text
string
id
string
dump
string
url
string
date
string
file_path
string
offset
int64
token_count
int64
language
string
page_average_lid
string
page_average_lid_score
float64
full_doc_lid
string
full_doc_lid_score
float64
per_page_languages
list
is_truncated
bool
extractor
string
page_ends
list
fw_edu_scores
list
minhash_cluster_size
int64
duplicate_count
int64
CHILDREN'S INTERNATIONAL SCHOOL, LAGOS ACADEMIC YEAR 2022-2023 SPRING TERM CURRICULUM OVERVIEW FOR PRIMARY Yr. 4 Spelling focus includes: Homophones and near homophones. Choose nouns or pronouns appropriately for clarity and cohesion and to avoid repetition. Handwriting:Reinforce the use of diagonal and horizontal strokes that are needed to join letters and understand which letters all term. Topic: To use maps, atlases to identify the position and significance of latitude, longitude, longitude, Equator, Northern Hemisphere, Southern Hemisphere, the Tropics of Cancer and Capricorn, Arctic and Antarctic Circle, the Prime/Greenwich Meridian and time zones. RE: To identify how students celebrate in their family, and explain how other people celebrate in their families. To compare celebrations for different cultures and religions Science: Investigate the differences between solids and liquids by examining and comparing the properties of sand and water. Discuss and explore the properties that make a material a solid or a liquid. French: Children will be able to describe their room in French. Music:  Children will be able to recognise repeated rhythmic patterns and time Values. Correctly use homophones and near homophones in the right context. Topic: Use maps, atlases to identify the position and significance of latitude and longitude. Identify the Equator, Northern Hemisphere, Southern Hemisphere, Tropics of Cancer and Capricorn, Arctic and Antarctic Circle, the Prime/Greenwich Meridian and time zones. RE: To describe the importance of a celebration Science: Children will be able to identify misconceptions and classify materials into solids, liquids and gases. Children will be able to explore a variety of everyday materials and develop simple descriptions of the states of matter. French: The children will be able to learn the objects and furniture in their room in French. Music   Introduction  to repeated rhythmic patterns. PE: Children will learn to familiarize themselves with football playing different games with the ball using different skills and techniques. Swimming: Students will learn how to improve their freestyle stroke by practicing: Leg kicks with arms extended and locked. T1, W2 Swimming: Freestyle stroke. Students will understand and be able to apply proper legs and arm actions as well as good body position and bilateral breathing in the freestyle strokes. Arts: Children will learn to recognize different features of a landscape. African Studies: Students will locate the Akan people using ancient and modern maps. ICT: To create a personal account on the scratch website and create simple programs with loops. PSHE: To identify ways that we can communicate respectfully online. Mathematics:  Students will be able to; Add and subtract fractions with the same denominator. Recognise and write decimal equivalents of any number of tenths or hundredth. Recognise and write decimal equivalents to 1/4, 1/2, 3/4 English: Children will be able to write Play scripts. PE: Children will be able to familiarize themselves with the game of football, play different games with the ball and get used to the game. Leg kicks with one arm on the thigh and the other extended forward with the shoulders touching the ear. Alternating arms action after six leg kicks. Single arm action 'catch and pull drill' and bilateral breathing every three arm pulls. Arts:  Students will collaboratively observe different landscape designed by various artists and identify the different features of these paintings. African Studies: To discover the location of the Akan people in the world. ICT: Children will be able to create and save programs on the scratch website and create simple programs with loops. PSHE: Children will be able to identify ways that we can communicate respectfully online. Mathematics: To add and subtract fractions with the same denominator. To recognise and write decimal equivalents of any number of tenths or hundredth. To recognise and write decimal equivalents to 1/4, 1/2, 3/4 English:  To plan and write several drafts of a play script. To propose changes to grammar and vocabulary to improve cohesion in sentences. Children will identify the features of a playscript as well as plan and write a play script using their traditional tale from the week before. In narratives, create settings, characters and plot. Grammar includes: Using the past tense and the perfect form of verbs. Spelling focus includes: (in order of weeks) Using near homophones in the right context. Topic: To locate the world's countries, using maps to focus on Europe (including the location of Russia) and Africa using an atlas. To use maps, atlases, globes and digital/computer mapping to locate countries and describe features. RE: To understand why events are important and why they are celebrated. To express how other people celebrate important events Science:  Develop understanding of gases through simple practical tasks and record findings using drawings. Investigate the presence of gases. French: Children will be able to talk about different buildings in a school. Music:  Children will be able to perform a repeated pattern to a steady The children will correctly use the past tense and the perfect form of verbs in sentences. To correctly use near homophones in the right context. Topic:   Children will be able to find countries in Europe and Africa on a map. Children will be able to find information in an atlas. RE: Children will be able to discuss how different celebrations are important to different people. Science: Children will be able to answer questions about gas using evidence from scientific enquiries and record findings using drawings. Children will be able to use simple practical enquiries and scientific evidence to demonstrate to others the evidence for gases. French:The children will be able to recognise the French buildings around the school. Music: Exposure to more rhythmic patterns PE: Children will learn to pass and control the ball with good eye coordination. Swimming:  Students will learn how to improve their freestyle stroke by practicing: Leg kicks with arms extended and locked. pulse and with awareness of different parts. Continuous single arm action 'catch and pull drill' and bilateral breathing every three arm pulls. PE:  Children will be able to control and pass the ball using their vision. Swimming: Freestyle stroke. Students will further understand and be able to apply proper legs and arm actions as well as good body position and bilateral breathing in the freestyle strokes. Arts:  To apply various techniques of applying water colour paint to create an abstract landscape. African Studies: Students will research for information behind the history of the Akan people from Ghana. ICT: Children will be able to program a chatbot. PSHE: Identify examples of cyberbullying and strategies to respond to online bullying. Continuous and alternating arms actions 'catch and pull drill' and bilateral breathing every three arm pulls. Arts:. Students will be able to respond to what is observed through painting. To understand the qualities and effect of a range of painting media. To use painting techniques for different purposes. Learn about the work of artists from different times and cultures. African Studies: To examine the history behind the Akan people. ICT: Children will be able to use the text to speech block code in scratch, and know that variables can be used to store user input. PSHE: Children will be able to identify examples of cyberbullying and strategies to respond to online bullying. T1, W3 Mathematics: Students will be able to; Convert between different units of measure [for example, kilometre to metre; hour to minute]. Use word problems to reinforce the above skill. English: Non-chronological Reports Children will be able to identify the features of non-chronological reports; plan and write a report on an animal using shared features. Grammar includes: Children will be able to extend the range of sentences with more than one clause and using a wide range of conjunctions Spelling focus includes: (in order of weeks) Children will be able to correctly spell nouns ending with suffix –ation. Topic: To use symbols and a key (including