text
stringlengths
8
5.77M
Q: SMS/Text message sending via PHP I'm interested in knowing if it would be at all feasible to be able to send text messages via PHP. The main purpose of which would be to send a single message to a group of people - 10+ - with updates regarding news and such. Preferably the solution should be free, though it is not a necessity in any way. Thanks to all in advance. A: I've done this with PHP, and it works very well. Text messages are nothing more than an email, usually with the receiver's 10 digit number @address.com. If you want to send text messages to someone with PHP, you'll need to get the proper address: Here is a Partial List You'll want to be careful with how long your messages get, since at about 55 characters (I believe) your message can be either split into multiple texts, or lost. Sending texts via email is free.
A letter from an Alberta recruiter points out that doctors working in the province's "resource rich oil economy" aren't facing salary freezes or cuts in health care spending. In fact, Alberta doctors stand to receive a 2% increase in fees. Dr. Victor Varma, president of the Kent Medical Society, said he and his colleagues have received similar letters for some time - particularly from Alberta and Saskatchewan. The Chatham-Kent Health Alliance radiologist has been targeted in what he believes is a "first wave" of recruitment efforts. Given the situation between the OMA and the province, he added, "I have a feeling we're going to see an increase in these letters." Established physicians with families and kids in school are less apt to want to get up and move. "That being said, these are the beginning of the cuts . . . who knows where it ends?" Varma said. He said physicians are not being consulted about changes the province wants to make to the health care system. "We're just being told this is how it is," he added. It's common knowledge Ontario's manufacturing base isn't what it used to be, Varma said, which is impacting tax revenues. This, coupled with an aging population, is driving up the cost of health care, he added. "I'm willing to go along with the government in making some changes, but please come to me to help make those changes, don't dictate those changes to me," Varma said. There's a concern he said, that bureaucrats are making changes without consulting physicians about how to save money and improve the system. Varma moved to Ontario from Alberta to be close to family, and he isn't interested in moving back. But, he is alarmed about the potential of budget cutbacks limiting procedures doctors can perform for patients, or prohibiting certain tests from being ordered. He noted one of the things being talked about is de-listing OHIP covered patients who need a CT Scan or MRI for back pain. "The question is: At what point does it get to that you feel like you can't practice medicine the way you should be practising medicine?" Varma said. He believes this situation may make it difficult to attract new physicians to Ontario. "That's definitely a disincentive to come to a jurisdiction." Varma said Chatham-Kent has worked very hard at its recruiting efforts resulting in a good complement of new physicians in the last two years. Sudbury doctor Dr. Pierre Leon Bonin, who is on the executive of the OMA, said most physicians in Ontario receive about four or five recruitment letters a week on average. He said the number has "just skyrocketed" in recent months. Ontario doctors are upset Health Minister Deb Mathews continues to describe the government's dispute with the OMA as a battle over salaries, he said, when the province is forcing physicians to absorb the cost of new services needed by a growing and aging population. Just because doctors bill OHIP, it doesn't mean the amount is all income, Bonin said. According to Matthews, Ontario has increased the budget for doctors' compensation by $5.1 billion over eight years.
/* * SPDX-License-Identifier: ISC * SPDX-URL: https://spdx.org/licenses/ISC.html * * Copyright (C) 2019 Aaron M. D. Jones <aaronmdjones@gmail.com> * * ECDH-X25519-CHALLENGE mechanism shared routines. */ #ifndef ATHEME_MOD_SASL_ECDH_X25519_CHALLENGE_H #define ATHEME_MOD_SASL_ECDH_X25519_CHALLENGE_H 1 #define ATHEME_ECDH_X25519_XKEY_LEN 32U #define ATHEME_ECDH_X25519_SALT_LEN 32U #define ATHEME_ECDH_X25519_CHAL_LEN 32U struct ecdh_x25519_server_response_fields { unsigned char pubkey[ATHEME_ECDH_X25519_XKEY_LEN]; unsigned char salt[ATHEME_ECDH_X25519_SALT_LEN]; unsigned char challenge[ATHEME_ECDH_X25519_CHAL_LEN]; } ATHEME_SATTR_PACKED; union ecdh_x25519_server_response { unsigned char octets[sizeof(struct ecdh_x25519_server_response_fields)]; struct ecdh_x25519_server_response_fields field; } ATHEME_SATTR_PACKED; #endif /* !ATHEME_MOD_SASL_ECDH_X25519_CHALLENGE_H */
//===-- TargetLibraryInfo.def - Library information -------------*- C++ -*-===// // // The LLVM Compiler Infrastructure // // This file is distributed under the University of Illinois Open Source // License. See LICENSE.TXT for details. // //===----------------------------------------------------------------------===// #if !(defined(TLI_DEFINE_ENUM) || defined(TLI_DEFINE_STRING)) #error "Must define TLI_DEFINE_ENUM or TLI_DEFINE_STRING for TLI .def." #elif defined(TLI_DEFINE_ENUM) && defined(TLI_DEFINE_STRING) #error "Can only define one of TLI_DEFINE_ENUM or TLI_DEFINE_STRING at a time." #else // One of TLI_DEFINE_ENUM/STRING are defined. #if defined(TLI_DEFINE_ENUM) #define TLI_DEFINE_ENUM_INTERNAL(enum_variant) enum_variant, #define TLI_DEFINE_STRING_INTERNAL(string_repr) #else #define TLI_DEFINE_ENUM_INTERNAL(enum_variant) #define TLI_DEFINE_STRING_INTERNAL(string_repr) string_repr, #endif /// int _IO_getc(_IO_FILE * __fp); TLI_DEFINE_ENUM_INTERNAL(under_IO_getc) TLI_DEFINE_STRING_INTERNAL("_IO_getc") /// int _IO_putc(int __c, _IO_FILE * __fp); TLI_DEFINE_ENUM_INTERNAL(under_IO_putc) TLI_DEFINE_STRING_INTERNAL("_IO_putc") /// void operator delete[](void*); TLI_DEFINE_ENUM_INTERNAL(ZdaPv) TLI_DEFINE_STRING_INTERNAL("_ZdaPv") /// void operator delete[](void*, nothrow); TLI_DEFINE_ENUM_INTERNAL(ZdaPvRKSt9nothrow_t) TLI_DEFINE_STRING_INTERNAL("_ZdaPvRKSt9nothrow_t") /// void operator delete[](void*, unsigned int); TLI_DEFINE_ENUM_INTERNAL(ZdaPvj) TLI_DEFINE_STRING_INTERNAL("_ZdaPvj") /// void operator delete[](void*, unsigned long); TLI_DEFINE_ENUM_INTERNAL(ZdaPvm) TLI_DEFINE_STRING_INTERNAL("_ZdaPvm") /// void operator delete(void*); TLI_DEFINE_ENUM_INTERNAL(ZdlPv) TLI_DEFINE_STRING_INTERNAL("_ZdlPv") /// void operator delete(void*, nothrow); TLI_DEFINE_ENUM_INTERNAL(ZdlPvRKSt9nothrow_t) TLI_DEFINE_STRING_INTERNAL("_ZdlPvRKSt9nothrow_t") /// void operator delete(void*, unsigned int); TLI_DEFINE_ENUM_INTERNAL(ZdlPvj) TLI_DEFINE_STRING_INTERNAL("_ZdlPvj") /// void operator delete(void*, unsigned long); TLI_DEFINE_ENUM_INTERNAL(ZdlPvm) TLI_DEFINE_STRING_INTERNAL("_ZdlPvm") /// void *new[](unsigned int); TLI_DEFINE_ENUM_INTERNAL(Znaj) TLI_DEFINE_STRING_INTERNAL("_Znaj") /// void *new[](unsigned int, nothrow); TLI_DEFINE_ENUM_INTERNAL(ZnajRKSt9nothrow_t) TLI_DEFINE_STRING_INTERNAL("_ZnajRKSt9nothrow_t") /// void *new[](unsigned long); TLI_DEFINE_ENUM_INTERNAL(Znam) TLI_DEFINE_STRING_INTERNAL("_Znam") /// void *new[](unsigned long, nothrow); TLI_DEFINE_ENUM_INTERNAL(ZnamRKSt9nothrow_t) TLI_DEFINE_STRING_INTERNAL("_ZnamRKSt9nothrow_t") /// void *new(unsigned int); TLI_DEFINE_ENUM_INTERNAL(Znwj) TLI_DEFINE_STRING_INTERNAL("_Znwj") /// void *new(unsigned int, nothrow); TLI_DEFINE_ENUM_INTERNAL(ZnwjRKSt9nothrow_t) TLI_DEFINE_STRING_INTERNAL("_ZnwjRKSt9nothrow_t") /// void *new(unsigned long); TLI_DEFINE_ENUM_INTERNAL(Znwm) TLI_DEFINE_STRING_INTERNAL("_Znwm") /// void *new(unsigned long, nothrow); TLI_DEFINE_ENUM_INTERNAL(ZnwmRKSt9nothrow_t) TLI_DEFINE_STRING_INTERNAL("_ZnwmRKSt9nothrow_t") /// double __cospi(double x); TLI_DEFINE_ENUM_INTERNAL(cospi) TLI_DEFINE_STRING_INTERNAL("__cospi") /// float __cospif(float x); TLI_DEFINE_ENUM_INTERNAL(cospif) TLI_DEFINE_STRING_INTERNAL("__cospif") /// int __cxa_atexit(void (*f)(void *), void *p, void *d); TLI_DEFINE_ENUM_INTERNAL(cxa_atexit) TLI_DEFINE_STRING_INTERNAL("__cxa_atexit") /// void __cxa_guard_abort(guard_t *guard); /// guard_t is int64_t in Itanium ABI or int32_t on ARM eabi. TLI_DEFINE_ENUM_INTERNAL(cxa_guard_abort) TLI_DEFINE_STRING_INTERNAL("__cxa_guard_abort") /// int __cxa_guard_acquire(guard_t *guard); TLI_DEFINE_ENUM_INTERNAL(cxa_guard_acquire) TLI_DEFINE_STRING_INTERNAL("__cxa_guard_acquire") /// void __cxa_guard_release(guard_t *guard); TLI_DEFINE_ENUM_INTERNAL(cxa_guard_release) TLI_DEFINE_STRING_INTERNAL("__cxa_guard_release") /// int __isoc99_scanf (const char *format, ...) TLI_DEFINE_ENUM_INTERNAL(dunder_isoc99_scanf) TLI_DEFINE_STRING_INTERNAL("__isoc99_scanf") /// int __isoc99_sscanf(const char *s, const char *format, ...) TLI_DEFINE_ENUM_INTERNAL(dunder_isoc99_sscanf) TLI_DEFINE_STRING_INTERNAL("__isoc99_sscanf") /// void *__memcpy_chk(void *s1, const void *s2, size_t n, size_t s1size); TLI_DEFINE_ENUM_INTERNAL(memcpy_chk) TLI_DEFINE_STRING_INTERNAL("__memcpy_chk") /// void *__memmove_chk(void *s1, const void *s2, size_t n, size_t s1size); TLI_DEFINE_ENUM_INTERNAL(memmove_chk) TLI_DEFINE_STRING_INTERNAL("__memmove_chk") /// void *__memset_chk(void *s, char v, size_t n, size_t s1size); TLI_DEFINE_ENUM_INTERNAL(memset_chk) TLI_DEFINE_STRING_INTERNAL("__memset_chk") /// double __sincospi_stret(double x); TLI_DEFINE_ENUM_INTERNAL(sincospi_stret) TLI_DEFINE_STRING_INTERNAL("__sincospi_stret") /// float __sincospif_stret(float x); TLI_DEFINE_ENUM_INTERNAL(sincospif_stret) TLI_DEFINE_STRING_INTERNAL("__sincospif_stret") /// double __sinpi(double x); TLI_DEFINE_ENUM_INTERNAL(sinpi) TLI_DEFINE_STRING_INTERNAL("__sinpi") /// float __sinpif(float x); TLI_DEFINE_ENUM_INTERNAL(sinpif) TLI_DEFINE_STRING_INTERNAL("__sinpif") /// double __sqrt_finite(double x); TLI_DEFINE_ENUM_INTERNAL(sqrt_finite) TLI_DEFINE_STRING_INTERNAL("__sqrt_finite") /// float __sqrt_finite(float x); TLI_DEFINE_ENUM_INTERNAL(sqrtf_finite) TLI_DEFINE_STRING_INTERNAL("__sqrtf_finite") /// long double __sqrt_finite(long double x); TLI_DEFINE_ENUM_INTERNAL(sqrtl_finite) TLI_DEFINE_STRING_INTERNAL("__sqrtl_finite") /// char *__stpcpy_chk(char *s1, const char *s2, size_t s1size); TLI_DEFINE_ENUM_INTERNAL(stpcpy_chk) TLI_DEFINE_STRING_INTERNAL("__stpcpy_chk") /// char *__stpncpy_chk(char *s1, const char *s2, size_t n, size_t s1size); TLI_DEFINE_ENUM_INTERNAL(stpncpy_chk) TLI_DEFINE_STRING_INTERNAL("__stpncpy_chk") /// char *__strcpy_chk(char *s1, const char *s2, size_t s1size); TLI_DEFINE_ENUM_INTERNAL(strcpy_chk) TLI_DEFINE_STRING_INTERNAL("__strcpy_chk") /// char * __strdup(const char *s); TLI_DEFINE_ENUM_INTERNAL(dunder_strdup) TLI_DEFINE_STRING_INTERNAL("__strdup") /// char *__strncpy_chk(char *s1, const char *s2, size_t n, size_t s1size); TLI_DEFINE_ENUM_INTERNAL(strncpy_chk) TLI_DEFINE_STRING_INTERNAL("__strncpy_chk") /// char *__strndup(const char *s, size_t n); TLI_DEFINE_ENUM_INTERNAL(dunder_strndup) TLI_DEFINE_STRING_INTERNAL("__strndup") /// char * __strtok_r(char *s, const char *delim, char **save_ptr); TLI_DEFINE_ENUM_INTERNAL(dunder_strtok_r) TLI_DEFINE_STRING_INTERNAL("__strtok_r") /// int abs(int j); TLI_DEFINE_ENUM_INTERNAL(abs) TLI_DEFINE_STRING_INTERNAL("abs") /// int access(const char *path, int amode); TLI_DEFINE_ENUM_INTERNAL(access) TLI_DEFINE_STRING_INTERNAL("access") /// double acos(double x); TLI_DEFINE_ENUM_INTERNAL(acos) TLI_DEFINE_STRING_INTERNAL("acos") /// float acosf(float x); TLI_DEFINE_ENUM_INTERNAL(acosf) TLI_DEFINE_STRING_INTERNAL("acosf") /// double acosh(double x); TLI_DEFINE_ENUM_INTERNAL(acosh) TLI_DEFINE_STRING_INTERNAL("acosh") /// float acoshf(float x); TLI_DEFINE_ENUM_INTERNAL(acoshf) TLI_DEFINE_STRING_INTERNAL("acoshf") /// long double acoshl(long double x); TLI_DEFINE_ENUM_INTERNAL(acoshl) TLI_DEFINE_STRING_INTERNAL("acoshl") /// long double acosl(long double x); TLI_DEFINE_ENUM_INTERNAL(acosl) TLI_DEFINE_STRING_INTERNAL("acosl") /// double asin(double x); TLI_DEFINE_ENUM_INTERNAL(asin) TLI_DEFINE_STRING_INTERNAL("asin") /// float asinf(float x); TLI_DEFINE_ENUM_INTERNAL(asinf) TLI_DEFINE_STRING_INTERNAL("asinf") /// double asinh(double x); TLI_DEFINE_ENUM_INTERNAL(asinh) TLI_DEFINE_STRING_INTERNAL("asinh") /// float asinhf(float x); TLI_DEFINE_ENUM_INTERNAL(asinhf) TLI_DEFINE_STRING_INTERNAL("asinhf") /// long double asinhl(long double x); TLI_DEFINE_ENUM_INTERNAL(asinhl) TLI_DEFINE_STRING_INTERNAL("asinhl") /// long double asinl(long double x); TLI_DEFINE_ENUM_INTERNAL(asinl) TLI_DEFINE_STRING_INTERNAL("asinl") /// double atan(double x); TLI_DEFINE_ENUM_INTERNAL(atan) TLI_DEFINE_STRING_INTERNAL("atan") /// double atan2(double y, double x); TLI_DEFINE_ENUM_INTERNAL(atan2) TLI_DEFINE_STRING_INTERNAL("atan2") /// float atan2f(float y, float x); TLI_DEFINE_ENUM_INTERNAL(atan2f) TLI_DEFINE_STRING_INTERNAL("atan2f") /// long double atan2l(long double y, long double x); TLI_DEFINE_ENUM_INTERNAL(atan2l) TLI_DEFINE_STRING_INTERNAL("atan2l") /// float atanf(float x); TLI_DEFINE_ENUM_INTERNAL(atanf) TLI_DEFINE_STRING_INTERNAL("atanf") /// double atanh(double x); TLI_DEFINE_ENUM_INTERNAL(atanh) TLI_DEFINE_STRING_INTERNAL("atanh") /// float atanhf(float x); TLI_DEFINE_ENUM_INTERNAL(atanhf) TLI_DEFINE_STRING_INTERNAL("atanhf") /// long double atanhl(long double x); TLI_DEFINE_ENUM_INTERNAL(atanhl) TLI_DEFINE_STRING_INTERNAL("atanhl") /// long double atanl(long double x); TLI_DEFINE_ENUM_INTERNAL(atanl) TLI_DEFINE_STRING_INTERNAL("atanl") /// double atof(const char *str); TLI_DEFINE_ENUM_INTERNAL(atof) TLI_DEFINE_STRING_INTERNAL("atof") /// int atoi(const char *str); TLI_DEFINE_ENUM_INTERNAL(atoi) TLI_DEFINE_STRING_INTERNAL("atoi") /// long atol(const char *str); TLI_DEFINE_ENUM_INTERNAL(atol) TLI_DEFINE_STRING_INTERNAL("atol") /// long long atoll(const char *nptr); TLI_DEFINE_ENUM_INTERNAL(atoll) TLI_DEFINE_STRING_INTERNAL("atoll") /// int bcmp(const void *s1, const void *s2, size_t n); TLI_DEFINE_ENUM_INTERNAL(bcmp) TLI_DEFINE_STRING_INTERNAL("bcmp") /// void bcopy(const void *s1, void *s2, size_t n); TLI_DEFINE_ENUM_INTERNAL(bcopy) TLI_DEFINE_STRING_INTERNAL("bcopy") /// void bzero(void *s, size_t n); TLI_DEFINE_ENUM_INTERNAL(bzero) TLI_DEFINE_STRING_INTERNAL("bzero") /// void *calloc(size_t count, size_t size); TLI_DEFINE_ENUM_INTERNAL(calloc) TLI_DEFINE_STRING_INTERNAL("calloc") /// double cbrt(double x); TLI_DEFINE_ENUM_INTERNAL(cbrt) TLI_DEFINE_STRING_INTERNAL("cbrt") /// float cbrtf(float x); TLI_DEFINE_ENUM_INTERNAL(cbrtf) TLI_DEFINE_STRING_INTERNAL("cbrtf") /// long double cbrtl(long double x); TLI_DEFINE_ENUM_INTERNAL(cbrtl) TLI_DEFINE_STRING_INTERNAL("cbrtl") /// double ceil(double x); TLI_DEFINE_ENUM_INTERNAL(ceil) TLI_DEFINE_STRING_INTERNAL("ceil") /// float ceilf(float x); TLI_DEFINE_ENUM_INTERNAL(ceilf) TLI_DEFINE_STRING_INTERNAL("ceilf") /// long double ceill(long double x); TLI_DEFINE_ENUM_INTERNAL(ceill) TLI_DEFINE_STRING_INTERNAL("ceill") /// int chmod(const char *path, mode_t mode); TLI_DEFINE_ENUM_INTERNAL(chmod) TLI_DEFINE_STRING_INTERNAL("chmod") /// int chown(const char *path, uid_t owner, gid_t group); TLI_DEFINE_ENUM_INTERNAL(chown) TLI_DEFINE_STRING_INTERNAL("chown") /// void clearerr(FILE *stream); TLI_DEFINE_ENUM_INTERNAL(clearerr) TLI_DEFINE_STRING_INTERNAL("clearerr") /// int closedir(DIR *dirp); TLI_DEFINE_ENUM_INTERNAL(closedir) TLI_DEFINE_STRING_INTERNAL("closedir") /// double copysign(double x, double y); TLI_DEFINE_ENUM_INTERNAL(copysign) TLI_DEFINE_STRING_INTERNAL("copysign") /// float copysignf(float x, float y); TLI_DEFINE_ENUM_INTERNAL(copysignf) TLI_DEFINE_STRING_INTERNAL("copysignf") /// long double copysignl(long double x, long double y); TLI_DEFINE_ENUM_INTERNAL(copysignl) TLI_DEFINE_STRING_INTERNAL("copysignl") /// double cos(double x); TLI_DEFINE_ENUM_INTERNAL(cos) TLI_DEFINE_STRING_INTERNAL("cos") /// float cosf(float x); TLI_DEFINE_ENUM_INTERNAL(cosf) TLI_DEFINE_STRING_INTERNAL("cosf") /// double cosh(double x); TLI_DEFINE_ENUM_INTERNAL(cosh) TLI_DEFINE_STRING_INTERNAL("cosh") /// float coshf(float x); TLI_DEFINE_ENUM_INTERNAL(coshf) TLI_DEFINE_STRING_INTERNAL("coshf") /// long double coshl(long double x); TLI_DEFINE_ENUM_INTERNAL(coshl) TLI_DEFINE_STRING_INTERNAL("coshl") /// long double cosl(long double x); TLI_DEFINE_ENUM_INTERNAL(cosl) TLI_DEFINE_STRING_INTERNAL("cosl") /// char *ctermid(char *s); TLI_DEFINE_ENUM_INTERNAL(ctermid) TLI_DEFINE_STRING_INTERNAL("ctermid") /// double exp(double x); TLI_DEFINE_ENUM_INTERNAL(exp) TLI_DEFINE_STRING_INTERNAL("exp") /// double exp10(double x); TLI_DEFINE_ENUM_INTERNAL(exp10) TLI_DEFINE_STRING_INTERNAL("exp10") /// float exp10f(float x); TLI_DEFINE_ENUM_INTERNAL(exp10f) TLI_DEFINE_STRING_INTERNAL("exp10f") /// long double exp10l(long double x); TLI_DEFINE_ENUM_INTERNAL(exp10l) TLI_DEFINE_STRING_INTERNAL("exp10l") /// double exp2(double x); TLI_DEFINE_ENUM_INTERNAL(exp2) TLI_DEFINE_STRING_INTERNAL("exp2") /// float exp2f(float x); TLI_DEFINE_ENUM_INTERNAL(exp2f) TLI_DEFINE_STRING_INTERNAL("exp2f") /// long double exp2l(long double x); TLI_DEFINE_ENUM_INTERNAL(exp2l) TLI_DEFINE_STRING_INTERNAL("exp2l") /// float expf(float x); TLI_DEFINE_ENUM_INTERNAL(expf) TLI_DEFINE_STRING_INTERNAL("expf") /// long double expl(long double x); TLI_DEFINE_ENUM_INTERNAL(expl) TLI_DEFINE_STRING_INTERNAL("expl") /// double expm1(double x); TLI_DEFINE_ENUM_INTERNAL(expm1) TLI_DEFINE_STRING_INTERNAL("expm1") /// float expm1f(float x); TLI_DEFINE_ENUM_INTERNAL(expm1f) TLI_DEFINE_STRING_INTERNAL("expm1f") /// long double expm1l(long double x); TLI_DEFINE_ENUM_INTERNAL(expm1l) TLI_DEFINE_STRING_INTERNAL("expm1l") /// double fabs(double x); TLI_DEFINE_ENUM_INTERNAL(fabs) TLI_DEFINE_STRING_INTERNAL("fabs") /// float fabsf(float x); TLI_DEFINE_ENUM_INTERNAL(fabsf) TLI_DEFINE_STRING_INTERNAL("fabsf") /// long double fabsl(long double x); TLI_DEFINE_ENUM_INTERNAL(fabsl) TLI_DEFINE_STRING_INTERNAL("fabsl") /// int fclose(FILE *stream); TLI_DEFINE_ENUM_INTERNAL(fclose) TLI_DEFINE_STRING_INTERNAL("fclose") /// FILE *fdopen(int fildes, const char *mode); TLI_DEFINE_ENUM_INTERNAL(fdopen) TLI_DEFINE_STRING_INTERNAL("fdopen") /// int feof(FILE *stream); TLI_DEFINE_ENUM_INTERNAL(feof) TLI_DEFINE_STRING_INTERNAL("feof") /// int ferror(FILE *stream); TLI_DEFINE_ENUM_INTERNAL(ferror) TLI_DEFINE_STRING_INTERNAL("ferror") /// int fflush(FILE *stream); TLI_DEFINE_ENUM_INTERNAL(fflush) TLI_DEFINE_STRING_INTERNAL("fflush") /// int ffs(int i); TLI_DEFINE_ENUM_INTERNAL(ffs) TLI_DEFINE_STRING_INTERNAL("ffs") /// int ffsl(long int i); TLI_DEFINE_ENUM_INTERNAL(ffsl) TLI_DEFINE_STRING_INTERNAL("ffsl") /// int ffsll(long long int i); TLI_DEFINE_ENUM_INTERNAL(ffsll) TLI_DEFINE_STRING_INTERNAL("ffsll") /// int fgetc(FILE *stream); TLI_DEFINE_ENUM_INTERNAL(fgetc) TLI_DEFINE_STRING_INTERNAL("fgetc") /// int fgetpos(FILE *stream, fpos_t *pos); TLI_DEFINE_ENUM_INTERNAL(fgetpos) TLI_DEFINE_STRING_INTERNAL("fgetpos") /// char *fgets(char *s, int n, FILE *stream); TLI_DEFINE_ENUM_INTERNAL(fgets) TLI_DEFINE_STRING_INTERNAL("fgets") /// int fileno(FILE *stream); TLI_DEFINE_ENUM_INTERNAL(fileno) TLI_DEFINE_STRING_INTERNAL("fileno") /// int fiprintf(FILE *stream, const char *format, ...); TLI_DEFINE_ENUM_INTERNAL(fiprintf) TLI_DEFINE_STRING_INTERNAL("fiprintf") /// void flockfile(FILE *file); TLI_DEFINE_ENUM_INTERNAL(flockfile) TLI_DEFINE_STRING_INTERNAL("flockfile") /// double floor(double x); TLI_DEFINE_ENUM_INTERNAL(floor) TLI_DEFINE_STRING_INTERNAL("floor") /// float floorf(float x); TLI_DEFINE_ENUM_INTERNAL(floorf) TLI_DEFINE_STRING_INTERNAL("floorf") /// long double floorl(long double x); TLI_DEFINE_ENUM_INTERNAL(floorl) TLI_DEFINE_STRING_INTERNAL("floorl") /// double fmax(double x, double y); TLI_DEFINE_ENUM_INTERNAL(fmax) TLI_DEFINE_STRING_INTERNAL("fmax") /// float fmaxf(float x, float y); TLI_DEFINE_ENUM_INTERNAL(fmaxf) TLI_DEFINE_STRING_INTERNAL("fmaxf") /// long double fmaxl(long double x, long double y); TLI_DEFINE_ENUM_INTERNAL(fmaxl) TLI_DEFINE_STRING_INTERNAL("fmaxl") /// double fmin(double x, double y); TLI_DEFINE_ENUM_INTERNAL(fmin) TLI_DEFINE_STRING_INTERNAL("fmin") /// float fminf(float x, float y); TLI_DEFINE_ENUM_INTERNAL(fminf) TLI_DEFINE_STRING_INTERNAL("fminf") /// long double fminl(long double x, long double y); TLI_DEFINE_ENUM_INTERNAL(fminl) TLI_DEFINE_STRING_INTERNAL("fminl") /// double fmod(double x, double y); TLI_DEFINE_ENUM_INTERNAL(fmod) TLI_DEFINE_STRING_INTERNAL("fmod") /// float fmodf(float x, float y); TLI_DEFINE_ENUM_INTERNAL(fmodf) TLI_DEFINE_STRING_INTERNAL("fmodf") /// long double fmodl(long double x, long double y); TLI_DEFINE_ENUM_INTERNAL(fmodl) TLI_DEFINE_STRING_INTERNAL("fmodl") /// FILE *fopen(const char *filename, const char *mode); TLI_DEFINE_ENUM_INTERNAL(fopen) TLI_DEFINE_STRING_INTERNAL("fopen") #if 0 // HLSL Change Starts - Exclude potentially duplicate 64bit versions /// FILE *fopen64(const char *filename, const char *opentype) TLI_DEFINE_ENUM_INTERNAL(fopen64) TLI_DEFINE_STRING_INTERNAL("fopen64") #endif // HLSL Change Ends /// int fprintf(FILE *stream, const char *format, ...); TLI_DEFINE_ENUM_INTERNAL(fprintf) TLI_DEFINE_STRING_INTERNAL("fprintf") /// int fputc(int c, FILE *stream); TLI_DEFINE_ENUM_INTERNAL(fputc) TLI_DEFINE_STRING_INTERNAL("fputc") /// int fputs(const char *s, FILE *stream); TLI_DEFINE_ENUM_INTERNAL(fputs) TLI_DEFINE_STRING_INTERNAL("fputs") /// size_t fread(void *ptr, size_t size, size_t nitems, FILE *stream); TLI_DEFINE_ENUM_INTERNAL(fread) TLI_DEFINE_STRING_INTERNAL("fread") /// void free(void *ptr); TLI_DEFINE_ENUM_INTERNAL(free) TLI_DEFINE_STRING_INTERNAL("free") /// double frexp(double num, int *exp); TLI_DEFINE_ENUM_INTERNAL(frexp) TLI_DEFINE_STRING_INTERNAL("frexp") /// float frexpf(float num, int *exp); TLI_DEFINE_ENUM_INTERNAL(frexpf) TLI_DEFINE_STRING_INTERNAL("frexpf") /// long double frexpl(long double num, int *exp); TLI_DEFINE_ENUM_INTERNAL(frexpl) TLI_DEFINE_STRING_INTERNAL("frexpl") /// int fscanf(FILE *stream, const char *format, ... ); TLI_DEFINE_ENUM_INTERNAL(fscanf) TLI_DEFINE_STRING_INTERNAL("fscanf") /// int fseek(FILE *stream, long offset, int whence); TLI_DEFINE_ENUM_INTERNAL(fseek) TLI_DEFINE_STRING_INTERNAL("fseek") /// int fseeko(FILE *stream, off_t offset, int whence); TLI_DEFINE_ENUM_INTERNAL(fseeko) TLI_DEFINE_STRING_INTERNAL("fseeko") #if 0 // HLSL Change Starts - Exclude potentially duplicate 64bit versions /// int fseeko64(FILE *stream, off64_t offset, int whence) TLI_DEFINE_ENUM_INTERNAL(fseeko64) TLI_DEFINE_STRING_INTERNAL("fseeko64") #endif // HLSL Change Ends /// int fsetpos(FILE *stream, const fpos_t *pos); TLI_DEFINE_ENUM_INTERNAL(fsetpos) TLI_DEFINE_STRING_INTERNAL("fsetpos") /// int fstat(int fildes, struct stat *buf); TLI_DEFINE_ENUM_INTERNAL(fstat) TLI_DEFINE_STRING_INTERNAL("fstat") /// int fstat64(int filedes, struct stat64 *buf) TLI_DEFINE_ENUM_INTERNAL(fstat64) TLI_DEFINE_STRING_INTERNAL("fstat64") /// int fstatvfs(int fildes, struct statvfs *buf); TLI_DEFINE_ENUM_INTERNAL(fstatvfs) TLI_DEFINE_STRING_INTERNAL("fstatvfs") /// int fstatvfs64(int fildes, struct statvfs64 *buf); TLI_DEFINE_ENUM_INTERNAL(fstatvfs64) TLI_DEFINE_STRING_INTERNAL("fstatvfs64") /// long ftell(FILE *stream); TLI_DEFINE_ENUM_INTERNAL(ftell) TLI_DEFINE_STRING_INTERNAL("ftell") /// off_t ftello(FILE *stream); TLI_DEFINE_ENUM_INTERNAL(ftello) TLI_DEFINE_STRING_INTERNAL("ftello") #if 0 // HLSL Change Starts - Exclude potentially duplicate 64bit versions /// off64_t ftello64(FILE *stream) TLI_DEFINE_ENUM_INTERNAL(ftello64) TLI_DEFINE_STRING_INTERNAL("ftello64") #endif // HLSL Change Ends /// int ftrylockfile(FILE *file); TLI_DEFINE_ENUM_INTERNAL(ftrylockfile) TLI_DEFINE_STRING_INTERNAL("ftrylockfile") /// void funlockfile(FILE *file); TLI_DEFINE_ENUM_INTERNAL(funlockfile) TLI_DEFINE_STRING_INTERNAL("funlockfile") /// size_t fwrite(const void *ptr, size_t size, size_t nitems, FILE *stream); TLI_DEFINE_ENUM_INTERNAL(fwrite) TLI_DEFINE_STRING_INTERNAL("fwrite") /// int getc(FILE *stream); TLI_DEFINE_ENUM_INTERNAL(getc) TLI_DEFINE_STRING_INTERNAL("getc") /// int getc_unlocked(FILE *stream); TLI_DEFINE_ENUM_INTERNAL(getc_unlocked) TLI_DEFINE_STRING_INTERNAL("getc_unlocked") /// int getchar(void); TLI_DEFINE_ENUM_INTERNAL(getchar) TLI_DEFINE_STRING_INTERNAL("getchar") /// char *getenv(const char *name); TLI_DEFINE_ENUM_INTERNAL(getenv) TLI_DEFINE_STRING_INTERNAL("getenv") /// int getitimer(int which, struct itimerval *value); TLI_DEFINE_ENUM_INTERNAL(getitimer) TLI_DEFINE_STRING_INTERNAL("getitimer") /// int getlogin_r(char *name, size_t namesize); TLI_DEFINE_ENUM_INTERNAL(getlogin_r) TLI_DEFINE_STRING_INTERNAL("getlogin_r") /// struct passwd *getpwnam(const char *name); TLI_DEFINE_ENUM_INTERNAL(getpwnam) TLI_DEFINE_STRING_INTERNAL("getpwnam") /// char *gets(char *s); TLI_DEFINE_ENUM_INTERNAL(gets) TLI_DEFINE_STRING_INTERNAL("gets") /// int gettimeofday(struct timeval *tp, void *tzp); TLI_DEFINE_ENUM_INTERNAL(gettimeofday) TLI_DEFINE_STRING_INTERNAL("gettimeofday") /// uint32_t htonl(uint32_t hostlong); TLI_DEFINE_ENUM_INTERNAL(htonl) TLI_DEFINE_STRING_INTERNAL("htonl") /// uint16_t htons(uint16_t hostshort); TLI_DEFINE_ENUM_INTERNAL(htons) TLI_DEFINE_STRING_INTERNAL("htons") /// int iprintf(const char *format, ...); TLI_DEFINE_ENUM_INTERNAL(iprintf) TLI_DEFINE_STRING_INTERNAL("iprintf") /// int isascii(int c); TLI_DEFINE_ENUM_INTERNAL(isascii) TLI_DEFINE_STRING_INTERNAL("isascii") /// int isdigit(int c); TLI_DEFINE_ENUM_INTERNAL(isdigit) TLI_DEFINE_STRING_INTERNAL("isdigit") /// long int labs(long int j); TLI_DEFINE_ENUM_INTERNAL(labs) TLI_DEFINE_STRING_INTERNAL("labs") /// int lchown(const char *path, uid_t owner, gid_t group); TLI_DEFINE_ENUM_INTERNAL(lchown) TLI_DEFINE_STRING_INTERNAL("lchown") /// double ldexp(double x, int n); TLI_DEFINE_ENUM_INTERNAL(ldexp) TLI_DEFINE_STRING_INTERNAL("ldexp") /// float ldexpf(float x, int n); TLI_DEFINE_ENUM_INTERNAL(ldexpf) TLI_DEFINE_STRING_INTERNAL("ldexpf") /// long double ldexpl(long double x, int n); TLI_DEFINE_ENUM_INTERNAL(ldexpl) TLI_DEFINE_STRING_INTERNAL("ldexpl") /// long long int llabs(long long int j); TLI_DEFINE_ENUM_INTERNAL(llabs) TLI_DEFINE_STRING_INTERNAL("llabs") /// double log(double x); TLI_DEFINE_ENUM_INTERNAL(log) TLI_DEFINE_STRING_INTERNAL("log") /// double log10(double x); TLI_DEFINE_ENUM_INTERNAL(log10) TLI_DEFINE_STRING_INTERNAL("log10") /// float log10f(float x); TLI_DEFINE_ENUM_INTERNAL(log10f) TLI_DEFINE_STRING_INTERNAL("log10f") /// long double log10l(long double x); TLI_DEFINE_ENUM_INTERNAL(log10l) TLI_DEFINE_STRING_INTERNAL("log10l") /// double log1p(double x); TLI_DEFINE_ENUM_INTERNAL(log1p) TLI_DEFINE_STRING_INTERNAL("log1p") /// float log1pf(float x); TLI_DEFINE_ENUM_INTERNAL(log1pf) TLI_DEFINE_STRING_INTERNAL("log1pf") /// long double log1pl(long double x); TLI_DEFINE_ENUM_INTERNAL(log1pl) TLI_DEFINE_STRING_INTERNAL("log1pl") /// double log2(double x); TLI_DEFINE_ENUM_INTERNAL(log2) TLI_DEFINE_STRING_INTERNAL("log2") /// float log2f(float x); TLI_DEFINE_ENUM_INTERNAL(log2f) TLI_DEFINE_STRING_INTERNAL("log2f") /// double long double log2l(long double x); TLI_DEFINE_ENUM_INTERNAL(log2l) TLI_DEFINE_STRING_INTERNAL("log2l") /// double logb(double x); TLI_DEFINE_ENUM_INTERNAL(logb) TLI_DEFINE_STRING_INTERNAL("logb") /// float logbf(float x); TLI_DEFINE_ENUM_INTERNAL(logbf) TLI_DEFINE_STRING_INTERNAL("logbf") /// long double logbl(long double x); TLI_DEFINE_ENUM_INTERNAL(logbl) TLI_DEFINE_STRING_INTERNAL("logbl") /// float logf(float x); TLI_DEFINE_ENUM_INTERNAL(logf) TLI_DEFINE_STRING_INTERNAL("logf") /// long double logl(long double x); TLI_DEFINE_ENUM_INTERNAL(logl) TLI_DEFINE_STRING_INTERNAL("logl") /// int lstat(const char *path, struct stat *buf); TLI_DEFINE_ENUM_INTERNAL(lstat) TLI_DEFINE_STRING_INTERNAL("lstat") /// int lstat64(const char *path, struct stat64 *buf); TLI_DEFINE_ENUM_INTERNAL(lstat64) TLI_DEFINE_STRING_INTERNAL("lstat64") /// void *malloc(size_t size); TLI_DEFINE_ENUM_INTERNAL(malloc) TLI_DEFINE_STRING_INTERNAL("malloc") /// void *memalign(size_t boundary, size_t size); TLI_DEFINE_ENUM_INTERNAL(memalign) TLI_DEFINE_STRING_INTERNAL("memalign") /// void *memccpy(void *s1, const void *s2, int c, size_t n); TLI_DEFINE_ENUM_INTERNAL(memccpy) TLI_DEFINE_STRING_INTERNAL("memccpy") /// void *memchr(const void *s, int c, size_t n); TLI_DEFINE_ENUM_INTERNAL(memchr) TLI_DEFINE_STRING_INTERNAL("memchr") /// int memcmp(const void *s1, const void *s2, size_t n); TLI_DEFINE_ENUM_INTERNAL(memcmp) TLI_DEFINE_STRING_INTERNAL("memcmp") /// void *memcpy(void *s1, const void *s2, size_t n); TLI_DEFINE_ENUM_INTERNAL(memcpy) TLI_DEFINE_STRING_INTERNAL("memcpy") /// void *memmove(void *s1, const void *s2, size_t n); TLI_DEFINE_ENUM_INTERNAL(memmove) TLI_DEFINE_STRING_INTERNAL("memmove") // void *memrchr(const void *s, int c, size_t n); TLI_DEFINE_ENUM_INTERNAL(memrchr) TLI_DEFINE_STRING_INTERNAL("memrchr") /// void *memset(void *b, int c, size_t len); TLI_DEFINE_ENUM_INTERNAL(memset) TLI_DEFINE_STRING_INTERNAL("memset") /// void memset_pattern16(void *b, const void *pattern16, size_t len); TLI_DEFINE_ENUM_INTERNAL(memset_pattern16) TLI_DEFINE_STRING_INTERNAL("memset_pattern16") /// int mkdir(const char *path, mode_t mode); TLI_DEFINE_ENUM_INTERNAL(mkdir) TLI_DEFINE_STRING_INTERNAL("mkdir") /// time_t mktime(struct tm *timeptr); TLI_DEFINE_ENUM_INTERNAL(mktime) TLI_DEFINE_STRING_INTERNAL("mktime") /// double modf(double x, double *iptr); TLI_DEFINE_ENUM_INTERNAL(modf) TLI_DEFINE_STRING_INTERNAL("modf") /// float modff(float, float *iptr); TLI_DEFINE_ENUM_INTERNAL(modff) TLI_DEFINE_STRING_INTERNAL("modff") /// long double modfl(long double value, long double *iptr); TLI_DEFINE_ENUM_INTERNAL(modfl) TLI_DEFINE_STRING_INTERNAL("modfl") /// double nearbyint(double x); TLI_DEFINE_ENUM_INTERNAL(nearbyint) TLI_DEFINE_STRING_INTERNAL("nearbyint") /// float nearbyintf(float x); TLI_DEFINE_ENUM_INTERNAL(nearbyintf) TLI_DEFINE_STRING_INTERNAL("nearbyintf") /// long double nearbyintl(long double x); TLI_DEFINE_ENUM_INTERNAL(nearbyintl) TLI_DEFINE_STRING_INTERNAL("nearbyintl") /// uint32_t ntohl(uint32_t netlong); TLI_DEFINE_ENUM_INTERNAL(ntohl) TLI_DEFINE_STRING_INTERNAL("ntohl") /// uint16_t ntohs(uint16_t netshort); TLI_DEFINE_ENUM_INTERNAL(ntohs) TLI_DEFINE_STRING_INTERNAL("ntohs") /// int open(const char *path, int oflag, ... ); TLI_DEFINE_ENUM_INTERNAL(open) TLI_DEFINE_STRING_INTERNAL("open") /// int open64(const char *filename, int flags[, mode_t mode]) TLI_DEFINE_ENUM_INTERNAL(open64) TLI_DEFINE_STRING_INTERNAL("open64") /// DIR *opendir(const char *dirname); TLI_DEFINE_ENUM_INTERNAL(opendir) TLI_DEFINE_STRING_INTERNAL("opendir") /// int pclose(FILE *stream); TLI_DEFINE_ENUM_INTERNAL(pclose) TLI_DEFINE_STRING_INTERNAL("pclose") /// void perror(const char *s); TLI_DEFINE_ENUM_INTERNAL(perror) TLI_DEFINE_STRING_INTERNAL("perror") /// FILE *popen(const char *command, const char *mode); TLI_DEFINE_ENUM_INTERNAL(popen) TLI_DEFINE_STRING_INTERNAL("popen") /// int posix_memalign(void **memptr, size_t alignment, size_t size); TLI_DEFINE_ENUM_INTERNAL(posix_memalign) TLI_DEFINE_STRING_INTERNAL("posix_memalign") /// double pow(double x, double y); TLI_DEFINE_ENUM_INTERNAL(pow) TLI_DEFINE_STRING_INTERNAL("pow") /// float powf(float x, float y); TLI_DEFINE_ENUM_INTERNAL(powf) TLI_DEFINE_STRING_INTERNAL("powf") /// long double powl(long double x, long double y); TLI_DEFINE_ENUM_INTERNAL(powl) TLI_DEFINE_STRING_INTERNAL("powl") /// ssize_t pread(int fildes, void *buf, size_t nbyte, off_t offset); TLI_DEFINE_ENUM_INTERNAL(pread) TLI_DEFINE_STRING_INTERNAL("pread") /// int printf(const char *format, ...); TLI_DEFINE_ENUM_INTERNAL(printf) TLI_DEFINE_STRING_INTERNAL("printf") /// int putc(int c, FILE *stream); TLI_DEFINE_ENUM_INTERNAL(putc) TLI_DEFINE_STRING_INTERNAL("putc") /// int putchar(int c); TLI_DEFINE_ENUM_INTERNAL(putchar) TLI_DEFINE_STRING_INTERNAL("putchar") /// int puts(const char *s); TLI_DEFINE_ENUM_INTERNAL(puts) TLI_DEFINE_STRING_INTERNAL("puts") /// ssize_t pwrite(int fildes, const void *buf, size_t nbyte, off_t offset); TLI_DEFINE_ENUM_INTERNAL(pwrite) TLI_DEFINE_STRING_INTERNAL("pwrite") /// void qsort(void *base, size_t nel, size_t width, /// int (*compar)(const void *, const void *)); TLI_DEFINE_ENUM_INTERNAL(qsort) TLI_DEFINE_STRING_INTERNAL("qsort") /// ssize_t read(int fildes, void *buf, size_t nbyte); TLI_DEFINE_ENUM_INTERNAL(read) TLI_DEFINE_STRING_INTERNAL("read") /// ssize_t readlink(const char *path, char *buf, size_t bufsize); TLI_DEFINE_ENUM_INTERNAL(readlink) TLI_DEFINE_STRING_INTERNAL("readlink") /// void *realloc(void *ptr, size_t size); TLI_DEFINE_ENUM_INTERNAL(realloc) TLI_DEFINE_STRING_INTERNAL("realloc") /// void *reallocf(void *ptr, size_t size); TLI_DEFINE_ENUM_INTERNAL(reallocf) TLI_DEFINE_STRING_INTERNAL("reallocf") /// char *realpath(const char *file_name, char *resolved_name); TLI_DEFINE_ENUM_INTERNAL(realpath) TLI_DEFINE_STRING_INTERNAL("realpath") /// int remove(const char *path); TLI_DEFINE_ENUM_INTERNAL(remove) TLI_DEFINE_STRING_INTERNAL("remove") /// int rename(const char *old, const char *new); TLI_DEFINE_ENUM_INTERNAL(rename) TLI_DEFINE_STRING_INTERNAL("rename") /// void rewind(FILE *stream); TLI_DEFINE_ENUM_INTERNAL(rewind) TLI_DEFINE_STRING_INTERNAL("rewind") /// double rint(double x); TLI_DEFINE_ENUM_INTERNAL(rint) TLI_DEFINE_STRING_INTERNAL("rint") /// float rintf(float x); TLI_DEFINE_ENUM_INTERNAL(rintf) TLI_DEFINE_STRING_INTERNAL("rintf") /// long double rintl(long double x); TLI_DEFINE_ENUM_INTERNAL(rintl) TLI_DEFINE_STRING_INTERNAL("rintl") /// int rmdir(const char *path); TLI_DEFINE_ENUM_INTERNAL(rmdir) TLI_DEFINE_STRING_INTERNAL("rmdir") /// double round(double x); TLI_DEFINE_ENUM_INTERNAL(round) TLI_DEFINE_STRING_INTERNAL("round") /// float roundf(float x); TLI_DEFINE_ENUM_INTERNAL(roundf) TLI_DEFINE_STRING_INTERNAL("roundf") /// long double roundl(long double x); TLI_DEFINE_ENUM_INTERNAL(roundl) TLI_DEFINE_STRING_INTERNAL("roundl") /// int scanf(const char *restrict format, ... ); TLI_DEFINE_ENUM_INTERNAL(scanf) TLI_DEFINE_STRING_INTERNAL("scanf") /// void setbuf(FILE *stream, char *buf); TLI_DEFINE_ENUM_INTERNAL(setbuf) TLI_DEFINE_STRING_INTERNAL("setbuf") /// int setitimer(int which, const struct itimerval *value, /// struct itimerval *ovalue); TLI_DEFINE_ENUM_INTERNAL(setitimer) TLI_DEFINE_STRING_INTERNAL("setitimer") /// int setvbuf(FILE *stream, char *buf, int type, size_t size); TLI_DEFINE_ENUM_INTERNAL(setvbuf) TLI_DEFINE_STRING_INTERNAL("setvbuf") /// double sin(double x); TLI_DEFINE_ENUM_INTERNAL(sin) TLI_DEFINE_STRING_INTERNAL("sin") /// float sinf(float x); TLI_DEFINE_ENUM_INTERNAL(sinf) TLI_DEFINE_STRING_INTERNAL("sinf") /// double sinh(double x); TLI_DEFINE_ENUM_INTERNAL(sinh) TLI_DEFINE_STRING_INTERNAL("sinh") /// float sinhf(float x); TLI_DEFINE_ENUM_INTERNAL(sinhf) TLI_DEFINE_STRING_INTERNAL("sinhf") /// long double sinhl(long double x); TLI_DEFINE_ENUM_INTERNAL(sinhl) TLI_DEFINE_STRING_INTERNAL("sinhl") /// long double sinl(long double x); TLI_DEFINE_ENUM_INTERNAL(sinl) TLI_DEFINE_STRING_INTERNAL("sinl") /// int siprintf(char *str, const char *format, ...); TLI_DEFINE_ENUM_INTERNAL(siprintf) TLI_DEFINE_STRING_INTERNAL("siprintf") /// int snprintf(char *s, size_t n, const char *format, ...); TLI_DEFINE_ENUM_INTERNAL(snprintf) TLI_DEFINE_STRING_INTERNAL("snprintf") /// int sprintf(char *str, const char *format, ...); TLI_DEFINE_ENUM_INTERNAL(sprintf) TLI_DEFINE_STRING_INTERNAL("sprintf") /// double sqrt(double x); TLI_DEFINE_ENUM_INTERNAL(sqrt) TLI_DEFINE_STRING_INTERNAL("sqrt") /// float sqrtf(float x); TLI_DEFINE_ENUM_INTERNAL(sqrtf) TLI_DEFINE_STRING_INTERNAL("sqrtf") /// long double sqrtl(long double x); TLI_DEFINE_ENUM_INTERNAL(sqrtl) TLI_DEFINE_STRING_INTERNAL("sqrtl") /// int sscanf(const char *s, const char *format, ... ); TLI_DEFINE_ENUM_INTERNAL(sscanf) TLI_DEFINE_STRING_INTERNAL("sscanf") /// int stat(const char *path, struct stat *buf); TLI_DEFINE_ENUM_INTERNAL(stat) TLI_DEFINE_STRING_INTERNAL("stat") /// int stat64(const char *path, struct stat64 *buf); TLI_DEFINE_ENUM_INTERNAL(stat64) TLI_DEFINE_STRING_INTERNAL("stat64") /// int statvfs(const char *path, struct statvfs *buf); TLI_DEFINE_ENUM_INTERNAL(statvfs) TLI_DEFINE_STRING_INTERNAL("statvfs") /// int statvfs64(const char *path, struct statvfs64 *buf) TLI_DEFINE_ENUM_INTERNAL(statvfs64) TLI_DEFINE_STRING_INTERNAL("statvfs64") /// char *stpcpy(char *s1, const char *s2); TLI_DEFINE_ENUM_INTERNAL(stpcpy) TLI_DEFINE_STRING_INTERNAL("stpcpy") /// char *stpncpy(char *s1, const char *s2, size_t n); TLI_DEFINE_ENUM_INTERNAL(stpncpy) TLI_DEFINE_STRING_INTERNAL("stpncpy") /// int strcasecmp(const char *s1, const char *s2); TLI_DEFINE_ENUM_INTERNAL(strcasecmp) TLI_DEFINE_STRING_INTERNAL("strcasecmp") /// char *strcat(char *s1, const char *s2); TLI_DEFINE_ENUM_INTERNAL(strcat) TLI_DEFINE_STRING_INTERNAL("strcat") /// char *strchr(const char *s, int c); TLI_DEFINE_ENUM_INTERNAL(strchr) TLI_DEFINE_STRING_INTERNAL("strchr") /// int strcmp(const char *s1, const char *s2); TLI_DEFINE_ENUM_INTERNAL(strcmp) TLI_DEFINE_STRING_INTERNAL("strcmp") /// int strcoll(const char *s1, const char *s2); TLI_DEFINE_ENUM_INTERNAL(strcoll) TLI_DEFINE_STRING_INTERNAL("strcoll") /// char *strcpy(char *s1, const char *s2); TLI_DEFINE_ENUM_INTERNAL(strcpy) TLI_DEFINE_STRING_INTERNAL("strcpy") /// size_t strcspn(const char *s1, const char *s2); TLI_DEFINE_ENUM_INTERNAL(strcspn) TLI_DEFINE_STRING_INTERNAL("strcspn") /// char *strdup(const char *s1); TLI_DEFINE_ENUM_INTERNAL(strdup) TLI_DEFINE_STRING_INTERNAL("strdup") /// size_t strlen(const char *s); TLI_DEFINE_ENUM_INTERNAL(strlen) TLI_DEFINE_STRING_INTERNAL("strlen") /// int strncasecmp(const char *s1, const char *s2, size_t n); TLI_DEFINE_ENUM_INTERNAL(strncasecmp) TLI_DEFINE_STRING_INTERNAL("strncasecmp") /// char *strncat(char *s1, const char *s2, size_t n); TLI_DEFINE_ENUM_INTERNAL(strncat) TLI_DEFINE_STRING_INTERNAL("strncat") /// int strncmp(const char *s1, const char *s2, size_t n); TLI_DEFINE_ENUM_INTERNAL(strncmp) TLI_DEFINE_STRING_INTERNAL("strncmp") /// char *strncpy(char *s1, const char *s2, size_t n); TLI_DEFINE_ENUM_INTERNAL(strncpy) TLI_DEFINE_STRING_INTERNAL("strncpy") /// char *strndup(const char *s1, size_t n); TLI_DEFINE_ENUM_INTERNAL(strndup) TLI_DEFINE_STRING_INTERNAL("strndup") /// size_t strnlen(const char *s, size_t maxlen); TLI_DEFINE_ENUM_INTERNAL(strnlen) TLI_DEFINE_STRING_INTERNAL("strnlen") /// char *strpbrk(const char *s1, const char *s2); TLI_DEFINE_ENUM_INTERNAL(strpbrk) TLI_DEFINE_STRING_INTERNAL("strpbrk") /// char *strrchr(const char *s, int c); TLI_DEFINE_ENUM_INTERNAL(strrchr) TLI_DEFINE_STRING_INTERNAL("strrchr") /// size_t strspn(const char *s1, const char *s2); TLI_DEFINE_ENUM_INTERNAL(strspn) TLI_DEFINE_STRING_INTERNAL("strspn") /// char *strstr(const char *s1, const char *s2); TLI_DEFINE_ENUM_INTERNAL(strstr) TLI_DEFINE_STRING_INTERNAL("strstr") /// double strtod(const char *nptr, char **endptr); TLI_DEFINE_ENUM_INTERNAL(strtod) TLI_DEFINE_STRING_INTERNAL("strtod") /// float strtof(const char *nptr, char **endptr); TLI_DEFINE_ENUM_INTERNAL(strtof) TLI_DEFINE_STRING_INTERNAL("strtof") // char *strtok(char *s1, const char *s2); TLI_DEFINE_ENUM_INTERNAL(strtok) TLI_DEFINE_STRING_INTERNAL("strtok") // char *strtok_r(char *s, const char *sep, char **lasts); TLI_DEFINE_ENUM_INTERNAL(strtok_r) TLI_DEFINE_STRING_INTERNAL("strtok_r") /// long int strtol(const char *nptr, char **endptr, int base); TLI_DEFINE_ENUM_INTERNAL(strtol) TLI_DEFINE_STRING_INTERNAL("strtol") /// long double strtold(const char *nptr, char **endptr); TLI_DEFINE_ENUM_INTERNAL(strtold) TLI_DEFINE_STRING_INTERNAL("strtold") /// long long int strtoll(const char *nptr, char **endptr, int base); TLI_DEFINE_ENUM_INTERNAL(strtoll) TLI_DEFINE_STRING_INTERNAL("strtoll") /// unsigned long int strtoul(const char *nptr, char **endptr, int base); TLI_DEFINE_ENUM_INTERNAL(strtoul) TLI_DEFINE_STRING_INTERNAL("strtoul") /// unsigned long long int strtoull(const char *nptr, char **endptr, int base); TLI_DEFINE_ENUM_INTERNAL(strtoull) TLI_DEFINE_STRING_INTERNAL("strtoull") /// size_t strxfrm(char *s1, const char *s2, size_t n); TLI_DEFINE_ENUM_INTERNAL(strxfrm) TLI_DEFINE_STRING_INTERNAL("strxfrm") /// int system(const char *command); TLI_DEFINE_ENUM_INTERNAL(system) TLI_DEFINE_STRING_INTERNAL("system") /// double tan(double x); TLI_DEFINE_ENUM_INTERNAL(tan) TLI_DEFINE_STRING_INTERNAL("tan") /// float tanf(float x); TLI_DEFINE_ENUM_INTERNAL(tanf) TLI_DEFINE_STRING_INTERNAL("tanf") /// double tanh(double x); TLI_DEFINE_ENUM_INTERNAL(tanh) TLI_DEFINE_STRING_INTERNAL("tanh") /// float tanhf(float x); TLI_DEFINE_ENUM_INTERNAL(tanhf) TLI_DEFINE_STRING_INTERNAL("tanhf") /// long double tanhl(long double x); TLI_DEFINE_ENUM_INTERNAL(tanhl) TLI_DEFINE_STRING_INTERNAL("tanhl") /// long double tanl(long double x); TLI_DEFINE_ENUM_INTERNAL(tanl) TLI_DEFINE_STRING_INTERNAL("tanl") /// clock_t times(struct tms *buffer); TLI_DEFINE_ENUM_INTERNAL(times) TLI_DEFINE_STRING_INTERNAL("times") /// FILE *tmpfile(void); TLI_DEFINE_ENUM_INTERNAL(tmpfile) TLI_DEFINE_STRING_INTERNAL("tmpfile") #if 0 // HLSL Change Starts - Exclude potentially duplicate 64bit versions /// FILE *tmpfile64(void) TLI_DEFINE_ENUM_INTERNAL(tmpfile64) TLI_DEFINE_STRING_INTERNAL("tmpfile64") #endif // HLSL Change Ends /// int toascii(int c); TLI_DEFINE_ENUM_INTERNAL(toascii) TLI_DEFINE_STRING_INTERNAL("toascii") /// double trunc(double x); TLI_DEFINE_ENUM_INTERNAL(trunc) TLI_DEFINE_STRING_INTERNAL("trunc") /// float truncf(float x); TLI_DEFINE_ENUM_INTERNAL(truncf) TLI_DEFINE_STRING_INTERNAL("truncf") /// long double truncl(long double x); TLI_DEFINE_ENUM_INTERNAL(truncl) TLI_DEFINE_STRING_INTERNAL("truncl") /// int uname(struct utsname *name); TLI_DEFINE_ENUM_INTERNAL(uname) TLI_DEFINE_STRING_INTERNAL("uname") /// int ungetc(int c, FILE *stream); TLI_DEFINE_ENUM_INTERNAL(ungetc) TLI_DEFINE_STRING_INTERNAL("ungetc") /// int unlink(const char *path); TLI_DEFINE_ENUM_INTERNAL(unlink) TLI_DEFINE_STRING_INTERNAL("unlink") /// int unsetenv(const char *name); TLI_DEFINE_ENUM_INTERNAL(unsetenv) TLI_DEFINE_STRING_INTERNAL("unsetenv") /// int utime(const char *path, const struct utimbuf *times); TLI_DEFINE_ENUM_INTERNAL(utime) TLI_DEFINE_STRING_INTERNAL("utime") /// int utimes(const char *path, const struct timeval times[2]); TLI_DEFINE_ENUM_INTERNAL(utimes) TLI_DEFINE_STRING_INTERNAL("utimes") /// void *valloc(size_t size); TLI_DEFINE_ENUM_INTERNAL(valloc) TLI_DEFINE_STRING_INTERNAL("valloc") /// int vfprintf(FILE *stream, const char *format, va_list ap); TLI_DEFINE_ENUM_INTERNAL(vfprintf) TLI_DEFINE_STRING_INTERNAL("vfprintf") /// int vfscanf(FILE *stream, const char *format, va_list arg); TLI_DEFINE_ENUM_INTERNAL(vfscanf) TLI_DEFINE_STRING_INTERNAL("vfscanf") /// int vprintf(const char *restrict format, va_list ap); TLI_DEFINE_ENUM_INTERNAL(vprintf) TLI_DEFINE_STRING_INTERNAL("vprintf") /// int vscanf(const char *format, va_list arg); TLI_DEFINE_ENUM_INTERNAL(vscanf) TLI_DEFINE_STRING_INTERNAL("vscanf") /// int vsnprintf(char *s, size_t n, const char *format, va_list ap); TLI_DEFINE_ENUM_INTERNAL(vsnprintf) TLI_DEFINE_STRING_INTERNAL("vsnprintf") /// int vsprintf(char *s, const char *format, va_list ap); TLI_DEFINE_ENUM_INTERNAL(vsprintf) TLI_DEFINE_STRING_INTERNAL("vsprintf") /// int vsscanf(const char *s, const char *format, va_list arg); TLI_DEFINE_ENUM_INTERNAL(vsscanf) TLI_DEFINE_STRING_INTERNAL("vsscanf") /// ssize_t write(int fildes, const void *buf, size_t nbyte); TLI_DEFINE_ENUM_INTERNAL(write) TLI_DEFINE_STRING_INTERNAL("write") #undef TLI_DEFINE_ENUM_INTERNAL #undef TLI_DEFINE_STRING_INTERNAL #endif // One of TLI_DEFINE_ENUM/STRING are defined. #undef TLI_DEFINE_ENUM #undef TLI_DEFINE_STRING
Q: ios : change window.rootViewController and memory management I'm facing the following problem : My app has two main controller (a)loginController and (b) contentController, when the app is launched I check if the user is logged in if yes I show the contentController otherwise I show the login controller. So basically in didFinishLaunchingWithOptions I assign one of this controller to window.rootViewController. The problem is when I want to switch from one controller to the other (because the user made a login or logout) to accomplish this I use the following code : [UIView transitionWithView:self.window duration:0.65 options:UIViewAnimationOptionTransitionFlipFromLeft animations:^{ self.window.rootViewController = self.contentController; } completion:^(BOOL finished){ [self.loginController release]; }]; before this transition window.rootViewController was loginController, the problem here is that when this code is executed I receive the following error: -[loginController _preferredInterfaceOrientationGivenCurrentOrientation:]: message sent to deallocated instance 0x1c55b490 I would like to understand how can I release my controller without getting this error. It would be also great if someone could suggest me what is the best approach to change window.rootViewController at runtime. A: Without seeing a lot more code it is impossible to determine why you are having memory management issues. But I'd like to offer a different answer. Make your content controller the window's root controller at all times. If you need to show the login screen, present it as a modal view controller over the content controller. This will be much easier than switching root view controllers. You can present it with no animation on startup so the user never sees it transition. Upon login you could dismiss any number of ways to reveal the content controller underneath it. If the user logs out, you can then present the login controller again, as a modal controller over the content controller.
Q: Translation of a Macklemore lyric We are creating our own family crest, and would like a translation of a lyric "no freedom til we're equal". I've looked on Google Translate, but quickly realised it's going to end up reading like a dodgy tattoo. I can see that changing the wording on this slightly, gives very different translations, so I guess I'm looking for the closest in style and meaning. Any help would be appreciated. A: The following phrase should suit you just fine if your desire is an entirely literal translation, rather than something more pragmatic: Lībertās nūlla dōnec aequālēs sumus. or Lībertātem nūllam habēbimus dōnec aequālēs sumus. Which translates literally to: No freedom until we are equal. We shall have no freedom until we are equal. I included habēbimus in the original phrase as I felt that it made more clear to whom the freedom would belong; however, it can be dropped without removing any critical meaning. Since you mentioned that this phrase would be included in a family crest and a tattoo, you probably don't want either to have the orthography of my previously provided quote, but rather, in the orthography of Classical Latin (all capitals, lack of a letter uU, apices marking long vowels, etc): LIBERTAS•NVLLA•DONEC•AEQVALES•SVMVS or LIBERTATEM•NVLLAM•HABEBIMVS•DONEC•AEQVALES•SVMVS But, the final style is obviously up to you. You can read more about the orthography of Classical Latin (with both formal and informal orthographies described) here. A: Your motto made me recall Ovid's famous line: Donec eris felix multos numerabis amicos. As long as you are happy you will have many friends. Imitating this and holding on to hexameter, I arrived at this suggestion: Donec eris mihi par poteris tibi vivere liber. As long as you are my equal you can live your own life free. This is not exactly what you wished. I needed some poetic licence to fit the metric constraints, but I personally feel that hexameter makes a motto more classy.
Scientists Discover The Gene Involved In Turning Hair Grey For the first time, researchers have identified a gene that’s involved in hair turning grey. And only people with European ancestry carried it, which could explain why some people can keep their nature colour into old age, while the rest of us start seeing grey hairs before our 30th birthdays. Scientists have long understood how our hair turns grey – as we age, we tend to stop producing as much of a pigment called melanin – but they haven’t been able to figure out why, or, more importantly, how to stop it. Understanding the gene involved in the process could change that, and could potentially lead to new treatments to avoid grey hair altogether. “We already know several genes involved in balding and hair colour but this is the first time a gene for greying has been identified in humans, as well as other genes influencing hair shape and density,” said one of the researchers, Kaustubh Adhikari, from University College London. The study looked at the genomes of more than 6,000 people in Latin America who came from a diverse range of backgrounds, including African, European, and Native American. By scanning their DNA and comparing it to their appearance, researchers were able to identify 18 genes that appear to influence hair traits – including grey hair, beard thickness, whether hair is curly or straight, and even whether or not someone will develop a unibrow. The gene found to be linked to grey hair is called IRF4, and it’s been shown in previous studies to be influence the production of melanin. But this is the first time anyone has been able to associate it with grey hair.
PARIS (Reuters) - France is consulting with its European partners about the situation in Venezuela, the president’s office said on Wednesday as the South American country’s opposition leader declared himself interim president. “We are closely following the situation and we are consulting our European partners,” a presidency official told Reuters after several countries in the region and Washington recognized opposition head Juan Guaido as interim president.
Q: is brk(0) taking taking too much time? This is an output of strace -T -ttt -ff -x -y -o pid.trace -p 2145 . Trace given below. 1503431273.934716 semop(1204093022, {{0, 1, SEM_UNDO}}, 1) = 0 <0.000004> 1503431273.934737 clock_gettime(CLOCK_REALTIME, {1503431273, 934741536}) = 0 <0.000004> 1503431273.934763 write(6</home/red/samples/debug/hexa.debug>, "17.08.23 01:17:53 [ hexa:2145"..., 79) = 79 <0.000016> 1503431273.934960 brk(0) = 0x1adc000 <0.000004> 1503431273.934974 brk(0x1afd000) = 0x1afd000 <0.000006> 1503431273.934994 brk(0) = 0x1afd000 <0.000003> 1503431273.935006 brk(0) = 0x1afd000 <0.000004> 1503431273.935017 brk(0x1afc000) = 0x1afc000 <0.000008> 1503431273.935033 brk(0) = 0x1afc000 <0.000003> 1503431273.935045 brk(0) = 0x1afc000 <0.000004> 1503431273.935057 brk(0) = 0x1afc000 <0.000004> 1503431273.935068 brk(0x1afb000) = 0x1afb000 <0.000005> 1503431273.935080 brk(0) = 0x1afb000 <0.000003> 1503431291.010338 brk(0) = 0x1afb000 <0.000006> 1503431291.010366 brk(0x1b1c000) = 0x1b1c000 <0.000006> 1503431291.010391 brk(0) = 0x1b1c000 <0.000003> 1503431291.010403 brk(0) = 0x1b1c000 <0.000004> 1503431291.010414 brk(0x1b12000) = 0x1b12000 <0.000008> 1503431291.010430 brk(0) = 0x1b12000 <0.000004> 1503431291.010443 brk(0) = 0x1b12000 <0.000004> 1503431291.010455 brk(0) = 0x1b12000 <0.000003> 1503431291.010466 brk(0x1b11000) = 0x1b11000 <0.000004> 1503431291.010478 brk(0) = 0x1b11000 <0.000004> 1503431301.277050 clock_gettime(CLOCK_REALTIME, {1503431301, 277067441}) = 0 <0.000005> 1503431301.277094 write(6</home/red/samples/debug/hexa.debug>, "17.08.23 01:18:21 [ hexa:2145"..., 91) = 91 <0.000019> 1503431301.277201 clock_gettime(CLOCK_REALTIME, {1503431301, 277216542}) = 0 <0.000005> 1503431301.277234 write(6</home/red/samples/debug/hexa.debug>, "17.08.23 01:18:21 [ hexa:2145"..., 126) = 126 <0.000018> 1503431301.277296 clock_gettime(CLOCK_REALTIME, {1503431301, 277301142}) = 0 <0.000004> 1503431301.277317 write(6</home/red/samples/debug/hexa.debug>, "17.08.23 01:18:21 [ hexa:2145"..., 126) = 126 <0.000012> 1503431301.288030 clock_gettime(CLOCK_REALTIME, {1503431301, 288037704}) = 0 <0.000004> if you look at the above trace at two brk(0)s (please see 1503431273.935080 and 1503431291.010478) taking too much time, around 17 seconds and 10 seconds respectively (comparing left side time). But execution time in the right side is just minimal. I have done multiple runs of this program, in the same Redhat Linux box (7.2), all runs were giving same timings (with microseconds difference) at same place of system call (brk(0)). What could be the issue? is it at Programming Level or OS level? I am not having source code for this, but I know it is a c/c++ program. A: To answer the question in the title: No, brk(0) is not taking too much time. You can see this by looking at the time reported for the syscall itself (<0.000003>, added by the -T option). That's only 3 microseconds. The values on the left are (absolute) timestamps. But that just means the process performed a brk syscall at 1503431273.935080 and another syscall at 1503431291.010338. That doesn't mean any single syscall took 17 seconds; it just means it took 17 seconds for the process to reach the next syscall. The process could have been doing many other things, such as doing raw computation (burning CPU), or not being scheduled (because the system was busy with other programs). The latter option is admittedly unlikely because you said this happened in multiple runs of the program. Therefore I think the most likely explanation is that the code just spends a lot of time computing things without needing to call the kernel (e.g. tight numeric code in a loop, with no memory allocation).
