text stringlengths 8 5.77M |
|---|
Anton Pannekoek Institute for Astronomy
Astronomer Joeri van Leeuwen receives Vici grant
26 February 2018
Astronomer Joeri van Leeuwen of the Netherlands Institute for Radio Astronomy (ASTRON)/UvA receives a Vici grant of 1.5 million euros to hunt for the source of gravitational waves. In the next five years he will study the afterglow of fused neutron stars with the radio telescopes in Westerbork, the Netherlands, with a team of six researchers.
Gravitational waves occur when two heavy objects in the Universe, such as neutron stars or black holes, revolve around each other and merge together. With the instruments Virgo and LIGO it is already possible to detect these ripples in space-time. But where they come from, and how they are made, is still largely unknown.
Van Leeuwen is able to study one of the causes of gravitational waves with the radio telescopes in Westerbork: the fusion of two neutron stars. 'Colliding neutron stars cause big explosions, which we can also see in radio light,' says Van Leeuwen. 'By studying the afterglow of these explosions, we can determine very precisely where the gravitational waves come from, which is not possible using gravitational wave detectors alone.'
In October 2017, colliding neutron stars that caused gravitational waves were observed for the first time in different types of light with multiple telescopes. A special feature of the radio telescopes in Westerbork is that they can search an even larger part of the sky than other telescopes with the most sensitive widescreen cameras in the world (Apertif).
By studying the neutron star explosions, Van Leeuwen also hopes to learn more about the matter of neutron stars. 'This matter is the same stuff that our bodies are made off, but we do not yet fully understand that. By measuring the afterglow of the explosions, we will learn more about the mass and the stability of the neutrons in the star.'
Clashing neutron stars can also cause very energetic radio flashes. 'Neutron stars have very strong magnetic fields, and when they merge into a black hole, this magnetic field is thrown out, which is probably a super strong magnetic pulse that we might see as a radio burst with our radio telescopes.'
The Vici grant allows Van Leeuwen to set up a new team of six researchers with whom he will hunt down the afterglow of gravitational wave sources. The observations start after the summer, when the Virgo and LIGO detectors start looking for gravitational waves again. 'As soon as they find one, we get a signal, and then we will try to find the source immediately with our telescopes.' |
Defense Minister Ehud Barak this weekend criticized the way Prime Minister Benjamin Netanyahu and Foreign Minister Avigdor Lieberman have handled relations with the Palestinian Authority over the last four years, telling Haaretz in an interview: "The last government should have done much more to advance the peace process vis-a-vis [Palestinian President Mahmoud] Abbas."
Barak also welcomed the conciliatory statements made by Abbas to Channel 2 interview on Thursday, whereby he declared that as long as he remains in power, he will not allow a third intifada to break out.
Abbas admitted in the interview that as a Palestinian refugee from Safed he wants to return to the city, but said only as a tourist, because Safed is part of Israel. "I believe that the West Bank and Gaza is Palestine. And the other parts are Israel," Abbas said. "Now and forever".
Barak said in an interview with Haaretz that Abbas' remarks were very courageous in light of the PA leader's political situation vis-a-vis Hamas. The defense minister termed the TV interview "very important because of its clarity" and because it was broadcast on "the channel that reaches more homes in the country than any other."
President Shimon Peres also reacted positively, saying Abbas' remarks should be taken seriously because "they accord with the position of the majority of the Israeli public, which supports the two-state solution."
Netanyahu, however, condemned Abbas and hinted that his remarks were aimed at deceiving the Israeli public. "There is no connection between the Palestinian Authority chairman's statements and his actual actions," read a statement issued by the Prime Minister's Office last night. It went on to say that Abbas "has refused to renew the negotiations with Israel for four years."
Among other reactions to Abbas' statements, Labor Party chairwoman Shelly Yacimovich, in a clear appeal to right-wing voters, was restrained. "A retreat to the 1967 border is inconceivable," she said, adding that the Palestinian leader's promise not to permit a third intifada to erupt was "satisfactory."
Political newbie Yair Lapid, whose Yesh Atid party is also targeting Likud-Yisrael Beiteinu voters, declined Haaretz's requests for his reaction to the Abbas interview.
In the interview Barak noted, though, that Abbas was not perfect and bore much of the responsibility for the stalled negotiations, calling "in error" the PA president's categorical rejection of all West Bank construction. "I told him a few times that when I was in talks with Arafat we built four times more in the settlements than now, and that when Olmert talked with him in Annapolis we built twice as much as today," Barak said.
But Barak laid part of the blame for the absence of talks at the door of Netanyahu's government, which he has served as defense minister for the past four years. Barak said Netanyahu claimed to support unconditional negotiations but did little to advance the peace process.
Barak stressed that despite his close cooperation with Netanyahu on the Iranian nuclear topic, he took issue with the prime minister when it came to the Palestinians, and made his own views clear in every meeting of the security cabinet. Barak repeated several times that if the international community saw Israel trying to make progress with the Palestinians, this would help in creating a worldwide consensus on the Iran issue.
"We have responsibility in the long term," Barak said, adding, "I did not succeed in getting the cabinet to deliberate in a deeper manner with the Palestinians. Many figures in Likud do not mean what I mean when they say negotiations without preconditions. I told Netanyahu all the time that we had to take ourselves in hand and present a policy initiative, without the petty games, and to say clearly what we are willing" to accept.
When asked why he did not do more as defense minister to advance the peace process, Barak cited the balance of political forces within the Netanyahu government. "When Lieberman is a major force in the government and the Likud representation in Knesset looks the way it does, that is the situation," Barak said.
He added that the Palestinian issue must be given a more central spotlight in the current elections campaign, as violence could resurge should the diplomatic freeze ensue. "Economy and society are important," Barak said, "but calm in Judea and Samaria is like health – you don't feel just how crucial it is until it's no longer missing to say we can maintain this equilibrium for so many years is a very erroneous way to read reality. We are on borrowed time." |
先ほどロサンゼルスでスタートした“Ubisoft E3 2018 カンファレンス”にて、MontrealのクリエイティブディレクターRoman Campos-Oriola氏が登壇し、「For Honor」のプレゼンテーションが開始。中国にインスパイアされた新勢力“Marching Fire”と攻城戦にフォーカスした新モード“Breach”の導入を発表。さらに6月18日（月）まで、UplayのPC版“For Honor”スターターエディションを期間限定で無料化することが明らかになりました。
なお、“Marching Fire”は10月16日ローンチ予定とのこと。 |
[Cite as State v. Brooks, 2012-Ohio-3810.]
Court of Appeals of Ohio
EIGHTH APPELLATE DISTRICT
COUNTY OF CUYAHOGA
JOURNAL ENTRY AND OPINION
No. 97668
STATE OF OHIO
PLAINTIFF-APPELLEE
vs.
IMANUEL BROOKS
DEFENDANT-APPELLANT
JUDGMENT:
REVERSED AND REMANDED
Criminal Appeal from the
Cuyahoga County Court of Common Pleas
Case Nos. CR-548353 and CR-551178
BEFORE: Jones, J., Sweeney, P.J., and Kilbane, J.
RELEASED AND JOURNALIZED: August 23, 2012
ATTORNEY FOR APPELLANT
Mary Elaine Hall
645 Leader Building
526 Superior Avenue, East
Cleveland, Ohio 44114
ATTORNEYS FOR APPELLEE
William D. Mason
Cuyahoga County Prosecutor
BY: Mark J. Mahoney
Assistant County Prosecutor
The Justice Center, 8th Floor
1200 Ontario Street
Cleveland, Ohio 44113
LARRY A. JONES, SR., J.:
{¶1} Defendant-appellant, Imanuel Brooks, appeals his sentence. For the reasons
that follow, we reverse and remand for resentencing.
I.
{¶2} In March 2011, Brooks was charged in Case No. CR-548353 with the
following crimes: Count 1, rape of a victim less than 13 years of age, with a sexually
violent predator specification; Count 2, kidnapping, with a sexual motivation
specification; and Count 3, intimidation of a crime victim or witness. The victim was
the ten-year-old daughter of Brooks’s girlfriend.
{¶3} In June 2011, Brooks was charged in Case No. CR-551178 with the
following crimes: Count 1, kidnapping; Count 2, felony domestic violence; Count 3,
aggravated menacing; Counts 4 and 5, misdemeanor domestic violence; Count 6,
aggravated menacing; Count 7, attempted murder; Count 8, felonious assault; Count 9,
domestic violence; and Count 10, aggravated menacing. The victim from the first case
was the named victim in Count 5, misdemeanor domestic violence; the named victim for
the remaining counts was her mother, Brooks’s girlfriend.
{¶4} After negotiations between Brooks and the state, Brooks pleaded guilty in the
first case to Count 1, rape, amended to delete the victim’s age and the sexually violent
predator specification, and Count 2, amended to attempted kidnapping with a sexual
motivation specification. The remaining charges in the case were dismissed.
{¶5} Relative to the second case, Brooks pleaded guilty to Count 2, felony
domestic violence, Counts 4 and 5, misdemeanor domestic violence, and Count 8,
felonious assault. The remaining charges in the case were dismissed.
{¶6} Sentencing was had on November 30, 2011. On the first case, the trial court
overruled the defense’s contention that the rape and attempted kidnapping counts merged,
and sentenced Brooks to ten years on the rape and six years on the attempted kidnapping,
to be served consecutively. On the second case, the trial court sentenced Brooks to
seven years on the felonious assault, and four years on the felony domestic violence, to be
served consecutively. The court also sentenced him to six months on each of the
misdemeanor domestic violence counts, to be served concurrently to each other and
concurrent to the felonious assault and felony domestic violence sentence. Brooks now
appeals, raising the following assignments of error for our review:
I. The trial court committed plain error when it failed to merge the rape
and attempted kidnapping with a sexual motivation specification in Counts
1 & 2 in CR 11-548353 for the purposes of felony sentencing.
II. The trial court committed plain error when it sentenced the
defendant-appellant to four years imprisonment for the third degree felony
of domestic violence.
III. The trial court committed plain error when it imposed consecutive
felony sentences upon the defendant-appellant in CR 11-548353 & CR
11-551178 because those sentences were contrary to law.
IV. The trial court committed plain error when it imposed consecutive
felony sentences upon the defendant-appellant in CR 11-548353 & CR
11-551178 in violation of its statutory duties pursuant to R.C. 2929.11 &
2929.12.
V. The trial court committed plain error when it imposed a six year
sentence for attempted kidnapping with a sexual motivation specification in
Count 2 to be served consecutively with the ten year sentence for rape in
Count 1 in CR 11-551178 in conflict with the overall purposes of felony
sentencing in R.C. 2929.11(A).
{¶7} Because all of Brooks’s assignments of error are relative to his sentence, we
consider them together.
II.
{¶8} The Ohio Supreme Court set forth the standard for reviewing felony
sentencing in State v. Kalish, 120 Ohio St.3d 23, 2008-Ohio-4912, 896 N.E.2d 124.
Under Kalish, appellate courts must apply a two-step approach when analyzing alleged
error in a trial court’s sentencing.
{¶9} First, they must examine the sentencing court’s compliance with all
applicable rules and statutes in imposing the sentence to determine whether the sentence
is clearly and convincingly contrary to law. If this first prong is satisfied, the trial
court’s decision is reviewed under an abuse-of-discretion standard. Id. at ¶ 4.
A. Merger of Rape and Attempted Kidnapping
{¶10} For his first assigned error, Brooks contends that the trial court erred by not
merging the rape and attempted kidnapping convictions. The state concedes the error,
and we agree.
R.C. 2941.25 provides as follows:
(A) Where the same conduct by defendant can be construed to constitute
two or more allied offenses of similar import, the indictment or information
may contain counts for all such offenses, but the defendant may be
convicted of only one.
(B) Where the defendant’s conduct constitutes two or more offenses of
dissimilar import, or where his conduct results in two or more offenses of
the same or similar kind committed separately or with a separate animus as
to each, the indictment or information may contain counts for all such
offenses, and the defendant may be convicted of all of them.
{¶11} The Ohio Supreme Court’s most recent analysis of allied offenses is in State
v. Johnson, 128 Ohio St.3d 153, 2010-Ohio-6314, 942 N.E.2d 1061. In Johnson, the
Court established, through a two-tiered test, that the conduct of the accused must be
considered when determining whether offenses are allied offenses of similar import
subject to merger. The first inquiry focuses on whether it is possible to commit multiple
offenses with the same conduct. Id. at ¶ 48. If the offenses “correspond to such a
degree that the conduct of the defendant constituting commission of one offense
constitutes commission of the other, then the offenses are of similar import.” Id. It is
not necessary that both crimes are always committed by the same conduct, only whether it
is possible for the defendant’s conduct to result in the commission of both offenses. Id.
If it is possible to commit both offenses with the same conduct, then courts must look at
the “state of mind” of the offender to determine if the offender acted with a separate
animus or purpose in committing two or more offenses. Id.
{¶12} Under Johnson, the facts of the criminal conduct must be evaluated to
determine whether the offenses are allied offenses subject to merger. “Post Johnson,
courts must undertake a case-by-case inquiry as to whether the defendant’s conduct can
constitute the commission of more than one charged offense.” State v. Hicks, 8th Dist.
No. 95169, 2011-Ohio-2780, ¶ 10.
{¶13} The record here demonstrates that the attempted kidnapping was part and
parcel of the rape. The two counts, therefore, should have merged. Accordingly, the
first assignment of error is sustained and the case is remanded for resentencing, at which
the state shall elect on which count to proceed. See State v. Whitfield, 124 Ohio St.3d
319, 2010-Ohio-2, 922 N.E.2d 182, ¶ 25.
B. Sentence on Felony Domestic Violence Count
{¶14} In his second assignment of error, Brooks contends that the trial court erred
in sentencing him to four years, i.e., 48 months, on the third degree felony domestic
violence count under the law prior to the sentencing amendments made pursuant to House
Bill 86 (“H.B. 86”). The state concedes the assignment of error, and we agree.
{¶15} H.B. 86 was effective on September 30, 2011, and Brooks was sentenced
on November 30, 2011. R.C. 1.58(B) provides that if the “penalty, forfeiture, or
punishment for any offense is reduced by a reenactment or amendment of a statute, the
penalty, forfeiture, or punishment, if not already imposed, shall be imposed according to
the statute as amended.”
{¶16} Under the law prior to H.B. 86, the domestic violence charge in Count 2 of
the second case was subject to a 1-to-5 year sentence. After the enactment of H.B. 86,
the same conviction is subject to a 9-, 12-, 18-, 24-, 30-, or 36-month sentence. See R.C.
2929.14(A)(3)(a) and (b). The trial court advised Brooks at the plea hearing that he
would be sentenced under the new law, but at sentencing, it sentenced him to four years
under the old law.1
{¶17} Because Brooks’s punishment for this offense was reduced by the enactment
of H.B. 86, under R.C. 1.58, the trial court should have sentenced him under the new law.
Accordingly, his second assignment of error is sustained.
C. Consecutive Sentences on the Two Cases
{¶18} As stated, Brooks’s third and fourth assignments of error challenge the trial
court’s judgment ordering that the sentence in the first case to be served consecutively to
the sentence in the second case. The argument within the assignments of error,
however, challenge the trial court’s imposition of consecutive sentences on the rape and
kidnapping counts, and more than a three year sentence on the third degree felony
domestic violence count. We find the trial court erred on those sentences, and thus
Brooks’s arguments in that regard are moot. To the extent, however, that Brooks’s
argument is that the trial court cannot impose the sentences on the two cases to run
consecutively, we find it not well taken. Upon resentencing, if the trial court complies
with the statutory requirements for felony consecutive sentences, it may sentence Brooks
to consecutive terms on the two cases. See generally State v. Brewster, 8th Dist. Nos.
1
The trial court gave Brooks the option of withdrawing his plea based upon the court’s
representation at the plea hearing that it would be sentencing him under the new law, but Brooks
declined to withdraw his plea.
80755 and 80756, 2002-Ohio-5847.
D. Sentence on Rape and Attempted Kidnapping
{¶19} In his final assignment of error, Brooks contends that the trial court’s
sentence on the rape and attempted kidnapping counts did not comport with the
overriding purposes of felony sentencing. Because we find that the two counts should
have merged, this assignment of error is moot.
{¶20} Judgment reversed; case remanded for resentencing consistent with this
opinion.
It is ordered that appellant recover from appellee costs herein taxed.
The court finds there were reasonable grounds for this appeal.
It is ordered that a special mandate issue out of this court directing the common
pleas court to carry this judgment into execution.
A certified copy of this entry shall constitute the mandate pursuant to Rule 27 of
the Rules of Appellate Procedure.
LARRY A. JONES, SR., JUDGE
JAMES J. SWEENEY, P.J., and
MARY EILEEN KILBANE, J., CONCUR
|
Rajesh Khattar
Rajesh Khattar is an Indian television and film actor, voice actor, and screenwriter.
Personal life
Khattar married actress Neelima Azeem in 1990 who is also Shahid Kapoor's mother. They have a son, Ishaan Khatter, who is an actor. Khattar and Azim got divorced in the year 2001. Khattar married Vandana Sajnani in 2008. Their first child, a boy, was born in August 2019 after 11 years of marriage.
Career
As a film actor, Khattar has worked in Hindi films like Don, Don 2, Khiladi 786, Race 2, the Satish Kaushik-directed Gang of Ghosts, Manjunath and Traffic. Khattar also appeared in English and other language TV series and TV films such as Sharpe's Peril, the French series Fais pas ci, fais pas ça and German movie Gift (2017) directed by Daniel Harrich.
Khattar returned to television after 8 years with Beyhadh as Ashwin Mehrotra on Sony TV, followed by Kya Qusoor Hai Amala Ka? as Rishaan Malik on Star Plus. He also featured in Vikram Bhatt's Spotlight on Viu. In 2018, Khattar portrayed the role of Harshvardhan Hooda in Colors TV's Bepannah.
Filmography
Films
Television
Dubbing career
As a Hindi voice-dubbing artist, Khattar has dubbed for many famous Hollywood actors including Tom Hanks, Johnny Depp, Jack Black, Robert Downey Jr., Dominic West, Nicolas Cage, Lambert Wilson and Michael Fassbender.
Dubbing roles
Live action films
Animated films
Production staff
Original content
Live action films
Dubbed content
Live action films
Awards and nominations
See also
Dubbing (filmmaking)
List of Indian Dubbing Artists
References
External links
Category:1960s births
Category:Living people
Category:Male actors in Hindi cinema
Category:21st-century Indian male actors
Category:Indian male voice actors |
---
author:
- 'Guanghan Cao, Cao Wang, Zengwei Zhu, Shuai Jiang, Yongkang Luo, Shun Chi, Zhi Ren, Qian Tao, Yuetao Wang and Zhu’an Xu'
title: 'Superconductivity induced by cobalt doping in iron-based oxyarsenides'
---
**Chemical doping has recently become a very important strategy to induce superconductivity especially in complex compounds. Distinguished examples include Ba-doped La$_2$CuO$_4$ (the first high temperature superconductor), K-doped BaBiO$_3$[@Cava1988], K-doped C$_{60}$[@Hebard] and Na$_{x}$CoO$_{2}\cdot y$H$_{2}$O[@Takada]. The most recent example is F-doped LaFeAsO[@Kamihara08], which leads to a new class of high temperature superconductors. One notes that all the above dopants are non-magnetic, because magnetic atoms generally break superconducting Cooper pairs. In addition, the doping site was out of the (super)conducting structural unit (layer or framework). Here we report that superconductivity was realized by doping magnetic element cobalt into the (super)conducting-active Fe$_2$As$_2$ layers in LaFe$_{1-x}$Co$_{x}$AsO. At surprisingly small Co-doping level of $x$=0.025, the antiferromagnetic spin-density-wave transition[@Dai] in the parent compound is completely suppressed, and superconductivity with $T_c\sim $ 10 K emerges. With increasing Co content, $T_c$ shows a maximum of 13 K at $x\sim 0.075$, and then drops to below 2 K at $x$=0.15. This result suggests essential differences between previous cuprate superconductor and the present iron-based arsenide one.**\
\
Recent discovery of superconductivity at 26 K in LaO$_{1-x}$F$_{x}$FeAs[@Kamihara08] has opened a new chapter in superconductivity research. The superconductivity was induced by partial substitution of O$^{2-}$ with F$^{-}$ in the parent compound LaFeAsO whose crystal structure consists of insulating La$_2$O$_2$ layers and conducting Fe$_2$As$_2$ layers (see the inset of Fig. 1(b)). Following this discovery, the superconducting transition temperature $T_c$ over 40 K was realized in LnFeAsO$_{1-x}$F$_{x}$ (Ln=lanthanides)[@Chen-Sm; @Chen-Ce; @Ren-Sm] and LnFeAsO$_{1-\delta}$[@Ren-Sm2]. Through an alternative chemical doping of thorium-for-gadolinium, $T_c$ has achieved 56 K in Gd$_{0.8}$Th$_{0.2}$FeAsO.[@Wang] These substitutions introduce extra positive charges in the insulating Ln$_2$O$_2$ layers, and extra electrons are produced onto the Fe$_2$As$_2$ layers as a result of charge neutrality. The occurrence of superconductivity in this sense is rather similar to cuprate superconductors in which superconductivity appears when appropriate amount of charge carriers are transferred into the CuO$_2$ planes by chemical doping at “charge reservoir layers”.[@Cava]
Band structure calculations and theoretical analysis reveal itinerant character of Fe 3$d$ electrons in the iron-based oxyarsenides.[@Singh; @wnl; @Tesanovic] The calculated electron density-of-states (DOS) versus energy for LaO$M$As ($M$ = Mn, Fe, Co and Ni) by Xu et al.[@Xu] shows that the main feature of total DOS remains unchanged, except that Fermi levels shift toward the top of valence band with band filling (adding electrons) one by one from $M$ = Mn, Fe, Co to Ni. According to this calculation, substitution of cobalt for iron is expected to add electrons into Fe$_2$As$_2$ layers because cobalt has one more electron than iron does. Therefore, we explored the cobalt substitution for iron in LaFeAsO system. Strikingly, superconductivity was observed by slight cobalt doping even on the superconducting-active Fe$_2$As$_2$ layers.
The polycrystalline LaFe$_{1-x}$Co$_{x}$AsO samples were synthesized by solid state reaction in vacuum using powders of LaAs, La$_{2}$O$_{3}$, FeAs, Fe$_{2}$As and Co$_{3}$O$_{4}$. LaAs was presynthesized by reacting stoichiometric La pieces and As powders in evacuated quartz tubes at 1223 K for 24 hours. FeAs and Fe$_{2}$As were prepared by reacting stoichiometric Fe powders and As powders at 873 K for 10 hours, respectively. Co$_{3}$O$_{4}$ and La$_{2}$O$_{3}$ were dried by firing in air at 773 K and 1173 K, respectively, for 24 hours before using. The powders of these intermediate materials were weighed according to the stoichiometric ratio of LaFe$_{1-x}$Co$_{x}$AsO ($x$=0, 0.01, 0.025, 0.05, 0.075, 0.1, 0.125, 0.15 and 0.2) and thoroughly mixed in an agate mortar and pressed into pellets under a pressure of 2000 kg/cm$^{3}$, all operating in a glove box filled with high-purity argon. The pellets were sealed in evacuated quartz tubes and heated at 1433 K for 40 hours.
Figure 1(a) shows the representative XRD patterns of LaFe$_{1-x}$Co$_{x}$AsO samples. The XRD peaks can be well indexed based on a tetragonal cell of ZrCuSiAs-type structure, indicating that the samples are essentially single phase. The lattice parameters are plotted in Fig. 1(b) as a function of Co content. With increasing Co content, the $a$-axis remains nearly unchanged while the $c$-axis shrinks significantly. Thus the cell volume decreases almost linearly, which is related to the smaller Co$^{2+}$ ions (than Fe$^{2+}$ ions). This fact indicates that Co was successfully doped into the lattice, according to Vegard’s law.
{width="7cm"} {width="8cm"}
The oxygen content in LaFe$_{1-x}$Co$_{x}$AsO is an important issue in present study, because oxygen deficiency itself might induce superconductivity. By high-pressure synthesis, superconductivity was indeed observed in oxygen-deficient LnFeAsO$_{1-\delta}$[@Ren-Sm2; @Kito]. It has also been reported that superconductivity was induced by oxygen deficiency in Sr-doped LaFeAsO via annealing in vaccum.[@Wu] We note that all the reported superconductors showed a remarkable decrease in $a$-axis as well as $c$-axis owing to the oxygen deficiency. However, the present LaFe$_{1-x}$Co$_{x}$AsO samples show no obvious change in $a$-axis, suggesting no significant oxygen deficiency.
Figure 2(a) shows the temperature dependence of electrical resistivity ($\rho$) in LaFe$_{1-x}$Co$_{x}$AsO. For the parent compound, a prominent anomaly characterized by a drop of $\rho$ was observed below 150 K. Neutron diffraction study[@Dai] indicated a structural phase transition at 155 K followed by an antiferromagnetic spin-density-wave transition at 137 K in LaFeAsO. The drop in $\rho$ (and also $\chi$, shown in the inset of Fig. 2(c)) at the structural transition temperature was interpreted as the result of incipient magnetic order.[@Fang] On doping 1% Co, the anomaly temperature $T_{anom}$ was suppressed to 135 K. For 0.025 $<x<$ 0.125, the resistivity anomaly disappears, instead, it shows a resistivity minimum at $T_{min}$ depending on the Co-doping levels. At lower temperatures, these samples become superconducting with $T_c$ from 7 to 13 K, as can be seen more clearly in Fig. 2(b). The samples of $x$=0.15 and 0.2 show no sign of superconducting transition above 3 K. The magnetic susceptibility at low temperatures (Fig. 2(c)) show strong diamagnetic signal for the samples with 0.025 $\leq x\leq $ 0.125. The magnetic expelling (Meissner effect) fraction and magnetic shielding one of the sample of $x$=0.075 are estimated to be 11% and 30%, respectively, confirming bulk superconductivity. For $x$=0, 0.01 and 0.15, no superconductivity was observed above 2 K.
{width="7cm"} {width="7cm"} {width="7cm"}
The electronic phase diagram for LaFe$_{1-x}$Co$_{x}$AsO was thus established from the above experimental data, as depicted in Figure 3. The phase region of the SDW state is very narrow. 2.5% Co doping completely destroys the SDW order, and superconductivity emerges. In the superconducting regime with 0.025 $\leq x\leq $ 0.125, one sees a dome-like $T_c(x)$ curve, similar to that of cuprate superconductors. Though the normal state shows metallic conduction at high temperatures, semiconducting behaviour is all observed above $T_c$. It is noted here that the borderline between metallic and semiconducting regions is not well established because polycrystalline samples were employed. For the higher Co-doping levels of $x\geq$0.15, superconductivity no longer survives. Further Co doping is also of interest, because the other end member LaFeCoO was an itinerant ferromagnetic metal[@LaCoAsO].
{width="7cm"}
The present Co-doped LaFeAsO system shows both similarities and differences in comparison with the phase diagram of F-doped LaFeAsO[@Kamihara08; @wnl; @PD]. First, the AFM SDW state in LaFeAsO is suppressed or destroyed by the electron doping in both systems. Second, both systems show a maximum $T_c$ upon electron doping. However, there are some differences as for the details of the electronic phase diagrams. (1) Co doping destroys the AFM order more strongly, and it shows no coexistence of superconductivity and SDW state. (2) The maximum $T_{c}$ is significantly lower in Co-doped system. (3) The optimal doping level is significantly lower and the superconducting region is narrower in LaFe$_{1-x}$Co$_{x}$AsO system. (4) The normal state of LaFe$_{1-x}$Co$_{x}$AsO system shows semiconducting behaviour above $T_{c}$. The last three points are probably related with the disorder effect within (Fe/Co)$_2$As$_2$ layers. The first issue can be qualitatively understood in Figure 4. According to the theoretical studies[@Yildirim; @Si; @Lu], the AFM order in the parent compound originates from the competing nearest-neighbor and next-nearest-neighbor superexchange interactions, bridged by As 4$p$ orbitals. Both interactions are antiferromagnetic, which gives rise to a frustrated magnetic ground state (striped AFM). Upon doping Co onto the Fe site, the original antiferromagnetic superexchange interactions may be changed into a double exchange between Co and Fe atoms, which obviously destroys the striped AFM order.
{width="8cm"}
Co-doping induced superconductivity challenges our previous understanding about occurrence of superconductivity via chemical doping. As a typical magnetic element, cobalt does not act as superconducting Cooper pairs breakers, which implies unconventional superconductivity. Additionally, superconductivity is robust in spite of doping on the Fe$_2$As$_2$ conducting layers. These facts support the itinerant scenario of the 3$d$ electrons, reminiscent of superconductivity on the border of itinerant-electron ferromagnetism in UGe$_2$[@Saxena]. For the cuprate superconductors, in sharp contrast, substitution of Cu with its neighbors in Periodic Table (Ni and Zn) in CuO$_2$ definitely destroys the superconductivity.[@Tarascon] Therefore, our result suggests that the mechanisms of two class high temperature superconductivity should be essentially different.
[00]{} Bednorz, J. G. & Muller, K. A. Possible high $T_c$ superconductivity in the Ba-La-Cu-O system. *Z. Phys. B* **64**, 189-193 (1986). Cava, R. J. *et al.* Superconductivity near 30 K without copper: the Ba$_{0.6}$K$_{0.4}$BiO$_3$ perovskite. *Nature* **332**, 814-816 (1988). Hebard, A. F. *et al.* Superconductivity at 18 K in potassium-doped fullerene (C$_{60}$). *Nature* **350**, 600-601 (1991). Takada, K. *et al.* Superconductivity in two-dimensional CoO$_2$ layers. *Nature* **422**, 53-55 (2003). Kamihara, Y. *et al.* Iron-based layered superconductor La\[O$_{1-x}$F$_x$\]FeAs ($x$=0.05-0.12) with $T_c$=26 K. *J. Am. Chem. Soc.* **130**, 3296-3297 (2008). Cruz, C. *et al.* Magnetic order versus superconductivity in the iron-based layered La(O$_{1-x}$F$_{x}$)FeAs systems. *Nature* 453, 899-902 (2008). Chen, X. H. *et al.* Superconductivity at 43 K in samarium-arsenide oxides SmFeAsO$_{1-x}$F$_x$. *Nature* **354**, 761-762 (2008). Chen, G. F. *et al.* Superconductivity at 41 K and its competition with spin-density-wave insability in layered CeO$_{1-x}$F$_x$FeAs. *Phys. Rev. Lett.* 100, 247002 (2008). Ren, Z. A. *et al.* Superconductivity at 55 K in iron-based F-doped layered quaternary compound Sm\[O$_{1-x}$F$_x$\]FeAs. *Chin. Phys. Lett.* **25**, 2215-2216 (2008). Ren, Z. A. *et al.* Novel superconductivity and phase diagram in the iron-based arsenic-oxides ReFeAsO$_{1-\delta}$ (Re = rare-earth metal) without fluorine doping. *Europhysics Lett.* **83**, 17002 (2008). Wang, C. *et al.* Thorium-doping induced superconductivity up to 56 K in Gd$_{1-x}$Th$_x$FeAsO. Preprint at http://arxiv.org/abs/0804.4290v2 (2008). Cava, R. J. Oxide superconductors. *J. Am. Ceram. Soc.* **83**, 5-28 (2000). Singh, D. J. & Du, M.-H. Density functional study of LaFeAsO$_{1-x}$F$_x$: A low carrier density superconductor near itinerant magnetism. *Phys. Rev. Lett.* **100**, 237003 (2008). Dong, J. *et al.* Competing orders and spin-density-wave instability in La(O$_{1-x}$F$_x$)FeAs. *Europhysics Lett.* **83**, 27006 (2008). Cvetkovic, V. & Tesanovic, Z. Multiband magnetism and superconductivity in Fe-based compounds. Preprint at http://arxiv.org/abs/0804.4678 (2008). Xu, G. *et al.* Doping-dependent phase diagram of LaOMAs (M=V-Cu) and electron-type superconductivity near ferromagnetic instability. *Europhysics Lett.* **82**, 67002 (2008). Kito, H. Eisaki, H. & Iyo, A. Superconductivity at 54 K in F-Free NdFeAsO$_{1-y}$. *J. Phys. Soc. Jpn.* **77**, 063707 (2008). Wu, G. et al. Superconductivity induced by oxygen deficiency in Sr-doped LaOFeAs. Preprint at http://arxiv.org/abs/0806.1687 (2008). Fang, C. *et al.* Theory of electron nematic order in LaFeAsO. *Phys. Rev. B.* **77**, 224509 (2008). Luetkens, H. *et al.* Electronic phase diagram of the LaO$_{1-x}$F$_x$FeAs superconductor. Preprint at http://arxiv.org/abs/0806.3533 (2008). Yanagi, H. *et al.* Itinerant ferromagnetism in layered crystals LaCoOX (X = P, As). Preprint at http://arxiv.org/abs/0806.0123 (2008). Yildirim, T. Origin of the $\sim$150 K anomaly in LaOFeAs: Competing antiferromagnetic superexchange interactions, frustration, and structural phase transition. Preprint at http://arxiv.org/abs/0804.2252 (2008). Si, Q. & Abrahams, E. Strong correlations and magnetic frustration in the high $T_{c}$ iron pnictides. Preprint at http://arxiv.org/abs/0804.2480 (2008). Ma, F. Lu, Z. & Xiang, T. Antiferromagnetic superexchange interactions in LaOFeAs. Preprint at http://arxiv.org/abs/0804.3370 (2008). Saxena, S. S. *et al.* Superconductivity on the border of itinerant-electron ferromagnetism in UGe$_2$. *Nature* **406**, 587-592 (2000). Tarascon, J. M. *et al.* 3$d$-metal doping of the high-temperature superconducting perovskites La-Sr-Cu-O and Y-Ba-Cu-O. *Phys. Rev. B.* **36**, 8393-8400 (1987).
This work is supported by the National Basic Research Program of China, the Natural Science Foundation of China and the PCSIRT of the Ministry of Education of China.
|
Array Extensions (Part 1)
Array Extensions (Part 2)
Destructuring (Part 1)
Destructuring (Part 2)
Destructuring (Part 3) |
Optimal design of multichannel equalizers for the structural similarity index.
The optimization of multichannel equalizers is studied for the structural similarity (SSIM) criteria. The closed-form formula is provided for the optimal equalizer when the mean of the source is zero. The formula shows that the equalizer with maximal SSIM index is equal to the one with minimal mean square error (MSE) multiplied by a positive real number, which is shown to be equal to the inverse of the achieved SSIM index. The relation of the maximal SSIM index to the minimal MSE is also established for given blurring filters and fixed length equalizers. An algorithm is also presented to compute the suboptimal equalizer for the general sources. Various numerical examples are given to demonstrate the effectiveness of the results. |
Yancey Ward said...My father was an avid turkey hunter here in Tennessee, but his observation was that he would see dozens of them out season, and the day before hunting season started, they disappeared.
What do you do If someone grabs away your property, OR there is a breach of agreement of sale OR You are planning to buy a property and you wish to know if there is a claim or objection to the said land, Of course you approach an advocate. As per the situation demands he may sometimes ask you to Public Notice Ad in Newspaper. Now what do you do? you don’t want to spend thousands of rupees on Newspaper ads just for placing a legal notice but at the sometime you also want to fulfil the formality. How do we help you?
We could talk about politics, but we always do that, and Althouse finds much of it either boring or click-bait.
We could talk about religion -- generally, in the West, religion has been a force for good. Islam? Not so much. Buddhism? Well, a little esoteric.....
We could talk sports.
We could talk science.
We could talk philosophy -- I'm still reading this "Trial of Socrates" by IF Stone (likely a Commie). In essence, Socrates used to wander around the streets of Athens, irritating people and asking questions, like, "How do you really know that?" He didn't write anything himself, which, to me, makes him suspect. Maybe, Plato is creating the image of Socrates in a way, Plato perceived him, not as Socrates actually was.
We could talk real estate. It's very expensive in the Bay Area. If you own a home, you are de facto rich. If you don't own a home, well, you may be a lifetime renter, not a rentier.
Yancey Ward remembers: My father was an avid turkey hunter here in Tennessee, but his observation was that he would see dozens of them out season, and the day before hunting season started, they disappeared.
Animals aren't stupid. When we had a large acreage in the mountains, deer would know when hunting season was starting and they would hang out in our yard. It was a 'sanctuary city'. I'm certainly not against hunting but we didn't hunt and the deer must have known it.
Well, seriously though; Who COULD HAVE EVER predicted that? I mean, If half the people in the country didn't vote; and half of those that did vote, voted for Trump... wouldn't you just ASSUME That WHAT sports fans Wanted; was to have ex-jocks talk about how much they hated Trump? That isn't what people were looking for? Who knew?
They are and they aren't. Sure, they don't really understand why we voted for Trump, nor do they care. But the execs knew very well that we despise their politics, and the politicization of sports on ESPN. But the deplorables still have a bit or market power.
OK, I took my walk. It dropped from 90 to 65 overnight after a short T-storm, and it was much nicer than yesterday. Today we have a brisk wind, blue skies and lower humidity. Yesterday, the Siberian was struggling on the beach, and today she was pretty happy to go a couple of miles up and back. Not the best day for picking up shark's teeth though, I only found 15.
Also, anyone noticed that Google has been broken for a few years? There was a time I could search "campy fantasy movie with dumb x-sword" and get 30 precise hits. Now all I get is an Amazon advert for a blender and 30 completely unrelated suggestions.
CBS was roundly [and justifiably] criticized for showing a post-round interview rather than the pivotal shot Koepka had to make to save his round for the win. Who'da thunk that, when we tune into a major golf tournament, we'd rather see GOLF than INTERVIEWS!
Will be crossing into Canada tomorrow. Got my vehicle serviced today and will have my firearm shipped to Tok so I can pick it up as soon as I hit Alaska. Weather has been wet and cold for the most part but the trip is fine otherwise.
The Woman wanted to do an experiment to see if tin-foil helmets would prevent us from reading each others' minds, until I showed her this article about how the government uses tin-foil helmets to spy on people.
“So apparently Adam Shiff wants to impeach Trump so he can figure out why he did it.”
The answer there is $$$$$$$$. I saw this earlier today. Might have been here, and if it was, I apologize in advance to those whom this bores. The Dems, from Speaker Palsi are stuck right now between a rock and a hard place. Their fringe wacko moneybags, like Tom Steyer and George Soros bought the last election through a combination of massive advertising and a lot of cheating, facilitated by Soros having bought election officials by the bushel around the country. They hate Trump with a white hot passion. They are demanding Impeachment probably only because drawing, quartering, flaying, and implement are currently not quite acceptable, yet, in this country. And the biggest recipients of that largess, those bribes, are the committee chairs looking into ways to impeach Trump, led by Pencil Neck Schiff himself. My memory is that he raked in almost $7 million in campaign contributions last year. They are going after Trump with an unholy vengeance, because that is what they were paid, and paid handsomely, to do.
Those deep pockets bought Palsi her new, no doubt oversized, Speaker’s gavel. But she got it by the Dems electing a lot of Trump district freshman Dems to Congress. If they impeach before they have anything that the broad American public would see as High Crimes and Misdemeanors, the Dems can probably say goodbye to their House majority, and probably the Presidency next year.
They recently have cranked up their subpoena machine requesting mountains of documents and large numbers of interviews under their oversight authority. But they have several problems there. First and foremost, much of what they are requesting has little if anything to do with legitimate oversight. Instead, it is aimed at finding crimes purportedly committed by Trump and his family. Which is not oversight, but a fishing expedition, which is not a legitimate Congressional purpose. And then Trump has ordered that a lot of what they want is covered by Executive Privilege. Sure, some will be pried loose through litigation, but it is going to be slow going. Very slow.
The wackos who bought this House majority want action now, and that means impeachment before probable cause of wrongdoing has been obtained. It would, maybe make discovery by the House easier because the rules for impeachment investigations are broader than for oversight investigations. But with it comes the argument by Trump and the Republicans that it was a fishing expedition, but also that the Dems are cheating. Part of our Anglo/American jurisprudence model is that probable cause comes first. Moreover, they are the ones who refused to allow an orderly transition of power after Trump won, and now essentially demanding a do over, based solely, it seems, on OrangeManBad. Americans don’t like cheaters, esp when it means negating their ballots. But it doesn’t appear that Palsi has the power to prevent what she surely knows will doom her to a one term Speakership, while almost guaranteeing Trump a second term.
Read an interesting article that the Dems had already written 2020 off.
Biden will be the sacrificial lamb to keep down-ticket races from getting swamped, and the other 23 dwarves are only in it to increase their speaking fees as a "former Presidential candidate" and get name recognition for 2024.
I’ve noticed that also about search engines. Amazon’s is absolutely the worst. Search for a men’s black belt, 32 inches and you get 12,000 results and half are not belts. Of the half that’s left 99% don’t meet the search criteria. I’ve started using another search engine to get results on amazon and use that.
My mother is an avid genealogist. She is a very old lady now, but very sharp and she has developed some interesting contacts - such as in the Spanish Ministry of Defense. Granted, our tribe has some colorful cases, so this hobby has amused her.
A couple of weeks ago she turned up something truly odd. Now, we have thought for some time that one branch (on my mothers side) was descended from a Turk. This was my late great uncles pet theory. This, it turns out, is true, in spades.
It seems we are descendants of the prophet Mohammed, sayyids, by way of the House of Ali, by way of a family of noble Turks granted military fiefdoms (timars), by way of a Turkish general and a sometime Pasha of Smyrna, killed holding an Ottoman fortress in what is now Moldavia against Catherine the Great, in 1770.
His son was born of a Spanish lady captured by the Turks and eventually deposited in the Pashas sergalio (the theme of a thousand romance novels and that opera by Mozart). Eventually the boy and his cousin, disaffected by Islam, decamped for Marseilles, and took service with the Bourbon monarchies of France and Spain. Both converted to Christianity and seem to have prospered and found favor.
The information comes by way of a petition, dated 1806, to the Emperor Napoleon, asking for intervention in a French lawsuit on behalf of the ex-Turk, concerning an inheritance, which contains a summarized personal history.
Granted, it is possible that this account is a bit over-egged. And there is no shortage of sayyids, syeds, saids. Its funny though to think of even a very distant kinship with, say, Sayyid Qutb.
They recently have cranked up their subpoena machine requesting mountains of documents and large numbers of interviews under their oversight authority. But they have several problems there
When the Dems have dug themselves a deeper hole, President Trump is going to "buckle."By "buckle" I mean he will unleash his people to appear. By then President Trump will have had time to work with Republicans on the committee to corordinate their questions. (shh,big secret, Republicans get to ask questions) Those question will be directed at the witnesses concerning the collusion of all the govt actors participating in the soft coup. Think of the theater of Hope Hicks explaining the evidence the President has seen proving Obama was leading the agencies to spy on his campaign. Hicks laying out the foreign intel agencies involved, and why the Italian intel agency had a resignation of 6 of their top management chiefs.
Why has Mueller dropped out of the Democrat Talking points? Nadler figured out Republicans are going to corner him to an exact time he knew the conspiracy with Russia was a frame up. (Weeks not years) The Republicans are going to grill him on Mifsud, and why Mueller claims he was working with the Russians, when he works with Britain all the time.Republicans have a lot more information they want from Mueller.
...In an interview conducted on Sunday morning, Deputy Labor leader Tanya Plibersek opined that if only her party had more time to explain to the various groups how much they’d all benefit from Labor’s plans, Australians would have realized how fortunate they’d be with a Labor government, and Shorten would’ve become Prime Minister. Such attitudes are patronizing, for they implicitly serve to place blame at the feet of voters, who apparently are too ignorant to know what’s good for them....
In the 60s there was an airline pilot rebuilding his SeaBee (amphibious airplane) where I flew out of. Lots of weekend pilots and loiterers milling around. He had a large cardboard box set up, with the magic marker legend, "Suggestions, Questions, Advice: Speak into Box"
To this day, the only cure for the Celtic Curse is blood-letting. We've all seen the paintings of blood-letting. The red-n-white pole in front of barber shop down the street is a representation of blood-letting.
I've always wondered why someone would believe that blood-letting was a good idea. I just didn't know that the answer was looking at me in the mirror.
It’s the hunters who can’t read the calendar, early bird gets the worm, as they say. I sometimes hear the discrete report of a pre-season gunshot around here.
Once I remember when a light snow fell, first of the season, in the late after noon, and then bang, after deer season was over. I just figured the snow made finding that buck pretty easy all of a sudden. If it were up to me the season on deer would never close.
Daniel Greenfield AKA Sultan Knish, pointed this out. Schiff fundraising in 2016 = below $1 million, in 2018 = $6.25 million. Swalwell 2016 $1.9 million to $3 million. Mad Max Waters $729,ooo in 2012 to $1.5 million. Squeaky wheels getting grea$ed.A feed merchant in the turkey zone we hunted said the turkeys would take corn from a rattled coffee can by a fellow we saw doing so, with his terrier sitting on an adjacent woodpile not 10 feet away, but would not show up around anyone wearing camo. The hunted get educated quick.
Rep. Jerrold Nadler, the chairman of the House Judiciary Committee, subpoenaed former White House communications director Hope Hicks and an aide to former White House counsel Don McGahn to testify before the panel.
The subpoenas direct Hicks to turn over documents by June 4 and testify on June 19.
It is 35 pages, written as a series of 1 or 2 pages observations ("Summary" then "Detail"), with all this phony, baloney spy-lingo, jargon gobbledygook.
1. None of it signed by the supposed author ("Chris Steele")2. It has 6 anonymous sources (Source A - Source G), sprinkled amidst all these Russian names.3. It has double and triple hearsay. "Source A said that Ivan Romanov said that Boris Nokitoff said that..." 4. It elevates Michael Cohen as some mastermind plotter, who engineered secret meetings with Russian oligarchs in Prague -- a demonstrated lie.5. It claims Carter Page had these secret meetings with Russian spies, although Page was exonerated by Mueller.6. It mentions Manafort, who was nailed for several things, but nothing to do with Russian collusion.7. It suggests not only that Russian whores peed on a hotel bed, but that there were tapes of the event (which have never surfaced.).
In sum, no sane person reading this would give it any credence. It is one man's spy novel fantasy of all these events and people, most of which are unprovable, some have which have been proven false. Think of the ending of The Usual Suspects with Kaiser Sosay. A made-up story.
And yet it was used by Comey's FBI to con a Judge into authorizing a warrant to spy on US citizens and the Trump campaign.
Further reflections on GoT: Emilia Clarke said she prepped for her big speech to the massed soldiers by studying Hitler's speeches. Why does every dictator have to be Hitler? Why can't some dictators be modelled on Lenin or even Napoleon? I think in some ways Dany is closer to Napoleon than to Hitler. Napoleon thought he was a neo-Charlemagne when he was in fact a proto-Mussolini. Morever, Napoleon convinced many of the leading intellectual lights of his time that his bloody wars were fought for high moral purpose. Making Daenerys into a Hitler figure overly simplified the ambiguity of her motivvation. Also, I think to dramatize how seductive her power was, she should have worn a see through white gown instead of that black leather thing. As a matter of fact, that should have been her trade mark garment.
More like Darth Vader or admiral hux of the first order (Benioff and Weiss, are moving next on to star wars, more to the point nenioff wrote a novel based on the siege of leningrad, based on a novel by kurzio malaparte kaputt.
memorize that phrase, from my pal Georges Bernanos, if you plan to spend any significant amount of time with aging older baby boomers. It is a good phrase to use around the not-quite religious who are not so far gone as to not want to hear about the POWER OF PRAYER.
right now, the 1940s cohort, with some exceptions like Trump, and I guess a few lucky hundreds of thousands - maybe, if we are being generous, a million or so - of other lucky older people, feels, most days, very old and they need the kindness that the young should show to the old - for example, they remember the phrase "the hostess with the mostest", or other phrases no longer current, and they wonder- where did those days go ---- why do those days seem so long ago - ????
and the people who are even older than that - the people who are older than people born in the late 40s - also need lots of concern and care from those of us still blessed with youth and energy. !!!!
if you are one of those people who avoid old people because they depress you:
Sad!
Wake up!
THE WISH TO PRAY IS A PRAYER IN ITSELF.
Also, go to church, and participate in the public praise of our Lord. It is not easy to understand other people, and such an action on your part will help you understand.
you know this if you know poor people ---- anyone who owns a staircase, or who gets to spend time at a place with a staircase, is lucky.
That is one example of why Martin Luther King was a great speaker, he knew that.
if you were poor you know this: only rich people or people who are charging lots of coin to visit their establishments have stairs. Poor people just ain't wanted in places that are hoity toity ,or at least kind of hoity toity, anyway, with stairs and staircases.
The spezzatura of the Southern preachers of yesteryear is amazing. I remember. A forgotten art for many, but not forgotten by all of us.
Good old Chesterton. I think the fact that people will believe in anything is amply proven by religion itself, so the cleverness is more apparent than real--as so often with GKC.
And of course, it's just lazy thinking to elide not believing the claims of revealed religion with not believing "in something." Forex, I believe in my own intelligence and rationality, more than I believe anything anyone else has ever told me . . . I have empirical evidence of my own intelligence and rationality.
It appears that the Remainer Torys have digested the polls and are beginning to walk away from May towards a No Deal Brexit. Farage’s statement that he could no longer trust Boris has precipitated a rout in the Tory party. It looks like they know they will lose on Thursday and have shifted their attention to the next general election. They probably hope to blunt Farage’s momentum and, a la McCain, pretend to be something they are not to hold onto power. Quelle surprise!
U.S. Customs and Border Protection has put up just 1.7 miles of fencing with the $1.57 billion that Congress appropriated last [fiscal] year for President Donald Trump’s wall along the Mexican border, a federal judge was told.
1,300 miles of border wall yet to be built will therefore cost $923,500,000 per mile or $1.2 trillion (I think) for the entire wall, not counting inflation - over the the next 765 years. I guess this building project is tougher than Trump's infamous rebuild of a Central Park ice skating rink 33 years ago.
And us oldtimers were appalled by Defense Secretary Robert McNamara's $437 hammers. $37 screws, $640 toilet seats and $7,622 coffee makers which seemed a bit high in 1983.
Then why do you misunderstand Chesterton? People have spiritual needs, a hunger to be satiated, like any other appetite. If they try to suppress that appetite it will simply manifest in other ways, often more dangerous. Look at how many atheists worship Marxism or Climatology. Or their mirrors.
Organized religion has it's flaws, certainly. But the ones who think they are smart and rational enough to go their own way usually wind up caught up in something culty. Getting conned while smirking at everyone else "for being marks".
Definition of a "first world problem": visiting an article via a link on a blog, and finding out that it's behind a paywall.
Yes, that is painful, but there's far greater suffering in the world. Count your blessings.
Incidentally, sometimes you can get past a paywall by going to the article via the link, and quickly doing a Ctrl-A and then Ctrl-C before the paywall covering appears. Then paste the content in a Word document.
Another option is to read a synopsis or analysis of the article by a blogger and her commenters, while expressing gratitude for the free service.
There was a large peacock strolling up the center of the street yesterday when I took the beagle out for her 6 a.m. constitutional. The beagle was fascinated and a little intimidated. Wish I’d had my camera ready!
Nope, Narr is short for narrledudh. And the German word has an irony I like.
Do you think "you're a narcissist!" and "everyone longs for some spiritual something or other!" or "be careful, you'll end up in a cult, like my cousin Ina's boy!" are effectivearguments FOR religious faith? (Paraphrasis for time.)
FYI I find lefties in general and Marxists in particular to be fairly cretinous in mind and person. I try to pick my company carefully, and I like most of the commenters here, even some of those who are, at the moment, most determined to put me in my place (how's that for an apt possessive?)
BTW, Holland's Shadow of the Sword/Crescent(maybe there was an American and a British title?) is really excellent on that Middle Eastern sorting-out, I'm glad someone else has read it.
There was a large peacock strolling up the center of the street yesterday when I took the beagle out for her 6 a.m. constitutional. The beagle was fascinated and a little intimidated. Wish I’d had my camera ready!
Peacocks are intimidating. My sister had a bunch of them for years. They were beautiful but noisy and they pecked compulsively at windows. Overall, a real PITA.
Peacocks are LOUD. There's a small pride(?) in an enclosure on a small business campus a few blocks away, but when the wind is right they can be heard a long way; we have at least two species of owl that call loudly in the evenings, and a few years ago--
I'll never forget (it was like a spiritual experience!) walking late one damp autumn evening, when I realized that I was literally right under an enormous flock of ducks or geese heading south; I finished my walk and stood outside listening to the thrumming rustling roar maybe 150 feet above my head for another half-hour, and they were still going over when I went inside.
I always put "NYT" or "WaPo" in parens or elsewhere near any link to these places. Who doesn't know that means you'll be dealing with a paywall? The warning is there. If you don't realize "NYT" or "WaPo" are sites that make money through subscriptions, why would you be reading this blog? 1. I link to these sites just about every day (at least), 2. It's basic common knowledge that you'd have to be out of it to find surprising, 3. This blog is hard enough to read that I presume all readers are intelligent.
So I think the underlying idea is really: I think you should link to trashier places. But that's not the Althouse blog.
So I just don't think you like this blog, and that makes me interpret posts taking up the reader's attention with talk of the paywall to be trolling. Trolling, as I define it, and as I regard as deletable, is an effort at hurting this blog. The continued attacks and butthurt bitching about the paywall and my deletions is more self-identification as someone who doesn't like this blog and wants to undermine it. I weed that out for the benefit of readers who want to read what I am interested in providing.
Look at it this way OM. They both take a leap of faith. Just wen you think you've got it all figured out something comes alond and lays waste to all our dearly held beliefs. Ya ne ver know. So whatever is in charge has a perverse sense of humor. Or not.Depending.
I have great sympathy and respect for Christians. I was raised Christian. I just couldn't make myself believe. It's requires faith and I'm not big on faith. The story sounds absurd and I see no evidence. How that has a connection to my political beliefs is beyond me.
Back in the old days, when O'Hair was still around and publishing "The American Atheist" they went out of their way to find conservative and non-lefty writers (though of course she was a nasty old pinko herself). (Pinka?)
I recall one lady who liked to quote one of her Catholic school teachers: Miss Soandso is impervious equally to the truths of revealed religion and higher mathematics. (Sounds like someone I know.)
Now, global warming/climate change/whatever. Whatever the cause and whatever the consequence, if a global change is taking place (I think it is) there's NOTHING ANYONE CAN DO but be prepared (or not) for the sort of catastrophe our writers and moviemakers have so carefully imagined for us in the last 120 years or so.
NarrWell, we might throw money and power at politicians who sport 'D's . . . I have every faith in them |
The effect of coenzyme Q10 on rooster semen preservation in cooling condition.
Oxidative stress has been known as a significant cause of the lower fertility rates correlated with liquid stored rooster semen. The effect of coenzyme Q10 (CoQ10), as a powerful antioxidant, seems be beneficial on semen storage of broiler breeder roosters at the cooled condition. Therefore, two experiments were performed to assess the effect of CoQ10 supplemented semen extender on sperm quality parameters, fertility, hatchability and sperm penetration (SP) rates of rooster semen stored at 5 °C. In the first experiment, semen samples of 12 roosters were weekly pooled for four weeks (47-50 weeks of age). The pooled semen was diluted by modified Beltsville poultry semen extender and divided into three equivalent parts containing different levels of CoQ10 [0 (Q-0), 100 (Q-100) and 200 (Q-200) μM/mL) and then stored for 24 h at 5 °C. Sperm quality including progressive motility, plasma membrane integrity and functionality were evaluated after 0 and 24 h storage. The results showed that progressive motility, plasma membrane integrity and functionality were improved in Q-200 compared to Q-0 after 24 h storage at 5 °C (P < 0.01, P < 0.05 and P < 0.01, respectively). According to the results of the first experiment, Q-200 group was selected to be used to evaluate the fertility, hatchability and SP rate in the second experiment during next four weeks (51-54 weeks of age). The results of the second experiment showed that fertility rate was significantly increased in Q-200 compared to control group by approximately 10%, although no significant difference was observed in hatchability and SP rates between Q-200 and control groups. In conclusion, the results of the present research confirm that supplementation of rooster semen extender with CoQ10 might be potentially used to improve semen quality and fertility rates. |
[The radiologic picture of bronchopulmonary aspergillosis].
