text stringlengths 8 5.77M |
|---|
New details about the upcoming “Spider-Man” reboot continue to emerge.
In addition to the recent casting news that Tom Holland will play Peter Parker, Marvel honcho Kevin Feige has revealed that the new film will explore Spider-Man in a firmly high-school setting.
“Spider-Man will be a ‘John Hughes’ movie,” Feige said in an interview with SlashFilm.
He added that Spidey’s age will set him apart from other Marvel characters. “Some of my favorite Spider-Man arcs and Spider-Man stories, he’s in high school for a lot of it. We want to explore that. That also makes him very, very different from any of our other characters in the MCU, which is something else we want to explore: how unique he is when now put against all these other characters.”
In an interview with Collider, Feige elaborated on the idea of pitting Parker against the other superheroes. Holland read against Robert Downey Jr. in a screen test, and reportedly held his own, which helped him cinch the part. “That was part of it,” Feige said. “When we’ll see that, I don’t know, but that was part of it.”
The Spidey reboot is likely to feature a comic-book villain who hasn’t been in any of the previous movies. “Right now we’re interested in seeing villains we haven’t seen before,” Feige told SlashFilm.
Feige also shared his rationale behind hiring Jon Watts to direct.
“We met with him four, five, or six times, and each time he had more and more interesting things to say,” Feige told Collider. “And at Marvel, it always comes down to ultimately, ‘We can make a movie with this person for two years, we could spend almost every day with this person for two years. Let’s go.'”
Related stories
Next 'Spider-Man' Will Still Be Peter Parker, Kevin Feige Confirms
Why Sony Called in Marvel's Big Gun to Reboot 'Spider-Man'
Marvel's Master Plan: Slate Grows to 3 Movies Per Year |
DALLAS (Reuters) - Dallas police headquarters and surrounding blocks were cordoned off and SWAT teams were deployed on Saturday after authorities received an anonymous threat against officers across the city, but a search for a “suspicious person” turned up no one, officials said.
The incident occurred as the city remained tense following Thursday night’s fatal shootings of five Dallas police officers by a former U.S. Army reservist. Police asked news organizations to stop airing live video from the area as they carried out the search.
Police said on Twitter that “out of an abundance of caution, officers searched the garage to ensure reports of a suspicious person (were) thoroughly investigated.” Police said they used a shotgun to get through a locked door during the search.
Before police sounded the “all clear,” tactical officers dressed in protective gear and armed with rifles searched the three-story structure, police said.
The department said there was no formal lockdown at the headquarters despite earlier media reports characterizing the incident that way. All streets around the building, however, were barricaded and vehicles were not allowed to enter the area, a Reuters eyewitness said.
“The Dallas Police Department received an anonymous threat against law enforcement across the city and has taken precautionary measures” to heighten security, Dallas police said in an emailed statement.
Before starting the sweep of the garage, officers pushed back reporters and camera operators who had gathered outside the headquarters in the Texas city’s downtown after initial reports of the lockdown. |
UNPUBLISHED
UNITED STATES COURT OF APPEALS
FOR THE FOURTH CIRCUIT
No. 96-2218
JAMES G. GILLES, Brother,
Plaintiff - Appellant,
versus
ROLAND M. WHEELER, Director of University
Services, Virginia Polytechnic Institute and
State University; ANN SPENCER, Associate Vice-
President for Personnel and Administrative
Services, Virginia Polytechnic Institute and
State University; CLARRESSA M. MORTON, Assis-
tant Director for Event Planning, Virginia
Polytechnic Institute and State University;
BOARD OF VISITORS, VIRGINIA POLYTECHNIC
INSTITUTE AND STATE UNIVERSITY; RICHARD M.
BAGLEY, Honorable; JOSEPH H. BARLOW; WILLIAM
C. BROADDUS, Esquire; HENRY J. DEKKER; BUFORD
L. DRISKILL, JR.; HORACE G. FRALIN; CLIFTON C.
GARVIN, JR.; ROBERT J. GREY, JR.; MICHAEL M.
HAWES, Vice-President for Finance and
Administration Olver, Incorporated; W. PAT
JENNINGS, SR., The Honorable; CECIL R. MAXSON,
JR., Facilities Executive Officer Corporate
Facilities Manager NationsBank Service
Corporation; RHEA F. MOORE, JR.; ROSE MILES
ROBINSON; SUE ELLEN ROCOVICH, Dr.; ROBERT
MORGAN, Student Member; PAUL E. TORGERSEN,
President, Virginia Polytechnic Institute and
State University; TOM GOODALE, Dr., Vice-
President for Student Affairs, Virginia
Polytechnic Institute and State University,
Defendants - Appellees,
and
BEVERLY H. SGRO, Dean of Students, Virginia
Polytechnic Institute and State University;
JERRY D. CAIN, General Counsel & Special As-
sistant Attorney General, Virginia Polytechnic
Institute and State University,
Defendants.
Appeal from the United States District Court for the Western Dis-
trict of Virginia, at Roanoke. Jackson L. Kiser, Senior District
Judge. (CA-92-933-R)
Submitted: November 28, 1997 Decided: December 11, 1997
Before WILKINSON, Chief Judge, and WIDENER and ERVIN, Circuit
Judges.
Affirmed by unpublished per curiam opinion.
J. Patrick Wiseman, WISEMAN, DURST, TUDDENHAM & OWEN, Austin,
Texas, for Appellant. James S. Gilmore, III, Attorney General of
Virginia, William H. Hurd, Deputy Attorney General, OFFICE OF THE
ATTORNEY GENERAL, Richmond, Virginia; Jerry D. Cain, General Coun-
sel/Special Assistant Attorney General, Kay Heidbreder, Associate
General Counsel/Special Assistant Attorney General, VIRGINIA
POLYTECHNIC INSTITUTE AND STATE UNIVERSITY, Blacksburg, Virginia,
for Appellees.
Unpublished opinions are not binding precedent in this circuit.
See Local Rule 36(c).
2
PER CURIAM:
Appellant James G. Gilles originally filed suit against Vir-
ginia Polytechnic Institute and State University ("Virginia Tech")
challenging the constitutionality of regulations under which the
university prohibited him from preaching at its drill field. By an
Agreed Order, the parties submitted to the district court only the
question of the constitutionality of Virginia Tech's sponsorship
regulation, which the court upheld against Appellant's First Amend-
ment challenge. On appeal, we vacated the district court's order
and remanded with directions to dismiss for lack of standing as
there was no justiciable issue. See Gilles v. Torgersen, 71 F.3d
497 (4th Cir. 1995).
While that appeal was pending, the district court granted
Appellant's motion for attorneys' fees based upon the Agreed Order.
When Defendants did not comply with the order, Appellant moved to
enforce it under Fed. R. Civ. P. 70. Defendants, in turn, filed a
motion to vacate the attorneys' fees order pursuant to Fed. R. Civ.
P. 60(b)(5). The district court granted Defendants' motion to va-
cate and denied Appellant's motion. Finding no reversible error, we
affirm the order based on the reasoning of the district court. See
Gilles v. Torgersen, No. 92-0933-R (W.D. Va. Aug. 9, 1996) *
AFFIRMED
*
We previously granted Appellant's unopposed motion to submit
this appeal for decision on the briefs without oral argument.
3
|
---
title: "Formspree"
icon: images/icons/formspree.svg
official_url: https://formspree.io/
--- |
The General Assembly of North Carolina declares it to be its
purpose to provide access to legal representation for domestic violence victims
in certain kinds of civil matters. The General Assembly finds that such
representation can best be provided in an efficient, effective, and economic
manner through established legal services programs in this State. (2004-186, s. 4.1.)
§ 7A-474.17. Definitions.
The following definitions shall apply throughout this
Article, unless the context otherwise requires:
(1) "Domestic violence victim" means a
resident of North Carolina that has been subjected to acts of domestic violence
as defined in G.S. 50B-1. A resident is not required to seek a protective order
under Chapter 50B of the General Statutes to qualify as a domestic violence
victim under this Article.
(2) "Legal assistance" means the provision of
any legal services, as defined by Chapter 84 of the General Statutes,
consistent with this Article. Provided, that all legal services provided
hereunder shall be performed consistently with the Rules of Professional
Conduct promulgated by the North Carolina State Bar. Provided, further, that no
funds appropriated under this Article shall be used for lobbying to influence
the passage or defeat of any legislation before any municipal, county, state,
or national legislative body.
(3) "Established legal services program"
means the following not-for-profit corporations using State funds to serve the
counties listed: Pisgah Legal Services, serving Buncombe, Henderson, Madison,
Polk, Rutherford, and Transylvania Counties; and Legal Aid of North Carolina;
or any successor entity or entities of the named organizations, or, should any
of the named organizations dissolve, the entity or entities providing
substantially the same services in substantially the same service area. (2004-186, s. 4.1; 2008-194, s. 3(c).)
§ 7A-474.18. Eligible activities and limitations.
(a) Eligible Activities. - Funds appropriated under
this Article shall be used only for the following purposes:
(1) To provide legal assistance to domestic violence
victims.
(2) To provide education to domestic violence victims
regarding their rights and duties under the law.
(3) To involve the private bar in the representation of
domestic violence victims pursuant to this Article.
(b) Eligible Cases. - The funds shall be prioritized
by each legal services program to serve the greatest number of eligible
clients, with emphasis placed on representation of clients needing legal
assistance with proceedings pursuant to Chapter 50B of the General Statutes.
Legal assistance shall be provided to eligible clients under this Article only
in the following types of cases:
(1) Actions for protective orders issued pursuant to
Chapter 50B of the General Statutes;
(2) Child custody and visitation issues; and
(3) Legal services which ensure the safety of the
client and the client's children.
(c) Limitations. - No funds appropriated under this
Article shall be used for any of the following purposes:
(1) To provide legal assistance with respect to any
criminal proceeding; or
(2) To provide legal assistance to any prisoner within
the Division of Adult Correction of the Department of Public Safety with regard
to the terms of that person's incarceration. (2004-186,
s. 4.1; 2011-145, s. 19.1(h); 2012-83, s. 16.)
§ 7A-474.19. Funds.
Funds to provide representation pursuant to this Article
shall be provided to the North Carolina State Bar for provision of direct
services by and support of the established legal services programs. The North
Carolina State Bar shall allocate these funds directly to each of the
established legal services programs with Pisgah Legal Services receiving the
allocation for Buncombe, Henderson, Madison, Polk, Rutherford, and Transylvania
Counties. Funds shall be allocated to each program based on the counties served
by that program using the following formula:
(1) Twenty percent (20%) based on a fixed equal dollar
amount for each county.
(2) Eighty percent (80%) based on the rate of civil
actions filed pursuant to Chapter 50B of the General Statutes in that county.
The North Carolina State Bar shall not use any of these funds
for its administrative costs. (2004-186, s. 4.1; 2008-194,
s. 3(d).)
§ 7A-474.20. Records and reports.
The established legal services programs shall keep
appropriate records and make periodic reports, as requested, to the North
Carolina State Bar. The North Carolina State Bar shall report annually to the
Chairs of the Joint Legislative Oversight Committee on Justice and Public
Safety on the amount of the funds disbursed and the use of the funds by each
legal services program receiving funds. The report to the Chairs of the Joint
Legislative Oversight Committee on Justice and Public Safety shall be made by January
15 of each year beginning January 15, 2006. (2004-186,
s. 4.1; 2013-360, s. 18B.5.) |
Q:
Is getting hit by Perishables/Food worse?
In Nichijou episode one, Yuuko gets hit by a Kokeshi, and then by an Akabeko on her head. She says that it could've been worse if she were struck by a Perishable, before actually getting hit on the head with a piece of Salmon.
I'm not sure if I get this. Why would it be worse? Why would she even say that? Is this some cultural reference, or am I just reading too much into this?
I should be glad nothing perishable struck me. It could have been worse.
A:
Perishables are worse because kokeshi is a solid wooden item and does not stain or make your hair dirty, whereas salmon would smell, and soil the hair. The joke is in the fact that she mentions the possibility of something like salmon falling on her head right before it happens. She mentions that because it is very unlikely that any object would fall from the sky and hit one's head, and it happens twice in a row, which is supposed to add to comic effect.
|
The geopolitical impact of consumer electronics
AN estimated 175,000 people gathered in Las Vegas from Jan. 6-9 for the annual International Consumer Electronics Show (CES), the premier conference of the consumer electronics industry. Some of the world’s largest firms useD the show to debut and feature new products and to showcase experimental and conceptual projects they are working on.
Advertisements
While Stratfor typically doesn’t track the latest iPhone model, the most dazzling 4K Ultra HD television or the highest resolution camera, the implications of the products themselves — and the innovative research behind them — can fundamentally change how countries interact with their citizens and with one another.
Then and now
Consumer electronics have only existed for about 100 years — since the advent of radio communications receivers — but their impact on geopolitics cannot be overstated.
Personal computers, cellphones and countless other products have revolutionized human life. Technological progress during the last century might equal that of the previous 1,000 or even 10,000 years, and consumer electronics have emerged as a major force behind that rapid advancement. Moreover, the pace of development is accelerating, and technologies that were unrelated 10 years ago — such as washing machines and the Internet — are now converging. This union of inertia and integration is a cornerstone of technological progress.
At the 2006 CES, everyone was looking at the latest flip phones, portable MP3 players, GPS-enabled navigation systems, e-readers and personal media players. The iPhone — which Apple introduced in 2007 — can perform the functions of all of those devices combined. Five years ago, tablets began emerging as smartphones kept getting larger and laptops and netbooks continued getting smaller. Last year, Microsoft released a combination of a tablet and a laptop called the Surface Book.
This year’s CES featured breathtaking curved 4K television sets alongside the debuts of other exciting projects. Google and Ford have already announced a joint venture in which Ford will build autonomous vehicles expanding on Google’s research in the field.
Unmanned aerial systems — drones — will be another centerpiece, with some models using hydrogen fuel cells to extend their ranges. Additive manufacturing, nanotech-based electronics, robotics, artificial intelligence and machine-learning technologies are all likely to be on display as well.
Although the products themselves have the ability to alter the world, it is the research involved in developing them that is truly groundbreaking. Historically, most research in the electronics industry grew out of government-led, public-private initiatives which involved the military more often than not. These days, consumer and industry demands are the leading force in the development of new technology. The demand for faster, more powerful and longer-lasting smartphones, tablets and laptops is driving research into new battery technology, investments into keeping up with Moore’s Law and most other research in the field.
The increasing demand for smart devices, the rise of smart grids and the convergence of these devices and the Internet — the so-called Internet of Things — will shape the way that machines communicate with each other and the way entire electric grids are designed.
Battery technology
2016 marks the 25th anniversary of Sony’s commercialization of the rechargeable lithium-ion battery. The battery has matured alongside the digital revolution, powering cellphones, laptops and almost every other device that needs a rechargeable battery. This has forced battery producers to invest in lithium-ion batteries to make them safer, smaller and capable of storing more energy. Though the humble battery has been slow to develop, its most profound geopolitical impact may be yet to come.
Tesla in the United States, LG Chem in South Korea and BYD in China are all building gigafactories to mass produce lithium-ion batteries for electric cars. This means that the specific technology that was pioneered, commercialized and then improved upon because of demands from the consumer electronics industry could strike a critical blow to oil’s monopoly as a transportation fuel. Ironically, it was Exxon that developed rechargeable lithium batteries in the 1970s, though they were never economical and were not lithium-ion.
Though lithium-ion batteries are not the only energy storage technology in development, they will dominate the small battery market for at least the next decade. This includes batteries used in electric vehicles, which are considered consumer electronics themselves.
Processing power
Consumer electronics have long driven advances in computing and processing power. True, much of the initial research and development of computers during the 1950s and early 1960s was funded by selling technology to the military. But since then the consumer electronics market has largely driven research, creating breakthroughs in the field.
The geopolitical, economic and military benefits of improvements in computing power are well documented: Heavily specialized supercomputers provide the foundation for research-intensive industries such as the health care sector, the oil and gas industry and defense. Increases in computing power resulted in smaller, more powerful computer chips, in turn enabling the digital revolution of the last five decades. And these advances are continuing unabated.
Now that consumer electronics have become the major force behind developments in processing power, maintaining Moore’s Law has become all the more important for chipmakers. As the personal computer market matured and consumer interest in laptops grew, promoting innovation in that field remained paramount. Now that the market has shifted toward smartphones and tablets, consumer demand for these gadgets will eventually taper off, raising the question of what, if anything, will take their place as the impetus for innovation.
This year’s CES offered a glimpse of some potential catalysts. Improvements in artificial intelligence, whether for robots or computers, require upgrades in computing power and algorithm complexity. Machine-learning algorithms and different means of direct human-machine interaction are expected to be among the major themes at CES this year. Of course, the next breakthrough in the field might be something different altogether. It could be the automation of vehicles, or some sort of virtual reality devices that turn everything we have now into high-definition lifelike projections. The possibilities are vast.
Conversely, it could be that the next growth engine for electronics does not require increased computing power. As machine-to-machine communication and the Internet of Things become more common, the proliferation of smart objects may not justify the expense of maintaining Moore’s Law. If consumer demand slows down, that could be geopolitically significant too — especially if the acceleration of digital innovation seen in the last 50 years slows with it.
Geopolitics and electronics
Consumer electronics is now one of the biggest markets in the world. Though US companies were early pioneers in the field, the Japanese soon caught up and by the 1980s rivaled the expertise of their US counterparts. Taiwan, Singapore and South Korea followed soon after. Each of these countries used consumer electronics as a springboard to move from low-end manufacturing into middle and high-end manufacturing. While these countries were often aided by foreign companies bringing in business operations to take advantage of low labor costs, they eventually developed their own indigenous capabilities.
This process is currently taking place in China. As of now, most of China’s electronics industry is either foreign-led or is licensing foreign technology. But Beijing’s priority is to foster a domestic capability in the industry and to eventually be able to compete with foreign electronics sectors. BYD, Xiaomi, Alibaba, Huawei, and Baidu are among the Chinese companies already making their mark on the global electronics scene. Over the coming years, China’s showing at electronics expos, including CES, will indicate its companies’ progress compared to the established industry giants in the United States, South Korea and Japan.
We cannot discount the possibility that consumer electronics will continue integrating into the heart of the global economic system. This means that companies such as Google, Facebook or even Baidu could become the most geopolitically important businesses going forward. This would not be unprecedented. For example, the East India Company factored heavily into geopolitics from the 17th century through the 19th century. The same is true of tobacco companies, which either contributed to or defined their countries’ geopolitical ambitions. Eventually, railroad companies in large countries such as the United States rose to become dominant regional forces.
Since Standard Oil’s emergence more than 100 years ago, oil companies have arguably been the most geopolitically important firms. Perhaps now that oil’s dominance in the global economy is beginning to ebb, technology companies will take the place of today’s energy giants. Regardless, the long-term developments and cumulative changes the consumer electronics sector brings about are as geopolitically important as innovations in any other part of the economy. |
Hotels and B&Bs
in and aroundMadron, Cornwall
AA rated
PENZANCE
Guest Accommodation
Part Georgian and part Victorian, the spacious Mount Royal has splendid views over Mount's Bay and is convenient for the town's attractions. There's a gracious elegance throughout with the impressive ...
AA rated
ST IVES
Guest Accommodation
This popular and attractive property stands on an elevated position convenient for the town centre and seafront. The Regent has well-equipped bedrooms, some with spectacular sea vistas, and the comfor...
AA rated
PENZANCE
Guest Accommodation
Penmorvah is just a few minutes' walk from the seafront with convenient on-street parking nearby. Rooms are comfortable and all are en suite. A warm welcome is assured with every effort made to ensure...
AA rated
PENZANCE
Inn
The Dolphin Tavern is a traditional inn just a few yards away from Penzance harbour, usefully located for the Scillonian ferry. Rooms are comfortable and well presented, and the staff are friendly and...
AA rated
This hotel enjoys spectacular views across the sea towards St Michaels Mount. All rooms have spacious balconies from where the views can be enjoyed - sunrises and sunsets can be spectacular. Bedrooms ... |
It doesn't take much to make this better
It doesn't take much to make this better
The most recent report along these lines was a May Central Florida Commission on Homelessness study indicating that the region spends $31,000 a year per homeless person on "the salaries of law-enforcement officers to arrest and transport homeless individuals — largely for nonviolent offenses such as trespassing, public intoxication or sleeping in parks — as well as the cost of jail stays, emergency-room visits and hospitalization for medical and psychiatric issues." By contrast, getting each homeless person a house and a caseworker to supervise their needs would cost about $10,000 per person.
This isn't a revelation. Many proponents of truly trying to handle the homeless problems in our country have been pointing to studies and generating numbers to prove that helping the homeless, just a tiny bit, would save tons of money. [Bold my emphasis]
In Colorado:
The Colorado Coalition for the Homeless estimates that taxpayers spend $43,240 per homeless individual in Colorado each year on everything from emergency health care to legal issues. A 2012 estimate found there are nearly 17,000 homeless persons in the Centennial State. As Hickenlooper notes, though, this money doesn’t even include “any effort to recover them” and help them transition off the streets. Housing 200 people at Fort Lyon, by contrast, will cost just $16,813 per person, less than half the cost of leaving them on the streets.
The study, conducted by the university’s Department of Social Work, found Moore Place saved $1.8 million in its first year by drastically reducing the amount of time its tenants spent in emergency rooms (447 fewer visits) and admitted to hospitals (372 fewer days). Statistics show tenants also stayed out of trouble more, with a 78 percent drop in arrests and 84 percent fewer days spent in jail.
There are real-life examples of cities testing out "housing policies" when it comes to the homeless. Moore Place , in east Charlotte, was built a couple of years ago to house homeless men and women. In its first year of operation: This is money we are already spending. People talk about "bootstraps" and "welfare" and they pretend to mean we all need to be self-reliant and not spend money "we don't have." But the numbers never match up. When you choose to ignore the homeless you are ignoring your community. It's strictly a humanity issue because it's sure as hell not a smart financial one. |
Peptidoglycan recognition proteins: pleiotropic sensors and effectors of antimicrobial defences.
Peptidoglycan recognition proteins (PGRPs) are innate immunity molecules that are present in most invertebrate and vertebrate animals. All PGRPs function in antimicrobial defence and are homologous to the prokaryotic peptidoglycan-lytic type 2 amidases. However, only some PGRPs have the catalytic activity that protects the host from excessive inflammation, and most PGRPs have diversified to carry out other host-defence functions. Insect and mammalian PGRPs defend host cells against infection through very different mechanisms. Insect PGRPs activate signal transduction pathways in host cells or trigger proteolytic cascades in the haemolymph, both of which generate antimicrobial effectors. By contrast, mammalian PGRPs are directly bactericidal. Here, we review these contrasting modes of action. |
Background {#Sec1}
==========
The use of health information technology (IT) can be an important strategy for improving patient safety \[[@CR1]\]. Health IT applications are increasingly used within Labor and Delivery (L&D) units to promote safety including clinical decision support systems, computerized medication order entry, and medication safety devices \[[@CR2]\]. These health IT applications aid providers in treatment decisions, support more complete and timely documentation, promote medication safety, and enable standardized data collection for quality improvement \[[@CR2]--[@CR6]\].
Health IT applications can be used as a means for applying safety science principles to quality and safety initiatives as in the Agency for Healthcare Research and Quality's (AHRQ) Comprehensive Unit-based Safety Program (CUSP), which we recently adapted for use in L&D Units as the AHRQ Safety Program for Perinatal Care (SPPC) \[[@CR7]\]. CUSP aims to improve the unit culture of safety by combining teamwork and communication, leadership, and safety science principles \[[@CR8]\]. These principles include standardizing processes, creating independent checks, and learning from defects. Health IT applications such as computerized provider order entry (CPOE), clinical decision support systems, and "smart" infusion pumps can aid in standardizing processes on L&D units. Standardizing nomenclature and data elements to be incorporated into electronic health records (EHR) for documenting procedures and patient status not only helps to improve real-time communication but allows for EHR documentation to be collected, reported, and compared across different units and organizations \[[@CR9], [@CR10]\]. Electronic checklists and other cognitive aid tools can be integrated and used in EHRs to create independent checks for both common L&D procedures (e.g., cesarean section) and obstetric emergencies such as shoulder dystocia and hemorrhage among others. Incorporating checklists and tools into EHR systems can guide providers through clinical processes; this can reduce cognitive burden and help to ensure no important steps are forgotten. \[[@CR4], [@CR10]\]. The safety science principle of learning from defects requires data about what happened surrounding an untoward event which can be captured and retrieved from checklists and other standardized documentation tools for evaluation of defects and quality improvement activities \[[@CR4], [@CR5]\].
Several studies have shown improvements in L&D unit safety through the use of health IT applications that enable the safety science principles. Provost & Gray found improved physician compliance with documentation of indication for elective labor induction after implementing a decision support system when compared to before implementation \[[@CR6]\]. Deering et al. found that documentation of several critical elements associated with shoulder dystocia care was significantly improved following the implementation of an electronic standard checklist. Important care components (e.g., gentle traction, McRoberts maneuver) and documentation elements (e.g., head-to-body delivery interval and presence/absence of clavicular fracture) were all found to be documented more frequently with use of the checklist \[[@CR5]\]. Eden et al. found that implementation of an obstetric-specific EHR resulted in more complete documentation in records when compared with paper-based records \[[@CR11]\].
Although several examples of successful health IT applications for improving patient safety have been published, information on how to leverage health IT to enable the safety science principles is often lacking in perinatal safety initiatives. As the role of health IT applications in perinatal settings is continually expanding, their use as a strategy for operationalizing safety science principles needs further evaluation. This paper describes how L&D units that implemented the AHRQ Safety Program for Perinatal Care (SPPC), a comprehensive perinatal safety program based on CUSP, incorporated the use of health IT to enable safety science principles for improving the culture of patient safety, teamwork and communication, and the quality of care processes \[[@CR7]\].
Methods {#Sec2}
=======
Design of the Safety Program for Perinatal Care {#Sec3}
-----------------------------------------------
The AHRQ SPPC was designed to facilitate coordination and teamwork in the L&D unit to improve patient safety and quality of care and decrease maternal and neonatal adverse events. The program consists of three program pillars: (1) fostering a culture of teamwork and communication, (2) implementing perinatal safety strategies, and (3) establishing a program of in situ simulations. Perinatal safety strategies were designed to apply the safety science principles from CUSP (i.e., standardizing, creating independent checks, learning from defects) to common obstetric processes (e.g., EFM, medication administration, cesarean section) and obstetric emergencies (e.g., obstetric hemorrhage, shoulder dystocia, and rapid response systems) \[[@CR8]\]. Participating L&D units received a series of web-based trainings, technical assistance, and data feedback reports to aid in the implementation of the program. Units were allowed to select and customize the perinatal safety strategies that best met their local culture and needs. Table [1](#Tab1){ref-type="table"} lists the number of units that implemented each of these strategies during the implementation phase.Table 1Perinatal safety strategies selected by L&D units in the SPPC, 2015--2016StrategyNumber of L&D units^a^Safe electronic fetal monitoring21Rapid response systems25Safe medication administration: oxytocin22Safe medication administration: magnesium sulfate9Safe practices related to cord prolapse7Safe practices related to shoulder dystocia18Safe practices related to obstetric hemorrhage32Safe cesarean section13^a^The number of units reporting the selection of this strategy at final data collection
SPPC participants {#Sec4}
-----------------
Forty-six L&D units completed participation in SPPC implementation between December 2014 and January 2016. Hospital and unit characteristics are summarized in Table [2](#Tab2){ref-type="table"}.Table 2Characteristics of the 46 L&D units that completed participation in the AHRQ SPPC, 2015--2016Hospital or L&D unit characteristicFrequency (%) or median (IQR)Publicly owned9 (20%)Rural referral center5 (11%)Median number of hospital beds9 9(IQR 6 to 14)Level 1 Basic neonatal care14 (30%)Level 2 Specialty neonatal care12 (26%)Level 3 Subspecialty neonatal care^a^20 (44%)Graduate medical program in obstetrics and gynecology12 (26%)Median annual number of births1430 (IQR 513 to 2692)L&D patient age^b^27 (IQR 26 to 29)Proportion of L&D patients that are white^c^68 (IQR 48% to 85%)^a^Includes Level 3A, 3B, 3C, and 3D^b^Each unit reported the mean age of L&D patients treated on their unit. The value reported here represents the median of the ages reported by units^c^Each unit reported the racial and ethnic composition of L&D patients treated on their unit. The value reported here represents the median of the proportion of white patients reported by units
Evaluation methods {#Sec5}
------------------
Participating sites submitted hospital and unit characteristics at baseline and following program implementation, semi-structured interviews were conducted with representatives of 46 of the participating L&D units. Table [3](#Tab3){ref-type="table"} summarizes the different types of organizational roles that participated in the interviews. Interviews were conducted by phone and in-person and lasted 1 h. Most interviews were conducted individually, in dyads, or in triads; a few were conducted in a focus group format.Table 3Number of interviewees by organizational rolesOrganizational roleNumber interviewed Nursing Directors18 Nursing (e.g., Nurse Mangers, Perinatal Clinical Nursing Specialists, Staff Nurses, Educators)61 Physician (e.g., OB/GYN, Anesthesiologist)10 Senior Leadership (Hospital President, VP of Nursing, Chief Clinical Officer)7 Administrator (e.g., Patient Care Administrator for OB, Perinatal Administrator)5 Quality (e.g., Quality Director, Quality Coordinator)12 Data Specialist (Data Coordinator, Data Manager)9 Other (e.g., Project Manager, Patient Safety Officer, Informatics Coordinator)9Total Interviewed131
The interviews focused on unit staff experiences with program implementation and were based on domains from the Consolidated Framework for Implementation Research (CFIR) \[[@CR12]\]. Interview protocols were customized and focused on perinatal safety strategies implemented by the unit. Interviews focused on implementation team structure and roles, experience with implementation and use of TeamSTEPPS® teamwork and communication techniques, the unit's selected perinatal safety strategies, and use of in situ simulations \[[@CR13]\]. Additional questions explored the use of the EHR in program implementation, experiences with collecting and reporting perinatal safety data, observed impacts of the program, and plans for sustainability.
Interviews were audio-recorded with permission of the interviewees and transcribed verbatim. NVivo version 10 (QSR International) was used to import and analyze all qualitative data. To capture emerging themes within and across the L&D units, we used deductive and inductive analysis techniques. A codebook based on select CFIR constructs was used for deductive analysis. To achieve consistency in data coding and interpretation, two analysts coded the first three interviews independently and assessed inter-rater reliability (percent agreement 95.5%, K = 0.58) to identify and resolve inconsistencies in application of the codebook. The remaining interviews were coded by individual coders. Coded data were further analyzed using inductive analysis techniques to identify emerging themes in the data. The evaluation was not considered to be human subjects research by the RTI International Institutional Review Board.
Results {#Sec6}
=======
Thirty-two L&D units (70%) incorporated EHR or other health IT applications during implementation of the SPPC. Two additional units developed plans for modifying their EHRs but did not receive approval from their organizational leadership to implement the modifications. When comparing L&D units that incorporated health IT with the units that did not, few differences were found related to hospital and unit characteristics between the two groups; total births (use of health IT vs. non-use of health IT, 2371 vs. 1353), number of labor and delivery beds of the hospital (11.1 vs. 7.8), age of mother (27.8 vs 27.4), percent of L&D patients that are white (62.9% vs 71.9%), percent of hospitals that were rural referral center (9.7% vs. 15.4%), percent of hospitals that were publicly owned (22.6% vs. 15.4%), percent of hospitals with a residency program (68.8% vs. 84.6%), percent of hospitals who reported a level 1 NICU basic neonatal care (22.6% vs. 53.9%), level 2 NICU specialty neonatal care (29.0% vs. 23.1%), and level 3 NICU sub-specialty neonatal care (48.4% vs. 26.0%). None of these differences were found to be statistically significant. Participating SPPC hospitals mentioned use of several different EHR systems and products on the unit including EPIC (EHR) and EPIC Stork, Meditech (EHR), GE Centricity™ (EHR) and Centricity Perinatal, Allscripts Sunrise™ (EHR), Clinical Computer Systems OBIX®, and Midas + ™ among others. Units that did incorporate health IT utilized and made modifications to their EHR systems to align with safety science principles for improving the culture of patient safety and quality of care processes on their unit.
Use of health IT for standardization {#Sec7}
------------------------------------
Through the use of safety science principles, program participants were encouraged to standardize procedures and processes on their units and a number of them used or modified their EHR systems to apply this principle. Unit staff made changes to standardized care processes through use of their health IT applications by developing new or revising standard EHR-based order sets, developing or standardizing electronic documentation templates, standardizing EFM documentation processes within the EHR, and installing smart pumps and other technology to standardize medication administration. The rest of this section details these findings.
Unit staff planned and executed efforts to develop new or modify existing order sets in their EHRs related to EFM, administration of oxytocin and magnesium sulfate, and obstetric hemorrhage. Nine units developed new or modified order sets to align with other changes made through SPPC to standardize protocols or policies on the unit. Units also reviewed existing order sets and made changes based on provider consensus to ensure standardized orders were being used across the unit. Units involved multidisciplinary teams to plan and develop new order sets including physicians, nurses, pharmacists, IT staff, and leadership committees to ensure that the order sets were based on up-to-date, evidence-based information.
Seven participating units used or modified their EHRs to add improved and standardized methods for documenting procedures and interventions. Units incorporated new data fields, drop-down menus, templates, and pop-up alerts to their EHR systems for documenting certain care processes, such as the management of shoulder dystocia. These modifications helped to ensure that the correct data elements were included by making the documentation more structured, standardized, and easier to record and prevented important data from being left out of the record.
Six units worked to standardize processes and EHR documentation of EFM. Units configured National Institute of Child Health and Human Development (NICHD) nomenclature for EFM interpretation using discrete data fields for classifying fetal status (normal, indeterminate, abnormal) in their EHRs. These improvements made it easier for nurses and providers to document and communicate findings in a standardized way across all clinicians with simple clicks in the EHR. These units developed templates in the EHR that prompted clinicians to provide documentation including further descriptions of the elements for the category of fetal status selected. Use of the newly configured discrete data fields allowed for easily retrievable data to create reports of all abnormal strips documented every month. These reports allowed teams to review the strips, assess the completeness and accuracy of documentation, and appropriateness of the clinical intervention. Regular peer review facilitated continuous feedback in care improvements on the unit. These reports also improved efficiency, as they replaced time consuming manual data retrieval of this data often through reviewing free text note sections in the records.
Other standardization changes related to installation of new smart pumps, which allowed administration of medication using drug dosing libraries programmed on the pump to help prevent dosing errors. A few units changed to single standardized concentrations of oxytocin infusion bags in combination with smart pumps, to further eliminate the need for dosing calculations or reprogramming of the pumps. Four L&D units also standardized medication dispensing through use of hemorrhage medication kits for quicker medication acquisition. Unit staff worked with their pharmacy and IT departments to program these hemorrhage medication kits into their automated medication dispensing stations so that during a hemorrhage emergency unit staff could select the hemorrhage kit, which activates all the necessary medication drawers to open at once so they can quickly obtain all the proper medications. Creating a hemorrhage kit sped up the process and resulted in quicker retrieval of needed medications during an emergency situation and no longer required staff to type in each medication and obtain them individually.
Use of health IT to support independent checks {#Sec8}
----------------------------------------------
L&D units were encouraged to apply the safety science principle of creating independent checks into their care processes and procedures to establish checks and reminders that reinforce perinatal safety. Some SPPC units modified their EHRs to establish these independent checks through use of electronic checklists, electronic hemorrhage risk assessments during admission to L&D, electronic communication and handoff tools, and transitioning to use and documentation of quantifiable blood loss during deliveries and hemorrhage episodes.
Three units configured their EHRs to build in checklists for oxytocin administration and shoulder dystocia management. Checklists, which were promoted as cognitive aids within the SPPC, were helpful in preparing for medication administration or a procedure to ensure that everything was in place and that the safety of the patient was continually monitored throughout the process. To promote regular use of the checklists once implemented, one unit educated staff to use the checklist as a tool to help guide procedures for taking care of their patients in an effort to encourage staff to shift from treating the patient first and charting later.
Eight units created independent checks within their EHRs by adding an electronic hemorrhage risk assessment to be completed upon a patient's admission to the hospital, to raise awareness about an individuals' increased risk for hemorrhage in order to be prepared and have resources and equipment available at the time of delivery. When this information is included in the EHR, it is available for all unit staff and ensures that it is not lost during shift changes. Units also made efforts to build risk assessment reports to replace time-consuming manual chart reviews for checking compliance with hemorrhage risk assessments done on the unit.
Unit staff also described creating independent checks on their units through the use of electronic communication tools. Four units used EHR-embedded handoff tools during transitions on the unit, which included required signoffs from both nurses to improve and document communication during shift changes. Two units built tools for SBAR (a communication technique from TeamSTEPPS that refers to summarizing information using four components---Situation, Background, Assessment, Recommendation) into their EHRs to conduct bedside reports during handoffs \[[@CR13]\]. These tools ensure patient information is disseminated during shift changes and allows for open discussion between staff. Units also made efforts to document information from debriefings held after significant events occurred on the unit. One unit had a debriefing tool built into its EHR specifically for shoulder dystocia occurrences to document what went well and what changes could be made for future occurrences. These debriefs are designed for open communication among all care team members to create checks and question potential deviations in standardized practices or protocols or other perinatal safety concerns. Using these electronic embedded communication tools helped to ensure that nurses and providers on the unit are documenting events and procedures similarly in their records while also having patient information readily available whenever needed.
Creating independent checks in the EHR regarding the quantification of blood loss (QBL) during deliveries and obstetric hemorrhage events was common among participating L&D units. Quantification of blood loss refers to a formal, accurate, and cumulative assessment of ongoing blood loss using as quantitative methods as possible, such as calibrated drapes and containers, and weighing of blood soaked items. This approach identifies excessive blood loss earlier than approaches that rely on non-quantitative methods as clinicians have been shown to underestimate blood loss \[[@CR14]\]. As part of participation in the SPPC, many L&D units decided to transition from estimating blood loss to using QBL and worked with their IT departments to refine QBL care processes and documentation in their EHRs. One unit had its IT staff put all QBL fields on one screen for easier documentation and aid in programming to ensure that all documentation was correlating correctly and totals were calculated accurately. Another unit that transitioned to QBL measurement realized that documenting QBL in its EHR was not being done consistently. To remedy this, the team made changes in its EHR to create hard stops, which prevented staff from being able to close out of a chart until the blood loss was documented in the record. This change has helped to ensure that all pieces of the documentation are accurately entered and correct blood loss totals are measured throughout different phases of labor and delivery. Unit staff noted the importance of buy-in from providers and staff when making these types of changes and used multiple methods for educating providers and staff on these changes including discussing in meetings, sending educational materials to staff to review, and promotion through organization leadership.
Use of health IT for learning from defects and monitoring processes of care {#Sec9}
---------------------------------------------------------------------------
L&D units participating in SPPC were encouraged to track and report process and clinical outcome measures related to perinatal safety throughout the implementation period to use in discussions to learn from defects and to monitor each unit's implementation progress. Discussions to learn from defects aids units to analyze near misses and adverse events that occurred on the unit and in developing strategies for ensuring safety improvements are implemented to prevent future occurrences. Units can use data generated from their EHRs to review and analyze these events and share outcomes with unit staff. Units used retrieved data to conduct chart audits to ensure compliance with documentation standards and to more closely examine abnormal EFM strips and subsequent interventions.
Seven units made changes in their EHRs to replace free text data fields with discrete fields that allowed for easier and less time-consuming retrieval of data when creating reports or performing records reviews. Transitioning to a more electronic process for reviews and audits made it also possible for checks to be done more often and by different levels of staff including unit staff, managers, and directors. Many unit staff noted that monitoring processes of care was an important area that was not currently being addressed at their organization and needed improvement. In words of one participant,""I think that we've been focused on safety, ... and \[on\] being able to measure things that we have in place to ensure that we are actually practicing safety. I think that's the portion that we've been missing, just being able to really examine the data. I think ... we just didn't know it. So now that we've been following these projects and going through the process, we really know what we need ... and are able to work with our IT department so that our system better fits our needs. It protects our patients and makes sure that they're safe.""
Unit staff reported several ways in which they were planning or using their EHRs to improve their data tracking and reporting methods. Three units were planning upgrades to their EHR systems to add perinatal-specific add-ons with prebuilt reports and ability to link data in the system for easier collection and reporting. A few units used data reporting systems that work in conjunction with their EHRs and have patient safety measures reports built in and updated frequently to meet government and other reporting standards. Two units began discussions with their IT departments to build or modify perinatal-focused dashboards in their EHRs to include safety data for monitoring and to be put on display for all staff to view regularly.
Challenges of incorporating health IT {#Sec10}
-------------------------------------
Unit staff faced multiple challenges in configuring their IT systems to aid in meeting the goals of SPPC. Unit requests for modifications to EHRs often take a significant amount of time to execute, requiring months of planning and input that extended beyond the SPPC short timeline of program implementation. Many unit staff reported challenges of overburdened IT staff and long queues for getting requested modifications made by their organization's IT departments; some units overcame this by having dedicated IT staff available to work closely with the unit staff to make these modifications in a timely manner. Others reported challenges in tracking and reporting data including that it was a difficult process to get data out of their EHR systems because most did not have reports built to easily pull the data and instead had to rely on manual collection of the data, which was very time consuming. Other challenges reported included long review and approval processes consisting of several rounds of reviews and committees; difficulties in reaching physician consensus; working with nonclinical IT staff to understand their clinical needs when developing new order sets; difficulties obtaining the correct resources to help units' extract data to report; and time to optimize the modifications in the system and ensure that they fit into clinical workflows. Some units which were part of larger hospital systems experienced difficulties in getting orders changed or other requests approved because of policies requiring for all changes to be system wide. A number of unit staff shared having difficulties in getting providers to change workflows and to routinely use new standardized processes of care which involved health IT applications. To address this issue, some units incorporated templates within their EHRs to help guide users through the new process and documentation procedures.
Through the course of making changes to their health IT applications, unit staff reported on several plans for the future around integrating the different electronic systems on the unit to address challenges from the lack of integrated information from their EFM systems or from different records within their EHR. One unit described its plans for integration with an update to its EHR that will result in documentation from the mother's record to flow into the infant's record for populating and linking data. The upgrade will also create easier workflows and more integration of physician and nurse documentation. Unit staff planning and implementing EHR upgrades noted the importance of being able to provide input in the planning stages and once implementation occurred to provide feedback on how it is going and potential changes that need to be made once it has gone live.
Discussion {#Sec11}
==========
This study describes ways in which L&D units used their EHRs or other health IT applications to apply science safety principles for advancing perinatal patient safety. Although not a main focus or requirement of SPPC, some integration of health IT into the execution of implementing SPPC was reported by 70% of participants. These participants used and modified health IT applications as a means for customizing and implementing their selected perinatal safety strategies. Participants made efforts to use health IT when implementing the program to aid in improvements in standardization, creating independent checks in unit processes, and learning from defects and monitoring care processes for preventing errors on the unit.
