text
stringlengths
8
5.77M
--- author: - | John Conway$^\star$ and Simon Kochen[^1]\ Princeton University, Department of Mathematics\ Princeton, NJ 08544-1000 title: 'On Adler’s “Conway–Kochen Twin Argument”' --- -1.0cm .3cm In arXiv: quant–ph/0604122v1 (17 April 2006), Stephen Adler published a critique of our paper “The Free Will Theorem” (arXiv: quant–ph/0604079, of which a slightly updated version \[1\] appears in “Foundations of Physics”). More recently we have discussed our argument with Professor Adler, and are happy to say that he now agrees with us, after certain clarifications, (see Adler \[2\]). Adler’s main concern is that spin measurements are not instantaneous, and also that the time they take varies with direction. The information available to the particle will vary with this time. This is true, but causes no problem. Particle a’s response function $\theta_a$ may depend on all the information that arrives up to the time of its response. We can in fact allow its domain to include information up to a time T that maximizes this response time over the 40 triples used in our argument. Of course $\theta_a$ for a particular triple will not in fact vary with information that arrives later than the response time for that triple, but that does not affect its functional nature (a function does not have to vary with all its arguments). A similar argument applies to $\theta_b$. (In fact our argument took this into account, though only implicitly, because the information $\alpha'$ of which $\theta_a$ is a function was defined to be independent of $x,y,z$. However, we are glad to provide the extra clarification.) In view of this, we do not actually need the “sequence of experiments” that Adler goes on to discuss. Each of the two experimenters of our argument makes just one experiment; for ${\mathrm B}$ this is to measure the squared spin in a direction $w$, while ${\mathrm A}$ makes three such measurements in orthogonal directions $x,y,z$. The reason why no sequence of such experiments is needed is that our “functional hypothesis“ threatens to produce what we called a “101–function” of direction. Since no such function exists there must be a failure of one of our axioms SPIN, TWIN or FIN. A failure of SPIN would be revealed if A were to measure just the failing triple $x,y,z$, while a failure of TWIN at $w$ would be revealed if ${\mathrm B}$ were to measure $w$ and ${\mathrm A}$ any triple including $w$. (As we said in the paper, FIN is justified not by direct experiment but as a consequence of relativity.) We are grateful to Adler for pointing us to the three papers \[3\], \[4\], \[5\]. These also twin the K–S paradox to obtain “no–go theorems” that go beyond those in the book by Redhead referenced in our paper. However, the Free Will Theorem is even stronger, in the ways mentioned there. We add some remarks on another topic. Several physicists have proposed a type of model in which superluminal transmission is possible in one sense (say, “on the inner level”), but not in another (“on the outer level”). For instance, the hits of potential GRW explanations will be on the inner level, but experimenters cannot send messages superluminally, since they can only access the outer level. Indeed, the Janus models of our paper are of this type, since Janus acts superluminally, but they are not covariant, because the image of one Janus model under a Lorentz transformation is another Janus model. A general strategy — we might call it the multi–Janus approach — for achieving covariance is to combine all these images in some way. One way of doing this was advocated in Fleming \[6\]; a similar one, based on a paper of Aharanov and Albert \[7\], was suggested for the GRW model by Ghiradi \[8\]. These may indeed be covariant in a formal sense, but the Free Will Theorem shows that any such strategy, if it works, must have the “dirty needles“ peculiarity described in the final version \[1\] of our paper, which discusses theories that operate by injecting new information into an otherwise deterministic universe. We show there that even if this new information is intrinsically stochastic and/or non–locally correlated, this will not help to account for our spin experiments, unless the injection “uses dirty needles”. By this we mean that either the information injected near particle $b$ provides knowledge about experimenter A’s choice of $x,y,z$, or that injected near a involves knowledge of $w$. Each of these clearly contradicts the Free Will Assumption, since in a suitable inertial frame $b$’s response happens before A chooses $x,y,z$, while in another frame $a$’s response happens before B chooses $w$. Alternatively, we can view this as a violation of causality that is gross in two ways — because it concerns the location of spots on macroscopic screens, and because the response of a particle can depend on decisions that may only be made 5 minutes after that response. However, these violations have a curious kind of deniability, in that they are undetectable by observers who do not have access to all the information involved. To summarize; explanations of this two–level type face a dilemma — injections by “clean needles” cannot account for our spin experiments, while the use of dirty needles is a gross violation of both causality and the Free Will Assumption. [9]{} J. H. Conway, S. Kochen,[*Found. Phys.*]{} (online July 11, 2006). S. Adler arXiv: quant–ph/0604122 (17 Oct. 2006). A. Stairs, [*Phil. Sci.*]{} [**50**]{} (1983), 587. H. R. Brown, G. Svetlichny, [*Found. Phys.*]{} [**20**]{} (1990), 1379. A .Elby, [*Found. Phys.*]{} [**20**]{} (1990), 1389. G. N. Fleming, [*J. Math. Physics*]{}, [**7**]{}, (1966), 1959. Y. Aharanov, D. Z. Albert, [*Phys. Rev.*]{} [**D 29**]{} (1984), 228. G. Ghirardi, arXiv: quant–ph/0003149v1 (31 March 2000). [^1]: jhorcon@yahoo.com; $^\star$kochen@math.princeton.edu
Enhancement of dissolution rate of piroxicam using liquisolid compacts. Piroxicam is a poorly soluble, highly permeable drug and the rate of its oral absorption is often controlled by the dissolution rate in the gastrointestinal. The poor dissolution rate of water-insoluble drugs is still a major problem confronting the pharmaceutical industry. There are several techniques to enhance the dissolution of poorly soluble drugs. Among them, the technique of liquisolid compacts is a promising technique towards such a novel aim. In this study, the dissolution behaviour of piroxicam from liquisolid compacts was investigated in simulated gastric fluid (SGF, pH 1.2) and simulated intestinal fluid (SIF, pH 7.2). To this end, several liquisolid tablets formulations containing various ratios of drug:Tween 80 (ranging from 10% to 50% w/w) were prepared. The ratio of microcrystalline cellulose (carrier) to silica (coating powder material) was kept constant in all formulations. The results showed that liquisolid compacts demonstrated significantly higher drug release rates than those of conventionally made (capsules and directly compressed tablets containing micronized piroxicam). This was due to an increase in wetting properties and surface of drug available for dissolution.
Islamic Dua for Love Marriage | Islamic Dua for Getting Love Since astrology has the vast range of astrology aspects as the solution for all problems. . Muslim astrologer Maulana ji has the great knowledge about the muslim astrology. Where they are expert of providing powerful Islamic Dua like : Islamic Dua for get ex love back, Islamic Dua for get married with desired person, Islamic Dua for husband, Islamic Dua for make someone loves you, Islamic Dua for Love Marriage etc. He has some super natural powers by the blessings of Allah.
Elemér Gergátz Elemér Gergátz (6 May 1942 – 19 June 2019) was a Hungarian veterinarian and politician, who served as Minister of Agriculture between 1991 and 1993. During his ministership he tried to compensate farmers and agrarian workers as a result subdivided land structure formed which the main cause of difficulties of the Hungarian agriculture. The coalition between the Hungarian Democratic Forum (MDF) and the Independent Smallholders, Agrarian Workers and Civic Party broke up in 1992. Gergátz wanted to stay in the government so he was excluded from the party. Soon after he joined to the United Smallholders' Party (EKGP). Gergátz died on 19 June 2019, at the age of 77. References Sources Bölöny, József – Hubai, László: Magyarország kormányai 1848–2004 [Cabinets of Hungary 1848–2004], Akadémiai Kiadó, Budapest, 2004 (5th edition). Zsigmond Király Főiskola - Jelenkutató Csoport Category:1942 births Category:2019 deaths Category:Hungarian veterinarians Category:People from Győr-Moson-Sopron County Category:Independent Smallholders, Agrarian Workers and Civic Party politicians Category:Agriculture ministers of Hungary
After Donald Trump won Tuesday's presidential election, Americans thought they were done with seeing Clintons in politics. That might not be true. Though some say that the Clinton political dynasty has ended, others have suggested that Chelsea Clinton is being groomed for Congress. The seat she could potentially take is that of Rep Nita Lowey, in New York's 17th Congressional District, sources have told the New York Post. Chelsea Clinton (pictured with her parents, Hillary and Bill Clinton, on Wednesday) could take the seat of Rep Nita Lowey, in New York's 17th Congressional District The seat Chelsea could potentially take is that of Rep Nita Lowey (right), in New York's 17th Congressional District. Lowey, 79, has held a seat in the US House of representatives since 1989 She could run for the seat once Lowey, 79, retires from office. Lowey has held a seat in the US House of representatives since 1989. A source told the Post that the Clintons 'will not give up' and want to continue their brand in politics. 'While it is true the Clintons need some time to regroup after Hillary's crushing loss, they will not give up. Chelsea would be the next extension of the Clinton brand,' the source said. The source added: 'In the past few years, she has taken a very visible role in the Clinton Foundation and on the campaign trail. 'While politics isn't the life Hillary wanted for Chelsea, she chose to go on the campaign trail for her mother and has turned out to be very poised, articulate and comfortable with the visibility.' The 17th Congressional District includes parts of Rockland and Westchester counties, as well as Chappaqua, where the Clinton family home is located Bill and Hillary Clinton purchased a Chappaqua, New York, home (right, with gray roof) in August for $1.6million, next to their own home (left). It was intended for Chelsea, her husband, Marc Mezvinsky, and their two children, Charlotte and Aiden While Chelsea and her family currently live in Manhattan, she could use the Chappaqua home (pictured) as her legal residence if she decides to run The 17th Congressional District includes parts of Rockland and Westchester counties, as well as Chappaqua, where the Clinton family home is located. Chelsea currently lives and votes in Manhattan, but in August Hillary and Bill Clinton purchased the home next to theirs in Chappaqua for $1.6million. The second home was purchased with the intention of Chelsea, her husband, Marc Mezvinsky, and their two children, Charlotte and Aiden, moving in. The Clinton had earlier bought the $10 million home in lower Manhattan where the couple live. Mezvinsky runs a hedge fund but had to shut down one aspect of it when it lost 90 per cent if its value by betting on Greece. If she is to run for the Congress seat when Lowey retires, Chelsea could make the Chappaqua address her legal residence. Lowey is currently serving her 14th term in Congress. A spokesperson for the Rep did not comment. The home sits just next door to Bill and Hillary Clinton's Chappaqua home, which they purchased in 1999 As well as following her parents into elected office, Chelsea would be following her father-in-law and mother-in-law into Congress. Edward Mezvinsky, her father-in-law, served from 1973 to 1977, while his wife Marjorie Margolie-Mezvinsky, served from 1993 to 1995. But both their careers ended when Edwards was convicted of a string of frauds and jailed for give years in 2001. He tried to escape conviction for his $10 million crime spree by claiming mental illness, which a judge disallowed. It is unclear how much he has paid back of the fortune he defrauded. The couple declared bankruptcy and divorced, ending her attempt to become Pennsylvania's lieutenant-governor. Chelsea Clinton's own finances were questioned in the Wikileaks leak of emails from the account of John Podesta, her mother's campaign chair. In them Doug Band, her father's right-hand man with whom she fought a bitter war over the Clinton Foundation, accused her of paying for part of her wedding and taxes on money given to her by her parents with charity funds.
Quite what Deneve has been working on since joining the Apple isn’t entirely clear. His former executive bio page simply listed him as “vice president of special projects at Apple, reporting to Tim Cook” and he hasn’t given interviews to the press or appeared on stage at the company’s events.
Newly elected governors face questions on Medicaid November 08, 2012 Our take: Read initial thoughts from Chas Roades on how President Obama’s win will shape the hospital industry. And register for a post-election discussion of the strategic, financial, and operational implications for hospitals and health systems. The eleven governors who were newly elected or re-elected on Tuesday night will soon have to publicly affirm their positions on several Affordable Care Act provisions, such as the law's Medicaid expansion. Most of the gubernatorial candidates had hesitated to state their positions on the expansion until after the election. As of Thursday morning, winners have been declared in all 11 gubernatorial races, with seven Democrats and four Republicans winning victories: When the Supreme Court upheld the ACA in June, the justices ruled that states can opt out of the expansion without any effect on current funding, essentially leaving the final decision up to each state's governor. So far, Republican governors in six states—Florida, Georgia, Louisiana, Mississippi, South Carolina and Texas—have announced that they will not participate. Under the ACA, the federal government would cover the full cost for the first three years of the expansion, which begins in 2016. However, analysts predict that the re-election of President Obama, coupled with intense lobbying by health advocates and the availability of billions of dollars federal subsidies, will persuade the six governors and other holdouts to move forward with the expansion and other provisions in the ACA, according to Kaiser Health News. Kansas Insurance Commissioner Sandy Praeger, a former president of the National Association of Insurance Commissioners, said she expects states will try to negotiate more limited expansion options. Paul Keckley, executive director of Deloitte’s Center for Health Solutions research group, said the Obama administration now also might be more willing to offer states more flexibility for some of the ACA provisions—or delay rolling out several of them—to ensure greater participation and success, Bloomberg reports. Explore the strategic, financial, and operational implications for hospitals and health systems—and discuss the ongoing political debate about the future of health care reform and provider reimbursement that will continue well beyond the election. Voters in three states on Tuesday approved ballot initiatives that block the implementation of the Affordable Care Act's individual mandate, while one state voted to block the establishment of a state-run insurance exchange. Main Topics Find A Topic… TOOL Performance Goal Library Don't ask your employees to write their own goals—let them use ours. Our library includes thousands of health care-specific goals, cascaded through four levels of staff and 18 clinical and non-clinical departments.Access the library
Q: sudo as user use current user folder. Why? Running the command sudo -u www-data composer install results in an error message, showing that the directory /home/dev/.composer is not writable. dev is user which called the command. Why does composer use the home directory of dev and not www-data? A: You are looking for the -H option. From the man page: -H The -H (HOME) option requests that the security policy set the HOME environment variable to the home directory of the target user (root by default) as specified by the password database. Depending on the policy, this may be the default behavior. In your comment you specified that you want to know why this happens. The answer is that sudo has many compile-time options. Since you did not specify which distribution you are running, I'm going to assume your distribution has set the option to preserve the $HOME environment variable.
Bangladesh paying oil-fired power plants for purchase defaults The state-owned Bangladesh Power Development Board is racking up large losses by paying penalties for not purchasing electricity from some oil-fired power plants under an existing agreement, a top BPDB official told Platts Monday. Bangladesh has kept many of its oil-fired power plants shut under a cost-cutting measure since early March as the BPDB stopped purchasing electricity from them, Platts reported previously. Of a total of 34 oil-fired power plants installed in the country, 12 of them, with a combined generating capacity of 591 MW, are currently closed, BPDB data show. As a consequence, the BPDB is currently paying around Taka 40.32 million/day ($494,723/day) in so-called capacity payments to the 12 plants that are closed for not purchasing electricity as per the agreement. The payments rose to as much as Taka 120 million/day in April when the BPDB shut the majority of the country’s oil-fired power plants under the cost-cutting measure, BPDB data show. The BPDB has been making capacity payments to oil-fired power plants under a clause in the power purchase agreement it made with the plants. In mid-2010 Bangladesh launched a drive to increase the number of oil-fired power plants in the country amid rapidly depleting domestic natural gas reserves, commissioning almost three dozen new oil-based power plants to be built by 2012. But the high price of oil products on the international market led to higher electricity generation costs at oil-fired power plants, resulting in the suspension of generation at many of the plants, the BPDB official said. Bangladesh meets almost all of its oil needs through imports and state-owned Bangladesh Petroleum Corp. is forecast to import 5.8 million mt of oil products in the fiscal year that ends June 30, up 13.72% year on year. The Bangladesh Energy Regulatory Commission in late May almost tripled the average industrial electricity tariff to Taka 14.44/kWh from Taka 5.61/kWh for uninterrupted electricity supply with the aim of restarting some of the plants that had closed. The BPDB is seeking a further 50% hike in industrial electricity tariffs from the BERC to cover losses for running oil-fired power plants. State-run electricity distribution companies have also sought a similar hike in retail tariffs to pass costs on to end-users. Bangladesh’s overall electricity generation is currently around 5 GW against demand of over 7 GW.
Q: Remove tag synonym [stack-overflow] -> [stackoverflow] I see that stack-overflow is now a synonym for [stackoverflow]. I strongly object to this, as historically: [stackoverflow] means the site itself (indeed almost all questions with this tag have been migrated to meta) [stack-overflow] means the stack overflow exception, as in numerous languages and operating systems. I monitor the [stackoverflow] tag so I can vote to migrate meta questions, and have been retagging any such questions that are actually pertaining to the exception type. Please remove this synonym. A: Weirdly, I think this synonym should be reversed, so it's [stackoverflow] --> [stack-overflow]. A tag that categorizes questions about Stack Overflow doesn't belong on Stack Overflow (those questions belong on Meta, of course). So it ends up being a metatag, which as we've seen recently, is disallowed by policy. Obviously that doesn't stop users from asking questions in the wrong place, but at the same time I think it's unreasonable to expect users (especially new ones) to be able to distinguish between the two tags. If you're monitoring questions for metaquestions, the way I'm proposing means you only need to follow 1 tag, and not do any retagging, as when the question gets migrated, there's a good chance it will be retagged anyway (and we can put [stack-overflow] --> [stackoverflow] here on Meta).
Q: How to record a call in android? Recorder = new MediaRecorder(); Recorder.setAudioSource(MediaRecorder.AudioSource.MIC); Recorder.setOutputFormat(MediaRecorder.OutputFormat.RAW_AMR); Recorder.setOutputFile(FileName); Recorder.setAudioEncoder(MediaRecorder.AudioEncoder.AMR_NB); this is my Code and i am not able to record the voice of other person.so what should i use instead of AudioSorce.MIC. plz help me A: Sorry to disappoint you, but you can't, not in the general case. Most Android running phones have the wiring in hardware/firmware so that the media of the call does not pass through the application processor at all - it goes from the audio to the DSP and vice versa, so you cannot access it. You can catch the audio of the person using the phone, but not the other way around, disregarding silly hacks like asking the person to use the speakers and recording the sound from there via the phone mic... A: class MyPhoneStateListener extends PhoneStateListener implements SensorEventListener { Context context; AudioManager audioManager; MediaRecorder recorder; private SensorManager mSensorManager; private Sensor myLightSensor; private boolean CallState; private float sensorState; public MyPhoneStateListener(Context context) { this.context = context; mSensorManager = (SensorManager) this.context.getSystemService(Context.SENSOR_SERVICE); myLightSensor = mSensorManager.getDefaultSensor(Sensor.TYPE_PROXIMITY); audioManager = (AudioManager) this.context.getSystemService(Context.AUDIO_SERVICE); if (myLightSensor == null){ Log.i("On Receive", "Not Support"); }else{ mSensorManager.registerListener(this,myLightSensor,SensorManager.SENSOR_DELAY_NORMAL); } } public void onCallStateChanged(int state, String incomingNumber) { switch (state) { case TelephonyManager.CALL_STATE_IDLE: System.out.println("My Call IDLE"); CallState = false; StartAudioSpeacker(); StopRecording(); System.out.println("Is phone speaker : "+ audioManager.isSpeakerphoneOn()); if (audioManager.isSpeakerphoneOn()) { audioManager.setSpeakerphoneOn(false); mSensorManager.unregisterListener(this); } break; case TelephonyManager.CALL_STATE_OFFHOOK: System.out.println("My Call OFFHOOK"); CallState = true; StartAudioSpeacker(); StartRecording(); System.out.println("Is phone speaker : "+ audioManager.isSpeakerphoneOn()); break; case TelephonyManager.CALL_STATE_RINGING: System.out.println("My Call RINGING"); break; } } @Override public void onAccuracyChanged(Sensor sensor, int accuracy) { if (sensor.getType() == Sensor.TYPE_PROXIMITY) { Log.i("Sensor Changed", "Accuracy :" + accuracy); } } public void onSensorChanged(SensorEvent event) { if (event.sensor.getType() == Sensor.TYPE_PROXIMITY) { Log.i("Sensor Changed", "onSensor Change :" + event.values[0]); sensorState = event.values[0]; StartAudioSpeacker(); } } public void StartAudioSpeacker(){ if (CallState && sensorState == 1.0) { audioManager = (AudioManager) this.context.getSystemService(Context.AUDIO_SERVICE); audioManager.setSpeakerphoneOn(true); audioManager.adjustStreamVolume(AudioManager.STREAM_MUSIC,AudioManager.ADJUST_RAISE, AudioManager.FLAG_SHOW_UI); audioManager.setStreamVolume(AudioManager.MODE_IN_CALL, audioManager.getStreamMaxVolume(AudioManager.MODE_IN_CALL), 1); System.out.println("Is phone speaker : "+ audioManager.isSpeakerphoneOn()); }else{ audioManager = (AudioManager) this.context.getSystemService(Context.AUDIO_SERVICE); audioManager.setSpeakerphoneOn(false); audioManager.setStreamVolume(AudioManager.MODE_IN_CALL, audioManager.getStreamMaxVolume(AudioManager.MODE_IN_CALL), 1); System.out.println("Speaker Volume :"+ audioManager.getStreamMaxVolume(AudioManager.MODE_IN_CALL)); System.out.println("Is phone speaker : "+ audioManager.isSpeakerphoneOn()); } } public void StartRecording(){ recorder = new MediaRecorder(); recorder.setAudioSource(MediaRecorder.AudioSource.VOICE_CALL); recorder.setOutputFormat(MediaRecorder.OutputFormat.THREE_GPP); recorder.setAudioEncoder(MediaRecorder.AudioEncoder.AMR_NB); recorder.setOutputFile(this.getFullSdPath()); try { recorder.prepare(); } catch (IllegalStateException e) { // TODO Auto-generated catch block e.printStackTrace(); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } recorder.start(); // Recording is now started Log.i(this.getClass().getName(), "Start Recording"); } public void StopRecording(){ recorder.stop(); recorder.reset(); recorder.release(); Log.i(this.getClass().getName(), "Stop Recording"); } public String getFullSdPath(){ File sdCard = new File(Environment.getExternalStorageDirectory() + "/RecordMyVoice"); if (!sdCard.exists()) { sdCard.mkdir(); } File file = new File(Environment.getExternalStorageDirectory()+"/RecordMyVoice/",new Date().getTime()+".3gp"); System.out.println("Full path of record sound is : "+file.getAbsolutePath()); return file.getAbsolutePath(); } }
GREEN ENERGY SMOOTHIE BREAKFAST Green Energy Smoothie Most of the time, I feel like I need more hours in a day just to get everything done. Do you ever feel like that? It’s such a crazy, fast-paced world we live in, and it can be a struggle to finish a single task sometimes.How do you handle the craziness of life? This is how I tackle my hardships. I’m sharing with you one of my favourite smoothie recipes for 3 reasons: – super quick and easy to make – ideal to get your daily micronutrients in no time – absolutely delicious and nutritious. Try my favorite smoothie anytime of the day (I prefer to drink mine for breakfast but it’s perfect for pre and post workout).
Move the mouse over the links below The relevant code is below. Note that #FFFF00 is the color of the highlight. This produces the color yellow. Links code: <a onMouseOver="javascript:highlightLink(this, '#FFFF00');" onMouseOut="javascript:unhighlightLink(this);" HREF="index.html">This will be highlighted</a> <a onMouseOver="javascript:highlightLink(this, '#00FF00');" onMouseOut="javascript:unhighlightLink(this);" HREF="index.html">This will also be highlighted, but with different highlight color</a>
Asymmetric catalysis is one of the most powerful methods for accessing a wide range of enantiomerically enriched compounds through the action of a chiral catalyst in a variety of asymmetric reactions. In the last few years, catalytic asymmetric alkylation of carbonyl compounds, especially aldehydes, has achieved substantial interest due to employment of organozinc reagents in the presence of a variety of chiral ligands such as β-amino alcohols, amino thiols and pyridyl alcohols (review by Pu and Yu, Chem. Rev. 2001, 101, 757-824). Such asymmetric organozinc additions allow the synthesis of many chiral alcohols that are valuable precursors for the manufacture of pharmacologically and biologically active compounds. More recently, a practical application of easily accessible chiral secondary and tertiary aminoalkylnaphthols in asymmetric addition of diethylzinc to aromatic aldehydes has been reported by Liu et al., Org. Lett. 2001, 3, 2733-2735, and by Palmieri et al., Tetrahedron: Asymmetry 2002, 13, 2417-2426. Similarly, a convenient protocol for the asymmetric alkenylation of aldehydes employing a tertiary aminoalkylnaphthol ligand has been described by Chan et al., J. Org. Chemistry 2003, 68, 1589-1590. However, compared to the well established enantioselective alkylations of aldehydes, the corresponding aryl transfer reactions have not yet reached a high level of utility. Up to now, ligands which have been successfully applied to catalyze aryl transfer reactions with high enantiomeric excess (ee) are relatively rare and difficult to manufacture, e.g., catalysts based upon ligands with planar chirality such as the ferrocene derivative shown below. Thus, the development of other types of effective chiral ligands is an important challenge in the area of catalytic aryl transfer reactions, in particular, chiral ligands which are highly selective and synthetically easily accessible.
class Object # The following helpers provide a level of indirection for running the specs # against a Hash implementation that has a different name than Hash. # Returns the Hash class. unless method_defined?(:hash_class) def hash_class Hash end end # Returns a new instance of hash_class. def new_hash(*args, &block) if block hash_class.new(&block) elsif args.size == 1 value = args.first if value.is_a?(Hash) or value.is_a?(hash_class) hash_class[value] else hash_class.new value end else hash_class[*args] end end end
Q: Calling a Variable on the Command Line in VBA I have a variable in my VBA script and I'm trying to call that variable on the command line within the script. Sub Test() 'Set enviro to %APPDATA% Dim enviro As String enviro = CStr(Environ("APPDATA")) 'Create a new variable that sets the file path for the RepoDir.txt RepoPath = enviro & "\RepoDir.txt" 'Create a new variable to grab the line of text in RepoDir.txt Dim FilePath As String Dim strFirstLine As String 'The new variable calls the RepoPath Variable FilePath = RepoPath Open FilePath For Input As #1 Line Input #1, strFirstLine 'MsgBox (strFirstLine) Shell ("cmd /c cd call strFirstLine & git pull RandomSig > %TEMP%\gitPull.txt 2>&1") End Sub I am trying to call the variable strFirstLine which contains a a pathway I want the command line to read and then CD to it. Is there anyway to do this? Thank you! A: You will want to pass the value of strFirsLine, not the name. Use (example): Shell ("cmd /c cd " & strFirstLine & "git ..."
For the past two years, Joe Lukens, Marconi Society Young Scholar and Research Scientist at Oak Ridge National Laboratory, has been interested in frequency-based quantum information processing as an approach to making the quantum Internet a reality. By using ideas and models from the current Internet, Lukens believes that we can bring the benefits of the quantum Internet to people more quickly and in a more scalable way. He recently co-authored a paper in Optica by OSA outlining an approach to do just that. Creating a More Practical Quantum Internet While the classical Internet is built to transmit bits to different locations, the quantum Internet transmits quantum bits, or qubits, the basic unit of information in a quantum computer. If you have a small, low-power quantum computer in one location, you can connect it to a larger quantum computer elsewhere and transmit qubits between them. The quantum Internet would allow this on a global scale. This is easier said than done. “Qubits are so squirrely,” says Lukens. “They degrade if they interact with their environment. You cannot copy a qubit without messing it up. You cannot amplify a qubit in order to send it further. These are the intrinsic challenges of quantum information.” Frequency encoding leverages well-understood tools used in the classical Internet, such as pulse shapers and modulators, to control bits going through the system. By making the quantum Internet compatible with the classical Internet, we can make the quantum Internet more practical. Why Do We Need a Quantum Internet? While many more use cases for the quantum Internet will no doubt emerge when it is available, just like they did in the classical Internet, there are some immediate applications: Security– When we have a quantum Internet, we can realize secure information between nodes, with security based on quantum mechanics rather than computational complexity. Quantum sensing can, in principle, let you detect quantities of dangerous chemicals more quickly and effectively. With entangled quantum sensors at different locations, we may even be able to detect new physics, such as dark matter. Quantum computing – Although high in its hype cycle right now, quantum computing has real potential to solve problems that cannot be done efficiently with today’s technology. One example is Shor’s algorithm, which is an efficient way to factor large numbers. Public key cryptography exists today to let us communicate securely on the Internet precisely because of the difficulty of this problem. Quantum computing will make solving problems like Shor’s algorithm much more accessible and will become a disruptive technology in many fields. Quantum simulation – When problems become very large and cannot be solved on traditional computers, quantum computers will be able to efficiently simulate other quantum systems. This could be very useful in basic sciences to help us understand particle physics, quantum chemistry, and more generally expand our understanding of the universe on scales ranging from atoms to galaxies. What Was the Discovery? All the applications above fall under the general umbrella of “quantum information processing”—using quantum systems to encode and process data. While quantum information processing can be achieved with any quantum particle (atoms, ions, electrons, superconducting circuits), single particles of light—or photons—are the best for traveling over long distances and connecting devices in the emerging quantum Internet. In the case of Lukens and his co-authors, the focus is on how to encode, manipulate, and measure information carried in some property of the individual photons. One of the novel aspects of Lukens’ research is encoding this information in the photon’s color, or frequency, which means that the frequency of the photon corresponds to 0 or 1 – say the photon is 0 at red and 1 at green. Each frequency forms a “bin” in which a photon can exist, so that each photon can be described as a frequency-bin qubit. This is very similar to the principles of WDM, a widespread technology used in classical optical communications. WDM has great tools to control and use frequencies at high data rates, and it is only recently becoming clear how we can apply these ideas in quantum computing and make full use of these existing tools. In order to develop large quantum networks with frequency bins, we will need to be able to apply quantum gates (basic logic operations) in parallel in optical fiber. Lukens and his co-authors discovered that they could have two different qubits and that they could apply two different gates, even on the same fiber. The ability to have different gates on the same fiber and control the qubits in parallel is a technical achievement that could allow us to connect quantum nodes at different wavelengths, which otherwise would not be able to be linked together. This creates a quantum interconnect which takes quantum systems that are physically far away from each other and connects, or quantum entangles, them. This approach to building the quantum Internet leverages tools and technology from the classical Internet, providing a step forward to the many promising applications of connected quantum devices. For more detail on the solution created by Lukens and Oak Ridge colleagues Nick Peters, Brian Williams, and Pavel Lougovski, as well as Purdue collaborators Hsuan-Hao Lu and Andy Weiner, check out the full article in Optica.
Danny Rios Daniel Rios (born November 11, 1972 in Madrid, Spain) is a former professional baseball player. He played in Major League Baseball (MLB), the KBO League, and Nippon Professional Baseball (NPB). Rios's repertoire included a sharp slider, change-up and fastball around 90 mph. Youth Rios's parents were Cuban and he was born in Spain. At age 2, his family immigrated to the United States, where he grew up and went to college at the University of Miami. Yankees organization Rios signed as an amateur free agent with the New York Yankees in 1993. He debuted with the GCL Yankees, going 2–1 with a 3.52 ERA and six saves in 24 games. He had the rare honor of being the closer on a team which briefly featured Mariano Rivera (then a starter). In 1994, Rios had his first year in full-season ball, going 3–2 with 17 saves and a 0.87 ERA in 37 games for the Greensboro Bats and allowing no earned runs (2 runs overall) in 10.1 IP for the Tampa Yankees (2 saves in 9 games). Rios's composite ERA of 0.70 was presumably one of the lowest in all of the minor leagues that year. Rios remained dazzling in 1995. With Tampa, he had a 2.00 ERA, 0–4 record, 24 saves and 72 strikeouts in 67.1 IP. He finished 53 games, most in the Florida State League. Rios moved to the cusp of the major leagues in 1996. He went 3–1 with 17 saves and a 2.09 ERA for the Norwich Navigators and 4–1 with a 1.95 ERA in 24 games for the Columbus Clippers. Baseball America rated him as the #9 prospect in the Yankee system, one spot ahead of fellow right-hander Tony Armas, Jr.. Rios spent most of 1997 with Columbus, doing an effective job, if not as impressive as his prior three years. In 58 games, he went 7–4 with 3 saves and a 3.08 ERA. He was four games pitched behind teammate Dale Polley for the International League lead. He made his major league debut in rough form on May 30, relieving Ramiro Mendoza with two on and one out against the Red Sox. He promptly served up back-to-back home runs to Wil Cordero and Mo Vaughn, the first two batters he faced. An inning later, Scott Hatteberg added another homer. He had allowed 3 runs in 1 IP, all on homers. He returned to Columbus but came back to the Yankees for a game late in the year, replacing Hideki Irabu with one on and one out in the 7th inning on September 5. He allowed three straight singles, bringing in one inherited runner and one another score. After back-to-back singles to open the 8th, he was replaced by Graeme Lloyd, ending a horrible rookie year in the majors – 9 hits and 5 runs in 2 innings plus three inherited runners plated. Royals system The Yankees waived Rios in March 1998 and he was picked up by the Kansas City Royals. He threw in five games early in the year for Kansas City, but struggled. He went 0–1 with a 6.14 ERA and would never again pitch in the major leagues, though he was just 25. He went 6–7 with one save and a 5.63 ERA for the 1998 Omaha Royals, being used regularly as a starting pitcher for the first time in his professional career. Rios was moved back to the bullpen in 1999 but the results were not good. He went 10–4 with Omaha to tie for the team lead in wins and saved four games, but had a 6.07 ERA. Independent leagues and Mexico In 2000, Rios moved to the Newark Bears, going 2–3 with a 4.26 ERA. He went to the Mexican League, where he was 6–3 with a 3.12 ERA for the Algodoneros de Union Laguna. Dan was 18–5 with a 2.98 ERA for Union Laguna in 2001, finishing 9th in the Mexican League in ERA. He led the Liga in victories. South Korea Rios drew notice overseas and was picked up by the KIA Tigers. He helped the club finish second in his first season there, going 14–5 with 13 saves and a 3.14 ERA. He was 4th in the Korea Baseball Organization in ERA. He fell to 10–13 in 2003, but his 3.82 ERA still ranked 9th in the KBO. In 2004, Danny led the KBO with 223 innings pitched. He went 17–8 with a 2.87 ERA, finishing 4th in ERA behind Park Myung-hwan, Gary Rath and Bae Young-soo. He tied Rath and Bae for the league lead in wins, though Bae had six fewer losses than Rios and Rath. At age 32, the right-hander was traded mid-season to the Doosan Bears. Cumulatively, he was 15–12 with a 3.51 ERA, third in the KBO in ERA behind Son Min-han and Kim Won-hyung. He battled control problems, walking 147 in 205 IP, but also tied Bae for the KBO lead in strikeouts (also 147). Rios was 12–16 with a 2.90 ERA in 2006 for Doosan. The veteran started 2007 with a splash – through September 23, he is 20–5 with a 1.96 ERA, leading the league in wins and ERA. He became the sixth pitcher in KBO history to have won 10+ games in six consecutive seasons, following Kim Si-jin (1983–1988), Sun Dong-yeol (1986–1991), Lee Kang-chul (1989–1998), Jung Min-chul (1992–1999) and Chung Min-tae (1996–2000). At that point, his career KBO record was 88–59, 3.00. He became the first 20-game winner in the KBO since Chung won that many in 1999; KBO schedules are only 126 games, making 20-game winners rarer than in the US. He was the first foreigner to win 20 games in a year (not counting Japanese natives of South Korean descent). Rios finished 22–5 with a 2.07 ERA. He won five more games than runners-up Ryu Hyun-jin and Kenny Rayborn and his ERA was .77 was ahead of runner-up Chae Byung-ryong. He whiffed 147, second in the KBO to Ryu, to miss out on the pitching Triple Crown. It was the highest win total by a starter since Hiroaki Fukushi in 1983. Rios continued his dominance in the post-season. In game one of the 2007 Korean Series, Danny threw a four-hit shutout against the SK Wyverns. Doping case In June 2008, while playing for the Yakult Swallows in the Nippon Professional Baseball (NPB), Rios tested positive for a metabolite of the anabolic steroid stanozolol and was subsequently banned from Japanese baseball for a year. External links Rios's KBO page Rios caught doping(Dropped from Tokyo Yakult Swallows) BR page References Category:Mexican Professional Baseball Hall of Fame inductees Category:Major League Baseball pitchers Category:New York Yankees players Category:Kansas City Royals players Category:Doosan Bears players Category:Kia Tigers players Category:KBO League Most Valuable Player Award winners Category:KBO League pitchers Category:Doping cases in baseball Category:Baseball players suspended for drug offenses Category:Spanish people of Cuban descent Category:Sportspeople from Madrid Category:Expatriate baseball players in South Korea Category:Tokyo Yakult Swallows players Category:Expatriate baseball players in Japan Category:Major League Baseball players from Spain Category:Miami Hurricanes baseball players Category:1972 births Category:Living people Category:Newark Bears players
NOTE: I no longer have time to maintain this module. Please see the forks list for actively maintained projects, such as https://github.com/kahwee/backbone-deep-model backbone-deep-model =================== Improved support for models with nested attributes. Allows you to get and set nested attributes with path syntax, e.g. `user.type`. Triggers change events for changes on nested attributes. Dependencies ============ Backbone >= 0.9.10 Installation ============ 1. Include Backbone and it's dependencies in your page/app. 2. Include `distribution/deep-model.min.js` Usage ===== Then just have your models extend from Backbone.DeepModel instead of Backbone.Model. Example code: //Create models with nested attributes var model = new Backbone.DeepModel({ id: 123, user: { type: 'Spy', name: { first: 'Sterling', last: 'Archer' } }, otherSpies: [ { name: 'Lana' }, { name: 'Cyrril' } ] }); //You can bind to change events on nested attributes model.bind('change:user.name.first', function(model, val) { console.log(val); }); //Wildcards are supported model.bind('change:user.*', function() {}); //Use set with a path name for nested attributes //NOTE you must you quotation marks around the key name when using a path model.set({ 'user.name.first': 'Lana', 'user.name.last': 'Kang' }); //Use get() with path names so you can create getters later console.log(model.get('user.type')); // 'Spy' //You can use index notation to fetch from arrays console.log(model.get('otherSpies.0.name')) //'Lana' Author ====== Charles Davison - [powmedia](http://github.com/powmedia) Contributors ============ - [mattyway](https://github.com/mattyway) - [AsaAyers](https://github.com/AsaAyers) Changelog ========= master: - Add supprt for arrays in nested attributes (sqren) 0.11.0: - Trigger change events only once (restorer) 0.10.4: - Fix #68 Model or collection in attributes are eliminated when defaults are used 0.10.0: - Support Backbone 0.9.10 0.9.0: - Support Backbone 0.9.9 (mattyway) - Add support for deep model defaults (mattyway) 0.8.0: - Allow nested attribute as Model identifier (milosdakic) - Add AMD support (drd0rk) - Added "change:*" event triggers for ancestors of nested attributes. (jessehouchins) - JSHint linting (tony) - Fix: undefined in setNested resulting from a recent change in backbone master. (evadnoob) 0.7.4: - Fix: #22 model.hasChanged() is not reset after change event fires - Fix: #18 Setting a deep property to the same value deletes the property (mikefrey) - Allow setting nested attributes inside an attribute whose value is currently null (sqs) 0.7.3: - Add DeepModel.keyPathSeparator to allow using custom path separators 0.7.2: - Check if the child object exists, but isn't an object. #12 (tgriesser) 0.7.1: - Model.changedAttributes now works with nested attributes. - Fix getting attribute that is an empty object 0.7: - Update for Backbone v0.9.2
[Antibiotic sensitivity of streptococci of the A, B, C and G serogroups isolated in 1987-1990]. Antibiotic susceptibility of 1114 cultures of beta-hemolytic streptococci belonging to serogroups A, B, C and G was tested. The cultures were isolated from healthy and diseased children and adults. Group A, C and G streptococci were shown to be highly susceptible to beta-lactams, erythromycin, lincomycin, chloramphenicol and ristomycin. Erythromycin, lincomycin, ristomycin and ampicillin (a beta-lactam) proved to be the most active antibiotics against group B streptococci. Streptococci of the four groups had low susceptibility to tetracycline and especially gentamicin. The different antibiotic susceptibility of the streptococcal cultures isolated from the diseased and healthy children and adults is discussed.
[Genetic diversity of Citrus succosa Hort. Ex Tanaka from seven provinces as revealed by AFLP analysis]. Using 28 selected primer combinations, 12 accessions of Bendizao tangerine from seven provinces were investigated by AFLP analysis. A total of 882 genetic sites were detected, among which 192 were polymorphic. Using Huangyan Bendizao as contrast, the polymorphic sites of the other 11 accessions from seven provinces are not very high (3.5%-10.54%), and the number of different sites between accessions from other provinces is higher than that from Zhejiang province, which indicates that the ecological difference can partially contribute the formation of the genetic diversity. Genetic distance and dendrogram showed considerably close relatedness among the 12 accessions, and the max genetic distance was 0.229. The genetic analysis of the 12 accessions from seven provinces can provide useful information for the relationship between the formation of genetic variation and environmental difference and can facilitate the genetic improvement of this cultivar.
Pages Thursday, April 29, 2010 Biryani with beautiful aroma and spice A beautiful aroma and mild in spices, it was quick to make and tasty. The recipe is from my aunt and the children loved the taste. I tried with chicken, it is the same for lamb or beef adjust the amount of water and salt depending on the rice and meat used. 500 g basmati or any other type of rice water for basmati 1/2 inch above the rice salt Prepare the rice in a rice cooker. After the rice is cooked add 1/2 tsp of margarine and yellow dye into the rice and toss 500 g chicken pinch of nutmeg 1" cinnamon 1 cardamom 1 clove 10 cadju or 15 toor dal 1 tsp coriander seeds 10 pepper seeds 1 tsp cumin seeds 1/2 tsp fennel seeds 1 tsp chillie powder 1/4 tsp turmeric 1/2 tsp salt Roast the spices a little and grind it finely, then marinate the chicken for 1/2 hour with the spices. 1/4 cup oil onion cinnamon, cardomom, cloves 1/2 tsp ginger garlic paste 200 g tomato Heat oil add onion when it is golden brown remove and keep aside. Add the cinnamon, cardamom and cloves, then add ginger garlic paste and tomatoes. When the tomato separates from the oil add the marinated chicken. Mix well add about a cup of water and cook until the gravy thickens. Add the cooked rice to the chicken, toss it. Decorate the rice with the fried onion, coriander leaves, cadjus and raisins. Keep it covered with foil for about 15 minutes before serving.