The increasing incidence of conditions associated with immune suppression, either as part of the illness or as the result of treatment, makes it necessary to investigate the possibility of fungus infections whenever there are broncho-pulmonary changes. In this respect, aspergillus is a common infection which produces more or less typical radiological changes. It often requires a variety of radiological procedures, including the use of CT and nuclear medicine. The latter can be useful in the allergic form of aspergillosis used for ventilation scintigraphy. The possibility of aspergillosis must be brought to the attention of the clinicians by the radiologist, even in cases that are not entirely typical. |
/**************************************************************************/
/* */
/* Copyright (c) 1996-2013 by Express Logic Inc. */
/* */
/* This software is copyrighted by and is the sole property of Express */
/* Logic, Inc. All rights, title, ownership, or other interests */
/* in the software remain the property of Express Logic, Inc. This */
/* software may only be used in accordance with the corresponding */
/* license agreement. Any unauthorized use, duplication, transmission, */
/* distribution, or disclosure of this software is expressly forbidden. */
/* */
/* This Copyright notice may not be removed or modified without prior */
/* written consent of Express Logic, Inc. */
/* */
/* Express Logic, Inc. reserves the right to modify this software */
/* without notice. */
/* */
/* Express Logic, Inc. info@expresslogic.com */
/* 11423 West Bernardo Court http://www.expresslogic.com */
/* San Diego, CA 92127 */
/* */
/**************************************************************************/
/**************************************************************************/
/**************************************************************************/
/** */
/** NetX Component */
/** */
/** Internet Group Management Protocol (IGMP) */
/** */
/**************************************************************************/
/**************************************************************************/
/**************************************************************************/
/* */
/* COMPONENT DEFINITION RELEASE */
/* */
/* nx_igmp.h PORTABLE C */
/* 5.5 */
/* AUTHOR */
/* */
/* William E. Lamie, Express Logic, Inc. */
/* */
/* DESCRIPTION */
/* */
/* This file defines the NetX Internet Group Management Protocol (IGMP)*/
/* component, including all data types and external references. It is */
/* assumed that nx_api.h and nx_port.h have already been included. */
/* */
/* RELEASE HISTORY */
/* */
/* DATE NAME DESCRIPTION */
/* */
/* 12-12-2005 William E. Lamie Initial Version 5.0 */
/* 08-09-2007 William E. Lamie Modified comment(s), */
/* resulting in version 5.1 */
/* 07-04-2009 William E. Lamie Modified comment(s), */
/* resulting in version 5.2 */
/* 12-31-2009 Janet Christiansen Added support for IGMPv2 e.g. */
/* sending leave group reports,*/
/* added multihome support, */
/* removed internal debug logic*/
/* resulting in version 5.3 */
/* 06-30-2011 Yuxin Zhou Modified comment(s), */
/* resulting in version 5.4 */
/* 04-30-2013 Yuxin Zhou Modified comment(s), */
/* resulting in version 5.5 */
/* */
/**************************************************************************/
#ifndef NX_IGMP_H
#define NX_IGMP_H
/* Define IGMP types and codes. */
/* IGMPv2 combines version field with the type field ffectively, and calls the 8 bit
field the Type field. IGMPv2 uses Type 0x11, 0x16, and 0x17 in this field, while
IGMPv1 uses Type 1 and 2 in the lower 4 bits, combined with version 1 in the upper 4 bits
for 0x11 and 0x12 as the possible values. */
/* Define the IGMP version in the IGMP header. */
#define NX_IGMP_VERSION 0x10000000
/* Define the numeric version of IGMP protocol used by NetX. */
#define NX_IGMP_HOST_VERSION_1 1
#define NX_IGMP_HOST_VERSION_2 2
/* Define the IGMP query message type and mask in the IGMP header. */
#define NX_IGMP_ROUTER_QUERY_TYPE 0x01000000
#define NX_IGMP_TYPE_MASK 0x0F000000
/* Define the IGMPv1 type for membership join reports. */
#define NX_IGMP_HOST_RESPONSE_TYPE 0x02000000
/* Define IGMPv2 types for membership join and leave reports. */
#define NX_IGMP_HOST_V2_JOIN_TYPE 0x16000000
#define NX_IGMP_HOST_V2_LEAVE_TYPE 0x17000000
/* Define the IGMPv2 type mask in the IGMP header. */
#define NX_IGMPV2_TYPE_MASK 0xFF000000
/* Define the IGMPv2 maximum response time mask in the IGMP header. Max value is 0x64,
left intentionally blank in IGMPv1 queries and all IGMP reports. Maximum response time
is in tenth's of a second. */
#define NX_IGMP_MAX_RESP_TIME_MASK 0x00FF0000
/* For IGMPv1 only, define the IGMP maximum delay time to 10 seconds as per RFC 1112. This is achieved if
the slow NetX IP periodic thread timer executes every second (e.g. NX_IP_PERIODIC_RATE is set to 100)
and the threadx timer interrupt occurs every 10 ms). */
#define NX_IGMP_MAX_UPDATE_TIME 10
/* Define the time to live for IGMP packets. RFC 1112 and 2236 specify
time to live should be set at 1. */
#define NX_IGMP_TTL 1
/* Define the mask for IGMPv1 packets' type field. */
#define NX_IGMP_TYPE_MASK 0x0F000000
/* Define the IP "all hosts" multicast address. */
#define NX_ALL_HOSTS_ADDRESS IP_ADDRESS(224, 0, 0, 1)
/* Define the IP "all routers" multicast address. */
#define NX_ALL_ROUTERS_ADDRESS IP_ADDRESS(224, 0, 0, 2)
/* Define Basic IGMP packet header data type. This will be used to
build new IGMP packets and to examine incoming IGMP queries sent
to NetX. */
typedef struct NX_IGMP_HEADER_STRUCT
{
/* Define the first 32-bit word of the IGMP header. This word contains
the following information:
bits 31-28 IGMP 4-bit version (Version 1)
bits 27-24 IGMP 4-bit type defined as follows:
Type Field IGMP Message Type
1 Router Query Request
2 Host Query Response
bits 15-0 IGMP 16-bit checksum
*/
ULONG nx_igmp_header_word_0;
/* Define the second and final word of the IGMP header. This word contains
the following information:
bits 31-0 32-bit group address (class D IP address)
*/
ULONG nx_igmp_header_word_1;
} NX_IGMP_HEADER;
/* Define the IGMP query response message size. */
#define NX_IGMP_HEADER_SIZE sizeof(NX_IGMP_HEADER)
/* Define IGMP function prototypes. */
UINT _nx_igmp_enable(NX_IP *ip_ptr);
UINT _nx_igmp_info_get(NX_IP *ip_ptr, ULONG *igmp_reports_sent, ULONG *igmp_queries_received,
ULONG *igmp_checksum_errors, ULONG *current_groups_joined);
UINT _nx_igmp_loopback_disable(NX_IP *ip_ptr);
UINT _nx_igmp_loopback_enable(NX_IP *ip_ptr);
UINT _nx_igmp_multicast_join(NX_IP *ip_ptr, ULONG group_address);
UINT _nx_igmp_multicast_interface_join(NX_IP *ip_ptr, ULONG group_address, UINT nx_interface_index);
UINT _nx_igmp_multicast_leave(NX_IP *ip_ptr, ULONG group_address);
VOID _nx_igmp_initialize(VOID);
VOID _nx_igmp_periodic_processing(NX_IP *ip_ptr);
VOID _nx_igmp_packet_process(NX_IP *ip_ptr, NX_PACKET *packet_ptr);
VOID _nx_igmp_packet_receive(NX_IP *ip_ptr, NX_PACKET *packet_ptr);
VOID _nx_igmp_queue_process(NX_IP *ip_ptr);
UINT _nx_igmp_multicast_check(NX_IP *ip_ptr, ULONG group_address, NX_INTERFACE *nx_interface);
/* Define error checking shells for API services. These are only referenced by the
application. */
UINT _nxe_igmp_enable(NX_IP *ip_ptr);
UINT _nxe_igmp_info_get(NX_IP *ip_ptr, ULONG *igmp_reports_sent, ULONG *igmp_queries_received,
ULONG *igmp_checksum_errors, ULONG *current_groups_joined);
UINT _nxe_igmp_loopback_disable(NX_IP *ip_ptr);
UINT _nxe_igmp_loopback_enable(NX_IP *ip_ptr);
UINT _nxe_igmp_multicast_join(NX_IP *ip_ptr, ULONG group_address);
UINT _nxe_igmp_multicast_interface_join(NX_IP *ip_ptr, ULONG group_address, UINT nx_interface_index);
UINT _nxe_igmp_multicast_leave(NX_IP *ip_ptr, ULONG group_address);
/* IGMP component data declarations follow. */
/* Determine if the initialization function of this component is including
this file. If so, make the data definitions really happen. Otherwise,
make them extern so other functions in the component can access them. */
#ifdef NX_IGMP_INIT
#define IGMP_DECLARE
#else
#define IGMP_DECLARE extern
#endif
#endif
|
Melanoma - what is new in sentinel node biopsy and locoregional treatments in 2003? Report of a workshop at the Third Research Meeting on Melanoma, Milan, Italy, May 2003.
This paper reports on the scientific session on sentinel node biopsy, surgery and locoregional treatments that took place during the Third Research Meeting on Melanoma, Milan, Italy, held in May 2003. It provides an overview of contributions presented at the meeting grouped according to subject - ultrasound scanning, sentinel node biopsy, mini-invasive surgery and stop-flow limb perfusion. The main comments made by the respective rapporteurs are also summarized. |
Q:
How to break down and print two list of lists together in Python?
Here are two lists:
a_value = [[0.234, 0.88,0.98],[0.923,0.777,0.87],[0.77,0.98,0.89]]
b_value = [[(1,1),(1,2),(1,3)],[(1,1),(1,2),(1,3)],[(1,1),(1,2),(1,3)]]
I need to join the two lists such that I have output that prints as:
Set1
b_value (1,1) = a_value 0.234
b_value (1,2) = a_value 0.88
b_value (1,3) = a_value 0.98
Set2
b_value (1,1) = a_value 0.923
b_value (1,2) = a_value 0.777
b_value (1,3) = a_value 0.87
Set 3
b_value (1,1) = a_value 0.77
b_value (1,2) = a_value 0.98
b_value (1,3) = a_value 0.89
The code that I have attempted looks like:
print("\n".join([('b_value{} a_value={}'.format(i,j)) for i,j in zip(b_value,a_value)]))
Output:
b_value[(1, 1), (1, 2), (1, 3)] a_value=[0.234, 0.88, 0.98]
b_value[(1, 1), (1, 2), (1, 3)] a_value=[0.923, 0.777, 0.87]
b_value[(1, 1), (1, 2), (1, 3)] a_value=[0.77, 0.98, 0.89]
I am not sure how to modify the code such that it breaks down the list of lists and also separates them into "Sets".
A:
Since you only need to print the values and not build a list, you should use for loops instead of the list comprehension. And then you also need to zip the sublists in a nested loop to place their items side-by-side:
for idx, (i ,j) in enumerate(zip(b_value,a_value), 1):
print("Set{}".format(idx))
for a,b in zip(i,j):
print('b_value {} = a_value {}'.format(a,b))
Set1
b_value (1, 1) = a_value 0.234
b_value (1, 2) = a_value 0.88
b_value (1, 3) = a_value 0.98
Set2
b_value (1, 1) = a_value 0.923
b_value (1, 2) = a_value 0.777
b_value (1, 3) = a_value 0.87
Set3
b_value (1, 1) = a_value 0.77
b_value (1, 2) = a_value 0.98
b_value (1, 3) = a_value 0.89
A:
You need to flatten the two lists, if you want to do this in a single line I'd use itertools.chain:
from itertools import chain
a_value = [[0.234, 0.88,0.98],[0.923,0.777,0.87],[0.77,0.98,0.89]]
b_value = [[(1,1),(1,2),(1,3)],[(1,1),(1,2),(1,3)],[(1,1),(1,2),(1,3)]]
print("\n".join([('b_value{} a_value={}'.format(i,j)) for i,j in zip(chain.from_iterable(b_value),chain.from_iterable(a_value))]))
However, if you need a faster method of flattening, use a few extra lines:
a_value = [[0.234, 0.88,0.98],[0.923,0.777,0.87],[0.77,0.98,0.89]]
b_value = [[(1,1),(1,2),(1,3)],[(1,1),(1,2),(1,3)],[(1,1),(1,2),(1,3)]]
flat_a = [item for sublist in a_value for item in sublist]
flat_b = [item for sublist in b_value for item in sublist]
print("\n".join([('b_value{} a_value={}'.format(i,j)) for i,j in zip(flat_b,flat_a)]))
|
Q:
Shutdown Mechanism in Unity 3D for Therapeutic Video Game
I am working on a therapeutic video game in Unity 3D which can only be played by a patient for 2 hours per day. After the two hour mark is reached, the game should not be able to be played until a full 24 hours later.
What is the best way to go about this in C# using any built in features of Unity3D? I am looking to use PlayerPrefs, Time.time (for the time the game has been on) and can't find anything in the documentation or forum that would let me access the current date.
My pseudo code is as follows:
variable that stores current date
variable that stores total play time
variable that stores the time that the 2 hour mark was reached
if it has been 24 hours past the last 2 hour mark:
game turns on
else
Application.Quit() - turn off the game
current total play time variable += Time.time
A:
It's as simple as using System.DateTime to access the current system time and date. C# in Unity runs on the Mono Framework (or .NET under special circumstances) and you can use most of their functionality.
|
{
"pagination": {
"BatchGetItem": {
"input_token": "RequestItems",
"output_token": "UnprocessedKeys"
},
"ListTables": {
"input_token": "ExclusiveStartTableName",
"limit_key": "Limit",
"output_token": "LastEvaluatedTableName",
"result_key": "TableNames"
},
"Query": {
"input_token": "ExclusiveStartKey",
"limit_key": "Limit",
"output_token": "LastEvaluatedKey",
"result_key": "Items"
},
"Scan": {
"input_token": "ExclusiveStartKey",
"limit_key": "Limit",
"output_token": "LastEvaluatedKey",
"result_key": "Items"
}
}
} |
C. Preisinger, B. Short, and V. De Corte contributed equally to this paper.
The online version of this article contains supplemental material.
Abbreviations used in this paper: MBP, myelin basic protein; MST, mammalian Ste20; siRNA, small interfering RNA; YSK1, yeast Sps1/Ste20-related kinase 1.
Introduction
============
Recent evidence suggests that the Golgi apparatus, in addition to its function in protein secretion, may be the site of signaling events important for diverse cellular processes (for review see [@bib18]; [@bib6]; [@bib40]). Thus, it has been proposed that the Golgi apparatus may act as a signaling platform, sensing and integrating signals from growth factor signaling pathways, and thereby participating in the regulation of downstream events ([@bib6]). This raises the question of which cellular processes require coordination of signaling at the cell surface and the various functions associated with the Golgi apparatus. The position of the Golgi apparatus within the cell responds to extracellular signals, rapidly reorienting in cells at experimental wound edges, migrating and polarizing cells, and in activated cytotoxic T lymphocytes toward the site of killing ([@bib28]; [@bib27]). These processes involve a complex series of signaling events coordinated with reorientation of the microtubule cytoskeleton and changes in actin dynamics dependent on dynein, Rho family GTPases, and the Arp2/3 complex ([@bib39]), and it is possible that membrane traffic and signaling via the Golgi apparatus are significant in this context. However, to date it is unknown how this integration between Golgi apparatus--associated signaling molecules and Golgi apparatus function could be achieved. Parallels between the organizational functions of Golgi matrix proteins and signaling scaffolds can be drawn ([@bib1]; [@bib20]), and it is possible that Golgi matrix proteins might organize and thereby control signaling complexes on Golgi membranes. This would also provide a means for coordinating signaling events with Golgi apparatus integrity and function.
The Ste20 family of serine/threonine protein kinases is implicated in a variety of signaling pathways including those involved in the control of cell migration and polarity ([@bib12]). In mammals, over 30 Ste20 kinases exist classified into two subgroups. These are the p21-activated kinases and the germinal center kinases ([@bib12]), and it is this latter group that is of interest here. Germinal center kinases possess an NH~2~-terminal kinase domain and a COOH-terminal regulatory domain and can be further subdivided into eight groups based on sequence homologies ([@bib12]). Subgroups II and III contain the mammalian Ste20 (MST) kinases, MST1 ([@bib11]), MST2 ([@bib10]), MST3 ([@bib43]), MST4 ([@bib32]; [@bib38]), and yeast Sps1/Ste20-related kinase 1 (YSK1; [@bib37]; [@bib35]). MST1 and MST2 are cleaved during apoptosis by caspase-3 and translocate into the nucleus ([@bib30]; [@bib51]) where they function in proapoptotic signaling ([@bib14]; [@bib33]). Less is known about the other MST kinases. YSK1, also known as Ste20/oxidant stress response kinase 1, is weakly activated by reactive oxygen intermediates but not by any other environmental stresses, or by growth factors ([@bib37]). However, this kinase does not participate in any of the known MAPK pathways ([@bib37]; [@bib35]) and a physiological function for YSK1 remains unknown. Like YSK1, MST4 overexpression fails to activate the JNK and p38 MAPK pathways, although it promotes anchorage-independent growth and tumor formation, and has been implicated in prostate cancer progression ([@bib38]; [@bib47]). Here, we investigate the MST family kinases YSK1 and MST4 and uncover a signaling function linked with the Golgi matrix protein GM130 that may play a role in the control of cell migration and polarization.
Results
=======
YSK1 and MST4 localize to the Golgi apparatus
---------------------------------------------
Antibodies raised against the recombinant human YSK1 kinase domain detected a protein of the expected size in total HeLa cell extract, rat liver cytosolic extract, and purified rat liver Golgi membranes ([Fig. 1](#fig1){ref-type="fig"} A). This reaction was competed by preincubation of the antibody with the purified antigen before Western blotting ([Fig. 1](#fig1){ref-type="fig"} A). Due to the high degree of sequence similarity between the MST family kinases these antibodies were further tested on lysates of cells transfected with GFP-tagged MST3, MST4, and YSK1. This revealed that polyclonal antibodies raised to YSK1 also react to a lesser extent with MST4, but not with MST3. An antibody raised to a unique sequence in the first 19 aa of YSK1 recognized only YSK1 ([Fig. 1](#fig1){ref-type="fig"} A). When used in immunofluorescence studies of HeLa cells these antibodies gave a cytosolic and Golgi apparatus staining pattern most similar to the cis-Golgi protein GM130 and the medial-Golgi protein GRASP55, and adjacent to but not overlapping with the trans-Golgi marker golgin97 ([Fig. 1](#fig1){ref-type="fig"} B). A similar staining pattern was observed in two other human cell lines, MelJuSo and HS68 (Fig. S1, available at <http://www.jcb.org/cgi/content/full/jcb.200310061/DC1>; unpublished data). Endogenous YSK1/MST4 are therefore Golgi proteins based on their localization in human cell lines and presence in purified Golgi membrane fractions.
{#fig1}
YSK1 and MST4 interact with the Golgi matrix protein GM130
----------------------------------------------------------
To identify interaction partners for these kinases that could explain their localization to the Golgi apparatus, a yeast two-hybrid screen of 2.2 million clones from a human testis cDNA library was performed. Only two clones interacted specifically with YSK1, and both contained the full-length ORF for the human Golgi matrix protein GM130 ([Fig. 2](#fig2){ref-type="fig"} A). A directed two-hybrid analysis was then used to map the interaction sites for YSK1 on rat GM130 ([Fig. 2](#fig2){ref-type="fig"} A). The YSK1 binding site of GM130 maps to amino acids 75--271, a region predicted to adopt a coiled-coil structure. This is discrete from the binding site for the vesicle docking protein p115 that lies in the first 75 aa ([Fig. 2](#fig2){ref-type="fig"} A), and the COOH-terminal region containing the binding sites for GRASP65 and Rab GTPases ([@bib3]). Binding assays using purified recombinant proteins confirmed that GM130^75-271^ bound directly to YSK1 ([Fig. 2](#fig2){ref-type="fig"} B), whereas the NH~2~-terminal domain of another Golgi matrix protein, golgin45, and GST did not ([Fig. 2](#fig2){ref-type="fig"} B). Furthermore, YSK1 failed to localize to the Golgi apparatus in cells depleted of GM130 using small interfering RNA (siRNA) duplexes ([Fig. 2](#fig2){ref-type="fig"} C). Therefore, YSK1 binds to a specific domain of the Golgi matrix protein GM130 and shows GM130-dependent localization in cells, thus providing a mechanism for its localization to the Golgi apparatus.
{#fig2}
Other MST kinases were then tested for interaction with GM130 and localization to the Golgi apparatus. A directed two-hybrid analysis revealed that MST4 interacted with full-length GM130 and the first 271 aa of GM130, but failed to interact with the empty vector control or golgin45 ([Fig. 3](#fig3){ref-type="fig"} A). MST3 showed no interactions with any of the proteins tested ([Fig. 3](#fig3){ref-type="fig"} A). Binding assays confirmed that MST4 bound directly to GM130^75-271^ but not to the NH~2~-terminal domain of golgin45 ([Fig. 3](#fig3){ref-type="fig"} B). Consistent with these results MST4 targeted to the Golgi apparatus in HeLa cells ([Fig. 3](#fig3){ref-type="fig"} C), whereas MST3 showed a cytoplasmic distribution ([Fig. 3](#fig3){ref-type="fig"} D). YSK1 displays significant homology with MST3 and MST4, to a high degree within the kinase domain and GM130 binding region and to a lesser but significant extent in the COOH terminus (Fig. S2, available at <http://www.jcb.org/cgi/content/full/jcb.200310061/DC1>). MST4 like YSK1 may target to the Golgi apparatus via an interaction with GM130, and therefore have a common regulatory mechanism. Interestingly, MST3 although highly homologous to YSK1 and MST4 does not localize to the Golgi apparatus or bind to GM130, suggesting it has different regulatory partners.
{#fig3}
YSK1 shows activity-dependent targeting to the Golgi apparatus
--------------------------------------------------------------
To investigate the targeting of YSK1 to the Golgi apparatus further, the features of YSK1 needed for its interaction with GM130 were mapped. Amino acids 20--302, comprising the kinase domain and a short region of charged amino acids distal to it, was the smallest fragment tested that interacted with GM130 ([Fig. 4](#fig4){ref-type="fig"} A). The NH~2~- and COOH-terminal sequences before amino acid 20 and after amino acid 302, respectively, were not essential for the interaction with GM130 ([Fig. 4](#fig4){ref-type="fig"} A). These constructs were then tested for their ability to target to the Golgi apparatus in transfection assays. Full-length YSK1 and, to a lesser extent, the first 302 aa comprising the GM130 binding region were Golgi apparatus localized ([Fig. 4](#fig4){ref-type="fig"} B). Decreased Golgi apparatus targeting of the first 302 aa of YSK1 compared with the wild-type protein may be explained by the observation that the COOH terminus is important for YSK1 homodimerization (Fig. S3, available at <http://www.jcb.org/cgi/content/full/jcb.200310061/DC1>). Two kinase activity-deficient mutants YSK1^K49R^ and YSK1^D158A^, the kinase domain alone, and a COOH-terminal construct lacking the kinase domain were unable to target to the Golgi apparatus ([Fig. 4](#fig4){ref-type="fig"} B). Therefore, the targeting of YSK1 to the Golgi apparatus requires an NH~2~-terminal region from amino acids 20 to 302 that binds to GM130, and includes the kinase domain. Kinase activity is also required for Golgi apparatus targeting and stable GM130 binding in vivo because kinase-dead mutants do not localize to the Golgi apparatus.
{#fig4}
GM130 is an activator of YSK1 and MST4
--------------------------------------
Because GM130 appears to function as a Golgi apparatus localized scaffold protein for YSK1, the relationship between YSK1 kinase activity and GM130 binding was investigated. A preliminary analysis of recombinant YSK1 purified from insect cells found that the pure kinase showed no activity toward the Golgi proteins GM130, GRASP65, and p115. From a variety of model substrates tested, only myelin basic protein (MBP) was phosphorylated (unpublished data), and this was therefore used for subsequent experiments. Titration of the GM130 NH~2~-terminal domain into YSK1 kinase assays up to a 20-fold molar excess resulted in a 25-fold stimulation of YSK1 activity above the basal level of activity ([Fig. 5](#fig5){ref-type="fig"} A). Under the same conditions, the NH~2~-terminal domain of golgin45 maximally activated YSK1 3.5-fold, whereas the protein storage buffer did not stimulate YSK1 ([Fig. 5](#fig5){ref-type="fig"} B). Analysis of activated YSK1 revealed phosphorylation of threonine 174, a modification absent from the nonactivated kinase ([Fig. 5](#fig5){ref-type="fig"} C and Fig. S4, available at <http://www.jcb.org/cgi/content/full/jcb.200310061/DC1>). This observation could be confirmed with pT174, an antibody directed against phosphorylated threonine 174, which detected YSK1 only after activation by GM130 ([Fig. 5](#fig5){ref-type="fig"} D, − peptide), and was competed by the corresponding phosphopeptide ([Fig. 5](#fig5){ref-type="fig"} D, + peptide). Using the pT174 antibody, phosphorylated YSK1 could only be detected in Golgi membranes but not cytosol, even though like p115, another GM130 partner, a pool of YSK1 was present in cytosol ([Fig. 5](#fig5){ref-type="fig"} E). This supports the model that a pool of activated YSK1 exists at the Golgi apparatus.
![**Binding to the NH~2~-terminal domain of GM130 triggers autophosphorylation and activation of YSK1.** (A) Purified YSK1, 0.8 pmoles, was incubated in the absence or presence of 0.7, 3.3, 6.7, and 16.7 pmoles of His-tagged GM130^75-271^ or (B) His-tagged golgin45^1-122^ at 37°C for 30 min. After this preincubation, samples were analyzed for kinase activity toward the model substrate MBP using γ-\[^32^P\]ATP, and by Western blotting for YSK1 and GM130 or golgin45 to control for gel loading. (C) Fragmentation of the phosphorylated NTFVGTPFWMAPEVIK peptide (Fig. S4) by tandem mass spectrometry gives daughter ions derived from the NH~2~ and COOH termini of the peptide indicating that threonine 174 (pT), shown in red, is the phosphorylated residue. (D) Activated and mock-activated YSK1 was Western blotted with affinity-purified antibody N19 to YSK1 and the pT174 antibody to the phosphorylated T-loop sequence IKRNpTFVGT, in the presence and absence of 5 μg of blocking peptide. (E) 25 μg of rat liver cytosol and 10 μg of Golgi membranes were Western blotted with antibodies to GM130, p115, YSK1 4256, and pT174 to phosphorylated YSK1. (F) Purified YSK1, YSK1^K49R^, YSK1^T174A^, MST4, and MST4^D162A^, 0.8 pmoles, were incubated in the absence or presence of 16.7 pmoles of His-tagged GM130^75-271^ at 37°C for 30 min. After this preincubation, samples were analyzed for kinase activity toward the model substrate MBP using γ-\[^32^P\]ATP, and by Western blotting for YSK1 MST4 and GM130 to control for gel loading.](200310061f5){#fig5}
Phosphorylation at the equivalent position of the T-loop in many other kinases is an important determinant for their activation ([@bib41]). Mutation of the T-loop threonine to alanine to give YSK1^T174A^ resulted in a form of the kinase that showed no activity toward MBP in the presence or absence of GM130, and was comparable to the kinase-dead ATP binding site mutant YSK1^K49R^ ([Fig. 5](#fig5){ref-type="fig"} F). Similar results to those obtained for YSK1 were also found with MST4. MST4 is specifically activated by binding to GM130 and is autophosphorylated as a consequence on threonine 178 ([Fig. 5](#fig5){ref-type="fig"} F; unpublished data). Therefore, activation of YSK1 and MST4 involves autophosphorylation at threonine 174 (178 in MST4), possibly as a consequence of dimerization stabilized by binding to GM130 at the Golgi apparatus.
Dominant-negative YSK1^T174A^ perturbs Golgi apparatus localization
-------------------------------------------------------------------
In addition to its function as part of the Golgi apparatus localized tethering complex required for vesicle docking and stacking of Golgi cisternae, GM130 has been proposed to form a structural landmark important for establishment of a polarized Golgi structure ([@bib36]). One aspect of polarized Golgi structure is the cis- to trans-polarity of the stacked cisternae, and the other is its asymmetric distribution within the cell. Association of the Ste20 family kinases YSK1 and MST4 with GM130 suggest this complex might act as a landmark in a transduction event important for signaling Golgi apparatus integrity and position within the cell, and controlling Golgi apparatus function. The effects of expressing wild-type YSK1, and YSK1^T174A^, which should behave as a dominant-negative mutant form of YSK1 unable to be activated by GM130, were then compared ([Fig. 6, A and B](#fig6){ref-type="fig"}). At high expression levels, YSK1 saturated the available binding sites at the Golgi apparatus and accumulated in the cytoplasm without causing any obvious change in the two Golgi markers GM130 and p115 ([Fig. 6](#fig6){ref-type="fig"} A). Expression of YSK1^T174A^ resulted in the dispersal of the perinuclear ribbon-like Golgi apparatus pattern of GM130 and p115 typical of HeLa cells ([Fig. 6](#fig6){ref-type="fig"} B). This effect was specific to the Golgi apparatus because the perinuclear late-endosomal and lysosomal compartments defined by LAMP1 showed no obvious differences in YSK1 and YSK1^T174A^ expressing cells ([Fig. 6](#fig6){ref-type="fig"} C). Golgi apparatus dispersal was observed in \>75% of cells expressing YSK^T174^ but not with the dominant-negative MST4^T178A^ or other YSK1 and MST4 constructs ([Fig. 6](#fig6){ref-type="fig"} D). Preliminary investigation revealed that transport of the transmembrane glycoprotein of vesicular stomatitis virus was not compromised in YSK1^T174A^ expressing cells, indicating they do not have a general defect in secretion (unpublished data). To obtain supporting evidence for a function of endogenous MST kinases at the Golgi apparatus in HeLa cells, depletion of YSK1 and MST4 was performed using siRNA and the cells stained for the Golgi marker GM130. In cells depleted of YSK1 and MST4 the Golgi apparatus was dispersed into the cell periphery, whereas in control cells depleted for lamin A the typical perinuclear Golgi apparatus morphology was preserved ([Fig. 6](#fig6){ref-type="fig"} E). Interfering with YSK1 and MST4 function, therefore, disturbs the ordered localization of the Golgi apparatus in the perinuclear region.
{#fig6}
A biochemical screen for YSK1 targets identifies 14-3-3ζ
--------------------------------------------------------
One explanation for the differences seen with the dominant-negative forms of YSK1 and MST4 is that they have different substrates. To test this hypothesis, a biochemical screening approach for the kinase substrate tracking and elucidation (KESTREL) was used ([@bib26]). Application of this method to HeLa cell extracts fractionated by size exclusion chromatography revealed a number of phosphorylation events ([Fig. 7](#fig7){ref-type="fig"} A). Strong autophosphorylation of both kinases hindered the identification of substrates in the 50--60-kD region. Significantly, a protein of apparent molecular mass 32 kD in fraction 17 was phosphorylated in YSK1 treated samples ([Fig. 7](#fig7){ref-type="fig"} A), but was not in MST4, kinase inactive YSK1^K49R^ or buffer-treated samples ([Fig. 7, A and B](#fig7){ref-type="fig"}). Further analysis using mass spectrometry and Western blotting revealed that this phosphoprotein corresponds to 14-3-3ζ phosphorylated at Serine 58 ([Fig. 7](#fig7){ref-type="fig"} A; unpublished data). Confirming these observations, recombinant 14-3-3ζ was phosphorylated by YSK1 but not MST4 ([Fig. 7](#fig7){ref-type="fig"} C). Furthermore, an mAb against 14-3-3ζ ([@bib31]) stained the Golgi apparatus and showed considerable overlap with the YSK1 activator GM130 ([Fig. 7](#fig7){ref-type="fig"} D). Therefore, 14-3-3ζ fulfills the criteria of a specific target for YSK1 at the Golgi apparatus.
{#fig7}
Dominant-negative YSK1^T174A^ abolishes collagen invasion and cell migration
----------------------------------------------------------------------------
It has recently been reported that in mammalian cells there is a link between the oncogenic Ras-signaling pathway and cell invasion induced by the actin severing protein gelsolin ([@bib13]). Together with other recent findings that Ras-signaling also occurs at the surface of the Golgi apparatus ([@bib9]; [@bib7]), these observations hint that YSK1 and MST4 may signal some aspect of cell migration involving the Golgi apparatus. The effects of expressing wild-type and various mutant forms of YSK1 and MST4 on gelsolin-induced invasion were therefore explored, using an established assay ([@bib8]). Coexpression of GFP, YSK1, and the kinase-dead YSK1^K49R^ mutant had no significant effect on gelsolin-induced invasion ([Fig. 8](#fig8){ref-type="fig"} A), whereas coexpression of dominant-negative YSK1^T174A^ abrogated collagen invasion. If 14-3-3ζ is the key YSK1 substrate mediating these effects, then expressing 14-3-3ζ^S58A^ should give the same result as dominant-negative YSK1^T174A^, whereas 14-3-3ζ^S58D^ should oppose YSK1^T174A^, and this was indeed the case ([Fig. 8](#fig8){ref-type="fig"} B). Gelsolin-induced invasion was abrogated by 14-3-3ζ^S58A^, but not by other forms of 14-3-3ζ, whereas 14-3-3ζ^S58A^ triggered collagen invasion in the absence of gelsolin, and this was not overcome by the expression of YSK1^T174A^ ([Fig. 8](#fig8){ref-type="fig"} B). Therefore, 14-3-3ζ may act downstream of both gelsolin and YSK1 in collagen invasion, and be the key substrate mediating the effects of YSK1.
{#fig8}
To analyze the effects of YSK1 on the polarization of the Golgi apparatus and centrosome a second assay for cell migration was used, in which confluent monolayers of cells are wounded and then cells along the wound edge microinjected with the constructs of interest ([@bib16]). Consistent with the collagen invasion defect YSK1^T174A^ expressing cells were unable to migrate into the wound in this assay ([Fig. 9](#fig9){ref-type="fig"} A). Furthermore, cells expressing YSK1^T174A^ failed to show polarization of the Golgi apparatus and centrosome in the direction of migration toward the wound edge ([Fig. 9](#fig9){ref-type="fig"} B). Interestingly, YSK1^T174A^ expression, although causing dispersal of the Golgi apparatus in some cells consistent with the phenotype seen in HeLa cells ([Fig. 6](#fig6){ref-type="fig"} B), resulted in the displacement of essentially intact Golgi apparatus away from the perinuclear region in others ([Fig. 9](#fig9){ref-type="fig"} C, arrowhead). Expression of wild-type YSK1 had little effect on either cell migration or Golgi apparatus and centrosome polarization ([Fig. 9](#fig9){ref-type="fig"}, A--D). Signaling via YSK1 appears to be required for cell migration and invasion into collagen because dominant-negative YSK1^T174A^ blocks these processes. Intriguingly, the wild-type MST4 kinase abrogated gelsolin-induced invasion into collagen, whereas kinase-dead MST4^D162A^ and dominant-negative MST4^T178A^ had no effect ([Fig. 8](#fig8){ref-type="fig"} A), suggesting that MST4 opposes the signaling pathway leading to invasion into collagen. Therefore, YSK1 and MST4 may function in a signaling pathway at the surface of Golgi membranes required for cell migration and polarization.
{#fig9}
Discussion
==========
GM130: a scaffold and activator for MST kinases
-----------------------------------------------
We have investigated the MST family of Ste20 kinases and identified two members, YSK1 and MST4, as Golgi apparatus--associated kinases. These two kinases bind to the Golgi matrix protein GM130 and thereby target to the Golgi apparatus, whereas a third and the most closely related family member MST3 is not associated with the Golgi apparatus and fails to bind to GM130. A similar mechanism has been observed for the MAPK ERK1 localized on the surface of endosomes, which involves a small scaffolding protein termed p14 ([@bib52]; [@bib49]). There is a second consequence of the interaction of YSK1 and MST4 with GM130. These kinases, when purified from insect cells, show only low levels of activity toward the model substrate MBP, and incubation with GM130 causes a \>25-fold increase in their activity. Analysis of activated YSK1 and MST4 reveals that they become autophosphorylated on T-loop residue threonine 174 (T178 in MST4) as a consequence of incubation with GM130, and that mutation of this residue in YSK1 abolishes kinase activity. Supporting evidence for the view that this is a key regulatory modification comes from studies on MST1 that identified phosphorylation of the equivalent residue in the T-loop as an activating event ([@bib21]). Other studies on MST1 have shown that the region COOH-terminal to the kinase domain also contributes to MST1 regulation, possibly via an autoinhibitory mechanism because truncation or cleavage of this domain during apoptosis results in kinase activation ([@bib11]; [@bib22]; [@bib51]). We have found that YSK1 and MST4 associate with GM130 via the kinase domain and a small region immediately COOH-terminal to it ([Fig. 4](#fig4){ref-type="fig"} A). Together, with the fact that GM130 is a dimer, this suggests that two molecules of YSK1 or MST4 may associate with a single molecule of GM130 and autophosphorylate in trans, thus providing a mechanism for the activation process and suggesting that Golgi apparatus--associated pools of these kinases are active.
Functions for Golgi apparatus--associated signaling pathways
------------------------------------------------------------
Directed cell motility is a highly complex process involving many discrete events such as polarization of the cytoskeleton, signal transduction events, and regulation of cell adhesion complexes ([@bib39]). In particular, cytoskeletal rearrangements and the secretion of proteins and lipids to specific subdomains of the plasma membrane accompany changes in cell polarity, and Golgi apparatus--localized kinases such as YSK1 and MST4 are in an ideal location to regulate these processes by modulating Golgi apparatus function. The association with GM130, and high degree of similarity between, YSK1 and MST4 might indicate that they have similar functions and downstream effectors. However, this appears not to be the case. Dominant-negative YSK1 but not MST4 causes dispersal of the Golgi apparatus and blocks cell migration, whereas wild-type MST4 but not YSK1 blocks cell migration without having any visible effects on the Golgi apparatus. One possibility is that competition for GM130 controls the relative levels of YSK1 and MST4 activity, although how this would be achieved is unclear at present. Together with their differential effects on cell migration they would therefore be predicted to act on different downstream pathways. The identification of 14-3-3ζ as a specific Golgi apparatus localized substrate for YSK1 but not MST4 supports this idea, and gives some clues as to how YSK1 signaling may control Golgi apparatus function and cell migration. The 14-3-3 proteins are dimeric adaptors typically binding to phosphorylated acceptor sites on their targets, thereby regulating a wide variety of cellular processes ([@bib50]). Furthermore, 14-3-3 proteins are themselves regulated by phosphorylation and dimerization ([@bib50]). In the context of this work, three particular functions reported for these proteins may be of relevance (depicted schematically in [Fig. 10](#fig10){ref-type="fig"}). First, 14-3-3ζ binds to phosphorylated Raf in the Ras-signaling pathway and stimulates its activity ([@bib17]; [@bib19]). Because a pool of activated Ras is generated at the Golgi apparatus in response to growth factor receptor activation, it is possible that YSK1 via 14-3-3ζ can modulate this pathway. Second, 14-3-3 proteins have been found associated with the cytoplasmic domains of specific integrin complexes ([@bib23]; [@bib5]; [@bib42]), and with Par3/Baz, one of a number of proteins important for control of cell polarity and cell asymmetry during development ([@bib4]; [@bib24]). Overexpression of 14-3-3 proteins blocks cell migration, and this could be exerted via integrins and their function in cell adhesion ([@bib23]; [@bib42]). An obvious way for YSK1 to control cell migration would therefore be via the 14-3-3ζ--dependent modulation of cell adhesion. Finally, 14-3-3 proteins have been reported to act in the quality control pathway regulating assembly and transport of multimeric membrane protein complexes from the ER to the Golgi apparatus ([@bib34]; [@bib53]). This provides another point of control for YSK1 that may be relevant for regulation of Golgi apparatus function. Exactly which if any of these potential mechanisms is relevant for YSK1 will require further characterization of 14-3-3ζ binding partners.
{#fig10}
Until recently, the range of signaling events occurring at the Golgi apparatus was unsuspected, and now includes specific aspects of Ras and growth factor signaling ([@bib9]; [@bib7]), apoptotic signaling ([@bib29]), and evidence that the Golgi apparatus acts as a sensor controlling mitotic entry ([@bib48]). To these we now add signaling events important for cell migration.
Materials and methods
=====================
Reagents and antibodies
-----------------------
Reagents were obtained from Sigma-Aldrich unless specified otherwise. Chromatography reagents and γ-\[^32^P\]ATP (3,000 Ci/mmol and 10 mCi/ml) were obtained from Amersham Biosciences. Antisera specific to YSK1 was raised in rabbits 4256 and 4257 immunized with recombinant human YSK1 by Biogenes, and then affinity purified over a column of YSK1 coupled to Affigel-15 (Bio-Rad Laboratories). Peptide antibodies to YSK1 (SC-6865, N19) and MST4 (3822) were purchased from Santa Cruz Biotechnology, Inc. and New England Biolabs, Inc., respectively. Mouse monoclonal anti-LAMP1/CD107a was purchased from Becton Dickinson. Antibodies specific to the phosphorylated YSK1/MST4 activation loop peptide CIKRNpTFVGT were produced by Abcam Ltd., and then isolated from a protein-A purified IgG fraction of the serum over the same peptide immobilized on Sulfolink resin according to the manufacturer\'s instructions (Pierce Chemical Co.). E. Nigg (Max-Planck-Institute of Biochemistry) and J. Celis (Institute of Cancer Biology, Copenhagen, Denmark) provided antibodies to the centrosome marker c-Nap1 and 14-3-3ζ, respectively. Other antibodies used in this experiment have been described and characterized previously ([@bib2]; [@bib46]; [@bib45]).
Molecular biology and two-hybrid screening
------------------------------------------
Full-length human YSK1, MST3, MST4, and 14-3-3ζ were amplified from human testis cDNA (Becton Dickinson) using the pfu polymerase (Stratagene) and cloned in pCRII-TOPO (Invitrogen). Point mutants were constructed using the Quickchange mutagenesis protocol (Stratagene). DNA oligonucleotides were purchased from Thermo-Hybaid and QIAGEN. All constructs were confirmed by DNA sequencing (Medigenomix). Mammalian expression constructs were made in pcDNA3.1+ (Invitrogen) and pEGFP-C2 (CLONTECH Laboratories, Inc.). For baculovirus expression, pVL1393 or the pAcSG2 vector (Becton Dickinson) modified to include the hexahistidine-tag from pQE32 (QIAGEN) was used. Baculoviruses were produced and proteins expressed in Sf9 cells according the manufacturer\'s protocols (Becton Dickinson). Bacterial expression was performed using the His-GST expression vector pGAT2 and the His-tag expression vector pQE32 (QIAGEN). Inserts encoding GM130^75-271^, golgin45^1-122^, and 14-3-3ζ were inserted into pGAT2 or pQE32 and proteins expressed in BL21(DE3) or JM109 cells, respectively. Proteins were purified over nickel-NTA agarose (QIAGEN). Insect cell expressed kinases were desalted in MEB (50 mM Tris-HCl, pH 7.3, 50 mM KCl, 10 mM MgCl~2~, 20 mM β-glycerophosphate, 15 mM EGTA), and other proteins were dialysed into PBS and aliquots snap frozen in liquid nitrogen for storage at −80°C. For two-hybrid screening, a system described previously was used ([@bib25]). The entire coding region of the human YSK1 cDNA was inserted into the two-hybrid bait vector pFBT9 (a version of pGBT9 \[CLONTECH Laboratories, Inc.\] modified to encode kanamycin resistance), and this plasmid transformed into the reporter strain PJ69-4A. A human testis cDNA library (CLONTECH Laboratories, Inc.) was transformed into this bait strain and plated on synthetic media lacking leucine, tryptophan, histidine, and adenine with 2% (wt/vol) glucose as the carbon source (QDO). Library plasmids were rescued using the ampicillin resistance marker and retransformed into PJ69-4A together with either pFBT9 or the YSK1 bait plasmid on synthetic medium lacking leucine and tryptophan (−LW), and five independent colonies streaked onto QDO. Those showing strong growth on QDO after 2 d at 30°C were taken as positive clones and the inserts were sequenced. Light colony color is indicative of a strong signal, whereas dark colony color indicates a weaker signal.
GM130 binding assays
--------------------
1 μg of recombinant His-tagged YSK1 or MST4 expressed in baculovirus-infected Sf9 cells was incubated with 5 μg of either GST-tagged GM130^75-271^, golgin45^1-122^, or GST alone for 1 h at 4°C in HNTM buffer (50 mM Hepes-KOH, pH 7.2, 200 mM NaCl, 0.5% \[vol/vol\] Triton X-100, 5 mM MgCl~2~) in the presence of 15 μl of glutathione-sepharose and 100 μM ATP in a total volume of 300 μl. Beads were washed in 3× 1 ml HNTM and bound protein was eluted directly in SDS-PAGE sample buffer. Samples were Western blotted and probed with either goat anti-YSK1 N19 (Santa Cruz Biotechnology, Inc.) or affinity-purified rabbit anti-YSK1/MST4. Loading controls were analyzed by SDS-PAGE and Coomassie brilliant blue staining.
Kinase assays and substrate identification
------------------------------------------
For activation experiments with YSK1 or MST4, and comparisons of different wild-type and mutant kinases, 0.8 pmoles of kinase in 7 μl MEB^+^ (MEB containing 1 mM DTT and 2 mM ATP) were mixed with 5 μl PBS containing the amount of His-tagged GM130^75-271^ or golgin45^1-122^ indicated in the figures and incubated for 30 min at 37°C. To this was added 8 μl MEB containing 1.5 μg of MBP and 0.1 μl γ-\[^32^P\]ATP. After incubation for 60 min at 37°C, reactions were analyzed by SDS-PAGE and autoradiography. For mass spectrometry, 40 pmoles of kinase in 20 μl MEB^+^ were either mock activated or activated for 2 h at 37°C, 10 μl of reducing sample buffer was added and the reaction mixtures were heated for 5 min at 95°C followed by SDS-PAGE. The corresponding bands were excised and processed for mass spectrometry as described previously ([@bib44]).
Potential substrates for YSK1 and MST4 were screened for using a modified KESTREL protocol ([@bib26]). HeLa S3 cells were grown in suspension using 1 liter of spinner flask at 37°C and 5% CO~2~ in DME containing 10% FCS (Invitrogen). Cell pellets were lysed on ice for 30 min in an equal volume of lysis buffer (40 mM Tris-HCl, pH 7.0, 1% \[vol/vol\] Triton X-100, 2.5 mM EDTA, 15 mM DTT) containing a protease inhibitor cocktail (Roche Diagnostics). The lysate was centrifuged at 112,000 *g* for 30 min at 4°C. The clarified extract (typically 20 mg/ml) was aliquoted, snap frozen in liquid nitrogen, and stored at −80°C. Before further use extracts were thawed, desalted on Biogel P6-DG (Bio-Rad Laboratories) into KESTREL buffer (40 mM Tris-HCl, pH 7.0, 0.1% \[vol/vol\] β-mercaptoethanol, 0.1 mM EGTA, 0.1% \[vol/vol\] Triton X-100), and incubated at 30°C for 20 min to allow dephosphorylation. For the fractionation shown, 10 mg of dephosphorylated cell extract was separated on a Superose-6 HR10/30 column equilibrated in KESTREL buffer containing 140 mM KCl. 1-ml fractions were collected throughout and each one subjected to a kinase assay. For kinase assays to identify substrate proteins, 10 μl of the dephosphorylated extract or column fractions were adjusted to 10 mM MgCl~2~, 100 μM ATP, 5 μCi γ-\[^32^P\]ATP, 2 μg YSK1 or MST4, and incubated at 37°C for 10 min. Assays were analyzed by SDS-PAGE and autoradiography. To identify phosphorylated proteins the autoradiograph was overlaid on to a Coomassie blue stained gel and the corresponding region excised and processed for mass spectrometry ([@bib44]).
Cell culture, RNA interference, and microscopy
----------------------------------------------
HeLa cells were cultured at 37°C and 5% CO~2~ in DME containing 10% FCS. Cells plated on glass coverslips were transfected 24--36 h after plating using Fugene-6 (Roche), and left to grow for 18--24 h before fixation and processing for immunofluorescence microscopy at RT. RNA interference was performed on HeLa cells transfected using oligofectamine (Invitrogen) with duplex RNA (Dharmacon Research Inc.) for 24 h, coverslips were placed in fresh growth medium for a further 24--112 h, and then the cells were processed for fluorescence microscopy ([@bib15]). YSK1 and MST4 were targeted with the sequences AACACATTCGTGGGCACCCCC and AATGGAATACCTGGGCGGTGG, GM130 with the sequence AACCCTGAGACAACCACTTCT, and the lamin-A control was described previously ([@bib15]). Cells were fixed for 20 min in 3% (wt/vol) PFA, quenched for 10 min with 50 mM ammonium chloride, and permeabilized with 0.1% (vol/vol) Triton X-100 for 5 min. All solutions were made in PBS, and antibody staining was performed for 60 min using a 1,000-fold dilution of antiserum or purified antibody at a final concentration of 1 μg/ml. Coverslips were mounted in 10% (wt/vol) Moviol 4-88, 1 μg/ml DAPI, 25% (wt/vol) glycerol in PBS. Images were collected using an Axioskop-2 with a 63× Plan Apochromat oil immersion objective of NA 1.4, except for wounding assays, which were imaged with a 40× Plan Neofluar objective of NA 0.75, standard filter sets (Carl Zeiss MicroImaging, Inc.), a 1,300 by 1,030 pixel-cooled CCD camera (model CCD-1300-Y; Princeton Instruments, Inc.) and Metavue software (Visitron Systems). Images were cropped in Adobe Photoshop 7.0, sized, and placed in figures using Adobe Illustrator 10.0 (Adobe Systems Inc.).
Collagen invasion assays
------------------------
HEK293T cells were grown in DME supplemented with 10% FBS, 2 mM [l]{.smallcaps}-glutamine, 100 U/ml penicillin, and 100 μg streptomycin (Invitrogen), and transfected with calcium phosphate. Invasion into collagen type I was performed as described previously ([@bib8]). Six-well plates were filled with 1.25 ml of neutralized type I collagen (0.09% \[wt/vol\]; Upstate Biotechnology Inc.) and incubated for at least 1 h at 37°C to allow gelification. The cells were harvested using Moscona buffer and Trypsin/EDTA and seeded on top of the collagen gel. The cultures were incubated for 24 h at 37°C. The depth of migration inside the gel was measured using a phase-contrast microscope controlled by a computer program. Invasive and superficial cells were counted in 12 fields of 0.157 mm^2^. The invasive index is the percentage of cells invading the gel over the total number of cells.
Wounding assays
---------------
HS68 cells were grown at 37°C and 5% CO~2~ in DME containing 10% FCS on glass coverslips until a confluent monolayer was obtained, typically 3-- 4 d after seeding. Wounds in the monolayers were created by scraping a 200 μl tip across the coverslips. Cells along the front of the wound edge were injected (300 hPa injection pressure, 0.2 s, 60 hPa holding pressure) with 200 ng/μl of plasmid DNA using a Femtojet microinjection system (Eppendorf AG) mounted on an Axiovert 25 with 20× LD A-Plan objective of NA 0.30 (Carl Zeiss MicroImaging, Inc.). After injection, the cells were grown for 16 h under normal growth conditions and stained with the appropriate antibodies. The orientations of the centrosome and Golgi apparatus were assessed according to a published method ([@bib16]).
Online supplemental material
----------------------------
Fig. S1 illustrates how YSK1/MST4 localize to the Golgi apparatus in HS68 cells. Fig. S2 shows a sequence comparison of YSK1 with MST3 and MST4; conserved features and mutations are also marked. In Fig. S3, a two-hybrid analysis reveals that YSK1 forms homodimers via the COOH terminus but cannot heterodimerize with MST4. In Fig. S4, mass spectrometry of activated and nonactivated YSK1 identifies the T-loop as one site of autophosphorylation. Online supplemental material is available at <http://www.jcb.org/cgi/content/full/jcb.200310061/DC1>.
We thank Ulrike Grüneberg and Thomas Mayer for useful discussions and comments on the manuscript.
The Max-Planck Society generously supports research in the group of F.A. Barr. V. De Corte is a Postdoctoral Fellow of the Fund for Scientific Research-Flanders (Belgium). J. Gettemans and V. De Corte greatly appreciate support from Marc Mareel and Joël Vandekerckhove, and acknowledge the support of the Belgian Federation against Cancer and Fortis Bank Verzekeringen.
[^1]: Address correspondence to Francis Barr, Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, Martinsried, 82152 Germany. Tel.: 49-89-8578-3135. Fax: 49-89-8578-3102. email: <barr@biochem.mpg.de>
|
Ontario Golf Courses
Public and Private
Ontario has 838 golf courses to choose from. This directory lists the courses by city.
The cities with the most golf courses like London, Burlington, and Niagara Falls are listed first under the Top 10. We list all other Ontario cities alphabetically, below.
Listowel Golf Club
The 27-hole "Listowel G.C."
course at the
Listowel Golf Club facility in Listowel, ON
features
all the hallmarks of Ontario golf
.
Listowel G.C. golf course opened in 1920. Brenden Parsons manages the course as the General Manager.
Subscribe Today
Get our best training tips, videos, and tee times deals -- straight to your inbox |
---
abstract: 'The supernova remnants left behind by Type Ia supernovae provide an excellent opportunity for the study of these enigmatic objects. In a previous work, we showed that it is possible to use the X-ray spectra of young Type Ia supernova remnants to explore the physics of Type Ia supernovae and identify the relevant mechanism underlying these explosions. Our simulation technique is based on hydrodynamic and nonequilibrium ionization calculations of the interaction of a grid of Type Ia explosion models with the surrounding ambient medium, coupled to an X-ray spectral code. In this work we explore the influence of two key parameters on the shape of the X-ray spectrum of the ejecta: the density of the ambient medium around the supernova progenitor and the efficiency of collisionless electron heating at the reverse shock. We also discuss the performance of recent 3D simulations of Type Ia SN explosions in the context of the X-ray spectra of young SNRs. We find a better agreement with the observations for Type Ia supernova models with stratified ejecta than for 3D deflagration models with well mixed ejecta. We conclude that our grid of Type Ia supernova remnant models can improve our understanding of these objects and their relationship to the supernovae that originated them.'
author:
- 'Carles Badenes, Kazimierz J. Borkowski and Eduardo Bravo'
title: |
Thermal X-Ray Emission from Shocked Ejecta in Type Ia Supernova Remnants II:\
Parameters Affecting the Spectrum
---
INTRODUCTION
============
The advent of modern X-ray observatories such as [*Chandra*]{} and [*XMM-Newton*]{} has produced a spectacular increase in both the quantity and the quality of the observations of Type Ia supernova remnants (SNRs). Yet, these excellent observations have led only to a modest improvement in our knowledge of the physics of Type Ia supernovae (SNe). Important issues such as the nature of the progenitor systems, the last stages of their evolution prior to the SN explosion or the physical mechanism behind the explosion itself still remain obscure [see @hillebrandt00:Ia-review; @branch95:Ia-review for reviews]. In a recent paper [@badenes03:xray henceforth Paper I], we examined the prospects for the identification of the explosion mechanism in Type Ia SNe through the analysis of the X-ray spectra of young SNRs. We assembled a grid of Type Ia SN explosion models, simulated their interaction with a uniform ambient medium (AM) and calculated the predicted X-ray spectra from the ensuing SNRs. The calculated X-ray SNR spectra varied dramatically from model to model, demonstrating that it is possible to use young Type Ia SNRs to probe the details of the Type Ia SN explosion mechanism.
