blob_id
large_string
language
large_string
repo_name
large_string
path
large_string
src_encoding
large_string
length_bytes
int64
score
float64
int_score
int64
detected_licenses
large list
license_type
large_string
text
string
download_success
bool
8c9ede3bb7f9724ebd700bbbda189af02ac9e358
Python
kev1/snt
/main.py
UTF-8
5,663
2.9375
3
[]
no_license
import os # print(env.variables.config['theme']['palette']) # access palette color. Automatic toggle of color ? def define_env(env): "Hook function" #---------------- <exo perso>-------------------- env.variables['compteur_exo'] = 0 @env.macro def exercice(): env.variables['compteur_exo'] += 1 return f"Exercice { env.variables['compteur_exo']}" #---------------- </exo perso>-------------------- #---------------- <PYODIDE>-------------------- env.variables['term_counter'] = 0 env.variables['IDE_counter'] = 0 @env.macro def terminal() -> str: """ Purpose : Create a Python Terminal. Methods : Two layers to avoid focusing on the Terminal. 1) Fake Terminal using CSS 2) A click hides the fake terminal and triggers the actual Terminal. """ tc = env.variables['term_counter'] env.variables['term_counter'] += 1 return f"""<div onclick='start_term("id{tc}")' id="fake_id{tc}" class="terminal_f"><label class="terminal"><span>>>> </span></label></div><div id="id{tc}" class="hide"></div>""" def read_ext_file(nom_script : str) -> str: """ Purpose : Read a Python file that is uploaded on the server. Methods : The content of the file is hidden in the webpage. Replacing \n by a string makes it possible to integrate the content in mkdocs admonitions. """ short_path = f"""docs/{os.path.dirname(env.variables.page.url.rstrip('/'))}""" try: f = open(f"""{short_path}/scripts/{nom_script}.py""") content = ''.join(f.readlines()) f.close() content = content+ "\n" # Hack to integrate code lines in admonitions in mkdocs return content.replace('\n','backslash_newline') except : return def generate_content(nom_script : str) -> str: """ Purpose : Return content and current number IDE {tc}. """ tc = env.variables['IDE_counter'] env.variables['IDE_counter'] += 1 content = read_ext_file(nom_script) if content is not None : return content, tc else : return "", tc def create_upload_button(tc : str) -> str: """ Purpose : Create upoad button for a IDE number {tc}. Methods : Use an HTML input to upload a file from user. The user clicks on the button to fire a JS event that triggers the hidden input. """ return f"""<button class="emoji" onclick="document.getElementById('input_editor_{tc}').click()">⤴️</button>\ <input type="file" id="input_editor_{tc}" name="file" enctype="multipart/form-data" class="hide"/>""" def create_unittest_button(tc: str, nom_script: str, mode: str) -> str: """ Purpose : Generate the button for IDE {tc} to perform the unit tests if a valid test_script.py is present. Methods : Hide the content in a div that is called in the Javascript """ stripped_nom_script = nom_script.split('/')[-1] relative_path = '/'.join(nom_script.split('/')[:-1]) nom_script = f"{relative_path}/test_{stripped_nom_script}" content = read_ext_file(nom_script) if content is not None: return f"""<span id="test_term_editor_{tc}" class="hide">{content}</span><button class="emoji_dark" onclick=\'executeTest("{tc}","{mode}")\'>🛂</button><span class="compteur">5/5</span>""" else: return '' def blank_space() -> str: """ Purpose : Return 5em blank spaces. Use to spread the buttons evenly """ return f"""<span style="indent-text:5em"> </span>""" @env.macro def IDEv(nom_script : str ='') -> str: """ Purpose : Easy macro to generate vertical IDE in Markdown mkdocs. Methods : Fire the IDE function with 'v' mode. """ return IDE(nom_script, 'v') @env.macro def IDE(nom_script : str ='', mode : str = 'h') -> str: """ Purpose : Create a IDE (Editor+Terminal) on a Mkdocs document. {nom_script}.py is loaded on the editor if present. Methods : Two modes are available : vertical or horizontal. Buttons are added through functioncal calls. Last span hides the code content of the IDE if loaded. """ content, tc = generate_content(nom_script) corr_content, tc = generate_content(f"""{'/'.join(nom_script.split('/')[:-1])}/corr_{nom_script.split('/')[-1]}""") div_edit = f'<div class="ide_classe">' if mode == 'v': div_edit += f'<div class="wrapper"><div class="interior_wrapper"><div id="editor_{tc}"></div></div><div id="term_editor_{tc}" class="term_editor"></div></div>' else: div_edit += f'<div class="wrapper_h"><div class="line" id="editor_{tc}"></div><div id="term_editor_{tc}" class="term_editor_h terminal_f_h"></div></div>' div_edit += f"""<button class="emoji" onclick='interpretACE("editor_{tc}","{mode}")'>▶️</button>""" div_edit += f"""{blank_space()}<button class="emoji" onclick=\'download_file("editor_{tc}","{nom_script}")\'>⤵️</button>{blank_space()}""" div_edit += create_upload_button(tc) div_edit += create_unittest_button(tc, nom_script, mode) div_edit += '</div>' div_edit += f"""<span id="content_editor_{tc}" class="hide">{content}</span>""" div_edit += f"""<span id="corr_content_editor_{tc}" class="hide">{corr_content}</span>""" return div_edit #---------------- </PYODIDE>--------------------
true
baacbe025c2a055ffd3dff7b6520cd9b841d6425
Python
BLUECARVIN/Several-ReinforcementLearning
/atari_game/Agent/DoubleDQN.py
UTF-8
10,939
2.515625
3
[ "MIT" ]
permissive
import sys sys.path.append("..") import torch from torch import nn from torch.nn import functional as F from torch.autograd import Variable import os import copy import pickle import gym import numpy as np import random from PIL import Image from Utils import hard_update from MLP import QNet import ReplayBuffer class DoubleDQNAgent(object): def __init__(self, env, random_seed, save_path, q_net=QNet, gamma=0.99, batch_size=32, initial_eps = 1.0, end_eps = 0.1, eps_plan = 500000, lr=0.00025, learning_start=50000, learning_freq=4, frame_history_len=4, target_update_freq=10000, memory_size=1000000, max_steps = 10000000, **kwargs): """ DQN Agent paras: env: the gym environment seed: the random seed save_path: the path to save model parameters q_net: the Q learning network function gamma: the reward's decrease parameter initial_e: the initial prob to choose random action end_e: the end prob to choose random action lr: the optimizer's learning rate target_update_freq: the target netwok's update frequency test_freq: the test frequency learning_start: begin to learn after learning_start steps learning_freq: the training frequency frame_history_len: how much frames should be feed to the model as one data memory_size: the maxmium size of replay buffer """ assert type(env.observation_space) == gym.spaces.Box assert type(env.action_space) == gym.spaces.Discrete # fix random seed torch.manual_seed(random_seed) np.random.seed(random_seed) random.seed(random_seed) # set env self.env = env self.test_env = copy.deepcopy(env) # get observation dim if len(env.observation_space.shape) == 1: # running on low-dimension observation(RAM) self.observation_dim = env.observation_space.shape[0] else: img_h, img_w, img_c = env.observation_space.shape self.observation_dim = frame_history_len # get action dim self.action_dim = env.action_space.n # set Q network self.learning_Q = q_net(self.observation_dim, self.action_dim).cuda() self.target_Q = q_net(self.observation_dim, self.action_dim).cuda() # sync two networks' parameter hard_update(self.target_Q, self.learning_Q) # set replay buffer self.replay_buffer = ReplayBuffer.ReplayBuffer(memory_size, frame_history_len) # define learning Q network's optimizer self.optimizer = torch.optim.RMSprop(self.learning_Q.parameters(), lr=lr, eps=0.01) # define loss function self.loss_func = nn.MSELoss() # initial other parameters self.gamma = gamma self.batch_size = batch_size self.initial_eps = initial_eps self.end_eps = end_eps self.eps_plan = eps_plan self.learning_start = learning_start self.learning_freq = learning_freq self.frame_history_len = frame_history_len self.max_steps = max_steps self.target_update_freq = target_update_freq self.steps = 0 self.save_path = save_path # set the eps self.eps = self.initial_eps # ============================ save and load model =============================== def save_model(self, name, path=None): if path: self.save_path = path if not os.path.isdir(self.save_path): os.makedirs(self.save_path) torch.save(self.target_Q.state_dict(), self.save_path + name + '.pt') print("The target model's parameters have been saved sucessfully!") def load_model(self, file_path): self.target_Q.load_state_dict(torch.load(file_path)) hard_update(self.learning_Q, self.target_Q) print("The models' parameters have been loaded sucessfully!") # ============================ utils ========================================== def cal_eps(self): self.eps = self.initial_eps - (self.initial_eps - self.end_eps) / self.eps_plan * (self.steps - self.learning_start) if self.eps < self.end_eps: self.eps = self.end_eps def pre_process(self, observation): img = np.reshape(observation, [210, 160, 3]).astype(np.float32) img = img[:, :, 0] * 0.299 + img[:, :, 1] * 0.587 + img[:, :, 2] * 0.114 img = Image.fromarray(img) resized_screen = img.resize((84, 110), Image.BILINEAR) resized_screen = np.array(resized_screen) x_t = resized_screen[18:102, :] x_t = np.reshape(x_t, [84, 84, 1]) return x_t.astype(np.uint8) # ============================= evaluate ====================================== def get_exploration_action(self, state): sample = random.random() self.cal_eps() if sample > self.eps: state = torch.from_numpy(state).type(torch.float32).unsqueeze(0) / 255.0 state = Variable(state).cuda() # action = torch.argmax(self.learning_Q(state)).detach().cpu() action = torch.argmax(self.learning_Q(state), dim=1).cpu() # action = self.learning_Q(state).data.max(1)[1].cpu() else: # action = int(np.random.uniform() * self.action_dim) # action = torch.from_numpy(action) action = torch.IntTensor([random.randrange(self.action_dim)]) return action def get_exploitation_action(self, state): state = torch.from_numpy(state).type(torch.float32).unsqueeze(0) / 255.0 state = Variable(state).cuda() action = torch.argmax(self.target_Q(state)).detach().cpu() return action # ============================= train ====================================== def train(self, is_render=False, path=None): last_observation = self.env.reset() last_observation = self.pre_process(last_observation) mean_episode_reward = -float('nan') best_mean_episode_reward = -float('inf') log = {'mean_episode_reward':[], 'best_mean_episode_reward':[]} num_param_updates = 0 episode_rewards = [] one_episode_reward = [] loss = [] while self.steps < self.max_steps: # store lastest observation last_index = self.replay_buffer.store_frame(last_observation) recent_observation = self.replay_buffer.encoder_recent_observation() # choose a random action if not state learning yet if self.steps < self.learning_start: action = random.randrange(self.action_dim) else: action = self.get_exploration_action(recent_observation)[0].numpy() # make a step observation, reward, done, _ = self.env.step(action) observation = self.pre_process(observation) one_episode_reward.append(reward) if is_render: self.env.render() # clip rewards between -1 and 1 reward = max(-1.0, min(reward, 1.0)) # store ohter info in replay memory self.replay_buffer.store_effct(last_index, action, reward, done) # if done, restat env if done: observation = self.env.reset() observation = self.pre_process(observation) episode_rewards.append(np.sum(one_episode_reward)) one_episode_reward = [] last_observation = observation # perform experience replay and train the network if ((self.steps > self.learning_start) and (self.steps % self.learning_freq == 0) and self.replay_buffer.can_sample): # get batch from replay buffer obs_batch, act_batch, rew_batch, next_obs_batch, done_mask = self.replay_buffer.sample_batch(self.batch_size) # turn all data to tensor obs_batch = Variable(torch.from_numpy(obs_batch).type(torch.float32) / 255.0).cuda() act_batch = Variable(torch.from_numpy(act_batch).long()).cuda() rew_batch = Variable(torch.from_numpy(rew_batch).type(torch.float32)).cuda() next_obs_batch = Variable(torch.from_numpy(next_obs_batch).type(torch.float32) / 255.).cuda() not_done_mask = Variable(torch.from_numpy(1 - done_mask).type(torch.float32)).cuda() # ================================ calculate bellman ========================================= # get current Q value current_q_value = self.learning_Q(obs_batch).gather(1, act_batch.unsqueeze(1)) # using learning Q net to choose the next action and using target Q to calculate next Q next_action = self.learning_Q(next_obs_batch).max(1)[1] next_max_q = self.target_Q(next_obs_batch).gather(1, next_action.unsqueeze(1)) next_q_values = not_done_mask.view(-1, 1) * next_max_q # compute the target of the current q values target_q_values = rew_batch.view(-1, 1) + (self.gamma * next_q_values) # compute bellman error bellman_error = target_q_values - current_q_value loss.append(bellman_error.detach().cpu().numpy()) # clip bellman error between [-1, 1] clipped_bellman_error = bellman_error.clamp(-1, 1) # * -1 bellman_d = -1. * clipped_bellman_error # optimize self.optimizer.zero_grad() current_q_value.backward(bellman_d.data) self.optimizer.step() # update steps num_param_updates += 1 # update network if num_param_updates % self.target_update_freq == 0: hard_update(self.target_Q, self.learning_Q) if len(episode_rewards) > 0: mean_episode_reward = np.mean(episode_rewards[-100:]) if len(episode_rewards) > 100: best_mean_episode_reward = max(best_mean_episode_reward, mean_episode_reward) log['mean_episode_reward'].append(mean_episode_reward) log['best_mean_episode_reward'].append(best_mean_episode_reward) if self.steps % 5000 == 0 and self.steps > self.learning_start: print("Steps: {}".format(self.steps)) print("mean reward (lastest 100 episodes): {:.4f}".format(mean_episode_reward)) print("best mean reward: {:.4f}".format(best_mean_episode_reward)) print("episodes: {}".format(len(episode_rewards))) print("exploration: {:.4f}".format(self.eps)) print("loss: {:.4f}".format(np.mean(loss))) sys.stdout.flush() loss = [] with open(self.save_path + 'log.pkl', 'wb') as f: pickle.dump(log, f) self.save_model('DQNtest', path=path) self.steps += 1 # =================================== test =============================================== def test(self, path, epoch, is_render=False): self.load_model(path) last_observation = self.env.reset() last_observation = self.pre_process(last_observation) mean_episode_reward = -float('nan') log = {'mean_episode_reward':[]} episode_rewards = [] one_episode_reward = [] loss = [] done_epoch = 0 for i in range(epoch): done = False while not done: # store lastest observation last_index = self.replay_buffer.store_frame(last_observation) recent_observation = self.replay_buffer.store_frame(last_observation) # choose the action by ste strategy action = self.get_exploitation_action(recent_observation)[0].numpy() # make a step observation, reward, done, _ = self.env.step(action) observation = self.pre_process(observation) one_episode_reward.append(reward) if is_render: self.env.render() self.replay_buffer.store_effect(last_index, action, reward, done) if done: observation = self.env.reset() observation = self.pre_process(observation) print("For the {}th epoch: ".format(i)) print("Agent has been taken {} steps, and the total reward is {:.2f}.".format(len(one_episode_reward), sum(one_episode_reward))) one_episode_reward = [] print("Done!") env.close()
true
5e74f80f6b69e6ba959e3c0c8fb221bc414e18a5
Python
mj-will/nessai
/nessai/utils/indices.py
UTF-8
1,684
3.03125
3
[ "MIT" ]
permissive
# -*- coding: utf-8 -*- """ Utilities related to insertion indices. """ import numpy as np from scipy import stats def compute_indices_ks_test(indices, nlive, mode="D+"): """ Compute the two-sided KS test for discrete insertion indices for a given number of live points Parameters ---------- indices : array_like Indices of newly inserted live points nlive : int Number of live points Returns ------- D : float Two-sided KS statistic p : float p-value """ if len(indices): counts = np.zeros(nlive) u, c = np.unique(indices, return_counts=True) counts[u] = c cdf = np.cumsum(counts) / len(indices) if mode == "D+": D = np.max(np.arange(1.0, nlive + 1) / nlive - cdf) elif mode == "D-": D = np.max(cdf - np.arange(0.0, nlive) / nlive) else: raise RuntimeError(f"{mode} is not a valid mode. Choose D+ or D-") p = stats.ksone.sf(D, len(indices)) return D, p else: return None, None def bonferroni_correction(p_values, alpha=0.05): """ Apply the Bonferroni correction for multiple tests. Based on the implementation in ``statmodels.stats.multitest`` Parameters ---------- p_values : array_like Uncorrelated p-values. alpha : float, optional Family wise error rate. """ p_values = np.asarray(p_values) alpha_bon = alpha / p_values.size reject = p_values <= alpha_bon p_values_corrected = p_values * p_values.size p_values_corrected[p_values_corrected > 1] = 1 return reject, p_values_corrected, alpha_bon
true
79e1b3a06f9e493296db4d8e2aa39d53e46c66d7
Python
LucasMaiale/Libro1-python
/Cap2/Programa 2_10.py
UTF-8
940
4.21875
4
[]
no_license
# -*- coding: utf-8 -*- """ @author: guardati Solución del problema 2.10 Calcula e imprime el total a pagar por alimento, a lo largo de un mes, en un refugio para perros en el cual viven perros de distinta edad y tamaño. Se considera que el mes tiene 30 días. """ precio_alim_ad = float(input('Ingrese el precio del alimento para adulto: $')) precio_alim_ca = float(input('Ingrese el precio del alimento para cachorro: $')) ''' Se multiplica por 30 para obtener el consumo en un mes y se divide por 1000 para expresar el consumo en kilos. ''' consumo_kg_adulto = (10 * 450 + 12 * 380) * 30 / 1000 consumo_kg_cachorro = 6 * 230 * 30 / 1000 costo_alim_ad = consumo_kg_adulto * precio_alim_ad costo_alim_ca = consumo_kg_cachorro * precio_alim_ca print(f'\nTotal a pagar por el alimento para perros adultos = ${costo_alim_ad:.2f}') print(f'Total a pagar por el alimento para perros cachorros = ${costo_alim_ca:.2f}')
true
8c95f82d65e97ad13aff5abca8b5121bed89f185
Python
sixty-north/added-value
/source/added_value/tabulator.py
UTF-8
15,887
2.625
3
[ "BSD-3-Clause" ]
permissive
from collections import deque from collections.abc import Mapping from itertools import product, chain, repeat from added_value.items_table_directive import NonStringIterable from added_value.multisort import tuplesorted from added_value.sorted_frozen_set import SortedFrozenSet from added_value.toposet import TopoSet from added_value.util import unchain, empty_iterable depth_marker = object() ROOT = object() LEAF = object() _UNSET = object() def breadth_first(obj, leaves=False): queue = deque() queue.append(obj) queue.append(None) level_keys = [] current_level_keys = TopoSet() while len(queue) > 0: node = queue.popleft() if node is None: level_keys.append(current_level_keys) current_level_keys = TopoSet() queue.append(None) if queue[0] is None: break else: continue if isinstance(node, Mapping): current_level_keys.update(node.keys()) for value in node.values(): queue.append(value) elif isinstance(node, NonStringIterable): current_level_keys.update(range(len(node))) for value in node: queue.append(value) else: if leaves: current_level_keys.add(node) return [ list(s) for s in level_keys[:-1] ] # Why the slice? Remove leaves? Is the last always empty? class Missing(object): def __str__(self): return "" def __repr__(self): return self.__class__.__name__ MISSING = Missing() def tabulate_body( obj, level_keys, v_level_indexes, h_level_indexes, v_level_sort_keys=None, h_level_sort_keys=None, ): """ Args: v_level_indexes: A sequence of level indexes. h_level_indexes: A sequence of level indexes. """ v_key_sorted = make_sorter(v_level_sort_keys, v_level_indexes) h_key_sorted = make_sorter(h_level_sort_keys, h_level_indexes) h_level_keys = [level_keys[level] for level in h_level_indexes] v_level_keys = [level_keys[level] for level in v_level_indexes] h_key_tuples = h_key_sorted(product(*h_level_keys)) v_key_tuples = v_key_sorted(product(*v_level_keys)) h_size = len(h_key_tuples) v_size = len(v_key_tuples) table = [[MISSING for _ in range(h_size)] for _ in range(v_size)] for h_index, h_keys in enumerate(h_key_tuples): for v_index, v_keys in enumerate(v_key_tuples): key_path = [None] * len(level_keys) merge_into_by_index(key_path, h_level_indexes, h_keys) merge_into_by_index(key_path, v_level_indexes, v_keys) for v_level, v_key in zip(v_level_indexes, v_keys): key_path[v_level] = v_key item = obj for key in key_path: try: item = item[key] except (IndexError, KeyError): break else: # no-break table[v_index][h_index] = item return table, v_key_tuples, h_key_tuples def make_sorter(level_sort_keys, level_indexes): if level_sort_keys is not None: if len(level_sort_keys) != len(level_indexes): raise ValueError( "level_sort_keys with length {} does not correspond to level_indexes with length {}".format( len(level_sort_keys), len(level_indexes) ) ) def key_sorted(level_keys): return tuplesorted(level_keys, *level_sort_keys) else: key_sorted = list return key_sorted def strip_missing_rows(table, row_keys): stripped_table = [] stripped_v_key_tuples = [] for row, v_key_tuple in zip(table, row_keys): if any(cell is not MISSING for cell in row): stripped_table.append(list(row)) stripped_v_key_tuples.append(v_key_tuple) return stripped_table, stripped_v_key_tuples def strip_missing_columns(table, h_key_tuples): transposed_table = transpose(table) stripped_transposed_table, stripped_h_key_tuples = strip_missing_rows( transposed_table, h_key_tuples ) stripped_table = transpose(stripped_transposed_table) return stripped_table, stripped_h_key_tuples def merge_into_by_index(sequence, indexes, values): for index, value in zip(indexes, values): sequence[index] = value def is_rectangular(seq_of_seqs): return len(set(map(len, seq_of_seqs))) <= 1 def size_h(rows_of_columns): try: first_row = rows_of_columns[0] except IndexError: return 0 else: return len(first_row) def size_v(rows_of_columns): return sum(1 for row in rows_of_columns if len(row) != 0) def size(rows_of_columns): return size_v(rows_of_columns), size_h(rows_of_columns) def transpose(rows_of_columns): return list(map(list, zip(*rows_of_columns))) def assemble_table( table_body, v_key_tuples, h_key_tuples, v_level_titles=None, h_level_titles=None, empty="" ): if not is_rectangular(table_body): raise ValueError("table_body {} is not rectangular".format(table_body)) if not is_rectangular(v_key_tuples): raise ValueError("v_key_tuples {} is not rectangular".format(v_key_tuples)) if not is_rectangular(h_key_tuples): raise ValueError("h_key_tuples {} is not rectangular".format(h_key_tuples)) if size_v(v_key_tuples) > 0 and (size_v(table_body) != size_v(v_key_tuples)): raise ValueError("table body and v_key_tuples have incompatible dimensions") h_key_tuples_transposed = transpose(h_key_tuples) if size_h(h_key_tuples_transposed) > 0 and ( size_h(table_body) != size_h(h_key_tuples_transposed) ): raise ValueError("table body and h_key_tuples have incompatible dimensions") if (v_level_titles is not None) and (len(v_level_titles) != size_h(v_key_tuples)): raise ValueError("v_level_titles and v_key_tuples have incompatible dimensions") if (h_level_titles is not None) and (len(h_level_titles) != size_v(h_key_tuples_transposed)): raise ValueError("h_level_titles and h_key_tuples have incompatible dimensions") boxed_h_level_titles = ( unchain(h_level_titles) if (h_level_titles is not None) else repeat(empty_iterable(), size_v(h_key_tuples_transposed)) ) num_h_level_title_columns = int(bool(h_level_titles)) num_stub_columns = max(size_h(v_key_tuples), num_h_level_title_columns) table = [] num_empty_columns = num_stub_columns - num_h_level_title_columns for boxed_h_level_title, h_key_row in zip(boxed_h_level_titles, h_key_tuples_transposed): row = list(chain(repeat(" ", num_empty_columns), boxed_h_level_title, h_key_row)) table.append(row) if v_level_titles is not None: v_level_titles_row = v_level_titles + [empty] * size_h(table_body) table.append(v_level_titles_row) for v_key_row, table_row in zip(v_key_tuples, table_body): row = list(v_key_row) row.extend(table_row) table.append(row) assert is_rectangular(table) return table def tabulate( obj, v_level_indexes=None, h_level_indexes=None, v_level_visibility=None, h_level_visibility=None, v_level_sort_keys=None, h_level_sort_keys=None, v_level_titles=None, h_level_titles=None, empty="", ): """Render a nested data structure into a two-dimensional table. Args: obj: The indexable data structure to be rendered, which can either be a non-string sequence or a mapping containing other sequences and mappings nested to arbitrarily many levels, with all the leaf items (which are neither sequences nor mappings, excluding strings). v_level_indexes: An iterable of the zero-based indexes of the levels for which the keys/indexes will be displayed along the vertical axis of the table. Taken together with the levels in h_levels these must represent the complete set of levels in the obj data structure. No level index should appear in both v_level_indexes and h_level_indexes, but all level indexes must appear in either v_level_indexes or h_level_indexes. If None, the levels not used in h_level_indexes will be used. If both v_level_indexes and h_level_indexes are not alternate indexes will be used as v_level and h_level indexes. h_level_indexes: An iterable of the zero-based indexes of the levels for which the keys/indexes will be displayed along the horizontal axis of the table. Taken together with the levels in v_levels these must represent the complete set of levels in the obj data structure. No level index should appear in both h_level_indexes and v_level_indexes, but all level indexes must appear in either h_level_indexes or v_level_indexes. If None, the levels not used in v_level_indexes will be used. If both v_level_indexes and h_level_indexes are not alternate indexes will be used as v_level and h_level indexes. v_level_visibility: An optional iterable of booleans, where each item corresponds to a level in v_level_indexes, and controls whether than level of index is included in the table stub columns. This iterable must contain the same number of items as v_level_indexes. h_level_visibility: An optional iterable of booleans, where each item corresponds to a level in h_level_indexes, and controls whether than level of index is included in the table header rows. This iterable must contain the same number of items as h_level_indexes. v_level_sort_keys: An optional iterable of Keys, where each key corresponds to a level in v_level_indexes, and controls how that key is sorted. If None, keys are sorted as-is. h_level_sort_keys: An optional iterable of Keys, where each key corresponds to a level in v_level_indexes, and controls how that key is sorted. If None, keys are sorted as-is. v_level_titles: An optional iterable of strings, where each string is a title which corresponds to a level in v_level_indexes, and which will be displayed against the row keys for that level. If None, no titles will be included. h_level_titles: An optional iterable of strings, where each string is a title which corresponds to a level in h_level_indexes, and which will be displayed against the column keys for that level. If None, no titles will be included. empty: An optional string value to use for empty cells. Returns: A list of lists representing the rows of cells. Example: tabulate(dict_of_dicts, [0, 1], []) """ level_keys = breadth_first(obj) v_level_indexes, h_level_indexes = validate_level_indexes( len(level_keys), v_level_indexes, h_level_indexes ) if v_level_visibility is None: v_level_visibility = [True] * len(v_level_indexes) if h_level_visibility is None: h_level_visibility = [True] * len(h_level_indexes) table, v_key_tuples, h_key_tuples = tabulate_body( obj, level_keys, v_level_indexes, h_level_indexes, v_level_sort_keys, h_level_sort_keys ) table, v_key_tuples = strip_missing_rows(table, v_key_tuples) table, h_key_tuples = strip_missing_columns(table, h_key_tuples) v_key_tuples = strip_hidden(v_key_tuples, v_level_visibility) h_key_tuples = strip_hidden(h_key_tuples, h_level_visibility) return assemble_table( table, v_key_tuples, h_key_tuples, v_level_titles, h_level_titles, empty=empty ) def validate_level_indexes(num_levels, v_level_indexes, h_level_indexes): """Ensure that v_level_indexes and h_level_indexes are consistent. Args: num_levels: The number of levels of keys in the data structure being tabulated. v_level_indexes: A sequence of level indexes between zero and num_levels for the vertical axis, or None. h_level_indexes: A sequence of level indexes between zero and num_levels for for the horizontal axis, or None. Returns: A 2-tuple containing v_level_indexes and h_level_indexes sequences. Raises: ValueError: If v_level_indexes contains duplicate values. ValueError: If h_level_indexes contains duplicate values. ValueError: If v_level_indexes contains out of range values. ValueError: If h_level_indexes contains out of range values. ValueError: If taken together v_level_indexes and h_level_indexes do not include all levels from zero to up to, but not including num_levels. ValueError: If v_level_indexes and h_level_indexes have items in common. """ if num_levels < 1: raise ValueError("num_levels {} is less than one".format(num_levels)) all_levels = SortedFrozenSet(range(num_levels)) if (h_level_indexes is None) and (v_level_indexes is None): v_level_indexes = range(0, num_levels, 2) h_level_indexes = range(1, num_levels, 2) h_level_set = SortedFrozenSet(h_level_indexes) v_level_set = SortedFrozenSet(v_level_indexes) if h_level_indexes is None: h_level_indexes = all_levels - v_level_set if v_level_indexes is None: v_level_indexes = all_levels - h_level_set if len(h_level_indexes) != len(h_level_set): raise ValueError("h_level_indexes contains duplicate values") if h_level_set and ((h_level_set[0] < 0) or (h_level_set[-1] >= num_levels)): raise ValueError("h_level_indexes contains out of range values") if len(v_level_indexes) != len(v_level_set): raise ValueError("v_level_indexes contains duplicate values") if v_level_set and ((v_level_set[0] < 0) or (v_level_set[-1] >= num_levels)): raise ValueError("v_level_indexes contains out of range values") unmentioned_levels = all_levels - v_level_set - h_level_set if len(unmentioned_levels) > 0: raise ValueError( "v_level_indexes and h_level_indexes do not together include levels {}".format( ", ".join(map(str, unmentioned_levels)) ) ) if not h_level_set.isdisjoint(v_level_set): raise ValueError("h_level_indexes and v_level_indexes are not disjoint") v_level_indexes = list(v_level_indexes) h_level_indexes = list(h_level_indexes) return v_level_indexes, h_level_indexes def strip_hidden(key_tuples, visibilities): """Filter each tuple according to visibility. Args: key_tuples: A sequence of tuples of equal length (i.e. rectangular) visibilities: A sequence of booleans equal in length to the tuples contained in key_tuples. Returns: A sequence equal in length to key_tuples where the items are tuples with a length corresponding to the number of items in visibility which are True. """ result = [] for key_tuple in key_tuples: if len(key_tuple) != len(visibilities): raise ValueError( "length of key tuple {} is not equal to length of visibilities {}".format( key_tuple, visibilities ) ) filtered_tuple = tuple(item for item, visible in zip(key_tuple, visibilities) if visible) result.append(filtered_tuple) return result # TODO: Multidimensional arrays. e.g. ndarray
true
4a582c4364f53a3d0844e8aa2a44063f6d4a8577
Python
sunary/image-process
/preprocess/edge_detect.py
UTF-8
3,918
2.515625
3
[]
no_license
__author__ = 'sunary' import cv2 from utils import helper from preprocess import histogram_equalization import numpy as np def basic(pix): temp_x = [[0] * len(pix[0]) for _ in range(len(pix))] temp_y = [[0] * len(pix[0]) for _ in range(len(pix))] edge_pix = [[0] * len(pix[0]) for _ in range(len(pix))] gx, gy = _sobel() sum_gray = 0 for i in range(len(gx)/2, len(pix) - len(gx)/2): for j in range(len(gx)/2, len(pix[0]) - len(gy)/2): for d1 in range(len(gx)): for d2 in range(len(gx)): temp_x[i][j] += gx[d1][d2] * pix[i + d1 - len(gx)/2][j + d2 - len(gx)/2] temp_y[i][j] += gy[d1][d2] * pix[i + d1 - len(gy)/2][j + d2 - len(gy)/2] sum_gray += temp_x[i][j]*temp_x[i][j] + temp_y[i][j]*temp_y[i][j] threshold = 3*sum_gray/((len(pix))*len(pix[0])) for i in range(0, len(pix) - 0): for j in range(0, len(pix[0]) - 0): edge_pix[i][j] = 0x000000 if (temp_x[i][j]*temp_x[i][j] + temp_y[i][j]*temp_y[i][j] > threshold) else 0xffffff return edge_pix def edge_detect(img): temp_x = np.zeros_like(img) temp_y = np.zeros_like(img) sobel = _sobel() gx = np.array(sobel[0]) gy = np.array(sobel[1]) for i in np.arange(1, np.size(img, 0) - 1): for j in np.arange(1, np.size(img, 1) - 1): temp_x[i][j] = np.sum(gx * img[i - 1: i + 2, j - 1: j + 2]) temp_y[i][j] = np.sum(gy * img[i - 1: i + 2, j - 1: j + 2]) sum_square = np.square(temp_x) + np.square(temp_y) threshold = 2 * np.mean(sum_square) edge_pix = np.zeros_like(img, dtype=np.uint8) for (i, j), value in np.ndenumerate(sum_square): edge_pix[i][j] = 0 if value < threshold else 0xffffff return edge_pix def auto_canny(img, sigma=0.33): v = np.median(img) lower = int(max(0, (1.0 - sigma) * v)) upper = int(min(255, (1.0 + sigma) * v)) edged = cv2.Canny(img, lower, upper) return edged def full_detect(img, is_binary=True, canny=True): if not is_binary: # img = histogram_equalization.clahe(img) img = histogram_equalization.ostu_algorithm(img) if canny: img = auto_canny(img) else: img = edge_detect(img) return img def extractEdges(input, cannyThreshold1=50, cannyThreshold2=200, borderApertureSize=3): input_gray = cv2.cvtColor(input, cv2.COLOR_BGR2GRAY) input_gray = cv2.createCLAHE(clipLimit=4.5, tileGridSize=(9,9)).apply(input_gray) input_gray = cv2.GaussianBlur(input_gray, (3,3), 1) return cv2.Canny(input_gray, cannyThreshold1, cannyThreshold2, apertureSize=borderApertureSize, L2gradient=False) def _sobel(): return ([[-1, 0, 1], [-2, 0, 2], [-1, 0, 1]], [[-1, -2, -1], [0, 0, 0], [1, 2, 1]]) def _robert(self): return ([[1, 0], [0, -1]], [[0, 1], [-1, 0]]) def _prewitt(self): return ([[-1, 0, 1], [-1, 0, 1], [-1, 0, 1]], [[-1, -1, -1], [0, 0, 0], [1, 1, 1]]) def bounding_box(img, range_w=None, range_h=None): img = histogram_equalization.adaptive_mean(img) cv2.imshow('binary', img) contours, hierarchy = cv2.findContours(img, cv2.RETR_LIST, cv2.CHAIN_APPROX_TC89_KCOS) boundings = [] for cnt in contours: x, y, w, h = cv2.boundingRect(cnt) if (not range_w or (w >= range_w[0] and w <= range_w[1])) and \ (not range_h or (h >= range_h[0] and h <= range_h[1])): boundings.append((x, y, w, h)) cv2.rectangle(img, (x, y), (x + w, y + h), (255), 2) return img, boundings if __name__ == '__main__': pix = helper.read_image('../resources/fp01.jpg') pix = helper.convert_gray(pix) helper.save_image('../resources/gray.png', True) pix = basic(pix) # noise_removal = NoiseRemoval() # pix = noise_removal.opening(pix) helper.save_image(pix, '../resources/edge.png')
true
36c306b33199594ed1d4b1a05ce2758bf99318e8
Python
Haestad/datatek
/oving5/kpc.py
UTF-8
4,324
3.171875
3
[]
no_license
""" This module contains the KeyPad Controller (KPC) class. """ from time import sleep from typing import Callable from keypad import Keypad from led_board import LEDBoard class KPC: """ Class that contains all the logic for operating the keypad. """ def __init__(self): self.keypad = Keypad() self.led_board = LEDBoard() self.password_path = "password.txt" self.override_signal = None self.current_signal = None self.passcode_buffer = "" self.led_pin = 0 self.led_duration = "" def reset_passcode_entry(self): """ Clear passcode_buffer and initiate 'power up' lighting sequence. """ self.passcode_buffer = "" self.power_up_led() def reset_agent(self): """ Resets the agent to a neutral state. """ self.override_signal = None self.current_signal = None self.passcode_buffer = "" def append_next_password_digit(self): """ Adds the given digit to the passcode_buffer. """ self.passcode_buffer += str(self.current_signal) def get_next_signal(self): """ return override signal if non-blank, else query keypad for next pressed key""" if self.override_signal is not None: override_signal = self.override_signal self.override_signal = None return override_signal self.current_signal = self.keypad.get_next_signal() return self.current_signal def verify_login(self): """ Compares the password in the password file to the password in passcode_buffer. If it matches, set override_signal to 'Y', else set it to 'N'. """ with open(self.password_path, 'r') as pw_file: correct_pw = pw_file.read() if self.passcode_buffer == correct_pw: self.override_signal = 'Y' self.twinkle_led() else: self.override_signal = 'N' self.flash_led() def validate_password_change(self): """ Checks if the new password is legal. A legal password should be at least 4 digits long, and should only contain a combination of symbols 0-9. If the password is legal, save it to 'password.txt'. The LED board should also flash based on failure or success. """ if len(self.passcode_buffer) >= 4: with open(self.password_path, 'w') as pw_file: pw_file.write(self.passcode_buffer) self.override_signal = 'Y' self.twinkle_led() else: self.override_signal = 'N' self.flash_led() def fully_activate_agent(self): """ Called when agent is activated. """ self.reset_agent() def exit_action(self): """ Called when exiting agent. """ self.reset_agent() self.power_down_led() def select_pin(self): """ Selects a LED pin to light up. """ self.led_pin = self.current_signal self.led_duration = "" def append_dur(self): """ Selects how long the LED should light up. """ self.led_duration += str(self.current_signal) @staticmethod def do_action(action: Callable[[], bool]): """ Executes the given action in KPC. """ return action() # LED Board methods def light_one_led(self): """ Lights the LED with the agents led pin and duration, and then clears the values. """ self.led_board.turn_on_led(self.led_pin) sleep(int(self.led_duration)) self.led_board.turn_off_led(self.led_pin) self.led_pin = None self.led_duration = "" def flash_led(self): """ Flashes all LEDs for 1 seconds. """ self.led_board.flash_all_led(1) def twinkle_led(self): """ Twinkles all LEDs for 1 seconds """ self.led_board.twinkle_all_led(1) def power_up_led(self): """ The LED sequence for powering up. """ led_list = [] for i in range(0, 5): led_list.append(i) self.led_board.flash_all_led(0.2, led_list) def power_down_led(self): """ The LED sequence for powering down. """ led_list = [0, 1, 2, 3, 4] for i in range(0, 5): self.led_board.flash_all_led(0.2, led_list) led_list.pop()
true
e57813e7a7871b3b99db5957b4aac3e31d0cd66a
Python
gistable/gistable
/all-gists/1770447/snippet.py
UTF-8
11,267
2.65625
3
[ "MIT" ]
permissive
#!/usr/bin/env python # zmqc: a small but powerful command-line interface to ZMQ. ## Usage: # zmqc [-0] (-r | -w) (-b | -c) SOCK_TYPE [-o SOCK_OPT=VALUE...] address [address ...] ## Examples: # zmqc -rc SUB 'tcp://127.0.0.1:5000' # # Subscribe to 'tcp://127.0.0.1:5000', reading messages from it and printing # them to the console. This will subscribe to all messages by default. # # ls | zmqc -wb PUSH 'tcp://*:4000' # # Send the name of every file in the current directory as a message from a # PUSH socket bound to port 4000 on all interfaces. Don't forget to quote the # address to avoid glob expansion. # # zmqc -rc PULL 'tcp://127.0.0.1:5202' | tee $TTY | zmqc -wc PUSH 'tcp://127.0.0.1:5404' # # Read messages coming from a PUSH socket bound to port 5202 (note that we're # connecting with a PULL socket), echo them to the active console, and # forward them to a PULL socket bound to port 5404 (so we're connecting with # a PUSH). # # zmqc -n 10 -0rb PULL 'tcp://*:4123' | xargs -0 grep 'pattern' # # Bind to a PULL socket on port 4123, receive 10 messages from the socket # (with each message representing a filename), and grep the files for # `'pattern'`. The `-0` option means messages will be NULL-delimited rather # than separated by newlines, so that filenames with spaces in them are not # considered two separate arguments by xargs. ## License: # This is free and unencumbered software released into the public domain. # # Anyone is free to copy, modify, publish, use, compile, sell, or # distribute this software, either in source code form or as a compiled # binary, for any purpose, commercial or non-commercial, and by any # means. # # In jurisdictions that recognize copyright laws, the author or authors # of this software dedicate any and all copyright interest in the # software to the public domain. We make this dedication for the benefit # of the public at large and to the detriment of our heirs and # successors. We intend this dedication to be an overt act of # relinquishment in perpetuity of all present and future rights to this # software under copyright law. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, # EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF # MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. # IN NO EVENT SHALL THE AUTHORS BE LIABLE FOR ANY CLAIM, DAMAGES OR # OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, # ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR # OTHER DEALINGS IN THE SOFTWARE. # For more information, please refer to <http://unlicense.org/> import argparse import array import errno import itertools import re import sys import zmq __version__ = '0.0.1' class ParserError(Exception): """An exception which occurred when parsing command-line arguments.""" pass parser = argparse.ArgumentParser( prog='zmqc', version=__version__, usage= "%(prog)s [-h] [-v] [-0] (-r | -w) (-b | -c)\n " "SOCK_TYPE [-o SOCK_OPT=VALUE...]\n " "address [address ...]", description="zmqc is a small but powerful command-line interface to ZMQ. " "It allows you to create a socket of a given type, bind or connect it to " "multiple addresses, set options on it, and receive or send messages over " "it using standard I/O, in the shell or in scripts.", epilog="This is free and unencumbered software released into the public " "domain. For more information, please refer to <http://unlicense.org>.", ) parser.add_argument('-0', dest='delimiter', action='store_const', const='\x00', default='\n', help="Separate messages on input/output should be " "delimited by NULL characters (instead of newlines). Use " "this if your messages may contain newlines, and you want " "to avoid ambiguous message borders.") parser.add_argument('-n', metavar='NUM', dest='number', type=int, default=None, help="Receive/send only NUM messages. By default, zmqc " "lives forever in 'write' mode, or until the end of input " "in 'read' mode.") mode_group = parser.add_argument_group(title='Mode') mode = mode_group.add_mutually_exclusive_group(required=True) mode.add_argument('-r', '--read', dest='mode', action='store_const', const='r', help="Read messages from the socket onto stdout.") mode.add_argument('-w', '--write', dest='mode', action='store_const', const='w', help="Write messages from stdin to the socket.") behavior_group = parser.add_argument_group(title='Behavior') behavior = behavior_group.add_mutually_exclusive_group(required=True) behavior.add_argument('-b', '--bind', dest='behavior', action='store_const', const='bind', help="Bind to the specified address(es).") behavior.add_argument('-c', '--connect', dest='behavior', action='store_const', const='connect', help="Connect to the specified address(es).") sock_params = parser.add_argument_group(title='Socket parameters') sock_type = sock_params.add_argument('sock_type', metavar='SOCK_TYPE', choices=('PUSH', 'PULL', 'PUB', 'SUB', 'PAIR'), type=str.upper, help="Which type of socket to create. Must be one of 'PUSH', 'PULL', " "'PUB', 'SUB' or 'PAIR'. See `man zmq_socket` for an explanation of the " "different types. 'REQ', 'REP', 'DEALER' and 'ROUTER' sockets are " "currently unsupported. --read mode is unsupported for PUB sockets, and " "--write mode is unsupported for SUB sockets.") sock_opts = sock_params.add_argument('-o', '--option', metavar='SOCK_OPT=VALUE', dest='sock_opts', action='append', default=[], help="Socket option names and values to set on the created socket. " "Consult `man zmq_setsockopt` for a comprehensive list of options. Note " "that you can safely omit the 'ZMQ_' prefix from the option name. If the " "created socket is of type 'SUB', and no 'SUBSCRIBE' options are given, " "the socket will automatically be subscribed to everything.") addresses = sock_params.add_argument('addresses', nargs='+', metavar='address', help="One or more addresses to bind/connect to. Must be in full ZMQ " "format (e.g. 'tcp://<host>:<port>')") def read_until_delimiter(stream, delimiter): """ Read from a stream until a given delimiter or EOF, or raise EOFError. >>> io = StringIO("abcXdefgXfoo") >>> read_until_delimiter(io, "X") "abc" >>> read_until_delimiter(io, "X") "defg" >>> read_until_delimiter(io, "X") "foo" >>> read_until_delimiter(io, "X") Traceback (most recent call last): ... EOFError """ output = array.array('c') c = stream.read(1) while c and c != delimiter: output.append(c) c = stream.read(1) if not (c or output): raise EOFError return output.tostring() def get_sockopts(sock_opts): """ Turn a list of 'OPT=VALUE' into a list of (opt_code, value). Work on byte string options: >>> get_sockopts(['SUBSCRIBE=', 'SUBSCRIBE=abc']) [(6, ''), (6, 'abc')] Automatically convert integer options to integers: >>> zmqc.get_sockopts(['LINGER=0', 'LINGER=-1', 'LINGER=50']) [(17, 0), (17, -1), (17, 50)] Spew on invalid input: >>> zmqc.get_sockopts(['LINGER=foo']) Traceback (most recent call last): ... zmqc.ParserError: Invalid value for option LINGER: 'foo' >>> zmqc.get_sockopts(['NONEXISTENTOPTION=blah']) Traceback (most recent call last): ... zmqc.ParserError: Unrecognised socket option: 'NONEXISTENTOPTION' """ option_coerce = { int: set(zmq.core.constants.int_sockopts).union( zmq.core.constants.int64_sockopts), str: set(zmq.core.constants.bytes_sockopts) } options = [] for option in sock_opts: match = re.match(r'^([A-Z_]+)\=(.*)$', option) if not match: raise ParserError("Invalid option spec: %r" % match) opt_name = match.group(1) if opt_name.startswith('ZMQ_'): opt_name = opt_name[4:] try: opt_code = getattr(zmq.core.constants, opt_name.upper()) except AttributeError: raise ParserError("Unrecognised socket option: %r" % ( match.group(1),)) opt_value = match.group(2) for converter, opt_codes in option_coerce.iteritems(): if opt_code in opt_codes: try: opt_value = converter(opt_value) except (TypeError, ValueError): raise ParserError("Invalid value for option %s: %r" % ( opt_name, opt_value)) break options.append((opt_code, opt_value)) return options def main(): args = parser.parse_args() context = zmq.Context.instance() sock = context.socket(getattr(zmq, args.sock_type)) # Bind or connect to the provided addresses. for address in args.addresses: getattr(sock, args.behavior)(address) # Set any specified socket options. try: sock_opts = get_sockopts(args.sock_opts) except ParserError, exc: parser.error(str(exc)) else: for opt_code, opt_value in sock_opts: sock.setsockopt(opt_code, opt_value) # If we have a 'SUB' socket that's not explicitly subscribed to # anything, subscribe it to everything. if (sock.socket_type == zmq.SUB and not any(opt_code == zmq.SUBSCRIBE for (opt_code, _) in sock_opts)): sock.setsockopt(zmq.SUBSCRIBE, '') # Live forever if no `-n` argument was given, otherwise die after a fixed # number of messages. if args.number is None: iterator = itertools.repeat(None) else: iterator = itertools.repeat(None, args.number) try: if args.mode == 'r': read_loop(iterator, sock, args.delimiter, sys.stdout) elif args.mode == 'w': write_loop(iterator, sock, args.delimiter, sys.stdin) finally: sock.close() def read_loop(iterator, sock, delimiter, output): """Continously get messages from the socket and print them on output.""" for _ in iterator: try: message = sock.recv() output.write(message + delimiter) output.flush() except KeyboardInterrupt: return except IOError, exc: if exc.errno == errno.EPIPE: return raise def write_loop(iterator, sock, delimiter, input): """Continously get messages from input and send them through the socket.""" for _ in iterator: try: message = read_until_delimiter(input, delimiter) sock.send(message) except (KeyboardInterrupt, EOFError): return if __name__ == '__main__': main()
