text
stringlengths
8
5.77M
Universal Studios Florida – Hollywood: Horror Make-Up Show How to take something gory, gruesome, and downright disgusting and turn it into wholesome, funny family fare? Universal has solved the problem with this enjoyable (not to mention educational) foray into the ghastly art of make-up and special effects for the horror genre. The key is a horror make-up “expert” with a bizarre and goofy sense of humor who is interviewed in a studio make-up lab by an on-stage host and straight-man. During a laugh-filled 25 minutes, our expert leads us through a grisly show-and-tell of basic horror movie tricks and gimmicks. It’s a roaring success that many call “Universal Studios’ best-kept secret.” Tip: The subject matter is undeniably gross and the performers are given fairly wide latitude to ad-lib. Some people may find either the subject matter or the humor (or both) beyond the bounds of good taste. The easily offended, then, should give this show a miss. Universal rates it PG-13. Using the inevitable volunteer from the audience (to very amusing effect), we learn how harmlessly dull knifes can be made to leave bloody trails on bare human flesh and, thanks to video projected onto two screens, we get a brief history of extreme makeup from Lon Chaney to modern masters Tom Savini and Rick Baker. Also on hand are mechanical werewolf heads like those used for the still stunning transformation scene in An American Werewolf in London. The show ends with a preview of a new, remotely controlled monster and yet another dirty trick played on a “volunteer.” This show actually instructs while it entertains. Everyone will have a keener understanding of basic horror effects, and young children will be sternly warned about the importance of safety at all times. (“Don’t do this at home . . . Do it at a friend’s house!”) The waiting area for this show is the lobby of the Pantages Theater, where you can peruse memorabilia displays from Universal’s horror-movie history while waiting for the show to begin. This is the best show at Universal and it just seems to get better and better every year. The performers, all skilled improvisers, play off the audience, making every show slightly different and rewarding repeat visits. The best seats in the house. If all you want to do is enjoy the show, the oft-repeated Universal refrain is absolutely true — every seat’s a good seat. Exhibitionists hoping to be selected as a volunteer should be aware that the performers have a predilection for young women seated in the middle, close to the stage.
Look at this NASA-taken picture. Tell me what you see at the top of the picture. Right… (Purple) lens flare! If it can happen on a picture taken by a camera used by NASA, why could it not happen on an iPhone or any other cameras for that matter? Because mindlessly jumping on the "Apple sucks" bandwagon in order to score cheap approval points of others is important to some. Gosh! Have we really gone this far? So far that we all believed that the "it just works" mentality has entitled us to just complain about any thing, and blame this on a design defect? The simple fact that people are complaining about lens flares and chromatic aberrations just shows how much they absolutely do not know how lens, light, refractions and other high-school physics work. They probably were sleeping in class, or just simply erased those teachings from their memory because they classified this as "Why am I learning this, it will not be useful to me in real life". What's next? Are they going to complain that we cannot use the phone under water, and that we cannot make phone calls because the battery is dead? Lens flares, chromatic aberrations, etc., are as old as lenses and cameras. That means centuries. Why do you think photographers use polarised filters, take multiple shots, and use a plethora of accessories when working with intense light source? For the fun of it, perhaps? Cameras use many lenses. Light trapped between lens components, the coating of the lenses, the materials use to fabricate the lenses, can all create aberrations in the output. And this holds true for cheap cameras to very expensive ones. Look at this NASA-taken picture. Tell me what you see at the top of the picture. Right… (Purple) lens flare! If it can happen on a picture taken by a camera used by NASA, why could it not happen on an iPhone or any other cameras for that matter? Are you seriously comparing a NASA camera, which probably has a massive lens aperture and sensor to accomodate a far wider scope, to the iPhone? And justifying the purple effect on the iPhone? This NASA camera can probably still capture the sun in the other hemisphere while it's setting in one. Jesus probably used the iPhone 5 to capture the Big Bang? Funny, the only likes you've got on your post are from the well known iToots, who'll toot their horn no matter what. While I've never experienced this problem on any of my iPhones up to & including the 4S or any of my android phones, it seems odd to me that every time apple have a problem with their devices, their response is often, "all phones do it, so shut up" While I've never experienced this problem on any of my iPhones up to & including the 4S or any of my android phones, it seems odd to me that every time apple have a problem with their devices, their response is often, "all phones do it, so shut up" And I've never had it happen on my iPhone 5, so I guess it never happens. Glad we got that one sorted out! Are you seriously comparing a NASA camera, which probably has a massive lens aperture and sensor to accomodate a far wider scope, to the iPhone? And justifying the purple effect on the iPhone? This NASA camera can probably still capture the sun in the other hemisphere while it's setting in one. Jesus probably used the iPhone 5 to capture the Big Bang? Funny, the only likes you've got on your post are from the well known iToots, who'll toot their horn no matter what. I bloody damn well am! Flares can happen with any camera. So what's your point?
The victory stance of a gold medalist and the slumped shoulders of a non-finalist are innate and biological rather than learned responses to success and failure, according to a University of British Columbia study using cross-cultural data gathered at the 2004 Olympic and Paralympic Games. In the first study of its kind, UBC psychology researcher Jessica Tracy investigated how pride and shame are expressed across cultures, and among the congenitally blind. She compared the non-verbal expressions and body language of sighted, blind, and congenitally blind judo competitors representing more than 30 countries, among them Algeria, Taiwan, North Korea, the Ukraine and the United States. Asst. Prof. Tracy's findings – published in this week's online Early Edition of the journal Proceedings of the National Academy of Sciences – show that the individuals displayed pride and shame behaviours in response to the same success and failure situations. Pride, unlike fear, anger or joy – which are categorized as primary emotions – has received little research attention in the past, explains Tracy. Her work explores how pride as an innate human biological response has evolved through time and shapes human social dynamics. "Since congenitally blind individuals could not have learned pride and shame behaviors from watching others, these displays of victory or defeat are likely to be an innate biological propensity in humans, rather than learned behaviour," says Tracy. Tracy and co-author Psychology Prof. David Matsumoto of San Francisco State University analyzed photos taken by an official International Judo Federation photographer who was not told about the specific research goals. The photographer shot the athletes during and immediately after each match, repeatedly for approximately 15 seconds, allowing for a series of moment-by moment images of each behavioural response. The researchers coded the athletes' head, arms and body positions. They found that winning athletes, both sighted and blind and across all cultures, tended to raise their arms, tilt their head up and puff out their chest. Also largely universal were the expressions of defeat, which include slumped shoulders and a narrowed chest. The researchers found that, to some extent, culture moderated the shame response among sighted athletes. It was less pronounced among individuals from highly individualistic, self-expression-valuing cultures, primarily in North America and West Eurasian countries. However, congenitally blind athletes across cultures showed the shame response, suggesting that the cultural difference found among sighted athletes was due to the Western cultural norm of hiding one's shame. "These findings support evolutionary accounts that pride and shame would have been powerful mechanisms in enhancing or inhibiting an individual's social status," says Tracy.
Some comments on the concepts of dose and dose equivalent. Although dose is the simplest and most widely used measurement of a radiation field, it does not always lead to an unambiguous estimate of response. This is reflected in the very wide range of relative biologic effectiveness (RBE) values for biological systems. The ambiguity arises from the focus on energy deposition as the source of biological effect, whether in macroscopic or microscopic volumes. The properties of the biological detector play a role equally important to the properties of the radiation field in their interaction. To predict even the most experimentally accessible biological response, cell killing, we must know the probability per unit path length for generating the observed end point. Especially for high LET radiations we need the action across sections and the particle-energy spectrum. No one parameter reduction of a radiation field can predict biological effect. For cell killing such a prediction can be made, however, from a two-parameter reduction of the interaction between the radiation field and a specific cell line and a specific ambience of the survival curve for the specific radiation field. The determination of these two parameters leads to a suggested new procedure for evaluating the dose equivalent.
Q: Passing parameter to delegate function I currently have this: instance = new Class1<Type1>( "param1", () => new ViewDataDictionary<Type2>( new Class2 { Prop1= CreateList(new List<long> { 234 }), Prop2= CreateList(new long[] { 234 }) }) ); I want to pass a variable in the function CreateList instead. Something like this long p1 = 123; instance = new Class1<Type1>( "param1", () => new ViewDataDictionary<Type2>( new Class2 { Prop1= CreateList(new List<long> { p1}), Prop2= CreateList(new long[] { p1}) }) ); But it gives me serialization error if I try to do the above. All the classes are marked serializable. A: When you reference a local variable in a lambda expression, it generates a closure (a compiler-generated class that "captures" your local variable as a field). This closure is not marked as serializable, so the serialization fails... Instead, you could change the type of the lambda expression to accept a parameter, and pass the value as a separate parameter : long p1 = 123; instance = new Class1<Type1>( "param1", (prm) => new ViewDataDictionary<Type2>( new Class2 { Prop1= CreateList(new List<long> { prm }), Prop2= CreateList(new long[] { prm }) }), p1);
Clean intermittent self-catheterization does not appear to be effective in the prevention of urethral stricture recurrence. The aim of this study was to assess the effect of clean intermittent self-catheterization (CISC) on stricture recurrence. The incidence of stricture recurrence was assessed retrospectively in a group of 126 new patients treated endoscopically for urethral stricture in a general urological setting between 1994 and 2001, of whom 31 performed twice-weekly CISC and 95 did not. Stricture recurrence was defined as recurrent symptomatic stricture requiring further operative intervention following initial intervention. The mean follow-up available was 25 months (range 1-132 months). Of the 126 patients assessed, 60 (47.6%) developed recurrent stricture and required an average of 3.13 endoscopic retreatments each during the follow-up period. There was no significant difference (chi-squared p = 0.46) between the number of stricture recurrences in those performing CISC (13-41.9%) and those not performing CISC (47-49.5%). CISC does not appear to prevent medium-term stricture recurrence.
Skyfoiled: Naomie Harris is shocked to find out her Oscars dress idea has been done by Emma Watson We break the bad news to Bond actress Naomie about her Ferrero Rocher wrappers frock There's only one thing worse than turning up on the red carpet ­wearing the same dress as someone else... finding out your Oscar dress idea has already been done. It’s a ­fashion fail of Katie Price ­proportions. Bond actress Naomie Harris now feels as uncomfortable as Victoria Beckham in flats about her Oscar frock thanks to us. Erm, awks. She revealed her plans to go “eco” and wear a frock made from recycled sweet wrappers courtesy of Vivienne Westwood when she attends the film bash next weekend. The only snag is Harry Potter actress Emma Watson got there first. And we had to break the news. Naomie said: “I’ve been having fittings for the dress this week and it’s fabulous, designed by a guy called Michael Badger from Ghana who won the Red Carpet Green Dress Challenge. He is lovely and based his design on a volcano and flowing lava. He didn’t know I was going to be wearing it when he won and they flew him to London so he could be there for my fitting.” This, she added, was at Vivienne Westwood HQ, where it was being made. “I’m really into sustainability and recycling and this is a great way to show it.” And then we dropped a style bombshell the size of Sarah Jessica Parker’s cupboard... she’s not the first to wear a dress which looks like Ferrero Rocher wrappers – another Brit A-lister did last a couple of years ago. Eeek. Getty Emma in "Ferrero" dress in 2009 Naomie’s face fell faster than a Bond villain dispatched with a Walther PPK when we showed her a picture of Emma’s gold outfit. She said: “Oh my goodness it is a bit similar, I can’t believe she’s done it first.” Then, quickly regaining her composure (what a pro) she added: “Obviously, mine is more of a gown rather than a party dress. I kind of wish you hadn’t shown me but good researching skills.” Why thank you. While Naomie is comfortable dressing up, she’s revealed she’s not that happy stripping off. Talking on a train, renamed Skyfall to promote the release of the DVD and Blu-ray tomorrow, she said: “I don’t think as an actress you should have to resort to nudity. I told Michael Mann, the director of Miami Vice, I wouldn’t do it.”
There are specific reasons to study at Macalester. Our students share theirs. Two great cities at your doorstep. Macalester is nestled in a lovely, residential neighborhood–minutes from downtown St. Paul and Minneapolis–which offers students a wealth of internship opportunities in business, finance, medicine, government, law, the arts, and more. Global neighborhood in your dorm. Macalester students are citizens of over 90 countries. Before your first class begins, you will have already started learning by sharing the college experience with new friends from around the world. Faculty who know how to make a difference. Our faculty earned their advanced degrees from some of the best schools in the world, and they remain thought-leaders in their fields. You'll have direct access to them since nearly 70% of classes have fewer than 20 students. They care about your future. Resources for enriched investigation. Macalester students enjoy a wealth of resources for research on and off campus–specialized laboratories, libraries, museum collections, distinct population groups for surveys, even a natural history center. Often students undertake research that makes real contributions to their discipline. They publish papers in scholarly journals, participate in conferences, and provide analysis for policy makers and real-world use.
" Requests the debugger to reselect in its code pane the next expression to be executed " Class { #name : #StWhereIsCommand, #superclass : #StDebuggerCommand, #category : #'NewTools-Debugger-Commands' } { #category : #default } StWhereIsCommand class >> defaultDescription [ ^ 'Highligh the next method to be executed (step) by the debugger.' ] { #category : #initialization } StWhereIsCommand class >> defaultIconName [ ^ #glamorousSearch ] { #category : #default } StWhereIsCommand class >> defaultName [ <toolbarDebugCommand: 1000> ^ 'Where is?' ] { #category : #initialization } StWhereIsCommand class >> defaultShortcut [ ^ nil ] { #category : #testing } StWhereIsCommand >> appliesTo: aDebugger [ ^ true ] { #category : #hooks } StWhereIsCommand >> execute [ self debugger selectNextExecutedExpression ]
Electron microscopical morphology of cytoplasmic granules from horse eosinophil leucocytes. The structure of specific granules from horse eosinophil leukocytes is still largely unknown. In this work, electron microscopical studies of horse eosinophils reveal that the large cytoplasmic granules contain an external membrane, a matrix of less density, and a dense (non crystalline) core. Round vacuolar inclusions of matrix materials were often observed within the cores. Horse eosinophil granules showed a considerable heterogeneity, and three morphological types could be identified according to structural features of the core and matrix.
Capacitors of the type utilized with ballasts in AC applications are commonly made from a metallized film, such as polypropylene. To form the capacitor, the film is typically wound into one or more roll-shaped capacitor sections which are housed within a sealed metal container. Such containers often include a mechanical interrupter which disconnects the capacitor from external terminals, in the event that there is excessive pressure or temperature within the container. In addition, the capacitor is impregnated with oil and the entire container is filled with oil, in order to seal out air and moisture. This avoids the possibility that air or moisture inside the capacitor might ionize and produce electrical arcing. The problem with oil-filled capacitors is that the oils used are considered to present an environmental and health hazard. Accordingly, great care must be taken to avoid leakage of the oil from the capacitor casing while the capacitor is installed. In addition, disposal of capacitors that are no longer usable requires that they be subjected to special toxic waste treatment. In some instances, metallized capacitor sections for fluorescent lighting applications have been dipped in wax. However, wax exhibits a relatively high degree of shrinkage and has a tendency to develop cracks. In high voltage applications, air and/or moisture is likely to enter these cracks and results in early failure of the capacitor, owing to electrical arcing. Also, wax tends to be a relatively expensive material for use in capacitors. Broadly, it is an object of the present invention to avoid the shortcomings of existing capacitors used for a AC applications. It is specifically contemplated that the invention provide a capacitor used for relatively high voltage AC applications which does not require a liquid impregnant in order to seal the capacitor against the entry of air and moisture. It is another object of the present invention to provide a metal encased capacitor which does not require a liquid fill material, yet is resistive to failures due to the leakage of air and/or moisture thereinto, and which will continue to function reliably in relatively high voltage applications for extended periods of time. It is also an object of the present invention to provide a capacitor for AC applications which is reliable, safe and convenient in use, yet relatively inexpensive in construction. It is also an object of the present invention to provide a method for manufacturing a capacitor useful in AC applications which meets one or more of the foregoing objects. In accordance with a preferred embodiment of the present invention, a capacitor for an AC application is manufactured from zinc alloy metallized polypropylene sheet material. The sheet material is wound into one or more sections having a roll-shape, which sections are placed within a metal container and provided with electrical terminals for connecting to the exterior of the container. The metal container is then filled with a potting compound comprising 80%-90% blown asphalt and 10%-20% wax additive. When the potting compound sets, the capacitor sections are sealed therein so as to be protected from air, moisture and thermal and electrical shock. The container is then covered with a top which includes a pressure interrupter, and it is sealed. This capacitor exhibits improved resistance to deterioration due to environmental factors over long periods of time, and it permits operation with higher voltages than was previously possible.
//////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////// // Copyright (c) Microsoft Corporation. All rights reserved. //////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////// #ifndef _TINYCLR_SYSTEM_XML_NATIVE_H_ #define _TINYCLR_SYSTEM_XML_NATIVE_H_ #include <TinyCLR_Runtime.h> #include <TinyCLR_Checks.h> #include <TinyCLR_Diagnostics.h> #include <TinyCLR_Hardware.h> #include <TinyCLR_Xml.h> #include <TinyCLR_Version.h> #include <system_xml_native.h> #include <SPOT_native.h> #include <CorLib_native.h> #endif
Lupus flares in two established end-stage renal disease patients with on-line hemodiafiltration during pregnancy - case series. Many patients with established end-stage renal disease on maintenance dialysis as a result of lupus nephritis are young females in their reproductive years. We report two such patients dialyzed with on-line hemodiafiltration who developed reactivation of lupus disease activity only when they conceived after initial systemic lupus erythematosus burnout. We believe that the flare was triggered by both efficient dialysis and hormonal changes during pregnancy. The flares were treated with oral corticosteroids with an excellent response. Both patients had live births but delivered preterm.
"No, you misunderstand," he said firmly. "These looters weren't Japanese. They were foreigners." The reasons for this are complex and partly cultural, but one reason is that Japan has tried hard to stitch all Japanese together into the nation's social fabric. In contrast, the U.S. -- particularly under the Bush administration -- has systematically cut people out of the social fabric by redistributing wealth from the most vulnerable Americans to the most affluent. It's not just that funds may have gone to Iraq rather than to the levees in New Orleans; it's also that money went to tax cuts for the wealthiest rather than vaccinations for children. None of this is to suggest that there are easy solutions for American poverty. As Ronald Reagan once said, "We fought a war on poverty, and poverty won." But we don't need to be that pessimistic -- in the late 1990's, we made real headway. A ray of hope is beautifully presented in one of the best books ever written on American poverty, "American Dream," by my Times colleague Jason DeParle. So the best monument to the catastrophe in New Orleans would be a serious national effort to address the poverty that afflicts the entire country. And in our shock and guilt, that may be politically feasible. Rich Lowry of The National Review, in defending Mr. Bush, offered an excellent suggestion: "a grand right-left bargain that includes greater attention to out-of-wedlock births from the Left in exchange for the Right's support for more urban spending." That would be the best legacy possible for Katrina. Otherwise, long after the horrors have left TV screens, about 50 of the 77 babies who die each day, on average, will die needlessly, because of poverty. That's the larger hurricane of poverty that shames our land. Op-Ed Columnist E-mail: nicholas@nytimes.com
Mi Tren Mi Tren is a light rail network under construction in the Bolivian city of Cochabamba, linking the city with Suticollo, El Castillo and San Simon University. Construction began in 2017 and is due to be finished in 2020. Background Construction began on the $504 million project in 2017 and is expected to be complete in 2020. Lines Rolling stock Stadler is due to supply 12 vehicles for the network, with delivery expected in August 2019, and Stadler is to provide three years' maintenance. Reports suggest that the Metelitsa model will be supplied, with the three-section vehicles having capacity for 200 passengers and a maximum speed of 80 km/h. References Category:Transport in Bolivia Category:Rail transport in Bolivia Category:Under construction tram and light rail transit systems
Expression of XMyoD protein in early Xenopus laevis embryos. A monoclonal antibody specific for Xenopus MyoD (XMyoD) has been characterized and used to describe the pattern of expression of this myogenic factor in early frog development. The antibody recognizes an epitope close to the N terminus of the products of both XMyoD genes, but does not bind XMyf5 or XMRF4, the other two myogenic factors that have been described in Xenopus. It reacts in embryo extracts only with XMyoD, which is extensively phosphorylated in the embryo. The distribution of XMyoD protein, seen in sections and whole-mounts, and by immunoblotting, closely follows that of XMyoD mRNA. XMyoD protein accumulates in nuclei of the future somitic mesoderm from the middle of gastrulation. In neurulae and tailbud embryos it is expressed specifically in the myotomal cells of the somites. XMyoD is in the nucleus of apparently every cell in the myotomes. It accumulates first in the anterior somitic mesoderm, and its concentration then declines in anterior somites from the tailbud stage onwards.
About Water & Tea Hello and thanks for visiting my humble site. I live on Orcas Island, in the San Juan Islands outside of Seattle, and I run this site from a cabin in the woods. I have been all over the world and decided I wanted to live where I wanted to live, selling products I use every day. I hope you enjoy them too! Thanks for your support and feel free to drop me a message if you want to say hi, or have any questions about these amazing products. Blessings! Dan I LOVE the TC Energy Design Delicate Carafe I ordered from you. I’ve done blind studies with nearly 10 people thus far. Without fail, they have no expression when they drink the water that was not in the carafe, and without fail, they make some sort of facial expression such as raising their eyebrows and then continue drinking it without returning to the other glass. The most common response is that is feels “softer and smoother” and a few folks have said it “tastes better.” The water taste “wetter” and “rounder” after just a few minutes in the carafe. I feel like my body absorbs the water better once it’s structured. I use my Alladin every day and have for over a year. I can’t imaging living without it.
Q: SQL - Display 2 columns as 1, but still use the ID_Column as a primary Key I have a table with 2 columns, Product ID and Product Description. In asp.NET I am populating a dropdown list with a datatable, and the user selects a product. Therefore I still need to use the ID as the identifier, but having a product description would help so the user would know what the product is. How is this done best? This is what I have so far (C#): public static DataTable GetProductList() { DatabaseAdapter dba = DatabaseAdapter.GetInstance(); string sqlQuery = ("SELECT PRODUCT_ID FROM PRODUCT"); DataTable dt = new DataTable(); dt.Load(dba.QueryDatabase(sqlQuery)); return dt; } This is where I am binding it (C#): private void PopulateProductList() { try { ProductList.DataSource = BusinessLayerHandler.GetUnitList(); ProductList.DataTextField = "PRODUCT_ID"; ProductList.DataValueField = "PRODUCT_ID"; ProductList.DataBind(); } catch { new Logging("E00080002"); Alert("Failed to Import Product List"); } } The current result is a List of Product ID's: 1, 2, 3, 4 and I need ID + Description: 1 - Photo Album, 2 - File, 3 - Pencil Box Then I would need to get the value of that list, but I don't need id + description, I only need the id as the identifier. This is where it is not yet clear, how is this done? String productID = ProductList.SelectedValue; I am using Oracle as my Database A: Try this: public static DataTable GetProductList() { DatabaseAdapter dba = DatabaseAdapter.GetInstance(); // Return a second, aliased column that concatenates PRODUCT_ID // with " - " and DESCRIPTION (alias NEW_DESCRIPTION) string sqlQuery = ("SELECT PRODUCT_ID, PRODUCT_ID + " - " + DESCRIPTION AS NEW_DESCRIPTION FROM PRODUCT"); DataTable dt = new DataTable(); dt.Load(dba.QueryDatabase(sqlQuery)); return dt; } private void PopulateProductList() { try { ProductList.DataSource = BusinessLayerHandler.GetUnitList(); // Assign the NEW_DESCRIPTION column to the DataTextField ProductList.DataTextField = "NEW_DESCRIPTION"; ProductList.DataValueField = "PRODUCT_ID"; ProductList.DataBind(); } catch { new Logging("E00080002"); Alert("Failed to Import Product List"); } } Essentially, select the PRODUCT_ID column and the PRODUCT_ID and DESCRIPTION columns cocatenated together - I aliased the second column for ease of reference. Then you can assign PRODUCT_ID to the DataValueField of the DropDownList and the concatenated column (in this case NEW_DESCRIPTION) to the DataTextField. EDIT If you simply want to get the product id (for the DropDownList value fields) and the product description for the Drop Down List option's text, modify the Select as follows: string sqlQuery = ("SELECT PRODUCT ID, DESCRIPTION FROM PRODUCT"); and then modify the DataTextField and DataValueField as follows: ProductList.DataTextField = "NEW_DESCRIPTION"; ProductList.DataValueField = "PRODUCT_ID"; The syntax for the SQL might be a little different for Oracle (I'm using SQL Server syntax), but the concept is the same - if you want one column's value for the DropDownList's value field and another column's value for the DropDownList's text field, simply select both columns from the table and assign them accordingly. This modification would produce a DropDownList with the following items: Photo Album File Pencil Box And a corresponding values for the items as: 1 2 3
1. Introduction {#sec1-diagnostics-09-00080} =============== Myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) encompasses diverse symptoms that manifest variably across a range of body systems, the characteristic symptoms being chronic unexplained fatigue (lasting more than 6 months) and post-exertional malaise (PEM)---a disabling and exacerbated disease state following bouts of physical or mental exertion that exceed a patient-specific threshold. ME/CFS also entails a varied kaleidoscope of other symptoms including muscle weakness, migraine, flu-like symptoms, cognitive impairment ("brain fog"), and sensitivities to a variety of external stimuli that may include light, sound, or specific odors. This can be accompanied by comorbidities, such as fibromyalgia, postural orthostatic tachycardia (POTS), and Ehlers--Danlos syndrome. A major challenge for this field of study has been the varied usage of multiple diagnostic case criteria that may render comparison between studies difficult depending on the composition of the participant cohort. Furthermore, these criteria are slow processes of exclusion that leave patients without the support or acknowledgment that they need for extended periods and they may be subjected to a protracted, harsh, and insensitive diagnostic gauntlet. These problems are further compounded by medical guidelines in some developed countries that are out of date regarding ME/CFS clinical practice and require urgent overdue revision. Case definitions, such as the commonly termed Oxford \[[@B1-diagnostics-09-00080]\] or Fukuda \[[@B2-diagnostics-09-00080]\] criteria, are most often utilized throughout the UK and USA, respectively, yet may fail to discriminate between generalized chronic fatigue and ME/CFS which specifically also involves PEM, which aids in characterizing this disorder as a discrete clinical entity. Also in usage are the Canadian Consensus Criteria \[[@B3-diagnostics-09-00080]\] and International Consensus Criteria \[[@B4-diagnostics-09-00080]\], which mandate PEM for a diagnosis of ME/CFS and therefore may be considered more specific definitions. While the presence of PEM is an optional component of the Fukuda criteria, PEM is, unfortunately, not required for research participation by all studies using this or other less strict definitions. Consequently, the discovery of a reliable diagnostic biomarker is perhaps the most common recurring theme in modern ME/CFS research. Despite myriad relevant study outcomes \[[@B5-diagnostics-09-00080],[@B6-diagnostics-09-00080],[@B7-diagnostics-09-00080],[@B8-diagnostics-09-00080],[@B9-diagnostics-09-00080],[@B10-diagnostics-09-00080],[@B11-diagnostics-09-00080],[@B12-diagnostics-09-00080],[@B13-diagnostics-09-00080],[@B14-diagnostics-09-00080],[@B15-diagnostics-09-00080],[@B16-diagnostics-09-00080]\], no such discovery has yet been widely validated or implemented as a suitable diagnostic biomarker of ME/CFS. Not only does ME/CFS affect multiple body systems and organs, but it does so with different and time-varying levels of severity and different patterns of comorbidities in different individuals, thereby producing a highly heterogeneous patient population \[[@B7-diagnostics-09-00080],[@B17-diagnostics-09-00080],[@B18-diagnostics-09-00080],[@B19-diagnostics-09-00080],[@B20-diagnostics-09-00080],[@B21-diagnostics-09-00080],[@B22-diagnostics-09-00080],[@B23-diagnostics-09-00080]\]. This complexity represents a major challenge to the task of incriminating one underlying pathological mechanism. It is also possible that different causative molecular insults result in different subsequent clinical presentations and this could contribute towards heterogeneity in the disorder. Patient subtyping to manage this heterogeneity has been previously discussed in the field \[[@B20-diagnostics-09-00080],[@B23-diagnostics-09-00080]\] and is lent credence by reproduced patterns of differential disease-associated gene expression \[[@B24-diagnostics-09-00080],[@B25-diagnostics-09-00080],[@B26-diagnostics-09-00080]\], gene expression profiles concurrent with comorbid POTS \[[@B27-diagnostics-09-00080]\], distinct DNA methylation profiles associated with quality of life scores and PEM \[[@B28-diagnostics-09-00080]\], severity and frequency of physical or mental fatigue \[[@B29-diagnostics-09-00080]\], or irritable bowel syndrome (IBS) comorbidity \[[@B30-diagnostics-09-00080]\], which can be concurrent with specific changes to patient metabolism \[[@B31-diagnostics-09-00080]\]. As timely, objective, and accurate diagnosis remains the most clear challenge facing the field, patient subtyping may be an important component of new diagnostic techniques and has seen early investigation with stratification-based severity scores \[[@B32-diagnostics-09-00080]\] or cytokine co-expression patterns \[[@B33-diagnostics-09-00080]\]. In summation, ME/CFS etiology has been difficult to pin down due to the combination of a diagnostic quagmire and the disorder's heterogeneous symptom presentation across multiple body systems. A traditional view has held that ME/CFS onset is often precipitated by some manner of bodily insult, commonly infection, however, the disorder is left without any known single causative pathogen to date. Given the heterogeneity of the patient population, this is unsurprising. It is possible that the initial pathological insult may not always be pathogen-mediated and could instead be instigated by alternative stresses of sufficient magnitude as to nudge homeostatic regulation loops into alternative stable states \[[@B34-diagnostics-09-00080]\], and these varying modes of initial insult may contribute to the heterogeneity of ME/CFS clinical presentation. Current research shows a tangible biomedical foundation underlying this clinical puzzle. Most of this evidence pertains to disturbed muscle function, metabolism, mitochondria, immunity, signaling, neurological, adrenal, and gut health. It is possible that these threads are together entangled as parts of an underlying molecular pathology reflecting a far-reaching homeostatic shift influencing each of these systems, perhaps differentially between individuals with varying clinical features. Furthermore, evidence of abnormalities affecting multiple systems is based on associations and the causal mechanisms responsible for the underlying pathology have yet to be determined. The following sections will address the current evidence for dysfunction across these systems in ME/CFS with specific examples of potential pathological interactions. 2. Abnormal Metabolism and Mitochondrial Function {#sec2-diagnostics-09-00080} ================================================= The nature of the persistent fatigue and PEM experienced by patients renders the area of cellular energetics fertile ground for investigation. However, in the intervening years since early studies \[[@B35-diagnostics-09-00080],[@B36-diagnostics-09-00080],[@B37-diagnostics-09-00080]\], mitochondria had been largely neglected in the field until their re-emergence as an area of interest during the last 10 years \[[@B9-diagnostics-09-00080]\]. The recent interest in this area has since generated a basis to support some manner of both mitochondrial and broader metabolic dysfunction in ME/CFS. 2.1. Dysregulated Amino Acid Metabolism and Impaired Provision of TCA Cycle Substrate {#sec2dot1-diagnostics-09-00080} ------------------------------------------------------------------------------------- This accumulation of evidence supporting dysregulated metabolism and mitochondrial energetics in ME/CFS has taken place across many experimental areas. There have been recent studies utilizing the metabolomics approach, which captures a quantitative snapshot of steady-state metabolite levels in a sample to infer underlying biochemical pathway modulation, typically achieved by either mass spectrometry (MS) or nuclear magnetic resonance (NMR) spectroscopy applications. The first of these studies used NMR to interrogate analytes within ME/CFS blood samples and reported decreases in glutamine and ornithine concentrations, suggesting abnormal amino acid metabolism linked to urea cycle dysregulation \[[@B38-diagnostics-09-00080]\]. A subsequent study utilizing MS conversely reported an elevation in ornithine concentration with a decrease in citrulline, but this also suggests urea cycle dysregulation \[[@B6-diagnostics-09-00080]\]. Subsequent work undertaken by the authors of the first study proposed that impaired glycolytic formation of pyruvate could be providing less downstream oxidized pyruvate derivatives to be used as substrate for the tricarboxylic acid (TCA) cycle \[[@B39-diagnostics-09-00080]\]. Work by others suggested that instead of a reduction in the glycolytic pyruvate supply, a deficiency in pyruvate dehydrogenase (PDH) function may form a bottleneck for the provision of TCA cycle substrate \[[@B40-diagnostics-09-00080]\]. These and the previous amino acid discrepancies could be due to differences in techniques (NMR vs. MS) and thus the range of detectable molecules. What could be taken from both lines of approach---supported by data from other similar studies \[[@B6-diagnostics-09-00080],[@B13-diagnostics-09-00080],[@B31-diagnostics-09-00080]\] and one cell culture study \[[@B41-diagnostics-09-00080]\]---is that there may be some manner of TCA cycle disturbance in ME/CFS, possibly one that is substrate supply-driven. 2.2. Inefficient ATP Synthesis and Abnormal Energy Stress Signaling {#sec2dot2-diagnostics-09-00080} ------------------------------------------------------------------- If the TCA cycle output of oxidative phosphorylation (OXPHOS) complex substrates is reduced by such a glycolysis \[[@B39-diagnostics-09-00080]\] or PDH \[[@B40-diagnostics-09-00080]\] defect, one might expect disturbances in cellular energy production in ME/CFS cells. There have been several studies which report a reduction of steady-state ATP levels \[[@B9-diagnostics-09-00080],[@B42-diagnostics-09-00080],[@B43-diagnostics-09-00080]\], yet other studies have reported an elevation \[[@B44-diagnostics-09-00080]\]. However, these steady-state measures do not provide information as to the metabolic flux (rates of production and depletion) of the molecule of interest. Real-time parameters of aerobic respiration and glycolysis can be measured in live cells by extracellular flux assays, which measure oxygen consumption rates (OCRs) and extracellular acidification rates (ECARs) using intact cells. Published studies of this type both found no significant difference in absolute ATP synthesis rates between the ME/CFS and control cells \[[@B41-diagnostics-09-00080],[@B45-diagnostics-09-00080]\]. However, this does not necessarily mean that there is no ATP synthesis defect, since a defect/inefficiency in ATP synthesis could be offset by compensatory homeostatic mechanisms. The homeostatic regulation of cellular energy metabolism is centered on two stress-sensing protein kinases, AMP-activated protein kinase (AMPK) \[[@B46-diagnostics-09-00080]\] and target of rapamycin (TOR) \[[@B47-diagnostics-09-00080]\], which play key, often mutually inhibitory, roles. If their activities are chronically dysregulated by metabolic abnormalities and energy insufficiencies in ME/CFS cells, they may be unable to respond to additional energy demand. This is supported by reports of AMPK in muscle cells from people with ME/CFS being unresponsive to stimulation by contraction-induced ATP depletion \[[@B43-diagnostics-09-00080],[@B48-diagnostics-09-00080]\]. Such insensitivity could result from AMPK already being in an activated state in these cells, or to its inhibition by chronically hyperactivated TOR complex 1 (TORC1). Elevated TORC1 activity was recently observed in ME/CFS cells (lymphoblasts) and this was accompanied by inefficient mitochondrial ATP synthesis and abnormally high and presumably compensatory expression of mitochondrial proteins \[[@B41-diagnostics-09-00080]\]. Elevated expression of mitochondrial proteins has also been found in other studies of patient saliva, lymphocytes, and platelets \[[@B41-diagnostics-09-00080],[@B49-diagnostics-09-00080],[@B50-diagnostics-09-00080],[@B51-diagnostics-09-00080]\]. Furthermore, reduced creatine kinase (CK) levels in the serum of people with ME/CFS may suggest reduced cellular CK presence \[[@B15-diagnostics-09-00080]\], which could contribute to inefficient ATP synthesis given the enzyme's roles in ATP homeostasis \[[@B52-diagnostics-09-00080]\]. Despite the breadth of sample types tested that suggest dysregulated energy metabolism (serum, urine, feces, muscle, B cells, lymphoblasts), it remains to be directly demonstrated that the perturbation of the associated stress-sensing pathways is systemic and this should be an area of future investigation. As noted above, glycolytic catabolism of glucose is a major supplier of acetyl coenzyme A (CoA) to the TCA cycle, and this can be assayed in intact cells by measuring the rate of acidification of the medium by cells provided with glucose as a substrate. This has been reported recently using natural killer (NK) cells from a small sample of six patients and six healthy controls \[[@B53-diagnostics-09-00080]\]. Although the authors found no differences in aerobic respiration rates, they did observe a reduced glycolytic reserve in the ME/CFS cells. The glycolytic reserve is a measure of the excess capacity of glycolysis to meet cellular ATP demands when mitochondrial ATP synthesis by oxidative phosphorylation is inhibited. This small study reported individual O~2~ consumption and extracellular acidification rates that were either negative or very small positive values, placing them at the threshold of reliable detection. This caveat also applies to heterogeneous peripheral blood mononuclear cell (PBMC) populations, which are commonly used for extracellular flux respirometry and have been previously employed in ME/CFS work \[[@B45-diagnostics-09-00080]\]. This difficulty arises because peripheral blood lymphocytes are metabolically quiescent \[[@B54-diagnostics-09-00080]\] and this not only makes metabolic rate assays technically difficult, but it may obscure differences in metabolism that would be apparent in actively metabolizing cells. 2.3. A Shift Towards Lipid Metabolism {#sec2dot3-diagnostics-09-00080} ------------------------------------- The TCA cycle can also be provided with acetyl CoA produced by fatty acid beta-oxidation when glucose-derived sources are insufficient \[[@B55-diagnostics-09-00080]\]. If the provision of substrate to the TCA cycle is indeed deficient in ME/CFS as previously suggested \[[@B31-diagnostics-09-00080],[@B39-diagnostics-09-00080],[@B40-diagnostics-09-00080]\], a role for the compensatory elevation of fatty acid metabolism could be implicated in the disorder \[[@B41-diagnostics-09-00080]\]. Fatty acid synthesis and beta-oxidation are regulated by both AMPK \[[@B56-diagnostics-09-00080]\] and TORC1 \[[@B57-diagnostics-09-00080]\]. AMPK promotes fatty acid beta-oxidation when activated by elevated ATP demand and promotes fatty acid biosynthesis when inactive, while TORC1 exerts the opposite effects. AMPK and TORC1 regulate each other in a complex reciprocal feedback network \[[@B58-diagnostics-09-00080]\], so that it is also possible for scenarios to arise where both are simultaneously activated \[[@B59-diagnostics-09-00080]\]. This raises the question: If both AMPK \[[@B43-diagnostics-09-00080],[@B48-diagnostics-09-00080]\] and TORC1 \[[@B41-diagnostics-09-00080]\] activities are elevated in ME/CFS cells, would we expect the rates of fatty acid catabolism to be increased or decreased? An answer may be found within the specific mechanisms of regulatory action of these pathways in lipid homeostasis. Activation of TORC1 promotes fatty acid biosynthesis by elevating the expression of gene products including acetyl-CoA carboxylase (ACC) through the upregulation of transcription factors Sterol Regulatory Element Binding Proteins 1 and 2 (SREBP-1 and SREBP-2) \[[@B60-diagnostics-09-00080]\]. ACC activity results in an accumulation of malonyl CoA, which is a potent inhibitor of the mitochondrial import of fatty acids for beta oxidation. ACC, however, is a primary regulatory target of AMPK and is inactivated by phosphorylation when AMPK is activated \[[@B61-diagnostics-09-00080]\]. In this way, the concurrent activation of AMPK and TORC1, if it does indeed occur in ME/CFS cells, may allow AMPK to constrain the effects of TORC1's upregulation of lipid-biosynthesis and downregulation of beta-oxidation. At the same time, both AMPK and TORC1 directly or indirectly induce the expression of diverse mitochondrial proteins, including those involved in fatty acid beta oxidation. The combined effects could be a steady state in which the cells have increased their use of beta oxidation relative to glycolysis as a supplier of acetyl CoA to the TCA cycle. Fatty acid oxidation is normally upregulated as a supplementary energy pathway during fasting or exercise as a response to reduced blood glucose concentration \[[@B62-diagnostics-09-00080]\]. An increased reliance on fatty acid oxidation, even at rest, may therefore also contribute to the inability for people with ME/CFS to meet the elevated energy demands imposed by exertion. Such a switch to lipid oxidation can be mediated by elevated inflammation \[[@B63-diagnostics-09-00080]\] and in combination with the pathological inflammation seen in patients \[[@B64-diagnostics-09-00080]\] could be evidence of a pathological interaction between inflammation and metabolism in ME/CFS. 3. Disturbed Immunity, Signaling, and Inflammatory Pathways {#sec3-diagnostics-09-00080} =========================================================== 3.1. NK Cells {#sec3dot1-diagnostics-09-00080} ------------- The function of the immune system has been a focus of ME/CFS research for many years. Evidence for immune dysfunction in ME/CFS has largely been sought through study of NK cells, which are cytotoxic immune cells with roles in both the innate and adaptive immune responses. Multiple groups have reported reduced NK cell cytotoxicity or numbers \[[@B65-diagnostics-09-00080],[@B66-diagnostics-09-00080],[@B67-diagnostics-09-00080],[@B68-diagnostics-09-00080],[@B69-diagnostics-09-00080]\] combined with concordant alterations to functional surface markers \[[@B70-diagnostics-09-00080],[@B71-diagnostics-09-00080],[@B72-diagnostics-09-00080]\]. Conversely, other groups have reported increased cytotoxicity in combination with alterations to functional surface markers. For example, perforin, a glycoprotein used as a functional indicator of NK cell cytotoxicity due to its roles in NK cell mediated lysis \[[@B73-diagnostics-09-00080],[@B74-diagnostics-09-00080]\], has been reported as upregulated \[[@B71-diagnostics-09-00080]\], downregulated \[[@B65-diagnostics-09-00080]\], or, along with every other assessed phenotypic parameter, unaltered in people with ME/CFS \[[@B75-diagnostics-09-00080]\]. A recent, rigorous large-scale biobank study also found no significant differences in NK cell numbers, subtype composition, or assessed functional parameters \[[@B76-diagnostics-09-00080]\]. In summation, NK research remains an area of active interest, but in light of conflicting findings, the role of NK cells in the disorder is still not well understood. 3.2. Calcium Signaling {#sec3dot2-diagnostics-09-00080} ---------------------- Calcium signaling is crucial to immune cell function \[[@B77-diagnostics-09-00080]\] and is tied to the mitochondria and endoplasmic reticulum as hubs of regulatory control and calcium storage \[[@B78-diagnostics-09-00080]\]. Therefore, a disturbance to calcium signaling could contribute to pathological outcomes involving immune system or bioenergetic dysfunction, both of which have been implicated in ME/CFS. In addition to the previous evidence of altered surface proteins on NK cells from ME/CFS patients, a reduction in the expression of transient receptor potential melastatin 3 (TRPM3) calcium ion channels \[[@B79-diagnostics-09-00080]\] has been reported in a subpopulation of ME/CFS NK cells \[[@B80-diagnostics-09-00080],[@B81-diagnostics-09-00080],[@B82-diagnostics-09-00080]\]. The reason for the reduced expression of TRPM3 in these cells is unknown, but in other cell types, expression of TRPM3 is repressed by the activity of microRNA-204 (miR-204), encoded by intron 6 of the *TRPM3* gene \[[@B83-diagnostics-09-00080]\]. However, miR-204 is not amongst the microRNAs whose expression is reportedly altered in ME/CFS patients \[[@B84-diagnostics-09-00080]\]. Reduced expression of TRPM3 receptors would be expected to cause a reduction in Ca^2+^ responses to pregnenolone sulfate (PregS), a specific activating ligand for TRPM3 channels. However, the opposite was observed when Ca^2+^ levels were assayed by flow cytometry using Indo1, a Ca^2+^-sensitive fluorescent dye in the TRPM3-depleted NK cells \[[@B80-diagnostics-09-00080]\]. Subsequent studies using whole cell patch clamping, however, have reported a loss of PregS-stimulated Ca^2+^ responses \[[@B81-diagnostics-09-00080],[@B82-diagnostics-09-00080]\]. 3.3. Links to Mitochondrial Dysfunction {#sec3dot3-diagnostics-09-00080} --------------------------------------- Cytosolic Ca^2+^ is a key element in the cell's extensive homeostatic networks, such that Ca^2+^ signals are regulated by and play regulatory roles in multiple processes in cells, including mitochondrial respiratory activity \[[@B85-diagnostics-09-00080]\] as well as mitochondrial protein import \[[@B86-diagnostics-09-00080]\] and the ion transport activity of TRPM3 itself \[[@B87-diagnostics-09-00080]\], both of which are activated by Ca^2+^-calmodulin. The mitochondria serve as both a source and a sink for cytosolic Ca^2+^ and the mitochondria interact closely with the endoplasmic reticulum at sites that mediate the exchange of lipids and Ca^2+^ signals \[[@B88-diagnostics-09-00080]\]. The mitochondria thus form a hub of interaction between Ca^2+^ and other molecular signals that regulate mitochondrial function, such as AMPK and TORC1 activity. In NK cells specifically, where the calcium-signaling defect has been reported, TORC1 activity is required for both effector function and cytokine production \[[@B89-diagnostics-09-00080],[@B90-diagnostics-09-00080],[@B91-diagnostics-09-00080]\] and it has been suggested that the development of NK cell antiviral memory is influenced by mitochondrial function \[[@B92-diagnostics-09-00080]\]. The reports of altered NK effector function in ME/CFS could therefore also be related to abnormal mitochondrial function and TOR signaling. Disrupted intracellular signaling and mitochondrial function in ME/CFS have also been previously linked through myriad other pathways provoked by immune-inflammation and oxidative stress \[[@B93-diagnostics-09-00080]\]. 3.4. Inflammation {#sec3dot4-diagnostics-09-00080} ----------------- Chronic system-wide inflammation is thought to be central to ME/CFS in the clinical setting as it is associated with symptom severity \[[@B64-diagnostics-09-00080]\], but the evidence demonstrating a role for specific pro-inflammatory cytokines is inconsistent. While there are indeed reports of the elevation of various pro-inflammatory cytokines in ME/CFS \[[@B33-diagnostics-09-00080],[@B71-diagnostics-09-00080],[@B94-diagnostics-09-00080],[@B95-diagnostics-09-00080],[@B96-diagnostics-09-00080],[@B97-diagnostics-09-00080],[@B98-diagnostics-09-00080],[@B99-diagnostics-09-00080]\], which would tie in with the chronic inflammation in the clinical setting, these findings contrast with reports of reduced expression of pro-inflammatory agents, such as interleukin-8 or transforming growth factor-beta1 \[[@B100-diagnostics-09-00080],[@B101-diagnostics-09-00080]\]. Consequently, evidence for the specific directional shift of individual cytokines has been previously summarized as largely inconsistent \[[@B102-diagnostics-09-00080]\]. Despite these issues, cytokine expression has been previously associated with ME/CFS disease duration and may have value in aiding the stratification of patient cohorts \[[@B33-diagnostics-09-00080],[@B94-diagnostics-09-00080]\]. One group has shown that a cohort of ME/CFS patients with leaky gut syndrome as a comorbidity may undergo significant symptom remission when the IgM and IgA immune responses are attenuated by treatment with anti-inflammatory and antioxidant medications \[[@B103-diagnostics-09-00080],[@B104-diagnostics-09-00080]\]. This finding has contributed towards the potential link between gut hyperpermeability and inflammation in ME/CFS. Therefore, it is likely that dysregulated chronic inflammatory action by the immune system is an aspect of ME/CFS, despite inconsistent reports. 3.5. Autoimmunity {#sec3dot5-diagnostics-09-00080} ----------------- Autoimmunity in the condition is an area that remains little researched, and has been most recently summarized and presented as a hypothetical model for ME/CFS, with some ties to gut dysbiosis and aberrant metabolism \[[@B105-diagnostics-09-00080]\]. Other autoimmune models for ME/CFS have been previously based on rituximab's role in B cell depletion as a possible therapeutic based on the promising outcomes of earlier studies \[[@B106-diagnostics-09-00080],[@B107-diagnostics-09-00080]\]. This would be concordant with other reports of elevated naïve and transitional B cells in patients, which may suggest autoimmune tendencies \[[@B108-diagnostics-09-00080]\]. However, a role for such B cell-mediated autoimmunity in the disorder is now challenged by the negative outcome of the more recent rituximab phase III clinical trial \[[@B109-diagnostics-09-00080]\], which refutes the previous rituximab work. This may also indicate that autoimmunity only applies as a key pathomechanism in a small subset of patients who respond positively to rituximab treatment \[[@B110-diagnostics-09-00080]\]. Other direct lines of evidence for autoimmune behavior in the disorder come from elevated autoantibody levels in sera \[[@B111-diagnostics-09-00080]\], supported by the improvement of symptoms following autoantibody removal treatment \[[@B112-diagnostics-09-00080]\], and abnormal IgM immune recognition of both microbial and human heat shock protein 60 in a subset of patients \[[@B113-diagnostics-09-00080]\] or against phosphatidylinositol \[[@B114-diagnostics-09-00080]\], despite the absence of an infective pathogen in each case. 4. Implications of Altered Gut Microbiota and Physiology {#sec4-diagnostics-09-00080} ======================================================== A disturbed gut microbiota \[[@B12-diagnostics-09-00080],[@B115-diagnostics-09-00080],[@B116-diagnostics-09-00080],[@B117-diagnostics-09-00080],[@B118-diagnostics-09-00080],[@B119-diagnostics-09-00080],[@B120-diagnostics-09-00080],[@B121-diagnostics-09-00080]\] has been proposed to play a role in ME/CFS. This is accompanied by physiological gut abnormalities, such as impaired motility \[[@B122-diagnostics-09-00080]\], elevated intestinal wall permeability \[[@B103-diagnostics-09-00080],[@B104-diagnostics-09-00080],[@B123-diagnostics-09-00080],[@B124-diagnostics-09-00080]\], and IBS comorbidity \[[@B31-diagnostics-09-00080],[@B125-diagnostics-09-00080],[@B126-diagnostics-09-00080]\], which has been proposed to comprise part of a ME/CFS subtype \[[@B30-diagnostics-09-00080]\]. The implications of these disturbances could be far-reaching, since the intestinal microbiota both regulates \[[@B127-diagnostics-09-00080],[@B128-diagnostics-09-00080]\] and is regulated by \[[@B129-diagnostics-09-00080],[@B130-diagnostics-09-00080]\] the immune system. Additionally, many studies have demonstrated a link between the gut microbiota and host mitochondrial function or metabolism, with disturbances in one resulting in subsequent dysfunction in the other \[[@B131-diagnostics-09-00080],[@B132-diagnostics-09-00080],[@B133-diagnostics-09-00080],[@B134-diagnostics-09-00080],[@B135-diagnostics-09-00080],[@B136-diagnostics-09-00080]\]. 4.1. The Gut Microbiota and Metabolism {#sec4dot1-diagnostics-09-00080} -------------------------------------- People with ME/CFS have been reported to present with gut microbiota disturbances and either metabolite variation \[[@B31-diagnostics-09-00080],[@B118-diagnostics-09-00080]\] or mitochondrial dysfunction \[[@B116-diagnostics-09-00080]\] and the two conditions could be linked. Sheedy et al. observed elevated Gram positive intestinal bacteria, which produce lactic acid that may lower the gut pH and lead to elevated gut permeability \[[@B137-diagnostics-09-00080]\]. Furthermore, the translocation of these enteric lactic acid products into the bloodstream could contribute to the elevated lactate reported in the cerebrospinal fluid of ME/CFS patients \[[@B138-diagnostics-09-00080],[@B139-diagnostics-09-00080],[@B140-diagnostics-09-00080]\] and in the blood of a subgroup of patients \[[@B141-diagnostics-09-00080]\]. This contrasts with reports of reduced blood lactate as measured by H-NMR metabolomics \[[@B39-diagnostics-09-00080]\], which suggests that lactic acidosis may only affect a subgroup of patients. If IBS comorbidity accompanied by gut dysbiosis and hyperpermeability is indeed a subtype of ME/CFS, the translocation of lactic acid produced by abnormally enriched Gram positive enteric bacteria in the affected individuals, rather than excessive production by the host metabolism, could explain this inconsistency. 4.2. Pathological Interactions between Gut Hyperpermeability and the Mitochondria {#sec4dot2-diagnostics-09-00080} --------------------------------------------------------------------------------- Broader implications for the immune system and mitochondrial function may come from reports of increased translocation of immunogenic bacterial secretions from the gut into the bloodstream, which in ME/CFS may be mediated by intestinal wall hyperpermeability in patients affected with IBS \[[@B104-diagnostics-09-00080],[@B142-diagnostics-09-00080]\]. For example, the generation of excess free radicals, which occurs in the mitochondria \[[@B143-diagnostics-09-00080]\], has been proposed to form part of a microbial defense mechanism \[[@B144-diagnostics-09-00080],[@B145-diagnostics-09-00080],[@B146-diagnostics-09-00080]\], with enteric species, such as *Escherichia coli*, highly susceptible to the bactericidal properties of free radical derived reactive nitrogen species (RNS) \[[@B147-diagnostics-09-00080]\]. Excess free radical generation not only results in the formation of RNS but also reactive oxygen species (ROS), whose production may be elevated in ME/CFS given the many reports of elevated oxidative stress in the disorder \[[@B148-diagnostics-09-00080],[@B149-diagnostics-09-00080],[@B150-diagnostics-09-00080],[@B151-diagnostics-09-00080],[@B152-diagnostics-09-00080],[@B153-diagnostics-09-00080]\]. Therefore, excessive free radical generation as such an antimicrobial response to circulating antagonists of enteric origin could provide one explanation for the reports of elevated oxidative stress in the disorder. Such a response may indeed be elicited by the ordinarily commensal Gram negative bacteria *E. coli*, which, while also known to target the mitochondria by the secretion of other toxins \[[@B154-diagnostics-09-00080],[@B155-diagnostics-09-00080]\], secretes immunogenic lipopolysaccharide (LPS). This endotoxin secretion is normally suppressed by the host microbiota at large \[[@B131-diagnostics-09-00080]\], however, the composition of the host microbiota is reportedly altered in cases of ME/CFS \[[@B12-diagnostics-09-00080],[@B115-diagnostics-09-00080],[@B116-diagnostics-09-00080],[@B117-diagnostics-09-00080],[@B118-diagnostics-09-00080],[@B119-diagnostics-09-00080],[@B120-diagnostics-09-00080],[@B121-diagnostics-09-00080]\]. Such a disturbance to the normal LPS secretion-suppressing host microbiota in ME/CFS and the presence of gut hyperpermeability may therefore not only lead to the synergistic amplification of bacterial toxin translocation into the blood and the consequent activation of inflammatory pathways \[[@B104-diagnostics-09-00080],[@B142-diagnostics-09-00080]\], but may also expose body-wide mitochondria to circulating virulent factors produced by Gram negative antagonists, such as *E.coli*. This is supported by the increase in *E. coli* gut colonization reported in cases of IBS \[[@B156-diagnostics-09-00080]\], which, again, can be an ME/CFS comorbidity. 4.3. The Gut--Brain Axis: Autonomic and Hormonal Dysregulation {#sec4dot3-diagnostics-09-00080} -------------------------------------------------------------- Physiological stress, considered one predisposing factor for ME/CFS \[[@B157-diagnostics-09-00080]\], has been suggested to play a role in modifying the gut microbiota in such a way that would reduce the numbers of *Bifidobacterium* and *Lactobacillus*, two genera responsible for the suppression of LPS-secreting commensal bacteria and has been implicated in this way in ME/CFS \[[@B158-diagnostics-09-00080],[@B159-diagnostics-09-00080]\]. While the translocation of immunogenic LPS into the bloodstream is generally associated with body-wide inflammation \[[@B160-diagnostics-09-00080],[@B161-diagnostics-09-00080]\], it may also lead to the elevation of proinflammatory elements and the stress hormone cortisol in the brain \[[@B162-diagnostics-09-00080]\]. The transduction of immunogenic pathogen signals is but one aspect of the gut--brain axis, so it is pertinent to address the potential for broader gut-brain driven \[[@B163-diagnostics-09-00080],[@B164-diagnostics-09-00080]\] or autonomic nervous dysregulation that may play a part in the disorder. Indeed, there is some evidence to support such dysregulation associated with vasomotor abnormalities \[[@B165-diagnostics-09-00080]\] or mitochondrial Coenzyme Q10 deficiency associated with cardiovascular lesions \[[@B166-diagnostics-09-00080]\]. There are relevant, respectively, to the ME/CFS comorbidity POTS, which likely involves vasomotor dysfunction \[[@B167-diagnostics-09-00080]\], or to the cardinal symptom of chronic fatigue. Further, the linkage of cortisol-driven stress responses to the gut through the hypothalamic-pituitary-adrenal (HPA) axis \[[@B168-diagnostics-09-00080]\] could be dysfunctional in ME/CFS due to the hypocortisolism previously suggested to play a role in the condition \[[@B169-diagnostics-09-00080],[@B170-diagnostics-09-00080]\]. This possibility could weave another perturbed regulatory loop into the system, which may aid in perpetuating an altered homeostasis. This has been previously reviewed at length \[[@B171-diagnostics-09-00080]\]. 5. Multi-System Pathological Interactions {#sec5-diagnostics-09-00080} ========================================= 5.1. Exposure to Stressors and the Theoretical Homeostatic Perpetuation of a Disease State {#sec5dot1-diagnostics-09-00080} ------------------------------------------------------------------------------------------ The reported disturbances to ME/CFS metabolism have been linked to chronic activation of emergency cell survival mechanisms to cope with adverse conditions \[[@B7-diagnostics-09-00080]\]. These adverse conditions could include energy stress, inflammation, HPA axis dysregulation, or pathogen exposure. They elicit a conserved homeostatic cell danger response \[[@B172-diagnostics-09-00080]\] that could result in the cell shifting to an alternative resting steady state and contribute to ME/CFS pathology \[[@B34-diagnostics-09-00080]\]. An alternative explanation would involve chronic ongoing exposure of cells to a causative insult. However, chronic pathogen exposure as the precipitating factor for such a response in ME/CFS seems unlikely, as theories of viral persistence have been thoroughly investigated and the evidence for chronic viral infection in ME/CFS is inconsistent \[[@B173-diagnostics-09-00080]\]. Another feature of ME/CFS is the characteristic symptom heterogeneity. Patient histories suggest that the initial insult eliciting the shift to the ME/CFS state differs between individuals and so may dysregulate the underlying cellular stress signaling pathways in different ways. This could contribute to inconsistencies between various studies and highlights the need for sensitive diagnostics and patient stratification into recognizably different categories. No matter the initial insult, each of the aforementioned possibilities can involve the interaction between chronic inflammation and immunological and mitochondrial dysfunction \[[@B99-diagnostics-09-00080],[@B174-diagnostics-09-00080],[@B175-diagnostics-09-00080]\]. This is similar to theories previously presented by others pertaining to dysregulated homeostatic feedback loops \[[@B34-diagnostics-09-00080]\]. Faced with a new challenge, such as the re-emergence of a dormant pathogen, over-exertion, or other stress depending on the tolerance of the individual, the affected pathways could again be perturbed, triggering a molecular cascade during bouts of PEM. In some patients, this may mimic the response to a recurrent infection regardless of whether the new trigger is pathogen-driven. Symptom flare-ups characteristic of ME/CFS may therefore result from antagonization of just one of the underlying nodes of a multi-system pathological web and a symptomatic body-wide cascade ensues. For example, the elevated oxidative stress reported in the disorder \[[@B148-diagnostics-09-00080],[@B149-diagnostics-09-00080],[@B150-diagnostics-09-00080],[@B151-diagnostics-09-00080],[@B152-diagnostics-09-00080],[@B153-diagnostics-09-00080]\] may be entangled with perturbed immune-inflammatory pathways \[[@B175-diagnostics-09-00080],[@B176-diagnostics-09-00080],[@B177-diagnostics-09-00080],[@B178-diagnostics-09-00080]\], gut inflammation \[[@B158-diagnostics-09-00080]\], and dysfunctional mitochondria. This may be exacerbated by other disturbances, such as the reported reduction in CK levels \[[@B15-diagnostics-09-00080]\], which can lead to the absence of CK-mediated ROS suppression \[[@B179-diagnostics-09-00080]\]. This raises the possibility of a vicious cycle of immunodysregulation and gut dysbiosis accompanied by poor physiological gut function \[[@B122-diagnostics-09-00080]\] that contribute to the perpetuation of a chronic bowel disease state. Such an altered state could interact with the previously suggested HPA dysregulation \[[@B34-diagnostics-09-00080]\] and contribute to the perpetuation of an alternative resting homeostasis. 5.2. Identifying Underlying Mechanisms {#sec5dot2-diagnostics-09-00080} -------------------------------------- The earlier sections of this review have discussed the evidence for dysregulated biological mechanisms in ME/CFS patients at the molecular, cellular, tissue, organ, and whole body levels. These changes are summarized in [Table 1](#diagnostics-09-00080-t001){ref-type="table"} and together provide insights into potential underlying disease mechanisms. Based on current biomedical literature, perturbations to the various systems listed in [Table 1](#diagnostics-09-00080-t001){ref-type="table"} are implicated in the underlying pathological mechanisms in ME/CFS. These phenomena are correlated clinically in that they appear in people with the disorder. However, the causal links between them are unknown and cannot be discerned purely on the basis of clinical correlation. There are many scenarios where more than one of the affected systems may exert pathological effects on another and vice versa. This complex and often reciprocal regulatory cross-talk between systems makes it difficult to distinguish cause from effect, so there is great need for the potential causal relationships to be addressed directly using appropriate experimental models. For example, the potential impact of gut hyperpermeability on body-wide mitochondrial function has been outlined in [Section 4.2](#sec4dot2-diagnostics-09-00080){ref-type="sec"}. However, the reverse may also take place. The differentiation, proliferation, and function of intestinal epithelial cells is known to depend upon normal mitochondrial function, with mitochondrial dysfunction resulting in subsequent hyperpermeability of the intestinal wall \[[@B188-diagnostics-09-00080],[@B189-diagnostics-09-00080],[@B190-diagnostics-09-00080]\]. Therefore, it is impossible to distinguish cause from effect in this case with correlations alone. Similarly, changes in metabolite levels in ME/CFS have been associated with both IBS comorbidity \[[@B31-diagnostics-09-00080]\] and alterations to intestinal flora composition \[[@B118-diagnostics-09-00080]\]. However, it has not been experimentally shown whether the IBS is caused by host metabolic dysfunction or irregular metabolite production and excretion by an altered gut microbiota, or if the gut microflora and metabolic abnormalities are caused by the IBS. The influence of the mitochondria upon the function of the immune system has similar implications. The mitochondria can partake in activation or suppression of inflammation indirectly by regulating autophagy, which in turn bears downstream regulatory consequences for the activation of inflammation \[[@B191-diagnostics-09-00080]\]. Mitochondria also regulate elements of the innate immune system by the release of immunogenic ligands \[[@B178-diagnostics-09-00080]\] and are important for immune cell effector function due to their classical roles in energy production and metabolism. Furthermore, immunological dysfunction is common in conditions which are primarily mitochondrial diseases \[[@B192-diagnostics-09-00080]\]. This is an important consideration with regard to the gut microbiota since it, in turn, influences and is influenced by the function of the immune system and \[[@B128-diagnostics-09-00080],[@B163-diagnostics-09-00080],[@B193-diagnostics-09-00080],[@B194-diagnostics-09-00080]\] immune cell population composition \[[@B195-diagnostics-09-00080]\]. Therefore, changes to any one of the mitochondria, immune system, or gut may dysregulate the others, again emphasizing the importance of future research addressing cause--effect relationships. 6. Conclusions {#sec6-diagnostics-09-00080} ============== ME/CFS is a heterogeneous condition that may encompass scenarios where uncertain, and possibly varying, underlying insults trigger body-wide molecular and cellular perturbations perpetuated by an alternative stable homeostatic states. Diagnostic advancement and the development of tools which objectively and accurately phenotype patients is therefore paramount for the development of mechanistic insight and effective therapeutics. It is likely that the inflammation and immune dysfunction classically studied in ME/CFS are entangled with dysfunctional energetics, gut health, or autonomic and adrenal dysregulation. The evidence for metabolic and mitochondrial dysfunction indicates inefficient respiration, impaired provision of TCA cycle substrate, and metabolic shifts towards the utilization of alternative metabolites. Immune effector cell dysfunction, chronic inflammation, defective signaling, and elevated oxidative stress may interact with not only the dysfunctional energetics but also with abnormal gut physiology and microbiota composition. These effects on the gut may also tie back to mitochondrial function and vice versa. The reciprocal interactions between these affected systems and the varied clinical presentation of relevant symptoms between individuals make it difficult to postulate cause--effect relationships with confidence. Furthermore, while disturbances to this range of interconnected systems across the body have been demonstrated, in some cases concurrently, this body of research has historically relied upon correlations, which creates the urgent need for research utilizing direct experimental investigation of cause--effect relationships. D.M., writing---original draft preparation and editing; S.J.A. and P.R.F., writing---review and editing. D.M. was the recipient of a La Trobe University Postgraduate Scholarship and Australian Government Research Training Program Fees Offset. This work was supported by generous patient donations and grants from the Judith Jane Mason & Harold Stannett Williams Memorial Foundation (Grant IDs: MAS2016F063, MAS2018F00026) and the McCusker Charitable Foundation. The authors declare no conflict of interest. diagnostics-09-00080-t001_Table 1 ###### Brief summary of relevant reports contributing towards the biomedical basis of ME/CFS. Area of Study Brief Summary of Key Reports in ME/CFS -------------------------------------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Metabolomics Multiple reports of disturbed amino acid metabolism \[[@B6-diagnostics-09-00080],[@B38-diagnostics-09-00080],[@B39-diagnostics-09-00080],[@B40-diagnostics-09-00080],[@B180-diagnostics-09-00080]\].Dysregulated lipid metabolism \[[@B7-diagnostics-09-00080],[@B13-diagnostics-09-00080],[@B31-diagnostics-09-00080],[@B39-diagnostics-09-00080]\], possible glycolysis impairment \[[@B39-diagnostics-09-00080]\], possible PDH impairment \[[@B40-diagnostics-09-00080]\], urea cycle dysregulation \[[@B6-diagnostics-09-00080],[@B38-diagnostics-09-00080]\].Overall: TCA cycle substrate provision deficiency and reliance on alternative fuel sources. Mitochondrial function Reduced \[[@B9-diagnostics-09-00080]\] vs. elevated steady-state ATP levels \[[@B42-diagnostics-09-00080],[@B44-diagnostics-09-00080],[@B48-diagnostics-09-00080]\] but resting ATP synthesis rates are normal \[[@B41-diagnostics-09-00080],[@B45-diagnostics-09-00080]\].Complex V inefficient and compensated for by upregulation of supporting pathways \[[@B41-diagnostics-09-00080]\]. Muscle activity Unresponsive AMPK and reduced glucose \[[@B43-diagnostics-09-00080],[@B48-diagnostics-09-00080],[@B141-diagnostics-09-00080]\] and oxygen uptake \[[@B181-diagnostics-09-00080]\]. Natural killer cells Overall inconsistent evidence---role mostly unknown \[[@B65-diagnostics-09-00080],[@B66-diagnostics-09-00080],[@B67-diagnostics-09-00080],[@B68-diagnostics-09-00080],[@B69-diagnostics-09-00080],[@B70-diagnostics-09-00080],[@B71-diagnostics-09-00080],[@B72-diagnostics-09-00080]\]. Calcium signaling Evidence for impaired TRPM3 function \[[@B81-diagnostics-09-00080],[@B82-diagnostics-09-00080]\]. Inflammation and cytokines Inconsistent molecular evidence \[[@B102-diagnostics-09-00080],[@B182-diagnostics-09-00080]\], yet is likely to play a role based on clinical presentation and the many reported disturbances in related systems. Autoimmunity Little researched, but proposed to form a subtype comorbid with IBS \[[@B114-diagnostics-09-00080]\].Role for B cell-mediated autoimmunity challenged by negative outcome of rituximab trial \[[@B106-diagnostics-09-00080],[@B109-diagnostics-09-00080],[@B110-diagnostics-09-00080]\]. B cells Linked to mitochondrial disturbances, subset proportions may vary \[[@B41-diagnostics-09-00080],[@B45-diagnostics-09-00080],[@B183-diagnostics-09-00080]\]. Gut microbiota and physiology Widely reported disturbances to the gut microbiota \[[@B12-diagnostics-09-00080],[@B103-diagnostics-09-00080],[@B115-diagnostics-09-00080],[@B116-diagnostics-09-00080],[@B117-diagnostics-09-00080],[@B119-diagnostics-09-00080],[@B120-diagnostics-09-00080],[@B184-diagnostics-09-00080]\] and gut hyperpermeability \[[@B103-diagnostics-09-00080],[@B123-diagnostics-09-00080],[@B124-diagnostics-09-00080]\]. Autonomic and hormonal dysregulation Vasomotor abnormalities \[[@B165-diagnostics-09-00080],[@B185-diagnostics-09-00080]\], hypocortisolism \[[@B169-diagnostics-09-00080],[@B170-diagnostics-09-00080]\], broad HPA axis disturbance \[[@B186-diagnostics-09-00080],[@B187-diagnostics-09-00080]\].