130 Cal.Rptr.2d 429 (2003) 106 Cal.App.4th 169 The PEOPLE, Plaintiff and Respondent, v. Hector Cortez GUTIERREZ, Defendant and Appellant. No. B159209. Court of Appeal, Second District, Division Eight. February 11, 2003. *430 Rene A. Ramos, under appointment by the Court of Appeal, Pasadena, for Defendant and Appellant. Bill Lockyer, Attorney General, Robert R. Anderson, Chief Assistant Attorney General, Pamela C. Hamanaka, Senior Assistant Attorney General, Deborah J. Chuang and Steven D. Matthews, Deputy Attorneys General, for Plaintiff and Respondent. RUBIN, J. Defendant Hector Cortez Gutierrez (appellant) appeals from the denial of his motion to set aside his guilty plea to a charge of attempted carjacking. He contends that the trial judge did not adequately explain to him the immigration consequences of his plea as required by Penal Code section 1016.5, and, therefore, the plea must be set aside under that statute.[1] We conclude that the trial court *431 complied with the legislative mandate when the plea was entered and properly denied appellant's subsequent motion to vacate. Accordingly, we affirm. PROCEDURAL HISTORY As the case comes to us following a plea, the underlying facts are of little moment. Suffice it to say that appellant and a confederate were charged with two counts of attempted carjacking in violation of section 664 and 215, subdivision (a). On March 24, 2000, both defendants entered pleas of guilty to one count and were sentenced to 18 months in state prison. The maximum sentence for attempted carjacking is four years six months. The remaining count was dismissed. In conjunction with entering his plea, appellant was advised of his constitutional rights and the nature and consequences of his plea both orally and by way of a written waiver form. In the course of the oral proceedings, the deputy district attorney asked appellant the following question: "If you are not a United States citizen, you will be deported from the United States, denied re-entry and denied amnesty or naturalization. [¶] Mr. Gutierrez, do you understand that?" Appellant answered, "Yes."[2] The written waiver form included a box number "10" which the appellant stated he had initialed. That portion of the form stated: "I understand that if I am not a citizen of the United States, the conviction for the offense charged may have the consequences of deportation, exclusion from admission to the United States, or denial of naturalization pursuant to the laws of the United States." Appellant told the court that he was pleading to count one because it was in his best interests to do so and that he understood the written waiver form and had initialed and signed it. The trial judge found that appellant "expressly, and knowingly, and intelligently waived all of his constitutional rights" and that his plea was entered "freely and voluntarily ... with an understanding of the nature and consequences, and that there is a factual basis for the plea." Nearly two years later, after he had served his sentence, been deported to Mexico, and denied re-entry to the United States, appellant moved to vacate his plea. He stated in a declaration filed with the court and signed in Mexico that he "was not advised my conviction in this case would result in my exclusion from admission. My attorney told me that I would not be deported if I accepted the prosecution's plea offer. For that reason, I agreed to waive all rights in the aboveentitled matter. [¶] Had I known that exile from my family and home would be the direct consequence of my plea, I would have exercised my right to a jury trial." He further stated that he had lived in the United States since 1971 and has a four-year-old daughter who is an American citizen. In the points and authorities filed with the trial court, appellant made the same arguments he asserts here: the verbal admonition of the immigration consequences of appellant's plea was legally defective, and it was not cured by the written waiver form which on its face showed irregularities. After hearing oral argument, the trial court denied the motion. This appeal followed. DISCUSSION A motion to vacate the judgment is the equivalent of a petition for a writ of *432 error coram nobis. (People v. Gontiz (1997) 58 Cal.App.4th 1309, 1312, 68 Cal. Rptr.2d 786 (Gontiz).) As such, it is an appealable order. (People v. Dubon (2001) 90 Cal.App.4th 944, 950, 108 Cal.Rptr.2d 914.) We review a motion to vacate under section 1016.5 for abuse of discretion. (People v. Superior Court (Zamudio) (2000) 23 Cal.4th 183, 192, 96 Cal.Rptr.2d 463, 999 P.2d 686 (Zamudio).) Section 1016.5, subdivision (a) provides: "Prior to acceptance of a plea of guilty or nolo contendere to any offense punishable as a crime under state law, except offenses designated as infractions under state law, the court shall administer the following advisement on the record to the defendant: [¶] If you are not a citizen, you are hereby advised that conviction of the offense for which you have been charged may have the consequences of deportation, exclusion from admission to the United States, or denial of naturalization pursuant to the laws of the United States." Subdivision (b) directs the court to vacate any plea taken without the advisement when the defendant shows that the plea may have the adverse consequences described by the statute. Appellant contends that the oral advisement of the immigration consequences of his plea was defective because it did not mirror the wording of section 1016.5. Appellant's factual observation is correct; his legal point is not. In taking the plea, instead of using the statutory language "exclusion from admission to the United States," the prosecutor used the phrase "denied re-entry." Appellant seizes on this misstatement and argues that under Gontiz, the plea must be vacated. In Gontiz, the court of appeal reversed two convictions because the trial court had failed to advise the defendant that he could be "excluded" from the United States; the only admonishments pertained to deportation and naturalization. In its opinion, the appellate court included the following passage that appellant contends helps his position here: "... There is case law which holds that the exact wording of the advisement is not critical so long as the defendant is warned there may be some immigration consequences flowing from his guilty plea. [Citations.] These cases are wrong. The statute requires the court to warn the defendant expressly of each of the three distinct possible immigration consequences of his conviction(s) prior to his plea." (Gontiz, supra, 58 Cal.App.4th at p. 1316, 68 Cal.Rptr.2d 786.)[3] Appellant reads too much into Gontiz' criticism of other cases. At most, Gontiz stands for the proposition that a generalized statement that a guilty plea may have "immigration consequences" is insufficient to comply with section 1016.5. Indeed, that is the precise holding in the last sentence which we have quoted above: "The statute requires the court to warn the defendant expressly of each of the three distinct possible immigration consequences of his conviction(s) prior to his plea." (Ibid.) Appellant's effort to convert Gontiz' reminder that trial courts must be faithful to the statute into a rule that any variance from the literal language of the legislation requires a plea to be vacated is unsupported for two reasons. First, the Supreme Court in Zamudio has implicitly recognized that substantial, not literal, compliance with section 1016.5 is sufficient. In discussing whether the failure to give *433 an admonishment on subsequent exclusion from the United States would be reversible error if the defendant faced no threat of exclusion, the court stated: "Nevertheless, if defendant's circumstances at the time of his 1992 plea did not, in fact, allow for the possibility of his subsequent exclusion from the United States in the event he were deported, the advisement he received concerning deportation and naturalization would have been in substantial compliance with the requirements of section 1016.5, in that they would have informed defendant of the only consequences pertinent to his situation...." (Zamudio, supra, 23 Cal.4th at p. 208, 96 Cal.Rptr.2d 463, 999 P.2d 686, italics added.) Second, both Zamudio and Gontiz make clear that the words used by the prosecutor here were the equivalent of the statutory language. "`Exclusion' is `being barred from entry to the United States.' [Citation.]" (Zamudio, 23 Cal.4th at p. 207, 96 Cal.Rptr.2d 463, 999 P.2d 686.) "Deportation is to be distinguished from exclusion, which is the denial of entry to the United States. [Citation.]" (Gontiz, supra, 58 Cal.App.4th at p. 1317, 68 Cal. Rptr.2d 786.) We hold here that only substantial compliance is required under section 1016.5 as long as the defendant is specifically advised of all three separate immigration consequences of his plea. Appellant was expressly told that one of the immigration consequences of his conviction was that he would be denied re-entry into the United States; in other words, under the statute, he would be excluded from the United States. The trial court, thus, substantially complied with the statute, and, hence, committed no error in the manner in which it took appellant's plea.[4] Even if we were to consider the variance in language used by the prosecutor as reversible error in a vacuum, there was no such void, as any error was concurrently cured by the written waiver of rights form utilized by the trial judge in accepting the plea. That waiver recites the verbatim language of section 1016.5 and, as we have observed, defendant initialed the box next to the advisement and told the trial judge that he had signed, read and understood the form. A court "may rely upon a defendant's validly executed waiver form as a proper substitute for a personal admonishment." (People v. Panizzon (1996) 13 Cal.4th 68, 83, 51 Cal. *434 Rptr.2d 851, 913 P.2d 1061.) Appellant argues that he "hastily signed" the form, impliedly "did not read the form or understand it," and that he simply followed instructions of his attorney and the deputy district attorney. Appellant's difficulty is that these assertions are not supported by the record. The declaration signed by appellant in support of his motion to vacate the plea does not corroborate the naked claims made in the opening brief. As relevant here, he stated only that he was not advised of exclusion from admission, his attorney told him he would not be deported, he has suffered understandably adverse consequences from his exclusion, and he would not have entered the plea if he had been properly advised. He does not contradict his statement to the court that he read, signed, initialed and understood the form. Appellant correctly points out that there was some hesitation at the time the plea was taken when the prosecutor asked appellant if he had discussed the case with his attorney. After acknowledging that he had reviewed everything on the waiver form, appellant said he had not discussed "all of [the form] yet" with his lawyer. There was a brief conference between appellant and his counsel, appellant stated on the record that he had one question, he conversed further with his attorney, the court reflected the conference on the record, and then appellant was asked if he had any questions. Appellant responded in the negative. He asked no questions when a few minutes later the prosecutor gave him the section 1016.5 admonishment. There is nothing in the record that suggests the question appellant had for his attorney during the taking of the plea had anything do with immigration. To the extent appellant is now contending that his attorney actually gave him advice that was contrary to what he was thereafter told orally and in writing in open court, that argument is equally unavailing. First, the only reference in the record to what his attorney advised him is the following statement contained in his declaration filed in support of his motion to vacate: "My attorney told me that I would not be deported if I accepted the prosecution's plea offer." This statement directly contradicts the oral and written waivers made in the trial court, including his statement that no promises were made to him that were not on the record. Of additional significance is that this statement does not address the re-entry/exclusion issue that is the basis of appellant's present appeal. It deals with deportation as to which there was no inconsistency between either the oral or written waivers and the statute. More fundamentally, at most this argument is a disguised claim that appellant received ineffective assistance of counsel, an argument which is not formally asserted in appellant's brief and is not cognizable on coram nobis. (See People v. Soriano (1987) 194 Cal.App.3d 1470, 1477, 240 Cal.Rptr. 328 [ineffective assistance of counsel may be raised only by direct appeal or habeas corpus petition].)[5] Finally, to the extent appellant states in his written declaration that his understanding was different than what he said in court, the trial court impliedly disbelieved him when it denied the motion to set aside *435 the plea. We are not free to disregard this implied finding that is supported by substantial evidence. (See Zamudio, supra, 23 Cal.4th at p. 210, 96 Cal.Rptr.2d 463, 999 P.2d 686 [factual issues presented on a motion to vacate plea are to be resolved by trial court].) For the same reasons, we reject appellant's argument, also without evidentiary support, that the fact appellant checked off boxes dealing with subjects for defense counsel and the prosecutor, respectively, demonstrates that appellant did not understand the immigration consequences of his plea. DISPOSITION The trial court's denial of appellant's motion to vacate is affirmed. We concur: COOPER, P.J., and BOLAND, J. NOTES [1] All further statutory references are to the Penal Code. [2] In the course of giving the advisements, the prosecutor asked essentially the same questions to the co-defendant who was present in court at the time. [3] In Zamudio, our Supreme Court disapproved Gontiz on the showing of prejudice required in motions under section 1016.5. (Zamudio, supra, 23 Cal.4th at p. 200, fn. 8, 96 Cal.Rptr.2d 463, 999 P.2d 686.) [4] Under Zamudio, a defendant who seeks to set aside his plea must show prejudice, namely, that but for the failure to advise, he would not have entered a guilty plea. This is a factual question for the trial court. (Zamudio, supra, 23 Cal.4th at pp. 199-200, 209-210, 96 Cal.Rptr.2d 463, 999 P.2d 686.) A review of the trial court's statements at the hearing on the motion to vacate reveals the court at least impliedly disbelieved appellant when appellant declared that if he had been advised orally using the statutory language he would have not pled guilty. As we have observed, the phrase "denied re-entry" is the legal equivalent of "exclusion of admission"; moreover, linguistically "denied re-entry" is a more precise statement of the consequence. Accordingly, appellant was not entitled to have his plea set aside because he failed to show prejudice. Appellant also contends there are actually three components to exclusion: re-entry, rescission of resident status, and ineligibility to adjust one's status, and further that the trial court erred when it admonished appellant only as to re-entry. He cites no authority for the proposition that there are three components under federal immigration law, or that there is any obligation to advise on such additional matters; thus, we may treat the issue as waived. (People v. Stanley (1995) 10 Cal.4th 764, 793, 42 Cal.Rptr.2d 543, 897 P.2d 481.) In any event, a trial court does not have an obligation to advise on those immigration consequences that appellant may suffer other than the ones listed in section 1016.5. (People v. Barocio (1989) 216 Cal.App.3d 99, 105, 264 Cal.Rptr. 573 [no obligation to advise on right to request a "recommendation against deportation" under 8 U.S.C. former § 1251(b)(2)].) [5] Appellant also states in his declaration: "I was not advised that my conviction in this case would result in my exclusion from admission." We observe that unlike the next sentence in his declaration in which he says his attorney expressly told him he would not be deported, the quoted statement does not say his attorney affirmatively told him he would not be excluded. His passive tense statement that he "was not advised" of exclusion is refuted by both the written and oral record of the proceedings.
Kris Jenner’s Giant Bald Spot – Does Corey Know She’s Going Bald? The Kardashian Klan matriarch looks like she is suffering from hair loss. 60 year old Kris Jenner was spotted out on the town with her boy toy, Corey Gamble – who she is engaged to and wants to film the wedding for an episode of Keeping Up With The Kardashians. Jenner was seen wearing a tight-fitting blue dress, and her lips were looking extra-plump (perhaps from some injections) and when she tilted her head down a giant bald spot could be spotted in the middle of her head. Corey, who is the same age as Kim, might want to re-think marrying a woman who is 25 years older than him and already starting to show signs of balding.
Q: Provision Developer Workspace + IDE inside Virtual Machine I'm trying to automate the provisioning of our developer workspaces which are based on Linux running in a Virtualbox. We also run the IDE inside the Virtualbox. The host system is Windows 7. The new solution will install the required dependencies (C libraries) and install + pre-configure the IDE (plugins, code formater). I'm wondering if Vagrant would be the tool of choice for this task. I am irritated since the Vagrant philosophy seems to be: easy provisioning of a dev/test server but running the IDE on the host - not inside the guest. The latter is not an option for us. What tooling would you recommend for our purposes? A: This is the answer to my question. I eventually went for Vagrant. This simple switch let the normally hidden Virtualbox GUI appear: v.gui = true More details here: https://docs.vagrantup.com/v2/virtualbox/configuration.html My experience with the solution was generally ok. I got my recipes version controlled as wanted. However, the feedback loop was quite long. To build the box with all my customization it took me about 7 minutes which was usually wasted waiting time. When changing a little bit I could try to execute just the changed scripts but to see the whole thing I had to rebuild the box - another 7 minutes wasted waiting. I am currently trying to understand how in the world of infrastructure as code you still get acceptable feedback loop (let's say below one minute). I assume this is where you enter the world of configuration management with tools like Ansible or Puppet.
Genomic plasticity, energy allocations, and the extended longevity phenotypes of Drosophila. The antagonistic pleiotropy theory of the evolution of aging is shown to be too simple to fully apply to the situation in which Drosophila are selected directly for delayed female fecundity and indirectly for extended longevity. We re-evaluated our own previously reported selection experiments using previously unreported data, as well as new data from the literature. The facts that led to this re-evaluation were: (1) the recognition that there are at least three different extended longevity phenotypes; (2) the existence of metabolic and mitochondrial differences between normal- and long-lived organisms; and most importantly; (3) the observation that animals selected for extended longevity are both more fecund and longer-lived than their progenitor control animals. This latter observation appears to contradict the theory. A revised interpretation of the events underlying the selection process indicates that there is a two-step change in energy allocations leading to a complex phenotype. Initial selection first allows the up-regulation of the antioxidant defense system genes and a shift to the use of the pentose shunt. This is later followed by alterations in mitochondrial fatty acid composition and other changes necessary to reduce the leakage of H(2)O(2) from the mitochondria into the cytosol. The recaptured energy available from the latter step is diverted from somatic maintenance back into reproduction, resulting in animals that are both long-lived and fecund. Literature review suggests the involvement of mitochondrial and antioxidant changes are likely universal in the Type 1 extended longevity phenotype.
Who is the Colorado Criminal Justice Reform Coalition? Our mission is to reverse the trend of mass incarceration in Colorado. We are a coalition of nearly 7,000 individual members and over 100 faith and community organizations who have united to stop perpetual prison expansion in Colorado through policy and sentence reform. Our chief areas of interest include drug policy reform, women in prison, racial injustice, the impact of incarceration on children and families, the problems associated with re-entry and stopping the practice of using private prisons in our state. Sunday, July 22, 2007 Crazy in America: The Hidden Tragedy of Our Criminalized Mentally Ill examines the fate of people with mental illness who tangle with a treacherous and unforgiving criminal justice system.Mary Beth Pfeiffer shows how people suffering from schizophrenia, bipolar disorder, depression and other mental illnesses are incarcerated simply because there is no viable alternative and then how they are punished again behind bars for behavior that is psychotic rather than criminal. The stories are moving and tragic as Ms. Pfeiffer puts a face to the horrific problem that we are facing. - The psychiatric odyssey of a 39-year-old Iowa woman with a history of 25 hospitalizations who blinded herself while locked in solitary confinement. -- The suicides of an 18-year-old youth who was abandoned for eight weeks in a tiny cell in a California juvenile prison and a 21-year-old New York woman who had been repeatedly punished with confinement to the prison "box". -- The deaths of two Florida men at the hands of untrained police who panicked in the face of psychosis. -- The path that led to a jail cell and breakdown for a 24-year-old Texan whose only crimes were to be mentally ill and drug-addicted. Pfeiffer's book is an indictment of a society that fails to provide decent mental health care to its most vulnerable citizens and then incarcerates them for often petty crimes, leaving them sicker and more damaged by the experience.
Na Liu Na Liu (born 7 February 1983) is a British table tennis player. Early life Liu was born in Liao Ning, China. Liu was raised in China and has lived in Belfast, Northern Ireland since 2001, gaining British citizenship in 2008. Career In table tennis, she competed for Great Britain at the 2012 Summer Olympics and represented Northern Ireland in 2010 at the Commonwealth Games in Delhi, India. She started playing tennis at the age of 7. References External links Na Liu profile Category:British female table tennis players Category:Chinese emigrants to the United Kingdom Category:Table tennis players at the 2012 Summer Olympics Category:Olympic table tennis players of Great Britain Category:1983 births Category:Living people Category:Table tennis players from Shenyang Category:Naturalised table tennis players
LEHIGH COUNTY, Pennsylvania--It's easy to find female fans of Donald Trump in this cluster of former factory towns in the hills west of New York City even after his comments about Fox News anchor Megyn Kelly that have been widely interpreted as referring to her menstrual cycle. The loud-mouthed real estate mogul, who holds a wide lead over rivals in the Republican race for the White House, has been unapologetic, despite pundits saying his clash with Kelly could hurt him with women voters and halt his meteoric rise in the polls. A new Reuters/Ipsos poll suggests Trump - who has dominated coverage of the 2016 election with a series of flame-throwing comments about illegal Mexican immigrants, the war record of Senator John McCain and Kelly - may in fact still be leading among women Republican supporters. There's evidence of that support in Lehigh County, Pennsylvania, even though the county leans Democrat. A third of women randomly interviewed by Reuters on the street self-identified as Trump supporters and said they still supported him. Kelly Ray, 34, a former teacher and conservative Christian who left work to home-school her two children, said Trump was an attractive candidate because he was an outsider who had not held elected office. "I like how disgusted he is in how things are right now," she said outside a Kohls department store in Trexlertown on Monday. "I'm not fed up with Donald Trump. I'm fed up with (U.S. President) Barack Obama." She said she was not put off by Trump's performance in last week's Republican presidential debate. Trump bristled when Kelly, one of the moderators, said he had called women "fat pigs, dogs, slobs and disgusting animals" in the past. Trump accused her of political correctness and of not treating him with respect. In a CNN interview on Friday he said of Kelly: "You could see there was blood coming out of her eyes, blood coming out of her - wherever." That comment was seen as implying she had been menstruating during the debate, although Trump has repeatedly denied this and said he had been referring to her nose. A Little Rough"Shame on the public for presuming something, for putting words in his mouth," said Evonne Groody, 28, a nurse in Allentown, Pennsylvania. Groody said Trump was her first choice for president even though she's a registered Democrat. "Women are not offended by that at all," said Lori Pesta, creator of Facebook group Women for Donald Trump, referring to Trump's comment about Kelly. The page, which has more than 600 "likes", was launched just days before the latest controversy erupted. "It doesn't matter what Donald Trump says. The news media is going to twist it. I heard the original comment and it shouldn't have been taken that way," she said. Trump's outspokenness is his most important quality, according to the women who like him. Women interviewed in Lehigh County and respondents in a Reuters/Ipsos poll praised his apparent honesty. "He's a little rough around the edges because he goes against the grain," said Angie Brodie, 38, another nurse in Allentown. To be sure, many of the women interviewed were vehemently opposed to Trump's behaviour. And the Reuters/Ipsos poll, conducted between Aug. 7 and Aug. 11, appeared to show female support for Trump waning slightly, falling to 20 percent from 26 percent on Aug. 3. The poll had a credibility interval of 7.1 percentage points. Trump's comment about Kelly cost him at least one supporter: Renee Daily, 56, a grandmother in Trexlertown who said his candidacy had inspired her to register to vote for the first time in her life. On Monday she said she had given up on him. "He just started to talk too much," she said. To win the presidency, Trump needs strong backing from women, who make up 53 percent of the U.S. electorate. At the moment, he has a wider lead among men than women. Big MouthParadoxically, media attention to Trump's comments about Kelly may be helping him shore up support. Of the 17 Republican presidential hopefuls, Trump is arguably the most spontaneous speaker. "What I say is what I say," he told Kelly in response to her question on women during the debate. Spontaneity is an advantage, said Davida Charney, a rhetoric and writing professor at the University of Texas at Austin. "Something that is unplanned and critical is somehow truer, more honest," she said. That's how Groody saw it. She said Trump seemed so straightforward that if he had wanted to say Kelly was irrational because she was menstruating, he would have just said it plainly. But some fans worry his unfiltered style could cross a line. Susan Wetzel, 55, a former shipping company worker living in a Dallas suburb, said she cared more about the problems Trump was addressing, like immigration than about his comments on Kelly, which she found offensive. She wants Trump to talk more about policy issues. "If he doesn't, he's not going to get my vote," she said. "We need a grown-up in office, we don't need a little kid."
High court throws out $1B fraud verdict in Exxon leak case (Lloyd Fox / Baltimore Sun ) February 26, 2013|By Arthur Hirsch, The Baltimore Sun Maryland's highest court on Tuesday struck down the bulk of a fraud case against ExxonMobil Corp. stemming from an underground gasoline leak in Baltimore County, reversing most of $1.65 billion in judgments and dealing a stunning blow to hundreds of families. In two opinions on cases arising from the 26,000 gallon spill in Jacksonville in 2006, the Court of Appeals tossed out claims of fraud and ruled that plaintiffs could not collect for emotional distress or the cost of medical care to monitor possible symptoms of illness. The rulings reverse court victories secured by residents and businesses. The court rejected $1 billion in punitive damages from a $1.5 billion verdict handed down in 2011 after a six-month jury trial. The court also rejected some claims from a 2009 case in which a jury awarded $150 million to a smaller number of plaintiffs and ordered some returned to Baltimore County Circuit Court for trial. "We're all still in a state of shock," said Susan Lazzaro, who lives with her husband, Robert, less than a mile from where the spill occurred at a main crossroads of Jarrettsville Pike, Paper Mill and Sweet Air roads. "We absolutely did not expect this. It leaves us with such a sense of defeat because we are still living with this nightmare." Charlie Engelmann, a spokesman for ExxonMobil, said in an email that the company was pleased with the decision. "The evidence showed that we acted appropriately after the accident and the court has agreed," Engelmann wrote. "We have apologized to the Jacksonville community and we remain ready to compensate those who were truly damaged by this unfortunate accident. We will continue the cleanup." The court rejected all six claims of fraud the jury affirmed in 2011, including ExxonMobil's alleged willful deceptions of public officials and residents before and after the accident. "Because we reverse the verdicts as to each of the alleged instances of fraud, the award to Appellees of punitive damages must be reversed as well," the court wrote. The key claim of fraud was rejected for lack of evidence, although the opinion does say that ExxonMobil could have been more forthcoming with Jacksonville residents about their investigation and made fewer mistakes. "That Exxon's efforts were imperfect, however, does not rise to fraud," the opinion said. H. Russell Smouse, an attorney with the Peter G. Angelos firm, which represented plaintiffs in the 2011 case, said the lawyers were still evaluating the 129-page opinion and would be talking with their clients on "the issues to be pursued." Smouse said lawyers were "still evaluating the avenues that remain available." Attorney Stephen Snyder, who represented plaintiffs in the case decided in 2009, could not be reached for comment. Residents of the suburban and rural community of Jacksonville, where residents are dependent on wells for their drinking water, reacted to the news with a mixture of disappointment and disbelief. Lazzaro said her family is still not able to take baths, and they keep their showers to two minutes or less. They use only bottled water for drinking and cooking, and the backyard Jacuzzi has been empty for years. She said she and her husband were counting on the value of their home on Constantine Drive as a retirement "nest egg," and now it's not clear what it would be worth. "You drive up and down Jarretsville Pike now and you see 'For Sale' signs everywhere," said Lazzaro, whose family was awarded $5.6 million in damages in the case decided in 2011. Hans Wilhelmsen, whose family was awarded $13.9 million in compensation and $47 million in punitive damages — the highest damages award in that case — said he spoke with about 10 other plaintiffs during the course of Tuesday to share their thoughts about the decision. "I think everybody was blown away," said Wilhelmsen. He said other plaintiffs he spoke with could not understand how an appeals court could reverse a finding of fraud made by a jury that heard evidence for months. "That's the biggest question in everybody's mind," said Wilhelmsen. He said he had counted on receiving the exact verdict sum, and knew it would be a long process before payment was made, but he had hoped the value of several properties he owns there would be recognized and compensated. "Nobody was looking for some sort of enormous payout, but just to protect the asset," said Wilhelmsen, who said he installed a water filtration system in his home that cost $15,000, and about $3,000 a year to maintain. Glen A. Thomas, president of the Greater Jacksonville Association, said of the verdict, "I guess I'm disappointed with some of it." "I find it hard to believe there was not some fraud in the length of time the leak was taking place," said Thomas, who was the association president at the time of the leak. "For what people knew and how long the leak itself was going on, people knew something they were not revealing." By the time the Exxon station was shut down in February 2006, a pressurized unleaded gasoline line had been leaking for 37 days. The leak caused by a contractor's drill on Jan. 13 actually set off an alarm immediately, but another contractor called to check on the station incorrectly decided there was no leak, and reset the alarm system so it could not detect the gasoline spill, according to the court documents. No plaintiffs have claimed they became ill from exposure to gasoline contamination, but residents say they have lived with the fear of cancer and other illnesses for years. The court ruled the plaintiffs had not shown enough evidence of exposure to toxic chemicals to collect damages for emotional stress or for the cost of having their health monitored by a doctor.
Anna Scott One of the favorite parts of Anna Scott’s job is working with the college students and watching them come to new understandings of what teaching and learning science really means. She works with students in a service-learning program for UGA science majors called FOCUS. She says FOCUS students leave the program with a deep respect for public school teachers and a refreshed view of why we learn science. Additionally, since she has been at UGA, she has received two grants. One is from the Corporation for National and Community Service and the one is from the Board of Regents. Both are used to make program improvements in an after school tutoring program at Pinewood Estates, a largely Spanish-speaking mobile home community north of campus. Hometown: Conyers, Georgia High School: Heritage High School Degree objective: Ph.D. in science education Other degrees: Expected graduation: December 2006 University highlights, achievements, awards and scholarships: In the spring of 2005 I was awarded both the Outstanding Teaching Award and the Excellence in Teaching Award for my teaching efforts on campus. My teaching has involved two service learning initiatives. I previously coordinated and handled instruction for the UGA students involved in after school tutoring at Pinewood Estates, a largely Spanish-speaking mobile home community north of campus. Currently, I teach science majors who spend 3 hours a week helping with science instruction in elementary schools in a program entitled FOCUS (Fostering our Community's Understanding of Science) which is supported by both the College of Agriculture and Environmental Services and PRISM (Partnership for Reform in Science and Math, a large National Science Foundation grant aimed at improving math and science teaching and learning in Georgia). I have also successfully written two grants in my time at UGA, both aimed at fostering appreciation for diversity. The first grant was from the Corporation for National and Community Service, and it was used to defray costs of providing tutoring services to the children of Pinewood Estates. The second grant was from the Board of Regents and was specifically awarded to aid in efforts to increase the number of minority students involved in the program at Pinewood Estates. I also had my first paper, as first author, accepted for publication in Academic Exchange Quarterly's Spring 2005 issue. The paper, entitled Service-Learning and Science: A Successful Model, attempts to make available to other institutions the skeleton of FOCUS--which I believe is a great program and should be expanded! Current Employment: I am a graduate assistant at UGA and my responsibilities include coordinating FOCUS, a service learning experience for UGA science majors. I work with both the partner teachers in the schools and also with the UGA students in a classroom setting. I am charged with helping them understand how to take their content knowledge and make it accessible to children. I chose to attend UGA because… ...the science education program at UGA is one of the best in the country. Athens is a great place to live and work, and it doesn’t hurt that my extended family is just an hour away! My favorite things to do on campus are… ...to find a quiet place on campus and read, and I love to walk on the campus. It just feels like a university is supposed to. Sometimes I walk from Aderhold all the way downtown for lunch, and I just soak up the academic feeling, especially on north campus. When I have free time, I like… What free time? If I’m not at school, I can be found doing something with my husband and 3 year old son—usually involving a playground! I also love taking my 2 dogs out for jaunts at the off-leash dog park. In November, I’ll be busy having my second child, a girl! The craziest thing I've done is… ...writing my first grant to the Corporation of National and Community Service, because I had no grant writing experience. I really just wanted to try it out, and then it got funded! I learned the work of carrying out the grant is almost as hard as writing it. My favorite place to study is… ...in the science library. I just feel smarter in there! I always go there to write too, now that I’m working on my prospectus. My favorite professor is… ...Steve Oliver in Science Education. He is my major professor and is the reason that I believe I can complete my degree. He is an amazing mentor. He has done wonderful things for my writing skills, and he never complains that I take up too much of his time! If I could share an afternoon with anyone, I would love to share it with… ...my husband, Trey. We have learned since starting a family that stolen moments together—just us—are really special and absolutely priceless. If I knew I could not fail, I would… ...scuba dive! The truth is I’m too scared that something will be wrong with my equipment, or that I’ll get down on the ocean floor and forget what I’m supposed to do. I have always thought it must be amazing to look at the sea like that though. Snorkeling will have to do for now. After graduation, I plan to… ...be a professor, and I want to work at an institution that values diversity and service learning. I love academia, but I know I will never be happy if I don’t feel like I can immediately see the results of my work in my community.
Q: Do growls interact with the harmony? Is the pitch of growls measurable or is it undefined (for example: bass drum and hi hat are both unpitched but you can tell the relative pitch)? Both me and my friend have good ears and have been unable to tell the pitch that our vocalist is singing when growling, and I haven't found this topic raised anywhere on the internet. EDIT: Reading a bit on wikipedia about unpitched percussion, I found the term 'inharmonicity' - in simple words it means that the sound produced doesn't interact with the harmony. I would like to know whether growls are harmonic or inharmonic, as it is possible to match pitch with growls but also with drums. EDIT2: Another bit of information is that our vocalist sings in tune most of the time, with some chance of missing a few notes (when singing clean), but when he growls we can't tell wether he's in tune or not. EDIT 3: Changed title from "Is growling pitched or unpitched?" to "Do growls interact with the harmony?", meaning, instead of if they have a fundamental pitch (Yes), if they interact with the harmony like clean vocals or don't interact with the harmony like drums (or somewhere in between like pizzicato which is both percussive and melodic). A: Inharmonicity actually doesn't mean something doesn't interact with the harmony. It's only a measure for how strongly the sound deviates from a periodic signal (or equivalently, one with only integer-multiple sinuoid partials). Such periodic-signal sounds are particularly well-suited for interacting with harmony, but even very inharmonic sounds can, to some degree, do so (Gamelan music is pretty much entirely based on this). And vice versa, sounds with low inharmonicity can be used in a way that does not interact with the harmony (e.g. “siren” sound effects). So, we really have two questions here: 1. Is growling inharmonic? Well, there are different degrees of “growliness”, but all growling certainly has some inharmonicity, that's what distinguishes it from clean singing. But it's also not completely inharmonic (like e.g. a china cymbal). To quantify this, look at a Fourier spectrum of a recording. For a clean voice, this will have well-separated peaks and nothing much else, roughly like†: Source: https://www.clear.rice.edu/elec431/projects95/psquared/psquared.html For a growled part there will be a much higher “noise floor” of inharmonicity, but I'm pretty sure you would still see some reasonably strong peaks, and they would probably still be spaced in integer ratio. Estimate sketch: 2. Does growling interact with harmony? I think it can, in principle, but I don't really have evidence. I'd definitely say most metal singers don't use growling in a way that would interact with the harmony, and I don't know if you can even control the pitched components of growling in a way that would allow this. But if you sampled snippets of growled singing and triggered it with a keyboard to play, say, a Baroque cantata, I suspect it would sound more harmonious then you'd think (albeit completely weird). †Spectrum analysers in music production are usually set up with logarithmic axes, which is more useful for mixing etc. purposes. But it means the spectrum will look inharmonic even if it's not: – the integer frequencies aren't equally-spaced anymore, and the noise floor appears much higher. If you try this out, be sure to set the spectrum to linear scale to properly see what's inharmonic and what's not.
Bloomberg Bloomberg | Quint is a multiplatform, Indian business and financial news company. We combine Bloomberg’s global leadership in business and financial news and data, with Quintillion Media’s deep expertise in the Indian market and digital news delivery, to provide high quality business news, insights and trends for India’s sophisticated audiences. Local Bonds Are All the Rage in EM as Investors Buy Up ETFs (Bloomberg) -- If investors wanted evidence that demand for local-currency bonds isn’t fleeting, here it is: The biggest exchange-traded fund tracking local debt in emerging markets has seen 17 weeks of inflows. The $9.7 billion iShares JP Morgan EM Local Government Bond UCITS ETF had net deposits of $341 million last week, the most since Feb. 8, as the Federal Reserve’s dovish stance and progress in U.S.-China trade talks spur demand from some of the world’s biggest money managers. This week inflows slowed, but still totaled $20 million through Thursday. Investors meanwhile pulled $251 million from the largest ETF for emerging-market dollar bonds last week, bringing outflows for April to $1.6 billion, the most in more than a year. “The dollar does not need to be super weak for emerging market local-currency bonds to be a good investment,” said Eric Stein, Boston-based co-director of global income at Eaton Vance Corp., which manages $460 billion of assets. “Even in an environment of moderate dollar strength, local bonds can generate good returns and we are positioned for that with them seen to outperform dollar bonds.” JPMorgan Chase & Co. said that its clients had increased their exposure to emerging currencies in April to the highest level since May 2018. They were overweight the South African rand, Russian ruble, Brazilian real, Nigerian naira and the Egyptian pound. “Some local-bond curves are steep, so they’re fairly attractive,” said Magdalena Polan, a strategist at Legal & General Investment Management in London. “Central banks are dropping hawkish guidance or even moving toward easing, so that’s good for bonds and would be a good opportunity in those EMs that can ease.” Local bonds have some catching up to do. They’ve returned investors 1.8 percent this year in dollar terms, which compares with 6.1 percent for emerging-market dollar bonds. The equity benchmark has rallied 11.6 percent. With local rates, “we can still witness a substantial positive gap between emerging-market and developed-market real yields,” said Carl Ross and Victoria Courmes, Boston-based analysts at Grantham Mayo Van Otterloo & Co. “Valuation metrics for emerging external debt are less compelling than they were at the beginning of the year, due to the rally.”
#!/usr/bin/ruby s=gets.chomp.sub(/0+$/,'') puts s==s.reverse ? :YES : :NO
Q: Envio de dados com ajax Tenho um chat online que funciona com ajax e PHP. Porém, estranhamente, quando eu digito somente uma interrogação (?) e envio o jQuery, retorna-me um erro no console. O ajax entra no error() e a interrogação (?) é inserida no banco, porém com uns caracteres estranhos tipo: jQuery33106296323571939269_1534100132138. JavaScript: $('#envia_chat_id').keyup(function(e){ if(e.which === 13 & $('#envia_chat_id').attr('class') === 'envia_chat'){ if(trim($('.envia_chat').val()) != ''){ var msgenvio = $('.envia_chat').val(); var msgrender = msgenvio.replace(/</g, '&lt;').replace(/>/g, '&gt;'); $('#chat_box').append('<div class="msg user_' + $('.time_user').val() + '"><span>'+ $('.nick_user').val() + ': </span>'+ msgrender +'</div)'); $('.envia_chat').val(''); $('.envia_chat').removeAttr('class'); $('#chat_box').scrollTop($('#chat_box').prop("scrollHeight")); $('#envia_chat_id').attr('placeholder','Aguarde para enviar outra...'); console.log('msg='+ msgenvio + '&type=enviaMsg&lobby=' + $('.lobbyid').val() + '&time=' + $('.time_user').val() + '&nick=' + $('.nick_user').val()); $.ajax({ url:'chat.php', dataType: 'JSON', type: 'POST', data: 'msg='+ msgenvio + '&type=enviaMsg&lobby=' + $('.lobbyid').val() + '&time=' + $('.time_user').val() + '&nick=' + $('.nick_user').val(), success: function(data){ console.log(data); setTimeout(function(){ $('#envia_chat_id').attr('class','envia_chat'); $('#envia_chat_id').attr('placeholder','Chat...'); }, 4000); }, error: function(data){ console.log(data); $('#chat_box').append('<div class="msg msg_erro">Tente novamente enviar esta mensagem.</div)'); $('#chat_box').scrollTop($('#chat_box').prop("scrollHeight")); $('#envia_chat_id').attr('class','envia_chat'); $('#envia_chat_id').attr('placeholder','Chat...'); } }); } } }); PHP: <?php session_start(); function Erro($texto){ $array = array('status' => $texto); return json_encode($array, JSON_PRETTY_PRINT); } function Sucesso($texto){ $array = array('status' => $texto); return json_encode($array, JSON_PRETTY_PRINT); } if(isset($_SESSION['login_id']) and !empty($_SESSION['login_id']) and isset($_POST['type']) and isset($_POST['lobby']) and is_numeric($_POST['lobby']) == true){ require('connection.php'); $id = $_SESSION['login_id']; $acao = $_POST['type']; $id_lobby = (is_numeric($_POST['lobby'])==true) ? $_POST['lobby'] : NULL; $tempo_atual = date("Y-m-d H:i:s"); $msg = (isset($_POST['msg'])==true and $_POST['msg'] != '') ? filter_var($_POST['msg'], FILTER_SANITIZE_SPECIAL_CHARS) : NULL; $time = (isset($_POST['time']) == true and $_POST['time'] == 'azul' or $_POST['time'] == 'laranja' or $_POST['time'] == 'ambos') ? $_POST['time'] : NULL; $nick = (isset($_POST['nick']) == true) ? $_POST['nick'] : NULL; if(trim($msg) != NULL and $time != NULL and $nick != NULL){ $insere_msg = mysqli_query($conexao, "INSERT INTO chat (id_user, content, id_lobby, timestamp, time, nick) VALUES ('$id', '$msg', '$id_lobby', '$tempo_atual', '$time', '$nick')"); if($insere_msg === true){ echo Sucesso('success'); } }else{ echo Erro('erro_null'); } }else{ echo Erro('erro_faltam'); } ?> A: Ao enviar o caractere ? sozinho numa das variáveis do data (concatenando as variáveis em forma de string URL, como está fazendo) o jQuery irá tratar a URL como JSONP e irá registrar um callback quando o Ajax retornar a requisição. Como não foi indicado nenhum callback (até porque não era essa a intenção devido a ao dataType ser "JSON"), irá resultar no erro mencionado, tal como: parsererror Error: jQuery33100166499243115803_1534312585291 was not called O jQuery criou e tentou chamar um callback jQuery33100166499243115803_1534312585291 que não existe. Envie os dados no data em forma de objeto, e não em forma de string URL: data: { msg: msgenvio, type: 'enviaMsg', lobby: $('.lobbyid').val(), time: $('.time_user').val(), nick: $('.nick_user').val() },
A prominent Wisconsin district attorney sent repeated text messages trying to spark an affair with a domestic abuse victim while he was prosecuting her ex-boyfriend, a police report shows. The 26-year-old woman complained last year to police after receiving 30 texts from Calumet County District Attorney Kenneth Kratz in three days, according to the report obtained by The Associated Press. "Are you the kind of girl that likes secret contact with an older married elected DA ... the riskier the better?" Kratz, 50, wrote in a message to Stephanie Van Groll in October 2009. In another, he wrote: "I would not expect you to be the other woman. I would want you to be so hot and treat me so well that you'd be THE woman! R U that good?" Kratz was prosecuting Van Groll's ex-boyfriend on charges he nearly choked her to death last year. He also was veteran chair of the Wisconsin Crime Victims' Rights Board, a quasi-judicial agency that can reprimand judges, prosecutors and police officers who mistreat crime victims. In a combative interview in his office Wednesday, Kratz did not deny sending the messages and expressed concern their publication would unfairly embarrass him personally and professionally. He said the Office of Lawyer Regulation had found he did not violate any rules governing attorney misconduct. That office cannot comment on investigations. "This is a non-news story," Kratz shouted. But he added, "I'm worried about it because of my reputational interests. I'm worried about it because of my 25 years as a prosecutor." 'Three days of hell' Van Groll told police in Kaukauna, Wis., where she lived, that she felt pressured to have a relationship with Kratz or he would drop the charges against her ex-boyfriend. Kratz then removed himself from that prosecution and the state Department of Justice took over. He resigned from the crime victims board, which he helped create, after more than a decade as chair. He and his wife filed for divorce last December, although he said they were separated when the messages were sent. Kratz has remained the top prosecutor based in Chilton, where he has served since 1992 and earns a $105,000 salary. Kratz, a Republican, said he intends to run for re-election in November 2012. Stephanie Van Groll, a domestic abuse victim whose ex-boyfriend Shannon Konitzer was charged with nearly choking her to death. "Nothing really happened to him and I had three days of hell," Van Groll said in a phone interview with the AP. "They gave him a slap on the wrist and told him not to do it again. If it was anybody else that did something like this, they'd lose their job." Domestic violence experts called Kratz's text messages disturbing and unethical for several reasons, including the power differential between a prosecutor and a younger abuse victim. "If what's being alleged is true, it's sad a prosecutor would use the same sort of power and control over a woman who has already experienced that in her personal life," said Patti Seger, executive director of the Wisconsin Coalition Against Domestic Violence. Kratz: 'I wrote the law' Kratz may be best known for prosecuting Steven Avery in the 2005 killing of Teresa Halbach, a 25-year-old photographer. The case won national attention because Avery had spent 18 years behind bars for a rape he did not commit in a separate case before DNA evidence implicated someone else. Kratz received glowing media attention and flirted with a run for Congress in 2008. Last year, around the time he was texting Van Groll, Kratz was back in the spotlight for prosecuting a woman who worked with others to lure a boyfriend to a hotel room and glued his penis to his stomach as revenge for his cheating. In the interview, Kratz said he was proud he helped achieve legislation creating the first-of-its-kind crime victims' board and that he had dedicated his career to their cause. "I wrote the law on crime victims in Wisconsin," he said, pointing to a picture of him with former Gov. Tommy Thompson signing that law. "That's the irony here." A spokeswoman said the board has not received a complaint about Kratz and is not investigating his conduct toward Van Groll. Kratz cited an undisclosed conflict of interest in stepping away from the abuse case after Van Groll reported the text messages, court records show. An assistant state attorney general acted as special prosecutor and won a conviction on one felony count of strangulation against the man, Shannon Konitzer. Van Groll said Kratz sent the first text minutes after she left his office, where he had interviewed her about the case. He said it was nice talking and "you have such potential," signing the message "KEN (your favorite DA)." Twenty minutes later, he added, "I wish you weren't one of this office's clients. You'd be a cool person to know!" But he quickly tried to start a relationship and told her to keep quiet about the texts. Van Groll at first was polite, saying Kratz was "a nice person" and thanking him for praise. By the second day, she responded with answers such as "dono" or "no." Kratz questioned whether her "low self-esteem" was to blame for the lack of interest. "I'm serious! I'm the atty. I have the $350,000 house. I have the 6-figure career. You may be the tall, young, hot nymph, but I am the prize!" he texted. Kratz told her the relationship would unfold slow enough for "Shannon's case to get done." "Remember it would have to be special enough to risk all," he wrote. Van Groll said she went to police on the third day after the messages started becoming "kind of vulgar." She provided copies of 30 messages and her responses, which the department released in response to an AP request. "Stephanie feels afraid that if she doesn't do what he wants Kratz will throw out her whole case," an officer who interviewed Van Groll wrote. The department referred the complaint to the state Division of Criminal Investigation because it works with Kratz's office on prosecutions. Van Groll, a college student and part-time preschool teacher who has moved to Merrill, said she has been told Kratz won't be charged because "they didn't think he did anything criminally wrong." Kratz on Wednesday waved a copy of what he said was a report by legal regulators that cleared him. He would not give a copy to AP, and slammed the door to his office when the interview was over.
The ISA is providing the videos contained on this website royalty free for editorial use only. No commercial rights are being granted. The ISA owns copyright. Sale or licensing of these images is strictly prohibited without prior written consent from the ISA. All rights reserved. The International Surfing Association (ISA), founded in 1964, is recognized by the International Olympic Committee as the World Governing Authority for Surfing, StandUp Paddle (SUP) Racing and Surfing, Bodysurfing, Wakesurfing, and all other wave riding activities on any type of waves, and on flat water using wave riding equipment. The ISA crowned its first Men’s and Women’s World Champions in 1964. It crowned the first Big Wave World Champion in 1965; World Junior Champion in 1980; World Kneeboard Champions in 1982; World Longboard Surfing and World Bodyboard Champions in 1988; World Tandem Surfing Champions in 2006; World Masters Champions in 2007; and World StandUp Paddle (SUP) and Paddleboard Champions in 2012. ISA membership includes the surfing National Governing Bodies of 103 countries on five continents. Its headquarters are located in La Jolla, California. It is presided over by Fernando Aguerre (Argentina), first elected President in 1994 in Rio de Janeiro. The ISA’s four Vice-Presidents are Karín Sierralta (PER), Kirsty Coventry (ZIM), Casper Steinfath (DEN) and Barbara Kendall (NZL).
Q: print out just one order number and the items associated with that number I have a mysql table holding the items from my cart array, e.g. item_id, size, quantity and they also have an order number in each row so if i had 3 items, the three rows would have the order id of 2. There is another table called orders which holds the order number for those items and the name, address etc. I want to be able to print out each order number and the items that match that order number however it's repeating the order number and printing it out three times, is there anyway i can just have order number: 1 then the three items below this? This query does print out the correct information but displays the orderid 3 times $sql = mysql_query("SELECT transactions.*, orders.orderid, orders.date FROM transactions LEFT JOIN orders ON transactions.orderid=orders.orderid WHERE orders.userid = '$userID'"); A: Building on FlyingFoX's example $currentOrderId = 0; while ($row = mysql_fetch_assoc($sql)){ if ($currentOrderId != $row["orderid"]){ // put everything that shall only be written once here. echo $row["orderid"]; $currentOrderId = $row["orderid"]; } // put everything that shall be written for every row here. echo $row["date"]; }
A Scientific Means for Islamic Military Alliance to Collaborate and Deploy The state-run Saudi Press Agency has announced that 34 nations are forming a new "Islamic military alliance" to fight terrorism. But will this new alliance really be able to prevent future terrorist attacks and create lasting peace? There is no statistically validated guarantee that the military strategy of fighting violence with violence will work. It certainly has not in the past. Why should it now? History shows that using violence to quell violence ultimately just ratchets up the level of violence. There is hope, however, if the new alliance honors its stated goal that terrorism "should be fought by all means and collaboration should be made to eliminate it." Today a scientifically validated means exists to prevent terrorism and war, and all countries involved in the alliance could collaboratively deploy it. This scientific approach is known in military circles as Invincible Defense Technology (IDT). This field-tested approach to reducing stress and violence is already part of the training of Brazil's Elite Police force, and has been field-tested by other militaries. It has been validated by 23 peer-reviewed studies carried out in both developed and developing nations, including the Middle East, Africa, Southeast Asia, and Latin America. Independent scientists and scholars endorse it, based on 25 years of ongoing research. IDT Reduces Societal Stress As a specially trained military unit, an "IDT Prevention Wing of the Military" uses IDT to neutralize the buildup of stress in the national collective consciousness that ultimately fuels terrorism, war and crime. As collective stress and frustration subside, government leaders and citizens alike are more capable of finding orderly and constructive solutions to the issues that have separated them for generations. Experience with IDT in highly stressed areas of the globe have demonstrated increased economic incentive and growth of prosperity. Individual creativity and entrepreneurship increase as well. With greater civic calm, citizens' aspirations rise and a more productive and balanced society emerges. Such a society naturally disallows violence as a means for change, or as an expression of discontent. With this, the ground for terrorism is eliminated. Moreover, this positive change in social trends takes place within a few days or weeks after IDT is introduced. The changes are measurable from such statistics as reduced terrorism, crime rates, accidents, hospital admissions, infant mortality, etc. The IDT warrior's daily routine includes the non-religious practice of the Transcendental Meditation technique and the advanced TM-Sidhi program. Military personnel, functioning as a societal coherence-creating military unit, practice these techniques together in a group twice a day, seven days a week, preferably near the targeted population in a secure location. Their presence need not be disclosed to achieve the effect of conflict resolution and violence reduction. Such coherence-creating groups have achieved positive benefits to society, shown experientially, in just 48 hours. Modern statistical methods demonstrate a consistent causal influence of the IDT group on reducing conflict, precluding chance or coincidence. The IDT approach has been used during wartime, resulting in reduction of fighting, reduced war deaths and casualties, and improved progress toward resolving the conflict through peaceful means. Its coherence-creating effect has also been documented on a global scale in a study published in the Journal of Offender Rehabilitation. When large assemblies of civilian IDT experts gathered during the years 1983-1985, terrorism-related casualties decreased 72%, international conflict decreased 32%, and overall violence was reduced in nations without intrusion by other governments. A civilian IDT group in Israel decreased the intensity of war in Lebanon in 1983 in a dramatic way in 48 hours, to name only one of 50 successful demonstrations. (See a summary of the study, published in the Journal of Conflict Resolution and summaries of follow-up studies in the Journal of Social Behavior and Personality and the Journal of Scientific Exploration). CONCLUSION IDT is totally unlike any other defense technology because it does not use violence in an attempt to quell violence. It is a more civilized approach, yet the IDT defense technology supersedes all other known defense technologies (which are based on electronic, chemical, and/or nuclear forces). Therefore, militaries that deploy it gain the ultimate strategic advantage. If the Islamic military alliance defense forces establish Prevention Wings of the Military, they will ease the current high tensions, reverse centuries of mistrust and hatred and permanently prevent future unrest. These IDT units will create genuine and lasting reconciliation and friendship where there was once only hatred and conflict. The powerful IDT human-resource-based defense technology disallows negative trends and prevents enemies from arising. No enemies means no terrorism and full security, as well as a normal, happy, productive life for everyone. By eliminating terrorism and ending decades-old cycles of violence, the Islamic military alliance IDT units will create lasting peace and prosperity. Their powerful demonstration of this non-violent peace technology will gain worldwide attention. They will be honored and respected as great warriors who served honorably in their militaries for the betterment of all humanity. Extensive scientific research objectively says, "Yes, this approach works." This is a military "means" that should be championed with "all means." It is desperately needed. There is truly no other solution. The Islamic military alliance must act now, before high social tensions inevitably explode again. About Me We do not open attachments. Stop e-mailing them. Threats and abusive e-mail are not covered by any privacy rule. This isn't to the reporters at a certain paper (keep 'em coming, they are funny). This is for the likes of failed comics who think they can threaten via e-mails and then whine, "E-mails are supposed to be private." E-mail threats will be turned over to the FBI and they will be noted here with the names and anything I feel like quoting. This also applies to anyone writing to complain about a friend of mine. That's not why the public account exists.
Vince Chan Vince Chan Realtor® Vince Chan BBA Personal Real Estate Corporation As an awarded Medallion Club member of the Real Estate Board of Greater Vancouver and an award winning Member of RE/MAX, Vince has consistently provided his clients with stellar buying, selling, and negotiation services for over 20 years. Born and raised in Burnaby, BC, Vince holds a degree in Business Administration from Simon Fraser University, is fluent in English and Cantonese, and enjoys taking part in the dynamic cultural, sporting, and recreational activities that abound in the Lower Mainland. Awards and Accolades*: Gold Master Medallion Club member awarded by Real Estate Board of Greater Vancouver Re/max Team Titan Club Award Platinum Club Award of RE/MAX Chairman Club member of RE/MAX Top 100 Re/max Western Canada Re/Max Hall of Fame Re/Max Lifetime Achievement Award BBA in Business Management from Simon Fraser University. Medallion Club Member: This award recognized the top 10% of REBGV for the year. Medallion Club Member 2017. Gold Master indicates 10+ years of membership. Titan Club Award: The Titan Club Award is given to RE/MAX Sales Associates whose GCI in a given year totaled over $750,000 to $999,999. Platinum Club Award: The Platinum Club Award is given to RE/MAX Sales Associates whose GCI in a given year totaled $250,000 to $499.999. Chairman’s Club: Created in 2003 to recognize Associates with increasing levels of commission within the range of $500,000 – $749,999. Top 100 Re/max Western Canada: RE/MAX Western Canada Top 100 team based on gross commission earned YTD 2015. RE/Max Hall of Fame: Established to recognize and salute the exclusive group of top producers who have achieved more than $1 million in gross commission earnings during their career with RE/MAX. There is no years of service requirement. RE/Max Lifetime Achievement Award: Introduced in 1992 with requirements of 7 years of service and $3 million gross commission. Associates must have previously achieved the Hall of Fame award. This representation is based in whole or in part on data generated by the Chilliwack District Real Estate Board, Fraser Valley Real Estate Board or Real Estate Board of Greater Vancouver which assumes no responsibility for its accuracy.
905 F.2d 94 Antonio Gomez HERNANDEZ, Plaintiff-Appellant,v.Phillip MAXWELL and Midland Police Department, Defendants-Appellees. No. 90-8062Summary Calendar. United States Court of Appeals,Fifth Circuit. July 10, 1990. Antonio Hernandez, Lovelady, Tex., pro se. Dorothy G. Palumbo, D. Kirk Swinney, Midland, Tex., for defendants-appellees. Appeal from the United States District Court for the Western District of Texas. Before POLITZ, GARWOOD and JOLLY, Circuit Judges. POLITZ, Circuit Judge: 1 The district court granted defendants' Fed.R.Civ.P. 12(b)(6) motion to dismiss the 42 U.S.C. Sec. 1983 suit filed pro se by Antonio Gomez Hernandez against the Midland, Texas Police Department and Detective Phillip Maxwell. Concluding that Hernandez has stated a cause upon which the requested relief may be granted, we vacate and remand for further proceedings. Background 2 On June 9, 1987 members of the Midland Police force, led by detective Maxwell, searched the residence of Hernandez pursuant to a warrant authorizing the search and seizure of heroin. No heroin was found but Hernandez was arrested and charged with possession of a controlled substance, a charge subsequently dismissed for insufficient evidence. During the course of the search the officers seized a sum of money. Hernandez alleges the sum was $2311. The defendants admit to seizing $140 from Hernandez's person and $271 from his bedroom. No receipt was given to Hernandez for the cash, nor was it returned. 3 Defendants moved for dismissal under Fed.R.Civ.P. 12(b)(6). The court invited a response from Hernandez which was forthcoming, again pro se. In his response to the motion Hernandez alleged that the defendants "intentionally appropriated the plaintiff's property [the cash] without due process of law with the intention of purposely depriving plaintiff of that property." 4 The court granted defendants' motion, concluding that Hernandez had failed to allege a claim of constitutional proportions. Hernandez timely appealed. Analysis 5 To prevail in a 42 U.S.C. Sec. 1983 suit a complainant must prove: "(1) that he has been deprived of a right 'secured by the Constitution and the laws' of the United States; and (2) that the persons depriving him of this right acted 'under color of any statute' " of the state. Daniel v. Ferguson, 839 F.2d 1124, 1128 (5th Cir.1988). 6 We detailed the standard of review for a 12(b)(6) motion in Rankin v. City of Wichita Falls, 762 F.2d 444, 446 (5th Cir.1985), stating: 7 The standard of review of a dismissal for failure to state a claim upon which relief may be granted is well established. We must accept all well pleaded averments as true and view them in the light most favorable to the plaintiff. We will not go outside the pleadings and we cannot uphold the dismissal "unless it appears beyond doubt that the plaintiff can prove no set of facts in support of his claim which would entitle him to relief." 8 Hernandez meets the first requirement of alleging deprivation of a constitutional right. He claims that he was subjected to an illegal search and seizure. He alleges that in the course of executing an invalid search warrant for heroin, cash was taken from his person and his bedroom. In addition to the dispute as to the amount, Hernandez alleges that the cash was taken, no receipt was given, and none was returned notwithstanding dismissal of the heroin charge for want of evidence. Giving his pro se pleading the expansive reading mandated by Haines v. Kerner, 404 U.S. 519, 92 S.Ct. 594, 30 L.Ed.2d 652 (1972), we are persuaded that Hernandez has alleged a violation of his constitutional right under the fourth amendment to be free of unreasonable searches and seizures, as well as his fourteenth amendment right not to be deprived of his property except pursuant to due process of law. 9 The second requirement is manifest--the officers were acting under color of state law when they allegedly deprived Hernandez of his constitutional rights. Hernandez adequately alleges such. 10 In granting the dismissal, the district court stated that it was "not convinced that a constitutional violation [arose because] significant amounts of cash are often associated with drug trafficking and because the cash in question was found in 'plain view' scattered on the bedroom floor and upon Hernandez's person after his arrest." In ruling on this threshold Rule 12(b)(6) motion the court a quo went beyond the pleadings and determined both the validity vel non and the validity of execution of the search warrant. Both exercises were premature. 11 The defendants contend that Hernandez has no cause of action because he failed to allege that the failure to return the money was caused by anything other than negligence. "Without an intentional act, there is no 'deprivation' in the constitutional sense." Lewis v. Woods, 848 F.2d 649, 652 (5th Cir.1988). Defendants do not accord Hernandez's allegations the reading to which they are entitled. He alleges the intentional appropriation of his property, and a willful and permanent deprivation. 12 Finally, defendants seek shelter in the assertion that Hernandez has no Sec. 1983 claim because he has an adequate postdeprivation remedy. The district court accepted this contention, citing Hudson v. Palmer, 468 U.S. 517, 104 S.Ct. 3194, 82 L.Ed.2d 393 (1984), and holding that Hernandez has no Sec. 1983 claim because he has an adequate postdeprivation remedy. 13 An adequate postdeprivation remedy may preclude a Sec. 1983 action. But we perceive the existence of a postdeprivation remedy as less than an adequate 12(b)(6) shield in the case at bar. Postdeprivation remedies are relevant, in a Sec. 1983 setting, only to procedural constitutional violations. They are not relevant to instances involving "substantive constitutional proscriptions applicable to the states." Augustine v. Doe, 740 F.2d 322, 325 (5th Cir.1984). In those instances, "when a plaintiff alleges that state action has violated an independent substantive right, he asserts that the action itself is unconstitutional. If so, his rights are violated no matter what process precedes, accompanies, or follows the unconstitutional action." Id. at 327. Cf. Cruz v. Cardwell, 486 F.2d 550 (8th Cir.1973). The latter fairly characterizes Hernandez's allegations of fourth amendment violations. 14 The judgment of the district court dismissing without prejudice the Sec. 1983 complaint of Hernandez is VACATED and the matter is REMANDED for further proceedings consistent herewith.
Why the Unicorn Financing Market Just Became Dangerous…For All Involved In February of last year, Fortune magazine writers Erin Griffith and Dan Primack declared 2015 “The Age of the Unicorns” noting — “Fortune counts more than 80 startups that have been valued at $1 billion or more by venture capitalists.” By January of 2016, that number had ballooned to 229. One key to this population growth has been the remarkable ease of the Unicorn fundraising process: Pick a new valuation well above your last one, put together a presentation deck, solicit offers, and watch the hundreds of million of dollars flow into your bank account. Twelve to eighteen months later, you hit the road and do it again — super simple. While not obvious on the surface, there has been a fundamental sea-change in the investment community that has made the incremental Unicorn investment a substantially more dangerous and complicated practice. All Unicorn participants — founders, company employees, venture investors and their limited partners (LPs) — are seeing their fortunes put at risk from the very nature of the Unicorn phenomenon itself. The pressures of lofty paper valuations, massive burn rates (and the subsequent need for more cash), and unprecedented low levels of IPOs and M&A, have created a complex and unique circumstance that many Unicorn CEOs and investors are ill-prepared to navigate. Many have noted that the aggregate shareholder value created by all of the Unicorns will vastly overshadow the losses from the inevitable failed unicorns. This likely truism is driven by the clear success of this generation’s transformational companies (AirBNB, Slack, Snapchat, Uber, etc). While this could provide some sense of comfort, most are not exposed to a Unicorn basket, and there is no index you can buy. Rather, most participants in the ecosystem have exposure to and responsibility for specific company performance, which is exactly why the changing landscape is important to understand. Perhaps the seminal bubble-popping event was John Carreyrou’s October 16th investigative analysis of Theranos in the Wall Street Journal. John was the first to uncover that just because a company can raise money from a handful of investors at a very high price, it does not guarantee (i) everything is going well at the company, or (ii) those shares are permanently worth the last round valuation. Ironically, Carreyrou is not a Silicon Valley-focused reporter, and the success of the piece served as a wake-up call for other journalists who may have been struck by Unicorn fever. Next came Rolfe Winkler’s deep dive “Highly Valued Startup Zenefits Runs Into Turbulence.” We should expect more of these in the future. In late 2015, many public technology companies saw a significant retrenchment in their share prices primarily as a result of a reduction in valuation multiples. A high performing, high-growth SAAS company that may have been worth 10 or more times revenue was suddenly worth 4-7 times revenue. The same thing happened to many Internet stocks. These broad-based multiple contractions have an immediate impact on what investors are willing to pay for the more mature private companies. Late 2015 also brought the arrival of “mutual fund markdowns.” Many Unicorns had taken private fundraising dollars from mutual funds. These mutual funds “mark-to-market” every day, and fund managers are compensated periodically on this performance. As a result, most firms have independent internal groups that periodically analyze valuations. With the public markets down, these groups began writing down Unicorn valuations. Once more, the fantasy began to come apart. The last round is not the permanent price, and being private does not mean you get a free pass on scrutiny. At the same time, we also started to see an increase in startup failure. In addition to high profile companies like Fab.com, Quirky, Homejoy, and Secret, numerous other VC-backed companies began to shut their doors. There were in fact so many that CB Insights started a list. Layoffs have also become more prevalent. Mixpanel, Jawbone, Twitter, HotelTonight and many others made the tough decision to reduce headcount in an attempt to lower expenses (and presumably burn rate). Many modern entrepreneurs have limited exposure to the notion of failure or layoffs because it has been so long since these things were common in the industry. By the first quarter of 2016, the late-stage financing market had changed materially. Investors were becoming nervous and were no longer willing to underwrite new Unicorn-level financings at the drop of a hat. Moreover, once high-flying startups began to struggle on the fundraising trail. In Silicon Valley boardrooms, where “growth at all costs” had been the mantra for many years, people began to imagine a world where the cost of capital could rise dramatically, and profits could come back in vogue. Anxiety slowly crept into everyone’s world. About this same point in time, the journalists that focus specifically on the venture capital industry noted something quite profound. In 1999, record valuations coexisted with record IPOs and shareholder liquidity. 2015 was the exact opposite. Record private Unicorn valuations were offset by increasingly fewer and fewer IPOs. If 1999 was a wet (read liquid) bubble, 2015 was a particularly dry one. Everyone was successful on paper, but in terms of real cash-on-cash returns, there was little to show. In Q1 of 2016 there were zero VC-backed technology IPOs. Less than one year since declaring it the “Age of the Unicorns,” Fortune Magazine was back with a dire warning, “Silicon Valley’s $585 Billion Problem: Good Luck Getting Out.” As we move forward, it is important for all players in the ecosystem to realize that the game has changed. Equally important, each player must understand how the new rules apply to them specifically. We will start by highlighting several emotional biases that can irrationally impact everyone’s decision making process. Next we will highlight the new player in the ecosystem that is poised to take advantage of these aforementioned changes and emerging biases. Lastly, we will then walk through each player in the ecosystem and what they should consider as they navigate this brave new world. Emotional Biases When academicians study markets, one common assumption is that the market participants will act in a rational way. But what if the participants are in a position that leads them to non-optimal and potentially irrational behavior? Many biases bring irrationality to the Unicorn fundraising environment: Founder/CEO — Many Unicorn founders and CEOs have never experienced a difficult fundraising environment — they have only known success. Also, they have a strong belief that any sign of weakness (such as a down round) will have a catastrophic impact on their culture, hiring process, and ability to retain employees. Their own ego is also a factor – will a down round signal weakness? It might be hard to imagine the level of fear and anxiety that can creep into a formerly confident mind in a transitional moment like this. Investors — The typical 2016 VC investor is also subject to emotional bias. They are likely sitting on amazing paper-based gains that have already been recorded as a success by their own investors — the LPs. Anything that hints of a down round brings questions about the success metrics that have already been “booked.” Furthermore, an abundance of such write-downs could impede their ability to raise their next fund. So an anxious investor might have multiple incentives to protect appearances — to do anything they can to prevent a down round. Anyone that has already “banked” their return — Whether you are a founder, executive, seed investor, VC, or late stage investor, there is a chance that you have taken the last round valuation and multiplied it by your ownership position and told yourself that you are worth this amount. It is simple human nature that if you have done this mental exercise and convinced yourself of a foregone conclusion, you will have difficulty rationalizing a down round investment. A race for the exits — As fear of downward price movement takes hold, some players in the ecosystem will attempt a brisk and desperate grab at immediate liquidity, placing their own interests at the front of the line. This happens in every market transition, and can create quite a bit of tension between the different constituents in each company. We have already seen examples of founders and management obtaining liquidity in front of investors. And there are also modern examples of investors beating the founders and employees out the door. Obviously, simultaneous liquidity is the most appropriate choice, however, fear of price deterioration as well as lengthened liquidity timing can cause parties on both sides to take a “me first” perspective. The Sharks Arrive With Dirty Term Sheets Who are the Sharks? These are sophisticated and opportunistic investors that instinctively understand the aforementioned biases of the participants and know exactly how to craft investments that can exploit the situation. They lie in wait of these exact situations, and salivate at the opportunity to exercise their advantage. “Dirty” or structured term sheets are proposed investments where the majority of the economic gains for the investor come not from the headline valuation, but rather through a series of dirty terms that are hidden deeper in the document. This allows the Shark to meet the valuation “ask” of the entrepreneur and VC board member, all the while knowing that they will make excellent returns, even at exits that are far below the cover valuation. Examples of dirty terms include guaranteed IPO returns, ratchets, PIK Dividends, series-based M&A vetoes, and superior preferences or liquidity rights. The typical Silicon Valley term sheet does not include such terms. The reason these terms can produce returns by themselves is that they set the stage for a rejiggering of the capitalization table at some point in the future. This is why the founder and their VC BOD member can still hold onto the illusion that everything is fine. The adjustment does not happen now, it will happen later. Dirty term sheets are a massive problem for two reasons. One is that they “unpack” or “explode” at some point in the future. You can no longer simply look at the cap table and estimate your return. Once you have accepted a dirty offering, the payout at each potential future valuation requires a complex analysis, where the return for the Shark is calculated first, and then the remains are shared by everyone else. The second reason they are a massive problem is that their complexity will render future financings all but impossible. Any investor asked to follow a dirty offering will look at the complexity of the previous offering and likely opt out. This severely heightens the risk of either running out of money or a complete recapitalization that wipes out previous shareholders (founder, employees, and investors alike). So, while it may seem innocuous to take such a round, and while it will solve your short term emotional biases and concerns, you may be putting your whole company in a much riskier position without even knowing it. Some later-stage investors may be tempted to become Sharks themselves and start including structured terms into their own term sheets. Following through and succeeding at such a strategy will require these investors to truly embrace being a Shark. They will need to be comfortable knowing that they are adverse to and in conflict with the founders, employees, and other investors on the capitalization chart. And they will need to be content knowing that they can win while others lose. This is not for the faint of heart, and certainly is not consistent with the typical investor behavior of the past several years. Let us now take a deeper dive into what this new fundraising environment means for each participant in the ecosystem. Entrepreneurs/Founders/CEOs Today’s Unicorn entrepreneur has been trained in an environment that may look radically different from what lies ahead. Here is the historic perspective. Money has been easy to raise. The market favors growth over profits. Competition also has access to capital. So, raise as much as you can as fast as you can, and be super-ambitious. Take as much market share as you can. Never in the history of venture capital have early stage startups had access to so much capital. Back in 1999, if a company raised $30mm before an IPO, that was considered a large historic raise. Today, private companies have raised 10x that amount and more. And consequently, the burn rates are 10x larger than they were back then. All of which creates a voraciously hungry Unicorn. One that needs lots and lots of capital (if it is to stay on the current trajectory). For the first time, perhaps in their lives, these entrepreneurs may face a situation where they cannot raise a clean incremental financing at a flat to up round. This is uncharted territory. There are a few alternatives: The first option available to many Unicorns today is a dirty term sheet. As discussed above, these terms can cleverly fool the inexperienced operator, because they are able to “meet the ask” with respect to cover valuation, and the accepting founder does not realize the carnage that will come down the road. The only reason one would accept such a deal is to maintain valuation appearances that simply do not matter. Taking a terms-laden deal is like starting the clock on a time bomb. Your only option is to hit the IPO window as fast as possible (Note: Box and Square were able to thread this needle successfully), otherwise, the terms will eat you alive. The main problem is that you will never raise another private round again, as no new investor will want to live on top of the termy round. So you will be stuck negotiating with the lender that already proved they were smarter than you. Take a clean round at a lower valuation. This will seem like a massive failure to many modern entrepreneurs, but they should quickly adjust their thinking. Reed Hastings at Netflix raised money in a high profile down round as a public CEO. Every single public CEO has had days where the stock price falls — it is common and accepted. The only thing you are protecting is image and ego and in the long run they absolutely do not matter. You should be more concerned about the long-term valuation of your shares, and minimizing the chance that you have the whole thing taken away from you. Terms are the true Godzilla that should scare you to death. A down round is nothing. Get over it and move on. Option #2 is way better than option #1. Buckle down and do whatever it takes to get cash-flow positive with your current cash balance. This might be the most foreign of all the choices, as your board of directors has been advising you to do the exact opposite for the past four years. You have been told to be “bold” and “ambitious” and that there is no better time to grab market share. Despite this, the only way to be completely in control of your own destiny is to remove the need for incremental capital raises altogether. Achieving profitability is the most liberating action a startup can accomplish. Now you make your own decisions. It will also minimize future dilution. Gavin Baker, a high-profile portfolio manager at Fidelity has a message for Unicorn CEOs: “Generate $1 of free cash flow, and then you can invest everything else in growth and stay at $1 in free cash flow for years. I get that you want to grow and I want you to grow, but let’s internally finance that growth by spending gross margin dollars rather than new dilutive dollars of equity. Ultimately, internally financing growth is the only way to control your own destiny rather than being at the mercy of the capital markets.” Go public. In the long run, the very best way for founders to look after their own ownership as well as that of their employees is to IPO. Until an IPO, common shares sit behind preferred shares. Most preferred shares have different types of control functions and most of them have a senior preference over common. If you really want to liberate your own common shares and those of your employees, then you want to convert the preferred to common and remove both the control and the liquidation preference over your shares. Many founders have been erroneously advised that IPOs are bad things and that the way to success is to “stay private longer.” Not only is an IPO better for your company (see Mark Zuckerberg and Marc Benioff on this subject), but an IPO is the best way to ensure the long-term value of your (and your employees’) shares. It is worth noting that stock prices go up and stock prices go down. There is not a single high-profile public company that has been able to avoid time periods where their shares underperformed. Amazon went from $106 to $6 as a public company. Salesforce went from $16 to $6 and stayed below $10 for many months. Netflix went from $38 to $8 in six months. Remember Facebook’s first six months as a public company? If you cannot handle a down valuation you should seriously consider abandoning the CEO position. Being a great leader means leading in good times as well as tough times. Taking a dirty deal is jeopardizing the future of your company, solely because you are afraid to lead through difficult news. Employees The explicit details of the capital structure of a company are typically obfuscated from the average employee. You know you work for a Unicorn, and you know you have some common shares. You might also know what percentage you own. And unfortunately, you may assume that the product of your Unicorn valuation and your percentage ownership is what you are worth. Of course, for that to be true, you need to reach a liquidity event (IPO or M&A) at or above the last round valuation with no incremental dilution from new rounds. But guess what: M&A is scarce (no large company wants to pay these prices or absorb these burn rates), and many founders have been told IPOs are bad. So how will you ever get liquid? For the most part, employees are in the exact same position as founders (above), with the exception that they don’t participate in the decision tree outlined above in 1-4. That said, they should be asking the exact same questions of management: Can we get to break-even on the money we have? Do we need to raise more money? If so, can we do it on clean terms (vs. dirty)? Employees should want to know if the founder/CEO would/did take a dirty deal, because common is at the most risk in such a situation. And then you should want to know if your leader is anti-IPO. If your CEO/founder will take a dirty round, and is also anti-IPO the chance that you will ever see liquidity for you shares anywhere near what you think they are worth is very, very low. You should probably move on to another company. INVESTORS Disclosure: It should be noted that the author of the article and his investment firm reside in this category. For the most part, early investors in Unicorns are in the same position as founders and employees. This is because these companies have raised so much capital that the early investor is no longer a substantial portion of the voting rights or the liquidation preference stack. As a result, most of their interests are aligned with the common, and key decisions about return and liquidity are the same as for the founder. This investor will also be wary of the dirty term sheet which has the ability to wrestle away control of the entire company. This investor will also have sufficient angst about the difference between paper return and real return, and the lack of overall liquidity in the market. Or at least they should. The one exception to this is the late-stage investor or the deep-pocketed investor who may represent a substantial part of the overall money raised. This particular type of investor may have protected their ownership through the use of active pro-rata or super pro-rata investing. They may have even encouraged the aggressive “spend-to-win” mentality knowing that they can keep writing checks. They have been acting like a loose-aggressive player at a poker table. There are two forces which have began to slow down this type of investor. First, as failure has begun to arrive on the scene, these investors have suffered some really big write-offs. These spectacular losses result in a lack of confidence not only for the investor, but more importantly for their LPs. The second problem is that for many of these investors, a single holding can become too large relative to the overall fund. They basically cannot afford to expose themselves to any more risk in a particular name. They use euphemisms to describe having over-eaten such as “fully allocated” or “at capacity.” This form of big investor indigestion has created a really bizarre and unprecedented activity in the Unicorn world. High-profile investors, who are already armed with plenty of capital, have resorted to hitting the phone banks to solicit others to pile in behind them in their names. The voracious Unicorns need even more capital than these big-boys can afford. Ironically, if you look at the big historic wins of this investor class, there is no record of sending out Evites to other investors. But now they “need” others, which should signal risk to all parties involved. More on this later. Investors also have to worry about raising their next fund, which can lead to unusual behavior that is independent of each individual company’s situation. Do you support the dirty term sheet because this allows you to keep your paper-mark and not spook your investors? Even though you know this may be bad for the company in the long run? Do you feel the need to raise more capital quickly before the prices erode further and bring down your IRR? Do you feel the need to have more money to keep feeding the cash hungry companies you have already funded? LIMITED PARTNERS (LPS) LPs are the large pools of capital, such as endowments and foundations, that invest in VC firms, hedge funds and the like. They are the real capital that make the system work. LPs evaluate the performance of the different investors in the ecosystem and make decisions about whether to fund their next effort or not. It’s a difficult job because the feedback cycles are so long — especially when it comes to investing in illiquid assets like startups (and Unicorns). Another big challenge for LPs is that they are asked to measure the performance of these illiquid assets even though doing so is quite difficult and may not be indicative of future real cash returns. In this case, many LPs have incorporated the high performance of Unicorn valuations into their overall results which has created very strong performance gains for the venture capital category. In a sense they have already “banked” the gains. The problem obviously is that the lack of any material liquidity in the market combined with the recent correction creates a risk that they may not see the actual cash returns for the paper gains they already booked. Furthermore, as mentioned earlier, they may face increased solicitation from VC firms who want to accelerate their fundraising process in the middle of this highly anxious environment. A recent WSJ article, “Venture-Capital Firms Draw a Rush of New Money,” highlights that VC firms are raising new funds from LPs at the highest rate in 15 years, even though cash liquidity is sitting at a seven-year low. A few sentences from the article are worth republishing here: In recent years venture firms have written bigger checks and encouraged companies to spend to battle for market supremacy. That left some venture firms short of cash, requiring them to raise money sooner than in years past to continue reaping fees and making new investments. Some venture capitalists say the fundraising spike is timed to ensure that paper gains on startup investments still look attractive. Cash distributions are what matter at the end of the day, but big paper gains still make for good fundraising pitches. In addition to these issues, there has also been an increase in “inside rounds” where investors write new checks into companies where they are already investors, avoiding the “market check” that might have resulted in a potentially down valuation. This activity, which has an obvious conflict of interest, makes the LP’s job of judging VC performance even more difficult. Against this difficult backdrop, many firms are asking their LPs to make new accelerated commitments to their next fund, exactly when evaluation is most difficult and anxiety may be at a cyclical peak. Moreover, deep down most LPs know that performance in the VC sector is counter cyclical to the amount of money raised by VCs. If you over-fund the industry, aggregate returns fall. Writing huge checks to bloated multibillion dollar VC funds could easily exacerbate the problems that already exist. One response from the LP community might be to demand commitments from new funds that prohibit inside-led rounds and cross-fund investing. This can help to ensure that new capital is not put to use in an attempt to save previous investment decisions — an activity known as “throwing good money after bad.” If this were not enough, some LPs are also being solicited to participate in SPVs (Special Purpose Vehicles), frequently from the very funds they have backed. As discussed earlier, some investors have reached a stage when they are overcommitted to a particular company in a particular fund (“at capacity”). Yet these investors want to keep providing capital to their Unicorns and support a growth-over-profits attitude. So they create a one-time special purpose investment vehicle (while greedily asking for even more carry). And the SPV has the added risk that is has no portfolio diversification or “look-back” feature to provide downside protection. Obviously the LPs can just say “no” to participating in the SPV (even though they may feel the pressure of obligation from the fund). This is likely the smart move. First, someone is asking you to write a check at the exact time everyone else is overcommitted. Hey, come help us out, we are drowning over here! Second, you already have ample exposure to this exact company, through your original investment. Lastly, it is quite unlikely that a historical study of peak-cycle SPV participation shows good returns. ALL PREVIOUSLY UNTAPPED FINANCIAL SOURCES (FAMILY OFFICES, SOVEREIGN WEALTH FUNDS, ETC) If you have a large pool of money and you haven’t been approached to invest in a Unicorn, it’s simply because people do not know where to find you. There are three types of people who are likely now approaching you, all of whom you should engage with quite carefully: SPV promoters – As mentioned in the section on LPs, investors have also broadened their SPV marketing more broadly to family offices and other pools of capital. The pitches typically involve phrases such as “you are invited to” or “we will provide access to” an opportunity to invest. This “you are so lucky to have this opportunity” pitch is eerily Madoffian. And remember, this solicitation is coming from investors who actually have money, but already know they are overcommitted. Brokers and 3rd-tier investment banks promoting the sale of secondary shares in Unicorn companies – If you ask any large family office, they will tell you they are being bombarded with calls and emails offering secondary positions in Unicorn companies. Often with teasers such as “20-40% discount to last round price.” Incremental Unicorn round – You might also be called on simply to pump more capital into a standard Unicorn round. With many investors “at capacity” due to the historic amounts of capital already raised, some companies are looking under any and every rock they can for more dollars. One of the shocking realities that is present in many of these “investment opportunities” is a relative absence of pertinent financial information. One would think that these opportunities which are often sold as “pre-IPO” rounds would have something close to the data you might see in an S-1. But often, the financial information is quite limited. And when it is included, it may be presented in a way that is inconsistent with GAAP standards. As an example, most Unicorn CEOs still have no idea that discounts, coupons, and subsidies are contra-revenue. If an audit is included, it might have massive “qualifications” where the auditor lists all the reasons that this particular audit may not comply with GAAP standards and that things could change materially if they dig in deeper. Investors need to really open their eyes to the fact that these are not IPOs. The companies have not been scrubbed in the same way, and the numbers they are looking at on a PowerPoint deck are potentially erroneous. Here is a recommendation: If you are about to write a multimillion dollar check for an incremental Unicorn investment, ask to speak to the auditor. Find out exactly how much scrutiny has been applied. New potential investors might also be surprised how few Unicorn executives truly understand their core unit economics. One easy way to spot these pretenders is that they obsessively focus on high level “gross merchandise value” or “multi-year forward bookings” and try to talk past things like true net revenue, gross margin, or operating profitability. They will even claim to be “unit profitable” when all they have really done is stopped being gross margin negative. These companies will one day need real earnings and real profits, and if the company does not proactively address this, you should not be giving them millions of dollars in late stage financings. Perhaps the biggest mistake untapped investors will make is assuming that because there are branded investors already in the company, that the new investment opportunity must be of high quality. They use the reputation of the other investors as a proxy for due diligence. There are multiple problems with this shortcut. First, these investors are “pot committed.” They invested a long time ago, and without your money their investment is “at risk.” Second, as discussed, they are already full and nervous. They didn’t call you before when they built their reputation. Why are they friendly now? The main message for investors who are just now being approached is the following: it’s not the second inning or even the sixth, it’s the fourteenth inning in a five-hour baseball game. You are not being invited to a special dance, you are being approached because you are the lender of last resort. And because of how we meandered to this place in time, parting with your dollars now would be an extremely risky move. Caveat emptor. SEC Visits Silicon Valley A few weeks ago, on March 31, 2016, the Chair of the SEC made a trip to Silicon Valley and gave a speech at an event at Stanford Law School. For those that are participating in Unicorn investing or for those considering investing in Unicorns, it would be a good idea to read the entirety of her presentation (which can be found here). Bloomberg’s interpretation of her presentation was that “Silicon Valley Needs To Corral Its Unicorns.” Chair White seems quite aware of the issues and pressures that have an ability to distort the Unicorn fundraising process: Nearly all venture valuations are highly subjective. But, one must wonder whether the publicity and pressure to achieve the unicorn benchmark is analogous to that felt by public companies to meet projections they make to the market with the attendant risk of financial reporting problems. And then she sends a message to all former and future investors regarding the need for increased due diligence: As I will discuss, the risk of distortion and inaccuracy is amplified because start-up companies, even quite mature ones, often have far less robust internal controls and governance procedures than most public companies. Vigilance by private companies about the accuracy of their financial results and other disclosures is thus especially critical. It would be quite unfortunate if the fundraising behavior of the Unicorn herd led to increased SEC involvement and rules with respect to private venture-backed startups. But if those involved believe that “not being public” also means “not being responsible,” we will quickly find ourselves in that exact place. We will have deservedly invited more scrutiny. Mo Money Mo Problems Perhaps the biggest lapse in judgment for all of those involved is the assumption that if we can just raise “one more round” everything will be fine. Founders have come to believe that more money is better, and the fluidity of the recent funding environment has led many to believe that heroic fundraising is a competitive advantage. Ironically, the exact opposite is true. The very best entrepreneurs are relatively advantaged in times of scarce capital. They can raise money in any environment. Loose capital allows the less qualified to participate in each market. This less qualified player brings more reckless execution which drags even the best entrepreneur onto an especially sloppy playing field. This threatens returns for all involved. The reason we are all in this mess is because of the excessive amounts of capital that have poured into the VC-backed startup market. This glut of capital has led to (1) record high burn rates, likely 5-10x those of the 1999 timeframe, (2) most companies operating far, far away from profitability, (3) excessively intense competition driven by access to said capital, (4) delayed or non-existent liquidity for employees and investors, and (5) the aforementioned solicitous fundraising practices. More money will not solve any of these problems — it will only contribute to them. The healthiest thing that could possibly happen is a dramatic increase in the real cost of capital and a return to an appreciation for sound business execution.
