datasets:
- multimolecule/gencode-human
library_name: multimolecule
license: agpl-3.0
mask_token: <mask>
pipeline_tag: fill-mask
tags:
- Biology
- DNA
widget:
- example_title: prion protein (Kanno blood group)
mask_index: 21
mask_index_1based: 22
masked_char: A
output:
- label: CTGTT
score: 0.958619
- label: CTGGT
score: 0.032288
- label: CTTTT
score: 0.002582
- label: CTCTT
score: 0.001927
- label: CTATT
score: 0.001795
pipeline_tag: fill-mask
sequence_type: cDNA
task: fill-mask
text: ATGGCGAACCTTGGCTGCTGG<mask>GGTTCTCTTTGTGGCCACATGGAGTGACCTGGGCCTCTGC
- example_title: interleukin 10
mask_index: 11
mask_index_1based: 12
masked_char: A
output:
- label: GCTCT
score: 0.998642
- label: GCGCT
score: 0.000622
- label: GCTCC
score: 0.000233
- label: GCTCA
score: 0.00011
- label: GCTGT
score: 0.000109
pipeline_tag: fill-mask
sequence_type: cDNA
task: fill-mask
text: ATGCACAGCTC<mask>TGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGCC
- example_title: Zaire ebolavirus
mask_index: 11
mask_index_1based: 12
masked_char: A
output:
- label: AATGA
score: 0.850157
- label: AAAGA
score: 0.086721
- label: AGTGA
score: 0.04054
- label: AAACA
score: 0.007653
- label: AAGGA
score: 0.005888
pipeline_tag: fill-mask
sequence_type: cDNA
task: fill-mask
text: >-
AATGTTCAAAC<mask>GTGAAGCTCTGTTAGCTGATGGTCTTGCTAAAGCATTTCCTAGCAATATGATGGTAGTCACAGAGCGTGAGCAAAAAGAAAGCTTATTGCATCAAGCATCATGGCACCACACAAGTGATGATTTTGGTGAGCATGCCACAGTTAGAGGGAGTAGCTTTGTAACTGATTTAGAGAAATACAATCTTGCATTTAGATATGAGTTTACAGCACCTTTTATAGAATATTGTAACCGTTGCTATGGTGTTAAGAATGTTTTTAATTGGATGCATTATACAATCCCACAGTGTTAT
- example_title: SARS coronavirus
mask_index: 14
mask_index_1based: 15
masked_char: A
output:
- label: TCTCT
score: 0.992082
- label: TTTCT
score: 0.007138
- label: TCTTT
score: 0.000205
- label: TCCCT
score: 0.000116
- label: TCTGT
score: 0.000113
pipeline_tag: fill-mask
sequence_type: cDNA
task: fill-mask
text: >-
ATGTTTATTTTCTT<mask>TTCTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATGATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTTTACTATCCTGATGAAATTTTTAGATCAGACACTCTTTATTTAACTCAGGATTTATTTCTTCCATTTTATTCTAATGTTACAGGGTTTCATACTATTAATCATACGTTTGACAACCCTGTCATACCTTTTAAGGATGGTATTTATTTTGCTGCCACAGAGAAATCAAATGTTGTCCGTGGTTGGGTTTTTGGTTCTACCATGAACAACAAGTCACAGTCGGTGATTATTATTAACAATTCTACTAATGTTGTTATACGAGCATGTAACTTTGAATTGTGTGACAACCCTTTCTTTGCTGTTTCTAAACCCATGGGTACACAGACACATACTATGATATTCGATAATGCATTTAAATGCACTTTCGAGTACATATCT
DNABERT
Pre-trained model on human genome using a masked language modeling (MLM) objective with k-mer tokenization.
Disclaimer
This is an UNOFFICIAL implementation of the DNABERT: pre-trained Bidirectional Encoder Representations from Transformers model for DNA-language in genome by Yanrong Ji, Zhihan Zhou, et al.
The OFFICIAL repository of DNABERT is at jerryji1993/DNABERT.
The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
The team releasing DNABERT did not write this model card for this model so this model card has been written by the MultiMolecule team.