Applying safety science principles through use of health IT allows for informed decision-making and more consistent care to be delivered to patients. Unit staff used order sets, checklists, and risk assessments in their EHRs to help guide procedures and processes on the unit in an effort to improve patient safety. This finding was consistent with the findings by Arora et al., Deering, Tobler, and Cypher, and Miller that these types of electronic tools can help to simply and standardize processes while supporting more complete and consistent documentation \[[@CR4], [@CR5], [@CR10]\]. Tools built into the EHRs, such as risk assessments, help unit staff be more aware of potential obstetric emergencies that could occur during deliveries such as obstetric hemorrhage and shoulder dystocia and allow care teams to be prepared in these rare occurrences. Other health IT technologies consistent with recommendations in literature were used in safe medication administration efforts including smart pumps and automatic medication dispensing units to help administer medications in an efficient, consistent, and evidenced-based manner while deterring the chance for human error \[[@CR2], [@CR3], [@CR15]\]. The frequent use of these types of integrated health IT applications and tools into L&D units' processes and procedures demonstrate the need to incorporate useful information on electronic tools such as checklists, risk assessments, order sets, and medication specific applications into perinatal safety initiatives.
Standardization of data in EHRs occurred through adoption of agreed-upon language and data definitions such as nationally recognized and recommended NICHD nomenclature and standardized categories for documenting interpretation of EFM strips \[[@CR9], [@CR10], [@CR16]\]. Improvements to standardized electronic documentation allowed for easier workflows using EHRs while ensuring that documentation was being completed consistently and accurately across all providers and staff. Using more discrete fields compared to free text data fields to structure data documentation in the EHR assures data is being captured in patient records while reducing staff cognitive burden, consistent with research showing more complete documentation in EHRs \[[@CR11]\]. Standardized data in EHRs make it possible for retrieval and reporting of data, which many units struggled with while participating in SPPC. Routinely monitoring processes of care on units helps to encourage a culture of safety through continual discussions of progress demonstrated on the unit, review of patient safety incidents and medical errors, and potential needs for further improvements to be implemented. Programs focused on promoting perinatal safety should include specific education on the standardizing of electronic documentation and tools for electronic reporting and monitoring as they become a more common practice in L&D units but still not easily performed by unit staff.
The multitude of challenges experienced by an extensive number of participating units including obtaining organization approval, working with their organization's often overloaded IT departments, and having novice users utilizing EHR systems illustrates the importance of the available resources necessary for patient safety improvement plans involving EHRs. As resources are made available to units for these improvements, unit staff will benefit from becoming active participants in the planning and execution of the changes by providing input throughout the planning, executing, and evaluating process to ensure that the changes align with units' needs and workflows. Stakeholder input from all perspectives including physicians, nurses, midwives, and other users is important to the process of selection, implementation, and evaluation of health IT applications and technology, because they are the end users of the technology, know the culture and workflows of the unit, and drive process changes \[[@CR2], [@CR10], [@CR16]\]. Encouraging L&D units who participate in perinatal safety initiatives and programs to designate or include one or more IT staff allocated to work with their team to plan and execute IT changes for achieving program goals may aid in integrating their health IT that best fits the units' workflows and reduce delays from IT departments.
Interviews also revealed a need for better integration of non-EHR systems on L&D units, an important need also recognized by organizations such as AWHONN \[[@CR16]\]. Units lacked integration of EFM and other systems with their EHRs, so data and information were not always documented in an efficient or consistent manner across clinicians and nurses. Enhancements to EHRs and addition of add-on modules may help to create better integration of systems to allow for better data and documentation flow and improved linking of records of mothers and babies for optimal care delivery. Providing L&D units with information on various health IT applications that can be used in conjunction with their EHR to promote perinatal safety allow more options for units to customize perinatal safety strategies to meet their specific goals.
Perinatal safety programs provide L&D units with useful materials, resources, and tools for aiding units to make modifications to L&D unit teams and processes for promoting improved patient safety. As health IT applications become more prevalent in hospitals and provide increased functionality for procedures and quality improvement, information and resources should be incorporated into perinatal safety toolkits to provide guidance on ways health IT can be used to operationalize safety science principles for improving perinatal safety strategies. As shown in our results, although a majority of units were able to use and modify their health IT applications while implementing SPPC, many challenges existed for units suggesting more support and guidance on how to leverage health IT in their units to promote perinatal safety is needed.
A limitation of this study was that the implementation period was only 10 months, and unit staff spent the first several months working on startup and planning activities with little change being made to processes on the unit. This relatively short SPPC time frame limited the number of improvements that could be completed on units, especially when making modifications to EHR systems, due to IT department project queues. This study relied on self-reported information regarding use of health IT from staff on participating L&D units. Results described in this paper are not based on observations of changes that were made on hospital units nor were data collected regarding health IT in any other data reporting activities as part of this program. Also, while this study examined changes made to health IT systems on L&D units with the intent to improve patient safety, no formal assessment was conducted of the potential impact that these health IT changes had on patient safety outcomes.
Conclusions {#Sec12}
===========
This study describes the use of EHRs and other health IT applications by L&D units that participated in a perinatal patient safety initiative to incorporate safety science principles to improve the quality of care and decrease maternal and neonatal adverse events. In planning and making changes to processes and policies to enhance patient safety, units incorporated health IT into their improvement strategies in a variety of ways. These strategies often included modifications to existing EHRs to enhance standardization of processes and data, development of automated checks to aid in decision-making and care delivery, and monitoring care processes for quality improvement. The modifications and refined uses of these technologies played an integral part in the implementation of SPPC and demonstrates the importance of incorporating health IT as a critical component in perinatal patient safety and quality improvement initiatives.
AHRQ
: Agency for Healthcare Research and Quality
AWHONN
: Association of Women's Health, Obstetrics and Neonatal Nurses
CFIR
: Consolidated Framework for Implementation Research
CPOE
: Computerized Provider Order Entry
CUSP
: Comprehensive Unit-based Safety Program
EFM
: Electronic Fetal Monitoring
EHR
: Electronic Health Record
IT
: Information Technology
L&D
: Labor & Delivery
NICHD
: National Institute of Child Health and Human Development
QBL
: Quantification of Blood Loss
SBAR
: Situation, Background, Assessment, Recommendation
SPPC
: Safety Program for Perinatal Care
TeamSTEPPS
: Team Strategies & Tools to Enhance Performance & Patient Safety
The authors would like to recognize the contributions of Brenda Harding at the Agency for Healthcare Research and Quality for program guidance. In addition, several RTI staff made contributions: Stephanie Teixeira-Poit, Elizabeth Pleasants, and Sara Jacobs for data and analytic support; Jill McArdle, Hannah Margaret Claire and Katrina Burson for coordination of implementation activities; and Jonathan Wald for review of an early draft of the manuscript. Lastly, the authors thank the SPPC clinical faculty for their input and review of program content and support during site training and implementation, and participating L&D units for their time and dedication to safety and quality improvements.
Funding {#FPar1}
=======
This project was funded by the Agency for Healthcare Research and Quality under a contract No. HHSA2902010000241, Task Order 3 to RTI International.
Availability of data and materials {#FPar2}
==================================
The study's data is not shared in order to protect participant anonymity.
JW drafted the manuscript, supported program implementation, and contributed to data collection and analysis. AS contributed to the design of the program implementation and evaluation, data collection and analysis, contributed ideas for the manuscript, and critically reviewed the manuscript. SS contributed technical assistance to sites during SPPC implementation and critically reviewed the manuscript. BL contributed to coordination of site activities during implementation, data collection, contributed ideas for the manuscript, and critically reviewed the manuscript. KM provided oversight to program evaluation and critically reviewed the manuscript. LK contributed to the design of the program implementation and evaluation and critically reviewed the manuscript. All authors have read and approved the final manuscript.
Ethics approval and consent to participate {#FPar3}
==========================================
This evaluation was not considered to be human subjects research by the RTI International Institutional Review Board.
Consent for publication {#FPar4}
=======================
Not applicable.
Competing interests {#FPar5}
===================
The authors declare that they have no competing interests.
Publisher's Note {#FPar6}
================
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
|
/***************************************************************
*
* Copyright (C) 1990-2007, Condor Team, Computer Sciences Department,
* University of Wisconsin-Madison, WI.
*
* Licensed under the Apache License, Version 2.0 (the "License"); you
* may not use this file except in compliance with the License. You may
* obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*
***************************************************************/
#include "condor_common.h"
#include "shadow_mgr.h"
#include "simplelist.h"
#include "string_list.h"
#include "condor_attributes.h"
#include "condor_config.h"
#include "classad_merge.h"
#include "my_popen.h"
/*
! ! ! BEWARE ! ! !
These two objects are based pretty heavily on the Starter and
StarterMgr objects in the startd. There was no easy way to share
the code via common base classes, and the Starter and Shadow objects
are very different from each other. However, most of the code in
here was lifted from condor_startd.V6/Starter.C and
condor_startd.V6/starter_mgr.C. If you change anything in here, you
should check in those two files, too, and make sure you don't need
to make the same change on that side.
! ! ! BEWARE ! ! !
*/
//--------------------------------------------------
// Shadow object
//--------------------------------------------------
Shadow::Shadow( const char* path_arg, ClassAd* ad )
{
s_path = strdup( path_arg );
s_ad = ad;
s_is_dc = false;
m_version_info = NULL;
if ( s_ad ) {
s_ad->LookupBool( ATTR_IS_DAEMON_CORE, s_is_dc );
char* version_string = NULL;
if (s_ad->LookupString(ATTR_VERSION, &version_string)) {
m_version_info = new CondorVersionInfo(version_string, "SHADOW", NULL);
free(version_string);
}
}
}
Shadow::Shadow( const Shadow& s )
{
if( s.s_path ) {
s_path = strdup( s.s_path );
} else {
s_path = NULL;
}
if( s.s_ad ) {
s_ad = new ClassAd( *(s.s_ad) );
} else {
s_ad = NULL;
}
s_is_dc = s.s_is_dc;
char* version_string = NULL;
if (s_ad && s_ad->LookupString(ATTR_VERSION, &version_string)) {
m_version_info = new CondorVersionInfo(version_string, "SHADOW", NULL);
free(version_string);
} else {
m_version_info = NULL;
}
}
Shadow::~Shadow()
{
if( s_path ) {
free(s_path);
}
if( s_ad ) {
delete( s_ad );
}
if (m_version_info) {
delete(m_version_info);
}
}
bool
Shadow::provides( const char* ability )
{
bool has_it = false;
if( ! s_ad ) {
return false;
}
if( ! s_ad->LookupBool(ability, has_it) ) {
has_it = false;
}
return has_it;
}
void
Shadow::printInfo( int debug_level )
{
dprintf( debug_level, "Info for \"%s\":\n", s_path );
dprintf( debug_level | D_NOHEADER, "IsDaemonCore: %s\n",
s_is_dc ? "True" : "False" );
if( ! s_ad ) {
dprintf( debug_level | D_NOHEADER,
"No ClassAd available!\n" );
} else {
dPrintAd( debug_level, *s_ad );
}
dprintf( debug_level | D_NOHEADER, "*** End of shadow info ***\n" );
}
bool
Shadow::builtSinceVersion(int major, int minor, int sub_minor) {
if (m_version_info) {
return m_version_info->built_since_version(major, minor, sub_minor);
}
/*
It doesn't even have a version string, we should return
false and assume it's older than whatever we care about
(e.g. this functionality was added for 6.8.5, and we *know*
the shadow is returning a version string there).
*/
dprintf(D_ALWAYS, "ERROR: shadow classad does not contain version "
"information, it must be REALLY OLD. "
"Please upgrade your shadow immediately.");
return false;
}
//--------------------------------------------------
// ShadowMgr:: object
//--------------------------------------------------
ShadowMgr::ShadowMgr()
{
}
ShadowMgr::~ShadowMgr()
{
Shadow* tmp_shadow;
shadows.Rewind();
while( shadows.Next(tmp_shadow) ) {
delete( tmp_shadow );
shadows.DeleteCurrent();
}
}
void
ShadowMgr::init( void )
{
StringList shadow_list;
StringList checked_shadow_list;
Shadow* tmp_shadow;
shadows.Rewind();
while( shadows.Next(tmp_shadow) ) {
delete( tmp_shadow );
shadows.DeleteCurrent();
}
char *tmp, *shadow_path;
tmp = param( "SHADOW_LIST" );
if( ! tmp ) {
// Not defined, give them a default
tmp = strdup( "SHADOW" );
dprintf(D_ALWAYS,
"WARNING: SHADOW_LIST not defined in config file, "
"using default: %s\n", tmp);
}
shadow_list.initializeFromString( tmp );
free( tmp );
shadow_list.rewind();
while( (tmp = shadow_list.next()) ) {
shadow_path = param( tmp );
if( ! shadow_path ) {
dprintf( D_ALWAYS, "Shadow specified in SHADOW_LIST "
"\"%s\" not found in config file, ignoring.\n",
tmp );
continue;
}
if( checked_shadow_list.contains(shadow_path) ) {
dprintf( D_ALWAYS, "Shadow pointed to by \"%s\" (%s) is "
"in SHADOW_LIST more than once, ignoring.\n",
tmp, shadow_path );
free( shadow_path );
continue;
}
// now, we've got a path to a binary we want to use as a
// shadow. try to run it with a -classad option and grab
// the output (which should be a classad), and construct
// the appropriate Shadow object for it.
tmp_shadow = makeShadow( shadow_path );
if( tmp_shadow ) {
shadows.Append( tmp_shadow );
}
// record the fact that we've already considered this
// shadow, even if it failed to give us a classad.
checked_shadow_list.append( shadow_path );
free( shadow_path );
}
}
Shadow*
ShadowMgr::findShadow( const char* ability )
{
Shadow *new_shadow, *tmp_shadow;
shadows.Rewind();
while( shadows.Next(tmp_shadow) ) {
if( tmp_shadow->provides(ability) ) {
new_shadow = new Shadow( *tmp_shadow );
return new_shadow;
}
}
return NULL;
}
void
ShadowMgr::printShadowInfo( int debug_level )
{
Shadow *tmp_shadow;
shadows.Rewind();
while( shadows.Next(tmp_shadow) ) {
tmp_shadow->printInfo( debug_level );
}
}
Shadow*
ShadowMgr::makeShadow( const char* path )
{
Shadow* new_shadow;
FILE* fp;
const char *args[] = {path, "-classad", NULL};
char buf[1024];
// first, try to execute the given path with a "-classad"
// option, and grab the output as a ClassAd
fp = my_popenv( args, "r", FALSE );
if( ! fp ) {
dprintf( D_ALWAYS, "Failed to execute %s, ignoring\n", path );
return NULL;
}
ClassAd* ad = new ClassAd;
bool read_something = false;
while( fgets(buf, 1024, fp) ) {
read_something = true;
if( ! ad->Insert(buf) ) {
dprintf( D_ALWAYS, "Failed to insert \"%s\" into ClassAd, "
"ignoring invalid shadow\n", buf );
delete( ad );
my_pclose( fp );
return NULL;
}
}
my_pclose( fp );
if( ! read_something ) {
dprintf( D_ALWAYS, "\"%s -classad\" did not produce any output, "
"ignoring\n", path );
delete( ad );
return NULL;
}
new_shadow = new Shadow( path, ad );
return new_shadow;
}
|
Q:
How to access a non-static method from a thread in C#
I'm not sure if this is good programming etiquette, anyway I have a normal method in which I update certain bits of data and UI elements such as textblocks etc.
Anyway, I want to create a thread that every X amount of Seconds it runs the Update Method but I cannot access it because from what I understand a thread can only run static methods.
What is the best way around this?
Thanks,
mg.
A:
from what I understand a thread can only run static methods.
This is simply not true. You can start a thread like this:
Thread thread = new Thread(() => { foo.bar(123, 456); });
thread.Start();
The method bar does not have to be static, but you do need to have a reference to an object to be able to call an instance method.
If you have a parameterless method you can also do this:
Thread thread = new Thread(bar);
You should note that you cannot modify the GUI from another thread than the main thread, so if all you want to do is update the GUI you shouldn't start a new thread. If you have a long running process and want to update the GUI occasionally to show progress without blocking the UI you can look at BackgroundWorker.
Alternatively you can update the GUI from a background thread using the Invoke pattern:
private void updateFoo()
{
if (InvokeRequired)
{
Invoke(new MethodInvoker(() => { updateFoo(); }));
}
else
{
// Do the update.
}
}
See this related question: C#: Automating the InvokeRequired code pattern
|
Q:
Arc length of curve of intersection between cylinder and sphere
Given the sphere $x^2+y^2+z^2 = \frac{1}{8}$ and the cylinder $8x^2+10z^2=1$, find the arc length of the curve of intersection between the two.
I tried parametrizing the cylinder (the task specifies this as a hint). My attempt:
$$x(t) = \frac{1}{\sqrt{8}} \sin(t)$$
$$z(t) = \frac{1}{\sqrt{10}} \cos(t)$$
Plugging this into $x^2+y^2+z^2 = \frac{1}{8}$, I solve for $y$ to get
$$y = \sqrt{\frac{\cos(2t)+1}{4\sqrt{5}}}$$
I then tried integrating $|x(t), y(t), z(t)|$ from $0$ to $2\pi$
with no luck. I suspect my parametrization is wrong as my expression for $y$ looks rather ugly. Any ideas?
A:
The intersection of the cylinder with the sphere produces two curves, each of which is a great circle.
Since the radius of the sphere is $\dfrac{1}{\sqrt{8}}$, the length of each great circle is $\dfrac{2 \pi}{\sqrt{8}} = \dfrac{\pi}{\sqrt{2}}$.
Using SymPy to verify:
>>> from sympy import *
>>> t = Symbol('t')
>>> x = sin(t) / sqrt(8)
>>> y = cos(t) / sqrt(40)
>>> z = cos(t) / sqrt(10)
>>> x_dot = diff(x,t)
>>> y_dot = diff(y,t)
>>> z_dot = diff(z,t)
>>> v = Matrix([x_dot, y_dot, z_dot])
>>> v.T * v
Matrix([[sin(t)**2/8 + cos(t)**2/8]])
>>> simplify(sin(t)**2/8 + cos(t)**2/8)
1/8
Note that the Euclidean norm of the velocity vector is $\dfrac{1}{\sqrt{8}}$ and, thus, independent of $t$.
|
State Line Tack Coupon & Promo Codes
We have a State Line Tack sale for you. Latest offer: 'Sign Up for State Line Tack Emails and Receive Special Offers and Latest Updates' The last time an offer was used was March 2, 2015.
How to use a State Line Tack coupon
State Line Tack is offering a coupon code for free shipping on all orders over $100 and less than 30 pounds, for a limited time. The company regularly features select product categories or brands at discounted prices and often included free products with purchases. If you join the company's email list, you will receive exclusive deals in your inbox.
Sign Up for State Line Tack Emails and Receive Special Offers and Latest Updates |
Interaction of the N-methyl-D-aspartic acid receptor NR2D subunit with the c-Abl tyrosine kinase.
The COOH-terminal domain of the NR2D subunit of the NMDA receptor contains proline-rich regions that show striking homology to sequences known to bind to Src homology 3 (SH3) domains. To determine whether the proline-rich region of the NR2D subunit interacts with specific SH3 domains, in vitro SH3 domain binding assays were performed. A proline-rich fragment of the NR2D subunit (2D(866-1064)) bound to the Abl SH3 domain but not to the SH3 domains from Src, Fyn, Grb2, GAP, or phospholipase C-gamma (PLCgamma). Co-immunoprecipitation of NR2D with Abl suggests stable association of NR2D and Abl in transfected cells. The SH3 domain plays an important role in the negative regulation of Abl kinase activity. To determine whether the interaction of NR2D with the Abl SH3 domain alters Abl kinase activity, Abl was expressed alone or with NR2D in 293T cells. Autophosphorylation of Abl was readily observed when Abl was expressed alone. However, co-expression of Abl with 2D(866-1064) or full-length NR2D inhibited autophosphorylation. 2D(866-1064) did not inhibit DeltaSH3 Abl, indicating a requirement for the Abl SH3 domain in the inhibitory effect. Similarly, 2D(866-1064) did not inhibit the catalytic activity of Abl-PP, which contains two point mutations in the SH2-kinase linker domain that release the negative kinase regulation by the SH3 domain. In contrast, the full-length NR2D subunit partially inhibited the autokinase activity of both DeltaSH3 Abl and Abl-PP, suggesting that NR2D and Abl may interact at multiple sites. Taken together, the data in this report provide the first evidence for a novel inhibitory interaction between the NR2D subunit of the NMDA receptor and the Abl tyrosine kinase. |
HOUSTON -- More than 6,300 individuals applied to become a NASAastronaut between Nov. 15, 2011 and Jan. 27, the second highestnumber of applications ever received by the agency. After a thoroughselection process, which includes interviews and medicalexaminations, nine to 15 people will be selected to become part ofthe 21st astronaut class.
"This is a great time to join the NASA family," NASA AdministratorCharles Bolden said. "Our newest astronauts could launch aboard thefirst commercial rockets to the space station the next generation ofscientists and engineers who will help us reach higher and create anAmerican economy that is built to last."
The Astronaut Selection Office staff will review the applications toidentify those meeting the minimum requirements. Next, an expandedteam, comprised mostly of active astronauts, will review thoseapplications to determine which ones are highly qualified. Thoseindividuals will be invited to Johnson Space Center for in-personinterviews and medical evaluations.
"We will be looking for people who really stand out," said PeggyWhitson, chief of the Astronaut Office at NASA's Johnson Space Centerand chair of the Astronaut Selection Board. "Our team not only willbe looking at their academic background and professionalaccomplishments but also at other elements of their personality andcharacter traits -- what types of hobbies they have or unique lifeexperiences. We want and need a mix of individuals and skills forthis next phase of human exploration."
NASA expects to announce a final selection of astronaut candidates inthe spring of 2013.
The selected astronaut candidates will have two years of initialtraining. Subjects will include space station systems, Russianlanguage and spacewalking skills training. Those who complete thetraining will be assigned technical duties within the AstronautOffice at Johnson and, ultimately, missions.
NASA Seeks Proposals For Edison Small Satellite Demonstrations
WASHINGTON -- NASA is seeking proposals for flight demonstrations ofsmall satellite technologies with the goal of increasing thetechnical capabilities and range of uses for this emerging category of spacecraft.
Small satellites typically weigh less than 400 pounds (180 kg) and aregenerally launched as secondary payloads on rockets carrying largerspacecraft. The small satellite category includes softball-sized"CubeSats," which are standardized, small, cube-shaped spacecraftthat can carry small payloads, and even smaller experimental spacecraft.
"NASA's Edison SmallSat program helps to continue America's leadershipin space through the further development of this class of satellites-- small, agile and relatively inexpensive spacecraft that couldperform many tasks in space enabling new missions and providingunique educational opportunities," said Michael Gazarik, director ofNASA's Space Technology Program at the agency's headquarters inWashington. "These spacecraft represent a new opportunity among themany ways that NASA can approach its diverse goals in science,exploration and education."
NASA's Edison Small Satellite Demonstration Program has released abroad agency announcement seeking low-cost, flight demonstrationproposals for small satellite technology. The topic areas for thissolicitation will be limited to demonstrations of communicationssystems for small satellites, proximity operations with smallsatellites and propulsion systems for Cubesat-scale satellites. Othertechnology and application demonstrations will be addressedin future solicitations.
"Encouraging the growth of small-spacecraft technology also benefitsour economy," said Andrew Petro, Edison program executive at NASAHeadquarters. "Many of the technologies that enable small spacecraftcome from the world of small business, where commercial practicesprovide innovative and cost-effective solutions. Those technologieswill continue to advance as demand and competition drive companiesto excel."
The advancement of small spacecraft technologies offers the potentialfor small satellites to expand the types of science and explorationat NASA. These spacecraft can accomplish new types of missions neverbefore possible, and they are expected to provide space access tomore technologists and scientists. Their small size means that theyare less expensive to build and launch, which allows NASA to engagethe expanding small-space community, including small businesses anduniversity researchers, in technology that helps enable larger goals.
Executive summaries of proposals must be submitted by March 4, 2012.NASA expects to invite full proposals this spring, with selectionsmade this fall. A selected project must be completed within two tothree years at a total cost of no more than $15 million. The numberof awards will depend on the quality and cost of proposals andavailability of funding.
The Edison Small Satellite Demonstration Program is managed by NASA'sAmes Research Center at Moffett Field, Calif., for the SpaceTechnology Program, which works to provide the technologies andcapabilities that will enable NASA's future missions. To view theannouncement and instructions for submissions, visit:
Colbert Advocates NASA Space Station Research
HAMPTON, Va. -- Stephen Colbert, host of the nightly 'The ColbertReport,' said in a new NASA public service announcement releasedtoday that he's always been a huge fan of space.
The talk show host tells his Colbert Nation -- and the world -- thathe now likes space even more "because NASA is doing great things onthe International Space Station (ISS)."
The completion of the ISS ushered in new era of research and discoveryin a near gravity-free environment. Research on the orbitallaboratory is focused on four areas: human health and exploration;basic life and physical sciences; earth and space science; andtechnology development to enable future exploration.
Colbert specifically mentions the agency's work aboard the spacestation to develop new vaccines to fight infectious and deadlydiseases, such as salmonella and pneumonia. As resistance towardcurrent antibiotics becomes more common, there is an increasing needfor alternative treatments.
The Comedy Central comedian has had a continuing interest in the ISS.In 2009, when NASA asked the public to help name the station's Node3, Colbert urged his followers to submit the name "Colbert." The namereceived the most entries and astronauts continue to exercise on themost famous treadmill in the world, the Combined OperationalLoad-Bearing External Resistance Treadmill or COLBERT, in thestation's Tranquility module. |
Q:
which technologies are used by Faceapp?
I am eagerly want to know how many types of technologies are used in "faceapp" application.which is working with selfies of users.it provides change gender,change age of user through its selfies and give result as per user filter..then how they do it ??
Help and give spark to my curiosity
A:
According to me
While they showing processing your image in app that image are being uploading on faceApp server.
After upload image on server. faceApp created a AI/ML. which process your image and give back image with filter selected by you
all filters are applied on server end by AI(Artificial Intelligence )/ML(Machine Learning )
|
Peri and Post-Menopausal Nutrition: What You Need to Know
Women 40 (sometimes mid-30s) and older face multiple challenges with nutrition and health. Undesirable weight gain, the loss of lean body mass, bone health concerns, and other issues that occur during the years leading to menopause and beyond can be very frustrating. While estrogen therapy has been proven to help with some of these age-related changes, it is no longer a standard of care for all women, due to other potential undesirable outcomes including increased breast cancer risk. Working with a dietitian to establish a personalized approach during this stage of life can empower women to remain healthy and strong throughout these changes.
Weight Gain
As estrogen levels begin to decline during peri-menopause (when a woman’s body makes its natural transition to menopause, usually in the mid-40s), fat is metabolized differently, which can lead to weight gain. Menopause occurs about one year after the last period, typically in the early 50s.
Research shows that hormonal changes are responsible for the increase in visceral body fat, which places women at increased risk for cardiovascular disease and Type 2 Diabetes. Additionally, overall weight gain that occurs with age (about 1 lb per year) is mostly due to the effects of aging, including decreased activity and a loss of lean body mass, which is more metabolically active than fat.
While physical activity helps maintain and build muscle, women in midlife should include protein during meals to promote muscle-protein synthesis, which is essential to the body’s continuous growth, repair, and maintenance of skeletal muscle. In addition to eating sufficient protein and balancing intake across the day, eating the right amount and type of carbohydrate can help cut calories and control blood sugar.
Bone density
The depletion of bone density often occurs after menopause, when the ovaries stop producing estrogen. Women can lose as much as 20% of their bone density five to seven years after menopause. Research suggests that it is important for women to enter menopause with sufficient bone density to minimize further losses.
A family history of osteoporosis is a risk factor for all women. Other lifestyle factors that can negatively affect bone health include a low body mass index, a suboptimal intake of Calcium and Vitamin D, smoking and excessive alcohol consumption. Certain drugs can also result in a depletion of bone density, including proton pump inhibitors used for reflux and serotonin uptake inhibitors often used to treat anxiety. Diabetes can also increase osteoporosis risk because bone turnover is slowed down in the presence of diabetes.
A dietary approach to consuming adequate Calcium and Vitamin D takes priority over supplementation, although supplementation may eventually be inevitable. Working with a dietitian will help you establish appropriate goals based on your individual circumstances.
Hot Flashes and Sleep Disturbances
Women in midlife can experience disrupted sleep patterns as they transition to menopause. According to the National Sleep Foundation, up to 61% of postmenopausal women report symptoms of insomnia, which includes trouble falling or staying asleep for three or more nights per week for one month.
The decline in estrogen and progesterone, which leads to hot flashes in about 75% to 85% of women, contributes to insomnia. Hot flashes can disrupt sleep as body temperature rises, leading to night sweats and wakefulness. Most women experience hot flashes for about one year, but some experience them for up to five years.
Sleep loss interrupts appetite regulation by increasing levels of the hunger hormone ghrelin and decreasing the satiety hormone leptin, which can raise the risk of weight gain. Working with a dietitian to address dietary factors that can interfere with sleep, such as caffeine and/or alcohol consumption too close to bedtime can be beneficial as part of a comprehensive nutrition plan to minimize the adverse effects of sleep disturbance.
If you can relate to any of the challenges described above, schedule an appointment with our dietitian, Allyson Balzuweit. A detailed analysis of your unique circumstances including health history, lab results, lifestyle, and food preferences combined with a personalized plan will ultimately yield results that will improve your health. Check out our website to learn more about the services that Allyson offers www.functionizethealth.com or email Allyson at allysonbalzuweit@aol.com. |
Case report {#sec0005}
===========
A 24-year-old immunocompetent male, with tumoral lesion in the occipital area which started at two years of age with areas of alopecia that progressively evolved to a tumor. His first consultation was at age 14, presenting at the clinical examination a hardened tumor with granular fundus ulcerations. He abandoned follow-up, returning ten years later with a considerable increase of the lesion ([Fig. 1](#fig0005){ref-type="fig"}). Material analysis of ulcer scaling identified at direct microscope examination grains composed of septate hyaline hyphae, and micologial culture isolated *Microsporum canis* ([Fig. 2](#fig0010){ref-type="fig"}). Histopathological examination revealed at the dermis and hypodermis clusters of septated hyaline hyphae of varied sizes involved by histiocytic Splendore-Hoeppli reaction with numerous multinucleated giant cells of foreign body type, besides neutrophilic exudate, edema and vascular congestion. No fistulated pathways were visualized promoting the continuity between the "grains" and the epidermal surface in the sample ([Fig. 3](#fig0015){ref-type="fig"}). He denied use of any immunosuppressive medication, presented non-reactive serology for HIV, and had no other comorbidities. Associating the clinical aspect with the complementary tests, the diagnosis of pseudomycetoma by *Microsporum canis* was confirmed. The patient was submitted to surgical excision of the tumor and associated oral griseofulvin, one gram per day for two years. In a one year follow-up after the end of griseofulvin, the patient showed no signs of relapse ([Fig. 4](#fig0020){ref-type="fig"}).Figure 1Clinical aspect of pseudomycetoma at occipital lesion. A and B, patient with 14-years-old. C, patient with 24-years-old.Figure 2A and B, Direct mycological examination clarified with 20% KOH. ×100 augmentation, showing agglomerates of septated hyphae, and ×400 augmentation, identifying the structures of hyaline septated hyphae. C and D, fungal culture, with white filamentous colony and yellow pigmented agar and microculture with hyaline septated hyphae in the background and three macroconidia in the center (Cotton blue, ×400).Figure 3Histopathological examination. A, identifying grains surrounded by inflammatory suppurative process and lymphohistiocytic reaction (Hematoxylin & Eosin, ×100). B, grain composed of septated hyaline hyphae surrounded by eosinophilic material (Splendore-Hoeppli phenomenon) (Hematoxylin & eosin, ×200). C, evidencing the morphology of hyphae (PAS, ×200).Figure 4Patient with clinical aspect after treatment.
Discussion {#sec0010}
==========
Chronic inflammatory and invasive forms of dermatophytosis are the result of an intense hypersensitivity reaction to the fungal infection, more frequent in immunocompromised individuals.[@bib0050] The clinical presentations are kerion celsi, Majocchi granuloma and pseudomycetoma.[@bib0055] Pseudomycetoma is an extremely rare mycosis, caused by the penetration of dermatophytes into the tissue from rupture of infected follicular epithelium. Ajello et al.[@bib0060] reported several species of dermatophytes producing grains in tissues, including *Microsporum canis*, *Trichophyton tonsurans* and *T. mentagrophytes*. According to these authors, mycelium aggregates formed by the dermatophytes would be pseudo-granules and the term pseudomycetoma should be applied to this deep dermatophytic infection.[@bib0065], [@bib0070] The isolated agent in this case was compatible with the most frequent tinea capitis agent in Brazil.[@bib0075], [@bib0080]
Clinical aspects of pseudomycetoma are identical to those of eumicetoma, yet in contrast to mycetomas, pseudomycetomas are more common in the scalp and do not have a history of trauma for its inoculation.[@bib0085] Although the dermatophytic hyphae usually are more delicate than the eumicetoma agents at mycological examinations, the same does not happen in the clusters visualized on the histopathological examination.[@bib0080], [@bib0085], [@bib0090] However, there is a difference between the two diseases at histopathology: mycetomas typically have sinus tracts through which fibrinopurulent exudate and grains are readily excreted; by contrast, pseudomycetomas lack sinus tracts.[@bib0085] Therefore, isolation of the agent should be obtained with fungal culture, as here presented. Although more frequent in immunosuppressed patients, there are reports of cases in immunocompetent patients, and the eosinophilic reaction of Splendore-Hoeppli around pseudogranules is present in all cases of pseudomycetoma, highlighting the intense reaction of the organism against the fungus.[@bib0065]
The treatment of pseudomycetoma by *M. canis* is surgical excision of the fungal mass, since the systemic antifungal does not reach therapeutic concentrations,[@bib0085] associated with oral griseofulvin[@bib0050], [@bib0075], [@bib0080] until clinical and mycological cure.
Financial support {#sec0020}
=================
None declared.
Authors' contributions {#sec0015}
======================
Ligia Rangel Barboza Ruiz: Approval of the final version of the manuscript; conception and planning of the study; elaboration and writing of the manuscript; obtaining, analysis, and interpretation of the data; effective participation in research orientation; intellectual participation in the propaedeutic and/or therapeutic conduct of the studied cases; critical review of the literature; critical review of the manuscript.
Clarisse Zaitz: Approval of the final version of the manuscript; conception and planning of the study; obtaining, analysis, and interpretation of the data; effective participation in research orientation; intellectual participation in the propaedeutic and/or therapeutic conduct of the studied cases.
Clarisse Zaitz: Intellectual participation in the propaedeutic and/or therapeutic conduct of the studied cases.
John Verrinder Veasey: Approval of the final version of the manuscript; elaboration and writing of the manuscript; critical review of the literature; critical review of the manuscript.
Conflicts of interest {#sec0025}
=====================
None declared.
How to cite this article: Ruiz LRB, Zaitz C, Lellis RF, Veasey JV. Pseudomycetoma of the scalp caused by *Microsporum canis*. An Bras Dermatol. 2020;95:369--72.
Study conducted at the Clínica de Dermatologia da Santa Casa de Misericórdia de São Paulo, São Paulo, SP, Brazil.
|
Why Can’t You Be A Christian Feminist?
I’ve come across a number of blog posts recently stating that you cannot be a Christian and be a Feminist. I may not be a Christian myself, but I know a number of Christian Feminists. As such, I find the argument absurd.
There are many different versions of Christianity. At it’s base, it is simply the belief in the God of the Bible, Jesus Christ, and the Bible as a holy text. That leaves a lot of room for added beliefs, which is why there are so many Christian denominations. It is also why each church is a little different. So to say you can’t be a Christian and a Feminist is ridiculous.
Dances in the Rain stated that “You cannot call yourself a Christian and a Feminist at the same time, not in today’s society. Once upon a time feminism may have been about the right for women to vote or to work but not any more.” So feminism is okay so long as you’re fighting for the vote or to work, but not if you’re fighting for anything else? Why is it Christian to fight for women’s suffrage and the right to work? Why is is not Christian to fight for the right to not be harassed while walking down the street? Or the right to be taken seriously after being raped? Is the right to medical care not Christian? What is it that makes certain right Christian but not others? And if feminism is not about women’s rights any more, what is it about?
She goes on to say “So why doesn’t feminism mesh with Christianity? Let’s see what some of the leading figures of modern feminism have to say…
‘It is important for us to encourage women to leave their husbands and not to live individually with men… All of history must be re-written in terms of oppression of women. We must go back to ancient female religions like witchcraft’ – The Declaration of Feminism, November 1971.
……. Witchcraft….. How lovely.”
Oh, is this what I’m supposed to believe now? Oops, I guess I’ve been doing feminism wrong.
The majority of feminists do not accept this. Very few feminists believe that women should up and leave their husbands. For one, that is a very heteronormative statement. It assumes that all women are straight and intend to marry, or are married to, men. This is not the case. I also don’t know any feminists who wish to re-write history. However, the idea of re-writing history comes from the fact that the subject of history has very much focused on rich white men. This is an actual problem. So much of history has been ignored because for a very long time historians were rich white men who only wrote about other rich white men. This is actually something that the Feminist movement of the 60’s and 70’s improved. You can now actually study the history of women within academia. Feminism brought that about. As for witchcraft, I know you think it’s real, ad it’s evil, but it’s not. The whole witchcraft thing was their way of saying “lets celebrate women. Let’s worship women.” They were tired of the male-only deity worship of the time.
Dances in the Rain continues “’God is going to change. We women… will change the world so much that He won’t fit any-more.’ – Naomi Goldenberg, Changing of the Gods: Fem…inism and the End of Traditional Religions (Quoted at beginning of From Father God to Mother Earth)
I didn’t realize God changed. Did you? Oh, what was that? Riiiight, it says in the Bible that God is un-changing. Awesome. God: 1 Feminists: 0”
Wait…I thought you were arguing that Christians can’t be feminists, not that feminists could be non-Christians. I thought that was obvious. What with feminists in the early suffrage movement coming out and saying things about how there is no god, and god so obviously shares the beliefs of his worshiper, etc. But the existence of non-Christians doesn’t mean there aren’t also Christians within the movement.
Dances in Rain asks “What do you think is more trustworthy? A never-changing, all-powerful God who cares about you and loves you? Or the ‘potential’ of your crazy neighbour down the street who owns five dozen cats? Or maybe you want to believe in the ‘potential’ of all those amazing politicians….”
*Who do you think is more trustworthy. People aren’t whats. But that’s beside the point. I think my neighbour is more trustworthy, because they actually exist. That means they actually have potential. But, if I were a Christian, couldn’t I just say that my neighbour has potential because of God? Couldn’t I say that God made it possible to trust them? I don’t really know why you think that this is actually an argument against feminism.
She then continues “’No women should be authorized to stay at home and raise her children. Women should not have that choice, because if there is such a choice, too many women will make that one’ (Feminist pioneer Simone de Beauvoir, Saturday Review, June 14, 1975).
Okay, this one gets me, because ten years from now I want to be at home, taking care of my first baby, not having to worry about work and who’s taking care of my little girl or boy. Do not take away my rights to take care of my future children at home.”
What does this even have to do with Christianity? There is actual contention with this issue today. Many feminists do think that women should be putting work ahead of families. But others don’t. I’m among the second group. If a woman wants to work rather than have a family, fine. If she wants to have a family and not work, fine. If she wants both, fine, but I wish we lived in a society that gave women the opportunity to do both without having to sacrifice one for the other.
Dances in the Rain then argues “’Marriage has existed for the benefit of men; and has been a legally sanctioned method of control over women… We must work to destroy it. The end of the institution of marriage is a necessary condition for the liberation of women. Therefore it is important for us to encourage women to leave their husbands and not to live individually with men.’ – The Declaration of Feminism, November 1971
Ladies, do you feel that marriage only benefits men? Because I’m not so sure. I mean, I’m not married, but I cannot wait until I get to marry the love of my life and live with him. And he’s going to take care of me in a way that I could not take care of myself. I’ll be happy and cherished and loved and I can’t think of a better life I will benefit greatly from marrying him.”
Historically speaking, yes, marriage was for the benefit of the man. The woman stated out as her fathers property and became her husbands property. It was common for the husband to either give the father of the bride a gift as payment for her, or to receive a gift from the father (this depended on the culture and time period as to which it was). Marriage was political: it was unlikely that neither partner even knew the other, let alone that they loved one another. It was meant as a way for men to gain more political power. Marriage for love is really a very modern thing. So yes, marriage was for the man for a long time. That doesn’t mean that it has to be that way now.
Why do you think a man can take care of you better than you can take care of yourself? Let’s look at this from a modern perspective: Most undergrads are women. That mean that you have a higher chance of going to university or college than your future husband. College grads on average make more that those who never went to college. That mean that you have the potential to make more than your future spouse (though it’s still unlikely). Women today do tend to work. It is easier to find a place to live if you’re single, though it’s generally cheaper to co-habitate. Though finding a roommate isn’t generally hard. Women also find it easier to find a place than men do. And, if you want to own a house and have kids (ie. The American dream), well, that’s now a pipe dream for many in our generation. Housing prices have skyrocketed, but wages have only gone up slightly. That means it’s nearly impossible to own a house on one salary. And kids are expensive. It’s unlikely you’ll even be able to afford to be a stay at home mom. Not unless you get very lucky.
She then states “I’m going to stop with the quotes there and say that no matter what, feminism is NOT the answer. God is.”
Why can their only be one answer?
“Whatever evil there is in these areas cannot be fought with feminism. When I see feminism I see the devil working against God, against women, against children, and against the sanctity of marriage. It breaks my heat to know that so many women buy into this.”
Where is this evil? What is it doing? Because I see no evil caused by feminism.http://wildaboutegypt.wordpress.com/2014/11/04/feminism-and-christianity/
Now, since you’ve had your opportunity to pick out some of the worst feminist quotes you could find, let me share some good ones:
36 responses to “Why Can’t You Be A Christian Feminist?”
In any movement there are bound to be differences of opinion, but within these opinions many will be similar or common to others, but not all. So it is a matter of choice, in that does the movement and its members have sufficient common opinions to which each individual member can relate to.
So, if they they are Femanists and can also relate to the Bible in a similar way, then they can also be Christians.
As to believing in any written text, is this purely not, in some ways also opinion, take history, which by the term must have occurred. But in all the occurrences, they are also coloured by opinion. This can be seen by how history is related in differing parts of the world as it is coloured to each individual area and by the opinions of the persons deemed to be recording it. Also history can be rewritten if an area has a change of its power structure.
Most of what is called “Christianity” in America today has very little to do with the actual teachings of Christ and much more to do with (mostly male) interpretations of ancient writings, often taking them way out of context. Visions from the likes of Dante and Bunyan also play a huge role.
But to be a Christian simply means to follow the teachings of Christ. Just like to be a Jungian means to follow the teachings of Jung. Or to be a Marxist means to follow the teachings of Marx. The actual message of Christ (if you take away everything else and read what he preached. A great way to do that is to get your hands on The Jefferson Bible) is a very consistent one: love, humility, forgiveness, and fellowship with others are the most important things. It’s basically the same message any good psychologist “preaches”, which is why I like to think of Jesus as the first great psychologist. If you live life the way he tried to teach us to live, you will find the peace and joy (heaven, if you will) that’s not possible when you go around hating, holding grudges, believing you’re better than others, isolating yourself in your superiority, etc.
If you are degrading anyone (and that means women), not treating them equally, then you are not loving them. Dances in the Rain has it backwards: you can’t call yourself a Christian and not be a feminist. I’m a Christian, and I can’t imagine I could be so without also being a feminist.