A South Carolina father facing a death penalty trial in the slayings of his five children exploded in a selfish rage after his son ruined an electrical outlet and then spent days driving around with their bodies, trying to figure out how to hide the crime, prosecutors said Tuesday, But in the defense's opening statement, Timothy Jones Jr.'s lawyer said the computer engineer had schizophrenia and was insane — his thin grasp on reality broken by his ex-wife's infidelity, the struggle of raising five young children on his own and a feeling he was failing God. Jones, 37, is charged with five counts of murder. Prosecutors said he killed 6-year-old Nahtahn in a rage after finding the boy, fascinated by electricity, had broken an outlet in their home near Lexington in August 2014. Jones then strangled 8-year-old Mera and 7-year-old Elias with his hands and 2-year-old Gabriel and 1-year-old Abigail with a belt, prosecutor Shawn Graham said "A father is supposed to love his children. Tim Jones loved himself more," Graham said in his opening statement, halted briefly when he appeared to choke up. Authorities pieced together the case using Jones' own words to police, bizarre web searches on his smartphone and handwritten notes found in his SUV nine days after the killings, after he dumped the bodies on a rural hillside near Camden, Alabama, and a police officer at a Smith County, Mississippi, traffic checkpoint arrested Jones as his vehicle smelled "like death," Graham said. But Jones' lawyer compared the father's mental state to a forest. He said there were some healthy trees, like a high-paying job, but almost all the other trees were diseased and fragile and exploded in a raging fire because of all the stress. The problems started when Jones' ex-wife had an affair with a neighbor around the time she was pregnant with their fifth child and Jones won full custody of the children, defense lawyer Rod Madsen said. Jones turned to drugs to medicate himself, which made his schizophrenia worse. He made bad financial decisions and took his kids' problems processing their parents' divorce as his own failings as a dad, Madsen said. Jones was deeply religious, but while he could memorize verses of Scripture, he could not explain their application to life or what they meant, Madsen said. "For him, it was a failure of faith. He must not be doing what the Bible told him to do," Madsen said. After killing his children, wrapping their bodies in plastic and putting them in his SUV, Jones drove around aimlessly, listening to voices in his head, his lawyer said. "He wasn't ready to let them go. He thought that was his way to spend time with them. He even played them songs," Madsen said. Jones finally left their bodies after a voice told him to cut off one of his son's legs and he couldn't do it. "He said a prayer and said goodbye," Madsen said. Graham said prosecutors are convinced that Jones knew right from wrong. He asked the jurors to listen carefully to the parade of mental health experts who will testify as the trial will likely stretch into June. Graham said they should weigh whether they are being told a fact that can be verified or something Jones told them. "Are they trying to look for the truth, or are they looking for a defense or an excuse?" Graham said. Jones' trial is being livestreamed from the Lexington County courthouse. ___ Follow Jeffrey Collins on Twitter at https://twitter.com/JSCollinsAP . Read his work at https://apnews.com/search/jeffrey%20collins
<?php /** * Copyright © Magento, Inc. All rights reserved. * See COPYING.txt for license details. */ namespace Magento\Framework\Model\ResourceModel\Db\Collection; use \Magento\Framework\App\ResourceConnection\SourceProviderInterface; use \Magento\Framework\Data\Collection\AbstractDb; /** * Abstract Resource Collection * * phpcs:disable Magento2.Classes.AbstractApi * @api * @SuppressWarnings(PHPMD.NumberOfChildren) */ abstract class AbstractCollection extends AbstractDb implements SourceProviderInterface { /** * Model name * * @var string */ protected $_model; /** * Resource model name * * @var string */ protected $_resourceModel; /** * Resource instance * * @var \Magento\Framework\Model\ResourceModel\Db\AbstractDb */ protected $_resource; /** * Fields to select in query * * @var array|null */ protected $_fieldsToSelect = null; /** * Expression fields to select in query. * * @var array */ private $expressionFieldsToSelect = []; /** * Fields initial fields to select like id_field * * @var array|null */ protected $_initialFieldsToSelect = null; /** * Fields to select changed flag * * @var boolean */ protected $_fieldsToSelectChanged = false; /** * Store joined tables here * * @var array */ protected $_joinedTables = []; /** * Collection main table * * @var string */ protected $_mainTable = null; /** * Reset items data changed flag * * @var boolean */ protected $_resetItemsDataChanged = false; /** * Name prefix of events that are dispatched by model * * @var string */ protected $_eventPrefix = ''; /** * Name of event parameter * * @var string */ protected $_eventObject = ''; /** * Event manager proxy * * @var \Magento\Framework\Event\ManagerInterface */ protected $_eventManager = null; /** * @param \Magento\Framework\Data\Collection\EntityFactoryInterface $entityFactory * @param \Psr\Log\LoggerInterface $logger * @param \Magento\Framework\Data\Collection\Db\FetchStrategyInterface $fetchStrategy * @param \Magento\Framework\Event\ManagerInterface $eventManager * @param \Magento\Framework\DB\Adapter\AdapterInterface $connection * @param \Magento\Framework\Model\ResourceModel\Db\AbstractDb $resource */ public function __construct( \Magento\Framework\Data\Collection\EntityFactoryInterface $entityFactory, \Psr\Log\LoggerInterface $logger, \Magento\Framework\Data\Collection\Db\FetchStrategyInterface $fetchStrategy, \Magento\Framework\Event\ManagerInterface $eventManager, \Magento\Framework\DB\Adapter\AdapterInterface $connection = null, \Magento\Framework\Model\ResourceModel\Db\AbstractDb $resource = null ) { $this->_eventManager = $eventManager; parent::__construct($entityFactory, $logger, $fetchStrategy, $connection); $this->_construct(); $this->_resource = $resource; $this->setConnection($this->getResource()->getConnection()); $this->_initSelect(); } /** * Initialization here * * @return void */ protected function _construct() //phpcs:ignore Magento2.CodeAnalysis.EmptyBlock { } /** * Retrieve main table * * @return string */ public function getMainTable() { if ($this->_mainTable === null) { $this->setMainTable($this->getResource()->getMainTable()); } return $this->_mainTable; } /** * Set main collection table * * @param string $table * @return $this */ public function setMainTable($table) { $table = $this->getTable($table); if ($this->_mainTable !== null && $table !== $this->_mainTable && $this->getSelect() !== null) { $from = $this->getSelect()->getPart(\Magento\Framework\DB\Select::FROM); if (isset($from['main_table'])) { $from['main_table']['tableName'] = $table; } $this->getSelect()->setPart(\Magento\Framework\DB\Select::FROM, $from); } $this->_mainTable = $table; return $this; } /** * @inheritdoc */ protected function _initSelect() { $this->getSelect()->from(['main_table' => $this->getMainTable()]); return $this; } /** * Get \Magento\Framework\DB\Select instance and applies fields to select if needed * * @return \Magento\Framework\DB\Select */ public function getSelect() { if ($this->_select && $this->_fieldsToSelectChanged) { $this->_fieldsToSelectChanged = false; $this->_initSelectFields(); } return parent::getSelect(); } /** * Init fields for select * * @return $this * @SuppressWarnings(PHPMD.CyclomaticComplexity) * @SuppressWarnings(PHPMD.NPathComplexity) */ protected function _initSelectFields() { $columns = $this->_select->getPart(\Magento\Framework\DB\Select::COLUMNS); $columnsToSelect = []; foreach ($columns as $columnEntry) { list($correlationName, $column, $alias) = $columnEntry; if ($correlationName !== 'main_table' || isset($this->expressionFieldsToSelect[$alias])) { // Add joined fields to select if ($column instanceof \Zend_Db_Expr) { $column = $column->__toString(); } $key = $alias !== null ? $alias : $column; $columnsToSelect[$key] = $columnEntry; } } $columns = $columnsToSelect; $columnsToSelect = array_keys($columnsToSelect); if ($this->_fieldsToSelect !== null) { $insertIndex = 0; foreach ($this->_fieldsToSelect as $alias => $field) { if (!is_string($alias)) { $alias = null; } if ($field instanceof \Zend_Db_Expr) { $column = $field->__toString(); } else { $column = $field; } if ($alias !== null && in_array($alias, $columnsToSelect) || // If field already joined from another table $alias === null && isset($alias, $columnsToSelect) ) { continue; } $columnEntry = ['main_table', $field, $alias]; array_splice($columns, $insertIndex, 0, [$columnEntry]); // Insert column $insertIndex++; } } else { array_unshift($columns, ['main_table', '*', null]); } $this->_select->setPart(\Magento\Framework\DB\Select::COLUMNS, $columns); return $this; } /** * Retrieve initial fields to select like id field * * @return array */ protected function _getInitialFieldsToSelect() { if ($this->_initialFieldsToSelect === null) { $this->_initialFieldsToSelect = []; $this->_initInitialFieldsToSelect(); } return $this->_initialFieldsToSelect; } /** * Initialize initial fields to select like id field * * @return $this */ protected function _initInitialFieldsToSelect() { $idFieldName = $this->getResource()->getIdFieldName(); if ($idFieldName) { $this->_initialFieldsToSelect[] = $idFieldName; } return $this; } /** * Add field to select * * @param string|array $field * @param string|null $alias * @return $this */ public function addFieldToSelect($field, $alias = null) { if ($field === '*') { // If we will select all fields $this->_fieldsToSelect = null; $this->_fieldsToSelectChanged = true; return $this; } if (is_array($field)) { if ($this->_fieldsToSelect === null) { $this->_fieldsToSelect = $this->_getInitialFieldsToSelect(); } foreach ($field as $key => $value) { $this->addFieldToSelect($value, is_string($key) ? $key : null); } $this->_fieldsToSelectChanged = true; return $this; } if ($alias === null) { $this->_fieldsToSelect[] = $field; } else { $this->_fieldsToSelect[$alias] = $field; } $this->_fieldsToSelectChanged = true; return $this; } /** * Add attribute expression (SUM, COUNT, etc) * Example: ('sub_total', 'SUM({{attribute}})', 'revenue') * Example: ('sub_total', 'SUM({{revenue}})', 'revenue') * For some functions like SUM use groupByAttribute. * * @param string $alias * @param string $expression * @param array|string $fields * @return $this */ public function addExpressionFieldToSelect($alias, $expression, $fields) { // validate alias if (!is_array($fields)) { $fields = [$fields => $fields]; } $fullExpression = $expression; foreach ($fields as $fieldKey => $fieldItem) { $fullExpression = str_replace('{{' . $fieldKey . '}}', $fieldItem, $fullExpression); } $this->getSelect()->columns([$alias => $fullExpression]); $this->expressionFieldsToSelect[$alias] = $fullExpression; return $this; } /** * Removes field from select * * @param string|null $field * @param bool $isAlias Alias identifier * @return $this */ public function removeFieldFromSelect($field, $isAlias = false) { if ($isAlias) { if (isset($this->_fieldsToSelect[$field])) { unset($this->_fieldsToSelect[$field]); $this->_fieldsToSelectChanged = true; } } else { foreach ($this->_fieldsToSelect as $key => $value) { if ($value === $field) { unset($this->_fieldsToSelect[$key]); $this->_fieldsToSelectChanged = true; break; } } } return $this; } /** * Removes all fields from select * * @return $this */ public function removeAllFieldsFromSelect() { $this->_fieldsToSelect = $this->_getInitialFieldsToSelect(); $this->_fieldsToSelectChanged = true; return $this; } /** * Standard resource collection initialization * * @param string $model * @param string $resourceModel * @return $this */ protected function _init($model, $resourceModel) { $this->setModel($model); $this->setResourceModel($resourceModel); return $this; } /** * Set model name for collection items * * @param string $model * @return $this */ public function setModel($model) { if (is_string($model)) { $this->_model = $model; $this->setItemObjectClass($model); } return $this; } /** * Get model instance * * @return string */ public function getModelName() { return $this->_model; } /** * Set resource model name for collection items * * @param string $model * @return void */ public function setResourceModel($model) { $this->_resourceModel = $model; } /** * Retrieve resource model name * * @return string */ public function getResourceModelName() { return $this->_resourceModel; } /** * Get resource instance * * @return \Magento\Framework\Model\ResourceModel\Db\AbstractDb */ public function getResource() { if (empty($this->_resource)) { $this->_resource = \Magento\Framework\App\ObjectManager::getInstance()->create( $this->getResourceModelName() ); } return $this->_resource; } /** * Retrieve table name * * @param string $table * @return string */ public function getTable($table) { return $this->getResource()->getTable($table); } /** * Retrieve all ids for collection * * @return array */ public function getAllIds() { $idsSelect = clone $this->getSelect(); $idsSelect->reset(\Magento\Framework\DB\Select::ORDER); $idsSelect->reset(\Magento\Framework\DB\Select::LIMIT_COUNT); $idsSelect->reset(\Magento\Framework\DB\Select::LIMIT_OFFSET); $idsSelect->reset(\Magento\Framework\DB\Select::COLUMNS); $idsSelect->columns($this->getResource()->getIdFieldName(), 'main_table'); return $this->getConnection()->fetchCol($idsSelect, $this->_bindParams); } /** * Join table to collection select * * @param string|array $table * @param string $cond * @param string|array $cols * @return $this */ public function join($table, $cond, $cols = '*') { if (is_array($table)) { foreach ($table as $k => $v) { $alias = $k; $table = $v; break; } } else { $alias = $table; } if (!isset($this->_joinedTables[$alias])) { $this->getSelect()->join([$alias => $this->getTable($table)], $cond, $cols); $this->_joinedTables[$alias] = true; } return $this; } /** * Redeclare before load method for adding event * * @return $this */ protected function _beforeLoad() { parent::_beforeLoad(); $this->_eventManager->dispatch('core_collection_abstract_load_before', ['collection' => $this]); if ($this->_eventPrefix && $this->_eventObject) { $this->_eventManager->dispatch($this->_eventPrefix . '_load_before', [$this->_eventObject => $this]); } return $this; } /** * Set reset items data changed flag * * @param bool $flag * @return $this */ public function setResetItemsDataChanged($flag) { $this->_resetItemsDataChanged = (bool)$flag; return $this; } /** * Set flag data has changed to all collection items * * @return $this */ public function resetItemsDataChanged() { foreach ($this->_items as $item) { $item->setDataChanges(false); } return $this; } /** * Redeclare after load method for specifying collection items original data * * @return $this */ protected function _afterLoad() { parent::_afterLoad(); foreach ($this->_items as $item) { $item->setOrigData(); if ($this->_resetItemsDataChanged && ($item instanceof \Magento\Framework\Model\AbstractModel)) { $item->setDataChanges(false); } } $this->_eventManager->dispatch('core_collection_abstract_load_after', ['collection' => $this]); if ($this->_eventPrefix && $this->_eventObject) { $this->_eventManager->dispatch($this->_eventPrefix . '_load_after', [$this->_eventObject => $this]); } return $this; } /** * Save all the entities in the collection * * @return $this */ public function save() { foreach ($this->getItems() as $item) { $item->save(); } return $this; } /** * @inheritdoc * @since 100.0.11 */ public function __sleep() { return array_diff( parent::__sleep(), ['_resource', '_eventManager'] ); } /** * @inheritdoc * @since 100.0.11 */ public function __wakeup() { parent::__wakeup(); $objectManager = \Magento\Framework\App\ObjectManager::getInstance(); $this->_eventManager = $objectManager->get(\Magento\Framework\Event\ManagerInterface::class); } }
2014 Newsroom B-CU Hosts Divine Nine Presidents Retreat Daytona Beach, FL - The top decision makers of the largest, Black Greek letter organizations will come together for a retreat at Bethune-Cookman University this weekend. The attendees will include: Paulette Walker, President of Delta Sigma Theta Sorority, Inc.; Mark Tillman, President of Alpha Phi Alpha Fraternity, Inc.; Dorothy Wilson, International President of Alpha Kappa Alpha Sorority, Inc.; Thomas Battles, Jr., Senior Grand Vice Polemarch of Kappa Alpha Psi Fraternity, Inc.; Mary Wright, President of Zeta Phi Beta Sorority, Inc.; Tony Knox, Grand Basileus of Omega Psi Phi Fraternity, Inc.; Bonita Herring, Grand Basileus of Sigma Gamma Rho Sorority, Inc.; Johnathan Mason, Sr., President of Phi Beta Sigma Fraternity, Inc.; and Robert Clark, Grand Polaris of Iota Phi Theta Fraternity, Inc. These nine organizations make up the National Pan-Hellenic Council, which promotes unity and interaction through forums, meetings and other activities. This will be the first official retreat since 2007; and the leaders are anxious to come together with a set agenda. The desired outcome of this retreat is to share partnership ideas, business strategies and offer possible resolutions to mutual concerns. President Jackson is excited to host such an illustrious group of guests on the campus of B-CU. "We are overjoyed that the Presidents of the Divine Nine have chosen to convene here on our campus. Our founder, Mary McLeod-Bethune, was an honorary member of the Divine Nine and these organizations are a large part of our campus culture," says President Jackson. Jennifer Jones, President of the National Pan-Hellenic Council, is optimistic about this weekend's event and credits B-CU with helping to create a great experience for these leaders. "We reached out to B-CU to host this event and they agreed. They have been extremely helpful; and it's been a great partnership," says Jones. The presidents will travel to Daytona Beach today and formally meet on Friday and Saturday. There are no planned receptions or outside events surrounding the retreat. For more information and media inquiries, please contact Keisha Boyd -boydk@cookman.edu or (386)214-3653. Bethune-Cookman University was founded in 1904 and serves the community via three campuses in Daytona Beach, Deltona and Hastings. For more information, visitwww.cookman.edu. ### Office of Communications About Bethune Cookman University: Founded in 1904 by Dr. Mary McLeod Bethune, Bethune-Cookman University (B-CU) today sustains her legacy of faith, scholarship and service through its relationship with the United Methodist Church and its commitment to academic excellence and civic engagement. B-CU offers 38 degrees on its main campus and online college. Located in Daytona Beach, B-CU is one of three private, historically black colleges in the state of Florida. The institution boasts a diverse and international faculty and student body of nearly 4,000. For more information, visit www.cookman.edu.
Introduction ============ Glaciers cover approximately 10% of the land surface on the Earth ([@ref-64]) and are important components of the hydrological cycle providing vital water resources ([@ref-7]; [@ref-39]; [@ref-102]). However, glaciers are shrinking rapidly across the world due to accelerating global warming ([@ref-51]; [@ref-92]; [@ref-60]), and most of them are expected to disappear by 2050 ([@ref-103]; [@ref-52]). As a prominent component of the glacier forefront, glacier-fed streams have a highly heterogeneous environment due to longitudinal alterations of landcover, river hydrology and morphology, sediment transport, and biogeochemical processes ([@ref-48]; [@ref-57]; [@ref-49]; [@ref-64]). For example, from glacier terminus to downstream, terrestrial vegetation increases ([@ref-104]; [@ref-77]), stream channel lengthens ([@ref-63]; [@ref-83]), and water source compositions changes ([@ref-15]). Biofilms are hot spots of microbial diversity and activity in stream ecosystems ([@ref-40]; [@ref-8]). Within stream biofilms, bacteria, fungi, and algae are the major components driving the bulk of metabolism and biogeochemical processes ([@ref-14]; [@ref-9]; [@ref-98]). The changing environment presents significant challenges for glacier-fed stream ecosystems. Previous studies have revealed that factors associated with glacier shrinkage have significant influences on the composition, diversity, and functional potential of bacterial communities in stream biofilms ([@ref-101], [@ref-100]; [@ref-78]; [@ref-79]). However, fungal communities in glacial systems are rarely studied ([@ref-32]; [@ref-3]). With the decrease in elevation, glacier coverage, and glacier source contribution to streamflow, as well as increase in distance to glacier terminus, bacterial communities showed increased alpha diversity as well as distinct taxonomic and functional compositions ([@ref-101], [@ref-100]; [@ref-78]; [@ref-79]). Biodiversity is important for generating and stabilizing ecosystem structure and functions ([@ref-59]; [@ref-94]). The positive effects of local species richness (alpha diversity) on ecosystem functioning have been widely confirmed by a growing number of studies ([@ref-25]; [@ref-21]; [@ref-29]). However, comparing to alpha diversity, beta diversity is an underexplored facet of biodiversity ([@ref-67]), which accumulates from compositional variations among local assemblages and provides insights into the mechanisms underlining biodiversity changes and their ecological consequences ([@ref-2]; [@ref-91]). For ecological communities suffering intensive environmental fluctuations and disturbances, focusing on beta diversity is especially important ([@ref-67]). In addition, microorganisms in many environments often coexist in a complex network with positive and negative interactions among members, playing pivotal roles in community assembly ([@ref-35]; [@ref-6]; [@ref-90]). These interactions may imply biologically or biochemically meaningful relationships between microorganisms ([@ref-99]). Microbial co-occurrence networks can reveal how taxa potentially interact with each other, how diverse taxa structure networks, and how networks are compartmentalized into modules of closely associated taxa, as well as how microbial communities responded to environmental variations ([@ref-71]; [@ref-35]; [@ref-27]; [@ref-4]). In addition, modularity (the tendency of a network to contain sub-clusters of nodes) is an important ecological feature in many biological systems, providing opportunities to identify highly connected taxa and integrate high dimension data into predicted ecological modules ([@ref-27]; [@ref-90]). A module is defined as a group of densely connected operational taxonomic units (OTUs), which have less links with OTUs belonging to other modules ([@ref-90]), forming a clustered network topology ([@ref-6]). Modules can help to reveal more ecological and evolutionary properties ([@ref-93]; [@ref-74]), which are easily overlooked when communities are studied as a whole or in taxonomic groups ([@ref-75]; [@ref-10]; [@ref-27]). The relationships between microbial modules and environmental variables can improve our understanding of the influences of environmental variation on microbial community assembly ([@ref-58]; [@ref-27]; [@ref-95]). However, previous studies in glacier-fed streams have only focused on the whole communities or certain taxonomic groups of bacteria and fungi ([@ref-82]; [@ref-63]; [@ref-101]; [@ref-78]). The network and modularity features of bacterial and fungal communities in glacier-fed streams are remaining one of our knowledge gaps. Integrating beta diversity and network modularity can provide novel insights into assembly mechanisms of microbial communities in glacier-fed streams. Glacier-fed streams in Tian Shan Mountains in Central Asia are particularly vulnerable to climate change, where glaciers contribute significantly to stream runoff ([@ref-1]; [@ref-44]; [@ref-92]). Glacier shrinkage has been observed in the past decades ([@ref-33]) and will accelerate in the coming decades as temperature increases ([@ref-55]; [@ref-38]). Here, we investigated bacterial and fungal communities in two glacier-fed streams using high-throughput sequencing combined with hydrological modeling. We aimed to examine the microbial co-occurrence networks (considering both fungal and bacterial communities) and to assess their response patterns to environmental variation in these glacier-fed streams. In glacier foreland soil, bacterial and fungal communities had contrasting community structures and response patterns to environmental variables ([@ref-11]; [@ref-13]; [@ref-17]). Glacier-fed streams have intimate connections with terrestrial ecosystems in the glacier foreland through multiple ways ([@ref-26]; [@ref-43]; [@ref-85]). Thus, we hypothesize that bacterial and fungal communities in glacier-fed streams have contrasting assembly mechanisms and respond differently to environmental variation. Materials and Methods ===================== Study area ---------- The Tian Shan mountains, known as the "water tower of Central Asia," span a large area of Central Asia from northwestern China to southeastern Kazakhstan and from Kyrgyzstan to Uzbekistan ([Fig. 1](#fig-1){ref-type="fig"}). In Tian Shan area, glaciers contribute considerably to water resources and play an important role in streamflow regimes ([@ref-92]; [@ref-97]). In China's portion of the Tian Shan Mountains, there are 7,934 glaciers with a total area of 7,179 km^2^ and a total volume of 707 km^3^ ([@ref-42]). However, glaciers in the Tian Shan Mountains are extremely sensitive to global warming ([@ref-55]) and have been shrinking rapidly due to climate warming since the 1970s ([@ref-69]; [@ref-33]). For example, Urumqi Glacier No. 1 (GN1, 43°06′N, 86°49′E) is located in eastern Tian Shan Mountain at the headwater of the Urumqi River ([Fig. 1](#fig-1){ref-type="fig"}) and retreated from an area of 1.95 km^2^ in 1962 to 1.65 km^2^ in 2010 ([@ref-105]). In 2050, GN1 will likely lose up to 54% of the glacier area and 79% of the ice volume relative to 1980 ([@ref-38]). ![Map of the study area.\ (A) Location of the study area. (B) Elevation distribution of the study area. GN1 represents Urumqi Glacier No. 1. (C) The Normalized difference of vegetation index (NDVI) of the study area.](peerj-07-7715-g001){#fig-1} Field sampling -------------- In June 2016, we investigated two glacier-fed streams in the Tian Shan Mountain. Water samples and benthic biofilm samples were collected from 11 sample sites in total spanning from the elevation of 3,828 to 2,646 m ([Fig. 1](#fig-1){ref-type="fig"}). The sample sites were chosen along the streams in order to have heterogeneous environments, including different land vegetation and hydrological properties such as glacier contributions to stream flow. However, due to the constraint of accessibility, the sites were not spaced at equal intervals. At each sample site, six to nine submerged rocks were randomly sampled from the stream cross section below 10 cm. A sterilized nylon brush was used to remove the benthic biofilm from each stone in an area of 4.5 cm diameter on the upper surface. The slurry was rinsed with 500 mL sterile water. Approximately 10 mL of the mixed slurry was filtered through a 0.2-μm polycarbonate membrane filter (Whatman, Maidstone, UK) which was immediately frozen in liquid nitrogen in the field. After transported to the lab, the benthic biofilm samples were stored under −80 °C until DNA extraction. In addition, 500 mL water samples were collected for chemical analyses with three replications and stored under 4 °C. Environmental factors --------------------- At each sample site, pH, conductivity (Cond), and elevation were measured in situ using a handheld pH meter (PHI 400 Series; Beckman Coulter, Brea, CA, USA), YSI meter (model 80, Yellow Springs, OH, USA), and GPS unit (Triton 500; Magellan, Santa Clara, CA, USA), respectively. Unfiltered water samples were directly used to measure total nitrogen (TN) and total phosphorus (TP). TN was analyzed by ion chromatography with prior persulfate oxidation (EPA 300.0). TP was analyzed using the ammonium molybdate method with prior oxidation (EPA 365.3). Filtered water samples (filtered with pre-combusted GF/F filters) were used to test nitrate (NO~3~^−^), ammonium (NH~4~^+^), soluble reactive phosphorus (SRP), and dissolved organic carbon (DOC). NO~3~^−^ was analyzed using ion chromatography (EPA 300.0). NH~4~^+^ was analyzed using the indophenol colorimetric method (EPA 350.1). SRP was measured according to the ammonium molybdate method (EPA 365.3). DOC was measured using a total organic carbon (TOC) analyzer (TOC-VCPH; Shimadzu Scientific Instruments, Columbia, MD, USA). Water chemistry data was reported in our previous research ([@ref-78]). In glacier-fed streams, both biotic and abiotic environments are tightly linked to the relative contributions of glacier melt and runoff to the stream flow ([@ref-62]; [@ref-45]; [@ref-56]). According to the landscape-based hydrological model proposed by [@ref-37], [@ref-36]), we classified the landscape into glaciated and non-glaciated. For each sample site, the proportion of glaciated area (GA) in its sub-catchment was calculated and the proportion of glacier source water (GS) in the total runoff was derived from the model ([@ref-37], [@ref-36]). The hydrological distance to glacier terminus (GD) was measured according to the river channel network ([Fig. 1](#fig-1){ref-type="fig"}). These hydrological parameters were also reported in our previous research ([@ref-78]). In the study area, the vegetation (grassland) status was measured by the normalized difference vegetation index (NDVI) using the Terra moderate resolution imaging spectroradiometer Vegetation Indices (MOD13Q1) Version 6 data downloaded from USGS (<https://earthexplorer.usgs.gov/>) ([Fig. 1](#fig-1){ref-type="fig"}). The MOD13Q1 product was generated on June 26, 2017 and has a resolution of 250 m. NDVI is calculated based on the absorption of red light and the reflection of infrared radiation by vegetation ([@ref-84]). The equation is represented as NDVI = (NIR − RED)/(NIR + RED), where NIR is near infrared reflectance and RED is visible red reflectance. It has been demonstrated that NDVI exhibits close relationships with above-ground vegetation biomass and coverage ([@ref-22]; [@ref-30]; [@ref-80]). For each stream site, the average NDVI of its sub-catchment (the upstream area of the stream site) was calculated as the mean NDVI of each pixel in the sub-catchment. DNA extraction, PCR, and sequencing ----------------------------------- Bacterial 16S rRNA gene sequences and fungal 18S rRNA gene sequences were analyzed to determine the bacterial community (BC) and fungal community (FC), respectively. To determine the fungal community, the internal transcribed spacer regions and 18S rRNA genes are commonly used and provide similar results and congruent conclusions ([@ref-18]). We used 18S rRNA gene sequencing to detect the fungal community in this study. DNA was extracted using the PowerSoil DNA Isolation Kit (MoBio, Carlsbad, CA, USA) following the manufacturer's protocol. The V3--V4 regions of the 16S rRNA genes were amplified using the bacterium-specific forward and reverse primers 338F-ACTCCTACGGGAGGCAGCA and 806R-GGACTACHVGGGTWTCTAAT (Invitrogen, Vienna, Austria) ([@ref-50]; [@ref-61]; [@ref-20]). The V4--V5 regions of the 18S rRNA genes were amplified using the fungus-specific forward and reverse primers 817F-TTAGCATGGAATAATRRAATAGGA and 1196R-TCTGGACCTGGTGAGTTTCC-3′ (Invitrogen, Vienna, Austria) ([@ref-12]). The forward primers were barcoded, and the barcodes were designed considering the balanced guanine--cytosine content, minimal homopolymer runs, and no self-complementarity of more than two bases to reduce internal hairpin propensity ([@ref-47]). PCR reaction systems were prepared using a Premix Taq Kit (Code No. RR902A; Takara, Kusatsu,, Japan) according to the manufacturer's instructions. The total volume of each PCR reaction was 20 μL, containing 10 μL of 2×EX Premix Taq™ Polymerase, one μL of forward primer, one μL of reverse primer, one μL of NDA extraction, and seven μL of Nuclease-free water. The PCR reactions were conducted with a thermal cycler (ABI 2700, SeqGen, Torrance, CA, USA) with a temperature profile of 1-min hot start at 80 °C, followed by pre-denaturation at 94 °C for 5 min, 30 cycles of amplification (denaturation at 94 °C for 30 s, annealing at 52 °C for 30 s, and extension at 72 °C for 90 s), and a final extension at 72 °C for 10 min. The PCR amplicons were verified in 1.0% agarose with 1× TAE buffer using electrophoresis, purified using the Gel Extraction Kit (Qiagen, Hilden, Germany), and quantified by Qubit 2.0 Fluorometer (Invitrogen, Carlsbad, CA, USA). One of the fungi sample (N2) was not successfully amplified. The purified and quantified DNA libraries were then pooled together according to their concentrations. The pooled library was sequenced on an Illumina MiSeq (PE300) sequencing platform. Analyses -------- Raw sequence data of bacterial 16S rRNA (available at NCBI, [PRJNA398147](PRJNA398147), [SRP115356](SRP115356)) and fungal 18S rRNA (available at NCBI, [PRJNA542974](PRJNA542974), [SRP198430](SRP198430)) were processed using QIIME 1.9.0 ([@ref-19]). The forward and reverse reads were merged. The merged sequences were then assigned to samples based on the barcode. The barcode and primer sequence were cut off to truncate the sequences. The sequences with length \>200 bp and mean quality score \<20 were discarded. Using UCHIME algorithm ([@ref-31]), the chimeric sequences were detected and removed. Finally, the effective sequences of 16S and 18S rRNA were grouped into OTUs against the Silva 132 database at 99% threshold. All the analyzed environmental variables, including GD, GA, GS, NDVI, elevation, pH, Cond, TN, NO~3~^−^, NH~4~^+^, TP, SRP, and DOC, were standardized using the "normalize" method in *decostand* function in vegan 2.5-3 package ([@ref-73]). Spearman correlation analyses (*cor* function in stats v3.6.0 package) were used to assess the pairwise relationships between environmental variables and visualized using *corrplot* function in corrplot 0.84 package. Mantel tests (*mantel* function in vegan 2.5-3 package) were used to assess the relationships among spatial dissimilarity (represented by geographic distance), overall environmental distance, hydrological dissimilarity, nutrient dissimilarity, and vegetation dissimilarity. Partial Mantel tests (*mantel.partial* function in vegan 2.5-3 package) were used to assess those relationships by controlling nutrient dissimilarity. The geographic distance was calculated based on the GPS coordinates of sample sites using *distGeo* function in geosphere 1.5-10 package. The environmental distance was represented by Euclidean distance based on all analyzed environmental variables. Hydrological dissimilarity was represented by Euclidean distance based on GD, GA, and GS. Nutrient dissimilarity was represented by Euclidean distance based on TN, NO~3~^−^, NH~4~^+^, TP, and SRP. Vegetation dissimilarity was represented by Euclidean distance based on NDVI. Euclidean distances were calculated using *vegdist* function in vegan 2.5-3 package ([@ref-73]). All the above statistical analyses were conducted in R 3.5.1 ([@ref-76]). The co-occurrence networks of bacterial and fungal communities were assessed and visualized using Cytoscape (version 3.7.1) ([@ref-89]). In network analyses, the pairwise correlations between OTUs (OTUs with a relative abundance \>0.01%) were calculated using Spearman's correlation based on the relative abundance of OTUs (data was transformed by Hellinger transformation using *decostand* function in vegan 2.5-3 package). Only strong (*R* \> 0.7 OR *R* \< −0.7) and significant (*P* \< 0.01) correlations were considered in network analysis. ClusterMaker app ([@ref-68]) was used to analyze the modular structures of the co-occurrence networks. Modularity values greater than 0.4 suggest that the network has a modular structure ([@ref-71]). The group attributes layout algorithm was used to construct the networks based on modules. The basic topological metrics of networks were calculated, including number of nodes, number of edges, clustering coefficient, characteristic path length, network density, network heterogeneity, and modularity. The taxonomic dissimilarities (beta diversity) of the BC and FC were calculated based on Bray--Curtis distance in terms of the relative abundance of OTUs using R package vegan 2.5-3 ([@ref-73]). Moreover, the taxonomic dissimilarities of the major modules (modules have more than 15 nodes) were also calculated based on Bray--Curtis distance in terms of the relative abundance of OTUs in the module. BM1, BM2, BM3, and BM4 represent four major modules in the bacterial network. FM1, FM2, FM3, FM4, FM5, and FM6 represent six major modules in the fungal network. Mantel tests were used to assess the correlations between spatial and environmental dissimilarities and taxonomic dissimilarities of bacterial and fungal communities and modules. The relationships among different modules and communities for bacteria and fungi were also assessed using Mantel tests. Results ======= Environmental variations and community taxonomic dissimilarities ---------------------------------------------------------------- The environmental variables of the streams varied across the sampling sites and showed differing interrelationships ([Fig. 2](#fig-2){ref-type="fig"}). GD, GA, GS, NDVI, elevation, pH, and conductivity were closely correlated with each other ([Fig. 2A](#fig-2){ref-type="fig"}). DOC was negatively correlated with GS, TN, and NO~3~^−^, while positively correlated with NDVI and pH ([Fig. 2A](#fig-2){ref-type="fig"}). Across the sampling sites, hydrological and vegetation dissimilarities had strong linear relationships with overall environmental dissimilarity, while nutrient dissimilarity only had a weak relationship ([Fig. 2B](#fig-2){ref-type="fig"}). Moreover, hydrological and vegetation dissimilarities had a strong interrelationship with each other but without significant relationships to nutrient dissimilarity ([Fig. 2B](#fig-2){ref-type="fig"}). Geographic distance only had a significant relationship with nutrient dissimilarity ([Fig. 2B](#fig-2){ref-type="fig"}). In addition, Mantel tests showed that environmental, hydrological, and vegetation dissimilarities had significant positive relationships to taxonomic dissimilarities of BC but not to FC ([Fig. 3](#fig-3){ref-type="fig"}). However, geographic distance and nutrient dissimilarity did not have significant relationships with taxonomic dissimilarities of both bacterial and fungal communities ([Fig. 3](#fig-3){ref-type="fig"}). ![(A) Pairwise-Spearman correlations between environmental variables.\ The magnitude of correlation coefficient is only shown graphically with color scale when correlation is significant (*P* \< 0.05). The color intensity and the size of the circle are proportional to the correlation coefficients. (B) Correlations between the different components of environmental dissimilarities. Spearman correlations (*r*) and associated *P*-values were calculated by Mantel test. Nutrient dissimilarity was controlled in Partial Mantel test.](peerj-07-7715-g002){#fig-2} ![Correlations between different components of environmental distance (environmental dissimilarity, hydrological dissimilarity, nutrient dissimilarity, and vegetation dissimilarity) and taxonomic dissimilarities of (A) bacterial and (B) fungal communities and modules.\ Spearman correlations were calculated by Mantel test. The magnitude of correlation coefficient is only shown graphically with color scale when correlation is significant (*P* \< 0.05). The color intensity and the size of the circle are proportional to the correlation coefficients.](peerj-07-7715-g003){#fig-3} Bacteria and fungi co-occurrence patterns and modular structures ---------------------------------------------------------------- In the studied glacier-fed streams, bacteria and fungi formed complex co-occurrence networks ([Fig. 4](#fig-4){ref-type="fig"}). The bacterial and fungal networks consisted of 904 and 238 nodes and 21,463 and 1,348 edges, respectively ([Table 1](#table-1){ref-type="table"}). The bacterial network had a higher number of nodes and edges as well as a higher network density ([Fig. 4](#fig-4){ref-type="fig"}; [Table 1](#table-1){ref-type="table"}), indicating the bacterial network was more complex and connected than the fungal network. However, the fungal network exhibited a higher clustering coefficient, characteristic path length, network heterogeneity, and modularity, indicating that the fungal network had a more clustered topology than the bacterial network ([Fig. 4](#fig-4){ref-type="fig"}; [Table 1](#table-1){ref-type="table"}). ![Co-occurrence network of (A) bacterial and (B) fungal communities.\ Dot and triangle represent bacterial and fungal OTUs (OTUs with a relative abundance \>0.01%), respectively. OTUs were colored according to major phylum (phylum with relative abundance \>1%). Edges represent Spearman correlation relationships (*P* \< 0.01). Gray lines indicate positive associations and pink lines indicate negative associations. The circles represent modules of the networks. The pie graphs in the below two panels show the composition of the modules in (C) bacterial and (D) fungal networks with the number representing the number of OTUs.](peerj-07-7715-g004){#fig-4} 10.7717/peerj.7715/table-1 ###### Topological parameters of the network of bacterial and fungal communities. ![](peerj-07-7715-g006) Topological parameters Description Bacterial Fungal ---------------------------- --------------------------------------------------------------------------------------------------- ----------- -------- Number of nodes Number of OTUs in the network 904 238 Number of edges (in total) Strong and significant correlations 21,463 1,348 Number of edges (positive) Positive correlations 18,419 1,253 Number of edges (negative) Negative correlations 3,044 95 Clustering coefficient The fraction of observed vs. possible clusters for each node 0.440 0.451 Characteristic path length The median of the means of the shortest path lengths connecting each vertex to all other vertices 2.887 3.829 Network density The ratio of the number of edges and the number of possible edges 0.053 0.048 Network heterogeneity Density distribution of connections between nodes 0.929 1.107 Modularity Tendency of a network to contain sub-clusters of nodes 0.52 0.599 Co-occurrence networks can be compartmentalized into modules within which nodes are closely associated and are expected to share environmental preferences. We found that the OTUs in bacterial and fungal networks were grouped into four and six major modules (modules with more than 15 nodes), respectively ([Figs. 4A](#fig-4){ref-type="fig"} and [4B](#fig-4){ref-type="fig"}). All the modules were formed by various microbial taxa ([Figs. 4C](#fig-4){ref-type="fig"} and [4D](#fig-4){ref-type="fig"}), which shown differently across sample sites ([Figs. S1](#supp-1){ref-type="supplementary-material"} and [S2](#supp-1){ref-type="supplementary-material"}). Modules had significantly different taxonomic compositions to each other ([Tables S1](#supp-2){ref-type="supplementary-material"} and [S2](#supp-2){ref-type="supplementary-material"}). Mantel tests showed that the taxonomic dissimilarities of the BC and modules had strong interrelationships ([Fig. 5](#fig-5){ref-type="fig"}). The taxonomic dissimilarities of FC and modules only had weak interrelationships. Between bacterial and fungal networks, only FM3 had strong relationships with BC and BMs. Mantel tests also revealed that all bacterial modules (BM1, BM2, BM3, and BM4) and one fungal module (FM3) were positively correlated with environmental, hydrological, and vegetation dissimilarities, but not with geographic distance and nutrient dissimilarity ([Fig. 3](#fig-3){ref-type="fig"}). ![Correlation matrix of the taxonomic dissimilarities for bacterial and fungal communities and modules.\ The magnitude of correlation coefficient is only shown graphically with color scale when correlation is significant (*P* \< 0.05). The color intensity and the size of the circle are proportional to Spearman correlation coefficients.](peerj-07-7715-g005){#fig-5} Discussion ========== Bacterial and fungal communities in stream biofilms are major components of glacier-fed stream ecosystems. The strong correlations between bacterial communities and environmental, hydrological, and vegetation characteristics suggest substantial influences of spatial heterogeneity and potential influences of glacier shrinkage on bacterial communities ([Fig. 3](#fig-3){ref-type="fig"}). However, the variation of bacterial communities was not associated with stream nutrient variations and geographic distance. In our studied glacier-fed streams, the proportion of GA, the proportion of glacier source water (GS), the hydrological distance to glacier terminus (GD)and the NDVI were the environmental variables associated with longitudinal patterns of glacier-fed streams. Glacier-fed streams are fed by various sources, including ice-melt, snowmelt, and groundwater ([@ref-15]). The contribution of different water sources varies longitudinally from the glacier terminus to downstream reaches and temporally with glacier shrinkage ([@ref-14]; [@ref-63]; [@ref-37]), resulting in distinct hydrology and physicochemical features which control the ecological structures and processes in glacier-fed streams ([@ref-15], [@ref-16]; [@ref-88]). Synchronizing with the hydrological changes in glacier-fed streams, vegetation growth and aboveground biomass in the catchment also has a clear elevation gradient ([@ref-23]) which will likely be amplified due to climate warming ([@ref-104]; [@ref-77]). The changed landcover modifies terrestrial and aquatic biogeochemistry ([@ref-87]), and affects stream biofilms ([@ref-34]; [@ref-72]). Thus, hydrological variables (GD, GA, and GS) and vegetation variable (NDVI) determine the environmental heterogeneity of glacier-fed streams and can potentially indicate glacier shrinkage. It has been widely demonstrated that glacier shrinkage alters watershed landcover and instream environments ([@ref-48]; [@ref-53]; [@ref-57]; [@ref-77]; [@ref-64]), imposing impacts on bacterial communities ([@ref-70]; [@ref-49]). For example, the alpha diversity of biofilm bacteria decreased with the increases of elevation, the proportion of glacier area in the watershed, and the relative contribution of glacier sources to stream runoff ([@ref-101]; [@ref-78]). Potential functions of bacterial communities are also significantly associated with hydrological factors ([@ref-79]). Our results further suggest strong influences of hydrological and vegetation characteristics on bacterial communities, leading to more different (biotic heterogenization) bacterial communities in glacier-fed streams. In contrast to bacterial communities, environmental, hydrological, and vegetation dissimilarities were not significantly associated with the dissimilarity of fungal communities. Moreover, the variation fungal communities were also not associated to nutrient variations. The results suggest that FC variations were not affected by the environmental variation and might be insensitive to glacier shrinkage. We proposed that the unique responses of fungi may relate to the low temperature which can suppress the response of fungal communities to environmental variation. Fungi can survive and grow in harsh conditions with low temperatures such as glacier and snow by evolving various adaptive features ([@ref-46]). These fungi are known as psychrophiles and psychrotrophs. Although they exist widely in cold environments, the optimum temperature for the growth of psychrophilic fungi is around 15 °C and for psychrotrophic fungi is 20 °C ([@ref-41]; [@ref-81]; [@ref-24]; [@ref-96]). In glacier-fed streams, water temperature is usually below 10 °C or even close to 0 °C in summer ([@ref-65]). More interestingly, the contrasting response patterns of bacterial and fungal communities were also found in glacier foreland soil ecosystems, where bacterial communities are strongly influenced by the presence of vegetation and environmental heterogeneity and show convergence ([@ref-17]). In contrast to the bacterial communities in glacier foreland soil, fungal richness and diversity were more static and the community structure and distribution show a large extent of stochastic processes across the glacier foreland ([@ref-11]; [@ref-13]; [@ref-17]). It has been revealed that bacteria and fungi in headwater streams are similar to communities in adjacent soil due to intimate associations between headwater streams and terrestrial ecosystems ([@ref-26]; [@ref-43]; [@ref-85]). The immigration and advection of allochthonous bacteria and fungi from terrestrial environments can influence bacterial and fungal communities in glacier-fed streams ([@ref-26]; [@ref-43]). The unique response of fungal communities in glacier-fed streams is congruent with the observations in the periglacial soils, suggesting differing trajectories of fungal and BC variations in glacier-fed streams. The different patterns of bacterial and fungal communities in glacier-fed streams were further supported by network analysis, which showed that the bacterial communities formed a more complex and connected network, while the fungal communities formed a more clustered network ([Fig. 4](#fig-4){ref-type="fig"}; [Table 1](#table-1){ref-type="table"}). Microbial communities are complex assemblages comprised by highly interactive taxa ([@ref-35]; [@ref-54]). This study is the first to explore the organization of the bacterial and fungal communities in glacier-fed streams using a co-occurrence approach with consideration of the driving forces. In general, communities with tight co-occurrence interactions and high complexity have a lower stability and are more susceptible to disturbance ([@ref-66]; [@ref-86]). The highly connected and complex bacterial network suggests that bacterial communities in the glacier-fed streams were more sensitive to environmental variations, especially to instream hydrological properties and land vegetation. Moreover, in a complex network, the highly interconnected species are grouped into a module ([@ref-5]; [@ref-71]). The strong interrelations among the taxonomic dissimilarities of BC and modules suggest that they had common processes in driving diversity and composition across various environments ([@ref-28]). In contrast, FC and modules generally had distinct driving processes to each other. Moreover, the fungal and bacterial communities also had different driving processes (except FM3 and bacterial communities and modules). Consistent with these findings, the variation of all bacterial modules and FM3 were strongly associated with environmental variation except nutrient dissimilarity, while fungal modules (except FM3) did not respond to environmental variation. Thus, our results suggest that, in our studied area, environmental variation had strong influences on bacterial communities and their assembly mechanisms but not on fungal communities (except one module) in biofilms of glacier-fed streams. The fungal communities may have unique assembly mechanisms which lead to their insensitive responses to environmental variations. Conclusion ========== Glacier shrinkage imposes significant influences on glacier-fed streams. Integrating beta diversity, our study provides the first co-occurrence network analyses of bacterial and fungal communities in glacier-fed streams. Firstly, this study highlighted that hydrological variables and vegetation status are important components in determining environment heterogeneity of glacier-fed streams and are indicator variables of glacier shrinkage. Then we identified co-occurrence properties of the microbial communities and their responses to environmental variations. Bacterial communities formed a more complex and connected network, while the fungal communities formed a more clustered network. Nutrients were insignificant to the assemblies of both bacterial and fungal communities in these glacier-fed streams. However, hydrological properties and vegetation status impose significant influences on assemblies of the BC but not on the FC. The results suggest the influences of glacier shrinkage on bacterial communities. However, fungi communities might be insensitive to glacier shrinkage. The results would add our knowledge of microbial community assembly mechanisms and the responses of microbial communities to environmental variations caused by glacier shrinkage. Supplemental Information ======================== 10.7717/peerj.7715/supp-1 ###### Supplementary Figures. [Figure S1](#supp-1){ref-type="supplementary-material"} Distributions of OTUs across sample sites for bacterial modules. [Figure S2](#supp-1){ref-type="supplementary-material"} Distributions of OTUs across sample sites for fungal modules. ###### Click here for additional data file. 10.7717/peerj.7715/supp-2 ###### Supplementary Tables. [Table S1](#supp-2){ref-type="supplementary-material"} Pairwise dissimilarity tests of taxonomic composition among bacterial modules using PERMANOVA (*adonis* function in vegan package 2.5-3). *R*^2^ and *P*-values (in bracket) are shown. [Table S2](#supp-2){ref-type="supplementary-material"} Pairwise dissimilarity tests of taxonomic composition among fungal modules using PERMANOVA (*adonis* function in vegan package 2.5-3). *R*^2^ and *P*-values (in bracket) are shown. ###### Click here for additional data file. We are grateful to anonymous reviewers for the suggestions of writing and analysis, to Zhao QD, Han TD, and Ren Y for assistance in the field. Additional Information and Declarations ======================================= The authors declare that they have no competing interests. [Ze Ren](#author-1){ref-type="contrib"} conceived and designed the experiments, performed the experiments, analyzed the data, contributed reagents/materials/analysis tools, prepared figures and/or tables, authored or reviewed drafts of the paper, approved the final draft. [Hongkai Gao](#author-2){ref-type="contrib"} conceived and designed the experiments, performed the experiments, analyzed the data, contributed reagents/materials/analysis tools, prepared figures and/or tables, authored or reviewed drafts of the paper, approved the final draft. The following information was supplied regarding data availability: Data is available at NCBI: [SRP115356](SRP115356) and [SRP198430](SRP198430).
