text stringlengths 8 5.77M |
|---|
Tumor necrosis factor alpha inhibits insulin-induced mitogenic signaling in vascular smooth muscle cells.
Tumor necrosis factor alpha (TNFalpha) interferes with insulin signaling in adipose tissue and may promote insulin resistance. Insulin binding to the insulin receptor (IR) triggers its autophosphorylation, resulting in phosphorylation of Shc and the downstream activation of p42/p44 extracellular signal-regulated kinase 1/2 mitogen-activated protein kinase (ERK1/2), which mediates insulin-induced proliferation in vascular smooth muscle cells (VSMC). Since insulin resistance is a risk factor for vascular disease, we examined the effects of TNFalpha on mitogenic signaling by insulin. In rat aortic VSMC, insulin induced rapid phosphorylation of the IR and Shc and caused a 5.3-fold increase in activated, phosphorylated ERK1/2 at 10 min. Insulin induced a biphasic ERK1/2 activation with a transient peak at 10 min and a sustained late phase after 2 h. Preincubation (30-120 min) with TNFalpha had no effect on insulin-induced IR phosphorylation. In contrast, TNFalpha transiently suppressed insulin-induced ERK1/2 activation. Insulin-induced phosphorylation of Shc was inhibited by TNFalpha in a similar pattern. Since mitogenic signaling by insulin in VSMC requires ERK1/2 activation, we examined the effect of TNFalpha on insulin-induced proliferation. Insulin alone induced a 3.4-fold increase in DNA synthesis, which TNFalpha inhibited by 48%. TNFalpha alone was not mitogenic. Inhibition of ERK1/2 activation with PD98059 also inhibited insulin-stimulated DNA synthesis by 57%. TNFalpha did not inhibit platelet-derived growth factor-induced ERK1/2 activation or DNA synthesis in VSMC. Thus, TNFalpha selectively interferes with insulin-induced mitogenic signaling by inhibiting the phosphorylation of Shc and the downstream activation of ERK1/2. |
.avatar img {
border: 2px solid $eshill-section-bgcolor;
margin-bottom: 1em;
@media (max-width: 767px) {
max-width: 210px;
margin-left: auto;
margin-right: auto;
}
}
.heading-separator h2 {
@include dashed-heading-variant($eshill-header-color, #fff, fontsize(h1));
margin: 6.5rem 0;
}
.person-card {
@media (min-width: 767px) {
height:45rem;
}
}
.team-content {
h4{
font-weight: bold;
text-align:center;
}
p {
text-align:center;
}
p.duty{
font-size: 1.4rem;
font-weight: bold;
}
p.period{
font-size: 1.4rem;
}
p.location{
color: #737373;
font-size: 1.4rem;
}
.links-inline {
list-style: none;
text-align: center;
padding: 0;
min-height: 4rem;
display: flex;
align-items: center;
justify-content: center;
a {
display: flex;
align-items: center;
justify-content: center;
width: 32px;
height: 32px;
background-color: #999;
border-radius: 50%;
margin: 3px;
text-decoration: none;
transition: all .2s ease;
&:hover {
background-color: #1e6887;
}
}
li.github {
a {
background-color: transparent;
&:hover {
background-color: transparent;
}
}
.fa {
font-size: 37px;
color: #999;
transition: all .2s ease;
&:hover {
color: #1e6887;
}
}
}
li.twitter {
.fa {
font-size: 18px;
color: #ffffff;
}
}
}
}
#contributors img {
display: inline-block;
@include rem(width, 42px);
@include rem(height, 42px);
@include rem(margin, 1px);
}
|
Q:
How to draw line chart using jfreechart from top to bottom?
I'm using jfreechart to draw line chart , I need the line to be drawn from top to bottom
.... Meaning: 0,0 coordinates will be in the top-left corner.
I was able to do it when I used 'CategoryPlot' just by change 'PlotOrientation' but label on the left became overlap..anyhow, I prefer 'xyplot'
changing 'setInverted' or 'setDomainAxisLocation' did not help
any help will be appreciated
update:
I'm reposting my code for better clarity (chart drawing part )
In the first code:
I got the needed output
as showing here
http://i58.tinypic.com/r1fr01.jpg
just by passing 'PlotOrientation.HORIZONTAL'
in this part, I'm using 'CategoryPlot'
import java.awt.*;
import javax.swing.JPanel;
import org.jfree.chart.*;
import org.jfree.chart.plot.CategoryPlot;
import org.jfree.chart.plot.PlotOrientation;
import org.jfree.chart.renderer.category.LineAndShapeRenderer;
import org.jfree.chart.title.TextTitle;
import org.jfree.data.category.CategoryDataset;
import org.jfree.data.category.DefaultCategoryDataset;
import org.jfree.ui.*;
public class PCategory extends ApplicationFrame
{
public PCategory(String s)
{
super(s);
JPanel jpanel = createDemoPanel();
jpanel.setPreferredSize(new Dimension(300, 200));
setContentPane(jpanel);
}
private static CategoryDataset createDataset()
{
DefaultCategoryDataset defaultcategorydataset = new DefaultCategoryDataset();
defaultcategorydataset.addValue(0,"Pixels", Integer.toString(0));
defaultcategorydataset.addValue(2,"Pixels", Integer.toString(1));
defaultcategorydataset.addValue(5,"Pixels", Integer.toString(2));
defaultcategorydataset.addValue(10,"Pixels", Integer.toString(3));
defaultcategorydataset.addValue(7,"Pixels", Integer.toString(4));
defaultcategorydataset.addValue(8,"Pixels", Integer.toString(5));
return defaultcategorydataset;
}
private static JFreeChart createChart(CategoryDataset categorydataset)
{
JFreeChart jfreechart = ChartFactory.createLineChart(null, null, null, categorydataset, PlotOrientation.HORIZONTAL, false, true, false);
jfreechart.addSubtitle(new TextTitle("Title"));
CategoryPlot categoryplot = (CategoryPlot)jfreechart.getPlot();
categoryplot.setRangePannable(true);
categoryplot.setRangeGridlinesVisible(false);
ChartUtilities.applyCurrentTheme(jfreechart);
LineAndShapeRenderer lineandshaperenderer = (LineAndShapeRenderer)categoryplot.getRenderer();
lineandshaperenderer.setBaseShapesVisible(true);
lineandshaperenderer.setDrawOutlines(true);
lineandshaperenderer.setUseFillPaint(true);
lineandshaperenderer.setBaseFillPaint(Color.white);
lineandshaperenderer.setSeriesStroke(0, new BasicStroke(3F));
lineandshaperenderer.setSeriesOutlineStroke(0, new BasicStroke(2.0F));
lineandshaperenderer.setSeriesShape(0, new java.awt.geom.Ellipse2D.Double(-5D, -5D, 10D, 10D));
return jfreechart;
}
public static JPanel createDemoPanel()
{
JFreeChart jfreechart = createChart(createDataset());
ChartPanel chartpanel = new ChartPanel(jfreechart);
chartpanel.setMouseWheelEnabled(true);
return chartpanel;
}
public static void main(String args[])
{
PCategory PCategory = new PCategory("PCategory.java");
PCategory.pack();
RefineryUtilities.centerFrameOnScreen(PCategory);
PCategory.setVisible(true);
}
}
In the second code:
I didn't get what I need even though I used same data and pass
'PlotOrientation.HORIZONTAL'
as showing here
http://i57.tinypic.com/11hq9tk.jpg
I commented out my approach to solve the problem
import java.awt.Dimension;
import javax.swing.JPanel;
import org.jfree.chart.*;
import org.jfree.chart.plot.PlotOrientation;
import org.jfree.chart.plot.XYPlot;
import org.jfree.chart.renderer.xy.XYLineAndShapeRenderer;
import org.jfree.data.xy.*;
import org.jfree.ui.ApplicationFrame;
import org.jfree.ui.RefineryUtilities;
public class PXYPlot extends ApplicationFrame {
public PXYPlot(String s) {
super(s);
JPanel jpanel = createPanel();
jpanel.setPreferredSize(new Dimension(300, 200));
setContentPane(jpanel);
}
private static XYDataset createDataset() {
XYSeries xyseries = new XYSeries("Pixels", true);
xyseries.add(0, 0);
xyseries.add(2, 1);
xyseries.add(5, 2);
xyseries.add(10, 3);
xyseries.add(7, 4);
xyseries.add(8, 5);
XYSeriesCollection xyseriescollection = new XYSeriesCollection();
xyseriescollection.addSeries(xyseries);
return xyseriescollection;
}
private static JFreeChart createChart(XYDataset xydataset)
{
JFreeChart Mychart = ChartFactory.createXYLineChart(null, null, null, xydataset, PlotOrientation.HORIZONTAL, true, true, false);
XYPlot xyplot = (XYPlot) Mychart.getPlot();
xyplot.setDomainPannable(true);
xyplot.setRangePannable(true);
XYLineAndShapeRenderer xylineandshaperenderer = (XYLineAndShapeRenderer) xyplot.getRenderer();
xylineandshaperenderer.setBaseShapesVisible(true);
xylineandshaperenderer.setBaseShapesFilled(true);
/* ----------- this part is my attempt to solve the problem -----
NumberAxis numberaxis = (NumberAxis)xyplot.getRangeAxis();
numberaxis.setInverted(true);
xyplot.setDomainAxisLocation(AxisLocation.TOP_OR_LEFT);
//------------I like XYplot because of the part -----------------
NumberAxis xAxis = new NumberAxis();
xAxis.setTickUnit(new NumberTickUnit(1));
XYPlot plot = (XYPlot) Mychart.getPlot();
plot.setDomainAxis(xAxis);
//-----------------------------
numberaxis.setStandardTickUnits(NumberAxis.createIntegerTickUnits());
*/
return Mychart;
}
public static JPanel createPanel() {
JFreeChart jfreechart = createChart(createDataset());
ChartPanel chartpanel = new ChartPanel(jfreechart);
chartpanel.setMouseWheelEnabled(true);
return chartpanel;
}
public static void main(String args[]) {
PXYPlot PXYPlot = new PXYPlot("PXYPlot.java");
PXYPlot.pack();
RefineryUtilities.centerFrameOnScreen(PXYPlot);
PXYPlot.setVisible(true);
}
}
I need 'XYPlot' because I have a huge amount of data , I think 'CategoryPlot' is not designed for it, beside I have overlapping issue with it. In addition, it needs number of overriding in order to meet my needs
A:
First, create your dataset as follows then don't change it...the data is the same no matter how you want to present it:
private XYDataset createDataset() {
XYSeries s1 = new XYSeries("S1");
s1.add(0, 0);
s1.add(1, 2);
s1.add(2, 5);
s1.add(3, 10);
s1.add(4, 7);
s1.add(5, 8);
XYSeriesCollection dataset = new XYSeriesCollection();
dataset.addSeries(s1);
return dataset;
}
Now a reasonably standard JFreeChart creation would look like this:
...and here is the code:
import java.awt.Color;
import java.awt.Dimension;
import java.awt.geom.Ellipse2D;
import javax.swing.JFrame;
import org.jfree.chart.ChartFactory;
import org.jfree.chart.ChartPanel;
import org.jfree.chart.JFreeChart;
import org.jfree.chart.axis.NumberAxis;
import org.jfree.chart.plot.XYPlot;
import org.jfree.chart.renderer.xy.XYLineAndShapeRenderer;
import org.jfree.data.xy.XYDataset;
import org.jfree.data.xy.XYSeries;
import org.jfree.data.xy.XYSeriesCollection;
public class StackOverflow25993430 extends JFrame {
public StackOverflow25993430(String title) {
super(title);
JFreeChart chart = createChart(createDataset());
ChartPanel panel = new ChartPanel(chart);
panel.setPreferredSize(new Dimension(500, 300));
setContentPane(panel);
}
private XYDataset createDataset() {
XYSeries s1 = new XYSeries("S1");
s1.add(0, 0);
s1.add(1, 2);
s1.add(2, 5);
s1.add(3, 10);
s1.add(4, 7);
s1.add(5, 8);
XYSeriesCollection dataset = new XYSeriesCollection();
dataset.addSeries(s1);
return dataset;
}
private JFreeChart createChart(XYDataset dataset) {
JFreeChart chart = ChartFactory.createXYLineChart(
"StackOverflow25993430", "X", "Y", dataset);
chart.removeLegend();
XYPlot plot = (XYPlot) chart.getPlot();
XYLineAndShapeRenderer renderer = (XYLineAndShapeRenderer) plot.getRenderer();
renderer.setSeriesShapesVisible(0, true);
renderer.setSeriesShape(0, new Ellipse2D.Double(-4.0, -4.0, 8.0, 8.0));
renderer.setSeriesFillPaint(0, Color.WHITE);
renderer.setUseFillPaint(true);
NumberAxis xAxis = (NumberAxis) plot.getDomainAxis();
xAxis.setStandardTickUnits(NumberAxis.createIntegerTickUnits());
return chart;
}
public static void main(String[] args) {
JFrame app = new StackOverflow25993430("JFreeChart");
app.pack();
app.setVisible(true);
}
}
Very little needs changing to get the plot you want. First, the plot orientation should be changed, second the x-axis should be inverted, and third you have to provide a hint that the y-axis should go at the top. Here is the result:
... and the code to produce it (with *** marking the 5 lines that were added):
import java.awt.Color;
import java.awt.Dimension;
import java.awt.geom.Ellipse2D;
import javax.swing.JFrame;
import org.jfree.chart.ChartFactory;
import org.jfree.chart.ChartPanel;
import org.jfree.chart.JFreeChart;
import org.jfree.chart.axis.AxisLocation; // ***
import org.jfree.chart.axis.NumberAxis;
import org.jfree.chart.plot.PlotOrientation; // ***
import org.jfree.chart.plot.XYPlot;
import org.jfree.chart.renderer.xy.XYLineAndShapeRenderer;
import org.jfree.data.xy.XYDataset;
import org.jfree.data.xy.XYSeries;
import org.jfree.data.xy.XYSeriesCollection;
public class StackOverflow25993430b extends JFrame {
public StackOverflow25993430b(String title) {
super(title);
JFreeChart chart = createChart(createDataset());
ChartPanel panel = new ChartPanel(chart);
panel.setPreferredSize(new Dimension(500, 300));
setContentPane(panel);
}
private XYDataset createDataset() {
XYSeries s1 = new XYSeries("S1");
s1.add(0, 0);
s1.add(1, 2);
s1.add(2, 5);
s1.add(3, 10);
s1.add(4, 7);
s1.add(5, 8);
XYSeriesCollection dataset = new XYSeriesCollection();
dataset.addSeries(s1);
return dataset;
}
private JFreeChart createChart(XYDataset dataset) {
JFreeChart chart = ChartFactory.createXYLineChart(
"StackOverflow25993430b", "X", "Y", dataset);
chart.removeLegend();
XYPlot plot = (XYPlot) chart.getPlot();
plot.setOrientation(PlotOrientation.HORIZONTAL); // ***
plot.setRangeAxisLocation(AxisLocation.TOP_OR_LEFT); // ***
XYLineAndShapeRenderer renderer = (XYLineAndShapeRenderer) plot.getRenderer();
renderer.setSeriesShapesVisible(0, true);
renderer.setSeriesShape(0, new Ellipse2D.Double(-4.0, -4.0, 8.0, 8.0));
renderer.setSeriesFillPaint(0, Color.WHITE);
renderer.setUseFillPaint(true);
NumberAxis xAxis = (NumberAxis) plot.getDomainAxis();
xAxis.setStandardTickUnits(NumberAxis.createIntegerTickUnits());
xAxis.setInverted(true); // ***
return chart;
}
public static void main(String[] args) {
JFrame app = new StackOverflow25993430b("JFreeChart");
app.pack();
app.setVisible(true);
}
}
|
b?
2843
Let d(m) = -m + 10. Let y be d(-5). Suppose -12*b = -y*b. Let t(i) = -i**2 - i + 15. What are the prime factors of t(b)?
3, 5
Let n(a) = a**2 + 16*a - 9. Let l be n(-16). Let t be ((-102)/9)/(2/l). Suppose -4*s = -5*s + t. List the prime factors of s.
3, 17
Let o(c) = -2*c**3 + c**2 - 7*c - 3. Suppose 3 = 2252*b - 2253*b. List the prime factors of o(b).
3
Suppose 0 = 2881*o - 2905*o + 22800. List the prime factors of o.
2, 5, 19
Let v = 124940 + -51482. What are the prime factors of v?
2, 3, 7, 11, 53
Let f(u) = -4*u + 4. Let m be f(3). Let n(i) = i**2 - 9*i + 1. Let a be n(m). Suppose 3*t - 5*v - a = -25, 3*t - 4*v - 113 = 0. What are the prime factors of t?
3, 13
Suppose 122*z + 17*z + 390*z = 28829442. List the prime factors of z.
2, 3, 31, 293
Suppose 4*b + 491 = 507. Suppose b*a - d - 2349 = 0, 399 = a - 4*d - 207. List the prime factors of a.
2, 293
Let h be -2*(-12)/8*1. Suppose 2*m = -4*x + 670, 0 = m - 6*x + h*x - 330. Suppose m = -38*o + 41*o. What are the prime factors of o?
3, 37
Let m be ((-6)/(24/20) - -10) + -2. Suppose -5*z + 170 = 5*j, 2*j + 6 = m*z - 96. What are the prime factors of z?
2, 17
Suppose -18 = -3*p + 3*w, 5*p - w = 4 + 14. Suppose -964 = -p*u - t, u = -2*u - 2*t + 968. What are the prime factors of u?
2, 5
List the prime factors of ((-240)/45 - -6)/((-3)/(190827/(-2))).
7, 13, 233
Suppose -4*a + a + 57 + 159 = 0. What are the prime factors of a?
2, 3
Let d(u) = 43085*u**3 + 9*u**2 - 66*u + 57. What are the prime factors of d(1)?
5, 7, 1231
Let s(a) = 44*a**2 + 6*a**2 + 8*a - 40*a**2 + 14 + 43*a**2. List the prime factors of s(-3).
467
Let p be 594/(-9)*(-1)/(-3). Let b be (7 + p)*(-3 + -8). Suppose -2*w - u = -4*u - 45, -b = -5*w - 3*u. List the prime factors of w.
2, 3, 5
Let r(p) = -p**3 + 12*p**2 + 4*p + 14. Suppose 0 = 18*z - 15*z - 36. Let l be r(z). Suppose 0 = l*d - 66*d + 348. List the prime factors of d.
3, 29
Let h(x) = 4*x**3 + x**2 - 4*x - 8. Let z be h(-2). What are the prime factors of (-3171)/z*(-12)/(-9)?
151
Let n be 0 - 1 - -2 - 12/4. Let v be 2 + n + 2 + -15. Let p = 165 - v. What are the prime factors of p?
2, 89
Let q = 6314 + -4178. List the prime factors of q.
2, 3, 89
What are the prime factors of 7701 + ((-1084)/84 + 13 - (-2)/(-21))?
3, 17, 151
Let g(y) = y - 6. Let l(q) = 415*q + 62. Let w(f) = 6*g(f) + l(f). List the prime factors of w(3).
1289
Suppose 3*h - 4*j - 3886 = 0, 0 = 4*h - j - 385 - 4766. List the prime factors of h.
2, 643
Let g = -3423 - -4389. What are the prime factors of g?
2, 3, 7, 23
Let c(i) = -i**3 - 6*i**2 - 9*i + 2. Let y(r) = -r**2 + 2*r - 1. Let m be y(-6). Let k = m - -42. What are the prime factors of c(k)?
2, 3, 19
Let n(h) = -173*h - 6. Let f be n(2). Let a = -52 - f. List the prime factors of a.
2, 3, 5
Let x be 18/((34/85)/(1/5)). Let q(p) = 3 - 6 + 4 - x*p + 3*p**2 + 13. List the prime factors of q(7).
2, 7
What are the prime factors of 6 - (-117 + -8 + 13)*(29 - 4)?
2, 23, 61
Suppose 0 = -4*b - 4*k - 0*k - 32, b - 4*k - 7 = 0. Let p be 108*b*(-12)/20. Suppose -12*r = -18*r + p. List the prime factors of r.
2, 3
Let x(j) = 148*j**2 - 41*j + 339. What are the prime factors of x(8)?
3, 29, 109
Let d be ((-5)/(-7))/(3 - (-80)/(-28)). Suppose 0 = d*t - 2*k, -3*k + 14 + 5 = 2*t. Suppose 2*m - 592 = -t*m. What are the prime factors of m?
2, 37
Suppose 3*u - 1809 = -3*l, -4*u - l = -1208 - 1198. Let a = u + -216. What are the prime factors of a?
5, 7, 11
Let x(v) = 2*v**3 - 33*v**2 + 59*v - 233. What are the prime factors of x(29)?
3, 13, 577
Suppose -2*m + 2 = -j, 4*j - 32 = -0*j - 2*m. Let w(k) = 14*k**2 - 7*k + 13. What are the prime factors of w(j)?
5, 19
What are the prime factors of 2101/2 + (-207)/(-414)?
1051
Let a(k) = -155*k - 93. Let n = -386 + 380. What are the prime factors of a(n)?
3, 31
Suppose 0 = -j + 2*b + 49, 4*j = 86*b - 91*b + 183. Suppose j*t = 42*t + 5785. List the prime factors of t.
13, 89
Let j(v) = 20*v**2 - 51*v - 71. Let a be j(-19). Suppose -315*z + 326*z = a. What are the prime factors of z?
2, 3, 41
List the prime factors of (1/(-5))/(102/(-3563710))*48/8.
2, 20963
Suppose 2*a + 22 = 2*b - 0, -2*b = -4*a - 30. What are the prime factors of (b/(112/(-12)))/((-1)/392)?
2, 3, 7
Suppose -7030 = -104*d + 55266. What are the prime factors of d?
599
Suppose -28*l + 0*l + 700 = 0. Let m(i) = -i**3 + 25*i**2 + 7*i - 27. What are the prime factors of m(l)?
2, 37
Let p(h) = -h**3 + 29*h**2 + 23*h + 43. What are the prime factors of p(-23)?
2, 59, 229
Suppose 0*k + 2*k - 2 = 0. Let b(d) = -459*d**3 - d**2 + 1. Let j be b(k). What are the prime factors of (-1)/2*4*j/6?
3, 17
Let a(j) = -72*j + 156. Let o be a(-20). Let z = -901 + o. List the prime factors of z.
5, 139
Let o(d) = 2 - 14 + 26 + 9*d. Suppose b - 5 = 0, -4*f + b = -0*f - 7. List the prime factors of o(f).
41
Let c = -22291 + 47596. List the prime factors of c.
3, 5, 7, 241
Let m = 69293 - 19110. Suppose -17391 - m = -46*p. What are the prime factors of p?
13, 113
Suppose 8*v + 166 = 3086. Let b = v + -195. What are the prime factors of b?
2, 5, 17
Suppose 28*q - 682 = 6*q. Suppose -2*i - 7975 = -q*i. What are the prime factors of i?
5, 11
Let l be ((-2315)/(-45)*-3)/((-3)/(-315)). List the prime factors of l/(-14) + (-3)/(-6).
2, 3, 193
Let c = -22147 + 104306. What are the prime factors of c?
7, 11, 97
Suppose 4*v - 48 = -i, 3*i - i + 48 = 4*v. Suppose -4*y + y = -v. List the prime factors of 3 + (1260/5)/y.
2, 3, 11
Suppose 345 = s - 602. Suppose -9*r = -4*l - 14*r + 1903, s = 2*l + r. List the prime factors of l.
2, 59
Let q = 25 - 31. List the prime factors of 12/(-21)*4179/q.
2, 199
Let c = 7079 - -60. What are the prime factors of c?
11, 59
Suppose -4*r - 550 = -4*s + 898, -2*r = -4*s + 734. Let j = -305 - r. List the prime factors of j.
2, 13
Suppose -59*d = 30*d - 1406141 + 434617. List the prime factors of d.
2, 2729
Suppose -5*z - 3*c + 13 = 0, 5*z - 12 = -c - 1. Let i(u) = -u**3 + 8*u**2 - 7*u + z*u**3 + 16 + 9*u. List the prime factors of i(-7).
3, 17
Suppose -4*c = -4*d + 72, 11*c - 12*c + 39 = 2*d. Suppose -m - 30 = -3*m. Suppose d*q = m*q + 240. What are the prime factors of q?
2, 3, 5
Suppose 17*v = 353 - 1560. Suppose -5*x + 680 = -0*x. Let t = v + x. List the prime factors of t.
5, 13
Let c = 453 - 453. Suppose -28*d + 12526 + 21578 = c. What are the prime factors of d?
2, 3, 7, 29
Let d = -47 - -53. Let p be (26/(-6) - -1)*-10*-6. List the prime factors of (d/(-4))/(4 - (-812)/p).
5
Let g be (-2)/(-3) + 3*(-664)/72. Let n = 30 + g. Suppose -3*j - 1 = 2*a - 9, -32 = -2*a + n*j. What are the prime factors of a?
2, 5
Suppose 4 = -4*h + 8*h. Let g be (-4)/(8/(-10)) - (-1 - h). Let z(r) = -r**3 + 7*r**2 + 7*r + 15. What are the prime factors of z(g)?
2
Let p(u) = -11*u**3 - 2*u**2. Let f be p(1). Let x(c) = c**3 + 14*c**2 - 3*c - 19. What are the prime factors of x(f)?
3, 7
Let q(c) = -c**2 + 12*c - 32. Let x be q(5). Suppose -3*p - 4*r + 1321 = 0, 19*r - 22*r - 1314 = -x*p. What are the prime factors of p?
439
Let p(z) = -z**3 - 5*z**2 + 8*z + 12. Let f be p(-5). Let s = f + 11. Let o = s - -70. What are the prime factors of o?
53
Let x = -205 - -123. Let r = 183 - x. List the prime factors of r.
5, 53
Let l = 10259 - 3444. What are the prime factors of l?
5, 29, 47
Suppose -2368 = -6*w - 10*w. List the prime factors of (132/(-18))/(w/75 - 2).
5, 11
Let t(u) = -u**2 + 11*u - 5. Let x be t(2). Let n = x + -12. List the prime factors of ((-70)/(-28))/(n/4).
2, 5
Let t = -327 + 765. Let w = 374 + t. List the prime factors of w.
2, 7, 29
Let l = 231 - 213. What are the prime factors of (-653 + -1)/((-36)/l)?
3, 109
Let t = -90 + 92. Let r be (-72)/16*4/(-3). Suppose 28 = r*c - t. What are the prime factors of c?
5
Suppose 0*l + 2*l - 60 = 0. Let t be ((-2)/(-7))/((-40)/(-140)). Let p = l - t. List the prime factors of p.
29
Let u(w) = w**2 - 17*w - 57. Let q(d) = d**2 - 4*d + 11. Let x be q(6). List the prime factors of u(x).
3
Suppose 2*n - 11100 = -3*f + n, 3*f + 2*n - 11094 = 0. List the prime factors of f.
2, 3, 617
Let v = -40 - 44. Let m be (-5)/2*v/10. What are the prime factors of (m/6 + -2)*(-568)/(-12)?
71
Let o be ((-3820)/6)/(8/(-12)). Suppose o = 5*g - 5*a, -2*g + 5*a + 162 = -229. What are the prime factors of g?
2, 47
What are the prime fact |
Posts have been exceedingly light recently as I have been both getting ready for vacation (which of course means posts will be non-existent until my return) and have spent the last several days preparing for and testifying yesterday before the Senate Judiciary Committee against overturning the Gross v. FBL Services decision of the Supreme Court this summer which nixed the mixed motive instruction for ADEA cases.
The future of mandatory arbitration was also a subject and frankly got a lot more attention than Gross. Senator Franken, one of the members of the Committee has taken that on as a major issue and that took up a lot of the hearing. For any who have an interest in seeing the hearing, there is a link to the webcast on the Committee's website.
More normal posting will hopefull arise following when I return and dig out from 2 weeks plus of accumulated email! |
Ontogenesis of 28 kDa vitamin D-induced calcium-binding protein in human kidney.
The kidney distribution of 28 kDa vitamin D-induced calcium binding protein (CaBP) was studied in 15 fetuses (11 to 33 weeks old), six children and adults (12 days to 32 years old) by immunocytochemistry using a specific antibody to rat renal 28 kDa CaBP. Similar results were obtained on frozen and fixed tissues. Kidneys from one adult and three fetuses were studied by immunoelectronmicroscopy for antigen localization at the subcellular level using the indirect immunoperoxidase technique. The 28 kDa CaBP was present in all kidneys from the eleventh week of gestation. At that stage, all deep parts of collecting ducts were homogeneously stained and a few distal tubules located in the deep cortex were intensely labeled. No labeling was observed in the early stage of nephron differentiation (S-body). 28 kDa CaBP distribution changed with kidney maturation. There was a progressive reduction of the deep part of collecting duct labeling and a concomitant increase in the number and intensity of stained distal tubular cells. At the ultrastructural level, 28 kDa CaBP was observed in the cytosol and the nuclear euchromatin. Our study demonstrates the early cellular synthesis of 28 kDa CaBP and its transient expression by deep collecting duct cells during early fetal life, at a time when only a few distal convoluted tubular cells synthetize it. |
module Events.CharacterSelect
( handleCharacterSelectEvent
)
where
import Brick
import qualified Graphics.Vty as V
import Types
import State
handleCharacterSelectEvent :: AppState -> BrickEvent Name e -> EventM Name (Next AppState)
handleCharacterSelectEvent s (VtyEvent (V.EvKey V.KEsc _)) =
continue $ cancelCharacterSelect s
handleCharacterSelectEvent s (VtyEvent (V.EvKey (V.KChar c) [])) =
continue $ selectCharacter c s
handleCharacterSelectEvent s _ =
continue s
|
Q:
When is it (not) appropriate to bundle dependencies with an application?
Summary
I recently had a conversation with the creator of a framework that one of my applications depends on. During that conversation he mentioned as a sort of aside that it would make my life simpler if I just bundled his framework with my application and delivered to the end user a version that I knew was consistent with my code. Intuitively I have always tried to avoid doing this and, in fact, I have taken pains to segment my own code so that portions of it could be redistributed without taking the entire project (even when there was precious little chance anyone would ever reuse any of it). However, after mulling it over for some time I have not been able to come up with a particularly good reason why I do this. In fact, now that I have thought about it, I'm seeing a pretty compelling case to bundle all my smaller dependencies. I have come up with a list of pros and cons and I'm hoping someone can point out anything that I'm missing.
Pros
Consistency of versions means easier
testing and troubleshooting.
Application may reach a wider
audience since there appear to be
fewer components to install.
Small tweaks to the dependency can
more easily be made downstream and
delivered with the application,
rather than waiting for them to
percolate into the upstream code base.
Cons
More complex packaging process to include
dependencies.
User may end up with multiple copies
of a dependency on their machine.
Per bortzmeyer's response, there are potential security concerns with not being able to upgrade individual components.
Notes
For reference, my application is written in Python and the dependencies I'm referencing are "light", by which I mean small and not in very common use. (So they do not exist on all machines or even in all repositories.) And when I say "package with" my application, I mean distribute under my own source tree, not install with a script that resides inside my package, so there would be no chance of conflicting versions. I am also developing solely on Linux so there are no Windows installation issues to worry about.
All that being said, I am interested in hearing any thoughts on the broader (language-independent) issue of packaging dependencies as well. Is there something I am missing or is this an easy decision that I am just over-thinking?
Addendum 1
It is worth mentioning that I am also quite sensitive to the needs of downstream packagers. I would like it to be as straightforward as possible to wrap the application up in a distribution-specific Deb or RPM.
A:
I favor bundling dependencies, if it's not feasible to use a system for automatic dependency resolution (i.e. setuptools), and if you can do it without introducing version conflicts. You still have to consider your application and your audience; serious developers or enthusiasts are more likely to want to work with a specific (latest) version of the dependency. Bundling stuff in may be annoying for them, since it's not what they expect.
But, especially for end-users of an application, I seriously doubt most people enjoy having to search for dependencies. As far as having duplicate copies goes, I would much rather spend an extra 10 milliseconds downloading some additional kilobytes, or spend whatever fraction of a cent on the extra meg of disk space, than spend 10+ minutes searching through websites (which may be down), downloading, installing (which may fail if versions are incompatible), etc.
I don't care how many copies of a library I have on my disk, as long as they don't get in each others' way. Disk space is really, really cheap.
A:
Can't you just rely on a certain version of those dependencies? E.g. in Python with setuptools you can specify which exact version it needs or even give some conditions like <= > etc. This of course only applies to Python and on the specifc package manager but I would personally always first try not to bundle everything. With shipping it as a Python egg you will also have all the dependencies installed automatically.
You might of course also use a two-way strategy in providing your own package with just links to the dependencies and nevertheless provide a complete setup in some installer like fashion. But even then (in the python case) I would suggest to simply bundle the eggs with it.
For some introduction into eggs see this post of mine.
Of course this is very Python specific but I assume that other language might have similar packaging tools.
A:
If you're producing software for an end-user, the goal is to let the customer use your software. Anything that stands in the way is counter-productive. If they have to download dependencies themselves, there's a possibility that they'll decide to avoid your software instead. You can't control whether libraries will be backwards compatible, and you don't want your software to stop working because the user updated their system. Similarly, you don't want a customer to install an old version of your software with old libraries and have the rest of the system break.
This means bundling is generally the way to go. If you can ensure that your software will install smoothly without bundling dependencies, and that's less work, then that may be a better option. It's about what satisfies your customers.
|
Main Menu
In France, the Socialist Government of the so-called Popular Front brought all the companies building military aircraft, aero engines and ar-mament under its control in 1936. The im-mediate result was the socialized oblivion of such established companies as Marcel Bloch, Bleriot, Nieuport, Potez, Dewoitine, Hanriot and Farman within half a dozen nationalized groups or Societies Nationales, named according to their geographical location (Nord, Ouest, Centre, Midi and so on). Les Mureaux, CAMS, and part of Breguet, Amoit and Potez formed SNCAN in 1938.
Dominant concern was production of Potez 630 series of twin-engined multipurpose aircraft. Peak output reached in May 1940. Development of basic type (e.g. Potez 671 specialized fighter with elliptical wing) was also SNCAN concern.
After World War II, although four of the nationalized groups continued operating un-der state control, private companies were al-lowed to resume the design and manufacture of both civil and military aircraft. Some of the pioneering names of French aviation, such as Breguet and Morane-Saulnier, returned to prominence, and by 1950 a new one had been added - Avions Marcel Dassault.
Caudron joined SNCAN in 1947.
Aerocentre / SNCAC went into liquidation during 1949, its plants and work being shared by SNCAN (Nord), SNCASO (Sud-Ouest) and engine form SNECMA.
In 1954, when company flew prototypes of trainers later built in quantity, amalgamated with Societe Frangaise d'Etudes et de Constructions de Materiels Aeronautiques Speciaux (SFECMAS, formerly Arsenal de I'Aeronautique).
From January 1958 called Nord Aviation. Under new name continued development of Nord/SFECMAS Gerfaut delta wing fighter; also Griffon, with fuselage forming outer casing of very large ramjet with turbojet in center for take-off and to ignite ramjet. Noratlas twin-boom transport, though first flown September 1949, continued in production and development under new name, achieving wide success. Nord name was emphasized in Noroit flying boat and Noreclair shipboard aircraft.
Max Holste joined Nord in 1961.
On January 1st, 1970 three French nationalised aircraft companies - Sud-Aviation, Nord Aviation and the missile manufacturing company, SEREB - were merged into Aérospatiale.
Nord-Aviation produced a version of the Messerschmitt Bf 108 Taifun, known as the Nord 1002 Pingouin, for the French military service immediately after the Second World War. A tricycle landing gear variant, the Nord 1101 Noralpha, and a redesigned civilian four-seat derivative, the Nord 1203 Norecrin, were also produced in quantity, together with Nord NC-853/856 Norvigie liaison/trainer aircraft delivered to the French army and to aero clubs in the mid-1950s. A batch of N.1402 Noroit twin-engined amphibians were built for the French navy; and the N.2501 Noratlas twin-boom, twin-engined transport, first flown 1952, was subsequently produced in France and Germany. Nord took over the Max Holste Super Broussard twin-engined transport design and developed it as the Nord 262 airliner, delivered to European and U.S. airlines and to the French navy by Aerospatiale. |
River falls divorced singles personals
Pof uses cookies to measure site performance and usage, provide you with advertising tailored to your interests, and enable social platform features such as share buttons. River falls wisconsin, cant delete this dammm account. Cathy wurzer is an american journalist and author she and eric eskola are the longtime hosts of almanac on twin cities public television she also hosts the regional portion of morning edition on minnesota public radio. Meet thousands of handsome single men personals online seeking women for dating, love, marriage in minnesota. Black river falls dating site, black river falls personals, black river falls singles luvfreecom is a 100% free online dating and personal ads site there are a lot of black river falls singles searching romance, friendship, fun and more dates.
(20 may 1977 - 1986) (divorced) while seeking to know her place in life, she decided to drop out of high school, and married douglas torfin, a telephone operator in her home town of thief river falls. River falls singles - if you are looking for serious relationship, then you come to the right place join our site to chat and meet new people budapest women from the millionaire matchmaker dating and love. Minnesota love dating and matchmaking service for minnesota singles and personals find your love in minnesota now.
Interests reading, walking, volunteering, crocheting about me i am a kind fun loving person who loves to laugh i spend most of my spare time volunteering for programs working with the youth in the st croix valley. Bookofmatchescom™ offers river falls free dating and personals for local single men and/or women the sign up process takes only seconds start meeting singles in river falls, wisconsin right now by signing up free or browsing through personal ads and hookup with someone that matches your interests. Free online dating in river falls for all ages and ethnicities, including seniors, white, black women and black men, asian, latino, latina, and everyone else forget classified personals, speed dating, or other river falls dating sites or chat rooms, you've found the best. River falls singles - if you are looking for someone to love you, begin using our dating site girls and men are waiting for you, sign up right now.
Join matchcom, the leader in online dating with more dates, more relationships and more marriages than any other dating site view divorced singles in river falls i am a: woman seeking a man man seeking a woman man seeking a man woman seeking a woman. Meet senior singles in river falls, wisconsin online & connect in the chat rooms dhu is a 100% free dating site for senior dating in river falls. Faith focused dating and relationships browse profiles & photos of minnesota thief river falls catholic women and join catholicmatchcom, the clear leader in online dating for catholics with more catholic singles than any other catholic dating site.
Faith focused dating and relationships browse profiles & photos of wisconsin river falls catholic singles and join catholicmatchcom, the clear leader in online dating for catholics with more catholic singles than any other catholic dating site. Thief river falls's best 100% free divorced singles dating site meet thousands of divorced singles in thief river falls with mingle2's free divorced singles personal ads and chat rooms our network of single men and women in thief river falls is the perfect place to make friends or find a boyfriend or girlfriend in thief river falls. Find something brilliant, or someone brilliant thief river falls is a lonely place without love check out other thief river falls singles here. River falls dating: browse river falls, wi singles & personals badger state of wisconsin why is matchcom the most popular way in the world to find love on your terms divorced , free online dating, gay singles, gay dating, jewish , lesbian singles, single parents. See why thousands of wisconsin, people visit us daily to find their online dating needs use multimedia options to enhance your chances for success, and find your males partner in river falls, in united states or anywhere on the planet.
More about my match charismatic & exciting wild native man i love silliness for i am pretty silly myself loves nature and being outdoors & enjoys going on random road trips just for the hell of it. Located opposite mystic mountain and just a few hundred metres east of the world-renowned dunn's river falls, little dunn's river has long been a favourite chill spot for many jamaicans. River falls singles - modern dating site the dating site is the easiest way to start chat to youthful and good looking people sign up for free and you will see it. Dating girls in thief river falls on ypcom see reviews, photos, directions, phone numbers and more for the best dating service in thief river falls, mn start your search by typing in the business name below.
Singles in river falls, wi are connecting on eharmony dating in river falls is not exactly a walk in the park it can be challenging for river falls singles looking for a more meaningful relationships that last. Bookofmatchescom™ offers thief river falls free dating and personals for local single men and/or women the sign up process takes only seconds start meeting singles in thief river falls, minnesota right now by signing up free or browsing through personal ads and hookup with someone that matches your interests. Discover the best dating spots in your city, whether it be through speed dating events, singles bars or clubs, or community activities we’ve also ranked the best dating sites, apps, chat rooms, and personals sites for each city to get you started both online and offline. Singles in thief river falls, mn are connecting on eharmony dating in thief river falls is not exactly a walk in the park it can be challenging for thief river falls singles looking for a more meaningful relationships that last.
Thief river falls dating site, thief river falls personals, thief river falls singles luvfreecom is a 100% free online dating and personal ads site there are a lot of thief river falls singles searching romance, friendship, fun and more dates. Hiking outdoors singles, singles, singles nature dating and relationships single professionals new in town singles singles-single parents adventure beer lovers social networking women's social social widows-widowers-divorced -singles/single divorced. |
Date: Sun, 27 Dec 2009 22:23:01 EST
From: Bwstories8@aol.com
Subject: Castaway Hotel: Grand Reopening - Book 4, chapters 1 - 2
Castaway Hotel -- Grand Reopening -- Book 4 by BW
Copyright 2009 by billwstories
Chapter 1 -- New horizons.
**Author's Note:** Please read the disclaimer in Chapter 00 before you read
this.
It was going to be a very interesting year, but the changes to our family
were just beginning. The first important change occurred after Steve Shay
and Sally Swarthout were able to pull a few strings for me and get Frankie
placed with us again. However, neither was initially enthusiastic about
the idea and discussed the situation with me thoroughly before agreeing to
help. Each of them had their doubts as to whether this was a wise move on
my part, considering the problems I'd had with Frankie the first time he
moved in with us, but I assured them Frankie was truly a changed person
since then. That's why I wanted to give him another chance.
They immediately wanted to know why I felt that way, so I had to explain
about Frankie's visit. I emphasized it wasn't just what he said that made
me believe in his dramatic transformation, but also the way he'd acted and
all he'd been through while in detention. I told them how he'd had trouble
looking Trey and I in the face as he apologized, showing how guilty he felt
about his actions, and then paraphrased Frankie's admission about how he
had endured a similar fate at the hands of others while he was
incarcerated. I reiterated that I was truly convinced he had learned his
lesson and done a complete one hundred-eighty degree turnabout, and
therefore deserved a second chance. Since they saw I was convinced of his
rehabilitation, they agreed to do everything they could to make it happen
for me.
I knew it wasn't going to be an easy task to pull this off, but Steve and
Sally gave it their best effort. After calling in a few favors from some
of their colleagues, they got Frankie reassigned and he officially returned
to the family on Labor Day weekend. I had the boys make a banner welcoming
him back, which we strung across the front porch, and I believe it was the
first thing Frankie spotted when Steve dropped him off. I suspect he was a
little embarrassed by the recognition, but also pleased that we went to the
trouble, and all the boys raced out to greet him with open arms. In fact,
Trey was the first one to go up to him and welcome him back and I think
that put Frankie at ease and allowed him to believe his past was truly
behing him now.
However, Frankie's return to the fold was not the only change that
occurred. It seemed there was also a budding relationship in progress,
this time between Nick and Kevin. Although Nick had sort of been pursuing
Kevin, Kevin seemed only mildly interested in Nick's attention. That
changed, however, shortly after the remainder of Nick's belongings arrived
here. I'm sure you're wondering what that might have to do with anything,
so let me explain.
Although Nick's parents had sent most of his clothing and personal effects
to him after they returned home from their visit here, it took them a while
longer to get the rest of the items he wanted sent here. These things
finally arrived the very same weekend Frankie was moving in. Happily, Nick
grabbed some of these items and headed up to his room. As he entered,
Kevin quickly noticed one of the things he was carrying.
"Is that a guitar case," Kevin gasped, looking at the shape of the
container Nick was setting down on the floor of their room.
"Yeah, I had my folks send it here," Nick replied. "I really am looking
forward to having it with me again. There's been a bunch of times I wished
I'd had it."
"You mean you play?" Kevin asked, somewhat rhetorically.
"No, I just keep my assault rifle in there," Nick teased, while making a
face at Kevin. "Of course I play, or I wouldn't have one, would I?"
"Wow, I asked Dad to buy me a guitar for my last birthday and I've learned
to play a few chords on it, but I'm still not very good," Kevin explained.
"Do you think you could teach me more?"
"Sure," Nick beamed. "That was one good thing my parents did for me when I
was younger. They paid for me to take lessons, starting when I was ten,
and I continued taking them until just before I left home. I'm not great,
but I'm not bad at it either, although I haven't been able to play much
since I ran away. That's why I was hoping to be able to practice while I
was here."
"Awesome," Kevin agreed. "If you can teach me to play better, maybe we can
find a drummer and a bass and form our own group!"
"That's a wicked idea," Nick agreed. "I was thinking about doing that back
home, before my Dad announced he was going to send me away to military
school. I'd love to be in a band. Come on, let's get your guitar and
we'll start practicing."
The two boys spent most of the Labor Day weekend playing their guitars,
with Nick teaching Kevin some new licks in the process. Both boys were
very excited by this opportunity and now had something else to draw them
even closer together. This new relationship also seemed to be helping
Kevin to forget about his disappointment concerning Dustin.
The school year had also begun very well for all of us. For the most part,
the boys were happy with their classes and teachers, and those playing on
the soccer teams were off to a good start. On the other end of the
spectrum, I was pleased with how my school had been operating and the first
few weeks had gone off without a hitch. The faculty and staff were doing a
tremendous job and there were only a few isolated problems with any of the
students. All and all, things were progressing quite smoothly, but it
didn't stop there.
The boys dating the cheerleaders were beginning to get very involved with
those girls, except for Danny and Brandon. However, they were still
maintaining enough of a smokescreen to deflect the types of criticism and
suspicions that had been brought to their attention earlier. However, that
wasn't always the case. At first, the girls that Danny and Brandon asked
out were more than a little leery of their intentions, so they set out to
see how serious both boys were. Almost immediately, they forced the boys
into participating in some pretty steamy make-out sessions and Danny and
Brandon each managed to pass the kissing test without a problem. In fact,
they even participated in a little fondling and light petting, so the girls
were beginning to believe they might have been wrong about them. Neither
boy had been pushed toward performing any sexual activities yet, so they
were grateful about that and content with how things were working out.
They admitted they even feel accepted by the others, although they aren't
thrilled about having to deceive the girls this way.
Not only are all of the boys doing well, but I also can't begin to express
how proud I am of Frankie. Right from the very first day he moved back in
with us, Frankie has kept his promise about staying out of trouble and
doing well in his classes. In just the first week he was with us, I heard
from two of his teachers -- but everything they had to say was good. Even
though they knew of his previous reputation, both as a problem student and
one who was unwilling to put forth any effort, they both told me they were
totally aghast over his remarkable start. He was completing his
assignments and doing them well, but not only that -- he was also
participating in class and setting a positive example for others, something
he had not been noted for previously. That news immediately brightened my
day, so I went home and told Frankie how proud I was of him. I think
Frankie was pleased that I had been told of this so soon and seemed to glow
from my praise.
"I told you I was going to do better," he responded, after I complimented
him, "and I'm not going to let you down this time."
"I know you won't," I agreed, "but I wanted you to realize your teachers
and I are all well aware of your extra-effort and increased level of
maturity. I am extremely proud of you and pleased that you are taking full
advantage of this new opportunity," I added, before I gave him a hug. I
was wondering how he was going to react to that, but I guess I shouldn't
have been, since he eagerly hugged me back.
"Thanks, that felt nice," he told me, after I released him. "I spent most
of my life with people pushing me away or with me doing it to them first,
before they could do it to me. But that really made me feel good. I
actually feel like I belong here now."
"You do, Frankie," I agreed. "From the moment you came back to live with
us, you've been considered a valued member of the Currie clan. I'll even
adopt you, like I did with the others, if that's what you want. It's your
decision and I'm not going to pressure you one way or the other, but I want
you to know that option is there, if you want to take advantage of it."
"You're still willing to do that?" Frankie challenged, not willing to
believe his ears. "You'd do that after all I put you through and all the
rotten things I did?"
"Hey, that was the old Frankie," I joked. "I'm asking the new Frankie to
join us."
"I'd like that, if it means I get to call you Dad from now on," he replied,
almost sounding as if his throat was beginning to tighten as he said it.
"Hey, you can call me Dad right now, if you want," I assured him. "You
don't have to wait until you're adopted."
"I'd like that... Dad," he said, trying it out before wrapping his arms
around me in a tremendous embrace. "I never thought I'd ever be able to
call anyone that," he confessed, "at least not someone I thought deserved
that name, but it sure feels good. Thanks, Dad."
"You're welcome, son," I replied, while squeezing him tightly in my arms.
This was truly a much different young man than on our first go around.
Besides Frankie's remarkable transformation, there were others, whom I also
monitored, to make sure they were still doing well. Among that group was
Carlos. He managed to keep in touch and remained close with my family. In
fact, he made certain to let us know he was doing fine and looking forward
to the next time he could be with us again. Due to the fact that it took a
few hours to make the round-trip drive to pick him up and then return trip
home, we decided it would be easier on all of us if we just did it during
the holidays and summer vacation. Therefore, we invited Carlos and his
mother to come for Thanksgiving, Christmas and New Years, as well as
joining us on our next vacation.
We also heard from the family in Arizona, the one Nick had brought to our
attention and we had helped out, while we were there. The parents told us
they had been doing well at their jobs, passed their probationary periods
and received excellent job reviews. There was even a possibility that they
may both be promoted soon, since the mother had been interviewed for the
supervisory position in the elementary cafeteria, while her husband was
taking a few crash courses to improve certain skills, so he could move up
from the custodial job and become the school's electrician. The kids were
also doing very well in their classes, loved their apartment and seemed
very happy with the way things were working out. All the family had needed
was a little break, which we provided for them, so they could turn their
lives around. My boys all felt great about having played a part in their
success, especially Nick, so now he was actively looking for someone new to
help.
The first weekend after Labor Day we threw a birthday party for Frankie,
even though his birthday had been on July 30th. Seeing he joined us late,
I didn't want him to miss out on celebrating such an important event in his
life. Even though he had turned seventeen, I think this was the first real
party or recognition he'd received in quite some time, possibly ever, and
he seemed thrilled that we were willing to do this for him. I told him in
advance what I had planned and suggested he could invite some others, if he
wished. After thinking about this for a few minutes, he admitted that he
didn't really know anyone else yet, except for the guys he got in trouble
with before, but he quickly assured me he was steering clear of them now.
He finally concluded that having his 'family' there for him would be
enough, but added that maybe next year he would have more people to invite.
After telling me that, he flashed me a huge grin, which was his signal that
he planned on sticking around this time.
It was an enjoyable party, although nothing elaborate, which was what
Frankie wanted. He told me he felt it would be best to keep it simple, but
that didn't mean it wasn't nice. We had a cookout and invited much of our
extended family to join us, but the boys wanted to do more -- something
special. They wanted to make sure Frankie not only enjoyed his party, but
found it worth remembering in years to come. With this in mind, they set
out to select some special gifts for him, things they felt he would really
appreciate.
First, they bought him his own boom box, similar to the one he had tried to
heist the first time he had been with us. They didn't do it to remind him
about what he'd done, but to give him something they thought he'd value.
Of course the double meaning didn't go unnoticed.
"You guys didn't have to do this," Frankie told them. "I wasn't going to
try to steal any of yours this time," he joked, before letting out a
nervous laugh.
"That's not what we thought," Kevin told him, since it was his and Dustin's
boom box that had disappeared the last time. "We just figured you'd get a
lot of use out of it and really enjoy it."
"Don't worry, I will," Frankie replied, "as soon as I get something to play
on it." That problem was quickly solved, though, since the boys had also
bought him some CDs to go with it, besides giving him a couple of gift
certificates, so he could purchase more on his own. Frankie seemed very
pleased by their thoughtfulness.
Aunt Sally, Aunt Mary and Uncle Steve gave him some new clothes and a nice
diamond stud earring, to replace the older earring he always wore, since
they noticed it was kind of cheap and not in very good condition. I also
gave him some clothes, as well as a gold- chain, since he admired some of
the chains the other guys wore. Not only that, but I also made him a
promise. Since he was now 17, I told him I'd include him with Kevin in the
next driving class, which would probably begin in the spring, so he could
start working toward getting his license. He was quite excited by that
announcement, and a bit surprised by the prospect, but he eagerly accepted
my offer.
The following weekend we celebrated Andrew's tenth birthday and he
enthusiastically included several young boys he was close to from school.
They had a sleepover party, which had almost become the standard for the
younger boys' birthdays, but Andrew made sure that most of his plans would
include the whole family.
I thought the party would be good for him too and give him something else
to make him forget his ordeal in Houston. I had been watching him closely
since it had happened and had seen no signs of any lingering negative
effects. Andrew appears to be a very resilient young man and had managed
to shake off the effects of that unwelcome encounter, which I think was
mainly due to the fact that we'd arrived before any penetration had
occurred. If we had gotten there after the fact, things might be much
different for him now.