true
cd90be762ee720db02d613d2c8dacbc2d103514c
Python
P-ppc/leetcode
/algorithms/SpiralMatrixIII/solution.py
UTF-8
934
3.0625
3
[]
no_license
class Solution(object): def spiralMatrixIII(self, R, C, r0, c0): """ :type R: int :type C: int :type r0: int :type c0: int :rtype: List[List[int]] """ res = [] directions = [[0, 1], [1, 0], [0, -1], [-1, 0]] direction_index = 0 max_step = 1 cur_step = 0 while len(res) < R * C: if 0 <= r0 < R and 0 <= c0 < C: res.append([r0, c0]) if cur_step == max_step: direction_index = (direction_index + 1) % 4 elif cur_step == max_step * 2: direction_index = (direction_index + 1) % 4 max_step += 1 cur_step = 0 r0 += directions[direction_index][0] c0 += directions[direction_index][1] cur_step += 1 return res
true
581e4bc4765822601bb0593ee3c64bee539611e6
Python
c0indev3l/btccharts-tick2candlestick
/tick2candlestick.py
UTF-8
12,641
2.78125
3
[]
no_license
#!/usr/bin/env python # -*- coding: utf-8 -*- """ .. module:: symbol :platform: Unix, Windows, Mac OS X :synopsis: Module to download tick data from BitcoinCharts http://api.bitcoincharts.com/v1/csv/ .. moduleauthor:: Working4coins <working4coins@gmail.com> Copyright (C) 2013 "Working4coins" <working4coins@gmail.com> You can donate: https://sites.google.com/site/working4coins/donate This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/> """ import os import argparse from symbol import Symbol from timeframe import TF import urllib2 from urlparse import urljoin import datetime import dateutil.parser import pandas as pd class ApiRequestBitcoinchartsGetTicks: """"Class to download (or read) tick data from BitcoinCharts using http://api.bitcoincharts.com/v1/csv/{symbol}.csv with {symbol}=mtgoxUSD """ filename = '' data = '' dataframe = None dataframe_out = None def __init__(self, args): self.args = args self.basepath = ARGS.basepath self.symbol = ARGS.symbol self.dt1 = ARGS.dt1 self.dt2 = ARGS.dt2 self.timeframe = ARGS.tf self.flag_download_overwrite = ARGS.downloadagain self.api_url = self.symbol.shortname()+'.csv' self.api_base_url = "http://api.bitcoincharts.com/v1/csv/" self.url = urljoin(self.api_base_url, self.api_url) def update(self): """Update data (get, convert to DataFrame, print, resample...""" self.get_data() #self.pretty_print_data() self.convert_to_dataframe() self.pretty_print_dataframe(self.dataframe) self.calculate() def get_data(self): """Get data (download and write or read from file)""" self.filename = os.path.join(self.basepath, "data_in/ticks_{api_url}".format( api_url=self.api_url, ) ) file_not_exists = not os.path.exists(self.filename) if self.flag_download_overwrite or file_not_exists: self.download() self.write_data() else: self.read_data() def download(self): """Download data""" print("Downloading using url {url} (please wait)".format(url=self.url)) response = urllib2.urlopen(self.url) self.data = response.read() def write_data(self): """Write data to file""" print("Writing {api_url} to {filename}"\ .format(api_url=self.api_url, filename=self.filename)) my_file = open(self.filename, 'w') my_file.write(self.data) my_file.close() def read_data(self): """Display read data from file message""" print("Reading {api_url} from {filename}"\ .format(api_url=self.api_url, filename=self.filename)) print(" instead of downloading using url {url}".format(url=self.url)) def pretty_print_data(self): """Print raw data (CSV here)""" print(self.data) def pretty_print_dataframe(self, dataframe): """Print DataFrame (head, ... tail, dtypes)""" print(dataframe.head()) print(dataframe) print(dataframe.tail()) print(dataframe.dtypes) #def conv_timestamp_to_datetime(x): # return(datetime.datetime.fromtimestamp(x, dateutil.tz.tzutc())) def convert_to_dataframe(self): """Convert raw data to a Python Pandas DataFrame""" self.dataframe = pd.read_csv(self.filename, names=['TIMESTAMP', 'PRICE', 'VOL']) def calculate(self): """Convert data to appropriate type, calculate, resample""" print("Convert data type") self.dataframe['TIMESTAMP'] = \ pd.to_datetime(self.dataframe['TIMESTAMP']*int(1e9)) #print(self.dataframe.dtypes) self.dataframe = \ self.dataframe.set_index('TIMESTAMP').astype('float64') self.dataframe['TICK_VOL'] = 1 #self.dataframe = self.dataframe.set_index('TIMESTAMP') #self.dataframe['TIMESTAMP'] = pd.DatetimeIndex( #self.dataframe['TIMESTAMP']) price_digits = 5 vol_digits = 8 self.dataframe['PRICE'] = self.dataframe['PRICE'].map( lambda x: int(x * 10**price_digits)) self.dataframe['VOL'] = self.dataframe['VOL'].map( lambda x: int(x * 10**vol_digits)) if self.dt1 != None: self.dataframe = self.dataframe[self.dataframe.index >= self.dt1] if self.dt2 != None: self.dataframe = self.dataframe[self.dataframe.index <= self.dt2] print("="*100) print("Tick data") self.pretty_print_dataframe(self.dataframe) print("="*100) #self.dataframe_out = self.dataframe.resample('15Min', how='ohlc') print("Resample ticks data to OHLC candlesticks {tf} (please wait)"\ .format(tf=self.timeframe)) timeframes_pandas_names = { TF.M1: '1min', TF.M5: '5min', TF.M15: '15min', TF.M30: '30min', TF.H1: '1H', TF.H2: '2H', TF.H4: '4H', TF.H6: '6H', TF.H12: '12H', TF.D1: '1D', TF.W1: '1W', TF.MN: '1M', } timeframe_pd = timeframes_pandas_names[self.timeframe] self.dataframe_out = self.dataframe['PRICE']\ .resample(timeframe_pd, how='ohlc') self.dataframe_out['VOL'] = self.dataframe['VOL']\ .resample(timeframe_pd, how='sum') self.dataframe_out['TICK_VOL'] = self.dataframe['TICK_VOL']\ .resample(timeframe_pd, how='sum') self.dataframe_out['TICK_VOL'] = self.dataframe_out['TICK_VOL'].fillna(0) # or .fillna(1) self.dataframe_out = self.dataframe_out.rename( columns={ 'open': 'OPEN', 'high': 'HIGH', 'low': 'LOW', 'close': 'CLOSE', } ) print("Fill NaN (VOLUME=0 and OPEN=HIGH=LOW=CLOSE=CLOSE_PREVIOUS)") #self.dataframe_out['MISSING'] = self.dataframe_out['VOL'].isnull() self.dataframe_out['VOL'] = self.dataframe_out['VOL'].fillna(0) self.dataframe_out['CLOSE'] = self.dataframe_out['CLOSE'].fillna() self.dataframe_out['OPEN'] = self.dataframe_out['OPEN']\ .fillna(self.dataframe_out['CLOSE']) self.dataframe_out['LOW'] = self.dataframe_out['LOW']\ .fillna(self.dataframe_out['CLOSE']) self.dataframe_out['HIGH'] = self.dataframe_out['HIGH']\ .fillna(self.dataframe_out['CLOSE']) for col in ['OPEN', 'HIGH', 'LOW', 'CLOSE', 'VOL', 'TICK_VOL']: self.dataframe_out[col] = self.dataframe_out[col].map(int) #self.dataframe_out.index = self.dataframe_out.index.map(lambda x: (x.to_pydatetime())) self.dataframe_out['TIMESTAMP'] = self.dataframe_out.index #self.dataframe_out['TIMESTAMP'] = self.dataframe_out.index.map(lambda x: int(x.to_pydatetime().strftime('%s'))) epoch = datetime.datetime(1970, 1, 1) self.dataframe_out['TIMESTAMP'] = self.dataframe_out.index.map(lambda x: int((x - epoch).total_seconds())) #self.dataframe_out['TIMESTAMP'] = self.dataframe_out.index.map(lambda x: int(x.to_pydatetime().strftime('%s'))) # see http://delorean.readthedocs.org/en/latest/quickstart.html # d.epoch() # or http://stackoverflow.com/questions/6999726/python-getting-millis-since-epoch-from-datetime # epoch = datetime.datetime.utcfromtimestamp(0) # delta = dt - epoch # delta.total_seconds() # http://stackoverflow.com/questions/8777753/converting-datetime-date-to-utc-timestamp-in-python/8778548#8778548 print("Reorder columns") self.dataframe_out = self.dataframe_out.reindex_axis(['TIMESTAMP', 'OPEN', 'HIGH', 'LOW', 'CLOSE', 'VOL', 'TICK_VOL'], axis=1) print("="*100) print("Candlestick data") self.pretty_print_dataframe(self.dataframe_out) print("="*100) self.output_file() def output_file(self): if ARGS.to != None: for to_format in ARGS.to.split(','): to_format = to_format.lower() if to_format == 'csv': self.to_csv() elif to_format == 'xls': self.to_xls() elif to_format == 'hdf5': self.to_hdf5() else: print("File format '{to_format}' is not supported".format(to_format=to_format)) def output_filename(self, ext): dt_format = '%Y%m%d%H%M' dt1_str = self.dataframe_out.index[0]\ .to_pydatetime().strftime(dt_format) dt2_str = self.dataframe_out.index[-1]\ .to_pydatetime().strftime(dt_format) filename = os.path.join(self.basepath, "data_out/{symbol}-{timeframe}-{dt1}-{dt2}.{ext}".format( symbol = self.symbol.longname(), timeframe = self.timeframe.name(), dt1 = dt1_str, dt2 = dt2_str, ext = ext)) return(filename) def to_xls(self): """Output excel file""" filename = self.output_filename('xls') print("Save to Excel file as {filename}".format(filename=filename)) self.dataframe_out.to_excel(filename, index=False) def to_csv(self): """Output CSV file""" filename = self.output_filename('csv') print("Save to CSV file as {filename}".format(filename=filename)) self.dataframe_out.to_csv(filename, index=False) def to_hdf5(self): """Output HDF5 file""" filename = self.output_filename('h5') #self.dataframe_out.to_hdf(filename,'table',append=True) print("Save to HDF5 file as {filename}".format(filename=filename)) try: os.remove(filename) # remove h5 file to avoid it to inflate except: print("Can't remove {filename} (maybe this file doesn't exist)".format(filename=filename)) store = pd.HDFStore(filename, complevel=9, complib='blosc') store.append('df', self.dataframe_out) store.close() if __name__ == "__main__": PARSER = argparse.ArgumentParser(description='Use the following parameters') PARSER.add_argument('--downloadagain', action="store_true", help="use this flag to overwrite data (downloading them again...)\n\ please don't use this too often!") PARSER.add_argument('--dt1', action="store", help="use this flag to set datetime from (2012-01-01T00:00Z)", default=None) PARSER.add_argument('--dt2', action="store", help="use this flag to set datetime to (2013-12-31T00:00Z)", default=None) PARSER.add_argument('--tf', action="store", help="use this flag to set timeframe \ (M1, M5, M15, M30, H1, H4, D1, W1, MN, YR)", default='M15') PARSER.add_argument('--symbol', action="store", help="use this flag to set market symbol (mtgox|BTC/USD)", default='mtgox|BTC/USD') PARSER.add_argument('--to', action="store", help="use this flag to set output file ('csv', 'xls', 'hdf5', 'csv,hdf5')") ARGS = PARSER.parse_args() ARGS.basepath = os.path.dirname(__file__) ARGS.symbol = Symbol(ARGS.symbol) ARGS.tf = TF.from_string(ARGS.tf) if ARGS.dt1 != None: ARGS.dt1 = dateutil.parser.parse(ARGS.dt1) if ARGS.dt2 != None: ARGS.dt2 = dateutil.parser.parse(ARGS.dt2) if ARGS.dt2 < ARGS.dt1: raise(Exception('dt2 < dt1 !')) #print(ARGS.dt1) DATATICKS = ApiRequestBitcoinchartsGetTicks(ARGS) DATATICKS.update()
true
3609e44572690965cb83d8cb123eaa89b7a23e56
Python
papadave11/DeepLearnig
/datatime_to_string.py
UTF-8
1,447
2.9375
3
[]
no_license
from pandas import read_csv from datetime import datetime from pandas import DataFrame from pandas import concat from sklearn.preprocessing import LabelEncoder from sklearn.preprocessing import MinMaxScaler import tensorflow as tf from tensorflow import keras from tensorflow.keras import layers from keras.models import Sequential from keras.layers import Dense, LSTM from keras.layers.core import Dense, Dropout, Activation from keras.callbacks import EarlyStopping import pandas as pd, numpy as np from matplotlib import pyplot # Python program to convert time # from 12 hour to 24 hour format # Function to convert the date format def convert24(str1): # Checking if last two elements of time # is AM and first two elements are 12 if str1[0] == "AM" and str1[0] == "12": return "00" + str1[1] # remove the AM elif str1[0] == "AM": return str1[1] # Checking if last two elements of time # is PM and first two elements are 12 elif str1[0] == "PM" and str1[0] == "12": return str1[1] else: # add 12 to hours and remove PM return str(int(str1[1]) + 12) dataset = read_csv('kumdan_2019.csv') print(dataset.date[0]) dataset.date = convert24(dataset.date[0]) print(dataset.date) print("ksksksks") """ print(dataset.hour[0]) #print(convert24("08:05:45 PM")) """
true
6e06351a7a4fdefe6d608ea87d394fdae8933789
Python
laolee010126/algorithm-with-python
/problems_solving/baekjoon/acm_craft.py
UTF-8
1,242
3.21875
3
[]
no_license
"""Get the mininum cost of building a wanted building url: https://www.acmicpc.net/problem/1005 """ import sys sys.setrecursionlimit(10 ** 9) def get_building_time(w, time, rule_cache): total_time_cache = [-1 for _ in range(len(time))] for i in rule_cache[0]: total_time_cache[i] = time[i] def get_time(w): if total_time_cache[w] == -1: ret = -1 for src in rule_cache[w]: ret = max(ret, get_time(src)) total_time_cache[w] = ret + time[w] return total_time_cache[w] return get_time(w) if __name__ == '__main__': C = int(input()) ans = [] for _ in range(C): N, R = (int(n) for n in input().split()) time = [0] + [int(n) for n in input().split()] rule_cache = [[] for _ in range(len(time))] start = [1 for _ in range(len(time))] for _ in range(R): src, dest = (int(n) for n in input().split()) rule_cache[dest].append(src) start[dest] = 0 rule_cache[0] = [dest for dest in range(len(time)) if start[dest] == 1] W = int(input()) v = get_building_time(W, time, rule_cache) ans.append(v) for n in ans: print(n)
true
74acff7cf11e5086d5d5edc9eaa3c47acbb27e40
Python
GarciaJhonLucas/colorise
/src/colorise/__init__.py
UTF-8
8,066
2.796875
3
[ "BSD-3-Clause" ]
permissive
#!/usr/bin/env python # -*- coding: utf-8 -*- """Python module for easy, cross-platform colored output to the terminal.""" import atexit import itertools import os import platform import sys import colorise.formatter from colorise.attributes import Attr # noqa: F401 _SYSTEM_OS = platform.system().lower() __author__ = 'Alexander Asp Bock' __version__ = '1.0.1' __license__ = 'BSD 3-Clause' __all__ = [ 'can_redefine_colors', 'redefine_colors', 'color_names', 'num_colors', 'set_color', 'reset_color', 'cprint', 'fprint', 'highlight' ] # Determine which platform-specific color manager to import if _SYSTEM_OS.startswith('win'): from colorise.win.color_functions import ( num_colors as _num_colors, redefine_colors as _redefine_colors, reset_color as _reset_color, set_color as _set_color, ) from colorise.win.win32_functions import ( can_redefine_colors as _can_redefine_colors, restore_console_modes, ) # Ensure that the console mode set before colorise was loaded is restored atexit.register(restore_console_modes) else: from colorise.nix.cluts import can_redefine_colors as _can_redefine_colors from colorise.nix.color_functions import ( num_colors as _num_colors, redefine_colors as _redefine_colors, reset_color as _reset_color, set_color as _set_color, ) def num_colors(): """Return the number of colors supported by the terminal.""" return _num_colors() def can_redefine_colors(file): """Return True if the terminal supports redefinition of colors. Only returns True for Windows 7/Vista and beyond as of now. """ return _can_redefine_colors(file) def redefine_colors(color_map, file=sys.stdout): """Redefine colors using a color map of indices and RGB tuples. .. note:: It is not currently possible to redefine colors on Mac and Linux systems via colorise. """ _redefine_colors(color_map, file) def color_names(): """Return a list of supported color names.""" return [ 'black', 'red', 'green', 'yellow', 'blue', 'purple', 'magenta', 'cyan', 'gray', 'grey', 'lightgrey', 'lightgray', 'lightred', 'lightgreen', 'lightyellow', 'lightblue', 'lightpurple', 'lightmagenta', 'lightcyan', 'white', ] def set_color(fg=None, bg=None, attributes=None, file=sys.stdout): """Set the current colors. If no arguments are given, sets default colors. """ if attributes is None: attributes = [] _set_color(fg, bg, attributes, file) def reset_color(file=sys.stdout): """Reset all colors and attributes.""" _reset_color(file) def cprint( string, fg=None, bg=None, attributes=None, end=os.linesep, file=sys.stdout, enabled=True, ): """Print a string to a target stream with colors and attributes. The fg and bg keywords specify foreground- and background colors while attributes is a list of desired attributes. The remaining two keyword arguments are the same as Python's built-in print function. Colors and attributes are reset before the function returns. """ if attributes is None: attributes = [] # Flush any remaining stuff before resetting colors file.flush() if not enabled: file.write(string) file.write(end) file.flush() else: reset_color(file) set_color(fg, bg, attributes, file) file.write(string) file.flush() # Flush before resetting colors reset_color(file) # Make sure to print the end keyword after resetting so the next line # is not affected by a newline or similar file.write(end) file.flush() # Flush before resetting colors # Global color formatter instance _COLOR_FORMATTER = colorise.formatter.ColorFormatter(set_color, reset_color) def fprint(fmt, autoreset=True, end=os.linesep, file=sys.stdout, enabled=True): """Print a string with color formatting. The autoreset keyword controls if colors and attributes are reset before each new color format. For example: >>> colorise.fprint('{fg=blue}Hi {bg=red}world', autoreset=False) would print 'Hi' in blue foreground colors and 'world' in blue foreground colors AND a red background color, whereas: >>> colorise.fprint('{fg=blue}Hi {bg=red}world', autoreset=True) would print 'Hi' in blue foreground colors but 'world' only with a red background color since colors are reset when '{bg=red}' is encountered. The remaining two keyword arguments are the same as Python's built-in print function. Colors and attribtues are reset before the function returns. """ _COLOR_FORMATTER.autoreset = autoreset _COLOR_FORMATTER.file = file _COLOR_FORMATTER.enabled = enabled _COLOR_FORMATTER.format(fmt) if enabled: file.flush() # Flush before resetting colors reset_color(file) # Make sure to print the end keyword after resetting so the next line is # not affected by a newline or similar file.write(end) def highlight( string, indices, fg=None, bg=None, attributes=None, end=os.linesep, file=sys.stdout, enabled=True, ): """Highlight characters using indices and print to a target stream. The indices argument is a list of indices (not necessarily sorted) for which to apply the colors and attributes. Indices that are out of bounds are ignored. fg and bg specify foreground- and background colors while attributes is a list of desired attributes. The remaining two keyword arguments are the same as Python's built-in print function. Colors and attribtues are reset before the function returns. """ if attributes is None: attributes = [] if not string or not indices or not (fg or bg or attributes)\ or not enabled: file.write(string + end) return idx = 0 sorted_indices = sorted(indices) if sorted_indices[0] < 0 or sorted_indices[-1] >= len(string): raise IndexError('Index out of bounds') # Group consecutive indices, e.g. [0, 2, 3, 5, 6] -> [(0), (2, 3), (5, 6)] groups = itertools.groupby( enumerate(sorted_indices), lambda x: x[0] - x[1], ) # Flush any remaining stuff before resetting colors file.flush() reset_color(file) for _, group in groups: # Get the starting and ending indices of the group group = list(group) start_idx, end_idx = group[0][1], group[-1][1] + 1 # Write anything up until the start index of the current group file.write(string[idx:start_idx]) file.flush() set_color(fg, bg, attributes, file) # Write the range of characters specified by the group file.write(string[start_idx:end_idx]) file.flush() reset_color(file) # Set current index to end of group idx = end_idx # Write anything that is left to write if idx < len(string): file.write(string[idx:]) file.write(end) def safe_atexit_reset_colors(): """Safely reset colors.""" # This is necessary when running the tests since pytest will redirect # stdout and stderr then restore them to the original values after the test # session. This closes stdout and stderr causing writes to the pytest # redirected streams to fail. # # By calling this function using the atexit module, stdout and stderr are # evaluated after having been restored by pytest # # See https://github.com/pytest-dev/pytest/issues/5502 if not sys.stdout.closed: reset_color(sys.stdout) if not sys.stderr.closed: reset_color(sys.stderr) # Ensure colors and attributes return to normal when colorise is quit atexit.register(safe_atexit_reset_colors)
true
a6e1cadf4e950f07e61e81db37b3e056e61b552f
Python
stbman/cs5228
/latlong/pairdist_latlong.py
UTF-8
1,201
2.953125
3
[]
no_license
import pandas as pd import numpy as np df = pd.read_csv("pairs.csv") db = pd.read_csv("latlong.csv") def updateLat(port): port = db[db["Port"] == port] assert(port is not None) assert(port.shape == (1,3,)) return port.iloc[0,1] def updateLong(port): port = db[db["Port"] == port] assert(port is not None) assert(port.shape == (1,3,)) return port.iloc[0,2] def calcDistance(data): origin_lat = np.radians(data[0]) origin_long = np.radians(data[1]) dest_lat = np.radians(data[2]) dest_long = np.radians(data[3]) R = 6373. # in km dlon = dest_long - origin_long dlat = dest_lat - origin_lat a = (np.sin(dlat/2.))**2. + np.cos(origin_lat) * np.cos(dest_lat) * (np.sin(dlon/2))**2. c = 2 * np.math.atan2( np.sqrt(a), np.sqrt(1.-a) ) d = R * c #(where R is the radius of the Earth) return d df["Origin_lat"] = df["Origin"].apply(updateLat) df["Origin_long"] = df["Origin"].apply(updateLong) df["Dest_lat"] = df["Dest"].apply(updateLat) df["Dest_long"] = df["Dest"].apply(updateLong) df["Distance"] = df[["Origin_lat", "Origin_long", "Dest_lat", "Dest_long"]].apply(calcDistance, axis=1) df.to_csv("pairdistances.latlong.csv")
true
9836e64bf7656bf1a2b2d36573c55bb408a24646
Python
spadwal7039/ttl255.com
/netbox/pynetbox-part4/prep_tags_for_search.py
UTF-8
1,030
2.6875
3
[ "MIT" ]
permissive
import ipaddress import itertools import pynetbox from config import NETBOX_URL, NETBOX_TOKEN # Instantiate pynetbox.api class with URL of your NETBOX and your API TOKEN nb = pynetbox.api(url=NETBOX_URL, token=NETBOX_TOKEN) # Prepare tags we want to combine mc_side = ["a_side", "b_side"] mc_exchange = ["nasdaq", "nyse"] mc_type = ["prod", "cert", "dr"] # Create product of the tag families mc_tag_prod = itertools.product(mc_side, mc_exchange, mc_type) # Create list with lists of resulting tag combinations # E.g. ['mc_src', 'a_side', 'nasdaq', 'prod'] mc_tags = sorted([["mc_src"] + (list(t)) for t in mc_tag_prod]) # Container from which we will be assigning prefixes mc_src_container = ipaddress.IPv4Network("10.255.0.0/16") mc_src_pfxs = mc_src_container.subnets(new_prefix=28) # Create new prefixes and attach tags to them for pfx, tag_list in zip(mc_src_pfxs, mc_tags): new_pfx = nb.ipam.prefixes.create(prefix=str(pfx), tags=tag_list) print("Prefix: {0}, tags: {1}".format(new_pfx.prefix, new_pfx.tags))
true
19190c777abe5418ab6a3ac218cfdb7ebfc5d2a6
Python
mahmoud-taya/OWS-Mastering_python_course
/Files/064.Files_handling_part_three_write_and_append_in_files.py
UTF-8
1,184
3.734375
4
[]
no_license
# ------------------------------------------------- # --- File handling => write and append in file --- # ------------------------------------------------- # Write => Replace the new value with the old value my_file = open("C:\Users\حسن صلاح\Google Drive\1. Projects_\Python course (Osama)\Learning code\hasan.txt", "w") my_file.write("This is a first line\n") my_file.write("Second line") my_file = open(r"C:\Users\حسن صلاح\Google Drive\1. Projects_\Python course (Osama)\Learning code", "w") my_file.write("Hasan salah\n" * 1000) my_list = ["Osama\n", "Ahmed\n", "Sayed"] my_file = open("C:\Users\حسن صلاح\Google Drive\1. Projects_\Python course (Osama)\Learning code", "w") my_file.writelines(my_list) # Append => Don't replace the new values with the old values # Start typing from the last line typed my_file = open("C:\Users\حسن صلاح\Google Drive\1. Projects_\Python course (Osama)\Learning code", "a") my_file.write("hasan") my_file.write("hasansalah\n") # Write after the word hasan not in the new line because there is no \n in the last line my_file.write("hasansalaheisa") # Write in the new line because there is a \n in the last line
true
f4ebb288aa151fcd939f80917040a35c37834565
Python
slominskir/rfwtools
/rfwtools/example_set.py
UTF-8
51,218
2.5625
3
[]
no_license
"""This package is for managing a collection of Examples. ExampleSet objects are typically created by a DataSet, but may be created directly. Basic Usage Examples: Start by saving this data in my-sample-labels.txt in the Config().label_dir directory (defaults to ./data/labels/). **THESE FIELDS SHOULD BE TAB SEPARATED. DOCUMENTATION SYSTEM INSISTS ON CONVERTING THEM TO SPACES. PLEASE FIX IF YOU TRY THIS EXAMPLE ON YOUR OWN** :: zone cavity cav# fault time 1L25 4 44 Microphonics 2020/03/10 01:08:41 2L24 5 77 Controls Fault 2020/03/10 01:42:03 1L25 5 45 Microphonics 2020/03/10 02:50:07 2L26 8 96 E_Quench 2020/03/10 02:58:13 1L25 5 45 Microphonics 2020/03/10 04:55:21 1L22 4 20 Quench_3ms 2020/03/10 05:06:13 1L25 5 45 Microphonics 2020/03/10 07:35:32 2L22 0 57 Multi Cav turn off 2020/03/10 07:59:49 2L23 0 65 Multi Cav turn off 2020/03/10 07:59:56 2L24 0 73 Multi Cav turn off 2020/03/10 08:00:03 Creating from scratch. This assumes you have label files in Config().label_dir, and will save a CSV file to Config().output_dir (defaults to ./processed-output/) :: from rfwtools.example_set import ExampleSet from rfwtools.example_validator import ExampleValidator es = ExampleSet() es.add_label_file_data(label_files=['my-sample-labels.txt']) es.get_label_file_report() es.remove_duplicates_and_mismatches() es.purge_invalid_examples(ExampleValidator()) es.save_csv("my_example_set.csv") Reporting and Visualization. This assumes that you have created and saved an ExampleSet as in the example above. :: from rfwtools.example_set import ExampleSet es = ExampleSet() es.load_csv("my_example_set.csv") es.display_frequency_barplot(x='zone', color_by='cavity_label') es.display_zone_label_heatmap(zones=['1L22', '1L23', '1L24', '1L25', '1L26']) es.display_summary_label_heatmap(title='2L22 7AM Summary', query = 'zone=="2L22" & dtime < "2020-03-10 08:00:00" & dtime > "2020-03-10 07:00:00"') """ import sys from datetime import datetime import warnings from typing import List, Tuple import pandas as pd import os import matplotlib.pyplot as plt from sklearn.metrics import classification_report import tzlocal from tqdm import tqdm from rfwtools import utils from rfwtools.config import Config from rfwtools.example import ExampleType, Factory, IExample from rfwtools.example_validator import ExampleValidator from rfwtools.timestamp import is_datetime_in_range, TimestampMapper from rfwtools.visualize.timeline import swarm_timeline from rfwtools.visualize import heatmap class ExampleSet: """A class for managing a collection of examples, including metadata about the collection of examples. Each ExampleSet supports having only one type of IExample object, and each only supports one set of kwargs. This class has methods for building collections of examples from our standard label files or from the waveform browser webservice. It also includes many methods for visualizing and reporting. Attributes: known_zones: A list of strings identifying the minimum set of zone categories to be included in the categorical. The class version is the default set. The instance version is the known to that instance. known_cavity_labels: A list of strings identifying the minimum set of cavity label categories to be included in the categorical. The class version is the default set. The instance version is the known to that instance. known_fault_labels: A list of strings identifying the minimum set of fault label categories to be included in the categorical. The class version is the default set. The instance version is the known to that instance. """ #: The expected fault levels as of Dec 2020. New faults may appear over time, but this is a baseline. _known_zones = ['0L04', '1L07', '1L22', '1L23', '1L24', '1L25', '1L26', '2L22', '2L23', '2L24', '2L25', '2L26'] _known_cavity_labels = ['0', '1', '2', '3', '4', '5', '6', '7', '8'] _known_fault_labels = ['Single Cav Turn off', 'Multi Cav turn off', 'E_Quench', 'Quench_3ms', 'Quench_100ms', 'Microphonics', 'Controls Fault', 'Heat Riser Choke', 'Unknown'] # Expected column names - others may exist, but these are what are required no matter. __mandatory_columns = ['zone', 'dtime', 'cavity_label', 'fault_label', 'cavity_conf', 'fault_conf', 'example', 'label_source'] def __init__(self, e_type: ExampleType = ExampleType.EXAMPLE, example_kwargs: dict = {}, known_zones: List[str] = None, known_cavity_labels: List[str] = None, known_fault_labels: List[str] = None, req_columns: List[str] = None): """Create an instance of an ExampleSet. Optionally override the default levels for zones and labels. Arguments: e_type: The type of example that should be created within this ExampleSet example_kwargs: A dictionary of keyword arguments that will be passed to every IExample object constructed. known_zones: A list of strings identifying the minimum set of zone categories to be included in the categorical. known_cavity_labels: A list of strings identifying the minimum set of cavity label categories to be included in the categorical. known_fault_labels: A list of strings identifying the minimum set of fault label categories to be included in the categorical. req_columns: A list of column names that are required to be in valid DataFrames used internally. These are in addition to the class defined list of "zone", "dtime", etc.. """ # For constructing examples. self.e_type = e_type self.example_kwargs = example_kwargs self.example_factory = Factory(e_type=e_type, **example_kwargs) # These columns are also required, but the list contents is variable based on use case. self._req_columns = [] if req_columns is not None: self._req_columns = req_columns # Setup the standard default values for zone and label options #: Instance's customized default list of known zones self._known_zones = ExampleSet._known_zones if known_zones is not None: self._known_zones = known_zones #: Instance's customized default list of known cavity_labels self._known_cavity_labels = ExampleSet._known_cavity_labels if known_cavity_labels is not None: self._known_cavity_labels = known_cavity_labels #: Instance's customized default list of known fault_labels self._known_fault_labels = ExampleSet._known_fault_labels if known_fault_labels is not None: self._known_fault_labels = known_fault_labels #: ExampleSet DataFrame with proper dtypes self._example_df = pd.DataFrame( {'zone': pd.Categorical([], categories=self._known_zones), 'dtime': pd.Series([], dtype='datetime64[ns]'), 'cavity_label': pd.Categorical([], categories=self._known_cavity_labels), 'fault_label': pd.Categorical([], categories=self._known_fault_labels), 'cavity_conf': pd.Series([], dtype="float64"), 'fault_conf': pd.Series([], dtype='float64'), 'example': pd.Series([], dtype="object"), 'label_source': pd.Series([], dtype="object") } ) # Create a hash for holding on to the label file data. This will preserve the original data after cleaning for # duplicates, mismatches, etc. #: A dictionary holding label file contents, keyed on file names self.label_file_dataframes = {} def get_required_columns(self) -> List[str]: """Generates the list of column names that must appear in a DataFrame for it to be a valid example_df. Returns: The list of column names """ return ExampleSet.__mandatory_columns + self._req_columns def has_required_columns(self, df: pd.DataFrame, dtypes: bool = False, skip_example: bool = True) -> bool: """Check if the given DataFrame has the required columns. Arguments: df: The DataFrame to check dtypes: Check for matching dtypes of "mandatory" columns. Uses existing _example_df's dtypes. Skips if _examples_df is None. skip_example: If True, requires that the 'example' column name is present. Otherwise it is not checked. Returns: True if all required column names are present. False otherwise. """ req_cols = self.get_required_columns() man_cols = ExampleSet.__mandatory_columns.copy() if skip_example: man_cols.remove("example") req_cols.remove("example") # Check that the columns have the same names for col in req_cols: if col not in df.columns.to_list(): if Config().debug: print(f"New DataFrame missing column '{col}'", file=sys.stderr) return False # Now that we know the df has an example column. Check that the examples have the same type as defined for this # ExampleSet. if not skip_example: df_e_type = df.example[0].get_example_type() if self.e_type != df_e_type: if Config().debug: print(f"New DataFrame different ExampleType '{df_e_type}' from '{self.e_type}", file=sys.stderr) return False # Check that the columns have the same dtype if dtypes and self._example_df is not None: # Check that all of the columns have matching dtypes. CategoricalDtypes match only if the have the same # categories, not only if they are by categorical. Here that's a problem since new categories may arise. # Just check that the names of the dtypes match. e_df_dtype_names = [str(x) for x in self._example_df[man_cols].dtypes] df_dtype_names = [str(x) for x in df[man_cols].dtypes] if not e_df_dtype_names == df_dtype_names: print(f"New DataFrame has at least one wrong dtype.", file=sys.stderr) return False return True def save_csv(self, filename: str, out_dir: str = None, sep: str = ',') -> None: """Write out the ExampleSet data as a CSV file relative to out_dir. Only writes out example_df equivalent. Arguments: filename: The filename to save. Will be relative out_dir out_dir: The directory to save the file in. Defaults to Config().output_dir sep: Delimiter string used by Pandas to parse given "csv" file """ if out_dir is None: out_dir = Config().output_dir self._example_df.drop('example', axis=1).to_csv(os.path.join(out_dir, filename), sep=sep, index=False) def load_csv(self, filename: str, in_dir: str = None, sep: str = ',') -> None: """Read in a CSV file that has ExampleSet data. Arguments: filename: The filename to save. Will be relative in_dir in_dir: The directory to find the file in. Defaults to Config().output_dir sep: Delimiter string used by Pandas to parse given "csv" file Raises: ValueError: If the CSV file does not have the expected column names. """ if in_dir is None: in_dir = Config().output_dir if type(filename).__name__ == 'str': df = pd.read_csv(os.path.join(in_dir, filename), sep=sep) else: # Allows for tricks with file-like objects df = pd.read_csv(filename, sep=sep) if not self.has_required_columns(df): raise ValueError("Cannot load CSV file. Unexpected column format.") # Put the DataFrame into a standard structure - categories, column order, etc. self.__standardize_df_format(df) # Add the example column df['example'] = df.apply(self._Example_from_row, axis=1, raw=False) self._example_df = df def update_example_set(self, df: pd.DataFrame, keep_label_file_dataframes: bool = False) -> None: """Replaces the contents of this ExampleSet with the supplied DataFrame. Note: A copy of df is used. Arguments: df: A DataFrame formatted for ExampleSet that will replace the the contents of this ExampleSet. keep_label_file_dataframes: Should the dictionary of label file DataFrames be kept. If False, the dictionary recreated. If True, no action is taken. Raises: ValueError: If columns do not match """ if not self.has_required_columns(df, dtypes=True): raise ValueError(f"New df does not have the required columns or column dtypes.") if not keep_label_file_dataframes: self.label_file_dataframes = {} self._example_df = df.copy() def get_example_df(self) -> pd.DataFrame: """Returns the example set as a DataFrame (copy) Returns: A copy of the internal ExampleSet DataFrame """ return self._example_df.copy() def add_label_file_data(self, label_files: List[str] = None, exclude_zones: List[str] = None, exclude_times: List[Tuple[datetime, datetime]] = None) -> None: """Process and add label files' data to the ExampleSet's internal collection. Arguments: label_files: List of label files to process. If None, all files in Config().label_dir are read. Relative paths are resolved relative to Config().label_dir. exclude_zones: List of zones to exclude. Defaults to Config().exclude_zones. exclude_times: List of 2-tuples of datetime objects. Each 2-tuple specifies a range to exclude. None implie +/-Inf. """ # Use the defaults from the config file if None is given e_zones = exclude_zones if exclude_zones is not None else Config().exclude_zones e_times = exclude_times if exclude_times is not None else Config().exclude_times l_files = label_files if l_files is None: # Only want to process regular files, not directories, etc. l_files = [f for f in os.listdir(Config().label_dir) if os.path.isfile(os.path.join(Config().label_dir, f))] if len(l_files) == 0: raise RuntimeError(f"No label files specified or discovered in default label_dir '{Config().label_dir}'") # Iterate through the supplied label files. Non-absolute paths will be assumed to be relative to the configured # label directory for label_file in l_files: if not os.path.isabs(label_file): label_file = os.path.join(Config().label_dir, label_file) # Process the label file into a DataFrame df = self._create_dataframe_from_label_file(filepath=label_file, exclude_zones=e_zones, exclude_times=e_times) # Stash the label file DataFrame into a dictionary in case we needed it later self.label_file_dataframes[label_file] = df.copy() # Add the DataFrame to the internal collection self._add_example_df(df) def add_web_service_data(self, server: str = None, begin: datetime = None, end: datetime = None, models: List[str] = None) -> None: """Add web service data (faults labeled by in-service model) to the ExampleSet. Note: Should be used exclusive of label data since they will largely overlap Arguments: server: The server to query for the data. If None, use the value in Config begin: The earliest time for which a fault should be included. If None, defaults to Jan 1, 2018 end: The latest time for which a fault should be included. If None defaults to "now" models: A list of model names that should be included in the results. None means include all """ if server is None: server = Config().data_server if begin is None: begin = datetime(year=2018, month=1, day=1) if end is None: end = datetime.now() # Get the data from the web service df = self._create_dataframe_from_web_query(server=server, begin=begin, end=end, models=models) # Add it to the existing ExampleSet self._add_example_df(df) def get_label_file_report(self) -> str: """Generate a string containing a report on the processed label files Returns: A formatted string containing the report. """ # Check to see if we have any duplicates and print them out num_total_events = self.count_events() num_total_labels = len(self._example_df) num_events_with_multiple_labels = self.count_duplicated_events() num_duplicate_labels = self.count_duplicated_labels() num_events_with_mismatched_labels = self.count_duplicated_events_with_mismatched_labels() num_mismatched_labels = self.count_mismatched_labels() mismatched_output = "None Found" if num_events_with_mismatched_labels != 0: mismatched_output = self.get_events_with_mismatched_labels().to_string() out = f"""#### Summary #### Note: event == unique zone/timestamp, label == row in label_file Number of events: {num_total_events} Number of labels: {num_total_labels} Number of events with multiple labels: {num_events_with_multiple_labels} Number of duplicate labels: {num_duplicate_labels} Number of 'extra' labels: {num_duplicate_labels - num_events_with_multiple_labels} Number of events with mismatched labels: {num_events_with_mismatched_labels} Number of mismatched labels: {num_mismatched_labels} #### Events With Mismatched Labels #### {mismatched_output} """ return out def remove_duplicates_and_mismatches(self, report: bool = False) -> None: """Removes duplicate example entries and removes all instances of examples that have mismatched labels. Args: report: Should information about what was removed be included? """ # Split into event groups gb = self._example_df.groupby(['zone', 'dtime']) # Keep only groups that that have exactly one unique cavity and fault label df = gb.filter(lambda x: x.cavity_label.nunique() == 1 and x.fault_label.nunique() == 1) # Print out the entries that were removed if report: tmp_df = gb.filter(lambda x: not (x.cavity_label.nunique() == 1 and x.fault_label.nunique() == 1)) print(f"## Removing the following {len(tmp_df)} entries from the ExampleSet as label mismatches ##") print(tmp_df.sort_values(["zone", "dtime"]).to_string()) print("\n") # Track the size so we can report if needed orig_size = len(self._example_df) # Replace the original example_df with this reduced set. self._example_df = df.drop_duplicates(["zone", "dtime"]) # Print out how many entries were removed as duplicates if report: num_dupes = orig_size - len(self._example_df) print(f"## Removed {num_dupes} entries from the ExampleSet for being duplicates ##") def purge_invalid_examples(self, validator: ExampleValidator, report: bool = True, progress: bool = True) -> None: """Removes all examples from the ExampleSet that do not pass validation Args: validator: A object that follows the ExampleValidator interface. report: Should information about what is purged be printed? progress: Should a progress bar be displayed """ # Variable for report output out = "\n## Validation Results ##\n" # Count of how many examples were removed count = 0 # Private function that allows for easy reporting def __apply_validator(row, _validator): """Applies the validator function in the context of DataFrame apply method. Updates out, count from parent Args: row (DataFrame) - A DataFrame row containing the example to be validated. Should contain an Example under a column named 'example' _validator (ExampleValidator) - Object doing the validation Returns: (bool) - True if example passed validation, Otherwise, False. """ # Allow this function to modify out and count from the parent function nonlocal out nonlocal count _validator.set_example(row.example) try: _validator.validate_data() except Exception as exc: count += 1 msg = f"Invalid event - {row.example}\n {exc}\n" out += msg # If we're debugging, we probably don't want to wait until the end to see what happened. if Config().debug: print(msg) return False return True # tqdm provides a progress bar and the pd.DataFrame.progress_apply method. This registers a new instance with # pandas if progress: # tqdm/pandas generate a Future warning about the Panel class. Suppress that since I can't do anything # about it. Will fix if it breaks. print("## Validating Examples ##") with warnings.catch_warnings(): warnings.filterwarnings("ignore", message="The Panel class is removed from pandas.") tqdm.pandas() # Apply the validator to generate a bool column we can filter on valid = self._example_df.progress_apply(func=__apply_validator, axis=1, _validator=validator) else: # Apply the validator to generate a bool column we can filter on valid = self._example_df.apply(func=__apply_validator, axis=1, _validator=validator) if report: print(out) print(f"\nPurging {count} invalid examples") # Keep only the events that are valid self._example_df = self._example_df[valid] def _add_example_df(self, df: pd.DataFrame, allow_new_columns: bool = False) -> None: """Add a DataFrame of examples to the ExampleSet's internal collection. Args: df: A dataframe of examples to be added to the existing examples allow_new_columns: An exception will be raised if df has any columns that do not map to existing attributes in the existing collection (e.g., you would be adding new columns to an existing DataFrame) Raises: ValueError: If new columns are being added and allow_new_columns != True """ # Make sure we are adding similar data unless otherwise stated if not allow_new_columns: if (len(df.columns.values.tolist()) != len(self._example_df.columns.values.tolist())) and ( sorted(df.columns.values.tolist()) != sorted(self._example_df.columns.values.tolist())): raise ValueError( "New DataFrame does not have same columns as example_df and allow_new_columns=False") if not self.has_required_columns(df, dtypes=True): raise ValueError("New DataFrame does not have required column dtypes.") # Union the categories present in the existing examples with those presented in new examples for col in [col for col in self._example_df.columns if self._example_df[col].dtype.name == 'category']: uc = pd.api.types.union_categoricals([self._example_df[col], df[col]]) self._example_df[col] = pd.Categorical(self._example_df[col], categories=uc.categories) df[col] = pd.Categorical(df[col], categories=uc.categories) # Add the new data to the bottom of the internal DataFrame, and add it to the dict of included label files self._example_df = pd.concat((self._example_df, df), ignore_index=True) def _create_dataframe_from_web_query(self, begin: datetime, end: datetime, server: str = None, models: List[str] = None) -> pd.DataFrame: """This creates a ExampleSet consistent DataFrame based on the responses of the web query. Labeled faults only. Arguments: server: The server to query for the data. If None, use the value in Config begin: The earliest time for which a fault should be included. If None, defaults to Jan 1, 2018 end: The latest time for which a fault should be included. If None defaults to "now" models: A list of model names that are to be included. All other results are excluded. Returns: The ExampleSet consistent DataFrame containing the web query response """ # Make the web query and get results web_fmt = "%Y-%m-%d %H:%M:%S" web_events = utils.get_events_from_web(server, begin=begin.strftime(web_fmt), end=end.strftime(web_fmt)) # Parse the web query. The web service returns fault events with a UTC timestamp. We convert it to the # localtime zone for simplicity and compatibility with the (untimezoned) label files. Assumption here is # that we are running this code in the same timezone as CEBAF is in. # TODO - Is there a better way to handle this? The label files not being TZ'ed throw a wrench in the works. fmt = "%Y-%m-%d %H:%M:%S.