the use of Ordnance Survey maps) to build knowledge of the United Kingdom and the wider world by identifying landmarks shown on an Ordnance Survey map RE: Investigating different celebrations that occur in different cultures all over the world Explore two major festivals -the Chinese New Year and Holi celebrations Science:  Observe that some materials change state when they are heated or cooled, and measure or research the temperature at which this happens in degrees Celsius (°C). Mathematics: To convert between different units of measure [for example, kilometre to metre; hour to minute]. To use word problems to reinforce the above skill. English: To identify the features of non-chronological reports; plan and write a report on an animal using shared features. To extend the range of sentences with more than one clause and using a wide range of conjunctions. To correctly spell nouns ending with suffix –ation. Topic:To be able to use a key to describe features on an Ordnance Survey map. RE: To understand how some celebrations are similar or different to others. Science: To understand, through practical tasks, that materials change state when they are heated or cooled and describe this process using scientific language. To understand the behaviour of particles in the different states and use a thermometer to observe temperature changes of water. French: The children will be able to say their names and ask people what their names are, and learn the days of the weeks and the months of the year. T1, W4 Learn about how particles behave in different states, and use a thermometer to make observations as water changes from one state to another. Music:  To  describe rhythms  through rhythmic symbols (notations). French: Greetings and introductions Music:  To perform a repeated pattern to a steady pulse with awareness of different parts. Arts:  To explore the image of Paul Klee's Landscape. PE:  Children will be able to control and dribble also encourages the use of vision. They will be able to understand the importance of movement on and off the ball in order to dribble an opponent. Swimming: Freestyle stroke. Students will know and be able to swim the freestyle stroke with correct form for 50 metres. African Studies: Students will be able to provide vital information and compare the Akan culture with others. ICT: Children will increase the complexity of their chatbot program. PSHE: To identify examples of online risks such as harmful content or contact and how we can protect ourselves from them . Mathematics:The students will be able to; Arts: Students will be able to createthe sky using wet on wet technique and demonstrate loading to create a wash. PE:  Children will  begin to control and dribble the ball using their vision and understand the importance of movement on and off the ball when dribbling opponents. Swimming: Students will swim complete freestyle stroke for 50m by practicing: Leg kicks with arms extended and locked. Leg kicks with one arm on the thigh and the other extended in front. Alternating arm actions after six leg kicks. Continuous and alternating arms actions 'catch and pull drill' and bilateral breathing every three arm pulls. Complete 50metres freestyle swim with bilateral breathing. African Studies: To investigate the Akan culture. ICT: Children will join text in scratch, use variables to store and respond to user input. Use the repeat loop code. PSHE: Children will be able to identify examples of online risks such as harmful content or contact and how we can protect ourselves from them. Mathematics: To identify lines of symmetry in 2-D shapes presented in different orientations. Identify lines of symmetry in 2-D shapes presented in different orientations To complete a simple symmetric figure with respect to a specific line of symmetry. Complete a simple symmetric figure with respect to a specific line of symmetry. English: Non-chronological Reports Children will identify the features of non-chronological reports; plan and write a report on scientific discovery or archaelogical findings. Grammar includes: Children will be able to extend the range of sentences using conjunctions expressing time, place and cause. Spelling focus includes: Adding the prefix sub- (meaning 'under') and adding the prefix super(meaning 'above'). Topic:  To use the eight points of a compass to build knowledge of the United Kingdom and the wider world by describing routes on a map. To use four and six-figure grid references to build their knowledge of the United Kingdom and the wider world by finding features on a map. RE: To identify what type of celebration Eid ul fitr is, and state the events that are observed during this celebration To compare this celebration to another religious celebration. To explain the Ancient Greek religion and mythology, the twelve Olympians. English: To identify the features of non-chronological reports; plan and write a report on scientific discovery or archaelogical findings. Extend the range of sentences using conjunctions expressing time, place and cause. To correctly add the prefix sub- (meaning 'under') and add the prefix super(meaning 'above'). Topic:  Students will use the eight compass points to describe routes on a map. Students will use four or six-figure grid references to locate places on a map RE: To research a celebration and explain its importance (Eid ul fitr) To examine the life, symbols and significance of Greek gods and goddesses: Aphrodite and Apollo Children will understand that Greek gods had some human characteristics and that they helped the Greeks to explain the world around them. Science: Children will be able to describe the terms evaporation and condensation. Children will be able to use scientific language to explain evaporation and condensation to others. Life, symbols and significance of Greek gods and goddesses Science: Learn about the water cycle and begin to understand the terms evaporation and condensation. Identify the part played by evaporation and condensation in the water cycle and associate the rate of evaporation with temperature. French: Greetings and introductions. Music:  To perform with awareness of different parts, Bar-line and time signatures PE:    Children will be able to pass the ball with accuracy using the inside of the foot. They will also be able to apply and demonstrate the replication of all the skills and rules learned in a game situation. Swimming: Backstroke. Students will understand and begin the backstroke by practicing good leg kicks and flat body position. Arts: To explore the image of Paul Klee's Landscape. African Studies: Students will be able to explain the uses of Adinkra symbols to the Akan people; identify some Adinkra symbols and their meanings. ICT: Children will increase the complexity of their chatbot program. French: The children will be able to say and recognise numbers in French from 1-31, say when their birthday is and practise the French alphabet. Music:To discover that repeated patterns are often used in music. PE:   Children will learn to pass the ball with some level of accuracy. They will learn to apply all techniques acquired to excel in the game, demonstrate and develop their knowledge and understanding of the rules within a game situation. Swimming: Students will begin the backstroke by practicing leg kicks with: -Float on chest -Float on abdomen or thighs -Float on the knees -Hands on thighs with leg kicks -Hands behind the head with leg kicks and -Hands extended behind the head with leg kicks. Arts:  Students will be able to review their works where applicable. African Studies: To explore the Adinkra symbols of the Akan people. ICT: Children will join numbers in arithmetic operation, add sound and use the if-then/ if-then-else conditional statement to respond to user input. PSHE: Children will be able to identify examples of hurtful behaviour and the effect our actions have on the feelings of others. RE: To understand why events are important and why they are celebrated. To express how other people celebrate important events and how they see Christmas being celebrated (in TV, shows and programmes) and what they observe people from other cultures do at Christmas. PE: To be able to sprint over short distances demonstrating this technique (high hips, relaxed neck and shoulders, still head etc.) Swimming: Students will perform arm actions in the backstroke using the following methods: -Demonstration outside of the pool. -Lying on the poolside. -Sculling action of the arms. -Single arm pull with the floater. -Double arm actions with the pull buoy and -Alternating arms with the pull buoy. French: The children will be able to understand different shops and places around town in French. Music:  Further exposure to rhythmic patterns based on spoken phrases Arts:   Students will learn about Impressionism through studying Water lilies 1905. African Studies: To design an Adinkra poster or a fabric. ICT: Children will learn how to backdrops that will suit the purpose of the app. Children will be able to create a variable to store data. Be able to hide and show a sprite PSHE: Children will be able to identify examples of good secrets and bad secrets, describe when it is right to keep a secret and when it is important to share a secret. Science: To ask questions and set up a simple fair test to investigate factors that speed up evaporation. End of Unit Assessment PE:. The children will  learn how to improve their 75m and 100m sprinting race. Swimming: Backstroke.Students will understand and begin the backstroke by practicing good leg kicks and flat body position. French: Children will be able to identify places in town. Music:  Students will invent lyrics to fit set rhythmic patterns and notes on the stave Arts:. To Explore the work of Claude Monet African Studies: Students will design a poster or a piece of fabric using Adinkra symbols. ICT: Children will create a questionnaire app. PSHE: To identify examples of good secrets and bad secrets, and when it's right to keep or share a secret. T1, W8 French: Nouns and articles. Music: To  perform with awareness of different parts and make improvements to their work PE:  To be able to perform a standing and semi-crouched sprint start. Swimming: Backstroke. Students will understand and be able to use correct arm actions in the backstroke. Arts: Water lilies: Claude Monet African Studies: Students will identify and state some of the major components of Ancient Mali that made it prosperous. ICT: Children will add more functionality to the questionnaire program. PSHE: To identify tell-tale signs that online images have been digitally altered or faked. Mathematics:Children will be able to; Solve problems involving multiplying and adding, including using integer scaling problems and harder - The feet are about shoulder width apart to obtain a good balanced position - The weight is distributed so that about 2/3rds of the weight is on the front foot. Set: - Bend the knees and lean forwards. - Arms synchronised with the legs - in this case right foot forward and left arm forward. - Back, neck and head in line. Swimming: Students will perform arm actions in the backstroke using the following methods: -Demonstration of outside the pool -Lying on the poolside -Sculling action of the arms -Single arm pull with the floater -Double arm actions with the pull buoy and -Alternating arms with the pull buoy. Arts:  Students will learn to use fine brush and dabs to create impressions rather than exact shapes. African Studies: To compare the location of Mali on the ancient and modern map. ICT: Children will learn how to use sound blocks and work with the if-then-else conditional statements. PSHE: Children will learn how to identify tell-tale signs that online images have been digitally altered or faked. Mathematics: To solve problems involving multiplying and adding, including using integer scaling problems and harder correspondence correspondence problems such as n objects are connected to m objects. problems such as n objects are connected to m objects. English:  Students will be able to write Myths and legends stories. Using features identified last week, the children will be able to write the final drafts of their myth or legend using checklists provided. Grammar includes: To indicate possession by using the possessive apostrophe, including with plurals. Spelling focus includes: The children will be able to correctly use words with a 'soft c' spelt with 'ce'. Topic: To understand aspects of Greek Myths and where we gain this information. To know what a myth is. Children appreciate and recognise the main features of Greek theatre. RE: To locate ancient Greek civilization in time Science:  They will recognise that vibrations from sounds travel through a medium to the ear. French: Nouns and articles. Music: The children will be able to identify different ways sounds are used to accompany a song PE: Athletics (Track and Field) Track: 100m, 200m, 400m, 800m, 1200m, 1500m,3000m, 5000m, 10000m, cross country, hurdles, steeplechase, Marathon, Relay. English : To read and compare different myths and legends. To indicate possession by using the possessive apostrophe, including with plurals. To Correctly use words with a 'soft c' spelt with 'ce'. To give and receive feedback based on the first draft of their Myth or legend. To transfer their mythical story to a scratch programme. Topic: To understand aspects of Greek Myths and where we gain this information. To know what a myth is. Children appreciate and recognise the main features of Greek theatre. To understand that Ancient Greece was made up of city states. To understand aspects of Greek Myths and where we gain this information. To know what a myth is. RE: To place the ancient civilization in time Science: To recognise that vibrations from sounds travel through a medium to the ear. French: The children will be able to know the French word for 'a', 'an' and 'the'. Music: An Introduction to musical T1, W9 accompaniment. Field: Long Jump, High Jump, Javelin, Shot Put, Triple jump, Hammer throw, Pole volt, Discuss, Swimming: Backstroke; Students will know and be able to demonstrate a complete backstroke for 4 x 12metres. Arts:  Introduction to perspective drawing African Studies:  Students will recount the legend of Sundiata Keita. ICT: Children will add more functionality to the questionnaire program. PSHE: To define the term 'digital footprint' and how to recognise what is or isn't appropriate to share online. Mathematics: The students will be able to; Solve problems involving multiplying and adding, including, integer scaling problems and harder correspondence problems such as n objects are connected to m objects. English:  Students will be able to write Personal Recounts. Grammar includes: To use appropriate punctuation after fronted adverbials. PE:  The children will be able to execute 100m and 200m. Swimming: Students will combine legs and arm action as well good body rotation to make a complete backstroke for 4 x 12metres. Arts:  Students will understand the use of horizon lines and vanishing points African Studies:  To examine the legend of Sundiata Keita. ICT: Children learn how to edit backdrops and add the switch costume and backdrop blocks to the program. PSHE: Children will be able to define the term 'digital footprint' in their own words and how to recognise what is or isn't appropriate to share online. Mathematics: To solve problems involving multiplying and adding, including integer scaling problems and harder correspondence problems such as n objects are connected to m objects. English: To listen to and discuss a wide range of non fiction. (Reading Comprehension) To use appropriate punctuation after fronted adverbials. Spelling focus includes: To begin to plan a personal recount in the first person, about a fear or phobia. The children will be able to correctly spell words with a 'soft c' spelt with 'ci' Topic:  To understand what is meant by democracy. RE: To understand some of the ideas of people living in Athens and Sparta Science: Find patterns between the pitch of a sound and features of the object that produced it. French: Nouns and articles. Music: The children will be able to identify melodic phrases and play them by ear and understand the treble (G) clef PE: Athletics (Track and Field) Track: 100m, 200m, 400m. Swimming: Backstroke; Students will know and be able to demonstrate a complete backstroke for 4 x 12metres. Art:  Urban Perspective African Studies:   Students will evaluate the authenticity of stories told by griots about Sundiata Keita. ICT: Children will create a program in Scratch. To edit and improve my recount draft using the correct features and checklist. To publish my recount. To correctly spell words with a 'soft c' spelt with 'ci' Topic: To understand what is meant by democracy. RE: To understand some of the ideas of people living in Athens and Sparta Science: To find patterns between the pitch of a sound and features of the object that produced it. French: The children will be able to know the French word for 'a' 'an' and 'the' and also learn how to apply them to nouns Music: To explore melodic phrases