/* Copyright (c) 2008-2018 Dovecot authors, see the included COPYING file */ #include "lib.h" #include "array.h" #include "crc32.h" #include "istream.h" #include "str.h" #include "unichar.h" #include "wildcard-match.h" #include "imap-parser.h" #include "imap-match.h" #include "mail-namespace.h" #include "mail-search-build.h" #include "mail-search-parser.h" #include "mailbox-attribute.h" #include "mailbox-list-iter.h" #include "imap-metadata.h" #include "virtual-storage.h" #include "virtual-plugin.h" #include <unistd.h> #include <fcntl.h> struct virtual_parse_context { struct virtual_mailbox *mbox; struct istream *input; pool_t pool; string_t *rule; unsigned int rule_idx; char sep; bool have_wildcards; bool have_mailbox_defines; }; static struct mail_search_args * virtual_search_args_parse(const string_t *rule, const char **error_r) { struct istream *input; struct imap_parser *imap_parser; const struct imap_arg *args; struct mail_search_parser *parser; struct mail_search_args *sargs; const char *charset = "UTF-8"; int ret; if (str_len(rule) == 0) { sargs = mail_search_build_init(); mail_search_build_add_all(sargs); return sargs; } input = i_stream_create_from_data(str_data(rule), str_len(rule)); (void)i_stream_read(input); imap_parser = imap_parser_create(input, NULL, (size_t)-1); ret = imap_parser_finish_line(imap_parser, 0, 0, &args); if (ret < 0) { sargs = NULL; *error_r = t_strdup(imap_parser_get_error(imap_parser, NULL)); } else { parser = mail_search_parser_init_imap(args); if (mail_search_build(mail_search_register_get_imap(), parser, &charset, &sargs, error_r) < 0) sargs = NULL; mail_search_parser_deinit(&parser); } imap_parser_unref(&imap_parser); i_stream_destroy(&input); return sargs; } static int virtual_config_add_rule(struct virtual_parse_context *ctx, const char **error_r) { struct virtual_backend_box *const *bboxes; struct mail_search_args *search_args; unsigned int i, count; *error_r = NULL; if (ctx->rule_idx == array_count(&ctx->mbox->backend_boxes)) { i_assert(str_len(ctx->rule) == 0); return 0; } ctx->mbox->search_args_crc32 = crc32_str_more(ctx->mbox->search_args_crc32, str_c(ctx->rule)); search_args = virtual_search_args_parse(ctx->rule, error_r); str_truncate(ctx->rule, 0); if (search_args == NULL) { i_assert(*error_r != NULL); *error_r = t_strconcat("Previous search rule is invalid: ", *error_r, NULL); return -1; } /* update at all the mailboxes that were introduced since the previous rule. */ bboxes = array_get(&ctx->mbox->backend_boxes, &count); i_assert(ctx->rule_idx < count); for (i = ctx->rule_idx; i < count; i++) { i_assert(bboxes[i]->search_args == NULL); mail_search_args_ref(search_args); bboxes[i]->search_args = search_args; } mail_search_args_unref(&search_args); ctx->rule_idx = array_count(&ctx->mbox->backend_boxes); return 0; } static int virtual_config_parse_line(struct virtual_parse_context *ctx, const char *line, const char **error_r) { struct mail_user *user = ctx->mbox->storage->storage.user; struct virtual_backend_box *bbox; const char *p; bool no_wildcards = FALSE; if (*line == ' ' || *line == '\t') { /* continues the previous search rule */ if (ctx->rule_idx == array_count(&ctx->mbox->backend_boxes)) { *error_r = "Search rule without a mailbox"; return -1; } while (*line == ' ' || *line == '\t') line++; str_append_c(ctx->rule, ' '); str_append(ctx->rule, line); return 0; } /* if there is no rule yet, it means we want the previous mailboxes to use the rule that comes later */ if (str_len(ctx->rule) > 0) { if (virtual_config_add_rule(ctx, error_r) < 0) return -1; } if (!uni_utf8_str_is_valid(line)) { *error_r = t_strdup_printf("Mailbox name not UTF-8: %s", line); return -1; } /* new mailbox. the search args are added to it later. */ bbox = p_new(ctx->pool, struct virtual_backend_box, 1); bbox->virtual_mbox = ctx->mbox; if (strcasecmp(line, "INBOX") == 0) line = "INBOX"; bbox->name = p_strdup(ctx->pool, line); switch (bbox->name[0]) { case '+': bbox->name++; bbox->clear_recent = TRUE; break; case '-': bbox->name++; bbox->negative_match = TRUE; break; case '!': /* save messages here */ if (ctx->mbox->save_bbox != NULL) { *error_r = "Multiple save mailboxes defined"; return -1; } bbox->name++; ctx->mbox->save_bbox = bbox; no_wildcards = TRUE; break; } if (bbox->name[0] == '/') { /* [+-!]/metadata entry:value */ if ((p = strchr(bbox->name, ':')) == NULL) { *error_r = "':' separator missing between metadata entry name and value"; return -1; } bbox->metadata_entry = p_strdup_until(ctx->pool, bbox->name, p++); bbox->metadata_value = p; if (!imap_metadata_verify_entry_name(bbox->metadata_entry, error_r)) return -1; no_wildcards = TRUE; } if (!no_wildcards && (strchr(bbox->name, '*') != NULL || strchr(bbox->name, '%') != NULL)) { bbox->glob = imap_match_init(ctx->pool, bbox->name, TRUE, ctx->sep); ctx->have_wildcards = TRUE; } if (bbox->metadata_entry == NULL) { /* now that the prefix characters have been processed, find the namespace */ bbox->ns = strcasecmp(bbox->name, "INBOX") == 0 ? mail_namespace_find_inbox(user->namespaces) : mail_namespace_find(user->namespaces, bbox->name); if (bbox->ns == NULL) { *error_r = t_strdup_printf("Namespace not found for %s", bbox->name); return -1; } if (strcmp(bbox->name, ctx->mbox->box.vname) == 0) { *error_r = "Virtual mailbox can't point to itself"; return -1; } ctx->have_mailbox_defines = TRUE; } array_push_back(&ctx->mbox->backend_boxes, &bbox); return 0; } static void virtual_mailbox_get_list_patterns(struct virtual_parse_context *ctx) { struct virtual_mailbox *mbox = ctx->mbox; ARRAY_TYPE(mailbox_virtual_patterns) *dest; struct mailbox_virtual_pattern pattern; struct virtual_backend_box *const *bboxes; unsigned int i, count; i_zero(&pattern); bboxes = array_get_modifiable(&mbox->backend_boxes, &count); p_array_init(&mbox->list_include_patterns, ctx->pool, count); p_array_init(&mbox->list_exclude_patterns, ctx->pool, count); for (i = 0; i < count; i++) { if (bboxes[i]->metadata_entry == NULL) continue; pattern.ns = bboxes[i]->ns; pattern.pattern = bboxes[i]->name; if (bboxes[i]->negative_match) dest = &mbox->list_include_patterns; else { dest = &mbox->list_exclude_patterns; pattern.pattern++; } array_push_back(dest, &pattern); } } static void separate_wildcard_mailboxes(struct virtual_mailbox *mbox, ARRAY_TYPE(virtual_backend_box) *wildcard_boxes, ARRAY_TYPE(virtual_backend_box) *neg_boxes, ARRAY_TYPE(virtual_backend_box) *metadata_boxes) { struct virtual_backend_box *const *bboxes; ARRAY_TYPE(virtual_backend_box) *dest; unsigned int i, count; bboxes = array_get_modifiable(&mbox->backend_boxes, &count); t_array_init(wildcard_boxes, I_MIN(16, count)); t_array_init(neg_boxes, 4); t_array_init(metadata_boxes, 4); for (i = 0; i < count;) { if (bboxes[i]->metadata_entry != NULL) dest = metadata_boxes; else if (bboxes[i]->negative_match) dest = neg_boxes; else if (bboxes[i]->glob != NULL) dest = wildcard_boxes; else { dest = NULL; i++; } if (dest != NULL) { array_push_back(dest, &bboxes[i]); array_delete(&mbox->backend_boxes, i, 1); bboxes = array_get_modifiable(&mbox->backend_boxes, &count); } } } static void virtual_config_copy_expanded(struct virtual_parse_context *ctx, struct virtual_backend_box *wbox, const char *name) { struct virtual_backend_box *bbox; bbox = p_new(ctx->pool, struct virtual_backend_box, 1); *bbox = *wbox; bbox->name = p_strdup(ctx->pool, name); bbox->glob = NULL; bbox->wildcard = TRUE; mail_search_args_ref(bbox->search_args); array_push_back(&ctx->mbox->backend_boxes, &bbox); } static bool virtual_ns_match(struct mail_namespace *config_ns, struct mail_namespace *iter_ns) { /* we match only one namespace for each pattern, except with shared namespaces match also autocreated children */ if (config_ns == iter_ns) return TRUE; if (config_ns->type == iter_ns->type && (config_ns->flags & NAMESPACE_FLAG_AUTOCREATED) == 0 && (iter_ns->flags & NAMESPACE_FLAG_AUTOCREATED) != 0) return TRUE; if ((iter_ns->flags & NAMESPACE_FLAG_INBOX_USER) != 0 && (config_ns->flags & NAMESPACE_FLAG_AUTOCREATED) != 0 && config_ns->prefix_len == 0) { /* prefix="" namespace was autocreated, so e.g. "*" would match only that empty namespace. but we want "*" to also match the inbox=yes namespace, so check it here separately. */ return TRUE; } return FALSE; } static bool virtual_config_match(const struct mailbox_info *info, ARRAY_TYPE(virtual_backend_box) *boxes_arr, unsigned int *idx_r) { struct virtual_backend_box *const *boxes; unsigned int i, count; boxes = array_get_modifiable(boxes_arr, &count); for (i = 0; i < count; i++) { if (boxes[i]->glob != NULL) { if (virtual_ns_match(boxes[i]->ns, info->ns) && imap_match(boxes[i]->glob, info->vname) == IMAP_MATCH_YES) { *idx_r = i; return TRUE; } } else { if (strcmp(boxes[i]->name, info->vname) == 0) { *idx_r = i; return TRUE; } } } return FALSE; } static int virtual_config_box_metadata_match(struct mailbox *box, struct virtual_backend_box *bbox, const char **error_r) { struct imap_metadata_transaction *imtrans; struct mail_attribute_value value; int ret; imtrans = imap_metadata_transaction_begin(box); ret = imap_metadata_get(imtrans, bbox->metadata_entry, &value); if (ret < 0) *error_r = t_strdup(imap_metadata_transaction_get_last_error(imtrans, NULL)); if (ret > 0) ret = wildcard_match(value.value, bbox->metadata_value) ? 1 : 0; if (ret >= 0 && bbox->negative_match) ret = ret > 0 ? 0 : 1; (void)imap_metadata_transaction_commit(&imtrans, NULL, NULL); return ret; } static int virtual_config_metadata_match(const struct mailbox_info *info, ARRAY_TYPE(virtual_backend_box) *boxes_arr, const char **error_r) { struct virtual_backend_box *const *boxes; struct mailbox *box; unsigned int i, count; int ret = 1; boxes = array_get_modifiable(boxes_arr, &count); if (count == 0) return 1; box = mailbox_alloc(info->ns->list, info->vname, MAILBOX_FLAG_READONLY); mailbox_set_reason(box, "virtual mailbox metadata match"); for (i = 0; i < count; i++) { /* break on error or match */ if ((ret = virtual_config_box_metadata_match(box, boxes[i], error_r)) < 0 || ret > 0) break; } mailbox_free(&box); return ret; } static int virtual_config_expand_wildcards(struct virtual_parse_context *ctx, const char **error_r) { const enum mail_namespace_type iter_ns_types = MAIL_NAMESPACE_TYPE_MASK_ALL; const enum mailbox_list_iter_flags iter_flags = MAILBOX_LIST_ITER_RETURN_NO_FLAGS; struct mail_user *user = ctx->mbox->storage->storage.user; ARRAY_TYPE(virtual_backend_box) wildcard_boxes, neg_boxes, metadata_boxes; struct mailbox_list_iterate_context *iter; struct virtual_backend_box *const *wboxes, *const *boxp; const char **patterns; const struct mailbox_info *info; unsigned int i, j, count; int ret = 0; separate_wildcard_mailboxes(ctx->mbox, &wildcard_boxes, &neg_boxes, &metadata_boxes); /* get patterns we want to list */ wboxes = array_get_modifiable(&wildcard_boxes, &count); if (count == 0) { /* only negative wildcards - doesn't really make sense. just ignore. */ return 0; } patterns = t_new(const char *, count + 1); for (i = 0; i < count; i++) patterns[i] = wboxes[i]->name; /* match listed mailboxes to wildcards */ iter = mailbox_list_iter_init_namespaces(user->namespaces, patterns, iter_ns_types, iter_flags); while ((info = mailbox_list_iter_next(iter)) != NULL) { /* skip non-selectable mailboxes (especially mbox directories) */ if ((info->flags & MAILBOX_NOSELECT) != 0) continue; if (strcmp(info->vname, ctx->mbox->box.vname) == 0) { /* don't allow virtual folder to point to itself */ continue; } if (virtual_config_match(info, &wildcard_boxes, &i) && !virtual_config_match(info, &neg_boxes, &j) && virtual_backend_box_lookup_name(ctx->mbox, info->vname) == NULL) { ret = virtual_config_metadata_match(info, &metadata_boxes, error_r); if (ret < 0) break; if (ret > 0) { virtual_config_copy_expanded(ctx, wboxes[i], info->vname); } } } for (i = 0; i < count; i++) mail_search_args_unref(&wboxes[i]->search_args); array_foreach(&neg_boxes, boxp) mail_search_args_unref(&(*boxp)->search_args); array_foreach(&metadata_boxes, boxp) mail_search_args_unref(&(*boxp)->search_args); if (mailbox_list_iter_deinit(&iter) < 0) { *error_r = mailbox_list_get_last_internal_error(user->namespaces->list, NULL); return -1; } return ret < 0 ? -1 : 0; } static void virtual_config_search_args_dup(struct virtual_mailbox *mbox) { struct virtual_backend_box *const *bboxes; struct mail_search_args *old_args; unsigned int i, count; bboxes = array_get_modifiable(&mbox->backend_boxes, &count); for (i = 0; i < count; i++) { old_args = bboxes[i]->search_args; bboxes[i]->search_args = mail_search_args_dup(old_args); mail_search_args_unref(&old_args); } } int virtual_config_read(struct virtual_mailbox *mbox) { struct mail_storage *storage = mbox->box.storage; struct virtual_parse_context ctx; const char *box_path, *path, *line, *error; unsigned int linenum = 0; int fd, ret = 0; i_array_init(&mbox->backend_boxes, 8); mbox->search_args_crc32 = (uint32_t)-1; box_path = mailbox_get_path(&mbox->box); path = t_strconcat(box_path, "/"VIRTUAL_CONFIG_FNAME, NULL); fd = open(path, O_RDONLY); if (fd == -1) { if (errno == EACCES) { mailbox_set_critical(&mbox->box, "%s", mail_error_eacces_msg("open", path)); } else if (errno != ENOENT) { mailbox_set_critical(&mbox->box, "open(%s) failed: %m", path); } else if (errno == ENOENT) { mail_storage_set_error(storage, MAIL_ERROR_NOTFOUND, T_MAIL_ERR_MAILBOX_NOT_FOUND(mbox->box.vname)); } else { mailbox_set_critical(&mbox->box, "stat(%s) failed: %m", box_path); } return -1; } i_zero(&ctx); ctx.sep = mail_namespaces_get_root_sep(storage->user->namespaces); ctx.mbox = mbox; ctx.pool = mbox->box.pool; ctx.rule = t_str_new(256); ctx.input = i_stream_create_fd(fd, (size_t)-1); i_stream_set_return_partial_line(ctx.input, TRUE); while ((line = i_stream_read_next_line(ctx.input)) != NULL) { linenum++; if (*line == '#') continue; if (*line == '\0') ret = virtual_config_add_rule(&ctx, &error); else ret = virtual_config_parse_line(&ctx, line, &error); if (ret < 0) { mailbox_set_critical(&mbox->box, "%s: Error at line %u: %s", path, linenum, error); break; } } if (ret == 0) { ret = virtual_config_add_rule(&ctx, &error); if (ret < 0) { mailbox_set_critical(&mbox->box, "%s: Error at line %u: %s", path, linenum, error); } } virtual_mailbox_get_list_patterns(&ctx); if (ret == 0 && ctx.have_wildcards) { ret = virtual_config_expand_wildcards(&ctx, &error); if (ret < 0) mailbox_set_critical(&mbox->box, "%s: %s", path, error); } if (ret == 0 && !ctx.have_mailbox_defines) { mailbox_set_critical(&mbox->box, "%s: No mailboxes defined", path); ret = -1; } if (ret == 0) virtual_config_search_args_dup(mbox); i_stream_unref(&ctx.input); i_close_fd(&fd); return ret; } void virtual_config_free(struct virtual_mailbox *mbox) { struct virtual_backend_box *const *bboxes; unsigned int i, count; if (!array_is_created(&mbox->backend_boxes)) { /* mailbox wasn't opened */ return; } bboxes = array_get_modifiable(&mbox->backend_boxes, &count); for (i = 0; i < count; i++) { if (bboxes[i]->search_args != NULL) mail_search_args_unref(&bboxes[i]->search_args); } array_free(&mbox->backend_boxes); }
NASA's Space Life Sciences Training Program. The Space Life Sciences Training Program (SLSTP) is an intensive, six-week training program held every summer since 1985 at the Kennedy Space Center (KSC). A major goal of the SLSTP is to develop a cadre of qualified scientists and engineers to support future space life sciences and engineering challenges. Hand-picked, undergraduate college students participate in lectures, laboratory sessions, facility tours, and special projects: including work on actual Space Shuttle flight experiments and baseline data collection. At NASA Headquarters (HQ), the SLSTP is jointly sponsored by the Life Sciences Division and the Office of Equal Opportunity Programs: it has been very successful in attracting minority students and women to the fields of space science and engineering. In honor of the International Space Year (ISY), 17 international students participated in this summer's program. An SLSTP Symposium was held in Washington D.C., just prior to the World Space Congress. The Symposium attracted over 150 SLSTP graduates for a day of scientific discussions and briefings concerning educational and employment opportunities within NASA and the aerospace community. Future plans for the SLSTP include expansion to the Johnson Space Center in 1995.
Swedish Fish Oreos are now a real thing FOX 32 NEWS - Oreo may have just come out with its most unique flavor yet: Swedish fish. Beginning this week, the limited edition cookie will be available exclusively at Kroger supermarkets throughout the country. The new cookie combines the classic chocolate wafers with a cherry candy flavored red crème. “We know that consumers enjoy variety when it comes to snacking so we create all of our limited-edition flavors to provide surprising new twists people know and love and on occasion, create unexpected and unique flavor combinations that people may never have thought were possible, including our latest from the Wonder Vault, Swedish Fish Flavored Creme Oreo Cookies,” an Oreo spokesperson told TIME in an email.
Changing Of The Guard: Rafa Becomes First Spaniard To Win Wimbledon Since ’66 Salt tears flowed in the locker room after Rafael Nadal lost to Roger Federer in last year’s Wimbledon final. Sobbing, he told his scowling coach and uncle, Toni, that he might never be in that position again. He truly believed this, but Toni knew better. Rafa was only 21 years old. “I told him his life does not change because he has not won this match,” Toni said.On Sunday, after a 4-hour, 48-minute marathon, Nadal approached the net to shake Federer’s hand with tears in his eyes. This time, after myriad opportunities eluded him, Nadal was a 6-4, 6-4, 6-7 (5), 6-7 (8), 9-7 winner. It was the longest men’s singles final on record at the All England Club, going back to 1877. And certainly, it was one of the finest. Sublime is the word that comes to mind.
It’s hard to stand up for the 2nd Amendment in Congress when you don’t have a spine… The Concealed Carry Reciprocity Act is the biggest pro-gun legislation ever to be introduced into Congress. It would dismantle more than a century of anti-gun laws on the books in blue states and restore the Second Amendment’s right to bear arms to all law abiding Americans (including the 26% of the country not allowed to carry at all). The bill was introduced 44-weeks ago. It took half a year, with the GOP trying to kill it on multiple occasions, but Paul Ryan finally caved and allowed a vote on the bill. It passed with a bipartisan majority. Yet, Mitch McConnell hasn’t even scheduled a vote on it. In fact, he hasn’t even commented on the bill in the past year. Mitch doesn’t think it can pass and doesn’t want to try to push it through. He is perfectly content with letting this legislation die collecting dust on his desk. Congress must pass a spending bill in the next week. We are launching a full assault demanding that Congress pass this bill, literally by any means necessary. Including the nuclear option! Tell Congress right now to go nuclear and fully pass the Concealed Carry Reciprocity Act, or else be removed from office! Right now, a Florida woman named Donna Gracey is facing 10 years in prison for bringing her legally owned pistol into the State of New Jersey. She was pulled over for “tinted windows” and when the police officer saw she had a lawful permit to carry in the State of Florida, they decided to search her car. They found a handgun. Her permit allows her to legally carry a firearm in 37 states, except New Jersey doesn’t honor Florida’s permit. In fact, New Jersey doesn’t honor any other state’s concealed carry permit and won’t allow practically any of its own residents to carry. The result is that the 2nd Amendment doesn’t exist in New Jersey. And it isn’t just New Jersey, either. 26% of all Americans live in states that believe they can reject concealed carry permits at any time, for any reason. If the Concealed Carry Reciprocity Act had been signed into law, Donna Gracey wouldn’t be facing felonies right now for exercising her Constitutional rights. Mitch McConnell’s inaction could literally send this woman to jail. Enough is enough. We are calling on all Members of Congress — Congressmen and Senators alike — to pass this common sense bill by any means necessary. That includes bypassing Mitch McConnell with a discharge petition and, yes, that includes the nuclear option. There are 51 Republican Senators. There are eight Democrat Senators up for re-election this year in pro-gun states that Trump won. The votes are there to pass this life-saving bill, but Mitch McConnell refuses to do what is necessary to get it passed. Enough is enough! Tell Congress right now to go nuclear and fully pass the Concealed Carry Reciprocity Act, or else be removed from office! Going nuclear would allow the Concealed Carry Reciprocity Act to pass with just 51 votes in the Senate. That means that we wouldn’t even need a single Democrat vote to pass it. But if RINOs like McCain or Flake wanted to block it, there are more than enough vulnerable Democrats up for re-election this year in pro-gun states like Montana, North Dakota, West Virginia, or Missouri. Now that Doug Jones has been sworn in as the next Senator for Alabama, it would take full Republican participation and then nine Democrats to pass it under the current rules. But if Congress goes nuclear, we could pass it into law TODAY. McConnell is literally stalling. It is up to us to make sure Congress understands that a right delayed is a right denied! Tell Congress right now to go nuclear and fully pass the Concealed Carry Reciprocity Act, or else be removed from office! Push forward, Max McGuire Advocacy Director Conservative Daily
Cellular origins of the fetal-haemoglobin-containing cells of normal adults. The origin of the small population of adult red cells which contain Hb F (F-cells) has been studied in a clonal disorder of haemopoiesis, polycythaemia rubra vera (P.R.V.). In eleven patients who had not received cytotoxic therapy F-cells comprised less than 0.1% to 11.9% of the circulating red cells, compared with 0.34% to 4.6% in 21 haematologically normal controls. Two additional patients were glucose-6-phosphate-dehydrogenase heterozygotes in whom the clonal nature of the P.R.V. could be demonstrated directly; they had F-cell values of 2.1% and 8.3%. These observations indicate that F-cells arise from the same population of stem cells as other adult cells and not from a separate stem-cell pool.
Q: Strange behaviour of as.numeric() with factor variable - gives completely different numbers to those supplied I have a dataset where I am trying to convert a factor into a numeric variable, it appeared to work fine the first time I ran it but now I have changed the vector contents the as.numeric() function is returning different (possibly previous) values rather the values now in the vector, despite the fact that these do not appear to be stored anywhere. It works fine if I convert to a character first, however. The code I am using is: rm(reprex) # ensure does not exist from previously reprex <- data.frame(rbind(c("BT",8),c("BL", 1), c("TS",1), c("SA", 7), c("S", 5), c("LS",5), c("M",3), c("CV",3), c("CF",3), c("PE",3))) names(reprex) <-c("Post Area", "Count") reprex$Countnum <- as.numeric(reprex$Count) # should be same as Count reprex$Countnum_char <- as.numeric(as.character(reprex$Count)) # is same as Count head(reprex) gives: Post Area Count Countnum Countnum_char 1 BT 8 5 8 2 BL 1 1 1 3 TS 1 1 1 4 SA 7 4 7 5 S 5 3 5 6 LS 5 3 5 Why is this? It seems to work if I convert it to a character before converting to numeric so I can avoid it, but I am confused about why this happens at all and where the strangely-mapped (I suspect from a previous version of the dataframe) factor levels are being stored such that they persist after I remove the object. A: This question deals with how R understands your process. Count = 1 is the smallest number and so this become Countnum = 1. Count = 3 is the second highest number so the factor level is 2, which also means that the Countnum = 2, and so on and so forth. In effect, what your first as.numeric does is takes the factor level and converts the factor level to a number. The Countnum_char takes the character value (e.g. Count = 8 is factor level = 5 or Count = 5 is factor level = 3) as its value and converts the value to a number, not the factor level.
Adult subglottiscope for laser surgery. A subglottiscope for use in adult men and women has been developed for microlaryngeal laser operations in the subglottic region of the larynx. The tip has been designed to facilitate exposure of the subglottis and upper trachea in both short-necked and long-necked individuals. A smoke evacuation channel has been included, as has a nonreflective finish. Finally, a port for jet ventilation has been added to facilitate use of this anesthetic technique when indicated. The authors have used the prototypes of these subglottiscopes on six patients, four women and two men, and have found the exposure of subglottic and upper tracheal lesions to be improved over that obtained with existing microlaryngoscopes.
Q: What is your prefered way to return XML from an ActionMethod in Asp.net MVC? I am displaying charts that load the data asynchronously because the searches are the work to fetch the data is quite heavy. The data has to be return as XML to make the chart library happy. My ActionMethods return a ContentResult with the type set as text/xml. I build my Xml using Linq to XML and call ToString. This works fine but it's not ideal to test. I have another idea to achieve this which would be to return a view that builds my XML using the XSLT View engine. I am curious and I always try to do the things "the right way". So how are you guys handling such scenarios? Do you implement a different ViewEngine (like xslt) to build your XML or do you Build your XML inside your controller (Or the service that serves your controller)? EDIT : Since I need this to pass the data to a Charting Library, I have to follow their xml structure. Their notation is not the way i want to build my model classes at all. That's why I build the XML myself using Linq to XML and wonder if a template would be better. Simple serialization is not what I look for A: Write a custom action result: public class XmlActionResult : ActionResult { public XmlActionResult(object data) { Data = data; } public object Data { get; private set; } public override void ExecuteResult(ControllerContext context) { context.HttpContext.Response.ContentType = "text/xml"; // TODO: Use your preferred xml serializer // to serialize the model to the response stream : // context.HttpContext.Response.OutputStream } } And in your controller action: public ActionResult Index() { var model = _repository.GetModel(); return new XmlActionResult(model); }
# Change Log All notable changes to this project will be documented in this file. See [Conventional Commits](https://conventionalcommits.org) for commit guidelines. ## [1.0.2](https://github.com/ecomfe/react-hooks/compare/@huse/boolean@1.0.1...@huse/boolean@1.0.2) (2020-03-31) **Note:** Version bump only for package @huse/boolean ## [1.0.1](https://github.com/ecomfe/react-hooks/compare/@huse/boolean@0.9.3...@huse/boolean@1.0.1) (2020-03-23) ### Bug Fixes * publish src to make source maps working as expected ([9d49f6b](https://github.com/ecomfe/react-hooks/commit/9d49f6b294a445c302f05da958c6e427e7eae669)) # [1.0.0](https://github.com/ecomfe/react-hooks/compare/@huse/boolean@0.9.3...@huse/boolean@1.0.0) (2020-03-14) **Note:** Version bump only for package @huse/boolean ## [0.9.4](https://github.com/ecomfe/react-hooks/compare/@huse/boolean@0.9.3...@huse/boolean@0.9.4) (2020-03-13) **Note:** Version bump only for package @huse/boolean ## [0.9.3](https://github.com/ecomfe/react-hooks/compare/@huse/boolean@0.9.2...@huse/boolean@0.9.3) (2020-03-07) ### Bug Fixes * upgrade immer to 6.x ([b8920fb](https://github.com/ecomfe/react-hooks/commit/b8920fb67a14bd111b543efdcd58b67b8277ba46)) ## [0.9.2](https://github.com/ecomfe/react-hooks/compare/@huse/boolean@0.9.1...@huse/boolean@0.9.2) (2020-03-02) **Note:** Version bump only for package @huse/boolean ## [0.9.1](https://github.com/ecomfe/react-hooks/compare/@huse/boolean@0.9.0...@huse/boolean@0.9.1) (2020-02-25) **Note:** Version bump only for package @huse/boolean # 0.9.0 (2020-02-14) ### Bug Fixes * mark all packages as public access ([660c126](https://github.com/ecomfe/react-hooks/commit/660c1265ee27cb0de0e7b456904a22f4370002d0)) ### Features * boolean hooks ([3d3293f](https://github.com/ecomfe/react-hooks/commit/3d3293f4d4b431537e92011479cd51b6420805d6))
<template> <figure ref="wrapper" class="factor-figure figure-manage"> <img :src="require(`./img/traffic.svg`)" alt="Sparkline Traffic" /> <div class="sparkline"> <div v-for="(point, index) in points" :key="index" class="point-wrap"> <div class="point"> <div class="point-text">{{ point.text }}</div> </div> </div> </div> </figure> </template> <script lang="ts"> export default { components: {}, data() { return { points: [ { text: `Social`, }, { text: `SEO`, }, { text: `DevOps`, }, { text: `Support`, }, { text: `Debugging`, }, { text: `Scaling`, }, ], } }, } </script> <style lang="less"> figure.figure-manage { position: relative; height: auto; padding-bottom: 4rem; img { width: 100%; max-width: 500px; margin: 0 auto; } .sparkline { position: absolute; top: 45%; left: 40%; height: 33px; .point-wrap { position: absolute; width: auto; height: 33px; .point { background: rgba(0, 0, 0, 0.1); padding: 0.2rem 1rem; border-radius: 8px; .point-text { font-size: 1.6rem; line-height: 1.4; } } &:nth-child(1) { .point { transform: translateY(-7rem) translateX(0rem); @media (max-width: 900px) { transform: translateY(-6rem) translateX(-1rem); } } } &:nth-child(2) { .point { transform: translateY(-10rem) translateX(15vw); } } &:nth-child(3) { .point { transform: translateY(1rem) translateX(9rem); @media (max-width: 900px) { transform: translateY(0rem) translateX(6rem); } } } &:nth-child(4) { .point { transform: translateY(-9rem) translateX(-20vw); } } &:nth-child(5) { .point { transform: translateY(5rem) translateX(-1rem); } } &:nth-child(6) { .point { transform: translateY(-1rem) translateX(-24vw); @media (max-width: 900px) { transform: translateY(-3rem) translateX(-36vw); } } } } } } </style>
Q: Retrieving info from JSON array with PHP i have this public JSON https://raw.github.com/currencybot/open-exchange-rates/master/latest.json and i need to extract data from it, right now i tried something like this: $input = file_get_contents("https://raw.github.com/currencybot/open-exchange-rates/master/latest.json"); $json = json_decode($input); echo $json[rates]->EUR; but i obtain a blank page, any suggestion? Thanks !! Ste A: json_decode either returns an object, or an array (when you use the second param). You are trying to use both. Try: $json = json_decode($input); echo $json->rates->EUR; OR $json = json_decode($input, true); echo $json['rates']['EUR']; As to the blank page, please add the following to the top of your script: error_reporting(E_ALL); init_set('display_errors', true); A 500 Error indicates you are unable to resolve that url using file_get_contents. Check here for more information.
using System; using System.Collections.Generic; using System.Linq; using System.Text; using Android.App; using Android.Content; using Android.OS; using Android.Runtime; using Android.Views; using Android.Widget; using Xamarin.Forms; using Xamarin.Forms.ControlGallery.Android; using Xamarin.Forms.Controls.Issues; using Xamarin.Forms.Platform.Android; using AView = Android.Views.View; [assembly: ExportRenderer(typeof(Bugzilla38989._38989CustomViewCell), typeof(_38989CustomViewCellRenderer))] namespace Xamarin.Forms.ControlGallery.Android { public class _38989CustomViewCellRenderer : Xamarin.Forms.Platform.Android.ViewCellRenderer { protected override AView GetCellCore(Cell item, AView convertView, ViewGroup parent, Context context) { var nativeView = convertView; if (nativeView == null) nativeView = (context.GetActivity()).LayoutInflater.Inflate(Resource.Layout.Layout38989, null); return nativeView; } } }
symfony framework forum Hi guys, I will soon be launching a new website - techlimelight.com. It's built with symfony 1.4 and incorporates tons of advanced features. It incorporates features from Wikipedia, Digg, Twitter, and a whole bunch of new awesomeness. While the site is not live just yet, I am accepting beta submissions on the front page. What it is:It is a community driven and moderated site. Users can submit a wealth of content: news stories, product information to wikis, product specifications, product pros/cons, product reviews, and much more. All of this information is organized around single areas called limelights. Each limelight represents a single product or company. Everything a user submits can be rated other users, which in turn affects the contributors account score.Everything can be intelligently sorted and organized. Users can follow specific users and limelights to create a custom stream of news and other information related directly to the products, technologies, and companies they are interested in. There are many more features, comparison tools, powerful search, a revenue sharing system for users, and more. If you're intersted in learning more about the project, please sign up for the beta at techlimelight.com and comment below. I'd love to chat about it! I also have a new blog discussing the problem I'm attempting to solve with the website at blog.techlimelight.com. My first article discusses one of the main problems tech limelight is attempting to solve: http://bit.ly/aRK3oy Thanks to the symfony team for the framework, I've fallen in love with it over the past couple of years!Marc
At Least 30 Killed in Somalia Bombings MOGADISHU, Somalia — At least 30 people died in a wave of coordinated bombings and shootings in the Somali capital, a medical source said, increasing estimates of the toll from the Sunday attacks which exposed the fragility of security gains in Mogadishu. African peacekeeping troops blocked off streets and searched houses across the city early on Monday to flush out suspected members of the Islamist militant group al Shabaab which claimed responsibility for the strikes. "At least 30 people died and 20 others were injured. That is from our services and hospital sources," a coordinator for Mogadishu's ambulance service, who asked not to be named for security reasons, told Reuters on Monday. Officials late on Sunday sad at least 19 people had died. At least one car bomb exploded and several suicide bombers blew themselves up in front of Mogadishu's law courts. Gunmen also stormed the court compound, spraying it with bullets. A couple of hours later a car bomb was detonated near the city's fortified airport. The al-Qaida-linked militants have staged a series of guerrilla-style bombings and attacks in the capital nearly two years after they were driven out of their positions there by African and government soldiers. The law courts were a symbolic target. Somalia's new government has made reforming the judiciary a priority in its program to shake off the country's "failed state" tag. The government exerts little influence beyond the capital.
United States Court of Appeals Fifth Circuit F I L E D UNITED STATES COURT OF APPEALS April 16, 2007 FOR THE FIFTH CIRCUIT Charles R. Fulbruge III Clerk No. 05-40747 UNITED STATES OF AMERICA, Plaintiff-Appellee, VERSUS RODOLFO MANUEL LUMBRERAS-LINERAS, Defendant-Appellant. Appeal from the United States District Court For the Southern District of Texas, Laredo USDC No. 5:04-CR-2475-1 ON REMAND FROM THE SUPREME COURT OF THE UNITED STATES Before JONES, Chief Judge, and JOLLY and DAVIS, Circuit Judges. PER CURIAM:* This court previously affirmed the conviction and sentence of the Appellant Rodolfo Manuel Lumbreras-Lineras (“Lineras”). On December 11, 2006, the Supreme Court vacated and remanded the case for reconsideration in light of Lopez v. Gonzalez, 127 S. Ct. 625 (2006). In light of Lopez, the district court erred by enhancing Lineras’s sentence based on a Texas conviction for possession of * Pursuant to 5TH CIR. R. 47.5, the court has determined that this opinion should not be published and is not precedent except under the limited circumstances set forth in 5TH CIR. R. 47.5.4. marijuana. Because Lineras has completed the confinement portion of his sentence, any argument that the prison term should be reduced is moot and the only portion of the sentence remaining for consideration is the defendant’s term of supervised release. However, as the Federal Public Defender notes, Lineras presumably has been deported. In order to resentence him and reduce his term of supervised release, FEDERAL RULE OF CRIMINAL PROCEDURE 43 requires the defendant to be present and have the opportunity to allocute. Because the defendant has been deported and is legally unable, without permission of the Attorney General, to reenter the United States to be present for a resentencing proceeding, there is no relief we are able to grant Lineras and his appeal is moot. See United States v. Rosenbaum-Alanis, No. 05-41400, 2007 WL 926832 (5th Cir. March 29, 2007). The appeal is therefore DISMISSED. 2
--- abstract: 'In this paper we propose an in-depth analysis of a method, called the flow network method, which associates with any network a complete and quasi-transitive binary relation on its vertices. Such a method, originally proposed by Gvozdik (1987), is based on the concept of maximum flow. Given a competition involving two or more teams, the flow network method can be used to build a relation on the set of teams which establishes, for every ordered pair of teams, if the first one did at least as good as the second one in the competition. Such a relation naturally induces procedures for ranking teams and selecting the best $k$ teams of a competition. Those procedures are proved to satisfy many desirable properties.' author: - | **Daniela Bubboloni**\ [ ]{}\ \ [ ]{}\ \ \ \ \ \ [tel: +39 055 2759667]{} - | **Michele Gori**\ [ ]{}\ \ [ ]{}\ \ \ \ \ \ [tel: +39 055 2759707]{} title: 'The flow network method[^1]' --- **Keywords:** Network, network flow, quasi-transitive relation, pairs comparison, ranking problem, Schulze method. **JEL classification:** D71. **MSC classification:** 05C21, 05C22, 94C15. Introduction ============ The Lega Basket Serie A, the first and highest-tier level of the Italian basketball league, currently consists of 16 teams. During the regular season of the basketball championship every team plays every other team twice for a total of 30 matches and ties are not allowed. At the end of the season, teams are ranked by the total number of wins. Basketball fans certainly like having a ranking of the teams available at any stage of the season. The usual method to build those temporary rankings is still based on counting the number of wins of each team. However, it is simple to understand that such a method may lead to questionable outcomes because, even though two teams won the same number of matches at a given moment, they might have played their matches against opponents of different quality. That suggests the need to look for more expressive ranking methods. Consider a set of teams and a list of matches played by those teams, where ties were not allowed. Such matches are supposed to be all the matches scheduled in a (possibly fictitious) competition among the considered teams. In order to rank the teams and select the winners one may compare them on the basis of the number of wins and, in fact, this method is largely used when each team confronts any other team the same number of times, as in the case of round-robin competitions. However, there are interesting situations which do not meet such a condition as the case of temporary rankings previously discussed or when the number of teams involved in a competition is so large that, for practical reasons, it is difficult to arrange all the possible matches[^2]. In these cases, counting the number of wins does not seem to be such a good idea. Consider, for instance, the competition among the three teams $\textsc{a}$, $\textsc{b}$ and $\textsc{c}$ described by the table[^3] $$\label{table1} \begin{array}{|c||c|c||c|c|} \hline \textsc{a} & 2 & 0 &\textsc{b}\\ \hline \textsc{a} & 2 & 0 &\textsc{c}\\ \hline \textsc{b} & 5 & 0 &\textsc{c}\\ \hline \end{array}$$ and note that not all the pairs of teams confronted each other the same number of times. Here, counting the number of wins makes team $\textsc{b}$ be the winner, even though most people probably believe that team $\textsc{a}$ deserves to win the competition. In order to overcome those difficulties, Gvozdik (1987) and Belkin and Gvozdik (1989) propose a method, that we are going to call the [*flow network method*]{}, which can be used to establish, for every competition and every pair of teams involved in the competition, if the first team did at least as good as the second one. In other words, the method associates with every competition a special binary relation on the set of teams. Moreover, it naturally allows to select the winners of the competition as well as to determine the rankings of the teams that are consistent with the competition[^4]. We independently rediscover the flow network method and we strongly believe that it is worthwhile to provide an in-depth analysis of it by revisiting old results and presenting new ones. Indeed, since the two above mentioned papers are published only in Russian, the flow network method has not certainly received the attention it deserves yet. First of all, let us describe how the flow network method operates through the analysis of a concrete example. Consider the competition among the four teams $\textsc{a}$, $\textsc{b}$, $\textsc{c}$ and $\textsc{d}$ described by the following table: $$\label{table2} \begin{array}{|c||c|c||c|c|} \hline \textsc{a} & 1 & 0 &\textsc{b}\\ \hline \textsc{a} & 1 & 2 &\textsc{c}\\ \hline \textsc{a} & 2 & 2 &\textsc{d}\\ \hline \textsc{b} & 1 & 2 &\textsc{c}\\ \hline \textsc{b} & 1 & 1 &\textsc{d}\\ \hline \textsc{c} & 2 & 2 &\textsc{d}\\ \hline \end{array}$$ Given two distinct teams $x$ and $y$, let us use the writing $x y$ to denote a match between $x$ and $y$ where $x$ beat $y$. Thus, looking at the table we can list all the matches played in and the corresponding winners as follows $$\label{list1} \begin{array}{l} \textsc{ab}, \textsc{ac},\textsc{ca},\textsc{ca}, \textsc{ad}, \textsc{ad}, \textsc{da}, \textsc{da}, \textsc{bc}, \textsc{cb}, \textsc{cb}, \textsc{bd}, \textsc{db}, \textsc{cd}, \textsc{cd}, \textsc{dc}, \textsc{dc}. \end{array}$$ Fix now two distinct teams $x$ and $y$. Let us call path from $x$ to $y$ (in ) any sequence $x_1\cdots x_n$ of $n\ge 2$ distinct teams $x_1,\ldots,x_n$ such that $x_1=x$, $x_n=y$ and $x_1 x_2,\ldots, x_{n-1}x_n$ are all in . For instance, $\textsc{ab}$ is a path from $\textsc{a}$ to $\textsc{b}$ since $\textsc{ab}$ is in ; $\textsc{acd}$ is a path from $\textsc{a}$ to $\textsc{d}$ since $\textsc{ac}$ and $\textsc{cd}$ are in ; $\textsc{bac}$ is not a path from $\textsc{b}$ to $\textsc{c}$ since $\textsc{ba}$ is not in . Given a path $x_1\cdots x_n$ from $x$ to $y$, we identify it with the sub-competition of involving only the teams $x_1,\ldots, x_n$ and where only the matches $x_1 x_2,\ldots, x_{n-1}x_n$ were played. Of course, the intuition suggests that $x$ did better than $y$ in that sub-competition. For instance, we obviously have that $\textsc{a}$ did better than $\textsc{b}$ in $\textsc{ab}$. Moreover, it is natural to state that $\textsc{a}$ did better than $\textsc{d}$ in $\textsc{acd}$ since in $\textsc{acd}$ only two matches were played, namely $\textsc{a}$ against $\textsc{c}$ and $\textsc{c}$ against $\textsc{d}$, and we know that $\textsc{a}$ beat $\textsc{c}$ and $\textsc{c}$ beat $\textsc{d}$ so that, in some sense, $\textsc{a}$ indirectly beat $\textsc{d}$. Denote next by $\lambda_{xy}$ the maximum length of a list of paths from $x$ to $y$ that can be built using each element in at most once. Note that the same path can appear more than once in a list. In order to clarify the definition of such a number, let us consider $\textsc{a}$ and $\textsc{b}$ and compute $\lambda_{\textsc{ab}}$. First of all, note that $$\textsc{ab}, \textsc{adcb}, \textsc{adcb}, \textsc{acdb},$$ are four paths from $\textsc{a}$ to $\textsc{b}$ in which are built using the following matches in $$\textsc{ab}, \textsc{ad}, \textsc{dc}, \textsc{cb}, \textsc{ad}, \textsc{dc}, \textsc{cb}, \textsc{ac}, \textsc{cd}, \textsc{db}.$$ The matches in which have not been used yet are $$\textsc{ca}, \textsc{ca}, \textsc{da}, \textsc{da}, \textsc{bc}, \textsc{bd}, \textsc{cd},$$ and it is clear that no further path from $\textsc{a}$ to $\textsc{b}$ can be built using them. Of course, matches in might be arranged to get a different list of paths from $\textsc{a}$ to $\textsc{b}$. For instance, we have that $$\textsc{ab}, \textsc{acb}, \textsc{adcb}, \textsc{adb},$$ is a different family of four paths from $\textsc{a}$ to $\textsc{b}$ which are built using the following matches in $$\textsc{ab}, \textsc{ac}, \textsc{cb}, \textsc{ad}, \textsc{dc}, \textsc{cb}, \textsc{ad}, \textsc{db}.