In this paper, we expand the results that were introduced in Paper I. Our objective is to examine the relationship between Type Ia SN explosions and the X-ray spectra of their SNRs within the framework of hydrodynamic, ionization, and spectral simulations. By comparing our models with observations, we aim at improving our understanding of both Type Ia SNe and young, ejecta-dominated SNRs. In § \[sec:Techniques\], we review the simulation scheme used in Paper I, and we discuss the influence of two important parameters which we had not hitherto explored: the amount of collisionless electron heating at the reverse shock and the density of the uniform AM that interacts with the ejecta. In § \[sec:Expanding\] we examine the performance of recent 3D Type Ia SN explosion models in the context of SNRs, and we discuss the ability of these 3D models to reproduce the fundamental properties of the X-ray spectra of Type Ia SNRs. Our conclusions are presented in § \[sec:Discussion\]. In order to facilitate the comparison between our models and X-ray observations of SNRs, we have generated a library of synthetic spectra. This library is presented and discussed in the Appendix. In a forthcoming paper (Badenes et al., in preparation), we will make a detailed comparison between our models and the X-ray spectrum of the Tycho SNR.
PARAMETERS AFFECTING THE X-RAY SPECTRUM {#sec:Techniques}
=======================================
From SN to SNR: the Simulation Scheme
-------------------------------------
Although the X-ray spectra of young Type Ia SNRs contain much information about the structure and composition of the material ejected by the SNe that originated them, this information is generally difficult to extract. The ejecta material consists almost entirely of heavy elements that are impulsively heated to X-ray emitting temperatures as the reverse shock propagates inwards in the reference frame of the expanding ejecta. The propagation of the reverse shock is in turn intimately related to the density structure of the ejecta, which results in an intricate dynamical behavior of the SNR early in its evolution [see @dwarkadas98:typeIa]. If there is a significant degree of stratification in the elemental composition of the ejecta, different chemical elements are shocked at different evolutionary times, after different periods of free expansion, and therefore emit X-rays under different physical conditions. This results in a very complex spectrum, which is hard to model and interpret.
The approach taken in Paper I was based on a grid of 1D Type Ia SN explosion models that included all the mechanisms currently under debate for the single degenerate Type Ia SN scenario: deflagrations, delayed detonations, pulsating delayed detonations and sub-Chandrasekhar explosions. The dynamics of the interaction of each explosion model with a uniform ambient medium (AM) of density $\rho_{AM}=10^{-24}\,\mathrm{g\cdot cm^{-3}}$ was followed with a 1D hydrodynamic code. The dynamic evolution of each fluid element in the shocked ejecta (i.e., the time evolution of density $\rho$ and specific internal energy per unit mass $\varepsilon$), together with its chemical composition as determined by the SN explosion model, were used as the input to ionization calculations. These calculations included the interactions between ions and electrons in the shocked plasma, and they provided time-dependent nonequilibrium ionization (NEI) states and electron temperature. Using these ionization states and electron temperatures, spatially integrated synthetic X-ray spectra were generated with a spectral code by adding the weighted contributions from each fluid element in the shocked ejecta. For a more detailed explanation, see Paper I and the references therein.
Within this simulation scheme, the X-ray spectrum from the shocked ejecta is determined by: (1) the density and chemical composition profiles of the SN ejecta from the explosion model, (2) the age of the SNR, (3) the amount of collisionless electron heating at the reverse shock, and (4) the density of the uniform AM. In Paper I, we analyzed the importance of (1) and (2); the impact of (3) and (4) is the focus of this Section.
Collisionless Electron Heating at the Reverse Shock
---------------------------------------------------
The unknown efficiency of collisionless electron heating in SNR shocks is one of the main uncertainties affecting the calculated X-ray spectra of SNRs. Direct application of the Rankine-Hugoniot relations at the shock front yields $$T_{p}=\frac{3m_{p}v_{s}^{2}}{16k}$$ for each population of particles $p$, where $m_{p}$ is the particle mass, $v_{s}$ is the shock velocity and $k$ is Boltzmann’s constant. Because of the large difference between electron and ion masses, the electrons are expected to be much colder than the ions, and the quotient of postshock specific internal energies defined as $$\beta\equiv\frac{\varepsilon_{e,s}}{\varepsilon_{i,s}}=\frac{\overline{Z_{s}}T_{e,s}}{T_{i,s}}$$ is expected to be close to 0, where $\overline{Z_{s}}$ is the preshock ionization state (i.e., the number of free electrons per ion in the unshocked ejecta). However, @cargill88:e_heating argued that plasma waves can redistribute energy among cold electrons and hot ions at the shock, bringing the value of $\beta$ close to $\overline{Z_{s}}$ [for a discussion of collisionless electron heating see @laming00:e_heatin_snr_shock].
So far, the observational evidence hints at a decreasing level of thermal equilibration with increasing shock speeds or Mach numbers in the forward shocks of SNRs [see @rakowski03:DEML71 and references therein]. In the forward shock of Tycho, @ghavamian01:balmer_SNRs found a value of $T_{e}/T_{i}\leq 0.1$ by analyzing the optical Balmer emission, while @vink03:sn1006-tequil estimated a much lower value at the forward shock of SN1006 from X-ray observations. The only constraint on the value of $\beta$ in the reverse shock of a young Type Ia SNR comes from the absorbed spectrum of the Schweizer and Middleditch star behind SN1006, where the amount of thermal energy deposited in the electrons was found to be negligible [@hamilton97:UV_SMstar_SN1006]. The model spectra presented in Paper I were calculated assuming no collisionless electron heating at the reverse shock, effectively setting $\beta$ to the lowest possible value, $\beta_{min}=\overline{Z_{s}}\cdot m_{e}/\overline{m_{i}}$, where $\overline{m}_{i}$ is the average ion mass in a fluid element. It is clear from the works cited above that, while full thermal equilibration between ions and electrons at the shock (i.e., $\beta=\overline{Z_{s}}$) is not compatible with the observations, values of $\beta$ larger than $\beta_{min}$ cannot be excluded.
The effect of varying amounts of collisionless electron heating at the forward shock on the X-ray spectrum emitted by the shocked AM of SNRs in the Sedov stage was discussed in @borkowski01:sedov; here, we shall analyze the impact of a small (but nonzero) amount of collisionless electron heating at the reverse shock on the properties of the shocked ejecta. We will illustrate this effect using a delayed detonation model as an example. Of all the classes of one-dimensional Type Ia explosion models, delayed detonations have been the most successful in reproducing the light curves and spectra of Type Ia SNe [@hoeflich96:nosubCh], and therefore it is of much interest to analyze the details of the X-ray emission that these models predict for Type Ia SNRs. Within the delayed detonations, we chose model DDTe because it has the largest amount of intermediate mass elements (Si, S, etc.) in the ejecta. This should make it easier to estimate the effects that collisionless electron heating at the reverse shock has on the prominent X-ray lines from these elements.
Figure \[fig-1\] shows the shocked ejecta of model DDTe for a uniform AM of density $\rho_{AM}=10^{-24}\,\mathrm{g\cdot cm^{-3}}$, 430 yr after the explosion (the age of the Tycho SNR). The electron heating and plasma ionization processes in the shocked ejecta have been calculated for $\beta=\beta_{min}$, $0.01$, and $0.1$. The unshocked ejecta were assumed to be singly ionized in all cases. As discussed in Paper I, the interaction of ejecta with the AM leads to the formation of density structures within the shocked ejecta, which strongly affect the distributions of ionization states (represented here by the average ion charge $\overline{Z}$), electron temperatures $T_{e}$, and ionization timescales ($\tau=\int n_{e}dt$). Together with the chemical composition profile of the ejecta, these distribution functions determine the spectral properties of each element, and ultimately the shape of the emitted X-ray spectrum. An important feature of the shocked ejecta is the pronounced density peak towards the contact discontinuity (CD) that appears in all Type Ia SNR models [see Paper I and @dwarkadas98:typeIa].
In the case with no collisionless heating ($\beta=\beta_{min}$), the electron temperature profile rises monotonically from the reverse shock to the CD, as internal energy is gradually redistributed from the hot ions to the cold electrons through Coulomb collisions. The electron temperature profile peaks at the CD, where the fluid elements have been shocked for the longest time and have the highest density (the rate at which the ion and electron temperatures equilibrate in the shocked ejecta scales with $\rho$, see eq. 1 in Paper I). Increasing the value of $\beta$ makes the electrons just behind the reverse shock hotter, but the electron temperature drops as numerous cold electrons are liberated in the ongoing ionization process and the total internal energy in the electrons is redistributed among more particles. For $\beta=0.01$, the electron temperature profile eventually relaxes to the profile obtained without any collisionless heating at the reverse shock, but in the $\beta=0.1$ case there is a significant residual temperature excess even in the outermost ejecta layers. The average ionization state and ionization timescale become severely affected only for $\beta \ge 0.1$, when the electrons reach extremely high($\sim 10^{9}$ K) temperatures behind the reverse shock. The ionization process is less efficient at these extreme temperatures, leading to lower mean ion charges and ionization timescales in the shocked ejecta.
The significance of this modification in the electron temperature profile is better understood when viewed in the context of the stratification that is inherent to 1D Type Ia SN explosion models. In the case of DDTe, as in all delayed detonation models, the inner ejecta layers are dominated by Fe and Ni, surrounded by a region rich in intermediate mass elements (mostly Si and S, but also Ar, Ca, and others), with O dominating the outermost ejecta layers. In Figure \[fig-1\], this stratified structure has been represented schematically in panel b. In this example, the increase in $T_{e}$ caused by collisionless electron heating at the reverse shock affects primarily the Fe-rich ejecta layers at this age. In terms of the emission measure-averaged electron temperature for each element X, $\langle T_{e}\rangle _{X}$, increasing the value of $\beta$ effectively reverses the approximate ordering in $T_{e}$ of the ejecta elements that is maintained throughout the evolution of the SNR. This is illustrated in Figure \[fig-2\], which can be contrasted with Figure 5 in Paper I.
In all the calculations presented here and in Paper I, $\overline{Z_{s}}$ has been set to 1, which is generally a good approximation for NEI plasmas in SNRs. Photoionization by UV starlight or by X-rays emitted by the shocked material in the SNR could raise $\overline{Z_{s}}$, but only by a factor of 3–4 [see @hamilton88:reionization_fe_sn1006]. After the shock, the heavy element plasma ionizes rapidly, and the values of $\overline{Z}(t)$ in fluid elements that started with different $\overline{Z_{s}}$ will converge over time. Due to this, the postshock X-ray emission is generally insensitive to moderate variations in the preshock ionization. In the presence of collisionless electron heating, increasing $\overline{Z_{s}}$ for a fixed value of $\beta$ raises the number of ’hot’ electrons and decreases their temperature in the same proportion. X-ray spectra, however, are sensitive mostly to the total internal energy transferred to the electrons at the shock and to the final electron temperature, and not so much to how the internal energy is distributed among the electrons. For all the values of $\overline{Z_{s}}$, the final electron temperature is similar because the final value of $\overline{Z}$ is very similar. In view of this, we do not expect significant deviations from the results presented here for $\overline{Z_{s}}>1$ at a fixed value of $\beta$.
The Ambient Medium Density
--------------------------
The density of the AM affects the spectral properties of the elements in the shocked ejecta in a dramatic way. This is due to two closely related effects: the acceleration of all the collisional plasma processes in denser media on one hand and the scaling of the hydrodynamic models with $\rho_{AM}$ on the other hand (see section 4.1 in Paper I for a discussion of the hydrodynamic scaling).
These effects are illustrated in Figures \[fig-3\] and \[fig-4\], which display the structure of the shocked ejecta of model DDTe at an age of 430 yr after the explosion, for a uniform AM of $\rho_{AM}=5\cdot10^{-24} \mathrm{g\cdot cm^{-3}}$ and $\rho_{AM}=2\cdot10^{-25} \mathrm{g\cdot cm^{-3}}$, respectively. These simulations are also shown for $\beta=\beta_{min}$, $0.01$, and $0.1$ to facilitate comparison with Figure \[fig-1\]. As a result of the scaling laws mentioned in Paper I, a SNR in a denser AM will be in a more evolved evolutionary stage at any given time, and vice versa – note how the reverse shock has not reached the Fe-dominated region of the ejecta at $t=430$ yr for $\rho_{AM}=2\cdot10^{-25} \mathrm{g\cdot cm^{-3}}$. The mean ionization state in the shocked ejecta, which peaks at $\overline{Z}\simeq10$ in the outermost Si-dominated layers for $\rho_{AM}=10^{-24} \mathrm{g\cdot cm^{-3}}$, rises as high as $\overline{Z}\simeq15$ for $\rho_{AM}=5\cdot10^{-24} \mathrm{g\cdot cm^{-3}}$ in the same region, but only reaches $\overline{Z}\simeq6$ for $\rho_{AM}=2\cdot10^{-25} \mathrm{g\cdot cm^{-3}}$. These differences in the mean ionization state correspond to differences in the ionization timescales of roughly an order of magnitude throughout the shocked ejecta for each factor 5 increase in $\rho_{AM}$. The electron temperature profiles are affected as well, although only by a factor of $\backsim2-3$. The higher densities and faster ionization rates tend to mitigate the effect of collisionless electron heating, favoring the convergence to the canonical $\beta=\beta_{min}$ case (compare panels c of Figures \[fig-3\] and \[fig-4\]).
Varying the value of $\rho_{AM}$ has an immediate impact on the emission measures and emission measure averaged quantities, mainly through the hydrodynamic scaling laws mentioned in Paper I. The approximate scaling of $EM_{X}(t)$ and $\langle \tau \rangle _{X}(t)$ is given by eqs. (3)-(5) in Paper I: $\rho_{AM}^{-1/3}$ for the t axis, $\rho_{AM}$ for $EM_{X}(t)$ and $\rho_{AM}^{2/3}$ for $\langle \tau \rangle _{X}(t)$. These approximate scalings are accurate within a factor of 2 for $2\cdot10^{-25}\leq\rho_{AM}\leq5\cdot10^{-24} \mathrm{g\cdot cm^{-3}}$, but they might break down for values of $\rho_{AM}$ outside this range. The effect of a change of $\rho_{AM}$ on the electron temperatures is more complex, and difficult to approximate with sufficient accuracy in view of the sensitivity of X-ray spectra to electron temperature. Whereas an accuracy within a factor of 2 is reasonable for $EM_{X}$ and $\tau_{X}$ , which span several orders of magnitude, changes by a factor of 2 are too large compared with the more modest (but still up to 2 orders of magnitude) range in $T_{e}$.
Effects on the X-ray Spectrum
-----------------------------
In Figure \[fig-5\], the temporal evolution of the spectra from the shocked ejecta of model DDTe is presented for three values of $\rho_{AM}$ ( $10^{-24}$, $5\cdot10^{-24}$, and $2\cdot10^{-25} \mathrm{g\cdot cm}^{-3}$) and two values of $\beta$ ($\beta_{min}$ and $0.1$). A preliminary inspection reveals that variations in $\rho_{AM}$ have profound effects on the calculated spectra. As expected from the scaling law for $<\tau>_{X}$, the plasma ionization state varies greatly, and the presence of different ions results in emission of different ionic lines. At $\rho_{AM}=5\cdot10^{-24} \mathrm{g\cdot cm^{-3}}$, for instance, the more advanced ionization state of Fe leads to a higher flux in the Fe L complex, which blends with O Ly$\alpha$ and Mg He$\alpha$ emission at the [*XMM-Newton*]{} CCD spectral resolution. The increase in the Fe K$\alpha$ line, on the other hand, is due to the higher temperatures in the ejecta. The prominent O He$\alpha$ line at 0.56 keV, seen at early times for $\rho_{AM}=10^{-24} \mathrm{g\cdot cm^{-3}}$, disappears at higher values of $\rho_{AM}$, because He-like O is ionized more rapidly. The overall higher ionization state of the plasma also leads to an increase in the flux of the Ly$\alpha$ lines of Si and S, and a shift towards higher energies of the Ca K$\alpha$ line. The shape and flux of the continuum emission also change. At lower densities, these effects are reversed. The Fe K$\alpha$ line and Fe L complex virtually disappear, revealing the underlying Ne He$\alpha$ and Ne Ly$\alpha$ lines at 0.9 and 1.0 keV. The O He$\alpha$ line becomes more important than O Ly$\alpha$, and the Ly$\alpha$ and He$\beta$ lines of Si and S vanish almost completely, as well as the Ca K$\alpha$ line. The continuum flattens and the emitted flux is generally lower at all energies.
In contrast with the global effects of variations of $\rho_{AM}$, changes in the amount of collisionless heating at the reverse shock have a different impact on different elements in a model with stratified ejecta like DDTe. For $\rho_{AM}=10^{-24} \mathrm{g\cdot cm^{-3}}$, the flux in the Fe K$\alpha$ line, which probes material at higher $T_{e}$ and lower $\tau$ than the Fe L complex, is increased by almost two orders of magnitude for $\beta = 0.1$. None of the other elements seems to be affected at this AM density, although model DDTe has a significant amount of S, Si and Ca in the inner ejecta. This increase in the Fe K$\alpha$ flux becomes less pronounced with time, and is accompanied by a slight change in the shape of the continuum. For $\rho_{AM}=5\cdot10^{-24}\, \mathrm{g\cdot cm^{-3}}$, the continuum is unaffected and the increase of the Fe K$\alpha$ line flux is reduced to less than an order of magnitude at early times, disappearing completely at late times. At $\rho_{AM}=2\cdot10^{-25} \mathrm{g\cdot cm^{-3}}$, however, the collisionless electron heating has a more noticeable effect. The shape of the spectrum is not changed at low energies, but the flux is somewhat lower at early times for $\beta=0.1$. At high energies, the level of continuum rises and the flux in the Fe K$\alpha$ line flux greatly increases. The effects of collisional electron heating can be clearly seen even at CCD spectral resolution. With a higher spectral resolution such as provided by [*ASTRO-E2*]{}, the predicted large temperature increases caused by collisionless heating (Fig. \[fig-2\]) should be detectable through various temperature-sensitive line diagnostics for a number of different chemical elements within the shocked ejecta.
We emphasize that model DDTe is presented here just as an illustrative example. For obvious reasons, it is not practical to present the effects of $\rho_{AM}$ and $\beta$ on the spectra of all the models in our grid. Although the details may vary, the general trends identified here for DDTe can be applied to most of the other models [for a discussion of other delayed detonation models, see @badenes04:model_grid].
To conclude, we note that collisionless electron heating at the reverse shock can have interesting effects on the spatially resolved X-ray emission. In particular, the enhanced flux in the Fe K$\alpha$ line discussed above would come mainly from the hotter regions of Fe-rich ejecta close to the reverse shock (see the shape of the electron temperature profile in Figures \[fig-1\], \[fig-3\], and \[fig-4\] for values of $\beta$ above 0.01). This scenario is compatible, at least qualitatively, with the finding that the Fe K$\alpha$ emission peaks at a smaller radius than the Fe L and Si He$\alpha$ emission in the X-ray CCD images of both the Tycho [@hwang98:tycho-Feemission] and Kepler [@cassam03:kepler] SNRs. Collisionless electron heating provides a simpler explanation to the rise of the electron temperature profile towards the reverse shock than the relic of an interaction with a circumstellar medium invoked by @dwarkadas98:typeIa for the Tycho SNR.
X-RAY SPECTRUM FROM THREE DIMENSIONAL TYPE Ia EXPLOSION MODELS {#sec:Expanding}
==============================================================
Type Ia SN Explosions in 3D: Fundamental Properties {#subsec:3Dmodels}
---------------------------------------------------
In Paper I, we introduced a grid of eight one dimensional Type Ia SN explosion models that included examples of all the paradigms currently under debate: sub-Chandrasekhar explosions, deflagrations, delayed detonations, and pulsating delayed detonations. This reduced grid is just a representative sample of a more extensive grid of 19 models, which constituted the base for the study of Type Ia SNRs conducted by @badenes04:PhD. The remaining 11 grid models are intermediate cases obtained by varying the parameters involved in the calculation of each explosion paradigm. We have included these models in the Appendix, both for reference in future works and for the convenience of those readers who want to use our synthetic SNR spectra for their own research. This grid is one representation of our current understanding of one dimensional Type Ia explosion models, upon which most of our knowledge of the physics of Type Ia SNe is based.
In view of the recent developments in the field, however, it has become clear that 1D calculations will soon be superseded by the three dimensional models that have begun to appear in the literature [@reinecke02:Ia3D; @gamezo03:Ia3D; @travaglio04:3D; @garcia-senz03:Ia3D]. These works have focused on pure deflagrations in 3D, proving that they are capable of producing robust explosions, but the ability of these models to explain the observations of Type Ia SNe has not been fully established yet. A common feature in all 3D deflagration models, and the most remarkable difference with respect to 1D models, is the uniform mixing of unburnt C and O material with $^{56}$Ni and the other products of nuclear burning throughout the ejecta. This mixing is due to the deformation of the flame front caused by Rayleigh-Taylor instabilities, an effect which seems unavoidable in 3D deflagrations. There has been some concern that the presence of large amounts of C and O in the inner layers of ejecta would lead to a spectral evolution inconsistent with optical observations [@gamezo03:Ia3D], but complex spectral simulations are required to verify this claim [@baron03:detectability]. Alternatives to the 3D deflagration scenario are being explored right now, including delayed detonations in 3D [@garcia-senz03:DDT3D; @gamezo04:DDT3D; @gamezo05:DDT3D] and two new explosion paradigms: gravitationally confined detonation [@plewa04:gcd] and pulsating reverse detonation [@bravo05:SNIa_3D_review], but none of these models has been completely understood yet. Here, we study 3D deflagration models in the context of the X-ray spectra of young SNRs to provide an independent method of assessing their viability for Type Ia explosions.
We use a one dimensional average of model B30U, a 3D deflagration from @garcia-senz03:Ia3D, to illustrate what can be expected from this class of models. The chemical composition and density profile of this model are presented in the Appendix, and they are very similar to those of the models obtained by @gamezo03:Ia3D and @travaglio04:3D, even though the computational techniques and the resolution of the calculations are different in each case [see Table 1 in @bravo05:SNIa_3D_review for a more detailed comparison of these works]. This shows that three dimensional deflagrations are relatively well understood, and supports our use of model B30U as a representative example of this class. The evolution of the emission measures and emission measure-averaged ionization timescales and electron temperatures of the principal elements in the ejecta of B30U are shown in Fig. \[fig-6\] for an interaction with $\rho_{AM}=10^{-24} \mathrm{g\cdot cm^{-3}}$ and $\beta=\beta_{min}$. Interpretation of differences between these plots and Figures 4, 5, and 6 of Paper I is not straightforward, because the 3D calculations are not fully self-consistent with the 1D models of the grid (the effect of the energy deposited by the decay of $^{56}$Ni on the density profile, for instance, has not been taken into account). Nevertheless, the main features of the evolution of the shocked ejecta do not depend on such details. The most striking property of this model is the similarity in the spectral properties ($\langle T_{e} \rangle$ and $\langle \tau \rangle$) of Fe and Si throughout the evolution of the SNR. This is in marked contrast to 1D models, where the stratification of the ejecta leads to significant differences between Fe and Si. The abrupt changes in several plots seen at $t\sim 8\cdot10^{10}$ s are due to the impact of the reverse shock on a remnant of unburnt white dwarf material formed in model B30U [for details, see @garcia-senz03:Ia3D].
In Figure \[fig-7\], we show the ejecta spectra of model B30U at the same values of $t$, $\rho_{AM}$ and $\beta$ as in Figure \[fig-5\] for model DDTe. The most remarkable properties of these spectra are the high Fe L-shell flux and the presence of the prominent Ni K$\alpha$ line at $\sim 7.5$ keV (except at the lowest AM densities). This is due to the large amounts of Fe and Ni that are found in the outermost layers of B30U, where the density of the shocked ejecta is highest. The results are a long Fe ionization timescale, which leads to the enhanced Fe L-shell flux, and a high Ni emission measure leading to a strong Ni K$\alpha$ emission. Such a strong Ni K$\alpha$ line has never been observed in thermal X-ray spectra of SNRs. Another interesting feature is the relative weakness of the Si and S K$\alpha$ lines. The reason for this is twofold: first, 3D deflagrations produce smaller amounts of Si, S and other intermediate mass elements than the conventional 1D delayed detonations; second, equivalent widths of the Si and S lines are smaller because of the strong continuum produced by the large amount of C and O that is present throughout the ejecta. These spectral characteristics exhibited by model B30U are common to all 3D deflagrations with well mixed ejecta.
Comparison with X-ray observations of SNRs {#subsec:Can3Ddoit?}
------------------------------------------
We compare the results of our simulations for the 3D deflagration model B30U with the basic properties of Type Ia SNRs. The prediction of similar emission measure-averaged electron temperatures and ionization timescales for Si and Fe can be easily tested by examining X-ray observations. We have searched the literature for young SNRs with published good-quality X-ray spectra that have been classified as Type Ia. Six objects meet these requirements: the historical remnants of Tycho, Kepler and SN1006, and three Large Magellanic Cloud SNRs: N103B, 0509-67.5, and DEM L71. We note that the classification of Kepler’s SNR as Type Ia is controversial [e.g., @blair04:kepler]. The remnant of SN1006 is not suitable for our purposes because it lacks strong Fe emission [@koyama95:acc_elect_SN1006]. In the case of DEM L71, although the X-ray spectrum of this SNR has been analyzed in some detail [see @hughes03:DEML71; @vanderHeyden03:DEML71], we found no published estimates of temperatures and ionization timescales for Fe and Si in the ejecta. The results of the analysis of the integrated spectrum for the other four SNRs are summarized in Table \[tab-1\].
The spectral properties of all the SNRs considered here show that an important fraction of the Fe in the shocked ejecta is emitting under conditions different from those of the Si. The authors of the works referenced in Table \[tab-1\] accounted for this by either adding a spectral component made of pure Fe to their fits or by using plane-parallel models that allowed to treat Fe and Si separately by assigning different values of $n_{e}t$ and $kT$ to each element. Since the analysis techniques, models, and data quality were different in each case, these results can only be compared either with our models or among themselves in a qualitative way. Nevertheless, a clear trend can be observed in all four SNRs considered here: the Fe component was always hotter than the Si component by at least a factor of 2. The Fe was at a lower ionization timescale in three out of four objects: Tycho, Kepler, and N103B. In 0509-67.5, however, the Fe component has a higher ionization timescale than Si. In this case, the statistics of the Fe K$\alpha$ line were poor, and the ionization timescale of Fe was constrained mostly by fitting the Fe L complex. @warren03:0509-67.5 note that their fit to the Fe L complex emission was not complete, because a strong line had to be added by hand. Improved atomic physics and higher resolution data would be highly desirable to confirm this result for 0509-67.5.
Since the emission measure averaged ionization timescales and electron temperatures of Si and Fe do not differ by more than 30% in model B30U (see Figure \[fig-6\]), we conclude that this model is in conflict with the observations listed on Table \[tab-1\], at least within the limitations of our simulations. This conclusion is extensible to any model in which Fe and Si are well mixed throughout the ejecta, and therefore can be applied to all the 3D deflagration models for Type Ia SNe discussed in the previous section. As we have seen in § \[sec:Techniques\], a plasma state with $\langle T_{e} \rangle_{Si}\,<\, \langle T_{e} \rangle_{Fe}$ and $\langle \tau \rangle_{Si}\,>\,\langle \tau \rangle_{Fe}$ arises naturally in Type Ia SN models with stratified ejecta, such as 1D delayed detonations or pulsating delayed detonations, that undergo a moderate amount of collisionless electron heating at the reverse shock. The ionization timescales of Fe and Si in 0509-67.5 are clearly incompatible with this scenario, but in this case @warren03:0509-67.5 found a very low amount of Fe in the shocked ejecta, with Fe to Si abundance ratios below 0.07. While this is very difficult to interpret in the context of well-mixed Type Ia SN ejecta, it could be more easily explained if the reverse shock were just entering the Fe-dominated region in stratified ejecta. A detailed comparison of our models with this SNR would be required to confirm this hypothesis.
We emphasize that our simulations based on one dimensional averages are too simple to rule out well-mixed 3D Type Ia SN explosion models. We do not account for a number of processes that might result in the Fe and Si in the ejecta emitting under different conditions, like the Ni bubble effect [@basko94:Nibubbles-SN87A; @blondin01:dynam_fe_bubbles_SNRs] or the formation of clumps in the ejecta [@wang01:Ia-inst-clump]. Nevertheless, we find that the observations of Type Ia SNRs seem easier to explain in the light of Type Ia SN explosion models with stratified ejecta.
DISCUSSION AND CONCLUSIONS {#sec:Discussion}
==========================
In this paper, we have examined several important aspects of the X-ray spectral models for the ejecta in Type Ia SNRs that were introduced in @badenes03:xray. We have explored the impact of the amount of collisionless electron heating at the reverse shock, $\beta$, and the density of the ambient medium, $\rho_{AM}$, on the integrated X-ray emission from the ejecta in Type Ia SNR models of different ages. We found that even small amounts of collisionless electron heating can modify the electron temperature profile inside the ejecta in a significant way, leading to a region of hot material at low ionization timescales close to the reverse shock. In the context of Type Ia SN explosion models with stratified ejecta, this modified temperature profile can affect the emission from the inner layers rich in Fe for a broad range of dynamical ages, increasing the flux in the Fe K$\alpha$ complex. This could explain why the Fe K$\alpha$ emission peaks at smaller radii than Fe L in both the Tycho [@hwang98:tycho-Feemission] and Kepler [@cassam03:kepler] SNRs. The density of the AM also has a strong impact on the X-ray emission from the ejecta. For higher values of $\rho_{AM}$, the SNR is in a more advanced evolutionary stage at a given age, and the ionization timescale of the shocked ejecta increases significantly. At lower values of $\rho_{AM}$, the ionization timescales decrease and the evolutionary stage is less advanced. We have provided approximate scaling laws to estimate these effects, and discussed their impact on specific emission lines and line complexes through an example.
We have also reviewed the fundamental properties of the recent deflagration models for Type Ia SNe calculated in 3D, and their performance in the context of the X-ray spectra of SNRs. Using our 1D simulation scheme, we have shown that the mixing of fuel and ashes throughout the ejecta, which is a common feature of these 3D explosion models, results in all the elements in the shocked ejecta of the SNR having very similar spectral characteristics. In particular, the emission measure averaged ionization timescales and electron temperatures of elements like Fe and Si are always very close to each other. This is in conflict with the observations of Type Ia SNRs in our Galaxy and the Magellanic Clouds, where the Fe and Si in the shocked ejecta are found to be emitting under different physical conditions. Within the limitations of our 1D simulation scheme, these observations are easier to explain with Type Ia explosion models that have stratified ejecta than with models that have well mixed ejecta like 3D deflagrations.
We believe that our models represent a significant improvement over current methods of analyzing and interpreting the X-ray emission from the shocked ejecta in SNRs. In order to facilitate the comparison between our models and observations, we have built a library of synthetic spectra, which is available from the authors upon request. This library is presented in the Appendix, where more Type Ia SN explosion models are introduced, and some aspects relevant to the comparison between the synthetic spectra and observations are discussed. A detailed example of this kind of comparison in the framework of the ejecta emission from the Tycho SNR will be the subject of a forthcoming paper (Badenes et al., in preparation).
We wish to thank Jack Hughes and Jessica Warren for detailed discussions concerning 0509-67.5. We also acknowledge conversations with Una Hwang and Martin Laming on several aspects of the research presented here. We are grateful to the anonymous referee for suggestions that helped to improve the quality of this manuscript. This research has been partially supported by the CIRIT and MCyT in Spain, through grants AYA2000-1785, AYA2001-2360, and AYA2002-04094-C03. CB would like to acknowledge support from GENCAT (grant 2000FI 00376) and IEEC in Barcelona, and from grant GO3-4066X from SAO at Rutgers. KJB is supported by NASA grant NAG 5-7153.
A LIBRARY OF SYNTHETIC SPECTRA FOR THE ANALYSIS OF EJECTA EMISSION IN TYPE Ia SNRs
==================================================================================
In this Appendix, we introduce our library of synthetic spectra for the ejecta emission in Type Ia SNRs. The objective of this library is to provide observers with a complete set of synthetic spectra for the ejecta emission in SNRs, calculated from an extensive grid of Type Ia SN explosion models, at different values of $t$, $\rho_{AM}$, and $\beta$. At present, our library includes more than 800 synthetic spectra in sequences like those presented in Figures \[fig-5\] and \[fig-7\] for models DDTe and B30U. For each model, we have generated synthetic spectra for several values in the ranges $430 \leq t \leq 5000$ yr; $2 \cdot 10^{-25} \leq \rho_{AM} \leq 5 \cdot 10^{-24} \mathrm{g \cdot cm^{-3}}$; and $\beta_{min} \leq \beta \leq 0.1$. In § \[subsec:Rationale\], we discuss these synthetic spectra in the context of the tools that are currently used for the analysis of ejecta emission in SNRs. In§ \[subsec:Comparing\] we comment on potential applications for our models. In § \[subsec:Caveats\], some important caveats and limitations of the models are discussed. Finally, in § \[subsec:Grid\], we introduce a number of Type Ia SN explosion models that, together with those presented in Paper I, complete the exploration of the parameter space for thermonuclear supernovae.
Rationale {#subsec:Rationale}
---------
The spectral analysis of the ejecta emission in young SNRs is a complex problem. Despite the spectacular increase in the quality of the observations, it has proved very difficult to extract the relevant physical parameters from these observations in a reliable way with the available tools. A frequent approach involves the fitting of several more or less sophisticated NEI components with varying abundances, electron temperatures, and ionization timescales to the observed X-ray spectra (several examples have been cited in § \[subsec:Can3Ddoit?\]). The results of applying this approach are not unique, and frequently very hard to interpret, because average parameters (like $T_{e}$ or $n_{e}t$) are assigned to a plasma whose physical properties have an enormous dynamic range, and where different chemical elements often emit under different conditions (see Figures \[fig-1\], \[fig-3\], and \[fig-4\]). The determination of elemental abundances in the entire volume of shocked plasma, which is crucial for establishing the connection between the SNRs and the SN explosions that originated them, is particularly unreliable when it is based on this approach. Often, NEI models just provide estimates for the emission measures of the elements, under the assumption of a homogeneous composition, and the difference between the ratios of these emission measures and the true abundance ratios in the plasma can be several orders of magnitude (see section 4.2 of Paper I).
The synthetic spectra presented in Paper I and in the present work open new possibilities for the interpretation of X-ray observations of Type Ia SNRs. Without claiming to include all the complex physical processes at play in young SNRs (see § \[subsec:Caveats\]), these synthetic spectra provide a much more accurate representation of the state of the shocked ejecta in young Type Ia SNRs than the simple NEI models currently available within software packages like XSPEC. Moreover, since the synthetic spectra are calculated from realistic SN explosion models, the connection between the observed spectrum and quantities like the explosion energy or the amount of each element present in the ejecta are easy to establish. The trade off is that the comparison between our synthetic spectra and X-ray observations is not necessarily a straightforward procedure.
Comparing Models and Observations {#subsec:Comparing}
---------------------------------
Several strategies with varying degrees of sophistication can be followed to compare our models to observations. A somewhat crude possibility is to focus on derived quantities like $ \langle T_{e} \rangle$ and $ \langle \tau \rangle$, as we have done in § \[subsec:Can3Ddoit?\]. While this can lead to interesting results, it is far better to perform more direct spectral comparisons using the library of synthetic spectra that we present here. The most effective way to apply this library will depend on the specific observational constraints for the SNR under study. In some cases, like the historical Galactic SNRs, the age will be known accurately, but the distance (and hence the total integrated X-ray flux and the radius of the forward shock) will be more uncertain. In other cases, like the SNRs in the Magellanic Clouds, the distance will be known, but the age will not. Reliable independent estimates for $\rho_{AM}$ may or may not be available. In each case, there will be more than one way to reduce the dimensionality of the problem. Rather than providing a recipe which may not be adequate for a specific case, we make here some suggestions which might prove useful in a more general context.
First, it is important to note that each synthetic spectrum is based on an underlying hydrodynamic model, so quantities such as the radius of the forward and the reverse shocks and their expansion parameters are available for each spectral model (see Figure 3 and eqns. (3), (4), and (5) in Paper I). In principle, it is possible to reverse the problem, find out which hydrodynamic models agree better with the observations and thus reduce the number of synthetic spectra to consider. In doing so, however, the limitations of 1D adiabatic hydrodynamics must be considered (see the following section). Second, the selection of a particular synthetic spectrum from our library to represent the ejecta component in an observed X-ray spectrum may not be trivial. The substantial uncertainties in the atomic data and the relative simplicity of the models with respect to real SNRs will probably make it impossible to attain a statistically valid fit. Synthetic spectra like ours are more vulnerable to these factors, because there is little room for self-adjustment, in contrast to conventional NEI models with variable abundances. If the emissivity of a particular line is underestimated in the spectral code used to generate our library, for instance, this cannot be compensated by artificially enhancing the abundance of that particular element, as in a conventional NEI model. Yet, even if some specific details of the observed spectrum cannot be reproduced, it is often possible to find a model whose overall characteristics are in reasonable agreement with the observations. Under these circumstances, a procedure needs to be devised in order to measure the degree of success of a specific synthetic spectrum. An example shall be provided in a forthcoming paper on the Tycho SNR (Badenes et al., in preparation).
Approximations and Caveats {#subsec:Caveats}
--------------------------
Our models are just a simplified representation of the complexity of young SNRs, and their limitations have to be considered when making comparison with observations. The crucial approximations were reviewed in sections 3.5 and 5 of Paper I, but it is important to revisit several issues here.
The most important simplification is certainly the assumption of spherical symmetry. Any description of young SNRs in the framework of 1-D models is necessarily incomplete, because it does not include important processes such as ejecta clumping and dynamic instabilities at the contact discontinuity between shocked ejecta and shocked AM [@chevalier92:hydrod_instab_SNR; @wang01:Ia-inst-clump]. The degree of ejecta clumping is crucial, and it is clear that our 1D models (and in particular, the distribution of $\tau$ and $T_{e}$ for each element) would be invalidated if clumps with a large density contrast like those proposed by @wang01:Ia-inst-clump were to dominate the emission measure of the shocked ejecta in Type Ia SNRs. In this case, gross inconsistencies are expected to emerge from comparison of 1-D models with observations. The degree of ejecta clumping strongly affects the morphology of the X-ray emission, and examination of this morphology in Type Ia SNRs should shed light on this issue. Multi-dimensional hydrodynamical simulations coupled with X-ray emission calculations could prove useful for this.
Another important issue whose impact on the X-ray spectra is hard to estimate is the effect of cosmic ray acceleration at the shocks. There is some indication that this process might affect the dynamics and X-ray spectra of the shocked AM without significantly modifying those of the shocked ejecta [@decourchelle00:cr-thermalxray], but more detailed simulations are needed to shed light on this question [see @ellison05:cr+revshock for a discussion].
To conclude this section, we comment on the importance of radiative losses, which have received some attention lately in the work of Blinnikov et al. [see @blinnikov04:lc+snr and references therein]. In Section 4 of @hamilton84:ejecta, it was shown that radiative losses always lead to catastrophic cooling in heavy element plasmas, driving the shocked material to infrared- and optically-emitting temperatures. Because no optically emitting knots with a composition dominated by heavy elements have been observed in Kepler, Tycho, or SN1006 [see @blair91:kepler_optical; @smith91:six_balmer_snrs], we conclude that radiative losses are not dynamically important in young Type Ia SNRs under usual conditions. Radiative losses are not included in our models in a self-consistent way, but we have extended the [*a posteriori*]{} monitoring of radiative losses described in section 3.5 of Paper I to the more unfavorable case of $\rho_{AM}=5\cdot10^{-24} \mathrm{g\cdot cm^{-3}}$. Our previous conclusions have been verified: radiative losses only affect the outermost layers of the models with the steepest ejecta density profiles. The values of $t_{rad}$, as defined in Paper I (the time when the calculated losses exceed 10% of the specific internal energy in at least 5% of the ejecta mass) for models with $t_{rad}<$5,000 yr are provided in Table \[tab-2\]. In these models, our calculations for the properties (density, electron temperature, ionization state, and X-ray emission) of the layers that undergo radiative losses are not reliable close to or beyond $t_{rad}$, and some amount of infrared or optical emission should be expected from this region of the ejecta. The fact that such emission is not observed in Kepler, Tycho or SN1006 suggests that models which predict substantial radiative losses in the ejecta are in conflict with observations of these historical SNRs.
The Complete Grid of Type Ia SN Explosion Models {#subsec:Grid}
------------------------------------------------
### One Dimensional Models
Among the eight one dimensional Type Ia SN explosion models introduced in Paper I, one was a sub-Chandrasekhar explosion (SCH), one was a pure detonation (DET), two were pure deflagrations (DEFa and DEFf), two were delayed detonations (DDTa and DDTe), and two were pulsating delayed detonations (PDDa and PDDe). These explosion paradigms, and the details involved in the calculation of the models, are described in Paper I (Section 2 and Appendix). For the deflagrations, delayed detonations and pulsating delayed detonations, the models presented in Paper I were extreme cases, obtained by considering the highest and lowest reasonable values of the parameters involved in each calculation. In the case of the deflagration models, the relevant parameter is $\kappa$, which controls the propagation velocity of the subsonic flame. For the delayed detonation and pulsating delayed detonation, the parameters are $\rho_{tr}$, which determines the density at which the transition from deflagration to detonation occurs, and $\iota$, which determines the flame velocity in the deflagration stage. All these parameters are defined in the Appendix of Paper I. By varying these parameters, we have generated four more deflagrations (DEFb, DEFc, DEFd, and DEFe), four more delayed detonations (DDTb, DDTbb, DDTc, and DDTd), and three more pulsating delayed detonations (PDDb, PDDc, and PDDd). In Table \[tab-3\] and Figure \[fig-8\], we present the nucleosynthetic output, chemical composition profiles and density profiles of these intermediate models that complete the exploration of the parameter space.
### Three Dimensional Models
A brief discussion on the state of the art in 3D calculations of thermonuclear SN explosions can be found in § \[subsec:3Dmodels\] of this work; for a review see @bravo05:SNIa_3D_review. Without going into the details of how these 3D models are calculated, here we present four one-dimensional mappings of 3D models that are representative of the current trends. Their main characteristics are given in Figure \[fig-8\] and Table \[tab-4\]. Model B30U is a 3D deflagration from @garcia-senz03:Ia3D, very similar to the models by @gamezo03:Ia3D and @travaglio04:3D (see discussion in § \[sec:Expanding\]). Model DDT3DA is a 3D version of the delayed detonation paradigm [@garcia-senz03:DDT3D]. In this model, a detonation was artificially inducted in those regions were the flame resulting from the turbulent deflagration phase was well described by a fractal surface of dimension larger than 2.5. We note that this particular model also results in very well mixed ejecta, and in fact the properties of its X-ray emission in the SNR phase are very similar to those of model B30U. Other delayed detonations in 3D calculated with different assumptions for the induction of the detonation result in more stratified ejecta [@gamezo04:DDT3D; @gamezo05:DDT3D]. For a comparison between these two kinds of three dimensional delayed detonations, see Table 1 and the accompanying text in @bravo05:SNIa_3D_review. Finally, two 3D sub-Chandrasekhar models from @garcia-senz99:SCH3D have also been included in the grid. Model SCH3DOP is a sub-Chandrasekhar explosion calculated in 3D where the layer of degenerate He was ignited at one single point, while in SCH3DMP the ignition happened at five different points. It is worth noting that none of the 3D models has been followed for a sufficient time to account for the effects of the decay of $^{56}$Ni on the density profiles.
[40]{} natexlab\#1[\#1]{}
Badenes, C. 2004, PhD thesis, Universitat Politècnica de Catalunya
Badenes, C., Bravo, E., Borkowski, K., & Domínguez, I. 2003, ApJ, 593, 358 \[Paper I\]
Badenes, C., Bravo, E. & Borkowski, K. 2005, Adv. Space Res., submitted
Baron, E., Lentz, E., & Hauschildt, P. 2003, ApJ, 588, L29
Basko, M. 1994, ApJ, 425, 264
Blair, W. 2004, in [1604-2004: Supernovae as Cosmological Lighthouses]{}, ed. M. Turatto, L. Zampieri, S. Benetti, & W. Shea. (ASP Conference Series), in press \[astro-ph/0410081\]
Blair, W., Long, K., & Vancura, O. 1991, ApJ, 366, 484
Blinnikov, S., Bakalanov, P., A.V.Kozyrcva, & Sorokina, E. 2004, in [1604-2004: Supernovae as Cosmological Lighthouses]{}, ed. M. Turatto, L. Zampieri, S. Benetti, & W. Shea. (ASP Conference Series), in press \[astro-ph/0409396\]
Blondin, J., Borkowski, K., & Reynolds, S. 2001, ApJ, 557, 782
Borkowski, K., Lyerly, W., & Reynolds, S. 2001, ApJ, 548, 820
Branch, D. & Khokhlov, A. 1995, Phys. Rep., 256, 53
Bravo, E., Badenes, C. & García-Senz, D. 2005, in [Interacting Binaries: Accretion, Evolution and Outcomes]{}, ed. L.A. Antonelli, L. Burderi, F. D’Antona, T. Di Salvo, G.L. Israel, L. Piersanti, O. Straniero & A. Tornambé. (AIP Conference Series), in press, \[astro-ph/0412155\]
Cargill, P. & Papadopoulos, K. 1988, ApJ, 329, L29
Cassam-Chenai, G., Decourchelle, A., Ballet, J., Hwang, U., Hughes, J., & R.Petre. 2004, A&A, 414, 545
Chevalier, R. 1982, ApJ, 258, 790
Chevalier, R., Blondin, J., & Emmering, R. 1992, ApJ, 392, 118
Decourchelle, A., Ellison, D., & Ballet, J. 2000, ApJ, 543, L57
Dwarkadas, V. & Chevalier, R. 1998, ApJ, 497, 807
Ellison, D., Decourchelle, A., & Ballet, J. 2005, A&A, 429, 569
Gamezo, V., Khokhlov, A. & Oran, E. 2005, ApJ, submitted \[astro-ph/0409598\]
Gamezo, V., Khokhlov, A. & Oran, E. 2004, Phys. Rev. Lett., 92, 1102
Gamezo, V., Khokhlov, A., Oran, E., Chtchelkanova, A., & Rosenberg, R. 2003, Science, 299, 77
García-Senz, D. & Bravo, E. 2003, in [From Twilight to Highlight: The Physics of Supernovae]{}, ed. W. Hillebrandt and B. Leibundgut (Berlin: Springer), 158 \[astro-ph/0211242\]
García-Senz, D. & Bravo, E. 2005, A&A, in press, \[astro-ph/0409480\]
García-Senz, D., Bravo, E. & Woosley, S. E. 1999, A&A, 349, 177
Ghavamian, P., Raymond, J., Smith, R., & Hartigan, P. 2001, ApJ, 547, 995
Hamilton, A. & Fesen, R. 1988, ApJ, 327, 178
Hamilton, A., Fesen, R., Wu, C., Crenshaw, D., & Sarazin, C. L. 1997, ApJ, 481, 838
Hamilton, A. & Sarazin, C. 1984, ApJ, 287, 282
Hillebrandt, W. & Niemeyer, J. 2000, ARA&A, 38, 191
Höflich, P. & Khokhlov, A. 1996, ApJ, 457, 500
Hughes, J., Ghavamian, P., Rakowski, C., & Slane, P. 2003, ApJ, 582, L95
Hughes, J., Hayashi, I., Helfand, D., Hwang, U., Itoh, M., Kirshner, R., Koyama, K., Markert, T., Tsunemi, H., & Woo, J. 1995, ApJ, 444, L81
Hwang, U., Hughes, J., & Petre, R. 1998, ApJ, 497, 833
Kinugasa, K. & Tsunemi, H. 1999, PASJ, 51, 239
Koyama, K., Petre, R., Gotthelf, E., Hwang, U., Matsuura, M., Ozaki, M., & Holt, S. 1995, Nature, 378, 255
Laming, J. M. 2000, ApJS, 127, 409
Lewis, K., Burrows, D., Hughes, J., Slane, P., Garmire, G., & Nousek, J. 2003, ApJ, 582, 770
Plewa, T., Calder, A.C., & Lamb, D.Q. 2004, ApJ, 612, L37
Rakowski, C., Ghavamian, P., & Hughes, J. 2003, ApJ, 590, 846
Reinecke, M., Hillebrandt, W., & Niemeyer, J. 2002, A&A, 391, 1167
Smith, R., Kirshner, R., Blair, W., & Winkler, P. 1991, ApJ, 375, 652
Travaglio, C., Hillebrandt, W., Reinecke, M., & Thielemann, F.-K. 2004, A&A, 425, 1029
, K., Bleeker, J., Kaastra, J., & Vink, J. 2003, A&A, 406, 141
Vink, J., Laming, M., Gu, M., Rasmussen, A., & Kaastra, J. 2003, ApJ, 587, L31
Wang, C.-Y. & Chevalier, R. 2001, ApJ, 549, 1119
Warren, J. & Hughes, J. 2004, ApJ, 608, 261
![ $EM(t)$ (top left), $<T_{e}>(t)$ (top right) and $<\tau>(t)$ (bottom) for the principal elements in the shocked ejecta of model B30U, interacting with a uniform AM of $\rho_{AM}=10^{-24} \mathrm{g\cdot cm^{-3}}$. The crosses in the $EM(t)$ plot represent the total emission measure of the shocked ejecta. See the on-line edition for a color version of this Figure. \[fig-6\]](f6a_color.eps "fig:") ![ $EM(t)$ (top left), $<T_{e}>(t)$ (top right) and $<\tau>(t)$ (bottom) for the principal elements in the shocked ejecta of model B30U, interacting with a uniform AM of $\rho_{AM}=10^{-24} \mathrm{g\cdot cm^{-3}}$. The crosses in the $EM(t)$ plot represent the total emission measure of the shocked ejecta. See the on-line edition for a color version of this Figure. \[fig-6\]](f6b_color.eps "fig:")
![ $EM(t)$ (top left), $<T_{e}>(t)$ (top right) and $<\tau>(t)$ (bottom) for the principal elements in the shocked ejecta of model B30U, interacting with a uniform AM of $\rho_{AM}=10^{-24} \mathrm{g\cdot cm^{-3}}$. The crosses in the $EM(t)$ plot represent the total emission measure of the shocked ejecta. See the on-line edition for a color version of this Figure. \[fig-6\]](f6c_color.eps)
![ Chemical composition and density profiles for the Type Ia SN explosion models that were not presented in Paper I. The abundances represented here are number abundances after the decay of all short lifetime isotopes. The density profiles ($\rho_{\mathrm norm}$) are represented at $t=10^{6}$ s after the SN explosion, and they have been normalized by $\rho_{n}=10^{-11}\, {\mathrm g \cdot cm^{-3}}$. See the on-line edition for a color version of this Figure.\[fig-8\]](f8a_color.eps "fig:") ![ Chemical composition and density profiles for the Type Ia SN explosion models that were not presented in Paper I. The abundances represented here are number abundances after the decay of all short lifetime isotopes. The density profiles ($\rho_{\mathrm norm}$) are represented at $t=10^{6}$ s after the SN explosion, and they have been normalized by $\rho_{n}=10^{-11}\, {\mathrm g \cdot cm^{-3}}$. See the on-line edition for a color version of this Figure.\[fig-8\]](f8b_color.eps "fig:")
[ccccccccc]{} Tycho & @hwang98:tycho-Feemission & 432 & NEI, single $T_{e}$, & $0.86$ & $\backsim 11$ & NEI, single $T_{e}$, & $> 1.7$ & $\sim 9$\
& & & single $n_{e}t$ & & & single $n_{e}t$ & &\
Kepler & @kinugasa99:kepler-ASCA & 404 & NEI, single $T_{e}$, & $0.77\pm0.06$ & $10.42^{+0.06}_{-0.05}$ & NEI, single $T_{e}$, & $>6$ & $9.53^{+0.07}_{-0.01}$\
& & & single $n_{e}t$ & & & single $n_{e}t$ & &\
0509-67.5 & @warren03:0509-67.5 & $< 1,000$ & Plane-parallel & $3.13\pm0.55$ & $9.93\pm0.02$ & Plane-parallel & $10.0^{+\infty}_{-5.44}$ & $10.53\pm0.02$\
& & & NEI shock & & & NEI shock & &\
N103B & @lewis03:N103B & $< 2,000$ & Plane-parallel & $\backsim 1$ & $>12$ & Plane-parallel & $> 2$ & $\sim 10.8$\
& & & NEI shock & & & NEI shock & &\
[ccc]{} DEFa & $3.0\cdot10^{10}$ s & $2\cdot10^{10}$ s\
DEFc & $2.7\cdot10^{10}$ s & $1.6\cdot10^{10}$ s\
DEFf & $2.4\cdot10^{10}$ s & $1.2\cdot10^{10}$ s\
PDDe & - & $1.5\cdot10^{11}$ s\
[ccccccccccccc]{} DEFb & 0.08 & & 1.37 & 0.64 & -19.14 & 0.94 & 0.61 & 0.61 & 0.025 & 0.017 & 0.0040 & 0.0043\
DEFc & 0.10 & & 1.37 & 0.74 & -19.29 & 0.99 & 0.68 & 0.55 & 0.021 & 0.014 & 0.0032 & 0.0032\
DEFd & 0.12 & & 1.37 & 0.80 & -19.34 & 1.02 & 0.71 & 0.52 & 0.021 & 0.014 & 0.0032 & 0.0034\
DEFe & 0.14 & & 1.37 & 0.81 & -19.29 & 0.98 & 0.73 & 0.49 & 0.021 & 0.013 & 0.0029 & 0.0028\
DDTb & 0.03 & $2.6\cdot10^{7}$ & 1.37 & 1.36 & -19.67 & 1.11 & 0.98 & 0.05 & 0.10 & 0.084 & 0.022 & 0.027\
DDTbb & 0.01 & $2.5\cdot10^{7}$ & 1.37 & 1.31 & -19.66 & 1.12 & 0.99 & 0.05 & 0.10 & 0.084 & 0.022 & 0.027\
DDTc & 0.03 & $2.2\cdot10^{7}$ & 1.37 & 1.16 & -19.51 & 1.11 & 0.80 & 0.12 & 0.17 & 0.13 & 0.033 & 0.038\
DDTd & 0.03 & $1.5\cdot10^{7}$ & 1.37 & 1.08 & -19.30 & 0.94 & 0.72 & 0.14 & 0.20 & 0.15 & 0.037 & 0.043\
PDDb & 0.03 & $2.2\cdot10^{7}$ & 1.37 & 1.36 & -19.72 & 1.14 & 1.04 & 0.03 & 0.085 & 0.070 & 0.018 & 0.022\
PDDc & 0.03 & $1.5\cdot10^{7}$ & 1.37 & 1.25 & -19.64 & 1.11 & 0.98 & 0.04 & 0.11 & 0.093 & 0.024 & 0.029\
PDDd & 0.03 & $1.2\cdot10^{7}$ & 1.37 & 1.24 & -19.53 & 1.04 & 0.89 & 0.05 & 0.15 & 0.13 & 0.034 & 0.041\
[ccccccccc]{} B30U & 1.37 & 0.42 & 0.53 & 0.66 & 0.045 & 0.011 & 0.0019 & 0.0017\
DDT3Da & 1.37 & 0.78 & 0.76 & 0.38 & 0.063 & 0.027 & 0.0066 & 0.0072\
SCH3DOP & 1.02 & 1.14 & 0.58 & 0.23 & 0.064 & 0.035 & 0.0093 & 0.0077\
SCH3DMP & 1.02 & 1.19 & 0.67 & 0.07 & 0.081 & 0.054 & 0.019 & 0.017\
|
TIMESTAMP = 1589872532
SHA256 (gnu-efi-3.0.12.tar.bz2) = 0196f2e1fd3c334b66e610a608a0e59233474c7a01bec7bc53989639aa327669
SIZE (gnu-efi-3.0.12.tar.bz2) = 154575
|
Q:
why jquery toggle() method doesnot work properly if page is not refreshed
Using following code i ma calling a modal window. I am using jquery .toggle() method to hide and show some portion of modal window based on a checkbox selection.