All relevant data are within the paper and its supporting information files, or are available from the GenBank database (accession number KU847397). 1. Introduction {#sec001} =============== The Western or European honey bee (*Apis mellifera*, Linnaeus 1756) is a eusocial insect living in colonies with three distinct castes: a single female queen, male drones, and female workers. Bee products like honey, wax, royal jelly or propolis are important to mankind \[[@pone.0164639.ref001]\]. Insect pollination is essential to agricultural productivity and human nutrition \[[@pone.0164639.ref002]\]. The pollination service of honey bees on crops, such as fruit trees and berries, in global agriculture has been estimated to be worth around €100 bn per year \[[@pone.0164639.ref003], [@pone.0164639.ref004]\]. Beekeepers have been reporting on unusually high honey bee colony mortality in North America \[[@pone.0164639.ref005]\] and Europe \[[@pone.0164639.ref006]\] for more than a decade. Natural populations of European honey bees are threatened or already extinct in many parts of the world. Parasitic infections cause a decline of feral honey bee colonies even in their original habitats \[[@pone.0164639.ref007]\]. Colony mortality is associated with strong *Varroa destructor* mite infestation and a rapid decrease of the adult bee population \[[@pone.0164639.ref008], [@pone.0164639.ref009]\]. The mite *Varroa jacobsoni*, a parasite of the Eastern honey bee (*A*. *cerana*), adapted to *A*. *mellifera* in the 1950s giving rise to the new species *V*. *destructor* \[[@pone.0164639.ref010]\]. Due to colony and queen bee trade, *V*. *destructor* has spread to all continents with the exception of Australia \[[@pone.0164639.ref011]\]. The global invasion reached central Europe in the 1970s and the USA in the 1980s \[[@pone.0164639.ref008]\]. Nowadays, bee colony survival depends on human supervision, intervention and regular control measures such as biotechnical or miticide treatments \[[@pone.0164639.ref012], [@pone.0164639.ref013]\]. The occurrence of deformed emerging bees is the major clinical sign of varroosis \[[@pone.0164639.ref014]\]. These deformities were closely associated with DWV infections as previously shown using experimental infection of pupae \[[@pone.0164639.ref015]\]. DWV is present in almost every beehive throughout the year, but DWV symptoms only occur in heavily Varroa infested colonies \[[@pone.0164639.ref016]\]. Overt DWV infections, characterized by the appearance of DWV symptoms at a colony level, are indicative of a colonies downfall and occur primarily during autumn \[[@pone.0164639.ref017]\]. There is general consensus that a synergistic interaction between DWV and Varroa mites plays an important role in colony mortality \[[@pone.0164639.ref018]--[@pone.0164639.ref021]\]. The Varroa mites' feeding behavior transmits DWV directly into the bees' haemolymph \[[@pone.0164639.ref016], [@pone.0164639.ref022], [@pone.0164639.ref023]\], bypassing the natural barriers of the bees body against conventional vertical and horizontal routes of virus transmission \[[@pone.0164639.ref024], [@pone.0164639.ref025]\]. It was documented that diverse DWV strains were present in the honey bee population of Hawaii before the Varroa mite invaded these islands, whereas a single strain prevails after the mite invasion \[[@pone.0164639.ref018]\]. A recent phylogenetic analysis supports the hypothesis that a DWV epidemic started in the mid of the 20^th^ century coinciding chronologically with the Varroa mites' host switch to *A*. *mellifera* \[[@pone.0164639.ref026]\]. DWV belongs to the genus *Iflavirus* within the family *Iflaviridae*. Iflaviruses are members of the order *Picornavirales* with a Picornavirus-like genome organization and particle morphology \[[@pone.0164639.ref014]\]. DWV is separated into the three master variants DWV-A, -B and -C \[[@pone.0164639.ref027]\]. Master variant A contains the classical DWV strains \[[@pone.0164639.ref028]\] and Kakugo virus \[[@pone.0164639.ref029]\], which are responsible for elevated colony mortality \[[@pone.0164639.ref018]\]. DWV-B includes the strains of *Varroa destructor viruses* (VDV), which are able to protect colonies by superinfection exclusion against DWV-A \[[@pone.0164639.ref030]\]. High recombination frequencies between different DWV strains and master variants have been documented in the field \[[@pone.0164639.ref031], [@pone.0164639.ref032]\]. However, only a few genomic sequences of DWV field strains have been deposited in databases and recombination was not proven *in vitro* using clonally selected viruses. DWV has a single-stranded RNA genome of about 10 kb. The genome is polyadenylated and contains a single open reading frame (ORF) that is flanked by non-translated regions (NTRs). The ORF encodes a 2,894 amino acid polyprotein, which is translated via an internal ribosomal entry site (IRES). Viral proteases mediate maturation of at least four structural proteins (VP1-4) from the N-terminal third of the polyprotein and of a replicase unit (RNA helicase, 3C protease, and RNA-dependent RNA polymerase) from the C-terminal part. A genomic sequence of DWV is known since 2006 \[[@pone.0164639.ref028]\] and plasmids containing DWV genomes have been presented \[[@pone.0164639.ref033]\]. The IRES element of DWV has been studied in detail documenting its functional activity \[[@pone.0164639.ref034], [@pone.0164639.ref035]\]. Only a limited number of virological tools have been developed for the laboratory research on bee viruses. Defined cell culture systems, serological reagents, characterized viral strains or clones are effectively missing despite decades of intense research. So far, all studies used bee models and virus isolates originating directly from the field or from propagation in bee infection models. The use of virus isolates from field samples, which had not been plaque purified in cell culture (biological cloning), may result in misleading conclusions. Multiple virus strains, master variants or even species could be present at the same time in such field isolates. The application of reverse genetics allows circumventing virus isolation, clonal plaque purification and production of clonal viruses in cell culture systems. To our best knowledge, no reverse genetics system has been presented for DWV or any other member of the genus *Iflavirus*. For bee viruses in general, a single publication reported on the generation of infectious transcripts of *Black queen cell virus* (BQCV) achieved by the assembly of full-length PCR products with a suitable recognition site for the T7 RNA polymerase \[[@pone.0164639.ref036]\]. Here, we describe a stable infectious plasmid clone of DWV and its application for studies on DWV pathogenesis. 2. Materials and Methods {#sec002} ======================== 2.1. Field sample {#sec003} ----------------- The DWV-positive bee sample used in this study originated from a colony loss in Austria that occurred in 2012. No specific permission was required for honey bee sample collection, because this study used remnants of specimens initially collected from colony losses for diagnostic purposes. Crude bee lysate from the field sample was injected into the ventral chest of white to purple eye honey bee pupae (13 to 15 days old) to propagate DWV. The infected bee pupae were incubated for three days at 35°C in a humid environment. All experiments with infectious DWV were carried out in biosafety level 2 facilities. 2.2. Stock preparation and virus purification {#sec004} --------------------------------------------- Single pupae were snap-frozen in 1 ml phosphate buffered saline (PBS) and homogenized in a TissueLyser II (Qiagen, Hilden, Germany). The lysate was cleared by centrifugation (13,000 rpm for 1 min) and filtered through a 0.2 μm nylon filter membrane (Acrodisc, Sigma-Aldrich). Viral load was measured as genome equivalents (GE) using quantitative RT-PCR (qRT-PCR). For concentration and purification, the filtrate was centrifuged through a 2 ml cushion of 50% sucrose (w/v) in a Beckman centrifuge (36,000 rpm, 4°C, 4 h, SW41 Ti). The resulting pellet was resuspended in 100 to 200 μl PBS and again, cleared by centrifugation (13.000 rpm for 1 min). All virus stocks were tested for the presence of *Acute bee paralysis virus* (ABPV) and *Sacbrood virus* (SBV) by conventional RT-PCR \[[@pone.0164639.ref037], [@pone.0164639.ref038]\]. 2.3. RNA purification and RT-PCR {#sec005} -------------------------------- RNA was extracted from whole pupae lysates or concentrated virus suspensions employing the QIAamp viral RNA Mini Kit (Qiagen, Hilden, Germany) and eluted in 60 μl nuclease free water. RT-PCR was carried out using the Long Amp RT-PCR Kit or the OneTaq One-Step RT-PCR Kit (NEB, Ipswich, USA). For 5'-RACE-PCRs, the DWV concentrate was digested with proteinase K prior to RNA extraction. A classic 5\'-RACE protocol was adapted using the Long Amp RT-PCR Kit. Briefly, first strand cDNA was synthesized from total RNA using the DWV specific primer PDV16 and precipitated with ethanol. Poly-A or poly-C tailed cDNA was generated using terminal deoxytransferase (TdT; NEB, Ipswich, USA). Another genome specific primer (PDV21) was used in conjunction with a primer containing oligo-dt / oligo-dg and adapter sequences (PDV18/PDV19) to amplify the DWV 5'-end. Finally, a nested PCR was performed using primers hybridizing with adapter (PDV20) and 5'-terminal DWV sequences (PDV22). 2.4. Generation of a full-length DWV-A clone {#sec006} -------------------------------------------- The DWV-A field isolate 1414 was chosen for our molecular cloning attempts because passaging of this virus yielded deformed or dead bees containing high DWV titers. In addition, this field sample did not contain ABPV or SBV. Sequence alignments of four DWV-A isolates (AJ489744, AY292384, JQ413340, AB070959) from databases allowed the design of DWV-A specific oligonucleotides ([Table 1](#pone.0164639.t001){ref-type="table"}). The overlapping RT-PCR fragments A (PDV1 and PDV16) and B (PDV5 and PDV18) were directly analysed by Sanger sequencing (Eurofins Genomics, Vienna, Austria) applying oligonucleotides PDV1 to PDV18 to assemble a master-sequence of DWV-A 1414. T-vector clones (Promega, Fitchburg, WI) containing the 5'-RACE-PCR products were sequenced with M13forw and M13rev primers. Based on the sequence information, a full-genome RT-PCR was designed. The complete DWV genome was amplified using the OneTaq One-Step RT-PCR Kit, oligonucleotides PDV17 and PDV23, and RNA purified from a virus concentrate (1,8 x 10^11^ GE). The 10,164 bp RT-PCR product was inserted in a pBR322 derived vector using a Gibson assembly reaction \[[@pone.0164639.ref039]\]. This vector already contained all features necessary for RNA translation providing an SP6 promoter, a poly-A sequence and a NotI site for linearization. For differentiation of cloned recombinant DWV (rDWV) and DWV field strains, a novel BamHI site at nt position 2,851 was introduced using a Q5 extension PCR (PDV24 and PDV25) preserving the encoded amino acid sequence. The plasmid (pL427) was sequenced after two passages in bacteria (*E*. *coli*, strain HB101) to confirm sequence stability. With the exception of several synonymous mutations within the coding region, no differences were found between the DWV-A 1414 master sequence and the cloned rDWV sequence. 10.1371/journal.pone.0164639.t001 ###### Oligonucleotides used in this study---nt position refers to DWV, strain Austria 1414 (KU847397). ![](pone.0164639.t001){#pone.0164639.t001g} Name Sequence nt Position ------- ----------------------------------------- ----------------------- PDV1 `cgatttatgccttccatag` forw. 22--40 PDV2 `gagctgggacccctcagtctc` forw. 766--786 PDV3 `gtgttgcaactcgcttcgttc` forw. 1583--1603 PDV4 `gaggatttgaatatatcgtc` forw. 2230--2249 PDV5 `gtggttcattagaatatag` forw. 2975--2993 PDV6 `ctgctaatcaacaaggacctg` forw. 3746--3766 PDV7 `gtctagcgctgcatctagttatg` forw. 4434--4456 PDV8 `ctactgtagattttagtaataattg` forw. 5153--5177 PDV9 `gatcgtattgctatggaagc` forw. 5911--5930 PDV10 `caagctccaagaaatcctgatg` forw. 6559--6580 PDV11 `gataagtatttaactcgtcccgtg` forw. 7234--7257 PDV12 `gagtgttagtaactggcgac` forw. 7946--7965 PDV13 `gatatcttggaatactagtgctg` forw. 8637--8659 PDV14 `ctgatttgcctttgtccgag` forw. 9359--9378 PDV15 `cacatgggaagaaatggatg` forw. 9807--9826 PDV16 `gtaaatcaaatactacataactc` rev. 3105--3127 PDV17 `actactatggttaaaactatac` rev. 10143--10164 PDV18 `ggccacgcgtcgactagtacttttttttttttttttt` rev. oligo-dt-adapter PDV19 `ggccacgcgtcgactagtacggggggggggggggggg` rev. oligo-dg-adapter PDV20 `ggccacgcgtcgactagtac` rev. adapter RACE PDV21 `gagactgaggggtcccagctc` rev. 766--786 PDV22 `ctctactcgatactgcagtg` rev. 529--548 PDV23 `tttaaaattcgctatgggagg` forw. 1--21 PDV24 `gatcccttttgttacaattagatg` forw. 2852--2875 PDV25 `ctttagcatgatctttcttc` rev. 2832--2851 PDV26 `attgtgccagattggactac` forw. 2368--2387 PDV27 `agatgcaatggaggatacag` rev. 2783--2802 PDV28 `caagaattgtgccagattggactactg` forw. 2363--2389 2.5. RNA in vitro synthesis and transfection {#sec007} -------------------------------------------- Synthetic infectious RNA was produced as previously described \[[@pone.0164639.ref040]\]. Briefly, 2.5 μg DNA of the plasmid was digested with NotI and purified using phenol-chloroform extraction. The linearized plasmid DNA was transcribed into genomic rDWV RNA using SP6-polymerase (NEB, Ipswich, MA). 50 μl of the transcription mixture was DNase digested, RNA was purified with the RNeasy Mini Kit (Qiagen, Hilden, Germany) and eluted in 30 μl RNase free water. One microliter of the purified synthetic RNA (8.2 x 10^11^ GE) was injected in the chest of apparently healthy blue-eye pupae using a Hamilton syringe (Model 702). Mock infections with 1 μl of PBS and infections with 1 μl of a DWV-A 1414 virus stock (wtDWV, 8.0 x 10^7^ GE) were performed as controls. All pupae used in the experiment were extracted from the same comb. After injection, the pupae were transferred to a 24-well plate, incubated at 35°C for 3 days and harvested or left for further development until emergence. 2.6. Characterization of rDWV pathogenicity {#sec008} ------------------------------------------- Three bee pupae from a third passage of rDWV, wtDWV-A 1414, and negative controls were disrupted in 1 ml of PBS each. The pupae lysates were pooled for each inoculum and sterile filtered (pore size 0.2 μl) to prepare infectious stocks. Virus stocks were diluted with PBS to a final concentration of 1.0 x 10^10^ GE/ml. A calculation of the infectious dose (TCID~50~/ml or PfU/ml) was not possible due to the lack of suitable systems. 40 white to blue eye bee pupae (14 to 15 days old) were extracted from one comb. The pupae were incubated at 35°C over night to allow the detection of accidentally injured animals. The next day, groups of ten pupae were infected with equal doses (5.0 x 10^6^ GE) of rDWV and wtDWV by injection. The pupae were further incubated for six days until the end of development (day 22). 2.7. GE quantification and marker identification {#sec009} ------------------------------------------------ An established diagnostic RT-PCR protocol \[[@pone.0164639.ref041]\] was adapted for GE quantification using PDV26 and PDV27. GEs were calculated by 7500 System SDS Software (Applied Biosystems, Foster City, USA) based on the standard curve of a cDNA plasmid. A different RT-PCR was used to determine the presence of the BamHI marker mutation in DWV genomes. A 764 nt fragment flanking the novel BamHI site was amplified using PDV16 and PDV28. Half of the PCR product was incubated with 20U BamHI for 30 min at 37°C and subjected to agarose gel electrophoresis. The appearance of two bands (488 and 276 nt) after BamHI digestion proved the presence of recombinant DWV. 2.8. Generation of mAbs against DWV VP1 {#sec010} --------------------------------------- The region coding for amino acid 622--894 of the DWV-A 1414 ORF was amplified by RT-PCR and inserted in a pet11a vector. The recombinant fragment of VP1 (rVP1, calculated molecular mass of 33 kDa) was prepared using heterologous expression in the *E*. *coli* strain Rosetta ([Fig 1A](#pone.0164639.g001){ref-type="fig"}). The histidine-tagged protein was purified by ion metal affinity chromatography (IMAC), as previously described \[[@pone.0164639.ref040]\]. Amount and purity of protein was determined by SDS-PAGE, and its identity was confirmed using an anti-His antibody ([Fig 1B](#pone.0164639.g001){ref-type="fig"}). BALB/c mice were immunized four times with rVP1 on days 0, 14, 28, and 42. Spleen cells were prepared and fused with sp2/0-AG14 myeloma cells to generate mAb producing hybridomas. Finally, 96 reactive mAbs were evaluated using ELISA, immunoblot ([Fig 1C](#pone.0164639.g001){ref-type="fig"}) and immunofluorescence assays against rVP1 and lysates of DWV infected bees. All animal use protocols employed in this study were approved by the institutional ethics and animal welfare committee and the national authority according to §§ 26ff. (Animal Experiments Act from 2012; BMWF-68.205/0107-II/3b/2013). ![Recombinant DWV VP1 (rVP1) and VP1 specific antibodies.\ (A) rVP1 was expressed in *E*. *coli* via plasmid pL443. Total protein from non-induced (NI) and induced (I) cultures was separated by SDS-PAGE and either stained with Coomassie blue or probed with an anti His-tag antibody. (B) IMAC purified rVP1 revealed by Coomassie stain and western blot analysis. (C) Reactivity and specificity of two mouse monoclonal antibodies is shown using *E*. *coli* expressing rVP1. Arrows indicate the protein bands of rVP1 and rVP1 dimer.](pone.0164639.g001){#pone.0164639.g001} 2.9. Western blot analysis {#sec011} -------------------------- Protein from total pupa homogenate was precipitated by the addition of 4 volumes of ice-cold acetone for Western blot analysis. The pellet was resuspended in distilled water and boiled in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) buffer. Samples were separated on 7.5% acrylamide gels prior to electrophoretic transfer to nitrocellulose membranes (Pall corporation, Port Washington, New York). To detect DWV antigens, blots were blocked with 5% skim milk powder and probed with different mouse monoclonal antibodies against DWV VP1. The blots were developed using Amersham ECL plus reagent (GE Healthcare, Chalfont St Giles, GB) and exposed to a C-Digit scanner (Licor, Lincoln, Nebraska) and X-ray films for imaging. 2.10. Immunohistochemistry staining {#sec012} ----------------------------------- Immunohistochemical investigations were performed using primary antibodies against DWV VP1 on an autostainer (Lab Vision AS 360) using the avidin-botin complex (ABC)-method. Briefly, 3 μm sections of fixed (4% formalin, 5% glycerin, 50% ethanol) and paraffin-embedded pupae were placed on coated slides and dried to enhance tissue adherence. The sections were deparaffinized in a descending alcohol series and rehydrated. Endogenous peroxidase activity was blocked by incubation in H~2~O~2~. The antigen-antibody-complex was detected using biotinylated anti-mouse IgG (Vector Laboratories, dilution 1:300), followed by incubation with streptavidin-peroxidase and visualization with diaminobenzidine (DAB; Labvision, Thermo Fisher Scientific). Subsequently, the sections were counterstained with haematoxylin, dehydrated and mounted. 2.11. Electron microscopy {#sec013} ------------------------- Concentrated virus samples were adsorbed to glow discharged, carbon coated copper grids and negatively stained with 1% uranyl acetate. Samples were analysed on a FEI Morgagni 268D electron microscope equipped with an 11 megapixel CCD camera (Morada, Olympus SIS) at 80kV and 24,000x nominal magnification. 3. Results {#sec014} ========== 3.1. Genome sequence of DWV-A strain 1414 {#sec015} ----------------------------------------- The complete genome of DWV-A 1414 (GenBank KU847397) was sequenced from RT-PCR fragments to establish an optimal genetic background for the development of a reverse genetics system. 5′ RACE-PCRs were performed, since remarkable size differences in the 5'-NTR between published DWV genomes were found. Amplicons from an A-tailing RACE and from a C-tailing RACE reaction were cloned and sequenced to uncover the ultimate 5'-end of DWV-A 1414. The majority of clones from both reactions contained a 5'-end sequence that was longer than any of the publicly available full-length DWV genome sequences ([Fig 2A](#pone.0164639.g002){ref-type="fig"}). As expected, most of the 5′-NTR was highly conserved between all DWV strains. However, a 5'-terminal stretch of 10 nucleotides was missing from Kakugo virus (DWV-A, AB070959) and at least 21 nucleotides were missing from all other DWV-A genomes and Varroa destructor virus 1 (DWV-B, AY251269, [Fig 2B](#pone.0164639.g002){ref-type="fig"}). A length difference of 14 nucleotides was observed, when comparing DWV-A 1414 (KU847397) to the recently published genomic sequence of DWV-C (ERS657949) \[[@pone.0164639.ref027]\]. ![Sequence analyses of DWV-A 1414.\ (A) DWV 5'-NTR sequences were obtained from tailing RACE-PCRs. Numbers of clones containing the respective 5'-terminal nucleotides are indicated below the sequence. (B) Sequence comparison of the 5'-terminus of DWV-A 1414 and related Iflaviruses. Genbank entries are provided behind the strain designations. (C) Neighbor joining analysis using genomic sequences of different Iflaviruses. The phylogenetic analysis documents a close relationship of DWV-A 1414 to other DWV-A isolates from Europe and America. The number of substitutions per site is given as a scale and bootstrap values for 1,000 replicates were indicated above all nodes.](pone.0164639.g002){#pone.0164639.g002} A phylogenetic analysis demonstrated the close relationship between published DWV-A sequences and our Austrian field strain from 2012 ([Fig 2C](#pone.0164639.g002){ref-type="fig"}). Pairwise identities to DWV-A 1414 are 98.0% for a DWV-A strain from Pennsylvania (AY292384), 97.6% for a DWV-A strain from Italy (AJ489744), 97.4% for a DWV-A strain from Chile (JQ413340.1), 96,7% for Kakugo virus (AB070959), but only 81.4% for Varroa destructor virus (DWV-B, AY251269.2). *In silico* translation revealed that all postulated 3C protease cleavage sites \[[@pone.0164639.ref028]\] were present in the polyprotein of strain A1414 ([Fig 3A](#pone.0164639.g003){ref-type="fig"}). ![Molecular clone of DWV-A 1414.\ (A) Genome organization: VPg, 5'- and 3'-NTR, ORF, and poly-A tract are indicated. Within the ORF, the putative polyprotein cleavage sites are shown. Boxes mark annotated polyprotein genes or motives, with nonstructural proteins above and structural proteins below the line. (B) Genomic RT-PCR of DWV-A 1414. (C) In vitro transcription of rDWV-A 1414 RNA. Linearized plasmid DNA and genomic RNA transcript are indicated.](pone.0164639.g003){#pone.0164639.g003} 3.2. Rescue of recombinant DWV (rDWV) {#sec016} ------------------------------------- A dose of 8.2 x 10^11^ GE synthetic RNA ([Fig 3B and 3C](#pone.0164639.g003){ref-type="fig"}) was injected in the thorax of blue eye bee pupae for the rescue of rDWV. Bee pupae showed a melanization at the injection site ([Fig 4A](#pone.0164639.g004){ref-type="fig"}, arrow). Following a three-day incubation, the bee pupae were homogenized in a total volume of 1 ml PBS. A mean viral load of 2.4 x 10^8^ GE/bee of rDWV was found in the transfected bee pupae using qRT-PCR. The rDWV was passaged in novel bee pupae using 0.5 μl of the lysate (1.2 x 10^5^ GE) obtained from the transfected pupae. After infection, the mean viral load of rDWV was 2.0 x 10^10^ GE/bee in the second and 2.5 x 10^10^ GE/bee in third passage. In parallel, we passaged the DWV-A 1414 isolate (wtDWV) using 0.5 μl of the described crude pupa lysate. A mean viral load of 8.2 x 10^10^ GE/bee was obtained from passage three of wtDWV. Mock infected pupae, which originated from the same combs, were used as controls in these experiments. DWV RNA was not detectable in the mock infected controls. A different RT-PCR assay was performed to differentiate between wtDWV and rDWV. The RT-PCR amplicons from rDWV transfected and rDWV infected bee pupae were completely fragmented after BamHI digest (488 and 276 bp) confirming the rescue of recombinant virus and the absence of field virus replication ([Fig 5A and 5B](#pone.0164639.g005){ref-type="fig"}). Western blot analysis of pupae infected with the field virus using the VP1 specific mAb DWVVP1A1 revealed large amounts of mature VP1 (46 kDa) and of an unknown 19 kDa protein, while only a weak signal of VP1 and of the 19 kDa protein was found after transfection of rDWV RNA ([Fig 6A](#pone.0164639.g006){ref-type="fig"}). However, a strong VP1 expression was observed after rDWV infection of pupae in subsequent passages. Interestingly, the mAb DWVVP1B1 showed no reactivity with the 19 kDa protein ([Fig 6B](#pone.0164639.g006){ref-type="fig"}). ![DWV infection model.\ (A) Bee pupae at the day p.i.. A black arrow at one bee pupa marks the injury caused by injection. (B) Typical outcome of infections with rDWV-A 1414 and wtDWV-A 1414: (B1) Healthy bee, which emerged at day 21 of development after mock infection. (B2) Bee pupa, which died three days after infection with wtDWV-A 1414. (B3) Nonviable adult bee, which emerged at day 21 after infection with rDWV-A 1414 showing typical wing and limb deformities.](pone.0164639.g004){#pone.0164639.g004} ![Differentiation of rDWV and wtDWV using the BamHI restriction site.\ Pupae transfected with synthetic RNA of rDWV-A 1414 (lane A2) and infected with wtDWV-A 1414 (lane A3) show the DWV specific RT-PCR product of 764 bp. Mock infected pupae (lane A1, B4) serve as negative controls. The PCR product of pupae transfected with rDWV-RNA (lane A4), infected with passage one rDWV (lane A6) and with passage three rDWV (lane B2) was converted in 488 bp and 276 bp fragments after BamHI digestion. In contrast, the PCR products of wtDWV infected controls (lane A5, A7, and B3) are not cleaved by BamHI. Arrows on the right side indicate the size of the respective visible RT-PCR products and fragments.](pone.0164639.g005){#pone.0164639.g005} ![Western blot analysis of the rDWV rescue.\ (A) Bee pupae infected with a DWV-A field isolate (wtDWV, lane 2 and 3) or transfected with synthetic RNA of the DWV-A clone (rDWV, lane 4 and 5) were probed two days and four days after inoculation using mAb DVWVP1A1. Bands with an apparent molecular mass of 46 kDa (VP1) and 19 kDa (unknown) were visible in wtDWV infected and rDWV transfected pupae but absent in the mock control (lane 1). (B) Bee pupae infected with passage three of wtDWV (lane 7) and rDWV (lane 8) were tested for VP1 expression using mAb DVWVP1B1 two days after infection. Interestingly, the 19 kDa protein was not detectable using mAb DVWVP1B1.](pone.0164639.g006){#pone.0164639.g006} 3.3. Pathogenicity of rDWV A1414 and wtDWV A1414 {#sec017} ------------------------------------------------ Pathogenicity of rDWV and wtDWV was assessed after infection of ten bee pupae with 5 x 10^6^ GE each, compared to a mock-infected control group. The surviving bees from each group at day 22 of development together with the dead pupae withdrawn prematurely from the experiment are presented in a supporting information file ([S1 Fig](#pone.0164639.s001){ref-type="supplementary-material"}). From the mock-infected control group, one bee pupa died at day two after injection and one bee displayed severe wing deformations after emergence. Eight of the bees appeared healthy with clear unfolded wings ([Fig 4B1](#pone.0164639.g004){ref-type="fig"}). In the wtDWV group, six bee pupae died at day three and two bees died at day four post infection ([Fig 4B2](#pone.0164639.g004){ref-type="fig"}), giving a mortality rate of 80%. One of the wtDWV infected bees emerged with severely malformed, damaged wings and one showed dwarfism with discoloration (morbidity rate of 100%). One bee of the rDWV infected group died at day three post infection, eight bees emerged with malformed wings, and one bee showed no signs of disease ([Fig 4B3](#pone.0164639.g004){ref-type="fig"}), yielding a mortality rate of 10% and a morbidity rate of 90% for rDWV. 3.4. Host cell tropism of rDWV and wtDWV A1414 {#sec018} ---------------------------------------------- Bee pupae infected with passage three of rDWV and wtDWV were analyzed by immunohistochemistry (IHC) at day three post infection (day 19 of development). Mock-infected control pupae were included as negative controls. The mAb DWVVP1B1 showed no reactivity in the negative control demonstrating the specificity of the staining for the DWV VP1 protein ([Fig 7A](#pone.0164639.g007){ref-type="fig"}). Tissue distribution of IHC signals for rDWV-infected bees was similar to that of wtDWV-infected bees ([Fig 7B and 7C](#pone.0164639.g007){ref-type="fig"}). DWV infection affected all parts of the bee body, including head, thorax, and abdomen as previously described \[[@pone.0164639.ref015]\]. In the head, DWV VP1 antigen was found in ocular cells, central nervous system and glandular tissues. In the thorax, connective tissue cells and glands were stained. No VP1 of DWV was found in haemocytes and muscle cells, suggesting that these cells are less susceptible to DWV-A infection. ![Immunohistochemistry staining of DWV infected cells.\ Bee pupae were probed using mAb DWVVP1B1 at day three post infection. The head (left row) and thorax region (right row) of mock (A), wtDWV (B) and rDWV (C) infected bee pupae is shown. A broad infection pattern is revealed by VP1 staining for wtDWV and rDWV. Anatomical details are indicated as retina (re), fenestrated layer (fl), lamina (la), outer chiasm (oc), and medulla (me) of the optical lobe and hypopharyngeal glands (hg) for the head in A. In the thorax section, muscle bundles (mb) separated by fat body cells (fb) are marked.](pone.0164639.g007){#pone.0164639.g007} 3.5. Electron microscopy of rDWV {#sec019} -------------------------------- Virions formed after transfection of rDWV RNA were assessed by transmission electron microscopy. Spherical particles with diameters of about 30 nm were observed in wtDWV ([Fig 8A](#pone.0164639.g008){ref-type="fig"}) and rDWV ([Fig 8B](#pone.0164639.g008){ref-type="fig"}) concentrates, as previously described for DWV \[[@pone.0164639.ref028]\]. In these virus preparations, very dense protein aggregates occurred, which most likely consist of DWV structural proteins. The protein composition of the preparations was further analysed by SDS-PAGE and Western blot analysis ([Fig 8C](#pone.0164639.g008){ref-type="fig"}), showing three clear bands representing the major DWV structural proteins. ![Virions of rDWV (A) and wtDWV (B) visualized by transmission electron microscopy.\ Proteinacious aggregates (white box) and single virions (black box) are enlarged for both preparations. The bar is 100 nm in the left and 25 nm in the right panels. (C) The protein content of purified rDWV virions is presented after SDS-PAGE in Coomassie stain and Western blot (DVWVP1A1). The apparent bands of DWV structural proteins are indicated.](pone.0164639.g008){#pone.0164639.g008} 4. Discussion {#sec020} ============= Typical wing deformities, brood losses and colony mortality are observed following varroa mite infestation of European honey bees. These symptoms are indicative of a DWV infection; however DWV is frequently detected in healthy colonies at the same time. The exclusion of additional pathogens responsible for colony mortality is excessively difficult, taken the lack of classical virological tools into account. The same applies for laboratory experiments reproducing the pathogenicity of DWV, in which certain requirements of Koch's postulates were already fulfilled \[[@pone.0164639.ref015]\]. Robert Koch defined strict criteria for the establishment of a causative relationship between a microbe and a disease, first published in 1884 \[[@pone.0164639.ref042]\]. These strict criteria include the isolation of a microbe from a diseased host, its growth in pure culture and the reproduction of the disease in a healthy host after experimental inoculation. Furthermore, the microbe must be re-isolated from the diseased experimental host and identified as being identical to the cultured microbe. Multiple attempts have been made to adapt Koch's postulates to chronic diseases \[[@pone.0164639.ref043]\], sequenced-based identification of pathogens \[[@pone.0164639.ref044]\], general association of environmental factors and disease \[[@pone.0164639.ref045]\], or the role of genes and their products in pathogenesis \[[@pone.0164639.ref046]\]. Pure virus cultures depend on biological cloning methods in defined cell culture systems, which have yet to be established for honey bee viruses. In this study, we applied molecular cloning to generate a pure DWV inoculum to better fulfill Koch's postulates. Each molecular approach to test candidate genetic factors involved in microbe pathogenesis requires an infection model and the ability to genetically manipulate the microbe. The ability to genetically manipulate the infectious agent is pivotal for controlled investigations of RNA viruses \[[@pone.0164639.ref047]\]. Infectious clones exist for a large number of positive-stranded RNA viruses, including picorna-, alpha-, pesti-, arteri-, and coronaviruses with genomes up to 30 kb. Reverse genetics has been a key technique for elucidating viral pathogenesis and the functions of viral gene products \[[@pone.0164639.ref048]\]. Here, we present the first plasmid based reverse genetics system for a DWV-A genome. Key feature of this DWV-A clone is the identity of the 5'-end that exceeds previous full-length DWV sequences by 10 to 21 nucleotides. Sequence comparison to other members of the family Iflaviridae demonstrates a high diversity of the 5'-terminus \[[@pone.0164639.ref049]\]. Preliminary bioinformatics analyses suggest a stem loop structure downstream 10 unpaired nucleotides at the very 5'end. Further experiments are needed to unravel function and two-dimensional structure of the 5'-NTR. It is noteworthy that the plasmid based copy of the DWV genome originated from a full length PCR product. This approach not only simplifies the construction of the cDNA clone but also warrants that not different---possibly incompatible---fragments of the DWV quasispecies cloud are joined. The eponymous clinical sign of DWV-A infection of bee pupae is the atrophy or misfolding of the wings, which is caused by vector borne DWV transmission \[[@pone.0164639.ref015], [@pone.0164639.ref050]\]. The unfolding and stretching of the wings represents the first step of a bee's development after molting to an imaginal stage in their holometabolous metamorphosis. Multiple factors might impair the sensitive process of hymenoptera wing development. Unsuitable incubation conditions, pupal injuries, the lack of a cocoon, hormonal disorders \[[@pone.0164639.ref051]\] and intoxication \[[@pone.0164639.ref052]\] have been shown to result in the emergence of adult bees with crippled or malformed wings. We were able to reproduce the typical clinical signs of DWV infections using synthetic RNA derived from a plasmid clone of DWV-A. Pathogenicity of the DWV-A clone was assessed by a high titer infection experiment showing a morbidity rate of 90%. In contrast, equivalent infections with the field isolate DWV-A 1414 caused a morbidity of 80%. Differences in the morbidity rate might be due to a clonal infection in case of the recombinant virus, compared to an infection with a cloud of divergent genomes in case of the field virus isolate. The importance of quasispecies for DWV pathogenesis has been put forward in previous studies reflecting the natural situation in most RNA viruses \[[@pone.0164639.ref027]\]. On these grounds it is exciting that a single genome from the quasispecies cloud is able to reproduce disease. We now can study the speed, complexity and direction of the development of DWV-A quasispecies radiating from a single clone. Further to this, virulence factors, or more likely, virulence associated gene alterations can be investigated in detail. Until now, it is not known whether wing deformities arise from wing tissue infection or result from systemic damages. Our immunohistochemistry data underlines that DWV injection led to systemic infections affecting all parts of the bee's body. DWV-A was detected in bee heads within the neural and gland tissues, as previously described \[[@pone.0164639.ref029]\]. In nurse bees, the exocrine glands of the head secrete the royal jelly. Since signals of DWV VP1 were detected in all secretory glands of the head, an evolutional adaptation of DWV to oral transmission is very likely \[[@pone.0164639.ref053]\]. Nutrient exchange is a continuous process in the bee colony that might contribute to transmission, horizontal infection and persistence of DWV in honey bee colonies \[[@pone.0164639.ref015]\]. The application of the reverse genetics system will provide a new basis to study the factors of DWV host cell tropism and to investigate the molecular mechanisms behind DWV transmission. Supporting Information {#sec021} ====================== ###### Pathogenicity of wtDWV and rDWV. Injection of ten bee pupae with PBS (A), 5 x 10^6^ GE of wtDWV (B), and 5 x 10^6^ GE of rDWV (C) was performed at day 15 of development. Outcome of the infection experiment documented at day 22 of development. (TIF) ###### Click here for additional data file. We thank Katharina Buczolich and Hann-Wei Chen for their excellent technical support and Stefan Mandl for providing healthy bee colonies. Electron Microscopy data was collected at the EM Facility of the Vienna Biocenter Core Facilities (VBCF). [^1]: **Competing Interests:**The authors have declared that no competing interests exist. [^2]: **Conceptualization:** BL AU TR.**Data curation:** BL.**Funding acquisition:** BL TR.**Investigation:** BL AU KS JE CR LJS SI HK TR.**Methodology:** BL AU KS JE CR LJS SI HK TR.**Project administration:** BL TR.**Resources:** BL AU HK TR.**Supervision:** BL TR.**Validation:** BL AU TR.**Visualization:** BL TR.**Writing -- original draft:** BL TR.**Writing -- review & editing:** BL TR.
I am opposed to the Palestinian effort at the United Nations because I think that it is going to get them nowhere. This is not the time for romantic gestures. This is the time for them to do something that will actually help them get a Palestinian state - a goal that I support. What is the likely outcome at the U.N.? The likely outcome is that the push is going to go nowhere in the Security Council. It may get to the General Assembly, and there may be a symbolic vote. But the result of that symbolic vote may well be that they lose funds - financial support from Israel, the U.S. and potentially some European countries - and it will make the Israelis feel that the Palestinians have gone in a unilateral direction when the only viable strategy is a bilateral one. At the end of the day, there is only one way you’re going to get a Palestinian state. And that’s if the Israelis agree to it. They have the land; they have the guns; they have the money. Palestinians may regard it as deeply unfair, and I understand that. But it is the world that we live in. The only way they’re going to get a Palestinian state is to engage directly with the Israelis. The Israelis have not been willing to be a productive partner in recent years, though it is worth remembering that the Israeli government under Ehud Barak did make a very serious effort and the Israeli government under Ehud Olmert made a very serious offer to the Palestinians. So, let’s not confuse Benjamin Netanyahu’s intransigence with all Israeli governments in recent years. The current government in Israel is clearly motivated by Israeli domestic politics. It fears the fragile governing coalition will fall apart. Perhaps, it is also motivated by ideological reasons. It is not in any way being a constructive partner. I think the U.N. vote is an understandable act of frustration on the part of the Palestinians, but they’re not going to get a Palestinian state through frustration. They’re going to get it by being smart and figuring out what they need to do to get the Israelis to engage in serious negotiations. I think Palestinian Prime Minister Salam Fayyad’s strategy of building a state from the ground up has been an incredibly successful one, and you can see it in the fact that Israelis have increasing respect for the institutions on the ground in the West Bank. I think the next big push the Palestinians need to figure out is how to get control of Gaza. If you have half of the Palestinian leadership that engages in terrorism and does not accept Israel’s right to exist, the Israelis are simply not going to create a Palestinian state under those conditions. Again, I’m leaving morality aside for now and just asking, “What is the practical path to a Palestinian state?” And the practical path has to be to sideline Hamas in some way or another. The more good governance the Palestinian authority is able to demonstrate, the more likely it is that Hamas will be sidelined. I’m convinced of the cause; I would like to see a Palestinian state, and I would like to see it broadly speaking on the boundaries that President Clinton’s plan talked about. Someone who has frequently been in these negotiations has told me: “It’s not that there’s no light at the end of the tunnel. Everybody sees the light at the end of the tunnel. The light at the end of the tunnel is blindingly clear and obvious. The problem is there’s no tunnel. There is no actual concrete path to getting to that light.” And it isn’t going to happen with grand gestures at the United Nations. It’s going to happen through a series of very smart, thoughtful and practical steps along the way. soundoff(937 Responses) dugee The old testament was written by the people who took the land from other people.It reads like a giant excuse for bad behavior from cover to cover. Having said that, I live in North America- also on stolen land. The fact is land changes hands over history.Trying to make it look legitimate with a holy book is lame. How about we look at the human catastrophe and sort it out on that basis. Zakaria answers his own statement why“The current government in Israel .... is not in any way being a constructive partner.” Duh! “If you have half of the Palestinian leadership that engages in terrorism and does not accept Israel’s right to exist, the Israelis are simply not going to create a Palestinian state under those conditions.” And did you see the softballs Zakaria threw at Turkey's Erdogan on the show last week? No question as to Erdogan's conflicting position that the Palestinians should have their own state-but how about the Kurds? This article is weak on analysis. As I understad it,Farid recognises that legitimate rights of the Palestinians to their own state in their ancesteral home land, however, in view of the objection from the US and Israel he does not believe it can happen at the UN. Most of us who are familiar with the situation understand that this move will not result in a Palestinian state but neither will the status que. A UN resolution even at the general assembly will provide the Palestinians with a better negotiating position by being able to use international legal venues that are not availble now. The issue of losing Israeli aid, com'oooon Farid you know better. Based on a recent UN funded study it was determined that the Israeli occpation is costing the Palestinians $4.5 billion per year by limiting accessis to natural resources and limits on movement of people and products. Farid should have clarfied that the funds Israel tranfers and often uses to blackmail the PA are Palestinian taxes collected by Israel on behalf of the PA by agreement and not aid provided by Israel. By saying that this is not the right approach and the Palestinian need to be smarter in finding ways to achieve a Plaestinian state is basicly accepting the status quoe. I expected Fraid would have recommended clear alternatives rather that just stating the abvious that this move will not result in a Palestinin state. Israelhave violated every agreement with the palestinians with impunity and the Palestinians had to to do something to shake upthe stalemate. Post a comment CNN welcomes a lively and courteous discussion as long as you follow the Rules of Conduct set forth in our Terms of Service. Comments are not pre-screened before they post. You agree that anything you post may be used, along with your name and profile picture, in accordance with our Privacy Policy and the license you have granted pursuant to our Terms of Service. About us The Global Public Square is where you can make sense of the world every day with insights and explanations from CNN's Fareed Zakaria, leading journalists at CNN, and other international thinkers. Join GPS editor Jason Miks and get informed about global issues, exposed to unique stories, and engaged with diverse and original perspectives.
Q: How to link entire article content as menu How to link entire article content (including text, paragraph, etc.) as menu in Joomla. Any help greatly appreciated. Thanks in Advance Entire above block I want as menu Thanks A: Your question is very vague, and parts of it doesn't make sense (add hyperlinked article to menu item and menu module, for instance). You're mixing the terms module, articles, urlmenu and others. But as far as I understand, you have one (or more) blocks like the image in your question, and you want to link them to an article with details about the hotel. What you need is the link to the article in question. This can be achieved in several ways. Choose the option that fits your needs: Get link in editor In your article editor (I assume you're using TinyMCE), you can create a link to any existing article with the "Article" button below the text window: This will insert a direct link to the article, with the article title as the link text. To see the actual link, click the "Source Code" button in the toolbar and copy the link parameter. Then simply paste the link you copied into an <a> tag surrounding your block. Hidden menu You can also create a new menu (Menus -> Menu Manager -> Add New Menu) and call it whatever you like ("Hidden" is a good idea). The menu will be invisible to users unless you publish it to a module position. Then create a new menu item in this hidden menu for each article you want to link to (for instructions, see the link provided by johnny_s). Notice the field "Alias": The alias field will be the link to your article. Once you save the menu item, you can link to the article like this: http://YOURSITE.com/index.php/YOURALIAS or index.php/YOURALIAS Replace YOURALIAS with the alias of your menu item. (Note that this will only work if you enabled "Search Engine Friendly URLs" in Global Configuration) Create the link manually You can create the link like this: index.php?option=com_content&view=article&id=XX&Itemid=YY Replace XX with the article ID (you can find this in the article manager, in the right-most column). The last part (&Itemid=YY) is optional, but if you replace YY with the ID of an existing menu item, the page layout (published modules etc.) will match this menu item. Use JCE The popular editor JCE (Joomla Content Editor) will allow you to create a link to any existing article. Instructions can be found here: https://www.joomlacontenteditor.net/support/documentation/25-links/271-interface A: From what I understand of your question, you want to call content into your menu output. This is absolutely possible, but it requires a bit of skill and understanding of Joomla. Instead of making your content an article, make your content in a module. Then you call that module into your menu item using a mega menu (such as CKMaximenu) and its paid plugin. Or utilize NoNumber, a combination of rereplacer, modules anywhere, or sourcerer would do it.
Q: What's the difference between Target CPU and Platform in Visual Studio 2013? In VS 2013, in Compile in Project Properties, I see two configurations that seem the relate to the same thing (printscreen right below). Platform and Target CPU. What's the difference? Is there any? A: By default the Platform strings are the same as the Target CPU or Mixed. However, since the Platform is a user configurable string you could give them any name or decouple them from the target CPU. I'd not recommend decoupling them, as it can be very confusing. But as your screenshot shows it's possible to create a Solution Configuration or Project Configuration named AnyCPU, yet configure your project to to build x86. Confusing as hell, but possible.
import SweetAlert from './SweetAlert.js' const Swal = SweetAlert Swal.default = Swal export default Swal
To tithe or not to tithe? Black churches vulnerable in economic downturn Tithing, or giving 10 percent of your income to support the ministries of your church, is vulnerable during the slow economic recovery. As the national unemployment rate trends downward, currently at 8.5 percent, the opposite is true for African-Americans. Since October 2011, black unemployment has increased from 15 percent to 15.8 percent in December, according to Bureau for Labor Statistics. The jobs crisis has impacted giving. The non-profit, Faith Communities Today, says 80 percent of congregations in a recent survey said they took a financial hit during the recession. Dr. Thomas Johnson, Sr., Senior Pastor of Canaan Baptist Church of Christ in Harlem says many of his members were impacted by cuts on Wall Street, public education and public transportation. “We see a difference in our tallies on Sunday when we count our tithes and offerings that there has been some decline,” he says. Some of the funds from tithing and offerings are used for building maintenance and infrastructure. But despite the dip in giving he says members expect the type of ministries they are accustomed to. “People still expect the same level of passion, and energy and resources and opportunities in worship.” Dr. Johnson says. Giving by the numbers According to Giving USA, religious charitable giving accounted for 35 percent of the $290.89 billion in charitable contributions in 2010 or about $100.63 billion. Approximately 87 percent of donations came from individuals and family foundations or an estimated $87.5 billion. This includes contributions to houses of worship, national offices of denominations and faith groups, ministries, and religious communities. Overall, giving was up 0.8 percent from 2009 to 2010, but if you adjust for inflation giving was down 0.8 percent. 2010 was the 56th year religion received the largest share of charitable dollars, but giving to religion has been decreasing as a share of total contributions since the 1986 to 1990 period, according to the Giving USA report. Houses of worship are feeling the pinch. According to non-profit Empty Tomb which gathers data from thousands of houses of worship in the U.S., per member giving as a percent of income was 2.38 percent in 2009, this is the lowest since data tracking began in 1968. Sylvia Ronsvalle, Vice President at Empty Tomb, says contributions have been declining whether the economy is good or bad. “Church giving is close to the family, it’s not the first place people will cut,” Ronsvalle says. Per member giving in dollars was $854.25 in 2009 after peaking at $863.81 in 2007, according to Empty Tomb. It declined for the first time in 2008, since tracking began in 1968. “As we become richer are we not giving more to the church, if that happens over time, it can weaken commitment,” Ronsvalle explains. “Church giving may have been more vulnerable during the last economic downturn, versus in the 1970s when people were still more committed and resisted decreasing giving until they had to,” she says. “I wouldn’t say it’s only the economy, it’s also that commitment to church.” Balance tithing with the budget Many worshipers try to balance obedience to tithing with trying to pay their bills. “We need to get away from thinking there has to be a set number on what you need to tithe,” says Sharon Epperson, CNBC Senior Commodities and Personal Finance Correspondent. Epperson says financial obligations should be paid first and tithing is a financial obligation. Church members “need to figure out how to budget and how to figure out how much to give each.” If people are looking for extra money to put in the collection plate on Sundays, Epperson suggests they look at ways to trim their budget such as cutting their cable, switching to a cheaper utilities provider and cutting transportation costs. A person giving of their time and talents should also be factored into contributions to houses of worship she says. Tithing talk There are two sides of the tithing debate, spiritual and practical. Dr. Johnson says church members have an obligation to tithe. “According to the bible to the tithe belongs to the Lord. If you have $1 you bring God a dime, if you have $100 you bring God $10 and so forth,” he explains. “The expectation that everybody will tithe with what they have is still there.” “I like a lot of Amens, but on tithing I don’t get too many Amens on that, but I’m still obligated to do it.” Dr. Johnson says Canaan is receiving adult disciples who have no understanding of how Christianity functions. As a result for adult Christians tithing can be a strange request. Dr. Johnson says God entrusts us and we should be a good steward of our income. Although referenced numerous times the Bible, tithing has its critics. ”[Preachers] use trickery and gimmicks to manipulate the congregation into paying 10 percent of their income,” says R. Renee, co-author of The Tithing Hoax book and blog. She says tithing has placed a financial, emotional and spiritual burden on people. “People or congregations feel compelled to pay this money even if they can’t afford it,” she says. R. Renee says church members should support the church financially, but it should be voluntary or through free will offerings. “Even if they can’t support with their finances, they can support with their time and skills.” Pastor Marc Royster of the Harvest for Christ Church & Ministries in Miramar, Florida says his church has seen a pretty consistent level of giving. He said some of his members are feeling the effects of a slow economic recovery. “Several people are on the bubble, if I can use that term. Threats of layoffs, threats of furloughs, so it’s a scary, scary time,” Pastor Royster says. “It would be irresponsible of me to vilify or ostracize a person because they are unable to give,” Pastor Royster suggests. He says he does not have to look at a balance sheet get any indication that things are going wrong. “My congregation comes directly to me and I know the stories of how mom is doing bad, a brother or a sister is having some struggles so I hear these stories all the time,” he says. Congregations, especially, those in hard hit communities must learn how to serve more people with fewer financial resources. “When the economy starts getting better the African American community tends to be the last layer of citizens to feel the effect of that,” Dr. Johnson says.