%f%z" event_list = web_events['events'] extracted_events = list() for event in event_list: # Get a timezone aware datetime object of UTC timestamp (manually add GMT offset string) then convert it # to local time dt_local = datetime.strptime(event['datetime_utc'] + "-00:00", fmt).astimezone( tzlocal.get_localzone()).replace(tzinfo=None) zone = event['location'] # Read in label info f_label = None c_label = None f_conf = None c_conf = None l_source = None # Skip any fault events that were not labeled if event['labels'] is not None: for label in event['labels']: # Check that this was labeled by one of the models we requested if models is not None: if label['model-name'] not in models: continue # Process the model source if l_source is None: l_source = label['model-name'] elif l_source != label['model-name']: # Make the source a combo with cavity model first if label['name'] == "cavity": l_source = f"{label['model-name']}/{l_source}" elif label['name'] == "fault-type": l_source = f"{l_source}/{label['model-name']}" else: print(f"Skipping {zone} / {dt_local} because of unrecognized label name") continue # The operator facing models may present slightly processed label names. Here we convert back to # names used in the label files. I guess this is a potential error point should future models # use these names in a different way. Not sure what to do about it here though. if label['name'] == "cavity": if label['value'] == 'multiple': c_label = "0" else: c_label = label['value'] c_conf = label['confidence'] elif label['name'] == "fault-type": if label['value'] == 'Multi Cav Turn off': f_label = "Multi Cav turn off" else: f_label = label['value'] f_conf = label['confidence'] # We only want labeled data if f_label is None or c_label is None: continue # Accumulate the events into a list of dictionaries. Each dictionary is one event extracted_events.append( {'zone': zone, 'dtime': dt_local, 'fault_label': f_label, 'cavity_label': c_label, 'fault_conf': f_conf, 'cavity_conf': c_conf, 'label_source': l_source}) # Construct an empty DataFrame df = pd.DataFrame({ 'zone': pd.Categorical([]), 'dtime': pd.Series([], dtype='datetime64[ns]'), 'fault_label': pd.Categorical([]), 'cavity_label': pd.Categorical([]), 'cavity_conf': pd.Series([], dtype='float64'), 'fault_conf': pd.Series([], dtype='float64'), 'label_source': pd.Series([], dtype='object') }) # Append the fault events to the DataFrame for event in extracted_events: df = df.append(event, ignore_index=True) # Operates in place on DataFrame self.__standardize_df_format(df) return df def _create_dataframe_from_label_file(self, filepath: str, exclude_zones: List[str] = None, exclude_times: List[List[datetime]] = None) -> pd.DataFrame: """This parses the DataSet's specified label files and saves the constructed IExamples. Arguments: filepath: Location of the label file exclude_zones: List of zones to exclude. Defaults to Config().exclude_zones. exclude_times: List of 2-tuples of datetime objects. Each 2-tuple specifies a range to exclude. None implie +/-Inf. Returns: A DataFrame of the Examlpes listed in the label file. """ # This is the header we expect in all files - tab separated exp_header = "zone cavity cav# fault time\n" # Work through the file and build a dictionary keyed on events # with an array of labels found for each event. We'll print out summary information, # and then print label files for each "good" event if not os.path.isfile(filepath): raise FileNotFoundError(f"File not found - {filepath}") if Config().debug: print(f"Processing {filepath}") zones = [] dts = [] c_labels = [] f_labels = [] c_confs = [] f_confs = [] l_sources = [] # Read each file line by line and create a new TSV file for each # labeled example we encounter with open(filepath, 'r') as fh: # Toss the header line by reading another one in loop - ignore any trailing whitespace line = fh.readline().lstrip() header = line if Config().debug: print("Skipping header: {}".format(header)) if header != exp_header: print("Error: Unexpected header: '{}'".format(header)) # Keep track of how many lines were skipped due to some error skip_count = 0 # Process each line. At this point we are expected labeled examples or comments while line: # Strip off leading and trailing whitespace line = fh.readline().rstrip().lstrip() # Check special cases if not line: if Config().debug: print("Found last line.") break if line.startswith("#"): if Config().debug: print("Skipping: '{}'".format(line)) continue if len(line) == 0: continue # Process the label fields fields = line.split('\t') zone = fields[0] cavity_label = fields[1] fault_label = fields[3] # Label files don't provide confidence levels cavity_conf = None fault_conf = None try: tsm = TimestampMapper() ts = tsm.get_full_timestamp(zone, datetime.strptime(fields[4], "%Y/%m/%d %H:%M:%S")) except ValueError as exc: skip_count += 1 print("Error processing line '{}'.".format(line)) print(f" {exc}") continue # Check if the zone should be excluded if exclude_zones is not None and zone in exclude_zones: continue # check if the label should be excluded because of the timestamp if is_datetime_in_range(ts, exclude_times): continue # Add entries to all of the lists for this example. zones.append(zone) dts.append(ts) c_labels.append(cavity_label) f_labels.append(fault_label) c_confs.append(cavity_conf) f_confs.append(fault_conf) l_sources.append(os.path.basename(filepath)) if Config().debug: print("Processed: {} {} - {}".format(zone, ts, line)) if Config().debug: print(f"Skipped {skip_count} events from {filepath} due to processing issues") # Construct a DataFrame for the new data df = pd.DataFrame( {'zone': pd.Categorical(zones), 'dtime': dts, 'cavity_label': pd.Categorical(c_labels), 'fault_label': pd.Categorical(f_labels), 'cavity_conf': c_confs, 'fault_conf': f_confs, 'label_source': l_sources}) # Update the DataFrame to have a standard format (column dtypes, order, etc.) Should add example column. self.__standardize_df_format(df) return df #### Reporting-related methods #### def count_events(self) -> int: """Count the number of unique events (zone/datetime combinations This would count as two since two unique zone/datetime pairs appeared 4240 2L25 2020-09-21 06:53:16.500 5 E_Quench 4241 2L26 2020-09-22 06:53:17.500 6 E_Quench 4242 2L26 2020-09-22 06:53:17.500 6 E_Quench Returns: the number of unique events (zone/datetime combinations """ return len(self._example_df.drop_duplicates(subset=['zone', 'dtime'])) def count_labels(self) -> int: """Counts the number of labels (rows in label files) Returns: the number of labels (rows in label files)""" return len(self._example_df) def get_duplicated_labels(self) -> pd.DataFrame: """"Identify the fault events that appear multiple times in the ExampleSet. Returns: A DataFrame containing labels for events that appear multiple times""" # Split on event. observed=True only includes categorical levels that are seen and improves performance gb = self._example_df.groupby(["zone", "dtime"], as_index=False, observed=True) # Keep event groups that have > 1 rows. Return length of the resulting DataFrame return gb.filter(lambda x: len(x) > 1) def count_duplicated_events(self) -> int: """Count the number of events that appear multiple times, i.e., were labeled more than once. Returns: the number of events that appear multiple times, i.e., were labeled more than once. This would count as one since only one event appeared that did occur multiple times 4240 2L25 2020-09-21 06:53:16.500 5 E_Quench 4241 2L26 2020-09-22 06:53:17.500 6 E_Quench 4242 2L26 2020-09-22 06:53:17.500 6 E_Quench """ # Get the duplicated labels, then remove duplicate zone/timestamp pairs return len(self.get_duplicated_labels().drop_duplicates(["zone", "dtime"])) def count_duplicated_labels(self) -> int: """Count the number of labeling occurrences for events that appear multiple times. This is basically the number of rows in the label files that are not for unique fault events. Returns: The number of labeling occurrences for events that appear multiple times""" return len(self.get_duplicated_labels()) def get_unduplicated_events(self) -> pd.DataFrame: """Identify the fault events that appear exactly once in the ExampleSet. Returns: DataFrame of the events that appear exactly once in the ExampleSet""" # Split on event. observed=True only includes categorical levels that are seen and improves performance gb = self._example_df.groupby(["zone", "dtime"], as_index=False, observed=True) # Keep event groups that have exactly one row. return gb.filter(lambda x: len(x) == 1) def count_unduplicated_events(self) -> int: """Count the number of events that appear exactly once. Returns: The number of events that appear exactly once. This would count as one since only one event appeared that did not occur multiple times 4240 2L25 2020-09-21 06:53:16.500 5 E_Quench 4241 2L26 2020-09-22 06:53:17.500 6 E_Quench 4242 2L26 2020-09-22 06:53:17.500 6 E_Quench """ # Return the length of resulting DataFrame return len(self.get_unduplicated_events()) def get_events_with_mismatched_labels(self) -> pd.DataFrame: """Identify fault events that appear multiple times with different labels. Returns: A DataFrame containing the events that have mismatched labels""" # Split on events. gb = self._example_df.groupby(['zone', 'dtime'], as_index=False, observed=True) # Keep event groups that have more than one unique fault or cavity label. Return the length of resulting # DataFrame. return gb.filter(lambda x: x.cavity_label.nunique() > 1 or x.fault_label.nunique() > 1) def count_duplicated_events_with_mismatched_labels(self) -> int: """Count the number of events that appear multiple times with different labels. Returns: The number of events that appear multiple times with different labels This would count as one since one event appeared that had mismatched labels 4240 2L26 2020-09-21 06:53:16.500 5 E_Quench 4241 2L26 2020-09-21 06:53:16.500 6 E_Quench 4242 2L26 2020-09-21 06:53:16.500 6 E_Quench """ # Get events that have mismatched labels mismatch_df = self.get_events_with_mismatched_labels() # Drop duplicates so that we have the event count, not the count of mismatched occurrences. Return the length # of resulting DataFrame return len(mismatch_df.drop_duplicates(['zone', 'dtime'])) def count_mismatched_labels(self) -> int: """Count the number of times an event with mismatched labels appears in the ExampleSet. Returns: The number of times an event with mismatched labels appears in the ExampleSet. This would count as three mismatched labels since one event with mismatched labels appeared three times 4240 2L26 2020-09-21 06:53:16.500 5 E_Quench 4241 2L26 2020-09-21 06:53:16.500 6 E_Quench 4242 2L26 2020-09-21 06:53:16.500 6 E_Quench """ return len(self.get_events_with_mismatched_labels()) #### Visualization Methods #### def display_timeline(self, query: str = None, **kwargs) -> None: """Display a timeline of examples as a swarmplot Arguments: query: The expr argument to DataFrame.query. Subsets data before plot kwargs: Other named parameters are passed to swarm_timeline method """ df = self._example_df.copy() if query is not None: df = df.query(query) swarm_timeline(df, **kwargs) def display_summary_label_heatmap(self, title: str = "Label Summary", query: str = None) -> None: """Display a heatmap of fault vs cavity labels for all examples in this object Arguments: title: The title of the plot query: The expr argument to DataFrame.query. Subsets data before plot """ df = self._example_df.copy() if query is not None: df = df.query(query) heatmap.heatmap_cavity_vs_fault_label_counts(data=df, title=title) def display_zone_label_heatmap(self, zones: List[str] = None, query: str = None) -> None: """Display a heatmap of fault vs cavity labels for all examples in this object for each unique zone category Arguments: zones: A list of the zones to display. query: The expr argument to DataFrame.query. Subsets data before plot """ if zones is None: zones = self._example_df.zone.cat.categories df = self._example_df.copy() if query is not None: df = df.query(query) heatmap.show_fault_cavity_count_by_zone(df, zones=zones) def display_examples_by_weekday_barplot(self, color_by: str = None, title: str = None, query: str = None) -> None: """Show example counts by the day of the week as a stacked barplot Arguments: color_by: The DataFrame column on which the bars will be split/colored. title: The title to put on the plot. A reasonable default will be generated if None. query: The expr argument to DataFrame.query. Subsets data before plot """ df = self._example_df.copy() # Query/subset the data if query is not None: df = df.query(query) # Get the day names day_names = ["Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"] df['day'] = df['dtime'].dt.day_name() df['day'] = pd.Categorical(df['day'], categories=day_names) if color_by is None: if title is None: title = "Example Count by Day of Week" # Get the counts by day count_df = df.groupby(['day'])['day'].count().unstack(color_by).loc[day_names, :] else: if title is None: title = f"{color_by} Count by Day of Week" df[color_by] = self._example_df[color_by] # Get the counts by the color_by column count_df = df.groupby(['day', color_by])['day'].count().unstack(color_by).loc[day_names, :] # Create the plot ax = count_df.plot(kind="bar", stacked=True, title=title) # Format the legend handles, labels = ax.get_legend_handles_labels() ax.legend(reversed(handles), reversed(labels), loc='center left', bbox_to_anchor=(1, 0.5), ncol=1) # Display it plt.gcf().subplots_adjust(left=0.1, top=0.9, right=0.7, bottom=0.2) plt.show() def display_frequency_barplot(self, x: str, color_by: str = None, title: str = None, query: str = None) -> None: """Display the example count against one or two different factors, as a (stacked) bar chart. Arguments: x: The column name for which each bar will appear. Should probably be categorical. color_by: The column name by which each bar will be split and colored (for a stacked bar plot). If None, then a simple bar plot will be displayed. title: The title to put on the chart. If None, a reasonable default will be generated. query: The expr argument to DataFrame.query. Subsets data before plot """ df = self._example_df.copy() if query is not None: df = df.query(query) # Set a reasonable default if title is None: start = df["dtime"].min().strftime("%Y-%m-%d %H:%M:%S.%f")[:-5] end = df["dtime"].max().strftime("%Y-%m-%d %H:%M:%S.%f")[:-5] title = f"{x}\n({start} - {end})" if color_by is None: # Simple chart if no factor to color by df[x].value_counts().sort_index().plot(kind="bar", title=title) else: # Get the counts count_df = df.groupby([x, color_by])[x].count() # Create the plot ax = count_df.unstack(color_by).fillna(0).plot(kind='bar', stacked=True, title=title) # Format the legend handles, labels = ax.get_legend_handles_labels() ax.legend(reversed(handles), reversed(labels), loc='center left', bbox_to_anchor=(1, 0.5), ncol=1) # Display it plt.subplots_adjust(left=0.1, top=0.9, right=0.7, bottom=0.4) plt.show() def get_classification_report(self, other: 'ExampleSet', label: str = "cavity_label", query: str = None, other_query: str = None): """This prints a classification report of this ExampleSet's cavity labels considering other as ground truth. Only examples from other for which there is an example in this ExampleSet are considered Arguments: other (ExampleSet): An ExampleSet that contains cavity labels considered the ground truth. label (str): The column name of containing the label values to compare. query (str) - The expr argument to DataFrame.query. Subsets data before comparison. other_query (str) - The expr argument to DataFrame.query. Subsets 'other' before comparison. """ # Subset this ExampleSet if requested df = self._example_df.copy() if query is not None: df = df.query(query) # Subset the other ExampleSet if requested o_df = other.get_example_df() if other_query is not None: o_df = o_df.query(query) df = df.merge(o_df[['zone', 'dtime', label]], how="inner", on=['zone', 'dtime']) print(classification_report(y_true=df[label + "_y"], y_pred=df[label + "_x"])) def __eq__(self, other: 'ExampleSet') -> bool: """Check if this ExampleSet is equivalent to the other.""" # Short circuit check if self is other: return True # Short circuit check if type(self) != type(other): return False eq = True # Check the example DataFrame - first consider None case if self._example_df is None and other.get_example_df() is not None: eq = False elif not self._example_df.equals(other.get_example_df()): eq = False # Check the dict of label file dataframes - first consider None case elif self.label_file_dataframes is None and other.label_file_dataframes is not None: eq = False elif self.label_file_dataframes is not None and other.label_file_dataframes is None: eq = False # Now check that the contents/lengths are the same elif len(self.label_file_dataframes.keys()) != len(other.label_file_dataframes.keys()): eq = False elif len(self.label_file_dataframes.keys()) == len(other.label_file_dataframes.keys()): for k in self.label_file_dataframes.keys(): if k not in other.label_file_dataframes.keys(): eq = False break if not self.label_file_dataframes[k].equals(other.label_file_dataframes[k]): eq = False break return eq def _Example_from_row(self, x: pd.DataFrame) -> IExample: """Creates an Example object from a row of a standard ExampleSet DataFrame""" return self.example_factory.get_example(zone=x.zone, dt=x.dtime, cavity_label=x.cavity_label, fault_label=x.fault_label, cavity_conf=x.cavity_conf, fault_conf=x.fault_conf, label_source=x.label_source) def __standardize_df_format(self, df: pd.DataFrame) -> None: """Attempts to put a DataFrame in a 'standard' format. This affects IN-PLACE variables that should be categorical, datetime, float, etc. and creates the example column if not already present. Columns are reordered. Arguments: df: The DataFrame to reformat """ # Seems like the datetime dtype doesn't want to stick df['dtime'] = df['dtime'].astype('datetime64[ns]') # Update the dtypes so that we get categories, etc. where it makes sense df['zone'] = df['zone'].astype('category') df['fault_label'] = df['fault_label'].astype('category') df['cavity_label'] = df['cavity_label'].astype('str') df['cavity_label'] = df['cavity_label'].astype('category') df.fault_conf = df.fault_conf.astype("float64") df.cavity_conf = df.cavity_conf.astype("float64") # Construct the Example objects based on row values if needed if 'example' not in df.columns.to_list(): df['example'] = df.apply(self._Example_from_row, axis=1, raw=False) # Ensure a consistent set of category levels and their order. master = { 'zone': ExampleSet._known_zones, 'fault_label': ExampleSet._known_fault_labels, 'cavity_label': ExampleSet._known_cavity_labels } # Add any missing levels and the make sure they are in a predictable order for factor in master.keys(): for f in master[factor]: # Add the category if it is not present if f not in df[factor].cat.categories.values: df[factor].cat.add_categories(f, inplace=True) # Enforce a known ordering df[factor].cat.reorder_categories(sorted(df[factor].cat.categories), inplace=True)
true
30e8d065634dd196eea631bda8532f71801958a7
Python
Matiyaa/kattis
/1.0/heartrate.py
UTF-8
185
3.15625
3
[]
no_license
n = int(input()) for i in range(n): b, p = map(float, input().split()) bpm = (60*b)/p min_bmp = bpm - (60 / p) max_bpm = bpm + (60 / p) print(min_bmp, bpm, max_bpm)
true
dafe2fc9be51dbb54fa5b860d82aed591ca39e23
Python
nickwu241/coding-problems
/leetcode/1103-distribute-candies-to-people.py
UTF-8
524
3.265625
3
[]
no_license
# https://leetcode.com/problems/distribute-candies-to-people/ import itertools class Solution: def distributeCandies(self, candies: int, num_people: int) -> List[int]: result = [0] * num_people candies_to_give = 0 for i in itertools.cycle(range(num_people)): candies_to_give += 1 if candies <= candies_to_give: result[i] += candies return result candies -= candies_to_give result[i] += candies_to_give
true
14ae7e311f29b2a70a0a6a757358570d2c37d99a
Python
zjarci/schematic-file-converter
/upconvert.py
UTF-8
2,461
3.0625
3
[]
no_license
#!/usr/bin/env python """ A universal hardware design file format converter using Upverter's Open JSON Interchange Format """ # upconvert.py - A universal hardware design file format converter using # Upverter's Open JSON Interchange Format # (http://upverter.com/resources/open-json-format/) # # Authors: # Alex Ray ajray@ncsu.edu # Upverter support@upverter.com # # Usage example: # ./upconvert.py -i test.upv -o test.json import os, re, copy, json import parser.openjson, parser.kicad, parser.eaglexml import writer.openjson, writer.kicad from argparse import ArgumentParser PARSERS = { 'openjson': parser.openjson.JSON, 'kicad': parser.kicad.KiCAD, 'eaglexml': parser.eaglexml.EagleXML, } WRITERS = { 'openjson': writer.openjson.JSON, 'kicad': writer.kicad.KiCAD } def parse(in_file, in_format='openjson'): """ Parse the given input file using the in_format """ try: p = PARSERS[in_format]() except KeyError: print "ERROR: Unsupported input type:", in_format exit(1) return p.parse(in_file) def write(dsgn, out_file, out_format='openjson'): """ Write the converted input file to the out_format """ try: w = WRITERS[out_format]() except KeyError: print "ERROR: Unsupported output type:", out_format exit(1) return w.write(dsgn, out_file) if __name__ == "__main__": parser = ArgumentParser() parser.add_argument("-i", "--input", dest="inputfile", help="read INPUT file in", metavar="INPUT") parser.add_argument("-f", "--from", dest="inputtype", help="read input file as TYPE", metavar="TYPE", default="openjson") parser.add_argument("-o", "--output", dest="outputfile", help="write OUTPUT file out", metavar="OUTPUT") parser.add_argument("-t", "--to", dest="outputtype", help="write output file as TYPE", metavar="TYPE", default="openjson") args = parser.parse_args() inputtype = args.inputtype outputtype = args.outputtype inputfile = args.inputfile outputfile = args.outputfile if None == inputfile: args.print_help() exit(1) # parse and export the data design = parse(inputfile, inputtype) if design is not None: # we got a good result write(design, outputfile, outputtype) else: # parse returned None -> something went wrong print "Output cancelled due to previous errors." exit(1)
true
ae723561829c3badd2f53ac6b8f498a7814ecf70
Python
rafaelmsartor/python-studies
/PythonAndBlockchain/assignments/assignment2.py
UTF-8
1,100
4.84375
5
[]
no_license
def print_header(header_text): print(header_text) print('-' * len(header_text)) # 1) Create a list of names and use a for loop to output the length of each name (len() ). names_list = ['Rafael', 'Fernanda', 'Anthony', 'Maria', 'Ana', 'Joe', 'Nathaly', 'Noah'] print_header('First Task') for name in names_list: print(name + ': ' + str(len(name))) print() # 2) Add an if check inside the loop to only output names longer than 5 characters. print_header('Second task') for name in names_list: if len(name) > 5: print(name + ': ' + str(len(name))) print() # 3) Add another if check to see whether a name includes a “n” or “N” character. print_header('Third task') for name in names_list: if len(name) > 5 and ('n' in name or 'N' in name): print(name + ': ' + str(len(name))) print() # 4) Use a while loop to empty the list of names (via pop() ) print_header('Fourth task') print('List before emptying: ' + str(names_list)) while len(names_list) > 0: names_list.pop() print('List after emptying: ' + str(names_list))
true
412e026e9e1b85bf1f6dbcb68485e4f05cb9e398
Python
PurpleBubble123/pp
/basic/list.py
UTF-8
511
4.40625
4
[]
no_license
# information about using list list1 = [1, 2, 3, "a", "b", "c", [1, 2, 3]] # 嵌套列表 #print(list) #print(type(list)) ## 查看type # 访问 # print(list1[0:3]) ## 左开右闭 # print(list1[1:]) # 添加 # list1.append("m") # list1 = list1 + ["n"] # print(list1) # 数据 CRUD 增删改查 # 更新 # list1[1] = "9" # print(list1) # 删除 # del list1 # del list1[1] # print(list1) # 嵌套列表访问 print(list1[6]) print(list1[6][0]) # 实践 list1.
true
8e7828cddcf57767ed8107fd22bfe9933ed524b0
Python
Christian-Fisher/SYSC3010T6_IRPS
/Python codes/IRpoller.py
UTF-8
1,410
2.84375
3
[]
no_license
import RPi.GPIO as IO import time import socket IO.setwarnings(False) IO.setmode(IO.BCM) IRPins = [12,13,14,15,16,17,18,19,20] # array of GPIO pins Socket = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) receiveSocket = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) receiveSocket.bind(("", 3001)) port =2001 local = "127.0.0.1" IO.setup(12,IO.IN) #GPIO 12 -> IR sensorA1 as input IO.setup(13,IO.IN) #GPIO 13 -> IR sensorA2 as input IO.setup(14,IO.IN) #GPIO 14 -> IR sensorA3 as input IO.setup(15,IO.IN) #GPIO 15 -> IR sensorB1 as input IO.setup(16,IO.IN) #GPIO 16 -> IR sensorB2 as input IO.setup(17,IO.IN) #GPIO 17 -> IR sensorB3 as input IO.setup(18,IO.IN) #GPIO 18 -> IR sensorC1 as input IO.setup(19,IO.IN) #GPIO 19 -> IR sensorC2 as input IO.setup(20,IO.IN) #GPIO 20 -> IR sensorC3 as input flag=[1,1,1,1,1,1,1,1,1] # initializing sensor states def sendToMain(spot, occupancy): Socket.sendto(("IR:"+str(spot)+","+str(occupancy)).encode('utf-8'),(local, port)) print("IR:"+str(spot)+","+str(occupancy)) while 1:# polling indefinitely time.sleep(2) for x in range(0,9): #loop through nine IR sensors if(IO.input(IRPins[x])!= flag[x]): #comparing current state with previous state flag[x] = (IO.input(IRPins[x])) # update flag element when state change occurs sendToMain(x, flag[x]) GPIO.cleanup() # Clearing GPIO setup at exit
true
ac238bf130461ca382c2fe277569145a9a2fcaad
Python
uchenna-j-edeh/dailly_problems
/arrays_manipulations_algorithms/run_length_encoding.py
UTF-8
1,491
3.890625
4
[]
no_license
""" Author: Uchenna Edeh Run-length encoding is a fast and simple method of encoding strings. The basic idea is to represent repeated successive characters as a single count and character. For example, the string "AAAABBBCCDAA" would be encoded as "4A3B2C1D2A". Implement run-length encoding and decoding. You can assume the string to be encoded have no digits and consists solely of alphabetic characters. You can assume the string to be decoded is valid. """ import sys def solution1(my_str): unique_counter = 0 unique_char = '' previous_str = '' running_str = '' #import pdb; pdb.set_trace() for i, val in enumerate(my_str): if i == 0: unique_counter = 1 previous_str = val #running_str = continue if val == previous_str: unique_counter = unique_counter + 1 else: running_str = running_str + str(unique_counter) + previous_str unique_counter = 1 #unique_char = val previous_str = val running_str = running_str + str(unique_counter) + previous_str return running_str def main(args): if len(args) != 2: raise AssertionError("Usage:\n\tpython3 {0} '{1}'\n\tExpected Result: {2}\n\tPlease Try Again!\n\t".format(__file__, "AAAABBBCCDAA", "4A3B2C1D2A" )) print(solution1(args[1])) if __name__ == "__main__": try: main(sys.argv) except AssertionError as e: print(e) sys.exit(1)
true
57872fddc9ef4f3724a37856bdcc44674063dd46
Python
rositahbakken/prosjekt
/MessageParser.py
UTF-8
2,789
2.921875
3
[]
no_license
__author__ = 'Anna' import json class MessageParser(): def __init__(self): self.possible_responses = { 'error': self.parse_error, 'info': self.parse_info, 'message': self.parse_message, 'history': self.parse_history, 'login': self.parse_login, 'logout': self.parse_logout, 'names': self.parse_names, 'help': self.parse_help # More key:values pairs are needed } def parse(self, payload): decodedPayload = payload.decode() payload = json.loads(decodedPayload) # decode the JSON object # JSON object on form: { 'timestamp': <timestampt>, 'sender': <username>, 'response': <response>, 'content': <content>, } if payload['response'] in self.possible_responses: return self.possible_responses[payload['response']](payload) else: return 'Not valid server response' # Response not valid def parse_error(self, payload): timestamp = payload['timestamp'] content = payload['content'] return timestamp+' '+'Error: '+content def parse_info(self, payload): timestamp = payload['timestamp'] content = payload['content'] return timestamp+' '+content def parse_message(self, payload): sender = payload['sender'] timestamp = payload['timestamp'] content = payload['content'] return timestamp+' '+sender+': '+content def parse_history(self, payload): # history = json.load(payload['content']) # history_msg = '' # history_list= [] # for user in history: # history_list.append([user, history[user]]) # [[timestap user, content],[timestamp user, content]...] # history_list.sort() # for user in history_list: # history_msg += user+': '+history[user]+'\n' # return history_msg sender = payload['sender'] timestamp = payload['timestamp'] content = payload['content'] return timestamp+' '+sender+': '+content def parse_login(self, payload): timestamp = payload['timestamp'] content = payload['content'] return timestamp+' '+content def parse_logout(self, payload): timestamp = payload['timestamp'] content = payload['content'] return timestamp+' '+content def parse_names(self, payload): timestamp = payload['timestamp'] content = payload['content'] return timestamp+' '+content def parse_help(self, payload): timestamp = payload['timestamp'] content = payload['content'] return timestamp+' '+content # Include more methods for handling the different responses...
true
790769dd2837866dd1ea5e3e5d7d2fcb2f6c68c1
Python
sberbank-ai-lab/embeddings-valid
/embeddings_validation/file_reader.py
UTF-8
4,514
2.640625
3
[]
no_license
import os import pickle import numpy as np import pandas as pd ID_TYPE_MAPPING = { 'str': str, 'int': np.int32, 'date': 'datetime64[D]', 'datetime': 'datetime64[s]', } class BaseReader: def __init__(self, conf): self.conf = conf self.source_path = [] self.df = None target_conf = conf['target'] self.cols_id = [x for x in target_conf['cols_id']] self.cols_id_type = [ID_TYPE_MAPPING.get(x) for x in target_conf['cols_id_type']] self.col_target = target_conf['col_target'] _unknown = [s for t, s in zip(self.cols_id_type, target_conf['cols_id_type']) if t is None] if len(_unknown) > 0: raise AttributeError(f'Unknown types: {_unknown}') def clone_schema(self): new = self.__class__(self.conf) new.source_path = self.source_path return new def dump(self, path): with open(path, 'wb') as f: pickle.dump(self, f) @classmethod def load(cls, path): with open(path, 'rb') as f: file = pickle.load(f) return file @staticmethod def _read_pd(path, read_args): ext = os.path.splitext(path)[1] if ext == '.csv': return pd.read_csv(path, **read_args) if ext == '.pickle': return pd.read_pickle(path, **read_args) if ext == '.parquet': return pd.read_parquet(path, **read_args) raise NotImplementedError(f'Not implemented for "{ext}" file type') @classmethod def read_table(cls, conf, file_name, rename_cols=None, drop_cols=None, read_args=None, drop_duplicated_ids=False, **kwargs): if read_args is None: read_args = {} self = cls(conf) columns = self.keep_columns() if type(file_name) is not list: file_name = [file_name] self.source_path = [] df = [] for f in file_name: path = os.path.join(conf.root_path, f) self.source_path.append(path) df.append(self._read_pd(path, read_args)) self.df = pd.concat(df, axis=0) if rename_cols is not None: self.df = self.df.rename(columns=rename_cols) if drop_cols is not None: self.df = self.df.drop(columns=drop_cols) if columns is not None: self.df = self.df[columns] self.cols_id_type_cast() if drop_duplicated_ids: self.drop_duplicated_ids() else: self.check_duplicated_ids() return self def __len__(self): return len(self.df) def keep_columns(self): raise NotImplementedError() def cols_id_type_cast(self): for col, dtype in zip(self.cols_id, self.cols_id_type): self.df[col] = self.df[col].astype(dtype) def drop_duplicated_ids(self): self.df = self.df.drop_duplicates(subset=self.cols_id, keep='first', ignore_index=True) def check_duplicated_ids(self): duplicated_count = self.df.duplicated(subset=self.cols_id, keep=False).sum() if duplicated_count > 0: raise IndexError(f'Found {duplicated_count} duplicated rows in "{self.source_path}". ' f'Check and fix your dataset or use `drop_duplicated_ids=True`') @property def target_values(self): return self.df[self.col_target] @property def ids_values(self): return self.df[self.cols_id] def select_ids(self, df_ids): new_df = self.clone_schema() new_df.df = pd.merge(self.df, df_ids.ids_values, left_on=self.cols_id, right_on=df_ids.cols_id, how='inner') return new_df def exclude_ids(self, df_ids): new_df = self.clone_schema() df = pd.merge(self.df, df_ids.ids_values, left_on=self.cols_id, right_on=df_ids.cols_id, how='left', indicator=True) excluded_cnt = df['_merge'].eq('both').sum() df = df[df['_merge'].eq('left_only')].drop(columns='_merge') new_df.df = df return new_df, int(excluded_cnt) def select_pos(self, df_pos): new_df = self.clone_schema() new_df.df = self.df.iloc[df_pos] return new_df class TargetFile(BaseReader): def keep_columns(self): return self.cols_id + [self.col_target] class IdFile(BaseReader): def keep_columns(self): return self.cols_id class FeatureFile(BaseReader): def keep_columns(self): return None
true
9a5b6520c8c66baeccce1ebdc98bb447c5432f8d
Python
bryceklinker/rasperry-pi-fun
/simple-lights/simple_lights/start.py
UTF-8
212
2.625
3
[ "MIT" ]
permissive
from gpiozero import LED from time import sleep pin_18_led = LED(18) pin_17_led = LED(17) while True: pin_17_led.off() pin_18_led.on() sleep(1) pin_17_led.on() pin_18_led.off() sleep(1)
true
3e0ac4257eb29fe4aea3231e33d786c74ed8bccc
Python
pseudonym117/Riot-Watcher
/src/riotwatcher/_apis/league_of_legends/LeagueApiV4.py
UTF-8
3,875
2.71875
3
[ "MIT" ]
permissive
from .. import BaseApi, NamedEndpoint from .urls import LeagueApiV4Urls class LeagueApiV4(NamedEndpoint): """ This class wraps the League-v4 Api calls provided by the Riot API. See https://developer.riotgames.com/api-methods/#league-v4/ for more detailed information """ def __init__(self, base_api: BaseApi): """ Initialize a new LeagueApiV4 which uses the provided base_api :param BaseApi base_api: the root API object to use for making all requests. """ super().__init__(base_api, self.__class__.__name__) def challenger_by_queue(self, region: str, queue: str): """ Get the challenger league for a given queue. :param string region: the region to execute this request on :param string queue: the queue to get the challenger players for :returns: LeagueListDTO """ return self._request_endpoint( self.challenger_by_queue.__name__, region, LeagueApiV4Urls.challenger_by_queue, queue=queue, ) def grandmaster_by_queue(self, region: str, queue: str): """ Get the grandmaster league for a given queue. :param string region: the region to execute this request on :param string queue: the queue to get the grandmaster players for :returns: LeagueListDTO """ return self._request_endpoint( self.grandmaster_by_queue.__name__, region, LeagueApiV4Urls.grandmaster_by_queue, queue=queue, ) def masters_by_queue(self, region: str, queue: str): """ Get the master league for a given queue. :param string region: the region to execute this request on :param string queue: the queue to get the master players for :returns: LeagueListDTO """ return self._request_endpoint( self.masters_by_queue.__name__, region, LeagueApiV4Urls.master_by_queue, queue=queue, ) def by_id(self, region: str, league_id: str): """ Get league with given ID, including inactive entries :param string region: the region to execute this request on :param string league_id: the league ID to query :returns: LeagueListDTO """ return self._request_endpoint( self.by_id.__name__, region, LeagueApiV4Urls.by_id, league_id=league_id ) def by_summoner(self, region: str, encrypted_summoner_id: str): """ Get league entries in all queues for a given summoner ID :param string region: the region to execute this request on :param string encrypted_summoner_id: the summoner ID to query :returns: Set[LeagueEntryDTO] """ return self._request_endpoint( self.by_summoner.__name__, region, LeagueApiV4Urls.by_summoner, encrypted_summoner_id=encrypted_summoner_id, ) def entries(self, region: str, queue: str, tier: str, division: str, page: int = 1): """ Get all the league entries :param string region: the region to execute this request on :param string queue: the queue to query, i.e. RANKED_SOLO_5x5 :param string tier: the tier to query, i.e. DIAMOND :param string division: the division to query, i.e. III :param int page: the page for the query to paginate to. Starts at 1. :returns: Set[LeagueEntryDTO] """ return self._request_endpoint( self.entries.__name__, region, LeagueApiV4Urls.entries, queue=queue, tier=tier, division=division, page=page, )
true
0a33a4f4cc388f29ac47e01f18e8845e45fcb0dd
Python
YnievesDotNet/calysto_lc3
/calysto_lc3/lc3.py
UTF-8
75,203
3.09375
3
[ "BSD-2-Clause" ]
permissive