The central point here, I think, is that there is a wild diversity of understanding as to what the term “feminist” means. Perhaps one should establish a clear definition and then ask people their views regarding THAT concept of feminism.
Well the problem is as follows. Feminism like all movements of any size is not perfectly unified. Second and more importantly while feminists are clear about wanting equality of the sexes, and more recently equality of genders. There are many groups around which want to say that feminist are actually man hating female supremacists which have taken over key institutions. No any given person is probably going to find them selves in between these two positions, but the final problem is that while we pose that feminist are about equality, there always going to be a few people who come by, hardly read our post, and rant about those evil feminists. Other wise we’d be glad to have those kind of conversations if come around.
Also we have discussed what feminism is at length through our blogs short history so we have posed definitions in the past, but it’s difficult to have to retread the same ground over and over. Even then there is no guarantee that anyone will agree to a definition.
Seeing that the historical figure identified as Jesus seems to be 1st ever recorded socialist, I can’t see why cant people be both
Christian and feminist. After all feminism is just one aspect of socialism.
It’s anachronistic to call Jesus a socialist. And besides, in what records we have of him, he seems to have thought that economics and politics were less important than the Kingdom of God.
I don’t think feminism is just an aspect of socialism, either, since it isn’t interested in what type of economic system we have, just that gender not determine one’s ability to access and participate in it.
I am a Christian. I am a feminist. For me, these things integrate very well, (I could quite happily say that God is a feminist) but of course I’m aware that’s not true of everyone. I’ve been accused of everything from witchcraft to betraying the sisterhood.
I do think part of the angst is being driven by changes in the church. Just this morning my boss and I were talking about minimising potential misogynistic backlash against me now that I am a priest.
Good, solid, relatable apologetics – from within whichever strand of thought – is essential to building understanding. (So is being willing to listen to others!)
I believe it’s a matter of how flexible you are willing to be with Christianity- or any other religion. And folks- don’t get your definition of feminism from Rush Limbaugh, and I won’t get my definition of “Christian” from the Westboro Baptist Church. Thanks. One assumption I see both atheists & Christians make is that of a “flat” interpretation of the Bible- that every part of it, every verse is equally important. Even fundamentalists generally do not see it that way. There are certain parts they regard as more important, and use them to interpret other parts- it’s called a hermeneutic, to get fancy.
I am a Christian Feminist. Do I agree with everything under the umbrella “christian”? No. Do I agree with everything under the umbrella “feminist”? No. But I understand where people think they are a contradiction in terms. Many Christians value all life – especially for the unborn. The last few decades many feminists have been fighting for the right to choose whether or not to bear life. Because these two stances are polar opposites – many people can’t imagine one could be both and on both sides. For me – I don’t know what I believe. I know the world’s youngest mother was five years of age when she gave birth to her child. It’s not uncommon today for 11, 12, and 13 year old girls to find themselves pregnant, not because they’re sinning sinners, but because their cousins, their uncles, or other relatives were really naughty. As much as I am for the lives of the unborn, I’m also for the lives of these accidental mothers who should get a chance to be a teenager.
Some might say “adoption is the solution.” But these young mothers will still have to go through a lot more trauma and confusion before that can take place. I don’t see many Christians offering legal help, holding the guilty accountable, providing financial support, counseling counseling (not Christian counseling because we all know that is flawed), etc. It is, after all, for easier to hold up signs condemning women that don’t want to be mothers for having gotten pregnant than it is to prevent the violence against women that causes many unwanted pregnancies. When pastors stand up at the pulpits condemning feminists because of abortion, then people get the impression that anything and everything related to feminism is bad because it’s contrary to the Word of God. People are also historically blind to a degree – Prohibition, for example, was a time when many women banded together to ban alcohol so that their husbands would have enough money to help feed them and their children and there would be less alcohol related domestic violence – back then if a woman’s husband would not provide, she could only turn to her family and her church. Schools don’t always teach that. History only remembers the women who were really important such as Mary and Elizabeth, Martha Washington, Betsy Ross or really infamous such as Eliabeth Bathory.
At this moment, Christianity is in the midst of a Biblical Manhood / Biblical Womanhood debate. Complementarians generally believe that because men are the leaders of the family, their wives should stay at home, raise the children, and follow their lead. Egalitarians feel that there is equality between men and women to such a degree that it doesn’t matter whether or not the man or the woman works or leads – whatever works for each family is what they should stick with. They point to the idea of mutual submission as being a necessary ingredient for successful Christian marriages. I’d agree with you that choice here is essential. God gave us the choice to be believers, therefore I believe he gives us the choice as to how we are to be Christians about our day to day life – and that might look exactly like the letter of the bible or it might look a lot like the spirit of the Bible, and it might look a little bit like both – God calls us to choose, so we should have the ability to choose.
Christianity seems to be stuck in a kind of “leave it to beaver” “father knows best” mode of thinking – those black and white 1950s sit-coms are the ideal by which they want everybody to comply because it looks like it was the golden age of modern Christianity. (If you ignore what really was going in real life.) Families went to church together, wives stayed at home, which were neat and tidy, the wives always looked like they were ready to play the part of the hostess in a moments notice and children pretty much did obey their parents. It was before the radical feminism and civil rights issues of the 1960s, and it was before the idea of biblical gender roles needed to be created as a response to feminism’s assertions about the equality of women. The world today isn’t so black and white, and has no love for tradition or stereotypes. Sorry to leave you with such a long comment, but the issues of feminism and Christianity are like ice-burgs and we can only see so much as surface issues, but there’s much more that remains hidden that needs to be brought to light to be dealt with.
Feminism is even just about women. It is a belief that ALL people should be treated equally and have equal rights regardless or gender, race, age, etc. Feminism is really “humanism” but that term is associated with a different movement already.
If you can not be a Christian and be a feminist then you basically confess that your God has biases and discriminates. Jesus was a feminist. He treated women, even ones of ill repute and of other races, with dignity and respect. In a culture where women were little more than property, where the poor and the sick where shunned, where people of other races were “unclean”, Jesus treated all of then as equal in value and rights to the rich male rulers.
Jesus did call a woman a dog in Matthew 15 (though he did relent and heal the child). The bible often doesn’t present a uniform clear message about such things as feminism, freedom, etc. A lot of things Paul says are quite opposed to women having equality with men.
I think that one can be a Christian and a feminist, just like one can be a Christian and a bigot, or a Christian and a communist, etc. It just depends on what parts you decide you like.
The Bible doesn’t preaching uniform clear message about almost anything. That is part of why it is tricky. Paul is among the most tricky to read because he seems self-contradictory all the time. And I agree that you can be a Christian and be almost anything else. Although I would be careful equating feminism as seemingly equal to bigotry or communism. Maybe some other examples of what you can be a Christian and also be would have been a better choice. 🙂
and this makes me wonder how anyone can assume a magical omni-everything entity had anything to do with reading it.
I meant to use bigot and communism because I knew someone would want me to use only nice terms about what Christians could possibly be and that would be misleading. As for communism, Jesus was a great practitioner of it. 🙂 Now, big “c” Communism is quite a bit different.
Once you’ve accepted that “Christianity” and “Feminism” are broad terms that unify a bunch of (relatively) diverse ideas rather than being just one monolithic thing, then I don’t think you can have a problem with the idea of a Christian Feminist, or a Feminist Christian.
As your argument with one of the other commenters here points out, some people seem to think it’s a battle over some arbitrary vowels and consonants, not the ideas people actually have. How can you even begin to have a constructive argument if someone’s immediate reaction to the F-word is to assume you’re a man-hating anti-equality nut based on no evidence but one single word being used as an identity?
Very interesting post. There’s a new movement within feminism called “third-wave feminism.” It came into being because some women felt like there wasn’t a spot for them within feminism. For instance, many felt like if you were a housewife or a capitalist, then you couldn’t be part of the dominant feminist movement. Third wave seeks to redefine what being a “feminist” means. It claims that, indeed, you can be a feminist and be a capitalist. You can be a man and be a feminist. You can be a Christian and be a feminist. The whole idea is about the individual and about pushing societal boundaries through everyday acts and through embracing seeming contradictions. Granted, the ideology has some issues, but I think that I like it best and that it is rather accepting and welcoming.
Third wave feminism has been around for a while. It’s over 20 years old. Some people have even posited that we are entering the 4th wave of feminism. What you’re describing seems to be Intersectional feminism.
Hmm, I would disagree. Third-wave came about during the 1990s with its pioneers being Naomi Wolf (The Beauty Myth [1991] and Fire with Fire: The New Female Power and How It Will Change the 21st Century [1993]), Rebecca Walker (particularly with her 1992 Ms. Magazine article “Becoming the 3rd Wave” and her 1995 To be Real: Telling the Truth and Changing the Face of Feminism), and Barbara Findland (Listen Up: Voices from the Next Feminist Generation [1995]). There has been talk of a fourth wave, but it has gained little steam and hasn’t truly formed due to it being so new. It doesn’t mean that it won’t form, but it’s still in its nascent stages.
I don’t see what you’re disagreeing with. I said third wave feminism has been out for 20 years, you said it began in the 1990s. 1994 was exactly 20 years ago. There’s no disagreement there. I said some people say we’ve entered a fourth wave, you said it has gained little traction. There’s no disagreement there. So what are you disagreeing with?
It think it is possible to be a Christian and a feminist. Read Proverbs 31:10-31. If anyone sounds like a feminist, the woman described in that passage does. Besides, I consider myself a Christian feminist 🙂
At some point the American public decided to label feminism as something it is not and then insist that others adhere to their new definition. Why this is the case I do not know. Perhaps myatheistlife will enlighten us.
I will be interested in seeing what it is that they bring to the table. Though I suspect I won’t be surprised. It’s rare for an anti-feminist to actually understands some of the difficulties actually faced with in the feminist movement. Strawmen are far more common.
I am a christian and I believe you can be whatever you want. Don’t get me wrong. Your views may be wrong, but a person can still be saved by the blood of Christ. If somebody says that you can’t be a christian and a (fill in the blank) then that means salvation is achieved by what we do or what we believe about secondary issues (not pertaining to Jesus’ life and death) and that is not correct. Salvation confess by grace through faith in Jesus Christ alone!
Says Christianity, many around the earth would disagree. You think it is correct, but I have to ask what kind of evidence could you possibility bring to the table to substantiate such a claim. And how could it be that salvation has nothing to do with your quality of your life, the good deeds you do. It means that any mass murdering ideological nut bag get to go into heaven so long as he believes in Jesus, but a kind soul who spend more time and effort into helping other, and living a caring life, who just never bought into the whole Christianity gets no reward. Such doctrine is the amoral, it has nothing to do with morality. It your fine with that all right, but there doesn’t seem to be anything merciful about this doctrine at all. IT does make such a god seem petty though.
John 3:16. “Whoever believes in me will not perish, but have everlasting life” it’s pretty black and white, though I do agree that a person who continues in murder is not saved because a true conversion changes the heart. He will murder no more. But that’s a pretty heavy issue. Very different from femenism.
Well the bible is rarely black and white and the gospels are full of contradictions making this rather unclear, but that doesn’t really get to the crux of the issues I was bringing up, but your are correct that it’s a bit off topic.
You, as a non-feminist, want to tell me, a feminist, what feminism is, or rather, is not. I find that much like a theist telling me, as an atheist, that atheists hate god. So yes, I do want to start this. I don’t like being told what I believe. And I don’t like it when arrogant assholes think they know more about my position than I do. So prey tell me, if feminism is not for equality of the sexes, what is it for? And where is your evidence? |
IEEE 802.6
IEEE 802.6 is a standard governed by the ANSI for Metropolitan Area Networks (MAN). It is an improvement of an older standard (also created by ANSI) which used the Fiber distributed data interface (FDDI) network structure. The FDDI-based standard failed due to its expensive implementation and lack of compatibility with current LAN standards. The IEEE 802.6 standard uses the Distributed Queue Dual Bus (DQDB) network form. This form supports 150 Mbit/s transfer rates. It consists of two unconnected unidirectional buses. DQDB is rated for a maximum of 160 km before significant signal degradation over fiberoptic cable with an optical wavelength of 1310 nm.
This standard has also failed, mostly for the same reasons that the FDDI standard failed. MANs are traditionally designed using Synchronous Optical Network (SONET), Synchronous Digital Hierarchy (SDH) or Asynchronous Transfer Mode (ATM). Recent designs use native Ethernet or MPLS.
IEEE 802.06
Category:Networking standards
Category:Metropolitan area networks |
Air plethysmography in chronic venous insufficiency: clinical diagnosis and quantitative assessment.
To define the role of air plethysmography (APG) in the clinical diagnosis and quantitative assessment of chronic venous insufficiency (CVI), APG studies were performed on 582 limbs in 291 patients with signs and symptoms of CVI. One hundred and thirty-one limbs were classified into group I (no evidence of CVI), 291 into group II (mild CVI), and 160 into group III (advanced CVI). On APG, the mean venous filling index (VFI) was 1.45 mL/s, 3.90 mL/s, and 5.25 mL/s in groups I, II, and III respectively (p<0.05). The mean ejection fraction (EF) and mean residual volume fraction (RVF) also showed significant differences between the limbs with CVI and the contralateral normal limbs, but the values were similar for the different severities of CVI limbs. The amount of overlap in VFI, EF, and RVF values among the clinical groups was considerable. Discrimination analysis derived a VFI value of 2.67 mL/s as a cutoff point between normal limbs and limbs with CVI, with a positive predictive value of 96%. In conclusion, APG is a simple and noninvasive test for quantitative assessment of the different components of CVI, valvular reflux, and calf muscle pump function. However, only VFI correlated significantly with the severity of CVI. VFI, with its high positive predictive value, may be useful in diagnosis of CVI, and it may serve as an objective quantitative measurement for monitoring the effect of treatment. |
/*
Copyright (c) 2014, Kevin Pope
All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions are met:
1. Redistributions of source code must retain the above copyright notice, this
list of conditions and the following disclaimer.
2. Redistributions in binary form must reproduce the above copyright notice,
this list of conditions and the following disclaimer in the documentation
and/or other materials provided with the distribution.
THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND
ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED
WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE
DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR
ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES
(INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES;
LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND
ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
(INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS
SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
The views and conclusions contained in the software and documentation are those
of the authors and should not be interpreted as representing official policies,
either expressed or implied, of the FreeBSD Project.
*/
namespace MatterHackers.Agg.UI
{
public class HorizontalSpacer : GuiWidget
{
public HorizontalSpacer()
{
HAnchor = HAnchor.Stretch;
}
}
public class VerticalSpacer : GuiWidget
{
public VerticalSpacer()
{
VAnchor = VAnchor.Stretch;
}
}
public class HorizontalLine : GuiWidget
{
public HorizontalLine()
: base(1, 1 * DeviceScale)
{
HAnchor = HAnchor.Stretch;
}
public HorizontalLine(Color color)
: this()
{
BackgroundColor = color;
}
}
public class VerticalLine : GuiWidget
{
public VerticalLine()
: base(1 * DeviceScale, 1)
{
VAnchor = VAnchor.Stretch;
}
public VerticalLine(Color color)
: this()
{
BackgroundColor = color;
}
}
} |
Biomaterials: silk-like secretion from tarantula feet.
An unsuspected attachment mechanism may help these huge spiders to avoid catastrophic falls. Spiders spin silk from specialized structures known as abdominal spinnerets--a defining feature of the creatures--and this is deployed to capture prey, protect themselves, reproduce and disperse. Here we show that zebra tarantulas (Aphonopelma seemanni) from Costa Rica also secrete silk from their feet to provide adhesion during locomotion, enabling these spiders to cling to smooth vertical surfaces. Our discovery that silk is produced by the feet provides a new perspective on the origin and diversification of spider silk. |
Q:
Changing spelling for multiple words at a time in R/replacing many words at once
I have a dataset (survey) and a column of birth_country, where people have written their country of birth. An example of it:
1 america
2 usa
3 american
4 us of a
5 united states
6 england
7 english
8 great britain
9 uk
10 united kingdom
how I would like it to look:
1 america
2 america
3 america
4 america
5 america
6 uk
7 uk
8 uk
9 uk
10 uk
I have tried using str_replace to manually insert the different spellings, to replace them with 'america' but when I look at my dataset, nothing has changed
e.g.
survey <- structure(list(birth_country = c("america", "usa", "american", "us of a", "united states", "england", "english", "great britain", "uk", "united kingdom")), row.names = c(NA, -10L), class = "data.frame")
survey$birth_country <- str_replace(survey$birth_country, ' "united state"|"united statea"|"united states of america"', "america")
thank you in advance
A:
Looks like the problem is in how you specified your regular expression. Try this (updated based on @Gabriella 's comment, and another tidyverse approach, similar to @MarBIo ):
library(tidyverse)
survey <- survey %>%
mutate(birth_country = if_else(
str_detect(birth_country,
"(united state)|(united statea)|(united states of america)"), #If your regular expression matches any in birth_country
"america", #Change it to "america"
birth_country #Otherwise, keep as is.
) #end of if_else
) #end of mutate
Other people are suggesting you come up with a more complex regular expression, which you can certainly do as well. Consecutive "or" (i.e. "|") statements in your regular expression works though.
|
BEIRUT (Reuters) - Syrian government troops backed by Russian air power moved to within 25 km (15 miles) of an Islamic State-held town in Raqqa province on Tuesday, the Syrian Observatory for Human Rights said, as state media reported air strikes against the jihadists in the area.
In a separate simultaneous campaign against Islamic State in Syria, U.S.-backed militias captured more territory from the group near the city of Manbij in Aleppo province, a spokesman for the forces told Reuters. The Observatory said they were now 2 km from the Islamic State-held city.
The offensives both got underway last week and are targeting Islamic State in areas of major strategic importance to its foothold in Syria, where it controls swathes of land up to the Iraqi border.
They are taking place at the same time as an assault by the Iraqi army against Falluja, an Islamic State bastion close to Baghdad. The simultaneous assaults by a myriad of enemies on farflung fronts amount to some of the greatest pressure Islamic State has faced since declaring its caliphate to rule over all Muslims from Iraq and Syria two years ago.
The Syrian army’s advance into Raqqa province, which has not been announced by the military, is initially targeting the Islamic State-held town of Tabqa, according to the Observatory and pro-Damascus media sources.
Raqqa province is a major base of operations for Islamic State and home to its de facto capital, Raqqa city.
Syrian state-run TV station Ikhbariya said on Tuesday the Syrian air force had targeted Islamic State positions south of Tabqa in the Rasafa area, destroying vehicles equipped with machine guns.
The Syrian military could not immediately be reached for comment. A military source told Reuters on Monday the army had advanced to the edge of Raqqa province, from where it could move in several directions against Islamic State.
The Observatory, citing its activists on the ground, said Islamic State had sent weapons and fighters from Raqqa city to Tabqa.
The separate U.S.-backed campaign that got underway last week aims to dislodge Islamic State from its last foothold at the Syrian-Turkish frontier and shut off its main access route to the outside world for material and manpower.
It is being fought on the ground by militias including the Kurdish YPG and allied Arab groups, which together formed an alliance last year known as the Syria Democratic Forces. It has proven to be the first effective fighting force allied to Washington during five years of multi-sided civil war in Syria.
Sharfan Darwish, spokesman for the Manbij Military Council that is part of the U.S.-backed force, said: “We are advancing on all fronts of our assault.”
The United States has consistently rejected the idea of partnering in the fight against Islamic State with President Bashar al-Assad, saying he should leave power. Some of Assad’s opponents have accused the Kurdish YPG of coordinating with his government’s forces, which the Kurds deny. |
Hostile foreign leaders express dismay at legislation that discriminates against their right to subvert and pervert.
COLUMBIA, South Carolina -- Osama bin Laden, professional terrorist saber-rattler, was today apprehended in South Carolina as he arrived to purchase his $5 Subversive Activities Permit. bin Laden's henchmen had reportedly advised him to register in Delaware, but he opted instead for South Carolina, citing the low price and the possibility of a free gift for early registration. He is currently being interrogated until he says something that could be used to justify the invasion of Iraq.
The passing of South Carolina's Subversive Activities Registration Act has led to an outcry among businesses who fear a loss in jobs if insurgents decamp to register in Delaware. Paul Johnson, CEO of a small company supplying satellite phones and Qur'ans, said he would likely have to cut his workforce by up to half. "This law targets the subversive, but comes down hard on decent hardworking people with families to feed by providing material support to those who wish to see us dead", he said.
Local militia leader Ted "Buck" Tanner, expressed concern about families and communities being divided between South Carolina and other subversive-friendly states. He commented, "This isn't right. We have three generations of insurgency here and it's being torn apart. Patriots for Freedom is large enough to support a creche and discounts with local restaurants. How can we maintain this if our members leave for Delaware?" Tanner would not disclose his plans, but returned to his compound to blog about water fluoridation and vaccination.
Bill Donohue, speaking for the Catholic League, stated that his members would not be registering. Although they consider a foreign head of state to be their highestauthority on earth, they have no plans for subversion--as long as the government stays the hell out of their business, except when the Church needs money or something hushed up, in which case there'll be no subversion as long as the government does what it's told to do. Donohue left quickly, citing the need for an urgent meeting with The Emperor.
The Saudi government has expressed concern that the registration fee will hurt their exports of jihad. It's almost certain that Islamic countries will retaliate by requiring western countries to purchase permits for invasion, liberation, and regime change.
Delaware has the most insurgent-friendly legislation in the U.S., as over 60% of U.S. insurgents register there. |
At the request of Loki, Lorelei bewitches Thor. Back on Earth Beta Ray Bill and Sif take on the Green Liberation Front, until the GLF realize that they are working for the Titanium Man, and they turn on him. Elsewhere, Megatak is killed by the Scourge. |
Wolfgang Borchert Theater
The Wolfgang Borchert Theater is a private theater in Münster. It is one of the oldest private theaters in Germany.
The theater was founded in 1958 as the Theater im kleinen Raum at the Münster Prinzipalmarkt. At the start of the sixties it moved to the Münster Hauptbahnhof and became the Zimmertheater Münster.
For the 1982/83 season it was renamed to the Wolfgang Borchert Theater. In 1999 it moved to its present location at Hafenweg.
External links
Wolfgang Borchert Theater
Category:Theatres in North Rhine-Westphalia |
NKTR
NK-tumor recognition protein is a protein that in humans is encoded by the NKTR gene.
This gene encodes a membrane-anchored protein with a hydrophobic amino terminal domain and a cyclophilin-like PPIase domain. It is present on the surface of natural killer cells and facilitates their binding to targets. Its expression is regulated by IL2 activation of the cells.
References
Further reading |
204 F.Supp.2d 967 (2002)
Curtis ROCKINGHAM Plaintiff
v.
MEN'S HEALTH CENTER, Charles David Scruggs, M.D., Pfizer Inc., Rite-Aid Corporation, and John Doe Defendants A-Z Defendant.
No. CIV.A. 3:01-CV-708BN.
United States District Court, S.D. Mississippi, Jackson Division.
May 29, 2002.
Charles Stephen Stack, Jr., Heidelberg & Woodliff, Jackson, MS, Vicki Slater, Jackson, MS, for Curtis Rockingham, plaintiff.
John Stuart Robinson, Jr., Charles Stephen Stack, Jr., Heidelberg & Woodliff, Jackson, MS, for Charles David Scruggs.
William F. Goodman, III, Mildred M. Morris, Susan Latham Steffey, Joseph Jason Stroble, Watkins & Eager, Jackson, MS, for Pfizer, Inc.
Silas W. McCharen, Daniel, Coker, Horton & Bell, Jackson, MS, for Rite-Aid Corp.
ORDER
BARBOUR, District Judge.
On May 20, 2002, the Court entered an Opinion and Order granting the Motion of Plaintiff for Remand based on its findings that (1) Defendants had not satisfied their burden of showing that Plaintiff did not have a possibility of establishing a claim for medical malpractice against Defendant Charles David Scruggs, M.D., and (2) there was at least a possibility that Plaintiff could survive the affirmative defense asserted by Defendants. The Court ordered the case remanded to the Circuit Court of the First Judicial District of Hinds County, Mississippi, in accordance with 28 U.S.C. § 1447(c) (providing in pertinent part that the case shall be remanded if "it appears that the district court lacks subject matter jurisdiction....").
On May 22, 2002, Defendants filed a "Motion for Reconsideration," which, because Defendants urge the Court to consider newly discovered evidence not previously available to them that allegedly "establishes that there is no reasonable basis to predict that Plaintiff [may] establish liability against the instate defendants," see Motion, the Court construes as a Motion for Relief for Judgment pursuant to Rule 60(b) of the Federal Rules of Civil Procedure. Pursuant to 28 U.S.C. § 1447(d), the Court may not review "[a]n order remanding a case to the *968 State court from which it was removed. ..." However, this section is not without exceptions. See Arnold v. Garlock, Inc., 278 F.3d 426, 437-38 (5th Cir. 2001). The Court may reconsider its order to remand (1) where "an exception to non-reviewability exists[, e.g.] the remand order was based on a defect in removal procedure," see In re Shell Oil Co., 932 F.2d 1523, 1528 (5th Cir.1991), or (2) prior to the actual mailing of a certified copy of the order to the clerk of the state court pursuant to 28 U.S.C. § 1447(c) when the remand order was based on finding that the court lacked a basis for asserting subject matter jurisdiction, as in the instant case. See Arnold, 278 F.3d at 437-38 (holding that, because a remand order is not self-executing, "the federal court is not divested of jurisdiction until the remand order, citing the proper basis under § 1447(c), is certified and mailed by the clerk of the district court" (citing McClelland v. Gronwaldt, 155 F.3d 507, 514 n. 15 (5th Cir.1998)). See also Browning v. Navarro, 743 F.2d 1069, 1078-79 (5th Cir.1984) (holding that, pursuant to section 1447(c), "[t]he federal court is completely divested of jurisdiction once it mails a certified copy of the order to the clerk of the state court"). Because the Clerk of Court has not yet mailed a certified copy of the Order of May 20, 2002, to the clerk of the state court, the Court finds that it retains jurisdiction to review its Order to remand.
IT IS THEREFORE ORDERED that the Clerk of Court shall not mail the certified copy of the Court's Order of May 20, 2002, to the clerk of the Circuit Court of the First Judicial District of Hinds County, Mississippi, until the Court has ruled on the Motion of Defendants for Relief from Judgment.
|
Anti-thyroid peroxidase antibodies during pregnancy and postpartum. Relation to postpartum thyroiditis.
The frequency of autoantibodies to thyroid microsomes (MAb), thyroid peroxidase (TPOAb) and thyroglobulin (TgAb) was studied in 736 women during and after pregnancy. The aim was to study the relationship between TPO Ab and post-partum thyroid disease, and to compare their behaviour with MAb. Seventy-five (10%) were either MAb or TgAB positive, of whom 36 were sampled serially at 18, 30 and 36 weeks of pregnancy and 1, 6 and 12 months post partum. Twenty of the antibody negative mothers were selected at random for controls. Twelve of the 36 antibody positive mothers developed post-partum thyroid dysfunction (group 1), 24 did not (group 2) compared with none of the 20 controls (group 3). Six months post partum, TPO Ab titres rose overall in both groups 1 and 2, but only in those with measurable TPO Ab during the first trimester. A TPO Ab was less frequently positive than MAb, but the difference was not statistically significant. TPO Ab are not superior to MAb for predicting post partum thyroid disease in pregnant women. |
The Foot That Ate Philadelphia: Joel Embiid’s Setback and What It Means for the Sixers
There was a news dump on Saturday night, and it landed right on Philadelphia. For any Sixers fan — whether they are all in on the process or have turned their Thad Young posters into a kind of shrine — Saturday night’s Woj bomb and attendant Sixers press release is pretty bad news.
https://twitter.com/JasonWolf/status/609903463888105472/photo/1
Embiid, who many thought had the highest ceiling (it was about the height of Hakeem Olajuwon) coming out of the 2014 NBA draft, was/is recovering from surgery to repair his navicular bone. We’re coming up on the one-year anniversary of the procedure, actually. Happy birthday!
Recovery from this surgery typically takes five to eight months, but the Sixers exercised caution and held Embiid out for the entire 2014-15 season. Throughout the first half of 2015, the news about Embiid was bad, including missed rehab appointments, fines accrued, and a blowup with the Sixers training staff. There was some kind of setback in March. But in the last few months — represented in some breathlessly shared Vines and videos — Embiid was looking good. The use of the word “dominant” in the Woj story is just a twist of the knife.
https://www.youtube.com/watch?v=a1iunhwzTG0
Will Embiid need surgery? A protective boot? Will he be held out of summer league? Is he late-period Andrew Bynum? Should he have been out partying this spring? Is that really any concern of ours? Is this actually a totally normal contingency when dealing with something like navicular bone surgery? Is he Greg Oden 2.0? These are all legitimate questions. I wouldn’t hold my breath waiting for answers from the usually cagey Sixers, though.
There are a few different reactions you can have to this story, and frankly, any one of them is appropriate at this point. You can fall into resignation and depression. Foot injuries like this on big men usually wind up at the top of a player’s basketball obit, not in the footnotes. “Joel Embiid came out of Kansas full of promise, drawing comparisons to some of the game’s greatest big men, but a foot injury derailed his career.” Nobody is going to be surprised if they read a story that starts that way in the next few years.
Of course, there’s always anger — the protein shake of the sports fan. You can go full Carrie Mathison, setting up a corkboard of every decision that Sixers GM Sam Hinkie has made over the last few years. In a different world, the Sixers could have Marcus Smart, Elfrid Payton, Giannis Antetokounmpo, and Nerlens Noel. That is by no means a perfect core, but it looks a lot further along than where they actually are: Noel, an injured Embiid, a departed Michael Carter-Williams, and some Vines of Dario Saric playing like Dwyane Wade. Over the last two drafts, the Sixers had four picks inside of the top 12. Noel is the only functional player they’ve got to show for it right now.
Then there’s the Zen way of looking at it. Help me out here, Axl …
The postseason is a bracing time of year for fans of rebuilding teams. You really see just how far away you are. For 82 games, you can trick yourself into believing that Robert Covington matters. Then the playoffs start and you realize how little it all means. That can be depressing, but it can also provide perspective.
So, with that in mind, the Sixers are no better or worse off than they were before this Embiid news broke. There isn’t a “there” there yet. It’s hard to imagine Embiid’s injury particularly impacting Hinkie’s draft strategy. The Sixers are still in Best-Available country. If the Lakers take D’Angelo Russell with the second pick, and Karl-Anthony Towns or Jahlil Okafor is still on the board, the Sixers will probably take one of the big men, despite the presence of Noel and Embiid. An asset is an asset. By that same token, Hinkie will not be scared off from taking projects like Emmanuel Mudiay or Kristaps Porzingis just because some want him to put a better product on the floor this October. He has not made a single decision that suggests he cares about any timeline but his own. That might actually cost him his job before he gets to see it through, or maybe the Sixers ownership group really is committed to a radically transparent rebuild, with the ultimate goal of winning an NBA title, and the owners are going to trust Hinkie through as many burned first-round picks as he needs to make to get them there.
To make myself feel better, I look at the largely homegrown roster of the Golden State Warriors. Players like Steph Curry, Klay Thompson, and Harrison Barnes: all first-round draft picks, all making up the core of a championship-caliber team. But to get to Curry, Thompson, and Barnes, they had to go through Patrick O’Bryant, Ike Diogu, Andris Biedrins, and Anthony Randolph. Will Hinkie wind up being Bob Myers or Garry St. Jean? Will the Sixers be playing for a title in four seasons, or kicking the tires on the latest Euro prospect who might need some seasoning in the Turkish Basketball League? The real question, for Sixers fans, is how long are you willing to wait? |
Q:
Bootstrap v4 buttongroup (radio button) smaller than button
I am trying to get a dropdown and a multi-toggle (radio buttons) to stay aside of each other. However, I can't get why they keep appearing of different size... I use bootstrap 4.0.
here is the html snippet of my header
<div id="header">
<p style="margin:0px;"><img src="assets/logo2.svg" width="63" height="14" style="left: 0px; top: 0px; border: 0;"></p>
<h1 id="title">Price Indicies</h1>
<div id="myDropdown" class="dropdown float-right">
<button class="btn btn-primary btn-sm dropdown-toggle" type="button" id="dropdownMenuButton" aria-haspopup="true" aria-expanded="false" data-toggle="dropdown">Boroughs
</button>
<div class="dropdown-menu">
<a class="dropdown-item" href="#">Boroughs</a>
<a class="dropdown-item" href="#">Brooklyn hoods</a>
<a class="dropdown-item" href="#">Manhattan hoods</a>
<a class="dropdown-item" href="#">Queens hoods</a>
</div>
</div>
<div class="btn-group float-right" data-toggle="buttons">
<label class="btn btn-primary active">
<input type="radio" name="options" id="sales" autocomplete="off">sales</input>
</label>
<label class="btn btn-primary">
<input type="radio" name="options" id="rentals" autocomplete="off">rentals</input>
</label>
</div>
</div>
Here is the live code:
https://run.plnkr.co/64KRhkyz35xXoeMw/
A:
I am assuming you want them to the the same heihgt as the drop down button. Your buttons are smaller because there is no text in them. If you were to add a space ( ) they would be the size of the normal bootstrap button. Then you would need to add the btn-sm class to make them the same size as the drop down button (or remove that class from the dropdown button).
|
Functional variant ANXA11 R230C: true marker of protection and candidate disease modifier in sarcoidosis.
In the recent genome-wide association study the polymorphisms of annexin A11 (ANXA11) gene were associated with susceptibility to sarcoidosis. Beside the replication of this finding and analysis of local ANXA11 expression in bronchoalveolar lavage cells, we wondered whether 'leading' ANXA11 rs1049550 (R230C) variant might also be related to the clinical manifestation of sarcoidosis. The study included 245 Czech patients with sarcoidosis and 254 healthy control subjects. The frequency of ANXA11(*)T allele was significantly lower in patients with sarcoidosis (35%) compared with controls (42%, P=0.04, odds ratio=0.77). Furthermore, ANXA11(*)T allele was less frequent in patients with the infiltration of lung parenchyma by comparison with those with isolated hilar lymphadenopathy (P=0.01). In line with the previous observation, ANXA11 mRNA expression was not deregulated in sarcoidosis and was independent from rs1049550 variant. In conclusion, ANXA11 rs1049550 single nucleotide polymorphism is the susceptibility marker in sarcoidosis, at least in Caucasians. Its role as a disease modifier should be independently replicated. |
/*
* Copyright 2017 Google Inc.
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
#ifndef QUADRIC_H
#define QUADRIC_H
#include <assert.h>
//////////////////////////////////////////////////////////////////////////////
// General vector definition for the quadric error metric processing.
// Basically this will allow us to add multiple paramters for the error
// computation.
template <class T, int N>
class etQVector {
public:
T elem[N];
etQVector() { reset(); }
etQVector(const etQVector<T, N> &v) {
int i;
for(i=0;i<N;i++) elem[i] = v.elem[i];
}
T &operator[](int index) {
assert(index < N);
return elem[index];
}
const T &operator[](int index) const {
assert(index < N);
return elem[index];
}
// Vector operators
void operator+=(const etQVector<T, N> &v) {
int i;
for(i=0;i<N;i++) elem[i] += v.elem[i];
};
void operator-=(const etQVector<T, N> &v) {
int i;
for(i=0;i<N;i++) elem[i] -= v.elem[i];
};
// Scalar operators
void operator+=(const T v) {
int i;
for(i=0;i<N;i++) elem[i] += v;
}
void operator-=(const T v) {
int i;
for(i=0;i<N;i++) elem[i] -= v;
}
void operator*=(const T v) {
int i;
for(i=0;i<N;i++) elem[i] *= v;
}
T norm2() {
T dst = 0.0;
int i;
for(i=0;i<N;i++) dst += elem[i]*elem[i];
return dst;
}
T norm() { return (T)sqrt(norm2()); }
// normalization function.
T normalize() {
T dst = norm2();
if(dst > 0) {
if(dst == 1.0) return dst;
dst = sqrt(dst);
*this *= (1.0 / dst);
return dst;
}
else reset();
return 0.0;
}
// Cross product
void cross(const etQVector<T,N> &v1, const etQVector<T,N> &v2)
{
// return vector cannot be the same.
assert(this != &v1 && this != &v2);
int i;
for(i=0;i<N;i++)
{
int idx1 = (i+1)%N, idx2 = (i+2)%N;
elem[i] = v1.elem[idx1] * v2.elem[idx2] - v1.elem[idx2] * v2.elem[idx1];
}
}
// Dot product
T dot(const etQVector<T,N> &v1, const etQVector<T,N> &v2)
{
T dst = 0.0;
int i;
for(i=0;i<N;i++) dst += v1.elem[i] * v2.elem[i];
return dst;
}
T dot(const etQVector<T,N> &v)
{
T dst = 0.0;
int i;
for(i=0;i<N;i++) dst += elem[i] * v.elem[i];
return dst;
}
int base() const { return N; }
// Distance from segment
T segmentDist(const etQVector<T,N> &p1, const etQVector<T,N> &p2)
{
etQVector<T,N> V(p2); V -= p1;
etQVector<T,N> W(*this); W -= p1;
T c1 = dot( W, V );
if( c1 <= 0 ) return dist(*this, p1);
T c2 = dot( V, V );
if ( c2 <= c1 ) return dist(*this, p2);
T b = c1 / c2;
V *= b;
V += p1;
return dist(*this, V);
}
// Distance between 2 points
T dist(const etQVector<T,N> &p1, const etQVector<T,N> &p2)
{
etQVector<T,N> p(p1); p -= p2;
return p.norm();
}
protected:
void reset()
{
int i;
for(i=0;i<N;i++) elem[i] = (T)0.0;
}
};
//////////////////////////////////////////////////////////////////////////////
// T is float or double
// N is the number of components of the quadric
//
template <class T, int N>
class etQuadric {
public:
T elem[(N*(N+1))>>1];
T area;
int base() const { return N; }
int size() const { return (N*(N+1))>>1; }
// Constructors
etQuadric()
{
reset();
}
etQuadric(const etQVector<T,N-1> &v1,const etQVector<T,N-1> &v2,const etQVector<T,N-1> &v3,
const double area = 1.0)
{
init(v1,v2,v3,area);
}
etQuadric(const etQVector<T,N> &v, const double area = 1.0)
{
init(v, area);
}
etQuadric(const etQuadric<T,N> &q)
{
assert(q.base() == base());
int i;
for(i=0;i<size();i++) elem[i] = q.elem[i];
area = q.area;
}
// Initialization with a plane
void init(const etQVector<T,N> &v, const double a)
{
int i;
for(i = 0;i<N;i++)
{
int j;
for(j = i;j<N;j++)
val(i, j) = v.elem[i] * v.elem[j];
}
area = a;
}
// Initialization with vectors.
void init(const etQVector<T,N-1> &v1,const etQVector<T,N-1> &v2,const etQVector<T,N-1> &v3)
{
etQVector<T,N-1> u(v2), v(v3), n;
u -= v1;
v -= v1;
n.cross(u, v);
double len = n.normalize();
etQVector<T,N> res;
int i;
for(i=0;i<N-1;i++) res[i] = n[i];
res[N-1] = -n.dot(v1);
init(res, 0.5 * len);
}
// Arithmetic manipulations.
void operator+=(const etQuadric<T, N> &q) {
int i;
for(i=0;i<size();i++) elem[i] += q.elem[i];
area += q.area;
}
void operator-=(const etQuadric<T, N> &q) {
int i;
for(i=0;i<size();i++) elem[i] -= q.elem[i];
area -= q.area;
}
void operator*=(const etQuadric<T, N> &q) {
int i;
for(i=0;i<size();i++) elem[i] *= q.elem[i];
}
void operator*=(const T &v) {
int i;
for(i=0;i<size();i++) elem[i] *= v;
}
// Evaluate a vector versus the quadric. The value returned
// is the quadric error metric.
double evaluate(const etQVector<T,N-1> &v) const
{
static const double factor[3][4] = {{1,2,2,2},{0,1,2,2},{0,0,1,2}};
static const double mult[4][2] = {{1,0},{1,0},{1,0},{0,1}};
double res = 0.0;
int i;
for(i = 0;i<N-1;i++)
{
int j;
for(j = i;j<N-1;j++)
res += factor[i][j] * getval(i, j) * v[i] * (mult[j][0] * v[j] + mult[j][1]);
res += factor[i][N-1] * getval(i, N-1) * v[i] * (mult[j][1]);
}
res += getval(N-1, N-1);
return res;
}
// reset everyting to 0
void reset() {
int i;
for(i=0;i<size();i++) elem[i] = (T)0.0;
area = (T)0.0;
}
protected:
inline T& val(const int x, const int y)
{
static const int idx[4][4] = {{0,1,2,3},{1,4,5,6},{2,5,7,8},{3,6,8,9}};
assert(x < N && y < N);
return elem[idx[y][x]];
}
inline T getval(const int x, const int y) const
{
static const int idx[4][4] = {{0,1,2,3},{1,4,5,6},{2,5,7,8},{3,6,8,9}};
assert(x < N && y < N);
return elem[idx[y][x]];
}
};
//////////////////////////////////////////////////////////////////////////////
//////////////////////////////////////////////////////////////////////////////
// Specific Vector & Quadric definition for geometry only Qems.
class etQVector3d {
public:
double elem[3];
etQVector3d() { reset(); }
etQVector3d(const etQVector3d &v) {
elem[0] = v.elem[0];
elem[1] = v.elem[1];
elem[2] = v.elem[2];
}
inline double &operator[](int index) {
assert(index < 3);
return elem[index];
}
inline const double &operator[](int index) const {
assert(index < 3);
return elem[index];
}
// Vector operators
void operator+=(const etQVector3d &v) {
elem[0] += v[0];
elem[1] += v[1];
elem[2] += v[2];
};
void operator-=(const etQVector3d &v) {
elem[0] -= v[0];
elem[1] -= v[1];
elem[2] -= v[2];
};
// Scalar operators
void operator+=(const double v) {
elem[0] += v;
elem[1] += v;
elem[2] += v;
}
void operator-=(const double v) {
elem[0] -= v;
elem[1] -= v;
elem[2] -= v;
}
void operator*=(const double v) {
elem[0] *= v;
elem[1] *= v;
elem[2] *= v;
}
double norm2() {
double dst = 0.0;
dst += elem[0]*elem[0];
dst += elem[1]*elem[1];
dst += elem[2]*elem[2];
return dst;
}
double norm() { return sqrt(norm2()); }
// normalization function.
double normalize() {
double dst = norm2();
if(dst > 0) {
if(dst == 1.0) return dst;
dst = sqrt(dst);
*this *= (1.0 / dst);
return dst;
}
else reset();
return 0.0;
}
// Cross product
void cross(const etQVector3d &v1, const etQVector3d &v2)
{
// return vector cannot be the same.
assert(this != &v1 && this != &v2);
elem[0] = v1[1] * v2[2] - v1[2] * v2[1];
elem[1] = v1[2] * v2[0] - v1[0] * v2[2];
elem[2] = v1[0] * v2[1] - v1[1] * v2[0];
}
// Dot product
double dot(const etQVector3d &v1, const etQVector3d &v2)
{
double dst = 0.0;
dst += v1.elem[0] * v2.elem[0];
dst += v1.elem[1] * v2.elem[1];
dst += v1.elem[2] * v2.elem[2];
return dst;
}
double dot(const etQVector3d &v)
{
double dst = 0.0;
dst += elem[0] * v.elem[0];
dst += elem[1] * v.elem[1];
dst += elem[2] * v.elem[2];
return dst;
}
int base() const { return 3; }
// Distance from segment
double segmentDist(const etQVector3d &p1, const etQVector3d &p2)
{
etQVector3d V(p2); V -= p1;
etQVector3d W(*this); W -= p1;
double c1 = dot( W, V );
if( c1 <= 0 ) return dist(*this, p1);
double c2 = dot( V, V );
if ( c2 <= c1 ) return dist(*this, p2);
double b = c1 / c2;
V *= b;
V += p1;
return dist(*this, V);
}
// Distance between 2 points
double dist(const etQVector3d &p1, const etQVector3d &p2)
{
etQVector3d p(p1); p -= p2;
return p.norm();
}
protected:
void reset()
{
elem[0] = 0.0;
elem[1] = 0.0;
elem[2] = 0.0;
}
};
#endif
|
President Donald Trump has taken quick action on immigration and other thorny issues during his brief time in office.