Q: Assign JavaScript Variable value into PHP Variable I have this JavaScript below which does few things on my website. I need to assign the value from JavaScript into PHP Variable to be used in a SESSION. <script type="text/javascript"> function CallbackReverse(what) { rand = get_rand(); text = "416-05-201-XXX"; text = text.replace("XXX", rand); //Store it in session <?php $_SESSION["pin_number"] = "text"; ?> } </script> Please help. A: You can't insert PHP code in javascript code, PHP is a server language and Javascript is a client language The solution to do what you want is using AJAX and call a PHP page which execute your action - you can send parameters (i.e. text) with jQuery : $.ajax({ type: 'POST', url: 'mypage.php', data: {text: text}, }).done(function () { /* success code here */ }); Your script PHP called : $text = $_POST['text']; $_SESSION['pin_number'] = $text;
ALTER TABLE character_db_version CHANGE COLUMN required_13991_01_characters_skills_cleanup_1829 required_13993_01_characters_fix_skills_overflow bit; UPDATE `character_skills` SET `value` = `max` WHERE `value` > `max`;
Q: Codeigniter: Email attachment of last emails not cleared while sending multiple emails in loop My code sends multiple emails in loop with attachment, Problem is attachments of last(previous all) emails get attached to next email. ex. suppose 3 emails in database with 1 attachment in each(a1.pdf, a2.pdf, a3.pdf) then, it sends email with attachment as email 1: attachment :a1.pdf email 2: attachment :a1.pdf, a2.pdf email 3: attachment :a1.pdf, a2.pdf, a3.pdf I am using codeigniter framework. My code is (this code is called in loop) . . . $this->email->subject($item->subject); $this->email->message($message); $attachments=''; if(strlen($item->attachment) > 5) { $attachments = explode(',', $item->attachment); foreach($attachments as $attachment) { if(strlen($attachment)>5) $this->email->attach(FCPATH . 'attachments/' . $attachment); } } $this->email->send(); . . . A: You need to reset it in CodeIgniter. At the end of the loop add: $this->email->clear(TRUE); This resets all email variables including the attachments, allowing you to create a new mail. A: You need to use $this->email->clear(); to clean out the variables set within the loop. Read the manual.
Q: Which feature/s will avoids SPAM or massive invalid transactions in a IOTA network? Watching IOTA presentation there is a thing that is still unclear for me: Knowing that IOTA involves PoW but a much lighter one (in order to achieve thousands of transactions per second, but also would not involve a big computational power) and also being every node that includes new transactions into a validator: What will avoid to a spammer/hacker post invalid transactions into the IOTA network? Let´s say, hundreds or thousand of devices starts to include new invalid transactions (transference of tokens or data) that they got confirmed by the other nodes participating in that SPAM process. This question is based on a IOTA presentation where a demo with a car was shown --> https://www.youtube.com/watch?v=2zvrA5KqeYw I was wondering: What if a malware is installed or starts to get involved into the car transactions, providing information that is not right? Knowing that the nodes that has the car are also TX "validators", could not be possible that they generate such amount of new invalid transactions, validated by itself? A: This blog explains exactly the main concern here reported: http://www.tangleblog.com/2017/07/10/is-double-spending-possible-with-iota/ Section: "Doublespending in IOTA" Basically, the increasing number of hosts also increase the difficulty to perform such attack, due to you need to get "an “omnipresence in the tangle with “bad” nodes, formed as a sub tangle (or parasite chain).". Also, perform double-spending validations require not only be "onmipresent" but very fast. Recommend take a deep look into that blog ;)
// Copyright (C) 2020 Igalia, S.L. All rights reserved. // This code is governed by the BSD license found in the LICENSE file. /*--- esid: sec-temporal.time.prototype.plus includes: [compareArray.js] ---*/ let called = 0; const constructorArguments = [ [12, 34, 56, 987, 654, 321], [12, 34, 56, 987, 654, 322], ]; class MyTime extends Temporal.Time { constructor(hour, minute, second, millisecond, microsecond, nanosecond) { assert.compareArray([hour, minute, second, millisecond, microsecond, nanosecond], constructorArguments.shift(), "constructor arguments"); ++called; super(hour, minute, second, millisecond, microsecond, nanosecond); } } const instance = MyTime.from("12:34:56.987654321"); assert.sameValue(called, 1); const result = instance.plus({ nanoseconds: 1 }); assert.sameValue(result.hour, 12, "hour result"); assert.sameValue(result.minute, 34, "minute result"); assert.sameValue(result.second, 56, "second result"); assert.sameValue(result.millisecond, 987, "millisecond result"); assert.sameValue(result.microsecond, 654, "microsecond result"); assert.sameValue(result.nanosecond, 322, "nanosecond result"); assert.sameValue(called, 2); assert.sameValue(Object.getPrototypeOf(result), MyTime.prototype);
Hotel Il Mulino Key Highlights Description The Hotel Il Mulino is located in Capo d’Orlando, a charming town situated on Sicily’s northern coast 90 Km. from Messina. Among the hotels in Capo d'Orlando, the Hotel Il Mulino boasts a privileged position: overlooking the sea on the beautiful sandy beach in the center of Capo d’Orlando. The hote... The Hotel Il Mulino is located in Capo d’Orlando, a charming town situated on Sicily’s northern coast 90 Km. from Messina. Among the hotels in Capo d'Orlando, the Hotel Il Mulino boasts a privileged position: overlooking the sea on the beautiful sandy beach in the center of Capo d’Orlando. The hotel is about 200 meters from the pedestrian area and about 300 meters from the train station General Information You must be logged in to view contact information for this supplier. Sign up for a free Cvent account today.
[Chemical disinfectant pollution of the air in the operating room]. After monitoring the air the operating room, the author found that the air was polluted by various chemical disinfectants which had exceeded the standard seriously. Close attention should be paid to it since health can be influenced by long period exposed to the polluted air. The author suggested the improved method for using chemical disinfectants to prevent air pollution in the operating room.
Transcallosal inhibition in chronic subcortical stroke. Movements of the paretic hand in patients with chronic subcortical stroke are associated with high interhemispheric inhibition (IHI) targeting the motor cortex in the lesioned hemisphere relative to healthy controls. The purpose of this investigation was to determine whether this abnormality also involves IHI operating during movements of the non-paretic hand. Here, we studied IHI in the process of generation of voluntary index finger movements by the paretic and non-paretic hands in a simple reaction time paradigm in a group of patients with chronic subcortical stroke. With movements of the non-paretic index finger, IHI targeting the contralateral primary motor cortex ((c)M1) decreased progressively to turn into facilitation at around movement onset, similar to healthy controls. In contrast, movements of the paretic index finger resulted in significantly deeper inhibition at all premovement timings relative to the non-paretic hand. In conclusion, these results document a deeper premovement IHI with paretic than non-paretic hand movements of patients with chronic subcortical stroke, a possible mechanism underlying deficits in motor control.
Innocent people had been getting tased, maced, shot with rubber bullets, and blasted with water cannons in below freezing temperatures for weeks, and Obama wouldn’t say a word about it. However, when veterans joined the front lines to protect innocent people from the violence of the local police force, and Bernie Sanders put increasing public pressure on him, the President finally spoke up. On December 5, Obama’s administration and the US Army Corps denied Dakota Access the last remaining easement it needs to drill under the Missouri River at Lake Oahe, halting completion of the pipeline. So how could the pipeline still be constructed without rerouting? Although this sounds like a victory on the surface, the corporations behind the pipeline (Energy Transfer Partners and Sunoco Logistics) are not worried. They reminded everyone that they are “committed to ensuring that this vital project is brought to completion and fully expect to complete construction of the pipeline without any additional rerouting in and around Lake Oahe” and that the Obama decision doesn’t change that “in any way”. And, unfortunately, the corporations could get around all of this in two ways: Obama’s decision isn’t permanent. Trump will most likely approve the project. Obama never guaranteed that the government will use force to keep the corporations from defying the law. Energy Transfer Partners can still drill under the river without a permit, an action that they’ve often taken in the past. Are protestors abandoning Standing Rock? Standing Rock water protectors do not intend to leave after hearing this “good news”. This was just an attempt to derail the growing protest movement. There is $3.8 billion at stake, and Big Oil is not going to give in easily. While President Obama has granted us a victory today, that victory isn’t guaranteed in the next administration. More threats are likely in the year to come, and we cannot stop until this pipeline is completely and utterly defeated, and our water and climate are safe. — Dallas Goldtooth, Indigenous Environmental Network The fight is not over.
17 Year-Old Hungarian Next Signing at Newcastle There is news buzzing on Tyneside today that another 17 year-old youngster will soon be through the door at Newcastle United. Chris Mort – determined to bring great young talent to Newcastle There are rumors that new Newcastle signing Ben Tozer watched the Reserves game against Sunderland from the stands last night. But also at the game was Hungarian Under-19 international Tamas Kadar and we fully expect 17 year-old Tamas Kadar to be signed, hopefully today, by the Newcastle club. It appears the club are attempting to get all the necessary paperwork from the English FA completed, before announcing the acquisition of the impressive youngster. Tamas Kadar is Zalaegerszeg’s young defender, and he is currently playing in Hungary, but last month the youngster was invited for trials at both Bolton and Newcastle United. The 17 year-old Hungarian is a first team regular in Hungary, and scouts from both Newcastle United and Bolton have been very impressed by his performances for the Zalaegerszeg club this season. His favorite position is in central defense but he can also play on the left at the back. Since both Newcastle and Bolton were interested, we suspect Sam Allardyce first lined him up while still manager at Bolton. And of course this latest capture will be in line with Newcastle’s new policy of finding players young, who have yet to make the grade. The plan is to finish their development at the club, which mirrors the way Arsenal and Arsene Wenger have captured many of their star players over the last several seasons. It is something that Sir Bobby Robson also tried, but it’s not always easy identifying these players while so young. The Hungarian Under-19 international has recently helped Hungary reach the qualifying stages of the European Championships, where they beat Wales as part of their qualification process. When Tamas was over for his trials in mid-December he told Sky Sports: “I really enjoyed being in England,” “In Bolton they would count me as a left-sided defender and in Newcastle I would play in the center of the defense. I admit this (central) is my favorite place on the pitch.” “I know nothing about the financial details, but I did my very best and I know they both liked my performances.” “I was told that I would have a good chance to sign in England and my move might be realized in the winter transfer period.” Kadar’s club Zalaegerszeg were not too interested in letting him go, after he made his debut for their first team last year, but of course were willing to listen to offers. We believe Newcastle have made more than an adequate offer, for the promising Hungarian. We think Tamas is probably the most likely of our young recruits to go straight into the first team squad and compete for a first team place. We hear he’s that good, and certainly the reports we have been receiving about the lad bear that out. We think he’s another excellent young player we have secured for the club’s future. It looks like Newcastle beat out Bolton Wanderers for the youngster – and he could well be the 3rd youngster arriving in as many days at the club. Tamas follows 17 year-old Ben Tozer on Monday and 18 year-old Wesley Baheng yesterday. Wonder who we have lined up for tomorrow? 😀 51 comments so far Before anyone asks why we are signing kids and where the big signings are – remember it is easier for Mort to tie up the deals for the kids quickly because the contracts are simplier. When you start dealing with the first 11 signings you’ve got clubs, agents, all sorts to deal with. Kadar is a great addition to the youngster line up – the best one we have signed so far. Hopefully people talk about the Newcastle kids in the same light as the Arsenal ones in years to come. At least thats what Mort wants. I’m over the moon that the club are recruiting youngsters. You get them for a small fee. If a handful grow to their potential then you’ve saved absolute millions on transfer fees. Well done mort and Co, and please can we have lots more! TBH I have not heard a lot about this kid, do we know any thing about him like height, no. of appearances etc? If anyone could find a video of him playing would be good. I tried youtube but nothing there. Keep the recruitment up – you can never out spend the top 4 clubs (even though we have sometimes tried) but this is the way to bridge the gap. We just need to make sure we can get them to full potential. I can’t believe it, I understand the decision by I thought he would be given the season. Mort backed him only a few days ago, seems a weird time to be getting rid. In my view there would be more and better managers available in the summer… now we have pearson in charge for man u. no offence to him but he isnt really very good. i feel sorry for sam that he wanted to leave but i can only up a new manager will do for us what it has done for spurs. we will need a new manager quick to buy players for the first team because pearson wont get money to spend. I’m pretty good at Championship Manager- even won the Champions League with Mansfield once! Wouldn’t fancy taking on the Toon though- Lippi maybe? Think Jose is not able to manager another Prem club this season- part of his agreement when he left Chelsea. Big Phil? Sven?- missed the boat there. Buy T-shirts and Hoodies health update My latest bone scans and CAT scans were completed on Wednesday of this week and yesterday I met with my oncologist Dr. Dhruva to look over the results. The stage four cancer remains stabilized and has not spread any further over the last six months. I was diagnosed with stage 4 prostate cancer in early 2017 after being in remission for six years. The cancer metastasized through the bones to different parts of the body and the treatment I am undergoing is hormone treatment. There is no cure for stage 4 cancer but there are treatments (like Hormone treatment) that attempt to prolong life. I am upbeat with the results and remain in awe of the doctors and nurses at the Rex Cancer Center here in Raleigh. It's truly humbling to see how inspiring they are with their patients. Ed Harrison Comments The purpose of the comments is to allow Newcastle United fans and others to express their views on the news of the day concerning the Newcastle United Football Club. We'd ask that you be civil towards other readers and refrain from obscene language and any comments on religion, ethnic groups or politics. Let's make this work - and let's help the Newcastle United Football Club become great again. Ed Harrison Kacper Tylenda Website Designer One of our avid readers Kacper Tylenda from Poland was the person who came in during April, 2017 and redesigned this web-site from top to bottom. We think he did a fantastic job to modernize the site with the roll-out on Thursday May 18th surprisingly smooth. I am so appreciative of his help. Kacper is starting his own business in web-design so if you want a website built or know of people who want to redo their sites in any way – here’s his portfolio. football club It’s the noise, the passion, the feeling of belonging, the pride in your city. It’s a small boy clambering up stadium steps for the very first time, gripping his father’s hand, gawping at that hallowed stretch of turf beneath him and, without being able to do a thing about it, falling in love.
Recently, Schell Games revealed that escape room VR spy game 'I Expect You to Die' has revenue more than $3 million across PSVR, Oculus Rift, HTC Vive and Windows Mixed Reality headsets since its 2016 release. I Expect You to Die creator Jesse Schell told Variety about their next VR game: a sword-fighting, lightweight dungeon crawler. He said that " What we are seeing is that the growth of VR is slow and steady," and also adds “It’s giving us a lot of confidence about the future. Maybe it didn’t take off like a rocket like some expected, but my perception is that’s because of technology and price point and we’re seeing technology and price point improve.” Also, said that he's found that VR games also seems to have a long tail.He believes the sweet spot for VR platefop will be when a headset can deliver a wireless, all-in-one system for $399.You can read more at Variety
Here at TalkAndroid.com, we love talking about all things Android… obviously. Today, however, we’re going to take a step back and look at another aspect of Google’s mobile platform: the carriers. Most of us have a bit of a love-hate relationship with our cellular providers. We’re thankful for the service they provide, but beyond that, things get hazy. When I say we’re thankful for the service, I mean that we are thankful that they provide service at all. Reception is another issue most of the time, along with call quality and dropped calls. Then, there’s the data options, and that’s where this rant comes in. AT&T announced a couple months back that they were putting a cap on their “unlimited” data plan, putting it up to a max of 2GB per month. On top of capping unlimited data (oxymoron much?), they have set up tiered pricing: 200MB / month and 2GB / month, with massive overage charges, the most expensive of which are on the 250MB plan. Their logic, of course, is that there are some users who won’t use as much data and would prefer to pay less for it. Now, Verizon has followed suit in the price tiering, saying they are going to impliment data tiers similar to AT&T, but they also say they do not agree with the way AT&T “values data”, which will make it interesting to see how Verizon will roll out the pricing. Even T-Mobile was gazing eye-to-eye with a lawsuit a while back, wherein the plaintiff said they capped his data usage without informing him in his initial contract. Wake up, carriers! It’s not 2004 anymore, and it’s time to stop acting – and pricing – like it is. The mobile market, in general, is moving towards higher end phones that consume a lot of data by default. We are well on our way to being the most socially-centered society ever. What with Facebook, Twitter, Foursquare, and similar services, we are becoming a people that have to be constantly connected… and that means data consumption on-the-go. Not too terribly long ago, mobile data was considered a commodity, viewed by many as a rather unnecessary privelege made mostly for business types and the well-to-do. Now, however, data is practically a need on a daily basis. E-mail, searching things on the go, staying in touch: these have all become an integral part of our lives, and people are beginning to wise up to the carriers’ games. The cost of keeping up a reliable data network is nothing in comparison to amount of money the consumer is being charged to access that data. The profit margin to the providers is almost obscene. Then, there’s tethering. Tethering is the ability to utilize the mobile data on your device from other devices, such as laptops and tablet computers, even your home or work desktop if need be. The carriers lump the data that you use in this fashion separately, as if it costs them more for you to access their data network from a device other than the ones that they have sanctioned. The truth? No way. Some would argue that they are simply charging you for the convenience of using this method of data consumption, which is equally outrageous, considering that the amount the average consumer pays to tether is the same amount they pay for “unlimited” data. That’s like paying your cable bill, plus an equal amount of money for every television you want to watch said cable on. It’s time our cellular providers wake up and smell the data. What with the ways carriers are limiting and pricing data usage, it seems they are trying to keep in peoples’ minds the idea that mobile data is still a precious and fragile service that requires every cent raked in from consumers who use the service to maintain. However, it may be time for the carriers to reevaluate their data strategy, as consumers are catching on to what the providers are pulling, some of which is thanks to internet access on-the-go. How ironic.
Q: How can we reconcile Genesis 1:24-26 & Genesis 2:18-20? Genesis 1:24-26(KJV) 24 And God said, Let the earth bring forth the living creature after his kind, cattle, and creeping thing, and beast of the earth after his kind: and it was so. 25 And God made the beast of the earth after his kind, and cattle after their kind, and every thing that creepeth upon the earth after his kind: and God saw that it was good. 26 And God said, Let us make man in our image, after our likeness: and let them have dominion over the fish of the sea, and over the fowl of the air, and over the cattle, and over all the earth, and over every creeping thing that creepeth upon the earth Genesis 2:18-20(KJV) 18 And the LORD God said, It is not good that the man should be alone; I will make him an help meet for him. 19 And out of the ground the LORD God formed every beast of the field, and every fowl of the air; and brought them unto Adam to see what he would call them: and whatsoever Adam called every living creature, that was the name thereof. 20 And Adam gave names to all cattle, and to the fowl of the air, and to every beast of the field; but for Adam there was not found an help meet for him. In Genesis 1 it would seem the animals were created before the man but in Genesis 2 the animals were created after the man specifically to find a help meet for the man A: You can't "reconcile" the two accounts of creation in Genesis 1 and 2 without creating more problems than you solve. The answer provided by gotquestions.org ignores the problem presented by Genesis 2:18, which verse seems to indicate that the man was alone, without the animals, as the OP indicates. Here are some reasons not to spend time on this type of "reconciliation" in the OT: The criterion of logical coherence is extra-textual, extra-cultural and anachronistic (originated in a later period than the text itself and in Greek culture). The writers and compilers of the OT did not share our conceptions about the existence of an objective reality or about an objective view of history. The large number of inconsistencies both within books of the OT and between the books is a clear indication that the writers of the books and compilers of the corpus felt that conflicting material should be included. We should respect this decision and endeavor to understand it. It detracts nothing from the sacredness of the texts themselves. The assumption of applicability of the criterion of coherence itself needs to be examined in each instance. Attempts to reconcile the conflicts usually lead to contrived readings or require making unprovable and often silly presuppositions. As such, they often create more problems than they solve. The reconciliations add nothing to our understanding of the texts or of the people who wrote them, and in fact, prevent a deeper understanding of what the texts are saying. In this particular case, it might be more fruitful to ask why there appear to be two different accounts of creation. How do these accounts complement each other? Why did the writer see the need to include both? Why did the writer not smooth out the obvious inconsistency?
Q: Passing bool value for int parameter in COM server function I have a COM Server function with an int parameter. When I call the function in Matlab and pass in "true" as an argument, C++ evaluates the passed in "true" value to -1 for my int parameter (I'm stepping through my code). When I pass in "false", it evaluates to 0 just fine. I'm doing this because I used to only allow true or false values for this parameter, but now I accept ints 0-4 so I maintain the same logic with inputs 0 and 1 for backwards compatibility. I just don't understand why a "true" value evaluates to -1! A: From http://msdn.microsoft.com/en-us/library/t2t3725f.aspx : the default format for Boolean types marshaling is UnmanagedType.VariantBool which is 2-byte integer value where the value -1 represents true and 0 represents false
1. Field of the Invention The present invention is related to a zipper-type fastening device, and, more particularly, to an improved pin and box assembly and improved slider body. 2. Description of the Related Art In the years since their invention, zippers have become ubiquitous. Zippers can be found in all types of clothing such as pants, dresses, and jackets, on carriers such as bags and luggage, and in gear such as sleeping bags and tents. In addition to serving as decoration, zippers can join together two sides of a garment, such as in the operation of a dress, and can serve as means to removably attach two pieces of fabric, such as in the attachment of a removable hood to a jacket. Fastening devices such as zippers can be separating or non-separating, and can be one-way or two-way devices. In a separating zipper, each of the two zipper tracks, comprising the tape and attached teeth, are connected to different elements that are primarily joined only by the interlocking zipper teeth. In a non-separating zipper, both zipper tracks are connected to a single element such that interlocking and unlocking the zipper teeth creates an opening in that element. A two-way zipper comprises two slider bodies that can work together or separately to interlock and unlock the zipper teeth. A one-way zipper comprises a single slider body as well as a pin and box assembly that aligns the zipper teeth contained on at least one of the zipper tracks. In their simplest form, one-way separating zippers are composed of relatively few parts, including: an origination assembly with a pin and a retainer body at the lower limit of each row of zipper teeth; two pieces of tape that are attached to fabric on one side and contain zipper teeth on the other; a slider body with a pull-tab; and two top stops at the upper limit of each row of teeth. To fasten two pieces of fabric together, the operator inserts the pin from the lower limit of one row of teeth into the retainer box at the matching lower limit of the other row of teeth. This aligns the teeth into an operable interlocking format. Once aligned, the operator pulls the latching mechanism, called the slider body, along the teeth track. Wedges inside the slider body force the teeth of each track to interact. If the teeth are aligned, the hook of each tooth settles into the hollow of an opposing tooth. The operator can continue to pull the slider body and interlock the teeth until the slider terminates at the top stops located at the upper limit of each row of teeth. To unfasten the pieces of fabric, the operator pulls the slider body back along the closed track. The wedges inside the slider body force the interlocking teeth apart and separate the zipper closure. Despite the ease with which zipper-type closures operate, many individuals encounter difficulty joining together the pin and body. Others may have difficulty grasping the small slider body or pulling it along the zipper's teeth. Examples of individuals who often encounter these difficulties include small children, people wearing gloves for protection, elderly, and people with poor vision, macular degeneration, or cataracts. Additionally, people with disabilities such as arthritis, multiple sclerosis, cerebral palsy, pervasion developmental disorders, Down's syndrome, ataxia, diabetes with neuropathy, stroke (CVA), paraplegics, Lou Gehrig's Disease, Parkinson's, and head injuries can also find the operation of zippers to be difficult. It is therefore a principal object and advantage of the present invention to provide a device for easier alignment of the pin and box of a zipper. It is another object and advantage of the present invention to provide a device for easier operation of a zipper slider body. It is a further object and advantage of the present invention to provide an improved zipper for use by individuals with limited dexterity. Other objects and advantages of the present invention will in part be obvious and in part be expressed hereinafter.
/*----------------------------------------------------------------------------*/ /* Copyright (c) 2017-2018 FIRST. All Rights Reserved. */ /* Open Source Software - may be modified and shared by FRC teams. The code */ /* must be accompanied by the FIRST BSD license file in the root directory of */ /* the project. */ /*----------------------------------------------------------------------------*/ #ifndef NTCORE_MOCKDISPATCHER_H_ #define NTCORE_MOCKDISPATCHER_H_ #include <memory> #include "IDispatcher.h" #include "gmock/gmock.h" namespace nt { class MockDispatcher : public IDispatcher { public: MOCK_METHOD3(QueueOutgoing, void(std::shared_ptr<Message> msg, INetworkConnection* only, INetworkConnection* except)); }; } // namespace nt #endif // NTCORE_MOCKDISPATCHER_H_
There is compelling evidence that Donald J. Trump may have personally committed up to eight criminal offenses while campaigning for president and during the first year of his presidency. The potential offenses include violations of laws regulating campaign contributions and their disclosure, making false records and statements, and a conspiracy to defraud (or to violate the laws of) the United States. We take no pleasure in explaining why anyone, much less a sitting president, could face criminal liability for his conduct, but we hope to make two modest contributions to the public discourse on this subject: First, by collecting and setting forth the remarkable volume of facts that have been admitted by two of President Trump’s likely co-conspirators or established in press reports, we hope to recapture the narrative that is so easily lost in an era of ever-shortening news cycles. Second, by articulating how the criminal law could be applied to the facts as we know them, we hope to provide structure to the ongoing conversation about the gravity of President Trump’s conduct. Five of Trump’s potential violations involved his apparent knowing and willful direction, receipt, and concealment of unlawful contributions to his presidential campaign in violation of the Federal Election Campaign Act (FECA), 52 U.S.C. § 30101 et seq. While it is true that technical offenses of the FECA are penalized with civil fines, more serious offenses are subject to criminal penalties. Unlawful campaign contributions or expenditures in excess of $25,000, made knowingly and willfully, are felonies punishable by up to five years in prison. The eight criminal offenses, including seven felonies, potentially committed by Trump include: Causing American Media Inc. (AMI) to make and/or accepting (or causing his then lawyer Michael Cohen to accept) an unlawful corporate contribution related to Karen McDougal. Two instances of causing Cohen to make and/or accepting an unlawful individual contributions related to Stephanie Clifford and February 2015 online polling. Two instances of causing Donald J. Trump for President LLC’s failure to report contributions from AMI and Cohen related to McDougal and Clifford. Causing Donald J. Trump for President LLC to file false reports with the Federal Election Commission (FEC). Making a false statement by failing to disclose liability to Cohen for the Clifford payment on his 2017 public financial disclosure form. Conspiracy to defraud the United States by undermining the lawful function of the FEC and/or violating federal campaign finance law related to “hush money” payments, false statements, and cover-ups of reimbursement payments to Cohen made by the Trump Organization. Read the full report, A Campaign to Defraud, here. Click to read the report. Read the appendix here.
Q: Tail -f with pagination I am trying to tail file with pagination tail -f foo.txt | more This works fine until file gets lets say 200 lines injected, when this happens nature of tail command is to go to end of file, at that point I lose track of trailing the log. Is there a way to avoid this? A: Use less with +F instead of tail/more: less +F foo.txt When you want to take a look around, hit Ctrl-c. To restart following (tailing), hit F.
You are here State to pay businessman $300,000 for SoE detention The State has been ordered to pay a little over $300,000 in compensation to a businessman from Couva who was briefly charged with being a gang member during the 2011 State of Emergency (SoE). Delivering a 40-page judgment in the San Fernando High Court on Tuesday, Justice Ricky Rahim ruled that police officers had maliciously prosecuted Darryl Bishop as they did not have reasonable or probable cause to suspect that he was guilty of the crime when they arrested him in August 2011. While Rahim said that malice could only be inferred by a court in rare circumstances, he said Bishop’s case fell within that category based on the lack of evidence against Bishop. He said: “Therefore, if the claimant is right that Cpl McDonald had no evidence to charge him then it cannot be said that Cpl McDonald had an honest belief that the claimant was guilty of the offence of being a member of a gang and so malice may be inferred since it can be said that the prosecution against the claimant was initiated for some other motive than to secure the ends of justice.” In assessing the $250,000 in general damages for Bishop, Rahim considered the humiliation, damage to his reputation and deprivation of his liberty caused by his arrest. He also awarded $50,000 in exemplary damages to serve as a deterrent against serious abuse of authority by the police. “The arbitrary exercise of power by the State in this case was overwhelming and the court should send a strong message it should not and will not be tolerated in a free and democratic society with respect for the rule of law,” Rahim said. He also awarded $10,000 in special damages, which represents the money Bishop paid for a lawyer to represent him before the charge was withdrawn by the Office of the Director of Public Prosecutions (DPP). Bishop was also seeking compensation for losses his two bars and fishing company suffered in his 45 day absence. However, Rahim said that he was not entitled as he failed to produce financial records proving his claims. According to the evidence in the case, Bishop was arrested as police raided his bar at Greg Street, Balmain, Couva, to allegedly search for drugs, firearms and ammunition. While no illegal items were found, Bishop was arrested and a large quantity of cash in his house and bar was seized. In his evidence, Bishop claimed that he knew the arresting officer (Cpl McDonald), as he had charged him with cocaine trafficking several years before. Bishop was found not guilty of that charge due to insufficient evidence. State attorneys did not call McDonald as a witness in the civil claim before Rahim, instead opting to use the testimony of two police officers, who allegedly performed surveillance on Bishop but found no evidence linking him to an crimes. The judgment comes less than a month after the State expended a little over $700,000 to settle false imprisonment claims with 15 men, who were also charged for being gang members during the SoE before being freed. Bishop was represented by Ramesh Lawrence Maharaj SC.
Google Launches Google Social Search Amid Social-Media Battle October 27, 2009 SAN FRANCISCO -(Dow Jones)- In a move underscoring the escalating battle among Internet companies over what is known as social media, Google Inc. (GOOG) on Monday launched a tool that allows users to find postings from their friends as part of a Web search. Google Social Search, which is available starting Monday, includes relevant postings by colleagues, friends and selected media sources on feeds from Twitter Inc. and on blogs, as well as in broader Internet searches on its search engine. The Mountain View, Calif.-based company posted details of the new product on a blog. A search for a restaurant could generate not only official sites and mainstream media reviews, but also comments from friends or colleagues on a range of different blogs or social sites, if they had set up a profile that allowed their data to be searched. Social Search is being launched days after both Google and Microsoft Corp. (MSFT), Google’s main rival in Internet search, announced separate deals with start-up micro-blogging site Twitter Inc. Microsoft also announced a similar deal with Facebook Inc. to get access to its user information. Microsoft owns approximately 1.6% of Facebook, following a 2007 investment. San Francisco-based start-up Twitter, which lets users blast short messages from computers and mobile phones which are then displayed on their pages, has seen explosive growth until recently. Marketers are increasingly looking for ways to tap social media such as Twitter and Facebook for ways to better track trend-making topics and reach younger users. It wasn’t immediately clear how Social Search relates to the deal Google announced with Twitter. Google didn’t immediately respond to a request for comment.
For the next 3 weeks I will be blogging from South Africa – destination 1 – Johannsburg. It’s very exciting. I have my pseudo match tickets, my South Africa currency (the Rand), I have my passport and about 20 jumpers – it’s going to be cold over there. I’ll try to ensure my blogging is half about my trip and half about what’s going on at Arsenal – as those who know me – know that I need my daily Arsenal dose! Let’s look at the Arsenal Centre Defence Exodus – ACDE – which has started with Senderos and we think Gallas too (...
High-Flow Oxygen Therapy to Speed Weaning From Mechanical Ventilation: A Prospective Randomized Study. High-flow oxygen therapy has been widely adopted, but its use for weaning patients from mechanical ventilation has not been reported. To evaluate whether high-flow oxygen therapy improves the efficiency of weaning patients from mechanical ventilation. In a single-center, prospective study, patients receiving mechanical ventilation were randomly assigned to 1 of 3 groups (T-tube, pressure support ventilation, or high-flow oxygen) during 2-hour spontaneous breathing trials in a 14-day study. Participants were followed up until hospital discharge or death. Of 268 patients included, 90 were assigned to the T-tube group, 96 to the pressure support ventilation group, and 82 to the high-flow oxygen group. The first-day 2-hour spontaneous breathing trial passing rates were higher in the pressure support ventilation and high-flow oxygen groups than in the T-tube group (P < .05). The time needed to pass the spontaneous breathing trial was less in the pressure support ventilation and high-flow oxygen groups than in the T-tube group (P < .05). The reintubation rate was lower and the successful weaning rate on the first day was higher in the high-flow oxygen group than in the T-tube and pressure support ventilation groups (P < .05). During the 14-day study period, the weaning time was less in the high-flow oxygen group than in the T-tube and pressure support ventilation groups (P < .05). High-flow oxygen therapy can reduce the time needed to wean patients from mechanical ventilation by shortening the time needed to pass a spontaneous breathing trial and by decreasing the reintubation rate.
"Amy's my sister, so I do whatever she does," Kim Caramele, who is the writer/producer on "Inside Amy Schumer" joked to the audience at the Writers Guild Award Television nominee's panel on her relationship with her famous sibling. "Before that I was a school psychologist. And I have a dog named Abbott and he has three legs. Thank you."
# # This Source Code Form is subject to the terms of the Mozilla Public # License, v. 2.0. If a copy of the MPL was not distributed with this # file, You can obtain one at http://mozilla.org/MPL/2.0/. # Configuration information for building in the "Core Components" source module ####################################################################### # [1.0] Master "Core Components" source and release <architecture> # # tags # ####################################################################### ifndef MK_ARCH include $(CORE_DEPTH)/coreconf/arch.mk endif ####################################################################### # [2.0] Master "Core Components" default command macros # # (NOTE: may be overridden in $(OS_TARGET)$(OS_RELEASE).mk) # ####################################################################### ifndef MK_COMMAND include $(CORE_DEPTH)/coreconf/command.mk endif ####################################################################### # [3.0] Master "Core Components" <architecture>-specific macros # # (dependent upon <architecture> tags) # # # # We are moving towards just having a $(OS_TARGET).mk file # # as opposed to multiple $(OS_TARGET)$(OS_RELEASE).mk files, # # one for each OS release. # ####################################################################### TARGET_OSES = FreeBSD BSD_OS NetBSD OpenUNIX OS2 QNX Darwin BeOS OpenBSD \ AIX RISCOS WINNT WIN95 Linux Android ifeq (,$(filter-out $(TARGET_OSES),$(OS_TARGET))) include $(CORE_DEPTH)/coreconf/$(OS_TARGET).mk else ifeq ($(OS_TARGET),SunOS) include $(CORE_DEPTH)/coreconf/SunOS5.mk else include $(CORE_DEPTH)/coreconf/$(OS_TARGET)$(OS_RELEASE).mk endif endif ####################################################################### # [4.0] Master "Core Components" source and release <platform> tags # # (dependent upon <architecture> tags) # ####################################################################### PLATFORM = $(OBJDIR_NAME) ####################################################################### # [5.0] Master "Core Components" release <tree> tags # # (dependent upon <architecture> tags) # ####################################################################### ifndef MK_TREE include $(CORE_DEPTH)/coreconf/tree.mk endif ####################################################################### # [6.0] Master "Core Components" source and release <component> tags # # NOTE: A component is also called a module or a subsystem. # # (dependent upon $(MODULE) being defined on the # # command line, as an environment variable, or in individual # # makefiles, or more appropriately, manifest.mn) # ####################################################################### ifndef MK_MODULE include $(CORE_DEPTH)/coreconf/module.mk endif ####################################################################### # [7.0] Master "Core Components" release <version> tags # # (dependent upon $(MODULE) being defined on the # # command line, as an environment variable, or in individual # # makefiles, or more appropriately, manifest.mn) # ####################################################################### ifndef MK_VERSION include $(CORE_DEPTH)/coreconf/version.mk endif ####################################################################### # [8.0] Master "Core Components" macros to figure out # # binary code location # # (dependent upon <platform> tags) # ####################################################################### ifndef MK_LOCATION include $(CORE_DEPTH)/coreconf/location.mk endif ####################################################################### # [9.0] Master "Core Components" <component>-specific source path # # (dependent upon <user_source_tree>, <source_component>, # # <version>, and <platform> tags) # ####################################################################### ifndef MK_SOURCE include $(CORE_DEPTH)/coreconf/source.mk endif ####################################################################### # [10.0] Master "Core Components" include switch for support header # # files # # (dependent upon <tree>, <component>, <version>, # # and <platform> tags) # ####################################################################### ifndef MK_HEADERS include $(CORE_DEPTH)/coreconf/headers.mk endif ####################################################################### # [11.0] Master "Core Components" for computing program prefixes # ####################################################################### ifndef MK_PREFIX include $(CORE_DEPTH)/coreconf/prefix.mk endif ####################################################################### # [12.0] Master "Core Components" for computing program suffixes # # (dependent upon <architecture> tags) # ####################################################################### ifndef MK_SUFFIX include $(CORE_DEPTH)/coreconf/suffix.mk endif ####################################################################### # [13.0] Master "Core Components" for defining JDK # # (dependent upon <architecture>, <source>, and <suffix> tags)# ####################################################################### ifdef NS_USE_JDK include $(CORE_DEPTH)/coreconf/jdk.mk endif ####################################################################### # [14.0] Master "Core Components" rule set # ####################################################################### ifndef MK_RULESET include $(CORE_DEPTH)/coreconf/ruleset.mk endif ####################################################################### # [15.0] Dependencies. ####################################################################### -include $(MKDEPENDENCIES) ####################################################################### # [16.0] Global environ ment defines ####################################################################### ifdef NSS_DISABLE_ECC DEFINES += -DNSS_DISABLE_ECC endif ifdef NSS_ECC_MORE_THAN_SUITE_B DEFINES += -DNSS_ECC_MORE_THAN_SUITE_B endif ifdef NSS_ALLOW_UNSUPPORTED_CRITICAL DEFINES += -DNSS_ALLOW_UNSUPPORTED_CRITICAL endif ifdef BUILD_LIBPKIX_TESTS DEFINES += -DBUILD_LIBPKIX_TESTS endif ifdef NSS_DISABLE_DBM DEFINES += -DNSS_DISABLE_DBM endif ifdef NSS_PKIX_NO_LDAP DEFINES += -DNSS_PKIX_NO_LDAP endif # Avoid building object leak test code for optimized library ifndef BUILD_OPT ifdef PKIX_OBJECT_LEAK_TEST DEFINES += -DPKIX_OBJECT_LEAK_TEST endif endif # This allows all library and tools code to use the util function # implementations directly from libnssutil3, rather than the wrappers # in libnss3 which are present for binary compatibility only DEFINES += -DUSE_UTIL_DIRECTLY USE_UTIL_DIRECTLY = 1 # Build with NO_NSPR_10_SUPPORT to avoid using obsolete NSPR features DEFINES += -DNO_NSPR_10_SUPPORT # Hide old, deprecated, TLS cipher suite names when building NSS DEFINES += -DSSL_DISABLE_DEPRECATED_CIPHER_SUITE_NAMES
Versions Citrix is a universal client for accessing desktop applications via a server solution. Applications such as CCure, Adonis, and SAPgui are also hosted on the MIT Citrix servers, and are accessed by both Macintosh and Windows users.
Roberts Space Industries announced that its upcoming space simulation Star Citizen (being helmed by Chris Roberts - creator of Wing Commander and Privateer) has raised over $15 million through crowd-funding. The crowdfunding cash comes from a combination of money raised through a highly successful Kickstarter campaign and crowd-funding efforts on the Roberts Space Industries company and Star Citizen web sites. "It’s unbelievable: Star Citizen fans have helped us reach the $15 million mark without any special promotion!" the company wrote on its web site. "Ten years ago, big publishers decided space games weren’t profitable… and you are proving them very, very wrong!" Roberts Space Industries revealed that reaching this milestone unlocks some new features to be added into the game including the flyable ship class, the escort carrier; a free digital 42-page Upgrade Handbook manual (which explains how to overclock your ship's computer); an in-game laser pistol for every backer (for people that funded up to this milestone); and a whole lot more. Roberts Space Industries also revealed the $17 million rewards, should the company hit that milestone. Those unlocks include a ship upgrade package for every backer containing an engine modifier; and an additional flyable ship class: battlecruiser.