The party went well and Andrew got many nice presents too, including some
nice clothes and an assortment of computer games he had mentioned wanting.
Not only that, but I also bought him a bunch of art supplies, since he had
shown an interest in that subject at school. His art teacher had informed
me that she thought Andrew had a great deal of talent and it might develop
fully with the right encouragement. That's why I bought him a paint kit, a
vast assortment of colored pencils, sketchpads, an easel and some large
heavy-duty sheets for him to paint on. I was mildly surprised that out of
all of his gifts, he seemed to appreciate that present the most.
For the weeks following the two parties, we didn't have much planned on the
weekends, other than the boys' sporting events, the boys' dates with their
girlfriends or spur of the moment family outings to the movies or a
restaurant. It was a relaxing time, which would come to an abrupt end when
the next big event on our calendar took place. However, that wouldn't
happen until late October, when Cole turned 15. It would also be the next
to last birthday we would celebrate for the year, with Dion's being the
only one still remaining before we started the cycle over again, and his
birthday wasn't until late November.
My three new drivers also kept me busy during those weeks, since they were
constantly begging me to take them out for a little more practice, which I
made sure we did at least twice a week. We had even progressed from
driving in the school parking lots to driving on some of the less busy
streets. Dustin and Danny were doing extremely well, while Brandon still
had an occasional problem along the way. Sometimes he would try to take a
corner too sharply and drive over the curb in the process or he would
forget about being gentle with the gas or brake pedal and send the rest of
us jerking forward or backward, whenever that happened. Other times he
might have trouble judging the width or length of the Grand Am and park a
little too close to the vehicle next to us, which made it difficult for
those on that side to get out of the car, or sporadically even gently nudge
the vehicle he was pulling in behind, although it was never hard enough to
do any damage to either vehicle.
Although he was still having these problems, he was also determined to get
better and worked hard trying to perfect these skills, while Danny did his
best to encourage him. Taking the driver's education course in school also
seemed to help him improve, as it gave him another perspective and
reinforced the things I was trying to get them all to learn also.
The boys even surprised me and changed the oil and filters on each of the
vehicles. They did this totally on their own, without any prodding from
me, and explained they did it because they felt it best to know as much
about how to take care of the car on their own, so they didn't have to
depend on me. They even washed and waxed the Grand Am every other weekend,
while taking turns doing the same to either the van or Suburban on the off
week. I guess that provided enough of a hint to let me know which vehicle
they preferred out of the three.
The sports teams had also kept many of the boys busy, as well as those of
us who went to watch their games, while much of the rest of their time was
occupied doing homework or helping me make changes around the house. Since
we had returned from vacation, we had moved the three computers to the
family room and set them up off to one side, so we could turn the upstairs
office into a spare bedroom. We even built a closet for the bedroom, by
extending one portion of the outer wall and utilizing the large open space
in the hallway. We also added another bathroom upstairs, although it was
just a shower stall, toilet and sink, to help alleviate some of the
congestion in the morning. Now, there were three bathrooms upstairs, the
public one downstairs and the one in my new master bedroom. We also added
another hot-water heater and better circulating pumps, so the water
pressure wouldn't drop dramatically when toilets were flushed, etc., and
help eliminate the chance of someone getting scalded.
During this time, some of the boys were also developing new interests. A
handful of them were more than eager to improve their cooking skills, since
they didn't want to give me any reason not to leave them on their own
whenever I had to go away. They really liked the idea of being in charge
while I was traveling, so they took turns preparing the meals every night,
even when I was there, which removed that responsibility from my shoulders.
They had even set up a rotating schedule for the various duties, which
included the cooking, cleaning and driving (which for the time being they
could only do when I was with them, but that would change once they had
their licenses). I eagerly allowed them to do this, and even encouraged
their taking increased responsibility for things, as some of them would
soon be heading off to college or possibly just living on their own, so it
would be good practice for them.
It's not that everything was perfect, as squabbles still popped up from
time to time. Sometimes it was over who was going to get to drive or the
'need' for someone to switch his chores, whenever he had a date or other
activity that conflicted with his assignment. Most of the time, however,
the boys would work this out amongst themselves, so I didn't have to
intervene, because they understood none of them would be happy if I had to
get involved.
There was even one major conflict between two of the new roommates, which
culminated with Dustin and Pat coming to blows. It seemed they had both
become interested in the same young lady and each of them thought the other
was being unfair in resolving this situation. Even though there was nearly
a two-year difference in their ages, the girl's age fell in between theirs.
She was approximately a year older than Pat and a year younger than Dustin.
After a few weeks of trying to gain the upper hand, they each began
accusing the other of interfering with their ability to change chores when
there was a scheduling conflict for them. They both felt the other one was
utilizing his influence with the other boys and talking them out of being
accommodating, whenever it was requested. They even began to complain
about who got to eat lunch with her or who she would spend time with after
school. Dustin felt he should have all of the lunch periods to spend with
her, since he played sports and was tied up after school, which meant Pat
got to spend all of that time with her. Even though this was true, Pat
felt they should still alternate the lunch times, because it wasn't his
fault that Dustin had chosen to play a sport and he hadn't.
After their little donnybrook, I had to lay down my own set of ground
rules. First, I told Pat that if he wanted to alternate the lunch periods,
then he would also have to alternate the after school time too, which meant
he could only spend every other afternoon with her, even if Dustin had
practice or a game. He didn't like that idea at all and quickly agreed to
give Dustin the lunch periods, so he could keep the after school time to
himself. However, whenever Dustin was in between sport seasons, they would
once again start alternating both the lunch period and the after school
time, so that neither would be able to see her twice in the same day.
Second, I notified all of the boys that if there were any more problems
with switching chores, then I would make a rule that there would be
absolutely no switching allowed. This would include everyone, so from that
point on every boy would have to stick to the schedule -- unless I made the
change personally, which I would not be inclined to do.
Third, if there were any more punches thrown, neither one would be allowed
to date anyone for a month, and finally, I moved Dustin to the twin bed in
the new bedroom, which had been the old computer room, to give them both a
chance to cool off. I moved Dustin instead of Pat, because that room had
been Pat's before all the switching took place, so I thought it was only
right he should get to stay there.
Things did calm down after that, especially after Pat lost interest in the
girl and found someone closer to his own age. The funny thing was that
Dustin dumped the girl too, a couple of weeks later, as he fell for a girl
who was a few months older than the first girl. And to think they were
ready to bash each other's brains out over her just a short time before.
Eventually Pat and Dustin did make up, but they each stayed in the room
they were currently in, as neither of them was convinced future conflicts
could be avoided. I think Kevin got a kick out of watching this and found
it amusing they were fighting over a girl, but I think he was most pleased
that Dustin's life wasn't working out as Dustin had hoped, especially after
he broke Kevin's heart. It's not that Kevin hated Dustin now, because he
still had strong feelings for him, but it made him feel better to know that
things were not all that easy for his former lover either.
Besides the conflict it brought into our home, the boys' interest in the
young ladies also had a negative effect on their soccer team. Although
they still had a winning record, they didn't do as well as either their
coach or I had anticipated. I think the distraction of dating and the
conflict between Dustin and Pat took its toll on the team as well.
I believe this was most noticeable at their homecoming game, which they
nearly lost to the team with the worst record in their league. Not only
were their girlfriends at this game, but it appeared most of my studs were
thinking ahead to the homecoming festivities after the game and not
focusing on their playing. This was painfully obvious, as we observed
their lackluster play and noted the silly and uncharacteristic mistakes
they made during the contest. Fortunately, they did manage to pull their
heads out of the clouds long enough to score a one goal victory and end
their season at 12 --3.
Of course, in late October we had a party for Cole as well, but he felt he
was now getting too old to have a sleepover, so I didn't push it and
honored his wishes. He did invite some of his friends from school to
attend, as well as most of our extended family. Even though he had been
socially immature for his age when he first arrived, and even for a while
afterward, he did eventually make some friends outside of the family and
Cole and those boys had remained fairly tight. They'd all been to our
house at various times and Cole has also been to their homes, but they
mostly hung out at school or at school functions.
I was a little surprised that Cole invited them to come to the house for
the day without telling them it was his birthday, but I suspect I knew why.
A couple of his friends' families aren't too well off and I suspect Cole
didn't want them to feel obligated to buy something for him, just because
it happened to be his birthday. By inviting them to come over without out
announcing this additional fact relieved them of that burden. I think the
boys were a bit shocked when they discovered this was a birthday
celebration, but after Cole explained he planned the day just for fun and
didn't expect such a big fuss over it, it seemed to make everyone feel
better. I think his friends understood his intentions and admired the way
he handled it, since they all enjoyed themselves without being embarrassed
that they hadn't brought him a gift. Although he still has difficulty in
some of his classes, he is remarkably bright about some things.
Cole, his friends and his brothers kept active for most of the day, playing
games and generally having a good time. They all joined us to eat, and
then again later when we had the cake and ice cream and I had Cole open his
presents. After his friends saw how much he got from the rest of us, I
think they began to understand why Cole didn't feel he needed anything from
them.
Halloween also proved to be an interesting time, but not because of the
Trick-or-Treating. Instead, it was because of the big high school
Halloween dance. All the guys with girlfriends planned on attending, and
even Danny and Brandon had dates for this big event. The boys also went
out of their way to help Frankie find a date for the dance too. They spent
hours on end preening for the big event and getting their costumes ready,
as they each wanted to impress their dates. As I watched them going
through their preparations, I was reminded of a muster of peacocks trying
to impress the peahens, but these boys had to provide their own plumage.
Since most of the other boys wouldn't be around that evening, Kevin, Trey
and Dion volunteered to help me take the little ones out collecting candy
door-to-door. I think this was done primarily to give them something to do
and keep them from feeling completely left out, so I graciously accepted
their assistance. Unfortunately, the offer didn't come without some
drawbacks.
You see, Trey was not happy about how everything was working out and
complained it wasn't fair that Dion and he couldn't go to the dance as a
couple. He even hinted that it might be considered a form of
discrimination. When I explained to him that they could go to the dance
together if they wanted to, I also reminded him they might also set
themselves up for some possible abuse in the process, so he decided to let
the matter drop. In the long run, Trey decided he was more of a lover than
a fighter, and felt helping with the younger ones would keep him from
thinking about missing the dance. Besides, it would also allow Dion and
him to do something together. I agreed and was happy to have the company
and the help.
Castaway Hotel -- Grand Reopening -- Book 4 by BW
Copyright 2009 by billwstories
Chapter 2 -- A Time to Give Thanks.
It was now November, which was marked by two important events:
Thanksgiving, when we would be having several visitors joining us for our
special dinner, and Dion's thirteenth birthday. Seeing the two events were
so close together, it was decided that we would celebrate Dion's birthday
the Saturday after Thanksgiving and he could invite some of his friends
from school to sleep over too.
The house was abuzz during the week before the holiday, as we spent a great
deal of time cleaning and preparing for our guests. All of the boys were
going to sleep on the carpet in the living room during that time, giving
their beds up to our visitors. In addition to their oldest brothers and
sisters, there would be Nick's parents, Brandon's parents, Jay and his
parents, Mr. and Mrs. Spence (the grandparents the boys had sort of picked
up during our vacation), Carlos and his mother (although I was sure Carlos
would sleep with the boys), and Nicky and Jordan. Aunt Sally, Aunt Mary
and Uncle Steve would be joining us for dinner, but they would not be
spending the night. It was going to be quite a massive get-together.
In order to avoid wearing ourselves out fixing the meal and becoming so
tired that we wouldn't enjoy the feast, we prepared some of the items the
day before. It was mostly the cold dishes, which included various salads
and some desserts, but it would take away much of the work the day of the
big event. During that time, we would be busy preparing two huge turkeys
and a full ham for the main course, in addition some other side dishes.
The women, which included my daughters and daughter-in-law and the other
females in attendance, all tried to volunteer to help prepare the meal for
us, but we shooed them away, letting them know (politely) that we could
fend for ourselves.
The boys were very pleased and quite proud when they served the meal.
Everyone was seated at one of two large tables, which were not segregated
by age. To determine the seating, we had everyone pull a number out of a
hat and then they took the seat with the corresponding number. That way,
we got to sit beside someone we might not have otherwise dined next to.
Everyone seemed happy with this procedure and I thought we would all enjoy
our time being near different individuals and might even form some stronger
bonds with them.
For this large gathering, we were utilizing both our normal dining room
table, with both leaves inserted into it, and a very large banquet table.
I had borrowed the banquet table from school and set up in the room
adjoining the dining room, so we would all be able to see and hear each
other during the meal. Each of the various items was then dished into four
identical containers and placed at either end of each table, as well as
utilizing four platters containing the two turkeys and two more filled with
ham. I recruited Steve Shay, Mike Lawrence, Patrick O'Hara, Howard Curtis
and John Spence to carve the meat and each was more than eager to help out
and assume that responsibility.
Before we began to eat, however, I suggested we take a few seconds to
recount all of the things we had to be thankful for. I started and
mentioned I was thankful for each of my children, grandchildren and my many
good friends, and then I turned it over to anyone else to do the same.
Mr. Spence quickly indicated he wanted to say something, so I sat down and
he stood up to speak.
"My wife and I have been very fortunate over the years, except when it came
to having a family. Being included here today and being accepted as a part
of this fantastic group has made us the happiest and most thankful we have
been in many years. My wife and I have spent a great deal of time
preparing to come here, and we also have a little surprise for you,
something to leave you so you'll always remember our love for you. Seeing
we have no family of our own, we were thrilled you, shall we say, adopted
us," he paused here, as many of the boys were giggling, because of the
similarity with their own situation. "Therefore, we have decided to donate
half of our estate to you now, and the other half will be left to you in
our will when we are gone. We love you all and this is just one way we
want to use to show you how much."
As Mr. Spence sat back down, you could have heard a pin drop in those two
rooms. We were totally shocked and left speechless by his announcement.
Although we didn't know exactly how much they were worth, they had hinted
previously that they had more money than most people could ever think of
using in a lifetime. We even suspected they might even be
multi-millionaires. After many awkward and silent moments, I thanked them
and explained that I didn't know what to say about this display of
generosity. After I thought about it for a minute or two longer, I
informed them that, if they didn't mind, I wanted to use some or most of
that money to establish a charitable fund to help other children and
families, especially families that wanted to adopt needy or hard-to-place
children.
After much discussion, the Spences agreed to my suggestion and it was
decided it would be called the "Castaway Foundation", which had been Aunt
Mary's suggestion. I immediately asked Sally to chair our new foundation
and requested that she also establish the criteria for what types of
assistance would be provided and at what levels. After giving it some
consideration and trying to determine how much time this would require, she
finally agreed and the boys all went over to give her a hug of thanks.
At that point, Steve volunteered his services as legal advisor to the
group, and the boys suggested that I should contact Matt (our former waiter
and future financial advisor) to assist us with investing the money wisely,
in the meantime. I offered to hire Sally and pay her more than she was
making now, if she was willing to run this for us, but she said she'd do it
for free and still work her regular job. She explained that way she would
keep her contacts and be able to find families on her own and while working
for the county. If she only ran the charity, she would soon become
isolated from many of the people in need. I told her she would be paid for
her services even if she kept her other job, and she finally gave in,
saying that would be fine, as long as she could donate it back to the
Castaway Fund and take the tax write-off. We all laughed at her
suggestion.
After we all thanked the Spences again, we began to eat. Unfortunately the
food was now a little cold, because that little surprise and ensuing
discussion took longer than I figured we'd be giving thanks. Some of us
decided to take our plates out and nuke the food in the microwave for a
minute or two, to get it warm again, but the boys didn't let it bother them
and just wolfed it down. Regardless of that minor inconvenience, everyone
appeared to enjoy the meal and complimented the boys on their hard work and
delicious dishes.
Once the meal had concluded, the women wouldn't take no for an answer and
shared the clean-up duties. They quickly put away the leftovers and did
the dishes, so it wasn't long before everything was taken care of. We
decided to hold off for an hour or so before we tried to tackle the
desserts, as everyone was quite stuffed from the main event.
While we waited in the living room, we talked about a variety of other
subjects, before the boys started coming in and asking the various adults
to join them for some fun. Soon they were leading the grown-ups off in
different directions, to join them for a board game, a computer game
(mostly solitaire or black-jack), or a game of cards (hearts, rummy or
double-solitaire). It was quite an enjoyable time, especially for the
Spences, and everyone had fun interacting with each other. After that we
had our desserts, before we collaborated on renting a couple of movies to
enjoy on the large-screen TV together. By the time things started to break
up, everyone was tired, yet fulfilled.
Friday started off with the boys fixing breakfast for everyone. They
conducted it more like a diner, taking orders from each individual as they
came down to eat, rather than fixing one large family breakfast. The boys
started off by making a large batch of pancake mix, figuring that a lot of
us would want pancakes because they always seem to hit the spot during the
cooler weather, but they also made eggs to order, regular and Canadian
bacon, toast, cereal, bagels, English muffins, and bagel or muffin
sandwiches, all upon request. Everyone got what they wanted, ate their
fill and my older children and houseguests were all pleasantly surprised,
not only by the boys' initiative, but also with the quality of the items
they had prepared. All in all, it went over well.
Later that afternoon, Steve called me to discuss some things we would need
to decide before establishing the Foundation. I felt some of the items he
brought up should be discussed in depth, so I talked the Spences into
staying for the entire following week, so they could be a part of setting
everything up, especially since it was their money that was funding it.
They were excited about being included in this process and I told them they
could stay in my room, (which they were already using) and I'd remain in
one of the other rooms. After some give and take on that point, they
finally agreed.
Friday evening the adults spent time together, while the boys entertained
themselves. Nick's parents had spent a great deal of time talking to
everyone and were almost speechless by the time they got to me.
"This is quite a family you have here, Josh," Mrs. Lawrence told me. "And
the Spences' announcement really was a blessing, wasn't it?"
"A blessing and a surprise," I responded. "Even though we don't really
need all of that money, I'm glad we'll be able to put it to good use and
help others. Isn't it strange how a chance meeting with them, on our way
to Arizona, has led to all of this?"
"No stranger than another chance meeting benefited our family,"
Mr. Lawrence mused. "I think your finding Nick was the best thing that
happened for our family too and I can't believe how much he's matured since
that time."
"He has come a long way," I agreed, "but I think it's ironic that he's been
looking for another family to help, like the one in Arizona, and now we
have all this money to do it with. He felt so good about helping the other
family that he wanted to do it again. He is a very caring and giving young
man."
"I'm not sure we would have ever seen that side of him," his mother
commented, "if it weren't for you and your boys."
"I'm sure it would have emerged eventually, but that side of him was
nothing we can be credited for. It's just that once he'd seen how much
good he could do, it was like a catalyst to make him want to do more. I'm
sure we'll find a way for him to be a part of the foundation, so he can
enjoy the good feelings that come as a result of helping others. I believe
he'll enjoy it more than any of the others."
"Josh, my hat's off to you," Nick's father said, "and I'm glad you talked
us into allowing him to come here to continue his education. I don't think
I've ever seen him get better grades, at least not since first or second
grade."
"Well, he did that on his own too," I confessed. "He came here a very
determined young man, intent on proving to you exactly what he could
accomplish."
"I'm not sure if that's good or bad," Mike Lawrence wondered aloud. "I
guess it's good that he's determined, but it saddens me to think that my
attitude toward him made him feel that he needed to prove himself to me. I
have always loved him, but I guess I just wasn't very good at showing it."
"He knows that now, but don't put all the blame on yourself," I suggested.
"From what he has told me, he was a bit hardheaded too, not wanting to see
your side either. Like I've said, I think it would have resolved itself in
time."
"Luckily," his mother added, "your intervention speeded up the process. We
owe you a great deal, so we're also going to contribute to your charity.
We're even going to encourage our friends and Mike's business associates to
do the same. It's the least we can do to repay you."
"That's very generous, but unnecessary," I offered. "I didn't do it to be
repaid."
"Think of it as though we're repaying other parents and children in need,"
she said, "hoping they'll be as lucky as we are."
"In that case, I gratefully accept your offer." After some more talking
and interaction with the kids, we all called it a night and went to our
rooms. I think it was the quietest I'd heard the house in ages.
Dion's birthday on Saturday turned out to be the largest of these types of
get-togethers we've held thus far. Not only was everyone from Thanksgiving
still here, but Jay joined us too, along with some of Dion's school
friends, who were also going to spend the night. Dion got a ton of gifts
and had a blast at his party. The boys played around outdoors for a large
part of the day, but did not play any team sports, since Dion wasn't overly
fond of them. Instead, they played tag, had some races and even had an egg
toss contest, which consisted of lobbing a raw egg between the various
partners until only one egg remained unbroken. The idea was to toss the
uncooked egg back and forth, with the distance increasing by one step
following each successful attempt, until all but one set of partners were
eliminated. It didn't matter whether it broke in one of the partners'
hands or on the ground, but once it happened that pair was finished. It
did get a bit messy before we crowned the winning pair, but the kids all
had a good time doing it.
Dion and his friends spent much of the evening in the family room, while
the other boys hung out in the living room. His brothers were all willing
to give Dion his privacy with his friends, although Dion had invited Trey,
Graham and Cole to join them.
On Sunday, my older children and grandchildren left first. Once they were
gone, Nick's parents said their good-byes and then drove back to the
airport in their rental car. Once they had also departed, I announced I
would be making the round-trip to take Carlos and his mom back to their
place. John and Margaret Spence volunteered to stay with the boys,
relishing their new role as grandparents, but they seemed quite bushed by
the time I got back. I guess they'd either forgotten or never knew how
energetic a group of boys could be.
Margaret also had dinner prepared while I was away, although she had agreed
to let a couple of the boys assist her, mostly to show her where I kept
things. It was a great meal and my sons all made sure they told her so.
She beamed like a new bride who had just received praise from her husband
after preparing her first full meal for him. Needless to say, the Spences
went to bed early that evening, while I sent the boys upstairs to shower
and get ready for bed.
Later that evening, Trey got Dion alone, so he could give him his belated
birthday gift. After they showered and went back to their room, he set his
plan into motion. "I'm sure glad we've got our room back," Trey announced.
"Sleeping with the others was okay, but I'm sure glad to be back in my own
bed," Dion agreed.
"And you'll be even happier after I give you your birthday present," Trey
announced, while shooting a wicked little grin toward Dion. It took Dion a
second to catch on to Trey's meaning, but then he started grinning
ear-to-ear.
"Tonight, you get to make love to me as a teenager," Trey told him, with
the cat-that-ate- the-canary smirk on his face. After allowing a second or
two for Dion to savor the thought, Trey walked over and kissed Dion
passionately, while ripping away the towel from around Dion's hips. He
eased Dion back to the bed, gently guided him on to it and then proceeded
to work on his body. Trey kissed Dion's neck, nibbled on his ears, and
worked his way down to Dion's nipples. He bathed those two delightful
circular patches of flesh with his tongue, nipped at the rigid little nubs
and then sucked on them like a starving kitten. Once he felt he had paid
sufficient attention to those sensitive areas, Trey worked his way lower,
running his tongue the length and breadth of Dion's firm abdomen, before
allowing his tongue to delve in and out of his navel. Now that he had Dion
squirming, Trey moved lower, but bypassed Dion penis, before aiming for
Dion's scrotum and inner thighs.
Dion was bouncing around on the mattress like a hyperactive super-ball, as
Trey played with his testes, lathed his sensitive inner thigh and the area
between the scrotum and the anus. Finally, Trey reached over to the
nightstand and grabbed a couple of items. He quickly ripped open a condom
packet and prepared to place it over Dion's bone.
"Do we really need to use that?" Dion wondered.
"Yes, we promised Dad that we would from now on, especially since you're
also fooling around a little with girls too," Trey advised him. "You know
he's right about that."
"But it's just the two of us and I haven't done that much with any of the
girls..." Dion's voice trailed off, showing how disappointed he was.
"But you have done some things and we also still mess around the others
from time to time, including some of the other guys with girlfriends," Trey
countered. "That's why we have to do this."
"What if we never do those things any more?" Dion asked, hopefully.
"We will, and you know it," Trey announced. "But if you are really willing
to give up on the idea of trying it with a girl and would promise to only
be with me, I'd say okay, but I don't think either of us believes that will
really happen. It's mainly because you like to do some of the other things
once in a while too, things I don't especially care for."
Dion knew what Trey meant by this. He had accepted that Trey liked
receiving better than giving and wasn't very fond of rimming Dion either.
That's why Dion gave in and Trey slid the rubber over his lengthy organ,
slicking it up with KY afterward. Once he had been prepared, Trey
straddled Dion's waist, reached back and grabbed Dion's teen shaft and
guided the head against his pucker. Slowly he sat back, feeling the ring
pop open and the helmet slide in, and then he waited momentarily before
adding more pressure and sliding down its entire length. Even though Dion
had just turned thirteen, he's had a bigger penis than most of the boys in
the house, and that had been the case almost since the day he moved in.
Now that he was fully engulfed by Trey's silky interior, Dion was in
absolute bliss. He not only loved the feeling of being in Trey's warm,
tight hole, but Trey had also developed very good muscle control and could
actually massage Dion's shaft even before he began his humping. Dion was
very appreciative of that skill and quite vocal about it. Needing no
further encouragement, Trey slowly lifted up and then slid back down Dion's
ample shaft, as he began to establish a nice, steady rhythm.
Dion was really moaning now. His eyes were only partially open and his
eyeballs rolled back into his head. He was totally oblivious to everything
in the room, but the tremendous pleasure emanating from his groin. Even
though his sausage was encased in the thin prophylactic membrane, it still
felt as if a thousand tiny fingers were stimulating his love muscle. It
was so overpowering that he could hardly bear the pleasure and soon felt
the rising tide of his orgasm.
As the tingling sensation continued to build in his testicles, he felt his
scrotum start to withdraw against his body and could sense the additional
blood flowing to his penis, causing it to swell even more. At that moment,
he felt the pressure building, as his seed began to be forced up his shaft.
He tried to hold it back and prolong the sensation, but that proved
impossible. Giving in to the inevitable, his semen exploded into the
rubber, threatening to blow the tip of the condom off.
Trey kept riding him, milking him for all he was worth, and only stopped
once Dion became so soft that it was impossible to continue. When that
happened he bent forward, kissed Dion lovingly and then leaned over even
further and off to the side, so he could whisper into his ear.
"Happy Birthday, lover," he gushed, but Dion didn't have enough strength
left to respond.
E-mail responses to the stories, story suggestions, or other 'constructive'
comments or advice may be sent to: bwstories8@aol.com - but please put the
story title in the subject line, so it doesn't get deleted as junk mail. |
Q:
Sorting Dictionary of type [String: [String: Any]] by Value
I'm working on an IOS project that gets its data from Google's Firebase Firestore.
I have Documents like this in Firestore:
5lTSobXhcQBR2oG95s5q
Title: "ABC"
Timestamp: 1554374528.641053
FEeIAlAPlcrVvvtSKn8D
Title: "XYZ"
Timestamp: 1554443702.1300058
In my IOS project I have a Dictionary like this:
myDictionary: [String: [String: Any]] = [5lTSobXhcQBR2oG95s5q: ["Title": "ABC", "Timestamp": 1554374528.641053], FEeIAlAPlcrVvvtSKn8D: ["Title": "XYZ", "Timestamp": 1554443702.1300058]]
How can I sort my Dictionary by Timestamp?
A:
Every collection in iOS or swift has a sort function.
For example:
let sortedArray = dictionary.sort() { return $0.timestamp < $1.timestamp }
$0 will reference to 'the first' element and $1 the element after the first one.
In your example, the logic is the same.
I would do it like this:
Extract the timestamp data and store it in an extra dictionary with the id as a key and the value as a timestamp. Then I would use the .sort function to sort these elements in my dictionary.
|
<!DOCTYPE html>
<html>
<head>
<meta charset="UTF-8">
<title>Reports using TreeGrid - jQuery EasyUI Demo</title>
<link rel="stylesheet" type="text/css" href="../../themes/default/easyui.css">
<link rel="stylesheet" type="text/css" href="../../themes/icon.css">
<link rel="stylesheet" type="text/css" href="../demo.css">
<script type="text/javascript" src="../../jquery.min.js"></script>
<script type="text/javascript" src="../../jquery.easyui.min.js"></script>
</head>
<body>
<h2>Reports using TreeGrid</h2>
<div class="demo-info">
<div class="demo-tip icon-tip"></div>
<div>Using TreeGrid to show complex reports.</div>
</div>
<div style="margin:10px 0;"></div>
<table title="Reports using TreeGrid" class="easyui-treegrid" style="width:700px;height:250px"
data-options="
url: 'treegrid_data3.json',
method: 'get',
rownumbers: true,
showFooter: true,
idField: 'id',
treeField: 'region'
">
<thead frozen="true">
<tr>
<th field="region" width="200">Region</th>
</tr>
</thead>
<thead>
<tr>
<th colspan="4">2009</th>
<th colspan="4">2010</th>
</tr>
<tr>
<th field="f1" width="60" align="right">1st qrt.</th>
<th field="f2" width="60" align="right">2st qrt.</th>
<th field="f3" width="60" align="right">3st qrt.</th>
<th field="f4" width="60" align="right">4st qrt.</th>
<th field="f5" width="60" align="right">1st qrt.</th>
<th field="f6" width="60" align="right">2st qrt.</th>
<th field="f7" width="60" align="right">3st qrt.</th>
<th field="f8" width="60" align="right">4st qrt.</th>
</tr>
</thead>
</table>
</body>
</html> |
Whether or not it translates into reality, exploring the most exciting bit of the wish list we draw out every new year. From the diverse repertoire of harvest fairs to the pine-scented breeze of meditative walking trails, India tosses up the unexpected at every bend of a lane – pulsating with an incredible blend of people, culture and landscapes. As the country celebrates India Tourism Day today, here are some of the radical travel trends of 2016 that come in handy while you plan your holidays this year…
Experimental Journeys More Favoured
As the term implies, experimental tours refer to a slow-paced and more immersive approach, in which the traveler seeks to sample real-life, hyper-life experiences, instead of the canned services that include visits to must-see place sand being treated to luxurious amnesties. Instead of high-end hotels, travelers are opting for homestays and soaking in indigenous culture, history and culinary traditions.
Selfies See a Downfall (Finally!!)
The burden of taking selfies in front of every monuments and uploading those photos on social media is off the tourist’s shoulders. A personal photographer will now be in the tow, as frolic around local hotspots. Travel firms are now incorporating a professional snapper in the holiday packages they offer. The photographer documents your trip and delivers you a daily dose of social media-appropriate images. |
New details have emerged about how a man was killed and a woman critically injured in a horror police car crash as investigations continue.
Crime
Man killed and woman critical following police crash
by HELEN KEMPTON
7th Jan 2020 1:29 PM
premium_icon
Subscriber only
HORRIFIED members of the public ran to assist two pedestrians hit by a spinning police car after it crashed with another vehicle at a city intersection in Launceston.
The couple, in their 40s, were visiting Tasmania from the Hunter Valley in NSW and taking a stroll in the city at about 8.30pm on Monday night.
A police car, being driven by a male on-duty officer on his way to a job in the suburb of Youngtown, went through a red light at the intersection of St John and Paterson streets with lights flashing but no sirens activated.
Police examine the silver Lancer at the intersection of Paterson and St John Streets. Picture: WIN News
Northern Crash Investigation Services will be undertaking more investigations at the scene tonight.
The intersection will be closed for about two hours from 6pm.
Traffic diversions for vehicles will be in place at the intersection of St John St and Cameron St, St John St and Brisbane St, and Paterson St and Charles St.
The man is the second tourist to be killed walking on Tasmania's streets in two days.
An elderly woman who was exploring Burnie after disembarking from a cruise ship was killed after being hit by a bus in Wilson St.
Another police car was involved in a collision in Launceston on Christmas Day - injuring the two officers inside.
The man is the second tourist to be killed walking on Tasmania’s streets in two days. Picture: CHRIS KIDD
The marked car was travelling on York St with emergency lights activated when it collided with a tow truck hauling a van on Bathurst St.
The Police Association of Tasmania expressed condolences to the family of the pedestrian killed and said union members had visited the police officer involved, offering support and guidance.
Tasmania Police has also offered its condolences to the family of the visiting couple who have children.
"This is a tragic incident and our thoughts are with the family of the deceased man and the woman currently in hospital," Mr Higgins said.
The police officer and a female passenger of the silver Lancer have been discharged from the Launceston General Hospital with non-life threatening injuries.
Mr Higgins said a Professional Standards investigation into the incident was underway to determine the circumstances surrounding the crash.
"I would like to recognise the admirable efforts of those members of the public who came to the aid of the people involved and provided assistance until emergency services arrived on the scene a short time later," Mr Higgins said.
"This is a traumatic incident for everyone involved, and we will also be providing support to those emergency services workers who have been affected."
Anyone with information should contact Police on 131444 or report anonymously to Crime Stoppers on 1800 333 000 or crimestopperstas.com.au |
Democrats are starting to figure out that Alexandria Ocasio-Cortez is the gift that keeps on giving . . . to Republicans.
A few days ago, Nancy Pelosi disdainfully dismissed Ocasio-Cortez's Green New Deal as "the green dream or whatever they call it, nobody knows what it is, but they’re for it, right?”
On today's Morning Joe, there was consensus condemnation of Ocasio-Cortez's opposition to NYC's deal with Amazon to establish an HQ in NYC, which contributed to Amazon's decision to cancel its plans. Donny Deutsch put it in starkest terms, saying Ocasio-Cortez is "extremely dangerous," and "does not know what she's talking about." Deutsch fretted that, from a Dem perspective, Ocasio-Cortez and her socialist sidekicks will "hand the presidency back to Donald Trump."
DONNY DEUTSCH: Joe, I actually called you yesterday, I was so out of my mind; my head was exploding. When you have Alexandria Ocasio-Cortez, who I find extremely dangerous at this point. I hope she doesn't tweet that, who are you Donny Deutsch, I don't care about you or anything. Because basically she has a twitter following: that's her power base. To basically come out and say, as you pointed out, what a great thing it is that we can take that money and give it to teachers. It doesn't exist. It's an abatement. $27 billion, we put down 3. That's business. That's what happens. You attach this to the Green Deal and you are handing President Trump--President Trump now gets to go, oh, the Democrats don't want jobs, the Democrats don't want companies coming to your neighborhoods, the Democrats have a Green Deal, that wants a 70% tax rate, that wants jobs for everybody even if--just handed to you. Tuition, handed to you. Socialism.
We are in a dangerous place, and if people don't, in the party, don't start to speak up against people like Alexandria Ocasio-Cortez, who is young and dynamic, but does not know what she's talking about. And her, and her cohorts, some of these new, fresh, progressive faces, are going to hand the presidency back to Donald Trump.
The panel focused on Ocasio-Cortez's ignorance of basic economics. In celebrating the cancellation of the Amazon deal she somehow imagined that the incentives offered to Amazon now could be distributed to teachers or other causes. She failed to understand that this was an incentive deal, and that there is no such pile of cash laying around.
Note: Deutsch worried about Ocasio-Cortez's ability to attack him over his comments, saying: "I hope she doesn't tweet that, who are you Donny Deutsch, I don't care about you or anything. Because basically she has a twitter following: that's her power base." It will be amusing to see how she might send her Twitter minions after Donny. |
Our Patient Services
At OhioHealth Primary Care Physicians, your health is our top priority. Our board-certified internal medicine and family medicine physicians can help you when you get sick, with expert care and management for chronic conditions such as high cholesterol, high blood pressure or diabetes. We also work with you to keep you healthy with a focus on preventive care — providing screenings as well as annual exams to help you avoid serious conditions later in life. And, OhioHealth’s on-site lab services make getting all the care you need even easier.
We conveniently treat such medical issues as:
Sore throat
Flu symptoms
Sinus problems
Ear ache
Minor and sports-related injuries
Allergies
Services, diagnostics and testing offered:
EKG’s
Spirometery
Preadmission testing
Physical exams
Prompt Appointments
We offer prompt appointments to people working in downtown Columbus who have their own physicians, but need medical care during the business day. Appointments can usually be made within 24 hours. |
---
abstract: 'We review recent results on the charged pion - charged hadron correlation in $p+p$ and $d$ + Au collisions as measured by the PHENIX Collaboration. Properties of di-jet system, such as the jet shape, associated hadron yield per trigger pion, and the underlying event are extracted statistically from the $\pi^{\pm}-h^{\pm}$ correlation function in $\Delta\phi$ and $\Delta\eta$. For jet triggered with high $p_T$ pions ($p_T>5$ GeV/c), no apparent differences in the jet properties are seen between $p+p$ and $d$ + Au.'
address: ' Columbia University, New York, NY 10027 and Nevis Laboratories, Irvington, NY 10533, USA'
author:
- Jiangyong Jia for the PHENIX Collaboration
title: 'Jet properties from $\pi^{\pm}$ - $h^{\pm}$ correlation in $p+p$ and $d$+Au collisions at $\sqrt{s_{NN}}$ = 200 GeV'
---
Introduction
============
The technique of two particle correlation in relative azimuth ($\Delta\phi$) and pseudorapidity ($\Delta\eta$) is an useful tool to access the (di-)jet properties in heavy-ion collisions. Comparing with the traditional full jet reconstruction method, the two particle correlation method is relatively insensitive to the level of the underly event, thus can probe soft jets ($\lesssim$5 GeV/c); combining with event mixing technique, it can also be used for detectors with limited acceptance.
To leading order in QCD, high $p_T$ jets are produced back-to-back in azimuth. This back-to-back correlation, however, is smeared by the fragmentation process and the initial and final state radiation, which lead to a typical di-hadron correlation function in $\Delta\phi$ as shown schematically in Figure.\[fig:cartoon\]. The associated hadron yield per trigger $\pi^{\pm}$ (conditional yield or CY) can be parameterized by a constant plus a double gauss function, $$\label{eq:cy1}
\frac{1}{N^0_{\rm{trig}}}\frac{dN_0}{d\Delta\phi} =
B+\frac{\rm{N}_{S}}{\sqrt{2\pi}\sigma_{N}}
e^{\frac{-\Delta\phi^2}{2\sigma_{N}^2}} + \frac{\rm{N}_{A}}
{\sqrt{2\pi}\sigma_{F}}
e^{\frac{-(\Delta\phi-\pi)^2}{2\sigma_{F}^2}},$$ In this analysis, everything about the (di-)jet is extracted from this parameterization. The peaks in the same side ($\Delta\phi=0$) and the away side ($\Delta\phi=\pi$) represent the intra-jet and di-jet correlation, respectively. The widths of the peaks are controlled by the jet fragmentation momentum $j_T$ and the parton transverse momentum $k_T$ [@Rak:2004gk; @Jia:2004sw]: $\sigma_{same}\propto j_{Ty}$, $\sqrt{\sigma^2_{away}-
\sigma^2_{same}}\propto k_{Ty}$, where the subscript “$y$” represent the 1D projection in transverse plane; The integrals of the peaks, $N_{S}$ and $N_A$ give the total number of hadrons associated with the trigger hadrons in the same side and the away side; The pedestal level beneath the jet structure, $B$, represents contributions from the underlying event.
The presence of the medium can modify the di-hadron correlation. Recent results from RHIC [@Adler:2002tq; @dan; @wolf] and SPS [@Agakichiev:2003gg] indicate a complicated modification of the jet structure in both the same side and the away side. The same side jet become elongated in $\Delta\eta$ but is relatively unmodified in $\Delta\phi$ direction. Meanwhile, the away side correlation become much broader and suppressed, which indicates strong interaction of the jets with the dense medium. In order to achieve quantitative understandings of the modifications of jets in the medium, one has to obtain an accurate baseline measurements of jet correlation in $p+p$ and $p+A$ collisions. Di-hadron correlation in $p+p$ collisions probes basic QCD effects such as jet fragmentation, initial and final state radiations; while correlation in $p+A$ collisions gives handle on the various initial state effects such as shadowing and jet broadening in cold nuclear medium.
We focus the physics discussions on three aspects of the $\pi^{\pm}-h^{\pm}$ correlations in Figure.\[fig:cartoon\]: jet shape, jet yield and the underlying event. But before doing that, we briefly discuss the identification of high $p_T$ charged pion and the techniques used to extract the jet properties.
Analysis {#sec:ana}
========
$\pi^{\pm}$ identification
--------------------------
PHENIX identifies high momentum charged pions with the RICH and EMCal detectors. Charged particles with velocities above the Cherenkov threshold of $\gamma_{\rm{th}} = 35$ (CO$_{2}$ radiator) emit Cherenkov photons, which are detected by photo-multiplier tubes (PMTs) in the RICH [@Aizawa:2003zq]. This threshold corresponds to 18 MeV/$c$ for electrons, 3.5 GeV/$c$ for muons and 4.9 GeV/$c$ for charged pions. In a previous PHENIX publication [@Adler:2003au], we have shown that charged particles with reconstructed $p_T$ above 4.9 GeV/$c$, which have an associated hit in the RICH, are dominantly charged pions and background electrons from photon conversions. The efficiency for detecting charged pions rises quickly past 4.9 GeV/$c$, reaching an efficiency of $>90\%$ at $p_T>6$ GeV/$c$.
To reject the conversion backgrounds in the pion candidates, the shower information at the EMC is used. Since most of the background electrons are genuine low $p_T$, they can be rejected by requiring a large shower energy in the EMC. In this analysis, a momentum dependent energy cut at EMC is applied: $E>0.3+0.15 p_T$. Additional electron rejection comes from the $\chi^2$ variable, $$\begin{aligned}
\chi^2
=\sum_{i}\frac{(E^{\rm{meas}}_{i}-E^{\rm{pred}}_{i})^2}{\sigma_{i}^2}
\label{eq:chisq}\end{aligned}$$ where $E^{\rm{meas}}_{i}$ is the energy measured at tower $i$, $E^{\rm{pred}}_{i}$ is the predicted energy for an electromagnetic particle of total energy $\sum_{i}E^{\rm{meas}}_{i}$ and $\sigma_{i}$ is the standard deviation for $E^{\rm{pred}}_{i}$. Both $E^{\rm{pred}}_{i}$ and $\sigma_{i}$ are obtained from the electron test beam data. EM shower is more compact than hadronic shower, thus has a smaller $\chi^2$ value. The $\chi^2$ value is then mapped to the probability ($prob$) for a shower being an EM shower. $prob$ ranges from 0 to 1, with a flat distribution expected for EM showers and a distribution peaked around 0 for hadronic showers. Figure. \[fig:prob\]a shows the normalized $prob$ distribution for the pion candidates and electrons. A cut of $prob$ $< 0.2$ selects pions with an efficiency of $\gtrsim
80$%. Since we are interested in per-triggered yield, the detailed knowledge of the pion efficiency is not necessary. The raw pion spectra for requiring only RICH cut and both RICH and EMCal cuts are shown in Figure. \[fig:prob\]b, the difference between the two is mostly due to electron background. The sample of charged pion used in the correlation analysis is from 5 to 16 GeV/c, with an purity better than 95%.
Extracting jet properties
-------------------------
The correlation functions are generally defined as $$\begin{aligned}
C\left(\Delta\phi\right) = \frac{N_{\rm{cor}}\left( \Delta\phi
\right)} {N_{\rm{mix}}\left( \Delta\phi \right)} \textrm{ in
azimuth and } C\left(\Delta\eta\right) = \frac{N_{\rm{cor}}\left(
\Delta\eta \right)} {N_{\rm{mix}}\left( \Delta\eta \right)}\end{aligned}$$ in pseudorapidity. $N_{\rm{cor}}$ and $N_{\rm{mix}}$ represent the same-event pair distribution and mixed-event pair distributions, respectively. The mixing is done by pairing trigger $\pi^{\pm}$ with charged hadrons from events having similar collision vertex and centrality as the $\pi^{\pm}$. Ref.[@Jia:2004sw] has shown that the correlation function and the conditional yield are related to each other by just a constant, $$\begin{aligned}
\label{eq:cy2}
\frac{1}{N^0_{\rm{trig}}}\frac{dN_0}{d\Delta\phi}
=\frac{R_{\Delta\eta}}{N_{\rm{trig}}\epsilon}\frac{N_{\rm{cor}}\left(\Delta\phi\right)}{\frac{2\pi
N_{\rm{mix}}\left(\Delta\phi\right)}{\int d\Delta\phi
N_{\rm{mix}}\left(\Delta\phi\right)}}\end{aligned}$$ where $N^0_{\rm{trig}}$ and $N_{\rm{trig}}$ are the true and detected number of triggers respectively, and $\epsilon$ is the average single particle efficiency for the associated particles in $2\pi$ in azimuth and $\pm0.35$ in pseudo-rapidity. $R_{\Delta
\eta}$ accounts for the loss of jet pairs outside PHENIX pair acceptance of $|\Delta \eta|<0.7$.
The two gauss functions in Eq.\[eq:cy1\] describe the $\Delta\phi$ distribution of the jet signal. The jet signal can also be presented in any other pair variables, such as $\Delta\eta$, trigger $p_T$ ($p_{T,\rm{trig}}$), associated hadron $p_T$ ( $p_{T,\rm{assoc}}$), $p_{\rm{out}} =
p_{T,assoc}\sin\Delta\phi$, $x_E =
\frac{p_{T,assoc}\cos\Delta\phi}{p_{T,trig}}$, di-hadron mass and di-hadron $p_T$. For every pair variable, we use a statistical weighting method to account for the acceptance correction. According to Eq.\[eq:cy2\], each pair on average needs a $\Delta\phi$ dependent correction factor, $w(\Delta\phi)$, $$\begin{aligned}
\label{eqn:weight} w(\Delta\phi) =
\frac{R_{\Delta\eta}}{N_{\rm{trig}}\epsilon}\frac{1}{\frac{2\pi
N_{\rm{mix}}\left(\Delta\phi\right)}{\int d\Delta\phi
N_{\rm{mix}}\left(\Delta\phi\right)}}\end{aligned}$$ When this factor is used as the weight in filling the $x_E$ histograms for both real and mixed pairs, we obtain $$\begin{aligned}
\frac{1}{N^0_{\rm{trig}}}\frac{dN_0}{dx_E} = \sum_{\rm{real}}
\delta(x_E) w(\Delta\phi)\end{aligned}$$ for the same-event pair distribution. Thus according to Eq.\[eq:cy1\], $x_E$ distribution for jet pairs equals to $$\begin{aligned}
\label{eq:statdndxe}
\frac{1}{N^0_{\rm{trig}}}\frac{dN_0^{\rm{jet}}}{dx_E} =
\sum_{\rm{real}} \delta(x_E) w(\Delta\phi) - C \sum_{\rm{mix}}
\delta(x_E) w(\Delta\phi)\quad.\end{aligned}$$ where $$\begin{aligned}
C =\frac{BR_{\Delta\eta}}{N_{\rm{trig}}\epsilon}\frac{2\pi}{\int
d\Delta\phi N_{\rm{mix}}\left(\Delta\phi\right)} \quad.\end{aligned}$$
Replacing $x_E$ with any pair variables, we obtain other jet pair distributions. However, the integral of the jet yield should be conserved independent of the pair variable used, [*i.e.*]{}: $$\begin{aligned}
\int d\Delta\phi\frac{dN_0^{\rm{jet}}}{d\Delta\phi}= \int
dx_E\frac{dN_0^{\rm{jet}}}{dx_E}=\int dp_{T,\rm{assoc}}
\frac{dN_0^{\rm{jet}}}{dp_{T,\rm{assoc}}} = \int
dp_{\rm{out}}\frac{dN_0^{\rm{jet}}}{dp_{\rm{out}}}\end{aligned}$$
Results {#sec:res}
=======
Jet shape
---------
In the following discussion, the trigger $\pi^{\pm}$ $p_T$ is always from 5 to 10 GeV/$c$, unless specified otherwise. Figure.\[fig:dphi\] shows the $\pi^{\pm} -h^{\pm}$ $\Delta\phi$ distribution from $p+p$ and $d$ + Au collisions for several range of $p_{T,assoc}$. The widths decrease with increasing $p_{T,assoc}$, which is consistent with narrowing of the jet cone for larger $p_{T,assoc}$. It is interesting to notice that a large fraction of all hadrons in the event are associated with the trigger, thus are originated from the hard-scattered partons. Even for $p_{T,assoc}$ as low as $0.4-1$ GeV/$c$, about 51% hadron yield in $p+p$ (27% in $d$ + Au) comes from the jet fragmentation.
[c]{}
Using the event mixing technique, we also measure the jet shape in $\eta$. For the single acceptance of $|\eta|<0.35$, the pair acceptance in pseudorapidity is limited to be $|\Delta\eta|<0.7$. Figure.\[fig:eta1\]a shows the same event and mixed event $\Delta\eta$ distribution for $1<p_{T,assoc}<2$ GeV/$c$, where a cut of $|\Delta\phi|<1$ is used to select only same side jet pairs. The mixed-event pair distribution is not a perfect triangle due to a gap around $\eta=0$ in PHENIX central arm detectors. The ratio of the two distributions gives the jet shape in $\Delta\eta$. It is shown in Figure.\[fig:eta1\]b and compared with the jet shape in $\Delta\phi$. There is no significant difference between the two and the extracted widths are consistent in both directions. We extend this comparison to other associated hadron $p_T$ ranges and summarize the results in Figure.\[fig:eta2\]. The overall agreement between the jet widths in $\Delta\eta$ and $\Delta\phi$ is pretty good, except at small $p_{T,\rm{assoc}}$, where the width in $\Delta\eta$ is systematically lower than that in $\Delta\phi$. The fact that this discrepancy exist in both $p+p$ and $d$ + Au collisions indicates that this deviation is likely due to the systematics of the fitting in a limited $\Delta\eta$ range rather than any real physics effect in $d$ + Au.
From the measured jet width, one can calculate the rms value of $zk_{Ty}$ [@Jia:2004sw], $(zk_{Ty})_{RMS} =
\sqrt{\left<z^2k^2_{Ty}\right>}$, for both $p+p$ and $d$ + Au. The resulting $(zk_{Ty})_{RMS}$ is plotted as function of trigger $p_T$ in Figure.\[fig:zkt\]. It looks quite similar between $p+p$ and $d$ + Au. The difference of $(zk_{Ty})_{RMS}$, averaged over $p_T$, is $\langle z^2k_{Ty}^{2} \rangle_{\rm{dAu}} - \langle
z^2k_{Ty}^{2} \rangle_{\rm{pp}} = 0.64\pm 0.78\pm 0.42$ (GeV/$c$)$^{2}$, which is consistent with 0. According to various theoretical estimations [@Wang:1998ww], the typical contribution to $\langle k_{Ty}^{2} \rangle$ from multiple scattering is 1 (GeV/$c$)$^2$ in central $d$ + Au collisions, while the contribution from initial and final radiation is much larger (around 8 (GeV/$c$)$^2$) [@Boer:2003tx]. The small multiple scattering contribution might have been washed out by the much larger contributions from initial and final radiation, which explains the lack of difference between the two systems.
[cc]{}
An alternative but more direct way in studying the away side $k_T$ broadening is through the $p_{out}$ distribution. For small angles, $p_{out}$ has simple relation to $j_T$ and $k_T$[@Jia:2004sw]: $$\langle {p_{out,same}^2 }\rangle \approx \langle {j_{T,y}^2 }
\rangle + x_E^2 \langle {j_{T,y}^2 }\rangle$$$$\langle
{p_{out,away}^2 } \rangle \approx \langle {j_{T,y}^2 } \rangle +
x_E^2 \langle {j_{T,y}^2 } \rangle + 2x_E^2 \langle {z^2k_{T,y}^2
} \rangle$$ Thus the difference of same side and away side $p_{out}$ distributions directly reflects the contribution from $k_T$. $$\begin{aligned}
2x_E^2 \left\langle {z^2k_{T,y}^2 } \right\rangle \approx
\left\langle {p_{out,same}^2 } \right\rangle - \left\langle
{p_{out,away}^2 } \right\rangle\end{aligned}$$ Figure. \[fig:daupppout\]a shows the same side and away side $p_{out}$ distribution. There is a significant difference between the two, which reflects the contribution from $k_T$. Both distributions have a gauss shape at small $p_{out}$ followed by an excess at large $p_{out}$. The gauss part presumably is due to the jet fragmentation (in both the same and away side) and intrinsic $k_T$ (away side only), while the excess is evidence for hard radiation contribution of the outgoing partons. Since the away side $p_{out}$ carries information about $k_T$, we compare between $p+p$ and $d$ + Au to see whether there is hint of additional $k_T$ broadening in $d$ + Au. The comparisons of away side $p_{out}$ distributions are shown in Figure.\[fig:daupppout\]b, no apparent differences are observed, consistent with the observations that $(zk_{T_y})_{\rm{RMS}}$ are similar between $p+p$ and $d$ + Au.
