
suppressMessages({ library(rpart) #library(rattle) library(rpart.plot) library(RColorBrewer) library(Amelia) library(prediction) library(plyr) library(aod) library(ROCR) }) ``` ### Load and check data ```{r} train <- read.csv("train_titanic.csv", header=T, na.strings=c("")) test <- read.csv("test_titanic.csv", header=T, na.strings=c("")) test$Survived <- 0 data <- rbind(train, test, fill = TRUE) ``` ### missing value ```{r} missmap(data, main = "NA vs. Observed") ``` ```{r} summary(data) ``` ```{r} summary(data$Age) ``` ### Distribution plot ```{r} z <- data$Age s <- 2 * z + 4 + rnorm(length(data$Age)) par(mfrow = c(2, 2)) hist(z) plot(s, z) qqnorm(z) qqline(z) plot(1:length(z),log(z), lty = 1) ``` ```{r} data$Age[is.na(data$Age)] <- mean(data$Age, na.rm = T) plot(density(data$Age)) ``` ```{r} mode <- function(x) { ux <- unique(x) ux[which.max(tabulate(match(x, ux)))] } train$Embarked[is.na(train$Embarked)] <- mode(train$Embarked) ``` ```{r} # Grab title from passenger names data$Title <- gsub('(.*, )|(\\..*)', '', data$Name) # Show title counts by sex table(data$Sex, data$Title) ``` ```{r} rare_title <- c('Dona', 'Lady', 'the Countess','Capt', 'Col', 'Don', 'Dr', 'Major', 'Rev', 'Sir', 'Jonkheer') # Also reassign mlle, ms, and mme accordingly data$Title[data$Title == 'Mlle'] <- 'Miss' data$Title[data$Title == 'Ms'] <- 'Miss' data$Title[data$Title == 'Mme'] <- 'Mrs' data$Title[data$Title %in% rare_title] <- 'Rare Title' # Show title counts by sex again table(data$Sex, data$Title) ``` ### Split into training & test sets ```{r} train <- data[1:891,] test <- data[892:1309,] ``` ```{r} table(train$Sex, train$Survived) prop.table(table(train$Sex, train$Survived)) prop.table(table(train$Sex, train$Survived),1) ``` ```{r} test$Survived <- 0 test$Survived[test$Sex == 'female'] <- 1 train$Child <- 0 train$Child[train$Age < 18] <- 1 table(train$Child, train$Survived) prop.table(table(train$Child, train$Survived),1) ``` ```{r} aggregate(Survived ~ Child + Sex, data=train, FUN=sum) aggregate(Survived ~ Child + Sex, data=train, FUN=length) aggregate(Survived ~ Child + Sex, data=train, FUN=function(x) {sum(x)/length(x)}) ``` ```{r} summary(train$Pclass) summary(train$Fare) ``` ```{r} train$Fare2 <- '30+' train$Fare2[train$Fare < 30 & train$Fare >= 20] <- '20-30' train$Fare2[train$Fare < 20 & train$Fare >= 10] <- '10-20' train$Fare2[train$Fare < 10] <- '<10' ``` ```{r} aggregate(Survived ~ Fare2 + Pclass + Sex, data=train, FUN=function(x) {sum(x)/length(x)}) ``` ```{r} test$Child <- 0 test$Child[test$Age < 18] <- 1 test$Fare2 <- '30+' test$Fare2[test$Fare < 30 & test$Fare >= 20] <- '20-30' test$Fare2[test$Fare < 20 & test$Fare >= 10] <- '10-20' test$Fare2[test$Fare < 10] <- '<10' ``` ### logit ```{r} model <- glm(Survived ~ Title + Child + Sex + Pclass + Fare2 + Embarked, family=binomial(link='logit'), data=train) summary(model) ``` ```{r} anova(model, test="Chisq") ``` ## Predict ```{r} fitted.results <- predict(model, newdata = subset(test, select = c('Title','Child', 'Sex', 'Pclass', 'Fare2', 'Embarked')), type = 'response') fitted.results <- ifelse(fitted.results > 0.5,1,0) misClasificError <- mean(fitted.results != test$Survived) print(paste('Accuracy',1-misClasificError)) ``` ```{r} p <- predict(model, newdata = subset(test), type="response") pr <- prediction(fitted.results, test$Survived) perf <- performance(pr, measure = "tpr", x.measure = "fpr") plot(perf) ``` ```{r} auc <- performance(pr, measure = "auc") auc <- auc@y.values[[1]] auc ``` ```{r} #submit <- data.frame(PassengerId = test$PassengerId, Survived = Prediction) #write.csv(submit, file = "titanic_logit.csv", row.names = FALSE) ```
#' Combine sample means from two samples #' #' This function combines the sample mean information from two samples (of #' the same phenomena) to return the sample mean of the union of the two #' samples. #' #' @param x.mean sample mean from the first sample, 'x' #' @param y.mean sample mean from the second sample, 'y' #' @param x.n sample size from the first sample, 'x' #' @param y.n sample size from the second sample, 'y' #' #' mergeMean = function(x.mean, y.mean, x.n, y.n) { N = x.n + y.n (x.mean*x.n + y.mean*y.n)/N }
/R/mergeMean.R
no_license
jmhewitt/telefit
R
false
false
540
r
#' Combine sample means from two samples #' #' This function combines the sample mean information from two samples (of #' the same phenomena) to return the sample mean of the union of the two #' samples. #' #' @param x.mean sample mean from the first sample, 'x' #' @param y.mean sample mean from the second sample, 'y' #' @param x.n sample size from the first sample, 'x' #' @param y.n sample size from the second sample, 'y' #' #' mergeMean = function(x.mean, y.mean, x.n, y.n) { N = x.n + y.n (x.mean*x.n + y.mean*y.n)/N }
basedir <- "/mnt/hdd0/univ/thesis-support-material/data/" library(edgeR) library(tidyr) library(dplyr) library(readr) library(stringr) # GUIDE: # https://ucdavis-bioinformatics-training.github.io/2018-June-RNA-Seq-Workshop/thursday/DE.html # importing data setwd(paste0(basedir, "4-4/featureCounts-output/")) filename = "counts.txt" #filename = "filtered-only-lncrnas/counts_only_lncRNA.txt" counts_full <- read_delim(filename, "\t", escape_double = FALSE, trim_ws = TRUE, skip = 1) counts_simple_full <- as.matrix(counts_full[,c(7,8,9,10,11,12)]) # renaming the rows and columns # note: bc*-1 are the shNT samples # bc*-2 are the sh1 samples # bc*-3 are the sh2 samples colnames(counts_simple_full) <- c("bc1-1", "bc1-2", "bc1-3", "bc2-1", "bc2-2", "bc2-3") rownames(counts_simple_full) <- counts_full$Geneid # set adjusted pvalue and LFC cutoffs padj.cutoff <- 0.01 lfc.cutoff <- 0.58 # ----- shNT vs sh-1 ---- # keeping only shNT and sh1 samples counts <- counts_simple_full[,c(1,4,2,5)] condition <- factor(c(rep("control", 2), rep("sh1", 2))) sampleInfo <- data.frame(row.names = colnames(counts), condition) group <- sampleInfo$condition # creating object d0 <- DGEList(counts) # compute normalization factors d0 <- calcNormFactors(d0) # filtering low expressed genes # we remove the genes whose cpm normalized count is < 1 # in every sample cutoff <- 1 drop <- which(apply(cpm(d0), 1, max) < cutoff) d <- d0[-drop,] mm <- model.matrix(~0 + group) y <- voom(d, mm, plot = F) # model fitting fit <- lmFit(y, mm) # setting the comparison between control and sh1 contr <- makeContrasts(groupsh1 - groupcontrol, levels = colnames(coef(fit))) # Estimate contrast for each gene tmp <- contrasts.fit(fit, contr) tmp <- eBayes(tmp) result.table <- topTable(tmp, sort.by = "P", n = Inf) DE.genes.sh1.limma <- result.table %>% filter(adj.P.Val < padj.cutoff & abs(logFC) > lfc.cutoff ) %>% arrange(-logFC) %>% mutate(gene = rownames(.)) %>% select(gene, adj.P.Val, logFC) DE.genes.sh1.limma <- as_tibble(DE.genes.sh1.limma) # ----------------------- rm(counts) rm(condition) rm(sampleInfo) rm(group) rm(d0) rm(d) rm(mm) rm(drop) rm(y) rm(fit) rm(contr) rm(tmp) rm(result.table) # ----- shNT vs sh2 ---- # keeping only shNT and sh2 samples counts <- counts_simple_full[,c(1,4,3,6)] condition <- factor(c(rep("control", 2), rep("sh2", 2))) sampleInfo <- data.frame(row.names = colnames(counts), condition) group <- sampleInfo$condition # creating object d0 <- DGEList(counts) # compute normalization factors d0 <- calcNormFactors(d0) # filtering low expressed genes # we remove the genes whose cpm normalized count is < 1 # in every sample cutoff <- 1 drop <- which(apply(cpm(d0), 1, max) < cutoff) d <- d0[-drop,] mm <- model.matrix(~0 + group) y <- voom(d, mm, plot = F) # model fitting fit <- lmFit(y, mm) # setting the comparison between control and sh1 contr <- makeContrasts(groupsh2 - groupcontrol, levels = colnames(coef(fit))) # Estimate contrast for each gene tmp <- contrasts.fit(fit, contr) tmp <- eBayes(tmp) result.table <- topTable(tmp, sort.by = "P", n = Inf) DE.genes.sh2.limma <- result.table %>% filter(adj.P.Val < padj.cutoff & abs(logFC) > lfc.cutoff ) %>% arrange(-logFC) %>% mutate(gene = rownames(.)) %>% select(gene, adj.P.Val, logFC) DE.genes.sh2.limma <- as_tibble(DE.genes.sh2.limma) # ---------------------------------- # a value of LFC > 0 means that the gene is MORE EXPRESSED in the sh1 (or sh2) # samples (the gene is upregulated upon tp53-mut silencing) rm(counts) rm(condition) rm(sampleInfo) rm(group) rm(d0) rm(d) rm(mm) rm(drop) rm(y) rm(fit) rm(contr) rm(tmp) rm(result.table) rm(counts_full) rm(counts_simple_full) rm(cutoff) rm(lfc.cutoff) rm(padj.cutoff) rm(filename) # ----------------------------------- #DE.genes.sh1.limma.upreg <- DE.genes.sh1.limma %>% filter(logFC > 0) #DE.genes.sh1.limma.downreg <- DE.genes.sh1.limma %>% filter(logFC < 0) #DE.genes.sh2.limma.upreg <- DE.genes.sh2.limma %>% filter(logFC > 0) #DE.genes.sh2.limma.downreg <- DE.genes.sh2.limma %>% filter(logFC < 0)
/scripts/4-4/DE-analysis/Limma/Limma.r
no_license
lorenzoiuri/thesis-support-material
R
false
false
4,276
r
basedir <- "/mnt/hdd0/univ/thesis-support-material/data/" library(edgeR) library(tidyr) library(dplyr) library(readr) library(stringr) # GUIDE: # https://ucdavis-bioinformatics-training.github.io/2018-June-RNA-Seq-Workshop/thursday/DE.html # importing data setwd(paste0(basedir, "4-4/featureCounts-output/")) filename = "counts.txt" #filename = "filtered-only-lncrnas/counts_only_lncRNA.txt" counts_full <- read_delim(filename, "\t", escape_double = FALSE, trim_ws = TRUE, skip = 1) counts_simple_full <- as.matrix(counts_full[,c(7,8,9,10,11,12)]) # renaming the rows and columns # note: bc*-1 are the shNT samples # bc*-2 are the sh1 samples # bc*-3 are the sh2 samples colnames(counts_simple_full) <- c("bc1-1", "bc1-2", "bc1-3", "bc2-1", "bc2-2", "bc2-3") rownames(counts_simple_full) <- counts_full$Geneid # set adjusted pvalue and LFC cutoffs padj.cutoff <- 0.01 lfc.cutoff <- 0.58 # ----- shNT vs sh-1 ---- # keeping only shNT and sh1 samples counts <- counts_simple_full[,c(1,4,2,5)] condition <- factor(c(rep("control", 2), rep("sh1", 2))) sampleInfo <- data.frame(row.names = colnames(counts), condition) group <- sampleInfo$condition # creating object d0 <- DGEList(counts) # compute normalization factors d0 <- calcNormFactors(d0) # filtering low expressed genes # we remove the genes whose cpm normalized count is < 1 # in every sample cutoff <- 1 drop <- which(apply(cpm(d0), 1, max) < cutoff) d <- d0[-drop,] mm <- model.matrix(~0 + group) y <- voom(d, mm, plot = F) # model fitting fit <- lmFit(y, mm) # setting the comparison between control and sh1 contr <- makeContrasts(groupsh1 - groupcontrol, levels = colnames(coef(fit))) # Estimate contrast for each gene tmp <- contrasts.fit(fit, contr) tmp <- eBayes(tmp) result.table <- topTable(tmp, sort.by = "P", n = Inf) DE.genes.sh1.limma <- result.table %>% filter(adj.P.Val < padj.cutoff & abs(logFC) > lfc.cutoff ) %>% arrange(-logFC) %>% mutate(gene = rownames(.)) %>% select(gene, adj.P.Val, logFC) DE.genes.sh1.limma <- as_tibble(DE.genes.sh1.limma) # ----------------------- rm(counts) rm(condition) rm(sampleInfo) rm(group) rm(d0) rm(d) rm(mm) rm(drop) rm(y) rm(fit) rm(contr) rm(tmp) rm(result.table) # ----- shNT vs sh2 ---- # keeping only shNT and sh2 samples counts <- counts_simple_full[,c(1,4,3,6)] condition <- factor(c(rep("control", 2), rep("sh2", 2))) sampleInfo <- data.frame(row.names = colnames(counts), condition) group <- sampleInfo$condition # creating object d0 <- DGEList(counts) # compute normalization factors d0 <- calcNormFactors(d0) # filtering low expressed genes # we remove the genes whose cpm normalized count is < 1 # in every sample cutoff <- 1 drop <- which(apply(cpm(d0), 1, max) < cutoff) d <- d0[-drop,] mm <- model.matrix(~0 + group) y <- voom(d, mm, plot = F) # model fitting fit <- lmFit(y, mm) # setting the comparison between control and sh1 contr <- makeContrasts(groupsh2 - groupcontrol, levels = colnames(coef(fit))) # Estimate contrast for each gene tmp <- contrasts.fit(fit, contr) tmp <- eBayes(tmp) result.table <- topTable(tmp, sort.by = "P", n = Inf) DE.genes.sh2.limma <- result.table %>% filter(adj.P.Val < padj.cutoff & abs(logFC) > lfc.cutoff ) %>% arrange(-logFC) %>% mutate(gene = rownames(.)) %>% select(gene, adj.P.Val, logFC) DE.genes.sh2.limma <- as_tibble(DE.genes.sh2.limma) # ---------------------------------- # a value of LFC > 0 means that the gene is MORE EXPRESSED in the sh1 (or sh2) # samples (the gene is upregulated upon tp53-mut silencing) rm(counts) rm(condition) rm(sampleInfo) rm(group) rm(d0) rm(d) rm(mm) rm(drop) rm(y) rm(fit) rm(contr) rm(tmp) rm(result.table) rm(counts_full) rm(counts_simple_full) rm(cutoff) rm(lfc.cutoff) rm(padj.cutoff) rm(filename) # ----------------------------------- #DE.genes.sh1.limma.upreg <- DE.genes.sh1.limma %>% filter(logFC > 0) #DE.genes.sh1.limma.downreg <- DE.genes.sh1.limma %>% filter(logFC < 0) #DE.genes.sh2.limma.upreg <- DE.genes.sh2.limma %>% filter(logFC > 0) #DE.genes.sh2.limma.downreg <- DE.genes.sh2.limma %>% filter(logFC < 0)
df2$R_cluster = NA #df2$cluster2 = NA AAA_R <- NULL for(i in 1:nrow(df2)){ # i = 1:n for(i in i){ # Start i[1],j[1:n] , i[2]:j[1:n] loop for(j in 1:nrow(df2)){ outputR <- print((df2$High[i] - df2$High[j])^2)# distance keep in output AAA_R <- rbind(AAA_R,outputR) # combine output in AAA AAA_R <- data.frame(AAA_R) # Create Data Frame outR <- as.data.frame(matrix(AAA_R$AAA_R[AAA_R$AAA_R!=""], ncol=nrow(df1), byrow=TRUE)) # 1 column to start_Day:today column diag(outR)=max(Data_NEW$High,na.rm = TRUE)^2 # Change Diagonal = 999 #df2$error[i] = min(out[i]) #df2$cluster[i] = which(out[i]== min(out[i])) } } } #################################################################################### #find dot nearest for(i in 1:nrow(df2)){ df2$R_cluster[i] = which(outR[i]== min(outR[i])) # column[n] find min #df2$cluster2[i] = order(out[i])[2] } #################################################################################### # COlumn numeric to draw a line df2$R_line = NA for(i in 1:nrow(df2)){ # i = 1:n for(i in i){ # Start i[1],j[1:n] , i[2]:j[1:n] loop for(j in 1:nrow(df2)){ if(df2$R_cluster[i] == df2$No[j]){ # if cluster[1] == No[1,2,3,...,today] is TRUE/print Low is row TRUE df2$R_line[i] = df2$High[j] } } } } #################################################################################### # Column = group by & count df2 <- df2 %>% group_by(df2$R_cluster) %>% mutate(R_count = n()) %>% ungroup() df2$`df2$R_cluster` <- NULL #################################################################################### df2$R_Confirm <- ifelse(df2$R_count >= 2, "let's go","Nope") # if else #################################################################################### ResistanceLine = NA for(i in 1:nrow(df2)){ if(df2$R_Confirm[i] == "let's go" & df2$High[i] >= df2$High[nrow(df2)]){ ResistanceLine[i] = (c(df2$R_line[i])) } } plot(addLines(h=c(ResistanceLine),col = "yellow"))
/ADA_ResistanceLine(link_SL).R
no_license
PersThanachot/Crypto_Support-ResistanceLine
R
false
false
2,092
r
df2$R_cluster = NA #df2$cluster2 = NA AAA_R <- NULL for(i in 1:nrow(df2)){ # i = 1:n for(i in i){ # Start i[1],j[1:n] , i[2]:j[1:n] loop for(j in 1:nrow(df2)){ outputR <- print((df2$High[i] - df2$High[j])^2)# distance keep in output AAA_R <- rbind(AAA_R,outputR) # combine output in AAA AAA_R <- data.frame(AAA_R) # Create Data Frame outR <- as.data.frame(matrix(AAA_R$AAA_R[AAA_R$AAA_R!=""], ncol=nrow(df1), byrow=TRUE)) # 1 column to start_Day:today column diag(outR)=max(Data_NEW$High,na.rm = TRUE)^2 # Change Diagonal = 999 #df2$error[i] = min(out[i]) #df2$cluster[i] = which(out[i]== min(out[i])) } } } #################################################################################### #find dot nearest for(i in 1:nrow(df2)){ df2$R_cluster[i] = which(outR[i]== min(outR[i])) # column[n] find min #df2$cluster2[i] = order(out[i])[2] } #################################################################################### # COlumn numeric to draw a line df2$R_line = NA for(i in 1:nrow(df2)){ # i = 1:n for(i in i){ # Start i[1],j[1:n] , i[2]:j[1:n] loop for(j in 1:nrow(df2)){ if(df2$R_cluster[i] == df2$No[j]){ # if cluster[1] == No[1,2,3,...,today] is TRUE/print Low is row TRUE df2$R_line[i] = df2$High[j] } } } } #################################################################################### # Column = group by & count df2 <- df2 %>% group_by(df2$R_cluster) %>% mutate(R_count = n()) %>% ungroup() df2$`df2$R_cluster` <- NULL #################################################################################### df2$R_Confirm <- ifelse(df2$R_count >= 2, "let's go","Nope") # if else #################################################################################### ResistanceLine = NA for(i in 1:nrow(df2)){ if(df2$R_Confirm[i] == "let's go" & df2$High[i] >= df2$High[nrow(df2)]){ ResistanceLine[i] = (c(df2$R_line[i])) } } plot(addLines(h=c(ResistanceLine),col = "yellow"))
## THIS FILE GEOCODES THE DOC RELEASE RECORDS AND MAPS THEM TO THEIR HOME ## VOTER PRECINCTS AND CENSUS BLOCK GROUPS released <- fread("./raw_data/doc/INMATE_RELEASE_ROOT_0419.csv") parole <- fread("./raw_data/doc/OFFENDER_ROOT_0419.csv") incarcerated <- fread("./raw_data/doc/INMATE_ACTIVE_ROOT_0419.csv") released <- filter(released, !(DCNumber %in% parole$DCNumber), !(DCNumber %in% incarcerated$DCNumber)) addresses <- fread("./raw_data/doc/INMATE_RELEASE_RESIDENCE_0419.csv") released_with_addresses <- inner_join(released, addresses) %>% filter(releasedateflag_descr == "valid release date") full_n <- nrow(released_with_addresses) saveRDS(full_n, "./temp/number_released.rds") released_with_addresses <- released_with_addresses %>% filter(grepl("[0-9]", substring(AddressLine1, 1, 1))) %>% mutate(address = gsub("[#]", "", paste(AddressLine1, City))) drop_start_chara <- full_n - nrow(released_with_addresses) n_to_geo <- nrow(released_with_addresses) saveRDS(nrow(released_with_addresses), "./temp/number_released_goodnumber.rds") released_with_addresses$group <- ceiling((c(1:nrow(released_with_addresses)) / nrow(released_with_addresses))*4) # these take a long time and are expensive to run so commenting out # lats_longs1 <- geocode(filter(released_with_addresses, group == 1)$address, override_limit = T, output = "more") # saveRDS(lats_longs1, "./temp/geocode_output1.rds") # lats_longs2 <- geocode(filter(released_with_addresses, group == 2)$address, override_limit = T, output = "more") # saveRDS(lats_longs2, "./temp/geocode_output2.rds") # lats_longs3 <- geocode(filter(released_with_addresses, group == 3)$address, override_limit = T, output = "more") # saveRDS(lats_longs3, "./temp/geocode_output3.rds") # lats_longs4 <- geocode(filter(released_with_addresses, group == 4)$address, override_limit = T, output = "more") # saveRDS(lats_longs4, "./temp/geocode_output4.rds") lats_longs <- bind_rows( readRDS("./temp/geocode_output1.rds"), readRDS("./temp/geocode_output2.rds"), readRDS("./temp/geocode_output3.rds"), readRDS("./temp/geocode_output4.rds") ) ### now keep only those in florida with good addresses, map to precincts released_with_addresses <- bind_cols(released_with_addresses, rename(lats_longs, ggl_address = address)) %>% filter(grepl(", fl ", ggl_address)) drop_geocode <- n_to_geo - nrow(released_with_addresses) ngood_geo <- nrow(released_with_addresses) released_with_addresses <- released_with_addresses %>% filter(!is.na(lat), !is.na(lon), loctype %in% c("range_interpolated", "rooftop")) ndrop_out_fl <- ngood_geo - nrow(released_with_addresses) saveRDS(nrow(released_with_addresses), "./temp/good_geocoded.rds") precincts <- readOGR("./raw_data/shapefiles/fl_2016_FEST", "fl_2016") precincts@data$full_id <- paste0(precincts@data$county, precincts@data$pct) precincts <- spTransform(precincts, "+init=epsg:4326") pings <- SpatialPoints(released_with_addresses[,c('lon','lat')], proj4string = precincts@proj4string) released_with_addresses$precinct <- over(pings, precincts)$full_id #### now map to census block groups bgs <- readOGR("./raw_data/shapefiles/tl_2018_12_bg", "tl_2018_12_bg") bgs <- spTransform(bgs, "+init=epsg:4326") pings <- SpatialPoints(released_with_addresses[,c('lon','lat')], proj4string = bgs@proj4string) released_with_addresses$block_group <- over(pings, bgs)$GEOID saveRDS(released_with_addresses, "./temp/released_with_addresses.rds") saveRDS(sum(released_with_addresses$loctype %in% c("range_interpolated", "rooftop")), "./temp/good_geocoded.rds") ############ COLLAPSE DOWN TO PRECINCTS / BLOCK GROUPS doc <- readRDS("./temp/released_with_addresses.rds") %>% mutate(county = substring(precinct, 1, 3), precinct = str_pad(substring(precinct, 4), width = 10, side = "left", pad = "0"), cp = paste0(county, precinct), PrisonReleaseDate = as.Date(substring(PrisonReleaseDate, 1, 10), "%m/%d/%Y"), years_since = 2018 - year(PrisonReleaseDate)) %>% filter(!is.na(cp), PrisonReleaseDate <= "2018-11-06") %>% group_by(ggl_address) %>% mutate(big_release = n() >= 5, years_since = ifelse(big_release, NA, years_since)) %>% group_by(cp) %>% summarize(years_since = mean(years_since, na.rm = T), all_doc = n(), small_res_doc = sum(1 - big_release), big_release = sum(big_release)) saveRDS(doc, "temp/full_doc_precinct.rds") doc_recent <- readRDS("./temp/released_with_addresses.rds") %>% mutate(county = substring(precinct, 1, 3), precinct = str_pad(substring(precinct, 4), width = 10, side = "left", pad = "0"), cp = paste0(county, precinct), PrisonReleaseDate = as.Date(substring(PrisonReleaseDate, 1, 10), "%m/%d/%Y"), years_since = 2018 - year(PrisonReleaseDate)) %>% filter(!is.na(cp), PrisonReleaseDate >= "2015-01-01", PrisonReleaseDate <= "2018-11-06") %>% group_by(ggl_address) %>% mutate(big_release_recent = n() >= 5) %>% group_by(cp) %>% summarize(all_doc_recent = n(), small_res_doc_recent = sum(1 - big_release_recent), big_release_recent = sum(big_release_recent)) saveRDS(doc_recent, "temp/recent_doc_precinct.rds") ## block groups doc_bg <- readRDS("./temp/released_with_addresses.rds") %>% mutate(county = substring(precinct, 1, 3), PrisonReleaseDate = as.Date(substring(PrisonReleaseDate, 1, 10), "%m/%d/%Y")) %>% filter(!is.na(block_group), PrisonReleaseDate <= "2018-11-06") %>% group_by(ggl_address) %>% mutate(big_release = n() >= 5, years_since = ifelse(big_release, NA, 2018 - year(PrisonReleaseDate))) %>% group_by(GEOID = block_group) %>% summarize(years_since = mean(years_since, na.rm = T), all_doc = n(), small_res_doc = sum(1 - big_release)) saveRDS(doc_bg, "temp/all_doc_bg.rds") doc_bg_recent <- readRDS("./temp/released_with_addresses.rds") %>% mutate(county = substring(precinct, 1, 3), PrisonReleaseDate = as.Date(substring(PrisonReleaseDate, 1, 10), "%m/%d/%Y")) %>% filter(!is.na(block_group), PrisonReleaseDate >= "2015-01-01", PrisonReleaseDate <= "2018-11-06") %>% group_by(ggl_address) %>% mutate(big_release = n() >= 5) %>% group_by(GEOID = block_group) %>% summarize(all_doc_recent = n(), small_res_doc_recent = sum(1 - big_release)) saveRDS(doc_bg_recent, "temp/recent_doc_bg.rds")
/code/01_geocode_releasees.R
no_license
ktmorris/florida_am4
R
false
false
6,628
r
## THIS FILE GEOCODES THE DOC RELEASE RECORDS AND MAPS THEM TO THEIR HOME ## VOTER PRECINCTS AND CENSUS BLOCK GROUPS released <- fread("./raw_data/doc/INMATE_RELEASE_ROOT_0419.csv") parole <- fread("./raw_data/doc/OFFENDER_ROOT_0419.csv") incarcerated <- fread("./raw_data/doc/INMATE_ACTIVE_ROOT_0419.csv") released <- filter(released, !(DCNumber %in% parole$DCNumber), !(DCNumber %in% incarcerated$DCNumber)) addresses <- fread("./raw_data/doc/INMATE_RELEASE_RESIDENCE_0419.csv") released_with_addresses <- inner_join(released, addresses) %>% filter(releasedateflag_descr == "valid release date") full_n <- nrow(released_with_addresses) saveRDS(full_n, "./temp/number_released.rds") released_with_addresses <- released_with_addresses %>% filter(grepl("[0-9]", substring(AddressLine1, 1, 1))) %>% mutate(address = gsub("[#]", "", paste(AddressLine1, City))) drop_start_chara <- full_n - nrow(released_with_addresses) n_to_geo <- nrow(released_with_addresses) saveRDS(nrow(released_with_addresses), "./temp/number_released_goodnumber.rds") released_with_addresses$group <- ceiling((c(1:nrow(released_with_addresses)) / nrow(released_with_addresses))*4) # these take a long time and are expensive to run so commenting out # lats_longs1 <- geocode(filter(released_with_addresses, group == 1)$address, override_limit = T, output = "more") # saveRDS(lats_longs1, "./temp/geocode_output1.rds") # lats_longs2 <- geocode(filter(released_with_addresses, group == 2)$address, override_limit = T, output = "more") # saveRDS(lats_longs2, "./temp/geocode_output2.rds") # lats_longs3 <- geocode(filter(released_with_addresses, group == 3)$address, override_limit = T, output = "more") # saveRDS(lats_longs3, "./temp/geocode_output3.rds") # lats_longs4 <- geocode(filter(released_with_addresses, group == 4)$address, override_limit = T, output = "more") # saveRDS(lats_longs4, "./temp/geocode_output4.rds") lats_longs <- bind_rows( readRDS("./temp/geocode_output1.rds"), readRDS("./temp/geocode_output2.rds"), readRDS("./temp/geocode_output3.rds"), readRDS("./temp/geocode_output4.rds") ) ### now keep only those in florida with good addresses, map to precincts released_with_addresses <- bind_cols(released_with_addresses, rename(lats_longs, ggl_address = address)) %>% filter(grepl(", fl ", ggl_address)) drop_geocode <- n_to_geo - nrow(released_with_addresses) ngood_geo <- nrow(released_with_addresses) released_with_addresses <- released_with_addresses %>% filter(!is.na(lat), !is.na(lon), loctype %in% c("range_interpolated", "rooftop")) ndrop_out_fl <- ngood_geo - nrow(released_with_addresses) saveRDS(nrow(released_with_addresses), "./temp/good_geocoded.rds") precincts <- readOGR("./raw_data/shapefiles/fl_2016_FEST", "fl_2016") precincts@data$full_id <- paste0(precincts@data$county, precincts@data$pct) precincts <- spTransform(precincts, "+init=epsg:4326") pings <- SpatialPoints(released_with_addresses[,c('lon','lat')], proj4string = precincts@proj4string) released_with_addresses$precinct <- over(pings, precincts)$full_id #### now map to census block groups bgs <- readOGR("./raw_data/shapefiles/tl_2018_12_bg", "tl_2018_12_bg") bgs <- spTransform(bgs, "+init=epsg:4326") pings <- SpatialPoints(released_with_addresses[,c('lon','lat')], proj4string = bgs@proj4string) released_with_addresses$block_group <- over(pings, bgs)$GEOID saveRDS(released_with_addresses, "./temp/released_with_addresses.rds") saveRDS(sum(released_with_addresses$loctype %in% c("range_interpolated", "rooftop")), "./temp/good_geocoded.rds") ############ COLLAPSE DOWN TO PRECINCTS / BLOCK GROUPS doc <- readRDS("./temp/released_with_addresses.rds") %>% mutate(county = substring(precinct, 1, 3), precinct = str_pad(substring(precinct, 4), width = 10, side = "left", pad = "0"), cp = paste0(county, precinct), PrisonReleaseDate = as.Date(substring(PrisonReleaseDate, 1, 10), "%m/%d/%Y"), years_since = 2018 - year(PrisonReleaseDate)) %>% filter(!is.na(cp), PrisonReleaseDate <= "2018-11-06") %>% group_by(ggl_address) %>% mutate(big_release = n() >= 5, years_since = ifelse(big_release, NA, years_since)) %>% group_by(cp) %>% summarize(years_since = mean(years_since, na.rm = T), all_doc = n(), small_res_doc = sum(1 - big_release), big_release = sum(big_release)) saveRDS(doc, "temp/full_doc_precinct.rds") doc_recent <- readRDS("./temp/released_with_addresses.rds") %>% mutate(county = substring(precinct, 1, 3), precinct = str_pad(substring(precinct, 4), width = 10, side = "left", pad = "0"), cp = paste0(county, precinct), PrisonReleaseDate = as.Date(substring(PrisonReleaseDate, 1, 10), "%m/%d/%Y"), years_since = 2018 - year(PrisonReleaseDate)) %>% filter(!is.na(cp), PrisonReleaseDate >= "2015-01-01", PrisonReleaseDate <= "2018-11-06") %>% group_by(ggl_address) %>% mutate(big_release_recent = n() >= 5) %>% group_by(cp) %>% summarize(all_doc_recent = n(), small_res_doc_recent = sum(1 - big_release_recent), big_release_recent = sum(big_release_recent)) saveRDS(doc_recent, "temp/recent_doc_precinct.rds") ## block groups doc_bg <- readRDS("./temp/released_with_addresses.rds") %>% mutate(county = substring(precinct, 1, 3), PrisonReleaseDate = as.Date(substring(PrisonReleaseDate, 1, 10), "%m/%d/%Y")) %>% filter(!is.na(block_group), PrisonReleaseDate <= "2018-11-06") %>% group_by(ggl_address) %>% mutate(big_release = n() >= 5, years_since = ifelse(big_release, NA, 2018 - year(PrisonReleaseDate))) %>% group_by(GEOID = block_group) %>% summarize(years_since = mean(years_since, na.rm = T), all_doc = n(), small_res_doc = sum(1 - big_release)) saveRDS(doc_bg, "temp/all_doc_bg.rds") doc_bg_recent <- readRDS("./temp/released_with_addresses.rds") %>% mutate(county = substring(precinct, 1, 3), PrisonReleaseDate = as.Date(substring(PrisonReleaseDate, 1, 10), "%m/%d/%Y")) %>% filter(!is.na(block_group), PrisonReleaseDate >= "2015-01-01", PrisonReleaseDate <= "2018-11-06") %>% group_by(ggl_address) %>% mutate(big_release = n() >= 5) %>% group_by(GEOID = block_group) %>% summarize(all_doc_recent = n(), small_res_doc_recent = sum(1 - big_release)) saveRDS(doc_bg_recent, "temp/recent_doc_bg.rds")
% Generated by roxygen2 (4.1.1): do not edit by hand % Please edit documentation in R/cr_search_free.r \name{cr_search_free} \alias{cr_search_free} \title{Search the CrossRef Metatdata for DOIs using free form references.} \usage{ cr_search_free(query, url = "http://search.crossref.org/links") } \arguments{ \item{query}{Reference query; a character vector of length 1 or greater, comma-separated of course.} \item{url}{Base url for the Crossref metadata API.} } \description{ Search the CrossRef Metatdata for DOIs using free form references. } \details{ Have to have at least three terms in each search query. } \examples{ \dontrun{ # search with title, author, year, and journal cr_search_free(query = "Piwowar Sharing Detailed Research Data Is Associated with Increased Citation Rate PLOS one 2007") cr_search_free(query="Renear 2012") # too few words, need at least 3 cr_search_free(query=c("Renear 2012","Piwowar sharing data PLOS one")) # multiple queries # Get a DOI and get the citation using cr_search doi <- cr_search_free(query="Piwowar sharing data PLOS one")$doi cr_search(doi = doi) # Queries can be quite complex too cr_search_free("M. Henrion, D. J. Mortlock, D. J. Hand, and A. Gandy, \\"A Bayesian approach to star-galaxy classification,\\" Monthly Notices of the Royal Astronomical Society, vol. 412, no. 4, pp. 2286-2302, Apr. 2011.") # Lots of queries queries <- c("Piwowar sharing data PLOS one", "Priem Scientometrics 2.0 social web", "William Gunn A Crosstalk Between Myeloma Cells", "karthik ram Metapopulation dynamics override local limits") cr_search_free(queries) } } \author{ Scott Chamberlain \email{myrmecocystus@gmail.com} } \seealso{ \code{\link{cr_search}}, \code{\link{cr_r}}, \code{\link{cr_citation}} }
/man/cr_search_free.Rd
permissive
andreywork/rcrossref
R
false
false
1,752
rd
% Generated by roxygen2 (4.1.1): do not edit by hand % Please edit documentation in R/cr_search_free.r \name{cr_search_free} \alias{cr_search_free} \title{Search the CrossRef Metatdata for DOIs using free form references.} \usage{ cr_search_free(query, url = "http://search.crossref.org/links") } \arguments{ \item{query}{Reference query; a character vector of length 1 or greater, comma-separated of course.} \item{url}{Base url for the Crossref metadata API.} } \description{ Search the CrossRef Metatdata for DOIs using free form references. } \details{ Have to have at least three terms in each search query. } \examples{ \dontrun{ # search with title, author, year, and journal cr_search_free(query = "Piwowar Sharing Detailed Research Data Is Associated with Increased Citation Rate PLOS one 2007") cr_search_free(query="Renear 2012") # too few words, need at least 3 cr_search_free(query=c("Renear 2012","Piwowar sharing data PLOS one")) # multiple queries # Get a DOI and get the citation using cr_search doi <- cr_search_free(query="Piwowar sharing data PLOS one")$doi cr_search(doi = doi) # Queries can be quite complex too cr_search_free("M. Henrion, D. J. Mortlock, D. J. Hand, and A. Gandy, \\"A Bayesian approach to star-galaxy classification,\\" Monthly Notices of the Royal Astronomical Society, vol. 412, no. 4, pp. 2286-2302, Apr. 2011.") # Lots of queries queries <- c("Piwowar sharing data PLOS one", "Priem Scientometrics 2.0 social web", "William Gunn A Crosstalk Between Myeloma Cells", "karthik ram Metapopulation dynamics override local limits") cr_search_free(queries) } } \author{ Scott Chamberlain \email{myrmecocystus@gmail.com} } \seealso{ \code{\link{cr_search}}, \code{\link{cr_r}}, \code{\link{cr_citation}} }
###Gabriel Agbesi Atsyor#### ##Masters Thesis R script### #setting the working directory getwd() setwd("C:/Users/GHOOST/Desktop/New Lit/data") #attaching packages library(lavaan) library(foreign) library(car) library(psych) library(ggplot2) library(summarytools) library(knitr) library(gridExtra) library(kableExtra) library(stargazer) library(multcomp) #attaching the data data<-read.csv("International Students Survey.csv") attach(data) ##FACTORS INFLUENCING STUDENTS DECISION TO STUDY IN RUSSIA #Data preparation: Demographic information #Age table(Age) summary(as.numeric(Age)) data$age<-recode(as.numeric(Age),"17:21=1; 22:26=2;27:hi=3") table(data$age) data$age<-factor(data$age,lab=c("17 to 21 yrs", "22 to 26 yrs", " 27 yrs and older")) #Degree data$degree<-What.degree.are.you.currently.studying.for. #Language of instruction data$language.of.instruction<-What.is.the.language.of.instruction.for.your.program. data$family.income<-What.was.your.annual.family.income.when.you.were.applying.to.study.abroad..estimate.in.US.dollars. #country regions table(Home.country) data$world.region[data$Home.country == 'Algeria'| data$Home.country == 'Botswana'| data$Home.country == 'Cameroon'| data$Home.country == 'Chad'| data$Home.country == 'Congo'| data$Home.country == 'DR Congo'|data$Home.country == 'Eritrea'| data$Home.country == 'Ivory Coast'| data$Home.country == 'Gambia'|data$Home.country == 'Ghana'| data$Home.country == 'Kenya'|data$Home.country == 'Madagascar'| data$Home.country == 'Niger'|data$Home.country == 'Nigeria'| data$Home.country == 'South Africa'|data$Home.country == 'Sudan'| data$Home.country == 'Uganda'|data$Home.country == 'Zambia'] <- 'Africa' data$world.region[data$Home.country == 'Bangladesh'| data$Home.country == 'India'| data$Home.country == 'Nepal'| data$Home.country == 'Pakistan'| data$Home.country == 'Sri Lanka'|data$Home.country == 'Indonesia'| data$Home.country == 'Philippines'|data$Home.country == 'Thailand'| data$Home.country == 'Vietnam'|data$Home.country == 'China'| data$Home.country == 'Japan'|data$Home.country == 'Mongolia'| data$Home.country == 'South Korea'|data$Home.country == 'Hong Kong'| data$Home.country == 'Taiwan'] <- 'Asia' data$world.region[data$Home.country == 'Australia'| data$Home.country == 'Austria'| data$Home.country == 'Bosnia and Herzegovina'| data$Home.country == 'Bulgaria'| data$Home.country == 'Europe'| data$Home.country == 'France'| data$Home.country == 'Germany'| data$Home.country == 'Italy'|data$Home.country == 'Poland'| data$Home.country == 'Portugal'|data$Home.country == 'Serbia'| data$Home.country == 'Spain'|data$Home.country == 'Switzerland'| data$Home.country == 'Republic of North Macedonia'| data$Home.country == 'USA'] <- 'Europe' data$world.region[data$Home.country == 'Armenia'| data$Home.country == 'Azerbaijan'|data$Home.country == 'Belarus'| data$Home.country == 'Estonia'|data$Home.country == 'Georgia'| data$Home.country == 'Georgia'|data$Home.country == 'Kazakhstan'| data$Home.country == 'Kyrgyzstan'|data$Home.country == 'Latvia'| data$Home.country == 'Moldova'|data$Home.country == 'Tajikistan'| data$Home.country == 'Turkmenistan'|data$Home.country == 'Ukraine'| data$Home.country == 'Uzbekistan'] <- 'Commonwealth of Independent States' data$world.region[data$Home.country == 'Bahrain'| data$Home.country == 'Egypt'| data$Home.country == 'Iran'| data$Home.country == 'Israel'| data$Home.country == 'Lebanon'| data$Home.country == 'Syria'| data$Home.country == 'Turkey'] <- 'Middle East' data$world.region[data$Home.country == 'Brazil'| data$Home.country == 'Colombia'|data$Home.country == 'Ecuador'| data$Home.country == 'Guatemala'| data$Home.country == 'Haiti'| data$Home.country == 'Mexico'|data$Home.country == 'Venezuela'| data$Home.country == 'Nicaragua'] <- 'Southern America' table(data$world.region, useNA = "ifany") attach(data) ##Regression Analysis:Factors that influenced the decision of international students to study in Russia #Data Preparation: Push Factors is.numeric(Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution) Competitive.University.admission.process<-Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution is.numeric(Competitive.University.admission.process) is.numeric(Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market) Perceived.advantage.of.international.degree<-Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market is.numeric(Perceived.advantage.of.international.degree) #creating a data frame for push factors PushFactors <-data.frame(language.of.instruction, degree, age, Gender, world.region, Home.country, Unavailability.of.the.desired.study.program,Low.quality.of.education ,Competitive.University.admission.process ,Perceived.advantage.of.international.degree ,Unavailability.of.scholarship.opportunities ,Encouragement.from.my.family.to.study.abroad,Encouragement.from..my.friends.to.study.abroad ,Better.earning.prospects.abroad, The.social.prestige.of.studying.abroad ,To.experience.a.different.culture) #exploratory factor analysis to allow for indexing. #principal component analysis pushpc <- princomp(~Unavailability.of.the.desired.study.program+Low.quality.of.education +Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution +Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market +Unavailability.of.scholarship.opportunities +Encouragement.from.my.family.to.study.abroad+Encouragement.from..my.friends.to.study.abroad +Better.earning.prospects.abroad+The.social.prestige.of.studying.abroad +To.experience.a.different.culture, data = PushFactors, cor = FALSE, na.action = na.omit) summary(pushpc) #factor analysis push.efa <- factanal(~Unavailability.of.the.desired.study.program+Low.quality.of.education +Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution +Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market +Unavailability.of.scholarship.opportunities +Encouragement.from.my.family.to.study.abroad+Encouragement.from..my.friends.to.study.abroad +Better.earning.prospects.abroad+The.social.prestige.of.studying.abroad +To.experience.a.different.culture, factors = 6, data = PushFactors , cor = FALSE, na.action = na.omit) print(push.efa, digits=2, cutoff=.3, sort=TRUE) push.efa1 <- factanal(~Unavailability.of.the.desired.study.program+Low.quality.of.education +Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution +Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market +Unavailability.of.scholarship.opportunities +Encouragement.from.my.family.to.study.abroad+Encouragement.from..my.friends.to.study.abroad +Better.earning.prospects.abroad+The.social.prestige.of.studying.abroad +To.experience.a.different.culture, factors = 5, data = PushFactors, cor = FALSE, na.action = na.omit) print(push.efa1, digits=2, cutoff=.3, sort=TRUE) push.efa2 <- factanal(~Unavailability.of.the.desired.study.program+Low.quality.of.education +Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution +Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market +Unavailability.of.scholarship.opportunities +Encouragement.from.my.family.to.study.abroad+Encouragement.from..my.friends.to.study.abroad +Better.earning.prospects.abroad+The.social.prestige.of.studying.abroad +To.experience.a.different.culture, factors = 4, data = PushFactors, cor = FALSE, na.action = na.omit) print(push.efa2, digits=2, cutoff=.3, sort=TRUE) #with p-value 0.0415, four factors are sufficient. #indexing the correlated factors #encouragement from family and friends cor.test(Encouragement.from..my.friends.to.study.abroad,Encouragement.from.my.family.to.study.abroad) encouragement.from.family.friends<-(Encouragement.from..my.friends.to.study.abroad+Encouragement.from.my.family.to.study.abroad)/2 table(encouragement.from.family.friends) PushFactors$encouragement.from.family.friends<-recode(encouragement.from.family.friends, "1=1; 1.5:2=2; 2.5:3=3; 3.5:4=4; 4.5:5=5") table(PushFactors$encouragement.from.family.friends) #advantages of studying abroad cor.test(Better.earning.prospects.abroad,The.social.prestige.of.studying.abroad) advantages.of.studying.abroad<-(Better.earning.prospects.abroad+The.social.prestige.of.studying.abroad)/2 table(advantages.of.studying.abroad) PushFactors$benefits.of.studying.abroad<-recode(advantages.of.studying.abroad, "1=1; 1.5:2=2; 2.5:3=3; 3.5:4=4; 4.5:5=5") table(PushFactors$benefits.of.studying.abroad) #access to education cor.test(Unavailability.of.the.desired.study.program,Low.quality.of.education) access.to.education<-(Unavailability.of.the.desired.study.program+Low.quality.of.education)/2 table(access.to.education) PushFactors$access.to.education<-recode(access.to.education, "1=1; 1.5:2=2; 2.5:3=3; 3.5:4=4; 4.5:5=5") table(PushFactors$access.to.education) attach(PushFactors) #checking for cronbach's aplha to establish reliability PushFactorsHC <-data.frame(access.to.education, Competitive.University.admission.process ,Perceived.advantage.of.international.degree ,Unavailability.of.scholarship.opportunities ,encouragement.from.family.friends ,advantages.of.studying.abroad ,To.experience.a.different.culture) psych::alpha(PushFactorsHC) #Regression analysis #Push factors in Home country that influenced the decision of international students to study in Russia #Empty model model0<-lm(as.numeric(language.of.instruction)~1, data = PushFactors) summary(model0) #Full Model model1<-lm(as.numeric(language.of.instruction)~encouragement.from.family.friends+ benefits.of.studying.abroad+access.to.education+ Competitive.University.admission.process+Perceived.advantage.of.international.degree+ Unavailability.of.scholarship.opportunities+To.experience.a.different.culture, data = PushFactors) summary(model1) #Full Model and controls model2<-lm(as.numeric(language.of.instruction)~encouragement.from.family.friends+ benefits.of.studying.abroad+access.to.education+ Competitive.University.admission.process+Perceived.advantage.of.international.degree+ Unavailability.of.scholarship.opportunities+To.experience.a.different.culture+as.numeric(age)+ as.numeric(Home.country)+as.numeric(Gender), data = PushFactors) summary(model2) #Full Model with interaction effect model3<-lm(as.numeric(language.of.instruction)~benefits.of.studying.abroad+ Unavailability.of.scholarship.opportunities+Competitive.University.admission.process+ (access.to.education+encouragement.from.family.friends+Perceived.advantage.of.international.degree+ To.experience.a.different.culture)*world.region, data = PushFactors) summary(model3) #Full Model and control with interaction effects model4<-lm(as.numeric(language.of.instruction)~benefits.of.studying.abroad+ Unavailability.of.scholarship.opportunities+Competitive.University.admission.process+ (access.to.education+encouragement.from.family.friends+Perceived.advantage.of.international.degree+ To.experience.a.different.culture)*world.region+as.numeric(age)+as.numeric(Gender), data = PushFactors) summary(model4) #Graph for the models stargazer(model1, model2, title="Regression Results: Push Factors in Home Country", align=TRUE, no.space=TRUE, single.row=T,type = "text", intercept.bottom = F,dep.var.labels = "Move to Moscow", out="a.doc", covariate.labels =c("Constant","Encouragement from family and friends","Benefits of studying abroad", "Access to education", "Competitive university admission process", "Perceieved advantage of an international degree", "Unavailability of scholarship opportunities", "Experience a different culture", "Age", "Home Country", "Gender")) stargazer(model3, model4, title="Regression Results: Push Factors in Home Country", align=TRUE,column.sep.width = "-5pt", no.space=TRUE, single.row=T,type = "text", intercept.bottom = F,dep.var.labels = "Move to Moscow", out="b.doc", covariate.labels =c("Constant","Benefits of studying abroad","Unavailability of scholarship opportunities", "Competitive university admission process","Access to education", "Encouragement from family and friends","Perceieved advantage of an international degree", "Experience a different culture","Asia", "CIS", "Europe", "Middle East", "South America", "Age", "Gender", "Access to education*Asia", "Access to education*CIS", "Access to education*Europe", "Access to education*Middle East", "Access to education*South America","Encouragement from family and friends*Asia", "Encouragement from family and friends*CIS", "Encouragement from family and friends*Europe", "Encouragement from family and friends*Middle East","Encouragement from family and friends*South America", "Perceieved advantage of an international degree*Asia","Perceieved advantage of an international degree*CIS", "Perceieved advantage of an international degree*Europe","Perceieved advantage of an international degree*Middle East", "Perceieved advantage of an international degree*South America","Experience a different culture*Asia", "Experience a different culture*CIS", "Experience a different culture*Europe", "Encouragement from family and friends*Middle East","Experience a different culture*South America")) #checking multicolinearity vif(model1) vif(model2) vif(model3) vif(model4) ####Pull factors that influenced the decision of international students to study in Russia Recommendations.from.family.friends<-Personal.recommendations.from.parents..relatives..and.friends #creating a data frame for push factors PullFactors<-data.frame(language.of.instruction, age, Gender, world.region, Home.country, Availability.of.desired.study.program,Higher.quality.of.education..compared.to.home.country., Low.cost.of.living,Low.tuition.fees,Awarded.scholarships.or.tuition.waiver,Attraction.to.Russian.culture..society, Career.prospects.in.Russia,Recommendations.from.family.friends,cultural.proximity.with.home, geographical.proximity.with.home,Quality.and.reputation.of.the.University,Recognition.of.the.degree.in.my.home.country, Quality.of.the.teaching.staff,The.reputation.of.the.alumni,The.reputation.of.the.international.community, HSE.position.in.international.university.rankings,Cost.of.tuition.for.international.students,Availability.of.scholarships, Support.services.for.international.students,Graduates.employment.rates,HSE.s.international.strategic.alliances, Local.employers.preference.of..degrees.awarded.by.HSE) #exploratory factor analysis to allow for index. #principal component analysis fit.pc <- princomp(~Availability.of.desired.study.program+Higher.quality.of.education..compared.to.home.country. +Low.cost.of.living+Low.tuition.fees+Awarded.scholarships.or.tuition.waiver+Attraction.to.Russian.culture..society +Career.prospects.in.Russia+Personal.recommendations.from.parents..relatives..and.friends+cultural.proximity.with.home +geographical.proximity.with.home+Quality.and.reputation.of.the.University+Recognition.of.the.degree.in.my.home.country +Quality.of.the.teaching.staff+The.reputation.of.the.alumni+The.reputation.of.the.international.community +HSE.position.in.international.university.rankings+Cost.of.tuition.for.international.students +Availability.of.scholarships+Support.services.for.international.students+Graduates.employment.rates +HSE.s.international.strategic.alliances+Local.employers.preference.of..degrees.awarded.by.HSE, data = PullFactors, cor = FALSE, na.action = na.omit) summary(fit.pc) fit.efa <- factanal(~Availability.of.desired.study.program+Higher.quality.of.education..compared.to.home.country. +Low.cost.of.living+Low.tuition.fees+Awarded.scholarships.or.tuition.waiver+Attraction.to.Russian.culture..society +Career.prospects.in.Russia+Personal.recommendations.from.parents..relatives..and.friends+cultural.proximity.with.home +geographical.proximity.with.home+Quality.and.reputation.of.the.University+Recognition.of.the.degree.in.my.home.country +Quality.of.the.teaching.staff+The.reputation.of.the.alumni+The.reputation.of.the.international.community +HSE.position.in.international.university.rankings+Cost.of.tuition.for.international.students +Availability.of.scholarships+Support.services.for.international.students+Graduates.employment.rates +HSE.s.international.strategic.alliances+Local.employers.preference.of..degrees.awarded.by.HSE, factors = 11, data = PullFactors, cor = FALSE, na.action = na.omit) print(fit.efa, digits=2, cutoff=.3, sort=TRUE) fit.efa2 <- factanal(~Availability.of.desired.study.program+Higher.quality.of.education..compared.to.home.country. +Low.cost.of.living+Low.tuition.fees+Awarded.scholarships.or.tuition.waiver+Attraction.to.Russian.culture..society +Career.prospects.in.Russia+Personal.recommendations.from.parents..relatives..and.friends+cultural.proximity.with.home +geographical.proximity.with.home+Quality.and.reputation.of.the.University+Recognition.of.the.degree.in.my.home.country +Quality.of.the.teaching.staff+The.reputation.of.the.alumni+The.reputation.of.the.international.community +HSE.position.in.international.university.rankings+Cost.of.tuition.for.international.students +Availability.of.scholarships+Support.services.for.international.students+Graduates.employment.rates +HSE.s.international.strategic.alliances+Local.employers.preference.of..degrees.awarded.by.HSE, factors = 8, data = PullFactors, cor = FALSE, na.action = na.omit) print(fit.efa2, digits=2, cutoff=.3, sort=TRUE) #with p-value 6.54e-10 8 factors are sufficient. #indexing the correlated pull factors #prospect of employment cor.test(Graduates.employment.rates,Local.employers.preference.of..degrees.awarded.by.HSE) cor.test(Graduates.employment.rates,Career.prospects.in.Russia) cor.test(Career.prospects.in.Russia,Local.employers.preference.of..degrees.awarded.by.HSE) employment.prospect<-(Graduates.employment.rates+Local.employers.preference.of..degrees.awarded.by.HSE+Career.prospects.in.Russia)/3 employment.prospect<-round(employment.prospect,2) table(employment.prospect) PullFactors$employment.prospect<-recode(employment.prospect, "1:1.33=1; 1.67:2.33=2; 2.67:3.33=3; 3.67:4.33=4; 4.67:5=5") table(PullFactors$employment.prospect) #proximity cor.test(cultural.proximity.with.home,geographical.proximity.with.home) proximity<-(cultural.proximity.with.home+geographical.proximity.with.home)/2 table(proximity) PullFactors$proximity<-recode(proximity, "1=1; 1.5:2=2; 2.5:3=3; 3.5:4=4; 4.5:5=5") table(PullFactors$proximity) #cost cor.test(Low.cost.of.living,Low.tuition.fees) cor.test(Low.cost.of.living,Cost.of.tuition.for.international.students) cor.test(Low.tuition.fees,Cost.of.tuition.for.international.students) cost.of.living<-(Low.cost.of.living+Low.tuition.fees+Cost.of.tuition.for.international.students)/3 cost.of.living<-round(cost.of.living,2) table(cost.of.living) PullFactors$cost.of.living<-recode(cost.of.living, "1:1.33=1; 1.67:2.33=2; 2.67:3.33=3; 3.67:4.33=4; 4.67:5=5") table(PullFactors$cost.of.living) #scholarships cor.test(Awarded.scholarships.or.tuition.waiver,Availability.of.scholarships) scholarship<-(Awarded.scholarships.or.tuition.waiver+Availability.of.scholarships)/2 table(scholarship) PullFactors$scholarship<-recode(scholarship, "1=1; 1.5:2=2; 2.5:3=3; 3.5:4=4; 4.5:5=5") table(PullFactors$scholarship) #HSE Quality cor.test(Quality.and.reputation.of.the.University,Quality.of.the.teaching.staff) HSE.quality<-(Quality.and.reputation.of.the.University+Quality.of.the.teaching.staff)/2 table(HSE.quality) PullFactors$HSE.quality<-recode(HSE.quality, "1=1; 1.5:2=2; 2.5:3=3; 3.5:4=4; 4.5:5=5") table(PullFactors$HSE.quality) #HSE Reputation cor.test(The.reputation.of.the.alumni, The.reputation.of.the.international.community) HSE.reputation<-(The.reputation.of.the.alumni+The.reputation.of.the.international.community)/2 table(HSE.reputation) PullFactors$HSE.reputation<-recode(HSE.reputation, "1=1; 1.5:2=2; 2.5:3=3; 3.5:4=4; 4.5:5=5") table(PullFactors$HSE.reputation) #Program Choice cor.test(Higher.quality.of.education..compared.to.home.country., Availability.of.desired.study.program) program.choice<-(Higher.quality.of.education..compared.to.home.country.