PE: The children will be able to execute 200m and 400m. Swimming: Students will combine legs and arm action as well good body rotation to make a complete backstroke for 4 x 12metres. Art:  Students will be able to use wax crayons to explore the Garrowby hill painting understanding the use of foreground, background and midground. -To understand the qualities and the effects of a range of painting media. T1, W10 PSHE: To identify examples of different types of communities and what it means to live in, and belong to one. -To use painting techniques for different purposes. African Studies: To evaluate the importance of griots to the history of Mali. ICT: Children learn how to add sound effects appropriately to a program, create variables, use the if-then-else statement. PSHE: Children will be able to identify examples of different types of communities and what it means to live in, and belong to one. Mathematics :  To estimate, compare and calculate as well as convert between units of mass (kg/g) and volume/capacity (l/ml). English : - To read texts that are structured in different ways (non fiction). To identify how language, structure, and presentation contribute to meaning. To identify the features of a newspaper report. To plan and write their first draft of a newspaper report. Topic: To infer information about Greek wars and warfare from illustrations and artefact photographs. To study armour and warships. RE: To understand that Greek gods had some human characteristics and that they helped the Greeks to explain the world around them. Mathematics: The students will be able to; Estimate, compare and calculate as well as convert between units of mass (kg/g) and volume/capacity (l/ml). English:  Students will be able to write Newspapers Reports. Grammar includes: To use paragraphs to organise ideas around a theme. Spelling focus includes: Words with a 'soft c' spelt with 'ci' Handwriting:Reinforce the use of diagonal and horizontal strokes that are needed to join letters and understand which letters. Topic:  To infer information about Greek wars and warfare from illustrations and artefact photographs. To study armour and warships. T1, W 11 RE: To examine the life, symbols and significance of Greek gods and goddesses: Aphrodite and Apollo Science: Find patterns between the volume of a sound and the strength of the vibrations that produced it. Mid-Topic Assessment Science:To find patterns between the volume of a sound and the strength of the vibrations that produced it. French: The children will learn about different outdoor sports in French. Music: Students will learn a song and sing it together and identify melodic phrases PE:  Athletics (Track and Field) Track: 100m, 200m, 400m, Swimming: Breaststroke; students will know and be able to demonstrate good breaststroke leg kicks, body position as well as correct breathing. Arts: Landscape perspective in the style of Seurat. African Studies: Students will recount the legend of Mansa Musa and his contributions toward the Mali Empire. ICT: Children will add more functionality to the game program. PSHE: To define racism and identify examples of racism. Mathematics :Students will be able to; Plot specified points and draw sides to complete a given polygon and French: The children will be able to talk about sports in French. Music: To explore melodic phrases PE:. The children will be able to execute the 200m and 400m. Swimming: Breaststroke; students will know and be able to demonstrate good breaststroke leg kicks, body position as well as correct breathing. Arts: Students will be able to create and show a developing understanding of perspectives when painting landscapes using pointillism. African Studies: To analyse the legend of Mansa Musa and reasons for Mali's prominence. ICT: Students create more complex sequences of instructions for the Scratch game. PSHE: Children will be able to define racism, identify some examples and the impact of racism on individuals and wider society. Mathematics : To plot specified points and draw sides to complete a given polygon and draw a pair of axes in one quadrant, with equal scales and integer labels. draw a pair of axes in one quadrant, with equal scales and integer labels. Identify lines of symmetry in 2-D shapes presented in different orientations. Complete a simple symmetric figure with respect to a specific line of symmetry. English:  Students will be able to write Newspapers Reports. Grammar includes: The children will be able to use simple organisational devices [for example, headings and subheadings] Spelling focus includes: The children will be able to correctly spell words with a 'soft c' spelt with 'ce'. Handwriting:Reinforce the use of diagonal and horizontal strokes that are needed to join letters and understand which letters. Handwriting: Increase the legibility, consistency and quality of their handwriting (for example, by ensuring that the downstrokes of letters are parallel and equidistant). Topic:  To look at the main events and characters of a key battle. To know that a battle may be interpreted in different ways and why this is so. To identify lines of symmetry in 2-D shapes presented in different orientations. To complete a simple symmetric figure with respect to a specific line of symmetry. English : To read texts that are structured in different ways (non fiction). To continue to identify how language, structure, and presentation contribute to meaning. To correctly spell words with a 'soft c' spelt with 'ce'. To use simple organisational devices [for example, headings and subheadings] Topic:  To look at the main events and characters of a key battle. To know that a battle may be interpreted in different ways and why this is so. To understand how modern events have connections with the past RE: To examine the life, symbols and significance of Greek gods and goddesses: Aretmis and Ares. Science: Investigate sound-proofing materials by planning and conducting a fair test. To consider all the variables and how to record the results. French: At the end of the lesson children To understand how modern events have connections with the past. should understand and use the French possessive adjectives accurately. RE: Children will understand that Greek gods had some human characteristics and that they helped the Greeks to explain the world around them. Science: To investigate sound-proofing materials by planning and conducting a fair test, considering all the variables and how to record the results. (Week beginning on the 28th Group task: Experiment and Independent task End of Unit) French: The children will be able to express the idea of possession using mon ma and mes to mean 'My'. Music: Students will identify and play repeated rhythmic patterns, and be introduced to the bass (F) clef PE: Field: Long Jump, High Jump, Javelin, Shot Put, Triple jump, Hammer throw, Pole volt, Discuss. Swimming: Breaststroke; students will understand and be able to demonstrate correct arm actions in the breaststroke as well as swim complete stroke with face in water for short distance. Arts:  Landscape perspective in the style of Seurat. African Studies:  Students will be able to outline the major trade routes and other important infrastructures in Timbuktu. Music: To explore melodic phrases using the bass clef. PE:  The children would be able to the shot put throw using the appropriate technique Swimming: Students will further learn how to swim the breaststroke by: I. Demonstrating the arms action on the land II. Sculling practice with the arms III. Practising the arm movement with the pull buoy in between the legs IV. Combining the legs and arms actions as well as good body position to make a complete breaststroke without breathing for a short distance. Arts:  Students will be able to create and show a developing understanding of perspectives when painting landscapes using pointillism. African Studies: To examine the importance of Timbuktu to Mali. ICT: Children will learn to combine variables and loops to create a timer for their program. PSHE: Children will be able to define prejudice and discrimination and identify different types of discrimination. T1, W 12 ICT: Children will add more functionality to the game program. PSHE: To define prejudice and discrimination and identify different types of discrimination. Mathematics : Students will be able to; Estimate, compare and calculate different measures, including money in pounds and pence. Use word problems for reinforcement. English:  Students will be able to write Narrative poems. Grammar includes: To identify how language, structure, and