$$ Also in this case, no further path from $\textsc{a}$ to $\textsc{b}$ can be built using the matches left out. Observe now that it is not possible to find more than four paths from $\textsc{a}$ to $\textsc{b}$. Indeed, in the number of matches of the type $x \textsc{b}$ where $x\in\{\textsc{a},\textsc{c},\textsc{d}\}$ is four and any path from $\textsc{a}$ to $\textsc{b}$ has to involve exactly one match of that type. As a consequence, we get $\lambda_{\textsc{ab}}=4$. As a further example, let us now compute $\lambda_{\textsc{ba}}$. First, observe that $\textsc{bca}$ and $\textsc{bda}$ are two paths from $\textsc{b}$ to $\textsc{a}$ which are built using the matches $\textsc{bc}$, $\textsc{ca}$, $\textsc{bd}$ and $\textsc{da}$ in . Moreover, we cannot build more than two paths from $\textsc{b}$ to $\textsc{a}$ since the number of matches of the type $\textsc{b}x$ where $x\in\{\textsc{a},\textsc{c},\textsc{d}\}$ is two and any path from $\textsc{b}$ to $\textsc{a}$ must involve exactly one match of that type. Thus, we get $\lambda_{\textsc{ba}}=2$. Using similar strategies, one can easily compute, for every pair of distinct teams $x$ and $y$, the number $\lambda_{xy}$. Such computations give $$\begin{array}{l} \lambda_{\textsc{ab}}=4,\;\lambda_{\textsc{ba}}=2,\;\lambda_{\textsc{ac}}=4,\; \lambda_{\textsc{ca}}=4,\; \lambda_{\textsc{ad}}=4,\; \lambda_{\textsc{da}}=4,\; \\ \lambda_{\textsc{bc}}=2,\; \lambda_{\textsc{cb}}=4,\; \lambda_{\textsc{bd}}=2,\; \lambda_{\textsc{db}}=4,\;\lambda_{\textsc{cd}}=5,\; \lambda_{\textsc{dc}}=4. \end{array}$$ Given two distinct teams $x$ and $y$, we interpret $\lambda_{xy}$ as the number of times the team $x$ directly or indirectly beat the team $y$ in the competition $\mathsf{C}$[^5]. As a consequence, for any pair of distinct teams $x$ and $y$, we interpret the inequality $\lambda_{xy}\ge \lambda_{yx}$ as the fact that $x$ did at least as good as $y$ in $\mathsf{C}$. In that case, we write $x\succeq_\textsf {C} y$. Of course, since we can assume that each team did at least as good as itself in $\mathsf{C}$, we also set $x\succeq_{\mathsf{C}} x$ for all $x\in \{\textsc{a},\textsc{b},\textsc{c},\textsc{d}\}$. Thus, we get a relation on the set of teams which is fully described as follows $$\label{c-intro} \begin{array}{l} \textsc{a}\succeq_{\textsf {C}} \textsc{a},\; \textsc{b}\succeq_{\textsf {C}} \textsc{b},\; \textsc{c}\succeq_{\textsf {C}} \textsc{c},\; \textsc{d}\succeq_{\textsf {C}} \textsc{d},\;\\ \textsc{a}\succeq_{\textsf {C}} \textsc{b},\; \textsc{a}\succeq_{\textsf {C}}\textsc{c}, \; \textsc{c}\succeq_{\textsf {C}} \textsc{a}, \; \textsc{a}\succeq_{\textsf {C}} \textsc{d},\\ \textsc{d}\succeq_{\textsf {C}}\textsc{a},\;\textsc{c}\succeq_{\textsf {C}} \textsc{b}, \; \textsc{d}\succeq_{\textsf {C}} \textsc{b}, \; \textsc{c}\succeq_{\textsf {C}} \textsc{d}. \end{array}$$ We call $\succeq_{\textsf{C}}$ the flow relation associated with $\mathsf{C}$. Because of its definition, we interpret its maxima, namely $\textsc{a}$ and $\textsc{c}$, as the winners of the competition $\mathsf{C}$ and its linear refinements, namely $\textsc{a}\succeq_{\textsf {C}}\textsc{c}\succeq_{\textsf {C}}\textsc{d}\succeq_{\textsf {C}}\textsc{b}$, $\textsc{c}\succeq_{\textsf {C}}\textsc{a}\succeq_{\textsf {C}}\textsc{d}\succeq_{\textsf {C}}\textsc{b}$ and $\textsc{c}\succeq_{\textsf {C}}\textsc{d}\succeq_{\textsf {C}}\textsc{a}\succeq_{\textsf {C}}\textsc{b}$ as the rankings of the teams which are consistent with the competition $\mathsf{C}$. We stress that $\succeq_{\mathsf{C}}$ is complete but it is not transitive because, for instance, we have that $\textsc{d}\succeq_{\textsf {C}} \textsc{a}$ and $\textsc{a}\succeq_{\mathsf {C}} \textsc{c}$ but $\textsc{d}\not\succeq_{\textsf {C}} \textsc{c}$. Observe also that, as it is immediately checked, the flow relation associated with the competition described by is a linear order having $\textsc{a}$ ranked first, $\textsc{b}$ ranked second and $\textsc{c}$ ranked third. In particular, the unique winner is $\textsc{a}$ and the unique admissible ranking is the flow relation itself, as one would desire. It is also implicit in its definition that the flow network method takes into account the quality of the opponents. Indeed, if in a competition a team $\textsc{a}$ won against teams of good quality, namely which won many matches, then there exist many paths from $\textsc{a}$ to the other teams. That potentially makes $\textsc{a}$ behave better than other teams in the flow relation. The flow network method owes its name to the fact that networks and flows are the basic concepts underlying its definition. In order to explain this fact, first note that there is a natural bijection between the set of competitions and the set of networks. Indeed, any competition can be identified with the network whose vertices are the teams involved in the competition and where, for every pair of distinct teams, the capacity of the arc from a team to another one is the number of times the first team beat the second one. Similarly, any network can be thought as a competition among its vertices where, for every arc, its capacity represents how many times its start vertex beat its end vertex[^6]. Moreover, given a network, it can be proved that, for every pair of distinct vertices $x$ and $y$, the number $\lambda_{xy}$ previously described equals the so-called maximum flow value from $x$ to $y$. In the paper, after having introduced in Section \[sec-network\] suitable notation for networks and some crucial results about them, we give in Section \[def-flow\] the formal definition of the flow network method. Then, in order to assess the method, in Section \[flow-network-method\] we deepen the analysis carried on by Belkin and Gvozdik (1989). We first show that the outcomes of the flow network method are always complete and quasi-transitive relations (Theorem \[F-qt\]), even though not necessarily transitive (Proposition \[non-o\]). We show then that the method may lead to any possible complete and quasi-transitive relation (Proposition \[main-qt\]) and that it is neutral, homogeneous, efficient, monotonic, reversal symmetric and symmetric (Propositions \[neut-F\], \[homo-net\], \[Eff-F\], \[Mon1-flow-rule\], \[Reversal\], \[flat\]). Remarkably, we also obtain a characterization of complete and quasi-transitive relations (Theorem \[co-qt\]). Networks are actually used to model a variety of situations, not necessarily related to sport competitions, where suitable information about pairwise comparisons among different alternatives is known[^7] and a ranking of the alternatives is needed. Thus, it is certainly possible to find in the literature lots of network methods, that is, procedures to associate with any network a binary relation (usually complete and transitive) on the set of teams describing when a team is at least as good as another one. Those methods have been designed in response to very different needs so that the rationale behind their definition, as well as the properties they fulfil, strongly depend on the specific framework they are supposed to manage. Langville and Meyer (2012) present an overview of different contexts and settings (like social choice, voting, web search engines, psychology and statistics) where ranking alternatives is important and describe lots of ranking procedures that can be formalized as network methods. Among the simplest network methods there are surely the Borda method, which associates with each network the relation which compares teams on the basis of the whole number of wins; the dual Borda method, which compares teams on the basis of the whole number of losses; the Copeland method[^8], which compares teams on the basis of the difference between the whole number of wins and the whole number of losses; the minimax method which compares teams on the basis of the maximum number of losses against each other team; the maxmin method which compares teams on the basis of the minimum number of wins against each other team. Gonzaléz-Díaz et al. (2014) consider several network methods originating from statistical and social choice approaches and compare them by studying how those methods perform with respect to a specific set of properties[^9]. Vaziri et al. (2017) focus on some popular sports network methods and discuss whether they satisfy suitable properties that a fair and comprehensive ranking method should meet[^10]. Several authors deepen the analysis of the properties of networks methods providing an axiomatic characterization of some of them. Bouyssou (1992), Palacios-Huerta and Volij (2004), Slutzki and Volij (2005), van den Brink and Gilles (2009) and Kitti (2016) respectively show that the Copeland, the normalized invariant, the fair-bets, the Borda and the non-normalized invariant network methods can be characterized by suitable sets of axioms[^11]. Csató (2017) proves instead an impossibility result showing the incompatibility of the self-consistency and the order preservation principles. Further, Laslier (1997, Chapters 3 and 10) presents an extensive survey of various scoring methods defined on the set of tournaments[^12] and on the set of balanced networks[^13]. All the above mentioned methods, as the large majority of methods available in the literature, are based on suitable definitions of scores for teams so that they determine a complete and transitive relation on the set of teams. An exception is the network method which can be deduced from the paper by Schulze (2011) and which is described and studied in Section \[schulze-sec\]. In fact, as the flow network method, such a network method has the peculiar property to associate with any network a complete and quasi-transitive relation on its vertices which is not in general transitive. As a consequence, the flow network method is different from all those methods leading to complete and transitive relations and, as proved in Section \[schulze-sec\], it is also different from the Schulze network method. However, we show that the flow and the Borda network methods agree on the class of balanced networks (Proposition \[balan-ut\])[^14]. This is a remarkable fact as it shows that the flow network method can be seen as an extension of the well-known method of “counting the wins” outside the ordinary framework where it is generally accepted. But we discovered other classes of networks on which those methods agree (Proposition \[cor-new\] and Theorem \[OI\]) and that shed light on the significance of the Borda network method outside the traditional context of the balanced networks. As a final remark, we recall that the computation of flows in a network can be performed by well-known algorithms, based on the Ford and Fulkerson augmenting paths algorithm, which run in polynomial time with respect to the number of vertices. As a consequence, the outcome of the flow network method applied to a competition can be computed in a polynomial time with respect to the number of teams. That fact is certainly encouraging with a view to concretely applying the method. After having carefully studied the properties of the flow network method, we focus on the procedure which associates with any network the family of the linear refinements of the flow relation[^15]. Such a procedure, formally defined in Section \[def-flow\], is called [*flow network rule*]{} and was first defined in Belkin and Gvozdik (1989). On the basis of the discussion made about the flow network method, we have that it is in general different from the network rules built by the known network methods by taking, for every network, the linear refinements of the corresponding relation. It also generally differs from the Kemeny and the ranked pairs rules[^16]. In Section \[fnr\] we prove several properties of the flow network rule. We focus then on the problem of selecting a subset of a given size from the set of vertices of a network. Mainly in the framework of voting theory the problem of selecting committees has been receiving more and more attention in the last years (for a survey, see Elkind et al., 2017). Many $k$-multiwinner network solutions, that is procedures which associate with any network a family of subsets of size $k$, can be built by each complete and quasi-transitive (in particular transitive) network method by taking, for every network, the $k$-maximum sets of the corresponding relation[^17]. A careful analysis of such solutions as well as a comparison among them represent, in our opinion, an interesting research line. However, at the best of our knowledge, no specific contribution on this theme is available in the literature when $k\ge 2$. The situation is different for the case $k=1$. Aziz et al. (2015) propose a canonical way to extend to the whole set of networks any method which associates with each balanced network a subset of its vertices. There are also lots of contributions about procedures to select the vertices of special types of networks like tournaments, weak tournaments and partial tournaments[^18]. We refer to Laslier (1997) for a survey on tournament solutions and to Peris and Subiza (1999), Aziz et al. (2015) and Brandt et al. (2016) for further interesting contributions on the extension of classical tournament solutions to the settings of weak and partial tournaments. We finally note that De Donder et al. (2000) also propose some results about balanced networks, while Dutta and Laslier (1999) consider a different framework somehow connected with networks, as discussed in Section \[dutta-sec\]. In Section \[def-flow\] we consider, for every positive integer $k$, the procedure which associates with any network the $k$-maximum sets of its flow relation. Such a procedure, called [*flow $k$-multiwinner network solution*]{}, is a new object and is in general different from $k$-multiwinner network solutions originating from known network methods and network rules. In Sections \[fns\], thanks to the previous analysis of the flow network method as well as some preliminary propositions about quasi-acyclic and quasi-transitive relations proved in Section \[relation-2\], we show that the flow $k$-multiwinner network solution fulfils a lot of desirable properties. Networks {#sec-network} ======== We assume $0\not\in \mathbb{N}$ and we set $\mathbb{N}_0=\mathbb{N}\cup\{0\}$. Moreover, given $k\ge 1$, we denote by $\ldbrack k \rdbrack$ the set $\{1,\ldots,k\}$. From now on, $V$ is a fixed finite set of size $|V|=n\ge 2$, $\Delta=\{(x,x)\in V^2:x\in V\}$ and $A=V^2\setminus \Delta$. A [*network*]{} on $V$ is a triple $N=(V,A,c)$, where $c$ is a function from $A$ to $\mathbb{N}_0$. We say that $V$ is the set of vertices of $N$, $A$ is the set of arcs of $N$ and $c$ is the capacity associated with $N$. Note that the pair $(V,A)$ is a complete digraph (without loops) on the set of vertices $V$. The set of networks on $V$ is denoted by $\mathcal{N}$. Networks can be used to mathematically represent competitions. Assume to have a set of teams which played a certain number of matches among each other and to know, for every team, the number of matches it won against any other team. Then we can represent that competition by a network by defining $V$ as the set of teams and, for every $(x,y)\in A$, defining $c(x,y)$ as the number of matches in which $x$ beat $y$. For instance, the competition $\mathsf{C}$ described in can be represented by the network $N_{\mathsf{C}}=(V,A,c)$ where $$\label{net-comp} \begin{array}{l} V=\{\textsc{a},\textsc{b},\textsc{c},\textsc{d}\};\\ \vspace{-2mm}\\ A=\{(x,y)\in V^2: x,y\in\{\textsc{a},\textsc{b},\textsc{c},\textsc{d}\} \mbox{ and } x\neq y\};\\ \vspace{-2mm}\\ c:V\to\mathbb{N}_0 \mbox{ is defined by }\\ c(\textsc{a},\textsc{b})=1,\; c(\textsc{b},\textsc{a})=0,\;c(\textsc{a},\textsc{c})=1,\; c(\textsc{c},\textsc{a})=2,\\ c(\textsc{a},\textsc{d})=2,\; c(\textsc{d},\textsc{a})=2,\; c(\textsc{b},\textsc{c})=1,\;c(\textsc{c},\textsc{b})=2,\\ c(\textsc{b},\textsc{d})=1,\; c(\textsc{d},\textsc{b})=1,\;c(\textsc{c},\textsc{d})=2,\; c(\textsc{d},\textsc{c})=2.\\ \end{array}$$ Let $N=(V,A,c)\in\mathcal{N}$. For every $x\in V$, the outdegree and the indegree of $x$ in $N$ are respectively defined by $$o(x)=\sum_{y\in V\setminus\{x\}}c(x,y), \qquad i(x)=\sum_{y\in V\setminus\{x\}}c(y,x).$$ Note that $o(x)$ and $i(x)$ depend on $N$ but the notation $o(x)$ and $i(x)$ does not refer to the symbol $N$. When the reference to the network is important we adopt the writings $o^N(x)$ and $i^N(x).$ We use a similar style for any other symbol defined for networks. We call reversal of $N$ the network $N^r=(V,A,c^r)\in\mathcal{N}$ where, for every $(x,y)\in A$, $c^r(x,y)=c(y,x)$. Given a bijection $\psi:V\rightarrow V$, we set $N^{\psi}=(V,A,c^{\psi}) \in\mathcal{N}$ where $c^{\psi}$ is defined, for every $(x,y)\in A$, by $c^{\psi}(x,y)=c(\psi^{-1}(x), \psi^{-1}(y))$. Moreover, given $\alpha\in\mathbb{N}$, we set $\alpha N=(V,A,\alpha c)\in \mathcal{N}$. Given $k\in \mathbb{N}_0$, we say that $N$ is a [*$k$-balanced network*]{} if, for every $(x,y)\in A$, $c(x,y)+c(y,x)=k$. In that case $k$ is called the balance of $N$. We denote the set of $k$-balanced networks on $V$ by $\mathcal{B}_k$ and we call $\mathcal{B}=\bigcup_{k\in \mathbb{N}_0}\mathcal{B}_k$ the set of balanced networks on $V$. Note that modelling competitions where each team confronts with any other team the same number of times leads to balanced networks. In particular, networks in $\mathcal{B}_1$ are the right tool to model round-robin competitions, namely those competitions where each team confronts with any other team exactly once. Those special competitions are largely studied in the literature and are generally modelled via asymmetric and complete digraphs, the so-called tournaments. Of course, there is a natural bijection among the set of tournaments on $V$ and the set $\mathcal{B}_1$. Let $N=(V,A,c)\in \mathcal{N}$ and $s,t\in V$ with $s\neq t$. A [*flow*]{} from $s$ to $t$ in $N$ is a function $f:A\to \mathbb{N}_0$ such that, for every $(x,y)\in A$, $f(x,y)\le c(x,y)$ and, for every $x\in V\setminus\{s,t\}$, $$\label{conservation} \sum_{y\in V\setminus\{x\}}f(x,y)=\sum_{y\in V\setminus\{x\}}f(y,x).$$ Note that the function $f_0:A\to \mathbb{N}_0$ defined by $f_0(x,y)=0$ for all $(x,y)\in A$ is a flow. It is called the null flow. The set of flows from $s$ to $t$ in $N$ is finite and it is denoted by $\mathcal{F}(N,s,t)$. Given $f\in \mathcal{F}(N,s,t)$, the value of $f$ is the integer $$\varphi(f)=\sum_{y\in V\setminus\{s\}}f(s,y)-\sum_{y\in V\setminus\{s\}}f(y,s).$$ The number $$\varphi_{st}=\max_{f\in \mathcal{F}(N, s,t)} \varphi(f),$$ which is well defined and belongs to $\mathbb{N}_0$, is called the [*maximum flow value*]{} from $s$ to $t$ in $N$. If $f\in \mathcal{F}(N,s,t)$ is such that $\varphi(f)=\varphi_{st}$, then $f$ is called a maximum flow from $s$ to $t$ in $N$. Let $S\subseteq V$ and denote by $S^c$ its complement in $V$. If $\varnothing \neq S\neq V$, the number $$c(S)=\sum_{x\in S,\, y\in S^c} c(x,y)$$ is called the capacity of $S$ in $N$. $S$ is called a [*cut*]{} from $s$ to $t$ (or for $\varphi_{st}$) in $N$ if $s\in S$ and $t\in S^c$. The set of cuts from $s$ to $t$ in $N$ is nonempty and finite and it is denoted by $\mathcal{C}(N,s,t)$. It is well-known that, for every $f\in \mathcal{F}(N,s,t)$ and $S\in \mathcal{C}(N,s,t)$, we have $$\label{duality} \varphi(f)\le c(S).$$ In particular, if $S_1=\{s\}$ and $S_2=V\setminus\{t\}$, then $S_1,S_2\in \mathcal{C}(N,s,t)$, $c(S_1)=o(s)$ and $c(S_2)=i(t).$ Thus, by , we get $\varphi_{st}\le \min\{o(s),i(t)\}.$ The fundamental result about flows in networks, namely the famous Maxflow-Mincut Theorem, states that $$\varphi_{st}=\min_{S\in \mathcal{C}(N,s,t)} c(S).$$ In particular, there always exists $S\in \mathcal{C}(N,s,t)$ such that $\varphi_{st}=c(S)$. Such a cut is called a [*minimum cut*]{} from $s$ to $t$ in $N$ (or for $\varphi_{st}$). The next result will turn out to be fundamental for our work. It is due to Gomory and Hu (1961). \[gomory\] Let $N\in \mathcal{N}$ and $x,y, z\in V$ be distinct. Then $\varphi_{xz}\ge\min\{\varphi_{xy},\varphi_{yz}\}.$ Let $S$ be a minimum cut from $x$ to $z$ in $N$. Then we have $x\in S$, $z\in S^c$ and $\varphi_{xz}=c(S)$. If $y\in S$, then $S$ is a cut from $y$ to $z$ and thus, by , $\varphi_{yz}\leq c(S)$. If instead $y\in S^c$ then $S$ is a cut from $x$ to $y$ and thus, by , $\varphi_{xy}\leq c(S)$. In both cases we get $\min\{\varphi_{xy},\varphi_{yz}\}\leq \varphi_{xz}.$ We call a sequence of $m\ge 2$ distinct vertices $x_1,\ldots, x_m$ such that $x_1=s$, $x_m=t$ and, for every $i\in\ldbrack m-1 \rdbrack$, $c(x_i,x_{i+1})\ge 1,$ a path from $s$ to $t$ in $N$ and we denote it by $x_1\cdots x_m$. The set of paths from $s$ to $t$ in $N$ is denoted by $\Gamma(N,s,t)$. Given $\gamma=x_1\cdots x_m\in \Gamma (N,s,t)$, we set $V(\gamma)=\{x_1,\ldots,x_m\}$ and $A(\gamma)=\{(x_1,x_2), \ldots, (x_{m-1},x_m)\}$. Fixed $k\in \mathbb{N}$, we define an arc-disjoint $k$-sequence in $\Gamma(N,s,t)$ as a sequence $(\gamma_{j})_{j=1}^k$ of $k$ (not necessarily distinct) paths in $\Gamma(N,s,t)$ such that, for every $a\in A$, $|\{j\in\ldbrack k \rdbrack: a\in A(\gamma_j)\}|\le c(a).$ We denote the set of arc-disjoint $k$-sequences in $\Gamma(N,s,t)$ by $\Gamma_k(N,s,t)$. Of course, if $\Gamma(N,s,t)=\varnothing$, then $\Gamma_k(N,s,t)=\varnothing$ for all $k\in \mathbb{N}$. We define $$\lambda_{st}=\left\{ \begin{array}{ll} \max\{k\in \mathbb{N}: \Gamma_k(N,s,t)\neq\varnothing\}&\mbox{ if } \Gamma(N,s,t)\neq\varnothing\\ \vspace{-2mm}\\ 0 &\mbox{ if } \Gamma(N,s,t)=\varnothing.\\ \end{array} \right.$$ From Bang-Jensen and Gutin (2008, Lemma 7.1.5), we have the equality $$\label{JG} \varphi_{st}=\lambda_{st},$$ which provides a useful interpretation of the maximum flow value in terms of arc-disjoint paths. Note that, due to , the maximum flow value from $x$ to $y$ in the network $N_{\mathsf{C}}$ described in has been computed in the introduction for all distinct $x,y\in V$. Relations ========= A relation $R$ on $V$ is a subset of $V^2$. It is customary to use relations on $V$ to represent individual or social preferences on $V$ by identifying, for every $x,y\in V$, the membership relation $(x,y)\in R$ with the statement “$x$ is at least as good as $y$”. We denote the set of relations on $V$ by $\mathbf{R}$. Let $R\in\mathbf{R}$. The strict relation associated with $R$ is $S(R)=\{(x,y)\in V^2:(x,y)\in R,(y,x)\notin R\}$; the reversal relation of $R$ is $R^r=\{(x,y)\in V^2:(y,x)\in R\}.$ Given $x,y\in V$, we usually write $x\succeq_R y$ instead of $(x,y)\in R$; $x\succ_R y$ instead of $(x,y)\in S(R)$; $x\sim_R y$ instead of $(x,y)\in R$ and $(y,x)\in R$. Recall that, by definition, $R$ is quasi-transitive if $S(R)$ is transitive; acyclic if, for every sequence $x_1,\ldots,x_m$ of $m\ge 2$ distinct elements of $V$ such that $x_i\succeq_R x_{i+1}$ for all $i\in\ldbrack m-1 \rdbrack$, we have that $x_m \not\succeq_R x_1$; quasi-acyclic if $S(R)$ is acyclic. Given a function $u:V\to \mathbb{R}$, the relation induced by $u$ is $R(u)=\{(x,y)\in V^2: u(x)\geq u(y)\}$. We denote the set of complete and quasi-acyclic relations on $V$ by $\mathbf{A}$; the set of complete and quasi-transitive relations on $V$ by $\mathbf{T}$; the set of complete and transitive relations on $V$ by $\mathbf{O}$; the set of complete, quasi-transitive and antisymmetric relations on $V$ by $\mathbf{L}$. The elements of $\mathbf{O}$ are called orders; the ones of $\mathbf{L}$ are called linear orders. Of course, we have $\mathbf{L}\subseteq \mathbf{O}\subseteq \mathbf{T}\subseteq \mathbf{A}$. Given $R\in\mathbf{R}$, we also consider the sets $$\mathbf{L}_\diamond(R)=\{L\in\mathbf{L}: L\subseteq R\},\quad \mathbf{L}^\diamond(R)=\{L\in\mathbf{L}: L\supseteq R\},$$ that is, the set of linear refinements and the set of linear extensions of $R$. Both those sets may be empty and if $L\in \mathbf{L}$, then $\mathbf{L}_\diamond(L)=\mathbf{L}^\diamond(L)=\{L\}$. Let $\mathbb{P}(V)$ be the set of the subsets of $V$ and, for $k\in \mathbb{N}$, let $\mathbb{P}_k(V)$ be the set of the subsets of $V$ of size $k$. Given $R\in\mathbf{R}$ and $W\in \mathbb{P}_k(V)$, we say that $W$ is a $k$-[*maximum set*]{} for $R$ if, for every $x\in W$ and $y\in V\setminus W$, we have $x\succeq_R y$. We define then the set $$C_k(R)=\{W\in\mathbb{P}_k(V): W \mbox{ is a $k$-maximum set for }R\}$$ Clearly, $C_n(R)=\{V\}$ and $C_k(R)=\varnothing$ for all $k>|V|=n$. Thus, the study of the set $C_k(R)$ is meaningful only if $k\in \ldbrack n-1 \rdbrack$. Note also that if $R$ is reflexive, then $\max(R)=\{x\in V:\{x\}\in C_1(R)\}$, where $\max(R)$ denotes the set of maxima for $R$. Finally, if $R\in\mathbf{L}$ and $k\in \ldbrack n-1 \rdbrack $, then $|C_k(R)|=1$. Definition of the flow network method {#def-flow} ===================================== We call [*network method*]{} any function from $\mathcal{N}$ to $\mathbf{R}$. A network method can be seen as a procedure to determine, for every competition and every ordered pair of teams, whether the first team did at least as good as the second one. The [*flow network method*]{} $\mathfrak{F}$ is defined, for every $N\in\mathcal{N}$, by $$\mathfrak{F}(N)= \{(x,y)\in A: \varphi^N_{xy}\ge \varphi^N_{yx}\}\cup \Delta.$$ The relation $\mathfrak{F}(N)$ on $V$ is called the [*flow relation*]{} associated with $N$. This network method was first proposed by Gvozdik (1987), who focuses only on balanced networks, and later extended and studied in Belkin and Gvozdik (1989). Note that, for the network $N_{\textsf{C}}$ defined in , $\mathfrak{F}(N_{\textsf{C}})$ coincides with the relation $\succeq_{\textsf{C}}$ in . We call next [*network rule*]{} any correspondence from $\mathcal{N}$ to $\mathbf{L}$. A network rule can be seen as a procedure to determine, for every competition, the set of all the possible rankings of the teams which are consistent with the competition. The [*flow network rule*]{} $\mathfrak{F}_\diamond$ is defined, for every $N\in\mathcal{N}$, by $$\mathfrak{F}_{\diamond}(N)=\mathbf{L}_\diamond(\mathfrak{F}(N)).$$ Such a network rule is the main object studied by Belkin and Gvozdik (1989). Given now $k\in \ldbrack n-1 \rdbrack $, we finally call [*$k$-multiwinner network solution*]{} any correspondence from $\mathcal{N}$ to $\mathbb{P}_k(V)$. A $k$-multiwinner network solution can be seen as a procedure to determine, for every competition, all the possible choices for the set of the best $k$ teams of the competition. The [*flow $k$-multiwinner network solution*]{} $\mathfrak{F}_k$ is defined, for every $N\in\mathcal{N}$, by $$\mathfrak{F}_k(N)=C_k(\mathfrak{F}(N)).$$ Our purpose is to study the properties of the three objects above defined. In order to discuss the properties of the flow network method we just need the crucial fact about complete and quasi-transitive relations which is proved in the next section. For studying the flow network rule and the flow $k$-multiwinner network solution further results from the theory of relations are necessary. They are collected in Section \[relation-2\]. Later on, given $N\in\mathcal{N}$ and $x,y\in V$, we write $x\succeq_{N} y$ instead of $x\succeq_{\mathfrak{F}(N)}y$; $x\succ_{N} y$ instead of $x\succ_{\mathfrak{F}(N)}y$; $x\sim_N y$ instead of $x\sim_{\mathfrak{F}(N)} y$. Thus, $x\succeq_{N} y$ means $x=y$ or $\varphi^N_{x,y}\geq\varphi^N_{yx};$ $x\succ_{N} y$ means $x\neq y$ and $\varphi^N_{xy}>\varphi^N_{yx};$ $x\sim_{N} y$ means $x=y$ or $\varphi^N_{xy}=\varphi^N_{yx}.$ Building complete and quasi-transitive relations ================================================ This section is devoted to the description of a general procedure to construct complete and quasi-transitive relations on $V$. For every $\vartheta:A\to \mathbb{R}$, define $R(\vartheta)\in \mathbf{R}$ by $$R(\vartheta)= \{(x,y)\in A: \vartheta(x,y)\ge \vartheta(y,x)\}\cup \Delta.$$ Given $\vartheta:A\to \mathbb{R}$, we say that $\vartheta$ satisfies the [*Gomory-Hu condition*]{} if, for every $x,y,z\in V$ distinct, we have $$\label{gomory-eq} \vartheta(x,z)\ge \min\{\vartheta(x,y),\vartheta(y,z)\}.$$ The next proposition is based on Schulze (2011, pp. 277-278). \[schulze\] If $\vartheta:A\to \mathbb{R}$ satisfies the Gomory-Hu condition, then $R(\vartheta)\in\mathbf{T}$. For shortness set $R=R(\vartheta)$. The completeness of $R$ is obvious. We show that $R$ is quasi-transitive. Let us consider $x,y,z\in V$ and assume that $x\succ_{R} y$ and $y\succ_{R} z$. We must prove that $x\succ_{R} z$, that is, $x\neq z$ and $$\label{equa3} \vartheta(x,z)>\vartheta(z,x).$$ Note that $x\succ_{R} y$ and $y\succ_{R} z$ mean $x\neq y$, $y\neq z$, $$\label{equa1} \vartheta(x,y)>\vartheta(y,x)$$ and $$\label{equa2} \vartheta(y,z)>\vartheta(z,y).$$ We first show that $x\neq z$. Indeed, if it were $x=z$, then we would get $\vartheta(x,y)>\vartheta(y,x)$ and $\vartheta(y,x)>\vartheta(x,y)$, a contradiction. By , we have $$\label{gomory-1} \vartheta(x,z)\ge \min\{\vartheta(x,y),\vartheta(y,z)\}.$$ $$\label{gomory-2} \vartheta(z,y)\ge \min\{\vartheta(z,x),\vartheta(x,y)\}.$$ $$\label{gomory-3} \vartheta(y,x)\ge \min\{\vartheta(y,z),\vartheta(z,x)\}.$$ Assume first that $$\label{eqA} \vartheta(x,y)\ge \vartheta(y,z).$$ Then, and give $$\label{eqB} \vartheta(x,z) >\vartheta(z,y).$$ Moreover, and give $\vartheta(x,y)>\vartheta(z,y).$ Since by , $\vartheta(z,y)$ must be greater or equal to one between $\vartheta(z,x)$ and $\vartheta(x,y)$, it follows that $\vartheta(z,y)\ge \vartheta(z,x)$. Using we then get . Assume next that $\vartheta(x,y)<\vartheta(y,z)$. Then and give $$\label{eqC} \vartheta(x,z)> \vartheta(y,x).$$ Moreover, by , $\vartheta(y,x)<\vartheta(y,z)$. Using , we get $\vartheta(y,x)\ge \vartheta(z,x)$. Using now we finally get . Properties of the flow network method {#flow-network-method} ===================================== The next result establishes the fundamental property of $\mathfrak{F}$. Such a property was proved by Belkin and Gvozdik (1989, Lemma 2). We derive it as a particular application of Proposition \[schulze\]. Given $N\in\mathcal{N}$, let $\varphi^N:A\to \mathbb{R}$ be defined, for every $(x,y)\in A$, by $\varphi^N(x,y)=\varphi^N_{xy}$ and note that $\mathfrak{F}(N)=R(\varphi^N)$. \[F-qt\] Let $N \in\mathcal{N}$. Then $\mathfrak{F}(N)\in\mathbf{T}$. By Proposition \[gomory\], $\varphi^N$ satisfies the Gomory-Hu condition. Thus, by Proposition \[schulze\], we get $\mathfrak{F}(N)=R(\varphi^N)\in \mathbf{T}$. If $n= 2$, we have $\mathbf{O}=\mathbf{T}$ so that the outcomes of the flow network method are always transitive. That does not hold true when $n\ge 3$, as shown by the next proposition. \[non-o\] Let $n\ge 3$. Then there exists $N \in\mathcal{N}$ such that $\mathfrak{F}(N)\not \in\mathbf{O}$. Let $V=\ldbrack n \rdbrack$. Consider $N=(V,A,c)$ such that $c(1,2)=1$ and $c(i,j)=0$ for all $i,j\in\ldbrack n \rdbrack$ with $i\neq j$ and $(i,j)\neq(1,2)$. Then $\mathfrak{F}(N)$ is such that $1\succ_N 2$ and $i\sim_N j$ for all $i,j\in\ldbrack n \rdbrack$ with $i\neq j$ and $\{i,j\}\neq \{1,2\}$. In particular, we have $2\succeq_N 3$ and $3\succeq_N 1$ but $2\not\succeq_N 1.$ Hence $\mathfrak{F}(N)$ is not transitive and so $\mathfrak{F}(N)\not \in\mathbf{O}$. Proposition \[main-qt\] below states that any relation belonging to $\mathbf{T}$ can in fact be the outcome of the flow network method applied to a suitable network. Its proof relies on the possibility to naturally associate a network to any relation. In what follows, given $R\in\mathbf{R}$, we set $N_R=(V, A,c_R)\in\mathcal{N}$ where, for every $(x,y)\in A$, $c_R(x,y)=1$ if $x\succ_{R} y$ and $c_R(x,y)=0$ otherwise. \[core\] Let $R\in \mathbf{T}$ and $(x,y)\in A$. Then: - $\varphi^{N_R}_{xy}>0$ if and only if $x\succ_{R} y;$ - $\varphi^{N_R}_{xy}=\varphi^{N_R}_{yx}=0$ if and only if $x\sim_R y$. $(i)$ If $x\succ_{R} y,$ then $c_R(x,y)=1$ and in $N_R$ we have at least the path $xy$, so that $\varphi^{N_R}_{xy}\geq 1.$ Assume next that $\varphi^{N_R}_{xy}>0.$ Then there exists a path in $N_R$ from $x$ to $y$. Thus, there exist $m\geq 2$ and $x_1, \ldots ,x_m\in V$ distinct such that $x_1=x$, $x_m=y$ and, for every $i\in\ldbrack m-1\rdbrack$, $c_R(x_{i},x_{i+1})=1$. It follows that we have the chain $x=x_1\succ_{R} x_2\succ_{R} \ldots \succ_{R} x_{m-1} \succ_{R} x_m=y.$ Since $S(R)$ is transitive, we also have $x\succ_{R}y.$ $(ii)$ Let $x\sim_R y$. Then we neither have $x\succ_{R} y$ nor $y\succ_{R} x$ and so, by $(i)$, we get $\varphi^{N_R}_{xy}=\varphi^{N_R}_{yx}=0$. Conversely let $\varphi^{N_R}_{xy}=\varphi^{N_R}_{yx}=0$. Then, by $(i)$, we neither have $x\succ_{R} y$ nor $y\succ_{R} x$. By completeness, the only possibility is $x\sim_R y$. \[main-qt\] If $R\in \mathbf{T}$ then $\mathfrak{F}(N_R)=R.$ We need to see that, for every $x,y\in V$ with $x\neq y$, $x\succeq_{R} y$ if and only if $\varphi^{N_R}_{xy}\geq\varphi^{N_R}_{yx}$. Assume first that $\varphi^{N_R}_{xy}\geq\varphi^{N_R}_{yx}.$ If $\varphi^{N_R}_{xy}>\varphi^{N_R}_{yx},$ then $\varphi^{N_R}_{xy}>0$ and, by Lemma \[core\](i), we get $x\succ_{R} y.$ If instead $\varphi^{N_R}_{xy}=\varphi^{N_R}_{yx}$ then, by Lemma \[core\](i), we necessarily have $\varphi^{N_R}_{xy}=\varphi^{N_R}_{yx}=0$ and thus, by Lemma \[core\](ii), $x\sim_R y$ and, in particular, $x\succeq_{R} y$. Assume next that $x\succeq_{R} y$. If $\varphi^{N_R}_{yx}=0,$ we trivially have $\varphi^{N_R}_{xy}\geq\varphi^{N_R}_{yx}.$ But we cannot have $\varphi^{N_R}_{yx}>0$ since otherwise, by Lemma \[core\](i), we would get $y\succ_{R} x,$ against $x\succeq_{R} y$. As a consequence of the above result and Proposition \[schulze\], we derive the following interesting characterization of the complete and quasi-transitive relations. \[co-qt\] Let $R\in\mathbf{R}$. Then $R\in \mathbf{T}$ if and only if there exists $\vartheta:A\to \mathbb{R}$ satisfying the Gomory-Hu condition, such that $R=R(\vartheta).$ One implication is just Proposition \[schulze\]. Assume now that $R\in \mathbf{T}$. Then, by definition of flow relation, we have $R(\varphi^{N_R})=\mathfrak{F}(N_R)$ and we know, by Proposition \[gomory\], that $\varphi^{N_R}$ satisfyies the Gomory-Hu condition. Since, by Proposition \[main-qt\], we have $\mathfrak{F}(N_R)=R, $ we deduce that $R=R(\varphi^{N_R}).$ We now present some further remarkable properties of $\mathfrak{F}$. The first property is about the behaviour of the relation $\mathfrak{F}(N)$ with respect to a relabelling of its vertices. It simply says that if one decides to relabel the network vertices, the flow relation accordingly changes. In other words, the flow relation does not depend on the names of vertices. For that reason we call that property neutrality. The second one is a homogeneity property for the flow relation. We observe that these two properties are considered by González-Díaz et al. (2014).[^19] \[neut-F\] Let $N=(V,A,c) \in\mathcal{N}$ and let $\psi:V\rightarrow V$ be a bijection. Then, for every $x,y\in V$, $x\succeq_N y$ if and only if $\psi(x)\succeq_{N^{\psi}} \psi(y).$ It is clearly enough to show that, for every $N=(V,A,c) \in\mathcal{N}$, every $(x,y)\in A$ and every bijection $\psi:V\rightarrow V$, we have $$\label{8}\varphi_{\psi(x)\psi(y)}^{N^{\psi}}=\varphi_{xy}^{N}.$$ Let $S$ be a minimum cut from $\psi(x)$ to $\psi(y)$ in $N^{\psi}$. Then $\psi^{-1}(S)$ is a cut from $x$ to $y$ in $N$. Thus, by definition of $c^{\psi}$ and by , we have $$\varphi_{\psi(x)\psi(y)}^{N^{\psi}}=c^{N^{\psi}}(S)=\sum_{\psi(u)\in S,\, \psi(v)\in S^c} c^{\psi}(\psi(u),\psi(v))=\sum_{u\in \psi^{-1}(S),\, v\in [\psi^{-1}(S)]^c} c(u,v)\geq \varphi_{xy}^{N}.$$ Then, we also have $$\varphi_{xy}^{N}=\varphi_{\psi^{-1}(\psi(x))\,\psi^{-1}(\psi(y))}^{(N^{\psi})^{\psi^{-1}}}\geq \varphi_{\psi(x)\psi(y)}^{N^{\psi}}$$ and so we get the equality . \[homo-net\] Let $N\in \mathcal{N}$ and $\alpha\in \mathbb{N}$. Then $\mathfrak{F}(\alpha N)=\mathfrak{F}(N)$. Let $N=(V,A,c)$ and let $\alpha N=(V,A,c')$, where $c'=\alpha c$. In order to get $\mathfrak{F}(\alpha N)=\mathfrak{F}(N)$ it is enough to show that, for every $(x,y)\in A$, $\varphi_{xy}^{\alpha N}=\alpha\varphi_{xy}^N$. Let $(x,y)\in A$. Consider $f\in \mathcal{F}(N,x,y)$ such that $\varphi_{xy}^N=\varphi(f)$. Then $\alpha f\in \mathcal{F}(\alpha N,x,y)$ so that $ \varphi_{xy}^{\alpha N}\ge \varphi(\alpha f)=\alpha \varphi(f)=\alpha\varphi_{xy}^{N}. $ Let $S$ be a cut from $x$ to $y$ in $N$ such that $c(S)=\varphi_{xy}^{N}$. Then $S$ is also a cut from $x$ to $y$ in $\alpha N$. Hence, by , $ \alpha\varphi_{xy}^{N}=\alpha c(S)=c'(S)\ge \varphi_{xy}^{\alpha N} $ and the proof is completed. Given a network $N$ and two distinct vertices $x^*$ and $y^*$, it can be useful to have simple conditions which are sufficient to guarantee $x^*\succeq_{N} y^*$ or $x^*\succ_{N} y^*$. Conditions of that type are described in the next proposition. \[Eff-F\] Let $N=(V,A,c)\in \mathcal{N}$ and $x^*,y^*\in V$ with $x^*\neq y^*$. Assume that $c(x^*,y^*)\ge c(y^*,x^*)$ and that, for every $z\in V\setminus\{x^*,y^*\}$, $c(x^*,z)\ge c(y^*,z)$ and $c(z,y^*)\ge c(z,x^*)$. Then $x^*\succeq_{N} y^*$. Assume further that one of the following conditions holds true: - $c(x^*,y^*)> c(y^*,x^*)$; - for every $z\in V\setminus\{x^*,y^*\}$, $c(x^*,z)> c(y^*,z)$; - for every $z\in V\setminus\{x^*,y^*\}$, $c(z,y^*)> c(z,x^*)$; - there exists $z\in V\setminus \{x^*,y^*\}$ such that $c(x^*,z)>c(y^*,z)$ and $c(z,y^*)>c(z,x^*)$. Then $x^*\succ_{N} y^*$. Let $S$ be a minimum cut for $\varphi_{x^*y^*}$ so that $S\subseteq V$, $x^*\in S,\ y^*\notin S$ and $c(S)=\varphi_{x^*y^*}.$ Define $T=(S\setminus \{x^*\})\cup\{y^*\}$ and note that, since $T\subseteq V$, $y^*\in T,\ x^*\notin T,$ we have that $T$ is a cut for $\varphi_{y^*x^*}$. By , we have $c(T)\ge \varphi_{y^*x^*}$. In order to obtain $\varphi_{x^*y^*}\ge \varphi_{y^*x^*}$, that is $x^*\succeq_N y^*$, it is enough to show $c(S)- c(T)\ge 0.$ Note that $$c(S)=\sum_{u\in S,v\in S^c}c(u,v)=\sum_{u\in S\setminus\{x^*\}, v\in S^c\setminus\{y^*\}}c(u,v)+\sum_{v\in S^c\setminus\{y^*\}}c(x^*,v)+\sum_{u\in S\setminus\{x^*\}}c(u,y^*)+c(x^*,y^*)$$ and $$c(T)=\sum_{u\in T,v\in T^c}c(u,v)=\sum_{u\in T\setminus\{y^*\}, v\in T^c\setminus\{x^*\}}c(u,v)+\sum_{v\in T^c\setminus\{x^*\}}c(y^*,v)+\sum_{u\in T\setminus\{y^*\}}c(u,x^*)+c(y^*,x^*)$$ Observe now that $T\setminus\{y^*\}=S\setminus\{x^*\}$ and $T^c\setminus\{x^*\}=S^c\setminus\{y^*\}.$ Thus $$\label{diff} c(S)-c(T)= (c(x^*,y^*)-c(y^*,x^*))+\sum_{v\in S^c\setminus\{y^*\}}(c(x^*,v)-c(y^*,v))+\sum_{u\in S\setminus\{x^*\}}(c(u,y^*)-c(u,x^*))$$ and every term between brackets is non-negative, which says $c(S)- c(T)\ge 0.$ Assume further that one among $(a)$, $(b)$, $(c)$ and $(d)$ holds true. Then, at least one of the terms between brackets in is now positive and so $\varphi_{x^*y^*}=c(S)>c(T)\ge\varphi_{y^*x^*}.$ Thus, $\varphi_{x^*y^*}>\varphi_{y^*x^*}$, that is, $x^*\succ_N y^*$. The flow network method also satisfies a monotonicity property, as described by the next proposition. This property implies that teams have an incentive to win when the flow network method is used to assess their performance. That is in line with the Property II in Vaziri et al. (2017). \[Mon1-flow-rule\] Let $N=(V,A,c)\in \mathcal{N}$, $N'=(V,A,c')\in \mathcal{N}$ and $x^* \in V$. Assume that the following conditions hold true: - for every $y\in V\setminus \{x^*\}$, $c'(x^*,y)\geq c(x^*,y)$ and $c'(y,x^*)\le c(y,x^*)$; - for every $(x,y)\in A$ with $x\neq x^*$ and $y\neq x^*$, $c'(x,y)= c(x,y)$. Then, for every $y\in V\setminus\{x^*\}$ such that $x^*\succeq_{N} y$, we have $x^*\succeq_{N'} y$. Moreover, for every $y\in V\setminus\{x^*\}$ such that $x^*\succeq_{N} y$ and one among $\ x^*\succ_N y$, $c'(x^*,y)> c(x^*,y)$ and $c'(y,x^*)< c(y,x^*)$ holds true, we have that $x^*\succ_{N'} y$. Let $y^*\in V\setminus\{x^*\}$ such that $x^*\succeq_{N} y^*$, that is $\varphi_{x^*y^*}^{N}\ge \varphi_{y^*x^*}^{N}$. We want to show that $\varphi_{x^*y^*}^{N'}\ge \varphi_{y^*x^*}^{N'}$. We prove first that $\varphi_{x^*y^*}^{N'}\ge \varphi_{x^*y^*}^{N}+c'(x^*,y^*)-c(x^*,y^*).$ Let $f$ be a maximum flow from $x^*$ to $y^*$ in $N$ such that $$\label{ca} \mbox{for every } x\in V\setminus \{x^*\}, \;f(x,x^*)=0.$$ Such a maximum flow can be obtained as the output of the well-known augmenting path algorithm applied to the null flow. Then we have $$\label{flusso} \varphi^{N}(f)= \varphi^N_{x^*y^*}= \sum_{y\in V\setminus \{x^*\}}f(x^*,y).$$ Consider now $f':A\to\mathbb{N}_0$ defined by $$f'(x,y)=\left\{ \begin{array}{ll} f(x^*,y^*)+ c'(x^*,y^*)-c(x^*,y^*) &\mbox{if }(x,y)= (x^*,y^*)\\ \vspace{-2mm}\\ f(x,y) &\mbox{if }(x,y)\neq(x^*,y^*)\\ \end{array} \right.$$ We show that $f'\in \mathcal{F}(N',x^*,y^*)$. By $(a)$ we have $f'(x,y)\geq 0$ for all $(x,y)\in A$. To see that $f'(x,y)\leq c'(x,y)$ for all $(x,y)\in A$, we need to distinguish some cases. Surely $f'(x^*,y^*)=f(x^*,y^*)+ c'(x^*,y^*)-c(x^*,y^*)\leq c'(x^*,y^*)$ because $f(x^*,y^*)\leq c(x^*,y^*).$ Let $(x,y)\in A\setminus \{(x^*,y^*)\}$. If $x=x^*$ and $y\neq y^*$ then, by $(a)$, we have $f'(x^*,y)=f(x^*,y)\leq c(x^*,y)\leq c'(x^*,y).$ Assume next $x\neq x^*$. If $y=x^*$ then, by , $f'(x,y)=f(x,x^*)=0\leq c'(x,x^*).$ If instead $y\neq x^*$ then, by $(b)$, we have $f'(x,y)=f(x,y)\leq c(x,y)=c'(x,y).$ We are left to show . Fix $u\not\in \{x^*, y^*\}$. We need to show $$\label{original} \sum_{z\in V\setminus \{u\}}f'(u,z)=\sum_{z\in V\setminus \{u\}}f'(z,u).$$ Since $u\not\in \{x^*, y^*\}$, by $f'$ definition, is the same as $ \sum_{(u, z)\in A}f(u,z)=\sum_{(z, u)\in A}f(z,u) $ which holds true because $f\in\mathcal{F}(N,x^*,y^*)$. Now, using , we get $$\varphi^{N'}(f')=\sum_{y\in V\setminus \{x^*\}}f'(x^*,y)-\sum_{y\in V\setminus \{x^*\}}f'(y,x^*)$$ $$=f'(x^*,y^*)+\sum_{y\in V\setminus \{x^*,y^*\}}f'(x^*,y)-\sum_{y\in V\setminus \{x^*,y^*\}}f(y,x^*)$$ $$=f(x^*,y^*)+ c'(x^*,y^*)-c(x^*,y^*)+ \sum_{y\in V\setminus \{x^*,y^*\}}f(x^*,y) =\varphi_{x^*y^*}^N+c'(x^*,y^*)-c(x^*,y^*).$$ As a consequence, $$\label{in1} \varphi_{x^*y^*}^{N'}\ge \varphi^{N'}(f')=\varphi_{x^*y^*}^{N}+c'(x^*,y^*)-c(x^*,y^*).$$ Consider now a minimum cut $S$ from $y^*$ to $x^*$ in $N$. Then we have $c(S)=\varphi_{y^*x^*}^{N}.$ Of course, $S$ is also a cut from $y^*$ to $x^*$ in $N'$ and then $$\label{in3} c'(S)\ge \varphi_{y^*x^*}^{N'}.$$ Moreover we have $$c'(S)=\sum_{u\in S,v\in S^c}c'(u,v)=\sum_{u\in S, v\in S^c\setminus \{x^*\}}c'(u,v)+\sum_{u\in S\setminus\{y^*\}}c'(u,x^*)+ c'(y^*,x^*).$$ Note now that, by the assumptions $(a)$ and $(b)$, we have $$\sum_{u\in S, v\in S^c\setminus \{x^*\}}c'(u,v)= \sum_{u\in S, v\in S^c\setminus \{x^*\}}c(u,v), \qquad \sum_{u\in S\setminus\{y^*\}}c'(u,x^*)\le \sum_{u\in S\setminus\{y^*\}}c(u,x^*)$$ and $c'(y^*,x^*)\le c(y^*,x^*).$ As a consequence, $$\label{in4} c'(S)+c(y^*,x^*)-c'(y^*,x^*)\le c(S).$$ Using now the inequalities , and and recalling that $\varphi^N_{x^*y^*}\ge \varphi^N_{y^*x^*}$, we obtain $$\varphi_{x^*y^*}^{N'}\ge \varphi_{x^*y^*}^{N}+c'(x^*,y^*)-c(x^*,y^*)\ge \varphi_{y^*x^*}^{N}+c'(x^*,y^*)-c(x^*,y^*)$$ $$=c(S)+c'(x^*,y^*)-c(x^*,y^*)\ge c'(S)+\left(c(y^*,x^*)-c'(y^*,x^*)\right)+\left(c'(x^*,y^*)-c(x^*,y^*)\right)$$ $$\ge \varphi_{y^*x^*}^{N'}+\left(c(y^*,x^*)-c'(y^*,x^*)\right)+\left(c'(x^*,y^*)-c(x^*,y^*)\right),$$ and thus $$\varphi_{x^*y^*}^{N'} \ge \varphi_{y^*x^*}^{N'}+\left(c(y^*,x^*)-c'(y^*,x^*)\right)+\left(c'(x^*,y^*)-c(x^*,y^*)\right).$$ In particular, $\varphi_{x^*y^*}^{N'} \ge \varphi_{y^*x^*}^{N'}$ so that the proof of the first part of the theorem is complete. Consider now $y^*\in V\setminus\{x^*\}$ such that $x^*\succeq_{N} y^*$ and one among $x^*\succ_N y^*$, $c'(x^*,y^*)> c(x^*,y^*)$ and $c'(y^*,x^*)< c(y^*,x^*)$ holds true. The same argument as above gives $\varphi_{x^*y^*}^{N'} > \varphi_{y^*x^*}^{N'}$ which completes the proof. We now observe that reversing a network, the flow relation gets its reversal. We call such a property reversal symmetry due to its similarity to the concept of reversal symmetry for social welfare functions proposed by Saari (1994) and recently deepened by Bubboloni and Gori (2015). Note also that this property is called inversion by González-Díaz et al. (2014). The proof of this fact, formalized in the proposition below, is very easy and thus omitted. \[Reversal\] Let $N \in\mathcal{N}$. Then, for every $(x,y)\in A$, we have $\varphi_{yx}^{N^r}=\varphi_{xy}^{N}$. In particular, $\mathfrak{F}(N^r)=\mathfrak{F}(N)^r$. The next proposition shows that if in a competition the number of wins (losses) of a team is greater than the number of its losses (wins), then the flow network method does not make that team be the worst (best) one. Its proof immediately follows from Theorem 1 in Lovász (1973) once adapted to the network context[^20], and from Proposition \[Reversal\] after having observed that $o^{N^r}(x)=i^{N}(x)$ for all $x\in V$. \[szigeti\] Let $N \in\mathcal{N}$ and $x^*\in V$. If $o(x^*)>i(x^*)$, then there exists $y\in V\setminus \{x^*\}$ such that $x^*\succ_{N}y$. If $o(x^*)<i(x^*)$, then there exists $y\in V\setminus \{x^*\}$ such that $y\succ_{N}x^*$. A network method is said [*flat*]{} on a network $N$ if it associates with $N$ the total relation $V^2$. A network method is said [*symmetric*]{} if it is flat on every network $N$ such that $N=N^r$. The symmetry property is a basic requirement for network methods invoked by González-Díaz et al. (2014). The next proposition fully characterizes the set of networks on which $\mathfrak{F}$ is flat. Generalizing the classic definition given for directed graphs, we define $N\in \mathcal{N}$ [*pseudo-symmetric*]{} if, for every $x\in V$, $o(x)=i(x)$. \[flat\]Let $N \in\mathcal{N}$. $\mathfrak{F}$ is flat on $N$ if and only if $N$ is pseudo-symmetric. In particular, $\mathfrak{F}$ is a symmetric network method.[^21] Let $N \in\mathcal{N}$ be pseudo-symmetric. We want to show that, for every $x,y\in V$ with $x\neq y$, we have $\varphi_{yx}^{N}=\varphi_{xy}^{N}.$ To that purpose we first show that, for every proper nonempty subset $S$ of $V$, we have $c(S)=c(S^c)$[^22]. Let $S\subseteq V$ with $\varnothing\neq S\neq V$. Given $x\in S$, we have that $$o(x)=\sum_{y\in V\setminus\{x\}}c(x,y)=\sum_{y\in S^c}c(x,y)+\sum_{y\in S\setminus\{x\}}c(x,y)$$ while $$i(x)=\sum_{y\in V\setminus\{x\}}c(y,x)=\sum_{y\in S^c}c(y,x)+\sum_{y\in S\setminus\{x\}}c(y,x).$$ Thus, we have $$\sum_{x\in S}o(x)=\sum_{x\in S}\sum_{y\in S^c}c(x,y)+\sum_{x\in S}\sum_{y\in S\setminus\{x\}}c(x,y)=c(S)+\sum_{(x,y)\in A\cap (S\times S)}c(x,y)$$ and $$\sum_{x\in S}i(x)=\sum_{x\in S}\sum_{y\in S^c}c(y,x)+\sum_{x\in S}\sum_{y\in S\setminus\{x\}}c(y,x)=c(S^c)+\sum_{(x,y)\in A\cap (S\times S)}c(y,x)$$ $$=c(S^c)+\sum_{(x,y)\in A\cap (S\times S)}c(x,y).$$ Since, for every $x\in S$, we have $o(x)=i(x)$, it follows that $$0=\sum_{x\in S}(o(x)-i(x))=c(S)-c(S^c).$$ Let now $x,y\in V$ with $x\neq y$. The map from $\mathcal{C}(N,x,y)$ to $\mathcal{C}(N,y,x)$ associating with $S\in \mathcal{C}(N,x,y)$ the set $S^c\in \mathcal{C}(N,y,x)$ is a bijection. It follows that $$\varphi_{xy}=\min_{S\in \mathcal{C}(N,x,y)} c(S)=\min_{S\in \mathcal{C}(N,x,y)} c(S^c)=\min_{T\in \mathcal{C}(N,y,x)} c(T)=\varphi_{yx}.$$ Let next $\mathfrak{F}$ be flat on $N$. Assume, by contradiction, that there exists $x^*\in V$ with $o(x^*)\neq i(x^*).$ Then, by Proposition \[szigeti\], there exists $y\in V$ such that $y\not \sim_N x^*$ against $\mathfrak{F}(N)=V^2.$ Finally, to show that $\mathfrak{F}$ is symmetric, note that if $N\in \mathcal{N}$ is such that $N=N^r$ then, for every $x\in V$, $o^N(x)=i^{N^r}(x)=i^N(x)$ and thus $N$ is pseudo-symmetric. Given two networks $N=(V,A,c)$ and $N'=(V,A,c')$, we define $N+N'=(V,A,c+c')\in\mathcal{N}$. From Proposition \[flat\], we immediately obtain for the flow network method the flatness preservation property introduced by González-Díaz et al. (2014). Let $N,N'\in\mathcal{N}$. If $\mathfrak{F}$ is flat on $N$ and $N'$, then $\mathfrak{F}$ is flat on $N+N'$. The flow, the Borda and the dual Borda network methods ------------------------------------------------------ Let us consider now the Borda network method $\mathfrak{B}:\mathcal{N}\to\mathbf{R}$ and the dual Borda network method $\widehat{\mathfrak{B}}:\mathcal{N}\to\mathbf{R}$ respectively defined, for every $N\in\mathcal{N}$, by $\mathfrak{B}(N)=R(o^N)$ and $\widehat{\mathfrak{B}}(N)=R(-i^N).$ In other words, $\mathfrak{B}(N)$ and $\widehat{\mathfrak{B}}(N)$ are the relations respectively induced by the outdegree function and by the opposite of the indegree function associated with the network $N$. Note that $\mathfrak{B}(N), \widehat{\mathfrak{B}}(N)\in \mathbf{O}$ and that $\widehat{\mathfrak{B}}(N)=(R(i^N))^r$. Our purpose is to describe some links among the flow, the Borda and the dual Borda network methods. We begin with the next lemma about balanced networks. It was stated, without proof, by Gvozdik (1987, Proposition 1) and Belkin and Gvozdik (1989, Lemma 1). \[BeGv-lemma1\] Let $N=(V,A,c)\in \mathcal{B}$. Then, for every $x,y\in V^2$ with $x\neq y$, $\varphi_{xy}-\varphi_{yx}=o(x)-o(y)$. It is enough to show that, for every $x,y\in V$ with $x\neq y$, $\varphi_{xy}-\varphi_{yx}\ge o(x)- o(y)$. Let $x,y\in V$ with $x\neq y$. Let $S$ be a minimum cut for $\varphi_{xy}$, so that $S\subseteq V$, $x\in S,\ y\notin S$ and $c(S)=\varphi_{xy}$. Define $T=(S\setminus \{x\})\cup\{y\}$ and note that, since $T\subseteq V$, $y\in T,\ x\notin T,$ we have that $T$ is a cut for $\varphi_{yx}$. By , we get $c(T)\ge \varphi_{yx}$. As a consequence $\varphi_{xy}-\varphi_{yx}\ge c(S)-c(T)$. Note that $$c(S)=\sum_{u\in S,v\in S^c}c(u,v)=\sum_{u\in S\setminus\{x\}, v\in S^c\setminus\{y\}}c(u,v)+\sum_{v\in S^c}c(x,v)+\sum_{u\in S\setminus\{x\}}c(u,y)$$ and $$c(T)=\sum_{u\in T,v\in T^c}c(u,v)=\sum_{u\in S\setminus\{x\}, v\in S^c\setminus\{y\}}c(u,v)+\sum_{v\in (S^c\setminus\{y\})\cup\{x\}}c(y,v)+\sum_{u\in S\setminus\{x\}}c(u, x).$$ Let $k\in \mathbb{N}_0$ be the balance of $N.$ Then we have $c(u,x)=k-c(x,u)$ for all $u\in V\setminus \{x\}$ and $c(u,y)=k-c(y,u)$ for all $u\in V\setminus \{y\}.$ It follows that $$\varphi_{xy}-\varphi_{yx}\ge c(S)-c(T)=\sum_{v\in S^c}c(x,v) +\sum_{u\in S\setminus\{x\}}c(u,y) -\sum_{v\in (S^c\setminus\{y\})\cup\{x\}}c(y,v)-\sum_{u\in S\setminus\{x\}}c(u, x) =$$ $$\sum_{v\in S^c}c(x,v) +\sum_{u\in S\setminus\{x\}}k-\sum_{u\in S\setminus\{x\}}c(y,u) -\sum_{v\in (S^c\setminus\{y\})\cup\{x\}}c(y,v)-\sum_{u\in S\setminus\{x\}}k+\sum_{u\in S\setminus\{x\}}c( x,u)=$$ $$\sum_{u\in V\setminus\{x\}}c(x,u)-\sum_{u\in V\setminus\{x\}}c(y,u)=o(x)-o(y).$$ As already pointed out by Belkin and Gvozdik (1989), from Proposition \[BeGv-lemma1\] we can immediately deduce that the flow and the Borda network methods agree on balanced networks. Indeed, we can also prove that on those networks they both agree with the dual Borda network method too. \[balan-ut\] Let $N\in\mathcal{B}$. Then $\mathfrak{F}(N)=\mathfrak{B}(N)=\widehat{\mathfrak{B}}(N)$. Let $N=(V,A,c)$. By Proposition \[BeGv-lemma1\], we immediately have that $\mathfrak{F}(N)=R(o)=\mathfrak{B}(N)$. On the other hand, if $k\in\mathbb{N}_0$ is the balance of $N$, we have $o(x)+i(x)=k(n-1)$ for all $x\in V$. Thus, $\mathfrak{B}(N)=R(o)=R(-i)=\widehat{\mathfrak{B}}(N)$. Since for $n=2$, we have $\mathcal{N}=\mathcal{B}$, we immediately get the next corollary. \[cor-n2\] Let $n=2$. Then, for every $N\in\mathcal{N}$, $\mathfrak{F}(N)=\mathfrak{B}(N)=\widehat{\mathfrak{B}}(N)$. The following Propositions \[suff-cond-FB\], \[suff-cond-FBhat\], \[cor-new\] and Theorem \[OI\] deepen the comparison among the flow, the Borda and the dual Borda network methods. In particular, they show that those methods agree on a set of networks larger than the one of the balanced networks. Of course there are instead cases in which the Borda and the dual Borda network methods do not coincide with the flow network method. This happens for every $N\in \mathcal{N}$ for which $\mathfrak{F}(N)\notin \mathbf{O}$. \[suff-cond-FB\] Let $n\ge 3$ and $N=(V,A,c)\in \mathcal{N}$. Assume that, for every distinct $x,y,u\in V$, there exists a real number $\beta(x,y,u)> -\frac{1}{n-2}$ such that $$c(y,u)-c(x,u)+c(u,y)-c(u,x)\ge \beta(x,y,u) (o(x)-o(y)).$$ Then $\mathfrak{F}(N)=\mathfrak{B}(N)$. In order to show that $\mathfrak{F}(N)=\mathfrak{B}(N),$ it is enough to show that, for every $x,y\in V$ with $x\neq y$, $o(x)\ge o(y)$ implies $\varphi_{xy}\ge \varphi_{yx}$ and $o(x)> o(y)$ implies $\varphi_{xy}> \varphi_{yx}$. For that purpose we will show that, for every $x,y\in V$ with $x\neq y$, there exists a positive constant $\alpha(x,y)$ such that $\varphi_{xy}-\varphi_{yx}\geq \alpha(x,y) (o(x)-o(y))$. Fix $x,y\in V$ with $x\neq y$ and let $S$ be a minimum cut from $x$ to $y$ so that $c(S)=\varphi_{xy}$. Consider now $T=(S\setminus \{x\})\cup\{y\}$ and note that, since $T\subseteq V$, $y\in T$ and $ x\notin T$, we have that $T$ is a cut from $y$ to $x$. Then we have that $$c(S)=\sum_{u\in S,v\in S^c}c(u,v)=\sum_{u\in S\setminus\{x\}, v\in S^c\setminus\{y\}}c(u,v)+\sum_{v\in S^c}c(x,v)+\sum_{u\in S\setminus\{x\}}c(u,y)$$ and $$c(T)=\sum_{u\in T,v\in T^c}c(u,v)=\sum_{u\in S\setminus\{x\}, v\in S^c\setminus\{y\}}c(u,v)+\sum_{v\in (S^c\setminus\{y\})\cup\{x\}}c(y,v)+ \sum_{u\in S\setminus\{x\}}c(u, x).$$ Since $c(T)\ge \varphi_{yx}$, we then have $$\varphi_{xy}-\varphi_{yx}\ge c(S)-c(T)=\sum_{v\in S^c}c(x,v) +\sum_{u\in S\setminus\{x\}}c(u,y) -\sum_{v\in (S^c\setminus\{y\})\cup\{x\}}c(y,v)-\sum_{u\in S\setminus\{x\}}c(u, x)$$ $$=o(x)-o(y)+\sum_{u\in S\setminus\{x\}}\left(c(y,u)-c(x,u)+c(u,y)-c(u,x)\right)$$ $$\ge o(x)-o(y)+ \sum_{u\in S\setminus\{x\}} \beta(x,y,u)(o(x)-o(y))=\left(1+\sum_{u\in S\setminus\{x\}} \beta(x,y,u)\right)(o(x)-o(y)).$$ Thus, we are left with proving that $ 1+\sum_{u\in S\setminus\{x\}} \beta(x,y,u)>0. $ Indeed, since $|S|\le n-1$, we have $$1+\sum_{u\in S\setminus\{x\}} \beta(x,y,u)> 1-\frac{|S|-1}{n-2}\ge 0,$$ and the proof is completed. \[suff-cond-FBhat\] Let $n\ge 3$ and $N=(V,A,c)\in \mathcal{N}$. Assume that, for every distinct $x,y,u\in V$, there exists a real number $\gamma(x,y,u)> -\frac{1}{n-2}$ such that $$c(x,u)-c(y,u)+c(u,x)-c(u,y)\ge \gamma(x,y,u) (i(y)-i(x)).$$ Then $\mathfrak{F}(N)=\widehat{\mathfrak{B}}(N)$. The proof of the above result is similar to the one of Proposition \[suff-cond-FB\] and thus omitted. \[cor-new\] Let $n\ge 3$ and $N=(V,A,c)\in \mathcal{N}$. Assume that there exist $a,b,l\in\mathbb{N}_0$ with $a+b>0$ and $\omega:V\to \mathbb{N}_0$ such that, for every $(x,y)\in A$, we have $ c(x,y)=a \omega(x)+b \omega(y)+l. $ If $(n-1)a<b$ or $(n-1)b<a$, then $\mathfrak{F}(N)=\mathfrak{B}(N)=\widehat{\mathfrak{B}}(N)$. Let us prove first that $\mathfrak{F}(N)=\mathfrak{B}(N)$. Let $x,y,u\in V$ be distinct and show that there exists $\beta=\beta(x,y,u)$ such that $\beta> -\frac{1}{n-2}$ and $$c(y,u)-c(x,u)+c(u,y)-c(u,x)\ge \beta (o(x)-o(y)),$$ in order to apply Proposition \[suff-cond-FB\]. Note that $ c(y,u)-c(x,u)+c(u,y)-c(u,x)=(a+b)(\omega(y)-\omega(x)) $ and that $ o(x)-o(y)=(b-(n-1)a)(\omega(y)-\omega(x)). $ Then we have to show that there exists $\beta> -\frac{1}{n-2}$ such that $$(a+b)(\omega(y)-\omega(x))\ge \beta (b-(n-1)a)(\omega(y)-\omega(x)).$$ If $\omega(y)-\omega(x)\ge 0$, we can choose $\beta=0$. If $\omega(y)-\omega(x)<0$, then it has to be $ a+b\le \beta (b-(n-1)a). $ We cannot have $b-(n-1)a=0$. Namely if $(n-1)a<b$, then $b-(n-1)a>0$. Let instead $(n-1)b<a$ and assume, by contradiction, that $b-(n-1)a=0$. Then we have $(n-1)^2a<a$. Thus $a\neq 0$ and so, since $a\in \mathbb{N}_0,$ we have $a>0$. It follows that $n(n-2)<0$ against $n\geq 3$. Then it is meaningful to define $$\beta = \frac{a+b}{b-(n-1)a}.$$ If $(n-1)a<b$, then we have $\beta >0>-\frac{1}{n-2}.$ If instead $(n-1)b<a$, then this implies $\beta> -\frac{1}{n-2}.$ Next we show that $\mathfrak{F}(N)=\widehat{\mathfrak{B}}(N)$. Let $x,y,u\in V$ be distinct and let us show that there exists $\gamma=\gamma(x,y,u)$ such that $\gamma> -\frac{1}{n-2}$ and $$c(x,u)-c(y,u)+c(u,x)-c(u,y)\ge \gamma (i(y)-i(x)),$$ in order to apply Proposition \[suff-cond-FBhat\]. Note that $ c(x,u)-c(y,u)+c(u,x)-c(u,y)=(a+b)(\omega(x)-\omega(y)) $ and that $ i(y)-i(x)=(a-(n-1)b)(\omega(x)-\omega(y)). $ Then we have to show that there exists $\gamma> -\frac{1}{n-2}$ such that $$(a+b)(\omega(x)-\omega(y))\ge \gamma (a-(n-1)b)(\omega(x)-\omega(y)).$$ If $\omega(x)-\omega(y)\ge 0$, we can choose $\gamma=0$. If $\omega(x)-\omega(y)<0$, then it has to be $ (a+b)\le \gamma (a-(n-1)b). $ As before, it cannot be $a-(n-1)b=0$. Thus it is meaningful to define $$\gamma = \frac{a+b}{a-(n-1)b}.$$ If $(n-1)b<a$, then we have $\gamma = \frac{a+b}{a-(n-1)b}>0>-\frac{1}{n-2}.$ If $(n-1)a<b$, then this implies $\gamma >-\frac{1}{n-2}.$ Let us finally define two special sets of networks, namely $$\mathcal{O}=\{(V,A,c)\in \mathcal{N}: \exists\mbox{ $\omega_1:V\to \mathbb{N}_0$ such that, $\forall\;(x,y)\in A$, $c(x,y)=\omega_1(x)$}\},$$ $$\mathcal{I}=\{(V,A,c)\in \mathcal{N}: \exists\mbox{ $\omega_2:V\to \mathbb{N}_0$ such that, $\forall\;(x,y)\in A$, $c(x,y)=\omega_2(y)$}\}.$$ \[OI\] Let $N\in \mathcal{B}\cup\mathcal{O}\cup \mathcal{I}$. Then $\mathfrak{F}(N)=\mathfrak{B}(N)=\widehat{\mathfrak{B}}(N)$. If $n=2$, then apply Corollary \[cor-n2\]. Assume now that $n\ge 3$. If $N\in \mathcal{B}$, then apply Proposition \[balan-ut\]. If $N\in \mathcal{O}\cup \mathcal{I}$, then apply Proposition \[cor-new\] with $a=1$, $b=0$, $l=0$ and with $a=0$, $b=1$, $l=0$. Consider now the set of networks $\mathcal{C}=\{(V,A,c)\in \mathcal{N}: c \mbox{ is constant}\}$. It is easily proved that if $n=2$, then $\mathcal{C}\subsetneq\mathcal{B}=\mathcal{O}= \mathcal{I}= \mathcal{N};$ if $n\geq 3$, then $\mathcal{O}\cap \mathcal{I}=\mathcal{O}\cap \mathcal{B}=\mathcal{I}\cap \mathcal{B}=\mathcal{C}.$ In particular, $\mathcal{O}$ and $\mathcal{I}$ have a very small intersection with the set of balanced networks, so that $ \mathcal{B}\cup\mathcal{O}\cup \mathcal{I}$ is, in general, considerably larger than $ \mathcal{B}.$ Further properties of relations {#relation-2} =============================== In this section we collect several facts about relations which are fundamental for the analysis of the flow network rule and the flow $k$-multiwinner network solution. We stress that all the theorems and propositions of the section do not require that $V$ has at least two elements, but only need that $V$ is finite and nonempty. Let us begin with recalling a classic result about acyclic relations which will turn out to be crucial in the sequel (Szpilrajn, 1939). \[greco\] Let $R\in \mathbf{R}$. Then the following facts hold: - $R$ is acyclic if and only if $\mathbf{L}^\diamond(R)\neq \varnothing$. - If $R$ is acyclic and $x,y\in V$ are such that $(x,y)\not\in R$ and $(y,x)\not\in R$, then there exists $L\in\mathbf{L}^\diamond(R)$ such that $x\succ_{L} y$. The proofs of the next three useful facts are almost immediate. We give the proof of the third one only. \[3-bis\] Let $R\in\mathbf{R}$, $k\in \ldbrack n-1 \rdbrack $ and $x^*\in V$. Assume that there exist distinct $y_1,\ldots, y_{n-k}\in V\setminus \{x^*\}$ such that, for every $j\in\ldbrack n-k\rdbrack$, $x^*\succ_R y_j$. Then, for every $W\in C_k(R)$, $x^*\in W$. \[ckrev\] Let $R\in\mathbf{R}$ and $k\in \ldbrack n-1 \rdbrack $. Then $W\in C_k(R^r)$ if and only if $V\setminus W\in C_{n-k}(R).$ \[totale\] Let $R\in\mathbf{R}$ be reflexive and $k\in \ldbrack n-1 \rdbrack $. Then $C_k(R)=\mathbb{P}_k(V)$ if and only if $R=V^2.$ Let $R=V^2$ and pick $W\in \mathbb{P}_k(V)$. Then, for every $x\in W$ and every $y\in V\setminus W$, we have $x\succeq_Ry$ and thus $W\in C_k(R).$ Conversely let $C_k(R)=\mathbb{P}_k(V)$. Assume, by contradiction, that there exist $x\in V$ and $y\in V$ such that $x\not \succeq_Ry$. Since $R$ is reflexive, we necessarily have $x\neq y.$ Since $k\in \ldbrack n-1 \rdbrack $, there exists $W\in \mathbb{P}_k(V)$ with $x\in W$ and $y \in V\setminus W$. The fact that $x\not \succeq_Ry$ says that $W\notin C_k(R)$ against $C_k(R)=\mathbb{P}_k(V)$. We propose now several results about complete and quasi-acyclic relations. We emphasize that such results, establishing the general properties of the set $\mathbf{A}$, provide tools to control the properties of any possible network method with values in $\mathbf{A}$. \[lin-ref\] Let $R\in\mathbf{A}$. Then $\mathbf{L}_\diamond(R)= \mathbf{L}^\diamond(S(R))\neq\varnothing$. We first show that $\mathbf{L}^\diamond(S(R))\subseteq \mathbf{L}_\diamond(R).$ Let $L\in \mathbf{L}^\diamond(S(R)).