Congressional Republicans, on the other hand, appear to growing weak-kneed when it comes to a proposed tax cut, border wall and repealing Obamacare.
Their inaction is getting to media pioneer Matt Drudge.
“No Obamacare repeal, tax cuts!” Drudge tweeted on Wednesday. “But Republicans vote to shut Warren? Only know how to be opposition not lead! DANGER.”
No Obamacare repeal, tax cuts! But Republicans vote to shut Warren? Only know how to be opposition not lead! DANGER https://t.co/1IrwjeZsQ0 — MATT DRUDGE (@DRUDGE) February 8, 2017
That was followed by, “Republican party should be sued for fraud. NO discussion of tax cuts now. Just lots of crazy. Back to basics, guys!”
Republican party should be sued for fraud. NO discussion of tax cuts now. Just lots of crazy. Back to basics, guys! pic.twitter.com/5uHIg8klq6 — MATT DRUDGE (@DRUDGE) February 8, 2017
A short time later, he even zinged White House priorities:
White House eyeing executive order targeting 'conflict minerals' rule… Meanwhile, is Obamacare penalty tax still in place? — MATT DRUDGE (@DRUDGE) February 8, 2017
Drudge’s observations beg the question: Do Congressional Republicans actually want to lead? Or do they prefer being the opposition party and complaining on Fox News all day?
House committees, as well as the full body, passed numerous pieces of legislation ranging from an Obamacare repeal to canceling Michelle Obama’s onerous lunch rules while leaders knew they had no chance of garnering President Obama’s signature.
By 2014, the Republican-led House had already voted to repeal Obamacare SIX times, the Washington Examiner reported.
Now, with man-of-action Donald Trump in the Oval Office, Republicans could run the table — if they have the guts.
Was it all for show? |
Enforcing TLS protocol invariants by rolling versions every six weeks - fanf2
https://www.ietf.org/mail-archive/web/tls/current/msg26385.html
======
niftich
This is part of Chrome's scheme to avoid protocol ossification -- where you
realize you can't deploy any enhancements because of widespread non-standards-
compliant (but likely, for the original implementer, "good enough") behavior.
The idea is to catch them early by simulating future versions now, which in
their belief is best done by perpetuating traffic that contains bullshit
versions on the wire. It's fairly clever, in that any implementer who doesn't
want to break significant portions of web traffic now must code their
implementation in a way that anticipates Chrome's future versions, which is
most sanely done by coding their implementation in a way that happens to match
what's in the spec. Meanwhile, noncompliant implementations will likely break
for a huge amount of users, causing widespread uproar and, presumably,
pressure to fix the problem.
Google's clients (e.g. Chrome, Android) and servers originate and receive a
high enough portion of traffic that they could pull this off on their own
without anyone else's buy-in, and still achieve the intended effect, but
they're reaching out to the community to build consensus. It's a hacky idea,
but one that backs noncompliant implementations into a corner now, instead of
them sticking around forever and causing incompatible changes later down the
road.
~~~
LoSboccacc
meanwhile who designed their stack properly enjoy running their software for
decades across multiple platforms without modifications.
I guess we just have to relearn all the lesson from the 80's
~~~
jaas
So if someone deployed SSLv3 when it was the secure version and left that
running for decades, you would describe this as proper and an ideal scenario
that we should strive for?
I sure hope that's not a lesson we learn in any decade.
~~~
LoSboccacc
only because the current mess forces network encryption to be enrolled within
the application at it's layer doesn't mean that's the ideal solution.
~~~
geofft
Er, one of the lessons from the '80s was the end-to-end principle.
Applications are the right place to handle encryption, and network encryption
solutions like IPsec are full of layering violations.
~~~
simias
Don't you think it ought to be handled by the kernel though? The same way TCP
is not handled in userland nowadays. It's a shame that every app has to
reinvent the wheel when it comes to crypto (even if most of them de-facto
standardize around a few library implementations). I wish SSL/TLS was just one
setsockopt away. You'd have one central point to handle certificate
authorities, exception, debugging etc...
~~~
geofft
Absolutely not - there's a ton of complexity in parsing certificates, checking
Certificate Transparency signatures, contacting OCSP responders, chasing
Authority Information Access references to intermediate certs (the latter two
immediately require having a full HTTP client), parsing name constraints, etc.
There are already too many ASN.1 decoders in my kernel and I don't want
another one. And I can upgrade my userspace libraries much more easily than I
can upgrade my kernel.
Importantly, the big reason for TLS to be at the endpoint and not use
IPsec/tcpcrypt/etc. is because the important thing to verify in TLS is the
hostname, not the IP address, and DNS resolution is in userspace everywhere
(as far as I know). You could imagine a design which pushed both DNS
resolution and TLS verification into the kernel, but it would be too
monolithic of a kernel for even UNIX's tastes.
TCP is a relatively simple protocol (in the sense that it doesn't have too
many moving parts, not in the sense that it's uninteresting) and fits fine in
the kernel. But even for reliable transport, there are plenty of apps using
their own thing over UDP (RTP, Mosh's SSP, QUIC, etc.) that are never going to
get into a kernel. And even for TCP alone there's a bunch of potential
complexity you can put into the kernel (DCTCP, New Reno, fq_codel, etc.) that
have been hard to deploy precisely because they require a kernel patch.
~~~
LoSboccacc
what has certificate management anything to do with communication encryption?
if you keep conflating responsibilities, you'll keep ending up with the same,
flawed, "solutions".
besides, everyone and their dog now has a "certificate" from the likes of
let's encrypt, so even their role as identity trust is basically moot.
~~~
geofft
> _what has certificate management anything to do with communication
> encryption?_
What's the point of encrypting something if you don't know who you're
encrypting to?
> _besides, everyone and their dog now has a "certificate" from the likes of
> let's encrypt, so even their role as identity trust is basically moot._
Yes, everyone should have a certificate, and I'm not sure why you think this
means "identity trust" isn't working. Certificates mean that you probably are
who you say you are. They don't mean that you're a good person.
------
marshray
Never expect old code to handle new protocol elements. If it's not exercised
regularly, it's not going to work.
Very few developers (outside of Google) are going to write randomized fuzzers
to test for compatibility with theoretical future extensions. They're going to
test that it works with existing stuff and then ship it.
So, the fuzzing has got to become part of the public ecosystem.
~~~
Narkov
Why can't you code you implementation to safely ignore new protocol elements?
They aren't asking you to support the new elements, just ignore them.
~~~
namibj
You can. But who is going to make sure you don't skip this part and make more
profit than your competitor?
~~~
pdkl95
Anybody that doesn't want to introduce crashing/fatal bugs that disrupt
productivity? Skipping checks[1] and making assumptions about input[2] is an
irresponsible disregard for basic security.
This is about basic programmer competence, not time a consuming feature that
might impact your development costs relative to your competitor. You are not
going to make more profit by leaving out the "default:" case to your
switch/case statements that skips parsing for unrecognized elements.
[1]
[https://archive.org/details/The_Science_of_Insecurity_](https://archive.org/details/The_Science_of_Insecurity_)
[2] [https://media.ccc.de/v/31c3_-_5930_-_en_-
_saal_6_-_201412291...](https://media.ccc.de/v/31c3_-_5930_-_en_-
_saal_6_-_201412291400_-_funky_file_formats_-_ange_albertini)
~~~
caf
The problem isn't leaving out the 'default' case. The problem is coding it as
default:
return DROP_CONNNECTION_AND_BAIL;
~~~
pdkl95
Yes, which is why I really like the idea of proactive enforcement with random
expected-to-be-ignored tags/parameters. I'm arguing against the idea that
leaving out the last part of this
for (item = params->head; item; item = item->next) {
switch (item->type) {
case KNOWN_PARAM_TYPE_FOO:
// do normal stuff
break;
/* ... etc ... */
IGNORE_KNOWN_PARAM_TYPE_BAR:
// fallthrough - BAR explicitly uses default handling
default:
continue; // skip unknown parameters
}
}
is evidence of incompetence, not a strategy that will "make more profit than
your competitor".
Also, as the BAR constant suggests, you probably already have code that skips
unrelated fields. While the difference in programmer time is almost always
trivially small, sometimes it might be _zero_.
~~~
mathw
Unfortunately incompetence can sometimes lead to increased profits in the
short term. Why else is there so much horrendous software out there?
------
Analemma_
I think that middleware boxes will still find some way to make our lives
miserable next time we try to upgrade— this seems like another instance of
"build an idiot-proof system, and the universe will just supply a better
idiot"— but this is still a great idea. This is so good I want to start doing
it with my company's internal stuff.
~~~
tialaramex
Company internal stuff generally isn't facing as hostile an environment as
HTTPS.
The famous "Alice and Bob After Dinner Speech" mentions
"Now most people in Alice's position would give up. Not Alice. She has courage
which can only be described as awesome. Against all odds, over a noisy
telephone line, tapped by the tax authorities and the secret police, Alice
will happily attempt, with someone she doesn't trust, whom she cannot hear
clearly, and who is probably someone else, to fiddle her tax returns and to
organize a coup d'etat, while at the same time minimizing the cost of the
phone call.
A coding theorist is someone who doesn't think Alice is crazy."
HTTPS is like Alice. In cryptography a theoretical attacker is often given
seemingly outrageous abilities, like they can send you huge numbers of
arbitrary messages to see what happens, they can time everything, they can see
messages you were sending and try sending other messages that are just a tiny
bit different, they can collect your messages and re-send them later, and so
on. In many systems a real attacker would struggle to pull these things off,
but in HTTPS thanks to things like cookies and Javascript it's actually not
difficult at all.
Your internal stuff almost certainly doesn't have arbitrary clients running
code from arbitrary other participants like the Web does. It also almost
certainly doesn't have a dedicated reliability team who can go change
everything every six weeks to keep up. If you do such changes every six weeks
for a few months, then get bored and stop, the last set rust shut and you've
gained nothing. Google is essentially promising their teams would undertake to
carry on indefinitely.
Google essentially proposes an artificial Red Queen's Race, with the goal
being to tire out middlebox vendors and/or their customers and have them
choose to exit the race.
~~~
chadnickbok
I hadn't heard of Red Queen's Race before, and your use of it in a somewhat
novel way was awesome. That was 15 minutes well wasted.
------
_old_dude_
You have the same kind of idea in the JDK to be sure that a user code does not
work if it relies on the iteration order of an immutable Set, the JDK use a
SALT [1] so the iteration order of the Set is different each time you start a
new VM allowing the code of the JDK to be changed in the future.
[1]
[http://hg.openjdk.java.net/jdk/jdk/file/f36d08a3e700/src/jav...](http://hg.openjdk.java.net/jdk/jdk/file/f36d08a3e700/src/java.base/share/classes/java/util/ImmutableCollections.java#l56)
~~~
ec109685
Salt is mostly there to prevent attackers that control program input from
exploiting the hashing algorithm to construct pathological worse case datasets
(e.g. ensuring every input hashes to same bucket).
------
tialaramex
Context:
1\. So called "Security" companies (middlebox vendors) advise customers to
write what are effectively firewall rules that bake ossification into their
systems using, I kid you not, regular expressions
[https://www.fidelissecurity.com/threatgeek/2018/02/exposing-...](https://www.fidelissecurity.com/threatgeek/2018/02/exposing-x509-vulnerabilities)
This type of nonsense is why one of the optional TLS 1.3 features is
certificate compression. It seems like a no-brainer to offer this for earlier
versions, but it turns out that middleboxes snoop the certificate and make
decisions about it so compressing it causes them to freak out. Why can we
(hopefully) fix that with an optional extension in TLS 1.3? Because in TLS 1.3
now the certificate is encrypted, so the middleboxes can't see it in the first
place.
2\. In about 2016 when it originally looked like TLS 1.3 was almost finished,
the middlebox vendors finally noticed something was happening and began
yelling about how their products had "legitimate" ‡ uses that would be blocked
by these improvements and it all needed re-thinking.
Fortunately (or perhaps inevitably) the middlebox vendors have no idea how the
IETF works, so they spent a lot of effort on trying to "win votes" which
should have anybody who was somehow unaware of this drama but involved with
the IETF smiling since there are no votes and you can't win. They also, like
typical business people, figured they could fly in to meetings in say,
Singapore or London, and spin up at the meeting, but of course those meetings
are just a temporary physical incarnation of the IETF, it exists all the time
as mailing lists, so if you aren't following those lists you're basically
always a kid who wandered into a room where people are having grown-up
discussions you can't understand.
3\. After a surprisingly long time the middlebox vendors got the hint and went
to ETSI to make their own alternative. ETSI is a traditional SDO which is
perfectly happy to work on a standard without any messy ethical
considerations. It is also, like most traditional SDOs, closed door, so we
have only limited visibility of what they're up to. So far it looks like TLS
1.2 (so, bad) but with the ability for an arbitrary number of middleboxes to
interact with all the packets on path (so, worse).
It's OK though because under their ETSI proposal the user will "Consent" to
this. If you've spent the last month mindlessly clicking through GDPR-inspired
boxes on US web sites you regularly visit, or indeed if you're the new hire
who has just this moment realised why the big boss decided he needed her with
him on this trip, and is now calculating whether to say "No" and risk losing
everything or to close her eyes and pretend this is happening to somebody else
you have a very good idea what "Consent" means in this context.
‡ "Legitimate" is a word you use when it's important for people to accept that
what you're doing is OK, without them thinking about what you were actually
doing because they might throw up. "Bribe officials to ignore flagrant safety
violations" makes you angry but "Legitimate facilitation payment" sounds very
respectable.
------
yuhong
Personally, I understood when the ClientHello was changed to deal with TLS
version intolerant servers, but disliked the middlebox changes in the
ServerHello.
------
tlb
Interesting idea, but why inflict this churn on all Chrome users? Just make a
standalone client that runs through all possible variations so that server
developers can test against it.
~~~
kkirsche
Companies like Symantec implementing devices like Bluecoat proxies are
notorious for not doing their due diligence on their network stack. This
ensures that it’s actually tested against devices and has the support of users
to be fixed rather than a few developers who won’t be able to move the needle.
At least that’s how I read this
------
forapurpose
I'm surprised that nobody is concerned that Google (or whoever) is spamming
the Internet to make everyone do what Google / TLS devs want them to do.
First, it's coercive. Second, it's in principle spam, even if the cost is
affordable in this case. Third, it sets three bad precedents:
* Google can do whatever they want
* Hijacking user computers for ulterior purposes (by utilizing Chrome) is ok
* Spam and coercion are ok. And if you argue it's ok in this instance, you aren't thinking past your nose.
Imagine if Symantec or Microsoft tried it; how would people react? Well you
don't have to wonder, because they will.
~~~
tptacek
You have to really want an anti-Google story to find it in this, the bit where
Google is using its market position on the server and clientside _to help make
sure vendors don 't break the TLS standard_.
~~~
forapurpose
What about the second precedent in the GP, and what about my point, _if you
argue it 's ok in this instance ..._?
~~~
staticassertion
Would you argue against Chrome sending out random LLMNR requests at boot to
detect attackers on the network? They aren't "hijacking" computers of users
who voluntarily installed chrome - in part due to the promise of a safer
browsing experience, which this is all about.
~~~
forapurpose
> Would you argue against Chrome sending out random LLMNR requests at boot to
> detect attackers on the network?
Good question.
No, I wouldn't, because it serves that user directly. Google could argue that
the TLS 'GREASE' benefits users, but that benefit, and let's assume it exists,
is very indirect: That user won't see any benefit that day, that week, and
maybe never; Google is using their users' computers to advocate something that
Google thinks is a good idea. To demonstrate GREASE can be taken too far,
imagine the extreme case where Google has Chrome send messages to U.S.
Congresspeople advocating against some policy - Google could argue that they
believe it's in the users' interests, but that would be highly disingenuous.
Again, that's extreme and not going to happen.
More realistically, imagine Microsoft had Windows 10 insert something in
network traffic to compel compatibility with some proprietary technology of
theirs. Imagine vendors disagreed about some standard, and different products
used GREASE to compete for different outcomes.
Where do you draw the line? I think GREASE violates end-user control or
autonomy. They become pawns in a standards competition. It's very arrogant of
Google and support of it betrays an arrogance perspective here at HN: users
are pawns, and their computers are ours to use as we see fit. (It's also
intentionally bad engineering, which makes me very uncomfortable.)
~~~
staticassertion
I disagree with the idea that users won't see benefits - the benefit is that
upgrades to a critical protocol can be rolled out more smoothly in the face of
compliant middleware. This benefit will be significant for end users.
Sending messages to Congress would be very different - that's squarely outside
of the purview of a browser. TLS is not.
As for Microsoft having Windows 10 insert things to support a proprietary
technology, again, this is a flawed analogy - it's simply not what's happening
here.
Why draw the line if we know that we haven't crossed it? You have put forth
two cases that seem obviously on the other side. This case seems obviously on
the 'we good' side.
Would you say A/B testing means 'users are pawns'? I really disagree with
that. Again, this is all in the interest of end users who have voluntarily
installed this software, at least in part because of the secure reputation.
|
'Supernatural' Recap: The Road To Hell
After a touching reunion that includes a hug and Sam giving Bobby their demon-killing knife, they hightail it out of hell with demonic doppelgangers acting as mediocre obstacles.
Meanwhile, at the safe houseboat, an unstable Kevin announces that he hid the demon tablet. As soon as he disappears, ignoring Dean's half-hearted threats, Naomi pops up to plead her case. Dean's angry, of course, but Naomi is convinced that they are actually allies, even though she trained Castiel to gank him. “When I learned of the angel tablet, I did tell Castiel to get it at any cost. That’s my job, to protect Heaven. Now Castiel is in the wind with a hydrogen bomb in his pocket and I’m scared for all of us,” she confessed.
Dean admits that he doesn’t trust angels, but he has neglected to ward the houseboat against them, probably because he's hoping Castiel will return. She offers him a gift before she leaves, letting Dean know that Ajay took Sam to Hell via the Purgatory exit.
As soon as Dean finds Ajay dead—a consequence of Crowley's spies and "non-patience"—he calls his other boyfriend Benny to beg the ultimate favor. As soon as they're face-to-face in the alley, the tone veers into the bizarre and and melodramatic, especially with the maudlin piano and Benny's trembling voice and despairing expression. It felt a little like Jensen Ackles' other gig on "Days of Our Lives" until I realized exactly what Dean was asking of Benny. To get back into Purgatory and rescue his little brother, Benny has to die and Dean has to do it. Thanks to the big heart behind those fierce fangs, he knows he doesn't belong topside anymore. They end it with a little testosterone over tears, "Come on you wimp," he laughs before Dean lops off his head.
Back in the wilds of Purgatory, Sam and Bobby catch up, and it's frustrating and kind of awesome that Bobby is giving Sam grief for not trying to get Dean out of Purgatory. "I taught him that agreement. It's a non-agreement," he says when Sam mentions the deal they made not to save each other from death.
Thankfully attacking monsters interrupt all of the angsty guilt that’s being piled onto Sam’s shoulders. Just like Dean's scenes early this season, the combat is majestically filmed, including a slow-mo money shot of Sam's glorious hair whipping in the wind. Benny arrives to for a last-minute save. As he spits out blood and chunks of monster, he looks unburdened and almost happy to be unleash a year of pent-up vampy aggression. And it's abundantly clear that he never intended to go back. Bobby is gobsmacked that Dean's friend is "a friggin' vampire," and wonders just how far off the rails his boys had gone since he left.
Sam barely has time to do anything other than glare hatefully at Benny before they have to perform the ritual and haul ass back to earth. A hunter beyond the end, Bobby vows to do his part, but promises that "if they give me a rockin' chair up there, I'm raisin’ hell." We expect nothin' less. With Bobby's soul safely nestled in his arm, Benny offers himself up as bait to encircling baddies to ensure that Sam can make it to the portal.
Sam lands back in Maine’s wilderness, and barely staggers over a hill before he’s tackled by a relieved Dean. Sam regards Dean with an broken, mournful expression, and explains that Benny’s absence. They quickly set Bobby free, and his soul, a comet-like orb of blue light, ascends only to be trapped by Crowley's menacing power. Just when all looks to be doomed for Bobby's afterlife and Sam and Dean mortal ones, Naomi tags in. She sets Bobby free, offering Dean a soft smile and yet another reason to trust her.
To complete the trial, Sam has to recite the same bit of Enochian he did after the first and its effect is instantaneous and excruciating. He screams from the pain, collapsing as his right arm begins to immolate. Dean can only watch horrified. I believe that this strange force is infusing Sam with some kind of supernatural power that his body doesn't know how to tolerate. Sam bleats out that he's fine, but it doesn't look like he can take much more. It’s too bad because I’m praying that the other half of the tablet reveals that the boys have to complete 57 more trials.
Even if you're emotionally done, "Supernatural" still isn't over. Crowley, played with sinister British swagger by Mark Sheppard, is finally showing us how he earned his title as the King of Hell. After toying with Kevin for most of the episode, he arrives in a tornado of broken glass and the horrific confession that he tortured and killed Mama Tran to procure his location. "What you people never seem to understand is that you are nothing but fleeting blips of light. I am forever!" And with that Kevin follows in his mother's footsteps, screaming in agony as Crowley messily and mercilessly kills the Winchesters' pet prophet. Crowley has also sealed his status as my favorite “Supernatural” villain ever. Sorry, Yellow Eyes!
When the Winchesters arrive to check on Kevin, it appears that he simply ran away. The houseboat is scrubbed clean, the notes are gone and Sam and Dean are royally screwed.
"Taxi Driver" was a suspenseful, action-packed adventure of an episode that felt cinematic in scope and season-finale good. It is arguably one of the best episodes of the series, joining the likes of "Born Under A Bad Sign," "Death's Door" and "Wishful Thinking." As a fan of the show, I’m proud of the top-notch work the writers are put in and the excellent performances the cast repeatedly turn in week after week. From A to F, “Repo Man” to “Bugs,” this installment earns an epic A+, 4 stars, and 53 gold stars. Bravo!
What did you think of tonight's episode? Did you wish Sam and Benny had a longer scene together? Was it the best ever? Hit up the comments section below!
How will this second trial effect Sam's health? What exactly are they going to do now that Kevin hid the tablet and was either dragged to hell or dead? Where is Castiel? We’ll have to wait until April 24 for the answers, but at least then Felicia Day is back! |
/* ###
* IP: GHIDRA
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package ghidra.app.plugin.core.compositeeditor;
public interface EditorAction extends CompositeEditorModelListener {
static final String BASIC_ACTION_GROUP = "1_BASIC_EDITOR_ACTION";
static final String DATA_ACTION_GROUP = "2_DATA_EDITOR_ACTION";
static final String COMPONENT_ACTION_GROUP = "3_COMPONENT_EDITOR_ACTION";
static final String BITFIELD_ACTION_GROUP = "4_COMPONENT_EDITOR_ACTION";
/**
* Method to set the action's enablement based on the associated editor
* model's current state.
*/
public void adjustEnablement();
}
|
using System;
using System.ComponentModel;
using System.Diagnostics;
using System.Drawing.Design;
namespace CSharpGL
{
/// <summary>
/// manages transform feedback states.
/// </summary>
public partial class TransformFeedbackObject : IDisposable
{
private readonly uint[] ids = new uint[1];
/// <summary>
///
/// </summary>
public uint Id { get { return this.ids[0]; } }
/// <summary>
/// manages transform feedback states.
/// </summary>
public TransformFeedbackObject()
{
glGenTransformFeedbacks(1, this.ids);
}
/// <summary>
///
/// </summary>
public void Bind()
{
glBindTransformFeedback(GL.GL_TRANSFORM_FEEDBACK, this.ids[0]);
}
/// <summary>
///
/// </summary>
public void Unbind()
{
glBindTransformFeedback(GL.GL_TRANSFORM_FEEDBACK, 0);
}
/// <summary>
/// Bind specified buffer to specified binding point of this transform feedback object.
/// Then data will be dumped to the specified buffer when this transform feedback object works.
/// </summary>
/// <param name="index"></param>
/// <param name="buffer"></param>
public void BindBuffer(uint index, GLBuffer buffer)
{
this.Bind();
glBindBufferBase(GL.GL_TRANSFORM_FEEDBACK_BUFFER, index, buffer.BufferId);
this.Unbind();
}
/// <summary>
///
/// </summary>
/// <param name="mode"></param>
/// <returns></returns>
internal void Begin(DrawMode mode)
{
bool sucessful = false;
switch (mode)
{
case DrawMode.Points:
glBeginTransformFeedback((uint)DrawMode.Points);
sucessful = true;
break;
case DrawMode.Lines:
glBeginTransformFeedback((uint)DrawMode.Lines);
sucessful = true;
break;
case DrawMode.LineLoop:
glBeginTransformFeedback((uint)DrawMode.Lines);
sucessful = true;
break;
case DrawMode.LineStrip:
glBeginTransformFeedback((uint)DrawMode.Lines);
sucessful = true;
break;
case DrawMode.Triangles:
glBeginTransformFeedback((uint)DrawMode.Triangles);
sucessful = true;
break;
case DrawMode.TriangleStrip:
glBeginTransformFeedback((uint)DrawMode.Triangles);
sucessful = true;
break;
case DrawMode.TriangleFan:
glBeginTransformFeedback((uint)DrawMode.Triangles);
sucessful = true;
break;
case DrawMode.Quads:
break;
case DrawMode.QuadStrip:
break;
case DrawMode.Polygon:
break;
case DrawMode.LinesAdjacency:
glBeginTransformFeedback((uint)DrawMode.Lines);
sucessful = true;
break;
case DrawMode.LineStripAdjacency:
glBeginTransformFeedback((uint)DrawMode.Lines);
sucessful = true;
break;
case DrawMode.TrianglesAdjacency:
glBeginTransformFeedback((uint)DrawMode.Triangles);
sucessful = true;
break;
case DrawMode.TriangleStripAdjacency:
glBeginTransformFeedback((uint)DrawMode.Triangles);
sucessful = true;
break;
case DrawMode.Patches:
break;
default:
throw new NotDealWithNewEnumItemException(typeof(DrawMode));
}
if (!sucessful)
{
throw new Exception(string.Format("{0} not acceptable as input parameter for glBeginTransformFeedback(uint primitiveMode);", mode));
}
}
/// <summary>
///
/// </summary>
/// <param name="mode"></param>
/// <returns></returns>
internal void Draw(DrawMode mode)
{
bool sucessful = false;
switch (mode)
{
case DrawMode.Points:
glDrawTransformFeedback((uint)DrawMode.Points, this.Id);
sucessful = true;
break;
case DrawMode.Lines:
glDrawTransformFeedback((uint)DrawMode.Lines, this.Id);
sucessful = true;
break;
case DrawMode.LineLoop:
glDrawTransformFeedback((uint)DrawMode.Lines, this.Id);
sucessful = true;
break;
case DrawMode.LineStrip:
glDrawTransformFeedback((uint)DrawMode.Lines, this.Id);
sucessful = true;
break;
case DrawMode.Triangles:
glDrawTransformFeedback((uint)DrawMode.Triangles, this.Id);
sucessful = true;
break;
case DrawMode.TriangleStrip:
glDrawTransformFeedback((uint)DrawMode.Triangles, this.Id);
sucessful = true;
break;
case DrawMode.TriangleFan:
glDrawTransformFeedback((uint)DrawMode.Triangles, this.Id);
sucessful = true;
break;
case DrawMode.Quads:
break;
case DrawMode.QuadStrip:
break;
case DrawMode.Polygon:
break;
case DrawMode.LinesAdjacency:
glDrawTransformFeedback((uint)DrawMode.Lines, this.Id);
sucessful = true;
break;
case DrawMode.LineStripAdjacency:
glDrawTransformFeedback((uint)DrawMode.Lines, this.Id);
sucessful = true;
break;
case DrawMode.TrianglesAdjacency:
glDrawTransformFeedback((uint)DrawMode.Triangles, this.Id);
sucessful = true;
break;
case DrawMode.TriangleStripAdjacency:
glDrawTransformFeedback((uint)DrawMode.Triangles, this.Id);
sucessful = true;
break;
case DrawMode.Patches:
break;
default:
throw new NotDealWithNewEnumItemException(typeof(DrawMode));
}
if (!sucessful)
{
throw new Exception(string.Format("{0} not acceptable as input parameter for glDrawTransformFeedback(id, (uint)primitiveMode);", mode));
}
}
/// <summary>
///
/// </summary>
/// <param name="mode"></param>
public void Begin(Mode mode)
{
glBeginTransformFeedback((uint)mode);
}
/// <summary>
///
/// </summary>
/// <param name="mode"></param>
public void Draw(Mode mode)
{
glDrawTransformFeedback((uint)mode, this.Id);
}
/// <summary>
///
/// </summary>
public void End()
{
glEndTransformFeedback();
}
/// <summary>
///
/// </summary>
public enum Mode : uint
{
/// <summary>
/// GL_POINTS = 0x0000;
/// </summary>
Points = GL.GL_POINTS,
/// <summary>
/// GL_LINES = 0x0001;
/// </summary>
Lines = GL.GL_LINES,
/// <summary>
/// GL_TRIANGLES = 0x0004;
/// </summary>
Triangles = GL.GL_TRIANGLES,
}
/// <summary>
///
/// </summary>
/// <param name="program"></param>
/// <param name="vaos"></param>
/// <param name="switchList"></param>
public void Draw(ShaderProgram program, VertexArrayObject[] vaos, GLSwitchList switchList = null)
{
// 绑定shader
program.Bind();
program.PushUniforms(); // push new uniform values to GPU side.
if (switchList != null) { switchList.On(); }
this.Bind();
foreach (var vao in vaos)
{
DrawMode mode = vao.DrawCommand.CurrentMode;
this.Begin(mode);
vao.Bind();
this.Draw(mode);
vao.Unbind();
this.End();
}
this.Unbind();
if (switchList != null) { switchList.Off(); }
// 解绑shader
program.Unbind();
}
}
}
|
Heretofore, in photolithography, it is common to employ an exposure device to transfer a fine circuit pattern onto a wafer to produce an integrated circuit. Along with high integration and high functionality of integrated circuits, microsizing of integrated circuit has been progressing, and an exposure device is required to form an image of a circuit pattern on a wafer with a high resolution in a deep focal depth, whereby blue shift of the exposure light source is in progress. The exposure light source has been advanced from the conventional g-line (wavelength: 436 nm), i-line (wavelength: 365 nm) or KrF excimer laser (wavelength: 248 nm), and now an ArF excimer laser (wavelength: 193 nm) is being used. Further, in order to be prepared for an integrated circuit for the next generation where the line width of a circuit pattern will be less than 100 nm, it is considered to be prospective to employ a F2 laser (wavelength: 157 nm) as the exposure light source, but it is considered that even this can not cover beyond a generation of a line width of 70 nm.
Under these circumstances, a lithographic technique employing typically a light having a wavelength of 13 nm among EUV light (extreme ultraviolet light) as the exposure light source, has attracted attention, as it may be applied to the printing of feature sizes of 50 nm and smaller. The image-forming principle of the EUV lithography (hereinafter referred to as “EUVL”) is the same as the conventional photolithography to such an extent that a mask pattern is transferred by means of an optical projection system. However, in the energy region of EUV light, there is no material to let the light pass therethrough. Accordingly, a refraction optical system can not be used, and an optical system will be required to be a reflection optical system in all cases.
The optical material for the exposure device to be used for EUVL will be a photomask, a mirror or the like, and it is basically constituted of (1) a base material, (2) a reflective multilayer formed on the base material and (3) an absorber layer formed on the reflective multilayer. For the multilayer, it is studied to form layers of Mo/Si alternately, and for the absorber layer, it is studied to use Ta or Cr as the layer-forming material. As the base material, a material having a low thermal expansion coefficient is required so that no strain will be formed even under irradiation with EUV light, and a glass having a low thermal expansion coefficient is being studied.
TiO2—SiO2 glass is known to be a very low thermal expansion material having a coefficient of thermal expansion (CTE) smaller than quartz glass, and the coefficient of thermal expansion can be controlled by the TiO2 content in the glass, whereby it is possible to obtain a zero expansion glass having a coefficient of thermal expansion being close to zero. Accordingly, TiO2—SiO2 glass is prospective as a material to be used for an optical material for the exposure device for EUVL.
In a conventional method for preparing TiO2—SiO2 glass, firstly, a silica precursor and a titania precursor are, respectively, converted into a vapor form, and then mixed. Such a vapor form mixture is feeded into a burner and thermally decomposed to form TiO2—SiO2 glass particles. Such TiO2—SiO2 glass particles will be deposited in a refractory container and at the same time will be melted to form TiO2—SiO2 glass. However, in TiO2—SiO2 glass prepared by this method, the temperature region where the coefficient of thermal expansion becomes substantially zero, is limited to about room temperature.
Further, U.S. patent application publication No. 2002/157421 discloses a method which comprises forming a TiO2—SiO2 porous glass body, converting it to a glass body, and then obtaining a mask substrate therefrom.
At the time of forming a reflective layer, the optical material for the exposure device for EUVL will have a temperature of about 100° C. Further, at the time of exposure, high energy rays will be irradiated, whereby the temperature of the material may locally increase.
Accordingly, the optical material for the exposure device for EUVL is desired to have a wide temperature region where the coefficient of thermal expansion becomes substantially zero. However, with conventional TiO2—SiO2 glass, the temperature region where the coefficient of thermal expansion becomes substantially zero, is narrow, and such is inadequate to be used for an optical material for the exposure device for EUVL. |
Integrated risk and recovery monitoring of ecosystem restorations on contaminated sites.
Ecological restorations of contaminated sites balance the human and ecological risks of residual contamination with the benefits of ecological recovery and the return of lost ecological function and ecosystem services. Risk and recovery are interrelated dynamic conditions, changing as remediation and restoration activities progress through implementation into long-term management and ecosystem maturation. Monitoring restoration progress provides data critical to minimizing residual contaminant risk and uncertainty, while measuring ecological advancement toward recovery goals. Effective monitoring plans are designed concurrently with restoration plan development and implementation and are focused on assessing the effectiveness of activities performed in support of restoration goals for the site. Physical, chemical, and biotic measures characterize progress toward desired structural and functional ecosystem components of the goals. Structural metrics, linked to ecosystem functions and services, inform restoration practitioners of work plan modifications or more substantial adaptive management actions necessary to maintain desired recovery. Monitoring frequency, duration, and scale depend on specific attributes and goals of the restoration project. Often tied to restoration milestones, critical assessment of monitoring metrics ensures attainment of risk minimization and ecosystem recovery. Finally, interpretation and communication of monitoring findings inform and engage regulators, other stakeholders, the scientific community, and the public. Because restoration activities will likely cease before full ecosystem recovery, monitoring endpoints should demonstrate risk reduction and a successional trajectory toward the condition established in the restoration goals. A detailed assessment of the completed project's achievements, as well as unrealized objectives, attained through project monitoring, will determine if contaminant risk has been minimized, if injured resources have recovered, and if ecosystem services have been returned. Such retrospective analysis will allow better planning for future restoration goals and strengthen the evidence base for quantifying injuries and damages at other sites in the future. |
Milonine, an Alkaloid of Cissampelos sympodialis Eichl. (Menispermaceae) Inhibits Histamine Release of Activated Mast Cells.
Milonine is an alkaloid of Cissampelos sympodialis Eichl. (Menispermaceae), a plant used in the northeast of Brazil to treat allergies such as asthma, rhinitis, and other conditions. Previously, several alkaloids were isolated from its roots and leaves with pharmacological properties in asthma and acute inflammation models. Therefore, the aim of this study was to evaluate the milonine effect on mast cells degranulation in vivo and in vitro. Swiss mice (n = 8) were used in models of paw edema induced by carrageenan, compound 48/80, or histamine. One hour before challenge, the animals were treated with milonine (at different doses) or standard drugs and, at different time points, the edema formation was measured. In addition, other different methods, such as anaphylactic shock reaction and scratching behavior models both induced by compound 48/80, a mast cell degranulator, were used to assess milonine effect histamine release in vivo. Moreover, milonine effect on mast cell degranulation in vitro was also carried out. Firstly, it was observed that milonine significantly decreased the carrageenan edema formation only at the beginning of the reaction (i.e., up to 2 h after challenge). Furthermore, this alkaloid decreased the edema induced by compound 48/80, maintained the paw tissue integrity, without modulating histamine-induced paw edema. In anaphylactic shock reaction, milonine increased the time of animal survival when compared with compound 48/80 group. Milonine also significantly decreased the scratching behavior induced by compound 48/80 with decreasing of mast cell degranulation in vitro. Therefore, these data indicated that milonine presents anti-allergic properties by decreasing mast cell degranulation rather than acting on histamine effect. |
Q:
Ошибка NoneType is not iterable в цикле
В цикле выводит ошибку:
TypeError: argument of type 'NoneType' is not iterable
Пытался исправить так:
if None in listUsers:
listUsers.remove(None)
for user in listUsers:
adj[user] = getFriends(user)
Ошибка остаётся прежней, но уже в строке с условием. Как это можно исправить?
A:
Попробуйте заменить весь код из вопроса на следующий:
adj = {user:getFriends(user) for user in listUsers if user} if listUsers else {}
|
OCMock is a new framework for testing Objective-C code using mock objects. Its trampoline-based interface is extremely simple:
Expectations
A trampoline records the message to expect, and the mock later checks to see whether your test code caused the same message to be sent to it. (It doesn’t seem to check the order or number of the messages, and unfortunately messages with non-object arguments don’t seem to be supported.)
Stubs
Using two trampolines, you can add a stub method to your mock object and set its return value.
From the user’s perspective, OCMock is not really any better than EasyMock (for Java), and it has considerably fewer features. However, it does fill a need in Objective-C, and it is a good example of what you can do in that language with relatively few lines of code.
Certainly schools should teach students how to write. But due to a series of historical accidents the teaching of writing has gotten mixed together with the study of literature. And so all over the country students are writing not about how a baseball team with a small budget might compete with the Yankees, or the role of color in fashion, or what constitutes a good dessert, but about symbolism in Dickens. |
Q:
Splitting and Comparing one String (Java)
I have been testing different method for a while and this is what I got. I just can't figure out how to solve this.
/** Return true iff s has an odd number of characters and
* the substring before the middle character equals the substring
* after it.
* Examples: For s = "" return false
* For s = "b" return true
* For s = "xbx" return true
* For s = "xxxx" return false
* For s = "hellohello" return false
* For s = "hello!hello" return true */
public static boolean isDoubled(String s) {
// TODO 1. There is no need for a loop. Do not use a loop.
// In all methods, use s1.equals(s2) and NOT s1 == s2 to test
// equality of s1 and s2.
int midLen = s.length() / 2;
if (midLen == 0) return false;
String[] parts = {s.substring(0, midLen - 1), s.substring(midLen + 1)};
String part1 = parts[0];
String part2 = parts[1];
if ((s.length() % 2 == 0) && (part1.equals(part2))) {
return true;
}
return false;
}
A:
You have mistake with using substring function:
public static boolean isDoubled(String s) {
if (s.length() % 2 == 0)
return false;
if (s.length() == 1)
return true;
int mid = s.length() / 2;
return s.substring(0, mid).equals(s.substring(mid + 1));
}
|
As Kelly McKenna fought, and failed, to feel Christ's presence in her life and bring others to her church, she turned to the only aspect of her life that she felt she could control: her weight.
McKenna said she developed anorexia and bulimia in her early 20s in response to the controlling efforts and constant criticism from peers and leaders at Xenos Christian Fellowship.
“I was doing the same thing everybody else was .... (yet) I was blamed for letting Satan into my life and not praying well enough,” said McKenna, who is now 32 and lives on the West Side. "That wreaked havoc on my mental state and forced me to try to control things in other ways — through eating disorders and cutting."
For years, some ex-congregants such as McKenna have raised concerns about the Columbus-based church’s power and what they say is its destructive influence over members.
Join the conversation at Facebook.com/columbusdispatch and connect with us on Twitter @DispatchAlerts
Ten former Xenos members and three of their relatives shared their disenchantment with the church with The Dispatch. They accuse the non-denominational evangelical church of spiritual abuse, isolation, control and manipulation.
The former members who talked with The Dispatch said they joined Xenos because of the acceptance and fun they had in the beginning of their involvement with it. But over time, some said they were overcome by strict biblical mandates, stressful time commitments and friendships that seemed to be based only on their membership in the group — not on who they are.
“It totally sucks you away from all other aspects of your life,” McKenna said. “It doesn’t allow you to enjoy your life.”
Leaders of Xenos, which has about 6,000 members in Columbus, reject claims that it attempts to control or pressure its members.
"We're the furthest thing from that," said Conrad Hilario, a teaching pastor at Xenos. "It's due to people's misunderstandings."
Scott Thumma, director of the Hartford Institute for Religion Research at Connecticut’s Hartford Seminary, said Xenos appears to be a "strict sect group" or a small, breakaway group from a larger tradition — in this case, the evangelical Christian movement.
Strict sect groups “often have high boundaries from the outside world, require more obedience from members and hold distinctive beliefs,” Thumma said.
***
Xenos was founded in the 1970s by two Ohio State University students, Dennis McCallum and Gary DeLashmutt, who remain leaders today. The two started the church in their campus house after they began to feel called to teach others about the Bible, said Keegan Hale, the pastoral support division coordinator for Xenos. Today, the church remains focused in Columbus, he said.
It has grown and now is made up largely of unmarried adults who are college age or older, Hale said. He credited its growth, which surged in the 1980s and 1990s and again this past decade, to large influxes of high school and college students.
The church is modeled on the book of Acts, which states that Jesus’ apostles met daily in their homes, which is largely where Xenos operates, Hilario said. High school students and adults meet in neighborhood homes, and college students and other unmarried young adults meet and live in “ministry houses" that they’re encouraged to rent in groups near the Ohio State campus. Once there, they have to abide by a set of guidelines spelled out in a ministry house agreement available on Xenos’ website.
The church’s principles are based on a “common-sense” reading of the Bible, with a focus on certain “one another” passages that speak to relationships and community, Hilario said. For example, some of the verses say to "be devoted to one another" (Romans 12:10), "serve one another" (Galatians 5:13) and "carry one another's burdens" (Galatians 6:2), he said.
"These commands kind of form a basis for the level of community we're trying to call people to," Hilario said.
Luke Gourley, 31, of Clintonville, is a member and was introduced to Xenos by his now wife. At first, he was skeptical, but what really drew him in were the clear biblical messages and the genuineness of the other members, he said.
People were “pretty vulnerable and open about their own lives, which was pretty atypical,” said Gourley, who joined Xenos in 2013. “People at other churches were more putting on a front.”