""" This code based on: http://www.daniweb.com/software-development/python/code/367871/ assembler-for-little-computer-3-lc-3-in-python Order of BRanch flags relaxed, BR without flags interpreted as BRnzp (always). """ from array import array import sys try: from IPython.display import HTML except: pass def ascii_str(i): if i < 256: if i < 32 or i > 127: # integers return "(or %s)" % i else: # int, or ASCII return "(or %s, %s)" % (i, repr(chr(i))) else: return "" class HEX(int): def __repr__(self): return lc_hex(self) def lc_hex(h): """ Format the value in the form xFFFF """ try: return 'x%04X' % lc_bin(h) except: return h def lc_bin(v): """ Truncate any extra bytes """ return v & 0xFFFF def is_composed_of(s, letters): return len(s) > 0 and sum([s.count(letter) for letter in letters]) == len(s) def is_hex(s): if len(s) > 1: if s[0] == "x": if s[1] == "-": return is_composed_of(s[2:].upper(), "0123456789ABCDEF") else: return is_composed_of(s[1:].upper(), "0123456789ABCDEF") return False def is_bin(s): return is_composed_of(s, "01") def sext(binary, bits): """ Sign-extend the binary number, check the most significant bit """ neg = binary & (1 << (bits - 1)) if neg: mask = 0 for i in range(bits, 16): mask |= (0b1 << i) return (mask | binary) else: return binary def lc_int(v): if v & (1 << 15): # negative return -((~(v & 0xFFFF) + 1) & 0xFFFF) else: return v def plus(v1, v2): """ Add two values together, return a positive or negative value. """ return lc_int(v1) + lc_int(v2) class LC3(object): """ The LC3 Computer. This object can assemble, disassemble, and execute LC3 programs. """ # if RX is used in an instruction, these are the positions: # 0000111222000333 reg_pos = [9, 6, 0] special_reg_pos = {"JSRR": [6]} ## JSRR R1 flags = {'n': 1 << 11, 'z': 1 << 10, 'p': 1 << 9} # All variations of instructions: # Note that the following are handled in code: # * two modes of ADD and AND # * variations of BR (BRn, BRnp, etc) # as they have the same mnemonic instruction_info = { 'ADD': 0b1 << 12, 'AND': 0b0101 << 12, 'BR': 0b0, 'GETC': (0b1111 << 12) + 0x20, 'HALT': (0b1111 << 12) + 0x25, 'IN': (0b1111 << 12) + 0x23, 'JMP': 0b1100 << 12, 'JMPT': (0b1100000 << 9) + 1, 'JSR': 0b01001 << 11, 'JSRR': 0b01000 << 11, 'LD': 0b0010 << 12, 'LDI': 0b1010 << 12, 'LDR': 0b0110 << 12, 'LEA': 0b1110 << 12, 'NOT': (0b1001 << 12) + 0b111111, 'OUT': (0b1111 << 12) + 0x21, 'PUTS': (0b1111 << 12) + 0x22, 'PUTSP': (0b1111 << 12) + 0x24, 'RET': 0b1100000111000000, 'RTI': 0b1000 << 12, 'RTT': 0b1100000111000001, 'ST': 0b0011 << 12, 'STI': 0b1011 << 12, 'STR': 0b0111 << 12, 'TRAP': 0b1111 << 12, 'SHIFT': 0b1101 << 12, } # bits of immediate mode field: immediate = { 'ADD': 5, 'AND': 5, 'BR': 9, 'GETC': 0, 'HALT': 0, 'IN': 0, 'JMP': 0, 'JMPT': 0, 'JSR': 11, 'JSRR': 0, 'LD': 9, 'LDI': 9, 'LDR': 6, 'LEA': 9, 'NOT': 9, 'OUT': 0, 'PUTS': 0, 'PUTSP': 0, 'RET': 0, 'RTI': 0, 'RTT': 0, 'ST': 9, 'STI': 9, 'STR': 6, 'TRAP': 8, 'SHIFT': 6, ## SHIFT R2, #1 } # Based on appendix figure C.2 and C.7 states, and 1 cycle for each memory read cycles = { 0b0000: 5 + 1, # BR 0b0001: 5 + 1, # ADD 0b0010: 7 + 3, # LD, + 2 memory reads 0b0011: 7 + 2, # ST, + 1 memory read, one store 0b0100: 6 + 1, # JSR 0b0101: 5 + 1, # AND 0b0110: 7 + 2, # LDR 0b0111: 7 + 3, # STR 0b1000: 12 + 3, # RTI 0b1001: 5 + 1, # NOT 0b1010: 9 + 3, # LDI 0b1011: 9 + 3, # STI 0b1100: 5 + 1, # JMP and RET 0b1101: 5 + 1, # SHIFT 0b1110: 5 + 1, # LEA 0b1111: 7 + 2, # TRAP } mnemonic = { 0b0000: "BR", 0b0001: "ADD", 0b0010: "LD", 0b0011: "ST", 0b0100: "JSR", 0b0101: "AND", 0b0110: "LDR", 0b0111: "STR", 0b1000: "RTI", 0b1001: "NOT", 0b1010: "LDI", 0b1011: "STI", 0b1100: "JMP", 0b1101: "SHIFT", 0b1110: "LEA", 0b1111: "TRAP", } def __init__(self, kernel=None): # Functions for interpreting instructions: self.kernel = kernel self.char_buffer = [] self.breakpoints = {} self.dump_mode = "dis" self.apply = { 0b0000: self.BR, 0b0001: self.ADD, 0b0010: self.LD, 0b0011: self.ST, 0b0100: self.JSR, 0b0101: self.AND, 0b0110: self.LDR, 0b0111: self.STR, 0b1000: self.RTI, 0b1001: self.NOT, 0b1010: self.LDI, 0b1011: self.STI, 0b1100: self.JMP, # and RET 0b1101: self.SHIFT, 0b1110: self.LEA, 0b1111: self.TRAP, } # Functions for formatting instructions: self.format = { 0b0000: self.BR_format, 0b0001: self.ADD_format, 0b0010: self.LD_format, 0b0011: self.ST_format, 0b0100: self.JSR_format, 0b0101: self.AND_format, 0b0110: self.LDR_format, 0b0111: self.STR_format, 0b1000: self.RTI_format, 0b1001: self.NOT_format, 0b1010: self.LDI_format, 0b1011: self.STI_format, 0b1100: self.JMP_format, # and RET_format 0b1101: self.SHIFT_format, 0b1110: self.LEA_format, 0b1111: self.TRAP_format, } self.initialize() #### The following allow different hardware implementations: #### memory, register, nzp, and pc can be implemented in different #### means. def initialize(self, runit=False): self.filename = "" self.debug = False self.meta = False self.warn = True self.noop_error = True self.source = {} self.cycle = 0 self.orig = 0x3000 self.line_count = 1 self.set_pc(HEX(0x3000)) self.cont = True self.suspended = False self.instruction_count = 0 self.immediate_mask = {} for im in self.immediate: self.immediate_mask[im] = (1 << self.immediate[im]) - 1 self.instructions = self.instruction_info.keys() self.regs = dict(('R%1i' % r, r) for r in range(8)) self.labels = {} self.label_location = {} self.register = {0:0, 1:0, 2:0, 3:0, 4:0, 5:0, 6:0, 7:0} self.reset_memory(runit=runit) # assembles OS self.reset_registers() def reset_memory(self, filename=None, runit=False): text = get_os() debug = self.debug self.debug = self.meta self.memory = array('i', [0] * (1 << 16)) self.breakpoints = {} # We reset these items here and below because of # bug (related to hack in interpreter?) self.assemble(text) self.debug = debug if runit: self.set_pc(0x0200) self.run() self.source = {} self.labels = {} self.label_location = {} self.set_pc(0x3000) self.orig = HEX(0x3000) self.line_count = 1 def reset_registers(self): debug = self.debug self.debug = self.meta for i in range(8): self.set_register(i, 0) self.set_nzp(0) self.debug = debug def set_nzp(self, value): self.nzp = (int(value & (1 << 15) > 0), int(value == 0), int((value & (1 << 15) == 0) and value != 0)) if self.debug: self.Print(" NZP <=", self.get_nzp()) def get_nzp(self, register=None): if register is not None: value = self.nzp[register] else: value = self.nzp if self.meta: if register: self.Print(" %s => %s" % ("NZP"[register], lc_hex(value))) else: self.Print(" NZP => %s" % (lc_hex(value), )) return value def get_pc(self): return self.pc def set_pc(self, value): self.pc = HEX(value) if self.debug: self.Print(" PC <= %s" % lc_hex(value)) def increment_pc(self, value=1): self.set_pc(self.get_pc() + value) def get_register(self, position): value = self.register[position] if self.meta: self.Print(" R%d => %s" % (position, lc_hex(value))) return value def set_register(self, position, value): self.register[position] = value if self.debug: self.Print(" R%d <= %s" % (position, lc_hex(value))) def set_instruction(self, location, n, line): """ Put n into memory[location]; also checks to to make sure represented correctly. """ self.set_memory(location, lc_bin(n)) def get_memory(self, location): value = self.memory[location] if self.meta: self.Print(" memory[%s] => %s" % (lc_hex(location), lc_hex(value))) return value def set_memory(self, location, value): self.memory[location] = value if self.debug: self.Print(" memory[%s] <= %s" % (lc_hex(location), lc_hex(value))) def memory_tofile(self, start, stop, f): self.memory[start:stop].tofile(f) def memory_byteswap(self): self.memory.byteswap() #### End of overridden methods def make_label(self, label): return label.replace(":", "").upper() def in_range(self, n, bits): """ Is n in range? -2**bits <= n < 2**bits """ return -(1 << (bits-1)) <= n < (1 << (bits-1)) def get_mem_str(self, loc): return 'x{0:04X}: {1:016b} {1:04x} '.format(loc, self.get_memory(loc)) #def reg(self, s, n=1): # return self.registers[s.rstrip(', ')] << self.reg_pos[n] def undefined(self, data): raise ValueError('Undefined Instruction: "%s"' % data) def valid_label(self, word): if word[0] == 'x' and word[1].isdigit(): return False return (word[0].isalpha() and all(c.isalpha() or c.isdigit() or c in ['_', ':'] for c in word)) def bitwise_and(self, value, mask): if value >= 0: if (value & ~mask) and self.warn: self.Error("Warning: Possible overflow of immediate: %s at line %s\n" % (value, self.source.get(self.get_pc(), "unknown"))) else: if (-value & ~(mask >> 1)) and self.warn: self.Error("Warning: Possible overflow of immediate: %s at line %s\n" % (value, self.source.get(self.get_pc(), "unknown"))) return (value & mask) def get_immediate(self, word, mask=0xFFFF): if (word.startswith('x') and all(n in '-0123456789abcdefgABCDEF' for n in word[1:])): if word[1] == "-": raw = (-int('0x' + word[2:], 0)) return self.bitwise_and(raw, mask) else: raw = int('0' + word, 0) return self.bitwise_and(raw, mask) elif word.startswith('#'): if word[1] == "-": raw = -int(word[2:]) return self.bitwise_and(raw, mask) else: raw = int(word[1:]) return self.bitwise_and(raw, mask) else: try: if word[0] == "-": raw = -int(word[1:]) return self.bitwise_and(raw, mask) else: raw = int(word) return self.bitwise_and(raw, mask) except ValueError: # could be a label return def set_assembly_mode(self, mode): # clear out spare instructions for key in list(self.instruction_info.keys()): if (self.instruction_info[key] >> 12) == 0b1101: del self.instruction_info[key] for key in list(self.immediate.keys()): if (self.immediate[key] >> 12) == 0b1101: del self.immediate[key] # Add new instructions ## SHIFT DST, SRC, immed6 ## TERMINAL SRC, 0/1=clear if mode == "SHIFT": # assembler: self.instruction_info["SHIFT"] = 0b1101 << 12 self.immediate["SHIFT"] = 6 # interpreter: self.cycles[0b1101] = 5 + 1 self.apply[0b1101] = self.SHIFT self.format[0b1101] = self.SHIFT_format elif mode == "TERMINAL": # assembler: self.instruction_info["TERMINAL"] = 0b1101 << 12 self.immediate["TERMINAL"] = 8 # interpreter: self.cycles[0b1101] = 10 + 1 self.apply[0b1101] = self.TERMINAL self.format[0b1101] = self.TERMINAL_format elif mode == "GRAPHICS": # assembler: self.instruction_info["CLEAR"] = (0b1101 << 12) + (0b010 << 3) self.instruction_info["GETCUR"] = (0b1101 << 12) + (0b100 << 3) self.instruction_info["SETCUR"] = (0b1101 << 12) + (0b101 << 3) self.instruction_info["POKE"] = (0b1101 << 12) + (0b001 << 3) self.instruction_info["PEEK"] = (0b1101 << 12) + (0b000 << 3) self.immediate["SCREEN"] = 0 self.immediate["CLEAR"] = 0 self.immediate["GETCUR"] = 0 self.immediate["SETCUR"] = 0 self.immediate["POKE"] = 0 self.immediate["PEEK"] = 0 # interpreter: self.cycles[0b1101] = 5 + 1 self.apply[0b1101] = self.SCREEN self.format[0b1101] = self.SCREEN_format else: raise ValueError("Invalid .SET MODE, '%s'. Use 'GRAPHICS', 'SHIFT', or 'TERMINAL'" % mode) self.instructions = self.instruction_info.keys() self.immediate_mask = {} for im in self.immediate: self.immediate_mask[im] = (1 << self.immediate[im]) - 1 def process_instruction(self, words, line_count, line): """ Process ready split words from line and parse the line use put to show the instruction line without label values """ self.source[self.get_pc()] = line_count found = '' alltogether = "".join(words) alltogether1 = "".join(words[1:]) if not words or words[0].startswith(';'): return elif is_bin(alltogether): ## Allow: ## 0001 000 000 0 00000 ## 0001000000000000 inst = eval("0b" + alltogether) self.set_instruction(self.get_pc(), inst, line_count) self.increment_pc() self.dump_mode = "dump" return elif len(words) > 1 and is_bin(alltogether1) and not self.is_keyword(words[0]): ## Allow: ## LABEL 0001000000000000 self.labels[self.make_label(words[0])] = self.get_pc() inst = eval("0b" + alltogether1) self.set_instruction(self.get_pc(), inst, line_count) self.increment_pc() self.dump_mode = "dump" return elif len(words) == 1 and is_hex(words[0]): ## Allow: ## x10F4 inst = eval("0" + words[0]) self.set_instruction(self.get_pc(), inst, line_count) self.increment_pc() self.dump_mode = "dump" return elif len(words) == 2 and is_hex(words[1]) and not self.is_keyword(words[0]): ## Allow: ## LABEL x2045 self.labels[self.make_label(words[0])] = self.get_pc() inst = eval("0" + words[1]) self.set_instruction(self.get_pc(), inst, line_count) self.increment_pc() self.dump_mode = "dump" return elif '.FILL' in words: word = words[words.index('.FILL') + 1] try: self.set_instruction(self.get_pc(), int(word), line_count) except ValueError: value = self.get_immediate(word) if value is None: label = self.make_label(word) if label in self.label_location: self.label_location[label].append([self.get_pc(), 0xFFFF, -1]) else: self.label_location[label] = [[self.get_pc(), 0xFFFF, -1]] else: self.set_memory(self.get_pc(), lc_bin(value)) if words[0] != '.FILL': self.labels[self.make_label(words[0])] = self.get_pc() self.increment_pc() return elif '.ORIG' in [word.upper() for word in words]: self.set_pc(int('0' + words[1] if words[1].startswith('x') else words[1], 0)) self.orig = self.get_pc() self.breakpoints = {} self.line_count = 0 self.dump_mode = "dis" self.reset_registers() return elif '.STRINGZ' in words: if self.valid_label(words[0]): self.labels[self.make_label(words[0])] = self.get_pc() #else: # no label... could be a block of .STRINGZ # raise ValueError('No label for .STRINGZ in line for PC = %s: %s, line #%s' % (lc_hex(self.get_pc()), line, line_count)) s = line.split('"') string1 = string = s[1] # rejoin if " inside quotes for st in s[2:]: if string.endswith('\\'): string += '"' + st # encode backslash to get special characters backslash = False for c in string: if not backslash: if c == '\\': if not backslash: backslash = True continue m = ord(c) else: if c in 'nblr': m = ord(c) - 100 else: # easiest to implement: # anything else escaped is itself (unlike Python) m = ord(c) backslash = False self.set_instruction(self.get_pc(), m, line_count) self.increment_pc() self.set_instruction(self.get_pc(), 0, line_count) self.increment_pc() return elif '.STRINGC' in words: if self.valid_label(words[0]): self.labels[self.make_label(words[0])] = self.get_pc() #else: # no label... could be a block of .STRINGZ # raise ValueError('No label for .STRINGZ in line for PC = %s: %s, line #%s' % (lc_hex(self.get_pc()), line, line_count)) s = line.split('"') string1 = string = s[1] # rejoin if " inside quotes for st in s[2:]: if string.endswith('\\'): string += '"' + st # encode backslash to get special characters backslash = False count = 1 last_m = None for c in string: if not backslash: if c == '\\': if not backslash: backslash = True continue m = ord(c) else: if c in 'nblr': m = ord(c) - 100 else: # easiest to implement: # anything else escaped is itself (unlike Python) m = ord(c) backslash = False if count % 2 == 0: self.set_instruction(self.get_pc(), m << 8 | last_m, line_count) self.increment_pc() else: last_m = m count += 1 if count % 2 == 0: self.set_instruction(self.get_pc(), last_m, line_count) self.increment_pc() self.set_instruction(self.get_pc(), 0, line_count) self.increment_pc() return elif '.BLKW' in words: self.labels[self.make_label(words[0])] = self.get_pc() value = self.get_immediate(words[-1]) if value is None or value <= 0: raise ValueError('Bad .BLKW immediate: "%s", %r' % (words[-1], value)) self.increment_pc(value) return elif '.SET' == words[0]: if words[1] == "MODE": self.set_assembly_mode(words[2]) return # ------------------------------------------------------------- self.dump_mode = "dis" ind = -1 if words[0].startswith('BR'): ind = 0 elif words[1:] and words[1].startswith('BR'): ind = 1 if ind >= 0 and len(words[ind]) <= 5: if all(c in self.flags for c in words[ind][2:].lower()): fl = 0 # BR means BRnzp if words[ind] == 'BR': words[ind] = 'BRnzp' for f in words[ind][2:].lower(): fl |= self.flags[f] words[ind] = 'BR' if words[0].upper() in self.instructions: found = words[0].upper() else: if self.valid_label(words[0]): self.labels[self.make_label(words[0])] = self.get_pc() else: raise ValueError('Invalid label "%s" in source line "%s", line #: %s' % (words[0], line, line_count)) if len(words) < 2: return found = words[1] if words[1] in self.instructions else '' if not found: word = words[0] if len(words) > 1: raise ValueError('Not an instruction: "%s"' % line) else: if self.valid_label(word): if self.make_label(word) in self.label_location: # FIXME: ? is this same as .FILL? self.label_location[self.make_label(word)].append([self.get_pc(), 0xFFFF, 16]) else: self.label_location[self.make_label(word)] = [[self.get_pc(), 0xFFFF, 16]] else: raise ValueError('Invalid label: "%r", line: %s' % (word, line)) return try: instruction = self.instruction_info[found] except KeyError: raise ValueError('Unknown: instruction "%s"' % found) else: if found == 'BR': instruction |= fl r = rc = 0 rc += found == 'JMPT' if found in self.special_reg_pos: reg_pos = self.special_reg_pos[found] else: reg_pos = self.reg_pos for word in words[1:]: word = word.rstrip(',') if word in self.regs: if found == "JMP": t = self.regs[word] << 6 else: t = self.regs[word] << reg_pos[rc] r |= t rc += 1 else: value = self.get_immediate(word, self.immediate_mask[found]) if value is not None: instruction |= value # set the immediate bit in ADD and AND instruction: if found in ('ADD', 'AND'): instruction |= 1 << 5 elif word != found: if self.valid_label(word): if self.make_label(word) in self.label_location: self.label_location[self.make_label(word)].append([self.get_pc(), self.immediate_mask[found], self.immediate[found]]) else: self.label_location[self.make_label(word)] = [[self.get_pc(), self.immediate_mask[found], self.immediate[found]]] else: raise ValueError('Invalid label: "%r", line: %s' % (word, line)) instruction |= r if found == 'JMPT': break self.set_instruction(self.get_pc(), instruction, line_count) self.increment_pc() def is_keyword(self, s): return (s in self.instruction_info.keys() or s.startswith(".") or s in ["GETC", "OUT", "PUTS", "IN", "PUTSP", "HALT"]) def assemble(self, code): self.source = {} self.labels = {} self.label_location = {} # processing the lines # first pass: for line in code.splitlines(): # remove comments ## FIXME: can't do like this! Need a real parser: orig_line, line = line, line.split(';')[0] # add space after comma to make sure registers are space separated also (not with strings) if '"' not in line: line = line.replace(',', ', ') # drop comments words = (line.split()) if ';' in line else line.split() if '.END' in words: break self.process_instruction(words, self.line_count, line) self.line_count += 1 # second pass: for label, value in self.label_location.items(): if label not in self.labels: raise ValueError('Bad label: "%s"' % label) else: for ref, mask, bits in value: current = self.labels[label] - ref - 1 # kludge for absolute addresses, # but seems correct for some code (lc3os.asm) if self.get_memory(ref) == 0: # not instruction -> absolute self.set_memory(ref, self.labels[label]) elif bits != -1 and not self.in_range(current, bits) : raise ValueError(("Not an instruction: \"%s\", mask %s, offset %s, %s, ref %s" % (label, bin(mask), self.labels[label] - ref, bin(self.labels[label]), lc_hex(ref)))) else: # FIXME: # Sets memory to value of label # ref, mask, bits: [x4000, 511, 9], [x4000, FFFF, -1] # where label was used in instruction # requires init memory first if bits == -1: self.set_memory(ref, self.labels[label]) else: self.set_memory(ref, plus(self.get_memory(ref), lc_bin(mask & current))) def handleDebug(self, lineno): pass def Print(self, *args, end="\n"): print(*args, end=end) def Error(self, string): if self.kernel: self.kernel.Error(string) else: sys.stderr.write(string) def run(self, reset=True): if reset: self.cycle = 0 self.instruction_count = 0 self.set_memory(0xFE04, 0xFFFF) ## OS_DSR Display Ready self.set_memory(0xFE00, 0xFFFF) ## OS_KBSR Keyboard Ready self.cont = True self.suspended = False if self.debug: self.Print("Tracing Script! PC* is incremented Program Counter") self.Print("(Instr/Cycles Count) INSTR [source line] (PC*: xHEX)") self.Print("----------------------------------------------------") while self.cont: self.step() def step(self): if self.debug: self.Print("=" * 60) self.Print("Stepping... => read, <= write, (Instructions/Cycles):") self.Print("=" * 60) pc = self.get_pc() self.handleDebug(self.source.get(pc, -1)) instruction = self.get_memory(pc) instr = (instruction >> 12) & 0xF self.instruction_count += 1 self.cycle += self.cycles[instr] self.increment_pc() if self.debug: line = self.source.get(pc, -1) line_str = (" [%s]" % line) if (line != -1) else "" self.Print("(%s/%s) %s%s (%s*: %s)" % ( self.instruction_count, self.cycle, self.format[instr](instruction, pc), line_str, lc_hex(self.get_pc()), lc_hex(instruction))) #if (instr in self.apply): self.apply[instr](instruction) if self.pc in self.breakpoints: self.cont = False self.suspended = True self.Print("...breakpoint hit at", lc_hex(self.pc)) def dump_registers(self): self.Print() self.Print("=" * 60) self.Print("Registers:") self.Print("=" * 60) self.Print("PC:", lc_hex(self.get_pc())) for r,v in zip("NZP", self.get_nzp()): self.Print("%s: %s" % (r,v), end=" ") self.Print() count = 1 for key in range(8): self.Print("R%d: %s" % (key, lc_hex(self.get_register(key))), end=" ") if count % 4 == 0: self.Print() count += 1 def dump(self, orig_start=None, orig_stop=None, raw=False, header=True): if orig_start is None: start = self.orig else: start = orig_start if orig_stop is None: stop = max(self.source.keys()) + 1 else: stop = orig_stop + 1 if stop <= start: stop = start + 10 if stop - start > 100: stop = start + 100 if raw or self.dump_mode == "dump": if header: self.Print("=" * 60) self.Print("Memory dump:") self.Print("=" * 60) for x in range(start, stop): self.Print("%-10s %s: %s" % ("", lc_hex(x), lc_hex(self.get_memory(x)))) else: if header: self.Print("=" * 60) self.Print("Memory disassembled:") self.Print("=" * 60) for memory in range(start, stop): instruction = self.get_memory(memory) instr = (instruction >> 12) & 0xF label = self.lookup(memory, "") if label: label = label + ":" instr_str = self.source.get(memory, "") if instr_str: self.Print("%-10s %s: %s %-41s [line: %s]" % ( label, lc_hex(memory), lc_hex(instruction), self.format[instr](instruction, memory), instr_str)) else: if instruction == 0: ascii = "\\0" else: ascii = "%s %s" % (instruction, ascii_str(instruction)) self.Print("%-10s %s: %s - %s" % ( label, lc_hex(memory), lc_hex(instruction), ascii)) def disassemble(self): start = min(self.source.keys()) stop = max(self.source.keys()) + 1 self.Print(".ORIG %s " % lc_hex(start)) for memory in range(start, stop): instruction = self.get_memory(memory) instr = (instruction >> 12) & 0xF label = self.lookup(memory, "") if label: label = label + ":" self.Print("%-10s %s" % (label, self.format[instr](instruction, memory))) self.Print(".END") def lookup(self, location, default=None): for label in self.labels: if self.labels[label] == location: return label if default is None: return location else: return default def STR(self, instruction): src = (instruction & 0b0000111000000000) >> 9 base = (instruction & 0b0000000111000000) >> 6 offset6 = instruction & 0b0000000000111111 self.set_memory(plus(self.get_register(base), sext(offset6, 6)), self.get_register(src)) def STR_format(self, instruction, location): src = (instruction & 0b0000111000000000) >> 9 base = (instruction & 0b0000000111000000) >> 6 offset6 = instruction & 0b0000000000111111 return "STR R%d, R%d, %s" % (src, base, offset6) def RTI(self, instruction): if (self.psr & 0b1000000000000000): raise ValueError("priviledge mode exception") else: self.set_pc(self.get_memory(self.get_register(6))) # R6 is the SSP self.set_register(6, lc_bin(plus(self.get_register(6), 1))) temp = self.get_memory(self.get_register(6)) self.set_register(6, lc_bin(plus(self.get_register(6), 1))) self.psr = temp def RTI_format(self, instruction, location): return "RTI" def NOT(self, instruction): dst = (instruction & 0b0000111000000000) >> 9 src = (instruction & 0b0000000111000000) >> 6 self.set_register(dst, lc_bin(~self.get_register(src))) self.set_nzp(self.get_register(dst)) def NOT_format(self, instruction, location): dst = (instruction & 0b0000111000000000) >> 9 src = (instruction & 0b0000000111000000) >> 6 return "NOT R%d, R%d" % (dst, src) def LDI(self, instruction): dst = (instruction & 0b0000111000000000) >> 9 pc_offset9 = instruction & 0b0000000111111111 location = plus(self.get_pc(), sext(pc_offset9, 9)) memory1 = self.get_memory(location) memory2 = self.get_memory(memory1) if self.debug: self.Print(" Reading memory[x%04x] (x%04x) =>" % (location, memory1)) self.Print(" Reading memory[x%04x] (x%04x) =>" % (memory1, memory2)) self.set_register(dst, memory2) self.set_nzp(self.get_register(dst)) def LDI_format(self, instruction, location): dst = (instruction & 0b0000111000000000) >> 9 pc_offset9 = instruction & 0b0000000111111111 return "LDI R%d, %s" % (dst, lc_hex(self.lookup(plus(sext(pc_offset9,9), location) + 1))) def STI(self, instruction): src = (instruction & 0b0000111000000000) >> 9 pc_offset9 = instruction & 0b0000000111111111 memory = self.get_memory(plus(self.get_pc(), sext(pc_offset9,9))) self.set_memory(memory, self.get_register(src)) ## Hook up, side effect display: if memory == 0xFE06: ## OS_DDR try: self.Print(chr(self.get_register(src)), end="") except: raise ValueError("value in R%d (%s) is not in range 0-255 (x00-xFF)" % (src, lc_hex(self.get_register(src)))) def STI_format(self, instruction, location): dst = (instruction & 0b0000111000000000) >> 9 pc_offset9 = instruction & 0b0000000111111111 return "STI R%d, %s" % (dst, lc_hex(self.lookup(plus(sext(pc_offset9,9), location) + 1))) def RESERVED(self, instruction): raise ValueError("attempt to execute reserved instruction") def RESERVED_format(self, instruction, location): return ";; RESERVED %s %s" % (lc_hex((instruction >> 12) & 0xF), lc_hex(instruction & 0b0000111111111111)) def LEA(self, instruction): dst = (instruction & 0b0000111000000000) >> 9 pc_offset9 = instruction & 0b0000000111111111 self.set_register(dst, lc_bin(plus(self.get_pc(), sext(pc_offset9,9)))) self.set_nzp(self.get_register(dst)) def LEA_format(self, instruction, location): dst = (instruction & 0b0000111000000000) >> 9 pc_offset9 = instruction & 0b0000000111111111 return "LEA R%d, %s" % (dst, lc_hex(self.lookup(plus(sext(pc_offset9,9), location) + 1))) def getc(self): ### No prompt for input: if len(self.char_buffer) == 0: data = self.kernel.raw_input() data = data.replace("\\n", "\n") if len(data) == 0: self.char_buffer = [0] # end of string elif len(data) == 1: self.char_buffer = [ord(char) for char in data] # single char mode else: self.char_buffer = [ord(char) for char in data] + [0] return self.char_buffer.pop(0) def TRAP(self, instruction): vector = instruction & 0b0000000011111111 self.set_register(7, self.get_pc()) self.set_pc(self.get_memory(vector)) if vector == 0x20: self.set_memory(0xFE02, self.getc()) elif vector == 0x21: pass elif vector == 0x22: # PUTS pass elif vector == 0x23: pass elif vector == 0x24: # PUTSP pass elif vector == 0x25: self.cont = False else: raise ValueError("invalid TRAP vector: %s" % lc_hex(vector)) def TRAP_format(self, instruction, location): vector = instruction & 0b0000000011111111 if vector == 0x20: return "GETC" elif vector == 0x21: return "OUT" elif vector == 0x22: return "PUTS" elif vector == 0x23: return "IN" elif vector == 0x24: return "PUTSP" elif vector == 0x25: return "HALT" else: return ";; Invalid TRAP vector: %s" % lc_hex(vector) def BR(self, instruction): n = instruction & 0b0000100000000000 z = instruction & 0b0000010000000000 p = instruction & 0b0000001000000000 pc_offset9 = instruction & 0b0000000111111111 if (not any([n, z, p])): if self.noop_error: raise Exception("Attempting to execute NOOP at %s\n" % lc_hex(self.get_pc() - 1)) elif self.warn: self.Error("Attempting to execute NOOP at %s\n" % lc_hex(self.get_pc() - 1)) if (n and self.get_nzp(0) or z and self.get_nzp(1) or p and self.get_nzp(2)): self.set_pc(plus(self.get_pc(), sext(pc_offset9,9))) if self.debug: self.Print(" True - branching to", lc_hex(self.get_pc())) else: if self.debug: self.Print(" False - continuing...") def BR_format(self, instruction, location): n = instruction & 0b0000100000000000 z = instruction & 0b0000010000000000 p = instruction & 0b0000001000000000 pc_offset9 = instruction & 0b0000000111111111 instr = "BR" if n: instr += "n" if z: instr += "z" if p: instr += "p" val = self.lookup(plus(sext(pc_offset9,9), location) + 1) ascii = ascii_str(pc_offset9) if not (n or z or p): return "NOOP - (no BR to %s) %s" % (lc_hex(val), ascii) else: return "%s %s %s" % (instr, lc_hex(val), ascii) def LD(self, instruction): dst = (instruction & 0b0000111000000000) >> 9 pc_offset9 = instruction & 0b0000000111111111 location = plus(self.get_pc(), sext(pc_offset9,9)) memory = self.get_memory(location) if self.debug: self.Print(" Reading memory[x%04x] (x%04x) =>" % (location, memory)) self.set_register(dst, memory) self.set_nzp(self.get_register(dst)) def LD_format(self, instruction, location): dst = (instruction & 0b0000111000000000) >> 9 pc_offset9 = instruction & 0b0000000111111111 return "LD R%d, %s" % (dst, lc_hex(self.lookup(plus(sext(pc_offset9,9), location) + 1))) def LDR(self, instruction): dst = (instruction & 0b0000111000000000) >> 9 base = (instruction & 0b0000000111000000) >> 6 offset6 = instruction & 0b0000000000111111 location = plus(self.get_register(base), sext(offset6,6)) memory = self.get_memory(location) if self.debug: self.Print(" Reading memory[x%04x] (x%04x) =>" % (location, memory)) self.set_register(dst, memory) self.set_nzp(self.get_register(dst)) def LDR_format(self, instruction, location): dst = (instruction & 0b0000111000000000) >> 9 base = (instruction & 0b0000000111000000) >> 6 offset6 = instruction & 0b0000000000111111 return "LDR R%d, R%d, %s" % (dst, base, offset6) def ST(self, instruction): src = (instruction & 0b0000111000000000) >> 9 pc_offset9 = instruction & 0b0000000111111111 self.set_memory(plus(self.get_pc(), sext(pc_offset9,9)), self.get_register(src)) def ST_format(self, instruction, location): src = (instruction & 0b0000111000000000) >> 9 pc_offset9 = instruction & 0b0000000111111111 return "ST R%d, %s" % (src, lc_hex(self.lookup(plus(sext(pc_offset9,9), location) + 1))) def JMP(self, instruction): base = (instruction & 0b0000000111000000) >> 6 self.set_pc(self.get_register(base)) def JMP_format(self, instruction, location): base = (instruction & 0b0000000111000000) >> 6 if base == 7: return "RET" else: return "JMP R%d" % base def JSR(self, instruction): temp = self.get_pc() if (instruction & 0b0000100000000000): # JSR pc_offset11 = instruction & 0b0000011111111111 self.set_pc(plus(self.get_pc(), sext(pc_offset11,11))) else: # JSRR base = (instruction & 0b0000000111000000) >> 6 self.set_pc(self.get_register(base)) self.set_register(7, temp) def JSR_format(self, instruction, location): if (instruction & 0b0000100000000000): # JSR pc_offset11 = instruction & 0b0000011111111111 return "JSR %s" % lc_hex(self.lookup(plus(sext(pc_offset11,11), location) + 1)) else: # JSRR base = (instruction & 0b0000000111000000) >> 6 return "JSRR R%d" % base def ADD(self, instruction): dst = (instruction & 0b0000111000000000) >> 9 sr1 = (instruction & 0b0000000111000000) >> 6 if (instruction & 0b0000000000100000) == 0: sr2 = instruction & 0b0000000000000111 self.set_register(dst, lc_bin(plus(self.get_register(sr1), self.get_register(sr2)))) else: imm5 = instruction & 0b0000000000011111 self.set_register(dst, lc_bin(plus(self.get_register(sr1), sext(imm5, 5)))) self.set_nzp(self.get_register(dst)) def ADD_format(self, instruction, location): dst = (instruction & 0b0000111000000000) >> 9 sr1 = (instruction & 0b0000000111000000) >> 6 if (instruction & 0b0000000000100000): imm5 = instruction & 0b0000000000011111 return "ADD R%d, R%d, #%s" % (dst, sr1, lc_int(sext(imm5, 5))) else: sr2 = instruction & 0b0000000000000111 return "ADD R%d, R%d, R%d" % (dst, sr1, sr2) def AND(self, instruction): dst = (instruction & 0b0000111000000000) >> 9 sr1 = (instruction & 0b0000000111000000) >> 6 if (instruction & 0b0000000000100000) == 0: sr2 = instruction & 0b0000000000000111 self.set_register(dst, self.get_register(sr1) & self.get_register(sr2)) else: imm5 = instruction & 0b0000000000011111 self.set_register(dst, self.get_register(sr1) & sext(imm5, 5)) self.set_nzp(self.get_register(dst)) def AND_format(self, instruction, location): dst = (instruction & 0b0000111000000000) >> 9 sr1 = (instruction & 0b0000000111000000) >> 6 if (instruction & 0b0000000000100000): imm5 = instruction & 0b0000000000011111 return "AND R%d, R%d, #%s" % (dst, sr1, lc_int(sext(imm5, 5))) else: sr2 = instruction & 0b0000000000000111 return "AND R%d, R%d, R%d" % (dst, sr1, sr2) def SHIFT(self, instruction): ## SHIFT DST, SRC, immed6 dst = (instruction & 0b0000111000000000) >> 9 src = (instruction & 0b0000000111000000) >> 6 imm6 = lc_int(sext(instruction & 0b0000000000111111,6)) if imm6 < 0: # arithmetic shift right preserves sign value = sext(self.get_register(src) >> -imm6, 16 + imm6) self.set_register(dst, value) else: self.set_register(dst, self.get_register(src) << imm6) self.set_nzp(self.get_register(dst)) def TERMINAL(self, instruction): ## TERMINAL SRC, 1 src = (instruction & 0b0000111000000000) >> 9 clear = (instruction & 0b0000000000000001) string = "" location = self.get_register(src) memory = self.get_memory(location) while memory != 0: string += chr(memory & 0b0000000011111111) if memory & 0b1111111100000000: string += chr((memory & 0b1111111100000000) >> 8) location += 1 memory = self.get_memory(location) self.kernel.Display(HTML("<pre>" + string + "</pre>"), clear_output=clear) def TERMINAL_format(self, instruction): ## TERMINAL SRC, 1 src = (instruction & 0b0000111000000000) >> 9 clear = (instruction & 0b0000000100000000) return "TERMINAL R%d, %d" % (src, clear) def SHIFT_format(self, instruction, location): ## SHIFT DST, SRC, DIR, immed4 dst = (instruction & 0b0000111000000000) >> 9 src = (instruction & 0b0000000111000000) >> 6 imm6 = instruction & 0b0000000000111111 return "SHIFT R%d, R%d, #%s" % (dst, src, lc_int(sext(imm6, 6))) def screen_set_cursor(self, x, y): pass def screen_get_cursor(self): return 0,0 def screen_clear(self): pass def screen_poke(self, x, y, value): pass def screen_peek(self, x, y): return 0 def SCREEN(self, instruction): ## SCREEN if (instruction & 0b010 << 3): # CLEAR #CLEAR: SCREEN ...,...,010,... self.screen_clear() elif (instruction & 0b100 << 3): # cursor #GETCUR: SCREEN Rx , Ry,100,... #SETCUR: SCREEN Rx , Ry,101,... if (instruction & 0b001 << 3): # setcur rx = (instruction & 0b0000111000000000) >> 9 ry = (instruction & 0b0000000111000000) >> 6 self.screen_set_cursor(self.get_register(rx), self.get_register(ry)) else: rx = (instruction & 0b0000111000000000) >> 9 ry = (instruction & 0b0000000111000000) >> 6 x, y = self.screen_get_cursor() self.set_register(rx, x) self.set_register(ry, y) else: # peek/poke #POKE: SCREEN Rx , Ry,001, RSRC #PEEK: SCREEN Rx , Ry,000, RDST if (instruction & 0b001 << 3): # poke rx = (instruction & 0b0000111000000000) >> 9 ry = (instruction & 0b0000000111000000) >> 6 src = (instruction & 0b0000000000000111) self.screen_poke(self.get_register(rx), self.get_register(ry), self.get_register(src)) else: rx = (instruction & 0b0000111000000000) >> 9 ry = (instruction & 0b0000000111000000) >> 6 dst = (instruction & 0b0000000000000111) self.set_register(dst, self.screen_peek(self.get_register(rx), self.get_register(ry))) def SCREEN_format(self, instruction, location): ## SCREEN if (instruction & 0b010 << 3): # CLEAR #CLEAR: SCREEN ...,...,010,... return "CLEAR" elif (instruction & 0b100 << 3): # cursor #GETCUR: SCREEN Rx , Ry,100,... #SETCUR: SCREEN Rx , Ry,101,... if (instruction & 0b001 << 3): # setcur rx = (instruction & 0b0000111000000000) >> 9 ry = (instruction & 0b0000000111000000) >> 6 return "SETCUR R%d, R%d" % (rx, ry) else: rx = (instruction & 0b0000111000000000) >> 9 ry = (instruction & 0b0000000111000000) >> 6 return "GETCUR R%d, R%d" % (rx, ry) else: # peek/poke #POKE: SCREEN Rx , Ry,001, RSRC #PEEK: SCREEN Rx , Ry,000, RDST if (instruction & 0b001 << 3): # poke rx = (instruction & 0b0000111000000000) >> 9 ry = (instruction & 0b0000000111000000) >> 6 src = (instruction & 0b0000000000000111) return "POKE R%d, R%d, R%d" % (rx, ry, src) else: rx = (instruction & 0b0000111000000000) >> 9 ry = (instruction & 0b0000000111000000) >> 6 dst = (instruction & 0b0000000000000111) return "PEEK R%d, R%d, R%d" % (rx, ry, dst) def load(self, filename): self.filename = filename fp = open(filename) text = "".join(fp.readlines()) fp.close() return text def execute_file(self, filename): text = self.load(filename) self.assemble(text) self.set_pc(self.orig) self.cycle = 0 self.instruction_count = 0 self.run() if self.suspended: self.Print("=" * 60) self.Print("Computation SUSPENDED") self.Print("=" * 60) else: self.Print("=" * 60) self.Print("Computation completed") self.Print("=" * 60) self.Print("Instructions:", self.instruction_count) self.Print("Cycles: %s (%f milliseconds)" % (self.cycle, self.cycle * 1./2000000)) self.dump_registers() def save(self, base): # producing output # symbol list for Simulators with open(base + '.sym', 'w') as f: self.Print('''//Symbol Name Page Address //---------------- ------------ //''', end='\t', file=f) self.Print('\n//\t'.join('\t%-20s%4x' % (name, value) for name, value in self.labels.items()), file=f) with open(base + '.bin', 'w') as f: self.Print('{0:016b}'.format(self.orig), file=f) # orig address self.Print('\n'.join('{0:016b}'.format(self.get_memory(m)) for m in range(self.orig, self.get_pc())), file=f) # object file for running in Simulator with open(base + '.obj', 'wb') as f: #do slice from right after code and write #(byteorder of 0 does not matter) self.set_memory(self.get_pc(), self.orig) self.memory_byteswap() self.memory_tofile(self.get_pc(), self.get_pc() + 1, f) self.memory_tofile(self.orig,self.get_pc(), f) self.memory_byteswap() def execute(self, text): words = [word.strip() for word in text.split()] if words[0].startswith("%"): if words[0] == "%dump": try: self.dump(*[int("0" + word, 16) for word in words[1:]], raw=True) except: self.Error("Error; did you load code first?") return True elif words[0] == "%regs": try: self.dump_registers() except: self.Error("Error; did you load code first?") return True elif words[0] == "%dis": try: self.dump(*[int("0" + word, 16) for word in words[1:]]) except: self.Error("Error; did you run load first?") return True elif words[0] == "%d": self.debug = not self.debug self.Print("Debug is now %s" % ["off", "on"][int(self.debug)]) return True elif words[0] == "%noop": self.noop_error = not self.noop_error self.Print("NOOP is now %s" % ["a warning", "an error"][int(self.noop_error)]) return True elif words[0] == "%pc": self.cycle = 0 self.instruction_count = 0 self.set_pc(int("0" + words[1], 16)) self.dump_registers() return True elif words[0] == "%labels": print("Label", "Location") for key in self.labels: print(key + ":", hex(self.labels[key])) print(self.label_location) return True elif words[0] == "%mem": location = int("0" + words[1], 16) self.set_memory(location, int("0" + words[2], 16)) self.dump(location, location) return True elif words[0] == "%reg": self.set_register(int(words[1]), int("0" + words[2], 16)) self.dump_registers() return True elif words[0] == "%warn": self.warn = bool(int(words[1])) return True elif words[0] == "%reset": self.initialize(runit=True) self.dump_registers() return True elif words[0] == "%step": orig_debug = self.debug self.debug = True if self.get_pc() in self.source: lineno = self.source[self.get_pc()] ## show trace self.step() self.debug = orig_debug self.dump_registers() return True elif words[0] == "%bp": if len(words) > 1: if words[1] == "clear": self.breakpoints = {} self.Print("All breakpoints cleared") return location = int("0" + words[1], 16) self.breakpoints[location] = True if self.breakpoints: count = 1 self.Print("=" * 60) self.Print("Breakpoints") self.Print("=" * 60) for memory in sorted(self.breakpoints.keys()): self.Print(" %d) " % count, end="") self.dump(memory, memory, header=False) count += 1 else: self.Print(" No breakpoints set") return True elif words[0] == "%exe" or words[0] == "%cont": ok = False try: # if .orig in code, then run, otherwise just assemble: self.debug = False if words[0] == "%exe": self.char_buffer = [] self.cycle = 0 self.instruction_count = 0 self.set_pc(self.orig) self.reset_registers() self.run() else: self.run(reset=False) if self.suspended: self.Print("=" * 60) self.Print("Computation SUSPENDED") self.Print("=" * 60) else: self.Print("=" * 60) self.Print("Computation completed") self.Print("=" * 60) self.Print("Instructions:", self.instruction_count) self.Print("Cycles: %s (%f milliseconds)" % (self.cycle, self.cycle * 1./2000000)) self.dump_registers() ok = True except Exception as exc: if self.get_pc() - 1 in self.source: self.Error("\nRuntime error:\n line %s:\n%s" % (self.source[self.get_pc() - 1], str(exc))) else: self.Error("\nRuntime error:\n memory %s\n%s" % (lc_hex(self.get_pc() - 1), str(exc))) ok = False return ok else: self.Error("Invalid Interactive Magic Directive\nHint: %help") return False else: ### Else, must be code to assemble: self.labels = {} self.label_location = {} ok = False try: self.assemble(text) self.Print("Assembled! Use %dis or %dump to examine; use %exe to run.") #self.dump() #self.dump_registers() ok = True except Exception as exc: if self.get_pc() - 1 in self.source: self.Error("\nAssemble error\n line %s\n" % self.source[self.get_pc()]) else: self.Error("\nAssemble error\n memory %s\n" % lc_hex(self.get_pc() - 1)) self.Error(str(exc) + "\n") ok = False return ok def get_os(): return """ ;############################################################################## ;# ;# lc3os.asm -- the LC-3 operating system ;# ;# "Copyright (c) 2003 by Steven S. Lumetta." ;# ;# Permission to use, copy, modify, and distribute this software and its ;# documentation for any purpose, without fee, and without written ;# agreement is hereby granted, provided that the above copyright notice ;# and the following two paragraphs appear in all copies of this software, ;# that the files COPYING and NO_WARRANTY are included verbatim with ;# any distribution, and that the contents of the file README are included ;# verbatim as part of a file named README with any distribution. ;# ;# IN NO EVENT SHALL THE AUTHOR BE LIABLE TO ANY PARTY FOR DIRECT, ;# INDIRECT, SPECIAL, INCIDENTAL, OR CONSEQUENTIAL DAMAGES ARISING OUT ;# OF THE USE OF THIS SOFTWARE AND ITS DOCUMENTATION, EVEN IF THE AUTHOR ;# HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. ;# ;# THE AUTHOR SPECIFICALLY DISCLAIMS ANY WARRANTIES, INCLUDING, BUT NOT ;# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR ;# A PARTICULAR PURPOSE. THE SOFTWARE PROVIDED HEREUNDER IS ON AN "AS IS" ;# BASIS, AND THE AUTHOR NO OBLIGATION TO PROVIDE MAINTENANCE, SUPPORT, ;# UPDATES, ENHANCEMENTS, OR MODIFICATIONS." ;# ;# Author: Steve Lumetta ;# Version: 1 ;# Creation Date: 18 October 2003 ;# Filename: lc3os.asm ;# History: ;# SSL 1 18 October 2003 ;# Copyright notices and Gnu Public License marker added. ;# ;############################################################################## .ORIG x0000 ; the TRAP vector table .FILL BAD_TRAP ; x00 .FILL BAD_TRAP ; x01 .FILL BAD_TRAP ; x02 .FILL BAD_TRAP ; x03 .FILL BAD_TRAP ; x04 .FILL BAD_TRAP ; x05 .FILL BAD_TRAP ; x06 .FILL BAD_TRAP ; x07 .FILL BAD_TRAP ; x08 .FILL BAD_TRAP ; x09 .FILL BAD_TRAP ; x0A .FILL BAD_TRAP ; x0B .FILL BAD_TRAP ; x0C .FILL BAD_TRAP ; x0D .FILL BAD_TRAP ; x0E .FILL BAD_TRAP ; x0F .FILL BAD_TRAP ; x10 .FILL BAD_TRAP ; x11 .FILL BAD_TRAP ; x12 .FILL BAD_TRAP ; x13 .FILL BAD_TRAP ; x14 .FILL BAD_TRAP ; x15 .FILL BAD_TRAP ; x16 .FILL BAD_TRAP ; x17 .FILL BAD_TRAP ; x18 .FILL BAD_TRAP ; x19 .FILL BAD_TRAP ; x1A .FILL BAD_TRAP ; x1B .FILL BAD_TRAP ; x1C .FILL BAD_TRAP ; x1D .FILL BAD_TRAP ; x1E .FILL BAD_TRAP ; x1F .FILL TRAP_GETC ; x20 .FILL TRAP_OUT ; x21 .FILL TRAP_PUTS ; x22 .FILL TRAP_IN ; x23 .FILL TRAP_PUTSP ; x24 .FILL TRAP_HALT ; x25 .FILL BAD_TRAP ; x26 .FILL BAD_TRAP ; x27 .FILL BAD_TRAP ; x28 .FILL BAD_TRAP ; x29 .FILL BAD_TRAP ; x2A .FILL BAD_TRAP ; x2B .FILL BAD_TRAP ; x2C .FILL BAD_TRAP ; x2D .FILL BAD_TRAP ; x2E .FILL BAD_TRAP ; x2F .FILL BAD_TRAP ; x30 .FILL BAD_TRAP ; x31 .FILL BAD_TRAP ; x32 .FILL BAD_TRAP ; x33 .FILL BAD_TRAP ; x34 .FILL BAD_TRAP ; x35 .FILL BAD_TRAP ; x36 .FILL BAD_TRAP ; x37 .FILL BAD_TRAP ; x38 .FILL BAD_TRAP ; x39 .FILL BAD_TRAP ; x3A .FILL BAD_TRAP ; x3B .FILL BAD_TRAP ; x3C .FILL BAD_TRAP ; x3D .FILL BAD_TRAP ; x3E .FILL BAD_TRAP ; x3F .FILL BAD_TRAP ; x40 .FILL BAD_TRAP ; x41 .FILL BAD_TRAP ; x42 .FILL BAD_TRAP ; x43 .FILL BAD_TRAP ; x44 .FILL BAD_TRAP ; x45 .FILL BAD_TRAP ; x46 .FILL BAD_TRAP ; x47 .FILL BAD_TRAP ; x48 .FILL BAD_TRAP ; x49 .FILL BAD_TRAP ; x4A .FILL BAD_TRAP ; x4B .FILL BAD_TRAP ; x4C .FILL BAD_TRAP ; x4D .FILL BAD_TRAP ; x4E .FILL BAD_TRAP ; x4F .FILL BAD_TRAP ; x50 .FILL BAD_TRAP ; x51 .FILL BAD_TRAP ; x52 .FILL BAD_TRAP ; x53 .FILL BAD_TRAP ; x54 .FILL BAD_TRAP ; x55 .FILL BAD_TRAP ; x56 .FILL BAD_TRAP ; x57 .FILL BAD_TRAP ; x58 .FILL BAD_TRAP ; x59 .FILL BAD_TRAP ; x5A .FILL BAD_TRAP ; x5B .FILL BAD_TRAP ; x5C .FILL BAD_TRAP ; x5D .FILL BAD_TRAP ; x5E .FILL BAD_TRAP ; x5F .FILL BAD_TRAP ; x60 .FILL BAD_TRAP ; x61 .FILL BAD_TRAP ; x62 .FILL BAD_TRAP ; x63 .FILL BAD_TRAP ; x64 .FILL BAD_TRAP ; x65 .FILL BAD_TRAP ; x66 .FILL BAD_TRAP ; x67 .FILL BAD_TRAP ; x68 .FILL BAD_TRAP ; x69 .FILL BAD_TRAP ; x6A .FILL BAD_TRAP ; x6B .FILL BAD_TRAP ; x6C .FILL BAD_TRAP ; x6D .FILL BAD_TRAP ; x6E .FILL BAD_TRAP ; x6F .FILL BAD_TRAP ; x70 .FILL BAD_TRAP ; x71 .FILL BAD_TRAP ; x72 .FILL BAD_TRAP ; x73 .FILL BAD_TRAP ; x74 .FILL BAD_TRAP ; x75 .FILL BAD_TRAP ; x76 .FILL BAD_TRAP ; x77 .FILL BAD_TRAP ; x78 .FILL BAD_TRAP ; x79 .FILL BAD_TRAP ; x7A .FILL BAD_TRAP ; x7B .FILL BAD_TRAP ; x7C .FILL BAD_TRAP ; x7D .FILL BAD_TRAP ; x7E .FILL BAD_TRAP ; x7F .FILL BAD_TRAP ; x80 .FILL BAD_TRAP ; x81 .FILL BAD_TRAP ; x82 .FILL BAD_TRAP ; x83 .FILL BAD_TRAP ; x84 .FILL BAD_TRAP ; x85 .FILL BAD_TRAP ; x86 .FILL BAD_TRAP ; x87 .FILL BAD_TRAP ; x88 .FILL BAD_TRAP ; x89 .FILL BAD_TRAP ; x8A .FILL BAD_TRAP ; x8B .FILL BAD_TRAP ; x8C .FILL BAD_TRAP ; x8D .FILL BAD_TRAP ; x8E .FILL BAD_TRAP ; x8F .FILL BAD_TRAP ; x90 .FILL BAD_TRAP ; x91 .FILL BAD_TRAP ; x92 .FILL BAD_TRAP ; x93 .FILL BAD_TRAP ; x94 .FILL BAD_TRAP ; x95 .FILL BAD_TRAP ; x96 .FILL BAD_TRAP ; x97 .FILL BAD_TRAP ; x98 .FILL BAD_TRAP ; x99 .FILL BAD_TRAP ; x9A .FILL BAD_TRAP ; x9B .FILL BAD_TRAP ; x9C .FILL BAD_TRAP ; x9D .FILL BAD_TRAP ; x9E .FILL BAD_TRAP ; x9F .FILL BAD_TRAP ; xA0 .FILL BAD_TRAP ; xA1 .FILL BAD_TRAP ; xA2 .FILL BAD_TRAP ; xA3 .FILL BAD_TRAP ; xA4 .FILL BAD_TRAP ; xA5 .FILL BAD_TRAP ; xA6 .FILL BAD_TRAP ; xA7 .FILL BAD_TRAP ; xA8 .FILL BAD_TRAP ; xA9 .FILL BAD_TRAP ; xAA .FILL BAD_TRAP ; xAB .FILL BAD_TRAP ; xAC .FILL BAD_TRAP ; xAD .FILL BAD_TRAP ; xAE .FILL BAD_TRAP ; xAF .FILL BAD_TRAP ; xB0 .FILL BAD_TRAP ; xB1 .FILL BAD_TRAP ; xB2 .FILL BAD_TRAP ; xB3 .FILL BAD_TRAP ; xB4 .FILL BAD_TRAP ; xB5 .FILL BAD_TRAP ; xB6 .FILL BAD_TRAP ; xB7 .FILL BAD_TRAP ; xB8 .FILL BAD_TRAP ; xB9 .FILL BAD_TRAP ; xBA .FILL BAD_TRAP ; xBB .FILL BAD_TRAP ; xBC .FILL BAD_TRAP ; xBD .FILL BAD_TRAP ; xBE .FILL BAD_TRAP ; xBF .FILL BAD_TRAP ; xC0 .FILL BAD_TRAP ; xC1 .FILL BAD_TRAP ; xC2 .FILL BAD_TRAP ; xC3 .FILL BAD_TRAP ; xC4 .FILL BAD_TRAP ; xC5 .FILL BAD_TRAP ; xC6 .FILL BAD_TRAP ; xC7 .FILL BAD_TRAP ; xC8 .FILL BAD_TRAP ; xC9 .FILL BAD_TRAP ; xCA .FILL BAD_TRAP ; xCB .FILL BAD_TRAP ; xCC .FILL BAD_TRAP ; xCD .FILL BAD_TRAP ; xCE .FILL BAD_TRAP ; xCF .FILL BAD_TRAP ; xD0 .FILL BAD_TRAP ; xD1 .FILL BAD_TRAP ; xD2 .FILL BAD_TRAP ; xD3 .FILL BAD_TRAP ; xD4 .FILL BAD_TRAP ; xD5 .FILL BAD_TRAP ; xD6 .FILL BAD_TRAP ; xD7 .FILL BAD_TRAP ; xD8 .FILL BAD_TRAP ; xD9 .FILL BAD_TRAP ; xDA .FILL BAD_TRAP ; xDB .FILL BAD_TRAP ; xDC .FILL BAD_TRAP ; xDD .FILL BAD_TRAP ; xDE .FILL BAD_TRAP ; xDF .FILL BAD_TRAP ; xE0 .FILL BAD_TRAP ; xE1 .FILL BAD_TRAP ; xE2 .FILL BAD_TRAP ; xE3 .FILL BAD_TRAP ; xE4 .FILL BAD_TRAP ; xE5 .FILL BAD_TRAP ; xE6 .FILL BAD_TRAP ; xE7 .FILL BAD_TRAP ; xE8 .FILL BAD_TRAP ; xE9 .FILL BAD_TRAP ; xEA .FILL BAD_TRAP ; xEB .FILL BAD_TRAP ; xEC .FILL BAD_TRAP ; xED .FILL BAD_TRAP ; xEE .FILL BAD_TRAP ; xEF .FILL BAD_TRAP ; xF0 .FILL BAD_TRAP ; xF1 .FILL BAD_TRAP ; xF2 .FILL BAD_TRAP ; xF3 .FILL BAD_TRAP ; xF4 .FILL BAD_TRAP ; xF5 .FILL BAD_TRAP ; xF6 .FILL BAD_TRAP ; xF7 .FILL BAD_TRAP ; xF8 .FILL BAD_TRAP ; xF9 .FILL BAD_TRAP ; xFA .FILL BAD_TRAP ; xFB .FILL BAD_TRAP ; xFC .FILL BAD_TRAP ; xFD .FILL BAD_TRAP ; xFE .FILL BAD_TRAP ; xFF ; the interrupt vector table .FILL INT_PRIV ; x00 .FILL INT_ILL ; x01 .FILL BAD_INT ; x02 .FILL BAD_INT ; x03 .FILL BAD_INT ; x04 .FILL BAD_INT ; x05 .FILL BAD_INT ; x06 .FILL BAD_INT ; x07 .FILL BAD_INT ; x08 .FILL BAD_INT ; x09 .FILL BAD_INT ; x0A .FILL BAD_INT ; x0B .FILL BAD_INT ; x0C .FILL BAD_INT ; x0D .FILL BAD_INT ; x0E .FILL BAD_INT ; x0F .FILL BAD_INT ; x10 .FILL BAD_INT ; x11 .FILL BAD_INT ; x12 .FILL BAD_INT ; x13 .FILL BAD_INT ; x14 .FILL BAD_INT ; x15 .FILL BAD_INT ; x16 .FILL BAD_INT ; x17 .FILL BAD_INT ; x18 .FILL BAD_INT ; x19 .FILL BAD_INT ; x1A .FILL BAD_INT ; x1B .FILL BAD_INT ; x1C .FILL BAD_INT ; x1D .FILL BAD_INT ; x1E .FILL BAD_INT ; x1F .FILL BAD_INT ; x20 .FILL BAD_INT ; x21 .FILL BAD_INT ; x22 .FILL BAD_INT ; x23 .FILL BAD_INT ; x24 .FILL BAD_INT ; x25 .FILL BAD_INT ; x26 .FILL BAD_INT ; x27 .FILL BAD_INT ; x28 .FILL BAD_INT ; x29 .FILL BAD_INT ; x2A .FILL BAD_INT ; x2B .FILL BAD_INT ; x2C .FILL BAD_INT ; x2D .FILL BAD_INT ; x2E .FILL BAD_INT ; x2F .FILL BAD_INT ; x30 .FILL BAD_INT ; x31 .FILL BAD_INT ; x32 .FILL BAD_INT ; x33 .FILL BAD_INT ; x34 .FILL BAD_INT ; x35 .FILL BAD_INT ; x36 .FILL BAD_INT ; x37 .FILL BAD_INT ; x38 .FILL BAD_INT ; x39 .FILL BAD_INT ; x3A .FILL BAD_INT ; x3B .FILL BAD_INT ; x3C .FILL BAD_INT ; x3D .FILL BAD_INT ; x3E .FILL BAD_INT ; x3F .FILL BAD_INT ; x40 .FILL BAD_INT ; x41 .FILL BAD_INT ; x42 .FILL BAD_INT ; x43 .FILL BAD_INT ; x44 .FILL BAD_INT ; x45 .FILL BAD_INT ; x46 .FILL BAD_INT ; x47 .FILL BAD_INT ; x48 .FILL BAD_INT ; x49 .FILL BAD_INT ; x4A .FILL BAD_INT ; x4B .FILL BAD_INT ; x4C .FILL BAD_INT ; x4D .FILL BAD_INT ; x4E .FILL BAD_INT ; x4F .FILL BAD_INT ; x50 .FILL BAD_INT ; x51 .FILL BAD_INT ; x52 .FILL BAD_INT ; x53 .FILL BAD_INT ; x54 .FILL BAD_INT ; x55 .FILL BAD_INT ; x56 .FILL BAD_INT ; x57 .FILL BAD_INT ; x58 .FILL BAD_INT ; x59 .FILL BAD_INT ; x5A .FILL BAD_INT ; x5B .FILL BAD_INT ; x5C .FILL BAD_INT ; x5D .FILL BAD_INT ; x5E .FILL BAD_INT ; x5F .FILL BAD_INT ; x60 .FILL BAD_INT ; x61 .FILL BAD_INT ; x62 .FILL BAD_INT ; x63 .FILL BAD_INT ; x64 .FILL BAD_INT ; x65 .FILL BAD_INT ; x66 .FILL BAD_INT ; x67 .FILL BAD_INT ; x68 .FILL BAD_INT ; x69 .FILL BAD_INT ; x6A .FILL BAD_INT ; x6B .FILL BAD_INT ; x6C .FILL BAD_INT ; x6D .FILL BAD_INT ; x6E .FILL BAD_INT ; x6F .FILL BAD_INT ; x70 .FILL BAD_INT ; x71 .FILL BAD_INT ; x72 .FILL BAD_INT ; x73 .FILL BAD_INT ; x74 .FILL BAD_INT ; x75 .FILL BAD_INT ; x76 .FILL BAD_INT ; x77 .FILL BAD_INT ; x78 .FILL BAD_INT ; x79 .FILL BAD_INT ; x7A .FILL BAD_INT ; x7B .FILL BAD_INT ; x7C .FILL BAD_INT ; x7D .FILL BAD_INT ; x7E .FILL BAD_INT ; x7F .FILL BAD_INT ; x80 .FILL BAD_INT ; x81 .FILL BAD_INT ; x82 .FILL BAD_INT ; x83 .FILL BAD_INT ; x84 .FILL BAD_INT ; x85 .FILL BAD_INT ; x86 .FILL BAD_INT ; x87 .FILL BAD_INT ; x88 .FILL BAD_INT ; x89 .FILL BAD_INT ; x8A .FILL BAD_INT ; x8B .FILL BAD_INT ; x8C .FILL BAD_INT ; x8D .FILL BAD_INT ; x8E .FILL BAD_INT ; x8F .FILL BAD_INT ; x90 .FILL BAD_INT ; x91 .FILL BAD_INT ; x92 .FILL BAD_INT ; x93 .FILL BAD_INT ; x94 .FILL BAD_INT ; x95 .FILL BAD_INT ; x96 .FILL BAD_INT ; x97 .FILL BAD_INT ; x98 .FILL BAD_INT ; x99 .FILL BAD_INT ; x9A .FILL BAD_INT ; x9B .FILL BAD_INT ; x9C .FILL BAD_INT ; x9D .FILL BAD_INT ; x9E .FILL BAD_INT ; x9F .FILL BAD_INT ; xA0 .FILL BAD_INT ; xA1 .FILL BAD_INT ; xA2 .FILL BAD_INT ; xA3 .FILL BAD_INT ; xA4 .FILL BAD_INT ; xA5 .FILL BAD_INT ; xA6 .FILL BAD_INT ; xA7 .FILL BAD_INT ; xA8 .FILL BAD_INT ; xA9 .FILL BAD_INT ; xAA .FILL BAD_INT ; xAB .FILL BAD_INT ; xAC .FILL BAD_INT ; xAD .FILL BAD_INT ; xAE .FILL BAD_INT ; xAF .FILL BAD_INT ; xB0 .FILL BAD_INT ; xB1 .FILL BAD_INT ; xB2 .FILL BAD_INT ; xB3 .FILL BAD_INT ; xB4 .FILL BAD_INT ; xB5 .FILL BAD_INT ; xB6 .FILL BAD_INT ; xB7 .FILL BAD_INT ; xB8 .FILL BAD_INT ; xB9 .FILL BAD_INT ; xBA .FILL BAD_INT ; xBB .FILL BAD_INT ; xBC .FILL BAD_INT ; xBD .FILL BAD_INT ; xBE .FILL BAD_INT ; xBF .FILL BAD_INT ; xC0 .FILL BAD_INT ; xC1 .FILL BAD_INT ; xC2 .FILL BAD_INT ; xC3 .FILL BAD_INT ; xC4 .FILL BAD_INT ; xC5 .FILL BAD_INT ; xC6 .FILL BAD_INT ; xC7 .FILL BAD_INT ; xC8 .FILL BAD_INT ; xC9 .FILL BAD_INT ; xCA .FILL BAD_INT ; xCB .FILL BAD_INT ; xCC .FILL BAD_INT ; xCD .FILL BAD_INT ; xCE .FILL BAD_INT ; xCF .FILL BAD_INT ; xD0 .FILL BAD_INT ; xD1 .FILL BAD_INT ; xD2 .FILL BAD_INT ; xD3 .FILL BAD_INT ; xD4 .FILL BAD_INT ; xD5 .FILL BAD_INT ; xD6 .FILL BAD_INT ; xD7 .FILL BAD_INT ; xD8 .FILL BAD_INT ; xD9 .FILL BAD_INT ; xDA .FILL BAD_INT ; xDB .FILL BAD_INT ; xDC .FILL BAD_INT ; xDD .FILL BAD_INT ; xDE .FILL BAD_INT ; xDF .FILL BAD_INT ; xE0 .FILL BAD_INT ; xE1 .FILL BAD_INT ; xE2 .FILL BAD_INT ; xE3 .FILL BAD_INT ; xE4 .FILL BAD_INT ; xE5 .FILL BAD_INT ; xE6 .FILL BAD_INT ; xE7 .FILL BAD_INT ; xE8 .FILL BAD_INT ; xE9 .FILL BAD_INT ; xEA .FILL BAD_INT ; xEB .FILL BAD_INT ; xEC .FILL BAD_INT ; xED .FILL BAD_INT ; xEE .FILL BAD_INT ; xEF .FILL BAD_INT ; xF0 .FILL BAD_INT ; xF1 .FILL BAD_INT ; xF2 .FILL BAD_INT ; xF3 .FILL BAD_INT ; xF4 .FILL BAD_INT ; xF5 .FILL BAD_INT ; xF6 .FILL BAD_INT ; xF7 .FILL BAD_INT ; xF8 .FILL BAD_INT ; xF9 .FILL BAD_INT ; xFA .FILL BAD_INT ; xFB .FILL BAD_INT ; xFC .FILL BAD_INT ; xFD .FILL BAD_INT ; xFE .FILL BAD_INT ; xFF OS_START ; machine starts executing at x0200 LEA R0,OS_START_MSG ; print a welcome message PUTS HALT OS_START_MSG .STRINGZ "\\nWelcome to the LC-3 simulator.