+ Availability.of.desired.study.program)/2 table(program.choice) PullFactors$program.choice<-recode(program.choice, "1=1; 1.5:2=2; 2.5:3=3; 3.5:4=4; 4.5:5=5") table(PullFactors$program.choice) attach(PullFactors) #checking for realibility PullFactorsRuHSE<-data.frame(program.choice,cost.of.living,proximity, scholarship,HSE.quality, HSE.reputation, Attraction.to.Russian.culture..society, Recognition.of.the.degree.in.my.home.country,Recommendations.from.family.friends, HSE.position.in.international.university.rankings,Support.services.for.international.students, HSE.s.international.strategic.alliances,employment.prospect) psych::alpha(PullFactorsRuHSE) #Full model model5<-lm(as.numeric(language.of.instruction)~employment.prospect+proximity+ cost.of.living+scholarship+HSE.quality+HSE.reputation+program.choice+ Recommendations.from.family.friends+Attraction.to.Russian.culture..society+ Recognition.of.the.degree.in.my.home.country+HSE.position.in.international.university.rankings+ Support.services.for.international.students+HSE.s.international.strategic.alliances, data = PullFactors) summary(model5) #Full model with controls model6<-lm(as.numeric(language.of.instruction)~employment.prospect+proximity+ cost.of.living+scholarship+HSE.quality+HSE.reputation+program.choice+ Recommendations.from.family.friends+Attraction.to.Russian.culture..society+ Recognition.of.the.degree.in.my.home.country+HSE.position.in.international.university.rankings+ Support.services.for.international.students+HSE.s.international.strategic.alliances+ as.numeric(age)+ as.numeric(Home.country)+as.numeric(Gender), data = PullFactors) summary(model6) #Fullmodel with interaction effect model7<-lm(as.numeric(language.of.instruction)~employment.prospect+scholarship+ HSE.quality+HSE.reputation+Recognition.of.the.degree.in.my.home.country+Support.services.for.international.students+ Attraction.to.Russian.culture..society+(Recommendations.from.family.friends+proximity+cost.of.living+ program.choice+HSE.position.in.international.university.rankings+ HSE.s.international.strategic.alliances)*world.region, data = PullFactors) summary(model7) #Fullmodel and controls with interaction effect model8<-lm(as.numeric(language.of.instruction)~employment.prospect+scholarship+ HSE.quality+HSE.reputation+Recognition.of.the.degree.in.my.home.country+ Support.services.for.international.students+Attraction.to.Russian.culture..society+ (Recommendations.from.family.friends+proximity+cost.of.living+program.choice+ HSE.position.in.international.university.rankings+HSE.s.international.strategic.alliances)*world.region+ as.numeric(age)+as.numeric(Gender), data = PullFactors) summary(model8) #Graph for the models stargazer(model5, model6, title="Regression Results: Push Factors in Home Country", align=TRUE, no.space=TRUE, single.row=T,type = "text", intercept.bottom = F,dep.var.labels = "Move to Moscow",out = "c.doc", covariate.labels =c("Constant","Employment prospects","Proximity","Cost of living", "Scholarship", "HSE quality", "HSE reputation", "Program choice","Recommendations from family and friends", "Attraction to Russian culture", "Recognition of HSE degree in my Home Country", "HSE position in University rankings","Support services for International Students", "HSE international stragtegic alliances","Age", "Home Country", "Gender")) stargazer(model7, model8, title="Regression Results: Push Factors in Home Country", align=TRUE, no.space=TRUE, single.row=T,type = "text", intercept.bottom = F,dep.var.labels = "Move to Moscow", out = "d.doc", covariate.labels =c("Constant","Employment prospects","Scholarship","HSE quality","HSE reputation", "Recognition of HSE degree in my Home Country","Support services for International Students", "Attraction to Russian culture", "Recommendations from family and friends","Proximity", "Cost of living", "Choice of program", "HSE position in University rankings", "HSE international alliances","Asia", "CIS","Europe", "Middle East", "South America", "Age", "Gender", "Recomendations from family and friends*Asia","Recomendations from family and friends*CIS", "Recomendations from family and friends*Europe","Recomendations from family and friends*Middle East", "Recomendations from family and friends*South America","Proximity*Asia", "Proximity*CIS", "Proximity*Europe", "Proximity*Middle East","Proximity*South America", "Cost of living*Asia","Cost of living*CIS", "Cost of living*Europe","Cost of living*Middle East","Cost of living*South America","Choice of program*Asia", "Choice of program*CIS", "Choice of program*Europe","Choice of program*Middle East", "Choice of program*South America", "HSE position in University rankings*Asia", "HSE position in University rankings*CIS", "HSE position in University rankings*Europe", "HSE position in University rankings*Middle East","HSE position in University rankings*South America", "HSE international alliances*Asia", "HSE international alliances*CIS", "HSE international alliances*Europe", "HSE international alliances*Middle East","HSE international alliances*South America")) #checking for multicolinearity vif(model5) vif(model6) vif(model7) vif(model8) #####Creating the Crosstab function crosstab <- function (..., dec.places = NULL, type = NULL, style = "wide", row.vars = NULL, col.vars = NULL, percentages = TRUE, addmargins = TRUE, subtotals=TRUE) ################################################################################### # # # Function created by Dr Paul Williamson, Dept. of Geography and Planning, # # School of Environmental Sciences, University of Liverpool, UK. # # # # Adapted from the function ctab() in the catspec packge. # # # # Version: 12th July 2013 # # # # Output best viewed using the companion function print.crosstab() # # # ################################################################################### #Declare function used to convert frequency counts into relevant type of proportion or percentage { mk.pcnt.tbl <- function(tbl, type) { a <- length(row.vars) b <- length(col.vars) mrgn <- switch(type, column.pct = c(row.vars[-a], col.vars), row.pct = c(row.vars, col.vars[-b]), joint.pct = c(row.vars[-a], col.vars[-b]), total.pct = NULL) tbl <- prop.table(tbl, mrgn) if (percentages) { tbl <- tbl * 100 } tbl } #Find no. of vars (all; row; col) for use in subsequent code n.row.vars <- length(row.vars) n.col.vars <- length(col.vars) n.vars <- n.row.vars + n.col.vars #Check to make sure all user-supplied arguments have valid values stopifnot(as.integer(dec.places) == dec.places, dec.places > -1) #type: see next section of code stopifnot(is.character(style)) stopifnot(is.logical(percentages)) stopifnot(is.logical(addmargins)) stopifnot(is.logical(subtotals)) stopifnot(n.vars>=1) #Convert supplied table type(s) into full text string (e.g. "f" becomes "frequency") #If invalid type supplied, failed match gives user automatic error message types <- NULL choices <- c("frequency", "row.pct", "column.pct", "joint.pct", "total.pct") for (tp in type) types <- c(types, match.arg(tp, choices)) type <- types #If no type supplied, default to 'frequency + total' for univariate tables and to #'frequency' for multi-dimenstional tables #For univariate table.... if (n.vars == 1) { if (is.null(type)) { # default = freq count + total.pct type <- c("frequency", "total.pct") #row.vars <- 1 } else { #and any requests for row / col / joint.pct must be changed into requests for 'total.pct' type <- ifelse(type == "frequency", "frequency", "total.pct") } #For multivariate tables... } else if (is.null(type)) { # default = frequency count type <- "frequency" } #Check for integrity of requested analysis and adjust values of function arguments as required if ((addmargins==FALSE) & (subtotals==FALSE)) { warning("WARNING: Request to suppress subtotals (subtotals=FALSE) ignored because no margins requested (addmargins=FALSE)") subtotals <- TRUE } if ((n.vars>1) & (length(type)>1) & (addmargins==TRUE)) { warning("WARNING: Only row totals added when more than one table type requested") #Code lower down selecting type of margin implements this... } if ((length(type)>1) & (subtotals==FALSE)) { warning("WARNING: Can only request supply one table type if requesting suppression of subtotals; suppression of subtotals not executed") subtotals <- TRUE } if ((length(type)==1) & (subtotals==FALSE)) { choices <- c("frequency", "row.pct", "column.pct", "joint.pct", "total.pct") tp <- match.arg(type, choices) if (tp %in% c("row.pct","column.pct","joint.pct")) { warning("WARNING: subtotals can only be suppressed for tables of type 'frequency' or 'total.pct'") subtotals<- TRUE } } if ((n.vars > 2) & (n.col.vars>1) & (subtotals==FALSE)) warning("WARNING: suppression of subtotals assumes only 1 col var; table flattened accordingly") if ( (subtotals==FALSE) & (n.vars>2) ) { #If subtotals not required AND total table vars > 2 #Reassign all but last col.var as row vars #[because, for simplicity, crosstabs assumes removal of subtotals uses tables with only ONE col var] #N.B. Subtotals only present in tables with > 2 cross-classified vars... if (length(col.vars)>1) { row.vars <- c(row.vars,col.vars[-length(col.vars)]) col.vars <- col.vars[length(col.vars)] n.row.vars <- length(row.vars) n.col.vars <- 1 } } #If dec.places not set by user, set to 2 unlesss only one table of type frequency requested, #in which case set to 0. [Leaves user with possibility of having frequency tables with > 0 dp] if (is.null(dec.places)) { if ((length(type)==1) & (type[1]=="frequency")) { dec.places <- 0 } else { dec.places <-2 } } #Take the original input data, whatever form originally supplied in, #convert into table format using requested row and col vars, and save as 'tbl' args <- list(...) if (length(args) > 1) { if (!all(sapply(args, is.factor))) stop("If more than one argument is passed then all must be factors") tbl <- table(...) } else { if (is.factor(...)) { tbl <- table(...) } else if (is.table(...)) { tbl <- eval(...) } else if (is.data.frame(...)) { #tbl <- table(...) if (is.null(row.vars) && is.null(col.vars)) { tbl <- table(...) } else { var.names <- c(row.vars,col.vars) A <- (...) tbl <- table(A[var.names]) if(length(var.names==1)) names(dimnames(tbl)) <- var.names #[table() only autocompletes dimnames for multivariate crosstabs of dataframes] } } else if (class(...) == "ftable") { tbl <- eval(...) if (is.null(row.vars) && is.null(col.vars)) { row.vars <- names(attr(tbl, "row.vars")) col.vars <- names(attr(tbl, "col.vars")) } tbl <- as.table(tbl) } else if (class(...) == "ctab") { tbl <- eval(...) if (is.null(row.vars) && is.null(col.vars)) { row.vars <- tbl$row.vars col.vars <- tbl$col.vars } for (opt in c("dec.places", "type", "style", "percentages", "addmargins", "subtotals")) if (is.null(get(opt))) assign(opt, eval(parse(text = paste("tbl$", opt, sep = "")))) tbl <- tbl$table } else { stop("first argument must be either factors or a table object") } } #Convert supplied table style into full text string (e.g. "l" becomes "long") style <- match.arg(style, c("long", "wide")) #Extract row and col names to be used in creating 'tbl' from supplied input data nms <- names(dimnames(tbl)) z <- length(nms) if (!is.null(row.vars) && !is.numeric(row.vars)) { row.vars <- order(match(nms, row.vars), na.last = NA) } if (!is.null(col.vars) && !is.numeric(col.vars)) { col.vars <- order(match(nms, col.vars), na.last = NA) } if (!is.null(row.vars) && is.null(col.vars)) { col.vars <- (1:z)[-row.vars] } if (!is.null(col.vars) && is.null(row.vars)) { row.vars <- (1:z)[-col.vars] } if (is.null(row.vars) && is.null(col.vars)) { col.vars <- z row.vars <- (1:z)[-col.vars] } #Take the original input data, converted into table format using supplied row and col vars (tbl) #and create a second version (crosstab) which stores results as percentages if a percentage table type is requested. if (type[1] == "frequency") crosstab <- tbl else crosstab <- mk.pcnt.tbl(tbl, type[1]) #If multiple table types requested, create and add these to if (length(type) > 1) { tbldat <- as.data.frame.table(crosstab) z <- length(names(tbldat)) + 1 tbldat[z] <- 1 pcntlab <- type pcntlab[match("frequency", type)] <- "Count" pcntlab[match("row.pct", type)] <- "Row %" pcntlab[match("column.pct", type)] <- "Column %" pcntlab[match("joint.pct", type)] <- "Joint %" pcntlab[match("total.pct", type)] <- "Total %" for (i in 2:length(type)) { if (type[i] == "frequency") crosstab <- tbl else crosstab <- mk.pcnt.tbl(tbl, type[i]) crosstab <- as.data.frame.table(crosstab) crosstab[z] <- i tbldat <- rbind(tbldat, crosstab) } tbldat[[z]] <- as.factor(tbldat[[z]]) levels(tbldat[[z]]) <- pcntlab crosstab <- xtabs(Freq ~ ., data = tbldat) names(dimnames(crosstab))[z - 1] <- "" } #Add margins if required, adding only those margins appropriate to user request if (addmargins==TRUE) { vars <- c(row.vars,col.vars) if (length(type)==1) { if (type=="row.pct") { crosstab <- addmargins(crosstab,margin=c(vars[n.vars])) tbl <- addmargins(tbl,margin=c(vars[n.vars])) } else { if (type=="column.pct") { crosstab <- addmargins(crosstab,margin=c(vars[n.row.vars])) tbl <- addmargins(tbl,margin=c(vars[n.row.vars])) } else { if (type=="joint.pct") { crosstab <- addmargins(crosstab,margin=c(vars[(n.row.vars)],vars[n.vars])) tbl <- addmargins(tbl,margin=c(vars[(n.row.vars)],vars[n.vars])) } else #must be total.pct OR frequency { crosstab <- addmargins(crosstab) tbl <- addmargins(tbl) } } } } #If more than one table type requested, only adding row totals makes any sense... if (length(type)>1) { crosstab <- addmargins(crosstab,margin=c(vars[n.vars])) tbl <- addmargins(tbl,margin=c(vars[n.vars])) } } #If subtotals not required, and total vars > 2, create dataframe version of table, with relevent #subtotal rows / cols dropped [Subtotals only present in tables with > 2 cross-classified vars] t1 <- NULL if ( (subtotals==FALSE) & (n.vars>2) ) { #Create version of crosstab in ftable format t1 <- crosstab t1 <- ftable(t1,row.vars=row.vars,col.vars=col.vars) #Convert to a dataframe t1 <- as.data.frame(format(t1),stringsAsFactors=FALSE) #Remove backslashes from category names AND colnames t1 <- apply(t1[,],2, function(x) gsub("\"","",x)) #Remove preceding and trailing spaces from category names to enable accurate capture of 'sum' rows/cols #[Use of grep might extrac category labels with 'sum' as part of a longer one or two word string...] t1 <- apply(t1,2,function(x) gsub("[[:space:]]*$","",gsub("^[[:space:]]*","",x))) #Reshape dataframe to that variable and category labels display as required #(a) Move col category names down one row; and move col variable name one column to right t1[2,(n.row.vars+1):ncol(t1)] <- t1[1,(n.row.vars+1):ncol(t1)] t1[1,] <- "" t1[1,(n.row.vars+2)] <- t1[2,(n.row.vars+1)] #(b) Drop the now redundant column separating the row.var labels from the table data + col.var labels t1 <- t1[,-(n.row.vars+1)] #In 'lab', assign category labels for each variable to all rows (to allow identification of sub-totals) lab <- t1[,1:n.row.vars] for (c in 1:n.row.vars) { for (r in 2:nrow(lab)) { if (lab[r,c]=="") lab[r,c] <- lab[r-1,c] } } lab <- (apply(lab[,1:n.row.vars],2,function(x) x=="Sum")) lab <- apply(lab,1,sum) #Filter out rows of dataframe containing subtotals t1 <- t1[((lab==0) | (lab==n.row.vars)),] #Move the 'Sum' label associated with last row to the first column; in the process #setting the final row labels associated with other row variables to "" t1[nrow(t1),1] <- "Sum" t1[nrow(t1),(2:n.row.vars)] <- "" #set row and column names to NULL rownames(t1) <- NULL colnames(t1) <- NULL } #Create output object 'result' [class: crosstab] result <- NULL #(a) record of argument values used to produce tabular output result$row.vars <- row.vars result$col.vars <- col.vars result$dec.places <- dec.places result$type <- type result$style <- style result$percentages <- percentages result$addmargins <- addmargins result$subtotals <- subtotals #(b) tabular output [3 variants] result$table <- tbl #Stores original cross-tab frequency counts without margins [class: table] result$crosstab <- crosstab #Stores cross-tab in table format using requested style(frequency/pct) and table margins (on/off) #[class: table] result$crosstab.nosub <- t1 #crosstab with subtotals suppressed [class: dataframe; or NULL if no subtotals suppressed] class(result) <- "crosstab" #Return 'result' as output of function result } print.crosstab <- function(x,dec.places=x$dec.places,subtotals=x$subtotals,...) { ################################################################################### # # # Function created by Dr Paul Williamson, Dept. of Geography and Planning, # # School of Environmental Sciences, University of Liverpool, UK. # # # # Adapted from the function print.ctab() in the catspec packge. # # # # Version: 12th July 2013 # # # # Designed to provide optimal viewing of the output from crosstab() # # # ################################################################################### row.vars <- x$row.vars col.vars <- x$col.vars n.row.vars <- length(row.vars) n.col.vars <- length(col.vars) n.vars <- n.row.vars + n.col.vars if (length(x$type)>1) { z<-length(names(dimnames(x$crosstab))) if (x$style=="long") { row.vars<-c(row.vars,z) } else { col.vars<-c(z,col.vars) } } if (n.vars==1) { if (length(x$type)==1) { tmp <- data.frame(round(x$crosstab,x$dec.places)) colnames(tmp)[2] <- ifelse(x$type=="frequency","Count","%") print(tmp,row.names=FALSE) } else { print(round(x$crosstab,x$dec.places)) } } #If table has only 2 dimensions, or subtotals required for >2 dimensional table, #print table using ftable() on x$crosstab if ((n.vars == 2) | ((subtotals==TRUE) & (n.vars>2))) { tbl <- ftable(x$crosstab,row.vars=row.vars,col.vars=col.vars) if (!all(as.integer(tbl)==as.numeric(tbl))) tbl <- round(tbl,dec.places) print(tbl,...) } #If subtotals NOT required AND > 2 dimensions, print table using write.table() on x$crosstab.nosub if ((subtotals==FALSE) & (n.vars>2)) { t1 <- x$crosstab.nosub #Convert numbers to required decimal places, right aligned width <- max( nchar(t1[1,]), nchar(t1[2,]), 7 ) dec.places <- x$dec.places number.format <- paste("%",width,".",dec.places,"f",sep="") t1[3:nrow(t1),((n.row.vars+1):ncol(t1))] <- sprintf(number.format,as.numeric(t1[3:nrow(t1),((n.row.vars+1):ncol(t1))])) #Adjust column variable label to same width as numbers, left aligned, padding with trailing spaces as required col.var.format <- paste("%-",width,"s",sep="") t1[1,(n.row.vars+1):ncol(t1)] <- sprintf(col.var.format,t1[1,(n.row.vars+1):ncol(t1)]) #Adjust column category labels to same width as numbers, right aligned, padding with preceding spaces as required col.cat.format <- paste("%",width,"s",sep="") t1[2,(n.row.vars+1):ncol(t1)] <- sprintf(col.cat.format,t1[2,(n.row.vars+1):ncol(t1)]) #Adjust row labels so that each column is of fixed width, using trailing spaces as required for (i in 1:n.row.vars) { width <- max(nchar(t1[,i])) + 2 row.lab.format <- paste("%-",width,"s",sep="") t1[,i] <- sprintf(row.lab.format,t1[,i]) } write.table(t1,quote=FALSE,col.names=FALSE,row.names=FALSE) } } library(sjPlot) library(sjmisc) library(sjlabelled) theme_set(theme_bw()) ##Descriptive Statistics: Demographic information theme_set(theme_bw()) #degree freq(degree, display.type = F,report.nas = F, headings = T, cumul = F, style = "grid") plot_frq(degree, geom.colors = c("red", "yellow"), title = "Degree") crosstab(data, row.vars = c("degree"), col.vars ="world.region", type = "f", style = "long", addmargins = T, dec.places = 0, subtotals = T) #language of instruction freq(language.of.instruction, display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") plot_frq(language.of.instruction, geom.colors = "#336699", title = "Language of instruction") crosstab(data, row.vars = c("language.of.instruction"), col.vars ="world.region", type = "f", style = "long", addmargins = T, dec.places = 0, subtotals = T) #Gender freq(Gender, display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") plot_frq(Gender, geom.colors = "#336699", title = "Gender") crosstab(data, row.vars = c("Gender"), col.vars ="world.region", type = "f", style = "long", addmargins = T, dec.places = 0, subtotals = T) #Age freq(age, display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") plot_frq(age, geom.colors = "#336699", title = "Age") crosstab(data, row.vars = c("age"), col.vars ="world.region", type = "f", style = "long", addmargins = T, dec.places = 0, subtotals = T) #World Region freq(world.region, display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") plot_frq(world.region, geom.colors = "#336699", title = "World Region") #Family income freq(What.was.your.annual.family.income.when.you.were.applying.to.study.abroad..estimate.in.US.dollars., display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") crosstab(data, row.vars = "family.income", col.vars ="world.region", type = "f", style = "long", addmargins = T, dec.places = 0, subtotals = T) #Length of stay in Russia freq(How.long.have.you.been.in.Russia.studying.for.your.current.program., display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") #Student finance status freq(How.are.you.financing.your.participation.in.the.program., display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") crosstab(data, row.vars = c("How.are.you.financing.your.participation.in.the.program."), col.vars ="world.region", type = "f", style = "long", addmargins = T, dec.places = 0, subtotals = T) #stay in Russia freq(Have.you.ever.been.in.Russia.before.you.enrolled.for.your.current.program, display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") #Data preparation: Push factors in home country influencing the decision to study in Russia #unavailable program unavailable.program <-as.factor(Unavailability.of.the.desired.study.program) unavailable.program <- factor(unavailable.program,levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(unavailable.program, Unavailability.of.the.desired.study.program) #quality of education low.educational.quality<-as.factor(Low.quality.of.education) low.educational.quality <- factor(low.educational.quality, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(low.educational.quality, Low.quality.of.education) #competitive University admission in home country competitive.admission<-as.factor(Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution) competitive.admission <- factor(competitive.admission, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(competitive.admission, Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution) #Advantage of international degree advantage.of.international.degree<-as.factor(Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market) advantage.of.international.degree <- factor(advantage.of.international.degree, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(advantage.of.international.degree, Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market) #unavailability of scholarships unavailability.of.scholarship<-as.factor(Unavailability.of.scholarship.opportunities) unavailability.of.scholarship <- factor(unavailability.of.scholarship, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(unavailability.of.scholarship, Unavailability.of.scholarship.opportunities) #encouragement from family encouragement.from.family<-as.factor(Encouragement.from.my.family.to.study.abroad) encouragement.from.family <- factor(encouragement.from.family, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(encouragement.from.family, Encouragement.from.my.family.to.study.abroad) #encouragement from friends encouragement.from.friends<-as.factor(Encouragement.from..my.friends.to.study.abroad) encouragement.from.friends <- factor(encouragement.from.friends, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(encouragement.from.friends, Encouragement.from..my.friends.to.study.abroad) #better earning prospects better.earning.prospects<-as.factor(Better.earning.prospects.abroad) better.earning.prospects <- factor(better.earning.prospects, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(better.earning.prospects, Better.earning.prospects.abroad) #social prestige social.prestige<-as.factor(The.social.prestige.of.studying.abroad) social.prestige <- factor(social.prestige, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(social.prestige, The.social.prestige.of.studying.abroad) #experience different culture experience.different.culture<-as.factor(To.experience.a.different.culture) experience.different.culture <- factor(experience.different.culture, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(experience.different.culture, To.experience.a.different.culture) #Descriptive Statistics: Push Factors influencing the decision to move to Russia #push factors pushfactor<-data.frame(unavailable.program,low.educational.quality,competitive.admission, advantage.of.international.degree,unavailability.of.scholarship, encouragement.from.family,encouragement.from.friends,better.earning.prospects, social.prestige,experience.different.culture) freq(pushfactor, display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") HCpushfactor<-data.frame(degree, world.region, unavailable.program,low.educational.quality,competitive.admission, advantage.of.international.degree,unavailability.of.scholarship, encouragement.from.family,encouragement.from.friends,better.earning.prospects, social.prestige,experience.different.culture) #Crosstab between Push Factors and World Region with degree crosstab(data, row.vars = c("world.region","degree"), col.vars ="Unavailability.of.the.desired.study.program", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Low.quality.of.education", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Unavailability.of.scholarship.opportunities", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Encouragement.from.my.family.to.study.abroad", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Encouragement.from..my.friends.to.study.abroad", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Better.earning.prospects.abroad", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="The.social.prestige.of.studying.abroad", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="To.experience.a.different.culture", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) is.factor(world.region) #Anova #Unavailable program data$region<-as.factor(world.region) attach(data) leveneTest(Unavailability.of.the.desired.study.program ~ region, data = data) res.aov <- aov(Unavailability.of.the.desired.study.program ~ region, data = data) # Summary of the analysis summary(res.aov) TukeyHSD(res.aov) summary(glht(res.aov, linfct = mcp(region = "Tukey"))) #Graphs #Plots for the push factors in the home countries #Push factors plot_stackfrq(pushfactor) #Unavailability of desired study program plot_grpfrq(unavailable.program, world.region, geom.colors = "gs", title = "Unavailability of desired study program in Home Country") plot_grpfrq(unavailable.program, degree, geom.colors = "gs", title = "Unavailability of Program") #Low quality of education plot_grpfrq(low.educational.quality, world.region, geom.colors = "gs", title = "Low quality of education in Home Country") plot_grpfrq(low.educational.quality, degree, geom.colors = "gs", title = "Low quality of education") #Competitive univeristy admission plot_grpfrq(competitive.admission, world.region, geom.colors = "gs", title = "Competitive University admission process in Home Country") plot_grpfrq(competitive.admission, degree, geom.colors = "gs", title = "Competitive university admission") #Perceived advantage of international degree plot_grpfrq(advantage.of.international.degree, world.region, geom.colors = "gs", title = "Perceived advantage of international degree than a local degree") plot_grpfrq(advantage.of.international.degree, degree, geom.colors = "gs", title = "Perceived advantage of internatioal degree") #Unavailability of Scholarship plot_grpfrq(unavailability.of.scholarship, world.region, geom.colors = "gs", title = "Unavailability of scholarship opportunities in Home Country") plot_grpfrq(unavailability.of.scholarship, degree, geom.colors = "gs", title = "Unavailability of scholarship") #Encouragement from family plot_grpfrq(encouragement.from.family, world.region, geom.colors = "gs", title = "Encouragement from family") plot_grpfrq(encouragement.from.family, degree, geom.colors = "gs", title = "Encouragement from family") #Encouragement from friends plot_grpfrq(encouragement.from.friends, world.region, geom.colors = "gs", title = "Encouragement from friends") plot_grpfrq(encouragement.from.friends, degree, geom.colors = "gs", title = "Encouragement from friends") #Better earning prospects plot_grpfrq(better.earning.prospects, world.region, geom.colors = "gs", title = "Better earning prospects abroad") plot_grpfrq(better.earning.prospects, degree, geom.colors = "gs", title = "Better earning prospects") #The social prestige of studying abroad plot_grpfrq(social.prestige, world.region, geom.colors = "gs", title = "The social prestige of studying abroad") plot_grpfrq(social.prestige, degree, geom.colors = "gs", title = "The.social.prestige.of.studying.abroad") #Experience different culture plot_grpfrq(experience.different.culture, world.region, geom.colors = "gs", title = "EXperience different culture abroad") plot_grpfrq(experience.different.culture, degree, geom.colors = "gs", title = "EXperience different culture") #Data preparation: Pull factors in Russia influencing the decision to study in Russia #availability of desired program available.study.program <-as.factor(Availability.of.desired.study.program) available.study.program <- factor(available.study.program, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(available.study.program, Availability.of.desired.study.program) #high quality of education high.educational.quality<-as.factor(Higher.quality.of.education..compared.to.home.country.) high.educational.quality <- factor(high.educational.quality, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(high.educational.quality, Higher.quality.of.education..compared.to.home.country.) #low cost of living low.cost.living<-as.factor(Low.cost.of.living) low.cost.living <- factor(low.cost.living, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(low.cost.living,Low.cost.of.living) #low tuition fees low.tuition<-as.factor(Low.tuition.fees) low.tuition <- factor(low.tuition, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(low.tuition, Low.tuition.fees) #Awarded scholarships scholarship.tuitionwaiver<-as.factor(Awarded.scholarships.or.tuition.waiver) scholarship.tuitionwaiver <- factor(scholarship.tuitionwaiver, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(scholarship.tuitionwaiver,Awarded.scholarships.or.tuition.waiver) #Attraction to Russian culture russian.culture<-as.factor(Attraction.to.Russian.culture..society) russian.culture <- factor(russian.culture, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(russian.culture, Attraction.to.Russian.culture..society) #Career prospects in Russia career.prospects<-as.factor(Career.prospects.in.Russia) career.prospects <- factor(career.prospects, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(career.prospects, Career.prospects.in.Russia) #Recommendations from family and friends family.friends.recommendations<-as.factor(Personal.recommendations.from.parents..relatives..and.friends) family.friends.recommendations <- factor(family.friends.recommendations, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(family.friends.recommendations, Personal.recommendations.from.parents..relatives..and.friends) #Cultural Proximity cultural.proximity<-as.factor(cultural.proximity.with.home) cultural.proximity <- factor(cultural.proximity, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(cultural.proximity, cultural.proximity.with.home) #Geographical proximity geographical.proximity<-as.factor(geographical.proximity.with.home) geographical.proximity <- factor(geographical.proximity, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(geographical.proximity, geographical.proximity.with.home) #Descriptive Statistics: Pull Factors in Russia influencing the decision to move to Russia Pullfactor_Russia<-data.frame(available.study.program, high.educational.quality, low.cost.living, low.tuition, scholarship.tuitionwaiver, russian.culture, career.prospects, family.friends.recommendations, cultural.proximity, geographical.proximity) freq(Pullfactor_Russia, display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") Pullfactor_Ru<-data.frame(world.region, degree, available.study.program, high.educational.quality, low.cost.living, low.tuition, scholarship.tuitionwaiver, russian.culture, career.prospects, family.friends.recommendations, cultural.proximity, geographical.proximity) #Crosstab between Pull Factors in Russia and World Region with degree crosstab(data, row.vars = c("world.region","degree"), col.vars ="Unavailability.of.the.desired.study.program", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Higher.quality.of.education..compared.to.home.country.", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Low.cost.of.living", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Availability.of.scholarships", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Attraction.to.Russian.culture..society", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Career.prospects.in.Russia", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Personal.recommendations.from.parents..relatives..and.friends", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="cultural.proximity.with.home", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="geographical.proximity.with.home", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) #Plots for the pull factors in Russia plot_stackfrq(Pullfactor_Russia) #Availability of desired study program plot_grpfrq(available.study.program, world.region, geom.colors = "gs", title = "Availability of desired study program in Russia") plot_grpfrq(available.study.program, degree, geom.colors = "gs", title = "Availability of desired study program") #High quality of education plot_grpfrq(high.educational.quality, world.region, geom.colors = "gs", title = "High quality of education in Russia") plot_grpfrq(high.educational.quality, degree, geom.colors = "gs", title = "High quality of education") #Low cost of living plot_grpfrq(low.cost.living, world.region, geom.colors = "gs", title = "Low cost of living in Russia") plot_grpfrq(low.cost.living, degree, geom.colors = "gs", title = "Low cost of living") #Low tuition fees plot_grpfrq(low.tuition, world.region, geom.colors = "gs", title = "Low tuition fees in Russia") plot_grpfrq(low.tuition, degree, geom.colors = "gs", title = "Low tuition fees") #Scholarship or tuition waiver plot_grpfrq(scholarship.tuitionwaiver, world.region, geom.colors = "gs", title = "Scholarship or tuition waiver") plot_grpfrq(scholarship.tuitionwaiver, degree, geom.colors = "gs", title = "Scholarship or tuition waiver") #Attraction to Russian culture plot_grpfrq(russian.culture, world.region, geom.colors = "gs", title = "Attraction to Russian culture") plot_grpfrq(russian.culture, degree, geom.colors = "gs", title = "Attraction to Russian culture") #Career prospects in Russia plot_grpfrq(career.prospects, world.region, geom.colors = "gs", title = "Career prospects in Russia") plot_grpfrq(career.prospects, degree, geom.colors = "gs", title = "Career prospects in Russia") #Recommendations from family and friends plot_grpfrq(family.friends.recommendations, world.region, geom.colors = "gs", title = "Recommendations from family and friends") plot_grpfrq(family.friends.recommendations, degree, geom.colors = "gs", title = "Recommendations from family and friends") #cultural.proximity plot_grpfrq(cultural.proximity, world.region, geom.colors = "gs", title = "Home Country's cultural proximity to Russia") plot_grpfrq(cultural.proximity, degree, geom.colors = "gs", title = "Cultural proximity") #Geograhical proximity plot_grpfrq(geographical.proximity, world.region, geom.colors = "gs", title = "Home Country's geograhical proximity to Russia") plot_grpfrq(geographical.proximity, degree, geom.colors = "gs", title = "Geograhical proximity") #Data preparation: Pull factors in HSE #Quality and Reputation of HSE HSE.qualityandreputation <-as.factor(Quality.and.reputation.of.the.University) HSE.qualityandreputation <- factor(HSE.qualityandreputation, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(HSE.qualityandreputation, Quality.and.reputation.of.the.University) #Recognition of HSE degree recognition.of.HSE.degree<-as.factor(Recognition.of.the.degree.in.my.home.country) recognition.of.HSE.degree <- factor(recognition.of.HSE.degree, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(recognition.of.HSE.degree, Recognition.of.the.degree.in.my.home.country) #Quality of teaching staff quality.teachers<-as.factor(Quality.of.the.teaching.staff) quality.teachers <- factor(quality.teachers, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(quality.teachers,Quality.of.the.teaching.staff) #Reputation of the alumni alumni.reputation<-as.factor(The.reputation.of.the.alumni) alumni.reputation <- factor(alumni.reputation, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(alumni.reputation, The.reputation.of.the.alumni) #reputation of the international community internationalcommunity.reputation<-as.factor(The.reputation.of.the.international.community) internationalcommunity.reputation <- factor(internationalcommunity.reputation, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(internationalcommunity.reputation,The.reputation.of.the.international.community) #HSE rank HSE.rank<-as.factor(HSE.position.in.international.university.rankings) HSE.rank <- factor(HSE.rank, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(HSE.rank, HSE.position.in.international.university.rankings) #Cost of tuition tuition.cost<-as.factor(Cost.of.tuition.for.international.students) tuition.cost <- factor(tuition.cost, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(tuition.cost, Cost.of.tuition.for.international.students) #Availability of scholarship available.scholarships<-as.factor(Availability.of.scholarships) available.scholarships <- factor(available.scholarships, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(available.scholarships,Availability.of.scholarships) #Support Services for international students international.students.support<-as.factor(Support.services.for.international.students) international.students.support <- factor(international.students.support, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(international.students.support, Support.services.for.international.students) #Graduate employment rate graduate.employment<-as.factor(Graduates.employment.rates) graduate.employment <- factor(graduate.employment, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(graduate.employment, Graduates.employment.rates) #HSE international strategic alliances HSE.alliances<-as.factor(HSE.s.international.strategic.alliances) HSE.alliances <- factor(HSE.alliances, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(HSE.alliances, HSE.s.international.strategic.alliances) #Local Employers preference for HSE degrees employers.preference.for.HSE.degrees<-as.factor(Local.employers.preference.of..degrees.awarded.by.HSE) employers.preference.for.HSE.degrees <- factor(employers.preference.for.HSE.degrees, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(employers.preference.for.HSE.degrees, Local.employers.preference.of..degrees.awarded.by.HSE) #Descriptive Statistics: Pull Factors in HSE influencing the decision to move to Russia Pullfactor_HSE<-data.frame(HSE.qualityandreputation,recognition.of.HSE.degree,quality.teachers, alumni.reputation,internationalcommunity.reputation,HSE.rank,tuition.cost, available.scholarships,international.students.support,graduate.employment, HSE.alliances,employers.preference.for.HSE.degrees) freq(Pullfactor_HSE, display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") HSEPullfactor<-data.frame(world.region, degree, HSE.qualityandreputation,recognition.of.HSE.degree,quality.teachers, alumni.reputation,internationalcommunity.reputation,HSE.rank,tuition.cost, available.scholarships,international.students.support,graduate.employment, HSE.alliances,employers.preference.for.HSE.degrees) #Crosstab between Pull Factors in HSE and World Region with degree crosstab(data, row.vars = c("world.region","degree"), col.vars ="Quality.and.reputation.of.the.University", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Recognition.of.the.degree.in.my.home.country", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Quality.of.the.teaching.staff", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="The.reputation.of.the.alumni", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="The.reputation.of.the.international.community", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="HSE.position.in.international.university.rankings", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Cost.of.tuition.for.international.students", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Availability.of.scholarships", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Support.services.for.international.students", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Graduates.employment.rates", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="HSE.s.international.strategic.alliances", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Local.employers.preference.of..degrees.awarded.by.HSE", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) #Plots for the pull factors in HSE plot_stackfrq(Pullfactor_HSE) #Quality and reputation of HSE plot_grpfrq(HSE.qualityandreputation, world.region, geom.colors = "gs", title = "Quality and reputation of HSE") plot_grpfrq(HSE.qualityandreputation, degree, geom.colors = "gs", title = "Quality and reputation of HSE") #Recognition of degree plot_grpfrq(recognition.of.HSE.degree, world.region, geom.colors = "gs", title = "Recognition of HSE degree in my Home Country") plot_grpfrq(recognition.of.HSE.degree, degree, geom.colors = "gs", title = "Recognition of degree") #Quality of teachers plot_grpfrq(quality.teachers, world.region, geom.colors = "gs", title = "Quality of HSE teachers") plot_grpfrq(quality.teachers, degree, geom.colors = "gs", title = "Quality of teachers") #Reputation of alumni plot_grpfrq(alumni.reputation, world.region, geom.colors = "gs", title = "Reputation of HSE alumni") plot_grpfrq(alumni.reputation, degree, geom.colors = "gs", title = "Reputation of alumni") #Reputation of International Community plot_grpfrq(internationalcommunity.reputation, world.region, geom.colors = "gs", title = "Reputation of HSE International Community") plot_grpfrq(internationalcommunity.reputation, degree, geom.colors = "gs", title = "Reputation of International Community") #HSE's rank plot_grpfrq(HSE.rank, world.region, geom.colors = "gs", title = "HSE's position on World Universities ranking") plot_grpfrq(HSE.rank, degree, geom.colors = "gs", title = "HSE's rank") #Cost of tuition plot_grpfrq(tuition.cost, world.region, geom.colors = "gs", title = "Cost of tuition in HSE") plot_grpfrq(tuition.cost, degree, geom.colors = "gs", title = "Cost of tuition") #Recognition of degree plot_grpfrq(available.scholarships, world.region, geom.colors = "gs", title = "Availability of scholarships in HSE") plot_grpfrq(available.scholarships, degree, geom.colors = "gs", title = "Availability of scholarships") #Support services for international students plot_grpfrq(international.students.support, world.region, geom.colors = "gs", title = "Support services for international students in HSE") plot_grpfrq(international.students.support, degree, geom.colors = "gs", title = "Support services for international students") #Graduate employment rate plot_grpfrq(graduate.employment, world.region, geom.colors = "gs", title = "HSE's Graduate employment rate") plot_grpfrq(graduate.employment, degree, geom.colors = "gs", title = "Graduate employment rate") #HSE alliances plot_grpfrq(HSE.alliances, world.region, geom.colors = "gs", title = "HSE strategic international alliances") plot_grpfrq(HSE.alliances, degree, geom.colors = "gs", title = "HSE alliances") #Recognition of degree plot_grpfrq(employers.preference.for.HSE.degrees, world.region, geom.colors = "gs", title = "Local employers preference for HSE degrees") plot_grpfrq(employers.preference.for.HSE.degrees, degree, geom.colors = "gs", title = "Local preference for HSE degrees") ###STUDENTS POST GRADUATION PLANS## #Descriptive Statistics #Post Graduation migration plans freq(What.are.your.plans.after.graduation., display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") plot_grpfrq(What.are.your.plans.after.graduation., world.region, geom.colors = "gs", title = "Post graduation plans") plot_grpfrq(What.are.your.plans.after.graduation., degree, geom.colors = "gs", title = "Post graduation plans") #Stay in Russia freq(What.will.be.your.reason.for.staying.in.Russia.after.graduation., display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") plot_grpfrq(What.will.be.your.reason.for.staying.in.Russia.after.graduation., world.region, geom.colors = "gs", title = "Reasons for staying in Russia after graduation") plot_grpfrq(What.are.your.plans.after.graduation., degree, geom.colors = "gs", title = "Reasons for staying in Russia after graduation") #Return home freq(What.will.be.your.reason.for.returning.home.after.graduation., display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") plot_grpfrq(What.will.be.your.reason.for.returning.home.after.graduation., world.region, geom.colors = "gs", title = "Reasons for returning home after graduation") plot_grpfrq(What.will.be.your.reason.for.returning.home.after.graduation., degree, geom.colors = "gs", title = "Reasons for returning home after graduation") #move to another country freq(What.will.be.your.reason.for.moving.to.another.country.after.graduation., display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") plot_grpfrq(What.will.be.your.reason.for.moving.to.another.country.after.graduation., world.region, geom.colors = "gs", title = "Reasons for moving to another country after graduation") plot_grpfrq(What.will.be.your.reason.for.moving.to.another.country.after.graduation., degree, geom.colors = "gs", title = "Reasons for moving to another country after graduation", show.na = F) #Stay in Russia after graduation #Better job opportunities job.opportunities <-as.factor(Better.job.opportunities..in.comparison.with.home.country.) job.opportunities <- factor(job.opportunities, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(job.opportunities, Better.job.opportunities..in.comparison.with.home.country.) #Higher quality of life high.quality.life<-as.factor(Higher.quality.of.life..in.comparison.with.home.country.) high.quality.life <- factor(high.quality.life, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(high.quality.life, Higher.quality.of.life..in.comparison.with.home.country.) #Better career opportunities career.opportunities<-as.factor(Better.career.opportunities.and.advancement.in.chosen.profession) career.opportunities <- factor(career.opportunities, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(career.opportunities,Better.career.opportunities.and.advancement.in.chosen.profession) #high income level high.income.level<-as.factor(Higher.income.level) high.income.level <- factor(high.income.level, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(high.income.level, Higher.income.level) #Ties to family and friends family.friends.ties<-as.factor(Ties.to.family.and.friends) family.friends.ties <- factor(family.friends.ties, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(family.friends.ties,Ties.to.family.and.friends) #international experience international.experience<-as.factor(Gain.international.experience) international.experience <- factor(international.experience, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(international.experience, Gain.international.experience) #family expectations familyexpectations<-as.factor(Family.expectations) familyexpectations <- factor(familyexpectations, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(familyexpectations, Family.expectations) #Restrcitive cultural practices cultural.practices<-as.factor(Restrictive.cultural.practices..eg..pressure.to.marry.) cultural.practices <- factor(cultural.practices, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(cultural.practices, Restrictive.cultural.practices..eg..pressure.to.marry.) #limited jobs limited.jobs<-as.factor(Limited.job.opportunities.in.home.country) limited.jobs <- factor(limited.jobs, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(limited.jobs, Limited.job.opportunities.in.home.country) #lower income levels lower.income<-as.factor(Lower.income.levels) lower.income <- factor(lower.income, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(lower.income, Lower.income.levels) #Lower quality of life lower.quality.life<-as.factor(Lower.quality.of.life.2) lower.quality.life <- factor(lower.quality.life, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(lower.quality.life, Lower.quality.of.life.2) #Political persecution politicalpersecution<-as.factor(Political.persecution) politicalpersecution <- factor(politicalpersecution, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(politicalpersecution, Political.persecution) #Dangers to ones own life danger.to.ones.life<-as.factor(Danger.or.fear.for.one.s.own.life) danger.to.ones.life <- factor(Danger.or.fear.for.one.s.own.life, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(danger.to.ones.life, Danger.or.fear.for.one.s.own.life) #Factors influencing the decision to stay in Russia RStayFactors<-data.frame(job.opportunities, high.quality.life,career.opportunities, high.income.level, family.friends.ties, international.experience, familyexpectations, cultural.practices,limited.jobs,lower.income,lower.quality.life, politicalpersecution,danger.to.ones.life) RussiaStay_factors<-data.frame(world.region, degree, Better.job.opportunities..in.comparison.with.home.country.+ Higher.quality.of.life..in.comparison.with.home.country.+ Better.career.opportunities.and.advancement.in.chosen.profession+ Higher.income.level+ Ties.to.family.and.friends+ Gain.international.experience+ Family.expectations+ Restrictive.cultural.practices..eg..pressure.to.marry.