Keeping a low profile: The mother-of-five was hiding her face as she left the Suntrap Tanning Studios MailOnline has contacted Katie's representative for comment. The TV personality is no doubt keeping up with her beauty regime in the run-up to her new pantomime role. It was revealed earlier this week that Peter Andre's ex-wife would be playing the Wicked Fairy in a production of Sleeping Beauty at the New Victoria Theatre in Woking, Surrey, later this year. Preparing for her new role? Katie was no doubt upping her beauty regime ahead of her new role as the Wicked Fairy in Sleeping Beauty at Woking's New Victoria Theatre Heading home: The outspoken beauty made a speedy exit after topping up her tan Meanwhile, Katie - who raises children Harvey, 13, Junior, 10, Princess Tiaamii, seven, Jett, two, and Bunny, one - was inundated with praise from fans when she made an appearance on ITV show This Morning last week. The outspoken beauty defended her decision to air her dirty laundry in public, insisting she has no regrets about announcing her husband Kieran Hayler's affair with her former friends Jane Pountney and Chrissy Thomas on Twitter last year. Katie - who has since patched things up with Kieran, the father of her two youngest children - explained: 'He failed the lie detector and within two minutes I on Twitter. I don't regret it at all. If anything I wish I said more.' Quizzed whether her children were too involved in the drama, Katie replied: 'My kids know everything, they were there when I caught Kieran. 'Even if it's not me putting it out there they will read it in the magazines. They have access to the computer. 'What they don't know is more harmful, because they will find out when they are older.' Telling it straight: During an appearance on ITV's This Morning last week, Katie explained why she decided to announce her husband Kieran Hayler's infidelity on Twitter last year
Shirvan State Reserve Shirvan State Reserve was established on the area of of a part of Bendovan State Game reserve in 1969 for the purpose of protecting and increasing the number of water birds. The area of the reserve was expanded to in 1982. Ecology The reserves is characterized by rich ornithological fauna. Water reserves account for of the area. Rare and valuable birds nest and winter in the swampy areas. The largest part of the reserve was transferred to the Shirvan National Park in 2003, and the area of the reserve currently totals . Fauna and flora Etymology The names of the reserve and national park appear to be derived from the word Shīr (, 'Lion'). The Asiatic lion used to occur in the Trans-Caucasus, including this area, before the end of the 10th century. A reason for its extinction here is that it was hunted by hunters, including 'shirvans' or 'shirvanshakhs', who were native to the Trans-Caucasus. See also Nature of Azerbaijan National Parks of Azerbaijan State Reserves of Azerbaijan State Game Reserves of Azerbaijan References Category:State reserves of Azerbaijan
The DPH letter, sent to the hospital yesterday, was issued in response to a plan submitted by the hospital which the DPH requested as part of its legal review and evaluation of the closure's impact on the health of the community. On April 17, the DPH had issued an initial finding that the beds slated for closure provided an essential service that is "necessary for preserving access and health status in the hospitals' service area." The DPH had requested the hospital provide more detailed information about their plan for the closure and their rationale for how patients would be cared for post closure. In rejecting the hospital's closure plan, the DPH calls into question nearly every aspect of the hospital's rationale for the closure, stating UMass Memorial's response does not "meet the needs of the patients in the Community. As a result of this review, the Department is deeply concerned that the proposed closure of thirteen out of twenty-seven psychiatric beds in the central Massachusetts area, will impact the timely admission and treatment of persons in need of inpatient psychiatric care." The DPH further calls upon the hospital to "reassess" the closure "to best meet the needs of those individuals presenting with a need for inpatient psychiatric care." Reporters can obtain a PDF of the letter by emailing dschildmeier@mnarn.org. The DPH is not alone in its opposition to the closure, as the plan has been met with strident opposition from every sector of the community, including leading mental health advocates, the Worcester City Council (which cast a unanimous vote in opposition to the closure), several members of the Worcester legislative delegation, local law enforcement officials, former patients and family members of patients, as well as staff at the facility. "No one outside of those proposing this callous and dangerous plan supports this closure," said Lisa Goss, RN, a nurse on 8 East, the unit where the beds are slated for closure. "All, including the agency in our state charged with protecting public health have evaluated and rejected the hospital's arguments for this closure, yet UMass has turned a deaf ear to the outcry from our community." UMass Management Shocks Staff by Threatening to Close the Unit Regardless of DPH Findings Goss's skepticism about UMass Memorial management's commitment to its patients is well founded. Nearly two weeks ago, after the DPH issued its initial finding that the beds slated for closure were an essential service that should be preserved, and before UMass had even submitted its required response to DPH, hospital management met with the staff on the unit and told them that they planned to go forward with the closure no matter what DPH ruled. "We were shocked that our management could take such an arrogant position and show such blatant disdain for our patients, and those who oversee the safety of our patients," said Goss. "In the interest of our patients and this community, we can only hope that UMass management finally comes to its senses and places its concern for patients ahead of its concern for the bottom line." The DPH rejected nearly every claim made by the hospital to justify the closing, including rejecting its contention that patients currently cared for on the unit can be safely admitted and cared for in other facilities in the region, particularly patients with both psychiatric and medical conditions, and patients who may be poor. "As the existing beds at the Medical Center treat patients with both psychiatric and medical needs, the Department is deeply concerned that the lack of information on diagnoses accepted at alternative sites and the potential inability of these alternate sites to accept some patients from the Medical Center will delay transfer of these patients to a facility that can meet their needs" The DPH letter further states, "these additional sites are not immediately available…Given the uncertainty of bed availability, the Department questions the Medical Center's assertion that there is sufficient capacity to treat patients with serious medical needs. Further, the Department is concerned that the Medical Center's reliance on beds at other facilities will consequently strain the regional capacity and limit access to inpatient psychiatric services and lead to increased ED boarding." In January, the management of UMass Memorial Medical Center announced plans to close 13 of the 27 psychiatric beds on 8 East, its busy inpatient psychiatric unit, and to convert these beds to medical surgical beds. On 8 East staff care for patients from the age of 16 up to geriatrics. They suffer from a range of mental health issues such as depression, bipolar disorder, anxiety, schizophrenia, addiction, and also may be suicidal, self-injurious, and have homicidal thoughts and behavior. These patients often also need treatment for other medical issues which they are able to receive on 8 East because it is a medical psychiatric unit within an acute care hospital. This unit is nearly always full, while at the same time, the UMass University and UMass Memorial emergency departments are overburdened with psychiatric patients waiting for a bed on this or any other unit in the state that can take them These patients often wait several hours to several days for a bed. Founded in 1903, the Massachusetts Nurses Association is the largest union of registered nurses in the Commonwealth of Massachusetts. Its 23,000 members advance the nursing profession by fostering high standards of nursing practice, promoting the economic and general welfare of nurses in the workplace, projecting a positive and realistic view of nursing, and by lobbying the Legislature and regulatory agencies on health care issues affecting nurses and the public. To view the original version on PR Newswire, visit:http://www.prnewswire.com/news-releases/mna-dph-rejects-umass-memorial-medical-centers-plan-to-close-psychiatric-beds-300454366.html "We are delighted to add an experienced commercial biologics team and facilities to help meet the needs of this transformative industry," said Mark Bamforth, president and chief executive officer at Brammer. "We are building on more than a decade of supplying first-in-human cell and gene therapy clinical trials under the leadership of Dr. Richard Snyder, Brammer's chief scientific officer. Our commercial-ready Cambridge facility will be fully operational by Q4 2017. We appreciate Biogen's support during the transition of the facilities and skilled manufacturing personnel." Originally built for the manufacture of Biogen's clinical and commercial biologics, the 66,000 square-foot Cambridge facility in the heart of Kendall Square was licensed by regulatory authorities to manufacture four commercial products. Brammer is renovating the facility for late-stage clinical development and commercial launch of gene therapy products. Brammer also acquired Biogen's nearby 49,000 square-foot, state-of-the-art distribution and warehousing facility, providing high-quality storage and distribution capabilities. Secretary of Housing and Economic Development for the Commonwealth of Massachusetts, Jay Ash, commented, "By bringing novel medical treatments to patients and retaining biotech manufacturing jobs in Massachusetts, Brammer Bio is enhancing the Commonwealth's leading position in both life sciences and advanced manufacturing." Since completing a merger with Florida Biologix, an Ampersand Capital Partners' portfolio company, in March 2016, Brammer has doubled its capacity for process development and is expanding its clinical production space in Alachua, Florida. The addition of Massachusetts facilities gives Brammer 230,000 square feet of development, distribution, and CGMP manufacturing facilities. Brammer also previously announced plans to build-out its 50,000 square-foot facility in Lexington, Massachusetts, which is currently being designed for late stage and commercial cell therapy supply. About Brammer Bio Brammer Bio offers clinical and commercial services to supply vectors for in vivo gene therapy and ex vivo modified-cell based therapy. This includes process and analytical development, and regulatory support, enabling large pharma and biotech clients to accelerate the delivery of novel medicines to improve patients' health. Brammer is owned by Ampersand Capital Partners, the only institutional investor in the company, and its founders. For more information, please visit www.brammerbio.com. About Ampersand Capital Partners Ampersand is a middle market private equity firm with a focus on growth equity investments in the healthcare sector. Over the past two decades, Ampersand has managed more than $1 billion in private equity partnerships. Ampersand leverages its unique blend of private equity and operating experience to build value and drive superior long-term performance alongside its portfolio company management teams. Visit www.ampersandcapital.com. To view the original version on PR Newswire, visit:http://www.prnewswire.com/news-releases/brammer-bio-announces-major-milestone-in-establishing-commercial-ready-gene-therapy-supply-for-the-industry-300453910.html Local authors Michael J. Vieira & J. North Conway will be available to sign copies of book --The North Dartmouth Barnes & Noble will be hosting a book signing foron Saturday, May 20th at 2:00p.m. Authors Michael J. Vieira and J. North Conway will be available to sign copies. Stop by to get your copy of this local history book signed!New England is a rocky, rugged region. Its towns are marked by stone walls and its cities anchored by native granite and marble buildings. Historically significant boulders, many with Native American as well as colonial and neo-pagan origins, attract tourists from around the world. Some are formations that are complex in shape, form and significance, while others contain enigmatic messages, meanings and intriguing characteristics. Learn more about the famous sites like Plymouth Rock, the Old Man of the Mountain and the Sleeping Giant, as well as the lesser-known such as Profile Rock, Dighton Rock and Slate Rock. Authors Michael J. Vieira and J. North Conway examine the history, the legends and the people associated with forty-five notable geological wonders.Dr. Michael J. Vieira retired in 2013 after serving as associate vice-president for academic affairs at Bristol Community College in Fall River, Massachusetts, since 2008. Prior to this, he was dean of business and information management, also at BCC, for five years. Mike earned a PhD from Capella University, a BA and MAT from Bridgewater State College and a CAGS from Rhode Island College, as well as certifications from the Commonwealth of Massachusetts.J. North Conway is the author of thirteen books, including a quartet of books about New York City during the Gilded Age: King of Heists, The Big Policeman, Bag of Bones and Queen of Thieves. Other works include American Literary: Fifty Books That Define Our Culture and Ourselves and The Cape Cod Canal: Breaking Through the Bared and Bended Arm.Barnes & Noble392 State Road Route 6North Dartmouth, MA 02747Saturday, May 20th, 2017 at 2:00 p.m.Available at area bookstores, independent retailers, and online retailers, or through Arcadia Publishing at (888)-313-2665 or online.The combination of Arcadia Publishing & The History Press creates the largest and most comprehensive publisher of local and regional content in the USA. By empowering local history and culture enthusiasts to write local stories for local audiences, we create exceptional books that are relevant on a local and personal level, enrich lives, and bring readers closer - to their community, their neighbors, and their past. Have we done a book on your town? Visit www.arcadiapublishing.com According to the survey, released by the Massachusetts Nurses Association at the State House on May 11, having too many patients at one time to care for is the most significant challenge to RNs providing high-quality patient care, with 77 percent of nurses identifying unsafe patient assignments as a problem. The survey also shows that patients are sicker than ever before, requiring highly specialized nursing care. To help educate the public about the role of RNs in today's complex health care environment, the MNA also premiered at the State House a video series called "What Nurses Really Do" alongside the survey. The first video and a call to action for more nurse videos can be seen at www.massnurses.org/WhatNursesDo. "When it comes to the delivery of patient care and the safety of patients, registered nurses are at the front lines of the health care system," said MNA President Donna Kelly-Williams, RN. "What happens to nurses and the nursing profession is directly connected to the ultimate health and well-being of every patient we encounter. In hospitals, nurses deliver 90 percent of the clinical care patients receive, and are the only caregivers legally and ethically accountable for the safety of patients every minute they are in the hospital." Nurses providing direct care report their patients have increased medical complications and are admitted to the hospital with more serious illness and injury today. Wide majorities of nurses – nearly eight-in-ten – say their patients are sicker now than patients ten years ago. More than half (53%) say their patients are much sicker – a figure that jumps to 63% among nurses working at community hospitals. Twice as many nurses say the staffing situation in their facility has gotten worse over the past four years (39%) as say it has gotten better (21%). Staffing issues are particularly problematic at community hospitals (8% gotten better, 41% gotten worse). Just one-in-ten nurses (10%) feels administrators at their hospital are very responsive to input from RNs about patient assignment levels. Three-in-ten (28%) say management rarely or never adjusts nurse staffing levels when RNs face unsafe patient loads. In each of these categories, RNs reported an increase in patient safety concern over 2015 survey results: "Our nurses are telling us that things are not working," said Rep. Denise Garlick, D-Needham. "We need to listen to them. Three years ago, I worked with my colleagues in the House and Senate to pass safe patient limits in our Intensive Care Units, knowing that it was the first step towards limits in all hospital units. Today's survey confirms that we must take that next step. Our nurses are telling us we need safe limits in all units to protect patients." By wide margins, nurses are more likely to say hospital mergers and acquisitions (21-point margin) and emerging business relationships between hospitals and pharmaceutical companies and/or medical device manufacturers (19-point margin) worsen the quality of patient care. Nurses are even more critical of the impact of insurance reimbursement changes, saying new insurance policies do more to worsen care by a 33-point margin. What Nurses Really Do For 15 straight years, nurses have topped Gallup's annual survey of the most honest and trustworthy professions. But many people don't really know what nurses do on a daily basis. "The State of Nursing in Massachusetts" shows that 43 percent of RNs do not believe patients understand their role. The reality is that nursing today is a complex and demanding profession. Patients are sicker than ever and are admitted to hospitals with serious medical complications. The MNA's video series, "What Nurses Really Do" features Massachusetts nurses speaking directly to the public, telling them about the specialized patient care they provide every day. The first installment in the series, debuting May 11 at the State House, features RNs from Cape Cod Hospital, Norwood Hospital and Brigham and Women's Faulkner Hospital. Nurses are encouraged to share their own experiences as nurses and tell the public what they really do at www.massnurses.org/WhatNursesDo. "The State of Nursing in Massachusetts" was commissioned by the MNA and conducted between April 5 and April 25, 2017 by Anderson Robbins Research, an independent research firm headquartered in Boston. The 2017 survey respondents were all registered nurses working in Massachusetts health care facilities randomly selected from a complete file of the 100,000 nurses registered with the Massachusetts Board of Registration in Nursing. Founded in 1903, the Massachusetts Nurses Association is the largest union of registered nurses in the Commonwealth of Massachusetts. Its 23,000 members advance the nursing profession by fostering high standards of nursing practice, promoting the economic and general welfare of nurses in the workplace, projecting a positive and realistic view of nursing, and by lobbying the Legislature and regulatory agencies on health care issues affecting nurses and the public. To view the original version on PR Newswire, visit:http://www.prnewswire.com/news-releases/state-of-nursing-in-massachusetts-survey-released-for-national-nurses-week---results-strike-alarm-for-patient-safety-amid-drastic-changes-to-health-care-300456133.html The Worksite Wellness Council of Massachusetts (WWCMA) announces Charlie Baker, Governor of Massachusetts, and Tad Mitchell, President and CEO of Wellright as their Keynote Speakers for the 6th Annual WWCMA Conference to be held on September, 19, 2017 at Gillette Stadium. Governor Charlie Baker was inaugurated as the 72nd Governor of the Commonwealth of Massachusetts on January 8th, 2015, after several decades of service in both state government and the private sector. Since taking office, Governor Baker has been making Massachusetts a great place to live, work and raise a family – while delivering a customer-service oriented state government that is as hard working as the people of the Commonwealth. Governor Baker believes people are policy and has appointed a bipartisan Cabinet and developed strong relationships with the legislature to work across the aisle and deliver results for our state. If Governor Baker is unable to attend the event due to unforeseen circumstances, another representative from his office will take his place. Tad Mitchell is the President and CEO of WellRight, a leading provider of employee wellness solutions. Mr. Mitchell is the co-author of 21 Habits: A Wellness Survival Guide, and the author of 101 Challenges: Become the Best You. “We are honored to have Governor Baker and Tad Mitchell as our keynote speakers for the 2017 WWCMA Annual Conference", states Niraj Jetly, WWCMA Education and Events Co-Chair, “We believe they will deliver outstanding presentations that will have a lasting impression on our attendees.” The WWCMA 6th Annual Conference theme is Establishing a Culture of Health: Supportive Wellness Strategies to Measure, Engage and Inspire. The focus this year will be on real life case studies from employers on their experiences with wellness programs, in addition to expert advice and research from wellness industry professionals. The conference is now open for registration and can be accessed on the Conference page of the WWCMA website. BOSTON--(BUSINESS WIRE)--GE [NYSE: GE] announced today the appointment of three new company officers. William “Mo” Cowan has joined GE as Vice President of Litigation and Legal Policy. Prior to joining GE, Mo was President and Chief Executive Officer of ML Strategies and Counsel to Mintz Levin. Prior to rejoining Mintz Levin, Mo represented the Commonwealth of Massachusetts as interim United States Senator, filling the vacancy created when John F. Kerry was appointed United States Secretary of State. Immediately prior to his Senate service, he served in several leadership positions for Massachusetts Governor Deval L. Patrick, including Chief Legal Counsel (2009-2011), Chief of Staff (2011-2013) and Senior Advisor (2013). He earned his bachelor’s degree in sociology from Duke University and his juris doctor from Northeastern University. Kevin Ichhpurani has been appointed Executive Vice President of Global Ecosystem and Channels for GE Digital, responsible for developing the company’s partner ecosystem across all business units within GE. Prior to joining GE, Kevin was the Senior Partner, Head of Global Alliances and Ecosystem Innovation at Ernst & Young and previously Executive Vice President of Business Development and Global Partner Ecosystem at SAP. Kevin has spent 20 plus years in the technology sector focused on strategic business development, M&A, venture capital and corporate strategy. Kevin holds an MBA from Northwestern University. Athena Kaviris has been promoted to Vice President of Human Resources for GE Transportation and GE Labor Relations. With more than twenty years of experience at GE, Athena has held leadership roles in human resources at GE Lighting, GE Power, GE Capital, GE Aviation and GE Transportation. Athena earned her bachelor’s degree in psychology and business administration from the State University of New York and completed her master’s degree coursework in organization development from the University of San Francisco. GE (NYSE: GE) is the world’s Digital Industrial Company, transforming industry with software-defined machines and solutions that are connected, responsive and predictive. GE is organized around a global exchange of knowledge, the "GE Store," through which each business shares and accesses the same technology, markets, structure and intellect. Each invention further fuels innovation and application across our industrial sectors. With people, services, technology and scale, GE delivers better outcomes for customers by speaking the language of industry. www.ge.com CHESTNUT HILL, MA, May 19, 2017-- Edward A. Schwartz has been included in Marquis Who's Who. As in all Marquis Who's Who biographical volumes, individuals profiled are selected on the basis of current reference value. Factors such as position, noteworthy accomplishments, visibility, and prominence in a field are all taken into account during the selection process.When reflecting upon his legal career, Mr. Schwartz is most proud of his work with the Digital Equipment Corporation, also known as DEC, a computer manufacturing company based in Maynard, Mass. He served as general counsel, vice president and secretary of the company from 1967 to 1988. Responsible for the company's law department on a global level, he oversaw the setting up of offices and technical schools that taught new technology to technicians. His work greatly contributed to the success of the company, which helped develop the Internet world before it became public, and enhanced communication technology for a wider audience. With the DEC, Mr. Schwartz was also able to work for a great company comprised of dedicated employees.Mr. Schwartz pursued a career in law after graduating with a Bachelor of Arts from Oberlin College in 1959. In 1962, he obtained an LL.B. from Boston College and became admitted to practice in the state of Connecticut. Mr. Schwartz became admitted to practice in the state of Massachusetts three years later. He has also completed postgraduate coursework at American University, Northeastern University and Stanford University.Mr. Schwartz returned to his alma mater, Boston College, in 1986 as a visiting professor of law. He then joined the faculty of the school as an adjunct professor for two years, and served on its board of directors as well. While he was a student at the university, he served as editor of the Boston College Industrial and Commercial Law Review from 1960 to 1962. He was also an editor for the Annual Survey of Massachusetts Law.In 1961, Mr. Schwartz began his professional career as a legal intern at the Office of the Attorney General for th Commonwealth of Massachusetts. He brought this experience to the law firm of Schatz & Schatz in Hartford, Conn., where he was an associate for three years. Mr. Schwartz was then an associate for the firm of Cohn, Reimer & Pollack in Boston Mass. for two years before joining the DEC. For eight years prior to his retirement, Mr. Schwartz served as president of the New England Legal Foundation in Boston.As a result of his dedication to the field of law, Mr. Schwartz was chosen to be featured in the 44th through 70th editions of Who's Who in America, and the 22nd edition of Who's Who in the East. He has also appeared in multiple editions of Who's Who in American Law and Who's Who in Finance and Business. However, Mr. Schwartz feels that his greatest accomplishments are his wonderful family and the friendships he has nurtured. He is particularly proud of his sons, Eric and Jeffrey.About Marquis Who's Who :Since 1899, when A. N. Marquis printed the First Edition of Who's Who in America , Marquis Who's Who has chronicled the lives of the most accomplished individuals and innovators from every significant field of endeavor, including politics, business, medicine, law, education, art, religion and entertainment. Today, Who's Who in America remains an essential biographical source for thousands of researchers, journalists, librarians and executive search firms around the world. Marquis now publishes many Who's Who titles, including Who's Who in America , Who's Who in the World , Who's Who in American Law , Who's Who in Medicine and Healthcare , Who's Who in Science and Engineering , and Who's Who in Asia . Marquis publications may be visited at the official Marquis Who's Who website at www.marquiswhoswho.com Contact:Fred Marks844-394-6946 "We are working while exhausted…" the MNA BFMC Committee writes in the letter. "Among our most important issues in negotiations for which a long-term solution is urgently needed is understaffing that forces RNs and others to work overtime and extra shifts without rest. In the past two years most RNs were convinced to move from 12 hour shifts to 8 hour shifts on the rationale presented by BFMC management that academic studies correlate long shifts to fatigue, medical errors and negative patient outcomes. We agreed. "But when we used to work 12s, we would be off duty a number of days. Now we are supposedly on 8s or 10s, scheduled for more days a week than before, but we are often really working four or five 12s, with no rest, because there is not enough staff, and so we are forced to pick up additional shift after shift after shift and can't go home at the end of our shifts. This is antithetical to the safe patient care studies management was (accurately) citing to us two years ago." During the past 12 months at BFMC: Noting that BFMC's president was quoted in the press saying, "As an organization here, do I feel that our staff is overworked? That's not my opinion." The nurses ask in their letter, "By what method did you come to that opinion?" In 2004, the Institute of Medicine – part of the National Academies of Sciences, Engineering, and Medicine – published a report outlining improvements to nurse working conditions. "Keeping Patients Safe: Transforming the Work Environment of Nurses" called for a ban on nurses working more than 12 hours in a 24-hour period. "In the event that nurses are required to work excessive hours because of an emergency, this information should be immediately disclosed to the public so that elective admissions can be postponed and other admissions diverted to different units or facilities. Similarly, in any instance where a nursing shortage prevents [a health care organization] from securing sufficient nurses to prevent work hours in excess of 12 hours in any 24-hour period and more than 60 hours in any seven day period, this information also should be disclosed to the public, so that elective admissions can be referred to other facilities or delayed until staffing is remedied. If an admission cannot be delayed or referred to another HCO, the patient and their family should be informed about the shortage of staffing and that nursing staff is working under conditions adverse to patient safety." "Nurse Working Conditions and Patient Safety Outcomes," a review of outcomes data for more than 15,000 patients in 51 U.S. hospital ICUs published in the journal Medicare Care, showed that overtime for nurses was associated with an increase risk in catheter-related urinary tract infections and skin ulcers. "The Working Hours of Hospital Staff Nurses and Patient Safety," published in Health Affairs, demonstrated that nurses working mandatory overtime are three times more likely to make a medical error. BFMC nurses have been bargaining with Baystate since November 2016. Nurses have voted 93 percent to authorize a one-day strike and filed seven unfair labor practice charges against Baystate Franklin with the National Labor Relations Board. The strike authorization vote gives the MNA BFMC Bargaining Committee the authority to call a one-day strike. Bargaining is over a new contract to replace the agreement that was scheduled to expire Dec. 31, 2016. A federal mediator joined the bargaining process in February. For more details, including the letters to the president, NLRB charges and hospital schedules, mandatory overtime reports and text messages showing a pattern of BFMC not having enough nurses for its patients, please contact Joe Markman at 781-571-8175 or jmarkman@mnarn.org. Founded in 1903, the Massachusetts Nurses Association is the largest union of registered nurses in the Commonwealth of Massachusetts. Its 23,000 members advance the nursing profession by fostering high standards of nursing practice, promoting the economic and general welfare of nurses in the workplace, projecting a positive and realistic view of nursing, and by lobbying the Legislature and regulatory agencies on health care issues affecting nurses and the public. To view the original version on PR Newswire, visit:http://www.prnewswire.com/news-releases/baystate-franklin-medical-center-nurses-worked-3980-shifts-longer-than-12-hours-in-one-year-rns-detail-nursing-practice-concerns-in-letter-to-hospital-president-300458632.html Major Development to Create 1,600 New Jobs in Marlborough Massachusetts Lt. Gov. Karyn Polito tours the 475,000-square foot Apex Center of New England in Marlborough, announces job creation. Marlborough, MA, May 26, 2017 --( The 475,000 square-foot Apex Center is among the largest developments currently underway in MetroWest and one of the biggest to come to Marlborough in the past decade. When completed in the fall of 2017, the development will consist of 11 buildings, including a 150,000-square-foot entertainment complex, two hotels, six restaurants, retail stores and office buildings. Over 96% of the space has already been leased and once it is fully operational, the Apex Center is expected to create 800 full-time and 800 part-time jobs. Massachusetts Lieutenant Governor Karyn Polito announced the job numbers while touring the entertainment center project site yesterday, alongside developer Robert Walker, Marlborough Mayor Arthur Vigeant, Marlborough Economic Development Corporation (MEDC) executive director Meredith Harris and other local officials. The tour was organized on Polito’s recommendation, after the Commonwealth of Massachusetts awarded a $3.05 million MassWorks Infrastructure Program grant to the city in November 2016. The grant will fund roadway improvements along Route 20 West, including new turn lanes and upgraded signals, to support the Apex Center. “This is a proud moment for our Commonwealth,” said Polito while speaking at yesterday’s event. “My colleagues in the legislature and city officials and the municipal government here are coming together with the private sector to unleash an incredible opportunity here. While there is a lot of activity in eastern Massachusetts, in our capital city, seeing this level of investment and activity in the heart of our Commonwealth is really profound, and it’s a real testament to the city’s leadership. When you have a private business owner, who wants to come forward to do something in a community like this, when he comes to City Hall and you have a full team ready and open for business, it makes his decision that much easier as to whether to invest here or somewhere else. So, it’s a real credit to Marlborough for really signaling to the business community that its wants to see this kind of activity and that it’s ready to take it on as a community. What you are creating here in Marlborough is an opportunity for the next generation to stay in the community, where students can graduate, go into the workplace and find all that they need right here in the city - great education, great jobs and a great place to live, work and raise a family. Congratulations on your success story.” “Part of the reason we’re here is because of the Lieutenant Governor and MassWorks and Secretary Ash’s confidence in the city, as well as the City of Marlborough’s commitment,” Walker said. “We wouldn’t be here without the support of the city; they have been very welcoming. When you invest hundreds of thousands of dollars, sometimes millions, into a city, you bring those very important jobs of every aspect. From entry level, all the way to management and ownership. A lot of these folks here are independent owners of their own business, which gets me excited every day to see someone be able to grow and prosper and bring someone up along with them. It’s quiet a success story.” "It’s going to be about 15 months from the day the project broke ground to the day the first facility at the Apex Center opens this fall," Vigeant said. “That is a fantastic achievement. I can’t thank Robert Walker and Ryan Development enough for bringing such a major and unique development to the City of Marlborough and following through on their commitment to build quickly and bring jobs for our residents.” “The Apex Center development is a clear indicator of the health of the Marlborough economy,” Harris said. “A project of this size and scope can only thrive in an environment that is welcoming and prospering. We look forward to seeing the Apex Center open in the fall and, not only bring new amenities to the region’s residents and employers, but create new jobs for our local community. And if all 1,600 jobs go to Marlborough residents, we could virtually eliminate unemployment in the city.” For high resolution images from the tour, go to: https://www.dropbox.com/sh/p7g57z5sc5uustn/AACTYNWxv0IXIePc7aVsuCs0a?dl=0 For more information about the Apex Center of New England, go to: http://www.apexcenterne.com. About MEDC: The Marlborough Economic Development Corporation (MEDC) is the state chartered economic development corporation for the City of Marlborough, MA and represents a public-private partnership for planning. MEDC works with municipal and private investors to foster economic development, job growth and community revitalization. For a complete overview of MEDC, visit www.MarlboroughEDC.com. Marlborough, MA, May 26, 2017 --( PR.com )-- The Apex Center of New England, a unique commercial mixed-use development in the City of Marlborough, is expected to create 1,600 permanent jobs when it opens in October, in addition to the approximately 400 temporary jobs it has already created during construction.The 475,000 square-foot Apex Center is among the largest developments currently underway in MetroWest and one of the biggest to come to Marlborough in the past decade. When completed in the fall of 2017, the development will consist of 11 buildings, including a 150,000-square-foot entertainment complex, two hotels, six restaurants, retail stores and office buildings. Over 96% of the space has already been leased and once it is fully operational, the Apex Center is expected to create 800 full-time and 800 part-time jobs.Massachusetts Lieutenant Governor Karyn Polito announced the job numbers while touring the entertainment center project site yesterday, alongside developer Robert Walker, Marlborough Mayor Arthur Vigeant, Marlborough Economic Development Corporation (MEDC) executive director Meredith Harris and other local officials. The tour was organized on Polito’s recommendation, after the Commonwealth of Massachusetts awarded a $3.05 million MassWorks Infrastructure Program grant to the city in November 2016. The grant will fund roadway improvements along Route 20 West, including new turn lanes and upgraded signals, to support the Apex Center.“This is a proud moment for our Commonwealth,” said Polito while speaking at yesterday’s event. “My colleagues in the legislature and city officials and the municipal government here are coming together with the private sector to unleash an incredible opportunity here. While there is a lot of activity in eastern Massachusetts, in our capital city, seeing this level of investment and activity in the heart of our Commonwealth is really profound, and it’s a real testament to the city’s leadership. When you have a private business owner, who wants to come forward to do something in a community like this, when he comes to City Hall and you have a full team ready and open for business, it makes his decision that much easier as to whether to invest here or somewhere else. So, it’s a real credit to Marlborough for really signaling to the business community that its wants to see this kind of activity and that it’s ready to take it on as a community. What you are creating here in Marlborough is an opportunity for the next generation to stay in the community, where students can graduate, go into the workplace and find all that they need right here in the city - great education, great jobs and a great place to live, work and raise a family. Congratulations on your success story.”“Part of the reason we’re here is because of the Lieutenant Governor and MassWorks and Secretary Ash’s confidence in the city, as well as the City of Marlborough’s commitment,” Walker said. “We wouldn’t be here without the support of the city; they have been very welcoming. When you invest hundreds of thousands of dollars, sometimes millions, into a city, you bring those very important jobs of every aspect. From entry level, all the way to management and ownership. A lot of these folks here are independent owners of their own business, which gets me excited every day to see someone be able to grow and prosper and bring someone up along with them. It’s quiet a success story.”"It’s going to be about 15 months from the day the project broke ground to the day the first facility at the Apex Center opens this fall," Vigeant said. “That is a fantastic achievement. I can’t thank Robert Walker and Ryan Development enough for bringing such a major and unique development to the City of Marlborough and following through on their commitment to build quickly and bring jobs for our residents.”“The Apex Center development is a clear indicator of the health of the Marlborough economy,” Harris said. “A project of this size and scope can only thrive in an environment that is welcoming and prospering. We look forward to seeing the Apex Center open in the fall and, not only bring new amenities to the region’s residents and employers, but create new jobs for our local community. And if all 1,600 jobs go to Marlborough residents, we could virtually eliminate unemployment in the city.”For high resolution images from the tour, go to: https://www.dropbox.com/sh/p7g57z5sc5uustn/AACTYNWxv0IXIePc7aVsuCs0a?dl=0For more information about the Apex Center of New England, go to: http://www.apexcenterne.com.About MEDC:The Marlborough Economic Development Corporation (MEDC) is the state chartered economic development corporation for the City of Marlborough, MA and represents a public-private partnership for planning. MEDC works with municipal and private investors to foster economic development, job growth and community revitalization. For a complete overview of MEDC, visit www.MarlboroughEDC.com. Click here to view the list of recent Press Releases from Marlborough Economic Development Corporation Garballey is seeking the state senate seat vacated by the death of Sen. Ken Donnelly, D-Arlington. Garballey currently is a state representative for the 23rd Middlesex District covering Arlington and West Medford. A special primary election is schedule for June 27. The special general election is July 25. "The MNA endorsed Ken Donnelly for State Senate and we believe Sean Garballey is the best person to continue Donnelly's legacy at the State House," Kelly-Williams said. Garballey has pledged to support nurse efforts to improve patient care through the state legislature. These include safe patient limits for nurses, workplace violence prevention and safe patient handling bills. He also supports the collective bargaining rights of workers, making sure every public school has a school nurse and improvements for mental health patients. "I proudly support the efforts of the Massachusetts Nurses Association to protect patients and ensure fair treatment of nurses and other health care professionals," Garballey said. "I know many MNA nurses, understand their concerns and support their legislative solutions. As a State Senator, I will be honored to stand with the MNA and fight for high-quality patient care." Founded in 1903, the Massachusetts Nurses Association is the largest union of registered nurses in the Commonwealth of Massachusetts. Its 23,000 members advance the nursing profession by fostering high standards of nursing practice, promoting the economic and general welfare of nurses in the workplace, projecting a positive and realistic view of nursing, and by lobbying the Legislature and regulatory agencies on health care issues affecting nurses and the public. To view the original version on PR Newswire, visit:http://www.prnewswire.com/news-releases/massachusetts-nurses-association-endorses-rep-sean-garballey-for-the-4th-middlesex-senate-district-300448993.html
To Whom It May Concern: This is a request under the Freedom of Information Act. I hereby request the following records: The FBI's files regarding or mentioning the "Pepe the Frog” character or meme, which was recently added to the ADL's Online Hate Symbols Database: http://www.adl.org/press-center/press-releases/extremism/adl-adds-pepe-the-frog-online-hate-symbols-database.html I am journalist who writes extensively about FBI files - https://www.muckrock.com/project/subjects-matter-fbi-files-10/, which have received national and international attention - http://www.dailymail.co.uk/news/article-3219376/Undercover-FBI-agents-spy-annual-Burning-Man-festival-light-ongoing-war-terrorism-use-test-new-intelligence-collection-technology.html The requested documents will be made available to the general public, and this request is not being made for commercial purposes. In the event that there are fees, I would be grateful if you would inform me of the total charges in advance of fulfilling my request. I would prefer the request filled electronically, by e-mail attachment if available or CD-ROM if not. Thank you in advance for your anticipated cooperation in this matter. I look forward to receiving your response to this request within 20 business days, as the statute requires. Sincerely, JPat Brown
Home > The bishops take a stand against critics of Catholic Relief Services The bishops take a stand against critics of Catholic Relief Services By Scott Alessi|Print |Share blogSocial Justice We've written quite a few times about the attacks from Catholic pro-life groups[1] aimed at church agencies that serve the poor, including Catholic Relief Services (CRS), Catholic Charities, and the U.S. bishops' Catholic Campaign for Human Development (CCHD). Each time, the story is the same: through some form of guilt by association, these organizations are labeled "anti-Catholic" for failing to adhere to the church's teaching on a very small set of issues, primarily abortion and contraception. The accusations thrown around[2] by groups like the American Life League have caused a great deal of confusion and division among Catholics. Without knowing all the facts, some people are misled by rhetoric and then pass along inaccurate information and, well, you know how gossip can spread. In recent months, CRS has devoted too much time and energy to carefully addressing and refuting the accusations[3] made against them, but juicy soundbites about scandal in a Catholic organization always get more attention than detailed, logical explanations of the complexities involved in running an international relief and development agency. Thankfully, the U.S. bishops have finally stepped in to defend CRS. In a press release issued today[4], the U.S. Conference of Catholic Bishops made a long overdue statement of clarification about the groups like ALL that are making it their business to target official church-run agencies like CRS: "We want to make it clear that those making these public critiques, albeit, we hope, in good faith, do not speak for the Catholic Church and we advise the Catholic faithful to exercise caution and consult the CRS website for clarification before endorsing or giving credence to the groups’ critiques... The U.S. Catholic bishops stand firmly behind CRS in its commitment to promote and defend human dignity and the sacredness of every human life from the moment of conception until natural death, and at every moment in between." The release also takes the time to address some of the criticism against CRS, including its partnerships and its adherence to Catholic teaching (for more about this, be sure to read our interview[5] with CRS president Carolyn Woo). The bishops are expressing their full confidence in CRS and attempting to settle this matter once and for all, reassuring Catholics that the work of CRS is an extension of the church's teaching, not a violation of it. It remains to be seen if this statement will truly silence the critics (as of this writing, there has been no official response from ALL). My guess is that they will continue their attacks, blaming the bishops for being complicit in the supposed "anti-Catholic" activities of CRS. If that happens, they will be declaring themselves more fit to interpret the teachings of the church than its own ordained leaders. There's certainly a place for disagreement with bishops and debate of issues between the church's leaders and the laity. But there's a difference between debate and declaring that those who disagree with you are "compromising with the devil[6]." If the critics aren't satisfied with a definitive statement from the bishops addressing their concerns, then it only further raises the question of what their true agenda is.
Sir Dave Brailsford is credited as one of the principal architects in transforming Great Britain's track fortunes over the last decade and can now claim to have replicated that on the road with Team Sky. After a sensational season for British cycling in 2012 - which saw Team Sky capture a one-two finish at the Tour de France before going on to win eight gold medals at the London Olympic Games - Brailsford faced the task of sustained success in 2013. The results followed, with a second consecutive Tour de France victory ensuring Team Sky did twice in four seasons what they had originally set out to do once in five. A third Tour victory arrived in 2015, with the team racking up its 200th win during a highly successful year. Often describing himself as an orchestra conductor, Brailsford oversaw the mammoth task of bringing the team together in 2009 and witnessed the squad go from strength to strength over six seasons on the road. Having maintained an upward trajectory, the goal remains to keep winning the world’s biggest races, with the elusive one-day Spring Classics a continued target. “Sport is about continuous improvement, it’s about getting better," said Brailsford. "It’s about being better next year than you are this year. It’s a bit like Formula One. You have a car and the designers might say ‘we can’t think how we’re going to make this any better’. But ultimately you can. And that’s what we’ve got to do. We’ve got to keep looking, researching and working – trying things. And that’s what it’s all about.” "Everyone is back at square one. Nobody has an advantage because of what we did last year. No one gets a 10-mile start or anything. We’re all absolutely back to zero. And unless you’ve done the work - unless you’ve put in and unless you’ve done what it takes - then you’re going to suffer. There’s no hiding place in this sport."
Tips – Surf Fishing What is surf fishing? Surf fishing is the method of catching fish, while standing on the shores of the beaches or walking in surf waves. In general, Surf fishing in making all types of beaches and saltwater beaches, sand and rock. Most surf fishermen do their fishing cast your bait into the sea of??the coast. While looking for a good profit, most surf fishermen do it as a sport. Baits & Equipment The baits used in surf fishing are longer than usual. These are made of a fishing rod, with a combination of lures, swivels, hooks and wires. The bases of the primers are extended to have a better grip. The different types of bait are used in accordance with the terms of fisheries and fish species found there. In general, primers with heavy sticks and larger hooks are used for larger fish. Besides fuses, most surfers are surfing bags usually contain a collection of lures to change the above. This is to avoid unnecessary trips back to the beach to change the bait when the need arises. They also carry containers filled with bags of food for fish and to bring back the crops. Bait casting The cast of the baits is a special way to get great distances to feed the fish. Unlike normal fishing quality surf fishing involves the coordination of both hands and body. This translates into the bait to reach a longer distance than usual. Some fishermen use the pendulum movement of the bait before casting. In some cases, the issue can find a distance of 180 meters. To help the cast, the fishermen get to the top of the rocks in some rocky beaches. Some surf fishermen use boats sailing to cast the bait rather than casting from shore. These boats are very small and are collapsible making them easy to carry. The boats are manufactured in such a way to help fishermen by providing the necessary balance. Surf Fishing Zones Surf fishing is done off the U.S. Atlantic coast. It is especially preferred in California, where a very popular sport. The reason for this is the presence of a large number of sandy beaches and rocky in parts. Also in certain parts of the coast of Australia, Surf fishing is done as a hobby. Fish species Many species of fish caught in the surf fishing. Since this as a sport, the intention is to capture a large number of fish, large, in particular. Although a large number of types of fish are caught, most of them are striped bass, found in large numbers along the beaches of the Atlantic. The most special is the availability of striped bass from the shore of the beach. These fish weigh up to 32 kilos. Some of the other types of fish commonly caught in the surf fishing are tuna, Black drum, blue fish, red fish, flounder, whiting, Bonita, Snook, Black fish etc To hazards There are plenty of dangers faced by surf fishermen. As faced by people moving to the rocks to cast their baits on the rocky beaches. From the beaches of white water are preferred for surf fishing because of the availability of fish along the shore, there is high possibility of hard and rough waves to come. This results in serious injury and serious. There are certain cases where deaths of Internet users have seen these waves in the rough. So be careful to check the sea conditions prior to fishing.
Taraxalisin -- a serine proteinase from dandelion Taraxacum officinale Webb s.l. Latex of dandelion roots contains a serine proteinase that hydrolyzes a chromogenic peptide substrate Glp-Ala-Ala-Leu-pNA optimally at pH 8.0. Maximal activity of the proteinase in the roots is attained in April, at the beginning of plant development after the winter period. The protease was isolated by ammonium sulfate precipitation of the root extract followed by affinity chromatography on a Sepharose-Ala-Ala-Leu-mrp and gel filtration on Superose 6R performed in FPLC regime. Pure serine proteinase named taraxalisin was inactivated by specific inhibitors of serine proteinases, diisopropylfluorophosphate (DFP) and phenylmethylsulfonylfluoride (PMSF). Its molecular mass is 67 kDa and pI 4.5. pH stability range is 6-9 in the presence of 2 mM Ca2+, temperature optimum is at 40 degrees C; Km=0.37+/-0.06 mM. The substrate specificity of taraxalisin towards synthetic peptides and insulin B-chain is comparable with that of two other subtilisin-like serine proteinases, cucumisin and macluralisin. The taraxalisin N-terminal sequence traced for 15 residues revealed 40% coinciding residues when aligned with that of subtilisin Carlsberg.
Q: Facebook SDK loginViewShowingLoggedInUser not getting called I'm new to iOS and trying to implement Facebook login and after login is successful I want it to go to another view. I've done everything that the documentation shows but I can't get the delegate to be called. I have seen people questions but I tried all of them. Nothing worked not sure if I miss something obvious. This is my LoginViewController.h #import <UIKit/UIKit.h> #import <FacebookSDK/FacebookSDK.h> @interface LoginViewController : UIViewController <FBLoginViewDelegate> @end This is my LoginViewController.m file #import "LoginViewController.h" @interface LoginViewController () @end @implementation LoginViewController - (void)viewDidLoad { [super viewDidLoad]; NSLog(@"Starting"); // Do any additional setup after loading the view. } - (void)didReceiveMemoryWarning { [super didReceiveMemoryWarning]; // Dispose of any resources that can be recreated. } /* #pragma mark - Navigation // In a storyboard-based application, you will often want to do a little preparation before navigation - (void)prepareForSegue:(UIStoryboardSegue *)segue sender:(id)sender { // Get the new view controller using [segue destinationViewController]. // Pass the selected object to the new view controller. } */ - (BOOL)application:(UIApplication *)application didFinishLaunchingWithOptions:(NSDictionary *)launchOptions { // Override point for customization after application launch. FBLoginView *loginView = [[FBLoginView alloc] init]; loginView.delegate = self; return YES; } -(void)loginViewShowingLoggedInUser:(FBLoginView *)loginView { NSLog(@"You're logged in"); [self performSegueWithIdentifier:@"segueToAnotherView" sender:self]; } -(void)loginViewShowingLoggedOutUser:(FBLoginView *)logoutView { NSLog(@"Logged out"); } @end I also have this in my AppDelegate.m - (BOOL)application:(UIApplication *)application openURL:(NSURL *)url sourceApplication:(NSString *)sourceApplication annotation:(id)annotation { // Call FBAppCall's handleOpenURL:sourceApplication to handle Facebook app responses BOOL wasHandled = [FBAppCall handleOpenURL:url sourceApplication:sourceApplication]; // You can add your app-specific url handling code here if needed return wasHandled; } When the app comes back I don't see the log "You're logged in" or even "Logged out" at all. I can only see the Logout button from Facebook. Also, the two view controllers are connected by a segue. A: You are going to want to add your app to Facebook, Download the Facebook SDK and add some values to your plist. There is a lot more you're going to need to do here and I suggest you read Facebook SDK Documentation If you need more help, I am brand new to iOS as well and just implemented my own Facebook login (I guess you could call it custom) and it works smoothly.
Kareena Kapoor and Saif Ali Khan to have their second child after two years Parents to internet sensation and nation’s cutest baby boy, Taimur Ali Khan, Kareena and Saif Ali Khan have been the biggest newsmakers for the longest of time. Kareena created waves with her pregnancy as she was out and about working and being truly unstoppable. Bebo and Saif welcomed little Taimur on December 20, 2016 and the little munchkin already has zillions of fan pages on social media while his every move gets photographed by the paparazzi. Present with BFF Amrita Arora, on a chat show recently, Kareena had one big revelation to make. When asked about her and Saif’s plan to have their second child, Kareena said, “After 2 years.” It didn’t stop there as Amrita immediately quipped, “I have told her if she decides to get pregnant again, let me know because I’ll be leaving the country.” When asked if she and Saif pamper li’l Taimur, Kareena excitedly shared that she enjoys doing it the most. On the work front, KKK will be next seen in Takht and Good News.
Two Mayo County Councillors found to have contravened the Local Government Act have responded to findings against them from the Standards in Public Office Commission (SIPO). Independent Councillor Frank Durcan and Fine Gael Councillor Cyril Burke were both found to have been in breach of a Code of Conduct for elected representatives. SIPO found there was no evidence to suggest Mayo County Council Chief Executive Peter Hynes had committed a breach of the same legislation. The SIPO reports followed a lengthy inquiry and the findings have been given to the Minister for Finance. Cllr Durcan said he did not accept the report, which he said was a waste of public money. The 78-year-old said he laughed when he saw the report and was critical of the decision to hold the inquiry in private, when he said, it should have taken place in a public forum. Cllr Burke said he was disappointed at the finding that he had failed to maintain proper standards. However he said he was pleased that the report confirmed he stood to make no personal gain from the arrangements. The SIPO reports stemmed from concerns around planning applications and Freedom of Information (FOI) requests. The investigation centred on interactions between the two councillors in late 2014, which were the subject of an internal Mayo County Council investigation, before being referred to the commission. It found that they came to an arrangement that Cllr Durcan would withdraw FOI requests he had made, in the expectation that this would lead to a favourable planning decision for land he owned. The report details evidence given by Cllr Durcan that a journalist with Independent News and Media had advised him on the type of questions he should put to Cllr Burke, ahead of meetings which were secretly recorded. It also transpired in evidence that the journalist, Philip Ryan, had been in contact with Cllr Durcan in the days leading up to the submission of FOI requests in August 2014 and had sent the councillor draft FOI requests. The report says Mr Ryan was present in an adjoining room, when the two councillors met in October 2014 and had made a recording of the conversation. Mr Durcan also told the inquiry that Mr Ryan had "advised him on the type of questions to put to Cllr Burke to get him to incriminate himself." The inquiry was prompted by allegations concerning a 6.5 acres site at Aghalusky, near Castlebar, which was owned by Cllr. Durcan. In October 2010 a pre-planning enquiry was submitted to Mayo County Council for a nursing home and 20 residential units on the land. The council said this was premature due to zoning, a lack of public services and traffic safety concerns. Four years later, on 12 August 2014, Cllr Durcan submitted two FOI requests to the council seeking details about the appointment of a senior official. He withdrew this request on 3 September 2014, saying he no longer required the information. But on 30 October he submitted the same requests to the council and was given the information on 19 November. The SIPO investigation examined contacts between Cllr Durcan and Cllr Burke around this time. The Commission found both had contravened Section 168 of the Act by agreeing that the FOI requests would be withdrawn "in the expectation of favourable planning for the Durcan lands." The Commission said the evidence of Frank Durcan was unreliable due to many contradictions between his original statements and his oral evidence. It says explanations provided by Cyril Burke were unsatisfactory and lacking in clarity and consistency. His credibility was further diminished when he accepted new and different explanations for his actions during cross examination. Fine Gael says it is considering the report before determining what action to take. Mr Hynes was alleged to have contravened Part 15 of the Local Government Act, by failing to maintain proper standards of integrity, conduct and concern for the public interest by arranging for Cllr Cyril Burke to ask Cllr Durcan to withdraw a Freedom of Information request in exchange for favourable zoning of land. But the commission says there is no direct evidence of Mr Hynes being involved in any agreement in relation to the subject matter of the alleged contraventions. Mayo County Council said the reports would be considered in due course.
The need for materials that display high specific strength, stiffness, and toughness in excess of those displayed by single phase engineering materials has resulted in the development of composites derived from two or more non-homogeneous materials, where a reinforcing material, generally of greater strength and/or stiffness, is dispersed within a continuous bulk matrix material. Composites allow the properties of the bulk material to be tailored for a specific application. A very useful type of composite is a laminar composite with pluralities of laminae, where each lamina contains unidirectional or woven reinforcing fibers, which are combined to form a composite. The orientation of the fibers can differ from one lamina to another in a stack of laminae. The reinforcement is predominately in the direction of the reinforcing fibers in the laminae, in-plane, with little or no reinforcement to the common perpendicular to the fibers, the thickness of the laminar composite. The ultimate performance of laminar composite materials is heavily influenced by the strength and toughness of the interlaminar region where adjacent laminae intimately contact. Enhancement of the interlaminar strength in composite materials has been achieved by four primary methods: interleaves, where a thin interlayer of an adhesive, which can be a second composite material, is placed at the interface between laminae; nanocomposite matrices, where the matrix material is further reinforced by a second reinforcing nanomaterial; Z-pinning, where laminae are connected by extending fibers through the thickness by weaving, knitting, braiding or stitching; and fiber whiskerization, where the reinforcing fibers are decorated with “whiskers” of a like or dissimilar reinforcing material. Limitations to employing these technologies have not facilitated their widespread adoption in commercial composites. For example: interleave methods reduce the composite's in-plane strength; nanocomposite matrices require costly resin transfer molding (RTM) processes and complex dispersion techniques; Z-pinning requires expensive tooling and leads to damage of the reinforcing fibers and can form defects that initiate composite failure; and fiber whiskerization remains costly and poses significant manufacturing challenges. Hence, there remains a need for interlaminar reinforcement that maintains the laminar composite's in-plane properties yet is low cost, environmentally benign, and compatible with commercial prepreg processing. Furthermore, the method of preparing the laminar composite should be readily adaptable to a commercial production scale without the requirement of advanced tooling or resin transfer processes.
Police are searching for someone who punched a man in the face following an argument over religion on the subway. Two men were riding a northbound yellow line train at Court Street when they got into a disagreement over differing religions shortly before 9:30 a.m. last Sunday, police said. As the train pulled into the 14th Street-Union Square station, one of the men stood up from his seat and punched the 40-year-old victim in the face when the train doors opened. The suspect then fled the scene. The victim sustained an abrasion and a bruise to his right eye, police said. The suspect was last seen wearing dark blue jeans and a green jacket. He is described as 6 feet tall with brown short hair. The investigating is ongoing by NYPD's Hate Crimes Task Force. Anyone with information regarding the incident should call the NYPD's Crime Stoppers Hotline at 1-800-577-TIPS.
HOUSTON (AP) — A National Guard member arrested on a sexual assault charge while serving on the U.S.-Mexico border lost his job as a county jailer last year after being arrested for drunken driving. Records obtained by The Associated Press on Thursday show Luis Carlos Ontiveros was fired in January 2017 by the El Paso County Sheriff’s Office. The sheriff fired Ontiveros one month after he was arrested for driving while intoxicated, accusing him of crashing his car while drunk and lying about it to police and investigators. Ontiveros remained a member of the Texas Army National Guard. He was arrested Monday in Alpine, Texas, and accused of sexually assaulting a woman at a motel. Ontiveros hasn’t responded to phone messages. The Guard declined to comment but said it is cooperating with investigators. Sign up for Daily Newsletters Manage Newsletters Copyright © 2020 The Washington Times, LLC.