Introduction {#section5-2050312119849770} ============ Percutaneous renal biopsy (Bx) is a useful diagnostic procedure for kidney diseases.^[@bibr1-2050312119849770],[@bibr2-2050312119849770]^ Adequate tissue and sufficient glomeruli are vital for pathological diagnostic yield. However, biopsy-complications, especially bleeding complications such as hematuria and perinephric hematoma should be of concern.^[@bibr3-2050312119849770][@bibr4-2050312119849770]--[@bibr5-2050312119849770]^ Two techniques of Bx which are "blind percutaneous renal biopsy (BBx)" and "real-time ultrasound-guided percutaneous renal biopsy (RBx)" are still being performed in developing countries. Previous studies mostly performed BBx with Tru-cut needle showing less efficacy and more complications than RBx which is performed with automated biopsy needle.^[@bibr6-2050312119849770][@bibr7-2050312119849770][@bibr8-2050312119849770][@bibr9-2050312119849770][@bibr10-2050312119849770][@bibr11-2050312119849770]--[@bibr12-2050312119849770]^ That were performed by different type and size of biopsy needles between two groups. The results from studies showed that the different sizes of needle biopsy affects the adequacy of tissue and complications.^[@bibr13-2050312119849770],[@bibr14-2050312119849770]^ The aim of this study was to compare efficacies and complications of both techniques performed with an automated biopsy needle in the same size. Methods {#section6-2050312119849770} ======= Study design {#section7-2050312119849770} ------------ This was a retrospective study. We reviewed our renal biopsy database from 1 January 2014 to 30 June 2017. Population {#section8-2050312119849770} ---------- Our hospital is tertiary, university and referral hospital in Bangkok, Thailand. Renal biopsies were performed when there was an indication and no contraindications, as verified by our nephrology staff. All renal biopsies were done by renal fellows under supervision of nephrology faculty staff. Before 1 August 2016, we performed BBx for all renal biopsies, after that RBx became the standard technique. We included all native and transplant renal biopsies that had completed data. The exclusion criteria were incomplete pathological data. BBx {#section9-2050312119849770} --- The patient lay in the proper position. The ultrasound was used for identifying the kidney, measuring the distance from the skin to renal cortex and marking the proper introducing needle site at skin by the nephrologist. The skin was cleaned with antiseptic solution and draped with sterile towels. Infiltration with 1% or 2% xylocaine at the skin and underlying subcutaneous tissue was performed, then a small incision was made at the skin. The renal biopsy needle was introduced at the site marked on the skin then advanced the expected distance and evaluated from initial ultrasound through the skin and the underlying tissue to the kidney. Verifying the proper location of the biopsy needle was done by observing respiratory movement of the needle. The patient was asked to hold his breath then the biopsy was performed. The needle was immediately removed then the specimen was collected in the container. For transplant kidney biopsy, the proper location of the biopsy needle was justified by feeling the resistance of the kidney. The renal biopsy was re-performed 1--3 times for adequate specimens and sent to the pathology laboratory. The renal biopsy needle was a 16-gauge (G), 15-cm length, automated spring-loaded needle. RBx {#section10-2050312119849770} --- The patient also lay in the proper position. The skin was cleaned with antiseptic solution and draped with sterile towels. The ultrasound probe was covered by a clear sterile cover. The ultrasonic gel was placed between the probe and inner side of the sterile cover. Chlorhexidine solution was used for transmitting ultrasonic waves from the skin to sterile cover. The operator performed aseptic ultrasound for kidney visualization. Local anesthesia was injected then a small incision at the skin was made. The needle biopsy was introduced through the incision site to renal cortex under real-time ultrasound guidance. The patient was asked to hold his breath then the biopsy was performed. The needle was immediately removed then the specimen was collected in the container. For transplant kidney biopsy, the upper pole of allograft was identified and biopsied under real-time ultrasound-guidance. The renal biopsy was re-performed 1--3 times for adequate specimens which were sent to the pathology laboratory. The renal biopsy needle was 16-G, 16-centimeter length, automated spring-loaded needle. The post-biopsy monitoring {#section11-2050312119849770} -------------------------- As per our post-biopsy protocol, patients were admitted for 12 h for absolute bed rest and 24 h observation. Vital signs were measured hourly until stable. Complications such as hematuria, abdominal pain, and perinephric hematoma were recorded. We performed renal ultrasound immediately after the biopsy. During the observation period, we performed renal ultrasound only in cases of suspicious bleeding complications. The hematocrit was serially measured if bleeding complication was clinically suspected. Blood transfusions were provided when clinically indicated. The role of renal angioembolization was considered where there were active bleeding complications. Outcome parameters {#section12-2050312119849770} ------------------ The primary outcome was an average number of total glomeruli. The number of total glomeruli was the number of glomeruli from light microscopy specimens plus the number of glomeruli from immunofluorescence specimens. Secondary outcomes were adequacy of tissue that was categorized in three classes 1. Complete adequate tissue means specimens included cortex, medulla and all the following:Native renal biopsy: at least 20 glomeruli and 2 vessels.Transplant renal biopsy: at least 10 glomeruli and 1 vessel. 2. Essential adequate tissue means specimens included cortex, medulla and all the following:Native renal biopsy: at least 10 glomeruli and 1 vessel.Transplant renal biopsy: at least 7 glomeruli and 1 vessel. 3. Inadequate tissue means the specimen contained insufficient structure for pathological diagnosis by the pathologist. The post-biopsy complications were hematuria, perinephric hematoma, required transfusion of blood component, required renal angioembolization and nephrectomy. Data collection {#section13-2050312119849770} --------------- This study was approved by the Institutional Review Board of Navamindradhiraj University (IRB 160/60) and registered to Thailand clinical trial registry (TCTR20181024002). We reviewed renal biopsy database focusing on patient characteristics, laboratory data (blood urea nitrogen (BUN), creatinine, estimated glomerular filtration rate (eGFR), hemoglobin, hematocrit (Hct), platelets and coagulogram), biopsy indications, biopsy complications and therapeutic procedures to manage complications. Pathological reports were reviewed to evaluate outcomes. Statistical analysis {#section14-2050312119849770} -------------------- Considering that mean of total glomeruli was a continuous outcome and assuming mean of total glomeruli would be 40% higher in RBx than BBx (15.4 vs 11). We estimated that 88 patients per group would need to be enrolled to provide 90% power at a two-sided alpha level of 0.05. For the statistical analysis, R version 3.4.4 (R Foundation for Statistical Computing, Vienna, Austria) was used. We compared patient characteristics, outcomes, and complications between the two groups. For continuous variables, normality test of Kolmogorov--Smirnov was performed to confirm that the samples were normal distribution or not. The student's t-test was used if normal distribution data, and Mann--Whitney U test was used if non-normal distribution data. The chi-square and Fisher's exact test were used for categorical variable analysis. We analyzed the multivariable logistic regression to find the factors associated with adequate kidney biopsy tissue and post-biopsy bleeding complications. We chose the risk factor from the univariable model if the p value \< 0.3. Results {#section15-2050312119849770} ======= We performed 246 renal biopsies in 42 months. Forty-two renal biopsies were excluded because of incomplete data. Of 204 renal biopsies, 169 (82.8%) were native renal biopsies and 35 (17.2%) were transplanted renal biopsies. Patients who had renal biopsy by RBx numbered 104 patients and 100 had biopsy by BBx. There were no significant differences in the demographic data, clinical features or pre-biopsy laboratory data based on biopsy technique ([Table 1](#table1-2050312119849770){ref-type="table"}). The median age was 41 years old (quartile 1 (Q~1~)-quartile 3 (Q~3~); 31--53) and females were 56.4%. The first three-common comorbidities were type 2 diabetes mellitus, hypertension, and systemic lupus erythematosus. The median creatinine and estimated eGFR were 1.72 (Q~1~-Q~3~: 0.96--2.64) mg/dL and 42 (Q~1~-Q~3~: 24.5--78.5) mL/min/1.73 m^2^, respectively. The first three common indications for native renal biopsy were nephrotic syndrome (27.9%), glomerulonephritis (23.7%), and isolated proteinuria (23.1%). Allograft dysfunction was the primary indication for transplant renal biopsy. ###### Baseline characteristics, clinical features and pre-biopsy laboratory data. ![](10.1177_2050312119849770-table1) All biopsies RBx BBx p-value ---------------------------------------------- ------------------- ------------------- ------------------- --------- Number of patients 204 104 100 Age: years, median (Q~1~, Q~3~) 41 (31, 53) 39 (28, 53) 44 (33, 53) 0.197 Sex: female, n (%) 115 (56.4) 63 (60.0) 52 (52.0) 0.274 Transplant renal biopsy, n (%) 35 (17.2) 16 (15.4) 19 (19) Comorbid disease, n (%):  Hypertension 122 (59.8) 57 (54.8) 55 (55.0) 1.000  DM 48 (23.5) 22 (21.2) 26 (26.0) 0.515  SLE 36 (17.6) 17 (16.3) 19 (19.0) 0.754  CKD 25 (12.3) 12 (11.5) 18 (18.0) 0.193 Creatinine (mg/dL), median (Q1, Q3) 1.72 (0.96, 2.64) 1.6 (0.94, 2.69) 1.78 (1.01, 2.55) 0.875 eGFR (ml/min/1.73 m^2^), median (Q1, Q3) 42.0 (24.5, 78.5) 45.0 (25.5, 80.0) 39 (24.0, 78.0) 0.461 BUN (mg/dL), median (Q1, Q3) 28.0 (18.0, 44.0) 26.5 (17.3, 40.8) 31.0 (18.0, 41.5) 0.422 Pre-biopsy Hb (g/dL), mean (SD) 11.2 (2.4) 11.2 (2.4) 11.2 (2.4) 0.704 Pre-biopsy platelets (x 10^3^/uL), mean (SD) 271 (90.5) 267 (81.4) 276 (99.4) 0.489 Pre-biopsy INR, median (Q1, Q3) 1.00 (0.95, 1.08) 1.01 (0.96, 1.11) 0.99 (0.93, 1.05) 0.089 Biopsy indication, n (%): Native renal biopsy  Glomerulonephritis 51 (30.2) 19 (21.6) 32 (39.5)  Nephrotic syndrome 47 (27.9) 25 (28.5) 22 (27.2)  Proteinuria 39 (23.1) 22 (25.0) 17 (21.0)  Unexplained AKI 18 (10.7) 12 (13.6) 6 (7.4)  Other 14 (8.1) 10 (11.3) 4 (4.9) Transplant renal biopsy  Allograft dysfunction 32 (91.4) 14 (87.5) 18 (94.7)  Proteinuria 3 (8.6) 2 (2.5) 1 (5.3) AKI: acute kidney injury; BUN: blood urea nitrogen; BBx: blind percutaneous renal biopsy; CKD: chronic kidney disease; DM: diabetes mellitus; eGFR: estimated glomerular filtration rate; Hb: hemoglobin; INR: international normalized ratio; n: number per group; Q~1~: the first quartile; Q~3~: the third quartile; RBx: real-time ultrasound-guide percutaneous renal biopsy; SLE: systemic lupus erythematosus; SD: standard deviation. The average number of total glomeruli with RBx (median 19, Q~1~-Q~3~: 11.8--27) was significantly more than with BBx (median 12, Q~1~-Q~3~: 7.8--21.3) (p \< 0.001) ([Table 2](#table2-2050312119849770){ref-type="table"}). RBx showed greater efficacy for both native and transplant renal biopsy. For completely adequate tissue definition, RBx achieved 47 (45.2%) specimens from 104 specimens, which was significantly better than the 16 (16%) (p-value \< 0.001) specimens from BBx. RBx also achieved more adequate tissue than BBx (75% vs 50%; p-value \< 0.001). Moreover, BBx had significantly more inadequate tissue specimens (16, 16%) than RBx (p-value \< 0.001). Bleeding complications were not statistically different in terms of hematuria (p-value = 0.215) and hematoma (p-value = 0.445) ([Table 3](#table3-2050312119849770){ref-type="table"}). The frequency of blood transfusion was the same for both groups (p-value = 0.949). No patient was sent for embolization or nephrectomy and no biopsy-related deaths occurred. ###### Comparing outcomes of two techniques. ![](10.1177_2050312119849770-table2) RBx BBx p-value --------------------------------------- ------------------- ------------------ --------- Total glomeruli, median (Q~1~, Q~3~):  Overall renal biopsy (n = 204) 19.0 (11.8, 21.0) 12.0 (7.8, 21.3) \<0.001  Native renal biopsy (n = 169) 19.0 (11.0,27.0) 14.0 (8.0, 22.0) 0.021  Transplant renal biopsy (n = 35) 19.5 (13.5, 20.3) 10.0 (5.8, 13.5) 0.004 Complete adequate tissue, n (%):  Overall renal biopsy 47 (45.2) 16 (16.0) \<0.001  Native renal biopsy 35 (39.8) 11 (13.6) \<0.001  Transplant renal biopsy 12 (75.0) 5 (26.3) 0.011 Essential adequate tissue, n (%):  Overall renal biopsy 78 (75.0) 50 (50.0) \<0.001  Native renal biopsy 65 (73.9) 42 (51.9) 0.005  Transplant renal biopsy 13 (81.3) 8 (42.1) 0.045 Inadequate tissue, n (%) 1 (0.96) 16 (16.0) \<0.001 BBx: blind percutaneous renal biopsy; Q~1~: the first quartile; Q~3~: the third quartile; RBx: real-time ultrasound-guide percutaneous renal biopsy. ###### Comparing biopsy complications of two techniques. ![](10.1177_2050312119849770-table3) RBx (n = 104) BBx (n = 100) p-value ------------------------------------ --------------- --------------- --------- Hematuria, n (%) 11 (10.6%) 5 (5%) 0.215 Hematoma, n (%) 5 (4.8%) 2 (2%) 0.445 Blood transfusion, n (%) 8 (7.7%) 7 (7%) 0.949 Embolization or nephrectomy, n (%) 0 0 BBx: blind percutaneous renal biopsy; n: number per group; RBx: real-time ultrasound-guide percutaneous renal biopsy. After we analyzed the univariable and multivariable logistic regression, RBx was the only factor significantly associated with adequate biopsy tissue (odds ratio (OR): 5.46; 95% confidence interval (CI): 2.66--11.24; p-value \< 0.001) ([Table 4](#table4-2050312119849770){ref-type="table"}). We also did logistic regression to find factors associated with bleeding complications, which means a composite of any hematuria or hematoma, or need for blood transfusion ([Table 5](#table5-2050312119849770){ref-type="table"}). After multivariable logistic regression was analyzed, the lower Hct (increase 1% of Hct: OR 0.90; 95% CI: 0.83--0.98; p-value = 0.014), lower eGFR (increase 1 mL/min/1.73 m^2^ of eGFR: OR 0.98; 95% CI: 0.96--1.00; p-value = 0.026) and female (OR 2.87; 95% CI: 1.03--7.98; p-value = 0.043) were found to be significantly associated with bleeding complications. ###### The univariable and multivariable logistic regression for association between biopsy data and complete adequate kidney tissue. ![](10.1177_2050312119849770-table4) Variable Univariable analysis Multivariable analysis^[a](#table-fn5-2050312119849770){ref-type="table-fn"}^ -------------------------- ---------------------- ------------------------------------------------------------------------------- -------------------- --------- Age, 1 year 0.99 (0.97--1.01) 0.376 -- -- CKD 1.12 (0.46--2.75) 0.807 -- -- eGFR, 1mL/min/1.73  m^2^ 1.00 (0.99--1.01) 0.293 1.01 (1.00--1.02) 0.303 RBx 4.00 (2.07--7.75) \<0.001 5.46 (2.66--11.24) \<0.001 CI: confidence interval; CKD: chronic kidney disease; eGFR: estimated glomerular filtration rate; OR: odds ratio; RBx: real-time ultrasound-guide percutaneous renal biopsy. Variables with p \< 0.3 in univariable analysis were included in the multivariable analysis. ###### The univariable and multivariable logistic regression for association between biopsy data and bleeding complications. ![](10.1177_2050312119849770-table5) Variable Univariable analysis Multivariable analysis^[a](#table-fn7-2050312119849770){ref-type="table-fn"}^ ------------------------- ---------------------- ------------------------------------------------------------------------------- ------------------- ------- Age, *1* *year* 1.01 (0.99--1.04) 0.395 -- -- Female 2.03 (0.80--5.14) 0.134 2.87 (1.03--7.98) 0.043 CKD 0.62 (0.14--2.82) 0.536 -- -- eGFR, 1mL/min/1.73 m^2^ 0.98 (0.96--0.99) 0.008 0.98 (0.96--1.00) 0.026 Hct, 1% 0.88 (0.82--0.94) \<0.001 0.90 (0.83--0.98) 0.014 Platelet, x 10^3^/mL 0.99 (0.99--1.00) 0.415 -- -- PT, 1 s 1.07 (0.95--1.14) 0.554 -- -- RBx 1.16 (0.49--2.72) 0.739 1.26 (0.49--3.21) 0.623 CI: confidence interval; CKD: chronic kidney disease; eGFR: estimated glomerular filtration rate; Hct: hematocrit; PT: prothrombin time; OR: odds ratio; RBx: real-time ultrasound-guide percutaneous renal biopsy. Variables with p \< 0.3 in univariable analysis were included in the multivariable analysis. Discussion {#section16-2050312119849770} ========== This study compared the two biopsy techniques that are still being performed in developing countries. We found that real-time ultrasound-guided percutaneous renal biopsy was superior to blind percutaneous renal biopsy in terms of the number of total glomeruli and adequacy of biopsy tissue. Bleeding complications were not significantly different for both techniques. We found that only RBx was a factor associated with adequate tissue. Bleeding complications were associated with lower hematocrit, lower eGFR, and being female but were not associated with biopsy technique. There was no association between the renal biopsy technique and bleeding complications. The previous study from Maya et al.^[@bibr9-2050312119849770]^ reported real-time ultrasound-guided biopsy with 18-G automated biopsy needle obtained more glomeruli than the blind technique with 14-G Tru-cut biopsy needle, 18 ± 9 versus 11 ± 9 (p-value = 0.0001) respectively. Likewise, Cozens et al.^[@bibr12-2050312119849770]^ observed the diagnostic yield from real-time ultrasound-guided biopsy with 18-G automated biopsy needle was greater than with the blind technique with 15-G Tru-cut biopsy needle. The results were the same as our study even though our BBx was performed with a 16-G automated loaded biopsy needle. The study from Riehl et al.^[@bibr10-2050312119849770]^ compared two different biopsy needles, 14-G Tru-cut and automated biopsy needle, using blind technique and found that the efficacy was not significantly different. The explanation of the superiority of RBx may be related to real-time renal visualization during the renal biopsy. In contrast, Bataille et al. compared five renal biopsy techniques by retrospective review of five centers that had different routine practice. They found the number of glomeruli was equal in the center that performed the blind biopsy with a 14-G automated biopsy needle, and the center that performed the real-time ultrasound-guided biopsy with the 14-G automated biopsy needle, while the center that performed the real-time ultrasound-guided biopsy with the 16-G automated biopsy needle had lower mean number of glomeruli. The centers, however, which performed the renal biopsy by blind technique did not obtain more renal core tissue than the centers that performed real-time ultrasound-guided technique.^[@bibr11-2050312119849770]^ This result was also observed from our study that BBx resulted in more inadequate tissue than RBx. Whereas, the study from Kim et al.^[@bibr7-2050312119849770]^ also reported a lower mean number of glomeruli in RBx with the 18-G biopsy needle, when compared to BBx with 14-G Tru-cut biopsy needle. Interestingly, Chung et al.^[@bibr15-2050312119849770]^ reported the number of glomeruli was greater when obtained by nephrologists rather than radiologists, and this was not associated with biopsy technique. The difference of efficacy among the studies might be related to physician experience and the needle size of renal biopsy. Our study showed a higher frequency of post-biopsy hematuria (7.8%) than in some previous studies.^[@bibr4-2050312119849770],[@bibr5-2050312119849770]^ However, the study from Esposito et al.^[@bibr16-2050312119849770]^ reported minor complication (arteriovenous fistula, minor hematoma spontaneously reabsorbed, gross hematuria, post-procedural hypotension) from RBx with 14-G biopsy needle by young trainee nephrologist was 17.3 percent and that was not different from experienced nephrologist. The several studies reported that the post-biopsy bleeding complications were lower in RBx.^[@bibr6-2050312119849770][@bibr7-2050312119849770][@bibr8-2050312119849770]--[@bibr9-2050312119849770]^ However, BBx in those studies was performed with the larger diameter and the Tru-cut biopsy needle, which was associated with more bleeding complications.^[@bibr4-2050312119849770],[@bibr10-2050312119849770],[@bibr14-2050312119849770]^ This was unlike our study, in which we performed the biopsy with the 16-G automated biopsy needle for both techniques, so the results of bleeding complications were not significantly different. Tondel et al.^[@bibr5-2050312119849770]^ analyzed the Norwegian Kidney Biopsy Registry from 1988 to 2010 (total 9288 native renal biopsies) and reported the major risk factors for major post-biopsy complications (blood transfusion, surgery and/or arterial embolization) were reduced eGFR and small clinical center size. Furthermore, the lower eGFR associated with bleeding complications was also confirmed by our study. A study from Sweden included 1001 native and transplant renal biopsies; they found women (OR 2.2; 95% CI: 1.3--3.7; p-value = 0.002), right-sided kidney, lower body mass index (BMI) and younger age were greater risk factors for major post-biopsy complications.^[@bibr17-2050312119849770]^ Some results from meta-analysis showed being female was one of the risk factors for hematuria and blood transfusion after real-time ultrasound-guided native renal biopsy.^[@bibr4-2050312119849770]^ We also found females had higher risk for bleeding complications which may be related to being female, having lower BMI, or kidney size was smaller than males. An association between lower hemoglobin and major bleeding was also reported.^[@bibr9-2050312119849770]^ We observed that every 1% decline of hematocrit increased the risk of bleeding complication by about 11%. The strength of our study is two techniques were compared by using the same sizes and types of biopsy needle. Limitations of this study include its retrospective nature. Some important data were not recorded, such as BMI, weight, height, and number of needle passes. In our hospital renal biopsy was performed by renal fellows. First-year renal fellows come to our hospital every year. In the early period of their new renal fellowship, they need to gain experience for renal biopsy under supervision by nephrology staff. Although the results might be confounded by operator experiences, the first-year renal fellows performed both techniques. This may imply that RBx is simple to perform by inexperienced operators due to the kidney and biopsy needle being visualized during operation. In contrast, the BBx must be performed by a confident and experienced operator. Although RBx requires to add-on infrastructures such as sterile coverage and biopsy guide, its diagnostic yield is superior to BBx. Infrastructures of RBx add more cost, however, these are inexpensive and can be afforded by developing countries. Therefore, we encourage to perform RBx. On the other hand, BBx is still acceptable without higher complications in limited resources. Female gender, anemia and low eGFR should caution biopsy-performers to be aware of post-renal biopsy complications. Conclusion {#section17-2050312119849770} ========== Our study confirms that the diagnostic yield of RBx is superior to BBx. The resulting complications are the same for both techniques. The authors thank all nurses and staffs in the Department of Medicine, Faculty of Medicine, Navamindradhiraj University and Vajira Hospital. **Declaration of conflicting interests:** The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article. **Ethical approval:** Ethical approval for this study was obtained from the Institutional Review Board of Navamindradhiraj University (IRB 160/60). **Funding:** The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by Navamindradhiraj University. **Informed consent:** Informed consent was waived by Institutional Review Board. **Trial registration:** Thailand Clinical Trial Registry (TCTR20181024002). **ORCID iD:** Wanjak Pongsittisak ![](10.1177_2050312119849770-img1.jpg) <https://orcid.org/0000-0002-9285-8404>
PRODUCT HIGHLIGHTS "I love the smell of this stuff. It is very moisturizing and does exactly what it says. I never feel the need to run for a bottle of moisturizer after a shower. It works best with a shower puff or washcloth. It's a little pricey, but worth the money." in 35 reviews "Moroccanoil is something i use at least once a week because i have oily sensitive skin but it makes my skin so smooth and the smell is amazing" in 20 reviews
KAOHSIUNG DISASTER: Kaohsiung risks all, gains little A TAXING ISSUE::Lawmakers are criticizing regulations that let petrochemical firms file business taxes in Taipei, while Kaohsiung gets less in state funds, but bears all the risks By Ko Yo-hau / Staff reporter Mon, Aug 04, 2014 - Page 3 In light of the explosions caused by gas leaking from underground pipelines in Greater Kaohsiung last week, which killed at least 28 people and injured more than 300, lawmakers are denouncing what they say is the longstanding unfairness of the city’s residents bearing the risks of living near petrochemical plants, while the companies’ Taipei headquarters enjoy the tax revenue generated by those facilities. One of these critics is Democratic Progressive Party (DPP) Legislator Lee Kun-tse (李昆澤), who yesterday called on LCY Chemical Corp and the state-owned CPC Corp, Taiwan (CPC) to move their head offices to Greater Kaohsiung. Lee said this would bridge the gap between the amount of central government-funded tax revenue allocated to the companies’ Taipei headquarters and that received by their Greater Kaohsiung units, which receive only about half the funds that their Taipei affiliates do. Citing the Regulations for Allocation of Centrally Funded Tax Revenues (中央統籌分配稅款分配辦法), Lee said that since the system assigns a 50 percent value to the revenue generated by each municipality and allocates central government-funded tax revenue accordingly, the petrochemical companies’ Taipei headquarters acquire the lion’s share of state-funded revenues, leaving their under-funded Kaohsiung units to deal with the pollution and public safety issues that come with operating a petrochemical facility. Citing LCY as an example, he said the company’s head office is in Taipei, but five of its six plants are based in the southern municipality, including its Kaohsiung, Siaogang (小港), Dashe (大社) and Linyuan plants (林園), as well as a fuel storage and transfer station it operates in the seaport of Cianjhen District (前鎮), the site of the explosions. Similarly, CPC has two smelters in the municipality, its Kaohsiung and Dalin (大林) smelters, as well as a refinery in Linyuan and a Cianjhen storage and transfer station, Lee said. Both LCY and CPC, whose revenues totaled NT$49.7 billion (US$1.67 billion) and NT$1.15 trillion respectively last year, put their Taipei headquarters in charge when filing business taxes, Lee said, adding that as a result, all their business taxes are filed with the National Taxation Bureau of Taipei. The companies’ practice of establishing plants in Greater Kaohsiung while letting their Taipei offices handle tax filing duties is against the principle of fair taxation, because Greater Kaohsiung residents have to live with the pollution and safety concerns caused by the plants, while those in Taipei receive most of the profits, he said. “[Greater] Kaohsiung has carried too heavy a burden for the sake of Taiwan’s economic development,” he said. Lee said he would submit a request to CPC asking it to move its head office to Kaohsiung, a move he said would raise the tax revenue allocated to the municipality by NT$3 billion a year. An official at the Greater Kaohsiung Government’s Finance Bureau, who declined to be named, said the taxes shouldered by CPC’s facilities in the south are about NT$500 million to NT$600 million, adding that the bureau is not privy to the amount the facilities pay in business tax since the National Taxation Bureau says that information is “confidential.” When reached for comment, independent Greater Kaohsiung City Councilor Huang Shih-lung (黃石龍) said: “Since CPC’s president lives in Taipei, why not ask him to move the plants there to make his managing them more efficient? Would Taipei residents approve of that?” He said the bottom line should be people’s quality of life, not tax revenues, adding that petrochemical companies should establish their facilities away from densely populated areas. DPP Legislator Chen Chi-mai (陳其邁) said on Facebook that setting up petrochemical facilities in a busy city is no different than planting a time bomb there, since both put residents’ lives at risk. He urged the central government to perform its duties and move underground pipelines out of densely populated areas, while calling on CPC to move its headquarters south to enable Greater Kaohsiung residents to benefit from the municipality receiving a higher amount of centrally funded tax revenues.
Emma Roberts Reveals She May Want to Quit Acting to Go 'Behind the Scenes' (ABC News) Fans of "Scream Queens" can't get enough of actress Emma Roberts in her role as wicked sorority president Chanel Oberlin. But perhaps they should get their fill while they can, because Roberts revealed she may give up acting completely in the future. "I think as I get older, there might come a time when I don't want to be in front of the camera anymore and want to be more behind the scenes: I would love to produce and maybe write," she said in the January issue of Allure magazine. Are Emma Roberts and Evan Peters Engaged? Emma Roberts Says Fiance 'Thought I Was So Weird' When They Met Roberts, 24, continued, "I thought of it a lot during 'Scream Queens' when every morning there's full hair and makeup and heels and mini dresses. And I thought, you know, I kind of want to show up to work one day and not care what I look like. It would be nice to just slip away for a little bit." The actress said an incident with her 14-year-old sister, Grace, also led her to care less about looks. Roberts recalled when she tried to post a picture of themselves on Instagram, and her sister pleaded with her not to. "She came up to me and said, 'Please don't post that; people are calling me ugly on your Instagram,'" Roberts said. The actress said the moment deeply affected her. "I've met some of the most beautiful people in the world, who have been some of the most awful people. I'm getting choked up talking about it," she said. "I thought, here's my little sister, and people are calling her ugly. ... I love her more than anything or anyone in the world." The incident with her sister is one of the reasons why Roberts decided to pose naturally on the cover of Allure. "You can put yourself out there and not Photoshop yourself or Facetune yourself," she explained. "It's just fine to say, 'Oh, I looked bad in that picture, but that was such a fun day. ... I also wanted to show people ... [with] my hair down. Basically no makeup." "I'm a small-B boob," she added. "I can't even fit into Victoria's Secret bras. They're all too big! So I'm standing up for the small-busted girls."
Item #217: Waterloo Boy "One Man Tractor" Full Line Brochure--nice! 34 pages, clean and nice, great art on cover, so nice I questioned whether it was original or not, but has the "Gugler Litho Co.--Milwaukee, WIS" logo on the back page like it should, great ORIGINAL piece!
Take the circumference measurement at the narrowest point of your waist. Lower Waist Take the circumference measurement at the hip bone. Hips Take the circumference measurement at the widest point of your hips/buttocks. Height Your height from head to toe. Disinfectant Regular price INR. 250 Size 300ml Detailed Measurements As important as it is to keep your body clean, it is also important to keep your surrounding clean too. From your bed side tables, your working desk, your dining area, your bathroom stands or even the inside of your car. It is important to ensure all these areas are kept hygienic 24/7. The Clap disinfectant is an aqueous liquid made of Vinegar, IPA and a dash of cinnamon oil, all of which help to clean with a simple spray. Simply spray, wipe and leave to dry. Best to keep this handy at all times. Why Me Wear Me Look After Me The vinegar in combination with IPA helps in cleaning any surface as quick as possible. It can be sprayed on wood, glass or metal and can be easily wiped of. It is already pre mixed and does not require any dilution. The vinegar in combination with IPA helps in cleaning any surface as quick as possible. It can be sprayed on wood, glass or metal and can be easily wiped of. It is already pre mixed and does not require any dilution.
Actions Report: Arrest is imminent in Tupac Shakur's murder case A source tells Scripps station KTNV in Las Vegas that an arrest is imminent in the murder of Tupac Shakur. Las Vegas police have not confirmed any activity on the case. The legendary rapper's life was cut short in a drive-by in Las Vegas more than 21 years ago. The case has been unsolved since 1996. This potential break comes after a confession in a new documentary. Duane Keith Davis says he was in the car when a fellow passenger and relative, Orlando Anderson, shot and killed Shakur. Anderson was killed two years later in 1998. Anderson had always denied any involvement in the shooting. ARREST IMMINENT? An ex-gangster claims he knows who really killed Tupac in a new Netflix series. Now, a source tells @KTNV they believe an arrest is imminent. @LVMPD has NOT confirmed a potential arrest in this cold case ... (cont'd) pic.twitter.com/l9EiKec57h "It was pretty much common knowledge who did it," said retired senior homicide Las Vegas police detective Phil Ramos. Ramos says detectives zeroed in on Anderson as a potential suspect soon after the shots were fired; however, the case hit roadblocks and went cold. "It's kind of a given gang members don't talk to cops, especially in murder cases," said Ramos, "that's what happened on this case." Tonight at 11 on @KTNV - we interview a now retired Las Vegas homicide detective about the information from the Netflix series. This detective was assigned to the Tupac case. We ask: Is the new info credible? What are the next potential steps for police and prosecutors? pic.twitter.com/cUSm3FrcX9
Q: Availability Group Endpoints Windows Authentication Error I have a two-node SQL Server 2016 Standard Always-On environment and when I create a new availability group, I receive the error message below: The Endpoints tab lists at least one endpoint that uses only Windows Authentication. However, the server instance might be running under a nondomain account. To use the listed endpoint, change the corresponding SQL Server service account to a domain account. To continue using the nondomain account, alter the endpoint to use a certificate. Do you want to use the listed endpoints? Now there is a fair amount of information to correct this, but I am struggling to find a fix for my scenario. All im finding, is when you are running SQL Server and the endpoints as a non-domain user, as the message suggests. I am running both instances as the same domain user, which has admin on both nodes and sysadmin in each instance of SQL Server, and this can be seen on the endpoints tab, both endpoint SQL Service account entries are the Domain\svc_account that is running SQL Server. The Availability groups get created perfectly, i occasionally have do grant CREATE DB to the secondary node to initialize the seeding, but other than that all is great. Failovers are perfect etc. We do have over 20 AG's. Could that be an issue? I believe AG have been tested successfully at up to 100 groups. Being SQL Server Standard, we can only do 1 DB per group, and most of the DBs are small at <5GB. So I am assuming its not causing any issues yet, but regardless I would like to know if its something I can ignore, or fix, in my scenario. The output of Node 1: Node 2: Thank you for all your assistance. A: So i am assuming its not causing any issues yet, but regardless i would like to know if its something i can ignore in my scenario, or fix. Looks like since everything seems to be configured properly (I can't see the domain account information [which is redacted as it should be :) ]) so I wouldn't worry about it. If this happens on multiple servers in the environment then it may require further investigation but overall everything you posted seems in line with a normal configured system. I traced this down to a call IsValidDomainUserForWinAuthentication used in SSMS which, for whatever reason, is returning false. Looking at the logic, it's checking a few various items, but the one that stands out is the assumption on how the service account name is configured (allowable characters) and that calls to LookupAccountName complete successfully. It would take a time travel trace or full memory dump of SSMS (when the message box is shown) to really investigate further which I don't believe is warranted at this time.
Stats i really wanted to draw him...! n... that was a BITCH! i mean his eyes... lips.. that freakin' nose gave me headache. i love u Misha, but srsly! -_- its not perfect... it took about 14h for face (SIC!) n about 3h for coat... o.O pencils (2H,3B,4B,5B,6B,8B) I claim no ownership of the characters used in this piece. All rights to Supernatural belong to the creator, Eric Kripke, as well as Warner Bros. Television and Productions.
Q: Using bisect to flip coins I am trying to solve this problem on Codechef, which has a list of \$N\$ coins, all initially tails-up, and a list of \$Q\$ commands. There are two possible commands, 0 A B flips all coins in the interval [A, B] and 1 A B prints the number of heads-up coins in the interval [A, B] (both intervals include B). After reviewing somebody else's answer that exceeded the time-limit, I came up with a fast numpy answer, which was still not fast enough for the online judge (3s instead of 0.3s). However, one other reviewer suggested the following algorithm: The key observation is that a 0 a b operation is in fact a pair of operations: flip coins from a to the end, and flip coins from b + 1 to the end. This leads to the solution: Decouple the 0 a b operation into a and b+1 Maintain the list of flip points, and keep it ordered To perform a 1 operation, find the largest flip point before A. If its index in flip list is even, the A coin is tails up, otherwise it is heads up. Then, traverse the flip list until B adding up lengths of every other interval. I tried to implement this, using bisect to keep the list of flips sorted, but it is a lot slower (20s for the same worst-case input as the 3s quoted above). from bisect import bisect_left, insort n, q = map(int, input().split()) flips = [] for _ in range(q): command, start, end = map(int, input().split()) if command == 0: insort(flips, start) insort(flips, end + 1) elif command == 1: flip_start = bisect_left(flips, start) flip_end = bisect_left(flips, end + 1) flips_temp = flips[flip_start:flip_end] insort(flips_temp, end + 1) if flip_start % 2: insort(flips_temp, start) print(sum(flips_temp[1::2]) - sum(flips_temp[:-1:2])) However, this is probably not the best implementation of that algorithm, maybe there is a way to use heapq to keep the list sorted (but then slicing and traversing it become harder). So, any comments, especially on how to speed this up, are welcome. I am aware that one should normally put this into a function and make it re-usable, but since this is time-critical code I think it is fine to leave it all in the global namespace. It is a one-shot script, anyway. The worst-case input file I used (which I generated using the code in my linked answer from above) can be found here (1.4 MB). It assumes the maximum allowed values for \$N\$ and \$Q\$ and contains a random sequence of the two allowed commands. I feed it to this code with the following command (and time it at the same time): time cat flipping_coins.dat | python3 flipping_coins.py Running only the cat command already takes 0.17s. As Ev. Kounis noted in the comments, there is currently no solution in pure Python that successfully beats this challenge. There are, however, a couple of PyPy solutions, which use segment trees. A: if command == 0: insort(flips, start) insort(flips, end + 1) Well, the main reason it's slow is insort. As the doc says, Keep in mind that the O(log n) search is dominated by the slow O(n) insertion step. That said, there's a significant performance improvement possible here without changing data structure. Flipping coins from a to the end and then flipping coins from a to the end is equivalent to doing absolutely nothing. So rather than always insert, toggle whether or not the value is in flips. I see an execution time reduction from about 30s to about 16s with def toggle(flips, val): idx = bisect_left(flips, val) if idx < len(flips) and flips[idx] == val: del flips[idx] else: flips.insert(idx, val) and if command == 0: toggle(flips, start) toggle(flips, end + 1) Obviously if you want speed then you need to switch to using a better data structure than a list, but within the constraints of list I think this is fairly efficient. elif command == 1: flip_start = bisect_left(flips, start) flip_end = bisect_left(flips, end + 1) flips_temp = flips[flip_start:flip_end] insort(flips_temp, end + 1) if flip_start % 2: insort(flips_temp, start) print(sum(flips_temp[1::2]) - sum(flips_temp[:-1:2])) The first thing that's suspicious here is insort. However, to my surprise, using flips_temp.append(end + 1) and flips_temp.insert(0, start) made things slightly slower. The real speedup comes from eliminating the copying. Careful analysis shows that the logic is equivalent to elif command == 1: flip_start = bisect_left(flips, start) flip_end = bisect_left(flips, end + 1) accum = sum(flips[flip_start+1:flip_end:2]) - sum(flips[flip_start:flip_end:2]) if flip_start % 2: accum = -start - accum if flip_end % 2: accum = accum + end + 1 print(accum) This gave me a further speedup from 16 seconds to 12 seconds. IMO it would make sense to implement the difference of sums using functools.reduce(operator.sub, ..., 0), but that's much much slower (~40 seconds).
En Iniya Pon Nilavae En Iniye Ponnilave is a 2001 Tamil-language Indian feature film directed by Balu Mahendra, starring Pandiarajan and Mounika. Cast Pandiarajan as Shiva Mounika as Rosie Suresh Chakravrthy Vichithra Vasanth Soundtrack Soundtrack was composed by M.S. Viswanathan and Ilayaraja. Thalirkalil Pookkal - K. J. Yesudas Kadhal Ninaive - KJ Yesudas Sillendra Malare - K. S. Chithra Poo Vendume - S. P. Balasubrahmanyam, Vani Jayaram Pudhu Kadalai - Mano, L. R. Eswari Production The film was initially titled Amma Appa Vilaiyaatu and was completed in the 1990s but remained unreleased. In 2001, the makers of the film re-emerged and chose to release it under a new title En Iniya Ponnilave, taken from the song from Balu Mahendra's 1981 film Moodu Pani. References Category:Indian films Category:2001 films Category:Films directed by Balu Mahendra Category:Tamil film scores by Ilaiyaraaja Category:2000s Tamil-language films
Last updated on .From the section Football Scotland skipper Darren Fletcher is delighted to return to competitive action for Scotland against Germany Euro 2016 Qualifying Group D: Germany v Scotland Venue: Signal Iduna Park, Dortmund. Date: Sunday, 7 September. Kick-off: 19:45 BST. Coverage: Live text commentary on the BBC Sport website and live commentary on BBC Radio Scotland. Darren Fletcher says Scotland's players are relishing the opportunity to topple world champions Germany in their opening match of Euro 2016 qualifying. The sides meet in Dortmund on Sunday night and Fletcher has revealed there is a buzz about the Scotland squad. Scotland have match-winners - Naismith "There's great excitement coming here and what a challenge it is," he said. "You've got to look forward to that challenge and not be scared of it - you have to embrace it. What a scalp it could be." The qualifier for France 2016 marks captain Fletcher's return to competitive action for Scotland, following a lengthy spell on the sidelines due to illness. And the 30-year-old insists facing a side of Germany's calibre at Signal Iduna Park is the perfect setting to restart his international career. "It's great to be back but I always felt I would be back. It's a great occasion," he added. "I've never played at the stadium before and what an opportunity to play against the world champions in their first competitive game (since winning the World Cup in Brazil)." Gordon Strachan says his Scotland squad know exactly what is required from them in Dortmund Germany lost 4-2 to Argentina on Wednesday in a friendly and are facing personnel issues ahead of the match. They have been hit with a number of injuries in defence and are without three of their World Cup-winning squad following the retirements of Miroslav Klose, Per Mertesacker and Philipp Lahm. But Fletcher is not expecting their level to drop. Scotland coach Strachan expects Germany to 'come alive' "We know what to expect from them," he said. "They may have a few players retired and missing but with the strength in depth they've got, and quality they have, we're expecting a fully-fit, top-class Germany team. To prepare for it any differently would be a big mistake." Fletcher, however, says Scotland go into the game with confidence on the back of a six-game unbeaten run. And he was unhappy when asked about the Scotland players by a German journalist. "I think it's a bit disrespectful that you don't know too much about the Scotland team to be honest," he said. "We've got a lot of good players, we play in the Premier League, a lot of us, we're on an unbeaten run and since the manager came in there's been a massive improvement in the team. Scotland manager Gordon Strachan and assistant Stuart McCall talk tactics during training in Germany "We've worked on what we do when we get the ball and we'll try to be positive when we get the ball, try to create openings and attack. "It's the start of a new campaign for us and we're in a good place just now, but we need to do it when it counts and we want to qualify for a major competition - it starts by trying to get a result here." Scotland boss Strachan is also confident his side are well-placed to face a side of Germany's quality. "Is it the best time to play Germany? For us it's a good time to be playing together," he said. "We're in a good place at the moment and we're respectful, we understand how good they are, but we're happy with what we've been doing in the last year. "We know how we're going to play, we know the formation. Every player will now exactly what's needed from them."
tech2 News Staff When it comes to online browsing, two-thirds of Indian users do not wait for even five seconds for a web page to load and move on to next website, a survey said on Wednesday. According to the survey by global digital content provider Limelight Networks, Indians are the most demanding Internet users and 54 percent would move to a different site to make a purchase if a website was too slow. Nearly 10 percent of Indian users do not re-visit a website after previously experiencing slow performance. Smartphones are the primary device used to access online content for Indians and more than half (56 percent) expect fast web performance regardless of what device they are using. "In today's crowded market, brands can't risk delivering a poor online experience to their customers," Michael Milligan, Senior Director at Limelight Networks, said in a statement. The annual global report, which highlights online behaviour and expectations of consumers from seven countries including India, found major increases in time spent online and the impact of online experiences on customer loyalty. Globally, more than 45 percent of people spent at least 15 hours a week online outside of work, a 64 percent increase from last year. Almost a third of Indian consumers spend at least 15 hours a week online outside of work — the lowest amongst the countries surveyed. Indian consumers also want to know their information is being safeguarded online. 69 percent have a negative opinion of a brand after it has experienced a security breach, and 45 percent say they will not shop at a website that has been the victim of a cyber-attack. "Security breaches, slow performance and other elements of an inefficient online experience impact a shopper's actions and have long-lasting effects on brand reputation and customer retention," added Milligan.
Q: matplotlib imshow - default colour normalisation I have consistently had problems with my colour maps when using imshow, some colours seem to just become black. I have finally realised that imshow seems to, by default, normalise the matrix of floating point values I give it. I would have expected an array such as [[0,0.25],[0.5,0.75]] to display the appropriate colours from the map, corresponding to those absolute values but the 0.75 will be interpreted as a 1. In the extreme case, an N x N array of 0.2 (for example), would just produce one big black square, rather than whatever one would expect 0.2 to correspond to in the colour map (perhaps a 20% grey). Is there a way to prevent this behaviour? It is particularly annoying when custom colour maps have many discontinuities, a small change in scale could cause all the colours to completely change. A: Just specify vmin=0, vmax=1. By default, imshow normalizes the data to its min and max. You can control this with either the vmin and vmax arguments or with the norm argument (if you want a non-linear scaling). As a quick example: import matplotlib.pyplot as plt data = [[0, 0.25], [0.5, 0.75]] fig, ax = plt.subplots() im = ax.imshow(data, cmap=plt.get_cmap('hot'), interpolation='nearest', vmin=0, vmax=1) fig.colorbar(im) plt.show()
Guam is a small island and a U.S. territory located southeast of Japan with a small population of about 163,000 people. Because of the small population, hunger in Guam has a much higher impact. Thankfully, things are looking up for Guam as rising employment rates and school programs are helping the hunger situation in Guam. One of the more impactful programs in Guam that is fighting the hunger situation is that all 26 elementary schools in Guam serve meals for free. This free meal plan is provided through the federally funded Community Eligibility Provision grant that is provided by the U.S. Department of Agriculture. This program feeds elementary students so they are focused and ready to participate in classes by giving them the nutrition they need. Some middle and high schools are also participating in the free meal program. The First Lady of Guam, Christine Calvo, wants to stamp out child hunger in Guam by expanding this program to all schools. With unemployment, food insecurity becomes an issue. Food insecurity is when people are without reliable access to affordable or nutritious food. Unfortunately, people need to spend money to eat, and if people are unemployed, they cannot do so. However, Guam has decreased its unemployment rate quite drastically. From June 2015 to June 2016, the unemployment rate in Guam dropped from 8.7 percent to 3.9 percent, a 55 percent decrease in unemployment. Because of this decrease, food insecurity has become less of an issue and more people know where their next meal is coming from. Although hunger in Guam used to be a major issue, solutions are being implemented to help those in the country. Implementing free meal programs in schools and decreasing unemployment are important steps to alleviating hunger in Guam. If the free meal program expands to all schools and the unemployment rate continues to drop, hunger could become a thing of the past for the people of Guam. – Daniel Borjas Photo: Flickr
Andrew Puzder will stay on as fast food CEO CBS News Chief White House Correspondent Major Garret said that a source very close to President Donald Trump's Labor Department nominee told him that he expects Puzder to withdraw because, "he's very exhausted of the abuse". "They're always polite, they always upsell, they never take a vacation, they never show up late, there's never a slip-and-fall, or an age, sex, or race discrimination case", Puzder previously said in an interview with Business Insider. President Donald Trump's nominee for labour secretary Andrew Puzder, has withdrawn from consideration on the eve of his confirmation hearing. Puzder, an attorney by trade, said he fully supports the president and his "highly qualified team". One senator, speaking on condition of anonymity, told the Associated Press that six Republican senators asked the White House to call off the hearing because they couldn't see themselves voting for him. They included five members of the Senate Health, Education, Labor and Pensions (HELP) committee, which was scheduled to hold a confirmation hearing for Puzder on February 16. The nominee has also faced concerns about his views on overtime and the minimum wage. Earlier this week Republicans had been strongly defending Puzder against allegations of not being fit for the position. The last-minute press conference comes amid a tumultuous week for the president, who saw Mr. Puzder drop out and had to force a resignation from his national security adviser over his misleading administration officials about contacts with Russian Federation during the transition. "When I learned of her status, we immediately ended her employment and offered her assistance in getting legal status", Puzder told the committee. Andrew's nomination was killed after he admitted to hiring an undocumented worker as a housekeeper, according to Slate, as the GOP viewed him weak on immigration.
Protease is an enzyme which catalyzes hydrolysis of peptide bond in proteins or peptides, exists in all organisms and plays a variety of physiological roles. Most of proteases from microorganisms are secreted to the extracellular environment and their activities are inhibited or activated by carbon sources or nitrogen sources. In addition, most of microbial proteases have their origin to pathogenic microbes to animals or plants, or the proteases have a pathogenic property. Microbial proteases are classified according to such characteristics as temperature, optimal pH, and the residues at the active site and have different industrial applications accordingly. For example, proteases are classified into thermostable, mesophilic or thermophilic based on temperature; into acidic, weak acidic, neutral or basic based on optimal pH; and into serine protease, cysteine protease, aspartate protease or metalloprotease based on the residues at the active site. The enzymatic activity of proteases is regulated by metallic cations such as Ca2+, Zn2+, Mg2+, Mn2+ found at the active site of the enzymes. Most proteases are zinc-containing proteins in which zinc is essential for activity. The representative example for the protease is serrapeptase produced by Serratia marcescens(ATCC 21074) isolated from the intestine of Bombyx mori and this enzyme can be used as an anti-inflammatory agent because it has a fibrin degrading ability and a hydrolysis activity for bradykinin and histamine which are inflammatory peptides. Bacterial proteases which have been cloned and characterized hitherto include those derived from Vibrio proteolyticus (See, David, V. A., A. H. Deutch, A. Sloma, D. Pawlyk, A. Ally, and D. R. Durham. Gene. 112:107-112. 1992), Erwinia chysanthemi B374 prtA (See, Ghigo, J. M., and C. Wandersman. MoL Gene. Genet. 236:135-144. 1992), Psudomonas aeruginisa LasB (See, Doung, F., A. Lazdunsk, B. Cami, and Murgier. Gene. 121:47-54. 1992), Serratia marcescens PrtSM (See, Braunagel, S. C., and M. J. Benedik. MoL Gen. Genet. 222:446-451 1990), Bacillus thuringiensis (See, Lovgren, A., M. Zhang, A. Engstrom, G. Dalhammar, and R. Landen. MoL Microbiol. 4:2137-3146.1990), etc.