$ Thus $L$ is linear and $L\supseteq S(R).$ We want to show that $L\subseteq R.$ Pick $(x,y)\in L$. If $x=y$, then $(x,x)\in R$ because $R$ is complete and then, in particular, reflexive. Let then $x\neq y$. Assume, by contradiction, that $(x,y)\not\in R$. Since $R$ is complete, we have $(y,x)\in R$ and then $(y,x)\in S(R)$. Thus $(y,x)\in L$ and, since $L$ is antisymmetric, we get the contradiction $x=y$. We next show that $\mathbf{L}_\diamond(R)\subseteq \mathbf{L}^\diamond(S(R)).$ Let $L\in \mathbf{L}_\diamond(R)$. Thus $L$ is linear and $L\subseteq R.$ We need to show that $S(R)\subseteq L.$ Let $(x,y)\in S(R)$, so that we have $(x,y)\in R$, $(y,x)\notin R$. Assume, by contradiction, that $(x,y)\notin L$. Then, since $L$ is complete, we have $(y,x)\in L$ and so also $(y,x)\in R,$ a contradiction. Finally, since $R\in\mathbf{A}$, we have that $S(R)$ is acyclic so that, by Theorem \[greco\], $\mathbf{L}^\diamond(S(R))\neq\varnothing$. \[2-bis\] Let $R\in\mathbf{A}$, $x^*\in V$ and $W\subseteq V\setminus \{x^*\}$. Assume that, for every $y\in W$, $x^*\succ_R y$. Then, for every $L\in \mathbf{L}_{\diamond}(R)$ and $y\in W$, $x^*\succ_L y$. Let $L\in \mathbf{L}_{\diamond}(R).$ Then, by Proposition \[lin-ref\], we have that $L\in \mathbf{L}^\diamond(S(R))$, that is, $L\supseteq S(R).$ Thus, $x^*\succ_R y$ for all $y\in W$ implies $x^*\succeq_L y$ for all $y\in W$. On the other hand, since $W\subseteq V\setminus \{x^*\}$, we necessarily have $x^*\succ_L y$ for all $y\in W$. \[2\] Let $R\in\mathbf{A}$, $x^*\in V$ and $W\subseteq V\setminus \{x^*\}$. Assume that, for every $y\in W$, $x^*\succeq_R y$. Then there exists $L\in \mathbf{L}_{\diamond}(R)$ such that, for every $y\in W$, $x^*\succ_L y$. Let $Z=\{z\in W: z\sim_R x^*\}$ and note that $x^*\notin Z.$ Then $W\setminus Z=\{y\in W: x^*\succ_R y\}\subseteq V\setminus \{x^*\}$ and, by Proposition \[2-bis\], for every $L\in \mathbf{L}_\diamond(R)$ and $y\in W\setminus Z$, we have $x^*\succ_L y$. Thus, if $Z=\varnothing$, it is sufficient to pick any $L\in \mathbf{L}_\diamond(R)$. Assume next that $Z\neq \varnothing.$ By the above observation, we only need to find $L\in \mathbf{L}_\diamond(R)$ such that for every $z\in Z$, $x^*\succ_L z$. Let $|Z|=m$ for some $1\leq m\leq |W|$ and let $Z=\{z_1,\dots, z_m\}$. Define, for every $i\in\{2,\dots, m+1\}$, $U_i(R)=\{(x^*,z_j): j\in \ldbrack i-1\rdbrack\}$, and consider the $m+1$ relations on $V$ given by $R_1=S(R)$ and $R_i=S(R)\cup U_i(R)$. Note that, for every $i\in \ldbrack m \rdbrack$, $(x^*,z_i)\not\in R_i$ and $(z_i,x^*)\not\in R_i$. Indeed, since $z_i\in Z$, we have that $(x^*,z_i)\notin S(R)$ and $(z_i,x^*)\notin S(R)$ and, by $U_i(R)$ definition, we also have $(x^*,z_i)\notin U_i(R), (z_i,x^*)\notin U_i(R).$ Let $I= \ldbrack m+1 \rdbrack$. We claim that, for every $i\in I$, $ \mathbf{L}_\diamond(R)\cap \mathbf{L}^\diamond(R_i)\neq \varnothing.$ Assume, by contradiction, that there exists $i\in I$ such that $ \mathbf{L}_\diamond(R)\cap \mathbf{L}^\diamond(R_i)=\varnothing.$ Let $s=\min\{i\in I: \mathbf{L}_\diamond(R)\cap \mathbf{L}^\diamond(R_i)=\varnothing\}$ and note that, since by Proposition \[lin-ref\], $ \mathbf{L}_\diamond(R)\cap \mathbf{L}^\diamond(R_1)= \mathbf{L}_\diamond(R)\cap \mathbf{L}^\diamond(S(R))=\mathbf{L}_\diamond(R)\neq\varnothing,$ we surely have $s\geq 2$. By definition of $s$, we then have $\mathbf{L}_\diamond(R)\cap \mathbf{L}^\diamond(R_{s-1})\neq \varnothing.$ From $ \mathbf{L}^\diamond(R_{s-1})\neq \varnothing$, by Theorem \[greco\](a), we deduce that $R_{s-1}$ is acyclic. Moreover $x^*$ and $z_{s-1}$ are distinct $(x^*,z_{s-1})\not\in R_{s-1}$ and $(z_{s-1},x^*)\not\in R_{s-1}$. Thus, by Theorem \[greco\](b), there exists $L\in \mathbf{L}^\diamond(R_{s-1})$ such that $x^*\succ_L z_{s-1}.$ Since $R_{s}=R_{s-1}\cup \{(x^*,z_{s-1})\}$, this says that $L\in \mathbf{L}^\diamond(R_{s})$. From $R_s\supseteq S(R)$ and from Proposition \[lin-ref\], we then deduce that $L\in \mathbf{L}^\diamond(S(R))=\mathbf{L}_\diamond(R)$. Hence $L\in \mathbf{L}_\diamond(R)\cap \mathbf{L}^\diamond(R_s)$, against the definition of $s.$ Now pick $L\in \mathbf{L}_\diamond(R)\cap \mathbf{L}^\diamond(R_{m+1}).$ Then we have $L\in \mathbf{L}_\diamond(R)$ and $x^*\succ_L z_i$ for all $i\in \ldbrack m\rdbrack$, as required. Let $W$ be a nonempty finite subset of $V$. Recall that the restriction of $R$ to $W$ is the relation on $W$ defined by $R_{\mid W}=R\cap W^2$. \[ckR\] Let $R\in\mathbf{A}$ and $k\in \ldbrack n-1 \rdbrack $. Then $$C_k(R)=\bigcup_{L\in\mathbf{L}_\diamond(R)}C_k(L).$$ In particular, $1\leq |C_k(R)|\leq |\mathbf{L}_\diamond(R)|$ and $C_k(R)\neq\varnothing$. Let $C=\bigcup_{L\in\mathbf{L}_\diamond(R)}C_k(L)$. By Proposition \[lin-ref\], we have that $\mathbf{L}_\diamond(R)\neq \varnothing$ and, for every $L\in\mathbf{L}_\diamond(R)$, we have $|C_k(L)|=1$. Thus surely $1\leq|C|\leq |\mathbf{L}_\diamond(R)|.$ We next show that $C_k(R)=C$. Let $W\in C$. Then there exists $L\in \mathbf{L}_\diamond(R)$ such that $W\in C_k(L)$. Thus, for every $x\in W$ and $y\in V\setminus W$, we have $x\succeq_L y$ and so, since $L$ is a refinement of $R$, we also have $x\succeq_R y$. Hence $W\in C_k(R).$ Consider now $W\in C_k(R)$. Since $R_{\mid W}$ is a complete and acyclic relation on $W$ and $R_{\mid V\setminus W}$ is a complete and acyclic relation on $V\setminus W$, by Proposition \[lin-ref\], we have that both admit linear refinements. Let $L_1$ be a linear refinement of $R_{\mid W}$ and $L_2$ be a linear refinement of $R_{\mid V\setminus W}$. Then $$L=L_1\cup L_2\cup \{(x,y)\in V^2:x\in W,\, y\in V\setminus W\}$$ is a refinement of $R$ which is a linear order of $V$, that is, $L\in \mathbf{L}_\diamond(R)$. Moreover, $C_k(L)=\{W\}$. Hence $W\in C$. The following result is now immediate taking into account that, given a relation $R$ in $\mathbf{A}$, we have that its reversal is still in $\mathbf{A}$, and that $ |\max(R)|=|C_1(R)|$ and $|\min(R)|= |\max(R^r)|$. \[exist-max-min\] Let $R\in \mathbf{A}$. Then $1\leq |\max(R)|\leq |\mathbf{L}_\diamond(R)|$ and $1\leq|\min(R)|\leq |\mathbf{L}_\diamond(R)|.$ \[inclusion\] Let $R\in \mathbf{A}$ and $k,l, m \in \ldbrack n-1 \rdbrack $ with $l\leq k\leq m$. Then for every $W\in C_k(R)$, there exist $W'\in C_m(R)$ and $W''\in C_l(R)$ such that $W''\subseteq W\subseteq W'$. Let $W\in C_k(R)$. Thus $W\subseteq V$, $|W|=k$ and, for every $x\in W$ and $y\in V\setminus W$, we have $x\succeq_R y$. We first show that there exists $W'\in C_m(R)$ such that $W\subseteq W'.$ The case $m=k$ is obvious. Assume then that $m>k$. Then $n\geq 3$ and $1\leq m-k\le (n-k)-1$. Consider now the set $V\setminus W$, whose size is $n-k\ge 2$. The relation $R_{\mid V\setminus W}$ is quasi-acyclic and complete and so, by Proposition \[ckR\], we have that $C_{m-k}(R_{\mid V\setminus W})\neq \varnothing.$ Pick $\hat{W}\in C_{m-k}(R_{\mid V\setminus W})$ and define $W'=W\cup \hat{W}$. We show that $W'\in C_m(R)$. Surely $|W'|=m$ because the sets $W$ and $ \hat{W}$ are disjoint. Let $x\in W'$ and $y\in V\setminus W'$. Since $V\setminus W'\subseteq V\setminus W$, if $x\in W$ we have $x\succeq_R y$. Since $V\setminus W'\subseteq V\setminus \hat{W}$, if $x\in \hat{W}$ we also have $x\succeq_R y$. We next show that there exists $W''\in C_l(R)$ such that $W''\subseteq W.$ The case $l=k$ is obvious. Assume then that $l<k$. Then $n\geq 3$ and $1\leq k-l\le k-1.$ Since $W$ has size $k\ge 2$ and the relation $R^r_{\mid W}$ is quasi-acyclic and complete, by Proposition \[ckR\] we have that $C_{k-l}(R^r_{\mid W})\neq \varnothing.$ Pick $\overline{W}\in C_{k-l}(R^r_{\mid W})$ and define $W''=W\setminus \overline{W}$. Then $W''\subseteq W\subseteq V$ and $|W''|=l$. We show that $W''\in C_l(R)$. Let $x\in W''$ and $y\in V\setminus W''.$ If $y\in V\setminus W$, then $x\succeq_R y$ because $x\in W$. If instead $y\in \overline{W}$, since $x\in W\setminus \overline{W}$, we have $y\succeq_{R^r}x$, that is, $x\succeq_R y$. \[3\] Let $R\in\mathbf{A}$, $k\in \ldbrack n-1 \rdbrack $ and $x^*\in V$. Assume that there exist distinct $y_1,\ldots, y_{n-k}\in V\setminus \{x^*\}$ such that, for every $j\in \ldbrack n-k \rdbrack$, $x^*\succeq_R y_j$. Then there exists $W\in C_k(R)$ such that $x^*\in W$. By Proposition \[2\], there exists $L\in \mathbf{L}_{\diamond}(R)$ such that, for every $j\in \ldbrack n-k \rdbrack$, $x^*\succ_L y_j$. By Proposition \[ckR\], we have $C_k(R)\supseteq C_k(L)$ and we also know that $C_k(L)=\{W\}$ for a suitable $W\subseteq V$ with $|W|=k$. Assume now by contradiction that $x^*\not\in W$. Then there exists $j^*\in \ldbrack n-k \rdbrack$ such that $y_{j^*}\in W$. That leads to the contradiction $y_{j^*}\succ_L x^*$. We end the section with a result which describes the effects on the set of the $k$-maximum sets of reversing a complete and quasi-transitive relation $R$. It says that there exists at least a $k$-maximum set for $R$ which does not appear as a $k$-maximum set for the reversal of $R$. \[qA\] Let $R\in \mathbf{T}$ with $R\neq V^2$. Then, for every $k\in \ldbrack n-1 \rdbrack $, $C_k(R)\not\subseteq C_k(R^r)$. Recalling that $\mathbf{A}\subseteq\mathbf{T}$, by Corollary \[exist-max-min\], we have that $\max(R)\neq\varnothing$ and that $\min(R)\neq\varnothing$. As a preliminary step, we show that there exist $x^*\in \max(R)$ and $y^*\in\min(R)$ such that $x^*\succ_R y^*$. We first see that there exist $x^*\in \max(R)$ and $y\in V$ such that $x^*\succ_R y$. Assume, by contradiction, that that fact does not happen. Since $R\neq V^2$ and $R$ is complete, there exist $x_0,x_1\in V$ such that $x_1\succ_R x_0$. In particular, $x_1\neq x_0$. Since $x_1\notin\max(R)$, there exists $x_2\in V$ such that $x_1\not\succeq_R x_2$. By completeness, we then have $x_2\succ_R x_1$ and, in particular, $x_2\neq x_1.$ We also have $x_2\neq x_0$, otherwise we would have the cycle $x_0\succ_R x_1\succ_R x_0.$ Since also $x_2\notin\max(R)$ we can repeat the argument constructing a sequence $x_0, \dots, x_m$ of arbitrary length $m\in\mathbb{N}$ of distinct elements of $V$, against $V$ finite. We now show that there exists $y^*\in\min(R)$ such that $x^*\succ_R y^*$. Assume, by contradiction, that that fact does not happen. By what shown above, there exists $y_0\in V$ such that $x^*\succ_R y_0$. Since $y_0\not\in \min(R)$, there exists $y_1\in V$ such that $y_1\not\succeq_R y_0$. By completeness $y_0\succ_R y_1$ and, in particular, $y_1\neq y_0$. Thus, by the transitivity of $S(R)$, we get $x^*\succ_R y_1$. Since $y_1\notin \min(R)$, there exists $y_2\in V$ with $y_1\succ_R y_2$. In particular $y_2\neq y_1$. We also have $y_2\neq y_0$, otherwise we would have the cycle $y_0\succ_R y_1\succ_R y_0.$ Thus, as before, we can repeat the argument constructing a sequence $y_0, \dots, y_m$ of arbitrary length $m\in\mathbb{N}$ of distinct elements of $V$, against $V$ finite. Fix now $x^*\in \max(R)$ and $y^*\in \min (R)$ such that $x^*\succ_R y^*$. Note that, in particular, $x^*\neq y^*$. We prove that there exists $W'\in C_k(R)$ such that $x^*\in W'$ and $y^*\not\in W'$. That implies the desired relation $C_k(R)\not\subseteq C_k(R^r)$ since certainly $W'\not\in C_k(R^r)$, due to the fact that $y^*\succ_{R^r} x^*$. By Proposition \[3\], there exists $W\in C_k(R)$ such that $x^*\in W$. If $y^*\not \in W$, then set $W'=W$. Let then $y^*\in W$. Since $R_{|V\setminus W}$ is complete and acyclic, by Corollary \[exist-max-min\], there exists $z^*\in \max(R_{|V\setminus W})$. Define then $W'=(W\setminus \{y^*\})\cup\{z^*\}$ and show that it is indeed the $k$-subset we are looking for. Trivially we have that $|W'|=k$, $x^*\in W'$ and $y^*\not\in W'$. Thus we are left with proving that $W'\in C_k(R)$. Consider then $x\in W'$ and $y\in V\setminus W'$. If $x\neq z^*$ and $y\neq y^*$, then $x\in W$ and $y\in V\setminus W$ so that $x\succeq_R y$. Let next $y=y^*$. Then $x\succeq_R y^*$ holds since $y^*\in \min(R)$. Finally let $x=z^*$ and $y\neq y^*$. Then $y\in V\setminus W$ and thus $z^*\succeq_R y$ because $z^*\in \max(R_{|V\setminus W})$. Properties of the flow network rule {#fnr} =================================== In this section we propose some properties of the flow network rule. Namely, we prove that that rule is decisive, neutral, homogeneous and that it satisfies non-imposition, efficiency, monotonicity, reversal symmetry and symmetry properties (Propositions \[BG-1\], \[neut-rule\], \[BG-2\], \[no-impo-rule\], \[BG-4\], \[BG-5\], \[BG-3\] and \[sym-rule\], respectively). Moreover, we show that the flow network rule coincides with the Borda and the dual Borda network rule on a wide class of networks (Proposition \[balan-ut-rule\]). We emphasize that Propositions \[BG-2\], \[BG-4\], \[BG-5\] and \[BG-3\] are revisions of propositions stated, without proofs, in Belkin and Gvozdik (1989). \[BG-1\] Let $N\in\mathcal{N}$. Then $\mathfrak{F}_{\diamond}(N)\neq\varnothing$. Apply Theorem \[F-qt\] and Proposition \[lin-ref\]. Given $L\in \mathbf{L}$ and a bijection $\psi:V\rightarrow V$, let $\psi L\in \mathbf{L}$ be defined, for every $x,y\in V$, by setting $x\succeq_{\psi L}y$ if and only if $\psi^{-1}(x)\succeq_{L}\psi^{-1}(y).$ \[neut-rule\] Let $N=(V,A,c) \in\mathcal{N}$ and $\psi:V\rightarrow V$ be a bijection. Then $ \mathfrak{F}_\diamond(N^{\psi})=\{\psi L: L\in \mathfrak{F}_\diamond(N)\}. $ We first show that if $L\in \mathfrak{F}_\diamond(N)$ and $\psi:V\rightarrow V$ is a bijection, then $\psi L\in \mathfrak{F}_\diamond(N^{\psi})$. Let $L\in \mathfrak{F}_\diamond(N)$. We need to see that, for every $x,y\in V$, $x\succeq_{\psi L}y$ implies $x\succeq_{N^{\psi}}y$. Fix then $x,y\in V$ and assume that $x\succeq_{\psi L}y$, that is, $\psi^{-1}(x)\succeq_{L}\psi^{-1}(y)$. Since $L\in \mathfrak{F}_\diamond(N)$, we have $\psi^{-1}(x)\succeq_{N}\psi^{-1}(y)$ and, by Proposition \[neut-F\], we get $x\succeq_{N^{\psi}}y.$ Next let $M\in \mathfrak{F}_\diamond(N^{\psi})$ and prove that there exists $L\in \mathfrak{F}_\diamond(N)$ such that $M=\psi L$. Define then $L=\psi^{-1}M$. Of course, we have that $M=\psi L$. Moreover, by the first part of the proof, $L\in \mathfrak{F}_\diamond((N^{\psi})^{\psi^{-1}})=\mathfrak{F}_\diamond(N)$. By Proposition \[homo-net\], we immediately obtain the next result. \[BG-2\] Let $N\in\mathcal{N}$ and $\alpha\in\mathbb{N}$. Then $\mathfrak{F}_{\diamond}(N)=\mathfrak{F}_{\diamond}(\alpha N)$. \[no-impo-rule\] Let $L\in\mathbf{L}$. Then there exists $N\in \mathcal{N}$ such that $\mathfrak{F}_{\diamond}(N)=\{L\}$. Consider the network $N_L$. Then, by Proposition \[main-qt\], we have $\mathfrak{F}(N_L)=L$ and thus $\mathfrak{F}_{\diamond}(N)=\{L\}.$ \[BG-4\] Let $N=(V,A,c)\in \mathcal{N}$ and $x^*,y^*\in V$ with $x^*\neq y^*$. Assume that $c(x^*,y^*)\ge c(y^*,x^*)$ and, for every $z\in V\setminus\{x^*,y^*\}$, $c(x^*,z)\ge c(y^*,z)$ and $c(z,y^*)\ge c(z,x^*)$. Then there exists $L\in \mathfrak{F}_{\diamond}(N)$ such that $x^*\succ_{L} y^*$. Moreover, if one of the conditions $(a)$, $(b)$, $(c)$ and $(d)$ of Proposition \[Eff-F\] holds true, then, for every $L\in \mathfrak{F}_{\diamond}(N)$, $x^*\succ_{L} y^*$. By Proposition \[Eff-F\], we have that $x^*\succeq_N y^*$. Then, by Proposition \[2\], there exits $L\in \mathfrak{F}_\diamond(N)$ such that $x^*\succ_L y^*$. Moreover, if one of the conditions $(a)$, $(b)$ ,$(c)$ and $(d)$ of Proposition \[Eff-F\] holds true, Proposition \[Eff-F\] gives $x^*\succ_N y^*$ and, by Proposition \[2-bis\], we get $x^*\succ_{L} y^*$ for all $L\in \mathfrak{F}_{\diamond}(N)$. \[BG-5\] Let $N=(V,A,c)\in \mathcal{N}$ and $x^* \in V$. Let $N'=(V,A,c')\in \mathcal{N}$ be such that conditions $(a)$ and $(b)$ of Proposition \[Mon1-flow-rule\] hold true. Then, for every $L\in \mathfrak{F}_{\diamond}(N)$, there exists $L'\in \mathfrak{F}_{\diamond}(N')$ such that $ \{y\in V: x^*\succ_L y\}\subseteq \{y\in V: x^*\succ_{L'}y\}. $ Assume further that, for every $y\in V\setminus\{x^*\}$, $c'(x^*,y)> c(x^*,y)$ or $c'(y,x^*)< c(y,x^*)$. Then, for every $L\in \mathfrak{F}_{\diamond}(N)$ and $L'\in \mathfrak{F}_{\diamond}(N')$, we have that $ \{y\in V: x^*\succ_L y\}\subseteq \{y\in V: x^*\succ_{L'}y\}. $ Let $L\in \mathfrak{F}_{\diamond}(N)$. Then $ \{y\in V: x^*\succ_L y\}\subseteq \{y\in V\setminus\{x^*\}: x^*\succeq_N y\}. $ By Proposition \[Mon1-flow-rule\], we have that $ \{y\in V\setminus\{x^*\}: x^*\succeq_N y\}\subseteq \{y\in V\setminus\{x^*\}: x^*\succeq_{N'} y\}. $ By Proposition \[2\], there exists $L'\in \mathfrak{F}_{\diamond}(N')$ such that $ \{y\in V\setminus\{x^*\}: x^*\succeq_{N'} y\}\subseteq \{y\in V: x^*\succ_{L'} y\}, $ and the first part of the statement follows. Assume now that, for every $y\in V\setminus\{x^*\}$, $c'(x^*,y)> c(x^*,y)$ or $c'(y,x^*)< c(y,x^*)$ and consider $L\in \mathfrak{F}_{\diamond}(N)$ and $L'\in \mathfrak{F}_{\diamond}(N')$. Then $ \{y\in V: x^*\succ_L y\}\subseteq \{y\in V\setminus\{x^*\}: x^*\succeq_N y\}. $ By Proposition \[Mon1-flow-rule\], we have that $ \{y\in V\setminus\{x^*\}: x^*\succeq_N y\}\subseteq \{y\in V\setminus\{x^*\}: x^*\succ_{N'} y\}. $ By Proposition \[2-bis\], we have that $ \{y\in V\setminus\{x^*\}: x^*\succ_{N'} y\}\subseteq \{y\in V: x^*\succ_{L'} y\}, $ and the second part of the statement follows. \[BG-3\] Let $N\in\mathcal{N}$. Then $\mathfrak{F}_{\diamond}(N^r)=\{L^r: L\in \mathfrak{F}_{\diamond}(N)\}$. By Proposition \[Reversal\], we know that $\mathfrak{F}(N^r)=\mathfrak{F}(N)^r$. Then $\mathfrak{F}_{\diamond}(N^r)=\mathbf{L}_\diamond(\mathfrak{F}(N^r))=\mathbf{L}_\diamond(\mathfrak{F}(N)^r)$ and it is immediately observed that $\mathbf{L}_\diamond(\mathfrak{F}(N)^r)=\{L^r: L\in \mathfrak{F}_{\diamond}(N)\}$. \[sym-rule\] Let $N\in\mathcal{N}$. Then $\mathfrak{F}_{\diamond}(N)=\mathbf{L}$ if and only if $N$ is pseudo-symmetric. If $N$ is pseudo-symmetric then, by Proposition \[flat\], $\mathfrak{F}(N)=V^2$ so that $\mathfrak{F}_{\diamond}(N)=\mathbf{L}$. Assume now $\mathfrak{F}_{\diamond}(N)=\mathbf{L}$. We complete the proof showing that $\mathfrak{F}(N)=V^2$ and applying Proposition \[flat\]. Consider $x,y\in V$. If $x=y$, then $x\succeq_N y$. If $x\neq y$ then suppose, by contradiction, that $x\not\succeq_N y$. Since $\mathfrak{F}(N)$ is complete, we have that $y\succ_N x$. As a consequence, by Proposition \[2-bis\], we have that, for every $L\in\mathfrak{F}_{\diamond}(N)$, $y\succ_L x$ against $\mathfrak{F}_{\diamond}(N)=\mathbf{L}$. The Borda network rule $\mathfrak{B}_\diamond$ and the dual Borda network rule $\widehat{\mathfrak{B}}_\diamond$ are respectively defined, for every $N\in\mathcal{N}$, by $\mathfrak{B}_\diamond(N)=\mathbf{L}_\diamond(\mathfrak{B}(N))$ and $\widehat{\mathfrak{B}}_\diamond(N)=\mathbf{L}_\diamond(\widehat{\mathfrak{B}}(N))$. Immediately from Theorem \[OI\], we get the next proposition. \[balan-ut-rule\] Let $N\in \mathcal{B}\cup\mathcal{O}\cup\mathcal{I}$. Then $\mathfrak{F}_\diamond(N)=\mathfrak{B}_\diamond(N)=\widehat{\mathfrak{B}}_\diamond(N).$ Properties of the flow $k$-multiwinner network solution {#fns} ======================================================= This section is devoted to present some remarkable properties of the flow $k$-multiwinner network solution. In the five propositions below we prove that it is decisive, neutral, homogeneous and satisfies a non-imposition property as well as a consistency property with respect to the parameter $k$ (Propositions \[decisive\], \[neut-sol\], \[homo-net2\], \[no-impo-k\] and \[inclusion2\], respectively). \[decisive\] Let $N\in\mathcal{N}$ and $k\in\ldbrack n-1 \rdbrack$. Then $\mathfrak{F}_k(N)\neq\varnothing$. It immediately follows from Theorem \[F-qt\] and Proposition \[ckR\]. The next two results are easily obtained applying Proposition \[neut-F\] and Proposition \[homo-net\]. \[neut-sol\] Let $N=(V,A,c) \in\mathcal{N}$, $\psi:V\rightarrow V$ bijective and $k\in \ldbrack n-1 \rdbrack $. Then $ \mathfrak{F}_k(N^{\psi})=\{\psi(W): W\in \mathfrak{F}_k(N)\}. $ \[homo-net2\] Let $N\in\mathcal{N}$, $\alpha\in\mathbb{N}$ and $k\in\ldbrack n-1 \rdbrack$. Then $\mathfrak{F}_k(\alpha N)=\mathfrak{F}_k(N)$. \[no-impo-k\] Let $W\in \mathbb{P}_k(V) $. Then there exists $N\in \mathcal{N}$ such that $\mathfrak{F}_{k}(N)=\{W\}$. Let $L$ be a linear oder having ranked in its first $k$ positions the element of $W.$ Then, by Proposition \[main-qt\], we have $\mathfrak{F}(N_L)=L$ and thus $\mathfrak{F}_{k}(N)=\{W\}.$ \[inclusion2\] Let $N\in\mathcal{N}$ and $l,k,m \in\ldbrack n-1 \rdbrack$ with $l\le k\le m$. For every $W\in \mathfrak{F}_k(N)$, there exists $W'\in \mathfrak{F}_m(N)$ and $W''\in \mathfrak{F}_l(N)$ such that $W''\subseteq W\subseteq W'$. Apply Proposition \[inclusion\] to the relation $\mathfrak{F}(N)$. The next two propositions show that $\mathfrak{F}_k$ satisfies properties sharing strong similarities with the concept of efficiency and monotonicity for social choice correspondences. \[Eff\] Let $N=(V,A,c)\in \mathcal{N}$, $x^*\in V$ and $k\in\ldbrack n-1 \rdbrack$. Assume that there exist distinct $y^*_1,\ldots, y^*_k\in V\setminus\{x^*\}$ such that, for every $j\in \ldbrack k \rdbrack$ and $z\in V\setminus\{x^*,y^*_j\}$, we have $c(y^*_j,x^*)\ge c(x^*,y^*_j)$, $c(y^*_j,z)\ge c(x^*,z)$ and $c(z,x^*)\ge c(z,y^*_j)$. Then there exists $W\in \mathfrak{F}_k(N)$ such that $x^*\notin W.$ Assume further that, for every $j\in\ldbrack k \rdbrack$, at least one of the following conditions holds true: - $c(y^*_j,x^*)> c(x^*,y^*_j)$; - for every $z\in V\setminus\{x^*,y^*_j\}$, $c(y^*_j,z)> c(x^*,z)$; - for every $z\in V\setminus\{x^*,y^*_j\}$, $c(z,x^*)> c(z,y^*_j)$; - there exists $z\in V\setminus\{x^*,y^*_j\}$ such that $c(y^*_j,z)> c(x^*,z)$ and $c(z,x^*)> c(z,y^*_j)$. Then, for every $W\in \mathfrak{F}_k(N)$, $x^*\notin W.$ By Proposition \[Eff-F\], we have that, for every $j\in\ldbrack k \rdbrack$, $y_j^*\succeq_N x^*$. Then, for every $j\in\ldbrack k \rdbrack$, $x^*\succeq_{N^r} y_j^*$. By Proposition \[3\], there exists $W'\in C_{n-k}(\mathfrak{F}(N^r))$ such that $x^*\in W'$. Define now $W=V\setminus W'$. By Proposition \[Reversal\], we have $C_{n-k}(\mathfrak{F}(N^r))=C_{n-k}(\mathfrak{F}(N)^r),$ so that by Proposition \[ckrev\], we get $W\in C_{k}(\mathfrak{F}(N))=\mathfrak{F}_k(N)$, with $x^*\not\in W$. Assume now that one among $(a)$, $(b)$, $(c)$ and $(d)$ holds true too. Then, by Proposition \[Eff-F\], for every $j\in\ldbrack k \rdbrack$, we have that $y_j^*\succ_N x^*$ that is $x^*\succ_{N^r} y_j^*$. Thus, by Proposition \[3-bis\], we have $x^*\in W'$ for all $W'\in C_{n-k}(\mathfrak{F}(N^r))=C_{n-k}(\mathfrak{F}(N)^r)$. By Proposition \[ckrev\], it follows then that, for every $W\in C_{k}(\mathfrak{F}(N))=\mathfrak{F}_k(N)$, $x^*\notin W.$ \[Mon1\] Let $N=(V,A,c)\in \mathcal{N}$, $k\in \ldbrack n-1 \rdbrack $, $W\in \mathfrak{F}_k(N)$ and $x^* \in W$. Let $N'=(V,A,c')\in \mathcal{N}$ be such that the conditions $(a)$ and $(b)$ of Proposition \[Mon1-flow-rule\] hold true. Then there exists $W'\in \mathfrak{F}_k(N')$ such that $x^*\in W'$. Assume further that, for every $y\in V\setminus W$, we have $x^*\succ_N y$ or $c'(x^*,y)> c(x^*,y)$ or $c'(y,x^*)< c(y,x^*)$. Then, for every $W'\in \mathfrak{F}_k(N')$, we have $x^*\in W'$. By Proposition \[Mon1-flow-rule\] we know that, for every $y\in V\setminus W$, $x^*\succeq_{N'} y$. Then, applying Proposition \[3\], we conclude. Assume now that, for every $y\in V\setminus W$, we have $x^*\succ_N y$ or $c'(x^*,y)> c(x^*,y)$ or $c'(y,x^*)< c(y,x^*)$. By Proposition \[Mon1-flow-rule\] we know that, for every $y\in V\setminus W$, $x^*\succ_{N'} y$. Then applying Proposition \[3-bis\] we conclude. The next proposition describes the effects of reversing a network on the outcomes of the flow $k$-multiwinner network solution. Remarkably we have that if on a network and on its reversal the flow $k$-multiwinner network solution selects a unique $k$-maximum set, those two sets cannot coincide. We refer to that property by saying that $\mathfrak{F}_k$ is immune to the reversal bias. The concept of immunity to the reversal bias has been introduced by Saari and Barney (2003) for voting systems and recently studied by Bubboloni and Gori (2016a, 2016b) in the framework of social choice correspondences. \[5/2\] Let $N\in \mathcal{N}$ and $k\in \ldbrack n-1 \rdbrack $. Then the following facts hold: - $\mathfrak{F}_k(N)\neq \mathbb{P}_k(V)$ implies $\mathfrak{F}_k(N)\not\subseteq\mathfrak{F}_k(N^r)$; - $|\mathfrak{F}_k(N)|=1$ implies $\mathfrak{F}_k(N)\not\subseteq \mathfrak{F}_k(N^r)$; - if $\mathfrak{F}_k(N)=\{W\}$ and $\mathfrak{F}_k(N^r)=\{U\}$, then $W\neq U;$ - If $N=N^r$, then $\mathfrak{F}_k(N)= \mathbb{P}_k(V)$; - $\mathfrak{F}_k(N)= \mathbb{P}_k(V)$ if and only if $\mathfrak{F}_k(N^r)= \mathbb{P}_k(V).$ $(i)$ Fix $N\in \mathcal{N}$ with $\mathfrak{F}_k(N)\neq \mathbb{P}_k(V)$. By Proposition \[totale\], we have $\mathfrak{F}(N)\neq V^2$. Since $\mathfrak{F}(N)\in \mathbf{T}$, by Propositions \[qA\] and \[Reversal\], we get $\mathfrak{F}_k(N)=C_k(\mathfrak{F}(N))\not\subseteq C_k(\mathfrak{F}(N)^r)=C_k(\mathfrak{F}(N^r))=\mathfrak{F}_k(N^r).$ $(ii)$ Since $n\geq 2$ and $k\in\ldbrack n-1 \rdbrack$, we have that $|\mathbb{P}_k(V)|\geq 2.$ Thus $|\mathfrak{F}_k(N)|=1$ implies $\mathfrak{F}_k(N)\neq \mathbb{P}_k(V)$ and applying $(i)$, we get $\mathfrak{F}_k(N)\not\subseteq\mathfrak{F}_k(N^r).$ $(iii)$ It follows immediately from $(ii)$. $(iv)$ Let $N=N^r$. Then, $\mathfrak{F}_k(N)=\mathfrak{F}_k(N^r)$ and $(i)$ gives $\mathfrak{F}_k(N)= \mathbb{P}_k(V)$. $(v)$ By Proposition \[totale\], we have that $\mathfrak{F}_k(N)= \mathbb{P}_k(V)$ if and only if $\mathfrak{F}(N)=V^2$. But, obviously, $\mathfrak{F}(N)=V^2$ is also equivalent to $\mathfrak{F}(N)^r=V^2$ which, by Proposition \[Reversal\], is equivalent to $\mathfrak{F}(N^r)=V^2.$ This last fact, by Proposition \[totale\], is in turn equivalent to $\mathfrak{F}_k(N^r)= \mathbb{P}_k(V).$ The next proposition refers to the symmetry properties of the flow $k$-multiwinner network solution. \[sym-sol\] Let $N\in\mathcal{N}$ and $k\in \ldbrack n-1 \rdbrack $. Then $\mathfrak{F}_{k}(N)=\mathbb{P}_k(V)$ if and only if $N$ is pseudo-symmetric. If $N$ is pseudo-symmetric then, by Proposition \[flat\], $\mathfrak{F}(N)=V^2$ so that $\mathfrak{F}_{k}(N)=\mathbb{P}_k(V)$. Assume now $\mathfrak{F}_{k}(N)=\mathbb{P}_k(V)$. By Proposition \[totale\] we get $\mathfrak{F}(N)=V^2$ and applying again Proposition \[flat\] we conclude that $N$ is pseudo-symmetric. Given $k\in\ldbrack n-1 \rdbrack$, the Borda $k$-multiwinner network solution $\mathfrak{B}_k$ and the dual Borda $k$-multiwinner network solution $\widehat{\mathfrak{B}}_k$ are respectively defined, for every $N\in\mathcal{N}$, by $\mathfrak{B}_k(N)=C_k(\mathfrak{B}(N))$ and $\widehat{\mathfrak{B}}_k(N)=C_k(\widehat{\mathfrak{B}}(N)).$ Immediately, from Theorem \[OI\], we obtain that those classical solutions coincide with the $k$-multiwinner network solution on a wide class of networks. \[balan-ut-2\] Let $N\in \mathcal{B}\cup\mathcal{O}\cup\mathcal{I}$ and $k\in \ldbrack n-1 \rdbrack$. Then $\mathfrak{F}_k(N)=\mathfrak{B}_k(N)=\widehat{\mathfrak{B}}_k(N).$ The Schulze network method {#schulze-sec} ========================== On the basis of the so called Schulze method introduced by Schulze (2011), we can formulate what we are going to call the [*Schulze network method*]{}. Let $N=(V,A,c)\in\mathcal{N}$ and $x,y\in V$ with $x\neq y.$ Define, for every $\gamma=x_1\cdots x_m\in \Gamma(N,x,y)$, $$\delta (\gamma)=\mathrm{min}\{c(x_i,x_{i+1}): i\in\ldbrack m-1 \rdbrack\}$$ and put $$s_{xy}=\left\{ \begin{array}{ll} \max\{\delta (\gamma):\gamma\in \Gamma(N,x,y)\}&\mbox{ if } \Gamma(N,x,y)\neq\varnothing\\ \vspace{-2mm}\\ 0 &\mbox{ if } \Gamma(N,x,y)=\varnothing\\ \end{array} \right.$$ Let $s:A\rightarrow \mathbb{N}_0 $ be the map associating to every $(x,y)\in A$ the number $s_{xy}.$ We call $s$ the Schulze function. Note that, due to the definition of path, $s_{xy}=0$ if and only if there exists no path from $x$ to $y$ in $N.$ Note also that $s_{xy}\geq c(x,y).$ Inspired by (2.2.5) in Schulze (2011), we get the following result. \[lemma-schulze\] Let $N\in\mathcal{N}$. Then $s$ satisfies the Gomory-Hu condition. We need to show that, for every $x,y,z\in V$ distinct, $s_{xz}\ge \min\{s_{xy},s_{yz}\}$. By contradiction, assume that there exist $x,y,z\in V$ distinct such that $s_{xz}< \min\{s_{xy},s_{yz}\}$. Thus, $s_{xy}>s_{xz}$ and $s_{yz}>s_{xz}$. In particular, $s_{xy}>0$ and $s_{yz}>0.$ Thus, by definition of $s_{xy}$, there exists a path $\gamma_{xy}=x_1\cdots x_m\in\Gamma(N,x,y) $, with $m\geq2$, such that $s_{xy}=\delta(\gamma_{xy})\ge \delta(\gamma)$ for all $\gamma\in \Gamma(N,x,y) $. In particular, for every $i\in \ldbrack m-1 \rdbrack$, we have $$\label{first -path} c(x_i,x_{i+1})\ge s_{xy}>s_{xz}.$$ Similarly, by definition of $s_{yz}$, there exists a path $\gamma_{yz}=y_1\cdots y_l\in\Gamma(N,y,z) $, with $l\geq 2$, such that $s_{yz}=\delta(\gamma_{yz})\ge \delta(\gamma)$ for all $\gamma\in \Gamma(N,y,z) $. In particular, for every $i\in \ldbrack l-1 \rdbrack$, we have $$\label{second -path} c(y_i,y_{i+1})\ge s_{yz}>s_{xz}.$$ Being $x_m=y=y_1$, the set $\{i\in \ldbrack m \rdbrack: x_i\in V(\gamma_{yz}) \}$ is nonempty and hence there exists $\nu=\mathrm{min}\{i\in \ldbrack m \rdbrack: x_i\in V(\gamma_{yz})\}.$ Since in a path the vertices are distinct, there exists a unique $\mu\in \ldbrack l \rdbrack$ such that $x_\nu=y_\mu.$ Moreover, due to $x\neq z$, we have $(\nu,\mu)\neq (1,l).$ If $\mu=l$, then $x_\nu=z$ and $\nu\ge 2,$ so that, by , $\gamma=x_1\cdots x_\nu\in \Gamma(N,x,z)$ and $\delta (\gamma)>s_{xz}$ which contradicts the definition of $s_{xz}$. If instead $\mu\leq l-1$ then, by definition of $\nu$ and $\mu$, the vertices $x_1,\dots, x_\nu,\,y_{\mu+1},\dots, y_l$ are all distinct and, by and , all the arcs between two consecutive vertices in that list have capacity greater than $s_{xz}.$ It follows that $\gamma=x_1\cdots x_\nu\,y_{\mu+1}\cdots y_l\in \Gamma(N,x,z)$ and $\delta (\gamma)>s_{xz}$ which again contradicts the definition of $s_{xz}$. The Schulze network method $\mathfrak{S}$ is now defined associating with every $N\in \mathcal{N}$ the relation $ \mathfrak{S}(N)=R(s). $ Then, by Proposition \[lemma-schulze\] and Proposition \[schulze\], we immediately get the next result which is completely analogous to Theorem \[F-qt\]. \[schulze-qt\] Let $N \in\mathcal{N}$. Then $\mathfrak{S}(N)\in\mathbf{T}$. Thus, we can replicate, word by word, all the definitions given in the flow environment. We obtain then the [*Schulze network rule*]{} defined, for every $N\in\mathcal{N}$, by $\mathfrak{S}_{\diamond}(N)=\mathbf{L}_\diamond(\mathfrak{S}(N))$; the [*Schulze $k$-multiwinner network solution*]{} defined, for every $N\in\mathcal{N}$, by $\mathfrak{S}_k(N)=C_k(\mathfrak{S}(N))$. Of course, all the results obtained in the flow environment using only the fact that the flow relation is complete and quasi-transitive continue to hold true in the Schulze environment. In particular, since it is immediately observed that, for every $N\in\mathcal{N}$, we have $\mathfrak{S}(N^r)=\mathfrak{S}(N)^r$, Proposition \[5/2\] remains true substituting the symbol $\mathfrak{F}$ with $\mathfrak{S}$. As a consequence, for every $k\in\ldbrack n-1 \rdbrack$, $|\mathfrak{S}_k(N)|=1$ implies $\mathfrak{S}_k(N)\not\subseteq \mathfrak{S}_k(N^r)$ so that, remarkably, the Schulze $k$-multiwinner network solution $\mathfrak{S}_k$ is immune to the reversal bias. On the other hand, there are some crucial differences between the flow and the Schulze network methods. Indeed, given $N\in\mathcal{N}$ and $x,y\in V$, considering $s_{xy}$ instead of $\varphi_{xy}$ to judge whether $x$ is at least as good as $y$ means to choose to focus only on the “best path” from $x$ to $y$ disregarding the contributes of the other paths. In our opinion, taking into account the whole network by considering the contribution not only of the main stream from $x$ to $y$ but also those of the secondary creeks, is more appropriate in many contexts. The next example concretely illustrates our point of view. \[flow-schulze-1\] [Consider the competition $\textsf {D}$ among the three teams in $V=\{\textsc{a}, \textsc{b},\textsc{c}\}$ described by the table $$\begin{array}{|c||c|c||c|c|} \hline \textsc{a} & 1 & 1 &\textsc{b}\\ \hline \textsc{a} & 1 & 1 &\textsc{c}\\ \hline \textsc{b} & 0 & 1 &\textsc{c}\\ \hline \end{array}$$ and let $N_{\textsf {D}}$ be the associated network. Then, for every $x\in \{\textsc{b},\textsc{c}\}$, we have $c(\textsc{a},x)=c(x,\textsc{a})=1$ and so also $s_{\textsc{a}x}=s_{x\textsc{a}}=1$. Moreover $s_{\textsc{b} \textsc{c} }=s_{\textsc{c} \textsc{b} }=1,$ so that $s$ is a constant function. It follows that $\mathfrak{S}(N_{\textsf {D}})=V^2$, so that, in particular, $\mathfrak{S}_1(N_{\textsf {D}})=\{\{\textsc{a}\}, \{\textsc{b}\},\{\textsc{c}\}\}.$ On the other hand, being $\varphi_{\textsc{a}\textsc{b}}=2$, $\varphi_{\textsc{b}\textsc{a}}=1$, $\varphi_{\textsc{a}\textsc{c}}=1$, $\varphi_{\textsc{c}\textsc{a}}=2$, $\varphi_{\textsc{b}\textsc{c}}=1$, $\varphi_{\textsc{c}\textsc{b}}=2$, we instead have that $\mathfrak{F}(N_{\textsf {D}})$ is the linear order $L$ given by $\textsc{c}\succ\textsc{a}\succ\textsc{b}$ and so $\mathfrak{F}_1(N_{\textsf {D}})=\{\{\textsc{c}\}\}.$[^23] ]{} An accurate analysis of the Schulze network method as well as a comparison with the flow network method is surely an interesting issue. It goes beyond the aim of the present paper. Comparison functions {#dutta-sec} ==================== Following Dutta and Laslier (1999), a comparison function on $V$ is a function $g:V^2\to \mathbb{R}$ such that, for every $(x,y)\in V^2$, $g(x,y)=-g(y,x)$. Denote by $\mathcal{G}$ the set of all the comparison functions on $V$. Any correspondence from $\mathcal{G}$ to $V$ is called a choice correspondence[^24]. Some interesting choice correspondences are defined by Dutta and Laslier (1999) in their paper. They are called the uncovered set ($UC$), the sign-uncovered set ($SUC$), the minimal covering set ($MC$), the sign minimal covering set ($SMC$), the essential set ($ES$) and the sign essential set ($SES$) and, as their names suggest, can be seen as extensions of some classical tournament solutions. Given $N=(V,A,c)\in\mathcal{N}$, it can be naturally associated with it the comparison function $g_N$, defined as follows $$g_N(x,y)= \left\{ \begin{array}{ll} c(x,y)-c(y,x) & \mbox{ if }x\neq y\\ 0&\mbox{ if }x=y \end{array} \right.$$ The function $g_N$ is called the margin function of $N$. As a consequence, any choice correspondence $F$ induces the 1-multiwinner network solution $\mathfrak{G}_F$ associating with any $N\in\mathcal{N}$ the set $\{\{x\}\subseteq V: x\in F(g_N)\}$. Thus, it can be interesting a comparison between the flow 1-multiwinner network solution and the 1-multiwinner network solutions induced by the choice correspondences above mentioned. Even though a deep analysis of that problem it is outside the purposes of this paper, we can easily prove that, in general, $\mathfrak{F}_1\neq \mathfrak{G}_{UC}$ and $ \mathfrak{F}_1\neq \mathfrak{G}_{MC}$. Indeed, consider $N=(V,A,c)$ where $$\begin{array}{l} V=\{\textsc{a},\textsc{b},\textsc{c},\textsc{d}\};\\ \vspace{-2mm}\\ A=\{(x,y)\in V^2: x,y\in\{\textsc{a},\textsc{b},\textsc{c},\textsc{d}\} \mbox{ and } x\neq y\};\\ \vspace{-2mm}\\ c:A\to\mathbb{N}_0 \mbox{ is defined by }\\ c(\textsc{a},\textsc{b})=2,\; c(\textsc{b},\textsc{a})=0,\;c(\textsc{a},\textsc{c})=2,\; c(\textsc{c},\textsc{a})=0,\\ c(\textsc{a},\textsc{d})=1,\; c(\textsc{d},\textsc{a})=0,\; c(\textsc{b},\textsc{c})=2,\;c(\textsc{c},\textsc{b})=0,\\ c(\textsc{b},\textsc{d})=1,\; c(\textsc{d},\textsc{b})=0,\;c(\textsc{c},\textsc{d})=1,\; c(\textsc{d},\textsc{c})=0.\\ \end{array}$$ A simple computation shows that $\{\textsc{d}\}\not\in \mathfrak{F}_1(N)$. Moreover, $g_N$ is such that $$\begin{array}{l} g_N(\textsc{a},\textsc{b})=2,\; g_N(\textsc{b},\textsc{a})=-2,\;g_N(\textsc{a},\textsc{c})=2,\; g_N(\textsc{c},\textsc{a})=-2,\\ g_N(\textsc{a},\textsc{d})=1,\; g_N(\textsc{d},\textsc{a})=-1,\; g_N(\textsc{b},\textsc{c})=2,\;g_N(\textsc{c},\textsc{b})=-2,\\ g_N(\textsc{b},\textsc{d})=1,\; g_N(\textsc{d},\textsc{b})=-1,\;g_N(\textsc{c},\textsc{d})=1,\; g_N(\textsc{d},\textsc{c})=-1.\\ \end{array}$$ Since $g_N$ is the same comparison function considered in Example 4.1 in Dutta and Laslier (1999), we get that $\{\textsc{d}\}\in UC(g_N)=MC(g_N)$ so that $\mathfrak{F}_1(N)\neq \mathfrak{G}_{UC}(N)$ and $ \mathfrak{F}_1(N)\neq \mathfrak{G}_{MC}(N)$. Aziz, H., Brill, M., Fischer, F., Harrenstein, P., Lang, J., Seeding, H.G., 2015. Possible and necessary winners of partial tournaments. Journal of Artificial Intelligence Research 54, 493-534. Bang-Jensen, J., Gutin, G., 2008. [*Digraphs Theory, Algorithms and Applications*]{}. Springer. Belkin, A.R., Gvozdik. A.A., 1989. The flow model for ranking objects. Problems of Cybernetics, Decision Making and Analysis of Expert Information, Eds. Dorofeyuk, A., Litvak, B., Tjurin, Yu., Moscow, 109-117 (in Russian). Bouyssou, D., 1992. Ranking methods based on valued preference relations: A characterization of the net flow method. European Journal of Operational Research 60, 61-67. Brandt, F., Brill, M., Harrenstein, P., 2016. Extending tournament solutions. Proceedings of the Twenty-Eighth AAAI Conference on Artificial Intelligence. Bubboloni, D., Gori, M., 2015. Symmetric majority rules. Mathematical Social Sciences 76, 73-86. Bubboloni, D., Gori, M., 2016a. On the reversal bias of the Minimax social choice correspondence. Mathematical Social Sciences 81, 53-61. Bubboloni, D., Gori, M., 2016b. Resolute refinements of social choices correspondences. Mathematical Social Sciences 84, 37-49. Csató, L., 2017. Some impossibilities of ranking in generalized tournaments. arXiv:1701.06539v4. De Donder, P., Le Breton, M., Truchon, M., 2000. Choosing from a weighted tournament. Mathematical Social Sciences 40, 85-109. Dutta and Laslier, 1999. Comparison functions and choice correspondences. Social Choice and Welfare 16, 513-532. Elkind, E., Faliszewski, P., Skowron, P., Slinko, A., 2017. Properties of Multiwinner Voting Rules. Social Choice and Welfare. doi:10.1007/s00355-017-1026-z. Gomory, R. E., Hu T. C., 1961. Multi-terminal network flows. Journal of the Society for Industrial and Applied Mathematics 9, No. 4, 551-570. González-Díaz, J., Hendrickx, R., Lohmann, E., 2014. Paired comparisons analysis: an axiomatic approach of ranking methods. Social Choice and Welfare 42, 139-169. Gvozdik, A.A., 1987. Flow interpretation of the tournament model for ranking. Abstracts of the VI-th Moscow Conference of young scientists on cybernetics and computing, Moscow: Scientific Council on Cybernetics of RAS, 1987, p.56 (in Russian). Hartmann, M., Schneider, M.H., 1993. Flow symmetry and algebraic flows. ZOR - Methods and Models of Operations Research 38, 261-267. Kitti, M., 2016. Axioms for centrality scoring with principal eigenverctors. Social Choice and Welfare 46, 639-653. Langville, A. N., Meyer, C. D., 2012. Who Is $\#1$? The Science of Rating and Ranking. Princeton University Press. Laslier, J.-F., 1997. [*Tournament solutions and majority voting*]{}. Studies in Economic Theory, Volume 7. Springer. Lovász, L., 1973. Connectivity in digraphs. Journal of Combinatorial Theory (B) 15, 174-177. Palacios-Huerta, I., Volij, O., 2004. The measurement of intellectual influence. Econometrica 72, 963-977. Patel, Jaymin, 2015. College football rankings: maximum flow model. Industrial Engineering Undergraduate Honors Theses, paper 35. Peris, J.E., Subiza, B., 1999. Condorcet choice correspondences for weak tournaments. Social Choice and Welfare 16, 217-231. Saari, D.G., 1994. [*Geometry of Voting*]{}. In: Studies in Economic Theory, vol. 3. Springer. Saari, D.G., Barney, S., 2003. Consequences of reversing preferences. The Mathematical Intelligencer 25, 17-31. Schulze, M., 2011. A new monotonic, clone-independent, reversal symmetric, and Condorcet-consistent single-winner election method. Social Choice and Welfare 36, 267-303. Slutzki, G., Volij, O., 2005. Ranking participants in generalized tournaments. International Journal of Game Theory 33, 255-270. Szpilrajn, E., 1930. Sur l’extension de l’ordre partiel. Fundamenta Mathematicae 16, 386-389. van den Brink, R., Gilles, R.P., 2009. The outflow ranking method for weighted directed graphs. European Journal of Operational Research 193, 484-491. Vaziri, B., Dabadghao, S., Yih, Y., Morin, T. L., 2017. Properties of sports ranking methods. Journal of the Operational Research Society, 1-12, doi:10.1057/s41274-017-0266-8. [^1]: We wish to thank an anonymous referee for letting us know the existence of the papers by Gvozdik (1987) and Belkin and Gvozdik (1989) (in Russian), where the flow network method was first formulated. We also thank Andrey Sarychev for translating the mentioned papers. Daniela Bubboloni was partially supported by GNSAGA of INdAM. [^2]: The National Football League (NFL) and the NCAA Division I Football Bowl Subdivision are examples of competitions where there are teams which never play each other on the field. [^3]: We describe a competition by a table in which every row has the shape $$\begin{array}{|c||c|c||c|c|} \hline x & m & n &y\\ \hline \end{array}$$ meaning that the matches involving the teams $x$ and $y$ were $m+n$ and that $x$ won $m$ times and $y$ won $n$ times. [^4]: We stress that Belkin and Gvozdik (1989) mainly focus on the problem of building rankings. [^5]: A similar interpretation appears in Patel (2015). [^6]: Due to the identification between competitions and networks, we are going to freely use the terminology of competitions for networks too. [^7]: Note that in many applications networks capacities are allowed to be nonnegative real numbers and networks are identified with their adjacency matrix. [^8]: The Copeland method is sometimes called net flow method (Bouyssou, 1992). [^9]: We emphasize that some of the properties considered by Gonzaléz-Díaz et al. (2014) are satisfied by the flow network method as described in course of the paper. [^10]: The flow network method fulfils the three main properties stated in that paper. Property I (opponent strength) has been already discussed; Property II (incentive to win) is the content of Proposition \[Mon1-flow-rule\]; Property III (sequence of matches) follows from the very definition of the method. [^11]: Note that the (normalized) invariant and the fair-bets methods are also known as the (normalized) long path and the Markov methods, respectively. [^12]: A tournaments is a complete and asymmetric digraph. Tournaments can be identified with networks whose capacities are 0 or 1 and such that the sum of the capacities of any pair of opposite arcs is 1. They are used to represent round robin-competitions. [^13]: A balanced network is a network whose sum of the capacities of any pair of opposite arcs is constant. Balanced networks represent competitions where any pair of teams confront each other the same number of time. [^14]: The equality between the flow and the Borda network methods on balanced networks is stated, without proof, in Belkin and Gvozdik (1989, Lemma 1). [^15]: Complete and quasi-acyclic relations always admit linear refinements (Proposition \[lin-ref\]). [^16]: That fact can be easily checked considering the network in Example \[flow-schulze-1\]. [^17]: Given a relation $R$ on a nonempty finite set $V$, a $k$-maximum set of $R$ is a subset $W$ of size $k$ of $V$ having the property that, for every $x\in W$ and $y\not\in W$, $(x,y)\in R$. Complete and quasi-acyclic relations always admit $k$-maximum sets (Proposition \[ckR\]). [^18]: Weak tournaments and partial tournaments can be naturally identified with networks whose arcs always have capacities that are 0 or 1 and such that the sum of the capacities of each pair of opposite arcs is at least 1 and at most 1 respectively. [^19]: Those authors use the term anonymity instead of neutrality. [^20]: For a more general approach, see also the main result in Hartmann and Schneider (1993). [^21]: We thank László Lovász for useful advices about this proposition. [^22]: That fact seems to be known in the literature even though we could not find a precise reference. Thus, for completeness, we provide a proof. [^23]: Note that, on the network $N_{\textsf {D}}$, the Kemeny network rule and the ranked pair network rule are equal to $\{L, \,\textsc{c}\succ\textsc{b}\succ\textsc{a},\, \textsc{a}\succ\textsc{c}\succ\textsc{b}\}$, while $\mathfrak{F}_{\diamond}(N_{\textsf {D}})=\{L\}$. [^24]: Actually, this definition is less general than the one in the paper of Dutta and Laslier. Nevertheless, it is sufficient for our purposes.
1. Field of Invention The invention is directed to an encoded sheet material and sheet processing apparatuses that use the encoded sheet material. More particularly, the invention relates to an encoded image recording medium and image recording apparatuses that use the encoded image recording media. 2. Description of Related Art Many different types of image recording devices are available in the market place. Such image recording devices include photocopying machines, laser, ink jet and dot-matrix printers, facsimile machines and offset printing presses. Each of these image recording devices use one or more types of image recording media in a form of sheet material. The photocopying machine, for example, can form an image on either paper or a plastic transparency. Also, the photocopy machine can form an image on various sizes of the recording medium. For instance, the photocopying machine can use the recording medium having various sizes such as 8 xc2xdxe2x80x3xc3x9711xe2x80x3, 8xc2xdxe2x80x3xc3x9714xe2x80x3 and A4 sizes. However, when a user desires to photocopy an image on a plastic transparency, for example, the user must load one or more plastic transparencies in an appropriate source tray of the photocopy machine. More sophisticated photocopying machines include multiple source trays for retaining a variety of recording media. The user must now remember which particular source tray contains the plastic transparency and must select that particular source tray on the photocopy machine in order to produce a plastic transparency with the desired image. Even with the more sophisticated photocopy machines, little information regarding the type of recording media being used is provided. As suggested above, the user can select one of a variety of sizes of the recording media upon which an image is to be formed. Usually, sensors in each source tray provide size information that is displayed on a display positioned in the console of the photocopying machine. Less sophisticated photocopying machines have source trays that are sized to accommodate only one particular size of the recording media. Thus, it is possible that the user can determine the size of the recording medium by viewing the console of the photocopying machine. Otherwise, in order for the user to ascertain any other information regarding the recording media, the user must ascertain this information on his/her own accord. Furthermore, if the user desires to photocopy a document that includes a variety of types of recording media, the user must load each type of the recording media in respective ones of the multiple source trays. Once the selected number of photocopies for each type of the recording media is produced, the photocopied document is then collated to produce the desired document with the appropriate types of recording media. For example, the desired photocopied document might include a first page as a transparency with a company logo form thereon, a second page as a sheet of bond quality paper bearing the title of the document, subsequent pages as standard photocopy paper containing the body of the document and a last page as a black card stock. For many types of photocopying machines, each of the different types of recording media must be first photocopied and then collated and assembled into the desired photocopied document. One embodiment of the invention is an encoded sheet material. The encoded sheet material includes a sheet of material that has a first surface, a second surface disposed opposite the first surface and an edge. The edge extends between the first and second surfaces and peripherally about the sheet of material. The edge has indicia that is arranged thereon to form a code that identifies at least one characteristic of the sheet material. Another embodiment of the invention is a sheet processing apparatus. The sheet processing apparatus includes a sheet of material, a code reader device and a processor. The sheet of material has indicia arranged on it to form a code that identifies information related to the sheet of material. The code reader device is operative in conjunction with the encoded sheet of material for reading the code. The processor communicates with the code reader device and causes the sheet processing apparatus to process the sheet of material based upon the read code. Another embodiment of the invention is an encoded image recording medium. The encoded image recording medium of the invention includes a sheet fabricated from an image recording material and has a first surface, a second surface which is disposed opposite the first surface and an edge that extends between the first and second surfaces and peripherally about the sheet. The edge has indicia arranged on it to form a code that identifies at least one characteristic of the sheet. Another embodiment of the invention is an encoded image recording medium that includes a plurality of sheets as described above. The plurality of sheets are stacked in facial registration with one another. Another embodiment of the invention is an image recording apparatus that forms an image on a selected type of image recording medium. The image recording apparatus includes a first type of image recording medium, a code reader device, an input device and a processor. The first type of image recording medium has indicia that is arranged on it to form a code that identifies the first type of image recording media. The code reader device is operative in conjunction with the encoded first type of image recording medium to read the indicia to identify the first type of image recording media. The input device provides an input signal representative of the selected type of the image recording medium. The processor is in communication with the code reader device and the input device and determines that the first type of image recording medium is identified as the selected type of image recording medium. The processor also causes the image recording apparatus to form the image on the first type of image recording medium upon determining that the first type of image recording medium is identified as the selected type of image recording medium.
Anti-M isoimmunization: management and outcome at the Ohio State University from 1969 to 1995. To review the management strategies and outcome in gravidas with anti-M isoimmunization over the past 26 years at The Ohio State University. Data collected from 115 pregnancies found to have anti-M antibody at The Ohio State University from September 1969 through February 1996 were reviewed retrospectively. We analyzed indirect antiglobulin tests, amniotic fluid with spectrophotometric examination, direct antiglobulin tests, M antigen status, antepartum course, and perinatal outcome. Anti-M antibody was found in 90 women who had 115 pregnancies over 26 years. Among those with positive indirect antiglobulin tests, 104 pregnancies had titers at or below 1:4. Only one patient with an initial low titer experienced more than a three-fold increase to 1:64. Two women underwent a total of eight amniocenteses when titers were at or above 1:128. Forty-two (60%) of the 70 infants tested were positive for M antigen. Nine infants required phototherapy. Eight of these infants were delivered preterm. There was an increase in the number of women seen with anti-M antibody in pregnancy at our institution, with nearly 10% of all gravidas with a positive antibody screen having anti-M alloantibodies. There were no cases of hemolytic disease of the newborn, mild or severe. The prevalence of anti-M isoimmunization may be increasing. The incidence of severe hemolytic disease of the newborn due to anti-M is extremely low. We found no cases in our review of 115 pregnancies, although there have been several cases of severe hemolytic disease of the newborn reported. If anti-M is detected in pregnancy, the titer is low (no more than 1:4), and there is no history of prior pregnancy complications suggesting a hemolytic disease process, we recommend no further testing other than an indirect antiglobulin test at 28 weeks to look for the emergence of other alloantibodies. However, if the initial titer is elevated or there is a concerning obstetric history, serial titers should be performed and amniocenteses reserved for rising titers.