$(document).ready(function() {
function ShowSaveEventForm(start, end, allDay) {
var month = start.getMonth() + 1 + "";
if (month.length == 1) {
month = "0" + month;
}
var date = start.getDate() + "";
if (date.length == 1) {
date = "0" + date;
}
var year = start.getFullYear();
var hours = start.getHours();
var sec = start.getSeconds();
var msec = start.getMilliseconds();
var stdate = new Date(year, month, date, hours, sec, msec);
var sdate = year + "-" + month + "-" + date;
var month = end.getMonth() + 1 + "";
if (month.length == 1) {
month = "0" + month;
}
var date = end.getDate() + "";
if (date.length == 1) {
date = "0" + date;
}
var year = end.getFullYear();
var hours = end.getHours();
var sec = end.getSeconds();
var msec = end.getMilliseconds();
var eddate = new Date(year, month, date, hours, sec, msec);
var edate = year + "-" + month + "-" + date;
$('#eventdate').val(sdate);
$('#edate').val(edate);
var acctype = $('input:radio[name=accesstype]:checked').val();
if (acctype == 1) {
$('#chose-multi').hide();
}
$("#check").click(function() {
$("#stime").toggle();
$("#etime").toggle();
});
$("#rstrcted").click(function() {
$("#chose-multi").show();
});
$("#private").click(function() {
$("#chose-multi").hide();
});
$("#public").click(function() {
$("#chose-multi").hide();
});
$('#error-message').hide(); // hide the error message section
$('#modal-form').modal('show');
}
And my HTML code is
<div id="modal-form" class="modal" tabindex="-1">
<div class="modal-dialog">
<div class="modal-content">
<div class="modal-header">
<button type="button" class="close" data-dismiss="modal">×</button>
<center> <h4 class="blue bigger">Create Event</h4></center>
</div>
<center>
<div id="error-message" class="alert alert-danger col-xs-12" style="display:none; height:10%">
<!-- Place holder for errors -->
</div>
</center>
<div class="modal-body overflow-visible">
<div class="row" style="height:10%">
<div class="col-xs-12"> <!-- Start Col-->
<div class="table-responsive">
<table class="table table-striped table-bordered table-hover">
<tr>
<td class="col-sm-4 control-label no-padding-left">Event Type</td>
<td class="col-sm-8">
<label>
<input id="eventtype" type="radio" name="caltype" value="{{ constant('KonnectEz\\WebBundle\\Common\\CommonConstants::VALUE_FOR_HOLIDAY') }}"/>
<span class="lbl"> Holiday</span>
</label>
<label>
<input id="caltype" type="radio" name="caltype" value="{{ constant('KonnectEz\\WebBundle\\Common\\CommonConstants::VALUE_FOR_EVENT') }}" checked/>
<span class="lbl"> Event</span>
</label>
</td>
</tr>
<tr>
<td class="col-sm-4 control-label no-padding-left">Name</td>
<td class="col-sm-8" ><input id="name" type="text" name="eventname" value="" required /></td>
</tr>
<tr>
<td class="col-sm-4 control-label no-padding-left">Description</td>
<td class="col-sm-8" > <input id="desc" type="text" name="description" value=""/> </td>
</tr>
<tr>
<td class="col-sm-4 control-label no-padding-left">Event Start Date</td>
<td class="col-sm-8"><input id="eventdate" type="text" name="date" value="yyyy-mm-dd" />
</td>
<tr>
<td class="col-sm-4 control-label no-padding-left">Event End Date</td>
<td class="col-sm-8"><input id="edate" type="text" name="eventenddate" value="yyyy-mm-dd" />
</td>
</tr>
<tr>
<td class="col-sm-4 control-label no-padding-left">Event Duration</td>
<td class="col-sm-8">
<div class="checkbox">
<label>
<input id="check" name="agrType-chk" type="checkbox" value="1" />
<span class="lbl"> All Day </span>
</label>
</div>
</td>
</tr>
<tr id="stime">
<td class="col-sm-4 control-label no-padding-left" id="time">Start Time</td>
<td class="col-sm-8" > <input type="text" name="stime" value="08:00" />
</td>
</tr>
<tr id="etime">
<td class="col-sm-4 control-label no-padding-left" id="edtime">End Time</td>
<td class="col-sm-8" id="etime"> <input type="text" name="etime" value="18:00" />
</td>
</tr>
<tr>
<td class="col-sm-4 control-label no-padding-left">Access Type</td>
<td class="col-sm-8">
<label>
<input id="public" name="accesstype" type="radio" value="{{ constant('KonnectEz\\WebBundle\\Common\\CommonConstants::VALUE_FOR_PUBLIC') }}" checked/>
<span class="lbl"> Public </span>
</label>
<label>
<input id="private" name="accesstype" type="radio" value="{{ constant('KonnectEz\\WebBundle\\Common\\CommonConstants::VALUE_FOR_PRIVATE') }}" />
<span class="lbl"> Private </span>
</label>
<label>
<input id="rstrcted" name="accesstype" type="radio" value="{{ constant('KonnectEz\\WebBundle\\Common\\CommonConstants::VALUE_FOR_RESTRICTED') }}" />
<span class="lbl"> Restricted </span>
</label>
</td>
</tr>
<tr id="chose-multi">
<td class="col-sm-4 control-label no-padding-left" >Select A Group:</td>
<td class="col-sm-8" >
{# <div class="row">#}
<div class="space-2"></div>
<select multiple="" class="col-xs-10 col-sm-8" id="selector" name="selector" >
{#<option value="0">Select Group</option>#}
{% for group in groupList %}
<option value="{{group.id}}">{{ group.name }}</option>
{% endfor %}
</select>
{# </div> #}
</td>
</tr>
</table>
</div>
</div>
</div>
</div>
<div class="modal-footer" style="height:10%">
<button id="save" class="btn btn-sm" data-dismiss="modal">
Cancel
</button>
<button class="btn btn-sm btn-primary" id="btnsubsave">
Save
</button>
</div>
</div>
</div>
</div>
But jquery .toggle() is not working properly on alternate times. Can anyone help to solve this problem.
A:
Bring following code out of the function ShowSaveEventForm
$("#check").click(function() {
$("#stime").toggle();
$("#etime").toggle();
});
$("#rstrcted").click(function() {
$("#chose-multi").show();
});
$("#private").click(function() {
$("#chose-multi").hide();
});
$("#public").click(function() {
$("#chose-multi").hide();
});
So it is like following
$(document).ready(function() {
$("#check").click(function() {
$("#stime").toggle();
$("#etime").toggle();
});
$("#rstrcted").click(function() {
$("#chose-multi").show();
});
$("#private").click(function() {
$("#chose-multi").hide();
});
$("#public").click(function() {
$("#chose-multi").hide();
});
function ShowSaveEventForm(start, end, allDay) {
var month = start.getMonth() + 1 + "";
if (month.length == 1) {
month = "0" + month;
}
...
...
|
Q:
Identifying commits that were done on a branch
I have a feature branch - let's call it featureX'
When I'm developing it - I create several commits, send them to the server, test it - several more commits etc...
When later I merge this branch to master - I want to see in the history, which commits were part of this featureX branch before they were committed to master.
Currently my way is to remember to add that to the comment whenever I commit - but I'm lazy and not always remember to do so.
Is there a way to tag these commits, or automatically add to their comments a prefix with the branch name?
I'm using git in Visual Studio, using it's UI
A:
Yes there is a way to automatically add a prefix with the branch name to their comments. It can be acheived using the commit-msg hook. For example, if you write this code into the file .git/hook/commit-msg :
#!/bin/bash
current_branch="$(git rev-parse --abbrev-ref HEAD)"
echo '['"$current_branch"'] '$(cat "$1") > "$1"
All your commit messages will be automatically prefixed with "[branch_name]".
EDIT:
I actually managed to write the same script in for windows
In a file called .git/hooks/commit-msg.bat write this code (which is almost the equivalent of the three lines above):
@echo off
FOR /F "tokens=* USEBACKQ" %%F IN (`git rev-parse --abbrev-ref HEAD`) DO (
SET current_branch=%%F
)
FOR /F "tokens=* USEBACKQ" %%F IN (`type .git\COMMIT_EDITMSG`) DO (
SET commit_msg=%%F
)
SET p_commit_msg=[%current_branch%] %commit_msg%
ECHO %p_commit_msg% > .git\COMMIT_EDITMSG
In the file .git/hooks/commit-msg, call this script like that:
#!/bin/bash
cmd.exe /c "commit-msg.bat"
|
Q:
Given the Following Code how Would i Change/Set my Silverlight WCF Service URI in code?
Given the Following Code how Would i Change/Set my Silverlight WCF Service URI in code?
mySvc.InsertPOCompleted += new EventHandler<SalesSimplicityPO_SL.POSvc.InsertPOCompletedEventArgs>(mySvc_InsertPOCompleted);
mySvc.InsertPOAsync(InitialsTextBox.Text.ToString(), DescTextBox.Text.ToString(), ClientTextBox.Text.ToString());
A:
BasicHttpBinding binding = new BasicHttpBinding();
EndpointAddress address = new EndpointAddress(new Uri("http://localhost/POSystem/POSvc.svc"));
POSvc.POSvcClient mySvc = new POSvc.POSvcClient(binding, address);
|
Learning Redis is an example-based introduction which demonstrates how to work with the data store by creating a playable word game, written in Node.js. Fundamental topics of Redis are covered along the way.
You’ll see how simple it is to install the database on your own machine or use a database provider in the cloud. Together we will discover the basic native data types of Redis and how to use them as we write a real game using JavaScript in a Node.js environment.We’ll store and retrieve data using the Redis CLI and understand the basic NoSQL data keys and storage techniques.
Whether you’re writing a game or any other application, you need a place to store data. Learning Redis will demonstrate why you should implement Redis.
Throughout the course, we will put to use the important concepts of Redis such as keys, values, sets, and hashes, which will help us build a solid application that works on some of the most important app requirements such as information storage, validation, pub/sub, notifications, and sorting.
By the end of the course, you will understand how to make use of all of Redis’ features so you can design applications with rapid, efficiently managed data access.
Who this course is for
This course assumes a working knowledge of JavaScript; experience with Node.js is useful but not necessary. Viewers are not expected to be familiar with Redis, or NoSQL.
What you will learn from this course
Explore Redis commands and make the most of the supplied toolset
Install Redis for use on a machine or on the cloud
Use Redis interactively through its command line interface (CLI)
Efficiently tackle application complexity using Redis data structures
Store, list, and sort data with Redis to help create dynamic applications
Make the most of the Redis data store by developing an exciting word game with Node.js |
Yu Huang, 27
Fashions three-dimensional grids of nanowires that act as electronic circuits
MIT
Chinese-born Yu Huang came to the United States in 1999 to pursue an advanced education in materials science. It didn’t take long, however, before she developed creative new ways to make nanoelectronics. One of her first breakthroughs was a method for controlling the assembly of circuitry made from semiconducing wires less than 100 nanometers in diameter. Huang, who received her PhD in June from Harvard University and is now a Lawrence Livermore fellow at MIT, suspended nanowires made of silicon and other materials in an ethanol solution. She then forced the fluid through tiny channels in a plastic mold, creating parallel nanowire arrays. Using the method, she built nanowire grids that could finction as electronic circuits. She also demonstrated that she could build up layers of arrays, creating three-dimensional circuitry. Huang says her approach, unlike other methods of assembling nanowires, could be scaled up to produce millions of devices at a time. Even though practical products are likely at least a decade away,, several computer chip manufacturers, including Intel, have expressed interest. |
[URL="http://api.tweetmeme.com/share?url=http://espn.go.com/nfl/story/_/id/8611636/darren-mcfadden-mike-goodson-oakland-raiders-play-vs-baltimore-ravens&service=bit.ly&source=espn"][IMG]http://api.tweetmeme.com/imagebutton.gif?url=http://espn.go.com/nfl/story/_/id/8611636/darren-mcfadden-mike-goodson-oakland-raiders-play-vs-baltimore-ravens[/IMG][/URL]The Oakland Raiders will be without their top two running backs for Sunday's game in Baltimore after Darren McFadden and Mike Goodson missed a third consecutive day of practice. |
Ethanol consumption: selective breeding in mice.
From a foundation stock of HS/Ibg mice, mass selection has yielded high-ethanol acceptance (HEA) and low-ethanol acceptance (LEA) lines with distributions which show little overlap in the 10th generation. Divergence has been systematic and the estimate of the realized heritability after 10 generations of selective breeding is 0.21 +/- 0.04. Low to moderate correlations among three methods of measuring alcohol consumption, including the one on which selection was based, were shown in an F2 generation derived from C57BL/Ibg and C3H/Ibg mice. |
1B50-1, a mAb raised against recurrent tumor cells, targets liver tumor-initiating cells by binding to the calcium channel α2δ1 subunit.
The identification and targeted therapy of cells involved in hepatocellular carcinoma (HCC) recurrence remain challenging. Here, we generated a monoclonal antibody against recurrent HCC, 1B50-1, that bound the isoform 5 of the α2δ1 subunit of voltage-gated calcium channels and identified a subset of tumor-initiating cells (TICs) with stem cell-like properties. A surgical margin with cells detected by 1B50-1 predicted rapid recurrence. Furthermore, 1B50-1 had a therapeutic effect on HCC engraftments by eliminating TICs. Finally, α2δ1 knockdown reduced self-renewal and tumor formation capacities and induced apoptosis of TICs, whereas its overexpression led to enhanced sphere formation, which is regulated by calcium influx. Thus, α2δ1 is a functional liver TIC marker, and its inhibitors may serve as potential anti-HCC drugs. |
New video reveals how flies land upside-down
It’s not unusual to see a fly effortlessly stick an upside-down landing on a ceiling, but exactly how they pull off the aerial stunt has eluded scientists for decades. Even modern drones cannot compete with the fly’s sophisticated touchdown tricks. Now, a new study offers the most comprehensive exploration of fly landings to date, revealing agile maneuvers that could one day lead to robotic fliers that mimic the insect’s aerobatic abilities.
In a bid to build machines that could imitate insect movements, Bo Cheng, a mechanical engineer at Pennsylvania State University in State College, started by scouring 50 years of scientific literature for studies involving fly landings. He was surprised that such a common occurrence was so underdocumented. Then he realized why: The flies’ lightning-quick moves during landings aren’t easy to observe.
So, Cheng and colleagues used high-speed video to capture and analyze more than 20 bluebottle flies (Calliphora vomitoria), known for their exquisite maneuvers, sticking their inverted landings in a flight chamber. The flies landed in versatile ways. Some stuck the landing by first planting their forelegs on the surface, then swinging their bodies into place, similar to a back flip (see video, above). Other landings looked more like barrel rolls. After taping 18 perfect landings, the team discovered that flies depend primarily on visual cues to make these maneuvers. When a fly sees that it’s about to collide with a ceiling, for example, it must decide in 50 milliseconds how to turn upside down and grab the ceiling with its feet, Cheng and colleagues write today in Science Advances .
But even nimble flies blunder: The study also describes 15 failed landings, which reveal that the insects need to move in a specific range of motion in less than the blink of a human eye to achieve a perfect landing and avoid colliding with the ceiling.
“This is a really interesting new paper,” says Jessica Fox, a biologist studying insect sensory systems using high-speed video at Case Western Reserve University in Cleveland, Ohio, who was not involved in the study. However, the insects’ landings may have been influenced by the experimental setup, she adds. Flies were stimulated with mechanical vibrations to get them to take off—in an area the size of a small box. If they had more room, and if they weren’t frightened into taking off, they may have chosen easier landings, she says. The study shows “what flies can do at their limits, when they are flying fastest and need to make decisions in the shortest amount of time.”
The flies “are just a starting point” in exploring how they and other flying insects—from mosquitoes to bees—control their complicated maneuvers, says co-author Sanjay Sane, an integrative biologist at the National Centre for Biological Sciences in Bengaluru, India. More studies of this kind will help scientists start to pinpoint the most important shared flight maneuvers across species, he says. And once scientists know more about the processes that control fly landings, Cheng adds, they may discover how to create robots that mimic the flies’ barrel rolls and other fly feats. “Just like children mimic their parents, we can let the fly teach a robot.” |
Junior College
Business
Writing in the Sydney Morning Herald, columnist Paul McGeough lamented that Minneapolis authorities were "not joining the dots" over how Officer Mohamed Noor had come to fire his weapon. Chief Harteau echoed this statement during the press conference, saying that this shooting " should not have happened ", and that Noor's actions went against how officers are trained.
The labor market is near full employment, with the jobless rate at 4.4 percent. Initial claims for state unemployment benefits fell 15,000 to a seasonally adjusted 233,000 for the week ended July 15, the labour department said on Thursday.
Without the Hillsborough deaths the number of homicides rose by 9%. The statisticians at the ONS say that perhaps even more alarming is the fact that these rates are accelerating, with a three percent increase recorded in the year to March 2015, followed by an eight percent rise in the following year, and now a 10 percent increase in the 12 months to March of this year.
The Rotterdam-based Unilever , which employs some 169,000 people around the world, owns more than 400 household brands including Dove, Knorr soups, Lipton, Magnum and Marmite. Premier Foods, whose brands include Ambrosia, Mr Kipling and Oxo, has reported a dip in first-quarter revenues after a combination of warm weather and lacklustre dessert sales dragged on its performance, writes Emma Newlands .
The laptop ban was lifted on Wednesday after overseas airports and airlines satisfied new security screening requirements set by the Department of Homeland Security. And to say the least, it destroyed the airplane. USA -bound travelers from about 300 global airports will now face increased security measures and may be required to present electronic for inspection.
The change in leadership marks the party's third leader in less than three years. His predecessor, Tim Farron, stood down after a disappointing general election in which the party increased its number of MPs from nine to 12 but saw its vote share fall to 7.4%.
Shares of other appliance retailers fell on the news . It's just the latest in a recent pattern of companies' share prices being decimated by relatively benign announcements from Amazon . Sears had said a year ago it was seeking a buyer for its Kenmore name, along with the DieHard battery and Craftsman tool brands. Sears is shedding retail spaces left and right and trying to claw its way back into the consumer appliance space that it once dominated.
Hydro One borrowed $3.4 billion to finance the purchase of Avista that also includes taking on the company's $2.3 billion in USA based debt. No workforce reductions are anticipated as a result of this transaction for either Hydro One or Avista according to a press release.
Red Sparrow is based on a novel about a Russian spy ( Jennifer Lawrence ) who's recruited by the Central Intelligence Agency to be a double agent. The film is based on the novel by former Central Intelligence Agency officer Jason Matthews, in which Putin plays a key role.
Inspired by the social nature of product promotion and discovery, Amazon .com, Inc. If so, you're able to click through and purchase it within the app . The key to the platform is the users. Is Amazon Trying To Revolutionize The Way We Read Product Reviews? Now it wants to turn them into something like "influencers"-those people with hordes of followers that you find on Instagram-promoting the stuff they like". |
Willie Sinclair
William Mearns "Willie" Sinclair (born 14 October 1934 in Coatbridge) is a Scottish former professional footballer who played as a midfielder for Aberdeen, Falkirk, Huddersfield Town, Tranmere Rovers, Halifax Town & Stirling Albion.
In the early 1960s Sinclair moved to Australia where he played for Adelaide Polonia and APIA.
References
External links
Category:1934 births
Category:Living people
Category:Scottish footballers
Category:Association football wingers
Category:English Football League players
Category:Scottish Football League players
Category:Aberdeen F.C. players
Category:Falkirk F.C. players
Category:Huddersfield Town A.F.C. players
Category:Tranmere Rovers F.C. players
Category:Halifax Town A.F.C. players
Category:Stirling Albion F.C. players
Category:People from Coatbridge |
//* This file is part of the MOOSE framework
//* https://www.mooseframework.org
//*
//* All rights reserved, see COPYRIGHT for full restrictions
//* https://github.com/idaholab/moose/blob/master/COPYRIGHT
//*
//* Licensed under LGPL 2.1, please see LICENSE for details
//* https://www.gnu.org/licenses/lgpl-2.1.html
#pragma once
#include "Action.h"
#include <string>
class MeshOnlyAction;
template <>
InputParameters validParams<MeshOnlyAction>();
class MeshOnlyAction : public Action
{
public:
static InputParameters validParams();
MeshOnlyAction(InputParameters params);
virtual void act() override;
};
|
Q:
Showing a function is a metric on $\mathbb{R}^{2}$
Question:
For $x=\left ( x_{1},x_{2} \right ),y=\left ( y_{1},y_{2} \right ) \in \mathbb{R}^{2}$
Define $d\left ( x,y \right )=\max\left \{ \left | x_{1}-y_{1} \right |,\left | x_{2}-y_{2} \right | \right \}$.
Show that $d$ is a metric on $\mathbb{R}^{2}$.
So, I've shown all the axioms except the triangle inequality which apparently is giving me a bit of problem.
Any help is appreciated.
Thanks in advance.
A:
$|x_1 - y_1| \leq |x_1 - z_1| + |z_1 - y_1| \leq d(x,z) + d(z,y),$ and similarly for $|x_2 - y_2|$. Therefore
$d(x,y) = max\{|x_1 - y_1|,|x_2 - y_2| \} \leq d(x,z) + d(y,z)$
|
Q:
std::out_of_range thrown when parsing a text file
I have the following code to read a text file.
const string FILENAME = PACKAGES_DIR + pname;
//the arguments to ifstream is a cstring and hence the conversion must be made
ifstream freader;
freader.open(FILENAME.c_str(),ios::in);
if(freader.is_open())
{
while(freader.good())
{
string line;
getline(freader,line);
cout<<line<<endl;
if(line.find("PackageId:"))
{
cout<<line.substr(11)<<endl;
}
else if(line.find("Name:"))
{
cout<<line.substr(5)<<endl;
}
else if(line.find("Version:"))
{
cout<<line.find(8)<<endl;
}
else
{
cout<<line<<endl;
}
}
}
The contents of the text file in question is
PackageId:994
Name:basket
Version:1.80-1
Deps:kdebase-runtime,libc0.1,libc0.1-udeb,libc6,libc6-udeb,libc6.1,libc6.1-udeb,libgcc1,libgpg-error0,libgpgme11,libkdecore5,libkdeui5,libkfile4,libkio5,libkparts4,libkutils4,libphonon4,libqimageblitz4,libqt4-dbus,libqt4-network,libqt4-qt3support,libqt4-svg,libqt4-xml,libqtcore4,libqtgui4,libstdc++6,libunwind7,libx11-6,phonon
The output that I get is
PackageId:994
geId:994
Name:basket
Version:1.80-1
0-1
Deps:kdebase-runtime,libc0.1,libc0.1-udeb,libc6,libc6-udeb,libc6.1,libc6.1-udeb,libgcc1,libgpg-error0,libgpgme11,libkdecore5,libkdeui5,libkfile4,libkio5,libkparts4,libkutils4,libphonon4,libqimageblitz4,libqt4-dbus,libqt4-network,libqt4-qt3support,libqt4-svg,libqt4-xml,libqtcore4,libqtgui4,libstdc++6,libunwind7,libx11-6,phonon
e-runtime,libc0.1,libc0.1-udeb,libc6,libc6-udeb,libc6.1,libc6.1-udeb,libgcc1,libgpg-error0,libgpgme11,libkdecore5,libkdeui5,libkfile4,libkio5,libkparts4,libkutils4,libphonon4,libqimageblitz4,libqt4-dbus,libqt4-network,libqt4-qt3support,libqt4-svg,libqt4-xml,libqtcore4,libqtgui4,libstdc++6,libunwind7,libx11-6,phonon
terminate called after throwing an instance of 'std::out_of_range'
what(): basic_string::substr
The output that I wanted is:
PackageId:994
994
Name:basket
basket
Version:1.80-1
1.80-1
...
What have I done wrong?
A:
Problem 1
while .good or while !.eof is almost always wrong. Throw away whatever book told you to do that, and do this instead.
In this case, the changed code looks a bit like this:
const string FILENAME = PACKAGES_DIR + pname;
//the arguments to ifstream is a cstring and hence the conversion must be made
ifstream freader(FILENAME.c_str(), ios::in);
if (freader) {
string line;
while (getline(freader,line)) { // <-----
cout << line << endl;
if (line.find("PackageId:"))
cout << line.substr(11) << endl;
else if (line.find("Name:"))
cout << line.substr(5) << endl;
else if (line.find("Version:"))
cout << line.find(8) << endl;
else
cout << line << endl;
}
}
Problem 2
You're not using std::string::find correctly.
line.find("PackageId:") returns either "the position of the first occurrence in the string of the searched content", or the member value npos if the match is not found.
This combined with not performing bounds checks on the first parameter to std::string::substr is causing issues with your strings.
Instead, write:
if (line.find("PackageId:") != std::string::npos)
Problem 3
cout<<line.find(8)<<endl; should say substr, not find.
Your code with some of the above fixed:
const string FILENAME = PACKAGES_DIR + pname;
//the arguments to ifstream is a cstring and hence the conversion must be made
ifstream freader(FILENAME.c_str(), ios::in);
if (freader) {
string line;
while (getline(freader,line)) { // <-----
cout << line << endl;
if (line.find("PackageId:") != std::string::npos && line.size() > 11)
cout << line.substr(11) << endl;
else if (line.find("Name:") != std::string::npos && line.size() > 5)
cout << line.substr(5) << endl;
else if (line.find("Version:") != std::string::npos && line.size() > 8)
cout << line.substr(8) << endl;
else
cout << line << endl;
}
}
|
The Market Crash That Never Came
By Mike McNamee
U.S. and international banking regulators, who seem convinced that mutual funds and their managers could threaten financial stability, have come up with a simple story: fund investors and asset managers “crowd or ‘herd’ into popular asset classes or securities” and thus “magnify market volatility.” And then when markets turn, a fund might have to “liquidate its assets quickly, [which] may impact asset prices and thereby significantly disrupt trading or funding in key markets.”
We have heard this story before. Unfortunately for the regulators’ argument, there’s no historical support for it.
Throughout the 74-year history of modern U.S. mutual funds, the historical evidence is consistent and compelling: stock and bond funds and their investors do not create the kinds of systemic risks that regulators imagine. During even the most turbulent periods in financial markets since World War II, investors have redeemed only modestly from stock and bond funds and funds’ sales of stocks and bonds have accounted for a small fraction of market trading. Those patterns held through 2008—the second-worst year for the U.S. stock markets since 1825—and the bond market turmoil of 2013.
We all understand the appeal of a simple narrative: fund investors panic, markets tank. But financial regulation ought to be based on facts, not stories—and the facts don’t support this tale.
An Old, Old Legend
The misperception that mutual fund investors could cause market crashes has been around for a long time—at least since 1929. The claim made its way into a Time cover story in 1959, when the magazine speculated that “in a failing market, millions of panicky, inexperienced shareholders would redeem their shares, forcing the funds to liquidate huge blocks of stock and collapse the market.” In 1994, economist Henry Kaufman argued that “The technology is in place for a cascade of selling by investors in mutual funds ... excesses originating in the mutual funds area may be the source of an economic shock should an asset price bubble be suddenly burst.”
The latest version of this tale comes from regulators with a bank mindset. The U.S. Treasury’s Office of Financial Research (OFR) hangs its fears about asset management and systemic risk on a hypothesis about “herding” and “fire sales.” The Financial Stability Board (FSB)—composed of financial regulators and central bankers from around the globe—speculates that funds can spread systemic risk through a “market transmission channel” driven by rapid fund redemptions.
It’s notable that this round of speculation is being driven by banking regulators—not by experts on capital markets or securities trading.
Time for Some Facts
ICI has been investigating—and knocking down—this false narrative for at least two decades.
The notion of “herding” is undercut by the very academic research that OFR cites. That research actually concludes that on average there is little evidence of herding among mutual funds, and not enough evidence to conclude that mutual fund trading moves securities prices away from their fundamentals.
The idea of “fire sales” fuelled by fund investors’ massive redemptions also falls short on facts. ICI’s research has looked at every episode of turmoil in the U.S. stock and bond markets since World War II—essentially, the entire history of the modern mutual fund industry in America. It shows that flows out of stock and bond funds are small relative to funds’ assets even when markets are falling sharply.
For example, when the S&P 500 Index fell by 42 percent in 1973-74, the cumulative outflow from stock funds over those two years was just 5.8 percent of assets. In October 1987, when the S&P 500 lost 22 percent in one month, stock fund investors pulled out just 3.2 percent of assets. From October 2007 to February 2009—when the S&P 500 was cut by more than half—outflows from stock funds totaled 3.6 percent of assets. And while the dot.com bubble was deflating in 2000–2001, investors actually put more money into stock funds.
The data for bond funds is similar. For example, when long-term bond interest rates spiked by more than 1 percentage point in May and June 2013, the cumulative outflow from bond mutual funds totaled only 3 percent of assets. Notably, the outflows from bond funds followed—and did not precede—declines in bond returns.
Fund Flows Aren’t Likely to Drive Asset Prices
Could industry-wide flow figures be masking destabilizing gyrations in individual funds? The data don’t support that story, either. ICI charted monthly flows as a share of assets for every stock and bond fund with at least $10 million in assets from 1985 through 2013, comparing the distribution of flows during turbulent markets with the normal pattern for the entire period. The result: some funds did experience slightly larger-than-normal outflows during periods of market stress, but there were no spikes in the number of funds with large outflows. For more information, see the chart below.
Market Crises Have Not Spurred Large-Scale Flight from U.S. Equity Mutual Funds*Distribution of monthly flows as a percentage of total number of funds
*Net percentage flow is calculated as U.S. mutual fund net new cash flow as a percentage of previous period U.S. total net assets.
Note: Data exclude funds with less than $10 million in average assets.
Source: Investment Company Institute
Clearly, fund investors don’t panic when markets hit turbulence. And funds’ sales of stocks and bonds aren’t likely to drive asset prices. Over the last decade, stock mutual funds have held roughly one-quarter of the value of all U.S. corporate equity—but U.S. domestic equity stock funds’ stock sales accounted on average for less than 10 percent of the trading on the New York Stock Exchange and NASDAQ markets. Similarly, since 2002, bond mutual funds’ trading never exceeded 10 percent of overall trading.
Why So Stable?
Why aren’t fund investors panicky, hair-triggered, and flighty?
The main reason: stock and bond mutual funds are overwhelmingly held by households—and those individual investors tend to take the long view. Of the $12.3 trillion in assets in stock, bond, and hybrid funds at year-end 2013, 95 percent were held by households.
More than 90 million Americans own mutual funds—and surveys show that virtually all of them say that saving for retirement is one of their goals. In fact, about three-quarters of fund owners indicate that retirement savings is their primary financial goal. That’s reflected by the fact that half of stock and bond fund assets are held through defined contribution retirement plans—such as 401(k) plans—or individual retirement accounts (IRAs).
As for the other half—80 percent of individuals who own funds outside of retirement accounts rely upon professional financial advisers. Such advisers help investors stay focused on their long-term goals and asset allocation at times when markets are in turmoil. And in a diverse group of 90 million people, it’s inevitable that when some pull back from stocks or bonds, others will see buying opportunities and plunge in.
What Crash?
It’s been at least 85 years since market pundits first speculated about a destabilizing market crash led by stock and bond mutual fund investors—yet it hasn’t happened.
Actual data provide positive, compelling evidence that stock and bond mutual funds, and their investors, do not threaten financial stability. And the character of fund investors—individuals focused on retirement and other long-term goals—is one of the important reasons why funds don’t play that role.
Regulators have the data they need to put this legend to rest, once and for all.
For more information on ICI's views and research on financial stability, please visit our Financial Stability Resource Center or read the other entries in this Viewpoints series: |
Screen Name
The email address/password you submitted is wrong or could not be found. Please try again. If you are not a member of the FIFA.com Club, please register first.
The email address/password you submitted is wrong or could not be found. Please try again. If you are not a member of the FIFA.com Club, please register first.
This Facebook account is already present
Your Club account has been locked due to a breach of our Terms of Service. Please set up a new account in line with the Club rules. Review the Club Rules. Alternatively, you can email us by completing our contact form.
Please enter a valid email address
The email address/password you submitted is wrong or could not be found. Please try again. If you are not a member of the FIFA.com Club, please register first.
Happy birthday to you!
In our regular Sunday feature, FIFA.com presents you with some of the biggest names in football who will be celebrating their birthdays over the coming week.
11. Philipp Lahm (29) had the honour of wearing the captain’s armband for Germany at the 2010 FIFA World Cup South Africa™ and at UEFA EURO 2012. A first-choice for his country to this day, he helped Die Nationalelf to finish third at the last two FIFA World Cups and second at EURO 2008, his third participation in the continental tournament. But it is with Bayern Munich that the versatile defender has enjoyed the greatest success, coming through the ranks to become a stalwart of the Bavarian team’s back line. After a two-year loan spell at Stuttgart, Lahm has thus far won four Bundesliga titles, four German Cups, two German Super Cups and one German League Cup in Munich, but his experiences in the UEFA Champions League have been less gratifying, as he has ended on the losing side in two recent finals.
12. Dario Simic (37) wrote his name into the history of Croatian football by propelling his country to the FIFA World Cup for the very first time, at France 1998, where they claimed an impressive third place. He subsequently skippered the Balkan nation at Korea/Japan 2002 and Germany 2006. The adaptable defender also took part in Croatia’s maiden UEFA European Championship adventure in 1996, as well as in the 2004 and 2008 editions. Simic started out at Dinamo Zagreb, where he secured five league titles, four Croatian Cups and a Croatian Super Cup, before exporting his talents to Inter Milan. Three seasons down the line, he signed for city rivals AC Milan, with whom he earned winners’ medals in Serie A, the Coppa Italia, the Supercoppa Italiana, the UEFA Champions League (twice), the UEFA Super Cup and the FIFA Club World Cup. After enjoying a stint in Monaco, he brought his career full circle by returning to Dinamo Zagreb.
13. Jose Manuel de la Torre (47) carries the hopes of an expectant Mexican nation on his shoulders, following his appointment as national coach in the aftermath of the 2010 FIFA World Cup South Africa. His efforts have already borne fruit, with El Tri confidently capturing the CONCACAF Gold Cup in 2011. De la Torre possesses a remarkable coaching CV, having guided teams to three Mexican championships, once at Guadalajara and twice at Toluca. As a player, he appeared at the 1985 FIFA U-20 World Cup and defended the colours of numerous Mexican sides, including Guadalajara, Cruz Azul and Necaxa, as well as Spanish outfit Real Oviedo.
14. Thomas Vermaelen (27) is currently one of Belgium’s top defenders, and will form part of his country’s last line of defence as they look to make a triumphant return to the FIFA World Cup in 2014. As a young man, the imposing centre-back played at the UEFA European U-21 Championship and at the Olympic Football Tournament at Beijing 2008. A product of Ajax’s renowned youth academy, it was with the Amsterdam club that he first experienced tangible success, winning the Dutch League, Cup (twice) and Super Cup (also twice). Vermaelen’s fine performances saw Arsenal move to procure his services in the summer of 2009, now establishing himself to such a degree he his been granted the captain's armband.
15. John Heitinga (29) is one of the key components of the Netherlands’ rearguard, distinguishing himself at Germany 2006 and South Africa 2010, where he entertained hopes of lifting the FIFA World Cup before having to settle for second place. In addition, he represented his country at the last three European Championships and appeared at the 2001 FIFA U-20 World Cup earlier in his career. Heitinga rose to prominence at Ajax, where he won three Dutch league winners’ medals, lifted the Dutch Cup and Dutch Super Cup on seven occasions in total, and earned the title of Dutch Footballer of the Year in 2008. After a stint at Atletico Madrid, he put pen to paper with Everton, the club at which he has spent the past three seasons.
16. Paul Scholes (38) is a living legend at Old Trafford, where he has spent the best part of 20 years defending the colours of Manchester United. After having initially announced his retirement last year, he reversed his decision to help out the club during an injury crisis. The Red Devils midfielder has attained ten English league championships, three FA Cups, two English League Cups, five Community Shields, two UEFA Champions League titles, an Intercontinental Cup and a FIFA Club World Cup. On the international stage, he turned out for England at two FIFA World Cups, France 1998 and Korea/Japan 2002, and two European Championships, Belgium/Netherlands 2000 and Portugal 2004. While a youth player, Scholes triumphed at the UEFA European U-18 Championship in 1993.
17. Gabriel (32) will be aiming to celebrate his birthday in style by hoisting the FIFA Futsal World Cup 2012 with Brazil, a victory that would represent a second successive triumph at this level for him and for his nation alike. |
Hepatic resection for tumours in cirrhotic livers.
A liver resection was performed in 25 out of 36 cirrhotic patients operated on for liver cell carcinomas. In the remaining 11 cases hepatectomy was not performed mainly because of the presence of other intrahepatic neoplastic nodules or thrombi in the portal branches revealed by intraoperative echography. The operative mortality in the 25 patients operated on was 16%; the actuarial survival at three years is 58%. Liver resection was carried out using a transparenchymal procedure; in 18 cases clamping of the hepatic pedicle was performed for an average period of 15 min. Twenty patients with small tumours had a segmentary or sub-segmentary resection; intraoperative echography proved indispensable in this situation, making it possible to recognize the lesion and outline the limits of the resection. The presence of a peritumoral capsule seems to have been an important prognostic factor. |
Thanks! It's actually the Van Storme vampire by reaper. Swapped the head, mechanical foot, and replaced the cup of blood in the left hand with the a staff, which still needs a cap piece of some kind. Still have some greenstuff work to do tying nico's collar into the vampire's cloak. |
6 So.3d 348 (2009)
Greg Thomas LAFLEUR
v.
James Orville BLUE, et al.
No. CA 08-1147.
Court of Appeal of Louisiana, Third Circuit.
March 4, 2009.
*349 Stanford B. Gauthier, II, Jonathan D. Mayeux, Kristi Husher Oubre, Nicole LaBorde Romero, Lafayette, LA, for Plaintiff/Appellant, Greg Thomas Lafleur.
Barry J. Heinen, Lafayette, LA, for Defendant/Appellee, Michael J. Breaux & Associates, Inc.
Jeffrey Ackermann, Durio, McGoffin, Stagg & Ackermann, Lafayette, LA, for Defendants/Appellees, James Orville Blue, Earline Bourque Blue.
John Stafford Irion, Jr., Lafayette, LA, for Defendants/Appellees, John Raymond Johnson Managing Investments, Inc.
Lawrence Charles Billeaud, Lafayette, LA, for Defendant/Appellee, Craig Spikes.
Jeremy A. Hebert, Richard L. Becker, Marcus L. Fontenot, Becker & Associates, Lafayette, LA, for Defendant/Appellee, Lafayette Consolidated Government.
Court composed of MARC T. AMY, BILLY HOWARD EZELL, and JAMES T. GENOVESE, Judges.
*350 EZELL, Judge.
Greg Thomas Lafleur appeals a trial court judgment which granted an exception of prescription in favor of the Lafayette Consolidated Government (LCG). Mr. Lafleur filed suit against the LCG for negligently approving a plat when the FEMA map clearly indicates that Lot 3 was situated in a floodway.
FACTS
On September 30, 1997, John Raymond Johnson and his wife purchased land located in Lafayette Parish. Subsequently, Mr. Johnson incorporated Managing Investments, Inc. (MII) in order to develop and market the land as a residential subdivision. At the end of 1997, MII engaged Craig Spikes to survey the land for the purpose of subdividing the land into four lots. Mr. Spikes prepared a plat which he dated January 20, 1998. The plat indicated that the property was located in flood zone AE. The plat was approved by the Lafayette Planning and Zoning Commission and was filed in the clerk's office on January 26, 1998.
In 2000, James and Earline Blue bought Lot 3 of the development. On October 24, 2003, the Plaintiff, Greg Thomas Lafleur, bought Lot 3 from the Blues. At the hearing, Mr. Lafleur testified that he bought Lot 3 to eventually build a house on.
Approximately six months after Mr. Lafleur purchased the lot, he applied for and received a permit to place culverts in the ditches on the two sides of his property. In September 2006, he decided to sell the property. In checking on the possibility of building a house on the property, potential buyers made inquiries about the property and discovered that part of the lot was in a floodway. The buyer decided not to buy the lot.
Mr. Lafleur then did an investigation on his own. He found out that about half of the property is located in a floodway, and, in order for him to obtain a residential building permit, he would have to obtain a no-rise certificate from an engineer. This is a certificate from a licensed engineer certifying that construction on the property located in the floodway would not obstruct the flow of waters through the floodway. Mr. Lafleur testified that he was told a survey for a no-rise certificate could cost $20,000.
On May 7, 2007, Mr. Lafleur filed suit against the Blues, the LCG, and Michael J. Breaux & Associates, Inc., the company that LaFleur hired to conduct a stakeout of the lot corners and complete an elevation certificate. In addition to claiming a redhibitory defect, he alleged that the LCG negligently approved the plat as there is no floodway indicated on the plat. On March 10, 2008, the Blues filed a third-party demand against MII and Mr. Johnson. In turn, on April 21, 2008, MII and Mr. Johnson filed a third-party demand against Mr. Spikes and the LCG.
Both the LCG and Mr. Spikes filed exceptions. A hearing on the exceptions was held on May 27, 2008. The trial court overruled the exceptions of no cause of action filed by both the LCG and Mr. Spikes. The trial court then granted an exception of prescription filed by the LCG and also granted an exception of no right of action raised by Mr. Spikes. Judgment was signed on May 27, 2008, and Mr. Lafleur appealed the judgment.
DISCUSSION
Mr. Lafleur claims the trial court erred in granting the LCG's exception of prescription. He argues that he filed a timely suit from the time he knew that his property was located in a floodway.
*351 "Delictual actions are subject to a liberative prescription of one year." La.Civ. Code art. 3492. The one-year prescriptive period for damage to immovable property begins to run "from the day the owner of the immovable acquired, or should have acquired, knowledge of the damage." La. Civ.Code art. 3493.
Ordinarily, the burden of proof is on the party pleading prescription. Petry v. Hebert, 06-1447 (La.App. 3 Cir. 5/2/07), 957 So.2d 286. However, when the plaintiff's petition has clearly prescribed on its face, the burden then shifts to the plaintiff to prove that prescription has been suspended or interrupted. Id.
The suit was filed nine years after the plat was approved by the LCG and threeand-one-half years after Mr. Lafleur purchased the property. Mr. Lafleur argues that his claim has not prescribed because he did not find out that Lot 3 was situated in a floodway until September 7, 2007, when he was informed that Lot 3 was in a floodway by potential buyers. He claims that the trial court ignored the LCG's duty to indicate a floodway on the plat. He argues that the doctrine of contra non valentum suspended the running of prescription because he had no knowledge that part of his land was situated in a floodway until he was informed of this fact by the potential buyers of the property.
There are four jurisprudentially-created circumstances that halt the running of prescription under the doctrine of contra non valentum:
1. When there is some legal cause that has prevented the courts from taking cognizance of or acting on the plaintiff's actions;
2. Where there is some condition of the contract or connected to the proceedings which prevented the creditor from acting;
3. When the defendant has prevented the plaintiff from bringing suit; and
4. When the plaintiff does not know nor reasonably know, even though his ignorance is not induced by the defendant.
Carter v. Haygood, 04-646 (La.1/19/05), 892 So.2d 1261, 1268; Stevens v. Bruce, 04-133 (La.App. 3 Cir. 6/2/04), 878 So.2d 734. In the present case Mr. Lafleur has alleged a claim that falls under the fourth category, which has become known as the "discovery rule."
A plaintiff need not have actual knowledge of the conditions which might entitle him to bring suit, but only "constructive notice." As a general rule, prescription begins to run from the time there is notice enough to call for inquiry about a claim, not from the time when the inquiry reveals facts or evidence sufficient to prove the claim. However, a plaintiff will be deemed to know what he could have learned by reasonable diligence, and contra non valentum will not apply to except the plaintiff's claim from the running of prescription if his ignorance is attributable to his own willfulness or neglect.
Terrel v. Perkins, 96-2629, pp. 5-6 (La. App. 1 Cir. 11/7/97), 704 So.2d 35, 39 (citations omitted).
Louisiana Revised Statutes 33:5051 provides for the procedures in platting land. Section B specifically sets forth the items that the plat shall contain. There is no requirement that the plat contain any information about a floodway. Louisiana Revised Statutes 33:113 provides for the approval of the plat by the planning commission and does not contain any requirement that a floodway be listed on the plat.
Mr. Lafleur has cited no authority that the LCG was required to indicate on the plat that a portion of Lot 3 was in a *352 floodway. A review of the arguments at the hearing indicates that there was no requirement at the time the plat was recorded that the fact that land is located in a floodway be included on the plat.
Furthermore, the plat does indicate that the property is located in flood zone AE. This information should have alerted Mr. Lafleur, and he should have researched the issue a little more. With some investigation before they bought the land, the potential buyers of his property were able to find out that the property was located in a floodway. Mr. Lafleur could have done likewise.
We agree with the trial court that Mr. Lafleur's action against the LCG has prescribed. No authority is cited that the LCG was required to indicate that a portion of Lot 3 was in a floodway. Mr. Lafleur was on notice that the property was in a flood zone. Further investigation by Mr. Lafleur would have revealed that it was in a floodway when he bought the property. Therefore, the trial court was correct in granting LCG's exception of prescription.
We also note that a brief was filed on behalf of Mr. Spikes arguing that his dismissal on an exception of no right of action was proper and raising the issue that the trial court committed manifest error in denying his exception of no cause of action. We first note that neither Mr. Lafleur, nor anyone else, has appealed the decision of the trial court to granting the exception of no right of action in favor of Mr. Spikes, so that judgment is final. Also, Mr. Spikes did not file an appeal nor answer Mr. Lafleur's appeal, so he cannot seek relief in the appellate court. La.Code Civ.P. art. 2133. Therefore, it is not necessary for us to address the issues raised by Mr. Spikes.
For the reasons set forth in this opinion, the judgment of the trial court is affirmed. Costs of this appeal are assessed to Greg Thomas Lafleur.
AFFIRMED.
|
31 F.Supp.2d 545 (1998)
Barbara VANCE, Plaintiff,
v.
NORTH PANOLA SCHOOL DISTRICT, Vernon Jackson, and W. Ray Strebeck, Defendants.
No. 2:96-CV-211-B-B.
United States District Court, N.D. Mississippi, Western Division.
October 9, 1998.
*546 Michael James Brown, Jackson, MS, for Plaintiff.
Timothy M. Threadgill, Mitchell, McNutt, Threadgill, Smith & Sams, Oxford, MS, for Defendants North Panola School Dist., Vernon Jackson, W. Ray Strebeck.
T. Hunt Cole, Jr., Mississippi Atty. Gen.'s Office, Jackson, MS, for Defendant State Dept. of Educ.
MEMORANDUM OPINION
BIGGERS, Chief Judge.
This cause comes before the court upon the defendants' motion for summary judgment. Upon due consideration of the parties' memoranda and exhibits, the court is ready to rule.
FACTS
The plaintiff is a white female who was hired by the North Panola School District in April of 1990. In May of 1994 she became the business manager of the school district. The plaintiff did not have a written contract of employment. During the time of the plaintiff's employment, the financial condition of the school district worsened sharply. Vernon Jackson, as superintendent of the school district, sent a letter to the plaintiff dated February 1, 1996, detailing the plaintiff's deficiencies and notifying her that her performance must improve. According to Jackson and to the plaintiff's deposition testimony, she did not respond to the letter. The plaintiff now contends in her brief that she did respond and she provides a copy of her response as an exhibit.
On March 7, 1996, the school board met, presumably for the sole purpose of discussing Vance's employment. On recommendation of Jackson, the board voted to discharge the plaintiff for the reasons set forth in the February 1 letter. The termination was to take effect March 8, the same date that the State of Mississippi took control of the North Panola School District and placed it under the conservatorship of Ray Strebeck. After receiving notice of her termination, the plaintiff met with Strebeck and R.D. Harris, deputy state superintendent of education, to ask about getting her job back. The plaintiff states that Strebeck told her she might be able to get her job back but that the local black community would have to be consulted.[1] Strebeck denies making such a statement. He claims that he simply told the plaintiff she could apply for the vacant position like anyone else. The plaintiff never did apply for the position and Strebeck hired a black male to take her place.
The plaintiff claims that her termination was part of a scheme headed by Lieutenant Governor Ronnie Musgrove to incur favor with the black voters of Panola County. The plaintiff asserts that she was notified of this alleged scheme by Donna Davis, a member of the State Board of Education. Davis, however, denies having any knowledge of the basis for plaintiff's termination.
The plaintiff filed suit for racial discrimination under Title VII of the Civil Rights Act of 1964 and 42 U.S.C. § 1983. The plaintiff also asserted a claim for overtime pay under the Fair Labor Standards Act; however, the plaintiff has conceded her overtime claim in response to the defendants' motion for summary judgment.
LAW
On a motion for summary judgment, the movant has the initial burden of showing the absence of a genuine issue of material fact. Celotex Corp. v. Catrett, 477 U.S. 317, 325, 106 S.Ct. 2548, 91 L.Ed.2d 265, 275 (1986) ("the burden on the moving party may be discharged by `showing'... that there is an absence of evidence to support the non-moving party's case"). Under Rule 56(e) of the Federal Rules of Civil Procedure, the burden *547 shifts to the non-movant to "go beyond the pleadings and by ... affidavits, or by the `depositions, answers to interrogatories, and admissions on file,' designate `specific facts showing that there is a genuine issue for trial.'" Celotex Corp., 477 U.S. at 324, 91 L.Ed.2d at 274. That burden is not discharged by "mere allegations or denials." Fed.R.Civ.P. 56(e). All legitimate factual inferences must be made in favor of the non-movant. Anderson v. Liberty Lobby, Inc., 477 U.S. 242, 255, 106 S.Ct. 2505, 91 L.Ed.2d 202, 216 (1986). Rule 56(c) mandates the entry of summary judgment "against a party who fails to make a showing sufficient to establish the existence of an element essential to that party's case, and on which that party will bear the burden of proof at trial." Celotex Corp., 477 U.S. at 322, 91 L.Ed.2d at 273. Before finding that no genuine issue for trial exists, the court must first be satisfied that no reasonable trier of fact could find for the non-movant. Matsushita Elec. Indus. v. Zenith Radio Corp., 475 U.S. 574, 587, 106 S.Ct. 1348, 89 L.Ed.2d 538, 552 (1986).
The plaintiff's claim for racial discrimination could possibly arise out of either her termination or her failure to be rehired. To present a prima facie case of race discrimination under Title VII, the plaintiff may show: (1) that she was a member of a protected class; (2) that she was qualified for the position held; (3) that she was subject to an adverse employment decision; and (4) that she was replaced by someone outside of the subject classification. Meinecke v. H & R Block, 66 F.3d 77, 83 (5th Cir.1995); Marks v. Prattco, Inc., 607 F.2d 1153, 1155 (5th Cir.1979). A plaintiff may always present a prima facie case by offering direct evidence of discrimination, in which case the four-part test developed for circumstantial evidence is unnecessary. Lee v. Russell County Bd. of Educ., 684 F.2d 769, 774 (11th Cir.1982). Once the plaintiff presents a prima facie case, the defendant must articulate a legitimate, non-discriminatory reason for the employment action. McDonnell-Douglas Corp. v. Green, 411 U.S. 792, 802-805, 93 S.Ct. 1817, 36 L.Ed.2d 668, 677-679 (1973). If the defendant is able to do so, the burden of production shifts back to the plaintiff to produce evidence that the defendant's articulated reason is merely a pretext for discrimination. Id.
The defendants assert that, even assuming the plaintiff has made the initial prima facie showing, they have articulated a legitimate, non-discriminatory reason for the plaintiff's discharge, that being the plaintiff's poor work performance as set forth in the letter of February 1 from Jackson to the plaintiff. The defendants contend that the plaintiff has failed to show that the defendants' articulated reason is really a pretext for discrimination. The plaintiff argues that the statements of Davis and Strebeck provide sufficient evidence of pretext to avoid summary judgment. The court disagrees. Davis' statement regarding the alleged political conspiracy is hearsay and is therefore inadmissible to defeat summary judgment. Furthermore, even if the court were to consider Davis' alleged comments, they would not be sufficient to show pretext as Davis' alleged statements about the political conspiracy merely reveal Davis' own speculative conclusions. Since Davis was not responsible for the decision to terminate the plaintiff, her conclusion as to the reasons for the termination are irrelevant. Strebeck's statement regarding needing the approval of the black community before he could rehire the plaintiff is likewise irrelevant as to the issue of the plaintiff's termination. Neither he nor Harris (who the statement is also attributed to) had any input in the decision to terminate the plaintiff. Accordingly, in the absence of any evidence that the defendants' articulated reason for termination is a pretext for discrimination, the court finds that the plaintiff's claim for racial discrimination in her termination should be dismissed.
To establish a prima facie case on the issue of failure to rehire,[2] the plaintiff *548 must show that she applied for a job for which the employer was seeking applicants. McDonnell-Douglas, 411 U.S. at 802, 93 S.Ct. 1817, 36 L.Ed.2d at 677. The plaintiff did not apply for the vacant position, and therefore cannot assert a prima facie case. Since the plaintiff did not apply for the position, any "evidence" of discrimination is irrelevant.
Finally, the plaintiff contends that the defendants violated her due process rights under the Fourteenth Amendment by not giving her notice of the right to appeal her termination. However, a protected property interest must be based upon a legitimate claim to continued employment under a source independent of the Fourteenth Amendment. McMillian v. City of Hazlehurst, 620 F.2d 484, 485 (5th Cir.1980). If, under state law, the employee serves "at-will", she has no such protected property interest. Id. The plaintiff, having no contract of employment, was employed at-will, and therefore had no claim to continued employment which could give rise to the allegedly infringed due process rights. The plaintiff asserts that the School Employment Procedures Law, codified at Miss.Code Ann. § 37-9-101, provides certain rights to employees required to have a valid certificate issued by the State Department of Education. The plaintiff claims application of the statute by virtue of the fact that she was a "Certified School Business Officer." However, as this court previously noted in Beasley v. Grenada, Mississippi, Municipal Separate Sch. Dist., Civil Action No. WC88-103-B-D (unpublished opinion), the School Employment Procedures Law confers rights only upon a certain class of educators, including teachers, principals and superintendents. Miss.Code Ann. § 37-9-105. Members of the support staff of the school district who are not part of the instructional personnel do not fall within the scope of the Act. Accordingly, the plaintiff may not assert due process rights through the School Employment Procedures Law.
CONCLUSION
For the foregoing reasons, the court finds that the defendants' motion for summary judgment should be granted. An order will issue accordingly.
NOTES
[1] The plaintiff's brief and affidavit attribute this statement to Strebeck, though the plaintiff's deposition testimony credits Harris with making the statement. The court will simply refer to the statement as Strebeck's, though for purposes of summary judgment it makes no difference which one actually made the alleged comment.
[2] The court is unfamiliar with an action for failure to "rehire." The court's initial reaction is that any failure to rehire is simply a part of the claim for wrongful termination and not a separate action. Accordingly, any claim the plaintiff is attempting to assert should be dismissed for the reasons set forth herein. However, to the extent the plaintiff is attempting to allege a separate cause of action, the court will analyze this case under the standards for the typical "failure to hire" type of racial discrimination.
|
Q:
Add brackets to string in data frame
I've got this data frame called df:
ColumnA ColumnB
String1 A
String2 A
String3 B
String4 A
... ...