***
The church bucks the notion of “Sunday-only” services, Hale said.
Members are encouraged each week to attend a large group teaching (central teaching); a Bible study of about 60 people (home church meeting); a smaller same-sex Bible study (cell group meeting); and a meeting with a spiritual mentor called a “discipler," he said.
The number and intensity of the meetings can be beyond overwhelming, the former members told The Dispatch.
Though meetings aren't required, if members live in a ministry house, the church makes it clear that attending them is important because of biblical examples, Hale said.
In addition to meetings, Xenos’ website and study center, at its headquarters on the Northeast Side, promote books written by elders, which former members say they were encouraged to read with their disciplers.
To move up in the church, members must attend more than 200 hours of leadership training classes, which include graded exams and homework and cost between $25 and $75, Hale said.
McKenna lived in ministry houses from 2005-09 and missed several family reunions and other events because of her involvement with Xenos, said Barbara Moum, Kelly’s mother. Even when McKenna was with relatives, she talked only about Xenos and spent a lot of time trying to persuade them to join the church, Moum said.
When her sister tried to persuade her to leave the group, Kelly McKenna said she thought it was a test of her commitment to God. She said the church characterizes those not involved in Xenos as non-believers who harm members’ journeys with God.
Xenos’ encouragement to live in ministry houses and attend several meetings a week "creates more of a potential for controlling the environment," said Steven Hassan, a mind-control expert and mental-health professional in Massachusetts.
Jake Leppert, 25, and a member, doesn’t see it that way.
“I think there are a lot of meetings,” said Leppert, who lives in one of Xenos’ ministry houses near Ohio State’s campus. “I go to them because I want to. People have a choice to go to them or not.”
Leppert said he's read posts online about bad experiences with the church and wants to hear both sides.
“Some things people said happened don’t sound good ... if these things are true, I’d like them out of our church,” he said.
In addition to grueling meeting schedules, some former members complained about the church's use of what it calls "accountability software" to monitor their internet usage.
“It’s insane; you’re an adult,” Alex Craig, 20, of the University District, said of the software program.
She said it has been used to monitor or block sites that aren't Christian or are critical of the church.
Hale said the software program is optional and only used to make sure that those living in the ministry houses aren't looking at pornography. It can be used to block certain sites, he acknowledged, but said those features have to be turned on by the person with the device.
"The goal of behavior control is dependence and obedience," said Hassan, who was a college junior in the mid-1970s when he was recruited into the Unification Church, the so-called Moonies.
"You want access to followers ... you don't want them exposed to things you can't control,” he said. “You want to keep them very busy with your own projects."
Delia Grantham, 18, of Bexley, was a member of Xenos for two years during high school.
She left the church because she said leaders of her high school group told the then-16-year-old that she couldn't be with her Jewish boyfriend forever: He was going to hell and she was going to heaven. Her salvation also was questioned, she said, when she admitted she'd been depressed after a friend, a fellow Xenos member, died by suicide.
"They were telling me even the thought of wanting to kill yourself is this big sin and you can't go to heaven now," she said, speaking of her own dark thoughts.
Some of Xenos’ practices and theological beliefs are not uncommon among some conservative Christian churches, said Thumma, of the Hartford Institute. But it seems to lean toward the extreme.
“Generally, the Christian God is about grace and forgiveness, and anyone that stresses otherwise is using their interpretation to try to control and manipulate other people,” he said.
***
Some former members say they were slowly isolated and became estranged from their friends and relatives who weren’t involved or didn’t support their involvement in the church.
Tricia Jones, 40, of Worthington, was involved from 1993 to ‘98, and she said she was persuaded by her Xenos peers to cut off all of the people in her life who were “not really Christians,” including her parents.
Jones’ father thought the distance he felt growing between him and his then-teenage daughter was normal. Now, he said, he realizes how different she became under the church’s influence.
“She was not as independent and not as self-confident as she used to be," said John Jones, of Worthington. "Her self-image seemed to change.”
When she was excommunicated after five years in the church, Tricia Jones said that all of the people she considered her close friends stopped talking to her.
"I thought I was in an environment where people were practicing the love of God, which I was taught was unconditional but, in fact, it's completely conditional," she said.
Hale said Xenos encourages people to spend time with their family, and that it excommunicates people, but only rarely and after several hearings and approval from leaders.
"What happens more often than not is … someone doesn't want to follow God," Hale said.
***
Criticism of Xenos has been going on for years.
In 2009, a woman from the northeastern Ohio city of Stow stood outside a Bible study at a Kent church and told passersby that Xenos had brainwashed her son and taken him from her. She also started an online blog and took allegations to various city, county, police and school officials.
There are online forums, one dating back to 2012, criticizing Xenos.
The amount of online criticism of Xenos is significant, said Rick Alan Ross, executive director of the Cult Education Institute in New Jersey.
"When you have a lot of former members who say the same kind of thing about why they left and what was wrong ... you have to say, 'Hmmm, what's going on here?'" Ross said, adding that many older, larger movements have not received the same kind of negative attention.
Xenos hasn’t changed its policies or practices due to online complaints, Hilario said. However, it is willing and would even like to investigate allegations if people reach out to the church, he said.
"We're very dedicated to keeping people accountable,” Hale said.
Former member Emily Fravel, 41, of Linden, was in the group from 2001 to ‘09, and she said she was cut off from Xenos after her departure. As a member, she said she had been told not to talk to people who left — or believe anything they said — because they were bitter, angry and never really committed to God.
This kind of behavior implies that Xenos believes there’s no legitimate reason to leave the church, which is concerning and “not typical of Protestant churches,” Ross said.
Ross has received complaints about the level of commitment "demanded by the group and its leadership.” He said people describe it as a “rigid, intolerant-of-criticism, top-down organization where people felt like they had no voice.”
Scared to leave the group, McKenna said she snuck out at night during a meeting to avoid other members trying to persuade her to stay.
She left a note for her roommates saying she wasn’t happy and needed to leave, and she never went back. Now, she realizes she never felt a connection to God like she thought she did, like members made her believe she should.
“I’d been convincing myself for years and lying to people and lying to myself, and I just reached a point where I couldn’t do it anymore,” she said.
dking@dispatch.com
@DanaeKing |
haha this reminds me about the time on BBC news :a guy in a school got hit in the eye by a flying flapjack and got sent home because of eye pain:Cue 20 mins of discussion about the need to make non triangular flapjacks! |
Sustained release of 5-fluorouracil from ethylene acetate copolymer.
Pharmacologic inhibition of fibroblast proliferation and scar formation remains an important consideration in many ophthalmologic surgical procedures. Such inhibition is particularly important in glaucoma filtration surgery. A sustained release system for 5-fluorouracil (5-FU) using ethylene vinyl acetate copolymer (Elvax) was characterized in vitro. 5-FU was incorporated into Elvax discs of 4 mm diameter. Discs were coated to allow sustained and predictable release over a 14 day period. Alteration of coatings, which act as rate-controlling membranes, allowed variation in the pattern of 5-FU release from the core which acts as the drug reservoir. This system for the sustained release of 5-FU may prove valuable in glaucoma surgery where the suppression of cellular proliferation is desired. The non-inflammatory nature of Elvax suggests this compound may provide an alternative means of 5-FU delivery. |
New polling places presumptive GOP presidential nominee Donald Trump ahead of Democratic presidential candidate Hillary Clinton in a general election matchup.
On May 19, Rasmussen Reports released the latest installment of its White House Watch survey. It found that 42 percent of polled respondents would sooner vote for Trump while 37 percent sided with Clinton.
20 percent of respondents chose neither option, with 13 percent citing that they preferred another candidate. Another 7 percent were undecided.
ADVERTISEMENT Thanks for watching! Visit Website
The business mogul’s lead over Clinton is a recent development; previous election tracking polls had the former Secretary of State leading a potential general election scenario, according to Real Clear Politics. Trump has climbed four percentage points in just two weeks.
This rising in the polls comes at the end of the Republican primary, with Trump’s GOP competitors exiting the race and leaving him to consolidate his party’s support.
Meanwhile, Clinton is still engaged in a primary battle against Sen. Bernie Sanders of Vermont. The Rasmussen Reports poll noted this when reviewing that likely voters under age 40 favor Clinton while older voters are more likely to support Trump.
“Young voters traditionally have been a key part of the Democratic base, but right now one-third of those voters like some other candidate or are undecided,” the survey stated. “Many of these voters are likely to be Sanders supporters which highlights how important it will be for Clinton to quickly heal her party after she wins the nomination.”
ADVERTISEMENT Thanks for watching! Visit Website
ADVERTISEMENT Thanks for watching! Visit Website
That may prove difficult for the former Secretary of State. Sanders’ aides have told The New York Times that the senator “is willing to do some harm to Mrs. Clinton in the shorter term if it means he can capture a majority of the 475 pledged delegates at stake in California.”
The California Democratic primary will not be held until June 7.
The Rasmussen Report poll found that there is a gender split among respondents. While Clinton has an 11 percentage-point edge among women voters, Trump leads her by 22 points among men.
On May 18, 2008, Rasmussen Reports’ White House Watch Survey found Republican Sen. John McCain of Arizona leading Democratic Sen. Barack Obama of Illinois by 45 to 44 percent, according to Real Clear Politics archives.
Sources: The New York Times, Rasmussen Reports, Real Clear Politics (2) / Photo credit: Gage Skidmore/Wikimedia Commons |
Abstract:
The lifetime prevalence of acquiring an Eating Disorder (ED) in the US is 0.6–4.5%. The focus of ED research has traditionally been in adolescents with minimal focus on adults. We aimed to compare and contrast the etiology and disease progression between two groups of adult patients with EDs: those diagnosed in adulthood versus those diagnosed in childhood (introduction). Thirty adult patient’s (29 females and 1 male) charts were reviewed from one eating disorders center. Data was extracted using a pre-constructed template and SPSS was used to determine existing trends (method). 50% were diagnosed with an ED in childhood and 50% in adulthood. The majority of the patients with an adult-onset ED were diagnosed with Eating Disorder not-otherwise-specified (ED-NOS). Common events that triggered the disease onset included death/ illness of a parent or child, and work-related stressors. In contrast, patients diagnosed as children had more varied diagnoses including ED-NOS, Bulimia Nervosa (BN), and Anorexia Nervosa (AN). Sexual abuse, personal illness, and the termination of a romantic relationship were common triggers in this patient group. Among all patients fatigue, emesis, constipation, diarrhea, heart palpitations, amenorrhea or irregular menses, and acid erosion of tooth enamel were common comorbidities. Psychiatric comorbidities, Major Depressive Disorder and Anxiety Disorder, were primarily seen and 29/30 patients were taking psychotropic medication to treat an underlying psychiatric illness at time of their first Eating disorder visit (results). The triggers and behaviors of patients diagnosed with EDs as children are different from patients diagnosed in adulthood. Regardless of the age of onset, comorbidities are equally severe and should be treated as such. The longer and ED remains untreated, the harder it is to get it into remission, therefore, adult health care providers must incorporate screening for ED’s when caring for this population (conclusion). |
On-chip assembly of 3D graphene-based aerogels for chemiresistive gas sensing.
Integration of the material preparation step into the device fabrication process is of prime importance for the development of high performance devices. This study presents an innovative strategy for the in situ assembly of graphene-based aerogels on a chip by polymerization-reduction and annealing processes, which are applied as chemiresistive gas sensors for the detection of NO2. |
Harris is a really good sign imo. He is a decent safety, and a good backup. The way Sendejo makes some of those weird tackles and gets hurt. I bet we see Harris quite a bit this year. Im really surprised a team didnt sign him for their starting safety, but I admit, I dont know a lot about the safety position, except Harrison is the best safety in the world. Ever.
I havent a clue who Mark Brown is but that seems like a #### of money for 18 carries. More then I will ever see in my life.
PurpleKoolaid wrote:Harris is a really good sign imo. He is a decent safety, and a good backup. The way Sendejo makes some of those weird tackles and gets hurt. I bet we see Harris quite a bit this year. Im really surprised a team didnt sign him for their starting safety, but I admit, I dont know a lot about the safety position, except Harrison is the best safety in the world. Ever.
I havent a clue who Mark Brown is but that seems like a #### of money for 18 carries. More then I will ever see in my life.
Brown was the leagues leading rusher in the preseason of 2016. He also showed flashes in his first legit game for Washington in week 16 vs the bears in 2016 taking 8 carries for 82 yards and a TD. Could be our 3rd string RB
PurpleKoolaid wrote:Harris is a really good sign imo. He is a decent safety, and a good backup. The way Sendejo makes some of those weird tackles and gets hurt. I bet we see Harris quite a bit this year. Im really surprised a team didnt sign him for their starting safety, but I admit, I dont know a lot about the safety position, except Harrison is the best safety in the world. Ever.
I havent a clue who Mark Brown is but that seems like a #### of money for 18 carries. More then I will ever see in my life.
PurpleKoolaid wrote:Harris is a really good sign imo. He is a decent safety, and a good backup. The way Sendejo makes some of those weird tackles and gets hurt. I bet we see Harris quite a bit this year. Im really surprised a team didnt sign him for their starting safety, but I admit, I dont know a lot about the safety position, except Harrison is the best safety in the world. Ever.
I havent a clue who Mark Brown is but that seems like a #### of money for 18 carries. More then I will ever see in my life.
PurpleMustReign wrote:My buddy owns a house in AZ and rents it occasionally to Jarius Wright and Anthony Harris. Harris is a nice guy and likes playing here.
Who is Smiths backup? Can Harris back up both positions?
Sent from my LG-H872 using Tapatalk
Yes he’s filled in for both before. Kearse is the other backup who I’ve always liked as well. That’s pretty sweet your buddy does that!
PurpleMustReign wrote:My buddy owns a house in AZ and rents it occasionally to Jarius Wright and Anthony Harris. Harris is a nice guy and likes playing here.
Who is Smiths backup? Can Harris back up both positions?
Sent from my LG-H872 using Tapatalk
Yes he’s filled in for both before. Kearse is the other backup who I’ve always liked as well. That’s pretty sweet your buddy does that!
He's also had Sherels there before I think. If Barr ever goes there I'm pushing old ladies out of the way to get there.
Sent from my LG-H872 using Tapatalk
0 x
The Devil whispered in the Viking's ear, "There's a storm coming." The Viking replied, "I am the storm." #SKOL2018
For the off-season Id like to see the Vikings work on solidifying our defense.I thought "Our next man up" game on Defense was kinda weak and we saw it against the Eagles because nobody really stepped up we our secondary got banged up.
As for the QB situation, Ill admit I'm on the skeptical side of adding Cousin's. I think he'll do a decent job with us I'm just not sure if he can take us all the way.
Dmizzle0 wrote:For the off-season Id like to see the Vikings work on solidifying our defense.I thought "Our next man up" game on Defense was kinda weak and we saw it against the Eagles because nobody really stepped up we our secondary got banged up.
As for the QB situation, Ill admit I'm on the skeptical side of adding Cousin's. I think he'll do a decent job with us I'm just not sure if he can take us all the way.
It’s not necessarily if Cousins “will” or “won’t” take us all the way. It’s who is the best option out there to do it. And no doubt the best option at QB is cousins IMO. Case is second for sure. Bradford would be up there if he could stay healthy. Teddy I just don’t see it. The 3 QBs we have hold big risks. With case being the one with the least amount of risk. I don’t see a big risk in Cousins given the consistency of his play and the consistency of his health. Not only do I believe he is the best QB of all 4 but he’s also the only one that doesn’t come with injury concerns or performance concerns. And if he had any, they would be minuscule compared to the other 3 |
Q:
use parameter to access predefined child
here in the below I'm trying to user the parameter ('selected') to call set style with the passed parameter (string) like onClick('firstheader')
I hope could explained my point
@ViewChild('firstheader', { static: false }) firstheader: ElementRef;
@ViewChild('secheader', { static: false }) secheader: ElementRef;
@ViewChild('thirdheader', { static: false }) thirdheader: ElementRef;
onClick(selected) {
this.firstheader.nativeElement.style.display = 'none'
this.secheader.nativeElement.style.display = 'none'
this.thirdheader.nativeElement.style.display = 'none'
this.selected.nativeElement.style.display = 'flex' <-- here (selected)
}
the HTML
<div class="header__bullets-container">
<div class="header__bullet" (click)="onClick('firstheader')"></div>
<div class="header__bullet" (click)="onClick('secheader')"></div>
<div class="header__bullet" (click)="onClick('thirdheader')"></div>
</div>
A:
The quickest and inefficient way would be to send the template reference directly to the controller and loop through all the headers and set the style.
Controller
headers = [];
@ViewChild('firstheader', { static: false }) firstheader: ElementRef;
@ViewChild('secheader', { static: false }) secheader: ElementRef;
@ViewChild('thirdheader', { static: false }) thirdheader: ElementRef;
ngAfterViewInit() {
this.headers = [this.firstheader, this.secheader, this.thirdheader];
}
onClick(selected: any) {
this.headers.forEach(header => {
if (header.nativeElement == selected) {
selected.style.display = 'flex';
} else {
header.nativeElement.style.display = 'none';
}
});
}
Template
<div class="header__bullets-container">
<div class="header__bullet" (click)="onClick(firstheader)"></div>
<div class="header__bullet" (click)="onClick(secheader)"></div>
<div class="header__bullet" (click)="onClick(thirdheader)"></div>
</div>
Notice the lack of quotation marks in the template. We are sending the HTML element to the controller instead of a string.
|
Little Saskatchewan First Nation
Little Saskatchewan First Nation is a First Nations reserve in central Manitoba. Its main reserve is the Little Saskatchewan 48 reserve.
Category:Indian reserves in Manitoba |
Child Safety
Plenty Parklands is committed to the safety and wellbeing of all children and young people. This will be the primary focus of our care and decision-making.
PPPS has zero tolerance for child abuse.
PPPS is committed to providing a child safe environment where children and young people are safe and feel safe, and their voices are heard about decisions that affect their lives.
Particular attention will be paid to the cultural safety of Aboriginal children and children from culturally and/or linguistically diverse backgrounds, as well as the safety of children with a disability.
Every person involved in PPPS has a responsibility to understand the important and specific role he/she plays individually and collectively to ensure that the wellbeing and safety of all. |
Centers of Excellence
Organizations that establish centers of excellence in education, clinical care, or research are committed to providing cutting edge innovations in their fields. Their endeavors are funded by national organizations such as the National Institutes of Health (NIH), National Institute on Aging (NIA), National Institute on Mental Health (NIMH), U.S. Administration on Aging (AOA) and the John A. Hartford Foundation.
The University of Pittsburgh Centers of Excellence in education are dedicated to ultimately improving quality of life for older adults.
Director: Charles F. Reynolds III, MD
A Hartford Center of Excellence, ACISR/LLMD provides a research infrastructure to promote investigations that ultimately will improve real world practice in the care of elderly living with depression and other severe mood disorders. It focuses on prevention and rehabilitation; improving care of difficult-to-treat late life mood disorders and providing assistance to families; and identifying and removing barriers to effective treatment practices in the community, especially among older primary care African Americans, in the nursing home, and in therehabilitation setting.
Director: Oscar Lopez, MDCo-Director: William E. Klunk, MD, PhDThe ADRC performs and promotes research designed to gain an understanding of the etiology and pathogenesis of Alzheimer’s disease (AD) and the mechanisms underlying the cognitive and neurobiological changes. It also develops strategies targeted at effective early diagnoses and treatments for AD and other dementias. Its research centers around the areas of genetics, neuroimaging, neuropathy, and minority outreach. A major focus is matching participating patients and family members with volunteer opportunities for AD-related studies.
Director: Steven Graham, MDThe GRECC is funded by the Department of Veterans Affairs and provides an integrated program of basic biomedical, clinical, and health services research; education of trainees and practitioners; and clinical demonstration projects designed to advance knowledge regarding the care of the elderly, with an emphasis on stroke. Its research focus includes neuronal-cell death in stroke, gene therapy in cerebrovascular disease, depression in the elderly, polypharmacy in long–term care, and end-of-life care.
Director: Neil M. Resnick, MDDesignated a National Center of Excellence by the John A. Hartford Foundation, the University of Pittsburgh’s Division of Geriatric Medicine is committed to excellence in geriatric research, clinical care, and training. Its research includes the biology of aging, cancer, dementia, depression, falls, frailty, heart disease, incontinence, infections, mobility, osteoporosis, pain, pharmacotherapy, resilience, and sarcopenia.
Bennett Van Houten, PhD, Leader of the Molecular and Cell Biology ProgramAdvancing the understanding, diagnosis, and treatment of cancer through basic, translational, clinical, and population based research programs.
Director: Robert Arnold, MDThe Supportive and Palliative Care Program at UPMC was established to improve the quality of life of patients whose diseases are no longer responsive to curative treatments. Its team of health care professionals offers care for patients with serious and life-limiting illnesses, and provides comfort and support to those patients and their families. |
Q:
Defining a graph as G=(V,E) -- how to interpret the notation?
I am looking at the following problem:
Define $V=\{0,1,2,3,4,5\}$. Define a graph $G=(V,E)$ by letting the edges be:
$$ E =\{(a,b):a-b^2 \le 1 \lor b-a^2 \le 1\}$$
I understand that 'V' stands for vertext and 'E' stands for edge -- but how do you actually take this information and construct a graph? It looks like the question gives you six individual vertexes to start out with.
A:
Take $|V|=6$ points and give them the names $0,\ldots,5$, then link the vertex $i$ to the vertex $j$ with an edge if, and only if $(i,j)$ (or $(j,i)$) is in $E$, i.e. if $i-j^2\le1$ or $j-i^2\le1$.
|
Picdun 2: Witch’s Curse Out Now on 3DS (Think RPG Crossed with Picross)
Triverse writes, "As [we] stated just a second ago, Picdun 2 is an RPG which makes use of Picross to give the levels that you traverse a reason to be completed. Once you completely explore a level, you will reveal a picture in the dungeon map, a picross style picture. Check the pics out, then hit up the Nintendo eShop on your 3DS and grab your copy today."
(3DS, Picdun 2: Witch’s Curse) |
Q:
Fetch the latest post with attachment image
What I want to do seems to be simple but I can't get around it. I'd like to get the latest post that has an image attachment. A little help would be appreciated.
Thanks
Lita
A:
This is a tricky one. If you wanted to get the latest image attachment and display the post associated with it, you could use:
$attachments = get_posts('post_type=attachment');
$first_attachment_post = get_post($attachments[0]->post_parent);
To get the latest post, but only if it has an attachment, I think the only way to do it would be with two nested queries. For example:
$the_query = new WP_Query( $args );
while ( $the_query->have_posts() ) : $the_query->the_post();
$attachments = get_children( array('post_parent' => get_the_ID(), 'post_type' => 'attachment', 'post_mime_type' => 'image') );
if ( $attachments ) {
// Post output here will only be display if attachments are found
echo '<li>' . get_the_title() . '</li>';
}
endwhile;
|
Undergraduate Catalog, Regulations
All chemical engineering majors are expected to consult the catalog before planning their course selections.
The CBEE department is continually working to improve our undergraduate educational process. Aligned with this, we are regularly working on new policies and procedures for our undergraduate program. These will all be posted on our web site, here on this page. We encourage you to check this page at the beginning and end to each semester to see if there are changes to our departmental policies that may impact you.
Chemical Engineering Gateway Requirements
Students are admitted to the chemical engineering program only when they pass all four of the following Gateway courses: ENES 101, MATH 152, CHEM 102, and ENCH 215 with a grade of at least two B’s and two C’s.* Enrolling in a gateway course at UMBC or a Chemical Engineering Department pre-approved equivalent course at another institution is considered an attempt. Students must select a track to complete—Traditional, Biotechnology/Bioengineering or Environmental Engineering and Sustainability.
*If a student is using AP credit for MATH 152 or PLTW credit for ENES 101, then the requirement is at least two B’s and one C. If the student has both MATH 152 and PLTW test credit, then the requirement is at least one B and one C.
Repeat policy
At UMBC, Students may not register for a course more than two times. They are considered registered for a course if they are enrolled after the end of the schedule adjustment period. A course in which the student receives a grade of “W” (Withdraw) is counted as an attempt. Students may petition the Office of Undergraduate Education for a third and final attempt of a course taken at UMBC or another institution.
Program Regulations
The responsibility for proper registration and for satisfying prerequisites for any course rests with the student, as does the responsibility for proper achievement in courses in which the student is enrolled. Each student should be familiar with the provisions of this catalog, including the academic regulations.
It is strongly recommended that every chemical engineering student satisfy the mathematics, chemistry and physics requirements as early as possible in their program.
To be eligible for a bachelor’s degree in engineering, a student must have an overall average of at least a “C” (2.0) and a grade of “C” or better in all engineering courses. Responsibility for knowing and meeting all degree requirements for graduation rests with the student. |
Spin density and coenzyme M coordination geometry of the ox1 form of methyl-coenzyme M reductase: a pulse EPR study.
Methyl-coenzyme M reductase (MCR) catalyses the reduction of methyl-coenzyme M (CH3-S-CoM) with coenzyme B (H-S-CoB) to CH4 and CoM-S-S-CoB in methanogenic archaea. Here we present a pulse EPR study of the "ready" form MCR(ox1), providing a detailed description of the spin density and the coordination of coenzyme M (CoM) to the Ni cofactor F430. To achieve this, MCR was purified from cells grown in a 61Ni enriched medium and samples were prepared in D2O with the substrate analogue CoM either deuterated in the beta-position or with 33S in the thiol group. To obtain the magnetic parameters ENDOR and HYSCORE measurements were done at X- and Q-band, and CW EPR, at X- and W-band. The hyperfine couplings of the beta-protons of CoM indicate that the nickel to beta-proton distances in MCR(ox1) are very similar to those in Ni(II)-MCR(ox1-silent), and thus the position of CoM relative to F430 is very similar in both species. Our thiolate sulfur and nickel EPR data prove a Ni-S coordination, with an unpaired spin density on the sulfur of 7 +/- 3%. These results highlight the redox-active or noninnocent nature of the sulfur ligand on the oxidation state. Assuming that MCR(ox1) is oxidized relative to the Ni(II) species, the complex is formally best described as a Ni(III) (d7) thiolate in resonance with a thiyl radical/high-spin Ni(II) complex, Ni(III)-(-)SR <--> Ni(II)-*SR. |
Q:
vsftpd : limit connection to a set of IP addresses
Is it possible to setup vsftpd to only accept connections from a certain set of IP addresses?
I've looked at the /etc/vsftpd.conf for options but there is no hint at that. The manual does not either.
My Server OS : Red Hat Enterprise Linux Server release 6.5 (Santiago)
A:
Seems you can use TCP Wrappers (just tested it on my Ubuntu) and use hosts.allow and hosts.deny to filter vsftpd access.
Add the following to your vsftpd.conf file :
tcp_wrappers=YES
Restart vsftpd.
In /etc/hosts.deny deny everyone for vsftpd :
vsftpd: ALL
Then, in /etc/hosts.allow add the authorized IPs :
vsftpd:192.168.0.39 192.168.0.50
|
Newark, NJ – The New Jersey Devils today acquired forward Marc Savard and Florida’s second-round pick in the 2018 NHL Draft in exchange for forwards Graham Black and Paul Thompson . The announcement was made by Devils’ Executive Vice President/General Manager Ray Shero.
Savard, 38, has career totals of 207 goals, 499 assists and 706 points while adding 737 penalty minutes in 807 career NHL games. In 25 Stanley Cup Playoff contests, he has eight goals and 14 assists with 22 penalty minutes. He has not played since the 2010-11 season due to injury.
Black spent all of the 2015-16 season with Albany (AHL), while Thompson spent most of the year with the A-Devils, outside of a three-game stint with New Jersey in January. |
DoD News
News Article
Panetta: Stable Pakistan Relationship Critical to Afghanistan Success
By Donna MilesAmerican Forces Press Service
ABOARD A MILITARY AIRCRAFT, Dec. 12, 2011 Defense Secretary Leon E. Panetta expressed confidence today that the United States and Pakistan can patch up their differences, emphasizing that “ultimately, we can’t win the war in Afghanistan without being able to win in our relationship with Pakistan as well.”
The secretary said restoring the strained relationship with the United States critical to long-term progress in Afghanistan. “I think it is going to be important, as we are able to move and progress in our efforts in Afghanistan, that we continue to do outreach in Pakistan,” he said.
“It is essential to stability in that region that we not only achieve a peaceful resolution with regards to Afghanistan, but that we are able to develop a more stable relationship with Pakistan as well,” he said. “If that region is ever going to find peace, it is going to happen not only by achieving stability in Afghanistan, but also by achieving some degree of stability in Pakistan as well.”
The U.S. relationship with Pakistan has been “difficult and complicated,” Panetta conceded. “But it is an important relationship, and it is one we have to continue to work at.”
The secretary noted that Pakistan has provided important cooperation to the United States. “At the same time, we have had some serious difficulties with regards to some of the operations that involve groups in the FATA [federally administered tribal areas] and groups along the border,” he said.
Strain between the two countries increased after the May 2 raid that took down Osama bin Laden in Pakistan, and intensified after a Nov. 26 engagement near Pakistan’s border with Afghanistan that killed 24 Pakistani soldiers.
U.S. Central Command is conducting a full investigation of the incident, under the leadership of Air Force Brig. Gen. Stephen A. Clark from Air Force Special Operations Command.
“A number of interviews have been conducted,” to determine factors involved in the incident, Panetta said. He expressed hope that the investigation will shed light on “exactly what happened,” but said he has not yet received an update on any findings.
Meanwhile, Panetta said Marine Corps Gen. John Allen, commander of U.S. and ISAF forces in Afghanistan, reports that operations are continuing to secure the border areas.
Even before the border incident, Allen reached out to Pakistani Army Chief of Staff Gen.Ashfaq Parvez Kayani to develop a relationship that would allow the United States and Pakistan to better coordinate and control border-area operations to prevent incidents, he said.
“Obviously what took place has complicated that relationship,” Panetta said. “But I think the effort now is to try to see if we can restore that kind of communication with regards to those border incidents.”
The United States also is working to get Pakistan to reopen ground supply routes into Afghanistan it closed after the border incident. “I am confident that will happen,” Panetta said. “I remain confident that at one point, we are going to be able to restore our normal supply routes.”
For now, Panetta said he’s satisfied that troops have the supplies they need to continue their operations in Afghanistan. “Our command structure has done an incredible job ensuring that one way or another, we are able to get those supplies in,” he said.
And if there’s one thing he said he’s learned, both at CIA and at the Defense Department, it’s the need to continue working at the relationship, even through “bumps in the road” and crises.
“The most important thing is to keep lines of communication open and make sure we do everything we can to restore some degree of a relationship that will allow us to be able to fulfill our mission,” he said.
Panetta emphasized that the mission of confronting terrorism supports both the United States’ and Pakistan’s interests.
“The terrorism that threatens us also threatens them,” he said. “And if we can recognize that, despite our differences, there are some common areas that we share in terms of our security, then I think we can ultimately find a way to resolve our differences and improve our relationship,” he said.
The secretary also spoke about President Barack Obama’s request that Iran return a recovered U.S. RQ-170 drone aircraft to the U.S., saying the request was “appropriate.” However, the secretary admitted that he didn’t “expect that will happen.”
Panetta said it’s difficult to know how much engineering know-how the Iranians will be able to obtain from parts of the downed drone in its possession. “I don’t know the condition of those parts. I don’t know exactly what state they are in,” he said. “So it will be a little difficult to tell exactly what they are going to be able to derive from what they have been able to get.” |
Home Sale Contracts, Number of First-Time Buyers Rise in February 2015
The number of homes under contract to sell in February 2015 increased to their highest level since June 2013, thanks to big gains in the Midwest and West, according to the NATIONAL ASSOCIATION OF REALTORS®.
NAR’s Pending Home Sales Index measures the number of homes that have sold, but haven’t yet made it to the closing table. The index has increased year-over-year for six consecutive months and is above 100 — considered an average level of activity — for the 10th consecutive month.
NAR Chief Economist Lawrence Yun attributes the gains — and the prospect for an uptick in sales in the coming months — to an “improving labor market, mortgage rates hovering around 4%, and the likelihood of more renters looking to hedge against increasing rents.”
The one obstacle, especially for first-time buyers, is the relatively low number of homes for sale, he says.
“Several markets remain highly competitive due to supply pressures, and REALTORS® are reporting severe shortages of move-in ready and available properties in lower price ranges,” Yun says. “The return of first-time buyers this year will depend on how quickly inventory shows up in the market.”
So far the signs are promising for the spring market: The percentage of first-time buyers increased slightly for the first time in February since November 2014, up to 29% from 28% in January.
has been a strategist and editor in the shelter and real estate fields for 12+ years — most recently as content manager for HouseLogic. Her 100-year-old four-square home is always teaching her new things. |
Campitelli
Campitelli is the X rione of Rome, located in Municipio I. Its logo consists of a black dragon's head on a white background. This symbol comes from the legend that Pope Silvester I threw out a dragon staying in the Forum Romanum.
Sites
Campidoglio
Roman Forum
Palatine Hill
Piazze
Piazza del Campidoglio
Piazza Campitelli
Piazza Venezia
Churches
Santa Maria in Aracoeli
Basilica of Santa Francesca Romana
San Bonaventura al Palatino
San Sebastiano al Palatino
Santi Cosma e Damiano
San Lorenzo in Miranda
Santa Maria Antiqua
Santi Luca e Martina
San Giuseppe dei Falegnami
Santa Maria Annunziata a Tor de' Specchi
Santa Maria della Consolazione, Rome
San Teodoro al Palatino
Basilica of Sant'Anastasia al Palatino
San Biagio de Mercato (deconsecrated)
Sant'Adriano al Foro Romano (deconsecrated)
Santa Maria Liberatrice al Foro Romano (destroyed)
Santi Venanzio e Ansovino (destroyed)
Santi Sergio e Bacco al Foro Romano (destroyed)
Musei
Musei Capitolini
Museo centrale del Risorgimento
Edifici
Palazzo Nuovo (Rome)
Palazzo Senatorio
Palazzo dei Conservatori
Ancient Roman Sites
Mamertine Prison
Domus Augustana
Domus Flavia
Domus Severiana
Insula Romana
Curia, Roman Forum
Palace of Domitian
Temple of Antoninus and Faustina
Temple of the Dioscuri
Temple of Divine Julius
Temple of Divine Romulus
Temple of Venus and Rome
Temple of Vesta, Rome
Basilica of Maxentius
Basilica Julia
Arch of Septimus Severus
Arch of Titus
Column of Phocas
External links
History, maps and images of the rione
Category:Rioni of Rome
Category:Rome R. X Campitelli |
PHPerl
Description
PHPerl links a Perl interpreter into the PHP3/4 module for Apache. It provides a PHP
API for managing Perl interpreters and evaluating Perl expressions, plus a package of
Perl subroutines to assist in executing Perl packages in PHP context. |
---
author:
- |
H. He,$^{1}$ P. Bourges,$^{2}$ Y. Sidis,$^{2}$ C. Ulrich,$^{1}$ L.P. Regnault,$^{3}$\
S. Pailhès,$^{2}$ N.S. Berzigiarova,$^{4}$ N.N. Kolesnikov,$^{4}$ B. Keimer$^{1\ast}$\
\
\
\
\
\
\
\
\
title: 'Magnetic Resonant Mode in the Single-Layer High Temperature Superconductor Tl$_2$Ba$_2$Cu$_{6+\delta}$'
---
An unusual spin excitation mode observed by neutron scattering has inspired numerous theoretical studies of the interplay between charged quasiparticles and collective spin excitations in the copper oxide high temperature superconductors. The mode has thus far only been observed in materials with crystal structures consisting of copper oxide bilayers, and it is notably absent in the single-layer compound La$_{2-x}$Sr$_{x}$CuO$_{4+\delta }$. Neutron scattering data now show that the mode is present in Tl$_2$Ba$_2$Cu$_{6+\delta}$, a single-layer compound with T$_c$ $\sim$ 90 K, thus demonstrating that it is a generic feature of the copper oxide superconductors, independent of the layer sequence. This restricts the theoretical models for the origin of the resonant mode and its role in the mechanism of high temperature superconductivity.
Electronic conduction in the copper oxide high temperature superconductors takes place predominantly in structural units of chemical composition CuO$_{2}$, in which copper and oxygen atoms form an approximately square planar arrangement. Most theoretical models of high temperature superconductivity are therefore based on a two-dimensional square lattice. In real materials, however, deviations from this simple situation are nearly always present. For instance, buckling distortions of the CuO$_{2}$ layers that are found in many copper oxides are thought to have a significant influence on the electronic structure and on the superconducting transition temperature $\rm T_{c}$. Interlayer interactions in materials with closely spaced CuO$_{2}$ layers (forming bi- or trilayer units) or additional copper oxide chains in the crystal structure present further complications whose influence on the superconducting properties remains a subject of debate. Experiments on Tl$_{2}$Ba$_{2}$CuO$_{6+\delta }$, a material with unbuckled, widely spaced CuO$_{2}$ layers and a maximum $\rm T_{c}$ around 90 K, have therefore played a pivotal role in resolving some issues central to our understanding of these materials ([*1, 2*]{}). We report inelastic neutron scattering measurements of Tl$_{2}$Ba$_{2}$CuO$_{6+\delta } $ near optimum doping ($\rm
T_{c} \sim 90$ K) that provide evidence of a sharp magnetic resonant mode below $\rm T_{c}$.
A resonant spin excitation of this kind has been extensively characterized by neutron scattering in the bilayer copper oxide YBa$_{2}$Cu$_{3}$O$_{6+\delta }$ ([*3–5*]{}) and was recently also observed in Bi$_{2}$Sr$_{2}$CaCu$_{2}$O$_{8+\delta }$, another bilayer compound ([*6, 7*]{}). At all doping levels, strong line shape anomalies of this collective spin excitation below T${\rm _{c}}$ bear witness to a substantial interaction with charged quasiparticles. Conversely, anomalies in the quasiparticle spectra observed by photoemission ([*8, 9*]{}), optical conductivity ([*10–13*]{}), tunneling ([*13, 14*]{}), and Raman scattering ([*15*]{}) techniques have been interpreted as evidence of coupling to the neutron mode. In the copper oxides (as well as some heavy fermion materials, where similar observation have been made ([*16*]{}) the correspondence between anomalous features in the spectra of spin and charge excitations has stimulated spin fluctuation based pairing scenarios ([*9, 11, 16*]{}) which are, however, still controversial ([*17–19*]{}). Other theories of high temperature superconductivity also rely on the resonant mode ([*20*]{}). It is therefore of great interest to establish whether the resonant spin excitation is a general feature of the various crystallographically distinct families of superconducting copper oxides. The failure to detect such an excitation in the single-layer compound La$_{2-x}$Sr$_{x}$CuO$_{4+\delta }$, despite much experimental effort ([*21*]{}), has hampered a unified phenomenology of the copper oxides, and the prospect that the mode could be a spectral feature specific to bilayer materials has cast a cloud over models in which spin excitations play a central role. The result of our experiment on single-layer Tl$_{2}$Ba$_{2}$CuO$_{6+\delta }$ (whose T${\rm _{c}} \sim 90$ K is closely similar to that of optimally doped YBa$_{2}$Cu$_{3}$O$_{6+\delta }$ and Bi$_{2}$Sr$_{2}$CaCu$_{2}$O$_{8+\delta }$) implies that strong magnetic interactions between closely spaced CuO$_{2}$ layers are not required for the formation of the resonant mode. The different form of the spin excitation spectrum of La$_{2-x}$Sr$_{x}$CuO$_{4+\delta }$ may be due to the proximity of a competing instability ([*22*]{}) that could also be responsible for the anomalously low T${\rm _{c}}\leq $ 40K.
Inelastic magnetic neutron scattering measurements on conventional triple axis or time-of-flight spectrometers require high quality copper oxide single crystals with volumes of at least 1 cm$^{3}$, which are only available for the La$_{2-x}$Sr$_{x}$CuO$_{4+\delta }$ and YBa$_{2}$Cu$_{3}$O$_{6+\delta }$ families. Due to advances in focusing techniques that improve the neutron beam delivery onto small samples, experiments on single crystals of Bi$_{2}$Sr$_{2}$CaCu$_{2}$O$_{8+\delta }$ with an order of magnitude smaller volumes have recently become feasible ([*6, 7*]{}). Unfortunately, the crystal growth of the Tl- and Hg-based copper oxide superconductors (which include the only known single-layer compounds with T${\rm _{c}}$ of order 90 K) has suffered from severe technical difficulties, chief among them the toxicity of some of the constituents. With typical crystal volumes well below 1 mm$^{3}$, inelastic neutron scattering on these compounds has thus far appeared hopeless. We have overcome these difficulties by synthesizing about 300 relatively large (0.5–3 mm$^{3}$) single crystals of Tl$_{2}$Ba$_{2}$CuO$_{6+\delta }$ through a CuO-rich flux technique ([*23*]{}), and co-aligning them in a mosaic of total volume 0.11 cm$^{3}$ using Laue x-ray diffraction (Fig. 1A). The crystallographic axes of the individual crystals in the array were aligned with an accuracy of about 1.5$^{\circ }$ (Fig. 1C). Before alignment, the magnetic susceptibilities of all crystals were measured as a function of temperature (typical data are shown in Fig. 1B). The mean T${\rm _{c}}$ (onset) of the individual crystals used in the array was 92.5 K, with a standard deviation of 2 K.
Compared to previous neutron scattering experiments on much larger crystals of Bi$_{2}$Sr$_{2}$CaCu$_{2}$O$_{8+\delta }$, the background from the Al plates and the adhesive holding the multicrystal array (Fig. 1A) was significantly enhanced, while the signal amplitude is substantially smaller due to the single-layer structure (see below). In order to compensate for this reduction in signal-to-background ratio, counting times of up to 5 hours per data point had to be used. Of particular interest was the energy range around 40 meV, where the resonant mode was observed in both YBa$_{2}$Cu$_{3}$O$_{6+\delta }$ and Bi$_{2}$Sr$_{2}$CaCu$_{2}$O$_{8+\delta }$ near optimum doping. In these two materials, the mode manifests itself in a sharply enhanced intensity around the in-plane wave vector ${\bf Q}_{\rm AF}=(\frac{1}{2},\frac{1}{2})$ that is present only below T${\rm _{c}}$; when the doping is reduced, magnetic intensity is observed also above T${\rm _{c}}$. (The components of the wave vector are denoted as ${\bf
Q}=(H,K,L)$ and given in units of the reciprocal lattice vectors $a^{\ast }=b^{\ast }=1.62$ Å$^{-1}$ and $c^{\ast }=0.27$ Å$^{-1}$ of the tetragonal structure.) As a function of the wave vector component [*L* ]{}perpendicular to the CuO$_{2}$ layers, one observes an intensity modulation due to strong interlayer interactions within a bilayer unit ([*3–7*]{}). As the Tl$_{2}$Ba$_{2}$CuO$_{6+\delta }$ are much further apart and hence much more weakly interacting, it is expected that this modulation is absent, and that the magnetic intensity is independent of [*L*]{} except for a slow decrease with increasing [*L*]{} due to the magnetic form factor. Note that the absence of the bilayer modulation goes along with a factor-of-two reduction in signal amplitude, which is further compounded by the lower density of CuO$_2$ planes in the Tl$_{2}$Ba$_{2}$CuO$_{6+\delta }$ structure.