presentation contribute to meaning. Spelling focus includes: Word families based on common words, showing how words are related in form and meaning. Handwriting:Increase the legibility, consistency and quality of their handwriting (for example, by ensuring that the downstrokes of letters are parallel and equidistant). Topic: To be able to deduce information about Greek beliefs and religious practices from pictures of buildings and pottery. Mathematics : To estimate, compare and calculate different measures, including money in pounds and pence. To use word problems for reinforcement. English :   To read texts that are structured in poetry. To identify how language, structure, and presentation contribute to meaning. To learn about the features of Narrative Poems. To write the first draft of a narrative poem. Topic:  To be able to deduce information about Greek beliefs and religious practices from pictures of buildings and pottery. To learn about the beliefs of Ancient Greeks. Science: Students will understand the behaviour of particles in the different states and use a thermometer to observe temperature changes of water. French:  At the of the lesson children should understand indoor sports. Music: Investigate sound-proofing materials by planning and conducting a fair test. T1, W 13 To learn about the beliefs of Ancient Greeks. PE:  To be able to perform/execute a good relay baton exchange and a good jump. Science: To investigate sound-proofing materials by planning and conducting a fair test, considering all the variables and how to record the results. French: The children will have to know and understand indoor sports in French. Music:  Students will be able identify melodic phrases, play them by ear and recognise how music can reflect different intentions, performed in different ways, exploring the way the performers. They will also familiarise with the bass (F) clef PE:  Athletics (Track and Field) Track: 400m, Relay/ Long Jump Swimming: Students will know and be able to swim complete breaststroke and breathing every stroke for a distance of 25metres. Arts:  Students will critically review and work on their projects based on feedback. African Studies: Students will be assessed on all they have learnt so far. ICT: Children will add more functionality and complexity to the game program. Mathematics : Children will review topics covered this term. Swimming: Students will learn to swim complete breaststroke by combining legs and arms actions as well as horizontal body position and breathing for 25metres. Arts: Students will critically review and work on their projects based on feedback. African Studies: To review our learning on the ancient Mali empire. ICT: Children will use conditional statements to add functionality to the game Mathematics :  Children will review topics covered this term. English:  Students will be able to perform their Narrative Poems. Grammar includes: To review topics covered this term. English: Read aloud their own writing, to a group or the whole class, using appropriate intonation and controlling the tone and volume so that the meaning is clear. Spelling focus includes: Statutory Spellings Challenge Words Handwriting:Increase the legibility, consistency and quality of their handwriting (for example, by ensuring that the downstrokes of letters are parallel and equidistant). Topic: To design and make masks and headdresses. Science: To explore and identify the way sound is made through vibration in a range of musical instruments. French: Review and Assessment Music:  Students will be able identify melodic phrases, play them by ear and recognise how music can reflect different intentions, performed in different ways, exploring the way the performers. They will also familiarise with the bass (F) clef. PE: Athletics (Track and Field) Track: 400m, Relay/ Long Jump Swimming: Students will understand and be able to swim complete breaststroke for 50m with improved form. Arts: Students will critically review and work on their projects based on feedback. To review topics covered this term. Respond to others appropriately, taking into account what they say Topic: Students will be able to appreciate the importance of masks, headdresses and face paint to tribal people. Science: Explore and identify the way sound is made through vibration in a range of musical instruments. French:   Review and Assessment Music: To explore melodic phrases, consider their intended effect, and expressively use musical elements. PE: To be able to perform/execute a good relay baton exchange and a good jump Swimming: Students will further learn how to swim complete breaststroke using the method 'pull and breathe, kick and glide' for 50m. Arts:  Students will critically review and work on their projects based on feedback. African Studies: Review learning this term. ICT: Children will use all they have learnt to add their own creativity to the program. African Studies: Review learning this term. ICT: Children will explore adding more flexibility and creativity to the game
<urn:uuid:82884e57-c1b5-4b04-b312-c6b23b21302e>
CC-MAIN-2023-14
https://www.cislagos.com/assets/Documents/Curriculum_Overview-/Year-4-Spring-Term.pdf
2023-03-27T00:29:05+00:00
crawl-data/CC-MAIN-2023-14/segments/1679296946584.94/warc/CC-MAIN-20230326235016-20230327025016-00335.warc.gz
793,306,263
8,155
eng_Latn
eng_Latn
0.953629
eng_Latn
0.997969
[ "nld_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 114, 2246, 4225, 6239, 7690, 9889, 12058, 14233, 16399, 18534, 20459, 22538, 24331, 26202, 27986, 30001, 31955, 34074, 35839, 37405, 39517, 39641 ]
[ 4.71875, 4.71875 ]
1
0
User guide to the java applet Compoly for learning descriptive geometry (assoc. prof. M. Szilvási-Nagy, Dept. of Geometry, www.math.bme.hu/~geom/) After starting: the actual model is a cube defined by the data in the left-hand side menu (see help). The composition of the polyhedrons is empty. Transformations: the commands r+ and r- rotate the actual model around the specified coordinate axis; m+ and m- (move) define translation, +s and -s define stretching/compressing. Changing the direction of projection: the commands left, right, up, down in the menu project from rotate the direction of projection, top/front draws top view (below) and front view (above). Transformations in the projection: the commands in the menu picture transform act on the screen; reset regenerates the original dimensions of the picture. 1. problem Put the cube defined in its original position (top/front, reset, def) into the composition (merge). Make a prism from the cube by transformations: Rotate around the cube into a parallel position to the coordinate axes (r+ 3-times). Watch the line of intersection on the actual model built with the components in the composition. Change the direction of projection, then top/front. Compress the actual model in the direction of z (-s 4-times) and in the x-direction (-s 4-times), stretch it in y-direction (+s 5-times). Change the position of the prism: Move it upwards in z-direction (m+ into the middle) and in x-direction (m+ into a symmetric position), watch the line of intersection with the cube on the surface of the prism. Change the direction of projection. Put the prism into the composition (merge), then change the option mode=draw into paint. The front view of the composition will appear. Look the central projection through red-green glasses by choosing the option draw=centr. You will see the composition in 3D. 2. problem Delete the data structure of the composition (new comp) and also the actual model (clear). The new actual model is a square. Change the number of sides into 2, then press def. (This is the axial section of the cube in the xz-plane.) Rotate it around x (r+ 3-times), then around z (r- 2-times). Put it into the composition (merge). Define a triangle: the number of sides = 2, lower radius1= 7.1, upper radius2= 0.1, height= 12, color= 3, press def. Rotate it around z (r- 4-times), around y (r- 2-times), Move it along y (m- 3-times), then merge. Generate different projections with the options (paint) and (centr), change the direction of projection, transform also the picture. 3. problem Pyramid: The number of sides= 5, lower radius1= 8, radius2= 0.1, height=12, color= 2, def, merge. Trapezoid: The number of sides= 2, radius1= 4, radius2= 6, height= 12, color= 3, def. Rotate around x (r+ 3-times), move along y (m+ 8-times), move along z (m+ 3-times) Change the direction of projection! The line of intersection is shown on the actual model. If the pyramid is the actual model (i.e. it is defined as the second model), then the line of intersection will be drawn on its surface: Delete the pyramid from the composition ( new comp ), put the trapezoid into the composition ( merge ), then define the pyramid again by the data 5, 8, 0.1, 12 and 2. In the drawing modes paint and centr only the composition is shown, i.e. the 2. model should be joined by the command merge. 