--- abstract: 'A search for recoiling supermassive black hole candidates recently yielded the best candidate thus far, SDSS J092712.65+294344.0 reported by Komossa et al. Here we propose the alternative hypothesis that this object is a supermassive black hole binary. From the velocity shift imprinted in the emission-line spectrum we infer an orbital period of $\sim 190$ years for a binary mass ratio of 0.1, a secondary black hole mass of $10^8~{\rm M}_\odot$, and assuming inclination and orbital phase angles of $45^\circ$. In this model the origin of the blueshifted narrow emission lines is naturally explained in the context of an accretion flow within the inner rim of the circumbinary disk. We attribute the blueshifted broad emission lines to gas associated with a disk around the accreting secondary black hole. We show that, within the uncertainties, this binary system can be long lived and thus, is not observed in a special moment in time. The orbital motion of the binary can potentially be observed with the $VLBA$ if at least the secondary black hole is a radio emitter. In addition, for the parameters quoted above, the orbital motion will result in a $\sim 100~{\rm km\,s^{-1}}$ velocity shift of the emission lines on a time scale of about a year, providing a direct observational test for the binary hypothesis.' author: - 'Tamara Bogdanović, Michael Eracleous, and Steinn Sigurdsson' title: | SDSS J092712.65+294344.0: Recoiling Black Hole or\ A Sub-parsec Binary Candidate? --- Introduction ============ The “mass loss” and gravitational rocket effect in the aftermath of the coalescence of a supermassive black hole binary (SBHB) can have profound effects on the properties of the nucleus of the host galaxy and give rise to unique observational signatures [@rr89; @milos05; @loeb07; @sb08; @lippai08; @sk08; @kl08; @moh08; @devecchi08; @bl08; @gm08]. Since the emission of gravitational waves in the last stages of the merger is not symmetric in general, the product of the merger can receive a significant recoil velocity, up to a few $\times \,100~{\rm km\,s^{-1}}$ for low black hole spins or spin axes aligned with the orbital axis [@herrmann07a; @herrmann07b; @baker06; @baker07; @gonzalez07b; @koppitz07; @rezzolla08]. In the special case of maximally spinning, equal mass supermassive black holes (SBHs) with their spin vectors in the orbital plane and directed opposite to each other, the recoil speed can be up to $\sim$ 4000  ${\rm km\,s^{-1}}$ [@campanelli07b] . The fraction of coalescences expected to produce a remnant recoiling at $V>$ 1000 ${\rm km\,s^{-1}}$ is about $10\, \%$, assuming black hole spins of $cJ/GM^2 = 0.9$, mass ratio range of 0.1 $<$ q $<$ 1, and arbitrary spin orientations [@sb07; @campanelli07a; @baker08]. Since the escape speed from most galaxies is less than 2000 ${\rm km\,s^{-1}}$ [@merritt04], if high velocity recoils are common, there should be many “empty nest" galaxies, without a central SBH. This is in contrast with the observation that almost all galaxies with bulges have a central SBH [for summary see @ff05]. However, if following a galactic merger the two SBHs find themselves in a gas rich environment, gas accretion torques will act to align the spin axes with the orbital axis and thus, reduce the post-merger kick to a value well below the galactic escape speed. This effect is expected to increase the chance of retention of recoiling SBHs by their host galaxies [@bogdanovic07]. Gas-poor mergers, on the other hand can lead to large recoil speeds that launch the final black hole out of the potential well of the host bulge or host galaxy. @bonning07 searched the Sloan Digital Sky Survey (SDSS) archive for merger products with large velocity offsets from their host galaxy. Among nearly 2600 objects, they found no convincing evidence for recoiling SBHs in quasars, placing an upper limit of 0.2 $\%$ on the probability of kicks with projected speeds greater than 800 ${\rm km\,s^{-1}}$ and 0.04 $\%$ on the probability of kicks with projected speeds greater than 2500 ${\rm km\,s^{-1}}$. More recently, Komossa et al. (2008), hereafter @komossa08, reported the discovery of one such candidate, a SBH receding from its host galaxy at a high projected speed of 2650 ${\rm km\,s^{-1}}$. This detection has very important implications for the cosmological evolution of SBHs. However, it is also remarkable given the likelihood of high velocity kicks and a narrow observational window (in cosmological terms) associated with this class of objects [@bl08]. Combined with several observational curiosities, they call the recoil idea into question (see discussion in §3). Here we propose that the peculiar spectroscopic properties of SDSS J092712.65+294344.0 [@am07] can be explained in the context of a SBHB model. In §\[S\_model\] we describe the proposed model, in §\[S\_conclude\] we discuss its physical basis, revisit the recoiling black hole model, and close by considering observational tests. A Supermassive Binary Black Hole Model for SDSS J092712.65+294344.0 {#S_model} =================================================================== SDSS J092712.65+294344.0 (hereafter J0927) exhibits an unusual optical emission-line spectrum, which features two sets of lines offset by 2650 ${\rm km\,s^{-1}}$ relative to each other. The “redward” system consists of only narrow emission lines (r-NELs) with a full width at half maximum (FWHM) of about 170 ${\rm km\,s^{-1}}$ at a redshift of $z=0.713$; this was identified by @komossa08, as the redshift of the galaxy that hosted the recoiling SBH at its birth. The “blueward” emission-line system comprises broad Balmer lines (b-BELs) and narrow, high-ionization forbidden lines (b-NELs) at a redshift of $z=0.698$ [see Table 1 in @komossa08 for the list of lines]. In addition, the emission-line ratios of both the blueward and redward system are consistent with photoionization by a hard ionizing continuum typical of an active galactic nucleus (AGN). According to the recoiling SBH interpretation of @komossa08, the b-BELs originate in the broad-line region (BLR) retained by the SBH. Because of their lower FWHM in comparison to b-BELs, the b-NELs were attributed to gas that is only marginally bound to the SBH. The FWHM of the b-NELs was explained in the context of an accretion disk that is expanding in the process of outward transport of angular momentum, the associated outflows, and the swept up ISM. The r-NEL lines were attributed to the narrow-line region that remains bound to the host galaxy. The accreting SBH provides a source of ionizing radiation for the b-BELs and b-NELs, as well as for the r-NELs, albeit from a larger distance. We find that, in the time that it takes the disk to expand to the extent needed to explain the width of the b-NELs, the AGN has traveled tens of kiloparsecs away from the host galaxy and thus, is not likely to power the r-NELs. Combined with the narrow observational window and specific configuration of the pre-coalescence binary, this presents a challenge for the recoiling SBH model (see §\[S\_revisit\] for more detailed discussion). Note however that the outflow origin of the b-NELs cannot be excluded based on the available data. We make the alternative suggestion that the observed velocity shift represents the projected orbital velocity of a bound black hole pair. In this model, the emission lines of the blueward system (b-NELs and b-BELs) originate in gas associated with the less massive, secondary black hole, while the r-NELs originate in the ISM of the host galaxy (Figure \[fig\_sketch\]). The accreting secondary SBH is the main source of ionizing radiation while the primary SBH is either quiescent or much fainter than the secondary (see the discussion in §3). From the observed X-ray luminosity of J0927 [$L_{\rm X} = 5 \times 10^{44}\;{\rm erg\,s^{-1}}$; @komossa08] we infer the bolometric luminosity of the secondary[^1] and derive a lower limit on its mass of $M_2 \gtrsim 5\times 10^7 {\>{\rm M_{\odot}}}$, based on the Eddington limit. We interpret the observed velocity separation of the two emission line systems as the projected velocity of the secondary relative to the center of mass. Assuming a circular orbit, the projected velocity of the secondary, $u_2$, is related to its orbital velocity, $V_2$, via $u_2=V_2 \,\sin{i}\,\sin{\phi} = 2650\,{\rm km\,s^{-1}}$, where $i$ is the inclination of the orbital axis of the binary relative to the line of sight, and $\phi$ is the orbital phase at the time of the observation ($\phi=0$ corresponds to conjunction). We derive the following expressions for the binary separation and orbital period as $$a\approx 0.16 \; {M_{2,8}\over 1+q} \left({0.1\over q}\right)\left({\sin i \over \sin 45^\circ}\;{\sin \phi\over \sin 45^\circ}\right)^2\; {\rm pc}\; , \label{eq1}$$ $$P \approx 190 \; {M_{2,8}\over (1+q)^2} \left({0.1\over q}\right)\left({\sin i\over \sin 45^\circ}\;{\sin \phi\over \sin 45^\circ}\right)^3\;{\rm yr}\, . \label{eq2}$$ In the above expressions, $q \equiv M_2 / M_1 \leq 1$ is the binary mass ratio, and $M_{2,8}$ is the mass of the secondary SBH in units of $10^8~{\rm M}_\odot$. We refrain from using the AGN scaling relations based on the H$\beta$ line width and the continuum luminosity [@kaspi05] to estimate the size of the BLR. A scenario in which the size of the BLR is determined by the SBHB dynamics most likely does not represent a “typical” AGN and hence, these or similar relations may not hold. For example, the BLR around the secondary SBH can be truncated by the tidal forces from the primary. This would result in broader lines, compared to a typical AGN with a black hole of the same mass. If the measured FWHM of the \[\]$\;\lambda$5007 lines is used as an indicator of the stellar velocity dispersion [@nelson00], the $M-\sigma$ relation [@tremaine02 for example] implies a mass for the primary SBH that is $\sim 3$ orders of magnitude below what we adopt in our model. However, such a discrepancy is not unprecedented; there are specific examples of objects that exhibit comparably large discrepancies [@nw96]. Moreover, if J0927 is a product of a recent merger the velocity dispersion of the narrow line region gas may not be a good tracer of the stellar velocity dispersion. Discussion & Conclusions {#S_conclude} ======================== The Physical Picture {#S_picture} -------------------- The evolution of a binary orbit is determined by the relative efficiency of processes that can transport orbital angular momentum, such as stellar and gas dynamical processes and in later stages, the emission of gravitational radiation [@bbr]. In the binary model considered here stellar processes are expected to be inefficient and to operate on time scales comparable to the Hubble time [@berczik06; @sesana07; @perets07]. A scenario in which large amounts of cold gas are present within the sub-parsec binary orbit is not favored in the context of current understanding of these systems [@armitage02; @milos05; @mm06]. Feedback from the AGN and binary torques are expected to efficiently heat and disperse the gas. As a consequence, the gaseous dynamical friction does not affect the orbital evolution of the binary in this phase. The gas outside of the SBHB orbit, in the circumbinary disk, can exert torques on the binary and @cuadra08 find that only binaries with mass $\lesssim 10^{7} {\>{\rm M_{\odot}}}$ can coalesce within a Hubble time due to this effect [see also @hayasaki08], while more massive SBHBs, like the one assumed here, evolve on longer time scales. If stellar and gas dynamical mechanisms for angular momentum transport are inefficient, the evolution of the sub-parsec binary orbit will be determined by the emission of gravitational radiation and the assumption of the circular orbit is justified. Note however that if high, near-Eddington mass accretion rates onto the binary are plausible, interactions with the circumbinary disk may drive the evolution of the orbital separation and eccentricity on time scale $\sim {\rm few}\times t_{\rm visc}\approx 10^8\,{\rm yr}$, shorter than $t_{\rm gw}$ (where $t_{\rm visc}$ and $t_{\rm gw}$ are, respectively, the viscous time scale of the disk at the inner edge and the gravitational wave decay time). Realistically, $t_{\rm visc}$ will be longer because the structure of the disk and consequently, accretion rate will be affected by the presence of the binary. If so, the time scale given by $t_{\rm visc}$ can be considered a conservative lower limit on the life span of the binary and the assumption of circularity (or more precisely, moderate eccentricity) is still a plausible one. The time scale for orbital decay of the binary due to the emission of gravitational waves is $$t_{\rm gw} \approx 1.4\times10^{10}\;{M_{2,8}\over (1+q)^5} \left({0.1\over q}\right)^2 \left({\sin i\over \sin 45^\circ}\;{\sin \phi\over \sin 45^\circ}\right)^8\;{\rm yr}\, . \label{eq3}$$ Since $t_{\rm gw}$ is a sensitive function of $\sin i$ and $\sin \phi$, it may be shorter than the Hubble time if we are observing the binary at low inclination or close to conjunction, or alternatively if the binary orbit has eccentricity e $>$ 0.1. We thus assume that the binary described here is surrounded by a circumbinary disk, as illustrated in Figure \[fig\_sketch\]. As the binary orbit decays, the inner rim of the disk follows it inward until the time scale for orbital decay by gravitational radiation becomes shorter than the viscous time scale. In the model presented here, $t_{\rm gw} > t_{\rm visc}$, implying that the binary has not detached from the circumbinary disk and can still draw matter from it. Moreover, detailed calculations have shown that for small mass ratios (q $\lesssim {\rm 1/few}$) accretion occurs preferentially onto the lower mass object which, as a consequence, will be more luminous and easier to detect [@al96; @gould00]. For example, @hayasaki07 find a significant inversion of accretion rates, $\dot{M}_2/\dot{M}_1 = 3.25$ for a $q = 0.5$ binary. This effect is consistent with the picture proposed here that the single set of broad emission lines observed in J0927 is associated with the secondary SBH. On the other hand, a lower limit of $q > 0.01$ can be placed on the binary mass ratio, given our choice $M_2 = 10^8 {\>{\rm M_{\odot}}}$ and the expected upper limit to black hole masses, $M_{\rm max} \sim 10^{10} {\>{\rm M_{\odot}}}$ [@nt08]. In addition to simulations of SBHBs, the accretion flow between a circumbinary disk and the binary has been modeled in simulations of disks surrounding stellar, T Tauri binaries [@gunther02; @gunther04]. The dynamics of these two types of systems are, in fact, quite similar. In particular, a common result of the above simulations is that the accretion on individual binary members is mediated by one or more accretion streams, implying that these may arise as a general property of circumbinary accretion flows. The detailed structure and spectroscopic signatures of such flows are unknown, nevertheless, we propose the following simple picture for the system considered here. Because the gas in accretion streams flowing towards the secondary SBH has a nonzero angular momentum, it is expected to form a small accretion disk surrounding the secondary SBH prior to plunging into it. Given the uniform and monotonic orbital evolution of the binary, this may be a long lived and stable phenomenon, where the rate of accretion onto $M_2$ (i.e., the surface density of the disk surrounding the black hole) will be determined by the flow rate of matter in the gas streams. @mm06 find the flow rate in such a binary system to be of order of $10\%$ of the accretion rate onto a single black hole with a mass equal to that of the binary. Some of the gas in the flow is accreted by the black holes, while the rest develops eccentric orbits, may collide with the inner rim of the circumbinary disk and leave the binary system in form of the high velocity outflows [@armitage02; @mm06]. While the details of this process remain to be modeled, we suggest in the context of our proposed scenario that a negligibly small fraction of the gas will be accreted by the primary black hole, given the angular momentum “barrier” that the gas experiences. Consequently, an AGN associated with $M_1$ may either be faint or have short lived accretion phases. This implies that for the binary mass ratio of $q = 0.1$, the accretion rate onto the secondary is less than or equal to its Eddington limit ($\dot M_2\lesssim {\dot M_{\rm Edd,\,2}}$). Thus, the necessary conditions to establish a long term accretion process on $M_2$ exist, though the realistic physical picture may be more complex due to radiative feedback from the AGN. The accretion flow within the Roche lobe of the secondary would resemble the accretion flow onto a single supermassive black hole in an AGN, i.e., its optical spectroscopic signature will be that of an AGN, exhibiting a spectrum with a blue, featureless continuum and broad, permitted emission lines. This picture is consistent with the properties of the observed b-BELs — if the FWHM of these lines are interpreted to roughly represent the size of the emission region around the secondary, it follows that the size of this region is $\sim 0.1a$ (assuming $i = 45^\circ$). Using the @eggleton83 approximation we estimate the effective Roche lobe radius of the secondary to be $R_{L2} / a = 0.21$ for $q = 0.1$. Thus, the BLR is bound to the secondary SBH, consistent with the expectation that any gas beyond the Roche lobe of the secondary should be tidally truncated by the primary. Binaries with moderate eccentricities and mass ratios that are not extreme are expected to truncate their circumbinary disks at an inner radius of about twice the binary semi-major axis, and hence, the streams from the circumbinary disk to the secondary will flow over a region of size comparable to that of the binary orbit. The stream properties will be intermediate between the physical properties of the secondary’s BLR and the NLR of the host galaxy; @dotti08, for example, estimate an [*average*]{} density in such a circumbinary region in the range $2-8\times 10^6\,{\rm cm^{-3}}$. Of course the density of the gas streams themselves will be higher but they will likely be surrounded by lower-density envelopes resulting from expansion or ablation of the gas due to illumination and heating by the accreting black hole. The gas in the streams will be photoionized by the AGN continuum and the resulting emission-line spectrum may have the following properties: $(i)$ It will consist of permitted lines, as well as forbidden lines from the lower-density parts of the flow, such as the ionized skin of the streams. Due to proximity in velocity space, the lines from the stream should be shifted to approximately the velocity of the broad emission lines from the vicinity of the secondary. $(ii)$ The profiles of the lines from this stream will be narrower than the broad, permitted lines and asymmetric, since they trace the [ *emissivity weighted*]{} distribution of the spatially confined stream of gas[^2]. $(iii)$ The line shifts, and perhaps also the asymmetries will be variable over the orbital cycle of the binary. We propose that the b-NELs, with their variety of shifts and widths, originate in this part of the flow. Circumstantial evidence in support of the proposed picture is also provided by the relative intensities of the b-NEL and r-NEL lines. By comparing the relative line intensities reported by @komossa08 with the photoionization models of @nagao01 [@nagao02] we find that the observed \[\]/\[\] ratios suggest a higher density (by 1–2 orders of magnitude) in the b-NLR compared to the r-NLR. Moreover, the \[\]/H$\beta$ ratios suggest a higher ionization parameter in the former region by a factor of several, which is also reflected in the \[\]/\[\] ratio. These differences in density and ionization are consistent with our hypothesis that the r-NLR is associated with gas in the nucleus of the host galaxy while the b-NLR is associated with denser gas that is part of the accretion flow onto the secondary black hole. The above conclusions are subject to some uncertainty because the results of photoionization models are sensitive to a variety of input parameters, such as the spectral energy distribution of the ionizing continuum. The Recoiling Black Hole Scenario Revisited {#S_revisit} ------------------------------------------- Let us consider the characteristic time scales relevant for the recoiling SBH model with the parameters adopted by @komossa08. The time during which a recoiling SBH of mass $\sim 6 \times 10^8\,{\>{\rm M_{\odot}}}$ appears as an AGN can in principle be close to $10^9$ yr, if the mass of the accretion disk carried along by the SBH is comparable to its own mass [@loeb07]. This cannot be the case in J0927, if its SBH charges away from the host galaxy at nearly the maximum speed predicted by numerical relativity. To accommodate a high velocity kick, the mass of the disk should be small enough not to slow down the SBH, implying that $t_{\rm AGN} \ll 10^9$ yr. Indeed, @bl08 calculate that the mass of the gas disk carried by the recoiling SBH in J0927 is $\sim 2 \%$ of the SBH mass, which would be accreted in only $\sim 10^7$ yr, if the accretion rate is 0.1 of the Eddington limit. If the FWHM of the \[\] line is indicative of the expansion of the accretion disk due to outward transport of angular momentum, as suggested in the context of the recoiling SBH model, then the final disk radius is $\sim$7 times larger than that immediately after the recoil. This factor is based on a comparison of the FWHM of the \[\] line [reported by @komossa08] and the line of sight recoil velocity[^3]. A disk expansion should be accompanied by a drop in surface density and an accretion rate reduction by a factor of $> 7^2$ (assuming the same disk scale height before and after the expansion). Even if the initial luminosity of this system was close to the Eddington limit, it is now a factor of 100 lower, implying a minimum SBH mass of $\sim5\times10^9\,{\>{\rm M_{\odot}}}$, given the estimated bolometric luminosity. It also follows from conservation of angular momentum that in process of disk expansion a sizable portion of the disk mass will be accreted, $M_{\rm acc} \sim M_{\rm disk} / \sqrt{7}$. Given the SBH recoil velocity and the estimated accretion time scale of $\sim 10^7$ yr [@bl08], this implies that, by the time this fraction of disk mass is accreted, the receding AGN should be at least few tens of kiloparsecs away from the host galaxy. This poses a challenge for the recoiling SBH model given the requirement for the AGN to power the observed emission lines in both its own BLR and NLR and the NLR bound to the host galaxy. More specifically, the ionization parameter of the r-NLR should be considerably lower than what is observed (see our comparison with photoionization models in §\[S\_picture\]). We note that origin of the widths and shifts of the \[NeIII\] and other b-NELs in an outflow or the swept up ISM gas cannot be excluded. In such a scenario the geometry and velocity distribution of the line-emitting gas is likely to be very complex. A detection of an AGN recoiling at nearly the maximum speed predicted by numerical relativity requires a combination of coincidences: (a) its recoil velocity vector must lie close to our line of sight, (b) the parameters of the pre-coalescence binary should have been such as to give a recoil speed close to the maximum, and (c) we should be observing the object in a relatively narrow time window after the recoil. This would also imply a larger population of systems at lower recoil speeds, which were not found by @bonning07. Indeed, @dotti08 calculate that SBHBs with parameters similar to those considered here can be $\sim$100 times intrinsically more common than the recoiling SBHs. A related question, then, is why have there been no more discoveries of SBHBs in the SDSS. The observational biases in the case of subparsec SBHBs are not understood due to uncertainties in the structure and properties of their nuclear regions. The Doppler shift signature may not be observable in all subparsec binaries. The majority of them may either be quiescent or they may exhibit a different signature that we still do not recognize, thus, making the expected (a posteriori) discovery rate for this class of objects difficult to evaluate. Possible Observational Tests {#S_tests} ---------------------------- The observational property of J0927 that presents the biggest challenge to any model are its two sets of narrow emission-lines. It seems that by coincidence the \[\] $\lambda$4959 line at $z=0.713$ overlaps with the \[\] $\lambda$5007 line at $z=0.698$. Moreover, the low signal-to-noise ratio (S/N) at the blue end of the original SDSS spectrum makes the line profiles difficult to characterize. New optical spectra with a higher S/N and spectral resolution are needed to characterize the line profiles and make better measurements of some line strengths (especially \[\]). Complementary near-IR spectra in the J-band could show the profile of the H$\alpha$ line and additional narrow, forbidden lines of important diagnostic value. Spectroscopic monitoring on time scales of years to decades could provide the most direct test of the binary hypothesis. According to the SBHB model, the emission lines associated with the BLR of the secondary SBH (b-BELs) will shift at a rate of $${du_2\over dt} \approx 88\; {(1+q)^2\over M_{2,8}} \left({q\over 0.1}\right) \left({\sin i\over \sin 45^\circ}\right)^{-3} \hbox to 4 em{\hss}$$ $$\hbox to 4 em{\hss} \times \left({\sin \phi\over \sin 45^\circ}\right)^{-4} \left({\cos \phi\over \cos 45^ \circ}\right)\;{\rm km~s^{-1}~yr^{-1}}\, . \label{eq_shift}$$ Thus, at $\phi=45^{\circ}$ the b-NELs would shift by $\sim 100~{\rm km~s}^{-1}$ in about a year[^4]. Spectroscopic and imaging observations at high angular resolution with the [*Hubble Space Telescope*]{} the ([*HST*]{}) are necessary in order to measure the redshift of the host galaxy, determine whether its morphology shows signs of a recent merger, and provide a check against the possibility of projection of two otherwise unrelated AGNs along the line of sight. Also, in case of the recoiling SBH, [*HST*]{} may resolve an off center AGN, depending on the orientation of the recoil velocity vector with respect to the line of sight. In the case of a binary scenario, if the two black holes (or at least the secondary) are radio emitters, their orbital motion may be detected with the $VLBA$. At the redshift of J0927, the orbital separation of the binary with parameters scaled as in eq (\[eq1\]), translates to an angular separation on the sky of about $\sim 20\,\mu{\rm as}$. This is comparable to the astrometric precision achieved with the VLBA and for a higher mass binary may approach the expected spatial resolution of the [*Square Kilometre Array*]{}. The confirmation of either model would be a major step towards our understanding of subparsec binaries or recoiling SBHs. A binary holds great promise for revealing the physics of gas in the nuclear region and the accretion signatures in the pre-coalescence phase of its evolution. Discovery of a recoiling SBH, on the other hand, has important implications for understanding the demographics of SBHs and their cosmological spin evolution. Both scenarios have direct ramifications for the rate of SBHB coalescences and the exploration of the binary parameter space, of large importance for gravitational wave observatories such as the [*Laser Interferometer Space Antenna*]{}. We thank Cole Miller for useful discussions, and Chris Reynolds and Sean O’Neill for helpful comments. TB thanks the UMCP-Astronomy Center for Theory and Computation Prize Fellowship program for support. [99]{} Adelman-McCarthy, J. K., et al. 2007, , 172, 634 Armitage, P. J., & Natarajan, P. 2002, , 567, L9 Artymowicz, P., & Lubow, S. H. 1996, , 467, L77 Baker, J. G., Boggs, W. D., Centrella, J., Kelly, B. J., McWilliams, S. T., Miller, M. C., & van Meter, J. R. 2008, , 682, L29 Baker, J. G., Boggs, W. D., Centrella, J., Kelly, B. J., McWilliams, S. T., Miller, M. C., & van Meter, J. R. 2007, , 668, 1140 Baker, J. G., Centrella, J., Choi, D.-I., Koppitz, M., van Meter, J. R., & Miller, M. C. 2006, , 653, L93 Begelman, M. C., Blandford, R. D., & Rees, M. J. 1980, , 287, 307 Berczik, P., Merritt, D., Spurzem, R. & Bischof, H.-P., 2006, , 642, 21 Blecha, L., & Loeb, A. 2008, , 390, 1311 Bogdanovi[ć]{}, T., Reynolds, C. S., & Miller, M. C. 2007, , 661, L147 Bonning, E. W., Shields, G. A., & Salviander, S. 2007, , 666, L13 Campanelli, M., Lousto, C., Zlochower, Y., & Merritt, D. 2007a, , 659, L5 Campanelli, M., Lousto, C., Zlochower, Y., & Merritt, D. 2007b, Physical Review Letters, 98, 231102 Colpi, M., Dotti, M., Mayer, L., & Kazantzidis, S. 2007, in “2007 STScI Spring Symposium: Black Holes”, eds. M. Livio & A. M. Koekemoer, Cambridge University Press (arXiv:0710.5207) Cuadra, J., Armitage, P. J., Alexander, R. D., & Begelman, M. C. 2008 (arXiv:0809.0311) Devecchi, B., Rasia, E., Dotti, M., Volonteri, M., & Colpi, M. 2008 (arXiv:0805.2609) Dotti, M., Montuori, C., Decarli, R., Volonteri, M., Colpi, M., & Haardt, F. 2008 (arXiv:0809.3446) Eggleton, P. P. 1983, , 268, 368 Elvis, M., Wilkes, B. J., McDowell, J. C., Green, R. F., Bechtold, J., Willner, S. P., Oey, M. S., Polomski, E., & Cutri, R. 1994, , 95, 1 Ferrarese, L., & Ford, H. 2005, Space Science Reviews, 116, 523 Gonz[á]{}lez, J. A., Sperhake, U., Br[ü]{}gmann, B., Hannam, M., & Husa, S. 2007, Physical Review Letters, 98, 091101 Gould, A., & Rix, H.2000, , 532, L29 Gualandris, A., & Merritt, D. 2008, , 678, 780 G[ü]{}nther, R., & Kley, W. 2002, , 387, 550 G[ü]{}nther, R., Sch[ä]{}fer, C., & Kley, W. 2004, , 423, 559 Hayasaki, K. 2008 (arXiv:0805.3408) Hayasaki, K., Mineshige, S., & Sudou, H. 2007, , 59, 427 Herrmann, F., Hinder, I., Shoemaker, D., & Laguna, P. 2007a, Classical and Quantum Gravity, 24, 33 Herrmann, F., Hinder, I., Shoemaker, D., Laguna, P., & Matzner, R. A. 2007b, , 661, 430 Kaspi, S., Maoz, D., Netzer, H., Peterson, B. M., Vestergaard, M., & Jannuzi, B. T. 2005, , 629, 61 Kocsis, B., & Loeb, A. 2008, Physical Review Letters, 101, 041101 Komossa, S., Zhou, H., & Lu, H. 2008, , 678, L81 (KZL08) Koppitz, M., Pollney, D., Reisswig, C., Rezzolla, L., Thornburg, J., Diener, P., & Schnetter, E. 2007, Physical Review Letters, 99, 041102 Lippai, Z., Frei, Z., & Haiman, Z. 2008, , 676, L5 Loeb, A. 2007, Physical Review Letters, 99, 041103 MacFadyen, A. I., & Milosavljevi[ć]{}, M. 2008, , 672, 83 Merritt, D., Milosavljevi[ć]{}, M., Favata, M., Hughes, S. A., & Holz, D. E. 2004, , 607, L9 Milosavljević, M., & Phinney, E.S., 2005, , 622, 93 Mohayaee, R., Colin, J., & Silk, J. 2008, , 674, L21 Nagao, T., Murayama, T., Shioya, Y., & Taniguchi, Y. 2002, , 567, 73 Nagao, T., Murayama, T., & Taniguchi, Y. 2001, , 546, 744 Natarajan, P., & Treister, E. 2008 (arXiv:0808.2813) Nelson, C. H. 2000, , 544, L9 Nelson, C. H., & Whittle, M. 1996, , 465, 96 Perets, H. B., Hopman, C., & Alexander, T. 2007, , 656, 709 Redmount, I. H., & Rees, M. J. 1989, Comments on Astrophysics, 14, 165 Rezzolla, L., Dorband, E. N., Reisswig, C., Diener, P., Pollney, D., Schnetter, E., & Szil[á]{}gyi, B. 2008, , 679, 1422 Schnittman, J. D., & Buonanno, A. 2007, , 662, L63 Schnittman, J. D., & Krolik, J. H. 2008, , 684, 835 Sesana, A., Haardt, F., & Madau, P. 2007, , 660, 546 Shields, G. A., & Bonning, E. W. 2008, , 682, 758 Tremaine, S., et al. 2002, , 574, 740 [^1]: Using the average quasar spectral energy distributions of @elvis94, we find that that the bolometric luminosity is related to the X-ray luminosity via $L_{\rm bol}\approx 14\; L_{\rm X}$. Here, the X-ray luminosity is measured in the 0.1–2.4 keV band observable by [*ROSAT*]{}. [^2]: The asymmetry may arise since in general case the stream geometry and velocity will not be symmetric with respect to the observer. While the exact profile shapes of these lines will depend on the photoionization effects (not considered here), these are not expected to give rise to symmetric line profiles, in general. [^3]: Assuming that the recoil velocity and the FWHM of the \[\] line indicate the truncation radius of the disk before and after the expansion. Larger factors are expected if the radius of marginal self-gravity is considered instead to obtain the former value. [^4]: However, note that there is a range of non-extreme parameter values for which the normalization factor in equation \[eq\_shift\] takes a lower value and consequently, the monitoring period may need to be longer.
<?php /** * Copyright © OXID eSales AG. All rights reserved. * See LICENSE file for license details. */ namespace OxidEsales\EshopCommunity\Tests\Integration\Application\Model; use OxidEsales\Eshop\Application\Model\Article; use OxidEsales\Eshop\Application\Model\Rating; use OxidEsales\Eshop\Core\Field; use OxidEsales\TestingLibrary\UnitTestCase; class RatingTest extends UnitTestCase { public function testUpdateProductRatingOnRatingDelete() { $this->createTestProduct(); $this->createTestRatings(); $rating = oxNew(Rating::class); $rating->load('id3'); $rating->delete(); $product = oxNew(Article::class); $product->load('testId'); $this->assertEquals( 2, $product->oxarticles__oxratingcnt->value ); $this->assertEquals( 1.5, $product->oxarticles__oxrating->value ); } public function testUpdateProductRatingOnRatingDeleteWhenAllRatingsForProductAreDeleted() { $this->createTestProduct(); $this->createTestRatings(); $rating = oxNew(Rating::class); $rating->load('id1'); $rating->delete(); $rating->load('id2'); $rating->delete(); $rating->load('id3'); $rating->delete(); $product = oxNew(Article::class); $product->load('testId'); $this->assertEquals( 0, $product->oxarticles__oxratingcnt->value ); $this->assertEquals( 0, $product->oxarticles__oxrating->value ); } private function createTestProduct() { $product = oxNew(Article::class); $product->setId('testId'); $product->oxarticles__oxrating = new Field(2); $product->oxarticles__oxratingcnt = new Field(3); $product->save(); } private function createTestRatings() { $rating = oxNew(Rating::class); $rating->setId('id1'); $rating->oxratings__oxobjectid = new Field('testId'); $rating->oxratings__oxtype = new Field('oxarticle'); $rating->oxratings__oxrating = new Field(1); $rating->save(); $rating = oxNew(Rating::class); $rating->setId('id2'); $rating->oxratings__oxobjectid = new Field('testId'); $rating->oxratings__oxtype = new Field('oxarticle'); $rating->oxratings__oxrating = new Field(2); $rating->save(); $rating = oxNew(Rating::class); $rating->setId('id3'); $rating->oxratings__oxobjectid = new Field('testId'); $rating->oxratings__oxtype = new Field('oxarticle'); $rating->oxratings__oxrating = new Field(3); $rating->save(); } }
Woyak Life Expectancy What is the average Woyak lifespan? An unusually short lifespan might indicate that your Woyak ancestors lived in harsh conditions. A short lifespan might also indicate health problems that were once prevalent in your family. The SSDI is a searchable database of more than 70 million names. You can find birthdates, death dates, addresses and more. SHOW MORE United States Between 1956 and 2004, Woyak life expectancy was at its lowest point in 1962, and highest in 2004. The average life expectancy for Woyak in 1956 was 65, and 89 in 2004.
Introduction ============ Adolescence and young adulthood are crucial phases with regard to social, professional, physical and psychological development. Having cancer seriously disrupts this development and can have a negative impact on issues regarding control over life, body image, finances, education, work plans, relationships, and plans for having children.[@b1-ppa-12-2615] The Dutch definition of AYA (diagnosed with cancer between 18 and 35 years) is based on the organization of the health care system in the Netherlands, in which pediatric oncology, for patients between 0 and 18 years at diagnosis, is centralized and adult oncology is only centralized for rare or complex cancer types. AYA cancer patients cannot profit from integrated care provided by pediatric oncology centers. AYA cancer patients frequently (40%--50%) report unmet (supportive) needs including contact with peers, access to age-appropriate information, treatment facilities, emotional support services, and fertility services,[@b2-ppa-12-2615]--[@b4-ppa-12-2615] thus underlining the fact that supportive care for this age group is not optimal to address all age-specific needs.[@b5-ppa-12-2615] In response, in the Netherlands and other European countries, initiatives to improve AYA cancer care have started recently.[@b6-ppa-12-2615],[@b7-ppa-12-2615] E-Health interventions are increasingly being used in cancer care -- for example, to support patients in managing problems in daily life and gaining knowledge.[@b8-ppa-12-2615] E-Health can be defined as "information and communication technology, especially the Internet, to improve or enable health and health care".[@b9-ppa-12-2615] According to the behavior change model of Ritterband, internet interventions can lead to symptom improvement through a combination of personal and environmental factors on the one hand (eg, knowledge, motivation, and beliefs) and specific website characteristics on the other hand (eg, appearance, content, and delivery).[@b10-ppa-12-2615] The Internet can be used by patients to find (medical) information and share stories on weblogs, forums, and online social networks (Facebook, Twitter) and online communities.[@b11-ppa-12-2615] Online communities are platforms where individuals meet and exchange experience and information.[@b12-ppa-12-2615] Previous studies showed that participating in an online community can have an empowering and therapeutic effect: patients find informational and emotional support,[@b13-ppa-12-2615],[@b14-ppa-12-2615] recognition,[@b12-ppa-12-2615],[@b15-ppa-12-2615] emotional expression, and insight.[@b16-ppa-12-2615] As a technical- and electronics-savvy generation, AYAs are primed to benefit from supportive care delivered through e-Health, alongside usual care.[@b17-ppa-12-2615],[@b18-ppa-12-2615] Currently there are six AYA communities/websites with different features to exchange informational, emotional, and social support as described in [Table 1](#t1-ppa-12-2615){ref-type="table"}. However, none of them provides a secure environment. Because AYAs with cancer express age-specific peer support as an important unmet need and given that exchange of information can be rather privacy-sensitive, a secure, closed online community could be an asset in addressing this need.[@b18-ppa-12-2615]--[@b20-ppa-12-2615] In 2010, an online community named AYA4 (All Information You've Asked for) was developed by and for Dutch AYA cancer patients treated at the Radboud University Medical Center (Radboudumc). This online community became available for all AYA cancer patients in the Netherlands in 2014. The aim of this article is to describe how the Dutch online AYA community is currently being used and to evaluate in particular 1) user statistics, 2) usefulness, and 3) content analysis addressing the psychological processes expressed in the messages on the forum. Methods ======= Development of an online AYA community -------------------------------------- The online community for AYA cancer patients was developed in close collaboration between the department of medical oncology, REshape & Innovation Center, and AYA cancer patients of the Radboudumc. The community works as follows. At first access, a community manager verifies age- and disease-specific information in the treating hospital. A disclaimer explains details of the community: for example, that members have to sign a digital will to define what has to be done with their community content after one's death. The content of the community is only accessible for AYA patients with login details. The only person who has access and is able to communicate with all users is the community manager, a non-health care professional, trained in communication, who is online for approximately 4 hours daily (with a stand-in, in case of absence). When patients log in for the first time, they are welcomed by the community manager and they are notified that she can facilitate forum discussions. She will not share personal information of AYA community members with health care professionals, unless the AYA patients give explicit permission to do so. Procedure --------- The Ethics Committee of the Radboudumc judged that no detailed review was warranted, given the nonintrusive character of this study (\#2016--2872). Study 1: user statistics ------------------------ When signing up to the community, patients have to fill out the following information: first name, surname, gender, date of birth, telephone number, email address, treating hospital, patient identification number, treating physician, nurse specialist, type of cancer diagnosis, age at and date of cancer diagnosis, date of start treatment, and what to do with the account in case of death. Logging data (assessed April 11, 2017) about activity and duration of logging in were analyzed using Google Analytics, a web analytics service offered by Google that tracks and records website traffic. Login data of the community manager were excluded from this analysis. Study 2: evaluation ------------------- The evaluation study of the online AYA community was part of a larger as yet unpublished study aimed to gain insight into the supportive care needs of AYA cancer patients in the Netherlands. Patients aged between 18 and 35 years at the time of cancer diagnosis were invited to participate and were recruited via a website of patient advocates ([www.kanker.nl](http://www.kanker.nl) and [www.aya4net.nl](http://www.aya4net.nl)). Participants (n=66) were asked whether they were familiar with AYA care and if they were aware of the existence of the online AYA community; 59% (n=39) indicated they knew the community. Nine of them were not a member of the community and were asked for their reasons of not being a member. Those patients who indicated to they were a member of the community (n=30) were asked to answer questions about the usefulness of the community. Study 3: content analysis ------------------------- The content of the forum (discussions between AYA patients) contains privacy-sensitive personal information: names, diagnoses, and shared experiences. This type of information cannot be used for research purposes without the explicit consent of the authors -- in this case, the AYA patients.[@b21-ppa-12-2615] Therefore, we asked the members permission to use the content of their forum messages through an opt-in procedure: we published a message on the forum in the first half of April 2016 in which we explained the aim of our study and asked the users for their consent to used their data in anonymized form. The data of patients who gave informed consent were anonymized according to the recommendations of King.[@b22-ppa-12-2615] An independent research assistant went through all messages in our sample manually and replaced all mentions of person names (except for names of caregivers) by the string "\*\*\*\*". All anonymized messages by users who gave consent were brought together in a sample that we refer to as the anonymized sample. A commonly used and well-studied methodology for investigating the psychological processes through language use is the Linguistic Inquiry and Word Count (LIWC).[@b23-ppa-12-2615] The LIWC analyzes texts for indicators of psychological processes that are important for psychologically processing of difficult experiences.[@b24-ppa-12-2615],[@b25-ppa-12-2615] The developers of the LIWC defined a set of linguistic and psychological categories that can be recognized by words in the text. For each category, they defined a set of words that are indicators for that category. For example, the word *me* is an indicator of the linguistic category "first person singular", and the word *good* is an indicator of the psychological category "positive emotions". We used the Dutch version of the LIWC consisting of 66 categories.[@b26-ppa-12-2615] There are five types of categories: 1) standard linguistic dimensions (eg, personal pronouns, first-person singular, and past-tense verbs); 2) psychological processes (eg, positive emotions, anxiety, humans); 3) relativity (eg, time and space); 4) personal concerns (eg, work, money, religion); 5) experimental dimensions (eg, swearing). The categories are organized hierarchically. For example, the main category "cognitive processes" under "psychological processes" has several subcategories, among which "insight", "inclusive", and "exclusive". Due to this hierarchy, a word can belong to more than one category. For example, the word *ik* ("I") occurs in the category "pronoun" as well as the category "first-person singular". The LIWC has been used before to distil these psychological processes from the content of online support communities.[@b27-ppa-12-2615],[@b28-ppa-12-2615] In this study, we did not analyze the language use of individual authors on the forum, but instead, we quantified the presence of LIWC categories in the anonymized sample as a whole. We implemented the LIWC using the word lists published for the Dutch version of the LIWC.[@b26-ppa-12-2615] Our LIWC script takes as input the complete text of our anonymized sample, and a dictionary of LIWC categories with the indicator words per category. The script splits the text in words, then looks up each word in the LIWC dictionary, and adds a count for the corresponding LIWC category. For example, each occurrence of the word *me* in the forum leads to a count for the category "first-person singular" and each occurrence of the word *good* in the forum leads to a count for the category "positive emotions". The output of the script is a count of indicator words occurring for each LIWC category. We sorted the categories by their frequencies of occurrence in order to analyze which linguistic and psychological categories are the most frequent in the forum. Results are depicted as relative word counts per category, which is the sum of the numbers of occurrences of all the words in the category divided by the total number of words in the sample. Results ======= User statistics --------------- As of November 2017, the community has 433 registered members with a mean age at diagnosis of 25.7 years (SD 4.9) of which 71% is female. Of these members, 18% were diagnosed with breast cancer, 17% with lymphoma, 10% with sarcoma, 7% with leukemia, 7% with testicular cancer, and 41% with other cancer types. The mean time since diagnosis when subscribing to the online AYA community was 2.7 years (SD 4.4), with a median time of 1 year; members were from 52 of the 91 hospitals in the Netherlands. In 2016, the online AYA community was visited 35,327 times. A visit is defined as a single online activity of a person at a certain time point by means of an electronic device. On average, a visitor was online for 1 minute and 23 seconds and looked at 2.47 pages per visit. The most frequently visited part of the community is the introduction page where AYA cancer patients introduce themselves by giving background information about their diagnosis, treatment trajectory, and daily-life problems because of cancer. Evaluation ---------- Sixty-six patients answered AYA questionnaires and, of those, 39 (59%) responded to have been informed about the AYA community; 30 (77%) became members of the AYA community and used the community on a regular basis. The nine patients who did not become members indicated that they had no interest (three patients), thought it was not useful for them (one patient), indicated that the community was not available at the time they were diagnosed (two patients), or were too fearful to hear the stories of other patients (three patients). Of the 30 community members, 25 (83%) were female. Of this group, the mean age at diagnosis was 25.6 years (SD 6.4, range 18--35) and mean age of questionnaire completion was 29.8 years (SD 5.3, range 22--39). The most frequent cancer diagnoses were breast cancer (20%), lymphoma (17%), and brain tumor (10%). Nine (30%) members rated the community as slightly useful and 18 (60%) rated the community as highly useful; three (10%) patients had no opinion. Use of the community resulted in acknowledgment of their problems (56%) and the feeling of being supported as well as in having valuable contacts with peers (63%). Almost half of the users felt less lonely, and 78% experienced recognition in the cancer stories of other AYAs. In an open question, AYA patients indicated the strong willingness to do something for other patients as the main reason to be an active member of the community ([Table 2](#t2-ppa-12-2615){ref-type="table"}). Content analysis using the LIWC ------------------------------- Only 14 members of the online community provided consent for use of their messages in our content analysis. Together, these 14 members have posted 1,896 messages on 293 topics between February 2014 (the date the online AYA community became available as a national service) and June 2016. This is 44% (total messages, 4,332) of the total number of messages posted in this period, indicating that these 14 members are among the most active members of the forum. The mean number of messages posted by the included users is 135 (SD 103, range 5--386). We analyzed those 1,896 messages in our sample by using the LIWC categories. The total number of words in the sample is 108,881; the number of distinct words is 11,622. Of these, 1,981 occur in one or more LIWC categories. [Figure 1](#f1-ppa-12-2615){ref-type="fig"} shows the 20 most frequent LIWC categories in the sample, with their relative word counts. The most frequent LIWC category is "present tense". There are 13,888 occurrences of words from that category in our sample (eg, "is", "have", "be", "am"). This gives a relative word count of 0.128 (13,888/108,888) for the category "present tense". Discussion ========== This study reports the use, evaluation, and content analysis of the online community for Dutch AYA cancer patients. To our knowledge, this is one of the first secure, closed communities for AYA cancer patients in Europe. Our online community is only accessible for AYA patients and survivors, in contrast with the large US community where family, friends, and professionals also have access.[@b19-ppa-12-2615],[@b29-ppa-12-2615]--[@b32-ppa-12-2615] Similarly, the Australian community is also accessible for siblings and offspring of family members with cancer.[@b33-ppa-12-2615] In the United Kingdom and Aus-tralia, digital platforms focus on younger age groups (16--25 years[@b34-ppa-12-2615] and 12--24 years,[@b33-ppa-12-2615] respectively) in comparison to the USA online support forum which serves AYA cancer patients between 15 and 39 years. All online communities have this in common that members provide and receive informational, emotional, and/or social support to some extent. User statistics of AYA communities have never reported. The user statistics of our study showed that the most common tumor types were breast cancer and lymphoma and that members were most often women. This is in line with previous research where most members were female.[@b34-ppa-12-2615],[@b35-ppa-12-2615] It could be that men have less need for peer support and are, therefore, less likely to become a member, or prefer other kinds of peer support, such as face-to-face interactions or via sporting activities.[@b36-ppa-12-2615] The short mean duration of online community visits may indicate that members use the community not as an extensive chat service but more as a forum to gain knowledge, express emotions, and get recognition. However, it might be an indication of the fact that AYA patients became scared of all that was written or that they did not like the online community and thought it to be something else. Thus, the results of the current study are hypothesis generating, and further in-depth research into the reasons for the short online duration is recommended. More than half of the our study subjects rated the community as highly useful, especially with regard to the acknowledgment of feeling supported and the establishment of valuable contacts with peers. This is in line with the results of the content analysis showing that members of the online AYA community indeed find emotional and cognitive expression as well as emotional support. Given the theory of Ritterband, it could be hypothesized that higher levels of emotional and cognitive expression and emotional support may lead to better symptom control because this theory stated that internet interventions can lead to symptom improvement through mechanisms such as social support, transfer of knowledge, and feelings of recognition.[@b10-ppa-12-2615] The interpretation of the LIWC categories displays that the first three categories in [Figure 1](#f1-ppa-12-2615){ref-type="fig"} are standard linguistic dimensions. Personal pronouns and especially references to self (I, me, and mine) are very common in discussion forum messages, indicating that the authors share narratives about themselves.[@b37-ppa-12-2615] The most interesting categories in [Figure 1](#f1-ppa-12-2615){ref-type="fig"} are cognitive, social, and affective processes. The category "cognitive processes" includes the subcategories "inclusive", "exclusive", "discrepancy", "insight", and "tentative". Examples of words that belong to the category "inclusive" are; also, with, and completely, whereas examples of words of the category "exclusive" are; without, outside, and except. The category discrepancy covers words such as should, hope, must, and want, indicating a reality that is different than expected or wished for. The category "insight" contains words such as; find, see, and know, indicating insightful disclosure -- a construct of empowerment that has been reported earlier for peer-directed patient support groups.[@b28-ppa-12-2615] The category "tentative" contains words such as; maybe, hope, and sometimes, indicating uncertainty. The category "social processes" covers words that describe interactions such as ask, people, and welcome. The category "affective processes" includes feelings and responses. In the online AYA community sample, positive emotions are the most prominent, with words such as; good, success, nice, happy, and better. The high frequency of words indicating cognitive, social, and affective processes may indicate that members of the online community find emotional support, emotional expression, and insight on the discussion forum. In 2012, Love et al reported on the content analysis of messages in an open online AYA cancer support forum in the USA. They found that AYAs exchange emotional and informational support, cope with difficult emotions, use particular language to describe experiences, enact identity, and communicate membership on the online cancer support forum.[@b19-ppa-12-2615] Although we used another method to explore content, our results are largely in line with those of Love et al. In our study, we found that the majority of online discussions encompassed emotional support and emotional expression. Moreover, our results show that the community members gained more insight, expressed by words related to thinking, knowing, and considering. A difference between both studies, is that our content analysis was based on larger amount of messages than in the study of Love et al. The main limitation of our study was the low participation rate of AYA community members that may limit the generalizability of our results. This may be explained by several factors. First, although in the Netherlands, every year, approximately 2,700 patients between age 18 and 35 are diagnosed with cancer, the AYA community currently has only 433 members. This might be attributable to the fact that patients and/or health care professionals are not familiar with AYA care and that the online AYA community only recently became available at the national level. Second, only a small part of the community members is active in discussions. This is in line with previous literature showing that only 10% of community members are active posters, the remaining 90% can be classified as "lurkers".[@b38-ppa-12-2615] Third, as the online AYA community was developed 8 years ago and patients grow older, some early members may now have less need for peer support. Fourth, interviews with AYA cancer patients also revealed that the online AYA community was used to establish a first contact with peers and, thereafter, other faster social media such as WhatsApp were used to intensify the contact. Fifth, we cannot rule out selection bias, as patients recruited in the evaluation and the content analysis study might be the ones that are highly in need of peer support ("superusers") due to multiple health problems or are the patients who act as patient advocates. The online AYA community is an example of an e-Health intervention that is highly valued by some users. E-Health has high confidentiality experience among cancer patients[@b39-ppa-12-2615] and has the potential to be cost-effective and to improve patient empowerment,[@b40-ppa-12-2615] psychological well-being,[@b39-ppa-12-2615],[@b41-ppa-12-2615] and health-related quality of life.[@b41-ppa-12-2615] Future studies should aim at in-depth knowledge about the use of the community in terms of not becoming a member of the community, reasons for stopping usage, reasons men visit the community less often, and whether additional elements should be added, in particular, to make it more attractive for men. Furthermore, it is worth exploring whether psychological interventions such as cognitive-behavioral therapy could be safely and effectively delivered online to AYA cancer patients.[@b42-ppa-12-2615] We expect that the AYA community will expand in terms of members and reputation in the future, because it only recently expanded from the regional to the national level. Conclusion ========== The Dutch online AYA community facilitates peer support in a secure digital environment and, in particular, leads to AYAs with cancer expressing feelings, exchanging information, and coping better with cancer. Health care professionals should play an active role in drawing attention to the existence and the possible benefits of the online AYA community. The authors would like to thank Robin Hooijer for his help with analyzing the Google Analytics data. The start of the Dutch online AYA community was supported by a grant from Alpe d'Huzes (grant no 2011--5346). **Disclosure** The authors report no conflicts of interest in this work. ![The 20 most frequent LIWC categories in the online AYA community sample, with their relative word counts.\ **Abbreviations:** AYA, adolescent and young adult; LIWC, Linguistic Inquiry and word count.](ppa-12-2615Fig1){#f1-ppa-12-2615} ###### Existing online communities/digital support services for AYA/TYA cancer patients worldwide ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Author, year, country Type of community/online support group Sample (N) Age range (years) Goal study Means Main results/conclusion --------------------------------------------------------- ------------------------------------------------------------------- ----------------------------------------------------------------------------- ------------------------------------------ ------------------------------------------------------------------------------------------------------------------- --------------------------------------------------------------------- --------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Love et al (2012)[@b19-ppa-12-2615]\ Online AYA cancer community, anonymous 6,000 plus users (+ small proportion of family, friends, and professionals) 15--39 • Content analysis of 350 randomly sampled messages\ • Data analysis of "speech events"\ • Exchange support, coping with emotions, describe experiences, enact identity and communicate membership\ Crook and Love (2017)[@b29-ppa-12-2615]\ • Examine challenges of online support\ • Qualitative coding of transcripts of messages\ • Challenges regarding soliciting support, disclosing to a community, advocacy online, negative sentiment evaluating health care services and asynchronous communication\ Thompson et al (2015)[@b30-ppa-12-2615]\ • Difference in language between online and offline support groups\ • Linguistic Inquiry and word count of transcripts\ • Differences between online and face-to-face support groups in terms of content and style words\ Donovan et al (2014)[@b32-ppa-12-2615]\ • Gain insight into the patterns of social support in response to AYAs' expressions of uncertainty\ • Analysis of 510 responses to posts\ • 67% of posts contains multiple types of support\ Pounders et al (2017)[@b31-ppa-12-2615] TX, USA • Better understand gender and identity issues among female AYAs • Analyzing individual message blog posts with text-mining software • Female AYA experience issues pertaining to infertility, feeling like a bad mom, hair loss, scarring, dating, and intimacy Fasciano et al (2015)[@b35-ppa-12-2615] Boston, MA, USA Website with social networking capacity N=30 YAs completed online survey (of the 188 who registered) 18--39 Development and content of YA-website Survey among users about use, satisfaction, emotional well-being Website is helpful, particularly in social networking function. YAs experienced increased connection with others. Some YAs experienced increased distress Gaulin (2010)[@b23-ppa-12-2615] USA "Group Loop" American online community NM Adolescents Assess impact of discussion boards and online support groups as a self-help tool for supporting the coping skills Analysis of messages • Exchange peer support and information about treatment\ • Facilitators helped them to cope Elwell et al (2011)[@b43-ppa-12-2615] USA Computer-mediated support group (no subscription or registration) NM Adolescents Explore types of social support using a qualitative approach Thematic analysis of 393 messages • Exchange informational, emotional, and social support\ • Useful with and without facilitator Griffiths et al (2015)[@b34-ppa-12-2615] UK Realshare online support community 12 16--30 Describe development and evaluation Realshare online community Focus groups • Helpful in communication and exchanging support with other patients and to arrange face-to-face meetings\ • A facilitator can be beneficial to encourage user interaction Patterson et al (2014)[@b33-ppa-12-2615] Australia Canteen online and phone mental health support service NA 12--25 (young people living with cancer) NA NA • Find information, connect with others, express feelings, utilize tools for support, access to professional psychosocial support\ • Service available for patients and offspring and siblings of family members with cancer ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- **Abbreviations:** AYA, adolescent and young adult; NA, not applicable; NM, not mentioned; YA, young adult. ###### Answers to the evaluation questionnaire about the usefulness of the online AYA community among 30 members --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Answers given about usefulness about the community AYA community members, n (%) ---------------------------------------------------- ---------------------------------------------------------------------------------------------------------------------------------- I feel listened to 9 (33%) I get recognition/acknowledgment 15 (56%) I find recognition in the stories of peers 21 (78%) I do not feel lonely any more 13 (48%) I have good contact with peers 17 (63%) My questions are being answered 9 (33%) I feel more self-confident 7 (26%) I get advice about coping with problems 12 (44%) I make new friends 12 (44%) I feel reassured 4 (15%) I feel safe 7 (26%) I feel supported 17 (63%) Other • It gives me the opportunity to share knowledge andto help others. It appears valuable to do something in a hopeless situation\ • I can support others\ • It is good to notice thatI am not the only person with problems --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- **Abbreviation:** AYA, adolescent and young adult.
Xerostomia: current streams of investigation. Xerostomia is the subjective feeling of dry mouth, and it is often related to salivary hypofunction. Besides medication-related salivary hypofunction, Sjögren syndrome and head-and-neck radiation are two common etiologies that have garnered considerable attention. Approaches to treating and/or preventing salivary hypofunction in patients with these conditions will likely incorporate gene therapy, stem cell therapy, and tissue engineering. Advances in these disciplines are central to current research in the cure for xerostomia and will be key to eventual treatment.
1. Introduction {#sec1} =============== Three-dimensional (3D) printing is a computer-aided additive manufacturing method that has gained growing attention due to its capability to fabricate high-shape-complexity products without molds.^[@ref1]^ Several techniques, such as fused deposition modeling (FDM), direct ink writing, powder bed fusion, binder jetting, vat photopolymerization, sheet lamination, and stereolithography, have been applied in the 3D printing process. Among these techniques, the stereolithography apparatus (SLA) uses UV light to solidify and cure a liquid ink through photopolymerization that allows for superior accuracy control and high resolution (up to 10 μm/layer) during the layer-by-layer printing process.^[@ref2]^ However, the requirement of photoreactive resin in stereolithography narrows the selection of the starting material^[@ref2]^ and, in turn, limits the applications of the resultant products. To overcome this shortcoming and obtain SLA products with various functions, researchers have developed various types of modified photoreactive resins.^[@ref3]−[@ref8]^ One of the methods is blending fillers with resins. For example, carbon materials, such as graphene oxide and carbon nanotubes, renowned for their high-performance mechanical properties, were added as enhanced fillers in the resin system to improve the mechanical performance of the printed materials.^[@ref4],[@ref9],[@ref10]^ Apart from carbon materials, other inorganic particles (nanoclay, aluminum oxide nanowires, sepiolite nanofibers, TiO~2~, and SiO~2~) have also been incorporated into the stereolithography process.^[@ref11]−[@ref13]^ These reports suggest that the incorporation of fillers in photoreactive resins is a promising means to improve the mechanical properties of the SLA-printed products. Of the many additives available, lignin shows significant research interest, particularly in the advent of bioeconomy.^[@ref14]^ With the addition of lignin as a filler, a variety of studies have shown that the resulting polymeric composites exhibit improved physical properties including antiaging,^[@ref15]^ flame retardant,^[@ref16]^ and UV absorption.^[@ref17]^ 3D-printed lignin-based materials have been investigated for the application as drug-delivery materials^[@ref18],[@ref19]^ and bio-based plastics and composites for scaffold in the medical engineering area.^[@ref19]^ From the perspective of improving the mechanical properties of composites, lignin can be employed as a stiff filler,^[@ref10],[@ref13]^ in much the same manner as it performs in vascular plants contributing to cell wall rigidity and durability. Therefore, several researchers had applied lignin in the field of 3D printing for biomaterials and composites, and studied on the reinforcement of lignin on the printed materials. Using an FDM 3D printing technique, Nguyen et al.^[@ref20]^ have shown that the incorporation of hardwood lignin (40 wt %) into nylon 12 increased Young's modulus of printed samples from ∼1.77 to ∼3.01 GPa and maintained the tensile strength at ∼55 MPa. The authors attributed the enhancement to the rigid phenolic units in lignin. This type of reinforcement in modulus may also be ascribed to the potential hydrogen bonds between lignin and nylon according to the report by Sallem-Idrissi et al.^[@ref21]^ Gkartzou et al.^[@ref22]^ reported the reinforcement of pine kraft lignin in FDM-printed sample of polylactide/lignin composite at various lignin concentrations. The Young's modulus of composites increased from ∼2.31 GPa (0 wt % lignin) to ∼2.33 GPa (5 wt % lignin), 2.41 GPa (10 wt % lignin), and ∼2.39 GPa (15 wt % lignin), while the tensile strength decreased with more lignin being added. Mimini et al.^[@ref23]^ compared the influence of kraft lignin, organosolv lignin, and lignosulfonate on the flexural and impact strengths of FDM-printed composite with PLA. The results showed a slight reduction on both flexural and impact strengths with blending 5, 10, and 15 wt % of the three species of additive. In terms of stereolithography 3D printing, Feng et al. printed composites with methacrylate/lignin-coated cellulose resin. They found that 0.5 wt % or less lignin-coated cellulose nanocrystals in the printed composite slightly improved the tensile strength and modulus of the postcured samples. However, the tensile performance dropped down when more filler (max to 1.0 wt %) was blended.^[@ref24]^ Another report by Sutton et al. proposed a method to modify lignin into photoreactive fillers (i.e., methacrylic anhydride-modified lignin), which could be photopolymerized with a methacrylate resin in the printing process.^[@ref25]^ The reported mechanical tests indicated that the elastic modulus decreased from 0.65 to 0.37 GPa, while the elongation increased from 1.87 to 7.62% with the addition of 15 wt % modified lignin of the printed composites. All of the abovementioned reports had clearly highlighted that on the one hand, lignin plays a crucial role as a sustainable filler in impacting the performance of 3D-printed products. On the other hand, the reinforcing effect of lignin seems complicated depending on the lignin source, content, polymer resin, and the printing techniques used. Moreover, to the best of our knowledge, limited studies^[@ref15]^ have been reported on the effect of incorporation of lignin into stereolithography 3D printing. In this study, a softwood kraft lignin is applied as a filler in stereolithography 3D printing to reinforce the mechanical properties of printed products. The methacrylate resin was selected for its commercial availability and widespread application in the 3D printing field. Printed samples with slurry blends of lignin and methacrylate resin were prepared, and it was determined that low charges of lignin (0.2--1.0 wt %) could significantly improve the mechanical performance (both Young's modulus and tensile strength) of the fabricated lignin-reinforced composite, which may extend the application of lignin-reinforced stereolithography products. The changes in the fracture morphology of the composites were suggestive of the mechanism of improved mechanical behavior of lignin composite in the 3D printing of these photoreactive resins. 2. Results and Discussion {#sec2} ========================= 2.1. Printability of the Mixed Resin {#sec2.1} ------------------------------------ The blended resin was used to print a "Tennessee" pattern to show the printability of the blended resin. [Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}a shows that the whole pattern was composed of printed parts with various lignin concentrations (i.e., 0.0, 0.2, 0.5, 0.8, 1.0 wt %). A higher concentration of lignin darkens the printed sample ([Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}a) and makes the printed sample softer ([Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}b,c). ![(a) Printed composite with various concentrations of lignin; (b, c) Stiffness estimation of the printed sample with various lignin concentrations by holding the same weight (b-0.2 wt %, c-1.0 wt %). The sample with higher lignin concentration has lower stiffness. All of the scale bars are 1 cm.](ao9b02455_0008){#fig1} 2.2. Determination of Lignin Concentration in the Printed Sample {#sec2.2} ---------------------------------------------------------------- To measure the lignin concentration in the 3D-printed composites, the concentrations of lignin in the printed samples were measured and calculated with the samples N-0.2%, N-0.4%, N-0.5%, N-0.8%, and N-1.0% using UV--vis spectroscopic analysis.^[@ref26]^ The measured results in [Table [1](#tbl1){ref-type="other"}](#tbl1){ref-type="other"} indicated that the lignin concentration in the printed samples is in accordance with the feed ratio, but the measured lignin concentrations were higher than that from the feed ratio. This may be attributed to the settling of lignin in the resin tank by gravity hence lignin was incorporated into the composites during the photopolymerization. ###### Comparison of Feed Ratio in the Printing Resin and Measured Lignin Concentration in Printed Composites   feed lignin concentration measured lignin concentration -------- --------------------------- ------------------------------- N-1.0% 1.0 wt % 1.49 ± 0.89 wt % N-0.8% 0.8 wt % 1.02 ± 0.08 wt % N-0.5% 0.5 wt % 0.83 ± 0.04 wt % N-0.4% 0.4 wt % 0.67 ± 0.12 wt % N-0.2% 0.2 wt % 0.29 ± 0.04 wt % 2.3. Gel Contents and Relative Residual Resin Contents in the Printed Samples {#sec2.3} ----------------------------------------------------------------------------- The printed samples consisted of gel fraction that cannot be dissolved (usually cross-linked network) and nongel fraction that can be extracted out using acetone. The gel contents from the printed samples decreased as more lignin was added into the composites ([Figure [2](#fig2){ref-type="fig"}](#fig2){ref-type="fig"}). There is ∼98 wt % gel in the printed sample without lignin, which implied that the printed sample by pure resin was highly cross-linked.^[@ref27]^ ![Gel contents of the printed samples with various lignin concentrations.](ao9b02455_0003){#fig2} With increasing lignin concentration in the composites, less gel was obtained in the printed composites, which indicated that the added lignin likely hindered the cross-linking of the methacrylate resin during the printing, in part, due to the UV absorption of the lignin.^[@ref17]^ This decreased degree of cross-link is consistent with the lower stiffness of the printed samples with higher lignin concentration ([Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}b). We then used differential scanning calorimeter (DSC) to investigate the thermal behaviors of printed samples with an attempt to characterize the polymerization status of the nongel part ([Figure [3](#fig3){ref-type="fig"}](#fig3){ref-type="fig"}). It has been reported that the unreacted resin in the printed sample will polymerize when the temperature increases, releasing heat in the processing.^[@ref28]^ As shown in [Table [2](#tbl2){ref-type="other"}](#tbl2){ref-type="other"}, all of the non-post-cured samples have exothermic enthalpy, suggesting the presence of unreacted resin in the printed samples. The increased concentration of lignin leads to higher exotherm enthalpy values, which implied that increased amounts of unreacted resin was present in the composites. To confirm this is related to the unreacted resin residual, we ran two postcured printed samples, P-0% and P-1.0%, as well. By contrast, the postcured printed samples have no exothermic behaviors ([Figure [3](#fig3){ref-type="fig"}](#fig3){ref-type="fig"}), which can be explained by the relatively low amount of residual resin after UV postcure. In addition, we found that the printed control sample owns an exothermic peak at a higher temperature (163.5 °C), while the other printed samples blended with lignin have exothermic peaks appearing at a lower temperature (137.2--140.4 °C). This phenomenon can be attributed to the low diffusion by the highly cross-linked structure in the control sample, making polymerization in highly cross-linked structures to require more energy (at a higher temperature). Adding lignin in the printed sample caused more residual resin and less-confined (cross-linked) structure, which requires lower energy (thus lower temperature to initiate^[@ref28]^) for curing the resin. ![DSC heating curves of several samples.](ao9b02455_0006){#fig3} ###### Exothermic Enthalpy and Peak Temperature Collected from the DSC Measurements sample name Δ*H* (J/g) peak temperature (°C) ------------- ------------ ----------------------- N-0% --14.88 163.5 N-0.2% --21.58 137.2 N-0.4% --52.76 133.2 N-0.5% --66.89 139.2 N-0.8% --92.64 137.0 N-1.0% --104.60 140.4 2.4. FTIR Analysis of the Non-Postcured Samples {#sec2.4} ----------------------------------------------- Fourier transform infrared spectroscopy (FTIR) analysis was performed for the non-postcured samples, as well as the starting softwood kraft lignin ([Figure [4](#fig4){ref-type="fig"}](#fig4){ref-type="fig"}). With regard to the softwood kraft lignin, the hydroxyl, carbonyl, and typical aromatic skeletal vibrations^[@ref29]^ of the kraft lignin were observed at 3362, 1678, and 1505 cm^--1^, respectively. The aromatic C--H in-plane deformation in the guaiacyl ring at 1134 cm^--1^ of the lignin can also be observed. In the printed samples, the C--H and CH~3~ on the backbone of the photoreacted polymer chain were observed at 2959 and 2863 cm^--1^, respectively. The peaks appearing at 3356 and 1700 cm^--1^ can be attributed to the −OH stretching and C=O stretching, respectively. The −OH stretching was attributed to the adsorption of water and −OH from lignin during the fabrication process, as previously reported.^[@ref3],[@ref25],[@ref28]^ Due to the low contents of lignin, all of the abovementioned peaks of the printed control sample did not show significant changes of intensities in the spectra compared with the composites incorporated with a different amount of lignin from 0.2 to 1.0 wt %. However, a subtle difference between the printed control sample and the composites was found with respect to the peaks located at 1638 and 1400--1100 cm^--1^. The minor peak at 1638 cm^--1^ ([Figure [4](#fig4){ref-type="fig"}](#fig4){ref-type="fig"}b) represents the stretching of C=C of the residual methacrylate that was not photopolymerized during the printing process,^[@ref28]^ which increased with the increasing amount of lignin added to the printing resin. This was attributed to the presence of lignin that could hinder the photopolymerization process, and the increasing lignin particles interfered with the UV light absorption in the system more significantly. The higher lignin incorporated accompanied by more unreacted residual resin in a printed sample leads to a lower stiffness ([Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}b,c). With respect to the spectra between 1400 and 1100 cm^--1^, the intensities of the multipeaks at 1350--1275 cm^--1^ ([Figure [4](#fig4){ref-type="fig"}](#fig4){ref-type="fig"}c) were assigned to the methacrylate ester and at the side chain of the polymer, which showed a gradual rise as lignin concentration increased. The peak intensity at 1200--1120 cm^--1^ corresponding to the aromatic C--H in-plane deformation of lignin increased with more lignin added ([Figure [4](#fig4){ref-type="fig"}](#fig4){ref-type="fig"}d).^[@ref25],[@ref28]^ These structural changes in printed samples indicated that the addition of lignin had interfered with the polymerization of methacrylate resin. ![FTIR spectra of printed samples with various concentrations of softwood kraft lignin ((a) 4000--600 cm^--1^, (b) 1660--1620 cm^--1^, (c) 1350--1275 cm^--1^, and (d) 1200--1100 cm^--1^).](ao9b02455_0004){#fig4} 2.5. Effects of Lignin on the Tensile Properties of Printed Samples {#sec2.5} ------------------------------------------------------------------- After the samples were printed, UV postcuring was performed to fully complete the polymerization in the resin, thereby enhancing their mechanical properties.^[@ref28]^ Based on the results ([Figure S1](http://pubs.acs.org/doi/suppl/10.1021/acsomega.9b02455/suppl_file/ao9b02455_si_001.pdf)), 4 h was chosen for the postcure. The effects of lignin on the tensile performance of printed samples were analyzed by varying the lignin loading concentration from 0.0 to 1.0 wt % in the resin system and were compared in [Figure [5](#fig5){ref-type="fig"}](#fig5){ref-type="fig"}. Comparing the non-postcured and postcured samples, all non-postcured samples exhibit lower tensile strength at the same tensile strain than that of the postcured with the same lignin concentration, and all non-postcured samples show gradually weaker tensile performance as more lignin was added. By contrast, all of the postcured lignin-added samples have a significantly increased ultimate tensile strength at break (45--50 MPa) than the control sample without lignin addition (30.7 MPa). This result indicated that the softwood kraft lignin showed a reinforcing effect to the methacrylate resin in the overall SLA 3D postcured printed samples. Also, the stress--strain curves of P-0% and the P-0.2% show typical yielding before the ultimate break, whereas the other samples with higher lignin addition do not show yielding. This result meant, on one hand, the addition of lignin increased the brittleness of the printed sample, and, on the other hand, there was a lignin concentration threshold beyond which the deformation behavior of the postcured printed sample has been changed. ![Stress--strain curves for non-postcured and postcured printed samples with various lignin concentrations.](ao9b02455_0001){#fig5} To further analyze the tensile test results, the tensile strengths and Young's modulus of postcured printed samples are compared in [Figure [6](#fig6){ref-type="fig"}](#fig6){ref-type="fig"} (the data for tensile strength and modulus are recorded in [Table [3](#tbl3){ref-type="other"}](#tbl3){ref-type="other"}). With respect to the tensile strength represented in [Figure [6](#fig6){ref-type="fig"}](#fig6){ref-type="fig"}a, the tensile strength value of the printed sample without lignin increased from 12.4 to 30.7 MPa after postcuring compared between N-0% and P-0%. This data suggested that the photopolymerization during printing was only partially completed and postcure was necessary to enhance the mechanical properties. Concerning the printed composites, the tensile strength showed a gradual decrease as more lignin was added for non-postcured composites. The tendency can be attributed to the hindering effect of the lignin on UV photopolymerization of the resin during printing, which was consistent with the finding in DSC that more residual methacrylate unreacted as more lignin was added. The weaker tensile strength also results in printed samples with more than 0.5 wt % lignin, which cannot be measured on the given load cell for the tensile stress was lower than the minimum stress value can be tested (5 MPa). It showed a similar trend on Young's modulus of the non-postcured samples ([Figure [6](#fig6){ref-type="fig"}](#fig6){ref-type="fig"}b). ![Tensile strength (a) and Young's modulus (b) of non-postcured and postcured printed samples.](ao9b02455_0005){#fig6} ###### Mechanical Data Collected from Tensile Tests tensile strength (MPa) Young's Modulus (GPa) ------------------------ ------------------------------------ -------- ------ ------ ------ -------- ------ ------ 0 27.1   30.3   1.86   1.74   0.2 8.5 --68.6 46.1 52.1 0.37 --80.1 2.20 26.4 0.4 7.0 --74.2 49.6 63.7 0.06 --96.8 2.25 29.3 0.5 4.0 --85.2 47.1 55.4 0.04 --97.8 2.19 25.9 0.8 \-[a](#t3fn1){ref-type="table-fn"} \- 47.6 57.1     2.39 37.4 1.0 \- \- 44.3 46.2     1.98 13.8 \- implied strength lower than the minimum stress value can be tested. On the other hand, for postcured printed samples, the tensile strength increased significantly to 46.1 and 49.6 MPa at the lignin incorporation levels of 0.2 and 0.4 wt %, respectively, which are 52 and 64% increment improvement from 30.7 MPa. The tensile strength leveled off by adding more lignin to 1.0 wt %. The incorporation of lignin has also resulted in a remarkable increase of Young's modulus of the printed/postcured samples ([Figure [6](#fig6){ref-type="fig"}](#fig6){ref-type="fig"}b). With the addition of 0.2 wt % lignin, Young's modulus increased by 26% from 1.74 to 2.20 GPa. Further increasing the lignin concentration to 0.8 wt % in the resin did not increase the modulus that remained in the range of 2.10--2.50 GPa. However, when 1.0 wt % lignin was added, the modulus steeply decreases to 1.98 GPa. The abovementioned results of the tensile strength and modulus indicated that the incorporation of a small amount of lignin to the methacrylate resin could significantly reinforce the mechanical strength of the postcured printed composites. 2.6. Morphological Analysis of the Fracture Feature of the Printed Samples {#sec2.6} -------------------------------------------------------------------------- To examine the enhancement mechanism of lignin on the printed samples, fractographic analysis of interfacial bonding has been performed using scanning electron microscopy (SEM). P-0.2% was selected to make a comparison with P-0% control as it has shown significant improvement of tensile strength with the lowest lignin concentration. The surface of P-0.2% ([Figure [7](#fig7){ref-type="fig"}](#fig7){ref-type="fig"}a) shows observable layer stack gaps every ∼100 μm, which is in accordance with the layer thickness (0.1 mm) in printing while layer gaps can only be recognized at some spots in the view as marked in [Figure [7](#fig7){ref-type="fig"}](#fig7){ref-type="fig"}b for P-0%. By comparing the sample surface of P-0.2% and P-0%, the surface of P-0.2% was much rougher than that of the control sample. These differences were likely due to the hindering effect of lignin on the UV photopolymerization printing process so that the resin was not fully polymerized. Concerning the fracture surface shown in [Figure [7](#fig7){ref-type="fig"}](#fig7){ref-type="fig"}c,d, the fracture surface of both P-0.2% and P-0% showed a typical "brittle" fraction. However, there is some difference between them mainly on crack formation. The control shows a much smoother surface with several long cracks ([Figure [7](#fig7){ref-type="fig"}](#fig7){ref-type="fig"}d), while there was some uneven area instead of conspicuous cracks on the failure surface of P-0.2% ([Figure [7](#fig7){ref-type="fig"}](#fig7){ref-type="fig"}c). These morphological difference of fracture surfaces can explain, in part, the increase of the tensile strength by the theory of rigid filler particles toughing.^[@ref30]^ ![SEM images of the surface (a, b) and cross section (fracture surface) (c, d) of P-0.2% (a, c) and P-0% (b, d).](ao9b02455_0002){#fig7} The micromechanism of rigid filler particles toughing includes three steps as stress concentration, debonding, and shear yielding. In this work, adding lignin can affect the stress concentration step during tensile tests. Without lignin addition, the methacrylate resin polymerized into a brittle polymer matrix after postcuring, which resulted in an internal integrity structure that is prone to failure at some weak points with stress loaded. The stress induced on the cross section of the test sample will be concentrated on a few weak points first and then break from there, leaving a smooth surface with a few individual cracks observed in [Figure [7](#fig7){ref-type="fig"}](#fig7){ref-type="fig"}d. By contrast, with rigid fillers (i.e., lignin microparticles in this study), the fillers increase the number of stress concentration spots. Then, the stress will be dissipated on more dispersed spots with a more distributed load that prevents the stress concentration microscopically. The well-dispersed lignin fillers at low concentration, therefore, enable the sample bearing higher tensile stress macroscopically. This is possibly the reason that the corresponding fracture surface of P-0.2% was uneven compared with that of the P-0% control. In addition, Manapat et al. found a similar fractographic morphology with printed graphene oxide composite that is related to crack deflection.^[@ref9]^ They concluded that the rough bonding and interactions in the printed sample lead to different stress distribution, which needs more energy for crack propagation, thereby bearing more stress in a tensile test. It seems that the incorporated lignin and graphene oxide played a similar role in dissipating stress load in the composites that are showing enhanced tensile properties. 3. Conclusions {#sec3} ============== In this paper, lignin-added methacrylate resin composite with enhanced tensile properties has been fabricated using 3D stereolithography apparatus. The lignin concentration in the composite determined by the UV--vis spectroscopic analysis revealed that the softwood kraft lignin in the range of 0.2--1.0 wt % had been successfully incorporated into methacrylate resin composite. Gel content measurement and DSC tests illustrated that the printed sample without lignin was highly cross-linked with low residual resin but increasing lignin concentration will hinder the cross-link, thus leading to higher residual resin in the printed sample. Postcuring has played a considerable influence in completing the photoreaction showing significantly enhanced mechanical properties compared with non-postcured analogs. The addition of lignin had the enhancement of tensile stress of the composite, and the fractographic analysis revealed a rough fracture surface in the lignin-added composite. The added filler at a certain amount is favorable for dissipating stress concentration that could be the primary reason for the enhanced mechanical performance of the lignin-included 3D-printed composites. 4. Materials and Methods {#sec4} ======================== 4.1. Materials and Chemicals {#sec4.1} ---------------------------- Softwood kraft lignin was acquired from an industrial source in the southeastern USA and was used after purification following a published methodology.^[@ref31]^ That is, shortly, the received dry kraft lignin was first suspended and stirred in the NaOH solution with EDTA-2Na^+^. The stirred mixture was then filtrated through a filter paper (Whatman 1), and the filtrate was then gradually acidified to pH = 3.0 with 2 M H~2~SO~4~ and then stored at −20 °C overnight. After thawing, the precipitates were collected by centrifugation and washed thoroughly with deionized water. The obtained air-dried powder was then used in the following 3D printing procedure. The hydroxyl content on the softwood kraft lignin was characterized by ^31^P NMR in the Supporting Information ([Figure S2 and Table S1](http://pubs.acs.org/doi/suppl/10.1021/acsomega.9b02455/suppl_file/ao9b02455_si_001.pdf)). Photoreactive methacrylate resins (product code: RS-F2-GPCL-04), including methacrylate monomer and oligomer and initiator, were purchased from Formlabs, Inc. Acetone (≥99.5%) and dimethyl sulfoxide (DMSO, ≥99.9%) were supplied by Sigma-Aldrich Inc. 2-Chloro-4,4,5,5-tetramethyl-1,3,2 dioxaphospholane, endo-*N*-hydroxy-5-norbornene-2,3-dicarboximide, pyridine, and deuterated chloroform and chromium acetylacetonate for NMR were all of analytical grade and purchased from Sigma-Aldrich. Isopropyl alcohol (≥99.5%) was provided by Fisher Chemical. All chemicals were used as received. 4.2. Fabrication of Lignin-Dispersed Resins {#sec4.2} ------------------------------------------- Lignin was dispersed into the methacrylate resin using a solution-blending procedure. Lignin was first dispersed in acetone at a concentration of 1.00 g/200.00 mL (lignin/acetone), and the resin was dissolved in acetone separately in a ratio of 200.00 g/200.00 mL (resin/acetone). The two solutions were blended independently and stirred overnight at room temperature. The two solutions were then mixed by varying feed ratios to control the lignin concentrations in the resin at 0.0, 0.2, 0.4, 0.5, 0.8, and 1.0 wt %. The resulting mixtures were stirred further overnight followed by rotary evaporation for 4 h at 30 °C to remove the acetone. All of these mixing steps were accomplished in aluminum-foil-covered beakers and flasks to avoid any prepolymerization. To measure the size of lignin in the acetone, dynamic light scattering (DLS) and SEM were used, and the data is shown in the Supporting Information ([Figures S3 and S4](http://pubs.acs.org/doi/suppl/10.1021/acsomega.9b02455/suppl_file/ao9b02455_si_001.pdf)). 4.3. 3D Printing of the Samples {#sec4.3} ------------------------------- A stereolithography file (.stl) of the required specimen shape (Type V dogbone in this case) was created in a Siemens NX 10.0 program before 3D printing. The printing processing was controlled by the printer software (Preform, v.2.15.0, Formlabs, Inc.) using a stereolithography printer (Form 1 +, Formlab Inc.) equipped with a 405 nm UV light laser ([Figure S5](http://pubs.acs.org/doi/suppl/10.1021/acsomega.9b02455/suppl_file/ao9b02455_si_001.pdf)). The 3D printing process included a layer-by-layer UV-light-induced free-radical polymerization of methacrylate resin to form the shape of samples as designed, where the layer thickness, which represents the resolution in the *z*-axis, was chosen as 0.1 mm ([Figure S5](http://pubs.acs.org/doi/suppl/10.1021/acsomega.9b02455/suppl_file/ao9b02455_si_001.pdf)). After printing, the samples were removed from the platform manually. They were then soaked at room temperature for 10 min in an isopropyl alcohol bath and another 10 min in a second isopropyl alcohol bath to remove unreacted resin on the surfaces of samples following the reported procedure.^[@ref25]^ The obtained sample was then stored in self-made aluminum foil boxes in an ambient environment after air drying overnight and designated as the non-postcured sample. To postcure the printed samples, a 36 W UV reactor (MelodySusie Co.) equipped with two 9 W lamps centered at a wavelength of 365 nm lamp combined with two 9 W LED centered at a wavelength of 405 nm was used. The UV intensity of the postcure device was measured as 280 ± 16 μW/cm^2^ (SP-82UV, Lutron Pocket UV Intensity Meter) during the postcure, and the data is shown in [Table S2](http://pubs.acs.org/doi/suppl/10.1021/acsomega.9b02455/suppl_file/ao9b02455_si_001.pdf). The samples were horizontally placed in the light reactor for a certain amount of time to cure one side of the sample, and then the samples are turned over for another period of the same time to cure the other side of the sample. The total postcuring time was presented as the sum up of the two time periods. The non-postcured and postcured samples were designated as N-*x* and P-*x*, respectively, where *x* represented the weight percentage of lignin in the sample corresponding to 0.0, 0.2, 0.4, 0.5, 0.8, and 1.0 wt %. All of the non-post-cured and postcured samples were kept in self-made aluminum foil boxes for further testing. 4.4. Characterization of Printed Samples {#sec4.4} ---------------------------------------- ### 4.4.1. Determination of the Lignin Concentrations in the Printed Sample {#sec4.4.1} To determine lignin concentration in the printed sample, the uncured printed sample was used because of its higher solubility than the UV cured products in DMSO. The non-postcured samples were first cut into small cubes (approximately 1 mm × 1 mm × 1 mm) and then dissolved into DMSO. The cubes with different lignin blending ratios (N-0.2%, N-0.4%, N-0.5%, N-0.8%, and N-1.0%) were weighed (*m*~1~, ∼0.3 g) and then dissolved in 20.00 mL DMSO with magnetic stirring at room temperature for 24 h. The undissolved material was separated by centrifugation at 10 000 rpm. The supernatant was pipetted out to measure the UV absorption of lignin in the solvent using UV--vis spectrometer at a wavelength of 300 nm with appropriate dilution.^[@ref26]^ The dissolved lignin concentration in the supernatant (*q*, mg/mL) was determined according to the calibration curve function from softwood kraft lignin/DMSO solution in various concentrations (0.0160, 0.0252, 0.0260, 0.0330, and 0.0365 mg/mL) as described in the Supporting Information ([Figure S6](http://pubs.acs.org/doi/suppl/10.1021/acsomega.9b02455/suppl_file/ao9b02455_si_001.pdf)). The weight (*m*~2~, g) of the undissolved residue was quantified after vacuum drying at 45 °C until the weights were unchanged. The lignin concentration (*c*, %) in the printed samples was given by [eq [1](#eq1){ref-type="disp-formula"}](#eq1){ref-type="disp-formula"} with the assumption that the lignin concentration (wt %) in the dissolved products is the same as that left in the undissolved residuewhere *V* is the volume of the solution of the supernatant (20 mL). ### 4.4.2. Gel Contents {#sec4.4.2} The gel contents of the non-postcured and postcured printed samples were gravimetrically determined after Soxhlet extraction using acetone for 48 h.^[@ref27]^ The samples (∼0.2 g) were cut into similar size (around 1 mm × 1 mm × 1 mm). The gel contents were calculated using [eq [2](#eq2){ref-type="disp-formula"}](#eq2){ref-type="disp-formula"}in which the *M*~0~ represented the initial weights before the extraction and the *M*~1~ represented the weights after the extraction. The measurement was conducted in triplicates. ### 4.4.3. Relative Contents of Unreacted Resin in Printing {#sec4.4.3} The relative contents of unreacted resin in the printed sample were evaluated by differential scanning calorimeter (DSC, Diamond, Perkin Elmer), which was calibrated with indium under a nitrogen atmosphere before the tests. The printed samples (3--5 mg) were heated from 25 to 210 °C at 10 °C /min to record the heat flow curves. The polymerization enthalpy was given by the peak area of the exothermic peak during each scan.^[@ref28]^ ### 4.4.4. Fourier Transform Infrared Spectroscopy (FTIR) Analysis {#sec4.4.4} FTIR analysis of the 3D-printed non-postcured composites was performed on a Perkin Elmer FTIR-ATR spectrometer II at room temperature. The FTIR spectra were collected from 4000 to 600 cm^--1^ with 16 scans and a resolution of 4 cm^--1^. ### 4.4.5. Tensile Tests {#sec4.4.5} Tensile testing of the printed samples was performed using a universal testing machine (Instron Co., model: Instron 5567) equipped with a 30 kN load cell according to the ASTM standard D638 (Type V).^[@ref32]^ Dogbone specimens were tested at an ambient temperature using a crosshead speed of 1 mm/min for all of the samples. Young's modulus was obtained by linear fitting of the stress--strain curves in the linear portion of the strain range^[@ref33]^ (0.1--0.5%) in the current study. Young's modulus and tensile strength were determined and reported as an average value of three test specimens. ### 4.4.6. Scanning Electron Microscopy (SEM) {#sec4.4.6} The morphology of the sample and fracture surfaces of the 3D-printed composites were studied using an SEM (Zeiss dual-beam FIB/SEM instrument), with an accelerating voltage of 3 kV. All samples were sputter-coated with a thin layer of gold on the target surface to prevent the buildup of electronic charge before observation. The Supporting Information is available free of charge on the [ACS Publications website](http://pubs.acs.org) at DOI: [10.1021/acsomega.9b02455](http://pubs.acs.org/doi/abs/10.1021/acsomega.9b02455).^31^P NMR characterization of the kraft softwood lignin; UV intensity of the postcure UV device; procedure to determine the standard curve of UV absorption--lignin concentration for lignin/DMSO solution; influence of postcuring time in Young's modulus of printed samples with 0.2 wt % lignin ([PDF](http://pubs.acs.org/doi/suppl/10.1021/acsomega.9b02455/suppl_file/ao9b02455_si_001.pdf)) Supplementary Material ====================== ###### ao9b02455_si_001.pdf The authors declare no competing financial interest. The authors thank Prof. Michael Kilbey and Mr. William Ledford at the Department of Chemistry, University of Tennessee, Knoxville, for the help on the DLS measurement.