The constant-energy scans (Fig. 2) indeed exhibit this characteristic signature, albeit at an energy of 47 meV that is somewhat larger than 40 meV, the mode energy in the optimally doped bilayer compounds; constant-energy scans around 40 meV were featureless (Fig. 2D). These data were taken on two different spectrometers with different final energies, with identical results. Above T${\rm _{c}}$, the scans show a featureless background that gradually decreases in an energy- and [**Q**]{}-independent fashion as the temperature is lowered. In the superconducting state, a sharp peak centered at [**Q**]{}$_{\rm AF}$ appears on top of this background. As expected for magnetic scattering that is uncorrelated from layer to layer, the peak intensities measured at two inequivalent [*L*]{}-positions ($L = 10.7$ and $12.25$, respectively) are identical within the errors. The identification of this peak with the magnetic resonant mode is further supported by comparing constant-[**Q**]{} scans at ${\bf Q}={\bf Q}_{\rm AF}$ above and below T${\rm _{c}}$. The difference signal shows a peak that is resolution limited in energy (Fig. 3), in agreement with observations in optimally doped YBa$_{2}$Cu$_{3}$O$_{6+\delta }$.
Constant-energy scans taken at different temperatures were fitted to Gaussian profiles (Fig. 2). The best overall fit was provided by an intrinsic [**Q**]{}-width of 0.23 $\pm$ 0.05 Å$^{-1}$ (full width at half maximum). The data were subsequently refitted with the [**Q**]{}-width kept fixed in order to reduce scatter, and the peak amplitude thus extracted as a function of temperature (Fig. 4). There is some indication of a broad peak centered around [**Q**]{}$_{\rm AF}$ even above T${\rm _{c}}$, as observed in underdoped YBa$_{2}$Cu$_{3}$O$_{6+\delta }$ ([*3-5*]{}), but this is well within the experimental error. Based on a calibration measurement of acoustic phonons (Fig. 1D), the spectral weight of the mode (that is, the energy-integrated intensity) at [**Q**]{}$_{\rm AF}$ is determined as $0.7 \pm 0.25$ $\mu_B^2$, which corresponds to $0.02 \pm 0.007$ $\mu_B^2$ when averaged over the entire Brillouin zone. Both the [**Q**]{}-width and the absolute spectral weight per $\rm CuO_2$ plane of the peak observed in Tl$_{2}$Ba$_{2}$CuO$_{6+\delta }$ are identical within the errors to those of the resonant mode measured in YBa$_{2}$Cu$_{3}$O$_{7}$ ([*4, 24*]{}), as are its dependence on energy and temperature. Although for Tl$_{2}$Ba$_{2}$CuO$_{6+\delta }$ the experimental information is much more limited at this time than for the latter material (large crystals of which have been studied for more than a decade), the cumulation of independent matching features allows us to infer with confidence a common origin of both phenomena. Other possible explanations of the observations in Tl$_{2}$Ba$_{2}$CuO$_{6+\delta
}$ (such as phonon anomalies) would require an implausible coincidence, especially since above ${\rm T_c}$ both the raw constant-energy scans (Fig. 2B) and the raw constant-[**Q**]{} scans around 47 meV (Fig. 3A) are featureless.
It is interesting to note that the resonant modes of both YBa$_{2}$Cu$_{3}$O$_{7}$ and Tl$_{2}$Ba$_{2}$CuO$_{6+\delta }$ are resolution limited in energy whereas a significant broadening is found in Bi$_{2}$Sr$_{2}$CaCu$_{2}$O$_{8+\delta }$ ([*6, 7*]{}). As even small concentrations of impurities systematically introduced into YBa$_{2}$Cu$_{3}$O$_{7}$ broaden the mode considerably ([*24, 25*]{}), the broadening in Bi$_{2}$Sr$_{2}$CaCu$_{2}$O$_{8+\delta
}$ was attributed to disorder. The sharpness of the mode observed in optimally doped Tl$_{2}$Ba$_{2}$CuO$_{6+\delta }$ appears to imply that disorder effects are minimal in this material, a surprising finding in view of the fact that Tl$_{2}$Ba$_{2}$CuO$_{6+\delta }$ (in contrast to YBa$_{2}$Cu$_{3}$O$_{7}$) is nonstoichiometric. It also means that the model of Refs. ([*11, 12*]{}), though qualitatively correct in predicting the presence of a resonant spin excitation in Tl$_{2}$Ba$_{2}$CuO$_{6+\delta }$, needs to be re-evaluated in view of the fact that the experimentally determined peak width is much smaller than predicted on the basis of the optical conductivity data. The mode energy found in Tl$_{2}$Ba$_{2}$CuO$_{6+\delta }$ notably exceeds the ones in both YBa$_{2}$Cu$_{3}$O$_{7}$ and Bi$_{2}$Sr$_{2}$CaCu$_{2}$O$_{8+\delta }$. This is in agreement with models according to which the resonant mode is a collective excitation pulled below the quasiparticle pair production continuum by exchange interactions ([*8, 9, 26–29*]{}). The lower mode energy in the bilayer materials could thus be a consequence of the strong interactions between the two CuO$_{2}$ layers that form a bilayer unit ([*26–29*]{}), assuming that the energy gap and hence the pair production threshold are identical in materials with identical T${\rm _{c}}$ as indicated by electronic Raman scattering results ([*30*]{}).
The most important implication of the findings reported here regards the unified phenomenological picture recently developed for spin and charge spectroscopies of the copper oxides ([*8–14*]{}). The spectral anomalies that have been interpreted as evidence of coupling to the collective spin excitation are also present in optical conductivity ([*31*]{}) and tunneling ([*32*]{}) data on single-layer Tl$_{2}$Ba$_{2}$CuO$_{6+\delta }$, and equally pronounced as in analogous data on bilayer materials. If the mode had turned out to be absent (or its spectral weight substantially diminished) in Tl$_{2}$Ba$_{2}$CuO$_{6+\delta }$, this general approach would have become untenable. It is now time to further refine the description of the coupled spin and charge excitations in the cuprates, and to fully evaluate its implications for the mechanism of high temperature superconductivity.
[**References and Notes**]{}
1. C.C. Tsuei [*et al.*]{}, [*Nature*]{} [**387**]{}, 481 (1997).
2. A.A. Tsvetkov [*et al.*]{}, [*Nature*]{} [**395**]{}, 360 (1998).
3. P. Bourges in [*The Gap Symmetry and Fluctuations in High Temperature Superconductors*]{} (eds. J. Bok, G. Deutscher, D. Pavuna and S.A. Wolf) 349 (Plenum Press, New York, 1998), and references therein.
4. H.F. Fong [*et al*]{}., [*Phys. Rev. B*]{} [**61**]{}, 14773 (2000), and references therein.
5. P. Dai, H.A. Mook, R.D. Hunt, F. Dogan, [*Phys. Rev. B*]{} [**63**]{}, 054525 (2001), and references therein.
6. H.F. Fong [*et al.*]{}, [*Nature*]{} [**398**]{}, 588 (1999).
7. H. He [*et al.*]{}, [*Phys. Rev. Lett.*]{} [**86**]{}, 1610 (2001).
8. M. Eschrig, M.R. Norman, [*Phys. Rev. Lett*]{}. [**85**]{}, 3261 (2000), and references therein.
9. A. Abanov, A.V. Chubukov, [*Phys.Rev. Lett.*]{} [**83**]{}, 1652 (1999).
10. D. Munzar, C. Bernhard, M. Cardona, [*Physica C*]{} [**318**]{}, 547 (1999).
11. J.P. Carbotte, E. Schachinger, D.N. Basov, [*Nature*]{} [**401**]{}, 354 (1999).
12. E. Schachinger, J.P. Carbotte, [*Phys. Rev. B*]{} [**62**]{}, 9054 (2000).
13. D. Manske, I. Eremin, K.H. Bennemann, [*Phys. Rev. B*]{} [**63**]{}, 054517 (2001).
14. J.F. Zasadzinski [*et al.,* ]{} [*Phys. Rev. Lett.*]{} [**87**]{}, 067005 (2001).
15. F. Venturini, U. Michelucci, T.P. Devereaux, A.P. Kampf, [*Phys. Rev. B*]{} [**62**]{}, 15204 (2000).
16. N.K. Sato [*et al.*]{}, [*Nature*]{} [**410**]{}, 340 (2001).
17. R. Zeyher, A. Greco, [*Phys. Rev. B*]{} [**64**]{}, 140510 (2001).
18. A. Lanzara [*et al.*]{}, [*Nature*]{} [**412**]{}, 510 (2001).
19. H.-Y. Kee, S.A. Kivelson, G. Aeppli, preprint cond-mat/0110478 (unpublished).
20. S.C. Zhang, [*Science*]{} [**275**]{}, 1089 (1997).
21. M.A. Kastner, R.J. Birgeneau, G. Shirane, Y. Endoh, [*Rev. Mod. Phys.*]{} [**70**]{}, 897 (1998), and references therein.
22. J.M. Tranquada, B.J. Sternlieb, J.D. Axe, Y. Nakamura, S. Uchida, [*Nature*]{} [**375**]{}, 561 (1995).
23. N.N. Kolesnikov [*et al.*]{}, [*Physica C*]{} [**242**]{}, 385 (1995).
24. H.F. Fong [*et al.*]{}, [*Phys. Rev. Lett.*]{} [**82**]{}, 1939 (1999).
25. Y. Sidis [*et al.*]{}, [ *Phys. Rev. Lett.*]{} [**84**]{}, 5900 (2000).
26. I.I. Mazin, V.M. Yakovenko, [*Phys. Rev. Lett.*]{} [**75**]{}, 4134 (1995).
27. D.Z. Liu, Y. Zha, K. Levin, [*Phys. Rev. Lett.*]{} [**75**]{}, 4130 (1995).
28. A.J. Millis, H. Monien, [*Phys. Rev. B*]{} [**54**]{}, 16172 (1996).
29. F. Onufrieva, P. Pfeuty, preprint cond-mat/9903097 (unpublished).
30. L.V. Gasparov, P. Lemmens, M. Brinkmann, N.N. Kolesnikov, G. Güntherodt, [*Phys. Rev. B*]{} [**55**]{}, 1223 (2000).
31. A.V. Puchkov, P. Fournier, T. Timusk, N.N. Kolesnikov, [*Phys. Rev. Lett.*]{} [**77**]{}, 1853 (1996).
32. L. Ozyuzer [*et al.*]{}, [*Physica C*]{} [**320**]{}, 9 (1999).
33. We would like to thank Bernard Hennion for his support during the LLB experiment and Patrick Baroni for technical assistance. The work at the Institute for Solid State Physics was supported in part by the Russian Foundation for Basic Research. The work at the MPI-FKF was supported in part by the German Federal Ministry of Research and Technology (BMFT).
[**Figure Captions**]{}
[**Fig. 1.**]{} (A) Photograph of the array of co-oriented Tl$_{2}$Ba$_{2}$CuO$_{6+\delta }$ single crystals. The crystals are glued onto Al plates only two of which are shown for clarity. (B) Typical diamagnetic shielding curves measured by SQUID magnetometry on individual crystals. (C) Rocking curve of the entire multicrystal array around the (1,1,0) Bragg reflection. The line is a Gaussian with a full width at half maximum of 1.5$^\circ$. (D) Constant-energy scan along ${\bf Q}=(2,2,L)$ at excitation energy 3.1 meV and temperature 100 K, showing two counterpropagating transverse acoustic phonons. The wave vector [**Q**]{} is given in reciprocal lattice units (r.l.u.). The data were taken at the 2T1 triple axis spectrometer at the Orphée research reactor in Saclay, France, with a pyrolytic graphite (PG) monochromator and a PG analyser set at the (002) reflection, and a fixed final energy of 14.7 meV. Three PG filters were inserted into the neutron beam in order to eliminate higher order contamination. The asymmetry of the profile is a resolution effect, and the solid line shows the result of a numerical convolution of a standard acoustic phonon dispersion with the spectrometer resolution.
[**Fig. 2.**]{} (A,B) Constant-energy scans along ${\bf
Q}=(H,H,L)$ with $L=10.7$ at an energy of 47.5 meV, taken on 2T under the same conditions as the data of Fig. 1D. (C,D) Constant-energy scans at 47 and 40 meV, respectively, taken on the IN22 spectrometer at the Institut Laue-Langevin in Grenoble, France, with a PG (002) monochromator and analyser and fixed final energy 30.5 meV. The wave vector [**Q**]{} is given in reciprocal lattice units (r.l.u.). The background revealed by scans above $\rm T_c$ (panel B) remained constant upon lowering the temperature except for a [**Q**]{}-independent scale factor. The lines in the upper panels are the results of fits as described in the text.
[**Fig. 3.**]{} Constant-[**Q**]{} scans at ${\bf
Q}=(0.5,0.5,12.25)$ taken under the same conditions as the data of Fig. 1D. (A) Raw data at $\rm T =99 K$ ($\rm > T_c$) and $\rm
T=27$ K ($\rm < T_c$). (B) Difference between the two scans of panel A. The line is a Gaussian profile whose width equals the experimental energy resolution.
[**Fig. 4.**]{} Temperature dependence of the magnetic intensity extracted from fits to constant-energy scans at energy 47.5 meV around the in-plane wave vector ${\bf Q_{AF}}=(1/2,1/2)$ (Fig. 2). The data were taken on two different spectrometers (2T and IN22) at different components of the out-of-plane wave vector $L$.
|
NEW YORK (Reuters) - Global stock markets tumbled on Monday and the Chinese yuan weakened to its lowest level since December as the trade war between the United States and China escalated.
Traders work on the floor at the New York Stock Exchange (NYSE) in New York, U.S., May 13, 2019. REUTERS/Brendan McDermid
MSCI’s gauge of stocks across the globe shed 1.90%, its biggest one-day drop in more than five months as it touched a two-month low. Wall Street’s main indexes tumbled more than 2%.
China said it would impose higher tariffs on a range of U.S. goods, striking back in its trade war with Washington shortly after President Donald Trump warned it not to retaliate in the long-running trade dispute between the world’s two biggest economies. Trump said he would meet with Chinese President Xi Jinping next month.
Investors piled into safe-haven assets, including U.S. Treasuries and the Japanese yen.
“It’s clear that there is a lot of nervousness around the U.S.-China trade negotiations and concern that it’s really deteriorating pretty significantly and that’s impacting all areas of markets,” said Kristina Hooper, chief global market strategist at Invesco in New York.
China’s finance ministry said it plans to set import tariffs ranging from 5 percent to 25 percent on a target list worth about $60 billion. Trump on Friday ordered his trade chief to begin the process of imposing tariffs on all remaining imports from China, but investors had taken solace in some comments from officials about the negotiations.
“The market thought it was positioning and at the end of the day there would be a deal and that over the weekend they would work things out and that is clearly not the way this thing is going,” said Paul Mendelsohn, chief investment strategist at Windham Financial Services in Charlotte, Vermont.
Slideshow ( 2 images )
On Monday, the Dow Jones Industrial Average fell 617.38 points, or 2.38%, to 25,324.99, the S&P 500 lost 69.53 points, or 2.41%, to 2,811.87 and the Nasdaq Composite dropped 269.92 points, or 3.41%, to 7,647.02.
“The market has been looking around for an excuse to correct. We were straight up from Christmas,” said Paul Nolte, portfolio manager at Kingsview Asset Management in Chicago. “We now have an excuse to have a correction.”
The pan-European STOXX 600 index lost 1.21%.
In currencies, the yuan weakened to as far as 6.92 against the U.S. dollar, its lowest level since Dec. 24.
The dollar index, which measures the greenback against a basket of currencies, was flat, with the euro down 0.04% to $1.1228.
U.S. Treasury yields fell to six-week lows as investors piled into low-risk assets.
Benchmark 10-year notes last rose 15/32 in price to yield 2.4015%, from 2.455% late on Friday.
Ten-year yields fell below those on three-month Treasury bills. A sustained inversion of this part of the yield curve has preceded every U.S. recession in the past 50 years.
Spot gold added 1.1% to $1,299.72 an ounce.
Oil futures fell as worries about the trade talks spooked investors who had initially sent oil higher on concerns that tanker attacks in the Middle East could disrupt supplies.
U.S. crude settled down 1% at $61.04 a barrel, while Brent settled at $70.23 a barrel, down 0.55%. |
Q:
LibGDX - Image width is not set to resetting to zero when full width
I am making a progress bar for showing the players current experience. However I have come around to a bug, which appears when the player is maxing out his experience and then is getting a new level. In the ideal world my code should reset the progress bar image width (which is a Scene2D image btw), but for some reason it is not setting the image width to zero, but is setting it to its full width instead, which I can't seem to understand why. I hope anyone can help me.
I have provided my code below, and also uploaded a video on youtube with my bug - Video of the bug
The method below is the one I use to change the experience progress bar width as well as the experience.
public void changeLevelExperience(int gainedExperience) {
float maxExpDividedInPixels = 131f / this.GAME.gameScreen.getGameManager().maxExperience;
this.GAME.gameScreen.getGameManager().currentExperience += gainedExperience;
if (this.GAME.gameScreen.getGameManager().currentExperience >= this.GAME.gameScreen.getGameManager().maxExperience) {
this.GAME.gameScreen.getGameManager().currentLevel++;
this.currentLevelLabel.setText(this.GAME.gameScreen.getGameManager().currentLevel + "");
//TODO: Another arrangement for the experience needs to be made.
this.GAME.gameScreen.getGameManager().maxExperience += 35;
this.GAME.gameScreen.getGameManager().currentExperience = 0;
Gdx.app.debug(TAG, this.GAME.gameScreen.getGameManager().currentExperience + "");
}
this.levelProgressBar.setWidth((int) (maxExpDividedInPixels * this.GAME.gameScreen.getGameManager().currentExperience * this.scaleFactor));
}
A:
I haven't personally used ProgressBar yet, but it looks like the right way to set the current percentage is using setValue(float), not setWidth(float). I'd start with that.
Also, saving your GameManager object in a local variable instead of writing this.GAME.gameScreen.getGameManager() 10 times will make the code a lot more legible ;)
A:
I found the bug. It was with some help from people at a facebook group. :)
The bug occours, because my Scene2D Image (the level progress bar) was a child of a scene2D Table. And the Table was initially set to have a column width to the width of the image, when it was at its largest size. This width was now set to zero, as I have done in the code below.
table.add(this.levelProgressBar).width(0 * this.scaleFactor).height(10 * this.scaleFactor);
Apparently the Image width is reset to the tables column width,when it is set to the width of zero.
Thank you all which tried to help me. It was really appreciated :)
|
Come October 17, weed will be legal in Canada. But that doesn’t mean it’s going to be available everywhere.
While some provinces, including Ontario, simply won’t have a brick-and-mortar retail scheme set up by that deadline, other municipalities have opted to ban weed shops outright.
Markham and Richmond Hill in Ontario, and Richmond, the city of North Vancouver, West Vancouver, Tofino, Abbotsford, Pitt Meadows and Whistler in BC, have decided not to allow pot shops in their jurisdictions. Canadians who live in areas that don’t sell pot will have to use a mail order system, similar to how medical cannabis is provided now.
Ontario Premier Doug Ford, who reversed former premier Kathleen Wynne’s plan for a provincial monopoly on pot sales, has given municipalities the opportunity to opt out of hosting a retail weed store. Stores will be set up by April 2019.
Speaking to CTV News, Richmond Hill Mayor David Barrow said he is taking up the premier on that offer.
Richmond, BC, meanwhile has come out strong against pot legalization. Last fall, it asked the province to grant it powers to allow tight control of consumption within its borders.
"This is a suburb. We're not the heavy duty nightlife of Downtown Vancouver and the action-packed thrill of adventure of Surrey. In Richmond, we tend to live a more conservative lifestyle," said Councillor Carol Day, according to a CBC News report at the time. Meanwhile, Councillor Derek Dang said weed is a gateway drug that could lead to fentanyl use.
“If you became an alcoholic, I don’t think you would start drinking the hard stuff first. You drink a beer then work your way up. We’ve already got drug problems with fentanyl, and it could be problematic,” he told Richmond News. The claim that weed is a gateway drug has been repeatedly debunked.
In other places, such as Tofino, West Van and Pitt Meadows, it seems the ban is a temporary measure to allow municipalities to come up with their own regulations around pot sales. And municipal elections, which take place in October across BC, could change things.
Cannabis lawyer Jack Lloyd told VICE it’s “ridiculous” to allow municipalities to dodge implementing federal legislation.
“Closed communities will push things back underground, which is the exact opposite of what the purpose of legalization is,” he said.
Lloyd said the reason municipalities are banning cannabis sales boils down to reefer madness, especially when you consider all of these jurisdictions sell liquor.
“It is a stigma tied to the very roots of cannabis prohibition in the first place—a rejection of cannabis, which is associated with criminality and persons of colour, and an explicit acceptance of alcohol which is homogenized and controlled largely by white European Canadians.”
Lloyd said it’s possible medical cannabis patients living in areas with no weed stores will be able to challenge the lack of access.
Sign up for the VICE Canada Newsletter to get the best of VICE Canada delivered to your inbox. |
Tag Archives: Unitization
Unitized Load: one or more products or packaged-products usually on a skid or pallet, but always secured together or restrained for distribution as a single load.1
For this first post we wanted to start basic, very basic, to build the context of what we’re trying to achieve when we stretch wrap a load. Why do we unitize loads? What are our goals? Why do we do what we do?
We all want to save money, but very often saving money in the short term can create larger hidden costs which continue to take a toll until they’re discovered and corrected.
We unitize to make shipping and handling more efficient, and at the lowest total cost. Total cost not only includes packaging, but labor, damages, and several other factors that need to be considered when unitizing your load.
Before unitization was a concept in packaging, every box or product needed to be handled individually for shipping , and it wasn’t unusual for a truckload or railcar of product to take up to three days to unload, and sometimes longer.2 The introduction of unitization made this handling process much more efficient, saving time and money. Pallets gained widespread use during WWII, where it’s easy to imagine the advantages of saving 20+ man hours per railcar of supplies being shipped, this allowed the military to use their service members for more important tasks and bigger benefits. 2 It’s hard not draw a comparison with today’s competitive marketplace, where each company needs to take full advantage of their personnel’s capabilities and become more adept at increasing efficiency than ever before.
One of the biggest killers of efficiency is damage. A damaged load costs many times the packaging and shipping costs proper handling, and degrades a company’s reputation.
Damage is preventable, but a focus on lowering packaging costs rather than creating a successful system has lead to higher and higher damage rates. Today the average North American company spends 4 to 5 times more in product damages than they spend on stretch film each year.3, 4
The way to prevent damage and create good systems is simple: focus on the basics. When making changes to save on packaging and shipping costs, test the new system and evaluate for success.
In future blog articles we’ll discuss how to test for success, the building blocks of creating a successful system, and tips for making systematic improvements. |
Q:
python 3.5 32 bit windows import module fails but pip install worked
new to python installed python 3.5 32-bit on windows 10, used pip to install a module
C:\Users\Lopez\Anaconda3\Scripts>pip install ystockquote
Requirement already satisfied (use --upgrade to upgrade): ystockquote in c:\users\lopez\anaconda3\lib\site-packages
You are using pip version 7.1.2, however version 8.1.2 is available.
You should consider upgrading via the 'python -m pip install --upgrade pip' command.
when I go to the IDLE and try the following I get a no module name
import ystockquote
Traceback (most recent call last):
File "", line 1, in
import ystockquote
ImportError: No module named 'ystockquote'
not sure what i am missing, guess its path related but appreciate any feedback
thanks, Juan
A:
thanks for your help guys,
I beleive the issues where with adding paths to my environment variables not the version of pip. I managed to get this working using the window pip install once i installed python 3 in a custom directory C:\Python35 rather than the deafault long windows suggested path
Instructions
In the Control Panel, search for Environment; click Edit the System Environment Variables. Then click the Environment Variables button.
In the User Variables section, we will need to either edit an existing PATH variable or create one. If you are creating one, make PATH the variable name and add the following directories to the variable values section as shown, separated by a semicolon. If you’re editing an existing PATH, the values are presented on separate lines in the edit dialog. Click New and add one directory per line.
C:\Python35-32;C:\Python35-32\Lib\site-packages\;C:\Python35-32\Scripts\
|
The Unemployment News is Still Disastrous, But It Doesn’t Matter Anymore
Jan 4, 2013
RUSH: Unemployment. We had this news. Normally, back during the campaign, we would have led with this news. But it doesn’t matter anymore. At least, it’s not of paramount importance, because we extended unemployment benefits. So the number of people unemployed really is irrelevant, other than as an interesting discussion item. And the basic numbers are these. “U.S. employers added 155,000 jobs in December,” And AP says that’s “a steady gain that shows hiring held up during the tense negotiations to resolve the fiscal cliff,” in Washington.
But it’s not a steady gain. It isn’t even enough to keep up with the increase in population. 155,000 jobs a month is pathetic. Joe Biden promised that we’d be hiring at a rate of 500,000 jobs a month in April of 2010 if we did the stimulus. We aren’t even keeping up with our birthrate. Future job seekers, we’re not even staying even, much less creating new jobs that would actually reduce unemployment.
Then the AP says, “The solid growth –” There is not any solid growth, folks. But they say, “The solid job growth wasnÂ’t enough to reduce the unemployment rate, which remained 7.8%.” Now, that is outright mendacity. The unemployment rate in December, as reported, was 7.7%. The revised rate was 7.8%. You know, they report the unemployment rate one week, and a week or two later they revise it, and that’s when you get the real number which is never reported. The same thing with the number of applications for unemployment. It’s always revised, and the revision is always higher.
So just to show you the media dishonesty here, the reported unemployment rate in November was 7.7%. The reported unemployment rate in December, 7.8%. So we went up, 7.7% to 7.8%. However, AP says it stayed the same. How’s that? Well, the 7.7% in November was revised to 7.8%, but that wasn’t reported because it would not make Obama look good. So nobody knew that the real unemployment rate was 7.8%. What was reported was 7.7%. And AP did not report the revision.
So now the rate for December is 7.8%, and AP says it “stayed the same.” So they’re using the revised number that nobody reported. They never do this. Never! They never report the revised number. All of this, still, is to make Obama look good. The fact of the matter is, the 7.8% is gonna be revised upward, and it’s gonna be 7.9% or 8% in a couple of weeks, but it won’t be reported.
The bottom line/take-away is that we’re not making a dent in unemployment. Now, internals. “Government unemployment numbers for December showed that while the general unemployment rate remained flat at 7.8%,” which, again, is a crock, “unemployment for women and African-Americans rose despite an economy that created 155,000 jobs. Unemployment for women rose to 7.3% in December from 7.0% while the rate for African-Americans rose sharply to 14.0% from 13.2% in November.”
Now, this is from Cybercast News Service. This is not reported in the mainstream media. The mainstream media, AP (paraphrased), “Wow, the economy’s still growing! It added 155,000 jobs! The unemployment rate stayed the same!” For women and blacks, the unemployment circumstance got worse. For youth unemployment? You ready for this? “The dismal jobs situation in America is even worse for young adults, who are suffering an unemployment rate 30% higher than the national average of 7.8%..
“According to Generation Opportunity, which charts unemployment for Millennials aged 18-29,” your kids, “the rate is 11.5% and a shocking 22.1% for younger black Americans.” But AP and the Obama State-Controlled Media are reporting 155,000 jobs and an unchanged 7.8% unemployment rate. But it’s up for women and minorities and really up for young people, particularly black young people where it’s 22%. It’s not reported. It’s there. You can find it. It’s just not being reported by the Drive-Bys.
So it’s getting worse, it isn’t improving — and, by the way, this is the only thing that can happen. We can’t create jobs because we’re taking money out of the private sector. When Obama starts raising taxes and fees and Obamacare kicks in, that’s just money out of everybody’s back pocket, including people that own businesses. When they have less money, there’s less money to grow businesses, or hire new people — or, in some cases, even stay open. It just isn’t mathematically possible to create jobs with an administration that’s taking so much money out of the economy.
Not possible.
What’s happening is the only thing that can happen with current administration policies. |
The country’s first post-independence leader dies nearly two years after he stepped down, following 37 years in office.
Former Zimbabwe President Robert Mugabe has died at the age of 95, President Emmerson Mnangagwa said.
“It is with the utmost sadness that I announce the passing on of Zimbabwe’s founding father and former President, Cde Robert Mugabe,” Mnangagwa posted on Twitter early on Friday.
“Mugabe was an icon of liberation, a pan-Africanist who dedicated his life to the emancipation and empowerment of his people. His contribution to the history of our nation and continent will never be forgotten.
“May his soul rest in eternal peace,” he added.
President Mnangagwa cut short his trip to South Africa where he was attending the World Economic Forum on Africa and is heading back to Zimbabwe, according to state media.
180413121700120
Mugabe was hospitalised in Singapore for months for an undisclosed ailment, Mnangagwa had confirmed earlier this year.
Officials often said he was being treated for a cataract, denying frequent private media reports that he had prostate cancer.
No further details were immediately available about the circumstances of his death or where he died.
Mugabe was forced to step down by the military in November 2017 following nationwide mass protests.
Mugabe enjoyed acceptance among peers in Africa who chose not to judge him in the same way as the UK, US and other Western detractors [Grant Lee Neuenburg/Reuters]
The former political prisoner-turned-guerrilla leader swept to power in the 1980 elections after a growing rebellion and economic sanctions forced the white minority colonial government to the negotiating table.
190906064218925
Born on February 21, 1924, into a Catholic family at Kutama Mission northwest of Harare, Mugabe was described as a loner and a studious child, known to carry a book even while tending cattle in the bush.
After his carpenter father left the family when he was 10, the young Mugabe concentrated on his studies, qualifying as a schoolteacher at the age of 17.
Education for blacks
Al Jazeera’s correspondent Haru Mutasa, reporting from Johannesburg, South Africa, said many credit Mugabe with the country’s high literacy rate.
“As a former teacher, he really tried to make sure as many blacks as possible got education when he came to power. He is credited for one of the highest literacy rates on the continent,” Mutasa said.
“Meanwhile, many others blame him for the things that have gone wrong in Zimbabwe. Many blame him for ruining what was ones a prosperous economy,” she added.
Earnest Mudzengi, political analyst based in Harare, says the former leader leaves behind a mix legacy.
“Young Zimbabweans will remember him as a tryant who squandered their futures and destroyed their countries,” Mudzengi told Al Jazeera.
“Many older Zimbabweans will look back in history and will remember him as a revolutionary fighter. They will also remember him for the early years of independence the massive social programs like expansion in the education sector and the building of clinics in rural areas,” he added.
During his 10 years in prison, Mugabe gained three degrees through correspondence [Howard Burditt/Reuters]
An intellectual who initially embraced Marxism, he enrolled at Fort Hare University in South Africa, meeting many of Southern Africa’s future black nationalist leaders.
After teaching in Ghana, where he was influenced by its founder, President Kwame Nkrumah, Mugabe returned to what was then Rhodesia, where he was imprisoned for his nationalist activities in 1964 and spent the next 10 years in prison camps or jail.
171115094122605
During his incarceration, he gained three degrees through correspondence, but the years in prison were wrenching.
Mugabe’s four-year-old son by his first wife, Ghanaian-born Sally Francesca Hayfron, died while he was behind bars. Rhodesian leader Ian Smith denied him leave to attend the funeral.
He once famously said that he’d rule his country until he turned 100, and many expected him to die in office.
But growing discontent about the southern African country’s fractured leadership and other problems prompted a military intervention, impeachment proceedings by the parliament and large street demonstrations for his removal.
Mugabe’s decline
The announcement of Mugabe’s November 21, 2017 resignation after he initially ignored escalating calls to quit triggered wild celebrations in the streets of the capital, Harare.
Mugabe’s decline in his last years as president was partly linked to the political ambitions of his wife, Grace, a brash, divisive figure whose ruling party faction eventually lost out in a power struggle with supporters of Mnangagwa, who was close to the military.
Despite Zimbabwe’s decline during his rule, Mugabe remained defiant, railing against the West for what he called its neo-colonialist attitude and urging Africans to take control of their resources, a populist message that was often a hit even as many nations on the continent shed the strongman model and moved towards democracy.
Mugabe enjoyed acceptance among peers in Africa who chose not to judge him in the same way as the United Kingdom, the United States and other Western detractors.
Towards the end of his rule, he served as rotating chairman of the 54-nation African Union and the 15-nation Southern African Development Community; his criticism of the International Criminal Court was welcomed by regional leaders who also thought it was being unfairly used to target African leaders. |
/* Filesystem notifications support with glib API.
Copyright (C) 2013-2020 Free Software Foundation, Inc.
This file is part of GNU Emacs.
GNU Emacs is free software: you can redistribute it and/or modify
it under the terms of the GNU General Public License as published by
the Free Software Foundation, either version 3 of the License, or (at
your option) any later version.
GNU Emacs is distributed in the hope that it will be useful,
but WITHOUT ANY WARRANTY; without even the implied warranty of
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
GNU General Public License for more details.
You should have received a copy of the GNU General Public License
along with GNU Emacs. If not, see <https://www.gnu.org/licenses/>. */
#include <config.h>
#include <gio/gio.h>
#include "lisp.h"
#include "coding.h"
#include "termhooks.h"
#include "keyboard.h"
/* This is a list, elements are quadruples (DESCRIPTOR FILE FLAGS CALLBACK) */
static Lisp_Object watch_list;
/* This is the callback function for arriving signals from
g_file_monitor. It shall create a Lisp event, and put it into
Emacs input queue. */
static gboolean
dir_monitor_callback (GFileMonitor *monitor,
GFile *file,
GFile *other_file,
GFileMonitorEvent event_type,
gpointer user_data)
{
Lisp_Object symbol, monitor_object, watch_object, flags;
char *name = g_file_get_parse_name (file);
char *oname = other_file ? g_file_get_parse_name (other_file) : NULL;
/* Determine event symbol. */
switch (event_type)
{
case G_FILE_MONITOR_EVENT_CHANGED:
symbol = Qchanged;
break;
case G_FILE_MONITOR_EVENT_CHANGES_DONE_HINT:
symbol = Qchanges_done_hint;
break;
case G_FILE_MONITOR_EVENT_DELETED:
symbol = Qdeleted;
break;
case G_FILE_MONITOR_EVENT_CREATED:
symbol = Qcreated;
break;
case G_FILE_MONITOR_EVENT_ATTRIBUTE_CHANGED:
symbol = Qattribute_changed;
break;
case G_FILE_MONITOR_EVENT_PRE_UNMOUNT:
symbol = Qpre_unmount;
break;
case G_FILE_MONITOR_EVENT_UNMOUNTED:
symbol = Qunmounted;
break;
case G_FILE_MONITOR_EVENT_MOVED:
symbol = Qmoved;
break;
default:
goto cleanup;
}
/* Determine callback function. */
monitor_object = make_pointer_integer (monitor);
watch_object = assq_no_quit (monitor_object, watch_list);
if (CONSP (watch_object))
{
struct input_event event;
Lisp_Object otail = oname ? list1 (build_string (oname)) : Qnil;
/* Check, whether event_type is expected. */
flags = XCAR (XCDR (XCDR (watch_object)));
if ((!NILP (Fmember (Qchange, flags))
&& !NILP (Fmember (symbol, list5 (Qchanged, Qchanges_done_hint,
Qdeleted, Qcreated, Qmoved))))
|| (!NILP (Fmember (Qattribute_change, flags))
&& EQ (symbol, Qattribute_changed)))
{
/* Construct an event. */
EVENT_INIT (event);
event.kind = FILE_NOTIFY_EVENT;
event.frame_or_window = Qnil;
event.arg = list2 (Fcons (monitor_object,
Fcons (symbol,
Fcons (build_string (name),
otail))),
XCAR (XCDR (XCDR (XCDR (watch_object)))));
/* Store it into the input event queue. */
kbd_buffer_store_event (&event);
/* XD_DEBUG_MESSAGE ("%s", XD_OBJECT_TO_STRING (event.arg)); */
}
/* Cancel monitor if file or directory is deleted. */
if (!NILP (Fmember (symbol, list2 (Qdeleted, Qmoved)))
&& strcmp (name, SSDATA (XCAR (XCDR (watch_object)))) == 0
&& !g_file_monitor_is_cancelled (monitor))
g_file_monitor_cancel (monitor);
}
/* Cleanup. */
cleanup:
g_free (name);
g_free (oname);
return TRUE;
}
DEFUN ("gfile-add-watch", Fgfile_add_watch, Sgfile_add_watch, 3, 3, 0,
doc: /* Add a watch for filesystem events pertaining to FILE.
This arranges for filesystem events pertaining to FILE to be reported
to Emacs. Use `gfile-rm-watch' to cancel the watch.
Value is a descriptor for the added watch. If the file cannot be
watched for some reason, this function signals a `file-notify-error' error.
FLAGS is a list of conditions to set what will be watched for. It can
include the following symbols:
`change' -- watch for file changes
`attribute-change' -- watch for file attributes changes, like
permissions or modification time
`watch-mounts' -- watch for mount events
`send-moved' -- pair `deleted' and `created' events caused by
file renames and send a single `renamed' event
instead
When any event happens, Emacs will call the CALLBACK function passing
it a single argument EVENT, which is of the form
(DESCRIPTOR ACTION FILE [FILE1])
DESCRIPTOR is the same object as the one returned by this function.
ACTION is the description of the event. It could be any one of the
following:
`changed' -- FILE has changed
`changes-done-hint' -- a hint that this was probably the last change
in a set of changes
`deleted' -- FILE was deleted
`created' -- FILE was created
`attribute-changed' -- a FILE attribute was changed
`pre-unmount' -- the FILE location will soon be unmounted
`unmounted' -- the FILE location was unmounted
`moved' -- FILE was moved to FILE1
FILE is the name of the file whose event is being reported. FILE1
will be reported only in case of the `moved' event. */)
(Lisp_Object file, Lisp_Object flags, Lisp_Object callback)
{
Lisp_Object watch_object;
GFile *gfile;
GFileMonitor *monitor;
GFileMonitorFlags gflags = G_FILE_MONITOR_NONE;
GError *gerror = NULL;
/* Check parameters. */
CHECK_STRING (file);
file = Fdirectory_file_name (Fexpand_file_name (file, Qnil));
if (NILP (Ffile_exists_p (file)))
report_file_error ("File does not exist", file);
if (!FUNCTIONP (callback))
wrong_type_argument (Qinvalid_function, callback);
/* Assemble flags. */
if (!NILP (Fmember (Qwatch_mounts, flags)))
gflags |= G_FILE_MONITOR_WATCH_MOUNTS;
if (!NILP (Fmember (Qsend_moved, flags)))
gflags |= G_FILE_MONITOR_SEND_MOVED;
/* Create GFile name. */
gfile = g_file_new_for_path (SSDATA (ENCODE_FILE (file)));
/* Enable watch. */
monitor = g_file_monitor (gfile, gflags, NULL, &gerror);
g_object_unref (gfile);
if (gerror)
{
char msg[1024];
strcpy (msg, gerror->message);
g_error_free (gerror);
xsignal1 (Qfile_notify_error, build_string (msg));
}
if (! monitor)
xsignal2 (Qfile_notify_error, build_string ("Cannot watch file"), file);
Lisp_Object watch_descriptor = make_pointer_integer_unsafe (monitor);
if (! (FIXNUMP (watch_descriptor)
&& XFIXNUMPTR (watch_descriptor) == monitor))
{
g_object_unref (monitor);
xsignal2 (Qfile_notify_error, build_string ("Unsupported file watcher"),
file);
}
/* The default rate limit is 800 msec. We adapt this. */
g_file_monitor_set_rate_limit (monitor, 100);
/* Subscribe to the "changed" signal. */
g_signal_connect (monitor, "changed",
(GCallback) dir_monitor_callback, NULL);
/* Store watch object in watch list. */
watch_object = list4 (watch_descriptor, file, flags, callback);
watch_list = Fcons (watch_object, watch_list);
return watch_descriptor;
}
DEFUN ("gfile-rm-watch", Fgfile_rm_watch, Sgfile_rm_watch, 1, 1, 0,
doc: /* Remove an existing WATCH-DESCRIPTOR.
WATCH-DESCRIPTOR should be an object returned by `gfile-add-watch'. */)
(Lisp_Object watch_descriptor)
{
Lisp_Object watch_object = assq_no_quit (watch_descriptor, watch_list);
if (! CONSP (watch_object))
xsignal2 (Qfile_notify_error, build_string ("Not a watch descriptor"),
watch_descriptor);
eassert (FIXNUMP (watch_descriptor));
GFileMonitor *monitor = XFIXNUMPTR (watch_descriptor);
if (!g_file_monitor_is_cancelled (monitor)
&& !g_file_monitor_cancel (monitor))
xsignal2 (Qfile_notify_error, build_string ("Could not rm watch"),
watch_descriptor);
/* Remove watch descriptor from watch list. */
watch_list = Fdelq (watch_object, watch_list);
/* Cleanup. */
g_object_unref (monitor);
return Qt;
}
DEFUN ("gfile-valid-p", Fgfile_valid_p, Sgfile_valid_p, 1, 1, 0,
doc: /* Check a watch specified by its WATCH-DESCRIPTOR.
WATCH-DESCRIPTOR should be an object returned by `gfile-add-watch'.
A watch can become invalid if the file or directory it watches is
deleted, or if the watcher thread exits abnormally for any other
reason. Removing the watch by calling `gfile-rm-watch' also makes it
invalid. */)
(Lisp_Object watch_descriptor)
{
Lisp_Object watch_object = Fassoc (watch_descriptor, watch_list, Qnil);
if (NILP (watch_object))
return Qnil;
else
{
GFileMonitor *monitor = XFIXNUMPTR (watch_descriptor);
return g_file_monitor_is_cancelled (monitor) ? Qnil : Qt;
}
}
DEFUN ("gfile-monitor-name", Fgfile_monitor_name, Sgfile_monitor_name, 1, 1, 0,
doc: /* Return the internal monitor name for WATCH-DESCRIPTOR.
The result is a symbol, either `GInotifyFileMonitor',
`GKqueueFileMonitor', `GFamFileMonitor', or `GPollFileMonitor'.
WATCH-DESCRIPTOR should be an object returned by `gfile-add-watch'.
If WATCH-DESCRIPTOR is not valid, nil is returned. */)
(Lisp_Object watch_descriptor)
{
if (NILP (Fgfile_valid_p (watch_descriptor)))
return Qnil;
else
{
GFileMonitor *monitor = XFIXNUMPTR (watch_descriptor);
return intern (G_OBJECT_TYPE_NAME (monitor));
}
}
void
globals_of_gfilenotify (void)
{
#if ! GLIB_CHECK_VERSION (2, 36, 0)
g_type_init ();
#endif
watch_list = Qnil;
}
void
syms_of_gfilenotify (void)
{
defsubr (&Sgfile_add_watch);
defsubr (&Sgfile_rm_watch);
defsubr (&Sgfile_valid_p);
defsubr (&Sgfile_monitor_name);
/* Filter objects. */
DEFSYM (Qchange, "change");
DEFSYM (Qattribute_change, "attribute-change");
DEFSYM (Qwatch_mounts, "watch-mounts"); /* G_FILE_MONITOR_WATCH_MOUNTS */
DEFSYM (Qsend_moved, "send-moved"); /* G_FILE_MONITOR_SEND_MOVED */
/* Event types. */
DEFSYM (Qchanged, "changed"); /* G_FILE_MONITOR_EVENT_CHANGED */
DEFSYM (Qchanges_done_hint, "changes-done-hint");
/* G_FILE_MONITOR_EVENT_CHANGES_DONE_HINT */
DEFSYM (Qdeleted, "deleted"); /* G_FILE_MONITOR_EVENT_DELETED */
DEFSYM (Qcreated, "created"); /* G_FILE_MONITOR_EVENT_CREATED */
DEFSYM (Qattribute_changed, "attribute-changed");
/* G_FILE_MONITOR_EVENT_ATTRIBUTE_CHANGED */
DEFSYM (Qpre_unmount, "pre-unmount"); /* G_FILE_MONITOR_EVENT_PRE_UNMOUNT */
DEFSYM (Qunmounted, "unmounted"); /* G_FILE_MONITOR_EVENT_UNMOUNTED */
DEFSYM (Qmoved, "moved"); /* G_FILE_MONITOR_EVENT_MOVED */
staticpro (&watch_list);
Fprovide (intern_c_string ("gfilenotify"), Qnil);
}
|
The certificate of confidentiality at the National Institute of Mental Health: discretionary considerations in its applicability in research on child and adolescent mental disorders.