Every string in ColumnA have different lenght. I want to put values from ColumnA in brackets if value in ColumnB == A in the same row. If the value in ColumnB == B I want to add square brackets instead. So it will looks like:
ColumnA ColumnB
(String1) A
(String2) A
[String3] B
(String4) A
... ...
What's the best way to achive that?
A:
You can use ifelse
df1$ColumnA <- with(df1, ifelse(ColumnB == "A", paste0("(", ColumnA, ")"),
paste0("[", ColumnA, "]")))
> df1$ColumnA
#[1] "(String1)" "(String2)" "[String3]" "(String4)"
Or if there are values other than A and B in ColumnB, you can use multiple ifelse
df1$ColumnA <- with(df1, ifelse(ColumnB == "A", paste0("(", ColumnA, ")"),
ifelse(ColumnB == "B", paste0("[", ColumnA, "]"), ColumnA)))
> df1$ColumnA
#[1] "(String1)" "(String2)" "[String3]" "(String4)"
|
News
Zarzuela is the best way to appreciate Spain. “Evening of Spanish Zarzuela at Philharmonic” concert takes place in Kyiv
Kyiv, February 1, 2016. “Zarzuela is more than a Spanish operetta, it’s a style of music closely connected with the culture and traditions of Spain. I believe it’s the best way to appreciate Spain, said Gerardo Ángel Bugallo Ottone, Spanish Ambassador to Ukraine, presenting the “Evening of Spanish Zarzuela at Philharmonic” concert at Ukraine Crisis Media Center. The concert will take place on February 5 at 7:00 p.m. at the National Philharmonic Hall of Ukraine in Kyiv. This musical form was especially popular in the late XIX – early XX century. Zarzuela combines the sensuality and spirit of the Spanish nation, said the ambassador.
Jose Hernandez, deputy director for international relations, National Philharmonic of Ukraine, said that instrumental pieces, arias and duets from the most popular Spanish zarzuelas will be the centerpiece of the program. The first part will feature the theme of Spain in the music of European composers, such as arias and duets from the world famous Carmen opera. “This will be a top-level, purely Spanish night. Culture and arts will certainly bond our nations,” said Hernandez. According to the Spanish tenor Israel Lozano, zarzuela straddles numerous styles. “It is popular music, but it comprises elements of opera,” said the tenor. It is Lozano’s second visit to Ukraine, and being an artist, he is sensible of responsibility before the audience, as “music is a universal language”. He expressed his support to Ukraine in difficult times and appealed for support for music and arts in general. Lozano commented Ukrainian culture and music are beautiful. “Material things disappear, but culture, tradition, language, values and classic art are education for the generations to come, so they are worth supporting,” said the tenor. Maestro Ricardo Casero, symphonic orchestra director, said that the concert in Kyiv will be a splendid experience for him, for this music is more complicated than it seems at first sight. “I agreed to come to Ukraine to express my support. You continue organizing top-level concerts, which is a wonderful decision,” said Casero.
Olha Chubareva, a soprano, a principal performer of the National Philharmonic of Ukraine, said she had been working with Spanish musicians for a year now. This is her first experience of performing zarzuela. “Zarzuela is quite difficult to perform, but it’s extremely emotional, which suits my spirit,” said the singer. She plans to add zarzuela pieces to her repertoire and make this music popular in our country. “This concert on February 5 will start promoting Spanish zarzuela in Ukraine,” she believes. According to Chubareva, sometimes music can say more than politicians. Moreover, it is a unique possibility of cooperation not only for the musicians themselves, but for agencies too, said Tamara Zavala Utrillas, Counselor on cultural issues of the Spanish Embassy. She emphasized that cultural exchange between countries is extremely important.
“We brought zarzuela here, for we want to help bring the situation in Ukraine back to normal. We want everyone to admit that Ukraine is a beautiful European country and it may live a normal European life. It is exactly what is going to happen in this country in future, for the people have already chosen their way,” summarized the Spanish ambassador.
Share
Topic: "How to prevent the State Bureau of Investigation from turning into the ‘club of downed pilots’"
Mustafa Nayem, Member of Parliament of Ukraine (Faction "Petro Poroshenko Bloc")
Volodymyr Petrakovskyi, Advisor to the StateWatch expert organization, member of the Scientific Advisory Board under the State Bureau of Investigation
Kateryna Butko, activist of the All-Ukrainian NGO "Avtomaidan", PROSUD Project Coordinator
UCMC press center is a platform that allows civic activists, experts, politicians, authorities, diplomats and members of international community to conduct briefings regarding events and processes taking place in Ukraine.
NGO Ukraine Crisis Media Center has no effect on media content produced during events at the UCMC press center, provides no guarantees and will not be liable for the content of information distributed by participants during the events held at the UCMC press center, including, but not limited to the participants distributing unreliable, untruthful, incomplete, inaccurate, invalid information during UCMC press center’s events or expressing their personal opinion. Furthermore, UCMC will not be liable for any damage resulting from such distribution or related to it or losses incurred by third parties. |
The study of a chemiluminescence immunoassay using the peroxyoxalate chemiluminescent reaction and its application.
The paper presented a novel chemiluminescence (CL) immunoassay method, which combines the advantages of traditional enzyme-linked immunosorbent assays (ELISA) and bis (2,4,6-trichlorophenyl) oxalate (TCPO)-hydrogen peroxide CL detection system. A fluorescent product 2,3-diaminophenazine (DAPN) was produced by reaction between o-phenylenediamine (OPDA, 1,2-diaminobenzene) and H(2)O(2) catalyzed by horseradish peroxidase (HRP). DAPN was excited by the reactive intermediate of TCPO-H(2)O(2) chemiluminescent reaction, and led to CL. The dependence of the CL intensity on the concentrations of antigen was studied. As analytical application, the proposed method was used for determination of recombinant human interleukin 6 (rHu IL-6) and beta-human chorionic gonadotropin (beta-HCG). Under the selected experimental conditions, a linear relationship was obtained between the CL intensity and the concentration of rHu IL-6 in the range of 4.0-625.0pg/ml, and beta-HCG in the range of 12.5-400.0mIU/ml. The detection limits were 0.5pg/ml for rHu IL-6 and 3mIU/ml for beta-HCG with relative standard deviation of 2.3 for 78.0pg/ml rHu IL-6, and 3.9 for 50.0mIU/ml beta-HCG. This method has been applied to the determination of rHu IL-6 in human serum and beta-HCG in urine with satisfactory results. |
A modified approach to horizontal augmention of soft tissue around the implant: omega roll envelope flap. Description of surgical technique.
The flap's design, as applied to implant surgery procedures for implant-prosthetic therapy, takes inspiration from the roll technique of Abrams (1980) and subsequent modifications. This article describes a modified flap design for the correction of horizontal alveolar mucosa defects in implant-supported rehabilitation with one-stage and two-stage approache. The omega roll envelope flap (OREF) is a roll flap combined with a modified pouch technique. The goal of this type of flap design is to correct localized horizontal alveolar ridge defects and augment peri-implant soft tissue thickness. OREF is a flap technique that avoids harvesting autologous connective tissue from another donor site by using the supracrestal connective tissue of the implant surgical site. The proposed technique allows for increased horizontal buccal soft tissue thickness during implant-prosthetic rehabilitation. The OREF technique is practical for one- and two-stage implant approaches, and when it is applied with an immediate non-functional loading procedure, this technique can optimize surgical and prosthesis chair times. This technique has shown advantages as maximizes the amount of connective tissue that can be rolled within the buccal flap. The OREF technique can be applied with a one-technique can be applied with a one-stage or two-stage implant-prosthetic approach. |
How I do it: Endoscopic diagnosis for superficial non-ampullary duodenal epithelial tumors.
There are no reports on detailed endoscopic diagnosis of superficial non-ampullary duodenal epithelial tumors (SNADET) except for relatively small case series. Herein, we conducted a prospective observational study to investigate the relationship between endoscopic findings and histopathological diagnosis of SNADET. A total of 163 SNADET diagnosed using magnified endoscopic examination with image-enhanced endoscopy (IEE-ME) were prospectively registered in this study. We investigated location, size, macroscopic type, color, and IEE-ME findings including surface structure (closed- or open-loop) and presence of white opaque substance (WOS) in SNADET. We analyzed association between these findings and histopathological diagnosis of SNADET based on the Vienna classification (VCL) using logistic regression analysis. In univariate analysis, lesion size, superficial structure, and WOS deposition showed statistical significance, and the oral side of the lesion location showed statistical tendency for association with VCL C4/5. In multivariate analysis, lesion size (odds ratio [OR], 2.92; 95% CI, 1.94-4.39; P < 0.05) and negative WOS (OR, 5.59; 95% CI, 1.72-18.1; P < 0.05) were significantly associated with VCL C4/5 lesions. Superficial structures with a closed-loop pattern on the surface showed statistical tendency for predicting VCL C4/5 lesions (OR, 2.15; 95% CI, 0.86-5.37; P = 0.10). Based on these findings, we concluded that negative WOS by IEE-ME and lesion size were independent predictors of VCL C4/5 SNADET. These factors may help us to understand of pathophysiology of SNADET and to select appropriate therapeutic strategies. |
Overlooked? Underestimated? Effects of Substrate Curvature on Cell Behavior.
In biological systems, form and function are inherently correlated. Despite this strong interdependence, the biological effect of curvature has been largely overlooked or underestimated, and consequently it has rarely been considered in the design of new cell-material interfaces. This review summarizes current understanding of the interplay between the curvature of a cell substrate and the related morphological and functional cellular response. In this context, we also discuss what is currently known about how, in the process of such a response, cells recognize curvature and accordingly reshape their membrane. Beyond this, we highlight state-of-the-art microtechnologies for engineering curved biomaterials at cell-scale, and describe aspects that impair or improve readouts of the pure effect of curvature on cells. |
module Piet
VERSION = "0.2.6"
end
|
Plasma D-dimer are measurable degradation products of cross-linked fibrin, whose levels increase in presence of a blood clot but also in various other situations associated with activated coagulation. Over the last 30 years, D-dimer have revealed their main strength as a diagnostic tool in venous thromboembolic diseases (VTE). Their central clinical usefulness indeed resides in their role as an exclusion test in patients with suspected VTE [@bib0055], [@bib0060]. Multiple large scale prospective management outcome trials have confirmed the safety of excluding pulmonary embolism (PE) and deep vein thrombosis (DVT) by a negative D-dimer test associated with a non-high pretest clinical probability [@bib0065]. Some more restricted evidence also suggests that D-dimer could allow ruling out aortic dissection in association with a low AAD-RS score [@bib0070]. Finally, D-dimer are used as a diagnostic tool in the setting of disseminated intravascular coagulation (DIC), and have been integrated in the latest ISTH overt-DIC diagnostic criteria [@bib0075].
D-dimer have also been studied as a prediction tool in different settings such as prediction of VTE occurrence in acutely ill hospitalized medical patients to guide thromboprophylaxis prescription, or prediction of VTE recurrence after a first episode of unprovoked VTE to tailor duration of anticoagulant treatment. In acutely ill medical inpatients, a post-hoc analysis of the MAGELLAN trial (*n* = 7581) showed that a D-dimer level \> 2 times the upper limit of normal range was an independent predictor of VTE events (OR compared to patients with D-dimer ≤ 2 times upper limit of normal range 2.29; 95% CI 1.75--2.98) [@bib0080]. For VTE recurrence prediction after a few months of anticoagulant treatment for a first idiopathic VTE, D-dimer levels -- on anticoagulation or after anticoagulation cessation -- have been extensively explored and included in all predictive models such as the Vienna Prediction Model, the HERDOO2 score, the DASH tool and the DAMOVES score [@bib0055].
Finally, the role of D-dimer as a prognostic tool has also been assessed, mainly in the setting of acute VTE. In a retrospective study published in 2006, Aujesky et al. showed that among patients with confirmed PE (*n* = 366), those who died had higher median D-dimer levels than patients who survived (4578 versus 2946 μg/L; *p*= 0.005). All-cause mortality increased with increasing D-dimer levels, rising from 1.1% in the first quartile (\<1500 μg/L) to 9.1% in the fourth quartile (\>5500 μg/L) ( *p*= 0.049) [@bib0085]. These findings were recently confirmed in the COMMAND-VTE registry (*n* = 2852): D-dimer levels were again an independent predictor of all-cause mortality in patients with acute VTE. Indeed, mortality at 30 days was of 1.2% in the first quartile (\<4900 μg/L), 2.2% in the second quartile (5000--9900 μg/L), 3.4% in the third quartile (10,000--19,900 μg/L) and 8.4% in the fourth quartile (DD ≥ 20,000 μg/L) [@bib0090].
In this issue, Frère et al. present the results of a systematic review and pooled analysis of available data on the association between D-dimer levels and mortality in 1355 hospitalized patients with coronavirus disease 2019 (COVID-19). As in the setting of acute VTE, higher D-dimer levels were shown to be associated with an increased all-cause mortality in the presented cohorts of patients with COVID-19. Of note, the increase in D-dimer levels did not seem to be the result of overt-DIC in these patients.
A high risk of VTE has been reported over the last few weeks in patients with severe COVID-19 (around 20--40% depending on the local systematic screening strategy) [@bib0095], [@bib0105], which prompted physicians to empirically increase prophylactic anticoagulant dosing. Whether an intensified anticoagulant treatment -- partly tailored to D-dimer levels -- will impact mortality in these patients is currently under investigation in at least four randomised trials (COVID-HEP [NCT04345848](NCT04345848){#intr0005}; IMPROVE [NCT04367831](NCT04367831){#intr0010}; COVI-DOSE [NCT04373707](NCT04373707){#intr0015}; RAPID COVID COAG [NCT04362085](NCT04362085){#intr0020}).
Altogether, the recent data including those presented by Frère et al. in this issue highlight once again the great interest of D-dimer as a biomarker in clinical practice, not only as a diagnostic tool but also as a prognostic tool [@bib0100].
Disclosure of interest {#sec0005}
======================
The authors declare that they have no competing interest.
This manuscript represents original work, and it is not under consideration for publication elsewhere. It has never been neither submitted nor published in another scientific journal. All authors meet criteria for authorship and none of the authors have any conflict of interest. All read and approved the final manuscript, and held responsibility for the decision to submit it for publication.
|
The present invention relates to a sliding member in which a high load acts on an end side of a sliding surface thereof, and particularly to a sliding member for a main bearing for supporting a crankshaft of an engine, for example.
In general, an engine used for an automobile or the like is constructed so that a crankshaft and a piston are mutually coupled via a connecting rod. This engine generates driving force by using the connecting rod to convert up-and-down movement (vertical movement) of the piston into rotational movement and to transmit it to the crankshaft. Because the crankshaft obtains the rotational movement by converting the up-and-down movement as described above, a main shaft thereof is rotated in a so-called elliptical orbit, that is, in a deflected state in an radial direction if using a grandiloquent phrase.
However, if the crankshaft is deflected during sliding operation before the main bearing supporting it conforms to the crankshaft, that is, in an initial state immediately after newly bringing it into use, a load acts particularly on both end portions in an axial direction of the main bearing. Therefore, the bearing surface load sometimes rises extremely in the portions to cause breakage of an oil film and accordingly, the sliding operation in a partial metallic contact state has caused seizure or the like. For preventing this seizure, it is necessary to improve conformability in the initial state, and in particular, to improve the initial conformability on an end side of the sliding surface in the axial direction.
There is known a sliding member which is improved in anti-seizure property by covering a bearing alloy layer with an overlay layer, by directly spraying hard particles of the mean particle diameter of 20 to 100 μm on the overlay layer to form fine recesses having a crater shape on the overlay layer working as a sliding surface, and by confining lubrication oil to the recesses, for example. See JP-A-2002-147459 (Paragraph “0010” to “0034,”, and Table 4), for example. |
No luck for the Swiss on the last day of the qualification phase at the Laser Worlds. The light wind specialist Guillaume Girod SUI could not defend his place in the Goldfleet despite of the slack wind conditions, dropping on rank 62. He will continue the Championship in the Silverfleet as do Christian Steiger SUI (69th) and Christoph Bottoni SUI (72nd). With this situation it is clear, that no Swiss Laser will be at the 2012 Olympics in Weymouth/London. At the (big breeze) Hyères Worldcup last week, Christoph Bottoni SUI - with the best result of his career - missed the nations' objective set by Swiss Olympic by a very small margin. To be noted, that contrary to other Olympic classes, the Laser Worldcups have practically always a top nations participation and in no other class, the 12 nations' barrier requested by Swiss Olympic is so demanding. The results. |
The magnitude of the COVID-19 crisis is unprecedented and is having a profound effect on the health, social and economic activities of Canadians. Statistics Canada is committed to supporting decision makers and to informing Canadians by generating rich, timely and relevant data and analysis about the current pandemic.
Recently, Statistics Canada drew on its unique relationship with Canadians to develop a new initiative to generate data and analysis quickly and effectively via crowdsourcing—and Canadians responded.
From April 3 to 9, 2020, close to 200,000 people visited Statistics Canada's website and took part in the online questionnaire about how COVID-19 is affecting their lives. Statistics Canada would like to thank participants who took the time to answer these important questions during this challenging time.
Today, Statistics Canada is releasing the first of a series of results based on crowdsourcing. Over the next few weeks, new crowdsourcing initiatives will be launched to get timely information about other important issues, such as the extent to which COVID-19 is affecting the lives and well-being of different groups of Canadians. Canadians are invited to keep coming to the website in order to participate.
Readers should note that unlike other surveys conducted by Statistics Canada, crowdsourcing data are not collected under a sample design using a probability-based sampling. As a result, the findings reported below cannot be applied to the overall Canadian population.
The objective of this first release is to better understand how crowdsourcing participants are reacting to the crisis, with a focus on differences across age groups and gender. Examining how various population groups are reacting to the pandemic is important, because not all Canadians will experience COVID-19 the same way.
Results indicate that senior participants are the most likely to be concerned about their own health and are also concerned about maintaining social ties. Younger people, on the other hand, are proportionately more likely to be concerned about the social and economic consequences of the pandemic.
Close to 6 in 10 seniors report being very or extremely concerned about their own health
Crowdsourcing participants were asked how concerned they were about a variety of situations stemming from the COVID-19 pandemic.
Some concerns were shared by a majority of participants, regardless of age. For example, at least 80% of participants in all age groups reported being very or extremely anxious about overloading the health system. Similarly, the vast majority of participants reported that they were worried about vulnerable people's health.
Other worries, however, were more specific to older Canadians. Specifically, close to 6 in 10 people aged 65 and older reported that they were very or extremely concerned about their own health, compared with 23% among those aged 15 to 24 and 28% among those aged 25 to 34. Similar results were found for men and women.
Infographic 1
Proportion of crowdsourcing participants who were very or extremely worried about certain COVID -1 9 related issues, by age group
Maintaining social ties was also a concern for seniors, particularly among those aged 75 and older (37%). According to census data, one-third of seniors in this age group live alone, and may therefore be more at risk of social isolation. Because seniors are more likely to have a limited social network, lone seniors may be more at risk in the context of the pandemic.
Older Canadians were also more likely to report that they had made plans to communicate with families and friends than their younger counterparts (Table 1). This was especially the case among women aged 75 and older, who are more likely to live alone. In this age group, 66% of women and 55% of men reported that they had made plans to communicate with family members or friends.
Younger participants are more likely to be concerned about social effects of the pandemic
Younger participants were less focused on personal health worries, and more focused on social stressors resulting from the pandemic, such as family stress from confinement or the possibility of civil unrest. Previous research has shown that younger people have a higher degree of social interactions, but a lower level of trust in their neighbours and strangers.
Specifically, participants aged 15 to 24 were more likely to report that they were very or extremely concerned about stress from confinement at home (41%), a concern they also shared with adults aged 35 to 44 (40%) who are more likely to be living with young children. These figures compared with 30% or below among participants aged 55 and older.
Younger participants aged 15 to 24 were also more likely to be very or extremely worried about the possibility of civil disorder (43%). This compared with 24% among participants aged 75 and older.
Like their older counterparts, maintaining social ties was also a concern for participants aged 15 to 24 (36%), who often had to put aside busy lives in order to follow social distancing rules.
That being said, younger participants were less likely to have made plans to communicate with their friends or family, relative to their older counterparts. Young men aged 15 to 24 were even less likely to have made such plans, at 44% (compared with 52% for women in the same age group).
Young women are more likely to be concerned about violence in the home
In a previous Statistics Canada survey conducted in the early stages of the pandemic, 10% of women and 6% of men reported that they were concerned about the possibility of violence in the home.
Results from crowdsourcing echo this finding, as women in all age groups were more likely than men to report being very or extremely anxious about the possibility of violence in the home.
Young women aged 15 to 24, however, were significantly more likely to report that they were very or extremely anxious about the possibility of violence in the home (12%), relative to men in the same age group (8%).
Infographic 2
Proportion of crowdsourcing participants who reported being very or extremely anxious about the possibility of violence in the house, by age group and by gender
Youth are also more likely to feel the economic pinch of the crisis
Young participants were also more likely than older participants to report that the current crisis would have an impact on their job or finances. These findings echo the most recent report from the Labour Force Survey, which indicated that young workers were the most impacted by job losses in the aftermath of the crisis.
Specifically, close to one-half of participants aged 15 to 24 reported that the COVID-19 pandemic would have a "moderate" or "major" impact on their ability to meet their financial obligations. This compared with an overall rate of 34% for all participants (Table 2).
Similarly, youth were also more likely than older participants to think that they would be losing their job or self-employment income as a result of the pandemic (43%, compared with 28% for all participants). The results above were similar for both men and women.
Seniors visit grocery stores and drugstores less frequently, but make greater use of delivery services
Perhaps owing to greater concern about their health, senior participants were generally less likely than younger participants to report that they had been to a grocery store or a drugstore in the past week.
This was particularly the case among women aged 75 and older. More than one-half of women in this age group had not been to a grocery store or drugstore in the past week (Chart 3). This compared with approximately one-fifth of women aged 45 to 54.
Infographic 3
Proportion of crowdsourcing participants who did not go to the grocery store or a drugstore in the week preceding the survey, by age group and by gender
While seniors were less likely to go to a grocery store or drugstore, they were more likely to use delivery services to get food or medication. About 25% of seniors aged 65 to 74 and 32% of seniors aged 75 and older reported using such services, and these proportions were similar between men and women (Table 3).
Older participants, however, were less likely than younger participants to have ordered prepared food. Women were generally less likely than men to have used these services.
Note to readers Data in this release are from Statistics Canada's Crowdsourcing: Impacts of COVID-19 on Canadians. The crowdsourcing questionnaire collects data on the current economic and social situation, as well as on people's physical and mental health, to effectively assess the needs of communities and implement suitable support measures during and after the pandemic. This alternative method of collecting information can be used to supplement data obtained from more traditional sources, particularly due to its relatively low implementation cost and ability to increase the granularity of data in a timely manner. From April 3 to 9, close to 200,000 people living in Canada voluntarily answered the survey, which focused on behaviour and attitudes related to COVID-19. Over the next few weeks, new crowdsourcing initiatives will be launched to get timely information about other important issues, such as the extent to which COVID-19 is affecting the lives and well-being of different groups of Canadians. Canadians are invited to keep coming to the website in order to participate. This analysis discusses the extent to which the concerns, precautions and weekly habits of participants varied across age groups.
Contact information
For more information, or to enquire about the concepts, methods or data quality of this release, contact us (toll-free 1-800-263-1136; 514-283-8300; STATCAN.infostats-infostats.STATCAN@canada.ca) or Media Relations (613-951-4636; STATCAN.mediahotline-ligneinfomedias.STATCAN@canada.ca). |
Vítězslav Tuma
Vítězslav Tuma (born 4 July 1971) is a former Czech football forward.
Tuma played at a position of forward, being a prolific goalscorer. He was a top goalscorer of Czech First League in the 2000/2001 season with 15 goals.
References
External links
Category:1971 births
Category:Living people
Category:Sportspeople from Nový Jičín
Category:Czech footballers
Category:FC Baník Ostrava players
Category:MFK Vítkovice players
Category:AC Sparta Prague players
Category:SK Sigma Olomouc players
Category:1. FK Příbram players
Category:Sabah FA players
Category:Czech First League players
Category:FK Drnovice players
Category:Association football forwards |
"Servants' battle enters a new dimension…" after Fate/Extra
By Egan Loo
The countdown at the project-cosmos.jp site ended with an announcement of a Fate/Extella game for PlayStation Vita and PlayStation 4 from Marvelous Inc.
Kadokawa's Weekly Famitsu is publishing a four-page feature on the Fate franchise's transition to the action game genre. The feature will feature messages from Fate franchise creators Kinoko Nasu and Takashi Takeuchi. The feature shows the Saber class character Nero Claudius (voiced by Sakura Tange) and teases that the "Servants' battle enters a new dimension…" after Fate/Extra.
Marvelous Entertainment and Type-Moon released the Fate/Extra PlayStation Portable game in Japan in 2010. Aksys Games released the game in North America in November 2011. The Fate/Extra CCC companion game shipped in Japan on the PSP in March 2013.
Source: Famitsu via Otakomu
Update: In a blog update, Nasu teases that the game will feature hack-and-slash action elements. The creator writes that although he cannot say anything yet, the staff members were allowed to do pretty much whatever they wanted, and this led to the title not being "Extra 3" to set the games apart. [Via Hachima Kikō] |
Credit Value Partners: European Crisis Creates Value Distressed
Credit Value Partners LP, is a distressed debt value based hedge fund. The fund recently outlined why they see many opportunities in the space currently. Below is a summary.
Stressed and Distressed Loans are an attractive asset class in this environment
1) A high-returning alternative to corporate equities
Underlying investment target (U.S. and European Companies) is essentially the same as for public equities
Historic investment returns on Distressed Loans have significantly exceeded those for equities1
Historically, attractive total returns and current interest income
2) Providing better downside protection and lower volatility
Investing in the most senior portion of a company’s capital structure, secured by the company’s assets
Investing in companies at distressed prices and depressed valuations
Recoveries on secured loans in bankruptcy are far superior to those on equities
1) A Natural Default Cycle is Underway: Corporate distressed debt investing cycles have historically been created by high levels of LBO related debt defaults. LBO debt maturities are coming due in record volumes over the next three to five years. At the same time, the average non-investment grade company is highly leveraged with greater than 5x debt to cash flow. This combination alone is likely to create high levels of defaults and a large distressed investing opportunity.
2) Credit Tightening Typically Leads to Higher Defaults: The European Sovereign Debt Crisis has recently and materially infected the U.S. High Yield Bond and Leveraged Loan markets. Borrowing spreads for non-investment grade companies at 12/31/11 were 28% higher than they were at 6/30/11, and new issue volumes for high yield and leveraged loans have fallen significantly, especially for single-B rated issuers. Unless this situation reverses itself, speculative grade companies will find it difficult to refinance their loans and bonds as their existing debt matures, leading to even higher levels of defaults.
3) The Sovereign Debt Crisis is Increasing the Odds of a Recession: As credit availability contracts, we are more likely to see a resumption or “double dip” of the 2008/9 recession. Recessions usually lead to lower corporate earnings, resulting in even higher debt multiples, which would likely cause default rates to trend even higher. |
Diagnostic performance of Japan NBI Expert Team classification for differentiation among noninvasive, superficially invasive, and deeply invasive colorectal neoplasia.
The Japan NBI Expert Team (JNET) classification is the first universal narrow-band imaging magnifying endoscopic classification of colorectal tumors. Considering each type in this classification, the diagnostic ability of Type 2B is the weakest. Generally, clinical behavior is believed to be different in each gross type of colorectal tumor. We evaluated the differences in the diagnostic performance of JNET classification for each gross type (polypoid and superficial) and examined whether the diagnostic performance of Type 2B could be improved by subtyping. We analyzed 2933 consecutive cases of colorectal lesions, including 136 hyperplastic polyps/sessile serrated polyps, 1926 low-grade dysplasias (LGDs), 571 high-grade dysplasias (HGDs), and 300 submucosal (SM) carcinomas. We classified lesions as polypoid and superficial type and compared the diagnostic performance of the classification system in each type. Additionally, we subtyped Type 2B into 2B-low and 2B-high based on the level of irregularity in surface and vessel patterns, and we evaluated the relationship between the subtypes and histology, as analyzed separately for polypoid and superficial types. We also estimated interobserver and intraobserver variability. The diagnostic performance of JNET classification did not differ significantly between polypoid and superficial lesions. Ninety-nine percent of Type 2B-low lesions were LGDs, HGDs, or superficial submucosal invasive (SM-s) carcinomas. In contrast, 60% of Type 2B-high lesions were deep submucosal invasive (SM-d) carcinomas. The results were not different between each gross type. Interobserver and intraobserver agreements for Type 2B subtyping were good, with kappa values of .743 and .786, respectively. Type 2B subtyping may be useful for identifying lesions that are appropriate for endoscopic resection. JNET classification and Type 2B sub classification are useful criteria, regardless of gross type. |
Rundown of Recent Question of the Week Polls
As I like to do from time to time, I’m providing a rundown of recent Question of the Week polls. I love these polls, as (to me, at least) they always provide a fascinating glimpse into how roadies experience the myriad aspects of our shared passion.
From knocking off big rides on your personal “cycling bucket list” to the percentage of readers who have broken a clavicle in a crash, there are always surprises in these little Q-and-A’s.
Cycling Bucket List Items
Let’s start with the Question from four issues ago: How Many of Your Cycling Bucket List Items Have You Checked Off?
The leading response, with more than 43% of the vote, was: I don’t really have a cycling bucket list.
Interestingly, the next-biggest vote-getter was at the other end of the spectrum. With just over 20% of the vote: How can anybody ever finish this list? It should be endless!
An equal number of you – 8% – have checked off from 3-5 or 5-10 of your bucket list items. And 5% answered: All of them! I’m looking for new ones.
Broken Collarbones While Riding
The Question posed not long after my recent crash brought another array of answers. We asked: Have You Ever Fractured Your Clavicle (Collarbone) in a Crash?
Over 850 of you weighed in. This time, I was surprised to find that so many of you have, in fact, suffered this “most common cycling injury.” More than 26% said, Yes, once. And other 6+% answered, Yes. More than once.
Thankfully, an even bigger percentage, nearly 48, replied, No, never. Here’s hoping you never join the affirmative crowd on this issue!
Longest Time Off Bike Due to a Crash
The sheer percentage of you who have broken a clavicle, among other such cycling injuries, in part accounts for the more than 53% of you who said A month or more in reply to the Question: What is the longest time you have been off the road (not including trainer) due to a crash injury?
And equal number, 9.5%, of you chose Less than month and Less than 2 weeks. Among the luckiest of you, at just under 8%, said Less than a week. And the truly blessed – just over 15% of readers – said I’ve always been able to ride.
Your Preferred Drivetrain
Finally, catching up on last week’s Question, What Drivetrain Do You Ride on Your Main Bike?
Three responsed dominated among the over 750 votes on this poll:
With just under 30%, the biggest vote-getter was 50×34, 10-speed.
The 11-speed version of this same compact combination netted over 22% of the vote. And the good old standard, 53×39, 10-speed, got nearly 11% of the vote. |
Fans of The Block should tune into an upcoming documentary on ABC, Gatwick: The Last Chance Hotel.
Filmed over 4 years this profiles former owners Rose Banks and Yvette Kelly and the accommodation they ran for Melbourne’s disenfranchised.
The Gatwick has been described by some as a flophouse, a hell hole even, and by others as providing an essential service for the disadvantaged.
Shot over four years, Gatwick – The Last Chance Hotel chronicles the final years of the Gatwick Private Hotel, a boarding house that over the years became a local, and then national icon and reveals the intimate stories and the fascinating characters you never knew about – and the women who dedicated their lives to looking after them.
Rose Banks and Yvette Kelly offered their tenants much more than a roof over their heads, and Gatwick – The Last Chance Hotel is as much a loving tribute to the sisters as it is a contemplation of dignity and the challenges faced by the underprivileged, including the basic need for shelter.
Clouded by various myths perpetuated in the media, this film tells the true story of Rose Banks and Yvette Kelly, twin sisters who worked at the hotel from the age of 14 until they sold the property in 2017.
Halfway home to a few; home to many, in this intimate documentary, we observe a rag tag menagerie of characters who either live in; frequent; or work at the Gatwick, under the watchful and caring eyes of twin sisters known locally as ‘The Saints of St Kilda’.
Creator/Producer Jason Byrne; Co-Producer Julian V. Costanzo; Editor Sara Edwards.
9:20pm Tuesday November 27 on ABC.
Related |
Kerala policeman caught cheating told to go on leave
A Kerala police official was caught cheating in an examination for Master of Laws (LL.M) and ordered to leave the exam hall. The official was later asked to go on leave by state Home Minister Ramesh Chennithala.
The police official, identified as T.J. Jose, inspector general of police of Thrissur range, has denied the cheating charge.
On hearing about the incident, Chennithala asked the police official to go on immediate leave.
Confirming the cheating incident, V.J. Peter, vice principal of St. Paul’s College at Kalamassery, said the incident would be intimated to the Mahatma Gandhi University which conducted the exam.
Jose told the media that he had done no wrong and left the examination hall at 11.30 a.m. on his own. The exam was due from 10.00 a.m. to 1 p.m.
“I have done nothing wrong and I will return for the last examination tomorrow (Tuesday),” he said.
The invigilator who caught Jose cheating was unaware of his identity, said an informed source.
Director General of Police K.N. Balasubramanian said action would be taken against Jose.
Additional Director General of Police Shankar Reddy has been asked to file a report on the incident.
Asian Lite International, with editions from London & Dubai, is now the most influential newspaper for the Indian Diaspora. A new media with active presence in the social and digital platforms, make Asian Lite most popular for the Indian community across the world. Asian Lite is the first publication to identify the potential and promote the contributions of Asian professionals, especially in the IT and Medical sectors, to the global economy. |
December is the bonenkai season and clubs are holding their award nights everywhere. One club we know that celebrated their fantastic year in style was the KCL Champions, Tokyo Giants.
The Kanto Cricket League held the presentation ceremony at an Indian/Pakistani restaurant at Koshigaya and the Giants had done elaborate arrangements to celebrate this occasion, including short-circuit cameras and a free dinner for the invitees. The chief guest of the night was the Ambassador of Pakistan, who gave away the trophies. The Ambassador spent more than two hours in the restaurant mingling with the cricketers and listening to the history of cricket in Japan and that of the KCL. The surprise guest and speaker at the ceremony was the CEO of the JCA, Alex Miyaji. Miyaji’s appearance was indeed a welcome sign of thawing relations between the two bodies.
The Ambassador gave away awards to the following cricketers as individual performers, in addition to the runner up and the winner.MVP – Ahmad Kamal (Tokyo Giants)Best batsman – Dhanuka Samaranayake (Serendib)Best bowler – Noman Iqbal (Lalazar)Man of the Final – Hameed Saeed (Tokyo Giants)
Correction: In the last issue we had incorrectly reported that this was the Giant’s 10th KCL victory. It is their 9th victory. Error is regretted.
+ Cricket Victoria conducts coaching camp in Japan +
Cricket Victoria conducted a 3 day Advanced Coaching seminar in Tokyo last month. The seminar, an Australian Level Two Coaching course, covered sessions related to the technical, tactical and fitness/health aspects of Cricket. JCA waived the fees, about JPY 10,000, for those currently active in coaching or possess a desire to coach in the near future. This was the highest level course ever to be held in Japan.
Indian Engineers on Twitter
Well, the Engineers can’t be away from latest technology for too long. Follow the Engineers at http://twitter.com/ieccjapan/ for live match updates and other cricket updates.
The Fine Print
Former Australian captain Greg Chappell feels given its increasing popularity, the Indian Premier League would soon become a world event and take cricket to hitherto unexplored regions. “I can see the day when IPL becomes a world format and we’ll have New York playing Bombay playing Beijing playing Sydney playing London,” Chappell said. “I have a feeling that Test cricket is going to reduce in size rather than grow in size,” he added.###
Michael Clarke, who recently returned to the Australian cricket team as vice-captain, wants to lead the side in future but only if incumbent Ricky Ponting decides to walk away on his own. “I could sit here and lie and say I don’t think about it. The truth is I hope I continue to get opportunities, whether it be one-day cricket, now with Twenty20 cricket or hopefully one day I get the chance to captain in Test cricket,” Clarke said. “But it is all so far away. Right now, I am over the moon and stoked I have been given the chance to captain the Twenty20. My leader, still, is Ricky Ponting.”###
Michael Clarke should never become a Test captain, considering his injury worries and Ricky Ponting’s desire to lead the national side to England for Ashes revenge in 2013, feel former Australian greats. “Michael Clarke hasn’t convinced me that he’s durable enough to be a captain,” said Ian Healy. Former Test captain Kim Hughes expressed concern about Clarke’s health saying, “Michael Clarke is getting experience, but there must be a question mark over him now with his back. The danger is that Clarke, because of his degenerative back injury, he might only be able to play Test cricket.”###
Shakib Al Hasan became the first ever Bangladeshi cricketer to be signed by an English county after Worcestershire roped him as their overseas recruit for next year.Currently the number one all-rounder in the ICC rankings, the 22-year-old Shakib will join the club after the completion of Bangladesh’s tour to England in mid-July 2010, subject to completion of visa arrangements. Shakib was thrilled with the distinction and said he was looking forward to join the county which had legendary all-rounders Kapil Dev, Ian Botham and Imran Khan in their ranks. “I consider it a huge honour to be the first Bangladeshi overseas player in county cricket and can’t wait to give my all for the club on the field,” Shakib said.###
The IPL is innovating – Four fielding substitutes instead of the lone 12th man, pink balls in practice matches and abolishing the Icon player status are some of the innovations which the Indian Premier League would embrace from its 2011 edition. From 2010 onwards, IPL would also be played under the supervision of the ICC Anti Corruption and Security Unit, while players who skip the tournament despite not having any national assignment might have their contracts terminated.###
A host of Indian politicians are using cricket terminology and epithets to defend Sachin Tendulkar against a local Indian plitician who decried that Tendulkar’s remarks that Mumbai (his hometown) belongs to all India, not just to Maharashtra (his home state and whose capital is Mumbai). “You have left the crease and moved to the pitch of politics,” Bal Thackeray, the firebrand Hindu Fundamentalist politician, had said in his party newspaper’s editorial. “Sachin has got Bal Thackeray out. Now, he (Thackeray) may cry as much as he wants after the fall of the wicket”, a Union Minister said. “Tendulkar has stumped Thackeray”, another one said. Yet another one made an entry in the scorebook of politics, “B Thackeray c&b S Tendulkar”.###
Peter McGlashan set an international record for catches by a wicketkeeper in a first-class match when he claimed his 12th catch for Northern Districts province against Central Districts in New Zealand domestic match last month. The former New Zealand ‘keeper took six catches, including one to dismiss former Black Caps batsman Mathew Sinclair, during Central’s first innings and seven, including catches from internationals Jamie How and Ross Taylor, in its second. McGlashan, 30, broke the record shared by 11 players, including former Australian wicketkeeper Rod Marsh and Zimbabwean Wayne James, when he caught Bevan Griggs off the bowling of Graham Aldridge.###
MCC, the custodian of the world’s most famous cricket ground, Lord’s, will turn to investors from the Middle East to help bankroll its planned £400 million redevelopment of Lord’s, which is designed to turn the ground into the world’s finest cricket stadium. The plans include to increase capacity by 7,500, to 37,000, and to build a new cricket academy in tunnels underneath the Nursery End. The main driver for revenue will be the sale of luxury flats around the ground, which estate agents have valued at £1.2 million each.###
Cricketer-turned-commentator Geoffrey Boycott kicked up a storm with an on-air four-letter rant during the third England-South Africa ODI, prompting the British Broadcasting Corporation (BBC) to apologise for the indiscretion. Boycott was heard shouting “f****** t****r” during BBC Test Match Special coverage of England’s third ODI against South Africa. “An off-air comment made by Geoffrey Boycott in a live broadcast was heard by some listeners which we apologised for as soon as we realised it had been audible,” a Radio 5 Live spokesman said.###
Source: Various web and print media
Asia & EAP News
ACC U19 Cup
Hosts Thailand overcame rivals Maldives by a handsome margin of 86 runs in the opening match of the ACC U19 Challenge while China defeated Brunei in the second match. Apart from the hosts, Kuwait, China, Maldives, Brunei, Bahrain, Myanmar and Iran are the other participating countries in the tournament that is currently being held between 9th – 18th December 2009 Cup at Prem Oval, Chiang Mai Gymkhana. Kuwait are favourites to lift the trophy.
Bali Sixes tournament announced in Easter 2010
Cricket Bali has announced its Bali Sixes tournament to be held in Easter 2010 at Udayana University Ground on the Bukit Peninsula, South Bali. The three-day event will run from 2-4 April 2010 and consist of a maximum of 12 competing teams, with six players in each team. The finals will be held on Sunday, 4 April along with a Bali young players’ match followed by presentations.
Fiji builds towards World Cricket League event
Cricket Fiji took a major step towards participating in the World Cricket League when they started a new competition, the Elite Player League, to ensure that players are used to the competition rules when they progress to playing for the Fiji Blues at international level. With Fiji set to play in the World Cricket League Division 5 competition in Nepal next February, this competition will be used as an important part of the team selection and preparation phase.
Indian Engineers’ Japan Cricket Rating – New results
Results as of October 30:
Here is the list of the top 10 teams(last month’s ranking in brackets):
We encourage all teams to send us your result statistics regularly so that your team’s rankings remain as accurate as possible. We are in a position to obtain the results of the official tournament matches on our own but we are looking for the results of the friendly matches.
Readers’ Corner
Whilst not disputing the fact that the Giants deserve to win the KCL every year, do you think that playing a home match every time is to their advantage? If I am incorrect about this then I apologise.
David Todd
Editor** We encourage our readers to write back to us with your articles, opinion, feedback and criticism. Feel free to write about anything related to cricket, in Japan or outside.
IECC Poll results
Do agree with the suggestion of lifting the quota for the bowlers in ODI to make it more interesting?
Snippets of the Month
Note: Beginning the Issue #39 (May 6, ’04), we bring you some interesting snippets from the cricket world, to celebrate the fourth anniversary this Newsletter and first anniversary of our popular “Trivial Facts” series. The same will be published on the front page of our website too.
“I swear I’ll never hit another 400 in my life.” 12-year-old Sarfaraz Khan after scoring 439 in an U-16 inter-school match in India.
Trivial facts (from our Archives)
1. Australia have scored 300+ runs on more than 55 occasions in ODIs – the most by any side. |
http://gty.im/502623548
The Writing Staff Gets Together To Give Their Thoughts On Where They Would Rank Ameer Abdullah.
The Detroit Lions’ rushing attack has not been up to par these last few seasons. Since Barry Sanders’ retirement, there hasn’t been a lot to get excited about in the Lions’ backfield. Jahvid Best’s career was cut short by injury. The Lions had a nice tandem in Reggie Bush and Joique Bell, but age limited the time-frame of their effectiveness. The Lions have not found a solution to their consistently sub-par rushing attack.
Drafted in the second round of the 2015 NFL Draft, Ameer Abdullah was supposed to be that solution. He flashed the ability to be the solution, the long-term primary ball carrier in the Detroit Lions’ backfield. Unfortunately, due to ball security issues in his rookie season and an injury in his second season, Ameer Abdullah has not proven that he is that guy for the Lions yet.
When on the field, Abdullah has flashed electric play making ability. When on the field, he has shown that he has the potential to be a huge part of the Lions offense. He just hasn’t been on the field enough to prove that he is either the future at the position for the Lions or just another in a long list of unsuccessful starters. Given a limited sample size of Ameer Abdullah’s ability at the NFL level, a few of the writers got together to give their takes on where we would rank Ameer Abdullah among NFL running backs.
http://gty.im/603001664
Ameer Abdullah is on his last leg in Detroit for me. I am a big injury person, and when it comes to serious injuries everyone gets three chances before I want to dump them. Stafford was on strike two after back to back season ending injuries, same with DeAndre Levy. Abdullah is on strike two, even though he didn’t miss time in 2015, he had shoulder surgery that cost him crucial offseason time. Players get hurt for a week or two, I get that, but in the NFL, you can’t afford to have someone to miss important time more than three times.
Now the big debate here is how Abdulah ranks among the NFL starting running backs. While Abdullah hasn’t wowed the fans yet of what he can do, considering he only started nine games in 2015 and played in two in 2016, he has yet to show a full 16 game season of him starting. His only full season he ran 143 times for 597 yards and for two touchdowns. Also, that was behind a weaker offensive line, one without Taylor Decker, TJ Lang, Rick Wagner, an inexperienced Travis Swanson and a rotating door at the right tackle position.
http://gty.im/490375990
Now Abdullah will have an improved offensive line and hopefully, he can stay healthy to show that he is a top 10 running back in the NFL. Where is Abdullah at out of the 10 running backs? Number 10, barely making the list. Here are the running backs that are better than Abdullah in no particular order:
LeSean McCoy
Le’Veon Bell
DeMarco Murray
Marshawn Lynch
Ezekiel Elliott
Devonta Freeman
Doug Martin
David Johnson
Todd Gurley
Todd Gurley? After the sophomore slump? Yup, if Gurley had an offensive line like Elliott had, Gurley would have great stats, but with a poor offensive line, that hurts his chances to take his skills to the next level.
Adrian Peterson is better than Ameer Abdullah looking at them overall, but currently, Peterson is showing his age, and maybe a new team can give his career another year or two of production, but looking at how running backs are doing right now, Abdullah is better than him.
Something to note as well, this year’s running back class was portrayed as the best class in years. While there are very talented players in the class and some will turn into great NFL running backs, Abdullah is better than almost every single one of them and fans were angry that we passed on a running back. Just look at these numbers, it was safe to give Abdullah another chance.
I really like Ameer Abdullah. I grew up on Barry Sanders, so I’ve always had a soft spot for elusive and explosive backs, guys that can do exciting things with the ball in their hands. Ameer Abdullah has shown that he is capable of that type of play. If he can play consistently the way that he has during his flashes, he could be among the best backs in the league. The problem has been staying on the field. Between the fumbles and last year’s injury, he hasn’t had the volume to prove that he can be that back on a regular basis.
The top tier of backs has to include Leveon Bell, Ezekiel Elliot, and David Johnson. I think that they are indisputably ahead of Ameer Abdullah. Following them, you have the veterans who are still producing at a high level. I’d include LeSean McCoy, Marshawn Lynch, and Demarco Murray. Those guys have produced for years now and have established themselves as top backs in the NFL. They are nearing the end of their prime, and possibly are past it already, but are still producing at a high level and haven’t shown significant decline in ability. I consider all of those guys to be ahead of Abdullah.
http://gty.im/497294262
The next group of guys are the young, talented running backs that have had productive years and have at times looked to be deserving of being considered a top NFL running back. Of these running backs, I would put Devonta Freeman, Jay Ajayi and Todd Gurley ahead of Ameer Abdullah. I’m not sold on Jordan Howard. I didn’t like him as a prospect, and I think that his production was largely opportunity based rather than talent based. He could prove me wrong and follow up his rookie season with a strong second year, but right now I would rather have Abdullah. I would probably put Melvin Gordon and Ameer Abdullah on even ground here. I’d give the edge to Gordon for now, strictly based on the fact that Gordon has had a mostly-full, productive NFL season, even if it wasn’t spectacular.
Finally, we have the rookies. You could make the argument that these guys have never taken an NFL snap and have no business in running back rankings. Generally, I would agree. This case is a little different, because Abdullah also has a limited sample size to judge. Leonard Fournette, Christian McCaffery, Dalvin Cook, and Joe Mixon all have the potential to be top backs in the NFL. Odds are that they won’t all reach that status. I would say that you could probably put Abdullah behind two of those four running backs, assuming two of them bust.
That ranks Ameer Abdullah somewhere between 10 and 15, depending on your opinion of the rookie running backs and Melvin Gordon.
http://gty.im/489458358
I’m not sure how my cohorts feel about it, but I’m excited about Ameer Abdullah’s return. A clean bill of health for the former Cornhusker bodes well for a paltry rushing attack that ranked 30th in the league in 2016.
Abdullah was a darling of media analysts who forecasted him as a breakout candidate before he went down with a foot injury in the Week two contest against the Titans. In just six quarters of action, he toted the rock 18 times for 101 yards (5.61 YPC). Had he kept that pace, it would have been good for third among running backs behind only Oakland’s Jalen Richard (83 attempts, 5.92 YPC) and Bill-cum-Patriot Mike Gillislee (101 attempts, 5.77 YPC).
That’s a small sample size to work with and the NFL season is a grind, so it’d have been impressive if Abdullah could have maintained that level of play through sixteen games. Nevertheless, he put on a show against Indianapolis and Tennessee. The Colts may have ranked dead-last in rush DVOA, but the Titans were a respectable 10th in Football Outsiders’ metric, and Abdullah actually averaged a higher YPC against Tennessee (6.33) than he did Indy (5.25).
Again, it’s tough to rank Abdullah because it requires a great deal of projection, but I’d say he’s a fringe top 10 back. According to Football Outsiders, Abdullah averaged 4.6 YPC on 81 carries after Cooter took over in 2015. That would have tied him for 10th among running backs in 2015 with Mark Ingram and Darren McFadden.
It’s not a question of talent for Abdullah; he needs to stay healthy and hang onto the ball. He only carried it 18 times in 2016, so it’s hard to tell if he remedied his fumbling issues (3.4% fumble rate in 2015), which will be something to monitor moving forward. With the likes of Jamaal Charles and Adrian Peterson finding new teams this offseason, the NFL is undergoing something of a changing of the guard at the running back position.
If he can stay on the field in 2017, Abdullah’s combination of elusiveness, elite change of direction ability, and balance could put him in the conversation as a top tier back. Until then, he remains on the bubble, somewhere in the 12-15 range.
http://gty.im/485701744
Thanks for reading! You can follow The Detroit Lions Podcast on Twitter @DetLionsPodcast. Be sure to join the community on the Detroit Lions subreddit. |
{
"images" : [
{
"idiom" : "universal",
"scale" : "1x"
},
{
"idiom" : "universal",
"filename" : "Icon-iPadPro@2x.png",
"scale" : "2x"
},
{
"idiom" : "universal",
"scale" : "3x"
}
],
"info" : {
"version" : 1,
"author" : "xcode"
}
} |
1. Field of the Invention
The present invention relates to an upper plate of plasma display panel, and a manufacturing method thereof. Particularly, the present invention relates to a black paste composition capable of improving the property of a black matrix, and a plasma display panel using the same.
2. Description of the Related Art
Plasma display panel (PDP) is a flat panel display device that can display images or information by using a light-emitting phenomenon from plasma discharge. PDP is generally divided into DC-type and AC-type according to panel structure and driving method.
PDP generates plasma discharge in each cell separated by barrier ribs. Thus, PDP is a display device using the light emitting phenomenon of visible rays generated from the energy difference when ultraviolet rays generated by plasma discharge of a gas (such as He, Xe, etc.) provided in each cell returns to the ground state by exciting a phosphor in the cell.
PDP has several advantages such as simple structure, easy manufacturing due to simple structure, high brightness, high luminous efficacy, memory capacity effect, and a wide viewing angle over 160°. Also, PDP can be used for wide screens of 40 or more inches.
FIGS. 1A-1F are cross-sectional views illustrating the steps of forming the upper plate of a common PDP in the art.
First, as shown in FIG. 1A, a black paste composition 122 is applied on an upper substrate 100 at the state that a transparent electrode 110 consisted of ITO, etc. is already formed by a process, for example, sputtering, ion plating, chemical depositing or electrodepositing.
The black paste composition 122 is RuO compound.
Then, an electrode material 132 is applied as shown in FIG. 1B.
Subsequently, a first mask 160 having a certain opening 162 is disposed on the upper substrate 100 on which the electrode material 132 is applied. The first mask 160 has the opening 162 at a position corresponding to a bus electrode 130, as shown in FIG. 1C.
The first mask was exposed to light by irradiating a UV lamp from top of the first mask 160 for a certain period of time.
Then, after the first mask 160 is removed, the upper substrate 100 is developed by using a developer.
As a result, the electrode material 132 and the black paste composition 122 in the other parts are removed, with only leaving cured parts in response to the UV lamp, as shown in FIG. 1D. Then, a sintering process is carried out thereto.
And, a dielectric layer material is applied on the upper substrate 100 on which the first black matrix 120 and the bus electrode 130 are formed, and dried to form an upper dielectric layer 140, as shown in FIG. 1E.
Then, the black paste composition 122 is re-applied on top of the upper dielectric layer 140. A second black matrix 150 is formed in each discharge cell through performing the developing and sintering processed thereto, as shown in FIG. 1F.
Subsequently, the manufacturing process of the upper plate of PDP is completed through forming one more dielectric layer (not shown) or a protection layer (not shown), on top of the upper dielectric layer 140 on which the second black matrix 150 is formed.
In case of manufacturing the upper plate of PDP through the above steps, the first and second black matrixes 120 and 150 are formed through two steps. That is, to form the first black matrix 120 disposed between the transparent electrode 110 and the bus electrode 120, the black paste composition 122 is applied, and the light-exposing, developing, and sintering processes are followed.
Also, to form the second black matrix 150 disposed in each discharge cell, the black paste composition 122 is applied, and the light-exposing, developing, and sintering processes are followed.
Thus, the manufacturing process becomes complicated, and the manufacturing cost as well as the manufacturing time is increased.
Also, the RuO compound used as the black paste composition 122 is very expensive, thereby increasing the manufacturing cost. |
Chameria Battalion
The Chameria battalion () was a battalion of the National Anti-Fascist Liberation Army of Albania during the Second World War. It was formed from the organized resistance groups of Cham Albanians on 15 June 1943 and was renamed as the IV Chameria Group () in October 1943, which ceased to exist after the Liberation of Albania. It included at the time of its creation more than 500 armed troops, the vast majority of whom were Albanians from the Greek part of Chameria region and the rest from the Albanian part, and about 40 members of the Greek minority in Albania.
Background
On April 7, 1939, Italian troops invaded Albania. The operation was led by General Alfredo Guzzoni. Despite some stubborn resistance by some patriots, especially at Durrës, the Italians made short work of the Albanians. Durrës was captured on April 7, Tirana the following day, Shkodër and Gjirokastër on April 9, and almost the entire country by April 10.
Unwilling to become an Italian puppet, King Zog, his wife, Queen Geraldine Apponyi, and their infant son Leka fled to Greece and eventually to London. On April 12, the Albanian parliament voted to depose Zog and unite the nation with Italy "in personal union" by offering the Albanian crown to Victor Emmanuel III.
Formation and renaming
On 15 June 1943, members of unorganized resistance groups in Southern Albania and Northwestern Greece decided to create the Chameria battalion, during the meeting of the Regional Committee of the National Anti-fascist Liberation Army in Konispol. The decision was adopted on June 30, 1943, when three resistance groups were united. These groups included the Tahsini group based in Konispol, the Father Stathi Melani group based in Filiates, and the Alush Taka group based in Paramithia. Each group numbered about 170-180 members, from which only 75 were not Cham Albanians, of whom 35 were from Delvinë and 40 were members of the Greek minority in Albania.
This battalion was the first big partisan organization in the Gjirokastër County (which at that time included Gjirokastër, Sarandë and Delvinë districts) and head as leader Haki Rushit Shehu from Konispol and as group leaders, Taho Mehmet Sejko from Filiates, Lefter Miço Talo from Ampelia (), Ali Demi from Filiates and as political commissar, Qazim Kondi from Polyneri ().
On October 10, 1943, the battalion was renamed as IV Chameria Group , which had more than 2 thousand troops, about half of them were Cham Albanians, and the rest Albanians and Greeks from southern Albania.
Contribution to the war
Chameria battalion was one of the main contributors in resistance to Italian and German forces in southern Albania. Four major battles are recorded to this battalion. At the end of 1943, a group of Cham Albanians, led by Ali Demi, attacked a German garrison, in Vlora, Albania, killing 39 German troops and losing 12 members of the battalion, including Ali Demi himself.