Article content The iconic Canadian ball hockey rink at Kandahar Airfield, its boards adorned with faded Maple Leaf flags, has been dismantled. A dozen Canadian embassy staff, including Ambassador Ken Neufeld and a few soldiers, played a final game of shinny last week on the concrete slab in the infield of the airfield’s boardwalk before U.S. army engineers helped take down the boards. We apologize, but this video has failed to load. tap here to see other videos from our team. Try refreshing your browser, or Matthew Fisher: Last game has been played at Canada's ball hockey rink in Kandahar — and it's headed home Back to video “I gotta say, it was a lot of fun,” Neufeld said. “But it was emotional, too.” A Canadian soldier on his fourth tour in Afghanistan, who asked that his name not be published because of the sensitive nature of his current work, said that “to be part of the ceremony and bring those boards back, it felt like a healthy closing of a chapter. “Strange to think we were playing hockey in the desert but there we were. It was a very positive experience. We sweated blood and tears for that place. It will always be part of me.” The boards of the rink are to be flown to CFB Trenton to eventually be put on display at the Canadian War Museum in Ottawa. There have also been discussions about exhibiting some of the mementos at the Hockey Hall of Fame in Toronto.
//========= Copyright Valve Corporation, All rights reserved. ============// // // Purpose: // // $NoKeywords: $ //=============================================================================// #ifndef EDITABLEPANEL_H #define EDITABLEPANEL_H #ifdef _WIN32 #pragma once #endif #include <vgui_controls/Panel.h> #include <vgui_controls/FocusNavGroup.h> namespace vgui { //----------------------------------------------------------------------------- // Purpose: Panel that supports editing via the build dialog //----------------------------------------------------------------------------- class EditablePanel : public Panel { DECLARE_CLASS_SIMPLE( EditablePanel, Panel ); public: EditablePanel(Panel *parent, const char *panelName); EditablePanel(Panel *parent, const char *panelName, HScheme hScheme); virtual ~EditablePanel(); // Load the control settings - should be done after all the children are added // If you pass in pPreloadedKeyValues, it won't actually load the file. That way, you can cache // the keyvalues outside of here if you want to prevent file accesses in the middle of the game. virtual void LoadControlSettings(const char *dialogResourceName, const char *pathID = NULL, KeyValues *pPreloadedKeyValues = NULL, KeyValues *pConditions = NULL); virtual void ApplySettings(KeyValues *inResourceData); // sets the name of this dialog so it can be saved in the user config area // use dialogID to differentiate multiple instances of the same dialog virtual void LoadUserConfig(const char *configName, int dialogID = 0); virtual void SaveUserConfig(); // combines both of the above, LoadControlSettings & LoadUserConfig virtual void LoadControlSettingsAndUserConfig(const char *dialogResourceName, int dialogID = 0); // Override to change how build mode is activated virtual void ActivateBuildMode(); // Return the buildgroup that this panel is part of. virtual BuildGroup *GetBuildGroup(); // Virtual factory for control creation // controlName is a string which is the same as the class name virtual Panel *CreateControlByName(const char *controlName); // Shortcut function to set data in child controls virtual void SetControlString(const char *controlName, const char *string); // Shortcut function to set data in child controls virtual void SetControlString(const char *controlName, const wchar_t *string); // Shortcut function to set data in child controls virtual void SetControlInt(const char *controlName, int state); // Shortcut function to get data in child controls virtual int GetControlInt(const char *controlName, int defaultState); // Shortcut function to get data in child controls // Returns a maximum of 511 characters in the string virtual const char *GetControlString(const char *controlName, const char *defaultString = ""); // as above, but copies the result into the specified buffer instead of a static buffer virtual void GetControlString(const char *controlName, char *buf, int bufSize, const char *defaultString = ""); // sets the enabled state of a control virtual void SetControlEnabled(const char *controlName, bool enabled); virtual void SetControlVisible(const char *controlName, bool visible); // localization variables (used in constructing UI strings) // after the variable is set, causes all the necessary sub-panels to update virtual void SetDialogVariable(const char *varName, const char *value); virtual void SetDialogVariable(const char *varName, const wchar_t *value); virtual void SetDialogVariable(const char *varName, int value); virtual void SetDialogVariable(const char *varName, float value); // Focus handling // Delegate focus to a sub panel virtual void RequestFocus(int direction = 0); virtual bool RequestFocusNext(VPANEL panel); virtual bool RequestFocusPrev(VPANEL panel); // Pass the focus down onto the last used panel virtual void OnSetFocus(); // Update focus info for navigation virtual void OnRequestFocus(VPANEL subFocus, VPANEL defaultPanel); // Get the panel that currently has keyfocus virtual VPANEL GetCurrentKeyFocus(); // Get the panel with the specified hotkey virtual Panel *HasHotkey(wchar_t key); virtual void OnKeyCodePressed( KeyCode code ); // Handle information requests virtual bool RequestInfo(KeyValues *data); /* INFO HANDLING "BuildDialog" input: "BuildGroupPtr" - pointer to the panel/dialog to edit returns: "PanelPtr" - pointer to a new BuildModeDialog() "ControlFactory" input: "ControlName" - class name of the control to create returns: "PanelPtr" - pointer to the newly created panel, or NULL if no such class exists */ // registers a file in the list of control settings, so the vgui dialog can choose between them to edit virtual void RegisterControlSettingsFile(const char *dialogResourceName, const char *pathID = NULL); // localization variables - only use this if you need to iterate the variables, use the SetLoc*() to set them KeyValues *GetDialogVariables(); protected: virtual void PaintBackground(); // nav group access virtual FocusNavGroup &GetFocusNavGroup(); // called when default button has been set MESSAGE_FUNC_HANDLE( OnDefaultButtonSet, "DefaultButtonSet", button ); // called when the current default button has been set MESSAGE_FUNC_HANDLE( OnCurrentDefaultButtonSet, "CurrentDefaultButtonSet", button ); MESSAGE_FUNC( OnFindDefaultButton, "FindDefaultButton" ); // overrides virtual void OnChildAdded(VPANEL child); virtual void OnSizeChanged(int wide, int tall); virtual void OnClose(); // user configuration settings // this is used for any control details the user wants saved between sessions // eg. dialog positions, last directory opened, list column width virtual void ApplyUserConfigSettings(KeyValues *userConfig); // returns user config settings for this control virtual void GetUserConfigSettings(KeyValues *userConfig); // optimization for text rendering, returns true if text should be rendered immediately after Paint() // disabled for now // virtual bool ShouldFlushText(); private: void ForceSubPanelsToUpdateWithNewDialogVariables(); BuildGroup *_buildGroup; FocusNavGroup m_NavGroup; KeyValues *m_pDialogVariables; // the wide and tall to which all controls are locked - used for autolayout deltas char *m_pszConfigName; int m_iConfigID; bool m_bShouldSkipAutoResize; }; } // namespace vgui #endif // EDITABLEPANEL_H
Integrating Social Services and Home-Based Primary Care for High-Risk Patients. There is a consensus that our current hospital-intensive approach to care is deeply flawed. This review article describes the research evidence for developing a better system of care for high-cost, high-risk patients. It reviews the evidence that home-centered care and integration of health care with social services are the cornerstones of a more humane and efficient system. The article describes the strengths and weaknesses of research evaluating the effects of social services in addressing social determinants of health, and how social support is critical to successful acute care transition programs. It reviews the history of incorporating social services into care management, and the prospects that recent payment reforms and regulatory initiatives can succeed in stimulating the financial integration of social services into new care coordination initiatives. The article reviews the literature on home-based primary care for the chronically ill and disabled, and suggests that it is the emergence of this care modality that holds the greatest promise for delivery system reform. In the hope of stimulating further discussion and debate, the authors summarize existing viewpoints on how a home-centered system, which integrates social and medical services, might emerge in the next few years.
Background {#Sec1} ========== Preclinical studies of breast cancer are limited by a lack of suitable models recapitulating aspects of human physiology and the biology of the human breast. Approximately 90 % of cancer treatments stemming from preclinical screens performed using xenografts in rodents fail during clinical trials \[[@CR1]\], highlighting intrinsic genetic, physiological \[[@CR2], [@CR3]\] and morphological \[[@CR4]\] differences between humans and mice. The pig offers a promising alternative to traditional rodent models given they share pronounced genomic \[[@CR5]\] and biological \[[@CR6]\] similarities to humans. As such, pigs have increasingly become an integral species for translational research, particularly for preclinical toxicology studies and as a biomedical model for human cardiovascular, integumentary and gastrointestinal systems \[[@CR7]\]. While the mammary glands of female pigs have only been infrequently cited as a model for the human breast, they closely recapitulate several important aspects of human breast biology. Development of the mammary tissue in pigs from embryogenesis \[[@CR8]\] through puberty \[[@CR9]\] and gestation \[[@CR10]\] parallels that of the human breast \[[@CR11]\]. While pigs have an average of 10--14 mammary glands, each has multiple (2--4) galactophores that drain to the nipple and form the primary duct from which the parenchymal tissue develops \[[@CR12]\]. Humans also have multiple galactophores per nipple, while the mouse has only one \[[@CR13]\]. The histomorphology of the porcine mammary gland and human breast has been similarly described as having terminal ductal lobular units (TDLU) embedded within fibrous inter-and intralobular connective tissues \[[@CR9], [@CR11]\], which contrasts to the simple ductal network and adipose-rich stroma of the mouse mammary gland \[[@CR4]\]. Importantly, intrinsic structural differences between the mammary glands of rodents and humans likely influence tumorigenic risk given that the stroma directs proliferative, morphogenic and hormonal responses by the epithelium \[[@CR14]--[@CR16]\]. Furthermore, the relative abundance of different TDLU morphotypes in the human breast can influence breast cancer risk, where the least-differentiated TDLU type 1 (TDLU-1) is most prone to transformation \[[@CR17]\]. A porcine model of human breast cancer would stand to address many of these interactions that underlie breast development and tumorigenesis \[[@CR18]\]. Moreover, the size and positioning of the voluminous mammary glands will allow for the assessment of multiple treatments or endpoints within an animal and over time using serial biopsies \[[@CR19]\]. Further to the above, few reports detail methods to isolate and genetically manipulate the mammary epithelial cells (pMEC) in pigs. The objective of this study was to establish methods of lentivirus-mediated transformation of pMEC as a first step toward developing a novel model for human breast cancer. We hypothesized pMEC would undergo oncogene-induced transformation to yield tumors with a histopathology resembling human breast cancers. Herein, we report the successful lentiviral transduction of porcine mammary cells *in vitro* and tissue *in vivo*, formation of tumors by transformed pMEC in immunocompromised mice, and the precocious expansion of TDLU when transformed pMEC were isografted into the pig mammary gland. Methods {#Sec2} ======= Experimental design {#Sec3} ------------------- We initially conducted experiments to determine the efficiency of using lentivirus for the transduction of pMEC *in vitro* and *in vivo*. In study one we sought to develop and optimize methods for the collection and dissociation of mammary tissue from nulliparous pigs for transduction *in vitro*. In study two we transduced pig mammary tissue *in vivo* by direct instillation of non-oncogenic lentivirus into the mammary gland duct or parenchyma. For study three, we sought to determine whether pMEC transduced with non-oncogenic lentivirus *in vitro* could develop typical mammary structures when transplanted back to the mammary fat pads of respective donor pigs. Finally, in studies four and five, pMEC were transformed *in vitro* by oncogenic lentivirus and either isografted to the mammary gland of donor pigs (study four) or xenografted to the mammary fat pad of immunocompromised mice (study five). Animals {#Sec4} ------- All experimental protocols for animal experimentation underwent prior ethical review and were approved by the UC Davis Animal Care and Use Committee following guidelines set forth by the Association for Assessment and Accreditation of Laboratory Animal Care and the Guide for the Care and Use of Agricultural Animals in Research and Teaching (protocol \#17675). For study one and study five, mammary tissue was obtained at necropsy from healthy nulliparous Yorkshire × Hampshire pigs obtained from the specific pathogen-free swine facility at UC Davis when they were 3--5 months of age (*n* = 8 and *n* = 4, respectively). For study two (*n* = 9 pigs from two litters), study three (*n* = 8 pigs from two litters), and study four (*n* = 4 pigs from two litters) pigs were healthy, experimentally naïve 4 week-old Yorkshire × Hampshire females. For studies two, three and four, piglets were selected that possessed at least twelve mammary glands, which permitted an individual pig to carry experimental treatments and controls within separate mammary glands. Piglets were housed indoors in a temperature-controlled facility (25--27 °C), as littermate pairs, were fed twice daily and had *ad libitum* access to water. Pigs were monitored daily for any changes in behavior or health status. During surgical procedures, pigs were assessed for changes in body temperature, heart rate and respiration. All surgical procedures involving pigs were carried out in a disinfected surgical suite designed for accommodating large animals. In study five, 20 experimentally naïve female *NOD scid gamma* (NOD.Cg-*Prkdc*^*scid*^ *Il2rg*^*tm1Wjl*^/SzJ (NSG)) mice (The Jackson Laboratory, Sacramento, CA; *n* = 4 per pMEC line) between 4 and 35 weeks of age (Table [1](#Tab1){ref-type="table"}) were maintained in littermate groups with *ad libitum* access to food and water. Mice were housed in a pathogen-free barrier facility under conditions of constant temperature (20--23 °C), humidity (45--65 %), and a 14 h light/10 h dark cycle. Tumor formation was assessed weekly by palpation, and tumor diameter recorded every 2d once they reached 1 mm diameter. During surgical procedures, mice were monitored for toe-pinch reflex and respiration rate. Surgical procedures were carried out within a disinfected biosafety cabinet to minimize pathogen exposure.Table 1pMEC were sorted to remove fibroblasts (CD140-), and some selected for expression of CD49f or tdTomato, and then transduced at various passages (P~T~) with one of the lentiviral constructs PGK-Tantigen (PGKT), CMV-tdTomato (CMVT) or PGKT-CMVT (PTCT)Cell lineFACSP~T~*In vitro* morphologyNumberAgeP~I~Cells (\#)MatrixSiteE + PTumor diameter (mm)Weeks carried*in vivo* characteristics*ss*071712 PGKTCD140-1Cobblestone, no foci367d61×10^5^HydrogelMGNoN/a16.7N/a*ss*071712 CMVTCD140-61×10^5^HydrogelMGNoN/a16.7*ss*071712 PGKTCD140-1774d61×10^5^HydrogelMGNoN/a15.7N/a*ss*071712 CMVTCD140-61×10^5^HydrogelMGNoN/a15.727-3 PTCTCD140-tdTomato+1Foci, radial outgrowth430d75×10^5^HydrogelMGNo\<1 mm19.5Normal ductal epithelium27-3 PTCTCD140-tdTomato+75×10^5^HydrogelSC (Rear)NoN/a19.5N/a28-3 PTCTCD140-1Elongated, some foci430d105×10^5^HydrogelMGNo15.3 ± 1.518.5Fibrosis, vimentin positive28-3 PTCTCD140-105×10^5^HydrogelSC (Rear)No12.3 ± 1.118.527-1 PTCTCD140-tdTomato+1Cobblestone, no foci430d115×10^5^HydrogelMGNoN/a36.4N/a27-1 PTCTCD140-tdTomato+115×10^5^HydrogelSC (Rear)NoN/a36.428-6 PTCTCD140-tdTomato+1Foci, rapid proliferation430d115×10^5^HydrogelMGNo\<1 mm42Fibrosis, squamous epithelium28-6 PTCTCD140-tdTomato+115×10^5^HydrogelSC (Rear)NoN/a42N/a*ss*020513_1 PTCTCD140- CD49f+1Cobblestone, no foci4102d34×10^5^HydrogelSC (Shoulder)No5.3 ± 0.632Glandular, squamous epithelium, CK8/18 positive*ss*020513_1 PTCTCD140- CD49f+242d31×10^6^MatrigelSC (Flank)Yes6.0 ± 0.410*ss*020513_2 PTCTCD140- CD49f+1Cobblestone, no foci438×10^5^MatrigelSC (Flank)Yes6.2 ± 1.210*ss*082112_PTCTCD140-6Cobblestone, no foci459d101×10^6^MatrigelMGYes\<1 mm10.6Normal ductal epithelium*ss*082112_PTCTCD140-6111×10^6^MatrigelSC (Rear)Yes7.21 ± 0.210.6Glandular, squamous epitheliumNSG mice (*n* = 3-7), at various ages, were injected with cells at various passages post-transduction (P~I~) in hydrogel or Matrigel into mammary gland fat pads (MG) or subcutaneously (SC), with or without implanted estrogen (E) and progesterone (P) pellets. Cells were grown in the mice for up to 42 weeks and the widest diameter (±SEM) and features of growths are indicated Pigs in study two received daily 17β-estradiol injections (IM, 0.1 mg/kg; Sigma Aldrich, St. Louis, MO) for 7d after lentivirus instillation to stimulate MEC proliferation \[[@CR9]\]. Similarly, pigs in studies three and four received daily 17β-estradiol for 7d prior to excision of mammary tissue. Upon reinstillation of lentivirus-transduced cells, a 17β-estradiol/cholesterol pellet (0.05 mg/kg) was placed subcutaneously, reducing the need for daily hormone injections. All pigs serving as donors for mammary tissue received penicillin intramuscularly 24 h prior to tissue collection to reduce the potential bacterial contamination of cultures. NSG mice carrying pMEC lines ss020513_1 and ss020513_2 (*n* = 4) and ss082112 (*n* = 4) received a pellet containing 2 μg 17β-estradiol and 0.75 mg progesterone (Sigma-Aldrich) at the time of cell injection to promote the proliferation of engrafted cells. Primary mammary cell isolation {#Sec5} ------------------------------ In studies one and four, immediately following exsanguination of pigs, the skin was disinfected, the nipple retracted and \~1 g of mammary tissue excised (*n* = 5 glands). In study three, pMEC were obtained by removing endogenous parenchyma from six mammary glands from five-week old pigs under isoflurane anesthesia using a cleared mammary gland procedure essentially as described \[[@CR20]\]. Analgesic (banamine, 2--5 mg/kg) was administered postoperatively. ### Organoid preparation {#Sec6} Minced mammary tissue was digested (1.5 mg/ml collagenase A (Roche, San Francisco, CA; 75 μg/ml DNase I, Roche; 1 mg/ml hyaluronidase, MP Biomedicals, Santa Ana, CA) in growth media (10 % fetal bovine serum \[FBS\], DMEM/F-12, penicillin G/streptomycin sulfate/amphotericin B) at 37 °C for 3 h. Organoids (40--100 μm diameter) were plated in primary porcine mammary epithelial media (modified from MEGM \[[@CR21]\] as a 1:1 mix of MCDB170 (US Biological, Salem, MA) and DMEM/F-12 (CellGro, Manassas, VA) with penicillin G/streptomycin sulfate/amphotericin B, 0.5 % FBS, bovine insulin (7.5 μg/mL, Sigma-Aldrich), human EGF (5 ng/mL, Millipore, Billerica, MA), hydrocortisone (0.25 μg/mL, Sigma-Aldrich), human apo-transferrin (2.5 μg/mL, Sigma-Aldrich), ethanolamine (0.1 mM, Sigma-Aldrich), o-phosphoethanolamine (0.1 mM Sigma-Aldrich), bovine pituitary extract (35 μg/mL, Gemini Bio-Products, West Sacramento, CA), and lipid-rich bovine serum albumin (0.1 %, Gemini Bio-Products). Cell culture {#Sec7} ------------ Primary pMEC were maintained in porcine mammary epithelial media or growth media, and were differentially trypsinized to reduce the number of contaminating fibroblasts \[[@CR21]\]. HEK293FT cells (Invitrogen, Grand Island, NY) were maintained in HEK293FT media (DMEM, 10 % FBS, penicillin G/streptomycin sulfate, non-essential amino acids and 1 mM sodium pyruvate). NIH/3 T3 cells (ATCC) were maintained in high glucose DMEM (Hyclone Laboratories, GE Healthcare Life Sciences, Logan UT) with 10 % FBS, 10 mM Hepes, 1 mM sodium pyruvate, penicillin G/streptomycin sulfate. Vectors and virus {#Sec8} ----------------- The human elongation factor 1α (EF1α)-tdTomato and phosphoglycerate kinase (PGK)-tdTomato plasmids were generated from pLVX-IRES-tdTomato (cytomegalovirus (CMV)-tdTomato; Clontech, Mountain View, CA) by cloning the EF1α promoter from pEF6/myc-His C (Invitrogen) or the human PGK promoter (GenBank:NG_008862.1) from the pMNDU3-PGK-Luc plasmid (UC Davis Vector Core, Sacramento, CA) by PCR (Additional file [1](#MOESM1){ref-type="media"}: Figure S1A). The PGK-T antigens (Tag)-CMV-tdTomato construct (Additional file [1](#MOESM1){ref-type="media"}: Figure S1B) was generated by first constructing pLVX-PGK-Tag. IRES-tdTomato was excised from pLVX-PGK-tdTomato to give pLVX-PGK. The Tag sequences encoding mouse polyomavirus small Tag (ST), middle Tag (MT) and large Tag (LT; GenBank:J02288) were amplified from p53.A6.6 (pPY-1; ATCC, Manassas, VA) and ligated into pLVX-PGK to generate pLVX-PGK-Tag. The CMV promoter was excised from pLVX-IRES-tdTomato and ligated into pLVX-PGK-Tag to generate pLVX-PGK-Tag-CMV. The tdTomato coding sequence was amplified from pLVX-IRES-tdTomato and ligated into pLVX-PGK-Tag-CMV to generate pLVX-PGK-Tag-CMV-tdTomato. All constructs were sequence verified. Lentiviral supernatants for PGK-Tag-CMV-tdTomato were prepared by the University of California San Francisco viral core and titrated by flow cytometry (9.3 × 10^7^ transduction units \[TU\]/ml). CMV-tdTomato viral supernatant was produced by triple transfection of HEK293FT cells in Opti-MEM I (Invitrogen) with packaging vector (16 μg/150 cm^2^ cells; pCMV-dR8.91, UC Davis Vector Core), envelope vector (3.2 μg/150 cm^2^ cells; pMDG-VSVG, UC Davis Vector Core) and transfer vector (16 μg/150 cm^2^ cells; pLVX-IRES-tdTomato) with Lipofectamine 2000 (Invitrogen). Lentiviral particles were concentrated by 100 kDa cut-off centrifugation (Millipore). Viral stocks were titrated in HEK293FT cells using qPCR \[[@CR22]\]. The woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) was used to measure integration and values normalized to the number of human albumin copies (WPRE Fwd GCGTCTGGAACAATCAACCT and Rev GGCATTAAAGCAGCGTATCC; hAlbumin \[GenBank:152112963\] Fwd GTGCTGCCTCGTAGAGTTTTCTG and Rev TCAATAGCCATGTGACCAGTGACT). Fluorescence activated cell sorting {#Sec9} ----------------------------------- Primary pMEC cultures were expanded for 13-14d post-isolation with two differential trypsinizations using Accutase (Innovative Cell Technologies, Mira Mesa, CA) to remove fibroblasts, followed by Accumax (Innovative Cell Technologies) to dislodge pMEC. Single cells were incubated with phycoerythrin-conjugated anti- CD140a (BD Biosciences, Franklin Lakes, NJ) and/or biotinylated anti-human CD49f (AbD Serotec, Oxford, UK), followed by streptavidin-Alexa 488 (Jackson Immunoresearch) and propidium iodide (10 μg/ml) and sorted using a MoFlo cell sorter (Cytomation, West Lafayette, IN). Viral transduction *in vitro* {#Sec10} ----------------------------- Adherent pMEC were transduced overnight using a multiplicity of infection (MOI) of 100 for PGK-tdTomato, EF1α-tdTomato or CMV-tdTomato, or an MOI of 20 for PGK-Tag-CMV-tdTomato, along with polybrene (6 μg/mL; Millipore). For study four, cultures of CD140a- pMEC were transduced with PGK-Tag (ss071712), pLVX-PGK-Tag-CMV-tdTomato (ss082112, 27--1, 27--3, 28--3) or CMV-tdTomato (ss071712). Two pMEC lines (ss020513_1, ss020513_2) were sorted to be CD140a-/CD49f + then transduced with PGK-Tag-CMV-tdTomato. A subset of CD140a- pMEC transduced with PGK-Tag-CMV-tdTomato were sorted for tdTomato + either 7d (27--3, 28--3) or 17d later (27--1, 28--6) depending on the initial number of CD140a- pMEC. Viral transduction *in vivo* {#Sec11} ---------------------------- In study two, saline or lentivirus (CMV-tdTomato, 5 × 10^6^ TU; EF1α-tdTomato, 1 × 10^7^ TU and PGK-tdTomato, 5 × 10^6^ TU with or without 6 μg/ml polybrene was instilled into the left (with polybrene; one gland/treatment) and right (without polybrene; one gland/treatment) thoracic and abdominal mammary glands of pigs (*n* = 9) via one of the two mammary ducts (intraductal) under isoflurane anesthesia. Additionally, saline or lentivirus suspension with 6 μg/ml polybrene was injected directly into the mammary parenchyma (20--25 mm subcutaneously; intramammary) in the four remaining mammary glands of each pig (one gland/treatment). Mammary glands were harvested at necropsy 5, 10 or 15 d later, and snap frozen or fixed in 4 % paraformaldehyde. *Ex vivo* transduction and grafting {#Sec12} ----------------------------------- In study three, dissociated mammary organoids (*n* = 30) were transduced overnight (MOI = 100) with PGK-tdTomato, CMV-tdTomato, EF1α-tdTomato, CMV-Tag, EF1α-Tag, PGK-Tag or no vector (control) with polybrene (6 μg/ml). After 24 h (*n* = 4 pigs) or 8d (n = 6 pigs) cultures of organoids were trypsinized and resuspended in serum-free media. Donor pigs were anesthetized with isoflurane and cells reinstilled via two intramammary injections/gland (0.9--4.5×10^5^ cells/injection; *n* = 2 glands/construct/pig) and each site closed with Vetbond (3 M, St. Paul, MN). The isografted mammary glands were harvested 3--5 weeks later, minced, and randomly divided for snap freezing in liquid N~2~ or fixation in 4 % paraformaldehyde. In study four, lentivirus-transduced pMEC were injected into NSG mice under isoflurane anesthesia. A range of 0.4-1 × 10^6^ pMEC resuspended in 20 μL of HyStem-C hydrogel (*n* = 46 injected sites; Glycosan Biosystems, Alameda, CA) or Matrigel HC (*n* = 24 injected sites; BD Biosciences) was injected either subcutaneously or directly into the mammary gland. For instillation of cells into the mammary gland, a small skin incision (\~5 mm) was made to visualize accurate placement within the mammary fat pad. Mice were treated postoperatively with a single dose of analgesic (buprenorphine; 0.05 mg/kg) and were monitored once daily over 7d for changes in health and behavior. Table [1](#Tab1){ref-type="table"} summarizes the mice and cell injections used. *In vitro* assays {#Sec13} ----------------- Cell number was assayed using a methylene blue assay \[[@CR23]\]. Cells were plated in 96 well-plates at 2000 cells/well (*n* = 6/cell line) on d0, and medium changed every 2d. Cells (20,000/well) were resuspended in 0.35 % agar in growth medium and poured onto a base layer (0.7 % agar in growth media), with growth medium changed every 2d. After 21d, cells were stained (0.04 % crystal violet, 2.1 % citric acid), imaged and colonies \>50 μm counted using ImageJ (NIH; <http://rsb.info.nih.gov/ij/>). Mammary gland and tumor whole mounts {#Sec14} ------------------------------------ Semi-thick tissue sections were dehydrated through graded ethanols to xylene (study three) or graded glycerol (study four) as described \[[@CR24]\]. Sections were imaged using a fluorescent dissecting microscope. The percent red area was calculated using Image J. Regions positive for red fluorescence were dissected and processed to paraffin for hematoxylin and eosin staining (H&E) and immunohistochemistry. Regions having dense ductal structures (study three, PGK-Tag mammary glands) were microdissected, paraffin-embedded and sectioned for histology (H&E) and genomic DNA extraction. Western blotting {#Sec15} ---------------- Cells (1--3 × 10^6^) were lysed and sonicated in buffer with protease and phosphatase inhibitors, and western blots performed as described \[[@CR25]\]. Antibodies were from Santa Cruz Biotechnology (rat polyomavirus early, cyclin D1, and p53), Cell Signaling Technology (Rb, phospho Rb, MAPK1/3 and phospho MAPK1/3)) and Jackson ImmunoResearch (HRP-conjugated secondary antibodies). Genomic DNA extraction and PCR detection of integration {#Sec16} ------------------------------------------------------- Genomic DNA was extracted from paraffin-embedded tissues as described \[[@CR26]\] using combined heating and non-heating protocols. DNA quality was assessed using primers for the porcine prolactin receptor gene \[[@CR27]\]. The incidence of lentiviral integration in studies two and three was determined using primer sets specific to tdTomato (Clontech; tdTomatoFin Fwd CTCCGAGGACAACAACATGG and Rev CTTGGTCACCTTCAGCTTGG; CMVtdTomato Fwd AACACGATGATAATATGGTGAGCAAGGG and TdTomatointernal Rev GACAGCTTCTTGTAATCGGGGATGTC) or amplified a product specific for PGK-Tag (PGKTagspec5P TGAAGATGTAAAGGGTCAAATAGC and PGKspec3P-2 AAGGCATTAAAGCAGCGTATC). ### RT-qPCR and qPCR (study two) {#Sec17} Total RNA was extracted and reverse transcribed as described \[[@CR28]\]. Primers spanned across exons of LEF1 (Fwd GACGAGCACTTTTCTCCAGGA, Rev TAATCTGTCCAACACCACCCG \[GenBank:XM_005666939\]), cyclin D1, (Fwd CCCTCCGTGTCCTACTTCAA, Rev CAGGCGGCTCTTTTTCAC \[GenBank:AK400348)\], cyclin A2, (Fwd TTGTGGGCACTGCTGCTATG, Rev GCAAGGACTTTCAAAACGAGGTG \[GenBank:GQ265874\]), MYC, (Fwd CGCTTTTTGGACGCTGGATT, Rev TTCTCCTCCTCGTCGCAGTA \[GenBank:X97040\]), RB1 (Rb), (Fwd ACGCCAACAAAAATGACTCC, Rev GTTGCCTCCTTCAGCACTTC \[GenBank: JX099502\]), TP53 (p53), (Fwd CCATCCTCACCATCATCACACT, Rev CTCTGTGCGGCGGTCTCT \[GenBank:NM_213824\]), P21, (Fwd GCAGACCAGCATGACAGATT, Rev TGTTTCCAGCAGGACAAGG \[GenBank:XM_001929558\]), P16, (Fwd GAGGGCTTCCTGGACACTTTG, Rev TGCAGTATCTCTGGGTTTCAATGA; \[GenBank:AJ316067\]) and 18S ribosomal RNA, (Fwd ACGGCTACCACATCCAAGGA, Rev CCAATTACAGGGCCTCGAAA \[GenBank: AF179868\]). All PCR products were sequenced. RT-qPCR was as described \[[@CR28]\], where relative transcript abundance was calculated using a 5-point standard curve obtained by 5-fold serial dilutions of a pMEC complementary DNA pool. The average relative expression for each sample was normalized to 18S ribosomal RNA levels \[[@CR29]\]. DNA was purified from tissues homogenized in Tri-Reagent (Molecular Research Center, Inc, Cincinnati, Ohio). Genomic DNA (40 ng) was amplified with tdTomatoFin primers using qPCR \[[@CR28]\]. Standard curves were generated from genomic DNA extracted from mouse mammary tumor cells (SSM-2) transduced with EF1α-tdTomato lentivirus and selected for tdTomato expression using a MoFlo cell sorter. The relative number of integrated virus particles was normalized to the corresponding level of 18S ribosomal DNA as a loading control for gene copy number (Fwd ACGGCTACCACATCCAAGGA, Rev CCAATTACAGGGCCTCGAAA \[Genbank: NR_046261\]). Immunohistochemistry {#Sec18} -------------------- Slides were prepared as described \[[@CR28]\], with modifications. Sections were incubated with anti-dsRED (1:50; Clontech), anti-human progesterone receptor (1:50; DakoCytomation, Carpinteria, CA), anti-human estrogen receptor (clone 6 F11, ThermoFisher Scientific, Waltham, MA), anti-vimentin (1:100; Millipore), anti-bovine cytokeratin 8/18 (1:2000; Fitzgerald Industries, Acton, MA), or anti-Ki67 (clone Ab-4; 1:1000; ThermoFisher Scientific) in 5 % horse serum in PBS at 4 °C overnight and detected with NovaRED (Vector Laboratories) or DAB (Invitrogen). Statistics {#Sec19} ---------- Differences were assessed by two-way ANOVA, and *P*-values calculated using Students *t*-tests. Data is presented as means ± SEM, with significance at *P* \< 0.05. For animal studies, individual mammary glands were treated as the experimental unit. Animal group sizes were selected to provide \>80 % power to detect differences, taking into consideration our experience with assessing porcine mammary gland morphology \[[@CR29]\] and the typical engraftment characteristics and rates of primary bovine and human MEC in immunodeficient mice \[[@CR30], [@CR31]\]. Results {#Sec20} ======= Primary culture of porcine mammary cells {#Sec21} ---------------------------------------- Dissociation of mammary tissue from nulliparous pigs (study one) yielded epithelial organoids that adhered to plastic within 24 h (Fig. [1](#Fig1){ref-type="fig"}). At 2d post-dissociation, mixed populations of cells included a cytokeratin-positive epithelial population (luminal), cells positive for both cytokeratin and vimentin (basal/myoepithelial) and two morphologically distinct vimentin-positive populations, one most likely being fibroblasts (Fig. [2](#Fig2){ref-type="fig"}).Fig. 1Representative images of pig mammary organoids collected after enzymatic dissociation of mammary gland tissue from a non-pregnant female. **a** A cluster of epithelial cells (closed arrowhead) and piece of duct (open arrowhead) with surrounding outgrowth 24 h after dissociation and plating. **b** An organoid with typical outgrowth 48 h after dissociation. Scale bar = 100 μmFig. 2Representative fluorescence images from pig mammary organoids 48 h after dissociation (P0) and after passages 1 and 2 (P1 and P2). Four distinct populations of cells were visible at P0. Cytokeratin-positive luminal epithelial cells, vimentin-positive fibroblasts (dashed circle, arrowheads in P2), cells positive for both vimentin and cytokeratin (dashed rectangle) and small, vimentin- positive cells (solid circle) found infrequently only at P0 Lentivirus for manipulating pMEC *in vitro* and *in vivo* {#Sec22} --------------------------------------------------------- We compared the CMV, EF1α and PGK promoters in lentivirus-transduced pMEC (study one), and determined EF1α to be the most effective *in vitro* (Additional file [2](#MOESM2){ref-type="media"}: Figure S2B). We next determined which promoter was most effective for pMEC *in vivo*, and the best route (intraductal or intramammary) for introducing lentivirus into the mammary gland (study two). Analysis of genomic DNA revealed that polybrene increased the incorporation of lentivirus instilled intraductally by 24-fold (Fig. [3a](#Fig3){ref-type="fig"}; *P* \< 0.05). We detected tdTomato in 5/9 CMV-, 5/9 EF1α- and in 4/9 PGK-tdTomato glands injected intraductally with lentivirus (Fig. [3b](#Fig3){ref-type="fig"}). In mammary glands receiving intramammary injections of lentivirus with polybrene we detected tdTomato in 2/8 CMV-, in 4/8 EF1α- and in 5/9 PGK-tdTomato glands (Fig. [3c](#Fig3){ref-type="fig"}). Glands transduced by intraductal instillation were analyzed for ductal outgrowths expressing tdTomato (Additional file [3](#MOESM3){ref-type="media"}: Figure S3). Clustered tdTomato-positive structures were present in the mammary gland injected with either EF1α-tdTomato or CMV-tdTomato lentivirus, consistent with localized transduction.Fig. 3Injection of lentivirus into the pig mammary gland. **a** Glands were injected intraductally (*n* = 9 pigs) with CMV-tdTomato, EF1α-tdTomato or PGK-tdTomato lentivirus with or without polybrene and harvested 5, 10 or 15d later. Lentiviral integration was determined by qPCR for tdTomato, corrected for 18S ribosomal RNA levels and expressed as a ratio of tdTomato integration with or without polybrene. Data are means ± SEM (*n* = 6-7). **b** Glands were injected intraductally (*n* = 9 pigs) with CMV-tdTomato, EF1α-tdTomato or PGK-tdTomato lentivirus and polybrene and harvested 5, 10 or 15d later. **c** Injections were into the mammary parenchyma (*n* = 9 pigs) with CMV-tdTomato, EF1α-tdTomato or PGK-tdTomato lentivirus and polybrene and harvested 5, 10 or 15d later. Negative controls (Neg) are genomic DNA from the mammary glands of two untreated pigs. Positive controls (Pos) are two pMEC lines transduced with CMV-tdTomato We examined whether pMEC transduced *ex vivo* would develop into epithelial structures upon transplantation into donor pigs (study three). Expansion of cells for 8d post-transduction before reinstallation yielded fluorescent TDLU outgrowths from EF1α-tdTomato (*n* = 1 of 8 mammary glands) and CMV-tdTomato (*n* = 2 of 8) transduced cells (Fig. [4a](#Fig4){ref-type="fig"}), but not from PGK-tdTomato transductants or in control glands (not shown), despite detection of tdTomato in 2/6 glands transplanted with PGK-tdTomato pMEC (Fig. [4b](#Fig4){ref-type="fig"}). Expansion of cells for 24 h post-transduction prior to reinstallation led to detection of genomic tdTomato in \>50 % of glands injected with CMV-tdTomato pMEC, EF1α-tdTomato or PGK-tdTomato transduced cells (Fig. [4c](#Fig4){ref-type="fig"}).Fig. 4Installation of lentivirus-transduced pig mammary epithelial cells (pMEC). **a** Representative images of red fluorescent terminal ductal lobular units identified in whole mounts of mammary glands injected with pMEC 8d after the cells were transduced with CMV-tdTomato, EF1α-tdTomato or PGK-tdTomato lentivirus. Tissues were harvested 3 or 5 weeks later. **b** Detection of tdTomato by PCR of genomic DNA from mammary glands analyzed in (**a**). Negative controls (Neg) are genomic DNA from the mammary glands of two untreated pigs. **c** Detection of tdTomato by PCR of genomic DNA from mammary glands injected with pMEC 24 h after the cells were transduced with CMV-tdTomato, EF1α-tdTomato or PGK-tdTomato lentivirus. Tissues were harvested 4 weeks later Oncogene-induced pMEC transformation *in vitro* {#Sec23} ----------------------------------------------- We compared the efficacy of the three promoters for expressing the Tag oncoproteins ST, MT and LT produced by splicing of the murine polyomavirus Tag. Based on the number of colonies in soft agar, the PGK promoter was most effective for directing Tag-induced transformation of pMEC *in vitro* (Additional file [4](#MOESM4){ref-type="media"}: Figure S4). When pMEC transduced with PGK-Tag, CMV-Tag or EF1α-Tag were injected as isografts, we only detected dense structures in whole mounts from all PGK-Tag engrafted glands that were evaluated (Fig. [5a](#Fig5){ref-type="fig"}; 2 pigs, 4 mammary glands total). These structures histologically resembled TDLU (Figs. [5b and c](#Fig5){ref-type="fig"}), and were positive for the expression of estrogen receptor (Additional file [5](#MOESM5){ref-type="media"}: Figure S5A), progesterone receptor (Additional file [5](#MOESM5){ref-type="media"}: Figure S5B), and epithelial cytokeratins (Additional file [5](#MOESM5){ref-type="media"}: Figure S5D) and negative for vimentin (Additional file [5](#MOESM5){ref-type="media"}: Figure S5C). Areas within and surrounding the TDLU were confirmed to be PGK-Tag positive (Fig. [5d](#Fig5){ref-type="fig"}). Subsequent experiments involving Tag utilized the PGK promoter.Fig. 5PGK-Tag transformed pMEC promote the precocious development of dense epithelial structures that resemble terminal ductal lobular units (TDLU). **a** Whole mounts of mammary glands injected with either pMEC transduced with PGK-Tag lentivirus or non-transduced pMEC (control mammary gland). **b** Densely packed structures identified by whole mount analysis of PGK-Tag engrafted mammary glands were sectioned and stained (H&E). A parenchyma-rich area from a contralateral control mammary gland is included for comparison. Scale bar =100 μm. **c** Magnification of H&E from (**a**) scale bar = 100 μm. **d** PCR detection of PGK-Tag in genomic DNA from paraffin sections of the mammary gland shown in (**b**). Positive control is genomic DNA from pMEC transduced with PGK-Tag. Negative is ddH~2~O template We next profiled Tag-induced molecular changes in pMEC. Those pMEC (*n* = 4 pigs) transduced with PGK-Tag exhibited increased proliferation and anchorage-independent growth (Figs. [6a-b](#Fig6){ref-type="fig"}). Analysis of the expression of oncogenes (LEF-1, cyclin A2, cyclin D1, myc) and tumor suppressor genes (p16, p21, Rb and p53) revealed that Tag-transduced pMEC had elevated P16 (*P* = 0.01) and cyclin A2 mRNA expression (*P* = 0.03; Fig. [6c](#Fig6){ref-type="fig"}). The LT protein was detected in PGK-Tag transduced pMEC (Fig. [7a](#Fig7){ref-type="fig"}), with upregulated TP53 (*P* = 0.007) and decreased phosphorylated Rb (*P* = 0.01; Figs. [7c-d](#Fig7){ref-type="fig"}) and a tendency for increased phosphorylated MAPK1/3 (*P* = 0.13; Fig. [7b](#Fig7){ref-type="fig"}). We also refined our transduction protocol using a vector that co-expressed tdTomato with Tag (PGK-Tag-CMV-tdTomato). We found that 55 ± 7 % pMEC transduced by PGK-Tag-CMV-tdTomato were red 7d after transduction whereas 95 ± 0.5 % were positive for tdTomato 4 weeks post-transduction (not shown).Fig. 6Pig mammary epithelial cells (pMEC) transduced with PGK-Tag lentivirus exhibit a transformed phenotype. **a** Growth of pMEC transduced with PGK-Tag (*n* = 4) and control pMEC transduced with CMV-tdTomato (*n* = 3). **b** Representative image of PGK-Tag transduced pMEC in soft agar. PGK-Tag pMEC formed 753.3 ± 30 colonies/well while CMV-tdTomato pMEC yielded no colonies. **c** pMEC transduced with PGK-Tag (*n* = 4) or PGK-Tag-CMV-tdTomato (*n* = 1) had similar expression of cyclin D1, myc, p53 and Rb and increased expression of cyclin A2 and p16 (\**P* \< 0.05) compared to control pMECFig. 7PGK-Tag transduced pMEC have altered oncogene expression. **a** Proteins from pMEC (*n* = 3), pMEC-PGKTag (*n* = 4) and an NSG mouse tumor from injection of pMEC-PGK-Tag-CMV-tdTomato cells (*n* = 1) were analyzed by western blot for ST, MT and LT. **b** Western blot of the same proteins using **b**) anti-MAPK1/3, anti-phospho MAPK1/3, anti-cyclin D1 and anti-β-actin antibodies, and **c**) anti-Rb, anti-phospho Rb, anti-p53 and anti-β-actin. **d** Protein levels from blots in **b**) and **c**) were quantified for pMEC (*n* = 3) and pMEC-PGKTag cells (*n* = 5) FACS sorting of primary pMEC {#Sec24} ---------------------------- We separated pMEC using lineage-specific markers previously used for human and mouse MEC \[[@CR32]\]. Stromal cells were removed by sorting for CD140a. The remaining pMEC were sorted as CD49f + and CD49f- that comprised 79 % and 21 %, respectively (*P* \< 0.001). The CD140a-CD49f- cells were enriched for cytokeratin-positive and vimentin-negative cells (luminal-like) whereas CD140a-CD49f + subpopulations were enriched for cytokeratin- and vimentin-positive cells (basal-like) (Additional file [6](#MOESM6){ref-type="media"}: Figure S6). Few cytokeratin-negative and vimentin-positive cells were present in CD140a^-^ CD49f + populations (0.07 % +/- 0.03, second passage). Dissociated pMEC depleted for CD140a (CD140a-, *n* = 5; Table [1](#Tab1){ref-type="table"}) and enriched for CD49f (CD140a-CD49f + *n* = 2; Table [1](#Tab1){ref-type="table"}) were transduced with PGK-Tag-CMV-tdTomato, and some further enriched for tdTomato (CD140a- tdTomato+; *n* = 3; Table [1](#Tab1){ref-type="table"}). Cells sorted for CD140a- tdTomato + exhibited red fluorescence *in vitro* (Additional file [7](#MOESM7){ref-type="media"}: Figure S7A). Transduction by PGK-Tag-CMV-tdTomato yielded transformed pMEC that gave rise to colonies able to grow in soft agar (Figure S7B) expressing ST, MT and LT (not shown). Populations of pMEC transduced by PGK-Tag-CMV-tdTomato varied morphologically *in vitro*. While CD140a-CD49f + pMEC retained a cobblestone morphology (Additional file [8](#MOESM8){ref-type="media"}: Figure S8A), CD140a^-^tdTomato^+^ pMEC were elongated (Additional file [8](#MOESM8){ref-type="media"}: Figure S8B), developed foci (Additional file [8](#MOESM8){ref-type="media"}: Figure S8C) or maintained a cobblestone morphology without foci (Additional file [8](#MOESM8){ref-type="media"}: Figure S8D). Transformed xenografted pMEC generate orthotopic and ectopic tumors {#Sec25} ------------------------------------------------------------------- To determine the tumorigenicity of transformed pMEC, all cell lines were injected into NSG mice either subcutaenously with hydrogel or Matrigel, or into the mammary fat pads. Cells injected in the fat pad, either in Matrigel or hydrogel, failed to form tumors after 36 weeks (*n* = 5; Table [1](#Tab1){ref-type="table"}). There were striking differences among tumors that formed subcutaneously following co-injection with Matrigel or hydrogel. While all transformed pMEC in Matrigel developed tumors (\>1 mm) after 4 weeks, only one line in hydrogel developed tumors after 16 weeks (Table [1](#Tab1){ref-type="table"}). Tumors from CD140a^-^CD49f + PGK-Tag-CMV-tdTomato pMEC injected with Matrigel or hydrogel were 54--74 % positive for red fluorescence (Additional file [9](#MOESM9){ref-type="media"}: Figure S9A-B). Tumors comprised mixed neoplastic glandular epithelium and nests of squamous epithelium having intracellular bridges and dyskeratosis with occasional microcalcifications and dense fibrosis (Fig. [8a-d](#Fig8){ref-type="fig"}). Immunohistochemistry for cytokeratin 8/18, Ki-67 and nuclear hormone receptors confirmed these tumors were epithelial and proliferative (Figs. [8e-f](#Fig8){ref-type="fig"}), albeit negative for estrogen receptor (Fig. [8g](#Fig8){ref-type="fig"}) and progesterone receptor (not shown). Tumors arising from CD140a- PGK-Tag-CMV-tdTomato pMEC co-injected subcutaneously with Matrigel were \<50 % red (Additional file [9](#MOESM9){ref-type="media"}: Figure S9E) and contained occasional nests of squamous epithelium mixed with glandular epithelium (Fig. [8h-i](#Fig8){ref-type="fig"}). Whole mount analysis revealed red fluorescent growths in the mammary fat pads of mice carrying CD140a- pMEC in Matrigel (6/8 injections; Additional file [9](#MOESM9){ref-type="media"}: Figure S9D) that were subsequently found to comprise non-neoplastic ducts or cysts (Fig. [8f](#Fig8){ref-type="fig"}), similar to results for normal human and bovine MEC transplanted into the mouse mammary fat pad \[[@CR31], [@CR30]\].Fig. 8Xenografted CD140-CD49+ pMEC transduced with PGK-Tag-CMV-tdTomato injected subcutaneously with Matrigel or hydrogel produce epithelial neoplasms. **a** Section (H&E) from a CD140-CD49+ PGK-Tag-CMV-tdTomato tumor in Matrigel showing neoplastic glandular epithelium. Scale bar = 600 μm. **b** Magnified encircled area in (**a**). Scale bar = 100 μm. **c** Section (H&E) from a CD140-CD49+ PGK-Tag-CMV-tdTomato tumor in hydrogel showing neoplastic glandular epithelium. Scale bar = 600 μm. **d** Magnified encircled area in (**c**). Scale bar = 100 μm. Immunolocalization of (**e**) cytokeratins 8/18, (**f**) Ki67 and (**g**) estrogen receptor in CD140-CD49+ PGK-Tag-CMV-tdTomato tumorous pMEC injected with Matrigel. Scale bar = 100 μm. **h** CD140- pMEC transduced with PGK-Tag-CMV-tdTomato develop ductal-like structures as subcutaneous xenografts. Section (H&E) depicting scattered glandular epithelium with hollow or cell-filled lumens. Scale bar = 600 μm. **i** Magnified encircled area in (**h**). Scale bar = 100 μm. **j** CD140-tdTomato + pMEC transduced with PGK-Tag-CMV-tdTomato produce epithelial-type neoplasms in mammary fat pads. Section (H&E) depicting fibrosis with neoplastic squamous epithelium. Scale bar = 600 μm. **k** Magnified encircled area in (**j**). Scale bar = 100 μm We recorded variation among growths arising from CD140^-^ pMEC instilled with hydrogel. One line of transformed pMEC only yielded microscopic fluorescent growths (Additional file [9](#MOESM9){ref-type="media"}: Figure S9E), which contained fibrosis and neoplastic squamous epithelial cells (Fig. [8j-k](#Fig8){ref-type="fig"}). A second line developed palpable mammary and subcutaneous tumors that were comprised chiefly of fibrous connective tissue. Accordingly, these tumors were strongly vimentin-positive with only scant dsRED immunoreactivity (not shown). A third line of CD140a-tdTomato + pMEC injected in hydrogel infrequently developed tumors in the mammary fat pad (1/8 injections; not shown) that comprised non-neoplastic ducts (not shown) similar to those found for pMEC co-instilled with Matrigel (Fig. [8h](#Fig8){ref-type="fig"}). Discussion {#Sec26} ========== Here we report the first successful lentivirus-mediated transgenesis and transformation of primary pMEC *in vitro* and *in vivo*. Given significant structural and functional similarities between the mammary glands of pigs and humans \[[@CR9]\], our approach is a first step toward a promising animal model in which to investigate the tissue-level cellular and environmental interactions behind human breast development and oncogenesis. A variety of genetically-engineered mouse models has enabled the identification of various genes involved in mammary cancer initiation and progression, yet the resulting tumors often differ in their pathology compared to human breast cancers \[[@CR33]\]. This discordance may reflect the greater frequency at which mouse tumors develop from alveolar structures \[[@CR33]\] compared to those of the human breast that often arise from less-differentiated TDLU-1 and -2 \[[@CR17]\]. As such, investigations into the initiation and progression of tumors within TDLU have been hampered by the absence of similar structures in the mouse mammary gland alongside the challenges associated with obtaining human tissues. Development of a pig breast cancer preclinical model stands to complement recent advances to optimize the limitations of mouse models such as the addition of human stromal elements to the mouse mammary fat pad \[[@CR34]\] and reconstitution of the mouse mammary epithelium with human preneoplastic cells \[[@CR35]\]. Our techniques enable transformation of MEC derived from the TDLU of pre- and peripubescent pigs that are synonymous with TDLU-1 and -2 in the human breast \[[@CR9]\]. Moreover, vacuum-assisted mammary biopsies \[[@CR19]\], which are impractical in rodents \[[@CR36]\], will allow serial sampling of a pig model of breast cancer to study the response to cancer treatment over time, or the influence of environmental and lifestyle factors on breast cancer risk. While a porcine pre-clinical model has limitations including increased cost and housing requirements \[[@CR36]\], these drawbacks are countered by the potential ability to authentically model normal human breast development and breast cancers within a context that is biologically and physiologically more similar to the human. The human breast and pig mammary gland have a similarly complex stromal microenvironment, which contrasts to that of the rodent mammary gland \[[@CR18]\]. Our results highlight the influence of stromal factors on the occurrence and rate of pMEC tumor formation *in vivo*. Similar to transformed human breast epithelial cells \[[@CR37]\], transformed pMEC failed to form tumors in the microenvironment of the mouse mammary fat pad despite developing tumors ectopically. Our data corroborates previous evidence showing that elements of the mouse mammary fat pad are inadequate to support proliferation of non-native epithelium \[[@CR18]\]. These data, alongside work by others \[[@CR34], [@CR31], [@CR30]\], adds to evidence highlighting differences between species in the stroma-directed behavior of the mammary epithelium. Indeed, attempts to reconstruct human \[[@CR31]\] or bovine \[[@CR30]\] mammary tissues in the mouse mammary fat pad by xenografting tissue fragments or dissociated MEC failed to generate species-specific TDLU. Given that the pig mammary gland is rich in connective tissues, co-inoculating irradiated pig stromal fibroblasts with transformed pMEC may have increased their viability when xenografted into the mouse mammary fat pad, as for human and bovine MEC \[[@CR34], [@CR38]\]. Along these same lines, Matrigel promoted transformed pMEC to form tumors, consistent with the stromal requirements of xenografts of human breast cancer cells \[[@CR39]\]. The matrix proteins found in Matrigel can support the growth of cells in a foreign environment, recapitulating the connective-tissue rich stroma of the human breast and pig mammary gland \[[@CR18], [@CR40]\]. However, unlike in humans, mammary carcinomas are extremely rare in pigs \[[@CR41]\]. This low incidence may reflect innate repressive effects of the stroma, which can restrain the tumorigenicity of undifferentiated mouse embryonic carcinoma cells \[[@CR42]\] and prevents marginally abnormal human mammary organoids developing hyperplasias in humanized mouse mammary fat pads \[[@CR34]\]. The structure and morphology of tumor stroma associated with xenografts differs from normal stroma \[[@CR43]\], suggesting that changes within tumor stroma may be more permissive. Accordingly, transformed porcine dermal fibroblasts readily formed undifferentiated sarcomas in the mammary glands of immunosuppressed pigs \[[@CR44]\], while we found that isogenic transplanted pMEC transformed by Tag failed to form palpable tumors in immunocompetent pigs (data not shown). While immunosuppression may have increased the take of transformed pMEC \[[@CR44]\], it is also possible that transformation of stromal cells is also required to induce mammary carcinomas in pigs. As such, future work to overcome these repressive mechanisms and develop the pig as an authentic breast cancer model may open up hitherto unexplored mechanisms to defeat breast cancer. We transformed pMEC by lentivirus-mediated expression of murine Tag proteins. While Tag or similar viral oncoproteins have not been directly implicated in human breast carcinogenesis, Tag activates various oncogenes and bypasses p53 and Rb \[[@CR45], [@CR46]\] as in many human breast cancers \[[@CR47], [@CR48]\]. Mammary tumors that develop from germline transgenic MT expression in the mouse mimic invasive human breast carcinomas with progressive loss of ER coincident with increased invasiveness \[[@CR49]\]. Herein, Tag-transformed pMEC developed estrogen receptor- negative, proliferative tumors when xenografted to mice. Interestingly, pMEC co-injected with Matrigel into estrogen-treated mice displayed a shorter latency to tumor formation, raising the possibility that transformed pMEC may have initially been hormone-sensitive. Given that mice carrying pMEC co-injected with hydrogel were not treated with estrogen, we cannot ascribe any differences in tumor formation rates to hormone supplementation. Nevertheless, our observations are consistent with similar findings in a mouse explant model of transgenic MT \[[@CR50]\]. Previous reports indicate that primary human MEC require disruption of multiple pathways for complete transformation \[[@CR37], [@CR51], [@CR35]\] whereas rodent cells can be transformed by two oncogenes \[[@CR52]\]. Along these lines, primary pig fibroblasts \[[@CR44]\] and human breast epithelial cells \[[@CR51]\] were transformed by sequential transduction with dominant negative p53, activated CYCLIN-dependent kinase complex (Cyclin D1/CDK4), c-Myc, H-Ras and telomerase. Our approach provides for the efficient induction of tumorigenesis in primary pMEC by lentivirus-mediated expression of Tag, which upregulates multiple oncogenic pathways. This approach led to the formation of heterogeneous tumors, perhaps as a consequence of lentiviral transduction. Along these lines, transgenic expression of MT in the mouse mammary gland induced homogenous luminal, solid adenocarcinomas \[[@CR53]\] whereas low levels of lentivirus-directed MT transformed both luminal and basal MEC, leading to concomitant heterogeneity among the tumors \[[@CR54]\]. One further explanation may be variable Tag expression within pMEC subpopulations. Consistent with this postulate, the degree of Ras expression in transformed primary human MEC correlated with tumorigenicity *in vivo* \[[@CR37]\]. Interestingly human MEC transformed with Ras-SV40 ST/LT-hTERT formed poorly differentiated squamous tumors when xenografted to the mammary fat pad of immunocompromised mice \[[@CR37]\], similar to our findings with xenografted pMEC transformed by Tag. Although squamous differentiation is rare among human breast carcinomas, it is a phenotype that has been linked to Wnt activation \[[@CR55]\], which has been associated with basal-like and receptor negative breast cancers \[[@CR56]\]. Transformation of pMEC by alternative oncogenes may yield tumors with distinct histopathologies and hormone receptor profiles. In addition, our data indicate that selecting pMEC for CD49f + enhanced the subsequent formation of luminal breast carcinomas, yielding tumors with luminal differentiated epithelium, whereas unenriched pMEC developed as normal ductal structures or fibrous tumors with and without squamous epithelium. It is possible that selection for CD49+/EpCAM+ cells in combination with culture conditions to increase ErbB3 expression over EGFR expression may increase the likelihood of generating luminal adenocarcinomas \[[@CR35]\]. Conclusions {#Sec27} =========== We have developed an approach for transforming porcine mammary epithelium. Our data point to similarities between the responses of pMEC and human MEC when xenografted to the mouse mammary fat pad, highlighting candidate differences in stromal requirements for oncogenesis across species. These studies lay the basis for investigating complex interactions underlying human breast cancer initiation and progression. Additional files {#Sec28} ================ Additional file 1: Figure S1.Plasmid maps of lentiviral vectors. (A) Map of the construct pLVX-IRES-tdTomato (CMV-tdTomato) wherein the CMV promoter directs tdTomato expression. The CMV promoter was replaced by the EF1α or PGK promoter to create EF1α-tdTomato or PGK-tdTomato. (B) To generate the pLVX-PGK-Tag-CMV-tdTomato vector, the pLVX-PGK-Tag vector was first created by replacing the IRES and tdTomato from the vector PGK-tdTomato with murine polyomavirus T antigen that encodes small T (ST), middle T (MT) and large T (LT) antigens. The CMV promoter and tdTomato coding sequence were sequentially added to the vector, creating a pLVX-PGK-Tag-CMV interim vector and the final expression vector pLVX-PGK-Tag-CMV-tdTomato. (PDF 155 kb) Additional file 2: Figure S2.Transduction of pMEC by CMV-, EF1α- and PGK-TdTomato lentivirus. (A) Representative bright field and corresponding fluorescent images of primary pMEC at passage 0, 7d after transduction by CMV-tdTomato, EF1α-tdTomato or PGK-tdTomato lentiviral constructs. (B) Quantification of cells expressing tdTomato, as a measure CMV, EF1α and PGK promoter activity in pMEC. (PDF 1353 kb) Additional file 3: Figure S3.Lentiviral integration following intraductal injection of lentivirus encoding CMV-tdTomato, EF1α-tdTomato or PGK-tdTomato (*n* = 9 pigs/lentiviral construct). Mammary tissues were harvested 5d post-injection, processed into paraffin and sections analyzed by immunohistochemical detection of dsRED (monomer of tdTomato) with using NovaRed for detection and a hematoxylin counterstain. The control section was not exposed to the dsRED antibody. The negative section is from a gland that was not injected with tdTomato expressing lentivirus. Scale bar = 100 μm. (PDF 624 kb) Additional file 4: Figure S4.The promoter of large, middle and small T antigen (Tag) expression affected the rate of anchorage-independent colony formation. Representative images from three replicate experiments to measure soft-agar colony formation by pMEC (*n* = 2 wells/construct) transduced with CMV-Tag, EF1α-Tag, PGK-Tag or CMV-tdTomato lentivirus (MOI of 100). NIH-3 T3 cells were transduced with the same constructs as a positive control. Cells transduced by CMV-tdTomato served as negative control. (PDF 508 kb) Additional file 5: Figure S5.Immunohistological features of the dense epithelial structures that appeared after isotopic engraftment of PGK-Tag transformed pMEC. Representative images detailing the expression of (A) estrogen receptor (B) progesterone receptor (C) vimentin and (D) cytokeratin. Scale bar = 100 μm. (PDF 9416 kb) Additional file 6: Figure S6.Vimentin and cytokeratin expression in CD49f-/+ populations. Representative images depicting cytokeratin (red) and vimentin (green) expression in FACS sorted pMEC. Cells affixed to glass slides were stained by immunofluorescence for both pan-cytokeratin and vimentin. (A) CD140-CD49- pMEC. (B) CD140a-CD49f + pMEC at passages 2 (P2), 3 (P3) and 5 (P5). Vimentin-only positive cells are circled. (PDF 846 kb) Additional file 7: Figure S7.Porcine mammary epithelial cells (pMEC) were transduced with PGK-Tag-CMV-TdTomato (PGK-Tag-CMV-tdT) lentivirus, cultured for 7d then sorted using a MoFlo for (A) tdTomato fluorescence. (B) The sorted tdTomato + cells were plated into a soft agar assay alongside CMV-TdTomato transduced pMEC. (PDF 1741 kb) Additional file 8: Figure S8.Representative images depicting differential *in vitro* morphology of populations of pMEC transduced by PGK-Tag-CMV-tdTomato lentivirus. Red fluorescence (RFP) is included to illustrate the percentage of transduced cells. (A) Transduced CD140a-CD49f + pMEC retained a cobblestone morphology characteristic of MEC. (B) Transduced CD140a-tdTomato + pMEC from pig 27-3 grew as elongated cells. (C) Transduced CD140- pMEC from pig 28-3 developed foci *in vitro* rather than as a monolayer. (D) Transduced CD140-tdTomato + pMEC from pig 28-6 grew as sheets of cobblestone epithelium with few foci. (PDF 1137 kb) Additional file 9: Figure S9.Bright field and red fluorescence (RFP) in a xenograft subcutaneous tumor excised from a mouse carrying CD140-CD49+ PGK-Tag-CMV-tdTomato pMEC (ss020513_1) in hydrogel (A) or Matrigel (B). Scale bar = 1 mm. (C) Bright field and RFP of a CD140- PGK-Tag-CMV-tdTomato tumor (ss082112) in Matrigel. Scale bar = 1 mm. Bright field and RFP of microscopic growths in mammary fat pads injected with CD140- pMEC transduced with PGK-Tag-CMV-tdTomato co-injected with (D) Matrigel (ss082112) or (E) hydrogel. Scale bar = 500 μm. (PDF 1166 kb) CMV : cytomegalovirus EF1α : human elongation factor 1α FBS : fetal bovine serum H&E : hematoxylin and eosin LT : large t antigen MT : middle t antigen NSG : *NOD gamma scid* mice (NOD.Cg-*Prkdc*^*scid*^ *Il2rg*^*tm1Wjl*^/SzJ) PGK : phosphoglycerate kinase pMEC : porcine mammary epithelial cells ST : small t antigen Tag : T antigen TDLU : terminal ductal lobular unit A. R. Rowson-Hodel and R. Manjarin contributed equally to this work. **Competing interests** The authors declare that they have no competing interests. **Authors' contributions** AR-H and JT prepared the manuscript and RH critically reviewed the manuscript. AR-H, JT, RM and RH designed the experiments, AR-H, RM and JT conducted the experiments and AB and RC provided technical expertise and reviewed tumor histopathology. All authors read and approved the final manuscript. We thank K. Parker, C. Sehnert and D. Sehnert for assistance with animals and facilities, E. Martínez-Alvarez, N. Breuner, A. Hanson, S. Santos, T. Lazzari and K. Scheier for technical assistance. O. Aina, N.E Hubbard, J.E. Walls at the UC Davis Center for Comparative Medicine performed the H&E stains, immunohistochemistry and provided imaging assistance. This work was supported by a grant from the Department of Defense (BC098018, to R.C. Hovey and R.D. Cardiff), and the University of California, Davis Henry A. Jastro Research Scholarship Award (A.R. Rowson-Hodel). We gratefully acknowledge the infrastructure support of the Department of Animal Science, College of Agricultural and Environmental Sciences, and the California Agricultural Experiment Station of the University of California-Davis.
Simple Wardrobe 22 January 2017 I’m a minimalist for years now, so my current actions sometimes can be not understandable, difficult or weird for people, who are starting walking this path. For this reason I’ve decided to start a series of articles called Simplicity Basics. In each article I’ll focus on one part of home or one part of our lives to make the start for new minimalists easier. Today’s subject is wardrobe. Clothes. I’ve chosen it for the start, because it’s something everyone owns. If you look at lists owned by different minimalists there are two categories that are on every list: clothes and electronics. So let’s start with clothes. Minimalist’s wardrobe How to declutter? Different ways can lead you to have a minimalist wardrobe. I think the easiest and the quickest way is to observe and note what you wear. After for example a month of noting what you wear, clean your closet. Keep only things that you’ve used in last 30 days. In the rest of your wardrobe you can find nice things: beautiful clothes, clothes bringing back memories, clothes that fit or suit you very, very well. But they are clothes you don’t wear! Maybe you don’t like them, maybe they’re not comfortable. If you’re not yet able to say them goodbye and sell, give or donate, then put them in a box and hide from your sight. I promise you won’t miss them. You won’t even remember those pieces. So you have your perfect minimalist wardrobe for today. How to keep your set of clothes useful and decluttered? Firstly, add anything new only when you need it. Don’t shop for fun nor just in case. Secondly, when you need to buy something (on a place of a worn out thing), use it as a chance to make your life simpler. For example don’t buy clothes that need ironing. I do so for years and my only contact with iron is when I want to be nice to my Husband! When you’re buying new clothes, think about doing laundry. Avoid colours that need being washed separately. Struggling with closet clutter? Now you can win your closet review/cleanout with Courtney Carver, the author of the Project 333! Details here. Deadline is December 16. If you’re outside the US (like me 🙂 ), you can take Courtney’s course: Dress with Less and Create Your Capsule Wardrobe. It’s available here. And I’m honored to be an affiliate partner for Courtney’s courses!
You are here Secrets of the Dead JFK: One PM Central Standard Time George Clooney narrates the Season 13 premiere, which recalls how the JFK assassination was reported by journalists on the scene in Dallas and Walter Cronkite, who anchored CBS News' coverage from New York. Included: the recollections of Dan Rather, Bob Schieffer, Marvin Kalb and Marianne Means; and former president Bill Clinton.