Jet yields
----------
The same side and away side $p_T$ distributions of the charged hadrons associated with jets are plotted in Fig\[fig:daupp1\], comparing between $p+p$ and $d$ + Au collisions. The same side yield is related to the di-hadron fragmentation, since both particles comes from the same jet, while the away side yield depends on two independent fragmentation functions: one parton fragments to produce the trigger, while the second parton produces the associated hadron. No apparent differences are seen between $p+p$ and $d$ + Au; this observation is in contradiction to some recombination model prediction [@Hwa:2004sw], in which a significant difference is expected due to shower-thermal contribution.
Di-hadron correlation also gives the $x_E$ distribution $\frac{1}{{N_{trig}}}\frac{{dN_h}}{{dx_E }}$, where $x_E =
z_{\rm{assoc}}/z_{\rm{trig}}$. When di-jet $p_T$ imbalance is ignored and $z_{\rm{assoc}}\ll z_{\rm{trig}}$, $z_{trig}$ varies very slowly with $z_{\rm{assoc}}$. Hence the $x_E$ distribution is closely related to the fragmentation function $D(z)$, $$\frac{1}{{N_{trig}}}\frac{{dN_h}}{{dx_E }} \approx z_{trig}
D(z)\quad.$$ Figure.\[fig:daupp2\] shows the measured $x_E$ distribution between $p+p$ and $d$ + Au. Again, no difference is seen between the two collision systems in both the same side and away side.
In $e^+e^-$ or $p+p$ collisions, the fragmentation functions $D(z)$ are known to approximately scale, [*i.e.*]{} are independent of jet energy. To check whether this is still true in $d$ + Au collisions, we plot in Figure. \[fig:daupp3\] the conditional yields as function of trigger $p_T$ in different ranges of $x_E$ for both $p+p$ and $d$ + Au. The amount of variation is within $\pm$ 25% for $p_T$ from $5-12$ GeV/$c$ with very little difference between the two systems. So we conclude that the evolution of the jet fragmentation as function of jet energy is very similar between $p+p$ and $d$ + Au.
Comments on underlying event
----------------------------
Events triggered by high $p_T$ hadrons not only contain particles originated from the two hard-scattered partons, but also those come from soft multiple interaction and the beam remnants. Underlying event in $p+p$ and $d$ + Au collisions refers to all hadrons except those from the two outgoing hard-scattered partons, which includes contributions from the beam remnants and initial and final state radiation [@Affolder:2001xt]. The physics of the underlying event is poorly known due to its non-perturbative nature. It is often studied phenomenologically with various QCD Monte-carlo models that have been tuned to fit the data [@Sjostrand:2004pf]. Underlying event has been studied extensively at the Tevatron energy [@Acosta:2004wq; @Affolder:2001xt]. Similar studies at the RHIC are very useful in understanding it’s dependence on $\sqrt{s}$, and can provide valuable constrains on the underlying event physics at the LHC.
Figure.\[fig:dphipp\] shows the jet pair distribution in $p+p$ collisions, reproduced from Figure.\[fig:dphi\]. The pedestal in the $\Delta\phi$ correlation, which represents the underlying event contribution, decreases quickly and becomes negligible at $p_{T,assoc}>2$ GeV/$c$. However, the level corresponding to minimum bias $p+p$ events, denoted by the thick horizontal line, seems to decrease even faster. Since minimum bias event has small hard-scattering contribution, the relative abundance of the pedestal in triggered events over the minimum bias events indicates that most of the underlying event comes from the initial or final state radiation of the hard-scattered partons.
[c]{}
The underlying event at RHIC can be checked in QCD Monte-carlo models. We use the PYTHIA6.131, which seems to be able to reproduce the jet conditional yield as shown in Figure.\[fig:un1\]. The roles of the initial/final state radiations are studied by switching them on and off in PYTHIA simulation. Figure.\[fig:un2\]a shows a typical $\pi^{\pm}-h^{\pm}$ azimuthal correlation with (top histogram) and without (bottom histogram) radiation from the simulation. There is a significant enhancement in the pedestal level when radiations are enabled. We can perform a more quantitative comparison by plotting separately the jet contribution (double gauss component), the underlying event (the constant component) and the minimum bias event level as function of $p_T$ in Figure.\[fig:un2\]b. The hierarchy of the three contributions can be clearly seen. For event tagged with a high $p_T$ jet, the spectra for both the jet fragmentation and the underlying events are much harder than that from typical minimum bias events. Current statistics from $p+p$ does not allow a quantitative comparison with the models yet, a much larger dataset collected from recent RHIC $p+p$ run in 2005 should help to address this question in the near future.
What about the underlying event in $d$ + Au? Figure.\[fig:dphi\] indicates that the underlying event levels are larger than those in $p+p$, although the properties of the jets are quite similar. Since the hard-scattering only happens in one of the nucleon-nucleon collision in $d$ + Au, we can assume the ambient particle production mechanism is the same as in minimum bias nucleon-nucleon collision. In this case, the ambient particle production should simply scale as the nuclear modification factor, $R_{\rm{dAu}}$ measured in $d$ + Au [@Matathias:2005zd]. Thus the underlying event yields in $p+p$ and $d$ + Au, $U_{\rm{dAu}}$ and $U_{\rm{pp}}$ are connected to each other through the following simple relation, $$\begin{aligned}
U_{\rm{dAu}} = U_{\rm{pp}} +
R_{\rm{dAu}}\left(N_{\rm{coll}}-1\right)Yield_{\rm{pp}}\end{aligned}$$ where Yield$_{\rm{pp}}$ represents the hadron yield per event in minimum bias $p+p$ collisions. Divide both side by $\rm{Yield_{pp}}$, we get, $$\begin{aligned}
\lambda_{\rm{dAu}} = \lambda_{\rm{pp}} + R_{\rm{dAu}}\left(N_{\rm{coll}}-1\right)\\
\lambda_{\rm{dAu}}= U_{\rm{dAu}}/\rm{Yield_{pp}},
\lambda_{\rm{pp}} = U_{\rm{pp}}/\rm{Yield_{pp}}\end{aligned}$$ note $\lambda_{\rm{pp}}$ denotes the ratio of underlying event yield to minimum bias event in $p+p$, which should be larger than 1 according to Figure.\[fig:dphipp\] and Figure.\[fig:un2\].
Conclusion
==========
The di-jet decay kinematics are studied using $\pi^{\pm}-h^{\pm}$ correlation in $p+p$ and $d$ + Au collisions. Measured jet widths, the calculated $k_T$ and distributions of $p_{out}$ are very similar between $p+p$ and $d$ + Au, which indicate no or small broadening in cold nuclear medium. Jet yield distribution in associated hadron $p_T$ and $x_E$ are also similar between $p+p$ and $d$ + Au, consistent with no significant increase in jet multiplicity in $d$ + Au relative to $p+p$. The dependence of the $x_E$ distribution on trigger $p_T$ is weak in measured trigger $p_T$ range. The underlying event yield in $p+p$ is studied in PYTHIA Monte-carlo. Events containing a large $p_T$ trigger appear to have a underlying event spectra much harder than the minimum bias hadron spectra.
|
Originally published on April 13, 2014. China has begin installing sensitive hydrophones on the floor of the China Seas in an effort to detect...
Originally published on April 13, 2014.
China has begin installing sensitive hydrophones on the floor of the China Seas in an effort to detect and track submarines belonging to the U.S. and its allies.
Lyle Goldstein and Shannon Knight, both highly-respected naval analysts, described the new listening system as “startling” in a recent article in Proceedings, a naval professional journal.
They claimed the “fixed ocean-floor acoustic array” is evidence that Beijing has begin to take seriously the incredible destructive power of enemy submarines—especially American ones.
China’s hydrophone system, which first appeared in 2012, apparently copies America’s own Sound Surveillance System, or SOSUS—an extensive network of hydrophones that helped the U.S. Navy track virtually all Soviet submarine movements starting in the mid-1950s.
The Soviets learned about SOSUS from American turncoat John Walker in 1968 and subsequently upgraded their sub designs to be quieter. In turn, the U.S. Navy enhanced SOSUS with better hydrophones and trawler vessels towing sensitive sonars.
At its peak effectiveness, SOSUS could detect submarines thousands of miles away. The hydrophone network was America’s “secret weapon,” according to the Navy—even when it wasn’t technically secret any more.
If China’s listening system is even half as effective as SOSUS, it could spell trouble for the U.S., Japanese and Australian navies, among China’s other rivals. The U.S.-led alliance’s numerous, high-tech submarines are its greatest advantage over Beijing’s rising military—and the surest guarantee against Chinese aggression.
If Beijing can reliably track American and allied subs, it can hunt them and potentially destroy them in wartime, thus defeating Washington’s first line of defense in the Pacific.
To be sure, there’s more to setting up a listening array than merely planting hydrophones in the seabed. SOSUS owed its success to steady investment and constant improvement over a period of 40 years—not to mention the U.S. Navy’s careful cultivation of a cadre of specialists able to interpret the array’s data output.
China has just begun setting up its own “Sino-SOSUS”—and could need years or decades to refine the related technology and techniques.
In any event, the Chinese array is an important step for a country that traditionally has neglected the difficult, expensive practice of tracking enemy submarines. As recently as 2011, Owen Cote—a naval analyst at the Massachusetts Institute of Technology—assessed Beijing’s anti-submarine warfare abilities as “very limited.”
China “appears not to be making major investments to improve” its sub-hunting prowess, Cote added.
That was then. Three years later, “the massive Chinese military-industrial complex has now come around to the great importance of ASW,” Goldstein and Knight wrote. “China’s substantial military and science-research energies have shifted accordingly.” |
Q:
Adding class using attr() in a variable?
I ran into an error while trying to output this in my html file, the JS looks like this:
$.getJSON('products.json', function(data){
$.each(data.products, function(i, f){
var launch = "<div"
+ attr("class", "testClass")
+ ">"
+ f.buyLink
+ "</div>"
If I remove the attr, it works, however it returns me with an Uncaught Reference Error. What it does is that it takes data from a json and outputs it to a div on a html file but I can't seem to add a class to it using javascript.
Edit: It was meant to be a class in such a way that it outputs:
<div class="testClass">f.buyLink</div>
A:
You either make it as a string:
var launch = "<div"
+ ' class="'+ f.buyLink + '"')
+ ">"
+ f.buyLink
+ "</div>
Or you create the element and use the attr() attribute.
var launch = $('<div>');
launch.attr("class", f.buyLink);
// alternative, note that f.buylink then should not have a dot!!
// launch.addClass( f.buyLink );
launch.text(f.buyLink);
or shorthand:
var launch = $('<div>').attr("class", f.buyLink).text(f.buyLink);
You can't use them combined as in your code.
|
2019–20 Scarlets season
The 2019–20 season is the 16th season in the history of the Scarlets, a Welsh regional rugby union side based in Llanelli, Carmarthenshire. In this season, they will compete in the Pro14 and, after failing to qualify for the Champions Cup for the first time in their history, the Challenge Cup. It will be the team's first season under head coach Brad Mooar, who will be assisted by defence coach Glenn Delaney and assistant attack coach Richard Whiffin, after Wayne Pivac departed to take charge of the Wales national team.
Pre-season and friendlies
Pro14
Fixtures
Table
Conference B
Rugby Champions Cup
Fixtures
Knockout stage
Table
Statistics
(+ in the Apps column denotes substitute appearance, positions listed are the ones they have started a game in during the season)
Stats correct as of 9 February 2020
Transfers
In
Out
References
2019–20
Category:2019–20 Pro14 by team
Category:2019–20 in Welsh rugby union
Category:2019–20 European Rugby Challenge Cup by team |
Monthly Archives: February 2013
The country I work and live in at the moment is modest in cultural events. Premiers are rare and are usually met with moderate enthusiasm by the public. And it’s a pity, as local artists would probably be the winners of ‘most devoted’ category in an Oscar’s world.
So I wouldn’t have left the flash mob created by local actors unnoticed. Look at these pictures! What do they tell you?… Is it how much colour a person can bring to a dull afternoon in the middle of an apathetic crowd? Or how much devotion artists may demonstrate by going to the public instead of waiting for the public to come to them in one of poorest countries in Europe, where the salary of an actor is about 200 Euro/month and the most expensive theatre entry ticket is about 6 Euro? …
I wish there were interviews with actors and people who witnessed the flash mob to gather its effects. I would have been ecstatic by such a close contact!
These pictures made me pushy on all my local friends urging them to go and see the play. And praise the artists, the play director and the author for persevering with the mission of enriching hearts and souls of an apathetic crowd, which does not know it needs the love and devotion of these humble servants of art perhaps even more than artists need it.
The play is called “Invisible photographs and clowns” by Val Butnaru. It’s the story of a betrayal, disappointment and emotional investment in a profit-free industry (Photos by Aurel Obreja).
I love to talk about non-lady-gaga people of our times. Sorry, Lady Gaga, nothing personal.
Martha Argerich is one of greatest pianists of the 20th Century. I “met” her at my gym, on the screen of one of those treadmills connected non-stop to Euronews. It was one of her rare interviews. She is charismatic when she talks, with her fingers painting in the air. She is even more charismatic when she plays piano. She seems to become part of the piano. Or is it the piano that becomes part of her? The critic Alex Ross put it best in a 2001 article about Martha Argerich for The New Yorker : “her unerring naturalness of phrasing allows her to embody the music rather than interpret it”.
I wondered what is her native language, as she did the interview for Euronews in German, just to realise a minute later that music is her language.
She was born in 1941 in Buenos Aires, Argentina. A cancer survivor, her belief is „music makes sense only when shared’.
If you are looking for a light week-end or vacation reading this is the book. It’s funny and spiritual. You’ll get rather sensible views on women-men relations. It’s a book with bonuses: it comes with a dozen of fine recipes and titles of melodies to accompany each stage of romance. So, go get a pen. Or rather not, if it all sounds familiar 🙂 :
The Middle: the seventh haven, we get invited, the nick name, friendship for life, domestic happiness?, soul-mates, I hate Mondays, welcome to Lola, La famiglia, home alone, for better and worse, is it true? check it out. Want to impress La Famiglia? They will find you irresistible after a chocolate and raspberry roulade (recipe included in the book).
The End: thunders and lighting, the end is approaching…, one more time, the last dance…, food, superb food, the seven stages of the end, ouch…it hurts…. Cigliege sotto spirit0 (cherries in alcohol) and Survivor by Destiny’s Child are on the suggestions list for this stage.
“All you need is love”, the author’s choice of ending the book, made me repeatedly return for more.
this book might be a surprise gift for non-cooking friends. At first they might look at it with a raised brow. A friend of mine who touched no kitchen ustencil in 30 years, started cooking and baking to everyones, hers included, amazement and delight, after this book landed under her Christmas tree last year with my note “Enjoy it!” Attached to it. I feel her personal life s also about to embark on a delightful journey she will enjoy.
This book was published in 1993. You get to see Zimbabwe through the eyes of one of the finest writers of this century. Doris Lessing was raised there after her family moved to Africa from Iran. Being banned for twenty-five years from her homeland, for her opposition to the government of what was then white Southern Rhodesia, she returns to a country she both knows and wants to get to know.
A combined diary, reportage and memoirs writing style keeps the reader entertained. Which is a must, given its 442 page richness.
If you are interested in development studies and history of the region this is a highly enlightening book. Everything from war, regional dimensions, politics, inter-racial relations, class relations, poverty, economics, agriculture, environment, infrastructure to colonialism, aid, education, local traditions, family and inter-personal relations, love, class and personal attitudes, roles of verandas are illustrated in their entire splendor and decadence.
Back to its title, my favorite part in the book is “And he shook with laughter, the marvelous African laughter born somewhere in the gut, seizing the whole body with good-humoured philosophy”. Made me want to share more good laughs with friends and family. Enjoy reading and laughing! |
JONESBORO (12/8/10) - The Arkansas State football team placed a league-high 11 different players, including five first-team selections, on the 2010 All-Sun Belt Conference Team, announced Wednesday morning by the conference office.
In addition to their five first-team selections, the Red Wolves had four players earn second team honors and two named honorable mention. A-State's 11 selections matched its 2008 total to tie the most in school history as a member of the Sun Belt. The Red Wolves have now picked up at least 10 All-Sun Belt Conference choices four of the past six seasons.
ASU will have five All-Sun Belt Conference performers from this season returning in 2011, matching Troy, Florida International and Louisiana-Monroe for the most in the league. While Florida International followed ASU with 10 players on this year's all-conference squad, it had a league-best 12 selections that included T.Y. Hilton (Jr., WR) listed at wide receiver, all-purpose and return specialist.
Following ASU and FIU, Middle Tennessee had nine, Troy and Florida Atlantic eight, North Texas seven, Louisiana-Monroe five and Louisiana-Lafayette and Western Kentucky four players named All-Sun Belt Conference.
Hilton was named the Sun Belt Conference Player of the Year, while Western Kentucky's Bobby Rainey (Jr., RB) was tabbed the Offensive Player of the Year, Middle Tennessee's Jamari Lattimore (Sr., DL) the Defensive Player of the Year, Troy's Corey Robinson (QB) the Freshman of the Year and Florida International's Mario Cristobal the Coach of the Year.
The All-Sun Belt Conference Team was selected by each team's head coach and a media representative from each institution. |
Share This Listing
Public Comments
🌟 Lacoste L.12.12 White Blanc Eau De Toilette for Men 100ml
✨ Authentic US Tester Perfume
❗ Naked Perfume • No Box • Cheaper Price than with Box
💯 Oil based & Long lasting
💝 Perfect gift for your loved ones this Valentines!
📦 Meet up will be held a day after if order happens after 10am |
Board of Director Biographies
Biography
Michael O. JohannsRetired United States SenatorElected to Deere & Company Board of Directors, 2015
Michael O. Johanns is retired from the United States Senate, where he served as a Senator from Nebraska from 2009 until 2015. In the 111th-113th Congresses, his committee assignments included Agriculture, Appropriations, Banking, Commerce, Veterans Affairs, Indian Affairs, and Environment & Public Works.
Prior to his term in the U.S. Senate, Johanns was the United States Secretary of Agriculture from 2005 until 2007. He was twice elected Governor of Nebraska, 1999-2005, and in 2002 he chaired the Midwestern Governors Association. Johanns served two terms as Mayor of Lincoln, Neb., from 1991 to 1998, and he served on the Lincoln City Council from 1989 to 1991. He served on the Lancaster County, Nebraska - County Board of Commissioners from 1983 to 1987, including a year as chair. After serving as a Judicial Law Clerk for Nebraska Supreme Court Justice Hale McCown from 1974 to 1975, he practiced law with private firms in Nebraska until 1991.
Johanns earned his B.A. from Saint Mary's University of Minnesota in Winona, Minn., and his J.D. from Creighton University School of Law in Omaha, Neb. In February 2016, his Presidential nomination as a new board member of the Millennium Challenge Corporation, a bilateral United States foreign aid agency, was confirmed by the United States Senate.
Deere & Company (NYSE: DE) is a world leader in providing advanced products and services and is committed to the success of customers whose work is linked to the land – those who cultivate, harvest, transform, enrich and build upon the land to meet the world's dramatically increasing need for food, fuel, shelter and infrastructure. Since 1837, John Deere has delivered innovative products of superior quality, built on a tradition of integrity. For more information, visit John Deere at its worldwide website at www.JohnDeere.com. |
/* u_1_12.c: Undefined behaviors on undefined #include syntax or header-
name. */
/* { dg-do preprocess } */
/* u.1.12: Argument of #include other than header-name. */
#include filename /* { dg-error "(#include|`#include') expects | Not a header name" } */
|
Residual effects of zolpidem, triazolam, rilmazafone and placebo in healthy elderly subjects: a randomized double-blind study.
With current hypnotic agents, next-day residual effects are a common problem. The purpose of the present study was to evaluate the residual effects of the commercially available hypnotics - zolpidem, triazolam, and rilmazafone - on the physical and cognitive functions of healthy elderly people in the early morning and the day following drug administration. In this study, the next-day residual effects of zolpidem, triazolam, and rilmazafone, following bedtime dosing in elderly subjects, were evaluated. Women (n = 11) and men (n = 2) aged 60-70 years received a single dose (at 23:00) of one of these, zolpidem 5 mg, triazolam 0.125 mg, rilmazafone 1 mg and placebo in a randomized, double-blind, crossover design. Measures of objective parameters and psychomotor performances (Timed up and Go test, Functional Reach Test, body sway test, critical flicker fusion test, simple discrimination reaction test, short-term memory test) and subjective ratings were obtained at 04:00, 07:00, and the next time of the day. All hypnotics were generally well tolerated; there were no serious adverse side effects and no subjects discontinued the evaluations. Compared to placebo, zolpidem and rilmazafone had good results on the Functional Reach Test. Although subjective assessments tended to be poor in the early morning, rilmazafone significantly improved the body sway test in the other hypnotics. A single dose of zolpidem 5 mg and triazolam 0.125 mg did not have any next-day residual effects on healthy elderly subjects. Residual effects appeared to be related to the compound's half-life and the dose used. Rilmazafone 1 mg exhibited steadiness in static and dynamic balance and seemed to be more favorable for the elderly with early morning awakening. |
Padawan has gone missing in Yavin IV after being hit by a creature
Reporters of the Galactic News watched a scene in the theatre on Yavin 4
Tyrron Archria introducing Orlan
Tyrron Archria, a Jedi padawan of the Kalway Order of the Jedi (KOJ) in Yavin 4 is reported missing after a public display of one of his creations. Formerly with the Jedi Refuge of Trandosha (TJR), Tyrron had developed there a life form called Orlan for defensive purpose. This form was create out of force plasma from a vial given in Tatooine. Now conceding such a creation might be against the code, he had destroyed all databanks and memories he had, able to reproduce such a project. He views however Orlan as his friend.
However since he left Trandosha, the creature stopped to work properly. Its plasma isn’t pure anymore or as fluid at it was. He confided his story to ask several advices. Several people, including his master, the Jedi Altantis, the priestess Septra Fiertze, the Republic Vice Chancellor Sapphire Tafo, and her bodyguard Shogarii, went to the theatre to watch the create. It has the form of a twirling spheroid out of white plasma. The witnesses tried to enter in contact with it, with limited success. Darken impurities in the plasma however were well seen during their examination, unable to figure yet how to control this “parasite”, they stopped it. But it was too late, the sphere swollen and headed to Tyrron, who flied across the theatre, several meters away.
Orlan swelling at the end
People tried to help him, but he screamed when gaining conscious back then he threw plasma projectiles in the room. During the confusion caused by the flashlights and the vapour, Tyrron disappeared. Several people were looking after him, but hey didn’t seen him in the academy. On the contrary, his starfighter was missing in the hangar.
Where he he gone and could he be cured of his merge with the parasitised creature, nobody yet know. Let’s hope he will reappear in good health and able to resume his Jedi training. Anybody having information is welcome to inform the Jedi of Yavin 4.
Related
first, I believe you mean stopped working properly not stopped to work properly, as that would indicate that it was working fine at the time of the disappearing of the padawan….second…a padawan is experimenting with creating things like this and no one thinks it’s suspicious…? typical Jedi, one of your own kind works with forces unknown to you and you don’t even suspect anything of him. |
Thursday, May 29, 2014
Better Sanitation SAVES Lives and Money
Open defecation costs $US260b globally
The UN is calling for the end of open defecation as it costs about $US260 billion worldwide.Source: AAP
THE United Nations says one billion people worldwide are still practising open defecation, which cost of billions of dollars annually due to illness, death and loss of productivity.
The practice spreads diseases like diarrhoea, dysentery, hepatitis A and typhoid through entire communities, the UN officials said, costing about $US260 billion ($A281 billion) worldwide.It has kept women under the threat of harassment, violence and rape, and has forced young girls to abandon education at puberty."It is high time to talk openly about open defecation, and it is high time to bring it to an end," UN Deputy Secretary General Jan Eliasson said during the launch of the world body's sanitation campaign in New York. "Let us remember that the first step to solve any problem is talking about it." The practice is most widespread in poor and developing countries.Some countries, including Vietnam and Bangladesh, where more than 30 per cent of their populations relieved themselves in open areas in the early 1990s, ended the practice entirely in 2012.However, open defecation lingers in dozens of other countries.In India an estimated 600 million people - more than half the population - defecate without using a toilet or latrine. "If we could end open defecation in just 10 countries, we would see the numbers of people affected drop by 80 per cent," Eliasson said, noting that the end of the practice could mean a direct reduction of 36 per cent in deaths due to diarrhoea for children under five.I have written several prior posts about water and sanitation, in developing economies, as a vital for removing poverty and also empowering women especially. It freaked me the first time I encountered it - which was in Africa - in the mid 1980s. Hard to really believe what I was seeing.While progress is being made - can we do more.........much more!It seems simple - provide public toilets, but in some areas little seems to happen. When the cost to society is so high - US$ 260 billion - a solution needs to be achieved.We need to put more money into some of these simple things. It does pay off![ some of this sourced via AAP] |
struct AnyCodingKey: CodingKey, Equatable {
var stringValue: String
var intValue: Int?
init?(stringValue: String) {
self.stringValue = stringValue
self.intValue = nil
}
init?(intValue: Int) {
self.stringValue = "\(intValue)"
self.intValue = intValue
}
init<Key: CodingKey>(_ base: Key) {
if let intValue = base.intValue {
self.init(intValue: intValue)!
} else {
self.init(stringValue: base.stringValue)!
}
}
func key<K: CodingKey>() -> K {
if let intValue = self.intValue {
return K(intValue: intValue)!
} else {
return K(stringValue: self.stringValue)!
}
}
}
extension AnyCodingKey: Hashable {
public func hash(into hasher: inout Hasher) {
self.intValue?.hash(into: &hasher) ?? self.stringValue.hash(into: &hasher)
}
}
extension AnyCodingKey: Encodable {
func encode(to encoder: Encoder) throws {
var container = encoder.singleValueContainer()
if let intValue = self.intValue {
try container.encode(intValue)
} else {
try container.encode(self.stringValue)
}
}
}
extension AnyCodingKey: Decodable {
init(from decoder: Decoder) throws {
let value = try decoder.singleValueContainer()
if let intValue = try? value.decode(Int.self) {
self.stringValue = "\(intValue)"
self.intValue = intValue
} else {
self.stringValue = try! value.decode(String.self)
self.intValue = nil
}
}
}
|
When Clean Water is a Terrorist Threat
Recently the Environmental Protection Agency has been trying to strengthen laws that would protect our ground water. Because factory farming is considered an “agriculture” and not industrial operation, confined animal feeding operation (CAFO) owners can skirt many of the environmental laws that regulate industry pollution standards. CAFOs create huge amounts of animal waste that cannot be absorbed in the soil, as would be the case on a real farm, and so waste is either collected in large lagoons or gets sprayed on crops. The problem is lagoons leak, rupture or overflow during heavy storms and CAFO operators often overspray (apply too much) animal waste locally because it costs less than transporting it to another location.
CAFO operators routinely use antibiotics in animal food, as well as give animals preventative injections of antibiotics to both make the animals grow fatter for slaughter and reduce the risk of infections that can run rampant when so many animals are densely packed together on factory farms. But those antibiotics find their way into out water supply. Samplings of rivers and streams shows 50% of our waterways contain traces of antibiotics that come directly from animal waste.
So where’s the terrorist threat? CAFO owners are upset because proposed rules would require they report exactly where they are storing all that waste. Are they concerned that a terrorist knowing the latitude and longitude of a manure lagoon could launch missiles and splatter the waste all over the place? Why bother when CAFO operators are already doing that, often clandestinely. No, the threat seems to be that if organizations that are against animal abuse and cruelty know where the farms are located they might sneak in and videotape the abuse that takes place. Exposing farm animal abuse is, believe it or not, considered terrorism in a number of states, thanks to well paid lobbyists who somehow convinced lawmakers that animal rights groups are a bigger threat to U.S. security than extremists groups that want to kill people, not animals.
The tragedy of factory farms is in part possible because the animals are hidden away from public view. Out of sight; out of mind, and the industry wants to keep it that way. Sir Paul McCartney once said that if factory farms had glass walls the farms would no longer exist because the public would see firsthand the horror that goes on inside. It would seem to me that owners who care nothing about animals or about protecting our environment are a bigger terrorist threat than activists who want to expose the abuses. |
#!/bin/bash -xe
if test -v CLEAR_CACHE; then
rm -rf $HOME/root
fi
: Travis tag = ${TRAVIS_TAG}
: Travis branch = ${TRAVIS_BRANCH}
: /etc/hosts --
cat /etc/hosts
: -- ends
# ### FIXME: This is a workaround, non-x86 builds have an IPv6
# configuration which somehow breaks the test suite runs. Appears
# that Apache::Test only configures the server to Listen on 0.0.0.0
# (that is hard-coded), but then Apache::TestSerer::wait_till_is_up()
# tries to connect via ::1, which fails/times out.
if grep ip6-localhost /etc/hosts; then
sudo sed -i "/ip6-/d" /etc/hosts
cat /etc/hosts
fi
# Use a rudimental retry workflow as workaround to svn export hanging for minutes.
# Travis automatically kills a build if one step takes more than 10 minutes without
# reporting any progress.
function run_svn_export() {
local url=$1
local revision=$2
local dest_dir=$3
local max_tries=$4
# Disable -e to allow fail/retry
set +e
for i in $(seq 1 $max_tries)
do
timeout 60 svn export -r ${revision} --force -q $url $dest_dir
if [ $? -eq 0 ]; then
break
else
if [ $i -eq $max_tries ]; then
exit 1
else
sleep $((100 * i))
fi
fi
done
# Restore -e behavior after fail/retry
set -e
}
function install_apx() {
local name=$1
local version=$2
local root=https://svn.apache.org/repos/asf/apr/${name}
local prefix=${HOME}/root/${name}-${version}
local build=${HOME}/build/${name}-${version}
local config=$3
local buildconf=$4
case $version in
trunk) url=${root}/trunk ;;
*.x) url=${root}/branches/${version} ;;
*) url=${root}/tags/${version} ;;
esac
local revision=`svn info --show-item last-changed-revision ${url}`
# Blow away the cached install root if the revision does not
# match.
test -f ${prefix}/.revision-is-${revision} || rm -rf ${prefix}
if test -d ${prefix}; then
return 0
fi
svn export -q -r ${revision} ${url} ${build}
pushd $build
./buildconf ${buildconf}
./configure --prefix=${prefix} ${config}
make -j2
make install
popd
touch ${prefix}/.revision-is-${revision}
}
if ! test -v SKIP_TESTING; then
### Temporary: purge old svn checkout from the cache
rm -rf $HOME/root/framework
# Make a shallow clone of httpd-tests git repo.
git clone --depth=1 https://github.com/apache/httpd-tests.git test/perl-framework
fi
# For LDAP testing, run slapd listening on port 8389 and populate the
# directory as described in t/modules/ldap.t in the test framework:
if test -v TEST_LDAP -a -x test/perl-framework/scripts/ldap-init.sh; then
docker build -t httpd_ldap -f test/travis_Dockerfile_slapd test/
pushd test/perl-framework
./scripts/ldap-init.sh
popd
fi
if test -v TEST_SSL; then
pushd test/perl-framework
./scripts/memcached-init.sh
./scripts/redis-init.sh
popd
fi
if test -v APR_VERSION; then
install_apx apr ${APR_VERSION} "${APR_CONFIG}"
APU_CONFIG="$APU_CONFIG --with-apr=$HOME/root/apr-${APR_VERSION}"
fi
if test -v APU_VERSION; then
install_apx apr-util ${APU_VERSION} "${APU_CONFIG}" --with-apr=$HOME/build/apr-${APR_VERSION}
fi
|
Solid-phase PEGylation of recombinant interferon alpha-2a for site-specific modification: process performance, characterization, and in vitro bioactivity.
'Solid-phase' PEGylation, in which a conjugation reaction attaches proteins to a solid matrix, has distinct advantages over the conventional, solution-phase process. We report a case study in which recombinant interferon (rhIFN) alpha-2a was adsorbed to a cation-exchange resin and PEGylated at the N-terminus by 5, 10, and 20 kDa mPEG aldehydes through reductive alkylation. After PEGylation, a salt gradient elution efficiently purified the mono-PEGylate of unwanted species such as unmodified IFN and unreacted PEG. Mono-PEGylation and purification were integrated into a single, chromatographic step. Depending on the molecular weight of the mPEG aldehyde, the mono-PEGylation yield ranged from 50 to 65%. Major problems associated with the solution-phase process such as random or uncontrollable multi-PEGylation and post-PEGylation purification difficulties were overcome. N-terminus sequencing and MALDI-TOF mass spectrophometry confirmed that the PEG molecule was conjugated only to the N-terminus. A cell proliferation study indicated reduced antiviral activity of the mono-PEGylate compared to that of the unmodified IFN. As higher molecular weight PEG was conjugated, in vitro bioactivity and antibody binding activity, as measured by a surface plasmon resonance biosensor, decreased. Nevertheless, trypsin resistance and thermal stability were considerably improved . |
For the last 60 million years, fungus-growing ants have farmed fungi for food. In their cultivation of those fungi, they've successfully relied on bacteria-produced antimicrobial ingredients to protect their crops from other species of parasitic fungi. Now, researchers reporting in the journal Trends in Ecology & Evolution say they are looking to these ants to find new ways to stop or slow the evolution of antibiotic resistance that now presents a major threat to modern medicine.
"Somehow the ant-bacteria alliance seems to have been able to sidestep the problem of antibiotic resistance," says Massimiliano Marvasi of the Università degli Studi di Firenze, Italy. "This led us to hypothesize that the application of potent cocktails of continually evolving variants of antimicrobial compounds was the most likely model by which to explain this dynamic."
Marvasi's team had been studying the fitness of multi-drug resistant pathogens in the environment. While exploring this, first author of the new review Ayush Pathak suggested that they compare what they saw in other environments including clinics to what happens in the fungus gardens of attine ants.
In clinical settings, antimicrobial use leads quickly to the rise of resistant bacterial strains. But the ants weren't having this same problem. The question was: Why?
The researchers say that the secret to the ants' success may be explained by the fact that the bacteria they associate with rely on antimicrobials that vary subtly and continually over time in both structure and combination. This element of surprise, enabled by the presence of gene clusters under selective pressure, allows the ant-associated bacteria to produce ever-changing and unpredictable antimicrobials. As a result, it's much tougher for the parasitic fungi to become resistant, even over the course of millions of years.
The ants' example suggests that mixing and administering continually varying cocktails of slight structural variants of known antibiotics might hold promise as a means to address antimicrobial resistance in the clinic, the researchers say. Along with the continued development of new molecules and classes of antibiotics, they suggest this strategy should now be assessed in the lab and ultimately in the clinic.
"I think the development of effective strategies for mixing subtle antibiotic variants could give a new life to old antibiotics," Marvasi says.
The researchers say the next step is to investigate the effects of selection pressure upon the bacterial gene clusters that produce antibiotic variants. "A better understanding of this relationship and its coevolutionary processes at the genetic level will complement development of new strategies for combating the rise of resistance as well as potentially giving rise to novel antibiotic compounds," Pathak says. |
#pragma once
#include <cstdint>
#include <array>
#include <limits>
#include <iosfwd>
#include <functional>
namespace rc {
/// Implementation of a splittable random generator as described in:
/// Claessen, K. och Palka, M. (2013) Splittable Pseudorandom Number
/// Generators using Cryptographic Hashing.
class Random {
friend bool operator==(const Random &lhs, const Random &rhs);
friend bool operator<(const Random &lhs, const Random &rhs);
friend std::ostream &operator<<(std::ostream &os, const Random &random);
template <typename Iterator>
friend Iterator serialize(const Random &random, Iterator output);
template <typename Iterator>
friend Iterator deserialize(Iterator begin, Iterator end, Random &output);
public:
/// Key type
using Key = std::array<uint64_t, 4>;
/// Type of a generated random number.
using Number = uint64_t;
/// Constructs a Random engine with a `{0, 0, 0, 0}` key.
Random();
/// Constructs a Random engine from a full size 256-bit key.
Random(const Key &key);
/// Constructs a Random engine from a 64-bit seed.
Random(uint64_t seed);
/// Splits this generator into to separate independent generators. The first
/// generator will be assigned to this one and the second will be returned.
Random split();
/// Returns the next random number. Both `split` and `next` should not be
/// called on the same state.
Number next();
private:
using Block = std::array<uint64_t, 4>;
using Bits = uint64_t;
static constexpr auto kBits = std::numeric_limits<Bits>::digits;
using Counter = uint64_t;
static constexpr auto kCounterMax = std::numeric_limits<Counter>::max();
void append(bool x);
void mash(Block &output);
Block m_key;
Block m_block;
Bits m_bits;
Counter m_counter;
uint8_t m_bitsi;
};
bool operator!=(const Random &lhs, const Random &rhs);
} // namespace rc
namespace std {
template <>
struct hash<rc::Random> {
using argument_type = rc::Random;
using result_type = std::size_t;
std::size_t operator()(const rc::Random &r) const {
return static_cast<std::size_t>(rc::Random(r).next());
}
};
} // namespace std
#include "Random.hpp"
|
Chromosomal circularization of the model Streptomyces species, Streptomyces coelicolor A3(2).
Streptomyces linear chromosomes frequently cause deletions at both ends spontaneously or by various mutagenic treatments, leading to chromosomal circularization and arm replacement. However, chromosomal circularization has not been confirmed at a sequence level in the model species, Streptomyces coelicolor A3(2). In this work, we have cloned and sequenced a fusion junction of a circularized chromosome in an S. coelicolor A3(2) mutant and found a 6-bp overlap between the left and right deletion ends. This result shows that chromosomal circularization occurred by nonhomologous recombination of the deletion ends in this species, too. At the end of the study, we discuss on stability and evolution of Streptomyces chromosomes. |
In an ene-thiol based photocurable resin composition which is a radical polymerization type photocuring system, active thiyl radicals are regenerated even when radicals are deactivated by oxygen. Said composition therefore has advantages such that polymerization inhibition caused by oxygen that occurs in acrylic materials does not occur, that the used amount of a photopolymerization initiator can be reduced, that volume shrinkage at the time of curing can be reduced, that curing can be done in a short period of time, i.e., from a few seconds to a few minutes after the initiation of polymerization, and that cured products of thick-film having a thickness of 1 mm or more can be produced, and is gathering attention as a photocurable material (Non-Patent Document 1).
For example, Patent Document 1 discloses a photocurable resin composition comprising polyene, polythiol and a compound having a bromine-substituted aromatic ring having a specific structure, in which the mass ratio of the polyene to the polythiol is from 49:1 to 1:49, as such an ene-thiol-based photocurable resin composition. Also, Patent Document 2 discloses an ene-thiol-based photocurable resin composition comprising a polyene compound, and a (poly)thiol-based monomer consisting of a reaction product of a polyvalent amine compound and a mercaptocarboxylic acid compound.
The technology disclosed in Patent Document 1 provides a photocurable resin composition having a high refractive index, in which the refractive index can be adjusted with high precision. The technology disclosed in Patent Document 2 provides a cured product that can be cured in a short period of time without polymerization inhibition caused by oxygen and with reduced volume shrinkage, and in which the amount of a photopolymerization initiator used can be reduced and humidity resistance is notably improved. However, Patent Documents 1 and 2 do not in any way mention the shock absorption and vibration absorption of the cured product.
Patent Document 3 discloses a transparent resin consisting of a cured product of a polymerizable composition comprising at least one of diallyl phthalate, diallyl isophthalate and diallyl terephthalate, and pentaerythritol tetra(3-mercaptopropionate). However, the concept of the shock properties described in Patent Document 3 which concern penetration of a ball and scattering of a sample is close to that of toughness and elongation properties, which are different from shock absorption in terms of rebound properties. Also, there is no mention of turbidity (haze) and yellowing (b* value) which indicate transparency. |
Ion permeation of pores in model membranes: selectivity, fluctuations and the role of surface charge.
Fluctuation of surface charge on pore walls provides a realistic, additional mechanism for generating fluctuation of ionic current and ionic selectivity in narrow pores. |
Q:
Standard equivalent for JAXB in Android
I am building an APP that uses XML requests and responses to communicate with a server via HTTP POST. Due to copyright restriction I cannot use SIMPLE XML to do (at least partially) what JAXB would normally do, and from all the information I have JAXB cannot be used on Android.
I did the job using XmlSerializer to build the request and XMLPullParser for parsing the response but I don`t like how the code looks like and I was not able to find any standard equivalent for JAXB in the Android SDK.
Is there any SDK component that I can use to transform the XSD schema files to Java classes and then use marshaller/unmarshaller to/from a XML file or I am stuck with using XmlSerializer/XMLPullParser?
A:
Is there any SDK component that I can use to transform the XSD schema files to Java classes
No.
I am stuck with using XmlSerializer/XMLPullParser?
You are welcome to use DOM or SAX instead of XmlPullParser, just as you can in classic Java.
There are also several XML parsing libraries for Android, beyond just SimpleXML.
|
Determinants of heavy cigarette smoking: are there differences in men and women? Results from the population-based MONICA/KORA Augsburg surveys.
Heavy cigarette smoking is more frequent in men than in women. So far, little is known whether this sex-specific difference in cigarette consumption is modified by age at smoking onset, sociodemographical, and lifestyle factors. Therefore, we aimed to identify sex-specific characteristics associated with heavy daily cigarette smoking. The study population consisted of 3,178 daily smokers aged 25-74 years from the population-based MONICA/KORA Augsburg surveys conducted between 1984 and 1995. Subjects consuming at least 20 cigarettes daily were defined as heavy smokers. Multivariate logistic regression was used to identify sociodemographical, smoking-related, and lifestyle characteristics of heavy smokers. A number of 1,576 subjects (49.6%) were identified as heavy smokers. Men were significantly more often heavy smokers than women with the exception of those women who have started smoking at an early age. Multivariate logistic regression revealed early age at smoking onset determines heavy smoking in women but not in men. While younger age at study examination and low educational level was associated with heavy smoking in men only, current employment was associated with heavy smoking in women only. Moreover, living alone, high alcohol or coffee consumption, and low physical leisure activity were associated with heavy smoking behavior in both sexes. Survey, obesity and parental history of smoking showed no association with heavy smoking. The present study revealed sex-specific differences in heavy smoking by age at smoking onset, which was not shown before so far. These findings should be further investigated and addressed in future prevention campaigns. |
Wedding Programs
Typography
Stripes
Recommended Just For You
Customer Raves & Reviews
Beautiful
We love them. They are perfect for our wedding. It was very easy to customize. We've never seen anything like them.
Lovely
By Starfishgirl on Sep 14, 2013
I am so pleased with the quality, color, customizabilty, and rapid delivery. This is a gorgeous template. Highly recommended.
I love my programs!! They look amazing
By AnneO on Jul 24, 2013
I was so excited to receive my programs, and they were more perfect that I had hoped. I am so glad that I stumbled upon magnet street for my order and I will definitely be recommending them!
beautiful program
By Bride802 on Jun 15, 2013
Great customer service. Great product. Very happy with the results and would go through magnet street again for sure.
My only issue is that the website was kind of hard to navigate. i.e. uploading/adding a logo to my program. The changes I made on the program with my work computer didn't translate to the product when I re-opened at my home computer and vice versa. Bizarre. |
1. Introduction {#sec0005}
===============
Trace metals (TMs) constitute one group of known hazardous substances; in some cases, these elements are naturally present in soils \[[@bib0005]\], as they originate from the erosion of rocks or volcanic activity. Additionally, anthropogenic activities like mineral processing; chemical, metallurgic, petrochemical, and textile industries; and fuel combustion, among others \[[@bib0010]\], have increased TM concentrations. In both cases, these contaminants are readily available for intake by plants because they are present mostly in the soil surface, along with plant nutrients \[[@bib0005],[@bib0015]\].
There is worldwide concern about some metals, such as cadmium (Cd), iron (Fe), and zinc (Zn), because they have the capacity to translocate into plant shoots; other metals like arsenic (As), chromium (Cr), and lead (Pb) bioaccumulate in most plant organs: roots, stem, leaves, and fruits \[[@bib0005]\]. In addition, TMs are nonbiodegradable, and they can move through food webs to ultimately be consumed by humans, which may result in various health risks due to their acute or chronic toxicity \[[@bib0020], [@bib0025], [@bib0030]\]. This concern has led researchers to test and apply different methodologies for sample preparation and metal quantification in food samples, including acid calcination \[[@bib0035]\], microwave-assisted acid digestion \[[@bib0040], [@bib0045], [@bib0050]\], and the use of absorbents and nanoparticles to extract TMs before quantification \[[@bib0055], [@bib0060], [@bib0065]\].
In crop cultivation, organic waste is commonly used as a source of nutrients, but long-term application can increase TM concentrations in soils \[[@bib0070]\]. In cultivable soils, Cd presence is assumed to occur from the soils' own natural volcanic composition, but it can also follow when some fertilizers (e.g., phosphorous derivatives) are used. Once consumed, this metal is retained in the human body, particularly in the kidneys, producing highly toxic effects and increasing the risk of kidney failure and cancer \[[@bib0075]\]. For nonsmoking populations, food consumption is the main source of Cd exposure \[[@bib0015]\]. Pb is another harmful TM that can damage the nervous, skeletal, circulatory, enzymatic, endocrine, and immune systems \[[@bib0025]\].
The presence of metals in vegetables is influenced by many factors, principally by the crop species and its metabolism, and by others such as the soil's initial concentration of contaminants, pH, organic matter availability, and presence of other ions and molecules \[[@bib0080],[@bib0085]\]. The kinetics of TMs' uptake depends on the mechanisms of their ion toxicity, including the blocking of functional groups in biomolecules and the replacing of essential metal ions in biomolecules \[[@bib0090]\]. Crops that are located close to vehicular traffic and factories also have an increased likelihood of TM presence \[[@bib0095]\].
Considering that vegetables are an important dietary source of essential nutrients, especially in terms of their high content of protein, vitamins, minerals, and fibers as well as beneficial antioxidant effects \[[@bib0100]\], their consumption is generally recommended \[[@bib0105]\]. Nevertheless, vegetables may also contain elevated concentrations of TMs due to high transfer from the soil to the harvested crop \[[@bib0005]\]. Further, since the early 20th century, human exposure to TMs from natural food consumption has increased because of their intensified use in industrial processes and products \[[@bib0025]\].
To protect food safety and human health, national and international organizations have established maximum permissible levels of TMs in food meant for human consumption \[[@bib0015],[@bib0105]\]. One such regulation is the General Standard for Contaminants and Toxins in Food and Feed Codex (CXS) 193--1995 \[[@bib0110]\]. In addition, the Environmental Protection Agency (EPA) proposed the use of hazard quotients (HQs), which help evaluate the potential exposure status of a population as related to their alimentary habits \[[@bib0115],[@bib0120]\]. The HQs have been extensively used to assess human health risk from vegetable consumption \[[@bib0020],[@bib0025]\].
In Ecuador, two of the most consumed crops in the population's daily diet are tomato (*Solanum lycopersicum*) and lettuce (*Lactuca sativa*), which are frequently used in salads and sandwiches. Each Ecuadorian consumes on average four kilos of tomatoes per year \[[@bib0125]\], and lettuce demand and consumption are high because of its use in both traditional and gourmet recipes \[[@bib0130]\].
There are no local-context studies that have determined Cd and Pb content in tomato and lettuce sold in the main markets in the Metropolitan District of Quito (DMQ, for its name in Spanish). For this reason, the present study aims to determine the Cd and Pb concentrations in tomato and lettuce samples from organic and nonorganic markets in the DMQ, Ecuador, to quantify the concentration of these TMs and evaluate compliance with the CXS 193--1995 international standard \[[@bib0110]\].
2. Materials and methods {#sec0010}
========================
2.1. Study location {#sec0015}
-------------------
The DMQ was selected for the current study as it is the most densely populated city in Ecuador, with a population of 2,735,987 \[[@bib0135]\]. It is the country's capital and one of the most touristic destinations of the region. In addition, the DMQ and its surroundings include different industrial and commercial enterprises as well as relatively heavy traffic around and within the city, which are potential pollution sources. At the same time, large-scale vegetable production is conducted near this area, principally to supply the main city markets.
The climate in Quito varies daily but remains relatively steady throughout the year; the weather ranges from warm, sunny days to cold and windy conditions mixed with rain. The average annual temperature in Quito is 18 °C with an annual low temperature around 7 °C and an annual high temperature around 25 °C \[[@bib0140]\].
2.2. Sampling {#sec0020}
-------------
All formal and registered nonorganic markets within the DMQ were considered for sampling, using information from the Direction of Markets, Fairs, and Platforms from the District Trade Coordination Agency of the DMQ municipality. Supermarkets were excluded because they have a limited number of approved vegetable providers, thus causing reduced variety in the samples. Additionally, organic markets (bioferias) were also sampled as another subgroup using information from the Economic Promotion Agency (CONQUITO) of the DMQ municipality.
The nonorganic markets were marked on a city map, which was divided into North, Central, and South zones; then, considering that there are four times as fewer bioferias than nonorganic markets, these organic markets were considered another group for this study.
Sixty-six markets were identified: 53 nonorganic markets, mixed markets, submarkets, and fairs and 13 organic bioferias.
Once located on the map and grouped by location/type, the representative amount of markets for the sample was calculated using the whole square root of the total number of markets per zone, shown in [Table 1](#tbl0005){ref-type="table"}.Table 1Number of sampled locations for each market subgroup.Table 1SubgroupTotal number of marketsNumber of sampled marketsNorth zone174Central zone184South zone184Bioferias134**Total**6616
The following markets were randomly selected:•North zone: "Bellavista" mixed market, "La Carolina" mixed market, "Rumiñahui" mixed market, and "San Antonio" mixed market.•Central zone: "América" mixed market, "Arenas" market, "Jaime Roldós" fair, and "Toctiuco" market.•South zone: "El Calzado" submarket, "Conocoto" mixed market, "Guamaní" fair, and "El Tingo" fair.•Bioferias: "Conquito," "La Floresta," "Quito Tenis," and "Quitumbe."
In every market, the Ecuadorian Standardization Service's (INEN) Ecuadorian Technical Standard (NTE) 1750:1994 was applied in the selection of samples \[[@bib0145]\], considering that every vendor had fewer than 100 kg of each product. A total of two kg of tomatoes and 10 units of lettuce were randomly selected from one vendor, collecting from five different vendors in each market. A total of 80 tomato and 80 lettuce samples from five vendors from each of the 16 markets were purchased and transferred to the Centro de Estudios Aplicados en Químca (CESAQ) laboratory. Then, all sample products were refrigerated at 4 ± 2 °C until their preparation.
During the sampling process, the number of vendors from whom samples were taken was selected according to the total number of vendors inside each market. In some cases, (Bellavista, Arenas, Guamaní, and Conquito), when there were less than five vendors, one vendor was considered as two or more lots.
2.3. Analysis of samples {#sec0025}
------------------------
The sample preparation and quantification methods were done using heat drying, microwave-assisted acid digestion, and graphite furnace atomic absorption spectrophotometry, taking as reference the methods described in Romero-Estévez et al. \[[@bib0050]\].
Initially, all samples were washed with high-quality reagent water (resistivity: 18.2 MΩ cm) to eliminate impurities. For both tomatoes and lettuce, the five samples from the same market were mashed and homogenized to obtain a composite sample (16 total composite samples for each vegetable). The water content of the composite samples was determined using a humidity analyzer (Mettler Toledo, HB43-S, Greifensee, Switzerland). Then, the composite samples were dried for 48 h at 60 °C in a Memmert UM 500 stove (Schwabach, Germany).
One (1.0000) gram of each composite sample was weighed in Teflon vials, where 5 mL of 70 % nitric acid (Fisher Chemical, Certified ACS plus, CAS\# 7697-37-2) and 3 mL of 30 % hydrogen peroxide (Fisher Chemical, Certified ACS plus, CAS\# 7722-81-1) were gradually added. Acid digestion was performed using a MARS 6 microwave (CEM, Matthews, NC, USA).