\\n\\nThe contents of the LC-3 tools distribution, including sources, management\\ntools, and data, are Copyright (c) 2003 Steven S. Lumetta.\\n\\nThe LC-3 tools distribution is free software covered by the GNU General\\nPublic License, and you are welcome to modify it and/or distribute copies\\nof it under certain conditions. The file COPYING (distributed with the\\ntools) specifies those conditions. There is absolutely no warranty for\\nthe LC-3 tools distribution, as described in the file NO_WARRANTY (also\\ndistributed with the tools).\\n\\nHave fun.\\n" OS_KBSR .FILL xFE00 OS_KBDR .FILL xFE02 OS_DSR .FILL xFE04 OS_DDR .FILL xFE06 OS_MCR .FILL xFFFE MASK_HI .FILL x7FFF LOW_8_BITS .FILL x00FF TOUT_R1 .BLKW 1 TIN_R7 .BLKW 1 OS_R0 .BLKW 1 OS_R1 .BLKW 1 OS_R2 .BLKW 1 OS_R3 .BLKW 1 OS_R7 .BLKW 1 TRAP_GETC LDI R0,OS_KBSR ; wait for a keystroke BRzp TRAP_GETC LDI R0,OS_KBDR ; read it and return RET TRAP_OUT ST R1,TOUT_R1 ; save R1 TRAP_OUT_WAIT LDI R1,OS_DSR ; wait for the display to be ready BRzp TRAP_OUT_WAIT STI R0,OS_DDR ; write the character and return LD R1,TOUT_R1 ; restore R1 RET TRAP_PUTS ST R0,OS_R0 ; save R0, R1, and R7 ST R1,OS_R1 ST R7,OS_R7 ADD R1,R0,#0 ; move string pointer (R0) into R1 TRAP_PUTS_LOOP LDR R0,R1,#0 ; write characters in string using OUT BRz TRAP_PUTS_DONE OUT ADD R1,R1,#1 BRnzp TRAP_PUTS_LOOP TRAP_PUTS_DONE LD R0,OS_R0 ; restore R0, R1, and R7 LD R1,OS_R1 LD R7,OS_R7 RET TRAP_IN ST R7,TIN_R7 ; save R7 (no need to save R0, since we ; overwrite later LEA R0,TRAP_IN_MSG ; prompt for input PUTS GETC ; read a character OUT ; echo back to monitor ST R0,OS_R0 ; save the character AND R0,R0,#0 ; write a linefeed, too ADD R0,R0,#10 OUT LD R0,OS_R0 ; restore the character LD R7,TIN_R7 ; restore R7 RET TRAP_PUTSP ; NOTE: This trap will end when it sees any NUL, even in ; packed form, despite the P&P second edition's requirement ; of a double NUL. ST R0,OS_R0 ; save R0, R1, R2, R3, and R7 ST R1,OS_R1 ST R2,OS_R2 ST R3,OS_R3 ST R7,OS_R7 ADD R1,R0,#0 ; move string pointer (R0) into R1 TRAP_PUTSP_LOOP LDR R2,R1,#0 ; read the next two characters LD R0,LOW_8_BITS ; use mask to get low byte AND R0,R0,R2 ; if low byte is NUL, quit printing BRz TRAP_PUTSP_DONE OUT ; otherwise print the low byte AND R0,R0,#0 ; shift high byte into R0 ADD R3,R0,#8 TRAP_PUTSP_S_LOOP ADD R0,R0,R0 ; shift R0 left ADD R2,R2,#0 ; move MSB from R2 into R0 BRzp TRAP_PUTSP_MSB_0 ADD R0,R0,#1 TRAP_PUTSP_MSB_0 ADD R2,R2,R2 ; shift R2 left ADD R3,R3,#-1 BRp TRAP_PUTSP_S_LOOP ADD R0,R0,#0 ; if high byte is NUL, quit printing BRz TRAP_PUTSP_DONE OUT ; otherwise print the low byte ADD R1,R1,#1 ; and keep going BRnzp TRAP_PUTSP_LOOP TRAP_PUTSP_DONE LD R0,OS_R0 ; restore R0, R1, R2, R3, and R7 LD R1,OS_R1 LD R2,OS_R2 LD R3,OS_R3 LD R7,OS_R7 RET TRAP_HALT ; an infinite loop of lowering OS_MCR's MSB LEA R0,TRAP_HALT_MSG ; give a warning PUTS LDI R0,OS_MCR ; halt the machine LD R1,MASK_HI AND R0,R0,R1 STI R0,OS_MCR HALT ;; BRnzp TRAP_HALT ; HALT again... BAD_TRAP ; print an error message, then HALT LEA R0,BAD_TRAP_MSG ; give an error message PUTS BRnzp TRAP_HALT ; execute HALT ; interrupts aren't really defined, since privilege doesn't ; quite work INT_PRIV RTI INT_ILL RTI BAD_INT RTI TRAP_IN_MSG .STRINGZ "\\nInput a character> " TRAP_HALT_MSG .STRINGZ "\\n\\n--- halting the LC-3 ---\\n\\n" BAD_TRAP_MSG .STRINGZ "\\n\\n--- undefined trap executed ---\\n\\n" .END """
true
c6850d346c0bbf1368263b8514100fb7f064e8c2
Python
mjepronk/euler-python
/problem20.py
UTF-8
172
2.84375
3
[]
no_license
# vim: sw=4:ts=4:et:ai from math import factorial def main(n=100): return sum(int(d) for d in str(factorial(n))) if __name__ == '': print("Result: %i" % main())
true
80ab507197305726b100bd90acee6b8442d5f6a9
Python
thorwhalen/ut
/ut/daf/struct.py
UTF-8
2,866
2.734375
3
[ "MIT" ]
permissive
__author__ = 'thor' import ut as ms import pandas as pd import ut.pcoll.order_conserving from functools import reduce class SquareMatrix(object): def __init__(self, df, index_vars=None, sort=False): if isinstance(df, SquareMatrix): self = df.copy() elif isinstance(df, pd.DataFrame): self.df = df self.index_vars = index_vars self.value_vars = ms.pcoll.order_conserving.setdiff( list(self.df.columns), self.index_vars ) self.df = self.df[self.index_vars + self.value_vars] else: raise NotImplementedError("This case hasn't been implemented yet") if sort: self.df.sort(columns=self.index_vars, inplace=True) def copy(self): return SquareMatrix(df=self.df.copy(), index_vars=self.index_vars) def transpose(self): return SquareMatrix( df=self.df, index_vars=[self.index_vars[1], self.index_vars[0]] ) def reflexive_mapreduce(self, map_fun, reduce_fun=None, broadcast_functions=True): df = self.df.merge( self.df, how='inner', left_on=self.index_vars[1], right_on=self.index_vars[0], suffixes=('', '_y'), ) df[self.index_vars[1]] = df[self.index_vars[1] + '_y'] df.drop( labels=[self.index_vars[0] + '_y', self.index_vars[1] + '_y'], axis=1, inplace=True, ) if not isinstance(map_fun, dict) and broadcast_functions: map_fun = dict(list(zip(self.value_vars, [map_fun] * len(self.value_vars)))) for k, v in map_fun.items(): df[k] = v(df[k], df[k + '_y']) df.drop(labels=[x + '_y' for x in self.value_vars], axis=1, inplace=True) if not reduce_fun: reduce_fun = dict() for k, v in map_fun.items(): reduce_fun[k] = lambda x: reduce(v, x) elif not isinstance(reduce_fun, dict) and broadcast_functions: reduce_fun = dict( list(zip(self.value_vars, [reduce_fun] * len(self.value_vars))) ) df = df.groupby(self.index_vars).agg(reduce_fun).reset_index(drop=False) return SquareMatrix(df=df, index_vars=self.index_vars) def reverse_indices(self): return [self.index_vars[1], self.index_vars[0]] def sort(self, **kwargs): kwargs = dict({'columns': self.index_vars}, **kwargs) sm = self.copy() sm.df = sm.df.sort(**kwargs) return sm def __str__(self): return self.df.__str__() def __repr__(self): return self.df.set_index(self.index_vars).__str__() def head(self, num_of_rows=5): return self.df.head(num_of_rows) def tail(self, num_of_rows=5): return self.df.tail(num_of_rows)
true
699c0b3aa9af299ab971d6580ef6fcf35e449d7e
Python
Mniharbanu/guvi
/code kata/positive.py
UTF-8
112
3.25
3
[]
no_license
aaa=int(input()) if(aaa>0): print("Positive") elif(aaa<0): print("Negative") else: print("Zero")
true
26b51fac6d96d5bb239868b5dbce620eefc14b4d
Python
ZoranPandovski/al-go-rithms
/math/Matrix multiplication/python/matrixmul.py
UTF-8
1,521
4.1875
4
[ "CC0-1.0" ]
permissive
""" SQUARE Matrix Multiplication Matrix multiplication is a binary operation that produces a matrix from two matrices. For matrix multiplication, the number of columns in the first matrix must be equal to the number of rows in the second matrix. The resulting matrix, known as the matrix product, has the number of rows of the first and the number of columns of the second matrix. Let A be a m x n matrix and B be a n x p matrix then the matrix C ,where C =A.B is defined as cij = Ai1.B1j + Ai2.B2j +...+ Ain.Bnj """ import numpy as np #Importing Numpy Library n=int(input()) #no.of rows/columns in the matrices A=[] #Array input from user one row at a time in the form of comma separated values. for i in range(n): a= [ ] for num in input().split(','): a.append(int(num)) A.append(a) # Coversion of Array into n x n matrix for both Aand B B=[] for i in range(n): b= [ ] for num in input().split(','): b.append(int(num)) B.append(b) X=np.mat(A) Y=np.mat(B) Z=X*Y z=np.array(Z) from array import * def array_list(z): m = z.tolist() # list print(*m ,sep=",") for i in range(n): array_list(z[i]) """ TEST CASE 1: >>> 2 1,2 3,4 5,6 7,8 OUTPUT: 19,22 43,50 TEST CASE 2: >>> 3 1,2,3 4,5,6 7,8,9 10,11,12 13,14,15 16,17,18 OUTPUT: 84,90,96 201,216,231 318,342,366 """
true
341707b940695b2069d93e4c3e3fa346159db254
Python
astrozot/imks
/imks/units_mcerp.py
UTF-8
4,075
2.671875
3
[]
no_license
# -*- coding: utf-8 -*- import mcerp import mcerp.umath as umath import math import uncertainties from .units import Value from . import units def umathdoc(f): "Decorator to copy the uncertainties.umath __doc__ string." f.__doc__ = getattr(umath, f.__name__, {"__doc__": ""}).__doc__ return f @umathdoc def ceil(x): if isinstance(x, Value): return Value(umath.ceil(x.value), x.unit) else: return umath.ceil(x) @umathdoc def fabs(x): if isinstance(x, Value): return Value(umath.fabs(x.value), x.unit) else: return umath.fabs(x) @umathdoc def floor(x): if isinstance(x, Value): return Value(umath.floor(x.value), x.unit) else: return umath.floor(x) @umathdoc def hypot(x, y): return sqrt(x*x + y*y) @umathdoc def pow(x, y): return x**y @umathdoc def sqrt(x): if isinstance(x, Value): return Value(umath.sqrt(x.value), x.unit / 2) else: return umath.sqrt(x) def fraction(q, p): """Given Python integers `(p, q)`, return the fraction p/q.""" if isinstance(q, Value) or isinstance(p, Value): q1 = Value(q) p1 = Value(p) return Value(float(q1.value) / float(p1.value), q1.unit - p1.unit) else: return Value(float(q) / float(p)) def mconvert(f): """Decorator for generic one-argument functions.""" g = lambda x: f(x.check_pure(f.__name__)) \ if isinstance(x, Value) else f(x) g.__doc__ = f.__doc__ return g def ufloat(s): """Convert a number in the format 12.2+/-0.3 into a Normal distribution.""" if s.find("+/-") >= 0 or s.find("(") >= 0 or s.find(u"±") >= 0: u = uncertainties.ufloat_fromstr(s) return mcerp.N(u.nominal_value, u.std_dev) else: return float(s) def ufloat_repr(self): if units.showerrors == 0: return str(self.mean) elif units.showerrors == 1: u = uncertainties.ufloat(self.mean, math.sqrt(self.var)) s = str(u) i = s.find(r"+/-") if i >= 0: return s[0:i] else: return s else: u = uncertainties.ufloat(self.mean, math.sqrt(self.var)) return str(u) def ufloat_repr_latex(self): s = "${" + ufloat_repr(self).replace("+/-", "} \pm {") + "}$" return s.replace("e", r"} \times 10^{") ###################################################################### # Load and unload functions def load(namespace): """Load all math defined functions, using when appropriate modified versions.""" globs = globals() names = ["Beta", "Bradford", "Burr", "ChiSquared", "Chi2", "Erf", "Erlang", "Exponential", "Exp", "ExtValueMax", "EVMax", "ExtValueMin", "EVMin", "Fisher", "F", "Gamma", "LogNormal", "LogN", "Normal", "N", "Pareto", "Pareto2", "PERT", "StudentT", "Triangular", "Tri", "Uniform", "Weibull", "Weib", "Bernoulli", "Bern", "Binomial", "B", "Geometric", "G", "Hypergeometric", "H", "Poisson", "Pois"] for name in names: if name[0] != '_': namespace[name] = globs.get(name, mconvert(getattr(mcerp, name))) names = dir(umath) for name in names: if name[0] != '_': namespace[name] = globs.get(name, mconvert(getattr(umath, name))) mcerp.UncertainVariable.__repr__ = mcerp.UncertainFunction.__repr__ = \ ufloat_repr mcerp.UncertainVariable.__str__ = mcerp.UncertainFunction.__str__ = \ ufloat_repr mcerp.UncertainVariable._repr_latex_ = \ mcerp.UncertainFunction._repr_latex_ = ufloat_repr_latex namespace["fraction"] = fraction namespace["ufloat"] = ufloat namespace["pi"] = math.pi namespace["e"] = math.e def unload(namespace): """Unload all math defined functions.""" names = dir(mcerp) + dir(umath) + ["fraction", "ufloat", "pi", "e"] for name in names: if name[0] != '_': try: del namespace[name] except KeyError: pass
true
74a58a86128dc0b4884dc38d002d2dcc34ab4e76
Python
vdmklchv/simple_weather_retriever
/main.py
UTF-8
768
3.453125
3
[]
no_license
import requests import config api_key = config.API_KEY while True: city = input("Enter a city. Enter quit to exit: ").lower() if city == "quit": break try: response_data = requests.get(f"https://api.openweathermap.org/data/2.5/weather?q={city}&appid={api_key}&units=metric").json() if response_data['cod'] == '404': print(response_data['message']) else: print(f"Weather in {city.capitalize()} - {response_data['sys']['country']} now:") print(f"Current temperature is {response_data['main']['temp']:.0f} C") print(f"Feels like {response_data['main']['feels_like']:.0f} C") except TypeError: print("Couldn't get weather data from remote server.") print("Goodbye")
true
bdea9cf7dbe7c417d424012892e784b5a5a15c76
Python
ParkJiSu28/Python_cote
/1419.py
UTF-8
224
3.203125
3
[]
no_license
s = input() tmp = list(s) answer = 0 for i in range(len(tmp)): if tmp[i] =='l': if i+3 <len(tmp): if tmp[i+1] =='o' and tmp[i+2] =='v' and tmp[i+3] =='e': answer +=1 print(answer)
true
08659868f0e78ee296306397e563686d41f4dbb9
Python
heiwushi/MyFlow
/myflow/optimizer.py
UTF-8
7,112
2.796875
3
[]
no_license
import abc import numpy as np import functools from myflow.ops import Tensor, Op, ones, zeros, add from myflow.common import _GradientMode from myflow.graph import Graph class ApplyGradient(Op): ''' 用计算好的梯度更新Variable ''' def __init__(self, compute_var_delta): ''' :param compute_var_delta: 根据梯度计算Variable的更新值,由不同的优化器来做具体实现 ''' self.op_name = "ApplyGradient" self.compute_var_delta = compute_var_delta def __call__(self, vars_gradients: dict, tensor_name=""): ''' 将应用梯度这一操作作为一个计算图tensor节点返回, 该节点的输入节点为要训练的若干个Variable及其对应的梯度 :param vars_gradients:一个字典,key为要训练的Variable节点,value为Variable节点的梯度 :param tensor_name: :return: ''' new_tensor = super().__call__(tensor_name) vars = list(vars_gradients.keys()) gradients = [vars_gradients[var] for var in vars] new_tensor.input_tensors.extend(vars) new_tensor.input_tensors.extend(gradients) return new_tensor def compute(self, tensor, input_vals): ''' 在Session.run()期间调用,对Variable节点的实际值进行更新 :param tensor: :param input_vals: :return: ''' var_vals = input_vals[0:int(len(input_vals) / 2)] gradient_vals = input_vals[int(len(input_vals) / 2):] var_delta = self.compute_var_delta(gradient_vals) for i, var in enumerate(tensor.input_tensors[0:int(len(input_vals) / 2)]): var.value = np.add(var_vals[i], var_delta[i]) def gradient(self, tensor: Tensor, output_grad: Tensor): return None class Optimizer(abc.ABC): ''' 所有优化器的基类 优化器实现了三个图操作: compute_gradient:给出梯度的计算图节点 apply_gradient:给出梯度更新的计算图节点 minimize:等价于先调用compute_gradient,再调用apply_gradient 所有派生于Optimizer的子类应该实现compute_var_delta方法。该方法决定不同优化器在计算时,如何根据梯度算出Variable节点的变化值 ''' def __init__(self): self.apply_gradient = ApplyGradient(self.compute_var_delta) @abc.abstractmethod def compute_var_delta(self, grad_vals_list): ''' 所有派生于Optimizer的子类应该实现compute_var_delta方法。该方法决定不同优化器在计算时,如何根据梯度算出Variable节点的变化值 :param grad_vals_list: 计算出的梯度值list :return: ''' pass def compute_gradient(self, loss: Tensor, var_list=None, cache_dict: dict = None, name=None): ''' 给出因变量loss关于自变量var_list的梯度的计算图 :param loss: 所求梯度的因变量节点 :param var_list: 所求梯度的自变量节点list :param name:节点名 :return: ''' # 这里要求必须是[]形状,即标量。实际上机器学习中的损失loss一般都是标量。 assert loss.shape == [] if var_list is None: var_list = Graph.get_default_graph().TRAIN_VARS_COLLECTIONS if cache_dict is None: cache_dict = dict() vars_gradients = {} with _GradientMode(): for var in var_list: result = cache_dict.get(var) if result is None: # 如果求的是关于自身的梯度,则直接返回一个形状与var一样、元素全为1的矩阵 if var == loss: result = ones(var.shape) else: # 根据多元复合函数求导法则,loss关于var的导数,应该为loss对var的所有输出节点所在路径分别求导,之后求和 result = zeros(var.shape) for output_n in var.out_tensors: # 对于每条输出路径,先对输出节点求导 output_grad = self.compute_gradient(loss, [output_n], cache_dict)[output_n] # 之后根据该节点的操作的gradient函数,计算该条路径对var的导数 order = output_n.input_tensors.index(var) var_g = output_n.op.gradient(output_n, output_grad)[order] # 与之前各条路径的结果累加 result = add(result, var_g) cache_dict[var] = result vars_gradients[var] = result return vars_gradients def minimize(self, loss, var_list=None): ''' :param loss:所求梯度的因变量节点 :param var_list:所求梯度的自变量节点list :return: ''' assert loss.shape == [] vars_gradients = self.compute_gradient(loss, var_list) return self.apply_gradient(vars_gradients) class SGD(Optimizer): ''' 基本的随机梯度下降算法 ''' def __init__(self, learn_rate=0.001): ''' :param learn_rate: 学习率 ''' super().__init__() self.learn_rate = learn_rate def compute_var_delta(self, grad_vals_list): for i in range(len(grad_vals_list)): grad_vals_list[i] = -self.learn_rate * grad_vals_list[i] return grad_vals_list class RMSProp(Optimizer): ''' Root Mean Square Prop优化算法 动态调整每个参数的学习率,使其反比于该参数的历史偏导数平方值总和的平方根。 而不同于AdaGrad的是,历史偏导数平方值的总和会以decay的速率衰减 ''' def __init__(self, learn_rate=0.001, decay=0.9): ''' :param learn_rate: 初始学习率 :param decay: 衰减率 ''' super().__init__() self.learn_rate = learn_rate self.decay = decay self.r = 0 def compute_var_delta(self, grad_vals_list): grad_vals_shape_list = list(map(lambda x: x.shape, grad_vals_list)) grad_vals_flatten_list = list(map(lambda x: x.flatten(), grad_vals_list)) grad_vals_concat = np.concatenate(grad_vals_flatten_list) self.r = self.r * self.decay + (1 - self.decay) * grad_vals_concat * grad_vals_concat var_delta_concat = - self.learn_rate * (1 / np.sqrt(self.r + 1e-8)) * grad_vals_concat var_delta = [] tmp_pos = 0 for i in range(len(grad_vals_list)): shape = grad_vals_shape_list[i] length = functools.reduce(lambda x, y: x * y, shape) var_delta.append(np.reshape(var_delta_concat[tmp_pos:tmp_pos + length], shape)) tmp_pos += length return var_delta class Adam(Optimizer): def __init__(self): super().__init__() # TODO def compute_var_delta(self, grad_vals_list): # TODO pass
true
4328d49dcbf8c4386078f9833526075cdb36dedb
Python
ideoforms/isobar
/tests/test_pattern_sequence.py
UTF-8
5,571
2.71875
3
[ "MIT" ]
permissive
import pytest import isobar as iso def test_psequence_ints(): a = iso.PSequence([1, 2, 3], 1) assert list(a) == [1, 2, 3] def test_psequence_tuples(): a = iso.PSequence([(1, 2), (3, 4), (5, 6)], 2) assert list(a) == [(1, 2), (3, 4), (5, 6), (1, 2), (3, 4), (5, 6)] def test_psequence_keys(): a = iso.PSequence([iso.Key("C", "major"), iso.Key("F", "minor")], 1) assert list(a) == [iso.Key("C", "major"), iso.Key("F", "minor")] def test_pseries(): a = iso.PSeries(2, iso.PSequence([1, 2]), iso.PConstant(5)) assert list(a) == [2, 3, 5, 6, 8] def test_prange(): a = iso.PRange(0, iso.PConstant(10), iso.PSequence([1, 2])) assert list(a) == [0, 1, 3, 4, 6, 7, 9] def test_pgeom(): a = iso.PGeom(1, iso.PSequence([1, 2]), 8) assert list(a) == [1, 1, 2, 2, 4, 4, 8, 8] def test_pimpulse(): a = iso.PImpulse(4) b = iso.PSubsequence(a, 0, 8) assert list(b) == [1, 0, 0, 0, 1, 0, 0, 0] def test_ploop(): a = iso.PSequence([1, 2, 3], 1) b = iso.PLoop(a, 3) assert list(b) == [1, 2, 3, 1, 2, 3, 1, 2, 3] def test_ploop_bang(): pass def test_ppingpong(): a = iso.PSequence([1, 2, 3], 1) b = iso.PPingPong(a, 2) assert list(b) == [1, 2, 3, 2, 1, 2, 3, 2, 1] def test_pcreep(): a = iso.PSequence([1, 2, 3, 4, 5], 1) b = iso.PCreep(a, 3, 1, 2) assert list(b) == [1, 2, 3, 1, 2, 3, 2, 3, 4, 2, 3, 4, 3, 4, 5, 3, 4, 5] def test_pstutter(): a = iso.PSequence([1, 2, 3, 4], 1) b = iso.PStutter(a, iso.PSequence([2, 3])) assert b.nextn(16) == [1, 1, 2, 2, 2, 3, 3, 4, 4, 4] def test_psubsequence(): a = iso.PSeries() b = iso.PSubsequence(a, 4, 4) assert list(b) == [4, 5, 6, 7] def test_pinterpolate(): a = iso.PSequence([0, 1, 2], 1) steps = iso.PSequence([4, 2], 1) b = iso.PInterpolate(a, steps, iso.INTERPOLATION_NONE) assert list(b) == [0, 0, 0, 0, 1, 1, 2] a = iso.PSequence([0, 1, 2], 1) steps = iso.PSequence([4, 2], 1) b = iso.PInterpolate(a, steps, iso.INTERPOLATION_LINEAR) assert list(b) == [0, 0.25, 0.5, 0.75, 1.0, 1.5, 2.0] b = iso.PInterpolate(iso.PSequence([0, 1, 2]), iso.PSequence([2, 2]), 99) print(next(b)) with pytest.raises(ValueError): next(b) def test_preverse(): a = iso.PSequence([1, 2, 3, 4, 5], 1) b = iso.PReverse(a) assert list(b) == [5, 4, 3, 2, 1] def test_preset(): a = iso.PSeries(0, 1) b = iso.PReset(a, iso.PImpulse(4)) c = iso.PSubsequence(b, 0, 10) assert list(c) == [0, 1, 2, 3, 0, 1, 2, 3, 0, 1] def test_pcounter(): a = iso.PCounter(iso.PImpulse(4)) b = iso.PSubsequence(a, 0, 10) assert list(b) == [1, 1, 1, 1, 2, 2, 2, 2, 3, 3] def test_pcollapse(): a = iso.PSequence([1, 2, None, 3, 4, None, None, 5, 6, None], 1) b = iso.PCollapse(a) assert list(b) == [1, 2, 3, 4, 5, 6] def test_pnorepeats(): a = iso.PSequence([1, 2, 2, 3, 3.5, 3.5, 4, None, None, 5], 1) b = iso.PNoRepeats(a) assert list(b) == [1, 2, 3, 3.5, 4, None, 5] def test_ppad(): a = iso.PSequence([1, None, 2], 1) b = iso.PPad(a, 6) assert list(b) == [1, None, 2, None, None, None] a = iso.PSequence([1, None, 2], 1) b = iso.PPad(a, 3) assert list(b) == [1, None, 2] def test_ppadtomultiple(): a = iso.PSequence([1, 2, 3, 4, None, 6], 1) b = iso.PPadToMultiple(a, 4) assert list(b) == [1, 2, 3, 4, None, 6, None, None] a = iso.PSequence([1, None, 2], 1) b = iso.PPadToMultiple(a, 3) assert list(b) == [1, None, 2] def test_parpeggiator(): a = iso.PArpeggiator([0, 1, 2, 3], iso.PArpeggiator.UP) assert a.nextn(16) == [0, 1, 2, 3] a = iso.PArpeggiator([0, 1, 2, 3], iso.PArpeggiator.DOWN) assert a.nextn(16) == [3, 2, 1, 0] a = iso.PArpeggiator([0, 1, 2, 3], iso.PArpeggiator.CONVERGE) assert a.nextn(16) == [0, 3, 1, 2] a = iso.PArpeggiator([0, 1, 2, 3, 4], iso.PArpeggiator.CONVERGE) assert a.nextn(16) == [0, 4, 1, 3, 2] a = iso.PArpeggiator([0, 1, 2, 3], iso.PArpeggiator.CONVERGE) assert a.nextn(16) == [0, 3, 1, 2] a = iso.PArpeggiator([0, 1, 2, 3, 4], iso.PArpeggiator.DIVERGE) assert a.nextn(16) == [2, 1, 3, 0, 4] a = iso.PArpeggiator([0, 1, 2, 3], iso.PArpeggiator.DIVERGE) assert a.nextn(16) == [1, 2, 0, 3] a = iso.PArpeggiator([0, 1, 2, 3, 4], iso.PArpeggiator.RANDOM) a.seed(0) a.reset() assert a.nextn(16) == [2, 1, 0, 4, 3] def test_peuclidean(): a = iso.PEuclidean(4, 7, 0) assert a.nextn(16) == [1, None, 1, None, 1, None, 1, 1, None, 1, None, 1, None, 1, 1, None] a = iso.PEuclidean(4, iso.PSequence([7, 7, 7, 7, 7, 7, 7, 8, 8, 8, 8, 8, 8, 8, 8, 4, 4, 4, 4], 1)) assert a.nextn(19) == [1, None, 1, None, 1, None, 1, None, 1, None, 1, None, 1, None, 1, 1, 1, 1, 1] def test_ppermut(): a = iso.PPermut(iso.PSequence([1, 11, 111]), 3) assert list(a) == [1, 11, 111, 1, 111, 11, 11, 1, 111, 11, 111, 1, 111, 1, 11, 111, 11, 1] def test_ppatterngeneratoraction(): n = 0 def generate(): nonlocal n n += 1 if n == 1: return iso.PSequence([0], 2) elif n == 2: return iso.PSequence([1, 2], 1) else: return None a = iso.PPatternGeneratorAction(generate) assert next(a) == 0 assert next(a) == 0 assert next(a) == 1 assert next(a) == 2 with pytest.raises(StopIteration): next(a) def test_psequenceaction(): a = iso.PSequenceAction([1, 2, 3], lambda a: list(reversed(a)), 4) assert list(a) == [1, 2, 3, 3, 2, 1, 1, 2, 3, 3, 2, 1]
true
f85d766ababb30ac625661420851dea2f4810277
Python
sujiny-tech/preparing-for-coding-test
/leetcode/Palindrome Linked List.py
UTF-8
593
3.796875
4
[]
no_license
class ListNode: def __init__(self, val=0, next=None): self.val=val self.next=next def isPalindrome(head:ListNode) -> bool: isTrue=True list_=[] while head!=None: list_.append(head.val) head=head.next print(list_) left, right=0, len(list_)-1 while left<right: if list_[left]==list_[right]: left+=1 right-=1 else: isTrue=False break return isTrue a=ListNode(1) b=ListNode(2) c=ListNode(3) a.next=b b.next=c ans=isPalindrome(a) print(ans)
true
48e4c539554a7155433b336524d5f72e32e1a03c
Python
lizhaodong/PrunedYOLO
/spar_v3.py
UTF-8
2,552
2.9375
3
[]
no_license
#This is the library for weights sparsification import tensorflow as tf import numpy as np #masks is a list of tuple, each tuple is (var_name, mask) masks = [] #name_tfv is a dictionary, where key is the variable name, #and value is tf.variable name_tfv = {} #name_ph, key variable name and value is tf.placeholder (with same dtype and shape) name_ph = {} def get_masks(sess, percent): #get_mask generates masks sparsifying model weights #Criteria for sparsification is specified by percientile, #i.e. fraction of elements maksed #arguments: #sess: tf sess where weights are stored #percent: fraction of sparsified tf_variables = tf.get_collection(tf.GraphKeys.TRAINABLE_VARIABLES) #name_vals is list, each is tuple (var_name, value) name_vals = [] data=[] #old_vals only contains values, it's a list old_vals = sess.run(tf_variables) for val in old_vals: if len(val.shape) > 1: data.extend(np.absolute(val).flatten().tolist()) CUTOFF = np.percentile(data, percent) for i in range(len(tf_variables)): if(len(old_vals[i].shape) > 1): name_tfv[tf_variables[i].name] = tf_variables[i] cur_ph = tf.placeholder(tf_variables[i].dtype, shape=tf_variables[i].get_shape()) name_ph[tf_variables[i].name] = cur_ph name_vals.append((tf_variables[i].name, old_vals[i])) global masks for pair in name_vals: weight_val = pair[1] mask_cur = np.abs(weight_val) < CUTOFF """ mask_cur = np.ones(weight_val.shape) if len(weight_val.shape)==2: for i in range(weight_val.shape[0]): for j in range(weight_val.shape[1]): if abs(weight_val[i, j]) < CUTOFF: mask_cur[i ,j] = 0 #pair[0] is the variable name """ masks.append((pair[0], mask_cur)) return masks ''' def apply_masks(sess): ops = [] for mask_tuple in masks: mask = mask_tuple[1] #mask_tuple[0] is the variable name, #name_tfv[var_name] gives the corresponding tf.var variable = name_tfv[mask_tuple[0]] new_var = tf.multiply(variable, mask) ops.append(tf.assign(variable, new_var)) sess.run(ops) ''' def apply_masks(sess): for mask_tuple in masks: mask = mask_tuple[1] variable = name_tfv[mask_tuple[0]] new_var = variable * mask sess.run(variable.assign(name_ph[mask_tuple[0]]), {name_ph[mask_tuple[0]]: sess.run(new_var)})
true
5d2a37897de4a1e1444c39f2b735d65a4cc79fcf
Python
gxsgxs/1808
/13day/06-列表遍历的坑.py
UTF-8
297
4
4
[]
no_license
list = [1,2,3,4,5,6,7,8,9] #注意 最后不要用循环去删除列表 ''' for i in range(len(list)):#0 1 2 3 4 5 6 7 8 list.pop(i) print(list) ''' ''' for i in list: print(i) list.pop() #list = [1,2,3,4,5,6,7,8] ''' for i in range(len(list)-1,-1,-1): list.pop(i) print(list)
true
367a1fd5dfd3ebec60cfe31572944291e44adc45
Python
zingzheng/LeetCode_py
/117Populating Next Right Pointers in Each Node II.py
UTF-8
1,861
3.328125
3
[]
no_license
##Populating Next Right Pointers in Each Node II ##Follow up for problem "Populating Next Right Pointers in Each Node". ##What if the given tree could be any binary tree? Would your previous solution still work? ##2015年8月26日 18:05:48 AC ##zss # Definition for binary tree with next pointer. class TreeLinkNode(object): def __init__(self, x): self.val = x self.left = None self.right = None self.next = None class Solution(object): def connect(self, root): """ :type root: TreeLinkNode :rtype: nothing """ if not root:return node=root while node: down = None while node: if not down: if node.left: down = node.left elif node.right: down = node.right nex = node.next while nex: if nex.left or nex.right: break nex=nex.next if node.left and node.right: node.left.next = node.right if node.left and not node.right and nex: if nex.left: node.left.next=nex.left else: node.left.next=nex.right if node.right and nex: if nex.left: node.right.next=nex.left else: node.right.next=nex.right node=nex node=down class Test(object): def t(self): t1= TreeLinkNode(1) t2= TreeLinkNode(2) t3= TreeLinkNode(3) t4= TreeLinkNode(4) t5= TreeLinkNode(5) t1.left=t2 t1.right=t3 t2.right=t4 t3.left=t5 return t1
true
f32ba6b90c374c6076d66420b138c27d1c8020a3
Python
marwahaha/studio_xkcd
/app/model.py
UTF-8
2,939
2.75
3
[]
no_license
import logging from peewee import * from utils.settings import Settings settings = Settings.get_instance() mysql_db = MySQLDatabase( settings['mysql']['database'], user=settings['mysql']['username'], password=settings['mysql']['password'], host=settings['mysql']['hostname'], port=settings['mysql']['hostport'] ) def mysql_query(func): def function_wrapper(*args, **kwargs): if mysql_db.is_closed(): logging.info('Opening MySQL Connection') mysql_db.connect() result = func(*args, **kwargs) if not mysql_db.is_closed(): logging.info('Closing MySQL Connection') mysql_db.close() return result return function_wrapper class BaseModel(Model): class Meta: database = mysql_db class Favorite(BaseModel): # id = IntegerField(null=False) user_id = CharField(max_length=36, null=False) xkcd_id = IntegerField(null=False) class Meta: db_table = 'favorites' def to_dict(self): return { 'id': self.id, 'user_id': self.user_id, 'xkcd_id': self.xkcd_id } @classmethod def from_dict(cls, favorite_dict): favorite = Favorite( id=favorite_dict.get('id'), user_id=favorite_dict.get('user_id'), xkcd_id=favorite_dict.get('xkcd_id') ) return favorite @classmethod @mysql_query def delete_favorite(cls, user_id, xkcd_id): try: delete_count = 0 item = cls.select().where(cls.user_id == user_id, cls.xkcd_id == xkcd_id).get() if item: delete_count = item.delete_instance() except cls.DoesNotExist: item = None delete_count = 0 return delete_count, item @classmethod @mysql_query def save_favorite(cls, favorite_object): favorite = Favorite.from_dict(favorite_object) favorite.save() favorite_response = cls.select().where(cls.user_id == favorite.user_id, cls.xkcd_id == favorite.xkcd_id).get() if favorite_response: return favorite_response.to_dict() raise Exception('there were issues saving the data') @classmethod @mysql_query def get_user_favorites(cls, user_id): if not user_id: return [] try: favorites_json = [] favorites = cls.select().where(cls.user_id == user_id).order_by(cls.id) for item in favorites: favorites_json.append(Favorite.to_dict(item)) except cls.DoesNotExist: favorites_json = [] return favorites_json @classmethod def get_user_favorites_array(cls, user_id): favorites_data = Favorite.get_user_favorites(user_id) favorites = [] for f in favorites_data: favorites.append(f["xkcd_id"]) return favorites
true
f53e11fa4c8e3a568308f3f3f64c62be824b1f82
Python
dtdannen/LUiGi-hierarchical-GDA
/experiments/GraphScripts/src/TestSetup.py
UTF-8
602
2.859375
3
[ "MIT" ]
permissive
''' Created on Apr 7, 2014 @author: dustin ''' """ You can use the proper typesetting unicode minus (see http://en.wikipedia.org/wiki/Plus_sign#Plus_sign) or the ASCII hypen for minus, which some people prefer. The matplotlibrc param axes.unicode_minus controls the default behavior. The default is to use the unicode minus """ import numpy as np import matplotlib import matplotlib.pyplot as plt matplotlib.rcParams['axes.unicode_minus'] = False fig, ax = plt.subplots() ax.plot(10*np.random.randn(100), 10*np.random.randn(100), 'o') ax.set_title('Using hypen instead of unicode minus') plt.show()
true
6f8af1a97b71b8c7c88737cf1993b9de7913cf47
Python
gregoritoo/UI_Anomaly_Detection
/Alertes/Alert_Prediction.py
UTF-8
4,461
2.609375
3
[]
no_license
import os path_to_kap = os.environ['kapacitor'] path_to_script = os.environ['script'] class Alert_Prediction(): def __init__(self, host, measurement): self.host = host self.measurement = measurement self.texte = "" def create(self, message, form, period): self.form = form ''' Create the tick alert Note : NEED TO DEFINE the path of the script, which will be launched when an alert is trigged, as a variable environnement Parameters ---------- message : str Message to be shown as an alert on slack etc ; need to be written with kapacitor syntax Returns ------- None. ''' where_condition = "" where = [[element.split("=") for element in form[1:].split(",")][i][0] for i in range(len(form[1:].split(",")))] for ele in where: where_condition = where_condition + ele + "=" + ele + " AND " texte = "" cond = ["var " + (form[1:].replace(",", " AND").split("AND")[i]).replace("=", "='") + "'" for i in range(len(form[1:].replace(",", " AND").split("AND")))] for element in cond: texte = texte + element + "\n" texte = texte + "\n\n" + """var realtime = batch |query('SELECT mean(yhat) as real_value FROM "telegraf"."autogen".pred_""" + self.measurement + """ WHERE """ + where_condition[ : -5] + """') .period(5m) .every(5m) .align() |last('real_value') .as('real_value') |log() .prefix('P0-1') .level('DEBUG') var predicted = batch |query('SELECT mean(yhat) as prediction FROM "telegraf"."autogen".pred_3""" + self.measurement + """ WHERE """ + where_condition[ : -5] + """') .period(5m) .every(1h) .align() |last('prediction') .as('prediction') |log() .prefix('P0-2') .level('DEBUG') var joined_data = realtime |join(predicted) .as('realtime', 'predicted') .tolerance(20m) var performance_error = joined_data |eval(lambda: abs("realtime.real_value" - "predicted.prediction")) .as('performance_error') |alert() .crit(lambda: "performance_error" > 0 ) .message('""" + message + """') .slack() .exec('""" + path_to_script + """', '\"""" + self.host + "\"'" + """, '\"""" + self.measurement + "\"'" + """, '\"""" + str( form[1:]) + "\"'" + """, '\"""" + period + "\"'" + """) |log() .prefix('P0-3') .level('DEBUG')""" self.texte = texte def save_alert(self): self.form = self.form[1:].replace("=", ".") self.form = self.form.replace(",", "_") self.form = self.form.replace(":", "") self.path = r"Alerte/alerte_" + self.measurement + "_" + self.form + ".tick" print(self.path) with open(self.path, "w") as f: f.write(self.texte) f.close() def define_alert(self): self.form = self.form.replace("=", ".") self.form = self.form.replace(",", "_") self.form = self.form.replace(":", "") cmd_define_alert = path_to_kap + " define " + "alerte_" + self.measurement + "_" + self.form + " -type batch -tick " + self.path + " -dbrp telegraf.autogen" print(cmd_define_alert) os.system('cmd /c ' + cmd_define_alert) def enable_alert(self): self.form = self.form.replace("=", ".") self.form = self.form.replace(",", "_") self.form = self.form.replace(":", "") cmd_enable_alert = path_to_kap + " enable " + "alerte_" + self.measurement + "_" + self.form os.system('cmd /c ' + cmd_enable_alert) def launch(self): self.define_alert() self.enable_alert()
true
1a9c665d367165827a3b803197573f65af5c9e56
Python
gtieng/web-scraping-challenge
/app.py
UTF-8
729
2.515625
3
[]
no_license
#import dependencies from flask import Flask, render_template, redirect from flask_pymongo import PyMongo import scrape_mars app = Flask(__name__) # Use PyMongo to establish Mongo connection mongo = PyMongo(app, uri="mongodb://localhost:27017/mars_app") # Set route @app.route('/') def index(): # Find one record of data from the mongo database mars_data = mongo.db.mars.find_one() # Return the template with the teams list passed in return render_template('index.html', content=mars_data) # Set route @app.route('/scrape') def action(): scrape = scrape_mars.scrape() mongo.db.mars.update({}, scrape, upsert=True) return redirect("/") if __name__ == "__main__": app.run(debug=True)
true
b8338fb2ac6972260f90e061ef0f0a99c7b603aa
Python
ramki123456/newrepository
/python/pythonclass/pratice/dictionaries.py
UTF-8
1,817
3.75
4
[]
no_license
'''#dictionaries:- the group of items which are enclosed by two {} are known as dictionaries. in dictionaries items are separated by comma. an item is a combination of key and value fair. key and value separated by : dictionaries are mutable datastructures so we can modify a dictionary. syntax: dictionary_name={item1,item2,------} item: key+value dictionary_name={key1:val1, key2:val2} in dictionaries keys are unique and should accept immutable data only. immutable-(int, float, ) in dictionaries values can be of any type and they do not contain dictionaries are unordered datastructures which uses heap as memory unit. note: the datastructures from which we can not access data by using indexing process are known as unordered. unordered datastructures like dictionaries will perform data manifulation operations very faster compared to ordered datastructures. dictionaries uses hashkey maechanism process (key paired with value) which will make data operations very faster. in dictionaries we can use a process named as keying which is used to access the data. use below syntax to perform keying. syntax: dictionary_name[key] d = {'a':1, 'b':2, 'c':3} print d[a] #updating an item: to update an item the key should exit in dictionary. follow the below syntax to update an element dictionary_name[key]=value d['c']=15 print d to insert an item the key could not exit. dictionary_name[key]=value d['x']=20 print d deleting an item: syntax: del dictionary_name[key] note: if you are inserting multiple val with same name dictionary crate an item with one key mapped with latest val. d = {'a':1, 'b':4, c:'23', 'a':43} print d employee={1179:{'name':'hari', 'age':26, 'comp':['ibm, hcl, tcs'], 'loc':'banglore'}, 1180:{'name':'ravi', 'age':23, 'comp':['ibm, hcl'], 'loc':'chennai'}}
true
406700c61cad11c1eedb31d49f8e83ee37020e79
Python
karwootang-gft/tb-houston-service
/solution.py
UTF-8
11,318
2.59375
3
[ "Apache-2.0" ]
permissive