{ "baseUrl": "http://test.coopcycle.org", "video": false, "chromeWebSecurity": false, "watchForFileChanges": false, "env": { "COMMAND_PREFIX": "" } }
The present invention relates to a memory controller, a flash memory system and a method for controlling a flash memory device, and particularly, to such a memory controller and flash memory system that can perform a series of data write operations to a flash memory device at high speed and a method for performing a series of data write operations to a flash memory device at high speed.
--- abstract: 'We study complete eigenvalue spectra of the staggered Dirac matrix in quenched QCD on a $6^3\times 4$ lattice. In particular, we investigate the nearest-neighbor spacing distribution $P(s)$ for various values of $\beta$ both in the confinement and deconfinement phase. In both phases except far into the deconfinement region, the data agree with the Wigner surmise of random matrix theory which is indicative of quantum chaos. No signs of a transition to Poisson regularity are found, and the reasons for this result are discussed.' address: - 'Institut für Kernphysik, Technische Universität Wien, A-1040 Wien, Austria' - 'Institut für Theoretische Physik, Technische Universität München, D-85747 Garching, Germany' author: - 'H. Markum$^{\rm a}$, R. Pullirsch$^{\rm a}$[^1], K. Rabitsch, and T. Wettig' title: Quantum chaos in QCD at finite temperature --- Introduction ============ The fluctuation properties of the eigenvalues of the lattice Dirac operator have attracted much attention recently. In Ref. [@Hala95], it was first demonstrated that they are described by random matrix theory (RMT). In particular, the so-called nearest-neighbor spacing distribution $P(s)$, i.e., the distribution of spacings $s$ between adjacent eigenvalues, agrees with the Wigner surmise of RMT. According to a conjecture by Bohigas [@Bohi84], quantum systems whose classical counterparts are chaotic have a $P(s)$ given by RMT whereas systems whose classical counterparts are integrable obey a Poisson distribution, $P(s)=e^{-s}$. In this sense, the form of $P(s)$ characterizes quantum chaos. At the localization transition in disordered mesoscopic systems, one observes a transition in $P(s)$ from Wigner to Poisson behavior. The question of whether there is such a transition in the case of the lattice Dirac operator was first raised in Ref. [@Hala95]. The present study serves to investigate this question. Recently, a Wigner to Poisson transition was also studied in the context of a spatially homogeneous Yang-Mills-Higgs system [@Sala97]. The lattice Dirac operator falls into one of three symmetry classes corresponding to the three chiral Gaussian ensembles of RMT [@Verb94]. In Ref. [@Hala95], the Dirac matrix was studied for SU(2) using both staggered and Wilson fermions which correspond to the chiral Gaussian symplectic (chGSE) and orthogonal (chGOE) ensemble, respectively. Here, we study SU(3) which for both staggered and Wilson fermions corresponds to the chiral Gaussian unitary ensemble (chGUE). We thus cover the last remaining symmetry class. The RMT result for $P(s)$ is quite complicated; it can be expressed in terms of so-called prolate spheroidal functions, see Ref. [@Meht91] where $P(s)$ has also been tabulated. A very good approximation to $P(s)$ is provided by $$\label{eq1} P(s)=\frac{32}{\pi^2}s^2e^{-\frac{4}{\pi}s^2}$$ which is the Wigner surmise for the chGUE. Eigenvalue analysis =================== We generated gauge field configurations using the standard Wilson plaquette action for SU(3) and constructed the matrix of the Dirac operator using the Kogut-Susskind prescription. The Dirac matrix is anti-hermitian so that all eigenvalues are imaginary and occur in pairs with opposite sign. We have worked on a $6^3\times 4$ lattice with various values of $\beta$ and typically produced 10 independent configurations for each $\beta$. All spectra were checked against the analytical sum rules $$\sum_{\lambda_n} \lambda_n = 0 \qquad {\rm and} \qquad \sum_{\lambda_n>0} \lambda_n^2 = 3V \:,$$ where V is the lattice volume. To construct $P(s)$, one first has to “unfold” the spectra [@Bohi84]. This procedure is a $local$ rescaling of the energy scale so that the mean level spacing is equal to unity on the unfolded scale. Ensemble and spectral averages (the latter is possible because of the spectral ergodicity property of RMT) are only meaningful after unfolding. Results ======= Our results are displayed in the plots. Figure \[fig1\] shows the staircase function $N(E)$ which is defined as the number of eigenvalues with $\lambda \le E$. In the continuum, $N(E)=\int_0^E\rho(\lambda)d\lambda$, where $\rho(\lambda)$ is the spectral density. Note that $\rho(\lambda)$ cannot be obtained from a random-matrix model. Figure \[fig2\] shows the nearest-neighbor spacing distribution $P(s)$ compared with the RMT result. In the confinement phase, we find the expected agreement of $P(s)$ with the Wigner surmise of Eq. (\[eq1\]). In the deconfinement phase, we still observe agreement with the RMT result up to $\beta=10.0$. No signs for a transition to Poisson behavior are found. Thus, the deconfinement phase transition does not seem to coincide with a transition in the spacing distribution. For larger values of $\beta$ the eigenvalues start to approach the degenerate eigenvalues of the free theory, given by $\lambda^2=\sum_{\mu=1}^4 \sin^2(2\pi n_\mu/L_\mu)/a^2$, where $a$ is the lattice constant and $n_\mu=0,\ldots,L_\mu-1$. In this case, the nearest-neighbor spacing distribution is trivial. However, it is possible to lift the degeneracies of the free eigenvalues using an asymmetric lattice where $L_x$, $L_y$, etc. are relative primes. For large lattices, the nearest-neighbor spacing distribution of the non-degenerate free eigenvalues is then given by the Poisson distribution. While it may be interesting to search for a Wigner to Poisson transition on such asymmetric lattices, it seems clear that this transition will not coincide with the deconfinement phase transition. Furthermore, we do not think that the absence of a signature for a transition from Wigner to Poisson behavior at the deconfinement phase transition is due to the finite lattice size. Even for the small lattice size we used, the agreement of $P(s)$ with the RMT curve is nearly perfect. This leads us to believe that we should have seen some sign of a transition if it existed in the thermodynamic limit. Conclusions =========== We have searched for a transition in the nearest-neighbor spacing distribution $P(s)$ from Wigner to Poisson behavior across the deconfinement phase transition. Such a transition exists, e.g., at the localization transition in disordered mesoscopic systems. In a Yang-Mills-Higgs system a smooth transition along a Brody distribution was seen [@Sala97]. We found no signature of a transition in our lattice data. The data agree with the RMT result in both the confinement and the deconfinement phase except for extremely large values of $\beta$ where the eigenvalues are trivial. In hindsight, these results are not totally unexpected. Temporal monopole currents survive the deconfinement phase transition leading to confinement of spatial Wilson loops. Thus, even in the deconfinement phase, the gauge fields retain a certain degree of randomness. In future investigations one might try to disentangle those spatial contributions to the Dirac matrix. Acknowledgments =============== This work was supported in part by FWF project P10468-PHY. We thank E.-M. Ilgenfritz, M.I. Polikarpov, and J.J.M. Verbaarschot for helpful discussions. [9]{} M.A. Halasz and J.J.M. Verbaarschot, Phys. Rev.  Lett. 74 (1995) 3920; M.A. Halasz, T. Kalkreuter, and J.J.M.  Verbaarschot, Nucl. Phys. B (Proc. Suppl.) 53 (1997) 266. O. Bohigas and M.J. Giannoni, Lect. Notes Phys.  209 (Springer, Heidelberg, 1984) 1. L. Salasnich, Mod. Phys. Lett. A 12 (1997) 1473. J.J.M. Verbaarschot, Phys. Rev. Lett. 72 (1994) 2531. M.L. Mehta, [*Random Matrices*]{}, 2nd ed. (Academic Press, San Diego, 1991). --------- --------------------------------------- -- ----------------------------------------- Confinement: $\beta=2.8$ (solid line) Deconfinement: $\beta=6.0$ (solid line) \[0mm\] and $\beta=5.0$ (dashed line) and $\beta=10.0$ (dashed line) \[3mm\] =4.9cm =4.9cm --------- --------------------------------------- -- ----------------------------------------- ------------------------------------ -- ----------------------------- Confinement: $\beta=2.8$ Confinement: $\beta=5.0$ \[3mm\] =4.9cm =4.9cm \[2mm\] Deconfinement: $\beta=6.0$ Deconfinement: $\beta=10.0$ \[3mm\] =4.9cm =4.9cm ------------------------------------ -- ----------------------------- [^1]: Poster presented by R. Pullirsch
--TEST-- Test array_diff() function : usage variations - binary safe checking --FILE-- <?php /* Prototype : array array_diff(array $arr1, array $arr2 [, array ...]) * Description: Returns the entries of $arr1 that have values which are * not present in any of the others arguments. * Source code: ext/standard/array.c */ /* * Test behaviour of array_diff() function with binary input */ echo "*** Testing array_diff() : usage variations ***\n"; $array1 = array( b"1", b"hello", "world", "str1" => "hello", "str2" => "world"); $array2 = array( b"1" => 'hello', b"world", "hello", 'test'); var_dump(array_diff($array1, $array2)); var_dump(array_diff($array2, $array1)); echo "Done"; ?> --EXPECTF-- *** Testing array_diff() : usage variations *** array(1) { [0]=> string(1) "1" } array(1) { [4]=> string(4) "test" } Done
Jurisdiction of Courts (Miscellaneous Amendments) Bill 2000 WARNING: This Digest was prepared for debate. It reflects the legislation as introduced and does not canvass subsequent amendments. This Digest does not have any official legal status. Other sources should be consulted to determine the subsequent official status of the Bill. The main purpose of the Bill is to remedy possible defects in legislation passed last year which established the Federal Magistrates Court (FMC), and specifically which provided for transfer of proceedings between the FMC and both the Federal Court and the Family Court. Secondly, where cases have already been transferred under the impugned provisions and decided, the Bill seeks to give statutory effect to the outcomes of that litigation, outcomes which might otherwise be legally ineffective. Thirdly, the Bill clarifies the monetary limit in trade practices litigation transferred to the FMC from the Federal Court. Last year the Parliament passed the Federal Magistrates Act 1999 (Federal Magistrates Act) and the Federal Magistrates (Consequential Provisions) Act 1999 (Consequentials Act). That legislation established the FMC and, amongst other things, detailed its jurisdiction in areas such as family law, trade practices, human rights, judicial review of administrative decisions and bankruptcy. The FMC was established as a lower level court to handle less complex matters currently dealt with in the Federal and Family Courts. It was intended to offer greater informality, simplicity and efficiency. Detailed information on the background to the establishment of the FMC can be found in the Bills Digest for the Federal Magistrates Act.(1) In accordance with the doctrine of separation of powers, federal judicial power can only be exercised by courts established under or recognised in Chapter III of the Commonwealth Constitution. The Federal Magistrates Court is a Chapter III court. As just noted, the Commonwealth Constitution has been interpreted by the High Court as giving effect to a separation of powers, relevantly for our purposes, a separation of the judiciary from both the Parliament and the Executive. The constitutional separation of powers, an implication derived from the structure of the Constitution which contains a separate Chapter III dealing exclusively with federal judicial power, puts limits on the powers of the Parliament and the Executive. Over the last decade or so, the High Court has asserted and defined those limits in increasingly robust fashion. In other words, a number of laws have been found invalid because the High Court has regarded Parliament as transgressing the separation between legislative and judicial power which arises by implication from the existence of Chapter III in the Constitution. The most significant High Court decision in terms of the current Bill is Kable v Director of Public Prosecutions (NSW).(2) There the High Court recognised a free-standing doctrine of 'incompatibility', which it will deploy to invalidate laws that inflict on courts exercising federal jurisdiction functions which are incompatible with the independence, impartiality and integrity of Chapter III courts. Specifically in that case, the legislation was seen as cloaking the decisions of the Executive and the Parliament to prolong the detention of a prisoner with the legitimacy of a court order, but without allowing the NSW Supreme Court (which exercises federal jurisdiction) the full, free and independent exercise of judicial power necessary to preserve public confidence in the judiciary. The decision in Kable was a warning from the High Court that legislation runs the risk of constitutional invalidity if it arguably creates the impression that courts exercising federal jurisdiction are mere extensions of the Executive. Kable also embodied another long-standing principle in the separation of legislative and executive powers: that only Chapter III courts can exercise federal judicial power. So the separation of powers in the Commonwealth Constitution gives rise to at least two doctrines: Parliament cannot foist functions on courts which are incompatible with their status as repositories of federal judicial power; nor can Parliament usurp the role of the courts and purport, as a legislature, to exercise judicial power. Both doctrines are relevant to the constitutionality of this Bill, as will be seen in the Concluding Comments. The creation of concurrent jurisdiction between the Federal Court and the FMC, and the Family Court and the FMC, together with the capacity for transfer of proceedings between the relevant superior court(3) and the lower level magistrates court are important features of the new federal magistracy. The ability to transfer proceedings was promoted by the Attorney-General when the legislation was introduced last year, as facilitating the division of judicial labour between more complex and less complex matters, and as contributing to the objective of easing the workload in both the Federal and Family Courts.(4) Defects in the transfer provisions would thus undermine a significant part of the legislative package so recently introduced. The power to transfer proceedings from the FMC to either of the superior federal courts is set out in the Federal Magistrates Act. In some cases, a federal magistrate can exercise a discretion over whether to transfer a matter or not (section 39). In other cases the transferral of proceedings will be mandatory (section 41)-proceedings in this category will be specified in regulations, although none have been made to date. There is no appeal in relation to the decision about transfer of proceedings. Provisions for the transfer of matters in the opposite direction, from either the Family or the Federal Court to the FMC, were set out in the Consequentials Act. The Family Law Act 1975 (Family Law Act) was amended to provide for both discretionary (section 33B) and mandatory (section 33C) transfer of proceedings to the FMC. The Federal Court of Australia 1976 was amended to provide for discretionary transfers (section 32AB). Again there is no appeal available regarding the transfer decision in any of these instances. The existence of these provisions explicitly authorising transfer of proceedings might, on one interpretation, be the end of the matter. It is reasonable to interpret them as implicitly conferring jurisdiction on the receiving court to hear and determine the matters.(5) The precise problem which has prompted the Bill is not explained in the Explanatory Memorandum nor the Second Reading Speech. It appears to be that these transfer provisions run into a potential conflict with provisions in the Administrative Decisions (Judicial Review) Act 1977 and the Family Law Act that deal with the jurisdiction of courts under those Acts. Arguably those provisions dealing with jurisdiction do not accommodate matters transferred to the court in question rather than originally instituted there. Whether this fear is well grounded in the family law area is discussed further below. Items 1 and 3 deal with the two-way transfer of ADJR matters(6) between the FMC and the Federal Court, and the transfer of family law matters from the Family Court to the FMC. Both items remove from the relevant Act a legal ambiguity which currently casts doubt on whether such transfers of proceedings are legally effective. Item 1 addresses that provision of the Administrative Decisions (Judicial Review) Act 1977 (ADJR Act) which indicates how the Act should be interpreted. Thus it adds three new subsections to existing section 3 of the ADJR Act. Proposed subsection 3(10) confirms that references to 'an application made to the Federal Court' include (and are deemed always to have included) applications transferred to the Federal Court from the FMC. The bracketed words in proposed subsection 3(10), which exclude some provisions in section 11 of the ADJR Act, are there to prevent this amendment from itself sowing confusion. Their effect is to preserve the possibility that the Federal Court and the FMC may impose different procedural rules for making applications to the court in question. A similar amendment is made in the next subsection, proposed subsection 3(11), for matters travelling in the opposite direction (ie from the Federal Court to the FMC). The wording is slightly different to take account of the fact that not every ADJR matter which can be commenced in the Federal Court may also be commenced in the FMC (the Explanatory Memorandum refers to a number of examples including certain migration and citizenship matters). The nett effect of both subsections is that when section 8 of the ADJR Act refers to jurisdiction over applications 'made to the...Court', there will be no doubt that it includes matters transferred to that court from the other tier (the FMC or the Federal Court depending on where the applicant initiated proceedings). Section 19 of the Federal Magistrates Act prevents splitting of related matters between the FMC and either the Family Court or the Federal Court. It prohibits someone from commencing proceedings in the FMC if an 'associated matter' is already before one of those other federal courts.(7) Its policy intent is unrelated to the issue addressed in the Bill. Therefore, to prevent this technical rule creating further ambiguity as far as jurisdiction in transferred proceedings is concerned, proposed subsection 3(12) says that section 19 will be disregarded when interpreting proposed paragraph 3(11)(b). Item 2 is a consequential amendment, a reminder that in assessing the original jurisdiction of a federal court in an ADJR matter, the clarifying statements in proposed subsections 3(10)-(12) should be taken into account. The Family Law Act confers jurisdiction on various courts to hear family law matters. Jurisdiction over 'matrimonial causes'-basically divorce, maintenance and property proceedings-is dealt with in Part V of that Act. Some courts have jurisdiction over defined family law matters including all matrimonial causes expressly conferred on them.(8) By contrast, jurisdiction is expressly conferred on the FMC only in relation to a small subset of family law matters in subsection 39(5A), as well as in other parts of the Act.(9) Subsection 39(1A), in rather different language, states that most matrimonial causes can be 'instituted...in the Federal Magistrates Court'. It seems clear that the language in subsection 39(1A) is sufficient to impliedly confer jurisdiction on the FMC to hear and determine those matrimonial causes which can be 'instituted' there.(10) Arguably, though, the (implied) conferral of jurisdiction in subsection 39(1A) is confined to matters which commence in the FMC, rather than those matrimonial causes transferred to the FMC from the Family Court. But there is one more piece in the mosaic of FMC jurisdiction over these matrimonial causes: subsection 39(9) of the Family Law Act says that where section 39 confers or invests a court with jurisdiction, that court also has jurisdiction over matters arising under Commonwealth law where proceedings are transferred to that court. Putting subsections 39(5A), (1A) and (9) together, arguably the FMC has jurisdiction over the subset of family proceedings mentioned in subsection 39(5A)-whether commenced in or transferred to the FMC-and over most matrimonial causes either instituted in (subsection 39(1A)) or transferred to (subsection 39(9)) the FMC. If this interpretation is correct, and it is difficult to see why it is not, there is no apparent problem or ambiguity to be resolved by the Bill. In any case, item 3 will remove any doubt. It states that the FMC has and always had jurisdiction where these matrimonial causes are instituted under the Family Law Act, thus catching proceedings commenced in either the superior or lower level court. The new FMC was, in the Consequential Act, given limited jurisdiction in civil actions for damages pursued under section 82 of the Trade Practices Act 1974 (TPA). A monetary limit of $200 000 was imposed when such damages claims are 'instituted in the Federal Magistrates Court'.(11) The wording of this monetary limitation creates an unintended ambiguity. Arguably it implies that the monetary limit does not apply where proceedings under section 82 are first commenced in the Federal Court and then transferred to the FMC rather than 'instituted' in the latter court. Item 4 removes this ambiguity by applying the limit to both situations. Item 5 is a minor consequential amendment which provides a cross-reference to the provision authorising transfer of TPA proceedings from the Federal Court to the FMC. Part 2 of the Bill is an attempt, based on a formula used in the past by Commonwealth drafters and approved in the High Court, to repair the legal damage which may have been caused by the defects in 'transfer of proceedings' provisions identified above. The scheme addresses those cases where the transfer provisions have been used in ADJR and family law matters to relocate proceedings from the Federal Court and Family Court respectively where they were instituted, to the FMC. The possible absence of FMC jurisdiction in such transferred proceedings puts a question mark over the legal validity of the decisions in those cases (the Explanatory Memorandum and Second Reading Speech do not provide an estimate of how many cases may be affected). The Bill labels these decisions 'designated judgments'. It then attempts to put the parties involved in or affected by those decisions in exactly the same legal situation as they would be if those decisions had been validly decided. Strictly speaking it does not legislate to 'validate' the decisions, because of constitutional concerns discussed below. Instead, through the Bill, Parliament will declare the rights and liabilities of the parties to be the same 'as if' each designated judgment had been validly made. It goes further and attempts to mirror and provide for in legislation the legal consequences which would follow if the judgments had been validly made. In adopting this mechanism of 'statutory judgments' the Bill embraces a model which has been used before in Commonwealth legislation to deal in one swoop with the problem of invalid or potentially invalid decisions. It was pioneered in the Matrimonial Causes Act 1971, which was enacted to deal with the consequence of the High Court decision in Knight v Knight.(12) That case found that certain orders for maintenance made by the Master of the South Australian Supreme Court were invalid because they involved the exercise of judicial power. The Master was not a member of the Court and therefore lacked jurisdiction to make the orders. The Matrimonial Causes Act 1971 declared the rights of parties in the affected maintenance proceedings to be the same as if the cases had been decided by a Supreme Court judge. The legislation was challenged in R v Humby on the basis that it breached the separation of powers provided for in Chapter III of the Constitution. The argument was that Parliament had transgressed the divide between legislative and judicial power, the latter sphere being reserved to Chapter III courts. The High Court unanimously rejected the challenge and upheld the legislation. Justice Mason put it this way: Chapter III contains no prohibition, express or implied, that rights in issue in legal proceedings shall not be the subject of legislative declaration or action... Here by legislative action the rights of parties in issue in proceedings which resulted in invalid determinations were declared. The rights so declared in form and in substance were the same as those declared by the invalid determinations. But the legislation does not involve an interference with the judicial process of the kind which took place in Liyanage v The Queen.(13) The same sort of model has been used subsequently, for example to deal with the potentially massive consequences of Re Wakim,(14) a constitutional decision which found the cross-vesting scheme for corporations law cases to be invalid and thus threw into doubt the validity of thousands of decided cases. Another recent example is found in the Family Court of Western Australia (Orders of Registrars) Act 1997 which dealt with certain orders made by registrars of the Family Court of Western Australia.(15) Item 7 defines which judgments of the FMC will be singled out for this form of legislative imitation. Although Part 1 of the Bill acknowledges that the transfer provisions for ADJR matters moving from the FMC to the Federal Court share the same defect, the Second Reading Speech states that no cases have yet taken this path, therefore item 7 only deals with ADJR matters transferred from the Federal Court to the FMC and family law matters moved from the Family Court to the FMC. Sub-item 7(1) pre-empts challenges based on possible defects in the provisions allowing ADJR matters to be transferred from the Federal Court to the FMC. It says that: if such a transfer occurred it transpires that the FMC did lack jurisdiction to decide the case the FMC delivered its judgment in the case, and the doubt over jurisdiction is removed by the clarifying amendments in item 1 then the FMC's purported decision is a 'designated judgment' for the purposes of the Bill. Similarly, if a family law matter was transferred from the Family Court to the FMC where it was decided, and it transpires that the FMC lacked jurisdiction over the transferred proceedings but that defect is cured by item 3, then the FMC's purported decision is again a 'designated judgment' for the purposes of the Bill (sub-item 7(2)). It is possible that in either situation the original decision of the FMC has been modified in some way. A court may have affirmed, revoked, set aside, reversed, varied, revived or suspended the original decision. Sub-item 7(3) has been inserted to ensure Part 2 has the desired curative effect on that judgment, both before and after any such modification. Item 8 is the key provision in Part 2, in which Parliament attempts by legislation to mirror what the FMC has purported to decide but, due to alleged drafting defects, may have lacked jurisdiction to do. Rather than 'validate' these decisions, item 8 creates a legislative proxy for the court order, a declaration by Parliament that the rights and liabilities of any person are the same as if the designated judgments had been valid decisions of the FMC. Item 9 elaborates on the effect of item 8. It confirms the ability of relevant people to exercise and enforce the rights and liabilities declared by legislation in item 8, as if they had instead been validly declared in a judgment and order by the FMC. Sub-item 9(2) confirms that this includes the right of appeal where that right is available against a decision of the FMC. Note that this creates the rather odd situation of appealing to a higher court against, not a trial and decision conducted by a judge, but a legislative declaration of rights and liabilities. A court decision may have effect beyond its immediate context of settling a dispute between parties. To take a simple example, an award of damages may attract a liability to pay tax to the Australian Taxation Office. Item 10 attempts to ensure that in mimicking the effect of a FMC order, the Bill replicates these flow-on effects of a court decision and confirms the right of all entities to act as if the designated judgment is, and always was, valid. Those who have contravened FMC court orders or do so in the future, will not be able to escape the legal consequences of their contravention by capitalising on the possible invalidity of such orders due to a defective transfer. That is the legal effect of sub-item 10(2). Item 11 confirms that courts can modify the rights and liabilities declared by item 8 just as if they had been validly declared in a judgment of the FMC. Sub-item 11(4) also affirms the power to effect any other action a court could have effected in the same situation, when considering applications to: modify a judgment grant an extension of time grant a stay of proceedings. Where past or future behaviour by a person would attract the powers of a court to deal with contempts in the case of a valid FMC order, the same behaviour attracts the same powers even though a designated judgment is instead the touchstone for assessing contempt: item 12. The oddity of a legislative declaration of rights and liabilities, as if it was a judgment of the FMC, could lead to problems if those rights and liabilities must subsequently be established in another proceeding. There has been in these cases strictly speaking no trial, no judge and no judgment, simply a legislative declaration of rights. In practical reality, there has been a full trial with all its normal accoutrements, but drafting defects may have robbed the FMC of the jurisdiction validly to conduct that trial. Item 13 provides that a copy of the court record of a designated judgment can be used in evidence in another proceeding to spell out the existence, nature and extent of the rights and liabilities declared in item 8. Of course, it may be that the Federal Court or Family Court has in some way already nullified a decision of the FMC, for reasons quite unrelated to the jurisdictional question raised by the transfer provisions. Item 14 confirms that Part 2 does not apply in such situations. As noted throughout this Digest, this Bill is based on a premise which is speculative. The doubt over jurisdiction in transferred proceedings has not been confirmed by a court, it is simply that the relevant Acts(16) contain ambiguities which may threaten that jurisdiction. The Bill, therefore, is drafted to cater for a future possibility: that a court decides there has indeed been an absence of jurisdiction. In such a case, Part 2 would be activated, with the intention of creating a set of legal consequences identical to those which would have flowed if the judgment had been valid. If it transpires there was never an absence of jurisdiction, Part 2 would have no work to do and the judgment would have its ordinary legal consequences. Because of the speculative premise underpinning the Bill, the Government has inserted items 16 and 17 to prevent any undesirable inferences being drawn. It says that the remedial action taken by the Bill should not be interpreted as indicating a lack of intention when the FMC was originally established that it (and the Federal Court) should have jurisdiction in such transferred proceedings. What can Parliament do when certain decisions, made in the past, are subsequently found or suspected to be invalid? When the decisions were purportedly made in court proceedings, the prospect of accepting their invalidity, undoing their myriad effects and re-running litigation presents a nightmare scenario. In 1973, in Humby, the High Court gave its unanimous approval to a particular legislative device aimed at avoiding the nightmare and restoring the legal effect of what were thought to be properly decided cases. The Court asserted that whatever the implied limitations on Parliament's power which arise from Chapter III of the Constitution, they do not invalidate legislative declarations of the rights of parties involved in litigation. Relying on the High Court's finding in Humby, the Commonwealth Parliament has enacted similar schemes for certain orders made in the Family Court of Western Australia and now, in this Bill, for certain decisions taken by the FMC. State Parliaments around Australia have also relied on the same model in enacting a preliminary 'rescue package' to deal with the potentially massive consequences of the High Court's invalidation of the cross-vesting scheme in the area of corporations law. As we have seen, however, in the intervening years since Humby was decided the High Court has adopted an increasingly robust view of the constitutional separation of powers. The doctrine in Kable spells danger for any law which might create an impression that Parliament is co-opting a court exercising federal jurisdiction to legislative or executive ends. The risk is a finding that Parliament is impermissibly exercising judicial power, or alternatively foisting on the judiciary a role incompatible with the independence and integrity of a Chapter III court. Taking a cue from Kable it might plausibly be argued that Part 2 of the Bill represents an attempt by Parliament to clothe its legislative act with the imprimatur of an FMC judgment. Put this way, one can see how the foundations of an earlier decision such as Humby may have been loosened by the subsequent High Court decisions on judicial power epitomised by Kable. It will come as no surprise, then, that the Humby model has indeed been subjected to fresh constitutional challenge in recent years. The NSW version of the post-Wakim rescue package, the Federal Courts (State Jurisdiction) Act 1999 (NSW), was challenged in Incentive Dynamics Pty Ltd v Robins.(17) That challenge was rejected by a single Supreme Court judge. He conceded that establishing rights and liabilities as if there had been a valid and effective trial on the merits where in fact there had been no such thing, and requiring a court without question to give effect to those rights and liabilities, might in some circumstances offend the constitutional separation of powers. The critical factor in his view was the nature of the body which had made the original (invalid) decision: the Act applies only where there has been a trial on the merits, by a tribunal of the highest integrity, competence and reputation, in which, subject to any points that could be raised in an ordinary appeal on the merits, both parties have had a fair opportunity to put their cases.(18) If this reasoning was adopted in the High Court, it suggests that the applicability of the Humby model would depend on how much the original decision-maker resembled a court conducting itself in a judicial way. It would also suggest that the current Bill would survive constitutional challenge based on Chapter III. The decision in Incentive Dynamics is under appeal to the NSW Court of Appeal.(19) Meanwhile, the stage has been set for a High Court decision which may decide the relationship between Humby and Kable. The provisions of the post-Wakim rescue package in Queensland and South Australia have been challenged in an appeal heard by the High Court on 13-14 June 2000.(20) The range of arguments put in that case-Re Macks; ex parte Saint-by those seeking to invalidate the State 'validation' legislation include: Humby should be over-ruled the legislation in Humby can be distinguished from the corporations rescue package by requiring courts to give their 'rubber stamp' to the declaration of rights and liabilities by Parliament, the legislation offends the incompatibility principle spelt out in Kable or amounts to a legislative usurpation of judicial function. There is one other aspect to Re Macks which raises a fresh issue not yet discussed in this Digest. Parties in the June 2000 High Court hearing homed in on the appeal provisions in the State 'validation' legislation. These resemble the 'right to appeal' provisions found in the Bill at sub-item 9(2). By drawing attention to the oddity of appealing to a higher court from an earlier decision which is in fact a legislative declaration of rights, some parties in Re Macks have questioned (in various ways) whether such a fiction is compatible with the proper functioning of an independent judiciary. Put another way, does the appellate hierarchy, which has the High Court at its apex, pre-suppose there was a genuine trial at first instance? If it does, can the appeal provisions stand? And if they can't, are they so inextricably bound up in the declaration of rights and liabilities that they bring the whole legislative scheme tumbling down? The outcome of Re Macks is likely to clarify the constitutionality of Part 2 of the current Bill. Sean Brennan 29 November 2000 Bills Digest Service Information and Research Services This paper has been prepared for general distribution to Senators and Members of the Australian Parliament. While great care is taken to ensure that the paper is accurate and balanced, the paper is written using information publicly available at the time of production. The views expressed are those of the author and should not be attributed to the Information and Research Services (IRS). Advice on legislation or legal policy issues contained in this paper is provided for use in parliamentary debate and for related parliamentary purposes. This paper is not professional legal opinion. Readers are reminded that the paper is not an official parliamentary or Australian government document. IRS staff are available to discuss the paper's contents with Senators and Members and their staff but not with members of the public. Except to the extent of the uses permitted under the Copyright Act 1968, no part of this publication may be reproduced or transmitted in any form or by any means, including information storage and retrieval systems, without the prior written consent of the Parliamentary Library, other than by Members of the Australian Parliament in the course of their official duties.
Introduction {#s1} ============ *Listeria monocytogenes* is a Gram positive facultative intracellular bacterium that has been used as a model pathogen to study host-pathogen interactions [@pone.0027435-Cossart1]. This opportunistic food-borne pathogen causes serious illness to immunocompromised individuals, pregnant women and the developing foetus [@pone.0027435-Lorber1]. To establish an infection in a host organism, the bacterium must first overcome the barriers of the innate immune system. Macrophages are professional phagocytes which provide a first line of innate immune defence against invading pathogens. Detection of *L. monocytogenes* by macrophages at the cell surface, within phagosomes or the cytosol triggers distinct host cell transcriptional responses via pattern recognition receptors (PRR) [@pone.0027435-McCaffrey1]--[@pone.0027435-Leber1]. Signalling via the so-called vacuolar/Toll-like receptor (TLR) - and the cytosolic/nuclear oligomerisation domain (NOD)-like receptor (NLR) - dependent pathways lead to mitogen-activated protein kinase (MAPK), nuclear factor kappa B (NF-κB) and Interferon Regulatory Factor-3 (IRF3) activation [@pone.0027435-Corr1]. As a consequence, numerous proinflammatory mediators and other molecules are expressed that further instruct elicitation of antigen-specific acquired immunity and clearance of infection. To prevent excessive and inappropriate activation of the immune system upon infection with an intracellular pathogen, the host cellular pathways need to be tightly regulated. MicroRNAs (miRNAs) are significant modulators of the immune response that function at post-transcriptional levels [@pone.0027435-Baltimore1]. Binding of miRNAs to partially complementary sequences in the 3′ untranslated region (3′ UTR) of their respective protein coding mRNA targets, leads to transcript degradation or translational inhibition [@pone.0027435-Bagga1]--[@pone.0027435-Lim1]. These small (21--24 nt) non-coding RNAs derive from intergenic sequences, exons or introns of primary transcripts, termed pri-miRNAs, generated mainly by RNA polymerase II [@pone.0027435-Bartel1]. In the nucleus, RNase III Drosha recognizes hairpin structures within the pri-miRNA and generates the precursor miRNA (pre-miR) of approx 60 nt length [@pone.0027435-Lee1]. Pre-miRs are exported from the nucleus and are further processed in the cytoplasm to the mature miRNA by the RNase III Dicer [@pone.0027435-Bernstein1]--[@pone.0027435-Hutvgner1]. Usually the sense (5p) strand of the mature miRNA is incorporated into the RNA-induced silencing complex (RISC), while the antisense (3p) strand is degraded [@pone.0027435-Schwarz1]--[@pone.0027435-Wang1]. In animals, complementary binding of miRNAs to their mRNA targets is mostly restricted to a 6--9 nt long seed region, which is located at the 5′ end of the miRNA. Recognition of PAMPs by PRRs of immune cells results in expression of distinct subsets of miRNAs. PRR-triggered miRNAs are thought to target and negatively regulate activated signalling cascade components. In particular, it has been proposed that miR-146a and miR-155 negatively regulate lipopolysaccharide (LPS)-induced TLR4 signalling in myeloid cells with NF-κB transcription factor involved in regulating miR-146a expression [@pone.0027435-Taganov1]--[@pone.0027435-OConnell1]. These miRNAs target protein-coding genes involved in receptor-induced signalling such as TNF receptor-associated factor 6 (TRAF6), IL-1 receptor-associated kinase (IRAK) 1 and IRAK2 by miR-146a [@pone.0027435-Taganov1], [@pone.0027435-Hou1], or Fas-associated death domain (FADD) and IκB kinase epsilon (IKKε) by miR-155 [@pone.0027435-Tili1], [@pone.0027435-Xiao1]. In addition, let-7e and miR-155 were found to target TLR4 and SOCS1, respectively, in response to LPS, regulated by Akt1 in macrophages [@pone.0027435-Androulidaki1]. In infection, miR-155 negatively regulates the epithelial cell response upon infection with Gram-negative bacterium *Helicobacter pylori* [@pone.0027435-Xiao1], while in macrophages infected with another Gram-negative bacterium *Francisella tularensis*, miR-155 expression resulted in enhanced pro-inflammatory response [@pone.0027435-Cremer1]. Similarly, infections with the protozoan parasite *Cryptosporidium parvum* in epithelial cells [@pone.0027435-Zhou1] or detection of heat-killed *Candida albicans* by macrophages [@pone.0027435-Monk1], lead to alterations of host miRNA profile, most likely involved in immunoregulation. Furthermore, analysis of the host miRNA profile upon *Salmonella Typhimurium* infection also identified the let-7 family of miRNAs as regulators of the inflammatory response in both epithelial cells and macrophages [@pone.0027435-Schulte1]. More recently, it was shown that miR-29 targets interferon (IFN)-γ production by natural killer (NK) cells, CD4+ T cells and CD8+ T cells during systemic infection with intracellular bacteria in mice [@pone.0027435-Ma1]. However, it is unclear whether infection with any Gram-positive intracellular bacteria can subvert the genome-wide miRNA profile of macrophages. To address this question, we employed the model pathogen *L. monocytogenes* and first determined whether the host genome-wide miRNA profile is altered upon infection of primary murine macrophages. We found that miR-155, miR-146a, miR-125a-3p/5p and miR-149 were amongst the most significantly regulated miRNAs in infected macrophages. To precisely dissect at which stage of infection and via which host pathways *Listeria* may promote induction of these miRNAs, we used genetically modified *L. monocytogenes* strains, to independently activate the extracellular/vacuolar response, and compare it to wild type *Listeria* that gain access to the cytosol and thus elicits both vacuolar and cytosolic immune responses in macrophages. To accurately identify the host pathways potentially involved in regulation of *Listeria*-induced miRNAs, we directly compared primary macrophages deficient for MyD88 (MyD88^−/−^), which transmits most TLR signals, or NF-κB p65 (p65^MYEL^ KO), which transcriptionally regulates the inflammatory response upon *Listeria* infection, to wild type cells. We have identified miR-155, miR-146a, miR-125a-3p/5p and miR-149 as highly responsive elements of the vacuolar host response, differentially regulated by inflammatory mediators in macrophages. Results {#s2} ======= *L. monocytogenes* infection in primary macrophages induces significant host miRNA expression {#s2a} --------------------------------------------------------------------------------------------- To determine the impact of *L. monocytogenes* infection in the global miRNA profile of macrophages, we performed parallel profiling of 585 miRNAs using TaqMan Rodent miRNA Arrays A and B (v2.0) on total RNA from bone marrow derived macrophages (BMDM) infected for 6 h with a calculated multiplicity of infection (MOI) 10 compared to non-infected cells, from three biological replicates. Using the Applied Biosystems (ABI) RQ Manager 1.2 and DataAssist v2.0 software for analyses, we comprehensively identified 385 miRNAs that were expressed in our samples, of which 13 were significantly (≥1.5 fold, *P* value≤0.05) up-regulated at 6 h post-infection (pi; [Table 1](#pone-0027435-t001){ref-type="table"} and [Figure S1](#pone.0027435.s001){ref-type="supplementary-material"}). Interestingly, *Listeria*-induced miRNAs included miR-155, miR-146a and miR-147, which are known modulators of the inflammatory response upon TLR ligation in macrophages [@pone.0027435-Taganov1]--[@pone.0027435-OConnell1], [@pone.0027435-Liu1]. Additionally, two recently described miRNAs with unknown function in infected macrophages, namely miR-125a-3p and miR-125a-5p, and a newly described miRNA, namely miR-149, were significantly up-regulated in *Listeria*-infected BMDMs. Surprisingly, no miRNAs were found to be significantly down-regulated in infected compared to non-infected macrophages ([Figure S1](#pone.0027435.s001){ref-type="supplementary-material"}). 