Model Details
DNABERT is a bert-style model pre-trained on the human genome with k-mer tokenization in a self-supervised fashion. This means that the model was trained on the raw nucleotides of DNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the Training Details section for more information on the training process.
Variants
- multimolecule/dnabert-5mer-3mer: The DNABERT model pre-trained on 3-mer data.
- multimolecule/dnabert-5mer-4mer: The DNABERT model pre-trained on 4-mer data.
- multimolecule/dnabert-5mer-5mer: The DNABERT model pre-trained on 5-mer data.
- multimolecule/dnabert-5mer-6mer: The DNABERT model pre-trained on 6-mer data.
Model Specification
| Variants | Num Layers | Hidden Size | Num Heads | Intermediate Size | Num Parameters (M) | FLOPs (G) | MACs (G) | Max Num Tokens |
|---|---|---|---|---|---|---|---|---|
| dnabert-6mer | 12 | 768 | 12 | 3072 | 89.19 | 96.86 | 48.43 | 512 |
| dnabert-5mer | 86.83 | |||||||
| dnabert-4mer | 86.24 | |||||||
| dnabert-3mer | 86.10 |
Links
- Code: multimolecule.dnabert
- Data: multimolecule/gencode-human
- Paper: DNABERT: pre-trained Bidirectional Encoder Representations from Transformers model for DNA-language in genome
- Developed by: Yanrong Ji, Zhihan Zhou, Han Liu, Ramana V Davuluri
- Model type: BERT
- Original Repositories: jerryji1993/DNABERT
Usage
The model file depends on the multimolecule library. You can install it using pip:
pip install multimolecule
Direct Use
Masked Language Modeling
Default transformers pipeline does not support K-mer tokenization.
You can use this model directly with a pipeline for masked language modeling:
import multimolecule # you must import multimolecule to register models
from transformers import pipeline
predictor = pipeline("fill-mask", model="multimolecule/dnabert-5mer")
output = predictor("ATCG<mask>TGCA")
Downstream Use
Extract Features
Here is how to use this model to get the features of a given sequence in PyTorch:
from multimolecule import DnaBertModel
from transformers import AutoTokenizer
tokenizer = AutoTokenizer.from_pretrained("multimolecule/dnabert-5mer")
model = DnaBertModel.from_pretrained("multimolecule/dnabert-5mer")
text = "ATCGATCGATCGATCG"
input = tokenizer(text, return_tensors="pt")
output = model(**input)
Sequence Classification / Regression
This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression.
Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch:
import torch
from multimolecule import DnaBertForSequencePrediction
from transformers import AutoTokenizer
tokenizer = AutoTokenizer.from_pretrained("multimolecule/dnabert-5mer")
model = DnaBertForSequencePrediction.from_pretrained("multimolecule/dnabert-5mer")
text = "ATCGATCGATCGATCG"
input = tokenizer(text, return_tensors="pt")
label = torch.tensor([1])
output = model(**input, labels=label)
Token Classification / Regression
This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for token classification or regression.
Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch:
import torch
from multimolecule import DnaBertForTokenPrediction
from transformers import AutoTokenizer
tokenizer = AutoTokenizer.from_pretrained("multimolecule/dnabert-5mer")
model = DnaBertForTokenPrediction.from_pretrained("multimolecule/dnabert-5mer")
text = "ATCGATCGATCGATCG"
input = tokenizer(text, return_tensors="pt")
label = torch.randint(2, (len(text), ))
output = model(**input, labels=label)
Contact Classification / Regression
This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression.
Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch:
import torch
from multimolecule import DnaBertForContactPrediction
from transformers import AutoTokenizer
tokenizer = AutoTokenizer.from_pretrained("multimolecule/dnabert-5mer")
model = DnaBertForContactPrediction.from_pretrained("multimolecule/dnabert-5mer")
text = "ATCGATCGATCGATCG"
input = tokenizer(text, return_tensors="pt")
label = torch.randint(2, (len(text), len(text)))
output = model(**input, labels=label)
Training Details
DNABERT used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling.