+ Limited.job.opportunities.in.home.country+Lower.income.levels+ Lower.quality.of.life.2+Political.persecution+Danger.or.fear.for.one.s.own.life) #Crosstabulation of Russia Stay factors with Region and degree crosstab(data, row.vars = c("world.region","degree"), col.vars ="Better.job.opportunities..in.comparison.with.home.country.", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Higher.quality.of.life..in.comparison.with.home.country.", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Better.career.opportunities.and.advancement.in.chosen.profession", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Higher.income.level", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Ties.to.family.and.friends", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Gain.international.experience", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Family.expectations", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Limited.job.opportunities.in.home.country", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Lower.income.levels", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Lower.quality.of.life.2", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Political.persecution", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Danger.or.fear.for.one.s.own.life", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) #Graphs #Factors influencing the decision to stay plot_stackfrq(RStayFactors) #Better job opportunities plot_grpfrq(job.opportunities, world.region, geom.colors = "gs", title = "Better job opportunities") plot_grpfrq(job.opportunities, degree, geom.colors = "gs", title = "Better job opportunities") #Higher quality of life plot_grpfrq(high.quality.life, world.region, geom.colors = "gs", title = "Higher quality of life") plot_grpfrq(high.quality.life, degree, geom.colors = "gs", title = "Higher quality of life") #Better career opportunities plot_grpfrq(career.opportunities, world.region, geom.colors = "gs", title = "Better career opportunities") plot_grpfrq(career.opportunities, degree, geom.colors = "gs", title = "Better career opportunities") #high income level plot_grpfrq(high.income.level, world.region, geom.colors = "gs", title = "high income level") plot_grpfrq(high.income.level, degree, geom.colors = "gs", title = "high income level") #Ties to family and friends plot_grpfrq(family.friends.ties, world.region, geom.colors = "gs", title = "Ties to family and friends") plot_grpfrq(family.friends.ties, degree, geom.colors = "gs", title = "Ties to family and friends") #international experience plot_grpfrq(international.experience, world.region, geom.colors = "gs", title = "Gain international experience") plot_grpfrq(international.experience, degree, geom.colors = "gs", title = "Gain international experience") #family expectations plot_grpfrq(familyexpectations, world.region, geom.colors = "gs", title = "Family expectations") plot_grpfrq(familyexpectations, degree, geom.colors = "gs", title = "Family expectations") #Restrcitive cultural practices plot_grpfrq(cultural.practices, world.region, geom.colors = "gs", title = "Restrictive cultural practices") plot_grpfrq(cultural.practices, degree, geom.colors = "gs", title = "Restrictive cultural practices") #limited jobs plot_grpfrq(limited.jobs, world.region, geom.colors = "gs", title = "Limited job opportunities") plot_grpfrq(limited.jobs, degree, geom.colors = "gs", title = "Limited job opportunities") #lower income levels plot_grpfrq(lower.income, world.region, geom.colors = "gs", title = "Lower income level") plot_grpfrq(lower.income, degree, geom.colors = "gs", title = "Lower income level") #Lower quality of life plot_grpfrq(lower.quality.life, world.region, geom.colors = "gs", title = "Lower quality of life") plot_grpfrq(lower.quality.life, degree, geom.colors = "gs", title = "Lower quality of life") #Political persecution plot_grpfrq(politicalpersecution, world.region, geom.colors = "gs", title = "Political persecution") plot_grpfrq(politicalpersecution, degree, geom.colors = "gs", title = "Political persecution") #Dangers to ones own life plot_grpfrq(danger.to.ones.life, world.region, geom.colors = "gs", title = "Danger to one's own life") plot_grpfrq(danger.to.ones.life, degree, geom.colors = "gs", title = "Danger to one's own life") #Data preparation Returning home: Pull factors in home country #Better job opportunities professional.opportunities <-as.factor(Better.professional.opportunities.in.home.country) professional.opportunities <- factor(professional.opportunities, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(professional.opportunities, Better.professional.opportunities.in.home.country) #Better quality of life better.quality.life<-as.factor(Better.quality.of.living.in.home.country) better.quality.life <- factor(better.quality.life, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(better.quality.life, Better.quality.of.living.in.home.country) #Feeling more comfortable at Home home.comfort<-as.factor(Feeling.more.comfortable.at.home) home.comfort <- factor(home.comfort, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(home.comfort,Feeling.more.comfortable.at.home) #higher income level higher.income <-as.factor(Higher.income.levels) higher.income <- factor(higher.income, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(higher.income, Higher.income.levels) #Family ties back home family.ties<-as.factor(Family.ties.back.home) family.ties <- factor(family.ties, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(family.ties, Family.ties.back.home) #Feelings of alienation feelings.of.alienation <-as.factor(Feelings.of.alienation.from.the.Russian.culture.and.population) feelings.of.alienation <- factor(feelings.of.alienation, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(feelings.of.alienation, Feelings.of.alienation.from.the.Russian.culture.and.population) #Difficulties in finding job job.difficulties<-as.factor(Difficulties.in.finding.a.job) job.difficulties <- factor(job.difficulties, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(job.difficulties, Difficulties.in.finding.a.job) #Poor working conditions poor.work<-as.factor(Poor.working.conditions) poor.work <- factor(poor.work, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(poor.work, Poor.working.conditions) #Lower quality of life low.life.quality <-as.factor(Lower.quality.of.life) low.life.quality <- factor(low.life.quality, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(low.life.quality, Lower.quality.of.life) #Perceived or Experienced discrimination discrimination<-as.factor(Perceived.or.experienced.discrimination) discrimination <- factor(discrimination, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(discrimination, Perceived.or.experienced.discrimination) #Crime and low level of safety crime.safety<-as.factor(Crime.and.low.level.of.safety) crime.safety <- factor(crime.safety, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(crime.safety, Crime.and.low.level.of.safety) #Strict migration process strict.migration<-as.factor(Strict.migration.process.difficulties.in.getting.visas.) strict.migration <- factor(strict.migration, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(strict.migration, Strict.migration.process.difficulties.in.getting.visas.) #Factors influencing the decision to stay in Russia HCReturnFactors<-data.frame(professional.opportunities,better.quality.life,home.comfort, higher.income, family.ties,feelings.of.alienation, poor.work, low.life.quality,discrimination,crime.safety,strict.migration) HomeReturn_factors<-data.frame(world.region, degree, Better.professional.opportunities.in.home.country+ Better.quality.of.living.in.home.country+Feeling.more.comfortable.at.home+ Higher.income.levels+ Family.ties.back.home+ Feelings.of.alienation.from.the.Russian.culture.and.population+ Difficulties.in.finding.a.job+ Poor.working.conditions+ Lower.quality.of.life+ Crime.and.low.level.of.safety+ Strict.migration.process.difficulties.in.getting.visas.) #Crosstabulation of Return home factors with Region and degree crosstab(data, row.vars = c("world.region","degree"), col.vars ="Better.professional.opportunities.in.home.country", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Better.quality.of.living.in.home.country", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Higher.income.levels", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Family.ties.back.home", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Feelings.of.alienation.from.the.Russian.culture.and.population", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Difficulties.in.finding.a.job", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Poor.working.conditions", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Lower.quality.of.life", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Crime.and.low.level.of.safety", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Strict.migration.process.difficulties.in.getting.visas.", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) #Graphs #Factors influencing the decision to stay plot_stackfrq(HCReturnFactors) #Better professional opportunities plot_grpfrq(professional.opportunities, world.region, geom.colors = "gs", title = "Better professional opportunities") plot_grpfrq(professional.opportunities, degree, geom.colors = "gs", title = "Better professional opportunities") #Better quality of life plot_grpfrq(better.quality.life, world.region, geom.colors = "gs", title = "Better quality of life") plot_grpfrq(better.quality.life, degree, geom.colors = "gs", title = "Better quality of life") #Feeling more comfortable at Home plot_grpfrq(home.comfort, world.region, geom.colors = "gs", title = "Feeling more comfortable at Home") plot_grpfrq(home.comfort, degree, geom.colors = "gs", title = "Feeling more comfortable at Home") #Higher income level plot_grpfrq(higher.income, world.region, geom.colors = "gs", title = "Higher income level") plot_grpfrq(higher.income, degree, geom.colors = "gs", title = "Higher income level") #Family ties back home plot_grpfrq(family.ties, world.region, geom.colors = "gs", title = "Family ties back home") plot_grpfrq(family.ties, degree, geom.colors = "gs", title = "Family ties back home") #Feelings of alienation plot_grpfrq(feelings.of.alienation, world.region, geom.colors = "gs", title = "Feelings of alienation") plot_grpfrq(feelings.of.alienation, degree, geom.colors = "gs", title = "Feelings of alienation") #Difficulties in finding job plot_grpfrq(job.difficulties, world.region, geom.colors = "gs", title = "Difficulties in finding jobs") plot_grpfrq(job.difficulties, degree, geom.colors = "gs", title = "Difficulties in finding jobs") #Poor working conditions plot_grpfrq(poor.work, world.region, geom.colors = "gs", title = "Poor working conditions") plot_grpfrq(poor.work, degree, geom.colors = "gs", title = "Poor working conditions") #Lower quality of life plot_grpfrq(low.life.quality, world.region, geom.colors = "gs", title = "Lower quality of life") plot_grpfrq(low.life.quality, degree, geom.colors = "gs", title = "Lower quality of life") #Perceived or Experienced discrimination plot_grpfrq(discrimination, world.region, geom.colors = "gs", title = "Perceived or Experienced discrimination") plot_grpfrq(discrimination, degree, geom.colors = "gs", title = "Perceived or Experienced discrimination") #Crime and low level of safety plot_grpfrq(crime.safety, world.region, geom.colors = "gs", title = "Crime and low level of safety") plot_grpfrq(crime.safety, degree, geom.colors = "gs", title = "Crime and low level of safety") #Strict migration process plot_grpfrq(strict.migration, world.region, geom.colors = "gs", title = "Strict migration process") plot_grpfrq(strict.migration, degree, geom.colors = "gs", title = "Strict migration process") #Data preparation: Moving to another country #Better job opportunities better_job.opportunities <-as.factor(Better.job.opportunities) better_job.opportunities <- factor(better_job.opportunities, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(better_job.opportunities, Better.job.opportunities) #higher quality of life high_quality.life<-as.factor(Higher.quality.of.life) high_quality.life <- factor(high_quality.life, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(high_quality.life, Higher.quality.of.life) #Better career opportunities better.career<-as.factor(Better.career.opportunities.and.advancement.in.chosen.profession.1) better.career <- factor(better.career, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(better.career, Better.career.opportunities.and.advancement.in.chosen.profession.1) #higher income level high.income <-as.factor(Higher.income.levels.1) high.income <- factor(high.income, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(high.income, Higher.income.levels.1) #Family and Friends ties family_friends.ties<-as.factor(Ties.to.family.and.friends.1) family_friends.ties <- factor(family_friends.ties, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(family_friends.ties, Ties.to.family.and.friends.1) #Gain international experience gain.experience<-as.factor(Gain.international.experience.1) gain.experience <- factor(gain.experience, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(gain.experience, Gain.international.experience.1) #Flexible immigration process flexible.immigration<-as.factor(Flexible.immigration.process) flexible.immigration <- factor(flexible.immigration, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(flexible.immigration, Flexible.immigration.process) #Moving to another country: Push factors in Russia #Feelings of alienation feeling.alienation <-as.factor(Feelings.of.alienation.from.the.Russian.culture.and.population.1) feeling.alienation <- factor(feeling.alienation, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(feeling.alienation, Feelings.of.alienation.from.the.Russian.culture.and.population.1) #Difficulties in finding job finding.job<-as.factor(Difficulties.in.finding.a.job.1) finding.job <- factor(finding.job, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(finding.job, Difficulties.in.finding.a.job.1) #Poor working conditions work.conditions<-as.factor(Poor.working.conditions.1) work.conditions <- factor(work.conditions, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(work.conditions, Poor.working.conditions.1) #Lower quality of life low.quality <-as.factor(Lower.quality.of.life.1) low.quality <- factor(low.quality, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(low.quality, Lower.quality.of.life.1) #Perceived or Experienced discrimination perceived.discrimination<-as.factor(Perceived.or.experienced.discrimination.1) perceived.discrimination <- factor(perceived.discrimination, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(perceived.discrimination, Perceived.or.experienced.discrimination.1) #Crime and low level of safety crime.safety.levels<-as.factor(Crime.and.low.level.of.safety.1) crime.safety.levels <- factor(crime.safety.levels, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(crime.safety.levels, Crime.and.low.level.of.safety.1) #Strict migration process strict.visa<-as.factor(Strict.migration.process.difficulties.in.getting.visas..1) strict.visa <- factor(strict.visa, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(strict.visa, Strict.migration.process.difficulties.in.getting.visas..1) #Moving to another country: Push factors in home country #family expectations family_expectations<-as.factor(Family.expectations.1) family_expectations <- factor(family_expectations, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(family_expectations, Family.expectations.1) #Availability of scholarship restrictive.practices<-as.factor(Restrictive.cultural.practices..eg..pressure.to.marry..1) restrictive.practices <- factor(restrictive.practices, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(restrictive.practices, Restrictive.cultural.practices..eg..pressure.to.marry..1) #limited jobs limited.jobs.opportunities<-as.factor(Limited.job.opportunities.in.home.country.1) limited.jobs.opportunities <- factor(limited.jobs.opportunities, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(limited.jobs.opportunities, Limited.job.opportunities.in.home.country.1) #lower income levels low.income<-as.factor(Lower.income.levels.1) low.income <- factor(low.income, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(low.income, Lower.income.levels.1) #Lower quality of life low_lifequality<-as.factor(Lower.quality.of.life.3) low_lifequality <- factor(low_lifequality, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(low_lifequality, Lower.quality.of.life.3) #Political persecution political_persecution<-as.factor(Political.persecution.1) political_persecution <- factor(political_persecution, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(political_persecution, Political.persecution.1) #Dangers to ones own life danger.to.life<-as.factor(Danger.or.fear.for.one.s.own.life.1) danger.to.life <- factor(danger.to.life, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(danger.to.life, Danger.or.fear.for.one.s.own.life.1) #Factors influencing the decision to stay in Russia Move2CountryFactors<-data.frame(better_job.opportunities,high_quality.life,better.career,high.income, family_friends.ties,gain.experience, flexible.immigration,feeling.alienation, finding.job,work.conditions,low.quality,perceived.discrimination, crime.safety.levels, strict.visa, family_expectations, restrictive.practices, limited.jobs.opportunities, low.income, low_lifequality, political_persecution, danger.to.life) MoveCountry_factors<-data.frame(world.region, degree, Better.job.opportunities,Higher.quality.of.life, Better.career.opportunities.and.advancement.in.chosen.profession.1, Higher.income.levels.1,Ties.to.family.and.friends.1,Gain.international.experience.1, Flexible.immigration.process,Feelings.of.alienation.from.the.Russian.culture.and.population.1, Difficulties.in.finding.a.job.1,Poor.working.conditions.1,Lower.quality.of.life.1, Perceived.or.experienced.discrimination.1, Crime.and.low.level.of.safety.1, Strict.migration.process.difficulties.in.getting.visas..1,Family.expectations.1, Restrictive.cultural.practices..eg..pressure.to.marry..1, Limited.job.opportunities.in.home.country.1, Lower.income.levels.1, Lower.quality.of.life.3, Political.persecution.1, Danger.or.fear.for.one.s.own.life.1) #Crosstabulation of Return home factors with Region and degree crosstab(data, row.vars = c("world.region","degree"), col.vars ="Better.job.opportunities", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Higher.quality.of.life", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Better.career.opportunities.and.advancement.in.chosen.profession.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Higher.income.levels.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Ties.to.family.and.friends.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Gain.international.experience.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Flexible.immigration.process", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Feelings.of.alienation.from.the.Russian.culture.and.population.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Difficulties.in.finding.a.job.1,Poor.working.conditions.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Lower.quality.of.life.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Perceived.or.experienced.discrimination.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Crime.and.low.level.of.safety.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Strict.migration.process.difficulties.in.getting.visas..1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Restrictive.cultural.practices..eg..pressure.to.marry..1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Family.expectations.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Limited.job.opportunities.in.home.country.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Lower.income.levels.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Lower.quality.of.life.3", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Political.persecution.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Danger.or.fear.for.one.s.own.life.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) #Graphs #Factors influencing the decision to stay plot_stackfrq(Move2CountryFactors) #Better job opportunities plot_grpfrq(better_job.opportunities, world.region, geom.colors = "gs", title = "Better job opportunities") plot_grpfrq(better_job.opportunities, degree, geom.colors = "gs", title = "Better job opportunities") #Higher quality of life plot_grpfrq(high_quality.life, world.region, geom.colors = "gs", title = "Higher quality of life") plot_grpfrq(high_quality.life, degree, geom.colors = "gs", title = "Higher quality of life") #Better career opportunities plot_grpfrq(better.career, world.region, geom.colors = "gs", title = "Better career opportunities") plot_grpfrq(better.career, degree, geom.colors = "gs", title = "Better career opportunities") #Higher income level plot_grpfrq(high.income, world.region, geom.colors = "gs", title = "Higher income level") plot_grpfrq(high.income, degree, geom.colors = "gs", title = "Higher income level") #Family and Friends ties plot_grpfrq(family_friends.ties, world.region, geom.colors = "gs", title = "Family and Friends ties") plot_grpfrq(family_friends.ties, degree, geom.colors = "gs", title = "Family and Friends ties") #Gain international experience plot_grpfrq(gain.experience, world.region, geom.colors = "gs", title = "Gain international experience") plot_grpfrq(gain.experience, degree, geom.colors = "gs", title = "Gain international experience") #Flexible immigration process plot_grpfrq(flexible.immigration, world.region, geom.colors = "gs", title = "Flexible immigration process ") plot_grpfrq(flexible.immigration, degree, geom.colors = "gs", title = "Flexible immigration process") #Feelings of alienation plot_grpfrq(feeling.alienation, world.region, geom.colors = "gs", title = "Feelings of alienation") plot_grpfrq(feeling.alienation, degree, geom.colors = "gs", title = "Feelings of alienation") #Difficulties in finding job plot_grpfrq(finding.job, world.region, geom.colors = "gs", title = "Difficulties in finding jobs") plot_grpfrq(finding.job, degree, geom.colors = "gs", title = "Difficulties in finding jobs") #Poor working conditions plot_grpfrq(work.conditions, world.region, geom.colors = "gs", title = "Poor working conditions") plot_grpfrq(work.conditions, degree, geom.colors = "gs", title = "Poor working conditions") #Lower quality of life plot_grpfrq(low.quality, world.region, geom.colors = "gs", title = "Lower quality of life") plot_grpfrq(low.quality, degree, geom.colors = "gs", title = "Lower quality of life") #Perceived or Experienced discrimination plot_grpfrq(perceived.discrimination, world.region, geom.colors = "gs", title = "Perceived or Experienced discrimination") plot_grpfrq(perceived.discrimination, degree, geom.colors = "gs", title = "Perceived or Experienced discrimination") #Crime and low level of safety plot_grpfrq(crime.safety.levels, world.region, geom.colors = "gs", title = "Crime and low level of safety") plot_grpfrq(crime.safety.levels, degree, geom.colors = "gs", title = "Crime and low level of safety") #Strict migration process plot_grpfrq(strict.visa, world.region, geom.colors = "gs", title = "Strict migration process") plot_grpfrq(strict.visa, degree, geom.colors = "gs", title = "Strict migration process") #Family expectations plot_grpfrq(family_expectations, world.region, geom.colors = "gs", title = "Family expectations") plot_grpfrq(job.opportunities, degree, geom.colors = "gs", title = "Family expectations") #Restrictive Cultural practices plot_grpfrq(restrictive.practices, world.region, geom.colors = "gs", title = "Restrictive Cultural practices") plot_grpfrq(restrictive.practices, degree, geom.colors = "gs", title = "Restrictive Cultural practices") #Limited jobs plot_grpfrq(limited.jobs.opportunities, world.region, geom.colors = "gs", title = "Limited jobs opportunities") plot_grpfrq(limited.jobs.opportunities, degree, geom.colors = "gs", title = "Limited jobs opportunities") #Lower income levels plot_grpfrq(low.income, world.region, geom.colors = "gs", title = "Lower income levels") plot_grpfrq(low.income, degree, geom.colors = "gs", title = "Lower income levels") #Lower quality of life plot_grpfrq(low_lifequality, world.region, geom.colors = "gs", title = "Lower quality of life") plot_grpfrq(low_lifequality, degree, geom.colors = "gs", title = "Lower quality of life") #Political persecution plot_grpfrq(political_persecution, world.region, geom.colors = "gs", title = "Political persecution") plot_grpfrq(political_persecution, degree, geom.colors = "gs", title = "Political persecution") #Dangers to ones own life plot_grpfrq(danger.to.life, world.region, geom.colors = "gs", title = "Dangers to ones own life") plot_grpfrq(danger.to.life, degree, geom.colors = "gs", title = "Dangers to ones own life")
/MThesis.R
no_license
Gabriel-Ghoost/Student-Analysis
R
false
false
140,136
r
###Gabriel Agbesi Atsyor#### ##Masters Thesis R script### #setting the working directory getwd() setwd("C:/Users/GHOOST/Desktop/New Lit/data") #attaching packages library(lavaan) library(foreign) library(car) library(psych) library(ggplot2) library(summarytools) library(knitr) library(gridExtra) library(kableExtra) library(stargazer) library(multcomp) #attaching the data data<-read.csv("International Students Survey.csv") attach(data) ##FACTORS INFLUENCING STUDENTS DECISION TO STUDY IN RUSSIA #Data preparation: Demographic information #Age table(Age) summary(as.numeric(Age)) data$age<-recode(as.numeric(Age),"17:21=1; 22:26=2;27:hi=3") table(data$age) data$age<-factor(data$age,lab=c("17 to 21 yrs", "22 to 26 yrs", " 27 yrs and older")) #Degree data$degree<-What.degree.are.you.currently.studying.for. #Language of instruction data$language.of.instruction<-What.is.the.language.of.instruction.for.your.program. data$family.income<-What.was.your.annual.family.income.when.you.were.applying.to.study.abroad..estimate.in.US.dollars. #country regions table(Home.country) data$world.region[data$Home.country == 'Algeria'| data$Home.country == 'Botswana'| data$Home.country == 'Cameroon'| data$Home.country == 'Chad'| data$Home.country == 'Congo'| data$Home.country == 'DR Congo'|data$Home.country == 'Eritrea'| data$Home.country == 'Ivory Coast'| data$Home.country == 'Gambia'|data$Home.country == 'Ghana'| data$Home.country == 'Kenya'|data$Home.country == 'Madagascar'| data$Home.country == 'Niger'|data$Home.country == 'Nigeria'| data$Home.country == 'South Africa'|data$Home.country == 'Sudan'| data$Home.country == 'Uganda'|data$Home.country == 'Zambia'] <- 'Africa' data$world.region[data$Home.country == 'Bangladesh'| data$Home.country == 'India'| data$Home.country == 'Nepal'| data$Home.country == 'Pakistan'| data$Home.country == 'Sri Lanka'|data$Home.country == 'Indonesia'| data$Home.country == 'Philippines'|data$Home.country == 'Thailand'| data$Home.country == 'Vietnam'|data$Home.country == 'China'| data$Home.country == 'Japan'|data$Home.country == 'Mongolia'| data$Home.country == 'South Korea'|data$Home.country == 'Hong Kong'| data$Home.country == 'Taiwan'] <- 'Asia' data$world.region[data$Home.country == 'Australia'| data$Home.country == 'Austria'| data$Home.country == 'Bosnia and Herzegovina'| data$Home.country == 'Bulgaria'| data$Home.country == 'Europe'| data$Home.country == 'France'| data$Home.country == 'Germany'| data$Home.country == 'Italy'|data$Home.country == 'Poland'| data$Home.country == 'Portugal'|data$Home.country == 'Serbia'| data$Home.country == 'Spain'|data$Home.country == 'Switzerland'| data$Home.country == 'Republic of North Macedonia'| data$Home.country == 'USA'] <- 'Europe' data$world.region[data$Home.country == 'Armenia'| data$Home.country == 'Azerbaijan'|data$Home.country == 'Belarus'| data$Home.country == 'Estonia'|data$Home.country == 'Georgia'| data$Home.country == 'Georgia'|data$Home.country == 'Kazakhstan'| data$Home.country == 'Kyrgyzstan'|data$Home.country == 'Latvia'| data$Home.country == 'Moldova'|data$Home.country == 'Tajikistan'| data$Home.country == 'Turkmenistan'|data$Home.country == 'Ukraine'| data$Home.country == 'Uzbekistan'] <- 'Commonwealth of Independent States' data$world.region[data$Home.country == 'Bahrain'| data$Home.country == 'Egypt'| data$Home.country == 'Iran'| data$Home.country == 'Israel'| data$Home.country == 'Lebanon'| data$Home.country == 'Syria'| data$Home.country == 'Turkey'] <- 'Middle East' data$world.region[data$Home.country == 'Brazil'| data$Home.country == 'Colombia'|data$Home.country == 'Ecuador'| data$Home.country == 'Guatemala'| data$Home.country == 'Haiti'| data$Home.country == 'Mexico'|data$Home.country == 'Venezuela'| data$Home.country == 'Nicaragua'] <- 'Southern America' table(data$world.region, useNA = "ifany") attach(data) ##Regression Analysis:Factors that influenced the decision of international students to study in Russia #Data Preparation: Push Factors is.numeric(Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution) Competitive.University.admission.process<-Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution is.numeric(Competitive.University.admission.process) is.numeric(Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market) Perceived.advantage.of.international.degree<-Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market is.numeric(Perceived.advantage.of.international.degree) #creating a data frame for push factors PushFactors <-data.frame(language.of.instruction, degree, age, Gender, world.region, Home.country, Unavailability.of.the.desired.study.program,Low.quality.of.education ,Competitive.University.admission.process ,Perceived.advantage.of.international.degree ,Unavailability.of.scholarship.opportunities ,Encouragement.from.my.family.to.study.abroad,Encouragement.from..my.friends.to.study.abroad ,Better.earning.prospects.abroad, The.social.prestige.of.studying.abroad ,To.experience.a.different.culture) #exploratory factor analysis to allow for indexing. #principal component analysis pushpc <- princomp(~Unavailability.of.the.desired.study.program+Low.quality.of.education +Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution +Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market +Unavailability.of.scholarship.opportunities +Encouragement.from.my.family.to.study.abroad+Encouragement.from..my.friends.to.study.abroad +Better.earning.prospects.abroad+The.social.prestige.of.studying.abroad +To.experience.a.different.culture, data = PushFactors, cor = FALSE, na.action = na.omit) summary(pushpc) #factor analysis push.efa <- factanal(~Unavailability.of.the.desired.study.program+Low.quality.of.education +Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution +Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market +Unavailability.of.scholarship.opportunities +Encouragement.from.my.family.to.study.abroad+Encouragement.from..my.friends.to.study.abroad +Better.earning.prospects.abroad+The.social.prestige.of.studying.abroad +To.experience.a.different.culture, factors = 6, data = PushFactors , cor = FALSE, na.action = na.omit) print(push.efa, digits=2, cutoff=.3, sort=TRUE) push.efa1 <- factanal(~Unavailability.of.the.desired.study.program+Low.quality.of.education +Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution +Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market +Unavailability.of.scholarship.opportunities +Encouragement.from.my.family.to.study.abroad+Encouragement.from..my.friends.to.study.abroad +Better.earning.prospects.abroad+The.social.prestige.of.studying.abroad +To.experience.a.different.culture, factors = 5, data = PushFactors, cor = FALSE, na.action = na.omit) print(push.efa1, digits=2, cutoff=.3, sort=TRUE) push.efa2 <- factanal(~Unavailability.of.the.desired.study.program+Low.quality.of.education +Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution +Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market +Unavailability.of.scholarship.opportunities +Encouragement.from.my.family.to.study.abroad+Encouragement.from..my.friends.to.study.abroad +Better.earning.prospects.abroad+The.social.prestige.of.studying.abroad +To.experience.a.different.culture, factors = 4, data = PushFactors, cor = FALSE, na.action = na.omit) print(push.efa2, digits=2, cutoff=.3, sort=TRUE) #with p-value 0.0415, four factors are sufficient. #indexing the correlated factors #encouragement from family and friends cor.test(Encouragement.from..my.friends.to.study.abroad,Encouragement.from.my.family.to.study.abroad) encouragement.from.family.friends<-(Encouragement.from..my.friends.to.study.abroad+Encouragement.from.my.family.to.study.abroad)/2 table(encouragement.from.family.friends) PushFactors$encouragement.from.family.friends<-recode(encouragement.from.family.friends, "1=1; 1.5:2=2; 2.5:3=3; 3.5:4=4; 4.5:5=5") table(PushFactors$encouragement.from.family.friends) #advantages of studying abroad cor.test(Better.earning.prospects.abroad,The.social.prestige.of.studying.abroad) advantages.of.studying.abroad<-(Better.earning.prospects.abroad+The.social.prestige.of.studying.abroad)/2 table(advantages.of.studying.abroad) PushFactors$benefits.of.studying.abroad<-recode(advantages.of.studying.abroad, "1=1; 1.5:2=2; 2.5:3=3; 3.5:4=4; 4.5:5=5") table(PushFactors$benefits.of.studying.abroad) #access to education cor.test(Unavailability.of.the.desired.study.program,Low.quality.of.education) access.to.education<-(Unavailability.of.the.desired.study.program+Low.quality.of.education)/2 table(access.to.education) PushFactors$access.to.education<-recode(access.to.education, "1=1; 1.5:2=2; 2.5:3=3; 3.5:4=4; 4.5:5=5") table(PushFactors$access.to.education) attach(PushFactors) #checking for cronbach's aplha to establish reliability PushFactorsHC <-data.frame(access.to.education, Competitive.University.admission.process ,Perceived.advantage.of.international.degree ,Unavailability.of.scholarship.opportunities ,encouragement.from.family.friends ,advantages.of.studying.abroad ,To.experience.a.different.culture) psych::alpha(PushFactorsHC) #Regression analysis #Push factors in Home country that influenced the decision of international students to study in Russia #Empty model model0<-lm(as.numeric(language.of.instruction)~1, data = PushFactors) summary(model0) #Full Model model1<-lm(as.numeric(language.of.instruction)~encouragement.from.family.friends+ benefits.of.studying.abroad+access.to.education+ Competitive.University.admission.process+Perceived.advantage.of.international.degree+ Unavailability.of.scholarship.opportunities+To.experience.a.different.culture, data = PushFactors) summary(model1) #Full Model and controls model2<-lm(as.numeric(language.of.instruction)~encouragement.from.family.friends+ benefits.of.studying.abroad+access.to.education+ Competitive.University.admission.process+Perceived.advantage.of.international.degree+ Unavailability.of.scholarship.opportunities+To.experience.a.different.culture+as.numeric(age)+ as.numeric(Home.country)+as.numeric(Gender), data = PushFactors) summary(model2) #Full Model with interaction effect model3<-lm(as.numeric(language.of.instruction)~benefits.of.studying.abroad+ Unavailability.of.scholarship.opportunities+Competitive.University.admission.process+ (access.to.education+encouragement.from.family.friends+Perceived.advantage.of.international.degree+ To.experience.a.different.culture)*world.region, data = PushFactors) summary(model3) #Full Model and control with interaction effects model4<-lm(as.numeric(language.of.instruction)~benefits.of.studying.abroad+ Unavailability.of.scholarship.opportunities+Competitive.University.admission.process+ (access.to.education+encouragement.from.family.friends+Perceived.advantage.of.international.degree+ To.experience.a.different.culture)*world.region+as.numeric(age)+as.numeric(Gender), data = PushFactors) summary(model4) #Graph for the models stargazer(model1, model2, title="Regression Results: Push Factors in Home Country", align=TRUE, no.space=TRUE, single.row=T,type = "text", intercept.bottom = F,dep.var.labels = "Move to Moscow", out="a.doc", covariate.labels =c("Constant","Encouragement from family and friends","Benefits of studying abroad", "Access to education", "Competitive university admission process", "Perceieved advantage of an international degree", "Unavailability of scholarship opportunities", "Experience a different culture", "Age", "Home Country", "Gender")) stargazer(model3, model4, title="Regression Results: Push Factors in Home Country", align=TRUE,column.sep.width = "-5pt", no.space=TRUE, single.row=T,type = "text", intercept.bottom = F,dep.var.labels = "Move to Moscow", out="b.doc", covariate.labels =c("Constant","Benefits of studying abroad","Unavailability of scholarship opportunities", "Competitive university admission process","Access to education", "Encouragement from family and friends","Perceieved advantage of an international degree", "Experience a different culture","Asia", "CIS", "Europe", "Middle East", "South America", "Age", "Gender", "Access to education*Asia", "Access to education*CIS", "Access to education*Europe", "Access to education*Middle East", "Access to education*South America","Encouragement from family and friends*Asia", "Encouragement from family and friends*CIS", "Encouragement from family and friends*Europe", "Encouragement from family and friends*Middle East","Encouragement from family and friends*South America", "Perceieved advantage of an international degree*Asia","Perceieved advantage of an international degree*CIS", "Perceieved advantage of an international degree*Europe","Perceieved advantage of an international degree*Middle East", "Perceieved advantage of an international degree*South America","Experience a different culture*Asia", "Experience a different culture*CIS", "Experience a different culture*Europe", "Encouragement from family and friends*Middle East","Experience a different culture*South America")) #checking multicolinearity vif(model1) vif(model2) vif(model3) vif(model4) ####Pull factors that influenced the decision of international students to study in Russia Recommendations.from.family.friends<-Personal.recommendations.from.parents..relatives..and.friends #creating a data frame for push factors PullFactors<-data.frame(language.of.instruction, age, Gender, world.region, Home.country, Availability.of.desired.study.program,Higher.quality.of.education..compared.to.home.country., Low.cost.of.living,Low.tuition.fees,Awarded.scholarships.or.tuition.waiver,Attraction.to.Russian.culture..society, Career.prospects.in.Russia,Recommendations.from.family.friends,cultural.proximity.with.home, geographical.proximity.with.home,Quality.and.reputation.of.the.University,Recognition.of.the.degree.in.my.home.country, Quality.of.the.teaching.staff,The.reputation.of.the.alumni,The.reputation.of.the.international.community, HSE.position.in.international.university.rankings,Cost.of.tuition.for.international.students,Availability.of.scholarships, Support.services.for.international.students,Graduates.employment.rates,HSE.s.international.strategic.alliances, Local.employers.preference.of..degrees.awarded.by.HSE) #exploratory factor analysis to allow for index. #principal component analysis fit.pc <- princomp(~Availability.of.desired.study.program+Higher.quality.of.education..compared.to.home.country. +Low.cost.of.living+Low.tuition.fees+Awarded.scholarships.or.tuition.waiver+Attraction.to.Russian.culture..society +Career.prospects.in.Russia+Personal.recommendations.from.parents..relatives..and.friends+cultural.proximity.with.home +geographical.proximity.with.home+Quality.and.reputation.of.the.University+Recognition.of.the.degree.in.my.home.country +Quality.of.the.teaching.staff+The.reputation.of.the.alumni+The.reputation.of.the.international.community +HSE.position.in.international.university.rankings+Cost.of.tuition.for.international.students +Availability.of.scholarships+Support.services.for.international.students+Graduates.employment.rates +HSE.s.international.strategic.alliances+Local.employers.preference.of..degrees.awarded.by.HSE, data = PullFactors, cor = FALSE, na.action = na.omit) summary(fit.pc) fit.efa <- factanal(~Availability.of.desired.study.program+Higher.quality.of.education..compared.to.home.country. +Low.cost.of.living+Low.tuition.fees+Awarded.scholarships.or.tuition.waiver+Attraction.to.Russian.culture..society +Career.prospects.in.Russia+Personal.recommendations.from.parents..relatives..and.friends+cultural.proximity.with.home +geographical.proximity.with.home+Quality.and.reputation.of.the.University+Recognition.of.the.degree.in.my.home.country +Quality.of.the.teaching.staff+The.reputation.of.the.alumni+The.reputation.of.the.international.community +HSE.position.in.international.university.rankings+Cost.of.tuition.for.international.students +Availability.of.scholarships+Support.services.for.international.students+Graduates.employment.rates +HSE.s.international.strategic.alliances+Local.employers.preference.of..degrees.awarded.by.HSE, factors = 11, data = PullFactors, cor = FALSE, na.action = na.omit) print(fit.efa, digits=2, cutoff=.3, sort=TRUE) fit.efa2 <- factanal(~Availability.of.desired.study.program+Higher.quality.of.education..compared.to.home.country. +Low.cost.of.living+Low.tuition.fees+Awarded.scholarships.or.tuition.waiver+Attraction.to.Russian.culture..society +Career.prospects.in.Russia+Personal.recommendations.from.parents..relatives..and.friends+cultural.proximity.with.home +geographical.proximity.with.home+Quality.and.reputation.of.the.University+Recognition.of.the.degree.in.my.home.country +Quality.of.the.teaching.staff+The.reputation.of.the.alumni+The.reputation.of.the.international.community +HSE.position.in.international.university.rankings+Cost.of.tuition.for.international.students +Availability.of.scholarships+Support.services.for.international.students+Graduates.employment.rates +HSE.s.international.strategic.alliances+Local.employers.preference.of..degrees.awarded.by.HSE, factors = 8, data = PullFactors, cor = FALSE, na.action = na.omit) print(fit.efa2, digits=2, cutoff=.3, sort=TRUE) #with p-value 6.54e-10 8 factors are sufficient. #indexing the correlated pull factors #prospect of employment cor.test(Graduates.employment.rates,Local.employers.preference.of..degrees.awarded.by.HSE) cor.test(Graduates.employment.rates,Career.prospects.in.Russia) cor.test(Career.prospects.in.Russia,Local.employers.preference.of..degrees.awarded.by.HSE) employment.prospect<-(Graduates.employment.rates+Local.employers.preference.of..degrees.awarded.by.HSE+Career.prospects.in.Russia)/3 employment.prospect<-round(employment.prospect,2) table(employment.prospect) PullFactors$employment.prospect<-recode(employment.prospect, "1:1.33=1; 1.67:2.33=2; 2.67:3.33=3; 3.67:4.33=4; 4.67:5=5") table(PullFactors$employment.prospect) #proximity cor.test(cultural.proximity.with.home,geographical.proximity.with.home) proximity<-(cultural.proximity.with.home+geographical.proximity.with.home)/2 table(proximity) PullFactors$proximity<-recode(proximity, "1=1; 1.5:2=2; 2.5:3=3; 3.5:4=4; 4.5:5=5") table(PullFactors$proximity) #cost cor.test(Low.cost.of.living,Low.tuition.fees) cor.test(Low.cost.of.living,Cost.of.tuition.for.international.students) cor.test(Low.tuition.fees,Cost.of.tuition.for.international.students) cost.of.living<-(Low.cost.of.living+Low.tuition.fees+Cost.of.tuition.for.international.students)/3 cost.of.living<-round(cost.of.living,2) table(cost.of.living) PullFactors$cost.of.living<-recode(cost.of.living, "1:1.33=1; 1.67:2.33=2; 2.67:3.33=3; 3.67:4.33=4; 4.67:5=5") table(PullFactors$cost.of.living) #scholarships cor.test(Awarded.scholarships.or.tuition.waiver,Availability.of.scholarships) scholarship<-(Awarded.scholarships.or.tuition.waiver+Availability.of.scholarships)/2 table(scholarship) PullFactors$scholarship<-recode(scholarship, "1=1; 1.5:2=2; 2.5:3=3; 3.5:4=4; 4.5:5=5") table(PullFactors$scholarship) #HSE Quality cor.test(Quality.and.reputation.of.the.University,Quality.of.the.teaching.staff) HSE.quality<-(Quality.and.reputation.of.the.University+Quality.of.the.teaching.staff)/2 table(HSE.quality) PullFactors$HSE.quality<-recode(HSE.quality, "1=1; 1.5:2=2; 2.5:3=3; 3.5:4=4; 4.5:5=5") table(PullFactors$HSE.quality) #HSE Reputation cor.test(The.reputation.of.the.alumni, The.reputation.of.the.international.community) HSE.reputation<-(The.reputation.of.the.alumni+The.reputation.of.the.international.community)/2 table(HSE.reputation) PullFactors$HSE.reputation<-recode(HSE.reputation, "1=1; 1.5:2=2; 2.5:3=3; 3.5:4=4; 4.5:5=5") table(PullFactors$HSE.reputation) #Program Choice cor.test(Higher.quality.of.education..compared.to.home.country., Availability.of.desired.study.program) program.choice<-(Higher.quality.of.education..compared.to.home.country.+ Availability.of.desired.study.program)/2 table(program.choice) PullFactors$program.choice<-recode(program.choice, "1=1; 1.5:2=2; 2.5:3=3; 3.5:4=4; 4.5:5=5") table(PullFactors$program.choice) attach(PullFactors) #checking for realibility PullFactorsRuHSE<-data.frame(program.choice,cost.of.living,proximity, scholarship,HSE.quality, HSE.reputation, Attraction.to.Russian.culture..society, Recognition.of.the.degree.in.my.home.country,Recommendations.from.family.friends, HSE.position.in.international.university.rankings,Support.services.for.international.students, HSE.s.international.strategic.alliances,employment.prospect) psych::alpha(PullFactorsRuHSE) #Full model model5<-lm(as.numeric(language.of.instruction)~employment.prospect+proximity+ cost.of.living+scholarship+HSE.quality+HSE.reputation+program.choice+ Recommendations.from.family.friends+Attraction.to.Russian.culture..society+ Recognition.of.the.degree.in.my.home.country+HSE.position.in.international.university.rankings+ Support.services.for.international.students+HSE.s.international.strategic.alliances, data = PullFactors) summary(model5) #Full model with controls model6<-lm(as.numeric(language.of.instruction)~employment.prospect+proximity+ cost.of.living+scholarship+HSE.quality+HSE.reputation+program.choice+ Recommendations.from.family.friends+Attraction.to.Russian.culture..society+ Recognition.of.the.degree.in.my.home.country+HSE.position.in.international.university.rankings+ Support.services.for.international.students+HSE.s.international.strategic.alliances+ as.numeric(age)+ as.numeric(Home.country)+as.numeric(Gender), data = PullFactors) summary(model6) #Fullmodel with interaction effect model7<-lm(as.numeric(language.of.instruction)~employment.prospect+scholarship+ HSE.quality+HSE.reputation+Recognition.of.the.degree.in.my.home.country+Support.services.for.international.students+ Attraction.to.Russian.culture..society+(Recommendations.from.family.friends+proximity+cost.of.living+ program.choice+HSE.position.in.international.university.rankings+ HSE.s.international.strategic.alliances)*world.region, data = PullFactors) summary(model7) #Fullmodel and controls with interaction effect model8<-lm(as.numeric(language.of.instruction)~employment.prospect+scholarship+ HSE.quality+HSE.reputation+Recognition.of.the.degree.in.my.home.country+ Support.services.for.international.students+Attraction.to.Russian.culture..society+ (Recommendations.from.family.friends+proximity+cost.of.living+program.choice+ HSE.position.in.international.university.rankings+HSE.s.international.strategic.alliances)*world.region+ as.numeric(age)+as.numeric(Gender), data = PullFactors) summary(model8) #Graph for the models stargazer(model5, model6, title="Regression Results: Push Factors in Home Country", align=TRUE, no.space=TRUE, single.row=T,type = "text", intercept.bottom = F,dep.var.labels = "Move to Moscow",out = "c.doc", covariate.labels =c("Constant","Employment prospects","Proximity","Cost of living", "Scholarship", "HSE quality", "HSE reputation", "Program choice","Recommendations from family and friends", "Attraction to Russian culture", "Recognition of HSE degree in my Home Country", "HSE position in University rankings","Support services for International Students", "HSE international stragtegic alliances","Age", "Home Country", "Gender")) stargazer(model7, model8, title="Regression Results: Push Factors in Home Country", align=TRUE, no.space=TRUE, single.row=T,type = "text", intercept.bottom = F,dep.var.labels = "Move to Moscow", out = "d.doc", covariate.labels =c("Constant","Employment prospects","Scholarship","HSE quality","HSE reputation", "Recognition of HSE degree in my Home Country","Support services for International Students", "Attraction to Russian culture", "Recommendations from family and friends","Proximity", "Cost of living", "Choice of program", "HSE position in University rankings", "HSE international alliances","Asia", "CIS","Europe", "Middle East", "South America", "Age", "Gender", "Recomendations from family and friends*Asia","Recomendations from family and friends*CIS", "Recomendations from family and friends*Europe","Recomendations from family and friends*Middle East", "Recomendations from family and friends*South America","Proximity*Asia", "Proximity*CIS", "Proximity*Europe", "Proximity*Middle East","Proximity*South America", "Cost of living*Asia","Cost of living*CIS", "Cost of living*Europe","Cost of living*Middle East","Cost of living*South America","Choice of program*Asia", "Choice of program*CIS", "Choice of program*Europe","Choice of program*Middle East", "Choice of program*South America", "HSE position in University rankings*Asia", "HSE position in University rankings*CIS", "HSE position in University rankings*Europe", "HSE position in University rankings*Middle East","HSE position in University rankings*South America", "HSE international alliances*Asia", "HSE international alliances*CIS", "HSE international alliances*Europe", "HSE international alliances*Middle East","HSE international alliances*South America")) #checking for multicolinearity vif(model5) vif(model6) vif(model7) vif(model8) #####Creating the Crosstab function crosstab <- function (..., dec.places = NULL, type = NULL, style = "wide", row.vars = NULL, col.vars = NULL, percentages = TRUE, addmargins = TRUE, subtotals=TRUE) ################################################################################### # # # Function created by Dr Paul Williamson, Dept. of Geography and Planning, # # School of Environmental Sciences, University of Liverpool, UK. # # # # Adapted from the function ctab() in the catspec packge. # # # # Version: 12th July 2013 # # # # Output best viewed using the companion function print.crosstab() # # # ################################################################################### #Declare function used to convert frequency counts into relevant type of proportion or percentage { mk.pcnt.tbl <- function(tbl, type) { a <- length(row.vars) b <- length(col.vars) mrgn <- switch(type, column.pct = c(row.vars[-a], col.vars), row.pct = c(row.vars, col.vars[-b]), joint.pct = c(row.vars[-a], col.vars[-b]), total.pct = NULL) tbl <- prop.table(tbl, mrgn) if (percentages) { tbl <- tbl * 100 } tbl } #Find no. of vars (all; row; col) for use in subsequent code n.row.vars <- length(row.vars) n.col.vars <- length(col.vars) n.vars <- n.row.vars + n.col.vars #Check to make sure all user-supplied arguments have valid values stopifnot(as.integer(dec.places) == dec.places, dec.places > -1) #type: see next section of code stopifnot(is.character(style)) stopifnot(is.logical(percentages)) stopifnot(is.logical(addmargins)) stopifnot(is.logical(subtotals)) stopifnot(n.vars>=1) #Convert supplied table type(s) into full text string (e.g. "f" becomes "frequency") #If invalid type supplied, failed match gives user automatic error message types <- NULL choices <- c("frequency", "row.pct", "column.pct", "joint.pct", "total.pct") for (tp in type) types <- c(types, match.arg(tp, choices)) type <- types #If no type supplied, default to 'frequency + total' for univariate tables and to #'frequency' for multi-dimenstional tables #For univariate table.... if (n.vars == 1) { if (is.null(type)) { # default = freq count + total.pct type <- c("frequency", "total.pct") #row.vars <- 1 } else { #and any requests for row / col / joint.pct must be changed into requests for 'total.pct' type <- ifelse(type == "frequency", "frequency", "total.pct") } #For multivariate tables... } else if (is.null(type)) { # default = frequency count type <- "frequency" } #Check for integrity of requested analysis and adjust values of function arguments as required if ((addmargins==FALSE) & (subtotals==FALSE)) { warning("WARNING: Request to suppress subtotals (subtotals=FALSE) ignored because no margins requested (addmargins=FALSE)") subtotals <- TRUE } if ((n.vars>1) & (length(type)>1) & (addmargins==TRUE)) { warning("WARNING: Only row totals added when more than one table type requested") #Code lower down selecting type of margin implements this... } if ((length(type)>1) & (subtotals==FALSE)) { warning("WARNING: Can only request supply one table type if requesting suppression of subtotals; suppression of subtotals not executed") subtotals <- TRUE } if ((length(type)==1) & (subtotals==FALSE)) { choices <- c("frequency", "row.pct", "column.pct", "joint.pct", "total.pct") tp <- match.arg(type, choices) if (tp %in% c("row.pct","column.pct","joint.pct")) { warning("WARNING: subtotals can only be suppressed for tables of type 'frequency' or 'total.pct'") subtotals<- TRUE } } if ((n.vars > 2) & (n.col.vars>1) & (subtotals==FALSE)) warning("WARNING: suppression of subtotals assumes only 1 col var; table flattened accordingly") if ( (subtotals==FALSE) & (n.vars>2) ) { #If subtotals not required AND total table vars > 2 #Reassign all but last col.var as row vars #[because, for simplicity, crosstabs assumes removal of subtotals uses tables with only ONE col var] #N.B. Subtotals only present in tables with > 2 cross-classified vars... if (length(col.vars)>1) { row.vars <- c(row.vars,col.vars[-length(col.vars)]) col.vars <- col.vars[length(col.vars)] n.row.vars <- length(row.vars) n.col.vars <- 1 } } #If dec.places not set by user, set to 2 unlesss only one table of type frequency requested, #in which case set to 0. [Leaves user with possibility of having frequency tables with > 0 dp] if (is.null(dec.places)) { if ((length(type)==1) & (type[1]=="frequency")) { dec.places <- 0 } else { dec.places <-2 } } #Take the original input data, whatever form originally supplied in, #convert into table format using requested row and col vars, and save as 'tbl' args <- list(...) if (length(args) > 1) { if (!all(sapply(args, is.factor))) stop("If more than one argument is passed then all must be factors") tbl <- table(...) } else { if (is.factor(...)) { tbl <- table(...) } else if (is.table(...)) { tbl <- eval(...) } else if (is.data.frame(...)) { #tbl <- table(...) if (is.null(row.vars) && is.null(col.vars)) { tbl <- table(...) } else { var.names <- c(row.vars,col.vars) A <- (...) tbl <- table(A[var.names]) if(length(var.names==1)) names(dimnames(tbl)) <- var.names #[table() only autocompletes dimnames for multivariate crosstabs of dataframes] } } else if (class(...) == "ftable") { tbl <- eval(...) if (is.null(row.vars) && is.null(col.vars)) { row.vars <- names(attr(tbl, "row.vars")) col.vars <- names(attr(tbl, "col.vars")) } tbl <- as.table(tbl) } else if (class(...) == "ctab") { tbl <- eval(...) if (is.null(row.vars) && is.null(col.vars)) { row.vars <- tbl$row.vars col.vars <- tbl$col.vars } for (opt in c("dec.places", "type", "style", "percentages", "addmargins", "subtotals")) if (is.null(get(opt))) assign(opt, eval(parse(text = paste("tbl$", opt, sep = "")))) tbl <- tbl$table } else { stop("first argument must be either factors or a table object") } } #Convert supplied table style into full text string (e.g. "l" becomes "long") style <- match.arg(style, c("long", "wide")) #Extract row and col names to be used in creating 'tbl' from supplied input data nms <- names(dimnames(tbl)) z <- length(nms) if (!is.null(row.vars) && !is.numeric(row.vars)) { row.vars <- order(match(nms, row.vars), na.last = NA) } if (!is.null(col.vars) && !is.numeric(col.vars)) { col.vars <- order(match(nms, col.vars), na.last = NA) } if (!is.null(row.vars) && is.null(col.vars)) { col.vars <- (1:z)[-row.vars] } if (!is.null(col.vars) && is.null(row.vars)) { row.vars <- (1:z)[-col.vars] } if (is.null(row.vars) && is.null(col.vars)) { col.vars <- z row.vars <- (1:z)[-col.vars] } #Take the original input data, converted into table format using supplied row and col vars (tbl) #and create a second version (crosstab) which stores results as percentages if a percentage table type is requested. if (type[1] == "frequency") crosstab <- tbl else crosstab <- mk.pcnt.tbl(tbl, type[1]) #If multiple table types requested, create and add these to if (length(type) > 1) { tbldat <- as.data.frame.table(crosstab) z <- length(names(tbldat)) + 1 tbldat[z] <- 1 pcntlab <- type pcntlab[match("frequency", type)] <- "Count" pcntlab[match("row.pct", type)] <- "Row %" pcntlab[match("column.pct", type)] <- "Column %" pcntlab[match("joint.pct", type)] <- "Joint %" pcntlab[match("total.pct", type)] <- "Total %" for (i in 2:length(type)) { if (type[i] == "frequency") crosstab <- tbl else crosstab <- mk.pcnt.tbl(tbl, type[i]) crosstab <- as.data.frame.table(crosstab) crosstab[z] <- i tbldat <- rbind(tbldat, crosstab) } tbldat[[z]] <- as.factor(tbldat[[z]]) levels(tbldat[[z]]) <- pcntlab crosstab <- xtabs(Freq ~ ., data = tbldat) names(dimnames(crosstab))[z - 1] <- "" } #Add margins if required, adding only those margins appropriate to user request if (addmargins==TRUE) { vars <- c(row.vars,col.vars) if (length(type)==1) { if (type=="row.pct") { crosstab <- addmargins(crosstab,margin=c(vars[n.vars])) tbl <- addmargins(tbl,margin=c(vars[n.vars])) } else { if (type=="column.pct") { crosstab <- addmargins(crosstab,margin=c(vars[n.row.vars])) tbl <- addmargins(tbl,margin=c(vars[n.row.vars])) } else { if (type=="joint.pct") { crosstab <- addmargins(crosstab,margin=c(vars[(n.row.vars)],vars[n.vars])) tbl <- addmargins(tbl,margin=c(vars[(n.row.vars)],vars[n.vars])) } else #must be total.pct OR frequency { crosstab <- addmargins(crosstab) tbl <- addmargins(tbl) } } } } #If more than one table type requested, only adding row totals makes any sense... if (length(type)>1) { crosstab <- addmargins(crosstab,margin=c(vars[n.vars])) tbl <- addmargins(tbl,margin=c(vars[n.vars])) } } #If subtotals not required, and total vars > 2, create dataframe version of table, with relevent #subtotal rows / cols dropped [Subtotals only present in tables with > 2 cross-classified vars] t1 <- NULL if ( (subtotals==FALSE) & (n.vars>2) ) { #Create version of crosstab in ftable format t1 <- crosstab t1 <- ftable(t1,row.vars=row.vars,col.vars=col.vars) #Convert to a dataframe t1 <- as.data.frame(format(t1),stringsAsFactors=FALSE) #Remove backslashes from category names AND colnames t1 <- apply(t1[,],2, function(x) gsub("\"","",x)) #Remove preceding and trailing spaces from category names to enable accurate capture of 'sum' rows/cols #[Use of grep might extrac category labels with 'sum' as part of a longer one or two word string...] t1 <- apply(t1,2,function(x) gsub("[[:space:]]*$","",gsub("^[[:space:]]*","",x))) #Reshape dataframe to that variable and category labels display as required #(a) Move col category names down one row; and move col variable name one column to right t1[2,(n.row.vars+1):ncol(t1)] <- t1[1,(n.row.vars+1):ncol(t1)] t1[1,] <- "" t1[1,(n.row.vars+2)] <- t1[2,(n.row.vars+1)] #(b) Drop the now redundant column separating the row.var labels from the table data + col.var labels t1 <- t1[,-(n.row.vars+1)] #In 'lab', assign category labels for each variable to all rows (to allow identification of sub-totals) lab <- t1[,1:n.row.vars] for (c in 1:n.row.vars) { for (r in 2:nrow(lab)) { if (lab[r,c]=="") lab[r,c] <- lab[r-1,c] } } lab <- (apply(lab[,1:n.row.vars],2,function(x) x=="Sum")) lab <- apply(lab,1,sum) #Filter out rows of dataframe containing subtotals t1 <- t1[((lab==0) | (lab==n.row.vars)),] #Move the 'Sum' label associated with last row to the first column; in the process #setting the final row labels associated with other row variables to "" t1[nrow(t1),1] <- "Sum" t1[nrow(t1),(2:n.row.vars)] <- "" #set row and column names to NULL rownames(t1) <- NULL colnames(t1) <- NULL } #Create output object 'result' [class: crosstab] result <- NULL #(a) record of argument values used to produce tabular output result$row.vars <- row.vars result$col.vars <- col.vars result$dec.places <- dec.places result$type <- type result$style <- style result$percentages <- percentages result$addmargins <- addmargins result$subtotals <- subtotals #(b) tabular output [3 variants] result$table <- tbl #Stores original cross-tab frequency counts without margins [class: table] result$crosstab <- crosstab #Stores cross-tab in table format using requested style(frequency/pct) and table margins (on/off) #[class: table] result$crosstab.nosub <- t1 #crosstab with subtotals suppressed [class: dataframe; or NULL if no subtotals suppressed] class(result) <- "crosstab" #Return 'result' as output of function result } print.crosstab <- function(x,dec.places=x$dec.places,subtotals=x$subtotals,...) { ################################################################################### # # # Function created by Dr Paul Williamson, Dept. of Geography and Planning, # # School of Environmental Sciences, University of Liverpool, UK. # # # # Adapted from the function print.ctab() in the catspec packge. # # # # Version: 12th July 2013 # # # # Designed to provide optimal viewing of the output from crosstab() # # # ################################################################################### row.vars <- x$row.vars col.vars <- x$col.vars n.row.vars <- length(row.vars) n.col.vars <- length(col.vars) n.vars <- n.row.vars + n.col.vars if (length(x$type)>1) { z<-length(names(dimnames(x$crosstab))) if (x$style=="long") { row.vars<-c(row.vars,z) } else { col.vars<-c(z,col.vars) } } if (n.vars==1) { if (length(x$type)==1) { tmp <- data.frame(round(x$crosstab,x$dec.places)) colnames(tmp)[2] <- ifelse(x$type=="frequency","Count","%") print(tmp,row.names=FALSE) } else { print(round(x$crosstab,x$dec.places)) } } #If table has only 2 dimensions, or subtotals required for >2 dimensional table, #print table using ftable() on x$crosstab if ((n.vars == 2) | ((subtotals==TRUE) & (n.vars>2))) { tbl <- ftable(x$crosstab,row.vars=row.vars,col.vars=col.vars) if (!all(as.integer(tbl)==as.numeric(tbl))) tbl <- round(tbl,dec.places) print(tbl,...) } #If subtotals NOT required AND > 2 dimensions, print table using write.table() on x$crosstab.nosub if ((subtotals==FALSE) & (n.vars>2)) { t1 <- x$crosstab.nosub #Convert numbers to required decimal places, right aligned width <- max( nchar(t1[1,]), nchar(t1[2,]), 7 ) dec.places <- x$dec.places number.format <- paste("%",width,".",dec.places,"f",sep="") t1[3:nrow(t1),((n.row.vars+1):ncol(t1))] <- sprintf(number.format,as.numeric(t1[3:nrow(t1),((n.row.vars+1):ncol(t1))])) #Adjust column variable label to same width as numbers, left aligned, padding with trailing spaces as required col.var.format <- paste("%-",width,"s",sep="") t1[1,(n.row.vars+1):ncol(t1)] <- sprintf(col.var.format,t1[1,(n.row.vars+1):ncol(t1)]) #Adjust column category labels to same width as numbers, right aligned, padding with preceding spaces as required col.cat.format <- paste("%",width,"s",sep="") t1[2,(n.row.vars+1):ncol(t1)] <- sprintf(col.cat.format,t1[2,(n.row.vars+1):ncol(t1)]) #Adjust row labels so that each column is of fixed width, using trailing spaces as required for (i in 1:n.row.vars) { width <- max(nchar(t1[,i])) + 2 row.lab.format <- paste("%-",width,"s",sep="") t1[,i] <- sprintf(row.lab.format,t1[,i]) } write.table(t1,quote=FALSE,col.names=FALSE,row.names=FALSE) } } library(sjPlot) library(sjmisc) library(sjlabelled) theme_set(theme_bw()) ##Descriptive Statistics: Demographic information theme_set(theme_bw()) #degree freq(degree, display.type = F,report.nas = F, headings = T, cumul = F, style = "grid") plot_frq(degree, geom.colors = c("red", "yellow"), title = "Degree") crosstab(data, row.vars = c("degree"), col.vars ="world.region", type = "f", style = "long", addmargins = T, dec.places = 0, subtotals = T) #language of instruction freq(language.of.instruction, display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") plot_frq(language.of.instruction, geom.colors = "#336699", title = "Language of instruction") crosstab(data, row.vars = c("language.of.instruction"), col.vars ="world.region", type = "f", style = "long", addmargins = T, dec.places = 0, subtotals = T) #Gender freq(Gender, display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") plot_frq(Gender, geom.colors = "#336699", title = "Gender") crosstab(data, row.vars = c("Gender"), col.vars ="world.region", type = "f", style = "long", addmargins = T, dec.places = 0, subtotals = T) #Age freq(age, display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") plot_frq(age, geom.colors = "#336699", title = "Age") crosstab(data, row.vars = c("age"), col.vars ="world.region", type = "f", style = "long", addmargins = T, dec.places = 0, subtotals = T) #World Region freq(world.region, display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") plot_frq(world.region, geom.colors = "#336699", title = "World Region") #Family income freq(What.was.your.annual.family.income.when.you.were.applying.to.study.abroad..estimate.in.US.dollars., display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") crosstab(data, row.vars = "family.income", col.vars ="world.region", type = "f", style = "long", addmargins = T, dec.places = 0, subtotals = T) #Length of stay in Russia freq(How.long.have.you.been.in.Russia.studying.for.your.current.program., display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") #Student finance status freq(How.are.you.financing.your.participation.in.the.program., display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") crosstab(data, row.vars = c("How.are.you.financing.your.participation.in.the.program."), col.vars ="world.region", type = "f", style = "long", addmargins = T, dec.places = 0, subtotals = T) #stay in Russia freq(Have.you.ever.been.in.Russia.before.you.enrolled.for.your.current.program, display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") #Data preparation: Push factors in home country influencing the decision to study in Russia #unavailable program unavailable.program <-as.factor(Unavailability.of.the.desired.study.program) unavailable.program <- factor(unavailable.program,levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(unavailable.program, Unavailability.of.the.desired.study.program) #quality of education low.educational.quality<-as.factor(Low.quality.of.education) low.educational.quality <- factor(low.educational.quality, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(low.educational.quality, Low.quality.of.education) #competitive University admission in home country competitive.admission<-as.factor(Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution) competitive.admission <- factor(competitive.admission, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(competitive.admission, Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution) #Advantage of international degree advantage.of.international.degree<-as.factor(Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market) advantage.of.international.degree <- factor(advantage.of.international.degree, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(advantage.of.international.degree, Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market) #unavailability of scholarships unavailability.of.scholarship<-as.factor(Unavailability.of.scholarship.opportunities) unavailability.of.scholarship <- factor(unavailability.of.scholarship, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(unavailability.of.scholarship, Unavailability.of.scholarship.opportunities) #encouragement from family encouragement.from.family<-as.factor(Encouragement.from.my.family.to.study.abroad) encouragement.from.family <- factor(encouragement.from.family, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(encouragement.from.family, Encouragement.from.my.family.to.study.abroad) #encouragement from friends encouragement.from.friends<-as.factor(Encouragement.from..my.friends.to.study.abroad) encouragement.from.friends <- factor(encouragement.from.friends, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(encouragement.from.friends, Encouragement.from..my.friends.to.study.abroad) #better earning prospects better.earning.prospects<-as.factor(Better.earning.prospects.abroad) better.earning.prospects <- factor(better.earning.prospects, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(better.earning.prospects, Better.earning.prospects.abroad) #social prestige social.prestige<-as.factor(The.social.prestige.of.studying.abroad) social.prestige <- factor(social.prestige, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(social.prestige, The.social.prestige.of.studying.abroad) #experience different culture experience.different.culture<-as.factor(To.experience.a.different.culture) experience.different.culture <- factor(experience.different.culture, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(experience.different.culture, To.experience.a.different.culture) #Descriptive Statistics: Push Factors influencing the decision to move to Russia #push factors pushfactor<-data.frame(unavailable.program,low.educational.quality,competitive.admission, advantage.of.international.degree,unavailability.of.scholarship, encouragement.from.family,encouragement.from.friends,better.earning.prospects, social.prestige,experience.different.culture) freq(pushfactor, display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") HCpushfactor<-data.frame(degree, world.region, unavailable.program,low.educational.quality,competitive.admission, advantage.of.international.degree,unavailability.of.scholarship, encouragement.from.family,encouragement.from.friends,better.earning.prospects, social.prestige,experience.different.culture) #Crosstab between Push Factors and World Region with degree crosstab(data, row.vars = c("world.region","degree"), col.vars ="Unavailability.of.the.desired.study.program", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Low.quality.of.education", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Competitive.university.admission.process..difficult.to.gain.admission.to.a.quality.local.institution", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Perceived.advantage.of.international.degree.over.a.local.one.at.the.local.job.market", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Unavailability.of.scholarship.opportunities", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Encouragement.from.my.family.to.study.abroad", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Encouragement.from..my.friends.to.study.abroad", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Better.earning.prospects.abroad", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="The.social.prestige.of.studying.abroad", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="To.experience.a.different.culture", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) is.factor(world.region) #Anova #Unavailable program data$region<-as.factor(world.region) attach(data) leveneTest(Unavailability.of.the.desired.study.program ~ region, data = data) res.aov <- aov(Unavailability.of.the.desired.study.program ~ region, data = data) # Summary of the analysis summary(res.aov) TukeyHSD(res.aov) summary(glht(res.aov, linfct = mcp(region = "Tukey"))) #Graphs #Plots for the push factors in the home countries #Push factors plot_stackfrq(pushfactor) #Unavailability of desired study program plot_grpfrq(unavailable.program, world.region, geom.colors = "gs", title = "Unavailability of desired study program in Home Country") plot_grpfrq(unavailable.program, degree, geom.colors = "gs", title = "Unavailability of Program") #Low quality of education plot_grpfrq(low.educational.quality, world.region, geom.colors = "gs", title = "Low quality of education in Home Country") plot_grpfrq(low.educational.quality, degree, geom.colors = "gs", title = "Low quality of education") #Competitive univeristy admission plot_grpfrq(competitive.admission, world.region, geom.colors = "gs", title = "Competitive University admission process in Home Country") plot_grpfrq(competitive.admission, degree, geom.colors = "gs", title = "Competitive university admission") #Perceived advantage of international degree plot_grpfrq(advantage.of.international.degree, world.region, geom.colors = "gs", title = "Perceived advantage of international degree than a local degree") plot_grpfrq(advantage.of.international.degree, degree, geom.colors = "gs", title = "Perceived advantage of internatioal degree") #Unavailability of Scholarship plot_grpfrq(unavailability.of.scholarship, world.region, geom.colors = "gs", title = "Unavailability of scholarship opportunities in Home Country") plot_grpfrq(unavailability.of.scholarship, degree, geom.colors = "gs", title = "Unavailability of scholarship") #Encouragement from family plot_grpfrq(encouragement.from.family, world.region, geom.colors = "gs", title = "Encouragement from family") plot_grpfrq(encouragement.from.family, degree, geom.colors = "gs", title = "Encouragement from family") #Encouragement from friends plot_grpfrq(encouragement.from.friends, world.region, geom.colors = "gs", title = "Encouragement from friends") plot_grpfrq(encouragement.from.friends, degree, geom.colors = "gs", title = "Encouragement from friends") #Better earning prospects plot_grpfrq(better.earning.prospects, world.region, geom.colors = "gs", title = "Better earning prospects abroad") plot_grpfrq(better.earning.prospects, degree, geom.colors = "gs", title = "Better earning prospects") #The social prestige of studying abroad plot_grpfrq(social.prestige, world.region, geom.colors = "gs", title = "The social prestige of studying abroad") plot_grpfrq(social.prestige, degree, geom.colors = "gs", title = "The.social.prestige.of.studying.abroad") #Experience different culture plot_grpfrq(experience.different.culture, world.region, geom.colors = "gs", title = "EXperience different culture abroad") plot_grpfrq(experience.different.culture, degree, geom.colors = "gs", title = "EXperience different culture") #Data preparation: Pull factors in Russia influencing the decision to study in Russia #availability of desired program available.study.program <-as.factor(Availability.of.desired.study.program) available.study.program <- factor(available.study.program, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(available.study.program, Availability.of.desired.study.program) #high quality of education high.educational.quality<-as.factor(Higher.quality.of.education..compared.to.home.country.) high.educational.quality <- factor(high.educational.quality, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(high.educational.quality, Higher.quality.of.education..compared.to.home.country.) #low cost of living low.cost.living<-as.factor(Low.cost.of.living) low.cost.living <- factor(low.cost.living, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(low.cost.living,Low.cost.of.living) #low tuition fees low.tuition<-as.factor(Low.tuition.fees) low.tuition <- factor(low.tuition, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(low.tuition, Low.tuition.fees) #Awarded scholarships scholarship.tuitionwaiver<-as.factor(Awarded.scholarships.or.tuition.waiver) scholarship.tuitionwaiver <- factor(scholarship.tuitionwaiver, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(scholarship.tuitionwaiver,Awarded.scholarships.or.tuition.waiver) #Attraction to Russian culture russian.culture<-as.factor(Attraction.to.Russian.culture..society) russian.culture <- factor(russian.culture, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(russian.culture, Attraction.to.Russian.culture..society) #Career prospects in Russia career.prospects<-as.factor(Career.prospects.in.Russia) career.prospects <- factor(career.prospects, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(career.prospects, Career.prospects.in.Russia) #Recommendations from family and friends family.friends.recommendations<-as.factor(Personal.recommendations.from.parents..relatives..and.friends) family.friends.recommendations <- factor(family.friends.recommendations, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(family.friends.recommendations, Personal.recommendations.from.parents..relatives..and.friends) #Cultural Proximity cultural.proximity<-as.factor(cultural.proximity.with.home) cultural.proximity <- factor(cultural.proximity, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(cultural.proximity, cultural.proximity.with.home) #Geographical proximity geographical.proximity<-as.factor(geographical.proximity.with.home) geographical.proximity <- factor(geographical.proximity, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(geographical.proximity, geographical.proximity.with.home) #Descriptive Statistics: Pull Factors in Russia influencing the decision to move to Russia Pullfactor_Russia<-data.frame(available.study.program, high.educational.quality, low.cost.living, low.tuition, scholarship.tuitionwaiver, russian.culture, career.prospects, family.friends.recommendations, cultural.proximity, geographical.proximity) freq(Pullfactor_Russia, display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") Pullfactor_Ru<-data.frame(world.region, degree, available.study.program, high.educational.quality, low.cost.living, low.tuition, scholarship.tuitionwaiver, russian.culture, career.prospects, family.friends.recommendations, cultural.proximity, geographical.proximity) #Crosstab between Pull Factors in Russia and World Region with degree crosstab(data, row.vars = c("world.region","degree"), col.vars ="Unavailability.of.the.desired.study.program", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Higher.quality.of.education..compared.to.home.country.", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Low.cost.of.living", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Availability.of.scholarships", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Attraction.to.Russian.culture..society", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Career.prospects.in.Russia", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Personal.recommendations.from.parents..relatives..and.friends", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="cultural.proximity.with.home", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="geographical.proximity.with.home", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) #Plots for the pull factors in Russia plot_stackfrq(Pullfactor_Russia) #Availability of desired study program plot_grpfrq(available.study.program, world.region, geom.colors = "gs", title = "Availability of desired study program in Russia") plot_grpfrq(available.study.program, degree, geom.colors = "gs", title = "Availability of desired study program") #High quality of education plot_grpfrq(high.educational.quality, world.region, geom.colors = "gs", title = "High quality of education in Russia") plot_grpfrq(high.educational.quality, degree, geom.colors = "gs", title = "High quality of education") #Low cost of living plot_grpfrq(low.cost.living, world.region, geom.colors = "gs", title = "Low cost of living in Russia") plot_grpfrq(low.cost.living, degree, geom.colors = "gs", title = "Low cost of living") #Low tuition fees plot_grpfrq(low.tuition, world.region, geom.colors = "gs", title = "Low tuition fees in Russia") plot_grpfrq(low.tuition, degree, geom.colors = "gs", title = "Low tuition fees") #Scholarship or tuition waiver plot_grpfrq(scholarship.tuitionwaiver, world.region, geom.colors = "gs", title = "Scholarship or tuition waiver") plot_grpfrq(scholarship.tuitionwaiver, degree, geom.colors = "gs", title = "Scholarship or tuition waiver") #Attraction to Russian culture plot_grpfrq(russian.culture, world.region, geom.colors = "gs", title = "Attraction to Russian culture") plot_grpfrq(russian.culture, degree, geom.colors = "gs", title = "Attraction to Russian culture") #Career prospects in Russia plot_grpfrq(career.prospects, world.region, geom.colors = "gs", title = "Career prospects in Russia") plot_grpfrq(career.prospects, degree, geom.colors = "gs", title = "Career prospects in Russia") #Recommendations from family and friends plot_grpfrq(family.friends.recommendations, world.region, geom.colors = "gs", title = "Recommendations from family and friends") plot_grpfrq(family.friends.recommendations, degree, geom.colors = "gs", title = "Recommendations from family and friends") #cultural.proximity plot_grpfrq(cultural.proximity, world.region, geom.colors = "gs", title = "Home Country's cultural proximity to Russia") plot_grpfrq(cultural.proximity, degree, geom.colors = "gs", title = "Cultural proximity") #Geograhical proximity plot_grpfrq(geographical.proximity, world.region, geom.colors = "gs", title = "Home Country's geograhical proximity to Russia") plot_grpfrq(geographical.proximity, degree, geom.colors = "gs", title = "Geograhical proximity") #Data preparation: Pull factors in HSE #Quality and Reputation of HSE HSE.qualityandreputation <-as.factor(Quality.and.reputation.of.the.University) HSE.qualityandreputation <- factor(HSE.qualityandreputation, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(HSE.qualityandreputation, Quality.and.reputation.of.the.University) #Recognition of HSE degree recognition.of.HSE.degree<-as.factor(Recognition.of.the.degree.in.my.home.country) recognition.of.HSE.degree <- factor(recognition.of.HSE.degree, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(recognition.of.HSE.degree, Recognition.of.the.degree.in.my.home.country) #Quality of teaching staff quality.teachers<-as.factor(Quality.of.the.teaching.staff) quality.teachers <- factor(quality.teachers, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(quality.teachers,Quality.of.the.teaching.staff) #Reputation of the alumni alumni.reputation<-as.factor(The.reputation.of.the.alumni) alumni.reputation <- factor(alumni.reputation, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(alumni.reputation, The.reputation.of.the.alumni) #reputation of the international community internationalcommunity.reputation<-as.factor(The.reputation.of.the.international.community) internationalcommunity.reputation <- factor(internationalcommunity.reputation, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(internationalcommunity.reputation,The.reputation.of.the.international.community) #HSE rank HSE.rank<-as.factor(HSE.position.in.international.university.rankings) HSE.rank <- factor(HSE.rank, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(HSE.rank, HSE.position.in.international.university.rankings) #Cost of tuition tuition.cost<-as.factor(Cost.of.tuition.for.international.students) tuition.cost <- factor(tuition.cost, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(tuition.cost, Cost.of.tuition.for.international.students) #Availability of scholarship available.scholarships<-as.factor(Availability.of.scholarships) available.scholarships <- factor(available.scholarships, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(available.scholarships,Availability.of.scholarships) #Support Services for international students international.students.support<-as.factor(Support.services.for.international.students) international.students.support <- factor(international.students.support, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(international.students.support, Support.services.for.international.students) #Graduate employment rate graduate.employment<-as.factor(Graduates.employment.rates) graduate.employment <- factor(graduate.employment, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(graduate.employment, Graduates.employment.rates) #HSE international strategic alliances HSE.alliances<-as.factor(HSE.s.international.strategic.alliances) HSE.alliances <- factor(HSE.alliances, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(HSE.alliances, HSE.s.international.strategic.alliances) #Local Employers preference for HSE degrees employers.preference.for.HSE.degrees<-as.factor(Local.employers.preference.of..degrees.awarded.by.HSE) employers.preference.for.HSE.degrees <- factor(employers.preference.for.HSE.degrees, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(employers.preference.for.HSE.degrees, Local.employers.preference.of..degrees.awarded.by.HSE) #Descriptive Statistics: Pull Factors in HSE influencing the decision to move to Russia Pullfactor_HSE<-data.frame(HSE.qualityandreputation,recognition.of.HSE.degree,quality.teachers, alumni.reputation,internationalcommunity.reputation,HSE.rank,tuition.cost, available.scholarships,international.students.support,graduate.employment, HSE.alliances,employers.preference.for.HSE.degrees) freq(Pullfactor_HSE, display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") HSEPullfactor<-data.frame(world.region, degree, HSE.qualityandreputation,recognition.of.HSE.degree,quality.teachers, alumni.reputation,internationalcommunity.reputation,HSE.rank,tuition.cost, available.scholarships,international.students.support,graduate.employment, HSE.alliances,employers.preference.for.HSE.degrees) #Crosstab between Pull Factors in HSE and World Region with degree crosstab(data, row.vars = c("world.region","degree"), col.vars ="Quality.and.reputation.of.the.University", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Recognition.of.the.degree.in.my.home.country", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Quality.of.the.teaching.staff", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="The.reputation.of.the.alumni", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="The.reputation.of.the.international.community", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="HSE.position.in.international.university.rankings", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Cost.of.tuition.for.international.students", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Availability.of.scholarships", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Support.services.for.international.students", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Graduates.employment.rates", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="HSE.s.international.strategic.alliances", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Local.employers.preference.of..degrees.awarded.by.HSE", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) #Plots for the pull factors in HSE plot_stackfrq(Pullfactor_HSE) #Quality and reputation of HSE plot_grpfrq(HSE.qualityandreputation, world.region, geom.colors = "gs", title = "Quality and reputation of HSE") plot_grpfrq(HSE.qualityandreputation, degree, geom.colors = "gs", title = "Quality and reputation of HSE") #Recognition of degree plot_grpfrq(recognition.of.HSE.degree, world.region, geom.colors = "gs", title = "Recognition of HSE degree in my Home Country") plot_grpfrq(recognition.of.HSE.degree, degree, geom.colors = "gs", title = "Recognition of degree") #Quality of teachers plot_grpfrq(quality.teachers, world.region, geom.colors = "gs", title = "Quality of HSE teachers") plot_grpfrq(quality.teachers, degree, geom.colors = "gs", title = "Quality of teachers") #Reputation of alumni plot_grpfrq(alumni.reputation, world.region, geom.colors = "gs", title = "Reputation of HSE alumni") plot_grpfrq(alumni.reputation, degree, geom.colors = "gs", title = "Reputation of alumni") #Reputation of International Community plot_grpfrq(internationalcommunity.reputation, world.region, geom.colors = "gs", title = "Reputation of HSE International Community") plot_grpfrq(internationalcommunity.reputation, degree, geom.colors = "gs", title = "Reputation of International Community") #HSE's rank plot_grpfrq(HSE.rank, world.region, geom.colors = "gs", title = "HSE's position on World Universities ranking") plot_grpfrq(HSE.rank, degree, geom.colors = "gs", title = "HSE's rank") #Cost of tuition plot_grpfrq(tuition.cost, world.region, geom.colors = "gs", title = "Cost of tuition in HSE") plot_grpfrq(tuition.cost, degree, geom.colors = "gs", title = "Cost of tuition") #Recognition of degree plot_grpfrq(available.scholarships, world.region, geom.colors = "gs", title = "Availability of scholarships in HSE") plot_grpfrq(available.scholarships, degree, geom.colors = "gs", title = "Availability of scholarships") #Support services for international students plot_grpfrq(international.students.support, world.region, geom.colors = "gs", title = "Support services for international students in HSE") plot_grpfrq(international.students.support, degree, geom.colors = "gs", title = "Support services for international students") #Graduate employment rate plot_grpfrq(graduate.employment, world.region, geom.colors = "gs", title = "HSE's Graduate employment rate") plot_grpfrq(graduate.employment, degree, geom.colors = "gs", title = "Graduate employment rate") #HSE alliances plot_grpfrq(HSE.alliances, world.region, geom.colors = "gs", title = "HSE strategic international alliances") plot_grpfrq(HSE.alliances, degree, geom.colors = "gs", title = "HSE alliances") #Recognition of degree plot_grpfrq(employers.preference.for.HSE.degrees, world.region, geom.colors = "gs", title = "Local employers preference for HSE degrees") plot_grpfrq(employers.preference.for.HSE.degrees, degree, geom.colors = "gs", title = "Local preference for HSE degrees") ###STUDENTS POST GRADUATION PLANS## #Descriptive Statistics #Post Graduation migration plans freq(What.are.your.plans.after.graduation., display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") plot_grpfrq(What.are.your.plans.after.graduation., world.region, geom.colors = "gs", title = "Post graduation plans") plot_grpfrq(What.are.your.plans.after.graduation., degree, geom.colors = "gs", title = "Post graduation plans") #Stay in Russia freq(What.will.be.your.reason.for.staying.in.Russia.after.graduation., display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") plot_grpfrq(What.will.be.your.reason.for.staying.in.Russia.after.graduation., world.region, geom.colors = "gs", title = "Reasons for staying in Russia after graduation") plot_grpfrq(What.are.your.plans.after.graduation., degree, geom.colors = "gs", title = "Reasons for staying in Russia after graduation") #Return home freq(What.will.be.your.reason.for.returning.home.after.graduation., display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") plot_grpfrq(What.will.be.your.reason.for.returning.home.after.graduation., world.region, geom.colors = "gs", title = "Reasons for returning home after graduation") plot_grpfrq(What.will.be.your.reason.for.returning.home.after.graduation., degree, geom.colors = "gs", title = "Reasons for returning home after graduation") #move to another country freq(What.will.be.your.reason.for.moving.to.another.country.after.graduation., display.type = F, report.nas = F, headings = T, cumul = F, style = "grid") plot_grpfrq(What.will.be.your.reason.for.moving.to.another.country.after.graduation., world.region, geom.colors = "gs", title = "Reasons for moving to another country after graduation") plot_grpfrq(What.will.be.your.reason.for.moving.to.another.country.after.graduation., degree, geom.colors = "gs", title = "Reasons for moving to another country after graduation", show.na = F) #Stay in Russia after graduation #Better job opportunities job.opportunities <-as.factor(Better.job.opportunities..in.comparison.with.home.country.) job.opportunities <- factor(job.opportunities, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(job.opportunities, Better.job.opportunities..in.comparison.with.home.country.) #Higher quality of life high.quality.life<-as.factor(Higher.quality.of.life..in.comparison.with.home.country.) high.quality.life <- factor(high.quality.life, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(high.quality.life, Higher.quality.of.life..in.comparison.with.home.country.) #Better career opportunities career.opportunities<-as.factor(Better.career.opportunities.and.advancement.in.chosen.profession) career.opportunities <- factor(career.opportunities, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(career.opportunities,Better.career.opportunities.and.advancement.in.chosen.profession) #high income level high.income.level<-as.factor(Higher.income.level) high.income.level <- factor(high.income.level, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(high.income.level, Higher.income.level) #Ties to family and friends family.friends.ties<-as.factor(Ties.to.family.and.friends) family.friends.ties <- factor(family.friends.ties, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(family.friends.ties,Ties.to.family.and.friends) #international experience international.experience<-as.factor(Gain.international.experience) international.experience <- factor(international.experience, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(international.experience, Gain.international.experience) #family expectations familyexpectations<-as.factor(Family.expectations) familyexpectations <- factor(familyexpectations, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(familyexpectations, Family.expectations) #Restrcitive cultural practices cultural.practices<-as.factor(Restrictive.cultural.practices..eg..pressure.to.marry.) cultural.practices <- factor(cultural.practices, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(cultural.practices, Restrictive.cultural.practices..eg..pressure.to.marry.) #limited jobs limited.jobs<-as.factor(Limited.job.opportunities.in.home.country) limited.jobs <- factor(limited.jobs, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(limited.jobs, Limited.job.opportunities.in.home.country) #lower income levels lower.income<-as.factor(Lower.income.levels) lower.income <- factor(lower.income, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(lower.income, Lower.income.levels) #Lower quality of life lower.quality.life<-as.factor(Lower.quality.of.life.2) lower.quality.life <- factor(lower.quality.life, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(lower.quality.life, Lower.quality.of.life.2) #Political persecution politicalpersecution<-as.factor(Political.persecution) politicalpersecution <- factor(politicalpersecution, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(politicalpersecution, Political.persecution) #Dangers to ones own life danger.to.ones.life<-as.factor(Danger.or.fear.for.one.s.own.life) danger.to.ones.life <- factor(Danger.or.fear.for.one.s.own.life, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(danger.to.ones.life, Danger.or.fear.for.one.s.own.life) #Factors influencing the decision to stay in Russia RStayFactors<-data.frame(job.opportunities, high.quality.life,career.opportunities, high.income.level, family.friends.ties, international.experience, familyexpectations, cultural.practices,limited.jobs,lower.income,lower.quality.life, politicalpersecution,danger.to.ones.life) RussiaStay_factors<-data.frame(world.region, degree, Better.job.opportunities..in.comparison.with.home.country.+ Higher.quality.of.life..in.comparison.with.home.country.+ Better.career.opportunities.and.advancement.in.chosen.profession+ Higher.income.level+ Ties.to.family.and.friends+ Gain.international.experience+ Family.expectations+ Restrictive.cultural.practices..eg..pressure.to.marry.+ Limited.job.opportunities.in.home.country+Lower.income.levels+ Lower.quality.of.life.2+Political.persecution+Danger.or.fear.for.one.s.own.life) #Crosstabulation of Russia Stay factors with Region and degree crosstab(data, row.vars = c("world.region","degree"), col.vars ="Better.job.opportunities..in.comparison.with.home.country.", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Higher.quality.of.life..in.comparison.with.home.country.", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Better.career.opportunities.and.advancement.in.chosen.profession", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Higher.income.level", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Ties.to.family.and.friends", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Gain.international.experience", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Family.expectations", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Limited.job.opportunities.in.home.country", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Lower.income.levels", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Lower.quality.of.life.2", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Political.persecution", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Danger.or.fear.for.one.s.own.life", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) #Graphs #Factors influencing the decision to stay plot_stackfrq(RStayFactors) #Better job opportunities plot_grpfrq(job.opportunities, world.region, geom.colors = "gs", title = "Better job opportunities") plot_grpfrq(job.opportunities, degree, geom.colors = "gs", title = "Better job opportunities") #Higher quality of life plot_grpfrq(high.quality.life, world.region, geom.colors = "gs", title = "Higher quality of life") plot_grpfrq(high.quality.life, degree, geom.colors = "gs", title = "Higher quality of life") #Better career opportunities plot_grpfrq(career.opportunities, world.region, geom.colors = "gs", title = "Better career opportunities") plot_grpfrq(career.opportunities, degree, geom.colors = "gs", title = "Better career opportunities") #high income level plot_grpfrq(high.income.level, world.region, geom.colors = "gs", title = "high income level") plot_grpfrq(high.income.level, degree, geom.colors = "gs", title = "high income level") #Ties to family and friends plot_grpfrq(family.friends.ties, world.region, geom.colors = "gs", title = "Ties to family and friends") plot_grpfrq(family.friends.ties, degree, geom.colors = "gs", title = "Ties to family and friends") #international experience plot_grpfrq(international.experience, world.region, geom.colors = "gs", title = "Gain international experience") plot_grpfrq(international.experience, degree, geom.colors = "gs", title = "Gain international experience") #family expectations plot_grpfrq(familyexpectations, world.region, geom.colors = "gs", title = "Family expectations") plot_grpfrq(familyexpectations, degree, geom.colors = "gs", title = "Family expectations") #Restrcitive cultural practices plot_grpfrq(cultural.practices, world.region, geom.colors = "gs", title = "Restrictive cultural practices") plot_grpfrq(cultural.practices, degree, geom.colors = "gs", title = "Restrictive cultural practices") #limited jobs plot_grpfrq(limited.jobs, world.region, geom.colors = "gs", title = "Limited job opportunities") plot_grpfrq(limited.jobs, degree, geom.colors = "gs", title = "Limited job opportunities") #lower income levels plot_grpfrq(lower.income, world.region, geom.colors = "gs", title = "Lower income level") plot_grpfrq(lower.income, degree, geom.colors = "gs", title = "Lower income level") #Lower quality of life plot_grpfrq(lower.quality.life, world.region, geom.colors = "gs", title = "Lower quality of life") plot_grpfrq(lower.quality.life, degree, geom.colors = "gs", title = "Lower quality of life") #Political persecution plot_grpfrq(politicalpersecution, world.region, geom.colors = "gs", title = "Political persecution") plot_grpfrq(politicalpersecution, degree, geom.colors = "gs", title = "Political persecution") #Dangers to ones own life plot_grpfrq(danger.to.ones.life, world.region, geom.colors = "gs", title = "Danger to one's own life") plot_grpfrq(danger.to.ones.life, degree, geom.colors = "gs", title = "Danger to one's own life") #Data preparation Returning home: Pull factors in home country #Better job opportunities professional.opportunities <-as.factor(Better.professional.opportunities.in.home.country) professional.opportunities <- factor(professional.opportunities, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(professional.opportunities, Better.professional.opportunities.in.home.country) #Better quality of life better.quality.life<-as.factor(Better.quality.of.living.in.home.country) better.quality.life <- factor(better.quality.life, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(better.quality.life, Better.quality.of.living.in.home.country) #Feeling more comfortable at Home home.comfort<-as.factor(Feeling.more.comfortable.at.home) home.comfort <- factor(home.comfort, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(home.comfort,Feeling.more.comfortable.at.home) #higher income level higher.income <-as.factor(Higher.income.levels) higher.income <- factor(higher.income, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(higher.income, Higher.income.levels) #Family ties back home family.ties<-as.factor(Family.ties.back.home) family.ties <- factor(family.ties, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(family.ties, Family.ties.back.home) #Feelings of alienation feelings.of.alienation <-as.factor(Feelings.of.alienation.from.the.Russian.culture.and.population) feelings.of.alienation <- factor(feelings.of.alienation, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(feelings.of.alienation, Feelings.of.alienation.from.the.Russian.culture.and.population) #Difficulties in finding job job.difficulties<-as.factor(Difficulties.in.finding.a.job) job.difficulties <- factor(job.difficulties, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(job.difficulties, Difficulties.in.finding.a.job) #Poor working conditions poor.work<-as.factor(Poor.working.conditions) poor.work <- factor(poor.work, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(poor.work, Poor.working.conditions) #Lower quality of life low.life.quality <-as.factor(Lower.quality.of.life) low.life.quality <- factor(low.life.quality, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(low.life.quality, Lower.quality.of.life) #Perceived or Experienced discrimination discrimination<-as.factor(Perceived.or.experienced.discrimination) discrimination <- factor(discrimination, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(discrimination, Perceived.or.experienced.discrimination) #Crime and low level of safety crime.safety<-as.factor(Crime.and.low.level.of.safety) crime.safety <- factor(crime.safety, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(crime.safety, Crime.and.low.level.of.safety) #Strict migration process strict.migration<-as.factor(Strict.migration.process.difficulties.in.getting.visas.) strict.migration <- factor(strict.migration, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(strict.migration, Strict.migration.process.difficulties.in.getting.visas.) #Factors influencing the decision to stay in Russia HCReturnFactors<-data.frame(professional.opportunities,better.quality.life,home.comfort, higher.income, family.ties,feelings.of.alienation, poor.work, low.life.quality,discrimination,crime.safety,strict.migration) HomeReturn_factors<-data.frame(world.region, degree, Better.professional.opportunities.in.home.country+ Better.quality.of.living.in.home.country+Feeling.more.comfortable.at.home+ Higher.income.levels+ Family.ties.back.home+ Feelings.of.alienation.from.the.Russian.culture.and.population+ Difficulties.in.finding.a.job+ Poor.working.conditions+ Lower.quality.of.life+ Crime.and.low.level.of.safety+ Strict.migration.process.difficulties.in.getting.visas.) #Crosstabulation of Return home factors with Region and degree crosstab(data, row.vars = c("world.region","degree"), col.vars ="Better.professional.opportunities.in.home.country", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Better.quality.of.living.in.home.country", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Higher.income.levels", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Family.ties.back.home", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Feelings.of.alienation.from.the.Russian.culture.and.population", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Difficulties.in.finding.a.job", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Poor.working.conditions", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Lower.quality.of.life", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Crime.and.low.level.of.safety", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Strict.migration.process.difficulties.in.getting.visas.", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) #Graphs #Factors influencing the decision to stay plot_stackfrq(HCReturnFactors) #Better professional opportunities plot_grpfrq(professional.opportunities, world.region, geom.colors = "gs", title = "Better professional opportunities") plot_grpfrq(professional.opportunities, degree, geom.colors = "gs", title = "Better professional opportunities") #Better quality of life plot_grpfrq(better.quality.life, world.region, geom.colors = "gs", title = "Better quality of life") plot_grpfrq(better.quality.life, degree, geom.colors = "gs", title = "Better quality of life") #Feeling more comfortable at Home plot_grpfrq(home.comfort, world.region, geom.colors = "gs", title = "Feeling more comfortable at Home") plot_grpfrq(home.comfort, degree, geom.colors = "gs", title = "Feeling more comfortable at Home") #Higher income level plot_grpfrq(higher.income, world.region, geom.colors = "gs", title = "Higher income level") plot_grpfrq(higher.income, degree, geom.colors = "gs", title = "Higher income level") #Family ties back home plot_grpfrq(family.ties, world.region, geom.colors = "gs", title = "Family ties back home") plot_grpfrq(family.ties, degree, geom.colors = "gs", title = "Family ties back home") #Feelings of alienation plot_grpfrq(feelings.of.alienation, world.region, geom.colors = "gs", title = "Feelings of alienation") plot_grpfrq(feelings.of.alienation, degree, geom.colors = "gs", title = "Feelings of alienation") #Difficulties in finding job plot_grpfrq(job.difficulties, world.region, geom.colors = "gs", title = "Difficulties in finding jobs") plot_grpfrq(job.difficulties, degree, geom.colors = "gs", title = "Difficulties in finding jobs") #Poor working conditions plot_grpfrq(poor.work, world.region, geom.colors = "gs", title = "Poor working conditions") plot_grpfrq(poor.work, degree, geom.colors = "gs", title = "Poor working conditions") #Lower quality of life plot_grpfrq(low.life.quality, world.region, geom.colors = "gs", title = "Lower quality of life") plot_grpfrq(low.life.quality, degree, geom.colors = "gs", title = "Lower quality of life") #Perceived or Experienced discrimination plot_grpfrq(discrimination, world.region, geom.colors = "gs", title = "Perceived or Experienced discrimination") plot_grpfrq(discrimination, degree, geom.colors = "gs", title = "Perceived or Experienced discrimination") #Crime and low level of safety plot_grpfrq(crime.safety, world.region, geom.colors = "gs", title = "Crime and low level of safety") plot_grpfrq(crime.safety, degree, geom.colors = "gs", title = "Crime and low level of safety") #Strict migration process plot_grpfrq(strict.migration, world.region, geom.colors = "gs", title = "Strict migration process") plot_grpfrq(strict.migration, degree, geom.colors = "gs", title = "Strict migration process") #Data preparation: Moving to another country #Better job opportunities better_job.opportunities <-as.factor(Better.job.opportunities) better_job.opportunities <- factor(better_job.opportunities, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(better_job.opportunities, Better.job.opportunities) #higher quality of life high_quality.life<-as.factor(Higher.quality.of.life) high_quality.life <- factor(high_quality.life, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(high_quality.life, Higher.quality.of.life) #Better career opportunities better.career<-as.factor(Better.career.opportunities.and.advancement.in.chosen.profession.1) better.career <- factor(better.career, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(better.career, Better.career.opportunities.and.advancement.in.chosen.profession.1) #higher income level high.income <-as.factor(Higher.income.levels.1) high.income <- factor(high.income, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(high.income, Higher.income.levels.1) #Family and Friends ties family_friends.ties<-as.factor(Ties.to.family.and.friends.1) family_friends.ties <- factor(family_friends.ties, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(family_friends.ties, Ties.to.family.and.friends.1) #Gain international experience gain.experience<-as.factor(Gain.international.experience.1) gain.experience <- factor(gain.experience, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(gain.experience, Gain.international.experience.1) #Flexible immigration process flexible.immigration<-as.factor(Flexible.immigration.process) flexible.immigration <- factor(flexible.immigration, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(flexible.immigration, Flexible.immigration.process) #Moving to another country: Push factors in Russia #Feelings of alienation feeling.alienation <-as.factor(Feelings.of.alienation.from.the.Russian.culture.and.population.1) feeling.alienation <- factor(feeling.alienation, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(feeling.alienation, Feelings.of.alienation.from.the.Russian.culture.and.population.1) #Difficulties in finding job finding.job<-as.factor(Difficulties.in.finding.a.job.1) finding.job <- factor(finding.job, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(finding.job, Difficulties.in.finding.a.job.1) #Poor working conditions work.conditions<-as.factor(Poor.working.conditions.1) work.conditions <- factor(work.conditions, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(work.conditions, Poor.working.conditions.1) #Lower quality of life low.quality <-as.factor(Lower.quality.of.life.1) low.quality <- factor(low.quality, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(low.quality, Lower.quality.of.life.1) #Perceived or Experienced discrimination perceived.discrimination<-as.factor(Perceived.or.experienced.discrimination.1) perceived.discrimination <- factor(perceived.discrimination, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(perceived.discrimination, Perceived.or.experienced.discrimination.1) #Crime and low level of safety crime.safety.levels<-as.factor(Crime.and.low.level.of.safety.1) crime.safety.levels <- factor(crime.safety.levels, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(crime.safety.levels, Crime.and.low.level.of.safety.1) #Strict migration process strict.visa<-as.factor(Strict.migration.process.difficulties.in.getting.visas..1) strict.visa <- factor(strict.visa, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(strict.visa, Strict.migration.process.difficulties.in.getting.visas..1) #Moving to another country: Push factors in home country #family expectations family_expectations<-as.factor(Family.expectations.1) family_expectations <- factor(family_expectations, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(family_expectations, Family.expectations.1) #Availability of scholarship restrictive.practices<-as.factor(Restrictive.cultural.practices..eg..pressure.to.marry..1) restrictive.practices <- factor(restrictive.practices, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(restrictive.practices, Restrictive.cultural.practices..eg..pressure.to.marry..1) #limited jobs limited.jobs.opportunities<-as.factor(Limited.job.opportunities.in.home.country.1) limited.jobs.opportunities <- factor(limited.jobs.opportunities, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(limited.jobs.opportunities, Limited.job.opportunities.in.home.country.1) #lower income levels low.income<-as.factor(Lower.income.levels.1) low.income <- factor(low.income, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(low.income, Lower.income.levels.1) #Lower quality of life low_lifequality<-as.factor(Lower.quality.of.life.3) low_lifequality <- factor(low_lifequality, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(low_lifequality, Lower.quality.of.life.3) #Political persecution political_persecution<-as.factor(Political.persecution.1) political_persecution <- factor(political_persecution, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(political_persecution, Political.persecution.1) #Dangers to ones own life danger.to.life<-as.factor(Danger.or.fear.for.one.s.own.life.1) danger.to.life <- factor(danger.to.life, levels = c(1,2,3,4,5), labels = c("Not at all influential", "Slightly influential", "Somewhat influential", "Very influential", "Extremely influential")) table(danger.to.life, Danger.or.fear.for.one.s.own.life.1) #Factors influencing the decision to stay in Russia Move2CountryFactors<-data.frame(better_job.opportunities,high_quality.life,better.career,high.income, family_friends.ties,gain.experience, flexible.immigration,feeling.alienation, finding.job,work.conditions,low.quality,perceived.discrimination, crime.safety.levels, strict.visa, family_expectations, restrictive.practices, limited.jobs.opportunities, low.income, low_lifequality, political_persecution, danger.to.life) MoveCountry_factors<-data.frame(world.region, degree, Better.job.opportunities,Higher.quality.of.life, Better.career.opportunities.and.advancement.in.chosen.profession.1, Higher.income.levels.1,Ties.to.family.and.friends.1,Gain.international.experience.1, Flexible.immigration.process,Feelings.of.alienation.from.the.Russian.culture.and.population.1, Difficulties.in.finding.a.job.1,Poor.working.conditions.1,Lower.quality.of.life.1, Perceived.or.experienced.discrimination.1, Crime.and.low.level.of.safety.1, Strict.migration.process.difficulties.in.getting.visas..1,Family.expectations.1, Restrictive.cultural.practices..eg..pressure.to.marry..1, Limited.job.opportunities.in.home.country.1, Lower.income.levels.1, Lower.quality.of.life.3, Political.persecution.1, Danger.or.fear.for.one.s.own.life.1) #Crosstabulation of Return home factors with Region and degree crosstab(data, row.vars = c("world.region","degree"), col.vars ="Better.job.opportunities", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Higher.quality.of.life", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Better.career.opportunities.and.advancement.in.chosen.profession.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Higher.income.levels.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Ties.to.family.and.friends.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Gain.international.experience.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Flexible.immigration.process", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Feelings.of.alienation.from.the.Russian.culture.and.population.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Difficulties.in.finding.a.job.1,Poor.working.conditions.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Lower.quality.of.life.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Perceived.or.experienced.discrimination.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Crime.and.low.level.of.safety.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Strict.migration.process.difficulties.in.getting.visas..1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Restrictive.cultural.practices..eg..pressure.to.marry..1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Family.expectations.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Limited.job.opportunities.in.home.country.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Lower.income.levels.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Lower.quality.of.life.3", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Political.persecution.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) crosstab(data, row.vars = c("world.region","degree"), col.vars ="Danger.or.fear.for.one.s.own.life.1", type = c("f", "t"), style = "long", addmargins = T, dec.places = 2, subtotals = T) #Graphs #Factors influencing the decision to stay plot_stackfrq(Move2CountryFactors) #Better job opportunities plot_grpfrq(better_job.opportunities, world.region, geom.colors = "gs", title = "Better job opportunities") plot_grpfrq(better_job.opportunities, degree, geom.colors = "gs", title = "Better job opportunities") #Higher quality of life plot_grpfrq(high_quality.life, world.region, geom.colors = "gs", title = "Higher quality of life") plot_grpfrq(high_quality.life, degree, geom.colors = "gs", title = "Higher quality of life") #Better career opportunities plot_grpfrq(better.career, world.region, geom.colors = "gs", title = "Better career opportunities") plot_grpfrq(better.career, degree, geom.colors = "gs", title = "Better career opportunities") #Higher income level plot_grpfrq(high.income, world.region, geom.colors = "gs", title = "Higher income level") plot_grpfrq(high.income, degree, geom.colors = "gs", title = "Higher income level") #Family and Friends ties plot_grpfrq(family_friends.ties, world.region, geom.colors = "gs", title = "Family and Friends ties") plot_grpfrq(family_friends.ties, degree, geom.colors = "gs", title = "Family and Friends ties") #Gain international experience plot_grpfrq(gain.experience, world.region, geom.colors = "gs", title = "Gain international experience") plot_grpfrq(gain.experience, degree, geom.colors = "gs", title = "Gain international experience") #Flexible immigration process plot_grpfrq(flexible.immigration, world.region, geom.colors = "gs", title = "Flexible immigration process ") plot_grpfrq(flexible.immigration, degree, geom.colors = "gs", title = "Flexible immigration process") #Feelings of alienation plot_grpfrq(feeling.alienation, world.region, geom.colors = "gs", title = "Feelings of alienation") plot_grpfrq(feeling.alienation, degree, geom.colors = "gs", title = "Feelings of alienation") #Difficulties in finding job plot_grpfrq(finding.job, world.region, geom.colors = "gs", title = "Difficulties in finding jobs") plot_grpfrq(finding.job, degree, geom.colors = "gs", title = "Difficulties in finding jobs") #Poor working conditions plot_grpfrq(work.conditions, world.region, geom.colors = "gs", title = "Poor working conditions") plot_grpfrq(work.conditions, degree, geom.colors = "gs", title = "Poor working conditions") #Lower quality of life plot_grpfrq(low.quality, world.region, geom.colors = "gs", title = "Lower quality of life") plot_grpfrq(low.quality, degree, geom.colors = "gs", title = "Lower quality of life") #Perceived or Experienced discrimination plot_grpfrq(perceived.discrimination, world.region, geom.colors = "gs", title = "Perceived or Experienced discrimination") plot_grpfrq(perceived.discrimination, degree, geom.colors = "gs", title = "Perceived or Experienced discrimination") #Crime and low level of safety plot_grpfrq(crime.safety.levels, world.region, geom.colors = "gs", title = "Crime and low level of safety") plot_grpfrq(crime.safety.levels, degree, geom.colors = "gs", title = "Crime and low level of safety") #Strict migration process plot_grpfrq(strict.visa, world.region, geom.colors = "gs", title = "Strict migration process") plot_grpfrq(strict.visa, degree, geom.colors = "gs", title = "Strict migration process") #Family expectations plot_grpfrq(family_expectations, world.region, geom.colors = "gs", title = "Family expectations") plot_grpfrq(job.opportunities, degree, geom.colors = "gs", title = "Family expectations") #Restrictive Cultural practices plot_grpfrq(restrictive.practices, world.region, geom.colors = "gs", title = "Restrictive Cultural practices") plot_grpfrq(restrictive.practices, degree, geom.colors = "gs", title = "Restrictive Cultural practices") #Limited jobs plot_grpfrq(limited.jobs.opportunities, world.region, geom.colors = "gs", title = "Limited jobs opportunities") plot_grpfrq(limited.jobs.opportunities, degree, geom.colors = "gs", title = "Limited jobs opportunities") #Lower income levels plot_grpfrq(low.income, world.region, geom.colors = "gs", title = "Lower income levels") plot_grpfrq(low.income, degree, geom.colors = "gs", title = "Lower income levels") #Lower quality of life plot_grpfrq(low_lifequality, world.region, geom.colors = "gs", title = "Lower quality of life") plot_grpfrq(low_lifequality, degree, geom.colors = "gs", title = "Lower quality of life") #Political persecution plot_grpfrq(political_persecution, world.region, geom.colors = "gs", title = "Political persecution") plot_grpfrq(political_persecution, degree, geom.colors = "gs", title = "Political persecution") #Dangers to ones own life plot_grpfrq(danger.to.life, world.region, geom.colors = "gs", title = "Dangers to ones own life") plot_grpfrq(danger.to.life, degree, geom.colors = "gs", title = "Dangers to ones own life")