The second major operation was after September 8, 1943, when Italy capitulated, Chameria battalion entered Delvinë and disarmed the local regiment of the Italian Army, on September 12, 1943.
The Italian source (G. Bonomi - Sacrificio italiano in terra albanese - La Prora; T. Scanagatta - Gli ultimi trenta giorini della divisione "Perugia" - Hoepli; and others) reports that on September 12, 1943 in Delvine there was only the 2nd battalion of 129 Infantry Regiment "Perugia". Not the whole regiment. And the battalion left Delvine, full armed, to "Argirocastro" called back from the Commander of the Division Gen. Chiminello. The same for the 3rd battalion in Giorgiokat.
The third operation was in the region between Konispol and Sagiada, on the next day, when they tried to disarm the local regiment of the Italian army in Saranda. They were forced to back in Sagiada by the Italian army, but in a counter-offensive managed to seize the regiment, disarm them and take all army equipments of the regiment in Saranda.
The same Italian source reports that In Saranda on September 13, 1943 there was no Regiment but 3.500 Italian soldier from many different corps. All of them left to Corfù 09/13/1943. There was no fight with the Chameria Battalion.
The fourth and final major operation occurred in the end October 1, 1943, when Chameria battalion managed to trap a squadre of German troops in the road between Filiates and Konispol and killed 12 Germans, taking their equipments.
After being transformed into the IV Chameria Group, its members took part in operations of the VI, VII, VIII and XII brigades of the Albanian National Liberation Army not only in Albania, but also in Kosovo, Montenegro and the Republic of Macedonia.
Aftermath
IV "Ali Demi" battalion
In 1944, Greek People's Liberation Army asked Cham Albanians living in Greece to create a battalion and to enlist in its ranks. Having a good relation with the Albanian Army, ELAS's and NAFLA's officers managed to persuade Chams to create armed forces under the ELAS army.
In May 1944, a group of local Cham Albanians, under the lead of Chameria battalion soldiers created the battalion named after Ali Demi, in the village Milea (), which was included in the 15th regiment of Greek People's Liberation Army. At the time of its creation, it comprised 460 partisans, consisting of both Cham Albanians and Greeks. "Ali Demi" battalion was the second largest of ELAS in the area of Epirus.
Being formed at the end of the war, the battalion had no considerable contribution in the liberation of Greece. More than 60 Chams were killed during a battle with German forces in Igoumenitsa. Other Cham Albanians were enlisted in VI, VII, IX and XI brigade of Greek People's Liberation Army, and fought in different mixed battalions of ELAS.
After the war
In an attempt to establish an ethnically pure border region, the Chams were evicted from northern Greece by guerrilla forces under the command of General Napoleon Zervas acting under the instructions of allied officers.
Muslim Cham Albanians that fled in Albania, were organised as refugees by the communist-led Albanian government. They formed a congress in 1946, adopted a memorandum, accused Greece for their persecution, and asked the international community to react in order to return to their homeland and to acquire reparations.
After their expulsion, these vets of ELAS, and the Cham Albanians from Greece, who took part in Chameria battalion formed in Albania the National Anti-Fascist Cham Committee, which was disbanded in 1947, when Cham Albanians lost their refugee status.
See also
Expulsion of Cham Albanians
Cham issue
Military history of Albania during World War II
IV "Ali Demi" battalion
References
Category:Cham Albanians
Category:Epirus in World War II
Category:Albania in World War II
Category:Battalions
Category:Chameria |
During a Sunday appearance on MSNBC’s “Kasie DC,” network foreign affairs analyst Brett McGurk, the former U.S. special envoy for the coalition against the Islamic State, weighed in on the U.S. military’s recent airstrikes in Baghdad to kill Iranian military leader Qasem Soleimani.
McGurk called the action a “big piece of business” that he said “means war” with Iran.
“When this happened about 96 hours ago or so, my immediate reaction was: number one, as someone who served in Iraq, there is an immediate sense of justice for the removal of Qasem Soleimani,” McGurk stated. “But number two, we need to presume that we are now at war with Iran. I don’t say that lightly. We can hope for the best, but the presumption is we’re at war with Iran.”
He continued, “[W]hat has happened since then with the statements, the tweets, the reporting, the shifting narratives from the administration, just shows a decision that clearly was not gamed out, was not well thought through. And for the President of the United States to say that we are prepared to strike 52 sites inside Iran with to congressional authorization, including cultural sites, which is clearly a violation of international law, stretches the boundaries of our constitutional republic to a real extreme. It’s almost unprecedented.”
Follow Trent Baker on Twitter @MagnifiTrent |
Introduction to Applications of SNPS
Accumulation of genetic changes affecting cell cycle control, cell differentiation, apoptosis, and DNA replication and repair lead to carcinogenesis (Bishop, J. M., “Molecular Themes In Oncogenesis,” Cell, 64(2):235-48 (1991)). DNA alterations include large deletions which inactivate tumor supressor genes, amplification to increase expression of oncogenes, and most commonly single nucleotide mutations or polymorphisms which impair gene expression or gene function or predispose an individual to further genomic instability (Table 1).
TABLE 1Genetic Alterations Commonly Found in the Human GenomeType of AlterationPossible Causes of AlterationPossible Consequences of AlterationDetection of AlterationSingle nucleotideInherited variationSilent does not alter functionDNA sequencingpolymorphismMethylationMissense: alters gene functionSSCP, DGGE, CDGE(SNP)CarcinogensNonsense: truncates geneProtein truncationDefective repair genesMismatch cleavageMicrosatelliteDefective DNA repair genesFrameshift truncates geneMicrosatellite Analysisinstability (MIN)CarcinogensLarge deletionsDefective DNA repair genesLoss of gene functionLoss of heterozygosityDefective DNA replication genesCGHIllegitimate recombinationSNP analysisDouble strand breakDNA amplificationsDefective DNA repair genesOverexpression of geneCompetitive PCRDefective DNA replication genesCGHIllegitimate recombinationSNP analysisOthers:Defective methylase genesGene silencing or overexpression,Endonuclease digestionMethylation,Double strand breakcreation of chimeric proteinPCR, FISHTranslocationRapid detection of germline mutations in individuals at risk and accurate characterization of genetic changes in individual tumors would provide opportunities to improve early detection, prevention, prognosis, and specific treatment. However, genetic detection poses the problem of identifying a predisposing polymorphism in the germline or an index mutation in a pre-malignant lesion or early cancer that may be present at many potential sites in many genes. Furthermore, quantification of allele copy number is necessary to detect gene amplification and deletion. Therefore, technologies are urgently needed that can rapidly detect mutation, allele deletion, and allele amplification in multiple genes. Single nucleotide polymorphisms (“SNP”s) are potentially powerful genetic markers for early detection, diagnosis, and staging of human cancers.
Identification of DNA sequence polymorphisms is the cornerstone of modern genome mapping. Initially, maps were created using RFLP markers (Botstein, D., et al., “Construction Of A Genetic Linkage Map In Man Using Restriction Fragment Length Polymorphisms,” Amer. J. Hum. Genet., 32:314-331 (1980)), and later by the more polymorphic dinucleotide repeat sequences (Weber, J. L. et al., “Abundant Class Of Human DNA Polymorphisms Which Can Be Typed Using The Polymerase Chain Reaction,” Amer. J. Hum. Genet., 44:388-396 (1989) and Reed, P. W., et al., “Chromosome-Specific Microsatellite Sets For Fluorescence-Based, Semi-Automated Genome Mapping,” Nat Genet, 7(3): 390-5 (1994)). Such sequence polymorphisms may also be used to detect inactivation of tumor suppressor genes via LOH and activation of oncogenes via amplification. These genomic changes are currently being analyzed using conventional Southern hybridizations, competitive PCR, real-time PCR, microsatellite marker analysis, and comparative genome hybridization (CGH) (Ried, T., et al., “Comparative Genomic Hybridization Reveals A Specific Pattern Of Chromosomal Gains And Losses During The Genesis Of Colorectal Tumors,” Genes, Chromosomes & Cancer, 15(4):234-45 (1996), Kallioniemi, et al., “ERBB2 Amplification In Breast Cancer Analyzed By Fluorescence In Situ Hybridization,” Proc Natl Acad Sci USA, 89(12):5321-5 (1992), Kallioniemi, et al., “Comparative Genomic Hybridization: A Rapid New Method For Detecting And Mapping DNA Amplification In Tumors,” Semin Cancer Biol, 4(1):41-6 (1993), Kallioniemi, et al., “Detection And Mapping Of Amplified DNA Sequences In Breast Cancer By Comparative Genomic Hybridization,” Proc Natl Acad Sci USA, 91(6):2156-60 (1994), Kallioniemi, et al., “Identification Of Gains And Losses Of DNA Sequences In Primary Bladder Cancer By Comparative Genomic Hybridization,” Genes Chromosom Cancer, 12(3):213-9 (1995), Schwab, M., et al., “Amplified DNA With Limited Homology To Myc Cellular Oncogene Is Shared By Human Neuroblastoma Cell Lines And A Neuroblastoma Tumour,” Nature, 305(5931):245-8 (1983), Solomon, E., et al., “Chromosome 5 Allele Loss In Human Colorectal Carcinomas,” Nature, 328(6131):616-9 (1987), Law, D. J., et al., “Concerted Nonsyntenic Allelic Loss In Human Colorectal Carcinoma,” Science, 241(4868):961-5 (1988), Frye, R. A., et al., “Detection Of Amplified Oncogenes By Differential Polymerase Chain Reaction,” Oncogene, 4(9):1153-7 (1989), Neubauer, A., et al., “Analysis Of Gene Amplification In Archival Tissue By Differential Polymerase Chain Reaction,” Oncogene, 7(5):1019-25 (1992), Chiang, P. W., et al., “Use Of A Fluorescent-PCR Reaction To Detect Genomic Sequence Copy Number And Transcriptional Abundance,” Genome Research, 6(10):1013-26 (1996), Heid, C. A., et al., “Real Time Quantitative PCR,” Genome Research, 6(10):986-94 (1996), Lee, H. H., et al., “Rapid Detection Of Trisomy 21 By Homologous Gene Quantitative PCR (HGQ-PCR),” Human Genetics, 99(3):364-7 (1997), Boland, C. R., et al., “Microallelotyping Defines The Sequence And Tempo Of Allelic Losses At Tumour Suppressor Gene Loci During Colorectal Cancer Progression,” Nature Medicine, 1(9):902-9 (1995), Cawkwell, L., et al., “Frequency Of Allele Loss Of DCC, p53, RBI, WT1, NF1, NM23 And APC/MCC In Colorectal Cancer Assayed By Fluorescent Multiplex Polymerase Chain Reaction,” Br J Cancer, 70(5):813-8 (1994), and Hampton, G. M., et al., “Simultaneous Assessment Of Loss Of Heterozygosity At Multiple Microsatellite Loci Using Semi-Automated Fluorescence-Based Detection: Subregional Mapping Of Chromosome 4 In Cervical Carcinoma,” Proceedings of the National Academy of Sciences of the United States of America, 93(13):6704-9 (1996)). Competitive and real-time PCR are considerably faster and require less material than Southern hybridization, although neither technique is amenable to multiplexing. Current multiplex microsatellite marker approaches require careful attention to primer concentrations and amplification conditions. While PCR products may be pooled in sets, this requires an initial run on agarose gels to approximate the amount of DNA in each band (Reed, P. W., et al., “Chromosome-Specific Microsatellite Sets For Fluorescence-Based, Semi-Automated Genome Mapping,” Nat Genet, 7(3): 390-5 (1994), and Hampton, G. M., et al., “Simultaneous Assessment Of Loss Of Heterozygosity At Multiple Microsatellite Loci Using Semi-Automated Fluorescence-Based Detection: Subregional Mapping Of Chromosome 4 In Cervical Carcinoma,” Proc. Nat'l. Acad. Sci. USA, 93(13):6704-9 (1996)). CGH provides a global assessment of LOH and amplification, but with a resolution range of about 20 Mb. To improve gene mapping and discovery, new techniques are urgently needed to allow for simultaneous detection of multiple genetic alterations.
Amplified fragment length polymorphism (“AFLP”) technology is a powerful DNA fingerprinting technique originally developed to identify plant polymorphisms in genomic DNA. It is based on the selective amplification of restriction fragments from a total digest of genomic DNA.
The original technique involved three steps: (1) restriction of the genomic DNA, i.e. with EcoRI and MseI, and ligation of oligonucleotide adapters, (2) selective amplification of a subset of all the fragments in the total digest using primers which reached in by from 1 to 3 bases, and (3) gel-based analysis of the amplified fragments. Janssen, et al., “Evaluation of the DNA Fingerprinting Method AFLP as an New Tool in Bacterial Taxonomy,” Microbiology, 142(Pt 7):1881-93 (1996); Thomas, et al., “Identification of Amplified Restriction Fragment Polymorphism (AFLP) Markers Tightly Linked to the Tomato Cf-9 Gene for Resistance to Cladosporium fulvum,”. Plant J, 8(5):785-94 (1995); Vos, et al., “AFLP: A New Technique for DNA Fingerprinting,” Nucleic Acids Res, 23(21):4407-14 (1995); Bachem, et al., “Visualization of Differential Gene Expression Using a Novel Method of RNA Fingerprinting Based on AFLP: Analysis of Gene Expression During Potato Tuber Development,” Plant J, 9(5):745-53 (1996); and Meksem, et al., “A High-Resolution Map of the Vicinity of the R1 Locus on Chromosome V of Potato Based on RFLP and AFLP Markers,” Mol Gen Genet, 249(1):74-81 (1995), which are hereby incorporated by reference.
AFLP differs substantially from the present invention because it: (i) uses palindromic enzymes, (ii) amplifies both desired EcoRI-MseI as well as unwanted MseI-MseI fragments, and (iii) does not identify both alleles when a SNP destroys a pre-existing restriction site. Further, AFLP does not identify SNPs which are outside restriction sites. AFLP does not, and was not designed to create a map of a genome.
Representational Difference Analysis (RDA) was developed by N. Lisitsyn and M. Wigler to isolate the differences between two genomes (Lisitsyn, et al., “Cloning the Differences Between Two Complex Genomes,” Science, 259:946-951 (1993), Lisitsyn, et al., “Direct Isolation of Polymorphic Markers Linked to a Trait by Genetically Directed Representational Difference Analysis,” Nat Genet, 6(1):57-63 (1994); Lisitsyn, et al., “Comparative Genomic Analysis of Tumors: Detection of DNA Losses and Amplification,” Proc Natl Acad Sci USA, 92(1):151-5 (1995); Thiagalingam, et al., “Evaluation of the FHIT Gene in Colorectal Cancers,” Cancer Res, 56(13):2936-9 (1996), Li, et al., “PTEN, a Putative Protein Tyrosine Phosphatase Gene Mutated in Human Brain, Breast, and Prostate Cancer,” Science, 275(5308):1943-7 (1997); and Schutte, et al., “Identification by Representational Difference Analysis of a Homozygous Deletion in Pancreatic Carcinoma That Lies Within the BRCA2 Region,” Proc Natl Acad Sci USA, 92(13):5950-4 (1995). The system was developed in which subtractive and kinetic enrichment was used to purify restriction endonuclease fragments present in one DNA sample, but not in another. The representational part is required to reduce the complexity of the DNA and generates “amplicons”. This allows isolation of probes that detect viral sequences in human DNA, polymorphisms, loss of heterozygosities, gene amplifications, and genome rearrangements.
The principle is to subtract “tester” amplicons from an excess of “driver” amplicons. When the tester DNA is tumor DNA and the driver is normal DNA, one isolates gene amplifications. When the tester DNA is normal DNA and the driver is tumor DNA, one isolates genes which lose function (i.e. tumor suppressor genes).
A brief outline of the procedure is provided herein: (i) cleave both tester and driver DNA with the same restriction endonuclease, (ii) ligate unphosphorylated adapters to tester DNA, (iii) mix a 10-fold excess of driver to tester DNA, melt and hybridize, (iv) fill in ends, (v) add primer and PCR amplify, (vi) digest ssDNA with mung bean nuclease, (vii) PCR amplify, (viii) repeat steps (i) to (vii) for 2-3 rounds, (ix) clone fragments and sequence.
RDA differs substantially from the present invention because it: (i) is a very complex procedure, (ii) is used to identify only a few differences between a tester and driver sample, and (iii) does not identify both alleles when a SNP destroys a pre-existing restriction site. Further, RDA does not identify SNPs which are outside restriction sites. RDA does not, and was not designed to create a map of a genome.
The advent of DNA arrays has resulted in a paradigm shift in detecting vast numbers of sequence variation and gene expression levels on a genomic scale (Pease, A. C., et al., “Light-Generated Oligonucleotide Arrays For Rapid DNA Sequence Analysis,” Proc Natl Acad Sci USA, 91(11):5022-6 (1994), Lipshutz, R. J., et al., “Using Oligonucleotide Probe Arrays To Access Genetic Diversity,” Biotechniques, 19(3):442-7 (1995), Eggers, M., et al., “A Microchip For Quantitative Detection Of Molecules Utilizing Luminescent And Radioisotope Reporter Groups,” Biotechniques, 17(3):516-25 (1994), Guo, Z., et al., “Direct Fluorescence Analysis Of Genetic Polymorphisms By Hybridization With Oligonucleotide Arrays On Glass Supports,” Nucleic Acids Res, 22(24):5456-65 (1994), Beattie, K. L., et al., “Advances In Genosensor Research,” Clinical Chemistry, 41(5):700-6 (1995), Hacia, J. G., et al., “Detection Of Heterozygous Mutations In BRCA1 Using High Density Oligonucleotide Arrays And Two-Colour Fluorescence Analysis,” Nature Genetics, 14(4):441-7 (1996), Chee, M., et al., “Accessing Genetic Information With High-Density DNA Arrays,” Science, 274(5287):610-4 (1996), Cronin, M. T., et al., “Cystic Fibrosis Mutation Detection By Hybridization To Light-Generated DNA Probe Arrays,” Hum Mutat, 7(3):244-55 (1996), Drobyshev, A., et al., “Sequence Analysis By Hybridization With Oligonucleotide Microchip: Identification Of Beta-Thalassemia Mutations,” Gene, 188(1):45-52 (1997), Kozal, M. J., et al., “Extensive Polymorphisms Observed In HIV-1 Clade B Protease Gene Using High-Density Oligonucleotide Arrays,” Nature Medicine, 2(7):753-9 (1996), Yershov, G., et al., “DNA Analysis And Diagnostics On Oligonucleotide Microchips,” Proc Natl Acad Sci USA, 93(10):4913-8 (1996), DeRisi, J., et al., “Use Of A CDNA Microarray To Analyse Gene Expression Patterns In Human Cancer,” Nature Genetics, 14(4):457-60 (1996), Schena, M., et al., “Parallel Human Genome Analysis: Microarray-Based Expression Monitoring Of 1000 Genes,” Proc. Nat'l. Acad. Sci. USA, 93(20):10614-9 (1996), Shalon, D., et al., “A DNA Microarray System For Analyzing Complex DNA Samples Using Two-Color Fluorescent Probe Hybridization,” Genome Research, 6(7):639-45 (1996)). Determining deletions, amplifications, and mutations at the DNA level will complement the information obtained from expression profiling of tumors (DeRisi, J., et al., “Use Of A cDNA Microarray To Analyse Gene Expression Patterns In Human Cancer,” Nature Genetics, 14(4):457-60 (1996), and Zhang, L., et al., “Gene Expression Profiles In Normal And Cancer Cells,” Science, 276:1268-1272 (1997)). DNA chips designed to distinguish single nucleotide differences are generally based on the principle of “sequencing by hybridization” (Lipshutz, R. J., et al., “Using Oligonucleotide Probe Arrays To Access Genetic Diversity,” Biotechniques, 19(3):442-7 (1995), Eggers, M., et al., “A Microchip For Quantitative Detection Of Molecules Utilizing Luminescent And Radioisotope Reporter Groups,” Biotechniques, 17(3):516-25 (1994), Guo, Z., et al., “Direct Fluorescence Analysis Of Genetic Polymorphisms By Hybridization With Oligonucleotide Arrays On Glass Supports,” Nucleic Acids Res, 22(24):5456-65 (1994), Beattie, K. L., et al., “Advances In Genosensor Research,” Clinical Chemistry, 41(5):700-6 (1995), Hacia, J. G., et al., “Detection Of Heterozygous Mutations In BRCA1 Using High Density Oligonucleotide Arrays And Two-Colour Fluorescence Analysis,” Nature Genetics, 14(4):441-7 (1996), Chee, M., et al., “Accessing Genetic Information With High-Density DNA Arrays,” Science, 274(5287):610-4 (1996), Cronin, M. T., et al., “Cystic Fibrosis Mutation Detection By Hybridization To Light-Generated DNA Probe Arrays,” Hum Mutat, 7(3):244-55 (1996), Drobyshev, A., et al., “Sequence Analysis By Hybridization With Oligonucleotide Microchip: Identification Of Beta-Thalassemia Mutations,” Gene, 188(1):45-52 (1997), Kozal, M. J., et al., “Extensive Polymorphisms Observed In HIV-1 Clade B Protease Gene Using High-Density Oligonucleotide Arrays,” Nature Medicine, 2(7):753-9 (1996), and Yershov, G., et al., “DNA Analysis And Diagnostics On Oligonucleotide Microchips,” Proc Natl Acad Sci USA, 93(10):4913-8 (1996)), or polymerase extension of arrayed primers (Nikiforov, T. T., et al., “Genetic Bit Analysis: A Solid Phase Method For Typing Single Nucleotide Polymorphisms,” Nucleic Acids Research, 22(20):4167-75 (1994), Shumaker, J. M., et al., “Mutation Detection By Solid Phase Primer Extension,” Human Mutation, 7(4):346-54 (1996), Pastinen, T., et al., “Minisequencing: A Specific Tool For DNA Analysis And Diagnostics On Oligonucleotide Arrays,” Genome Research, 7(6):606-14 (1997), and Lockley, A. K., et al., “Colorimetric Detection Of Immobilised PCR Products Generated On A Solid Support,” Nucleic Acids Research, 25(6):1313-4 (1997) (See Table 2)). While DNA chips can confirm a known sequence, similar hybridization profiles create ambiguities in distinguishing heterozygous from homozygous alleles (Eggers, M., et al., “A Microchip For Quantitative Detection Of Molecules Utilizing Luminescent And Radioisotope Reporter Groups,” Biotechniques, 17(3):516-25 (1994), Beattie, K. L., et al., “Advances In Genosensor Research,” Clinical Chemistry, 41(5):700-6 (1995), Chee, M., et al., “Accessing Genetic Information With High-Density DNA Arrays,” Science, 274(5287):610-4 (1996), Kozal, M. J., et al., “Extensive Polymorphisms Observed In HIV-1 Clade B Protease Gene Using High-Density Oligonucleotide Arrays,” Nature Medicine, 2(7):753-9 (1996), and Southern, E. M., “DNA Chips: Analysing Sequence By Hybridization To Oligonucleotides On A Large Scale,” Trends in Genetics, 12(3):110-5 (1996)). Attempts to overcome this problem include using two-color fluorescence analysis (Hacia, J. G., et al., “Detection Of Heterozygous Mutations In BRCA1 Using High Density Oligonucleotide Arrays And Two-Colour Fluorescence Analysis,” Nature Genetics, 14(4):441-7 (1996)), 40 overlapping addresses for each known polymorphism (Cronin, M. T., et al., “Cystic Fibrosis Mutation Detection By Hybridization To Light-Generated DNA Probe Arrays,” Hum Mutat, 7(3):244-55 (1996)), nucleotide analogues in the array sequence (Guo, Z., et al., “Enhanced Discrimination Of Single Nucleotide Polymorphisms By Artificial Mismatch Hybridization,” Nature Biotech., 15:331-335 (1997)), or adjacent co-hybridized oligonucleotides (Drobyshev, A., et al., “Sequence Analysis By Hybridization With Oligonucleotide Microchip: Identification Of Beta-Thalassemia Mutations,” Gene, 188(1):45-52 (1997) and Yershov, G., et al., “DNA Analysis And Diagnostics On Oligonucleotide Microchips,” Proc Natl Acad Sci USA, 93(10):4913-8 (1996)). In a side-by-side comparison, nucleotide discrimination using the hybridization chips fared an order of magnitude worse than using primer extension (Pastinen, T., et al., “Minisequencing: A Specific Tool For DNA Analysis And Diagnostics On Oligonucleotide Arrays,” Genome Research, 7(6):606-14 (1997)). Nevertheless, solid phase primer extension also generates false positive signals from mononucleotide repeat sequences, template-dependent errors, and template-independent errors (Nikiforov, T. T., et al., “Genetic Bit Analysis: A Solid Phase Method For Typing Single Nucleotide Polymorphisms,” Nucl. Acids Res., 22(20):4167-75 (1994) and Shumaker, J. M., et al., “Mutation Detection By Solid Phase Primer Extension,” Human Mutation, 7(4):346-54 (1996)).
Over the past few years, an alternate strategy in DNA array design has been pursued. Combined with solution-based polymerase chain reaction/ligase detection assay (PCR/LDR) this array allows for accurate quantification of each SNP allele (See Table 2).
TABLE 2Comparison of high-throughput techniques to quantify known SNPs in clinical samples.TechniqueAdvantagesDisadvantagesHybridization on1) High density: up to 135,000 addresses.1) Specificity determined by hybridizationDNA array2) Scan for SNPs in thousands of loci.difficult to distinguish all SNPs.3) Detects small insertions/deletionsdifficult to quantify allelic imbalance2) Each new DNA target requires a new arrayMini-sequencing1) Uses high fidelity polymerase extension1) Cannot detect small insertions/deletions.(SNuPE) onminimizes false positive signal.2) Each new DNA target requires a new array.DNA array2) Potential for single-tube assayPCR/LDR with1) Uses high fidelity thermostable ligase;1) Requires synthesis of many ligation primerszip-code captureminimizes false positive signal.on universal2) Separates SNP identification from signal capture;DNA arrayavoids problems of false hybridization3) Quantify gene amplifications and deletions.4) Universal array works for all gene targets.For high throughput detection of specific multiplexed LDR products, unique addressable array-specific sequences on the LDR probes guide each LDR product to a designated address on a DNA array, analogous to molecular tags developed for bacterial and yeast genetics genetics (Hensel, M., et al., “Simultaneous Identification Of Bacterial Virulence Genes By Negative Selection,” Science, 269(5222):400-3 (1995) and Shoemaker, D. et al., “Quantitative Phenotypic Analysis Of Yeast Deletion Mutants Using A Highly Parallel Molecular Bar-Coding Strategy,” Nat Genet, 14(4):450-6 (1996)). The specificity of this reaction is determined by a thermostable ligase which allows detection of (i) dozens to hundreds of polymorphisms in a single-tube multiplex format, (ii) small insertions and deletions in repeat sequences, and (iii) low level polymorphisms in a background of normal DNA. By uncoupling polymorphism identification from hybridization, each step may be optimized independently, thus allowing for quantitative assessment of allele imbalance even in the presence of stromal cell contamination. This approach has the potential to rapidly identify multiple gene deletions and amplifications associated with tumor progression, as well as lead to the discovery of new oncogenes and tumor suppressor genes. Further, the ability to score hundreds to thousands of SNPs has utility in linkage studies (Nickerson, D. A., et al., “Identification Of Clusters Of Biallelic Polymorphic Sequence-Tagged Sites (pSTSs) That Generate Highly Informative And Automatable Markers For Genetic Linkage Mapping,” Genomics, 12(2):377-87 (1992), Lin, Z., et al., “Multiplex Genotype Determination At A Large Number Of Gene Loci,” Proc Natl Acad Sci USA, 93(6):2582-7 (1996), Fanning, G. C., et al., “Polymerase Chain Reaction Haplotyping Using 3′ Mismatches In The Forward And Reverse Primers: Application To The Biallelic Polymorphisms Of Tumor Necrosis Factor And Lymphotoxin Alpha,” Tissue Antigens, 50(1):23-31 (1997), and Kruglyak, L., “The Use of a Genetic Map of Biallelic Markers in Linkage Studies,” Nature Genetics, 17:21-24 (1997)), human identification (Delahunty, C., et al., “Testing The Feasibility Of DNA Typing For Human Identification By PCR And An Oligonucleotide Ligation Assay,” Am. J. Hum. Gen., 58(6):1239-46 (1996) and Belgrader, P., et al., “A Multiplex PCR-Ligase Detection Reaction Assay For Human Identity Testing,” Gen. Sci. & Tech., 1:77-87 (1996)), and mapping complex human diseases using association studies where SNPs are identical by decent (Collins, F. S., “Positional Cloning Moves From Perditional To Traditional,” Nat Genet, 9(4):347-50 (1995), Lander, E. S., “The New Genomics: Global Views Of Biology,” Science, 274(5287):536-9 (1996), Risch, N. et al., “The Future Of Genetic Studies Of Complex Human Diseases,” Science, 273(5281):1516-7 (1996), Cheung, V. G. et al., “Genomic Mismatch Scanning Identifies Human Genomic DNA Shared Identical By Descent,” Genomics, 47(1):1-6 (1998), Heung, V. G., et al., “Linkage-Disequilibrium Mapping Without Genotyping,” Nat Genet, 18(3):225-230 (1998), and McAllister, L., et al., “Enrichment For Loci Identical-By-Descent Between Pairs Of Mouse Or Human Genomes By Genomic Mismatch Scanning,” Genomics, 47(1):7-11 (1998)).
For 85% of epithelial cancers, loss of heterozygosity and gene amplification are the most frequently observed changes which inactivate the tumor suppressor genes and activate the oncogenes. Southern hybridizations, competitive PCR, real time PCR, microsatellite marker analysis, and comparative genome hybridization (CGH) have all been used to quantify changes in chromosome copy number (Ried, T., et al., “Comparative Genomic Hybridization Reveals A Specific Pattern Of Chromosomal Gains And Losses During The Genesis Of Colorectal Tumors,” Genes, Chromosomes & Cancer, 15(4):234-45 (1996), Kallioniemi, et al., “ERBB2 Amplification In Breast Cancer Analyzed By Fluorescence In Situ Hybridization,” Proc Natl Acad Sci USA, 89(12):5321-5 (1992), Kallioniemi, et al., “Comparative Genomic Hybridization: A Rapid New Method For Detecting And Mapping DNA Amplification In Tumors,” Semin Cancer Biol, 4(1):41-6 (1993), Kallioniemi, et al., “Detection And Mapping Of Amplified DNA Sequences In Breast Cancer By Comparative Genomic Hybridization,” Proc Natl Acad Sci USA, 91(6):2156-60 (1994), Kallioniemi, et al., “Identification Of Gains And Losses Of DNA Sequences In Primary Bladder Cancer By Comparative Genomic Hybridization,” Genes Chromosom Cancer, 12(3):213-9 (1995), Schwab, M., et al., “Amplified DNA With Limited Homology To Myc Cellular Oncogene Is Shared By Human Neuroblastoma Cell Lines And A Neuroblastoma Tumour,” Nature, 305(5931):245-8 (1983), Solomon, E., et al., “Chromosome 5 Allele Loss In Human Colorectal Carcinomas,” Nature, 328(6131):616-9 (1987), Law, D. J., et al., “Concerted Nonsyntenic Allelic Loss In Human Colorectal Carcinoma,” Science, 241(4868):961-5 (1988), Frye, R. A., et al., “Detection Of Amplified Oncogenes By Differential Polymerase Chain Reaction,” Oncogene, 4(9):1153-7 (1989), Neubauer, A., et al., “Analysis Of Gene Amplification In Archival Tissue By Differential Polymerase Chain Reaction,” Oncogene, 7(5):1019-25 (1992), Chiang, P. W., et al., “Use Of A Fluorescent-PCR Reaction To Detect Genomic Sequence Copy Number And Transcriptional Abundance,” Genome Research, 6(10):1013-26 (1996), Heid, C. A., et al., “Real Time Quantitative PCR,” Genome Research, 6(10):986-94 (1996), Lee, H. H., et al., “Rapid Detection Of Trisomy 21 By Homologous Gene Quantitative PCR (HGQ-PCR),” Human Genetics, 99(3):364-7 (1997), Boland, C. R., et al., “Microallelotyping Defines The Sequence And Tempo Of Allelic Losses At Tumour Suppressor Gene Loci During Colorectal Cancer Progression,” Nature Medicine, 1(9):902-9 (1995), Cawkwell, L., et al., “Frequency Of Allele Loss Of DCC, p53, RBI, WT1, NF1, NM23 And APC/MCC In Colorectal Cancer Assayed By Fluorescent Multiplex Polymerase Chain Reaction,” Br J Cancer, 70(5):813-8 (1994), and Hampton, G. M., et al., “Simultaneous Assessment Of Loss Of Heterozygosity At Multiple Microsatellite Loci Using Semi-Automated Fluorescence-Based Detection: Subregional Mapping Of Chromosome 4 In Cervical Carcinoma,” Proc. Nat'l. Acad. Sci. USA, 93(13):6704-9 (1996)). Recently, a microarray of consecutive BACs from the long arm of chromosome 20 has been used to accurately quantify 5 regions of amplification and one region of LOH associated with development of breast cancer. This area was previously thought to contain only 3 regions of amplification (Tanner, M. et al., “Independent Amplification And Frequent Co-Amplification Of Three Nonsyntenic Regions On The Long Arm Of Chromosome 20 In Human Breast Cancer,” Cancer Research, 56(15):3441-5 (1996)). Although this approach will yield valuable information from cell lines, it is not clear it will prove quantitative when starting with microdissected tissue which require PCR amplification. Competitive and real time PCR approaches require careful optimization to detect 2-fold differences (Frye, R. A., et al., “Detection Of Amplified Oncogenes By Differential Polymerase Chain Reaction,” Oncogene, 4(9):1153-7 (1989), Neubauer, A., et al., “Analysis Of Gene Amplification In Archival Tissue By Differential Polymerase Chain Reaction,” Oncogene, 7(5):1019-25 (1992), Chiang, P. W., et al., “Use Of A Fluorescent-PCR Reaction To Detect Genomic Sequence Copy Number And Transcriptional Abundance,” Genome Research, 6(10):1013-26 (1996), Heid, C. A., et al., “Real Time Quantitative PCR,” Genome Research, 6(10):986-94 (1996), and Lee, H. H., et al., “Rapid Detection Of Trisomy 21 By Homologous Gene Quantitative PCR (HGQ-PCR),” Human Genetics, 99(3):364-7 (1997)). Unfortunately, stromal contamination may reduce the ratio between tumor and normal chromosome copy number to less than 2-fold. By using a quantitative SNP-DNA array detection, each allele can be distinguished independently, thus reducing the effect of stromal contamination in half. Further by comparing the ratio of allele-specific LDR product formed from a tumor to control gene between a tumor and normal sample, it may be possible to distinguish gene amplification from loss of heterozygosity at multiple loci in a single reaction.
Using PCR/LDR to Detect SNPs.
The ligase detection reaction (“LDR”) is ideal for multiplexed discrimination of single-base mutations or polymorphisms (Barany, F., et al., “Cloning, Overexpression, And Nucleotide Sequence Of A Thermostable DNA Ligase Gene,” Gene, 109:1-11 (1991), Barany, F., “Genetic Disease Detection And DNA Amplification Using Cloned Thermostable Ligase,” Proc. Natl. Acad. Sci. USA, 88:189-193 (1991), and Barany, F., “The Ligase Chain Reaction (LCR) In A PCR World,” PCR Methods and Applications, 1:5-16 (1991)). Since there is no polymerization step, several probe sets can ligate along a gene without interference. The optimal multiplex detection scheme involves a primary PCR amplification, followed by either LDR (two probes, same strand) or ligase chain reaction (“LCR”) (four probes, both strands) detection. This approach has been successfully applied for simultaneous multiplex detection of 61 cystic fibrosis alleles (Grossman, P. D., et al., “High-Density Multiplex Detection Of Nucleic Acid Sequences: Oligonucleotide Ligation Assay And Sequence-Coded Separation,” Nucleic Acids Res., 22:4527-4534 (1994) and Eggerding, F. A., et al., “Fluorescence-Based Oligonucleotide Ligation Assay For Analysis Of Cystic Fibrosis Transmembrane Conductance Regulator Gene Mutations,” Human Mutation, 5:153-165 (1995)), 6 hyperkalemic periodic paralysis alleles (Feero, W. T., et al., “Hyperkalemic Periodic Paralysis: Rapid Molecular Diagnosis And Relationship Of Genotype To Phenotype In 12 Families,” Neurology, 43:668-673 (1993)), and 20 21-hydroxylase deficiency alleles (Day, D., et al., “Detection Of Steroid 21 Hydroxylase Alleles Using Gene-Specific PCR And A Multiplexed Ligation Detection Reaction,” Genomics, 29:152-162 (1995) and Day, D. J., et al., “Identification Of Non-Amplifying CYP21 Genes When Using PCR-Based Diagnosis Of 21-Hydroxylase Deficiency In Congenital Adrenal Hyperplasia (CAH) Affected Pedigrees,” Hum Mol Genet, 5(12):2039-48 (1996)).
21-hydroxylase deficiency has the highest carrier rate of any genetic disease, with 6% of Ashkenazi Jews being carriers. Approximately 95% of mutations causing 21-hydroxylase deficiency are the result of recombinations between an inactive pseudogene termed CYP21P and the normally active gene termed CYP21, which share 98% sequence homology (White, P. C., et al., “Structure Of Human Steroid 21-Hydroxylase Genes,” Proc. Natl. Acad. Sci. USA, 83:5111-5115 (1986)). PCR/LDR was developed to rapidly determine heterozygosity or homozygosity for any of the 10 common apparent gene conversions in CYP21. By using allele-specific PCR, defined regions of CYP21 are amplified without amplifying the CYP21P sequence. The presence of wild-type or pseudogene mutation is subsequently determined by fluorescent LDR. Discriminating oligonucleotides complementary to both CYP21 and CYP21P are included in equimolar amounts in a single reaction tube so that a signal for either active gene, pseudogene, or both is always obtained. PCR/LDR genotyping (of 82 samples) was able to readily type compound heterozygotes with multiple gene conversions in a multiplexed reaction, and was in complete agreement with direct sequencing/ASO analysis. This method was able to distinguish insertion of a single T nucleotide into a (T)7 tract, which cannot be achieved by allele-specific PCR alone (Day, D., et al., “Detection Of Steroid 21 Hydroxylase Alleles Using Gene-Specific PCR And A Multiplexed Ligation Detection Reaction,” Genomics, 29:152-162 (1995)). A combination of PCR/LDR and microsatellite analysis revealed some unusual cases of PCR allele dropout (Day, D. J., et al., “Identification Of Non-Amplifying CYP21 Genes When Using PCR-Based Diagnosis Of 21-Hydroxylase Deficiency In Congenital Adrenal Hyperplasia (CAH) Affected Pedigrees,” Hum Mol Genet, 5(12):2039-48 (1996)). The LDR approach is a single-tube reaction which enables multiple samples to be analyzed on a single polyacrylamide gel.
A PCR/LDR assay has been developed to detect germline mutations, found at high frequency (3% total), in BRCA1 and BRCA2 genes in the Jewish population. The mutations are: BRCA1, exon 2 185delAG; BRCA1, exon 20 5382insC; BRCA2, exon 11 6174delT. These mutations are more difficult to detect than most germline mutations, as they involve slippage in short repeat regions. A preliminary screening of 20 samples using multiplex PCR of three exons and LDR of six alleles in a single tube assay has successfully detected the three Ashkenazi BRCA1 and BRCA2 mutations.
Multiplexed PCR for Amplifying Many Regions of Chromosomal DNA Simultaneously.
A coupled multiplex PCR/PCR/LDR assay was developed to identify armed forces personnel. Several hundred SNPs in known genes with heterozygosities, >0.4 are currently listed. Twelve of these were amplified in a single PCR reaction as follows: Long PCR primers were designed to have gene-specific 3′ ends and 5′ ends complementary to one of two sets of PCR primers. The upstream primers were synthesized with either FAM- or TET-fluorescent labels. These 24 gene-specific primers were pooled and used at low concentration in a 15 cycle PCR. After this, the two sets of primers were added at higher concentrations and the PCR was continued for an additional 25 cycles. The products were separated on an automated ABD 373A DNA Sequencer. The use of these primers produces similar amounts of multiplexed products without the need to carefully adjust gene-specific primer concentrations or PCR conditions (Belgrader, P., et al., “A Multiplex PCR-Ligase Detection Reaction Assay For Human Identity Testing,” Genome Science and Technology, 1:77-87 (1996)). In a separate experiment, non-fluorescent PCR products were diluted into an LDR reaction containing 24 fluorescently labeled allele-specific LDR probes and 12 adjacent common LDR probes, with products separated on an automated DNA sequencer. LDR probe sets were designed in two ways: (i) allele-specific FAM- or TET-labeled LDR probes of uniform length, or (ii) allele-specific HEX-labeled LDR probes differing in length by two bases. A comparison of LDR profiles of several individuals demonstrated the ability of PCR/LDR to distinguish both homozygous and heterozygous genotypes at each locus (Id.). The use of PCR/PCR in human identification to simultaneously amplify 26 loci has been validated (Lin, Z., et al., “Multiplex Genotype Determination At A Large Number Of Gene Loci,” Proc Natl Acad Sci USA, 93(6):2582-7 (1996)), or ligase based detection to distinguish 32 alleles although the latter was in individual reactions (Nickerson, D. A., et al., “Identification Of Clusters Of Biallelic Polymorphic Sequence-Tagged Sites (pSTSs) That Generate Highly Informative And Automatable Markers For Genetic Linkage Mapping,” Genomics, 12(2):377-87 (1992)). This study validates the ability to multiplex both PCR and LDR reactions in a single tube, which is a prerequisite for developing a high throughput method to simultaneously detect SNPs throughout the genome.
For the PCR/PCR/LDR approach, two long PCR primers are required for each SNP analyzed. A method which reduces the need for multiple PCR primers would give significant savings in time and cost of a large-scale SNP analysis. The present invention is directed to achieving this objective. |
Q:
Gnome-terminal doesn't start any more after auto login to X
Tell me please is there any way to resolve this issue without installing a login manager please?
I've enabled the auto login for startx, following the steps from the beyond link:
How to make auto login work in Ubuntu? (no display manager)
Auto login is functioning now.
On the device is a command line installation from Minimal Lubuntu 16.10 mini.iso. without any desktop, only the Kernel and some restricted modules. The only environment installed is fluxbox.
After booting in Fluxbox, I can't open gnome-terminal at all, until I will not do the next steps. xterm can start.
ctrl+alt+del in the running Fluxbox, it will redirect me for a second-two in tty, but because auto login is enable it will redirect me back automatically from tty1 to Fluxbox. So, in order to remain in tty I will keep pressing continuously ctrl+c.
Now, being in tty I will
sudo -i
su myusername
startx
Being again in fluxbox, I can run the terminal normally.
Do you please have any clues please, why I can't open the terminal without doing the above?
Trying to start gnome-terminal from xterm when at the first login.
gnome-terminal
Error constructing proxy for org.gnome.Terminal:/org/gnome/Terminal/Factory0: Error calling StartServiceByName for org.gnome.Terminal: Timeout was reached
Excuse me, I am not sure that DBUS_SESSION_BUS_ADDRESS is active or not.
/var/log/Xorg.0.log
Output of env from xterm (after logging manually again to startx)
TERM=xterm
SHELL=/bin/bash
WINDOWID=8388621
XTERM_SHELL=/bin/bash
USER=root
LS_COLORS=rs=0:di=01;34:ln=01;36:mh=00:pi=40;33:so=01;35:do=01;35:bd=40;33;01:cd=40;33;01:or=40;31;01:mi=00:su=37;41:sg=30;43:ca=30;41:tw=30;42:ow=34;42:st=37;44:ex=01;32:*.tar=01;31:*.tgz=01;31:*.arc=01;31:*.arj=01;31:*.taz=01;31:*.lha=01;31:*.lz4=01;31:*.lzh=01;31:*.lzma=01;31:*.tlz=01;31:*.txz=01;31:*.tzo=01;31:*.t7z=01;31:*.zip=01;31:*.z=01;31:*.Z=01;31:*.dz=01;31:*.gz=01;31:*.lrz=01;31:*.lz=01;31:*.lzo=01;31:*.xz=01;31:*.bz2=01;31:*.bz=01;31:*.tbz=01;31:*.tbz2=01;31:*.tz=01;31:*.deb=01;31:*.rpm=01;31:*.jar=01;31:*.war=01;31:*.ear=01;31:*.sar=01;31:*.rar=01;31:*.alz=01;31:*.ace=01;31:*.zoo=01;31:*.cpio=01;31:*.7z=01;31:*.rz=01;31:*.cab=01;31:*.jpg=01;35:*.jpeg=01;35:*.gif=01;35:*.bmp=01;35:*.pbm=01;35:*.pgm=01;35:*.ppm=01;35:*.tga=01;35:*.xbm=01;35:*.xpm=01;35:*.tif=01;35:*.tiff=01;35:*.png=01;35:*.svg=01;35:*.svgz=01;35:*.mng=01;35:*.pcx=01;35:*.mov=01;35:*.mpg=01;35:*.mpeg=01;35:*.m2v=01;35:*.mkv=01;35:*.webm=01;35:*.ogm=01;35:*.mp4=01;35:*.m4v=01;35:*.mp4v=01;35:*.vob=01;35:*.qt=01;35:*.nuv=01;35:*.wmv=01;35:*.asf=01;35:*.rm=01;35:*.rmvb=01;35:*.flc=01;35:*.avi=01;35:*.fli=01;35:*.flv=01;35:*.gl=01;35:*.dl=01;35:*.xcf=01;35:*.xwd=01;35:*.yuv=01;35:*.cgm=01;35:*.emf=01;35:*.ogv=01;35:*.ogx=01;35:*.aac=00;36:*.au=00;36:*.flac=00;36:*.m4a=00;36:*.mid=00;36:*.midi=00;36:*.mka=00;36:*.mp3=00;36:*.mpc=00;36:*.ogg=00;36:*.ra=00;36:*.wav=00;36:*.oga=00;36:*.opus=00;36:*.spx=00;36:*.xspf=00;36:
SUDO_USER=xdpsx
SUDO_UID=1000
USERNAME=root
PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/usr/local/games
MAIL=/var/mail/root
PWD=/home/xdpsx
LANG=en_US.UTF-8
XTERM_LOCALE=en_US.UTF-8
XTERM_VERSION=XTerm(324)
HOME=/root
SUDO_COMMAND=/bin/su
SHLVL=2
LOGNAME=root
LESSOPEN=| /usr/bin/lesspipe %s
DISPLAY=:0.0
SUDO_GID=1000
LESSCLOSE=/usr/bin/lesspipe %s %s
XAUTHORITY=/home/xdpsx/.Xauthority
COLORTERM=truecolor
_=/usr/bin/env
Output of ps aux | grep dbus from xterm (after logging manually again to startx)
message+ 668 0.0 0.0 6420 3936 ? Ss 19:11 0:00 /usr/bin/dbus-daemon --system --address=systemd: --nofork --nopidfile --systemd-activation
nobody 811 0.0 0.1 9316 4000 ? S 19:11 0:00 /usr/sbin/dnsmasq --no-resolv --keep-in-foreground --no-hosts --bind-interfaces --pid-file=/var/run/NetworkManager/dnsmasq.pid --listen-address=127.0.1.1 --cache-size=0 --conf-file=/dev/null --proxy-dnssec --enable-dbus=org.freedesktop.NetworkManager.dnsmasq --conf-dir=/etc/NetworkManager/dnsmasq.d
xdpsx 1375 0.0 0.0 6136 3460 ? Ss 19:11 0:00 /usr/bin/dbus-daemon --session --address=systemd: --nofork --nopidfile --systemd-activation
xdpsx 1381 0.0 0.0 6136 3316 ? S 19:11 0:00 /usr/bin/dbus-daemon --config-file=/usr/share/defaults/at-spi2/accessibility.conf --nofork --print-address 3
xdpsx 1505 0.0 0.0 7004 312 ? S 19:12 0:00 dbus-launch --autolaunch fedd8908d0d244c498876a97f5b34c28 --binary-syntax --close-stderr
xdpsx 1506 0.0 0.0 6136 3060 ? Ss 19:12 0:00 /usr/bin/dbus-daemon --fork --print-pid 5 --print-address 7 --session
xdpsx 1529 0.0 0.0 6136 3356 ? S 19:14 0:00 /usr/bin/dbus-daemon --config-file=/usr/share/defaults/at-spi2/accessibility.conf --nofork --print-address 3
root 1834 0.0 0.0 5144 828 pts/1 S+ 19:25 0:00 grep --color=auto dbus
Thank you.
A:
I am seeing a similar problem since upgrading to Ubuntu 16.10. I discovered that I can fix the environment and start gnome-terminal like this:
dbus-update-activation-environment --systemd --all
gnome-terminal &
If that doesn't work, then you could try this:
dbus-launch gnome-terminal &
|
After working hard for the last few week we attended the second race weekend with the Mid-American Sprint Series at Briggs and Stratton Raceway Park, hosted by the Badger Kart Club. Jason had been struggling to conquer this very difficult track and find the best setup for his kart.
Badger’s track is a series of very tight, flat turns followed by a 3 straights with 90 degree left turns between them. If you can keep the momentum up through the all of the inner corners (instructions) and hit “no-mans land” (corner 10) just right and fly down the straights at top speed, you can catch your competitors. Jason has had only a handful of sessions on this track and most of them were in his kid kart almost two years ago. If he can get the hang of this track he should be able to apply the same principles on other tracks in the series. This is a real driver’s track, requiring a host of different cornering techniques and patience to find the precise line for your kart and style. Then, you can start to race the rest of the field.
The week before the race, we rested, attending school, doing homework, and playing baseball. We packed up the truck on Thursday night and set off for the track on Friday morning. The afternoon weather was expected to be nice after the morning rain. So we took our time getting packed, remembering to bring our clothes. We spent the afternoon running around with friends, fine tuning the kart, and practicing, often in that order. The last time we were there, lap times were mostly in the area of 49 to 50 seconds a lap, which is about 3 seconds off the pace. We both had work to do to find those seconds, but we would be happy running consistent 48s. Most of Jason’s time was lost in the corners. He was still slowing down too much on the entry, losing time getting back up to speed. At the end of the day he was getting closer, with a few 48s and a lot of low 49s, and signs of improvement.
Saturday had some of the most competitive racing of the weekend. Jason qualified 4th of 6 in his class for the pre-feature. In the pre-feature race, he got a good start and did not give up any places but did not gain any either. He held on until midway through when Dylan (#4 from Concept Haulers) was able to take advantage of a mistake in the hairpin and popped by Jason. Jason got stuck behind Dylan and this allowed Randy (#23 from Road America) to catch up to Jason. Two laps later Jason pulled back into 4th exiting no-mans land (turn 10) with more speed than Dylan, and held off Randy till the end.
In the feature race, Jason again stared in 4th. His start was not as aggressive this time, and was passed by Randy as they flew into turn one. Jason dogged him, working to pass him, corner after corner, lap after lap, trying to find the edge and looking for the mistake. Each time there was not quite enough room – the speed was just short, or histiming was off. At last, as they entered no-mans land for the 16th and the last time, Jason was right on Randy’s bumper and ready. As they exited the turn and headed down the straight, Randy was just a little too fast and little sideways, stripping his momentum. Jason made his move for the inside line and beat Randy to turn 11. His opponent overcome he pressed the pedal to the finish line for 4th place
.
The races on Sunday, also Mothers Day, were also excellent but it was a struggle to get there. Jason had crashed his bike at the track the night before and gave himself some good road rash and bruises. It was painful but superficial. When he woke up, he was immediately uninterested in racing and wanted to “just go home”.After some convincing, a bit of children’s Advil, caffeine, and strong fatherly cajoling (yup, I made him drive injured) he was convinced that he could and should race. He took to the track for qualifying and put in a respectable 48 second lap but only qualified 4th of 4. His start for the pre-feature was off and he was not able to take any advantage. A few laps later he had a good run on Randy again. They banged side by side into turn one and he got a good bump in the rear from Randy on the exit. From there it was downhill. The kart was very loose and he was not able to catch Randy again. It turned out that the last bump had moved his right rear wheel inward about an inch, throwing the kart’s handling out of whack. That said he still ran some his fastest laps in a broken kart.
I was able to fix the kart for the feature but he was about ready to give up. He was tired, sore, and frustrated. Then we remember the cheese cows from the day before. Not only do the top three drivers get trophies they also got cows made of cheese. Noting that he had been running low 47 second laps until the bump, I said I would get him a cheese cow if he could run a 46 second lap, a lap that would be on pace with the fastest kart on the track. That brought his spirits up and he was pretty stoked about being able to earn a cow. On the green he pushed really hard and held the outside of turn one forcing Randy to drop back. For the the first few laps he and Randy dropped back from Seth’s (#88 from Road America) 2nd place. Then Jason’s laps started to get faster and the Seth started to get closer. He managed to catch and pass Seth coming out of no-mans land, putting him in second place. He just need to run clean. Unfortunately, he spun in the hair pin turn and narrowlyavoided a collisions with Randy and Seth. He got back on track quick leaving Seth behind and started to make his way back up to Randy. Over the next several laps to the end he made great progress on closing the distance between him and Randy but there was just not enough time left. At the checkered flag he took third earning him a trophy and a cow. Unfortunately, he did not earn a second cow missing a 46 second lap by mere 1 hundredth of second. I would have gotten it for him but he seem so pleased that he a earned the cow on his own that it was not necessary. He spent the rest of the day exclaiming to anyone who would listen that all he wanted was his cheese cow.
Next race is at Blackhawk Farms Raceway in South Beloit and the first race with Championship Enduro Series the last weekend of May. We are going to spend the next few weeks making some notes about the current kart setup and then researching and making changes to get ready for road racing. The first of these changes is taking off the Briggs LO206 that we have been using and putting on the Briggs Animal a faster more powerful motor.
Thanks to his buddies that he fights with on the track, and then runs off to play catch with until the next race. Thanks to Julie Westie (Randy’s Mom) for the two of the photos. Most importantly, thanks to my Mom and Jason’s Mom.
Share this:
Tweet
|
load("//tools:defs.bzl", "go_library", "go_test")
package(licenses = ["notice"])
go_library(
name = "limits",
srcs = [
"context.go",
"limits.go",
"linux.go",
],
visibility = ["//:sandbox"],
deps = [
"//pkg/abi/linux",
"//pkg/context",
"//pkg/sync",
],
)
go_test(
name = "limits_test",
size = "small",
srcs = [
"limits_test.go",
],
library = ":limits",
)
|
Miscellaneous
When unhealthy weight attains broad amount and moves out of control, Apettite supressants 37.5 mg, the load reduction medication demonstrates rapid actions and drags it with the beginnings. After other drug treatments and medical treatments stop trying, Apettite supressant 37.5 mg from http://www.akronjoblink.comcomes to the picture and obliges unhealthy weight to look at a hasty escape. Being overweight is not a minor dilemma right now however a probable disease effective at destroying damage to our bodies. Whether it is forgotten and stored to become solved afterwards, the harmful effects would be noticeable within a short while. When the BMI exceeds 30 then being overweight turns into a burial plot danger to system demanding specific interest as they are necessary for the treating of diseases like cancer, diabetic issues, osteo-arthritis, cardiovascular diseases and high blood pressure levels. In such a predicament of exogenous unhealthy weight Apettite supressants 37.5 milligrams …
Despite the fact that Apettite supressant 37.5 milligrams is mouth suppressors that help in reducing bodyweight, they ought to be taken only within a standard eating habits instead of on it’s own. Apettite supressant 37.5 mg from http://emthem.com, when used alone to lose weight, may cause serious unwanted side effects and complications so the consumption has to be carefully only. Regardless if Phentermine 37.5 milligram pills are consumed and also a eating habits, you will find unwanted effects, like xerostomia, insomnia, irritability, stomach disappointed or irregularity until the entire body sets on the treatment. These might fade away in time but it’s sound practice to inform the doctor when they continue to persist for long. Diet regime, smoking, sleeping and alcohol consumption practices must be modified for that medication to adopt result in addition to stopping unwanted effects which may lead to severe complications. Before Apettite supressant 37.5 mg … |
About this title:
Synopsis: This new, larger edition is an all-encompassing review of excellence in current international poster design.