--- abstract: 'We present high-spatial resolution Plateau de Bure Interferometer CO(2–1) and SiO(2–1) observations of one intermediate-mass and one high-mass star-forming region. The intermediate-mass region IRAS20293+3952 exhibits four molecular outflows, one being as collimated as the highly collimated jet-like outflows observed in low-mass star formation sources. Furthermore, comparing the data with additional infrared H$_2$ and cm observations we see indications that the nearby ultracompact H[ii]{} region triggers a shock wave interacting with the outflow. The high-mass region IRAS19217+1651 exhibits a bipolar outflow as well and the region is dominated by the central driving source. Adding two more sources from the literature, we compare position-velocity diagrams of the intermediate- to high-mass sources with previous studies in the low-mass regime. We find similar kinematic signatures, some sources can be explained by jet-driven outflows whereas other are better constrained by wind-driven models. The data also allow to estimate accretion rates varying from a few times $10^{-5}$M$_{\odot}$yr$^{-1}$ for the intermediate-mass sources to a few times $10^{-4}$M$_{\odot}$yr$^{-1}$ for the high-mass source, consistent with models explaining star formation of all masses via accretion processes.' author: - 'H. Beuther' - 'P. Schilke' - 'F. Gueth' title: Massive molecular outflows at high spatial resolution --- Introduction ============ Studies of massive molecular outflows have revealed many important insights in the formation of massive stars over recent years. Based on the morphologies and energetics we can deduce physical processes taking place at the inner center of the regions. Several single-dish studies agree on the results that massive molecular outflows are ubiquitous phenomena in massive star formation and that they are far more massive and energetic than their low-mass counterparts (e.g., @shepherd1996a [@ridge2001; @zhang2001; @beuther2002b]). A point these studies disagree on is the degree of collimation of massive outflows. Based on early studies by @shepherd1996b and its follow-ups, it was believed that high-mass outflows tend to be less collimated than low-mass flows. As the outflow collimation is theoretically tightly connected with the accretion process, these studies favored the idea that massive stars might form via different physical processes, e.g., the coalescence of intermediate-mass protostars at the very center of dense evolving cluster [@bonnell1998; @stahler2000; @bally2002]. However, recent observations by @beuther2002b show that the previously claimed lower collimation of massive outflows is mostly an observational artifact caused by the larger distances of the target sources (on the average a few kpc) and too low spatial resolution of most studies. Their data taken with the IRAM 30m telescope at a spatial resolution of $11''$ are consistent with massive, bipolar outflows as collimated as their low-mass counterparts. This implies that massive stars can form in a qualitatively similar manner as low-mass stars, just with accretion rates increased by orders of magnitude. These latter observations are still based on single-dish observations, and to substantiate the scenario a statistically significant number of high-spatial-resolution interferometer studies of massive molecular outflows is necessary. As a first step in that direction @beuther2002d have observed the massive star-forming region IRAS05358+3543 with the Plateau de Bure Interferometer (PdBI) in CO(1–0), SiO(2–1) and H$^{13}$CO$^+$(1–0). They observed a massive outflow from the central object of the evolving cluster which is jet-like and highly collimated with a collimation degree of 10. This is the upper end of collimation degrees observed for low-mass outflows as well [@richer2000]. In addition to that collimated jet-like structure, they observed at least two more outflows within the same region. In another source, IRAS19410+2336, the two outflows observed at single-dish resolution split up at least into 7 separate outflows when observed with interferometers [@beuther2003a]. Similar results were observed toward G35.2 by @gibb2003. One of the main conclusions of these studies is that massive star-forming regions can appear confusing with single-dish instruments, but that it is possible to disentangle the structures with high enough spatial resolution into features well known from low-mass star formation. Contrary, other high-spatial-resolution studies of high-mass star-forming regions indicate that massive outflows can also appear morphologically and energetically different to their low-mass counterparts (e.g., @shepherd1998 [@shepherd2003]). As the high-spatial-resolution results are still based on poor statistical grounds, we pursued massive outflow studies with the PdBI[^1]. Here we present the results of two more regions – IRAS19217+1651 and IRAS20293+3952 – observed at an angular resolution as high as $1.8''$ in CO(2–1) and SiO(2–1). The two sources are part of a large and well studied sample of 69 high-mass protostellar objects at early evolutionary stages prior to producing significant ultracompact H[ii]{} (UCH[ii]{}) regions [@sridha; @beuther2002a; @beuther2002b; @beuther2002c]. The two sources were chosen because they combine different features of massive star formation: IRAS19217+1651 has a luminosity of $10^{4.9}$L$_{\odot}$ and shows a rather simple morphology with one mm continuum source associated with cm emission and H$_2$O and class II CH$_3$OH masers. Contrary, IRAS20293+3952 contains a small UCH[ii]{} region, contributing most of the bolometric luminosity ($10^{3.8}$L$_{\odot}$, @sridha), and likely a cluster of younger intermediate-mass sources triggering the molecular outflows. While the single-dish outflow map of IRAS19217+1651 shows a well-defined bipolar morphology, already the single-dish data of IRAS20293+3952 show that we are dealing with multiple outflows in that region [@beuther2002b]. Both sources cover a wide range of characteristics from intermediate- to high-mass star formation, the main source parameters are listed in Table \[sources\]. After describing the observations in §\[obs\], we present the observational results for both sources separately in §\[obs\_res\]. Then we discuss the results in the framework of massive star formation and include literature data with special regard to the position-velocity structure of massive outflows in §\[discussion\]. Finally, §\[conclusion\] draws the conclusions, summarizes the current stage of massive molecular outflow studies, and outlines main topics to be tackled in the coming years. Observations {#obs} ============ Plateau de Bure Interferometer (PdBI) ------------------------------------- We observed IRAS19217+1632 and IRAS20293+3952 in different runs from November 1999 to February 2002 with the Plateau de Bure Interferometer at 1.3mm and at 3mm in the C and D configurations with 4 antennas in 1999 and 5 antennas in 2002. The 1mm receivers were tuned to the CO(2–1) line at 230.5GHz, and the 3mm receivers covered the SiO(2–1) line at 86.85GHz. The typical system temperatures at 1.3mm are about 300K and at 3mm about 135K. The phase noise was mostly below 20$^{\circ}$ and always below 30$^{\circ}$. After smoothing the data, the final velocity resolution in both lines is 1kms$^{-1}$, adequate to sample the broad wing emission of the outflows. Atmospheric phase correction based on the 1.3mm total power was applied. For continuum measurements, we placed two 320MHz correlator units in each band to cover the largest possible bandwidths. The primary beam at 1.3mm is $22''$, and to cover both regions completely mosaics were necessary. In IRAS19217+1651 the mosaic consisted of 5 fields (offsets \[$''$\]: 19/33, 12/24, 6/14, 0/4, -5/-6) and in IRAS20293+3952 of 8 fields (offsets \[$''$\]: 24/10, 12/7, 2/4, -10/1, 36/15, 32/3, 32/-9 32/-20) with respect to the phase reference centers listed in Table \[sources\]. The somewhat peculiar V-shaped mosaic for IRAS20293+3952 was chosen based on the previous single-dish observations [@beuther2002b]. Temporal fluctuations of the amplitude and phase were calibrated with frequent observations of the quasars 1923+210, 2032+107 and 2013+370. The amplitude scale was derived from measurements of MWC349 and 3C345, and we estimate the final flux density accuracy to be $\sim 15\%$. Synthesized beams at the different wavelengths are listed in Table \[beams\]. Short spacings with the IRAM 30m telescope ------------------------------------------ To account for the missing short spacings and to recover the line-flux, we also observed the source in CO(2–1) at $11''$ resolution with the IRAM 30m telescope in Summer 2002. The observations were done remotely from the Max-Planck-Institut für Radioastronomie (MPIfR) Bonn in the on-the-fly mode. Typical system temperatures at 1.3mm were around 400K, the data were sampled in $4''$ increments (Nyquist sampling is $\frac{\lambda}{2D} \sim 4.5''$) and the velocity resolution was 0.1kms$^{-1}$. The algorithm to derive visibilities from the single-dish data corresponding to each pointing center is described by @gueth1996. The single-dish and interferometer visibilities are subsequently processed together. Relative weighting has been chosen to minimize the negative side-lobes in the resulting dirty beam while keeping the highest angular resolution possible. Images were produced using natural weighting, then a CLEAN-based deconvolution of the mosaic was performed. Synthesized beams of the merged data are listed in Table \[beams\]. It should be noted that only the CO(2–1) data have been complemented by short spacing data from the 30 m telescope whereas we did not get these data at 3mm. Nevertheless, at 3mm the short-spacings problem is less severe because the interferometer samples larger regions at lower frequencies. Observational results {#obs_res} ===================== For both sources we detect bipolar outflows in CO(2–1) and SiO(2–1) (Figs. \[19217\_co\] & \[20293\_co\]). While IRAS19217+1651 is dominated by one extremely energetic outflow, IRAS20293+3952 exhibits one collimated jet-like outflow and at least three more outflows. Before discussing their implications for massive star formation we present each star-forming region separately. IRAS19217+1651 {#19217} -------------- ### Millimeter Continuum {#cont_19217} Even at the highest spatial resolution of $\sim 1.5''$ the mm continuum emission of IRAS19217+1651 remains single-peaked and does not split up into multiple sub-sources (Fig. \[19217\_cont\]). The millimeter continuum fluxes are given in Table \[continuum\]. Comparing the 1.3mm flux obtained with the PdBI and the 1.2mm single-dish fluxes [@beuther2002a] we estimate that about $80\%$ of the total continuum flux is filtered out by the interferometer. Compact cm continuum emission and 22GHz H$_2$O and 6.7GHz Class II CH$_3$OH maser emission observed with the VLA and ATCA [@sridha; @beuther2002c] peak at the mm continuum source [^2]. It has to be taken into account that IRAS19217+1651 is five times further away than IRAS20293+3952, and thus we cannot resolve as much structure. Nevertheless, the spatial coincidence of mm/cm continuum emission and the two maser species suggests that the region is dominated by one massive evolving protostar at the cluster center. Assuming optically thin dust emission at mm wavelength, we calculate the mass and peak column density using the 1.3mm data following the procedure outlined for the single-dish dust continuum data by @beuther2002a. Recent studies indicate that the dust opacity index $\beta$ could be lower than the canonical value 2 at the core centers of massive star-forming regions (@goldsmith1997 and references therein; @beuther2004b [@beuther2004e; @kumar2003]). Unfortunately, we cannot properly differentiate between the dust and free-free contributions in the mm regime toward IRAS19217+1615, and thus not derive $\beta$ explicitly for this source. Based on the other studies we set $\beta$ to 1. We use a dust temperature of 38K as derived by SED fits to the IRAS data [@sridha]. As discussed by @beuther2002a, the errors of the estimated masses and column densities are dominated by systematics like the exact knowledge of $\beta$ or the temperature. For example, reducing $\beta$ from the canonical value of 2 to 1 lowers the estimated mass by about one order of magnitude. We estimate the masses and column densities to be correct within a factor 5-10. The total gas mass of the central core observed at 1.3mm with the PdBI is around 220M$_{\odot}$, and the peak column density of the order a few times $10^{23}$ cm$^{-2}$ corresponds to a visual extinction $A_{\rm{v}} = N_{\rm{H}}/2\times10^{21} \sim 600$ (Table \[continuum\]). ### The molecular outflow {#outflow_19217} Figure \[19217\_co\] presents the merged PdBI+30m CO(2–1) outflow image obtained for IRAS19217+1651. We observe a bipolar outflow emanating from the mm core with the main blue emission to the south-west and the main red emission to the north-east. The gas with the highest velocities ($\pm 30$kms$^{-1}$) is located at the core center, however we find high velocity gas offset from the core as well (see below, Figure \[pos\_velo\]). The overall collimation of the outflow is pretty high with a collimation degree $\sim 3$ (length of the outflow divided by its width). The morphology of the blue outflow wing resembles a cone-like structure. The red wing to the north-east shows an elongated feature with a P.A. of $40^{\circ}$ with respect to the main outflow axis. The morphology of the red wing is quite different compared with the blue wing, and one can get the impression that in this area might be a second outflow in the north. However, the mass contained in the red wing is very high ($\sim 50$M$_{\odot}$, Table \[outflows\]), and it is difficult to imagine such a massive and energetic outflow without a mm continuum source as the counterpart (the $3\sigma$ rms of 7.5mJy corresponds to a mass sensitivity of 4.3M$_{\odot}$). Therefore, we conclude that the red and blue wing emission is part of the same outflow emanating from the massive mm core. The different morphologies to the north and south are likely attributed to environmental differences. The SiO(2–1) emission shown in Figure \[19217\_co\] exhibits a similar outflow morphology as the CO observations but missing the broad lower intensity outflow emission depicted in CO. As SiO is mainly a shock tracer [@schilke1997a] it is likely that SiO is not excited in the outer regions of the outflow. However, it should be mentioned that this difference might also be an observational artifact because we do not have the short spacings data for SiO and thus the larger scale SiO outflow emission could be filtered out by the interferometer. Furthermore, due to the larger primary beam of the PdBI at 3mm compared to 1mm ($59''$ and $22''$, respectively) we observe a larger field in SiO and detect an additional bipolar structure in the west not covered by the CO data. We do not detect a mm continuum source there (the 3mm continuum covers the same field). Nevertheless, it is likely that a mm continuum source is simply too weak and not detected due to insufficient signal to noise. Adopting the same assumptions outlined in §\[cont\_19217\] for the 3mm continuum data, the $3\sigma$rms of 2.4mJy corresponds to a mass sensitivity of $\sim 30$M$_{\odot}$. IRAS20293+3952 {#20293} -------------- ### Millimeter Continuum {#cont_20293} Figure \[20293\_cont\] presents the mm continuum data for IRAS20293+3952 and additionally the cm and H$_2$O maser emission in that region. Obviously, the overall picture is different from IRAS19217+1651. We find three mm continuum sources with an H$_2$O maser associated with the strongest of them. Furthermore, offset from the mm emission there is a resolved cm source indicating a more evolved UCH[ii]{} region. We do not detect any mm continuum emission at the position of the UCH[ii]{} region down to the $3\sigma$ rms sensitivity limit of 13.5mJy, corresponding to a mass sensitivity of 0.2M$_{\odot}$ assuming optically thin dust emission. Instead of one source dominating the whole region (§\[cont\_19217\]) IRAS20293+3952 exhibits four sources possibly interacting with each other. Comparing the interferometric and single-dish fluxes [@beuther2002b], nearly $90\%$ of the total flux is filtered out in IRAS20293+3952, even more than in IRAS19217+1651. Assuming optically thin dust emission with a dust temperature of 56K [@sridha] using again the dust opacity index $\beta=1$ (§\[cont\_19217\]) we derive masses and column densities for the three mm clumps. The masses of each clump listed in Table \[continuum\] are about two orders of magnitude below the value derived for IRAS19217+1651 whereas the beam averaged column densities are of the same order, only lower by factors of 2-6. The clump masses between 1 and 3M$_{\odot}$ appear low regarding the overall luminosity of the region of $10^{3.8}$L$_{\odot}$. However, the luminosity is measured with the large IRAS beam and thus comprises also the nearby UCH[ii]{} region. Assuming the cm emission to be optically thin, @sridha estimated the stellar luminosity of its central source to be close to the infrared-derived value. Therefore, while it is possible that we partly underestimate the mass of the dust cores in IRAS20293+3952, it seems obvious that the dominant luminosity source is the UCH[ii]{} region. The mm sources nearby, which trigger all the spectacular outflows, form a kind of secondary cluster of intermediate-mass sources. ### Four molecular outflows {#outflow_20293} As the millimeter continuum, the outflow emission in IRAS20293+3952 is more complex than in IRAS19217+1651 as well. The CO velocity spread down to zero intensity with $\Delta v \sim 92$kms$^{-1}$ in IRAS20293+3952 is also larger compared to $\Delta v \sim 64$kms$^{-1}$ in IRAS19217+1651. Figure \[20293\_co\] shows three images of the CO red and blue outflow emission (extreme outflow velocities, moderate outflow velocities, and all outflow velocities), it also sketches the four outflows identified in that region. Figure \[20293\_sio\] shows the SiO(2–1) emission of the region. As the region is complex not all identifications are unambiguous and some features can belong to one or the other outflow, or even outflows which we do not identify yet. Our outflow identifications are based on the CO and SiO morphology and the assumption that there are no other outflow-powering sources than mm1 to mm3. [*Outflow (A):*]{} The most prominent feature in Figure \[20293\_co\] is the collimated jet-like outflow emanating from mm1 in south-west–north-eastern direction. Especially interesting is the red wing with its extreme collimation extending about 1pc in length. The collimation degree of this red wing is $\sim 8$ as high as known values for the most collimated low-mass outflows [@richer2000]. Figure \[red\_20293\] shows a close-up of moderate and extreme velocities for the red emission stressing that the higher-velocity gas is more collimated than the lower-velocity gas. The ratio of the projected width perpendicular to the outflow direction of the moderate-velocity gas versus the extreme-velocity gas is $\ge 2$. This morphology resembles the observations of low-mass outflows [@bachiller1996]. It is unlikely that the moderate-velocity gas is strongly confused by the ambient gas because the chosen velocity interval \[13,25\]kms$^{-1}$ for the moderate-velocity component is still significantly offset from the velocity of rest $v_{\rm{LSR}}=6.5$kms$^{-1}$. Furthermore, Figure \[pos\_velo\] presents a position velocity diagram of outflow (A), and we find high-velocity gas at the outflow center as well as at the very end of the red wing. The morphology of the blue wing is less clear which might be partly due to the smaller extend of the mosaic in that direction (§\[obs\]). The blue feature highlighted with the dashed arrow in Fig. \[20293\_co\] could be part of a larger cone of the blue wing of (A), but it is also possible that there is another outflow consisting of this blue feature and maybe the northern red feature we so far associate with outflow (D). [*Outflow (B):*]{} A second outflow emanates from mm1 in south-eastern direction. The blue CO emission is only observed at a distance of $\sim 20''$ but SiO is observed right to mm1. While the blue emission is strong we do not observe red emission to the north. Partly, this should be due to the small extend of the PdBI mosaic in that direction (§\[obs\]). [*Outflow (C):*]{} We observe a third small outflow emanating from mm3 in east-west direction. [*Outflow (D):*]{} The fourth outflow (D) likely emanates from mm2 and is more or less parallel to outflow B. Again, we see strong blue emission toward the south-east but less red emission toward the north-west. As already mentioned in the context of outflow (A), the red feature in the north could also be part of still another outflow emanating from mm1 with the blue counterpart shown in dashed contours.\ [*Shocked H$_2$ emission:*]{} Additionally interesting is a comparison of the outflow data with shocked H$_2$ emission at 2.12$\mu$m. The near-infrared H$_2$ data were taken with the Omega Prime camera on the Calar Alto telescope within the observations of a large sample of massive star-forming regions, the basic data reduction is described in a separate paper by Stanke et al. (in prep.). Figure \[20293\_h2\] presents an overlay of the H$_2$ emission with the CO outflow data and the cm source outlining the UCH[ii]{} region. We can distinguish a few regions of prominent H$_2$ emission: first, we find H$_2$ features associated with the blue CO emission of outflows (A) and (B). Furthermore, we clearly identify ring-like H$_2$ emission around the UCH[ii]{} region. Judging from the morphology, the red CO outflow (A) bends partly around that ring-like structure. In addition, there are strong H$_2$ emission knots between mm2 and mm3 which could be associated with outflows (C) and (D), but which may also be part of the ring-like H$_2$ emission. Discussion ========== Molecular outflows ------------------ ### Masses and energetics The CO(2–1) data allow to estimate the masses and energetics of the different outflows in both sources. However, for IRAS20293+3952 it is not always clear whether emission belongs to one or the other outflow. For example, the emission right at the center of mm1 can be part of the outflows (A) as well as (B). Most likely, both outflows contribute to the observed emission. Similarly, the emission between mm2 and mm3 could be part of the outflows (C) and (D). In the following calculations these regions of overlap are always attributed to both contributing outflows. We calculate opacity-corrected H$_2$ column densities in both outflows following the approach outlined in @beuther2002b. The average temperature in the outflows is set to 30K and the average line opacity in the outflow wings to $\tau (^{13}$CO $2-1)=0.1$ (based on observations by @choi1993). According to @cabrit1990 derived masses are accurate to a factor 2 to 4, whereas the accuracy of dynamical parameters are lower, at about a factor 10. The derived masses and energetic parameters for the outflows in both sources are presented in Table \[outflows\]. A comparison of the outflow mass $M_{\rm{out}}=75$M$_{\rm{\odot}}$ in IRAS19217+1651 with the single-dish observations derived value of 108M$_{\rm{\odot}}$ [@beuther2002b] shows that both values agree within 25$\%$. This gives confidence that the merging process of the PdBI data with the single-dish observations worked reasonably well and we recovered most of the outflow emission. Such a comparison is more difficult for IRAS20293+3952 because the single-dish data did not resolve the multiple outflows. The values presented in Table \[outflows\] confirm that IRAS19217+1651 powers a very massive and energetic molecular outflow on pc scales. The derived outflow rate $\dot{M}_{\rm{out}}$ is of the order $10^{-3}$M$_{\rm{\odot}}$yr$^{-1}$. Under the assumption of momentum driven outflows this leads to an estimate of the accretion rate of the order a few times $10^{-4}$M$_{\rm{\odot}}$yr$^{-1}$ (for details on the assumptions see @beuther2002b). Accretion rates of that order are high enough to overcome the radiation pressure of a forming star and build the most massive stars via accretion processes (e.g., @norberg2000 [@mckee2003]). The outflow parameters for IRAS20293+3952 are all about one order of magnitude below the values for IRAS19217+1651. They are higher than typical masses and energetics in the low-mass regime [@richer2000] but below often observed parameters for massive outflows [@shepherd1996b; @ridge2001; @beuther2002b; @gibb2003]. The outflows emanate from a cluster of intermediate-mass protostars right in the vicinity of a more evolved UCH[ii]{} region. The data show that the UCH[ii]{} region is too evolved to trigger any collimated outflow. Thus, although most of the bolometric luminosity stems from the UCH[ii]{} region, nearly all the mechanical force $F_{\rm{m}}$ and mechanical luminosity $L_{\rm{m}}$ (Table \[outflows\]) is due to the outflows from the intermediate-mass cluster. Based on the outflow rate $\dot{M}_{\rm{out}}$ we can again estimate accretion rates between $10^{-5}$ and $10^{-4}$M$_{\rm{\odot}}$yr$^{-1}$, right between typical values for low- and high-mass star-forming regions. ### Dynamical interactions in IRAS20293+3952 The presence of four molecular outflows emanating from three mm continuum sources, and one UCH[ii]{} region within less than 1pc projected on the plane of the sky reveals multiple regions of interaction. Obviously, the CO and SiO emission around the mm sources is caused by different interacting molecular outflows, but the UCH[ii]{} seems to affect the outflows as well. Assuming that the ring-like shocked H$_2$ emission is caused by the star powering the central UCH[ii]{} region, its sphere of influence extends as far as outflow (A) and the mm sources mm2 and mm3. The H$_2$ emission between mm2 and mm3 might thus not be just due to the outflows (C) and (D) but there may also be contributions from the UCH[ii]{} region. With the data so far, we cannot unambiguously conclude whether the spatial association of mm2 and mm3 with the H$_2$ ring is simple coincidence or whether the formation of mm2 and mm3 might even be associated with some triggering mechanism from the UCH[ii]{} region. Even more intriguing is the spatial bending of the red wing of outflow (A) right north of the UCH[ii]{} region. Figure \[20293\_h2\] shows that this bending follows largely the ring-like H$_2$ feature in that region. This could be just due to projection effects, but it is also possible that an expanding pressure wave from the UCH[ii]{} region intercepts with outflow (A) and pushes its gas slightly to the north. The radius of the H$_2$ shell is about $7.7''$ corresponding to 15000AU at a distance of 2kpc. Position-velocity diagrams of massive outflows ---------------------------------------------- Position-velocity (p-v) diagrams are often used as a tool to understand the driving mechanisms of outflows (e.g., @smith1997 [@downes1999; @lee2001; @lee2002]). In addition to p-v diagrams of outflows presented in this paper, Figure \[pos\_velo\] shows p-v diagrams of two other massive outflow sources taken from the same initial source sample: IRAS23033+5951 observed in CO(1–0) with BIMA by Wyrowski et al. (in prep.) and IRAS20126+4104 observed in CO(2–1) with the IRAM 30m by Lebron et al. (in prep.). For details on the outflow characteristics, we refer to the corresponding papers, here we are only interested in their p-v diagrams. The range of outflow masses for these four outflows is broad, from intermediate masses in IRAS20293 to very high masses in IRAS23033 ($M_{\rm{out}}=119$M$_{\odot}$, Wyrowski et al., in prep.). The bolometric luminosities also vary by orders of magnitude: outflow (A) in IRAS20293 is driven by an intermediate-mass protostar, and the bolometric luminosities of IRAS20126, IRAS23033 and IRAS19217 are $10^{3.9}$, $10^{4.0}$ and $10^{4.9}$L$_{\odot}$, respectively. Admittedly, the statistical number of presented outflows is low, but nevertheless we cover a broad range of luminosities and masses and can compare these data with theories and previous studies in the low-mass regime. We observe mainly two features in the p-v space: first of all, high-velocity gas is detected at the outflow centers in IRAS19217 and IRAS20293. There is some high-velocity gas in IRAS23033 near the center as well, but the red and blue is shifted spatially to the other side of the outflow center compared with the larger scale flow, thus this high-velocity gas might be due to a second outflow spatially just barely resolved (Wyrowski et al., in prep.). IRAS20126 does not show any high-velocity gas near the outflow center. Secondly, we observe high-velocity gas at some distances from the core center: IRAS23033 exhibits the so-called Hubble-law in the blue wing, i.e., a velocity increase with distance from the core center. In IRAS20293, the velocity also increases gradually with distance in the red wing, and the emission feature at the very end of the collimated outflow shows emission at all velocities again. In IRAS20126, we see a gradual velocity increase and then decrease again with distance from the core center, this is the only source where the p-v diagram is rather symmetric. IRAS19217 shows some high-velocity features at distances from the center as well, but there is no real symmetry with respect to the core center. We compare our data with high-spatial-resolution observations of low-mass outflows by @lee2000 [@lee2002]. They observed 10 low-mass sources and found mainly two kinematic features in the p-v diagrams: parabolic structures originating at the driving source and convex spur structures with high-velocity gas near H$_2$ bow shocks. While the parabolic structures can be explained by wind-driven models the spur structures are attributed to jet-driven bow-shock models [@lee2000; @lee2001; @lee2002]. While some outflows show clear signatures of one or the other model, there are also a few sources which exhibit signatures of both. @lee2002 propose that a combination of a jet- and wind-driven model might explain all features in a more consistent way. In their first published sample, they see nearly no central high-velocity gas [@lee2000], whereas in later published sources some central high-velocity gas is observable [@lee2002]. High-velocity features at the core centers are likely due to jets but they can also be mimicked by highly inclined winds (Fig. 10, @lee2001). Transferring the low-mass and simulation results to our data, we find clear spur and Hubble-law jet-signatures in IRAS20293 and IRAS23033, whereas IRAS20126 can be explained by a wind-driven model (e.g., compare with RNO91, Fig.10, in @lee2000). IRAS19217 is a less clear-cut case because we find the jet-indicating high-velocity gas at the core center but also features further outside which resemble more the parabolic structures indicative of wind-driven models. Morphologically, the IRAS19217 outflow is also somewhat intermediate between a collimate jet-like outflow and cavity-like features indicative rather of a wind (Figure \[19217\_co\]). Likely, both mechanisms contribute to the observed outflow in IRAS19217. To summarize, our intermediate- to high-mass outflow data show kinematic signatures which can be explained by jet- and/or wind-driven models. We do not find any striking difference to low-mass position-velocity diagrams. Similar to their low-mass counterparts, no single model is yet capable to explain all observations consistently. Conclusions {#conclusion} =========== The presented analysis of high-spatial-resolution observations of intermediate- to high-mass molecular outflows indicates that the outflow morphologies/kinematics and thus their driving mechanisms do not vary significantly compared to their low-mass counterparts. The higher the source luminosity the more energetic the outflows, but the qualitative signatures are similar. These observations indicate that similar driving mechanisms can be responsible for outflows of all masses. We find an extremely collimated jet-like outflow emanating from the intermediate-mass source mm1 in IRAS20293+3952. This outflow shows the highest degree of collimation at highest velocities and slightly lower collimation at lower velocities, similar to low-mass sources [@bachiller1996]. The whole region IRAS20293+3952 shows many signs of dynamical interactions, not only between the different outflows (at least four) but there are also indications of a shock wave from the nearby UCH[ii]{} region interacting with the collimated outflow. While the UCH[ii]{} region is the main source of luminosity in IRAS20293, most of the mechanical force stems from the outflows of the intermediate-mass sources. The high-mass source IRAS19217+1651 shows a nice bipolar outflow, slightly less collimated than the outflow (A) in IRAS20293, but still comparable to many low-mass flows. This region is strongly dominated by the central core which exhibits mm/cm continuum emission as well as H$_2$O and CH$_3$OH maser emission. Position-velocity diagrams of molecular outflows from intermediate to high masses show similar signatures as known for low-mass outflows. Some sources are better explained by jet-driven outflows whereas others seem to be due rather to wind-driven outflows. IRAS19217 exhibits signatures of both. The proposal from @lee2002 that a combination of both driving mechanisms can explain all outflows consistently also holds for our sample. Estimated accretion rates are of the order a few times $10^{-5}$M$_{\odot}$yr$^{-1}$ for the intermediate-mass sources in IRAS20293 and a few times $10^{-5}$M$_{\odot}$yr$^{-1}$ for the high-mass source IRAS19217, consistent with models forming stars of all masses via accretion (e.g, @norberg2000 [@mckee2003]). The data presented in this paper further support the idea that massive stars form via similar accretion-based processes as their low-mass counterparts. The main difference appears to be their clustered mode of formation and increasing accretion rates and energetics with increasing stellar mass and luminosity. However, investigations of the most massive stars is just beginning, and studies like this one so far rarely exceeded sources with luminosities $>10^5$L$_{\odot}$. This is to a large degree due to the fact that there simply do not exist many sources with far higher luminosity which are in a state of evolution prior or at the very beginning to form a significant UCH[ii]{} region. Therefore, on the one hand we have to extend massive star formation research significantly to even higher luminosities to confirm the present results or to identify possible differences in that regime. On the other hand, the constrains set on the massive star-forming processes are yet mostly indirect, e.g., observing molecular outflows on large scales and inferring the processes likely taking place at the cluster centers. As the spatial resolution and sensitivity of (sub-)mm interferometers increase steadily, it is now necessary to really study the cluster centers and try to resolve the relevant processes in more direct ways. For example, massive disk which are crucial to explain the observed outflows need to be properly identified, resolved and studied to manifest its physical conditions. Furthermore, the strong radiation of the massive protostars significantly changes the chemistry of those central regions. The broad bandwidth and high spatial resolution of current and future (sub-)mm interferometers (SMA, PdBI, CARMA, and further on ALMA) will shed light on many such processes. We like to say thank you very much to Thomas Stanke, Friedrich Wyrowski and Mayra Lebron for providing the H$_2$ data and two of the p-v diagrams prior to publication. We also thank G. Paubert from the IRAM 30m telescope for help with the single-dish data. Furthermore, we thank the referee for helpful comments improving the presentation of the paper. H.B. acknowledges financial support by the Emmy-Noether-Program of the Deutsche Forschungsgemeinschaft (DFG, grant BE2578/1). [lrrrrrrrr]{} 19217+1632 & 19:23:58.78 & 16:57:36.52 & 3.5 & 10.5 & $10^{4.9}$ & 9500 & 108 & $3.6\,10^{47}$\ 20293+3952 & 20:31:10.70 & 40:03:09.98 & 6.3 & 2.0 & $10^{3.8}$ & 460 & 9 & $7.8\,10^{46}$ [lrrrr]{} 19217+1632 & 1.3 cont & PdBI & $1.58\times 1.43$ (32$^{\circ}$) & $\sim 16600 \times 15000$\ 19217+1632 & 1.3 line & PdBI+30m & $1.93\times 1.69$ (51$^{\circ}$) & $\sim 20300 \times 17700$\ 19217+1632 & 3 cont & PdBI & $4.93\times 3.78$ (58$^{\circ}$) & $\sim 51800 \times 39700$\ 19217+1632 & 3 line & PdBI & $6.05\times 4.91$ (71$^{\circ}$) & $\sim 63500 \times 51600$\ 20293+3952 & 1.3 cont & PdBI & $1.91\times 1.75$ ($-101^{\circ}$) & $\sim 3800 \times 3500$\ 20293+3952 & 1.3 line & PdBI+30m & $1.96\times 1.79$ (84$^{\circ}$) & $\sim 3900 \times 3600$\ 20293+3952 & 3 cont & PdBI & $5.10\times 4.31$ (50$^{\circ}$) & $\sim 10200 \times 8600$\ 20293+3952 & 3 line & PdBI & $5.10\times 4.36$ (49$^{\circ}$) & $\sim 10200 \times 8700$ [lrrrrrrr]{} 19217+1632 & & 56 & 68 & 100& 379 & 216 & 6$10^{23}$\ 20293+3952 & 1 & 13 & 19 & 95 & 201 & 3 & 2$10^{23}$\ 20293+3952 & 2 & 7$^a$ & 12$^a$ & 47 & 92 & 1 & 1$10^{23}$\ 20293+3952 & 3 & – & – & 37 & 76 & 1 & 1$10^{23}$ [lrrrrrrrrrrr]{} 19217+1652 & 24.4 & 50.4 & 74.8 & 2210 & 68 & 1.6 & 48200 & 1.5e-3 & 4.6e-2 & 116\ 20293+3952(A) & 1.3 & 0.7 & 2.0 & 90 & 4.1 & 0.20 & 4300 & 4.5e-4 & 2.1e-2 & 79\ 20293+3952(B) & 1.0 & 0.0 & 1.0 & 46 & 2.1 & 0.17 & 3700 & 2.7e-4 & 1.2e-2 & 46\ 20293+3952(C) & 0.2 & 0.1 & 0.3 & 9 & 0.2 & 0.06 & 2100 & 1.5e-4 & 4.1e-3 & 9\ 20293+3952(D) & 0.8 & 0.1 & 0.9 & 22 & 0.6 & 0.31 & 12600 & 6.8e-5 & 1.7e-3 & 4 [^1]: IRAM is supported by INSU/CNRS (France), MPG (Germany), and IGN (Spain). [^2]: @beuther2002c presented a similar image with the cm source and one H$_2$O maser feature being $\sim 5''$ offset to the east. Unfortunately, the astrometry in their image was wrong, here we present the correct positions.
"likes to steal and is currently totally fucked?" "You guessed it." "Me." "NeaI Bannen." "My father always called me a quitter." "I had to live with that my whole life." "Now, you've probably got a lot of questions." "Like, why is he fucked?" "Why is he smoking in a Nicotine Anonymous meeting?" "And who is that?" "So, that's Madison, by the way, and we'll get to her and why she's got my wallet a little later." "For now, just know that I had every intention of getting out of the criminal lifestyle." "My friends in the back." "We welcome you." "Maybe some new friends." "So I'm guessing you don't have" " the 150 G's to pay Sonny." " Where's the fucking money, Bannen?" "That's why you're pretending like you don't see us" " when we're chasing you all over the city." " Now you can beg for mercy." "Not exactly, guys." "Kill me if you want, but if you give me a week, I'll give you an extra 100 G's." "Wait, wait, wait, hold on." "I'm getting way ahead of myself here." "So I should probably mention that the goons work for the notorious prison gangster Sonny Carr, who I owe a little money to." "Don't let his Latin flair fool you." "He will shoot you in the face." "Let me back up a bit." "We got the studio loft job, hot chick that works at front desk," "Mr. B trying to hunt me down." "Right, this is probably a good time to bring up Mr. B and how I used to work for him before I went freelance." "He's a man of many virtues." "Patience isn't one of them." "Anyway, I'm trying to triple my money..." "Right, so here we are at the beginning." "I had 50 G's to my name, but I owed Sonny 150." "Today." "I had one last job lined up but I figured, hey, why not play a little cards, triple my money, and then pay off my debts the honorable way?" "In these situations, I always think of Grandpa's principles, which he liked to call the Bannen Way." "Let me give you an example." "I know what you're thinking," ""If you owe Sonny 150,000 and you've got that in your hands," ""you should probably quit. " But, hey, we're all human." "I'm all in." "Hey, Bannen, it's Zeke." "Where the hell are you?" "Did you forget we have our last job today?" "Get down to the studio complex downtown, all right?" " It's D-day, Zeke, and we're a little short." " What are you talking about?" "We've got two seconds flat to pull off this job and you're talking to me about short?" "I had kings." "What was I supposed to do, fold?" "I'm here." "Let's just visualize the game plan." "All right, let's do this." "When you get in the lobby, you're gonna convince the manager" " to give you the key to Haskell's studio loft." " So I'm impersonating this Haskell guy?" "Right." "Go out the back." "On your left will be a building." "Down the hall, and you're looking for J345." "You're gonna look for a laptop on a desk." "You take care of the transfer, I'll take care of the rest." "Hey, Bannen, I know you said we were done working for Mr. B, but..." "You're seriously bringing up Mr. B right now?" "All right, yeah." "Don't get all yelly at me." " I just thought that maybe he could help." " Not an option." "Roger that." "All right, we'll just focus on the studio job." "Do you have your video feed glasses?" "And roger that." " All right, work your magic, Bannen." " Sorry." "Shit." "Shit!" " Hello." " What happened to the regular manager?" " Hi." " I seem to have lost my key." "I must have left it in my..." "Jesus." "Those eyes." " Let me just verify your info." " Okay, tell her your name is Allen Haskell." "Haskell, Allen." "A" " L-L-E-N." "Can I get a date?" "Of birth?" " Keep your pants on, Bannen." "It's 4-22-47." " Sure." "4-22-47." " You look fantastic for 60, by the way." "Unfortunately, we don't have any spare keys." "What?" "No." "She's new." "She doesn't know what she's talking about." "But I do have the master key." "No, no, no, no!" "That is not an option." "Tell her to look in the drawer." "Should I escort you myself?" ""No, thank you, ma'am, but if you'll just check the desk drawer... "" " Tell her that, Bannen." " Okay." "Okay?" "It's not okay!" "It's not okay at all!" "You need to focus." "Please listen to me." "Oh, God, Bannen, we have a job to do." "You're going to blow this whole job." "You will not engage with this girl." "Okay, all right, now that she's let you in, you will say, "Thank you and good day," but you will not engage!" "All right, just listen to me, neal Bannen." "All right?" "We have a job to do." "Do not, I repeat, do not..." "Oh, God." "He engaged." "Hey." "Okay, Bannen..." "Bannen, I need you to focus right now." "Find the laptop." "We have a small window of time here." "I have some quick business to do." "Oh, God." "One second, one second." " Dude, get in here." " Go!" "Get out!" "Get out!" "Bannen, thank you, thank you, thank you." "Okay, go to the accounts folder." "That's it." "That's it right there." "Now, set up the transfer to the external and I'll take care of the rest, all right?" " Looks like there's two more accounts." " No, no, no." "No other accounts, Bannen." "There's only one unsecured." "All right?" "We don't have time for other accounts." "I don't care." "Let's do it." "Bannen, how about this?" "Get the 100,000." "All right, Bannen, remember what your grandfather used to say," ""A winner knows when to quit, a loser quits too early or too late,"" "as in quit having sex now!" "All right, if you go for more than one account, they're gonna freeze all three and we're gonna wind up with nothing." "Shit!" "Haskell just entered the building." "Bannen, I need to know if we're going after the one account." "We're just going after the one account." " Yeah." " Yeah!" "Is that a "yeah" to me on the one account or to the girl?" " Yes!" " Okay." "Now, B, get out of there now!" "He's walking down the hall!" "He's walking down the hall!" "Please, please get out of there right now, all right?" "This isn't funny, man." "Get out of there right now!" "Please get out!" "Go, go, go!" " Yes!" " Yeah!" " Dirty boy!" " Yeah!" "Allen!" "Transfer is complete." "On both our ends." "Thanks, bro." "Biggest pimp ever." "Hey, Neal." "Get in." "Your uncle wants to talk to you." "When a mob guy probes you for answers, you gotta watch what you say." "When he's your uncle, well, same deal, just slightly more uncomfortable." "I understand you've gotten yourself in a bit of trouble with Sonny." " Nothing I can't handle." " Manni, have Veronica join us." "Drink?" "Yeah, the old falling off the wagon thing." "I've never seen this shot with you and my folks." "Happier times." "Now, you should know this." "As a rule, I don't go to anybody." "I make them come to me." "That was another one of Granddad's principles." "So next time I call, answer the goddamn phone." "I'm better with texting." "Your charm has really run out, though, with your friend Sonny." "If it was up to him, you'd be floating in the river." "What do you owe him?" "Would $250,000 cover it?" "How about 500?" "Let's just make it the American dream." "$1,000,000." "Neal Bannen, millionaire." "I'm offering you a chance to square your debt." "Maybe a little place in the Bahamas, fancy cars, women." " Or whatever you want." "I don't care." " Sounds intriguing." "Suffice it to say, that box is a valuable piece of merchandise." "Yeah, I think I saw one of these at Ikea." "Yeah, The Mensch." "Though he is heavily guarded, he will not be expecting someone like you." "Wait." "Hold up." "You want me to steal the box from The Mensch?" "The Mensch was a former rabbi who later found a home in the Jewish mob." "And he also got into the sex trade biz." "I'm not only the president..." "And he wasn't much of a mensch." "How you procure the box is entirely up to you." "That was your grandfather's." "His father gave it to him after the war." "My father gave it to me when he realized he was dying." "And now..." "Yeah, I'm not really a gun-toting kind of thief." "You will be." "You know what I like about you, Neal?" "Even when you're in a position where you have no choice, you convince yourself that you do." "No." "No!" "I'm not giving you the 100,000." " You're just gonna blow it..." " Come on." "...on another card game, okay?" "Just not until we get the whole amount for Sonny." "Now, this job that Mr. B wants us to do looks right up your alley." "All right?" "Check it out." "The Mensch is having one of his mail-order bride galas in a couple of days at one of his storage facilities." "Even if I'm going to do this job, which I'm not," "I need more than you jerking off behind your computer." " Okay, first of all..." " And that's when I met Madison." "Dude, this is gonna be so cake sauce." "Look..." "It's just gonna be a bunch of rich d-bags and hot Russian broads walking around, looking to get some action." "A million dollars. $1,000,000." "Sorry." "Bannen, you're just gonna stop walking when I'm right in the middle of making an important executive decision?" "I gotta grab something out of my car." "I'll catch up with you." "All right." "I'll just go over all of this on my own." "I'm sorry." "You okay?" "What?" "Always be the summoner, never the summoned." "Don't do it, Bannen." "You're breaking the rule." "Excuse me, sir, ever heard of a crosswalk?" " Hey." " Can I see some ID?" "It wouldn't happen to be in any of those three wallets, would it?" " No, I just..." " Yeah, okay." " Why don't you just step over to the side..." " Oh, my God..." "Back again." "Did you miss us?" "Tell us what to do here, Neal." " Where the fuck is he?" " Interrogation." " Which one?" " B." "So here we are." "Third strike, no more outs." "Just months after you told me you were gonna be a better man." "If you're convicted, that's life in prison." "No more fancy cars, fancy clothes, women, just you in an orange jumpsuit pitching nickels against the wall with a bunch of homeboys who are going to take a deep-seated interest in your last name." "You two take a walk." "I want a private conversation with my son." "Yeah, this is my dad's version of quality time." "I know about the money you owe Sonny Carr." "And I know about your dealings with my brother." "The D.A. wants you convicted, locked up, key thrown away." "She wants to set an example for the precinct, and I'm not totally opposed to that idea." "But..." "I can make her cut you a deal." "Total immunity." "That perked up your ears, didn't it, huh?" "Keep your virgin ass out of the state pen." "It's what your granddad would call appealing to a man's self-serving greed." "Let me guess." "You want me to turn states on Mr. B?" "It's your last chance, kiddo." "Hey, Dad?" "My father always called me a quitter." "I had to live with that my whole life." "It wasn't until the day he died..." "After posting bail, I'm back to square one." "Broke and screwed." "Third strike, no more outs." "I understand you've gotten yourself in a bit of trouble with Sonny." "Taking no action means 25 years in prison." "I'm offering you a chance to square your debt." "...your virgin ass out of the state pen." "Or I could turn states on Mr. B, which means having to look over my shoulder forever." "And I know about your dealings with my brother." "$1,000,000." "Or I could work for Mr. B, pay off my debts, and run from the police my whole life." "Even when you're in a position where you have no choice, you convince yourself that you do." "It was decision time." "Kill me if you want, but if you give me a week, I'll get you an extra 100 G's." "Not for Sonny, for you." "Just, you know, tell him you couldn't find me." "When in need, appeal to greed." "What if we said we want 200 G's?" "Well, Finch, I guess I say okay." "Come on, man." "Where you gonna find that kind of money?" "Mr. B hired me to do a job, retrieve a box that somebody stole from him." "Word on the street says there's something pretty special in that box." "Tony was telling me about it the other day." "It's a mask of some sort." "I mean, it's worth a lot of money." "All right, so I'll get you guys your money." "In good faith, I'll let Cujo back there take a shot." "You, Bannen, you got yourself one week." "Francis." "Nice." "So we're good, right?" "Uncle B was right." "I don't have a choice." "You've got a choice." "Grow up or give up." "That's your advice?" "I thought you were supposed to be supportive." "I guess next time I'll just ask God for advice." "God's a little busy to worry about you." "You gotta believe in yourself." "Go with your gut." "And don't take all of this too seriously, 'cause it'll bite you in the ass." "Thanks, Mom." "You always know what to say." "Are you aware that breaking and entering is a felony?" "The use of a gun can increase the sentence to state prison." "Well, I'll be sure to only use it in self-defense, then." "Based on what I've seen, I think you could use a bodyguard." "Unless you're applying for the job, I'll assume you're stalking me, which gives me quite a case against you." "Oh, no, actually, I just dropped by to give this back to you." "I was mildly impressed." "No one has ever lifted from me before." "I kept your Starbucks card for my trouble." "Sure." "Press charges, break the code of thieves and, yeah, have my Starbucks card." "Did you just say "code of thieves"?" "You highly overestimate your charm, and you're definitely underestimating my trigger finger," " so I feel like I should sneak out now." " Without hearing my business proposition?" "Your business proposition?" "See, I was thinking maybe you were tracking me because you find me attractive, but clearly you're just using me for my more roguish qualities." "A deft hand can be very attractive." "I feel like I should tell you things about myself, like I never commit to anyone or anything, ever." "I have trust issues." "My daddy didn't love me." "If you want to offer me a job, you should make it the best damn offer possible because, Mr. Bannen, no matter how enchanting you think you are, people get one chance with me, and if you screw up that chance, you may never see me again." "Face-to-face, anyway." "The job is to steal something that means a lot to one scumbag and deliver it to another scumbag." "Your salary for this job is a couple hundred thousand, and it may or may not include benefits." "And it's gonna be very dangerous, I'm not gonna lie, not to somebody like you." "You'd sniff that out 100 yards away." "My fee is actually 500 grand, but that doesn't mean I'm gonna do the job." "Spoken like a true pro." "That was straight out of the book." "Whatever you pledge allegiance to owns you." "Lesson learned." "How's your father doing?" "He doesn't know I'm working for you again, if that's what you mean." " You haven't seen him?" " No, why?" "He's watching me." "I hope for his sake he keeps his distance." "Not to worry, though." "Your allegiance is in the right place." "I can't even open this frigging thing." "It's supposed to have the Turin Shroud in it." "You know, that shmate Jesus was buried with?" "Could someone please open this fucking box for me?" "What is that?" "Wait, wait." "What is that?" "A frigging power tool?" "Have you ever heard of the Sabbath?" "Have you ever heard of a Jew?" "Do you know what a Jew is, Mr. Shnook?" "Today is Saturday." "It's the Sabbath." "You can't use electricity on the Sabbath." "How was I to know?" "Look, I'm sorry." "Power tool." "You're a shmuck, Shnook." "What?" "Mr. B is sending somebody over for the box." "Find him." "I want him dead!" "You didn't have to sleep in my car." "So I'm gonna take this job on one condition." "I call the shots." "No." "There's Zeke." "He's my right-hand man." "Hey, buddy, you ready for prep day?" "So ready." "I just took the biggest deuce you've ever seen." "I feel, like, five pounds lighter." "I almost sent you a picture of it." "Zeke, you're in the car with Madison, the one I was telling you about." " She's kindly gonna help us on this job." " We'll always have this moment, Zeke." "Nice to meet you, too, Madison." "Okay, on to more pressing matters." "Apparently, The Mensch has found out that Mr. B sent you after the box and has hired an assassin trio for protection." "These are the hottest assassins I have ever seen." " Perfect." " The first one I call Jailbait." "I believe she's in her 20s, but she says she's 17, because perverts seem to get off on that kind of thing." "She seduces her victims, she lets them have their way with her," "she waits for the opportune time, and then she stabs them with a horse tranquilizer." "I'm not even gonna get into what she does after that." "And then the next one is former special ops, trained in acrobatics, martial arts and espionage." "And she loves knives." "I call her Stiletto." "And last, but certainly not least, the one I named Bombshell." "Really not much to say about Bombshell." "She's hot, she's blonde, she likes to blow shit up." "Bannen, listen to me." "I'm sending you the images." "Look at them this time, okay?" "Why is that funny?" "There's no such thing as a trio of hot assassins." "In my wildest fantasies, maybe." " I'm saying let me drive once." " No." "You don't know how to drive your own car." "What are we..." "What are we doing?" "We have to go see my uncle before we do the job." "I'm sorry." "We have to make a quick stop to see your mob uncle?" "There are certain people, Bannen, who I would like to remain anonymous to, like everyone." "He's the one paying the bills right now, so..." "Wait a second, I just realized," " after I pay Sonny and his guys..." " Who's that?" " ... and Zeke gets his cut..." " Bannen!" "...and then you get your cut, I'm left with nothing." "Bannen!" "Always good to see you, bud." "I know we told you we were gonna give you a little more time, but sorry, man, you were summoned." " Who in the fuck is this pretty boy?" " It's Neal Bannen." " No, it's not." " What do you mean?" "What do you mean what do I mean?" "This ain't Neal Bannen." "All due respect, Sonny, we've been trailing that piece of shit for weeks." "With all due respect, I'm telling you, this ain't Neal Bannen, because Neal Bannen swore he was gonna have my fucking money by now." "Can we talk as two cutty macks?" "I could've sworn you owed me 150 G's, huh?" "But every time my gentlemen catch up with you, you have nothing." "Now I ain't never been no college cat." "I mean, my teachers was macks, hustlers, pimps." "You see, I didn't use a pen or a pad." "I used three-card Marley, loaded dice," "and loaded guns." "I think I get where you're going..." "Now, I want to ask you, do you hold grudges?" "Because I do." "When I hold on to a grudge for too long, man, I start to see red, and then there's only one thing that keeps me out of the red." "Box!" "And then I'm nice and smooth again." "Then I start to remind myself," ""Isn't Neal Bannen retrieving some sort of valuable box for Mr. B?"" "He is." "He totally is!" "And I hear that it's got a set of these thick, flawless diamonds inside of it." " Isn't that right?" " I heard an antique mask." "Diamonds!" "Then it's clear to me." "Instead of taking the money," "I'll take the box." "You dig?" " ¡Papi!" " I dig." "You're playing my favorite song." "Neal Bannen?" "Wait, wait, wait, wait." "Mami, you two know each other?" "Come on, Papi, let's dance." "Catalina." "Normally I would kill a man for crossing that line, but we agreed, you're gonna bring me the box, so I can't do that." "I see you brought your little lady friend with you." "I think I found a way to reciprocate." " Okay." " Okay, ya pues." "What are you doing?" "Sonny, what are you doing?" "You know, you're right, Sonny." "I did sleep with your girl." "Before you guys were together, of course." "It's only fair, though, that you have your way with her." "What?" "Okay, you know what, Sonny?" "Come on." "Come on!" "Stop!" " What are you doing?" " Come on." "Come on." "Come on." "I should probably warn you, though, as a cutty, she may not be very clean." "I mean, when a girl sleeps with as many guys as she does, she's bound to have something." "Are you saying you brought a hooker up in here?" "I didn't know she was a prostitute when I first met her." "When I picked her up for our little date, first thing she said was, "$5 for a handjob. "" "I mean, I should've known." "Look at the way she's dressed, those "fuck me" boots." " Mami, is he telling the truth?" " I'm not a prostitute." "I'm a high-class call girl." "And I'm $50 for a handjob." "$50." "Thanks for looking out for a cutty, man." "Jesus!" "Thanks, guys." " I think I'm falling in love." " Don't." "I'll only hurt you." "Are you two ready for this?" "We'll have the box by tonight." "Neal?" "Just so you know, Manni doesn't work for me anymore." "From now on it's Dimitri or me." "You trust this girl?" "Why wouldn't I?" "All right." "Word to the wise from your favorite uncle." "Don't fuck this up." "No turning back now." "Hey, B, we just got the invite." " You going over the guest list?" " Yeah, I think I got my guy." "All right, while you're doing that, we'll finish the replica box." "All right." "I'll tie up the rest of the loose ends." "Replica complete." "All right, let's make sure we're on the same page." "I'm going to arrive as J.C. Trilby." " I'll already be there." " And I'll mingle for a bit." "Before you meet up, you both need to mark each of the guards with transponders so I can track them." "There's eight of them." "And I'm gonna mark The Mensch." " We meet up and flirt for a while." " Yeah." "By that time, everyone should be nice and toasty, so you can head to one of the rooms." "The Mensch's private room should be guarded." " Go to the next room over." " I'll hand you the replica." "Bannen will make his way through The Mensch's secret doorway to get to his private room." "The box should be hidden in a hollowed bust." "Switch it out with the replica and you're good." "Wait, wait, B, you never told me how you're gonna pose as J.C. Trilby." "I can't reveal all my secrets." "Hey, Madison should be on the rooftop." "She couldn't wait." "She marked all the guards." "She only has The Mensch left." "Let's party." "Okay, Madison, just get him interested in you, but don't be too aggressive." "You don't wanna scare him off." " Hello." " I've been eyeing you all night." "Okay, change of plans." "Just go for it." " It's so nice to finally meet The Mensch." " I know." "Okay, find your opportunity and mark him." "That sounded just nasty." "We are in." "All right, Madison, make your way over to the bar." " Let's get this over with." " Bannen will pick you up there." "Making my move on Madison." "Fuck off, bitch!" "You will make a fine wife." "Why don't we go inside and we make it official?" "How are you still single?" " We got to make this believable." " How do you propose we do that?" "Okay, but just to make it believable." "Hey, hey, hey." "How you doing, huh?" "Mister..." " Trilby." "J.C. Trilby." "Yes." "Yes." " Trilby, Trilby." "That's great." "You know, I think, Mr. Trilby, you better beat it." "This one's mine, okay?" "Looks like The Mensch might be in love." "I think she's got him." " What's going on?" " We're about to find out." "How could you still be single?" "Maybe you should come to my room." "I'll suck your fingers, I'll suck your toes, and then you can suck mine." "Hey, go with it." "He's gonna lead you right to the box." " Let's go." " Come on." "You may not be needed, Bannen." "What do you say we check out one of those private rooms?" "Sure." "Hey, you want to join us?" "Come on." "Okay, Madison, the box should be in the corner..." "Not bad, huh?" "...under a hollowed bust." "Do what you gotta do." " Why is..." "What's he doing here?" " This is Mr. Shnook." "He's privy to all my business." "He's fine." "He's good." "I think we should do it now." "Come here." "Could you just..." "Could you just..." "The things that I would like to do to you," "I don't think you're gonna want Shnook to see." "Mr. Shnook, please leave the room." "And lock the door behind you." "Beat it!" "Pervert!" "Why don't you guys make yourself comfortable?" "You know, entertain each other." " What the hell is going on with Madison?" " Hold on." " She's not responding." " What do you mean?" "Madison?" "Madison, do you read me?" "What?" " She's gone." " What do you mean "she's gone"?" "She just disappeared." "She's completely off the radar and The Mensch isn't moving at all." "What the fuck is going on?" "I'm going in there." "I'm gonna just..." "I'll be right back." "You guys just keep doing what you're doing." "God, I could marry both of you." "This is spooky, B. Be careful." "Something's not right." "Where'd she go?" "Trilby, thank God it's you." "That sock was disgusting." " Tell me where she went!" " Wait a minute." "Wait a minute!" "You're not J.C. Trilby." "You're that prick Bannen!" "Shit, Bannen, get out!" " You're after the fucking box, right?" " Go to the window." "You fucker!" "Shnook!" "Get your fucking ass in here!" "Shnook!" " What's happening, B?" " Shnook!" " I'm in the dark here, B. What's going on?" " Get in here!" "Shnook!" "What are you doing, B?" "You're surrounded." "Get out of there!" "It wasn't until precisely this moment that I believed the assassin trio even existed." "I hate being wrong." "Finally, finally, the assassin has arrived." "You're dead, Bannen." "You're dead!" "I want you to fucking cut him into little pieces." "I want you to slice his liver!" "Go, go, go, go, go." "Go!" "Come on, hurry!" "Come on!" "Come on!" " Bannen, what is happening?" " Zeke, Madison has the box." "She's off the radar, Bannen." "She turned off her cell phone, I can't find her on the satellite." "I can't call Mr. B and tell him I lost it." "You gotta find her." "Just find her!" "So what are you gonna do?" " Sorry, is this iced tea?" " Yeah, Long Island." "Wait." "Happy holidays." "Okay, gentlemen, a big round of applause for Tammy, everybody." "Tammy." "All right, gentlemen, tonight is amateur night." "Some lucky lady is gonna walk out of here with 500 bucks." "Any takers?" "$500, ladies, $500." "Easy money, easy money, easy money." "Come on, $500." "Come onto the stage." "Amateur ladies, report to the stage." "Going once, going twice..." "Whoa!" "Okay, who do we have here?" "Wait a second." "Hold on a second." "Steve?" "Steve?" "You sure this girl's the legal age for this club?" "Let's not waste any more time, then." "Yeah!" "Well..." "I think this little lady's got quite a future." "What do you guys think?" "I thought this was amateur night." "Something tells me you're not what you seem." "How old are you really?" " Old enough." " Are you sure?" "Quick lesson." "You want someone to do what you want, you need to choose the options for them." "I especially like to use this principle when picking up women." "I have an idea." "Why don't we go back to your place" " and you can find out how old I really am?" " But this time, it was being used on me." "Or we can go to a motel and you can do whatever you want to me." "And I didn't care." "Zeke, dude, have you seen two girls and a bullwhip?" " No, I have no wish to..." " Check this out." " Look, look." "Watch, watch, watch." " Get off my computer." " Just lookit." " Don't touch that." " What did you just hit?" " Here we go again." "Hey, guys!" "Guys, come check this out." " That's Jailbait." " Yeah, she is." "No, you don't..." "Hold on." "Bannen?" "Bannen?" "Can you hear me?" "Can you hear me?" "No, no, no, no." "She's gonna kill him, okay?" "That's what she does." "Okay." "She's gonna stab him and she's gonna cut off his balls." "All right?" "Bannen!" "Wake up!" "Okay, this might..." "Oh, God, please work, please work." "Okay." "Okay." "Bannen, Jailbait's trying to kill you!" " What?" "What?" " She is going to cut off your balls!" "Jailbait's trying to kill me?" "For the record, I helped you save him." "You tell him that." "You tell him what I did here today." "Hey, B, I found Madison, all right?" "She turned her phone back on." " Where is she?" " I traced her call to a guy named Marcel." " Send me her location." "I'll get her." " Keep your eye out for Bombshell." " Hey." " I am so sorry." "That is so weird, 'cause I was just looking for you at the party." "Right, because I had to slip out." " I missed you." " Yeah, I wanted to say goodbye and I said, "Fuck it, I'm just gonna jump out the window. "" " Yeah." "I wanted to say bye to you." " No, that was you." " I have to go." " Wait, wait, wait." "Can't we just have, like, one straightforward conversation?" " Give up yet?" " Give me the box." "You want the box?" "Hey, you know what?" "I have an offer for you." "I know a guy." "He's actually interested in purchasing my box." "He's got a new connection in France, so we can split the profits 80I20." " Let me guess, you get 80, I get 20." " Yes, genius." "All right, 70I30." "Yeah, I'm not here to make a deal with you, all right?" "Okay, 60I40." "That's my last offer." "I'm the only one who knows how to get a hold of Marcel." "Now think about it, Bannen." "I don't need you or your contact, I just need the box, so just hand it over." "Okay, you're right." "You don't need me." "I guess I'm out of options, so..." "Come get it." "Wow." "Holy shit." " That was nice." " That's pretty far." "I really, really wish you wouldn't make me do this." "I think I like you." "Let me tell you what's gonna happen." " Okay." " All right?" "I'm gonna walk over and you're gonna hand me the box." "I'm gonna walk away and I'm gonna give it to Mr. B, who's gonna pay me my money so I can pay off Sonny." "You want to shoot me sometime in between, so be it, 'cause I don't have a choice." "Okay, 50I50." "Stay away from him." "I wish I could see your face when it happens." "If I see your blonde fucking bimbo weave again, I will end you." "What am I supposed to do with this?" "Return to Mr. B and then turn states on him?" "He'd kill me." "If I don't, I go to jail." "And the fucked up thing is all I can think about" " is that drink at the strip club." " Well, you made a mistake." "At some point, you got to let it go and move on." "Little voices in your head, those instinct voices," " what are they telling you?" " Run." "Spoken like a true hero." "That's how I know I raised you right." "The only advice I can give you is trust that whatever you decide is the right choice." "Whatever I decide is the right choice." "Uncle B, I got the box." "I knew I could count on you." "We'll meet in the afternoon." "I got a warehouse in the fishing district." "Come alone." "Wait, Manni's been a cop the whole fucking time?" "Yep." "What the hell are they gonna do with me if they find out I'm wearing a wire?" "Probably shoot you." "I'm kidding." "It's gonna be fine." "All you gotta do is make sure that you get in there and deliver the box and get him talking." "Okay?" "If anything goes wrong, and I'm sure it won't," " we'll cut the lights and move in." " Anything happens, you hit the floor." " Let us be your guardian angel." " I thought that was Mom's role." "What would she think of all this?" "All set." "All right, let's rock and roll." "This is fucking bullshit, Zeke." "I'm doing the biggest drop-off of my life and you're not even there to wish me good luck?" "Whatever, dude." "Fuck off." "I'll call you later." "All right, you're gonna waltz in as your charming self." "Everything is normal." "Sure, just doing a drop-off to my mob uncle, who I'm about to rat out in front of his armed henchmen." " You know, typical day for Neal Bannen." " Or you can go to jail." "Choice is yours." "Unit A arriving and getting into position." "Let's move." "You're gonna frisk my own nephew?" "If I know Neal, he didn't bring the gun." "He's not wearing a wire." "Why would he be wearing a wire?" "You're not wearing a wire, are you?" "All right, boys, grab him, tie him up, slit his throat." "And then we're gonna take his balls and cut them off and throw them to the sharks!" "Watch out, boys, here comes the fuzz." "Unit B, what's your 20?" "Now, Neal, I'm very excited you found the box." "May I see it?" "Hans, get him his money." "Remember, you're not gonna just drop off the box and walk out." "You have to get him talking." "You gonna tell me what's in the box before I give it back?" "Your future." "You passed, Neal." "I wanted to see if you would follow through with your promise." "Are you saying this is some sort of test?" "Come on." "The Mensch?" "His trio of assassins?" "The Mensch was a test of my patience, that is for sure." "The assassins, however, generally, they're freelance." "Their services go to the highest bidder." "They tried to kill me." "They had to appear to be your adversaries." "But, really, they were meant to be your guides." "You've gotta get him to talk." "Get a clean statement now." "Wait a second." "What about Madison?" "She ran off with the box." "How'd you know I'd find her?" "No way." "You trust this girl?" "I saw her on the street that day." "I found her." "How silly of me to assume that a man with your sexual appetite would spot a beautiful woman and instinctively follow." "Like I said, you passed the test." "NeaI, make the drop-off and get out." "We have got nothing unless you get a clean statement." "Do it now." "I said you could have everything." "The money, power, the women." "What if I told you everything was yours?" "The keys to the kingdom, Neal." "Everything your grandfather dreamed was possible." "And everything your mother threw away." "Neal, do not listen to him." "Get out." "I trusted your allegiance was in the right place." "You didn't disappoint me." "You earned this." "Now go pay Sonny and we'll talk further." "What, are you gonna make my arm fall off?" "Come get your money." "NeaI, what the hell is going on?" "Talk to me." "Now you know where my allegiance lies." " Cut the lights now!" "Cut the lights now!" " Go, go, go, go!" "Neal!" "It's okay!" "Look, you had a momentary lapse of judgment, but I'm an understanding guy." "They got nothing on me." "No harm done." "I got your money." "We can still get out of here." "Neal." "I'm dying." "You're my last chance to make a meaningful contribution to this world." "I'm asking for you and me not to be enemies." "Nicholas!" "Don't you fucking move." "Stay right fucking there." "Yeah, only one missing from this little reunion." " Son, get out of here." " Your mother, Neal." " Come with me, you'll know everything." " That is not a suggestion, it's an order." "Go ahead." "We'll meet next week for coffee." "Looks like I win, Nick." "Your little reign of terror is over." "What could you possibly find so amusing?" "This reminds me of when we were kids." "I used to shoot pigeons out back." " Pigeons?" " Captain, what's your 10-20?" "Rats from the sky." "I'm around back." "I'll hold him till you get here." "They shit everywhere." "They terrorized the cat." "They stole birdseed from the cardinals and the gold finches, the noble birds." "You came out back one day and objected to my action." "Yeah, I broke your fucking nose." "I'm behind the warehouse, standing by." "Dad came out." "He saw my nose bloodied, shattered." "But he warned you, one of these days I'd grow up and you wouldn't be able to pick on me anymore." "And you said..." "You'll never be as big as me." "Right." "Nick, stop fucking around." "Don't do this." "Come on, Zeke, pick up." "Pick up." "For some reason, you've always been known as the guy who did what he thought was right." "I guess that's how you got to be where you are." "And I will always be known as the guy who was willing to do what the other guy wasn't." "God damn you." "Zeke?" "No, I'm looking for Zeke." "Do you know where he is?" "Hey, Bannen, look, I know you're doing the drop-off right now and I'm maybe being paranoid, but the guy I saw, the other guys, like big guys snooping around..." "So I thought maybe you could..." "Hold on." "Hold on." "No!" "No, no!" "No!" "Bannen!" "Don't worry, guys." "I'll get him back somehow." "Can we help, Bannen?" "Mr. Bannen?" "I am good with guns." "I've got, like, a 98% headshot kill ratio." " Hello?" " Be cool, all right?" "Be cool." "Thank you." "Dr. Travis, you have a visitor in the main lobby." " I don't want to hear "I'm sorry. "" " I wasn't going to say I'm sorry." "Code of thieves, huh?" "You know, you should actually appreciate the fact that I took a job and followed through with it." "You, on the other hand, you just had to screw up my deal with Mr. B, didn't you?" "You know what my favorite thing was?" "This was my favorite." "Unbutton, unbutton, unbutton." "You're so dramatic." "You owe me money, Bannen." " I owe you money?" " Yes. 500 grand." "That's up from the $5 for a handjob." " You think that's funny?" " Yeah." "That was a freebie." "You're gonna slap me?" "You're gonna have to let go of one of them if you want another handjob." "Yeah?" "You know how fucked I am right now?" "Zeke's been kidnapped, my dad's been shot by my uncle, and it's probably my fault." "So today's arguably the worst day of my life." "And for some reason, all I can think about..." "Yeah, well, don't be fooled now, because all I want is my money." "Yeah?" "Prove it." " It's Jim, one of Sonny's guys." " Mr. B is calling me." "Sonny's got Zeke." "He's threatening to kill him unless we bring him the box." "Mr. B knows we're together." "He said we can keep the box." "He just wants you to meet him at Inspiration Point." "I'm not meeting him at Inspiration Point." "I'm doing this alone." "I don't want you getting hurt." "Bannen, I'm going with you." "Look, Sonny." "The box." "No games." "I just want the kid." "I don't want any trouble." "I want to be done with all this." " Francis, untie the kid." " What?" "That's it?" "Hold on." "How do I open it?" "Nobody knows how to open the box." "You like to fuck with me, don't you?" "You're always finding new ways to fuck with me." "Did you enjoy fucking my girl?" "Catalina?" "You're like a connoisseur of fucking with my life." "And for some reason, you're still alive." "Yeah." " How in the fuck does he get away with that?" " I'm fucked." "You shoot pool?" "Shoot some motherfucking pool." "I'm Sonny Carr, and I'm gonna watch you take a bullet in your gut." "I want to see how charming you are then when the bullet enters your body but doesn't blow out your back, so you fight the urge to squirm." "I'm gonna wipe that pretty, charming boy smile off your dying motherfucking face!" "I cannot let you fuck with me anymore, pretty boy." "You're dying right here on this motherfucking pool table." "Eight ball, corner pocket." "Give me my gun!" "Give me my gun!" "Mami, what are you doing with papi's gun?" "Shoot him, Mami." "Go ahead, mama." "No." "Shoot him, mama." "Give me..." "Give papi the gun, mama." "Look, I'll make it up to you." "I didn't mean to hurt you." "Mama, it's loaded." "Give me the gun." "Mama, we'll make love, sweet love." "Give me the gun." "Tell me, mama..." "Francis!" "Francis?" "You all right?" "Stupid bitch." "Fucking waste." "Who's the fucking man now, Sonny, huh?" "Who's in charge now, huh?" "Who's in charge now, right?" "I never liked that guy." "Fuck." "Out of bullets." "I guess today's your lucky day." "Thanks." "You good?" "Yeah." "I mean, I was thinking about starting my own business anyway." "I could still use that 200 G's." "Little Tommy needs some braces." " Right." " Go on, get out of here." "I'm sure I'll catch up with you sooner or later." "Bannen." "Let's just say you owe me one." "You look like shit." "I am so proud of you." "The D.A. says we haven't got enough on my brother." "I'll plead on your behalf." "For 60 years that prick's wanted to shoot me, but he'd never, never break his golden rule." "Always covers his tracks." "Uses his fall guys to take out his trash." " Dimitri shot you?" " Yeah." "And unless Nicholas admits guilt, we may never get him." " Hey, hey, hey." " Jesus." "Dad, just relax." "He keeps bringing up Mom." "I mean, what did he mean at the warehouse when he said, "Everything your mother threw away"?" "It's time you heard this from me." "I haven't told you the truth because I tried to protect you." "It's not gonna change what happened." " It's not gonna change what he did." " What did he do?" "I was afraid of what you would do." "I was afraid of what he might do to you." "I loved her so much." " I swear, there was nothing I could do." " Sir?" " She loved you from the bottom of her heart." " Sir, I'm gonna need you to leave." "She..." "She would never do anything to hurt you." " Sir, please, leave." " I swear to God, she loved you." "Okay." "Yep." "Okay, thanks." "Hey, all right, so I just spoke to Marcel." "He's in France." "He still wants the box." "We need to hop on an airplane." "What's going on?" "What are you doing?" "What happened?" "I'm going to Inspiration Point." "Bannen, we'll sell the box." "You're finally gonna start over." "I don't care about the box anymore." "Okay." "If you leave, I won't be here when you get back." "Tell me about my mother." "Neal Bannen Jr." "Pointing a gun." "Did you ever think you'd see the day?" "Tell me what you did to her." "That gun you're holding, that was your grandfather's, you know that." "Cut the shit." "I'm clean." "It's just you and me here." "I want the truth." "What happened to her?" "When two men, brothers, love a woman the way we loved her..." "What happened to her was an accident." "Facts." "Go." " You were a kid." " Yes." " She had a car accident." " Yes." "I was driving that car." "I was having an affair with your mother, Neal." "On and off, since before you were born." " What are you telling me?" " He was drinking." "He was in a blind rage." "Are you trying to tell me that you're my dad?" "We kept up the facade as long as possible." "Your mother's choice." "He was suspicious." "He followed us one day in his car." "He tried to run us off the road." "It worked." "The car flipped." "Me and him, we blamed each other, but for the first time in years, we agreed to cover it up." "For your sake." "I'm gonna tell you something here in a minute that's gonna upset you." "Very much so." "And then I'm going to sit right there, and you're gonna execute me for what I did." "Now when you do, everything I own will be yours." "It may take you a while to realize, but this is what you were meant to do, Neal." "I don't want it." " That's why I put you through this." " But I don't care." "I don't want it." "I'm not going to let you piss away this opportunity." "But I don't want it!" "You apparently missed the memo that says, "I'm trying to get out of this lifestyle. "" "This whole wild goose chase that you put me on to find this stupid box?" "I have a theory." "I think you created the box so you could draw out your enemies." "You knew if you created enough lore surrounding it that nobody could resist, and eventually they'd all get killed." "The Mensch." "Sonny." "So what's really in the box?" "I mean, everybody's got their theories." "Ancient masks, diamonds or whatever." "But you and I know it doesn't matter." "And then it hit me." "Nothing." "Nothing in the box." "How poetic to think that everything that everybody wants, whatever their little greedy minds come up with, that's what's in the box." "Brilliant." "You wonder why I want you to be my successor?" "God, I wish I'd thought of that." "But no." "Unfortunately, I did put a little something in that box." "And your girlfriend's gonna be the first one to find out." "God, I see so much of your mother in her." "I could tell right away you'd met your match with her." "She was a big asset to me when I needed her, but now she's..." "She's getting in the way." "Neal Bannen's answering service." "Now, you may hate me at first, but you're gonna have to trust me when I tell you that she'd only be a distraction to you." " Hello?" " She'll appear to be loyal." "Did you really think I'd leave without you?" "Is this Madison?" "I promise you, she won't be there when you get back." "Let's do this." "I'm sorry." "It's just too perfect." "We made a replica box." "For The Mensch job?" "It was because I was so tired of the real box that I had to get rid of it." "So on my way to visit my father at the hospital," "I dropped the real box off at your office." "You just blew up your own building." "Well done." "But you're gonna come around, Neal." "My blood courses through your veins." "You're capable of so much more." "You proved it tonight by coming here to kill me." "Let's do it." "Yeah?" "Like I said, I'm not really a gun-toting kind of thief." "They got nothing on me." "Just you and me, right?" "They got nothing on me." "You're probably right." "Zeke, please tell me you got that." " Every word." " Got you." "Sometimes a man has to make up his own set of rules, so I added a new one to the Bannen list." "Don't let other people determine what you should and should not do." " Nice car." " Thank you." " Where'd you get it?" " Just test-driving." ".:" "Napisy24" " Nowy Wymiar Napisów :." "Napisy24.pl"
--- layout: default title: Application bootstrap parent: Concepts nav_order: 25 --- # Application bootstrap {: .no_toc } <div class="code-example" markdown="1"> Learn how the NRN application is "bootstrapped" (AKA "started, initialised"), what components are called, on what conditions, and in what order. </div> {% include page-toc.md %} --- ## Learn more about the "bootstrap" concept One of the biggest challenges with Next.js is the difficulty (on a developer standpoint) to know where our code is running and how it affects the behaviour. Depending on the execution context (server, browser, client side transition, server side transition) there are some APIs that are unavailable, or are working differently. (cookies, localstorage, etc.) Part of it is documented in [`MultiversalAppBootstrap`](https://github.com/UnlyEd/next-right-now/blob/v2-mst-aptd-at-lcz-sty/src/components/appBootstrap/MultiversalAppBootstrap.tsx) directly: ```tsx /* * We split the rendering between server and browser * There are actually 3 rendering modes, each of them has its own set of limitations * 1. Server while building SSR pages (doesn't have access to browser-related features (LocalStorage), but it does have access to request-related data (cookies, HTTP headers)) * 2. Server while building SSG pages (doesn't have access to browser-related features (LocalStorage), nor to request-related data (cookies, localStorage, HTTP headers)) * 3. Static rendering (doesn't have access to server-related features (HTTP headers), but does have access to request-related data (cookie) and browser-related features (LocalStorage)) _(e.g: page previously generated through SSG)_ * * What we do here, is to avoid rendering browser-related stuff if we're not running in a browser, because it cannot work properly. * (e.g: Generating cookies will work, but they won't be stored on the end-user device, and it would create "Text content did not match" warnings, if generated from the server during SSG build) * * So, the BrowserPageBootstrap does browser-related stuff and then call the PageBootstrap which takes care of stuff that is universal (identical between browser and server). * While the ServerPageBootstrap does server-related stuff and then call the PageBootstral wich takes care of stuff that is universal (identical between browser and server). * * XXX If you're concerned regarding React rehydration, read our talk with Josh, author of https://joshwcomeau.com/react/the-perils-of-rehydration/ * https://twitter.com/Vadorequest/status/1257658553361408002 * * XXX There may be more rendering modes - See https://github.com/vercel/next.js/discussions/12558#discussioncomment-12303 */ ``` ## What is `Multiversal`? The term `Multiversal` is meant for "code that runs on all situations", to make it obvious it's always executed, no matter what. The idea behind that `Multiversal` term _(which we invented ourselves)_ is that while `Universal` is well-known by developers and stands for code that runs on both the client and the server (or, for apps/tools that are compatible with both, depending on who wrote the definition), `Multiversal` stands for "code running no matter what". Because, you might not want to run some code, depending on the execution context ("browser" vs "server during ssg build" vs "server during SSR"). For instance: - The `Amplitude` module is instantiated only on the browser. - The Cookie consent popup is instantiated only on the browser. - The userSessionContext is populated on both browser/server, but it's not done the same way, because on the browser we can read the cookie anytime, but on the server they're passed down to the react tree instead, and they're not available during the SSG build step. Those are small, but important differences that affect the application and how code should be written and reasoned about. > The purpose of the `Multiversal` keyword is to make it obvious what's happening, from a developer standpoint. (Multiverse > Universe) :wink: ## What's the NRN page lifecycle? 1. All request always starts from [`src/pages/_app.tsx`](https://github.com/UnlyEd/next-right-now/blob/v2-mst-aptd-at-lcz-sty/src/pages/_app.tsx), that's just [how Next.js works internally](https://nextjs.org/docs/advanced-features/custom-app). 1. [From there](https://github.com/UnlyEd/next-right-now/blob/v2-mst-aptd-at-lcz-sty/src/pages/_app.tsx#L98), the [`MultiversalAppBootstrap`](https://github.com/UnlyEd/next-right-now/blob/v2-mst-aptd-at-lcz-sty/src/components/appBootstrap/MultiversalAppBootstrap.tsx) NRN component is rendered 1. This `MultiversalAppBootstrap` component is used as a router to decide which component should be rendered next, depending on whether the page is rendered from the browser, or the server. - If the page is served by the server (either SSR, or SSG during build, or client-side transition that is calling an SSR page, etc.) then [`ServerPageBootstrap`](https://github.com/UnlyEd/next-right-now/blob/v2-mst-aptd-at-lcz-sty/src/components/appBootstrap/ServerPageBootstrap.tsx) is rendered. - If the page is served by the browser (as a static page, either through a full page reload or a client-side navigation) then [`BrowserPageBootstrap`](https://github.com/UnlyEd/next-right-now/blob/v2-mst-aptd-at-lcz-sty/src/components/appBootstrap/BrowserPageBootstrap.tsx) is rendered. - In either cases, that's where our React Providers are initialised, alongside all the stuff that is app-wide. 1. Eventually, the Next.js page itself is rendered (stored in `props.Component`) 1. When the page itself renders, the first thing it renders is the Layout used by this page, which is the [`DefaultLayout`](https://github.com/UnlyEd/next-right-now/blob/v2-mst-aptd-at-lcz-sty/src/components/pageLayouts/DefaultLayout.tsx) by default. - Lots of components are rendered by the layout. (nav menu, footer, sidebar, error handling, etc.) - Each page can use a different layout. 1. Then, the page content itself is rendered, inside the layout. --- <div class="pagination-section"> <span class="fs-4" markdown="1"> [< Tenancy](./tenancy){: .btn } </span> <span class="fs-4" markdown="1"> [Guides: Tenancy](../guides/tenancy){: .btn .btn-blue } </span> <span class="fs-4" markdown="1"> [GraphQL >](./graphql){: .btn .btn-purple } </span> </div>
Q: Swift dynamic cast failed *IDE: XCODE 6 beta3 *Language: Swift + Objective C Here is my code. Objective C Code @implementation arrayTest { NSMutableArray *mutableArray; } - (id) init { self = [super init]; if(self) { mutableArray = [[NSMutableArray alloc] init]; } return self; } - (NSMutableArray *) getArray { for(...; ...; ...) { ... NSString *cutFinal = xxx; [mutableArray addObject: cutFinal]; } return mutableArray; // mutableArray = {2, 5, 10} } Swift Code var target = arrayTest.getArray() // target = {2, 5, 10} for index in 1...10 { for targetIndex in 0..target.count { if index == target.objectAtIndex(targetIndex) as Int { println("GET") } else { println(index) } } } I want the following result: 1 GET 3 4 GET 6 7 8 9 GET But, my code gives me the error libswift_stdlib_core.dylib`swift_dynamicCastObjCClassUnconditional: 0x107e385b0: pushq %rbp ...(skip) 0x107e385e4: leaq 0xa167(%rip), %rax ; "Swift dynamic cast failed" 0x107e385eb: movq %rax, 0x6e9de(%rip) ; gCRAnnotations + 8 0x107e385f2: int3 0x107e385f3: nopw %cs:(%rax,%rax) . if index == target.objectAtIndex(targetIndex-1) as Int { // target.objectAtIndex(0) = 2 -> but type is not integer I think this code is incomplete. But I can't find the solution. Help me T T I solved the problem !!! my Objective C code NSString *cutFinal = xxx; [mutableArray addObject: cutFinal]; fix NSString *cutFinal = xxx; NSNumber *add = [NSNumber numberWithInteger:[cutFinal intValue]]; [mutableArray addObject: add]; and my Swift code var target = arrayTest.getArray() as [Int] A: I would have taken the best out of Swift actually, writing something like this instead: for index in 1...10 { let array = target.filter{$0 == index} let value = array.count == 0 ? "\(index)" : "GET" println("\(value)") }
The minimum wage in Nevada is $7.25 per hour if the employer sponsors group health insurance policies, or $8.25 if health insurance is not part of the compensation package. This doesn’t mean a person will automatically receive those wages because some employers are taking advantage of loopholes in current statutes [LVRJ] There are other elements which are the subject of FAQs on the Labor Commissioner’s web site. However, the bottom line is still that the minimum wage in Nevada is not a living wage. The point is driven home in the realm of fast food operations, and there is talk of a bill in the upcoming session of the state legislature to raise the minimum wage to $15.00 per hour. Because minimum wage levels are a topic inserted in the state constitution, the raise would have to pass in two sessions and go to the voters. [LVRJ] The second important point is that Nevada job growth is showing in sectors which employ a high number of minimum wage workers – in the sector we are pleased to call “leisure and hospitality.” The median wage for a fast food cook in Nevada is $18,890 per year. [DETR] A counter attendant can expect median annual wages of $20,990. [DETR] Now, look at the 2014 Federal poverty guidelines: Obviously, there’s ample evidence from the charts above to support the contention that if employers pay sub-living level wages, then the state and local governments must make up the difference in the form of social safety net programs. In short, the taxpayers are subsidizing the businesses. But, but, but… Spare me the noble story of How I Started Mowing Lawns in the 7th Grade And Worked Up To…. Only about 7% of the low wage work force in this country is composed of teenagers. This means 93% of low wage workers are adults. Women make up about 60% of the low wage work force, and a growing number of low wage workers are men. [LWW] But, but, but… granted that wages are low in retail and fast food sectors but this is insufficient to raise the minimum for everyone… yes, fast food work considered nationally makes up about 5% of low wage employment. However, we’re forgetting about data entry operators, bank tellers, child care workers, teachers’ aides, home health care providers, maids, cooks, porters, cashiers, pharmacy assistants, parking lot attendants, ambulance drivers, dry-cleaning workers, hotel receptionists, and a plethora of other low wage occupations. The median annual wage for a home health care provider is $26,170; for a bank teller $24,940; for a grocery cashier about $21,370. None of these jobs would get a person with a family of four above the federal poverty line. But, but, but… if we raise the minimum wage that will actually destroy jobs… this bit of mythology has been around since time out of mind. It’s purely theoretical, rising from the minds of well paid lobbyists from the United State Chamber of Commerce, and at least five academic studies have debunked it: “A significant body of academic research has found that raising the minimum wage does not result in job losses even during hard economic times. There are at least five different academic studies focusing on increases to the minimum wage—including increases ranging from 7 percent to 12.3 percent made during periods of high unemployment—that find an increase in the minimum wage has no significant effect on employment levels. The results are likely because the boost in demand and reduction in turnover provided by a minimum wage counteracts the higher wage costs. Similarly, a simple analysis of increases to the minimum wage on the state level, even during periods of state unemployment rates above 8 percent, shows that the minimum wage does not kill jobs. Indeed the states in our simple analysis had job growth slightly above the national average. […] All the studies came to the same conclusion—that raising the minimum wage had no effect on employment.” [emphasis in original] [TProg] But, but, but … think of the Mom and Pop store… which we would except for the fact that 2/3rds of low wage workers don’t work at the corner bodega. 2/3rds of our low wage workers labor for large corporations. For example, WalMart has seen profits grow by 23% since the Recession, Yum! Brands by 45%, and McDonalds by a hefty 130%, with help from U.S. taxpayers supporting their personnel. [TP] From the April 15th edition of Forbes we learn that WalMart workers cost U.S. taxpayers approximately $6.2 billion in public assistance. One certainly wouldn’t want to disparage the efforts of the Walton’s to create a successful business – but on the other hand there’s no reason to give the ultra-rich family gifts from the taxpayers. McDonald’s cost the U.S. taxpayers some $1.2 billion in public assistance. [HuffPo] A billion here, a billion there, and soon, as the late Senator Everett Dirksen opined, it starts to add up to real money. That would be real money Mom and Pop are paying in taxation to support their competition. And then there’s the concept – repeated to the point of redundancy – that increasing wages increases aggregate demand, and increased demand produces increased sales, and increased sales yield increased profits – for any business, large or small. We should be asking Nevada politicians who are out seeking our votes this season: Do you support raising the minimum wage in Nevada to $15.00 per hour? If what comes back is a “No” qualified by the standard talking points – it’s just kids, or it’s just a few jobs, or it’ll kill employment – then the politician in question is simply regurgitating the corporate line, the big corporate line. The big corporate lie.