For the quantification, the obtained digestions were filtered. Then, Cd and Pb content were determined using an absorption spectrophotometer coupled to a graphite furnace (HGA 900 and AAnalys 400, Perkin Elmer Inc., Waltham, MA, USA), using the temperature programming described in [Table 2](#tbl0010){ref-type="table"}. Calibration curves were prepared using four different concentration levels of dilutions of certified reference materials of 0.5, 1.0, 2.0, and 4.0 μg/mL for Cd (Inorganic Ventures, 1000 μg/mL, Certified Standard, CAS \# 7697-37-2) and 5.0, 10.0, 20.0, and 40.0 μg/mL for Pb (Inorganic Ventures, 1000 μg/mL, Certified Standard, CAS \# 7697-37-2). A linear regression coefficient (R^2^) of a minimum of 0.99 was expected to demonstrate linear adjustment between concentration and absorbance. All the standards of the calibration curves, samples, and blanks were prepared using analytical grade reagents and high-quality reagent water. The results are presented in mg/kg of dry and fresh weight. Matrix modifiers were also used: for Cd analysis, a mixture of 0.015 mg Pd (Inorganic Ventures, Matrix modifier, CAS \# 7697-37-2) and 0.01 mg Mg(NO~3~)~2~; for Pb, 0.2 mg NH~4~H~2~PO~4~ (Inorganic Ventures, Matrix modifier, CAS \# 7697-38-2).Table 2Temperature programming of the graphite furnace used to analyze the Cd and Pb in the samples.Table 2Temperature (°C)Ramp Time (s)Hold Time\
(s)CadmiumLead1101101301301301530850700102016501800052450245013
All composite samples were analyzed in duplicate, and reagent blanks and fortifications in known concentrations (0.050 mg/kg for Cd and 0.250 mg/kg for Pb) prepared from certified reference materials of approximately 1000 mg/mL were added to original non-fortified samples and used as quality control. The relative standard deviation (RSD) and the accuracy as relative recovery rates of fortifications were also evaluated using the criteria established in the Guidelines for Single Laboratory Validation of Chemical Methods for Dietary Supplements and Botanicals of the Association of Official Analytical Chemists (AOAC) \[[@bib0150]\]: precision of 16.0 % for repeatability and recoveries between 75.0 % and 120.0 % for accuracy. In addition, a certified reference material of tomato leaves 1573a from the National Institute of Standards and Technology was used as an additional quality control.
The obtained results were compared with the CXS 193--1995 \[[@bib0110]\]. The corresponding threshold value in fresh weight for tomato is 0.100 mg/kg for both Cd and Pb; for lettuce, the values corresponding to fresh weight are 0.200 mg/kg for Cd and 0.300 mg/kg for Pb \[[@bib0110]\].
3. Results and discussion {#sec0030}
=========================
All the calibration curves presented R^2^ values higher than 0.99. The limits of detection (LOD) and the limits of quantification (LOQ) were calculated by using low-level concentration fortifications for each metal. The obtained LOD values were 0.010 and 0.150 μg/kg for Cd and Pb, respectively, and the obtained LOQ values were 0.050 and 0.250 mg/kg for Cd and Pb, respectively.
As shown in [Table 3](#tbl0015){ref-type="table"}, Cd results in tomatoes indicated that the 16 composite samples had concentrations lower than the CXS 193--1995 threshold values (0.100 mg/kg, fresh weight); the highest values were found in bioferias and North zone markets. In addition, three markets (two bioferias and one from the Central zone) had non-detectable results.Table 3Cadmium results in tomato and lettuce from 16 of the principal markets in Quito, Ecuador.Table 3MarketZoneTOMATO (*Solanum lycopersicum*)LETTUCE (*Lactuca sativa*)Cadmium content in samples \[mg/kg\] (dry weight)Cadmium content in samples \[mg/kg\] (fresh weight)RSD \[%\]Relative\
recovery \[%\]Cadmium content in samples \[mg/kg\] (dry weight)Cadmium content in samples \[mg/kg\] (fresh weight)RSD \[%\]Relative\
recovery \[%\]1South\<0.050\<LOQ\--84.2 %0.1660.0082.4%82.1 %2South0.1150.0105.5%102.0 %0.0540.0022.2%119.3 %3South0.1000.0098.9%104.7 %\<0.050\<LOQ\--81.4 %4South\<0.050\<LOQ\--115.8 %NDND\--94.5 %5CentralNDND\--87.2 %\<0.050\<LOQ\--80.9 %6Central\<0.050\<LOQ\--79.0 %\<0.050\<LOQ\--85.7 %7Central\<0.050\<LOQ\--119.3 %NDND\--84.2 %8Central0.1470.01410.7%112.7 %\<0.050\<LOQ\--91.2 %9North0.3780.0353.8%78.4 %0.5650.0272.4 %114.5 %10North0.142\<LOQ\--113.8 %0.2450.0191.6 %104.2 %11North0.1420.0146.3%84.6 %0.0940.00314.7 %76.5 %12North0.1570.0158.5%97.9 %\<0.050\<LOQ\--103.7 %13BioferiaNDND\--78.7 %NDND\--77.3 %14BioferiaNDND\--117.6 %NDND\--91.7 %15Bioferia0.3500.0333.5%116.5 %0.4500.0242.2%119.2 %16Bioferia0.6600.0580.3%105.0 %0.4310.0341.8%118.9 %Threshold values[a](#tblfn0005){ref-type="table-fn"}0.1000.200Acceptance limits[b](#tblfn0010){ref-type="table-fn"}16.0 %75.0--120.0 %16.0 %75.0--120.0 %[^1][^2][^3]
For lettuce, the 16 markets also showed results lower than the CXS 193--1995 threshold values (0.200 mg/kg, fresh weight). The highest results for Cd were found in the same bioferias that had the highest Cd levels in tomatoes and markets from the North zone. Four markets showed no detectable results (two bioferias, one from the Central and one from the South zone).
The Pb quantification results ([Table 4](#tbl0020){ref-type="table"}) demonstrated that for tomatoes, 4 of the 16 markets sampled (25 %) had Pb content near or exceeding the CXS 193--1995 threshold values (0.100 mg/kg, fresh weight). Two markets had Pb in non-detectable concentrations, and the highest values were found in markets from the South zone and bioferias. In the case of lettuce, Pb results did not exceed the CXS 193--1995 threshold values (0.300 mg/kg, fresh weight), and the highest values were found in markets from the Central zone and one bioferia.Table 4Lead results in tomato and lettuce from 16 of the principal markets in Quito, Ecuador.Table 4MarketZoneTOMATO (*Solanum lycopersicum*)LETTUCE (*Lactuca sativa*)Lead content in samples \[mg/kg\] (dry weight)Lead content in samples \[mg/kg\] (fresh weight)RSD \[%\]Relative\
recovery \[%\]Lead content in samples \[mg/kg\] (dry weight)Lead content in samples \[mg/kg\] (fresh weight)RSD \[%\]Relative recovery \[%\]1South\<0.250\<LOQ\--93.9 %0.4990.0242.3%87.7 %2South2.3270.2090.5%115.6 %0.7870.0361.3%105.2 %3South0.5440.0521.0%103.9 %0.8080.0321.7%116.1 %4South0.8100.0790.3%88.0 %1.0050.0381.5%118.6 %5Central1.6370.1620.2%116.1 %1.1820.0600.2%82.3 %6Central0.9940.0911.6%90.6 %0.9960.0391.5%102.8 %7Central0.4720.0452.9 %95.5 %0.6360.0240.5%94.3 %8Central\<0.250\<LOQ\--86.1 %0.2540.0102.5%93.2 %9NorthNDND\--103.6 %NDND\--112.6 %10North\<0.250\<LOQ\--87.1 %\<0.250\<LOQ\--103.8 %11North\<0.250\<LOQ\--102.2 %\<0.250\<LOQ\--115.5 %12North0.4370.0412.7%103.3 %\<0.250\<LOQ\--108.4 %13Bioferia1.0180.1101.3%118.0 %1.0770.0661.1%99.2 %14Bioferia0.9380.0990.7%93.0 %\<0.250\<LOQ\--118.1 %15Bioferia0.5260.0531.3%94.8 %0.5570.0291.6%81.3 %16BioferiaNDND\--116.8 %\<0.250\<LOQ\--113.9 %**Threshold values**[a](#tblfn0015){ref-type="table-fn"}0.1000.300**Acceptance limits**[b](#tblfn0020){ref-type="table-fn"}16.0 %75.0--120.0 %16.0 %75.0--120.0 %[^4][^5][^6]
As mentioned, for tomatoes, the Pb concentration in 25 % of the samples was near or exceeded the corresponding suggested threshold value. These results could indicate an important source of Pb contamination and a possible hazard from the consumption of these and similar products, especially if consumption is high and frequent, which could increase the probability of health problems associated with Pb toxicity. The contamination level of food and the effectiveness of actions to reduce contamination should be assessed by monitoring, survey programs, and more specialized research programs where necessary \[[@bib0110]\]. In this sense, local health and commercial control authorities should monitor the contaminants in food products sold in the DMQ and other places in Ecuador to ensure their safety.
The quality control results were consistent with AOAC criteria \[[@bib0150]\]. For precision, considering the RSD values, the highest were 14.7 % and 2.9 % for Cd and Pb, respectively. The fortification relative recoveries were between 77.3 % and 119.3 % for Cd and between 81.3 % and 118.6 % for Pb. The recoveries of the certified reference material used were between 87.2 % and 98.1 % for Cd.
Considering the total amount of Cd and Pb in the tomato and lettuce samples, the markets from the North zone (9--12) had the lowest concentration of metals. The highest metal content was found in markets 2, 5, and 13, corresponding to the South and Central zones and one bioferia, respectively ([Fig. 1](#fig0005){ref-type="fig"}). This result shows that the metal content is unrelated to market location; rather, markets in the same zones had different results, which confirms that the tomatoes and lettuce sold differed in terms of origin.Fig. 1Total metal content (cadmium \[Cd\] and lead \[Pb\]) in tomatoes and lettuce from 16 principal markets in Quito, Ecuador.Fig. 1
Various studies related to these toxic metals' content in tomatoes and lettuce have been conducted in products from local markets in Ecuador and other countries. [Table 5](#tbl0025){ref-type="table"} shows the present study's results compared to those obtained by other studies.Table 5Ranges of cadmium and lead concentrations from studies conducted in different countries.Table 5CountryCadmium content (mg/kg)Lead content (mg/kg)ReferenceTomatoLettuceTomatoLettuceEcuador (Quito)0.009--0.0580.002--0.0340.041--0.2090.010--0.066The present study\<0.050--0.660[\*](#tblfn0025){ref-type="table-fn"}\<0.050--0.565[\*](#tblfn0025){ref-type="table-fn"}\<0.250--2.327[\*](#tblfn0025){ref-type="table-fn"}\<0.250--1.182[\*](#tblfn0025){ref-type="table-fn"}Ecuador (Quito)\--0.008--0.019\--0.0011--0.027\[[@bib0155]\]Ecuador (Quito)0.008--0.0240.004--0.0050.001--0.0040.031--0.273\[[@bib0160]\]Croatia (Varaždin)\--0.97--1.52[\*](#tblfn0025){ref-type="table-fn"}\--0.82--2.22[\*](#tblfn0025){ref-type="table-fn"}\[[@bib0005]\]Argelia\--26.99[\*](#tblfn0025){ref-type="table-fn"}\-\-\--\[[@bib0025]\]Chile (metropolitan region)\-\-\--\<0.014--0.057\<0.143--0.208\[[@bib0165]\]Brazil (Belo Horizonte)\-\-\--0.009[\*](#tblfn0025){ref-type="table-fn"}0.037[\*](#tblfn0025){ref-type="table-fn"}\[[@bib0095]\]Brazil (Pernambuco)\-\-\--\<0.01\<0.06\[[@bib0170]\]Spain (Barcelona)\-\-\--\<0.0050.0080--0.0244\[[@bib0175]\]Spain (Valencia)0.00550.009800.0038\[[@bib0225]\]India (Amravati)0.2[\*](#tblfn0025){ref-type="table-fn"}5.5[\*](#tblfn0025){ref-type="table-fn"}\-\-\--\[[@bib0180]\]India (Nashik)0.90[\*](#tblfn0025){ref-type="table-fn"}2.20[\*](#tblfn0025){ref-type="table-fn"}\-\-\--\[[@bib0185]\]India (Andhra Pradesh)0.0193\--0.3\--\[[@bib0230]\]USA (Florida) organic products0.000930.004950.014500.0120\[[@bib0190]\]USA (Florida) nonorganic products0.00430.007720.004870.0253Jamaica0.266\--0.021\--\[[@bib0220]\][^7]
In Carrillo Quezada's \[[@bib0155]\] study, lettuce samples from 30 DMQ markets showed slightly lower results than those from the present study for both Cd and Pb. Further, in a later study by Velasquez Paredes \[[@bib0160]\], in tomato and lettuce samples collected from two of the DMQ's main markets, the Cd results were also lower than the present study's in both vegetables. However, Velasquez Paredes \[[@bib0160]\] found Pb content in lettuce samples that was approximately four times higher than that found in the present study, whereas for tomatoes, the present study's Pb results were approximately 50 times higher. This heterogeneity in TM levels strongly suggests that determining a TM concentration trend is not possible since even within the same market, TM levels vary by vegetable and vegetable origin; therefore, frequent control of these contaminants in vegetables is needed.
The maximum Cd concentration obtained in tomatoes (0.660 mg/kg, dry weight) in the current study was three times higher than that reported by Mohod \[[@bib0180]\] from Amravati, India, but lower than that reported by Labhade \[[@bib0185]\] from Nashik, Murad Basha et al. \[[@bib0230]\] from Andhra Pradesh, India, and quite lower than that reported by Murad Basha et al. \[[@bib0220]\] from Jamaica. Further, the concentrations reported by Hadayat et al. \[[@bib0190]\] from Florida (USA) in both organic and nonorganic tomatoes were considerably lower than those from the present study, the same happened with the concentrations reported by Marín et al. \[[@bib0225]\] from Valencia. For Cd content in lettuce, the dry weight results obtained by the present study were largely lower than those reported in Croatia \[[@bib0005]\], Argelia \[[@bib0025]\], and India \[[@bib0185]\], but higher than the value assessed in Valencia \[[@bib0225]\]. This heterogeneity could be due to several external factors that could affect the TM content in natural products, such as the initial metal content in the crop soils and the environmental pollution near the cultivation sites.
The Pb results in lettuce samples for the current study showed values that were similar to those from Croatia \[[@bib0005]\], Brazil \[[@bib0095]\], Chile \[[@bib0165]\], and Spain \[[@bib0175]\]. In the case of tomatoes, the Pb concentrations obtained by the present study were higher than all the international studies in [Table 5](#tbl0025){ref-type="table"}, except from the mining area of India (Andhra Pradesh) \[[@bib0230]\], which clearly demonstrate the possible toxicity of Ecuadorian tomatoes, especially those from the four markets where the samples exceeded the CDX 193-95 threshold values \[[@bib0110]\]. A study conducted by Silva et al. \[[@bib0195]\] demonstrated that even with low Pb concentrations, genotoxic effects in plants occur, as proven by the increase in the number of micronucleated cells and of DNA fragmentation.
When comparing the results between nonorganic and organic crops (bioferias), considering the values from the present study and those reported by Hadayat et al. \[[@bib0190]\], the metal content is completely different. Hadayat et al. \[[@bib0190]\] describe that in the analyses of organic market products, the TM concentration was lower than that found in nonorganic crops; the authors suggest this is due to the non-use of metal-based pesticides. In the present study, the samples from organic markets (bioferias) had Cd and Pb content in tomatoes and lettuce greater than that from the other three market groups selling nonorganic products. Further, the Cd content found by the present study and the results of Hadayat et al. \[[@bib0190]\] are contradictory. There has been a significant increase in consumer demand for organic products, which are marketed as such because of the relatively low use of chemicals in their cultivation and less processing. Nevertheless, a superior nutritional content and lower presence of toxins (TMs) that contribute to the safe consumption of these products have not yet been fully demonstrated. Proximal analyses of macro and micronutrients have shown a low nitrogen content in organic crops, but evidence in relation to other nutrients and contaminants is lacking \[[@bib0200]\].
Furthermore, the high levels of Cd and Pb in Ecuadorian vegetables may be because Ecuadorian soils are rich in some metals, including Cd and Pb \[[@bib0205],[@bib0210]\]; this natural presence contributes to their incidence in crops. In addition, one general organic cultivation practice involves using the residue from the previous generation of plants as fertilizer; thus, all the metal content present in the leaves, stems, and other parts of the harvested plants is reincorporated into the soil, which replaces mineral nutrients for the next generation's growth.
Moreover, even when urban agriculture plays an important role in cities' sustainable food supply, the products need to be monitored and regulated because not only TMs but also other toxic substances from air pollution and soil contamination could be present \[[@bib0095]\]. Currently, industrial and motor vehicle emissions are one of the main sources of air pollution identified in urban sites, including big cities. These pollutants can be present in the particulate matter of air emissions and eventually be deposited in the soil and plants \[[@bib0170]\].
Adopting soilless cultivation systems that include good management practices can reduce crop soil contamination. In the last decade, the number of soilless cultivation systems in cities has increased because of the benefits they offer \[[@bib0175]\]. This distinct cultivation technique avoids the likelihood of the transference of contaminants and TMs from soils to vegetables, which is a long-term health and safety risk associated with urban agriculture. Dala-Paula et al. \[[@bib0095]\] found a significant positive correlation between Cd in lettuce and in soil; in the case of Pb, even when soil concentrations varied, its low mobility made no significant difference in the metal intake of plants. Contrary to this, in the present study, higher concentrations of Pb were found, and this could be related to the presence of this element in the atmosphere.
In cities like the DMQ, especially in locations in or near mountains, the natural presence (from volcanic eruptions, the weathering of rocks, and erosion) of contaminants like TMs can lead to high concentrations in soils. Adding to this natural presence are anthropogenic activities like irrigation; the use of fertilizers, pesticides, and sludge applications; industrial activities; solid waste disposal; mining; smelting; vehicular exhaust; and domestic and agricultural use of metals and metallic compounds \[[@bib0215]\]. All of these may necessitate the application of protocols for the cultivation, production, and transportation of agricultural products as well as education regarding possible sources of contamination and ways of mitigating the danger.
4. Conclusions {#sec0035}
==============
As no local studies have been conducted related to the content of Cd and Pb in tomatoes and lettuce sold in the main markets of all the different areas of the DMQ, this research is the first to determine the levels of these metals in products of daily consumption.
Although the results showed that in most of the cases, the TM concentrations were lower than the threshold values, their presence in agricultural products in Ecuador should still be considered. In the case of tomatoes and lettuce, TM contamination is not overtly related to agricultural and transportation processes; therefore, the TM content found in these products is assumed to be from soil contamination. This information needs to be considered by farmers so remediation techniques that reduce TM presence in their crops can be utilized. Further, Ecuadorian agricultural authorities should implement control mechanisms to ensure that food contaminants are within the maximum limits established in national and international regulations.
In addition, the controversy involving organic versus nonorganic agricultural products continues; nutritional information, toxicity levels, and even pricing of organic products are not fully supported by scientific evidence. The results of the present study show that in fact the organic products, which are considered "healthier" than nonorganic products, in most of the cases had higher concentrations of Cd and Pb.
In view of this study's findings, more research should be conducted that not only analyzes the TM content in foodstuffs but also tracks pollution in the soil, water, and air. In addition, it is necessary to carry out studies focused on the differences between organic and nonorganic crop nutrients and the possible effect of contaminants like TMs on these nutrients.
Funding {#sec0040}
=======
This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.
CRediT authorship contribution statement {#sec00005}
========================================
**David Romero-Estévez:** Conceptualization, Methodology, Software, Validation, Formal analysis, Investigation, Data curation, Writing - original draft, Writing - review & editing, Visualization. **Gabriela S. Yánez-Jácome:** Writing - review & editing, Visualization. **Karina Simbaña-Farinango:** Formal analysis, Investigation. **Pamela Y. Vélez-Terreros:** Formal analysis, Investigation. **Hugo Navarrete:** Conceptualization, Resources, Supervision, Project administration, Funding acquisition.
Declaration of Competing Interest
=================================
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
The authors would like to thank the Pontificia Universidad Católica del Ecuador for the total funding of this research.
[^1]: RSD: Relative standard deviation; \<LOQ: lower than the limit of quantification; ND: Not detectable.
[^2]: FAO/WHO. General Standard for Contaminants and Toxins in Food and Feed CXS 193--1995 (Revision 2019).
[^3]: AOAC. Guidelines for Single Laboratory Validation of Chemical Methods for Dietary Supplements and Botanicals.
[^4]: RSD: Relative standard deviation; \<LOQ: lower than the limit of quantification; ND: Not detectable.
[^5]: FAO/WHO. General Standard for Contaminants and Toxins in Food and Feed CXS 193--1995 (Revision 2019).
[^6]: AOAC. Guidelines for Single Laboratory Validation of Chemical Methods for Dietary Supplements and Botanicals.
[^7]: Dry weight.
|
Ayatollah Khamenei stresses unity among Muslim states
Leader of the Islamic Revolution Ayatollah Seyyed Ali Khamenei has underscored the need for unity among all Muslim countries amid enemy plots to create rift in the Islamic Ummah.
Addressing a group of Iranian Hajj officials in Tehran on Tuesday, Ayatollah Khamenei described Islamic unity as “the Islamic Republic’s fundamental slogan”, which means that Muslim states should set aside enmities and stand by each other vis-à-vis important global issues.
The Leader further described Hajj pilgrimage as an opportunity that must be seized in order to foil enemy plots, which are hatched to separate Iran from the rest of the Muslim world.
“Raising a barrier between the Islamic Republic [of Iran] and the rest of the Muslim world is one of the ploys [used by] the enemies of unity in the Islamic Ummah,” the Leader stated, adding that every Muslim is obligated to make efforts to help raze this “fake barrier.”
The annual pilgrimage of Hajj brings millions of Muslims together from a variety of nationalities, races and sects.
Hajj, as one of the world’s largest gatherings, is a demonstration of the solidarity of the Muslim people and their submission to God. Hajj rituals take place during six days (8th-13th) of the Islamic lunar month of Dhul-Hijjah. |
Q:
There is not the set of all compactification.
Definition (0)
Let be $X$ a topological space. So a pair $(h,K)$ is a compactification of $X$ if $K$ is a compact space and if $h:X\rightarrow K$ is an embedding of $X$ in $K$ such that $h[X]$ is dense in $K$. Moreover a compactification $(h,K)$ of $X$ is a $T_2$ compactification if $K$ is a Hausdorf -compact- space.
Achtung (1)
In the previoius definition many authors require that $K$ must be Hausdorff!
Statement (2)
There is not the set of all compactification
Proof. Using the previous definition it's possible to show that any topological space has at least one compactification -its Alexandrov compactification: here the proof. So if there exist the set of all compactification it would contain the set of all set, since infact any set $X$ can organise as a topological space and $X\subseteq X^\infty$.
Well I have this trouble: using the definition of my text -see the lemma (4) here- we can use the Alexandrov compactification only on not compact spaces and so the proof of the previous statement would be valid iff for any set $X$ there exist a not compact topology. Furthermore if in the definition (0) I require that $K$ must be $T_2$, then the statement (2) it is still true?
Could someone help me, please?
A:
If $X$ has one compactification $(h,K)$, only demanding $h[X]$ dense in $Y$ and $h$ an embedding into $Y$, and $Y$ compact (without Hausdorff), then there is no set of compactifications of $X$, because for any set $Z$ such that $|Y| = |Z|$, we can transport the topology and $h$ to $Z$ too and get (an essentially the same) compactification of $X$: if $f$ is a bijection from $Y$ to $Z$, define a topology on $Z$ by $\{f[O]: O \in \mathcal{T}_Y\}$ and define $h' = f \circ h$ and then $(h',Z)$ is as required. And it is well-known that for any non-empty set, there is no set of all sets with the same cardinality. That's why cardinal numbers were invented, essentially.
Any any space $X$ has a trivial compactification $Y=X\cup \{\infty\}$ where the topology on $Y$ is given by $\mathcal{T}_X \cup \{Y\}$ and $f(x)=x$ is the embedding. (The only open set covering $\infty$ is $Y$ so any cover of $Y$ has a one-element subcover, and denseness of $X=f[X]$ in $Y$ is also trivial for the same reason.)
So for any non-empty $X$ (locally compact or not, Hausdorff or not, compact or not) there is no set of all compactifications of $X$ for trivial set theory reasons.
And if $Y$ has to be Hausdorff then $X\neq \emptyset$ has a compactification iff $X$ is Tychonofff, so for a non-Tychonoff space there is a set of compactifications, namely the empty set. If $X$ is Tychonoff there is always at least one, so not set of them.
|
The excitement for Back to the Future Day continues with a tease of another documentary about one of the most integral parts of the time traveling adventure. The DeLorean time machine from Back to the Future is one of the most iconic vehicles in cinema history, but for some reason, the primary car used during the production of the film trilogy was left to fall apart on the backlot of Universal Studios. It sat in the rain for years, fans would sneak onto the lot and steal parts from it, and the car seemed destined for the junkyard.
But Back to the Future writer Bob Gale wasn’t prepared to let the original DeLorean be erased from existence, and he had a restoration team assembled to bring the car back to its former glory. The work, which lasted over two years, is chronicled in the Outatime trailer, a documentary about the saving of this film legend.
Outatime started with a Kickstarter campaign for a feature-length documentary about the restoration of the DeLorean time machine, and that version of the film is still being worked on by director and producer Steve Concotelli. However, if you happen to be picking up the new 30th anniversary box set for Back to the Futurecoming on October 20th, a 20-minute featurette version of the doc will be part of the special features on that release.
The Kickstarter page for the project touted some pretty cool names for talking heads including Bob Gale, John Murdy (creative director of Universal Studios), Michael Scheffe (construction coordinator), Michael Lantieri (special effects supervisor), Kevin Pike (special effects supervisor), members of the Restoration Team and more. Their insight is the key to making this much more than an episode of a car restoration show you might see on television. Here’s a nice description of the film from the campaign page:
What makes this story unique is how the restoration was accomplished. The Time Machine wasn’t restored by a studio or an auto body shop. Instead, Universal Studios boldly decided to have FANS restore the car. Fans with the knowledge, passion and the obsessive attention to detail that the Time Machine deserved!
So, Bob Gale hired Joe Walser – who assembled a team of the biggest “Back to the Future” fans and the best Time Machine builders in the world. Together, they had one goal – restore the car with 100% accuracy. Every wire. Every detail. Exactly like it was in the movie.
We’re not sure when the final feature film version will get released. But as huge fans of Back to the Future, we’ll be keeping our ear to the ground for release information. In the meantime, fans can look forward to the Back to the Future documentary Back in Time, premiering at the We’re Going Back 30th anniversary celebration in California, and hitting VOD the same day. |
Copy slackarchive/config.yaml.sample to slackarchive/config.yaml, and replace all the values within {...} with the appropriate values you want. Any place with a token or key, ensure those are random. You can generate a random value on the command line with bash using the following command: openssl rand -base64 8 |md5 |head -c24;echo (if you have OpenSSL) or without ping -c 1 yahoo.com |md5 | head -c24; echo. We avoid using /dev/urandom in case you are not using a UNIX-based machine.
Follow the same instructions as above for slackarchive-bot/config.yaml.sample. Ensure you put the config file in the same folder as where the sample file is.
Make sure you change at least the password (and ideally the username) of the MongoDB user in mongodb/docker-entrypoint-initdb.d/slackarchive.js. By default, the user is slackarchive and the password is 1234. NOTE: if you change these, you must update the values in the other two configuration files, AND change the MongoDB URI/URL string in the docker-compose.yaml file under the slackarchive directive.
If you want additional security, change the MongoDB root username and password in the docker-compose.yaml file under the mongodb directive and environment variables.
With all of these configuration options updates, you should now be able to start SlackArchive using the following commands: |
There is a general misconception that the initial voltage defined for a utility or a swing bus generator is the initial operating voltage at the connected bus. The initial voltage is actually the internal voltage before the source impedance.
For Load Flow calculation, if the “Include Source Impedance for Utility and Swing Generator” option in the load flow study set up is checked, an internal generator impedance branch is created, one side of this branch is the source bus, the other side is the internal bus of the source, the voltage of this internal source bus will be the constant defined as this initial voltage. If this option is unchecked, the voltage of the source bus will be the constant as this initial voltage. |
House lawmakers approved a measure that critics said would criminalize voter registration efforts as the largest group of protesters this year gathered at the state Capitol..
The measure, backed by Secretary of State Tre Hargett, would require groups leading voter registration efforts to undergo training and potentially face fines for submitting too many incomplete forms.
Critics of the proposal have questioned its intentions, noting it comes after an effort to register more African American voters and people of color during the 2018 midterm elections.
After two protesters were removed while the chamber considered the bill, the House approved it along party lines, with a 71-26 vote.
Hargett's office has said the bill is needed after thousands of late-filed registration forms created difficulties for local officials, in part because many incomplete documents were filed.
The bill specifically requires groups organizing voter registration drives to undergo training and forces them to hand in completed documents in a timely manner.
The legislation also seeks to assess a civil penalty against groups that turn in more than 100 deficient voter registration applications.
Amendment limits ability to penalize voter-registration groups
Rep. Tim Rudd, R-Murfreesboro, amended the legislation on the floor to limit the ability to assess such penalties against groups.
Mark Goins, the state's elections coordinator, later noted that only groups that had a paid employee who oversaw a voter registration drive could face a penalty.
Goins added if someone turned in more than 100 deficient forms, they could only face a civil penalty.
"No one is going to be liable criminally for turning in a form that lacks information," he said.
Under the bill, a criminal penalty could be assessed if a group leading a registration drive does not take the required training.
As the bill made its way through the legislature, the penalty provision led to significant opposition from voter registration groups, ranging from the League of Women Voters to the Equity Alliance and Tennessee Black Voter Project, which registered thousands of African American voters last year.
As members entered the House chamber on Monday, they were faced with nearly 100 protesters who chanted, "Vote no or you must go."
Speaking to Rep. Micah Van Huss, R-Jonesborough, Tequila Johnson, co-founder of the Equity Alliance, said the bill represented voter suppression and racism.
"(This bill) discourages people from volunteering in the Volunteer State," she said.
The group of protesters said those who voted in favor of the legislation would face action at the ballot box.
"We will get you out," Johnson declared. "We will come for your seats."
The protests continued inside the House chamber as members considered the legislation during a lengthy session that at one point was interrupted by someone in the gallery yelling.
Two people were eventually removed by state troopers, who said the protesters were being disruptive.
The majority of the protesters, however, stood silently while waiving signs as the House deliberated.
On Monday afternoon, the governor told reporters the most important thing for him is to ensure the state has free and fair elections and a process that encourages people to engage.
"We'll look and see if this bill does that," Lee said, declining to answer a question on whether there should be more restrictions placed on the voter registration process.
The Senate version of the bill could be taken up in the chamber as early as later this week.
VOTER REGISTRATION:Voter registration groups could face fines for too many incomplete forms under new bill
LEAGUE OF WOMEN VOTERS:Tennessee should improve voter registration drives not criminalize them. Kill bill that would do that.
DEMOCRATIC OPINION:Senate should pause before criminalizing voter registration
TRE HARGETT:Tennessee must reform voter registration drive laws to preserve election integrity
Want to read more stories like this? A subscription to one of our Tennessee publications gets you unlimited access to all the latest politics news, podcasts like Grand Divisions, plus newsletters, a personalized mobile experience and the ability to tap into stories, photos and videos from throughout the USA TODAY Network's 109 local sites.
Reach Joel Ebert at jebert@tennessean.com or 615-772-1681 and on Twitter @joelebert29. |
María de los Ángeles Pineda Villa
María de los Ángeles Pineda Villa is the former first lady of Iguala, a city in Guerrero, Mexico. Pineda Villa and her husband, José Luis Abarca Velázquez were accused by Attorney General of Mexico Jesús Murillo Karam of the "probable masterminds" behind the 2014 Iguala mass kidnapping and disappearance of 43 students from the Ayotzinapa Rural Teachers' College. Pineda Villa and her husband fled hours after the reported abductions and were arrested by federal authorities on November 4, 2014. The prosecution's investigation indicates that Mayor Abarca ordered local police to stop the students from protesting a political event and speech Pineda Villa was scheduled to hold. The police allegedly attacked the students' buses when they entered Iguala and then delivered them to members of the local drug gang, Guerreros Unidos. Along with her familial ties to the Sinaloa Cartel and Beltrán-Leyva Cartel, confessions by detained gang members and police officers have revealed Pineda Villa as the "principle operator" of the Guerreros Unidos.
Family and early ties to organized crime
María de los Ángeles Pineda Villa is the daughter of Salomón Pineda Bermúdez and Maria Leticia Villa Ortuño. She has four brothers: Julio Guadalupe, Mario Antonio, Salomón and Alberto.
Salomón, or "El Malon" and his brothers, Mario "El MP" and Alberto "El Borrado", have operated as drug traffickers in Guerrero and Morelos since 2002. After operating independently as drug dealers in Guerrero, the brothers formally joined the Sinaloa Cartel in 2002. Under the orders of Arturo Beltrán Leyva, they were placed in charge of operations in Zihuatanejo and other areas of Guerrero, as well as the state of Morelos. The Pinedas trafficked drugs, primarily cocaine, coming from Colombia and Venezuela to Guerrero. In 2005, under the instruction of the Sinaloa Cartel, the brothers formed a group of 200 hitmen called the "Los Pelones" to control Guerrero and defend against attacks by rival cartels, such as the Los Zetas and La Familia Michoacana. The "Los Pelones" are believed to be the predecessor of the Guerreros Unidos.
In 2006, the Mexican Drug War began under President Felipe Calderón's administration, which involved a crackdown on drug trafficking organizations by Mexican authorities. In March 2009, Mexico's Office of the General Prosecutor (Procuraduría General de la República, PGR) named Alberto and Mario Antonio Pineda Villa in their list of the most wanted drug traffickers. In May 2009, five members of the Pineda Villa family were arrested by the PGR in Morelos: Alberto, Mario, Salomón and their parents, Salomón and Maria. In September 2009, Alberto and Mario were murdered for their betrayal of Arturo Beltrán Leyva. In December 2009, kingpin Arturo Beltrán Levya was killed during a shootout with Mexican Marines in Cuernavaca, Morelos. His death caused the Beltrán-Leyva Cartel to break up into smaller independent organizations, led by former Betrán Leyva operators. This included the Guerreros Unidos, led by Salomón "El Malon" Pineda Villa, in the Guerrero and Morelos states.
Political history
María de los Ángeles Pineda and her husband, José Luis Abarca Velázquez, met in Guerrero and built their wealth selling gold and jewelry. After accumulating a number of local businesses, they came into contact with local political bigwigs in Iguala who then tapped Abarca to enter a mayoral contest. Despite having no previous political experience, the businessman won the election and became Mayor of Iguala in June 2012. Mayor Abarca and Guerrero's Governor, Ángel Aguirre, were both members of the Party of the Democratic Revolution (PRD) in opposition to President Enrique Peña Nieto's Institutional Revolutionary Party (PRI).
In 2013, Abarca was accused of killing a local community organizer and fellow PRD member, Arturo Hernández Cardona, and two fellow leftist activists the day after an argument at a city council meeting. Hernández's wife, Iguala city councilwoman Sofia Mendoza, gave a statement to state authorities, but they failed to investigate the allegations against Abarca.
Evidence suggests that state officials, namely Governor Ángel Aguirre of Guerrero, were aware of Mayor Abarca and Maria Pineda's criminal ties. On October 13, 2014, a video was posted online of a blindfolded and tied woman who identified herself as Maria Leonor Villa Ortuña, the mother of María de los Ángeles Pineda and mother-in-law of Mayor Abarca. Along with detailing her family's criminal history and ties to the Beltrán-Leyva cartel, the woman claims that her sons funded Ángel Aguirre's 2011 campaign for governor on behalf of the Beltrán-Leyva cartel.
While her husband held the mayoral position, many have claimed Pineda Villa's forceful presence at City Council meetings was evidence that she was the one "calling the shots" in terms of political decisions. In fact, at the time of the disappearances, she had already been tapped by Abarca's PRD party to run as the next mayor of Iguala. While the event scheduled on September 26, 2014 was supposedly to celebrate her role advancing Iguala's welfare program, many believe it was actually the unofficial start of her mayoral election campaign.
Iguala disappearances, investigation and arrests
On September 26, 2014, around 100 male student teachers from the round 100 students from Ayotzinapa Rural Teachers' College travel by bus through the town of Iguala on their way to a demonstration in Mexico City. That night, municipal police in Iguala confront the students and open fire against them. Three students and three by-standers were killed and 43 students are forcibly disappeared as a result.
On September 28, 2014, Guerrero State’s Attorney General opens an investigation into the mass kidnapping and killings. Iguala authorities arrest 22 local police officers and name the cartel Guerreros Unidos responsible for the crimes.
On October 1, 2014, Mayor Abarca and María Pineda Villa go into hiding.
On October 17, 2014, Mexico's Attorney General Murillo announced the arrest of who he deemed the "supreme leader" of the Guerreros Unidos cartel, Sidronio Casarrubias Salgado. In his interrogation, Casarrubias told authorities that Maria Pineda ordered the Guerreros Unidos to "make an example" of the missing students and identified her as the leader of the local police and the gang's highest-ranking member in government.
On October 23, 2014, following political pressure and international outrage over the disappearances, Governor Aguirre resigned.
On November 4, 2014, Major Abarca and María Pineda Villa are arrested in Mexico City and Abarca is sent to a maximum security prison.
On January 5, 2015, María Pineda Villa is transferred from house arrest to the maximum security prison of "El Rincon"in Tepic, Nayarit. She has been charged with federal crimes of organized crime and conducting operations with illicit funds.
References
Category:Organized crime in Mexico
Category:Mexican Drug War
Category:Forced disappearance
Category:Corruption in Mexico
Category:Sinaloa Cartel traffickers
Category:Kidnapping in Mexico
Category:Mexican women in politics |
In Episode 5 of Sixers 365, Sixers.com's Max Rappaport and 97.5 The Fanatic FM's Brian Seltzer discuss Nerlens Noel's breakout performance, the emergence of Robert Covington, the team's upcoming West Coast road swing, and more.
Make sure to subscribe via iTunes.
*If using our mobile app, please click "view in browser" |
× Thanks for reading! Log in to continue. Enjoy more articles by logging in or creating a free account. No credit card required. Log in Sign up {{featured_button_text}}
STEVENSVILLE — Call them mustangs. Or brumbies. Just don’t call the wild horses of the Sapphire Mountains invaders.
“They’re remnants from the time when the Salish had horses here,” said SuZanne Miller, who often sees the elusive bands from her ranch on the Bitterroot River. “All horses in North America are from feral stock brought over by the Spanish. These have been added to by various escapes from local horse owners. But most are born in the wild at this point.”
About 50 horses wander the forests between the Bitterroot and Rock Creek. Rarely seen in the summer, they often gather on the grasslands of the MPG Ranch east of Stevensville in winter. Some travel in bands of 10 or a dozen, while a few lone stallions or bachelor tandems keep more to themselves. They display a grab-bag of varieties, including draft, palomino, pinto, quarter and rodeo rough stock.
They also display an attitude unlike any other wild herbivore in Montana. Gifted with great strength and speed, wild horses will investigate newcomers where deer and elk bolt for cover. That gives them confidence to display curiosity in disconcerting ways.
“There’s a real consciousness in there,” MPG Ranch video supervisor Alan Ramsey said of his encounters with inquisitive horses. “They send out sentries who figure out how the rest of the band should react.”
Wild horse bands differ from other wildlife in remarkable ways. They have complex social structures, with alpha stallions and mares topping a pecking order. The stallions stay with the band year-round, unlike bucks and bulls that often hang in bachelor herds. That gives horses a better defense against predators such as mountain lions, wolves and bears.
They fill a unique niche in the landscape as well. Their full hooves make them the best ice-breakers in the woods, and other species benefit from their ability to open water holes in winter. They also have better teeth for nipping dried grass and brush than elk do.
“They can bite off the two- and three-year-old dead leaves on bunch grass that elk won’t touch,” Ramsey said. “That stuff’s useless to elk until a fire or a horse takes it off.”
A 2014 study Ramsey and Katharine Roggeveen produced for MPG Ranch cataloged the extensive history of wild horses in the Bitterroot Valley. In their compilation, they started by observing North America’s original horse species was about the size of a house cat. The continent’s pre-ice age horse fossils turned up in digs in the Bighorn Basin of Montana and Wyoming dating to 55 million years ago.
Around 4.8 million years ago, the Equus simplicidens ancestral horse appeared and eventually split into zebras, asses and modern horses. A large concentration of horse fossils has been explored near Hagerman, Idaho. A Pryor Mountain cave in Montana produced a horse bone dated to 13,860 years ago. However, archaeologists conclude that those horses died out of North America around 10,000 years ago during the end of the last ice age. While some remains in Alberta and Texas appear to date between 1,000 and 8,000 years ago, most researchers agree modern horses didn’t return to North America until Spanish settlers brought their mounts from Europe in 1519.
Shoshone Indians appear to be the first tribe to acquire horses in the Northwest, shortly after 1690. The Bitterroot Salish probably got their first herds from the Shoshone sometime between 1700 and 1730. Lewis and Clark reported trading horses with a party of Salish Indians in 1805: “Those people possess ellegant horses (sic).”
Stevensville historians reported that Blackfeet raiding parties often tried to acquire Salish horses in the Bitterroot Valley, where at times at least 4,000 were pastured. A note by the Florence Civic Club mentioned the presence of “wild” horses in the Eight Mile and Woodchuck hills in the 1880s. In 1891, Chief Charlo’s community of Bitterroot Salish made their forced relocation to the Flathead Indian Reservation on Oct. 15, 1891 in a mile-long procession, with several hundred horses.
The wild horses appeared in local news accounts throughout the 1900s. Rodeo promoter Oral Zumwalt had a 12,000-acre ranch in Miller Creek at the southern end of the Missoula Valley and often let his rodeo stock winter in the Sapphire Mountains there. After complaints from other ranchers who said their grazing land was overrun by the rodeo and wild horses, the state Livestock Commission conducted an aerial roundup on the neighboring Shroeder (now MPG) Ranch. Using a dozen helicopters, the wranglers were able to corral 100 of the estimated 240 horses running loose. Three-quarters of those turned out to be branded and were returned to their owners or sold at auction.
Reg Kesler took over Zumwalt’s operation in 1962 and continued to hold rodeos in Miller Creek until he closed shop in 1995. An estimated 30 to 40 wild horses continued to hold out in the Sapphires.
In 1981, then-Ravalli County Sheriff Dale Dye investigated the shooting of 18 wild horses northeast of Florence. That built on several other tales of Bitterroot residents prowling the hills seeking horses for impromptu bucking contests, ranch mounts and mischief.
That illustrates the wild horse’s odd legal status. The Wild Free-Roaming Horses and Burros Act of 1971 makes all unbranded and unclaimed horses on U.S. public lands wild animals, and prohibits their removal, killing or domestication. The Bureau of Land Management has responsibility for them on federal land. However, Montana law does not acknowledge the existence of wild horses, and prohibits abandoned or stray horses from running at large. Montana Fish, Wildlife & Parks has little to do with them, as they don’t classify as either a big-game or a non-game animal.
“Most of the desire to control them has come from the ranching community,” Miller said. “They can be hard on fences, and they do compete with cows for grass. But it’s a lot less so now because of the change in land ownership here. There are fewer people in the cattle industry. I tell people we have a wild horse herd across the river, and they just roll their eyes.”
Love 36 Funny 1 Wow 2 Sad 1 Angry 4 |
/*-
* -\-\-
* styx-client
* --
* Copyright (C) 2016 - 2017 Spotify AB
* --
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
* -/-/-
*/
package com.spotify.styx.client;
import com.spotify.styx.model.TriggerParameters;
import com.spotify.styx.model.WorkflowInstance;
import java.util.concurrent.CompletionStage;
/**
* Interface for Styx client, scheduler resources.
*/
public interface StyxSchedulerClient extends AutoCloseable {
/**
* Trigger a {@link WorkflowInstance}
*
* @param componentId component id
* @param workflowId workflow id
* @param parameter parameter
*/
CompletionStage<Void> triggerWorkflowInstance(String componentId,
String workflowId,
String parameter);
/**
* Trigger a {@link WorkflowInstance}
*
* @param componentId component id
* @param workflowId workflow id
* @param parameter parameter
* @param triggerParameters additional parameters for the {@link WorkflowInstance}
*/
CompletionStage<Void> triggerWorkflowInstance(String componentId,
String workflowId,
String parameter,
TriggerParameters triggerParameters);
/**
* Trigger a {@link WorkflowInstance}
*
* @param componentId component id
* @param workflowId workflow id
* @param parameter parameter
* @param triggerParameters additional parameters for the {@link WorkflowInstance}
* @param allowFuture allow triggering future partition
*/
CompletionStage<Void> triggerWorkflowInstance(String componentId,
String workflowId,
String parameter,
TriggerParameters triggerParameters,
boolean allowFuture);
/**
* Halt a {@link WorkflowInstance}
*
* @param componentId component id
* @param workflowId workflow id
* @param parameter parameter
*/
CompletionStage<Void> haltWorkflowInstance(String componentId,
String workflowId,
String parameter);
/**
* Retry a {@link WorkflowInstance}
*
* @param componentId component id
* @param workflowId workflow id
* @param parameter parameter
*/
CompletionStage<Void> retryWorkflowInstance(String componentId,
String workflowId,
String parameter);
@Override
void close();
}
|
The ZnuABC operon is important for Yersinia ruckeri infections of rainbow trout, Oncorhynchus mykiss (Walbaum).
Signature-tagged mutagenesis was used to identify genes essential for survival of Yersinia ruckeri in its natural host, rainbow trout, Oncorhynchus mykiss. A mini-Tn5-Km2 signature-tagged mutant, C6-1, was missing from rainbow trout kidney at 7 days after an immersion challenge. The transposon insertion in C6-1 was in a homologue of the znuA gene of Escherichia coli that encodes ZnuA, a zinc-binding periplasmic protein of the high-affinity zinc transporter ZnuABC. Further sequencing of the C6-1 locus in Y. ruckeri identified homologues of two other genes: znuB, encoding a putative inner membrane permease, and znuC, encoding a putative ATPase. When present on a low-copy plasmid, the znuABC locus of Y. ruckeri fully restored growth of a zinc transport-deficient DeltaznuABC mutant of E. coli. Unlike DeltaznuABC mutants of E. coli and Salmonella typhimurium, the DeltaznuABC mutant of Y. ruckeri did not demonstrate significantly slower growth in zinc-deficient M9 minimal medium or in Luria-Bertani (LB) medium supplemented with the metal chelators EDTA and tetrakis-(2-pyridylmethyl)-ethylenediamine (TPEN). In LB medium, the znuA::lacZ and znuCB::lacZ transcriptional fusions of Y. ruckeri were derepressed by addition of EDTA and TPEN and were repressed by addition of zinc and manganese. In a competitive challenge by immersion, the DeltaznuABC mutant was unable to compete with the parental strain and survived poorly in rainbow trout kidney, indicating that the ZnuABC transporter has a role in establishing and maintaining a rainbow trout infection by Y. ruckeri. |
Sister Rosemary Nyirumbe has been hailed as a hero for her efforts in Uganda to educate girls and rescue those attacked by infamous warlord Joseph Kony and the Lord’s Resistance Army. In the video above, the beloved nun stresses the power of education and the importance of maintaining focus on helping and empowering the affected girls. |
Q:
A Test: Find the Missing Words!
Each of the following pairs of words is missing a word.
Find the missing words.
$$\def\T#1{\text{#1}}
\begin{array}{rl}
\T{A} & \T{DING}\\
\T{CAN} & \T{GAS}\\
\T{IN} & \T{ADS}\\
\T{LIFE} & \T{LESS}\\
\T{MARSH} & \T{SPICE}\\
\T{OUT} & \T{BACK}\\
\T{PREP} & \T{ANT}\\
\T{PRO} & \T{FISH}\\
\T{SCATTER} & \T{WILL}\\
\T{SEE} & \T{ME}\\
\T{TAX} & \T{LAND}\\
\T{TEE} & \T{REIN}\\
\T{UP} & \T{MAN}\\
\T{WHERE} & \T{EVER}\\
\T{WIN} & \T{HERE}\\
\end{array}$$
When you're done with that, ...
There's a word missing from the set of missing words you found.
What's the final missing word?
Why is it missing?
For full marks ...
What kind of test is this?
A:
The final missing word is...
their
Explanation: The missing words for each pair
...create new words when they're linked to each word they're inbetween, thusly:
A Men Ding [Amen, Mending]
Can To Gas [Canto, Togas]
In To Ads [Into, Toads]
Life Time Less [Lifetime, Timeless]
Marsh All Spice [Marshall, Allspice]
Out Come Back [Outcome, Comeback]
Prep Aid Ant [Prepaid, Aidant]
Pro Of Fish [Proof, Offish]
Scatter Good Will [Scattergood, Goodwill]
See The Me [Seethe, Theme]
Tax Is Land [Taxis, Island]
Tee The Rein [Teethe, Therein]
Up Country Man [Upcountry, Countryman]
Where For Ever [Wherefor, Forever]
Win Now Here [Winnow, Nowhere]
And these missing words...
combined are one word ('their') short of a known quote:
"Now is the time for all good men to come to the aid of their country."
Their is probably the odd one out because it's impossible to find a word that ends in 'their' (though there's kinda one that starts with it, 'theirselves'). And it's not in the original sentence, which was a typing exercise by Charles E. Weller ("Now is the time for all good men to come to the aid of the party") and an example of filler text (AKA placeholder\dummy text).
|
A general view of a building and a pier on Da Tay island in the Spratly archipelago January 6, 2013.
Image Credit: REUTERS/Quang Le
Archaeology and the South China Sea
A new maritime archaeology vessel is another component in China’s strategy for the South China Sea.
By Andrew S. Erickson and Kevin Bond for The Diplomat
July 20, 2015
Recently, Vietnamese and Western media resumed reporting on China’s HD-981 oil rig, after it was redeployed to disputed waters, dredging up memories of the intense anti-Chinese protests in Vietnam and the diplomatic standoff that occurred last year when the rig was moved to waters between Vietnam and China for the first time. The HD-981 oil rig gives China a mobile, economic platform from which to project its sovereignty in disputed waters, but what about a cultural-historical platform? Well, “they have a ship for that,” too, and its recent deployment in the Paracel Island chain went relatively unnoticed. The vessel in question is China’s first domestically designed and developed archaeological ship, and its deployment reflects China’s ability to rapidly introduce dedicated ships for virtually every function it desires.
In 2014, China officially launched its first archaeological vessel, the 950-ton, 56 meter-long Kaogu-01. Originally commissioned by the State Administration of Cultural Heritage (SACH) in 2012, primary construction on Kaogu-01 was completed by Chongqing Dongfeng Shipbuilding Corporation on January 24, 2014 at a total end cost of around 80 million yuan ($12.9 million). According to the Chongqing Youth Daily, the deployment of this ship marks the end of Chinese maritime archaeologists conducting their research from rented fishing vessels.
The ship’s high price tag is reflected in its facilities and tools, which are sufficiently plentiful and advanced for the local news in Qingdao to describe Kaogu-01 as “armed to the teeth.” The ship boasts an A-frame crane capable of hoisting up to 3 tons, a folding arm crane that can extend up to 6 meters past the edge of the ship, a dive workroom, a decompression chamber, an “air-lock chamber for excavated cultural relics,” and two food storage rooms. Some reports even claim that it boasts a submersible to facilitate underwater searches.
While it remains unclear which submersible, if any, Kaogu-01 might be equipped with, China’s deep-water submersible technology is quite advanced. In 2010, China became only the fifth country, after Russia, France, Japan, and the United States, to have a manned submersible capable of descending past the 1,000 meter mark. In 2012, China’s Jiaolong-01 7,000 meter manned submersible underwent its second round of tests, descending to a depth of 6,000 meters over 10 hours. China has also used submersible to execute underwater archaeological tasks in the past, using the Osprey-01 four-man submersible to explore underwater ruins in Fuxian Lake, Yuxi City, Yunnan Province in 2001.
Kaogu-01 is powered by an electric motor capable of reaching speeds up to 12 knots. In addition, the ship can carry supplies sufficient for up to 30 days’ continuous operation. To increase stability and thereby minimize strain on the crew, the ship’s center of gravity has been lowered. It also sports an “anti-rolling tank” that can be adjusted to allow the ship to withstand winds of up to 75 km/h and waves up to 5.5 meters high, up to 8 on the Beaufort scale.
Kaogu-01’s first opportunity to use these facilities came during its first deployment, shortly after the ship’s maiden voyage ceremony in Qingdao last September, when it sailed to Dongkengtuo shipwreck about 48 kilometers off the coast of Tangshan, Shandong province, to conduct archaeological tests. On April 13 this year, Kaogu-01 began its second large-scale mission, departing Wenchang City in Hainan Province on a 45-day expedition to Shanhu (Pattle) Island in the Paracels, the site of a naval battle in the 1974 conflict between China and South Vietnam over the islands and still contested by Vietnam. The relative quiet from Vietnam compared with the commotion that accompanied the oil rig last year at first seems strange, but could stem from Vietnam prioritizing among its concerns, particularly given the usually less-politicized nature of maritime archaeology. However, things may be heating up even here as China rapidly develops its maritime archaeology industry.
Maritime Archaeology Boom
Kaogu-01 represents the latest big step in what has been a rather active decade for Chinese domestic maritime archaeology, a field that has developed rapidly since its beginnings in China around 1987 with the establishment of the Center for Underwater Archaeology at the present-day National Museum of China in Beijing. Two years later, China conducted its first underwater archaeological survey. Since then, more than a dozen shipwrecks have been excavated, and a large number of other potential sites have been identified.