The Armed Forces Flag Day is significant as it reminds the nation of its obligation to look after the veterans, disabled soldiers, war widows and dependents of those who have sacrificed their lives for the safety, honour and integrity of the country. The Armed Forces Flag Day is observed every year on 7 December since 1949 to honour the soldiers, airmen and sailors of the country. The day is significant as it reminds the nation of its obligation to look after the veterans, disabled soldiers, war widows and dependents of those who have sacrificed their lives for the safety, honour and integrity of the country. A fund has been established by the government, the Armed forces Flag Day Fund (AFFDF), for the welfare of veterans, disabled soldiers, war widows and dependents of those who have sacrificed their lives in the line of duty and also for the rehabilitation of the Ex-Servicemen (ESM) community. Seeking contributions to the aforesaid mentioned fund, a Ministry of Defence release said, "The aim of the campaign to generate awareness about the ‘Armed Forces Flag Day Fund’ and encourage people to contribute generously. Several cashless payment methods have been setup and made available. You can send your contributions via PayTM number ‘8800462175’ and UPI code: armedforcesflagdayfund@sbi – To contribute using Credit/Debit Card or Net Banking log on to ksb.gov.in/armed-forces-flag-day-fund.htm." Many known names and organisations honoured the soldiers, airmen and sailors of the country on Twitter. Defence Minister Nirmala Sitharaman urged the people to contribute towards the AFFD Fund, thanking the ones who have and are spreading the message. We can never express our gratitude enough towards the sacrifices our soldiers make for India. However, we can honour their valour and martyrdom by celebrating the #ArmedForcesFlagDay today. Let us also contribute generously towards the AFFD fund. Visit https://t.co/2EASWvtDN6 pic.twitter.com/lxSyQH5orz — Raksha Mantri (@DefenceMinIndia) December 7, 2018 Arunachal Chief Minister Pema Khandu, to celebrate Indian Armed Forces Flag Day, is visiting Vijaynagar, one of the remotest circle in Arunachal Pradesh bordering Myanmar to meet retired soldiers and their families who are settled there. On #ArmedForcesFlagDay leaving today for Vijaynagar - one of the remotest circle in Arunachal bordering Myanmar to meet our Armed Forces retired soldiers and their families who are settled there. @adgpi @PMOIndia @DefenceMinIndia pic.twitter.com/PJBerNKSl9 — Pema Khandu (@PemaKhanduBJP) December 7, 2018 Union minister Dharmendra Pradhan paid tribute to the heroes of Indian Armed Forces, honouring their "indomitable courage and supreme sacrifice". He also urged the people to contribute to the fund. Our armed forces are our pride. On #ArmedForcesFlagDay let us salute the sacrifices of our valiant forces by wearing the armed forces flag and contribute to armed forces flag day fund through https://t.co/MRSLPTNrXT or Paytm- 8800462175. pic.twitter.com/buRyDVF1hM — Dharmendra Pradhan (@dpradhanbjp) December 7, 2018 West Bengal chief minister Mamata Banerjee gave her best wishes to the ones serving in the military, stating that the nation is indebted to their service. Today is Armed Forces Flag Day. My best wishes to all those who are serving in the Indian Armed Forces. The nation is indebted to them for their service. We must continue to work for the welfare of Indian Armed Forces personnel — Mamata Banerjee (@MamataOfficial) December 7, 2018 Union Minister for Railways Piyush Goyal urged the people to pledge to honour the men and women in uniform and contribute to the AFFDF towards the well-being of their families. On Armed Forces Flag Day, we salute the men in uniform who gallantly protect our borders & selflessly defend our Motherland. Let us pledge to honour their sacrifice and contribute towards the well-being of their families. Donate at https://t.co/6Flh0zKyZ0 pic.twitter.com/vDXSksEviv — Piyush Goyal (@PiyushGoyal) December 7, 2018 The Indian Air Force and the Additional Directorate General of Public Information of the Indian Army also urged the people to contribute to the fund. Since 1949,7th December is observed as the Armed Forces Flag Day throughout the country to honour the men in uniform.Let us all contribute to ‘Armed Forces Flag Day Fund’.This fund is used for the welfare of the families of the martyrs and disabled soldiers.#ArmedForcesFlagDay pic.twitter.com/Q9pFIi6bG3 — ADG PI - INDIAN ARMY (@adgpi) December 7, 2018 Central Industrial Security Force (CISF) paid tribute to the soldiers who have sacrificed their lives for the "safety, honour and integrity of the nation." On #ArmedForcesFlagDay #CISF salutes courage, valour & sacrifice of Indian Armed Forces and pays tribute to martyrs who have sacrificed their lives for the safety, honour & integrity of the nation. pic.twitter.com/1V372jbFH9 — CISF@India (@CISFHQrs) December 7, 2018 Badminton player Saina Nehwal uploaded a video honouring the sacrifice of the soldiers and asking the people to contribute to the fund. #ArmedForcesFlagDay ..... 7 th December 2018 .... Jai Hind 🇮🇳.. pic.twitter.com/NFJlRh594A — Saina Nehwal (@NSaina) December 6, 2018 Another shuttler PV Sindhu also expressed her gratitude to the soldiers through a video message. Playback singer KS Chithra persuaded the people to contribute to the AFFDF and to wear the flag with pride. #ArmedForcesFlagDay is a thanks giving day by every Indian for our glorious armed forces. Message from the well renowned playback singer @KSChithra#ArmedForcesWeek2018 @SpokespersonMoD Donate to #AFFD fund at https://t.co/5HyGdoAn3g pic.twitter.com/mRADQQLSVo — PRO Defence Trivandrum (@DefencePROTvm) December 6, 2018 Haryana Chief Minister Manohar Lal paid tribute to the soldiers, saluting the courage, valour and sacrifice of the brave soldiers who "valiantly guard our borders day and night, for the security of our nation and citizens." On #ArmedForcesFlagDay I salute the courage, valour & sacrifice of our brave soldiers who valiantly guard our borders day and night, for the security of our nation and citizens. Jai Hind! pic.twitter.com/VyhaINWQg2 — Manohar Lal (@mlkhattar) December 7, 2018 Odisha chief minister Naveen Patnaik remembered their selfless sacrifice of the soldiers for the motherland. Salute to all martyrs and the men in uniform on #ArmedForcesFlagDay, who valiantly guard our borders to safeguard the country's honor. Remembering their selfless sacrifice for the motherland to ensure that we live our lives in freedom and prosperity. pic.twitter.com/SkwmC2cYkk — Naveen Patnaik (@Naveen_Odisha) December 7, 2018 Banks also paid tribute to the soldiers urging them to contribute to the fund. ICICI bank asked people to "give something to those, who give everything to the nation." As the country observes the #ArmedForcesFlagDay today, here’s our chance to do our bit in supporting the heroes who guard our tomorrow. To contribute to the #AFFD fund, visit: https://t.co/wlVmksjrmQ @KSBSectt @DefenceMinIndia @nsitharaman pic.twitter.com/7B4noZmZ9N — ICICI Bank (@ICICIBank) December 7, 2018 SBI asked people to extend their support by wearing the flag and donating to the fund. They sacrifice their lives, without a second thought, to protect us. Extend your support by wearing the flag and donating to the Armed Forces Flag Day Fund to help the disabled ex-servicemen and the martyrs’ families. Donate through BHIM SBI Pay: https://t.co/1ho06MbWn9 pic.twitter.com/cVmiaak6Dr — State Bank of India (@TheOfficialSBI) December 7, 2018 To celebrate the day, the University Grants Commission (UGC) has directed varsities across the country to observe 7 December as the Armed Forces Flag Day to commemorate the "supreme sacrifices" made by the country's soldiers during conflicts.
All of Scrooge McDuck's Millions #2: My Second Million $0.99 All of Scrooge McDuck's Millions #2: My Second Million Scrooge McDuck's stories about how he made his millions continue! Scrooge earned his second million with a unique idea: constructing a railway line that connects the East and the West coasts of the United States! But when he encounters a major setback, how can Scrooge turn this problem into profit?
Friday, April 20, 2007 INDEPENDENCE DAY HALL The "REN & STIMPY SHOW" was a short-lived cartoon. Its founder, John Kricfalusi targeted the humor for teens and young adults. The show enjoyed a great success for two years until the network "stole" the rights from him. Then without Kricfalusi's creative genius, the network produced their own ersatz version. Driven by the it's early reputation the show remained popular but viewers noticed a drop in quality. Then within two years, the show was off the air. One of the bright spots throughout the run was Billy West, the voice of Stimpy. Billy West molded Stimpy's voice from his impression of Larry Fine from the "THREE STOOGES." Apparently Mr. West is the only person in the world who does a decent Larry...of course, there probably isn't much of a call for Larry Fine impersonators anyway. Therefore on our family visit with Andrew's friend Vinnie last week to Philadelphia, I was surprised to see a huge (and not aesthetically beautiful) wall moral of Larry Fine over Jon's Bar & Grill on South Street. Later when we wanted lunch, somehow Larry lured us back. The back of the menu included Larry's biography and we were surprised that he had actually lived in the building that the restaurant/bar now occupied. Oh, yeah in case you're curious...and PLEASE pardon the pun...the food was "FINE." From there, we went to the Franklin Institute to see the King Tut Exhibit. They must have extremely long waits at times, because they had snaky railings set-up like at amusement parks. Our time slot was 5:30PM and luckily we walked past the railings directly to a holding area. At first it seemed like we would have a long wait but they allow 60 people in every three minutes. Our wait was about ten minutes. Before going inside, a museum representative gives a short spiel on patron etiquette as well as some do's and don'ts . That's followed by a two-minute film narrated by Omar Shariff that gives a brief history of what you are about to see. The exhibit is divided into five rooms. The crowds are small enough that if you wanted to see everything up close, the wait, if any was short. Also each item had a small plaque to read and this information was repeated in big print at the top and all sides of the individual showcases. On the funny side, in the first room, a woman with a one-year old in her arm was dragging a whining three-year old along. I was standing next to them when she suddenly bent down, stuck her finger in the tike's face and said, "You're NOT ruining this for me!" When the kid tried to rebut she interrupted, "When I take you to Disneyworld I don't ruin it for you, do I?" I kept an eye on them and the boy never whined again. In comparison to when I saw King Tut at the New York Museum of Natural History in 1978, the crowd was controlled much better this time around. I also think there was a lot more to see and the time restrictions in each room were more relaxed. There were minor flaws in the presentation but I won't mention them because I wouldn't want to discourage any of my readers from attending. On the way out, photography was permitted in the gift shop. They had tons of crap to buy to help you recall the memories of the trip but you should always remember, one picture is worth a thousand words. It should be noted that the ticket price also includes the regular museum. If you've never been to the Franklin Institute, its great for all ages. We parked easily at a meter about a block away...so bring plenty of quarters. After we left, Andrew's friend wanted to see (as he called it) Independence DAY Hall. Being Philadelphia illiterate, I took the loooong way to get there but was able to come through on my promise. More importantly, through my guidance, Vinnie has dropped the word DAY. NEIL ARMSTRONG - ASTRONAUNT (1930-2012) MARCEL MARCEAU - MIME, ACTOR (1923-2007) "FREE AT LAST, FREE AT LAST, FREE AT LAST, THANK GOD ALL MIGHTY, I'M FREE AT LAST." and "DARKNESS CANNOT DRIVE OUT DARKNESS. ONLY LIGHT CAN DO THAT. HATE CANNOT DRIVE OUT HATE. ONLY LOVE CAN DO THAT." and "I HAVE A DREAM THAT MY FOUR LITTLE CHILDREN WILL ONE DAY LIVE IN A NATION WHERE THEY WILL NOT BE JUDGED BY THE COLOR OF THEIR SKIN, BUT BY THE CONTENT OF THEIR CHARACTER." LINDSAY NELSON - SPORTSCASTER - (1919-1995) "THEY, (THE 1962, NEW YORK METS), PLAYED FOR FUN, BECAUSE THEY COULDN'T PLAY ANY OTHER WAY." SAM LEVENSON - HUMORIST-JOURNALIST (1911-1980) IF YOU DIE IN AN ELEVATOR, BE SURE TO PRESS THE "UP" BUTTON. BUDDHA (SIDDHARTHA GAUTAMA) - SPIRITUAL TEACHER (c. 563 BC - 483 BC) "THOUSANDS OF CANDLES CAN BE LIT FROM A SINGLE CANDLE, AND THE LIFE OF THE CANDLE WILL NOT BE SHORTENED. HAPPINESS NEVER DECREASES BY BEING SHARED." and "YOU CAN SEARCH THROUGHOUT THE ENTIRE UNIVERSE FOR SOMEONE MORE DESERVING OF YOUR LOVE AND AFFECTION THAN YOU ARE YOURSELF AND THAT PERSON IS NOT TO BE FOUND ANYWHERE. YOU YOURSELF, AS MUCH AS ANYBODY IN THE UNIVERSE, DESERVE YOUR LOVE AND AFFECTION." MOTHER TERESA - NUN & MISSIONARY (1910-1997) "I KNOW GOD WILL NOT GIVE ME ANYTHING I CAN'T HANDLE, I JUST WISH HE DIDN'T TRUST ME SO MUCH." SHIRLEY JACKSON - AUTHOR (1916-1965) "I HAVE OFTEN NOTICED THAT ONE CAN OBSERVE WITH DETATCHMENT, SIGHTS THAT WHEN PUT INTO WORDS BECOME DISGUSTING." MALCOLM X. - CIVIL RIGHTS ACTIVIST, CLERGYMAN (1925-1965) "YOU'RE NOT SUPPOSED TO BE SO BLIND WITH PATRIOTISM THAT YOU CAN'T FACE REALITY. WRONG IS WRONG NO MATTER WHO SAYS IT OR DOES IT." MEL BLANC - VOICE ACTOR, COMEDIAN (1908-1989) "THAT'S ALL FOLKS!" MUHAMMAD ALI - BOXER, SOCIAL ACTIVIST (1942-Present) "I AM THE GREATEST." JACKIE GLEASON - ACTOR, COMEDIAN (1916-1987) "THE WORST THING YOU CAN DO WITH MONEY... IS SAVE IT." JAWAHARLAL NEHRU - 1st PRIME MINISTER OF INDIA - 1889-1964 "LIFE IS LIKE A GAME OF CARDS, THE HAND YOU ARE DEALT IS DETERMINISM. THE WAY YOU PLAY IT, IS FREE WILL." HARRY TRUMAN - 33RD U.S. PRESIDENT - (1884-1972) "IT'S A RECESSION WHEN YOUR NEIGHBOR LOSES HIS JOB; IT'S A DEPRESSION WHEN YOU LOSE YOURS." EDGAR ALLAN POE - AUTHOR (1809-1849) "I HAVE NO FAITH IN HUMAN PERFECTABILITY. I THINK THAT HUMAN EXERTION WILL HAVE NO APPRECIABLE EFFECT UPON HUMANITY. MAN IS NOW ONLY MORE ACTIVE-NOT MORE HAPPY-NOR WISE, THAN HE WAS 6000 YEARS AGO." CONFUCIUS - SOCIAL PHILOSOPHER - (551 BC - 479 BC) "NEVER IMPOSE ONTO OTHERS WHAT YOU WOULD NOT CHOOSE FOR YOURSELF." RODNEY DANGERFIELD - ACTOR - COMEDIAN - (1921-2004) MY LUCK IS SO BAD, IF I INVESTED IN A CEMETERY, PEOPLE WOULD STOP DYING....Dangerfield's Tombstone, "THERE GOES THE NEIGHBORHOOD." ZSA ZSA GABOR - ACTRESS - (1917-PRESENT) "I NEVER HATED A MAN ENOUGH TO GIVE BACK HIS DIAMONDS." RONALD REAGAN - 40th U.S. PRESIDENT - ACTOR (1911-2004) "IT HAS BEEN SAID THAT POLITICS IS THE SECOND OLDEST PROFESSION. I HAVE LEARNED THAT IT BEARS A STRIKING RESEMBLENCE TO THE FIRST.' HASKEL "HY" EDELBLUM - FATHER, ROLE MODEL, ARTIST (1928-1995) "IF SOMEONE IS TALKING TO THEM SELF AND YOU ANSWER, THEN THEY AREN'T TALKING TO THEM SELF." OPRAH WINFREY TV Host, Producer, Philantropist (1954 to Present) "CHEERS TO A NEW YEAR AND ANOTHER CHANCE TO GET IT RIGHT." and "YOU CAN HAVE IT ALL. YOU JUST CAN'T HAVE IT ALL AT ONCE." ERMA BOMBECK - AUTHOR, HUMORIST (1927-1996) SHOPPING IS A WOMAN THING. IT'S A CONTACT SPORT LIKE FOOTBALL. WOMEN ENJOY THE SCRIMMAGE, THE NOISY CROWDS, THE DANGER OF BEING TRAMPLED TO DEATH AND THE ECSTASY OF THE PURCHASE. TRUMAN CAPOTE - AUTHOR, HUMORIST (1924-1984) LIFE IS A MODERATELY GOOD PLAY WITH A BADLY WRITTEN THIRD ACT. CLARENCE DARROW - LAWYER (1857-1938) AS LONG AS THE WORLD SHALL LAST THERE WILL ALWAYS BE WRONGS AND IF NO MAN OBJECTED AND NO MAN REBELLED, THESE WRONGS WOULD LAST FOREVER.
/* This library is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the license, or (at your option) any later version. */ package ee.ioc.cs.jbe.browser.detail.elementvalues; import org.gjt.jclasslib.structures.elementvalues.EnumElementValue; import org.gjt.jclasslib.util.ExtendedJLabel; import ee.ioc.cs.jbe.browser.BrowserServices; import ee.ioc.cs.jbe.browser.BrowserTreeNode; import ee.ioc.cs.jbe.browser.detail.FixedListDetailPane; import javax.swing.tree.TreePath; /** * Class for showing element value entry of type Enum. * * @author <a href="mailto:vitor.carreira@gmail.com">Vitor Carreira</a> * @version $Revision: 1.4 $ $Date: 2006/09/25 16:00:58 $ */ public class EnumElementValueEntryDetailPane extends FixedListDetailPane { private ExtendedJLabel lblTypeNameIndex; private ExtendedJLabel lblTypeNameIndexVerbose; private ExtendedJLabel lblConstNameIndex; private ExtendedJLabel lblConstNameIndexVerbose; public EnumElementValueEntryDetailPane(BrowserServices services) { super(services); } protected void setupLabels() { addDetailPaneEntry(normalLabel("Type name:"), lblTypeNameIndex = linkLabel(), lblTypeNameIndexVerbose = highlightLabel()); addDetailPaneEntry(normalLabel("Const name:"), lblConstNameIndex = linkLabel(), lblConstNameIndexVerbose = highlightLabel()); } public void show(TreePath treePath) { EnumElementValue eeve = (EnumElementValue) ((BrowserTreeNode)treePath.getLastPathComponent()).getElement(); constantPoolHyperlink(lblTypeNameIndex, lblTypeNameIndexVerbose, eeve.getTypeNameIndex()); constantPoolHyperlink(lblConstNameIndex, lblConstNameIndexVerbose, eeve.getConstNameIndex()); super.show(treePath); } }
Q: Numpy remove duplicate columns with values greater than 0 I've the following array. array([[ 0, 0, 0, 0, 0, 3], [ 4, 4, 0, 0, 0, 0], [ 0, 0, 0, 23, 0, 0]]) I am looking to find the unique values column wise such that my result is. array([[ 0, 0, 0, 0, 3], [ 4, 0, 0, 0, 0], [ 0, 0, 23, 0, 0]]) The unique should only be applied to columns without 0 values i.e all columns which has 0 as their value should remain. Also I've to make sure that the indices of the columns is not changed. They remain at their place. I've already tried the following. np.unique(a,axis=1, return_index=True) But this gives me (array([[ 0, 0, 0, 3], [ 0, 0, 4, 0], [ 0, 23, 0, 0]]), array([2, 3, 0, 5])) There are two problems in this result. The column indices are moved and the columns with only 0 values are also merged. A: This will accomplish what you want: import numpy as np import pandas as pd x = np.array([[ 0, 0, 0, 0, 0, 3], [ 4, 4, 0, 0, 0, 0], [ 0, 0, 0, 23, 0, 0]]) df = pd.DataFrame(x.T) row_sum = np.sum(df, axis=1) df1 = df[row_sum != 0].drop_duplicates() df0 = df[row_sum == 0] y = pd.concat([df1, df0]).sort_index().values.T y array([[ 0, 0, 0, 0, 3], [ 4, 0, 0, 0, 0], [ 0, 0, 23, 0, 0]]) By summing the columns (or the rows after transposing) you can identify which ones contain all zeros, and filter them out before dropping the duplicates. Then you can re-combine them and sort by the index to get the desired output.
Refrigerator Drawers Handy and Expensive Many of us could use the space an extra refrigerator in the kitchen would provide. I have a spare freezer in the garage, but when I’m cooking for holidays or other large gatherings, my large fridge bursts to overflowing. I have even stored food for neighbors who have the same dilemma. If you don’t need a lot of storage space and can spare a cupboard or two, a refrigerator drawer might be right for you. A refrigerator drawer is just what it sounds like- a fridge that fits under the counter and pulls out like a drawer. They can be installed near a prep sink, making them just right for fresh produce. At consumerreports.org , they offer a complete look at some brands, pointing out both pros and cons. Refrigerator drawers provide not only additional storage space but also some conveniences. If you have young children, for example, you can stow snacks in an easy-to-access spot. Or, when you’re prepping for that big dinner party, you can keep your fresh ingredients at hand. And on the KitchenAid Superba ($2,500), you can place one drawer at a standard refrigerator temperature and the other at a “pantry” setting of up to 60° F. This would allow you, for example, to chill beer, white wine, and other beverages for your gathering in the bottom drawer and store root vegetables in the top. (All five tested models have two drawers.) Other upsides are on the design front. Refrigerator drawers don’t eat up much floor space: On average, the units we tested are 35 inches high (they’ll fit below a standard-height counter) and 24 inches deep (matching the standard depth of base cabinets). Three models are 24 inches wide (same as a typical dishwasher), the other two, 27. And, as with many other fridges, they can fit in with the kitchen décor. All five models are available with a stainless-steel look, and the Sub-Zero 700BR ($3,200) can be fitted with a panel to match the finish of cabinets. But you’ll pay dearly for those limited benefits. The tested models cost an average of $2,500 (prices range from $1,800 to $3,200) for what we measured as only about 4 cubic feet of usable fridge capacity (none of the models has a freezer). What’s more, while fridge drawers cost little to run (about $32 to $42 a year), they’re far less energy-efficient than any type of full-sized refrigerator in our Ratings, scoring poor in our calculations. Some other drawbacks: The Marvel 60RD ($2,500) has no bins, dividers, or shelves, and its controls are inside the top of the front frame, requiring you to open the top drawer much of the way to access them. And the U-Line Echelon ($2,500) is not equipped with an on/off switch. To unplug the unit, you need to pull the fridge out from the wall. So far, we lack repair data for refrigerator drawers. A different solution to the problem, though possibly not as attractive, is to purchase a small freestanding refrigerator, or even a portable one that can be plugged in on an as-needed basis. Or, there’s always the neighbors… Comments Wow, what they don’t come up with these days, if only you’re rich enough to buy em!! If I had the money to spend, I imagine a discreetly placed mini-fridge would be more effective. You could even hide it inside a cabinet… APD is a high end appliance dealer in Culver City, on the west side of Los Angeles. They specialize in high end appliances at competitive prices with excellent design and consulting services as part of the mix. Their brands include Miele, Viking, Thermador and Sub-Zero. Where to find them: 8644 Washington Boulevard Culver City, CA 90232-7442 (323) 870-5806 gotoapd.com
Entangled complexity: why complex interventions are just not complicated enough. The shift of health care burden from acute to chronic conditions is strongly linked to lifestyle and behaviour. As a consequence, health services are attempting to develop strategies and interventions that can attend to the complex interactions of social and biological factors that shape both. In this paper we trace one of the most influential incarnations of this 'turn to the complex': the Medical Research Council (MRC) guidance on developing and evaluating complex interventions. Through an analysis of the key publications, and drawing on social scientific approaches to what might constitute complexity in this context, we suggest that such initiatives need to adjust their conceptualisation of 'the complex'. We argue that complexity needs to be understood as a dynamic, ecological system rather than a stable, albeit complicated, arrangement of individual elements. Crucially, in contrast to the experimental logic embedded in the MRC guidance, we question whether the Randomised Controlled Trial (RCT) is the most appropriate method through which to engage with complexity and establish reliable evidence of the effectiveness of complex interventions.
In general, a high-functional cosmetic such as essence, eye cream, anti-aging agent, anti-wrinkle agent is highly expensive and accommodated in a compact cosmetic container. This cosmetic container simply includes a main container and a cap such that a user opens the cap closing an opening of the main container to discharge and apply the cosmetic on a desired spot on the skin. However, it is difficult for a user to control the discharged amount of the cosmetic and the expensive cosmetic as much as stained on hands is wasted. On this account, a spouting-type cosmetic container has been developed such that a user may extract a desired amount of cosmetic with a pipette (Spuit) to apply the extracted cosmetic to a desired spot on the skin. An existing spouting-type cosmetic container 10, as illustrated in FIG. 1, includes a main container 20 accommodating cosmetic therein and a cap unit 30 closing an opening 21 of the main container 20 and being associated with a pipette tube 33 to suction/discharging the cosmetic accommodated in the main container 20. The main container 20 has male threads 21a formed around the outer circumference of the opening 21 for the screw-coupling with the cap unit 30. The cap unit 30 includes a pipette tube (Spuit) 33 going in and out the main container 20 through the opening 21, a push button 35, and an elastic member 37 provided at the lower side of the push button 35. However, the existing spouting-type cosmetic container 10 is inconvenient to use because a user couples the cap unit 30 to the main container 20 and separates the push button 35 from the main container 20 by pushing and rotating the push button 35 once.
Q: Refrigerator on GFCI is tripping other AFCI breakers in the house This is going to sound really weird, but it has been going on for 6 years and the electricians that wired our house spent multiple days trying to figure it out before we found it was definitely the fridge, but no idea what or why. When we open the door on our fridge (a 6 yr old Whirlpool model #WRF736SDAM11 French Door) it occasionally trips another AFCI circuit in our house. The circuit it trips used to jump all over the place, but is pretty consistent on which breaker it throws these days. The electricians went over all of the lines that were tied to the fridge, and to the other breakers that were tripping, but found no faults. They replaced outlets, breakers, switches, the lot with no result. It only happens when opening the door of the fridge. I've read that the LED driver in this fridge could cause line noise, but I'm not sure how to verify that, and if so, how to go about resolving it. The fridge itself never trips the GFCI circuit it is on. A: Because it happens when you open the door, it is more than likely caused by the light. There seems to be a known issue affecting your Whirlpool WRF736SDAM11 refrigerator. Under limited, varying circumstances, the LED Driver Board may produce signal noise which can produce a false trip of an AFCI breaker. Correction: After verifying the refrigerator is supplied by an AFCI breaker, order Service Kit #W10810444 and install in accordance with instructions supplied with kit. Note: AFCI breakers are different than GFCI breakers. GFCI breakers are not affected. AFCI breakers are typically labeled “Arc Fault” (Figure 1) or “AFCI” (Figure 2) on the breaker face and have a test button. Service Pointer - W10806461 (Tripping of AFCI Breakers) (pdf) As for the whereabouts of the mentioned Service Kit #W10810444 - I've not been able to find an image for what it actually is. It is described as CORD-POWER but it will need to be something more to actually solve your problem. (some ebay results are just a simple wire cord - don't buy that). here's a link to one for sale and another Alternatively, you might be able to fix it by unplugging the LED in the fridge. This might not work - especially if the LED driver isn't actually on the same chip - but if it fixes your issue, you can be sure that your issue is related to the LED driver. If you are in a bind, you could just put a battery powered motion sensing light in the fridge to replace the built in one - not elegant but doable. Noise from electronics tripping AFCI breakers is rather common. I visited the Square D (Schneider) facility ~6 years ago. They had a room full of household electrical loads (ceiling fans, sump pumps, TVs) to test their breakers with. They said they once went to a guy's house and bought the $5,000 TV from him that was tripping his breaker so they could fix the issue and test improvements to the breaker design. That is to say one option is to replace the AFCI circuit breaker - they likely have a new and improved revision that won't be affected by the LED driver in your fridge. If you want, contact the manufacture of the breaker and inquire whether they can offer you a replacement, discount coupon or other resolution.
BARCELONA-REAL MADRID De los millones de aficionados que seguirán el Clásico por televisión, habrá uno muy especial. Se trata de la gran ausencia que tendrá el Real Madrid en sus filas respecto a los duelos contra el Barça de la última década: Cristiano Ronaldo. El crack de la Juventus seguirá desde Turín el encuentro de esta tarde en el Camp Nou entre su exequipo y el Barcelona (16:15 horas, beIN). Horas antes del partido, el crack portugués atendió a As para mandar un mensaje de apoyo al madridismo. Cristiano ya no es jugador blanco, pero eso no impide que desee lo mejor a sus excompañeros en el Clásico y confiese su cariño hacia el que fue su club hasta hace solo unos meses: “Tengo mucho respeto por el Barcelona, pero llevo al Real Madrid en el corazón. Por eso espero que el Madrid sea feliz en el partido de hoy”. Cristiano es el segundo máximo goleador de la historia de los Clásicos compartiendo ese honor con Alfredo Di Stéfano. Los dos jugadores más grandes de la historia del Madrid marcaron 18 goles en los duelos entre el Madrid y el Barcelona. En el caso del astro portugués, 12 de esos 18 goles marcados contra el Barcelona los logró en el Camp Nou, convirtiéndole así en el mayor azote azulgrana de la última década. Precisamente, en la última visita liguera del Madrid al feudo culé, el crack portugués marcó uno de los dos goles blancos en el empate 2-2 de la jornada 36.
A.A., C.F., L.A., and J.-L.C. contributed equally to this work. The burden of tuberculosis is not equally shared ================================================ Tuberculosis, an infectious disease caused by *Mycobacterium tuberculosis*, remains a leading public health problem worldwide. The global incidence of tuberculosis is rising, with ∼8.8 million new cases and 2 million deaths each year ([@bib1]). However, not all individuals exposed to *M. tuberculosis* become chronically infected. Epidemiological studies of tuberculosis in highly endemic countries indicate a consistent pattern of host stratification, with ∼20% of individuals retaining negative tuberculin skin tests throughout life, despite repeated exposure to the bacteria ([@bib2]). As an intrinsic, global impairment of delayed type hypersensitivity is improbable in all nonresponders, a substantial fraction of these individuals are likely to be naturally resistant to tuberculous infection. Moreover, progression to clinical tuberculosis is far from being an inevitable consequence of persistent infection by *M. tuberculosis*, as only an estimated 10% of infected individuals develop clinical disease. Another level of interindividual variability also exists; there are two major clinical forms of tuberculosis in endemic areas, which correspond to the two age-dependent epidemiological peaks of incidence ([Fig. 1](#fig1){ref-type="fig"}). In young children, tuberculosis is often disseminated due to early, hematogenous spread of the mycobacterium after primary pulmonary infection. In adults, the infection is often limited to the lungs and reflects the reactivation of latent tuberculosis from a silent primary infection. ![Mortality rates for disseminated tuberculosis (blue bars) and chronic pulmonary tuberculosis (red bars) per 100,000 untreated persons of various ages living in Bavaria in 1905 (adapted from references [@bib7] and [@bib28]). Note that there were too few deaths to accurately plot cases of pulmonary tuberculosis before the age of 20 and disseminated tuberculosis between the ages of 5 and 20 yr. These data relate to the natural history of tuberculosis in an endemic area before BCG vaccines and antimycobacterial antibiotics were available. Vaccination against and early diagnosis and treatment of tuberculosis in children may now have blurred the corresponding clinical phenotypes of tuberculosis, but not the underlying genotype. There are other forms of tuberculosis, with primary infection in adults and reactivation in late childhood. There is, however, clearly a "golden age" between the ages of 4 and 13 yr (reference [@bib6]).](20052302f1){#fig1} Predisposition to tuberculosis is largely inherited =================================================== Before Pasteur\'s groundbreaking microbial theory of disease, tuberculosis was suspected to reflect an intrinsic host disorder, often echoing familial predisposition. As Benjamin Marten described in 1720, "'Some persons are of such an happy constitution that if any of one of the inimical animals that causes consumption \[of the lungs\], happen to get into their bodies, they may likewise be quickly forced out again, through some of the emunctories, before they are produced into life; or else wholly destroyed'"(3). This "familial" hypothesis, suggested by the familial clustering of cases, gained favor by the end of the 18th century and dominated medical thinking for most of the 19th century ([@bib3], [@bib4]). However, Pasteur\'s microbial theory and Koch\'s subsequent identification of *M. tuberculosis* overturned such theories, which were based on anecdotal observations in the absence of epidemiological or experimental evidence. It was not until 1933 that rigorous genetic epidemiological studies provided strong evidence for the contribution of genetic factors to tuberculosis, with higher concordance rates of tuberculosis observed among monozygotic than dizygotic twin pairs ([@bib4], [@bib5]). In addition, although it was long known that the incidence of tuberculosis was particularly high in newly exposed populations ([@bib6]), this observation was poorly understood. A genetic interpretation of this observation was provided when the ancestors of susceptible individuals, unlike those of resistant individuals living in the same environment, were found to be more likely to have originated from tuberculosis-free areas ([@bib7]). Immunodeficiencies favor the development of tuberculosis ======================================================== The first molecular evidence that a predisposition to tuberculosis might reflect inborn errors of immunity was provided by the occurrence of overwhelming tuberculosis in children with rare, severe primary immunodeficiencies (PIDs) ([Table I](#tbl1){ref-type="table"}) ([@bib8], [@bib9]). Disseminated disease in children with PIDs is often caused by widespread, weakly virulent mycobacteria, such as bacillus Calmette-Guerin (BCG) vaccines and environmental mycobacteria (EM). In contrast, bona fide tuberculosis caused by virulent *M. tuberculosis* has been reported more rarely in these children. To date, one child with severe combined immunodeficiency, two children with X-linked hyper IgM syndrome, and one child with anhidrotic ectodermal dysplasia with immunodeficiency have been diagnosed with tuberculosis ([Table I](#tbl1){ref-type="table"}) ([@bib8]). The rarity of these patients may be a mere consequence of the fortuitous occurrence of tuberculosis and immunodeficiency, but more probably reflects the lower levels of exposure to *M. tuberculosis*. Supporting this view, a large proportion of children (∼35%) with chronic granulomatous disease (CGD), a less severe PID, were diagnosed with severe tuberculosis in two endemic areas ([@bib10], [@bib11]). The high predisposition to tuberculosis conferred by CGD established a causal link between human genes and tuberculosis. This suggested that predisposition to tuberculosis in other children may also reflect Mendelian inborn errors of immunity. However, this issue is complicated by the fact that children with these PIDs also suffer from multiple opportunistic infectious diseases, unlike most other children with the common form of tuberculosis. ###### Tuberculosis in children with Mendelian inborn errors of immunity ------------------------------------------------------------------------------------------------ Inherited defect No.\ Age at\ Country\ Reference of patients disease onset of origin ------ ------------------ ------------- --------------- ----------- ---------------------------- PID SCID 1 NA Australia cited in ([@bib8]) HIGM 2 15,33 NA, Japan cited in ([@bib8]) EDA-ID 1 1.7 NA cited in ([@bib8]) CGD 6 1.5--7.5 Hong Kong Lau et al. ([@bib10]) CGD 13 NA Iran Movahedi et al. ([@bib11]) MSMD complete IFN-γR1 1 12 Turkey Dorman et al. ([@bib29]) partial IFN-γR1 1 3 Japan Sasaki et al. ([@bib30]) IL-12p40 1 2.5 Turkey Picard et al. ([@bib31]) MST partial IFN-γR1 1 3 Portugal Jouanguy et al. ([@bib17]) IL-12Rβ1 1 18 Morocco Altare et al. ([@bib14]) IL-12Rβ1 2 5,12 Spain Caragol et al. ([@bib15]) IL-12Rβ1 1 11 Turkey Ozbek et al. ([@bib16]) ------------------------------------------------------------------------------------------------ Severe combined immunodeficiency (SCID), hyper IgM syndrome (HIGM), anhidrotic ectodermal dysplasia with immunodeficiency (EDA-ID), and chronic granulomatous diseases (CGDs) are conventional primary immunodeficiencies (PIDs) associated with multiple infectious diseases. The syndrome of Mendelian susceptibility to mycobacterial diseases (MSMDs) is associated with clinical disease caused by poorly virulent mycobacteria, such as BCG vaccines and environmental mycobacteria, in otherwise healthy patients. Complete and partial interferon-γ receptor 1 (IFN-γR1) deficiency, complete interleukin (IL)-12 p40 deficiencies, and complete IL-12 receptor β1 (IL-12Rβ1) deficiency are genetic etiologies of MSMD. The syndrome of Mendelian susceptibility to tuberculosis (MST) is defined by the occurrence of clinical tuberculosis in children apparently resistant to other infectious agents, including poorly virulent mycobacteria. Two genetic etiologies of MSMD were also found to be associated with MST. Some information was not available (NA). The syndrome of Mendelian susceptibility to mycobacterial diseases ================================================================== Further progress in the understanding of the genetic basis of tuberculosis was achieved from 1996 onwards, with studies of the syndrome known as Mendelian susceptibility to mycobacterial diseases (MSMD) ([@bib12]). Patients with MSMD are particularly susceptible to weakly virulent mycobacteria (BCG and EM) but are resistant to most other infectious agents, with the exception of *Salmonella*. In the last decade, germline mutations have been found in five MSMD-causing genes (*IFNGR1*, *IFNGR2*, *STAT1*, *IL12B*, *IL12RB1*). These genes encode proteins that are involved in interleukin (IL)-12/23--dependent, interferon (IFN)-γ--mediated immunity. Extensive allelic heterogeneity at these loci accounts for the existence of twelve distinct genetic disorders responsible for MSMD, which were diagnosed in \>300 patients worldwide in \<10 yr, mostly in nonendemic areas. Three MSMD patients with BCG- and/or EM-induced disease, living in endemic areas, also developed bona fide tuberculosis. These patients, who had deficiencies in IFN-γR1 or IL-12p40 expression, developed tuberculosis between the ages of 2.5 and 12 yr ([Table I](#tbl1){ref-type="table"}). As these patients suffered from both tuberculosis and mycobacterial disease caused by the weakly virulent BCG or EM species, it remained unclear whether common cases of tuberculosis alone may also be attributable to a Mendelian predisposition. Mendelian susceptibility to tuberculosis in children: a novel concept ===================================================================== Intriguingly, IL-12Rβ1 deficiency showed incomplete penetrance for the case-definition phenotype of MSMD ([@bib13]), as not all individuals with this deficiency were susceptible to BCG and EM disease. Moreover, in children from three unrelated families, IL-12Rβ1 deficiency was found to be associated with culture-proven severe tuberculosis as the sole infectious phenotype ([@bib14]--[@bib16]) ([Table I](#tbl1){ref-type="table"}). In one family, an IL-12Rβ1--deficient patient developed abdominal tuberculosis ([@bib14]). She had been vaccinated three times with BCG with no adverse effects, whereas her brother, who was also deficient for IL-12Rβ1, developed BCG disease after immunization. In another family, an IL-12Rβ1--deficient girl developed disseminated tuberculosis ([@bib15]). Her IL-12Rβ1--deficient sister had a history of nontyphoidal extraintestinal salmonellosis and, despite prophylactic treatment with isoniazid, also developed tuberculosis. Finally, a girl with IL-12Rβ1 deficiency, but no relevant personal or familial history of mycobacteriosis or salmonellosis, developed disseminated tuberculosis ([@bib16]). These cases of severe tuberculosis in children with IL-12Rβ1 deficiency provided proof-of-principle that tuberculosis can be a Mendelian disease. Mendelian predisposition to tuberculosis is not limited to IL-12Rβ1 deficiency, however, as one child with a partial IFN-γR1 deficiency suffered from tuberculosis ([@bib17]). These observations raise the possibility that a substantial proportion of children worldwide who have disseminated tuberculosis have a Mendelian predisposition to disease ([@bib18]). Bayesian estimation of the frequency of Mendelian tuberculosis in endemic areas =============================================================================== In an attempt to calculate the frequency of Mendelian tuberculosis, we estimated the expected proportion of Mendelian cases of disseminated tuberculosis among children: P(Mendel/cTB). Direct application of Bayes\' theorem for calculating conditional probabilities gives the following equation: $$\documentclass[10pt]{article} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{pmc} \usepackage[Euler]{upgreek} \pagestyle{empty} \oddsidemargin -1.0in \begin{document} \begin{equation*}{\mathrm{P}} \left \left({\mathrm{Mendel}}|{\mathrm{cTB}}\right) \right =\frac{{\mathrm{P}} \left \left({\mathrm{cTB}}|{\mathrm{Mendel}}\right) \right {\cdot}{\mathrm{P}} \left \left({\mathrm{Mendel}}\right) \right }{{\mathrm{P}} \left \left({\mathrm{cTB}}\right) \right }\end{equation*}\end{document}$$where P(cTB) is the cumulative incidence of disseminated tuberculosis by the age of 14 yr, P(Mendel) is the frequency of individuals carrying the relevant Mendelian mutations (all mutations predisposing to Mendelian tuberculosis), and P(cTB/Mendel) is the cumulative incidence of disseminated tuberculosis among these individuals (the cumulative penetrance). Based on epidemiological data, P(cTB) can be estimated at 2 × 10^−4^. We varied P(Mendel) from 10^−5^ to 10^−4^ and P(cTB/Mendel) from 0.5 to 0.9, based on past genetic reports ([@bib12], [@bib13]). Remarkably, the estimated proportion of Mendelian cases of disseminated tuberculosis (P\[Mendel/cTB\]) ranges from 3 to 45% ([Fig. 2](#fig2){ref-type="fig"}). It may seem provocative to suggest that almost half the children with disseminated tuberculosis might display a Mendelian predisposition. However, this high estimate is based on realistic assumptions: P(Mendel) = 10^−4^ and P(cTB\|Mendel) = 0.9. It therefore seems likely that a substantial fraction of children suffering from tuberculosis have a Mendelian predisposition. This prediction is experimentally testable, by investigating groups of children with tuberculosis living in endemic areas. ![Bayesian estimation of the rate of Mendelian predisposition to disseminated tuberculosis in childhood in endemic areas. The x axis corresponds to P(Mendel), the y axis corresponds to P(cTB/Mendel), and the z axis corresponds to P(Mendel/cTB) (see "Bayesian estimation of the frequency..."). As an example, assuming P(Mendel) = 0.0001 and P(cTB/Mendel) = 0.5, the estimated proportion of Mendelian cases among children with disseminated tuberculosis is P(Mendel/cTB) = 0.25.](20052302f2){#fig2} Complex genetic predisposition to tuberculosis in adults ======================================================== Pediatric and adult tuberculosis differ markedly in epidemiological features (two distinct peaks of incidence), clinical appearance (disseminated versus pulmonary disease), and pathogenesis (primary infection vs. reactivation). These differences probably reflect differences in immunological and genetic control ([Fig. 1](#fig1){ref-type="fig"}). More genetic studies have focused on adult than on childhood tuberculosis but with less success. No adults with Mendelian tuberculosis have yet been reported, and no major susceptibility locus has been identified by genome-wide linkage studies ([@bib19]). In addition, few studies reporting associations between human genes and adult tuberculosis have been reproduced (for review see reference [@bib12]). The most convincing associations to date were obtained with the *natural resistance-associated macrophage protein 1* (*NRAMP1,* alias *SLC11A1*) gene, the human orthologue of the murine *Nramp1* gene. This gene encodes a membrane transporter protein that depletes phagosomes of divalent cations that are essential for the intraphagosomal survival of some mycobacterial species. The *NRAMP1* region was also found to be linked with tuberculosis during an outbreak in a Canadian aboriginal community ([@bib20]). However, although this and other studies suggest that complex human genetic factors (*NRAMP1* alleles in particular) may be involved in susceptibility to pulmonary tuberculosis in adults, the associations are weak, and causal relationships between genotypes and phenotypes have not been demonstrated. A common *MCP1* allele confers a high attributable risk ======================================================= A study published in this issue reveals an important new genetic link to pulmonary tuberculosis in adults ([@bib21]). In this study, Flores-Villanueva et al. identify a polymorphism in the promoter region of the gene encoding the chemokine monocyte chemoattractant protein--1 (MCP-1) that confers susceptibility to pulmonary tuberculosis in Mexican adults. This polymorphism is characterized by an adenine (A) to guanine (G) change at position −2518 of the *MCP1* promoter. The results of the study are reported in terms of odds ratio (OR), which is a valid estimate of the relative risk (the risk of developing tuberculosis according to genotype) when the disease prevalence is low (typically \<10%). The ORs of tuberculosis among individuals with AG and GG versus AA genotypes were estimated at 2.3 and 5.4, respectively. This means that individuals homozygous for the G allele were approximately five times more likely to develop tuberculosis than those homozygous for the A allele. The GG genotype is associated with an increase in MCP-1 production, which leads to decreased production of IL-12, a key antimycobacterial cytokine ([@bib12]), providing a possible explanation for the observed increased susceptibility to tuberculosis. The *MCP1* susceptibility allele is very common (occurring in ∼50% of the Mexican population), giving an estimated attributable risk as high as 64% in this population ([@bib22]). In other words, if the −2518G *MCP1* polymorphism were the only risk factor for tuberculosis among exposed individuals in Mexico (which is unlikely), the incidence of disease would be 64% lower in the absence of the G allele. This association was also found in a South Korean population ([@bib21]). However, this *MCP1* allele was previously reported not to be associated with tuberculosis in a Brazilian cohort ([@bib23]). Nevertheless, this study reports the most substantial impact ever described of a human allele on adult tuberculosis at the population level. From complex to Mendelian inheritance (and back again) ====================================================== Common alleles that predispose adults to pulmonary tuberculosis provide candidate genes (such as *MCP1*) for the study of Mendelian tuberculosis in childhood. Conversely, MSMD-causing genes (such as *IL12RB1*) are candidate genes for complex predisposition to tuberculosis in adults. Allelic heterogeneity (allelic variations at a given locus) may account for the age-dependent clinical heterogeneity of tuberculosis. Alternatively, nonallelic heterogeneity may be involved, as the pools of genes that govern immunity to primary and latent mycobacterial infections may not overlap. In any event, disseminated tuberculosis seems to reflect Mendelian predispositions in a fraction of children, whereas adult pulmonary disease seems to reflect a more complex genetic predisposition. However, these modes of inheritance are artificially separated because modifier genes have a profound impact on the expression of Mendelian traits. In addition, major genes, which are genes whose common polymorphisms exert an effect strong enough to be detected in segregation studies and/or genome-wide linkage scans, may exert an almost Mendelian impact ([@bib9]). Moreover, Mendelian and complex predispositions are not mutually exclusive in either age group, as suggested by the recent description of *NRAMP1* susceptibility alleles in children with tuberculosis ([@bib24]). Johann Gregor Mendel, the father of genetics, and Francis Galton, the father of biometrics, were ignorant of each other\'s work, although both were born in 1822 and lived in Europe ([@bib25]). Most barriers of communication have since fallen, and research on tuberculosis has benefited from the combined efforts of molecular and population geneticists. From the microbial to the genetic paradigm ========================================== The idea that even seemingly noncontagious diseases may be infectious, as highlighted by the relationship between *Helicobacter pylori* and gastric ulcers, has become a dominant paradigm in medicine. However, microbes, including *M. tuberculosis*, are necessary but not sufficient for the development of infectious disease. This novel idea was clearly expressed by Louis Pasteur himself when he described the two diseases of silk worms (pebrine and flacherie) that provided the experimental basis for his microbial theory ([@bib26]). He found that the pebrine disease was apparently purely infectious, whereas flacherie was both infectious and hereditary, with only certain silkworm strains being vulnerable. Pasteur, who was also born in 1822, never heard of Mendel but explicitly spoke of "flacherie héréditaire" and added that "'it is not the microbe that is transmitted from the parents to the offspring, but the predisposition to disease'" ([@bib26]). The considerable success of Pasteur\'s microbial theory overshadowed his own audacious conception of the ecology and heredity of infectious diseases ([@bib26], [@bib27]). The genetic theory of infectious diseases has recently benefited from interactions between different disciplines ([@bib18]). There is a continued need to reconsider infectious diseases to ensure the timely development of novel preventive and curative treatments (<http://www.nap.edu/catalog/11471.html>). Vaccines that specifically protect genetically predisposed individuals against infection and immunomodulatory drugs that restore impaired immunity are needed to circumvent the inevitable spread of antibiotic-resistant pathogens, including *M. tuberculosis*. We thank E. Schurr, J. El Baghdadi, S. Dupuis-Boisson, D. Nolan, N. Remus and all members of the laboratory of Human Genetics of Infectious Diseases for helpful discussions. The laboratory is supported by grants from the INSERM, Agence Nationale de la Recherche, March of Dimes, and Foundation BNP-Paribas. A.A. is supported in part by a grant from Assistance-Publique-Hôpitaux de Paris. J.-L.C. is an International Scholar of the Howard Hughes Medical Institute. [^1]: CORRESPONDENCE J.-L.C.: <casanova@necker.fr>
The purpose of this project is to investigate the nervous control of secretion from the submucosal glands of the canine trachea using a new in vivo method to isolate and quantitate submucosal gland fluid secretion. I will use this new technique to study the nervous pathways and reflex mechanisms involved in the control of submucosal gland secretion into the canine airway. I will also collect submucosal gland fluid using micropuncture techniques and measure the electrolyte and protein content of the fluid. I will correlate any changes which occur in the concentrations of electrolytes and proteins with nervous stimuli. I will also try to correlate changes in electrolyte concentrations in the fluid with my previous investigations of active ion transport and electrical properties in the canine tracheal epithelium.
[Revision of the European pharmaceutical legislation]. In accordance with the Regulation N 2309/93/EC, the Commission shall produce a synopsis of European registration operating procedures no later than 2001. On July 18, 2001, after a wide open consultation, the College of Commissioners adopted a Proposed Revision elaborated by the "DG Enterprises". This Proposed Revision was guided by the desire to facilitate access of citizens of the European Union to innovating and safe medications, to limit fragmentation of the interior market, prejudicial to the community pharmaceutical industry, and to prepare widening of the community. This synopsis focused essentially on registration procedures and pharmacovigilance, on patient information, on reform of the European agency for administrative protection of recorded data. The Proposed Revision is following the codecision procedure and should come into force, in a more or less amended form, at the end of 2004 at the latest.
Q: Ext JS Message Box Position I have a very 'long' screen and apparently when I am using the Ext JS 3.3.1 messagebox, it goes all the way to the bottom and removed everything in the background. This is some example code: Ext.Msg.show({ title:'[SOME TITLE]', msg: '[SOME MESSAGE]', buttons: Ext.Msg.YESNO, fn: function (btn){ if(btn=='yes'){ //Do something } } }, icon: Ext.Msg.QUESTION} ); A: So you want to set only the Y position of your MessageBox? Do this: var msg=Ext.Msg.show({ title:'[SOME TITLE]', msg: '[SOME MESSAGE]', buttons: Ext.Msg.YESNO, fn: function (btn){ if(btn=='yes'){ //Do something } } }); msg.getDialog().getPositionEl().setTop(50); //this is enough for Y position only Using setPosition do this: msg.getDialog().setPosition(undefined,50) I used 50 pixels in this example because that's near the top. You can set it to something else from the top. A: try this Ext.MessageBox.show({ msg: 'Saving your data, please wait...', progressText: 'Saving...', width:300, wait:true, waitConfig: {interval:200}, icon:'ext-mb-download', //custom class in msg-box.html animEl: 'mb7' });
Saint Helena football team The Saint Helena football team is a representative football team of Saint Helena, organised by the Saint Helena Football Association. The team is not affiliated with any confederation or FIFA. History The team made its international debut in June 2019 when participating in the 2019 Inter Games Football Tournament. Results Saint Helena's score first. Current squad The following players have been called up for the 2019 Inter Games Football Tournament. |- ! colspan="9" style="background:#b0d3fb; text-align:left;"| |- style="background:#dfedfd;" |- ! colspan="9" style="background:#b0d3fb; text-align:left;"| |- style="background:#dfedfd;" |- ! colspan="9" style="background:#b0d3fb; text-align:left;"| |- style="background:#dfedfd;" References Category:National sports teams of Saint Helena Category:Football in Saint Helena
Polur Varadhan Polur M. Varadhan (25 February 1952 – 27 January 2011) was an Indian politician and Member of the Legislative Assembly of Tamil Nadu. He was elected to the Tamil Nadu legislative assembly from Chengam constituency as an Indian National Congress candidate in 2001, and 2006 elections and from Sriperumbudur constituency in 1991 election. Personal life Varadhan was born in Keezhkarikkathur village in Polur Taluk in Tiruvannamalai district in Tamil Nadu on 25 February 1952. He died in Chennai on 27 January 2011 due to an unreported liver illness. He is survived by his wife Prema and a son named Rajiv. References Category:1951 births Category:2011 deaths Category:Members of the Tamil Nadu Legislative Assembly Category:Indian National Congress politicians from Tamil Nadu Category:People from Tiruvannamalai district Category:Members of the 10th Tamil Nadu Legislative Assembly
Q: Why say "שבת היא מלזעוק"? Shulchan Aruch, Orach Chayim 287: יכולים לנחם אבלים בשבת וכן יכולים לבקר את החולה ולא יאמר לו כדרך שאומר לו בחול אלא אומר לו שבת היא מלזעוק ורפואה קרובה לבא ורחמיו מרובים ושבתו בשלום הגה וי״א דאין צריך לומר ורחמיו מרובים וכו׳ וכן נהגו. ‏ If I understand it correctly, this means: One may console mourners on Shabas, and one may likewise visit the sick. But he should not say to him as he does on a weekday, telling him rather "It is Shabas, preventing crying out; healing is soon to come; His mercies are great; spend Shabas in peace". Hagaha: But some say it's unnecessary to say "His mercies are great", etc., and [omitting it] is the custom. Indeed, the prevalent custom when wishing sick people well on Shabas is to say "שבת היא מלזעוק ורפואה קרובה לבא / It is Shabas, preventing crying out; healing is soon to come", as prescribed. What's the point of saying "שבת היא מלזעוק / It is Shabas, preventing crying out"? Why not just say "רפואה קרובה לבא / healing is soon to come" as a way of obliquely praying for the patient, if that's the purpose of speaking? What does saying "שבת היא מלזעוק / It is Shabas, preventing crying out" accomplish, and how does it do so? A: The Gemara in Shabbos 113a–b interprets the passuk in Yishaya 58 ודבר דבר - שלא יהא דבורך של שבת כדבורך של חול. דבור - אסור, הרהור - מותר Your manner of speech on shabbos should not be the same as the week. speech is forbidden, but thinking is permitted. Rashi says it means no discussing business: שלא יהא דבורך של שבת כדבורך של חול — כגון מקח וממכר וחשבונות. Tosfos disagrees with Rashi, and say the point is reduce the amount of talking altogether. Tosfos quotes the Yerushalmi, that “they barely permitted greeting people on Shabbat”: שלא יהא דבורך של שבת כדבורך של חול — פי' בקונטרס כגון מקח וממכר ואין נראה לר"ת דהא כבר נפקא ממצוא חפצך אלא אומר ר"ת כדאמר בויקרא רבה (פ' לד) ר"ש בן יוחי הוה ליה אימא סבתא דהות מישתעיא סגיא אמר לה אימא שבתא הוא שתקה משמע שאין כל כך לדבר בשבת כמו בחול ובירושל' אמרי' בטורח התירו בשאלת שלום בשבת. The Shulchan Aruch codifies this with a short, with a focus on not discussing business, and the Rema cites the Terumas Ha'Deshen (307:1): ודבר דבר (ישעיה נח, יג): שלא יהא דבורך של שבת כדבורך של חול; הלכך אסור לומר: דבר פלוני אעשה למחר או סחורה פלונית אקנה למחר, ואפילו בשיחת דברים בטלים אסור להרבות. הגה: וב"א שסיפור שמועות ודברי חדושים הוא עונג להם, מותר לספרם בשבת כמו בחול; אבל מי שאינו מתענג, אסור לאומרם כדי שיתענג בהם חבירו (ת"ה סי' ס"א). Says Rav Herschel Schachter that although technically there is no problem with being Mevaker a Choleh or being Menachem Avel, however, because inevitably you will come to discuss things that are Divrei Chol (ie. Details of the sickness, the details of the death) you should add or change when saying either Hamakom Yenachem Eschem or Refuah Shleima one must add "Shabbos Hi M'liztok U'refuah Krova Lavo" for health and "Shabbos Hi L'Nachem" for a mourner, as if to say that although we shouldn't visit Hashem should give you.
{"currencyCode":"CAD","itemData":[{"priceBreaksMAP":null,"buyingPrice":9.49,"ASIN":"1423106865","isPreorder":0},{"priceBreaksMAP":null,"buyingPrice":9.49,"ASIN":"1423133080","isPreorder":0},{"priceBreaksMAP":null,"buyingPrice":9.49,"ASIN":"1423119916","isPreorder":0}],"shippingId":"1423106865::siVLIc3tJ1Ls8GeJF9D9UQ8mTKLOuaGmrDVh7D%2F3Nfo9Qk10UmjSzr5ool5cMzW1zVfSWrFkQjBr%2BcGzARlrNHHGCgoKWE3D,1423133080::Zz4i0SMpL7U540OcVzEhj9w4Ju%2BkBF9AV%2F%2F3p%2By0jyVmXF2Ir2gMmvnjZV1ZN5mGCUiMV12iq0lUUEz5WbZzutWG07pfr2qAspv7vUhehko%3D,1423119916::VqpGWUCilFlQdaE81e94fp8dWEfUFF3lCv%2FH9QDaZBooGqEYbyX%2BmafYk9KwjBCy%2BkhyM%2BHHgeMQ70odSIhjGo2PiCLcngIrhKSXQm2IXfE%3D","sprites":{"addToWishlist":["wl_one","wl_two","wl_three"],"addToCart":["s_addToCart","s_addBothToCart","s_add3ToCart"],"preorder":["s_preorderThis","s_preorderBoth","s_preorderAll3"]},"shippingDetails":{"xz":"same","xy":"same","yz":"same","xyz":"same"},"tags":["x","y","z","w"],"strings":{"addToWishlist":["Add to Wish List","Add both to Wish List","Add all three to Wish List","Add all four to Wish List"],"addToCart":["Add to Cart","Add both to Cart","Add all three to Cart","Add all four to Cart"],"showDetailsDefault":"Show availability and shipping details","shippingError":"An error occurred, please try again","hideDetailsDefault":"Hide availability and shipping details","priceLabel":["Price:","Price For Both:","Price For All Three:","Price for all four:"],"preorder":["Pre-order this item","Pre-order both items","Pre-order all three items","Pre-order all four items"]}} Product Description Review From easy reader and chapter book series to epic fantasies, favorite characters, settings and story lines reemerge in new additions. Young readers will welcome the return of Mo Willems's pessimistic pachyderm and spirited pig. In There Is a Bird on Your Head! Gerald the elephant despairs over a family of birds that nests atop his cranium, while Piggie is delighted. And in I Am Invited to a Party! party expert Gerald helps Piggie prepare for all possibilities, as they get dressed for a fancy party, pool party and costume party-all at the same time.—PW It helps to have a best friend when you run into trouble, whether it's the what-to-wear-to-a-party kind or the wildlife-on-your-head variety. Like the first two entries in this beginning reader series (My Friend Is Sad and Today I Will Fly!, rev. 5/07), each of these books features a simple story told entirely through speech balloons and Willems's emotive pig and elephant characters. The animated illustrations will help new readers decode tone and meaning while the spare dialogue enhances the pictures' slapstick humor. High-spirited Piggie has never been to a party; when she receives her first invitation, neurotic Gerald takes charge of their attire. "I know parties," he claims, but Piggie and young readers may have doubts about that when Gerald insists they dress for "a fancy pool costume party." In the end, Gerald proves to be savvier than he and Piggie look. In the second book, two "love birds" make a nest on Gerald's head. Cause enough for panic, but when their three eggs hatch (in record gestation time), hysteria ensues. Luckily, Piggie has a good head on her shoulders. The minimalism of both the text and the uncluttered pictures focuses readers' attention and moves the stories forward. Party on, Elephant & Piggie!—Horn Book Beginning readers familiar with Willems's books will recognize his distinctive humor and illustrative style in these stories. When Piggie receives her first invitation to a party, she asks Gerald to join her and relies on his advice because he "knows" parties in order to prepare for the big event. The elephant, however, has a tendency to overanalyze, so he prepares them both for any contingency a fancy/pool/costume party. Piggie's expressive features show her questions about their attire, but the friends set off bedecked in flippers, masks, top hat, pearl earrings, cowboy hat, and evening dress. Imagine her surprise when they find all the other guests as lavishly overdressed as they are. In the second title, Gerald learns that there are worse things than a bird on your head, namely, two love birds, a nest, and three hatchlings. With the help of Piggie, he is finally able to ask them to move, but, as the final page reveals, they have become her problem. Both books use speech bubbles gray ones for Gerald, pink for Piggie to tell the entire story. This feature is a nice touch that facilitates paired/choral readings. The conversation between the friends flows smoothly and allows beginning readers to practice expression as they read. These appealing titles will tickle the funny bones of children and are sure to become favorites.—SLJ About the Author Mo Willems is the author of groundbreaking picture books, including; Knuffle Bunny: A Cautionary Tale (Caldecott Honor winner 2004); Don't Let the Pigeon Drive the Bus! (Caldecott Honor winner 2003); Don't Let the Pigeon Stay up Late!; The Pigeon Finds a Hot Dog!; Time to Say "Please"!; Leonardo, the Terrible Monster; Edwina, the Dinosaur Who Didn't Know She Was Extinct. He also wrote Today I will Fly! and My Friend Is Sad, the first books in this series. In his previous life, Mo was a six-time Emmy Award winning writer and animator for Sesame Streetand the creator of Cartoon Network's Sheep in the BigCity. He lives with his family in Brooklyn, New York. Most helpful customer reviews It is very difficult to find an early reading book that can hold a child’s interest. Mo Willems rivals Dr. Suess in a charming sense of fun. His book does not rhyme, but instead has a single sentence, sometimes a single word, on each page. The vocabulary could be handled by children in early first grade. It is a large book, at 57 pages, but a quick read. It is the story of an elephant to has an unwanted bird, which expands to be two birds and a nest, on his head. The birds, elephant, and pig are simply drawn but the consternation of the elephant comes across clearly. The book is laugh out loud funny. There are several moments where children will pause to enjoy the humor. The ending is satisfying and silly. Children will enjoy reading and rereading this book. This book would be a cute Easter gift or springtime present for the beginning reader. Most Helpful Customer Reviews on Amazon.com (beta) Amazon.com: 169 reviews 40 of 42 people found the following review helpful Fun to read!Sept. 1 2007 By M. Noll - Published on Amazon.com Format: Hardcover There Is a Bird On Your Head! is my son's favorite of the Elephant and Piggie books! This whole series is great fun... my son loves the expressions on the faces of both characters. And, more importantly, HE wants to do the reading at bedtime because he has fun trying to match his reading to the expressions from the faces. And, we love looking for Pigeon on the back covers! I wish there were more of these books! 44 of 50 people found the following review helpful A Winner for My Avid Read Constantly (Just Not Books) SonOct. 4 2007 By Julie Jordan Scott - Published on Amazon.com Format: Hardcover My little boy reads everything with words on it... except, ofcourse, for books. He usually yells at me when I have the audacity to suggest we sit down and cuddle and read but this book was different. It was my first time reading anything by Mo Willems so I had no preconceived notions. What I found was very funny text on clean, simply illustrated pages without too many words on each page. YES! My six-year-old son has been reading (self taught) since he was four, but normally there is too much stuff going on in books with lots of detailed, color spread pages. This title had the perfect balance of white space without too many words and an enjoyable story that didn't talk down to a child who favors this style of book. I have never had him sit there and read through a whole book for me. He read this entire book and would have read it again. It felt like a miracle. Perhaps it was. Mo Willems, you have my heart. Sam and I will read more of your books! 31 of 34 people found the following review helpful Great book for new readers !!!Nov. 29 2007 By liz b. - Published on Amazon.com Format: Hardcover My first grader (who's been struggling with reading in general and lacking motivation) just read this book aloud to me and her little brother at bedtime and they were both laughing hysterically at the end. We'd taken the 4 books in this series out of the library, and when I suggested it was time for bed she literally begged me to read the other 3 RIGHT NOW, which we did.Few things make a parent prouder than hearing your child learn to read, except maybe when they finally get excited about it!We are all now Mo Willems fans! 15 of 16 people found the following review helpful unexpected great momentFeb. 22 2008 By Jacqlyn Cyr - Published on Amazon.com Format: Hardcover I happen to be waiting for exrays for my elderly mother and I happened to pick up this book and decided to make time pass quickly,so I began to read aloud to my mother (84yrs. old). Well, we both laughed wholeheartedly with each turn of the page. Even bystanders enjoyed it. So young or old, Mo touches the child in all of us.The humor was simple and well illustrated.I wish I had grandchildren to read to but I am sure going to get the entire collection, just in case, and in the meantime I will read to my favorite audience, Mom. Thanks for the moment! 10 of 10 people found the following review helpful Mo Willems should be declared a National Treasure!Sept. 18 2008 By Philip G. Traynor - Published on Amazon.com Format: Hardcover Mo Willems is a genius. These books work like a classic Warner Brothers cartoon; working on two levels simultaneously. There's simple sight-gag humor for the kids; and sly, subtle humor for the grownups. The sparse but extremely expressive artwork is a joy to behold and study. My 4 year old daughter encounterd this book in a library while on vacation this summer. We all find the book and all the others in the series to be excruciatingly funny! We read the books aloud; I play Gerald, and my daughter plays Piggie. (I also do any other minor characters) We read the dialogue in a huge, over-the-top, melodramatic fashion, doing our best Mel Blanc/Daws Butler impressions, and act out the physical bits where we can... She just dissolves into fits of hysterical laughter... We have all of the Piggie books now, and several of the "Pigeon" series too. I cannot recommend the works of Mo Willems highly enough!