10.1371/journal.pone.0027435.t001 ###### Significant miRNA expression upon *L. monocytogenes* infection in Bone Marrow Derived Macrophages. ![](pone.0027435.t001){#pone-0027435-t001-1} microRNA Fold change *P* value ----------------- ------------- ----------- *Array A* mmu-miR-146a 2.56 0.0005 mmu-miR-147 3.15 0.0011 mmu-miR-191 1.75 0.0073 mmu-miR-125a-5p 1.76 0.0096 mmu-miR-132 1.54 0.0101 mmu-miR-497 2.27 0.0225 mmu-miR-155 11.57 0.0146 mmu-miR-125a-3p 5.38 0.0263 mmu-miR-200c 2.31 0.0435 mmu-miR-139-5p 1.82 0.0489 *Array B* mmu-miR-455\* 3.2066 0.0166 mmu-miR-149 2.0487 0.0257 mmu-miR-29b\* 2.9698 0.025 Genome-wide profiling was performed by Taqman Rodent miRNA Arrays A and B v2.0 (ABI, Life Technologies). To validate the accuracy of our array results and study further the regulation of these miRNAs upon infection, we generated four new sets of experiments, each including: two timepoints of infection with two types of bacteria (MOI 10) in two different sorts of BMDMs. These samples were subsequently used to quantify miRNA expression by real time quantitative PCR (RT-qPCR) using Taqman assays. The results from these experiments validate that miR-155 and miR-125a-3p were significantly upregulated at 6 h pi by approximately 5-fold ([Figure 1A--B](#pone-0027435-g001){ref-type="fig"}). These two miRNAs represent the highest regulated among the five *Listeria*-induced miRNAs. At 6 h pi miR-146a, miR-125a-5p and miR-149 were significantly induced by 1.5--2.0 folds ([Figure 1C--E](#pone-0027435-g001){ref-type="fig"}). Interestingly, miR-125a-3p and miR-149 were also significantly up-regulated as early as 3 h pi ([Figure 1B and 1E](#pone-0027435-g001){ref-type="fig"}). Taken together, our miRNA-array and RT-qPCR data clearly demonstrate that *L. monocytogenes* subverts the host miRNA profile, causing specific miRNAs to be upregulated early upon infection in BMDMs. These results provide the first miRNA signature of a Gram-positive intracellular pathogen in murine primary macrophages. ![Regulation of *L. monocytogenes*-induced miRNAs in macrophages.\ Bone marrow derived macrophages (BMDMs) from wild type (WT; n = 4) and MyD88^−/−^ (n = 4) mice were infected (MOI 10) with *L. monocytogenes* (*Lm*) and the LLO-deficient mutant *Δhly* (*Lm Δhly*) for 3 h and 6 h. Total RNA was extracted and the expression levels of miR-155 (A), miR-146a (B), miR-125a-3p (C), miR-125a-5p (D) and miR-149 (E) were quantified by RT-qPCR using TaqMan miRNA assays. Data was normalized to the endogenous control sno202 and fold changes of miRNA expression relative to the non-infected control of its own genotype was calculated by the 2^−ΔΔCT^ method. Data represents the mean ± SEM from three to four biological replicates. Statistical significance of miRNA expression between infected and non infected WT BMDMs was determined by the Student *t*-test; \* *P*\<0.05; \*\* *P*\<0.01; \*\*\* *P*\<0.001. Statistical significance of miRNA induction in infection between WT and MyD88^−/−^ BMDMs was determined by two-way ANOVA test; \# *P*\<0.05, \#\# *P*\<0.01, \#\#\# *P*\<0.001.](pone.0027435.g001){#pone-0027435-g001} *L. monocytogenes* induced miRNA expression is LLO-independent {#s2b} -------------------------------------------------------------- Upon uptake by macrophages, *L. monocytogenes* is initially found within the phagosomal vacuole before escaping into the cytosol where it replicates. In parallel, a distinct set of genes is transcriptionally activated upon vacuolar *L. monocytogenes* infection, important for intracellular bacteria sensing [@pone.0027435-Leber1]. Destruction of the phagosomal membrane by *L. monocytogenes* is essential for *in vivo* bacterial virulence and is mediated by the pore-forming haemolysin Listeriolysin-O (LLO), encoded by the *hly* gene [@pone.0027435-Portnoy1]. Therefore, deletion of the gene encoding LLO (*Δhly*) renders this mutant unable to enter the host cell cytosol, avirulent and low in immunogenicity [@pone.0027435-Peters1]. In our study, we employed this mutant (*Δhly-Lm*) as a tool to investigate compartment-specific miRNA-induction in BMDMs at 3 h and 6 h pi, by which timepoints wild type *Lm* are already replicating in the host cytosol, in contrast to *Δhly-Lm* which remain confined in the phagosome ([Figure S2](#pone.0027435.s002){ref-type="supplementary-material"}). The intracellular growth of both types of bacteria in macrophages is illustrated in [Figure S3](#pone.0027435.s003){ref-type="supplementary-material"}. Strikingly, quantitative analyses of miR-155, miR-146a, miR-125a-3p, miR-125a-5p and miR-149 revealed that all five miRNAs were significantly upregulated by the vacuole-contained bacteria at both timepoints ([Figure 1A--E](#pone-0027435-g001){ref-type="fig"}). Our findings suggest that these miRNAs are induced in macrophages not only upon wild type/cytosolic *Listeria* infection but also upon vacuolar infection i.e. independent of bacterial virulence and access to the host cytosol. Vacuolar miRNA response to infection is MyD88-dependent {#s2c} ------------------------------------------------------- Downstream signalling of all TLRs (except of TLR3), IL-1 and IL-18 receptors depends on the adaptor molecule MyD88 [@pone.0027435-Kawai1]. In macrophages, the so-called vacuolar transcriptional response upon *L. monocytogenes* infection is MyD88-dependent, while escape of bacteria in the cytosol induces a MyD88-independent/cytosolic transcriptional response [@pone.0027435-McCaffrey1]--[@pone.0027435-Leber1], [@pone.0027435-ORiordan1]. To accurately demonstrate which type of host response regulates the *L. monocytogenes*-induced miRNA expression in primary macrophages, and further analyse the strong effect of *Δhly-Lm* infection on miRNA induction, we quantified changes in miRNA expression upon infection with wild type *Lm* or *Δhly-Lm* for 3 h and 6 h in MyD88^−/−^ compared to wild type (WT) BMDMs. Interestingly, expression of miR-155, miR-125a-3p, miR-146a and miR-149 was significantly reduced in MyD88^−/−^ compared to WT BMDMs upon infection with *Δhly*-*Lm* ([Figure 1A--C and 1E](#pone-0027435-g001){ref-type="fig"}, respectively). The effect of MyD88 ablation in miR-125a-5p induction was moderate ([Figure 1D](#pone-0027435-g001){ref-type="fig"}). These findings suggest that *L. monocytogenes* promotes a predominant vacuolar miRNA response that is MyD88-dependent. We additionally analysed BMDM culture supernatants from the same infections for tumour necrosis factor (TNF) production, a gene that represents induction of the vacuolar response upon *Listeria* infection in macrophages [@pone.0027435-Leber1]. In agreement to the published data, TNF production was induced upon wild type *Lm* and *Δhly-Lm* infection in WT BMDMs and completely abolished in MyD88^−/−^ BMDM ([Figure S4](#pone.0027435.s004){ref-type="supplementary-material"}), while bacterial uptake in cells of both genotypes was comparable ([Figure S5](#pone.0027435.s005){ref-type="supplementary-material"}). *L. monocytogenes* infection promotes upregulation of miRNA genes at transcriptional level {#s2d} ------------------------------------------------------------------------------------------ MiR-125a-3p and miR-125a-5p represent two opposing strands of the same primary transcript (pri-miR; [Figure S6](#pone.0027435.s006){ref-type="supplementary-material"}). Nevertheless, *Listeria*-induced expression levels of the two mature miRNAs varied between the two strands by 4.5-folds ([Figure 1B and 1D](#pone-0027435-g001){ref-type="fig"}) suggesting differential regulation upon infection. Regulation of mature miRNA expression can occur on the level of transcription as well as post-transcriptionally [@pone.0027435-Taganov1]--[@pone.0027435-OConnell1], [@pone.0027435-Davis1]. To determine whether *L. monocytogenes* regulates miRNA-125a-3p/5p expression in BMDMs at transcriptional level, we analysed the induction of pri-miR-125a, in parallel to pri-miR-146a, upon 3 h and 6 h pi with wild type *Lm* and *Δhly-Lm*. We found that pri-miR-125a and pri-miR-146a were both upregulated upon cytosolic and vacuolar infections, while pri-miR-125a induction was significantly augmented upon *Δhly-Lm* infection ([Figure 2](#pone-0027435-g002){ref-type="fig"}). Furthermore, we compared miRNA transcriptional regulation upon infection of MyD88^−/−^ and WT BMDMs and found that pri-miR-125a upregulation was significantly decreased in infected MyD88^−/−^ BMDM ([Figure 2A](#pone-0027435-g002){ref-type="fig"}) suggesting that MyD88 signalling is also required for the upregulation of the primary transcript upon infection, most likely upon immediate recognition of *Listeria* PAMPs extracellularly or in the phagosomal vacuole. In contrast, pri-miR-146a induction was unaffected in MyD88^−/−^ BMDMs compared to WT cells infected by either wild type *Lm* or *Δhly-Lm* ([Figure 2B](#pone-0027435-g002){ref-type="fig"}). Our findings suggest that *Listeria* infection in BMDMs regulates both miR-125a-3p/5p and miR-146a at transcriptional levels, the first in a vacuolar/MyD88-dependent manner and the latter in a MyD88-independent manner. ![*L. monocytogenes*-induced transcriptional regulation of miR-146a and miR-125a.\ Bone marrow derived macrophages (BMDMs) were infected (MOI 10) with *L. monocytogenes* (*Lm*) and the LLO-deficient mutant *Δhly* (*Lm Δhly*) for 3 h and 6 h. Total RNA was extracted and the expression levels of primary transcript (pri)-miR-125a (A) and pri-miR-146a (B) were quantified by RT-qPCR using TaqMan assays. Data was normalized to the endogenous control gene HPRT1 and fold changes of miRNA induction in infected compared to control cells of each genotype were calculated by the 2^−ΔΔCT^ method. Data represents the mean ± SEM from three biological replicates. Statistical significance of miRNA expression between infected and non infected WT BMDMs was determined by the Student *t*-test; \* *P*\<0.05, \*\* *P*\<0.01, \*\*\* *P*\<0.001. Statistical significance of miRNA induction in infection between WT and MyD88^−/−^ BMDMs was determined by two-way ANOVA test; \# *P*\<0.05, \#\# *P*\<0.01, \#\#\# *P*\<0.001.](pone.0027435.g002){#pone-0027435-g002} TLR2-mediates miR-125a-3p and miR-125a-5p upregulation in macrophages {#s2e} --------------------------------------------------------------------- Upon infection, *L. monocytogenes*-derived lipoteichonic acids [@pone.0027435-Travassos1] and lipoproteins [@pone.0027435-Machata1] are recognised by membrane-bound TLR2 receptors which transmit their signals via MyD88 [@pone.0027435-Seki1]. Activation of TLRs in immune cells results in expression of distinct subsets of miRNAs, including miR-146a [@pone.0027435-Taganov1] and miR-155 [@pone.0027435-OConnell1]. To investigate the response of miR-125a-3p and miR-125a-5p upon receptor-specific activation, we stimulated BMDMs with the TLR2 synthetic ligand Pam3CSK4. Interestingly, our results showed that miR-125a-3p and miR-125a-5p were significantly induced upon Pam3CSK4 treatment in BMDMs, providing the first evidence to support involvement of the TLR2 pathway in the induction of these two miRNAs ([Figure 3A--B](#pone-0027435-g003){ref-type="fig"}). Recently, miR-125a-3p and miRNA-125a-5p were reported to be moderately upregulated upon TLR4 ligation by LPS, a major component of the cell wall of Gram-negative bacteria, in BMDMs subjected to microarray analyses (*P* values of 0.095 and 0.066 respectively) [@pone.0027435-Monk1]. Unlike this study, we used ultra-pure LPS to prevent residual protein impurities influencing the induction attributed to TLR4-signalling, and found that miR-125a-3p and miR-125a-5p were both significantly upregulated upon specific TLR4 ligation (*P*\<0.01 and *P*\<0.001, respectively) similarly to miR-146a which served as positive control ([Figure 3A--C](#pone-0027435-g003){ref-type="fig"}). Most importantly, we compared TLR2- and TLR4-mediated upregulation of miR-125a-3p, miR-125a-5p and miR-146a in BMDMs from WT and MyD88^−/−^ mice, and could show that TLR2-mediated upregulation of all three miRNAs by Pam3CSK4 was significantly decreased in MyD88^−/−^ cells and thus was MyD88-dependent ([Figure 3A--C](#pone-0027435-g003){ref-type="fig"}). Compared to WT cells, MyD88^−/−^ BMDMs showed impaired TNF production upon stimulation with Pam3CSK4 and LPS ([Figure S2](#pone.0027435.s002){ref-type="supplementary-material"}). Notably, TLR4-mediated miRNA expression induced by LPS was not entirely MyD88-dependent, since for all three miRNAs, expression was slightly but not significantly reduced in MyD88^−/−^ compared to WT cells ([Figure 3A--C](#pone-0027435-g003){ref-type="fig"}). This is most likely due to the action of the adaptor protein TIR domain containing adaptor inducing interferon beta (TRIF) that transmits MyD88-independent TLR4 signals. Similarly, TLR2 and TLR4 activation led to upregulation of miR-125a and miR-146a primary transcripts in WT BMDMs, while induction of pri-miR-125a was MyD88-dependent ([Figure 3D--E](#pone-0027435-g003){ref-type="fig"}). These findings support that miR-125a-3p and miR-125a-5p are new members of the group of miRNAs that are induced upon TLR/MyD88-signalling and underline a role in the vacuolar response of macrophage to infection. ![Regulation of miR-125a-3p/5p and miR-146a expression upon TLR2 and TLR4 stimulation.\ Wild type (WT; n = 3) and MyD88^−/−^ (n = 2) mouse bone marrow derived macrophages (BMDMs) were treated with 1 µg/ml ultra-pure LPS or 2 µg/ml Pam3CSK4 for 6 h. Total RNA was extracted and miRNA expression levels were quantified by RT-qPCR using TaqMan miRNA assays. MiR-125a-3p (A), miR-125a-5p (B) and miR-146a (C) expression in MyD88^−/−^ BMDMs. Pri-miR-125a (D) and pri-miR-146a (E) expression upon TLR stimulation in WT and MyD88^−/−^ BMDMs. Data was normalized to sno202 or HPRT1, endogenous controls for miR or pri-miR expression, respectively, and fold changes were calculated by the 2^−ΔΔCT^ method and expressed relative to non-infected control of each genotype. Data represents the mean ± SEM of at least two biological replicates. Statistical significance of miR/pri-miR induction was determined by the Student *t*-test compared to non infected control (\* *P*\<0.05, \*\* *P*\<0.01, \*\*\* *P*\<0.001) or two-way ANOVA between WT and KO cells (\# *P*\<0.05, \#\# *P*\<0.01, \#\#\# *P*\<0.001).](pone.0027435.g003){#pone-0027435-g003} NF-κB p65 regulates miR-155, but not miR-125a-3p/5p and miR-146a, expression in response to *L. monocytogenes* or LPS {#s2f} --------------------------------------------------------------------------------------------------------------------- A potential mechanism for selectively regulating miRNA transcript levels upon infection is via nuclear transcription factors [@pone.0027435-Taganov1], [@pone.0027435-Zhou1], [@pone.0027435-Fazi1]. Activation of NF-κB transcription factors downstream of TLRs is crucial in coordinating the transcriptional response to infection, and various NF-κB subunit knock-out mice show increased susceptibility to *L. monocytogenes* infection [@pone.0027435-Caamao1]. Few studies report that miR-155 and miR-146a have active NF-κB binding sites in their promoter elements [@pone.0027435-Taganov1], [@pone.0027435-Gatto1], or their induction depends on signalling via the IκB kinase (IKK) complex [@pone.0027435-Cremer1]--[@pone.0027435-Monk1]. We hypothesised that NF-κB p65 is involved in regulating transcription of *L. monocytogenes*-induced miRNAs, and to accurately demonstrate its direct role we compared BMDMs from mice in which p65 is genetically ablated (p65^MYEL^ KO) to WT cells upon mild (MOI 1) infection with *L. monocytogenes* for 4 h or exposure to LPS for 4 h and 8 h. To corroborate the absence of functional p65 we first assessed the response of TNF, a p65-regulated gene. As expected, p65^MYEL^ KO BMDMs showed reduced TNF production upon infection or LPS treatment compared to WT cells ([Figure S7](#pone.0027435.s007){ref-type="supplementary-material"}). Similarly, miR-155, which possesses two active NF-κB binding sites in the BIC/miR-155 promoter region, was significantly reduced in p65^MYEL^ KO BMDMs compared to WT cells upon LPS treatment and *L. monocytogenes* infection ([Figure 4A and 4E](#pone-0027435-g004){ref-type="fig"}), suggesting the involvement of the canonical NF-κB pathway, and specifically of the p65 subunit. Surprisingly, miR-146a expression which was shown to be NF-κB p65 dependent upon LPS treatment in mouse embryonic fibroblasts [@pone.0027435-Sheedy1] was unaffected in p65^MYEL^ KO compared to WT BMDMs treated with LPS or infected with *L. monocytogenes* ([Figure 4B and 4E](#pone-0027435-g004){ref-type="fig"}). Similarly, miR-125a-3p and miRNA-125a-5p which are predicted to derive from exon1 of a non-coding RNA transcript on chromosome 17 (Ensembl: Ncrna 00085-003) that has several putative NF-κB binding sites in the pri-miR-125a promoter region, was unaffected by genetic ablation of p65 in infected or LPS treated BMDMs ([Figure 4C--E](#pone-0027435-g004){ref-type="fig"}). Furthermore, we specifically investigated the pri-miR-125a kinetics and found that only at 8 h after LPS exposure, its expression was significantly reduced in p65^MYEL^ KO compared to WT BMDMs ([Figure 4F](#pone-0027435-g004){ref-type="fig"}). Based on *in silico* analyses of the 1.5 kb region upstream of the pri-miR-125a transcriptional start site for transcription factor binding sites, using the Genomatix MatInspector software package, we found that apart of the two putative NF-κB p65 sites, there are also putative NF-κB p50 and IRF binding sites present in the promoter region ([Figure S6](#pone.0027435.s006){ref-type="supplementary-material"}). These results suggest that regulation of *L. monocytogenes*-induced pri-miR-125a may be propelled by NF-κB p50 or another transcription factor, which is also likely for miR-146a, while miR-155 transactivation upon *L. monocytogenes* infection and LPS treatment in BMDMs is predominately NF-κB p65 dependent. ![Regulation of miR-125a-3p/5p, miR-146a and miR-155 expression in macrophages by NF-κB p65.\ Wild type (WT) and p65^MYEL^ KO BMDMs were treated with 100 ng/ml ultra-pure LPS for 4 h and 8 h (A--D, F) or infected (MOI 1) with *L. monocytogenes* (*Lm*) for 4 h (E--F). Total RNA was extracted and the expression levels of miR-125a-3p, miR-125a-5p, miR-146a and miR-155 were quantified by TaqMan miRNA assays. Data was normalized to sno202 or HPRT1, endogenous controls for miR or pri-miR expression, respectively, and fold changes were calculated by the 2^−ΔΔCT^ method and expressed relative to the mock-treated/mock-infected control for each timepoint/condition in each genotype. Data represents the mean ± SEM of at least two independent experiments, including minimum two mice from each genotype. Statistical significance of miR/pri-miR induction between WT and p65^MYEL^ KO BMDMs was determined by two way ANOVA; \* *P*\<0.05, \*\* *P*\<0.01, \*\*\* *P*\<0.001.](pone.0027435.g004){#pone-0027435-g004} Discussion {#s3} ========== It is well established that miRNAs are important players of the post-transcriptional mechanism that regulates gene expression in many biological processes, including cell proliferation, differentiation, immunity and tumorigenesis. Host-pathogen interactions must be tightly controlled at all levels to prevent excessive inflammation and spread of infection. It is increasingly appreciated that miRNAs are important immunoregulators; however our knowledge on the role of miRNAs upon bacterial infection is far from comprehensive. Infection of macrophages with one of the best studied Gram positive intracellular pathogens *L. monocytogenes* initiates a sequence of responses at transcriptional and post-transcriptional levels which are vital for host survival. In this model, we first explored whether miRNAs are part of the anti-listerial immune response of macrophages. Our study reveals the *Listeria*-induced miRNA signature at 6 h pi in primary macrophages. Specifically, infection induced significant upregulation of 13 miRNAs, including miR-155, miR-146a, miR-125a-3p/5p and miR-149. To our knowledge, this is the first comprehensive profile of miRNA expression upon Gram-positive bacterial infection. Notably, at 6 h pi, we did not detect significantly downregulated miRNAs in infected BMDMs compared to non-infected control cells. To establish profound down-regulation of miRNAs, longer timepoints may need to be explored [@pone.0027435-Zhou1], [@pone.0027435-Schulte1]--[@pone.0027435-Ma1] though in that case, the contribution of cytokines and interferons produced by infected macrophages should also be considered when attributing the direct and indirect effects of bacterial infection on the host miRNA profile [@pone.0027435-OConnell1]. Our aim was to investigate potential miRNA induction linked to PRR activation which is vital for innate immune defence against intracellular pathogens. To validate our array data, we performed quantitative RT-PCR and confirmed that miR-155, miR-146a, miR-125a-3p/5p and miR-149 were significantly increased in macrophages upon early sensing of live bacteria, suggesting that these miRNA genes may be implicated in the inflammatory immune response. MiR-149 has not been characterised before in macrophages upon TLR activation, while miR-125a-3p/5p were only recently reported to be upregulated upon LPS treatment or heat-killed *C. albicans* infection, in monocytes [@pone.0027435-Bazzoni1] and macrophages [@pone.0027435-Monk1], respectively. MiR-155 and miR-146a are induced in different cell types upon viral, parasitic, fungal or Gram-negative bacterial infections as well as upon specific TLR ligation and are thought to modulate the inflammatory response [@pone.0027435-Taganov1]--[@pone.0027435-Schulte1], [@pone.0027435-Gatto1]. To determine how *L. monocytogenes* infection promotes host miRNA induction, we differentiated the phases of infection to vacuolar or cytosolic which are characterized by distinct transcriptional profiles in macrophages [@pone.0027435-McCaffrey1]--[@pone.0027435-Leber1]. To accomplish this, we employed two different types of *L. monocytogenes* EGDe bacteria, the wild type and its isogenic mutant *Δhly* [@pone.0027435-Peters1] which is confined to the phagosome and therefore does not induce cytosolic immune signalling. Interestingly, like wild type infection, vacuolar/*Δhly-Lm* infection caused significant upregulation of all five miRNAs, suggesting that the haemolytic action of LLO and therefore the cytosolic surveillance pathways are not implicated in the miRNA response of macrophages to infection. To investigate whether this response is regulated via the TLR signalling pathway and establish the effect of vacuolar infection to the host miRNA response, we compared miRNA induction between WT and MyD88^−/−^ BMDMs, upon *wt-Lm* and *Δhly-Lm* infections. Our data shows that miR-155, miR-125a-3p, miR-146a and miR-149 response is MyD88-dependent upon *Δhly-Lm* infection, suggesting that these miRNAs are among the early-response genes expressed in macrophages upon phagosomal detection of *Listeria* PAMPs. These data also provide the first evidence on miR-149 and miR-125a-3p regulation by MyD88. From all *Listeria*-induced miRNAs, we were particularly attracted to miRNA-125a-3p and miRNA-125a-5p, because they represent the two strands of the same miRNA duplex, and unlike their trend of induction upon LPS treatment or heat-killed *C. albicans* infection [@pone.0027435-Monk1], upregulation upon *Listeria* infection varied significantly between the two miRNA strands. *Listeria* promotes miR-125a gene expression upon MyD88 signalling at the transcriptional level which was comparable to the induction and regulation of the mature miR-125a-3p. In contrast, miR-125a-5p expression during both *wt-* and *Δhly-Lm* infections was moderately affected by MyD88 deletion in BMDMs. Based on the mechanism proposed by Schwarz et al. [@pone.0027435-Schwarz1], miRNA 3p and 5p strand accumulation depends on free energy properties of miRNA duplexes, and can be developmentally regulated in specific cell lineages [@pone.0027435-Kuchen1]. It is tempting to speculate that microbial infection may also influence the mechanisms that regulate mature miRNA abundance and strand stability in activated macrophages, providing an additional element to the proposed mechanism, perhaps depending on miRNA target abundance and the state of the infected cell. Furthermore, recent evidence on miRNA-125a-3p/5p in lung carcinoma suggests that the two strands exhibit opposing functions in regulating invasive and metastatic capabilities of lung cancer cells [@pone.0027435-Jiang1]. Although their role in infection is still unresolved, we clearly show that miR-125a-3p/5p, alongside miR-155 and miR-146a, are part of the early innate immune response of macrophages to *Listeria* infection. The majority of the targets for miR-155 and miR-146a are still unknown [@pone.0027435-Taganov1], [@pone.0027435-Hou1]--[@pone.0027435-Xiao1], [@pone.0027435-Cremer1], [@pone.0027435-Nahid1]--[@pone.0027435-Lu1], while the targets for miR-125a-3p/5p and miR-149 have not yet been explored. We carried out computational analyses by *TargetScanMouse 5.1* software as previously described [@pone.0027435-Zhou1], [@pone.0027435-Sethupathy1], and identified a variety of immune-related putative mRNA targets of all five *L. monocytogenes*-induced miRNAs ([Table S1](#pone.0027435.s009){ref-type="supplementary-material"}). MiR-125a-3p and miR-125a-5p potentially target the interleukin-1 receptor 1 (IL-1 R1), and the IL-6 receptor (IL-6 R), respectively. MiR-125a-5p shares the same 5′-UTR sequence (seed region) with miR-125b and may therefore target the same mRNAs. In murine macrophages, miR-125b was shown to be induced by LPS and to target TNFα [@pone.0027435-Tili1] and in H69 epithelial cells it was upregulated upon *C. parvum* infection via NF-κB [@pone.0027435-Zhou1]. However, miR-125b was not upregulated in our arrays, which is not surprising since the two miRNAs derive from transcripts located on different chromosomal locations, and are probably regulated differently in BMDMs infected with *L. monocytogenes* compared to other types of infection. The recognition of *Listeria* PAMPs by TLR2 in macrophages is well established [@pone.0027435-Travassos1]--[@pone.0027435-Seki1]. MiR-155 and miR-146a have been shown to be induced upon ligation of TLR2 and TLR4 [@pone.0027435-Taganov1]--[@pone.0027435-OConnell1]. In contrast, the role of TLR2 on miR-125a-3p/5p induction and regulation has not been recognised. We have demonstrated that miR-125a-3p/5p were upregulated upon TLR2 activation, which turned out to be MyD88-dependent. The TLR2-MyD88-dependent induction of miR-125a-3p/5p was found to be regulated at transcriptional levels. Furthermore, miR-125a-3p/5p were significantly upregulated upon LPS stimulation, although the requirement of MyD88 at both mature and primary-transcript levels was less evident, possibly due to involvement of TLR4-TRIF-mediated signalling, that is also induced upon LPS treatment in BMDMs [@pone.0027435-Sheedy1]. Recent evidence suggests that miR-125a-5p is involved in the atherosclerotic response of monocytes/macrophages since its expression was induced by ox-LDL stimulation of THP-1 cells while its down-regulation lead to reduced lipid uptake and inflammatory cytokine secretion, including IL-6, TNF- α, and TGF-β [@pone.0027435-Chen1]. Therefore, miR-125a gene is likely to have a broad role in modulating the inflammatory response of myeloid cells. A potential mechanism for selectively regulating miRNA transcript levels upon immune stimuli is via nuclear transcription factors [@pone.0027435-Zhou1], [@pone.0027435-Fazi1], [@pone.0027435-Marson1]. Promoter binding by NF-κB or pharmacological inhibition of IKK signalling was used previously to show regulation of miR-146a and miR-155 expression upon Gram-negative bacterial infections or LPS stimulation in several independent studies [@pone.0027435-Taganov1], [@pone.0027435-Cremer1], [@pone.0027435-Monk1], [@pone.0027435-Gatto1]--[@pone.0027435-Sheedy1]. Similarly, during *C. parvum* infection in epithelial cells several miRNA genes were activated upon NF-κB p65 binding to their promoter regions [@pone.0027435-Zhou1]. NF-κB p65 is a member of the NF- κB family of transcription factors, crucial for induction of proinflammatory gene transcription upon *Listeria* infection [@pone.0027435-Caamao1]. We used NF-κB p65 deficient BMDMs to investigate miR-125a-3p/5p regulation upon *L. monocytogenes* infection or LPS treatment, in parallel to miR-146a and miR-155. Unlike miR-155, miR-125a-3p/5p and miR-146a expression were unaffected in p65^MYEL^ KO compared to WT BMDMs infected with *L. monocytogenes* or treated with LPS. The expression of pri-miR-125a following LPS challenge, but not upon *L. monocytogenes* infection, was significantly decreased in p65^MYEL^ KO compared to WT BMDMs, which indicates a specific requirement for p65 in miR-125a-3p/5p gene transcription. In agreement to this observation, IKKβ was reported to play a role in miR-125a transcription upon fungal PAMP- or LPS-treated macrophages [@pone.0027435-Monk1] suggesting that NF-κB regulates miR-125a transcription in specific conditions and types of infection. Similarly, we observed increased TNF production upon *wt* and *Δhly-Lm* infections, which coincides with increased miR-155 expression, both of which were regulated by NF-κB p65. Perhaps *Listeria*-induced miR-155 is involved in regulating TNFα mRNA stability in BMDMs. Finally, infection with the Gram-negative bacterium *Francisella novicida*, but not *Francisella tularensis*, induced miR-155 expression in human monocytes [@pone.0027435-Cremer1]. Similarly to *F. novicida*, *L. monocytogenes Δhly* cannot escape from the phagosome in the cytoplasm of the host cell, unlike the virulent strain *F. tularensis* which led to a significantly lower miR-155 expression. Thus, it is possible that miR-155 is a common element of the host innate immune response to phagosome-confined bacteria following activation of TLR2/MyD88 signalling. In summary, our study reveals the first genome-wide *Listeria*-induced miRNA profile in primary murine macrophages. Our findings show significant upregulation of specific miRNAs upon infection. Most importantly, expression of these miRNAs was augmented during the vacuolar host response, in a MyD88-dependent manner, and differentially regulated by NF-κB p65, suggesting that they are part of the early innate immune response of macrophages to bacterial infection. The *Listeria*-induced miRNA signature is composed of the well established in immune regulation miR-155 and mR-146a, as well as the newly detected miR-149 and the miR-125a-3p/5p duplex, all of which are predicted to target important immune-related genes. Furthermore, this study signifies the miRNA host response upon Gram positive intracellular bacterial infection in macrophages providing new aspects of regulation in host-pathogen interactions, at post-transcriptional levels. Materials and Methods {#s4} ===================== Ethics Statement {#s4a} ---------------- All animal procedures were conducted in accordance with European (EU directive 86/609/EEC), national (TierSchG), and institutional guidelines and protocols of the University of Cologne, and were approved by local governmental authorities (Landesamt für Natur, Umwelt und Verbraucherschutz Nordrhein-Westfalen) under the licenses 8.87-50.10.45.08.219 and 8.87-50.10.37.09.242. BMDM primary cell culture {#s4b} ------------------------- BMDMs were isolated from the femurs and tibias of WT and KO C57BL/6 mice, 8--12 weeks old. After red blood cell lysis, cells were plated in RPMI supplemented with 10% FCS, 15% L929-conditioned medium as a source of the macrophage colony-stimulating factor (M-CSF), 100 units/ml penicillin and streptomycin, 2 mM glutamine, 1 mM sodium glutamate and HEPES. Cells were cultured for 7--8 days in bacterial dishes in a humidified incubator with 5% CO~2~ at 37°C and differentiated BMDMs were used for experiments on day 8--10. Over 95% of these cells were F4/80 and CD11b double positive as determined by FACS analyses ([Figure S8](#pone.0027435.s008){ref-type="supplementary-material"}). Reagents {#s4c} -------- Ultra-pure LPS from *E. coli* serotype EH100 (Ra) TLR-grade was obtained from Alexis Biochemicals and Pam3CSK4 was purchased from Invivogen. TNF production was measured in the culture supernatants using an ELISA kit (R&D Systems). TRITC-conjugated Phalloidin and goat anti-rabbit IgG FITC conjugates were purchased from SIGMA; polyclonal antibody against *L. monocytogenes* was purchased from Acris. Mmu-miRNA detection assays were obtained from Applied Biosystems (ABI, Life Technologies): sno202 (assay ID: TM 001232); miR-125a-3p (assay ID: TM 002199); miR-125a-5p (assay ID: TM 002198); miR-146a (assay ID: TM 000468); miR-149 (assay ID: TM 002255); miR-155 (assay ID: TM 002571); pri-mir-146a (Mm03306349); pri-mir-125a (Mm03306233); HPRT1(Mm01545399_m1). Mice {#s4d} ---- All mice were kept under specific pathogen-free conditions. WT C57BL/6 mice were purchased from Charles River. MyD88^−/−^ mice, on a C57BL/6 genetic background, were previously described by Adachi *et al.*, 1998 [@pone.0027435-Adachi1]. The C57BL/6 Mx1Cre mice were crossed with p65^FL/FL^ transgenic mice to generate p65^MYEL^ KO upon systemic administration of polyinosine-polycytidylic acid (polyI:C). Bacteria {#s4e} -------- *L. monocytogenes* EGDe wild-type, serotype 1/2a, and the isogenic deletion mutant *L. monocytogenes* EGDe *Δhly* [@pone.0027435-Peters1] were kindly provided by E. Domann and T. Chakraborty (Justus-Liebig-University, Giessen, Germany). Bacteria were grown from single colonies in BHI medium at 37°C with shaking, and were harvested during mid-log phase. Bacteria were washed three times in PBS and the optical density of the culture was measured at 600 nm to calculate the required inoculum for infections. Bacterial infections {#s4f} -------------------- One day prior to infection, BMDMs were seeded in cell culture dishes in complete RPMI medium without antibiotics. Cells were infected with normal mouse serum (NMS)-opsonised bacteria at a multiplicity of infection (MOI) of 1 or 10. At 30 min pi, non-infected control cells and infected cells were washed 4 times with PBS before the addition of fresh medium. Samples were taken at 3 h and 6 h pi. Additionally, at 1 h, 3 h and 6 h after infections in BMDMs, cells were lysed in 0.1% Triton-X100 in H2O. Serial dilutions (10^−2^--10^−6^) were plated on blood agar plates overnight and colony forming units were counted the next day, to determine the rate of bacterial growth. RNA isolation {#s4g} ------------- Total RNA from BMDMs was isolated with TRIzol according to the manufacturer\'s protocol (Invitrogen, Life Technologies). The quantity of total RNA was measured at the *NanoVue* spectrophotometer (GE Healthcare) and quality was determined by automated gel electrophoresis on the Experion system (Bio-Rad). Prior to pri-miR assays, RNA was DNase I-treated using the Ambion TURBO DNA-free kit (Ambion, Life Technologies). TaqMan Rodent miRNA Arrays {#s4h} -------------------------- TaqMan Rodent miRNA Arrays A and B (v2.0) were used for genome-wide profiling according to the Sanger miRBase v10, in non-infected and *L. monocytogenes*-infected BMDMs (6 h pi, MOI 10) from three independent experiments. Total RNA (800 ng) was reverse transcribed using miRNA-specific Megaplex RT Primer-Pools A and B with the TaqMan Reverse Transcription Kit (ABI, Life technologies). The respective RT reactions were distributed into the allocated ports of the preloaded miRNA Array cards A and B and Taqman was performed for profiling 585 miRNAs, including controls, according to the manufacturer\'s instructions, on an ABI 7900HT sequence detection system. ABI RQ Manager 1.2 and the DataAssist v2.0 software (Life Technologies) were used to analyse the data. Data was normalized to the endogenous controls mU6 and sno202, and miRNAs with a Ct value ≤35 were included in the analysis. MiRNA expression fold changes were calculated by the 2^−ΔΔCT^ method [@pone.0027435-Livak1], and Student *t*-test was performed to determine significance. MiRNAs with a fold change ≥1.5 and with a *P* value ≤0.05 were classified as significantly regulated. TaqMan pri- and miRNA assays {#s4i} ---------------------------- Mature miRNA expression was quantified using TaqMan microRNA assays (ABI, Life Technologies). Total RNA (10 ng) was reversed transcribed using miRNA specific primers and the TaqMan Reverse Transcription Kit (ABI, Life Technologies). TaqMan miRNA assays were performed on a Roche LC480 LightCycler, using the TaqMan Universal PCR Master Mix (ABI, Life Technologies) and analyzed with the LC480 analysis software (Roche). For quantification of pri-miR-miRNA levels, DNase I-treated total RNA (500 ng) was reverse transcribed using Invitrogen SuperScript II reverse transcriptase (Invitrogen, Life Technologies). The TaqMan pri-miR assays were performed according to the manufacturer\'s instructions (ABI, Life Technologies). Relative fold changes of gene expression were determined with the 2^−ΔΔCT^ method [@pone.0027435-Livak1]. Values were normalized to the endogenous controls, sno202 for mature miRNAs and Hypoxanthin-Guanin-Phophoribosyltransferase 1 (HPRT1) for pri-miRs. Statistical significance was determined by Student *t*-test or two-way ANOVA. Supporting Information {#s5} ====================== ###### ***L. monocytogenes*** **infection in primary macrophages induces significant host miRNA expression.** TaqMan Rodent miRNA Arrays A and B (v2.0) were used to profile 585 miRNAs, including controls, in non-infected and *L. monocytogenes*-infected BMDMs at 6 h, MOI 10, from three independent experiments. Total RNA (800 ng) was reverse transcribed using miRNA-specific Megaplex RT Primer-Pools A and B with the TaqMan Reverse Transcription Kit (Life Technologies). Data was normalized to the endogenous controls mU6 and sno202 using the ABI RQ Manager 1.2 and the DataAssist v2.0 software (Life Technologies). MiRNAs with a Ct value ≤35 were included in the analysis. Fold changes ≥1.5 calculated by 2^−ΔΔCT^ method, and *P* values≤0.05 determined by Student *t*-test, were used to identify significantly regulated miRNAs. (TIF) ###### Click here for additional data file. ###### **Immunofluorescence staining of macrophages infected with** ***L. monocytogenes*** **(** ***Lm*** **).** Bone marrow derived macrophages (BMDMs) were infected (MOI 10) with *Lm* (A and C) or the LLO-deficient mutant *Δhly* (B and D) for 3 h (A and B) and 6 h (C and D). Cells were fixed, permeabilized and stained with TRITC-phalloidin antibody against filamentous actin (red), anti-*Listeria* primary antibody with FITC-conjugated goat anti-rabbit secondary antibody, to detect bacteria (green). Cell nuclei were stained with DAPI (blue). Immunomicrographs were taken with a 40× objective. (TIF) ###### Click here for additional data file. ###### **Growth curves of** ***L. monocytogenes*** **(** ***Lm*** **) wild type (wt) and** ***Δhly*** **mutant in macrophages.** Cells were infected for 30 min and samples were collected at indicated timepoints post infection. Cells were lysed in 0.1% Triton-X100 in H2O and serial dilutions (10^−2^--10^−6^) were plated on blood agar plates overnight. Colony forming units were counted the next day and cfu/ml were plotted from 2--3 replicates. (TIF) ###### Click here for additional data file. ###### **TNF production in wild type (WT) and MyD88^−/−^ primary macrophages.** Cells were treated for 6 h with 2 µg/ml Pam3CSK4 or 1 µg/ml LPS; or infected (MOI 10) for 3 h and 6 h with *L. monocytogenes* (*Lm*) or the LLO-deficient mutant *Δhly* (*Lm Δhly*). TNF (pg/ml) production was measured in the culture supernatant collected from 1×10^6^ cells/ml by ELISA. Data represents the mean values ± SEM from two biological replicates. (TIF) ###### Click here for additional data file. ###### **Immunofluorescence staining of macrophages infected with** ***L. monocytogenes*** **(** ***Lm*** **).** Wild type (WT; A and C) or MyD88^−/−^ (B and D) bone marrow derived macrophages (BMDMs) were infected with *Lm* MOI 10, for 3 h (A and B) or 6 h (C and D). Cells were then fixed, permeabilized and stained with TRITC-phalloidin antibody against filamentous actin (red), anti-*Listeria* primary antibody with FITC-conjugated goat anti-rabbit secondary antibody, to detect bacteria (green). Cell nuclei were stained with DAPI (blue). Immunomicrographs were taken with a 40× objective. (TIF) ###### Click here for additional data file. ###### **Schematic diagram of miR-125a genomic locus on mouse chromosome 17.** Putative binding sites of NF-κB and IRF3/7 are shown (boxes) within the 1.5 kb upstream region of the pri-miR-125a transcriptional start site. Pre-miR-125a matures in the cytoplasm giving rise to mature miR-125a-5p and miR-125a-3p. (TIF) ###### Click here for additional data file. ###### **TNF production in wild type and p65^MYEL^KO macrophages.** WT (n = 2) and p65^MYEL^KO (n = 2) bone marrow derived macrophages (BMDMs) were infected with *L. monocytogenes* (*Lm*) MOI 1 for 4 h, or treated with 100 ng/ml LPS for 4 h and 8 h. TNF (pg/ml) production was measured in the culture supernatant collected from 1×10^6^ cells/ml by ELISA. Data represents the mean values ± SEM from one experiment. (TIF) ###### Click here for additional data file. ###### **Characterisation of differentiated bone marrow derived macrophages (BMDMs) by FACS.** BMDMs from days 7--8 of differentiation were stained with F4/80 (eBiosciences) and/or CD11b (BD) antibodies and analysed at the FACS Calibur. Quadrant statistics was performed using Cell Quest (BD). (TIF) ###### Click here for additional data file. ###### **Predicted and confirmed miRNA targets selected on the basis of their potential or known involvement in the anti-bacterial immune response of macrophages.** Putative targets were predicted using TargetScan 5.1. Confirmed targets were selected from the cited studies. (DOCX) ###### Click here for additional data file. **Competing Interests:**The authors have declared that no competing interests exist. **Funding:**This work was supported by funds from the University of Cologne. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. [^1]: Conceived and designed the experiments: NP. Performed the experiments: AKDS AM. Analyzed the data: AKDS RUM NP. Contributed reagents/materials/analysis tools: AA MP BS MK RM. Wrote the paper: NP.
Dandruff, also known as scruff, is due to excessive shedding of dead skin cells from the scalp. It is quite normal for the skin cells of the scalp to die and flake off. A normal quantity of skin flaking is quite natural, but when the flaking becomes excessive due to some irritation or some skin allergy then it needs attention. There is no convincing reason yet whether some foods like sugar or yeast or excessive perspiration can cause or increase dandruff. If you have some fungal infection, that can cause dandruff or flaking of the skin. Another cause of dandruff could be cold weather, cold weather makes the skin dry and causes it to flake and shed which in turn causes dandruff. Some kind of food allergy can also be a cause of dandruff. Even nutritional deficiency can be one of the major causes of dandruff. Deficiency of B-complex vitamins or omega 3 fatty acids and other such vitamins can also cause flaking of the skin. Excessive use of hair gels, hair sprays or other chemicals such as hair coloring chemicals can also cause roughness of the scalp and cause it to shed skin. Dandruff Cure How to get rid of dandruff? There are a lot of ways to treat dandruff. It can be controlled and prevented from increasing. Dandruff cure could be categorized as follows: External dandruff treatment: External treatment includes using anti-dandruff shampoos or using anti-fungal shampoos. Even massaging the scalp with certain specific oils can help reduce the flaking of the scalp. Nutritional dandruff treatment: Nutritional treatment includes eating good nutritious food. An intake of lot of liquids to keep your skin supple helps. Eating a lot of fruits and juices and eating a balanced diet helps in avoiding the occurrence of dandruff. Take a proper sleep of 7-8 hours. All the above methods help in treating dandruff to some extent. Having food rich in B-complex would also help. Avoiding excess of salt, sugar and alcohol also helps. Relaxation dandruff treatment: Treatments like meditation and yoga help the body and mind to relax which in turn leads to reduction of stress. By reducing stress also we could control the skin from flaking. Allopathic dandruff treatment: Then there are certain allopathic treatments for the cure of dandruff. By consulting a skin specialist or a physician you could take certain oral medicines and drugs which could help treat dandruff. Naturopathy dandruff treatments: Various home made natural treatments are available for curing dandruff. These can be easily done at home and help keep dandruff at bay when done at regular intervals.
Save Search Search Name Send Email Alerts No Yes Frequency Immediately Daily Weekly Monthly Please Note To make sure we provide information you are interested in, when you're interested in it, if there are stretches of updates you don't open, we'll automatically decrease the frequency of the updates you receive. If you like the updates, you just need to open them to keep receiving them. You already have a saved search with that name. If you save, you will overwrite the existing saved search. Are you sure? 617 Brady Way, Batavia, IL 60510 Tip: You can click and drag or swipe the photos and thumbnails back and forth. $475,995  BEDS 4  BATHS 3.5  SQFT 3,609  $/SQFT $131 Active MLS # 10135189, Listed by New Home Star of Chicago, LLC 617 Brady Way is a $475,995, 3,609 square foot, 4 bedroom, 3.5 bath home located in Batavia, IL. Seller’s Description OFFERING AS A TO BE BUILT OPTION! New PROPOSED construction by the #1 Luxury Home Builder in America, Toll Brothers. This stunning Hopewell Brougham floor plan features a soaring 2-story foyer and vaulted family room, spacious gourmet kitchen with large center island, walk-in pantry, and breakfast area! Over-sized master suite with with private den and colossal his and her walk-in closets. 9-foot ceilings on the 1st AND 2nd floor creates an open and airy floorplan with dual staircases perfect for entertaining. Located in the prestigious community Tanglewood Hills. Experience resort style living with a pool, clubhouse, tennis courts, and walking trails! Top rated Batavia School District and elementary school is located in the community. Visit our model home today to learn about how easy it is to build your dream home with Toll Brothers! The accuracy of all information, regardless of source, including but not limited to square footages and lot sizes, is deemed reliable but not guaranteed and should be personally verified through personal inspection by and/or with the appropriate professionals. Listings marked with the Broker Reciprocity icon (above) are provided courtesy of Midwest Real Estate Data, LLC. Broker Reciprocity Database. NOTICE: Many homes contain recording devices, and buyers should be aware they may be recorded during a showing. Permenantly Hide Are you sure you want to permanently hide this property? This can’t be undone. Don’t ask me again Email This Listing From First Name Last Name Email Address To Name Email Address Email Subject Email Contents Check out this property I found on Z Team (Z Team of Goodwill Realty Group): http://www.nobshomesearch.com/homes/617-brady-way-batavia-il-60510/29848478 characters remaining Receive a copy Yes No Get Email Alerts Notify me when this property's price or status changes. Information Request Your request for more information has been received. Update Your Profile? It looks like you changed your contact information. Would you like to update your profile to reflect this new contact information for future use? Create Account? You&rsqup;ve already entered all the information we need to create you a free account. Do you want an account to be created for you automatically?