Before this latest trip to Shanhu Island, China’s carried out large-scale underwater archaeological excavations at Sandaogang shipwreck off of Liaoning Province from 1992-97, Wanjiao-01 and Daliandao shipwrecks off Fujian province in 2005 and 2007, Huaguangjiao (Discovery Reef) in the Paracels in 2007 and 2008, and Nan’ao-01 shipwreck off the coast of Guangdong province between 2010 and 2012. In addition, the Nanhai-01 shipwreck, found off the coast of Guangdong province in 1987, was moved to a specially constructed museum in 2007, where it continued to undergo excavations in 2009.
All of these shipwrecks contained numerous porcelain specimens in their holds, such as plates, bowls, and cups. According to analysis of their cargoes, most were bound for Southeast Asia, with the exception being the Sandaogang shipwreck, which was supposedly bound for Korea. These wrecks provide much evidence for examining maritime trade between China and others in the region, which appeared to thrive during most of China’s history. In Japan, Chinese junks became revered by urban merchants in the 18th century as talismans of abundant trade.
Amid this rapid growth in maritime archaeology, China’s SACH founded the China Center of Underwater Cultural Heritage Protection (CCUCHP) in 2009. Since its founding, CCUCHP has been working with other departments, including the Ministry of Foreign Affairs, the Ministry of Science and Technology, the Ministry of Public Security, the Ministry of Transport, and the State Oceanic Administration, to create a “National Underwater Cultural Heritage Protection Team,” which has coordinated missions and other tasks such as symposiums, meetings, and research.
In addition, a regional underwater archaeological research and preservation center has been established in Jinan, Shandong province. Perhaps most interesting, however, are two constructions in the South China Sea area currently being planned. The first is a National Underwater Cultural Heritage Protection South China Sea Base, the feasibility report for which was recently approved by the State Development and Reform Commission. This base, likely to be located in Lingshui County, Hainan, aims to centralize all South China Sea cultural heritage investigations, training, and research under one national-level organization. The second is the planned construction of a Paracel Islands Underwater Archaeology Work Station on Yongxing* (Woody) Island in the Paracels.
China’s archaeological work in disputed islands also extends to the Spratly Island chain, which it disputes with the Philippines, Malaysia, Brunei, and Taiwan. China has identified roughly 200 different underwater “cultural heritage sites” between the Spratlys and the Paracels, and has been conducting archaeological explorations in the Spratlys since at least 2013.
Maritime archaeology seems like an innocuous enough field. Yet Kaogu-01’s deployment close to the site of a battle between China and Vietnam in an island chain still claimed by the latter, as well as ongoing archaeological work in the disputed Spratly Island chain, indicate that China may see a secondary, political purpose in expanding its maritime archaeological industry, namely strengthening China’s claims to disputed areas in the South China Sea.
Hunting for Buried Sovereignty
China’s current claims in the South China Sea revolve around its nine-dash line, encircling both the Paracel and Spratly Island chains, which are also claimed by several of China’s neighbors. In addition, this line comes into direct conflict with several exclusive economic zones (EEZs) claimed by China’s neighbors under UNCLOS. China’s dispute with the Philippines is currently the subject of international litigation at the Permanent Court of Arbitration, although China does not recognize the court’s legal authority and is, therefore, not participating. However, despite not recognizing the authority of the Permanent Court of Arbitration to which the Philippines submitted the case, China nevertheless submitted a position paper to the court explaining why it believes the court holds no jurisdiction and briefly stating China’s justification for its claims.
In this position paper, China outlines that its claims are based on historical right, asserting that China was the first to discover, name, explore, and exploit the Paracel and Spratly Islands, which it calls the Xisha and the Nansha respectively. Like the shape of China’s new “Maritime Silk Road,” this is based heavily on China’s history.
News outlets, both official and unofficial, have made direct connections between Chinese efforts in maritime archaeology and the protection of maritime rights in the South China Sea, including in a 2014 National Cultural Newsreport, which stated that maritime archaeology and the protection of China’s maritime history have become important tools in defending China’s maritime rights and sovereignty, directly alluding to the “complicated” rights disputes that the PRC currently faces with its neighbors.
At SACH’s February 2014 CCUCHP Annual Meeting, another direct link was made between the Nan’ao-1 shipwreck site off Hainan’s coast, archaeological work in the Spratlys, and protecting national sovereignty. The meeting outlined several goals of these two projects, including filling in the gaps in China’s maritime archaeological academia, supplementing and confirming China’s ancient and Republican era historical records, providing a legal and historical basis for China’s rights in the South China Sea, and expressing Chinese sovereignty in order to protect its cultural heritage.
The officials directly involved with the projects have also been vocal about how maritime archaeology assists in the protection of national rights. Jiang Bo, Director of the Institute of Underwater Archaeology in the Center of Underwater Cultural Heritage Protection, drew a connection between current expeditions and the Maritime Silk Road. In addition, at Kaogu-01’s maiden voyage ceremony in Qingdao, Li Xiaojie, Director of the SACH and Vice-Minister of the Ministry of Culture, said that maritime archaeology plays an irreplaceable part in preserving China’s national culture and protecting its maritime rights.
What is implied in these statements is that China plans to use underwater archaeology as a way to strengthen its historical claims within the nine-dash line in the South China Sea. Looking for historical remains, though, is not China’s only means of asserting its sovereignty over the South China Sea through maritime archaeology. Chinese maritime forces are also enforcing Chinese laws regarding the protection of underwater cultural sites by chasing away “unauthorized” investigations in China’s claimed waters.
Active Protection and Demonstrating Sovereignty
Chinese laws regarding underwater cultural sites, such as shipwrecks or other sunken structures are laid out in the “Regulations of the People’s Republic of China Concerning the Administration of the Protection of Underwater Cultural Relics.” In these provisions, China casts an expansive net. It lays claim to all “relics of Chinese origin” outside the territorial waters of another state, all relics of Chinese “or of unidentified origin” that remain in the sea outside China’s territorial waters and yet inside its administrated waters, and all cultural relics that remain inside Chinese territorial waters. Chinese law also does not allow for private enterprises to conduct excavation, exploration, or salvage work on shipwrecks.
In 2013, China enforced those claims on an unsuspecting French archaeologist and his team investigating the wreck of a Chinese junk off the Philippine coast. According to one report, a Chinese twin-prop plane flew overhead. Then a Chinese marine-surveillance vessel approached the Philippines-registered ship, issuing instructions in English to turn around and head back. While it is difficult to say where exactly this incident actually happened, it does go to show that China is both willing and able to use force to enforce its sovereignty claims over shipwrecks and other relics in disputed waters.
China has also turned to the use of passive technology to protect its cultural relics. According to Yu Xingguang, Director of the State Oceanic Administrations Number 3 Research Facility, China has finished developing the technology for monitoring buoys, which employ acoustics technology to survey underwater wrecks and monitor their condition, while also simultaneously using China’s Automatic Identification System (AIS) to identify and monitor ships entering and exiting the area of wrecks in real time.
Enforcing its sovereignty claims off the Philippines is one obvious way that China is using maritime archaeology to assert and protect its sovereignty. Another method apparently used is much more subtle. It involves the use of China’s new ship, Kaogu-01, in disputed areas to assert its control over them, as well as the gradual buildup of work stations and bases in the area, such as the one planned for Yongxing Island.
Based on its current location, Kaogu-01 appears to already be fitting well into this approach, itself part of the latest wave of what some term China’s “creeping assertiveness” over the past few decades. China seems to remain content to slowly, incrementally further its claims by changing facts on the ground while maintaining a willingness to engage diplomatically with other disputants. This strategy was successful in helping China to consolidate physical control over the Paracel Islands in the 1970s, and is currently helping it to further its claims in the Spratlys. Li Xiaojie’s declaration in February 2015 that Kaogu-01’s principal area of operations will be “China’s coast, including the Paracel Islands” indicates that, for now, Kaogu-01 may be limited to enhancing China’s extant claims. However, mediaspeculationsurroundingKaogu-01’s launch suggesting that the ship was bound for the Spratlys hints that it could become another version of the mobile oil rig, deploying to disputed areas in an attempt to assert China’s claims.
While it remains premature to say how effective the deployment of Kaogu-01 to disputed waters may be in bolstering Beijing’s specific positioning vis-à-vis the South China Sea, China is clearly digging deep for evidence to support its claims. The use of the archaeological ship to search for evidence supporting China’s claims is certain to play a substantive part in China’s overall approach there – a comprehensive effort that smaller neighbors, even combined, simply cannot match. The results of these excavations and any evidence of China’s presence “since ancient times” are likely to be heavily publicized by Chinese media in the future. Stay tuned for further elaboration of Chinese historical claims!
Dr. Andrew S. Erickson is an Associate Professor in the Strategic Research Department at the U.S. Naval War College. Kevin Bond is a research intern at the China Maritime Studies Institute (CMSI) at the U.S. Naval War College. He received his M.A. from the Johns Hopkins University-Nanjing University Center for Chinese and American Studies and his bachelor of arts degree from Gettysburg College. |
.
y**(-6039/16)
Simplify (((b*b**(-2/73))/b)/b**(-15))/((b**(-24)/b)/b*b*b**(-13/2)) assuming b is positive.
b**(6785/146)
Simplify (d**(-2/19))**(7/8)/(d**(3/8))**(-2) assuming d is positive.
d**(25/38)
Simplify ((t**0)**(24/11)*((t/t**(-1))/t*t)**16)**(-6) assuming t is positive.
t**(-192)
Simplify ((t**29/t*t*t**18*t)**(-45))**46 assuming t is positive.
t**(-99360)
Simplify ((s*s*(s*s/((s/(s/((s/s**(-5))/s*s)))/s)*s)/s)/(s/s**(-3)))/(s**(-8)*s)**(-3/31) assuming s is positive.
s**(-176/31)
Simplify q**(1/17)/q**11*(q**(-5/2))**(-1/10) assuming q is positive.
q**(-727/68)
Simplify f**(-1/2)*f**0*((f*f*f**(-4/7))/f)**(1/11) assuming f is positive.
f**(-71/154)
Simplify ((b**(-2)*b/(b/(b*b*b*b**(-7/3)*b*b))*b)/(b**(-1/5)*(b/(b*b**(2/25)))/b))**(-27) assuming b is positive.
b**(-1989/25)
Simplify ((a/(a**(9/5)/a))/a*a**(-1/5)/a)/((a**(-21)/a)/a*a**(2/47)) assuming a is positive.
a**(985/47)
Simplify (g*g**(-9))**(-20)/(g**(-11))**(7/2) assuming g is positive.
g**(397/2)
Simplify (w**(-3/10)*w)/w*w/w**(1/13)*((w*(w/(w**(-20)*w)*w)/w)/w)**(-5/4) assuming w is positive.
w**(-3169/130)
Simplify (b*b*(b**2*b*b)/b)/b**(22/5)*b**(-24)*b**17 assuming b is positive.
b**(-32/5)
Simplify d**(-2)/d*d**5*(d*(d**(-7)*d)/d)/(d/d**(2/13)*d) assuming d is positive.
d**(-76/13)
Simplify (l**(-1/2)*l)/(l/l**(-1/2))*l**(1/4)*l**0 assuming l is positive.
l**(-3/4)
Simplify (w**(-8)/(w/(w*w**(1/6)))*w**0/((w*w*w**6/w)/w*w))**(-6/5) assuming w is positive.
w**(89/5)
Simplify (b**(-5/2)*b*b**(-5/2)*b*b)/(b/(b/(b*b**2*b)))**(6/7) assuming b is positive.
b**(-38/7)
Simplify (f*((f/f**(-27))/f)/f)/(f/f**(-2/73)*f)*(f*(f/(f/(f/(((f**(9/4)*f)/f)/f*f))*f))/f)/f*f**(-1/23) assuming f is positive.
f**(145597/6716)
Simplify (f*f**(-5)*f/(f/f**(-3)))/(f/f**(-2))**(-9) assuming f is positive.
f**20
Simplify ((j**(5/2))**(-19))**(-50) assuming j is positive.
j**2375
Simplify (k**(3/5))**17*k**(-4)/k**(-27) assuming k is positive.
k**(166/5)
Simplify q**(-16)/q*q/(q**(-5)/q)*(q**(4/5))**(1/64) assuming q is positive.
q**(-799/80)
Simplify ((n/n**21)/n)/(n/(n/(n**(1/13)*n)))*(n/n**(1/34))/(n**(8/9)/n) assuming n is positive.
n**(-83519/3978)
Simplify (r/(r*r*r**(-3/5)/r*r))**31*(r*r**2*r)/r**(5/2) assuming r is positive.
r**(-109/10)
Simplify (q/((q/q**(-3/8))/q*q))**(1/20)/(q**(-1/11)/(q**(9/4)*q)) assuming q is positive.
q**(5847/1760)
Simplify k**7/(k/(k*k**14))*((k/(k**(-1/4)/k))/k)**21 assuming k is positive.
k**(189/4)
Simplify ((s/((s*s/(((s**(-27)/s)/s*s)/s*s))/s))/s**(-1/3))**(5/8) assuming s is positive.
s**(-415/24)
Simplify (q/(q**4*q)*q)**(-1/3)/((q*q**(-2/15)/q*q)/q)**35 assuming q is positive.
q**(17/3)
Simplify (k/(k/k**(6/5))*k**(-2/23))/((k/(((k**18*k)/k)/k))/k**(-4/9)) assuming k is positive.
k**(17252/1035)
Simplify (o**0/((o*o**6*o)/o)*o**(3/7)/o**(-4))**(-22) assuming o is positive.
o**(396/7)
Simplify (y**(-1/50)/y*y**(-5))/((y/y**37)/y**(-23)) assuming y is positive.
y**(349/50)
Simplify u**24*u*u**26*u*(u**(4/3))**(-11) assuming u is positive.
u**(112/3)
Simplify ((c*(c*c/(c/((c**(2/5)*c)/c)*c*c))/c)/c)**(-3/28)/(c**(-3))**(22/5) assuming c is positive.
c**(468/35)
Simplify ((v/(((v**(1/23)*v)/v)/v))/(v*v*v**(4/27)/v))/((v/v**(-6/5))/v**0) assuming v is positive.
v**(-4321/3105)
Simplify ((v/(v/(v/(v/(v**(-1/6)*v)))))/v)**(-7)*v/v**(-1)*v**(-16) assuming v is positive.
v**(-77/6)
Simplify ((u**0*u)**(-4/37)*(u*u**0*u)**(-1/6))**(2/25) assuming u is positive.
u**(-98/2775)
Simplify (p*p**(1/2)*p)**47*(p**0*p*p)**(-1/4) assuming p is positive.
p**117
Simplify (d**(-9/7)/d)/d*d**(-12)*d**(-17)*d**(-8)/d assuming d is positive.
d**(-289/7)
Simplify ((((u*u**(-12)*u)/u)**(-1/2))**(-1))**(-8/7) assuming u is positive.
u**(44/7)
Simplify ((o/(o**1/o))/o*o/o**(-3/2)*o*(o*o**(-1/6))/(o/o**(3/4)))**(-9) assuming o is positive.
o**(-147/4)
Simplify (((n/n**(-3/2))/n**7)**8)**15 assuming n is positive.
n**(-540)
Simplify ((z**6/z*z*z)/z)**(-34)*(z*(z*(z*z**(1/5)*z*z)/z)/z)**(9/5) assuming z is positive.
z**(-4956/25)
Simplify ((f/((f**(-6/7)/f)/f))/f)/(f**(-9/2)/f)*f**(-3/4)/(f*f/f**28) assuming f is positive.
f**(941/28)
Simplify (((i*i**0)/(i**(-1/2)/i))/(i**(-6)/(i/(i/i**(-3/7)))))**(-1/2) assuming i is positive.
i**(-113/28)
Simplify (((o/((o**(-2/9)/o)/o))/(o/o**(2/3)))/(((o**(-1/2)/o)/o*o)/(o*o**(7/3))))**(-1/29) assuming o is positive.
o**(-139/522)
Simplify (i**(-10/9))**(5/4)/(i*i**17*i*i/(i**(-21)*i)) assuming i is positive.
i**(-745/18)
Simplify (((z**(-2/7))**(4/15))**(-20/7))**(1/15) assuming z is positive.
z**(32/2205)
Simplify ((x/x**(1/4))**11)**(1/9) assuming x is positive.
x**(11/12)
Simplify ((v*v*((v/(v**(4/25)/v))/v)/v*v*v)/v**(-6/19))/(v/(v/v**(-1/41))*v)**43 assuming v is positive.
v**(-736066/19475)
Simplify (b**(1/20)*b*b**(-14))/((b*b**(-14))/(b/(b/((b*(b*b*b*b/(b**(-2)*b)*b*b*b)/b)/b)))) assuming b is positive.
b**(141/20)
Simplify (n/n**(-2/23)*n**(-4/11))/(n**(-3))**(22/9) assuming n is positive.
n**(6115/759)
Simplify (((m**(1/4)/m)/m)**(-32/3)/((m/(m*m*((m**(1/3)*m*m)/m)/m*m)*m)/(m**(-3/2)*m*m)))**(3/44) assuming m is positive.
m**(123/88)
Simplify (((d**11*d)/d)/(d**(2/39)/d))/(d**(1/2))**45 assuming d is positive.
d**(-823/78)
Simplify ((c**(5/13)*c)/c**22)/(((c*c/((c/(c**(4/19)/c*c))/c))/c)/c**4) assuming c is positive.
c**(-4403/247)
Simplify ((z**0*(z/(z*(z/z**0)/z*z)*z)/z)/((z**(-2)/z)/z*z**(-4)/z))**(-14/11) assuming z is positive.
z**(-112/11)
Simplify (s/(s*s**(-22)))**33/(s**(-4)*s*s*(s*s**14*s)/s) assuming s is positive.
s**713
Simplify ((w*w**(2/11)*w**2)/((w/(w**(2/27)/w)*w)/(w/((w**(3/2)*w)/w))))**(-7/6) assuming w is positive.
w**(1015/3564)
Simplify ((g*g**18)/(g*g**(-2/13)))/(g/(g*g/((g*g**14)/g)))**(-3/40) assuming g is positive.
g**(9947/520)
Simplify c/(c**(-24)*c*c*c)*c*(c/c**(-11))/c*c/(c/(c**(-6)*c))*c*c*c**(3/2)/c*c assuming c is positive.
c**(65/2)
Simplify j*(j/j**(-2))/j*j/(j*j**9*j)*((j*j*j**(-2/37))/j)/j**(-3) assuming j is positive.
j**(-113/37)
Simplify (c**(-2/7)*c*c*c*c/c**0*c)/((c*c**(-2))/(c/(c/c**(1/12)))) assuming c is positive.
c**(487/84)
Simplify (g**(-3))**(-3/20)*g*g**(5/6)*g**(-3/5) assuming g is positive.
g**(101/60)
Simplify (j*j**(-5/2)*j/(j*j**13))/(j*j**1)**37 assuming j is positive.
j**(-177/2)
Simplify (i/(i/(i*i**(-26)*i)*i)*i)/i**19*(i/(i**6/i))**(-1/3) assuming i is positive.
i**(-125/3)
Simplify x**(1/20)*x*x*x*x*(x*(x**2/x)/x)/x*(((x/(x*x**21*x*x))/x)/x)/(x*x**(-24)) assuming x is positive.
x**(41/20)
Simplify ((v*v/v**(3/7)*v*v*v*v**5)/(v/(((v*v**(2/13))/v*v*v)/v)*v**(1/5)))**(-2/9) assuming v is positive.
v**(-8668/4095)
Simplify (((i**(2/3)/i)/(i*i*i**(-10)))/(i**0)**(-20/3))**36 assuming i is positive.
i**276
Simplify (((z*z**3)**(-3/2))**(-42))**(1/3) assuming z is positive.
z**84
Simplify (w*w*w/(w/(w/w**(-7/6)*w)))/w*w**(-12)*((((w*(w/(w/(w**(6/11)/w*w)))/w)/w)/w)/w)/w*w**(4/11) assuming w is positive.
w**(-721/66)
Simplify ((w*(w**(-3)/w)/w)/(w*w/w**(-11/3)*w))/(w**14/((w**(-1/23)/w)/w)) assuming w is positive.
w**(-1843/69)
Simplify (((u/u**(1/5))/u*(u*u**(4/5))/u*u)/(u**(7/3)/(u/(u*u**2))))**(1/7) assuming u is positive.
u**(-41/105)
Simplify (g**(-2/5))**(-9)/(g*g*g**(-3/4)*g*g*g**(3/5)/g*g*g) assuming g is positive.
g**(-5/4)
Simplify (((y*(y/(y*y/y**(7/2)*y))/y*y)/y)/y)/y**(-17)*y**(-4/9)/(y**(-11)/y) assuming y is positive.
y**(523/18)
Simplify c**(-3)*c*c**(-4)*c**15*(c**(-3/2)*c)/c assuming c is positive.
c**(15/2)
Simplify ((o**(-2/5)/(o/(o*o*o**(2/35)/o)))**0)**(-6) assuming o is positive.
1
Simplify ((c/c**20)/c**(-3/11))**(5/12) assuming c is positive.
c**(-515/66)
Simplify (z**31*z**(2/97)/z)**43 assuming z is positive.
z**(125216/97)
Simplify (u*u*u*u*u/(u**(-14)/u))**(1/76)/(u**(6/5)/u**14) assuming u is positive.
u**(1241/95)
Simplify (h**(-3))**(-25/4)*h**(-1/5)*h*h/h**(2/11)*h assuming h is positive.
h**(4701/220)
Simplify ((n**(1/2))**(-37)*(n**(-1/5)*n)**(-16/5))**(1/24) assuming n is positive.
n**(-351/400)
Simplify (g/g**2)/g*(g*g*g/(g*g*((g**(-8)*g)/g*g)/g))/g*(g**(-1/2)*g)**(-48) assuming g is positive.
g**(-18)
Simplify (((r**(-9)*r)/(r**(-7)/r))**(-27))**(-1/15) assuming r is positive.
1
Simplify (((o/(o*o/(o**(-1/2)*o)))**(-1/6))**22)**(12/11) assuming o is positive.
o**2
Simplify ((g**(-5/3)/(g*g**1))**35)**(-17/5) assuming g is positive.
g**(1 |
The Difference Between a Contact Management System and a Customer Relationship Manager.
People often times confuse Contact Management Systems with Customer Relationship Management (CRM). Although similar, the two systems are indeed different. In simple terms, the difference lies in the amount of sales representatives an organization has. An organization that has many sales representatives targeting a single job role would normally be using a CRM. This type of an organization has a many-to-many interaction model. In contrast, an organization, which has a sales interaction model of one-to-many, would normally prefer a Contact Management System.
Why Use a Contact Management System?
A contact manager is a software program that allows users to easily store and find contact information, such as telephone numbers, addresses, and names. In other words, a CMS can help businesses overcome the challenges associated with inconsistency and information fragmentation. A contact management software package can greatly enhance the effectiveness of all types of contact interactions. It also can help in regards to: marketing operations, productivity of sales cycles, and service delivery by enabling the creation of reliable, real-time information about both current and prospective customers that, most importantly, is easy to access. Departments within the organization that deal with customers on a daily basis such as sales, marketing, customer service, help desks, etc. are able to collaborate together and coordinate cross-function activities.
How Does it Work at 5Degrees?
With a contact management system, the process of entering the contact's information, storing the contact's information, and retrieving the contact's information is fully automated and entirely consolidated. All customer-facing employees, regardless of their specific role or department, can add; update; and retrieve information through a single, centralized storage place. In sum, this means that any authorized user can more effectively keep track of information about each respective customer such as: name, phone number, company title, mailing address, email address, and other important contact data. In sum, Contact Management software can help all of the authorized workers in an organization by giving them valuable insights into prospective and current clients, so that they can provide them with a more valuable customer experience. |
From the glut of goals provided by Luis Suarez and Daniel Sturridge, to the speed of Raheem Sterling and the guile of Philippe Coutinho, as well as the deployment of Steven Gerrard as football's answer to the quarterback, Liverpool's re-emergence last season was the arguably the biggest surprise in the race for the title.
If Liverpool ultimately fell short in finishing second, some compensation came in the form of player awards for Suarez and a manager of the year award for Brendan Rodgers.
But one man’s name was never mentioned in despatches in discussions as to why a team that had finished seventh the previous season gave eventual winners Manchester City the fright of their lives.
That man was Ian Graham, a Cambridge graduate, who holds a PhD in theoretical physics.
A self-confessed fan of the club, Liverpool's Director of Research Graham declined an interview with CNN, saying through an intermediary that he preferred to stay “silent on all media pieces on soccerball analytics.”
Beloved in baseball, though still widely distrusted in football, the concept behind “Moneyball” is to use statistics to recruit players who might go on to become a star for your team, or someone you sell for a lot of money.
Between 2005 and 2012 Graham was Decision Technology's head of football research developing "a set of statistical models for the prediction of football matches and the rating of players," according to the company's website.
Describing Graham as a “really bright guy,” Stott recruited the physicist from Cambridge, one of England’s most prestigious universities. “I interviewed lots of people before appointing Ian after his predecessor went to work for a bookmakers.
“Ian will be influencing their decision making,” added Stott of Graham’s work at Liverpool.
At one point Liverpool had been talking to Decision Technology about working for them, but in the end, according to Stott, the club’s American owner John W Henry opted to headhunt Graham instead.
Henry also runs the Boston Red Sox and played a part in the “Moneyball” book and movie.
Michael Lewis’ book tells the story of general manager of the Oakland Athletics baseball team Billy Beane and his attempts to scout players by analysing statistics. After Henry bought the Red Sox in 2002 he offered Beane the post of General Manager but was turned down. In 2002, the Athletics had set an AL record by winning 20 consecutive games.
Under the era of Liverpool’s former technical director Damien Comolli, the English side was arguably an example of how not to do “Moneyball,” having bought forward Andy Carroll from Newcastle United for £35 million ($56 million) before selling him to West Ham for a huge loss.
Comolli, however, might suggest that Suarez's signing more than makes up for the Frenchman’s aberrations between November 2010 and April 2012 in buying and selling players, as the Uruguayan’s transfer value has probably tripled since he joined Liverpool from Ajax for €26.5 million ($35.8 million).
Since Comolli’s departure, Liverpool’s work in the transfer market has been more successful, with Sturridge, Coutinho and goalkeeper Simon Mignolet playing a leading part in Liverpool’s successful campaign, which culminated in qualification for the lucrative European Champions League.
The Anfield club’s work in the transfer window continues to surprise, notably the recent signing of Southampton and England international striker Rickie Lambert, 32, whose career has flourished while playing for the South Coast club.
“We help analyse players,” said Stott explaining Decision Technology’s work with Spurs. “We basically do ‘Moneyball’ with them in relation to the evaluation of players and other statistical questions – for example what are Spurs’ chances of reaching the Champions League in any given year?”
It was during Comolli’s tenure that Decision Technology started working with Spurs.
“Quantification of players is not a silver bullet,” said Stott, who has has co-authored the Times' Fink Tank football column for over 10 years.
“It’s a different source of information and it can’t see the subtleties of a player that a scout can.
“The analysis runs across 7,000 players across 21 leagues over three seasons. No scout can watch that much football. But what we do doesn’t undermine the work that scouts do. What you have to remember about data is that there is no sentimentality about data.”
Last season Spurs were widely criticized for spending £110m on seven players after selling Gareth Bale to Real Madrid for a world record transfer fee. Spurs finished the season in sixth position on 69 points, but Stott points to the steady progression Spurs have been making.
“When we started working with them, they had 55 points in the league. Our forecasts are just one part of the input – and that will be the same at Liverpool,” said Stott, talking broadly about the use of statistics in player recruitment.
“Other people will be involved in the decision making process such as Franco Baldini,” he added, referring to Spur’s Italian director of football, a role previously held by Comolli, who worked at White Hart Lane between 2005 and 2008.
This analytic approach to the "beautiful game" can throw up suprising conclusions, not least when it come to one of European football's traditional powerhouses.
Despite Holland’s reputation for developing young players and the Dutch national team's tendency to punch above its weight on the international stage, Stott argues that Decision Technology’s analysis has led them to be “not huge fans of the Dutch league.”
He adds: “You can evaluate how a Dutch team might be against an English team. You trace it back like a spider’s web cross checking European matches between team. We can track those matches and calibrate those leagues. The Dutch teams are not as strong as other leagues.”
According to Stott, it’s primarily Spurs and Liverpool in the England Premier League that are actively engaged in the use of statistical analysis in relation to player recruitment, though he also cited the influence of Gavin Fleig at Manchester City.
Fleig said he was unable to speak to CNN as he was about to go on paternity leave.
While working for Decision Technology, Graham did give an interview to the British news agency Press Association, explaining the nuances of relating statistics to transfer analysis.
"Analysis is hard to do because of the nature of the game. It's hard to explain because of the extra work required in generating meaningful results and hard to sell because there is no great tradition of statistical analysis in the game.
"But that doesn't mean it's not useful. What is necessary is an appreciation of the advantages and limitations of statistical analysis.
"In my experience, one can develop tools that evaluate players despite the fluid nature of football. It's just very tough to do."
soundoff(2 Responses)
I'm a Blackburn fan but would love to see liverpool to develop their stars to help them reach their old heights and win some trophies. I have great faith in sterling and Sturridge to perform for Liverpool and England as I say in bigphillysfootyblog.wordpress.com
Post a comment
CNN welcomes a lively and courteous discussion as long as you follow the Rules of Conduct set forth in our Terms of Service. Comments are not pre-screened before they post. You agree that anything you post may be used, along with your name and profile picture, in accordance with our Privacy Policy and the license you have granted pursuant to our Terms of Service. |
INTRODUCTION
============
Nuclear DNA is packaged into nucleosomes, the basic repeating structural units in chromatin. The nucleosome consists of a histone octamer arranged as a central tetramer of histones H3 and H4 surrounded by two histone H2A--H2B dimers, around which DNA is wrapped. Core histones undergo post-translational modifications at many sites, including acetylation, methylation, ubiquitination and phosphorylation. Some modifications (active marks) are generally associated with transcriptionally active chromatin regions while others (repressive marks) correlate with repressed regions. Histone acetylation typically marks active genes as does di- or trimethylation of lysine 4 of H3. Di- or trimethylation of H3 at lysine 9 constitutes a repressive mark ([@B1],[@B2]). However, the role of a given mark or group of marks may vary with the cellular context and the gene under study. Added to the complexity are histone variants and the dynamics of histone modifications, which can change very rapidly ([@B3]). H2A, H2B and H3 have variants, some expressed at the time of DNA synthesis (H3.1, H2A.1) and others expressed throughout the cell cycle (H2A.Z, H3.3) ([@B4],[@B5]). H2A.Z is located at telomeric repeats, centromeric regions and at promoters of polymerase I and II transcribed genes ([@B6],[@B7]). H3.3 is located in regulatory regions of genes and closely correspond to DNAase I hypersensitive sites ([@B8],[@B9]). H3.3 is enriched in active marks (di- and trimethylated K4 and acetylated K9, 14, 18 and 23) ([@B10]). Histone variants and modifications may stabilize or destabilize nucleosome structure. Hydroxyapatite dissociation chromatography provided evidence that H2A.Z stabilized the association of the H2A--H2B dimer in the histone octamer, with the H2A.Z stabilization being reduced when the octamer histones were acetylated ([@B5],[@B11]).
H3 phosphorylation at serine 10 is required for chromatin condensation during mitosis and is also associated with the transcriptional activation resulting from stimulation by external stimuli like mitogens and stress ([@B12; @B13; @B14; @B15]). Although much less studied, H3 phosphorylation at serine 28 has also been found coupled with chromatin condensation during mitosis ([@B16]) and induced following stimulation of signal transduction pathways in mouse fibroblasts and epidermal cells ([@B13],[@B14],[@B17],[@B18]). The three H3 variants, H3.1, H3.2 and H3.3, participated in TPA-stimulated phosphorylation at serine 10 and serine 28 ([@B17]). Stimulation of the Ras-MAPK pathway in human breast cancer results in the phosphorylation of H3 at serine 10 but not at serine 28 ([@B19]). Thus, these two phosphorylation events at serine 10 and serine 28 are independent and act separately to promote gene expression ([@B17]).
The ability to isolate transcriptionally active/competent chromatin from avian erythrocytes, which are arrested in G0 phase of the cell cycle, has been informative as to the histone modifications and nucleosome structural features of transcriptionally active/competent chromatin. (Transcriptionally competent chromatin is in an open and accessible conformation but not transcriptionally active). The 0.15 M NaCl-soluble poly- and oligonucleosome fractions isolated from chicken immature erythrocytes contain only 3% of the total nuclear DNA, but ∼25% of the total active sequences and ∼45% of the total competent sequences. In contrast, only 0.5% of the total repressed gene sequences are present in these fractions ([@B20]). These poly- and oligonucleosome fractions enriched in active/competent genes are enriched in highly acetylated species of H3, H2B and H4, ubiquitinated (u) and polyubiquitinated species of H2A and more strikingly uH2B ([@B20]). Other characteristics of active/competent chromatin fractions are the highly dynamic acetylation/deacetylation of the core histones ([@B21]) and the preferential methylation of acetylated H3 and H4 ([@B22]). Moreover, newly synthesized histones H2A and H2B and to a lesser extent H3.3 and H4 preferentially exchange with nucleosomal histones of transcriptionally active/competent chromatin domains, suggesting that nucleosomes of active chromatin may be inherently less stable than bulk nucleosomes *in vivo* ([@B23]). Supporting this idea, structural studies using electron spectroscopic imaging have shown that only 66% of the nucleosomes of the active/competent chromatin present the circular profile seen in 90% of the bulk chromatin, while the remaining nucleosomes appear to be U-shaped or elongated. Some of the nucleosomes with an altered morphology have a lower protein mass and may be devoid of an H2A--H2B dimer ([@B24]).
In this study, we demonstrate the fidelity of this fractionation protocol to separate active/competent from repressed chromatin through the distinct partitioning of the active H3K4me2/3 and repressive H3K9me2 marks. Applying this protocol to study the partitioning of phosphorylated H3, we show that H3S28p, but not H3S10p, qualified as an active mark. We found that H3 phosphorylation at serine 28 was associated with active chromatin and that the histone H3.3 variant was preferentially phosphorylated at serine 28. Evidence is presented that H3.3 phosphorylated at serine 28 was associated with labile nucleosomes.
MATERIALS AND METHODS
=====================
Isolation of chicken erythrocyte nuclei
---------------------------------------
Mature and immature erythrocytes were isolated from adult white Leghorn chickens, and nuclei prepared as described ([@B20]), with the exception that phosphatase inhibitors were used in the nuclei isolation buffers ([@B25]).
Nuclei digestion and chromatin fractionation
--------------------------------------------
Nuclei were digested and the chromatin was fractionated as described previously ([@B20]). Briefly, the fractionation protocol included the following steps. Digested nuclei were re-suspended into low ionic strength solution containing 10 mM EDTA, and solubilized chromatin fragments were obtained in fraction S~E~. Chromatin fraction S~E~ was made 150 mM in NaCl, and salt-soluble (S~150~) and salt-insoluble (P~150~) chromatin fractions were collected. Chromatin fragments in fraction S~150~ were size-resolved on a Bio-Gel A-1.5 m column, obtaining five fractions (F1--F5) ([Figure 1](#F1){ref-type="fig"}). Figure 1.Fractionation of avian erythrocyte chromatin. Avian erythrocyte nuclei were incubated with micrococcal nuclease, and chromatin fragments soluble in a low ionic strength solution containing 10 mM EDTA were recovered in fraction S~E~. Chromatin fraction S~E~ was made 150 mM in NaCl, and salt-soluble (S~150~) and salt-insoluble (P~150~) chromatin fractions were collected. Chromatin fragments in fraction S~150~ were size-resolved on a Bio-Gel A-1.5 m column into five fractions: F1 containing polynucleosomes, F2/F3 containing mostly oligonucleosomes and F4/F5 containing mostly di- and/or mononucleosomes.
Hydroxyapatite chromatography
-----------------------------
The 0.15 M NaCl-soluble chromatin (S~150~) fraction was applied to a hydroxyapatite (Bio-Rad HTP, Bio-Rad, Hercules, CA, USA) column at a ratio of 1 mg of DNA to 0.25 g of hydroxyapatite. The column was washed with 0.63 M NaCl in 0.1 M potassium phosphate, pH 6.7, removing histones H1 and H5 as well as non-histone chromosomal proteins. A linear NaCl gradient from 0.63 to 2 M NaCl in 0.1 M potassium phosphate, pH 6.7/1 mM dithiothreitol (DTT) was run through the column at a flow rate of 1 ml/min, and 4.5 ml fractions were collected. Histones were extracted from every fourth fraction ([@B11]).
Histone electrophoresis and immunoblot analysis
-----------------------------------------------
Histones were electrophoretically resolved on one-dimensional SDS or AUT, or two-dimensional (AUT into SDS), 15% polyacrylamide gels ([@B26]). Immunochemical staining of histones with anti-H3K4me2 (Upstate, Charlottesville, VA, USA), anti-H3K4me3 (Abcam, Cambridge, MA, USA), anti-H3K9me2 (Upstate), anti-H3S10p (Upstate Charlottesville, VA, USA), anti-H3S28p (Sigma, St. Louis, MO, USA) or anti-histone H3 (Cell Signaling Technology, Danvers, MA, USA) antibodies was performed as described previously ([@B27]). The reaction product was detected with horseradish peroxidase conjugated second antibodies and the enhanced chemiluminescence system (Amersham ECL Western blotting system, GE Healthcare, Little Cholfont Buckinghamshire, UK). The specificity of the anti-H3S10p and anti-H3S28p antibodies was previously demonstrated ([@B17]). Furthermore, incubation for 1 h at 37°C of 10 µg histones from the chicken immature erythrocyte fraction S150 with 2 U of calf intestinal alkaline phosphatase resulted in the loss of anti-H3S10p and anti-H3S28p antibody reactivity (data not shown).
Chromatin immunoprecipitation (ChIP) assay
------------------------------------------
ChIP assays were done on chicken immature and mature erythrocyte nuclei as described previously with some modifications ([@B28]). After incubation with 1% formaldehyde for 10 min and lysis of the nuclei, the chromatin was sheared to an average fragment size of 500 bp, diluted to 8 A~260~ U/ml in dilution buffer (16.7 mM Tris--HCl, pH 8.1, 1.2 mM EDTA, 167 mM NaCl, 1.1% Triton X-100, 0.01% SDS and 0.5 mg/ml BSA), and pre-cleared by incubation with 60 μl/ml of Protein A/G agarose beads. Cross-linked chromatin fragments (1 ml) were incubated with 5 µg anti-H3S10p (Upstate, Charlottesville, VA, USA), anti-H3S28p (Sigma, St. Louis, MO, USA), anti-acetyl-histone H3 (Lys9/18) (Upstate Charlottesville, VA, USA) or rabbit polyclonal pre-immune antibodies. Immunoprecipitated complexes were recovered by an incubation with protein A/G agarose (pre-treated with 500 μg/ml of yeast tRNA) and were serially washed with 1 ml of washing buffer I (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris, pH 8.1 and 150 mM NaCl), washing buffer II (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris, pH 8.1 and 500 mM NaCl), washing buffer III (0.25 M LiCl, 1% NP-40, 1% deoxycholate, 1 mM EDTA and 10 mM Tris, pH 8.1) and then twice with 1 mM EDTA, 10 mM Tris--HCl, pH 8.0. Precipitated chromatin complexes were eluted from the beads with 100 μl of elution buffer (1% SDS, 0.1 M NaHCO~3~). After reversal of the cross-linking at 65^°^C, DNA was isolated directly from the agarose slurry using the QIAQuick PCR Purification kit (Qiagen, Mississauga, ON, Canada) and re-suspended in 40 μl of water. The ChIP and input DNA concentrations were determined with the Quant-iT Picogreen dsDNA kit (Invitrogen, Carlsbad, CA, USA). ChIP and input DNAs were analyzed by PCR using chicken H5 gene promoter primers forward 5′CCATCACATCCCTTCTGGTC3′ and reverse 5′CACTGGGGTTAGGGAGCTTA3′ to amplify a 235 bp fragment, chicken vitellogenin exon 3 primers forward 5′ACCCAGGATTCAATAGCAGAA3′ and reverse 5′TGAGGAGGTAAGCATTCTCTGG3′ to amplify a 150 bp fragment or avian primers, which have been described previously ([@B29]), to amplify a sequence in the condensed chromatin region upstream of the 5′ β-globin insulator (Fol-het 20157 amplicon), or sequences in the β^A^-globin (Globin 39652 amplicon) or β^ε^-globin (Globin 44235 amplicon) promoter regions. Equal volumes of ChIP and input purified DNAs were amplified and the PCR products (histone H5 promoter and vitellogenin exon 3 amplicons) were electrophoresed on a 1.5% agarose gel and stained with ethidium bromide for visualization. Equal amounts (5 ng) of ChIP and input DNA were quantified by real-time PCR. The enrichment values were calculated according to a published formula ([@B30]).
RESULTS
=======
Partitioning of methylated H3 in avian erythrocyte chromatin
------------------------------------------------------------
The partitioning of methylated H3 in fractionated chromatin from chicken immature erythrocyte nuclei was investigated. [Figure 1](#F1){ref-type="fig"} describes the chromatin fractionation procedure. Chromatin fragments resulting from the micrococcal nuclease digestion of nuclei were separated into low salt-soluble (S~150~) and -insoluble (P~150~) fractions, which are enriched and depleted in transcriptionally active/competent chromatin, respectively. S~150~ was further fractionated into five fractions according to chromatin fragment sizes, as shown in [Figure 2](#F2){ref-type="fig"}A and B. Fraction F1, consisting of polynucleosomes, was enriched in active and even more so in competent sequences, while fractions F2 and F3, composed of oligonucleosomes, were enriched in active and competent DNA sequences ([@B20]). The immunoblot analysis of histones extracted from the different fractions revealed that H3K4me2 and H3K4me3 were both enriched in S~150~ and depleted in P~150~ ([Figure 2](#F2){ref-type="fig"}C and D). Moreover, both states of H3K4 methylation were enriched in the polynucleosome (F1) and oligonucleosome (F2/F3) fractions, with H3K4me3 showing greater levels than H3K4me2 in fractions F2/F3, which are the fractions that are most enriched in active DNA sequences. As for H3K9me2, it was found associated with repressed chromatin regions in the P~150~ fraction ([Figure 2](#F2){ref-type="fig"}E). H3K9me2 was also present in the mononucleosome (F4/F5) fraction, which contains repressed DNA sequences ([@B20]). The distinct partitioning of the active H3K4me2/3 and repressive H3K9me2 marks demonstrates the fidelity of this fractionation protocol to separate active/competent from repressed chromatin. Figure 2.H3K4me2/3 histones are associated with active/competent chromatin while H3K9me2 is associated with repressed chromatin. The chicken immature erythroid chromatin fragments that are soluble in 0.15 M NaCl (fraction S~150~, 200--300 A~260~) were fractionated by gel exclusion chromatography on a Bio-Gel A-1.5 m column, obtaining five fractions F1--F5 (**A**). DNA isolated from each chromatin fraction and a 100 bp DNA ladder (M) were run on a 1% agarose gel and stained with ethidium bromide (**B**). Histones (10 µg) extracted from fractions S~150~, P~150~, F1 and combined fractions F2/F3 or F4/F5 were loaded onto a SDS--15% polyacrylamide gel, transferred to a nitrocellulose membrane and immunochemically stained with anti-H3K4me2 (**C**), anti-H3K4me3 (**D**) or anti-H3K9me2 (**E**) antibodies or the gel was stained with Coomassie blue (**F**).
Enrichment of H3 phosphorylated at serine 28 in transcriptionally active/competent chromatin regions
----------------------------------------------------------------------------------------------------
In vertebrates phosphorylation of H3 at serine 10 and serine 28 has been extensively studied in the context of mitosis or in the course of the rapid and transient expression of the immediate early genes in response to extracellular stimuli ([@B13],[@B14]). However, whether vertebrate H3 phosphorylation events play a role in transcription under other circumstances has not been investigated. We carried out the fractionation of chicken immature erythrocyte chromatin fragments as described above and analyzed the distribution of H3S10p and H3S28p in the different fractions. As shown in [Figure 3](#F3){ref-type="fig"}C, there was an enrichment of H3S28p in S~150~. When S~150~ was further fractionated, H3S28p preferentially partitioned into the fractions enriched in active and competent DNA sequences (F1 and F2). In contrast, H3S10p was equally distributed between all fractions ([Figure 3](#F3){ref-type="fig"}A). To validate the antibodies against the phosphorylated H3 histones, we verified that H3 phosphorylation at serine 10 or serine 28 occurred as expected after treatment of 10T1/2 cells with TPA to stimulate the MAP kinase pathways ([Figure 3](#F3){ref-type="fig"}A and C). These observations demonstrate that H3 phosphorylation at serine 28 partitions selectively with chromatin enriched in transcriptionally active/competent chromatin. Figure 3.H3S28p is enriched in active/competent chromatin fractions of chicken immature erythrocytes. Histones (10 µg) extracted from chicken immature erythrocyte salt-soluble (S~150~) or -insoluble (P~150~) chromatin or gel exclusion chromatographic fractions (F1--F5) were loaded onto a SDS--15% polyacrylamide gel, transferred to a nitrocellulose membrane and immunochemically stained with anti-H3S10p (**A**) or anti-H3S28p (**C**) antibodies or the gel was stained with Coomassie blue (**B** and **D**). The immunoblot analysis of 10 µg of histones from serum-starved 10T1/2 cells left untreated (--) or treated with 100 nM TPA for 30 min (TPA) was done to validate the antibodies (**A** and **C**).
Association of H3 phosphorylated at serine 28 with promoter region of the transcriptionally active genes
--------------------------------------------------------------------------------------------------------
The preferential association of H3 phosphorylation at serine 28 with active/competent DNA-enriched chromatin was further characterized by ChIP assays on chicken immature and mature erythrocyte nuclei. We initially analyzed the histone H5 gene as it is expressed in chicken immature erythrocytes but is inactive in chicken mature erythrocytes ([@B31],[@B32]). Although not expressed in mature erythrocytes, the chromatin of the histone H5 maintains a DNAase I sensitive competent chromatin state. The vitellogenin gene was chosen as a representative repressed gene in erythrocytes ([@B33]). Cross-linked chromatin fragments of an average size of 500 bp were immunoprecipitated by anti-H3S28p or anti-H3S10p antibodies. The content in the antibody-bound chromatin of a 235 bp H5 DNA sequence spanning the promoter and first 80 bp of the transcribed region was visualized ([Figure 4](#F4){ref-type="fig"}A) and quantified by real-time PCR ([Figure 4](#F4){ref-type="fig"}B). There was a marked enrichment of H3S28p in the promoter region of the active H5 gene compared to the competent gene, as shown by the enrichment values obtained with anti-H3S28p antibodies when using chromatin prepared from immature and mature erythrocytes. As expected, acetylated H3 was also found associated with the promoter region of the active H5 gene in immature erythrocytes ([Figure 4](#F4){ref-type="fig"}A). Conversely, only a slight enrichment of H5 promoter sequence was detected in immature erythrocyte chromatin immunoprecipitated with anti-H3S10p antibodies ([Figure 4](#F4){ref-type="fig"}A and B). Acetylated H3 was not associated with the repressed vitellogenin gene ([Figure 4](#F4){ref-type="fig"}A). DNA immunoprecipitated with anti-H3S10p antibodies contained vitellogenin sequences ([Figure 4](#F4){ref-type="fig"}B). Figure 4.H3S28p is associated with the promoter region of active histone H5 gene. ChIP assays were performed on chicken immature (IE) and mature (ME) erythrocyte nuclei. Cross-linked chromatin fragments were immunoprecipitated with anti-H3S28p, anti-H3S10p, anti-acetyl-histone H3 or rabbit polyclonal pre-immune (pre-im) antibodies. DNA was purified from the ChIP fractions and the input fraction (1:80 dilution) and analyzed for the presence of histone H5 and vitellogenin gene sequences. An equal volume of DNA was amplified from each fraction. The PCR products were loaded onto a 1% agarose gel and stained with ethidium bromide (**A**). Five nanograms of DNA from input and ChIP fractions were quantitated by real-time PCR. The enrichment values of histone H5 or vitellogenin sequences in ChIP DNAs relative to input DNA are shown (*n* = 3, standard deviation shown) (**B**). The enrichment values of histone H5, 5′ flanking globin, β^A^-globin and β^ε^-globin sequences in ChIP DNAs relative to input DNA are shown (*n* = 3, standard deviation shown) **(C)**.
We then studied the association of H3S28p and H3S10p with the promoter regions of the β^A^-globin and β^ε^-globin genes, whose expression has been well characterized. The embryonic β^ε^-globin gene is not expressed in immature erythrocytes, while the adult β^A^-globin gene is highly expressed ([@B34]). In mature erythrocytes, the β^A^-globin gene is not transcribed ([@B35]). We also analyzed a sequence from a condensed chromatin region upstream of the β-globin 5′ insulator, which is not expressed in erythrocytes ([@B29]). [Figure 4](#F4){ref-type="fig"}C shows the reproducibility of our results with the H5 promoter region, demonstrating that the active, but not competent, H5 promoter was associated with H3S28p. A similar association of H3S28p with the promoter region of the expressed β^A^-globin gene in immature erythrocytes was also observed. However, H3S28p was not enriched with the inactive β^A^-globin gene in mature erythrocytes, the non-expressed β^ε^-globin gene or the region flanking the 5′ end of the β-globin locus in immature or mature erythrocytes. H3S10p was associated with the transcribed H5 and β^A^-globin genes in immature erythrocytes, but only to a moderate extent when the enrichment values in immature erythrocytes were compared to those in mature erythrocytes where the genes are no longer expressed. In summary, the ratios of enrichment between immature and mature erythrocytes for H3S28p were 20.1 and 14.3 for the H5 promoter (panel B and C, respectively) and 9.6 for β^A^-globin promoter. In contrast the ratios of enrichment between immature and mature erythrocytes for H3S10p were 1.5 and 2.9 for the H5 promoter (panel B and C, respectively) and 3.4 for β^A^-globin promoter, which were similar to the ratio for the repressed vitellogenin gene (3.4). These observations provide evidence that H3S28p is associated with transcribed, but not competent or repressed, genes in chicken erythrocytes.
Association of H3 phosphorylated at serine 28 with labile nucleosomes
---------------------------------------------------------------------
We previously used hydroxyapatite dissociation chromatography to study the effect of histone modifications and histone variants on histone--DNA interactions in nucleosomes ([@B11]). In this approach, the chromatin is immobilized on the hydroxyapatite while the histones are dissociated by a gradient of NaCl. The method provides a means to compare the effect of histone modifications and variants on altering nucleosome stability ([@B36]). Of the nucleosomal histones, the histone H2A--H2B dimer dissociates first at ∼0.9 M NaCl, followed by the histone (H3--H4)~2~ tetramer which dissociates between 1.2 and 2.0 M NaCl. This dissociation profile of histones from hydroxyapatite bound chromatin fragments appears to mimic the disassembly of nucleosomes *in situ* during transcription ([@B37]). Thus, the transcriptionally active gene-enriched, 0.15 M NaCl-soluble fraction S~150~ from chicken immature erythrocytes was applied to a hydroxyapatite column, and the histones were dissociated from the DNA with increasing concentrations of NaCl. [Figure 5](#F5){ref-type="fig"}A shows the elution profile of core histones with the first peak containing H2A and H2B and the second peak containing H3 and H4, as revealed by the electrophoretic analysis of the eluted histones on an acid--urea--Triton polyacrylamide gel stained with Coomassie blue ([Figure 5](#F5){ref-type="fig"}B). In agreement with our previous results, H2A.Z dissociated at higher salt concentrations than the bulk of H2A. Immunoblot analysis of eluted histones with anti-H3S28p antibodies revealed that most of the H3S28p population, predominantly the phosphorylated H3.3 variant, eluted ahead of the H3 bulk ([Figure 5](#F5){ref-type="fig"}C). The easier dissociation from nucleosomal DNA of H3 phosphorylated at serine 28 was particularly evident when comparing the chromatographic profiles of the H3S28p immunosignal and total histone absorbance, with the H3S28p profile displaying a clear leftward shift compared to the H3/H4 peak ([Figure 5](#F5){ref-type="fig"}A). In contrast, such a weakening of the H3 interaction with nucleosomal DNA was not apparent when H3 was phosphorylated at serine 10. H3 phosphorylation at serine 10 appeared to strengthen the H3--nucleosomal DNA interactions, as the elution of H3S10p was observed throughout the elution of H3 and H4 and delayed compared to the elution of bulk H3 and H4 ([Figure 5](#F5){ref-type="fig"}A and D). These observations suggest that H3 phosphorylation at serine 28 is associated with destabilized nucleosomes, while phosphorylation at serine 10 is associated with more stable nucleosomes. Figure 5.Effects of histone H3 phosphorylation on nucleosome properties. The chicken immature erythrocyte salt-soluble chromatin fraction S~150~ (300 A~260~) was applied to a hydroxyapatite column. A linear gradient from 0.63 to 2 M NaCl in 0.1 M potassium phosphate (pH 6.7)/1 mM DTT was run through the column (filled circle) (**A**). Histones (10 µg) extracted from every fourth fraction were electrophoretically resolved on an AUT--15% polyacrylamide gel. The gel was stained with Coomassie blue ('ox' denotes the oxidized forms of histone H2B.1) (**B**), or the histones were transferred to a nitrocellulose membrane and immunochemically stained with anti-H3S28p (**C**) or anti-H3S10p (**D**) antibodies. The immunoblot signals were quantified, and the chromatographic profiles of H3S28p (open square) and H3S10p (filled diamond) are shown in A.