4. problem Prism to the left: 4, 7, 7, 10, 1, def , z r- 3-times, merge Triangle roof: 3, 7, 7, 11, 2, def , z r+ 2-times, x r- 6-times (into horizontal position), moving up on the top of the prism: z m+, y m-, merge. Tower: 6, 8, 8, 25, 1, def , z r+ 2-times, y m+, merge. Conic roof: 18, 10, 0.1, 7, 2, def, move upon the tower: y m+, z m+, merge. Delete the actual (last) model (clear), and choose the mode paint or centr. Remarks: 1. The picture can copied into the graphic editor paint or into word through the clip board (press Alt-PrintScreen then paste). 2. The stand alone program writes the data of the composition into a .wrl file, which can be transported e.g. into the program Euler3D. 5. problem cone: 24, 8, 0.1, 12, 2, def, merge cylinder: 18, 2.6, 2.6, 18, 3,def rotate into horizontal position (x, r+ 6-times), move along y (m+ into symmetric position), move along z (m+ above the base of the cone) change the direction of projection (left/right, up/down), move along x (m+), watch the line of intersection. If the configuration looks nicely, merge. Change the mode into paint or centr. 6. problem delete the actual model (clear) and the composition (new comp), press top/front and reset. define the cone above again: 24, 8, 0.1, 12, 2, def, merge define a rectangle: 2, 12, 12, 18, 3, def rotate x, r+ 2-times, move z, m- 3-times, move y m+ watch the conic section change the mode into centr in order to get different conic sections rotate again around x and move along y change the direction of projection merge the rectangle, move it upwards (z m+) and merge it again colored picture will be shown in the paint mode more constructions:
<urn:uuid:c81b7cd1-12fa-4918-ba4b-103ab3731f1a>
CC-MAIN-2023-14
http://math.bme.hu/~geom/compolyk/Compoly-lab.pdf
2023-03-27T00:17:53+00:00
crawl-data/CC-MAIN-2023-14/segments/1679296946584.94/warc/CC-MAIN-20230326235016-20230327025016-00334.warc.gz
36,276,967
1,372
eng_Latn
eng_Latn
0.985138
eng_Latn
0.98593
[ "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 2571, 4097, 5074 ]
[ 2.1875 ]
1
0
I would give my bread to the hungry and my clothing to the my people dead and thrown out Tobit 1:17 naked; and if I saw any one of behind the wall of Nin'eveh, I would bury him. The Silent Witness of Saint John Cemetery Charleston is blessed with an African-American Catholic community that has compellingly born witness to the Gospel while living a rich cultural history including the injustices, triumphs, and struggles that characterize the experience of African-Americans throughout the southern United States. Many places in Charleston, to which almost half of all enslaved Africans first entered North America, signify struggle. One place in particular, Saint John Catholic Cemetery, is ground on which the enduring grace of faith in Christ has been a silent witness to injustice and indifference. It is ground on which today we lay Catholics can join together as brothers and sisters in Christ to bring long overdue recognition to the faithful souls there interred. In its silence, Saint John Cemetery stands like Jesus before His accusers convicting us of our neglect. We owe our brothers and sisters in the community of saints a proper memorial that speaks to them and future generations about their faith, our faith, that in the words of Venerable Father Augustus Tolton, teaches us to, "pray and forgive." The first Bishop of Charleston, John England, reported in 1833 that roughly 1,200 enslaved people in Charleston were Catholic. In 1843, a representative of the Diocese of Charleston purchased a plot of land located near the Southeast corner of Coming Street and the Crosstown Highway for, "use of the colored Roman Catholic population of the City of Charleston and Charleston Neck, as a cemetery or burial ground for the said Colored Slaves or free," black people.* The diocese later used a portion of the cemetery property at the corner of Coming Street and Shepard Street now the Crosstown, for the construction of Immaculate Conception Church which was dedicated in 1880. This wooden building was later converted to a school for African-American children. In 1923, the diocese used the western portion of the property along Shepard Street now the Crosstown to build a new brick Immaculate Conception Church for African-American Catholics. The cemetery remained in use. While it was owned by the diocese, the unincorporated "Saint John Burial Association," comprised of African-American church elders, maintained the property. In 1967, the diocese closed what had been the two African-American churches in the previously Jim Crow segregated Charleston—Immaculate Conception and Saint Peter which was located on Wentworth Street. African-American parishioners were transferred to Saint Patrick Church. SAINT JOHN CEMETERY CHARLESTON, SC A third historically African-American church, Our Lady of Mercy on America Street, was merged with Saint Patrick Church in 2014. Also, in 1967, the South Carolina Department of Transportation which had taken by eminent domain a portion of the Immaculate Conception and Saint John property while eradicating the adjacent portion of Shepard Street, completed the Crosstown Highway. The school was closed and both buildings were damaged by fire and later razed. During the transfer of parishes to Saint Patrick Church, the cemetery death register for the period including the burial of enslaved people (1843-1882) was lost. For more than twenty years, the property remained vacant and unmarked. Grave stones were lost, destroyed, or removed. Its history forgotten or overlooked, the diocese sought to sell the property in the 1990's. In 1994, a group of concerned African-Americans prompted a study conducted by the Chicora Foundation and initiated on behalf of the community by Calvary Episcopal Church. The study concluded that as many as 1,000 souls may be buried in the ground of this consecrated Catholic cemetery. The diocese suspended its efforts to sell the property. In recent years, at the request of Saint Patrick Church, the diocese assumed responsibility for the maintenance of the property. It fenced in most of the land and posted a sign identifying it as a Catholic cemetery. For anyone unfamiliar with its history, the cemetery property behind the fence is an unremarkable grass field. Painfully, for our Catholic neighbors who still have a family or personal connection to the cemetery, it is often used as a dog park. For the souls interred therein, it is their final resting place—a place that connects our brief life in this fallen world with the hope of eternal union with Christ among the communion of saints. The Saint John Cemetery Memorial Project In the eyes of the foolish they seemed to have died, and their departure was thought to be an affliction, and their going from us to be their destruction; but they are at peace. For though in the sight of men they were punished, their hope is full of immortality. Having been disciplined a little, they will receive great good, because God tested them and found them worthy of himself. (WIS 3:2-5) CONCEPTUAL DESIGN OF SAINT JOHN CEMETERY MEMORIAL PARK The lay Catholic community of Charleston shares a duty to make this final resting place of our departed Catholic brothers and sisters a holy place of remembrance and prayer. Carolina Catholic Professionals, a nonprofit charitable organization, has made the Saint John Cemetery Memorial Project its priority endeavor. Pictured to the left is a conceptual design for a memorial park. * From passage quoting the Charleston County RMC Deed Book N11, page 130; referenced in "The St. John's Burial Association and Catholic Cemetery at Immaculate Conception, City of Charleston, South Carolina: What Became of the Dead?" Tinkley, Michael; Hacker, Debi; Chicora Foundation Research, 1994. We ask you to join us in support of this effort. Donate here https://carolinacatholicprofessionals.com/Donate Please contact Frank Dirks by email at email@example.com or by phone at 843.670.1350
<urn:uuid:59ba068c-a3fa-4693-9463-5ce7e59ec9e1>
CC-MAIN-2023-14
https://carolinacatholicprofessionals.com/resources/Documents/SaintJohnCemetery.pdf
2023-03-27T01:41:04+00:00
crawl-data/CC-MAIN-2023-14/segments/1679296946584.94/warc/CC-MAIN-20230326235016-20230327025016-00333.warc.gz