""" This is the deployments module and supports all the ReST actions for the solutions collection """ # 3rd party modules from flask import make_response, jsonify, abort from config import db, app from models import Solution, SolutionSchema from models import ModelTools from extendedSchemas import ExtendedSolutionSchema from extendedSchemas import SolutionDeploymentSchema from extendedSchemas import SolutionNamesOnlySchema import solution_extension from pprint import pformat import requests import os import json from sqlalchemy import literal_column def read_all(active=None, namesonly=None, page=None, page_size=None, sort=None): """ This function responds to a request for /api/solutions with the complete lists of solutions :return: json string of list of solutions """ app.logger.debug("solution.read_all") app.logger.debug(f"Active: {active}, namesonly: {namesonly}") # pre-process sort instructions if (sort==None): solution_query = Solution.query.order_by(Solution.id) else: try: sort_inst = [ si.split(":") for si in sort ] orderby_arr = [] for si in sort_inst: si1 = si[0] if len(si) > 1: si2 = si[1] else: si2 = "asc" orderby_arr.append(f"{si1} {si2}") #print("orderby: {}".format(orderby_arr)) solution_query = Solution.query.order_by(literal_column(", ".join(orderby_arr))) except Exception as e: print("Exception: {}".format(pformat(e))) solution_query = Solution.query.order_by(Solution.id) # Create the list of solutions from our data if active != None: solution_query = solution_query.filter(Solution.active == active) # do limit and offset last if (page==None or page_size==None): solutions = solution_query.all() else: solutions = solution_query.limit(page_size).offset(page * page_size) if namesonly == True: # Serialize the data for the response schema = SolutionNamesOnlySchema(many=True) data = schema.dump(solutions) else: solutions_arr = [] for sol in solutions: solutions_arr.append(solution_extension.build_solution(sol)) app.logger.debug("solutions array:") app.logger.debug(pformat(solutions_arr)) # Serialize the data for the response schema = ExtendedSolutionSchema(many=True) data = schema.dump(solutions_arr) app.logger.debug("solutions data:") app.logger.debug(data) return data, 200 def read_one(oid): """ This function responds to a request for /api/solution/{oid} with one matching solution from solutions :param application: id of solution to find :return: solution matching id """ sol = (Solution.query.filter(Solution.id == oid).one_or_none()) if sol is not None: solution = solution_extension.build_solution(sol) # Serialize the data for the response solution_schema = ExtendedSolutionSchema() data = solution_schema.dump(solution) return data, 200 else: abort( 404, f"Solution with id {oid} not found".format(id=oid) ) def create(solutionDetails): """ This function creates a new solution in the solutions list based on the passed in solutions data :param solution: solution to create in solutions list :return: 201 on success, 406 on solutions exists """ # Defaults if (solutionDetails.get('active') == None): solutionDetails['active'] = True if (solutionDetails.get('favourite') == None): solutionDetails['favourite'] = True if (solutionDetails.get('teams') == None): solutionDetails['teams'] = 0 if (solutionDetails.get('deployed') == None): solutionDetails['deployed'] = False if (solutionDetails.get('deploymentState') == None): solutionDetails['deploymentState'] = "" if (solutionDetails.get('statusId') == None): solutionDetails['statusId'] = 0 if (solutionDetails.get('statusCode') == None): solutionDetails['statusCode'] = "" if (solutionDetails.get('statusMessage') == None): solutionDetails['statusMessage'] = "" # Remove applications because Solutions don't have # any applications when they are first created if ('applications' in solutionDetails): del solutionDetails['applications'] # we don't need the id, the is generated automatically on the database if ('id' in solutionDetails): del solutionDetails["id"] solutionDetails['lastUpdated'] = ModelTools.get_utc_timestamp() solutionDetails['environments'] = json.dumps(solutionDetails.get('environments') or []) print("Create name 2: " + solutionDetails['name']) schema = SolutionSchema(many=False) new_solution = schema.load(solutionDetails, session=db.session) db.session.add(new_solution) db.session.commit() print("Create name 3: " + new_solution.name) # Serialize and return the newly created solution # in the response print(pformat(solutionDetails['environments'])) print("create solution") print(pformat(new_solution)) print(pformat(new_solution.environments)) schema = ExtendedSolutionSchema() data = schema.dump(new_solution) return data, 201 def update(oid, solutionDetails): """ Updates an existing solutions in the solutions list. :param key: key of the solutions to update in the solutions list :param solutions: solutions to update :return: updated solutions """ app.logger.debug(solutionDetails) # Does the solutions exist in solutions list? existing_solution = Solution.query.filter( Solution.id == oid ).one_or_none() # Does solutions exist? if existing_solution is not None: solutionDetails['environments'] = json.dumps(solutionDetails.get('environments') or existing_solution.environments) schema = SolutionSchema() update_solution = schema.load(solutionDetails, session=db.session) update_solution.key = solutionDetails.get('id', oid) update_solution.lastUpdated = ModelTools.get_utc_timestamp() db.session.merge(update_solution) db.session.commit() # return the updted solutions in the response schema = ExtendedSolutionSchema(many=False) print(">>>>> " + pformat(solutionDetails)) solutionDetails['environments'] = json.loads(solutionDetails['environments']) data = schema.dump(solutionDetails) return data, 200 # otherwise, nope, deployment doesn't exist, so that's an error else: abort(404, f"Solution not found") def delete(oid): """ This function deletes a solution from the solutions list :param key: id of the solutions to delete :return: 200 on successful delete, 404 if not found """ # Does the solution to delete exist? existing_solution = Solution.query.filter(Solution.id == oid).one_or_none() # if found? if existing_solution is not None: db.session.delete(existing_solution) db.session.commit() return make_response(f"Solution {oid} successfully deleted", 200) # Otherwise, nope, solution to delete not found else: abort(404, f"Solution {oid} not found") def deployment_read_all(): """ This function responds to a request for /api/solutiondeployments with the complete lists of deployed solutions :return: json string of list of deployed solutions id and deployed fields """ app.logger.debug("solution.deployment_read_all") solutions = Solution.query.all() schema = SolutionDeploymentSchema(many=True) data = schema.dump(solutions) app.logger.debug("solutions data:") app.logger.debug(data) return data, 200 def deployment_read_one(oid): """ This function responds to a request for /api/solutiondeployment/{oid} with one matching solution deployment from solutions :param application: id of solution to find :return: solution matching id """ sol = (Solution.query.filter(Solution.id == oid).one_or_none()) if sol is not None: # Serialize the data for the response solution_schema = SolutionDeploymentSchema(many=False) data = solution_schema.dump(sol) return data, 200 else: abort( 404, f"Solution with id {oid} not found".format(id=oid) ) def deployment_create(solutionDeploymentDetails): """ This function queries a solution forwards the request to the DaC :param solution: id :return: 201 on success, 406 if solution doesn't exist """ app.logger.debug(pformat(solutionDeploymentDetails)) oid = solutionDeploymentDetails['id']; sol_json_payload = read_one(oid) resp = sol_json_payload[0] print(pformat(resp)) data = send_deployment_request_to_the_dac(resp) resp_json = data.json() print(pformat(resp_json)) return resp_json, 201 def deployment_update(oid, solutionDeploymentDetails): """ Updates an existing solutions in the solutions list with the deployed status. :param key: id of the solution :param solutionDetails: solution details to update :return: updated solution """ app.logger.debug(solutionDeploymentDetails) # Does the solutions exist in solutions list? existing_solution = Solution.query.filter( Solution.id == oid ).one_or_none() # Does solutions exist? if existing_solution is not None: schema = SolutionSchema(many=False) update_solution = schema.load(solutionDeploymentDetails, session=db.session) update_solution.id = oid update_solution.lastUpdated = ModelTools.get_utc_timestamp() update_solution.deployed = solutionDeploymentDetails.get('deployed', update_solution.deployed) update_solution.deploymentState = solutionDeploymentDetails.get('deploymentState', update_solution.deploymentState) update_solution.statusId = solutionDeploymentDetails.get('statusId', update_solution.statusId) update_solution.statusCode = solutionDeploymentDetails.get('statusCode', update_solution.statusCode) update_solution.statusMessage = solutionDeploymentDetails.get('statusMessage', update_solution.statusMessage) db.session.merge(update_solution) db.session.commit() # return the updted solutions in the response schema = SolutionDeploymentSchema(many=False) data = schema.dump(update_solution) return data, 200 # otherwise, nope, deployment doesn't exist, so that's an error else: abort(404, f"Solution {oid} not found") def send_deployment_request_to_the_dac(sol_json_payload): url = "http://" + os.environ['GCP_DAC_URL'] + "/api/solution/" print(f"url: {url}") print(f"data: {sol_json_payload}") headers = { 'Content-Type': "application/json" } response = requests.post(url, data=json.dumps(sol_json_payload), headers=headers) print(pformat(response)) #resp_json = response.json() return response
true
de7f3d5ab6bb2f29f7951974483170f9f0144848
Python
alanespinozaz/S1-TAREA_1
/14.py
UTF-8
780
3.953125
4
[]
no_license
# """ Determinar si un número entero proporcionado por el usuario es primo. # Un número primo es un entero que no tiene más divisores que él mismo y la unidad. """ class Ejemplo14: def __init__(self): pass def evaluarprimo(self): divisor, num, res= 0,0,0 primo = True divisor = 2 num = int(input("ingrese el numero:")) while divisor < num: res = num/2 if res<0: divisor = divisor+1 print("f") if primo == True: print("numero:",num,"no es primo:") else: print("numer:",num,"no es primo:") eje14 = Ejemplo14() eje14.evaluarprimo()
true
f2c35140f8cfed45fb952a4ddc2f260a9d58780b
Python
RajkumarMittal/DS-ALGO
/Sorting/BubbleSort.py
UTF-8
382
3.75
4
[]
no_license
def bubble_sort(array): length = len(array) if length <= 1: return array for i in range(length-1): for j in range(i+1, length): if array[i] > array[j]: array[i], array[j] = array[j], array[i] return array def selection_sort(arr): if len(arr) <= 1: return arr arr = [4, 3, 2, 1] print(bubble_sort(arr))
true
d552ee40a25fda6a17f3416a6bebf26dde74dcf6
Python
alegarpa/warmupp2
/logincounter/tests.py
UTF-8
5,554
2.734375
3
[]
no_license
from django.test import TestCase, Client from logincounter.models import User import json class TestUsers(TestCase): MAX_LENGTH_INPUT = "abcdefghjiklmnopqrstuvwxyzabcdefghjiklmnopqrstuvwxyzabcdefghjiklmnopqrstuvwxyzabcdefghjiklmnopqrstuvwxyzabcdefghjiklmnopqrstuvwxyz" def setUp(self): self.client = Client() self.user1 = User.objects.create(user="user1", password="password") self.user2 = User.objects.create(user="user2", password="password") def testDefault(self): self.assertEquals(self.user1.login_count, 1) self.assertEquals(self.user2.login_count, 1) def testAdd(self): response = self.client.post('/users/add/', data = json.dumps({'user': 'user3', 'password': 'password3'}), content_type="application/json") result = json.loads(response.content) user3 = User.objects.get(user='user3') self.assertEquals(200, response.status_code) self.assertEquals(user3.login_count, result['count']) self.assertEquals(User.SUCCESS, result['errCode']) def testLogin(self): response = self.client.post('/users/login/', data = json.dumps({'user': self.user1.user, 'password': self.user1.password}), content_type="application/json") result = json.loads(response.content) user1 = User.objects.get(user=self.user1.user) self.assertEquals(200, response.status_code) self.assertEquals(user1.login_count, result['count']) self.assertEquals(User.SUCCESS, result['errCode']) def testDuplicateUser(self): response = self.client.post('/users/add/', data = json.dumps({'user': self.user1.user, 'password': 'wrong password'}), content_type="application/json") result = json.loads(response.content) user1 = User.objects.get(user=self.user1.user) self.assertEquals(200, response.status_code) self.assertEquals(self.user1.password, user1.password) self.assertEquals(User.ERR_USER_EXISTS, result['errCode']) def testInvalidUser(self): response = self.client.post('/users/login/', data = json.dumps({'user': 'bad user', 'password': 'wrong password'}), content_type="application/json") result = json.loads(response.content) try: bad_user = User.objects.get(user='bad user') except User.DoesNotExist as e: bad_user = None self.assertEquals(200, response.status_code) self.assertEquals(None, bad_user) self.assertEquals(User.ERR_BAD_CREDENTIALS, result['errCode']) def testInvalidPassword(self): response = self.client.post('/users/login/', data = json.dumps({'user': self.user1.user, 'password': 'wrong password'}), content_type="application/json") result = json.loads(response.content) user1 = User.objects.get(user=self.user1.user) self.assertEquals(200, response.status_code) self.assertEquals(self.user1.login_count, user1.login_count) self.assertEquals(User.ERR_BAD_CREDENTIALS, result['errCode']) def testBlankUser(self): response = self.client.post('/users/add/', data = json.dumps({'user': '', 'password': 'wrong password'}), content_type="application/json") result = json.loads(response.content) try: bad_user = User.objects.get(user='') except User.DoesNotExist as e: bad_user = None self.assertEquals(200, response.status_code) self.assertEquals(None, bad_user) self.assertEquals(User.ERR_BAD_USERNAME, result['errCode']) def testBlankPassword(self): response = self.client.post('/users/add/', data = json.dumps({'user': 'asdf', 'password': ''}), content_type="application/json") result = json.loads(response.content) try: good_user = User.objects.get(user='asdf') except User.DoesNotExist as e: good_user = None self.assertEquals(200, response.status_code) self.assertNotEquals(None, good_user) self.assertEquals(User.SUCCESS, result['errCode']) def testLongUser(self): response = self.client.post('/users/add/', data = json.dumps({'user': self.MAX_LENGTH_INPUT, 'password': 'wrong password'}), content_type="application/json") result = json.loads(response.content) try: bad_user = User.objects.get(user=self.MAX_LENGTH_INPUT) except User.DoesNotExist as e: bad_user = None self.assertEquals(200, response.status_code) self.assertEquals(None, bad_user) self.assertEquals(User.ERR_BAD_USERNAME, result['errCode']) def testLongPassword(self): response = self.client.post('/users/add/', data = json.dumps({'user': 'bad user', 'password': self.MAX_LENGTH_INPUT}), content_type="application/json") result = json.loads(response.content) try: bad_user = User.objects.get(user='bad user') except User.DoesNotExist as e: bad_user = None self.assertEquals(200, response.status_code) self.assertEquals(None, bad_user) self.assertEquals(User.ERR_BAD_PASSWORD, result['errCode']) def testResetFixture(self): response = self.client.post('/users/add/', data = json.dumps({'user': 'user323', 'password': 'password'}), content_type="application/json") result = json.loads(response.content) User.resetFixture() try: bad_user = User.objects.get(user='323') except User.DoesNotExist as e: bad_user = None self.assertEquals(200, response.status_code) self.assertEquals(None, bad_user) self.assertEquals(User.SUCCESS, result['errCode'])
true
8ffdf10f3ee959f30bfb90e5292f9e918908f228
Python
vmarcella/DS23
/spark/rdd.py
UTF-8
1,061
3.359375
3
[]
no_license
import math from pyspark import SparkContext sc = SparkContext() yeet = [2.3, 3.4, 4.4, 2.4, 3.3, 4.0] # Parallelize the list, yeet parallel_yeet = sc.parallelize(yeet, 2) # Collect all of the yeets print(parallel_yeet.collect()) # Take two elements from the list print(parallel_yeet.take(2)) # Get the number of partitions print(parallel_yeet.getNumPartitions()) temp_data = [59, 58, 34, 43, 23, 42] parallel_temp_data = sc.parallelize(temp_data, 2) print(parallel_temp_data.collect()) def f(ls): s = 0 for i in ls: if (i * 2) % 4 == 0: s += i * 2 return math.sqrt(s) def f(ls): s = 0 for i in ls: if (i * 2) % 4 == 0: s += i * 2 return math.sqrt(s) print(f(range(100000))) values = sc.parallelize(range(100000)) new = lambda x, y: x + (y * 2) print(math.sqrt(values.filter(lambda x: (x * 2) % 4 == 0).reduce(new))) print( math.sqrt( values.map(lambda n: n * 2) .filter(lambda n: n % 4 == 0) .reduce(lambda a, b: a + b if b % 4 == 0 else a) ) )
true
aadabbcad1d951c1333eaca0b102bc3ab21e72ac
Python
pytest-dev/pytest-xdist
/src/xdist/scheduler/loadfile.py
UTF-8
2,172
2.84375
3
[ "MIT" ]
permissive
from .loadscope import LoadScopeScheduling from xdist.remote import Producer class LoadFileScheduling(LoadScopeScheduling): """Implement load scheduling across nodes, but grouping test test file. This distributes the tests collected across all nodes so each test is run just once. All nodes collect and submit the list of tests and when all collections are received it is verified they are identical collections. Then the collection gets divided up in work units, grouped by test file, and those work units get submitted to nodes. Whenever a node finishes an item, it calls ``.mark_test_complete()`` which will trigger the scheduler to assign more work units if the number of pending tests for the node falls below a low-watermark. When created, ``numnodes`` defines how many nodes are expected to submit a collection. This is used to know when all nodes have finished collection. This class behaves very much like LoadScopeScheduling, but with a file-level scope. """ def __init__(self, config, log=None): super().__init__(config, log) if log is None: self.log = Producer("loadfilesched") else: self.log = log.loadfilesched def _split_scope(self, nodeid): """Determine the scope (grouping) of a nodeid. There are usually 3 cases for a nodeid:: example/loadsuite/test/test_beta.py::test_beta0 example/loadsuite/test/test_delta.py::Delta1::test_delta0 example/loadsuite/epsilon/__init__.py::epsilon.epsilon #. Function in a test module. #. Method of a class in a test module. #. Doctest in a function in a package. This function will group tests with the scope determined by splitting the first ``::`` from the left. That is, test will be grouped in a single work unit when they reside in the same file. In the above example, scopes will be:: example/loadsuite/test/test_beta.py example/loadsuite/test/test_delta.py example/loadsuite/epsilon/__init__.py """ return nodeid.split("::", 1)[0]
true
66a9c733e91025c7d548c3d3515595b448978dc0
Python
JeyFernandez/proyecto-de-pytohn-
/este es mi codigo/main.py
UTF-8
1,379
3.65625
4
[]
no_license
from Registro import Registro from Matricula import Matricula if __name__ == '__main__': run = True while(run): print("\n|REGISTRO DE ESTUDIENTES|\n") select = int(input("Seleccione la opcio que hara:\n1-Asignar Carrera\n2-Matricular estudiantes\n3-Revisar la matricula\n4-Salir\n:")) if select == 1: nombre = input("Dijite el nombre de la carrera: ") registro = Registro(nombre) print("\nSe asigno la carrera ~{}~ correctamente!".format(registro.Asisnar_carrera(nombre))) elif select == 2: nombre_y_apellido = input("Nombre y Apellido: ") edad = input("Edad: ") cedula = input("Numero de cedula: ") sexo = input("Sexo: ") estado_civil = input("Estado Civil: ") direccion = input("Direccion: ") numero_telefono = input("Numero de Celular: ") correo_electronico = input("Correo Electronico: ") matricula = Matricula(nombre_y_apellido , edad, cedula, sexo, estado_civil, direccion, numero_telefono, correo_electronico) registro.matricular_estudiante(matricula) elif select == 3: print("|MATRICULA ACTUAL|") for i in registro.ver_matricula(): print(i) elif select == 4: run = False
true
f64fd4078ca205be03c8096cb39932650fe35dd6
Python
baraloni/IntroToCS
/ex8/ship_helper.py
UTF-8
761
3.890625
4
[]
no_license
def direction_repr_str(direction_class, direction): """ Converts a direction to string. :param direction: The direction to convert to string. Should be one of the constants of the Direction class ([UP, DOWN, LEFT, RIGHT, NOT_MOVING) :return: A string representation for a valid direction input or the string 'UNKNOWN' if the input direction is not valid. """ if direction == direction_class.NOT_MOVING: return 'NOT MOVING' elif direction == direction_class.UP: return 'UP' elif direction == direction_class.DOWN: return 'DOWN' elif direction == direction_class.LEFT: return 'LEFT' elif direction == direction_class.RIGHT: return 'RIGHT' else: return 'UNKNOWN'
true
38d42ce3da88f3ced4649a5b033405f4e23834b7
Python
ZoranPandovski/al-go-rithms
/data_structures/Tree/Binary-tree/left-view.py
UTF-8
2,623
3.59375
4
[ "CC0-1.0" ]
permissive
#Initial Template for Python 3 import atexit import io import sys import queue from collections import defaultdict # default dict used as a map, to store node-value mapping. _INPUT_LINES = sys.stdin.read().splitlines() input = iter(_INPUT_LINES).__next__ _OUTPUT_BUFFER = io.StringIO() sys.stdout = _OUTPUT_BUFFER @atexit.register def write(): sys.__stdout__.write(_OUTPUT_BUFFER.getvalue()) def LeftView(root): ''' :param root: root of given tree. :return: print the left view of tree, dont print new line ''' # code here q=[] q.append((root,0)) hmap={} while(len(q)!=0): curr=q.pop(0) node=curr[0] level=curr[1] if hmap.get(level)==None: hmap[level]=node.data level+=1 if node.left!=None: q.append((node.left,level)) if node.right!=None: q.append((node.right,level)) # print(hmap) # print(level) for i in range(level): print(hmap[i],end=" ") class Node: def __init__(self,val): self.data = val self.left = None self.right = None # Tree Class class Tree: def __init__(self): self.root = None self.map_nodes = defaultdict(Node) def Insert(self,parent, child,dir): if self.root is None: root_node = Node(parent) child_node = Node(child) if dir == 'L': root_node.left = child_node else: root_node.right = child_node self.root = root_node self.map_nodes[parent] = root_node self.map_nodes[child] = child_node return parent_node = self.map_nodes[parent] child_node = Node(child) self.map_nodes[child] = child_node if dir == 'L': parent_node.left = child_node else: parent_node.right = child_node return if __name__ == '__main__': test_cases = int(input()) for cases in range(test_cases): n = int(input()) # number of nodes in tree a = list(map(str, input().strip().split())) # parent child info in list # construct the tree according to given list tree = Tree() i = 0 while (i < len(a)): parent = int(a[i]) child = int(a[i + 1]) dir = a[i + 2] i += 3 tree.Insert(parent, child, dir) # Insert the nodes in tree. LeftView(tree.root) print() ''' # Node Class: class Node: def __init__(self,val): self.data = val self.left = None self.right = None '''
true
3a0ff29ee1ef3c21586885d3190e3e537b0b347b
Python
geolee1/Covid-Entry-Log
/src/console/SearchConsole.py
UTF-8
1,634
3.359375
3
[ "MIT" ]
permissive
from core.database import find_db, time_search_db, get_all_db from core.person import print_person from core.setting import get_search_time from core.tools import menu_input, yes_or_no, clear def type_input() -> str: while True: user_input = input("검색할 항목을 선택하세요. (이름/전화번호/날짜/모두)\n>> ") if user_input == "이름" or user_input.lower() == "name": return "name" elif user_input == "전화번호" or user_input.lower() == "phone": return "phone" elif user_input == "날짜" or user_input.lower() == "date": return "date" elif user_input == "모두" or user_input.lower() == "all": return "all" else: print("없는 항목입니다.\n") def search_person(): while True: clear() type = type_input() if type == "all": persons = get_all_db() else: print() value = input("검색할 내용을 입력하세요.\n>> ") persons = find_db(type, value) print_person(persons, index=True) if persons != []: select = menu_input( f"선택한 사람으로부터 {get_search_time()} 시간 동안 출입한 사람을 검색합니다.\n검색할 사람의 번호를 입력해주세요.", 0, len(persons)-1) time_persons = time_search_db(persons[select]) print_person(time_persons) if yes_or_no("다시 검색하시겠습니까?"): continue else: return
true
b383ea732e760828c027104f515a2ebdc9b2af94
Python
sasazlat/UdacitySolution-ITSDC
/data_structure/other_data_structures.py
UTF-8
5,563
4.34375
4
[]
no_license
# coding: utf-8 # # Other Data Structures [optional] # # The purpose of this notebook is to show you some of the many other data # structures you can use without going into too much detail. You can learn # more by reading [documentation from Python's collections # library](https://docs.python.org/3.3/library/collections.html). # ## 1. Tuples # # The only standard library data structure that we haven't discussed. The # tuple is an immutable (unchangeable) sequence of Python objects. # # The tuple is very similar to a list. You can read more about it in the # [Python tuple # documentation](https://docs.python.org/3/tutorial/datastructures.html#tuples-and-sequences) # In[ ]: # tuples are created with (parentheses) my_tuple = (1,2,3) print(my_tuple) print(type(my_tuple)) # In[ ]: # elements can be accessed just like they are with lists. print(my_tuple[0]) print(my_tuple[1]) print(my_tuple[2]) # In[ ]: # there are some things you can't do with tuples # due to them being immutable. my_tuple[1] = 4 # In[ ]: # but there are also some things you CAN do with tuples # that you can't do with lists... t1 = ('a','b','c') t2 = (1, 2, 3) set_of_tuples = set() set_of_tuples.add(t1) set_of_tuples.add(t2) print(set_of_tuples) # In[ ]: L1 = ['a','b','c'] L2 = [1, 2, 3] set_of_lists = set() set_of_lists.add(L1) set_of_lists.add(L2) print(set_of_lists) # ## 2. Namedtuple # # Very similar to a tuple except the fields can be named as well! I use # namedtuples when I want to use `object.property` notation but don't want to # define a full class. # In[ ]: # named tuple's need to be imported from the collections library from collections import namedtuple # here we define Point as a new type of thing. # It has properties x and y. Point = namedtuple("Point", ["x", "y"]) # here we actually instantiate a point p1 = Point(5, -3) print(p1) # In[ ]: # there are two ways to access the fields in a point... # ... by position print(p1[0]) print(p1[1]) # In[ ]: # ... or by name print(p1.x) print(p1.y) # ## 3. Counter # Often we want to count how many times something occurs. The code below # demonstrates how to use a `Counter` to count the number of occurrences of # various characters in a string. # In[ ]: from collections import Counter string = "the quick brown fox jumped over the lazy dog" character_counter = Counter() for character in string: character_counter[character] += 1 character_counter.most_common() # It looks like this string had 8 spaces, 4 e's, 4 o's, etc... # In[ ]: # something that's nice about counters is that they don't throw # an error if you try to access a key that isn't there. Instead # they return 0. # how many capital A's are in the string above? print(character_counter["A"]) # In[ ]: # but how many lowercase a's? print(character_counter["a"]) # ## 4. defaultdict # # A default dict is best explained by example. Let's go back to the "three # boxes of tickets" example from earlier. # In[ ]: TICKET_BOXES = { "low" : [], "medium" : [], "high" : [] } unfiled_tickets = [{ "priority" : "high", "description" : "slammed on brakes" }, { "priority" : "low", "description" : "windshield chipped" }, { "priority" : "low", "description" : "failed to use turn signal" } , { "priority" : "medium", "description" : "did not come to complete stop at stop sign" }] def file_ticket(ticket): priority = ticket['priority'] TICKET_BOXES[priority].append(ticket) for ticket in unfiled_tickets: file_ticket(ticket) print(TICKET_BOXES) # In[ ]: # so far so good! But what if we try to file a ticket # with a priority "highest" (as we saw in Jira)? new_ticket = { "priority" : "highest", "description": "vehicle crashed!" } file_ticket(new_ticket) # In[ ]: # as expected, we get a key error... one way to fix this # is as follows def file_ticket_fixed(ticket): priority = ticket['priority'] # new code if priority not in TICKET_BOXES: TICKET_BOXES[priority] = [] TICKET_BOXES[priority].append(ticket) file_ticket_fixed(new_ticket) print(TICKET_BOXES) # In[ ]: # OR we can use a "defaultdict" from collections import defaultdict TICKET_BOXES = defaultdict(list) # notice the argument of list... def file_ticket(ticket): priority = ticket['priority'] TICKET_BOXES[priority].append(ticket) for ticket in unfiled_tickets: file_ticket(ticket) file_ticket(new_ticket) print(TICKET_BOXES) # When you try to access a key that doesn't exist, defaultdict adds that key to # the dictionary and associates a **default** value with it (in this case a # list). # # If you want to learn more you can read the [documentation on # defaultdict](https://docs.python.org/3.3/library/collections.html#collections.defaultdict) # ## 5. Other data structures from `collections` # In[ ]: from collections import deque, OrderedDict # In[ ]: d = deque([4,5,6]) print(d) # In[ ]: d.append(7) print(d) # In[ ]: d.appendleft(3) print(d) # In[ ]: last = d.pop() print("last element was", last) print("now d is", d) # In[ ]: first = d.popleft() print("first element was", first) print("now d is", d) # In[ ]: # # # # # # In[ ]: od = OrderedDict() # In[ ]: od['a'] = 1 od['b'] = 2 od['c'] = 3 # In[ ]: # as the name implies, an OrderedDict is a dictionary that # keeps track of the order in which elements were added. print(od)
true
92df7e86f102356fa8dc4d1f29c47f3398dac423
Python
andreu-gonzalez/socio
/sociocontroller.py
UTF-8
1,905
2.984375
3
[]
no_license
from socio import socio class sociocontroller: def __init__(self): self.listasocios={} self.productos={'naranja':5,'platano':10,'manzana':3} def addsocio(self,socio): if socio.getIdsocio() not in self.listasocios: if socio.getDni() not in self.listasocios: self.listasocios[socio.getIdsocio()] = socio return True return False def borrarsocio(self,id_socio): if id in self.listasocios: del self.listasocios[id_socio] return True return False def listar(self): return self.listasocios def registrarsocio(self,id_socio,nombre,kilos): if id_socio in self.listasocios: if nombre in self.productos: self.listasocios[id_socio].setRegistro(nombre,kilos) return True return False return False def lisrarproductos(self): for key in self.productos: print (key, ":", self.productos[key]) def actualizasaldo(self,id_socio): saldo=0.0 if id_socio in self.listasocios: for clave,valor in self.listasocios[id_socio].getregistro().items(): saldo+= self.productos[clave] * float(valor) self.listasocios[id_socio].actualizaSaldo(saldo) self.listasocios[id_socio].delRegistros() return True return False def fichaSocio(self,id_socio): socio="" if id_socio in self.listasocios: for clave,valor in self.listasocios.items(): socio = ("Id_socio: "+valor.getIdsocio()+"tDni: "+valor.getDni()+"Nombre: "+valor.getNombre()+"Apellidos: "+valor.getApellido()+"fecha: "+str(valor.getFecha())+"Saldo: "+str( "{:10.2f}".format(valor.getSaldo()))+"Registros Pendientes: "+str(valor.getregistro())) return socio
true
85235c00e1aedc41ff781a44dc38b26cb82476c8
Python
Jozkings/wag
/degrees.py
UTF-8
2,124
3.578125
4
[]
no_license
class Degrees(object): """object for saving degree informatians about graph""" def __init__(self, graph): self.max_degree_node = None self.max_degree_value = float("-inf") self.min_degree_node = None self.min_degree_value = float("inf") self.avg_degree = 0 self.degrees = {} self.graph_ref = graph self.compute_degrees() def get_degree(self, node): """returns degree of node""" """:param node: node of the graph""" return self.degrees[node] def get_degrees(self): """returns all nodes degrees as dictionary""" return self.degrees def get_min_degree(self): """returns minimal degree as pair: node, node degree value""" return self.min_degree_node, self.min_degree_value def get_max_degree(self): """returns maximum degree as pair: node, node degree value""" return self.max_degree_node, self.max_degree_value def get_avg_degree_value(self): """returns average degree value of nodes""" return self.avg_degree def get_stats_degrees(self): """returns maximum and minimal degree as pair: node, node degree value and average degree value""" return (self.max_degree_node, self.max_degree_value), \ (self.min_degree_node, self.min_degree_value), self.avg_degree def compute_degrees(self): """computes degrees of nodes in graph and saves them (together with minimal, maximum and avarage degree)""" degree_sum = 0 for key in self.graph_ref: degree = len(self.graph_ref[key]) self.degrees[key] = degree if degree < self.min_degree_value: self.min_degree_value = degree self.min_degree_node = key if degree > self.max_degree_value: self.max_degree_value = degree self.max_degree_node = key degree_sum += degree self.avg_degree = round(degree_sum / len(self.degrees), 5) if len(self.degrees) > 0 else 0
true
64f42544224f6681c30780e7e21b6b0d56d3d7c2
Python
davidliii/Automatic-INO-Deploy
/arduino_command_line.py
UTF-8
2,200
2.875
3
[]
no_license
#=================================================================================================== # Developped by: David Li # Email: davidli2881@gmail.com # Date: 1/14/2020 # # This is a lightweight arduino command line interface, created with the purpose of # selecting LED strip patterns more easily (as each pattern uses a different .ino file) # Goal of this project is to eventually develop a GUI that allows a user to select a # folder containing all of the LED patterns they wish to cycle through, adjust upload # parameters, and run any sketch without needing to open the IDE. A naive saving method # will be implemented by creating a save.txt file containing information about previous # upload preferences and previously loaded folders. The save.txt will be compiled using json #objects and updated everytime a new folder is uploaded/deleted or preferences change. # Important setup: # Arduino program folder must be set to environment PATH # Com port number needs to be predetermined (automatic detection in the future) # #=================================================================================================== import subprocess import os def open_ide(): #opens the arduino IDE os.system("arduino") def open_ino(*filepaths): #open input files in arduino IDE for file in filepaths: command_name = "arduino " + file os.system(command_name) def upload_ino(board, chip, port, filepath): #compiles and uploads sketch according to user parameters board_command = parse_board_flag(board, chip) port_command = parse_port_flag(port) upload_command = parse_upload_flag(filepath) command_name = "arduino" + board_command + port_command + upload_command os.system(command_name); def parse_board_flag(board, chip): #generates board selection command command = " --board arduino:avr:" + board + ":cpu=" + "chip" return command def parse_port_flag(port): #generates port selection command command = " --port " + port return command def parse_upload_flag(filepath): #generates upload selection command commmand = " --upload " + filepath return command if __name__ == "__main__": os.system("arduino --version")
true
fd1622a3b7788afd4d3675257b60519f7d66842d
Python
Scarygami/aoc2019
/19/19.py
UTF-8
1,686
3.046875
3
[ "Apache-2.0" ]
permissive
import os import sys currentdir = os.path.dirname(os.path.abspath(__file__)) parentdir = os.path.dirname(currentdir) sys.path.insert(0, parentdir) try: from lib.intcode import IntcodeVM except ImportError: print("Intcode library could not be found") exit(1) def check_square(machine, startx, starty, size=100): if not check_row(machine, startx, starty, size): return False if not check_row(machine, startx, starty + size - 1, size): return False return True def check_row(machine, startx, y, size=100): if not check_field(machine, startx, y): return False if not check_field(machine, startx + size - 1, y): return False return True def check_field(machine, x, y): if machine.run([x, y]) == [1]: return True return False def find_square(machine, size=100): y = -1 minx = 0 while True: y = y + 1 startx = None for x in range(minx, minx + 5): if check_field(machine, x, y): startx = x minx = x break if startx is None: # No tractor beam in this row continue x = startx while check_row(machine, x, y, size): if check_square(machine, x, y, size): return (x, y) x = x + 1 machine = IntcodeVM(IntcodeVM.read_intcode(os.path.join(currentdir, "input.txt")), silent=True) affected = [] for y in range(50): for x in range(50): if check_field(machine, x, y): affected.append((x, y)) print("Part 1: %s" % len(affected)) x, y = find_square(machine, 100) print("Part 2: %s" % (x * 10000 + y))
true
25fd0539a07bcf835d5a104adba05848f89e20fb
Python
littlesnell/learngit
/python/ceshi_little.py
UTF-8
2,182
3.078125
3
[]
no_license
#!/usr/bin/env python #encoding=utf-8 # 导入MySQL驱动 import MySQLdb #进行连接数据库 conn = MySQLdb.connect(host="localhost",user="root",passwd="111111",db="littledog",port=3306,charset="utf8") cursor = conn.cursor() # 创建用户表 #cursor.execute('create table ceshi (id varchar(20) primary key, name varchar(20),age int,class varchar(50))') # 菜单选择 a = 1#防止while无法正常运行 while a!=5: print "1-查询数据" print "2-修改数据" print "3-删除数据" print "4-增添数据" print "5-退出" a = input("请输入你的选择:") if a==1:#有问题 # 运行查询: print "请选择查询的方式" print "1-按ID查询" print "2-按姓名查询" print "3-按年龄查询" print "4-按班级查询" b =input( "请输入你的选择") if b==1: id = raw_input('请输入你要查询的ID:') cursor.execute('select * from ceshi where id = %s',id) values = cursor.fetchall() print values if b==2: name = raw_input('请输入你要查询的姓名') cursor.execute('select * from ceshi where name = %s',name) if b==3: age = raw_input('请输入你要查询的年龄') cursor.execute('select * from ceshi where age = %s',age) if b==4: classes = raw_input('请输入你要查询的班级') cursor.execute('select * from ceshi where class = %s',classes) cursor = conn.cursor() cursor.execute('select * from ceshi where id = %s','1' ) values = cursor.fetchall() #if a==2: if a==3: # 删除数据 id = raw_input('请输入你要删除数据的ID:') cursor.execute('delete * from ceshi where id = %s',id) if a==4: # 插入数据 id = raw_input('id:') name = raw_input('name:') age = raw_input('age:') classes = raw_input('class:') cursor.execute('insert into ceshi (id,name,age,class) values (%s,%s,%s,%s)',[id,name,age,classes]) #提交事物 conn.commit() if a==5: exit
true
4e2204630faf0c48b5157bfce5672d0ce3498a82
Python
roni-kemp/python_programming_curricula
/CS1/0200_turtles/project_turtle_funny_face/student_code/funny_face_BCS.py
UTF-8
2,041
3.734375
4
[ "MIT" ]
permissive
#Brendan Clark-Slakey #9/27/2017 # Funny Face Project import turtle, time #Create and name a variable for the turtle tommy = turtle.Turtle() tommy.shape("turtle") #All our circles will be this size size = 30 #Draw the right eye tommy.penup() tommy.color("red") tommy.fillcolor("red") tommy.goto(200,70) tommy.begin_fill() tommy.pendown() tommy.circle(size) tommy.penup() tommy.end_fill() #draw the right eyebrow tommy.penup() tommy.color("black") tommy.goto(175,125) tommy.setheading(-45) tommy.pensize(10) tommy.pendown() tommy.left(75) tommy.fd(75) #Draw the left eye tommy.penup() tommy.color("red") tommy.fillcolor("red") tommy.goto(0,70) tommy.pensize(1) tommy.begin_fill() tommy.pendown() tommy.circle(size) tommy.penup() tommy.end_fill() #draw the left eyebrow tommy.penup() tommy.color("black") tommy.goto(0,125) tommy.setheading(-45) tommy.pensize(10) tommy.pendown() tommy.right(155) tommy.fd(75) #Draw the smile tommy.penup() tommy.color("black") tommy.goto(50,0) tommy.setheading(-45) tommy.pensize(10) tommy.pendown() tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) tommy.fd(5) tommy.left(5) #draw one of the horns tommy.penup() tommy.color("red") tommy.goto(175,200) tommy.setheading(80) tommy.pensize(10) tommy.pendown() tommy.fd(50) tommy.right(130) tommy.fd(50) #draw the other horn tommy.penup() tommy.color("red") tommy.goto(-50,200) tommy.setheading(60) tommy.pensize(10) tommy.pendown() tommy.fd(50) tommy.right(130) tommy.fd(50) #Makes turtle not visible in final product tommy.shape("circle") tommy.shapesize(.01) time.sleep(4) #Wait some number of seconds to see the result?
true
e5e5105913dea8c99b217f5759f92190e1c8c7d3
Python
peterk87/blast2xl
/blast2xl/util.py
UTF-8
233
2.875
3
[ "MIT" ]
permissive
from typing import Mapping, Dict, Any, Set def invert_dict(d: Mapping) -> Dict[Any, Set]: out = {} for k, v in d.items(): if v in out: out[v].add(k) else: out[v] = {k} return out
true
7be5aa5b585cc292f8af5679a5fdbd87f8f6c562
Python
arita37/d-script
/recurnets/basic_recurrent.py
UTF-8
5,622
3.03125
3
[ "Apache-2.0" ]
permissive
# coding: utf-8 # # Basic Recurrent Neural Network # # Testing out original code for a simple LSTM to understand the sequential writing of an author from left to right. (To do: bi-directional recurrent LSTMs.) # # Details: # We require two additional layers that I've written to make the dimensions of the input to other layers consistent. # ### Imports # In[1]: import pickle import numpy import keras import time from keras.models import Sequential from keras.layers.core import Dense, Dropout, Activation, Flatten from keras.layers.convolutional import Convolution2D, MaxPooling2D from keras.optimizers import SGD from keras.utils.np_utils import to_categorical from keras.layers.normalization import BatchNormalization as BN from keras.layers.core import Layer from keras.layers.recurrent import LSTM import theano.tensor as T import h5py import random import numpy as np from collections import defaultdict from minibatcher import MiniBatcher import matplotlib.pylab as plt # get_ipython().magic(u'matplotlib inline') # ### New Keras layers for use in the recurrent network # In[2]: class Squeeze(Layer): ''' Get rid of any dimensions of size 1. First dimension is assumed to be nb_samples. ''' def __init__(self, **kwargs): super(Squeeze, self).__init__(**kwargs) @property def output_shape(self): input_shape = self.input_shape data_shape = tuple( np.array(input_shape)[ np.array(input_shape) > 1 ] ) return (input_shape[0],)+ data_shape def get_output(self, train=False): X = self.get_input(train) # size = T.prod(X.shape) // X.shape[0] # nshape = (X.shape[0], size) # return T.reshape(X, output_shape) return X.squeeze() class Transpose3(Layer): ''' Get rid of any dimensions of size 1. First dimension is assumed to be nb_samples. ''' def __init__(self, transpose_order, **kwargs): self.transpose_order = transpose_order super(Transpose3, self).__init__(**kwargs) @property def output_shape(self): input_shape = self.input_shape data_shape = () for j in self.transpose_order: data_shape+=(input_shape[j],) return data_shape def get_output(self, train=False): X = self.get_input(train) # size = T.prod(X.shape) // X.shape[0] # nshape = (X.shape[0], size) # return T.reshape(X, output_shape) return X.transpose(self.transpose_order) # ### Data (40 authors, 15 forms per author) # In[3]: num_authors=40 num_forms_per_author=15 hdf5_file = '/work/data/output_shingles_sparse.hdf5' fIn = h5py.File(hdf5_file, 'r') authors = [] # Filter on number of forms per author for author in fIn.keys(): if len(fIn[author]) > num_forms_per_author: authors.append(author) if len(authors) < num_authors: raise ValueError("There are only %d authors with more than %d forms"%(len(authors), num_forms_per_author)) keys = [] # Get all the keys from our hdf5 file for author in authors[:num_authors]: # Limit us to num_authors forms = list(fIn[author]) for form in forms[:num_forms_per_author]: # Limit us to num_form_per_author for line_name in fIn[author][form].keys(): for shingle in range(fIn[author][form][line_name].shape[0]): keys.append([(author,form,line_name), shingle]) # Normalization function which scales values from 0 (white) to 1 (black) normalize = lambda x: 1.0 - x.astype(np.float32)/255.0 m = MiniBatcher(fIn, keys,normalize=normalize, batch_size=32, min_shingles=20*7*num_forms_per_author) m.batch_size = 32*20 m.set_mode(MiniBatcher.TEST) [X_test, Y_test] = m.get_batch() X_test = np.expand_dims(X_test, 1) Y_test = to_categorical(Y_test, num_authors) print 'test_size:', X_test.shape, Y_test.shape m.batch_size = 32*100 m.set_mode(MiniBatcher.TRAIN) # ### Define the neural network # # #### Current architecture # 1. Convolution2D (48, 12, 12) + Relu + MaxPool (2,2) # 2. Convolution2D (48, 6, 6 ) + Relu + MaxPool (2,2) # 3. Convolution2D->1D (48, 6, 35) + Relu # In[4]: model = Sequential() model.add(Convolution2D(48, 12, 12, border_mode='full', input_shape=(1, 120, 120), activation='relu')) model.add(MaxPooling2D(pool_size=(2,2))) model.add(Convolution2D(48, 6, 6, border_mode='full', activation='relu')) model.add(MaxPooling2D(pool_size=(2,2))) # model.add(MaxPooling2D(pool_size=(70,2))) model.add(Convolution2D(48, 6, 35, activation='relu')) model.add(Squeeze()) model.add(Transpose3((0,2,1))) model.add(LSTM(output_dim=48, activation='sigmoid', inner_activation='hard_sigmoid')) model.add(Dense(40, activation='softmax')) sgd = SGD(lr=0.015, decay=1e-6, momentum=0.5, nesterov=True) model.compile(loss='categorical_crossentropy', optimizer=sgd) print "Finished compilation with optimization set to SGD" model.load_weights('basic_recurrent.hd5') m.batch_size = 32*100 m.set_mode(MiniBatcher.TRAIN) for i in range(500): print 'Starting Epoch: ', i start_time = time.time() (X_train, Y_train) = m.get_batch() X_train = np.expand_dims(X_train, 1) Y_train = to_categorical(Y_train, num_authors) print X_train.shape, Y_train.shape model.fit(X_train, Y_train, batch_size=32, nb_epoch=1, show_accuracy=True, verbose=1, validation_data=(X_test, Y_test)) print 'Elapsed Time: ', time.time() - start_time if numpy.mod(i,50)==0: print "Checkpoint at"+str(i) model.save_weights('basic_recurrent'+str(i)+'.hd5')
true
e715d9b161daafa82f24e07e3cb1ff9996609e03
Python
TeamKun/MineTexTool
/main.py
UTF-8
1,922
2.703125
3
[]
no_license
import glob import os import shutil as ut import numpy as np from PIL import Image def md(path): if not os.path.isdir(path): os.makedirs(path) print("makedir: " + path) size = float(input()) for name in glob.glob('assets/**/*.png', recursive=True): if size < 1.0: img = Image.open(name) height = int(img.height*size) width = int(img.width*size) if height < 1: height = 1 if width < 1: width = 1 resize = img.resize((width, height), Image.LANCZOS) # resize = img.resize((width, height), Image.NEAREST) out = "out\\" + str(size) + "\\" + name pathlist = out.split('\\') del pathlist[-1] mdpath = "" for st in pathlist: mdpath = mdpath + st + "\\" md(mdpath) resize.save(out) print("resize Pillow->" + str(size) + "x" + str(size) + " : " + name) else: image = np.asarray(Image.open(name).convert("RGB"), dtype=np.uint8) zoomed_image = image.repeat(size, axis=0).repeat(size, axis=1) resize = Image.fromarray(zoomed_image) out = "out\\" + str(size) + "\\" + name pathlist = out.split('\\') del pathlist[-1] mdpath = "" for st in pathlist: mdpath = mdpath + st + "\\" md(mdpath) resize.save(out) print("resize Numpy->" + str(size) + "x" + str(size) + " : " + name) # mcmeta for name in glob.glob('assets/**/*.mcmeta', recursive=True): out = "out\\" + str(size) + "\\" + name pathlist = out.split('\\') del pathlist[-1] mdpath = "" for st in pathlist: mdpath = mdpath + st + "\\" md(mdpath) ut.copyfile(name, out) print("mcmeta copy->" + str(out))
true
3da103b85a9f322bea8709b48a3ff00551eff581
Python
leejz/misc-scripts
/randomize_fasta.py
UTF-8
2,786
3.265625
3
[ "MIT" ]
permissive
#!/usr/bin/env python """ -------------------------------------------------------------------------------- Created: Jackson Lee 12/4/12 This script reads in a fasta file and randomizes the lines Input fasta file format: 4098968.combined_unique.fa >Sequence0000000001 GCGCCCCTACGGGGAACGTTTTACTTCCAGTTTTAAAGCAGCTTTTACCCATCCAAACTCTGCGGTAACTTTATCATAAATTGTGGTAATATCTTCTGAT Output file format: same -------------------------------------------------------------------------------- usage: randomize_fasta.py -i input.fa -o output_fasta """ #------------------------------------------------------------------------------- #Header - Linkers, Libs, Constants from string import strip from argparse import ArgumentParser, RawDescriptionHelpFormatter from random import shuffle #------------------------------------------------------------------------------- #function declarations #------------------------------------------------------------------------------- #Body print "Running..." if __name__ == '__main__': parser = ArgumentParser(usage = "randomize_fasta.py -i input.fa -o output.fa", description=__doc__, formatter_class=RawDescriptionHelpFormatter) parser.add_argument("-i", "--input_fasta", action="store", dest="inputfilename", help="fasta file of input sequences") parser.add_argument("-o", "--output_fasta", action="store", dest="outputfilename", help="output fasta file name") options = parser.parse_args() mandatories = ["inputfilename", "outputfilename"] for m in mandatories: if not options.__dict__[m]: print "\nError: Missing Arguments\n" parser.print_help() exit(-1) fastafilename = options.inputfilename outputfilename = options.outputfilename print "Reading Fasta file..." with open(fastafilename,'U') as fastainfile: fasta_lines = [line.strip() for line in fastainfile] large_fasta = [] header = '' fasta = '' for iter, line in enumerate(fasta_lines): if line[0] == '>': if iter > 0: large_fasta.append([header,fasta]) header = line fasta = '' else: fasta = fasta + line if iter == len(fasta_lines)-1: large_fasta.append([header,fasta]) print 'last line!' print "Writing randomized Fasta file: " + outputfilename shuffle(large_fasta) with open(outputfilename, 'w') as outfile: for fastaline in large_fasta: outfile.write(fastaline[0]+'\n') outfile.write(fastaline[1]+'\n') print "Done!"