--- abstract: 'Recently, \[[arXiv:0810.3134]{}\] is accepted and published. We show that the Bell inequalities lead to a new type of linear-optical Deutsch algorithms. We have considered a use of entangled photon pairs to determine simultaneously and probabilistically two unknown functions. The usual Deutsch algorithm determines one unknown function and exhibits a two to one speed up in a certain computation on a quantum computer rather than on a classical computer. We found that the violation of Bell locality in the Hilbert space formalism of quantum theory predicts that the proposed [*probabilistic*]{} Deutsch algorithm for computing two unknown functions exhibits at least a $2\sqrt{2}(\simeq 2.83)$ to one speed up.' author: - Koji Nagata - Sangkyung Lee - Jaewook Ahn title: Nonlocality improves Deutsch algorithm --- Introduction ============ Recently, [@NagataNakamura] is accepted and published. Quantum information processing and quantum computing have attracted much interest in science community because of their novel usage of quantum mechanics in technological applications. Many ideas of quantum processors and computers were experimented in many architectures of physical systems, including ion traps, neutral atoms, nuclear spins in magnetic resonance, semiconductor quantum dots, and super-conducting resonators [@IONTRAPQC; @ATOMQC; @NMRQC; @QuantumDotQC; @SCQC]. Still the progress has been limited to a few qubit operations and the performance is far from being practical. The ability of quantum computers in outperforming their classical counterparts has not been demonstrated. In many physical systems, the preparation and change of quantum states, or how to prepare entanglements and how to maintain coherence, is a more difficult task than how to wire logics quantum-mechanically. However, in quantum computing with linear optical systems, it is relatively easy to deal with entanglement and decoherence. For this reason, linear optical quantum computings or the linear interactions of photons with matters are often adopted for the implementation of $N$-qubit quantum algorithms [@AhnScience2000; @BhattacharyaPRL2002]. Especially entanglement is an important aspect that a quantum mechanical device can have and the quantum information carried by an entangled state like Einstein, Podolsky, and Rosen (EPR) state overcomes some of the limitations of classical information used in communication and cryptography [@NC; @Galindo; @CRYPTOGRAPHY; @BRUKNER_PRL]. Recently, there have been several attempts to use single-photon two-qubit states for quantum computing. Oliveira [*et al.*]{} implemented the Deutsch algorithm with polarization and transverse spatial modes of the electromagnetic field as qubits [@Oliveira]. Single-photon Bell states were prepared and measured by Kim [@Kim2003]. Also the decoherence-free implementation of Deutsch algorithm using such single-photon two logical qubits [@Mohseni2003]. Although such a single-photon two-qubit implementation is not scalable, the quantum gates necessary for information processing can be implemented deterministically using only linear optical elements. Often a demonstration of quantum algorithm, which is performed with possibly mixed quantum states, is presented without a proper mathematical theory for the analysis of experimental data, or with a rather complicated quantum tomographical state analysis. However, if the output state of an experiment under study should be an entangled state, we can choose to use Bell inequalities [@BELL]. It is a sufficient condition to demonstrate a negation of Bell locality and the detection of entanglement. We can consider the following question. Is there a relationship between the negation of Bell locality and the performance of such quantum algorithm that can be implemented by a single photon? Interestingly the answer is yes. In this paper we have devised an experimental scheme to obtain simultaneous and nonlocal answers from Deutsch problem with two unknown functions. Especially we elaborate the use of *entanglement* in processing this quantum algorithm. The advantage of using an EPR pair of photons (two-photon two-qubit states) in quantum computing algorithm is analyzed with Bell inequalities in quantum theory. We show that a set of answers of the given Deutsch problem, with two unknown functions, statistically shows a violation of Bell locality in the Hilbert space formalism of quantum theory. It turns out that the negation of Bell locality exhibits a $2\sqrt{2}$ to one speed up at least. We, thus, observe a highly nonlocal effect and it leads the entangled answers in a network of pair quantum computers to provide enhanced information compared with its classical counterpart. An important note here is that there must be probabilistic errors in answers which appear due to the imperfection of the photon detection and defects in optical devices. Thus it is necessary to take into account many measurements and what we can do is only to analyze probabilistically in real experimental situation. By applying the maximum likelihood principle, the answer to the Deutsch problem is estimated probabilistically. In the following sections, we introduce a method of linear optical quantum computing of Deutsch problem. In the section \[entanglement2\], the method that utilizes two-photon two-qubit entanglement is discussed. This method allows statistical analysis of the average value of Bell operator. In order to overcome the imperfection of the photon detection and possible defects in optical devices, the fidelity [@NAGATA1] of the method is analyzed. During the analysis of Bell operator or the fidelity to EPR state in Sec. \[witness\], the separable states are distinguished from the entangled states. It is well known that the fidelity which is larger than $1/\sqrt{2}$ to EPR state is a sufficient condition for a negation of Bell locality in the Hilbert space formalism of quantum theory. We can say that our Deutsch scheme succeeds with the probability of the value of the lower bound of fidelity at least under the condition where the fidelity is larger than $1/\sqrt{2}$. A short summary and conclusion follows in Sec. \[summary\]. Deutsch algorithm with two unknown functions {#entanglement2} ============================================ ![The schematic of Deutsch algorithm with a two-photon state. The classical channel (A) represents the type of the chosen Deutsch function. The two quantum channels (B) and (C), in a superposition single-photon state, are initially prepared in a horizontally polarized state, $|1\rangle$, and a vertically polarized state, $|0\rangle$, respectively. The channel (D) is for the extra photon for a time correlation detection.[]{data-label="schematic"}](figx.eps){width="100.00000%"} The Deutsch algorithm determines whether a given function, $f(x)$, on a binary number, $x$, is either balanced or constant, where the function is constant if the function outputs for $x=0$ and $1$ are the same and balanced if not. The unknown function is defined by $$\begin{aligned} U_f|x\rangle_{y}\equiv|x\rangle_{y\oplus f(x)}.\end{aligned}$$ In a classical computer the answer is obtained by calculating $f(0)$ and $f(1)$, while in a quantum computer only a single calculation with a superposition state of $0$ and $1$ is necessary. Hence, if $f(H)=f(V)$ then the output label should not depend on $H$ and $V$, whereas if $f(H)\neq f(V)$ then the output label should depend on $H$ and $V$. As shown in Fig. \[schematic\], Deutsch algorithm can be implemented using a two-photon state. The quantum channels (B) and (C) represent the horizontally polarized photon, in a superposition state coherently traveling along two paths 2 and 2’, from an EPR photon pair. The qubits in these channels are to be simultaneously altered by the control bit in channel (A) that denotes $|1\rangle$ for a balanced function or $|0\rangle$ for a constant function. Then the final photon state, which is collapsed and detected either at the detector D2 or D2’, reveals the type of the Deutsch function: whether the unknown function was balanced or constant. The other photon, in the vertical polarization, is used as a gate function for the coincidence measurement. This is reminiscent of Oliveira’s scheme in [@Oliveira], except that we discuss quantum-mechanical advantage of wiring two of those Deutsch algorithms which are simultaneously processed by an entangled two-photon state. ![The Deutsch algorithm with a two-photon entangled state[]{data-label="setup3"}](fig1e.eps){width="85.00000%"} We describe the experimental scheme shown in Fig. \[setup3\]. The unknown functions $A$ and $B$ in the gray boxes represent the CNOT gate in Fig \[schematic\]. The half-wave-plates labeled from HWP1 to HWP5, oriented at $\theta=22.5^{\circ}$, are the Hadamard gates, which change a horizontal (vertical) polarization state into a 45$^{\circ}$ (45$^{\circ}$) polarization state. The half-wave-plates labeled as HWP in Fig. \[setup3\] are oriented at $\theta=45^{\circ}$ and swap the horizontal and vertical polarizations, like the $X$ gates in Fig \[schematic\]. In our implementations, we assign the truth values 0 and 1 as $|H\rangle\leftrightarrow |1\rangle,~ |V\rangle \leftrightarrow |0\rangle$. The initial photon is in the coherent superposition state of $(|1\rangle_{2}+|0\rangle_{2'})/\sqrt{2}$. Then, the state evolution after the logic gates $H$ and $V$ depending on the choice of the unknown Deutsch function, $X$ for the balanced function or $I$ for the constant function, becomes $$\begin{aligned} H \left[ \begin{tabular}{c} $X$ \\ $I$ \end{tabular} \right]H|1\rangle + \alpha X H \left[\begin{tabular}{c} $X$ \\ $I$ \end{tabular}\right]H|0\rangle= \left[ \begin{tabular}{c} $1- \alpha$ \\ $1 + \alpha$ \end{tabular} \right]|1\rangle,\end{aligned}$$ where the detector D2 clicks if $\alpha=1$ and D2’ clicks if $\alpha=-1$. This scheme is the generalization of the usual Deutsch algorithm in such a way that we can determine the lower bound of the success probability of the algorithm and we can see a violation of Bell locality in the Hilbert space formalism of quantum theory. In this section, we consider an ideal case, i.e., there is not any experimental noise to simplify the discussion. However, in real experimental situations, we have to take error answers into account due to experimental imperfections. Thus, many runs of experiments are evidently necessary. Hence, we shall discuss a method using Bell operators to analyze experimental data. The method of such analysis will be presented in Sec. \[witness\]. We use Pauli observables for the representation of photon polarization states as $$\begin{aligned} \sigma_z&=&|H\rangle\langle H|-|V\rangle\langle V|, \nonumber \\ \sigma_x&=&|H\rangle\langle V|+|V\rangle\langle H|.\end{aligned}$$ The initial state of photons is an EPR bi-photon state as $$\begin{aligned} \frac{1}{\sqrt{2}}(|V\rangle_1 |H\rangle_{1'} -|H\rangle_1|V\rangle_{1'}).\label{initial}\end{aligned}$$ Now we follow the time evolution of each of photons. Deutsch algorithm with a function A ----------------------------------- Assume that the case where the state $|H\rangle_1|V\rangle_{1'}$ is contributed to our Deutsch algorithm. In this case, the unknown function (A) is determined as constant or balanced. After HWP1, the each state of photons becomes $$\begin{aligned} |H\rangle_{1}\rightarrow\frac{|H\rangle_{1}+|V\rangle_{1}}{\sqrt{2}}, \quad |V\rangle_{1'}\rightarrow |V\rangle_{D1}.\end{aligned}$$ Hence the state $|H\rangle_1|V\rangle_{1'}$ becomes $$\begin{aligned} \frac{1}{\sqrt{2}}(|H\rangle_1 +|V\rangle_{1})|V\rangle_{D1}.\end{aligned}$$ A vertically polarized photon is detected by the $D1$ detector. That is, $$\sigma^{D1}_z=-1. \label{Pauliz}$$ We see that the state of the photons $\frac{1}{\sqrt{2}}(|H\rangle_1 +|V\rangle_{1})|V\rangle_{D1}$ is projected into the following $ (|H\rangle_1+|V\rangle_{1})/\sqrt{2}$. In order to simplify the discussion, in what follows, we consider this state. The polarizing beam splitter (PBS2) changes each of states as $ |H\rangle_1 \rightarrow |H\rangle_2,~|V\rangle_{1}\rightarrow|V\rangle_{2'}$. Hence we have $$\begin{aligned} \frac{1}{\sqrt{2}} (|H\rangle_2+|V\rangle_{2'}).\label{select}\end{aligned}$$ After the half-wave plate (HWP2) each of the states becomes as $$\begin{aligned} |H\rangle_2\rightarrow\frac{|H\rangle_2+|V\rangle_2}{\sqrt{2}},\quad |V\rangle_{2'}\rightarrow\frac{|H\rangle_{2'}-|V\rangle_{2'}}{\sqrt{2}}.\end{aligned}$$ From state (\[select\]), after HWP2, we have $$\begin{aligned} \frac{1}{\sqrt{2}} \bigg((\frac{|H\rangle_2+|V\rangle_2}{\sqrt{2}}) +(\frac{|H\rangle_{2'}-|V\rangle_{2'}}{\sqrt{2}})\bigg). \label{SL}\end{aligned}$$ A dove prism (DP) is the most important part in implementing the given functions. The output polarization state of the dove prism rotates at twice the angular rate of the rotation of the prism itself. So, if a dove prism inclines at $45^{\circ}$ about a vertical line, the image rotates at $90^{\circ}$. Now we consider how a CNOT gate (cf. [@CNOT]) is implemented with the space and polarization degrees of freedom of a photon. As shown in Fig. \[CNOT\], a horizontally polarized photon is transmitted through the polarization beam splitter. But a vertically polarized photon is reflected at the polarization beam splitter. They propagate along different ways. The angle between a vertical line and the axis of the dove prism is $45^{\circ}$ in the case of a horizontally polarized photon, but $-45^{\circ}$ in the other case. So this configuration implements such changes of photon paths: $2 \rightarrow a$, $2' \rightarrow b$ when the polarization is horizontal. $2\rightarrow b$, $2' \rightarrow a$ when the polarization is vertical. Here $a$ and $b$ are the labels for the paths toward detectors. Output photons labeled by $a$ and $b$ are detected by $D2$. ![An example of polarization-CNOT gates[]{data-label="CNOT"}](fig2.eps){width="25.00000%"} ### Balanced function case In the balanced function case, the changes of the polarization states of the photons due to the dove prism are: $$\begin{aligned} &&|H\rangle_2\rightarrow |H\rangle_a,~ |H\rangle_{2'}\rightarrow |H\rangle_b,\nonumber\\ &&|V\rangle_2\rightarrow |V\rangle_b,~ |V\rangle_{2'}\rightarrow |V\rangle_a.\end{aligned}$$ Thus, after the dove prism, the state (\[SL\]) becomes $$\begin{aligned} \frac{1}{\sqrt{2}} \bigg((\frac{|H\rangle_a+|V\rangle_b}{\sqrt{2}}) +(\frac{|H\rangle_{b}-|V\rangle_{a}}{\sqrt{2}})\bigg).\end{aligned}$$ After HWP3, we have $(|V\rangle_{a}+|H\rangle_{b})/\sqrt{2}$. After HWP($\theta=45^{\circ}$), we get $(|V\rangle_{a}-|V\rangle_{b})/\sqrt{2}$. Hence, we detect only vertically polarized photons in $D2$. This implies $$\begin{aligned} (\sigma^{a}_z=\sigma^{b}_z=)\sigma^{D2}_z=-1.\label{PauliBz}\end{aligned}$$ Hence from Eqs. (\[Pauliz\]) and (\[PauliBz\]) the value of observable $\sigma^{D1}_z \sigma^{D2}_z$ should be $+1$. This is one of the success result of a single run of the experiment, i.e., $$\begin{aligned} \sigma^{D1}_z \sigma^{D2}_z=+1.\label{PaulifinalBz}\end{aligned}$$ ### Constant function case After the dove prism, polarized photon states changes as follows $$\begin{aligned} &&|H\rangle_2\rightarrow |H\rangle_a,~ |H\rangle_{2'}\rightarrow |H\rangle_b,\nonumber\\ &&|V\rangle_2\rightarrow |V\rangle_a,~ |V\rangle_{2'}\rightarrow |V\rangle_b.\end{aligned}$$ Thus, after the dove prism, the state (\[SL\]) becomes $$\begin{aligned} \frac{1}{\sqrt{2}} \bigg((\frac{|H\rangle_a+|V\rangle_a}{\sqrt{2}}) +(\frac{|H\rangle_{b}-|V\rangle_{b}}{\sqrt{2}})\bigg).\end{aligned}$$ After HWP3 we have $ (|H\rangle_{a}+|V\rangle_{b})/\sqrt{2}. $ After HWP($\theta=45^{\circ}$), we have $ (|H\rangle_{a}+|H\rangle_{b})/\sqrt{2}. $ Hence, we detect only horizontally polarized photons in $D2$. This implies $$\begin{aligned} (\sigma^{a}_z=\sigma^{b}_z=)\sigma^{D2}_z=+1.\label{PauliCz}\end{aligned}$$ Hence from Eqs. (\[Pauliz\]) and (\[PauliCz\]) the value of observable $\sigma^{D1}_z\sigma^{D2}_z$ should be $-1$. This is one of the success result of a single run of the experiment, i.e., $$\begin{aligned} \sigma^{D1}_z\sigma^{D2}_z=-1.\label{PaulifinalCz}\end{aligned}$$ Thereby, we can determine whether a given function (A) is constant or balanced with utilizing the state $|H\rangle_1|V\rangle_{1'}$. Deutsch algorithm with a function B ----------------------------------- Similarly we can assume that the case where the state $|V\rangle_1|H\rangle_{1'}$ is contributed to our Deutsch algorithm. In this case, the unknown function (B) is determined in constant one or balanced one. At the detector $D3$ the photon state becomes $ (|H\rangle_1 +|V\rangle_{1})|V\rangle_{D3}/\sqrt{2}. $ So a vertically polarized photon is detected by the $D3$ detector. That is, $$\sigma^{D3}_z=-1. \label{Pauliz2}$$ Therefore in the balanced function case, the changes of the polarization states of the photons due to the dove prisms, HWP6 and the last HWP($\theta=45^{\circ}$) are: $ (|V\rangle_{a}-|V\rangle_{b})/\sqrt{2}. $ Hence, we detect only vertically polarized photons in $D4$. This implies $$\begin{aligned} (\sigma^{a}_z=\sigma^{b}_z=)\sigma^{D4}_z=-1.\label{PauliBz2}\end{aligned}$$ Hence from Eqs. (\[Pauliz2\]) and (\[PauliBz2\]) the value of observable $\sigma^{D3}_z \sigma^{D4}_z$ should be $+1$. This is one of the result of a single run of the experiment, i.e., $$\begin{aligned} \sigma^{D3}_z \sigma^{D4}_z=+1.\label{PaulifinalBz2}\end{aligned}$$ In the constant function case, similarly we get after the dove prisms, HWP6 and the last HWP($\theta=45^{\circ}$) $ (|H\rangle_{a}+|H\rangle_{b})/\sqrt{2}. $ And, we detect horizontally polarized photons in $D4$. This implies $$\begin{aligned} (\sigma^{a}_z=\sigma^{b}_z=)\sigma^{D4}_z=+1.\label{PauliCz2}\end{aligned}$$ Hence from Eqs. (\[Pauliz2\]) and (\[PauliCz2\]) the value of observable $\sigma^{D3}_z\sigma^{D4}_z$ should be $-1$. This is one of the success result of a single run of the experiment, i.e., $$\begin{aligned} \sigma^{D3}_z\sigma^{D4}_z=-1.\label{PaulifinalCz2}\end{aligned}$$ Thereby, we can determine whether a given function (B) is constant or balanced with utilizing the state $|V\rangle_1|H\rangle_{1'}$. Thus, we can determine whether either a given function (A) or (B) is constant or balanced with utilizing EPR entanglement. Clearly, many EPR experiments evaluate two functions simultaneously, i.e, Deutsch algorithm exhibiting a four to one speed up. In the next section, we assume the existence of experimental imperfections and we present the method to determine the lower bound of the success probability of our scheme presented by Fig. \[setup3\]. Especially, a violation of Bell locality in the Hilbert space formalism of quantum theory ensure the success probability is larger than $1/\sqrt{2}$. Bell operator analysis {#witness} ======================= In the previous section, we have assumed that the initial state is a two-photon entangled state $ |\Psi\rangle=(|V\rangle_z |H\rangle_z -|H\rangle_z|V\rangle_z)/\sqrt{2}$. We now insert a polarizer oriented at $45^{\circ}$ and a HWP ($\lambda/2$ plate) in front of each detector. See Fig. \[sigmaX\]. This allows the measurement of polarized photon states described in polarized basis $x$. That is, one can measure an observable $\sigma_x$ in this way. Due to the feature of the initial state, the same situation occurs in the ideal case. The situation is as follows. One can see $$\begin{aligned} |H\rangle_x=\frac{|H\rangle_z+|V\rangle_z}{\sqrt{2}},\nonumber\\ |V\rangle_x=\frac{|H\rangle_z-|V\rangle_z}{\sqrt{2}}.\end{aligned}$$ Let us rewrite the initial state $|\Psi\rangle$ using $x$ polarization basis. We have $ |\Psi\rangle=(|V\rangle_x |H\rangle_x -|H\rangle_x|V\rangle_x)/\sqrt{2}$. This implies that the scheme mentioned in the preceding section works in the same way. However, we have to take the imperfection of the photon detection and defects in optical device into account. ![A setup of measurement of polarization in $z$ basis and in $x$ basis[]{data-label="sigmaX"}](fig3b.eps){width="25.00000%"} Here we introduce Bell operators: $$\begin{aligned} &&B_A=\frac{1}{\sqrt{2}}(\sigma^{D1}_x\sigma^{D2}_x +\sigma^{D1}_z\sigma^{D2}_z)\nonumber\\ &&B_B=\frac{1}{\sqrt{2}}(\sigma^{D3}_x\sigma^{D4}_x +\sigma^{D3}_z\sigma^{D4}_z).\end{aligned}$$ First of all, we check if both of the following Bell inequalities [@BELL] are violated: $$\begin{aligned} |\langle B_A\rangle_{\rm avg}|\leq 1,~ |\langle B_B\rangle_{\rm avg}|\leq 1.\end{aligned}$$ When both of the Bell inequalities are violated, we can ensure that the success probability of our Deutsch algorithm is larger than $1/\sqrt{2}$ in the experiment as shown below. We note here that if experimental error exits one could misjudge the unknown function. For instance, it is possible that actually observed data says that the unknown function is constant even though the unknown function is in fact balanced. Such a wrong case occurs when experimental error is larger than a half. Nevertheless, our analysis rules out such a wrong case since a violation of two Bell inequalities ensures the success probability of our scheme is larger than $1/\sqrt{2}$. In Table \[TABLE\_ADV\], we summarize the relationship between a violation of Bell inequalities and the two types of functions ($A$) and ($B$). $A$ $B$ ---------- ----------------------------------- ----------------------------------- Balanced $\langle B_A\rangle_{\rm avg}>1$ $\langle B_B\rangle_{\rm avg}>1$ Constant $\langle B_A\rangle_{\rm avg}<-1$ $\langle B_B\rangle_{\rm avg}<-1$ : The rationship between the the violation of Bell inequalities and the two kinds of functions ($A$) and ($B$).[]{data-label="TABLE_ADV"} The situation is as follows. First, we consider the case in which the unknown function (A) is balanced. The fidelity to $(|H\rangle_{D1}|H\rangle_{D2}+|V\rangle_{D1}|V\rangle_{D2})/\sqrt{2}$ in some quantum state $\rho$ (the success probability) is bounded as [@NAGATA1] $$\begin{aligned} \langle B_A/\sqrt{2}\rangle \leq f^A_b \leq \frac{\langle B_A/\sqrt{2}\rangle+1}{2}.\end{aligned}$$ In an ideal case, we have $ \langle B_A\rangle=\sqrt{2}. $ In the presence of experimental noise, we have $$\begin{aligned} \langle B_A \rangle= \frac{1}{\sqrt{2}}(\langle\sigma_x^{D1} \sigma_x^{D2}\rangle_{\rm avg}+ \langle\sigma_z^{D1} \sigma_z^{D2}\rangle_{\rm avg}).\end{aligned}$$ Hence, we can determine the range of the value of the success probability $f^A_b$ in the presence of experimental noise. Thus, a violation of Bell inequalities implies the success probability $f^A_b$ is larger than $1/\sqrt{2}$ at least. We can analyze the case where the unknown function (B) is balanced in a similar way. Next, we consider the case where the unknown function (A) is constant. The fidelity to $(|H\rangle_{D1}|V\rangle_{D2} -|V\rangle_{D1}|H\rangle_{D2})/\sqrt{2}$ in some quantum state $\rho$ (the success probability) is bounded as $$\begin{aligned} -\langle B_A/\sqrt{2}\rangle \leq f_c^A \leq \frac{-\langle B_A/\sqrt{2}\rangle+1}{2}.\end{aligned}$$ In ideal case, we have $ \langle B_A \rangle=-\sqrt{2}. $ In the presence of the experimental noise, we have $$\begin{aligned} \langle B_A \rangle= -\frac{1}{\sqrt{2}}(\langle\sigma_x^{D1} \sigma_x^{D2}\rangle_{\rm avg}+ \langle\sigma_z^{D1} \sigma_z^{D2}\rangle_{\rm avg}).\end{aligned}$$ Hence, we can determine the range of the value of the success probability $f_c^A$ in the presence of experimental noise. Thus, a violation of Bell inequalities implies the success probability $f^A_c$ is larger than $1/\sqrt{2}$ at least. We can analyze the case where the unknown function (B) is constant in a similar way. We have two functions (A) and (B). The global success probability of our Deutsch algorithm is given by $$\begin{aligned} P_{\rm success}=\frac{f^A_{k_1}+f^B_{k_2}}{2}~~(k_1,k_2\in\{b,c\}).\end{aligned}$$ Clearly, this value $P_{\rm success}$ is equal to the global probability with which a perfectly entangled state is detected. As an example, suppose that the case where conditions $\langle B_A\rangle_{\rm avg}>1$ and $\langle B_B\rangle_{\rm avg}<-1$ are met. We can know that the unknown function (A) is balanced and (B) is constant. In this case, our Deutsch scheme presented in Fig. \[setup3\] succeeds with the probability of the value $(\langle B_A/\sqrt{2}\rangle_{\rm avg} +\langle-B_B/\sqrt{2}\rangle_{\rm avg})/2$ at least. This value is equal to the lower bound of the probability with which a perfect entangled state is detected, i.e., the lower bound of the global success probability of our Deutsch algorithm. We can analyze other cases (there are four cases in fact) in the same way. So we can probabilistically determine whether each of two functions is constant or balanced simultaneously, based on a violation of two Bell inequalities and the evaluation of the success fidelity with utilizing two-photon entangled state. This implies [*probabilistic*]{} Deutsch algorithm exhibiting a four to one speed up in ideal case. A violation of Bell locality in Hilbert space says probabilistic Deutsch algorithm exhibiting a $2\sqrt{2}$ to one speed up at least. Summary and conclusion {#summary} ====================== In summary, we have presented a linear-optical implementation of quantum algorithm with the use of entanglement of photon states. For the process of Deutsch algorithm, two-photon two-qubit entangled states have been considered in conjunction with a polarization-based C-NOT gate. The algorithm presented here is the only algorithm which incorporates the Deutsch algorithm with a violation of Bell inequalities, to date. A violation of Bell inequalities ensures the success of probabilistic Deutsch algorithm with two unknown functions which exhibits at least a $2\sqrt{2}$ to one speed-up probabilistically. The global nonlocal effect leads us to make quantum computer faster than usual ones. This work has been supported by Frontier Basic Research Programs at KAIST and K.N. is supported by the BK21 research professorship. [9]{} K. Nagata and T. Nakamura, arXiv:0810.3134. J. I. Cirac and P. Zoller, Phys. Rev. Lett. [**74**]{}, 4091 (1995). D. Jaksch, Contemp. Phys. [**45**]{}, 367 (2004). T. Hayashi, T. Fujisawa, H. D. Cheong, Y. H. Jeong, and Y. Hirayama, Phys. Rev. Lett. [**91**]{}, 226804 (2003). N. A. Gershenfeld and I. L. Chuang, Science [**275**]{}, 350 (1997). Y. Nakamura, Yu. A. Pashkin, and J. S. Tsai, Nature [**398**]{}, 786 (1999). J. Ahn, T. C. Weinacht, and P. H. Bucksbaum, Science [**287**]{}, 463 (2000). N. Bhattacharya, H. B. van Linden van den Heuvell, and R. J. Spreeuw, Phys. Rev. Lett. [**88**]{}, 137901 (2002). M. A. Nielsen and I. L. Chuang, [*Quantum Computation and Quantum Information*]{} (Cambridge University Press, Cambridge, 2000). A. Galind and M. A. Martín-Delgado, Rev. Mod. Phys. [**74**]{}, 347 (2002). A. K. Ekert, Phys. Rev. Lett. [**67**]{}, 661 (1991); V. Scarani and N. Gisin, Phys. Rev. Lett. [**87**]{}, 117901 (2001); A. Acín, N. Gisin, and V. Scarani, Quant. Inf. Comp. [**3**]{}, 563 (2003). . Brukner, M. Żukowski, J.-W. Pan, and A. Zeilinger, Phys. Rev. Lett. [**92**]{}, 127901 (2004). A. N. de Oliveira, S. P. Walborn, and C. H. Monken, J. Opt. B: Quantum Semiclass. Opt. [**7**]{}, 288-292 (2005). Y.-H. Kim, Phys. Rev. A [**67**]{}, 040301(R) (2003). M. Mohseni, J. S. Lundeen, K. J. Resch, and A. M. Steinberg, Phys. Rev. Lett. [**91**]{}, 187903 (2003). J. S. Bell, Physics (Long Island City, N.Y.) [**1**]{}, 195 (1964); J. F. Clauser, M. A. Horne, A. Shimony, and R. A. Holt, Phys. Rev. Lett. [**23**]{}, 880 (1969). D. Deutsch, [*Proc. Roy. Soc. London Ser. A*]{} [**400**]{}, 97 (1985). K. Nagata, M. Koashi, and N. Imoto, Phys. Rev. A [**65**]{}, 042314 (2002). M. Fiorentino and F. N. C. Wong, Phys. Rev. Lett. [**93**]{}, 070502 (2004).
<?xml version="1.0" encoding="utf-8"?> <Type Name="ParallelMergeOptions" FullName="System.Linq.ParallelMergeOptions"> <TypeSignature Language="C#" Value="public enum ParallelMergeOptions" /> <TypeSignature Language="ILAsm" Value=".class public auto ansi sealed ParallelMergeOptions extends System.Enum" /> <AssemblyInfo> <AssemblyName>System.Core</AssemblyName> <AssemblyVersion>4.0.0.0</AssemblyVersion> </AssemblyInfo> <Base> <BaseTypeName>System.Enum</BaseTypeName> </Base> <Docs> <remarks> <attribution license="cc4" from="Microsoft" modified="false" /> <para>Use NotBuffered for queries that will be consumed and output as streams, this has the lowest latency between beginning query execution and elements being yielded. For some queries, such as those involving a sort (OrderBy, OrderByDescending), buffering is essential and a hint of NotBuffered or AutoBuffered will be ignored. However, queries that are created by using the AsOrdered operator can be streamed as long as no further sorting is performed within the query itself.</para> <para>Use AutoBuffered for most cases; this is the default. It strikes a balance between latency and overall performance. </para> <para>Use FullyBuffered for queries when the entire output can be processed before the information is needed. This option offers the best performance when all of the output can be accumulated before yielding any information, though it is not suitable for stream processing or showing partial results mid-query.</para> </remarks> <summary> <attribution license="cc4" from="Microsoft" modified="false" /> <para>Specifies the preferred type of <newTerm>output merge</newTerm> to use in a query. In other words, it indicates how PLINQ should merge the results from the various partitions back into a single result sequence. This is a hint only, and may not be respected by the system when parallelizing all queries.</para> </summary> </Docs> <Members> <Member MemberName="AutoBuffered"> <MemberSignature Language="C#" Value="AutoBuffered" /> <MemberSignature Language="ILAsm" Value=".field public static literal valuetype System.Linq.ParallelMergeOptions AutoBuffered = int32(2)" /> <MemberType>Field</MemberType> <AssemblyInfo> <AssemblyVersion>4.0.0.0</AssemblyVersion> </AssemblyInfo> <ReturnValue> <ReturnType>System.Linq.ParallelMergeOptions</ReturnType> </ReturnValue> <Docs> <summary> <attribution license="cc4" from="Microsoft" modified="false" /> <para>Use a merge with output buffers of a size chosen by the system. Results will accumulate into an output buffer before they are available to the consumer of the query.</para> </summary> </Docs> </Member> <Member MemberName="Default"> <MemberSignature Language="C#" Value="Default" /> <MemberSignature Language="ILAsm" Value=".field public static literal valuetype System.Linq.ParallelMergeOptions Default = int32(0)" /> <MemberType>Field</MemberType> <AssemblyInfo> <AssemblyVersion>4.0.0.0</AssemblyVersion> </AssemblyInfo> <ReturnValue> <ReturnType>System.Linq.ParallelMergeOptions</ReturnType> </ReturnValue> <Docs> <summary> <attribution license="cc4" from="Microsoft" modified="false" /> <para>Use the default merge type, which is AutoBuffered.</para> </summary> </Docs> </Member> <Member MemberName="FullyBuffered"> <MemberSignature Language="C#" Value="FullyBuffered" /> <MemberSignature Language="ILAsm" Value=".field public static literal valuetype System.Linq.ParallelMergeOptions FullyBuffered = int32(3)" /> <MemberType>Field</MemberType> <AssemblyInfo> <AssemblyVersion>4.0.0.0</AssemblyVersion> </AssemblyInfo> <ReturnValue> <ReturnType>System.Linq.ParallelMergeOptions</ReturnType> </ReturnValue> <Docs> <summary> <attribution license="cc4" from="Microsoft" modified="false" /> <para>Use a merge with full output buffers. The system will accumulate all of the results before making any of them available to the consumer of the query.</para> </summary> </Docs> </Member> <Member MemberName="NotBuffered"> <MemberSignature Language="C#" Value="NotBuffered" /> <MemberSignature Language="ILAsm" Value=".field public static literal valuetype System.Linq.ParallelMergeOptions NotBuffered = int32(1)" /> <MemberType>Field</MemberType> <AssemblyInfo> <AssemblyVersion>4.0.0.0</AssemblyVersion> </AssemblyInfo> <ReturnValue> <ReturnType>System.Linq.ParallelMergeOptions</ReturnType> </ReturnValue> <Docs> <summary> <attribution license="cc4" from="Microsoft" modified="false" /> <para>Use a merge without output buffers. As soon as result elements have been computed, make that element available to the consumer of the query.</para> </summary> </Docs> </Member> </Members> </Type>
Q: Why is the wrong explanation of "air travels a longer distance and creates a lift" so popular? When I was learning for my license, one of the first diagrams I remember was about the wing profile. The air going around the wing and on the upper side it has to travel a longer way, thus generating lower pressure and bang, plane is flying. Same explanation already back at school. See my other question: if the theory was right, why can planes fly inverted? So here's the follow up: why is this wrong theory so popular and still part of books? Wouldn't it make sense to teach students how a wing really works? I mean just look at any RC plane meeting - you'll be amazed what weird designs are capable of flying if there's enough engine power. A: Long story short is that both Newton's third law and the Bernoulli's effect are two different ways of explaining the same phenomena. Accurate equations have been written to explain both. Newton's third law, the air being forced down and forcing the airplane up, is actually the effect of lift though not the cause. The cause of lift is the change in pressure. The falsehood that is taught is usually that the two little air particles actually meet up at the same point downstream at the trailing edge of the wing at the same time. This is completely false. In fact, if you were to actually track two air particles, one over the top, and one across the bottom, the one going over the top of the wing will probably arrive much sooner than the one on the bottom! [Even though the distance IS longer] It picks up that much speed. Also they don't actually really meetup again afterwards at all. The real pivotal relation (which I learned in my Advanced Aerodynamics class at ERAU using John. D. Anderson's book Intro to Flight) is the Kutta-Joukowsky theorem. Taking the time to explain this to a Private Pilot student would probably be a waste of your time and theirs but I will sum it up here anyway to be fair to the question. I will assume incompressible flow because after about Mach .3< it starts to get more complicated. The Kutta-Joukowsky theorem takes the integral of velocity times the cosine of the incremental angle of the distance along the closed curve. This is a quantity called circulation. The lift equation is then formed as lift equals density (altitude basically) times velocity times circulation. So if you really want get in-depth here is an article from MIT that explains potential flow theory. What you will find is that the cause of lift is indeed directly related to Bernoulli's principle in that the change in pressure is what creates the lift. However it has nothing to do with particles meeting up at the trailing edge because they never really do meet up. This doesn't discount Newton's third law either: lift can be explained that way but it is the effect of lift, not the actual cause. And yes, like you mentioned, even a flat-plate for example can create lift when angled right in a wind tunnel. A: Wouldn't it make sense to teach students how a wing really works? No, not really. Ask any (good) CFI and they'll tell you that there are certain topics that a student really needs to understand properly. Examples: What's a stabilized approach and how do you fly one? (A disappointing number of students tell me it means holding the same airspeed all the way down) Why do we clear the prop area? (You'd think this would be too simple to screw up, but there's been more students than I've got fingers on my throttle hand who haven't yelled "clear!" until they're already cranking the engine.) And so on. How a wing really works is not one of these topics - the consequences of misunderstanding a stabilized approach are that you screw it up and your landings are terrible (or even dangerous). The consequences of misunderstanding prop safety are that someone loses a hand or dies. The consequences of misunderstanding how a wing generates lift are...well...the wing keeps flying anyway. Now, if the student is an aerospace engineer, they'll need to know the real story, but for a pilot, they can continue in their ignorance for their entire career and never be negatively affected (unless they meet an aerospace engineer in a bar and get into a fight). To extend the point, I myself tell students that to properly understand GPS, you need to get into the theory of relativity, but for a functional but incorrect understanding, you can think of it as "DME-in-space". It's very wrong on several levels, but it's enough to satisfy the needs of that category of student - same as the wing pressure-differential explanation.
Effects of obeticholic acid on lipoprotein metabolism in healthy volunteers. The bile acid analogue obeticholic acid (OCA) is a selective farnesoid X receptor (FXR) agonist in development for treatment of several chronic liver diseases. FXR activation regulates lipoprotein homeostasis. The effects of OCA on cholesterol and lipoprotein metabolism in healthy individuals were assessed. Two phase I studies were conducted to evaluate the effects of repeated oral doses of 5, 10 or 25 mg OCA on lipid variables after 14 or 20 days of consecutive administration in 68 healthy adults. Changes in HDL and LDL cholesterol levels were examined, in addition to nuclear magnetic resonance analysis of particle sizes and sub-fraction concentrations. OCA elicited changes in circulating cholesterol and particle size of LDL and HDL. OCA decreased HDL cholesterol and increased LDL cholesterol, independently of dose. HDL particle concentrations declined as a result of a reduction in medium and small HDL. Total LDL particle concentrations increased because of an increase in large LDL particles. Changes in lipoprotein metabolism attributable to OCA in healthy individuals were found to be consistent with previously reported changes in patients receiving OCA with non-alcoholic fatty liver disease or non-alcoholic steatohepatitis.
The Best Gluten Free Restaurants in London The very best gluten free restaurants in London! Exactly where to find the safest and most amazing gluten free food in London! When Mr. Maebell was diagnosed with celiac 12 years ago we were seniors in high school. Right up until his diagnoses we had been sharing my afternoon snack of wheat thins in 4th period Economics. Quite abruptly that changed. At that time the 18 year old versions of us never ever thought we would be able to travel the way we both wanted to. Making sure you can have gluten free food prepared with no cross contamination concerns was just so unlikely. Fortunately, we were wrong. We just finished our second trip to Europe and I can tell you the food was not an issue. There are SO MANY amazing gluten free options! These are some of our favorites from the trip! Honest Burger We ate at Honest Burger three times during our stay. We lodged in South Kensington and it was an easy walk from our hotel. This small chain of burger joints is not 100% gluten free, however, once I spoke with them and did some research I felt it was a safe option. The staff had an amazing understanding of how important cross contamination was. After we placed our order each time the waiter would ask if we had any other dietary concerns, at first I thought they only asked that because we specified that we had to have gluten free items but I heard them ask the tables around us as well. Credit: Honest Burger Instagram The really cool thing about Honest Burger is that they have a small, albeit impressive menu and we could have every single item on it! Onion rings, burgers, fries, a delicious chicken sandwich, it was all fair game! They do offer regular gluten full buns, but they use separate toasters, and workspace and they change gloves. One of the owners is unable to eat gluten so they have great procedures in place to prevent contamination. Breakfast options: the traditional English breakfast (that was a TON of food) and the avocado toast with eggs and chorizo. The verdict: I felt the food was safe and delicious. Mr. Maebell loved the Chili burger and I loved the grilled chicken sandwich. The fries and onion rings are amazing, don’t skip the chipotle mayo dipping sauce! The breakfast was fine, though not our favorite but it was difficult to find gluten free breakfast so I am very grateful they had options for us! Oh man, what a gem. This was my favorite place, hands down. Actually next time we visit London I will likely choose a hotel based on it’s proximity to Niche, that is how much I enjoyed it. This 100% gluten free restaurant has a range of options. We started off with the NFC basket, which featured fried chicken tenders, BBQ sauce and ranch. It was great and I wish they offered it as a dinner option. My husband got a burger that came with fries and coleslaw and I got the Chicken Pie, which I am still craving. The chicken pie came in the most wonderfully flaky crust and was perfectly seasoned. I am on a mission to recreate it! The verdict: We loved it. We were stuffed, otherwise we would have tried dessert. Put this one at the top of your list. Côte Brasserie happened to be our saving grace one day. It was on our list of restaurants and we literally stumbled into it while on our way to another restaurant. We had walked miles and were super hungry so we went right in. This French restaurant has a lot to offer, it has lunch specials and an extensive gluten free menu. And a Crème Caramel dessert to die for. What we tried The verdict: We went to see Aladian while we were there and this is just a few doors down, so it was really nice to have dinner and see a show. This 100% gluten free pasta house is small, so seating is limited and you might want to make reservations. We actually went because I had read they had great gluten free tiramisu, but it was not on the menu and they waiter said they didn’t have any, so I’m not sure if it has been discontinued. What we had: The bread basket which featured several different kinds of gluten free bread, the tomato muffin was my favorite. It also came with butter, salt and olives. Mr. Maebell ordered the Tomato pappardelle with Bolognese Ragu and I had the Artichokes Carbonara Tagliatelle. The verdict: Both meals were delicious and filling. This was the only gluten free pasta house I came across that I felt was a safe gluten free option. They also offer ravioli! Beyond Bread was my big hope for a gluten free croissant, alas, they did not have any. I had been stalking this 100% gluten free bakeries instagram for a while so I knew we had to stop in. The shop is an easy walk to the British Museum so we stopped in for breakfast. What we had: Mr. Maebell had the waffles with bacon and I had the french toast. My french toast was great, the bread was soft and fluffy and the mascraphone topping was wonderful. Go do it London was wonderful. This was our second trip to Europe and I can assure you it is far easier to accommodate a gluten free diet there than it is in the USA. Not only are the options plentiful, but they understand cross contamination. If you are on the fence about traveling abroad don’t let dietary restrictions hold you back. There is so much WORLD out there, go see it!
[A case report of incomplete endocardial cushion defect with mitral stenosis in an elderly patient]. The following paper describes a mitral valve replacement (SJM 27 mm), the patch closure (EPTFE) of an ostium primum atrial septal defect and tricuspid annuloplasty (De Vega's method) in a 64-year-old female patient with an incomplete endocardial cushion defect and mitral stenosis. Surgery revealed thickened, mitral valve leaflets and the presence of a cleft, findings similar to those observed in case of rheumatic degeneration. Investigation of patient hemodynamics confirmed a diagnosis of Lutembacher syndrome and a lower with left ventricle volume. After surgery, the volume of left ventricle increased and the patients clinical course was uneventful.
Seoul urged to handle Yasukini case fairly Liu was arrested in South Korea for throwing Molotov cocktails at the Japanese embassy in Seoul. The Japanese government has asked for his extradition after he set fire to the Yasukuni Shrine to express his hatred to Japan. Liu's grandmother is a …Read more on Global Times
hello good night, I have a chuwi vi8 plus and I need the windows to install it, I would like that loaded the link to mega or some other cloud service since currently this gives me trouble, I really would like to support me, greetings Hi good afternoon, I have trouble downloading Windows 10, should loading to another server, or at least divided into two parts of the file, as I have tried downloading several times and I mark error reach 2 gb, I really I would like to help me. regards Here is the singleboot Bios. Your tablet is dualboot Vi8 Plus. You flashed a error Bios. If you can't use a professional programmer tool to flash dualboot Bios, you have to return it to your seller for repair. Hello! I need the driver for vi8 plus p32g22160700053. It was originally set andoid and windows. Drivers that you laid out are not suitable for my version. It does not work touch screen and bluetooth. You can put the driver specifically for this model? I try all the possible drivers of different tablets Chuwi, but nothing is impossible. Thank you in advance!
/* * Copyright (C) 2017 The Android Open Source Project * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License */ package com.android.tools.build.bundletool.model; import static com.android.tools.build.bundletool.model.BundleModule.APEX_DIRECTORY; import static com.android.tools.build.bundletool.model.BundleModule.ASSETS_DIRECTORY; import static com.android.tools.build.bundletool.model.BundleModule.DEX_DIRECTORY; import static com.android.tools.build.bundletool.model.BundleModule.LIB_DIRECTORY; import static com.android.tools.build.bundletool.model.BundleModule.RESOURCES_DIRECTORY; import static com.android.tools.build.bundletool.model.BundleModule.ROOT_DIRECTORY; import static com.android.tools.build.bundletool.model.SourceStamp.STAMP_SOURCE_METADATA_KEY; import static com.android.tools.build.bundletool.model.SourceStamp.STAMP_TYPE_METADATA_KEY; import static com.android.tools.build.bundletool.model.utils.ResourcesUtils.SCREEN_DENSITY_TO_PROTO_VALUE_MAP; import static com.android.tools.build.bundletool.model.utils.TargetingNormalizer.normalizeApkTargeting; import static com.android.tools.build.bundletool.model.utils.TargetingNormalizer.normalizeVariantTargeting; import static com.google.common.base.Preconditions.checkArgument; import static com.google.common.base.Preconditions.checkState; import static com.google.common.collect.ImmutableList.toImmutableList; import static com.google.common.collect.MoreCollectors.toOptional; import com.android.aapt.Resources.ResourceTable; import com.android.bundle.Config.ApexEmbeddedApkConfig; import com.android.bundle.Files.ApexImages; import com.android.bundle.Files.Assets; import com.android.bundle.Files.NativeLibraries; import com.android.bundle.Targeting.Abi; import com.android.bundle.Targeting.AbiTargeting; import com.android.bundle.Targeting.ApkTargeting; import com.android.bundle.Targeting.GraphicsApi; import com.android.bundle.Targeting.GraphicsApiTargeting; import com.android.bundle.Targeting.LanguageTargeting; import com.android.bundle.Targeting.MultiAbi; import com.android.bundle.Targeting.MultiAbiTargeting; import com.android.bundle.Targeting.OpenGlVersion; import com.android.bundle.Targeting.Sanitizer; import com.android.bundle.Targeting.Sanitizer.SanitizerAlias; import com.android.bundle.Targeting.SanitizerTargeting; import com.android.bundle.Targeting.TextureCompressionFormatTargeting; import com.android.bundle.Targeting.VariantTargeting; import com.android.bundle.Targeting.VulkanVersion; import com.android.tools.build.bundletool.model.BundleModule.ModuleType; import com.android.tools.build.bundletool.model.SourceStamp.StampType; import com.android.tools.build.bundletool.model.utils.ResourcesUtils; import com.google.auto.value.AutoValue; import com.google.auto.value.extension.memoized.Memoized; import com.google.common.base.Joiner; import com.google.common.base.Predicate; import com.google.common.base.Predicates; import com.google.common.collect.ImmutableList; import com.google.common.collect.ImmutableSet; import com.google.common.collect.Multimap; import com.google.common.collect.Multimaps; import com.google.errorprone.annotations.Immutable; import java.net.MalformedURLException; import java.net.URISyntaxException; import java.net.URL; import java.util.List; import java.util.Optional; import java.util.StringJoiner; import java.util.stream.Stream; import javax.annotation.CheckReturnValue; /** A module split is a subset of a bundle module. */ @Immutable @AutoValue @AutoValue.CopyAnnotations public abstract class ModuleSplit { private static final Joiner MULTI_ABI_SUFFIX_JOINER = Joiner.on('.'); /** The split type being represented by this split. */ public enum SplitType { STANDALONE, SYSTEM, SPLIT, INSTANT, ASSET_SLICE, } /** * Returns the targeting of the APK represented by this instance. * * <p>Order of repeated all repeated fields is guaranteed to be deterministic. */ public abstract ApkTargeting getApkTargeting(); /** * Returns the targeting of the Variant this instance belongs to. * * <p>Order of repeated all repeated fields is guaranteed to be deterministic. */ public abstract VariantTargeting getVariantTargeting(); /** Whether this ModuleSplit instance represents a standalone, split, instant or system apk. */ public abstract SplitType getSplitType(); /** * Returns AppBundle's ZipEntries copied to be included in this split. * * @return entries representing files copied from the bundle in this split. They exclude special * files such as: manifest and resources which are generated explicitly. The keys are paths * inside the module, as opposed to the original bundle's ZipEntry names. */ public abstract ImmutableList<ModuleEntry> getEntries(); public abstract Optional<ResourceTable> getResourceTable(); public abstract AndroidManifest getAndroidManifest(); public abstract ImmutableList<ManifestMutator> getMasterManifestMutators(); public abstract BundleModuleName getModuleName(); public abstract boolean isMasterSplit(); public abstract Optional<NativeLibraries> getNativeConfig(); public abstract Optional<Assets> getAssetsConfig(); /** The module APEX configuration - what system images it contains and with what targeting. */ public abstract Optional<ApexImages> getApexConfig(); public abstract ImmutableList<ApexEmbeddedApkConfig> getApexEmbeddedApkConfigs(); public abstract Builder toBuilder(); /** Returns true iff this is split of the base module. */ public boolean isBaseModuleSplit() { return getModuleName().equals(BundleModuleName.BASE_MODULE_NAME); } /** * Returns the split suffix base name based on the targeting. * * <p>The split suffix cannot contain dashes as they are not allowed by the Android Framework. We * replace them with underscores instead. */ public String getSuffix() { if (isMasterSplit()) { return ""; } StringJoiner suffixJoiner = new StringJoiner("_"); // The dimensions below should be ordered by their priority. AbiTargeting abiTargeting = getApkTargeting().getAbiTargeting(); if (!abiTargeting.getValueList().isEmpty()) { abiTargeting.getValueList().forEach(value -> suffixJoiner.add(formatAbi(value))); } else if (!abiTargeting.getAlternativesList().isEmpty()) { suffixJoiner.add("other_abis"); } MultiAbiTargeting multiAbiTargeting = getApkTargeting().getMultiAbiTargeting(); for (MultiAbi value : multiAbiTargeting.getValueList()) { suffixJoiner.add( MULTI_ABI_SUFFIX_JOINER.join( value.getAbiList().stream().map(ModuleSplit::formatAbi).collect(toImmutableList()))); } // Alternatives without values are not supported for MultiAbiTargeting. SanitizerTargeting sanitizerTargeting = getApkTargeting().getSanitizerTargeting(); for (Sanitizer sanitizer : sanitizerTargeting.getValueList()) { if (sanitizer.getAlias().equals(SanitizerAlias.HWADDRESS)) { suffixJoiner.add("hwasan"); } else { throw new IllegalArgumentException("Unknown sanitizer"); } } LanguageTargeting languageTargeting = getApkTargeting().getLanguageTargeting(); if (!languageTargeting.getValueList().isEmpty()) { languageTargeting.getValueList().forEach(suffixJoiner::add); } else if (!languageTargeting.getAlternativesList().isEmpty()) { suffixJoiner.add("other_lang"); } getApkTargeting() .getScreenDensityTargeting() .getValueList() .forEach( value -> suffixJoiner.add( SCREEN_DENSITY_TO_PROTO_VALUE_MAP .inverse() .get(value.getDensityAlias()) .replace('-', '_'))); GraphicsApiTargeting graphicsApiTargeting = getApkTargeting().getGraphicsApiTargeting(); if (!graphicsApiTargeting.getValueList().isEmpty()) { graphicsApiTargeting .getValueList() .forEach(value -> suffixJoiner.add(formatGraphicsApi(value))); } else if (!graphicsApiTargeting.getAlternativesList().isEmpty()) { suffixJoiner.add("other_gfx"); } TextureCompressionFormatTargeting textureFormatTargeting = getApkTargeting().getTextureCompressionFormatTargeting(); if (!textureFormatTargeting.getValueList().isEmpty()) { textureFormatTargeting .getValueList() .forEach(value -> suffixJoiner.add(value.getAlias().name().toLowerCase())); } else if (!textureFormatTargeting.getAlternativesList().isEmpty()) { suffixJoiner.add("other_tcf"); } return suffixJoiner.toString(); } private static String formatAbi(Abi abi) { return AbiName.fromProto(abi.getAlias()).getPlatformName().replace('-', '_'); } private static String formatGraphicsApi(GraphicsApi graphicsTargeting) { StringJoiner result = new StringJoiner("_"); if (graphicsTargeting.hasMinOpenGlVersion()) { result.add("gl" + formatGlVersion(graphicsTargeting.getMinOpenGlVersion())); } else if (graphicsTargeting.hasMinVulkanVersion()) { result.add("vk" + formatVulkanVersion(graphicsTargeting.getMinVulkanVersion())); } return result.toString(); } private static String formatVulkanVersion(VulkanVersion vulkanVersion) { // Will treat missing minor as 0 which is fine. return vulkanVersion.getMajor() + "_" + vulkanVersion.getMinor(); } private static String formatGlVersion(OpenGlVersion glVersion) { // Will treat missing minor as 0 which is fine. return glVersion.getMajor() + "_" + glVersion.getMinor(); } /** Filters out any entries not referenced in the given resource table. */ public static ImmutableList<ModuleEntry> filterResourceEntries( ImmutableList<ModuleEntry> entries, ResourceTable resourceTable) { ImmutableSet<ZipPath> referencedPaths = ResourcesUtils.getAllFileReferences(resourceTable); return entries.stream() .filter(entry -> referencedPaths.contains(entry.getPath())) .collect(toImmutableList()); } /** Removes the {@code splitName} attribute from elements in the manifest. */ @CheckReturnValue public ModuleSplit removeSplitName() { AndroidManifest apkManifest = getAndroidManifest().toEditor().removeSplitName().save(); return toBuilder().setAndroidManifest(apkManifest).build(); } public ModuleSplit removeUnknownSplitComponents(ImmutableSet<String> knownSplits) { AndroidManifest apkManifest = getAndroidManifest().toEditor().removeUnknownSplitComponents(knownSplits).save(); return toBuilder().setAndroidManifest(apkManifest).build(); } /** Writes the source stamp in the split manifest. */ public ModuleSplit writeSourceStampInManifest(String stampSource, StampType stampType) { if (!isEligibleForSourceStamp()) { return this; } checkStampSource(stampSource); AndroidManifest apkManifest = getAndroidManifest() .toEditor() .addMetaDataString(STAMP_SOURCE_METADATA_KEY, stampSource) .addMetaDataString(STAMP_TYPE_METADATA_KEY, stampType.toString()) .save(); return toBuilder().setAndroidManifest(apkManifest).build(); } private boolean isEligibleForSourceStamp() { switch (getSplitType()) { case SPLIT: case INSTANT: return isBaseModuleSplit() && isMasterSplit(); case STANDALONE: return true; default: return false; } } private static void checkStampSource(String stampSource) { try { new URL(stampSource).toURI(); } catch (MalformedURLException | URISyntaxException e) { throw new IllegalArgumentException("Invalid stamp source. Stamp sources should be URLs.", e); } } /** Writes the final manifest that reflects the Split ID. */ @CheckReturnValue public ModuleSplit writeSplitIdInManifest(String resolvedSplitIdSuffix) { AndroidManifest moduleManifest = getAndroidManifest(); String splitId = generateSplitId(resolvedSplitIdSuffix); AndroidManifest apkManifest; if (isMasterSplit()) { apkManifest = moduleManifest.toEditor().setSplitIdForFeatureSplit(splitId).save(); } else { apkManifest = AndroidManifest.createForConfigSplit( moduleManifest.getPackageName(), moduleManifest.getVersionCode(), splitId, getSplitIdForMasterSplit(), moduleManifest.getExtractNativeLibsValue()); } return toBuilder().setAndroidManifest(apkManifest).build(); } /** Ensures that the {@code <application>} element is present in the manifest. */ @CheckReturnValue public ModuleSplit addApplicationElementIfMissingInManifest() { AndroidManifest modifiedManifest = getAndroidManifest().toEditor().addApplicationElementIfMissing().save(); return toBuilder().setAndroidManifest(modifiedManifest).build(); } /** Sets the hasCode attribute in the manifest to the given value. */ @CheckReturnValue public ModuleSplit setHasCodeInManifest(boolean hasCode) { AndroidManifest modifiedManifest = getAndroidManifest().toEditor().setHasCode(hasCode).save(); return toBuilder().setAndroidManifest(modifiedManifest).build(); } private String generateSplitId(String resolvedSuffix) { String masterSplitId = getSplitIdForMasterSplit(); if (isMasterSplit()) { return masterSplitId; } StringBuilder splitIdBuilder = new StringBuilder(masterSplitId); if (splitIdBuilder.length() > 0) { splitIdBuilder.append("."); } return splitIdBuilder.append("config.").append(resolvedSuffix).toString(); } private String getSplitIdForMasterSplit() { return getModuleName().getNameForSplitId(); } /** * Creates a builder to construct the {@link ModuleSplit}. * * <p>Prefer static factory methods when creating {@link ModuleSplit} from {@link BundleModule}. */ public static Builder builder() { return new AutoValue_ModuleSplit.Builder() .setEntries(ImmutableList.of()) .setSplitType(SplitType.SPLIT) .setApexEmbeddedApkConfigs(ImmutableList.of()); } /** * Creates a {@link ModuleSplit} with all entries from the {@link BundleModule} valid directories. * * <p>The generated ModuleSplit has an empty APK targeting and an empty variant targeting. */ public static ModuleSplit forModule(BundleModule bundleModule) { return forModule(bundleModule, VariantTargeting.getDefaultInstance()); } /** * Creates a {@link ModuleSplit} with all entries from the {@link BundleModule} valid directories * with an empty APK targeting and the given variant targeting. */ public static ModuleSplit forModule( BundleModule bundleModule, VariantTargeting variantTargeting) { return fromBundleModule( bundleModule, Predicates.alwaysTrue(), /* setResourceTable= */ true, variantTargeting); } /** * Creates a {@link ModuleSplit} only with the resources entries with an empty APK targeting and * an empty variant targeting. */ public static ModuleSplit forResources(BundleModule bundleModule) { return forResources(bundleModule, VariantTargeting.getDefaultInstance()); } /** * Creates a {@link ModuleSplit} only with the resources entries with an empty APK targeting and * the given variant targeting. */ public static ModuleSplit forResources( BundleModule bundleModule, VariantTargeting variantTargeting) { return fromBundleModule( bundleModule, entry -> entry.getPath().startsWith(RESOURCES_DIRECTORY), /* setResourceTable= */ true, variantTargeting); } /** * Creates a {@link ModuleSplit} only with the assets entries with an empty APK targeting and an * empty variant targeting. */ public static ModuleSplit forAssets(BundleModule bundleModule) { return forAssets(bundleModule, VariantTargeting.getDefaultInstance()); } /** * Creates a {@link ModuleSplit} only with the assets entries with an empty APK targeting and the * given variant targeting. */ public static ModuleSplit forAssets( BundleModule bundleModule, VariantTargeting variantTargeting) { return fromBundleModule( bundleModule, entry -> entry.getPath().startsWith(ASSETS_DIRECTORY), /* setResourceTable= */ false, variantTargeting); } /** * Creates a {@link ModuleSplit} only with the native library entries with an empty APK targeting * and an empty variant targeting. */ public static ModuleSplit forNativeLibraries(BundleModule bundleModule) { return forNativeLibraries(bundleModule, VariantTargeting.getDefaultInstance()); } /** * Creates a {@link ModuleSplit} only with the native library entries with an empty APK targeting * and the given variant targeting. */ public static ModuleSplit forNativeLibraries( BundleModule bundleModule, VariantTargeting variantTargeting) { return fromBundleModule( bundleModule, entry -> entry.getPath().startsWith(LIB_DIRECTORY), /* setResourceTable= */ false, variantTargeting); } /** * Creates a {@link ModuleSplit} only with the dex files with an empty APK targeting and an empty * variant targeting. */ public static ModuleSplit forDex(BundleModule bundleModule) { return forDex(bundleModule, VariantTargeting.getDefaultInstance()); } /** * Creates a {@link ModuleSplit} only with the dex files with an empty APK targeting and the given * variant targeting. */ public static ModuleSplit forDex(BundleModule bundleModule, VariantTargeting variantTargeting) { return fromBundleModule( bundleModule, entry -> entry.getPath().startsWith(DEX_DIRECTORY), /* setResourceTable= */ false, variantTargeting); } public static ModuleSplit forRoot(BundleModule bundleModule) { return forRoot(bundleModule, VariantTargeting.getDefaultInstance()); } public static ModuleSplit forRoot(BundleModule bundleModule, VariantTargeting variantTargeting) { return fromBundleModule( bundleModule, entry -> entry.getPath().startsWith(ROOT_DIRECTORY), /* setResourceTable= */ false, variantTargeting); } /** * Creates a {@link ModuleSplit} only with the apex image entries with an empty APK targeting and * an empty variant targeting. */ public static ModuleSplit forApex(BundleModule bundleModule) { return forApex(bundleModule, VariantTargeting.getDefaultInstance()); } public static ModuleSplit forApex(BundleModule bundleModule, VariantTargeting variantTargeting) { return fromBundleModule( bundleModule, entry -> entry.getPath().startsWith(APEX_DIRECTORY), /* setResourceTable= */ false, variantTargeting); } /** * Creates a {@link ModuleSplit} with entries from the Bundle Module satisfying the predicate with * the given variant targeting. * * <p>The created instance is not standalone thus its variant targets L+ devices initially. */ private static ModuleSplit fromBundleModule( BundleModule bundleModule, Predicate<ModuleEntry> entriesPredicate, boolean setResourceTable, VariantTargeting variantTargeting) { ModuleSplit.Builder splitBuilder = builder() .setModuleName(bundleModule.getName()) .setEntries( bundleModule.getEntries().stream() .filter(entriesPredicate) .collect(toImmutableList())) .setAndroidManifest(bundleModule.getAndroidManifest()) // Initially each split is master split. .setMasterSplit(true) .setSplitType(getSplitTypeFromModuleType(bundleModule.getModuleType())) .setApkTargeting(ApkTargeting.getDefaultInstance()) .setApexEmbeddedApkConfigs( ImmutableList.copyOf( bundleModule.getBundleConfig().getApexConfig().getApexEmbeddedApkConfigList())) .setVariantTargeting(variantTargeting); bundleModule.getNativeConfig().ifPresent(splitBuilder::setNativeConfig); bundleModule.getAssetsConfig().ifPresent(splitBuilder::setAssetsConfig); bundleModule.getApexConfig().ifPresent(splitBuilder::setApexConfig); if (setResourceTable) { bundleModule.getResourceTable().ifPresent(splitBuilder::setResourceTable); } return splitBuilder.build(); } private static SplitType getSplitTypeFromModuleType(ModuleType moduleType) { switch (moduleType) { case FEATURE_MODULE: return SplitType.SPLIT; case ASSET_MODULE: return SplitType.ASSET_SLICE; } throw new IllegalStateException(); } @Memoized Multimap<ZipPath, ModuleEntry> getEntriesByDirectory() { return Multimaps.index(getEntries(), entry -> entry.getPath().getParent()); } /** Returns all {@link ModuleEntry} that are directly inside the specified directory. */ public Stream<ModuleEntry> getEntriesInDirectory(ZipPath directory) { checkArgument(directory.getNameCount() > 0, "ZipPath '%s' is empty", directory); return getEntriesByDirectory().get(directory).stream(); } /** * Returns all {@link ModuleEntry} that have a relative module path under a given path. * * <p>Note: Consider using {@link #getEntriesByDirectory()} for performance, unless a recursive * search is truly needed. */ public Stream<ModuleEntry> findEntriesUnderPath(String path) { ZipPath zipPath = ZipPath.create(path); return findEntriesUnderPath(zipPath); } /** * Returns all {@link ModuleEntry} that have a relative module path under a given path. * * <p>Note: Consider using {@link #getEntriesByDirectory()} for performance, unless a recursive * search is truly needed. */ public Stream<ModuleEntry> findEntriesUnderPath(ZipPath zipPath) { return getEntriesByDirectory().asMap().entrySet().stream() .filter(dirAndEntries -> dirAndEntries.getKey().startsWith(zipPath)) .flatMap(dirAndEntries -> dirAndEntries.getValue().stream()); } /** Returns the {@link ModuleEntry} associated with the given path, or empty if not found. */ public Optional<ModuleEntry> findEntry(ZipPath path) { return getEntriesInDirectory(path.getParent()) .filter(entry -> entry.getPath().equals(path)) .collect(toOptional()); } /** Returns the {@link ModuleEntry} associated with the given path, or empty if not found. */ public Optional<ModuleEntry> findEntry(String path) { return findEntry(ZipPath.create(path)); } public boolean isApex() { return getApexConfig().isPresent(); } /** Builder for {@link ModuleSplit}. */ @AutoValue.Builder public abstract static class Builder { public abstract Builder setModuleName(BundleModuleName moduleName); public abstract Builder setMasterSplit(boolean isMasterSplit); public abstract Builder setNativeConfig(NativeLibraries nativeConfig); public abstract Builder setAssetsConfig(Assets assetsConfig); /** * Sets the module APEX configuration - what system images it contains and with what targeting. */ public abstract Builder setApexConfig(ApexImages apexConfig); public abstract Builder setApexEmbeddedApkConfigs( ImmutableList<ApexEmbeddedApkConfig> apexEmbeddedApkConfigs); protected abstract ApkTargeting getApkTargeting(); public abstract Builder setApkTargeting(ApkTargeting targeting); protected abstract VariantTargeting getVariantTargeting(); public abstract Builder setVariantTargeting(VariantTargeting targeting); public abstract Builder setSplitType(SplitType splitType); public abstract Builder setEntries(List<ModuleEntry> entries); public abstract Builder setResourceTable(ResourceTable resourceTable); public abstract Builder setAndroidManifest(AndroidManifest androidManifest); abstract ImmutableList.Builder<ManifestMutator> masterManifestMutatorsBuilder(); public Builder addMasterManifestMutator(ManifestMutator manifestMutator) { masterManifestMutatorsBuilder().add(manifestMutator); return this; } protected abstract ModuleSplit autoBuild(); public ModuleSplit build() { ModuleSplit moduleSplit = this.setApkTargeting(normalizeApkTargeting(getApkTargeting())) .setVariantTargeting(normalizeVariantTargeting(getVariantTargeting())) .autoBuild(); // For system splits the master split is formed by fusing Screen Density, Abi, Language // splits, hence it might have Abi, Screen Density, Language targeting set. if (moduleSplit.isMasterSplit() && !moduleSplit.getSplitType().equals(SplitType.SYSTEM)) { checkState( moduleSplit.getApkTargeting().toBuilder() .clearSdkVersionTargeting() // TCF can be set on standalone/universal APKs: if suffix stripping was enabled, // a default targeting suffix was used. .clearTextureCompressionFormatTargeting() .build() .equals(ApkTargeting.getDefaultInstance()), "Master split cannot have any targeting other than SDK version or Texture" + "Compression Format."); } return moduleSplit; } } }
<map id="OpenMesh::Utils::HeapT&lt; HeapEntry, HeapInterface &gt;" name="OpenMesh::Utils::HeapT&lt; HeapEntry, HeapInterface &gt;"> <area shape="rect" id="node2" title="STL class. " alt="" coords="19,95,190,121"/> </map>
Writer Céleste Parr on This Life’s small, meaningful moments Spoiler warning: Do not read this article until you have seen This Life Episode 204, “Communion.” Sunday’s episode of This Life, “Communion,” was a rough one for several members of the Lawson family. Natalie’s custody battle with David came to an abrupt end after Caleb chose not to testify against his father, and Matthew made a desperate move to save his marriage by bringing Nicole to meet his son. Meanwhile, Maggie made a disturbing discovery about Oliver. Céleste Parr co-wrote the episode with series showrunner Joseph Kay. A veteran of feature films, she turned her attention toward television in 2014, writing a pilot that caught Kay’s attention and eventually landing a spot in This Life‘s Season 2 writers’ room. “We both have a deep appreciation for the small and the understated,” Parr says of Kay. “They strike us both as being more emotionally powerful and resonant.” Joining us by phone from Montreal, Parr breaks down the major plot points in “Communion” and explains the importance of the show’s small, emotional story beats. Several scenes in this episode really resonated with me, including the two bathroom scenes with Nicole looking at the clothes of Julian and then later Abby. What’s the key to making quiet scenes like that work? Céleste Parr: I know that in my case, having worked in low-budget film, you sort of become very aware of small moments in your life that resonate and learning how to say a lot about an emotional moment or an emotional shift and to do so in a quiet and down-to-earth way. I actually find that it’s easier to create a visceral emotional response with small moments like that, because they trigger a sense of recognition in our lives. So I think it’s actually easier to tell an emotional story in small moments like that, small visual cues that ring true broadly just on a human emotional level. Natalie decides to stop fighting David in court after Caleb backs out of testifying. What is Natalie’s relationship with David going to be like going forward? Natalie, I think, is realizing now that she has no choice. Obviously, so much that’s going on with her is that she’s afraid that she’s not going to survive her illness, so she’s trying to parent her children posthumously. But to do that, she would have to control uncontrollable variables. She wasn’t able to control what happened in Matthew’s marriage, and she can’t control David, who’s elusive and inconsistent and, God forbid, more complex than the deadbeat she’s made him out to be in her mind. And she doesn’t even realize the extent to which her children are already outgrowing her control, and so moving forward with David, she’s going to have to open her eyes to a version of him that she used to be very close to, and loved even, and to recognize he’s a complex human being and that he might actually bring something to the lives of their children. I’m surprised that David has become one of my favourite characters. He’s so complex and real. Do you enjoy writing him? I love writing David. I’ve always been very drawn to writing characters who on the surface may appear antagonist or a villain or characters who present a threat, and I’ve always found it very rewarding to understand them. Instead of having a knee-jerk reaction of judging or reducing them to their worst qualities, really trying to connect with them and understand them, and to recognize bits of myself in them so that I can do justice to them as people, not just characters there to move the plot forward. Caleb moves out of Natalie’s house at the end of the episode. What’s that going to mean for him and for Natalie? For Caleb, it’s going to take some time for him. He’s going to have to spend some time in limbo trying to figure out who he is outside of what Natalie and his sisters have needed him to be, and who he is outside of trying to fill the shoes of David, who was absent for so many years. So, in this episode, Caleb has to make this difficult decision that, to him, he may worry that he may be perceived as letting down the family, but he’s finally stepping up for himself, and coming of age in this way, and becoming an adult. And we see this in [Episode] 203 with the fridge, he knows that he never has been able to be a father. You know, he was the man of the house before he was a man, and now he has to break off and grow into a man. And that’s going to part of Natalie having to let go of the things that made her feel safe and in control. She’s been able to count on Caleb and not realizing to what extent she was robbing Caleb of his own agency and his own identity. So she just has to trust in herself and the girls, and she has to trust in Caleb that he’s going to take care of himself. The scene between Matthew, Nicole and Beatrice was so hard to watch. What was Matthew’s plan there? We all recognized it as this great, terrible plan, bringing Nicole and Beatrice together. But I think the beauty of it, even though it is a terrible idea, is that he’s not wrong. He knew that if Nicole could see Julian, she would recognize the innocent life he’s trying to protect and nourish, which reminds her, heartbreakingly, of why she loves this man. And she sees traces of him in his son, so, of course, instinctively, she’s going to love that little boy, too, and connect emotionally to Matthew’s decision to be a father to his son. She’s really a mother at heart and she’s a deeply compassionate woman. Compassion, though, it also has a way making matters of the heart very complicated, because it was almost too easy and convenient for her to villainize Matthew and dismiss him as a con, but now she can’t. Nicole tells Matthew that she can’t move forward with him. Is there any way she can forgive him in the future? I think what we see in her in this episode is forgiveness. I think she does forgive him after this journey. But forgiveness is one thing, to continue to be vulnerable and intimate and to trust this man, that’s a whole other story. She’s going to have to look inside and see whether or not that’s a possibility for her, or whether she’s going to have to stand on her own. Maggie goes to Oliver’s studio and finds it in a deplorable state. What’s going on with him? Oliver is clearly struggling, and he’s a very private person, and he’s a very solitary person. So we’re going to discover at the same time as his family what’s happening with Oliver. That’s going to be a journey we take with the people who love him. But what we will see is that, with Matthew and Natalie’s lives imploding in these really spectacular ways, these really striking ways, the noise that creates within the family has made it too easy for others who are struggling to slip between the cracks unnoticed. Raza delivers some truth to Maggie this week. Their marriage might have been a bad idea, but is he good for her in a way? I think Raza is a much-needed touchstone for her. He’s not got much invested in making her happy. It’s not like he’s counting on getting lucky at the end of the night. So she comes to him and wants a dose of the truth, and he’s going to tell her the truth. And he, standing on the outside, has perspective that nobody else has, and he has no agenda here, so he can just level with her. Do you have a favourite scene in the episode? I was really surprised by the scene with Caleb and David at the end of the episode. I was blown away by the chemistry that those two actors have, but also physically, the difference between them on screen, the size of them. David being someone who is so comfortable in his skin and his body, and he’s just sort of processing his day, and then Caleb shows up sort of vulnerable and also having had kind of an epiphany. This bonding moment between them after all those years and all those feelings of betrayal and disappointment, for them to just connect in this moment, to actually see it, to feel the chemistry between them was really surprising. And then just at the end of the scene, the focus shifts—I mean literally the focus of the image—shifts from David to Caleb, and Caleb just sort of looks at his father with those big blue eyes, and he looks like a boy. And it’s like I’m seeing a boy and his father, and it really moved me. Something like that, you can’t put that on the page. Everyone does their job and you get these moments of magic like that. A.R. Wilson has been interviewing actors, writers and musicians for over 20 years. In addition to TV-Eh, her work has appeared in Curve, ROCKRGRL, Sound On Sight and Digital Journal. A native of Detroit, she grew up watching Mr. Dressup and The Friendly Giant on CBC, which led to a lifelong love of Canadian television. Her perpetual New Year's resolution is to become fluent in French.