[Bioelectrical properties and ultrastructure of vascular smooth muscle cells in tissue culture]. Intracellular recording was performed in tissue culture of the rabbit vena portae from the smooth muscle cells (SMC) with spontaneous discharges. In inactive SMC the dischartges could be elicited by hyperpolarizing current. The membrane potentials and the input impedance of the SMC decreased with the growth of osmolarity of extracellular medium. The cells were identified as those of smooth muscle on the ground of electronmicroscopic studies. Cellular contacts of nexus type existed between adjacent SMC.
Ben & Jerry’s is launching a new flavor, Pecan Resist, which the company made to promote activism in the U.S. The Limited Batch flavor – chocolate ice cream with white and dark fudge chunks, pecans, walnuts and fudge-covered almonds – is part of the company’s campaign to "lick injustice and champion those fighting to create a more just and equitable nation for us all," it said Tuesday. Ben & Jerry’s is donating $25,000 to each of four organizations working on behalf of people of color, Native Americans' environmental justice and women – Color Of Change, Honor the Earth, Women’s March and Neta. More:Forget lines: At Walmart, you can make purchases right where you are this holiday season More:Whopping 62 percent of jobs don't support middle-class life after accounting for cost of living More:Coca-Cola: Sprite lemonade, Minute Made veggie juice debuting next year The Burlington, Vermont-based business is using the new flavor to criticize some of President Donald Trump's recent pronouncements. "The company cannot be silent in the face of President Trump’s policies that attack and attempt to roll back decades of progress on racial and gender equity, climate change, LGBTQ rights and refugee and immigrant rights – all issues that have been at the core of the company’s social mission for 40 years," Ben & Jerry's said in a statement. The White House could not immediately be reached for comment. The ice-cream maker made the announcement in the National Press Club's First Amendment Room in Washington, D.C. Ben & Jerry's, which Unilever acquired in 2000, has used its sweet treats to promote its social justice agenda before. For example, Chubby Hubby became Hubby Hubby in 2009 to celebrate same sex marriage in Vermont, Chocolate Fudge Brownie was temporarily renamed Food Fight Fudge Brownie to support GMO labeling and EmpowerMint in 2016 was used to promote voting rights, the company said. A half-cup serving of Pecan Resist contains 300 calories, 20 grams of fat and 25 grams of sugar, according to the flavor's nutrition label. A quick note for flavor-watchers: Pecan Resist was previously called New York Super Fudge Chunk. The flavor is sold only at participating Ben & Jerry's scoop shops and through the company's website. Bay Area artist and activist Favianna Rodriguez designed the Pecan Resist pint. The carton reads, "Welcome to the resistance. Together, Pecan Resist!...We celebrate the diversity of our glorious nation & raise our spoons in solidarity for all Americans. Take a stand & join those on the front lines.” A URL on the package directs people to information about the four organizations to which Ben & Jerry's donated money. Dipayan Biswas, a University of South Florida professor of marketing, said the new flavor will foster loyalty from some customers and prompt others to boycott Ben & Jerry's – like what happened to Chick-fil-A in 2012 after CEO Dan Cathy spoke out against gay marriage. "Paradoxically, it makes good business sense. Brands, like politicians, often do well when they’re more polarizing," he said. "A lot of people hate them for that. That’s fine. They get loyalty from other segments." But Biswas said he doesn't know if the ice cream flavor will effect the change the company wants it to. "Research shows words have subliminal impact," he said. "When you see the brand name, in this case, it can subtly remind people of certain things. I'm not sure it will (inspire) action." Follow USA TODAY reporter Zlati Meyer on Twitter: @ZlatiMeyer
/* * NotebookDoc.java * * Copyright (C) 2020 by RStudio, PBC * * Unless you have received this program directly from RStudio pursuant * to the terms of a commercial license agreement with RStudio, then * this program is licensed to you under the terms of version 3 of the * GNU Affero General Public License. This program is distributed WITHOUT * ANY EXPRESS OR IMPLIED WARRANTY, INCLUDING THOSE OF NON-INFRINGEMENT, * MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Please refer to the * AGPL (http://www.gnu.org/licenses/agpl-3.0.txt) for more details. * */ package org.rstudio.studio.client.rmarkdown.model; import org.rstudio.studio.client.workbench.views.source.editors.text.rmd.ChunkDefinition; import com.google.gwt.core.client.JavaScriptObject; import com.google.gwt.core.client.JsArray; public class NotebookDoc extends JavaScriptObject { protected NotebookDoc() { } public final native JsArray<ChunkDefinition> getChunkDefs() /*-{ return this.chunk_definitions || []; }-*/; public final native RmdChunkOptions getDefaultOptions() /*-{ return this.default_chunk_options || {}; }-*/; public final native int getChunkRenderedWidth() /*-{ return this.chunk_rendered_width || 0; }-*/; public final native int getDocWriteTime() /*-{ return this.doc_write_time || 0; }-*/; // returns any manually specified working directory (i.e. from the knitr // root.dir option) public final native String getWorkingDir() /*-{ return this.working_dir || ""; }-*/; public final native void setChunkDefs(JsArray<ChunkDefinition> defs) /*-{ this.chunk_definitions = defs; }-*/; public final static String CHUNK_RENDERED_WIDTH = "chunk_rendered_width"; }
Q: Laravel 5.6 - Session is not persisting after it expires I have a very weird issue with my two of my local environments. Once my session expires due to not being refreshed for too long, a new session will be created as expected. However, if I am browsing on public site (which is not under Auth protection), the session will not persist and with each get/post request, it will be ignored and a new one will be created (I can see that on XRSF token and new file being created in storage/framework). Here are few scenarios: If no user is logged in, everything works fine. If admin user is logged in (with "Remember me" being checked), but public user is not, accessing any public (unprotected) route (which uses default web middleware) will recreate session as described above. However, once I access any route under admin middlware (web middleware + auth check), session will stick and after that, the issue for public route disappears. If both users are logged in and I access any protected route, session sticks immediately. I tried the following, without any success: reading and trying out suggestions from other threads remove all caches reinstalled XAMPP tried different browsers (same result for Chrome, Edge and freshly installed Firefox) setting SESSION_DOMAIN - this actually broke Edge, sessions stopped working altogether removed site cookies changed APP_URL and APP_NAME tried file and database drivers for session accessed site using XAMPP through VHost (e.g. http://mySite/) and through php artisan server made sure web middleware isn't applied twice to any route What resolves the issue: accessing protected page deleting cookies reopening browser Environments where I reproduced the issue: My PC Windows 10 Pro x64, build 1709 PHP 7.2.0 (XAMPP) My laptop Windows 10 Pro x64, build 1803 PHP 7.2.7 (XAMPP) Colleague's laptop macOS High Sierra 10.13.6 PHP 7.2.1 (MAMP) What probably does not cause the issue: file permissions my Laravel configuration (as I tried dozen of suggestions in similar threads) XAMPP or MAMP OS What might caused the issue: cookies (although I have no idea how) PHP settings Laravel (given the weird behavior in given scenarios, I cannot exclude this option yet) Here are some files that might be useful for you: .env APP_NAME=MySite APP_ENV=local APP_KEY=base64:dEoI03jGqlhIZS4om6sx7j7aFMmKEweJpN72PijsCTQ= APP_DEBUG=true APP_URL=http://mySite LOG_CHANNEL=stack DB_CONNECTION=mysql DB_HOST=localhost DB_PORT=3306 DB_DATABASE=mySite DB_USERNAME=root DB_PASSWORD=password BROADCAST_DRIVER=log CACHE_DRIVER=file SESSION_DRIVER=file SESSION_LIFETIME=120 QUEUE_DRIVER=sync REDIS_HOST=127.0.0.1 REDIS_PASSWORD=null REDIS_PORT=6379 MAIL_DRIVER=smtp MAIL_HOST=smtp.mailtrap.io MAIL_PORT=2525 MAIL_USERNAME=null MAIL_PASSWORD=null MAIL_ENCRYPTION=null PUSHER_APP_ID= PUSHER_APP_KEY= PUSHER_APP_SECRET= PUSHER_APP_CLUSTER=mt1 MIX_PUSHER_APP_KEY="${PUSHER_APP_KEY}" MIX_PUSHER_APP_CLUSTER="${PUSHER_APP_CLUSTER}" RouteServiceProvider.php <?php namespace App\Providers; use Illuminate\Support\Facades\Route; use Illuminate\Foundation\Support\Providers\RouteServiceProvider as ServiceProvider; class RouteServiceProvider extends ServiceProvider { /** * This namespace is applied to your controller routes. * * In addition, it is set as the URL generator's root namespace. * * @var string */ protected $namespace = 'App\Http\Controllers'; /** * Define your route model bindings, pattern filters, etc. * * @return void */ public function boot() { // parent::boot(); } /** * Define the routes for the application. * * @return void */ public function map() { $this->mapApiRoutes(); $this->mapPublicRoutes(); $this->mapOrganizationRoutes(); $this->mapVolunteerRoutes(); $this->mapAdminRoutes(); } /** * Define the "web" routes for the application. * * These routes all receive session state, CSRF protection, etc. * * @return void */ protected function mapAdminRoutes() { Route::middleware('admin') ->prefix("admin") ->namespace($this->namespace."\Admin") ->group(base_path('routes/admin.php')); } /** * Define the "web" routes for the application. * * These routes all receive session state, CSRF protection, etc. * * @return void */ protected function mapPublicRoutes() { Route::middleware('web') ->namespace($this->namespace) ->group(base_path('routes/public.php')); } /** * Define the "organization" routes for the application. * * These routes all receive session state, CSRF protection, etc. * It also contains auth protection and nav builder * * @return void */ protected function mapOrganizationRoutes() { Route::middleware('organization') ->prefix("organization") ->namespace($this->namespace . "\Organization") ->group(base_path('routes/organization.php')); } /** * Define the "volunteer" routes for the application. * * These routes all receive session state, CSRF protection, etc. * It also contains auth protection and nav builder * * @return void */ protected function mapVolunteerRoutes() { Route::middleware('volunteer') ->prefix("volunteer") ->namespace($this->namespace . "\Volunteer") ->group(base_path('routes/volunteer.php')); } /** * Define the "api" routes for the application. * * These routes are typically stateless. * * @return void */ protected function mapApiRoutes() { Route::prefix('api') ->middleware('api') ->namespace($this->namespace) ->group(base_path('routes/api.php')); } } routes/public.php <?php /* |-------------------------------------------------------------------------- | Web Routes |-------------------------------------------------------------------------- | | Here is where you can register public routes for your application. These | routes are loaded by the RouteServiceProvider within a group which | contains the "web" middleware group. Now create something great! | */ Route::get('/', "LandingController@getIndex"); Route::group(["prefix" => "/auth"], function () { Route::get('/logout/{guard}', 'Common\AuthController@getLogout')->name('logout.get'); Route::get('/login', 'Common\AuthController@getLogin')->name('login.get'); Route::post('/login', 'Common\AuthController@postLogin')->name('login.post'); Route::get('/register/{guard}', 'Common\RegistrationController@getRegister')->name('register.get'); Route::post('/register/{guard}', 'Common\RegistrationController@postRegister')->name('register.post'); Route::get("/register/success/{guard}", "Common\RegistrationController@getSuccess")->name("register.success.get"); }); Route::group(["prefix" => "admin/auth"], function() { Route::get("/login", "Admin\AuthController@getLogin")->name("admin.auth.login.get"); Route::post("/login", "Admin\AuthController@postLogin")->name("admin.auth.login.post"); Route::get("/logout", "Admin\AuthController@getLogout")->name("admin.auth.logout.get"); }); routes/admin.php <?php /* |-------------------------------------------------------------------------- | Web Routes |-------------------------------------------------------------------------- | | Here is where you can register web routes for your application. These | routes are loaded by the RouteServiceProvider within a group which | contains the "admin" middleware group. Routes are prefixed with "/admin" | Now create something great! | */ Route::get("/", "DashboardController@getIndex")->name("admin.dashboard"); // rest omitted Http/Kernel.php <?php namespace App\Http; use Illuminate\Foundation\Http\Kernel as HttpKernel; class Kernel extends HttpKernel { /** * The application's global HTTP middleware stack. * * These middleware are run during every request to your application. * * @var array */ protected $middleware = [ \Illuminate\Foundation\Http\Middleware\CheckForMaintenanceMode::class, \Illuminate\Foundation\Http\Middleware\ValidatePostSize::class, \App\Http\Middleware\TrimStrings::class, \Illuminate\Foundation\Http\Middleware\ConvertEmptyStringsToNull::class, \App\Http\Middleware\TrustProxies::class, ]; /** * The application's route middleware groups. * * @var array */ protected $middlewareGroups = [ 'web' => [ \App\Http\Middleware\EncryptCookies::class, \Illuminate\Cookie\Middleware\AddQueuedCookiesToResponse::class, \Illuminate\Session\Middleware\StartSession::class, // \Illuminate\Session\Middleware\AuthenticateSession::class, \Illuminate\View\Middleware\ShareErrorsFromSession::class, \App\Http\Middleware\VerifyCsrfToken::class, \Illuminate\Routing\Middleware\SubstituteBindings::class, ], 'api' => [ 'throttle:60,1', 'bindings', ], 'admin' => [ 'web', 'auth:admin', 'nav:admin', // nav is custom middleware for loading navigation config to nwidart/laravel-menus library ], 'organization' => [ 'web', 'auth:organization', 'nav:organization', ], 'volunteer' => [ 'web', 'auth:volunteer', 'nav:volunteer', ], ]; /** * The application's route middleware. * * These middleware may be assigned to groups or used individually. * * @var array */ protected $routeMiddleware = [ //'auth' => \Illuminate\Auth\Middleware\Authenticate::class, 'auth' => \App\Http\Middleware\AuthMiddleware::class, 'auth.basic' => \Illuminate\Auth\Middleware\AuthenticateWithBasicAuth::class, 'bindings' => \Illuminate\Routing\Middleware\SubstituteBindings::class, 'cache.headers' => \Illuminate\Http\Middleware\SetCacheHeaders::class, 'can' => \Illuminate\Auth\Middleware\Authorize::class, 'guest' => \App\Http\Middleware\RedirectIfAuthenticated::class, 'signed' => \Illuminate\Routing\Middleware\ValidateSignature::class, 'throttle' => \Illuminate\Routing\Middleware\ThrottleRequests::class, 'nav' => \App\Http\Middleware\NavigationBuilder::class, ]; } AuthMiddlware.php <?php namespace App\Http\Middleware; use Closure; use Illuminate\Support\Facades\Auth; class AuthMiddleware { /** * Handle an incoming request. * * @param \Illuminate\Http\Request $request * @param \Closure $next * @param string $guard * @return mixed */ public function handle($request, Closure $next, $guard) { if (!Auth::guard($guard)->check()) { return redirect()->route(config("auth.guards.$guard.redirect")); } return $next($request); } } To end this, I would like to say that any suggestion or comment is welcomed. I need to determine if this is my local issue, or if this has something to do with Laravel so that I can open an issue on their GitHub page. A: After more investigation, I found out that the issue was caused by barryvdh/laravel-debugbar package. By removing it or turning application into production/debug=false, everything worked as expected. I will update this answer once I have response from barryvdh.
Get mean, already. That was the unsolicited advice I offered to President Obama last year. The administration was reeling under a relentlessly anti-intellectual right-wing assault on healthcare reform. The program finally got passed, but the Democrats looked hopelessly feckless in the attempt. Today the Democratic agenda, like the party’s weight in Congress, has dramatically shrunk. Hard-fought reforms on healthcare and consumer finance could be nullified by legislative meddling. Social Security, which keeps millions of older Americans out of the poorhouse, is under fresh assault. Is the retreat underway? Last week, Democrats were on the verge of giving in to a GOP demand to extend the Bush tax cuts for the wealthy. But the latest horrific job numbers underscore the point that what’s needed more than payoffs to the top echelon is more direct economic stimulus and assistance for the working class. My advice to Obama now might be: “Give ‘em hell, Barry.” Except it’s not Harry Truman whom Obama should look to for inspiration, but Franklin Roosevelt. No one was better than FDR at batting his opponents’ pitches back down their throats, to cheers from the grandstands. FDR’s best-known retort to his critics on Wall Street, uttered in a 1936 campaign speech, was “I welcome their hatred.” But in that speech he also drew a razor-sharp distinction between his administration and the previous dozen years of GOP rule, which ended with three years of depression. “Nine mocking years with the golden calf and three long years of the scourge!” Roosevelt said. “Nine crazy years at the ticker and three long years in the bread lines! Nine mad years of mirage and three long years of despair! Powerful influences strive today to restore that kind of government with its doctrine that that government is best which is most indifferent.” Have you heard anything that colorful or direct from President Obama? Me neither. Did Roosevelt make a rowdy fight of it? You betcha. It’s true that the political landscape was much different then. Both parties had moderate, progressive and conservative blocs — in fact, FDR’s toughest political adversaries were Southerners from his own party. Today we seem to have one party with aspirations to reform and another with aspirations to obstruction. Yet even reform-minded Democrats act as if they’re embarrassed by the thought that government should do anything. If so, why are they in Washington? Roosevelt, for his part, refused to shy away from the principle of government action. “I have never had sympathy with the point of view that a session of the Congress is an unfortunate intrusion of what they call ‘politics’ into our national affairs,” he said in a 1937 Fireside Chat. “Democratic government can never be considered an intruder into the affairs of a democratic nation.” Roosevelt had other principles that seem to be overlooked by his successor today. He rarely let a political slur go unanswered. In 1936, Al Smith, the former Democratic presidential candidate, surfaced as a front man for the right-wing Liberty Lobby and labeled the New Deal as “socialist.” (Sound familiar?) Roosevelt squelched him by unearthing a speech Smith had delivered during his 1928 presidential campaign. “The cry of socialism,” Smith had said then, “has been patented by the powerful interests that desire to put a damper on progressive legislation. Is that cry of socialism anything new?… I have heard it raised by reactionary elements and the Republican Party in my own state for over a quarter century.” Why don’t today’s Democrats play hardball like that? I suspect it’s because deep down they fear their fellow Americans are idiots. When conservatives attack healthcare reform with a ridiculous claim about, say, healthcare “death panels,” the Democrats assume most Americans will believe it on faith. And you can’t argue with faith. So this year they were afraid to base their reelection campaigns on the achievement of healthcare reform. Their campaign slogans should have been: No more chicanery by health insurers! No more rejections for preexisting conditions! No more rip-off deductibles and undisclosed co-pays! They passed an economic stimulus program which, according to the bipartisan Congressional Budget Office, has increased employment by up to 3.6 million people, lowered the unemployment rate by as much as 2 percentage points and increased gross domestic product by up to 4.1%. Yet they failed to challenge their opponents’ claims that the stimulus “failed.” They seemed to hope that voters would forget their accomplishments. That was stupid and spineless, and the harvest was a deserved trouncing at the polls. Yes, I’ve heard the argument that conservatives and Republicans have their own cable TV megaphone in Fox News. That’s no excuse. Democrats and progressives had their own megaphone: the White House and a commanding majority in Congress. They just didn’t use it. We are today gripped by the curious superstition that government is ineffective and sinister. The same phenomenon appeared in the late ‘30s, recalled Thurman Arnold, a penetrating political analyst during the New Deal. In such an atmosphere, Arnold observed, “mystical attacks on practical measures achieved an astonishing degree of success.” Politicians became more obsessed with upholding their ideologies than with “the day-to-day distribution of food, housing and clothing to those who needed them.” Arnold was writing in 1937 — his book “The Folklore of Capitalism” should be required reading for every politician and business leader today — but I haven’t seen a better critique of today’s nattering political mythologists this side of Joe Scarborough. Obama should take heed and stick to the goals he was elected for. He might think about these words from a Fireside Chat in 1938, when FDR was struggling to cope with a recession caused in part by his abandonment of fiscal stimulus. “To reach a port, we must sail — sail, not lie at anchor. Sail, not drift.” Michael Hiltzik’s column appears Sundays and Wednesdays. Reach him at mhiltzik@latimes.com, read past columns at latimes.com/hiltzik, check out facebook.com/hiltzik and follow @latimeshiltzik on Twitter.
When grocery shopping, everyone has a natural habit of picking and choosing the most aesthetically pleasing fruits and vegetables. However, sometimes the less attractive produce is equally as healthy and delicious. Supermarket food that is not purchased, often for superficial reasons, is thrown out, which creates food waste. To help reduce this problem, a successful Canadian supermarket retailer is selling its imperfect produce at lesser prices. Fruits and vegetables that are misshapen or considered “ugly,” but are otherwise good, are being sold on sale at Loblaws, Canada’s largest supermarket chain. This clever campaign is an intelligent way to raise awareness of the dangers of excessive food waste. Discarded food fills up landfills and decomposes causing the emission of greenhouse gases like methane, which is toxic to our environment. The campaign is also a way to help consumers save money on produce that is equal in nutrition to more “attractive” produce.
Role of angiopoietin-2 in adaptive tumor resistance to VEGF signaling blockade. Angiopoietin-2 (ANG2/ANGPT2) is a context-dependent TIE2 receptor agonist/antagonist and proangiogenic factor. Although ANG2 neutralization improves tumor angiogenesis and growth inhibition by vascular endothelial growth factor (VEGF)-A signaling blockade, the mechanistic underpinnings of such therapeutic benefits remain poorly explored. We employed late-stage RIP1-Tag2 pancreatic neuroendocrine tumors (PNETs) and MMTV-PyMT mammary adenocarcinomas, which develop resistance to VEGF receptor 2 (VEGFR2) blockade. We found that VEGFR2 inhibition upregulated ANG2 and vascular TIE2 and enhanced infiltration by TIE2-expressing macrophages in the PNETs. Dual ANG2/VEGFR2 blockade suppressed revascularization and progression in most of the PNETs, whereas it had only minor additive effects in the mammary tumors, which did not upregulate ANG2 upon VEGFR2 inhibition. ANG2/VEGFR2 blockade did not elicit increased PNET invasion and metastasis, although it exacerbated tumor hypoxia and hematopoietic cell infiltration. These findings suggest that evasive tumor resistance to anti-VEGFA therapy may involve the adaptive enforcement of ANG2-TIE2 signaling, which can be reversed by ANG2 neutralization.
George P. Bush at a campaign stop in El Paso in March. (Juan Carlos Llorca/Associated Press) George P. Bush, the son of former Florida governor Jeb Bush (R), said Sunday on ABC's "This Week" that his father is seriously considering a presidential run in 2016. "I think it's more than likely that he's giving this serious thought in moving forward ... that he'll run," he said. Bush also said the family "would be behind [Jeb Bush] 100 percent if he decides to" run. Bush is running for Texas land commissioner.
Pre- and postsynaptic alpha-2 adrenoceptors as target for drug discovery. The presynaptic terminal autoreceptors which modulate the release of noradrenaline through a negative feed-back mechanism correspond to the alpha 2-subtype of adrenoceptors. These receptors are also present post-synaptically in the pancreatic islets were they mediate inhibition of the glucose-induced release of insulin. The sympathetic innervation of the pancreatic islets involves alpha 2-adrenoceptors both presynaptically as well as postsynaptically. SL 84.0418 is a novel alpha 2-adrenoceptor antagonist with preferential effects in the periphery and with at least a 10-fold higher selectivity ratio between alpha 2 and alpha 1-adrenoceptors when compared with idazoxan. SL 84.0418 antagonizes the hyperglycemia and the inhibition of insulin release induced by the alpha 2-adrenoceptor agonist UK 14304. The administration of SL 84.0418 significantly reduces the glucose evoked hyperglycemia in several species including man. It is proposed that SL 84.0418 may represent a useful and novel hypoglycemic drug in the treatment of type II diabetes.
<?php include($tpl_common_dir . 'action_confirm.tpl'); echo $tabs; ?> <div class="tab-content"> <div class="panel-heading"> <div class="pull-right"> <div class="btn-group mr10 toolbar"> <?php if (!empty ($help_url)) : ?> <a class="btn btn-white tooltips" href="<?php echo $help_url; ?>" target="new" data-toggle="tooltip" title="" data-original-title="Help"> <i class="fa fa-question-circle fa-lg"></i> </a> <?php endif; ?> </div> <?php echo $form_language_switch; ?> </div> </div> <?php echo $form['form_open']; ?> <div class="panel-body panel-body-nopadding"> <label class="h4 heading"><?php echo $form_title; ?></label> <?php foreach ($form['fields'] as $name => $field) { //Logic to calculate fields width $widthcasses = "col-sm-7"; if ( is_int(stripos($field->style, 'large-field')) ) { $widthcasses = "col-sm-7"; } else if ( is_int(stripos($field->style, 'medium-field')) || is_int(stripos($field->style, 'date')) ) { $widthcasses = "col-sm-5"; } else if ( is_int(stripos($field->style, 'small-field')) || is_int(stripos($field->style, 'btn_switch')) ) { $widthcasses = "col-sm-3"; } else if ( is_int(stripos($field->style, 'tiny-field')) ) { $widthcasses = "col-sm-2"; } $widthcasses .= " col-xs-12"; ?> <div class="form-group <?php if (!empty($error[$name])) { echo "has-error"; } ?>"> <label class="control-label col-sm-3 col-xs-12" for="<?php echo $field->element_id; ?>"><?php echo $form[ 'text' ][$name]; ?></label> <div class="input-group afield <?php echo $widthcasses; ?> <?php echo ($name == 'description' ? 'ml_ckeditor' : '')?>"> <?php echo $field; ?> </div> <?php if (!empty($error[$name])) { ?> <span class="help-block field_err"><?php echo $error[$name]; ?></span> <?php } ?> </div> <?php } ?> </div> <div class="panel-footer"> <div class="row"> <div class="col-sm-6 col-sm-offset-3 center"> <button class="btn btn-primary lock-on-click"> <i class="fa fa-save"></i> <?php echo $form['submit']->text; ?> </button>&nbsp; <a class="btn btn-default" href="<?php echo $cancel; ?>"> <i class="fa fa-refresh"></i> <?php echo $form['cancel']->text; ?> </a> </div> </div> </div> </form> </div> <?php echo $autoload;?>
A Brillouin analysis sensor is a fibre optic distributed sensor that can measure changes in the local strain and/or temperature conditions of an optical sensing fibre through analysis of the Brillouin frequency of the sensing fibre at any point. The sensing fibre is usually attached to or embedded in a host material and is used to measure the strain and/or temperature conditions of the host. Both strain and temperature cause a shift in the Brillouin frequency. Position is determined by the round-trip transit time of the optical signal in the fibre. Reference herein to a Brillouin analysis sensor system shall mean a Brillouin analysis sensor plus an optical sensing fibre. A Brillouin analysis sensor system operates on the principle of Brillouin amplification. In a Brillouin amplifier, a signal (or Stokes) light wave propagating in one direction experiences optical gain if its frequency falls within the Brillouin gain profile of the amplifier pump wave propagating in the opposite direction. The Stokes wave experiences gain (with a corresponding loss from the pump) in accordance with the Brillouin gain profile. The power in either wave may be monitored to determine the Brillouin gain profile; if the Stokes wave is chosen to be monitored then the system is said to operate in Brillouin gain mode (as any interaction causes an increase in the Stokes wave). Otherwise, it is said to operate in Brillouin loss mode. Two lasers may be used to generate the two lightwaves, in which case the frequency difference between them is maintained and controlled by a control loop (often a phase-locked loop). Alternatively, a single laser source may be used and a second lightwave generated from it by optical frequency modulation (using an electronic signal of the desired frequency). One type of Brillouin analysis sensor is a Brillouin Optical Time Domain Analysis (“BOTDA”) system. To obtain spatial information in a BOTDA system, one of the two light waves is pulsed by an electro-optic modulator (EOM) driven by an electronic pulse generator, while the intensity of the other light wave is monitored as a function of time elapsed (i.e. in the time domain) since the generation of the pulse. In this way position, z, is determined from the time-of-flight, t, as z=ct/2n, where c is the speed of light and n is the group index of refraction of the fibre. The intensity of the interaction (either gain or loss depending on which wave is monitored) is a function of the relative frequency difference between the two lasers. It is also a function of the gain profile of the fibre at the point of interaction, which moves (with the pulse) along the fibre. The frequency difference is swept over some range of frequencies of interest. Since frequency characteristics of the Brillouin profile are modified by the strain and temperature conditions of the sensing fibre, the local strain and temperature conditions can be inferred from a measurement of the Brillouin gain or loss profile. This profile is obtained by considering the Brillouin interaction at a given point in space as a function of frequency difference. A second type of Brillouin analysis sensor is the Brillouin Optical Frequency Domain Analysis sensor (“BOFDA”). In frequency domain analysis, a sine-wave amplitude modulated light wave is used in place of the pulse modulated wave used in BOTDA. Measurements are carried out in the frequency domain by sweeping this modulation frequency and measuring the interaction with the cw wave. The frequency domain data can be mathematically transformed to the time domain to obtain the positional information which is the equivalent of the signal that would be obtained by BOTDA. A third type of Brillouin analysis sensor is the Brillouin Optical Correlation Domain Analysis sensor (“BOCDA”). In correlation domain analysis both light waves are modulated and positional information is extracted from the correlation of the two signals. Correlation based sensors can have very high resolutions, although at the cost of limited overall sensing length. Traditionally bright pulses have been used to interrogate the sensing fibre with BOTDA systems, however the use of dark pulses has recently been shown to have several advantages in terms of resolution, accuracy and speed. BOTDA (and all other Brillouin analysis distributed sensors) require that the state of polarization (“SOP”) be matched (parallel) between the two light waves (pump and Stokes) at all locations in the sensing fibre. If the SOP is not matched, then the intensity of the Brillouin signal will fade at locations where the SOP is mismatched, resulting in amplitude noise and possibly locations in the sensor where the two SOPs are orthogonal and no signal can be obtained. In prior art BOTDA sensor systems, the SOP can be kept aligned but only if special polarization-maintaining (“PM”) fibres are used as the sensing element. Such fibres have higher attenuation, are much more expensive and are more difficult to work with compared to standard single mode fibres (“SMF”). If non-PM fibre (i.e. SMF) is used, then the state of polarization of the two lightwaves will vary with position (and possibly with time) along the fibre length. To deal with this situation, a prior art BOTDA system will often take multiple measurements on SMF, altering the lightwaves' relative polarization states between measurements, and using an average result. It has been shown that using averaged data from switching one of the waves between two orthogonal polarization states can reduce polarization fading, however the averaged signal will only be one half of the maximum Brillouin signal. Alternatively, a set of measurements taken with three particular SOPs can improve this average to two thirds of the maximum, but requires at least triple the time to take data. Moreover, the devices typically used to alter the SOP in a BOTDA system have switching times which are slow enough to significantly add to the overall acquisition time of the sensor. Also, because the multiple measurements are made at different times, it is possible for changes to the conditions of the sensor (e.g. mechanical vibrations or motions) between measurements to alter the SOP so that the multiple measurements no longer average orthogonal SOPs, thus reducing the efficacy of polarization averaging methods. BOTDA distributed sensor systems are therefore subject to polarization fading effects which require expensive PM fibre or polarization averaging schemes.
53 wounded in PKK car bomb attack in Turkey’s Van VAN DHA photo A total of 53 people were wounded on Sept. 12 when outlawed Kurdistan Workers’ Party (PKK) militants staged a car bomb attack targeting a police checkpoint in the eastern province of Van, on the first day of Islam’s holy Eid al-Adha (Feast of Sacrifice) holiday.PKK militants detonated a bomb-laden vehicle parked near a police checkpoint in front of the provincial headquarters of the ruling Justice and Development Party (AKP) in the central Beşyol area at 10:50 a.m., the Van Governor’s Office said in a statement.Van Governor İbrahim Taşyapan announced that 53 people, including four police officers and four Iranian citizens, were wounded in the attack, which was carried out in one of the city’s busiest spots during the Islamic holiday. He also added that two of the wounded were in critical condition.The governor also stated that the vehicle, a panel van-type minibus, was probably detonated by remote control ten seconds after it was parked behind the barriers of the checkpoint.A number of firefighters and health personnel were immediately dispatched to the area as buildings near the scene were damaged and a fire broke out in the aftermath of the attack.The AKP provincial headquarters and a hotel near the scene were greatly damaged by the explosion, while the windows of nearby houses and storefronts were shattered in the blast.Security forces’ efforts to apprehend the PKK militants responsible for the attack were ongoing.In addition, Turkey’s Radio and Television Supreme Council (RTÜK) issued a temporary gag order on the attack.Meanwhile, the attack drew condemnations from the ruling AKP government as well as many main opposition Republican People’s Party (CHP) deputies.Interior Minister Süleyman Soylu said the attack could not achieve its ultimate goal due to precautions taken at police checkpoints with barricades.Deputy Prime Minister Nurettin Canlikli said that with the attack the PKK had turned to directly targeting civilians and innocent people, a sign showing that they had begun to falter.Speaking in the southeastern province of Diyarbakır, AKP deputy chairman Mehdi Eker said: “We all have to say ‘stop’ to these traitors with our stance, statements, and prayers [against terrorism].”Development Minister Lütfi Elvan criticized that the attack came on the first day of Eid al-Adha.In the opposition ranks, CHP deputy head and Ordu deputy Seyit Torun condemned the attack, saying it was extremely saddening that such attack was staged during an Islamic holiday.The party’s deputy head, Öztürk Yılmaz, said such attacks would never be accepted by society, urging for calm and caution against provocations.Early on Sept. 12, two PKK militants, who were in preparation for an attack, were killed during clashes with special operations police in the province’s İpekyolu district.The attack also comes after a government move to replace 28 local mayors with trustees for their alleged links to terror organizations, including the PKK.Four district municipality mayors in Van had been replaced by either deputy governors or district governors on Sept. 11, as part of a recent decree law the under state of emergency following the July 15 failed coup attempt.
Re: Nuisance Calls From Virgin Media There is the option to send Virgin Media aSection 11 DPA Noticewhich gives you the right to make a request to an organisation to stop processing your data for the purposes of direct marketing. If you send this notice to an organisation it means they must stop, or not begin, sending you marketing material or contacting you for marketing purposes. You need to give the organisation enough information to identify you. This may be your full name, address, email address or other information, such as your account number. Your notice needs to be in writing, an email is acceptable for this purpose. Your letter should be sent to Virgin Media's Data Protection Officer at MEDIA HOUSE BARTLEY WOOD BUSINESS PARK HOOK HAMPSHIRE RG27 9UP TEMPLATE LETTER [Your full name] [Your full address] [Today's date] Data Controller / Company Secretary [Organisation's full address] Dear Sir or Madam, Notice under the Data Protection Act 1998 not to use my personal information for direct marketing I,[your full name]of[your full address]require you to[stop / not to begin]processing personal information relating to me for direct marketing as soon as possible and in any event within 28 days of the date of this[letter / e-mail]. If you do not normally handle these requests for your organisation, please pass this[letter / e-mail]to your Data Protection Officer or the person who does. Please note that if you do not comply with this notice, I can apply to the court for an order against you under Section 11 of the Data Protection Act. Yours faithfully, [Your name] In normal circumstances you should expect them to stop contacting you by email within 28 days of receiving your notice, and post to stop within two months. Telephone contact should also stop within this time period. Re: Nuisance Calls From Virgin Media on ‎20-12-201720:25 Hi Pamdor, Thanks for your post and apologies to hear you are receiving unwanted calls from us. I've gone into your account and changed your marketing preferences to No Contact so this will stop any calls you are getting from us. It will also stop any emails, addressed marketing and texts from us too. It can take up to 6 weeks for things to completely stop but you should see it reduce as time goes on.
This week's Fulmer Cupdate is brought to you by Boardmaster Brian. If your cellphone works better today than it usually does, thank him for letting major telecom companies use his penis as an antenna on select weekdays. When Reggie Nelson's babymaker is finally rented for similar duties, AT&T's service will finally be considered something close to "not horrible." Enjoy. AUBURN. Backup quarterback Zeke Pike was arrested for public intox just after midnight on Sunday in Auburn, leading one to so many questions at once. How does one get arrested for public intoxication in Auburn, a town that's three blocks long and all but designed to fumble tipsy students back to campus? (Things roll uphill in Auburn: drunk students, Gene Chizik's career, etc.) Furthermore, how the hell does a football player get arrested for public intox in a a town that doubles as a tax dodge for skullduggerous logging magnates and football factory? And why on earth did the energetic Lee County prosecutors not add a public insurrection and treason charge to Pike's tally? When will we rally to the challenge posed by so-called "Americans" restricting the rights of those who wish to trod tipsily upon this fine land of ours as they like? WHEN, WE ASK? There are no answers to these questions, but we do have one lonely point for the defending Fulmer Cup Champs. Barring a Ponzi scheme orchestrated by players working a boiler room set up in the Auburn football facilities, this appears to be twilight of the Tigers' reign as Fulmer Cup title holders. (This scenario? Entirely possible, especially if Trooper Taylor is waving a towel and talking to a nervous, gullible doctor over the PA.) HAWAI'I. Alema Tachibana, arrested for DUI the second time in three months. We'd never drive drunk on an island, because there's always the possibility we're just going to floor it with the windows up, fall asleep at the wheel, and wake up driving on the shores of Australia. That's how the first settlers got there, after all, all seven of them in a waterlogged but still-running Nash Rambler. AC/DC doesn't remember any of it, but that's exactly how it all started, and don't bother searching this on Wikipedia it's full of internet lies. Three points for a repeat offender charge and a DUI for the Warriors. SOUTH CAROLINA. Not currently on the team, so former OL Kenny Davis' sexual assault charges do not count.
If you’ve been paying attention to the rash of security startups entering the market today, you will no doubt notice the theme wherein the majority of them are, from the get-go, organizing around deployment models which operate from “The Cloud.” We can argue that “Security as a service” usually refers to security services provided by a third party using the SaaS (software as a service) model, but there’s a compelling set of capabilities that enables companies large and small to be both effective, efficient and cost-manageable as we embrace the “new” world of highly distributed applications, content and communications (cloud and mobility combined.) In the same way that I differentiated “Virtualizing Security, Securing Virtualization and Security via Virtualization” in my Four Horsemen presentation, I ask people to consider these three models when discussing security and Cloud: By the Cloud: Security services delivered by Cloud Computing services which are used by providers in option #2 which often rely on those features described in option #1. Think, well…basically any service these days that brand themselves as Cloud… What I’m talking about here is really item #3; security “by the cloud,” wherein these services utilize any cloud-based platform (SaaS, PaaS or IaaS) to delivery security capabilities on behalf of the provider or ultimate consumer of services. For the SMB/SME/Branch, one can expect a hybrid model of on-premises physical (multi-function) devices that also incorporate some sort of redirect or offload to these cloud-based services. Frankly, the same model works for the larger enterprise but in many cases regulatory issues of privacy/IP concerns arise. This is where the capability of both “private” (or dedicated) versions of these services are requested (either on-premises or off, but dedicated.) Service providers see a large opportunity to finally deliver value-added, scaleable and revenue-generating security services atop what they offer today. This is the realized vision of the long-awaited “clean pipes” and “secure hosting” capabilities. See this post from 2007 “Clean Pipes – Less Sewerage or More Potable Water?” If you haven’t noticed your service providers dipping their toes here, you certainly have seen startups (and larger security players) do so. Here are just a few examples: As many vendors “virtualize” their offers and start to realize that through basic networking, APIs, service chaining, traffic steering and security intelligence/analytics, these solutions become more scaleable, leveragable and interoperable, the services you’ll be able to consume will also increase…and they will become more application and information-centric in nature. Again, this doesn’t mean the disappearance of on-premises or host-based security capabilities, but you should expect the cloud (and it’s derivative offshoots like Big Data) to deliver some really awesome hybrid security capabilities that make your life easier. Rich Mogull (@rmogull) and I gave about 20 examples of this in our “Grilling Cloudicorns: Mythical CloudSec Tools You Can Use Today” at RSA last month. Get ready because while security folks often eye “The Cloud” suspiciously, it also offers up a set of emerging solutions that will undoubtedly allow for more efficient, effective and affordable security capabilities that will allow us to focus more on the things that matter. In my Commode Computing talk, I highlighted the need for security automation through the enablement of APIs. APIs are centric in architectural requirements for the provisioning, orchestration and (ultimately) security of cloud environments. So there’s a “dark side” with the emergence of APIs as the prominent method by which one now interacts with stacks — and it’s highlighted in VMware’s vCloud Director Hardening Guide wherein beyond the normal de rigueur deployment of stateful packet filtering firewalls, the deployment of a Web Application Firewall is recommended. Why? According to VMware’s hardening guide: In summary, a WAF is an extremely valuable security solution because Web applications are too sophisticated for an IDS or IPS to protect. The simple fact that each Web application is unique makes it too complex for a static pattern-matching solution. A WAF is a unique security component because it has the capability to understand what characters are allowed within the context of the many pieces and parts of a Web page. I don’t disagree that web applications/web services are complex. I further don’t disagree that protecting the web services and messaging buses that make up the majority of the exposed interfaces in vCloud Director don’t require sophisticated protection. This, however, brings up an interesting skill-set challenge. How many infrastructure security folks do you know that are experts in protecting, monitoring and managing MBeans, JMS/JMX messaging and APIs? More specifically, how many shops do you know that have WAFs deployed (in-line, actively protecting applications not passively monitoring) that did not in some way blow up every app they sit in front of as well as add potentially significant performance degradation due to SSL/TLS termination? Whether you’re deploying vCloud or some other cloud stack (I just happen to be reading these docs at the moment,) the scope of exposed API interfaces ought to have you re-evaluating your teams’ skillsets when it comes to how you’re going to deal with the spotlight that’s now shining directly on the infrastructure stacks (hardware and software) their private and public clouds. Many of us have had to get schooled on web services security with the emergence of SOA/Web Services application deployments. But that was at the application layer. Now it’s exposed at the “code as infrastructure” layer. Think about it. /Hoff [Update 6/7/11 – Here are two really timely and interesting blog posts on the topic of RESTful APIs: While the study breaks down the survey in detail in Appendix 1, I would kill to see the respondent list so I could use the responses from some of these “cloud providers” to quickly make assessments of my short list of those to not engage with. I suppose it’s not hard to believe that security is not a primary concern, but given all the hype surrounding claims of “cloud is more secure than the enterprise,” it’s rather shocking to think that this sort of behavior is reflective of cloud providers. Let’s see why. This survey qualifies those surveyed as such: We surveyed 103 cloud service providers in the US and 24 in six European countries for a total of 127 separate providers. Respondents from cloud provider organizations say SaaS (55 percent) is the most frequently offered cloud service, followed by IaaS (34 percent) and PaaS (11 percent). Sixty-five percent of cloud providers in this study deploy their IT resources in the public cloud environment, 18 percent deploy in the private cloud and 18 percent are hybrid. …and offers these most “salient” findings: The majority of cloud computing providers surveyed do not believe their organization views the security of their cloud services as a competitive advantage. Further, they do not consider cloud computing security as one of their most important responsibilities and do not believe their products or services substantially protect and secure the confidential or sensitive information of their customers.– The majority of cloud providers believe it is their customer’s responsibility to secure the cloud and not their responsibility. They also say their systems and applications are not always evaluated for security threats prior to deployment to customers. – Buyer beware – on average providers of cloud computing technologies allocate 10 percent or less of their operational resources to security and most do not have confidence that customers’ security requirements are being met. – Cloud providers in our study say the primary reasons why customers purchase cloud resources are lower cost and faster deployment of applications. In contrast, improved security or compliance with regulations is viewed as an unlikely reason for choosing cloud services. The majority of cloud providers in our study admit they do not have dedicated security personnel to oversee the security of cloud applications, infrastructure or platforms. – Providers of private cloud resources appear to attach more importance and have a higher level of confidence in their organization’s ability to meet security objectives than providers of public and hybrid cloud solutions. _ While security as a “true” service from the cloud is rarely offered to customers today, about one-third of the cloud providers in our study are considering such solutions as a new source of revenue sometime in the next two years. Ultimately, CA summarized the findings as such: “The focus on reduced cost and faster deployment may be sufficient for cloud providers now, but as organizations reach the point where increasingly sensitive data and applications are all that remains to migrate to the cloud, they will quickly reach an impasse,” said Mike Denning, general manager, Security, CA Technologies. “If the risk of breach outweighs potential cost savings and agility, we may reach a point of “cloud stall” where cloud adoption slows or stops until organizations believe cloud security is as good as or better than enterprise security.” I have so much I’d like to say with respect to these summary findings and the details within the reports, but much of it I already have. I don’t think these findings are reflective of the larger cloud providers I interact with which is another reason I would love to see who these “cloud providers” were beyond the breakdown of their service offerings that were presented.” In the meantime, I’d like to refer you to these posts I wrote for reflection on this very topic:
Acute lymphoblastic leukaemia (ALL) is the most common childhood cancer. As over 80% of patients now achieve 10-year overall survival ([@bib12]), attention now focuses on minimising sequelae of the condition and its treatment. Increased obesity has been reported amongst survivors of childhood ALL, with cranial irradiation as a major risk factor ([@bib15]), with one study demonstrating obesity in 50% of ALL survivors at final height ([@bib8]). The most recent UK report, which included a cohort of unirradiated patients treated on the MRC/UKALL XI protocol, demonstrated raised body mass index standard deviation scores (BMI-SDS) in both males and females, from diagnosis to the end of treatment (EoT), but this increase did not persist to last follow-up ([@bib7]). More recent treatment protocols have replaced cranial irradiation with intrathecal chemotherapy as standard central nervous system disease prophylaxis and treatment. Published reports on the auxological effects of these changes are conflicting. An increased incidence of overweight and obesity is reported amongst some US cohorts ([@bib2]; [@bib4]). However, a retrospective report from the US Childhood Cancer Survivor Study did not identify any BMI increase in ALL survivors treated with chemotherapy alone, although self-reported heights and weights were used and adult thresholds of overweight and obese used ([@bib10]). There have been no reports on auxological parameters in a UK cohort treated on a contemporary treatment protocol without cranial irradiation as standard therapy. We therefore performed a retrospective longitudinal single-centre study to evaluate the relative contributions of height and weight to BMI at different time points during treatment and follow-up in patients treated on the MRC/UKALL97 protocol. Patients and methods ==================== Retrospective case-note analysis was performed on all children with ALL enrolled on the MRC/UKALL97 protocol at Addenbrooke\'s Hospital, Cambridge, UK between 1997 and 2003 and aged 1--16 years at diagnosis. Anonymised demographic and treatment data was recorded between January and April 2008. Height and weight measurements at ALL diagnosis and annual time points until 3 years out (YO) from EoT were collected. Body mass index was calculated at each time point using the standard formula: weight (kg)/height (m)^2^. Height-, weight- and BMI-SDS were calculated relative to British age- and population-referenced normative data ([@bib5]). Exclusion criteria were relapse, death, irradiation (cranial or testicular), bone marrow transplant or other co-existing condition affecting long-term growth (namely chronic liver disease, which was presumed to occur as a result of use of 6-thioguanine during ALL treatment). Analyses were performed using SPSS version 10 (SPSS (UK) Limited, IBM, Woking, UK). Changes in height-, weight- and BMI-SDS across time from diagnosis were explored using a univariate model including each of these as the dependent variable, incorporating both the time from diagnosis and subject identification. *Post-hoc* analysis for time was performed using Dunnett\'s two-sided test. To account for multiple comparisons, a *P*-value ⩽0.001 (two-tailed) was considered significant. Between-group differences in height-, weight- and BMI-SDS changes between diagnosis and 3 YO by gender, diagnostic white cell count (WCC; \< or ⩾50 × 10^9^ l^−1^), MRC/UKALL97 treatment regimen (A/B/high risk) and steroid randomisation (prednisolone/dexamethasone) were performed using one-way analysis of variance for patients with complete data sets to 3 YO. Overall frequency of overweight (BMI-SDS 1.3--2.3) and obesity (BMI-SDS \>2.3) in patients at diagnosis and 3 YO were determined according to standard WHO criteria ([@bib6]) and between-group differences examined using *χ*^2^-test (*P*\<0.05 significant). Results ======= Study patients/demographics --------------------------- From a total of 134 patients enrolled, 57 (42%) were excluded: 28 died, 9 relapsed, 7 received irradiation (6 cranial, 1 testicular), 1 patient underwent bone marrow transplant, 9 developed chronic liver disease, 2 had insufficient auxological data at diagnosis and 1 patient transferred to adult care. Of the 77 patients included, 37 (48%) were male and 40 (52%) were female. Median (range) age (year) at diagnosis was 4.6 (1.1--15.9), with no gender difference (females 4.3 (1.1--13.1), males 5.6 (1.5--15.9)). Median age at 3 YO was 9.8 years in females and 11.8 years in males, giving an overall median of 10.1 (6.5--20.1). At the time of data capture, 13 of the 77 patients had not reached 3 YO and a further 11 either did not have measurements recorded or were lost to follow-up. Distribution of ethnic groups reflected that of the local population (87% White British). Disease/treatment characteristics --------------------------------- Of the 77 patients included, 67 patients (87%) had low WCC at diagnosis (\<50 × 10^9^ l^−1^) and 10 (13%) were high count (⩾50 × 10^9^ l^−1^). In total, 52 patients (67.5%) were treated on MRC/UKALL97 protocol Regimen-A, 19 patients (24.7%) on Regimen-B and 6 patients (7.8%) on the high-risk protocol, consistent with overall UK figures. A total of 30 patients (39%) received prednisolone and 47 received (61%) dexamethasone -- the unequal distribution attributable to dexamethasone becoming standard therapy during the MRC/UKALL97 study because of its superior event-free survival ([@bib13]). Most male patients received 2 years of maintenance ALL therapy (i.e., approximately 3 years treatment in total), and therefore received a greater cumulative dose of steroid treatment than females, who only received 1 year of maintenance. Whole group and gender subgroup comparisons ------------------------------------------- Adjusted mean height-, weight- and BMI-SDS for whole group and gender subgroups at diagnosis, 1 year into treatment, EoT and yearly intervals to 3 YO are shown in [Table 1](#tbl1){ref-type="table"}. Height: whole-group mean height-SDS was reduced from 1 year into treatment to 2 YO. For the male subgroup, mean height-SDS was reduced at EoT and 2 YO, whereas for females the scores were reduced at 1 year into treatment and EoT ([Figure 1A](#fig1){ref-type="fig"}). Weight: whole-group mean weight-SDS was higher from EoT to 3 YO. When analysed by gender, mean weight-SDS for males was unchanged. Females showed raised mean weight-SDS at all time points from 1 YO until 3 YO ([Figure 1B](#fig1){ref-type="fig"}). Body mass index: whole-group mean BMI-SDS was higher from 1 year into treatment and still raised at 3 YO. In males, the mean BMI-SDS was elevated from 1 year into treatment until 1 YO. In the female subgroup, mean BMI-SDS was elevated from EoT and at all time points to 3 YO ([Figure 1C](#fig1){ref-type="fig"}). Between-group comparisons for BMI --------------------------------- There were no differences in changes in BMI-SDS from diagnosis to 3 YO in direct comparisons between groups for WCC at diagnosis, treatment regimens, steroid agent used or gender. This may reflect the relatively small numbers in each group. Overall frequency of overweight/obesity --------------------------------------- More patients were overweight or obese at 3 YO than at diagnosis (25 out of 53 (47.2%) *vs* 23 out of 77 (29.9%), respectively; *P*=0.01) ([Table 2](#tbl2){ref-type="table"}). Discussion ========== Despite the lack of cranial irradiation in current treatment protocols, we have shown that UK survivors of childhood ALL have increases in BMI-SDS, which persist well into follow-up. Our data extend previous historical observations. [@bib7] demonstrated that both male and female unirradiated ALL patients had increased BMI-SDS at EoT in a UK cohort, although such changes were no longer significant at last follow-up. An increased BMI-SDS at EoT was also demonstrated in a US cohort treated without cranial irradiation, but no gender difference was identified, possibly because patients were not followed up beyond EoT ([@bib2]). Our findings reveal that females are at particular risk for increases in BMI-SDS and that such changes persist from EoT until at least 3 YO. These data are consistent with a US study, which not only identified increased BMI at EoT but also that the proportion of patients overweight or obese was unchanged 2--3 years later, with females at increased risk of such findings ([@bib4]). Our systematic examination of height- and weight-SDS in this study enables conclusions to be drawn about the relative contribution of each to BMI in the whole group and in gender subgroup analyses. Early BMI increases reflect reduced height-SDS, whereas weight-SDS remains static. These changes are likely due to acute suppressive effects of steroid therapy and leukaemic illness *per se* on height velocity, with absent weight gain common initially because of treatment intensity. Subsequent elevation of BMI-SDS appears secondary to weight gain, with females particularly susceptible. In males, BMI-SDS changes are transient, recovering by 2 YO. As males do not demonstrate weight-SDS changes, increased BMI reflects slow height-SDS recovery. In females, BMI increases do not appear until EoT, but then persist until 3 YO, and appear predominantly secondary to effects on weight, as height recovers by 1 YO. The weight gain observed in females is not attributable to total steroid dose received, as males, who receive greater cumulative doses as a result of 2 years maintenance therapy, did not display such findings. However, the slower height recovery seen in males is consistent with the effects of longer steroid treatment on linear growth. Our findings suggest a sexually dimorphic phenomenon, with the relative contributions to persistently increased BMI from increased dietary intake, altered metabolism and/or reduced physical activity in females yet to be determined. Of note, females are more likely to have reduced physical activity during cancer treatment and follow-up ([@bib17]), with female ALL survivors having also been identified as at risk of poor physical fitness ([@bib11]). Survivors of childhood cancer are already at risk of adverse long-term health outcomes, such as increased cardiovascular risk with higher rates of myocardial infarction ([@bib14]), and females appear to be at greater risk than their male counterparts ([@bib1]). Although small BMI-SDS reductions have been demonstrated to lead to improvements in cardio-metabolic risk in obese adolescents ([@bib9]), longitudinal cohort studies such as the Bogalusa Heart Study have demonstrated that childhood overweight persists into adulthood and is associated with increased frequency of features of the metabolic syndrome in adulthood ([@bib3]). These findings suggest that intervention strategies, targeting both patients\' dietary and lifestyle choices, might be required to prevent weight gain and physical inactivity developing during ALL treatment and follow-up. We recognise that our study has a number of limitations. First, as a retrospective study, we did not have a control group for comparison. The inclusion of longitudinal data from healthy children, measured against the same reference data would strengthen our observations. However, the children included in our report were measured serially with SDS for auxological parameters calculated against current UK standard reference data ([@bib6]). The frequency of overweight and obese in our cohort as determined by WHO standards approaches 50% at 3 YO. The most recent reports from the UK national child measurement programme (using the same reference data) report prevalence rates of overweight and obesity (school year 6, 2009/2010) in our region of 26--32% ([@bib16]), similar to the prevalence in our cohort at diagnosis (29.9%). It is therefore likely that the increased frequency we describe is real. Second, given that the overall median age of patients was still only 10.1 years at 3 YO, it will be important to continue to follow this cohort through puberty to final height. As dietary intake and physical activity were not measured in this study, it will also be important in the future to prospectively study the impact of targeted interventions on these parameters, and other more sophisticated auxological indices of overweight. In conclusion, childhood survivors of ALL treated without cranial irradiation are at risk of BMI increases, which persist into follow-up, with females appearing particularly susceptible. Through targeted intervention strategies we may aim to minimise the associated long-term morbidity and mortality in this patient group. We thank Ms Beryl Hay for her assistance in retrieving medical records for the study. ![Mean height- (**A**), weight- (**B**) and BMI- (**C**) SDS from diagnosis to 3 years out (YO) from end of treatment (EoT) by gender subgroup (95% confidence intervals; CIs). Results for males are depicted by squares; for females by circles. 1 yr Rx=1 year of treatment. Asterisks denote significant differences in height-, weight and BMI-SDS at that time point when compared with values at diagnosis. ^\*^*P*\<0.0001; ^\*\*^*P*=0.001.](bjc201116f1){#fig1} ###### Height-, weight- and BMI-SDS in whole group and male and female subgroups from diagnosis to 3 years out (YO) from end of treatment (EoT)   **Whole group** **Male subgroup** **Female subgroup** ------------ ------------------------- ------------------------ --------------------- -------------- ------------------------ ---- -------------- ------------------------ ---- -------------- Height-SDS Diagnosis 0.17 (0.09--0.26) 77   0.17 (0.04--0.30) 37   0.18 (0.07--0.28) 40     1 year into treatment −0.27 (−0.36 to −0.18) 69 **\<0.0001** −0.21 (−0.35 to −0.06) 32 0.03 −0.32 (−0.43 to −0.21) 37 **\<0.0001**   End of treatment −0.31 (−0.40 to −0.22) 68 **\<0.0001** −0.27 (−0.41 to −0.13) 32 **\<0.0001** −0.35 (−0.47 to −0.24) 36 **\<0.0001**   1 year post EoT (1 YO) −0.09 (−0.18 to 0.00) 66 **\<0.0001** −0.06 (−0.20 to 0.08) 31 0.02 −0.09 (−0.20 to 0.03) 35 0.005   2 years post EoT (2 YO) −0.04 (−0.14 to 0.06) 58 **\<0.0001** −0.09 (−0.26 to 0.09) 23 **\<0.0001** −0.01 (−0.13 to 0.10) 35 0.13   3 years post EoT (3 YO) 0.01 (−0.09 to 0.11) 53 0.004 −0.06 (−0.25 to 0.13) 20 0.006 0.05 (−0.07 to 0.17) 33 0.31                       Weight-SDS Diagnosis 0.37 (0.26--0.48) 77   0.29 (0.12--0.46) 37   0.44 (0.30--0.59) 40     1 year into treatment 0.41 (0.30--0.52) 69 0.99 0.45 (0.27--0.62) 32 0.671 0.38 (0.24--0.53) 37 0.97   End of treatment 0.74 (0.62--0.85) 68 **\<0.0001** 0.62 (0.44--0.80) 32 0.078 0.85 (0.70--1.00) 36 0.003   1 year post EoT (1 YO) 0.83 (0.72--0.96) 66 **\<0.0001** 0.72 (0.52--0.91) 31 0.003 0.96 (0.80--1.11) 35 **\<0.0001**   2 years post EoT (2 YO) 0.83 (0.70--0.96) 58 **\<0.0001** 0.61 (0.39--0.83) 23 0.789 1.00 (0.84--1.15) 35 **\<0.0001**   3 years post EoT (3 YO) 0.78 (0.65--0.92) 53 **\<0.0001** 0.55 (0.31--0.79) 20 0.471 0.95 (0.79--1.11) 33 **\<0.0001**                       BMI-SDS Diagnosis 0.35 (0.20--0.50) 77   0.24 (0.01--0.46) 37   0.46 (0.27--0.64) 40     1 year into treatment 0.81 (0.65--0.97) 69 **\<0.0001** 0.87 (0.62--1.13) 32 **0.001** 0.77 (0.57--0.96) 37 0.13   End of treatment 1.29 (1.13--1.45) 68 **\<0.0001** 1.11 (0.85--1.36) 32 **\<0.0001** 1.46 (1.26--1.66) 36 **\<0.0001**   1 year post EoT (1 YO) 1.21 (1.05--1.37) 66 **\<0.0001** 1.05 (0.79--1.31) 31 **\<0.0001** 1.36 (1.15--1.56) 35 **\<0.0001**   2 years post EoT (2 YO) 1.14 (0.96--1.31) 58 **\<0.0001** 0.86 (0.56--1.17) 23 0.01 1.34 (1.14--1.55) 35 **\<0.0001**   3 years post EoT (3 YO) 1.04 (0.85--1.22) 53 **\<0.0001** 0.77 (0.43--1.10) 20 0.02 1.24 (1.03--1.45) 33 **\<0.0001** Abbreviations: BMI=body mass index; *N*=number of patients included in the analysis at the stated time-point; SDS=standard deviation score. Adjusted means (95% confidence intervals; CI) are listed. Significant *P*-values are displayed in bold. ###### Frequency of overweight and obese at diagnosis and 3 years from end of treatment (3 YO) **WHO group** **At diagnosis (*N*=77)** **At 3 YO (*N*=53)** ***P*-value** ------------------------------------- --------------------------- ---------------------- ----------------- Healthy (BMI-SDS \<1.3) 54 (70.1%) 28 (52.8%) Not significant Overweight (BMI-SDS 1.3--2.3) 21 (27.3%) 16 (30.2%) Not significant Obese (BMI-SDS \>2.3) 2 (2.6%) 9 (17.0%) Not significant Overweight or obese (BMI-SDS \>1.3) 23 (29.9%) 25 (47.2%) 0.01 Abbreviations: BMI=body mass index; *N*=number of patients included in the analysis is not the stated time-point; SDS=standard deviation score. Difference assessed by *χ*^2^-test; *P*\<0.05 significant. [^1]: These authors contributed equally to this work.