#' evaldyntracer: a dynamic tracer for eval #' #' evaldyntracer is an R package for tracing usage of the eval function. It #' intercepts and analyzes the usage and impact of eval in R code. It also #' exports the intercepted data for further summarization and analysis. #' #' @useDynLib evaldyntracer, .registration = TRUE, .fixes="C_" "_PACKAGE"
/R/evaldyntracer.R
permissive
chakshugoyal97/evaldyntracer
R
false
false
347
r
#' evaldyntracer: a dynamic tracer for eval #' #' evaldyntracer is an R package for tracing usage of the eval function. It #' intercepts and analyzes the usage and impact of eval in R code. It also #' exports the intercepted data for further summarization and analysis. #' #' @useDynLib evaldyntracer, .registration = TRUE, .fixes="C_" "_PACKAGE"
#' @export vc.r <- function(expr) { mock_network_functions( eval.parent(substitute(expr)) ) } network_function_registry <- local({ registry <- list() list( empty = function() { length(registry) == 0 }, init = function() { registry$`httr:::perform` <<- duplicate(httr:::perform) }, get = function(key) { registry[[key]] } ) }) mock_network_functions <- function(expr) { setup_network_mocks() eval.parent(substitute({ testthatsomemore::package_stub("httr", "perform", mock_network_function("httr:::perform"), expr )})) } setup_network_mocks <- function() { if (network_function_registry$empty()) { network_function_registry$init() } } mock_network_function <- function(fn) { # TODO: (RK) Support non-standard evaluation, argument preservation, # environment preservation, etc.? eval(bquote( function(...) { network_request(.(fn), list(...)) } )) } network_request <- local({ # TODO: (RK) Replace with package currently being tested. network_requests <- NULL function(fn, args) { if (is.null(network_requests)) { network_requests <<- director::registry$new( file.path(system.file(package = "vcr"), file.path("tests", "net_data")) ) } key <- digest::digest(list(fn, args)) result <- network_requests$get(key) if (is.null(result)) { result <- do.call(network_function_registry$get(fn), args) network_requests$set(key, result) } network_requests$get(key) } })
/R/vc.r.R
no_license
robertzk/vc.r
R
false
false
1,525
r
#' @export vc.r <- function(expr) { mock_network_functions( eval.parent(substitute(expr)) ) } network_function_registry <- local({ registry <- list() list( empty = function() { length(registry) == 0 }, init = function() { registry$`httr:::perform` <<- duplicate(httr:::perform) }, get = function(key) { registry[[key]] } ) }) mock_network_functions <- function(expr) { setup_network_mocks() eval.parent(substitute({ testthatsomemore::package_stub("httr", "perform", mock_network_function("httr:::perform"), expr )})) } setup_network_mocks <- function() { if (network_function_registry$empty()) { network_function_registry$init() } } mock_network_function <- function(fn) { # TODO: (RK) Support non-standard evaluation, argument preservation, # environment preservation, etc.? eval(bquote( function(...) { network_request(.(fn), list(...)) } )) } network_request <- local({ # TODO: (RK) Replace with package currently being tested. network_requests <- NULL function(fn, args) { if (is.null(network_requests)) { network_requests <<- director::registry$new( file.path(system.file(package = "vcr"), file.path("tests", "net_data")) ) } key <- digest::digest(list(fn, args)) result <- network_requests$get(key) if (is.null(result)) { result <- do.call(network_function_registry$get(fn), args) network_requests$set(key, result) } network_requests$get(key) } })
source("/data/safe/bekritsk/simons/scripts/genotyper/emGenotyper/src/mendelScoreFunctions2.R") source("/data/safe/bekritsk/simons/scripts/genotyper/emGenotyper/src/modelingFunctions3.R") source("/data/safe/bekritsk/simons/scripts/genotyper/emGenotyper/src/genotyperFunctions2.R") source("/data/safe/bekritsk/simons/scripts/genotyper/emGenotyper/src/figureFunctions.R") source("/data/safe/bekritsk/simons/scripts/genotyper/emGenotyper/src/dataLoadingFunctions.R") source("/data/safe/bekritsk/simons/scripts/genotyper/emGenotyper/src/annotationFunctions.R") source("/data/safe/bekritsk/simons/scripts/genotyper/emGenotyper/src/helperFunctions.R") dirname="/data/safe/bekritsk/simons/Exome/workingSet/06182013_completeWiglerSSCQuads/" locus.info.file=paste(dirname,"allele_matrix_info.txt",sep="") allele.info.file=paste(dirname,"allele_matrix.txt",sep="") family.info.file=paste(dirname,"person_info.txt",sep="") #load families locus.info<-load.locus.info(locus.info.file) #Exclude sex chromosomes--X and Y can be corrected for copy number (MT copy number is unknown), but genotyper #also needs to accomodate single allele genotypes for X and Y, depending on gender. MT could be single allele genotype, #but could have many more than 2 genotypes as well allele.info<-load.alleles(allele.info.file,locus.info,exclude.XY=TRUE,exclude.MT=FALSE) locus.info<-remove.chromosomes(locus.info,c("chrX","chrY")) locus.info<-add.locus.idxs.to.locus.info(locus.info,allele.info) person.info<-load.person.info(family.info.file) exon.anno.file<-"/mnt/wigclust4/home/bekritsk/genomes/hg19/hg19BedFiles/hg19.ms.ccds.rg.info.exons.merged.bed" intron.anno.file<-"/mnt/wigclust4/home/bekritsk/genomes/hg19/hg19BedFiles/hg19.ms.ccds.rg.info.introns.merged.bed" mirna.anno.file<-"/mnt/wigclust4/home/bekritsk/genomes/hg19/hg19BedFiles/hg19.ms.miRNA.merged.bed" utr.anno.file<-"/mnt/wigclust4/home/bekritsk/genomes/hg19/hg19BedFiles/hg19.ms.ccds.rg.info.utr.merged.bed" gene.id.file<-"/mnt/wigclust4/home/bekritsk/genomes/hg19/hg19GeneName.ccds.rg.geneID.txt" gene.ids<-load.gene.ids(gene.id.file) ptm<-proc.time() annotations<-get.annotations(exon.file=exon.anno.file,intron.file=intron.anno.file,mirna.file=mirna.anno.file,utr.file=utr.anno.file, locus.info=locus.info) print(proc.time() - ptm) save(annotations,file=sprintf("%sannotations.RData",dirname)) ptm<-proc.time() coverage.estimator<-linear.coverage.model(allele.info$locus.cov,print.dir=dirname,people=person.info) print(proc.time()-ptm) save(coverage.estimator,file=sprintf("%scoverageEstimator.RData",dirname)) #plot coverage per person total.cov<-pop.total.coverage.hist(allele.info$locus.cov,dirname) mean.cov<-pop.mean.coverage.hist(allele.info$locus.cov,dirname) #find individuals with low correlation between expected and observed allele coverage or very low observed coverage and remove them problem.people<-unique(as.integer(c(which(total.cov < (mean(total.cov) - (2*sd(total.cov)))),which(coverage.estimator$cor < 0.8)))) problem.families<-which(person.info$family.id %in% person.info$family.id[problem.people]) #exclude families from analysis where a member has low correlation between expected and observed allele coverage or has low total coverage person.info<-exclude.people.from.person.df(person.info,problem.families) locus.info<-exclude.people.from.locus.df(locus.info,allele.info,problem.families) allele.info<-exclude.people.from.allele.df(allele.info,problem.families) coverage.estimator<-exclude.people.from.exp.coverage.matrix(coverage.estimator,problem.families) pop<-ncol(allele.info$alleles) n.fams<-pop/4 by.fams<-get.fam.mat(person.info) mom.and.pop<-which(person.info$relation %in% c("mother","father")) em.geno<-call.genotypes(allele.info,locus.info,coverage.estimator,pop) save(em.geno,file=sprintf("%semGenotpyes.RData",dirname)) locus.info<-add.num.called(em.geno,locus.info,stop.locus=1000) locus.info<-add.allele.biases(em.geno,locus.info,stop.locus=1000) save(locus.info,file=sprintf("%slocusInfo.RData",dirname)) graphBiasInfo(dirname,locus.info) graphGenotypeOverviewStats(dirname,em.geno) max.alleles<-6 #number of most common alleles within family to consider when calculating the Mendel score mendel.ind<-get.mendel.trio.indices(max.alleles) n.ind<-nrow(mendel.ind) #total number of genotype combinations (of 4^max.alleles) that are Mendelian fam.genotypes<-get.mendel.scores(allele.info=allele.info,locus.info=locus.info,geno.list=em.geno, n.fams=n.fams,by.fam=by.fams,pop.size=pop,coverage.model=coverage.estimator,mendel.ind=mendel.ind) save(fam.genotypes,file=sprintf("%sfamilyGenotypes.RData",dirname)) allele.cov.info<-get.allele.cov.info(allele.info,locus.info,coverage.estimator$exp.cov,gp$genotypes) low.mendel.threshold<-5e-3 allele.fit.threshold<-1e-5 noise.fit.threshold<-1e-3 max.error.rate<-1e-1 too.biased<-0.5 include.na.noise<-FALSE include.na<-FALSE pro.low.mendel<-length(which(fam.genotypes[,,10] <= low.mendel.threshold)) pro.low.mendel.indices<-which(fam.genotypes[,,10] <= low.mendel.threshold, arr.ind=T) pro.low.mendel.indices<-cbind(pro.low.mendel.indices,1) sib.low.mendel<-length(which(fam.genotypes[,,11] <= low.mendel.threshold)) sib.low.mendel.indices<-which(fam.genotypes[,,11] <= low.mendel.threshold, arr.ind=T) sib.low.mendel.indices<-cbind(sib.low.mendel.indices,2) low.mendel.indices<-rbind(sib.low.mendel.indices,pro.low.mendel.indices) low.mendel.indices<-low.mendel.indices[order(low.mendel.indices[,1],low.mendel.indices[,2],low.mendel.indices[,3]),] tot.low.mendel<-vector() denovo.loci<-as.integer(names(table(low.mendel.indices[,1]))) for(i in denovo.loci) { loci.indices<-which(low.mendel.indices[,1] == i) denovo.fams.at.loci<-as.integer(names(table(low.mendel.indices[loci.indices,2]))) for(j in denovo.fams.at.loci) { dn.fam.at.locus<-which(low.mendel.indices[,1] == i & low.mendel.indices[,2] == j) if(length(dn.fam.at.locus) == 1) { tot.low.mendel<-rbind(tot.low.mendel,low.mendel.indices[dn.fam.at.locus,]) } else { tot.low.mendel<-rbind(tot.low.mendel,c(low.mendel.indices[dn.fam.at.locus[1],1:2],3)) } } } denovo.info<-array(NA,dim=c(nrow(low.mendel.indices),2)) for(i in 1:nrow(tot.low.mendel)) { locus<-tot.low.mendel[i,1] family<-tot.low.mendel[i,2] who.dn<-tot.low.mendel[i,3] num.na<-sum(fam.genotypes[locus,family,1:8] == -1) if(num.na == 0) { dn.allele.bias<-get.allele.bias(fam.genotypes[locus,family,],who.dn,allele.cov.info,locus.info,locus) if(is.na(dn.allele.bias)){dn.allele.bias<-1} if(dn.allele.bias > too.biased & (1/dn.allele.bias) > too.biased) { fam.ind<-by.fams[family,] num.good.allele.fit<-sum(gp$genotypes[locus,fam.ind,4] > allele.fit.threshold) num.good.noise.fit<-length(which(gp$genotypes[locus,fam.ind,5] > noise.fit.threshold)) num.low.error<-sum(np.noise.estimator[locus,fam.ind] < max.error.rate) if(num.good.noise.fit == 4 & num.good.allele.fit == 4 & num.low.error == 4) { if(who.dn == 1) { denovo.info[i,1]<-fam.genotypes[locus,family,10] } else if (who.dn == 2) { denovo.info[i,1]<-fam.genotypes[locus,family,11] } else if (who.dn == 3) { denovo.info[i,1]<-mean(fam.genotypes[locus,family,10:11]) } denovo.info[i,2]<-i } } } } denovo.info<-na.omit(denovo.info) denovo.info<-denovo.info[order(denovo.info[,1]),] quartz();plot(-10*log10(denovo.info[,1]),main=sprintf("Top %d de novo candidate scores",nrow(denovo.info)),pch=16,ylab="log10 denovo score") denovo.dir<-"~/Desktop/prelimFams2/denovos6/" fig.dirs<-create.dn.figure.dirs(denovo.dir) total.denovo<-0 for(i in 1:nrow(denovo.info)) { total.denovo<-total.denovo+1 denovo.ind<-tot.low.mendel[denovo.info[i,2],] fam.ind<-by.fams[denovo.ind[2],] dn.locus<-denovo.ind[1] dn.family<-denovo.ind[2] dn.person<-denovo.ind[3] locus.info.index<-allele.info$locus.row.indices[dn.locus] dn.type<-NULL ifelse(dn.person == 1, dn.indices<-5:6, ifelse(dn.person == 2, dn.indices<-7:8, dn.indices<-5:8)) dn.anno<-get.locus.annotations(dn.locus,annotations,gene.ids) context<-annotation.precedence(dn.anno) dn.alleles<-unique(fam.genotypes[dn.locus,dn.family,dn.indices]) graph.dir<-NULL if(sum(dn.alleles %in% fam.genotypes[dn.locus,dn.family,1:4]) == length(dn.alleles)) #all alleles in Mendel violation child are in parents, omission violation { ifelse(dn.person == 1, graph.dir<-fig.dirs[["omissions"]][["proband"]][[context]], ifelse(dn.person == 2, graph.dir<-fig.dirs[["omissions"]][["sibling"]][[context]], graph.dir<-fig.dirs[["omissions"]][["both"]][[context]])) } else #new allele in Mendel violation child, commission violation { ifelse(dn.person == 1, graph.dir<-fig.dirs[["commissions"]][["proband"]][[context]], ifelse(dn.person == 2, graph.dir<-fig.dirs[["commissions"]][["sibling"]][[context]], graph.dir<-fig.dirs[["commissions"]][["both"]][[context]])) } plot.family(locus.info,allele.info,gp$genotypes,dn.locus,person.info,family.ind=by.fams[dn.family,],fam.genotypes=fam.genotypes[dn.locus,dn.family,], who.dn=dn.person,print.dir=graph.dir,anno=dn.anno) plot.pop.image(locus.info,gp$genotypes,denovo.ind[1],print.dir=graph.dir,fam.genotypes=fam.genotypes[dn.locus,dn.family,],who.dn=denovo.ind[3],anno=dn.anno) plot.dn.eo.scatter(allele.info,locus.info,dn.locus,dn.family,by.fams,gp$genotypes,coverage.estimator,who.dn=dn.person,fam.genotypes=fam.genotypes[dn.locus,dn.family,], print.dir=graph.dir,anno=dn.anno) plot.dn.cov.scatter(allele.info,locus.info,dn.locus,dn.family,by.fams,gp$genotypes,who.dn=dn.person,fam.genotypes=fam.genotypes[dn.locus,dn.family,], print.dir=graph.dir,anno=dn.anno) } unique.mendel<-as.integer(names(which(table(tot.low.mendel[,1]) == 1))) for(i in unique.mendel) { denovo.locus.info<-tot.low.mendel[which(tot.low.mendel == i),] locus<-denovo.locus.info[1] family<-denovo.locus.info[2] who.dn<-denovo.locus.info[3] plot.family(locus.info,allele.info,gp$genotypes,locus,family.id=as.character(person.info$family.id[by.fams[family,1]]), fam.genotypes=fam.genotypes[locus,family,],who.dn=who.dn,print.dir="~/Desktop/prelimFams2/uniqueMendel2/") plot.pop.heatmap(locus.info,allele.info,pop,gp$genotypes,i,print.dir="~/Desktop/prelimFams2/uniqueMendel2/") }
/emGenotyper/popGenotyper7_fullSet.R
no_license
MBekritsky/uSeq
R
false
false
10,564
r
source("/data/safe/bekritsk/simons/scripts/genotyper/emGenotyper/src/mendelScoreFunctions2.R") source("/data/safe/bekritsk/simons/scripts/genotyper/emGenotyper/src/modelingFunctions3.R") source("/data/safe/bekritsk/simons/scripts/genotyper/emGenotyper/src/genotyperFunctions2.R") source("/data/safe/bekritsk/simons/scripts/genotyper/emGenotyper/src/figureFunctions.R") source("/data/safe/bekritsk/simons/scripts/genotyper/emGenotyper/src/dataLoadingFunctions.R") source("/data/safe/bekritsk/simons/scripts/genotyper/emGenotyper/src/annotationFunctions.R") source("/data/safe/bekritsk/simons/scripts/genotyper/emGenotyper/src/helperFunctions.R") dirname="/data/safe/bekritsk/simons/Exome/workingSet/06182013_completeWiglerSSCQuads/" locus.info.file=paste(dirname,"allele_matrix_info.txt",sep="") allele.info.file=paste(dirname,"allele_matrix.txt",sep="") family.info.file=paste(dirname,"person_info.txt",sep="") #load families locus.info<-load.locus.info(locus.info.file) #Exclude sex chromosomes--X and Y can be corrected for copy number (MT copy number is unknown), but genotyper #also needs to accomodate single allele genotypes for X and Y, depending on gender. MT could be single allele genotype, #but could have many more than 2 genotypes as well allele.info<-load.alleles(allele.info.file,locus.info,exclude.XY=TRUE,exclude.MT=FALSE) locus.info<-remove.chromosomes(locus.info,c("chrX","chrY")) locus.info<-add.locus.idxs.to.locus.info(locus.info,allele.info) person.info<-load.person.info(family.info.file) exon.anno.file<-"/mnt/wigclust4/home/bekritsk/genomes/hg19/hg19BedFiles/hg19.ms.ccds.rg.info.exons.merged.bed" intron.anno.file<-"/mnt/wigclust4/home/bekritsk/genomes/hg19/hg19BedFiles/hg19.ms.ccds.rg.info.introns.merged.bed" mirna.anno.file<-"/mnt/wigclust4/home/bekritsk/genomes/hg19/hg19BedFiles/hg19.ms.miRNA.merged.bed" utr.anno.file<-"/mnt/wigclust4/home/bekritsk/genomes/hg19/hg19BedFiles/hg19.ms.ccds.rg.info.utr.merged.bed" gene.id.file<-"/mnt/wigclust4/home/bekritsk/genomes/hg19/hg19GeneName.ccds.rg.geneID.txt" gene.ids<-load.gene.ids(gene.id.file) ptm<-proc.time() annotations<-get.annotations(exon.file=exon.anno.file,intron.file=intron.anno.file,mirna.file=mirna.anno.file,utr.file=utr.anno.file, locus.info=locus.info) print(proc.time() - ptm) save(annotations,file=sprintf("%sannotations.RData",dirname)) ptm<-proc.time() coverage.estimator<-linear.coverage.model(allele.info$locus.cov,print.dir=dirname,people=person.info) print(proc.time()-ptm) save(coverage.estimator,file=sprintf("%scoverageEstimator.RData",dirname)) #plot coverage per person total.cov<-pop.total.coverage.hist(allele.info$locus.cov,dirname) mean.cov<-pop.mean.coverage.hist(allele.info$locus.cov,dirname) #find individuals with low correlation between expected and observed allele coverage or very low observed coverage and remove them problem.people<-unique(as.integer(c(which(total.cov < (mean(total.cov) - (2*sd(total.cov)))),which(coverage.estimator$cor < 0.8)))) problem.families<-which(person.info$family.id %in% person.info$family.id[problem.people]) #exclude families from analysis where a member has low correlation between expected and observed allele coverage or has low total coverage person.info<-exclude.people.from.person.df(person.info,problem.families) locus.info<-exclude.people.from.locus.df(locus.info,allele.info,problem.families) allele.info<-exclude.people.from.allele.df(allele.info,problem.families) coverage.estimator<-exclude.people.from.exp.coverage.matrix(coverage.estimator,problem.families) pop<-ncol(allele.info$alleles) n.fams<-pop/4 by.fams<-get.fam.mat(person.info) mom.and.pop<-which(person.info$relation %in% c("mother","father")) em.geno<-call.genotypes(allele.info,locus.info,coverage.estimator,pop) save(em.geno,file=sprintf("%semGenotpyes.RData",dirname)) locus.info<-add.num.called(em.geno,locus.info,stop.locus=1000) locus.info<-add.allele.biases(em.geno,locus.info,stop.locus=1000) save(locus.info,file=sprintf("%slocusInfo.RData",dirname)) graphBiasInfo(dirname,locus.info) graphGenotypeOverviewStats(dirname,em.geno) max.alleles<-6 #number of most common alleles within family to consider when calculating the Mendel score mendel.ind<-get.mendel.trio.indices(max.alleles) n.ind<-nrow(mendel.ind) #total number of genotype combinations (of 4^max.alleles) that are Mendelian fam.genotypes<-get.mendel.scores(allele.info=allele.info,locus.info=locus.info,geno.list=em.geno, n.fams=n.fams,by.fam=by.fams,pop.size=pop,coverage.model=coverage.estimator,mendel.ind=mendel.ind) save(fam.genotypes,file=sprintf("%sfamilyGenotypes.RData",dirname)) allele.cov.info<-get.allele.cov.info(allele.info,locus.info,coverage.estimator$exp.cov,gp$genotypes) low.mendel.threshold<-5e-3 allele.fit.threshold<-1e-5 noise.fit.threshold<-1e-3 max.error.rate<-1e-1 too.biased<-0.5 include.na.noise<-FALSE include.na<-FALSE pro.low.mendel<-length(which(fam.genotypes[,,10] <= low.mendel.threshold)) pro.low.mendel.indices<-which(fam.genotypes[,,10] <= low.mendel.threshold, arr.ind=T) pro.low.mendel.indices<-cbind(pro.low.mendel.indices,1) sib.low.mendel<-length(which(fam.genotypes[,,11] <= low.mendel.threshold)) sib.low.mendel.indices<-which(fam.genotypes[,,11] <= low.mendel.threshold, arr.ind=T) sib.low.mendel.indices<-cbind(sib.low.mendel.indices,2) low.mendel.indices<-rbind(sib.low.mendel.indices,pro.low.mendel.indices) low.mendel.indices<-low.mendel.indices[order(low.mendel.indices[,1],low.mendel.indices[,2],low.mendel.indices[,3]),] tot.low.mendel<-vector() denovo.loci<-as.integer(names(table(low.mendel.indices[,1]))) for(i in denovo.loci) { loci.indices<-which(low.mendel.indices[,1] == i) denovo.fams.at.loci<-as.integer(names(table(low.mendel.indices[loci.indices,2]))) for(j in denovo.fams.at.loci) { dn.fam.at.locus<-which(low.mendel.indices[,1] == i & low.mendel.indices[,2] == j) if(length(dn.fam.at.locus) == 1) { tot.low.mendel<-rbind(tot.low.mendel,low.mendel.indices[dn.fam.at.locus,]) } else { tot.low.mendel<-rbind(tot.low.mendel,c(low.mendel.indices[dn.fam.at.locus[1],1:2],3)) } } } denovo.info<-array(NA,dim=c(nrow(low.mendel.indices),2)) for(i in 1:nrow(tot.low.mendel)) { locus<-tot.low.mendel[i,1] family<-tot.low.mendel[i,2] who.dn<-tot.low.mendel[i,3] num.na<-sum(fam.genotypes[locus,family,1:8] == -1) if(num.na == 0) { dn.allele.bias<-get.allele.bias(fam.genotypes[locus,family,],who.dn,allele.cov.info,locus.info,locus) if(is.na(dn.allele.bias)){dn.allele.bias<-1} if(dn.allele.bias > too.biased & (1/dn.allele.bias) > too.biased) { fam.ind<-by.fams[family,] num.good.allele.fit<-sum(gp$genotypes[locus,fam.ind,4] > allele.fit.threshold) num.good.noise.fit<-length(which(gp$genotypes[locus,fam.ind,5] > noise.fit.threshold)) num.low.error<-sum(np.noise.estimator[locus,fam.ind] < max.error.rate) if(num.good.noise.fit == 4 & num.good.allele.fit == 4 & num.low.error == 4) { if(who.dn == 1) { denovo.info[i,1]<-fam.genotypes[locus,family,10] } else if (who.dn == 2) { denovo.info[i,1]<-fam.genotypes[locus,family,11] } else if (who.dn == 3) { denovo.info[i,1]<-mean(fam.genotypes[locus,family,10:11]) } denovo.info[i,2]<-i } } } } denovo.info<-na.omit(denovo.info) denovo.info<-denovo.info[order(denovo.info[,1]),] quartz();plot(-10*log10(denovo.info[,1]),main=sprintf("Top %d de novo candidate scores",nrow(denovo.info)),pch=16,ylab="log10 denovo score") denovo.dir<-"~/Desktop/prelimFams2/denovos6/" fig.dirs<-create.dn.figure.dirs(denovo.dir) total.denovo<-0 for(i in 1:nrow(denovo.info)) { total.denovo<-total.denovo+1 denovo.ind<-tot.low.mendel[denovo.info[i,2],] fam.ind<-by.fams[denovo.ind[2],] dn.locus<-denovo.ind[1] dn.family<-denovo.ind[2] dn.person<-denovo.ind[3] locus.info.index<-allele.info$locus.row.indices[dn.locus] dn.type<-NULL ifelse(dn.person == 1, dn.indices<-5:6, ifelse(dn.person == 2, dn.indices<-7:8, dn.indices<-5:8)) dn.anno<-get.locus.annotations(dn.locus,annotations,gene.ids) context<-annotation.precedence(dn.anno) dn.alleles<-unique(fam.genotypes[dn.locus,dn.family,dn.indices]) graph.dir<-NULL if(sum(dn.alleles %in% fam.genotypes[dn.locus,dn.family,1:4]) == length(dn.alleles)) #all alleles in Mendel violation child are in parents, omission violation { ifelse(dn.person == 1, graph.dir<-fig.dirs[["omissions"]][["proband"]][[context]], ifelse(dn.person == 2, graph.dir<-fig.dirs[["omissions"]][["sibling"]][[context]], graph.dir<-fig.dirs[["omissions"]][["both"]][[context]])) } else #new allele in Mendel violation child, commission violation { ifelse(dn.person == 1, graph.dir<-fig.dirs[["commissions"]][["proband"]][[context]], ifelse(dn.person == 2, graph.dir<-fig.dirs[["commissions"]][["sibling"]][[context]], graph.dir<-fig.dirs[["commissions"]][["both"]][[context]])) } plot.family(locus.info,allele.info,gp$genotypes,dn.locus,person.info,family.ind=by.fams[dn.family,],fam.genotypes=fam.genotypes[dn.locus,dn.family,], who.dn=dn.person,print.dir=graph.dir,anno=dn.anno) plot.pop.image(locus.info,gp$genotypes,denovo.ind[1],print.dir=graph.dir,fam.genotypes=fam.genotypes[dn.locus,dn.family,],who.dn=denovo.ind[3],anno=dn.anno) plot.dn.eo.scatter(allele.info,locus.info,dn.locus,dn.family,by.fams,gp$genotypes,coverage.estimator,who.dn=dn.person,fam.genotypes=fam.genotypes[dn.locus,dn.family,], print.dir=graph.dir,anno=dn.anno) plot.dn.cov.scatter(allele.info,locus.info,dn.locus,dn.family,by.fams,gp$genotypes,who.dn=dn.person,fam.genotypes=fam.genotypes[dn.locus,dn.family,], print.dir=graph.dir,anno=dn.anno) } unique.mendel<-as.integer(names(which(table(tot.low.mendel[,1]) == 1))) for(i in unique.mendel) { denovo.locus.info<-tot.low.mendel[which(tot.low.mendel == i),] locus<-denovo.locus.info[1] family<-denovo.locus.info[2] who.dn<-denovo.locus.info[3] plot.family(locus.info,allele.info,gp$genotypes,locus,family.id=as.character(person.info$family.id[by.fams[family,1]]), fam.genotypes=fam.genotypes[locus,family,],who.dn=who.dn,print.dir="~/Desktop/prelimFams2/uniqueMendel2/") plot.pop.heatmap(locus.info,allele.info,pop,gp$genotypes,i,print.dir="~/Desktop/prelimFams2/uniqueMendel2/") }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/wr.data.R \name{wr.data} \alias{wr.data} \title{Reading WhatsApp conversation data} \usage{ wr.data(file, OS, CheckForErrors = FALSE) } \arguments{ \item{file}{the directory of the WhatsApp .txt file} \item{OS}{indicating if the operating system is "android" or "iOS"} \item{CheckForErrors}{will check for errors in reading of input data, mostly due to quoted text} } \value{ Returns a data frame with formatted WhatsApp data } \description{ Reading WhatsApp conversation data } \author{ Finlay Campbell <f.campbell15@imperial.ac.uk> }
/man/wr.data.Rd
permissive
finlaycampbell/WhatsAppR
R
false
true
616
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/wr.data.R \name{wr.data} \alias{wr.data} \title{Reading WhatsApp conversation data} \usage{ wr.data(file, OS, CheckForErrors = FALSE) } \arguments{ \item{file}{the directory of the WhatsApp .txt file} \item{OS}{indicating if the operating system is "android" or "iOS"} \item{CheckForErrors}{will check for errors in reading of input data, mostly due to quoted text} } \value{ Returns a data frame with formatted WhatsApp data } \description{ Reading WhatsApp conversation data } \author{ Finlay Campbell <f.campbell15@imperial.ac.uk> }
#' Multivariate Adaptive Regression Splines Model #' #' Build a regression model using the techniques in Friedman's papers #' "Multivariate Adaptive Regression Splines" and "Fast MARS". #' #' @param pmethod pruning method. #' @param trace level of execution information to display. #' @param degree maximum degree of interaction. #' @param nprune maximum number of terms (including intercept) in the pruned #' model. #' @param nfold number of cross-validation folds. #' @param ncross number of cross-validations if \code{nfold > 1}. #' @param stratify logical indicating whether to stratify cross-validation #' samples by the response levels. #' #' @details #' \describe{ #' \item{Response Types:}{\code{factor}, \code{numeric}} #' \item{\link[=TunedModel]{Automatic Tuning} of Grid Parameters:}{ #' \code{nprune}, \code{degree}* #' } #' } #' * included only in randomly sampled grid points #' #' Default values for the \code{NULL} arguments and further model details can be #' found in the source link below. #' #' In calls to \code{\link{varimp}} for \code{EarthModel}, argument #' \code{metric} may be specified as \code{"gcv"} (default) for the generalized #' cross-validation decrease over all subsets that include each predictor, as #' \code{"rss"} for the residual sums of squares decrease, or as #' \code{"nsubsets"} for the number of model subsets that include each #' predictor. Variable importance is automatically scaled to range from 0 to #' 100. To obtain unscaled importance values, set \code{scale = FALSE}. See #' example below. #' #' @return \code{MLModel} class object. #' #' @seealso \code{\link[earth]{earth}}, \code{\link{fit}}, #' \code{\link{resample}} #' #' @examples #' model_fit <- fit(Species ~ ., data = iris, model = EarthModel) #' varimp(model_fit, metric = "nsubsets", scale = FALSE) #' EarthModel <- function(pmethod = c("backward", "none", "exhaustive", "forward", "seqrep", "cv"), trace = 0, degree = 1, nprune = NULL, nfold = 0, ncross = 1, stratify = TRUE) { pmethod <- match.arg(pmethod) MLModel( name = "EarthModel", label = "Multivariate Adaptive Regression Splines", packages = "earth", response_types = c("factor", "numeric"), predictor_encoding = "model.matrix", params = params(environment()), grid = function(x, length, random, ...) { modelfit <- fit(x, model = EarthModel(pmethod = "none")) max_terms <- min(2 + 0.75 * nrow(modelfit$dirs), 200) params <- list( nprune = round(seq(2, max_terms, length = length)) ) if (random) params$degree <- head(1:2, length) params }, fit = function(formula, data, weights, ...) { attach_objects(list( contr.earth.response = earth::contr.earth.response ), name = "earth_exports") glm <- list(family = switch_class(response(data), factor = "binomial", numeric = "gaussian")) eval_fit(data, formula = earth::earth(formula, data = as.data.frame(data), weights = weights, glm = glm, ...), matrix = earth::earth(x, y, weights = weights, glm = glm, ...)) }, predict = function(object, newdata, ...) { newdata <- as.data.frame(newdata) predict(object, newdata = newdata, type = "response") }, varimp = function(object, metric = c("gcv", "rss", "nsubsets"), ...) { earth::evimp(object)[, match.arg(metric), drop = FALSE] } ) } MLModelFunction(EarthModel) <- NULL
/R/ML_EarthModel.R
no_license
chen061218/MachineShop
R
false
false
3,644
r
#' Multivariate Adaptive Regression Splines Model #' #' Build a regression model using the techniques in Friedman's papers #' "Multivariate Adaptive Regression Splines" and "Fast MARS". #' #' @param pmethod pruning method. #' @param trace level of execution information to display. #' @param degree maximum degree of interaction. #' @param nprune maximum number of terms (including intercept) in the pruned #' model. #' @param nfold number of cross-validation folds. #' @param ncross number of cross-validations if \code{nfold > 1}. #' @param stratify logical indicating whether to stratify cross-validation #' samples by the response levels. #' #' @details #' \describe{ #' \item{Response Types:}{\code{factor}, \code{numeric}} #' \item{\link[=TunedModel]{Automatic Tuning} of Grid Parameters:}{ #' \code{nprune}, \code{degree}* #' } #' } #' * included only in randomly sampled grid points #' #' Default values for the \code{NULL} arguments and further model details can be #' found in the source link below. #' #' In calls to \code{\link{varimp}} for \code{EarthModel}, argument #' \code{metric} may be specified as \code{"gcv"} (default) for the generalized #' cross-validation decrease over all subsets that include each predictor, as #' \code{"rss"} for the residual sums of squares decrease, or as #' \code{"nsubsets"} for the number of model subsets that include each #' predictor. Variable importance is automatically scaled to range from 0 to #' 100. To obtain unscaled importance values, set \code{scale = FALSE}. See #' example below. #' #' @return \code{MLModel} class object. #' #' @seealso \code{\link[earth]{earth}}, \code{\link{fit}}, #' \code{\link{resample}} #' #' @examples #' model_fit <- fit(Species ~ ., data = iris, model = EarthModel) #' varimp(model_fit, metric = "nsubsets", scale = FALSE) #' EarthModel <- function(pmethod = c("backward", "none", "exhaustive", "forward", "seqrep", "cv"), trace = 0, degree = 1, nprune = NULL, nfold = 0, ncross = 1, stratify = TRUE) { pmethod <- match.arg(pmethod) MLModel( name = "EarthModel", label = "Multivariate Adaptive Regression Splines", packages = "earth", response_types = c("factor", "numeric"), predictor_encoding = "model.matrix", params = params(environment()), grid = function(x, length, random, ...) { modelfit <- fit(x, model = EarthModel(pmethod = "none")) max_terms <- min(2 + 0.75 * nrow(modelfit$dirs), 200) params <- list( nprune = round(seq(2, max_terms, length = length)) ) if (random) params$degree <- head(1:2, length) params }, fit = function(formula, data, weights, ...) { attach_objects(list( contr.earth.response = earth::contr.earth.response ), name = "earth_exports") glm <- list(family = switch_class(response(data), factor = "binomial", numeric = "gaussian")) eval_fit(data, formula = earth::earth(formula, data = as.data.frame(data), weights = weights, glm = glm, ...), matrix = earth::earth(x, y, weights = weights, glm = glm, ...)) }, predict = function(object, newdata, ...) { newdata <- as.data.frame(newdata) predict(object, newdata = newdata, type = "response") }, varimp = function(object, metric = c("gcv", "rss", "nsubsets"), ...) { earth::evimp(object)[, match.arg(metric), drop = FALSE] } ) } MLModelFunction(EarthModel) <- NULL
#' @title RR exact CI, TOSST method. #' @description Estimates confidence interval for the risk ratio or prevented fraction; exact method based on the #' score statistic (inverts two one-sided tests). #' @details Estimates confidence intervals based on the score statistic that are 'exact' in the sense of accounting for discreteness. #' Inverts two one-sided score tests. The score statistic is used to select tail area tables, and the binomial probability is estimated #' over the tail area by taking the maximum over the nuisance parameter. Algorithm is a simple step search. #' \cr \cr The data may also be a matrix. In that case \code{y} would be entered as \code{matrix(c(y1, n1-y1, y2, n2-y2), 2, 2, byrow = TRUE)}. #' @param y Data vector c(y1, n1, y2, n2) where y are the positives, n are the total, and group 1 is compared to group 2. #' @param alpha Complement of the confidence level. #' @param pf Estimate \emph{RR} or its complement \emph{PF}? #' @param trace.it Verbose tracking of the iterations? #' @param iter.max Maximum number of iterations #' @param converge Convergence criterion #' @param rnd Number of digits for rounding. Affects display only, not estimates. #' @param stepstart starting interval for step search #' @param nuisance.points number of points over which to evaluate nuisance parameter #' @param gamma parameter for Berger-Boos correction (restricts range of nuisance parameter evaluation) #' @return A \code{\link{rr1}} object with the following fields. #' \item{estimate}{vector with point and interval estimate} #' \item{estimator}{either \code{"PF"} or \code{"RR"}} #' \item{y}{data vector} #' \item{rnd}{how many digits to round the display} #' \item{alpha}{complement of confidence level} #' @export #' @references Koopman PAR, 1984. Confidence intervals for the ratio of two binomial proportions. \emph{Biometrics} 40:513-517. #' \cr Agresti A, Min Y, 2001. On small-sample confidence intervals for parameters in discrete distribution. \emph{Biometrics} 57: 963-971. #' \cr Berger RL, Boos DD, 1994. P values maximized over a confidence set for the nuisance parameter. \emph{Journal of the American Statistical Association} 89:214-220. #' @author David Siev \email{david.siev@@aphis.usda.gov} #' @note Level tested: Moderate. #' @seealso \code{\link{RRotsst}, \link{rr1}} #' #' @examples #' \dontrun{RRtosst(c(4, 24, 12, 28)) #' #' # PF #' # 95% interval estimates #' #' # PF LL UL #' # 0.611 0.012 0.902 } ##-------------------------------------------------------------------- ## RRtosst function ##-------------------------------------------------------------------- RRtosst <- function(y, alpha = 0.05, pf = TRUE, stepstart=.1, iter.max = 36, converge = 1e-6, rnd = 3, trace.it=FALSE, nuisance.points=120, gamma=1e-6){ # Estimates exact confidence interval by the TOSST method # Score statistic used to select tail area tables # Binomial probability estimated over the tail area # by taking the maximum over the nuisance parameter # Written 9/17/07 by Siev # Functions called by rrcix(): # .rr.score.asymp - gets asymptotic interval for starting value of upper bound # found in this file below # (if want to eliminate calling this function would have to search down from r.max) # binci - gets Clopper-Pearson intervals for Berger-Boos method # included here now, but may be moved to another package binci <- function(y,n,alpha=.05,show.warnings=F){ w <- 1*show.warnings - 1 options(warn=w) p <- y/n cpl <- ifelse(y>0,qbeta(alpha/2,y,n-y+1),0) cpu <- ifelse(y<n,qbeta(1-alpha/2,y+1,n-y),1) out <- cbind(y,n,p,cpl,cpu) dimnames(out) <- list(names(y), c('y','n','p.hat','cp low','cp high')) options(warn=0) return(out) } # Data entry y=c(x2,n2,x1,n1) Vaccinates First (order same but subscripts reversed) # data vector if(is.matrix(y)) y <- c(t(cbind(y[,1],apply(y,1,sum)))) # NOTE: the subscripts are reversed compared to the other functions x2 <- y[1] n2 <- y[2] x1 <- y[3] n1 <- y[4] p1 <- x1/n1 p2 <- x2/n2 rho.mle <- p2/p1 # itemize all possible tables in omega (17.26) Y <- data.frame(y1=rep(0:n1,(n2+1)),y2=rep(0:n2,rep(n1+1,n2+1))) observed <- (1:nrow(Y))[Y[,1]==x1 & Y[,2]==x2] Y$C <- choose(n1,Y$y1)*choose(n2,Y$y2) # score statistic - with pi.tilde by quadratic formula scst <- function(rho,y1,n1,y2,n2){ pih1 <- y1/n1 # unrestricted MLE of current data pih2 <- y2/n2 if(y1==0 & y2==0) sc <- 0 else if(y2==n2) sc <- 0 else{ A <- rho*(n1+n2) B <- -(rho*(y1+n2) + y2 + n1) C <- y1+y2 pit1 <- (-B-sqrt(B^2-4*A*C))/(2*A) pit2 <- rho*pit1 sc <- (pih2-rho*pih1)/sqrt(rho^2*pit1*(1-pit1)/n1 + pit2*(1-pit2)/n2) } return(sc) } # get Clopper-Pearson intervals for Berger-Boos method cp <- binci(c(x1,x2),c(n1,n2),alpha=gamma)[,c('cp low','cp high')] L1 <- cp[1,1] U1 <- cp[1,2] L2 <- cp[2,1] U2 <- cp[2,2] r.min <- L2/U1 r.max <- U2/L1 if(rho.mle==0) low <- 0 else{ # search for lower endpoint iter <- 0 step <- stepstart low <- max(0.0001,r.min) # start above 0 (for quadratic formula) repeat{ iter <- iter + 1 if(iter > iter.max) break if(iter>1){ old.low <- low low <- low+step } scst.y <- rep(NA,nrow(Y)) for(i in 1:length(scst.y)) scst.y[i] <- scst(low,Y$y1[i],n1,Y$y2[i],n2) q.set <- Y[scst.y>=scst.y[observed],] q.set$n1y1 <- n1-q.set$y1 q.set$n2y2 <- n2-q.set$y2 if(gamma > 0) pn <- seq(max(L1,L2/low),min(U1,U2/low),length=nuisance.points) # Berger-Boos method 17.164 else pn <- seq(0,min(1/low,1),length=nuisance.points) # simple method 17.138 if(sum(pn>1)>0){ cat('\nIteration', iter, 'nuisance parameter outside parameter space\n') next } fy <- rep(NA,nuisance.points) for(i in 1:nuisance.points){ pni <- pn[i] fy[i] <- sum(q.set$C * pni^q.set$y1 * (1-pni)^q.set$n1y1 * (low*pni)^q.set$y2 * (1-low*pni)^q.set$n2y2) } max.fy <- max(fy) if(trace.it) cat('\nIteration',iter,'rho.low',low,'tail',max.fy,'\n') if(abs(max.fy-(alpha/2 - gamma/2)) < converge) break if(max.fy > (alpha/2 - gamma/2)){ step <- step/2 low <- low-step*2 } } # end repeat } # end else # search for upper endpoint upward from just below asymptotic # rather than downward from r.max # get asymptotic interval for starting ci.asymp <- .rr.score.asymp(c(x2,n2,x1,n1)) # koopman version (slightly narrower interval than mn) high <- ci.asymp[3]*.9 iter <- 0 step <- stepstart repeat{ iter <- iter + 1 if(iter > iter.max) break if(iter>1){ old.high <- high high <- high+step } scst.y <- rep(NA,nrow(Y)) for(i in 1:length(scst.y)) scst.y[i] <- scst(high,Y$y1[i],n1,Y$y2[i],n2) p.set <- Y[scst.y<=scst.y[observed],] p.set$n1y1 <- n1-p.set$y1 p.set$n2y2 <- n2-p.set$y2 if(gamma > 0) pn <- seq(max(L1,L2/high),min(U1,U2/high),length=nuisance.points) # Berger-Boos method 17.164 else pn <- seq(0,min(1/high,1),length=nuisance.points) # simple method 17.138 if(sum(pn>1)>0){ cat('\nIteration', iter, 'nuisance parameter outside parameter space\n') next } fy <- rep(NA,nuisance.points) for(i in 1:nuisance.points){ pni <- pn[i] fy[i] <- sum(p.set$C * pni^p.set$y1 * (1-pni)^p.set$n1y1 * (high*pni)^p.set$y2 * (1-high*pni)^p.set$n2y2) } max.fy <- max(fy) if(trace.it) cat('\nIteration',iter,'rho.high',high,'tail',max.fy,'\n') if(abs(max.fy-(alpha/2 - gamma/2)) < converge) break if(max.fy < (alpha/2 - gamma/2)){ step <- step/2 high <- high-step*2 } } # end repeat int <- c(rho.hat=rho.mle,low=low,high=high) if(!pf) names(int) <- c("RR", "LL", "UL") else{ int <- 1 - int[c(1,3,2)] names(int) <- c("PF", "LL", "UL") } return(rr1$new(estimate = int, estimator = ifelse(pf, 'PF', 'RR'), y = as.matrix(y), rnd = rnd, alpha = alpha)) # out <- list(estimate = int, estimator = ifelse(pf, 'PF', 'RR'), y = y, rnd = rnd, alpha = alpha) # class(out) <- 'rr1' # return(out) } #------------------------------------------------------- # Asymptotic score interval #------------------------------------------------------- ## #' Internal function. #' #' @usage .rr.score.asymp(y) #' @param y data #' @export #' @examples #' # none .rr.score.asymp <- function(y, alpha = 0.05, iter.max = 18., converge = 0.0001, mn=F){ # asymptotic score interval # code taken from RRsc() # choice of either Koopman (mn=F) # or Miettinenen-Nurminen (mn=T) # Data entry y=c(x2,n2,x1,n1) Vaccinates First u.p <- function(p1, p2, n1, n2) (1. - p1)/(n1 * p1) + (1. - p2)/(n2 * p2) z.phi <- function(phi, x1, x2, n1, n2, u.p, root, za, MN = F) { if(MN) mn <- sqrt((n1 + n2 - 1.)/(n1 + n2)) else mn <- 1. p2 <- root(x1, x2, n1, n2, phi) p1 <- p2 * phi u <- u.p(p1, p2, n1, n2) z <- ((x1 - n1 * p1)/(1. - p1)) * sqrt(u) * mn return(z) } root <- function(x1, x2, n1, n2, phi){ a <- phi * (n1 + n2) b <- - (phi * (x2 + n1) + x1 + n2) cc <- x1 + x2 det <- sqrt(b^2. - 4. * a * cc) rt <- ( - b - det)/(2. * a) return(rt) } al2 <- alpha/2. z.al2 <- qnorm(al2) z.ah2 <- qnorm(1. - al2) zv <- c(z.al2, z.ah2) x1 <- y[1.] n1 <- y[2.] x2 <- y[3.] n2 <- y[4.] p1 <- x1/n1 p2 <- x2/n2 p1 <- x1/n1 phi.mle <- p1/p2 # 0.5 log method p1 <- (x1 + 0.5)/(n1 + 0.5) p2 <- (x2 + 0.5)/(n2 + 0.5) phi <- p1/p2 v <- sqrt(u.p(p1, p2, (n1 + 0.5), (n2 + 0.5))) starting <- exp(v * zv + logb(phi)) # Score method score <- rep(0., length(zv)) for(k in 1.:length(zv)) { if(k == 1. & x1 == 0.) score[k] <- 0. else if(k == 2. & x2 == 0.) score[k] <- Inf else { phi <- c(starting[k], 0.9 * starting[k]) za <- -zv[k] zz <- c(z.phi(phi[1.], x1, x2, n1, n2, u.p, root, za, mn), z.phi(phi[2.], x1, x2, n1, n2, u.p, root, za, mn)) if(abs(za - zz[1.]) > abs(za - zz[2.])) phi <- rev(phi) phi.new <- phi[1.] phi.old <- phi[2.] # cat("\n\n") iter <- 0. repeat { iter <- iter + 1. if(iter > iter.max) break z.new <- z.phi(phi.new, x1, x2, n1, n2, u.p, root, za, mn) # cat("iteration", iter, " z", z.new, "phi", phi.new, "\n") if(abs(za - z.new) < converge) break z.old <- z.phi(phi.old, x1, x2, n1, n2, u.p, root, za, mn) phi <- exp(logb(phi.old) + logb(phi.new/phi.old) * ((za - z.old)/(z.new - z.old))) phi.old <- phi.new phi.new <- phi } score[k] <- phi.new } } int <- c(phi.mle,score) # cat("\n\n") names(int) <- c('point','LL','UL') return(int) } #------------------------------------------------------ # End asymptotic score method #------------------------------------------------------ # .rr.score.asymp(c(0,18,16,19),mn=F) # .rr.score.asymp(c(0,18,16,19),mn=T)
/R/RRtosst.r
no_license
tmrealphd/PF
R
false
false
10,694
r
#' @title RR exact CI, TOSST method. #' @description Estimates confidence interval for the risk ratio or prevented fraction; exact method based on the #' score statistic (inverts two one-sided tests). #' @details Estimates confidence intervals based on the score statistic that are 'exact' in the sense of accounting for discreteness. #' Inverts two one-sided score tests. The score statistic is used to select tail area tables, and the binomial probability is estimated #' over the tail area by taking the maximum over the nuisance parameter. Algorithm is a simple step search. #' \cr \cr The data may also be a matrix. In that case \code{y} would be entered as \code{matrix(c(y1, n1-y1, y2, n2-y2), 2, 2, byrow = TRUE)}. #' @param y Data vector c(y1, n1, y2, n2) where y are the positives, n are the total, and group 1 is compared to group 2. #' @param alpha Complement of the confidence level. #' @param pf Estimate \emph{RR} or its complement \emph{PF}? #' @param trace.it Verbose tracking of the iterations? #' @param iter.max Maximum number of iterations #' @param converge Convergence criterion #' @param rnd Number of digits for rounding. Affects display only, not estimates. #' @param stepstart starting interval for step search #' @param nuisance.points number of points over which to evaluate nuisance parameter #' @param gamma parameter for Berger-Boos correction (restricts range of nuisance parameter evaluation) #' @return A \code{\link{rr1}} object with the following fields. #' \item{estimate}{vector with point and interval estimate} #' \item{estimator}{either \code{"PF"} or \code{"RR"}} #' \item{y}{data vector} #' \item{rnd}{how many digits to round the display} #' \item{alpha}{complement of confidence level} #' @export #' @references Koopman PAR, 1984. Confidence intervals for the ratio of two binomial proportions. \emph{Biometrics} 40:513-517. #' \cr Agresti A, Min Y, 2001. On small-sample confidence intervals for parameters in discrete distribution. \emph{Biometrics} 57: 963-971. #' \cr Berger RL, Boos DD, 1994. P values maximized over a confidence set for the nuisance parameter. \emph{Journal of the American Statistical Association} 89:214-220. #' @author David Siev \email{david.siev@@aphis.usda.gov} #' @note Level tested: Moderate. #' @seealso \code{\link{RRotsst}, \link{rr1}} #' #' @examples #' \dontrun{RRtosst(c(4, 24, 12, 28)) #' #' # PF #' # 95% interval estimates #' #' # PF LL UL #' # 0.611 0.012 0.902 } ##-------------------------------------------------------------------- ## RRtosst function ##-------------------------------------------------------------------- RRtosst <- function(y, alpha = 0.05, pf = TRUE, stepstart=.1, iter.max = 36, converge = 1e-6, rnd = 3, trace.it=FALSE, nuisance.points=120, gamma=1e-6){ # Estimates exact confidence interval by the TOSST method # Score statistic used to select tail area tables # Binomial probability estimated over the tail area # by taking the maximum over the nuisance parameter # Written 9/17/07 by Siev # Functions called by rrcix(): # .rr.score.asymp - gets asymptotic interval for starting value of upper bound # found in this file below # (if want to eliminate calling this function would have to search down from r.max) # binci - gets Clopper-Pearson intervals for Berger-Boos method # included here now, but may be moved to another package binci <- function(y,n,alpha=.05,show.warnings=F){ w <- 1*show.warnings - 1 options(warn=w) p <- y/n cpl <- ifelse(y>0,qbeta(alpha/2,y,n-y+1),0) cpu <- ifelse(y<n,qbeta(1-alpha/2,y+1,n-y),1) out <- cbind(y,n,p,cpl,cpu) dimnames(out) <- list(names(y), c('y','n','p.hat','cp low','cp high')) options(warn=0) return(out) } # Data entry y=c(x2,n2,x1,n1) Vaccinates First (order same but subscripts reversed) # data vector if(is.matrix(y)) y <- c(t(cbind(y[,1],apply(y,1,sum)))) # NOTE: the subscripts are reversed compared to the other functions x2 <- y[1] n2 <- y[2] x1 <- y[3] n1 <- y[4] p1 <- x1/n1 p2 <- x2/n2 rho.mle <- p2/p1 # itemize all possible tables in omega (17.26) Y <- data.frame(y1=rep(0:n1,(n2+1)),y2=rep(0:n2,rep(n1+1,n2+1))) observed <- (1:nrow(Y))[Y[,1]==x1 & Y[,2]==x2] Y$C <- choose(n1,Y$y1)*choose(n2,Y$y2) # score statistic - with pi.tilde by quadratic formula scst <- function(rho,y1,n1,y2,n2){ pih1 <- y1/n1 # unrestricted MLE of current data pih2 <- y2/n2 if(y1==0 & y2==0) sc <- 0 else if(y2==n2) sc <- 0 else{ A <- rho*(n1+n2) B <- -(rho*(y1+n2) + y2 + n1) C <- y1+y2 pit1 <- (-B-sqrt(B^2-4*A*C))/(2*A) pit2 <- rho*pit1 sc <- (pih2-rho*pih1)/sqrt(rho^2*pit1*(1-pit1)/n1 + pit2*(1-pit2)/n2) } return(sc) } # get Clopper-Pearson intervals for Berger-Boos method cp <- binci(c(x1,x2),c(n1,n2),alpha=gamma)[,c('cp low','cp high')] L1 <- cp[1,1] U1 <- cp[1,2] L2 <- cp[2,1] U2 <- cp[2,2] r.min <- L2/U1 r.max <- U2/L1 if(rho.mle==0) low <- 0 else{ # search for lower endpoint iter <- 0 step <- stepstart low <- max(0.0001,r.min) # start above 0 (for quadratic formula) repeat{ iter <- iter + 1 if(iter > iter.max) break if(iter>1){ old.low <- low low <- low+step } scst.y <- rep(NA,nrow(Y)) for(i in 1:length(scst.y)) scst.y[i] <- scst(low,Y$y1[i],n1,Y$y2[i],n2) q.set <- Y[scst.y>=scst.y[observed],] q.set$n1y1 <- n1-q.set$y1 q.set$n2y2 <- n2-q.set$y2 if(gamma > 0) pn <- seq(max(L1,L2/low),min(U1,U2/low),length=nuisance.points) # Berger-Boos method 17.164 else pn <- seq(0,min(1/low,1),length=nuisance.points) # simple method 17.138 if(sum(pn>1)>0){ cat('\nIteration', iter, 'nuisance parameter outside parameter space\n') next } fy <- rep(NA,nuisance.points) for(i in 1:nuisance.points){ pni <- pn[i] fy[i] <- sum(q.set$C * pni^q.set$y1 * (1-pni)^q.set$n1y1 * (low*pni)^q.set$y2 * (1-low*pni)^q.set$n2y2) } max.fy <- max(fy) if(trace.it) cat('\nIteration',iter,'rho.low',low,'tail',max.fy,'\n') if(abs(max.fy-(alpha/2 - gamma/2)) < converge) break if(max.fy > (alpha/2 - gamma/2)){ step <- step/2 low <- low-step*2 } } # end repeat } # end else # search for upper endpoint upward from just below asymptotic # rather than downward from r.max # get asymptotic interval for starting ci.asymp <- .rr.score.asymp(c(x2,n2,x1,n1)) # koopman version (slightly narrower interval than mn) high <- ci.asymp[3]*.9 iter <- 0 step <- stepstart repeat{ iter <- iter + 1 if(iter > iter.max) break if(iter>1){ old.high <- high high <- high+step } scst.y <- rep(NA,nrow(Y)) for(i in 1:length(scst.y)) scst.y[i] <- scst(high,Y$y1[i],n1,Y$y2[i],n2) p.set <- Y[scst.y<=scst.y[observed],] p.set$n1y1 <- n1-p.set$y1 p.set$n2y2 <- n2-p.set$y2 if(gamma > 0) pn <- seq(max(L1,L2/high),min(U1,U2/high),length=nuisance.points) # Berger-Boos method 17.164 else pn <- seq(0,min(1/high,1),length=nuisance.points) # simple method 17.138 if(sum(pn>1)>0){ cat('\nIteration', iter, 'nuisance parameter outside parameter space\n') next } fy <- rep(NA,nuisance.points) for(i in 1:nuisance.points){ pni <- pn[i] fy[i] <- sum(p.set$C * pni^p.set$y1 * (1-pni)^p.set$n1y1 * (high*pni)^p.set$y2 * (1-high*pni)^p.set$n2y2) } max.fy <- max(fy) if(trace.it) cat('\nIteration',iter,'rho.high',high,'tail',max.fy,'\n') if(abs(max.fy-(alpha/2 - gamma/2)) < converge) break if(max.fy < (alpha/2 - gamma/2)){ step <- step/2 high <- high-step*2 } } # end repeat int <- c(rho.hat=rho.mle,low=low,high=high) if(!pf) names(int) <- c("RR", "LL", "UL") else{ int <- 1 - int[c(1,3,2)] names(int) <- c("PF", "LL", "UL") } return(rr1$new(estimate = int, estimator = ifelse(pf, 'PF', 'RR'), y = as.matrix(y), rnd = rnd, alpha = alpha)) # out <- list(estimate = int, estimator = ifelse(pf, 'PF', 'RR'), y = y, rnd = rnd, alpha = alpha) # class(out) <- 'rr1' # return(out) } #------------------------------------------------------- # Asymptotic score interval #------------------------------------------------------- ## #' Internal function. #' #' @usage .rr.score.asymp(y) #' @param y data #' @export #' @examples #' # none .rr.score.asymp <- function(y, alpha = 0.05, iter.max = 18., converge = 0.0001, mn=F){ # asymptotic score interval # code taken from RRsc() # choice of either Koopman (mn=F) # or Miettinenen-Nurminen (mn=T) # Data entry y=c(x2,n2,x1,n1) Vaccinates First u.p <- function(p1, p2, n1, n2) (1. - p1)/(n1 * p1) + (1. - p2)/(n2 * p2) z.phi <- function(phi, x1, x2, n1, n2, u.p, root, za, MN = F) { if(MN) mn <- sqrt((n1 + n2 - 1.)/(n1 + n2)) else mn <- 1. p2 <- root(x1, x2, n1, n2, phi) p1 <- p2 * phi u <- u.p(p1, p2, n1, n2) z <- ((x1 - n1 * p1)/(1. - p1)) * sqrt(u) * mn return(z) } root <- function(x1, x2, n1, n2, phi){ a <- phi * (n1 + n2) b <- - (phi * (x2 + n1) + x1 + n2) cc <- x1 + x2 det <- sqrt(b^2. - 4. * a * cc) rt <- ( - b - det)/(2. * a) return(rt) } al2 <- alpha/2. z.al2 <- qnorm(al2) z.ah2 <- qnorm(1. - al2) zv <- c(z.al2, z.ah2) x1 <- y[1.] n1 <- y[2.] x2 <- y[3.] n2 <- y[4.] p1 <- x1/n1 p2 <- x2/n2 p1 <- x1/n1 phi.mle <- p1/p2 # 0.5 log method p1 <- (x1 + 0.5)/(n1 + 0.5) p2 <- (x2 + 0.5)/(n2 + 0.5) phi <- p1/p2 v <- sqrt(u.p(p1, p2, (n1 + 0.5), (n2 + 0.5))) starting <- exp(v * zv + logb(phi)) # Score method score <- rep(0., length(zv)) for(k in 1.:length(zv)) { if(k == 1. & x1 == 0.) score[k] <- 0. else if(k == 2. & x2 == 0.) score[k] <- Inf else { phi <- c(starting[k], 0.9 * starting[k]) za <- -zv[k] zz <- c(z.phi(phi[1.], x1, x2, n1, n2, u.p, root, za, mn), z.phi(phi[2.], x1, x2, n1, n2, u.p, root, za, mn)) if(abs(za - zz[1.]) > abs(za - zz[2.])) phi <- rev(phi) phi.new <- phi[1.] phi.old <- phi[2.] # cat("\n\n") iter <- 0. repeat { iter <- iter + 1. if(iter > iter.max) break z.new <- z.phi(phi.new, x1, x2, n1, n2, u.p, root, za, mn) # cat("iteration", iter, " z", z.new, "phi", phi.new, "\n") if(abs(za - z.new) < converge) break z.old <- z.phi(phi.old, x1, x2, n1, n2, u.p, root, za, mn) phi <- exp(logb(phi.old) + logb(phi.new/phi.old) * ((za - z.old)/(z.new - z.old))) phi.old <- phi.new phi.new <- phi } score[k] <- phi.new } } int <- c(phi.mle,score) # cat("\n\n") names(int) <- c('point','LL','UL') return(int) } #------------------------------------------------------ # End asymptotic score method #------------------------------------------------------ # .rr.score.asymp(c(0,18,16,19),mn=F) # .rr.score.asymp(c(0,18,16,19),mn=T)