204,396,962
1,244
eng_Latn
eng_Latn
0.992926
eng_Latn
0.996468
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1323, 2728, 4060, 5045, 5998 ]
[ 2.484375 ]
1
1
Summer 2023 Week One Class Descriptions Alice's Tea Pots- Don't be late for a very important date in our clay studio! Create a Wonderland inspired tea pot in terra cotta clay, using coil methods and hand building. Pieces will be bisque and glaze fired. Art Around the World- Capture the beauty of beaches or the peaks of mountains as we take a virtual art tour of vacation spots around the world. Brightly colored beach balls, or downhill ski slopes may appear in our art getaway drawings and paintings! Aboriginal Art from Australia, Mosaics from Mexico and more! A variety of painting and mixed media will be used. Birds of a Feather- Let's draw and paint some of our bird brained friends! Birds come in a variety of colors and styles and can do more than fly - they are truly entertaining and can be quite humorous! Young artists will learn to handle a variety of fine art media, such as oil pastels, watercolor, tempera and more, as they create delightful bird artwork! Carnival of Animals: A magical menagerie of drawings and paintings will be created as we embellish our animal friends to be on parade in your home. Charlie Harper Animals- Colorful, geometric shapes create awesome animals in this Charlie Parker inspired class. Using paint and mixed media, we will create colorful animals in their lovely landscapes. Clay Animal Pals: Let's make pinch pot animal pals! This is an introductory clay class where the youngest beginning sculptor can learn the basics of sculpting while creating fun animals in clay. Terra cotta clay, kiln fired, and colorful paints will be used. All materials included. Creative Collage- Mixed media at its best! Using colorful paper and paint, create texture and depth to your design. Make your own colorful paper to use in your design, or cut paper from newspapers and magazines. The sky is the limit! Floral Frenzy- Let's draw and paint nature's beauties-flowers Jungle Art: Dare to enter the jungle and discover the fun and fantastic effects of experimenting with and mixing different media. We may try mixing media such as: watercolor, ink, acrylic, pastels, or even creating with unusual materials! Create stunning artwork while learning about drawing, color and composition. Marvelous Monsters in Clay: Create your own unique monsters that are scary, funny, or cute. Design your monster with five eyes, a tail, or horns. Whatever you can imagine, you can build! Don't be afraid to create something cute or creepy in our clay studio. Marvelous Clay monsters will come to life in terra cotta clay. Clay Sculptures will be kiln fired. Painting on Glass- Using a reverse method of painting the details first, artists will learn how to transform an image onto glass using acrylic paint. Red Fish, Blue Fish- Explore real life tropical marine life from tide pools to coral reefs and the open ocean beyond and also enjoy animated fish like Dr. Seuss's classic, "One Fish, Two Fish". Drawing and painting and mixed media projects. Sculpey Clay- Use air dry clay to create beautiful and functional pieces. Earrings, bowls, keychains and more! Shields and Armor- Knights, castles, bridges and more await in this drawing and painting class. Learn techniques to bring your medieval artwork to life. Tapestry for Teens- Using a small table loom, create a beautiful wall hanging. Various colors and textures of yarn, thread and fabric weave together to create a one-of-a-kind work of art. Experiment with the patterns and textures to create your own masterpiece!
<urn:uuid:672cc0ee-fc78-40d7-b154-cc3fb76aa5f5>
CC-MAIN-2023-14
https://www.kaleidoscopeart.org/_files/ugd/c5e1fd_c4da084a05234a548e826130712ae401.pdf
2023-03-27T00:57:12+00:00
crawl-data/CC-MAIN-2023-14/segments/1679296946584.94/warc/CC-MAIN-20230326235016-20230327025016-00332.warc.gz
913,393,712
748
eng_Latn
eng_Latn
0.997894
eng_Latn
0.998263
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 2591, 3516 ]
[ 2.59375 ]
1
0
Great scat! Bears—not birds—are the chief seed dispersers in Alaska January 16 2018 A black bear eats devil's club berries in southeastern Alaska. Credit: Taal Levi, Oregon State University. 1/4 It's a story of bears, birds and berries. In southeastern Alaska, brown and black bears are plentiful because of salmon. Their abundance also means they are the primary seed dispersers of berry-producing shrubs, according to an Oregon State University study. The OSU team used motion-triggered cameras to record bears, birds and small mammals eating red berries of devil's club, and retrieved DNA in saliva left on berry stalks to identify the species and sex of the bears. Researchers found that bears, while foraging, can disperse through their scat about 200,000 devil's club seeds per square kilometer per hour. Rodents then scatter and hoard those seeds, much like squirrels hoard acorns. The study was published today in the journal Ecosphere. In most ecosystems, birds generally are thought of as chief dispersers of seeds in berries, said Taal Levi, an ecologist in OSU's College of Agricultural Sciences and co-author on the study. The researchers found that birds accounted for only a small fraction of seed dispersal. This is the first instance of a temperate plant being primarily dispersed by mammals through their gut, and suggests that bears may influence plant composition in the Pacific Northwest. It was well-known that bears were dispersing seeds through their scat, Levi said, but it was not known that they were dispersing more seeds than birds, or the relative contribution of brown and black bears to seed dispersal, or whether the two species bears were eating berries at different times of the year. "Devil's club is extremely abundant in northern southeast Alaska, so it 2/4 didn't seem plausible that birds were dispersing all this fruit," Levi said. "Bears are essentially like farmers. By planting seeds everywhere, they promote a vegetation community that feeds them." The researchers found that in the study area along the Chilkat and Klehini rivers in southeastern Alaska, brown bears dispersed the most seeds, particularly before salmon became widely available. They also found that after the brown bears switched from eating berries to salmon later in the season, black bears moved in and took over the role as principal seed dispersers. Black bears are subordinate to brown bears and avoid them. The fruit on a devil's club stalk is clustered into a cone containing berries. The researchers observed through the camera recordings that brown bears can swallow an estimated 350 to 400 berries in a single mouthful. Birds, on the other hand, consumed on average 76 berries per plant that they visited. "That's pretty remarkable," Levi said. "When birds visit these shrubs, they take a few berries and fly off. They don't eradicate the cones like a bear." Laurie Harrer, Levi's co-author, swabbed devil's club to retrieve environmental DNA from residual saliva left by animals and birds that ate the berries. Harrer, a master's student in OSU's Department of Fisheries and Wildlife, analyzed the samples to determine that female brown bears ate more berries than male brown bears, female black bears ate more than male black bears and brown bears ate more than black bears. Brown bears, also known as grizzlies, are extinct in Oregon and California and are nearly extinct in Washington. 3/4 Powered by TCPDF (www.tcpdf.org) "The indirect effect of salmon is that they support abundant bear populations that then disperse a lot of fruit," Levi said. "We've lost the salmon-bear ecosystem that once dominated the Pacific Coast. That has implications for the plant community. These seed dispersal pathways through brown bears are all but eliminated. The degree to which black bears can fulfill that role is not clear." More information: The primacy of bears as seed dispersers in salmonbearing ecosystems, Ecosphere (2018). DOI: 10.1002/ecs2.2076 , onlinelibrary.wiley.com/wol1/d … .1002/ecs2.2076/full Provided by Oregon State University Citation: Great scat! Bears—not birds—are the chief seed dispersers in Alaska (2018, January 16) retrieved 26 March 2023 from https://phys.org/news/2018-01-great-scat-bearsnot-birdsarechief.html This document is subject to copyright. Apart from any fair dealing for the purpose of private study or research, no part may be reproduced without the written permission. The content is provided for information purposes only. 4/4