Preferential phosphorylation at serine 28 of histone variant H3.3
-----------------------------------------------------------------
To further study the differential phosphorylation at serine 10 and serine 28 of H3 variants, histones were extracted from the transcriptionally active DNA-enriched, 0.15 M NaCl-soluble fraction S~150~ from chicken immature erythrocytes and analyzed by two-dimensional gel electrophoresis. The Coomassie blue staining in [Figure 6](#F6){ref-type="fig"}A exhibits the resolution of the three H3 variants H3.1, H3.2 and H3.3. All three variants were identified in the immunoblot analysis using anti-histone H3 antibodies ([Figure 6](#F6){ref-type="fig"}B). However, the variant H3.3 was prominently detected using anti-H3S28p antibodies ([Figure 6](#F6){ref-type="fig"}C) while variants H3.1, H3.2 and to a lesser extent H3.3 were detected using anti-H3S10p antibodies ([Figure 6](#F6){ref-type="fig"}D). It should be noted that in our previous studies this anti-H3S28p antibody detected phosphorylation at serine 28 with the three H3 variants in mitotic and TPA-induced mouse fibroblasts ([@B17]). As this antibody will detect S28p in all three H3 variants, our results show that avian erythrocyte H3.3 is the major H3 variant being phosphorylated at serine 28. Figure 6.Histone variant H3.3 is preferentially phosphorylated at serine 28. Histones (10 µg) extracted from the chicken immature erythrocyte salt-soluble chromatin fraction (S~150~) were resolved by two-dimensional gel electrophoresis (AUT into SDS), stained with Coomassie blue (**A**), or transferred to nitrocellulose, and immunochemically stained with anti-total histone H3 (**B**), anti- H3S28p (**C**) or anti-H3S10p (**D**) antibodies.
DISCUSSION
==========
Phosphorylation of H3 S10 is induced by a wide variety of extracellular stimuli, and gene expression mediated by phosphorylation of H3 S10 has been the focus of numerous studies. While phosphorylation of H3 S28 has promoted less interest, it is also known to be induced following stimulation of signal transduction pathways ([@B13],[@B14]). In chicken erythrocytes, we observed phosphorylation of H3 S10. However, this modified H3 was not associated with any specific chromatin fraction and was found equally in transcriptionally active and repressed chromatin regions. In ChIP assays, we found that H3S10p was modestly enriched with regulatory regions of active genes. In contrast, H3S28p paralleled the fractionation of transcribed chromatin and was directly associated with the transcriptionally active, but not silenced, histone H5 or β^A^-globin promoter regions.
Recent studies found that epitope-tagged H3.3 is enriched in promoter region in avian cells regardless of the gene\'s transcriptional activity ([@B8]) which is in agreement with our earlier studies showing that endogenous newly synthesized H3.3 was incorporated into transcription active/competent chromatin independent of transcription ([@B23]). In contrast, yeast H3.3 is incorporated only in promoters of active genes ([@B38]). At promoters and DNAase I hypersensitive sites, nucleosomes are dynamically disassembled and reassembled with the incorporation of H3.3 ([@B9]). Mammalian and *Drosophila* H3.3 is found enriched in active marks including H3K4me3, H3K9ac and H3K14ac ([@B10],[@B39]). In the avian immature erythrocyte active gene-enriched salt-soluble chromatin, H3.3 was the principal H3 variant being phosphorylated at serine 28. In contrast, all three H3 variants were phosphorylated at serine 10. These observations are consistent with the idea that H3.3 located in chromatin regions of nucleosome instability are phosphorylated at serine 28.
Histone modifications and variants may stabilize (e.g. H2A.Z) or destabilize (e.g. acetylation) nucleosomes. H3.3 differs from canonical H3 in only four amino acids, and the incorporation of either of the H3 forms into a nucleosome is unlikely to change its overall structure ([@B4]). However, modifications of H3.3 could potentially destabilize H3.3 containing nucleosomes. Our studies applying hydoxyapatite dissociation chromatography provide evidence that H3 phosphorylated at serine 28 is associated with labile nucleosomes. In contrast, H3 phosphorylation at serine 10 dissociated with the bulk of H3. These observations suggest that phosphorylation at serine 10 may have no affect on nucleosome structure. Reconstitution of nucleosome arrays containing H3 phosphorylated at serine 10 showed that this modification did not alter chromatin structure ([@B40]), which is consistent with our results that H3 phosphorylation at serine 10 does not destabilize nucleosome structure. Phosphorylation of H3.3 at serine 28 may be involved in the dynamic disassembly--assembly of nucleosomes in active promoters.
Research support by a grant from the Canadian Institutes of Health Research (CIHR) Grant MOP-9186, a Canada Research Chair to J.R.D., and CIHR Canada Graduate Scholarships Doctoral Award to P.S.E. are gratefully acknowledged. We acknowledge the strong support of the CancerCare Manitoba Foundation for our facilities at MICB. We thank Dr Geneviève Delcuve for preparation of the manuscript. Funding to pay the Open Access publication charges for this article was provided by Canadian Institutes of Health Research Grant MOP-9186.
*Conflict of interest statement*. None declared.
|
+ y*p and give o.
2
Rearrange -2*t**2 + t**2 + 9*t**2 to b*t**2 + c + x*t and give b.
8
Rearrange 0*h**4 - h**3 - 3*h - 6*h**2 + 3*h**4 - 5*h**4 to l*h**3 + q*h**4 + s*h + n*h**2 + i and give n.
-6
Rearrange 30*r + 27*r - 23*r**2 - 56*r to n*r**2 + l*r + x and give n.
-23
Express (0*n - 7 + 2 + n)*(-n**2 + 4*n**2 - n**2) + n**3 - 2*n**3 + 0*n**3 in the form w*n**2 + o + k*n**3 + i*n and give w.
-10
Express -z - z**3 + z + (2*z + 4 - 4)*(3*z + 2*z**2 - 3*z) + 6*z**3 - 2*z**3 - 2*z**3 - 2 + z**3 + 2 as k*z + f*z**2 + q*z**3 + d and give q.
6
Rearrange (-4*f + 0*f + 2*f)*(1 - 4 + 4)*(3*f**3 + 33*f**3 + 13*f**3) to v + l*f**2 + b*f + a*f**4 + j*f**3 and give a.
-98
Rearrange 24 + 2*r + 0*r + 52*r**2 + 0*r - 54*r**2 to j + m*r**2 + x*r and give j.
24
Rearrange (-3 - 6*p + 3 + (4*p - 5*p - p)*(-5 + 5 + 1))*(4*p**3 - 3*p**3 + 4*p**3) to the form i*p**2 + m + r*p + t*p**3 + l*p**4 and give l.
-40
Express (7*g - 3*g + 10*g)*(2*g - g + g) in the form v + b*g + d*g**2 and give d.
28
Rearrange -45 + 2*f**2 - 6*f - f**3 + 45 - 2*f**4 + 0*f**4 to s*f**2 + u*f**3 + g*f**4 + b + d*f and give d.
-6
Express 3*g**4 - 6*g**4 + 4 + 2*g + 2*g**4 as j*g**2 + n*g**3 + d*g + t + c*g**4 and give d.
2
Rearrange (-2*z - 1 + 1)*(-z**3 - z**2 + 2490*z + 2*z**2 - 2484*z) to the form v + a*z**2 + n*z**3 + u*z + g*z**4 and give g.
2
Rearrange 5*m + 12*m + 12*m + 50 - 27*m to k*m + y and give k.
2
Express (-2*g**2 + g**2 + 0*g**2)*(1379 - 581 - 609 - 2 + 2 - 2 + (0 + 1 - 2)*(0 + 4 - 2) - 1 - 1 + 0 + 3 + 0 - 1) in the form l*g + i + u*g**2 and give u.
-185
Rearrange -149*i + 149*i + 35*i**2 + (-i + 1 - 1)*(2*i - 4*i + 0*i) + 4 - 4 - i**2 to o*i**2 + c + x*i and give o.
36
Rearrange 79*u - 70 + 68 - 6*u to n + f*u and give f.
73
Rearrange 99 - 29*t - 99 to q + o*t and give o.
-29
Rearrange (l - 2*l + 2*l)*(-18 + 1 + 0) to the form o*l + n and give o.
-17
Rearrange -8*q**3 + 4 + 10*q**3 - 6*q - 2 to z*q**3 + h*q + r + f*q**2 and give h.
-6
Rearrange 6*w - 2*w + 3 - 7*w to q + j*w and give j.
-3
Express -1 - 9*y**2 + 2 + 7 - 6 in the form p*y**2 + u*y + a and give a.
2
Express -3*p + 8*p**3 + 6 - 5 + 2*p + 1 in the form f*p**3 + r + u*p**2 + l*p and give r.
2
Express (-3 + 1 + 1)*(-3 - 2*d + 3)*(7 - 1 - 7) as a + t*d and give t.
-2
Rearrange (-6 + 6 + 6)*(m + 0 + 0) to the form i*m + p and give i.
6
Rearrange -6*j**2 - 15*j**2 - 6*j**2 - 5*j**2 to c + m*j**2 + i*j and give m.
-32
Rearrange -b**2 - 11*b - 20 + 20 to q*b**2 + p + m*b and give m.
-11
Rearrange (o + 6 - 6*o + 3*o)*(5*o - 10*o + 17*o) to the form c*o + h*o**2 + n and give h.
-24
Express -33*r**2 + 53*r**2 - 68*r**3 - 20*r**2 - 2*r in the form q*r + c*r**2 + y*r**3 + t and give y.
-68
Express 3*x**4 + 2 + x**2 + 4*x - x**3 - 5 + 4 as i*x**2 + b*x**4 + v*x**3 + o*x + h and give b.
3
Rearrange (4 + 16*b - 4)*(-2 - 4*b + 2) + 2*b**2 - 5*b**2 + 2*b**2 to v + n*b**2 + j*b and give n.
-65
Rearrange -12 + 0*r**2 + 176*r**4 + 2*r**3 - 178*r**4 - r**2 to the form m*r**4 + x*r + v*r**3 + a + h*r**2 and give m.
-2
Express -3*h**4 - 4*h**3 - h - 1 + 7*h**3 + 5*h**4 as z + n*h + v*h**2 + a*h**3 + j*h**4 and give a.
3
Express (-2*i + 1 - 2 + 14*i)*(i - i - 3*i**2) as l*i + z + o*i**2 + n*i**3 and give n.
-36
Express (-j - 2*j + 2*j)*(-4 + 1 + 5) - 5*j + 2*j + j + (4*j + 0*j - 2*j)*(5 - 4 + 0)*(8 + 23 + 17) in the form g + u*j and give u.
92
Express -82 + 16*r + 82 as p + w*r and give w.
16
Express -9*m - 2*m**2 + 8 + 11 - 16 as x + d*m**2 + b*m and give d.
-2
Rearrange (-8 + 5*u**2 + 8)*(1 + u - 1)*(0*u + u - 2*u) + u**4 + 3*u**4 - u**4 to the form q*u**4 + r*u**2 + v*u**3 + k + a*u and give q.
-2
Express -3*w**4 + w**4 + w**4 + (-4*w**4 - 2*w**4 + w**4)*(-1 - 4 + 4) - 3*w**4 + w**4 + 3*w**4 in the form i*w**4 + g*w + y + j*w**3 + o*w**2 and give i.
5
Express (d + 5*d - 274 + 275)*(-2 - 1 + 2)*(0*d - 3*d + d) in the form i*d**2 + x*d + a and give x.
2
Express (l - 5*l + 2*l)*(-2 + 0 + 4) + 2*l + 2*l - 6*l in the form h + v*l and give v.
-6
Express 2 - 44*s - 5 + 41*s as v + b*s and give v.
-3
Rearrange -4 + 4 + 2 + 2 + t**3 - 3*t**2 to the form w*t**2 + s*t + j*t**3 + y and give j.
1
Express ((6 - 2 - 2)*(-1 - n + 1) + n + n - n + 1)*(-36*n - 34*n + 57*n) in the form l*n**2 + d + r*n and give l.
13
Express 37 - 42 - k + 4*k**2 - 2*k**2 in the form p + q*k**2 + i*k and give q.
2
Rearrange (3*r**2 - 5*r**2 + r**2)*(2*r - 2*r + r**2 + (0*r - r + 3*r)*(r - 2*r - r) + 2*r**2 + r**2 - 2*r**2) to q*r**2 + d*r + v*r**3 + y + k*r**4 and give k.
2
Rearrange -3*y**3 + 3*y**2 + 5 - y**4 - 2 + 0 to the form q*y**4 + j + u*y**2 + s*y**3 + c*y and give j.
3
Express (-1 + 0 + 2)*(2*s**3 - 3*s**3 - s**3) + (-2 + 2 - s)*(5*s**2 - s**2 - 2*s**2) in the form m*s**2 + u*s + d + a*s**3 and give a.
-4
Rearrange -94 + 94 - 18*l to the form j*l + q and give j.
-18
Rearrange -18*z + 8*z - 9*z - 4*z to o + k*z and give k.
-23
Rearrange (-2 - 1 - 6)*(2*s - 2*s - 2*s) to the form d*s + h and give d.
18
Rearrange (-3*a - 6 + 6)*(2 - 3*a**3 - a**3 + a**3) to d + j*a + t*a**3 + z*a**4 + b*a**2 and give t.
0
Express 0*u**2 - u + 2*u**2 + u**2 in the form b + o*u**2 + j*u and give j.
-1
Rearrange 8*d + 18*d + 2*d to the form i*d + o and give i.
28
Rearrange -1 + 14*c**3 - c**2 - 4*c**4 - c + 8*c**3 - 16*c**3 to the form f + v*c**2 + o*c**4 + k*c + j*c**3 and give k.
-1
Rearrange 6 + o**2 - 9 - 5 to d + y*o**2 + z*o and give d.
-8
Express (-4 + 2 + 3)*(-f**4 + 5*f**4 - 3*f**4) + (3*f - f + 0*f)*(0 + f**3 + 0) in the form t*f**3 + k*f**4 + w*f + y*f**2 + d and give k.
3
Rearrange 9*u**3 + 5*u**2 - 3*u**2 + 10*u**2 - 7*u**2 to x*u + p*u**2 + j + w*u**3 and give w.
9
Rearrange (2*h**4 + h**4 - 4*h**4)*(-10 + 12 - 10) + 0*h**4 - 2*h**4 + 0*h**4 to s*h**2 + u + o*h + a*h**4 + b*h**3 and give a.
6
Rearrange -19*s - 85*s**2 + 45*s**2 + 41*s**2 to n*s + p*s**2 + h and give p.
1
Express -4*s**3 + 7*s + 17*s**3 - 8*s as q*s**2 + p*s**3 + z + d*s and give d.
-1
Express 2*c**2 - 9*c + 2*c**2 + 6 - c**3 - 3*c**2 in the form y*c + l*c**2 + a*c**3 + k and give l.
1
Rearrange 609 - 609 + 2*o**4 - 5*o**2 - 2*o - o**3 to n*o**2 + g*o**4 + r + s*o**3 + a*o and give s.
-1
Rearrange (10 - 1 + 0)*(0 + 0 + 3)*(2*f - 2*f + 2*f**2) to the form q*f + p*f**2 + j and give p.
54
Express (-5*t + 9*t - 6*t)*(t - 4*t + 4*t + (-3 + 1 - 1)*(-4*t + 3*t + 3*t)) as u*t**2 + d + w*t and give u.
10
Rearrange -2 + 0 + 7 + 9*c**2 - 3 - 2*c**3 to the form y*c**3 + s*c**2 + a + z*c and give a.
2
Rearrange (-4*p**3 + 4*p**3 + 2*p**3)*(1 + 17*p - 17*p + 7*p) to c + y*p**4 + g*p**3 + l*p + m*p**2 and give g.
2
Express (43*q**2 - 24*q**2 - 28 - 17*q**2)*(-q**2 - 2*q**2 + 4*q**2) in the form y + d*q**3 + n*q + l*q**4 + z*q**2 and give l.
2
Rearrange (-q**3 + 3*q**3 + 0*q**3)*(-2 + 6 - 3)*(-37*q + 5*q - 15*q) to the form w + m*q**2 + t*q**4 + o*q + p*q**3 and give t.
-94
Express -18*y + 3 + 10*y - 1 + 10*y**4 as p*y + u*y**4 + m*y**2 + l + k*y**3 and give u.
10
Rearrange -2*t**2 - 1 + 1 + (4*t + 2*t - 5*t)*(-4*t + 3*t + 2*t) - t**2 + 0*t**2 - t**2 + (t - t - t)*(-3*t - t + 7*t) to the form x + a*t + g*t**2 and give g.
-6
Express (2 - 2 + 2*y)*(11 + 29 + 9) in the form o*y + f and give o.
98
Express -2 + 2*b + 17*b**4 - 2*b - 12*b**4 - 2*b**2 as t*b + r*b**3 + c + y*b**2 + h*b**4 and give c.
-2
Rearrange (-u + 2*u + 0*u)*(6 + 5 + 4) to the form s*u + g and give s.
15
Rearrange 28*i**4 - 10*i + 3 - 1 + 1 + 8*i to n*i**4 + a*i**3 + u*i + p*i**2 + v and give u.
-2
Express 0 + 9*a**2 + 34*a**3 - 16*a**3 - 17*a**3 - 1 in the form x*a**3 + u*a**2 + l*a + v and give u.
9
Express (2*q - 2*q + 2*q**3)*(59*q + 6*q + 21*q + 43*q) in the form x*q + m*q**2 + z*q**4 + a + j*q**3 and give z.
258
Express 6 - 2 - 9*c**2 - 3 + (2 - c - 2)*(-4*c + 3*c - c) + 3*c**2 + 0*c**2 - 5*c**2 in the form u*c + w*c**2 + l and give w.
-9
Rearrange 13*a - 367*a**3 + a**2 - a**2 + 369*a**3 + 1 to the form t*a**3 + j*a**2 + z + l*a and give z.
1
Rearrange 419 + 83*w - 419 to j + o*w and give o.
83
Rearrange -5 + 2*k**3 - 5*k + 5*k + 0*k + 2*k**2 to the form p*k**2 + f*k + c + y*k**3 and give p.
2
Rearrange 5*p + 15*p**2 - 3*p + 0*p + 7*p**4 - 9*p**4 + p**3 to c*p**3 + a + t*p**4 + d*p**2 + j*p and give d.
15
Rearrange -6*l**3 + 5*l - l - l**3 to the form j + g*l**2 + n*l + t*l**3 and give n.
4
Express -14*t - 18*t + 12*t in the form b*t + u and |
As a result, just 178 USGS researchers were present at the AGU conference in New Orleans last week — a 60 percent drop from last year. In addition, 30 abstracts for posters or oral presentations, which take weeks to prepare, were withdrawn by USGS scientists who were unable to attend.
AD
AD
According to spokeswoman A.B. Wade, the USGS was not given a rationale for the policy shift.
A spokeswoman for the Interior Department said the decision to limit the number of employees saved hundreds of thousands of tax dollars. She said the larger number of employees who attended the meeting in past years were an example of the Obama administration's “addiction to spending.”
But one USGS scientist who was denied approval to attend the AGU conference just 10 days before the meeting said the crackdown on attendance amounted to the Interior Department “telling us we can’t do our jobs.”
“It's in my position description that I am to conduct research and disseminate that research,” said the scientist, who spoke on the condition of anonymity out of concern for his job. “When I had legitimate science and I had a budget to attend the meeting and I’m told I can’t go, that’s harassment.”
AD
AD
The scientist, who works in USGS’s Climate and Land Use Change mission area, has attended the AGU conference most years since the late 1990s. He helped organize events at the conference, was slated to participate in multiple sessions, and had already booked a plane ticket and reserved a hotel room when he was denied approval for his travel.
Typically, USGS researchers who wish to travel for a conference must apply via an online database. If the conference will cost more than $100,000, USGS officials then submit the requests to the Interior Department for approval.
The annual AGU meeting is the biggest geoscience conference of the year, featuring more than 22,000 scientists from all over the world, and USGS has spent hundreds of thousands of dollars to send roughly 450 researchers for the past several years. Attendees say the conference gives them an opportunity to share their research, meet with far-flung collaborators, find out about funding opportunities, and keep up to date with the most advanced science and technologies in their fields.
AD
AD
Christine McEntee, executive director of the American Geophysical Union, called the drop in this year's USGS attendance “troubling.”
“We’re concerned about it because there’s no better place [than AGU] for the U.S. to share the stellar knowledge and stellar research it has with the world,” she said.
Wade noted that this year's meeting location in New Orleans (it is usually held in San Francisco) may have increased the cost of attendance for some researchers; the USGS has a large campus in Menlo Park, Calif., an easy commute to San Francisco.
But overall registration numbers were typical, and participation by other federal agencies didn't drop by nearly as much, according to the AGU. This year's attendees included 252 scientists from the National Oceanic and Atmospheric Administration — roughly the same as last year — and 735 researchers from NASA, down 13 percent from 2016.
AD
AD
The limit on USGS conference travel also appears to have affected attendance at the annual meeting of the Geological Society of America, which was held this October in Seattle. Melissa Cummiskey, GSA's senior director of meetings, said the number of USGS researchers at the conference was down between 40 and 45 percent from the previous year. Those researchers who were approved to attend found out just a week before the conference, Cummiskey said.
USGS and other Interior Department bureaus could see major spending cuts in the coming year. This summer, Interior Secretary Ryan Zinke told a Senate panel that he planned to shed some 4,000 staffers from the department — about 8 percent of full-time staff. He also defended President Trump's proposal to slash Interior's 2018 budget by more than 13 percent, saying, “This is what a balanced budget looks like.”
Under the stopgap continuing resolutions that have covered government spending since September, the budget for USGS has remained relatively constant.
AD
AD
Meanwhile, the inspector general for the Interior Department opened an investigation in October into Zinke's travel decisions and use of taxpayer funds. Documents obtained through open-records requests have shown that Zinke paid $12,375 for a four-hour chartered flight from Las Vegas to Montana and spent more than $53,000 on three helicopter trips in the summer.
Conference attendance by federal employees has been under scrutiny for much longer. Stricter policies for travel across the federal government were put in place in 2012 after a scandal at the General Services Administration. The inspector general for the GSA published a scathing report about a $823,000 Las Vegas conference that featured a mind reader and a $31,208 reception.
Marcia McNutt, who directed the USGS from 2009 to 2013, said the bureau argued strongly for the importance of attending AGU in the wake of that scandal and was able to send its normal contingent of scientists to the meeting. She noted that the president hasn't yet nominated a USGS director, and the nominee for assistant secretary for water and science (the department official who oversees the bureau) hasn't been confirmed.
AD
AD
“There’s no one there to advocate for the USGS when they need to go to an important meeting like this,” she said.
McNutt, who is president of the National Academy of Sciences, said that the absence of USGS researchers from the AGU conference represents hundreds of lost opportunities for government scientists — a statement the Interior spokeswoman called “hyperbolic.”
“AGU is just this incredibly exciting venue for people to learn from each other and be on the cutting edge,” McNutt said. “If you aren’t there, if you have to wait until all that gets published, you are in the backwoods of science. And all of those people who didn’t get to go are basically sitting there in the backwoods in the dark.” |
Reebok DMX Sky Performance Running Shoe - Mens
Sorry, this item is sold out!Looks like you've got more shoe shopping to do - have fun!
Item # 271251UPC # 886839826277
Lace-up and get moving in these men's DMX Sky performance running shoes for men. Featuring DMXSky outsole technology which channels air exactly where you need it for excellent underfoot cushioning, while the thin, midfoot caging offers lightweight support.
*Your pronation type is determined by the natural motion your feet apply throughout your running gait. When you pronate your foot rolls from either the outer edge, inner edge or not at all. If your foot rolls to the outer edge when you run, you are an underpronator, if it rolls to the inner edge you are a overpronator and if your foot doesn't roll at all you are a neutral or stable runner. |
Juan Correa
Juan Correa (1646–1716) was a distinguished Mexican painter of the late seventeenth and early eighteenth centuries. His years of greatest activity were from 1671 to 1716. He was an Afro-Mexican, the son of a Mulatto physician from Cádiz, Spain of the same name, and a free black woman, Pascuala de Santoyo. Correa "became one of the most prominent artists in New Spain during his lifetime, along with Cristóbal de Villalpando." Manuel Toussaint considers Correa and Villalpando the main exponents of the Baroque style of painting in Mexico. Correa was a very productive religious painter, with two major paintings in sacristy of the Cathedral of Mexico City, one of the Immaculate Conception and the other An Allegory of the Church. He also painted major works for the Jesuit church in Tepozotlan, Mexico (now the Museum of the Viceroyalty). According to Toussaint, Correa is "important in achieving a new quality, in the creative impulse he expresses, and which one cannot doubt embodies the eagerness of New Spain for an art of its own, breaking away from its Spanish lineage. Here New Sapin attains its own personality, unique and unmistakable." Correa was José de Ibarra's teacher.
Gallery
See also
Afro-Mexicans
Castas
Mexican art
References
Further reading
Bailey, Gauvin Alexander. ‘’Art of Colonial Latin America’’. London: Phaidon Press 2005.
Donahue Wallace, Kelly. "A Virgin of Sorrows Attributed to Juan Correa." Anales del Instituto de Investigaciones Estéticas. Vol. 23. No. 79. Universidad Nacional Autónoma de México, Instituto de Investigaciones Estéticas, 2001.
Hyman, Aaron M. "Inventing Painting: Cristóbal de Villalpando, Juan Correa, and New Spain's Transatlantic Canon." The Art Bulletin 99.2 (2017): 102-135.
Toussaint, Manuel. ‘’Colonial Art in Mexico’’. Translated and edited by Elizabeth Wilder Weisman. Austin: University of Texas Press 1967.
Category:Afro-Mexican
Category:Colonial Mexico
Category:17th-century Mexican painters
Category:Mexican male painters
Category:18th-century Mexican painters
Category:People of New Spain
Category:Mexican painters
Category:Religious painters
Category:1646 births
Category:1716 deaths |
Early onset of obesity induces reproductive deficits in female rats.
The incidence of obesity is increasing rapidly all over the world and results in numerous health detriments, including disruptions in reproduction. However, the mechanisms by which excess body fat interferes with reproductive functions are still not fully understood. After weaning, female rats were treated with a cafeteria diet or a chow diet (control group). Biometric and metabolic parameters were evaluated in adulthood. Reproductive parameters, including estradiol, progesterone, LH and prolactin during the proestrus afternoon, sexual behavior, ovulation rates and histological analysis of ovaries were also evaluated. Cafeteria diet was able to induce obesity in female rats by increasing body and fat pad weight, which resulted in increased levels of triglycerides, total cholesterol, LDL and induced insulin resistance. The cafeteria diet also negatively affected female reproduction by reducing the number of oocytes and preantral follicles, as well as the thickness of the follicular layer. Obese females did not show preovulatory progesterone and LH surges, though plasma estradiol and prolactin showed preovulatory surges similar to control rats. Nevertheless, sexual receptiveness was not altered by cafeteria diet. Taken together, our results suggest that the cafeteria diet administered from weaning age was able to induce obesity and reduce the reproductive capability in adult female rats, indicating that this obesity model can be used to better understand the mechanisms underlying reproductive dysfunction in obese subjects. |
By Erol Yayboke
The Issue
Since gaining its independence from Sudan in 2011, South Sudan has struggled to fulfill the promise of a new nation, eventually descending into civil war in late 2013. The country is now bearing the devastating human and financial costs of a complex conflict with ever-changing armed and political actors. Aid organizations face an array of humanitarian access constraints while working to address the acute needs of 7 million people, roughly half of the country. Although there is cause for cautious optimism after a peace agreement was signed in September 2018, these humanitarian needs will only grow in the absence of sustainable peace and a political solution to the man-made crisis in South Sudan.
South Sudan has received significant humanitarian aid from the United States and the international community for decades. Since 2011, total humanitarian funding surpassed $9.5 billion, most of which has been part of the coordinated South Sudan Humanitarian Response Plan (SSHRP). The U.S. government has provided almost $3 billion to the SSHRP, with even more to development priorities.This aid has helped and continues to help millions: in 2017 alone, more than 5 million people received food assistance, almost 3 million people received emergency health kits, and nearly one million children and pregnant and lactating women were treated for malnutrition.
Some hoped that peace and prosperity would follow years of devastating armed conflict. Such hopes were, however, short-lived: South Sudan descended into civil war in late 2013. Since then, more than 4 million South Sudanese, or approximately 1 in 3 of its citizens, 85 percent of whom are women and children, have been forced from home. The protracted crisis is further complicated by domestic political actors who seem immune from or uninterested in the suffering of their people and regional diplomatic processes that often result in fleeting promises of reconciliation before retreat into armed conflict. This has led to a staggering number of South Sudanese caught in the cross fire. Of the 7 million people currently in need of humanitarian aid, 5.3 million are food insecure. A recent study showed that the conflict has led to almost 400,000 deaths since late 2013.
With so much need, the country relies heavily on external humanitarian funding, which should be credited for saving countless South Sudanese lives. However, the UN estimates current needs at $1.7 billion, only half of which has been funded to date. At the same time, the Trump Administration initiated a comprehensive review of its aid programs to South Sudan in May 2018. In its statement, the White House said that while the United States remained “committed to saving lives, we must also ensure our assistance does not contribute to or prolong the conflict, or facilitate predatory or corrupt behavior”. Ultimately, a cessation of hostilities, a more inclusive and reconciliatory political process that results in a functional government delivering services to citizens, and economic growth all are critical for South Sudan to one day emerge from this dark period in its history. These goals have proved elusive, primarily because of armed conflict, and aid groups find themselves dealing with predatory and often corrupt behavior that increases the human and financial costs of humanitarian access. Although similar or even more acute challenges may exist in other places (e.g., Nigeria, Somalia, and Yemen), the constraints in South Sudan on aiding some of the most vulnerable people on the planet are no less formidable.
Inconsistent access in South Sudan is coupled with staggering human costs: today more than half of the country’s population is in need of life-saving humanitarian aid. Protracted and widespread conflict means that people throughout the country are suffering, stretching the capacity of nongovernmental organizations (NGOs) and offering opportunities for state and nonstate actors to manipulate aid for their own, primarily nonhumanitarian purposes. To deliver humanitarian aid to vulnerable people, NGO workers must regularly navigate access with myriad local actors, many of whom are armed. They have limited money, food, supplies, and vehicles and thus see NGO-provided goods as ripe for exploitation.
Thus, the human costs of humanitarian access constraints are most acute for those who are unable to receive assistance. But the costs to the people delivering that aid are also high. The United Nations Office for the Coordination of Humanitarian Affairs (UNOCHA) counts 192 organizations currently responding to the crisis in South Sudan with emergency programs; more than 100 aid workers from these and other organizations have died since the most recent conflict erupted in 2013.9 In 2017, South Sudan was the most dangerous country for aid workers, with 50 percent more workers killed than in Syria and 612 aid workers forced to relocate due to ongoing conflict.10 Already in 2018, 36 aid workers have been kidnapped, with a vast majority of those at risk working for national NGOs.11 In response, many NGOs maintain security apparatuses that add to the already high financial costs of operating in South Sudan. |
The True-Born Englishman
The True-Born Englishman is a satirical poem published in 1701 by Daniel Defoe defending the then King of England William, who was Dutch-born, against xenophobic attacks by his political enemies, and ridiculing the notion of English racial purity. It quickly became popular.
According to a preface Defoe supplied to an edition of 1703, the poem's declared target is not Englishness as such but English cultural xenophobia, against the cultural disturbance new immigrants caused. Defoe's argument was that the English nation as it already existed in his time was a product of various incoming European ethnic groups, from Ancient Britons to Anglo-Saxons, Normans and beyond. It was therefore nonsensical to abuse newer arrivals since the English law and customs would assure their inevitable assimilation:
Extract
This extract was used by historian and political scientist Benedict Anderson as an epigram for his 1983 book Imagined Communities discussing the origins of nationalism.
References
Further reading
Category:English poems
Category:Satirical works
Category:1701 poems
Category:1701 in England
Category:Prejudice and discrimination
Category:Works by Daniel Defoe |
In our last issue we advised the radical left in Britain to be “open to the sudden fissures that the crisis of the British state can…unexpectedly open up, perhaps making possible a qualitative advance”. And the unexpected came very quickly, and in a particularly surprising form.
In the same article we stressed the persistence of Labour, despite the scale of its defeat in May. But we didn’t imagine that the opening for the radical left would come from within the Labour Party, thanks to the extraordinary movement that took shape around Jeremy Corbyn and swept him into the party leadership on 12 September. It was all the more so since his victory came amid a surge of popular support for refugees and migrants—articulated strongly by Corbyn himself and marked by nationwide rallies that very day.
This seems an astonishing reversal compared to what seemed to be the case at the time of the general election in May. Then the contrast was between the triumph of the Scottish National Party north of the border on an anti-austerity ticket and the apparent dominance in England of pro-austerity and anti-migrant politics expressed by all three main parties as well as by the most successful challenger, the UK Independence Party. So what’s happened?
Fundamentally we have discovered that England isn’t after all a little royalist, chauvinist enclave immune to the political processes at work elsewhere in Europe. The experience of crisis and austerity and the corruption and involution of the party system are general phenomena, which are producing political radicalisation to the left as well as to the right. This has been expressed in the rise of Syriza in Greece and of Podemos in the Spanish state. It was clear at the time of the general election that there was a large current of opinion to the left of the Labour mainstream that found expression in voting SNP in Scotland, but went largely unrepresented in England. Now it has found its voice.
This basic driving force is understood even by Peter Mandelson, one of the architects of New Labour. At the same time as denouncing Corbyn’s rise as a “mortal danger” to the Labour Party, he acknowledges: “In different ways and intensities, we are all experiencing our ‘Syriza’ moment”. But this comparison poses a question. Syriza and Podemos are challengers to the mainstream social democratic parties: indeed Pasok (the Panhellenic Socialist Movement) in Greece has been virtually destroyed by its role in imposing austerity. A few months ago it was fashionable to talk about the “Pasokification” of Labour. Now we have seen the left wing rebellion find expression within Labour—not merely through Corbyn’s election, but in the rise in party membership from under 200,000 in May to 342,000 in mid-September.
Paradoxically, Corbyn was able to present himself as an alternative to Labour while campaigning successfully to lead Labour! How do we explain this paradox? Three factors seem important. First, without giving too much importance to individuals, there is Corbyn’s persona. First elected to the House of Commons in 1983, by which time Tony Benn’s star was already waning, Corbyn had been largely marginalised within the Labour Party under successive leaderships. He survived through being a good constituency MP and a dedicated champion of numerous grassroots campaigns. He could therefore plausibly present himself as an outsider to the established party system. His personal qualities—modesty, honesty, moral and political consistency, dedication to the causes he has embraced—reinforced his attractions to those looking for a left wing alternative.
Secondly, there is the nature of Labour itself. Badly damaged in the New Labour era, the party has participated in the general decline of the established political system in the neoliberal era. But despite the drubbing it suffered in May, Labour continues (in England and Wales at least) to maintain the loyalty, however grudging, of many working class people who see it as a shield against the Tory attacks. The continuing importance of the trade unions in the party’s life is one ingredient here. But so too is the role of many inner city constituency parties—including Corbyn’s own Islington North—in campaigning on social issues important to working class communities. The picture is complicated by the role of Labour-controlled councils in implementing austerity, but this makes local parties a focus for lobbying and contestation that keep them alive politically.
Thirdly, there is the changing structure of the Labour Party. Because the configuration of power inside the party will have a decisive impact on the fate of the Corbyn leadership it’s worth looking at this in more detail. Since the modern Labour Party was constituted in 1918, there have been three centres of power within the party—the Parliamentary Labour Party (PLP), the trade union leaders wielding the block vote representing their affiliated members, and the individual members organised into constituency Labour parties (CLPs). Traditionally it was the CLPs that provided the main base of successive movements of the Labour left—the Socialist League in the 1930s, the Bevanites in the 1950s, and the Bennites in the late 1970s and early 1980s.
But all these movements broke themselves on the barrier of the PLP-trade union axis. In his classic study British Political Parties Bob McKenzie quotes a May 1930 entry from the Fabian intellectual Beatrice Webb’s diaries where she records the remark by her husband Sidney, then a Labour cabinet minister, “that the constituency parties were frequently unrepresentative groups of nonentities dominated by fanatics and cranks, and extremists, and that if the block vote of the trade unions were eliminated, it would be impractical to vest control of policy in Labour Party conferences”.
McKenzie comments:
there can be little doubt that he accurately reflected the conviction of the great majority of the parliamentary leadership of the Labour Party then and now. They would find it intolerable if the conference could be dominated or controlled by those (many of whom they consider “fanatics, cranks and extremists”) who turn up in large numbers as delegates from constituency parties. The conference could not be accorded even nominal authority in determining the long-range goals of the party if it were subject to the overriding influence of the constituency party delegates. But the parliamentary leaders have little to fear from the party conference as long as they retain the confidence (and the block vote support) of the traditionally moderate and conservative leadership of the majority of the big trade unions. Indeed it is this bond of mutual confidence between the parliamentary and trade union leadership of the Labour movement which is an essential key to the understanding of the functioning of the Labour Party.
McKenzie was writing in the mid-1950s, when right wing trade union chiefs were helping the Labour leadership see off the challenge of the left wing movement led by Aneurin Bevan, which, through its network of local Brains Trusts, represented the peak of the Labour left’s influence among the CLPs. The Bennite movement 25 years later also benefitted from support in the constituencies as well as the disaffection of some trade union leaders thanks to the upturn in workers’ struggles in the late 1960s and early 1970s and successive Labour governments’ imposition of pay controls. But, after a section of the Labour right broke away in 1981 to form the Social Democratic Party (SDP), the trade union leaders intervened to pull Labour back to the centre under Neil Kinnock’s leadership (1983-92).
This configuration of power, which has bound together two fundamentally conservative forces—the parliamentary Labour leadership, ever pulled towards the centre by electoral pressures and integration into the state apparatus, and the trade union bureaucracy, defined by its role in mediating between labour and capital—is critical to ensuring the bourgeois nature of the Labour Party. As Tony Cliff and Donny Gluckstein put it:
the Labour Party is a capitalist workers’ party… Trade union consciousness and parliamentary reformism are the pillars of Labourism. The Labour Party is the political expression of the trade union bureaucracy, aiming to influence parliament. The trade union bureaucracy is a mediating element between workers and employers. The Labour Party is also a mediating element, except that it is at one remove from the direct struggle at the point of production. In addition the Labour Party leaders are sometimes called upon to run the ship of state: the trade union officials are never given the running of enterprises.
Underlying the failure of Bennism were the defeats suffered by the British working class and the triumph of neoliberalism under the Margaret Thatcher government (1979-90). Famously, Tony Blair after becoming leader of the Labour Party in 1994 sought to reconcile social democracy and neoliberalism. As part of this project, he aspired to break the link between Labour and the unions, turning the party into a “normal” centre-left bourgeois party, closest to the Democrats in the United States. But, typical of Blair’s weakness as a domestic policymaker (masked in the latter years of his premiership by his enthusiasm for imperialist war-making abroad), he never achieved this goal. We can now see that seeking to weaken the union connection was a form of hubris on the part of the Labour right.
Ironically the biggest step towards achieving this aim was taken by Ed Miliband, elected Labour leader in 2010 in part to draw a line under the Blair era. The main reform achieved by the Bennites in their efforts to democratise the party was to make the leader elected not by the PLP but by an electoral college in which MPs, affiliated trade unions, and individual party members had an equal share of the vote. Ironically, this change guaranteed that the leadership would be occupied by “safe” figures from the soft left (Kinnock and Miliband) or the right (John Smith, Blair and Gordon Brown).
But the Blairites long demanded that this be replaced by “one member one vote” (OMOV). Miliband, harried by the Tories because his own victory over his brother David (the Blairite candidate) depended on union support, and after a row with the Unite union over its role in a parliamentary candidate selection in Falkirk, essentially gave in to the right. Henceforth the leader would be elected by individual party members plus affiliated trade unionists and Labour supporters (in the latter case paying the famous £3 for the privilege).
Never can there have been a clearer case of Be Careful What You Wish For. But the right’s advocacy of OMOV made a certain sense. It could be justified as a response to change—the fraying social connections of all mainstream parties, the more atomised societies of the neoliberal era. And the composition of the CLPs itself changed in the Blair era, as left wingers, and even less militant but traditional social democrats, left in disgust, and relatively affluent middle class supporters of New Labour joined up.
Patrick Wintour points out that in the 2010 leadership election:
by the final round among party members David Miliband received 54.4 percent of the vote to Ed Miliband’s 45.6 percent. David Miliband won outright in 540 constituencies (more than 85 percent of the total), whereas Ed Miliband won outright in just 73 (12 percent). Diane Abbott, the left wing candidate at that time, did not win a single constituency.
In 2015, as Wintour notes, only 71,546 union supporters voted compared to 245,520 party members and 105,000 registered supporters. But Corbyn won 49.59 percent of the members, 83.76 percent of the supporters and 57.61 of trade unionists—an overall first preference victory of 59.5 percent. This result can’t be dismissed as merely an effect of the influx of supporters after he announced his candidacy in June. If the election had been confined to members, Corbyn would certainly have won once the second preferences of the lower performing candidates (Liz Kendall and Yvette Cooper) had been redistributed. The Labour Party membership has been recomposed—first of all thanks to Miliband’s very timid attempts to distance himself from Blair and Brown and then as a result of the inflow of new members that started after his defeat in May.
None of this alters the fact that Labour’s working class roots have become much weaker since the heyday of Bevanism, when individual party membership peaked at 1,014,524 in 1952, nearly three times the present figure. McKenzie, an academic who also pursued a successful TV career, presciently suggested: “Perhaps in retrospect it will be evident that the mass party saw its heyday during the period when the extension of the franchise had created a mass electorate but there was as yet no effective means of reaching the voters in their own homes” via radio, TV, and now the internet.
But what we can now see is that the very loosening of mainstream parties’ social anchorage means that—with the help of Facebook and Twitter—they can, in the right circumstances, become the vehicle of wider currents of protest. As Corbyn himself acknowledges, his campaign was powered in large part by the different mass movements that he has championed, notably the People’s Assembly against Austerity and the Stop the War Coalition. Seumas Milne puts what has happened well:
Politics is polarising in response to over a decade of falling living standards, rising insecurity and economic crisis. The media and political establishment has proved incapable of managing the intrusion of Corbyn’s democratic insurgency into what had seemed a well-insulated elite order. Media organisations that have for years called every major issue wrongly, from the war on terror to the economy, find themselves unable to deal with a movement that has overturned the rules of the game.
The key question is, of course, what happens now. Before considering Corbyn’s options, it’s worth noting that his victory probably is curtains for the hardcore Blairites. The interventions the New Labour elite—Blair himself, Mandelson, Alastair Campbell—made during the election campaign were hugely counter-productive. Their candidate, Kendall, achieved a humiliating 4.5 percent of the vote. Even the election as deputy leader of Tom Watson, who initiated the ministerial revolt in 2006 that forced Blair to name a date for his retirement, must be a bitter pill for the Blairites to swallow.
Their ability to mount a damaging split comparable to the SDP breakaway seems limited. They lack big hitters comparable to the Gang of Four (Roy Jenkins, David Owen, Shirley Williams and Bill Rodgers) who led the 1981 secession. Moreover, the wretched plight of the Liberal Democrats hardly makes them an inviting ally. The rumour, reported by Robert Peston, that “one or a number of the New Labour Blairite ultras could cross the floor to the Tories, because of their personal relationship with [George] Osborne—to whom they feel closer, in a political and social sense, than they do to Labour’s new leader, Jeremy Corbyn”, is a sign of their weakness rather than their strength.
This doesn’t mean that Corbyn has an easy hand to play. The dominant oligarchic structure of power in the Labour Party has been destabilised, not destroyed. He faces three outright enemies: the PLP, the Tories and the media, one threatening embrace—the British state, and one unreliable ally—the trade union leaders. The response to Corbyn’s victory by Labour MPs, hardly any of whom voted for him, was one of uncomprehending and childish fury. This is expressed both in the flood of refusals to serve in his shadow cabinet (in many cases before they had been asked) and in the willingness of those who agreed to accept posts to criticise him publicly. This reaction shows a contempt for the Labour Party’s democratic processes (no doubt many MPs would happily dismiss those who voted for Corbyn as Webb’s “fanatics, cranks and extremists”) that may well rebound on them. But undoubtedly the PLP is determined to bully him into “responsibility”.
The other open enemies, the media and the Tories, go together. What used to be called Fleet Street remains dominated by pro-Tory big business (though even the supposedly centre-left Guardian was hostile to Corbyn’s candidacy). In all likelihood we are going to see a rerun of the vicious campaign of media vituperation that a generation ago sought to destroy Tony Benn and Michael Foot. What Miliband suffered was a much milder version, though by the end the baying ranks of Tory backbenchers at Prime Minister’s Question Time and relentless media barracking wore down his public presence.
David Cameron’s initial response to Corbyn was subtler, though still designed to destroy, according to the Financial Times:
The first element is to treat Mr Corbyn with respect, an acknowledgment that the Labour leader is a product of a profound anti-politics mood in the country, disdainful of spin and boorish behaviour in the House of Commons… Mr Corbyn’s courteous style and refusal to engage in personality politics makes him a difficult target in the Commons; the public might respond badly to him being targeted for ridicule or mockery. Instead Mr Cameron and George Osborne plan to attack Mr Corbyn on his policies, with a focus on the threat he poses to the “security” of Britain and the economic wellbeing of families. Their strategy is to argue that Mr Corbyn is not some eccentric aberration to be targeted as an individual; rather that his overwhelming mandate as Labour leader proves he now represents mainstream Labour thinking. Mr Osborne is particularly determined to make sure that Mr Corbyn’s failings damage the Labour brand.
And then there is the British state. In winning the Labour leadership Corbyn has taken up a position in that state, as Leader of Her Majesty’s Opposition and potential prime minister. The initial media kerfuffles over his attitude to the monarchy weren’t simply symbolic. The very first Labour government in January 1924 demonstrated that it was no threat to the established order by the eagerness with which its members affirmed their loyalty to the Crown. Beatrice Webb recorded that the new ministers “were all laughing over Wheatley—the revolutionary—going down on both knees and actually kissing the King’s hand” when he received the seals of office from George V. These charades are about securing Labour leaders’ commitment to loyally serving the British state.
Jeremy Corbyn is a republican, a socialist and an anti-imperialist, so this is a big ask. But the record of previous left wing Labour leaders is not a happy one. George Lansbury inherited the leadership by default in 1932, as the only ex-cabinet minister left in the House of Commons after the disaster of Ramsay MacDonald’s betrayal. He had emerged through the struggles of the working class in the East End of London—above all, the efforts during the 1920s of the London borough of Poplar to provide the unemployed with decent support. A J P Taylor calls him “the most lovable figure in modern politics”.
But he fronted a policy described by Ralph Miliband as “MacDonaldism without MacDonald”, for example, opposing proposals that Labour-controlled councils should refuse to implement the Tory-dominated national government’s means test on unemployment relief. In permanent conflict with the Labour National Executive Committee over his pacifism, Lansbury was forced out after a particularly brutal attack by Ernest Bevin, general secretary of the Transport and General Workers’ Union, at the 1935 party conference.
Michael Foot succeeded James Callaghan in 1980 and initially made a powerful impact outside parliament by addressing a series of mass demonstrations against unemployment. But he was then dragged down by his efforts to appease the Labour right and discredited by his urging Thatcher on her war with Argentina over the Falklands. He resigned after presiding over a devastating electoral defeat in 1983.
Corbyn is by background closer to Lansbury than to Foot. Foot, despite his history as Bevan’s loyal aide, was a lifelong House of Commons man whose parliamentarianism was expressed in his friendship with Enoch Powell, with whom he was frequently in political alliance on issues such as House of Lords reform and Europe. Corbyn—as we have already seen, marginalised in the House of Commons—has used his parliamentary role to support a variety of extra-parliamentary movements and struggles.
Moreover, unlike Lansbury, who told the 1934 Labour conference: “I have never considered myself leader—but as the spokesman of my colleagues in the House of Commons… It was an accident that put me there”, Corbyn has sought the leadership and won a thumping victory. This gives him considerable authority. But he can only hope to counter the forces lined up against him with powerful extra-parliamentary support.
One potential source of that support is those fickle friends, the trade union leaders. Corbyn’s campaign won the backing of a number of major unions. At least two factors were involved. First, it’s clear that many leading union officials are thoroughly fed up with the ignorance and indifference that much of the parliamentary leadership display towards the organised working class. Backing Corbyn was an opportunity to get the PLP’s attention. Secondly, there are more specifically political reasons. Len McCluskey, Unite general secretary, has made no secret of his desire to wipe New Labour out and “reclaim” the party for the left. Corbyn’s candidacy posed for people like him the question: If not now, when? Unite gave significant organisational support to his campaign (though the idea that this was the reason for his victory is plain silly).
The union leaders’ backing can both help Corbyn and hold him back. As we have seen, the union bureaucracy is the crucial social underpinning of Labour’s parliamentary reformism. Like the rest of the party, it will judge Corbyn by his ability to deliver electoral success—above all, to win in 2020 and repeal the anti-union law now being pushed through by the Tories. Already the union leaders’ moderating pull is being felt. McCluskey is widely rumoured to have lobbied Corbyn not to make his fellow left winger John McDonnell shadow chancellor of the exchequer. Happily Corbyn ignored this advice, only to see the unions vote against a discussion of Trident at the Labour Party conference. He doesn’t have the union leaders to thank for his victory, which gives him considerable authority to pursue his own path. But his ability actually to do so depends on his being able to turn the movement that crystallised to support him into something long-lasting. This faces several difficulties.
First of all, a substantial movement of activists, based mainly in the CLPs, gathered around Benn at the end of the 1970s. But its defeat—and the wider defeat of the workers’ movement under Thatcher—caused the Labour left to dwindle away. Its weakness was reflected in the 7.42 percent of first preferences that Diane Abbott as the candidate of the “hard left” won in the 2010 leadership election. Many of the surviving Labour left activists helped to drive Corbyn’s campaign. But to face off the PLP he will need to persuade thousands of the people who joined Labour or registered as supporters to vote for him to become active members, turning up regularly to their local branch meetings and constituency general committees and all-member meetings. But the gap between largely online participation in Corbyn’s campaign and involvement week-in, week-out in Labour’s internal life is a big one.
This poses, secondly, the question of how to motivate these potential activists. One of the weaknesses of the Bennite movement was its preoccupation with the inner-party struggle. This led it to ignore the way in which the economic defeats being suffered by workers were pulling the rug from under it. Cliff summed up this contradiction with the formula “political upturn, industrial downturn”: the contradiction was resolved by the defeat of the Labour left. But it’s clear that what motivated people to back Corbyn were the broader causes he championed—in a nutshell, resistance to austerity, war and racism. Sustaining their involvement will require also sustaining the movements around these different (though interconnected) causes. But this is a recipe for endless conflict with the Labour right-wingers in the House of Commons. Products of the New Labour era, they are entirely sincere in supporting, for example, a benefit cap, military action against ISIS, or clamping down on immigration. It’s precisely to oppose such policies that people voted for Corbyn.
Thirdly, Labour is fundamentally an electoral party. It exists, in other words, to contest and win elections. Corbyn will be judged fundamentally by this criterion. One especially odious right wing Labour MP, John Mann, put it crudely, but his basic view is widely shared in the party mainstream: “If Corbyn breathes new life into Labour in the Scottish elections next year, delivers a crushing victory for us in Wales and improves our position in England, he will have earned the right to lead us into the next General Election. But if he fails to do that, my party must act”.
The pressure to deliver electorally will constantly cut across the effort to widen the net of left-Labour activists and sustain the social movements behind Corbyn’s victory. The pressure can be seen in his efforts to conciliate enough right wingers to serve in the shadow cabinet by, for example, retreating from his earlier policy of making Labour support for a Yes vote in the EU referendum conditional on Cameron not seeking “reforms” that “undermine rights at work”. But if he pursues this path of compromise, he could end up like Foot, abandoned by the left and despised by the right.