true
85ce3bb57a6072a065f82a2f089d28040170cdb3
Python
phlax/aio.signals
/aio/signals/tests/test_signals.py
UTF-8
3,398
2.703125
3
[]
no_license
import unittest import asyncio import aio.testing from aio.signals import Signals class AioSignalsTestCase(unittest.TestCase): def test_listen(self): def signal_called(signal): pass signals = Signals() signals.listen('test-signal', signal_called) self.assertEqual( signals._signals, {"test-signal": set([signal_called])}) def test_listen_again(self): def signal_called(signal): pass signals = Signals() signals.listen('test-signal', signal_called) signals.listen('test-signal', signal_called) self.assertEqual( signals._signals, {"test-signal": set([signal_called])}) def test_unlisten(self): def signal_called(signal): pass def signal_called2(signal): pass signals = Signals() signals.listen('test-signal', signal_called) signals.listen('test-signal', signal_called2) signals.unlisten('test-signal', signal_called) self.assertEqual( signals._signals, {"test-signal": set([signal_called2])}) def test_unlisten_again(self): """ calling signals.unlisten twice does nothing """ def signal_called(): pass def signal_called2(): pass signals = Signals() signals.listen('test-signal', signal_called) signals.listen('test-signal', signal_called2) signals.unlisten('test-signal', signal_called) signals.unlisten('test-signal', signal_called) self.assertEqual( signals._signals, {"test-signal": set([signal_called2])}) def test_unlisten_missing_signal(self): """ if signals.unlisten is called with non-existent signal silently ignore """ def signal_called(): pass signals = Signals() signals.listen('test-signal', signal_called) signals.unlisten('FOO-SIGNAL', signal_called) self.assertEqual( signals._signals, {"test-signal": set([signal_called])}) def test_unlisten_missing_func(self): """ if signals.unlisten is called with non-existent callback func silently ignore """ def signal_called(): pass def signal_called2(): pass signals = Signals() signals.listen('test-signal', signal_called) signals.unlisten('test-signal', signal_called2) self.assertEqual( signals._signals, {"test-signal": set([signal_called])}) @aio.testing.run_until_complete def test_emit(self): """ """ class Checker: signal = None args = None checker = Checker() @asyncio.coroutine def signal_called(signal): yield from asyncio.sleep(2) checker.signal = signal.name checker.args = signal.data return "done" signals = Signals() signals.listen('test-signal', signal_called) result = yield from signals.emit('test-signal', "EXPECTED RESULT") self.assertEqual(result, ["done"]) self.assertEqual(checker.signal, "test-signal") self.assertEqual(checker.args, "EXPECTED RESULT")
true
27955c81c418f80de63fcff5d29cc09590996d50
Python
clockworksspheres/ramdisk
/src/ramdisk/lib/libHelperExceptions.py
UTF-8
1,515
2.5625
3
[]
no_license
""" Class for ramdisk management specific creations Should be OS agnostic @author: Roy Nielsen """ class UnsupportedOSError(Exception): """ Meant for being thrown when an action/class being run/instanciated is not applicable for the running operating system. @author: Roy Nielsen """ def __init__(self, *args, **kwargs): Exception.__init__(self, *args, **kwargs) class NotValidForThisOS(Exception): """ Meant for being thrown when an action/class being run/instanciated is not applicable for the running operating system. @author: Roy Nielsen """ def __init__(self, *args, **kwargs): Exception.__init__(self, *args, **kwargs) class SystemToolNotAvailable(Exception): """ Meant for being thrown when a system command is not available for use by the library. @author: Roy Nielsen """ def __init__(self, *args, **kwargs): Exception.__init__(self, *args, **kwargs) class NotEnoughMemoryError(Exception): """ Thrown when there is not enough memory for this operation. @author: Roy Nielsen """ def __init__(self, *args, **kwargs): Exception.__init__(self, *args, **kwargs) class NotACyLoggerError(Exception): """ Custom Exception """ def __init__(self, *args, **kwargs): Exception.__init__(self, *args, **kwargs) class UserMustBeRootError(Exception): """ Custom Exception """ def __init__(self, *args, **kwargs): Exception.__init__(self, *args, **kwargs)
true
a891507491a0dd3ffb583adb51caf021734d79dc
Python
israelferrazaraujo/dcsp
/quantum classifier/cin/pennylane/templates/dc_hqc.py
UTF-8
1,175
2.59375
3
[]
no_license
import pennylane as qml from pennylane import numpy as np from cin.pennylane.qml.hierarchical_classifier import circuit as circuit_hierarchical_classifier from cin.pennylane.encoding.divide_and_conquer import Encoding def config(X): n = int(np.ceil(np.log2(len(X[0])))) # pylint: disable=no-member n = 2**int(np.ceil(np.log2(n))) # n tem que ser potência de 2. # pylint: disable=no-member N = 2**n-1 # len(X[0])-1 # N precisa ser tal que n seja potência de 2 mais próxima de log_2(X[0]). O hierarchical exige que n seja dessa maneira. w = 2*n - 1 # número de parâmetros do circuito (weights) X = np.c_[X, np.zeros((len(X), 2**n-len(X[0])))] # o número de qubits necessários para codificar os dados (log_2(N)) precisa ser uma potencia de 2. # pylint: disable=no-member return n, N, w, X def circuit(weights, state_vector=None, n=4): encode = Encoding(state_vector, 'dc_amplitude_encoding', entangle=True) q = encode.output_qubits # o comprimento de q deve ser igual a n. return circuit_hierarchical_classifier(n , q, weights)
true
bd9ea365241d35234622b0938ed9229256051be8
Python
gdamjan/Scalable
/Echo/client-old.py
UTF-8
918
3.015625
3
[ "MIT" ]
permissive
#! /usr/bin/env python import asyncore, socket class Client(asyncore.dispatcher_with_send): def __init__(self, host, port, message, n): asyncore.dispatcher.__init__(self) self.create_socket(socket.AF_INET, socket.SOCK_STREAM) self.connect((host, port)) self.out_buffer = message self.N = n def handle_close(self): self.N = self.N - 1 self.close() def handle_read(self): self.N = self.N - 1 buf = self.recv(1024) print 'Received: %s' % buf if self.N == 0: raise "STOP" # self.close() # so I'm not closing it def main(n): host, port = 'localhost', 9901 print "Opening %d connections to %s:%d" % (n, host, port) for i in xrange(n): Client(host, port, 'Hello, world!', n) asyncore.loop() import sys try: main(int(sys.argv[1])) except KeyboardInterrupt: sys.exit(0)
true
4dea064d0ba3a8536ada5cbcedcc567be4c0fe8c
Python
RomanYatsuniak/physics-projects
/4/Project.py
UTF-8
4,615
2.765625
3
[]
no_license
import numpy as np import io from sympy import * import sympy import matplotlib.pyplot as plt import math s = io.BytesIO(open('input.txt', 'rb').read().replace(b',', b';').replace(b')', b' ').replace(b'(', b' ').replace(b'[',b' ').replace(b']', b' ')) data1 = np.genfromtxt(s, dtype=(float, float,float, float, float, float, float, float, float, float, float, float, float, float, float, float),delimiter=";") Array=[] g=9.81 G=6.7*(10**(-11)) x0 = 10 y0 = 10 V0x = 0 V0y = 0 m1 = 100 x1 = 20 y1 = 10 V1x = 0 V1y = 0 m2 = 300 x3 = 15 y3 = 0 V2x = 0 V2y = 0 m3 = 150 T=80 res_x=[] res_y=[] res_x2=[] res_y2=[] res_x3=[] res_y3=[] i=0.001 V00=sqrt((V0x**2)+(V0y**2)) V01=sqrt((V1x**2)+(V1y**2)) V02=sqrt((V2x**2)+(V2y**2)) a0=V00/T a1=V01/T a2=V02/T x1c=0 y1c=0 x2c=0 y2c=0 Bit1=False Bit2=False Bit3=False while i<=T: if(Bit1==False): x_r_1=x0+V0x*i+(a0*(i**2))/2 y_r_1=y0+V0y*i+(a0*(i**2))/2 res_x.append(x_r_1) res_y.append(y_r_1) if(Bit2==False): x_r_2=x1+V1x*i+(a1*(i**2))/2 y_r_2=y1+V1y*i+(a1*(i**2))/2 res_x2.append(x_r_2) res_y2.append(y_r_2) if(Bit3==False): x_r_3=x3+V2x*i+(a2*(i**2))/2 y_r_3=y3+V2y*i+(a2*(i**2))/2 res_x3.append(x_r_3) res_y3.append(y_r_3) if(x_r_1>=x_r_2 and y_r_1>=y_r_2 or x_r_1>=x_r_2 and y_r_1<=y_r_2 or x_r_1<=x_r_2 and y_r_1>=y_r_2 or x_r_1<=x_r_2 and y_r_1<=y_r_2 ): Beta=(x_r_1+x_r_2)/(y_r_1+y_r_2) Beta=np.arctan(int(Beta)) V00=V00*np.cos(Beta) Bit2==True x1c=x_r_1 y1c=y_r_1 X1=True if(x_r_1>=x_r_3 and y_r_1>=y_r_3 or x_r_1>=x_r_3 and y_r_1<=y_r_3 or x_r_1<=x_r_3 and y_r_1>=y_r_3 or x_r_1<=x_r_3 and y_r_1<=y_r_3 ): Beta=(x_r_1+x_r_3)/(y_r_1+y_r_3) Beta=np.arctan(int(Beta)) V00=V00*np.cos(Beta) Bit3==True x1c=x_r_1 y1c=y_r_1 X1=True if(x_r_2>=x_r_3 and y_r_2>=y_r_3 or x_r_2>=x_r_3 and y_r_2<=y_r_3 or x_r_2<=x_r_3 and y_r_2>=y_r_3 or x_r_2<=x_r_3 and y_r_2<=y_r_3 ): Beta=(x_r_2+x_r_3)/(y_r_2+y_r_3) Beta=np.arctan(int(Beta)) V01=V01*np.cos(Beta) Bit3==True x1c=x_r_2 y1c=y_r_2 X2=True if(x_r_2>=x_r_1 and y_r_2>=y_r_1 or x_r_2>=x_r_1 and y_r_2<=y_r_1 or x_r_2<=x_r_1 and y_r_2>=y_r_1 or x_r_2<=x_r_1 and y_r_2<=y_r_1 ): Beta=(x_r_2+x_r_1)/(y_r_2+y_r_1) Beta=np.arctan(int(Beta)) V01=V01*np.cos(Beta) Bit1==True x1c=x_r_2 y1c=y_r_2 X2=True if(x_r_3>=x_r_1 and y_r_3>=y_r_1 or x_r_3>=x_r_1 and y_r_3<=y_r_1 or x_r_3<=x_r_1 and y_r_3>=y_r_1 or x_r_3<=x_r_1 and y_r_3<=y_r_1 ): Beta=(x_r_3+x_r_1)/(y_r_3+y_r_1) Beta=np.arctan(int(Beta)) V02=V02*np.cos(Beta) Bit3==True x1c=x_r_3 y1c=y_r_3 X3=True if(x_r_3>=x_r_2 and y_r_3>=y_r_2 or x_r_3>=x_r_2 and y_r_3<=y_r_2 or x_r_3<=x_r_2 and y_r_3>=y_r_2 or x_r_3<=x_r_2 and y_r_3<=y_r_2 ): Beta=(x_r_3+x_r_2)/(y_r_3+y_r_2) Beta=np.arctan(int(Beta)) V02=V02*np.cos(Beta) Bit2==True x1c=x_r_3 y1c=y_r_3 X3=True if(Bit2==True and Bit1==True or Bit2==True and Bit3==True or Bit3==True and Bit1==True or Bit3==True and Bit2==True or Bit1==True and Bit2==True or Bit1==True and Bit3==True): if(X3==True): x2c=x_r_3 y2c=y_r_3 if(X2==True): x2c=x_r_2 y2c=y_r_2 if(X1==True): x2c=x_r_1 y2c=y_r_1 T_k = i break i+=0.005 plt.figure(figsize=(15,15)) plt.scatter(res_x,res_y, 5, color='red') plt.scatter(res_x2,res_y2, 5, color='orange') plt.scatter(res_x3,res_y3, 5, color='blue') plt.savefig('1.png') array12 = np.array(['(' +str(round(x_r_1,2))+'('+str(round(T,2))+')'+', '+str(round(y_r_1,2))+'('+str(round(T,2))+')'+'); '+'('+str(round(V0x,2))+'('+str(round(T,2))+'), '+str(round(V0y,2))+'('+str(round(T,2))+')); '+'(' +str(round(x_r_2,2))+'('+str(round(T,2))+')'+','+str(round(y_r_2,2))+'('+str(round(T,2))+')); '+'('+str(round(V1x,2))+'('+str(round(T,2))+'), '+str(round(V1y,2))+'('+str(round(T,2))+')); '+'(' +str(round(x_r_3,2))+'('+str(round(T,2))+')'+', '+str(round(y_r_3,2))+'('+str(round(T,2))+')); '+'('+str(round(V2x,2))+'('+str(round(T,2))+'), '+str(round(V2y,2))+'('+str(round(T,2))+')); '+'('+str(round(x1c,2))+', '+str(round(y1c,2))+'); ('+str(round(x2c,2))+', '+str(round(y2c,2))+');']) print(array12) np.savetxt('output.txt', array12, delimiter='', fmt="%s")#
true
8981e87b88ac1ef036c1d88e80c017870be53590
Python
unblest/python
/ex15.py
UTF-8
635
4
4
[]
no_license
# exercise 15: reading files # import the argument variable per "normal" from sys import argv # define the input for the file name we're going to read script, filename = argv # define and new variable with the open verb which is new txt = open(filename) # print the contents of the file print "Here's your file %r:" % filename print txt.read() # now asks for the file name again and assigns to a new variable print "Type the file name again:" file_again = raw_input("> ") # define another variable to open the filename given txt_again = open(file_again) # print the results print txt_again.read() txt.close() txt_again.close()
true
0bcf8020288a8b32849d3debd40e22da7b705781
Python
CheKey30/leetcode
/0114/114.py
UTF-8
943
4.15625
4
[]
no_license
``` Given a binary tree, flatten it to a linked list in-place. For example, given the following tree: 1 / \ 2 5 / \ \ 3 4 6 The flattened tree should look like: 1 \ 2 \ 3 \ 4 \ 5 \ 6 ``` # Definition for a binary tree node. # class TreeNode: # def __init__(self, x): # self.val = x # self.left = None # self.right = None class Solution: def flatten(self, root: TreeNode) -> None: """ Do not return anything, modify root in-place instead. """ def preorder(root,res): if root: res.append(root) preorder(root.left,res) preorder(root.right,res) tmp = [] if not root: return preorder(root,tmp) n = len(tmp) for i in range(n-1): tmp[i].left = None tmp[i].right = tmp[i+1]
true
c8e606c100e756dcdad5b315f4ee3a6a7a95db80
Python
rsk2327/Blog
/MisclassCost/ClassExtractor.py
UTF-8
1,677
2.78125
3
[]
no_license
# -*- coding: utf-8 -*- """ Created on Tue Feb 9 20:14:18 2016 @author: rsk """ import cPickle import gzip import os import sys import time import numpy import theano import theano.tensor as T from collections import Counter from LogLayer import * dataset = "/home/rsk/Documents/MNIST/Misclassification/mnist.pkl.gz" f = gzip.open(dataset, 'rb') [(trainx,trainy),(validx,validy),(testx,testy)] = cPickle.load(f) f.close() #%% #train_set, valid_set, test_set def imbalance(data,label,digits={3:0.5,7:0.7}): """ Creates an imabalance in the data vector by selectively downsampling classes as given by the digits dictionary. The digits dictionary specifies by what ratio any particular class should be downsampled Returns the downsampled datasets and its corresponding labels """ classIndices=[] for i in range(10): classIndices.append([]) for i in range(len(data)): classIndices[label[i]].append(i) finalIndices=[] for i in range(10): if i in digits.keys(): n = int(len(classIndices[i])*digits[i]) finalIndices= finalIndices + classIndices[i][0:n] else: finalIndices = finalIndices + classIndices[i] return [data[finalIndices] , label[finalIndices]] #%% if __name__=="__main__": a = imbalance(trainx,trainy) # Checking if imbalance has been created or not balanced = Counter(trainy) imbalanced = Counter(a[1]) print "Balanced :" print balanced print "Imbalanced :" print imbalanced
true
687b18a9a0dd8bcb0c7b785313582760642c210d
Python
Aasthaengg/IBMdataset
/Python_codes/p02848/s105798212.py
UTF-8
138
3.203125
3
[]
no_license
n=int(input()) s=list(input()) # z=90=>65 for i in s: x=ord(i) y=x+n if y>90: z=chr(y-26) else: z=chr(y) print(z,end='')
true
b9b6daf6eb6d535c1a76a9f0d79b96b47c73389d
Python
darkangelcraft/SPLI-RSA
/Bruteforce attack/test.factor.py
UTF-8
191
3
3
[]
no_license
n = 100123 flag = True i = 2 if(n%2 == 0): i=2 flag=False i = i - 1 i = i + 1 while flag: print("Numero sotto test %i" %i) if (n%i == 0): flag=False else: i = i + 2 print("i %d" %i)
true
56369b5e1b657f5ba1a66167bb44eee995a38071
Python
diogobaeder/moneypertime
/moneypertime/stores/models.py
UTF-8
1,502
2.96875
3
[ "BSD-2-Clause" ]
permissive
from django.db import models PRICE_TYPE_CHOICES = ( ('C', 'Cash'), ('G', 'Gold'), ) class Store(models.Model): name = models.CharField(max_length=200, unique=True) price = models.IntegerField(help_text='Price of the store itself') price_type = models.CharField(choices=PRICE_TYPE_CHOICES, max_length=1, default=PRICE_TYPE_CHOICES[0][0]) employees = models.IntegerField(help_text='Number of employees accepted initially') experience = models.IntegerField(help_text='Experience earned when built') size1 = models.SmallIntegerField(help_text='Size of one of the sides of the store') size2 = models.SmallIntegerField(help_text='Size the other side of the store') build_time = models.IntegerField(help_text='Time spent to build this store') should_create_on_water = models.BooleanField(help_text='Should the store be created on water?', default=False) amount = models.IntegerField(help_text='Amount earned per interval') interval = models.IntegerField(help_text='Interval, in seconds, in which the amount is earned') performance = models.FloatField(help_text='Calculated performance (amount / (interval * size1 * size2))', editable=False, null=True, blank=True, default=0) def __unicode__(self): return self.name def save(self, *args, **kwargs): performance = float(self.amount) / (self.interval * self.size1 * self.size2) self.performance = round(performance, 2) super(Store, self).save(*args, **kwargs)
true
0ae912b847faaeeeba975a4d01b98684014f427f
Python
Subash45/Multiplication_cipher
/multiplicative_cipher.py
UTF-8
1,045
3.953125
4
[ "CC0-1.0" ]
permissive
# get word and the key from the user word = input("\nEnter Your Password : ") key = int(input("Enter The Key Value : ")) crypted = "" # creating dict with alphabets alpha = {0: 'a', 1: 'b', 2: 'c', 3: 'd', 4: 'e', 5: 'f', 6: 'g', 7: 'h', 8: 'i', 9: 'j', 10: 'k', 11: 'l', 12: 'm', 13: 'n', 14: 'o', 15: 'p', 16: 'q', 17: 'r', 18: 's', 19: 't', 20: 'u', 21: 'v', 22: 'w', 23: 'x', 24: 'y', 25: 'z'} num = {'a': 0, 'b': 1, 'c': 2, 'd': 3, 'e': 4, 'f': 5, 'g': 6, 'h': 7, 'i': 8, 'j': 9, 'k': 10, 'l': 11, 'm': 12, 'n': 13, 'o': 14, 'p': 15, 'q': 16, 'r': 17, 's': 18, 't': 19, 'u': 20, 'v': 21, 'w': 22, 'x': 23, 'y': 24, 'z': 25} for i in word: if 'a' <= i <= 'z' or 'A' <= i <= 'Z': if 'a' <= i <= 'z': temp = (num[i] * key) % 26 crypted += alpha[temp] else: j = i.lower() temp_1 = (num[j] * key) % 26 temp_2 = alpha[temp_1] crypted += temp_2.upper() else: crypted += i print('\nEncrypted text is : ', crypted, "\n")
true
944e1047d077fffbacc92a4fd7fe70373c77c2c2
Python
49257620/reboot
/studysrc/example/exam089.py
UTF-8
992
3.953125
4
[]
no_license
# encoding: utf-8 """ 【程序89】 题目:某个公司采用公用电话传递数据,数据是四位的整数,在传递过程中是加密的,加密规则如下:    每位数字都加上5,然后用和除以10的余数代替该数字,再将第一位和第四位交换,第二位和第三位交换。 1.程序分析: 2.程序源代码: """ code_li = [8, 4, 5, 6] print('code:', code_li) def encode(code_li): for i in range(len(code_li)): code_li[i] = (code_li[i] + 5) % 10 code_li[0], code_li[3] = code_li[3], code_li[0] code_li[1], code_li[2] = code_li[2], code_li[1] return code_li decode_li = encode(code_li) print('encode:', decode_li) def decode(decode_li): code_li[0], code_li[3] = code_li[3], code_li[0] code_li[1], code_li[2] = code_li[2], code_li[1] for i in range(len(decode_li)): code_li[i] = code_li[i] - 5 if code_li[i] > 5 else code_li[i] + 5 return code_li print('decode:', decode(decode_li))
true
da80964eac1ac1f0e8d227d5d2458ca338d99fde
Python
eshandinesh/gis_based_crime_mapping
/mapping/gis/yoink/feed.py
UTF-8
2,349
2.796875
3
[ "MIT" ]
permissive
import ConfigParser, datetime, logging, os, time import feedparser from .download import download from .util import catching logger = logging.getLogger('yoink.feed') class Feed(object): '''Represents a single feed from which files are downloaded. ''' TIME_FORMAT = '%Y-%m-%dT%H:%M:%S' def __init__(self, name, url, folder, timestamp, config): self.name = name self.url = url self.folder = folder self.timestamp = timestamp self.config = config @catching(handler=lambda e: logger.error('Error processing feed: {0}'.format(e))) def update(self): '''Read latest feed data and schedule new files for download. ''' logger.info('reading feed: {0}'.format(self.url)) # read the feed parsed = feedparser.parse(self.url) # grab the entries entries = parsed['entries'] # filter out entries older than the feed timestamp entries = filter(lambda e: e['updated_parsed'][:8] > self.timestamp.timetuple()[:8], entries) # process each entry (in timestamp order) map(self.process_entry, entries) @catching(exception_type=KeyError, handler=lambda e: logger.error('Entry is missing a field: {0}'.format(e))) def process_entry(self, entry): '''Look for all enclosures in `entry` and download anything that meets the Feed's criteria. ''' # Download the entry if it's timestamp is greater than the # feed's for enc in entry['enclosures']: if enc['type'].startswith('audio/'): url = enc['href'] if self.config.preview: logger.info('[PREVIEW] Downloading {0}'.format(url)) else: # Schedule the URL for download download(url, self.folder) # Update the feed's timestamp self.timestamp = max( self.timestamp, datetime.datetime.strptime( time.strftime( Feed.TIME_FORMAT, entry['updated_parsed']), Feed.TIME_FORMAT))
true
a67df7ec61ff33f67c48659d771be02bfca87c86
Python
CharlesLaforte/learning
/python/Minecraft/Classes/GhostCastle.py
UTF-8
1,048
2.65625
3
[]
no_license
from mcpi.minecraft import Minecraft mc = Minecraft.create("smalldell1") import time class NamedBuilding(object): def __init__(self, x, y, z, width, height, depth, name): self.x = x self.y = y self.z = z self.width = width self.height = height self.depth = depth self.name = name def build(self): mc.setBlocks(self.x, self.y, self.z, self.x + self.width, self.y + self.height, self.z + self.depth, 4) mc.setBlocks(self.x + 1, self.y + 1, self.z + 1, self.x + self.width - 1, self.y + self.height - 1, self.z + self.depth - 1, 0) def clear(self): mc.setBlocks(self.x, self.y, self.z, self.x + self.width, self.y + self.height, self.z + self.depth, 0) def getInfo(): pass pos = mc.player.getTilePos() x = pos.x y = pos.y z = pos.z ghostCastle = NamedBuilding(x, y, z, 10, 16, 16, "Ghost Castle") ghostCastle.build() mc.postToChat(ghostCastle.getInfo()) time.sleep(30) ghostCastle.clear()
true
2ca91efd9c7ebf25d33aa2d948df64a020defb64
Python
mfsuve/DeepReinforcementLearning
/blg604ehw2/dqn/model.py
UTF-8
12,154
3.109375
3
[]
no_license
""" Deep Q network implementations. Vanilla DQN and DQN with Duelling architecture, Prioritized ReplayBuffer and Double Q learning. """ import torch import numpy as np import random from copy import deepcopy from collections import namedtuple from blg604ehw2.dqn.replaybuffer import UniformBuffer from blg604ehw2.dqn.replaybuffer import PrioirtyBuffer from blg604ehw2.dqn.replaybuffer import Transition from blg604ehw2.atari_wrapper import LazyFrames from blg604ehw2.utils import process_state from blg604ehw2.utils import normalize class BaseDqn: """ Base class for DQN implementations. Both greedy and e_greedy policies are defined. Greedy policy is a wrapper for the _greedy_policy method. Arguments: - nact: Number of the possible actions int the action space - buffer_capacity: Maximum capacity of the replay buffer """ def __init__(self, nact, buffer_capacity): super().__init__() self.nact = nact self.buffer_capacity = buffer_capacity self._device = "cpu" def greedy_policy(self, state): """ Wrapper for the _greedy_policy of the inherited class. Performs normalization if the state is a LazyFrame(stack of gray images) and cast the state to torch tensor with additional dimension to make it compatible with the neural network. """ ### Optional, You many not use this ### if isinstance(state, LazyFrames): state = np.array(state, dtype="float32") state = state.transpose(2, 0, 1) state = normalize(state) if isinstance(state, np.ndarray): state = torch.from_numpy(state).float().to(self.device) if state.shape[0] != 1: state.unsqueeze_(0) with torch.no_grad(): return self._greedy_policy(state) def e_greedy_policy(self, state, epsilon): """ Return action from greedy policy with the 1-epsilon probability and random action with the epsilon probability. """ if random.uniform(0, 1) < epsilon: return random.randint(0, self.nact - 1) else: return self.greedy_policy(state) def push_transition(self, transition): """ Push transition to the replay buffer """ raise NotImplementedError def update(self, batch_size): """ Update the model """ raise NotImplementedError def _greedy_policy(self, state): """ Return greedy action for the state """ raise NotImplementedError @property def buffer_size(self): """ Return buffer size """ return self.buffer.size @property def device(self): """ Return device name """ return self._device @device.setter def device(self, value): """ Set device name and the model's device. """ super().to(value) self._device = value class DQN(BaseDqn, torch.nn.Module): """ Vanilla DQN with target network and uniform replay buffer. Implemantation of DeepMind's Nature paper. Arguments: - valuenet: Neural network to represent value function. - nact: Number of the possible actions int the action space - lr: Learning rate of the optimization (default=0.001) - buffer_capacity: Maximum capacity of the replay buffer (default=10000) - target_update_period: Number of steps for the target network update. After each update counter set to zero again (default=100) """ def __init__(self, valuenet, nact, lr=0.001, buffer_capacity=10000, target_update_period=100): super().__init__(nact, buffer_capacity) self.valuenet = valuenet self.target_net = deepcopy(valuenet) self.target_update_period = target_update_period self.target_update_counter = 0 self.buffer = UniformBuffer(capacity=buffer_capacity) self.opt = torch.optim.Adam(self.valuenet.parameters(), lr=lr) def _greedy_policy(self, state): """ Return greedy action for the state """ ### YOUR CODE HERE ### # You may skip this and override greedy_policy directlyDQN return self.valuenet(state).argmax().item() ### END ### def push_transition(self, transition, *args): """ Push transition to the replay buffer Arguments: - transition: Named tuple of (state, action, reward, next_state, terminal) """ self.buffer.push(transition) def update(self, batch_size, gamma): """ Update the valuenet and targetnet(if period) and return mean absolute td error. Process samples sampled from the replay buffer for q learning update. Raise assertion if thereplay buffer is not big enough for the batchsize. """ assert batch_size < self.buffer.size, "Buffer is not large enough!" ### YOUR CODE HERE ### batch = self.buffer.sample(batch_size) batch = Transition(*map(lambda e: e.to(self.device), batch)) state_action_values = self.valuenet(batch.state).gather(1, batch.action.long().unsqueeze(-1)) y = torch.zeros(batch_size, device=self.device) non_terminal_idx = batch.terminal == 0 non_terminal_next_states = batch.next_state.index_select(0, non_terminal_idx.nonzero().squeeze()) y[non_terminal_idx] = self.target_net(non_terminal_next_states).max(1)[0].detach() expected_state_action_values = (y * gamma) + batch.reward expected_state_action_values = expected_state_action_values.unsqueeze(-1) MAE = torch.nn.L1Loss() MSE = torch.nn.MSELoss() with torch.no_grad(): td_error = MAE(state_action_values, expected_state_action_values).item() loss = MSE(state_action_values, expected_state_action_values) self.opt.zero_grad() loss.backward() for param in self.valuenet.parameters(): param.grad.data.clamp_(-1, 1) self.opt.step() self.target_update_counter += 1 if self.target_update_counter % self.target_update_period == 0: self.target_net.load_state_dict(self.valuenet.state_dict()) self.target_update_counter = 0 ### END ### return td_error # mean absolute td error class DuelingDoublePrioritizedDQN(BaseDqn, torch.nn.Module): """ DQN implementaiton with Duelling architecture, Prioritized Replay Buffer and Double Q learning. Double Q learning idea is implemented with a target network that is replaced with the main network at every Nth step. Arguments: - valuenet: Neural network to represent value function. - nact: Number of the possible actions int the action space - lr: Learning rate of the optimization (default=0.001) - buffer_capacity: Maximum capacity of the replay buffer (default=10000) - target_replace_period: Number of steps to replace value network with the target network (default=50) """ def __init__(self, valuenet, nact, lr=0.001, buffer_capacity=10000, target_replace_period=50): super().__init__(nact, buffer_capacity) ### YOUR CODE HERE ### self.valuenet = valuenet self.target_net = deepcopy(valuenet) self.target_update_period = target_replace_period self.target_update_counter = 0 self.buffer = PrioirtyBuffer(capacity=buffer_capacity) self.opt = torch.optim.Adam(self.valuenet.parameters(), lr=lr) ### END ### def _greedy_policy(self, state): """ Return greedy action for the state """ ### YOUR CODE HERE ### return self.valuenet(state).argmax().item() ### END ### def td_error(self, trans, gamma): """ Return the td error, predicted values and target values. """ # Optional but convenient ### YOUR CODE HERE ### s, a, r, ns, t = trans if isinstance(s, LazyFrames): s = normalize(np.array(s, dtype='float32').transpose(2, 0, 1)) ns = normalize(np.array(ns, dtype='float32').transpose(2, 0, 1)) s = torch.from_numpy(s).to(self.device).unsqueeze(0) a = torch.from_numpy(np.array(a, dtype='float32')).to(self.device).unsqueeze(0) r = torch.from_numpy(np.array(r, dtype='float32')).to(self.device).unsqueeze(0) ns = torch.from_numpy(ns).to(self.device).unsqueeze(0) t = torch.from_numpy(np.array(t, dtype='float32')).to(self.device).unsqueeze(0) with torch.no_grad(): values = self.valuenet(s).gather(1, a.long().unsqueeze(-1)).squeeze() argmax = self.valuenet(ns).argmax(1, keepdim=True) target = self.target_net(ns).gather(1, argmax).squeeze() expected = r + (gamma * target * (1 - t)) td_error = (values - expected.squeeze()).abs() del values del expected del target del argmax return td_error.detach().mean().item() ### END ### def push_transition(self, transition, gamma): """ Push transitoins and corresponding td error into the prioritized replay buffer. """ ### YOUR CODE HERE ### # Remember Prioritized Replay Buffer requires # td error to push a transition. You need # to calculate it for the given trainsition self.buffer.push(transition, self.td_error(transition, gamma)) ### END ### def update(self, batch_size, gamma): """ Update the valuenet and replace it with the targetnet(if period). After the td error is calculated for all the batch, priority values of the transitions sampled from the buffer are updated as well. Return mean absolute td error. """ assert batch_size < self.buffer.size, "Buffer is not large enough!" ### YOUR CODE HERE ### # This time it is double q learning. # Remember the idea behind double q learning. idxs, batch, ws = self.buffer.sample(batch_size) state, action, reward, next_state, done = batch if state.ndim > 2: state = state.transpose(0, 3, 1, 2) state = normalize(state) next_state = next_state.transpose(0, 3, 1, 2) next_state = normalize(next_state) state = torch.from_numpy(state).to(self.device) action = torch.LongTensor(action).to(self.device).unsqueeze(-1) reward = torch.FloatTensor(reward).to(self.device) next_state = torch.from_numpy(next_state).to(self.device) done = torch.FloatTensor(done).to(self.device) def td_error_sub(s, a, r, ns, t): values = self.valuenet(s).gather(1, a).squeeze() argmax = self.valuenet(ns).argmax(1, keepdim=True) target = self.target_net(ns).gather(1, argmax).squeeze() expected = r + (gamma * target * (1 - t)) td_error = (values - expected).abs() return td_error.detach(), values, expected td_error, values, expected = td_error_sub(state, action, reward, next_state, done) td_error = td_error.mean().item() # Imprtance Sampling Weights loss = ((values - expected).pow(2) * torch.FloatTensor(ws).to(self.device)).mean() self.opt.zero_grad() loss.backward() self.opt.step() self.target_update_counter += 1 if self.target_update_counter % self.target_update_period == 0: self.target_net.load_state_dict(self.valuenet.state_dict()) self.target_update_counter = 0 new_vals = td_error_sub(state, action, reward, next_state, done)[0] self.buffer.update_priority(idxs, new_vals.detach().cpu().squeeze().numpy()) ### END ### return td_error # mean absolute td error
true
8c0554c6e2ab73333b430a59538f930013c4b425
Python
manasa0917/python_code
/Class 8/maths_module.py
UTF-8
409
3.46875
3
[]
no_license
def add(a,b): return a+b def factorial(n): if (n>10000): return 0 mult=1 for i in range(1,n+1): mult=mult *i return mult def driverFucntion(): num1 = int(input("num 1: ")) num2 = int(input("num 2: ")) print("sum = {}".format(add(num1,num2))) print("Factorial of sum = {}".format(factorial(add(num1,num2)))) if __name__ == "__main__": driverFucntion()
true
fccf01d4dccc1083afa4a1d034f22a127eb76214
Python
mkvenkatesh/Random-Programming-Exercises
/max_positive_sub_array.py
UTF-8
2,847
4.125
4
[]
no_license
""" Problem Description: Given an array of integers, A of length N, find out the maximum sum sub-array of non negative numbers from A. The sub-array should be contiguous i.e., a sub-array created by choosing the second and fourth element and skipping the third element is invalid. Maximum sub-array is defined in terms of the sum of the elements in the sub-array. Find and return the required subarray. NOTE: If there is a tie, then compare with segment's length and return segment which has maximum length. If there is still a tie, then return the segment with minimum starting index. Problem Constraints: 1 <= N <= 10^5 -10^9 <= A[i] <= 10^9 Example Input Input 1: A = [1, 2, 5, -7, 2, 3] Input 2: A = [10, -1, 2, 3, -4, 100] Example Output Output 1: [1, 2, 5] Output 2: [100] # Algorithm Find the first non-negative integer and do a running sum until the next non-negative integer. Put the running sum and start/end index of this subarray in a tuple. Loop through and do this until end of array. If new rs > oldrs, replace rs with new rs and new start/end index. if rs is same, store the one with longest length. If rs is same and length is same, continue. """ class Solution: # @param A : list of integers # @return a list of integers def maxset(self, A): start_index = 0 subarray_sum = 0 subarray_start = None subarray_end = 0 result = { "sum": -1, "start_index": 0, "end_index": 0 } while start_index < len(A): # positive number if A[start_index] >= 0: if subarray_start == None: subarray_start = start_index subarray_sum += A[start_index] subarray_end = start_index # negative number else: subarray_start = None subarray_sum = 0 # check if running sum and length of the subarray from current # iteration is greater than or equal to subarray from previous # iteration if (subarray_start != None): if (subarray_sum > result["sum"]): result["sum"] = subarray_sum result["start_index"] = subarray_start result["end_index"] = subarray_end elif (subarray_sum == result["sum"]): if (subarray_end - subarray_start) > (result["end_index"] - result["start_index"]): result["start_index"], result["end_index"] = subarray_start, subarray_end start_index += 1 if result["sum"] == -1: return [] else: return A[result["start_index"] : result["end_index"]+1] A = [-1, -1, -1, -1] s = Solution() print(s.maxset(A))
true
90ba7c97636889461b2ee8d0c69f2abd209a3841
Python
mhcrnl/pygtk
/book/02-App_and_AppWindow/Application1.py
UTF-8
1,255
2.6875
3
[]
no_license
class Application(Gtk.Application): def __init__(self, *args, **kwargs): super().__init__(*args, application_id="org.example.myapp", flags=Gio.ApplicationFlags.HANDLES_COMMAND_LINE, **kwargs) self.window = None self.add_main_option("test", ord("t"), GLib.OptionFlags.NONE, GLib.OptionArg.NONE, "Command line test", None) def do_startup(self): Gtk.Application.do_startup(self) action = Gio.SimpleAction.new("quit", None) action.connect("activate", self.on_quit) self.add_action(action) def do_activate(self): # We only allow a single window and raise any existing ones if not self.window: # Windows are associated with the application # when the last one is closed the application shuts down self.window = AppWindow(application=self, title="Main Window") self.window.present() def do_command_line(self, command_line): options = command_line.get_options_dict() if options.contains("test"): # This is printed on the main instance print("Test argument recieved") self.activate() return 0
true
cb3e4054fd5bf34156955b2c99dd091e01bb59d3
Python
s-rachmaninoff/Algorithm-1
/Python_Algorithm/solve/section_4/solution_8.py
UTF-8
476
3.203125
3
[]
no_license
# 침몰하는 타이타닉 (그리디) def solution(n, m, people): people.sort() cnt = 0 while people: if len(people) == 1: cnt += 1 break if people[0] + people[-1] <= m: cnt += 1 people.pop(0) people.pop() else: cnt += 1 people.pop() return cnt n, m = map(int, input().split()) people = list(map(int, input().split())) print(solution(n, m, people))
true
875b714c1ad0dd93b044e6d4c078ae3cd35184f8
Python
6306022610113/INE_Problem
/exam/comm.py
UTF-8
304
3.515625
4
[]
no_license
Sales = int(input("ENTER YOUR SALES : ")) Commission = 0 if Sales > 2000 : if Sales > 4000: if Sales > 6000: Commission = 0.1 else: Commission = 0.07 else: Commission = 0.04 else: Commission = 0.02 print("ํYOUR COMMISSION : ",Commission)
true
8e0685bb3f8eeb35bd71f19d11e45a7be7c04aff
Python
Vinceeee/mypy
/py3.6/async_guides/async_http.py
UTF-8
903
3.140625
3
[ "Apache-2.0" ]
permissive
#!/usr/bin/env python import asyncio from random import randint from urllib import request """ Non-blocking url-open by asyncio """ async def openurl(url): print("opening {} ".format(url)) u = request.urlopen(url, timeout=10) print(u.read()) st = randint(2, 3) await asyncio.sleep(st) print("task completed.") return {url:u.status} def normal_run(): # only coroutine task instances , # which need to be triggered in a event_loop loop = asyncio.get_event_loop() while True: task1 = openurl("http://localhost:12345") task2 = openurl("http://localhost:12345/home") tasks = [asyncio.ensure_future(task1), asyncio.ensure_future(task2)] loop.run_until_complete(asyncio.wait(tasks)) # loop.run_until_complete(task1) for task in tasks: print(task.result()) if __name__ == '__main__': normal_run()
true
8bc2cb156c3eb31266fac9f1b12499e8193d4daa
Python
BABIN2D/Health-Management-System
/Health Management System.py
UTF-8
2,737
3.71875
4
[]
no_license
import datetime def gettime(): '''Time Function To Get The Current Time''' return datetime.datetime.now() choice = input('Enter R to read\nEnter L to log\t') # Decision on whether to write or read the txt file. if choice in('L','l'): # Entering the log or write function. user_name = input('Enter Your Name\t') # Asking the User to Enter There Name with open('Health Management System.txt','a') as file: # Opening the Health Management System txt. file. file.write('Time-\t') file.write(str(gettime())) # Writing the time from the time function. file.write('\n') file.write('Name- ') file.write(user_name +'\n') # Writing the username diet_Exercise = input('Enter D for Diet\nEnter E for Exercise\t') # Decision on Diet or Exercise. if diet_Exercise in ('D','d'): file.write('Diet- ') while True: # Entering in a while loop till the user wants to write # his/her diet chart. file.write(input('Enter Your Diet\t')+'\t') # Asking the user to input the diet. choice1 = input('Do You Want to Log More Diet?\t') # decision box for more diet if choice1 in ('Yes','yes','YES','y','Y'): # if the user enters any of the following - yes, Yes, YES, continue # Y or y. this will count as the user wants to write more diet else: file.write('\n') print('Good Bye') break # Terminating the program if the above options are not in the list. elif diet_Exercise in('E','e'): # Entering exercise loop if user enters E or e. file.write('Exercise- ') while True: # Entering the while loop file.write(input('Enter Your Exercise\t')+'\t') # Asking user to input his/her exercise choice2 = input('Do You Want to Log More Exercise?\t') # Asking user if he/she wants to log more exercise. if choice2 in ('Yes','yes','YES','y','Y'): # If user wants to log more exercise. continue else: file.write('\n') print('Good Bye') break # If the user doesn't wish to log any more entries. else: with open('Health Management System.txt') as fileR: print(fileR.read())
true
50ffb52975944c90498abfa29667b3ef5cfbecc2
Python
jditlee/tmdSurprise_leetcode_hot100
/[124]二叉树中的最大路径和.py
UTF-8
1,656
3.46875
3
[]
no_license
# 路径 被定义为一条从树中任意节点出发,沿父节点-子节点连接,达到任意节点的序列。同一个节点在一条路径序列中 至多出现一次 。该路径 至少包含一个 节点,且不 # 一定经过根节点。 # # 路径和 是路径中各节点值的总和。 # # 给你一个二叉树的根节点 root ,返回其 最大路径和 。 # # # # 示例 1: # # # 输入:root = [1,2,3] # 输出:6 # 解释:最优路径是 2 -> 1 -> 3 ,路径和为 2 + 1 + 3 = 6 # # 示例 2: # # # 输入:root = [-10,9,20,null,null,15,7] # 输出:42 # 解释:最优路径是 15 -> 20 -> 7 ,路径和为 15 + 20 + 7 = 42 # # # # # 提示: # # # 树中节点数目范围是 [1, 3 * 104] # -1000 <= Node.val <= 1000 # # Related Topics 树 深度优先搜索 动态规划 二叉树 # 👍 1112 👎 0 # leetcode submit region begin(Prohibit modification and deletion) # Definition for a binary tree node. class TreeNode: def __init__(self, val=0, left=None, right=None): self.val = val self.left = left self.right = right class Solution: def __init__(self): self.res = float("-inf") def maxPathSum(self, root: TreeNode) -> int: def maxGain(node:TreeNode)->int: if not node: return 0 left = max(maxGain(node.left),0) right = max(maxGain(node.right),0) self.res = max(self.res,node.val+left+right) return node.val+max(left,right) maxGain(root) return self.res # leetcode submit region end(Prohibit modification and deletion)
true
8a25b4f460b990576fb0e14eabe56cfa30d77960
Python
nickcoats/kattis-assignments
/get_shorty/get_shorty.py
UTF-8
1,752
3.078125
3
[]
no_license
import sys # # Code Sample from Kattis Get Shorty Assignment # URL: https://open.kattis.com/problems/getshorty # Execute: pyhton get_shorty.py < get_shorty.in # tests = [] testSet = [] i = 0 valid = False validData = False for row in sys.stdin: row = row.replace('\r', '').replace('\n', '') row = row.split() if len(row) == 2 and int(row[0]) == 0 and row[0] == row[1]: tests.append(testSet) break if len(row) == 2: if (int(row[0]) >= 2 and int(row[0]) <= 10000) and (int(row[1]) >= 1 and int(row[1]) <= 15000): row[0] = int(row[0]) row[1] = int(row[1]) if i == 0: valid = True testSet.append(row) i += 1 continue valid = True if validData == True: tests.append(testSet) testSet = [] testSet.append(row) else: valid = False testSet = [] if len(row) == 3 and valid == True: passed = False row[0] = int(row[0]) row[1] = int(row[1]) if float(row[2]) >= 0.00 and float(row[2]) <= 1.00: passed = True row[2] = float(row[2]) if passed: validData = True testSet.append(row) else: validData = False for test in tests: mikaelSize = 0.00 startSize = 1.00 stop = test[0][0] - 1 for i in range(1,len(test)): startSize = startSize * test[i][2] if test[i][0] == stop or test[i][1] == stop: if startSize > mikaelSize: mikaelSize = startSize startSize = 1.00 continue print '{0:.4f}'.format(mikaelSize)
true
e883ffa06f8f4589c6cf35ff4cf4a2b769816f45
Python
ISIS2503/Grupo7
/Experimento2/Persistencia/consumerMedidas.py
UTF-8
1,505
2.640625
3
[ "MIT" ]
permissive
import json import requests from kafka import KafkaConsumer def post(p_sensetime, p_type, p_dataValue, p_unit): payload = { "sensetime": p_sensetime, "type": p_type, "dataValue": p_dataValue, "unit": p_unit } url = 'http://localhost:8080/measurements' response = requests.post(url, data=json.dumps(payload), headers={'Content-type': 'application/json'}) print(message.topic) print("Response Status Code: " + str(response.status_code)) consumer = KafkaConsumer('rawdata', group_id='my-group', bootstrap_servers=['localhost:8090']) for message in consumer: json_data = json.loads(message.value.decode('utf-8')) sensetime = json_data['sensetime'] temp = json_data['temperature'] senseTemp = temp['data'] tempUnit = temp['unit'] gas = json_data['gas'] senseGas = gas['data'] gasUnit = gas['unit'] if ((json_data['noise'] != None) and (json_data['ilumination'] != None)): noise = json_data['noise'] senseNoise = noise['data'] noiseUnit = noise['unit'] ilumination = json_data['ilumination'] senseIlumination = ilumination['data'] iluminationUnit = ilumination['unit'] post(sensetime, "temperature", float(senseTemp), str(tempUnit)) post(sensetime, "gas", float(senseGas), str(gasUnit)) post(sensetime, "noise", float(senseNoise), str(noiseUnit)) post(sensetime, "iluniation", float(), str(iluminationUnit)) else: post(sensetime, "temperature", float(senseTemp), str(tempUnit)) post(sensetime, "gas", float(senseGas), str(gasUnit))
true
d0c6c97c71faaa21f45e40125255f088eb15ed7d
Python
andreafresco/Project-Euler
/p003.py
UTF-8
1,097
3.765625
4
[]
no_license
# # Solution to Project Euler problem 3 # Copyright (c) Andrea Fresco. All rights reserved. # # https://projecteuler.net/problem=3 # https://github.com/andreafresco/Project-Euler # def smallest_prime(n): # return the smallest prime of n or n itself # if it is prime assert n > 0 i = 2 # we restrict the search of prime numbers between 2 and sqrt(n) while i*i <= n: # equivalent to i <= sqrt(n) if n%i == 0: return i # we return the first prime number we encounter i+=1 return n def Largest_Prime_Factor(P): smallest = smallest_prime(P) # finding the smallest prime while smallest < P: # Dividing the number by all it's smallest prime numbers until we reach # the highest prime number (condition: P = smallest) P //= smallest # integer division to avoid floating point results (e.g. 17.0 instead of 17) smallest = smallest_prime(P) return P if __name__ == "__main__": print(Largest_Prime_Factor(600851475143))
true
2e908bc075d4955811ebf0360f8270f622d4d305
Python
alina-pavaluc/extract_pe_features
/classifier.py
UTF-8
4,532