The 24th edition of this annually awaited Graphis poster collection has been expanded considerably. Whether brash and bold, quiet and elegant, serious or funny, sparse or dense with imagery, the best and brightest of poster graphics come together in a volume that includes an extended caption for each entry, commenting on the design philosophy that guided its creation.
Product Description:
This new, larger edition of the annually awaited Graphis poster collection is an all-encompassing review of excellence in current international poster design. Brash and bold, quiet and elegant, serious and funny, the best and brightest of poster graphics come together in a volume that includes an extended caption for each entry, commenting on the design philosophy that guided its creation. 400 color illustrations.
Orders usually ship within 2 business days. Shipping costs are based on books
weighing 2.2 LB, or 1 KG. If your book order is heavy or oversized, we may contact
you to let you know extra shipping is required. |
Development of an allergy test model: activation of human mast cells with potentially allergenic substances.
Due to the permanent increase of newly developed and already existing allergies, simple, quick, and reliable test models for detecting potentially allergenic substances are still required. Here, we describe the development of a new in vitro allergy test based on isolated primary mast cells (MC) of non-allergic patients from lung tissue and foreskin specimens, respectively. To establish the specificity of the test model we used primary MC stimulated with immunoglobulin E (IgE), human recombinant stem cell factor (hrSCF), and anti-IgE antibodies to release significant amounts of histamine indicating the ability of MC to cause a hypersensitivity reaction of the immediate type. The general applicability of this test model for detecting allergenic substances could be confirmed by histamine release of primary MC stimulated with sera of patients suffering from house dust allergy, and the corresponding antigen Dermatophagoides pteronyssinus. The results of the present work suggest that this newly developed human in vitro model provides the opportunity of testing substances for their allergenic potential within days and at low costs. This could also be of particular interest for newly produced compounds. |
Topics
LOUDONVILLE, N.Y. -- Tournament MVP Brett Bisping had 20 points and nine rebounds for Siena, which cruised past Fresno State, 81-68, in the decisive Game 3 of the College Basketball Invitational championship series Saturday. Rob Poole added 23 points for Siena (20-18), which capped its longest season that began Nov. 8 with its first national postseason title since jumping to Division I in 1976. Picked 10th of 11 in the preseason Metro Atlantic Athletic Conference coaches' poll, Siena got a rowdy crowd of 2,788 fired up early and never trailed. Siena's student section was lured by the promise free bacon before the brunch-time tip. Fresno State hit just three of its first 17...
1 Wichita State (34-0, Missouri Valley champion) vs.
16 Play-in winner 1 (below)
The Shockers have the experience from last year's run to the Final Four, plus they can shoot, are big and physical, and have a crafty point guard in sophomore Fred... |
The present invention relates to a linear guide apparatus and, in particular, to a self-lubrication linear guide apparatus that allows a lubricant to be automatically supplied to a plurality of rolling elements, which are component parts of the linear guide apparatus and which are rolling within a slider, over a long period of time.
An exemplary conventional linear guide apparatus for ordinary use includes, as shown in FIG. 4, an axially extending guide rail 1 that has rolling grooves 3 on outer surfaces thereof, and a slider 2 that is engaged with the guide rail 1 so as to mount over the guide rail 1. The slider 2 includes a slider main body 2A and end caps 2B attached to both end portions of the slider main body. The slider main body 2A has not only rolling grooves formed on the inner surfaces of both sleeve portions 4 thereof so as to confront the rolling grooves 3 of the guide rail 1, but also rolling element return grooves that pass through the thick-walled portions of the sleeve portions. Each end cap 2B has curved grooves that allow the rolling grooves of the slider main body 2A to communicate with the rolling element return grooves that extend in parallel with the rolling grooves of the slider main body 2A. Thus, the rolling grooves, the rolling element return grooves, and the curved grooves on both ends provide rolling element circulation circuits. A large number of balls, which are the rolling elements, are loaded into the rolling element circulation circuits. The rolling elements within the rolling grooves of the slider 2 are retained by a retainer so that the rolling elements avoid falling away from the slider 2 when the slider 2 is removed from the guide rail 1.
The slider 2 that is engaged with the guider rail 1 moves smoothly along the guide rail through the rolling of the rolling elements accommodated within both rolling grooves that confront each other, and during such movement the rolling elements are endlessly circulating throughout the rolling element circulation passages within the slider.
Grease or lubricating oil is charged into the slider 2 from a grease nipple 7, so that the rolling elements are lubricated.
However, in the conventional linear guide apparatus having such a lubrication system that lubricating oil or grease is used as a lubricant as it is, i.e., without giving any special arrangement, the lubricant is consumed quickly especially when the apparatus is operated at high temperatures because the lubricant charged into the slider does not stay but flows outside the apparatus. Therefore, the conventional linear guide apparatus has encountered the problem that the lubricant must be replenished repeatedly at short intervals. |
Q:
How do I stop Blender from automatically creating floating windows?
Is there any way to stop Blender from showing the file explorer, Preferences and Render results in new floating windows and just show those editors as part of the inerface?
A:
I assume you're looking for fullscreen by default.
Open a new blank file. Go to Window > Toggle Fullscreen Window. Then, go to File > Defaults > Save Startup File
Edit:
To stop renders and file browsers from popping up in new windows, go to Edit > Preferences.
Then select Interface > Editors > Temporary Windows.
Keep User Interface will not make any changes to the user UI when you press render. If there is an Image Editor set to Render Preview open, it'll display in there.
Fullscreen will replace your current window with a fullscreen render preview/file explorer.
Image Editor will replace the current editing window to an Image Editor set to render preview (for ex. your default 3D viewport will be switched to Image Editor it that was open)
EDIT 2
If you want to keep the current interface without any floating windows all you need to do is change the editor type or Toggle the active window, by selecting it on the top left, or selecting the shortcut of the editor you want. The file browser is Shift+F1. To go back to the 3D viewport press Shift+F5. Rendered images will be in the Image Editor or Shift+F10
To toggle the current active window into the preferences window you need create a new shortcut (version 2.8 has no pre-assigned default).
To edit the preferences and add a new shortcut:
Open the preferences window>keymap open the window section. Press on Add New to a new shortcut :
Type screen_space_type_set_or_cycle and select a combination of keys of your choice (in previous versions of blender it was Ctrl+Alt+U) and select the preferences window as "type" on the bottom left.
Then Click on the top right of the screen to show the option to save the preferences to make the change permanent.
|
1. Introduction {#sec1-molecules-21-01475}
===============
*Epimedii Folium*, commonly called Yinyanghuo, is an important perennial shade herb in traditional Chinese medicine. *Epimedium* belongs to the Berberidaceae family and is widely used as an aphrodisiac and to strengthen muscles and bones. *Epimedium* leaves contain high amounts of flavonoid glycosides, such as epimedin A, epimedin B, epimedin C, and icariin \[[@B1-molecules-21-01475],[@B2-molecules-21-01475]\]. Recent reports have shown that flavonoids from *Epimedium* significantly affect the treatment of breast cancer, liver cancer, and leukemia \[[@B3-molecules-21-01475],[@B4-molecules-21-01475],[@B5-molecules-21-01475]\]. The recognition of the health benefits of *Epimedium* has increased its market demand. However, its resource recycling rate is low and environmentally dependent. Furthermore, its natural sources are endangered, further increasing prices. Commercial culture can address resource constraints of *Epimedium*. *E. pseudowushanense* B.L.Guo is an important resource of *Epimedii Folium* and is the first *Epimedium* species introduced and cultivated in Guizhou Province, China.
Light is an important environmental factor influencing plant growth, development, and secondary metabolism \[[@B6-molecules-21-01475]\]. Under high light conditions, certain plant species, such as bayberry trees, do not grow because light irradiance decreases photosynthetic rates \[[@B7-molecules-21-01475]\]. Therefore, all plants have their own optimal light intensity ranges for growth. Light intensity that is too high or too low impacts morphology, photosynthetic physiology, and secondary metabolite production. These characteristics are closely related to medicinal plant productivity. For example, Ma and others \[[@B8-molecules-21-01475]\] reported that *Camptotheca acuminata* grown under 75% irradiance had significantly greater height, net photosynthetic rate (Pn), stomatal conductance (gs), total aboveground biomass, and chlorophyll fluorescence than plants grown under 100% (1500 ± 30 μmol·m^−2^·s^−1^), 50%, and 25% irradiance.
The function of different flavonoids varies according to the structure and specific flavonoids are involved for instance in limiting exogenous microbial growth, helping generate new fruits or leaves, providing light protection, and enhancing antioxidant defense \[[@B9-molecules-21-01475],[@B10-molecules-21-01475]\]. Qualitative and quantitative composition of flavonoids varies under different environments \[[@B9-molecules-21-01475]\]. Changes in light intensity may influence flavonoid content because the flavonoid hydroxyl groups on the A and B rings vary in number and position. Several studies have shown that high light irradiance promotes the biosynthesis of flavonoids, such as dihydroxy B-ring-substituted flavonoids (luteolin 7-*O*- and quercetin 3-*O*-glycosides) but does not influence the biosynthesis of monohydroxy B-ring-substituted flavonoids (pigenin 7-*O*- and kaempferol 3-*O*-glycosides) \[[@B11-molecules-21-01475],[@B12-molecules-21-01475],[@B13-molecules-21-01475],[@B14-molecules-21-01475]\]. Pacheco and others \[[@B15-molecules-21-01475]\] reported that *Piper aduncum* grown under 50% natural light irradiance had higher total flavonoid concentration than those grown under 100% natural irradiance. Based on these reports and the harvest time of *E. pseudowushanense*, the present study exposed *Epimedium* to five different light intensities for 60 days.
In the natural environment, *E. pseudowushanense* grows in woodlands, scrub, and forest edges. In commercial culture, *E. pseudowushanense* seedlings are usually shade-grown by a simulated wild cultivation method. However, our understanding of the photosynthesis and flavonoid content of *E. pseudowushanense* under shade management is limited. This study aims to determine the optimal light conditions for commercial *Epimedium* production. This study also aims to investigate flavonoid accumulation in *Epimedium* under different light intensities to improve its propagation and cultivation. The results of the present study may contribute to the scientific culture and management of *Epimedium*, as well as provide a reference for other *Epimedium* species. We anticipate that our results will improve our understanding of the changes in photosynthetic parameters and concentrations of secondary metabolites in *Epimedium* under different light treatments. Our results will provide a sound theoretical foundation for the standardized cultivation of this important medicinal plant.
2. Results {#sec2-molecules-21-01475}
==========
2.1. Effects of Light Intensity on Plant Growth {#sec2dot1-molecules-21-01475}
-----------------------------------------------
Clear external differences were observed among plants grown under 60 days of different light intensities. Compared with high light intensities (L3, L4, and L5), leaf areas were higher under low light intensities (L1 and L2). L2 resulted in the highest leaf area. Light intensity had different effects on *E. pseudowushanense* growth: L3, L4, and L5 resulted in higher number of branches. On the contrary, L1 and L2 resulted in higher SPAD and water content. The number of branches under L3, L4, and L5 were 156.3% (*p* \< 0.05), 187.5% (*p* \< 0.05), and 203.1% (*p* \< 0.05) higher, respectively, than of plants grown under L1. SPAD values under L1 and L2 were 53.1% (*p* \< 0.05) and 54.3% (*p* \< 0.05) higher, respectively, than in plants grown under L5. Water content responded similarly. The highest values were observed in plants under L1 and the lowest were in plants under L5 ([Figure 1](#molecules-21-01475-f001){ref-type="fig"}).
2.2. Effects of Light Intensity on Plant Photosynthetic Parameters {#sec2dot2-molecules-21-01475}
------------------------------------------------------------------
[Figure 2](#molecules-21-01475-f002){ref-type="fig"} presents the effects of different light intensities on leaf photosynthetic parameters. Compared with L1, leaf net photosynthesis (Pn), transpiration rate (T), and water use efficiency (WUE) increased as light intensity increased, but not under L5. L4 resulted in the highest Pn, T, and WUE, whereas L1 resulted in the lowest measurements. Compared with L1, L4 increased Pn, T, and WUE by 457.9% (*p* \< 0.05), 107.6% (*p* \< 0.05), and 173.7% (*p* \< 0.05), respectively. The highest gs values were observed under L4. No significant differences were observed between other treatments (*p* \> 0.05). Compared with L1, intercellular CO~2~ concentration (Ci) decreased by 33.1% (*p* \< 0.05), 34.3% (*p* \< 0.05), and 36.2% (*p* \< 0.05) under L3, L4, and L5, respectively.
2.3. Effects of Light Intensity on Chloroplast Ultrastructure {#sec2dot3-molecules-21-01475}
-------------------------------------------------------------
Light intensity markedly influenced the shape and number of starch grains and grana lamellae in *Epimedium* ([Figure 3](#molecules-21-01475-f003){ref-type="fig"}). L4 resulted in more grana lamellae than other treatments, with approximately 11 to 14 grana lamellae per grana. Plants under L5 had more starch grains per chloroplast. Starch grains seldom appeared under L1. Interestingly, plants under L1 and L2 had narrower chloroplasts than plants under L3, L4, and L5.
2.4. Effect of Light Intensity on Flavonoid Content in Epimedium {#sec2dot4-molecules-21-01475}
----------------------------------------------------------------
[Table 1](#molecules-21-01475-t001){ref-type="table"} shows that the method of determining the flavonoid glycosides is highly accurate. [Figure 4](#molecules-21-01475-f004){ref-type="fig"} shows the changes in the contents of four different flavonoid glycosides in *E. pseudowushanense* under different light intensities. Epimedin A and epimedin B amounts showed similar changes. Epimedin A and epimedin B increased when light intensity increased from L1 to L4, whereas both decreased under L5. The highest epimedin A and epimedin B contents were observed under L4. Epimedin A and epimedin B contents were 191.4% (*p* \< 0.05) and 95.8% (*p* \< 0.05) higher, respectively, than under L1. Furthermore, epimedin C content increased as light intensity increased from L1 to L3, whereas epimedin C content decreased as light intensity increased from L3 to L5. Thus, L3 increased epimedin C by 483.6% (*p* \< 0.05) compared with L1. Interestingly, icariin content was unaffected by light treatment. Icariin contents in plants under L4 and L1 were significantly higher than in plants under L5. Icariin contents under L2 and L3 were intermediate. Epimedin C was the major flavonoid in *Epimedium*.
2.5. Effect of Light Intensity on Leaf Dry Biomass and Medicinal-Ingredient Yield of Epimedium {#sec2dot5-molecules-21-01475}
----------------------------------------------------------------------------------------------
Different light intensities were associated with differences in leaf dry biomass ([Figure 5](#molecules-21-01475-f005){ref-type="fig"}). The highest leaf dry biomass was observed in plants under L4. Leaf dry biomass gradually increased as light intensity increased from L1 to L4. L4 increased leaf dry biomass by 926.3% (*p* \< 0.05) compared with L1. Interestingly, leaf dry biomass decreased as light intensity increased from L4 to L5.
Given that the total of epimedin A, epimedin B, epimedin C, and icariin content in flavonoid glycosides was more than 90% in any treatment (data not shown), these four components represented flavonoid glycosides in *Epimedium*. Medicinal-ingredient yield was calculated as the product of flavonoid glycoside content and leaf dry biomass per plant. [Figure 6](#molecules-21-01475-f006){ref-type="fig"} shows that plants under 60 days of L3 and L4 had higher medicinal-ingredient yields than under other treatments (*p* \< 0.05). Medicinal-ingredient yield gradually increased as light intensity increased from L1 to L3, whereas it decreased by 40.3% (*p* \< 0.05) as light intensity increased from L3 to L5.
3. Discussion {#sec3-molecules-21-01475}
=============
Although *Epimedium* is a shade-tolerant species, light intensity plays an important role in its survival, early growth, development of photosynthetic apparatus, and production of secondary metabolites \[[@B16-molecules-21-01475],[@B17-molecules-21-01475],[@B18-molecules-21-01475]\]. Four major flavonoids including icariin, epimedin A, epimedin B, and epimedin C are quality indicators of *Epimedii Folium* \[[@B2-molecules-21-01475]\]. Our study showed that medicinal-ingredient yields of individual plants were higher under 60 days of L3 and L4 treatment ([Figure 6](#molecules-21-01475-f006){ref-type="fig"}). This result suggests that the L3 and L4 are the optimal conditions for the medicinal ingredient production of *Epimedium*. Meanwhile, content of epimedin C, the major *Epimedium* flavonoid, was lower under low and high light intensity treatments, therefore reducing the medicinal-ingredient yield of individual plants under L1, L2, and L5 treatments ([Figure 4](#molecules-21-01475-f004){ref-type="fig"}). Interestingly, the production of different flavonoids was induced by different light ranges. A large number of other flavones were probably stimulated by lower light in addition to the four major components. In addition, epimedin A and epimedin B contents increased significantly as light intensity increased from L1 to L4, but decreased as light intensity increased from L4 to L5. Epimedin C content increased significantly as light intensity increased from L1 to L3, whereas it decreased as light intensity increased from L3 to L5. Furthermore, icariin content changed differently compared with other flavonoids. These results signify the complex relationships between light intensity and epimedin A, epimedin B, epimedin C, and icariin biosynthesis. Further studies are necessary to better understand the factors regulating the synthetic balance of the four medicinal flavones in the flavonoid pathway.
Leaf dry biomass influences the medicinal-ingredient yield of *Epimedium*. Leaf dry biomass is influenced by light intensity. Various plant characteristics, such as leaf area, number of branches, water content, and SPAD are influenced by light intensity \[[@B19-molecules-21-01475]\]. Differences in plant morphology are documented in different species adapted to various light environments \[[@B20-molecules-21-01475],[@B21-molecules-21-01475]\]. In the present study, *E. pseudowushanense* seedlings grown under relatively low light intensities (L1--L2) had larger leaves compared with those grown under high light intensities (L3--L5) ([Figure 1](#molecules-21-01475-f001){ref-type="fig"}). These findings are similar to the results reported by Tang and others \[[@B22-molecules-21-01475]\]. Our study showed that *E. pseudowushanense* seedlings grown under L3--L5 treatments had significantly higher number of branches and lower water content ([Figure 1](#molecules-21-01475-f001){ref-type="fig"}). In *E. pseudowushanense*, the number of branches was directly associated with leaf biomass. More branches signify more leaves and more leaf dry biomass. Lower water content influenced leaf dry biomass similarly. Additionally, the highest Pn, gs, and T were observed in plants under L4 ([Figure 2](#molecules-21-01475-f002){ref-type="fig"}). Decreased Pn was associated with reduced T, gs, and Ci as light intensity increased from L4 to L5. This result indicates that stomatal limitation occurred and is presumably consistent with *E. pseudowushanense* stomatal traits. SPAD is another important factor determining photosynthetic rate and plant growth. In this study, we observed that SPAD decreased as light intensity increased from L3 to L5 ([Figure 1](#molecules-21-01475-f001){ref-type="fig"}), suggesting that excessive light intensity induced pigment damage \[[@B23-molecules-21-01475]\]. This finding is consistent with the response of *T. hemsleyanum* \[[@B19-molecules-21-01475]\]. Interestingly, higher SPAD and lower Pn were observed under L1 and L2. Thus, these results might be considered as responses to different light conditions \[[@B24-molecules-21-01475]\].
Chloroplasts are the only organelles in which photosynthesis occurs. Photoreactions are localized in the internal chloroplast membrane (i.e., the thylakoid). Thylakoid structure and integrity are critical for effective photosynthesis \[[@B25-molecules-21-01475]\]. In this study, leaves grown under L4 had better-developed grana and more thylakoids than those under other treatments ([Figure 3](#molecules-21-01475-f003){ref-type="fig"}), consistent with the highest photosynthetic rates and leaf dry biomass under L4. *E. pseudowushanense* chloroplasts were damaged under high light intensities (L5), thus decreasing flavonoid glycoside content because chloroplasts synthesize flavonoids in the plant cell \[[@B26-molecules-21-01475],[@B27-molecules-21-01475]\]. Similar results were reported for *Camptotheca acuminata* seedlings \[[@B8-molecules-21-01475]\].
*E. pseudowushanense* is most commonly utilized in the treatment of osteoporosis, liver cancer, and leukemia because of its high flavonoid content \[[@B4-molecules-21-01475],[@B28-molecules-21-01475],[@B29-molecules-21-01475]\]. Based on previous studies on *Epimedium* species \[[@B30-molecules-21-01475]\], the most suitable intensity for flavonoid accumulation in *E. sagittatum* ranged from 40--160 μmol·m^−2^·s^−1^. We set the L1 to L5 light regimes from 9.1--127.3 μmol·m^−2^·s^−1^. We conclude that L3 (54.6 ± 2.5 μmol·m^−2^·s^−1^) and L4 (90.9 ± 2.5 μmol·m^−2^·s^−1^) treatments achieved higher medicinal-ingredient yields after 60 days, and are therefore recommended for *Epimedium* cultivation. The present study provides a better understanding of the responses of growth, photosynthesis, and secondary metabolite accumulation in *E. pseudowushanense* seedlings exposed to various light intensities. Our results could serve as a theoretical basis for the standardized cultivation of *E. pseudowushanense*.
4. Materials and Methods {#sec4-molecules-21-01475}
========================
4.1. Plant Materials and Growth Conditions {#sec4dot1-molecules-21-01475}
------------------------------------------
*E. pseudowushanense* buds germinate in February. Flowering occurs from March to April and fruiting occurs in May \[[@B31-molecules-21-01475]\]. *E. pseudowushanense* is cultivated under 10% to 30% irradiance in greenhouses. Its rhizome buds develop during winter. New leaves and stems with flowers develop in the following early spring. For this study, healthy, homogenous two-year-old *E. pseudowushanense* seedlings were collected from Lei Shan County (16° N, 108° E) in Guizhou Province. Each stem had two compound leaves. Each compound leaf had three leaflets ([Figure 7](#molecules-21-01475-f007){ref-type="fig"}). Seedlings were transferred to plastic pots (inner diameter: 10 cm, height: 10 cm) with drainage holes. One seedling was transferred per pot. All pots contained a substrate mixture of 75% peat and 25% vermiculite. On 26 December 2013, the transplanted seedlings were transferred to the greenhouse of the Institute of Medicinal Plant Development. Seedlings were then grown under shade. Each seedling was disinfected with 800-fold carbendazim solution. A completely randomized design with three replications per treatment and 10 seedlings per replicate was set up on 1 February 2014, or approximately one month after transferring. Inflorescences were removed upon blossoming to promote growth of the leaves utilized in medicinal treatments. Temperature range was set as 20--21 °C during the entire cultivation period. Humidity was maintained at 60%. The five light intensities were supplied by T5-fluorescent lamps at 16-h irradiation durations per day. Light treatment groups were as follows: L1 (9.1 ± 2.5 μmol·m^−2^·s^−1^), L2 (18.2 ± 2.5 μmol·m^−2^·s^−1^), L3 (54.6 ± 2.5 μmol·m^−2^·s^−1^), L4 (90.9 ± 2.5 μmol·m^−2^·s^−1^), and L5 (127.3 ± 2.5 μmol·m^−2^·s^−1^). Light intensities were measured by LI-6400 external quantum sensor (LI-COR, Lincoln, NE, USA) system. Sufficient water was provided for plants once every four days until the end of experimentation.
4.2. Plant Growth, Chlorophyll Content, and Leaf Dry Biomass {#sec4dot2-molecules-21-01475}
------------------------------------------------------------
The number of newly germinated branches was recorded after 60 days of light treatment. Leaf areas of three leaflets were measured by LI-3000C (LI-COR, Lincoln, NE, USA). Fresh leaf weights were measured by an electronic balance. Leaf dry weights were measured after oven drying leaves at 60 °C to constant weight. Water content was calculated as: water content = 1 − dry weight/wet weight. Chlorophyll content was measured by a chlorophyll meter SPAD-502 (Konica Minolta Inc., Tokyo, Japan). Measurement light wavelengths were 650 nm and 940 nm. At the end of each treatment, all leaves of intact plants were collected to calculate leaf dry biomass.
4.3. Photosynthetic Parameters {#sec4dot3-molecules-21-01475}
------------------------------
Photosynthetic measurements were taken between 9:00 AM and 11:00 AM. Healthy, fully-developed, topmost leaflets of fronds were taken from three randomly selected plants per replicate treatment. Photosynthesis (Pn) was measured by a LI-6400 portable photosynthesis system (Li-Cor, Inc., Lincoln, NE, USA) with a standard leaf chamber equipped with a 6400-02B LED light source. Data were recorded under 21% O~2~, 500 μmol (CO~2~)·m^−2^·s^−1^ air concentration, 60% relative humidity, 200 μmol (CO~2~)·s^−1^ air flow, and 20 ± 0.5 °C temperature. Vapor pressure deficit (VPD) was calculated with leaf and air temperatures and relative humidity. VPD was similar among the five experimental treatments.
4.4. Assessment of Chloroplast Ultrastructure {#sec4dot4-molecules-21-01475}
---------------------------------------------
To observe the chloroplast ultrastructure of mesophyll cells in *E. pseudowushanense* seedlings subjected to different light intensities for 60 days, a fully expanded leaflet from a randomly selected plant from each replicate per treatment was collected. Fresh leaves were cut into 4--6 slices (1 mm^2^) at their adaxial surfaces for transmission electron microscopy. Sections were placed immediately in 2.5% (*v*/*v*) glutaraldehyde (0.1 M phosphate buffer, pH 7.2), then de-gassed and fixed for at least 4 h. Samples were then post-fixed with 1% (*v*/*v*) osmium acid. After fixation, samples were washed three times with the same buffer for 15 min. Specimens were dehydrated by a graded ethanol series (50%, 70%, 90%, 95%, and 100% at 30 min each) then embedded in epoxy resin, from which ultrathin sections were prepared. The ultrathin sections were sequentially stained with uranyl acetate and lead citrate and then examined with a transmission electron microscope (JEM-1400, Hitachi, Tokyo, Japan).
4.5. Flavonoid Content and Medicinal-Ingredient Yield {#sec4dot5-molecules-21-01475}
-----------------------------------------------------
One ternate leaf was collected per plant after 30, 60, 90, and 120 days of exposure to different light intensity treatments. Fresh leaves of 10 seedlings per replicate were fixed for 3 min in a microwave, then dried to a constant weight at 60 °C. Sample pretreatment was performed according to the Chinese Pharmacopoeia Commission (2010). Samples were crushed and sifted through a No. 3 pharmacopoeia sieve. Approximately 200 mg of sample was added to 50 mL 70% ethanol then extracted by ultrasonication for 30 min. The extract was then filtered with a 0.45 μm microfiltration membrane for HPLC analysis. Eluent A contained double distilled water and eluent B contained acetonitrile. The gradient elution program was as follows: 0--17 min (25%--26% B), 17--26 min (26%--100% B). The column was washed with 100% eluent B between every two samples for 15 min and then re-equilibrated with 25% eluent B for 10 min. Elution conditions were as follows: 1.0 mL·min^−1^ flow rate, 25 °C column temperature, 270 nm detection wavelength, and 20 μL injection volume. Six gradient concentrations of epimedin A (3.1--32.3 μg·mL^−1^), epimedin B (3.1--32.3 μg·mL^−1^), epimedin C (20.5--520.6 μg·mL^−1^), and icariin (3.1--32.3 μg·mL^−1^) were prepared. A Zorbax SB-C18 column (Agilent Technologies, Palo Alto, CA, USA) was utilized as the chromatographic column in chromatographic analysis (250 mm × 4.6 mm I.D., 5 μm). HPLC analysis data were processed by PerkinElmer ChemStation software (version 6.3.1, PerkinElmer, Waltham, MA, USA).
Medicinal ingredient yield was calculated as: medicinal-ingredient yield = (epimedin A content + epimedin B content + epimedin C content + icariin content) × leaf dry biomass.
4.6. Data Analysis {#sec4dot6-molecules-21-01475}
------------------
Statistical analysis was conducted with one-way ANOVA software (R language version 3.1.1, <https://www.r-project.org/about.html>). Differences between means were detected with Tukey HSD test. *p* value was set at 0.05 and 0.01 for ANOVA and Tukey HSD tests, respectively.
The National Natural Science Foundation of China (81473302) supported this study. We would like to thank Zhang Yali for his insightful suggestions regarding the manuscript and Ding Wanlong for taking pictures. We are very grateful for the experiment support of GUOYAOJITUAN TONGJITANG (GUIZHOU) PHARMACEUTICAL CO.LTD, and some personal support from Xiangbo Yang, Zhihai Jiang, and Li Li. Funding: The National Natural Science Foundation of China (81473302).
**Sample Availability:** Samples of the compounds are available from the authors.
B.G. and J.P. conceived and designed the experiments; J.P. performed the experiments; J.P. analyzed the data; B.G. contributed reagents/materials/analysis tools; J.P. wrote the paper.
The authors declare no conflict of interest.
Pn
Net photosynthetic rate
gs
Stomatal conductance
SPAD
Soil and Plant Analyzer Development (the relative content of chlorophyll)
T
Transpiration rate
WUE
Water use efficiency
Ci
Intercellular CO
2
concentration
SG
Starch grains
GL
Grana lamellae
VPD
Vapor pressure deficit
######
Morphological parameters of *E. pseudowushanense* under different light intensities. The data are expressed as mean ± SD. Different letters indicate significant differences between light intensity treatments (*p* \< 0.05); *n* = 30.
{#molecules-21-01475-f002}
{#molecules-21-01475-f003}
{#molecules-21-01475-f004}
{#molecules-21-01475-f005}
{#molecules-21-01475-f006}
{#molecules-21-01475-f007}
molecules-21-01475-t001_Table 1
######
Calibration data of four analytes.
Analyte ^a^ Linear Range (μg·mL^−1^) Calibration Equation ^b^ r^2^ LOD (μg·mL^−1^) LOQ (μg·mL^−1^) Intra-Day RSD (%) (*n* = 6) Inter-Day RSD (%) (*n* = 6) Recovery and RSD (%) (Mean, *n* = 6)
------------- -------------------------- ---------------------------- -------- ----------------- ----------------- ----------------------------- ----------------------------- -------------------------------------- ------ ------ ------ --------------
1 3.1\~32.2 *Y* = 7701.546*x* + 9983 0.9992 0.26 0.81 2.46 1.91 1.36 1.06 0.98 1.39 105.54, 3.32
2 3.1\~32.2 *Y* = 5548.525*x* + 15,762 0.9995 0.29 0.95 3.27 2.38 1.57 1.62 1.78 1.20 104.06, 2.96
3 20.5\~520.6 *Y* = 7171.274*x* + 31,544 0.9993 0.03 0.11 3.36 1.50 2.02 1.83 1.19 1.14 102.95, 3.37
4 3.1\~32.2 *Y* = 9108.011*x* + 6141 0.9996 0.11 0.37 2.50 1.66 1.46 1.79 1.54 1.44 104.92, 2.70
^a^ The compound codes 1, 2, 3, and 4 of each analyte refers to epimedin A, epimedin B, epimedin C, and icariin, respectively; ^b^ Y: peak area; X: concentration of compound (μg·mL^−1^).
|
/* # perror
*
* Print a description of errno to stderr with given prefix appended, `NULL` for no prefix.
*
* Sample output on glibc 2.23:
*
* perror test EDOM: Numerical argument out of domain
*/
#include "common.h"
int main(void) {
errno = EDOM;
perror("perror test EDOM");
return EXIT_SUCCESS;
}
|
package jadx.tests.integration.names;
import java.io.File;
import org.junit.jupiter.api.Test;
import jadx.core.dex.nodes.ClassNode;
import jadx.tests.api.SmaliTest;
import static org.hamcrest.MatcherAssert.assertThat;
import static org.hamcrest.Matchers.containsString;
import static org.hamcrest.Matchers.not;
public class TestReservedClassNames extends SmaliTest {
/*
* public class do {
* }
*/
@Test
public void test() {
ClassNode cls = getClassNodeFromSmali("names" + File.separatorChar + "TestReservedClassNames", "do");
String code = cls.getCode().toString();
assertThat(code, not(containsString("public class do")));
}
}
|
) -6288 (b) -8/7 (c) 607 (d) -2
b
Which is the closest to 13/5? (a) 9 (b) 3/2 (c) 8945 (d) -0.5
b
Which is the nearest to 0? (a) -288 (b) -0.015 (c) -1 (d) 3/8
b
What is the closest to 9 in -2/5, -3, -10/23, 3364?
-2/5
Which is the nearest to 1? (a) 2/43 (b) 2/11 (c) 2/19 (d) -33 (e) 5 (f) 0.5
f
Which is the nearest to 171? (a) 1 (b) 0.4 (c) -12 (d) -819
a
What is the closest to -14/5 in 44, -1, 23925?
-1
Which is the closest to 0? (a) -3 (b) 1 (c) -1/3 (d) -2692652 (e) -5
c
What is the closest to 7/4252 in -3/2, -5, 3.5?
-3/2
What is the nearest to 1.4 in 21, 1, -3, 0.2, 2/5, 0.1?
1
Which is the closest to -1? (a) 5/6 (b) 2/15 (c) 6/53 (d) 0.4 (e) -0.14
e
Which is the closest to -161/15? (a) 19 (b) -2/3 (c) 2
b
Which is the nearest to -0.1? (a) -0.1 (b) -1008/37 (c) 217 (d) -8 (e) -2
a
Which is the nearest to -0.1? (a) 979277 (b) -3 (c) 0
c
What is the nearest to -114456 in -0.2, 0.2, 1, -3/8?
-3/8
Which is the closest to 5/11? (a) 14.3 (b) 1.2 (c) 1/9
c
What is the closest to 4.1 in -0.1, -3, -4, -1/9820, 1?
1
Which is the nearest to -1/3? (a) -2/5 (b) 39010 (c) 2/9 (d) 1/38
a
Which is the closest to -4? (a) 5 (b) 23 (c) -5/24
c
What is the closest to 1 in -41, 1, 1/4, -2, 1/415, -28.6?
1
Which is the closest to -2? (a) -2 (b) -54/11 (c) 77 (d) -2/5 (e) -0.06
a
Which is the nearest to 572.5? (a) -0.2 (b) -5/23 (c) 0
c
Which is the closest to -0.1? (a) -0.5 (b) 42/7843 (c) -2/7 (d) -5
b
Which is the closest to 87? (a) 3.2 (b) 1354 (c) 0.3
a
What is the nearest to 3/2 in -7, 3/2, -0.077721?
3/2
What is the nearest to -1/2 in 2, 5, -5/2, 41752?
-5/2
What is the closest to -4260 in -9, -0.4, -71?
-71
What is the nearest to 2 in 44, 3, -2/14557?
3
Which is the closest to 2? (a) 0 (b) 6 (c) 1/509 (d) 5 (e) -2/3
c
What is the nearest to 3/5 in 0.017, 2/17, -255, 4?
2/17
Which is the nearest to 88/7? (a) -2/15 (b) 2/11 (c) 87.49
b
What is the nearest to 0 in -2.6, 28, 79/4, -5?
-2.6
What is the closest to -0.1 in 5/4, -539325, 0?
0
What is the closest to 1/2 in 0, 61026, 5, 1/3?
1/3
What is the closest to -7/30 in 4/3, -2/23, -1/4, 9/10, 2?
-1/4
What is the nearest to 1/2 in -5, 5, -5/64, -0.2, 122?
-5/64
Which is the nearest to -3? (a) 34 (b) 2160 (c) 0.12
c
What is the nearest to 13 in -492, -17, -0.31?
-0.31
What is the closest to -1.73496 in 0.5, 5, -0.2, 2?
-0.2
What is the nearest to -0.1 in -47157, 2, -1/66?
-1/66
Which is the closest to -0.0399? (a) -1/3 (b) 2/9 (c) -2/5 (d) 0.027
d
Which is the closest to -0.2? (a) 3 (b) -11 (c) 783 (d) 4 (e) -0.1 (f) -63
e
What is the closest to 5 in -2/9, 8, -4, 4, -620?
4
What is the closest to 13/4 in 1/6, 22, -9, -4/9?
1/6
What is the nearest to 0.1 in 35, -2, 2, -0.1, 13.048, -0.2?
-0.1
What is the closest to -1/3 in 168941, -0.25, -4?
-0.25
What is the closest to 1/4 in 12/11, 4, 1058?
12/11
Which is the nearest to 64? (a) -1 (b) 1.5 (c) 1/4 (d) 0.3 (e) -4/3
b
What is the nearest to -1/6 in 2/23, 45.32, 3, -1/12?
-1/12
Which is the nearest to 6? (a) -13/73 (b) 17 (c) 0.3
c
Which is the nearest to 1/4? (a) 0 (b) -459 (c) -2/7 (d) -1 (e) -399
a
Which is the nearest to 0? (a) -10 (b) 82 (c) 1/2 (d) -1/33 (e) 5 (f) -136
d
Which is the closest to -2? (a) 0.1 (b) -3 (c) -11/26 (d) 5 (e) -0.5
b
What is the closest to 3 in -1, 1/2, 23/351, 0.3?
1/2
What is the nearest to -7/5 in -3, -5, -10476/7, -4, 0.1?
0.1
Which is the nearest to 94/27? (a) 0.5 (b) -5 (c) -91 (d) 25 (e) -1
a
What is the nearest to 2474 in 1, 120, -7, -2/3?
120
What is the closest to -2/3 in 1/2, -1478, -13083?
1/2
Which is the closest to 1/45? (a) 4/5 (b) 1853 (c) -3/10 (d) -4/51
d
What is the closest to -40 in -2/103, 25, 2, -0.2, -2/7, 44?
-2/7
Which is the closest to 1? (a) -0.13 (b) 0.0825 (c) 4 (d) 1/5 (e) -3.2 (f) 0.5
f
Which is the closest to -1? (a) 0.2 (b) -787/15 (c) -36/17
c
Which is the nearest to -6.6? (a) -1/2 (b) -0.06 (c) -4022 (d) -3
d
Which is the nearest to 0.4? (a) 31 (b) -2/9 (c) 5 (d) 8964 (e) -0.1
e
What is the closest to 7/284139 in -1/18, -0.3, 1?
-1/18
Which is the closest to -12? (a) 14/3 (b) -0.5 (c) 14572
b
Which is the closest to 3/19? (a) 3080 (b) 0.5 (c) -5 (d) -1
b
What is the closest to 2 in 57/122, -259, 3?
3
Which is the closest to 2/7? (a) -0.001 (b) 0.0373 (c) 3/5 (d) -1/2 (e) 3
b
What is the nearest to -0.1 in -29.45, 1/3, 5, -2/75?
-2/75
Which is the nearest to -4? (a) 2/3 (b) 11/18 (c) -1357/5 (d) 7 (e) -1
e
Which is the closest to -0.1? (a) 0 (b) -1 (c) 99154/3
a
What is the nearest to 2/5 in -2/5, 5, -1/6, 3473.4, 7?
-1/6
Which is the nearest to -60897? (a) 4 (b) -2.85 (c) 0.5
b
Which is the nearest to -0.1? (a) 5 (b) -1/3 (c) 2/13 (d) -0.9716 (e) 2/39 (f) 1/5
e
What is the closest to -0.1 in -3, -1, -354, -1/2, 0.14?
0.14
Which is the nearest to -3? (a) -0.2 (b) 0.34467 (c) -1/6
a
What is the nearest to 0.27 in -2/5, -0.05, -17, -620?
-0.05
What is the nearest to 45 in -4/3, -779, 1.8?
1.8
What is the closest to -1 in 0.4, -0.174, 81, 869?
-0.174
Which is the nearest to 12.7? (a) 4 (b) 0 (c) -35/37
a
Which is the nearest to 0.1? (a) -0.1 (b) -5 (c) 15/1297 (d) 3
c
What is the closest to 2 in 0.3, -1, 3.2612, -3?
3.2612
Which is the nearest to -4? (a) 1/10 (b) -92/7 (c) -3/4 (d) -0.28 (e) -1.4 (f) -9
e
What is the nearest to 1/8 in -3, -122/7, -0.07, -1/4, 125?
-0.07
What is the closest to 80 in 2, 5, 0.64, -3, -5?
5
Which is the nearest to -2/3? (a) 55535 (b) 4 (c) -1/18
c
Which is the closest to 39165? (a) 1810 (b) 3 (c) -1
a
Which is the nearest to 9? (a) 0.405 (b) 3 (c) -7 (d) 2/35 (e) 0.08 (f) -0.5
b
What is the closest to -23 in 248, 7, -5, 24, 4/5?
-5
What is the nearest to -1 in -154, 10, -183, -0.1, -146?
-0.1
Which is the nearest to 1/3? (a) -8 (b) 4 (c) -4/51 (d) 2265
c
Which is the nearest to -1/4? (a) -3 (b) -3010/23 (c) -6 (d) -4
a
Which is the closest to 0.3? (a) 12119 (b) 3 (c) -3/5 (d) -2/9 (e) -9
d
What is the closest to 2/3 in -2/13, 3633141, -2/11?
-2/13
Which is the closest to -18/11? (a) -4 (b) 22/67 (c) -2/25 (d) 0.01 (e) -5 (f) 3/8
c
Which is the closest to 3/206? (a) -1 (b) -2/5 (c) 52 (d) -4/7
b
What is the nearest to 2 in -31894, -1/3, 0.2?
0.2
What is the nearest to 0 in -0.3, -195, -1/21, 11, -3?
-1/21
Which is the nearest to -1? (a) 5.8 (b) -194 (c) -0.2 (d) -4 (e) 0.2 (f) 2/13
c
What is the closest to 0.1 in -0.2, -2630, -1, -218?
-0.2
Which is the closest to -3/2? (a) 5 (b) 11/2 (c) -6 (d) 1/6 (e) 13/3
d
What is the closest to 2/9627 in 0.2844, -3, 0.4?
0.2844
Which is the closest to 3? (a) 1/13 (b) 0.1 (c) 1 (d) 2/11 (e) -23
c
What is the nearest to 0.52 in 3, 481/11, 2?
2
Which is the nearest to 1? (a) 0.3 (b) 0 (c) 3 (d) 0.034 (e) 123 (f) 1
f
Which is the closest to -1.39? (a) -5 (b) -53 (c) -0.09 (d) 0.4 (e) 6/5
c
Which is the nearest to 211.054? (a) -0.5 (b) -7 (c) -0.4
c
Which is the nearest to 1/2? (a) 7 (b) 0.4 (c) 58147
b
Which is the closest to -0.0745? (a) -1 (b) 0 (c) 5897
b
What is the closest to -205 in 0.05, -32/7, 0.2?
-32/7
Which is the nearest to -0.8? (a) -0.4 (b) 78995.9 (c) -3
a
What is the nearest to -2/3 in -2/11, -360028, 1?
-2/11
Which is the nearest to 0? (a) 6 (b) 0.5 (c) -324 (d) 5/4 (e) 2/13
e
Which is the closest to -26? (a) 9 (b) 2/23 (c) 1/8 (d) -1/12 (e) -1
e
What is the closest to -1 in -5, -0.03, 2, 0.0401, 7, -5/6?
-5/6
What is the closest to -0.1 in -5, -30, 3/38, 0.9, 4, -2/135?
-2/135
Which is the closest to -1? (a) 2 (b) 0 (c) 2368 (d) 20 (e) 0.5
b
What is the closest to -0.3 in 2/9, 3/4, -0.128, 13, 4.8?
-0.128
What is the nearest to -2 in 3/10, -1/4, 3.5, -3.8, -2/11?
-1/4
Which is the closest to 6049? (a) -5 (b) 5 (c) 2/5 (d) 1.31 (e) 4
b
What is the closest to -11 in -0.03278, -1.6, 1/3?
-1.6
What is the closest to -2 in 0.74, 2.25, 0, 2, -2/5?
-2/5
Which is the closest to -1? (a) 5 (b) -1/68 (c) -2 (d) -1/5 (e) 78/7
d
What is the nearest to -2/191 in 4, 0.9, 1/2, -1, -0.1?
-0.1
Which is the nearest to -5825? (a) 39 (b) -18 (c) 0
b
What is the nearest to -8 in 1/4, 83, -2, 60, 0.07?
-2
Which is the nearest to -7? (a) 6929 (b) -11 (c) |
#FROM golang:latest
FROM dev.reg.iflytek.com/base/golang:1.8.3
WORKDIR /go/src/github.com/fanux
RUN go get github.com/nats-io/gnatsd && \
go get github.com/fanux/lhttp && \
git clone https://github.com/fanux/lhttp-web-demo && \
cd lhttp-web-demo && go install && \
cd ../lhttp/websocketServer && go install
CMD sh lhttp/start.sh
|
Q:
General meaning of the term "Functional"
In the most general is a "functional" simply a function which can accept a function as input?
So, is it natural to describe:
$f: \mathbb{N} \rightarrow \mathbb{N}$
as a function. Whereas it is more natural to describe:
$F: (\mathbb{N} \rightarrow \mathbb{N}) \rightarrow \mathbb{N} $
As a functional (although it is obviously still a function).
The context is a book on Domain Theory, where they describe:
$$GCD(h;a,b) := \begin{cases}b & \text{if } rem(a,b) = 0 \\ h(b,rem(a,b)) & \text{otherwise} \\\end{cases}$$
as a functional.
A:
A functional is a function from a vector space to its underlying field. Often the vector space is a function space, in which case the argument is indeed a function, but this isn't always the case. In general a function which takes a function as an argument is called a higher order function (although this term is really from computer science, not mathematics).
|
/*
* Copyright (c) 2017, 2019, Oracle and/or its affiliates. All rights reserved.
*
* This program is free software; you can redistribute it and/or modify
* it under the terms of the GNU General Public License, version 2.0,
* as published by the Free Software Foundation.
*
* This program is also distributed with certain software (including
* but not limited to OpenSSL) that is licensed under separate terms,
* as designated in a particular file or component or in included license
* documentation. The authors of MySQL hereby grant you an additional
* permission to link the program and your derivative works with the
* separately licensed software that they have included with MySQL.
*
* This program is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
* GNU General Public License, version 2.0, for more details.
*
* You should have received a copy of the GNU General Public License
* along with this program; if not, write to the Free Software
* Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA
*/
#ifndef PLUGIN_X_TESTS_DRIVER_CONNECTOR_SESSION_HOLDER_H_
#define PLUGIN_X_TESTS_DRIVER_CONNECTOR_SESSION_HOLDER_H_
#include <cassert>
#include <cstdint>
#include <limits>
#include <map>
#include <memory>
#include <string>
#include <utility>
#include <vector>
#include "my_macros.h" // NOLINT(build/include_subdir)
#include "plugin/x/client/mysqlxclient/xconnection.h"
#include "plugin/x/client/mysqlxclient/xsession.h"
#include "plugin/x/protocol/stream/compression/compression_algorithm_interface.h"
#include "plugin/x/src/helper/optional_value.h"
#include "plugin/x/tests/driver/formatters/console.h"
struct Connection_options {
std::string socket;
std::string host;
std::string network_namespace;
int port{0};
std::string user;
std::string password;
std::string schema;
std::string ssl_mode;
std::string ssl_ca;
std::string ssl_fips_mode;
std::string ssl_ca_path;
std::string ssl_cert;
std::string ssl_cipher;
std::string ssl_key;
std::string allowed_tls;
int64_t io_timeout{-1};
int64_t session_connect_timeout{-1};
bool dont_wait_for_disconnect{false};
bool trace_protocol{false};
xcl::Internet_protocol ip_mode{xcl::Internet_protocol::V4};
std::vector<std::string> auth_methods;
bool compatible{false};
std::vector<std::string> compression_algorithm{"DEFLATE_STREAM",
"LZ4_MESSAGE", "ZSTD_STREAM"};
std::string compression_mode{"DISABLED"};
bool compression_combine_mixed_messages{true};
int64_t compression_max_combine_messages{0};
xpl::Optional_value<int32_t> compression_level;
bool is_ssl_set() const {
return !ssl_ca.empty() || !ssl_ca_path.empty() || !ssl_cert.empty() ||
!ssl_cipher.empty() || !ssl_key.empty();
}
};
class Session_holder {
private:
using Frame_type = Mysqlx::Notice::Frame::Type;
public:
Session_holder(std::unique_ptr<xcl::XSession> session, const Console &console,
const Connection_options &options);
protocol::Compression_algorithm_interface *get_algorithm();
xcl::XSession *get_session();
bool enable_compression(const xcl::Compression_algorithm algorithm,
const int64_t level);
void clear_received_messages();
bool try_get_number_of_received_messages(const std::string message_name,
uint64_t *value) const;
void remove_notice_handler();
xcl::XError connect(const bool is_raw_connection);
xcl::XError reconnect();
private:
xcl::XError setup_session();
xcl::XError setup_connection();
void setup_compression();
void setup_ssl();
void setup_other_options();
void setup_msg_callbacks();
xcl::Handler_result trace_send_messages(
xcl::XProtocol *protocol,
const xcl::XProtocol::Client_message_type_id msg_id,
const xcl::XProtocol::Message &msg);
xcl::Handler_result trace_received_messages(
xcl::XProtocol *protocol,
const xcl::XProtocol::Server_message_type_id msg_id,
const xcl::XProtocol::Message &msg);
xcl::Handler_result count_received_messages(
xcl::XProtocol *protocol,
const xcl::XProtocol::Server_message_type_id msg_id,
const xcl::XProtocol::Message &msg);
xcl::Handler_result dump_notices(const xcl::XProtocol *protocol,
const bool is_global, const Frame_type type,
const char *data,
const uint32_t data_length);
void print_message(const std::string &direction,
const xcl::XProtocol::Message &msg);
std::shared_ptr<protocol::Compression_algorithm_interface> m_algorithm;
xcl::XProtocol::Handler_id m_handler_id{-1};
std::unique_ptr<xcl::XSession> m_session;
std::map<std::string, uint64_t> m_received_msg_counters;
const Console &m_console;
Connection_options m_options;
bool m_is_raw_connection{false};
};
#endif // PLUGIN_X_TESTS_DRIVER_CONNECTOR_SESSION_HOLDER_H_
|
Hi everyone.
I have ported Theora to Symbian OS and am now in the process of
trying to increase my maximum playback speed. I have done a few
Assembly Language optimisations such as my YUV -> RGB routine and some
blitting routines, but they constitute such a small amount of the total
CPU time being used that they only made about 1 FPS difference. I am
currently running 208 x 176 video at about 10.5 FPS and I am aiming for
about 15 FPS.
Can anyone point out some routines which could be considered as "low
hanging fruit," which would benefit from Assembly Language
implementation? From prior experience I would think that the Ogg
bitstream routines, the motion compensation routines and the DCT
routines would be a good start.
I unfortunately don't have access to a profiler at the moment, which
makes it difficult for me to figure these things out for myself.
Thanks in advance for any help you can give.
--
Colin Ward
Aida Senior Sofware Engineer
CSIRO, Australia |
Temporary suspension and delays in international mail: due to the spread of the novel coronavirus (COVID-19), countries and territories around the world are stopping acceptance of postal items and experiencing delivery delays. Your order will be canceled if you order from an affected region or if it cannot be delivered. We deeply apologize for the inconvenience to our customers and request your understanding. Please confirm your region's postal situation before you order. (See the Japan Post notice here)
This is a safe and natural manicure used "Gofun"(scallop shell fine powder) for the materials. "Gofun" which has excellent functions of antibacteria, sterilization, and deodorizing, has been used as painting pigment of Japanese paintings or Kyoto dolls for long period of time. Enjoy the beautiful and seasonal Kyoto-like colors which are produced by applying the technique of painting. As it is easy to remove with an alcohol for disinfection, it is safe for kids to use it as well.
"Thunberg's meadowsweet" is high-end gray which is elegant and matured. |
/*
* Licensed to the Apache Software Foundation (ASF) under one
* or more contributor license agreements. See the NOTICE file
* distributed with this work for additional information
* regarding copyright ownership. The ASF licenses this file
* to you under the Apache License, Version 2.0 (the
* "License"); you may not use this file except in compliance
* with the License. You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package org.apache.hive.benchmark.vectorization.mapjoin;
import org.apache.hadoop.hive.ql.exec.vector.mapjoin.MapJoinTestConfig.MapJoinTestImplementation;
import org.apache.hadoop.hive.ql.plan.VectorMapJoinDesc.VectorMapJoinVariation;
import org.openjdk.jmh.annotations.Scope;
import org.openjdk.jmh.annotations.Setup;
import org.openjdk.jmh.annotations.State;
import org.openjdk.jmh.runner.Runner;
import org.openjdk.jmh.runner.RunnerException;
import org.openjdk.jmh.runner.options.Options;
import org.openjdk.jmh.runner.options.OptionsBuilder;
/*
* Simple one long key map join benchmarks.
*
* Build with "mvn clean install -DskipTests -Pdist,itests" at main hive directory.
*
* From itests/hive-jmh directory, run:
* java -jar target/benchmarks.jar org.apache.hive.benchmark.vectorization.mapjoin.MapJoinOneStringKeyBench
*
* {INNER, INNER_BIG_ONLY, LEFT_SEMI, OUTER}
* X
* {ROW_MODE_HASH_MAP, ROW_MODE_OPTIMIZED, VECTOR_PASS_THROUGH, NATIVE_VECTOR_OPTIMIZED, NATIVE_VECTOR_FAST}
*
*/
@State(Scope.Benchmark)
public class MapJoinOneStringKeyBench extends AbstractMapJoin {
public static class MapJoinOneStringKeyInnerRowModeHashMapBench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.INNER, MapJoinTestImplementation.ROW_MODE_HASH_MAP);
}
}
public static class MapJoinOneStringKeyInnerRowModeOptimized_Bench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.INNER, MapJoinTestImplementation.ROW_MODE_OPTIMIZED);
}
}
public static class MapJoinOneStringKeyInnerVectorPassThrough_Bench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.INNER, MapJoinTestImplementation.VECTOR_PASS_THROUGH);
}
}
public static class MapJoinOneStringKeyInnerNativeVectorOptimizedBench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.INNER, MapJoinTestImplementation.NATIVE_VECTOR_OPTIMIZED);
}
}
public static class MapJoinOneStringKeyInnerNativeVectorFastBench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.INNER, MapJoinTestImplementation.NATIVE_VECTOR_FAST);
}
}
//-----------------------------------------------------------------------------------------------
public static class MapJoinOneStringKeyInnerBigOnlyRowModeHashMapBench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.INNER_BIG_ONLY, MapJoinTestImplementation.ROW_MODE_HASH_MAP);
}
}
public static class MapJoinOneStringKeyInnerBigOnlyRowModeOptimized_Bench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.INNER_BIG_ONLY, MapJoinTestImplementation.ROW_MODE_OPTIMIZED);
}
}
public static class MapJoinOneStringKeyInnerBigOnlyVectorPassThrough_Bench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.INNER_BIG_ONLY, MapJoinTestImplementation.VECTOR_PASS_THROUGH);
}
}
public static class MapJoinOneStringKeyInnerBigOnlyNativeVectorOptimizedBench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.INNER_BIG_ONLY, MapJoinTestImplementation.NATIVE_VECTOR_OPTIMIZED);
}
}
public static class MapJoinOneStringKeyInnerBigOnlyNativeVectorFastBench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.INNER_BIG_ONLY, MapJoinTestImplementation.NATIVE_VECTOR_FAST);
}
}
//-----------------------------------------------------------------------------------------------
public static class MapJoinOneStringKeyLeftSemiRowModeHashMapBench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.LEFT_SEMI, MapJoinTestImplementation.ROW_MODE_HASH_MAP);
}
}
public static class MapJoinOneStringKeyLeftSemiRowModeOptimized_Bench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.LEFT_SEMI, MapJoinTestImplementation.ROW_MODE_OPTIMIZED);
}
}
public static class MapJoinOneStringKeyLeftSemiVectorPassThrough_Bench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.LEFT_SEMI, MapJoinTestImplementation.VECTOR_PASS_THROUGH);
}
}
public static class MapJoinOneStringKeyLeftSemiNativeVectorOptimizedBench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.LEFT_SEMI, MapJoinTestImplementation.NATIVE_VECTOR_OPTIMIZED);
}
}
public static class MapJoinOneStringKeyLeftSemiNativeVectorFastBench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.LEFT_SEMI, MapJoinTestImplementation.NATIVE_VECTOR_FAST);
}
}
//-----------------------------------------------------------------------------------------------
public static class MapJoinOneStringKeyOuterRowModeHashMapBench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.OUTER, MapJoinTestImplementation.ROW_MODE_HASH_MAP);
}
}
public static class MapJoinOneStringKeyOuterRowModeOptimized_Bench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.OUTER, MapJoinTestImplementation.ROW_MODE_OPTIMIZED);
}
}
public static class MapJoinOneStringKeyOuterVectorPassThrough_Bench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.OUTER, MapJoinTestImplementation.VECTOR_PASS_THROUGH);
}
}
public static class MapJoinOneStringKeyOuterNativeVectorOptimizedBench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.OUTER, MapJoinTestImplementation.NATIVE_VECTOR_OPTIMIZED);
}
}
public static class MapJoinOneStringKeyOuterNativeVectorFastBench extends MapJoinOneStringKeyBenchBase {
@Setup
public void setup() throws Exception {
doSetup(VectorMapJoinVariation.OUTER, MapJoinTestImplementation.NATIVE_VECTOR_FAST);
}
}
//-----------------------------------------------------------------------------------------------
public static void main(String[] args) throws RunnerException {
Options opt = new OptionsBuilder()
.include(".*" + MapJoinOneStringKeyBench.class.getSimpleName() + ".*")
.build();
new Runner(opt).run();
}
} |
A Minnesota trucking company closed down for good without any warning on Friday, leaving hundreds of workers out of work.