The fate of the Corbyn leadership electorally will be tied up with its ability to offer an economic alternative to austerity that captures people’s imaginations. Some proposals—renationalising the railways and clamping down on corporate tax-dodging—are popular. The key macroeconomic policy, developed by the tax reformer Richard Murphy, is “People’s Quantitative Easing (QE)”. This would involve the Bank of England buying the bonds and other assets of local councils, housing associations, and a new National Investment Bank. The money thereby created could then be used by these institutions to fund productive investment.
The quirky right winger Ambrose Evans-Pritchard, international business editor of the Daily Telegraph, says this “is exactly what the world will need if the global economy tips into another recession with interest rates already at zero and debt ratios stretched to historic extremes”. But, further to the left, the Marxist economist Michael Roberts has been a consistent critic of the idea, often put forward by post-Keynesian economists, that QE, by pumping money into the economy, can overcome the stagnation caused fundamentally by a relatively low rate of profit. He points out that People’s QE would leave the bulk of the British economy in the hands of private corporations that have cut investment significantly since the onset of the global crisis in 2007 and are unlikely to change course without a significant rise in profitability.
What this controversy highlights is the fact that Corbyn’s and McDonnell’s programme is, hardly surprisingly given that they are long-standing members of the Labour Party, a reformist one. Indeed, Corbyn’s victory must be seen as one manifestation of a new wave of reformism that has been developing in Europe over the past few years (and even beyond Europe, as Bernie Sanders’s phenomenal performance in the American presidential campaign shows). This new reformism differs in many ways from older versions of social democracy, but it essentially seeks to reverse austerity, increase economic growth, and reduce inequality without directly challenging the existing structures of capitalist power (including, in the case of Syriza and Podemos, those of the European Union and the eurozone).
The trouble is that this new reformism has been brutally tested at the other end of Europe, in Greece under Alexis Tsipras’s short-lived first government. Swept to office in a revolt against austerity in Greece, Syriza found itself locked in permanent confrontation with the EU. The astonishing step forward represented by the referendum of 5 July—nearly 62 percent of the electorate voting No to the EU demands for yet more austerity—was followed barely a week later on 13 July by Tsipras signing a new agreement in Brussels that subjects Greece to a third and even harsher memorandum of understanding. After Syriza split over this capitulation, he called a snap election on 20 September that returned him to office on roughly the same share of the vote he had won in January.
Back in April the Financial Times reported:
Eurozone authorities’ frustration with Greece has grown so intense that a change in the current Athens government’s make-up, however far-fetched, has become a frequent topic of conversation on the sidelines of bailout talks. Many officials—up to and including some eurozone finance ministers—have suggested privately that only a decision by Alexis Tsipras…to jettison the far left of his governing Syriza party can make a bailout agreement possible.
Far-fetched or not, the EU has got its way and more. Panos Garganas diagnoses this tragic reversal in the next article in this issue. But something needs to be said about it here because of a strange amnesia that grips many on the radical left. Many enthusiasts for Corbyn a few months ago were hoping for a “British Syriza”. But shouldn’t there be some reflection on what happened to the original Syriza? What implications does it have for the development of a new left, here in Britain included? Addressing this question can be divisive. Some leading left wing intellectuals—for example, Leo Panitch and Slavoj Žižek—have defended Tsipras, basically on the grounds that there was no alternative. This disagreement underlines that the progress of the left is not a smooth continuous upward advance, but a polarised process involving debates, divisions and sometimes splits.
Of course, there is a long history of reformist governments reversing their policies under pressure from capital—think of Harold Wilson in Britain in the mid-1960s and mid-1970s or François Mitterrand in France in the early 1980s. The usual mechanism for disciplining governments has been capital flight causing a currency crisis. But of course, Greece no longer has a national currency. So a new mechanism came into play—the European Central Bank, first rationing liquidity to Greek banks and thereby encouraging a bank run, and then, by ceasing to make further loans, shutting the entire banking system down at the end of June.
In some ways this is a politically more potent weapon than currency crisis since closing the banks directly attacks the pockets of individual citizens. But it could have been countered. The No victory in the referendum was achieved in defiance of the bank shutdown. Shortly after he was effectively sacked as Greek finance minister after the referendum, Yanis Varoufakis revealed that he had created a team to prepare a “Plan B” involving, for example, “a parallel banking system while the banks were shut as a result of the ECB’s aggressive action to give us some breathing space”. But he never received the authorisation from Tsipras to go ahead. The problem wasn’t lack of technical means, but of the political will to seek an alternative to capitulation. Sustaining this alternative would have depended on turning the popular rejection of austerity in the referendum into much more sustained mass mobilisation and self-organisation.
Syriza was meant to be a new kind of anti-capitalist party. But in reality Tsipras’s cave-in has recapitulated in six months the movement from left reformism to social liberalism that it took Pasok 20 years to accomplish. Along the way, under Andreas Papandreou during the 1980s, Pasok achieved political and social reforms for the Greek working class. Syriza in government delivered nothing of substance and is now committed to an even more vicious programme of austerity than those mandated by the first and second memorandums.
The new government won’t have an easy ride. Tsipras concentrated his fire on the Greek Tories, New Democracy, already thrown into disarray from defeat in the referendum. But turnout fell to a historic low of 56.6 percent. Syriza lost 300,000 votes, half to Popular Unity (PU), the new party formed by Syriza’s Left Platform in August. Some 9.46 percent of the vote went to parties to the left of Syriza. This provides a good starting point for resistance to Tsipras’s attempts to deliver on his devil’s pact with Brussels.
Some on the radical left have simply switched their allegiances from Syriza to PU. But its leadership around Panagiotis Lafazanis hardly laid a strong basis for the new party when in government. They greeted Tsipras’s reversal of the referendum result with byzantine parliamentary manoeuvres (in the first parliamentary vote on 10 July a couple voted against while the rest either voted for it or abstained) and, rather than resign their ministerial positions and start campaigning publicly immediately, waited for several weeks to be sacked by Tsipras.
PU argues, correctly, that Greece should leave the eurozone, but surely the problem with Syriza lay deeper than Tsipras’s refusal to abandon the euro? Even one of its supporters has admitted: “Some of the problematic aspects of Syriza—both in terms of a certain bureaucratic organisational culture and of a reformist conception of the political programme—are being reproduced inside Popular Unity”. Tsipras called a snap election in part to deny PU the time to organise properly, which no doubt helps to explain why it didn’t get past the 3 percent barrier to obtaining seats in parliament.
But there needs to be much more reflection on the causes of Syriza’s failure. One main lesson of the Greek experience is to avoid becoming trapped in the media and parliamentary bubble. The strength of the new left derives from the social movements that have pushed it forward. Whether it is a matter of rebuilding the anti-austerity left in Greece or sustaining Corbyn’s leadership, the starting point must be the streets and the workplaces, not parliament.
Finally, how and—above all—where should socialists organise? The flood into the Labour Party has swept along many ex-members of the revolutionary left. The climate is in some way reminiscent of the euphoria surrounding Syriza particularly at the time of its electoral breakthrough in 2012. The Greek Socialist Workers Party (SEK) was criticised then for not joining Syriza and instead building Antarsya (the Front of the Anticapitalist Left) together with other far-left organisations. SEK’s choice has now been fully vindicated. Antarsya’s independent stance hasn’t led to isolation—the general secretary of Syriza actually thanked it for its role in the referendum campaign. But it did allow it immediately to challenge Tsipras’s subsequent betrayal without the initial hesitations or equivocations of the Left Platform.
In the direct confrontation between its government and the structures of capitalist power, Syriza buckled. Corbyn is just beginning to deal with these structures and their especially insidious manifestations within the Labour Party itself. We in the Socialist Workers Party will continue to support him against the right. But we shall do so as an independent organisation. As revolutionary socialists, we have inherited the Marxist critique of reformism, which has just been confirmed again in Greece. This theoretical understanding will make us particularly effective in the fight against the right, and in warning Corbyn that, if he compromises with them, he will destroy his leadership.
In this struggle we welcome continuing to work side by side with members of the Labour Party new and old (as we have for many years with Corbyn himself). Because our organisation is geared to intervening in and building social movements, strikes, demonstrations and other forms of contestation, we can act untrammelled by the structures of the Labour Party, governed as they are by the very different rhythms of elections and inner-party manoeuvres. We look forward to helping to shape this exciting new phase in the history of the British left.
Notes |
Identification of a neural stem cell in the adult mammalian central nervous system.
New neurons are continuously added in specific regions of the adult mammalian central nervous system. These neurons are derived from multipotent stem cells whose identity has been enigmatic. In this work, we present evidence that ependymal cells are neural stem cells. Ependymal cells give rise to a rapidly proliferating cell type that generates neurons that migrate to the olfactory bulb. In response to spinal cord injury, ependymal cell proliferation increases dramatically to generate migratory cells that differentiate to astrocytes and participate in scar formation. These data demonstrate that ependymal cells are neural stem cells and identify a novel process in the response to central nervous system injury. |
from matplotlib.finance import quotes_historical_yahoo
from datetime import date
import numpy as np
from scipy import signal
import matplotlib.pyplot as plt
from scipy import fftpack
from matplotlib.dates import DateFormatter
from matplotlib.dates import DayLocator
from matplotlib.dates import MonthLocator
today = date.today()
start = (today.year - 1, today.month, today.day)
quotes = quotes_historical_yahoo("QQQ", start, today)
quotes = np.array(quotes)
dates = quotes.T[0]
qqq = quotes.T[4]
y = signal.detrend(qqq)
alldays = DayLocator()
months = MonthLocator()
month_formatter = DateFormatter("%b %Y")
fig = plt.figure()
fig.subplots_adjust(hspace=.3)
ax = fig.add_subplot(211)
ax.xaxis.set_minor_locator(alldays)
ax.xaxis.set_major_locator(months)
ax.xaxis.set_major_formatter(month_formatter)
# make font size bigger
ax.tick_params(axis='both', which='major', labelsize='x-large')
amps = np.abs(fftpack.fftshift(fftpack.rfft(y)))
amps[amps < 0.1 * amps.max()] = 0
plt.plot(dates, y, 'o', label="detrended")
plt.plot(dates, -fftpack.irfft(fftpack.ifftshift(amps)), label="filtered")
fig.autofmt_xdate()
plt.legend(prop={'size':'x-large'})
ax2 = fig.add_subplot(212)
ax2.tick_params(axis='both', which='major', labelsize='x-large')
N = len(qqq)
plt.plot(np.linspace(-N/2, N/2, N), amps, label="transformed")
plt.legend(prop={'size':'x-large'})
plt.show()
|
[Correction of unstable osteosynthesis following intertrochanteric osteotomy].
When a tension-wire osteosynthesis with right angle plate after intertrochanteric osteotomy breaks down, one may achieve an undminished result and sufficient stability using the same principle -tension wiring -in another way. Improvements in the AO osteosynthesis-material might further raise the firmness of tension. |
Q:
how to insert special fav icon bar on the web
Is it possible to insert special icon bar on the web like this (show icon front of address bar from firefox 3.0)
How do it?
Thanks
eBattulga
A:
If you are talking about the Security ID button located in the address bar:
(source: mozilla.com)
This is shown when the site is browsed via SSL/TLS (HTTPS) with a valid signed certificate. In order to implement that, you will need to purchase a certificate from a trusted certificate authority and configure your server to use that certificate.
|
/*
MIT License http://www.opensource.org/licenses/mit-license.php
Author Tobias Koppers @sokra
*/
"use strict";
const SingleEntryDependency = require("./dependencies/SingleEntryDependency");
class SingleEntryPlugin {
constructor(context, entry, name) {
this.context = context;
this.entry = entry;
this.name = name;
}
apply(compiler) {
compiler.plugin("compilation", (compilation, params) => {
const normalModuleFactory = params.normalModuleFactory;
compilation.dependencyFactories.set(SingleEntryDependency, normalModuleFactory);
});
compiler.plugin("make", (compilation, callback) => {
const dep = SingleEntryPlugin.createDependency(this.entry, this.name);
compilation.addEntry(this.context, dep, this.name, callback);
});
}
static createDependency(entry, name) {
const dep = new SingleEntryDependency(entry);
dep.loc = name;
return dep;
}
}
module.exports = SingleEntryPlugin;
|
/*
* Copyright (c) 2018 EKA2L1 Team
*
* This file is part of EKA2L1 project
* (see bentokun.github.com/EKA2L1).
*
* This program is free software: you can redistribute it and/or modify
* it under the terms of the GNU General Public License as published by
* the Free Software Foundation, either version 3 of the License, or
* (at your option) any later version.
*
* This program is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
* GNU General Public License for more details.
*
* You should have received a copy of the GNU General Public License
* along with this program. If not, see <http://www.gnu.org/licenses/>.
*/
#pragma once
#include <common/types.h>
#include <kernel/server.h>
#include <utils/dll.h>
namespace eka2l1 {
const std::string get_loader_server_name_through_epocver(const epocver ver);
class loader_server : public service::server {
/*! \brief Parse a E32 Image/ Rom Image, and use informations from parsing to spawn a new process.
*
* arg0: TLdrInfo contains spawn request
* arg1: Contains path to the image.
* arg2: Contains extra argument for the process.
*
* request_status: Error code.
*/
void load_process(service::ipc_context &context);
/*! \brief Parse a E32 Image / Rom Image, and use informations from parsing to spawn a new library.
*
* arg0: TLdrInfo contains spawn request
* arg1: Contains library name.
* arg2: Contains library path.
*
* request_status: New Process handle.
*/
void load_library(service::ipc_context &context);
/*! \brief Get library/executable info (uids, security layer, capatibilities, etc..).
*
* arg0: TLdrInfo that will contain library/executable general info
* arg1: Name
* arg2: Buffer contains external info
*/
void get_info(service::ipc_context &context);
void delete_loader(service::ipc_context &context);
void check_library_hash(service::ipc_context &context);
public:
explicit loader_server(system *sys);
};
}
|
Friday, July 13, 2012
My Blog---My 'Things to Remember'
Practicing the Presence:
Be present as the watcher of your mind -- of your thoughts and emotions as well as your reactions in various situations. Be at least as interested in your reactions as in the situation or person that causes you to react. Notice also how often your attention is in the past or future. Don't judge or analyze what you observe. Watch the thought, feel the emotion, observe the reaction. Don't make a personal problem out of them. You will then feel something more powerful than any of those things that you observe: the still, observing presence itself behind the content of your mind, the silent watcher.
Reincarnation doesn't help you if in your next incarnation you still don't know who you are.
~ Eckhart Tolle Stillness Speaks
I'm a slooooow learner when it comes to 'observing WITHOUT reacting' :D; and I DO NOT want to 'reincarnate'---this time around will do it for me, thank you very much.
Ahhh...the joy of wanting to come back because it is so fun....silent witness is great for all those troubling times...if I could come back as a Tiger Swallowtail in her black dress I think I would...I would like to come to my gardens....maybe even a fly about inside? or maybe I could be a female Northern Cardinal....who lives in my garden? Lots of seeds and waterand such nice humans...Sherry, who is glad you are here now... |
The relevance of persisters in tuberculosis drug discovery.
Bacterial persisters are a subpopulation of cells that exhibit phenotypic resistance during exposure to a lethal dose of antibiotics. They are difficult to target and thought to contribute to the long treatment duration required for tuberculosis. Understanding the molecular and cellular biology of persisters is critical to finding new tuberculosis drugs that shorten treatment. This review focuses on mycobacterial persisters and describes the challenges they pose in tuberculosis therapy, their characteristics and formation, how persistence leads to resistance, and the current approaches being used to target persisters within mycobacterial drug discovery. |
Introduction {#s1}
============
One of the central issues in evolutionary physiology is the question of what mechanisms led to the evolution of complex adaptations. The evolution of endothermy, the internal production of heat, has been of particular interest as this mode of living not only provides benefits, but also harbors many costs (Bartholomew, [@B4]; Withers et al., [@B45]). Endothermy allowed birds and mammals to uncouple their lives from external sources of heat to become nocturnal and also to be active in cold habitats. However, to fuel such an existence endotherms must consume large amounts of food to provide enough energy to maintain a high and stable body temperature (T~b~). Therefore, the question of what selection forces have led to such an energetically wasteful strategy has been subject to vivid discussion for already several decades (e.g., Bennett and Ruben, [@B6]; Hayes and Garland, [@B17]; Farmer, [@B12], [@B13]; Koteja, [@B26], [@B27]; Angilletta and Sears, [@B2]; Grigg et al., [@B16]; Kemp, [@B23]; Geiser, [@B14]; Clarke and Pörtner, [@B10]; Lovegrove, [@B30], [@B31]). According to one of the hypotheses, the aerobic capacity model, high basal metabolic rates (BMR), i.e., a key feature of mammalian and avian endothermy, evolved as a correlated response to selection for high perpetual locomotion fueled by aerobic metabolism (Bennett and Ruben, [@B6]). The assumption of a positive correlation between aerobic capacity and BMR has been subject to numerous comparative, individual-level phenotypic and quantitative genetic analyses, which have generally provided convincing support (e.g., Hayes and Garland, [@B17]; Sadowska et al., [@B40]; Auer et al., [@B3]). However, to our knowledge, the question of how selection for high aerobic exercise performance affects other thermoregulatory traits has not been intensively studied. Therefore, the present study is based on a unique experimental evolution model system, with lines of the bank vole (*Myodes glareolus*) selected for several generations toward an increased exercise-induced aerobic metabolism (Sadowska et al., [@B38]; Konczal et al., [@B24]). In our previous reports, we showed that the selection indeed resulted in an increased BMR (Sadowska et al., [@B41]) and increased thermogenic capacity (the maximum cold-induced rate of oxygen consumption; Dheyongera et al., [@B11]). Here we ask, how the selection affected the "thermoregulatory curve" and other thermoregulatory traits.
The thermoregulatory curve (Figure [1](#F1){ref-type="fig"}), also known as the Scholander-Irving model, depicts the pattern of changes of resting metabolic rate (RMR) of an endothermic homeotherm over a range of ambient temperatures (T~a~) (Scholander et al., [@B42]; McNab, [@B32]; Riek and Geiser, [@B36]; Levesque et al., [@B29]). In a range of T~a~ termed the thermoneutral zone (TNZ), heat balance can be maintained without producing extra heat above the level of BMR. At T~a~ below the lower boundary of TNZ (i.e., the lower critical temperature; LCT), RMR increases to compensate for greater heat loss. According to a simplified linear model, the heat loss, and hence RMR, is proportional to a total thermal conductance coefficient (*c*), which incorporates both the properties of thermal insulation of the animal\'s body and characteristics of evaporative heat loss: RMR = *c*(T~b~−T~a~) (McNab, [@B32]). If heat loss exceeds the thermogenic capacity of the animal, hypothermia occurs. On the other hand, at T~a~ above the upper boundary of the TNZ (i.e., the upper critical temperature; UCT), costly mechanisms of dissipating excess heat must be engaged to avoid overheating, such as increased evaporative cooling and increased blood circulation to distal body parts (these are depicted by the entire thermoregulatory curve model and cannot be explained by the Scholander-Irving model itself). Such processes, as well as passive thermodynamic effects due to an increased T~b~, result in an elevated RMR, and consequently an enhanced thermoregulatory burden. Therefore, the increase of RMR above the TNZ is typically more rapid than that below the TNZ, and animals may become severely hyperthermic at T~a~\'s just above the TNZ.
{#F1}
In the current study we aimed to quantify how the above-described thermoregulatory characteristics changed in lines of bank voles subject to selection for high rates of oxygen consumption achieved during swimming ($\overset{˙}{\text{V}}$O~2~swim; Sadowska et al., [@B38], [@B41], [@B39]). In generations 11--14 of the selection experiment, voles from the selected "Aerobic" (A) lines achieved about a 50% higher $\overset{˙}{\text{V}}$O~2~swim than those from unselected, control (C) lines. Not surprisingly, both the spontaneous locomotor activity in cages and the maximum forced-running oxygen consumption (the aerobic capacity *per se*) were also increased in the A lines (Jaromin et al., [@B20]), as well as some other morphological and biochemical traits related to exercise metabolism (Stawski et al., [@B44]; Jaromin et al., [@B21]). Importantly, the swimming trials are performed at 38°C, therefore the direct selection is imposed on locomotor performance only, and not on thermoregulatory capability. According to the aerobic capacity model, however, we predicted that the evolution of aerobic exercise performance should also drive the evolution of thermoregulatory properties. Indeed, voles from the A lines evolved also a 7.3% higher mass-adjusted BMR, increased rate of food consumption (and hence presumably an increased average daily heat production), and increased thermogenic capacity (Sadowska et al., [@B38], [@B41]; Dheyongera et al., [@B11]). Thus, a few traits crucial in shaping the thermoregulatory curve have changed in response to selection for aerobic exercise performance (although others, namely the capacity for nonshivering thermogenesis, NST, remained unaffected; Stawski et al., [@B43]). Therefore, we hypothesize that other characteristics, especially the boundaries of the TNZ, thermal conductance, and T~b~ at high T~a~ have also changed.
As we already know that BMR (i.e., RMR measured in the TNZ in fasted animals; McNab, [@B32]), measured at a T~a~ of 28°C chosen to be plausibly within the TNZ of voles based on published data (Górecki, [@B15]), increased in the A lines (Sadowska et al., [@B41]), a straightforward expectation is that RMR measured at T~a~ around 28°C should be also higher in the A than in the C lines. However, further predictions can be only conditional, depending on how thermal conductance and T~b~ have changed (Figure [1](#F1){ref-type="fig"}). Under the laboratory conditions of our selection experiment, the voles are housed at 20°C, i.e., at a temperature below the TNZ. Thus, there is no strong argument to expect that increased BMR should result in a change of thermal insulation in the A lines. If this is the case we should expect that in the A lines: (1a) both the LCT and the UCT will be markedly shifted downwards (although not necessarily by the same amount, as the values are determined by distinct physical and physiological process), (1b) as a consequence of a lower UCT, at a particular T~b~ above the UCT the increase of RMR will be higher and a more profound hyperthermia will occur, and (1c) below the LCT the thermoregulatory curve will overlap with that of the C lines. However, if the thermal insulation of the selected voles has decreased proportionally to the increase of BMR, and they evolved a more efficient mechanism for dissipating excess heat by evaporative cooling or transferring excess heat to distal body parts, we can expect that in the A lines: (2a) the position of the TNZ will remain unaffected, (2b) above the UCT the increase of RMR will be less steep, and (2c) below the LCT the thermoregulatory curve will be steeper than in the C lines as a result of higher heat loss. If, on the other hand, voles from the A lines have an increased T~b~ yet their thermal insulation properties have not changed, then we might expect that: (3) the entire thermoregulatory curve will be shifted upwards, but the lines will remain parallel. Still more scenarios can be envisioned if we consider the possibility that both thermal insulation and T~b~ have evolved. Thus, even though the physical process we consider is relatively simple and technically "hard" predictions can be formulated, the experiment has, inevitably, an exploratory nature.
Materials and methods {#s2}
=====================
This study was undertaken on bank voles (*M. glareolus*) from the 13th and 14th generations of the artificial selection experiment. Information about the base population, the rationale of the ongoing experiment, selection protocol, and direct response to the selection has been presented in our earlier work (Sadowska et al., [@B38], [@B41]; Konczal et al., [@B24]). To summarize, the base colony was founded using \~320 voles captured in the Niepołomice Forest in southern Poland in 2000 and 2001. The animals were bred randomly for 6--7 generations, and the colony was used for quantitative genetic analyses of metabolic rates (Sadowska et al., [@B40]). In 2004, the multidirectional selection experiment was established (Sadowska et al., [@B38]). In the selected "Aerobic" (A) lines used in this current work, the selection criterion was the maximum mass-independent (residual from regression) 1-min rate of oxygen consumption achieved during an 18-min swimming trial, performed at the age of 75--85 days. The swim test was conducted at 38°C, at a temperature close to T~b~ of the voles, so that no thermoregulatory burden was imposed (neither excessive heat loss nor overheating load; see Supplementary Material [1](#SM1){ref-type="supplementary-material"}). The test was terminated earlier than the maximum 18-min if an animal was struggling to swim, irrespective of the selection direction of the individual. Four replicate A-selected lines and four unselected Control (C) lines are maintained (to allow valid tests of the effects of selection; Henderson, [@B18]), with 15--20 reproducing families in each of the eight lines (which prevents excess inbreeding). The selection was applied mostly within families, but if more than 16 families were available, families in which all individuals scored below the adjusted line mean were excluded. The animals were kept in standard plastic mouse cages with sawdust bedding at a constant temperature (20 ± 2°C) and photoperiod (16:8 L:D) and supplied with food (a standard rodent chow: 24% protein, 3% fat, 4% fiber; Labofeed H, Kcynia, Poland) and water *ad libitum*. All of the procedures associated with the breeding scheme and the selection protocol were approved by the Local Bioethical Committee in Kraków, Poland (No. 99/2006, 21/2010, and 22/2010).
One week before measurements of RMR all individuals were implanted with miniature data loggers to measure T~b~ (resolution 0.125°C, iButton thermochron DS1921H, Maxim Integrated Products, Inc., Sunnyvale, California, USA). These data loggers were programmed to record T~b~ every 5-min yielding \~2,144 data points per animal (3 iButtons malfunctioned and no data were retrieved). Data loggers were coated in wax (mean total mass: 2.43 g) and calibrated over a temperature range of 15--43°C against an Albhorn precision thermometer (Albhorn Therm 2244-1, probe: NTC type C 856-1). The procedure was performed as described in Jefimow and Wojciechowski ([@B22]). The surgery was performed under Nembutal (95 mg kg^−1^; Morbital, Biowet, ZAP, Poland) anesthesia in voles from generation 13 or under ketamine (40 mg kg^−1^; Ketamine 10%, Biowet, Puławy, Poland) followed by xylazine (8 mg kg^−1^; Sedazin 2%, Biowet, Puławy, Poland) in voles from generation 14. A 1 to 1.5-cm incision was made to the skin and muscle layers and a sterilized (95% alcohol) logger was inserted into the abdominal cavity. The muscle and skin were sutured using absorbable suture (Safil 5/0, AesculapAG, Tuttlingen, Germany) and voles were provided water containing the antibiotic enrofloxacin (50 mg L^−1^) *ad libitum*. Post-surgical care was continued for the next 3 days.
RMRs of voles were measured as rates of O~2~ consumption (mLO~2~ min^−1^) at T~a~ ranging from 10 to 34°C (10°C: selected *n* = 61, control *n* = 61; 20°C: selected *n* = 71, control *n* = 71; 25--34°C: selected *n* = 32, control *n* = 32). Throughout all experiments T~a~ was measured once every 10-min with data loggers (the same type as used for T~b~) placed in the experimental chambers.
Four hours before measurements the voles were weighed and placed in plastic respirometric chambers (850 mL), without access to food or water, at the required T~a~ to allow animals to acclimatize to the chambers. The chambers were fitted with wire tops suspended 3 cm below the ceiling of the chamber. With the air inlet near the bottom and the outlet at the top of the chamber. This was to ensure that the voles could not exhale air directly into the outgoing air and the incoming air was mixed with the air in the chamber.
The measurements were performed at two time intervals (the actual timing varied ±0:30 h from the following values): the "Morning" group of voles were placed in the chambers at 06:00, the chambers were connected to the system only at 10:00 and the recordings continued until 13:00. The "Afternoon" group was placed in the respirometric chambers at 09:00, the chambers were connected to the system only at 13:00 and the recordings continued until 16:00. The "Timing" group was included as a cofactor in all statistical analyses.
Rates of oxygen consumption ($\overset{˙}{\text{V}}$O~2~) were measured using an open-flow positive-pressure respirometric system. Fresh air was dried (silica gel) and pumped into the chambers containing the animals. The rate of air flowing into the chambers was stabilized at either 350 mL min^−1^ (for T~a~ of 20--34°C) or 450 mL min^−1^ (for T~a~ of 10°C) (STPD) with thermal mass-flow controllers (Alborg, Orangeburg, NY, USA). The actual flow was corrected after calibrating the mass-flow controllers against a precise LO 63/33 rotameter (Rota, Germany). Samples of air flowing out of the animal chamber were pre-dried with ND2 non-chemical drier (Sable Systems Inc.), dried with a small volume of chemical absorbent (magnesium perchlorate) and passed through the O~2~ analyzers. Mean values of analog outputs from the O~2~ analyzer were recorded once per second with Lab Jack UE-9 AD interface and a custom-made protocol using DAQ Factory acquisition system (Azotech, Ashlans, OR, USA). $\overset{˙}{\text{V}}$O~2~ was calculated according to equation 1b in Koteja ([@B25]). We assumed RQ equals 0.85, which was confirmed by measurements performed together with a CO~2~ analyzer in a subset of the animals.
Two experimental setups were used, one for stable temperatures of 10 and 20°C and another for increasing T~a~ from 25 to 34°C.
The rates of oxygen consumption for T~a~ of 10 and 20°C were measured with a five-channel respirometric system with a FOX O~2~ analyzer (Sable Systems Inc. Las Vegas, NV, USA). Samples of air flowing out of a reference (empty) and four measurement chambers (with animals) were analyzed sequentially, in a 13-min cycle. In each cycle, the reference channel and the first measurement channel were active for 165-s, and the remaining three measurement channels were active for 150-s, which ensured a complete washout of the system after switching channels (the time was longer for the reference and the first measurement channels because the change of air composition after switching to those channels is larger than in the case of the other channels). The last 20-s before switching channels was used to calculate the rate of O~2~ uptake. Importantly, as the air flow/chamber volume ratio was low (0.44), the last 20-s effectively represented a signal integrated from a longer period.
For the second protocol only two animals were measured simultaneously during each trial during which T~a~ was increased from 25 to 34°C in 3°C increments. Throughout the measurements animals were kept at 25 and 28°C for 1 h and at 31 and 34°C for 30-min. The shorter time periods at high T~a~ were to prevent hyperthermia, particularly in individuals from the A lines. The rates of oxygen consumption for T~a~ 25 to 34°C were measured continuously with either a FOX O~2~ analyzer or FC-10a analyzer (Sable Systems Inc. Las Vegas, NV, USA). The rate of O~2~ uptake was obtained for the lowest 1-min reading for each experimental T~a~.
Maximum thermogenic capacity ($\overset{˙}{\text{V}}$O~2~cold) was measured as the rate of oxygen consumption (ml min^−1^) in completely soaked individuals placed in a wet chamber for up to 18-min at +23°C (procedure similar to Sadowska et al., [@B40] and Dheyongera et al., [@B11]). The voles were weighed, soaked in warm (+38°C) water containing a drop of dog shampoo to ensure complete saturation and then placed in wet respirometric chambers (500 mL) maintained at +23°C in a temperature-controlled cabinet (PTC-1 Peltier; Sable Systems, Las Vegas, NV, USA). The respirometric chambers were connected to one of two separate open-flow, positive pressure respirometric systems. The airflow rate through the chambers (about 2,000 mL min^−1^ at standard temperature and pressure), was controlled to ±1% with mass flow controllers (either Model ERG3000, Beta-Erg, Warsaw, Poland: or Model GFC-171S, Aalborg Instruments, Orangeburg, NY, USA). Excurrent air was pre-dried with ND2 non-chemical drier (Sable Systems, Las Vegas, NV, USA) or DG-1 Dewpoint Generator with Pelt-4 Condenser PC-2 (Sable Systems, Las Vegas, NV, USA) and dried with a small volume of chemical absorbent (magnesium perchlorate) and passed through the O~2~ analyzers. (FC-10A or FC2 Oxzilla: Sable Systems, Las Vegas, NV, USA). In both systems, the concentration of gases was recorded every second with UI2 (Sable Systems, Las Vegas, NV, USA) interface and protocol using Expedata acquisition system. Thermogenic capacity was defined as the highest 1-min instantaneous rates of oxygen consumption (Bartholomew et al., [@B5]; effective volume of the chambers was 650 and 700 mL, respectively). At the end of each trial we measured rectal temperature (T~b~cold) using an Albhorn thermometer (Albhorn Therm 2244-1, probe: NTC type C 856-1).
Two values of T~b~ were calculated from the data: (1) T~b~mean is the mean T~b~ from 30-min of data that were recorded 4.5--5-h after putting the animal in the chamber and (2) T~b~rmr is the T~b~ recorded at the time of the lowest RMR measurement. From measurements of T~b~rmr and RMR we also calculated the thermal conductance \[CT, mLO~2~/(min × °C)\] of the voles at each of the measurement T~a~s:
CT
=
RMR
/
(
T
b
rmr
−
T
a
)
For statistical analyses we used SAS (v. 9.4, SAS Institute, Inc., Cary, NC, USA). To compare T~b~mean, T~b~rmr, RMR and CT of voles from A and C lines at each of the measurement T~a~s and also for T~b~cold and $\overset{˙}{\text{V}}$O~2~cold from the maximum thermogenic capacity trials we applied a cross-nested Mixed ANCOVA model implemented with the Mixed Procedure (with REML method) with Selection (A vs. C) as the main, top-level fixed factor, and replicated Lines as a random effect nested within Selection. Further, we also included fixed cofactors and covariates: Sex, Generation (13 or 14), Timing (Morning or Afternoon), Age, and Body Mass. The model included also a fixed interaction of Selection × Sex and the random interaction of Sex × Line. Values that were obtained from active individuals were omitted from the analyses. Additionally, studentized residuals were analyzed and observations with residuals below −3 or above 3 were considered outliers and removed from the final analyses.
Next, we used a repeated-measures extension of the above model to perform analyses for combined results from the trial performed at temperatures around the TNZ (25, 28, 31, and 34°C). In addition to the factors described above, the model included a fixed repeated-measures factor for T~a~ (treated as a grouping factor), interactions of T~a~ with Selection, Sex and Line, and the random effect of Individual ("subject"). As the analyses performed separately for each T~a~ revealed large differences of residual variance, in the repeated measures model an "unstructured" type of residual (co)variance matrix was assumed. To compare the four T~a~ groups, Tukey-Kramer post-hoc tests were performed. A similar but simpler model (with no interactions between T~a~ and other factors and compound symmetry variance structure) was used to analyze initial body mass measured before the three trials (at 10, 20, and 25--34°C). In all of the above analyses, variance was constrained to non-negative values (default approach in SAS), and Satterthwaite approximation for non-orthogonal models was applied to calculate the denominator degrees of freedom.
Finally, to analyze the main characteristics of the thermoregulatory curve we applied a stage-regression model, implemented in SAS mixed nonlinear procedure (NLMIXED). The data available could not allow a reliable estimate of the UCT and therefore the analyses were performed only for the temperature range of 10--31°C, and was focused on the question of whether selection affected LCT, the level of RMR above LCT (RMR~TNZ~; conceptually equivalent to BMR), and the slope of the relationship between RMR and T~a~ below LCT (*C*~*t*~; i.e., another measure of thermal conductance). The model includes also random effects of individuals (ID) and residual error e, each assumed to have a normal distribution. The logic of the model was as follows:
RMR
=
{
for
T
a
\>
=
LCT
:
RMR
TNZ
\+
ID
\+
e
for
T
a
\<
LCT
:
RMR
TNZ
\+
CT
×
(
LCT
−
T
a
)
\+
ID
\+
e
However, all of the three parameters of the model are known to depend on body mass (e.g., McNab, [@B32]). Therefore, they were introduced to the model as linear functions of body mass (M~b~), each with an intercept and a mass-slope coefficient:
LCT
=
t
0
\+
t
m
×
M
b
RMR
TNZ
=
b
0
\+
b
m
×
M
b
RMR
TNZ
=
b
0
\+
b
m
×
M
b
(
3
b
)
Finally, each of the six parameters were introduced to the model as either a value common for both of the selection directions or specific for the A and C lines. Thus, the initial "full" model had a total of 12 fixed parameters (in addition to two random effects), i.e., allowed not only difference in intercepts between the selection directions, but also heterogeneous mass-slopes. The model was then stepwise reduced, first by removing the coefficients responsible for differences in mass-slope coefficients (which resulted in a model with homogeneous mass-slopes), and then by removing other components. We first compared the models using AIC criterion, and then to formally test significance of difference in a particular parameter between the A and C lines a likelihood ratio test (LRT) was applied.
Here we present adjusted least square means (with standard error) for the main factor only (Selection). In the supplementary files we also provide the complete tables with descriptive statistics and results of the mixed ANCOVA models and NLMIXED (Supplementary Material [2](#SM2){ref-type="supplementary-material"}) and also raw data (Supplementary Material [3](#SM3){ref-type="supplementary-material"}).
Results {#s3}
=======
Body mass (M~b~) measured before the three respirometric trials (at 10, 20, and 25--34°C) increased with age \[*F*~(1,\ 148)~ = 4.91, *p* = 0.028\] and was on average 0.32 ± 0.15 g lower in the afternoon than in the morning trials \[*F*~(1,\ 215)~ = 4.19, *p* = 0.042\], but did not differ between generations \[*F*~(1,\ 135)~ = 0.94, *p* = 0.33\] or the three trials \[*F*~(2,\ 198)~ = 0.96, *p* = 0.39\]. The M~b~ adjusted for these cofactors was higher in the selected (A) than in control (C) lines, and higher in males than in females \[LSM ± SE for the age of 140 days; A line females: 24.6 ± 0.9 g, males: 28.0 ± 0.9 g, C line females: 21.6 ± 0.9 g, males 25.3 ± 0.9 g; effect of selection: *F*~(1,\ 6.1)~ = 6.55, *p* = 0.042; effect of sex: *F*~(1,\ 5.6)~ = 39.8, *p* = 0.001\].
The results for T~b~mean and T~b~rmr were similar and here we only present the results for T~b~rmr (see Table [1](#T1){ref-type="table"} for values of both variables). T~b~rmr was elevated in the A lines at higher T~a~ but not at lower T~a~, in comparison to the C lines. Specifically, at 10°C T~b~rmr was virtually identical in the lines, and at 20°C it was only 0.08°C higher in the A lines (*p* \> 0.71; Table [1](#T1){ref-type="table"}, Figure [2A](#F2){ref-type="fig"}). At T~a~s around the TNZ, T~b~rmr tended to be higher in the A than in the C lines (at 25°C: 0.38°C difference, at 28°C: 0.23°C, at 31°C: 0.25°C), but the difference was nearly significant only at 25°C (*p* = 0.07; otherwise *p* \> 0.44; Table [1](#T1){ref-type="table"}, Figure [2A](#F2){ref-type="fig"}). The difference in T~b~rmr between the A and C lines was greatest at the T~a~ of 34°C (1.01°C), but because individual variance dramatically increased the difference was still not significant (*p* = 0.15; Table [1](#T1){ref-type="table"}, Figure [2A](#F2){ref-type="fig"}). However, the repeated measures analysis performed for combined T~a~s around TNZ (25, 28, 31, and 34°C) showed that T~b~rmr, averaged across the four temperatures, was clearly significantly higher in the A than in the C lines \[A lines = 38.72 ± 0.13°C; C lines = 38.12 ± 0.12; effect of Selection: *F*~(1,\ 8.7)~ = 10.8, *p* = 0.009\]. The analysis showed also that T~b~rmr averaged across the A and C lines was similar at 25°C (38.03°C) and 28°C (38.01°C), slightly increased at 31°C (38.13°C), and increased significantly at 34°C \[39.51°C; effect of T~a~: *F*~(3,\ 55.9)~ = 24.0, *p* \< 0.0001\]. Further, the analysis also revealed a significant interaction between the effects of T~a~ and Selection \[*F*~(3,\ 55.8)~ = 5.12, *p* = 0.003\]; while the differences in T~b~rmr between the lines at T~a~ ranging from 25 to 31°C were similar (\~0.3°C), at 34°C T~b~rmr in the A lines was more than 1.5°C higher than that in the C lines.
######
Summary statistics showing values (adjusted least square means ± standard error, LSM ± SE) for control (C) and selected (A) lines for each measured variable for each experimental procedure.
**Trial** **Variable** **LSM ± SE** **Significance of effects**
--------------------------------- --------------------------------- ---------------- ----------------------------- ------------ ------ ------- ----------- ---------- -------------- ----------
10°C T~b~mean 38.51 ± 0.13 38.35 ± 0.13 0.12 0.57 0.16 0.79 0.87 0.75 0.34
T~b~rmr 38.32 ± 0.14 38.27 ± 0.14 0.74 0.93 0.82 0.87 0.38 0.85 0.76
RMR 2.36 ± 0.03 2.42 ± 0.03 0.19 0.07 0.74 0.95 0.13 **\<0.0001** 0.74
CT 0.08 ± 0.001 0.09 ± 0.001 0.44 0.31 0.63 0.76 0.35 **\<0.0001** 0.44
20°C T~b~mean 38.11 ± 0.08 38.11 ± 0.08 0.54 0.11 0.09 **0.02** 0.11 **0.02** **0.01**
T~b~rmr 37.94 ± 0.11 38.02 ± 0.11 0.72 0.35 0.16 **0.05** 0.80 **0.03** **0.04**
RMR 1.61 ± 0.02 1.64 ± 0.02 0.53 0.64 0.77 **0.001** 0.11 **\<0.0001** **0.02**
CT 0.09 ± 0.001 0.09 ± 0.001 0.28 0.94 0.84 **0.002** 0.17 **\<0.0001** 0.10
25°C T~b~mean 38.07 ± 0.11 38.17 ± 0.11 0.61 0.18 0.96 0.43 0.99 0.28 0.18
T~b~rmr 37.83 ± 0.12 38.22 ± 0.12 0.07 0.94 0.81 0.54 0.24 0.26 0.72
RMR 1.15 ± 0.02 1.26 ± 0.02 0.19 0.44 0.09 0.96 0.57 **\<0.0001** 0.42
CT 0.09 ± 0.002 0.10 ± 0.002 0.56 0.69 0.08 0.77 0.92 **\<0.0001** 0.37
28°C T~b~mean 37.95 ± 0.12 38.26 ± 0.12 0.23 0.86 0.79 0.36 0.53 0.97 0.29
T~b~rmr 37.887 ± 0.123 38.116 ± 0.124 0.447 0.69 0.732 0.461 0.306 0.975 0.32
RMR 1.08 ± 0.04 1.19 ± 0.04 0.18 0.84 0.59 0.36 0.93 **\<0.0001** 0.29
CT 0.11 ± 0.002 0.12 ± 0.002 0.19 0.91 0.73 0.22 0.11 **\<0.0001** 0.20
31°C T~b~mean 38.18 ± 0.18 38.66 ± 0.18 0.27 0.45 0.75 0.88 0.59 0.29 0.99
T~b~rmr 38.00 ± 0.13 38.25 ± 0.14 0.57 0.52 0.64 0.64 0.13 0.93 0.88
RMR 1.09 ± 0.05 1.19 ± 0.05 0.15 0.10 0.69 0.36 0.28 **\<0.0001** 0.57
CT 0.15 ± 0.004 0.16 ± 0.005 0.15 0.23 0.58 0.43 **0.05** **\<0.0001** 0.67
34°C T~b~mean 39.46 ± 0.40 40.08 ± 0.39 0.29 0.76 0.69 0.76 0.38 0.15 0.24
T~b~rmr 39.05 ± 0.40 40.05 ± 0.39 0.15 0.66 0.78 0.42 0.97 **0.04** 0.57
RMR 1.19 ± 0.06 1.25 ± 0.07 0.53 0.89 0.74 0.31 0.89 **\<0.0001** 0.39
CT 0.25 ± 0.007 0.24 ± 0.008 0.45 0.83 0.80 0.12 0.06 **\<0.0001** 0.07
$\overset{˙}{\text{V}}$O~2~cold T~b~cold 28.48 ± 0.20 28.60 ± 0.22 0.36 0.06 0.34 **0.03** NA **0.01** 0.59
$\overset{˙}{\text{V}}$O~2~cold 4.20 ± 0.07 4.69 ± 0.07 **0.0003** 0.06 0.90 0.06 NA **\<0.0001** 0.25
*LSM are calculated for a fixed body mass (25 g) and age (140 days). Shown also are the significance of each of the effects, significant effects are shown in bold*.
*T~b~mean (°C) = mean body temperature of 30-min of data (data from 4.5 to 5-h after putting animal in the chamber); T~b~rmr (°C) = body temperature at time of lowest RMR; RMR (mLO~2~min^−1^) = lowest resting metabolic rate; CT \[mLO~2~/(min × °C)\] = thermal conductance; T~b~cold (°C) = T~b~ after maximum thermogenesis experiment; $\overset{˙}{\text{V}}$O~2~cold (mLO~2~min^−1^) = maximal MR during thermogenesis experiment; NA = not applicable to these measurements*.
![**(A)** Mean body temperatures (T~b~rmr) of bank voles at the time of the lowest measured resting metabolic rate (RMR) at each measurement temperature (T~a~) for control (C: black dots) and selected (**A**: blue diamonds) lines. **(B)** Mean RMR of bank voles at each measurement T~a~ for the C (black dots) and the A (blue diamonds) lines. For both figures means are the adjusted least square means (LSM calculated for a fixed body mass, 25 g, and age, 140 days) and the whiskers above and below each mean value represent the standard error (note: for most RMR results the SE range is not visible, because it is smaller than the size of the symbols). The lines on **(B)** represent the best-fit model, with a common lower critical temperature (LCT = 26.1 ± 0.27°C), but different levels of RMR above LCT (RMR~TNZ~, for a 25 g vole; A lines: 1.19 mLO~2~/min, C lines: 1.08 mLO~2~/min), and different slopes \[C~t~, for a 25 g vole; A lines: 0.055 mLO~2~/(min × °C), C lines: 0.061 mLO~2~/(min × °C)\].](fphys-08-01070-g0002){#F2}
At all measurement T~a~s, RMR increased with increasing body mass (*p* \< 0.0001; Table [1](#T1){ref-type="table"}). At T~a~s below the LCT (10 and 20°C), RMR did not differ between the A and C lines (*p* \> 0.19; Table [1](#T1){ref-type="table"}). Specifically, RMR for A lines was only 2.6% higher at 10°C and 2.1% higher at 20°C (Table [1](#T1){ref-type="table"}, Figure [2B](#F2){ref-type="fig"}). In contrast, at measurement T~a~s between 25 and 31°C RMR was \~9% higher in the A than in the C lines, however, these differences were not significant (*p* \> 0.15; Table [1](#T1){ref-type="table"}, Figure [2B](#F2){ref-type="fig"}). At 34°C RMR in the A lines was 4.2% higher than in the C lines (Table [1](#T1){ref-type="table"}, Figure [2B](#F2){ref-type="fig"}), but this difference was also not significant (*p* = 0.53). Yet, similarly to T~b~rmr, the repeated measures analysis performed for combined T~a~s around TNZ (25, 28, 31, and 34°C) revealed that RMR, averaged across the four temperatures, was significantly higher in the A than in the C lines \[A lines = 1.24 ± 0.03 mLO~2~min^−1^; C lines = 1.12 ± 0.03 mLO~2~min^−1^; effect of Selection: *F*~(1,\ 19.4)~ = 7.65, *p* = 0.01\]. Additionally, the RMR of the lines combined was significantly affected by T~a~ \[*F*~(3,\ 8.5)~ = 12.08, *p* = 0.002\]: it was higher at 25°C (1.21 ± 0.02 mLO~2~min^−1^) and 34°C (1.24 ± 0.03 mLO~2~min^−1^) in comparison to 28°C (1.14 ± 0.02 mLO~2~min^−1^) and 31°C (1.13 ±0.03 mLO~2~min^−1^). However, unlike for T~b~rmr, the interaction between Selection and T~a~ was not significant for RMR \[*F*~(3,\ 8.5)~ = 0.32, *p* = 0.81\], i.e., the differences between the A and C lines were consistent across the T~a~s (and *vice versa*).
Similarly to RMR, thermal conductance (CT) increased significantly with increasing body mass at all measurement T~a~s (*p* \< 0.0001; Table [1](#T1){ref-type="table"}). Further, CT followed a similar trend to T~b~rmr and RMR, such that at the lower T~a~s of 10 and 20°C the CT values were nearly identical in the A and C lines (*p* \> 0.28; Table [1](#T1){ref-type="table"}). At measurement T~a~s between 25 and 31°C the CT of the A lines was ≈6% higher than that measured in the C lines. However, this was reversed at 34°C, such that the CT of control voles was 3% higher than that of the selected voles. While these results were not significant, the repeated measures analysis performed for combined T~a~s (25, 28, 31, and 34°C) revealed that CT, averaged across the four temperatures, was nearly significantly higher in the A than in the C lines \[A lines = 0.15 ± 0.003 mLO~2~/(min × °C); C lines = 0.14 ± 0.002 mLO~2~/(min × °C); *p* = 0.07\]. As expected, the CT of the lines combined increased significantly with increasing T~a~ (25°C = 0.09±0.001 mLO~2~/(min × °C); 28°C = 0.11±0.002 mLO~2~/(min × °C); 31°C = 0.16±0.003 mLO~2~/(min × °C); 34°C = 0.24±0.005 mLO~2~/(min × °C); *p* = 0.04). Further, similarly to RMR, the interaction between the effect of Selection and T~a~ was not significant for CT (*p* = 0.19).
The analysis of the stage-regression model applied to characterize the thermoregulatory curve showed that the best fit model according to the AIC Fit statistic (Table [2](#T2){ref-type="table"}, model 8) had a common LCT (26.1 ± 0.3°C), which did not depend significantly on either body mass or selection direction. The rate of metabolism above LCT (RMR~TNZ~), adjusted for the effect of body mass, was 0.11 ± 0.03 mlO~2~/min higher in the A than in the C lines (χ^2^ = 13.2, *p* \< 0.001). The slope of the increase of RMR below LCT (*C*~*t*~), which can be treated as another characteristic of thermal conductance, increased with body mass (χ^2^ = 4.8, *p* = 0.028), and was significantly lower in the A than in the C lines \[for a vole with a mean mass of 25 g: A lines: 0.078 mLO~2~/(min × °C), C lines: 0.081 mLO~2~/(min × °C), difference: 0.006 ± 0.003 mLO~2~/(min × °C); χ^2^ = 5.0, *p* = 0.025\]. Thus, the thermoregulatory curve lines for the A and C voles meet at 7.5°C (Figure [2B](#F2){ref-type="fig"}). However, as RMR was not measured at even lower temperatures, the results do not allow us to resolve whether the lines intersect or converge. Below the LCT, RMR increased so that for the A lines at 20°C it was about 1.4-fold higher, and at 10°C was 2-fold higher, than RMR in the TNZ. As RMR in the TNZ was lower for the C lines, these differences were greater, such that RMR at 20°C was 1.5-fold higher, and at 10°C was 2.2-fold higher, than RMR in the TNZ.
######
Summary of Fit statistics for nonlinear, stage-regression models (implemented in SAS NLMIXED procedure), applied to determine how selection affected the main characteristics of the thermoregulatory curve in bank voles.
**Model specification (parameters included)** **Fit statistics and criteria**
------------------------------------------------------------------------------------------------------------- ----------------------------------------------- --------------------------------- --------------------------------------------------------- ----------------------- ------------- ------------- ------------- -------------
Heterogeneous mass-slopes 1 12 *b~*m*~, c~*m*~, t~*m*~* different (selection-specific) *b~0~, ct~0~, lc~0~* −338.8 −310.8 −309.8 −269.6
Homogeneous mass-slopes (*b~*m*~, c~*m*~, t~*m*~* common in all further models)
All mass-slope coefficients included 2 9 *b~*m*~, c~*m*~, t~*m*~* *b~0~, c~0~, t~0~* −331.2 −309.2 −308.6 −276.9
3 8 *b~*m*~, c~*m*~, t~*m*~* *c~0~, t~0~* −321.0 −301.0 −300.5 −271.6
4 8 *b~*m*~, c~*m*~, t~*m*~* *b~0~, t~0~* −328.8 −308.8 −308.3 −279.4
5 8 *b~*m*~, c~*m*~, t~*m*~* *b~0~, c~0~*, −331.1 −311.1 −310.6 −281.7
Homogeneous slopes, but CT or LCT mass-slope coefficients excluded (mass-independence of the trait assumed) 6 8 *b~*m*~, t~*m*~* *b~0~, c~0~, t~0~* −328.7 −308.7 −308.2 −279.3
7 8 *b~*m*~, c~*m*~* *b~0~, c~0~, t~0~* −331.3 −311.3 −310.8 −281.9
**8** **7** ***b**~*m*~**, c**~*m*~* ***b**~0~**, c**~0~,* --**331.1** --**313.1** --**312.7** --**286.7**
9 6 *b~*m*~, c~*m*~* *b~0~* −326.1 −310.1 −309.8 −286.6
10 6 *b~*m*~, c~*m*~* *c~0~* −317.9 −301.9 −301.6 −278.4
11 6 *b~*m*~*, *b~0~, c~0~* −326.3 −310.3 −309.9 −286.7
*The three main parameters were entered in the model as linear functions of body mass (M~b~), with an intercept and mass-slope coefficients ("0" and "m" subscripts, respectively): the lower critical temperature (LCT = t~0~ + t~m~ × M~b~), resting metabolic rate above LCT (RMR~TNZ~ = b~0~ + b~m~ × M~b~), and thermal conductance (C~t~ = c~0~ + c~m~ × M~b~). The intercepts and mass-slope parameters were specified either as common or different for the A and C lines. Thus, the full model had 12 fixed parameters (plus two random effects, not shown), which were then step-wise reduced. The common intercept coefficients were always retained in the model, and therefore are not shown in the table. A lower value of the Fit criteria indicates a better fit of the model, and the best-fit model is highlighted in bold*.