############################################################### # 2015 csv file for january to november ############################################################### file <- read_csv("inst/extdata/jan-nov2015.csv", skip = 5, col_names = c("Date", "Time", "PM2.5_Delhi", "PM2.5_Chennai", "PM2.5_Kolkata", "PM2.5_Mumbai", "PM2.5_Hyderabad"), col_types = "ccnnnnn", na = c("", "NA", "NoData", "-999", "---", "InVld", "PwrFail")) which24 <- which(grepl("24:00 AM", file$Date)) file <- file %>% mutate(Time = ifelse(grepl("24:00 AM", Date), "12:00 AM", Time)) %>% mutate(Date = dmy(gsub(" 24:00 AM", "", Date))) file$Date[which24] <- file$Date[which24] + days(1) file <- file %>% filter(!is.na(Date)) %>% mutate(datetime = paste(as.character(Date), Time)) %>% mutate(datetime = parse_date_time(datetime, "%Y-%m-%d I:M p", tz = "Asia/Kolkata")) %>% select(datetime, everything()) %>% select(- Date, - Time) data_us <- bind_rows(data_us, file) ############################################################### # 2015 file for december is a pdf, yikee ############################################################### # f <- "inst/extdata/jan-dec_2015.pdf" # out1 <- extract_tables(f) # save(out1, file = "inst/extdata/us_data.RData") load("inst/extdata/us_data.RData") # apply said functions all_pm <- bind_rows(lapply(out1, transform_tableau)) names(all_pm) <- "name" # now separate all_pm <- all_pm %>% separate(col = name, sep = ",", into = c("PM2.5_Chennai", "PM2.5_Kolkata", "PM2.5_Hyderabad", "PM2.5_Mumbai", "PM2.5_Delhi")) all_pm <- all_pm %>% mutate(PM2.5_Chennai = as.numeric(PM2.5_Chennai), PM2.5_Kolkata = as.numeric(PM2.5_Kolkata), PM2.5_Hyderabad = as.numeric(PM2.5_Hyderabad), PM2.5_Mumbai = as.numeric(PM2.5_Mumbai), PM2.5_Delhi = as.numeric(PM2.5_Delhi)) # now find the corresponding times # not that easy since part of the pdf is unreadable times_us <- bind_rows(lapply(out1, horaire_tableau)) names(times_us) <- "datetime" times_us <- times_us %>% mutate(datetime = as.POSIXct(datetime, origin = "1970-01-01", tz = "Asia/Kolkata")) all_pm <- cbind(all_pm, times_us) names(all_pm)[6] <- "datetime" first_interesting <- max(which(month(all_pm$datetime) == 11))+2 all_pm <- all_pm[first_interesting:nrow(all_pm),] all_pm$datetime <- seq(from = ymd_hms("2015-12-01 01:00:00", tz = "Asia/Kolkata"), to = ymd_hms("2016-01-01 00:00:00", tz = "Asia/Kolkata"), by = "1 hour") data_us <- bind_rows(data_us, all_pm) rm(out1) rm(all_pm)
/inst/pm25_consulate_2015.R
no_license
dshen1/usaqmindia
R
false
false
3,101
r
############################################################### # 2015 csv file for january to november ############################################################### file <- read_csv("inst/extdata/jan-nov2015.csv", skip = 5, col_names = c("Date", "Time", "PM2.5_Delhi", "PM2.5_Chennai", "PM2.5_Kolkata", "PM2.5_Mumbai", "PM2.5_Hyderabad"), col_types = "ccnnnnn", na = c("", "NA", "NoData", "-999", "---", "InVld", "PwrFail")) which24 <- which(grepl("24:00 AM", file$Date)) file <- file %>% mutate(Time = ifelse(grepl("24:00 AM", Date), "12:00 AM", Time)) %>% mutate(Date = dmy(gsub(" 24:00 AM", "", Date))) file$Date[which24] <- file$Date[which24] + days(1) file <- file %>% filter(!is.na(Date)) %>% mutate(datetime = paste(as.character(Date), Time)) %>% mutate(datetime = parse_date_time(datetime, "%Y-%m-%d I:M p", tz = "Asia/Kolkata")) %>% select(datetime, everything()) %>% select(- Date, - Time) data_us <- bind_rows(data_us, file) ############################################################### # 2015 file for december is a pdf, yikee ############################################################### # f <- "inst/extdata/jan-dec_2015.pdf" # out1 <- extract_tables(f) # save(out1, file = "inst/extdata/us_data.RData") load("inst/extdata/us_data.RData") # apply said functions all_pm <- bind_rows(lapply(out1, transform_tableau)) names(all_pm) <- "name" # now separate all_pm <- all_pm %>% separate(col = name, sep = ",", into = c("PM2.5_Chennai", "PM2.5_Kolkata", "PM2.5_Hyderabad", "PM2.5_Mumbai", "PM2.5_Delhi")) all_pm <- all_pm %>% mutate(PM2.5_Chennai = as.numeric(PM2.5_Chennai), PM2.5_Kolkata = as.numeric(PM2.5_Kolkata), PM2.5_Hyderabad = as.numeric(PM2.5_Hyderabad), PM2.5_Mumbai = as.numeric(PM2.5_Mumbai), PM2.5_Delhi = as.numeric(PM2.5_Delhi)) # now find the corresponding times # not that easy since part of the pdf is unreadable times_us <- bind_rows(lapply(out1, horaire_tableau)) names(times_us) <- "datetime" times_us <- times_us %>% mutate(datetime = as.POSIXct(datetime, origin = "1970-01-01", tz = "Asia/Kolkata")) all_pm <- cbind(all_pm, times_us) names(all_pm)[6] <- "datetime" first_interesting <- max(which(month(all_pm$datetime) == 11))+2 all_pm <- all_pm[first_interesting:nrow(all_pm),] all_pm$datetime <- seq(from = ymd_hms("2015-12-01 01:00:00", tz = "Asia/Kolkata"), to = ymd_hms("2016-01-01 00:00:00", tz = "Asia/Kolkata"), by = "1 hour") data_us <- bind_rows(data_us, all_pm) rm(out1) rm(all_pm)
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/play_by_play.R \name{win_probability} \alias{win_probability} \title{NBA games win probabilities} \usage{ win_probability( game_ids = c(21700002, 21700003), nest_data = FALSE, filter_non_plays = FALSE, return_message = TRUE ) } \arguments{ \item{game_ids}{vector of game ids} \item{nest_data}{if \code{TRUE} nests data} \item{filter_non_plays}{if \code{TRUE} filters out non plays} \item{return_message}{if \code{T} returns message} } \value{ a \code{tibble} a `tibble` } \description{ Gets nba in-game win probabilities for specified game ids } \examples{ win_probability(game_ids = c(21700002, 21700005), filter_non_plays = T, nest_data = FALSE, return_message = TRUE) } \seealso{ Other game: \code{\link{box_scores}()}, \code{\link{fanduel_summary}()}, \code{\link{game_logs}()} Other season: \code{\link{fanduel_summary}()} } \concept{game} \concept{season}
/man/win_probability.Rd
no_license
abresler/nbastatR
R
false
true
955
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/play_by_play.R \name{win_probability} \alias{win_probability} \title{NBA games win probabilities} \usage{ win_probability( game_ids = c(21700002, 21700003), nest_data = FALSE, filter_non_plays = FALSE, return_message = TRUE ) } \arguments{ \item{game_ids}{vector of game ids} \item{nest_data}{if \code{TRUE} nests data} \item{filter_non_plays}{if \code{TRUE} filters out non plays} \item{return_message}{if \code{T} returns message} } \value{ a \code{tibble} a `tibble` } \description{ Gets nba in-game win probabilities for specified game ids } \examples{ win_probability(game_ids = c(21700002, 21700005), filter_non_plays = T, nest_data = FALSE, return_message = TRUE) } \seealso{ Other game: \code{\link{box_scores}()}, \code{\link{fanduel_summary}()}, \code{\link{game_logs}()} Other season: \code{\link{fanduel_summary}()} } \concept{game} \concept{season}
args = commandArgs(trailingOnly=T) #args = c("/well/ukbiobank/expt/V2_QCed.SNP-QC/src/V2_QCed.snpqc-tests.R","/well/ukbiobank/expt/V2_QCed.SNP-QC/src/V2_QCed.bin2clusterplots.R","/well/ukbiobank/qcoutput.V2_QCed.sample-QC-testing/QC-Scripts/R/scripts/readPSperformance.R","/well/ukbiobank/qcoutput.V2_QCed.sample-QC-testing/QC-Scripts/R/scripts/auxFunctions.R", #"-in","b1__b11-b001__b095-autosome-sampleqc-fastpca-highquality-init1","-threshold","0.003") print(args) h = args[-c(which(args%in%c("-in","-threshold")),1+which(args%in%c("-in","-threshold")))] for(helperScript in h){ source(helperScript) } OutputFile = args[which(args=="-in")+1] threshold = as.numeric(args[which(args=="-threshold")+1]) SnpLoads = paste0(baseSampleQCDir,'/data/PCA/',OutputFile,'.snpload.map') loads = dplyr::tbl_df(read.table(SnpLoads,header=F,stringsAsFactors=F)) # look at the first 5 PCs # standard-deviations are very similar, 0.00298768 # what about the distributions? system(paste0('mkdir plots')) for(pc in 1:5){ png(paste0('plots/',OutputFile,'-PC',pc,'-loads-hist-%02d.png'),width=1500,height=1500,res=150) hist(loads[[pc + 7]],breaks=1000,xlab=paste0('PC ',pc),main=paste0("SNP-loads PC ", pc,"\nVertical lines shown at ",-threshold," and ",threshold)) # abline(v=mean(loads[[pc + 7]]),col="red") abline(v=c(-threshold,threshold),col="red") hist(abs(loads[[pc + 7]]),breaks=1000,xlab=paste0('PC ',pc),main=paste0("Absolute value SNP-loads PC ", pc)) # abline(v=mean(loads[[pc + 7]]),col="red") abline(v=c(threshold),col="red") dev.off() } # select a set of SNPs for(threshold in c(seq(0.003,0.004,by=0.0005),seq(0.005,0.01,by=0.001)) ){ print(threshold) pc1 = abs(loads[[8]]) > threshold pc2 = abs(loads[[9]]) > threshold pc3 = abs(loads[[10]]) > threshold pc4 = abs(loads[[11]]) > threshold hi = pc1 + pc2 + pc3 exc = sum(hi>0) # extreme in at least one inc = sum(hi==0) print(paste0(exc," SNPs will be in the exclusion list. That leaves ",inc," remaining, out of ",nrow(loads))) # 1-4: 34,364 SNPs left. # 1-3: 50,959 SNPs left. ~ 40 % # 1-2: 63,835 SNPs left. # 1: 81,370 SNPs left. ## NOTE: all are left with around 80,000 SNPs using 0.003 threshold # exclude remaining SNPs, plus SNPs in LD excludeSNPs = loads$V2[hi>0] keepSNPs = loads$V2[hi==0] # save list of SNPs write.table(excludeSNPs,file=paste0(OutputFile,"-snpsToExcludePCs-",threshold,".txt"),quote=FALSE,row.names=FALSE,col.names=FALSE) write.table(keepSNPs,file=paste0(OutputFile,"-snpsToKeepPCs-",threshold,".txt"),quote=FALSE,row.names=FALSE,col.names=FALSE) } write.table(seq(0.003,0.01,by=0.001),paste0(OutputFile,"-snpsToKeepPCs-thresholds.txt"),quote=FALSE,row.names=FALSE,col.names=FALSE)
/QC-Scripts/PCA/pca-UKBio/filter-snps-for-king.R
no_license
cgbycroft/UK_biobank
R
false
false
3,016
r
args = commandArgs(trailingOnly=T) #args = c("/well/ukbiobank/expt/V2_QCed.SNP-QC/src/V2_QCed.snpqc-tests.R","/well/ukbiobank/expt/V2_QCed.SNP-QC/src/V2_QCed.bin2clusterplots.R","/well/ukbiobank/qcoutput.V2_QCed.sample-QC-testing/QC-Scripts/R/scripts/readPSperformance.R","/well/ukbiobank/qcoutput.V2_QCed.sample-QC-testing/QC-Scripts/R/scripts/auxFunctions.R", #"-in","b1__b11-b001__b095-autosome-sampleqc-fastpca-highquality-init1","-threshold","0.003") print(args) h = args[-c(which(args%in%c("-in","-threshold")),1+which(args%in%c("-in","-threshold")))] for(helperScript in h){ source(helperScript) } OutputFile = args[which(args=="-in")+1] threshold = as.numeric(args[which(args=="-threshold")+1]) SnpLoads = paste0(baseSampleQCDir,'/data/PCA/',OutputFile,'.snpload.map') loads = dplyr::tbl_df(read.table(SnpLoads,header=F,stringsAsFactors=F)) # look at the first 5 PCs # standard-deviations are very similar, 0.00298768 # what about the distributions? system(paste0('mkdir plots')) for(pc in 1:5){ png(paste0('plots/',OutputFile,'-PC',pc,'-loads-hist-%02d.png'),width=1500,height=1500,res=150) hist(loads[[pc + 7]],breaks=1000,xlab=paste0('PC ',pc),main=paste0("SNP-loads PC ", pc,"\nVertical lines shown at ",-threshold," and ",threshold)) # abline(v=mean(loads[[pc + 7]]),col="red") abline(v=c(-threshold,threshold),col="red") hist(abs(loads[[pc + 7]]),breaks=1000,xlab=paste0('PC ',pc),main=paste0("Absolute value SNP-loads PC ", pc)) # abline(v=mean(loads[[pc + 7]]),col="red") abline(v=c(threshold),col="red") dev.off() } # select a set of SNPs for(threshold in c(seq(0.003,0.004,by=0.0005),seq(0.005,0.01,by=0.001)) ){ print(threshold) pc1 = abs(loads[[8]]) > threshold pc2 = abs(loads[[9]]) > threshold pc3 = abs(loads[[10]]) > threshold pc4 = abs(loads[[11]]) > threshold hi = pc1 + pc2 + pc3 exc = sum(hi>0) # extreme in at least one inc = sum(hi==0) print(paste0(exc," SNPs will be in the exclusion list. That leaves ",inc," remaining, out of ",nrow(loads))) # 1-4: 34,364 SNPs left. # 1-3: 50,959 SNPs left. ~ 40 % # 1-2: 63,835 SNPs left. # 1: 81,370 SNPs left. ## NOTE: all are left with around 80,000 SNPs using 0.003 threshold # exclude remaining SNPs, plus SNPs in LD excludeSNPs = loads$V2[hi>0] keepSNPs = loads$V2[hi==0] # save list of SNPs write.table(excludeSNPs,file=paste0(OutputFile,"-snpsToExcludePCs-",threshold,".txt"),quote=FALSE,row.names=FALSE,col.names=FALSE) write.table(keepSNPs,file=paste0(OutputFile,"-snpsToKeepPCs-",threshold,".txt"),quote=FALSE,row.names=FALSE,col.names=FALSE) } write.table(seq(0.003,0.01,by=0.001),paste0(OutputFile,"-snpsToKeepPCs-thresholds.txt"),quote=FALSE,row.names=FALSE,col.names=FALSE)
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/dims.R \name{dims} \alias{dims} \title{Dimensions} \usage{ dims(x, ...) } \arguments{ \item{x}{An object.} \item{...}{Other arguments passed to methods.} } \value{ An integer vector of the dimensions. } \description{ Gets the dimensions of an object. } \details{ Unlike \code{base::dim()}, dims returns the length of an atomic vector. } \seealso{ \code{\link[base:dim]{base::dim()}} Other {dimensions}: \code{\link{ndims}()}, \code{\link{npdims}()}, \code{\link{pdims}()} } \concept{{dimensions}}
/man/dims.Rd
permissive
krlmlr/universals
R
false
true
578
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/dims.R \name{dims} \alias{dims} \title{Dimensions} \usage{ dims(x, ...) } \arguments{ \item{x}{An object.} \item{...}{Other arguments passed to methods.} } \value{ An integer vector of the dimensions. } \description{ Gets the dimensions of an object. } \details{ Unlike \code{base::dim()}, dims returns the length of an atomic vector. } \seealso{ \code{\link[base:dim]{base::dim()}} Other {dimensions}: \code{\link{ndims}()}, \code{\link{npdims}()}, \code{\link{pdims}()} } \concept{{dimensions}}
library(shiny) shinyApp( ui = fluidPage( #leave some spacing br(), sidebarLayout( sidebarPanel(), mainPanel( sliderInput("nrow", label = "Select rows", min = 1, max = 32, value = c(1, 5)), tableHTML_output("mytable")) ) ), server = function(input, output) { output$mytable <- render_tableHTML( tableHTML(mtcars[input$nrow[1]:input$nrow[2], ], theme = 'rshiny-blue') ) } )
/shiny_example.R
no_license
clemens-zauchner/tableHTML_Vienna_R
R
false
false
468
r
library(shiny) shinyApp( ui = fluidPage( #leave some spacing br(), sidebarLayout( sidebarPanel(), mainPanel( sliderInput("nrow", label = "Select rows", min = 1, max = 32, value = c(1, 5)), tableHTML_output("mytable")) ) ), server = function(input, output) { output$mytable <- render_tableHTML( tableHTML(mtcars[input$nrow[1]:input$nrow[2], ], theme = 'rshiny-blue') ) } )
\name{DiffMat_forward} \alias{DiffMat_forward} %- Also NEED an '\alias' for EACH other topic documented here. \title{ Diffusion matrix building } \description{ Internal function that builds the discretized diffusion matrix of the FPK process going forward in time (for simulations) } \usage{ DiffMat_forward(V) } \arguments{ \item{V}{ A vector giving the values of the evolutionary potential (V) at each point in the gridded trait interval. } } \author{ F.C. Boucher }
/man/DiffMat_forward.Rd
no_license
cran/BBMV
R
false
false
471
rd
\name{DiffMat_forward} \alias{DiffMat_forward} %- Also NEED an '\alias' for EACH other topic documented here. \title{ Diffusion matrix building } \description{ Internal function that builds the discretized diffusion matrix of the FPK process going forward in time (for simulations) } \usage{ DiffMat_forward(V) } \arguments{ \item{V}{ A vector giving the values of the evolutionary potential (V) at each point in the gridded trait interval. } } \author{ F.C. Boucher }
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/EM_W_multi.R \docType{package} \name{Probabilistic-PLS} \alias{Probabilistic-PLS} \alias{Probabilistic-PLS-package} \title{PPLS: Probabilistic Partial Least Squares} \description{ This package implements the Partial Least Squares method in a probabilistic framework. } \section{Usage}{ Just do PPLS(Datamatrix_1,Datamatrix_2,nr_of_components) to have a quick and dirty fit, modify the default arguments if necessary. } \author{ Said el Bouhaddani (\email{s.el_bouhaddani@lumc.nl}), Jeanine Houwing-Duistermaat (\email{J.J.Houwing@lumc.nl}), Geurt Jongbloed (\email{G.Jongbloed@tudelft.nl}), Szymon Kielbasa (\email{S.M.Kielbasa@lumc.nl}), Hae-Won Uh (\email{H.Uh@lumc.nl}). Maintainer: Said el Bouhaddani (\email{s.el_bouhaddani@lumc.nl}). } \keyword{Probabilistic-PLS}
/Package/PPLS/man/Probabilistic-PLS.Rd
no_license
selbouhaddani/PPLS
R
false
true
851
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/EM_W_multi.R \docType{package} \name{Probabilistic-PLS} \alias{Probabilistic-PLS} \alias{Probabilistic-PLS-package} \title{PPLS: Probabilistic Partial Least Squares} \description{ This package implements the Partial Least Squares method in a probabilistic framework. } \section{Usage}{ Just do PPLS(Datamatrix_1,Datamatrix_2,nr_of_components) to have a quick and dirty fit, modify the default arguments if necessary. } \author{ Said el Bouhaddani (\email{s.el_bouhaddani@lumc.nl}), Jeanine Houwing-Duistermaat (\email{J.J.Houwing@lumc.nl}), Geurt Jongbloed (\email{G.Jongbloed@tudelft.nl}), Szymon Kielbasa (\email{S.M.Kielbasa@lumc.nl}), Hae-Won Uh (\email{H.Uh@lumc.nl}). Maintainer: Said el Bouhaddani (\email{s.el_bouhaddani@lumc.nl}). } \keyword{Probabilistic-PLS}
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/PlotsSpatial.R \name{linearRatePlot} \alias{linearRatePlot} \title{Plot a linear rate histogram from a SpatialProperties1D object} \usage{ linearRatePlot(sp1, n = 1, outma = c(1, 1, 1, 0), margin = c(1.5, 2, 0.8, 0.3), axis.x.pos = 0, axis.y.pos = 0, axis.y.las = 2, mgp.x = c(0.5, 0.05, 0), mgp.y = c(0.8, 0.3, 0.2), xlab = "Position (cm)", ylab = "Rate (Hz)", xaxis.at = seq(0, 80, 20), yaxis.at = seq(0, 50, 10), ...) } \arguments{ \item{sp1}{SpatialProperties1d object} \item{n}{Index of the histogram in the sp1 object that you want to plot} \item{outma}{Outer margins of the figure} \item{margin}{Inner margins of the figure} \item{axis.x.pos}{position of x axis} \item{axis.y.pos}{position of y axis} \item{axis.y.las}{las of y axis} \item{mgp.x}{mgp for x axis} \item{mgp.y}{mgp for y axis} \item{xlab}{Name to display under the x axis} \item{ylab}{Name to display at the left of the y axis} \item{xaxis.at}{where to put the tics} \item{yaxis.at}{where to put the tics} \item{...}{passed to the plot function} } \description{ In development }
/man/linearRatePlot.Rd
no_license
kevin-allen/relectro
R
false
true
1,150
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/PlotsSpatial.R \name{linearRatePlot} \alias{linearRatePlot} \title{Plot a linear rate histogram from a SpatialProperties1D object} \usage{ linearRatePlot(sp1, n = 1, outma = c(1, 1, 1, 0), margin = c(1.5, 2, 0.8, 0.3), axis.x.pos = 0, axis.y.pos = 0, axis.y.las = 2, mgp.x = c(0.5, 0.05, 0), mgp.y = c(0.8, 0.3, 0.2), xlab = "Position (cm)", ylab = "Rate (Hz)", xaxis.at = seq(0, 80, 20), yaxis.at = seq(0, 50, 10), ...) } \arguments{ \item{sp1}{SpatialProperties1d object} \item{n}{Index of the histogram in the sp1 object that you want to plot} \item{outma}{Outer margins of the figure} \item{margin}{Inner margins of the figure} \item{axis.x.pos}{position of x axis} \item{axis.y.pos}{position of y axis} \item{axis.y.las}{las of y axis} \item{mgp.x}{mgp for x axis} \item{mgp.y}{mgp for y axis} \item{xlab}{Name to display under the x axis} \item{ylab}{Name to display at the left of the y axis} \item{xaxis.at}{where to put the tics} \item{yaxis.at}{where to put the tics} \item{...}{passed to the plot function} } \description{ In development }
#setwd(paste0(getwd(),"/rcourse_lesson5")) ## LOAD PACKAGES #### library(dplyr) library(purrr) ## READ IN DATA #### # Full data on election results data_election_results = list.files(path = "data/elections", full.names = T) %>% # Run read.table call on all files map(read.table, header = T, sep = "\t") %>% # Combine all data frames into a single data frame by row reduce(rbind) # Read in extra data about specific elections data_elections = read.table("data/rcourse_lesson5_data_elections.txt", header=T, sep="\t") # Read in extra data about specific states data_states = read.table("data/rcourse_lesson5_data_states.txt", header=T, sep="\t") # See how many states in union versus confederacy xtabs(~civil_war, data_states) ## CLEAN DATA #### # Make data set balanced for Union and Confederacy states data_states_clean = data_states %>% # Drop any data from states that were not in the US during the Civil War filter(!is.na(civil_war)) %>% # Drop any data besides the first 11 states in the Union or Confederacy based on date of US entry group_by(civil_war) %>% arrange(order_enter) %>% filter(row_number() <= 11) %>% ungroup() # Double check balanced for 'civil_war' variable xtabs(~civil_war, data_states_clean) # Combine three data frames data_clean = data_election_results %>% # Combine with election specific data inner_join(data_elections) %>% # Combine with state specific data inner_join(data_states_clean) %>% # Drop unused states mutate(state = factor(state)) # Double check independent variables are balanced xtabs(~incumbent_party+civil_war, data_clean)
/rcourse_lesson5/scripts/rcourse_lesson5_cleaning.R
no_license
pcava/R4Publication
R
false
false
1,613
r
#setwd(paste0(getwd(),"/rcourse_lesson5")) ## LOAD PACKAGES #### library(dplyr) library(purrr) ## READ IN DATA #### # Full data on election results data_election_results = list.files(path = "data/elections", full.names = T) %>% # Run read.table call on all files map(read.table, header = T, sep = "\t") %>% # Combine all data frames into a single data frame by row reduce(rbind) # Read in extra data about specific elections data_elections = read.table("data/rcourse_lesson5_data_elections.txt", header=T, sep="\t") # Read in extra data about specific states data_states = read.table("data/rcourse_lesson5_data_states.txt", header=T, sep="\t") # See how many states in union versus confederacy xtabs(~civil_war, data_states) ## CLEAN DATA #### # Make data set balanced for Union and Confederacy states data_states_clean = data_states %>% # Drop any data from states that were not in the US during the Civil War filter(!is.na(civil_war)) %>% # Drop any data besides the first 11 states in the Union or Confederacy based on date of US entry group_by(civil_war) %>% arrange(order_enter) %>% filter(row_number() <= 11) %>% ungroup() # Double check balanced for 'civil_war' variable xtabs(~civil_war, data_states_clean) # Combine three data frames data_clean = data_election_results %>% # Combine with election specific data inner_join(data_elections) %>% # Combine with state specific data inner_join(data_states_clean) %>% # Drop unused states mutate(state = factor(state)) # Double check independent variables are balanced xtabs(~incumbent_party+civil_war, data_clean)
pgfhypergeometric <- function(s,params) { require(hypergeo) k<-s[abs(s)>1] if (length(k)>0) warning("At least one element of the vector s are out of interval [-1,1]") if (length(params)<3) stop("At least one value in params is missing") if (length(params)>3) stop("The length of params is 3") m<-params[1] n<-params[2] p<-params[3] if (m<0) stop("Parameter m must be positive") if(!(abs(m-round(m))<.Machine$double.eps^0.5)) stop("Parameter m must be positive integer") if (n<0) stop("Parameter n must be positive") if(!(abs(n-round(n))<.Machine$double.eps^0.5)) stop("Parameter n must be positive integer") if ((p>=1)|(p<=0)) stop ("Parameter p belongs to the interval (0,1)") if (m<n) stop ("Parameter m is greater or equal then n ") Re(hypergeo(-n,-m*p,-m,1-s)) }
/Compounding/R/pgfhypergeometric.R
no_license
ingted/R-Examples
R
false
false
844
r
pgfhypergeometric <- function(s,params) { require(hypergeo) k<-s[abs(s)>1] if (length(k)>0) warning("At least one element of the vector s are out of interval [-1,1]") if (length(params)<3) stop("At least one value in params is missing") if (length(params)>3) stop("The length of params is 3") m<-params[1] n<-params[2] p<-params[3] if (m<0) stop("Parameter m must be positive") if(!(abs(m-round(m))<.Machine$double.eps^0.5)) stop("Parameter m must be positive integer") if (n<0) stop("Parameter n must be positive") if(!(abs(n-round(n))<.Machine$double.eps^0.5)) stop("Parameter n must be positive integer") if ((p>=1)|(p<=0)) stop ("Parameter p belongs to the interval (0,1)") if (m<n) stop ("Parameter m is greater or equal then n ") Re(hypergeo(-n,-m*p,-m,1-s)) }
# Exercise 3: writing and executing functions # Define a function `add_three` that takes a single argument and # returns a value 3 greater than the input add_three <- function(your_num){ return(your_num + 3) } add_three(3) # Create a variable `ten` that is the result of passing 7 to your `add_three` # function # Define a function `imperial_to_metric` that takes in two arguments: a number # of feet and a number of inches # The function should return the equivalent length in meters imperial_to_metric <- function(feet, inches){ return(paste(feet*0.3048 + inches*0.0254, "meters")) } imperial_to_metric(5, 6) # Create a variable `height_in_meters` by passing your height in imperial to the # `imperial_to_metric` function height_in_meters <- imperial_to_metric(5, 6)
/chapter-06-exercises/exercise-3/exercise.R
no_license
cpz-baron/INFO201-Week-2
R
false
false
806
r
# Exercise 3: writing and executing functions # Define a function `add_three` that takes a single argument and # returns a value 3 greater than the input add_three <- function(your_num){ return(your_num + 3) } add_three(3) # Create a variable `ten` that is the result of passing 7 to your `add_three` # function # Define a function `imperial_to_metric` that takes in two arguments: a number # of feet and a number of inches # The function should return the equivalent length in meters imperial_to_metric <- function(feet, inches){ return(paste(feet*0.3048 + inches*0.0254, "meters")) } imperial_to_metric(5, 6) # Create a variable `height_in_meters` by passing your height in imperial to the # `imperial_to_metric` function height_in_meters <- imperial_to_metric(5, 6)
# Compare model implementation in manuscript with alternate model implementations library("plyr") library("magrittr") library("tidyr") library("xtable") library("ggplot2") library("dplyr") library("RColorBrewer") library(cowplot) # Models to compare ------------------------------------------------------------ models <- c("MK_F_RNminus","MK_P_RNminus","MK_U_RNminus","MK_FM_RNminus", "MK_F_RNplus","MK_P_RNplus","MK_U_RNplus","MK_FM_RNplus", "MK_P2_RNminus","MK_U2_RNminus","MK_FM2_RNminus", "MK_P2_RNplus","MK_U2_RNplus","MK_FM2_RNplus") # Load Fits -------------------------------------------------------------------- FittedFull <- readRDS("Fits/FitFull.rds") %>% filter(model %in% models) # Identify best fit ------------------------------------------------------------ BestFull <- FittedFull %>% group_by(model,cvid) %>% filter(Dev == min(Dev, na.rm = TRUE)) %>% #finds best fit of 20 runs arrange(cvid) %>% distinct() %>% group_by(cvid) %>% mutate(delLL = LL - min(LL), delDev = Dev - min(Dev), delAIC = AIC - min(AIC)) %>% group_by(model) ## globally determines order of bars in graphs modelsinorder <- BestFull %>% group_by(model) %>% summarize(means = mean(AIC)) %>% arrange(-means) %>% .$model BestFull$model <- factor(BestFull$model,levels = modelsinorder) # Manuscript-style graph ------------------------------------------------------- ## Fitted Full AICmeans <- BestFull %>% group_by(model) %>% summarize(means = mean(AIC)) %>% arrange(means) #sum all aics AICtot <- BestFull %>% group_by(cvid,model) %>% mutate(deltaAIC = AIC - AICmeans %>% slice(1) %>% .$means) %>% group_by(model) %>% summarize(mdeltaAIC = mean(deltaAIC)) %>% mutate(mdeltaAICadj = ifelse(mdeltaAIC > 20,20,mdeltaAIC)) %>% arrange(model) allAIC <- ggplot(AICtot,aes(y = mdeltaAICadj,x = model,fill = mdeltaAIC)) + geom_rect(aes(xmin=0, xmax=14.5, ymin=0, ymax=1), fill = "grey") + geom_bar(stat = "identity") + coord_flip(ylim = c(0,20)) + scale_fill_gradientn(name = expression(paste(Delta," AIC")), colors = rev(brewer.pal(n = 9, name = "YlOrRd")), limits=c(0,20))+ scale_y_continuous(name = expression(paste(Delta," AIC")), breaks = seq(0,20,2), labels = c(seq(0,18,2),"...")) + scale_x_discrete(name = "Model", labels = c( expression(paste("VP(",kappa,")U2-")), expression(paste("VP(",kappa,")U-")), expression(paste("VP(",kappa,")P-")), expression(paste("VP(",kappa,")P2-")), expression(paste("VP(",kappa,")F3+")), expression(paste("VP(",kappa,")F2+")), expression(paste("VP(",kappa,")F+")), expression(paste("VP(",kappa,")F2-")), expression(paste("VP(",kappa,")F-")), expression(paste("VP(",kappa,")F3-")), expression(paste("VP(",kappa,")U2+")), expression(paste("VP(",kappa,")P+")), expression(paste("VP(",kappa,")U+")), expression(paste("VP(",kappa,")P2+")) )) + theme(axis.text.x = element_text(size=12), axis.text.y = element_text(size=12), axis.title = element_text(size=12), legend.text = element_text(size = 12), axis.ticks.y = element_blank(), panel.background = element_rect(fill = "white"), legend.position = c(0.7,0.7), panel.border = element_rect(colour = "black", fill = "transparent"), strip.background = element_rect(fill = "white"), strip.text.x = element_text(size=12), strip.placement = "outside", strip.text = element_text(size=12)) # Split by individual differences ---------------------------------------------- Refcompare <- BestFull %>% mutate(modeltype = case_when(model %in% c("MK_FM_RNminus", "MK_F_RNminus") ~ "F-", model %in% c("MK_FM_RNplus","MK_F_RNplus") ~ "F+", model %in% c("MK_FM2_RNplus") ~ "FM+", model %in% c("MK_FM2_RNminus") ~ "FM-", model %in% c("MK_P_RNplus","MK_P2_RNplus") ~ "P+", model %in% c("MK_U_RNplus","MK_U2_RNplus") ~ "U+", model %in% c("MK_P_RNminus","MK_P2_RNminus") ~ "P-", model %in% c("MK_U_RNminus","MK_U2_RNminus") ~ "U-")) %>% mutate(reference = case_when(model %in% c("MK_FM_RNminus","MK_P_RNminus", "MK_U_RNminus","MK_FM_RNplus", "MK_P_RNplus","MK_U_RNplus") ~ "aRef", TRUE ~ "bAlt")) RefFp <- Refcompare %>% filter(model %in% c("MK_FM_RNplus")) %>% mutate(modeltype = "FM+") RefFm <- Refcompare %>% filter(model %in% c("MK_FM_RNminus")) %>% mutate(modeltype = "FM-") Refcompare <- bind_rows(Refcompare,RefFp,RefFm) %>% mutate(modeltype = factor(modeltype, levels = c("F-","F+","FM-","FM+", "P-","P+","U-","U+"), labels = c("F2- - F-", "F2+ - F+", "F3- - F-", "F3+ - F+", "P2- - P-", "P2+ - P+", "U2- - U-", "U2+ - U+"))) Allmodels <- Refcompare %>% group_by(modeltype,exp,cvid) %>% arrange(modeltype,reference) %>% summarize(diffs = diff(AIC)) Refcomp <- ggplot(data = Allmodels, aes(x = cvid, y = diffs, colour = exp)) + scale_y_continuous(limits=c(-50,50), name=expression(paste(Delta, "AIC (alternative model - reference model)"))) + geom_point() + facet_wrap(.~modeltype, nrow=4) + theme(axis.text.x = element_blank(), axis.ticks.x = element_blank(), axis.text.y = element_text(size=12), axis.title.y = element_text(size=12), axis.title.x = element_blank(), legend.text = element_text(size = 12), axis.ticks.y = element_blank(), panel.background = element_rect(fill = "white"), legend.key = element_rect(fill="transparent"), legend.title = element_blank(), panel.border = element_rect(colour = "black", fill = "transparent"), strip.background = element_rect(fill = "white"), strip.text.x = element_text(size=12), strip.placement = "outside", strip.text = element_text(size=12)) plot_grid(allAIC,Refcomp,nrow=1,rel_widths=c(1,2)) #ggsave("VP_modelvariants.png", units="cm", width=35, height=20, dpi=600)
/Compare_modelvariants.R
no_license
nklange/InferenceModelComparison
R
false
false
6,599
r
# Compare model implementation in manuscript with alternate model implementations library("plyr") library("magrittr") library("tidyr") library("xtable") library("ggplot2") library("dplyr") library("RColorBrewer") library(cowplot) # Models to compare ------------------------------------------------------------ models <- c("MK_F_RNminus","MK_P_RNminus","MK_U_RNminus","MK_FM_RNminus", "MK_F_RNplus","MK_P_RNplus","MK_U_RNplus","MK_FM_RNplus", "MK_P2_RNminus","MK_U2_RNminus","MK_FM2_RNminus", "MK_P2_RNplus","MK_U2_RNplus","MK_FM2_RNplus") # Load Fits -------------------------------------------------------------------- FittedFull <- readRDS("Fits/FitFull.rds") %>% filter(model %in% models) # Identify best fit ------------------------------------------------------------ BestFull <- FittedFull %>% group_by(model,cvid) %>% filter(Dev == min(Dev, na.rm = TRUE)) %>% #finds best fit of 20 runs arrange(cvid) %>% distinct() %>% group_by(cvid) %>% mutate(delLL = LL - min(LL), delDev = Dev - min(Dev), delAIC = AIC - min(AIC)) %>% group_by(model) ## globally determines order of bars in graphs modelsinorder <- BestFull %>% group_by(model) %>% summarize(means = mean(AIC)) %>% arrange(-means) %>% .$model BestFull$model <- factor(BestFull$model,levels = modelsinorder) # Manuscript-style graph ------------------------------------------------------- ## Fitted Full AICmeans <- BestFull %>% group_by(model) %>% summarize(means = mean(AIC)) %>% arrange(means) #sum all aics AICtot <- BestFull %>% group_by(cvid,model) %>% mutate(deltaAIC = AIC - AICmeans %>% slice(1) %>% .$means) %>% group_by(model) %>% summarize(mdeltaAIC = mean(deltaAIC)) %>% mutate(mdeltaAICadj = ifelse(mdeltaAIC > 20,20,mdeltaAIC)) %>% arrange(model) allAIC <- ggplot(AICtot,aes(y = mdeltaAICadj,x = model,fill = mdeltaAIC)) + geom_rect(aes(xmin=0, xmax=14.5, ymin=0, ymax=1), fill = "grey") + geom_bar(stat = "identity") + coord_flip(ylim = c(0,20)) + scale_fill_gradientn(name = expression(paste(Delta," AIC")), colors = rev(brewer.pal(n = 9, name = "YlOrRd")), limits=c(0,20))+ scale_y_continuous(name = expression(paste(Delta," AIC")), breaks = seq(0,20,2), labels = c(seq(0,18,2),"...")) + scale_x_discrete(name = "Model", labels = c( expression(paste("VP(",kappa,")U2-")), expression(paste("VP(",kappa,")U-")), expression(paste("VP(",kappa,")P-")), expression(paste("VP(",kappa,")P2-")), expression(paste("VP(",kappa,")F3+")), expression(paste("VP(",kappa,")F2+")), expression(paste("VP(",kappa,")F+")), expression(paste("VP(",kappa,")F2-")), expression(paste("VP(",kappa,")F-")), expression(paste("VP(",kappa,")F3-")), expression(paste("VP(",kappa,")U2+")), expression(paste("VP(",kappa,")P+")), expression(paste("VP(",kappa,")U+")), expression(paste("VP(",kappa,")P2+")) )) + theme(axis.text.x = element_text(size=12), axis.text.y = element_text(size=12), axis.title = element_text(size=12), legend.text = element_text(size = 12), axis.ticks.y = element_blank(), panel.background = element_rect(fill = "white"), legend.position = c(0.7,0.7), panel.border = element_rect(colour = "black", fill = "transparent"), strip.background = element_rect(fill = "white"), strip.text.x = element_text(size=12), strip.placement = "outside", strip.text = element_text(size=12)) # Split by individual differences ---------------------------------------------- Refcompare <- BestFull %>% mutate(modeltype = case_when(model %in% c("MK_FM_RNminus", "MK_F_RNminus") ~ "F-", model %in% c("MK_FM_RNplus","MK_F_RNplus") ~ "F+", model %in% c("MK_FM2_RNplus") ~ "FM+", model %in% c("MK_FM2_RNminus") ~ "FM-", model %in% c("MK_P_RNplus","MK_P2_RNplus") ~ "P+", model %in% c("MK_U_RNplus","MK_U2_RNplus") ~ "U+", model %in% c("MK_P_RNminus","MK_P2_RNminus") ~ "P-", model %in% c("MK_U_RNminus","MK_U2_RNminus") ~ "U-")) %>% mutate(reference = case_when(model %in% c("MK_FM_RNminus","MK_P_RNminus", "MK_U_RNminus","MK_FM_RNplus", "MK_P_RNplus","MK_U_RNplus") ~ "aRef", TRUE ~ "bAlt")) RefFp <- Refcompare %>% filter(model %in% c("MK_FM_RNplus")) %>% mutate(modeltype = "FM+") RefFm <- Refcompare %>% filter(model %in% c("MK_FM_RNminus")) %>% mutate(modeltype = "FM-") Refcompare <- bind_rows(Refcompare,RefFp,RefFm) %>% mutate(modeltype = factor(modeltype, levels = c("F-","F+","FM-","FM+", "P-","P+","U-","U+"), labels = c("F2- - F-", "F2+ - F+", "F3- - F-", "F3+ - F+", "P2- - P-", "P2+ - P+", "U2- - U-", "U2+ - U+"))) Allmodels <- Refcompare %>% group_by(modeltype,exp,cvid) %>% arrange(modeltype,reference) %>% summarize(diffs = diff(AIC)) Refcomp <- ggplot(data = Allmodels, aes(x = cvid, y = diffs, colour = exp)) + scale_y_continuous(limits=c(-50,50), name=expression(paste(Delta, "AIC (alternative model - reference model)"))) + geom_point() + facet_wrap(.~modeltype, nrow=4) + theme(axis.text.x = element_blank(), axis.ticks.x = element_blank(), axis.text.y = element_text(size=12), axis.title.y = element_text(size=12), axis.title.x = element_blank(), legend.text = element_text(size = 12), axis.ticks.y = element_blank(), panel.background = element_rect(fill = "white"), legend.key = element_rect(fill="transparent"), legend.title = element_blank(), panel.border = element_rect(colour = "black", fill = "transparent"), strip.background = element_rect(fill = "white"), strip.text.x = element_text(size=12), strip.placement = "outside", strip.text = element_text(size=12)) plot_grid(allAIC,Refcomp,nrow=1,rel_widths=c(1,2)) #ggsave("VP_modelvariants.png", units="cm", width=35, height=20, dpi=600)
#' View table and attributes #' #' Displays the table and attributes of the object. #' #' @param pt A `pivot_table` object. #' #' @return A `pivot_table` object. #' #' @family pivot table definition functions #' @seealso #' #' @export view_table_attr <- function(pt) { UseMethod("view_table_attr") } #' @rdname view_table_attr #' @export view_table_attr.pivot_table <- function(pt) { if (ncol(pt) > 0) { utils::View(pt) } else { utils::View("") } if (length(attr(pt, "page")) > 0) { df <- data.frame(page = attr(pt, "page"), n_col_labels = "", n_row_labels = "", stringsAsFactors = FALSE) df[1, "n_col_labels"] <- attr(pt, "n_col_labels") df[1, "n_row_labels"] <- attr(pt, "n_row_labels") utils::View(df) } else { utils::View("") } invisible(pt) }
/R/pivot_table_view_table_attr.R
no_license
cran/flattabler
R
false
false
827
r
#' View table and attributes #' #' Displays the table and attributes of the object. #' #' @param pt A `pivot_table` object. #' #' @return A `pivot_table` object. #' #' @family pivot table definition functions #' @seealso #' #' @export view_table_attr <- function(pt) { UseMethod("view_table_attr") } #' @rdname view_table_attr #' @export view_table_attr.pivot_table <- function(pt) { if (ncol(pt) > 0) { utils::View(pt) } else { utils::View("") } if (length(attr(pt, "page")) > 0) { df <- data.frame(page = attr(pt, "page"), n_col_labels = "", n_row_labels = "", stringsAsFactors = FALSE) df[1, "n_col_labels"] <- attr(pt, "n_col_labels") df[1, "n_row_labels"] <- attr(pt, "n_row_labels") utils::View(df) } else { utils::View("") } invisible(pt) }
vertex.centrality.hits <- function(id='(all networks)',direction='out',arc_weight='(empty)',alpha='0',maximum_iterations='100',tolerance='0.001',allow_loops='false',filter='(empty)',cluster='(empty)',arc_set='(empty)',save_as='hits',save_to='None',debug='false'){ l <- as.list(match.call()) l2 <- list() for (i in names(l[-1])) { l2 <- c(l2, eval(dplyr::sym(i))) } names(l2) <- names(l[-1]) l3 <- c(l[1], l2) FNA::exec_command(FNA::check(l3)) }
/R/vertex.centrality.hits.R
no_license
lubospernis/FNA_package
R
false
false
470
r
vertex.centrality.hits <- function(id='(all networks)',direction='out',arc_weight='(empty)',alpha='0',maximum_iterations='100',tolerance='0.001',allow_loops='false',filter='(empty)',cluster='(empty)',arc_set='(empty)',save_as='hits',save_to='None',debug='false'){ l <- as.list(match.call()) l2 <- list() for (i in names(l[-1])) { l2 <- c(l2, eval(dplyr::sym(i))) } names(l2) <- names(l[-1]) l3 <- c(l[1], l2) FNA::exec_command(FNA::check(l3)) }
integrated_vars <- c( server_1 = Sys.getenv("TEST_SERVER_1"), key_1 = Sys.getenv("TEST_KEY_1"), server_2 = Sys.getenv("TEST_SERVER_2"), key_2 = Sys.getenv("TEST_KEY_2") ) health_checks <- list( server_1 = tryCatch(httr::content(httr::GET(paste0(integrated_vars[["server_1"]], "/__ping__"))), error = print), server_2 = tryCatch(httr::content(httr::GET(paste0(integrated_vars[["server_2"]], "/__ping__"))), error = print) ) # decide if integrated tests can run if ( all(nchar(integrated_vars) > 0) && all(as.logical(lapply(health_checks, function(x){length(x) == 0}))) ) { test_dir("integrated-tests") } else { context("integrated tests") test_that("all", { skip("test environment not set up properly") }) }
/tests/testthat/test-integrated.R
no_license
tbradley1013/connectapi
R
false
false
740
r
integrated_vars <- c( server_1 = Sys.getenv("TEST_SERVER_1"), key_1 = Sys.getenv("TEST_KEY_1"), server_2 = Sys.getenv("TEST_SERVER_2"), key_2 = Sys.getenv("TEST_KEY_2") ) health_checks <- list( server_1 = tryCatch(httr::content(httr::GET(paste0(integrated_vars[["server_1"]], "/__ping__"))), error = print), server_2 = tryCatch(httr::content(httr::GET(paste0(integrated_vars[["server_2"]], "/__ping__"))), error = print) ) # decide if integrated tests can run if ( all(nchar(integrated_vars) > 0) && all(as.logical(lapply(health_checks, function(x){length(x) == 0}))) ) { test_dir("integrated-tests") } else { context("integrated tests") test_that("all", { skip("test environment not set up properly") }) }
mtcars write.csv(mtcars, "mtcars.csv") library(margins) library(lme4) library(tidyverse) # 1: SAME x <- lm(mpg ~ cyl * hp + wt, data = mtcars) (m <- margins(x)) summary(m) plot(m) # 2: SAME x <- lm(mpg ~ cyl + hp * wt, data = mtcars) margins(x, at = list(cyl = mean(mtcars$cyl, na.rm = T))) # 3: SAME # stata: reg mpg cyl hp wt # margins, dydx(*) x <- lm(mpg ~ cyl + hp + carb, data = mtcars) margins(x) # 4: # stata: reg mpg cyl hp i.carb # margins, dydx(*) x <- lm(mpg ~ cyl + hp + as.factor(carb), data = mtcars) margins(x) # 5: # Stata: xtmixed mpg hp i.carb || cyl: # margins, dydx(*) mtcars$carb_factor <- as.factor(mtcars$carb) mtcars x <- lmer(mpg ~ hp + carb_factor + (1 | cyl), data = mtcars, REML = FALSE) mtcars_sub <- head(mtcars, 4) mtcars_sub <- mtcars_sub %>% select(mpg, hp, carb) x1 <- lm(mpg ~ hp + carb, data = mtcars_sub) summary(x1) m1 <- margins(x, type = "link") summary(m1) # 6: # Stata: margins, at(hp=(66 243.5)) m <- margins(x1, at = list(hp = c(66, 243.5))) print(m, digits = 10) coef(m)[1] summary(m, digits = 6) plot(m) plot(m1) (66 - mean(mtcars_sub$hp)) * (-.0824) margins_hp = -0.08235294118 low = 66 high = 243.5 mtcars_sub$predict_low = mtcars_sub$mpg + (low - mtcars_sub$hp) * (margins_hp) mtcars_sub$predict_high = mtcars_sub$mpg + (high - mtcars_sub$hp) * (margins_hp) mean(mtcars_sub$predict_low) mean(mtcars_sub$predict_high) # the Stata command gives a point prediction of the dependent variable whereas # the R command gives the average marginal effect, so to get the point # prediction you have to multiply it by the change in the variable of interest # and add that to the original point prediction!!!!!!! # FINAL SUB MODEL # Stata: xtmixed mpg wt i.carb || cyl: # R: t4 <- lmer(mpg ~ wt + as.factor(carb) + (1 | cyl), data = mtcars, REML = FALSE) # FINAL MODEL: # STATA: margins, at((mean) _all H_citytract_multi_i=(.23 .54)) ################################## regressions in R v. stata ###############################3 ## model 1: exactly the same # stata : reg mpg cyl hp wt t1 <- lm(mpg ~ cyl + hp + wt, data = mtcars) summary(t1) ## model 2: as.factor is the same thing as doing i. in stata!!!! # stata: reg mpg i.cyl hp wt t2 <- lm(mpg ~ as.factor(cyl) + hp + wt, data = mtcars) summary(t2) ## model 3: THIS IS THE SAME # stata: xtmixed mpg wt || geo_id2: t3 <- lmer(mpg ~ wt + (1 | cyl), data = mtcars, REML = FALSE) summary(t3) ## model 4: THIS IS THE SAME # stata: xtmixed mpg wt || cyl: t3 <- lmer(mpg ~ wt + (1 | cyl), data = mtcars, REML = FALSE) summary(t3) ## model 4: THIS IS THE SAME # stata xtmixed mpg wt i.carb || cyl: t4 <- lmer(mpg ~ wt + as.factor(carb) + (1 | cyl), data = mtcars, REML = FALSE) summary(t4) # FINAL MODEL: # xtmixed biggestsplit H_citytract_multi_i diversityinterp pctasianpopinterp # pctblkpopinterp pctlatinopopinterp medincinterp pctrentersinterp # pctcollegegradinterp biracial nonpartisan primary logpop i. year south midwest # west if winner==1||geo_id2: m1 <- lmer(biggestsplit ~ H_citytract_multi_i + diversityinterp + pctasianpopinterp + pctblkpopinterp + pctlatinopopinterp + medincinterp + pctrentersinterp + pctcollegegradinterp + biracial + nonpartisan + primary + logpop + year.f + south + midwest + west + (1 | geo_id2), data = rp_1, REML=FALSE)
/margins practice.R
no_license
mburzillo/old_version_final_project_2
R
false
false
3,408
r
mtcars write.csv(mtcars, "mtcars.csv") library(margins) library(lme4) library(tidyverse) # 1: SAME x <- lm(mpg ~ cyl * hp + wt, data = mtcars) (m <- margins(x)) summary(m) plot(m) # 2: SAME x <- lm(mpg ~ cyl + hp * wt, data = mtcars) margins(x, at = list(cyl = mean(mtcars$cyl, na.rm = T))) # 3: SAME # stata: reg mpg cyl hp wt # margins, dydx(*) x <- lm(mpg ~ cyl + hp + carb, data = mtcars) margins(x) # 4: # stata: reg mpg cyl hp i.carb # margins, dydx(*) x <- lm(mpg ~ cyl + hp + as.factor(carb), data = mtcars) margins(x) # 5: # Stata: xtmixed mpg hp i.carb || cyl: # margins, dydx(*) mtcars$carb_factor <- as.factor(mtcars$carb) mtcars x <- lmer(mpg ~ hp + carb_factor + (1 | cyl), data = mtcars, REML = FALSE) mtcars_sub <- head(mtcars, 4) mtcars_sub <- mtcars_sub %>% select(mpg, hp, carb) x1 <- lm(mpg ~ hp + carb, data = mtcars_sub) summary(x1) m1 <- margins(x, type = "link") summary(m1) # 6: # Stata: margins, at(hp=(66 243.5)) m <- margins(x1, at = list(hp = c(66, 243.5))) print(m, digits = 10) coef(m)[1] summary(m, digits = 6) plot(m) plot(m1) (66 - mean(mtcars_sub$hp)) * (-.0824) margins_hp = -0.08235294118 low = 66 high = 243.5 mtcars_sub$predict_low = mtcars_sub$mpg + (low - mtcars_sub$hp) * (margins_hp) mtcars_sub$predict_high = mtcars_sub$mpg + (high - mtcars_sub$hp) * (margins_hp) mean(mtcars_sub$predict_low) mean(mtcars_sub$predict_high) # the Stata command gives a point prediction of the dependent variable whereas # the R command gives the average marginal effect, so to get the point # prediction you have to multiply it by the change in the variable of interest # and add that to the original point prediction!!!!!!! # FINAL SUB MODEL # Stata: xtmixed mpg wt i.carb || cyl: # R: t4 <- lmer(mpg ~ wt + as.factor(carb) + (1 | cyl), data = mtcars, REML = FALSE) # FINAL MODEL: # STATA: margins, at((mean) _all H_citytract_multi_i=(.23 .54)) ################################## regressions in R v. stata ###############################3 ## model 1: exactly the same # stata : reg mpg cyl hp wt t1 <- lm(mpg ~ cyl + hp + wt, data = mtcars) summary(t1) ## model 2: as.factor is the same thing as doing i. in stata!!!! # stata: reg mpg i.cyl hp wt t2 <- lm(mpg ~ as.factor(cyl) + hp + wt, data = mtcars) summary(t2) ## model 3: THIS IS THE SAME # stata: xtmixed mpg wt || geo_id2: t3 <- lmer(mpg ~ wt + (1 | cyl), data = mtcars, REML = FALSE) summary(t3) ## model 4: THIS IS THE SAME # stata: xtmixed mpg wt || cyl: t3 <- lmer(mpg ~ wt + (1 | cyl), data = mtcars, REML = FALSE) summary(t3) ## model 4: THIS IS THE SAME # stata xtmixed mpg wt i.carb || cyl: t4 <- lmer(mpg ~ wt + as.factor(carb) + (1 | cyl), data = mtcars, REML = FALSE) summary(t4) # FINAL MODEL: # xtmixed biggestsplit H_citytract_multi_i diversityinterp pctasianpopinterp # pctblkpopinterp pctlatinopopinterp medincinterp pctrentersinterp # pctcollegegradinterp biracial nonpartisan primary logpop i. year south midwest # west if winner==1||geo_id2: m1 <- lmer(biggestsplit ~ H_citytract_multi_i + diversityinterp + pctasianpopinterp + pctblkpopinterp + pctlatinopopinterp + medincinterp + pctrentersinterp + pctcollegegradinterp + biracial + nonpartisan + primary + logpop + year.f + south + midwest + west + (1 | geo_id2), data = rp_1, REML=FALSE)
LoadSellerList <- function(venture){ require(XLConnect) sellerWB <- loadWorkbook(paste0("../../1_Input/SellerList/",venture,".xlsx")) sellerList <- readWorksheet(sellerWB, sheet = 1) sellerList }
/3_Script/1_Code/fn_LoadSellerList.R
no_license
datvuong/Crossborder_SellerCharges
R
false
false
209
r
LoadSellerList <- function(venture){ require(XLConnect) sellerWB <- loadWorkbook(paste0("../../1_Input/SellerList/",venture,".xlsx")) sellerList <- readWorksheet(sellerWB, sheet = 1) sellerList }
library("rphast") args <- commandArgs(trailingOnly = TRUE) ref_root <- args[1] msa_root <- args[2] feat_file <- args[3] tree <- args[4] tree_output <- args[5] chr_vector <- paste("chr", c(1:10), sep = "") chr <- chr_vector[1] ref_file <- paste(ref_root, chr, ".fa", sep = "") msa <- paste(msa_root, chr, ".fa", sep="") align4d <- read.msa(msa, refseq = ref_file, format = "FASTA", do.4d = TRUE, features= read.feat(feat_file)) for (chr in chr_vector[2:length(chr_vector)]){ ref_file <- paste(ref_root, chr, ".fa", sep = "") msa <- paste(msa_root, chr, ".fa", sep="") align4d2 <- read.msa(msa, refseq = ref_file, format = "FASTA", do.4d = TRUE, features= read.feat(feat_file)) align4d <- concat.msa(list(align4d, align4d2)) } neutralMod <- phyloFit(align4d, tree=tree, subst.mod="REV") sink(tree_output) neutralMod$tree sink()
/gerp/scripts-gerp/estimate_neutral_tree.R
permissive
HuffordLab/NAM-genomes
R
false
false
841
r
library("rphast") args <- commandArgs(trailingOnly = TRUE) ref_root <- args[1] msa_root <- args[2] feat_file <- args[3] tree <- args[4] tree_output <- args[5] chr_vector <- paste("chr", c(1:10), sep = "") chr <- chr_vector[1] ref_file <- paste(ref_root, chr, ".fa", sep = "") msa <- paste(msa_root, chr, ".fa", sep="") align4d <- read.msa(msa, refseq = ref_file, format = "FASTA", do.4d = TRUE, features= read.feat(feat_file)) for (chr in chr_vector[2:length(chr_vector)]){ ref_file <- paste(ref_root, chr, ".fa", sep = "") msa <- paste(msa_root, chr, ".fa", sep="") align4d2 <- read.msa(msa, refseq = ref_file, format = "FASTA", do.4d = TRUE, features= read.feat(feat_file)) align4d <- concat.msa(list(align4d, align4d2)) } neutralMod <- phyloFit(align4d, tree=tree, subst.mod="REV") sink(tree_output) neutralMod$tree sink()
### Stock market prediction using Numarical and Text anaylsis ### #installing package quantmod install.packages("quantmod") library(quantmod) # stock price analyis of SENS getSymbols("SENS", src="yahoo") chartSeries(SENS) addMACD() # adds moving average convergence divergence signals addBBands() # Adds Bollinger bands to the stock addCCI() # Add Commodity channel index. addADX() #Add Directional Movement Indicator addCMF() #Add Money Flow chart Returns_by_yaer_SENS<-yearlyReturn(SENS) head(Returns_by_yaer_SENS) Returns_by_month_SENS=monthlyReturn(SENS) head(Returns_by_month_SENS) getSymbols("^BSESN", src="yahoo") chartSeries(BSESN) addMACD() # adds moving average convergence divergence signals addBBands() # Adds Bollinger bands to the stock price. addCCI() # Add Commodity channel index. addADX() #Add Directional Movement Indicator addCMF() #Add Money Flow chart ### Text analysis ### df=read.csv(file.choose()) head(df) str(df) View(df) #build corpus library(tm) Corpus=iconv(df$headline_text) Corpus=Corpus(VectorSource(Corpus)) inspect(Corpus[1:5]) #cleaning the text Corpus=tm_map(Corpus,tolower) inspect(Corpus[1:5]) Corpus=tm_map(Corpus,removeNumbers) Corpus=tm_map(Corpus,removePunctuation) inspect(Corpus[1:15]) stopwords('english') clean.set=tm_map(Corpus,removeWords,stopwords("english")) inspect(Corpus[1:15]) clean.set=tm_map(Corpus,stripWhitespace) inspect(Corpus[1:15]) #term doc matrix tdm=TermDocumentMatrix(clean.set) tdm tdm=as.matrix(tdm) tdm[1:10,1:20] w=rowSums(tdm) w w=subset(w,w>10) barplot(w,las=2,col = rainbow(20)) #wordcloud library(wordcloud) w=sort(rowSums(tdm),decreasing = T) set.seed(222) wordcloud(words = names(w), freq = w, max.words = 300, random.order = F, min.freq = 5)
/stock market analysis.R
no_license
ZishanSayyed/Stock-analysis-and-Text-analysis
R
false
false
1,886
r