2.703125
3
[]
no_license
import csv import pickle import numpy as np import pandas as pd from sklearn import tree from sklearn.ensemble import RandomForestClassifier from sklearn.neural_network import MLPClassifier from extract_features import extract_features_from_file, extract_features_from_folder class Classifier: def __init__(self, filename): self.loaded_model = pickle.load(open(filename, 'rb')) self.target_names = ['clean', 'malware'] def label_file(self, extracted_features): predicted = self.loaded_model.predict_proba(extracted_features) return list(map(lambda p: (self.target_names[p.argmax()], p.max()), predicted)) def classify_file(self, filename): extracted_features = extract_features_from_file(filename) if extracted_features is not None: return filename, self.label_file([extracted_features])[0] else: # TODO return 'this is not an application, so it\'s not a threat', '1.0' def scan_folder(self, folder_name): file_names, features = extract_features_from_folder(folder_name) classification = self.label_file(features) return zip(file_names, classification) def train_using_decision_tree_classifier(): features = [] labels = [] with open('C:\\Users\\Alina\\PycharmProjects\\licenta2\\all_features.csv') as feature_file: features_files = csv.reader(feature_file, delimiter=',') for row in features_files: features.append(row[1:-1]) labels.append(row[-1]) # target_names = ['clean', 'malware'] # features_name = ['DebugSize', 'ImageVersion', 'IatRVA', 'ExportSize', # 'ResourceSize', 'VirtualSize2', 'NumberOfSections', 'CheckSum', 'DLLCharacteristics', # 'SizeOfInitializedData', 'SizeOfStackReserve'] clf = tree.DecisionTreeClassifier() clf = clf.fit(features, labels) filename = 'C:\\Users\\Alina\\PycharmProjects\\licenta2\\finalized_model.sav' pickle.dump(clf, open(filename, 'wb')) def train_using_mlp(): features = [] labels = [] with open('C:\\Users\\Alina\\PycharmProjects\\licenta2\\all_features.csv') as feature_file: features_files = csv.reader(feature_file, delimiter=',') for row in features_files: features.append(list(map(float, row[1:-1]))) labels.append(row[-1]) y = pd.factorize(labels)[0] clf = MLPClassifier(solver='lbfgs', alpha=1e-5, hidden_layer_sizes=(100, 50), random_state=1, max_iter=200) clf.fit(features, y) filename = 'C:\\Users\\Alina\\PycharmProjects\\licenta2\\MLP_model.sav' pickle.dump(clf, open(filename, 'wb')) def train_using_random_forest_classifier(): features = [] labels = [] feature_names = ['DebugSize', 'ImageVersion', 'ResourceSize', 'VirtualSize2', 'CheckSum', 'DLLCharacteristics', 'SizeOfInitializedData', 'SizeOfStackReserve'] with open('C:\\Users\\Alina\\PycharmProjects\\licenta2\\all_features.csv') as feature_file: features_files = csv.reader(feature_file, delimiter=',') for row in features_files: features.append(list(map(float, [row[1], row[2], row[5], row[6], row[8], row[9], row[10], row[11]]))) labels.append(row[-1]) y = pd.factorize(labels)[0] # X_train, X_test, y_train, y_test = train_test_split(features, y, test_size=0.3) clf = RandomForestClassifier(n_jobs=2, random_state=0, n_estimators=100) clf.fit(features, y) # print(pd.Series(clf.feature_importances_, index=feature_names)) # clf.fit(X_train, y_train) # y_pred = clf.predict(X_test) # print("Accuracy:", metrics.accuracy_score(y_test, y_pred)) # print(clf.predict([[0, 0.0, 278572, 0, 61484, 65536, 3, 46976398, 0, 65536, 1048576]])) # print(clf.predict_proba([[0, 0.0, 278572, 0, 61484, 65536, 3, 46976398, 0, 65536, 1048576]])) filename = 'C:\\Users\\Alina\\PycharmProjects\\licenta2\\finalized_model_random_forest.sav' pickle.dump(clf, open(filename, 'wb')) def use_classifier(): filename = 'C:\\Users\\Alina\\PycharmProjects\\licenta2\\finalized_model_random_forest.sav' loaded_model = pickle.load(open(filename, 'rb')) result = loaded_model.predict([[0, 0.0, 360448, 0, 292, 2176, 5, 0, 0, 301568, 1048576]]) prob = loaded_model.predict_proba([[0, 0.0, 360448, 0, 292, 2176, 5, 0, 0, 301568, 1048576]]) print(result, prob) if __name__ == "__main__": train_using_random_forest_classifier() # use_classifier()
true
dc760cee1fc366f930e2494d232d30b9995c6870
Python
VilenShvedov/Myprojects
/005_001_2.py
UTF-8
113
2.71875
3
[]
no_license
import 005_001_Functions print(functions.doubles(10)) print(functions.triples(10)) print(functions.squares(10))
true
2ab955390f3bbf5f9bd123814a26831b6805d087
Python
ngvanryneveld/CapstoneProject-L1Task15
/own_game.py
UTF-8
12,080
3.703125
4
[]
no_license
# import pygame allows for the game library functions to be included in the program # import random allows for the program to generate random numbers import pygame import random # this initializes the pygames modules to get everything started pygame.init() # the size of the screen display will be adjusted through these variables being width and height screen_width = 800 screen_height = 600 # this creates the screen according to the above set variables screen = pygame.display.set_mode((screen_width, screen_height)) # this is importing the images within this folder as the various characters and items within the pygame player = pygame.image.load("player.png") enemy1 = pygame.image.load("monster.png") enemy2 = pygame.image.load("monster.png") enemy3 = pygame.image.load("monster.png") prize = pygame.image.load("prize.png") # this evaluates the size of the player's image and is used in the boundary detection of the pygame player_height = player.get_height() player_width = player.get_width() # this evaluates the size of the enemies' images and is used in the boundary detection of the pygame enemy1_height = enemy1.get_height() enemy1_width = enemy1.get_width() enemy2_height = enemy2.get_height() enemy2_width = enemy2.get_width() enemy3_height = enemy3.get_height() enemy3_width = enemy3.get_width() # this evaluates the size of the prize's image and is used in the boundary detection of the pygame prize_height = prize.get_height() prize_width = prize.get_width() # this print statement is just for interest of the user to see the size of the player's character print("This is the height of the player " + str(player_height)) print("This is the width of the player " + str(player_width)) # this is to select a difficulty level within the game and will speed up the game play appropriately as well as speed up the user's movements if level 10 is selected difficulty = input("""Enter a level you would like to play, ranging from 1 - 10, 10 can be discomforting but you will receive a slight speed bonus, anything under 3 is for newbies: """) # this while loop means the player cannot enter a false level number, but has to be from 1 - 10 while difficulty != "10" and difficulty != "9" and difficulty != "8" and difficulty != "7" and difficulty != "6" and difficulty != "5" and difficulty != "4" and difficulty != "3" and difficulty != "2" and difficulty != "1": difficulty = input("Enter a level you would like to play, ranging from 1 - 10: ") # this determines the starting position of the player with the XPosition being set but the YPosition being random without the possibility of the player being outside the screen playerXPosition = 100 playerYPosition = random.randint(0, screen_height - player_height) # this determines the enemies starting positions are off the screen as well as ensures they are all at different XPositions so that they do not overlap with each other # the enemies YPositions are all random but without allowing them to be out of the screen enemy1XPosition = screen_width enemy1YPosition = random.randint(0, screen_height - enemy1_height) enemy2XPosition = screen_width + (2 * enemy1_width) enemy2YPosition = random.randint(0, screen_height - enemy2_height) enemy3XPosition = screen_width + (4 * enemy2_width) enemy3YPosition = random.randint(0, screen_height - enemy3_height) # this determines the prize's position but ensures that it only is available after the enemies have moved onto the screen prizeXPosition = screen_width + (7 * enemy3_width) prizeYPosition = random.randint(0, screen_height - prize_height) # the boolean value here ensures that while the keys are not being pressed, the value is false keyUp = False keyDown = False keyRight = False keyLeft = False # this is the game loop in order to continue running the games' logic over and over until something occurs # this continuously refreshes the game screen to represent the real time game play # in terms of this game, it will keep looping until the pygame has a quit function reached, which would signify the end of the game # boolean value 1 equals true so this will continuously run until quit while 1: # this clears the screen screen.fill(0) # this draws the position of the player, enemies and prizes specified position screen.blit(player, (playerXPosition, playerYPosition)) screen.blit(enemy1, (enemy1XPosition, enemy1YPosition)) screen.blit(enemy2, (enemy2XPosition, enemy2YPosition)) screen.blit(enemy3, (enemy3XPosition, enemy3YPosition)) screen.blit(prize, (prizeXPosition, prizeYPosition)) # this updates the screen pygame.display.flip() # this for loop is to run through the events within the pygame for event in pygame.event.get(): # this event checks if the player quits the pygame, in turn it exits the program if event.type == pygame.QUIT: pygame.quit() exit(0) # this event checks if the player presses a down key if event.type == pygame.KEYDOWN: # it further tests if the key pressed is the one the player wants # pygame.K_(DIRECTION) represents the keyboard constant if event.key == pygame.K_UP: keyUp = True if event.key == pygame.K_DOWN: keyDown = True if event.key == pygame.K_RIGHT: keyRight = True if event.key == pygame.K_LEFT: keyLeft = True # this event checks if the key is up (i.e. not pressed by the player) if event.type == pygame.KEYUP: # tests if the key released is the one the player wants if event.key == pygame.K_UP: keyUp = False if event.key == pygame.K_DOWN: keyDown = False if event.key == pygame.K_RIGHT: keyRight = False if event.key == pygame.K_LEFT: keyLeft = False # this determines if the player selected the highest level if difficulty == "10": # the following if functions move the players positions when the appropriate key is pressed # the 2nd if functions of each mean the directions being pressed will not allow the player to move off the screen # because of the hard level being selected, the player has the added speed movement if keyUp == True: if playerYPosition > 0: playerYPosition -= 1.5 if keyDown == True: if playerYPosition < (screen_height - player_height): playerYPosition += 1.5 if keyRight == True: if playerXPosition < (screen_width - player_width): playerXPosition += 1.5 if keyLeft == True: if playerXPosition > 0: playerXPosition -= 1.5 # this is if the player does not select level 10 elif difficulty != "10": # the players movement is at normal speed # the 2nd if functions of each mean the directions being pressed will not allow the player to move off the screen if keyUp == True: if playerYPosition > 0: playerYPosition -= 1 if keyDown == True: if playerYPosition < (screen_height - player_height): playerYPosition += 1 if keyRight == True: if playerXPosition < (screen_width - player_width): playerXPosition += 1 if keyLeft == True: if playerXPosition > 0: playerXPosition -= 1 # this creates a box around the player in order to check for collision with the enemy or the prize # it checks if the boxes intersect playerBox = pygame.Rect(player.get_rect()) # this updates the playerBox to the players position and creates the size of the box with width and height playerBox.top = playerYPosition playerBox.left = playerXPosition playerBox.height = player_height playerBox.width = player_width # this creates a box around the enemies' in order to check for collision with the enemy or the prize # it checks if the boxes intersect enemy1Box = pygame.Rect(player.get_rect()) # this updates the enemyBox's positions and creates the size of the box with width and height enemy1Box.top = enemy1YPosition enemy1Box.left = enemy1XPosition enemy1Box.height = enemy1_height enemy1Box.width = enemy1_width enemy2Box = pygame.Rect(player.get_rect()) enemy2Box.top = enemy2YPosition enemy2Box.left = enemy2XPosition enemy2Box.height = enemy2_height enemy2Box.width = enemy2_width enemy3Box = pygame.Rect(player.get_rect()) enemy3Box.top = enemy3YPosition enemy3Box.left = enemy3XPosition enemy3Box.height = enemy3_height enemy3Box.width = enemy3_width # this creates a box around the prize in order to check for collision with the enemy or the prize # it checks if the boxes intersect prizeBox = pygame.Rect(player.get_rect()) # this updates the prizeBox to the prize's position and creates the size of the box with width and height prizeBox.top = prizeYPosition prizeBox.left = prizeXPosition prizeBox.height = prize_height prizeBox.width = prize_width # this tests for the collision of the playerBox with the enemy boxes and prints out the appropriate message and quits the game and closes the window if playerBox.colliderect(enemy1Box): print("You lose!") pygame.quit() exit(0) if playerBox.colliderect(enemy2Box): print("You lose!") pygame.quit() exit(0) if playerBox.colliderect(enemy3Box): print("You lose!") pygame.quit() exit(0) # this test for the collision with the playerBox with the prizeBox and prints out the winning message and quits the game and closes the window if playerBox.colliderect(prizeBox): print("You win!") pygame.quit() exit(0) # this tests to see if the playerBox did not collide with the enemies but also missed the prize and means he therefore did not win the game and prints out the appropriate message and exits the game and exits the window if enemy1XPosition < (0 - enemy1_width) and enemy2XPosition < (0 - enemy2_width) and enemy3XPosition < (0 - enemy3_width) and prizeXPosition < (0 - prize_width): print("You almost won, but you missed the prize!") pygame.quit() exit(0) # the following if statements are to determine how fast the enemies and the prize approach the player, determined by the input of level if difficulty == "10": enemy1XPosition -= 5 enemy2XPosition -= 5 enemy3XPosition -= 5 prizeXPosition -= 5 if difficulty == "9": enemy1XPosition -= 4.5 enemy2XPosition -= 4.5 enemy3XPosition -= 4.5 prizeXPosition -= 4.5 if difficulty == "8": enemy1XPosition -= 4 enemy2XPosition -= 4 enemy3XPosition -= 4 prizeXPosition -= 4 if difficulty == "7": enemy1XPosition -= 3.5 enemy2XPosition -= 3.5 enemy3XPosition -= 3.5 prizeXPosition -= 3.5 if difficulty == "6": enemy1XPosition -= 3 enemy2XPosition -= 3 enemy3XPosition -= 3 prizeXPosition -= 3 if difficulty == "5": enemy1XPosition -= 2.5 enemy2XPosition -= 2.5 enemy3XPosition -= 2.5 prizeXPosition -= 2.5 if difficulty == "4": enemy1XPosition -= 2 enemy2XPosition -= 2 enemy3XPosition -= 2 prizeXPosition -= 2 if difficulty == "3": enemy1XPosition -= 1.5 enemy2XPosition -= 1.5 enemy3XPosition -= 1.5 prizeXPosition -= 1.5 if difficulty == "2": enemy1XPosition -= 1 enemy2XPosition -= 1 enemy3XPosition -= 1 prizeXPosition -= 1 if difficulty == "1": enemy1XPosition -= 0.5 enemy2XPosition -= 0.5 enemy3XPosition -= 0.5 prizeXPosition -= 0.5
true
025bc17d7f2d4ff41468d8ec02e77a429ca54410
Python
DockerNAS/yamlscript-formula
/_utils/voluptuous.py
UTF-8
35,512
2.703125
3
[ "MIT" ]
permissive
# encoding: utf-8 # # Copyright (C) 2010-2013 Alec Thomas <alec@swapoff.org> # All rights reserved. # # This software is licensed as described in the file COPYING, which # you should have received as part of this distribution. # # Author: Alec Thomas <alec@swapoff.org> """Schema validation for Python data structures. Given eg. a nested data structure like this: { 'exclude': ['Users', 'Uptime'], 'include': [], 'set': { 'snmp_community': 'public', 'snmp_timeout': 15, 'snmp_version': '2c', }, 'targets': { 'localhost': { 'exclude': ['Uptime'], 'features': { 'Uptime': { 'retries': 3, }, 'Users': { 'snmp_community': 'monkey', 'snmp_port': 15, }, }, 'include': ['Users'], 'set': { 'snmp_community': 'monkeys', }, }, }, } A schema like this: >>> settings = { ... 'snmp_community': str, ... 'retries': int, ... 'snmp_version': All(Coerce(str), Any('3', '2c', '1')), ... } >>> features = ['Ping', 'Uptime', 'Http'] >>> schema = Schema({ ... 'exclude': features, ... 'include': features, ... 'set': settings, ... 'targets': { ... 'exclude': features, ... 'include': features, ... 'features': { ... str: settings, ... }, ... }, ... }) Validate like so: >>> schema({ ... 'set': { ... 'snmp_community': 'public', ... 'snmp_version': '2c', ... }, ... 'targets': { ... 'exclude': ['Ping'], ... 'features': { ... 'Uptime': {'retries': 3}, ... 'Users': {'snmp_community': 'monkey'}, ... }, ... }, ... }) == { ... 'set': {'snmp_version': '2c', 'snmp_community': 'public'}, ... 'targets': { ... 'exclude': ['Ping'], ... 'features': {'Uptime': {'retries': 3}, ... 'Users': {'snmp_community': 'monkey'}}}} True """ import os import re import sys from contextlib import contextmanager from functools import wraps if sys.version > '3': import urllib.parse as urlparse long = int unicode = str basestring = str ifilter = filter iteritems = dict.items else: from itertools import ifilter import urlparse iteritems = dict.iteritems __author__ = 'Alec Thomas <alec@swapoff.org>' __version__ = '0.8.5' @contextmanager def raises(exc, msg=None): try: yield except exc as e: if msg is not None: assert str(e) == msg, '%r != %r' % (str(e), msg) class Undefined(object): def __nonzero__(self): return False def __repr__(self): return '...' UNDEFINED = Undefined() class Error(Exception): """Base validation exception.""" class SchemaError(Error): """An error was encountered in the schema.""" class Invalid(Error): """The data was invalid. :attr msg: The error message. :attr path: The path to the error, as a list of keys in the source data. :attr error_message: The actual error message that was raised, as a string. """ def __init__(self, message, path=None, error_message=None, error_type=None): Error.__init__(self, message) self.path = path or [] self.error_message = error_message or message self.error_type = error_type @property def msg(self): return self.args[0] def __str__(self): path = ' @ data[%s]' % ']['.join(map(repr, self.path)) \ if self.path else '' output = Exception.__str__(self) if self.error_type: output += ' for ' + self.error_type return output + path class MultipleInvalid(Invalid): def __init__(self, errors=None): self.errors = errors[:] if errors else [] def __repr__(self): return 'MultipleInvalid(%r)' % self.errors @property def msg(self): return self.errors[0].msg @property def path(self): return self.errors[0].path @property def error_message(self): return self.errors[0].error_message def add(self, error): self.errors.append(error) def __str__(self): return str(self.errors[0]) class Schema(object): """A validation schema. The schema is a Python tree-like structure where nodes are pattern matched against corresponding trees of values. Nodes can be values, in which case a direct comparison is used, types, in which case an isinstance() check is performed, or callables, which will validate and optionally convert the value. """ def __init__(self, schema, required=False, extra=False): """Create a new Schema. :param schema: Validation schema. See :module:`voluptuous` for details. :param required: Keys defined in the schema must be in the data. :param extra: Keys in the data need not have keys in the schema. """ self.schema = schema self.required = required self.extra = extra self._compiled = self._compile(schema) def __call__(self, data): """Validate data against this schema.""" try: return self._compiled([], data) except MultipleInvalid: raise except Invalid as e: raise MultipleInvalid([e]) # return self.validate([], self.schema, data) def _compile(self, schema): if schema is Extra: return lambda _, v: v if isinstance(schema, Object): return self._compile_object(schema) if isinstance(schema, dict): return self._compile_dict(schema) elif isinstance(schema, list): return self._compile_list(schema) elif isinstance(schema, tuple): return self._compile_tuple(schema) type_ = type(schema) if type_ is type: type_ = schema if type_ in (int, long, str, unicode, float, complex, object, list, dict, type(None)) or callable(schema): return _compile_scalar(schema) raise SchemaError('unsupported schema data type %r' % type(schema).__name__) def _compile_mapping(self, schema, invalid_msg=None): """Create validator for given mapping.""" invalid_msg = invalid_msg or 'mapping value' default_required_keys = set(key for key in schema if (self.required and not isinstance(key, Optional)) or isinstance(key, Required)) _compiled_schema = {} for skey, svalue in iteritems(schema): new_key = self._compile(skey) new_value = self._compile(svalue) _compiled_schema[skey] = (new_key, new_value) def validate_mapping(path, iterable, out): required_keys = default_required_keys.copy() error = None errors = [] for key, value in iterable: key_path = path + [key] candidates = _iterate_mapping_candidates(_compiled_schema) for skey, (ckey, cvalue) in candidates: try: new_key = ckey(key_path, key) except Invalid as e: if len(e.path) > len(key_path): raise if not error or len(e.path) > len(error.path): error = e continue # Backtracking is not performed once a key is selected, so if # the value is invalid we immediately throw an exception. exception_errors = [] try: out[new_key] = cvalue(key_path, value) except MultipleInvalid as e: exception_errors.extend(e.errors) except Invalid as e: exception_errors.append(e) if exception_errors: for err in exception_errors: if len(err.path) > len(key_path): errors.append(err) else: err.error_type = invalid_msg errors.append(err) # If there is a validation error for a required # key, this means that the key was provided. # Discard the required key so it does not # create an additional, noisy exception. required_keys.discard(skey) break # Key and value okay, mark any Required() fields as found. required_keys.discard(skey) break else: if self.extra: out[key] = value else: errors.append(Invalid('extra keys not allowed', key_path)) for key in required_keys: if getattr(key, 'default', UNDEFINED) is not UNDEFINED: out[key.schema] = key.default else: msg = key.msg if hasattr(key, 'msg') and key.msg else 'required key not provided' errors.append(Invalid(msg, path + [key])) if errors: raise MultipleInvalid(errors) return out return validate_mapping def _compile_object(self, schema): """Validate an object. Has the same behavior as dictionary validator but work with object attributes. For example: >>> class Structure(object): ... def __init__(self, one=None, three=None): ... self.one = one ... self.three = three ... >>> validate = Schema(Object({'one': 'two', 'three': 'four'}, cls=Structure)) >>> with raises(MultipleInvalid, "not a valid value for object value @ data['one']"): ... validate(Structure(one='three')) """ base_validate = self._compile_mapping( schema, invalid_msg='object value') def validate_object(path, data): if (schema.cls is not UNDEFINED and not isinstance(data, schema.cls)): raise Invalid('expected a {0!r}'.format(schema.cls), path) iterable = _iterate_object(data) iterable = ifilter(lambda item: item[1] is not None, iterable) out = base_validate(path, iterable, {}) return type(data)(**out) return validate_object def _compile_dict(self, schema): """Validate a dictionary. A dictionary schema can contain a set of values, or at most one validator function/type. A dictionary schema will only validate a dictionary: >>> validate = Schema({}) >>> with raises(MultipleInvalid, 'expected a dictionary'): ... validate([]) An invalid dictionary value: >>> validate = Schema({'one': 'two', 'three': 'four'}) >>> with raises(MultipleInvalid, "not a valid value for dictionary value @ data['one']"): ... validate({'one': 'three'}) An invalid key: >>> with raises(MultipleInvalid, "extra keys not allowed @ data['two']"): ... validate({'two': 'three'}) Validation function, in this case the "int" type: >>> validate = Schema({'one': 'two', 'three': 'four', int: str}) Valid integer input: >>> validate({10: 'twenty'}) {10: 'twenty'} By default, a "type" in the schema (in this case "int") will be used purely to validate that the corresponding value is of that type. It will not Coerce the value: >>> with raises(MultipleInvalid, "extra keys not allowed @ data['10']"): ... validate({'10': 'twenty'}) Wrap them in the Coerce() function to achieve this: >>> validate = Schema({'one': 'two', 'three': 'four', ... Coerce(int): str}) >>> validate({'10': 'twenty'}) {10: 'twenty'} Custom message for required key >>> validate = Schema({Required('one', 'required'): 'two'}) >>> with raises(MultipleInvalid, "required @ data['one']"): ... validate({}) (This is to avoid unexpected surprises.) Multiple errors for nested field in a dict: >>> validate = Schema({ ... 'adict': { ... 'strfield': str, ... 'intfield': int ... } ... }) >>> try: ... validate({ ... 'adict': { ... 'strfield': 123, ... 'intfield': 'one' ... } ... }) ... except MultipleInvalid as e: ... print(sorted(str(i) for i in e.errors)) # doctest: +NORMALIZE_WHITESPACE ["expected int for dictionary value @ data['adict']['intfield']", "expected str for dictionary value @ data['adict']['strfield']"] """ base_validate = self._compile_mapping( schema, invalid_msg='dictionary value') groups_of_exclusion = {} for node in schema: if isinstance(node, Exclusive): if node.group_of_exclusion not in groups_of_exclusion.keys(): groups_of_exclusion[node.group_of_exclusion] = [] groups_of_exclusion[node.group_of_exclusion].append(node) def validate_dict(path, data): if not isinstance(data, dict): raise Invalid('expected a dictionary', path) errors = [] for label, group in groups_of_exclusion.items(): exists = False for exclusive in group: if exclusive.schema in data: if exists: msg = exclusive.msg if hasattr(exclusive, 'msg') and exclusive.msg else \ "two or more values in the same group of exclusion '%s'" % label errors.append(Invalid(msg, path)) break exists = True if errors: raise MultipleInvalid(errors) out = type(data)() return base_validate(path, iteritems(data), out) return validate_dict def _compile_sequence(self, schema, seq_type): """Validate a sequence type. This is a sequence of valid values or validators tried in order. >>> validator = Schema(['one', 'two', int]) >>> validator(['one']) ['one'] >>> with raises(MultipleInvalid, 'invalid list value @ data[0]'): ... validator([3.5]) >>> validator([1]) [1] """ _compiled = [self._compile(s) for s in schema] seq_type_name = seq_type.__name__ def validate_sequence(path, data): if not isinstance(data, seq_type): raise Invalid('expected a %s' % seq_type_name, path) # Empty seq schema, allow any data. if not schema: return data out = [] invalid = None errors = [] index_path = UNDEFINED for i, value in enumerate(data): index_path = path + [i] invalid = None for validate in _compiled: try: out.append(validate(index_path, value)) break except Invalid as e: if len(e.path) > len(index_path): raise invalid = e else: if len(invalid.path) <= len(index_path): invalid = Invalid('invalid %s value' % seq_type_name, index_path) errors.append(invalid) if errors: raise MultipleInvalid(errors) return type(data)(out) return validate_sequence def _compile_tuple(self, schema): """Validate a tuple. A tuple is a sequence of valid values or validators tried in order. >>> validator = Schema(('one', 'two', int)) >>> validator(('one',)) ('one',) >>> with raises(MultipleInvalid, 'invalid tuple value @ data[0]'): ... validator((3.5,)) >>> validator((1,)) (1,) """ return self._compile_sequence(schema, tuple) def _compile_list(self, schema): """Validate a list. A list is a sequence of valid values or validators tried in order. >>> validator = Schema(['one', 'two', int]) >>> validator(['one']) ['one'] >>> with raises(MultipleInvalid, 'invalid list value @ data[0]'): ... validator([3.5]) >>> validator([1]) [1] """ return self._compile_sequence(schema, list) def _compile_scalar(schema): """A scalar value. The schema can either be a value or a type. >>> _compile_scalar(int)([], 1) 1 >>> with raises(Invalid, 'expected float'): ... _compile_scalar(float)([], '1') Callables have >>> _compile_scalar(lambda v: float(v))([], '1') 1.0 As a convenience, ValueError's are trapped: >>> with raises(Invalid, 'not a valid value'): ... _compile_scalar(lambda v: float(v))([], 'a') """ if isinstance(schema, type): def validate_instance(path, data): if isinstance(data, schema): return data else: msg = 'expected %s' % schema.__name__ raise Invalid(msg, path) return validate_instance if callable(schema): def validate_callable(path, data): try: return schema(data) except ValueError as e: raise Invalid('not a valid value', path) except MultipleInvalid as e: for error in e.errors: error.path = path + error.path raise except Invalid as e: e.path = path + e.path raise return validate_callable def validate_value(path, data): if data != schema: raise Invalid('not a valid value', path) return data return validate_value def _iterate_mapping_candidates(schema): """Iterate over schema in a meaningful order.""" # We want Extra to match last, because it's a catch-all. # Without this, Extra might appear first in the iterator, and fail # to validate a key even though it's a Required that has its own # validation, generating a false positive. return sorted(iteritems(schema), key=lambda v: v[0] == Extra) def _iterate_object(obj): """Return iterator over object attributes. Respect objects with defined __slots__. """ d = {} try: d = vars(obj) except TypeError: # maybe we have named tuple here? if hasattr(obj, '_asdict'): d = obj._asdict() for item in iteritems(d): yield item try: slots = obj.__slots__ except AttributeError: pass else: for key in slots: if key != '__dict__': yield (key, getattr(obj, key)) raise StopIteration() class Object(dict): """Indicate that we should work with attributes, not keys.""" def __init__(self, schema, cls=UNDEFINED): self.cls = cls super(Object, self).__init__(schema) class Marker(object): """Mark nodes for special treatment.""" def __init__(self, schema, msg=None): self.schema = schema self._schema = Schema(schema) self.msg = msg def __call__(self, v): try: return self._schema(v) except Invalid as e: if not self.msg or len(e.path) > 1: raise raise Invalid(self.msg) def __str__(self): return str(self.schema) def __repr__(self): return repr(self.schema) class Optional(Marker): """Mark a node in the schema as optional.""" class Exclusive(Optional): """Mark a node in the schema as exclusive. Exclusive keys inherited from Optional: >>> schema = Schema({Exclusive('alpha', 'angles'): int, Exclusive('beta', 'angles'): int}) >>> schema({'alpha': 30}) {'alpha': 30} Keys inside a same group of exclusion cannot be together, it only makes sense for dictionaries: >>> with raises(MultipleInvalid, "two or more values in the same group of exclusion 'angles'"): ... schema({'alpha': 30, 'beta': 45}) For example, API can provides multiple types of authentication, but only one works in the same time: >>> msg = 'Please, use only one type of authentication at the same time.' >>> schema = Schema({ ... Exclusive('classic', 'auth', msg=msg):{ ... Required('email'): basestring, ... Required('password'): basestring ... }, ... Exclusive('internal', 'auth', msg=msg):{ ... Required('secret_key'): basestring ... }, ... Exclusive('social', 'auth', msg=msg):{ ... Required('social_network'): basestring, ... Required('token'): basestring ... } ... }) >>> with raises(MultipleInvalid, "Please, use only one type of authentication at the same time."): ... schema({'classic': {'email': 'foo@example.com', 'password': 'bar'}, ... 'social': {'social_network': 'barfoo', 'token': 'tEMp'}}) """ def __init__(self, schema, group_of_exclusion, msg=None): super(Exclusive, self).__init__(schema, msg=msg) self.group_of_exclusion = group_of_exclusion class Required(Marker): """Mark a node in the schema as being required, and optionally provide a default value. >>> schema = Schema({Required('key'): str}) >>> with raises(MultipleInvalid, "required key not provided @ data['key']"): ... schema({}) >>> schema = Schema({Required('key', default='value'): str}) >>> schema({}) {'key': 'value'} """ def __init__(self, schema, msg=None, default=UNDEFINED): super(Required, self).__init__(schema, msg=msg) self.default = default def Extra(_): """Allow keys in the data that are not present in the schema.""" raise SchemaError('"Extra" should never be called') # As extra() is never called there's no way to catch references to the # deprecated object, so we just leave an alias here instead. extra = Extra def Msg(schema, msg): """Report a user-friendly message if a schema fails to validate. >>> validate = Schema( ... Msg(['one', 'two', int], ... 'should be one of "one", "two" or an integer')) >>> with raises(MultipleInvalid, 'should be one of "one", "two" or an integer'): ... validate(['three']) Messages are only applied to invalid direct descendants of the schema: >>> validate = Schema(Msg([['one', 'two', int]], 'not okay!')) >>> with raises(MultipleInvalid, 'invalid list value @ data[0][0]'): ... validate([['three']]) """ schema = Schema(schema) @wraps(Msg) def f(v): try: return schema(v) except Invalid as e: if len(e.path) > 1: raise e else: raise Invalid(msg) return f def message(default=None): """Convenience decorator to allow functions to provide a message. Set a default message: >>> @message('not an integer') ... def isint(v): ... return int(v) >>> validate = Schema(isint()) >>> with raises(MultipleInvalid, 'not an integer'): ... validate('a') The message can be overridden on a per validator basis: >>> validate = Schema(isint('bad')) >>> with raises(MultipleInvalid, 'bad'): ... validate('a') """ def decorator(f): @wraps(f) def check(msg=None): @wraps(f) def wrapper(*args, **kwargs): try: return f(*args, **kwargs) except ValueError: raise Invalid(msg or default or 'invalid value') return wrapper return check return decorator def truth(f): """Convenience decorator to convert truth functions into validators. >>> @truth ... def isdir(v): ... return os.path.isdir(v) >>> validate = Schema(isdir) >>> validate('/') '/' >>> with raises(MultipleInvalid, 'not a valid value'): ... validate('/notavaliddir') """ @wraps(f) def check(v): t = f(v) if not t: raise ValueError return v return check def Coerce(type, msg=None): """Coerce a value to a type. If the type constructor throws a ValueError or TypeError, the value will be marked as Invalid. Default behavior: >>> validate = Schema(Coerce(int)) >>> with raises(MultipleInvalid, 'expected int'): ... validate(None) >>> with raises(MultipleInvalid, 'expected int'): ... validate('foo') With custom message: >>> validate = Schema(Coerce(int, "moo")) >>> with raises(MultipleInvalid, 'moo'): ... validate('foo') """ @wraps(Coerce) def f(v): try: return type(v) except (ValueError, TypeError): raise Invalid(msg or ('expected %s' % type.__name__)) return f @message('value was not true') @truth def IsTrue(v): """Assert that a value is true, in the Python sense. >>> validate = Schema(IsTrue()) "In the Python sense" means that implicitly false values, such as empty lists, dictionaries, etc. are treated as "false": >>> with raises(MultipleInvalid, "value was not true"): ... validate([]) >>> validate([1]) [1] >>> with raises(MultipleInvalid, "value was not true"): ... validate(False) ...and so on. """ return v @message('value was not false') def IsFalse(v): """Assert that a value is false, in the Python sense. (see :func:`IsTrue` for more detail) >>> validate = Schema(IsFalse()) >>> validate([]) [] """ if v: raise ValueError return v @message('expected boolean') def Boolean(v): """Convert human-readable boolean values to a bool. Accepted values are 1, true, yes, on, enable, and their negatives. Non-string values are cast to bool. >>> validate = Schema(Boolean()) >>> validate(True) True >>> with raises(MultipleInvalid, "expected boolean"): ... validate('moo') """ if isinstance(v, basestring): v = v.lower() if v in ('1', 'true', 'yes', 'on', 'enable'): return True if v in ('0', 'false', 'no', 'off', 'disable'): return False raise ValueError return bool(v) def Any(*validators, **kwargs): """Use the first validated value. :param msg: Message to deliver to user if validation fails. :param kwargs: All other keyword arguments are passed to the sub-Schema constructors. :returns: Return value of the first validator that passes. >>> validate = Schema(Any('true', 'false', ... All(Any(int, bool), Coerce(bool)))) >>> validate('true') 'true' >>> validate(1) True >>> with raises(MultipleInvalid, "not a valid value"): ... validate('moo') msg argument is used >>> validate = Schema(Any(1, 2, 3, msg="Expected 1 2 or 3")) >>> validate(1) 1 >>> with raises(MultipleInvalid, "Expected 1 2 or 3"): ... validate(4) """ msg = kwargs.pop('msg', None) schemas = [Schema(val, **kwargs) for val in validators] @wraps(Any) def f(v): error = None for schema in schemas: try: return schema(v) except Invalid as e: if error is None or len(e.path) > len(error.path): error = e else: if error: raise error if msg is None else Invalid(msg) raise Invalid(msg or 'no valid value found') return f def All(*validators, **kwargs): """Value must pass all validators. The output of each validator is passed as input to the next. :param msg: Message to deliver to user if validation fails. :param kwargs: All other keyword arguments are passed to the sub-Schema constructors. >>> validate = Schema(All('10', Coerce(int))) >>> validate('10') 10 """ msg = kwargs.pop('msg', None) schemas = [Schema(val, **kwargs) for val in validators] def f(v): try: for schema in schemas: v = schema(v) except Invalid as e: raise e if msg is None else Invalid(msg) return v return f def Match(pattern, msg=None): """Value must be a string that matches the regular expression. >>> validate = Schema(Match(r'^0x[A-F0-9]+$')) >>> validate('0x123EF4') '0x123EF4' >>> with raises(MultipleInvalid, "does not match regular expression"): ... validate('123EF4') >>> with raises(MultipleInvalid, 'expected string or buffer'): ... validate(123) Pattern may also be a _compiled regular expression: >>> validate = Schema(Match(re.compile(r'0x[A-F0-9]+', re.I))) >>> validate('0x123ef4') '0x123ef4' """ if isinstance(pattern, basestring): pattern = re.compile(pattern) def f(v): try: match = pattern.match(v) except TypeError: raise Invalid("expected string or buffer") if not match: raise Invalid(msg or 'does not match regular expression') return v return f def Replace(pattern, substitution, msg=None): """Regex substitution. >>> validate = Schema(All(Replace('you', 'I'), ... Replace('hello', 'goodbye'))) >>> validate('you say hello') 'I say goodbye' """ if isinstance(pattern, basestring): pattern = re.compile(pattern) def f(v): return pattern.sub(substitution, v) return f @message('expected a URL') def Url(v): """Verify that the value is a URL.""" try: urlparse.urlparse(v) return v except: raise ValueError @message('not a file') @truth def IsFile(v): """Verify the file exists.""" return os.path.isfile(v) @message('not a directory') @truth def IsDir(v): """Verify the directory exists. >>> IsDir()('/') '/' """ return os.path.isdir(v) @message('path does not exist') @truth def PathExists(v): """Verify the path exists, regardless of its type.""" return os.path.exists(v) def Range(min=None, max=None, min_included=True, max_included=True, msg=None): """Limit a value to a range. Either min or max may be omitted. Either min or max can be excluded from the range of accepted values. :raises Invalid: If the value is outside the range. >>> s = Schema(Range(min=1, max=10, min_included=False)) >>> s(5) 5 >>> s(10) 10 >>> with raises(MultipleInvalid, 'value must be at most 10'): ... s(20) >>> with raises(MultipleInvalid, 'value must be higher than 1'): ... s(1) """ @wraps(Range) def f(v): if min_included: if min is not None and v < min: raise Invalid(msg or 'value must be at least %s' % min) else: if min is not None and v <= min: raise Invalid(msg or 'value must be higher than %s' % min) if max_included: if max is not None and v > max: raise Invalid(msg or 'value must be at most %s' % max) else: if max is not None and v >= max: raise Invalid(msg or 'value must be lower than %s' % max) return v return f def Clamp(min=None, max=None, msg=None): """Clamp a value to a range. Either min or max may be omitted. """ @wraps(Clamp) def f(v): if min is not None and v < min: v = min if max is not None and v > max: v = max return v return f def Length(min=None, max=None, msg=None): """The length of a value must be in a certain range.""" @wraps(Length) def f(v): if min is not None and len(v) < min: raise Invalid(msg or 'length of value must be at least %s' % min) if max is not None and len(v) > max: raise Invalid(msg or 'length of value must be at most %s' % max) return v return f def In(container, msg=None): """Validate that a value is in a collection.""" @wraps(In) def validator(value): if not value in container: raise Invalid(msg or 'value is not allowed') return value return validator def Lower(v): """Transform a string to lower case. >>> s = Schema(Lower) >>> s('HI') 'hi' """ return str(v).lower() def Upper(v): """Transform a string to upper case. >>> s = Schema(Upper) >>> s('hi') 'HI' """ return str(v).upper() def Capitalize(v): """Capitalise a string. >>> s = Schema(Capitalize) >>> s('hello world') 'Hello world' """ return str(v).capitalize() def Title(v): """Title case a string. >>> s = Schema(Title) >>> s('hello world') 'Hello World' """ return str(v).title() def DefaultTo(default_value, msg=None): """Sets a value to default_value if none provided. >>> s = Schema(DefaultTo(42)) >>> s(None) 42 """ @wraps(DefaultTo) def f(v): if v is None: v = default_value return v return f def ExactSequence(validators, **kwargs): """Matches each element in a sequence against the corresponding element in the validators. :param msg: Message to deliver to user if validation fails. :param kwargs: All other keyword arguments are passed to the sub-Schema constructors. >>> from voluptuous import * >>> validate = Schema(ExactSequence([str, int, list, list])) >>> validate(['hourly_report', 10, [], []]) ['hourly_report', 10, [], []] """ msg = kwargs.pop('msg', None) schemas = [Schema(val, **kwargs) for val in validators] def f(v): if not isinstance(v, (list, tuple)): raise Invalid(msg) try: for i, schema in enumerate(schemas): v[i] = schema(v[i]) except Invalid as e: raise e if msg is None else Invalid(msg) return v return f if __name__ == '__main__': import doctest doctest.testmod()
true
7383f5100571ba71f80321c14faa4fcf6bd2b317
Python
xunathan96/CSC420
/Assignment 1/code/boundary.py
UTF-8
1,337
3.0625
3
[]
no_license
import numpy as np def crop_filter(filter): height, width = filter.shape # Crop filter to be odd x odd if height%2 == 0: height = height - 1 if width%2 == 0: width = width - 1 filter = filter[:height, :width] return filter def zero_pad(image, filter): height, width = filter.shape j = int((height-1)/2) k = int((width-1)/2) pad_axis_1 = (j,j) # Pad j pixels before and after axis 1 pad_axis_2 = (k,k) padding = (pad_axis_1, pad_axis_2) frame = np.pad(image, padding, mode='constant', constant_values=0) return frame, j, k def zero_pad_3D(image, filter): height, width, depth = filter.shape j = int((height-1)/2) k = int((width-1)/2) l = int((depth-1)/2) pad_axis_1 = (j,j) # Pad j pixels before and after axis 1 pad_axis_2 = (k,k) pad_axis_3 = (l,l) padding = (pad_axis_1, pad_axis_2, pad_axis_3) frame = np.pad(image, padding, mode='constant', constant_values=0) return frame, j, k, l def zero_pad_extend(image, filter): height, width = filter.shape pad_axis_1 = (height,height) # Pad j pixels before and after axis 1 pad_axis_2 = (width,width) padding = (pad_axis_1, pad_axis_2) frame = np.pad(image, padding, mode='constant', constant_values=0) return frame, height, width
true