Child and adolescent researchers must balance increasingly complex sets of ethical, legal, and scientific standards when investigating child and adolescent mental disorders. Few guidelines are available. One mechanism that provides the investigator immunity from legally compelled disclosure of research records is described. However, discretion must be exercised in its use, especially with regard to abuse reporting, voluntary disclosure of abuse, and protection of research data. Examples of discretionary issues in the use of the certificate of confidentiality are provided. |
Background {#Sec1}
==========
Avian influenza virus (AIV) is an important zoonotic pathogen \[[@CR1]\] and can be classified into 16 hemagglutinin (HA) subtypes and 9 neuraminidase (NA) subtypes based on the antigenicity of these two surface glycoproteins. At least 136 species have been discovered in 26 different families of wild birds and harbour 144 subtypes of influenza A virus \[[@CR1]--[@CR4]\]. Most subtypes are found not only in common aquatic birds but also in lower mammals, such as bats, as has been demonstrated in recent reports \[[@CR1], [@CR5]--[@CR7]\]. In Qinghai Lake, China in 2005, massive numbers of migrating birds died by H5N1, and this virus subsequently spread worldwide \[[@CR8], [@CR9]\]. In recent years, different influenza virus subtypes (such as H5, H6, H7, and H10) have emerged in succession in poultry, crossed the species barrier and caused frequent outbreaks of human infection \[[@CR1], [@CR10]--[@CR15]\]. The continuous outbreaks of avian influenza in recent decades have alarmed and increased focus on the role of wild birds, as major reservoirs, that maintain the persistence and variation of AIV, facilitating viral spread and disease occurrence.
H6 AIV was first isolated from turkeys in Massachusetts, USA in 1965 \[[@CR10], [@CR16]\]. Currently, H6 AIVs has a worldwide distribution, and strains of the virus have been detected in various animal species \[[@CR17]\]. On June 21, 2013, the first case of a human infection by an avian-origin H6N1 influenza A virus (A/Taiwan/2/2013, Taiwan2) was reported by the Taiwan Centres for Disease Control \[[@CR11], [@CR18]\]. Human infection with H6 AIVs in mainland China has not been reported, but a serum antibody positive for the H6 virus was found in poultry workers \[[@CR19]\]. More than 30% of the H6 AIVs circulating in poultry in China have enhanced affinity to human-like receptors (ɑ-2, 6 NeuAcGal). Some H6 subtypes can also infect mice without prior adaptation, and some can be efficiently transmitted among guinea pigs \[[@CR17]\]. These events indicate that H6 AIV can cross species barriers and directly infect humans. As the natural host of AIVs, wild birds play an important role in virus reassortment as well as intra- and interspecies transmission \[[@CR4], [@CR5]\]. However, there is little research regarding the biological properties of H6 AIV strains from wild birds and their potential threat to mammals compared to the many studies of H6 AIV in poultry.
In the present study, we isolated 13 H6 AIV strains after surveying wild birds in the wetlands of the National Nature Reserves in Anhui Province, China. For all of these strains, each gene segment was sequenced to analyse phylogenetic and speculate its origin. We also preliminarily evaluated the potential threat of each strain to mice. Our study highlights the importance of performing regular surveillance of AIV strains in Anhui Province, China as an integral part of worldwide efforts to better understand AIV ecology and prevent the emergence of novel, potentially pandemic strains. Surveillance of avian influenza virus (AIVs) in wild birds for early warning, prevention, and control of viral outbreaks should be enhanced to reduce the risk of pathogen emergence from wildlife host reservoirs.
Methods {#Sec2}
=======
Virus isolation and identification {#Sec3}
----------------------------------
In spring and autumn of 2014, 2970 faecal samples were collected from wild birds in Anhui Province, China. Fresh, single faecal samples were collected with cotton swabs and placed into 5 ml EP tubes with 2 ml virus protection solution (phosphate-buffered solution (pH 7.2) supplemented with penicillin, streptomycin, and 10% glycerinum). The handheld end of each cotton swab was broken off, and the remainder was placed into the sample tube and covered tightly. The handheld ends of the swabs were inserted into the ground to designate collection locations to avoid repetition in sampling.
Bird species were identified based on morphological characteristics observed by binoculars before sampling and were further determined based on faecal shape and colour in addition to DNA barcoding \[[@CR20]\]. The samples were vortexed, oscillation and finally centrifuged, and the collected supernatant was inoculated into 9-day-old specific-pathogen-free (SPF) chicken embryos. Allantoic fluid was harvested after 72 h of culture. The HA activity of the allantoic fluid was then evaluated using an HA test. Following this, influenza virus and HA subtypes were identified using a hemagglutination inhibition (HI) test \[[@CR21]\] with H6 mono-antiserum and further verified using subtype-specific real-time PCR (RT-PCR) \[[@CR22], [@CR23]\]. Virus was standardized to a concentration of 4 HAU/25 μl prior to using the HI assay to identify HA subtype. Working in a PBC, 25 μL of standardized test virus for each unknown isolate was dispensed into a series of three wells (in triplicate) in a U-bottom microtitre plate. Additionally, 25 μL of a corresponding HA-subtype positive-control antigen was dispensed at a 4 HAU/25 μL concentration into positive-control wells. Then, 25 μl of the appropriate standardized antiserum was added to the first well of the HA-subtype series. The antiserum in the antigen wells was then serially diluted beginning with the first well (25 μL carry-back with the excess 25 μL from the final row being discarded). In this way, the serum was diluted into standardized antigen. Each subtype series was diluted as soon as possible after the addition of the antiserum for that series. After this step, 25 μL of liquid remained in each well. The plate was then covered and incubated at room temperature for 25 min. Following this, 25 μL of 1% chicken erythrocyte suspension was added to each well, and the plate was submitted to gentle shaking/agitation. The erythrocyte solution was mixed periodically during this step to ensure an even suspension of erythrocytes during the dispensing process. The plate was then covered with microtitre plate-sealing tape (the PBS was removed from the plates after sealing with the tape) and incubated at room temperature until a distinct button formed in the positive-control wells, which typically required 20--30 min. The assay plates were initially observed after approximately 20 min of incubation and checked frequently thereafter for evidence of hemagglutination. Because some isolates can elute (i.e., detach from erythrocytes) in as little as 30 min, the time window for evaluation of assay results is short in some cases \[[@CR21]\]. NA subtypes were directly analysed using subtype-specific RT-PCR and sequencing analysis. Viral RNA was extracted from the allantoic fluid samples that were positive in the HA test using TRIzol reagent. Next, cDNA was synthesized by reverse transcription with the Uni12 primer. Viral genomes were PCR-amplified using primers complementary to the conserved promoter and non-coding region of each gene segment (Table [1](#Tab1){ref-type="table"}). The PCR reaction contained 1 μl cDNA, 1 μl forward primer and reverse primer, 5 μl 10× Taq buffer (TAKARA, Japan), 4 μl 2.5 mM dNTPs (TAKARA, Japan), 1 μl Ex Taq (TAKARA, Japan) and 37 μl RNase-free water for a final volume of 50 μl. A single PCR program was used for all primers with the following conditions: initial denaturation at 95 °C for 10 min; 30 cycles of 95 °C for 30 s, 56 °C for 30 s, and 72 °C for 1.5 min; and extension at 72 °C for 10 min, after which the reaction was stored at 4 °C. The PCR products were purified using a PCR purification kit (TianGen, China) and sequenced on an Applied Biosystems DNA analyser using specific primers.Table 1Primers in RT-PCRPrimersSequencesH6HAFUCAAAAGCAGGGGAAAATGATH6HAFLGTAGAAACAAGGGTGTTTTTYTCTAAN1NAUCAAAATGAATCCAAATCAGAAGAN1NALTTTTTTGAACAAACTACTTGTCAAN2NAUAGCAAAAGCAGGAGTAAAAATGN2NALAGTAGAAACAAGGAGTTTTTTCTAAA
Genetic and phylogenetic analyses {#Sec4}
---------------------------------
Nucleotide sequences were edited using the SeqMan module of the DNASTAR package, and multiple sequence alignments were compiled using Clustal W \[[@CR22]--[@CR24]\]. Phylogenetic analyses were performed with the neighbour-joining method with maximum likelihood trees using MEGA 6.0 software \[[@CR25], [@CR26]\]. Bootstrap values of 1,000 were used. The phylogenetic analyses were based on the following coding sequences (nucleotides): polymerase PB2 (PB2), 1 to 2280; polymerase PB1 (PB1), 1 to 2274; polymerase PBA (PA), 1 to 2151; hemagglutinin (HA), 1 to 1701; nucleoprotein (NP), 1 to 1497; neuraminidase (NA), 1 to 1410; matrix protein 1 (M), 1 to 982; and non-structural protein 1 (NS), 1 to 844.
Mouse studies {#Sec5}
-------------
The 50% egg infection dose (EID~50~) was calculated according to the protocol of Reed and Muench. Six-week-old female BALB/c mice (Experimental Animal Centre of Vital River, Beijing, China) were randomly divided into four infection groups (8 mice/group) and one control group (5 mice/group). Animals in the infection groups were mildly anesthetized with dry ice and infected by intranasal inoculation with a dose of 10^6^ EID~50~ (50 μl/mouse). Three of the eight mice were randomly euthanized on day 3 post inoculation (p.i.) for titration of virus from the lungs, nasal turbinate, kidneys, spleen, and brain. The remaining five mice were monitored daily for 2 weeks for changes in body weight and mortality.
Results {#Sec6}
=======
Influenza virus isolation and subtype identification {#Sec7}
----------------------------------------------------
In total, 13 H6 AIV strains were isolated from 2970 faecal samples collected from wild birds in Anhui Province, China, in 2014. The strains consisted of two NA subtypes, H6N1 (3 strains) and H6N2 (10 strains), and the host for all of these viruses was Anser fabalis (bean goose) (Table [2](#Tab2){ref-type="table"}).Table 2Information of the 13 avian influenza virusesNo.VirusAbbreviationPlaceYear1A/*Anser fabalis*/Anhui/S20/2014(H6N2)AH/S20Shengjin Lake20142A/*Anser fabalis*/Anhui/S39/2014(H6N2)AH/S39Shengjin Lake20143A/*Anser fabalis*/Anhui/S45/2014(H6N2)AH/S45Shengjin Lake20144A/*Anser fabalis*/Anhui/S65/2014(H6N2)AH/S65Shengjin Lake20145A/*Anser fabalis*/Anhui/S104/2014(H6N2)AH/S104Shengjin Lake20146A/*Anser fabalis*/Anhui/S148/2014(H6N2)AH/S148Shengjin Lake20147A/*Anser fabalis*/Anhui/L9/2014(H6N2)AH/L9Caizi Lake20148A/*Anser fabalis*/Anhui/L63/2014(H6N2)AH/L63Caizi Lake20149A/*Anser fabalis*/Anhui/L93/2014(H6N2)AH/L93Caizi Lake201410A/*Anser fabalis*/Anhui/L144/2014(H6N1)AH/L144Caizi Lake201411A/*Anser fabalis*/Anhui/L180/2014(H6N2)AH/L180Caizi Lake201412A/*Anser fabalis*/Anhui/L221/2014(H6N1)AH/L221Caizi Lake201413A/*Anser fabalis*/Anhui/L256/2014(H6N1)AH/L256Caizi Lake2014
Phylogenetic analysis of whole genes {#Sec8}
------------------------------------
The HA genes of all 13 H6 isolates, including 3 H6N1 viruses and 10 H6N2 viruses, belonged to the Eurasian lineage and were further divided into 2 groups according to nucleic acid homology (\>95%). The homology of the 13 viral strains ranged between 93.1 and 100%. Group 1 consisted of only one virus, AH/L221, which exhibited the highest sequence identity with A/MDK/Vietnam/LBM455/2013(H6N2) in a GenBank search as well as high sequence identity with A/duck/eastern China/34/2005(H6N1) isolated from poultry. The 12 strains in group 2 exhibited high sequence identity with A/QA/Korea/CN20/2009(H6N1). Among poultry influenza viruses, these 12 viruses exhibited high sequence identity with A/duck/eastern China/11/2008(H6N1) (Fig. [1a](#Fig1){ref-type="fig"}). The three N1 NA genes formed only one group, and their homology was greater than 98% (Fig. [1b](#Fig1){ref-type="fig"}). The ten N2 NA genes exhibited greater diversity than the HA genes and formed 3 groups. Three N2 genes had a North American lineage, and seven other NA genes had a Eurasian lineage. The homology of the nucleotide sequences ranged between 86.5 and 99.8% (Fig. [1c](#Fig1){ref-type="fig"}).Fig. 1Phylogenetic analysis based on maximum likelihood of surface genes H6 (**a**), N1 (**b**) and N2 (**c**) of AIVs isolated in Anhui Province, 2014. Phylogenetic trees were generated with the MAGE 6.0 software package. The phylogenetic trees for HA (1A) were rooted to A/Turkey/Canada/1/1963 (H6N8). The phylogenetic tree for the N1 genes were rooted to A/Brevig_Mission/1/18(H1N1) and N2 genes were rooted to turkey/Massachussetts/3740/65(H6N2). The genomic sequences of the viruses listed in black and blue were downloaded from available databases; the viruses listed in red, yellow, and/or purple was sequenced in this study. The sequences shown in cyan and italics in Fig 1c were obtained from a paper by Wang GJ. Abbreviations: CK, chicken; DK, duck; GS, goose; SW, swine; ML, mallard; GT, green-winged teal; PD, Pacific black duck; WDK, wild duck; MLDK, mallard duck; WB, wild bird; EN, environment
To better understand the evolution of the H6 AIV strains in this study, 6 internal genes from the 13 viruses were phylogenetically analysed as a whole. These genes exhibited more diversity than the surface genes and were further divided into eight genotypes (Table [3](#Tab3){ref-type="table"}). The nucleotide and amino acid homologies for the 13 H6 isolates in this study were 86.8--100% and 96.1--99.9% for the PB2 gene, 95.6--100% and 99.1--100% for the PB1 gene, 90.3--100% and 97.9--100% for the PA gene, 93.5--100% and 96.4--100% for the NP gene, 96.6--100% and 98.5--100% for the M gene, and 71.2--100% and 63.7--100% for the NS gene, respectively. All of the internal genes belong to a Eurasian lineage except for the PA gene of strain AH/L180 and the NS gene of strain AH/L93, which belong to the North American lineage. The genes were further classified into various subgroups within each lineage. The PB2 gene originated from poultry and wild birds in countries outside of China (i.e., Vietnam, Korea, and Republic of Georgia) and was divided into three groups (Fig. [2a](#Fig2){ref-type="fig"}). The PB1 gene, which showed few differences in nucleotide sequences among different strains, was classified into one group (Fig. [2b](#Fig2){ref-type="fig"}), while the PA gene was classified into three groups (Fig. [2c](#Fig2){ref-type="fig"}). The NP genes from the 13 strains were divided into two groups (Fig. [2d](#Fig2){ref-type="fig"}): three originated from ducks in Vietnam and the other ten originated from mallard in Republic of Georgia. The M genes of all 13 stains had high identity and were placed into one group (Fig. [2e](#Fig2){ref-type="fig"}). In addition, the NS phylogenetic tree showed that the NS genes of the H6 AIVs were clearly divided into two genetic lineages, termed allele A and allele B, and most of the H6 AIVs contained Eurasian allele B, although one virus from strain AH/L93 had allele A. The NS gene was classified into two groups (Fig. [2f](#Fig2){ref-type="fig"}).Table 3The genotypes of 13 H6 AIVs{#d29e936} Fig. 2Phylogenetic analysis by maximum likelihood of inner genes of H6 subtype AIVs isolated in Anhui Province, 2014: (**a**) PB2, (**b**) PB1, (**c**) PA, (**d**) NP, (**e**) M, and (**f**) NS. The colours of the virus names listed in the PB2, PB1, PA, NP, M, and NS trees match those used in the genotype table. The phylogenetic trees of inner genes were rooted to A/Turkey/Canada/1/1963 (H6N8). The nucleotide sequences of the viruses listed in black were downloaded from GenBank; the viruses listed in red, yellow, or green were sequenced in this study. The sequences shown in cyan and italics were obtained from a paper by Wang GJ. Abbreviations: CK, chicken; DK, duck; GS, goose; SW, swine; WDK, wild duck; WB, wild bird; WGS, wild goose; EN, environment
Preliminary analyses of the possible origins of the strains were conducted. There were three Genotype 1 viruses, which were tri-reassortment of H6N2, H5N1 and H3N6. There were three Genotype 2 viruses, which were tri-reassortment of H6N2, H9N2 and H3N6. There were two Genotype 3 viruses, which were bi-reassortment of H6N2 and H9N2. There was only one virus in Genotype 4 and one in Genotype 5: both were tri-reassortment of H6N2, H9N2 and H5N1. There was only one virus in Genotype 6, which was a bi-reassortment of H6N2 and H9N2. There was only one virus in Genotype 7 and one in Genotype 8: both were tri-reassortments of H6N2, H6N1 and H3N6 (Fig. [4](#Fig4){ref-type="fig"}).
Molecular characterization of viral genes {#Sec9}
-----------------------------------------
The isolated H6 strains, except for AH/L221, contained seven potential glycosylation sites according to analysis performed at <http://www.cbs.dtu.dk/services/NetNGlyc>; these included sites at positions 26 to 28, 27 to 29, 39 to 41, 306 to 308, and 311 to 313 on HA1 and at positions 498 to 500 and 557 to 559 on HA2 (H3 numbering, which is used throughout the manuscript). Strain AH/L221 contained eight potential glycosylation sites, including a glycosylation site on NNT at positions 182 to 184. All viruses except for strain AH/L144 contained the PQIETR/G motif at the cleavage site between HA1 and HA2. The cleavage site on AH/L144 contained the PLIETR/G motif, which includes an amino acid substitution from Q to L. None of the strains contained consecutive basic amino acids within the motif, and all conformed to the characteristics of low-pathogenicity AIVs. The amino acid substitutions A138S, E190V, P186L \[[@CR27]\], Q226L, and G228S, as well as the absence of glycosylation at positions 158 to 160 in HA, have been reported to increase the affinity of influenza virus for human-type receptors \[[@CR28]\]. The above-mentioned changes were not detected in any of the 13 H6 avian viruses sequenced. Necklace deletion in the NA gene confers enhanced virus lethality in mice. In the present study, none of the 13 H6 AIVs studied had a necklace deletion in the NA gene \[[@CR29]\]. Some amino acid substitutions, including T271A, E627K, and D701N in PB2, contribute to increased virulence and transmission of influenza viruses in mammals. The H6 viruses sequenced in this study did not contain any of these changes either. No Y436H substitutions in the PB1 protein or T515A substitutions in the PA protein were found, which suggests that the studied viruses have low pathogenicity for mammalian and avian hosts. Additionally, no amino acid substitutions were found in the M2 transmembrane domain, suggesting that the viruses are sensitive to M2 ion channel inhibitors \[[@CR30]\].
The N66S substitution in the PB1-F2 protein, which has been associated with the increased virulence of the 1918 pandemic virus and the high pathogenicity of the AI H5N1 virus in mice and ferrets \[[@CR31], [@CR32]\], was not found in any of the H6 strains examined in this study. Additionally, none of the viruses harboured the S31N substitution in the M2 protein, indicating that all are sensitive to amantadine inhibitors \[[@CR33]\]. The virulence of influenza virus in humans is related to resistance to the antiviral effects of cytokines, such as interferon (IFN). In particular, the D92E mutation in the NS1 protein increases resistance to IFN; this mutation was not observed in any of the strains evaluated in this study \[[@CR34]\].
Replication of H6 viruses in mice {#Sec10}
---------------------------------
To investigate the replication ability and virulence of the isolated H6 strains in mammals \[[@CR35]\], five H6 strains were selected according to their NA gene subtype and phylogenetic characteristics of HA and NA and used to infect mice. Following infection, none of the viruses were detected in the spleen, kidneys, or brain of the mice. Four of the five viruses caused the mice to lose weight (Fig. [3a](#Fig3){ref-type="fig"}). In virus proliferation tests in chicken embryos, one strain of virus, strain AH/S45 (H6N2), was not detectable in any organs, whereas the four other strains were detected in the lungs (mean titre 2.4 to 6.3 log10 EID~50~) and nasal turbinate (mean titre 0.6 to 1.3 log10 EID~50~) (Fig. [3b](#Fig3){ref-type="fig"}). These results indicate that the majority of H6 influenza viruses that were isolated from wild birds can replicate in the respiratory systems of mice without preadaptation.Fig. 3Changes in body weight. Body weight (**a**) and mortality (**b**) in BALB/c mice inoculated with strains A and B of H6 viruses. **a** Body weights and survival rates of mice were observed over 14 days after infection. **b** Lungs and trachea were collected at 3 days post infection (p.i.), and virus replication levels were measured by EID~50~ values in specific-pathogen-free (SPF) eggs
Discussion {#Sec11}
==========
Based on body shape, physiological characteristics, and other features, wild birds have unique flight patterns, which has led to their wide geographical spread, strong regional activity and extended seasonal migration. Wild birds migrate from breeding to wintering places each year along unique migration routes. Wild aquatic birds are the natural host of influenza virus and can act as a reservoir for the transfer of genes between species, forming transient "genome constellations" that are continually reshuffled by reassortment \[[@CR36], [@CR37]\]. The birds' migration behaviours expand the distribution of the virus and provide conditions for the cross-border spread of viruses. Many reports have analysed the biological and pathogenic characteristics of influenza virus in poultry in China; however, studies of influenza virus in wild birds are relatively rare.
In recent years, several AIV subtypes have been circulating and evolving in southern China; these include the H5, H9, and H6 subtypes as well as the newly emerged H7N9 and H10N8 viruses. This has led to frequent avian influenza outbreaks in poultry and humans. Anhui Province is located in south-eastern China (29°41′to 34°38′N, 114°54′to 119°37′E). Lying in the middle and lower valleys of the Yangtze and HuaiHe rivers, Anhui is abundant in wetlands, with wetland areas accounting for 21% of the total area of the province. These areas provide important stopover and wintering grounds for birds migrating along the East Asia-Australia migratory flyway. In the fall and winter of each year, a large number of migratory birds gather in the wetlands, resulting in extremely high population densities of the same or different species, which likely favours the spread and viral gene reassortment of the influenza virus. As an important agricultural province, Anhui is also home to a great number of poultry raised under different farming practices. These poultry often come into close contact with wild birds, creating the opportunity for cross-species AIV transmission.
In 2 years of surveillance work in Anhui, we obtained 31 AIV strains from 2970 faecal samples. Among these strains, eight subtype combinations, including H1N1, H1N2, H3N3, H3N8, H6N1, H6N2, H9N2, and H11N9, were identified using HA-HI tests and PCR. The H6 subtype accounted for the largest proportion of those identified, being found in approximately 41.9% (13/31) of the samples. H6N2 accounted for the majority of these H6 AIVs (10/13). Overall, the goal of this work was to obtain baseline information regarding the epidemiological and virological characteristics of H6 virus strains that exist in wild waterfowl. Toward this aim, we assessed 13 strains of H6 virus isolated from faecal samples of bean goose (Anser fabalis) in Anhui Province, China in 2014.
These 13 H6 strains originated from complicated reassortment between viruses found in poultry and wild birds from China and other countries (Fig. [4](#Fig4){ref-type="fig"}). Interestingly, all of the HA genes originated from poultry in China. Except for strain AH/L221, which originated from the A/duck/Eastern China/34/2005(H6N1)-like gene pool, the other 12 H6 strains all originated from the A/duck/Hunan/2110/2006(H6N2)-like gene pool. The ten N2 strains all exhibited high sequence identity with wild birds from different countries and were reassortment between H9N2 and H6N2 in bean goose, duck, and mallard. Three N1 genes were found in H6N1 isolates from poultry in their native countries. The internal genes also showed complicated reassortment from varied sources, including poultry and different wild bird species from China and other countries. This finding further shows that wild birds, as the natural host of AIV, play an important role in gene reassortment or rearrangement of viruses, which can subsequently be transmitted to domestic poultry. A former study showed that the gene flow and reassortment of the Eurasian lineage in the North American gene pool dramatically changed the evolutionary dynamics of influenza virus in natural reservoir hosts \[[@CR38]\]. The HA, PA and NS genes in the strains examined in this study had high identity with A/bean goose/Korea/220/2011(H9N2), which belongs to the North American lineage \[[@CR38]\]. China and Korea are both along the same bird migration pathway, which increases the gene flux of influenza virus between the two countries and may accelerate evolution driven by North American-Eurasian reassortment. During seasonal migration for breeding and wintering, migratory birds can distribute genes to local poultry or wild birds and can acquire additional genes \[[@CR39]\]. This invasion of viruses from wild bird reservoirs can increase the risk of emergence of highly pathogenic avian influenza (HPAI) viruses and threaten food security in addition to increasing the chance of virus infection in humans.Fig. 4A simplified schematic showing the putative genomic composition of the novel H6N1 and H6N2 reassortant avian influenza viruses identified in this study. The eight gene segments (from *top* to *bottom*) in each virus are PB2, PB1, PA, HA, NP, NA, M, and NS. Each colour represents a separate source background. Eight genotypes are listed here. The six different colours represent separate virus backgrounds. The illustration is based on nucleotide-distance comparisons and phylogenetic analyses
Gillim-Ross et al. \[[@CR40]\] described 14 strains of H6 virus from poultry that could infect and replicate in the lungs of mice and showed that some of these strains are lethal. Wang et al. also reported that 37 of 38 tested H6 viruses from poultry could replicate efficiently in the lungs of mice \[[@CR17]\]; however, none were lethal. In the present study, experimental infection in mice revealed that all but one of the studied H6 strains could replicate in the lungs and turbinate of mice without adaptation. Some of the viruses also induced weight loss in mice. These data support the idea that H6 AIVs from wild birds can replicate in BALB/c mice without adaptation and that mammals can be directly infected with wild-bird AIV. Following infection, the AH/S45 strain was not found in any organs, but this strain has high sequence identity with strain AH/S20: these two strains have no reported differences in amino acid sequence. Further research is required to determine whether differences in amino acids that influence the viral replication ability exist between these two viruses. Some studies have reported that red blood cells from turkeys, sheep, and horses possess a-2, 3 receptors; however, red blood cells in humans with Type O blood and those from guinea pigs possess a-2, 6 receptors. Interestingly, in the present study, the 13 H6 AIV strains studied all exhibited high HA activity in red blood cells from horses and sheep but low activity in red blood cells from Type O humans and from guinea pigs. These results coincide with the properties bestowed by amino acids 226 and 228 in the HA gene of the virus, which together form the characteristic poultry receptor-binding site on the virus \[[@CR27]\].
H6 AIV has a worldwide distribution, similar to H5N1 and H9N2 \[[@CR41], [@CR42]\], and has caused considerable losses in poultry farming. In one report, out of a total of 15,689 serum specimens gathered from 22 provinces in mainland China, approximately 63 specimens were positive for H6 AIV \[[@CR12]\]. These cases of H6-infected humans serve as a warning. As the natural host of influenza virus, wild birds, especially migratory species, play an indispensable role in the spread and reassortment of AIV and provide unknown opportunities for the mutation and emergence of novel influenza viruses \[[@CR43]\]. To fully understand the ecology, biology, and potential hazards of influenza virus, regular surveillance of all influenza virus hosts, and especially wild birds and poultry, is necessary. The data generated from such efforts must be combined to accurately assess the potential threat. Notably, the present study provides only a general overview of the H6 virus strains that are currently circulating among Anseriformes in Anhui, China. More intensive sampling and sequencing of AIVs from wild birds is needed to help refine our understanding of host specificity and viral evolution \[[@CR44]\], which will also reveal the processes driving viral adaptation and maintenance in alternative hosts.
Conclusion {#Sec12}
==========
The H5, H6, and H9 subtypes of influenza A virus are found worldwide. Although it is known that H6 AIV strains found in poultry pose a potential threat to humans, few studies have surveyed this subtype in infected wild birds, and its threat to humans is therefore not well understood. In the present study, we performed a risk assessment of H6 influenza A virus transmission using phylogenetic and pathogenic analyses to better understand the potential threat of wild birds, especially migratory birds, transmitting influenza virus to poultry and/or humans. In doing so, we identified 13 strains of H6 AIV in Anseriformes. Some of these strains were reassortment from the Eurasian and North American lineages. Overall, we conclude that H6 AIV strains isolated from wild birds have the potential to infect mammals and humans.
AIV
: Influenza A virus
HA
: Hemagglutinin
M
: Matrix
NA
: Neuraminidase
NP
: Nucleoprotein
NS
: Non-structural
PA
: Acidic polymerase
PB1
: Polymerase basic 1
PB2
: Polymerase basic 2
RT-PCR
: Reverse-transcription polymerase chain reaction
We are grateful for the technical support and staff of related laboratories in the Natural Conservation & Management Station of Anhui Province.
Funding {#FPar1}
=======
This research was supported by the National Key National Key Research and Development Program of China(2016YFD0500201) and the Surveillance of Wildlife Diseases Department from the State Forestry Administration of China.
Availability of data and materials {#FPar2}
==================================
Data supporting the conclusions of this article are presented in the manuscript.
Authors' contributions {#FPar3}
======================
This study is a result of collaborative work. YG participated in data collection, conceiving the study design, and drafting the manuscript. QY and SC worked on isolating viruses. XW and ZF participated in sample collection. HChen provided equipment used for the study. JM worked on data analysis. HChai participated in discussions and modified the manuscript. GD provided equipment used for the study as well as funding support. YH participated in study design, made suggestions throughout the study, revised the manuscript and provided funding. All authors read and approved the final manuscript.
Competing interests {#FPar4}
===================
The authors declare that their work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Consent for publication {#FPar5}
=======================
Not applicable.
Ethics approval {#FPar6}
===============
This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the Ministry of Science and Technology of the People's Republic of China. General animal care was provided as required by the Institutional Animal Care and Use Committee (approval number BRDW-XBS-14 for mice) \[[@CR17], [@CR45]\].
|
The present invention is generally in the area of using polymeric semi-interpenetrating and interpenetrating polymer network compositions and photocrosslinkable polymeric hydrogels in medical treatments, especially joint resurfacing and plastic surgery and delivery of drugs.
Congenital Defects
Many congenital defects, especially in the urogenital areas, require surgical correction. Examples include treatment of reflux and urinary incontinence. WO 94/25080 by Massachusetts Institute of Technology describes the use of injectable polysaccharide-cell compositions for delivering isolated cells by injection, which then form new tissue that is effective as a bulking agent. The polymers that are described crosslink ionically, as a function of ionic strength, temperature, pH, or combinations thereof. WO 96/40304 by Reprogenesis describes similar applications of polymeric hydrogels formed by covalent crosslinking, for example, by photopolymerization of the injected polymer-cell suspension using a catheter or during surgery.
Craniofacial Contour Deformities
Craniofacial contour deformities, whether traumatic, congenital, or aesthetic, currently require invasive surgical techniques for correction. Furthermore, deformities requiring augmentation often necessitate the use of alloplastic prostheses which suffer from problems of infection and extrusion. Correction of these defects and irregularities remain a difficult and controversial problem. Sims, et al., reported in Plastic Reconstructive Surgery 98:845 (1996), the formation of new cartilage from injected polyethylene oxide-cell suspensions, and suggested that this technology would be useful in plastic surgery.
Replacement or Repair of Cartilaginous Surfaces
The aging population, especially of those active in sports and in jobs creating stress on joints, have little recourse at this time for repair or replacement of cartilage. Arthroscopic surgery can be used to remove torn cartilage but highly invasive and painful surgery is required for repair or replacement of a joint having little cartilage left. In most cases a prosthetic device must be used to replace the entire joint, following destruction of the smooth cartilaginous surface which normally allows for free movement of the abutting joint surfaces. As described in U.S. Pat. No. 5,514,378 to Vacanti, et al., it has been proposed to create new joint surfaces using a synthetic polymeric mesh seeded with chondrocytes, which forms new cartilage as the polymer degrades. Although this is promising, the seeded mesh must still be implanted surgically.
There is a need for improved injectable polymer-cell compositions which are biocompatible and biodegradable for delivering isolated cells by injection. There is a further need for less invasive means of covalently crosslinking polymer-cell suspensions following injection.
Accordingly, it is an object of the present invention to provide methods and compositions for injection of cells to form cellular tissues and cartilaginous structures, based on interpenetrating networks of synthetic polymers.
It is a further object of the invention to provide improved compositions to form cellular tissues and cartilaginous structures including non-cellular material which will degrade and be removed to leave tissue or cartilage that is histologically and chemically the same as naturally produced tissue or cartilage.
It is another object of the present invention to provide compositions for and a method for covalent crosslinking a polymer-cell suspension for formation of new tissue following injection. |
Patient-reported outcome measures after routine periodontal and implant surgical procedures.
To compare patient-reported outcome measures (PROMs) after different dental surgical procedures over a 1-week post-surgical period and in relation to duration of the surgery, and periosteal releasing incisions. To evaluate the prevalence of post-surgical complications. Four hundred and sixty-eight healthy dental patients requiring surgeries, such as crown lengthening (CL), open flap debridement (OFD) and implant installation (IMP) in the National Dental Centre, Singapore (2009-2011), were consecutively recruited. PROMs on bleeding, swelling, pain and bruising were obtained using Visual Analogue Scales (VAS) on days 0, 3, 5 and 7 post-operatively. On the day of surgery, the IMP procedure gave the lowest median VAS for all four PROM parameters. After a week, OFD still had a significantly higher VAS for swelling, pain and bruising. Patients who underwent procedures lasting more than 60 min. had higher VAS for all parameters except bleeding. After considering other important confounders, type of surgery procedure was no longer associated with the VAS score for any of the parameters. Time after surgery, male gender and shorter surgery duration reduced post-operative VAS for one or more of the parameters. Longer surgeon experience helps reduce VAS scores only for bleeding. Prevalence for tenderness to palpation was 11.6%, 8.9% and 12.2% for IMP, CL and OFD, respectively, 1-week post-operatively. Swelling and suppuration occurred rarely. The median VAS scores for all PROM parameters were generally low and reduced to near zero over a week following all three surgical procedures tested. Time after surgery and shorter surgery duration were associated with lower VAS scores in all the PROM parameters in this cohort of patients. Surgery type was not associated significantly with VAS after adjustment with other important confounders. Low prevalences of post-surgical complications were reported. |
#include "include/cef_client.h"
#include "app/client_app.h"
int WINAPI wWinMain(HINSTANCE hInst, HINSTANCE hPrevInst, LPWSTR lpszCmdLine, int nCmdShow)
{
_wsetlocale(LC_ALL, L"chs");
#ifdef _DEBUG
AllocConsole();
FILE* fp = NULL;
freopen_s(&fp, "CONOUT$", "w+t", stdout);
wprintf_s(L"Command:\n%s\n\n", lpszCmdLine);
#endif
CefMainArgs main_args(GetModuleHandle(NULL));
CefRefPtr<nim_cef::ClientApp> app(new nim_cef::ClientApp());
// 执行子进程逻辑，此时会堵塞直到子进程退出。
return CefExecuteProcess(main_args, app.get(), NULL);
}
|
NSA chief says Trump has not directed him to counter Russian meddling
Win McNamee/Getty Images(WASHINGTON) — One of the nation’s top intelligence officials told Congress Tuesday that despite what he called Russia’s “sustained aggression,” President Donald Trump has not directed him to take any action to counter Russian election meddling.
Senators on both sides expressed irritation with the U.S. government’s failure to prevent Russian interference in the 2016 election and with the lack of a clear strategy to counter yet more meddling in this year’s midterm elections.
“How long are we going to step back and look broadly at this attack,” asked Connecticut Democrat Richard Blumenthal, telling Rogers he was outraged by Russia’s “disrupting, sowing discord, continuing to attack our democracy in ways that most Americans find abhorrent.”
“I’m an operational commander – not a policy maker,” Rogers responded. “I am not going to tell the president what he should or should not do.”
Rogers, who was testifying in his capacity as commander of U.S. Cyber Command, said that absent any new directions from the president, his ability to respond is limited by the scope of his existing authority. But he said nothing the government has done so far has deterred the Russian onslaught.
“They haven’t paid a price that is sufficient to get them to change their behavior,” said Rogers. “It certainly hasn’t changed their behavior in the way that we need.”
Virginia Democrat Tim Kaine, Hillary Clinton’s running mate in 2016, told Rogers “we’ve been humiliated as a country, we’ve lost the first real cyber war our nation has been in. The U.S. government failed to protect the U.S. democracy.”
Asked at Tuesday’s White House briefing why Rogers has not been given the authority to counter Russian meddling, press secretary Sarah Sanders told reporters, “No one is denying him the authority. We’re looking at a number of different ways” to prevent Russian interference. |
Sweet and Memorable Mothers Day Gift
Mother's Day is a celebration honoring the mother of the family. This stunning flower arrangement has been picked fresh for you to help you celebrate a Mother's Day, Birthday, Anniversary or express your thank you or get well wishes. This combo goes above and beyond and gives mom some delicious cake and chocolates treat to enjoy on her special day. There' also fresh flowers comes with it so she' sure to keep it on display somewhere in the house or office. It comes complete with all the side items that can make her even more enjoyable with chocolaty delight. Cute little party stuff if she wants to enjoy it with dad or a friend or with relatives. Whenever your mother get this kind of gift hamper its like she feels that she is in heaven of love with all the happiness of the world. If you are looking for some exotic Mother's Day Hampers like Vanilla Cake with Red Roses Bouquet, then head to Giftacrossindia.com the largest variety gifting store of India.Product Includes : 25 Red and white Roses Hand Tied Bouquet , 1/2 Kg Vanilla Cake, Cute Teddy along with 1 Bar of Cadbury Dairy Milk Fruit N Nut Chocolate (Weight : 35 gms).
Disclaimer
Kindly note the points mentioned below.
The image displayed is indicative in nature. Actual product may vary in shape or design as per the availability.
Flowers may be delivered in fully bloomed, semi-bloomed or bud stage.
The chosen delivery time is an estimate and depends on the availability of the product and the destination to which you want the product to be delivered.
Since flowers and cakes are perishable in nature, we attempt delivery of your order only once. The delivery cannot be redirected to any other address.
This product is hand delivered and will not be delivered along with courier products.
Occasionally, substitution of flowers/flavors/designs is necessary due to temporary and/or regional unavailability issues.
The icing, design of the cake may vary from the image depending upon local availability.
Actual delivered flower's design/ pattern may vary as flowers are sourced from local city vendor & arranged manually. |
Q:
Joint Distribution of Scaled multivariate Standard normals
Let $X$ be $N(0,I_n)$, a $n$-dimensional multivariate standard normal. Let $Y = X/||X||$. I know $Y$ is distributed uniformly on the surface of a $n$ dimensional "circle" but how do I prove this?
The answer given Here is fine but I am looking for a finding joint density/ using Jacobian transform type answer if possible.
A:
One way, painful but mechanical: Represent each point $x\in\mathbb R^n$ in "polar coordinates" $(r,\sigma)$ by $x=r\sigma$, where $r\ge0$ and $\sigma\in\mathbb R^n$ with $\|\sigma\|=1$, that is, $\sigma\in S^{n-1}$, and apply the usual Jacobian change-of-variables formula to obtain the joint density for $(r,\sigma)$ when $x$ is a standard Gaussian vector. The key thing here is that the value of the Jacobian determinant depends only on $r$ and not on $\sigma$.
Another way is to argue from the formula for the characteristic function of the vector $X$: $\phi(u)=E[\exp(i\langle u,X\rangle)] = \prod_{k=1}^n E[\exp(i u_k X_k)]=\prod_{k=1}^n\exp(-u_k^2/2)$, to obtain (in the end) $\phi(u)=\exp(-\|u\|^2/2)$, and to exploit the spherical symmetry of the formula for $\phi$.
|
/* $OpenBSD: key_wrap.c,v 1.5 2017/05/02 17:07:06 mikeb Exp $ */
/*-
* Copyright (c) 2008 Damien Bergamini <damien.bergamini@free.fr>
*
* Permission to use, copy, modify, and distribute this software for any
* purpose with or without fee is hereby granted, provided that the above
* copyright notice and this permission notice appear in all copies.
*
* THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES
* WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF
* MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR
* ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES
* WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN
* ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
* OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
*/
/*
* This code implements the AES Key Wrap algorithm described in RFC 3394.
*/
#include <sys/param.h>
#include <sys/systm.h>
#include <sys/endian.h>
#include <crypto/aes.h>
#include <crypto/key_wrap.h>
static const u_int8_t IV[8] =
{ 0xa6, 0xa6, 0xa6, 0xa6, 0xa6, 0xa6, 0xa6, 0xa6 };
void
aes_key_wrap_set_key(aes_key_wrap_ctx *ctx, const u_int8_t *K, size_t K_len)
{
AES_Setkey(&ctx->ctx, K, K_len);
}
void
aes_key_wrap_set_key_wrap_only(aes_key_wrap_ctx *ctx, const u_int8_t *K,
size_t K_len)
{
AES_Setkey(&ctx->ctx, K, K_len);
}
void
aes_key_wrap(aes_key_wrap_ctx *ctx, const u_int8_t *P, size_t n, u_int8_t *C)
{
u_int64_t B[2], t;
u_int8_t *A, *R;
size_t i;
int j;
memmove(C + 8, P, n * 8); /* P and C may overlap */
A = C; /* A points to C[0] */
memcpy(A, IV, 8); /* A = IV, an initial value */
for (j = 0, t = 1; j <= 5; j++) {
R = C + 8;
for (i = 1; i <= n; i++, t++) {
/* B = A | R[i] */
memcpy(&B[0], A, 8);
memcpy(&B[1], R, 8);
/* B = AES(K, B) */
AES_Encrypt(&ctx->ctx, (const uint8_t *)(caddr_t)B, (uint8_t *)(caddr_t)B);
/* MSB(64, B) = MSB(64, B) ^ t */
B[0] ^= htobe64(t);
/* A = MSB(64, B) */
memcpy(A, &B[0], 8);
/* R[i] = LSB(64, B) */
memcpy(R, &B[1], 8);
R += 8;
}
}
memset(B, 0, sizeof B);
}
int
aes_key_unwrap(aes_key_wrap_ctx *ctx, const u_int8_t *C, u_int8_t *P, size_t n)
{
u_int64_t B[2], t;
u_int8_t A[8], *R;
size_t i;
int j;
memcpy(A, C, 8); /* A = C[0] */
memmove(P, C + 8, n * 8); /* P and C may overlap */
for (j = 5, t = 6 * n; j >= 0; j--) {
R = P + (n - 1) * 8;
for (i = n; i >= 1; i--, t--) {
/* MSB(64, B) = A */
memcpy(&B[0], A, 8);
/* MSB(64, B) = MSB(64, B) ^ t */
B[0] ^= htobe64(t);
/* B = MSB(64, B) | R[i] */
memcpy(&B[1], R, 8);
/* B = AES-1(K, B) */
AES_Decrypt(&ctx->ctx, (const uint8_t *)(caddr_t)B, (uint8_t *)(caddr_t)B);
/* A = MSB(64, B) */
memcpy(A, &B[0], 8);
/* R[i] = LSB(64, B) */
memcpy(R, &B[1], 8);
R -= 8;
}
}
memset(B, 0, sizeof B);
/* check that A is an appropriate initial value */
return timingsafe_bcmp(A, IV, 8) != 0;
}
|
Leeto is an African name for boys meaning Journey. Read below for Leeto's celebrity and ruler associations, and numerological meanings. If Leeto is the one, congratulations! If you'd like more options, try our Popular Names at Birth. Use the yellow form to the left to search over a million birth records from several countries. First, select baby's gender. The form will automatically reload. Select the country where baby was born. The form reload one last time. Select the year of birth. Wait a second, and the page will automatically go to the requested baby birth name popularity information. And remember to tell your friends about Leeto. Maybe you can save them the cost of a baby names book.