include(TestingMacros) add_regression_test(sapt3 "psi;sapt;cart")
--- abstract: 'Let $p \geq 2$ be a prime, and ${{\mathbb F}}_p$ be the field with $p$ elements. Extending a result of Seidel for $p=2,$ we construct an isomorphism between the Floer cohomology of an exact or Hamiltonian symplectomorphism $\phi,$ with ${{\mathbb F}}_p$ coefficients, and the ${{\mathbb{Z}}}/(p)$-equivariant Tate Floer cohomology of its $p$-th power $\phi^p.$ The construction involves a Kaledin-type quasi-Frobenius map, as well as a ${{\mathbb{Z}}}/(p)$-equivariant pants product: an equivariant operation with $p$ inputs and $1$ output. Our method of proof involves a spectral sequence for the action filtration, and a local ${{\mathbb{Z}/p\mathbb{Z}}}$-equivariant coproduct providing an inverse on the $E^2$-page. This strategy has the advantage of accurately describing the effect of the isomorphism on filtration levels. We describe applications to the symplectic mapping class group, as well as develop Smith theory for persistence modules of Hamiltonian diffeomorphisms on symplectically aspherical symplectic manifolds. We illustrate the latter by giving a new proof of the celebrated no-torsion theorem of Polterovich. Along the way, we prove a sharpening of the classical Smith inequality for actions of ${{\mathbb{Z}/p\mathbb{Z}}}.$' author: - 'Egor Shelukhin, Jingyu Zhao' title: | The ${{\mathbb{Z}}}/(p)$-equivariant product-isomorphism\ in fixed point Floer cohomology --- Introduction ============ Equivariant cohomology with respect to the action of the cyclic group of order $p,$ and the resulting Smith-type inequalities (see [@Hsiang-Transformation; @Borel-Transformation; @Bredon-Transformation] for the classical theory) have been obtained and used to great effect in various Floer theories in recent years, see for example [@Hend; @Hendricksetal; @Seidel; @SeidelSmith; @ManolescuLidman; @TreumannLipshitz]. In the case of symplectic fixed point Floer cohomology $HF^*(\phi)$ of a symplectic automorphism $\phi$ of a Liouville manifold, and the ${{\mathbb{Z}}}/2{{\mathbb{Z}}}$-equivariant cohomology of its second iterate $\phi^2,$ it was most recently studied by Seidel by means of a remarkable cohomological operation coming from the ${{\mathbb{Z}}}/2{{\mathbb{Z}}}$ symmetry of the pair of pants with boundary conditions given by $\phi$ on the two input cylinders, and by $\phi^2$ on its output cylinder. In particular, he proves, under suitable assumptions that the analogue of the Smith inequality $$\label{eqn:Smith_ineq} \dim_{{{\mathbb{F}}}_2} HF^*(\phi) \leq \dim_{{{\mathbb{F}}}_2} HF^*(\phi^2)^{{{\mathbb{Z}}}/2{{\mathbb{Z}}}} \leq \dim_{{{\mathbb{F}}}_2} HF^*(\phi^2)$$ holds true for fixed point Floer cohomology. In this paper, we extend the work of Seidel to all primes $p \geq 2,$ to fixed point Floer cohomology in an action window $I = (a,b),$ where $a<b$ are generic values in ${{\mathbb{R}}}\cup \{\pm \infty \},$ and to local Floer cohomology. In the latter case, a Smith-type inequality was obtained by more elementary methods in [@CineliGinzburg] during the preparation of this paper. We note that the case of action windows, and of local Floer homology, is of interest already for Hamiltonian diffeomorphisms of symplectically aspherical symplectic manifolds. We record a sample application. Let $\phi$ be a Hamiltonian diffeomorphism of a symplectically aspherical symplectic manifold, and $\phi^p$ its $p$-th iterate. Assume that $p\cdot a,p \cdot b$ are not critical values of the Hamiltonian action functional corresponding to $\phi^p$ and the free homotopy class of contractible loops. Then the Floer cohomology of $\phi$ in interval $I = (a,b)$ and that of $\phi^p$ in interval $p\cdot I = (p\cdot a,p\cdot b)$ are related by the following Smith-type inequality: $$\label{eq: Smith in interval} \dim_{{{\mathbb{F}}}_p} HF^*(\phi)^{I} \leq \dim_{{{\mathbb{F}}}_p} (HF^*(\phi^p)^{p\cdot I})^{{{\mathbb{Z}/p\mathbb{Z}}}} \leq \dim_{{{\mathbb{F}}}_p} HF^*(\phi^p)^{p\cdot I}.$$ We remark that these cohomology groups are defined by perturbing $\phi$ by a sufficiently $C^2$-small Hamiltonian diffeomorphism to $\phi_1,$ and using the fact that the endpoints of the interval are not in the spectrum. In this case, we can choose a perturbation $\phi_1$ so that $\phi_1^p$ is a sufficiently $C^2$-small Hamiltonian perturbation of $\phi^p.$ There are two essentially immediate consequences of the above Smith-type inequalities and . Similarly to the results obtained by Hendricks [@Hend] and Seidel [@Seidel] in the case of $p=2$, one first obtains the following corollary, that is proven as Corollary \[app:MCG\] below, for the $p$-th iterates of $\phi$ in the symplectic mapping class group.\ Given an exact symplectic manifold $W$ which is cylindrical at infinity, and a compactly supported exact symplectomorphism $\phi,$ if $\dim_{{{\mathbb{F}}}_p} HF^*(\phi) > \dim_{{{\mathbb{F}}}_p} H^*(W),$ then $[\phi^{p^k}] \neq 1$ in the symplectic mapping class group of $W$ for all $k\geq 0.$ Furthermore, with the help of the action-filtered version of the Smith-type inequality , we also provide a new proof of a well-known theorem of Polterovich [@Polterovich-groups], stating that the group of Hamiltonian diffeomorphisms of a closed symplectically aspherical symplectic manifold contains no non-trivial torsion elements.\ Let $\phi \in \operatorname{\mathrm{Ham}}(M,{\omega})$ be a Hamiltonian diffeomorphism of a symplectically aspherical symplectic manifold, such that $\phi^k = 1$ for some $k \in {{\mathbb{Z}}}_{>1}.$ Then $\phi = {{\mathrm{id}}}.$ To prove our main theorem, we use a cohomological operation coming from a branched cover of a cylinder with $p$ inputs and $1$ output, and its ${{\mathbb{Z}/p\mathbb{Z}}}$-symmetry, as in [@Seidel] for $p=2.$ However, showing that this ${{\mathbb{Z}/p\mathbb{Z}}}$-equivariant product map is an isomorphism on the associated Tate cohomology groups requires substantially more complicated tools. Indeed, while for $p=2$ the local contributions can be deduced from a few special cases, including the period-doubling bifurcation, as discussed in [@Seidel Section 6], for $p>2$ a more refined approach was found to be necessary. We proceed by providing a local inverse map for the product in terms of an equivariant coproduct operation with $1$ input and $p$ outputs, in the spirit of [@Seidel Remark 6.10]. It is curious to note that the classical Wilson theorem from number theory ultimately plays an important role in the calculation leading to local invertibility. The local-to-global argument then proceeds by the use of the action-filtration spectral sequence. We record our main result, from which inequality follows purely algebraically. In fact a stronger inequality follows (see Remark \[rmk: sharp Smith\]). We refer to the Sections below, for a detailed definition of all the notions involved in it. \[thm: main\] Let $\phi$ be an exact symplectic automorphism of a Liouville domain, or a Hamiltonian diffeomorphism of a closed symplectically aspherical symplectic manifold. For a generic interval $I = (a,b)$ with $a<b,$ $a,b \in {{\mathbb{R}}}\cup \{\pm \infty\},$ and a prime $p \geq 2,$ working with coefficients in ${{\mathbb{F}}}_p,$ there exists a quasi-Frobenius isomorphism of Tate cohomology groups $$F: {\widehat{H}}^*({{\mathbb{Z}/p\mathbb{Z}}}, HF^*(\phi)^I)^{(1)} \to {\widehat{H}}^*({{\mathbb{Z}/p\mathbb{Z}}}, (CF^*(\phi)^{\otimes p}))^{p\cdot I}$$ and a natural map between ${{\mathbb{Z}/p\mathbb{Z}}}$ group cohomology and the ${{\mathbb{Z}/p\mathbb{Z}}}$-equivariant Floer cohomology group $${\mathcal{P}}: H^*({{\mathbb{Z}/p\mathbb{Z}}}, (CF^*(\phi)^{\otimes p}))^{p\cdot I} \to HF^*_{{{\mathbb{Z}/p\mathbb{Z}}}}(\phi^p)^{p\cdot I}$$ that becomes an isomorphism of Tate cohomology groups $${\mathcal{P}}: {\widehat{H}}^*({{\mathbb{Z}/p\mathbb{Z}}}, (CF^*(\phi)^{\otimes p}))^{p\cdot I} \to {\widehat{HF}}^*_{{{\mathbb{Z}/p\mathbb{Z}}}}(\phi^p)^{p\cdot I}$$ after tensoring with ${{\mathbb{F}}}_p((u))$ over ${{\mathbb{F}}}_p[[u]].$ Here $${\widehat{H}}^*({{\mathbb{Z}/p\mathbb{Z}}}, HF^*(\phi)^I)^{(1)} \cong HF^*(\phi)^I \otimes_{{{\mathbb{F}}}_p} {{\mathbb{F}}}_p((u))\left< \theta \right>,$$ where $u$ and $\theta$ are formal variables, which can be thought to be of degree $2$ and $1$, ${{\mathbb{F}}}_p((u)) = {{\mathbb{F}}}_p[u^{-1},u]]$ denotes the formal Laurent power series in $u,$ and $\left< \theta \right>$ denotes an exterior algebra on $\theta,$ and the superscript $^{(1)}$ denotes the Tate twist. We observe that the composition $${\mathcal{P}}\circ F: HF^*(\phi)^I \otimes_{{{\mathbb{F}}}_p} {{\mathbb{F}}}_p((u))\left< \theta \right> \to {\widehat{HF}}^*_{{{\mathbb{Z}/p\mathbb{Z}}}}(\phi^p)^{p\cdot I}$$ is in particular an isomorphism of ${{\mathbb{F}}}_p((u))$ vector spaces. Studying their dimensions, we deduce . Since the case of $p=2$ amounts essentially to a repetition, with perhaps a very slight extension, of results of [@Seidel], for brevity we omit the discussion of this case. However we note that the methods used in this paper do apply for $p=2,$ and we obtain a slightly stronger result, in view of the inequality . We add that a generalization of a part of the results of this paper to the monotone case, as well as further applications to dynamics, are forthcoming. Acknowledgements {#acknowledgements .unnumbered} ================ We thank Mohammed Abouzaid, Viktor Ginzburg, Basak Gürel, Kristen Hendricks, Paul Seidel, Leonid Polterovich, and Dingyu Yang, for very useful discussions. Part of this project was carried out while both authors were postdoctoral members at the Institute for Advanced Study, supported by NSF grant No. DMS-1128155. We thank the IAS for a great research atmosphere. At the University of Montréal E.S. was supported by an NSERC Discovery Grant and by the Fonds de recherche du Québec - Nature et technologies. At Harvard CMSA, J.Z. was supported by the Simons Foundation grant $\#385573$, Simons Collaboration on Homological Mirror Symmetry. Group cohomology and Tate cohomology {#sec: group_coho} ==================================== Morse functions on classifying spaces {#sec:Morse} ===================================== Fixed point Floer cohomology {#sec:Floer_coho} ============================ The ${{\mathbb{Z}/p\mathbb{Z}}}$-equivariant Floer cohomology {#sec:equiv-Floer-coho} ============================================================= ${{\mathbb{Z}/p\mathbb{Z}}}$-equivariant pants product and coproduct {#sec:prod-coprod} ==================================================================== Local Floer cohomology and the action filtration {#sec:local-FH} ================================================ The local coproduct-product is invertible {#sec:locally invertible} ========================================= Applications and discussion =========================== First, in the exact case, we prove the following version of the Smith inequality for fixed point Floer cohomology, extending the work of Seidel to prime orders $p>2.$ \[thm: Smith exact\] Let $\phi$ be an exact symplectomorphism of a Liouville domain $W,$ cylindrical at infinity. Then the ranks of its fixed point Floer cohomology, and that of its $p$-th iterate $\phi^p$ satisfy the following inequality: $$\dim_{{{\mathbb{F}}}_p} HF^*(\phi) \leq \dim_{{{\mathbb{F}}}_p} HF^*(\phi^p)^{{{\mathbb{Z}/p\mathbb{Z}}}} \leq \dim_{{{\mathbb{F}}}_p} HF^*(\phi^p).$$ Observe that by the main result, Theorem \[thm: main\], we obtain $$2 \dim_{{{\mathbb{F}}}_p} HF^*(\phi) = \dim_{{{\mathbb{K}}}((u))} {\widehat{H}}^*({{\mathbb{Z}/p\mathbb{Z}}}, HF^*(\phi))^{(1)} = \dim_{{{\mathbb{K}}}((u))} {\widehat{H}}^*_{{{\mathbb{Z}/p\mathbb{Z}}}}(\phi^p).$$ However by estimate the latter dimension satisfies $$\dim_{{{\mathbb{K}}}((u))} {\widehat{H}}^*_{{{\mathbb{Z}/p\mathbb{Z}}}}(\phi^p) \leq \dim_{{{\mathbb{K}}}((u))} {\widehat{H}}^*({{\mathbb{Z}/p\mathbb{Z}}}, HF^*(\phi^p)),$$ whence we obtain the bound $$\label{eq: summary bound}2 \dim_{{{\mathbb{F}}}_p} HF^*(\phi) \leq \dim_{{{\mathbb{K}}}((u))} {\widehat{H}}^*({{\mathbb{Z}/p\mathbb{Z}}}, HF^*(\phi^p))$$ By the structure theorem for modules over PID, and the observation that ${{\mathbb{K}}}[{{\mathbb{Z}/p\mathbb{Z}}}] \cong {{\mathbb{K}}}[t]/\left<t^p\right>,$ we have that $HF^*(\phi^p),$ as a ${{\mathbb{K}}}[{{\mathbb{Z}/p\mathbb{Z}}}]$-module, splits into a direct sum $$HF^*(\phi^p) = \bigoplus_{0 \leq k \leq p} ({{\mathbb{K}}}[t]/\left<t^k\right>)^{\oplus m_k},$$ for multiplicities $m_k \geq 0.$ It is easy to calculate that $$\dim_{{{\mathbb{K}}}((u))} {\widehat{H}}^*({{\mathbb{Z}/p\mathbb{Z}}}, HF^*(\phi^p)) = 2 (m_0 + \ldots + m_{p-1}),$$ while $2 \dim_{{{\mathbb{F}}}_p} HF^*(\phi^p)^{{{\mathbb{Z}/p\mathbb{Z}}}} =2 (m_0 + \ldots + m_{p-1} + m_p).$ \[rmk: sharp Smith\] Note that if $m_p > 0,$ then the bound is strictly stronger than the classical Smith inequality. We observe that the algebraic methods used in the proof of this bound work in the classical setting of the Smith inequality (see [@Borel-Transformation; @Bredon-Transformation; @Hsiang-Transformation]), for example when the space in question is a finite $CW$ complex, and provide a sharpening thereof. We have not found this sharper version in the literature. Of course in the classical setting, quite a lot more than the Smith inequality is known by now. For example, the cohomology of the fixed point set of a ${{\mathbb{Z}/p\mathbb{Z}}}$-action was completely described in terms the associated equivariant cohomology, as a module over both ${{R_p}}$ and the Steenrod algebra [@Smith-revisited]. It would be very interesting to find an analogue of the latter result in Floer theory. \[app:MCG\] In particular, if $\dim_{{{\mathbb{F}}}_p} HF^*(\phi) > \dim_{{{\mathbb{F}}}_p} H^*(W)$ then $[\phi^{p^k}] \neq 1$ in the symplectic mapping class group of $W$ for all $k\geq 0.$ This corollary is immediate, since $HF^*({{\mathrm{id}}}) \cong HF^*(W)$ and $HF^*(\phi)$ is invariant under isotopies of exact symplectomorphisms of $W$ cylindrical at infinity. Furthermore, iterating the inequality of Theorem \[thm: Smith exact\] we obtain that $\dim_{{{\mathbb{F}}}_p} HF^*(\phi^{p^k})$ is a non-decreasing function of $k \in {{\mathbb{Z}}}_{\geq 0}.$ Furthermore, in both the exact and the symplectically aspherical setting, denoting for an open interval $I \subset {{\mathbb{R}}},$ of the form $(a,b),$ $a,b \in {{\mathbb{R}}},$ or $(-\infty,b),$ $b \in {{\mathbb{R}}},$ by $$HF^*(\phi)^I$$ the cohomology of the subcomplex generated by points of action value in $I,$ and by $k \cdot I$ for $k>0,$ the interval $(ka, kb)$ in the first case and $(-\infty, kb)$ in the second case, we obtain the following sharpening of Theorem \[thm: Smith exact\]. We always assume that the finite endpoints of an interval are not in the spectrum of the associated Hamiltonian diffeomorphism. We note that it is interesting for Hamiltonian diffeomorphisms on symplectically aspherical symplectic manifolds, even though the total cohomology is trivial, in the sense that in this case $HF^*(\phi) \cong HF^*({{\mathrm{id}}}) \cong H^*(M)$ for all $\phi \in \operatorname{\mathrm{Ham}}(M,{\omega}).$ \[thm: Smith exact filtered\] Let $\phi$ be an exact symplectomorphism of a Liouville domain $W,$ cylindrical at infinity or a Hamiltonian diffeomorphism of a closed symplectically aspherical symplectic manifold. Then the ranks of its fixed point Floer cohomology in action window $I,$ and that of its $p$-th iterate $\phi^p$ in action window $p\cdot I$ satisfy the following inequality: $$\dim_{{{\mathbb{F}}}_p} HF^*(\phi)^I \leq \dim_{{{\mathbb{F}}}_p} (HF^*(\phi^p)^{p\cdot I})^{{{\mathbb{Z}/p\mathbb{Z}}}} \leq \dim_{{{\mathbb{F}}}_p} HF^*(\phi^p)^{p \cdot I}.$$ We remark that this inequality is invariant with respect to shifts of the relevant action functionals, and therefore makes sense independently of them. In both settings, we can consider the system $(HF^*(\phi)^{<t}, \pi^{s,t})$ where $t \in {{\mathbb{R}}},$ $s \leq t,$ and $HF^*(\phi)^{<t} : = HF^*(\phi)^{(-\infty,t)},$ while $\pi^{s,t}: HF^*(\phi)^{<s} \to HF^*(\phi)^{<t}$ is the map induced by inclusions. In case $\phi$ is non-degenerate, it was observed in [@PolterovichS] that this system is a persistence module with certain additional constructibility properties. It therefore has an associated finite barcode, determined uniquely up to permutation: a finite multiset ${\mathcal{B}}(\phi) = \{(I_j,m_j)\}$ of itervals of the form $I_j = (a_j, b_j]$ or $(a_j, \infty),$ and multiplicities $m_j \in {{\mathbb{Z}}}_{>0}.$ One of the properties of such barcodes is that $$\dim HF^*(\phi)^{(-\infty, t)} = \displaystyle \sum_{t \in I_j} m_j,$$ $$\dim HF^*(\phi)^{(a,b)} =\displaystyle \sum_{b \in I_j, a \notin I_j} m_j.$$ Furthermore, as an application, Theorem \[thm: Smith exact filtered\], gives a new proof of a celebrated “no-torsion” theorem of Polterovich for the Hamiltonian group of closed symplectically aspherical manifolds. Further applications to Hamiltonian dynamics are forthcoming. We normalize actions in such a way that the barcode of ${{\mathrm{id}}}$ consists of $\dim HF^*(\phi)$ infinite bars starting at $0.$ In the closed symplectically aspherical case this is ensured by requiring that the Hamiltonian $H \in {\mathcal{H}}$ generating $\phi$ have zero mean over $M$ for all $t \in [0,1].$ Let $\phi \in \operatorname{\mathrm{Ham}}(M,{\omega})$ be a Hamiltonian diffeomorphism of a symplectically aspherical symplectic manifold, such that $\phi^k = 1$ for some $k \in {{\mathbb{Z}}}_{>1}.$ Then $\phi = {{\mathrm{id}}}.$ Our new proof proceeds as follows. Let $p$ be a prime dividing $k.$ Then $\phi_1 = \phi^{k/p}$ satisfies $\phi_1^p = {{\mathrm{id}}}.$ By induction it is therefore enough to prove the theorem for all $k=p$ prime. Fix a prime $p$ and suppose $\phi \neq {{\mathrm{id}}},$ $\phi^p = {{\mathrm{id}}}.$ Fix ${{\mathbb{F}}}_p$ as the coefficient field for Floer cohomology. Let $c_+$ and $c_-$ be the maximal and minimal starting point of an infinite bar. By [@SchwarzAspherical] we have $\phi \neq {{\mathrm{id}}}$ if and only if $c_+(\phi) > c_-(\phi).$ Therefore there exists an interval $I = (a,b)$ with closure contained in ${{\mathbb{R}}}\setminus \{0\},$ such that $a,b$ are not in the spectrum of $\phi,$ $pa,pb$ are not in the spectrum of $\phi^p,$ and $$\dim_{{{\mathbb{F}}}_p} HF^*(\phi)^{I} >0.$$ Then by Theorem \[thm: Smith exact filtered\], we obtain $\dim_{{{\mathbb{F}}}_p} HF^*(\phi^p)^{p\cdot I} \geq 1.$ However, since $\phi^p ={{\mathrm{id}}},$ and $0 \notin p\cdot I,$ $$\dim_{{{\mathbb{F}}}_p} HF^*(\phi^p)^{p\cdot I} = 0.$$ This is a contradiction that finishes the proof. Orientations and signs {#app:signs and or} ======================
Q: вложенное значение span html <span id="price">4500</span> JS var price = document.getElementById('price').innerHtml; вопрос в том, почему значение переменной undefined, либо если использовать parseInt, то же самое A: Потому что свойство называется не innerHtml, а innerHTML. JavaScript - регистрозависимый язык.
Q: Was thinking about building a SqlConnection Method...is that a bad idea? I was thinking about building a method that I could pass in the connString to in order to generate my SqlConnection. Is that a bad idea? Is it better if I just wrap my calls in their own using (SqlConnection statements? We had issues with another app where one of the devs was passing the connection around and keeping it open, which was causing a lot of grief. Just wanted to ask the experts before attempting something that could lead to issues. A: This is the common pattern I use and I think it's good: using (var cn = new SqlConnection(DatabaseConnection.ConnectionStringToDb)) { using (var cmd = new SqlCommand("command string", cn)) { // your code } } Where DatabaseConnection.ConnectionStringToDb is a static helper class property I create to fetch or store connection string.
Gastrointestinal effects of Syzigium aromaticum (L) Merr. & Perry (Myrtaceae) in animal models. Gastrointestinal disorders constitute one of the most common diseases world-wide and the treatment of some of them has since constituted a great challenge to health workers, which therefore calls for an urgent search into newer agents. In recent years, several efforts have been made through series of investigations on natural resources. The plant Syzigium aromaticum (SYZ), commonly known as clove has since been employed locally to treat constipation. Attempt to complement the effort of other researchers called for its selection for laboratory investigation, in order to determine its possible effect on intestinal propulsion in rodents as well as its suspected gastrointestinal protective properties. SYZ hot aqueous extract was investigated using selected doses in the various study models. Effect of the decoction on intestinal propulsion was studied by administering 300 and 700 mg kg(-1) hot extract to groups of overnight fasted mice, while using charcoal meal as a marker. The effect of the herbal drug was compared with other standard drugs and antagonists. In the same vein, the same doses of the extract were administered orally to groups of overnight fasted rats prior to challenge with different necrotizing agents-absolute ethanol (1 ml/rat), indomethacin (30 mg kg(-1)) and 70% ethanol in 150 mM HCl (1 ml/rat). Both negative and positive controls were similarly treated simultaneously with distilled water (10 ml kg(-1)) and standard antiulcer drugs (omeprazole 20.0 mg kg(-1), cimetidine 100.0 mg kg(-1) and misoprostol 0.2 mg kg(-1)), respectively. Lastly, the effect of SYZ was investigated on a segment of isolated rabbit ileum and subsequently compared with acetylcholine 5.5 x 10(-5) M. The effects of atropine (3.4 x 10(-6) M and 3.4 x 10(-5) M) on SYZ were also studied. The extract was found to increase the gut muscle propulsion similar to the standard drugs-carbachol and metoclopramide. When used together with atropine, SYZ produced a reduction in intestinal propulsion which suggested the involvement of cholinergic mechanisms in the action of the extract. In the ulcer models, the decoction reduced the ulcer number and ulcer area in the ethanol and HCl-ethanol models, with significant respective ulcer indices of 2.80 +/- 3.51 and 11.4 +/- 3.79 compared with controls (p < 0.05). In the indomethacin model, the extract, 700 mg kg(-1), compared favourably with misoprostol with an index of 0.20 +/- 0.11 which was also found to be significant compared with the control. In the in-vitro investigation on the rabbit ileum SYZ (200-6400 microg ml(-1)) contracted the tissue in a dose-dependent fashion but it was found to be less effective than acetylcholine (5.5 x 10(-5) M). Atropine sulphate 3.4 x 10(-6) M and 3.4 x 10(-5) M reduced gut contractility induced by SYZ, similar to the in-vivo observation. The latter could substantiate the earlier speculation of the herbal drug exerting its effect via cholinergic mechanism apart from the diverse possible activities of the various bioactive components that were identified through phytochemical testing of SYZ. The present findings explain the folkloric uses of SYZ as an antiulcer and a purgative agent as well as its possible mechanism of action.
Effect of antibiotics on gut microbiota, glucose metabolism and body weight regulation: a review of the literature. Gut bacteria are involved in a number of host metabolic processes and have been implicated in the development of obesity and type 2 diabetes in humans. The use of antibiotics changes the composition of the gut microbiota and there is accumulating evidence from observational studies for an association between exposure to antibiotics and development of obesity and type 2 diabetes. In the present paper, we review human studies examining the effects of antibiotics on body weight regulation and glucose metabolism and discuss whether the observed findings may relate to alterations in the composition and function of the gut microbiota.
Q: perl \@ escape sequence I've got a perl script with something like the following: " \"blah\@$string;blah\" " But I'm not sure what the \@ is doing/supposed to do. I've tried googling '\@' but I can't seem to find anything. A: It causes the @ to mean "An at sign" instead of "Dereference $string as an arrayref". A: The backslash before the @ tells Perl to treat it literally, otherwise it will treat it as an array. If the @ is followed by an $ it will be treated as an array reference (a string holding a reference to an array). If you print it out it may be clearer (I have changed your code to use qq||): my $string = 'i-am-a-string'; print qq| "blah\@$string;blah" |; # with backslash # "blah@i-am-a-string;blah" print qq| "blah@$string;blah" |; # no backslash # Can't use string ("i-am-a-string") as an ARRAY ref $string = [1,2,3]; # string now an array reference print qq| "blah\@$string;blah" |; # with backslash # "blah@ARRAY(0x803bc0);blah" # ARRAY(0x803bc0) is where (1,2,3) lives print qq| "blah@$string;blah" |; # no backslash # "blah1 2 3;blah"
Re: Yaesu 5400 interface and software question IIRC, FODTrack will work with the Easycomm protocol. 73, Jim KQ6EA --- w8iss@wideopenwest.com wrote: > I have a Yaesu 5400 AZ/EL and am wanting to control > it from a weather Satellite > program called Wxtoimg. I have a list of controllers > that Wxtoimg will use: > > CX6DD, DL7AOT, EASYCOMM, GS-232A, LVBTracker, > RC2800, ROT2Prog, SAEBRTrack, > SatDrive, and SATTracker JR. > > Which one would be closest to a FodTrack controller > if any? > > James W8ISS > _______________________________________________ > Sent via AMSAT-BB@amsat.org. Opinions expressed are > those of the author. > Not an AMSAT-NA member? Join now to support the > amateur satellite program! > Subscription settings: > http://amsat.org/mailman/listinfo/amsat-bb > _______________________________________________ Sent via AMSAT-BB@amsat.org. Opinions expressed are those of the author. Not an AMSAT-NA member? Join now to support the amateur satellite program! Subscription settings: http://amsat.org/mailman/listinfo/amsat-bb
[A study of uterine adhesions following suturing of the uterus with catgut or Vicryl in cesarean sections in cattle]. A caesarean section was performed in 202 cows for the first time. The uterus of 103 of these cows was sutured with Vicryl (7 metric) and the uterus of 99 cows was sutured with plain catgut (9 metric). The cows were randomly allotted to the two groups. All cows were rectally examined to diagnose adhesions between the uterus and the surrounding tissue five weeks post partum. Adhesions were found in 50% of the cases. There were no differences in the number of adhesions and the severity of the adhesions between the catgut and the Vicryl group (Table 1).
What factors influence suboptimal ward care in the acutely ill ward patient? As technological developments continue to offer patients more health care choices patient acuity increases. Patients that traditionally would have been cared for in a critical care environment are increasingly located on general wards. This change impacts on the acute care sector in a number of ways. Patients who are inpatients have more complex problems and a greater number of co-morbidities and are therefore more likely to suffer physiological deterioration. Procedures requiring inpatient stays are often more complex and associated with higher rates of mortality and morbidity. As patient acuity has increased research has highlighted that the care of the acutely ill ward patient is suboptimal. Suboptimal care implies a lack of knowledge regarding the significance of clinical findings relating to dysfunction of airway, breathing and circulation. This paper analyses the literature on the factors that contribute to suboptimal ward care of the acutely ill patient. It uses the categories proposed by McQuillan et al. [McQuillan P, Pilkington S, Allan A, Taylor B, Short A, Morgan G, et al. Confidential inquiry into quality of care before admission to intensive care. BMJ 1998;316(7148):1853-8] in relation to suboptimal ward care in an attempt to develop a conceptual analysis of the factors that influence suboptimal ward care and acutely ill ward patients. Thus, it aims to develop and enhance practitioners' knowledge and understanding of this topic and therefore improve patient care outcomes.
Sunday, January 02, 2011 Please write to your MP I will be talking about childbirth. It will not be a nice story. If you've been reading the papers, you'll know that a national scandal is finally coming to light. The government promised three thousand new midwives to the NHS before the election, but have they done anything about it? Of course not; that would mean spending money. The reason they promised the midwives is that birth rates are high, midwife rates are low, and you cannot manage a birth with too few midwives. Women are in labour are being turned away from hospitals that cannot accommodate them. 22% of women in labour are left unattended - more than one in five. The papers acknowledge that this is a 'frightening' experience. Speaking as one of those one in five, let me state that this is a grotesque understatement. I gave birth over four months ago, and here's what happened to me: At 43 and a half weeks overdue, I went to the hospital to meet with a consultant for advice. That 'advice' turned out to be the information that if I didn't want to double my son's chances of brain damage, I'd let her book me in for an induction - and when I agreed, the information that the induction would take place the day after tomorrow. I went into hospital. The first thing the midwife told me was that she was looking after ten women that day. She strapped me to a monitor to check the baby was doing okay before beginning the induction, and left. My husband had to go find her when it seemed the monitor wasn't working - which it wasn't. The allotted half hour passed, and my husband had to go find her again. She gave me a Prostaglandin pessary (the first stage in inductions) and disappeared again. After an hour or so it fell out and my husband once again had to go track her down to get another one. Visiting hours ended at ten o'clock. At nine o'clock my husband had to go get her so we could insist on some kind of check, because by that time I'd been in pain all afternoon and all evening. Constant pain, not contractions, because that's often the effect of an induction. I didn't know this could happen, though, because she didn't have the time to brief me. She monitored me for a while, didn't manage to get the time to examine how dilated I was, and disappeared again. At that point my husband was sent home and told visiting hours started again at eight o'clock in the morning. The night staff was one main midwife and one woman on the desk - a bullying individual who snapped at anyone who asked her for help. At this point, let me say that the daytime midwife seemed like a perfectly nice person. After the baby was born she came to congratulate me and coo at him. But do you know what happened because of time pressures on this perfectly nice person? She forgot to brief me about pain relief. Then she went home, leaving me in the care of a skeleton crew with ten women to look after. The staff shortages meant that my overnight care plan boiled down to this: isolate the woman without pain relief or information for ten hours. No one so much as put a head around the door to see if I was alive or dead. I had to drag out into the corridor in agony to beg for pain relief - which was, it turned out, available if only you knew to ask for it - and wait a long time before it arrived. At four in the morning, I threw up from the pain. Pressing a call button for help, I was briefly attended by a midwife who examined me and said I was three centimetres dilated and could go up to a labour ward - which meant I could call my husband and community midwives to come keep me company. She said she'd call the labour ward and let them know. Then she disappeared, and I never saw her again. My husband wasn't there to look for her, and I couldn't do it, so she just vanished out of my life for ever. That was the night shift. Come the morning, the first midwife returned and tried to get me into a labour ward. Day shift began at eight o'clock. It was noon before I got into one. At that point I was requesting an epidural, so they called for an anaesthetist to come. While waiting, they suggested breaking my waters by hand so as to move the labour along. 'Is it going to hurt?' I said. 'I've been in pain for twenty-four hours, I can't take any more. Maybe we should wait for the epidural.' 'No,' they said, 'it's not painful.' So they went ahead. They saved themselves a couple of hours in so doing, which probably cleared the room for another patient sooner. They also fucking lied to me. Breaking a membrane doesn't hurt, but what that rush of hormones does to an unprepared cervix is agonising. Between twelve and two I was in constant, relentless pain, because they decided not to wait for the anaesthetist even though I'd specifically said I wanted to if it was going to cause more pain. So let me sum up. Understaffing meant that I was isolated while in labour for a full night shift, left there by staff who were so rushed they forgot to brief me on pain relief. Or to offer me pethidine, which I've since been informed by the hospital was what they should have done. Or to give me any kind of explanation about what was happening to my body and that of my baby, who, they had recently informed me, was at increased risk of brain damage if he didn't come out extremely soon. It then meant that they lied to me about how painful a procedure would be so as not to slow down the conveyor belt I was on. This was not an unusual experience. A friend of mine from antenatal class tells me that the day after she gave birth, they had women giving birth on the public antenatal wards because there was nowhere else to put them. I am trying not to cry as I type this. I can tell you here and now that while I had planned to have another child, now I am seriously questioning whether I can go through that again. I feel sick and terrified every time I enter that hospital - even when I was just returning some property. Heaven help me if I ever need medical treatment there again. In short: the levels of understaffing and limited accommodations are at crisis point. The NHS needs more money. A lot more money. Something has to give, and if it's not the government's purse strings it'll be women. I'm going to be blunt about this: unless the government fucking pays out like it said it would, they are making the plain statement that they think preserving the pockets of the wealthy is important enough to justify the torture of thousands of women. The government made a promise. Even if they keep it, it'll only go partway to solving the problem, but they made a promise and they're not keeping it. Please write to your MP and ask them to put on the pressure. I mean, I knew it was bad, I'm shocked all over again each time you mention what happened to you, but I can't get over that bit about leaving a laboring woman totally alone for ten hours...It'd be bad enough for a natural labor, but for an induction? There are no words. Except, I'm sorry. It won't do any good for me to write to your MP, but I hope you and all the rest of the 22% -- not to mention everyone else who cares about the health of mothers and babies-- continue to scream the place down until your government gets its act together. It's a word I learned watching the extra features on the DVD box set of Rome rather than at college, admittedly, but the notes were put in by a proper academic, so there you go. This is the story: In ancient Rome prior to the emperors, honestiores - people of status and property - were supposed to be exempt from torture, and it was generally agreed that torturing a noble was cruel. The humbler classes, on the other hand - the humiliores - could be tortured, beaten, crucified and subjected to great maltreatment (slaves' testimony was not considered admissible unless extracted under torture, for instance), and physical cruelty was a fairly normal part of their experience. This was not considered a particularly serious matter. That, I think, is where we get the word 'humiliate'. It's in the bones of our language: the idea that suffering is a terrible thing to inflict on people that matter, but not such a problem with lesser folk. It's profoundly humiliating to be treated as if it doesn't matter when you suffer, and our language and history show you why: it's treating you as a person of no worth. People who think the pain of childbirth isn't a serious business? These are people who either think that all women are humiliores, or that women unfortunate enough to have difficult labours are humiliores while the women who can manage drug-free births - which is to say, the women who don't experience pain that's unbearable - are honestiores. Sexism or Just World Fallacy, or possibly both, but people that bad things should happen to either way. I'm not in the UK, so I can't write to any relevant MP, but I'm wondering if there isn't room in this for a class action lawsuit. It seems millions of women are being materially harmed (in lots of unnecessary pain, but also ignoring women means if a maiming or life-threatening situation develops, no one is there to fix it). I don't suggest you have the time or energy to do this, but you might see if anyone else is doing it and add your voice to the chorus. Well, the NHS does get sued if it actually screws up a birth in such a way as to damage the baby. My dad's a medical negligence lawyer, and a big proportion of his cases are incidents of the kind. (Not a comforting set of cases to reflect on while in labour, let me tell you.) But suing for emotional distress isn't really a UK thing. Among other things, the whole problem is that the NHS is under-funded. Suing it, should the case succeed, would only make it poorer than ever, and it'd be patients like me who'd suffer for it. You and me both, mmy. In the U.S. one can sue, not for damages, but to get the organization to change its behavior. If that were possible in a case like this, it seems that Kit's father would know about it. How awful! I had an induced delivery with both of my children, and I can't imagine how dreadful it would be to do that alone. :( I'm a doctor and my husband is a doctor and we had a midwife with us every single minute, as well as my mother. And it was still hard, and it went for hours and hours. I cannot imagine how frightening your experience must have been - those of us who work in hospitals sometimes forget how strange they are to those are not there every day. I now see why so many UK doctors come here to Australia to work! And so many stay! (But I will just say that the second time around it was totally different. I was induced again, but my body knew what to do, it was quicker it was easier and it was altogether a better experience, despite having a 50% larger baby the second time around! All the best with your family.) I'm curious as to WHY they're so reticent to use money that's been entrusted to them specifically for such purposes. Money has no way to be its own purpose, after all. In the end, it's just a form of indirect barter. {sigh} Where's their sense of fealty to the general populace? On a side note, I also have to wonder HOW freely given testimony from a slave could be regarded as invalid. Then again, if Terry Jones's Barbarians is anything to go by, I get the feeling many of the Romans would have regarded "rule of fear" as a redundant term... Kit, having seen references to your experiences on Slacktivist I knew it had been bad but had no idea how bad. This is horrific. I'm so sorry that you went through that experience. :( I know I'm coming very late to this, but there's a relevant aspect that I happen to know a bit about - what happens to people who want to train as midwives in the UK. Which is, mostly, that they can't. One of my sisters - an intelligent, hard-working and all round strong woman - tried desperately to get a place to study midwifery. It wasn't possible - despite the desperate shortage of midwives, university places to study midwifery were actually being reduced, and the law had just been changed to make a degree compulsory. That was two years ago now. Further back, a family friend who moved to the UK from Africa - a fully qualified midwife - attempted to get permission to practice in the UK and came up against so much restrictive red tape that she was forced to take a different nursing position to support herself and her son.So the problem isn't just in the NHS itself - it's also in the universities, and the immigration paperwork, and probably elsewhere across the board. All the people who hear about a midwifery crisis and dismiss it as less important than issues A through to Z, and not worth their time or effort to get new midwives trained/certified.I'll definitely write to my MP on the back of this post of yours (though as my MP is Vince Cable I'm not sure what that's going to achieve!) Best wishes for your recovery, and for all good things for the small offspring.
<LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" xmlns:app="http://schemas.android.com/apk/res-auto" xmlns:tools="http://schemas.android.com/tools" android:layout_width="match_parent" android:layout_height="match_parent" android:layout_marginLeft="16dp" android:layout_marginRight="16dp" android:baselineAligned="false" android:divider="?android:attr/dividerHorizontal" android:orientation="horizontal" android:showDividers="middle" tools:context="sunger.net.org.elestickheader.ItemListActivity"> <!-- This layout is a two-pane layout for the Items master/detail flow. --> <android.support.v7.widget.RecyclerView xmlns:android="http://schemas.android.com/apk/res/android" xmlns:tools="http://schemas.android.com/tools" android:id="@+id/item_list" android:name="sunger.net.org.elestickheader.ItemListFragment" android:layout_width="@dimen/item_width" android:layout_height="match_parent" android:layout_marginLeft="16dp" android:layout_marginRight="16dp" app:layoutManager="LinearLayoutManager" tools:context="sunger.net.org.elestickheader.ItemListActivity" tools:listitem="@layout/item_list_content" /> <FrameLayout android:id="@+id/item_detail_container" android:layout_width="0dp" android:layout_height="match_parent" android:layout_weight="3" /> </LinearLayout>
Acute Flaccid Myelitis: Etiologic Challenges, Diagnostic and Management Considerations. Purpose of review Acute flaccid myelitis is a polio-like illness defined by the acute onset of flaccid paralysis in the setting spinal MRI demonstrating a longitudinal lesion in the gray matter of the cord. This paper aims to review the current state of knowledge and key clinical points for the diagnosis and management of acute flaccid myelitis. Recent findings There were clusters of AFM noted in California and Colorado in 2014, with additional cases across the USA that year, and another spike in cases in 2016. Patients have been managed with classic treatments for transverse myelitis, but in general without benefit, although some colleagues have noted anecdotal improvement in individual patients. Our current practice at the Children's Hospital of Philadelphia is to initiate therapy with intravenous immunoglobulin (IVIG) upon recognition of acute flaccid myelitis in hopes of boosting humoral immunity, and to provide an emphasis on rehabilitation services, including physical and occupational therapy. There is some data that suggests a connection to the virus enterovirus D68 (EV D68), but there has been no definitive link. Publications regarding longer-term outcomes in these patients are early in development and, thus far, only provide data for 6 to 12 months from onset. Summary AFM is a serious illness with long-term consequences, and we have much to learn. Key areas in need of further investigation involve etiology, host susceptibilities, treatment options, and long-term outcome. Individual clinicians can assist in these efforts by the prompt reporting of cases of AFM to the US Centers for Disease Control and Prevention.
Eddie Chapman (footballer) Eddie Chapman (3 August 1923 – October 2002) was an English football player and chairman, closely associated with West Ham United. At schoolboy level, he won honours with Ilford and London, and also had a trial for England Schools. In 1937, his last season as a schoolboy, he scored 102 goals for his school team Loxford, and 128 in total, including a game that saw him score 12 goals, three games where he scored 9 goals, and 8 in another. He first joined West Ham on 3 August 1937 as an office junior, earning 25 shillings a week plus 2/6d expenses. He trained with the team two or three afternoons a week, and went on to join Romford on loan to gain more experience. In an interview with Colin Benson, Chapman recalls one of his first experiences in the West Ham first team, in a war-time game against London rivals Arsenal. "I played outside right against Arsenal and it was truly a marvellous thing to be on the same field as the likes of George Swindin, Eddie Hapgood, the Compton brothers and the rest. I was 16 and scored in a convincing 6–0 win. What a day that was for me". Chapman appeared in the second round second leg of the Football League War Cup in 1940, a 3–0 win over Leicester, and earned a 30/- (£1.50) match fee for the game. He was also in the squad for the final against Blackburn Rovers, but did not play. He won a winners medal with the junior side in the London Junior Combination at the age of 19. He was given a professional contract in September 1942 but, due to the war and his involvement with the Royal Engineers, he was not available to play for West Ham on a full-time basis until January 1947, although he competed in the Kent League for Gillingham while he was stationed at Chatham. While at Gillingham, he scored 9 goals in one week against Chelsea, and then 7 the next against the RAF. He made a total of 26 war-time appearances for West Ham, scoring 8 goals. He also played for the Royal Engineers All-England XI. After the war, his opportunities in the West Ham first team were limited by the presence of players such as Eric Parsons, Terry Woodgate, Kenny Bainbridge and Harry Hooper, and were not helped by a persistent back injury. He scored his first league goal during his debut, a home game against Coventry City during the 1948–49 season. He made 1 FA Cup appearance against Luton on 8 January 1949. He played his last of 7 senior league games for West Ham the same season, having scored 3 goals for the club. After leaving the playing staff, Chapman continued his involvement with the club's administrative affairs, and became West Ham's club secretary in 1956, following Frank Cearns' retirement. He was promoted to Chief Executive in 1980. In 1974 he was a recipient of the Football League Secretaries and Managers Association Long Service Award, and also the Canon League Loyalty Award in August 1984. He retired in the summer of 1986 after 49 years of service for the east London club. He returned to Gillingham in an advisory capacity less than a month after retiring, and made a dozen trips to the Priestfield Stadium to help advance the club's administrative systems and matchday organisation. His testimonial match between West Ham and Terry Venables' International IX took place on 9 August 1987. He died in 2002. References The Eddie Chapman testimonial: official souvenir magazine Category:1923 births Category:2002 deaths Category:Footballers from East Ham Category:English footballers Category:English football chairmen and investors Category:Association football forwards Category:West Ham United F.C. players Category:West Ham United F.C. club secretaries Category:Gillingham F.C. wartime guest players Category:West Ham United F.C. non-playing staff
Comparison of six methods for preparing cefazolin sodium for intermittent injection. The time and cost of preparing i.v. piggyback doses of cefazolin sodium using automated and manual methods were compared. One-gram doses of cefazolin sodium were prepared in batches of 100 using each of six methods. Total equipment process times were recorded during five trials with each method. Personnel time and total materials costs were determined. Bulk-vial reconstitution methods, including a manual syringe and three automated fluid-delivery devices (Burron Multi-Ad syringe pump, Unispense peristaltic pump, and Valleylab heart-valve cassette pump), were compared. Two prefilled container systems (Faspak flexible plastic bags with Physio-Control peristaltic pump, and glass piggyback bottles with the Multi-Ad pump) were compared with each other and with the bulk-reconstitution methods. Of the bulk-vial methods, total process times were significantly shorter for the Multi-Ad and Unispense systems. Of the prefilled container systems, total process time and personnel time were significantly shorter for the Faspak method than for the manufacturer's piggyback bottle method. Materials costs were similar for all bulk-vial methods and were significantly lower for both prefilled container systems. Overall costs were lower for prefilled systems; the cost per dose was $3.63 for the manufacturer's piggyback bottle system and $4.26 for the Faspak system. Total personnel time required by the Faspak method was 21.5 minutes per batch, approximately one third the time required by any other method. In terms of personnel time and materials costs for preparation of i.v. cefazolin sodium doses, manufacturers' prefilled container systems have advantages over bulk-reconstitution methods.
Arkansas has bodies at running back, and recruiting outlets say they have talent, but whether or not Razorback head coach Bobby Petrino will get all he wants out of the backs remains to be seen. Come inside for a complete breakdown.
John Friedman on the Economics of Kindergarten and Public Policy Interviewed by Doug Gavel on August 3, 2010 A child’s success in her first year in the classroom can portend her chances of success as an adult. That is one key finding in a new research study co-authored by Harvard Kennedy School assistant professor John Friedman. Along with several colleagues, he examined the records of 12,000 school children who were subjects of an education experiment in Tennessee in the 1980’s, in order to determine how one’s kindergarten education affects her prospects later in life. Friedman holds a Ph.D. in Economics, an A.M. in Statistics, and a B.A. in Economics, all from Harvard University, and his academic research focuses on the economics and political economy of public policy. Q: Please explain the parameters of the original Tennessee experiment and the data you drew upon for your research. Friedman: In 1985 the government of Tennessee started a program in which a group of students entering kindergarten were randomly placed, some to large classrooms and some to small classrooms. Teachers were also randomly assigned to different classrooms, and then as a byproduct of this, the peers that a student had in each classroom were randomly assigned. The experiment continued for four years through the third grade. For the past 20 years, this random assignment of kids to classrooms has been a vital tool in helping educational researchers understand the impact of teachers, of peers, and of class size on educational outcomes. This data set followed the students after the program ended in third grade, through eighth grade, and test scores were collected each year. So prior to our research, we could examine the impact of smaller kindergarten classrooms, or that of having a more experienced kindergarten teacher, or that of having a smarter set of peers in kindergarten on a student’s test scores through the eighth grade. But the data stopped at that point, so the question remained – did the impact on test scores through the eighth grade accurately represent the longer term impact of these early education interventions? Our study sought to address the outcomes that we really care about – whether the child went to college, the quality of that college, whether she is in a high-paying job, whether she owns a home, and whether she is saving for retirement. Q: Please discuss the most compelling findings from your analysis. Friedman: The most significant results from our study are twofold. First of all, we were able to show that students who were in a smaller kindergarten class were about two percentage points more likely to attend college than those who had been in larger classes; they earned a little bit more salary; they were more likely to be married and more likely to own a home. Also, students with more experienced teachers earned $900 dollars more per year at age 27 than their peers who had less experienced kindergarten teachers. And that gap seems to grow over time, so that if we followed the students for a few more years, that gap might be even larger. The second major finding of our study responded to the question: Are test scores a good measure of the longer-term impacts of a better teacher or a smaller classroom? What we found was very interesting. We found that kindergarten test scores are a very accurate measure of the impact of a kindergarten class on later life outcomes. For every percentile higher that the students scored in kindergarten, for instance, they earned about $80 more per year later in life. Later test scores were not as accurate a measure. For instance, the impact of small classes is to increase kindergarten test scores, but it has almost no impact on eighth grade test scores. So there’s a conflict there – is the immediate impact upon kindergarten test scores or the long-term impact on eighth grade test scores more relevant for long term outcomes? And it looks like it was really the kindergarten score that was the best measure. The fact that effects faded over time in regards to test scores was not a good measure of the long term impact on outcomes. Q: Did the findings surprise you? Friedman: People tend to have different perspectives about the issues that we studied. Some people, seeing the impact of test scores fading over time, thought that what happened in kindergarten just could not have that much of an impact on one’s life 20 or 30 years later. But other people, especially those who believe that early childhood interventions are really important, felt that kindergarten might really have a tremendous impact later on. So I think that the community was pretty much split on whether our results were consistent with what they had believed or differed from what they believed. One thing that we can be sure of, however, is that we are not identifying all of the factors that influence a person’s development. Kindergarten is very important, but prior research suggests that the impact of one’s parents is at least three times more important than one’s kindergarten class. Your peers are crucially important, also, not only in class but outside of class as well. So your kindergarten class is tremendously important; the stakes are very high in kindergarten. But just because you don’t have the best kindergarten class doesn’t mean that you are doomed for life; there are other important influences as well. Q: What are the implications of this research on early childhood education? Friedman: I would identify two significant implications. First of all, I think this research validates a tremendous amount of literature on early childhood interventions, because that literature is only able to look at test scores. These findings show that those test scores are indeed a fairly reliable predictor for what goes on in the longer term. The second major impact of our study, I think, is to highlight how important kindergarten is. The stakes are tremendously high. And this research highlights how critically important it is for educators to support kindergarten and to spend its resources correctly. We have calculated that the difference between an above average teacher and a below average teacher on lifetime earnings of students is about $320,000 for an average size kindergarten class. That’s based on a calculation in which lifetime earnings are $16,000 more per students, and there are 20 students in a class. I’m not an expert in teacher recruitment, and I don’t have a specific policy recommendation to raise the quality of teachers, but I find it disturbing when states are reducing funding for these types of early education programs, such as Head Start or direct funding to schools. I think the results from our research suggest that that’s not the best way to look after the long term well being of our children. Q: How do you see these findings as influencing policy makers? Friedman: These findings highlight how important kindergarten is for determining the long term success of children. And one of the important sub-findings of our research is that these interventions seem to raise the long term earnings and the probability of attending college just as much for richer students as for poorer students. So this suggests that one way to narrow economic inequality is to focus resources on those students who have fewer opportunities or fewer resources available to them when they are young. Unfortunately much of the funding for schools in this country comes from local taxes, which means that students who grow up in poor neighborhoods often attend very poorly- funded schools. That might serve to perpetuate the patterns of inequality if kindergarten funding and the quality of the kindergarten classroom are important over the long run. So I hope that in the broader picture our research might help policymakers understand the importance of redirecting some of the early education funding towards those lower income neighborhoods, which, as a result, would serve to equalize the early education opportunities that different students are getting. Q: What future research projects are you planning to follow up on this study? Friedman: I think that the current study is very good at picking out a few specific aspects of the kindergarten classroom that seem to matter and highlighting the overall importance of kindergarten, but we do not make many specific recommendations about how to make a kindergarten class better. We know that small classes are good, and we know that teacher experience seems to matter, but beyond that we are limited in the lessons that we can draw. So I think the research project going forward will continue to examine what makes a kindergarten class excellent. This research really gives us a lot more power to see, for instance, whether and how peers matter. We have very little to say about the quality of one’s peers, but educational research has time and again found that one’s peers are extremely important. Similarly, it would be nice to know something more about what beyond teacher experience makes a difference – maybe if the teachers have children themselves, or if they’re younger or older, or if they have more experience in that particular age range rather than in schools in general. So I think that is the challenge moving forward – to make specific policy recommendations beyond the more broad brush of the current findings.