Anna Christie Summary Old Chris Christopherson looks upon the sea as the symbol of a malignant fate. True, he is now skipper of the coal barge Simeon Winthrop, but in his younger days he was an able seaman and boatswain on the old windjammers and visited every port in the world. As far back as he knew, the men of his family in Sweden followed the sea. His father died aboard ship in the Indian Ocean, and two of his brothers drowned. The curse of the sea is not confined to the men in the family. After the news of her husband’s and her sons’ deaths, Chris’s mother died of a broken heart. Unable to bear the loneliness of being a sailor’s wife, his own wife brought their young daughter, Anna, to America to live with some cousins on a farm in Minnesota. Anna’s mother died, and the girl is being brought up by her relatives. Chris did not see his daughter for almost twenty years. One day while he is having a drink at Johnny the Priest’s saloon near South Street in New York City, he receives a postcard from St. Louis telling him that Anna is on her way to New York. This news throws Chris into something of a panic, for living on the barge with him is a middle-aged prostitute named Marthy. Chris decides to get rid of the woman. Being a kind-hearted soul and genuinely fond of Marthy, he dislikes the idea of turning her out, but Marthy says that Chris always treated her decently, and she will move on to someone else. When Marthy catches a glimpse of Chris’s daughter, she is shocked. Anna is twenty years old and pretty in a buxom sort of way, but her painted face and cheap showy clothes are telltale evidence of what she is—a prostitute. Marthy wonders what Chris’s reaction is going to be. In his eyes, however, Anna is the innocent child he always imagined her to be, and he is even hesitant about ordering wine to celebrate their reunion. Life on the barge is an entirely new experience for Anna. She comes to love the sea and to respond to its beauty with the same intensity with which her father responds to its malignance. With the soothing effect of her new environment, and the presence of her father’s gentleness and simplicity, Anna begins to lose some of her hardness and to build some faith in men. One night, while the Simeon Winthrop is anchored in the outer harbor of Provincetown, Massachusetts, Chris hears cries for help. He pulls aboard the barge four men who have been drifting for five days after the wreck of their ship. One of the men, an Irishman named Mat Burke, takes an immediate fancy to Anna, and even in his weakened... (The entire section is 1050 words.) Get Free Access Start your free trial with eNotes for complete access to this resource and thousands more. 30,000+ Study Guides Save time with thousands of teacher-approved book and topic summaries.
Abdalgader Albagrmi’s office sits above a vault piled high with gold. It’s the dwindling pile of cash next to the bullion, however, that keeps the Libyan rebels’ deputy Central Bank chief up at night. As that pile shrinks, so too does the chance of funding and sustaining a revolution to oust one of the world’s longest-serving dictators. If the cash-flow problem “isn’t solved in the next few days, there’s going to be a problem here”, Albagrmi said, speaking from his office in Benghazi, the north-east Mediterranean port that has become the rebels’ de facto capital. On Tuesday, Italy pledged hundreds of millions of euros in funds and fuel to the rebels — the latest aid to be promised by a foreign government. But three months into the fight against Libyan leader Muammar Gaddafi, the rebels complain they have yet to see a penny of the hundreds of millions of dollars on offer. Meanwhile, Libya’s more than $70-billion in assets are unreachable — frozen by United Nations sanctions. Their only export revenue source — oil sales — is at a standstill because of the fighting and, rounding off the problems, Albagrmi says businessmen are hoarding cash instead of depositing it into banks. “Two weeks, if things continue as they are … and there could be a liquidity crisis,” he said. The prediction is a troubling one for the rebels, who are locked in a battle against a better-equipped Libyan military, as a shortage of cash has the potential to translate into a crisis of confidence in the civilian National Transitional Council. The rebel government, from the start, pledged a measure of transparency in its dealings that contrasts sharply with the Gaddafi regime’s opaque policies over the past four decades. Albagrmi was careful from the start of the uprising against Gaddafi on February 15 to make sure that he and others at the Benghazi branch of the Central Bank stayed true to that promise. “After the revolution, everybody on the street had weapons and I was afraid there could be looting. We prevented that,” he said. To ensure that life went on normally for Libyans, the central and commercial banks reopened within four days of the start of the uprising and organizers of the revolt, acting on the advice of bank managers, deposited 200 dinars ($160) into every bank account held in the rebel-controlled region. The cash came from one of two underground vaults encased in double walls and sealed off by a steel door that required three keys to open. Two of the keys were in Benghazi while the third was in Tripoli, the Libyan capital still under Gaddafi’s control. It took three days to get into the vault, with officials finally forming an eight-man committee to oversee the operation. ‘They will find everything is in order’ In one room, they found Libyan dinars and foreign currency. Albagrmi said he is not authorized to give a precise figure, but said it was between 500-million and one billion dinars. He did not have a precise figure for the foreign currency holdings, but said it “wasn’t much”. In the second vault was a huge pile of gold bars that some reports have valued at about $1-billion. The bullion is part of what the World Gold Council estimates is Libya’s trove of 143 tonnes of gold in reserve. Albagrmi said he hasn’t counted the bullion in the Benghazi branch and refused a request by the Associated Press to photograph the cache, saying the eight-member committee would have to be re-formed to accompany reporters into the underground vault. The deputy Central Bank head said that every effort was made to ensure the money was properly accounted for. “The rebels didn’t break in and take money — not a single dinar,” he said.” “Any auditor can come in here and they will find everything is in order,” he said. The gold sits as a tantalising treasure for a de facto government that says it needs a $3-billion infusion to keep afloat, with the money to go toward paying salaries, buying medicine and supplies and powering the country’s eastern half. Tempting as it might be, however, the gold will go untouched, said Albagrmi. It is what has been preventing the dinar from depreciating even more against the dollar, who’ll give us a loan against it anyway?” he asked. The Libyan currency now stands at about 1.60 dinars to the dollar, compared to 1.25 dinars to the dollar before the uprising in the east. The emerging liquidity crunch has helped stoke inflation, with the cost of some goods doubling over the past few months and businessmen forced to pay premiums on foreign currency to complete import deals. ‘Problem of liquidity’ But with the Central Bank in Benghazi dealing with a diminishing supply of dinars, businessmen have been reluctant to deposit money. “The problem is if I deposit 100 s000 [dinars] today, if I go to the bank tomorrow they’ll tell me they can’t give me any money because of the … problem of liquidity,” said Mustafa Mahmoud, an importer and exporter who runs a hardware store. “The next day maybe they’ll give me 2 000 or 5 000 [dinars]. That doesn’t work for me.” To help ease the burden on the fledgling government, Albagrmi says the Central Bank has limited withdrawals by individuals to 750 dinars per month, a level he said was “more then enough given the current circumstances”. But the cash crunch weighs heavily on his mind, especially as “not one dollar has reached us” of the money promised by other countries. Qatar has pledged $400-million. Kuwait promised $180-million. Other friendly nations, led by France and Italy, promised a fund of at least $250-million last month. The rebels are asking for loans secured by billions of dollars in assets that were frozen under sanctions imposed on Gaddafi and the Tripoli government. At first, legal hurdles were blamed for delays in unfreezing the Libyan funds. Weeks later, the question on the rebels’ minds is if the hesitation stems from fears the money would be used to buy arms desperately needed to take on the better-equipped forces loyal to Gaddafi. Another concern may be that the rebels, despite their best efforts, remain a largely untested quotient. The rebels have offered no accounting of how they spent the money the provisional government borrowed from the Central Bank. Also unclear is how they spent the roughly $129-million they got from the one tanker of oil they were able to sell with the help of Qatar. Oil sales have since stopped because of damage to the fields from the fighting. They have also not disclosed what they have done with the millions of dollars donated by Libyans living abroad. One businessman, who declined to be identified because it was “un-Libyan” to boast about donations, said he came back from England and gave £200 000 ($331 000) to the rebel cause. Rebel officials have confirmed they received the cash. Despite the challenges — or perhaps because of them — Albagrmi said the rebels have done well, so far. Benghazi is “an economic paradise” compared to Tripoli, he says. Gasoline shortages in the capital have people lining up for days, with the gasoline costing more than three times the 15 dinars (10 US cents) a liter the easterners still pay. “It’s a huge achievement, what we’ve accomplished,” Albagrmi said, referring to the financial balancing act they undertake daily. – Sapa-AP
Characterization of the iron superoxide dismutase gene of Azotobacter vinelandii: sodB may be essential for viability. Azotobacter vinelandii contains two superoxide dismutases (SODs), a cytoplasmic iron-containing enzyme (FeSOD), and a periplasmic copper/zinc-containing enzyme (CuZnSOD). In this study, the FeSOD was found to be constitutive, while the activity of CuZnSOD increased as the culture entered the stationary phase. Total SOD (units/mg protein) in stationary phase cells grown under nitrogen-fixing conditions was not significantly different from those grown under non-nitrogen-fixing conditions. The gene encoding FeSOD (sodB) was isolated from an A. vinelandii cosmid library. A 1-kb fragment containing the coding region and 400 base pairs of upstream sequence was cloned and sequenced. The nucleotide sequence and the deduced amino acid sequence had a high degree of homology with other bacterial FeSODs, particularly with P. aeruginosa. Attempts to construct a sodB mutant by recombination of a sodB::kan insertion mutation into the multicopy chromosome of A. vinelandii were unsuccessful even in the presence of SOD mimics or nutritional supplements. These results suggest that FeSOD may be essential for the growth and survival of A. vinelandii, and that the periplasmic CuZnSOD cannot replace the function of FeSOD.
Zoic Studios has expanded its creative team, adding VFX Supervisor Chad Wanstreet to its Culver City studio, as well as promoting Nate Overstrom to Creative Director in its New York studio. Wanstreet has nearly 15 years of experience in visual effects, working across series, feature film, commercial and video game projects. He comes to Zoic from FuseFX, where he worked on top series including NBC’s “Timeless,” Amazon Prime’s “The Tick,” Marvel’s “Agents of S.H.I.E.L.D.” for ABC and Starz’s Emmy-winning series “Black Sails.” Wanstreet thrives as a creative problem solver, fusing a streamlined pipeline approach with an impeccable attention to detail, partnering with directors to bring any visual concept to life. Overstrom has spent over 15 years of his career with Zoic, working across the Culver City and New York City studios, earning two Emmy nominations and working on top series including “Banshee,” “Maniac” and “Iron Fist.” He is currently the VFX Supervisor on Cinemax’s “Warrior.” The growth of the creative department is accompanied by the promotion of several Zoic lead artists to VFX Supervisors, with Andrew Bardusk, Matt Bramante, Tim Hanson and Billy Spradlin stepping up to lead teams on a wide range of episodic work. Bardusk just wrapped Season 4 of DC’s “Legends of Tomorrow,” Bramante just wrapped Noah Hawley’s upcoming feature film Lucy in the Sky, Hanson just completed Season 2 of Marvel’s “Cloak & Dagger” and Spradlin just wrapped Season 7 of CW’s “Arrow.” “Chad is a great fit for us and a nice addition to what has become a really strong creative team,” notes Zoic Executive Creative Director/Co-Founder Chris Jones. “Each of these artists share the same core values we established from our start in 2002 of bringing a tireless work ethic in pursuit of creative excellence. Congrats to Nate, Tim, Matt, Bill and Andrew. It’s an exciting time at Zoic and we couldn’t ask for better creative leadership.” “Zoic’s dedication to design and visual storytelling is in their DNA and that is truly evident in their work,” adds Wanstreet. “I’m thrilled to be a part of a team that has creative intent at its core.” About Chad Wanstreet: Wanstreet leveraged his studies in architecture to launch his career in visual effects by bringing structural designs to life through architectural rendering software. He worked as a VFX artist in Detroit at Speedshape, working on projects for top brands such as Ford, GE and General Motors, eventually stepping up as a CG Supervisor. In 2014, he relocated to Los Angeles, joining Blur Studio and quickly stepping up as a lead artist. He worked on full CG in-game cinematics and VFX elements for game clients including Microsoft, Marvel, DC and 343. Shifting to episodic, he joined Encore VFX as CG Supervisor, where he managed a team of 70 artists, delivering up to 100 shots daily. There he helped to develop and execute the creature-heavy aesthetics for “Arrow” and “The Flash.” He then spent a year as a CG Supervisor and eventually VFX Supervisor at FuseFX, working on series including “The Tick.” About Nate Overstrom: Overstrom has worked on dozens of projects that span across feature film, television and commercials. With well over a decade of industry experience, he is known for his mastery of CG and live-action compositing. He earned a BFA in Computer Art from SVA in New York, then went on to intern for Zoic in Los Angeles. He later moved back to NYC and spent two years with Look Effects. In 2014, Zoic recruited Overstrom to spearhead its NYC studio as a VFX Supervisor. There his work has earned him multiple Emmy nominations as well as three VES Award nominations. He has lent his talents to numerous projects since joining Zoic, including the Amazon original series “The Man in the High Castle” which was nominated for a 2016 Emmy for “Outstanding Special Visual Effects.” Additional credits include “Homeland” and “The Defenders” in 2017, as well as “Manifest” in 2018. The news comes on the heels of a bustling start of the year for Zoic across all divisions, including the recent announcement of the company’s second development deal, optioning New York Times best-selling author Michael Johnston’s fantasy novel “Soleri” for feature film and television adaptation as well as the addition of Daniel Cohen as Executive Producer, Episodic and Series in NYC and Lauren F. Ellis as Executive Producer, Episodic and Series in Culver City. About Zoic Studios Zoic Studios is an entertainment company based in Culver City, California, New York, NY and Vancouver, B.C., which creates computer-generated visual effects for film, television, commercials and video games. “Visual Evolution” is their mission: to evolve the story, art, and technology of the moving image. Zoic’s accomplished artists and producers understand story, process, technique and relationships. Their team has a proven track record of success in a range of media including episodic, film, commercials and gaming. Masters in the fields of 3D, Compositing, and Production Management, their elite reputation attracts additional talent and encourages a strong work ethic. Zoic’s relationships with its clients are deep and long lasting. The company is known for results-driven excellence in all endeavors.
Q: How can I check given partial or incomplete python program is syntacticly correct or not How can I write a program which can parse the incomplete and return True if the string of tokens till now can possibly generate syntactically correct python program and False if no syntactically correct python program can be generated ever. Here is an example. programs = ["def foo():", "def ():", "def foo(): return ", "def foo(x):\n else"] def check(program): ''' returns True if program can be possibly completed as a valid python program else False if there doesn't exist any string which can be appended after the 'program' to make it valid python program. ''' pass print([check(program) for program in programs]) >> [True, False, True, False] I know I can use antlr-python runtime which can check run the parser to check the grammar expansion rule in appropriate order, but I need pure python solution. Can I do this with only python ast module if not how can I do it with python-antlr-runtime. A: I was managed to this antlr, here is my solution from antlr4 import * from antlr4.error import ErrorListener from Python3Lexer import Python3Lexer from Python3Parser import Python3Parser class MyErrorListener(ErrorListener.ErrorListener): def syntaxError(self, recognizer, offendingSymbol, line, column, msg, e): if offendingSymbol.type == -1: pass else: raise Exception("syntaxError") def reportAmbiguity(self, recognizer, dfa, startIndex, stopIndex, exact, ambigAlts, configs): raise Exception("reportAmbiguity") def reportAttemptingFullContext(self, recognizer, dfa, startIndex, stopIndex, conflictingAlts, configs): raise Exception("reportAttemptingFullContext") def reportContextSensitivity(self, recognizer, dfa, startIndex, stopIndex, prediction, configs): raise Exception("reportContextSensitivity") def check(program): try: input_stream = InputStream(program) lexer = Python3Lexer(input_stream) stream = CommonTokenStream(lexer) parser = Python3Parser(stream) parser.addErrorListener(MyErrorListener()) parser.file_input() return True except Exception: return False if __name__ == '__main__': programs = ["def foo():", "def ():", "def foo(): return ", "def foo(x):\n else"] print([check(program) for program in programs])
Rakuten Inc., the Japanese online retailer controlled by billionaire Hiroshi Mikitani, is buying the Viber Internet messaging and calling service for $900 million as it moves into social networking. Viber will provide a distribution channel for Rakuten’s digital products, Mikitani said at a briefing in Tokyo. Rakuten also hopes to create a game platform on closely held Viber, which has 300 million users of its instant messaging and free Internet phone services. The acquisition will help Rakuten compete with Naver Corp.’s Line service and Tencent Holdings Ltd.’s WeChat, which both combine instant messaging with shopping and gaming. Rakuten, which wants to have 70 percent of its transactions come from overseas by as early as 2020, recently bought stakes in social-network operator Pinterest Inc. and digital book seller Kobo Inc. as Mikitani tries to boost sales after missing analyst estimates for two straight years. “As smartphones become a more important communication tool than personal computers, Rakuten needs to find a way to link smartphones to its businesses,” said Naoki Fujiwara, a Tokyo- based chief fund manager at Shinkin Asset Management Co. “This deal is probably aimed at linking the two.” The acquisition is being financed through bank borrowing and is expected to close in March, Mikitani said. Rakuten had cash and near-cash items worth 345 billion yen ($3.4 billion) as of Sept. 30, almost quadruple the amount at the end of 2011, according to data compiled by Bloomberg. Rakuten Deals Rakuten wants to capitalize on Cyprus-based Viber’s free messaging, paid stickers and games to expand its current base of about 225 million members, he said. “Viber understands how people actually want to engage and have built the only service that truly delivers on all fronts,” Mikitani said in a statement. “This makes Viber the ideal total consumer engagement platform for Rakuten.” Rakuten Ichiba, the Tokyo-based company’s most-popular service, connects merchants to customers shopping for toys, electronics and clothing as well as selling Japanese goods to customers overseas. Rakuten controlled 27.7 percent of Japan’s Internet retailing market as of last year, according to data from researcher Euromonitor International. Last year, Rakuten acquired digital content platform Viki Inc. In 2012, it acquired Wuaki.tv, a Europe-based video-on- demand and streaming service, and led a group that acquired a minority stake in Pinterest for $100 million. Third-Richest Rakuten rose 1.2 percent to close at 1,657 yen in Tokyo trading yesterday. The stock has gained 5.95 percent this year, compared with a 9.1 percent drop in the broader Topix index. Mikitani is Japan’s third-richest man with a net worth of $9.2 billion, according to the Bloomberg Billionaires Index. His company also competes for online sales with Yahoo Japan Corp., whose biggest shareholder is billionaire Masayoshi Son’s SoftBank Corp. Viber allows people to talk and text on mobile phones without paying a fee. It was developed by Viber Media, which was founded in February 2010, and is now available in 193 countries, according to its website. “There was a sense that we can accelerate the growth of our company by tapping into Rakuten’s user base in various countries,” said Viber Chief Executive Officer Talmon Marco, a co-founder whose family owns 11.4 percent of Viber Media. “We would be able to continue to build Viber, continue to maintain the mentality and speed of a startup while having support.” Skype, WeChat Goldman Sachs Group Inc. acted as sole financial adviser to Viber. The app competes in the market for Internet phone calls and messaging with Microsoft Corp.’s Skype service, WhatsApp Inc. and Tencent Holdings Ltd.’s QQ instant-messaging service and WeChat. QQ had 816 million monthly active users at the end of September, almost seven times the population of Japan. “You just need to look at WeChat,” said Mark Tanner, the founder of China Skinny, a Shanghai-based research and marketing agency. “It’s creeping into every part of Chinese commerce, this WeChat app, and Viber will probably do the same type of thing.” Rakuten yesterday posted annual earnings that were 21 percent below analyst projections, its second straight year of missing analyst estimates. Net income was 42.9 billion yen ($421 million) in 2013, missing the 54.2 billion-yen average of 21 analyst estimates compiled by Bloomberg.
In recent years, flat display panels such as liquid crystal panels and plasma display panels have been increasingly used as display elements for image display devices such as television receivers instead of conventional cathode-ray tubes, allowing for image display devices to be made thinner. In display panels used in such image display devices, a plurality of TFTs are provided in rows and columns as switching elements for controlling the operation of respective pixels. Conventionally, silicon semiconductors made of materials such as amorphous silicon and polycrystalline silicon were generally used for semiconductor films included in the TFTs. In recent years, however, it has been proposed that organic semiconductor films made of organic materials be used for the semiconductor films. Since organic semiconductor films can be formed at low temperatures, it is possible to form the films via a low cost coating process such as spin coating, and it is also possible to use a flexible substrate such as a plastic substrate, for example, in the device; thus, such a film is suitable for a flexible image display device. Patent Documents 1 and 2 disclose examples of semiconductor devices that use such an organic semiconductor film.
1. Field of the Inventions The present inventions relate to the field of material or article handling systems. More particularly, the present inventions relate to a system and a method for an automated storage and retrieval of rotary dies. 2. Background Art FIG. 1 is an illustration of a rotary die storage rack 11 for a manual storage and retrieval of a plurality of rotary dies 10. Each rotary die 10 includes an elongated semi-circular body 10a, and a plurality of cutting blades (not shown) mounted to and upwardly extended from a convex surface of body 10a. Rotary die storage rack 11 includes a frame 12, and a plurality of rotary die shelves 13 disposed within and mounted to frame 12. Rotary die shelves 13 form a grid consisting of five (5) horizontal rows and five (5) vertical columns of rotary die shelves 13. Each rotary die shelf 13 is defined by a left angle iron 13a and a right angle iron 13b. The bodies 10a of each stored rotary die 10 have a left longitudinal edge placed upon left angle iron 13a, and a right longitudinal edge placed upon right angle iron 13b. Alternatively, each rotary die shelf 13 can include a board 13c placed upon left angle iron 13a and right angle iron 13b, and the left longitudinal edge and the right longitudinal edge of a body 10a of a rotary die 10 can be placed upon board 13c. Utilization of board 13c enables two or more rotary dies 10 having dissimilar radiuses to be placed upon board 13c. Prior to the advent of rotary die storage rack 11, the typical storing procedures for rotary dies 10 were to either stand rotary dies 10 on the floor or hang rotary dies 10 from hooks There are several advantages of rotary die storage rack 11 over these aforementioned storing procedures. First, a risk of structural damage to a stored rotary die 10 is reduced when the stored rotary die 10 is being supported by a rotary die shelf 13. Second, a risk of a personal injury to personnel during a storage of rotary dies 10, particularly a risk of being cut by a cutting blade of a stored rotary die 10, is also reduced when rotary dies 10 are being supported by rotary die shelves 13. Finally, rotary die storage rack 11 is a more efficient use of floor space. A major disadvantage of rotary die storage rack 11 is a number of horizontal rows of rotary die shelves 13 is dictated by a maximum height of a horizontal row of rotary die shelves 13 in which a person can easily and safely manually store and retrieve a rotary die 10. As such, in situations requiring additional rotary die shelves 13 for a storage of extra rotary dies 10, rotary die storage rack 11 can only be laterally expanded to include additional vertical columns of rotary die shelves 13, or an additional rotary die storage rack 11 would have to be made or purchased. However, the appropriation of additional floor space for the additional vertical columns of rotary die shelves 13 or for an additional rotary die storage rack 11 may not be feasible or desirable.
// // StatusItemView.swift // ClashX // // Created by CYC on 2018/6/23. // Copyright © 2018年 yichengchen. All rights reserved. // import AppKit import Foundation import RxCocoa import RxSwift class StatusItemView: NSView { @IBOutlet var imageView: NSImageView! @IBOutlet var uploadSpeedLabel: NSTextField! @IBOutlet var downloadSpeedLabel: NSTextField! @IBOutlet var speedContainerView: NSView! weak var statusItem: NSStatusItem? lazy var menuImage: NSImage = { let customImagePath = (NSHomeDirectory() as NSString).appendingPathComponent("/.config/clash/menuImage.png") return NSImage(contentsOfFile: customImagePath) ?? NSImage(named: "menu_icon")! }() static func create(statusItem: NSStatusItem?) -> StatusItemView { var topLevelObjects: NSArray? if Bundle.main.loadNibNamed("StatusItemView", owner: self, topLevelObjects: &topLevelObjects) { let view = (topLevelObjects!.first(where: { $0 is NSView }) as? StatusItemView)! view.statusItem = statusItem view.setupView() return view } return NSView() as! StatusItemView } func setupView() { let fontSize: CGFloat = 9 let font: NSFont if let fontName = UserDefaults.standard.string(forKey: "kStatusMenuFontName"), let f = NSFont(name: fontName, size: fontSize) { font = f } else { font = NSFont.menuBarFont(ofSize: fontSize) } uploadSpeedLabel.font = font downloadSpeedLabel.font = font uploadSpeedLabel.textColor = NSColor.black downloadSpeedLabel.textColor = NSColor.black } func updateViewStatus(enableProxy: Bool) { let selectedColor = NSColor.red let unselectedColor: NSColor if #available(OSX 10.14, *) { unselectedColor = selectedColor.withSystemEffect(.disabled) } else { unselectedColor = selectedColor.withAlphaComponent(0.5) } imageView.image = menuImage.tint(color: enableProxy ? selectedColor : unselectedColor) updateStatusItemView() } func updateSpeedLabel(up: Int, down: Int) { guard !speedContainerView.isHidden else { return } let kbup = up / 1024 let kbdown = down / 1024 var finalUpStr: String var finalDownStr: String if kbup < 1024 { finalUpStr = "\(kbup)KB/s" } else { finalUpStr = String(format: "%.2fMB/s", Double(kbup) / 1024.0) } if kbdown < 1024 { finalDownStr = "\(kbdown)KB/s" } else { finalDownStr = String(format: "%.2fMB/s", Double(kbdown) / 1024.0) } if downloadSpeedLabel.stringValue == finalDownStr && uploadSpeedLabel.stringValue == finalUpStr { return } downloadSpeedLabel.stringValue = finalDownStr uploadSpeedLabel.stringValue = finalUpStr updateStatusItemView() } func showSpeedContainer(show: Bool) { speedContainerView.isHidden = !show updateStatusItemView() } func updateStatusItemView() { statusItem?.updateImage(withView: self) } } extension NSStatusItem { func updateImage(withView view: NSView) { if let rep = view.bitmapImageRepForCachingDisplay(in: view.bounds) { view.cacheDisplay(in: view.bounds, to: rep) let img = NSImage(size: view.bounds.size) img.addRepresentation(rep) img.isTemplate = true image = img } } }
defmodule Tai.Advisors.Groups.RichConfigTest do use ExUnit.Case, async: true alias Tai.Advisors.Groups.RichConfig defmodule TestProvider do @product_a struct(Tai.Venues.Product, venue_id: :venue_a, symbol: :btc_usd) @product_b struct(Tai.Venues.Product, venue_id: :venue_a, symbol: :ltc_usd) @product_c struct(Tai.Venues.Product, venue_id: :venue_b, symbol: :btc_usd) @fee_a struct(Tai.Venues.FeeInfo, venue_id: :venue_a, symbol: :btc_usd, credential_id: :main) @fee_b struct(Tai.Venues.FeeInfo, venue_id: :venue_a, symbol: :ltc_usd, credential_id: :main) @fee_c struct(Tai.Venues.FeeInfo, venue_id: :venue_b, symbol: :btc_usd, credential_id: :main) def products do [@product_a, @product_b, @product_c] end def fees do [@fee_a, @fee_b, @fee_c] end end describe ".parse" do test "can substitute decimals" do config = %{premium: {"-0.3", :decimal}} assert rich_config = RichConfig.parse(config, TestProvider) assert rich_config.premium == Decimal.new("-0.3") end test "can substitute products from provider" do config = %{product_a: {{:venue_a, :btc_usd}, :product}} assert rich_config = RichConfig.parse(config, TestProvider) assert %Tai.Venues.Product{} = rich_config.product_a assert rich_config.product_a.venue_id == :venue_a assert rich_config.product_a.symbol == :btc_usd end test "can substitute fees from provider" do config = %{fee_a: {{:venue_a, :btc_usd, :main}, :fee}} assert rich_config = RichConfig.parse(config, TestProvider) assert %Tai.Venues.FeeInfo{} = rich_config.fee_a assert rich_config.fee_a.venue_id == :venue_a assert rich_config.fee_a.symbol == :btc_usd assert rich_config.fee_a.credential_id == :main end end end
2007 CFL season The 2007 Canadian Football League season was the 54th season of modern Canadian professional football. Officially, it was the 50th season of the league, and many special events were held to commemorate the event. Regular-season play began on June 28, 2007 at the Rogers Centre in Toronto, Ontario and concluded on Saturday, November 3, 2007. The playoffs began on Sunday, November 11, 2007, and ended with the championship game, the 95th Grey Cup, at the Rogers Centre in Toronto, on November 25, 2007, with the Saskatchewan Roughriders as champions. CFL News in 2007 Schedule On February 14, 2007, the CFL announced the game schedule for the 2007 season, introducing a 19-week schedule that included 18 regular-season games and one bye week for each team. Bye weeks were taken consecutively by each division beginning with the East in Week 8, creating two weeks of divisional rivalry games. The year's regular-season schedule kicked off on Canada Day weekend and included the CFL's annual traditional rivalries — highlighted by the Labour Day and Thanksgiving Classics. The Canadian Football Hall of Fame game returned to Ivor Wynne Stadium on induction weekend and featured the Winnipeg Blue Bombers and the Hamilton Tiger-Cats on September 15. The regular-season concluded with a triple-header on Saturday, November 3, as teams finalized post-season positioning before the Division Semi-Finals began eight days later on Sunday, November 11. The CFL's Division Championships qualified the season's two Grey Cup competing teams one week later on November 18. The 2007 season officially concluded with the 95th Grey Cup on Sunday, November 25, returning to Toronto for the first time since 1992. Television On February 28, 2007, the CFL announced details of the 2007 broadcast schedule which included all 77 games broadcast across the country by partners TSN, CBC or RDS. The year's regular season schedule saw 50 games aired on TSN, which were also carried live on TSN Broadband, 22 games on CBC and a minimum of 16 Montreal Alouettes' games on RDS. Coverage of the entire post-season, including the 95th Grey Cup in Toronto, Ontario, returned to CBC and RDS in the fall. The 2007 season would be the CBC's final season as a CFL broadcaster for the foreseeable future, as the CFL and TSN begin an exclusive 5-year deal with the 2008 CFL season. TSN's 50-game CFL broadcast schedule became available for the first time ever on multiple TSN distribution platforms. All 50 games aired live on TSN and TSN Broadband, with a minimum of 35 broadcasts produced and televised in High Definition on TSN HD. The majority of HD telecasts aired Friday nights during the 11th season of Wendy's Friday Night Football. TSN's broadcast schedule got underway on June 28 with a season opening double-header featuring BC at Toronto followed by Winnipeg at Edmonton. Additional highlights included two Grey Cup rematches featuring Montreal vs. BC (Aug. 31 and Sept. 9), the traditional Labour Day Classic Weekend with Winnipeg at Saskatchewan (Sept. 2) and the Hall of Fame Game featuring Winnipeg at Hamilton (Sept. 15). The first of 22 CFL on CBC regular-season games aired on Saturday, June 30 when the Hamilton Tiger-Cats played the Calgary Stampeders at McMahon Stadium. CBC's regular-season line-up featured the first-ever CFL on CBC triple-header as well as the traditional double-headers, the Labour Day and Thanksgiving Day Classics. League Attendance The CFL's average attendance for 2007 was 29,167, which is the highest average since the 1983 CFL season. CFL in Ottawa The Ottawa franchise did not play in the 2007 season. The CFL indicated that there was not enough time for a potential new owner to get the franchise up and running until 2009 at the earliest. Salary Management System 2007 was the first year the new salary cap and salary management system was enforced. The cap was set at $4.05 million and it demonstrated its successful implementation as six clubs were under the salary expenditure cap while two teams exceeded and were penalized. The Saskatchewan Roughriders were fined, as were the Montreal Alouettes, who also lost a first round draft pick at the 2008 CFL Canadian Draft. selection. New Commissioner On March 12, 2007, Mark Cohon was named the CFL's 12th commissioner. The son of McDonald's of Canada founder George Cohon succeeded Tom Wright. Born in Chicago, Illinois, Cohon moved to Toronto, Ontario when he was two years old. Cohon is a graduate of Chicago's Northwestern University with a Bachelor of Science with a major in communication studies and was a business consultant to environmental and youth organizations in Toronto before becoming president and chief executive officer of AudienceView Ticketing, a company which sells ticketing systems and services to sports, arts and entertainment events. In 2006, he was appointed new chair of the Ontario Science Centre. He was appointed to the board of trustees in 2003. Rule Changes The "Ricky Williams Rule" Outgoing CFL commissioner Tom Wright, stated that a rule will be introduced before the start of next season that would prevent a player under suspension in the National Football League from signing with a CFL club. Some columnists dubbed this "The Ricky Williams Rule" because the running back joined the Toronto Argonauts after the NFL suspended him for the 2006 season for failing its substance abuse program for the fourth time. Illegal Movement This rule will penalize offensive linemen 5 yards for abrupt snap down into 2 or 3 point stance. This rule is aimed at eliminating a tactic by offensive linemen, solely designed to draw the defence offside. Kick from Scrimmage On a kick from scrimmage going out of bounds in flight between the 20-yard lines, the receiving team will have the option of taking possession at the point the ball went out of bounds in flight, or having a 10-yard penalty applied against the kicking team at the point of the last scrimmage, with the down repeated. This forces the kicking team on punts and field goal attempts to land the ball in the field of play. Unnecessary roughness Any player in possession of the ball, who falls to the ground without contact and is not attempting to advance the ball, may only be touched down and may not be contacted in any other manner. Players on the ground are in an extremely vulnerable position and should be protected from excessive contact. Horse-collar tackles will be penalized. Contact above the shoulders on the long snapper will be penalized. Roughing the Passer Contact below a quarterback's knees will no longer be accepted. Defensive players may no longer lead with the head or use the head as the primary contact point to hit a passer. Ducking the head and launching at a passer is not acceptable. In the 2006 season, Spergon Wynn was the victim of such a hit at the hands of Scott Schultz. There was no penalty on the play, although Schultz was subsequently fined. Blocking on Kick Returns Players on the return team will once again be allowed to block oncoming tacklers from the sides. This was the rule until 2006, when the CFL outlawed blocks on the back of the side, leading to the temporary demise of the kick return touchdown. In 2006, there were only three touchdowns from kick returns, compared to eighteen in 2005. In addition to fewer touchdowns being scored, shorter kick returns lead to offences having to cover a larger portion of the field to score a touchdown, leading to more field goals and fewer touchdowns. With the long kick returns coming back in 2007, it was expected that games would be higher scoring and more exciting. Records and Milestones Winnipeg Blue Bombers slotback, Milt Stegall passed Mike Pringle and George Reed for the most career touchdowns with 137 on July 27. By the end of the season he had 144 career touchdowns and, with 14,695 career receiving yards, was trying to pass Allen Pitts all-time league record of 14,891 receiving yards. Toronto Argonauts slotback, Derrell Mitchell surpassed Paul Masotti as the franchise's all-time leading receiver on July 26. Winnipeg Blue Bombers running back, Charles Roberts passed Leo Lewis to become the franchise's all-time leading rusher on September 2. BC running back, Joe Smith broke former Lion great Cory Philpot's franchise single season rushing record on October 28. Regular season Note: GP = Games Played, W = Wins, L = Losses, T = Ties, PF = Points For, PA = Points Against, Pts = Points ''Teams in bold finished in playoff positions. Grey Cup Playoffs The Saskatchewan Roughriders are the 2007 Grey Cup Champions, defeating the Winnipeg Blue Bombers 23–19 at Toronto's Rogers Centre. It was the first Grey Cup for the Roughriders since they won it in 1989, ending an 18-year drought. The Roughriders' James Johnson (DB) was named the Grey Cup's Most Valuable Player and Andy Fantuz (SB) was named as the Grey Cup's Most Valuable Canadian. Playoff bracket CFL Leaders CFL Passing Leaders CFL Rushing Leaders CFL Receiving Leaders 2007 CFL All-Stars Offence QB – Kerry Joseph, Saskatchewan Roughriders WR – Derick Armstrong, Winnipeg Blue Bombers WR – Jason Clermont, BC Lions WR – Terrence Edwards, Winnipeg Blue Bombers WR – Geroy Simon, BC Lions RB – Charles Roberts, Winnipeg Blue Bombers RB – Joe Smith, BC Lions OT – Dan Goodspeed, Winnipeg Blue Bombers OT – Rob Murphy, BC Lions OG – Kelly Bates, BC Lions OG – Scott Flory, Montreal Alouettes C – Jeremy O'Day, Saskatchewan Roughriders Defence DE – Jonathan Brown, Toronto Argonauts DE – Cameron Wake, BC Lions DT – Doug Brown, Winnipeg Blue Bombers DT – Tyrone Williams, BC Lions LB – Kevin Eiben, Toronto Argonauts LB – Zeke Moreno, Hamilton Tiger-Cats LB – Barrin Simpson, Winnipeg Blue Bombers DB – Ryan Phillips, BC Lions DB – Kenny Wheaton, Toronto Argonauts CB – Byron Parker, Toronto Argonauts CB – Jordan Younger, Toronto Argonauts DS – Orlondo Steinauer, Toronto Argonauts Special teams K – Nick Setta, Hamilton Tiger-Cats P – Damon Duval, Montreal Alouettes ST – Ian Smart, BC Lions 2007 Western All-Stars Offence QB – Kerry Joseph, Saskatchewan Roughriders WR – Jason Clermont, BC Lions WR – D.J. Flick, Saskatchewan Roughriders WR – Nik Lewis, Calgary Stampeders WR – Geroy Simon, BC Lions RB – Joffrey Reynolds, Calgary Stampeders RB – Joe Smith, BC Lions OT – Gene Makowsky, Saskatchewan Roughriders OT – Rob Murphy, BC Lions OG – Kelly Bates, BC Lions OG – Jay McNeil, Calgary Stampeders C – Jeremy O'Day, Saskatchewan Roughriders Defence DE – Fred Perry, Saskatchewan Roughriders DE – Cameron Wake, BC Lions DT – Aaron Hunt, BC Lions DT – Tyrone Williams, BC Lions LB – Otis Floyd, BC Lions LB – Reggie Hunt, Saskatchewan Roughriders LB – Maurice Lloyd, Saskatchewan Roughriders DB – Korey Banks, BC Lions DB – Ryan Phillips, BC Lions CB – Lavar Glover, BC Lions CB – James Johnson, Saskatchewan Roughriders DS – Barron Miles, BC Lions Special teams K – Sandro DeAngelis, Calgary Stampeders P – Paul McCallum, BC Lions ST – Ian Smart, BC Lions 2007 Eastern All-Stars Offence QB – Kevin Glenn, Winnipeg Blue Bombers WR – Derick Armstrong, Winnipeg Blue Bombers WR – Ben Cahoon, Montreal Alouettes WR – Terrence Edwards, Winnipeg Blue Bombers WR – Milt Stegall, Winnipeg Blue Bombers RB – Jesse Lumsden, Hamilton Tiger-Cats RB – Charles Roberts, Winnipeg Blue Bombers OT – Alexandre Gauthier, Winnipeg Blue Bombers OT – Dan Goodspeed, Winnipeg Blue Bombers OG – Scott Flory, Montreal Alouettes OG – Taylor Robertson, Toronto Argonauts C – Marwan Hage, Hamilton Tiger-Cats Defence DE – Jonathan Brown, Toronto Argonauts DE – Tom Canada, Winnipeg Blue Bombers DT – Adriano Belli, Toronto Argonauts DT – Doug Brown, Winnipeg Blue Bombers LB – Kevin Eiben, Toronto Argonauts LB – Zeke Moreno, Hamilton Tiger-Cats LB – Barrin Simpson, Winnipeg Blue Bombers DB – Randee Drew, Montreal Alouettes DB – Kenny Wheaton, Toronto Argonauts CB – Byron Parker, Toronto Argonauts CB – Jordan Younger, Toronto Argonauts DS – Orlondo Steinauer, Toronto Argonauts Special teams K – Nick Setta, Hamilton Tiger-Cats P – Damon Duval, Montreal Alouettes ST – Dominique Dorsey, Toronto Argonauts 2007 Intergold CFLPA All-Stars Offence QB – Kevin Glenn, Winnipeg Blue Bombers OT – Dan Goodspeed, Winnipeg Blue Bombers OT – Patrick Kabongo, Edmonton Eskimos OG – Andrew Greene, Winnipeg Blue Bombers OG – Scott Flory, Montreal Alouettes C – Marwan Hage, Hamilton Tiger-Cats RB – Charles Roberts, Winnipeg Blue Bombers FB – Chris Szarka, Saskatchewan Roughriders SB – Terrence Edwards, Winnipeg Blue Bombers SB – Milt Stegall, Winnipeg Blue Bombers WR – Derick Armstrong, Winnipeg Blue Bombers WR – Kamau Peterson, Edmonton Eskimos Defence DE – Jonathan Brown, Toronto Argonauts DE – Cameron Wake, BC Lions DT – Doug Brown, Winnipeg Blue Bombers DT – Adriano Belli, Toronto Argonauts LB – Barrin Simpson, Winnipeg Blue Bombers LB – Zeke Moreno, Hamilton Tiger-Cats LB – JoJuan Armour, Hamilton Tiger-Cats CB – Byron Parker, Toronto Argonauts CB – Jordan Younger, Toronto Argonauts HB – Korey Banks, BC Lions HB – Ryan Phillips, BC Lions S – Barron Miles, BC Lions Special teams K – Nick Setta, Hamilton Tiger-Cats ST – Dominique Dorsey, Toronto Argonauts P – Damon Duval, Montreal Alouettes Head Coach Kent Austin, Saskatchewan Roughriders 2007 Rogers CFL Awards CFL's Most Outstanding Player Award – Kerry Joseph (QB), Saskatchewan Roughriders CFL's Most Outstanding Canadian Award – Jason Clermont (SB), BC Lions CFL's Most Outstanding Defensive Player Award – Cameron Wake (DE), BC Lions CFL's Most Outstanding Offensive Lineman Award – Rob Murphy (OG), BC Lions CFL's Most Outstanding Rookie Award – Cameron Wake (DE), BC Lions CFL's Most Outstanding Special Teams Award – Ian Smart (RB), BC Lions CFLPA's Outstanding Community Service Award – Milt Stegall (SB), Winnipeg Blue Bombers Rogers Fans' Choice Award – Charles Roberts (RB), Winnipeg Blue Bombers CFL's Scotiabank Coach of the Year – Kent Austin, Saskatchewan Roughriders Commissioner's Award – Keith Pelley, Toronto Hugh Campbell Distinguished Leadership Award - Bob Ackles, BC Lions References Cfl Season, 2007 Category:Canadian Football League seasons
Who's Nailin' Paylin [Clips + Full Scene From The "FILM"] Sarah Palin If yall have been seeing the many articles on ThisIs50.com about Sarah Palin's Adult Film called "Who's Nailin' Paylin?" brought to u by Hustler Video. Then here is something u might be interested in seeing. ;] Here are 12 clips of the Porn Film.."Nailin Palin" featuring Lisa Ann as Sarah Palin. (Not behind the scenes material this s*** is the real deal) ENJOY. lol "I just heard it today and I've been a loyal unit fan since early days.. Happy to see them doing it.. Banks always been my favorite idk why @lordcezar not feeling it I thought his track was the toughest real hip hop"
Preparation Make the guacamole: add avocado and tomatillos to a medium bowl and season with salt and pepper; mash gently with a fork. Add onion, cilantro, jalapeño, and lime juice; mix gently. Cover surface with cling wrap and set aside. In a large skillet over medium-high flame, heat the olive oil. Add peppers, onion, and garlic. Season with salt and pepper. Sauté until softened and just cooked through. Make the spice mix: in a small bowl, stir together chili powder, paprika, brown sugar, onion powder, garlic powder, oregano, cumin, and cayenne. Gently form four 6 ounce patties, being careful not to over work the meat. Season both sides of each patty with salt and pepper. Season both sides of each patty with spice mixture. Allow spices to sit for 10 minutes before cooking. Cook your patties to desired doneness (we recommend medium-rare), using a hot oiled grill or pre-heated, lightly-greased cast iron pan. Just before patties are finished cooking, top each with 2 slices of cheese and cover until cheese melts. Allow patties to rest on a cutting board, for about 5 minutes. While patties are resting, spread softened butter on the bread and cook on a griddle, or broil on high heat until golden brown. Customer Service Follow Us D'Artagnan 100% Guarantee Our consistent quality and commitment to excellence has kept the D'Artagnan name in the best American restaurants and kitchens for more than 30 years. D'Artagnan is confident our meats and prepared foods are the best tasting you'll find, which is why we back every purchase made at dartagnan.com with a 100% Satisfaction Guarantee.Learn more
Trump For Romney? Romney went overboard in his criticisms of Trump during the heat of the election and he should be forgiven. Fifty million Americans have said or thought worse and as they gradually come around, they too, need to be forgiven. Trump has been a great president so far and he could go on to be a historic one, but that REQUIRES widening his base. This mid-term and the next presidential election are the two chances he has to do that. Widening the base is a complicated feat. Trump has to bring new believers on board, whilst not alienating the ones he already has. I think he has brilliant political instincts and will make the right choices. Trump also needs to be less sensitive to HONEST criticism — I understand the need to fight lying leftist loony tunes Pelosi and Schumer, they are human garbage, lie after lie, but Romney isn’t in that category, he is a man with a following in the exact camp Trump could pick up supporters in, something that would be very good for him in states other than just Utah. I hope the President’s political team has this critical factor under consideration. Whichever way the President goes, I support him, I just hope he hears McConnell, because sometimes he whispers when he should be shouting. Senate Majority Leader Mitch McConnell from this AP report: AP — Senate Majority Leader Mitch McConnell (R-Ky.) said that President Trump should back Mitt Romney‘s Senate bid, saying that the former presidential candidate bolsters the GOP’s prospects of holding onto the seat currently held by Sen. Orrin Hatch (R-Utah). “We don’t want to lose the seat, and this looks like a pretty formidable candidate,” McConnell told The New York Times in an interview on Friday. Asked whether Trump is comfortable with Romney’s Senate bid, McConnell replied: “I can’t imagine that he’s not.” After months of speculation, Romney announced this week that he would run to succeed Hatch, the longest-serving Republican currently in the Senate. Hatch, 83, said last month that he would not seek an eighth term in office. The White House had pressed Hatch to run for reelection in 2018, largely in hopes of deterring Romney from seeking the Senate seat, according to the Times. Romney, a former Massachusetts governor who challenged former President Obama for the White House in 2012, has been a vocal critic of Trump. Speaking at a GOP dinner in Provo, Utah, on Friday, Romney vowed to break from Trump when he believes it is necessary. “I’m not always with the president on what he might say or do, and if that happens, I’ll call them like I see them, the way I have in the past,” Romney said, according to the Times. He did, however, mention that he supports much of Trump’s domestic agenda. McConnell told the Times on Friday that Romney would enter the Senate with a profile similar to the one Hillary Clinton had when she ran successfully for Senate in 2000. “The best way to think about that, and I told [Romney] this a couple of months ago, I said: ‘You’ll be a freshman like Hillary Clinton was,’ ” McConnell said. “He will come in here with a level of national identity and respect that will make him effective from Day 1.”
How England can match the German blueprint Germany's fourth World Cup triumph at Brazil 2014 proved a decade in the making. Here, we examine how England could emulate Joachim Low's men and arrest years of underachievement. Jurgen Klinsmann's overhaul of Germany's footballing style has been built upon by Joachim Low. Credit: PA IDENTITY Germany's winless campaign at Euro 2004 precipitated Jurgen Klinsmann's ascent as the new national coach. The former Tottenham striker quickly set about a wide-ranging overhaul not just of an ageing squad, but also an outdated footballing style. Klinsmann challenged Germany to develop a team in the country's image: based on quick tempo and high quality. Germany have used that style as a base ever since, centred around accuracy in technique. England have sorely lacked the technical wherewithal for international success for nigh on a generation: a long-term strategic blueprint must be devised now, to be implemented at every junior-level side, as well as employed by the seniors. Neuer, Ozil, Howedes, Boateng, Khedira and Hummels all were given their chance after encouraging at under-21 level..
Adenovirus colitis in human immunodeficiency virus infection: an underdiagnosed entity. Adenovirus infection of the gastrointestinal tract in human immunodeficiency virus (HIV)-infected patients is rarely reported, probably because of a lack of familiarity of most pathologists with diagnostic criteria during routine light microscopy and possible misidentification as cytomegalovirus infection. We studied colonoscopic biopsy specimens from 135 HIV-infected patients with clinically suspected cytomegalovirus colitis during a 4.5-year period to morphologically identify the presence of adenovirus infection. Immunohistochemical staining for adenovirus was performed for confirmation on all suspected cases. Adenovirus infected cells showed characteristic amphophilic or eosinophilic nuclear inclusions, predominantly affecting the surface epithelium and characteristically involving goblet cells. Sixteen cases showed morphologic features of adenovirus infection, all confirmed by immunohistochemistry. Twelve cases also showed cytomegalovirus infection, whereas 4 showed adenovirus alone. In 10 cases, adenovirus colitis was not recognized during initial routine histopathologic diagnostic evaluation. Adenovirus inclusions also were discovered in the stomach, the duodenum, and the liver in single cases. Conclusions are as follows: (1) Adenovirus colitis has been underdiagnosed at our institution and, we suspect, in general. (2) The morphologic features and nuclear inclusions of adenovirus colitis are characteristic and can be identified reliably by routine light microscopy. (3) Adenovirus infection also may be diagnosed morphologically in extracolonic sites, such as the stomach, the small intestine, and the liver. (4) Coinfection of adenovirus with cytomegalovirus and other agents is seen frequently, but, less frequently, adenovirus may be identified as a sole pathogen.
RightStuff tattoo machines is a company maker whose priority is our customers’ satisfaction, and thus the tattoo machines, that are the main part of our production, are the effect of experience of the experts from many fields.For those people, who have an idea of opening a tattoo studio, or whose tattoo business is growing and needs renovation or purchasing new tattooing equipment , it is important to have reliable accessories of high quality.What makes a professional tattoo artist? For sure, he should be a man of fine artistic taste and possess the vision of aesthetics. Also, a real professional should be a man of experience, have good skills in tattoo art and be able to satisfy the clients` needs. However, even the best tattoo artist won’t be able to release all his creative potential without high-quality tattoo equipment. High quality tattoo stuff from our online tattoo supply store allows tattoo artist to work quicker and easier, and also help him to satisfy the most sophisticated clients` wishes. So, if you want your tattoo studio to provide high-quality service, make sure you work with professional tattoo artists and quality, reliable tattooing accessories. If you want to order quality tattooing equipment wholesale, the first thing you need to do is to find reliable people, who have a lot of experience in the tattoo industry and who will be able to deliver worldwide you the finest equipment, that will be suitable for your work. Our professional tattoo supplies will not only help you choose the right supply in store, but also prevent you from worrying, overpaying and spending extra time. Choosing Right Stuff tattooing equipment you can be sure in its long reliable work, you don’t need to worry about tuning, our accessories is not requiring any preliminary manipulations, it is ready for work just from the moment you open the package and take it out. We take into consideration all possible demands of a tattoo artist and as well you get a long time warranty from the builder. The Right Stuff online internet shop provides you reliable, quality tattoo equipment, as well as individually constructed custom tattoo machines with the application of handwork techniques. Having chosen to order your tattoo equipment in the Right Stuff, you can be sure you will purchase it quickly, not wasting a single minute. Our specialists are able to answer any of your questions and give you a good piece of advice about the tattoo gear. We are always happy to collaborate with new customers! Each person starting his tattoo business or any tattoo master can order the needed for his job equipment and goods at RightStuff. The ordered stuff is quickly and safely delivered to the customers living in the USA and Canada, to our Asian and European clients. Our best propositions The RightStuff store offers each one interested in saving money and getting exclusively high-quality stuff for tattoo business the following products: Besides the offered things, you can always get the books on tattoo – from the pictures’ collections interesting both for artists and their clients to special literature on this business. Our company makes sales also. Ordering the chosen product online on our website – tattoo supply shop Select the tattoo product that interests you now; pick its specifications and characteristics (the quantity, color, size, etc.) and add it to the “Cart”. Go on shopping until you get you have marked all the goods you wish to order. Visiting the Checkout page, fill in the form, providing us your contact information that includes your name, country and address. Pick the way of payment that is more comfortable for you. When planning to shop online at RightStuff tattoo store further, create your account. We never deal with any private information, giving it to the third persons. Thus, your privacy will be respected.
Q: C++ Inheritance Problem leads to segmentation fault Here is some sample code to illustrate the problem I am having. #include <iostream> using namespace std; class Foo { public: Foo(int x) { m_x = x; } int getX() { return m_x; } private: int m_x; }; class Bar : public Foo { public: Bar(int x) : Foo(x) {} //some other stuff }; int main() { Bar* bar = new Bar(5); cout<<bar->getX()<<endl; return 0; } I have a large project that I am working on and I have a similar situation to above. When bar->getX() is called the this pointer is 0x0 causing a segmentation fault. I have tried copping the getX function to the Bar class but this does not fix the problem, the this pointer is still 0x0. Any ideas? I have no idea how to google for this, only found people having problems with virtual functions. ps. This sample works. EDIT: std::cout<<m_engine<<std::endl; focus_x = m_engine->getX(); The output is:0x2e6d763638667858 (not NULL), so that is not the problem... A: My guess, from your edit, is that m_engine is a dangling pointer. That is, the memory pointed to by m_engine has been deleted. You still have the address where the memory was allocated stored in m_engine, but when you try to access that address in memory expecting a valid Foo, Bar, etc. object to be there, that portion of memory has been reclaimed by the operating system and another object is possibly using that memory. Accessing memory that has been deallocated is undefined behaviour in C++. I suggest you add a breakpoints in the m_engine destructor (whatever the class is) to see who is deleting m_engine. The other possibility is memory corruption, but this is much harder to diagnose.
Patent-holding company TQP Development made millions claiming that it owned a breakthrough in Web encryption, even though most encryption experts had never heard of the company until it started a massive campaign of lawsuits. Yesterday, the company's litigation campaign was brought to an end when a panel of appeals judges refused (PDF) to give TQP a second chance to collect on a jury verdict against Newegg. The TQP patent was invented by Michael Jones, whose company Telequip briefly sold a kind of encrypted modem. The company sold about 30 models before the modem business went bust. Famed patent enforcer Erich Spangenberg bought the TQP patent in 2008 and began filing lawsuits, saying that the Jones patent actually entitled him to royalties on a basic form of SSL Internet encryption. Spangenberg and Jones ultimately made more than $45 million from the patent. Newegg finally took the TQP patent to a jury trial but lost in 2013 when a jury said Newegg should pay $2.3 million for infringement. But after a long delay, Newegg still won the lawsuit on post-trial motions. US District Judge Rodney Gilstrap agreed with Newegg's lawyers that because the company's encryption scheme didn't change "key values" with each block of data, it couldn't possibly fit into the description of the Jones patent. TQP appealed its case, and oral arguments were heard at the US Court of Appeals for the Federal Circuit on February 8. Yesterday, the three-judge panel found in Newegg's favor, issuing a short two-page order that did not explain its reasoning. While TQP could theoretically still appeal to the full Federal Circuit or to the Supreme Court, it's far from clear there's any legal issue in the case that would compel either of those bodies to take the case. Newegg and its former chief legal officer, Lee Cheng, have long taken an uncompromising view on the necessity of fighting what they term "patent trolls" in court. The TQP Development trial, in which Cheng faced off against Spangenberg, may end up being Newegg's last high-profile patent trial. In October, Cheng left Newegg for Nashville-based guitar maker Gibson Brands. The Newegg win did not invalidate the TQP patent, which expired in 2012. No new cases have been filed since 2014. After the trial against Newegg, the TQP patent was sold, according to former owner Spangenberg. The new entity's ownership is unclear, but it is still represented by the same lawyers from Los Angeles-based Russ, August and Kabat. TQP lead attorney Marc Fenster didn't respond to a request for comment on the appeals court ruling. "Newegg’s e-commerce encryption systems never infringed TQP’s patent, which is directed to outdated modem technology from the 1980s," Newegg lawyer Dan Brean told Ars via e-mail. "The differences are clear and fundamental in terms of how and when data is encrypted and transmitted. That is why Judge Gilstrap entered judgment in Newegg’s favor despite the jury’s verdict, and the Federal Circuit has now affirmed that judgment." "I’m glad that this is finally over," added Newegg lawyer Kent Baldauf. "We have lived with this a long time as it was filed in 2011. This patent troll case was particularly troubling as it not only involved an antiquated technology that has never been used by modern Internet retailers such as Newegg, but it was also asserted to cover the foundational developments of luminaries in the field of encryption such as Ron Rivest and Whit Diffie. We are thankful that Newegg once again stood up to a patent troll and refused to settle based upon a patent that it did not infringe."
Property companies have made millions of pounds by buying land from the Ministry of Defence and applying for planning permission, before selling on the sites. In several cases, no building occurred before the resale; on other sites, no development at all has occurred years after the original sales. In most cases, the MoD failed to ensure that any of the windfall profits were returned to the taxpayer. Nia Griffith, the shadow defence secretary, said the transactions were appalling and the MoD should have ensured the developers could not simply sell the land on at a large profit. “The absurd thing is that there is a mechanism when you dispose of land to claw back some of the profits,” said Griffith. “That is quite standard among local authority sales. It is bizarre that the MoD doesn’t do it.” The property company IM Land bought part of the former MoD Ensleigh site outside Bath for £17.1m in June 2013. Within less than three years, approximately a third of the site was sold to housing developers for £11.3m. Further smaller parcels of land have been sold for almost £10m and IM Land, which is owned by the Conservative donor Lord Edmiston, still owns around a third of the site. Houses on the site are being built by Linden, which is part of Galliford Try, and Bloor Homes, which was founded by the Conservative donor John Bloor. The average house price rose by 23% between 2013 and 2016, according to Land Registry data. A spokesperson for IM Group said: “MoD Ensleigh was acquired by IM Group following a full marketing campaign conducted by the MoD and their appointed advisors. This marketing campaign determined the open market value achievable for the site.” In June 2013, RAF Brampton, just outside Huntingdon in Cambridgeshire, was sold to a Jersey-based company called JCAM Commercial Real Estate Property for £10.1m. Over the past two years, the land has been sold off in parcels for more than £28m. Part of the site was sold to the Metropolitan Housing Trust housing association for £14.5m. The shadow defence secretary, Nia Griffith, says the MoD should have ensured the developers would not simply sell the land on at a large profit. Photograph: Gareth Fuller/PA Archive/PA Images Tim Leslie, the founder of JCAM, said his company had demolished buildings on the site and spent money on roads, as well as making payments of £7.3m through the community infrastructure levy and to the council. “Buying land without planning permission is a risky business and, when successful, the returns should reflect that,” said Leslie. “Our gain will be in line with what we expect to make when we buy land and then achieve planning. Clearly, if the MoD had achieved a planning consent and then sold the land, they would have achieved a significantly higher price.” Another former MoD site in Bath was bought by the property developer Square Bay for £12.5m in March 2013. It was sold on in March 2016 for £29m. Square Bay was also involved in buying Fremington training camp in north Devon, which was sold in December 2010 for £3.4m. The members of the partnership set up to buy the training camp, Fremington Developments LLP, included companies registered in the British Virgin Islands, Switzerland and Hong Kong. In February 2014, three years and two months after the land was bought from the MoD, it was sold for £10.1m to Bovis Homes and a division of Barratt Homes. Markham Hanson, a partner in Fremington Developments and the managing director of Square Bay, said the company had spent more than £1m to achieve planning permission on the Fremington site. Hanson said the land had been bought on the open market, following a marketing campaign by the MoD. Hanson said: “We acquired the site without planning consent and with a high degree of risk attached due to the fact that the site had some challenging access issues that needed to be overcome, and a slow development market in the UK at the time.” The sales come after the controversial purchase of thousands of MoD houses by Annington Homes, a company owned by a Guernsey-based fund managed by the private equity tycoon Guy Hands. An MoD spokesperson said: “We look to achieve the greatest return for the taxpayer when selling land and have made over half a billion pounds in sales since 2010. Every penny is reinvested back into our armed forces. “Applying for planning permission before selling land does not always provide best value for the taxpayer. It can delay the sale, is not always granted and can restrict the freedom of potential buyers to develop the site according to their needs.” • This article was amended on 19 March 2018 to correct the spelling of Galliford Try from Gallimore.
Under President Donald Trump's administration, more kids separated at border than originally estimated: Report Tough Trump-era policies contributed to the family separations, HHS says. Under President Donald Trump's administration, thousands more kids may have been separated from their parents at the border than was previously known, according to an internal government report released Thursday, with a "steep increase" of such cases almost a year before "zero tolerance" began. The latest findings by the Health and Human Services Inspector General's office suggests that tough immigration policies embraced early in Trump's term contributed to the family separations. Also, poor communication among federal agencies and informal tracking systems made it difficult to track whether the kids ended up with their parents, sponsors or in foster care, the internal watchdog reported. "The total number of children separated from a parent or guardian by immigration authorities is unknown," according to the report. The report's conclusions triggered a fierce backlash among House Democrats, including Rep. Elijah Cummings of Maryland, who chairs the House Oversight and Reform Committee and called the Trump administration's immigration policies "callous and immoral." "This is government-sanctioned child abuse, and the whole ordeal is a stain on our nation and our values," said Democratic Rep. Rosa DeLauro of Connecticut. Democratic Rep. Lucille Roybal-Allard of California said "When Republicans controlled the House, President Trump may have thought he could get away with this cruelty and incompetence. But those days are over." DeLauro and Roybal-Allard will be the top Democrats this year on committees that oversee spending for immigration-related programs, including the care of migrant minors in government custody. The Trump administration has defended its handling of what it says is both a security and humanitarian crisis at the border and points to the influx of families claiming asylum. In a statement released Thursday, HHS said it has "accounted publicly" for all children separated by their families who were in its care when a federal judge intervened after a lawsuit had been filed objecting to the policy. "HHS faced challenges in identifying separated children," according to the agency's statement. "The effort undertaken by HHS was complex, fast-moving, and resource-intensive. (The IG) report provides a window into the herculean work of the HHS career staff to 'rapidly identify children in (its) care who had been separated from their parents and reunify them." "Zero-tolerance" was a policy announced in spring 2018 by then-Attorney General Jeff Sessions that mandated prosecution of illegal border entries, even without evidence of more serious crimes like drug trafficking. Because many of the adults were traveling with children, and the federal courts have determined that children can't be detained for extended periods of time, the policy resulted in the separation of some 2,700 children in a matter of weeks. With the parent in detention, the child would be designated an "unaccompanied" minor and provided to the HHS Office of Refugee Resettlement. HHS still oversees the care of some 10,500 migrant minors, who are mostly older kids and teens who crossed the border alone. According to the latest report, however, the true scope of family separations under Trump might be difficult to assess. In addition to that 2,700 estimation the agency has provided to a federal judge, government investigators found that "thousands of children may have been separated during an influx that began in 2017," almost a year before zero-tolerance policy even began. In some cases, minors are separated from guardians if there is evidence of a serious crime other than the illegal border crossing. That policy is similar to previous administrations, which would separate families if U.S. officials thought doing so was necessary to protect the child from harm. But according to the report, tracking data suggests there was a sudden uptick in separations shortly after Trump took office. Whereas children separated from their families represented only 0.3 percent of minors in U.S. custody in late 2016, that number shot up to 3.6 percent by August 2017. Sessions announced the zero-tolerance policy in the spring of 2018. But Trump abandoned the approach amid a public backlash, and by June 2018, a federal judge ruled in favor of families represented in a lawsuit and ordered that the children should be reunited. HHS has been updating the judge on its progress. As of last December, the government told the court there were only eight kids still waiting to be reunited. A more current update was not available due to the government shutdown. This version corrects attribution of the quote by Rep. DeLauro to note it was not a joint statement with Roybal-Allard, who commented separately.