### Stock market prediction using Numarical and Text anaylsis ### #installing package quantmod install.packages("quantmod") library(quantmod) # stock price analyis of SENS getSymbols("SENS", src="yahoo") chartSeries(SENS) addMACD() # adds moving average convergence divergence signals addBBands() # Adds Bollinger bands to the stock addCCI() # Add Commodity channel index. addADX() #Add Directional Movement Indicator addCMF() #Add Money Flow chart Returns_by_yaer_SENS<-yearlyReturn(SENS) head(Returns_by_yaer_SENS) Returns_by_month_SENS=monthlyReturn(SENS) head(Returns_by_month_SENS) getSymbols("^BSESN", src="yahoo") chartSeries(BSESN) addMACD() # adds moving average convergence divergence signals addBBands() # Adds Bollinger bands to the stock price. addCCI() # Add Commodity channel index. addADX() #Add Directional Movement Indicator addCMF() #Add Money Flow chart ### Text analysis ### df=read.csv(file.choose()) head(df) str(df) View(df) #build corpus library(tm) Corpus=iconv(df$headline_text) Corpus=Corpus(VectorSource(Corpus)) inspect(Corpus[1:5]) #cleaning the text Corpus=tm_map(Corpus,tolower) inspect(Corpus[1:5]) Corpus=tm_map(Corpus,removeNumbers) Corpus=tm_map(Corpus,removePunctuation) inspect(Corpus[1:15]) stopwords('english') clean.set=tm_map(Corpus,removeWords,stopwords("english")) inspect(Corpus[1:15]) clean.set=tm_map(Corpus,stripWhitespace) inspect(Corpus[1:15]) #term doc matrix tdm=TermDocumentMatrix(clean.set) tdm tdm=as.matrix(tdm) tdm[1:10,1:20] w=rowSums(tdm) w w=subset(w,w>10) barplot(w,las=2,col = rainbow(20)) #wordcloud library(wordcloud) w=sort(rowSums(tdm),decreasing = T) set.seed(222) wordcloud(words = names(w), freq = w, max.words = 300, random.order = F, min.freq = 5)
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/mean_survival.R \name{survmean} \alias{survmean} \title{Compute Mean Survival Times Using Extrapolation} \usage{ survmean(formula, data, adjust = NULL, weights = NULL, breaks = NULL, pophaz = NULL, e1.breaks = NULL, e1.pophaz = pophaz, r = "auto", surv.method = "hazard", subset = NULL, verbose = FALSE) } \arguments{ \item{formula}{a \code{formula}, e.g. \code{FUT ~ V1} or \code{Surv(FUT, lex.Xst) ~ V1}. Supplied in the same way as to \code{\link{survtab}}, see that help for more info.} \item{data}{a \code{Lexis} data set; see \code{\link[Epi]{Lexis}}.} \item{adjust}{variables to adjust estimates by, e.g. \code{adjust = "agegr"}. \link[=flexible_argument]{Flexible input}.} \item{weights}{weights to use to adjust mean survival times. See the \link[=direct_standardization]{dedicated help page} for more details on weighting. \code{survmean} computes curves separately by all variables to adjust by, computes mean survival times, and computes weighted means of the mean survival times. See Examples.} \item{breaks}{a list of breaks defining the time window to compute observed survival in, and the intervals used in estimation. E.g. \code{list(FUT = 0:10)} when \code{FUT} is the follow-up time scale in your data.} \item{pophaz}{a data set of population hazards passed to \code{\link{survtab}} (see the \link[=pophaz]{dedicated help page} and the help page of \code{survtab} for more information). Defines the population hazard in the time window where observed survival is estimated.} \item{e1.breaks}{\code{NULL} or a list of breaks defining the time window to compute \strong{expected} survival in, and the intervals used in estimation. E.g. \code{list(FUT = 0:100)} when \code{FUT} is the follow-up time scale in your data to extrapolate up to 100 years from where the observed survival curve ends. \strong{NOTE:} the breaks on the survival time scale MUST include the breaks supplied to argument \code{breaks}; see Examples. If \code{NULL}, uses decent defaults (maximum follow-up time of 50 years).} \item{e1.pophaz}{Same as \code{pophaz}, except this defines the population hazard in the time window where \strong{expected} survival is estimated. By default uses the same data as argument \code{pophaz}.} \item{r}{either a numeric multiplier such as \code{0.995}, \code{"auto"}, or \code{"autoX"} where \code{X} is an integer; used to determine the relative survival ratio (RSR) persisting after where the estimated observed survival curve ends. See Details.} \item{surv.method}{passed to \code{survtab}; see that help for more info.} \item{subset}{a logical condition; e.g. \code{subset = sex == 1}; subsets the data before computations} \item{verbose}{\code{logical}; if \code{TRUE}, the function is returns some messages and results along the run, which may be useful in debugging} } \value{ Returns a \code{data.frame} or \code{data.table} (depending on \code{getOptions("popEpi.datatable")}; see \code{?popEpi}) containing the following columns: \itemize{ \item{est}{: The estimated mean survival time} \item{exp}{: The computed expected survival time} \item{obs}{: Counts of subjects in data} \item{YPLL}{: Years of Potential Life Lost, computed as (\code{(exp-est)*obs}) - though your time data may be in e.g. days, this column will have the same name regardless.} } The returned data also has columns named according to the variables supplied to the right-hand-side of the formula. } \description{ Computes mean survival times based on survival estimation up to a point in follow-up time (e.g. 10 years), after which survival is extrapolated using an appropriate hazard data file (\code{pophaz}) to yield the "full" survival curve. The area under the full survival curve is the mean survival. } \details{ \strong{Basics} \code{survmean} computes mean survival times. For median survival times (i.e. where 50 % of subjects have died or met some other event) use \code{\link{survtab}}. The mean survival time is simply the area under the survival curve. However, since full follow-up rarely happens, the observed survival curves are extrapolated using expected survival: E.g. one might compute observed survival till up to 10 years and extrapolate beyond that (till e.g. 50 years) to yield an educated guess on the full observed survival curve. The area is computed by trapezoidal integration of the area under the curve. This function also computes the "full" expected survival curve from T = 0 till e.g. T = 50 depending on supplied arguments. The expected mean survival time is the area under the mean expected survival curve. This function returns the mean expected survival time to be compared with the mean survival time and for computing years of potential life lost (YPLL). Results can be formed by strata and adjusted for e.g. age by using the \code{formula} argument as in \code{survtab}. See also Examples. \strong{Extrapolation tweaks} Argument \code{r} controls the relative survival ratio (RSR) assumed to persist beyond the time window where observed survival is computed (defined by argument \code{breaks}; e.g. up to \code{FUT = 10}). The RSR is simply \code{RSR_i = p_oi / p_ei} for a time interval \code{i}, i.e. the observed divided by the expected (conditional, not cumulative) probability of surviving from the beginning of a time interval till its end. The cumulative product of \code{RSR_i} over time is the (cumulative) relative survival curve. If \code{r} is numeric, e.g. \code{r = 0.995}, that RSR level is assumed to persist beyond the observed survival curve. Numeric \code{r} should be \code{> 0} and expressed at the annual level when using fractional years as the scale of the time variables. E.g. if RSR is known to be \code{0.95} at the month level, then the annualized RSR is \code{0.95^12}. This enables correct usage of the RSR with survival intervals of varying lengths. When using day-level time variables (such as \code{Dates}; see \code{as.Date}), numeric \code{r} should be expressed at the day level, etc. If \code{r = "auto"} or \code{r = "auto1"}, this function computes RSR estimates internally and automatically uses the \code{RSR_i} in the last survival interval in each stratum (and adjusting group) and assumes that to persist beyond the observed survival curve. Automatic determination of \code{r} is a good starting point, but in situations where the RSR estimate is uncertain it may produce poor results. Using \code{"autoX"} such as \code{"auto6"} causes \code{survmean} to use the mean of the estimated RSRs in the last X survival intervals, which may be more stable. Automatic determination will not use values \code{>1} but set them to 1. Visual inspection of the produced curves is always recommended: see Examples. One may also tweak the accuracy and length of extrapolation and expected survival curve computation by using \code{e1.breaks}. By default this is whatever was supplied to \code{breaks} for the survival time scale, to which \code{c(seq(1/12, 1, 1/12), seq(1.2, 1.8, 0.2), 2:19, seq(20, 50, 5))} is added after the maximum value, e.g. with \code{breaks = list(FUT = 0:10)} we have \code{..., 10+1/12, ..., 11, 11.2, ..., 2, 3, ..., 19, 20, 25, ... 50} as the \code{e1.breaks}. Supplying \code{e1.breaks} manually requires the breaks over time survival time scale supplied to argument \code{breaks} to be reiterated in \code{e1.breaks}; see Examples. \strong{NOTE}: the default extrapolation breaks assume the time scales in the data to be expressed as fractional years, meaning this will work extremely poorly when using e.g. day-level time scales (such as \code{Date} variables). Set the extrapolation breaks manually in such cases. } \examples{ library(survival) library(Epi) ## take 500 subjects randomly for demonstration data(sire) sire <- sire[sire$dg_date < sire$ex_date, ] set.seed(1L) sire <- sire[sample(x = nrow(sire), size = 500),] ## NOTE: recommended to use factor status variable x <- Lexis(entry = list(FUT = 0, AGE = dg_age, CAL = get.yrs(dg_date)), exit = list(CAL = get.yrs(ex_date)), data = sire, exit.status = factor(status, levels = 0:2, labels = c("alive", "canD", "othD")), merge = TRUE) ## phony variable set.seed(1L) x$group <- rbinom(nrow(x), 1, 0.5) ## age group x$agegr <- cut(x$dg_age, c(0,45,60,Inf), right=FALSE) ## population hazards data set pm <- data.frame(popEpi::popmort) names(pm) <- c("sex", "CAL", "AGE", "haz") ## breaks to define observed survival estimation BL <- list(FUT = seq(0, 10, 1/12)) ## crude mean survival sm1 <- survmean(Surv(FUT, lex.Xst != "alive") ~ 1, pophaz = pm, data = x, weights = NULL, breaks = BL) sm1 <- survmean(FUT ~ 1, pophaz = pm, data = x, weights = NULL, breaks = BL) \dontrun{ ## mean survival by group sm2 <- survmean(FUT ~ group, pophaz = pm, data = x, weights = NULL, breaks = BL) ## ... and adjusted for age using internal weights (counts of subjects) ## note: need also longer extrapolation here so that all curves ## converge to zero in the end. eBL <- list(FUT = c(BL$FUT, 11:75)) sm3 <- survmean(FUT ~ group + adjust(agegr), pophaz = pm, data = x, weights = "internal", breaks = BL, e1.breaks = eBL) } ## visual inspection of how realistic extrapolation is for each stratum; ## solid lines are observed + extrapolated survivals; ## dashed lines are expected survivals plot(sm1) \dontrun{ ## plotting object with both stratification and standardization ## plots curves for each strata-std.group combination plot(sm3) ## for finer control of plotting these curves, you may extract ## from the survmean object using e.g. attributes(sm3)$survmean.meta$curves #### using Dates x <- Lexis(entry = list(FUT = 0L, AGE = dg_date-bi_date, CAL = dg_date), exit = list(CAL = ex_date), data = sire[sire$dg_date < sire$ex_date, ], exit.status = factor(status, levels = 0:2, labels = c("alive", "canD", "othD")), merge = TRUE) ## phony group variable set.seed(1L) x$group <- rbinom(nrow(x), 1, 0.5) ## NOTE: population hazard should be reported at the same scale ## as time variables in your Lexis data. data(popmort, package = "popEpi") pm <- data.frame(popmort) names(pm) <- c("sex", "CAL", "AGE", "haz") ## from year to day level pm$haz <- pm$haz/365.25 pm$CAL <- as.Date(paste0(pm$CAL, "-01-01")) pm$AGE <- pm$AGE*365.25 BL <- list(FUT = seq(0, 8, 1/12)*365.25) eBL <- list(FUT = c(BL$FUT, c(8.25,8.5,9:60)*365.25)) smd <- survmean(FUT ~ group, data = x, pophaz = pm, verbose = TRUE, r = "auto5", breaks = BL, e1.breaks = eBL) plot(smd) } } \seealso{ Other survmean functions: \code{\link{lines.survmean}}, \code{\link{plot.survmean}} Other main functions: \code{\link{rate}}, \code{\link{relpois_ag}}, \code{\link{relpois}}, \code{\link{sirspline}}, \code{\link{sir}}, \code{\link{survtab_ag}}, \code{\link{survtab}} } \author{ Joonas Miettinen } \concept{main functions} \concept{survmean functions}
/man/survmean.Rd
no_license
m-allik/popEpi
R
false
true
11,353
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/mean_survival.R \name{survmean} \alias{survmean} \title{Compute Mean Survival Times Using Extrapolation} \usage{ survmean(formula, data, adjust = NULL, weights = NULL, breaks = NULL, pophaz = NULL, e1.breaks = NULL, e1.pophaz = pophaz, r = "auto", surv.method = "hazard", subset = NULL, verbose = FALSE) } \arguments{ \item{formula}{a \code{formula}, e.g. \code{FUT ~ V1} or \code{Surv(FUT, lex.Xst) ~ V1}. Supplied in the same way as to \code{\link{survtab}}, see that help for more info.} \item{data}{a \code{Lexis} data set; see \code{\link[Epi]{Lexis}}.} \item{adjust}{variables to adjust estimates by, e.g. \code{adjust = "agegr"}. \link[=flexible_argument]{Flexible input}.} \item{weights}{weights to use to adjust mean survival times. See the \link[=direct_standardization]{dedicated help page} for more details on weighting. \code{survmean} computes curves separately by all variables to adjust by, computes mean survival times, and computes weighted means of the mean survival times. See Examples.} \item{breaks}{a list of breaks defining the time window to compute observed survival in, and the intervals used in estimation. E.g. \code{list(FUT = 0:10)} when \code{FUT} is the follow-up time scale in your data.} \item{pophaz}{a data set of population hazards passed to \code{\link{survtab}} (see the \link[=pophaz]{dedicated help page} and the help page of \code{survtab} for more information). Defines the population hazard in the time window where observed survival is estimated.} \item{e1.breaks}{\code{NULL} or a list of breaks defining the time window to compute \strong{expected} survival in, and the intervals used in estimation. E.g. \code{list(FUT = 0:100)} when \code{FUT} is the follow-up time scale in your data to extrapolate up to 100 years from where the observed survival curve ends. \strong{NOTE:} the breaks on the survival time scale MUST include the breaks supplied to argument \code{breaks}; see Examples. If \code{NULL}, uses decent defaults (maximum follow-up time of 50 years).} \item{e1.pophaz}{Same as \code{pophaz}, except this defines the population hazard in the time window where \strong{expected} survival is estimated. By default uses the same data as argument \code{pophaz}.} \item{r}{either a numeric multiplier such as \code{0.995}, \code{"auto"}, or \code{"autoX"} where \code{X} is an integer; used to determine the relative survival ratio (RSR) persisting after where the estimated observed survival curve ends. See Details.} \item{surv.method}{passed to \code{survtab}; see that help for more info.} \item{subset}{a logical condition; e.g. \code{subset = sex == 1}; subsets the data before computations} \item{verbose}{\code{logical}; if \code{TRUE}, the function is returns some messages and results along the run, which may be useful in debugging} } \value{ Returns a \code{data.frame} or \code{data.table} (depending on \code{getOptions("popEpi.datatable")}; see \code{?popEpi}) containing the following columns: \itemize{ \item{est}{: The estimated mean survival time} \item{exp}{: The computed expected survival time} \item{obs}{: Counts of subjects in data} \item{YPLL}{: Years of Potential Life Lost, computed as (\code{(exp-est)*obs}) - though your time data may be in e.g. days, this column will have the same name regardless.} } The returned data also has columns named according to the variables supplied to the right-hand-side of the formula. } \description{ Computes mean survival times based on survival estimation up to a point in follow-up time (e.g. 10 years), after which survival is extrapolated using an appropriate hazard data file (\code{pophaz}) to yield the "full" survival curve. The area under the full survival curve is the mean survival. } \details{ \strong{Basics} \code{survmean} computes mean survival times. For median survival times (i.e. where 50 % of subjects have died or met some other event) use \code{\link{survtab}}. The mean survival time is simply the area under the survival curve. However, since full follow-up rarely happens, the observed survival curves are extrapolated using expected survival: E.g. one might compute observed survival till up to 10 years and extrapolate beyond that (till e.g. 50 years) to yield an educated guess on the full observed survival curve. The area is computed by trapezoidal integration of the area under the curve. This function also computes the "full" expected survival curve from T = 0 till e.g. T = 50 depending on supplied arguments. The expected mean survival time is the area under the mean expected survival curve. This function returns the mean expected survival time to be compared with the mean survival time and for computing years of potential life lost (YPLL). Results can be formed by strata and adjusted for e.g. age by using the \code{formula} argument as in \code{survtab}. See also Examples. \strong{Extrapolation tweaks} Argument \code{r} controls the relative survival ratio (RSR) assumed to persist beyond the time window where observed survival is computed (defined by argument \code{breaks}; e.g. up to \code{FUT = 10}). The RSR is simply \code{RSR_i = p_oi / p_ei} for a time interval \code{i}, i.e. the observed divided by the expected (conditional, not cumulative) probability of surviving from the beginning of a time interval till its end. The cumulative product of \code{RSR_i} over time is the (cumulative) relative survival curve. If \code{r} is numeric, e.g. \code{r = 0.995}, that RSR level is assumed to persist beyond the observed survival curve. Numeric \code{r} should be \code{> 0} and expressed at the annual level when using fractional years as the scale of the time variables. E.g. if RSR is known to be \code{0.95} at the month level, then the annualized RSR is \code{0.95^12}. This enables correct usage of the RSR with survival intervals of varying lengths. When using day-level time variables (such as \code{Dates}; see \code{as.Date}), numeric \code{r} should be expressed at the day level, etc. If \code{r = "auto"} or \code{r = "auto1"}, this function computes RSR estimates internally and automatically uses the \code{RSR_i} in the last survival interval in each stratum (and adjusting group) and assumes that to persist beyond the observed survival curve. Automatic determination of \code{r} is a good starting point, but in situations where the RSR estimate is uncertain it may produce poor results. Using \code{"autoX"} such as \code{"auto6"} causes \code{survmean} to use the mean of the estimated RSRs in the last X survival intervals, which may be more stable. Automatic determination will not use values \code{>1} but set them to 1. Visual inspection of the produced curves is always recommended: see Examples. One may also tweak the accuracy and length of extrapolation and expected survival curve computation by using \code{e1.breaks}. By default this is whatever was supplied to \code{breaks} for the survival time scale, to which \code{c(seq(1/12, 1, 1/12), seq(1.2, 1.8, 0.2), 2:19, seq(20, 50, 5))} is added after the maximum value, e.g. with \code{breaks = list(FUT = 0:10)} we have \code{..., 10+1/12, ..., 11, 11.2, ..., 2, 3, ..., 19, 20, 25, ... 50} as the \code{e1.breaks}. Supplying \code{e1.breaks} manually requires the breaks over time survival time scale supplied to argument \code{breaks} to be reiterated in \code{e1.breaks}; see Examples. \strong{NOTE}: the default extrapolation breaks assume the time scales in the data to be expressed as fractional years, meaning this will work extremely poorly when using e.g. day-level time scales (such as \code{Date} variables). Set the extrapolation breaks manually in such cases. } \examples{ library(survival) library(Epi) ## take 500 subjects randomly for demonstration data(sire) sire <- sire[sire$dg_date < sire$ex_date, ] set.seed(1L) sire <- sire[sample(x = nrow(sire), size = 500),] ## NOTE: recommended to use factor status variable x <- Lexis(entry = list(FUT = 0, AGE = dg_age, CAL = get.yrs(dg_date)), exit = list(CAL = get.yrs(ex_date)), data = sire, exit.status = factor(status, levels = 0:2, labels = c("alive", "canD", "othD")), merge = TRUE) ## phony variable set.seed(1L) x$group <- rbinom(nrow(x), 1, 0.5) ## age group x$agegr <- cut(x$dg_age, c(0,45,60,Inf), right=FALSE) ## population hazards data set pm <- data.frame(popEpi::popmort) names(pm) <- c("sex", "CAL", "AGE", "haz") ## breaks to define observed survival estimation BL <- list(FUT = seq(0, 10, 1/12)) ## crude mean survival sm1 <- survmean(Surv(FUT, lex.Xst != "alive") ~ 1, pophaz = pm, data = x, weights = NULL, breaks = BL) sm1 <- survmean(FUT ~ 1, pophaz = pm, data = x, weights = NULL, breaks = BL) \dontrun{ ## mean survival by group sm2 <- survmean(FUT ~ group, pophaz = pm, data = x, weights = NULL, breaks = BL) ## ... and adjusted for age using internal weights (counts of subjects) ## note: need also longer extrapolation here so that all curves ## converge to zero in the end. eBL <- list(FUT = c(BL$FUT, 11:75)) sm3 <- survmean(FUT ~ group + adjust(agegr), pophaz = pm, data = x, weights = "internal", breaks = BL, e1.breaks = eBL) } ## visual inspection of how realistic extrapolation is for each stratum; ## solid lines are observed + extrapolated survivals; ## dashed lines are expected survivals plot(sm1) \dontrun{ ## plotting object with both stratification and standardization ## plots curves for each strata-std.group combination plot(sm3) ## for finer control of plotting these curves, you may extract ## from the survmean object using e.g. attributes(sm3)$survmean.meta$curves #### using Dates x <- Lexis(entry = list(FUT = 0L, AGE = dg_date-bi_date, CAL = dg_date), exit = list(CAL = ex_date), data = sire[sire$dg_date < sire$ex_date, ], exit.status = factor(status, levels = 0:2, labels = c("alive", "canD", "othD")), merge = TRUE) ## phony group variable set.seed(1L) x$group <- rbinom(nrow(x), 1, 0.5) ## NOTE: population hazard should be reported at the same scale ## as time variables in your Lexis data. data(popmort, package = "popEpi") pm <- data.frame(popmort) names(pm) <- c("sex", "CAL", "AGE", "haz") ## from year to day level pm$haz <- pm$haz/365.25 pm$CAL <- as.Date(paste0(pm$CAL, "-01-01")) pm$AGE <- pm$AGE*365.25 BL <- list(FUT = seq(0, 8, 1/12)*365.25) eBL <- list(FUT = c(BL$FUT, c(8.25,8.5,9:60)*365.25)) smd <- survmean(FUT ~ group, data = x, pophaz = pm, verbose = TRUE, r = "auto5", breaks = BL, e1.breaks = eBL) plot(smd) } } \seealso{ Other survmean functions: \code{\link{lines.survmean}}, \code{\link{plot.survmean}} Other main functions: \code{\link{rate}}, \code{\link{relpois_ag}}, \code{\link{relpois}}, \code{\link{sirspline}}, \code{\link{sir}}, \code{\link{survtab_ag}}, \code{\link{survtab}} } \author{ Joonas Miettinen } \concept{main functions} \concept{survmean functions}
#library(xlsx) SofiaLaugh=data.frame() ACA2.11=read.xlsx("Angels Care Sofia A 2-11-14.xlsx",1) ACA2.11t=t(ACA2.11) LaughACA2.11=data.frame(ACA2.11t[c(9,12,15,18,21,24),]) LaughACA2.11=data.matrix(LaughACA2.11) LaughACA2.11=LaughACA2.11-1 LaughACA2.11=colSums(LaughACA2.11,na.rm=T) LaughACA2.11 ACB2.11=read.xlsx("Angels Care Sofia B 2-11-14.xlsx",1) ACB2.11t=t(ACB2.11) LaughACB2.11=data.frame(ACB2.11t[c(9,12,15,18,21,24),]) LaughACB2.11=data.matrix(LaughACB2.11) LaughACB2.11=LaughACB2.11-1 LaughACB2.11=colSums(LaughACB2.11,na.rm=T) LaughACB2.11 ACA2.17=read.xlsx("AngelsCare_Sofia1.2.17.14_BL.xlsx",1) ACA2.17t=t(ACA2.17) LaughACA2.17=data.frame(ACA2.17t[c(9,12,15,18,21,24),]) LaughACA2.17=data.matrix(LaughACA2.17) LaughACA2.17=LaughACA2.17-1 LaughACA2.17=colSums(LaughACA2.17,na.rm=T) LaughACA2.17 ACB2.17=read.xlsx("AngelsCare_Sofia2.2.17.14_BL (Video Label is Sesame).xlsx",1) ACB2.17t=t(ACB2.17) LaughACB2.17=data.frame(ACB2.17t[c(9,12,15,18,21,24),]) LaughACB2.17=data.matrix(LaughACB2.17) LaughACB2.17=LaughACB2.17-1 LaughACB2.17=colSums(LaughACB2.17,na.rm=T) LaughACB2.17 ASCA2.13=read.xlsx("Austin S. Christian Academy Sofia A 2-13-14.xlsx",1) ASCA2.13t=t(ASCA2.13) LaughASCA2.13=data.frame(ASCA2.13t[c(9,12,15,18,21,24),]) LaughASCA2.13=data.matrix(LaughASCA2.13) LaughASCA2.13=LaughASCA2.13-1 LaughASCA2.13=colSums(LaughASCA2.13,na.rm=T) LaughASCA2.13 CWA2.3=read.xlsx("CreativeWorld_Sofia1.2.3.14_BL.xlsx",1) CWA2.3t=t(CWA2.3) LaughCWA2.3=data.frame(CWA2.3t[c(9,12,15,18,21,24),]) LaughCWA2.3=data.matrix(LaughCWA2.3) LaughCWA2.3=LaughCWA2.3-1 LaughCWA2.3=colSums(LaughCWA2.3,na.rm=T) LaughCWA2.3 CWB2.3=read.xlsx("CreativeWorld_Sofia2.2.3.14_BL (Video Label is SST).xlsx",1) CWB2.3t=t(CWB2.3) LaughCWB2.3=data.frame(CWB2.3t[c(9,12,15,18,21,24),]) LaughCWB2.3=data.matrix(LaughCWB2.3) LaughCWB2.3=LaughCWB2.3-1 LaughCWB2.3=colSums(LaughCWB2.3,na.rm=T) LaughCWB2.3 PNA2.10=read.xlsx("Papa and Nanas Sofia A 2-10-14.xlsx",1) PNA2.10t=t(PNA2.10) LaughPNA2.10=data.frame(PNA2.10t[c(9,12,15,18,21,24),]) LaughPNA2.10=data.matrix(LaughPNA2.10) LaughPNA2.10=LaughPNA2.10-1 LaughPNA2.10=colSums(LaughPNA2.10,na.rm=T) LaughPNA2.10 PNB2.10=read.xlsx("Papa and Nanas Sofia B 2-10-14.xlsx",1) PNB2.10t=t(PNB2.10) LaughPNB2.10=data.frame(PNB2.10t[c(9,12,15,18,21,24),]) LaughPNB2.10=data.matrix(LaughPNB2.10) LaughPNB2.10=LaughPNB2.10-1 LaughPNB2.10=colSums(LaughPNB2.10,na.rm=T) LaughPNB2.10 RDA2.12=read.xlsx("QRosiesDaycare_Sofia1.2.12.14_BL.xlsx",1) RDA2.12=t(RDA2.12) LaughRDA2.12=data.frame(RDA2.12t[c(9,12,15,18,21,24),]) LaughRDA2.12=data.matrix(LaughRDA2.12) LaughRDA2.12=LaughRDA2.12-1 LaughRDA2.12=colSums(LaughRDA2.12,na.rm=T) RDB2.12=read.xlsx("QRosiesDaycare_Sofia1.2.12.14_BL.xlsx",1) RDB2.12=t(RDB2.12) LaughRDB2.12=data.frame(RDB2.12t[c(9,12,15,18,21,24),]) LaughRDB2.12=data.matrix(LaughRDB2.12) LaughRDB2.12=LaughRDB2.12-1 LaughRDB2.12=colSums(LaughRDB2.12,na.rm=T) SofiaLaugh=rbind(LaughACA2.11,LaughACB2.11,LaughACA2.17,LaughACB2.17,LaughASCA2.13,LaughCWA2.3,LaughCWB2.3,LaughPNA2.10,LaughPNB2.10,LaughRDA2.12,LaughRDB2.12) SofiaLaugh=t(SofiaLaugh) edit(SofiaLaugh) write.xlsx(SofiaLaugh,"/Users/bradlide/Desktop/Data/2Sofia/SofiaCompiledLaugh.xlsx",sheetName="Laugh")
/Unsaved R Document 5.R
no_license
bradlide/SesameFinal
R
false
false
3,217
r
#library(xlsx) SofiaLaugh=data.frame() ACA2.11=read.xlsx("Angels Care Sofia A 2-11-14.xlsx",1) ACA2.11t=t(ACA2.11) LaughACA2.11=data.frame(ACA2.11t[c(9,12,15,18,21,24),]) LaughACA2.11=data.matrix(LaughACA2.11) LaughACA2.11=LaughACA2.11-1 LaughACA2.11=colSums(LaughACA2.11,na.rm=T) LaughACA2.11 ACB2.11=read.xlsx("Angels Care Sofia B 2-11-14.xlsx",1) ACB2.11t=t(ACB2.11) LaughACB2.11=data.frame(ACB2.11t[c(9,12,15,18,21,24),]) LaughACB2.11=data.matrix(LaughACB2.11) LaughACB2.11=LaughACB2.11-1 LaughACB2.11=colSums(LaughACB2.11,na.rm=T) LaughACB2.11 ACA2.17=read.xlsx("AngelsCare_Sofia1.2.17.14_BL.xlsx",1) ACA2.17t=t(ACA2.17) LaughACA2.17=data.frame(ACA2.17t[c(9,12,15,18,21,24),]) LaughACA2.17=data.matrix(LaughACA2.17) LaughACA2.17=LaughACA2.17-1 LaughACA2.17=colSums(LaughACA2.17,na.rm=T) LaughACA2.17 ACB2.17=read.xlsx("AngelsCare_Sofia2.2.17.14_BL (Video Label is Sesame).xlsx",1) ACB2.17t=t(ACB2.17) LaughACB2.17=data.frame(ACB2.17t[c(9,12,15,18,21,24),]) LaughACB2.17=data.matrix(LaughACB2.17) LaughACB2.17=LaughACB2.17-1 LaughACB2.17=colSums(LaughACB2.17,na.rm=T) LaughACB2.17 ASCA2.13=read.xlsx("Austin S. Christian Academy Sofia A 2-13-14.xlsx",1) ASCA2.13t=t(ASCA2.13) LaughASCA2.13=data.frame(ASCA2.13t[c(9,12,15,18,21,24),]) LaughASCA2.13=data.matrix(LaughASCA2.13) LaughASCA2.13=LaughASCA2.13-1 LaughASCA2.13=colSums(LaughASCA2.13,na.rm=T) LaughASCA2.13 CWA2.3=read.xlsx("CreativeWorld_Sofia1.2.3.14_BL.xlsx",1) CWA2.3t=t(CWA2.3) LaughCWA2.3=data.frame(CWA2.3t[c(9,12,15,18,21,24),]) LaughCWA2.3=data.matrix(LaughCWA2.3) LaughCWA2.3=LaughCWA2.3-1 LaughCWA2.3=colSums(LaughCWA2.3,na.rm=T) LaughCWA2.3 CWB2.3=read.xlsx("CreativeWorld_Sofia2.2.3.14_BL (Video Label is SST).xlsx",1) CWB2.3t=t(CWB2.3) LaughCWB2.3=data.frame(CWB2.3t[c(9,12,15,18,21,24),]) LaughCWB2.3=data.matrix(LaughCWB2.3) LaughCWB2.3=LaughCWB2.3-1 LaughCWB2.3=colSums(LaughCWB2.3,na.rm=T) LaughCWB2.3 PNA2.10=read.xlsx("Papa and Nanas Sofia A 2-10-14.xlsx",1) PNA2.10t=t(PNA2.10) LaughPNA2.10=data.frame(PNA2.10t[c(9,12,15,18,21,24),]) LaughPNA2.10=data.matrix(LaughPNA2.10) LaughPNA2.10=LaughPNA2.10-1 LaughPNA2.10=colSums(LaughPNA2.10,na.rm=T) LaughPNA2.10 PNB2.10=read.xlsx("Papa and Nanas Sofia B 2-10-14.xlsx",1) PNB2.10t=t(PNB2.10) LaughPNB2.10=data.frame(PNB2.10t[c(9,12,15,18,21,24),]) LaughPNB2.10=data.matrix(LaughPNB2.10) LaughPNB2.10=LaughPNB2.10-1 LaughPNB2.10=colSums(LaughPNB2.10,na.rm=T) LaughPNB2.10 RDA2.12=read.xlsx("QRosiesDaycare_Sofia1.2.12.14_BL.xlsx",1) RDA2.12=t(RDA2.12) LaughRDA2.12=data.frame(RDA2.12t[c(9,12,15,18,21,24),]) LaughRDA2.12=data.matrix(LaughRDA2.12) LaughRDA2.12=LaughRDA2.12-1 LaughRDA2.12=colSums(LaughRDA2.12,na.rm=T) RDB2.12=read.xlsx("QRosiesDaycare_Sofia1.2.12.14_BL.xlsx",1) RDB2.12=t(RDB2.12) LaughRDB2.12=data.frame(RDB2.12t[c(9,12,15,18,21,24),]) LaughRDB2.12=data.matrix(LaughRDB2.12) LaughRDB2.12=LaughRDB2.12-1 LaughRDB2.12=colSums(LaughRDB2.12,na.rm=T) SofiaLaugh=rbind(LaughACA2.11,LaughACB2.11,LaughACA2.17,LaughACB2.17,LaughASCA2.13,LaughCWA2.3,LaughCWB2.3,LaughPNA2.10,LaughPNB2.10,LaughRDA2.12,LaughRDB2.12) SofiaLaugh=t(SofiaLaugh) edit(SofiaLaugh) write.xlsx(SofiaLaugh,"/Users/bradlide/Desktop/Data/2Sofia/SofiaCompiledLaugh.xlsx",sheetName="Laugh")
# Return full path to problem data file. dataFileFullPath <- function(fname) { paste("data", fname, sep="/") } # Returns solution for a given problem. computeSolutionFor <- function(fname) { # This is for the standard, python solver sol <- system(paste('python solver.py', dataFileFullPath(fname)), intern=T) #sol <- system(paste('./facility', dataFileFullPath(fname)), intern=T) cost <- as.numeric(substr(sol[1], 1, nchar(sol[1])-1)) solution <- as.numeric(unlist(strsplit(sol[2], " "))) list(cost=cost, solution=solution) } # Create a color mapping function between the given vector (which may contain duplicate values) # and a color for each unique value in the vector. makeColorMapper <- function(vals) { uniq <- sort(unique(vals)) colors <- rainbow(length(uniq)) function(val) { colors[which(uniq == val)] } } # Loads one data file and returns a list with facilities (fx) and customers (cx). loadDataFile <- function(fname) { rawData <- read.csv(dataFileFullPath(fname), header=F, sep=' ') facCount <- rawData$V1[1]; custCount <-rawData$V2[1] facilities <- rawData[2:(1+facCount), 1:4] colnames(facilities) <- c('setupCost', 'capacity', 'x', 'y') customers <- rawData[(2+facCount):(1+facCount+custCount), 1:3] colnames(customers) <- c('demand', 'x', 'y') list(fx = facilities, cx = customers) } # Plots one instance of the Facility Location problem defined in fname, including # the solution (obtained via python solver.py fname). plotInstance <- function(fname, plotLegend=F, plotSol=T) { z <- loadDataFile(fname) facilities <- z$fx customers <- z$cx plot(customers$y ~ customers$x, col="red", main=paste("Facility Location",fname), xlab="x", ylab="y", xlim=c(min(c(min(customers$x), min(facilities$x))),max(c(max(customers$x), max(facilities$x)))), ylim=c(min(c(min(customers$y), min(facilities$y))),max(c(max(customers$y), max(facilities$y))))) points(facilities$y ~ facilities$x, col="blue") if (plotLegend) { colors <- c("red", "blue", "blue") legend("topleft", legend=c("customer", "facility", "facility open"), col=colors, text.col=colors, y.intersp=0.85, pch=c(1,1,16)) } if (plotSol) { plotSolution(fname, customers, facilities) } } # Plots solution for one instance of the problem, defined in fname. plotSolution <- function(fname, customers=NULL, facilities=NULL) { # Lazy load customers & facilities if (is.null(customers) || is.null(facilities)) { z <- loadDataFile(fname) facilities <- z$fx customers <- z$cx } z <- computeSolutionFor(fname) # converting from 0 based arrays of the output to 1 based arrays of R z$solution <- z$solution + rep(1,length(z$solution)) facSel <- facilities[sort(unique(z$solution)),] colors <- makeColorMapper(z$solution) mtext(formatC(z$cost, format="d", big.mark=","), line=0.2, outer=F, col="#CC2211") points(facSel$y ~ facSel$x, col="blue", pch=16) ci <- 0 for (fi in z$solution) { ci <- ci + 1 f <- facilities[fi,] c <- customers[ci, ] segments(f$x, f$y, c$x, c$y, col=colors(fi)) } } # Plots multiple data instances (all found in _metadata by default). # If only specific instances need to be plotted, then limit can be passed a vector # of their IDs (e.g. c(1,3,5) would only plot problems #1, #3 and #5). plotMulti <- function(limit=NULL, plotSol=T, fname = './_metadata') { z <- read.table(fname, header=F, sep=' ', skip=3) names <- lapply(as.character(z$V2), function (a) substr(a,8,nchar(a)-1)) if (!is.null(limit)) { names <- names[limit] } if (length(names) > 1) { par(mfrow=c(2,length(names)/2)) } else { par(mfrow=c(1,1)) } lapply(names, function (a) plotInstance(a, a == names[[1]], plotSol)) } #png(width=1600, height=900, res=96, antialias="subpixel", filename="out.png") #plotMulti() #dev.off() # Manually plotting selected problems: #plotInstance('fl_25_2')
/facility/plot.R
no_license
alexvorobiev/dopt
R
false
false
3,921
r
# Return full path to problem data file. dataFileFullPath <- function(fname) { paste("data", fname, sep="/") } # Returns solution for a given problem. computeSolutionFor <- function(fname) { # This is for the standard, python solver sol <- system(paste('python solver.py', dataFileFullPath(fname)), intern=T) #sol <- system(paste('./facility', dataFileFullPath(fname)), intern=T) cost <- as.numeric(substr(sol[1], 1, nchar(sol[1])-1)) solution <- as.numeric(unlist(strsplit(sol[2], " "))) list(cost=cost, solution=solution) } # Create a color mapping function between the given vector (which may contain duplicate values) # and a color for each unique value in the vector. makeColorMapper <- function(vals) { uniq <- sort(unique(vals)) colors <- rainbow(length(uniq)) function(val) { colors[which(uniq == val)] } } # Loads one data file and returns a list with facilities (fx) and customers (cx). loadDataFile <- function(fname) { rawData <- read.csv(dataFileFullPath(fname), header=F, sep=' ') facCount <- rawData$V1[1]; custCount <-rawData$V2[1] facilities <- rawData[2:(1+facCount), 1:4] colnames(facilities) <- c('setupCost', 'capacity', 'x', 'y') customers <- rawData[(2+facCount):(1+facCount+custCount), 1:3] colnames(customers) <- c('demand', 'x', 'y') list(fx = facilities, cx = customers) } # Plots one instance of the Facility Location problem defined in fname, including # the solution (obtained via python solver.py fname). plotInstance <- function(fname, plotLegend=F, plotSol=T) { z <- loadDataFile(fname) facilities <- z$fx customers <- z$cx plot(customers$y ~ customers$x, col="red", main=paste("Facility Location",fname), xlab="x", ylab="y", xlim=c(min(c(min(customers$x), min(facilities$x))),max(c(max(customers$x), max(facilities$x)))), ylim=c(min(c(min(customers$y), min(facilities$y))),max(c(max(customers$y), max(facilities$y))))) points(facilities$y ~ facilities$x, col="blue") if (plotLegend) { colors <- c("red", "blue", "blue") legend("topleft", legend=c("customer", "facility", "facility open"), col=colors, text.col=colors, y.intersp=0.85, pch=c(1,1,16)) } if (plotSol) { plotSolution(fname, customers, facilities) } } # Plots solution for one instance of the problem, defined in fname. plotSolution <- function(fname, customers=NULL, facilities=NULL) { # Lazy load customers & facilities if (is.null(customers) || is.null(facilities)) { z <- loadDataFile(fname) facilities <- z$fx customers <- z$cx } z <- computeSolutionFor(fname) # converting from 0 based arrays of the output to 1 based arrays of R z$solution <- z$solution + rep(1,length(z$solution)) facSel <- facilities[sort(unique(z$solution)),] colors <- makeColorMapper(z$solution) mtext(formatC(z$cost, format="d", big.mark=","), line=0.2, outer=F, col="#CC2211") points(facSel$y ~ facSel$x, col="blue", pch=16) ci <- 0 for (fi in z$solution) { ci <- ci + 1 f <- facilities[fi,] c <- customers[ci, ] segments(f$x, f$y, c$x, c$y, col=colors(fi)) } } # Plots multiple data instances (all found in _metadata by default). # If only specific instances need to be plotted, then limit can be passed a vector # of their IDs (e.g. c(1,3,5) would only plot problems #1, #3 and #5). plotMulti <- function(limit=NULL, plotSol=T, fname = './_metadata') { z <- read.table(fname, header=F, sep=' ', skip=3) names <- lapply(as.character(z$V2), function (a) substr(a,8,nchar(a)-1)) if (!is.null(limit)) { names <- names[limit] } if (length(names) > 1) { par(mfrow=c(2,length(names)/2)) } else { par(mfrow=c(1,1)) } lapply(names, function (a) plotInstance(a, a == names[[1]], plotSol)) } #png(width=1600, height=900, res=96, antialias="subpixel", filename="out.png") #plotMulti() #dev.off() # Manually plotting selected problems: #plotInstance('fl_25_2')
with(ac471f882a8104baa9de21680922ff92e, {ROOT <- 'D:/SEMOSS_v4.0.0_x64/SEMOSS_v4.0.0_x64/semosshome/db/Atadata2__3b3e4a3b-d382-4e98-9950-9b4e8b308c1c/version/1c4fa71c-191c-4da9-8102-b247ffddc5d3';rm(list=ls())});
/1c4fa71c-191c-4da9-8102-b247ffddc5d3/R/Temp/aVgKSrNdeDvD2.R
no_license
ayanmanna8/test
R
false
false
212
r
with(ac471f882a8104baa9de21680922ff92e, {ROOT <- 'D:/SEMOSS_v4.0.0_x64/SEMOSS_v4.0.0_x64/semosshome/db/Atadata2__3b3e4a3b-d382-4e98-9950-9b4e8b308c1c/version/1c4fa71c-191c-4da9-8102-b247ffddc5d3';rm(list=ls())});
File <- setRefClass( 'File', fields = c('root','path_info','path'), methods = list( initialize = function(root,...){ root <<- root callSuper(...) }, call = function(env){ path_info <<- Utils$unescape(env[["PATH_INFO"]]) if (length(grep('..',path_info,fixed=TRUE))){ return(forbidden()) } if (grepl('#',path_info)) path_info <- strsplit(path_info,'#')[[1]] if (grepl('\\?',path_info)) path_info <- strsplit(path_info,'\\?',)[[1]] path <<- normalizePath(file.path(root,path_info)) if (file_test('-d',path)){ if(!grepl(".*/$", path_info)){ return(redirect(paste(env[["SCRIPT_NAME"]], env[["PATH_INFO"]], "/", sep=""), status=301)) } newpath <- file.path(path, "index.html") if(file.exists(newpath)){ path <<- normalizePath(newpath) serving() } else { return(indexdir()) } } else if (file.exists(path)){ serving() } else { not_found() } }, forbidden = function(){ body = 'Forbidden\n' list( status=403L, headers = list( 'Content-type' = 'text/plain', 'Content-Length' = as.character(nchar(body)), 'X-Cascade' = 'pass' ), body = body ) }, indexdir = function(){ body <- paste(list.files(path), collapse="\n") list( status=200L, headers = list( 'Content-type' = 'text/plain', 'Content-Length' = as.character(nchar(body)) ), body = body ) }, redirect = function(location){ res <- Response$new() res$redirect(location, status=302) res$finish() }, serving = function(){ fi <- file.info(path) if (fi$size > 0) { body = readBin(path,'raw',fi$size) } else { body <- path names(body) <- 'file' } list ( status=200L, headers = list( 'Last-Modified' = Utils$rfc2822(fi$mtime), 'Content-Type' = Mime$mime_type(Mime$file_extname(basename(path))), 'Content-Length' = as.character(fi$size) ), body=body ) }, not_found = function(){ body <- paste("File not found:",path_info,"\n") list( status=404L, headers = list( "Content-Type" = "text/plain", "Content-Length" = as.character(nchar(body)), "X-Cascade" = "pass" ), body = body ) } ) )
/R/File.R
no_license
qlycool/Rook
R
false
false
2,273
r
File <- setRefClass( 'File', fields = c('root','path_info','path'), methods = list( initialize = function(root,...){ root <<- root callSuper(...) }, call = function(env){ path_info <<- Utils$unescape(env[["PATH_INFO"]]) if (length(grep('..',path_info,fixed=TRUE))){ return(forbidden()) } if (grepl('#',path_info)) path_info <- strsplit(path_info,'#')[[1]] if (grepl('\\?',path_info)) path_info <- strsplit(path_info,'\\?',)[[1]] path <<- normalizePath(file.path(root,path_info)) if (file_test('-d',path)){ if(!grepl(".*/$", path_info)){ return(redirect(paste(env[["SCRIPT_NAME"]], env[["PATH_INFO"]], "/", sep=""), status=301)) } newpath <- file.path(path, "index.html") if(file.exists(newpath)){ path <<- normalizePath(newpath) serving() } else { return(indexdir()) } } else if (file.exists(path)){ serving() } else { not_found() } }, forbidden = function(){ body = 'Forbidden\n' list( status=403L, headers = list( 'Content-type' = 'text/plain', 'Content-Length' = as.character(nchar(body)), 'X-Cascade' = 'pass' ), body = body ) }, indexdir = function(){ body <- paste(list.files(path), collapse="\n") list( status=200L, headers = list( 'Content-type' = 'text/plain', 'Content-Length' = as.character(nchar(body)) ), body = body ) }, redirect = function(location){ res <- Response$new() res$redirect(location, status=302) res$finish() }, serving = function(){ fi <- file.info(path) if (fi$size > 0) { body = readBin(path,'raw',fi$size) } else { body <- path names(body) <- 'file' } list ( status=200L, headers = list( 'Last-Modified' = Utils$rfc2822(fi$mtime), 'Content-Type' = Mime$mime_type(Mime$file_extname(basename(path))), 'Content-Length' = as.character(fi$size) ), body=body ) }, not_found = function(){ body <- paste("File not found:",path_info,"\n") list( status=404L, headers = list( "Content-Type" = "text/plain", "Content-Length" = as.character(nchar(body)), "X-Cascade" = "pass" ), body = body ) } ) )
# clear variables and close windows rm(list = ls(all = TRUE)) graphics.off() # load data x = read.table("implvola.dat") # rescale x = x/100 # number of rows n = nrow(x) # compute first differences z = apply(x,2,diff) # calculate covariance s = cov(z) * 1e+05 # determine eigenvectors e = eigen(s) e = e$vectors f1 = e[, 1] f2 = e[, 2] # Adjust second Eigenvector in R not necessary - the computation differs from R to Matlab # Plot plot(f1, col = "blue3", ylim = c(-0.6, 0.8), lwd = 2, type = "l", xlab = "Time", ylab = "Percentage [%]", main = "Factor loadings") points(f1) lines(f2, col = "red3", lwd = 2, lty = "dotdash") points(f2)
/QID-3401-SFEPCA/SFEPCA.R
no_license
QuantLet/SFE
R
false
false
651
r
# clear variables and close windows rm(list = ls(all = TRUE)) graphics.off() # load data x = read.table("implvola.dat") # rescale x = x/100 # number of rows n = nrow(x) # compute first differences z = apply(x,2,diff) # calculate covariance s = cov(z) * 1e+05 # determine eigenvectors e = eigen(s) e = e$vectors f1 = e[, 1] f2 = e[, 2] # Adjust second Eigenvector in R not necessary - the computation differs from R to Matlab # Plot plot(f1, col = "blue3", ylim = c(-0.6, 0.8), lwd = 2, type = "l", xlab = "Time", ylab = "Percentage [%]", main = "Factor loadings") points(f1) lines(f2, col = "red3", lwd = 2, lty = "dotdash") points(f2)
#***require packages for the analysis the analysis pkg=c("plyr", "ggplot2", "phyloseq", "data.table", "reshape2", "ape", "GUniFrac", "ape", "phytools", "metagenomeSeq", "ggtern","PMCMR") lapply(pkg, library, character.only = TRUE) rm(list = ls()[grep("*.*", ls())]) alphaInd = c("Shannon", "Observed") color_palette<-c("#000000","#806600","#803300","666666") # ***Upload and prepare phyloseq objects*** mat=read.table( "otu_table.txt", sep="\t", row.names=1, header=T) mat=as.matrix(mat) OTU=otu_table(mat, taxa_are_rows=T) tax=read.table("taxa_table.txt", sep="\t", row.names=1, header=1) tax=as.matrix(tax) TAXA=tax_table(tax) sd=read.table("sample_data.txt", sep="\t", row.names=1, header=1) SD=sample_data(sd) TREE=read.tree("16s_trim_v5v6_KG_DepExp_Derep.tree") physeq= phyloseq(OTU, TAXA, SD,TREE) #Remove samples with less than 1000 reads physeq1 = prune_samples(sample_sums(physeq) > 1000, physeq) #Select for full and hs depleted samples cond=c("input","afull","hs") physeq2=subset_samples(physeq1, config2 %in% cond) comm=c("Back","Comp") physeq2=subset_taxa(physeq2, tag %in% comm) #Rarefication to even depth based on smallest sample size rf=min(sample_sums(physeq2)) physeq.rrf=rarefy_even_depth(physeq2, rf, replace=TRUE) p_nat=plot_richness(physeq.rrf,"config3","config2" ,measures=alphaInd) p_nat$layers <- p_nat$layers[-1] #neworder<-c("input","matrixpure","matrix3per","rootpure","root3per") #p_nat$data$config3 <- ordered(p_nat$data$config3, levels= neworder) p1=p_nat+geom_boxplot(data=p_nat$data, aes(x=config3, y=value, color=config2), width=1)+ geom_point(size=4)+theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank())+ scale_colour_manual(values=color_palette) #ggtitle(paste0("Alpha diversity rarefication to ",rf, " sequencing depth")) subp2 = ggplot(data=p_nat$data[p_nat$data$variable=="Observed",], aes(x=config3, y=value, color=config2))+ geom_boxplot(width=1)+ geom_point(size=2)+theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(),legend.position="none")+ scale_colour_manual(values=color_palette) + facet_wrap(~variable) + scale_y_continuous(limits=c(0, 130), breaks=c(0,25,50,75,100,125)) kruskal.test(data=subp2$data, value ~ config3) posthoc.kruskal.conover.test(data=subp2$data, value ~ config3, method="BH") subp1 = ggplot(data=p_nat$data[p_nat$data$variable=="Shannon",], aes(x=config3, y=value, color=config2))+ geom_boxplot(width=1)+ geom_point(size=2)+theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(),legend.position="none")+ scale_colour_manual(values=color_palette) + facet_wrap(~variable) + scale_y_continuous(limits=c(0, 6), breaks=c(0,0.5,1.5,2.5,3.5,4.5,5.5)) kruskal.test(data=subp1$data, value ~ config3) posthoc.kruskal.conover.test(data=subp1$data, value ~ config3) gridExtra::grid.arrange(subp2, subp1, ncol=2)
/community_analysis/FlowPots_system/alpha-hs.R
no_license
hmamine/ciiwarm17
R
false
false
2,923
r
#***require packages for the analysis the analysis pkg=c("plyr", "ggplot2", "phyloseq", "data.table", "reshape2", "ape", "GUniFrac", "ape", "phytools", "metagenomeSeq", "ggtern","PMCMR") lapply(pkg, library, character.only = TRUE) rm(list = ls()[grep("*.*", ls())]) alphaInd = c("Shannon", "Observed") color_palette<-c("#000000","#806600","#803300","666666") # ***Upload and prepare phyloseq objects*** mat=read.table( "otu_table.txt", sep="\t", row.names=1, header=T) mat=as.matrix(mat) OTU=otu_table(mat, taxa_are_rows=T) tax=read.table("taxa_table.txt", sep="\t", row.names=1, header=1) tax=as.matrix(tax) TAXA=tax_table(tax) sd=read.table("sample_data.txt", sep="\t", row.names=1, header=1) SD=sample_data(sd) TREE=read.tree("16s_trim_v5v6_KG_DepExp_Derep.tree") physeq= phyloseq(OTU, TAXA, SD,TREE) #Remove samples with less than 1000 reads physeq1 = prune_samples(sample_sums(physeq) > 1000, physeq) #Select for full and hs depleted samples cond=c("input","afull","hs") physeq2=subset_samples(physeq1, config2 %in% cond) comm=c("Back","Comp") physeq2=subset_taxa(physeq2, tag %in% comm) #Rarefication to even depth based on smallest sample size rf=min(sample_sums(physeq2)) physeq.rrf=rarefy_even_depth(physeq2, rf, replace=TRUE) p_nat=plot_richness(physeq.rrf,"config3","config2" ,measures=alphaInd) p_nat$layers <- p_nat$layers[-1] #neworder<-c("input","matrixpure","matrix3per","rootpure","root3per") #p_nat$data$config3 <- ordered(p_nat$data$config3, levels= neworder) p1=p_nat+geom_boxplot(data=p_nat$data, aes(x=config3, y=value, color=config2), width=1)+ geom_point(size=4)+theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank())+ scale_colour_manual(values=color_palette) #ggtitle(paste0("Alpha diversity rarefication to ",rf, " sequencing depth")) subp2 = ggplot(data=p_nat$data[p_nat$data$variable=="Observed",], aes(x=config3, y=value, color=config2))+ geom_boxplot(width=1)+ geom_point(size=2)+theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(),legend.position="none")+ scale_colour_manual(values=color_palette) + facet_wrap(~variable) + scale_y_continuous(limits=c(0, 130), breaks=c(0,25,50,75,100,125)) kruskal.test(data=subp2$data, value ~ config3) posthoc.kruskal.conover.test(data=subp2$data, value ~ config3, method="BH") subp1 = ggplot(data=p_nat$data[p_nat$data$variable=="Shannon",], aes(x=config3, y=value, color=config2))+ geom_boxplot(width=1)+ geom_point(size=2)+theme_bw()+ theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(),legend.position="none")+ scale_colour_manual(values=color_palette) + facet_wrap(~variable) + scale_y_continuous(limits=c(0, 6), breaks=c(0,0.5,1.5,2.5,3.5,4.5,5.5)) kruskal.test(data=subp1$data, value ~ config3) posthoc.kruskal.conover.test(data=subp1$data, value ~ config3) gridExtra::grid.arrange(subp2, subp1, ncol=2)
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/bundle_linking.R \name{remove_duplicate_bundle_links} \alias{remove_duplicate_bundle_links} \title{remove_duplicate_bundle_links} \usage{ remove_duplicate_bundle_links(linked_bundles) } \arguments{ \item{linked_bundles}{output of link_bundles} } \value{ linked_bundles with duplicate links removed } \description{ remove_duplicate_bundle_links }
/man/remove_duplicate_bundle_links.Rd
no_license
gabrielburcea/clahrcnwlhf
R
false
true
425
rd
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/bundle_linking.R \name{remove_duplicate_bundle_links} \alias{remove_duplicate_bundle_links} \title{remove_duplicate_bundle_links} \usage{ remove_duplicate_bundle_links(linked_bundles) } \arguments{ \item{linked_bundles}{output of link_bundles} } \value{ linked_bundles with duplicate links removed } \description{ remove_duplicate_bundle_links }
library(plyr) library(dplyr) library(data.table) library(Stack) test = read.csv('/Train-Test Splits/Context/test.csv', header = TRUE) #Order LEs by 'user_id' setDT(test)[,freq := .N, by = "user_id"] test = test[order(freq, decreasing = T),] #Get the unique user_ids and their frequencies unique_user_id = with(test,aggregate(freq ~ user_id,FUN=function(x){unique(x)})) frequen = unique_user_id$freq frequen = sort(frequen, decreasing = TRUE) user = unique(test$user_id) #Positive LEs are given a rating 1 test$rating=1 test$freq = NULL #Creating a test set with one temporary positive LE to start with temp = test[1,] temp$lang = as.character(temp$lang) temp$hashtag = as.character(temp$hashtag) temp$tweet_lang = as.character(temp$tweet_lang) for (i in 1:length(user)) { #Get LEs of the particular user lis = filter( test, test$user_id ==user[i]) #Creating 9 negative samples for each positive sample of the 'user_id' notlis = do.call("rbind", replicate(9, lis, simplify = FALSE)) #Get vector of the languages that the user hasn't used notlang = setdiff(test$lang, lis$lang) notlang = rep(notlang,length.out=nrow(notlis)) #Get vector of the hashtags that the user hasn't used nothash = setdiff(test$hashtag, lis$hashtag) nothash = rep(nothash,length.out=nrow(notlis)) notlis$lang = notlang notlis$hashtag = nothash notlis$tweet_lang = notlang #Negative LEs are given a rating 0 notlis$rating = 0 #Stacking the negative samples for each user temp = Stack(temp, notlis) print(i) } #Discarding the temporary LE that was used at the beginning of creating the test set temp = temp[2:nrow(temp),] #Merging the positive and negative LEs to create the final test set test_all = Stack(test, temp) #Writing the final test set (to be input to FM) to file write.table(test_all, 'test_final_POP_USER.txt', quote = FALSE, col.names= FALSE, row.names = FALSE, sep = '\t')
/Context_POP_USER/test_POP_USER.r
no_license
asmitapoddar/nowplaying-RS-Music-Reco-FM
R
false
false
1,956
r
library(plyr) library(dplyr) library(data.table) library(Stack) test = read.csv('/Train-Test Splits/Context/test.csv', header = TRUE) #Order LEs by 'user_id' setDT(test)[,freq := .N, by = "user_id"] test = test[order(freq, decreasing = T),] #Get the unique user_ids and their frequencies unique_user_id = with(test,aggregate(freq ~ user_id,FUN=function(x){unique(x)})) frequen = unique_user_id$freq frequen = sort(frequen, decreasing = TRUE) user = unique(test$user_id) #Positive LEs are given a rating 1 test$rating=1 test$freq = NULL #Creating a test set with one temporary positive LE to start with temp = test[1,] temp$lang = as.character(temp$lang) temp$hashtag = as.character(temp$hashtag) temp$tweet_lang = as.character(temp$tweet_lang) for (i in 1:length(user)) { #Get LEs of the particular user lis = filter( test, test$user_id ==user[i]) #Creating 9 negative samples for each positive sample of the 'user_id' notlis = do.call("rbind", replicate(9, lis, simplify = FALSE)) #Get vector of the languages that the user hasn't used notlang = setdiff(test$lang, lis$lang) notlang = rep(notlang,length.out=nrow(notlis)) #Get vector of the hashtags that the user hasn't used nothash = setdiff(test$hashtag, lis$hashtag) nothash = rep(nothash,length.out=nrow(notlis)) notlis$lang = notlang notlis$hashtag = nothash notlis$tweet_lang = notlang #Negative LEs are given a rating 0 notlis$rating = 0 #Stacking the negative samples for each user temp = Stack(temp, notlis) print(i) } #Discarding the temporary LE that was used at the beginning of creating the test set temp = temp[2:nrow(temp),] #Merging the positive and negative LEs to create the final test set test_all = Stack(test, temp) #Writing the final test set (to be input to FM) to file write.table(test_all, 'test_final_POP_USER.txt', quote = FALSE, col.names= FALSE, row.names = FALSE, sep = '\t')
## This is the code for the programming assignment of week 3. ## Holds variables in memory for: ## - The input matrix ## - It's inverse (when required) makeCacheMatrix <- function(x = matrix()) { i <- NULL set <- function(y) { x <<- y i <<- NULL } get <- function() x setInverse <- function(inverse) i <<- inverse getInverse <- function() i list(set=set, get=get, getInverse=getInverse, setInverse=setInverse) } ## Calculates the inverse of the matrix in `x` if there's no cached result ## already. Otherwise, return the cached version. cacheSolve <- function(x, ...) { inverse <- x$getInverse() if (is.null(inverse)) { inverse <- solve(x$get(), ...) x$setInverse(inverse) } inverse }
/cachematrix.R
no_license
jverce/ProgrammingAssignment2
R
false
false
792
r
## This is the code for the programming assignment of week 3. ## Holds variables in memory for: ## - The input matrix ## - It's inverse (when required) makeCacheMatrix <- function(x = matrix()) { i <- NULL set <- function(y) { x <<- y i <<- NULL } get <- function() x setInverse <- function(inverse) i <<- inverse getInverse <- function() i list(set=set, get=get, getInverse=getInverse, setInverse=setInverse) } ## Calculates the inverse of the matrix in `x` if there's no cached result ## already. Otherwise, return the cached version. cacheSolve <- function(x, ...) { inverse <- x$getInverse() if (is.null(inverse)) { inverse <- solve(x$get(), ...) x$setInverse(inverse) } inverse }
#If the data files don't already exist, download and unzip them if(!file.exists("./summarySCC_PM25.rds")) { download.file("https://d396qusza40orc.cloudfront.net/exdata%2Fdata%2FNEI_data.zip", "./temp_data.zip") unzip("temp_data.zip") file.remove("./temp_data.zip") } # read the source files (if pm25 object does not already exist) if(!exists("pm25")) { pm25 <- readRDS("summarySCC_PM25.rds") } if(!exists("SCC")) { SCC <- readRDS("Source_Classification_Code.rds") } # Subset the SCC codes that belong to vehicle emissions by regex against the EI.Sector column # then filter pm25 by SCC code and Baltimore fips value, and aggregate and sum resulting Emissions by year vehicleSCC <- SCC[grep("vehicle", SCC$EI.Sector, ignore.case = TRUE), ] veh_emissions <- pm25[pm25$fips == "24510" & pm25$SCC %in% vehicleSCC$SCC, ] veh_emissions <- aggregate(Emissions ~ year, veh_emissions, sum) # create a new png device, plot the data, then close the device png("plot5.png") barplot(veh_emissions$Emissions, names.arg = veh_emissions$year, xlab = "Year", ylab = "PM25 emission (tons)", main = "Total PM2.5 emission from vehicle sources in Baltimore, MD") dev.off()
/Assignment 2 - Week 4/plot5.R
no_license
myer0154/Coursera--Exploratory-Data-Analysis
R
false
false
1,164
r
#If the data files don't already exist, download and unzip them if(!file.exists("./summarySCC_PM25.rds")) { download.file("https://d396qusza40orc.cloudfront.net/exdata%2Fdata%2FNEI_data.zip", "./temp_data.zip") unzip("temp_data.zip") file.remove("./temp_data.zip") } # read the source files (if pm25 object does not already exist) if(!exists("pm25")) { pm25 <- readRDS("summarySCC_PM25.rds") } if(!exists("SCC")) { SCC <- readRDS("Source_Classification_Code.rds") } # Subset the SCC codes that belong to vehicle emissions by regex against the EI.Sector column # then filter pm25 by SCC code and Baltimore fips value, and aggregate and sum resulting Emissions by year vehicleSCC <- SCC[grep("vehicle", SCC$EI.Sector, ignore.case = TRUE), ] veh_emissions <- pm25[pm25$fips == "24510" & pm25$SCC %in% vehicleSCC$SCC, ] veh_emissions <- aggregate(Emissions ~ year, veh_emissions, sum) # create a new png device, plot the data, then close the device png("plot5.png") barplot(veh_emissions$Emissions, names.arg = veh_emissions$year, xlab = "Year", ylab = "PM25 emission (tons)", main = "Total PM2.5 emission from vehicle sources in Baltimore, MD") dev.off()