Thank you for choosing The Resort at Glade Springs in West Virginia. Please enable javascript for a better browsing experience while visiting our site. If you do not, we understand, but some interactive features may be unavailable. Both packages require a two-night minimum stay. Rate based on double occupancy. Bridge Day was first celebrated in 1980 to commemorate the completion of the New River Gorge Bridge, the world's second longest single arch bridge. Today, it is rated one of the top 100 festivals in North America, and a must-see if you're planning an autumn vacation in southern West Virginia. The festival is unique in that it is the only day visitors may walk across the bridge. BASE jumpers can parachute from the railing and rappellers are allowed to descend and ascend fixed ropes. Vendors line both ends of the bridge selling crafts, shirts, photos, souvenirs, and refreshments. The spectacular fall foliage of the New River Gorge frames the event which is expected to attract hundreds of BASE jumpers and around 80,000 spectators this year. "BASE" is an acronym which stands for the four categories of objects from which one can jump - Building, Antenna, Span (the word used for a bridge), and Earth (the word used for a cliff.) Although 876 feet is extremely high, it is a quick 8 seconds from the bridge to the water of the New River below. Most jumpers will fall from the bridge 3-4 seconds before deploying their parachute, and then spend the next 20-30 seconds floating down to the designated landing zone located at the water's edge. If your vacation plans bring you to The Resort at Glade Springs in October, come enjoy Bridge Day, West Virginia's largest one-day festival! It appears you are using an older web browser! While using our site, you may encounter some trouble along the way. For PC users, we recommend upgrading to the latest version of Internet Explorer or Firefox. For Mac users, we recommend the latest version of Safari or Firefox. Thank you for choosing The Resort at Glade Springs in West Virginia. Please enable javascript for a better browsing experience while visiting our site. If you do not, we understand, but some interactive features may be unavailable.
Q: Transaction rollback doesn't work I have made a database wrapper with extra functionality around the PDO system (yes, i know a wrapper around a wrapper, but it is just PDO with some extra functionality). But i have noticed a problem. The folowing doesn't work like it should be: <?php var_dump($db->beginTransaction()); $db->query(' INSERT INTO test (data) VALUES (?) ;', array( 'Foo' ) ); print_r($db->query(' SELECT * FROM test ;' )->fetchAll()); var_dump($db->rollBack()); print_r($db->query(' SELECT * FROM test ;' )->fetchAll()); ?> The var_dump's shows that the beginTransaction and rollBack functions return true, so no errors. I expected that the first print_r call show a array of N items and the second call show N-1 items. But that issn't true, they both show same number of items. My $db->query(< sql >, < values >) call nothing else then $pdo->prepare(< sql >)->execute(< values >) (with extra error handling ofcourse). So i think or the transaction system of MySQL doesn't work, or PDO's implenmentaties doesn't work or i see something wrong. Does anybody know what the problem is? A: Check if your type of database equals innoDB. In one word you must check if your database supports transactions. A: Two possible problems: The table is MyISAM which doesn't support transaction. Use InnoDB. Check to make sure auto-commit is OFF. http://www.php.net/manual/en/pdo.transactions.php A: I'm entering this as an answer, as a comment is to small to contain the following: PDO is just a wrapper around the various lower level database interface libraries. If the low-level library doesn't complain, either will PDO. Since MySQL supports transactions, no transaction operations will return a syntax error or whatever. You can use MyISAM tables within transactions, but any operations done on them will be done as if auto-commit was still active: mysql> create table myisamtable (x int) engine=myisam; Query OK, 0 rows affected (0.00 sec) mysql> create table innodbtable (x int) engine=innodb; Query OK, 0 rows affected (0.00 sec) mysql> start transaction; Query OK, 0 rows affected (0.00 sec) mysql> insert into myisamtable (x) values (1); Query OK, 1 row affected (0.00 sec) mysql> insert into innodbtable (x) values (2); Query OK, 1 row affected (0.00 sec) mysql> rollback; Query OK, 0 rows affected, 1 warning (0.00 sec) mysql> select * from myisamtable; +------+ | x | +------+ | 1 | +------+ 1 row in set (0.00 sec) mysql> select * from innodbtable; Empty set (0.00 sec) mysql> As you can see, even though a transaction was active, and some actions were performed on the MyISAM table, no errors were thrown.
Q: Unexpected behaviour Bitcoin RPC getbalance I am seeing a smaller amount of BTC when I run ./bitcoin-cli getbalance compared to ./bitcoin-cli getbalance "" Here is the documentation on GetBalance from the BTC wiki, which highlights why I am confused getbalance [account] [minconf=1] If [account] is not specified, returns the server's total available balance. If [account] is specified, returns the balance in the account. If no account is specified, it should return the server's total balance, and yet here is my result: ./bitcoin-cli getbalance --- 0.00001250 ./bitcoin-cli getbalance "" --- 0.34869089 Why is this happening? A: It turns out that the reason was because the blockchain (Bitcoin Cash) had hardforked, after updating to the latest version my issue was resolved
George Mason III George Mason III (1690March 5, 1735) was an early American planter, businessman, and statesman. Mason was the father of George Mason IV, a Founding Father of the United States. Early life Mason was born in 1690 at Chopawamsic plantation in Stafford County, Virginia. He was the eldest son of George Mason II and his first wife Mary Fowke. Planter and politician At the time of his father's death in 1716, Mason was 27 and already a man of prominence in Stafford County. Like his father, Mason increased the family's property and social standing in Stafford County, and continued a tradition of leadership and public service. Also like his father, Mason served as a colonel in the Stafford County militia and represented Stafford in the House of Burgesses between 1715 and 1726. It was during his tenure as a burgess in Williamsburg that Mason met and married his wife Ann Stevens Thomson. He served as County Lieutenant of Stafford in 1719. Mason also served as sheriff of Stafford County. Mason amassed enormous land holdings in Stafford, Fauquier, Prince William, and Fairfax counties in Virginia. Mason also increased his land holdings by acquiring large grants south of the Occoquan River, which were later named Woodbridge by his grandson Thomas Mason. Mason leased most of his properties out as smaller farms with their rent paid in tobacco yield. Other sources of Mason's income came from fisheries and a ferry service carrying King's Highway across the Occoquan River. Because Mason owned land on both sides of the Occoquan River, he enjoyed a monopoly on river crossings as well as on the fishing rights in Belmont Bay. In 1716, Mason accompanied the "Knights of the Golden Horseshoe Expedition" led by Lt. Governor Alexander Spotswood across the Blue Ridge and into the Shenandoah Valley. Marriage and children Mason married Ann Stevens Thomson, daughter of Stevens Thomson and his wife Dorothea, in 1721. The couple had three children: George Mason IV (11 December 1725–7 October 1792) Mary Thomson Mason Selden (1731–5 January 1758) Thomson Mason (14 August 1733–26 February 1785) A few years after his marriage to Ann, Mason moved his family to Stump Neck plantation in Charles County, Maryland, relegating the Chopawamsic estate in Stafford County, Virginia, to a secondary residence. Later life Mason died in a ferry accident on 5 March 1735 on the Potomac River. Soon after his death, Mason's widow and children returned to Chopawamsic. At the time of his death, Mason owned in Stafford County alone. References Category:1690 births Category:1735 deaths Category:American people of English descent Category:American planters Category:British North American Anglicans Category:Businesspeople from Maryland Category:Businesspeople from Virginia Category:Deaths by drowning Category:Deaths due to shipwreck Category:George Mason Category:House of Burgesses members Category:People of colonial Maryland Category:Mason family Category:People from Stafford County, Virginia Category:Virginia sheriffs
The goal is to gain an understanding of the morphological basis for inhibitory interactions within the visual cortex. Inhibitory mechanisms play a critical role in shaping the response properties of visual cortical neurons, and the identification of the neural elements involved in this process will provide an important contribution towards understanding the function of visual cortex. We have already successfully used an antiserum to glutamic acid decarboxylase (GAD, the synthetic enzyme for the inhibitory neurotransmitter gamma-aminobutyric acid, GABA) to examine GABAergic neurons in the thalamus, and we now wish to use GAD immunocytochemistry along with other methods to address this issue in the striate cortex. Specifically, we propose to: 1) establish the number, type, and distribution of neurons and terminals which are immunoreactive for GAD and GABA within monkey striate cortex; 2) learn more about the morphology of distinct classes of GABAergic neurons by examining the types of synaptic contacts they receive on their somata, by correlating them with Golgi stained material, and by examining their relation to neuropeptide containing neurons; 3) examine the morphology and the source of prominent GAD and GABA immunoreactive terminals in the geniculate recipient laminae of striate cortex; and 4) establish the contribution made by GABA immunoreactive neurons to interlaminar and intralaminar connections within striate cortex and to projections outside of striate cortex. This research should provide valuable insights into the functional organization of visual cortex and may illustrate fundamental principles that apply to other regions of the cerebral cortex as well.
1. Field of the Invention The present invention relates to an organic semiconductor device comprising an organic semiconductor layer made of an organic compound having a marked characteristic of carrier mobility. 2. Description of the Related Art An inorganic semiconductor, e.g., silicon plays a major role in semiconductor devices such as diodes, and transistors that perform switching and amplifying functions necessary for signal processing, because such devices require multiple performances such as a high carrier mobility, a low dark current, a low driving voltage, and a complicated device structure and the like. In the field of organic semiconductors, organic electroluminescent devices utilizing the photoelectric conversion characteristics thereof are under development. Furthermore, when an electric field is applied on an organic semiconductor thin-film, a carrier density is increased. Accordingly, when a pair of electrodes is disposed on an organic semiconductor thin-film, an electric current is flowed therebetween. For example, provided that a source electrode and a drain electrode are disposed on an organic semiconductor thin-film and a gate electrode is disposed therebetween so as to apply a voltage across a thickness direction of the thin-film, a switching over the electric current that flows in a direction of the organic semiconductor thin-film can be achieved. Accordingly, organic transistors are also under study, and the organic semiconductors are being utilized in the technology such as information transfer, processing, recording and display that utilize electric signals and control, at a junction interface (metal-organic semiconductor, organic semiconductor-organic semiconductor), carriers (electrons and holes) in the organic semiconductor. FIGS. 1 and 2 show examples of bottom contact type and top contact type structures of an organic MOS-FET that uses an organic semiconductor thin-film. The organic MOS-FET is provided on a substrate 10 with gate electrode 14, gate insulating film 12, source electrode 11 and drain electrode 15, and organic semiconductor layer 13. As the gate electrode 14, Ni, Cr and the like are used; as the gate insulating film 12, inorganic materials such as oxides or nitrides of metals such as SiO2 and SiN and resins such as PMMA; and as the organic semiconductor layer 13, pentacene and the like. Furthermore, for the source electrode 11 and the drain electrode 15, a single layer film of Pd, Au and the like is used. However, when a current flows from a source electrode through an organic semiconductor layer to a drain electrode, at the respective interfaces, potential barriers are generated owing to differences between work functions of the source electrode and the drain electrode and an ionization potential of the organic semiconductor layer. As a result, a higher driving voltage is required.
This year, Trisha completes a decade in cinema. Having been on the top for 10 years, the actress is happy, and she thanks everyone who had supported and encouraged her. "My special thanks go to the fans the media," Trisha says, while saying that she is thankful to her directors, producers and co-stars. "It has been a lovely journey," she says. At a time when the market of an actress is believed not more than five years, Trisha is still ruling the roost in south Indian cinema, something which is very rare in these parts. In her 10th year, she is part of three promising projects in Kollywood alone. They are Vishal starrer 'Samar', 'Jayam' Ravi's 'Boologam' and 'Endrendrum Punnagai' with Jiiva. A couple of days ago, she was honoured by a Telugu magazine for completing a decade. "Jus attended the Santosham Film Awards..Won d award for 'A decade of Telugu Cinema'.Humbled n honoured.Thank u !!!" tweeted Trisha.
The First Step in Dressing Right for Your Body is to Know Your Body-Type! Take the Body-Type Quiz and Learn Yours!” In just a few steps you’ll be on your way to choosing the right styles that work for your Body-Type, saving you time and money! Latest Facebook Post Coats made from San Marcos blankets, a Mexican family "heirloom", are a statement for diversity as well as beauty! xox ~Michelle#SanMarcosCobijas #BrendaEquihua #BlanketCoat #LatinoIdentity ... See MoreSee Less
Heidelberg, January 24, 2011 - The biopharmaceutical company Apogenix GmbH gave an update on the status of patient recruitment in its ongoing clinical Phase II trial with APG101 for the treatment of Glioblastoma Multiforme (GBM). The independent Data Safety Monitoring Board (DSMB) has recommended the unchanged continuation of the efficacy trial with APG101 in its second meeting on the basis of 25 patients treated. Clinical data show that APG101 is safe and well tolerated by patients. In Germany the trial is being conducted in 21 study centers and 11 additional sites in Austria and Russia. In the open-label, randomized, controlled trial, patients with first or second relapse of Glioblastoma are being treated. Patients will either be treated with APG101 and radiotherapy or with radiotherapy alone. Primary endpoint of the trial is the 6-month-rate of progression-free survival (PFS6). Secondary endpoints include overall survival, safety and tolerability of APG101, and parameters assessing the patients' quality of life. "The positive assessment of the study by the DSMB allows us to confidently pursue our objective to prove the effectiveness of APG101 to treat Glioblastoma, thus providing a new treatment option for patients," said Dr Harald Fricke, Chief Medical Officer of Apogenix. The principle investigator of the trial, Prof Wolfgang Wick (Clinical Cooperation Unit Neurooncology German Cancer Research Center and Department of Neurooncology University Hospital of Heidelberg) added: "Besides investigating APG101's innovative mechanism of action we will also study its efficacy in combination with reirradiation in a multicenter controlled study for the first time. We are confident that the addition of APG101 to radiotherapy is a combination that will significantly improve the treatment of recurrent Gliobastoma." In Germany, the trial centers are located in Heidelberg, Mannheim, Frankfurt/Oder, Frankfurt/Main, Berlin, Hamburg, Ulm, Dresden, Bochum, Leipzig, Bonn, Munich, Tübingen, Stuttgart, Mainz, Regensburg, Marburg and Aachen. In Austria, the trial is being conducted in Vienna, Graz, Linz and Innsbruck. About Apogenix Apogenix, a spin-out from the German Cancer Research Center (DKFZ), is developing novel protein therapeutics for the treatment of cancer and inflammatory diseases, based either on the targeted modulation of apoptosis (programmed cell death) or by blocking the invasive growth of tumour cells. The company is developing APG101, its lead product candidate, to treat Glioblastoma multiforme (GBM), the most common and aggressive type of primary brain tumour. Since its inception in autumn 2005, the company has raised €43 million and has been awarded public grants totalling of more than €6 million. Apogenix is based in Heidelberg, Germany. About APG101 The company's lead product candidate, APG101, a soluble fusion protein combining the extracellular domain of the CD95-receptor and the Fc-portion of IgG, completed Phase I studies in 2009. In December 2009, APG101 entered a controlled Phase II trial for the treatment of Glioblastoma multiforme (GBM). Apogenix plans to out-license APG101 no later than the completion of proof of concept Phase II trials. Apogenix has been granted orphan drug status for APG101 to treat GBM in Europe and the U.S. and for the prevention of "acute Graft-versus-Host Disease" in Europe.
Thomas Fire Update As some of you may already know, normal operation of Kazrog LLC has been adversely affected by the Thomas Fire currently burning in California. As a one-man company, I’ve been able to keep prices low and quality high by maintaining a streamlined workflow and focusing on making products that (individually) do one thing well. The downside of being a lone developer, of course, is that if things go wrong, it can derail the entire operation. At this point in time, my family and I are safe – we’ve evacuated inland and are visiting relatives who have been kind enough to provide us with a place to stay. My servers are redundant and in another state, so the Kazrog website is working flawlessly as always. Active development, however, has been paused for the time being. I’ve not been able to bring my core build machines with me – only my laptop with minimal tools installed. Rural Internet service is literally broken – not due to the fire, but due to the lack of any kind of meaningful regulation of Internet service in this country. Accordingly, I’m having to tether to my cell phone at $10 USD / GB to get to the cloud, which of course I’m doing sparingly. I appreciate everyone’s kind words of concern. I consider myself very lucky at this time – there are a lot of people (many who are also in the music industry) who have been much more heavily impacted by this disaster, and I feel fortunate that my family and I are safe and comfortable. So, until further notice, I’m going to focus on spending time with my family and staying out of the smoke. I’ll post another update once things are mostly back to normal.
America is shocked by the Trump administration’s putting kids in cages, but such tactics —designed to create terror and modify behaviour — are nothing new. Republicans have been using it for decades. I know: I was a kid caged by Republicans in the 1980s. I don’t have to say I was “caged.” I could say I was “impounded” or “imprisoned.” To be new-razor precise, I’d choose the word “warehoused.” Because that’s where they stored us, the tens of thousands of teens whose parents didn’t want to deal with them anymore: in warehouses across the United States. Our parents dropped us off, wrote a cheque and walked away. Like the immigrant children separated from their families at the U.S. border, we wouldn’t talk to our parents again for 10 months, a year — sometimes, depending on the kid, longer. The warehouses were called Straight Inc., a “treatment” program for child drug addicts. This was strictly spin. If the founders were honest, they’d have called Straight what the ACLU did: “a concentration camp for throwaway teens”. Most of us had barely smoked weed. Maybe we drank a beer once. To compel our parents to pay the monthly stipend, Straight had to make us admit that we were addicts. So they forced us to put negative spin on our own past behaviours. How did they do that? In a word, torture. Once we were locked in the privacy of “the building,” our code for the warehouse, we were sexually assaulted (all of us were “strip-searched” and “belt-looped,” wherein another child put their hand in our pants, pulled the waistband up into our butt crack, and dragged us around, as standard; some of us were raped by our “oldcomers,” the kids whose houses we slept in). We were assaulted psychologically (“spit therapy” was used in “review,” where we were stood up in the seething mass of our peers, who then took turns spitting saliva and personalized vitriol into our faces). We wore “humble clothes” (intentionally mismatched, uncomfortable and humiliating outfits into which we would bleed, crap, or pee when we weren’t allowed to use the bathroom, or when we were being punished with “T.P. therapy”: three squares of toilet paper, and not an inch more). We experienced this and much, much more until we “got honest with ourselves,” admitting to the group, and our parents, that the few tokes of weed we’d tried, or the single beer we’d drank, or the magic marker we had sniffed, meant that we were “addicted to drugs and alcohol.” Straight Inc. was founded by Trump Victory co-chair and major Republican fundraiser Mel Sembler, a man who started out selling dresses, moved on to selling shopping malls, and then, as a pal of first lady Nancy Reagan, helped create the Just Say No! campaign, thereby fostering the 1980s anti-drug hysteria. From there he moved on to selling the disappearance of “troubled” teens by labelling them as drug addicts. The Tampa Bay Times recently asked Mel Sembler’s wife, Betty, for her opinion on Trump’s “sometimes crude and frequent false statements.” She replied that Trump is “an unconventional politician…whose style is to approach problems with a hammer he’s not afraid to use.” Kirstjen Nielsen struggles to deny migrant children were kept in dog-like cages The use of a hammer to solve human problems is an apt metaphor for Straight. Kids who refused to “admit to their addiction,” or to “motivate,” or to sing preschool songs recast into Straight-praise songs, were slammed onto the floor by five of the peers, and “sat on,” or wrestled into a five-point restraint. If these “misbehavours” tried to jerk away from their peers’ grasp, they were carried into a small, windowless “intake room.” We couldn’t see what happened in there, but we could hear the thumps. We could hear the screams. When the former misbehaver emerged, they were crumpled, limping, bloody, and bruised, but obedient. They put their arms up to motivate; they sang the Straight praise songs. They admitted to their addiction. When 60 Minutes did an episode on Straight, they spoke to Fred Collins, who won a $220,000 lawsuit against Straight for false imprisonment in 1984. Collins described the experience of a boy who was forcibly restrained by other teens — a boy who was “sat on” — saying, “They had four or five people sitting on him. And they broke his ribs… he complained that his ribs were broken and they said shut up, and he wasn’t even allowed to go to the hospital. They ended up healing the wrong way.” Mel and Betty Sembler consider Straight “their greatest achievement.” Republican movers and shakers, in turn, consider the Semblers one of the party’s greatest assets. “It’s almost hard to put on a Richter scale what both Mel and Betty have meant to Republican politics,” says veteran Republican fundraiser Ann Herberger in The Tampa Bay Times. Right-wing fear and anger is created with words, with the creation of an “other” who doesn’t adhere to their social agenda. In an article titled “We Had to Torture the Children in Order to Save Them,” American Conservative describes Straight’s strategy for demonising teenagers. “The teens are consistently characterized as liars and manipulators, and their own parents are urged to reflexively disbelieve anything they say.” Trump uses the same tactic with immigrants, deeming them bad hombres, drug dealers, and rapists; saying there are “crimes of all kinds coming through our Southern border” and zeroing in on his own word choice: “People hate the word invasion, but that’s what it is.” Once voters pulled the lever for Trump, and once parents signed their kids into Straight, they became complicit in the process. They now have a cemented, subconscious motive to believe the spin: to believe we need to build that wall. To believe Straight’s “bad kid” propaganda. Challenging those ideas would mean challenging their own judgement and accepting blame for helping create a disastrous reality. It is far more palatable to roar louder along with the angry, fearful crowd. In that 60 Minutes episode I mentioned, Straight’s executive director was questioned about kids restraining kids. The reporter asked, “The kids who say they have suffered injuries as a result of that, they’re lying?” The director replied, “They are giving you their perspective of what happened. If they suffered an injury, it was the result of a fight they probably…that they started!” Trump's inner circle: Meet the members of the US president's cabinet Show all 20 1 /20 Trump's inner circle: Meet the members of the US president's cabinet Trump's inner circle: Meet the members of the US president's cabinet Donald Trump's Cabinet Donald Trump's Cabinet is one the richest in American history, filled with billionaires, conservatives and several career politicians. AFP/Getty Trump's inner circle: Meet the members of the US president's cabinet Mike Pence US Vice President Mike Pence has defended Donald Trump throughout his presidency while walking a fine line to avoid any public involvement in major scandals. AFP/Getty Trump's inner circle: Meet the members of the US president's cabinet Mike Pompeo Secretary of State Mike Pompeo replaced Donald Trump's previous appointment to the post, Rex Tillerson, and has led talks with North Korea in establishing high-profile summits between the president and Kim Jong Un. Getty Trump's inner circle: Meet the members of the US president's cabinet Wilbur Ross Secretary of Commerce Wibur Ross raised controversy when he was accused of falsely claiming to have sold stock in a bank and violated a government ethics agreement. AFP/Getty Trump's inner circle: Meet the members of the US president's cabinet Robert Lighthizer US Trade Representative Robert Lighthizer has been a fixture in Donald Trump's ongoing trade spat with China. AFP/Getty Trump's inner circle: Meet the members of the US president's cabinet William Barr Attorney General William Barr replaced Jeff Sessions as the nation's top cop in early 2019 and has refused to commit to recusing himself from the Russia probe despite an unsolicited memo he sent to the Justice Department decrying the investigation. EPA Trump's inner circle: Meet the members of the US president's cabinet Rick Perry Energy Secretary Rick Perry has held his post throughout Donald Trump's presidency despite previously undermining the need for the agency he now leads in past public statements. Ken Shipp / United States Department of Energy Trump's inner circle: Meet the members of the US president's cabinet Betsy DeVos Education Secretary Betsy DeVos has also held her post throughout the presidency, despite major backlash to her apparent undermining of the nationwide public school system and advocacy for charter programmes. Getty Trump's inner circle: Meet the members of the US president's cabinet Steven Mnuchin Treasury Secretary Steven Mnuchin has faced numerous controversies throughout his tenure as the head of Treasury, including costing taxpayers at least a million dollars in travel expenses. AP Trump's inner circle: Meet the members of the US president's cabinet Robert Wilkie Veterans Affairs secretary Robert Wilkie was appointed after Donald Trump's White House doctor Ronny Jackson withdrew over allegations he provided prescription drugs to patients without prescriptions. AFP/Getty Trump's inner circle: Meet the members of the US president's cabinet David Bernhardt Secretary of the Interior David Bernhardt took office in January 2019 after the resignation of Ryan Zinke after previously serving as Zinke's deputy. Before taking office Bernhardt worked for many years as a solicitor for the Department of the Interior. Tami Heilemann / United States Department of the Interior Trump's inner circle: Meet the members of the US president's cabinet Elaine Chao Transportation Secretary Elaine Chao has held her post throughout the presidency and has mostly avoided controversy, despite a report claiming her office has been in frequent coordination with her husband's, Mitch McConnell. AFP/Getty Trump's inner circle: Meet the members of the US president's cabinet Kevin McAleenan Acting Secretary of Homeland Security Kevin McAleenan took over from Kirstjen Nielsen after she resigned in April 2019. He previously worked as the executive director of the executive director of the Office of Anti Terrorism in the Customs and Border Protection agency United States Customs and Border Protection Trump's inner circle: Meet the members of the US president's cabinet Ben Carson Secretary of Housing and Urban Development Ben Carson was appointed shortly after Donald Trump took office and raised controversy over an exorbitant furnishing bill for his office. Reuters Trump's inner circle: Meet the members of the US president's cabinet Gina Haspel CIA Director Gina Haspel was appointed in 2018 and faced backlash surrounding her oversight of Guantanamo Bay. Getty Trump's inner circle: Meet the members of the US president's cabinet Dan Coats Director of National Intelligence Dan Coats could be the next person to leave Donald Trump's administration over his refuting the president's claims surrounding ISIS. Reuters Trump's inner circle: Meet the members of the US president's cabinet Sonny Perdue Agriculture Secretary Sonny Perdue has been dogged by ethics questions throughout his tenure and faced controversy when emails showed the agency appeared willing to eagerly work with lobbyists under his leadership. Reuters Trump's inner circle: Meet the members of the US president's cabinet Alex Azar Health and Human Services Secretary Alex Azar is a former pharmaceutical lobbyist and former drug company executive. Getty Trump's inner circle: Meet the members of the US president's cabinet Mick Mulvaney Acting Chief of Staff and Office of Management and Budget Director Mick Mulvaney has described himself as one of the most conservative officials in the White House. EPA Trump's inner circle: Meet the members of the US president's cabinet Robert Wilkie Secretary of State for Veterans Affairs Robert Wilkie has spent his career on Capitol Hill serving in various roles in foreign affairs and defence. He holds the rank of Lieutenant Colonel in the US Air Force Reserve. Gene Russell / United States Department of Veterans Affairs Sembler’s Straight Inc. was eventually shut down due to abuse lawsuits and government investigations. His Trump Victory bio on Wikipedia makes no mention of Straight, describing him as a shopping mall developer, and his anti-drug organization is now called The Drug Free America Foundation. There is no mention of Straight Inc. on the foundation’s website, but if you scroll all the way to the bottom, you’ll find a “Follow Us on Twitter” button with some cryptic words above it: “Key required even if secret is empty.” If you want to see it and decipher that spin, act fast. Because the truth has a way of disappearing.
package ast type SetOperation uint func (n *SetOperation) Pos() int { return 0 }
<?php namespace Pterodactyl\Http\Requests\Api\Client\Servers\Backups; use Pterodactyl\Models\Backup; use Pterodactyl\Models\Server; use Pterodactyl\Models\Permission; use Pterodactyl\Http\Requests\Api\Client\ClientApiRequest; class DownloadBackupRequest extends ClientApiRequest { /** * @return string */ public function permission() { return Permission::ACTION_BACKUP_DOWNLOAD; } /** * Ensure that this backup belongs to the server that is also present in the * request. * * @return bool */ public function resourceExists(): bool { /** @var \Pterodactyl\Models\Server|mixed $server */ $server = $this->route()->parameter('server'); /** @var \Pterodactyl\Models\Backup|mixed $backup */ $backup = $this->route()->parameter('backup'); if ($server instanceof Server && $backup instanceof Backup) { if ($server->exists && $backup->exists && $server->id === $backup->server_id) { return true; } } return false; } }
import scipy.io as sio import pickle import numpy as np import os import numpy as np import time path = "/media/zhaojian/6TB/data/tensorflow_model_result/siamese/" outputDir = "/media/zhaojian/6TB/project/Resnext_MS_model_Simple/extracted_feature/vggBaseTestSet/" features = sio.loadmat(path + "basetest.mat") data = features['data'] labels = features['label'] # print "labels[0]: ", labels[0] for index in range(len(data)): personData = np.asarray(data[index]) label = str(labels[:, index][0][0]) print "label: ", label.split(" ") print "personData.shape: ", personData.shape sio.savemat(outputDir + label, {"identityFeature": personData})
Allan H. Goldman Allan H. Goldman (born 1943) is an American real estate investor and co-Chairman of the real estate investment company Solil Management. Biography Goldman was born in 1943 to a Jewish family, the daughter of Lillian (née Schuman) and Sol Goldman. He has three sisters: Jane Goldman, Diane Goldman Kemper, and Amy Goldman Fowler. His father was the largest non-institutional real estate investor in New York City in the 1980s, owning a portfolio of nearly 1,900 commercial and residential properties. After his father's death, his three sisters engaged in litigation with their mother over his father's assets; their mother subsequently received 1/3rd of their father's estate. He and his sister, Jane Goldman, manage the remaining real estate assets via the firm Solil Management. His cousin, Lloyd Goldman, is also a notable real-estate investor in New York City. References Category:American billionaires Category:American real estate businesspeople Category:American Jews Category:1943 births Category:Living people Category:Sol Goldman family
[Physicochemical changes in DNA and deoxyribonucleoprotein caused by potassium cyanate]. The influence of KNCO on the structural integrity of the DNP salt solutions was studied. By the methods of sedimentation, viscosimetry, spectrophotometry and circular dichroism it was shown that KNCO failed to induce degrading the polynucleotide DNA strands and weakened the bonds between the DNA and protein.
Slipline® PRS SlipLine®—trademarked and engineered by BlueFin—is a pipeline remediation solution that combines ingenuity and technical bench strength to solve routine, problematic occurrences with flowline integrity. In a search for measures that would provide economical rehabilitation, BlueFin devised an asset-saving procedure that allows for a high-pressure composite pipe to be placed inside a carbon steel pipeline. This procedure has multiple points of value: bi-directional flow for gas lift needs, bi-directional flow for chemical injection points, and secondary flowline containment for degraded pipelines. The worth-capacity of this service rests solely on application expertise, which allows for tremendous cost benefit and mitigation of environmental impact for sensitive geographical areas.
[Creating an optimal learning environment]. The charge sister, or first-line nursing manager, is the king pin in clinical teaching of the student. The teaching function of the ward sister is discussed with emphasis on the principles of guidance, leadership and motivation, which is essential for establishing an optimal learning environment.
Management of the unbalanced wrist in cerebral palsy by tendon transfer. Over a 25-year period, 60 children with spasticity of the upper extremity mainly resulting from cerebral palsy underwent surgical reconstruction of the unbalanced wrist. A detailed classification of the deformity is described on the basis of the functional anatomy of the unbalanced wrist in cerebral palsy, which was divided into three groups. In retrospective analysis of the long-term results, this classification has proved helpful in selecting an option for the treatment of this difficult deformity. In addition, the described classification has aided us in keeping accurate follow-up records in predicting the progress of the patient, and in coordinating the postoperative treatment.
Q: How to align in memory the array payload of a ByteArray# with GHC Haskell I have a few questions about how to align not a ByteArray# but a ByteArray#'s array payload (the actual bytes of nonmetadata data stored in the array), which might be complicated by the fact that the RTS stores array metadata in the memory right before the array payload: If you have a value of type ByteArray#, it definitely points to a heap object with type ARR_WORDS (see below)… ⋮ ARR_WORDS, MUT_ARR_PTRS_CLEAN, MUT_ARR_PTRS_DIRTY, MUT_ARR_PTRS_FROZEN0, MUT_ARR_PTRS_FROZEN Non-pointer arrays are straightforward: | Header | Bytes | Array payload | Does newAlignedPinnedByteArray# already work around this by specifically aligning the array payload rather than aligning everything including the metadata? Assuming that it doesn't, the number of bytes the metadata takes up can presumably change with new GHC versions. How can I determine how many bytes that takes up at my module's compiletime (I'm perfectly happy to use Template Haskell or some sort of Cabal trickery)? How can I use that information to figure out how much larger I should make the array to accomodate padding to get alignment of the array payload? How can I use that information to get an Addr# to the padded start of the array payload? Please ensure that your suggestions for getting the proper alignment cannot be undone even if the copying garbage collector doesn't care about alignment. A: From the GHC source code in PrimOps.cmm where the alignment is performed: /* Now we need to move p forward so that the payload is aligned to <alignment> bytes. Note that we are assuming that <alignment> is a power of 2, which is technically not guaranteed */ p = p + ((-p - SIZEOF_StgArrBytes) & (alignment - 1)); So, it is the payload that is aligned, not the header.
Q: What kind of bamboo should I use for making a Chinese fan? I've started making a functional fan, and I was wondering what kind of wood or bamboo (I prefer bamboo) I should use to make the body of the fan. I kinda searched around using words like "thin", but the kind of thin in woodworking is not really what I'm looking for. Here's the drawing I made for now (I'll probably redraw it), any feedback/ideas are appreciated. A: From bamboogrove.com There are many different opinions on how many species of bamboo that there are. Some experts say there are approximately 1000 species of bamboo, while others say there are more than 1600 species on the planet growing naturally. It would be hard to make any specific recommendation on bamboo species as there are so many and I am not sure of your local. I have no real opinion on what is available in North America other than the kind that grows at my parents place, in Ontario, is weak and not good for much. You see things like bamboo poles for fencing. You could split those with a knife fairly easily to get the lengthwise strips that you would need for this. Buying an entire fence seems excessive though. However for where and what it is used for it should be more than sufficient for what your are doing. You might have better luck if this is a one off project by using something simpler like a bamboo placemat. You should be able to find one of these easy. You can take that apart and get (almost?) the lengths you need and there should be enough strength in there to get the job done. Also would not have to finish or cut it yourself.
Re: Building Business Credit & Spark Card Denial (WTH) I was denied for the same card after being approved for the Ink and the Amex Plum. I sent in a written letter for reconsideration and was approved. I also sent credit card statements ( from Ink and Plum) and credit reports with a copy of the denial letter asking for the BS reasons given for denial to be found in the reports. But my case was a little funny. I had bogus negative file (ironically from Cap1) that was removed in the interim that was partly responsible for my initial denial. I sent a copy of that apology letter from Cap1 along with everything else. Unfortunately they also hard pulled me again. Tri-pull. I was ticked off by that because it was a RECON. But they took it as if I was reapplying. I ask in vain for them to be removed. Whatever. Look, Cap1 stinks.,...BIG TIME. They stink especially in this very sphere of card services that you are dealing with: Applications/approvals/recons/limits or anything that requires underwriting. They stink because you can't talk to anyone directly who has any power to consider your request and they tri-pull every time. I put up with it to get this card. The base rewards are unsurpassed. So I guess it was worth it. I would write a letter and include any supporting docs that help your cause. That's what I did. Try to include reports dated the same day as your denial. It's worth a try. Careful. They tri-pull you again. Request that do not do this if you don't want it. They may do it anyway. They did to me. Grrr. Re: Building Business Credit & Spark Card Denial (WTH) I can vouch for the Spark showing up on personal credit reports. What a rude shock that was....especially after I was told it would not. Par for the course for Cap1: Rude, rough and abrasive. They'll never change. I USE them....but I don't like them. I've actually called Amex practically begging them to make the Plum 2% (or better) so I can give them all my Spark Spend. No luck yet. Re: Building Business Credit & Spark Card Denial (WTH) 1. Send email to executive office for cap1 and ask for it to be recon... While you send that email also ask that your current 2 personal cards be upgraded to quicksilver, af removed and cl's on both to $10k... They will ask if you will accept less. 2. Amex business cards DO NOT report to personal credit unless you default, not sure if poster was referring to personal cards when they said they reported. Re: Building Business Credit & Spark Card Denial (WTH) 1. Send email to executive office for cap1 and ask for it to be recon... While you send that email also ask that your current 2 personal cards be upgraded to quicksilver, af removed and cl's on both to $10k... They will ask if you will accept less. 2. Amex business cards DO NOT report to personal credit unless you default, not sure if poster was referring to personal cards when they said they reported. ROFLOL Good advice OLD TREAD ALERT CA Before you app think...Have you done your research of the CC?Does it fit your spending?Do you have a plan for the bonus w/o going into debt?Can you afford the AF?Do you know the cards benefits? Is it worth the HP? Forums posts are not provided or commissioned by FICO. Forums posts have not been reviewed, approved or otherwise endorsed by FICO. It is not FICO's responsibility to ensure all posts and/or questions are answered. Advertiser Disclosure: The listings that appear on myFICO are from companies from which myFICO receives compensation, which may impact how and where products appear on myFICO (including, for example, the order in which they appear). myFICO does not review or include all companies or all available products. † Credit cards for FICO Score ranges: The score ranges are guidelines based on internal myFICO analysis of actual applicant approvals, and having a FICO Score in a particular range does not guarantee you will be approved for credit cards recommended in that range. These ranges were not provided by any card issuer. IMPORTANT INFORMATION: All FICO® Score products made available on myFICO.com include a FICO® Score 8, along with additional FICO® Score versions. Your lender or insurer may use a different FICO® Score than the versions you receive from myFICO, or another type of credit score altogether. Learn more FICO, myFICO, Score Watch, The score lenders use, and The Score That Matters are trademarks or registered trademarks of Fair Isaac Corporation. Equifax Credit Report is a trademark of Equifax, Inc. and its affiliated companies. Many factors affect your FICO Score and the interest rates you may receive. Fair Isaac is not a credit repair organization as defined under federal or state law, including the Credit Repair Organizations Act. Fair Isaac does not provide "credit repair" services or advice or assistance regarding "rebuilding" or "improving" your credit record, credit history or credit rating. FTC's website on credit.
Brad Gassoff Howard Bradley "Gasser" Gassoff (born November 13, 1955 in Quesnel, British Columbia), is a retired NHL, WCHL, and CHL player. Gassoff spent most of his career in the CHL with the Tulsa Oilers and the Dallas Black Hawks. He was drafted by the Vancouver Canucks in round #2, 28th overall in the 1975 NHL Amateur Draft, and was selected by the Winnipeg Jets in round 1, #8 overall 1975 WHA Amateur Draft. He first played in the WCHL, then moved up to the NHL/CHL level. The only team he did play for in the NHL is for the Vancouver Canucks. He later on retired as a Dallas Black Hawks player. Family His brother Bob also played in the NHL for the St. Louis Blues until his death on May 27, 1977 in a motorcycle accident. His brother Ken, born October 9, 1954, was drafted by the New York Rangers in the 1974 NHL Amateur Draft and by the Houston Aeros in the 1974 WHA Amateur Draft. Awards Ken McKenzie Trophy - 1975–76 Career statistics Regular season and playoffs References External links Category:1955 births Category:Canadian ice hockey defencemen Category:Cariboo people Category:Dallas Black Hawks players Category:Ice hockey people from British Columbia Category:Kamloops Chiefs players Category:Living people Category:Medicine Hat Tigers players Category:People from the Cariboo Regional District Category:Tulsa Oilers (1964–84) players Category:Vancouver Canucks draft picks Category:Vancouver Canucks players Category:Winnipeg Jets (WHA) draft picks Category:World Hockey Association first round draft picks Category:Canadian expatriate ice hockey players in the United States
Posts Tagged ‘health’ I’m always on the lookout for a new “To Do” type of app that will help me remember to do certain tasks that I’m trying to turn into behaviors. I’ve been successful with a few behavior changes, like working out regularly, but others just don’t seem to stick (like working on my book). The latest… It is a common myth that eating animal fats will make you fat and cause heart disease. It’s simply not true and it isn’t that simple to explain the causes behind diseases like atherosclerosis. Your body needs cholesterol to survive and be healthy. The cholesterol we eat has little to do with the cholesterol we measure… So, you’ve heard about this CrossFit thing and you’ve decided to give it a shot. But, maybe you are a little worried because you’ve heard about it from friends who do it. Or you’ve watched a few videos of some of the elite (or insane) athletes doing crazy workouts. You don’t think you are that strong, that fast, or that fit yet. Don’t worry about it. Seriously. The nice thing about CrossFit is that everything is scaled appropriately for your capabilities and experience. So, everyone starts out light if they aren’t familiar with weight lifting. Heck, for the Overhead Squat I spent weeks using nothing but a wooden dowel until I became more flexible and skilled. One of the most important things to focus on when you are just starting out is to take the time to get your form and technique perfected before trying to go heavy. Don’t be shy about scaling the lifts and WODs (i.e., workout of the day) by using less weight or scaling the technique (e.g., doing burpees without the push-up component). A good coach will recommend that when you are new and tell how you to scale, because he or she wants you to get the most out of the program and not get injured. So, focus on learning in the first few months (and it does take months) so that you become really good at the lifts and exercises. Then, once you feel comfortable and you’ve worked through the adaptation (you will be sore a lot), you can start adding more weight. Your coach will help you program that. I’ve been using a really firm J Fit foam roller for quite some time now. As I wrote about in this post, using a foam roller is a critical useful tool for increasing blood flow and circulation to your muscles and tissues to promote healing. They can also provide “myofascial release”, which is a technique that results in softening and lengthening of the fascia over your muscles. By focusing the roller on places where you are stiff, sore, or are experiencing reduced flexibility; you can break down unwanted adhesions between the fascia and the underlying muscle tissue. At first the foam roller was pretty painful. But after using it for awhile, I’m used to it and it takes a lot more pressure to work on the knots in my muscles. As I wrote about in “Women and CrossFit – Time to Kill the Weightlifting Myth“, there are many misconceptions and poor role models for women who want to be fit. It isn’t about becoming “skinny” and looking like a supermodel. It is about being healthy, strong, and achieving a level of fitness that is right for you and sustainable for your lifestyle. That is what’s really sexy: Being the strongest you that you can be! So, to prove this point, every week we will feature the strongest and sexiest women as determined by votes from all of you. To participate, you can upload a photo of yourself. Once we approve the photo, it will be available for voting. So, be sure to tell all of your friends about it so that they can come back and vote for you here! I’m still ramping up my training for the Tough Mudder event in NorCal this September. I’m wearing my Vibram FiveFingers much more regularly and did another 4 mile trail run in a pair of the KSOs. You may recall that I did buy a pair of the KSO Treks earlier and did a trail run in them as well. The fit was a bit too large. They felt fine for walking around, but my smaller toes kept slipping out of their pockets as I started running harder and climbing. So, I bought a size smaller of the KSOs, which are a bit different (better for water, thinner sole). Now my big toe is a bit cramped. Guess I have weird toes. Dear readers, I would like to hear from you! What do you think are the best bodyweight exercises? In the poll below, select the one bodyweight exercise that you think is the best or write in your own answer. If you could only do one bodyweight exercise, what would it be? Well, today was the last day of my Paleo Challenge. So we took photos and measurements in CrossFit this morning. We won’t know who the winners are until next week. But, I wanted to do a quick post and share my after photo. The Paleo diet helped me bring out more definition. I lost about 4 pounds that I just couldn’t seem to gain back, but maybe that’s ok. Today in CrossFit we did a Conditioning WOD that included the Overhead Squat. The Overhead Squat (OHS) is as much about shoulder flexibility and core strength as it is about leg strength, perhaps even more about flexibility and balance. I’ll be honest; I’ve struggled with the OHS. It isn’t about the weight or my ability to squat it. It’s about my shoulder flexibility more than anything else. As you get down into the deep squat position, you should be able to shrug your shoulders, lock your arms out straight overhead, and actually have those arms somewhat behind your head (i.e., someone should be able to see your ears from the side). When I started doing the OHS, I couldn’t even put my arms that straight overhead with NO WEIGHT! My shoulder flexibility held me back. But, I’ve been working on stretches and using a lacrosse ball to open up the muscles around my scapula and shoulders. It is helping and I can do a better OHS now, but I have a lot more room for improvement before I can add significant weight to this lift. To continue preparing for the Tough Mudder event, I am still doing CrossFit during the week. But I’ve also added a trail run each weekend to keep improving my endurance and add a bit more cardio work. I ran again in my Vibram FiveFingers to see how they feel on the rocky trail and what it feels like to keep running in cold, wet feet. It was ok. The FiveFingers certainly just let the water come in and your feet are instantly wet and cold. But I found that my feet warmed up as I kept running, so it was tolerable. My feet obviously still need to toughen up more. I felt all of the sharp stones on the trail (it was a really rocky trail). But, the barefoot running style ensures that you are landing lightly on your forefoot and lifting your feet quickly back off the ground again. So, hitting a rock wasn’t nearly as painful as it would be when you stride out and land harder on your heels.
// // TLCoin.swift // ArcBit // // Created by Timothy Lee on 3/14/15. // Copyright (c) 2015 Timothy Lee <stequald01@gmail.com> // // This library is free software; you can redistribute it and/or // modify it under the terms of the GNU Lesser General Public // License as published by the Free Software Foundation; either // version 2.1 of the License, or (at your option) any later version. // // This library is distributed in the hope that it will be useful, // but WITHOUT ANY WARRANTY; without even the implied warranty of // MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU // Lesser General Public License for more details. // // You should have received a copy of the GNU Lesser General Public // License along with this library; if not, write to the Free Software // Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, // MA 02110-1301 USA import Foundation enum TLBitcoinDenomination:Int { case bitcoin = 0 case milliBit = 1 case bits = 2 } @objc class TLCoin:NSObject { struct STATIC_MEMBERS { static let numberFormatter: NumberFormatter = NumberFormatter() } fileprivate var coin:BTCMutableBigNumber class func zero() -> (TLCoin) { return TLCoin(btcNumber:BTCBigNumber.zero()) } class func one() -> (TLCoin) { return TLCoin(btcNumber:BTCBigNumber.one()) } class func negativeOne() -> (TLCoin) { return TLCoin(btcNumber:BTCBigNumber.negativeOne()) } init(btcNumber:BTCBigNumber) { coin = btcNumber.mutableCopy() } fileprivate func getBTCNumber() -> (BTCBigNumber) { return coin } func add(_ other:TLCoin) -> (TLCoin) { let tmp = coin.mutableCopy().add(other.getBTCNumber()) return TLCoin(btcNumber: tmp!.copy()) } func subtract(_ other:TLCoin) -> (TLCoin) { let tmp = coin.mutableCopy().subtract(other.getBTCNumber()) return TLCoin(btcNumber: tmp!.copy()) } fileprivate func multiply(_ other:TLCoin) -> (TLCoin) { let tmp = coin.mutableCopy().multiply(other.getBTCNumber()) return TLCoin(btcNumber: tmp!.copy()) } fileprivate func divide(_ other:TLCoin) -> (TLCoin) { let tmp = coin.mutableCopy().divide(other.getBTCNumber()) return TLCoin(btcNumber: tmp!.copy()) } init(uint64:UInt64) { coin = BTCMutableBigNumber(uInt64: uint64) } init(doubleValue:Double) { //TODO: get rid this init method let tmp = NSDecimalNumber(value: doubleValue as Double).multiplying(by: NSDecimalNumber(value: 100000000 as UInt64)) coin = BTCMutableBigNumber(uInt64: tmp.uint64Value) } func toUInt64() -> (UInt64) { return STATIC_MEMBERS.numberFormatter.number(from: coin.decimalString)!.uint64Value } init(bitcoinAmount:(String), bitcoinDenomination:(TLBitcoinDenomination), locale: Locale=Locale.current) { //TODO move to TLCurrencyFormat like an droid, so dont have to create formatter everytime let bitcoinFormatter = NumberFormatter() bitcoinFormatter.numberStyle = .decimal bitcoinFormatter.maximumFractionDigits = 8 bitcoinFormatter.locale = locale let tmpString = bitcoinFormatter.number(from: bitcoinAmount) if tmpString == nil { coin = BTCMutableBigNumber(uInt64:0) return } let satoshis:UInt64 let mericaFormatter = NumberFormatter() mericaFormatter.maximumFractionDigits = 8 mericaFormatter.locale = Locale(identifier: "en_US") let decimalAmount = NSDecimalNumber(string: mericaFormatter.string(from: bitcoinFormatter.number(from: bitcoinAmount)!)) if (bitcoinDenomination == TLBitcoinDenomination.bitcoin) { satoshis = decimalAmount.multiplying(by: NSDecimalNumber(string: "100000000")).uint64Value } else if (bitcoinDenomination == TLBitcoinDenomination.milliBit) { satoshis = (decimalAmount.multiplying(by: NSDecimalNumber(value: 100000 as UInt64))).uint64Value } else { satoshis = (decimalAmount.multiplying(by: NSDecimalNumber(value: 100 as UInt64))).uint64Value } coin = BTCMutableBigNumber(uInt64:satoshis) } func bigIntegerToBitcoinAmountString(_ bitcoinDenomination: TLBitcoinDenomination) -> (String) { //TODO move to TLCurrencyFormat like an droid, so dont have to create formatter everytime let bitcoinFormatter = NumberFormatter() bitcoinFormatter.numberStyle = .decimal if (bitcoinDenomination == TLBitcoinDenomination.bitcoin) { bitcoinFormatter.maximumFractionDigits = 8 return bitcoinFormatter.string(from: NSNumber(value: bigIntegerToBitcoin() as Double))! } else if (bitcoinDenomination == TLBitcoinDenomination.milliBit) { bitcoinFormatter.maximumFractionDigits = 5 return bitcoinFormatter.string(from: NSNumber(value: bigIntegerToMilliBit() as Double))! } else { bitcoinFormatter.maximumFractionDigits = 2 return bitcoinFormatter.string(from: NSNumber(value: bigIntegerToBits() as Double))! } } func toString() -> (String) { return coin.decimalString != nil ? coin.decimalString : "0" } fileprivate func bigIntegerToBits() -> (Double) { return (NSDecimalNumber(string: coin.decimalString as String).multiplying(by: NSDecimalNumber(value: 0.01 as Double))).doubleValue } fileprivate func bigIntegerToMilliBit() -> (Double){ return (NSDecimalNumber(string: coin.decimalString as String).multiplying(by: NSDecimalNumber(value: 0.00001 as Double))).doubleValue } func bigIntegerToBitcoin() -> (Double) { return (NSDecimalNumber(string: coin.decimalString as String).multiplying(by: NSDecimalNumber(value: 0.00000001 as Double))).doubleValue } func less(_ other:TLCoin) -> (Bool) { return coin.less(other.getBTCNumber()) } func lessOrEqual(_ other:TLCoin) -> (Bool) { return coin.lessOrEqual(other.getBTCNumber()) } func greater(_ other:TLCoin) -> (Bool) { return coin.greater(other.getBTCNumber()) } func greaterOrEqual(_ other:TLCoin) -> (Bool) { return coin.greaterOrEqual(other.getBTCNumber()) } func equalTo(_ other:TLCoin) -> (Bool) { return coin.greaterOrEqual(other.getBTCNumber()) && coin.lessOrEqual(other.getBTCNumber()) } }
Under present Federal tax law, the reinvestment of bond proceeds generated through the sale of municipal bonds by the bond issuer (typically a governmental entity such as a state, city, county or school district) is subject to significant restriction. With some exceptions, an issuer's investment earnings on idle bond proceeds are limited to the arbitrage yield on the bonds (as defined by the Internal Revenue Code). Additional interest earned above the arbitrage yield generally must be rebated to the U.S. Government. By law the placement of investments of bond proceeds must be done in a competitive fashion, ensuring the highest yield possible given the bidding restrictions. Generally, at least three bona fide bids must be offered before one may be accepted under Internal Revenue Service “safe harbor” guidelines. The typical current practice is for a third-party bid broker to develop and distribute bid specifications and a bid form to potential bidders. At or before an appointed time, bidders may submit bids to the broker by voice, facsimile, or electronic mail. During the bidding process, the broker is aware of the values of the bids submitted. The practice of brokering these types of investments is not at present regulated. As a result, in recent times the IRS has found or has alleged that participants in the bidding process—both brokers and the bidders (providers of the investment products, typically investment banks and insurance companies)—have rigged and colluded on bids, resulting in lower investment earnings on the investments and, as a result, lower rebate payments to the U.S. Government. The IRS estimates the costs of this bid-rigging and collusion to exceed $100 million to date. Generally, this illicit rigging and collusion involves brokers and/or providers agreeing to: (1) provide non-competitive bids in order to meet the three-bid minimum; (2) make or participate in side payments of fees or other considerations in order to ensure a particular bid is the winner; (3) provide a “last-look” to a bidder, giving one participant information on the results of the bidding process and leading to an unfair advantage. Most of these non-competitive processes result from the broker's ability to influence the outcome of the bidding process during the bid itself. By creating a secure process for the receipt of bids, restricting the broker's knowledge of specific bid information during the bid process, creating an electronic log of all bidding activity, and providing all bids received simultaneously and transparently to transaction participants (broker, issuer, bond counsel, tax counsel) at the expiration of the bid process, the broker's ability to influence the outcome is nearly eliminated. A level playing field is created for all bidders and the highest possible investment yield is assured to the benefit of the issuer and the U.S. Government. This process uses the same technologies currently employed by the bidders—specifically, facsimile, and to some extent, electronic mail—in the existing process, so it does not create an additional burden to bidder participation.
June 30 (June 20 Julian Calendar, Wednesday), Britain: Lord Cecil Calvert, second Baron Baltimore, is granted at Greenwich a charter for establishing a proprietary colony on Chesapeake Bay between Pennsylvania and Virginia in the New World by King Charles I of England (it specifies all unsettled lands north of the Potomac River on both sides of the Chesapeake Bay, so as to avoid conflicts with settlers from Virginia Colony; the Lord Proprietor is also to furnish one fifth of any gold or silver in the colony, and provide two arrows a year from local tribesmen to the Royal Castle at Windsor every Easter). Enjoying the rights of a palatinate (descendant rights nearly equal to an independent state, including rights to wage war, collect taxes, and establish a colonial nobility), Lord Baltimore gathers members, mostly Catholic, for the new colony, to be named Maryland after the reigning Queen Consort Henrietta Maria de Bourbon of England (age 23). On the same day, King Charles also issues a proclamation to the Gentry to keep to their residents in the country and not move residence to London, Winchester, or the adjoining towns. July 13 (July 3 Julian Calendar, Wednesday), Britain: In London, King Charles's Privy Council meets one last time on the matter of the Maryland Charter, and finally sides with Lord Cecil Calvert, second Baron Baltimore, ordering “that the Lord Baltimore should be left to his patent, and the other parties to the course of law, according to their desires. But for the preventing of further questions and differences, their Lordships did also think fit and order that, things standing as they do, the planters on either side shall have free traffic and commerce each with the other, and that neither party shall receive fugitive persons belonging to the other, nor do any act which may draw on a war from the natives upon either of them: and lastly that they shall sincerely entertain all good correspondence and assist each other in all occasions in such manner as becometh fellow subjects and members of the same state.” When news of this grant arrives in Virginia colony, the colonists there become angry at having to be neighbors with English Catholics; William Claiborne, with his own settlement in the northern Chesapeake Bay, prepares to do what he can to thwart the colony. Because of the anticipated opposition to this arrangement, Lord Baltimore decides to stay behind in London and support his colony in the Royal Court, sending his brother Leonard Calvert instead to serve as his governor (his youngest brother George Calvert likewise is sent to help with affairs in the new colony). September 25 (September 15 Julian Calendar, Sunday), Lord Proprietor Cecil Calvert, second Baron Baltimore (age 28), writes instructions to his brother and appointive Colonial Governor Leonard Calvert (age 27), their younger brother George Calvert, and commissioners Thomas Cornwallis and Jerome Hawley, while the ship “Ark of London” (under master Richard Lowe) and pinnace “Dove” (under commander Captain Robert Wintour and master Captain Richard Orchard) are being fitted for the voyage in London. These instructions declare that the new Maryland colony should not be for Catholics alone, but should be open for anyone to freely worship as they believe. ----------------- From "The History of Maryland" by John Leeds Bozman (1837): In most of the early public acts of the province, Leonard Calvert is commonly styled "his lordship's lieutenant-general," but as the term governor is a word of the same import and sometimes used in some of the old records of the province, and is also of more modern usage, and therefore more intelligible, it is here (in Bozman's book) adopted. The term "lieutenant-general," as thus used in the early colonization of the province, was probably adopted from that applied to the King's viceroy or governor of Ireland, who was at this period so termed (Lord Lieutenant of Ireland). October 25 (October 15 Julian Calendar, Tuesday), Britain: The ships “Ark of London” (manned by 40 men under master Richard Lowe) and “Dove” (manned by six men under commander Captain Robert Wintour and master Captain Richard Orchard), both owned by Cecil Calvert, second Baron Baltimore and Lord Proprietor of the proposed Maryland Colony, are fitted out for their journey to the New World at Blackwall. The ships are allowed to drift down the Thames River to Gravesend, where Governor Leonard Calvert orders the ships to load stores (including winter and summer clothing, cannons, knives, rifles, non-perishable food, plants and seeds, and casks of water and beer), and 128 passengers before sailing to the Isle of Wight. Believing that the ships had set sail for the New World already, Secretary of State Sir John Coke issues an urgent dispatch to Admiral John Pennington, ordering the ships intercepted and brought back to Tilbury Hope (across from Gravesend) so that those aboard can be administered their oath to the Crown, as per the original agreement between their Lord Proprietor and King Charles I of England, Scotland, and Ireland. October 29 (October 19 Julian Calendar, Saturday), English government agents administer the oath of allegiance to the Crown to all the 128 passengers and 40 crewmen who are aboard the ship “Ark of London” and the 8 crewmembers aboard the pinnace “Dove” at the port of Tilbury Hope (across from Gravesend). October 30 (October 20 Julian Calendar, Sunday), after having been certified as having all members aboard given the oath of allegiance to the Crown, Secretary of State Sir John Coke gives his permission for the ships “Ark of London” (under master Richard Lowe) and “Dove” (under voyage commander Captain Robert Wintour and pinnace master Captain Richard Orchard) to leave England “provided there be no other person or persons aboard the said ship or pinnace but such as have or shall have taken the oath of allegiance as aforesaid.” The ships sail for Cowes on the Isle of Wight, where they are to wait for a month further passengers and supplies. (The original intent of the sailing to take place in late fall was to time their landing so that homes could be built before the spring planting; the coming delay at the Isle of Wight would rush this schedule.)
James Fleetwood James Fleetwood (baptised 25 April 1603, Chalfont St Giles; died 17 July 1683, Hartlebury Castle) was an English clergyman and Bishop of Worcester. Life He was descended from the old Lancashire family of Fleetwood and was the seventh son of Sir George Fleetwood of The Vache, Chalfont St Giles, Buckinghamshire. He was educated at Eton and King's College, Cambridge. Upon his ordination he was appointed chaplain to Dr Wright Bishop of Lichfield. He became vicar of Prees, Shropshire and a Prebendary of Eccleshall. Fleetwood was a committed Royalist and served as chaplain in the King's Army during the Civil War. In 1642 he was awarded a Doctorate of Divinity by King Charles in recognition of his services at the Battle of Edge Hill, and in the same year was appointed Rector of Sutton Coldfield and chaplain to Charles, Prince of Wales. At the end of the Civil War he was ejected from the living of Sutton Coldfield but on the Restoration he was appointed as chaplain to Charles II and Provost of King's College, Cambridge. He was later Rector of Anstey, Hertfordshire and of Denham, Buckinghamshire and in 1675 was appointed Bishop of Worcester. He died in 1683 and was buried in Worcester Cathedral. References A Genealogical and Heraldic History of the Extinct and Dormant Baronetcies of England, Ireland and Scotland 2nd Ed (1844) John and John Bernard Burke p200 Google Books. Brief biography of James Fleetwood. Category:English bishops Category:1600s births Category:1683 deaths Category:People educated at Eton College Category:Alumni of King's College, Cambridge Category:17th-century Anglican bishops Category:Bishops of Worcester Category:Vice-Chancellors of the University of Cambridge Category:Provosts of King's College, Cambridge Category:Cavaliers
The quest to achieve the detailed structural and functional characterization of CymA. Shewanella oneidensis MR-1 is a sediment organism capable of dissimilatory reduction of insoluble metal compounds such as those of Fe(II) and Mn(IV). This bacterium has been used as a model organism for potential applications in bioremediation of contaminated environments and in the production of energy in microbial fuel cells. The capacity of Shewanella to perform extracellular reduction of metals is linked to the action of several multihaem cytochromes that may be periplasmic or can be associated with the inner or outer membrane. One of these cytochromes is CymA, a membrane-bound tetrahaem cytochrome localized in the periplasm that mediates the electron transfer between the quinone pool in the cytoplasmic membrane and several periplasmic proteins. Although CymA has the capacity to regulate multiple anaerobic respiratory pathways, little is known about the structure and functional mechanisms of this focal protein. Understanding the structure and function of membrane proteins is hampered by inherent difficulties associated with their purification since the choice of the detergents play a critical role in the protein structure and stability. In the present mini-review, we detail the current state of the art in the characterization of CymA, and add recent information on haem structural behaviour for CymA solubilized in different detergents. These structural differences are deduced from NMR spectroscopy data that provide information on the geometry of the haem axial ligands. At least two different conformational forms of CymA are observed for different detergents, which seem to be related to the micelle size. These results provide guidance for the discovery of the most promising detergent that mimics the native lipid bilayer and is compatible with biochemical and structural studies.