According to LME, Inc.'s website, a statement went on to say that the company ceased operations due to "unforeseen circumstances."
The following is a full statement from the company:
"We apologize for the inconvenience of the situation but effective July 12, 2019 LME Inc. will no longer be making pickups or deliveries of freight due to unforeseen circumstances and have ceased operations. Our plan is to utilize an alternate carrier to assist in getting all freight delivered and some staff are remaining to help with that. Freight handled by the alternative carrier will be billed by the alternative carrier but with your LME rates applied to the invoice. There will be some delays in the transits of these moves and they may be significantly delayed in some remote locations. LME Inc."
KSTP/Matt Belanger
Joe Habeck, a New Ulm resident and driver for LME Trucking for the past eight years out of its terminal in Courtland, said he was out driving Thursday when the company told him to come back, drop off the truck and eventually stated the company was closing.
"They said, 'come back' and I said 'why' and they said 'can't tell you, just come back," he said. "Then they said, 'we're done, get your stuff and go home.'"
Habeck noted he was supposed to get paid on Friday but wasn't. He says he is owed about $2,400 still from the company in total.
"I have a new truck I just bought. Don't know how I'm going to pay that," Habeck said. "I have car insurance, a family to feed and no health insurance now. I'd like to know what happened and give me my money I am owed. I worked for it-- it's stealing from me, basically."
Habeck's emotions are running high, alike his former co-workers.
"Honestly I'd like to cry but I don't know, I'm just in shock yet," he said. "They [co-workers] are all in shock [and] they don't know what to next."
LME Trucking's website says the company employed over 600 people in multiple states — listing 3M and John Deere as major accounts. |
Impaired receptor editing in the primary B cell repertoire of BASH-deficient mice.
The editing of B cell Ag receptor (BCR) through successive rearrangements of Ig genes has been considered to be a major mechanism for the central B cell tolerance, which precludes appearance of self-reactive B cells, through studies using anti-self-Ig transgenic/knock-in mouse systems. However, contribution of the receptor editing in the development of the normal B cell repertoire remains unclear. In addition, the signaling pathway directing this event is unknown. In this study, we demonstrate that receptor editing in anti-DNA Ig knock-in mice is impaired in the absence of an adaptor protein BASH (BLNK/SLP-65) that is involved in BCR signaling. Remarkably, the supposed hallmarks of receptor editing such as Iglambda chain expression, recombination sequence rearrangements at Igkappa loci, and presence of in-frame VkappaJkappa joins in the Igkappa loci inactivated by the recombination sequence rearrangements, were all diminished in BASH-deficient mice with unmanipulated Ig loci. BCR ligation-induced Iglambda gene recombination in vitro was also impaired in BASH-deficient B cells. Furthermore, the BASH-deficient mice showed an excessive Ab response to a DNA carrier immunization, suggesting the presence of unedited DNA-reactive B cells in the periphery. These results not only define a signaling pathway required for receptor editing but indicate that the BCR-signaled receptor editing indeed operates in the development of normal B cell repertoire and contributes to establishing the B cell tolerance. |
Decavanadate as a biochemical tool in the elucidation of muscle contraction regulation.
Recently reported decameric vanadate (V(10)) high affinity binding site in myosin S1, suggests that it can be used as a tool in the muscle contraction regulation. In the present article, it is shown that V(10) species induces myosin S1 cleavage, upon irradiation, at the 23 and 74 kDa sites, the latter being prevented by actin and the former blocked by the presence of ATP. Identical cleavage patterns were found for meta- and decavanadate solutions, indicating that V(10) and tetrameric vanadate (V(4)) have the same binding sites in myosin S1. Concentrations as low as 50 muM decavanadate (5 muM V(10) species) induces 30% of protein cleavage, whereas 500 muM metavanadate is needed to attain the same extent of cleavage. After irradiation, V(10) species is rapidly decomposed, upon protein addition, forming vanadyl (V(4+)) species during the process. It was also observed by NMR line broadening experiments that, V(10) competes with V(4) for the myosin S1 binding sites, having a higher affinity. In addition, V(4) interaction with myosin S1 is highly affected by the products release during ATP hydrolysis in the presence or absence of actin, whereas V(10) appears to be affected at a much lower extent. From these results it is proposed that the binding of vanadate oligomers to myosin S1 at the phosphate loop (23 kDa site) is probably the cause of the actin stimulated myosin ATPase inhibition by the prevention of ATP/ADP exchange, and that this interaction is favoured for higher vanadate anions, such as V(10). |
A list of film revivals and the occasional new one, to catch in NYC, mainly Manhattan and Queens. Sometimes reviews of what i see, unless I'm not in the mood. Not every revival, just what I want to see and might be able to catch.
Sunday, January 19, 2014
Revivals: late January edition
Hey all, Mike here with a short list for the rest of January. A small-ish list, but one I'm enthusiastic about. Let's start with the screening I want to catch the most:
ALL THAT JAZZ introduced by Matt Zoller Seitz- Fri Jan 24 at 7- Museum of the Moving Image in Astoria- Part of the Museum of the Moving Image's See It Big series: Musicals Edition. A DCP restoration of Bob Fosse'ssemi-autobiographical film, better than any print previously used in other revival houses. Around 1974, Fosse was trying to direct, co-write and choreograph Chicago on Broadway starring his (long separated) wife Gwen Verdon: while trying to balance his relationship with girlfriend Ann Reinking with the other women he slept around with, keep up a relationship with his daughter, and struggle to edit his film Lenny into something at least watchable. All while being a chain smoker and popping Dexedrine like they were candies. Wanna guess how many heart attacks he had, and how close to death he was?
After he got better and both projects went up, what's a man to do? After he put up the show Dancin', he chose to make all of that into a movie. His friend Shirley MacLaine claims to have given Fosse the idea, he claimed not to remember. But otherwise, change the names to protect the innocent as well as those he might not have liked, such as Michael Bennett, played in a way by John Lithgow. Made sure he came off as the biggest jerk of all, yet still likable. Bring in some veterans who have been around his world, like Ben Vereen, Leland Palmer (who came out of retirement to play the Gwen Verdon type, then went back into retirement), designer Tony Walton to help with the Art Direction, and Reinking to essentially play herself (which she does well, plus dances terrifically). Make the film essentially a flashback from a place that might be in-between life and death, and that might only be happening in the Fosse-like man's imagination, with Jessica Lange as one luscious Angel of Death, and you've got a helluva picture.
Non-original music and newly developed Fosse choreography shine here. For those who have difficulty with musicals where the singing and dancing come from inorganic places, note the singing and dancing only come from the audition/rehearsal of a musical, one moment performing for Dad, and that imagination place between life and death. The best example was the use of Teddy Pendergrass's On Broadway. In another F.U. to Michael Bennett (allegedly), Fosse whittled down the audition process of ensemble dancers as depicted in A Chorus Line (which crushed Chicago at the Tonys and was still a massive hit when All That Jazz was released) into a mere 3-5 minutes of what Fosse thought was more realistic. It's one of the showstoppers of this film.
That said, we're in for the ride, because we buy Roy Scheider as the Fosse type. According to Razzle Dazzle (the Fosse biography by Kevin Boyd Grubb); unlike Warren Beatty who wanted massive rewrites to fit his tempo, or Jack Nicholson who was more interested in watching the Lakers than talking in depth with Fosse, or Richard Dreyfuss who quit before he was fired during rehearsal, Scheider was more submissive. He was actually willing to learn how to be Fosse from Fosse, not impose a character of his own creation. Might not necessarily be ideal, but film is the director's medium. You might not believe Scheider was ever a dancer before the last scene, but you do come away believing everything else.
Which brings me to one particular part of All That Jazz. The two top films for me that came out in 1979 are All That Jazz and Apocalypse Now. The difference for me between Apocalypse being very good and All That Jazz being not only the best film of 1979, but also in my personal top 35 ever, is the ending. Apocalypse is one of the best, until we get to see Marlon The World's Fattest Green Beret, and then Coppola's film deflates and suffers (Redux only partially fixes this). But the ending of All That Jazz is a great finale, the build-up leads to a payoff greater than expected. And when it's time for us to go, what could be better than a send-off with singing, dancing lights, spectacle, and everyone we ever became close to giving us a fond farewell. The little details is what Fosse nailed, while Francis had fat Marlon in the jungle.
Not as big a hit as Cabaret, but successful enough. 9 Oscar nominations, including Picture, Fosse for Director and Screenplay, Scheider for Actor and also for Cinematography. 4 Oscars, including Art Direction and Editing. In fact, it one the first 4 awards announced at the 1980 ceremonies. Don't know why they didn't start with a Supporting Category like in other years. But after that, the Kramer vs. Kramer steamroller commenced, and All That Jazz's commercial momentum slowed. It also won Fosse the Golden Palm at the Cannes Film Festival.One can argue what was the first standout, live action movie musical of the 2000s. Whether you think its Moulin Rouge or Rob Marshall's Chicago. But the last great live action musical before any of them was All That Jazz.
The film will be introduced by Matt Zoller Seitz, TV critic for New York Magazine and Vulture.com, and contributor to rogerebert.com. He wrote a glowing look-back on All That Jazz for the New York Times, for the film's 30th anniversary. He cited how this and Fosse's other film work was inspired by the likes of Alain Resnais and Sidney Lumet, and how said filmography has inspired the likes (in terms of narrative and editing room choices) of Steven Soderbergh, Alejandro Gonzalez Inarritu, and Sofia Coppola. I've included a link to that enthusiastic article below the Moving Image link, and I'm sure Mr. Seitz will bring the same enthusiasm to his introduction:
MY DARLING CLEMENTINE- Sat Jan 25 at 5:30, 7:30 and 9:30 and Mon Jan 27 and Thurs Jan 30 (both tentative for me) at 7:30 and 9:30- Film Forum- A new DCP restoration. Another John Ford classic in a career full of classics. For me, my preferred classics from Ford's career are Mister Roberts and The Ox-Bow Incident. For the likes of Scorsese, it's The Searchers. For others it might be say, Stagecoach or The Quiet Man or How Green Was My Valley. For the likes of Sam Peckinpaugh and in terms of some shots (according to the Film Forum's website), Ingmar Bergman, it would be My Darling Clementine.
A telling of the Wyatt Earp/ Doc Holliday story, culminating in the shoot-out at the O.K. Corral. Plays around with facts, makes up or combines characters, the later in the case of the title character, Clementine Carter. Seems this story gelled together in part thanks to Wyatt Earp's widow stymieing all screenplay efforts prior to her death in late 1944, in part out of memories of Ford talking to Earp on Western film sets back in the Silent Era, and because of the popularity of the Wyatt Earp books from author Stuart Lake (now "considered largely fictional"). Even then, it probably wouldn't have been made by Ford if he didn't have one more film left to make as part of his contract with 20th Century Fox, so he stuck with a genre and man he felt comfortable with.
Heavy on atmosphere and dealing with absolutes, especially against dastardly Old Man Clanton (Walter Brenann) and his sons. Two different love-crossed relationships involving Wyatt, Clementine, bucolic Doc Holliday (Victor Mature) and a Mexican hooker. And stoic Everyman Henry Fonda as Wyatt, riding through Monument Valley to the lawless town of Tombstone. Great Cinematography as well.
A film generally on the short list among the best Westerns ever made. This DCP restoration is the 104 minute archival cut from UCLA's film archive, as opposed to the 97 minute theatrical release. Ford's original 127 minute or so cut, taken away from him by Fox, seems forever lost. But we have something good here:
THE MUPPET SHOW episodes with Rita Moreno, Steve Martin and Carol Burnett- Sun Jan 26 at 1- Museum of the Moving Image in Astoria- A chance to see 3 episodes of The Muppet Show, uncut. At least how it was aired in America, they tended to be a little longer in Britain. The first official episode with guest star Rita Moreno, with our first Veterinarian's Hospital, first Muppet News Flash, first Swedish Chef, and the first time Fozzie bombs onstage. Followed by the Steve Martin episode, where the Show is "Closed for auditions". Martin shows off his banjo skills and Statler and Waldorf make a rare appearance out of the balcony. The day concludes with Carol Burnett episode, where all attempts to perform are blocked by Gonzo's impromptu dance marathon.
Moreno received her first Emmy for her work here in a performance that made her an EGOT, the Burnett episode won an Emmy for its writing, and I've enjoyed the change of pace from the usual format with Martin's episode. All will be introduced and explained by Craig Shemin, president of the Jim Henson Legacy:
THE POSEIDON ADVENTURE for 7.50- Thurs Jan 30 at 7 and 9:30- Bow Tie Cinemas- I tried to see this a couple of years ago at Lincoln Center, but Hurricane Irene hit so bye-bye went that opportunity. Aside from one or two Midnight screenings at Landmark Sunshine Cinema, the other screenings of this film have been at this Chelsea location. Those screenings were not convenient for me, and these two screenings might be just as inconvenient for me. But since I'm not exactly sure how my life will go on that day, I will post this film and see what happens.
Either the 7pm screening with a Hedda Lettuce intro, or 9:30 without it, both for 7.50. I don't know if there will be discreet-ish commentary in the style of MST3K by Hedda for the 7pm show; the film doesn't entirely need it, but there are sections where it wouldn't hurt.
As for The Poseidon Adventure itself, I've been waiting to see this film on the big screen for a while now. The best disaster film ever made. One part action film, one part adventure film and one part religious parable, a group of passengers try to survive when the ocean liner they were on completely capsizes. They're attempting to reach the bottom or outer hull of the ship, which is the thinnest part of the ship and is above the surface. It's a theory that help will come in that direction, and that theory comes from a young boy, but those who haven't given up feel it's the only way to survive and see The Morning After (the title of the Oscar winning song). Gene Hackman plays an atypical hero, an ultra-self-righteous, Captain Ahab-esque, defrocked preacher whose personality clashes with loud doubter Ernest Borgnine may proof more problematic than the fires and leaks the group encounters. Throw in aspects of The Flying Dutchmen, Ship of Fools, other survivors wandering the ship like they were in the desert, and all the survivors looking for salvation of some sort, and you got parables right in your face. Or you can enjoy the strong acting and good action set pieces. Fine cast that includes Red Buttons, Jack Albertson, Leslie Neilsen, Roddy McDowell and Oscar nominated Shelley Winters. A special Oscar for its Visual Effects. 8 nominations in total, including Cinematography, Editing and for John Williams' fine score:
A STAR IS BORN (1954)- Fri Jan 31 at 7- Museum of the Moving Image- A 35mm print as part of the Museum's See It Big series: Musicals edition. 2 hours 56 minutes long; a little shorter than the advertised cuts at Lincoln Center a year or two ago of 3 hours 1 minute. I don't know what exactly stays in or out. Hell I'm guessing that I can do this screening at all, so I'm posting this just in case. Warner Bros. executives cut out 30 minutes after the film's premiere, before it was released. Director George Cukor fought it, to no avail. Not only was a lot of A Star Is Born cut, but a musical number, Born in a Trunk was added. In 1983, a version that restored all but 5 minutes was released, but the shortened cut seemed to be what was usually screened on some stations and revival screenings. This cut is longer than most of what has been screened in other revival houses prior to 2008.
Chances are you know the story, whether it's this version, Janet Gaynor's, Streisand's or some variation so I don't have to go into it too much. Cukor's fist musical and first color film, where Judy Garland plays the unknown who becomes a star, and James Mason plays the leading man who discovers her, marries her, and falls apart due to depression and alcoholism. Bogie, Gary Cooper, Brando, Montgomery Clift and Cary Grant all turned down the role; they all apparently didn't want to be perceived as loser has-beens, though Grant was supposedly afraid of working with a probably unreliable drug addict like Garland. Grant seemed to be right regarding the difficulties it would take to work with the actress. Illnesses both real and imaginary (or made up?), fluctuating weight and difficulties from alcoholism and drug addiction made it a problematic shoot. And that was before Warner Bros. decided that A Star is Born had to be their first CinemaScope picture, forcing Cukor to scrap everything that had been shot and do it all over again. Oh joy.
Garland (singing mostly Ira Gershwin tunes) and Mason were both Oscar nominated, as was the Art Direction, Costume Design, Music and the Gershwin- Harold Arlen song "The Man That Got Away". That song might just be the highlight of the film. Overall, may or may not be the best version of this story, but one that holds up: |
Q:
Merging results in T-SQL statement
I have to queries:
select id, name, num from pending
id, name, num
1, first, 1
3, third, 12
select id, name, num from completed
id, name, num
1, first, 100
2, second, 20
I want output to combine these, maybe like a pivot table, using T-SQL.
id, name, pending, completed, total
1, first, 1, 100, 101
2, second, null, 20, 20
3, third, 12, null, 12
How can this be written?
A:
No need for a pivot.
SELECT
COALESCE(p.id, c.id),
COALESCE(p.name, c.name),
p.num AS pending,
c.num AS completed,
COALESCE (p.num, 0) + COALESCE (c.num, 0) AS total
FROM
pending p
FULL OUTER JOIN
completed c ON p.id = c.id
COALESCE is ANSI SQL but you could use ISNULL too
|
Today, I’m offering you a job. The pay is no good, but the schedule is your own, and all you have to do is pretend you’re a tour guide.
Friends or relatives are coming to Los Angeles for the first time. They want to see the Hollywood sign, check out the beach scene in Santa Monica or Venice, and visit the Getty or the Broad. All the usual stuff.
But they also want to get past that, and have an authentic experience or two before getting back on the plane.
So where will you take them?
I wondered about this two weeks ago on a trip to Rome, where massive crowds of tourists at the Colosseum, the Forum, St. Peter’s and the Trevi Fountain made me want to stray off course and find the city only locals know. Where would I advise someone visiting my city to do that?
I realize, of course, that you can live in Los Angeles for years and not know half its secrets or even begin to understand this necklace of disparate cities and neighborhoods strung together with asphalt. But we all have found a few of our own sanctuaries.
A view of the Griffith Observatory, with downtown Los Angeles sparkling in the background. (Wally Skalij / Los Angeles Times)
I asked some people around town to let me in on their secrets.
“Go grab a Busy Bee sandwich on Walker Avenue and head down to Royal Palms Beach and watch a beautiful sunset, or you can even catch a glimpse of whales in peak season,” said City Councilman Joe Buscaino, making a good pitch for the San Pedro area he represents.
“What we call entertainment along our waterfront is watching the massive ships” coming and going, Buscaino said. “You see the regional and international economy right before your eyes, and you don’t get to see that in other parts of the city.”
All right, so that isn’t quite a Universal Studios experience, but that’s the point.
The Los Angeles Tourism & Convention Board offers itineraries and ideas at discoverlosangeles.com, and there are some unexpected treats among them, including the Libros Schmibros Lending Library in Boyle Heights, the Baxter Street stairs in Echo Park, or the Martial Arts History Museum in Burbank.
“We know travelers today are increasingly seeking authentic experiences where they can really become immersed in the destination and live like a local,” said Ernest Wooden Jr., chief executive of the tourism board.
“Go check out Leimert Park and see the black influence on the city,” said my friend Lawrence Tolliver, a South Los Angeles barber. He just celebrated his 75th birthday in that neighborhood, where you can find books and live music and check out the art space created by local artist Mark Bradford, who was recently featured on “60 Minutes.”
Tolliver also recommended going to the heart of downtown L.A.’s commercial and residential renaissance, and then wander a few blocks east.
“You’ll see people in tents and get a sense of the real Los Angeles paradox — rich people two blocks away from poor people,” he said.
Emanuel Berry, 12, plays in the Watts Towers Art Center Amphitheater as the sun sets on a warm February day. (Bob Chamberlin / Los Angeles Times)
Luis Rodriguez, author and former Los Angeles poet laureate, recommends visiting what he called “the most iconic L.A. symbol outside of the Hollywood sign”: Watts Towers, built over 33 years in the last century by Italian immigrant and tile mason Simon Rodia.
Rodriguez would also have you travel by the Metro Gold Line, not Uber, to Mariachi Plaza in Boyle Heights.
“Walk around. Get the flavor of the turn-of-the-last-century houses and learn about its Jewish, Japanese and Mexican history,” he said. “There’s still a Buddhist temple and synagogues as well as Jewish and Chinese cemeteries.”
Whatever your neighborhood, living like a local means knowing we all sleep on a bed of cracked plates. One of the most eye-opening and terrifying local experiences I’ve had was a tour of the San Andreas fault with earthquake queen Lucy Jones. But you don’t have to go all the way to the desert for a sense of our impending doom.
“I’d take them on a tour of the Hollywood fault — from Griffith Park to Ozzie and Harriet’s house” near Runyon Canyon, Jones said. She sent me details on scarps, thrusts and a tell-tale topography that reveals our eternal peril.
But we live in denial, so let’s eat.
“There’s a hot dog place that’s really hot right now at the top of California Market,” said Peaches Chung, a communications specialist with the Koreatown Youth and Community Center.
“You know how American people eat corn dogs as a meal? Koreans eat them as a snack… You fry corn dogs, sprinkle them with sugar and top them with ketchup.”
Peaches, her real name, recommended the squid ink and mozzarella dog.
A view of the 110 Freeway slicing through downtown Los Angeles as photographed from a helicopter. (Wally Skalij / Los Angeles Times)
Kathay Feng, an attorney with Common Cause, told me she just took a visiting friend on a three-day tour of the San Gabriel Valley, and she sent me her notes on the whole itinerary.
Day 1: Vietnamese Pho at Golden Deli, trip to Huntington Library, dinner at Xiao Vei Yang — “hot pot of boiling soup base that you slowly throw in meats, vegetables, noodles and a lot of other goodies.” And “this sounds crazy, but we ate a second late-night dinner at Juicy Dumplings in Focus Plaza.”
Day 2: Breakfast at Si Hai (scallion pancakes, sweet soft tofu, and Zhong Zi, a Chinese tamale), tour of San Gabriel Mission and Ramona Museum, chilaquiles at Luna’s, performance at Mission Playhouse, Popsicle break at Nomad Ice Pops, dinner at Mian (“amazing spicy Chengdu noodles), Boba at Bo Po Mo Fo, “and, yes, we lost our minds and had a second later dinner at Green Zone restaurant.”
Should I give you Day 3, or should we just give Kathay Feng her own reality TV show and follow her around that way?
I could go on, of course.
You have to once in your life see a grunion run, for instance. And you have to go to the intersection of Lincoln and Ozone on the Santa Monica/Venice border, breathe deeply and see if you can find the willpower to pass the Mariscos Guillen La Playita shack WITHOUT stopping to buy a shrimp taco.
You should go to the Griffith Observatory before the sun comes up and hike the trail behind it until the downtown skyline and the Pacific Ocean appear in the first light of day.
Or go to El Matador State Beach in Malibu and watch the waves carve the rock sculptures, or to a Marina del Rey bait shop, where you might get lucky and see monks in saffron robes buying live bait and setting it free.
Sophie Yoo, 10, of Thousand Oaks plays in the arches of a rock formation while watching the tide roll in at twilight at El Matador State Beach in Malibu. (Allen J. Schaben / Los Angeles Times)
And then you’ll know you can be in only one place.
Now, I’m turning this job over to you. Send me your own personal guide to your Los Angeles, and you might get it published one day, right here.
No Disneyland, no Walk of Fame, no Santa Monica Pier. I want the hidden gems.
steve.lopez@latimes.com
|
Amazing! This is the only image in existence with mermaid form's hair undone!
I always search for new angles to use ss inspiration for my fanfiction. This one is the best! And it makes her look so *human*. Simply heartwarming. |
[Molecular epidemiology of hepatitis B virus in Northern Cyprus].
Identification of hepatitis B virus (HBV) strains and understanding of molecular epidemiological characteristics are important for the effective surveillance of HBV infections. Genotype D is dominant in studies performed in Turkey but it is known that cases infected with genotypes A, E, G and H also exists. In contrast, there are no data regarding the molecular epidemiologic characteristics of the HBV in Northern Cyprus. The aim of this study was to determine the distribution of genotypes and subgenotypes of HBV among the people living, educating and working in Northern Cyprus. A total of 160 cases (1.2%) who were HBsAg seropositive out of 13.892 subjects admitted to Nicosia, Near East University Hospital microbiology laboratory for the routine control and to blood center for donor screening tests between November 2011 to September 2014, were included in the study. HBV-DNA levels in the HBsAg positive cases were detected by real-time polymerase chain reaction and genotypes/subgenotypes were determined by sequence analysis of the viral pol gene (reverse transcriptase [rt] region, between 80-250. aminoacids). Sixty samples (60/160, 37.5%) were excluded from sequencing analysis due to negative and/or very low (< 30 IU/ml) HBV-DNA levels, so 100 samples were included in sequence analysis. Ninety-six of those cases (13 female, 87 male; mean age: 35.51 ± 12.88 years) were anti-HBc IgG, 95 were anti-HBe and five were HBeAg positive, with a mean HBV-DNA level of 5.36 x 10(6) ± 3.58 x 10(7) IU/ml. As 32 (32%) samples yielded HBV-DNA level below the threshold of 1000 IU/ml, sequence analyses were unsuccesful, eventually 68 (68/160, 42.5%) samples could be phylogenetically analyzed. The distribution of HBV genotypes/subgenotypes were found as follows: 48 were (70.6%) D/D1; four were (5.9%) D/D2; one was (1.5%) D/D3, five were (7.4%) A/A1, two were (2.9%) A/A2 and eight were (11.8%) genotype E. Among the most frequent D1 strains, 60.4% (29/48) cases were from Turkish; single D/D3 strain from Benguela (Angola) and all eight genotype E strains were from Nigerian national cases. According to the data of this first study performed in TRNC on this subject, genotype D is dominant (53/68, 78%) in Northern Cyprus and consistent with the subgenotype distribution that is similar to Turkey and mediterranean basin. The prevalences of genotype A (7/68, 10.3%) and E (8/68, 11.8%) were also remarkable. In conclusion, although Northern Cyprus is an island country the heterogeneous distribution of HBV genotype/subgenotype may be contributed to the cosmopolitan characteristics of various populations from different countries who have come here for education, work or touristic purposes. |
Prince of Persia: The Sands of Time Walkthrough :
This walkthrough for Prince of Persia: The Sands of Time [Playstation 2] has been posted at 08 Aug 2008 by shadow95 and is called "There's something glowing up there". The Walkthrough have a rating 2 by 2 our users. If walkthrough is usable don't forgot thumbs up shadow95 and share this with your freinds. And most important we have 47 other walkthroughs for Prince of Persia: The Sands of Time, read them all!
Walkthrough - There's something glowing up there
//-----------------------------------------------------------------\\
"There's something glowing up there" (33%)
\\-----------------------------------------------------------------//
T33%
<<>>
Sand Fields 2
Fountain of Life 0
Description Press three buttons, pull two levers, push a block through a
hole. Head back to the previous room, and follow the path to
the next save-point.
<<>>
Take a look around the room. On both sides there's a bunch of pipes hanging
from the ceiling. There's a wall with a crack on one side, and a shabby door
on the other. On the left side of the room (seen from the door you entered
through) there is a gate. Behind it are two more gates, you need to open all
three of them to reach a lever. So, let's do that first. Each door is opened
by a button. The first button is in the floor of the pool in the center of
the room. Step on it, watch the scene. Now, when you step off the button,
Farah should get onto it. If not, try again. When you've placed Farah at the
right spot, go to the pool at the end of the room, past the save-point.
There are two buttons here: one on the left wall, and one on the right. To
the left there's a big statue. If you've watched the vision, you know what
to do: push the statue towards the button on the wall. The head of the thing
will push the button. Alright, that's two. Now run up the wall to the last
button, and touch it. Now all three doors will be opened. You have to be
quickly, because the first door (the one you opened lastly) will close soon.
The other two will stay opened though. Once you've made it past the three
gates, grab the Sand Field and then turn the lever. Some pools in the big
room are now drained. Exit this small room, back into the big room.
Now, from the door you entered through, turn right. Walk through the bath
that is now drained of water. On the wall up ahead, you should be able to
see a small, narrow ledge. Run up the wall and grab the ledge (you couldn't
do this before because of the water). Climb up, and then jump off to grab the
pipe behind you. Move around the corner of the pipe. And swing to the next
part. The pipe you're on and the next part make a 90 degrees angle, but it's
still possible to grab it. On the second pipe, move around the corner again,
and swing on to the lever in the corner. When you hang from it, a hatch near
the start of the room will partly open. Get down to the ground, and back to
the entrance. Now turn left. On the wall ahead is another narrow ledge. Grab
it, climb up, and jump to the pipe. Swing towards the next section of pipe.
Don't try to swing to the next part, it's too far to reach it. Instead, move
around the corner, and swing to the pillar to the right. Grab the pillar,
and jump to the next one. Now you can jump to the third section of pipes.
Swing on to the lever in the corner. When you pull it, the hatch will open
up completely. Head to that hatch now. There's a big white block in the
bath nearby. Push it into the hole in the wall.
Alright, now what? Well, you need to cross the room with the swinging bars
again. The route is exactly the same as before, so that's no problem. You'll
be back in the room where you moved that pot. The white block you've just
pushed through the hole is in the bath here. Push it down the little
waterfall. Remember that ladder you couldn't reach? Well, push the block
under the ladder, and now you can reach it! Climb up, and absorb the Sand
Field at the top. Enter the door, and hang from the edge on the other side.
Drop down, and move right. Go through the hole in the grate. On the other
side, hang from the ledge again, and move left. Jump off to the column
behind you. Turn, so that your back is pointing to the wall on the left,
and jump off. You should be able to grab the narrow ledge here. Jump up,
grab the ledge above you, and move to the right, past the hole in the grate.
Drop down to the ledge below, and then grab the rim in the corner. From here,
jump off to grab the pole behind you. Swing to the next platform. Now
perform two Wall-Runs to get to the door. There's a pole above your head
here. Run up the wall next to the door, and jump off. Grab the pole, and
swing from pole to pole to reach the other side of the room. Get onto the
ledge here. Move towards the door, and smash the obstacles. Press the button
on the floor to open a door. Get past two spinning blades, this should be no
problem. In the next room, you'll have to fight a bunch of enemies again, but
it shouldn't be too much of a problem. Use the save-point that appears after
the fight.
<<>>
1) Behind the three gates that you have to open to reach a lever.
2) After pushing the block through the hole, make your way back through the
corridor with the swinging bars and push the block under the ladder. The
Field's at the top of this ladder, right in the path you have to take. |
---------------------- Forwarded by Vince J Kaminski/HOU/ECT on 12/30/99
04:31 PM ---------------------------
Vince J Kaminski
10/04/99 07:30 AM
To: Andrew Schuleman/AA/Corp/Enron@ENRON
cc: Thomas Bauer/AA/Corp/Enron@Enron, Richard Causey/Corp/Enron@Enron, Ted
Murphy/HOU/ECT@ECT, Stinson Gibner/HOU/ECT@ECT, Vince J Kaminski/HOU/ECT@ECT,
Patty Grutzmacher/AA/Corp/Enron@Enron, John Sorrells/AA/Corp/Enron@Enron,
Derek Claybrook/AA/Corp/Enron@Enron
Subject: Re: Model Development Report
Andy,
Thanks for your message regarding the Model Risk project. I think it's a very
important issue and really critical to Enron. The model risk represents a
very significant exposure to the company: a wrong model results in bad
decisions and eventually leads to accounting errors and incorrect financial
statements.
Here are my comments.
1. Reasons of model risk. The main source of model risk in Enron is omitted
in your list. I think it's due to the fact that the responsibility for the
final model approval and validation is dispersed in the organization and
there no single unit/person that is vested with the authority to audit,
approve and monitor valuation models. The popular perception is that this is
done by the Research Group, but this could not be further form the truth.
Given the way the organization evolved over the last few years, we became a
group of internal consultants, working on highly specialized, partial
problems (sometimes, we work on a project from A to Z, but it's an exception
to the rule).
It's imperative that this is communicated to the senior management in a
precise, non-ambiguous way. I think that this is the main source of potential
problems and the first shortcoming of the modeling process to be corrected.
2. Inappropriate application of models. I would expand point 3 in your
draft (inappropriate application of models)
and add two lower level points: a) wrong inputs b) incorrect model used for a
given transaction. TVA is an example of point a: a transaction in case of
which the inputs have not been being updated for an extended period of time
in the past.
3. Control Strength. Under Control Strength you can mention that several
audits
of the Research Group model by Arthur Andersen and Darrell Duffie have been
initiated at our insistence.
4. Audit scope. I don't think you can address the issue of the model risk if
you exclude
from your review Risk Analytics and IT. The model development
activity cannot be divided into separate, independent processes.
I am afraid your recommendations will be highly inaccurate if your audit
scope will
remain as is.
Vince Kaminski
Andrew Schuleman@ENRON
09/29/99 06:00 PM
To: Wanda Curry/HOU/ECT@ECT, Vince J Kaminski/HOU/ECT@ECT
cc:
Subject: Model Development Report
Attached is a draft of the Model Development Report that will be presented at
the Controller's Meeting on Friday, October 1, 1999. I would appreciate if
you could please review the report and respond with any comments prior to the
meeting. I appreciate all your help and cooperation throughout our review.
Thanks,
Andy |
Moss makes a beautiful and extremely versatile addition to any garden space. Moss can be grown in shady areas, as part of a rock garden, in conjunction with water gardens and ponds or in areas where grass struggles to grow. Learn about the wonders of moss from moss gardener and owner of Moss Acres, Al [...] |
In the modern information age it is imperative for the organization to have its information at its fingertips. To meet this need for information, additions to systems are often developed to give consolidated management overviews of the operational information. Often, consolidated views require information from several operational systems and this leads to separate systems, often referred to as MIS (management information systems) or decision support systems. Sometimes the consolidated management information is represented in a specialized system often referred to as a data warehouse. |
For Bintcliffe, it marks a return to top-class action with the German prestige car manufacturer after three years in the BTCC racing the permanent all-wheel-drive Audi A4 quattro (1996-7) and the front-wheel-drive Audi A4 (1998) as team-mate to Frank Biela (1996-7) and Yvan Muller (1998) for Audi Sport UK.
Bintcliffe, who raced against and beat drivers like Audi’s 1996 BTCC champion Biela, Nigel Mansell, Alain Menu, Jason Plato, Rickard Rydell, Gabriele Tarquini, Derek Warwick and Joachim Winkelhock, during his three year BTCC spell, has not raced since September 1998. He joined the Audi squad after winning three consecutive one-make championships (1993 Honda CRX, 1994 Renault Clio and 1995 Ford Credit Fiesta).
Palmer, meanwhile, will be stepping up to the GT3 specification Audi R8 LMS after racing Westfield and Caterham sports cars between 2002-5. The team is planning a concerted pre-season test program in the UK which actually began yesterday (Oct 13) with Guasch driving a Ginetta at Brands Hatch and continues at Silverstone today (Oct 14) and Snetterton tomorrow (Oct 15).
Race Results Amended For Final FIA GT3 European Championship Race At Zolder
Following post-race inspections, United Autosports has been re-classified in seventh (Zak Brown/Matthew Bell) & 10th (Michael Guasch/Mark Patterson) places in the 12th and final race at Zolder (Oct 10). It means Brown/Bell were the highest placed Audi R8 LMS and marks the first time both United Autosports sports cars have finished in the top-10 in the same race.
The amended results mean United Autosports finish 11th FIA GT3 Teams Championship. In the Audi Manufacturer's Cup, Guasch/Patterson tied in the runners-up position with Bell/Brown seventh.
* The result of round 12 and championship positions remain provisional subject to the outstanding appeals, lodged by Prospeed Competition and Belgian Audi Club, being heard by the International Court of Appeal (ICA).
“I’m delighted to be racing full time again and especially that it’s in an Audi. Contesting the British GT Championship with United Autosports as Richard [Dean] has been a friend for years and to co-drive with Jay, another long-term friend who I ran in my Westfield and Caterham teams, is the icing on the cake. I’ve never raced in the British GT category but know it’s a very professionally run and competitive series. Having driven the four-wheel-drive Audi quattro and front-wheel-drive Audi A4 in the British Touring Car Championship in the 1990s, it’ll be interesting to add the rear-wheel-drive Audi R8 LMS to my portfolio and I guess will be a somewhat unique achievement.”
“Competing in the British GT Championship will be a steep learning curve for me but after a pre-season test program, I’m sure I’ll be there or thereabouts – especially having John as my co-driver and the competitive package of United Autosports and the Audi R8 LMS behind me. I have only previously raced Westfield or Caterham cars but tested GT3 machinery [Ascari and Porsche]. My business commitments will now allow me to race regularly for the first time since 2005 and I’m very excited about the prospect.”
Zak Brown (USA). Driver, Chairman, Co-Owner United Autosports:
“I'm extremely pleased that United Autosports will be racing regularly in Britain next season – in many respects it remains the ‘home’ of world motorsport. I’m certain the Audi R8 LMS sports car will be ultra-competitive in the BGT and will prove to be immensely popular with British race fans. In Matt Bell and Mike Guasch, a pairing we announced earlier this month, and now John and Jay, we have two driver pairings who I’m sure will be title BGT contenders despite the series being very competitive.”
Richard Dean (GB), Managing Director & Co-Owner of United Autosports:
“I'm excited on so many levels to have Jay and John joining our team. With our driver British GT Championship line-up already completed by October, it gives us plenty of time to prepare for next season’s campaign. Jay knows most of the BGT circuits but GT3 is a big step up for him so testing time before the 2011 test ban kicks in will be of great benefit for him
“John's return to racing an Audi in the UK will spark lots of memories for British Touring Car race fans and will generate some lively debate on just how fast he is likely to be in a GT3 sports car! I’m certain he will run at the front from the opening race of the season. Twelve years on from his ‘factory’ drive with Audi Sport UK, it’s a compliment to United Autosports he has chosen us for his racing return.” |
Q:
Get ComboBox selected value from a list which has two types of objects and the combobox is only showing one of them
I'm building a C# application in Windows Forms.
I have a vehicle class and two derived classes car and motorbike.
I then have the vehicles saved into a list.
Now I have a form where I want to show only the cars or only the motorbikes. In a main form there is a button "show cars" and another button "show motorbikes" and they will tell the other form which to list ("type" variable in code below).
In the show form I have a combobox which will show all the cars or motorbikes (only one, not both) that exist and when selecting one, there are textboxes that will show the info from that one.
To populate the combobox I use:
foreach (Vehicle V in GetVehiclesList())
{
if (type == "Car")
{
if (V.WhatIsIt() == "Car")
{
combobox.Items.Add(V.GetVehicleName());
}
}
else if (type == "Motorbike")
{
if (V.WhatIsIt() == "Motorbike")
{
combobox.Items.Add(V.GetVehicleName());
}
}
}
Note: WhatIsIt() returns a string with the class' name.
Now the problem is to get the selected vehicle in the combobox to show the info from that vehicle.
If I wanted to show all the vehicles, I would use this:
private void combobox_SelectedIndexChanged(object sender, EventArgs e)
{
VehicleToShow = GetVehiclesList()[combobox.SelectedIndex];
vehicle_name_textbox.Text = VehicleToShow.GetVehicleName();
// and goes on
}
What this does is it gets the index number of the combobox item selected and goes get the vehicle in the list with that same position number.
It works because the vehicles are added to the combobox with same position/index as in the list.
Therefore, it doesn't work for displaying only one of them (car or motorbike) because the position number in list will fail to be equal to the index in combobox.
So I used the folowing approach:
private void combobox_SelectedIndexChanged(object sender, EventArgs e)
{
VehicleToShow = null;
int carposition = 0;
int motorbikeposition = 0;
int comboboxindex = combobox.SelectedIndex;
foreach (Vehicle V in GetVehiclesList())
{
if (V.WhatIsIt() == "Car")
{
if (carposition == comboboxindex)
{
VehicleToShow = V;
}
else
{
carposition++;
}
}
else if (V.WhatIsIt() == "Motorbike")
{
if (motorbikeposition == comboboxindex)
{
VehicleToShow = V;
}
else
{
motorbikeposition++;
}
}
}
vehicle_name_textbox.Text = VehicleToShow.GetVehicleName();
// and goes on
}
While this seems to me to be something that should work, when using it, it won't display the info from the vehicle selected in the combobox.
How can I get it to work?
Note: Placing each vehicle type in a different list is not an option. Also, searching list for an object with same name as selected value is not best option since it won't work properly if it has two vehicles with same name. Ideally it would be something similar as the approach I tried to use.
A:
Don't add the names of your objects to the list. Add the actual objects themselves instead; then combobox.SelectedItem immediately contains everything you need without requiring any lookup at all, since it'll be the full object.
The filling of the data:
this.combobox.Items.Clear();
foreach (Vehicle veh in this.GetVehiclesList())
{
// assuming "type" is a string variable filled up by some other selected value.
if (!String.Equals(type, typeof(veh).ToString()))
continue;
this.combobox.Items.Add(veh);
}
Though derloopkat's suggestion of saving type as an actual Type so you can compare them directly is probably more efficient than string compares. Avoid string compares in code; they are often an ugly programmer shortcut for something that can be done way more elegantly and efficiently internally.
To make them show up in the list correctly, simply add the ToString() function in your vehicle class that returns the actual vehicle name:
public override String ToString()
{
return this.GetVehicleName()
}
And finally, to retrieve the selected object and update your UI:
private void combobox_SelectedIndexChanged(Object sender, EventArgs e)
{
// "as" is a "try cast": if the object is not the expected type it will become null.
this.VehicleToShow = this.combobox.SelectedItem As Vehicle;
if (this.VehicleToShow == null)
return; // maybe add code to clear UI
this.vehicle_name_textbox.Text = this.VehicleToShow.GetVehicleName();
// fill in the rest
}
|
Q:
GORM (grails) - cache blob image or something else
Let's say I have a domain class
class Profile{
String name
byte[] logo
}
and a controller:
class ImageController {
def renderImage ={
def image = Profile.get(params.id).logo
if (image) {
response.setContentLength(image.length)
response.getOutputStream().write(image)
} else {
response.sendError(404)
}
}
}
and a gsp:
<img width="48"
height="48"
src="${createLink(controller: 'image', action: 'renderImage', id: 1)}">
Ok so so far so good. The image renders fine and I am happy. However, since the gsp snippet is part of my main layout the image is rendered each time I reload a page.
My question: is there a way to cache this image (blob mysql)? I have 2nd level caching turned on etc. But I am not sure if the image is cached or not. How would you do this?
thanks.
A:
Add static mapping = { cache true } to your Profile domain class to turn on caching. As long as you fetch the Profile objects with get(id), it'll use the cached version. If you're using a more complicated query, you'll need to let grails know the query is cacheable too.
See the Caching section in the Grails manual. Also, it can be helpful to turn on hibernate SQL logging to confirm the objects are cached.
|
Jeanne Baret
Jeanne Baret (sometimes spelled Baré or Barret) (July 27, 1740 – August 5, 1807) was a member of Louis Antoine de Bougainville's expedition on the ships La Boudeuse and Étoile in 1766–1769. Baret is recognized as the first woman to have completed a voyage of circumnavigation of the globe.
Jeanne Baret joined the expedition disguised as a man, calling herself Jean Baret. She enlisted as valet and assistant to the expedition's naturalist, Philibert Commerçon (anglicized as Commerson), shortly before Bougainville's ships sailed from France. According to Bougainville's account, Baret was herself an expert botanist.
Early life
Jeanne Baret was born on July 27, 1740, in the village of La Comelle in the Burgundy region of France. Her record of baptism survives and identifies her as the legitimate issue of Jean Baret and Jeanne Pochard. Her father is identified as a day laborer and seems likely to have been illiterate, as he did not sign the parish register.
Nothing definitive is known of Baret's childhood or young adulthood. She later told Bougainville that she had been orphaned and lost her fortune in a lawsuit before taking to disguising herself as a man. While she might well have been an orphan given the low life expectancies of the time, historians agree that other details of the story she gave Bougainville were a fabrication to shield Commerson from complicity in her disguise. Burgundy was at this time one of the more backward provinces of France in terms of the condition of the peasant classes, and it is likely that Baret's family was quite impoverished.
One of the mysteries of Baret's life is how she obtained at least the rudiments of an education, as her signature on later legal documents provides evidence that she was not illiterate. One of her biographers, Glynis Ridley, suggests that her mother might have been of Huguenot extraction, a group that had a higher tradition of literacy than was otherwise typical of the peasant classes of the time. Another biographer, John Dunmore, suggests that she was taught by the parish priest or taken on as a charity case by a member of the local gentry.
Relationship with Commerson
At some point between 1760 and 1764, Baret became employed as housekeeper to Commerson, who had settled in Toulon-sur-Arroux, some 20 km to the south of La Comelle, upon his marriage in 1760. Commerson's wife, who was the sister of the parish priest, died shortly after giving birth to a son in April 1762, and it seems most likely that Baret took over management of Commerson's household at that time, if not before.
It is also evident that Baret and Commerson shared a more personal relationship, as Baret became pregnant in 1764. French law at that time required women who became pregnant out of wedlock to obtain a "certificate of pregnancy" in which they could name the father of their unborn child. Baret's certificate, from August 1764, survives; it was filed in a town 30 km away and witnessed by two men of substance who likewise had travelled a considerable distance from their homes. She refused to name the father of her child, but historians do not doubt that it was Commerson and that it was Commerson who had also made the arrangements with the lawyer and witnesses on her behalf.
Shortly afterwards, Baret and Commerson moved together to Paris, where she continued in the role of his housekeeper.
Baret apparently changed her name to "Jeanne de Bonnefoy" during this period. Her child, born in December 1764, was given the name Jean-Pierre Baret. Baret gave the child up to the Paris Foundlings Hospital. He was quickly placed with a foster mother but died in the summer of 1765. (Commerson had left his legitimate son from his marriage in the care of his brother-in-law in Toulon-sur-Arroux and never saw him again in his lifetime.)
In 1765, Commerson was invited to join Bougainville's expedition. He hesitated in accepting because he was often in poor health; he required Baret's assistance as a nurse as well as in running his household and managing his collections and papers. His appointment allowed him a servant, paid as a royal expense, but women were completely prohibited on French navy ships at this time. At some point, the idea of Baret disguising herself as a man in order to accompany Commerson was conceived. To avoid scrutiny, she was to join the expedition immediately before the ship sailed, pretending to be a stranger to Commerson.
Before leaving Paris, Commerson drew up a will in which he left to "Jeanne Baret, known as de Bonnefoi, my housekeeper", a lump sum of 600 livres along with back wages owed and the furnishings of their Paris apartment. Thus, while the story Baret concocted for Bougainville's benefit to explain her presence on board ship was carefully designed to shield Commerson from involvement, there is clear documentary evidence of their previous relationship, and it is highly improbable that Commerson was not complicit in the plan himself.
With Bougainville
Baret and Commerson joined the Bougainville expedition at the port of Rochefort in late December 1766. They were assigned to sail on the storeship, the Étoile. Because of the vast quantity of equipment Commerson was bringing on the voyage, the ship's captain, François Chesnard de la Giraudais, gave up his own large cabin on the ship to Commerson and his "assistant". This gave Baret significantly more privacy than she would have had otherwise on board the crowded ship. In particular, the captain's cabin gave Baret access to private toilet facilities so that she did not have to use the shared head with other members of the crew.
In addition to Bougainville's published account, Baret's story figures in three other surviving memoirs of the expedition: a journal kept jointly by Commerson and Pierre Duclos-Guyot; a journal by the Prince of Nassau-Siegen, a paying passenger on the Boudeuse; and a memoir by François Vivès, surgeon on the Étoile. Vivès has the most to say about Baret, but his memoir is problematical because he and Commerson were on bad terms throughout the voyage, and his account – largely written or revised after the fact – is full of innuendo and spiteful comments directed at both Commerson and Baret.
Commerson suffered badly from both seasickness and a recurring ulcer on his leg in the early part of the voyage, and Baret probably spent most of her time attending to him. Aside from the ceremony of "crossing the line", which Commerson described in some detail in his memoir, there was little for the botanists to do until the Étoile reached Montevideo. There they set out on expeditions to the surrounding plains and mountains. Commerson's leg was still troubling him, and Baret seems to have done much of the actual labor, carrying supplies and specimens. In Rio de Janeiro – a much more dangerous place, where the Étoiles chaplain was murdered ashore soon after their arrival – Commerson was officially confined to the ship while his leg healed, but he and Baret nonetheless collected specimens of a flowering vine, which he named Bougainvillea.
After a second visit to Montevideo, their next opportunity to collect plants was in Patagonia while the ships of the expedition were waiting for favorable winds to carry them through the Strait of Magellan. Here Baret accompanied Commerson on the most troublesome excursions over rugged terrain and gained a reputation for courage and strength. Commerson, still hampered by his leg injury, referred to Baret as his "beast of burden" on these expeditions. In addition to the manual labor she performed in collecting plants, stones, and shells, Baret also helped Commerson organize and catalog their specimens and notes in the weeks that followed, as the ships entered the Pacific.
Surviving accounts of the expedition differ on when Baret's gender was first discovered. According to Bougainville, rumors that Baret was a woman had circulated for some time, but her gender was not finally confirmed until the expedition reached Tahiti in April 1768. As soon as she and Commerson landed on shore, Baret was immediately surrounded by Tahitians who cried out that she was a woman. It was necessary to return her to the ship to protect her from the excited Tahitians. Bougainville recorded this incident in his journal some weeks after it happened, when he had an opportunity to visit the Étoile to interview Baret personally.
In his account, Vivès reports much speculation about Baret's gender early in the voyage and asserts that Baret claimed to be a eunuch when confronted directly by La Giraudais (whose own official log has not survived). Bougainville's account of Baret's unmasking on Tahiti is not corroborated by the other journal accounts of the expedition, although Vivès describes a similar incident in which Baret was immediately pointed out as a woman by the Tahitian Ahu-toru on board the ship. Vivès also describes a different incident on New Ireland in mid-July in which Baret was caught off-guard, stripped, and "examined" by a group of other servants on the expedition. Duclos-Guyot and Nassau-Siegen also recorded that Baret had been discovered to be a woman on New Ireland, but without mentioning details.
Ahu-toru travelled back to France with the expedition and was subsequently questioned at some length about Baret. Modern scholars now believe that Ahu-toru actually thought that Baret was a transvestite, or mahu. However, other Tahitian natives reported the presence of a woman in Bougainville's expedition to later visitors to the island, including James Cook in 1769 and Domingo de Bonechea in 1772, which indicates that her gender was known to the Tahitians if not to her shipmates at the time she visited the island.
After crossing the Pacific, the expedition was desperately short of food. After a brief stop for supplies in the Dutch East Indies (now Indonesia), the ships made a longer stop at the island of Mauritius in the Indian Ocean. This island, known as Isle de France, was then an important French trading station. Commerson was delighted to find that his old friend and fellow botanist Pierre Poivre was serving as governor on the island, and Commerson and Baret remained behind as Poivre's guests. Probably Bougainville also actively encouraged this arrangement, as it allowed him to rid himself of the problem of a woman illegally on board his expedition.
On Mauritius, Baret continued in her role as Commerson's assistant and housekeeper. It is likely that she accompanied him in plant-collecting on Madagascar and Bourbon Island in 1770–1772. Commerson continued to have serious health problems, and he died in Mauritius in February 1773. His financial resources on the island had dwindled, his patron Poivre had been recalled to Paris, and Baret was left without the means to immediately return to France to claim the money due her from Commerson's will.
Later life
After Commerson's death, Baret seems to have found work running a tavern in Port Louis for a time. Then, on May 17, 1774, she married Jean Dubernat, a non-commissioned officer in the French Army who was most likely on the island on his way home to France.
There is no record of exactly when Baret and her husband arrived in France, thus completing her voyage of circumnavigation. Most likely it was sometime in 1775. In April 1776, she received the money that was due to her under Commerson's will after applying directly to the Attorney General. With this money, she settled with Dubernat in his native village of Saint-Aulaye where he possibly became the blacksmith.
In 1785, Baret was granted a pension of 200 livres a year by the Ministry of Marine. The document granting her this pension makes clear the high regard with which she was held by this point:
Jeanne Barré, by means of a disguise, circumnavigated the globe on one of the vessels commanded by Mr de Bougainville. She devoted herself in particular to assisting Mr de Commerson, doctor and botanist, and shared with great courage the labours and dangers of this savant. Her behaviour was exemplary and Mr de Bougainville refers to it with all due credit.... His Lordship has been gracious enough to grant to this extraordinary woman a pension of two hundred livres a year to be drawn from the fund for invalid servicemen and this pension shall be payable from 1 January 1785.
She died in Saint-Aulaye on August 5, 1807, at the age of 67.
Legacy and controversy
Commerson named many of the plants he collected after friends and acquaintances. One of them, a tall shrub with dark green leaves and white flowers that he found on Madagascar, he named Baretia bonafidia. But Commerson's name for this genus did not survive, as it had already been named by the time his reports reached Paris; it is currently known as Turraea. While over seventy species are named in honor of Commerson, only one, Solanum baretiae, honors Baret.
The New York Botanical Garden includes a plant specimen, attributed to Comerson but believed to be collected by Baret with him, in their herbarium.
For many years, Bougainville's published journal – a popular bestseller in its day, in English translations as well as the original French – was the only widely available source of information about Baret. More recent scholarship has uncovered additional facts and documentation about her life, but much of the new information remained little-known and inaccessible to the general public, particularly outside France. The first English-language biography of Baret, by John Dunmore, was not published until 2002, and then only in New Zealand. Other articles appeared only in scholarly journals.
The 2010 biography of Baret by Glynis Ridley, The Discovery of Jeanne Baret, brought Baret to the attention of a wider audience and helped to overturn some of the old misconceptions about her life. However, Ridley's biography has also been highly criticized by some reviewers for its reliance on improbable chains of speculation that are not corroborated by any other primary or secondary sources.
References
Category:1740 births
Category:1807 deaths
Category:French explorers
Category:French explorers of the Pacific
Category:Female travelers
Category:Female-to-male cross-dressers |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.