Boughs and Birds - Fold Up Save the Date Item Description and Details Description and Details Sweetly perched above and below your save the date wording, these lovebirds deliver your wedding details with elegance and grace. Your photo appears below your wording. Design and wording are printed in your choice of colors and fonts. Fold up save the dates are cleverly designed to fold into a self-mailing piece. Seals are included for securing the save the date closed when mailing. Your return address is printed on the outer flaps of these unique save the dates for no additional cost. Envelopes not needed. Price Includes: Save the Dates Size: 3 7/8" x 5 5/8" folded Card Type: Self-Mailer Paper Weight: Paper Options Available Printing Method: Flat/Digital Ink Color(s) Shown: Pewter, Surf Font(s) Shown: Copperplate Gothic 32bc (CPG), Carolyna (CPK) Wording Shown: N991 Personalization Options: Design is printed as shown. Your wording is printed in your choice of colors and fonts. Your choice of photo. Sample Price: $0.99 Please Note: Seals are included for securing the save the date closed when mailing. Your return address is printed on the outer flaps of these unique save the dates for no additional cost. Envelopes not needed. If ordered today, we estimate your order will be printed, packed and ready for shipment on Friday, November 23. Description and Details Sweetly perched above and below your save the date wording, these lovebirds deliver your wedding details with elegance and grace. Your photo appears below your wording. Design and wording are printed in your choice of colors and fonts. Fold up save the dates are cleverly designed to fold into a self-mailing piece. Seals are included for securing the save the date closed when mailing. Your return address is printed on the outer flaps of these unique save the dates for no additional cost. Envelopes not needed. Price Includes: Save the Dates Size: 3 7/8" x 5 5/8" folded Card Type: Self-Mailer Paper Weight: Paper Options Available Printing Method: Flat/Digital Ink Color(s) Shown: Pewter, Surf Font(s) Shown: Copperplate Gothic 32bc (CPG), Carolyna (CPK) Wording Shown: N991 Personalization Options: Design is printed as shown. Your wording is printed in your choice of colors and fonts. Your choice of photo. Sample Price: $0.99 Please Note: Seals are included for securing the save the date closed when mailing. Your return address is printed on the outer flaps of these unique save the dates for no additional cost. Envelopes not needed. If ordered today, we estimate your order will be printed, packed and ready for shipment on Friday, November 23.
If Shakespeare's Juliet had asked Craig LeHoullier "What's in a name?," LeHoullier would have pushed back on her contention that names are meaningless conventions. That's because LeHoullier knows the importance of genealogy in regards to heirloom tomatoes. To LeHoullier, what's in the name of an heirloom tomato is a fascinating history of the conscientious gardeners who passed seeds through succeeding generations. He compares this to six degrees of separation: If any link in the chain had been broken, these tomatoes, cherished relics of the gardening world, would have been lost for all time. Storey Publishing "Heirlooms are living things, and unless they are grown and saved and shared and relished, they'll go extinct," he said. This is a central message in his book, "Epic Tomatoes: How to Select & Grow the Best Varieties of All Time," which won the Garden Writers Association Gold Award in 2016. It includes information about selecting and growing heirloom tomatoes as well as some of his favorite heirloom tomato stories. These are topics LeHoullier knows well. A lifelong gardener, LeHoullier has specialized in heirloom tomatoes for 30-plus years and annually grows an average of 150 varieties in pots and bags on the driveway of his home in Raleigh, North Carolina. He calculates that he has grown or tasted more than 3,000 tomatoes and played a role in introducing more than 200 types. A retired chemist in the pharmaceutical industry, he has been an ambassador for heirloom tomatoes since an "aha!" moment in 1986 when he discovered Seed Savers Exchange, an Iowa nonprofit that preserves heirloom plants. "That started me down the path of yellow and purple and green and white and heart-shaped and all these other tomatoes," he said. "It also kind of captured the fact that I love history and genealogy and that I love to share information. The thought of growing 50 different tomatoes that look and taste different and most of them have interesting stories ... it was almost like a perfect intersection of many aspects of life that I enjoy." Here are his six favorite stories about the names behind heirloom tomatoes, old varieties that are open pollinated by wind or insects. Only one story is about a red tomato; the others are about a purple, a pink, a yellow and two whites. And if by the end of this story, you find yourself wanting to grow one of these but can't find seedlings, we've included a list of companies that carry seeds of one or more of these varieties as well as seeds of other heirloom tomatoes at the end. 1. Cherokee Purple Kip Dawkins Photography, from 'Epic Tomatoes' by Craig LeHoullier (Storey Publishing) This is one of the most popular heirloom tomatoes and one that LeHoullier named. After LeHoullier joined the Seed Savers Exchange, he started building his heirloom seed collection through magazine seed swaps. This was about 1998-1990, and word got out that he was collecting seeds, growing tomatoes from the seeds, and then disseminating seeds through the Seed Savers Exchange. As a result, each spring people started mailing him heirloom tomato seeds. One such envelope arrived in 1990 from John D. Green in Sevierville, Tennessee. Green included seeds and a letter that said the seeds were from a purple tomato passed down from the Cherokees and grown more than 100 years ago. LeHoullier suspected it was really a pink tomato because, he said, old seed catalogs often described pink tomatoes as purple. Still, he decided to plant the seeds and see what happened. To his amazement, as the fruit ripened he and his wife, Susan, saw a color they'd never seen before. And they knew they were the recipients of something truly special when they tasted the tomatoes. "They were absolutely delicious," LeHoullier said. He wanted to share seeds from his discovery with other heirloom tomato growers, but he needed to name the tomato first. "Based on information Mr. Green shared with me, I thought Cherokee Purple was as good a name as any," LeHoullier recalled. Next, he called his friend Jeff McCormick, who ran Southern Exposure Seed Exchange at the time, to tell him about a tomato with an unusual color, interesting history and great flavor. The next spring, McCormick grew plants with LeHoullier's seeds. He loved the taste but worried about the color, so he called LeHoullier and said, "Well that’s a fine tasting tomato, but it's funny looking. It looks like a leg bruise, and I'm not sure the public will accept it. I'll tell you what. I'll carry the seed in my catalog, and we'll see what happens." Parallel to sharing the seed with McCormick, LeHoullier also shared the seed through the Seed Savers Exchange. To say the tomato has been popular since is an understatement; it's been a runaway hit. Growing tips: The first rule in buying Cherokee Purple seed is to be confident of your seed source, advised LeHoullier. So many people and companies are involved in seed saving now that mistakes can happen with an open-pollinated crop like a tomato because bees can get in and provide crosses that people don't detect, LeHoullier said. "I've been to enough markets and enough tastings to know that many heirlooms aren't what they are supposed to be. I've seen Cherokee Purples that have the wrong size, the wrong color, the wrong flavor and the wrong internal structure." If you're working with seedlings you've grown or purchased, plant them deep when putting them in pots or in the garden. (When planted deep, tomatoes will sprout roots along the stem.) Then get ready for a rambunctious plant. It's not the tallest of the indeterminate, meaning infinitely growing, heirlooms, but it needs a strong stake or cage to keep it under control. It also produces a very good fruit set. It will grow well in the Northeast, but it excels in the South and Southeast. It seems to have developed some naturally inbred disease tolerance and resistance, perhaps due to is supposed Tennessee origins. LeHoullier said it's one of the last tomatoes to go down to disease for him year after year, no matter the weather. Flavor: "I love a tomato that attacks my taste buds and Cherokee Purple does that," LeHoullier explains. "It soothes the senses. It's intense. It's got some elements of acidity, some elements of sweetness and it's also got a nice texture that's very juicy and very smooth. So, I would describe Cherokee Purple as being one of those tomatoes that kind of has it all in terms of the intensity, the complexity the fullness and the balance. To my taste buds, there are not a ton of tomatoes with that level of uniform excellence. Having grown 3,000 tomatoes and counting in my career, Cherokee Purple always rises into the top 10 of my tasting experience." 2. Radiator Charlie's Mortgage Lifter (aka Mortgage Lifter) Kip Dawkins Photography, from 'Epic Tomatoes' by Craig LeHoullier (Storey Publishing) The story of this tomato originates in the late 1920s in Logan, West Virginia, with a man named M.C. Byles. As the story goes, Byles lived at the bottom of a hill in the mountains, LeHoullier said. Byles' job was to repair truck radiators. The trucks would overheat going uphill, and when they came back down, the drivers would have to get the radiators repaired, which Byles would do. Byles was also an avid gardener and had a goal of creating the biggest tomato possible. In trying to achieve this goal, he used a unique method of putting a plant that produced large tomatoes in the middle of a circle of three other tomato varieties. The central tomato was German Johnson, a large and pretty-well known North Carolina heirloom, although no one knows the exact history behind it, LeHoullier said. When the plants produced flowers, Byles would take a baby ear syringe and pull pollen from the flowers on the periphery and put them on the German Johnson's flowers. Byles would take seeds from the pollinated German Johnson tomatoes and save them to plant the next year. After some years of repeating this process, Byles claimed he had produced a plant that would produce enormously large tomatoes weighing two-to-three pounds. Byles decided to publicize his tomatoes and let people know he would have seedlings of a tomato variety that would produce enormous fruit. He would sell them for either $2 or $2.50 each. Word got out and people would come from miles around to buy Radiator Charlie's seedlings. "This is the late 1920s early '30s, the economy wasn't great and people are paying $2.50 for a tomato plant!" LeHoullier marveled. "He sold so many of these tomatoes that he paid off a $5,000 or $6,000 house mortgage within a few years. And so, the tomato became known as Radiator Charlie's Mortgage Lifter. Talk about a combination of cleverness and savviness! I think this is just a great homey story." "Those of us who grow Radiator Charlie's Mortgage Lifter to this day will often find that it is indeed the largest tomato that we grow," LeHoullier said. "I have grown them to two-three pounds." Growing tips: "Mortgage Lifter is a huge tomato that grows on huge vines," said LeHoullier. "The best way to succeed with Mortgage Lifter is to provide a tall stake or grow it in a cage. It needs full sun — like most very large-fruited heirlooms, more sun means a better chance at a good yield. Summers that are very hot (above 90 degrees for extended stretches) and humid will be tough on Mortgage Lifter, which will suffer quite a lot of blossom drop, reducing yield." Flavor: "This is not a top 10 tomato for me in flavor," said LeHoullier. "It's probably a top 50. The reason for that is because it tastes a lot like many of the other large, pink beefsteak type tomatoes." To LeHoullier, that means it tends to be a little more on the sweet side and lacks the complexity of Cherokee Purple. Still, he calls it a superb tomato. 3. Lillian's Yellow Heirloom Kip Dawkins Photography, from 'Epic Tomatoes' by Craig LeHoullier (Storey Publishing) After Epic Tomatoes came out, LeHoullier was invited to appear on "The Splendid Table" in 2015. During the show, he was asked to name three tomato varieties he would want if he was stranded on a deserted island. Number one, he said, was the orange cherry tomato Sun Gold for its unique flavor and incredible productivity (which, LeHoullier points out, is not an heirloom). Number two was Cherokee Purple. Number three was Lillian's Yellow Heirloom. This is an obscure tomato but one that deserves wider recognition, LeHoullier said. He describes it as a large bright yellow tomato, almost white canary yellow, with flesh that is an ivory-tinged yellow. The fruit grows to one and a half pounds on vigorous plants with dark green potato-leafed foliage. The tomato is named for Lillian Bruce. She lived in Tennessee and liked to save seeds. Her sons helped her do this by scanning flea markets and farmers markets for interesting produce. One day — no one knows exactly when — they brought her a yellow tomato. She loved it, saved seeds from it and grew it in succeeding years. The seeds made their way to a seed saver named Robert Richardson, a Seed Savers Exchange member in New York. He knew how much LeHoullier loved tomatoes and sent him seeds from Lillian Bruce's yellow tomato. They arrived in a packet simply labeled Lillian's No. One. LeHoullier found the name bland and boring and didn’t have high hopes that the seed would produce anything special. "But, I thought, this is a new tomato, so let's try it out," he said. "And I was just blown away by the flavor. It is a top-five in flavor and beauty, and it hardly has any seeds." But it bothered him that Lillian's No. One wasn't a very good name, so he called it Lillian's Yellow Heirloom and started sending seeds to some seed companies, including Victory Seeds and Tomato Growers Supply. "So, it's starting to get widely grown and accepted." Growing tips: "Lillian's Yellow Heirloom is no more difficult to grow than any of the larger heirlooms." LeHoullier said. "What makes it different is that it is typically one of the latest tomatoes to ripen. It therefore takes patience ... but that patience will be richly rewarded." Flavor: The amount of flesh versus the size of the seed cavity makes this tomato a little exceptional. "If you were to think of the tomato equivalent of a piece of steak where you know it's just solid flesh, Lillian's Yellow has almost solid meat with just some tiny, tiny seed cavities spread throughout the periphery," LeHoullier said. "In fact, if you were to save seeds from it, you would get no more than 10, 15 or 20 seeds from a pound or a one-and-half-pound tomato. That is really on the low end. Many tomatoes will give you a couple of hundred seeds from a one-pound tomato. It is succulent and it melts in your mouth. Many people think that a tomato with that kind of texture will be dry and mealy, but this one just is just amazing. Like Cherokee Purple and Brandywine, it has intensity and balance. It's one of the tomatoes that I call delightful, not even knowing what that word means except that it sparkles in your mouth." 4. Viva Lindsey's Kentucky Heirloom (aka Kentucky Heirloom Viva) Kip Dawkins Photography, from 'Epic Tomatoes' by Craig LeHoullier (Storey Publishing) LeHoullier confesses that this is not his favorite tomato to eat, but he loves the story behind it. That story begins, he said, at a time when he was captivated by the description of tomatoes in the Seed Savers Exchange. One description that especially intrigued him was about Viva Lindsey's Kentucky Heirloom, also known as Kentucky Heirloom Viva. The catalog described it as ivory white and delicious to eat, so he ordered it from a historical garden center in Kentucky. Viva Lindsey, he found out, was a friend of a family named Martin, and it was the Martin family who donated the tomato to the garden center. The great aunt of Viva's fiancé gave her seeds of a tomato as a wedding gift in 1922, at which time the tomato was already called an heirloom. "I like to re-tell this story because I think of where we are today and when people get married they have registries and you buy them coffee pots they don't need and silver services that will probably never leave the closet. We live in a more narcissistic time in my view. "Here we are in 1922, and there is this young girl, Viva Lindsey, getting married and receiving seeds of a tomato, and it was probably one of the most cherished wedding gifts she received. And it makes me think about simpler times and how nice it would be if we could all treasure the gift of seeds of a flower or a tomato or a bean just as equally as an Amazon Echo or an Apple iPod or something like that." Growing tips: This is an incredibly vigorous and productive plant that LeHoullier said he grows every other year or every two-three years for the beauty of the fruit. "The plant produces 12- to16-ounce fruit that are truly an ivory color and on the very bottom is a pink blossom blush like mother of pearl," he said Flavor: "When you cut it open, it's a seedier tomato than Lillian's Yellow. I would say it is not in my top 50 of flavor because it is a sweet mild tomato. But, if you want a tomato for a cheeseburger or a grilled cheese, or just you just want to lay it out and put some basil and Parmesan cheese on it just to enhance its flavor a little bit, it's worth growing." 5. Coyote Kip Dawkins Photography, from 'Epic Tomatoes' by Craig LeHoullier (Storey Publishing) When LeHoullier caught the heirloom tomato bug, he was living in Pennsylvania and heirlooms were not that well known at the time. Because he was specializing in something unusual, the Pennsylvania Horticultural Society asked him to put in a few displays at their fall harvest festival. He complied and would bring a few hundred plants with tomatoes of all different shapes and sizes and lined them up and let people taste them. He remembers that being a lot of fun, and he especially remembers a woman name Maye Clement. She came to Pennsylvania from Mexico some years previously and brought him what he said was "the cutest little cluster of tomatoes, still on the vine, that were tiny, and almost pure white." Clement told LeHoullier that she brought the tomato from home, and that he could have it. "After she gave me those tomatoes, she left me her contact information. I wrote to her and asked her to provide additional information. She wrote me back said the tomato grows wild in Vera Cruz, Mexico, where it is called tomatio sylvestre Amarylla. That translates into wild small yellow tomato," said LeHoullier, adding that Clement said it had picked up the nickname Coyote. "Here's another example of someone who grows a tomato that may cause her to think of home, or being a child at home or of her kids," LeHoullier said. "Maybe it helps her think of what she has gained coming to America, or what she lost from Mexico. Maybe her growing this tomato reminds her of the flavors of home, and she felt strongly enough about wanting to share this that she brought me the actual tomatoes to grow. So, we are talking 27 years ago, and this is a tomato that grows all the time, and I sell seedlings from its fruit." Growing tips: "Coyote grows like a weed — meaning it is unfussy, prolific and very easy to grow successfully," LeHoullier said. "One bonus is that it is not an issue to germinate." Flavor: This is a polarizing tomato in terms of flavor. "Some people absolutely love it and can't get enough of it, and some people taste it and say I'll never grow that again," said LeHoullier. "It is extremely sweet and, like some white tomatoes, it has an unusual almost musky background flavor that some people find off-putting. I think of it as the cilantro of the tomato world. It does tend to divide people. But, again, what a nice little story." Where to buy heirloom tomato seeds LeHoullier co-leads a tomato breeding project that has succeeded in putting 70 new compact growing varieties in various seed catalogs. This will be the topic of his next book, which he plans to self-publish in the fall. Many companies carry seeds of all these varieties and some seeds of LeHoullier's full-size heirloom tomatoes. Along with the other companies mentioned throughout the article, The Tomato Growers Supply Company, Sample Seed, and Johnny's Selected Seeds are all great places to stock up on additional seeds. Craig Lehoullier can be contacted for speaking engagements or for signed copies of his book by visiting his website, where you can also follow his blog. Book cover image provided courtesy of Storey Publishing.
A novel approach to percutaneous right-ventricular mechanical support. We report our initial experience with our newly developed percutaneous right-ventricular assist device (VAD) with CentriMag (perc CM-RVAD). A flexible outflow cannula placed from the right internal jugular vein to the pulmonary artery and an inflow cannula placed from the femoral vein to the right atrium constituted the perc CM-RVAD. When needed, biventricular support was provided with left VAD (LVAD), either with a percutaneous LVAD placed through axillary or femoral artery access or with a fully implantable LVAD. Between January 2009 and June 2010, all of the attempted patients successfully received perc CM-RVAD (n = 8). Mean blood pressure, heart rate, and central venous pressure showed a trend toward improvement after the perc CM-RVAD, with less inotrope/vasopressor requirement. Mixed venous oxygen saturation (SvO(2)) increased significantly from 64 ± 20 Torr to 78 ± 6 Torr (P < 0.01). The percutaneous VADs were explanted after myocardial recovery in seven patients; however, in three of these, perc CM-RVAD was used as a temporary bridge to other devices. One patient was bridged to a surgical biventricular assist device (BiVAD) and transferred back to the referring hospital on support. One death occurred due to multiple-organ failure 8 days after explantation of the RVAD with recovery. Perc CM-RVAD was feasible and provided hemodynamic improvement.
Prosecutors say Perry's own words have 'instilled a concern' for witnesses. Prosecutors accuse Perry of threat Special prosecutors are claiming that Texas Gov. Rick Perry should not be given access to a grand jury transcript, citing “concern” of retaliation against witnesses. “The defendant’s own words have instilled a concern for all persons who participated in the grand jury investigation,” special prosecutors Mike McCrum and David M. Gonzalez argued in a brief made public on Monday, according the Texas Tribune. The special prosecutors cited remarks by Perry following his Aug. 15 indictment on allegations of abuse of power. ( POLITICO's polling center: Current polls) “I am confident that we will ultimately prevail, that this farce of a prosecution will be revealed for what it is. And those responsible will be held accountable,” Perry said at the time, according to the outlet. Despite a request by Perry’s lawyers last month for a transcript of the grand jury testimony, McCrum and Gonzalez argued that Perry has not established a need for the transcript.
145 Ga. App. 539 (1978) 244 S.E.2d 55 DOOLEY v. THE STATE. 55220. Court of Appeals of Georgia. Submitted January 30, 1978. Decided March 14, 1978. Rehearing Denied March 31, 1978. W. Benjamin Ballenger, for appellant. William M. Campbell, District Attorney, Richard W. Hendrix, Assistant District Attorney, for appellee. SHULMAN, Judge. Defendant appeals from his conviction for possession of a motor vehicle with the identifying number removed. See Code Ann. § 68-9916 (a) (c). 1. The indictment charging defendant with the crime stated that the accused "did unlawfully possess a certain motor vehicle... from which the manufacturer's serial number had been removed and altered for the purpose of concealing and misrepresenting the identity of such motor vehicle, contrary to the laws of said State," etc. Defendant's demurrer to the indictment was overruled. It is urged that the court erred in overruling the demurrer because the indictment failed to allege that the defendant possessed the vehicle with knowledge of the alteration or removal of the manufacturer's serial number. *540 While it would have been better practice to recite the words "knowingly possessed" in the indictment (see, e.g., Daniel v. State, 118 Ga. App. 370 (1) (163 SE2d 863)), the failure to have done so does not render the indictment subject to demurrer. Goodwyne v. State, 38 Ga. App. 183 (143 SE 443). 2. The trial court charged the jury in substantially the same language of Code Ann. § 68-9916 (a). In the general charge, the court failed to charge the substance of Code Ann. § 68-9916 (c) which prohibits a "knowing violation." Defendant enumerates as error the court's failure to instruct the jury adequately as to the necessary elements of the offense charged, to wit: that the accused must have knowledge of the alteration. We agree with appellant that guilty knowledge of the alteration is the gist of the offense. Greer v. State, 113 Ga. App. 342 (1) (147 SE2d 877). See also Studdard v. State, 124 Ga. App. 713 (185 SE2d 775) (likening offense of possessing and using motor vehicle license plate for the purpose of concealing and misrepresenting identity of motor vehicle upon which it was being used to offense of receiving stolen goods). The trial court communicated the essential element of the offense to the jury when, on recharge, the jury was instructed that they "would have to find beyond a reasonable doubt that he did possess it with the intent to do what they charged him with doing, that he intended to possess it and he knowingly possessed it." The trial court's failure to charge in its original instructions that a knowing violation was an essential element of the offense was immaterial in light of the recharge. Potts v. State, 134 Ga. App. 512 (4) (215 SE2d 276). 3. Appellant contends that the trial court erred in denying his motion to suppress evidence resulting from the search of the vehicle involved in the case at bar. The evidence shows that the vehicle seized was in defendant's used car lot, which was open to the public. Law enforcement officials went to defendant's place of business during business hours for the purpose of investigating the theft of a stolen vehicle which was found elsewhere and was reported to belong to defendant. The *541 officers observed, in plain view, a vehicle on defendant's lot with the driver's door open, the dashboard removed, screwdrivers on the front seat, and the dashboard serial plate missing. A subsequent check of the car revealed that the car in fact was stolen. The court did not err in denying the motion to suppress. Mahr v. State, 137 Ga. App. 116 (2b) (223 SE2d 204). Judgment affirmed. Bell, C. J., and Birdsong, J., concur.
Q: Adding a ApplicationBarIconButton from Application.Resources in XAML I have a ApplicationBarIconButton which I use repeatedly on multiple pages. I want to be able to define the Click action in my Application C# file. I have <Application.Resources> <shell:ApplicationBarIconButton x:Key="AddLocationAppBarIconBut" IconUri="/icons/appbar.add.rest.png" Text="location" Click="Add_Location_Event" /> in my App.xaml file and I want to load it into another page I have under <phone:PhoneApplicationPage.ApplicationBar> How do I go about this exactly? Can I bind a click event to an event in my Application cs file? A: Unfortunately, you can't! In full WPF framework, you'd be able to do something like this: <phone:PhoneApplicationPage.ApplicationBar> <shell:ApplicationBar> <shell:ApplicationBar.Buttons> <StaticResource ResourceKey="AddLocationAppBarIconBut" /> </shell:ApplicationBar.Buttons> </shell:ApplicationBar> </phone:PhoneApplicationPage.ApplicationBar> The trick here is in the usage of StaticResource, but Silverlight doesn't have a backing class representation like that; you can only use the Markup Extension as {StaticResource AddLocationAppBarIconBut}, but this won't help you here! What you can is define the full ApplicationBar object as a resource and then just call it on the page like this: <phone:PhoneApplicationPage ApplicationBar="{StaticResource ApplicationBarResource}"> <!-- remaining code --> <phone:PhoneApplicationPage />
Introduction {#s1} ============ Enterotoxigenic *E. coli* (ETEC) is one of the most common causes of acute watery diarrhoea in the developing world, both among children and adults, causing up to 400 million diarrhoeal episodes and approximately 380.000 deaths in children under the age of five every year. In addition, ETEC causes approximately 400 million diarrhoeal cases among adults. ETEC is also the most common cause of travellerś diarrhoea in these countries [@pone.0035827-WHO1]--[@pone.0035827-Qadri1]. ETEC is endemic in many countries such as Bangladesh where the infection follows a distinct biannual seasonal pattern with one peak during the hot and dry months of April and May, and a second peak in September and October when the heavy monsoon rains have subsided [@pone.0035827-Qadri2]. ETEC infection is acquired by ingestion of contaminated food or water, and the infection is established when the bacteria reach the small intestine. Diarrhoea is caused by the actions of one or two enterotoxins, the heat-stable (ST) and/or the heat-labile (LT) toxin, which bind to receptors on the epithelial surface, thereby activating signalling pathways that stimulate the opening of ion channels [@pone.0035827-Sanchez1], [@pone.0035827-Qadri1], [@pone.0035827-Nataro1] and subsequent release of water and electrolytes into the intestinal lumen. Colonization of the small intestine is mediated by colonization factors (CFs), which are fimbrial, fibrillar or afimbrial structures on the bacterial surface that adhere to the enterocytes. At present at least 25 different CFs have been identified [@pone.0035827-Grewal1]--[@pone.0035827-Qadri3]. Two of the most common CFs expressed by clinical isolates from different parts of the world are the coli surface antigens 5 (CS5) and 6 (CS6) [@pone.0035827-Qadri1], [@pone.0035827-Gaastra1], [@pone.0035827-Shaheen1]--[@pone.0035827-Qadri5]. CS5 and CS6 belong to the colonization factor antigen group IV (CFA/IV) which also contains coli surface antigen 4 (CS4). CS5 is always expressed together with CS6, while CS6 can also be expressed alone or together with CS4 [@pone.0035827-Gaastra1], [@pone.0035827-Wolf1]. CS5 is a fibrillar antigen, and its operon encodes a major subunit (*csfA*), a minor subunit (*csfD*), an outer membrane usher (*csfC*), two chaperones (*csfB* and *csfF*), and a protein involved in pilus length regulation (*csfE*) [@pone.0035827-Duthy1]. CS6 is afimbrial and is composed of two structural subunits, CssA and CssB, located on the bacterial cell membrane. The CS6 operon contains four genes, *cssA*, *cssB*, *cssC*, and *cssD*, encoding the two structural subunits CssA and CssB, a chaperone (CssC), and an usher (CssD), respectively [@pone.0035827-Wolf2]. The current knowledge about the regulation of CS5 and CS6 is limited, and the present study was conducted in order to increase the understanding of the regulation of these important virulence factors in the human gut, with an emphasis on CS5. When bacteria enter and colonize the gastrointestinal tract they encounter a variety of host environmental factors that may influence virulence gene expression, e.g. bile and sodium bicarbonate, which have previously been shown to regulate expression of virulence factors in other enteropathogens [@pone.0035827-Gupta1]--[@pone.0035827-Hung1]. NaHCO~3~ is secreted from the pancreas into the duodenum, and is also released from the CFTR channels which results in an increase in pH. Bile has detergenic properties and acts as an emulsifier of dietary fats and lipids *in vivo* [@pone.0035827-Hofmann1] and plays a role in antimicrobial defence [@pone.0035827-Begley1]. It is produced by the liver and contains many components including bile acids, cholesterol, phospholipids, and biliverdin [@pone.0035827-Begley1]. Primary bile acids are produced directly from cholesterol in the liver by the hepatocytes, and secondary bile acids are produced by bacteria in the caecum and colon by modifications of the primary bile acids. Primary and secondary bile acids are modified by the hepatocytes by conjugation with either glycine (glyco-conjugated bile acids) or taurine (tauro-conjugated bile acids) [@pone.0035827-Hofmann1], [@pone.0035827-Begley1]. Bile salts are secreted into the duodenum at estimated concentrations of 0.2--2% [@pone.0035827-Barrett1]. In this study we investigated the expression of CS5 and CS6 in ETEC bacteria isolated without sub-culturing from clinical stool samples (*in vivo*). The effects of sodium bicarbonate and bile on the expression of CS5 were investigated in *in vitro* cultured bacteria. A certain component of bile, sodium glycocholate hydrate, was identified as a potent inducer of CS5 expression. To our knowledge this is the first report that implicates this molecule as an inducer of enteropathogenic bacterial virulence. Results {#s2} ======= CS5+CS6, LT+ST ETEC Strains Isolated from Bangladeshi Stool Specimens {#s2a} --------------------------------------------------------------------- Four clinical ETEC strains from stool specimens collected in 2005 and 2006 from adult patients with acute diarrhoea at the icddr,b hospital in Dhaka were included in the study ([Table 1](#pone-0035827-t001){ref-type="table"}). An LT+STh, CS5+CS6 laboratory reference strain (E3003; sometimes referred to as VM 75689 in other studies), originally isolated in Dhaka in 1988, was also included. A total of 127 clinical stool specimens were collected in 2005 between April and June during the ETEC peak season. Out of a total of 34 identified ETEC positive stool specimens, five contained a CS5+CS6 positive strain that expressed both the ST and the LT toxin. Strains E1777, E1779, and E1785 were chosen for subsequent studies. A co-infecting pathogen was only detected for the patient infected with strain E1779, who had a co-infection with *V. cholerae* Ogawa. 10.1371/journal.pone.0035827.t001 ###### Strains used in the study and results from culturing[a](#nt101){ref-type="table-fn"} of clinical stool specimens. ![](pone.0035827.t001){#pone-0035827-t001-1} ETECstrain[b](#nt102){ref-type="table-fn"}: Culture onMacConkeyagar *^c^* Culture onTTGA agar CF and toxin profileof isolated ETEC strain Year ofisolationin Dhaka --------------------------------------------- ------------------------------- --------------------- --------------------------------------------- -------------------------- **E1777** *E. coli* negative CS5+CS6, STh+LT April 2005 **E1779** *E. coli* *V.cholerae* Ogawa CS5+CS6, STh+LT May 2005 **E1785** *E. coli* negative CS5+CS6, STh+LT June 2005 **E2265** *E. coli* negative CS5+CS6, STh+LT March 2006 **E3003** ***^c^*** *E. coli* N.T. CS5+CS6, STh+LT 1988 Culture was performed on MacConkey agar plates to detect *E. coli* and on Taurocholate-tellurite-gelatin agar (TTGA) for detection of vibrios; all cultures were performed overnight at 37°C. Department of Microbiology and Immunology, University of Gothenburg, enterotoxigenic *Escherichia coli* (ETEC) strain collection number. Immune Responses Against the CS5 and CS6 ETEC Strains {#s2b} ----------------------------------------------------- ELISA analyses of serum samples from the three patients from whom the CS5+CS6 positive strains E1777, E1779, and E1785 had been isolated showed that on day 7 (early convalescence) the patients infected with E1777 and E1785 had developed strong IgG as well as IgA immune responses against CS5, whereas the patient infected with strain E1779, who had a co-infection with *V. cholerae* Ogawa, had developed only a very modest immune response (IgA and IgG) against CS5 ([Fig. 1](#pone-0035827-g001){ref-type="fig"}). The patient infected with strain E1785 also developed a strong immune response (IgA and IgG) against CS6, whereas those infected with strains E1777 and E1779 exhibited modest immune responses ([Fig 1](#pone-0035827-g001){ref-type="fig"}). These results confirm that CS5 and CS6 were indeed expressed and exposed on the bacteria during the infection. The IgA responses induced against CS6 were comparable to those previously reported for Bangladeshi adults infected with CS5+CS6 ETEC strains [@pone.0035827-Qadri6]. ![IgA and IgG serum antibody responses to CS5 and CS6 in individual patients.\ The responses to CS5 (broken lines) and CS6 (solid lines) were measured by ELISA in sera from patients infected with strains E1777, E1785 and E1779, on different days after hospitalization. Serum from the patient infected with strain E2265 was not available.](pone.0035827.g001){#pone-0035827-g001} Transcription of the CS5 and CS6 Operons *in vivo* {#s2c} -------------------------------------------------- The transcription levels of the CS5 and CS6 operons in *in vivo* bacterial samples was analyzed by extracting total RNA directly from diarrhoeal stool bacteria and measuring the transcription levels of the structural genes *csfD* and *cssB* of CS5 and CS6, respectively, by quantitative real time reverse transcriptase PCR (rt RT-PCR). Since the *E. coli* bacterial load in the diarrhoeal stool specimens was unknown, and since there are no reliable *E. coli* housekeeping genes for relative quantification, the relative ratio of the transcription levels of *csfD* and *cssB* was determined and compared instead of analyzing the transcription level of each individual gene in relation to a housekeeping gene or a fixed amount of RNA ([Fig. 2](#pone-0035827-g002){ref-type="fig"}). Transcription of the *E. coli* housekeeping gene *gapA* was detected in all samples, concluding that intact *E. coli* mRNA was present in all *in vivo* bacterial samples. Transcription of *csfD* and *cssB* was observed in the three *in vivo* bacterial samples in which ETEC was the only detected bacterial pathogen, *i.e.* those containing strains E1777, E1785 and E2265 ([Table 1](#pone-0035827-t001){ref-type="table"}). The sample that contained *V. cholerae* in addition to ETEC, i.e. strain E1779, was negative for transcription of both *csfD* and *cssB*; since transcription of *gapA* was present, this was not due to the deterioration of RNA but indicative of low levels of ETEC bacteria in this particular stool sample. ![Transcriptional *csfD*:*ccsB* ratio *in vivo* and *in vitro*.\ Transcription of *csfD* and *cssB* was quantified by real time reverse transcriptase PCR (rt RT-PCR) in *in vivo* bacterial samples (strains E1777, E1785, E2265; closed bar) and after one (strains E1785, E2265, E3003; open bars) and two (E1777, E1779; hatched bars) hours of *in vitro* culture in LB medium alone and in LB supplemented with 0.15% crude bile or 0.2% individual bile salts. Bars show the means and standard errors of the means of two (after two hours of culture) or three (*in vivo* and after one hour of culture) separate experiments.](pone.0035827.g002){#pone-0035827-g002} Bile, but not Sodium Bicarbonate, Induces Phenotypic Expression of CS5 both under Nutrient-rich and Nutrient-poor Conditions {#s2d} ---------------------------------------------------------------------------------------------------------------------------- In order to investigate whether the expression of CS5 by ETEC bacteria *in vivo* may be regulated by the host environmental factors bile and NaHCO~3~, which are both abundant in the human intestine, the strains were analyzed by an inhibition ELISA after *in vitro* culture in the presence and absence of these factors. After overnight culture to stationary phase in LB medium (all five strains) as well as in M9 minimal medium supplemented with glucose, glycerol, or casamino acids as the primary carbon source (strains E1779 and E2265), CS5 was only detected on the bacterial surface when bile was present in the culture medium. Crude bile is routinely added to the culture medium (CFA medium) under standard diagnostic laboratory conditions in order to enable detection of phenotypic CS5, e.g. by dot-blot analysis [@pone.0035827-Sjling1]. Our results indicate that the presence of bile is required for phenotypic CS5 expression not only under nutrient-rich conditions, but also under nutrient-poor conditions. NaHCO~3~ was tested at concentrations 0.3% (35.7 mM) and 0.6% (71.4 mM), which fall within the concentration range previously reported to positively regulate the expression of virulence factors in other enteropathogenic bacteria, i.e. *Vibrio cholerae* and enterohemorrhagic *E. coli* (EHEC) [@pone.0035827-Abe1], [@pone.0035827-Abuaita1]. However, overnight culture to stationary phase in LB medium supplemented with NaHCO~3~ did not result in phenotypic expression of CS5 in any of the five strains included in the study, indicating that this host factor is not an inducer of CS5 expression. Sodium Glycocholate Hydrate Induces Phenotypic Expression of CS5 {#s2e} ---------------------------------------------------------------- The induction of CS5 expression by crude bile was found not to be due to non-specific induction by the detergenic properties of bile, since overnight culture to stationary phase in LB supplemented with Triton X-100 (0.1% and 0.04%) did not result in phenotypic CS5 expression in any of the five strains included in the study. Approximately 50% of the organic compounds in bile are constituted by bile acids [@pone.0035827-Begley1]. To individually investigate the effects of some of the major bile salts in human bile on CS5 expression, strain E1777 was cultured to stationary phase in LB supplemented with the primary bile salts, i.e. sodium cholate hydrate (NaCH) and sodium chenodeoxycholate (NaCDC) [@pone.0035827-Begley1], respectively; the glyco- and tauro-conjugated salts of NaCH, i.e. sodium glycocholate hydrate (NaGCH) and taurocholic acid sodium salt hydrate (TCA), respectively; and the secondary bile salt sodium deoxycholate (NaDC), which is derived from cholic acid by dehydroxylation [@pone.0035827-Begley1]. The individual bile salts were tested at final concentrations of 0.04% and 0.2% (NaCH), 0.04%, 0.1% and 0.2% (NaDC), 0.04%, 0.1% and 0.2% (TCA), 0.04% (NaCDC), and 0.04%, 0.1% and 0.2% (NaGCH). Expression of CS5 on the bacterial surface was induced by NaDC (results not shown), which is known to induce virulence in other enteropathogenic bacteria [@pone.0035827-Hung1], [@pone.0035827-Lunelli1]--[@pone.0035827-Torres1], as well as by the glycoconjugate NaGCH. The tauro-conjugated counterpart of NaGCH, TCA, and the corresponding unconjugated bile salt NaCH, did not induce phenotypic CS5 expression, irrespectively of the concentration used. The ability of NaGCH and the inability of NaCH and TCA to induce CS5 surface expression was confirmed for the clinical strains E1779, E1785, and E2265 as well as the reference strain E3003, using a concentration of 0.2% of each individual salt ([Fig. 3](#pone-0035827-g003){ref-type="fig"}). ![Phenotypic CS5 levels in LB alone and LB supplemented with bile or individual bile salts.\ CS5 expression was quantified by inhibition ELISA after overnight culture to stationary phase of strains E1777, E1779, E1785, E2265, and E3003. CS5 surface expression tifwas induced by NaGCH, but not by the corresponding unconjugated bile salt NaCH or its tauro-conjugated counterpart TCA (representative data).](pone.0035827.g003){#pone-0035827-g003} ![Levels of *csfD* and *cssB* transcription compared to in LB alone after one hour of culture.\ Level of *csfD* (A) and *cssB* (B) transcription in LB supplemented with crude bile or individual bile salts standardized to the level of transcription in LB medium alone, after one hour of culture. Transcription was measured by reverse transcriptase real time PCR. Bars show means and standard errors of the means of three separate experiments (strains E1785, E2265, and E3003, respectively). \*, P = \<0.05](pone.0035827.g004){#pone-0035827-g004} Transcription of *csfD* is Induced by Bile and NaGCH *in vitro* {#s2f} --------------------------------------------------------------- The novel discovery that NaGCH may act as an inducer of virulence was further investigated by studying the effects on transcription of the CS5 operon by NaGCH, TCA, and NaCH. As comparison, the effects of crude bile were also investigated. This was performed by quantification of the transcription of *csfD*, which encodes the CS5 minor structural subunit, in strains cultured to exponential growth phase in LB medium alone and in LB medium supplemented with 0.15% crude bile or 0.2% NaGCH, 0.2% NaCH or 0.2% TCA, respectively. The transcription of *csfD* was up-regulated approximately 100-fold after one hour of culture when LB was supplemented with 0.15% crude bile or 0.2% NaGCH as compared to after culture in LB alone ([Fig. 4](#pone-0035827-g004){ref-type="fig"}). The up-regulation of *csfD* transcription was significantly higher in LB medium supplemented with 0.15% crude bile or 0.2% NaGCH, respectively, than in LB medium supplemented with 0.2% NaCH or 0.2% TCA after one ([Fig. 4](#pone-0035827-g004){ref-type="fig"}), two and five hours of culture (data not shown). Transcription of the CS6 structural subunit gene *cssB* was up-regulated approximately 10-fold after the first hour of culture in LB medium supplemented with 0.15% crude bile or 0.2% NaGCH as compared to in LB medium alone ([Fig. 4](#pone-0035827-g004){ref-type="fig"}), and less than 10-fold up-regulated or even down-regulated after two and five hours of culture (not shown), indicating that the up-regulation of *csfD* in the presence of bile or NaGCH was specific for the CS5 operon and was not due to a general up-regulation of transcription. The Induction of CS5 Expression by NaGCH is Dose-dependent {#s2g} ---------------------------------------------------------- Inhibition ELISA analyses of strain E1777 after overnight culture to stationary phase in LB supplemented with NaGCH to a final concentration of 0.4%, 0.2%, and 0.1%, respectively, revealed that the induction of phenotypic CS5 expression by NaGCH is dose-dependent ([Fig. 5](#pone-0035827-g005){ref-type="fig"}). Phenotypic expression of CS5 was also detected when a NaGCH concentration of 0.04% was tested, but a NaGCH concentration of 0.004% was not sufficient for induction of phenotypic CS5 expression (data not shown). The induction of CS5 expression by crude bile is shown as comparison in [Fig. 5](#pone-0035827-g005){ref-type="fig"}. ![Dose-dependent induction of phenotypic CS5 expression by NaGCH.\ Expression of CS5 was determined by inhibition ELISA in strain E1777 after overnight culture to stationary phase in LB medium supplemented with NaGCH or crude bile. Bars indicate means and standard errors of the means of two measurements in one experiment.](pone.0035827.g005){#pone-0035827-g005} The Ratio Between *csfD* and *cssB* Transcription Levels is Highest *in vivo* and in the Presence of Bile or NaGCH *in vitro* {#s2h} ----------------------------------------------------------------------------------------------------------------------------- *In vivo*, i.e. in bacteria obtained directly from the stool specimens without sub-culturing, the level of transcription of *csfD* was higher than *cssB*. The transcriptional ratios of *csfD* to *cssB* (*csfD*:*cssB*) were found to be 182∶1, 65∶1, and 76∶1 for the samples containing strains E1777, E1785, and E2265, respectively. Similar *csfD*:*cssB* ratios were observed *in vitro* after one and two hours of culture in LB medium supplemented with 0.15% crude bile or 0.2% NaGCH ([Fig. 2](#pone-0035827-g002){ref-type="fig"}). On the other hand, culture in LB medium alone or supplemented with 0.2% TCA or 0.2% NaCH did not result in a similar ratio between *csfD* and *cssB* transcription. Furthermore, the relative levels of transcription of *csfD* and *cssB* in the presence of NaGCH was found to be dose-dependent, as determined for strain E1777; the obtained *csfD*:*cssB* ratios were 2∶1 after overnight culture to stationary phase in LB supplemented with 0.004% NaGCH, 75∶1 in 0.04% NaGCH, 151∶1 in 0.1%, 163∶1 in 0.2%, and 207∶1 in 0.4% NaGCH, which supports that NaGCH is a specific inducer of transcription of the CS5 operon. Discussion {#s3} ========== Diarrhoea caused by ETEC seems to require colonization of the human intestine by different colonization factors. In this study we have investigated the expression of the important ETEC colonization factors CS5 and CS6 *in vivo*, as well as the role of certain host factors in the human gastrointestinal tract as putative regulators of CS5. These analyses have shown that expression of CS5 is strongly enhanced *in vivo* as compared to CS6 and that a specific factor in the human intestine, i.e. the glyco-conjugated primary bile salt sodium glycocholate (NaGCH) can act as a positive regulator of CS5 expression. To our knowledge, this is the first description of induction of virulence by this bile component. Relatively little has previously been known about the regulation of CS5, especially *in vivo*. Under standard laboratory conditions (overnight culture on CFA medium at 37°C), crude bile is routinely added to the culture medium in order to enable phenotypic expression of CS5 [@pone.0035827-Sjling1]. Our results show that bile induces expression of CS5 not only in nutrient-rich media, but also under nutrient-poor conditions where only amino acids, glycerol, or glucose constitute the carbon source. In this study we wanted to further investigate the dependency on bile for phenotypic CS5 expression to occur, and to elucidate how this induction comes about. The induction was first determined not to be due to non-specific effects of the detergent properties of bile, since addition of a detergent (Triton X-100) to the culture medium failed to induce phenotypic CS5 expression. Since bile salts form a major constituent of human bile [@pone.0035827-Begley1], we next decided to test some of the major bile salts in human bile for effects on CS5 expression. A number of enteric bacterial pathogens have previously been reported to switch on the expression of virulence factors in the presence of bile salts. For instance, in atypical enteropathogenic *Escherichia coli* (aEPEC), phenotypic expression of the major subunit of the afimbrial LDA adhesin has been reported to be enhanced by a mixture of sodium deoxycholate, sodium taurodeoxycholate, and sodium chenodeoxycholate [@pone.0035827-Torres1]. In *Campylobacter jejuni*, sodium deoxycholate, sodium cholate and sodium chenodeoxycholate stimulate the production of *Campylobacter* invasion antigens (Cia), thus affecting the invasiveness of the bacteria [@pone.0035827-RiveraAmill1], and in *V. cholerae* sodium cholate, sodium deoxycholate and sodium taurocholate have been found to induce phenotypic expression of the cholera toxin under certain *in vitro* conditions [@pone.0035827-Hung1]. In the case of ETEC, individual bile salts have not previously been investigated for their effects on the expression of the colonization factors. In this study we show that one of the bile salts previously known to induce the expression of virulence factors in *Campylobacter, Shigella*, *Salmonella*, and *V. cholerae*, sodium deoxycholate (NaDC), also induces the expression of CS5. More importantly, we were able to identify another positive regulator of the common CS5, the glyco-conjugated primary bile acid sodium glycocholate (NaGCH, or glycocholic acid in its acid form). To the best of our knowledge this is the first study to report that this bile acid can serve as an inducer of bacterial virulence. The crude bile extract (Oxoid) that is routinely used for diagnostic purposes for detection of CS5 is mainly composed of NaGCH and the sodium salt of the tauro-conjugated counterpart of NaGCH, sodium taurocholate (TCA), the latter of which we found is not able to induce expression of CS5. Since glycocholic and taurocholic acid have also been reported to be the main constituents of bile [@pone.0035827-Willson1], one may speculate that NaGCH is more important for CS5-mediated virulence than NaDC *in vivo*. Glycocholate is formed by the linking of a glycine amino group by an amide bond to the carboxyl group of the primary bile acid cholic acid [@pone.0035827-Begley1]. Considering that sodium cholate (NaCH) and TCA did not induce expression of CS5, this indicates that the glycine amino group in NaGCH is somehow a prerequisite for NaGCH to positively regulate virulence gene expression. Studies to further elucidate the role of the glycine group have been initiated, as well as to determine the molecular basis of the positive regulation of CS5 expression by NaGCH. The induction of CS5 on the bacterial surface by NaGCH was coupled with a dose-dependent up-regulation of the ratio between *csfD* and *cssB* transcription levels, suggesting that regulation of CS5 expression at least partly occurs on the transcriptional level. Interestingly, NaGCH has previously been reported to activate certain promoters involved in *E. coli* stress responses [@pone.0035827-Merritt1]. While the CS5 operon itself does not encode a specific regulatory protein, the AraC/XylS-like transcription factor CsvR has been suggested to positively regulate CS5 transcription [@pone.0035827-deHaan1], [@pone.0035827-Gallegos1]. These, and other possible pathways of regulation of CS5 expression by NaGCH, are being explored further. In contrast to CS5, no positive regulator has yet been demonstrated for CS6 [@pone.0035827-Favre1]. The transcription of the CS6 operon was not up-regulated to the same extent by NaGCH as the transcription of the CS5 operon, suggesting that these two operons are under the control of different regulators. In the *in vivo* bacterial samples (collected from diarrhoeal stool without sub-culturing), we found that the CS5 operon was transcribed at approximately 100-fold higher levels than the CS6 operon. Interestingly, these levels were similar to the levels of up-regulation which were observed *in vitro* after one and two hours of culture, when crude bile or NaGCH was added to the culture media. Taken together, these results suggest that the conditions encountered by ETEC bacteria in diarrhoeal stool are mimicked by the conditions prevailing after one hour of culture in LB medium supplemented by 0.2% NaGCH or 0.15% bile, at least when it comes to transcription of the CS5 and CS6 operons. Transcription of *csfD* and *cssB* was detected in three of the four patients included in the study; the exception was a patient who had a co-infection with *V. cholerae*. This patient also exhibited a very modest immune response to CS5 and CS6. Hence, it is tempting to speculate about whether possible interactions between ETEC and a co-infecting enteropathogen such as *V. cholerae* may result in reduced expression of ETEC virulence genes, e.g. CS5. However, further studies are needed to explore this. In the *in vivo* setting, bile salts are secreted into the duodenum at estimated concentrations of 0.2--2% [@pone.0035827-Barrett1]. In this study most individual bile salts were tested at a concentration of 0.2%, since a concentration of 0.15% crude bile is sufficient to induce expression of CS5. However, the concentration of individual bile salts *in vivo* is affected by the nutritional status of the host, e.g. the ingestion of a fatty meal will increase their concentration, and the concentration of bile in the intestinal lumen is lower in malnourished patients [@pone.0035827-Begley1]. The ratio of glyco-conjugated (e.g. NaGCH) to tauro-conjugated (e.g. TCA) bile acids has also been reported to vary. It has been reported to be 3∶1 in the normal case, but to be much lower (0.1∶1) in taurine-fed individuals. Foods that are rich in taurine include meat and sea-food, which will increase tauroconjugation [@pone.0035827-Begley1]. In the light of our findings, this suggests that the diet of an individual may influence the outcome of an infection with CS5 positive ETEC, since certain diets may decrease the ratio between glyco- and tauro-conjugates. One may speculate whether a diet lacking adequate levels of taurine, e.g. lacking in meat, which is a common occurrence in poor socioeconomic settings where ETEC infections are common, may further increase the severity of CS5 ETEC infections. The composition of bile also varies between different populations, eg. in rural African women the ratio of glyco- to tauro-conjugated bile acids may be as high as 9∶1 [@pone.0035827-Begley1]. Our results showed that the induction of CS5 is dose-dependent; a final concentration of sodium glycocholate of 0.004% was not enough to induce phenotypic expression, but a gradual increase in induction was observed when increasing the concentration of the salt from 0.04% to 0.4%. Bile is delivered from the gall bladder into the proximal part of the small intestine and sequentially decreases in concentration along the intestine due to re-absorption to the liver. In addition, the bile level is likely to differ between the intestinal lumen and the mucosal layer. Our findings suggest that CS5 ETEC bacteria are capable of fine-tuning the expression of CS5 according to the concentration and composition of bile, in order for optimal expression to occur at different sites and under varying nutritional conditions in the human intestine. CS5 is only expressed in ETEC strains that are also capable of expressing CS6 [@pone.0035827-Wolf3]. Unlike CS5, however, CS6 is not dependent on the presence of bile in order to be expressed *in vitro*, which suggests that expression of these two important colonization factors may be induced by different environmental niches within the host. Another abundant host factor in the human small intestine, NaHCO~3~, was also tested but ruled out as a putative regulator of CS5. The concentration of NaHCO~3~ in the intestine is difficult to measure and exhibits great variability. The concentrations used by us, 35.7 mM and 71.4 mM, fall within the concentration range previously reported to positively regulate the virulence factors in other enteropathogens, i.e. *V. cholerae* and enterohemorrhagic *E. coli* (EHEC). Thus, 35.7 mM NaHCO~3~ has been found to upregulate CT and TCP in *V. cholerae* [@pone.0035827-Abe1], and 44 mM to induce the production of virulence factors in EHEC [@pone.0035827-Abuaita1]. In summary, we report the novel findings that the ETEC colonization factor CS5 is considerably more expressed *in vivo* than CS6 when co-expressed on the same bacteria and that the bile component sodium glycocholate, which is abundant in the human intestine, induces phenotypic expression of CS5 in a dose-dependent manner. Materials and Methods {#s4} ===================== Ethics Statement {#s4a} ---------------- This study was conducted according to the principles expressed in the declaration of Helsinki. The study was approved by the Research Review Committee and the Ethical Review Committee of the International Centre for Diarrhoeal Disease Research, Bangladesh (icddr,b) (protocol\# 2001-027). Ethical permission for the study was also obtained from the Regional Ethical Review Board, Gothenburg, Sweden (S199-03 and 088-10). Written informed consent was obtained from study participants prior to enrollment in the study and the collection of stool and blood specimens. No children were included in the study. Collection of *in vivo* Bacterial Samples from Stools {#s4b} ----------------------------------------------------- Watery diarrhoeal stool specimens were collected from adult patients with acute diarrhoea admitted to the hospital of the International Centre for Diarrhoeal Disease Research (icddr,b) in Dhaka, Bangladesh. Fresh stool specimens (10--50 ml) were placed on ice and brought from the hospital wards to the laboratory where bacteria present in the stool samples were immediately isolated essentially as previously described [@pone.0035827-Sjling2] with some modifications. The stool samples were filtered through sterilized gauze and centrifuged at 1000×g for 10 minutes in order to remove mucus and other large particles. The supernatant, containing the bacteria, was carefully removed and centrifuged at 16000×g for 10 minutes. The resulting bacterial pellet, *i.e.* the *in vivo* bacterial sample, was resuspended in 1 ml RNALater® (Qiagen, Hilden, Germany), divided into two aliquots of 500 µl, stored at -70°C and shipped to Sweden for total RNA extraction and quantification of transcription. Characterization of Stool Specimens and Clinical ETEC Isolates {#s4c} -------------------------------------------------------------- Bacteriological analysis of the stool specimens was performed essentially as previously described [@pone.0035827-Qadri5]. Specimens were initially screened for *V. cholerae* by dark-field microscopy; negative specimens were further screened for presence of *E. coli-*like bacteria, and *V. cholerae*, *Shigella* spp, and *Salmonella* spp by standard methods [@pone.0035827-Qadri5], [@pone.0035827-WHO2]. Six lactose-fermenting *E. coli*-like colonies identified after culture on MacConkey medium were individually tested for ST and LT by ELISA assays and for the CFs CFA/I, CS1-8, CS12, CS14, CS17 and CS21 by dot-blot assays [@pone.0035827-Sjling1], [@pone.0035827-Svennerholm2], [@pone.0035827-Svennerholm3]. DNA from a pool of the six colonies was tested for the genes encoding LT, STh, and STp by PCR [@pone.0035827-Sjling1], [@pone.0035827-Blin1]. One representative ETEC colony from each ETEC positive stool specimen was grown to exponential phase in LB medium and stored at -70°C in LB supplemented with 20% glycerol; these strains were further used in the *in vitro* experiments. Collection of Blood and Serum Specimens {#s4d} --------------------------------------- Blood samples were collected from the patients at the acute stage of the infection, *i.e.* on day 2 or 3 of hospitalization, and during convalescence on days 7 (early convalescence) and 21 (late convalescence), and stored at -20°C until analyses. *In vitro* Culture Conditions {#s4e} ----------------------------- The ETEC isolates were cultured overnight on LB or blood agar plates at 37°C. Three or six colonies were picked and grown to exponential phase in LB (pH 7.5) at 37°C with aerated shaking (150 or 200 rpm) to reach exponential phase. This starting culture was inoculated into the media to be tested at a final concentration of 10^7^ or 10^8^ bacteria/ml, based on the absorbance at OD~600~, and cultured overnight at 37°C with shaking (150 rpm). Media tested were LB, CFA broth [@pone.0035827-Evans1], and defined minimal medium (M9). M9 medium was supplemented with either glucose (0.2% w/v), glycerol (0.2% w/v), or casamino acids (1% w/v) as the primary carbon source. When relevant, crude bile (Oxoid, Hampshire, UK) was added to a final concentration of 0.15% w/v [@pone.0035827-Sjling1], or 0.015% (in the case of M9). LB medium was supplemented with Triton X-100 (Sigma, St Louis, MO), sodium bicarbonate (Sigma), or individual bile salts (Sigma), i.e. sodium cholate hydrate (NaCH), sodium deoxycholate (NaDC), taurocholic acid sodium salt hydrate (TCA), sodium chenodeoxycholate (NaCDC), and sodium glycocholate hydrate (NaGCH), respectively, at different concentrations as indicated. Enzyme-linked Immunosorbent Assay (ELISA) {#s4f} ----------------------------------------- The phenotypic expression of CS5 and CS6 on the bacterial surface was quantified by inhibition ELISA assays after overnight culture to stationary phase, essentially as described [@pone.0035827-Grewal2], with a starting concentration of 10^9^ or 10^10^ bacteria/ml. Total RNA Extraction from *in vitro* Bacterial Cultures {#s4g} ------------------------------------------------------- The pellet from one ml of bacterial culture was treated with lysozyme and RLT buffer (Qiagen) and stored at -70°C. Total RNA was prepared from a volume corresponding to 10^9^ lysed bacteria with the RNeasy^®^ Mini Kit (Qiagen, Hilden, Germany), removing contaminating DNA on-column by using the RNase-Free DNase Set (Qiagen). Alternatively, approximately 10^9^ bacteria were spun down, treated with RNAProtect® (Qiagen) and stored at -70°C before total RNA extraction. The integrity of the RNA and absence of contaminating DNA was checked by agarose gel electrophoresis and the RNA concentration was measured spectrophotometrically using a NanoDrop^®^ ND-1000 (NanoDrop Technologies, Wilmington, DE). All RNA samples were stored at -70°C. Total RNA Extraction from *in vivo* Bacterial Samples {#s4h} ----------------------------------------------------- *In vivo* bacterial samples in RNALater were thawed on ice and spun down at 4°C. The pellet was treated with an appropriate volume of lysozyme and RLT buffer (Qiagen) before total RNA extraction using the RNeasy® Mini Kit (Qiagen). Contaminating DNA was removed by twice performing the on-column DNase treatment described above. cDNA Synthesis {#s4i} -------------- cDNA was synthesized from a maximum of 200 ng total RNA using the QuantiTect Reverse Transcription Kit (Qiagen), which includes an additional DNAse treatment step. Controls for DNA contamination without reverse transcriptase (-RT) were prepared simultaneously with the synthesized cDNA from the same amount of total RNA. cDNA and (-RT) controls were stored at -20°C. Quantitative Real Time RT-PCR Assays {#s4j} ------------------------------------ The real-time RT-PCR assays were performed on an ABI 7500 (Applied Biosystems, Foster City, CA) using the double-stranded DNA-specific dye SYBR®Green I (Applied Biosystems, Warrington, UK) as detector. Primers for the CS5 minor structural subunit gene *csfD* and the *E. coli* housekeeping gene *gapA* were designed using the Primer Express 2.0 software (Applied Biosystems, Foster City, CA). The primers for the CS6 structural subunit gene *cssB* have been described previously [@pone.0035827-Nicklasson1] ([Table 2](#pone-0035827-t002){ref-type="table"}). 10.1371/journal.pone.0035827.t002 ###### Primers used for PCR and real-time Reverse Transcriptase PCR (rt RT-PCR). ![](pone.0035827.t002){#pone-0035827-t002-2} Gene Primers (5′→3′) Direction Product size -------------------------------------------------- --------------------------- ----------- -------------- *csfD* (CS5) [a](#nt103){ref-type="table-fn"} ACTTGGATATTGGTCGACTGCAA Forward 101 bp ATTCTTTAAAACCTCTCCAGCGAAT Reverse *cssB* (CS6) [b, c](#nt104){ref-type="table-fn"} CAGGAACTTCCGGAGTGGTA Forward 152 bp CTGTGAATCCAGTTTCGGGT Reverse *gapA* [d](#nt106){ref-type="table-fn"} CGTTGAAGTGAAAGACGGTCATC Forward 101 bp CAACACCAACTTCGTCCCATTT Reverse CS5 minor subunit**;** GenBank accession number [AJ224079]{.ul}. CS6 structural subunit CssB; GenBank accession number [UO4846]{.ul}. Primers described in [@pone.0035827-Nicklasson1]. *E. coli* D-glyceraldehyde-3-phosphate dehydrogenase (GAPDH); GenBank accession number [U014639.1.]{.ul} The transcription levels were determined by absolute quantification using a standard curve for each gene which was generated by ten-fold serial dilutions of a known amount of specific PCR product. These PCR products were generated by conventional PCR from DNA isolated from laboratory strains (E17018/A for *csfD*; E11881/14 for *cssB* and *gapA*), using the same primers as for real-time PCR. PCR products were purified by the QIAQuick PCR Purification Kit (Qiagen) or the E.Z.N.A Cycle Pure Kit (Omega Bio-Tek, Inc., Norcross, GA), and their concentrations were carefully determined on a NanoDrop^®^ ND-1000 (NanoDrop). The number of PCR products per µl was calculated as previously described [@pone.0035827-Sjling2]. The PCR products were then diluted in Elution Buffer (Qiagen, Omega Bio-Tek) to give ten-fold dilution series from 5×10^7^ to 5 PCR products/µl. All real-time PCR reactions were performed in 20 µl volumes containing 8 pmol of each specific primer, 10 µl Power SYBR®Green PCR Master Mix (Applied Biosystems), and 2 µl of template, using the default cycling settings with minor modifications as described in [@pone.0035827-Lothigius1]. Quantification was performed by using the default software settings for the threshold and baseline values (Applied Biosystems). The number of gene-specific transcripts per 20 ng of total RNA was calculated. cDNA samples and corresponding (--RT) controls were run in parallel. When the difference in C~t~ values between the sample and the (--RT) control was ≥ 3.0 or ≤ 6.6, the number of transcripts was adjusted accordingly. When the difference was \> 6.6 the (--RT) values were ignored since any contaminating DNA would account for less than 1% of the total product, but if the difference was \< 3.0 the amount of DNA contamination was considered too high and the results were discarded. Since we have previously found a detection limit of 2--3 copies per reaction for real-time PCR [@pone.0035827-Lothigius1] the detection limit in this study was set at 2 transcripts per reaction, and all results below 2 transcripts were considered as negative. Measurement of Antibody Response in Serum {#s4k} ----------------------------------------- Antibody titers of IgG and IgA isotypes against CS5 and CS6 were determined as described previously [@pone.0035827-Qadri6] using purified CS5 (1 µg/ml) and recombinant CS6 (0.3 µg/ml) as coating antigens. Statistical Analyses {#s4l} -------------------- Results were analyzed with the non-parametrical non-paired Mann-Whitney test using the GraphPad Prism version 4.00 for Windows (GraphPad Software, San Diego, CA, USA). We are thankful to Dr. Yasmin Ara Begum and colleagues at the icddr,b for help with collection of clinical samples, and to Gudrun Wiklund for valuable technical assistance in Gothenburg. **Competing Interests:**The authors have declared that no competing interests exist. **Funding:**This study was supported by the Swedish Agency for Research and Economic Cooperation (Sida-SAREC) and the Swedish International Development Agency (grants INT-ICDDR, B-HN-01-AV): [www.sida.se](http://www.sida.se); the Swedish Research Council (grant 16X-09084): [www.vr.se](http://www.vr.se); the International Centre for Diarrhoeal Disease Research, Bangladesh (icddr,b): [www.icddrb.org](http://www.icddrb.org); the Marianne and Marcus Wallenberg Foundation: [www.wallenberg.com](http://www.wallenberg.com); and the Magnus Bergvall Foundation: [www.magnbergvallsstiftelse.nu/](http://www.magnbergvallsstiftelse.nu/). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. [^1]: Conceived and designed the experiments: MN ÅS AMS. Performed the experiments: MN AvM. Analyzed the data: MN ÅS AvM AMS. Contributed reagents/materials/analysis tools: ÅS FQ AMS. Wrote the paper: MN ÅS AMS.