Potential. Entertainer - Expression / Destiny Number 3. Questing a destiny along a variety of paths that may include writing, speaking, singing, acting or teaching; our entertainers, writers, litigators, teachers, salesmen, and composers. Leeto also has the destiny to sell himself or sell just about any product that comes along. Leeto is imaginative in his presentation, and Leeto may have creative talents in the arts, although these are more likely to be latent. Leeto is an optimistic person that seems ever enthusiastic about life and living. Leeto is friendly, loving and social, and people like Leeto because he is charming and such a good conversationalist. His ability to communicate may often inspire others. It is his role in life to inspire and motivate; to raise the spirits of those around him.
Desire. Solitude - Soul Urge Number 7. Leeto may be fond of reading or other activities that involve retreating to periods of being alone and away from the disruptions of the outer world. Leeto likes to dream and develop idealistic understandings, to study and analyze, to gain knowledge and wisdom. Leeto may be too laid back and withdrawn to really succeed in the business world, and Leeto will be much more comfortable in circumstances that are tolerant of his reserve, his analytical approach, and his desire to use his mind rather than his physical being.
Popular Leeto
(10 is best)
Birth Records. As a name given at birth, Leeto popularity is Birth: (no record).
Favorite Lists. Only one registered user (sally_p) has added Leeto to their lists of favorite names. You can add him by clicking the heart icon above.
User Rankings. For Leeto as an African name, 1 Who's Your Baby? visitor has cast a vote ranking him at 50% which is considered Medium popularity. If you disagree with this rating, or would like to share your own opinion, use the voting button above.
Sudoku Puzzle
Leeto is the right length and structure to make a sudoku puzzle. Isn't that cool? Give it a try!
Maybe this would make a fun baby shower game. Play or print a Leeto sudoku puzzle.
Tarot Reading
Not sure if this name is the one? Think deeply about Leeto. Concentrate hard on his name and meaning. Then let the universe decide with a free
single-card Leeto tarot reading. |
share this story
JERUSALEM — An Al-Jazeera journalist imprisoned by Israel was released under a plea bargain Monday, after he acknowledged having contact with the Islamic militant group Hamas, his attorney said.
According to the Israeli military verdict, Samer Allawi said he attended two meetings "in or near Qatar" in 2006 and 2010 with Al- Jazeera colleagues allegedly active in Hamas and later met senior Hamas member Osama Hamdan at a press conference.
The prosecutor alleged that on both occasions Allawi agreed to help strengthen public support for Hamas by reporting stories that would positively portray the Palestinians, but that he did not act on that due to "inability or unwillingness.".
Salim Wakim, the journalist's attorney, said his client was sentenced with "very, very, very trivial crimes."
His lawyer said Allawi refused the requests by Hamas. The military prosecutor also said that Allawi never carried out the requests, saying instead that he acted unethically.
The military prosecutor found Allawi guilty of making contact with and offering services to the Islamic militant group Hamas, considered a terrorist organization by Israel and several Western nations.
Allawi was released after paying a $1,400 fine, said Wakim.
Allawi, Al-Jazeera's bureau chief in Afghanistan, was arrested in August by Israeli soldiers when he was on his way back to Kabul after visiting family in the West Bank. He was held in an Israeli military prison for over a month.
Video footage on Al-Jazeera Arabic showed Allawi on Monday kissing his mother's hand and forehead repeatedly and hugging another woman upon his release. He was tearful.
Regardless of what transpires at the UN, it must become the impetus towards increased commitment on the part of the international community to fulfill the legitimate aspirations of the Palestinian people and the yearning of Israelis for peace and security.
Loading comments…
More than 35 reporters have been held in Iranian jails, without right of counsel or even being aware of the charges against them. Worse than Iran is the leftist darling Turkey, who has detained more than 60 recognized journalists, again without right of counsel or knowledge of pending charges. Turkey currently has a backlog of more than 1000 cases pending against journalists, army personnel, and anyone identified as a critic of Erdogan. The Israeli detainee, of "Palestinian" background, by his own admission, said he was recruited to Hamas in 1993 and he served there until 2004 in a senior committee that oversees Hamas operations abroad and is responsible for fundraising. Samer Allawi also said he attended a meeting in 2000 in Saudi Arabia in which he said he would be part of a terror operation on behalf of Hamas. He also offered to use his position as a reporter to promote Hamas interests. Despite these most felonious of actions and intents, Allawi was protected under Israeli law, had the right to counsel, the ability to address his case to a recognized legal entity, mediate a compromise, and secure his release. Is that not how a proper democracy adjudicates its laws? The story should act as another example of the integrity of the Israeli system, but rather HuffPo chooses to shed light on this particular case in hopes of furthering the leftist’s morally inverse narrative of Israel as some kind of rouge state.
Loading comments…
"The Israeli detainee, of "Palestinian" background, by his own admission...." There's your problem, Bar - you seem to think that it is a mark of shame for anyone to admit that they are Palestinian. I would ask you to leave behind the rhetoric and vitriol of hate and join those who wish for a more peaceful and equitable future for the peoples of Israel and Palestine.
SpoonieLuv: "The Israeli detainee, of "PalestiniÂan" backgroundÂ, by his own admission...."
"The Israeli detainee, of "Palestinian" background, by his own admission, said he was recruited to Hamas in 1993 and he served there until 2004 in a senior committee that oversees Hamas operations abroad and is responsible for fundraising"
In other words, the admission he made was that he was a Hamas operative, not that he was a palestinian!! You owe him an apology.
Json: You are extremely dishonest or have poor reading comprehension!! "The
Loading comments…
Ridiculous. He never should have been detained in the first place. Something is very wrong with this most current Israeli regime. Very wrong indeed. They are beginning to remind me of the bullies over in Iran.
Each1Teach1: Ridiculous. He never should have been detained in the first
Loading comments…
Since I know that plenty of lunatics are simply going to see the station's name and immediately decide to write a bunch of negative things without even reading the article, let me correct them in advance:
Al Jazeera has had the most in-depth and analytical reporting of events in the Middle East, and often of events around the world. They recently had an article about the health effects arising from the BP oil spill in the Gulf of Mexico. In other words, it got to be the well respected media source that it is by being the OPPOSITE of Fox News.
Loading comments…
Interestingly, the Al Jazeera article is a little different: Allawi - bureau chief of Al Jazeera in Kabul - was charged with being a member of Hamas and, though the Israelis said they would hold him for four days, they held him and questioned him for 50 days. |
Insect cold tolerance
Insects are small ectotherms with little ability to generate and maintain body heat. Despite this obvious limitation, insects colonized almost all terrestrial and freshwater habitats on the Earth, including frosty ends of Arctics and Antarctics. The evolutionary success of insects was based on their ability to evolve complex and efficient strategies for survival at low body temperatures. In our laboratory, we conduct experiments on whole array of biochemical, physiological and molecular adjustments that counteract damaging effects of subzero temperatures. In terms of cold tolerance, some insects are unique among all animals. For instance, larvae of the malt fly, Chymomyza costata survive submersion in liquid nitrogen (-196°C). Knowledge on mechanisms that underlie such fantastic cold-tolerance can help in development of new techniques for cryogenic storage of biological material. |
The Telegraph ran an article about a sizable — and growing — number of Catholic pilgrims arriving in a small village in the Pyrenean foothills. With 94 residents, the town has no hotels or shops — a fact that has left some of the new arrivals a bit confused. The town does have a small statue of the Virgin Mary which some pilgrims have worshiped at. Most pilgrims have noted that the town seems curiously quiet for Catholicism’s third largest pilgrimage site.
The village is Lourde. Without an “s”. The pilgrims, of course, are looking for Lourdes. The statue some pilgrims have prostrated themselves in front of is not the famous Statue of Our Lady at the Grotto of Massabielle but a simple village statue of the virgin. Lourde is 92 kilometers (57 miles) to the east of the larger and more famous city with the very similar name.
Given the similar names, pilgrims have apparently been showing up at Lourde for as long as the residents of the smaller village can remember. But villagers report a very large up-tick in confused pilgrims in recent years. To blame, apparently, is the growing popularity of GPS navigation systems.
Pilgrims have typed in “L-O-U-R-D-E” in their GPS navigation devices and forgotten the final “S”. Indeed, using the clunky on-screen keyboards and automatic completion functionality, it’s often much easier to type in the name of the tiny village than the name of the more likely destination. One letter and only 92 kilometers away in the same country, it’s an easy mistake to make because the affordances of many GPS navigation systems make it slightly easier to ask to go to Lourde than to Lourdes. Apparently, twenty or so cars of pilgrims show up in Lourde each day. Sometimes carrying as many people as live in the town of Lourde itself!
The GPS navigation systems, of course, will happy route drivers to either city and do not know or care that Lourde is rarely the location a driver navigating from across Europe wants. The GPS is designed to show drivers their next turn so a driver won’t know they’re off course until they reach their destination. The systems assume that destinations were entered correctly. A human navigator asked for directions would never point a person to the smaller village. Indeed, they would probably not know it even exists.
A municipal councilor in Lourde suggested that, “the GPS is not at fault. People are.” Of course, she’s correct. Pilgrims typed in the name of their destination incorrectly. But the reason there’s an increase in people making this particular mistake is because the technology people use to navigate in their cars has changed dramatically over the last decade in a way that makes this mistake more likely. A dwindling number of people pore over maps or ask a passer-by or a gas station attendant for directions. On the whole, navigation has become more effective and more convenient. But not without trade-offs and costs.
GPS technology frames our experience of navigation in ways that are profound, even as we are usually take it for granted. Unlike a human, the GPS will never suggest a short detour that leads us to a favorite restaurant or a beautiful vista we’ll be driving by just before sunset. As in the case of Lourde, it will make mistakes no human would (the reverse is also true, of course). In this way, the twenty cars of confused pilgrims showing up in Lourde each day can remind us of the power that technologies have over some of the little tasks in our lives.
I caught this revealing error on the always entertaining Photoshop Disasters and thought it was too good to resist pointing out here:
The picture, of course, is a bag of Tao brand jasmine rice for sale in Germany. The error is pretty obvious if you understand a little German: the phrase transparentes sichtfeld literally means transparent field of view. In this case, the phrase is a note written by the graphic designer of the rice bag’s packaging that was never meant to be read by a consumer. The phrase is supposed to indicate to someone involved in the bag’s manufacture than the pink background on which the text is written is supposed to remain unprinted (i.e., as transparent plastic) so that customers get a view directly onto the rice inside the bag.
The error, of course, is that the the pink background and the text was never removed. This was possible, in part, because the the pink background doesn’t look horribly out of place on the bag. A more important factor, however, is the fact that the person printing the bag and bagging the rice almost certainly didn’t speak German.
In this sense, this bears a lot of similarity with some errors I’ve written up before — e.g., the Welsh autoresponder and the Translate server error restaurant. And as in those cases, there are takeaways here about all the things we take for granted when communicating using technology — things we often don’t realize until language barriers make errors like this thrust hidden processes into view.
This error revealed a bit of the processes through which these bags of rice are produced and a little bit about the people and the division of labor that helped bring it to us. Ironically, this error is revealing precisely through the way that the bag fails to reveal its contents.
SSL stands for “Secure Sockets Layer” and refers to a protocol for using the web in a secure, encrypted, manner. Every time you connect to a website with an address prepended with https://, instead of just http://, you’re connecting over SSL. Almost all banks and e-commerce sites, for example, use SSL exclusively.
SSL helps provide security for users in at least two ways. First, it helps keep communication encoded in such a way that only you and the site you are communicating with can read it. The Internet is designed in a way that makes messages susceptible to eavesdropping; SSL helps prevent this. But sending coded messages only offer protection if you trust that the person you are communicating in code with really is who they say they are. For example, if I’m banking, I want to make sure the website I’m using really is my bank’s and not some phisher trying to get my account information. The fact that we’re talking in a secret code will protect me from eavesdroppers but won’t help me if I can’t trust the person I’m talking in code with.
To address this, web browsers come with a list of trusted organizations that verify or vouch for websites. When one of these trusted organizations vouches that a website really is who they say they are, they offer what is called a “certificate” that attests to this fact. A certificate for revealingerrors.com would help users verify that that they really are viewing Revealing Errors, and not some intermediary, impostor, or stand-in. If someone were redirect traffic meant for Revealing Errors to an intermediary, users connecting using SSL would get an error message warning them that the certificate offered is invalid and that something might be awry.
That bit of background provides the first part of this explanation for this error message.
In this image, a user attempted to connect to the Whitehouse.gov website over SSL — visible from the https in the URL bar. Instead of a secure version of the White House website, however, the user saw an error explaining that the certificate attesting to the identity of the website was not from the United States White House, but rather from some other website called a248.e.akamai.net.
This is a revealing error, of course. The SSL system, normally represented by little more than a lock icon in the status bar of a browser, is thrust awkwardly into view. But this particularly revealing error has more to tell. Who is a248.e.akamai.net? Why is their certificate being offered to someone trying to connect to the White House website?
a248.e.akamai.net is the name of a server that belongs to a company called Akamai. Akamai, while unfamiliar to most Internet users, serves between 10 and 20 percent of all web traffic. The company operates a vast network of servers around the world and rents space on these servers to customers who want their websites to work faster. Rather than serving content from their own computers in centralized data centers, Akamai’s customers can distribute content from locations close to every user. When a user goes to, say, Whitehouse.gov, their computer is silently redirected to one of Akamai’s copies of the Whitehouse website. Often, the user will receive the web page much more quickly than if they had connected directly to the Whitehouse servers. And although Akamai’s network delivers more 650 gigabits of data per second around the world, it is almost entirely invisible to the vast majority of its users. Nearly anyone reading this uses Akamai repeatedly throughout the day and never realizes it. Except when Akamai doesn’t work.
Akamai is an invisible Internet intermediary on a massive scale. But because SSL is designed to detect and highlight hidden intermediaries, Akamai has struggled to make SSL work with their service. Although Akamai offers a service designed to let their customers use Akamai’s service with SSL, many customers do not take advantage of this. The result is that SSL remains one place where, through error messages like the one shown above, Akamai’s normally hidden network is thrust into view. An attempt to connect to a popular website over SSL will often reveal Akamai. The White House is hardly the only victim; Microsoft’s Bing search engine launched with an identical SSL error revealing Akamai’s behind-the-scenes role.
Akamai plays an important role as an intermediary for a large chunk of all activity online. Not unlike Google, Akamai has an enormous power to monitor users’ Internet usage and to control or even alter the messages that users send and receive. But while Google is repeatedly — if not often enough — held to the fire by privacy and civil liberties advocates, Akamai is mostly ignored.
We appreciate the power that Google has because they are visible — right there in our URL bar — every time we connect to Google Search, GMail, Google Calendar, or any of Google’s growing stable of services. On the other hand, Akamai’s very existence is hidden and their power is obscured. But Akamai’s role as an intermediary is no less important due its invisibility. Errors provide one opportunity to highlight Akamai’s role and the power they retain.
I’ve found that the always entertaining FAILblog is a rich source for revealing errors. Here’s a nice example.
Every reader on FAILblog can chuckle at the idea an item is being offered for $69.98 instead of an original $19.99 as part of a clearance sale. The idea that one can “Save $-49” is icing on the cake. Of course, most readers will immediately assume that no human was involved in the production of this sign; it’s hard to imagine that any human even read the sign before it went up on the shelf!
The sign was made by a computer program working from a database or a spreadsheet with a column for the name of the product, a column for the original price, and a column for the sale price. Subtracting the sale price from the original gives the “savings” and, with that data in hand, the sign is printed. The idea of negative savings is a mistake that only a computer will make and, with the error, the sign-producing computer program is revealed.
Errors like this, and FAILblog’s work in in general, highlights one of the reasons that I think that errors are such a great way to talk about technology. FAILblog is incredibly popular with millions of people checking in to see the latest pictures and videos of screw-ups, mistakes, and failures. For whatever reason — sadism, schadenfreude, reflection on things that are surprisingly out of place, or the comfort of knowing that others have it worse — we all know that a good error can be hilarious and entertaining.
My own goal with Revealing Errors centers on a type of technology education. I want to revealing hidden technology as a way of giving people insight into the degree and the way that our lives are technologically mediated. In the process, I hope to lay the groundwork for talking about the power that this technology has.
But if people are going to want to read anything I write, it should also be entertaining. Errors are appropriate for a project like mine because they give an a view into closed systems, hidden intermediaries and technological black boxes. But they they are great for the project because they are also intrinsically interesting!
A number of people (including the New York Times) wrote about a costly error at Brigham Young University last week that was originally reported by the Utah Valley Daily Herald. The error itself was subtle. First, it is important to realize that Brigham Young is a private university owned by the Church of Jesus Christ of Latter-day Saints (i.e., the Mormon Church or LDS for short). The front of the the Daily Universe — the BYU university newspaper — featured a photograph of a group of men who form one of the most important governing bodies in the LDS church with the heading, “Quorum of the Twelve Apostates.”
The caption should have said the “Quorum of the Twelve Apostles” which is the name of the governing body in question. An apostle, of course, is a messenger or ambassador although the term is most often used to refer to Jesus’ twelve closest disciples. The term apostle is used in LDS to refer to a special high rank of priest within the church. An apostate is something else entirely; the term refers to a person who is disloyal and unfaithful to a cause — particularly to a religion.
Shocked that the paper was labeling the highest priests in the church as disloyal and unfaithful, thousands of copies of the paper (18500 by one report) were pulled from news stands around campus. New editions of the paper with a fixed caption were produced and replaced at what must have been enormous cost to BYU and the Daily Universe.
The source of the error, says the university’s spokesperson, was in a spellchecker. Working under a tight deadline, the person spell-checking the captions ran across a misspelled version of “apostles” in the text. In a rush, they clicked the first term in the suggestion list which, unfortunately, happened to be a similarly spelled near-antonym of the word they wanted.
From a technical perspective, this error is a version of the Cupertino effect although the impact was much more strongly felt than most examples of Cupertino. Like Cupertino, BYU’s small disaster can teach us a whole lot about the power and effect of technological affordances. The spell-checking algorithm made it easier for the Daily Universe’s copy editor to write “apostate” than it was to write “apostle” and, as a result, they did exactly that. A system with different affordances would have had different effects.
The affordances in our technological systems are constantly pushing us toward certain choices and actions over others. In an important way, the things we produce and says and the ways we communicate are the product of these affordances. Through errors like BYU’s, we get a glimpse of these usually-hidden affordances in every-day technologies.
Last year, I talked about some of the dangers of machine translation that resulted in a Chinese restaurant advertised as “Translate Server Error” and another restaurant serving “Stir Fried Wikipedia.” This article from the BBC a couple months ago shows that embarassing translation errors are hardly limited to either China or to machine translation systems.
The English half of the sign is printed correctly and says, “No entry for heavy goods vehicles. Residential site only.” Clearly enough, the point of the sign is to prohibit truck drivers from entering a residential neighborhood.
Since the sign was posted in Swansea, Wales, the bottom half of the sign is written in Welsh. The translation of the Welsh is, “I am not in the office at the moment. Send any work to be translated.”
It’s not too hard to piece together what happened. The bottom half of the sign was supposed to be a translation of the English. Unfortunately, the person ordering the sign didn’t speak Welsh. When he or she sent it off to be translated, they received a quick response from an email autoresponder explaining that the email’s intended recipient was temporarily away and that they would be back soon — in Welsh.
Unfortunately, the representative of the Swansea council thought that the autoresponse message — which is coincidentally, about the right length — was the translation. And onto the sign it went. The autoresponse system was clearly, and widely, revealed by the blunder.
One thing we can learn from this mishap is simply to be wary of hidden intermediaries. Our communication systems are long and complex; every message passes through dozens of computers with a possibility of error, interception, surveillance, or manipulation at every step. Although the representative of the Swansea council thought they were getting a human translation, they, in fact, never talked to a human at all. Because the Swansea council didn’t expect a computerized autoresponse, they didn’t consider that the response was not sent by the recipient.
Another important lesson, and one also present in the Chinese examples, is that software needs to give users responses in the language they are interacting in to be interpreted correctly. In the translation context where users plan to use, but may not understand, their program’s output, this is often impossible. That’s why when a person has someone, or some system, translate into a language they do not speak, they open themselves up to these types of errors. If a user does not understand the output of a system they are using, they are put completely at the whim of that system. The fact that we usually do understand our technology’s output provides a set of “sanity checks” that can keep this power in check. We are so susceptible to translation errors because these checks are necessarily removed.
If, like most people, you have trouble parsing the agreement, that’s because it’s not the text of the license agreement that’s being shown but the “marked up” XHTML code. Of course, users are only supposed to see the processed output of the code and not the code itself. Something went wrong here and Mark was shown everything. The result is useless.
Conceptually, computer science can be boiled down to a process of abstraction. In an introductory undergraduate computer science course, students are first taught syntax or the mechanics of writing code that computers can understand. After that, they are taught abstraction. They’ll continue to be taught abstraction, in one way or another, until they graduate. In this sense, programming is just a process of taking complex tasks and then hiding — abstracting — that complexity behind a simplified set of interfaces. Then, programmers build increasingly complex tools on top of these interfaces and the whole cycle repeats. Through this process of abstracting abstractions, programmers build up systems of almost unfathomable complexity. The work of any individual programmer becomes like a tiny cog in a massive, intricate machine.
Mark’s error is interesting because it shows a ruptured black box — an accute failure of abstraction. Of course, many errors, like the dialog shown below, show us very little about the software we’re using.
With errors like Mark’s, however, users are quite literally presented with a view of parts of the system that programmer was trying to hide.
Here’s another photo I’ve been showing in a my talks that shows a crashed ATM displaying bits of the source code of the application running on the ATM; a bit of unintentional “open sourcing.”
These examples are embarrassing for authors of the software that caused them but are reasonably harmless. Sometimes, however, the window we get into a broken black box can be shocking.
In talks, I’ve mentioned a configuration error on Facebook that resulted in the accidental publication of the Facebook source code. Apparently, people looking at the code found little pieces like these (comments, written by Facebook’s authors, are bolded):
/* Monitoring these people's profile viewage. Stored in central db on profile_views. Helpful for law enforcement to monitor stalkers and stalkees. */
The first block describes a list of “baddies” and “hotties” represented by user ID numbers that Facebook’s authors have singled out for monitoring. The second stanza should be self-explanatory.
Facebook has since taken steps to avoid future errors like this. As a result, we’re much less likely to get further views into their code. Of course, we have every reason to believe that this code, or other code like it, still runs on Facebook. Of course, as long as Facebook’s black box works better than it has in the past, we may never again know exactly what’s going on.
Like Facebook’s authors, many technologists don’t want us knowing what our technology is doing. Sometimes, like Facebook, for good reason: the technology we use is doing things that we would be shocked and unhappy to hear about it. Errors like these provide a view into some of what we might be missing and reasons to be discomforted by the fact that technologists work so hard to keep us in the dark.
I was browsing this store for worker clothes in Germany a few weeks back when I noticed something funny in the bottom corner. I’ve highlighted the snafu in the screenshot below with a big red arrow.
The arrow points to paragraph that is definitely not in German. In fact, it’s Latin. Well, almost Latin.
The paragraph is a famous piece of Latin nonsense text that starts with, and is usually referred to as, lorem ipsum. Lorem ipsum has apparently been in existence (in one form or another), and in use by the printing and publishing industry, for centuries. Although it’s originally derived by a text from Cicero, the Latin is meaningless.
The story behind lorem ipsum is rooted in the fact that when presented with text, people tend to read it. For this reason, and because sometimes text for a document doesn’t exist until late in the process, many text and layout designers do what’s called Greeking. In Greeking, a designer inserts fake or “dummy” text that looks like real text but, because it doesn’t make any sense, lets viewers focus on the layout without the distraction of “real” words. Lorem ipsum was the printing industry’s standard dummy text. It continues to be popular in the world of desktop and web publishing.
In fact, lorem ipsum is increasingly popular. The rise of computers and computer-based web and print publishing has made it much easier and more common for text layout and design to be prototyped and much more likely that a document’s designer is not the same person or firm that publishes the final version. While both design and publishing would have been done in print houses half a century ago, today’s norm is for web, graphic, print and layout designers to give their clients pages or layouts with dummy text — often the lorem ipsum text itself. Clients — the “real” text’s producers, that is — are expected to replace the dummy text with the real text before printing or uploading their document to the web.
We can imagine what happened in this example. The clothing shop hired a web design firm who turned over the “greeked” layout to the store owners and managers. The store managers replaced the greeked text with information about their products and services. Not being experts — or just because they were careless — they missed a few spots and some of the Greeked text ended up published to the world by mistake.
A quick look around the web shows that this shop is in good company. Although lorem ipsum is often preferred because the spacing makes the text “look like” English from a distance, many other dummy texts are both used and abused. Here’s an example from an auto advertisement.
Due to rapidly and radically changed roles introduced by desktop publishing — changes in structure and division of labor that are usually invisible — you can see accidentally published lorem ipsum text all over the web and in all sorts of places in the printed world as well. We don’t often reflect on the changes in the human and technological systems behind web and desktop publishing. Errors like these give an opportunity to do so.
I’m going to be giving another revealing errors talk this week at the cultural center Mama in Zagreb, Croatia. The talk is scheduled for 14:00 on January 10th and will be part of the weekly skill sharing meeting. It should be a lot of fun and there will be time talk to chat and grab a coffee or something afterward. Please join if you can and feel free to contact me if you have any questions.
What is interesting, and what Mako would consider a “Revealing Error”, is when the auto-blur algorithm can not distinguish between an advertisement’s face and a regular human’s face. For the ad, the model has been compensated to have his likeness (and privacy) commercially exploited for the brand being advertised. On the other hand, there is a legal grey-area as to whether Google can do the same for random people on the street, and rather than face more privacy criticism, Google chooses to blur their identities to avoid raising the issue of whether it is their right to do so, at least in America.
So who cares that the advertisement has been modified? The advertiser, probably. If a 2002 case was any indication, advertisers do not like it when their carefully placed and expensive Manhattan advertisements get digitally altered. While the advertisers lost a case against Sony for changing (and charging for) advertisements in the background of Spiderman scenes located in Times Square, its clear that they were expecting their ads to actually show up in whatever work happened to be created in that space. There are interesting copyright implications here, too, as it demonstrates an implicit desire by big media for work like advertising to be reappropriated and recontextualized because it serves the point of getting a name “out there.”
To put my undergraduate philosophy degree to use, I believe these cases bring up deep ethical and ontological questions about the right to control and exhibit realities (Google Street View being one reality, Spiderman’s Time Square being another) as they obtain to the real reality. Is it just the difference between a fiction and a non-fiction reality? I don’t think so, as no one uses Google maps expecting to retrieve information that is fictional. Regardless, expect these kinds of issues to come up more and more frequently as Google increases its resolution and virtual worlds merge closer to real worlds. |
Tuesday, May 4, 2010
I'm cheating a bit with this one, since there are actually something around the ballpark of 15,000 species in the Buprestidae family, but hey, they are a really interesting group of insects! They range in size (from about 4-100mm) and habitat, but they all share the common characteristic of looking shiny.
Scientists have been looking at the molecular structure of their every so shiny exoskeletons because they reflect, rather than absorb color.
One specific species, the jewel scarab Chrysina gloriosa, can actually distinguish between circularly polarized and non polarized light, and reflect circularly polarized light off of their exoskeletons. This allows them to see each other, but keeps predators from seeing them. Only one other species (a type of shrimp) is known to be sensitive to this type of light. (CP light is what movies these days are using for 3D effects, we have to wear glasses cause humans lack the natural perception)
And while we're on the topic of super neat exoskeletons, their vibrant colors have led certain cultures to use them for decorative purposes for hundreds of years. You can even buy your own beetle jewelry!
Some species are apparently able to detect fires from dozens of miles away using a sensor that detects infrared radiation from fire and other sources. They specifically need burnt firewood to breed so what better way to figure out where fires are happening? Figuring out how to mimic these sensors could have major civilian and military impacts, and all from the undersides of tiny beetles! (Interestingly, these places are a great place for them to breed because no other critters go there. Safety!) |
/**
* Copyright (C) 2012-2020 the original author or authors.
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package not.test.application;
import com.google.inject.Singleton;
import ninja.Result;
import ninja.Results;
import ninja.jaxy.GET;
import ninja.jaxy.Path;
@Singleton
@Path("/not")
public class ForbiddenController {
@Path("/get")
@GET
public Result testAnnotatedGetRoute() {
return Results.text().render("should not exist");
}
}
|
So I have a 2001 Grand Am GT Coupe and I am thinking about installing a HID Conversion Kit. Depending how how big of a pain in the butt it is going to be will depend on whether I am going to use my factory enclosures ( boo ) or my Anzo Projector w/ Halo head lights.
So I have been reading all over to just disable to DRL's because it fries the HID Ballast. I get that - though the question is why? Do the grand am DRL circuits simply give out a lower voltage than 12v when the DRL's are on? Or is it something that I read on a Mazda forum that all DRL's do which is that the DRL circuit sends out a 12v+ current like this - - - - - - - - which is pulsed - causing the filament in standard halogen bulbs to only get half as bright as normal instead of 12v+ ------------ or even 6v+ -------------. Since it is pulsed it causes the relay in the ballast to go on and off like nuts and usually results in the HID's flickering because they are going on and off so fast.
I just want to know which, because that same Mazda forum gave an interesting fix to turn the 12v+ - - - - - - - into 12v+ ------------- by adding a capacitor to the DRL circuit on each head lamp before the ballast so that way the pulse goes into the capacitor but it stores enough juice that when the ballast pulls the power back out it can pull it at a constant rate - thus preventing the ballast from frying. But if that is just a Mazda thing - or just not a Pontiac thing, which is what I am trying to figure out, that would determine whether I am able to keep my DRL's ( as I kinda like having them there ) and get HID's.
And on a side note I will also explain how my current after market lights are set up since I don't know if they all operate the same or not.
The original headlights, as we know, had on 9007 hi/lo bulb. the new head lights have two bulbs in each. One Phillips H9 65W and one Sylvania OSRAM H3 55W bulb. The H3 is the lo and the H9 is the hi, but both come on dimmed with the DRL's are on. Then when the head lights are on the H3's go brighter and the H9's turn off. When I switch to my hi's the H3's turn off completely and the H9's then turn on.
So how I hypothesize it to work with HID's is I would leave the H9 as it is and just get ballasts for the H3 ( as I hear H9 is non existent/hard to find ) and either disable the DRL's - leaving only the H3 HID's to go on when the head lights are turned on lo and the H9's to go on when on hi leaving their opposites off.
-OR-
capping the DRL's if possible leaving the H9's the way they are turning on dimmed with the DRL's and the HID's turning on at full power. Then when the head lights turn on lo the H9's power off and the HID's stay as is, and when the hi's are turned on the HID's would power off and the H9's power on.
So .... yeah any information on my above book would be appreciated so I can figure out the best and easiest way to go about things as I really want to make the jump to HID's.
The DRL's are on when the headlights are not on. The DRL's run off less voltage; not enough to run the ballast. So your options are either always put your lights on when using the car, or to disable drl's. As long as you're not afraid of snipping a wire in the harness, its no big deal at all.
Is it true that you cannot use the factory headlights or the black headlights with clear corners and put HID's in them? on customgrandam.com they sell a 9007 - 35 watt - HID system that fits directly into the stock grand am headlights...AND DO I STILL HAVE TO DISABLE THE DRL'S when i purchase that HID kit? (purchasing soon)
Is it true that you cannot use the factory headlights or the black headlights with clear corners and put HID's in them? on customgrandam.com they sell a 9007 - 35 watt - HID system that fits directly into the stock grand am headlights...AND DO I STILL HAVE TO DISABLE THE DRL'S when i purchase that HID kit? (purchasing soon)
You don't want to put HIDs into non-projector housings. They are not designed to properly focus the light pattern. If you want to run HIDs, get HID projectors.
thanks for the kind post...it doesnt look like ass, or why would people make HID kits for every bulb type/headlight type? From H1,H3,H7, to 9003-9007 bulbs, there are HID kits....I have seen them in many vehicles even straight off the lot that project the light fine and look good. I have projectors right now from ebay and they suck ass with a 6000K H1 kit, there is no way to adjust the actual lense so you never know what you are going to get. The only way to adjust the beam of light is to use the adjusters that move the whole headlight...
thanks for the kind post...it doesnt look like ass, or why would people make HID kits for every bulb type/headlight type? From H1,H3,H7, to 9003-9007 bulbs, there are HID kits....I have seen them in many vehicles even straight off the lot that project the light fine and look good. I have projectors right now from ebay and they suck ass with a 6000K H1 kit, there is no way to adjust the actual lense so you never know what you are going to get. The only way to adjust the beam of light is to use the adjusters that move the whole headlight...
It looks terrible, especially compared to HID projectors. When you try them both, you'll really see the difference.
well, i have the new 8000k HID 9007 kit installed in the black and clear housing headlights and it looks amazing, light output is great and the new headlights are easily adjustable....also did DRL disable and ALC bypass which was cake! i guess buying a GOOD HID kit for 9007 bulbs isnt such a bad idea....many compliments only one week into having them installed
well, i have the new 8000k HID 9007 kit installed in the black and clear housing headlights and it looks amazing, light output is great and the new headlights are easily adjustable....also did DRL disable and ALC bypass which was cake! i guess buying a GOOD HID kit for 9007 bulbs isnt such a bad idea....many compliments only one week into having them installed
Take a picture with the beam shining against a wall, and you'll see how terrible the glare is. Better yet, drive towards your car with its lights on, see how well you can see. |
Mini Facelift Columbus, OH
The Mini Facelift is Dr. Smith’s exclusive, in-office procedure which uses a less-invasive approach to improve the jowls and neckline. This procedure can provide a natural, lasting result that enhances your appearance and helps you to put your best face forward. Mini Facelift recovery is generally much shorter than the traditional face lift. In addition, there are typically fewer risks and less expense involved.
Candidates for the Mini-Facelift
Candidates for the Mini Facelift are generally in good health and have realistic expectations for improving aging signs in the face. The Mini Facelift is usually reserved for individuals who are just beginning to see the first signs of aging, including minor sagging or drooping around the cheeks, jawline jowls and neck. Many patients are in their 40s and 50s, making this an excellent procedure for those who are not yet ready for a full facelift but still seeking rejuvenation. For patients with more extensive sagging, the traditional full facelift may be advised. A consultation with Dr. Smith is the best way to determine whether or not the Mini Facelift can help you to meet your aesthetic goals.
The Mini-Facelift Surgery
Surgical times for the Mini Facelift are much shorter than the traditional full facelift. In fact, the surgery typically takes just one hour to complete. In addition, the surgery can be performed with local anesthesia and sedation rather than general anesthesia. This is a quick, easy procedure that fits well into many patients’ active lifestyles.
During the surgery, much smaller incisions are made. Rather than running from the temples to in front of, around and behind the ear as with the traditional facelift, the incision often extends only to just below the earlobe. Working through the incision, sagging facial tissue is then lifted, repositioned and removed and the skin is carefully re-draped before closing the incisions with fine sutures.
Recovering from the Mini-Facelift
Following the Mini Facelift, many patients experience just five to seven days of downtime. Bruising and swelling are generally minimal. Discomfort is often minor but can be managed with pain medication if necessary. Visible results are often seen immediately. |
The use of the GBI as predictor of bipolar disorder in a population of adolescent offspring of parents with a bipolar disorder.
To assess the usefulness of the General Behavior Inventory (GBI) to predict the development of mood disorders in the offspring of parents with bipolar disorder. The GBI and the K-SADS (first measurement) and the SCID (last measurement) were used to assess psychopathology among 129 adolescent and young adult offspring of a bipolar parent with an interval of 5 years. Based on the SCID results at the last measurement, the offspring were assigned to one of four groups: with bipolar mood disorder, with unipolar mood disorders, with non-mood disorders and without disorders and GBI-scores at the first measurement were compared across the four groups. The scores on the Depression scale of the GBI for the offspring who later developed a bipolar or any mood disorder were significantly higher than for the offspring who did not develop a mood disorder across a 5-year interval. For the offspring with a unipolar mood disorder at the first measurement, the scores on the Depression scale were significantly higher for those who switched to bipolar disorder versus those who remained unipolar. The GBI can be used in a high-risk sample of offspring of parents with bipolar disorder as a self-report measure as an aid to detect those who will develop bipolar disorder across a 5-year interval. |
BEAUMONT, Texas — A Texas appeals court has sent to arbitration a dispute in which Exxon is seeking coverage as an additional insured for a 2013 fatal refinery fire, ruling that the insurer has the right to enforce the policy’s arbitration agreement because Exxon’s claims are based upon the policy.
On April 27, the Texas Court of Appeals, 9th District, further held that the dispute falls within the ambit of the arbitration clause because it involves a disagreement over the interpretation of the policy’s “additional insured” clause.
In April 2013, a fire occurred at Exxon’s Beaumont, Texas refinery, during which ... |
Vacaville Bank Robbery Suspect May Be Linked To SoCal Cop Shooting
VACAVILLE (CBS SF) — Vacaville police are searching for a masked man who robbed a Bank of the West at gunpoint on Monday evening, and say he may be the same person who shot and wounded a police officer in a recent bank robbery in Chino.
A man armed with an AK-style assault rifle entered the bank on Helen Power Drive and demanded money around 4:50 p.m., Sgt. Jeff King said. He took cash and fled.
He is described as white, about 5 feet 10 inches tall and weighing roughly 150 pounds. He was wearing a black ski mask and a green-colored tactical vest with the word “SHERIFF” in block letters on the back, King said.
Several customers and employees were in the bank at the time of the robbery but no one was injured.
Detectives are investigating whether the robbery is related to similar robberies in Sacramento and Chino, King said.
In the Chino robbery, which occurred at a California Bank and Trust around 11 a.m. on Feb. 29, the robber shot a responding police officer with an assault rifle.
The officer drove himself to a hospital and was listed in stable condition.
The description of the Chino suspect differs slightly from that of the Vacaville suspect. The Chino suspect is described as a white man 35 to 40 years old, between 6 feet and 6 feet 2 inches tall and weighing 200-250 pounds, Chino police said.
He was wearing a dark blue bulletproof vest and fled the bank in a four-door, charcoal gray Nissan Maxima with tinted windows and chrome wheels.
King said the robber is extremely dangerous, and anyone with information on him is urged to call Vacaville police at (707) 449-5200 or detective Jeff Datzman at (707) 449-4741.
(Copyright 2012 by CBS San Francisco and Bay City News Service. All rights reserved. This material may not be published, broadcast, rewritten or redistributed.) |
Pope Francis has emerged as one of the most important voices on the global stage about the need for a stronger moral dimension in economic policies. This has caused some upset in business and financial circles.
Prominent US political commentator Keith Farrell responded by accusing Pope Francis of being overly influenced by Marxist ideas that “the rich have only gotten rich at the expense of the poor”.
Farrell argues that “the inequality gap simply doesn’t matter”. He wrote that “capitalism has produced unrivalled economic growth” and is “chiefly responsible for halving of world poverty rates over the past 20 years”.
What Farrell fails to acknowledge is that most of the recent global improvement in living standards is occurring in communist China, hardly a model capitalist country; that the global financial system is fragile; and that globally two billion people still struggle in severe poverty.
Confronting the ‘dark side’ of capitalism
Pope Francis acknowledges the progress already made to improve living standards in many countries, but is urging that priority be given to lifting living standards for the rest of the world. He is highlighting the “dark side” of our capitalist economic systems, and particularly how extreme economic inequality is harming millions of people.
Francis does not speak as an armchair philosopher, moralising from afar. He personally experienced the devastation in Argentina when it defaulted on its debts in 2001-02, driving half the population into poverty and crippling the country economically. Banks failed and many people lost their life savings.
Even in Italy Francis sees the prolonged economic depression, with unemployment at over 12%, but youth unemployment at 40%. In Europe as a whole, 25 million (11.5%) are unemployed, including 5.3 million young people (10.2%), while in Greece and Spain over 25% are unemployed, with over 55% for youth.
The reach of Catholicism
Francis repeated his strong attack on such economic inequality during his recent visit to South Korea, where millions of people turned out to greet him. On the first day of his visit, he urged Koreans to show “special concern for the poor, the vulnerable and those who have no voice”, and to be “leaders in the globalisation of solidarity”.
Some 800,000 people crowded into Seoul as the Pope beatified 124 Korean martyrs. Francis urged Asian Catholic youth to build “a more missionary and humbler church”, one that “loves and worships God by seeking to serve the poor, the lonely, the infirm and the marginalised”.
Francis applauds capitalist economies that offer just and reasonable outcomes for all citizens, with supports for the disadvantaged. This is the sort of economy that most countries aspire to, and which we see most evident in the Scandinavian and northern European countries, but also to a lesser degree in Australia.
Religion still plays a part in Australian society, as census data reveals. The papal message of opposition to extreme capitalism may resonate in Australia. Francis rejects the neoliberal notion that the market of itself will resolve moral dilemmas and reward people appropriately, with governments playing only a very minimal role.
A moral argument for equity
Francis is appalled that so many people are still barely surviving in many countries when the world has such unprecedented wealth and could do much more to lift the living standards of poorer populations with better policies.
Moreover, as development economists well know, even countries with a relatively low Gross Domestic Income can achieve greatly improved health care, education and life expectancy with good policies, like many of those in the UN Sustainable Development Goals. They show that far from social equity being a subversive or communist notion, it can promote rapid social uplift for whole populations.
Francis insists that the current situation for millions of people is fiercely unjust and needs to change radically. He is not calling for violent revolution of course, but he fears such outcomes unless improved economics produce more viable outcomes for those in severe poverty.
He repeatedly calls on the many people in business, finance and governments who are genuinely concerned about social justice to help develop more equitable policies.
Pope Francis is appealing for globalisation with a conscience. In June he praised businesses that served genuine human needs, but saw it as “intolerable” that economies were being reshaped to serve the interests of financial markets. This was accumulating immense wealth in the hands of relatively few while depriving many others of decent livelihoods.
Keith Farrell is right that the Pope thinks some financial interests have exploited the poor, but who can credibly deny it? We can expect to hear more from Pope Francis along these lines, especially in a new document on environmental responsibility and sustainability now being prepared. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.