The maximum thermogenesis ($\overset{˙}{\text{V}}$O~2~cold) of voles from the A lines was 10% higher than that measured in voles from the C lines (*p* \< 0.0001; Table [1](#T1){ref-type="table"}). However, the $\overset{˙}{\text{V}}$O~2~cold measured during the maximum thermogenesis trials did not differ between the A and C lines (*p* = 0.70; Table [1](#T1){ref-type="table"}). An extrapolation of the thermoregulatory curve toward low temperatures and $\overset{˙}{\text{V}}$O~2~cold values allows an estimation of the lower lethal temperature (LLT), at which the thermoregulatory demand meets the ceiling of maximum thermogenesis. Although the slope of the curve was lower for the A lines, the difference may not hold at lower temperatures. Therefore, for the extrapolation below 7.5°C (where the lines meet) we used a common slope of 0.058 mLO~2~/(min × °C). The LLT calculated in this way for a 25 g vole was 8.4°C lower in the A (−28.6°C) than in the C lines (−20.2°C).
Discussion {#s4}
==========
Our study provides data that fill in the gaps in our knowledge on how selecting for high-activity related aerobic metabolism can also result in correlated changes in thermal physiological traits. Specifically, as predicted by our previous studies on BMR (Sadowska et al., [@B41]), RMR within the TNZ was higher in selected (A) lines in comparison to control (C) lines. Resting metabolism is correlated with many life history traits, such as growth, survival, or reproductive output, which suggests that the fitness of an individual can be associated with RMR (Boratynski and Koteja, [@B7], [@B8]; Burton et al., [@B9]). Thus, the increase in RMR in the TNZ in the voles from the A lines suggests that the evolution of increased aerobic exercise capacity leads to many other correlated changes. In addition, the T~b~ of selected voles in the TNZ was ≈0.3°C higher in comparison to control voles, and the difference increased to ≈1.5°C at a T~a~ of 34°C, revealing that the increased heat production resulting from higher RMR was not completely balanced by increased heat dissipation. While there are advantages for animals to have a high BMR or RMR, such as increased maximal MR for longer activity periods, there are also advantages to having a low BMR or RMR (Larivée et al., [@B28]). For example, individuals with a low BMR or RMR do not have to eat as much (Dheyongera et al., [@B11]); therefore their foraging requirements are reduced along with exposure to predators (Larivée et al., [@B28]). Importantly, while endotherms can maintain high metabolism and a stable T~b~ to remain active over a range of T~a~, this comes at a cost.
Selection for high-activity related metabolism could influence RMR at T~a~ below the LCT in several ways (Figure [1](#F1){ref-type="fig"}). The results of the stage-regression analysis supported a model in which the LCT does not differ between the A and C lines, and the slope of the thermoregulatory curve is lower in A lines, so that the lines meet at T~a~ = 7.5°C (Table [2](#T2){ref-type="table"}, Figure [2B](#F2){ref-type="fig"}). Because we do not have results for T~a~s below 10°C or between 10 and 20°C, we could not attempt to fit a more complex model, which would allow to determine whether the thermoregulatory curves for the A and C lines converge at low T~a~, or if indeed they intersect, so that below ≈ 7°C RMR would become lower in the A than in the C lines. However, as the thermal conductance (CT), calculated from individual values of RMR and T~b~ measured at T~a~ = 10°C, does not differ significantly between the lines, and the CT value is actually even slightly higher in the A than in the C lines (Table [1](#T1){ref-type="table"}), we can predict that the lines actually converge, rather than intersect. In addition to the similar RMR in the A and C lines measured at the moderately low temperatures, there were also no significant differences in T~b~. This result suggests that RMR and T~b~ at cold T~a~ are conserved regardless of selection for higher MR during activity, possibly to reduce the amount of energy needed to maintain normothermia below the LCT.
Importantly, while many endotherms employ physiological mechanisms to deal with cold temperatures, such as non-shivering thermogenesis (NST) and torpor, such tools are not employed by all species (Jackson et al., [@B19]; Ruf and Geiser, [@B37]; Stawski et al., [@B43]). Interestingly, NST capacity measured in bank voles from the same generations as those in the current study did not differ between the A and C lines (Stawski et al., [@B43]). Therefore, in bank voles NST capacity does not appear to be genetically correlated to activity-related metabolism and is likely a plastic trait, which would be advantageous in predictable environments such as those that bank voles occupy (Stawski et al., [@B43]). By conserving RMR and NST capacity at low T~a~ regardless of selection pressures acting on activity-related aerobic metabolism, bank voles with high BMR can also survive these cold temperatures by not increasing the amount of energy used to remain normothermic (however, their overall energy needs may be increased if they maintain a higher locomotor activity). Importantly, as RMR in the TNZ is higher for the A lines in comparison to the C lines, the selected voles do not need to increase their RMR as much at T~a~ below the LCT. This smaller increase in energy expenditure as the temperature drops was likely important during the evolution of endothermy and also currently in terms of adapting rapidly to colder weather. Additionally, our data also revealed that voles from the A lines have a 10% higher thermogenic capacity (Table [1](#T1){ref-type="table"}). Consequently, as RMR and CT below the LCT practically do not differ between the selection directions, the selected voles presumably have a 7°C lower LLT than voles from the C lines, i.e., have a higher capacity to withstand very cold T~a~.
Hotter temperatures can be more difficult for endotherms to cope with than cold. Endotherms in particular can overheat rapidly and this can lead to organ failure and death. Therefore, for T~a~ above the UCT endotherms need to dissipate heat and often do so by increasing evaporative water loss and MR (Pis, [@B33]; Rezende and Bacigalupe, [@B35]). Due to the higher RMR and T~b~ of the selected voles in the TNZ, we predicted that the slope of the line would be steeper above the UCT in comparison to control lines. While we were unable to estimate the UCT based on our data, the RMR and T~b~ of some voles already showed an increase at the measurement T~a~ of 31°C, and an even greater increase at 34°C. Therefore, while there appears to be considerable individual variation, we hypothesize that the UCT of voles is around 31°C. Importantly, the T~b~ of voles from the A lines at 34°C was much higher in comparison to the C lines. This result suggests that selection for high activity-related metabolism can reduce the capacity of effective thermoregulation at high T~a~, and therefore decrease the upper lethal temperature.
The results of our current and previous studies show that selection for increased aerobic capacity during activity leads to many other correlated changes, such as a shift in the thermoregulatory curve as shown here. Specifically, the selection for high aerobic exercise performance, even though operating under thermally neutral conditions, has resulted in the evolution of increased cold tolerance, which, under natural conditions, could allow voles to inhabit colder environments. Conversely, this selection has also resulted in voles overheating at high T~a~, which may lead to difficulties in a warming climate. Bank voles offer an ideal model to analyse metabolic adjustments to differing climates as they have a wide distribution throughout Europe, extending in the North all the way into the Arctic Circle and down to the Mediterranean in the South (Raczyński, [@B34]). In the West they are found in Ireland and in the East they inhabit a large portion of Russia (Raczyński, [@B34]). Throughout this large range bank voles experience a variety of climates, suggesting they may display physiological flexibility to enable adaptation to differing weather patterns. Yet, surprisingly, the possibility of geographical variation of their metabolic traits has not been explored extensively and we are only aware of one study (Aalto et al., [@B1]). This research revealed that bank voles do not appear to display evident variation in BMR across a wide geographical range, from Northern Finland to the Balkan Peninsulas. The authors suggested that throughout this wide climatic range voles can select similar microclimates (Aalto et al., [@B1]). However, the methodology of this study was not perfect, because the measurements were conducted neither on voles\' immediately after capture nor on ones maintained under common-garden conditions. Thus, the data do not represent effects of current local conditions, and do not represent genetically-based differences, either. Therefore, it would be beneficial to repeat such an experiment with a more robust experimental design, and compare the outcome with that of our selection experiment. To conclude, the results of the current thermoregulatory curve experiment and the results from the whole experimental evolutionary model research support the assumptions of the aerobic capacity model of the evolution of endothermy.
Author contributions {#s5}
====================
All authors designed the study, analyzed the results, worked on the manuscript and gave approval for publication. CS and ES performed the experiments.
Conflict of interest statement
------------------------------
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
For their help with this research we would like to thank Katarzyna Baliga-Klimczyk, Katarzyna M. Chrzaścik, Agata Rudolf, and Paulina Szymanska. We are grateful to Michał S. Wojciechowski for lending us his data loggers and teaching us the implantation surgery.
**Funding.** This research was funded by the Jagiellonian University and the European Union under the European Social Fund (POKL.04.01.01-053/09) to CS, a grant for the development of young scientists and doctoral students from Jagiellonian University (DS/MND/WBiNoZ/INoS/2/2011) to CS and ES, Jagiellonian University (DS/WBINOZ/INOS/757) to PK, the Polish Ministry of Science and Higher Education (8167/B/P01/2011/40 to PK and 0595/B/P01/2011/40 to ES), and the National Science Centre Poland (2016/22/E/NZ8/00416) to ES.
Supplementary material {#s6}
======================
The Supplementary Material for this article can be found online at: <https://www.frontiersin.org/articles/10.3389/fphys.2017.01070/full#supplementary-material>
######
Click here for additional data file.
######
Click here for additional data file.
######
Click here for additional data file.
[^1]: Edited by: Elias T. Polymeropoulos, Institute for Marine and Antarctic Studies (IMAS), Australia
[^2]: Reviewed by: Steve Portugal, Royal Holloway, University of London, United Kingdom; Stewart C. Nicol, University of Tasmania, Australia
[^3]: This article was submitted to Integrative Physiology, a section of the journal Frontiers in Physiology
|
Q:
Principal Curvature
Find the principal curvature at the vertices of the hyperboloid with two sheets $$\frac {x^2}{a^2}-\frac {y^2}{b^2}-\frac {z^2}{c^2}=1$$
Can someone help me with this problem ??
A:
calculate second fundamental matrix.
$$II = \begin{bmatrix} X_{yy}\cdot n & X_{yz}\cdot n \\ X_{zy}\cdot n & X_{zz}\cdot n \end{bmatrix},$$
$${x } =\sqrt{\frac {y^2a^2}{b^2}+\frac {z^2a^2}{c^2}+a^2}$$
$$f(y,z)=\sqrt{\frac {y^2a^2}{b^2}+\frac {z^2a^2}{c^2}+a^2}$$
then finding out the $X_{yy}=\frac{\partial^2 f}{\partial y^2}$...
and n is the unit normal vector
|
2002 Nebraska gubernatorial election
The 2002 Nebraska gubernatorial election, held on November 5, 2002, featured incumbent Republican Governor of Nebraska Mike Johanns defeating his Democratic opponent Stormy Dean in a landslide.
This was the first gubernatorial election in Nebraska where the winning primary candidates chose their running mates after the primary election. Prior to this, both the governor and the lieutenant governor were chosen at the primary election. This was also the first gubernatorial election in which a Republican was re-elected in more than forty years.
Republican Party primary
Candidates
Mike Johanns, incumbent Governor of Nebraska
Robert J. Wicht
Results
Democratic Party primary
Candidates
Stormy Dean, insurance company executive
Luis R. Calvillo
Results
Nebraska Party primary
Candidates
Paul A. Rosberg, farmer
Results
General election
Results
References
Gubernatorial
2002
Category:2002 United States gubernatorial elections |
Automated tracing of electron-density maps of proteins.
The tracing of experimental electron maps in the field of protein crystallography is not a rate-limiting step for structure elucidation, but does represent the process that requires the most expertise and user time. This paper presents a method for automatically tracing the electron-density maps of proteins which can reliably generate a C(alpha) trace for protein maps with data in the resolution range 1.5-4 A. The number of C(alpha) atoms placed and the precision of atom placement depends on the quality of the map, but even with poor maps (FOM approximately 0.5) the algorithm can provide a significant saving in time over conventional methods of interpretation. The interpretation of six experimental maps is presented at different resolutions and levels of phase error; these show that data with an FOM of 0.7 or better can be entirely traced with no user intervention. |
[Thrombocytapheresis with the new PLT-30 collection chamber in the CS 3000 Plus cell separator].
Eight healthy blood donors underwent paired thrombocytapheresis with the CS 3000 Plus blood cell separator. For each donor, two samples were run: one with the TNX-6 separation and the new PLT-30 collection chamber and one with TNX-6 separation and the A-35 collection chamber. With the PLT 30 chamber, the platelet yield was higher than with the A-35 chamber. Separation efficiency was statistically better with the PLT-30 chamber. |
---
title: "Property generator"
lang: en
layout: page
keywords: LoopBack
tags:
sidebar: lb3_sidebar
permalink: /doc/en/lb3/Property-generator.html
summary:
---
{% include content/generator-create-app.html lang=page.lang %}
### Synopsis
Adds a new property to an existing LoopBack model.
```
lb property [options]
```
With IBM API Connect v5 developer toolkit:
```
apic create --type model [options]
```
With legacy StrongLoop tools:
```
slc loopback:property [options]
```
### Options
{% include_relative includes/CLI-std-options.md title='no' %}
`-n, --name`
: With IBM API Connect v5 developer toolkit only, optionally provide the name of the
property as the value of this option.
If provided, the tool will use that as the default when it prompts for the name.
### Interactive Prompts
The tool will prompt you for the:
* Model to which to add the new property.
* Name of the property to add.
* Data type of the property.
* Whether the property is required.
### Output
The tool modifies the [Model definition JSON file](Model-definition-JSON-file.html) to add the specified property to the specified model.
|
Several types of motor implements that are utilized domestically are powered by small gasoline engines. These motor implements can include a large number of devices such as push or riding lawn motors, generators, water pumps, rotor tillers, and marine engines for boats. Purchasing a multitude of these devices individually is expensive, with the main cost component being the gasoline engine.
Therefore, in order to minimize the costs associated with the purchase of a number of these motor implements, the need to utilize several gasoline engines, one engine for each implement, must be eliminated. A device is needed whereby a single gasoline engine can be employed in a variety of implements to perform a variety of tasks.
Toward this end, many devices have been proposed. One such device, U.S. Pat. No. 3,863,291 issued to Woelffer, is a convertible device. This device transforms an existing motor implement into a different motor implement. For example, a push lawn mower is converted into an air blower. Although this device reduces the need for one engine in the domestic motor tool arsenal, its range of applications is very restricted. Applications beyond this restricted range require the purchase of further gasoline engines. |
Q:
How to build your own tabs in MvvmCross?
I'm trying to build my own tabs in MonoDroid and MvvmCross.
The reason for building my own tabs is so that I can have further control over them. I want them on every screen even if they aren't in the tabs, I want to control clicks on certain tabs.
Loading the two Fragments on the page is fine, however when I click a button that is on either the tab fragment or content fragment that navigates to the next content fragment I am getting the error message "An unhandled exception occured." which isn't so helpful.
02-06 10:15:13.947 W/dalvikvm( 2040): JNI WARNING: JNI method called with exception pending
02-06 10:15:13.947 W/dalvikvm( 2040): in Lcirrious/mvvmcross/droid/fragging/MvxEventSourceFragmentActivity;.n_startActivityForResult:(Landroid/content/Intent;I)V (NewString)
In mgmain JNI_OnLoad
02-06 10:15:13.947 W/dalvikvm( 2040): Pending exception is:
02-06 10:15:13.947 I/dalvikvm( 2040): android.content.ActivityNotFoundException: Unable to find explicit activity class {frags.droid/frags.droid.views.frags.ChildTwoView}; have you declared this activity in your AndroidManifest.xml?
02-06 10:15:13.947 I/dalvikvm( 2040): (raw stack trace not found)
02-06 10:15:13.947 I/dalvikvm( 2040): "main" prio=5 tid=1 NATIVE
02-06 10:15:13.947 I/dalvikvm( 2040): | group="main" sCount=0 dsCount=0 obj=0x41aaf710 self=0x41a96210
02-06 10:15:13.957 I/dalvikvm( 2040): | sysTid=2040 nice=0 sched=0/0 cgrp=apps handle=1074675708
02-06 10:15:13.957 I/dalvikvm( 2040): | state=R schedstat=( 0 0 0 ) utm=164 stm=41 core=0
02-06 10:15:13.967 I/dalvikvm( 2040): #00 pc 000012fe /system/lib/libcorkscrew.so (unwind_backtrace_thread+29)
02-06 10:15:13.967 I/dalvikvm( 2040): #01 pc 0006324e /system/lib/libdvm.so (dvmDumpNativeStack(DebugOutputTarget const*, int)+33)
02-06 10:15:13.967 I/dalvikvm( 2040): #02 pc 000572b8 /system/lib/libdvm.so (dvmDumpThreadEx(DebugOutputTarget const*, Thread*, bool)+395)
02-06 10:15:13.967 I/dalvikvm( 2040): #03 pc 00057326 /system/lib/libdvm.so (dvmDumpThread(Thread*, bool)+25)
02-06 10:15:13.967 I/dalvikvm( 2040): #04 pc 0003b530 /system/lib/libdvm.so
02-06 10:15:13.967 I/dalvikvm( 2040): #05 pc 0003eef2 /system/lib/libdvm.so
02-06 10:15:13.967 I/dalvikvm( 2040): at cirrious.mvvmcross.droid.fragging.MvxEventSourceFragmentActivity.n_startActivityForResult(Native Method)
02-06 10:15:13.967 I/dalvikvm( 2040): at cirrious.mvvmcross.droid.fragging.MvxEventSourceFragmentActivity.startActivityForResult(MvxEventSourceFragmentActivity.java:110)
02-06 10:15:13.967 I/dalvikvm( 2040): at android.app.Activity.startActivity(Activity.java:3661)
02-06 10:15:13.967 I/dalvikvm( 2040): at android.app.Activity.startActivity(Activity.java:3629)
02-06 10:15:13.967 I/dalvikvm( 2040): at mono.android.view.View_OnClickListenerImplementor.n_onClick(Native Method)
02-06 10:15:13.967 I/dalvikvm( 2040): at mono.android.view.View_OnClickListenerImplementor.onClick(View_OnClickListenerImplementor.java:29)
02-06 10:15:13.967 I/dalvikvm( 2040): at android.view.View.performClick(View.java:4475)
02-06 10:15:13.967 I/dalvikvm( 2040): at android.view.View$PerformClick.run(View.java:18786)
02-06 10:15:13.967 I/dalvikvm( 2040): at android.os.Handler.handleCallback(Handler.java:730)
02-06 10:15:13.967 I/dalvikvm( 2040): at android.os.Handler.dispatchMessage(Handler.java:92)
02-06 10:15:13.967 I/dalvikvm( 2040): at android.os.Looper.loop(Looper.java:137)
02-06 10:15:13.967 I/dalvikvm( 2040): at android.app.ActivityThread.main(ActivityThread.java:5419)
02-06 10:15:13.967 I/dalvikvm( 2040): at java.lang.reflect.Method.invokeNative(Native Method)
02-06 10:15:13.967 I/dalvikvm( 2040): at java.lang.reflect.Method.invoke(Method.java:525)
02-06 10:15:13.967 I/dalvikvm( 2040): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:1187)
02-06 10:15:13.967 I/dalvikvm( 2040): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:1003)
02-06 10:15:13.967 I/dalvikvm( 2040): at dalvik.system.NativeStart.main(Native Method)
All my custom code is below.
I have my own CustomPresenter
public class CustomPresenter : MvxAndroidViewPresenter, ICustomPresenter
{
// map between view-model and fragment host which creates and shows the view based on the view-model type
private Dictionary<Type, IFragmentHost> dictionary = new Dictionary<Type, IFragmentHost>();
public override void Show(MvxViewModelRequest request)
{
IFragmentHost host;
if (this.dictionary.TryGetValue(request.ViewModelType, out host))
{
if (host.Show(request))
{
return;
}
}
base.Show(request);
}
public void Register(Type viewModelType, IFragmentHost host)
{
this.dictionary[viewModelType] = host;
}
}
I'm using a MvxFragmentActivity as my host view which will contain the content section at the top and the tabs at the bottom, this also implements IFragmentHost. All pages will be Fragments including the tabs.
public class FirstView : MvxFragmentActivity, IFragmentHost
{
ChildTwoView _childTwo;
public bool Show(Cirrious.MvvmCross.ViewModels.MvxViewModelRequest request)
{
// create view model
var loaderService = Mvx.Resolve<IMvxViewModelLoader>();
var viewModel = loaderService.LoadViewModel(request, null /* saved state */);
_childTwo = (ChildTwoView)SupportFragmentManager.FindFragmentById(Resource.Layout.childtwoview);
var customPresenter = Mvx.Resolve<ICustomPresenter>();
//customPresenter.Register(Type)
// decide which fragment to create based on the view-model type
var fm = this.SupportFragmentManager;
var ft = fm.BeginTransaction();
if (viewModel.GetType().Name == "ChildTwoViewModel")
{
var fragmentView = new ChildTwoView();
ft.Replace(Resource.Id.childViewHost, fragmentView);
}
//var fragmentView = viewModel.GetType().Name;
// load fragment into view
ft.AddToBackStack(null);
ft.Commit();
return true;
}
protected override void OnCreate(Bundle bundle)
{
base.OnCreate(bundle);
SetContentView(Resource.Layout.FirstView);
var childView = new ChildView()
{
ViewModel = new ChildViewModel()
};
var tabView = new TabView()
{
ViewModel = new TabViewModel()
};
var fm = this.SupportFragmentManager;
var ft = fm.BeginTransaction();
//ft.Add(childView, "child");
ft.Replace(Resource.Id.childViewHost, childView, "child");
ft.Replace(Resource.Id.tabViewHost, tabView, "tab");
ft.Commit();
}
}
I am setting up these in the Setup.cs
protected override IMvxAndroidViewPresenter CreateViewPresenter()
{
var customPresenter = new CustomPresenter();
Mvx.RegisterSingleton<ICustomPresenter>(customPresenter);
return customPresenter;
}
All help is greatly appreciated.
EDIT
I decided against this approach and went with the standard Android TabHost to keep consistency between apps.
A:
The error says it all. You have most likely forgot to add a Activity attribute to your ChildTwoView like:
[Activity]
public class ChildTwoView : Activity { ... }
Oh wait, your ChildTwoView is not an Activity, when then you can't use the built in Show method in the presenter. It does not support Fragments.
|
Pacific island lawmakers mull dumping Taiwan for China
Published: Thursday, November 22, 2007, 13:38 [IST]
Subscribe to Oneindia News
TAIPEI, Nov 22 (Reuters) Some lawmakers in the tiny South Pacific nation of Palau are suggesting it break links with diplomatically isolated Taiwan and recognise rival China instead, the archipelago's ambassador to Taiwan said.
Taiwan is recognised by just 24 mostly impoverished countries around the world which it attracted with lavish aid. Taipei needs all the friends it can get to prove it is a separate entity from Beijing, which is recognised by 170 countries and insists that the rest of the world treat Taiwan as a Chinese province.
Some members of Palau's 16-seat House of Delegates, speaking after visits from Chinese Foreign Ministry ''scouts'', had said ties with Beijing would offer more business opportunities to the archipelago of about 20,000 people, envoy Lydia Ngirablosch said.
''Over the past three months there was noise coming out of the House, though not so much recently,'' Ngirablosch said. ''The (legislators) say China has a booming economy and that it's better to do business there.'' Beijing, which lost control of the island at the end of the Chinese civil war in 1949, seeks to pressure it into unification by making diplomatic allies switch ties to Beijing.
Successive Taiwan bids for UN membership have failed over 15 years. Taiwan, formally known as the Republic of China, lost its seat at the United Nations in 1971 in favour of Beijing's People's Republic.
Beijing has threatened to attack the island if it moves towards formal independence.
Ngirablosch said Palau lawmakers had travelled recently to China and Macau, a former Portuguese-run enclave which reverted to Beijing in 1999, and Chinese officials had twice visited Palau.
One of those visits coincided with a September 2006 summit between Taiwan and its six South Pacific allies.
Among Palau lawmakers favouring ties with Beijing is one who is running for president next year, Ngirablosch added. But she said the pro-China legislators had made no formal proposals to change allegiance.
''Even though there's noise about switching ties, that doesn't mean the government has to address it,'' Ngirablosch said. ''I'm proud to say that most of us are well educated. We know the administrative structure of the Chinese government.'' Foreign Ministry spokeswoman Phoebe Yeh said Taiwan officials would speak to the pro-China legislators and monitor any efforts by Beijing to ''destroy'' Taipei's diplomatic ties.
Taiwan consolidated relations with its six South Pacific allies at a summit in the Marshall Islands last month, pledging medical aid and long-term development assistance to its allies.
Palau has attracted Taiwan investment in fishing and tourism since the two governments established ties in 1999 after the archipelago emerged from US control. |
Washington DC lawyer Victoria Toensing went on with Lou Dobbs on Monday.
Victoria discussed her whistleblower client has information on the Uranium One scandal.
Toensing’s client is an American businessman who worked for years undercover as an FBI confidential witness, according to John Solomon and Alison Spann at The Hill. The man was blocked by the Obama Justice Department from telling Congress about conversations and transactions he witnessed related to the Russian nuclear industry’s efforts to win favor with Bill and Hillary Clinton and influence Obama administration decisions, his lawyer tells The Hill.
On Monday Toensing told Dobbs her client knows what the Russians were saying during the bribery of the Clinton cabal.
Lou Dobbs: Weigh for us the impact of what he does know and what you may have learned from him. TRENDING: FBI Agent Who Uncovered Weiner Laptop with Hillary's Emails says FBI Leadership Told Him to Erase All of His Findings Victoria Toensing: …It’s quite significant. He can tell what all of the Russians were talking about during the time that the bribery payments were made.
Via Lou Dobbs Tonight:
|
using System;
using System.Reflection;
using CommandLine;
using WinServiceInstaller;
namespace YaR.Clouds.Console
{
public class Program
{
private static ServiceConfigurator _c;
static void Main(string[] args)
{
var result = Parser.Default.ParseArguments<CommandLineOptions>(args);
var exitCode = result
.MapResult(
options =>
{
_c = new ServiceConfigurator
{
Assembly = Assembly.GetExecutingAssembly(),
Name = options.ServiceInstall ?? options.ServiceUninstall ?? "wdmrc",
DisplayName = string.IsNullOrEmpty(options.ServiceInstallDisplayName)
? $"WebDavCloud [{options.Protocol}]"
: options.ServiceInstallDisplayName,
Description = "WebDAV gate2cloud",
FireStart = () => Payload.Run(options),
FireStop = Payload.Stop
};
if (options.ServiceInstall != null)
{
options.ServiceRun = true;
options.ServiceInstall = null;
_c.CommandLine = Parser.Default.FormatCommandLine(options);
_c.Install();
return 0;
}
if (options.ServiceUninstall != null)
{
_c.Uninstall();
return 0;
}
if (options.ServiceRun)
{
_c.Run();
return 0;
}
System.Console.CancelKeyPress += (sender, eventArgs) => Payload.Stop();
Payload.Run(options);
return 0;
},
errors => 1);
if (exitCode > 0) Environment.Exit(exitCode);
}
}
}
|
Trichomonas vaginalis is a sexually-transmitted, obligate extracellular parasite that colonizes the human urogenital tract. Despite being of critica importance to the parasite's survival relatively little is known about the mechanisms employed to establish an infection and thrive within its host. As an extracellular organism, T. vaginalis must adhere to the epithelial lining of the host's urogenital tract to survive. Despite the importance o T. vaginalis surface proteins as a critical interface for pathogen-host interactions, the identity f the surface proteins involved in these processes remains unknown. The overall goals of this proposal are to characterize two surface proteins that are members of the tetraspanin (TSP) family and TSP1-containing exosomes as an abundant surface protein to determine the roles they play in the interaction of this parasite with its human host. Mammalian TSPs exist as membrane complexes that regulate adhesion, migration, intracellular signaling and motility [and our preliminary data indicate that T. vaginalis TSPs are involved in parasite migration]. In specific aim 1 we will determine role of tetraspanin 6 (TSP6) during host-parasite interaction. Our preliminary data show that TSP6 targets to both the plasma membrane and flagella of the parasite and changes its localization upon exposure to host cells. [Moreover, the loss of its 16 amino acid C-terminal intracellular tail results in loss of flagella localization of TSP6 and reducd parasite migration. We propose to further analyze TSP6 function using a knock down approach to test its role in adherence, migration and cytotoxicity to host cells.] In addition, as TSPs act s molecular scaffolds by forming complexes with other cell surface proteins, we will perform co- immunoprecipitation experiments to identify TSP6 partner proteins. These studies will provide the first molecular analyses of tetraspanin proteins in unicellular parasites and enhance our understanding of T. vaginalis host-pathogen interactions. In specific aim 2 we will characterize TSP1 containing exosomes. TSP1 is present on the surface of the cell and on intracellular multivesicular bodies and [exosomes that are released by the parasite. Purification of exosomes has allowed us to show that parasite exosomes induce cytokine release by host cells. We will determine the protein composition of exosomes and their effect on host:parasite communication using TSP1-overexpressing, TSP1-KD and WT parasites.] In addition to providing information about the role of TSP1 in host:pathogen interactions, these studies are the first to examine T. vaginalis exosomes, a key organelle which may mediate communication between T. vaginalis and its host. This research will be done primarily at Fundacin Instituto de Investigaciones Biotecnolgicas (IIB-INTECH) in Chascomus, Argentina in collaboration with Dr. Natalia de Miguel. |
A pesky Times Square Spider-Man wore his costume to Manhattan court Sunday as he pleaded not guilty to assault charges — and the judge warned him this was his last chance to clean up his act.
Web-slinger Abdelamine el-Khezzani is accused of kicking a Virginia woman who wouldn’t tip him after he posed for pictures with her kids Saturday. The arrest came months after he was busted for allegedly roughing up a comedy-club ticket seller.
“Have you heard the expression ‘Three strikes and you’re out’?” Justice Laura Ward asked el-Khezzani, who took off his mask but still wore his red-and-blue leotard costume for his arraignment.
“If you come to the plate and you strike out a third time, you’re out,’’ she said. “This is your second time at bat.”
Ward warned el-Khezzani, 37, that if he is arrested again, “bail will be set so high that you won’t be able to get out.”
He was released and is due in court April 6 in both cases.
El-Khezzani insisted to The Post outside the Manhattan Criminal Court building — where he struck an iconic Spidey pose — that he was innocent and said he explained to tourists Rodney Merrill, 55, and Margaretta Patman that he worked for tips before posing with their kids Saturday.
The family had stopped for pictures with el-Khezzani and a Batman on the corner of West 45th Street and Broadway.
Batman, a k a Jose Escalona, claimed to The Post that the family stiffed the costumed workers after taking photos with them.
El-Khezzani said he told Patman, “Excuse me, miss. Have a nice day, but you lied” about giving a tip.
Merrill then shouted, “Are you calling my wife a liar?” el-Khezzani said.
“You don’t want to do this in front of your kids,” el-Khezzani said he told them.
“Show me your Spider-Man skills,” Merrill then allegedly challenged before walking away.
El-Khezzani said he retorted, “Great, you walk away,” prompting the tourist to turn around and smash him with an uppercut to the neck.
El-Khezzani said he was so angry that he called police, who tracked Merrill and Patman to a nearby McDonald’s. That’s when the family claimed el-Khezzani kicked Patman, he said.
Both Merrill and el-Khezzani were arrested on assault charges. Merrill, of McLean, Va., was released on a desk-appearance ticket.
Patman denied her husband did anything wrong.
“We were not the aggressors,” she told The Post on Sunday.
“A lot of people complained about Spider-Man. He does it all the time, being aggressive.
“He was harassing my baby,” she added of el-Khezzani, who was also charged with disorderly conduct.
The incident comes as the Times Square Alliance claims 61 percent of workers in the area have had a negative encounter with the costumed characters, who frequent tourist-heavy spots, offering pictures in exchange for tips.
The group surveyed Times Square workers in October and is slated to host a news conference Monday on the costumed-character crisis, two days before a City Council hearing on legislation that would regulate pedestrian plazas.
A little more than half of the workers who said they had a bad experience with costumed characters felt unsafe after the interaction, the Alliance said. |
Trump's deliberations over his running mate have already spilled out into the public sphere, as both he and surrogates have hinted at who might be on the shortlist.
Trump has repeatedly stressed that he would pick a running mate with political and government experience -- versus a businessman like himself -- whose relationships with powerful members of Congress could help him enact his agenda legislatively.
In past interviews, Trump has said he's looking at five or six candidates and that he will unveil his pick at the Republican National Convention in July. But the real estate mogul has offered only a few clues as to what kind of person he is looking for.
One of his advisers on the matter and former presidential rival, Ben Carson, appeared to spill the beans recently, telling The Washington Post that among those on the list are John Kasich, Marco Rubio, and Ted Cruz. Trump later said few, if any, of those were actually being considered, and Carson backed off his remarks. |
PG2 ASW
Looking to Paul George’s hometown of Palmdale for design direction, these colors represent the various aspects of the Inland Empire. The gray represents the desert and dust of Palmdale, while the orange is meant to highlight the sunset on the horizon. The pop of green is a nod to the nature around this area. Lastly, the sockliner features a custom graphic of Palmdale, and a grit out and midsole highlight the city’s terrain. |
It is well-known that superior energy resolution can be realized with radiation detectors that use superconducting tunnel junctions, as compared with semiconductor radiation detectors using semiconductors. The energy gap of a superconductor is small, on the order of 1/1000th of the energy gap of a semiconductor or less, and is considerably smaller than the maximum phonon energy; therefore, when radiation is absorbed in a superconductor, a 1000-times greater number of electrons than in the case of a semiconductor detector are excited above the energy gap. In a superconducting tunnel junction, the electrons excited above the energy gap can be extracted as signal charge via a tunneling effect. Therefore, a radiation detector using a superconducting tunnel junction can have extremely high sensitivity and high energy resolution (see Non-Patent Literature 1).
However, with a detector of the type in which radiation is directly absorbed in a single superconducting tunnel junction to measure its energy, because the superconducting tunnel junction has a small surface area on the order of several hundred micrometers×several hundred micrometers or less and a thickness on the order of several hundred nanometers, the detection efficiency is extremely low, at one part in several thousand compared with that of a semiconductor detector.
To overcome these drawbacks of radiation detectors using superconducting tunnel junctions, a superconducting series-junction detector has been developed (for example, see Patent Literature 1 and Patent Literature 2). The superconducting series-junction detector is provided with a superconducting series junction in which a large number of superconducting tunnel junctions are connected in series or in parallel on at least one surface of a single-crystal insulator or semiconductor substrate. The superconducting series junction mentioned here includes not only junctions connected in a single series, as in Patent Literature 1, but also includes multiple series junctions connected in parallel. The substrate thickness is, for example, about 400 micrometers. In the superconducting series-junction detector, radiation is absorbed in a radiation absorber, such as the substrate, where the energy thereof is converted to phonons, the phonons are absorbed in the superconducting tunnel junctions formed on the surface of the radiation absorber, exciting electrons in the superconductor, and those excited electrons are extracted as signal charge via the tunneling effect. The energy of the radiation is measured from the magnitude of that signal charge. Because the phonons are absorbed in a large number of superconducting tunnel junctions, the effective area of the detector can be made large. In addition, because the thickness of the radiation absorber is the thickness of the detector, the radiation absorption efficiency can also be increased.
A superconducting tunnel junction is also effective for an optical sensor. When a superconducting series junction is used as an optical sensor, the sensor effective area is large; therefore, in this case too, an advantage is afforded in that the detection efficiency is high. In the present invention, light such as ultraviolet light, visible light, infrared light, which are electromagnetic waves similar to X-rays etc., are also included in the definition of radiation.
With regard to radiation detectors making use of the fact that a large number of electrons are excited in a superconductor by radiation, besides superconducting tunnel junction detectors, for example, kinetic induction detectors (Kinetic Inductance Detector) are also well-known (for example, see Non-Patent Literature 2). Kinetic inductance detectors are also known as microwave kinetic inductance detectors (Microwave Kinetic Inductance Detector). In a kinetic inductance detector, when electrons are excited in a superconducting film of a resonator by radiation, the kinetic inductance of the superconductor resonator changes. The resonance frequency and Q factor of the superconducting resonator change due to this change in the kinetic inductance. The amount of radiation or the energy per individual unit of radiation is measured from the magnitude of the changes in resonance frequency and Q factor (for example, see Non-Patent Literature 3).
In other words, in a kinetic inductance detector and a superconducting tunnel junction detector, although the signal extraction methods are different, what they have in common is that the basis of the signal is excited electrons in the superconductor.
In the case of a kinetic inductance detector, similar to the case of a superconducting series-junction detector, radiation can be absorbed in a semiconductor or insulator single-crystal radiation absorber, where the energy thereof is converted to phonons, these phonons are absorbed in a phonon-absorbing superconducting film provided on the surface of the radiation absorber, exciting electrons, and the radiation can also be detected using changes in the resonance frequency and Q factor of a resonator formed to include this superconducting film (for example, see Non-Patent Literature 4 and Non-Patent Literature 5).
In other words, with the phonon-mediated kinetic inductance detector and the superconducting series-junction detector, although the signal extraction methods differ, what they have in common is that the basis of the signal is excited electrons that are excited in the superconducting film on the substrate surface by phonons generated by radiation absorbed in the substrate. Note that, in the case of the superconducting series junction, the superconducting film on the substrate surface is a superconducting lower electrode of the superconducting tunnel junction.
In the case of the phonon-mediated kinetic inductance detector, it is necessary to provide the superconductor for absorbing phonons on the surface of the radiation absorber substrate; however, with regard to the entire resonator, in some cases the entire resonator is provided on that substrate surface (for example, see Non-Patent Literature 4), and in some cases, some elements of the resonator are provided on another substrate close to that substrate (for example, see Non-Patent Literature 5). FIGS. 1 to 4 show example structures of these kinetic inductance detectors. FIG. 1 and FIG. 2 are an example in which the entire resonator is provided on the surface of the radiation absorber substrate, where FIG. 1 is a plan view, and FIG. 2 is a sectional view taken through part A-A in FIG. 1. FIG. 3 and FIG. 4 are an example in which part of the resonator is provided on another substrate close to the radiation absorber substrate. FIG. 3 is a plan view of the other substrate close to the radiation absorber substrate, and FIG. 4 is a sectional view of the entire resonator, corresponding to part A-A in FIG. 3, including both a radiation absorber substrate 4 and another substrate 5 close to it. 1 represents a through-line formed of a superconducting film for supplying microwaves and measuring the Q factor and resonance frequency, 2 represents a phonon-absorbing superconducting film, and 3 represents a high-Q-factor superconducting resonator line. The through-line 1 and the high-Q-factor superconducting resonator line 3 are capacitively coupled. In addition, in this case also, the phonon sensor 2 is bonded to the surface of the radiation absorber 4.
In the superconducting series-junction detector and the kinetic inductance detector, radiation is absorbed in the radiation absorber, such as a semiconductor or insulator substrate, where the energy thereof is converted to phonons, the phonons are absorbed in the superconducting tunnel junction or phonon-absorbing superconductor formed on the surface of the radiation absorber, exciting electrons in the superconductor, and these excited electrons are extracted as signal charge via the tunneling effect, or a change in the characteristics of the superconducting resonator due to the excited electrons is extracted as a signal. The radiation energy is measured from the magnitude of this signal. However, this does not mean that all of the radiation energy is directly converted to phonons. This can be understood from the principle of a semiconductor detector that does not use phonons. In the case of a semiconductor detector, an electric field is applied to the detector to collect electrons and holes excited by radiation, and the radiation energy is measured from the magnitude of this signal charge. On the other hand, in the case of a radiation detector in which a signal is generated by phonons, such as the superconducting series-junction detector, the electrons and holes in the radiation absorber cannot contribute to the signal charge unless their energy is converted to phonons.
The processing time for the signal from the superconducting series-junction detector and the kinetic inductance detector is normally from several microseconds to several tens of microseconds. Therefore, in the case of these superconducting radiation detectors, the radiation energy expended in generating electrons and holes in the radiation absorber, such as a semiconductor or insulator, by the radiation does not contribute to the signal unless the electrons and holes recombine within the time for extracting and processing the signal, and the energy is thereof is converted to phonons. However, the lifetime of excited electrons in a high-purity silicon substrate, in other words, the electron-hole recombination time, is from several tens of microseconds to 1 millisecond or longer.
In addition, for example, in the case where the radiation absorber is semiconductor silicon and where the radiation is X-rays, it is well-known that about 30% of the X-ray energy is imparted to electrons, and the remaining about 70% is expended in generating phonons. However, this energy distribution ratio statistically fluctuates for each unit of radiation even though the radiation energy is constant, and this statistical fluctuation degrades the energy resolution.
Unless the excitation energy possessed by electrons excited by radiation such as X-rays and light is released in the form of phonons within the signal measurement time, there is a problem in that, not only does the energy resolution of these detectors deteriorate, but also the sensitivity is reduced by a corresponding amount. |
----------- On Hiatus -------------I love characters, but they always break my heart. |
Q:
Testing CanCanCan ability definition
I'm using CanCanCan with Rolify and I´m trying to test my Ability class authorization.
When testing if a unprivileged user can CRUD other users in the system the test fails
1) Ability a guest user should not be able to manage others
Failure/Error: expect(subject).to_not be_able_to(:crud, User)
expected not to be able to :crud User(...)
But I can't find any reason why the check in my Ability class fails:
class Ability
include CanCan::Ability
def initialize(user = User.new)
alias_action :create, :read, :update, :destroy, :destroy_multiple, to: :crud
# What is wrong?
can :crud, User, id: user.id
if user.has_role?(:admin)
can :manage, User
end
end
end
This is my spec:
require 'rails_helper'
require 'cancan/matchers'
RSpec.describe Ability do
let(:user) { create(:user) }
subject { Ability.new(user) }
context "a guest user" do
it "should be able to manage self" do
expect(subject).to be_able_to(:crud, user)
end
it "should not be able to manage others" do
expect(subject).to_not be_able_to(:crud, User)
end
end
end
A:
expect(subject).to_not be_able_to(:crud, User)
You are referencing User model, not instance there. Use User.new or another persisted User instance.
|
Statewide political activism for California academic nursing leaders.
The California Association of Colleges of Nursing (CACN) is a not-for-profit, non-partisan nursing organization whose members are the universities' Schools of Nursing that offer baccalaureate and graduate degree programs in California. The nursing deans and directors are the individuals who attend scheduled statewide meetings and actualize the mission, vision, and governance of this organization. Starting in 2011, CACN began a journey toward greater political activism that was initiated by strategic planning. During the Spring 2017 meeting, forty-four California nursing deans/directors advanced their advocacy by attending prescheduled visits with California legislators. The goals for meetings with California policy makers included: 1. Inform them about CACN as an organization and its sphere of influence and 2. Educate them about CACN's perspective on current bills in the California legislature. This manuscript details a process to assist other state organizations to move toward political activism in support of the nursing profession from the academic nursing leadership perspective. |
The effectiveness of community interventions targeting HIV and AIDS prevention at young people in developing countries.
To identify successful HIV/AIDS prevention interventions targeting youths and delivered in geographically bounded communities (for example, rural villages, urban settlements or neighbourhoods) in developing countries. A systematic review and synthesis of studies evaluating interventions that were published between January 1990 and December 2004 was conducted. Using predetermined criteria, all interventions were summarized into multiple tables to facilitate comparison. Results of the evaluations of each of four types of intervention were reviewed using predetermined thresholds of evidence. The four types of interventions were classified as follows. Type 1 interventions were those targeting youths and delivered through existing organizations or centres that served youths. Type 2 were those targeting youths but not affiliated with existing organizations or centres. Type 3 were those targeting all community members and delivered through traditional kinship networks. Type 4 were those targeting communities as a whole and delivered through community-wide events. Evaluations of 22 interventions were reviewed. Type 1 interventions produced primarily positive results at the required threshold of evidence. They are recommended for use in scaling-up projects but should be subject to continued rigorous evaluations. Studies of all other intervention types produced primarily positive results, but the evaluations were less rigorous so clear conclusions could not be drawn about their effectiveness. It is recommended that these interventions be continued and that priority should be given to implementing rigorous evaluations of these interventions. Considerable creativity, ingenuity and commitment is demonstrated in designing and delivering HIV interventions but there is a paucity of adequate evidence of their effectiveness. This precludes identification of the types of interventions that actually produce the targeted changes. It is essential that governments and donor agencies invest in high quality process and outcome evaluations and cost-benefit analyses so that effective interventions can be identified and promoted. |
Last season one of the dominant stories for the NFL was its sudden and unexpected drop in ratings. After so many years of so much growth, it was shocking to see the NFL’s massive television viewing numbers actually move in the opposite direction.
There were lots of theories as to why the NFL would see a dip in ratings last season – people were obsessed with the election (a reasonable theory) or that people were boycotting Colin Kaepernick (a bit far-fetched although there are poll numbers that support it). Then there is just plain old overexposure (which might be the best explanation).
Heading into this season, it would seem as though the NFL would be set up to rebound with no new 2017 election cycle. While overall ratings were down last season, they did bounce back up once the calendar hit November and benefitted from the success of the Dallas Cowboys and the number of nationally televised games that were shown.
Nevertheless, that may not be the case. According to Variety, evidence shows that advertisers are preparing for another drop in ratings this season for the NFL’s most watched primetime games:
A Variety survey of commercial-ratings projections for the 2017-18 broadcast-network TV season finds that ad buyers believe fewer people than last season will watch commercials during such primetime stalwarts as NBC’s “Sunday Night Football” and the “Thursday Night Football” broadcasts on both NBC and CBS. To be sure, the games remain TV’s top draw, with higher ratings expected for football than almost anything else on next season’s grid. But NFL games are proving just as vulnerable to audience erosion as their scripted counterparts. Advertisers’ commercial ratings predictions are culled by using estimates from three top media-buying agencies, which negotiate prices for and placement of billions of dollars in TV commercials each year.
It’s impossible to predict what might happen politically and culturally this fall that could potentially derail the NFL from the outside. The ratings dip last year certainly has the NFL’s attention and they’ve responded by altering how commercials are aired throughout the games with fewer, yet longer advertising breaks.
Do the predictions from advertisers just reflect a hangover from the sudden decreases last year or is there something that has a deeper and long-term meaning at play?
Perhaps the most interesting comment might come from one of those ad buyers who believes that the NFL has “peaked” and overexposed itself on national television.
The 2017-18 C3 projections illustrate the effects of football’s tough season last year, when the outsize allure of the presidential election and the absence of star players prompted a drop of about 8%, or around 1.4 million people, in TV’s overall football audience. NFL stars Tony Romo, Tom Brady and Peyton Manning were off the gridiron for various reasons at the start of the season (Manning retired), and a slew of political headlines and debates kept the nation distracted from its usual pastimes. The Chicago Cubs took part in the World Series for the first time in decades, providing more competition for sports fans. Meanwhile, a new supply of Thursday-night games on broadcast has made more of the sport available to a wider audience. “Straight up, I believe the NFL has peaked and there too many games being broadcast,”said Ira Berger, who supervises ad buying on broadcast and cable for The Richards Group, an independent Dallas ad agency. “Nothing goes up forever — except taxes.”
We’ve been wondering for years when the NFL would hit its peak in terms of television ratings. At some point, it just has to because it’s unrealistic to expect it to keep growing and growing ad infinitum. Sports have life cycles, which is why horse racing and boxing aren’t leading your local sports section and baseball has been replaced by football as the national pastime.
The league could bounce back this year, but this is the first time we’ve really seen the idea of the NFL hitting its peak given credence by someone from inside the television industry. Before the shield starts to panic, its numbers still far outpace any other sports league or entertainment property in the country and likely will do so for the foreseeable future.
There are much more important longer term issues with people watching and playing football with the world still learning more about concussions and CTE. Who knows what might happen to football in 50 or 60 years. But in the immediate short term, the idea of overexposure certainly makes sense as the NFL has expanded so rapidly with games now on Thursday, Sunday, and Monday nights as well as some Sunday morning broadcasts from London. If the NFL has reached a point of oversaturation, then they have to own that themselves and figure out if less is more.
This season will be incredibly informative though in letting us know whether or not last year’s decline in numbers was a one-year fluke, or the beginning of a downward trend for the league as it comes down from its ratings heights.
[Variety] |
Q:
Codeship independent CI for microservices in monorepo
Currently we have a NodeJS monolith app. The tests run in Codeship and if the tests are green then the code will be deployed to Heroku. That is pretty easy.
So we would like to break up our monolith app into microservices and we prefer monorepo solution.
For example we have service-1 and service-2 in the repo. We would like to setup independent CI and deployment pipeline for each services on Codeship.
my-repo
- service-1
- src
- package.json
- docker-compose.yml
- codeship-steps.yml
- service-2
- src
- package.json
- docker-compose.yml
- codeship-steps.yml
Do you have any idea how can we setup the ideal CI?
A:
Yes CodeShip Pro provides a Docker Compose-like approach to setting up multiple services from the same project space. Assuming microservices are already split up into their particular folders, a codeship-services.yml may look like the following:
service-a:
build:
context: ./service-a
dockerfile: Dockerfile # The Dockerfile in ./service-a directory
service-b:
build:
context: ./service-b
Please check out our comprehensive intro guide for more information
|
Inhibition of soleus Hoffmann reflex by ankle-foot orthosis application in healthy volunteers.
An ankle-foot orthosis is suggested to actively assist dorsiflexion of the foot by induction of a positive proprioceptive impact to ankle dorsiflexor muscles. However, an objective proof is missing. To assess the proprioceptive impact of an ankle-foot orthosis application by Hoffmann reflex recordings of the soleus muscle under static conditions. It was hypothesized that the use of an ankle-foot orthosis facilitated dorsiflexor motor function and thus a decreased the soleus Hoffmann reflex. Experimental study in healthy volunteers, pre-post test design. In all, 20 healthy volunteers were enrolled in order to assess the proprioceptive impact of orthosis application. The Hoffmann reflex was recorded before, during, and after orthosis application. Under orthosis application, the Hoffmann reflex significantly decreased as compared to before (p < 0.05) and after application (p < 0.05). Findings indicate an inhibition of plantarflexors probably induced by facilitation of ankle dorsiflexors under static conditions. At first glance, it seems that foot orthoses primarily have a stabilizing effect on ankle joints in terms of simple mechanical bandages. However, the present results suggest an additional active impact on proprioceptive control. The putative neuromodulatory effect on motor control may support the application of such ankle-foot orthoses in, for example, drop foot. Furthermore, the objective assessment of a neurophysiological mode of action of orthoses by Hoffmann reflex recordings might be an appropriate primary outcome parameter in clinical trials. |
Starbound 1.3 PC Free Game Download – LINK IN DESCRIPTION
Here is Starbound 1.3 PC Free Game Download – LINK IN DESCRIPTION that will work as title says. this Tool has been developed by groupe of hackers whos only fun is to hack some program. This program will do exactly what you looking for.
NO HIDDEN ads, surveys or offers. Download includes just one .exe file which includes instruction file and program itself. NO Scams, malwares, viruses or other hidden BS… Only tool file.
Starbound 1.3 PC Free Game Download – LINK IN DESCRIPTION made to be secure and safe, it has built in proxy list, which will hide your IP. There is nothing to worry about.
Starbound 1.3 PC Free Game Download – LINK IN DESCRIPTION features
- Clean file, no ads, offers or malwares
- Easy install and full instruction txt file
- Built in Proxy list
- Supports Windows And Mac OS (some mobile platforms too, but you need to download and test, if this tool works on your phone)
- Support (contact us with questions or report error)
Developer Notes
Download Links: (Google drive)
Part 1 (990mb) –
Part 2 (464mb) –
Starbound is developed and published by Chucklefish. It was released in 22 Jul, 2016.
You’ve fled your home, only to find yourself lost in space with a damaged ship. Your only option is to beam down to the planet below and gather the resources you need to repair your ship and set off to explore the vast, infinite universeu2026
In Starbound, you create your own story – there’s no wrong way to play! You may choose to save the universe from the forces that destroyed your home, uncovering greater galactic mysteries in the process, or you may wish to forego a heroic journey entirely in favor of colonizing uncharted planets.
All files are uploaded by users like you, we can’t guarantee that Starbound 1.3 PC Free Game Download – LINK IN DESCRIPTION are up to date. Download and check if it’s works for you, if not, search for different version in search box. Enjoy. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.