Training Data
The DNABERT model was pre-trained on the human genome. The training data consists of DNA sequences from the human reference genome (GRCh38.p13), with all sequences containing only the four canonical nucleotides (A, T, C, G).
Training Procedure
Preprocessing
DNABERT used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT:
- 15% of the tokens are masked. In the last 20,000 steps, the masking rate is increased to 20%.
- In 80% of the cases, the masked tokens are replaced by
<mask>. - In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace.
- In the 10% remaining cases, the masked tokens are left as is.
Since DNABERT used k-mer tokenizer, it masks the entire k-mer instead of individual nucleotides to avoid information leakage.
For example, if the k-mer is 3, the sequence "TAGCGTAT" will be tokenized as ["TAG", "AGC", "GCG", "CGT", "GTA", "TAT"]. If the nucleotide "C" is masked, the adjacent tokens will also be masked, resulting ["TAG", "<mask>", "<mask>", "<mask>", "GTA", "TAT"].
Pre-training
The model was trained on 8 NVIDIA RTX 2080Ti GPUs.
- Batch size: 2,000
- Steps: 120,000
- Learning rate: 4e-4
- Learning rate scheduler: Linear
- Learning rate warm-up: 10,000 steps
Citation
@ARTICLE{Ji2021-cj,
title = "{DNABERT}: pre-trained Bidirectional Encoder Representations
from Transformers model for {DNA-language} in genome",
author = "Ji, Yanrong and Zhou, Zhihan and Liu, Han and Davuluri, Ramana V",
abstract = "MOTIVATION: Deciphering the language of non-coding DNA is one of
the fundamental problems in genome research. Gene regulatory
code is highly complex due to the existence of polysemy and
distant semantic relationship, which previous informatics
methods often fail to capture especially in data-scarce
scenarios. RESULTS: To address this challenge, we developed a
novel pre-trained bidirectional encoder representation, named
DNABERT, to capture global and transferrable understanding of
genomic DNA sequences based on up and downstream nucleotide
contexts. We compared DNABERT to the most widely used programs
for genome-wide regulatory elements prediction and demonstrate
its ease of use, accuracy and efficiency. We show that the
single pre-trained transformers model can simultaneously achieve
state-of-the-art performance on prediction of promoters, splice
sites and transcription factor binding sites, after easy
fine-tuning using small task-specific labeled data. Further,
DNABERT enables direct visualization of nucleotide-level
importance and semantic relationship within input sequences for
better interpretability and accurate identification of conserved
sequence motifs and functional genetic variant candidates.
Finally, we demonstrate that pre-trained DNABERT with human
genome can even be readily applied to other organisms with
exceptional performance. We anticipate that the pre-trained
DNABERT model can be fined tuned to many other sequence analyses
tasks. AVAILABILITY AND IMPLEMENTATION: The source code,
pretrained and finetuned model for DNABERT are available at
GitHub (https://github.com/jerryji1993/DNABERT). SUPPLEMENTARY
INFORMATION: Supplementary data are available at Bioinformatics
online.",
journal = "Bioinformatics",
publisher = "Oxford University Press (OUP)",
volume = 37,
number = 15,
pages = "2112--2120",
month = aug,
year = 2021,
copyright = "https://academic.oup.com/journals/pages/open\_access/funder\_policies/chorus/standard\_publication\_model",
language = "en"
}
The artifacts distributed in this repository are part of the MultiMolecule project. If you use MultiMolecule in your research, you must cite the MultiMolecule project as follows:
@software{chen_2024_12638419,
author = {Chen, Zhiyuan and Zhu, Sophia Y.},
title = {MultiMolecule},
doi = {10.5281/zenodo.12638419},
publisher = {Zenodo},
url = {https://doi.org/10.5281/zenodo.12638419},
year = 2024,
month = may,
day = 4
}
Contact
Please use GitHub issues of MultiMolecule for any questions or comments on the model card.
Please contact the authors of the DNABERT paper for questions or comments on the paper/model.
License
This model is licensed under the GNU Affero General Public License.
For additional terms and clarifications, please refer to our License FAQ.
SPDX-License-Identifier: AGPL-3.0-or-later