### ========================================================================= ### RangedData objects ### ------------------------------------------------------------------------- ## For keeping data with your ranges ## There are two design aims: ## 1) Efficiency when data is large (i.e. apply by chromosome) ## 2) Convenience when data is not so large (i.e. unrolling the data) ## The ranges are stored in a IntegerRangesList, while the data is stored ## in a SplitDataFrameList. The IntegerRangesList is uncompressed, because ## users will likely want to apply over each IntegerRanges separately, ## as they are usually in separate spaces. Also, it is difficult to ## compress RangesLists, as lists containing Views or NCLists ## are uncompressible. The SplitDataFrameList should be compressed, ## because it's cheap to create from a split factor and, more ## importantly, cheap to get and set columns along the entire dataset, ## which is common. Usually the data columns are atomic vectors and ## thus trivially compressed. It does, however, incur a slight ## performance penalty when applying over the RangedData. setClass("RangedData", contains = c("DataTable", "List"), representation(ranges = "IntegerRangesList", values = "SplitDataFrameList"), prototype = prototype(ranges = new("SimpleIRangesList"), values = new("CompressedSplitDataFrameList"))) wmsg2 <- function(...) paste0(" ", paste0(strwrap(paste0(c(...), collapse="")), collapse="\n ")) RangedData_is_deprecated_msg <- c("RangedData objects are deprecated. ", "Please migrate your code to use GRanges or GRangesList objects instead. ", "See IMPORTANT NOTE in ?RangedData") RangedData_method_is_defunct_msg <- function(what) c("RangedData objects are deprecated and the ", what, " is now defunct. ", "Please migrate your code to use GRanges or GRangesList objects instead. ", "See IMPORTANT NOTE in ?RangedData") ### - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ### Accessor methods. ### setMethod("values", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) x@values }) setReplaceMethod("values", "RangedData", function(x, value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (extends(class(value), "SplitDataFrameList")) { if (!identical(elementNROWS(values(x)), elementNROWS(value))) stop("'value' must have same elementNROWS ", "as current 'values'") } else if (extends(class(value), "DataFrame")) { value <- split(value, space(x)) } else { stop("'value' must extend class SplitDataFrameList or DataFrame") } if (is.null(rownames(value)) && !is.null(rownames(x))) rownames(value) <- rownames(x) else if (!identical(rownames(value), rownames(values(x)))) stop("rownames of 'value', if non-NULL, must match the ", "rownames of 'x'") x@values <- value x }) setMethod("ranges", "RangedData", function(x, use.names=TRUE, use.mcols=FALSE) x@ranges ) setReplaceMethod("ranges", "RangedData", function(x, value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (extends(class(value), "IntegerRangesList")) { if (!identical(lapply(ranges(x), names), lapply(value, names))) stop("'value' must have same length and names as current 'ranges'") } else if (extends(class(value), "IRanges")) { value <- split(value, space(x)) } else { stop("'value' must extend class IntegerRangesList or IRanges") } x@ranges <- value x }) ## range delegates setMethod("start", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) start(unlist(ranges(x), use.names=FALSE)) }) setMethod("end", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) end(unlist(ranges(x), use.names=FALSE)) }) setMethod("width", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) width(unlist(ranges(x), use.names=FALSE)) }) setReplaceMethod("start", "RangedData", function(x, ..., value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) start(ranges(x), ...) <- value x }) setReplaceMethod("end", "RangedData", function(x, ..., value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) end(ranges(x), ...) <- value x }) setReplaceMethod("width", "RangedData", function(x, ..., value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) width(ranges(x), ...) <- value x }) setMethod("length", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) length(ranges(x)) }) setMethod("names", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) names(ranges(x)) }) setReplaceMethod("names", "RangedData", function(x, value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (!is.null(value) && !is.character(value)) stop("'value' must be NULL or a character vector") names(x@ranges) <- value names(x@values) <- value x }) setMethod("elementNROWS", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) elementNROWS(ranges(x)) }) setMethod("space", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) space(ranges(x)) }) setGeneric("universe", function(x) standardGeneric("universe")) setMethod("universe", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) universe(ranges(x)) }) setGeneric("universe<-", function(x, value) standardGeneric("universe<-")) setReplaceMethod("universe", "RangedData", function(x, value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) universe(x@ranges) <- value x }) setMethod("score", "RangedData", function(x) { what <- "score() getter for RangedData objects" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) score <- x[["score"]] ## if (is.null(score) && ncol(x) > 0 && is.numeric(x[[1L]])) ## score <- x[[1L]] score }) setReplaceMethod("score", "RangedData", function(x, value) { what <- "score() setter for RangedData objects" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) if (!is.numeric(value)) stop("score must be numeric") if (length(value) != nrow(x)) stop("number of scores must equal the number of rows") x[["score"]] <- value x }) ## values delegates setMethod("nrow", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) sum(nrow(values(x))) }) setMethod("ncol", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) ncol(values(x))[[1L]] }) setMethod("rownames", "RangedData", function(x, do.NULL = TRUE, prefix = "row") { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) rn <- unlist(rownames(values(x), do.NULL = do.NULL, prefix = prefix), use.names=FALSE) if (length(rn) == 0) rn <- NULL rn }) setMethod("colnames", "RangedData", function(x, do.NULL = TRUE, prefix = "col") { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (length(x) == 0) character() else colnames(values(x), do.NULL = do.NULL, prefix = prefix)[[1L]] }) setReplaceMethod("rownames", "RangedData", function(x, value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (!is.null(value)) { if (length(value) != nrow(x)) { stop("invalid 'row.names' length") } else { if (!is.character(value)) value <- as.character(value) ends <- cumsum(elementNROWS(x)) value <- new("CompressedCharacterList", unlistData = value, partitioning = PartitioningByEnd(ends)) } } ranges <- ranges(x) for(i in seq_len(length(ranges))) { names(ranges[[i]]) <- value[[i]] } x@ranges <- ranges rownames(x@values) <- value x }) setReplaceMethod("colnames", "RangedData", function(x, value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) colnames(x@values) <- value x }) setMethod("columnMetadata", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) columnMetadata(values(x)) }) setReplaceMethod("columnMetadata", "RangedData", function(x, value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) columnMetadata(values(x)) <- value x }) ### - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ### Validity. ### .valid.RangedData.ranges <- function(x) { if (!identical(lapply(ranges(x), length), lapply(values(x), nrow))) "'ranges' and 'values' must be of the same length and have the same names" else if (!identical(unlist(lapply(ranges(x), names), use.names=FALSE), rownames(x))) "the names of the ranges must equal the rownames" else NULL } .valid.RangedData.names <- function(x) { nms <- names(x) if (length(nms) != length(x)) "length(names(x)) must equal length(x)" else if (!is.character(nms) || S4Vectors:::anyMissing(nms) || anyDuplicated(nms)) "names(x) must be a character vector without any NA's or duplicates" else NULL } .valid.RangedData <- function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) c(.valid.RangedData.ranges(x), .valid.RangedData.names(x)) } setValidity2("RangedData", .valid.RangedData) ### - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ### Constructor. ### ## creates a single-element RangedData (unless splitter (space) is specified) RangedData <- function(ranges = IRanges(), ..., space = NULL) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) hasDots <- (((nargs() - !missing(space))) > 1) if (is(ranges, "IntegerRangesList") && !is(ranges, "IntegerRanges")) { if (!is.null(space)) warning("since 'class(ranges)' extends IntegerRangesList, 'space' argument is ignored") if (is.null(names(ranges))) names(ranges) <- as.character(seq_len(length(ranges))) space <- Rle(factor(names(ranges), levels = names(ranges)), elementNROWS(ranges)) N <- sum(elementNROWS(ranges)) NAMES <- unlist(lapply(ranges, names), use.names=FALSE) } else { if (!is(ranges, "IntegerRanges")) { coerced <- try(as(ranges, "RangedData"), silent=TRUE) if (is(coerced, "RangedData")) return(coerced) stop("'ranges' must be an IntegerRanges or directly coercible to RangedData") } N <- length(ranges) NAMES <- names(ranges) if (is.null(space)) { if (N == 0) space <- Rle(factor()) else space <- Rle(factor("1")) } else if (!is(space, "Rle")) { space <- Rle(space) } if (!is.factor(runValue(space))) runValue(space) <- factor(runValue(space)) if (length(space) != N) { if (length(space) == 0L) stop("'space' is a 0-length vector but length of 'ranges' is > 0") ## We make an exception to the "length(space) must be <= N" rule when ## N != 0L so we can support the direct creation of RangedData objects ## with 0 rows across 1 or more user-specified spaces like in: ## RangedData(ranges=IRanges(), space=letters) if (N != 0L && length(space) > N) stop("length of 'space' greater than length of 'ranges'") if (N %% length(space) != 0) stop("length of 'ranges' not a multiple of 'space' length") space <- rep(space, length.out = N) } if (!is(ranges, "IRanges")) ranges <- as(ranges, "IRanges") ranges <- split(ranges, space) } if (hasDots) { args <- list(...) if (length(args) == 1L && is(args[[1L]], "SplitDataFrameList")) { values <- unlist(args[[1L]], use.names=FALSE) } else { values <- DataFrame(...) } } else values <- S4Vectors:::make_zero_col_DataFrame(N) if (N != nrow(values)) { if (nrow(values) > N) stop("length of value(s) in '...' greater than length of 'ranges'") if (nrow(values) == 0 || N %% nrow(values) != 0) stop("length of 'ranges' not a multiple of length of value(s) in '...'") rind <- S4Vectors:::recycleVector(seq_len(nrow(values)), N) values <- values[rind,,drop=FALSE] } rownames(values) <- NAMES ## ensure these are identical values <- split(values, space) new2("RangedData", ranges = ranges, values = values, check=FALSE) } ### - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ### Subsetting. ### ## The extraction operator delegates to the values (extracts columns) setMethod("[[", "RangedData", function(x, i, j, ...) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) dotArgs <- list(...) if (length(dotArgs) > 0) dotArgs <- dotArgs[names(dotArgs) != "exact"] if (!missing(j) || length(dotArgs) > 0) stop("invalid subsetting") if (missing(i)) stop("subscript is missing") if (!is.character(i) && !is.numeric(i)) stop("invalid subscript type") if (length(i) < 1L) stop("attempt to select less than one element") if (length(i) > 1L) stop("attempt to select more than one element") if (is.numeric(i) && !is.na(i) && (i < 1L || i > ncol(x))) stop("subscript out of bounds") if (is.na(i) || (is.character(i) && !(i %in% c("space", "ranges", colnames(x))))) NULL else if (i == "space") space(x) else if (i == "ranges") unlist(ranges(x), use.names=FALSE) else unlist(values(x), use.names=FALSE)[[i]] }) setReplaceMethod("[[", "RangedData", function(x, i, j,..., value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (!missing(j) || length(list(...)) > 0) stop("invalid subsetting") if (missing(i)) stop("subscript is missing") if (!is.character(i) && !is.numeric(i)) stop("invalid subscript type") if (length(i) < 1L) stop("attempt to select less than one element") if (length(i) > 1L) stop("attempt to select more than one element") if (is.numeric(i) && (i < 1L || i > ncol(x) + 1L)) stop("subscript out of bounds") if (i == "space") stop("cannot replace \"space\" information") if (i == "ranges") { ranges(x) <- value } else { nrx <- nrow(x) lv <- length(value) if (!is.null(value) && (nrx != lv)) { if ((nrx == 0) || (nrx %% lv != 0)) stop(paste(lv, "elements in value to replace", nrx, "elements")) else value <- rep(value, length.out = nrx) } nrows <- elementNROWS(values(x)) inds <- seq_len(length(x)) spaces <- factor(rep.int(inds, nrows), inds) values <- unlist(values(x), use.names=FALSE) values[[i]] <- value x@values <- split(values, spaces) names(x@values) <- names(x) } x }) ### Supported index types: numeric, logical, character, NULL and missing. ## Two index modes: ## - list style ([i]): subsets by range space (e.g. chromosome) ## - matrix style ([i,j]): subsets the data frame setMethod("[", "RangedData", function(x, i, j, ..., drop=FALSE) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (length(list(...)) > 0) stop("parameters in '...' not supported") if (missing(i) && missing(j)) return(x) checkIndex <- function(i, lx, nms) { if (!is.atomic(i)) return("invalid subscript type") if (is.numeric(i)) { if (!is.integer(i)) i <- as.integer(i) if (S4Vectors:::anyMissingOrOutside(i, upper = lx)) return("subscript contains NAs or out of bounds indices") if (S4Vectors:::anyMissingOrOutside(i, 0L, lx) && S4Vectors:::anyMissingOrOutside(i, upper = 0L)) return("negative and positive indices cannot be mixed") } else if (is.logical(i)) { if (S4Vectors:::anyMissing(i)) return("subscript contains NAs") if (length(i) > lx) return("subscript out of bounds") } else if ((is.character(i) || is.factor(i))) { if (S4Vectors:::anyMissing(i)) return("subscript contains NAs") if (S4Vectors:::anyMissing(match(i, nms))) return("mismatching names") } else if (!is.null(i)) { return("invalid subscript type") } NULL } mstyle <- nargs() > 2 if (mstyle) { ranges <- ranges(x) values <- values(x) if (!missing(j)) { prob <- checkIndex(j, ncol(x), colnames(x)) if (!is.null(prob)) stop("selecting cols: ", prob) values <- values[, j, drop=FALSE] } if (!missing(i)) { if (is(i, "IntegerRangesList")) stop("subsetting a RangedData object ", "by an IntegerRangesList subscript is not supported") if (is(i, "LogicalList")) { x_eltNROWS <- elementNROWS(ranges(x)) whichRep <- which(x_eltNROWS != elementNROWS(i)) for (k in whichRep) i[[k]] <- rep(i[[k]], length.out = x_eltNROWS[k]) i <- unlist(i, use.names=FALSE) } else if (is(i, "IntegerList")) { itemp <- LogicalList(lapply(elementNROWS(ranges(x)), rep, x = FALSE)) for (k in seq_len(length(itemp))) itemp[[k]][i[[k]]] <- TRUE i <- unlist(itemp, use.names=FALSE) } prob <- checkIndex(i, nrow(x), rownames(x)) if (!is.null(prob)) stop("selecting rows: ", prob) if (is.numeric(i) && any(i < 0)) i <- setdiff(seq(nrow(x)), -i) if (is.logical(i)) { igroup <- factor(rep.int(seq_len(length(x)), elementNROWS(x)), levels = seq_len(length(x))) if (length(i) < nrow(x)) i <- rep(i, length.out = nrow(x)) } else { if (is.null(i)) i <- integer(0) if (is.factor(i)) i <- as.character(i) if (is.character(i)) { dummy <- seq_len(nrow(x)) names(dummy) <- rownames(x) i <- dummy[i] if (S4Vectors:::anyMissing(i)) ## cannot subset by NAs yet stop("invalid rownames specified") } starts <- cumsum(c(1L, head(elementNROWS(x), -1))) igroup <- factor(findInterval(i, starts), levels = seq_len(length(x))) if (anyDuplicated(runValue(Rle(igroup)))) stop("cannot mix row indices from different spaces") i <- i - (starts - 1L)[as.integer(igroup)] } isplit <- split(i, igroup) names(isplit) <- names(x) ranges <- S4Vectors:::subset_List_by_List(ranges, isplit) values <- S4Vectors:::subset_List_by_List(values, isplit) if (drop) { ok <- (elementNROWS(ranges) > 0) ranges <- ranges[ok] values <- values[ok] } } } else { if (!missing(i)) { prob <- checkIndex(i, length(x), names(x)) if (!is.null(prob)) stop("selecting spaces: ", prob) ranges <- ranges(x)[i] values <- values(x)[i] } } x@ranges <- ranges x@values <- values x }) ### - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ### Combining and splitting. ### setMethod("c", "RangedData", function(x, ..., recursive = FALSE) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (!identical(recursive, FALSE)) stop("\"c\" method for RangedData objects ", "does not support the 'recursive' argument") if (missing(x)) rds <- unname(list(...)) else rds <- unname(list(x, ...)) rd <- rds[[1L]] if (!all(sapply(rds, is, "RangedData"))) stop("all arguments in '...' must be RangedData objects") nms <- lapply(rds, ## figure out names like 'c' on an ordinary vector function(rd) structure(logical(length(rd)), names = names(rd))) nms <- names(do.call(c, nms)) names(rds) <- NULL # critical for dispatch to work ranges <- do.call(c, lapply(rds, ranges)) values <- do.call(c, lapply(rds, values)) names(ranges) <- nms rd@ranges <- ranges names(values) <- nms rd@values <- values rd }) setMethod("rbind", "RangedData", function(..., deparse.level=1) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) args <- unname(list(...)) rls <- lapply(args, ranges) nms <- unique(unlist(lapply(args, names), use.names=FALSE)) rls <- lapply(rls, function(x) {y <- as.list(x)[nms];names(y) <- nms;y}) dfs <- lapply(args, function(x) {y <- as.list(values(x))[nms];names(y) <- nms;y}) safe.c <- function(...) { x <- list(...) do.call(c, x[!sapply(x, is.null)]) } rls <- IRangesList(do.call(Map, c(list(safe.c), rls))) safe.rbind <- function(...) { x <- list(...) do.call(rbind, x[!sapply(x, is.null)]) } dfs <- SplitDataFrameList(do.call(Map, c(list(safe.rbind), dfs))) for (i in seq_len(length(rls))) names(rls[[i]]) <- rownames(dfs[[i]]) initialize(args[[1L]], ranges = rls, values = dfs) }) ### - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ### Coercion ### ### The 2 functions, as.data.frame.IntegerRangesList() and ### as.data.frame.DataFrameList() are needed for as.data.frame.RangedData(). ### ### A new as.data.frame,List method was implemented in BioC 2.15 and ### is now used by all List classes. Because the RangedData class is being ### phased out, we want to retain the old behavior. In order to do that ### we have to keep these 2 helpers because as.data.frame.RangedData() ### uses old methods from both IntegerRangesList and DataFrameList. ### ### These helpers are not exported. .as.data.frame.IntegerRangesList <- function(x, row.names=NULL, optional=FALSE, ...) { if (!(is.null(row.names) || is.character(row.names))) stop("'row.names' must be NULL or a character vector") x <- as(x, "CompressedIRangesList") spaceLevels <- seq_len(length(x)) if (length(names(x)) > 0) { spaceLabels <- names(x) } else { spaceLabels <- as.character(spaceLevels) } data.frame(space = factor(rep.int(seq_len(length(x)), elementNROWS(x)), levels = spaceLevels, labels = spaceLabels), as.data.frame(unlist(x, use.names = FALSE)), row.names = row.names, stringsAsFactors = FALSE) } .as.data.frame.DataFrameList <- function(x, row.names=NULL, optional=FALSE, ...) { if (!(is.null(row.names) || is.character(row.names))) stop("'row.names' must be NULL or a character vector") if (!missing(optional) || length(list(...))) warning("'optional' and arguments in '...' ignored") stacked <- stack(x) if (is.null(row.names)) row.names <- rownames(stacked) as.data.frame(stacked, row.names = row.names, optional = optional) } .as.data.frame.RangedData <- function(x, row.names=NULL, optional=FALSE, ...) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (!(is.null(row.names) || is.character(row.names))) stop("'row.names' must be NULL or a character vector") if (!missing(optional) || length(list(...))) warning("'optional' and arguments in '...' ignored") data.frame(.as.data.frame.IntegerRangesList(ranges(x)), .as.data.frame.DataFrameList(values(x))[-1L], row.names = row.names, stringsAsFactors = FALSE) } setMethod("as.data.frame", "RangedData", .as.data.frame.RangedData) setAs("RangedData", "DataFrame", function(from) { DataFrame(as.data.frame(ranges(from)), unlist(values(from), use.names=FALSE)) }) setAs("Rle", "RangedData", function(from) { what <- "coercion method from Rle to RangedData" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) new2("RangedData", ranges = IRangesList("1" = successiveIRanges(runLength(from))), values = SplitDataFrameList("1" = DataFrame(score = runValue(from))), metadata = metadata(from), check = FALSE) }) setAs("RleList", "RangedData", function(from) { what <- "coercion method from RleList to RangedData" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) ranges <- IRangesList(lapply(from, function(x) successiveIRanges(runLength(x)))) values <- SplitDataFrameList(lapply(from, function(x) DataFrame(score = runValue(x)))) if (is.null(names(from))) { nms <- as.character(seq_len(length(from))) names(ranges) <- nms names(values) <- nms } new2("RangedData", ranges = ranges, values = values, metadata = metadata(from), elementMetadata = elementMetadata(from, use.names=FALSE), check = FALSE) }) setAs("RleViewsList", "RangedData", function(from) { what <- "coercion method from RleViewsList to RangedData" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) subject <- subject(from) from_ranges <- restrict(ranges(from), 1L, elementNROWS(subject), keep.all.ranges = TRUE) ### FIXME: do we want to insert NAs for out of bounds views? score <- subject[from_ranges] score_part <- as(lapply(width(from_ranges), PartitioningByWidth), "IntegerRangesList") score_ranges <- ranges(score) ol <- findOverlaps(score_ranges, score_part) offind <- as(lapply(ol, subjectHits), "IntegerList") offset <- (start(from_ranges) - start(score_part))[offind] ranges <- shift(ranges(ol, score_ranges, score_part), offset) viewNames <- lapply(from_ranges, function(x) { if (is.null(names(x))) seq_len(length(x)) else names(x) }) RangedData(ranges, score = unlist(runValue(score), use.names = FALSE)[queryHits(ol)], view = unlist(viewNames, use.names = FALSE)[subjectHits(ol)]) }) setAs("IntegerRanges", "RangedData", function(from) { what <- "coercion method from IntegerRanges to RangedData" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) RangedData(from) }) setAs("IntegerRangesList", "RangedData", function(from) { what <- "coercion method from IntegerRangesList to RangedData" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) from_names <- names(from) if (is.null(from_names) || anyDuplicated(from_names)) stop("cannot coerce a IntegerRangesList object with no names ", "or duplicated names to a RangedData object") unlisted_from <- unlist(from, use.names=FALSE) unlisted_values <- mcols(unlisted_from, use.names=FALSE) mcols(unlisted_from) <- NULL ans_ranges <- relist(unlisted_from, skeleton=from) metadata(ans_ranges) <- metadata(from) if (!is(unlisted_values, "DataFrame")) { if (!is.null(unlisted_values)) warning("could not propagate the inner metadata columns of ", "'from' (accessed with 'mcols(unlist(from))') ", "to the data columns (aka values) of the returned ", "RangedData object") unlisted_values <- S4Vectors:::make_zero_col_DataFrame(length(unlisted_from)) } ans_values <- newCompressedList0("CompressedSplitDataFrameList", unlisted_values, PartitioningByEnd(ans_ranges)) new2("RangedData", ranges=ans_ranges, values=ans_values, #metadata=metadata(from), elementMetadata=elementMetadata(from, use.names=FALSE), check=FALSE) } ) setAs("list", "RangedData", function(from) { what <- "coercion method from list to RangedData" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) do.call(c, unname(from)) } ) .fromRangedDataToCompressedIRangesList <- function(from) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) ans <- ranges(from) ## Propagate 'values(from)'. ans_unlisted_values <- unlist(values(from), use.names=FALSE) mcols(ans@unlistData) <- ans_unlisted_values ans } setAs("RangedData", "CompressedIRangesList", .fromRangedDataToCompressedIRangesList ) setAs("RangedData", "IRangesList", .fromRangedDataToCompressedIRangesList) setMethod("as.env", "RangedData", function(x, enclos = parent.frame(2)) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) env <- S4Vectors:::makeEnvForNames(x, colnames(x), enclos) makeAccessorBinding <- function(fun, name = deparse(substitute(fun))) { makeActiveBinding(name, function() { val <- fun(x) rm(list=name, envir=env) assign(name, val, env) ## cache for further use val }, env) } makeAccessorBinding(ranges) makeAccessorBinding(space) makeAccessorBinding(start) makeAccessorBinding(width) makeAccessorBinding(end) env }) .RangedData_fromDataFrame <- function(from) { what <- "coercion method from data.frame or DataTable to RangedData" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) required <- c("start", "end") if (!all(required %in% colnames(from))) stop("'from' must at least include a 'start' and 'end' column") datacols <- setdiff(colnames(from), c(required, "space", "width")) RangedData(IRanges(from$start, from$end), from[,datacols,drop=FALSE], space = from$space) } setAs("data.frame", "RangedData", .RangedData_fromDataFrame) setAs("DataTable", "RangedData", .RangedData_fromDataFrame) ### - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ### Show ### .show_RangedData <- function(object) { nr <- nrow(object) nc <- ncol(object) lo <- length(object) cat(class(object), " with ", nr, ifelse(nr == 1, " row and ", " rows and "), nc, ifelse(nc == 1, " value column across ", " value columns across "), lo, ifelse(lo == 1, " space\n", " spaces\n"), sep = "") if (nr > 0) { nms <- rownames(object) if (nr < 20) { ranges <- unlist(ranges(object), use.names=FALSE) values <- unlist(values(object), use.names=FALSE) out <- cbind(space = as.character(space(object)), ranges = showAsCell(ranges), "|" = rep.int("|", nr)) if (nc > 0) out <- cbind(out, as.matrix(format(do.call(data.frame, lapply(values, showAsCell))))) if (is.null(nms)) rownames(out) <- as.character(seq_len(nr)) else rownames(out) <- nms classinfo <- matrix(c("<factor>", "<IRanges>", "|", unlist(lapply(values, function(x) { paste("<", classNameForDisplay(x), ">", sep = "") }), use.names = FALSE)), nrow = 1, dimnames = list("", colnames(out))) } else { top <- object[1:9, ] topRanges <- unlist(ranges(top), use.names=FALSE) topValues <- unlist(values(top), use.names=FALSE) bottom <- object[(nr-8L):nr, ] bottomRanges <- unlist(ranges(bottom), use.names=FALSE) bottomValues <- unlist(values(bottom), use.names=FALSE) out <- rbind(cbind(space = as.character(space(top)), ranges = showAsCell(topRanges), "|" = rep.int("|", 9)), rbind(rep.int("...", 3)), cbind(space = as.character(space(bottom)), ranges = showAsCell(bottomRanges), "|" = rep.int("|", 9))) if (nc > 0) out <- cbind(out, rbind(as.matrix(format(do.call(data.frame, lapply(topValues, showAsCell)))), rbind(rep.int("...", nc)), rbind(as.matrix(format(do.call(data.frame, lapply(bottomValues, showAsCell))))))) if (is.null(nms)) { rownames(out) <- c(as.character(1:9), "...", as.character((nr-8L):nr)) } else { rownames(out) <- c(head(nms, 9), "...", tail(nms, 9)) } classinfo <- matrix(c("<factor>", "<IRanges>", "|", unlist(lapply(topValues, function(x) { paste("<", classNameForDisplay(x), ">", sep = "") }), use.names = FALSE)), nrow = 1, dimnames = list("", colnames(out))) } out <- rbind(classinfo, out) print(out, quote = FALSE, right = TRUE) } } setMethod("show", "RangedData", function(object) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) suppressWarnings(.show_RangedData(object)) })
/R/RangedData-class.R
no_license
rajaldebnath/IRanges
R
false
false
37,081
r
### ========================================================================= ### RangedData objects ### ------------------------------------------------------------------------- ## For keeping data with your ranges ## There are two design aims: ## 1) Efficiency when data is large (i.e. apply by chromosome) ## 2) Convenience when data is not so large (i.e. unrolling the data) ## The ranges are stored in a IntegerRangesList, while the data is stored ## in a SplitDataFrameList. The IntegerRangesList is uncompressed, because ## users will likely want to apply over each IntegerRanges separately, ## as they are usually in separate spaces. Also, it is difficult to ## compress RangesLists, as lists containing Views or NCLists ## are uncompressible. The SplitDataFrameList should be compressed, ## because it's cheap to create from a split factor and, more ## importantly, cheap to get and set columns along the entire dataset, ## which is common. Usually the data columns are atomic vectors and ## thus trivially compressed. It does, however, incur a slight ## performance penalty when applying over the RangedData. setClass("RangedData", contains = c("DataTable", "List"), representation(ranges = "IntegerRangesList", values = "SplitDataFrameList"), prototype = prototype(ranges = new("SimpleIRangesList"), values = new("CompressedSplitDataFrameList"))) wmsg2 <- function(...) paste0(" ", paste0(strwrap(paste0(c(...), collapse="")), collapse="\n ")) RangedData_is_deprecated_msg <- c("RangedData objects are deprecated. ", "Please migrate your code to use GRanges or GRangesList objects instead. ", "See IMPORTANT NOTE in ?RangedData") RangedData_method_is_defunct_msg <- function(what) c("RangedData objects are deprecated and the ", what, " is now defunct. ", "Please migrate your code to use GRanges or GRangesList objects instead. ", "See IMPORTANT NOTE in ?RangedData") ### - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ### Accessor methods. ### setMethod("values", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) x@values }) setReplaceMethod("values", "RangedData", function(x, value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (extends(class(value), "SplitDataFrameList")) { if (!identical(elementNROWS(values(x)), elementNROWS(value))) stop("'value' must have same elementNROWS ", "as current 'values'") } else if (extends(class(value), "DataFrame")) { value <- split(value, space(x)) } else { stop("'value' must extend class SplitDataFrameList or DataFrame") } if (is.null(rownames(value)) && !is.null(rownames(x))) rownames(value) <- rownames(x) else if (!identical(rownames(value), rownames(values(x)))) stop("rownames of 'value', if non-NULL, must match the ", "rownames of 'x'") x@values <- value x }) setMethod("ranges", "RangedData", function(x, use.names=TRUE, use.mcols=FALSE) x@ranges ) setReplaceMethod("ranges", "RangedData", function(x, value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (extends(class(value), "IntegerRangesList")) { if (!identical(lapply(ranges(x), names), lapply(value, names))) stop("'value' must have same length and names as current 'ranges'") } else if (extends(class(value), "IRanges")) { value <- split(value, space(x)) } else { stop("'value' must extend class IntegerRangesList or IRanges") } x@ranges <- value x }) ## range delegates setMethod("start", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) start(unlist(ranges(x), use.names=FALSE)) }) setMethod("end", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) end(unlist(ranges(x), use.names=FALSE)) }) setMethod("width", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) width(unlist(ranges(x), use.names=FALSE)) }) setReplaceMethod("start", "RangedData", function(x, ..., value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) start(ranges(x), ...) <- value x }) setReplaceMethod("end", "RangedData", function(x, ..., value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) end(ranges(x), ...) <- value x }) setReplaceMethod("width", "RangedData", function(x, ..., value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) width(ranges(x), ...) <- value x }) setMethod("length", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) length(ranges(x)) }) setMethod("names", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) names(ranges(x)) }) setReplaceMethod("names", "RangedData", function(x, value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (!is.null(value) && !is.character(value)) stop("'value' must be NULL or a character vector") names(x@ranges) <- value names(x@values) <- value x }) setMethod("elementNROWS", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) elementNROWS(ranges(x)) }) setMethod("space", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) space(ranges(x)) }) setGeneric("universe", function(x) standardGeneric("universe")) setMethod("universe", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) universe(ranges(x)) }) setGeneric("universe<-", function(x, value) standardGeneric("universe<-")) setReplaceMethod("universe", "RangedData", function(x, value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) universe(x@ranges) <- value x }) setMethod("score", "RangedData", function(x) { what <- "score() getter for RangedData objects" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) score <- x[["score"]] ## if (is.null(score) && ncol(x) > 0 && is.numeric(x[[1L]])) ## score <- x[[1L]] score }) setReplaceMethod("score", "RangedData", function(x, value) { what <- "score() setter for RangedData objects" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) if (!is.numeric(value)) stop("score must be numeric") if (length(value) != nrow(x)) stop("number of scores must equal the number of rows") x[["score"]] <- value x }) ## values delegates setMethod("nrow", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) sum(nrow(values(x))) }) setMethod("ncol", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) ncol(values(x))[[1L]] }) setMethod("rownames", "RangedData", function(x, do.NULL = TRUE, prefix = "row") { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) rn <- unlist(rownames(values(x), do.NULL = do.NULL, prefix = prefix), use.names=FALSE) if (length(rn) == 0) rn <- NULL rn }) setMethod("colnames", "RangedData", function(x, do.NULL = TRUE, prefix = "col") { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (length(x) == 0) character() else colnames(values(x), do.NULL = do.NULL, prefix = prefix)[[1L]] }) setReplaceMethod("rownames", "RangedData", function(x, value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (!is.null(value)) { if (length(value) != nrow(x)) { stop("invalid 'row.names' length") } else { if (!is.character(value)) value <- as.character(value) ends <- cumsum(elementNROWS(x)) value <- new("CompressedCharacterList", unlistData = value, partitioning = PartitioningByEnd(ends)) } } ranges <- ranges(x) for(i in seq_len(length(ranges))) { names(ranges[[i]]) <- value[[i]] } x@ranges <- ranges rownames(x@values) <- value x }) setReplaceMethod("colnames", "RangedData", function(x, value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) colnames(x@values) <- value x }) setMethod("columnMetadata", "RangedData", function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) columnMetadata(values(x)) }) setReplaceMethod("columnMetadata", "RangedData", function(x, value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) columnMetadata(values(x)) <- value x }) ### - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ### Validity. ### .valid.RangedData.ranges <- function(x) { if (!identical(lapply(ranges(x), length), lapply(values(x), nrow))) "'ranges' and 'values' must be of the same length and have the same names" else if (!identical(unlist(lapply(ranges(x), names), use.names=FALSE), rownames(x))) "the names of the ranges must equal the rownames" else NULL } .valid.RangedData.names <- function(x) { nms <- names(x) if (length(nms) != length(x)) "length(names(x)) must equal length(x)" else if (!is.character(nms) || S4Vectors:::anyMissing(nms) || anyDuplicated(nms)) "names(x) must be a character vector without any NA's or duplicates" else NULL } .valid.RangedData <- function(x) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) c(.valid.RangedData.ranges(x), .valid.RangedData.names(x)) } setValidity2("RangedData", .valid.RangedData) ### - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ### Constructor. ### ## creates a single-element RangedData (unless splitter (space) is specified) RangedData <- function(ranges = IRanges(), ..., space = NULL) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) hasDots <- (((nargs() - !missing(space))) > 1) if (is(ranges, "IntegerRangesList") && !is(ranges, "IntegerRanges")) { if (!is.null(space)) warning("since 'class(ranges)' extends IntegerRangesList, 'space' argument is ignored") if (is.null(names(ranges))) names(ranges) <- as.character(seq_len(length(ranges))) space <- Rle(factor(names(ranges), levels = names(ranges)), elementNROWS(ranges)) N <- sum(elementNROWS(ranges)) NAMES <- unlist(lapply(ranges, names), use.names=FALSE) } else { if (!is(ranges, "IntegerRanges")) { coerced <- try(as(ranges, "RangedData"), silent=TRUE) if (is(coerced, "RangedData")) return(coerced) stop("'ranges' must be an IntegerRanges or directly coercible to RangedData") } N <- length(ranges) NAMES <- names(ranges) if (is.null(space)) { if (N == 0) space <- Rle(factor()) else space <- Rle(factor("1")) } else if (!is(space, "Rle")) { space <- Rle(space) } if (!is.factor(runValue(space))) runValue(space) <- factor(runValue(space)) if (length(space) != N) { if (length(space) == 0L) stop("'space' is a 0-length vector but length of 'ranges' is > 0") ## We make an exception to the "length(space) must be <= N" rule when ## N != 0L so we can support the direct creation of RangedData objects ## with 0 rows across 1 or more user-specified spaces like in: ## RangedData(ranges=IRanges(), space=letters) if (N != 0L && length(space) > N) stop("length of 'space' greater than length of 'ranges'") if (N %% length(space) != 0) stop("length of 'ranges' not a multiple of 'space' length") space <- rep(space, length.out = N) } if (!is(ranges, "IRanges")) ranges <- as(ranges, "IRanges") ranges <- split(ranges, space) } if (hasDots) { args <- list(...) if (length(args) == 1L && is(args[[1L]], "SplitDataFrameList")) { values <- unlist(args[[1L]], use.names=FALSE) } else { values <- DataFrame(...) } } else values <- S4Vectors:::make_zero_col_DataFrame(N) if (N != nrow(values)) { if (nrow(values) > N) stop("length of value(s) in '...' greater than length of 'ranges'") if (nrow(values) == 0 || N %% nrow(values) != 0) stop("length of 'ranges' not a multiple of length of value(s) in '...'") rind <- S4Vectors:::recycleVector(seq_len(nrow(values)), N) values <- values[rind,,drop=FALSE] } rownames(values) <- NAMES ## ensure these are identical values <- split(values, space) new2("RangedData", ranges = ranges, values = values, check=FALSE) } ### - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ### Subsetting. ### ## The extraction operator delegates to the values (extracts columns) setMethod("[[", "RangedData", function(x, i, j, ...) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) dotArgs <- list(...) if (length(dotArgs) > 0) dotArgs <- dotArgs[names(dotArgs) != "exact"] if (!missing(j) || length(dotArgs) > 0) stop("invalid subsetting") if (missing(i)) stop("subscript is missing") if (!is.character(i) && !is.numeric(i)) stop("invalid subscript type") if (length(i) < 1L) stop("attempt to select less than one element") if (length(i) > 1L) stop("attempt to select more than one element") if (is.numeric(i) && !is.na(i) && (i < 1L || i > ncol(x))) stop("subscript out of bounds") if (is.na(i) || (is.character(i) && !(i %in% c("space", "ranges", colnames(x))))) NULL else if (i == "space") space(x) else if (i == "ranges") unlist(ranges(x), use.names=FALSE) else unlist(values(x), use.names=FALSE)[[i]] }) setReplaceMethod("[[", "RangedData", function(x, i, j,..., value) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (!missing(j) || length(list(...)) > 0) stop("invalid subsetting") if (missing(i)) stop("subscript is missing") if (!is.character(i) && !is.numeric(i)) stop("invalid subscript type") if (length(i) < 1L) stop("attempt to select less than one element") if (length(i) > 1L) stop("attempt to select more than one element") if (is.numeric(i) && (i < 1L || i > ncol(x) + 1L)) stop("subscript out of bounds") if (i == "space") stop("cannot replace \"space\" information") if (i == "ranges") { ranges(x) <- value } else { nrx <- nrow(x) lv <- length(value) if (!is.null(value) && (nrx != lv)) { if ((nrx == 0) || (nrx %% lv != 0)) stop(paste(lv, "elements in value to replace", nrx, "elements")) else value <- rep(value, length.out = nrx) } nrows <- elementNROWS(values(x)) inds <- seq_len(length(x)) spaces <- factor(rep.int(inds, nrows), inds) values <- unlist(values(x), use.names=FALSE) values[[i]] <- value x@values <- split(values, spaces) names(x@values) <- names(x) } x }) ### Supported index types: numeric, logical, character, NULL and missing. ## Two index modes: ## - list style ([i]): subsets by range space (e.g. chromosome) ## - matrix style ([i,j]): subsets the data frame setMethod("[", "RangedData", function(x, i, j, ..., drop=FALSE) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (length(list(...)) > 0) stop("parameters in '...' not supported") if (missing(i) && missing(j)) return(x) checkIndex <- function(i, lx, nms) { if (!is.atomic(i)) return("invalid subscript type") if (is.numeric(i)) { if (!is.integer(i)) i <- as.integer(i) if (S4Vectors:::anyMissingOrOutside(i, upper = lx)) return("subscript contains NAs or out of bounds indices") if (S4Vectors:::anyMissingOrOutside(i, 0L, lx) && S4Vectors:::anyMissingOrOutside(i, upper = 0L)) return("negative and positive indices cannot be mixed") } else if (is.logical(i)) { if (S4Vectors:::anyMissing(i)) return("subscript contains NAs") if (length(i) > lx) return("subscript out of bounds") } else if ((is.character(i) || is.factor(i))) { if (S4Vectors:::anyMissing(i)) return("subscript contains NAs") if (S4Vectors:::anyMissing(match(i, nms))) return("mismatching names") } else if (!is.null(i)) { return("invalid subscript type") } NULL } mstyle <- nargs() > 2 if (mstyle) { ranges <- ranges(x) values <- values(x) if (!missing(j)) { prob <- checkIndex(j, ncol(x), colnames(x)) if (!is.null(prob)) stop("selecting cols: ", prob) values <- values[, j, drop=FALSE] } if (!missing(i)) { if (is(i, "IntegerRangesList")) stop("subsetting a RangedData object ", "by an IntegerRangesList subscript is not supported") if (is(i, "LogicalList")) { x_eltNROWS <- elementNROWS(ranges(x)) whichRep <- which(x_eltNROWS != elementNROWS(i)) for (k in whichRep) i[[k]] <- rep(i[[k]], length.out = x_eltNROWS[k]) i <- unlist(i, use.names=FALSE) } else if (is(i, "IntegerList")) { itemp <- LogicalList(lapply(elementNROWS(ranges(x)), rep, x = FALSE)) for (k in seq_len(length(itemp))) itemp[[k]][i[[k]]] <- TRUE i <- unlist(itemp, use.names=FALSE) } prob <- checkIndex(i, nrow(x), rownames(x)) if (!is.null(prob)) stop("selecting rows: ", prob) if (is.numeric(i) && any(i < 0)) i <- setdiff(seq(nrow(x)), -i) if (is.logical(i)) { igroup <- factor(rep.int(seq_len(length(x)), elementNROWS(x)), levels = seq_len(length(x))) if (length(i) < nrow(x)) i <- rep(i, length.out = nrow(x)) } else { if (is.null(i)) i <- integer(0) if (is.factor(i)) i <- as.character(i) if (is.character(i)) { dummy <- seq_len(nrow(x)) names(dummy) <- rownames(x) i <- dummy[i] if (S4Vectors:::anyMissing(i)) ## cannot subset by NAs yet stop("invalid rownames specified") } starts <- cumsum(c(1L, head(elementNROWS(x), -1))) igroup <- factor(findInterval(i, starts), levels = seq_len(length(x))) if (anyDuplicated(runValue(Rle(igroup)))) stop("cannot mix row indices from different spaces") i <- i - (starts - 1L)[as.integer(igroup)] } isplit <- split(i, igroup) names(isplit) <- names(x) ranges <- S4Vectors:::subset_List_by_List(ranges, isplit) values <- S4Vectors:::subset_List_by_List(values, isplit) if (drop) { ok <- (elementNROWS(ranges) > 0) ranges <- ranges[ok] values <- values[ok] } } } else { if (!missing(i)) { prob <- checkIndex(i, length(x), names(x)) if (!is.null(prob)) stop("selecting spaces: ", prob) ranges <- ranges(x)[i] values <- values(x)[i] } } x@ranges <- ranges x@values <- values x }) ### - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ### Combining and splitting. ### setMethod("c", "RangedData", function(x, ..., recursive = FALSE) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (!identical(recursive, FALSE)) stop("\"c\" method for RangedData objects ", "does not support the 'recursive' argument") if (missing(x)) rds <- unname(list(...)) else rds <- unname(list(x, ...)) rd <- rds[[1L]] if (!all(sapply(rds, is, "RangedData"))) stop("all arguments in '...' must be RangedData objects") nms <- lapply(rds, ## figure out names like 'c' on an ordinary vector function(rd) structure(logical(length(rd)), names = names(rd))) nms <- names(do.call(c, nms)) names(rds) <- NULL # critical for dispatch to work ranges <- do.call(c, lapply(rds, ranges)) values <- do.call(c, lapply(rds, values)) names(ranges) <- nms rd@ranges <- ranges names(values) <- nms rd@values <- values rd }) setMethod("rbind", "RangedData", function(..., deparse.level=1) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) args <- unname(list(...)) rls <- lapply(args, ranges) nms <- unique(unlist(lapply(args, names), use.names=FALSE)) rls <- lapply(rls, function(x) {y <- as.list(x)[nms];names(y) <- nms;y}) dfs <- lapply(args, function(x) {y <- as.list(values(x))[nms];names(y) <- nms;y}) safe.c <- function(...) { x <- list(...) do.call(c, x[!sapply(x, is.null)]) } rls <- IRangesList(do.call(Map, c(list(safe.c), rls))) safe.rbind <- function(...) { x <- list(...) do.call(rbind, x[!sapply(x, is.null)]) } dfs <- SplitDataFrameList(do.call(Map, c(list(safe.rbind), dfs))) for (i in seq_len(length(rls))) names(rls[[i]]) <- rownames(dfs[[i]]) initialize(args[[1L]], ranges = rls, values = dfs) }) ### - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ### Coercion ### ### The 2 functions, as.data.frame.IntegerRangesList() and ### as.data.frame.DataFrameList() are needed for as.data.frame.RangedData(). ### ### A new as.data.frame,List method was implemented in BioC 2.15 and ### is now used by all List classes. Because the RangedData class is being ### phased out, we want to retain the old behavior. In order to do that ### we have to keep these 2 helpers because as.data.frame.RangedData() ### uses old methods from both IntegerRangesList and DataFrameList. ### ### These helpers are not exported. .as.data.frame.IntegerRangesList <- function(x, row.names=NULL, optional=FALSE, ...) { if (!(is.null(row.names) || is.character(row.names))) stop("'row.names' must be NULL or a character vector") x <- as(x, "CompressedIRangesList") spaceLevels <- seq_len(length(x)) if (length(names(x)) > 0) { spaceLabels <- names(x) } else { spaceLabels <- as.character(spaceLevels) } data.frame(space = factor(rep.int(seq_len(length(x)), elementNROWS(x)), levels = spaceLevels, labels = spaceLabels), as.data.frame(unlist(x, use.names = FALSE)), row.names = row.names, stringsAsFactors = FALSE) } .as.data.frame.DataFrameList <- function(x, row.names=NULL, optional=FALSE, ...) { if (!(is.null(row.names) || is.character(row.names))) stop("'row.names' must be NULL or a character vector") if (!missing(optional) || length(list(...))) warning("'optional' and arguments in '...' ignored") stacked <- stack(x) if (is.null(row.names)) row.names <- rownames(stacked) as.data.frame(stacked, row.names = row.names, optional = optional) } .as.data.frame.RangedData <- function(x, row.names=NULL, optional=FALSE, ...) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) if (!(is.null(row.names) || is.character(row.names))) stop("'row.names' must be NULL or a character vector") if (!missing(optional) || length(list(...))) warning("'optional' and arguments in '...' ignored") data.frame(.as.data.frame.IntegerRangesList(ranges(x)), .as.data.frame.DataFrameList(values(x))[-1L], row.names = row.names, stringsAsFactors = FALSE) } setMethod("as.data.frame", "RangedData", .as.data.frame.RangedData) setAs("RangedData", "DataFrame", function(from) { DataFrame(as.data.frame(ranges(from)), unlist(values(from), use.names=FALSE)) }) setAs("Rle", "RangedData", function(from) { what <- "coercion method from Rle to RangedData" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) new2("RangedData", ranges = IRangesList("1" = successiveIRanges(runLength(from))), values = SplitDataFrameList("1" = DataFrame(score = runValue(from))), metadata = metadata(from), check = FALSE) }) setAs("RleList", "RangedData", function(from) { what <- "coercion method from RleList to RangedData" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) ranges <- IRangesList(lapply(from, function(x) successiveIRanges(runLength(x)))) values <- SplitDataFrameList(lapply(from, function(x) DataFrame(score = runValue(x)))) if (is.null(names(from))) { nms <- as.character(seq_len(length(from))) names(ranges) <- nms names(values) <- nms } new2("RangedData", ranges = ranges, values = values, metadata = metadata(from), elementMetadata = elementMetadata(from, use.names=FALSE), check = FALSE) }) setAs("RleViewsList", "RangedData", function(from) { what <- "coercion method from RleViewsList to RangedData" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) subject <- subject(from) from_ranges <- restrict(ranges(from), 1L, elementNROWS(subject), keep.all.ranges = TRUE) ### FIXME: do we want to insert NAs for out of bounds views? score <- subject[from_ranges] score_part <- as(lapply(width(from_ranges), PartitioningByWidth), "IntegerRangesList") score_ranges <- ranges(score) ol <- findOverlaps(score_ranges, score_part) offind <- as(lapply(ol, subjectHits), "IntegerList") offset <- (start(from_ranges) - start(score_part))[offind] ranges <- shift(ranges(ol, score_ranges, score_part), offset) viewNames <- lapply(from_ranges, function(x) { if (is.null(names(x))) seq_len(length(x)) else names(x) }) RangedData(ranges, score = unlist(runValue(score), use.names = FALSE)[queryHits(ol)], view = unlist(viewNames, use.names = FALSE)[subjectHits(ol)]) }) setAs("IntegerRanges", "RangedData", function(from) { what <- "coercion method from IntegerRanges to RangedData" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) RangedData(from) }) setAs("IntegerRangesList", "RangedData", function(from) { what <- "coercion method from IntegerRangesList to RangedData" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) from_names <- names(from) if (is.null(from_names) || anyDuplicated(from_names)) stop("cannot coerce a IntegerRangesList object with no names ", "or duplicated names to a RangedData object") unlisted_from <- unlist(from, use.names=FALSE) unlisted_values <- mcols(unlisted_from, use.names=FALSE) mcols(unlisted_from) <- NULL ans_ranges <- relist(unlisted_from, skeleton=from) metadata(ans_ranges) <- metadata(from) if (!is(unlisted_values, "DataFrame")) { if (!is.null(unlisted_values)) warning("could not propagate the inner metadata columns of ", "'from' (accessed with 'mcols(unlist(from))') ", "to the data columns (aka values) of the returned ", "RangedData object") unlisted_values <- S4Vectors:::make_zero_col_DataFrame(length(unlisted_from)) } ans_values <- newCompressedList0("CompressedSplitDataFrameList", unlisted_values, PartitioningByEnd(ans_ranges)) new2("RangedData", ranges=ans_ranges, values=ans_values, #metadata=metadata(from), elementMetadata=elementMetadata(from, use.names=FALSE), check=FALSE) } ) setAs("list", "RangedData", function(from) { what <- "coercion method from list to RangedData" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) do.call(c, unname(from)) } ) .fromRangedDataToCompressedIRangesList <- function(from) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) ans <- ranges(from) ## Propagate 'values(from)'. ans_unlisted_values <- unlist(values(from), use.names=FALSE) mcols(ans@unlistData) <- ans_unlisted_values ans } setAs("RangedData", "CompressedIRangesList", .fromRangedDataToCompressedIRangesList ) setAs("RangedData", "IRangesList", .fromRangedDataToCompressedIRangesList) setMethod("as.env", "RangedData", function(x, enclos = parent.frame(2)) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) env <- S4Vectors:::makeEnvForNames(x, colnames(x), enclos) makeAccessorBinding <- function(fun, name = deparse(substitute(fun))) { makeActiveBinding(name, function() { val <- fun(x) rm(list=name, envir=env) assign(name, val, env) ## cache for further use val }, env) } makeAccessorBinding(ranges) makeAccessorBinding(space) makeAccessorBinding(start) makeAccessorBinding(width) makeAccessorBinding(end) env }) .RangedData_fromDataFrame <- function(from) { what <- "coercion method from data.frame or DataTable to RangedData" .Defunct(msg=wmsg(RangedData_method_is_defunct_msg(what))) required <- c("start", "end") if (!all(required %in% colnames(from))) stop("'from' must at least include a 'start' and 'end' column") datacols <- setdiff(colnames(from), c(required, "space", "width")) RangedData(IRanges(from$start, from$end), from[,datacols,drop=FALSE], space = from$space) } setAs("data.frame", "RangedData", .RangedData_fromDataFrame) setAs("DataTable", "RangedData", .RangedData_fromDataFrame) ### - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ### Show ### .show_RangedData <- function(object) { nr <- nrow(object) nc <- ncol(object) lo <- length(object) cat(class(object), " with ", nr, ifelse(nr == 1, " row and ", " rows and "), nc, ifelse(nc == 1, " value column across ", " value columns across "), lo, ifelse(lo == 1, " space\n", " spaces\n"), sep = "") if (nr > 0) { nms <- rownames(object) if (nr < 20) { ranges <- unlist(ranges(object), use.names=FALSE) values <- unlist(values(object), use.names=FALSE) out <- cbind(space = as.character(space(object)), ranges = showAsCell(ranges), "|" = rep.int("|", nr)) if (nc > 0) out <- cbind(out, as.matrix(format(do.call(data.frame, lapply(values, showAsCell))))) if (is.null(nms)) rownames(out) <- as.character(seq_len(nr)) else rownames(out) <- nms classinfo <- matrix(c("<factor>", "<IRanges>", "|", unlist(lapply(values, function(x) { paste("<", classNameForDisplay(x), ">", sep = "") }), use.names = FALSE)), nrow = 1, dimnames = list("", colnames(out))) } else { top <- object[1:9, ] topRanges <- unlist(ranges(top), use.names=FALSE) topValues <- unlist(values(top), use.names=FALSE) bottom <- object[(nr-8L):nr, ] bottomRanges <- unlist(ranges(bottom), use.names=FALSE) bottomValues <- unlist(values(bottom), use.names=FALSE) out <- rbind(cbind(space = as.character(space(top)), ranges = showAsCell(topRanges), "|" = rep.int("|", 9)), rbind(rep.int("...", 3)), cbind(space = as.character(space(bottom)), ranges = showAsCell(bottomRanges), "|" = rep.int("|", 9))) if (nc > 0) out <- cbind(out, rbind(as.matrix(format(do.call(data.frame, lapply(topValues, showAsCell)))), rbind(rep.int("...", nc)), rbind(as.matrix(format(do.call(data.frame, lapply(bottomValues, showAsCell))))))) if (is.null(nms)) { rownames(out) <- c(as.character(1:9), "...", as.character((nr-8L):nr)) } else { rownames(out) <- c(head(nms, 9), "...", tail(nms, 9)) } classinfo <- matrix(c("<factor>", "<IRanges>", "|", unlist(lapply(topValues, function(x) { paste("<", classNameForDisplay(x), ">", sep = "") }), use.names = FALSE)), nrow = 1, dimnames = list("", colnames(out))) } out <- rbind(classinfo, out) print(out, quote = FALSE, right = TRUE) } } setMethod("show", "RangedData", function(object) { .Deprecated(msg=wmsg2(RangedData_is_deprecated_msg)) suppressWarnings(.show_RangedData(object)) })