<urn:uuid:d4422d07-0912-4016-bb22-6e150dcfbbb5>
CC-MAIN-2023-14
https://phys.org/news/2018-01-great-scat-bearsnot-birdsare-chief.pdf
2023-03-27T00:34:26+00:00
crawl-data/CC-MAIN-2023-14/segments/1679296946584.94/warc/CC-MAIN-20230326235016-20230327025016-00334.warc.gz
544,319,294
960
eng_Latn
eng_Latn
0.992968
eng_Latn
0.99814
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 197, 1807, 3435, 4512 ]
[ 2.5 ]
1
0
HOW TO HOLD A DACHSHUND PROPERLY Holding a Dachshund Safely 1. Place one hand under the chest. Picking up a dachshund is different than the way you'd pick up other breeds, but it's not especially hard once you learn the right method. Start by slipping a hand under the dog's upper body to support his chest and ribcage. Don't lift up yet. Spread your fingers out so that you support as much of the dog's upper body as possible. The wider the area you can spread his weight over, the gentler it will be on his spine. 2. Place your other hand under the dog's rump. Gently slip your free hand under the dog's rump — either directly behind it or just in front of the dog's rear legs to support its lower body. Get ready to lift up. Here, again, it is best to spread your hand to give the widest base of support possible. 3. Slowly lift the dachshund, keeping its body level. Now, simply lift the dog up. As you go, try to keep the dog's lower body from hanging or drooping beneath its lower body. A little bending is fine, but you'll want to keep the dog's back as flat as possible to keep from putting stress on it. 4. Continue to support the dog's back as you hold it. As you move around or play with your dachshund, make sure its lower back is well-supported at all times. Dachshunds aren't like other dogs — letting their lower bodies dangle is uncomfortable to them and can contribute to painful back problems (like slipped and ruptured discs) over time. Luckily, with a little practice, this should become second nature after a while. Eventually, it will feel "wrong" to pick the dachshund up in the incorrect way. 5. Transition to a "cradle" hold if you wish. As long as the dachshund's back is well-supported and its body is fairly straight, it doesn't really matter how you choose to hold it. If you'd like the convenience of being able to hold your dachshund with one arm, try shifting to this alternate hold once you've picked it up correctly by following the steps above: * Gently shift the dog's weight so that it comes to rest on the forearm of the arm that you were using to support its rump. Use your full forearm to support its weight. * Tuck the dog against your body for added support and comfort. This should feel a little like how you would cradle a baby or hold a football. Use your free arm when needed to help the dog balance and keep it from squirming or wriggling free. 6. To set the dachshund down, slowly lower it to the floor. If you've had experience with other dog breeds, you may be used to "dropping" or gently heaving them back to the ground when you're done holding them. With dachshunds, instead, you'll want to lower the dog all the way to the ground before letting go. As always, keep its back well-supported as you lower it down. Ideally, you'll want its feet to be touching the ground before you let go. As you'll read below, even a drop of a few inches can put stress on the dachshund's back and joints. 7. Never drop the dachshund back onto the ground. As noted above, dogs should be set down gently, not dropped. A dachshund's legs are very short compared to other dog breeds'. This means that they can't bend very far to absorb the shock of hitting the ground, which puts most of the impact stress on the leg joints and back. Getting rid of the dog's "fall" eliminates this danger. Don't trust your dog's body language here. Dachshunds don't know that their skeleton can't support falls, so they may be perfectly willing to jump out of your hands. Even if this doesn't cause them immediate pain, it can lead to painful problems if continued in the long term. 8. Show family and friends how to hold dachshunds properly before letting them play. Nothing's more frustrating than when you take the time to learn how to hold your dachshund properly, only for well-meaning relatives to come over and treat it like an ordinary dog. To avoid problems, be sure to educate any visitors about the proper ways to hold your dog before they play with it. This is especially true for children, who can sometimes be too rough with dogs on accident. It's a wise idea to supervise children when they first interact with your dachshund until you're confident that they know how to play safely.
<urn:uuid:4e81bcdc-8caa-43bc-9431-e58620c29b96>
CC-MAIN-2024-33
https://www.baldoxies.com/_files/ugd/7dcc06_f79c09726db844a3bd02262af55e26fb.pdf
2024-08-07T11:37:57+00:00
crawl-data/CC-MAIN-2024-33/segments/1722640694449.36/warc/CC-MAIN-20240807111957-20240807141957-00479.warc.gz
521,761,726
986
eng_Latn
eng_Latn
0.998623
eng_Latn
0.999049
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 518, 821, 2297, 2398, 2948, 3608, 4225 ]
[ 3.875 ]
1
0
Some habitable exoplanets could experience wildly unpredictable climates March 12 2015, by Peter Kelley A "chaotic Earth" could exist in a planetary system in which a neighboring planet has "year" that is an integer multiple of another planet's "year," and if the orbital planes are not aligned. The affected planet's orbit can become very elongated and even flip all the way over, such that the two planets are revolving in opposite senses. These planets would have unpredictable climates, perhaps becoming inhospitable for millions of year at a time. Here, the potentially habitable planet is perturbed by a Neptune-mass planet on a three-year orbit and has an elongated orbit, which would make it relatively hot. As such it is mostly dry, but some seas remain, including one which contains the stellar glint, a feature astronomers will look for as it reveals the presence of surface liquids. Credit: Rory Barnes 1/4 As telescopes of ever-greater power scan the cosmos looking for life, knowing where to look—and where not to waste time looking—will be of great value. New research by University of Washington astronomer Rory Barnes and co-authors describes possible planetary systems where a gravitational nudge from one planet with just the right orbital configuration and tilt could have a mild to devastating effect on the orbit and climate of another, possibly habitable world. Their findings have been accepted for publication in the Astrophysical Journal. The magnitude of the chaos can range widely, Barnes said, from planets whose orbits remain largely circular to those "whose orbits get so elongated that a planet could slam into its host star—an extreme form of climate change!" Even if the effect isn't that dramatic, the orbit—thus the climate, as orbit is a primary driver of climate—could still be severe enough to inhibit life, or sterilize the planet if life has already begun, Barnes said. The particular effect they studied is called a "mean motion resonance" and it comes into play when two planets' orbital periods are an integer ratio of each other, such as Neptune orbiting the sun three times for every time Pluto orbits twice. A repetitive force, like a gravitational nudge, happens at the same place in the planets' orbits around the star, the effect of which grows slowly over millions of years. This can happen to a planet in its star's habitable zone, the swath of space around it that's just right to allow an orbiting rocky planet to have water in liquid form on its surface, thus giving life a chance. Barnes calls such worlds "chaotic Earths" and suggests making them lower priorities 2/4 in the search for life. Another condition for this orbital bullying is "mutual inclination," meaning that the two planets are angled toward each other in space. Planets in our solar system all lie along the same plane in space, and are called coplanar, but not all planetary systems are like that. So Barnes and colleagues decided to "kick up" inclinations between planets in computer models and study the result. "That was the basic idea," he said. "What happens when you have planets that are in this resonance and with mutual inclinations? "And what we found was that things go all haywire. Those little perturbations that keep happening at the same point cause one of the orbits to do some crazy things—even flip over entirely—and then kind of come back to where it was before. It was pretty unexpected for us." If the fluctuations are small, such worlds might yet retain their chance of life and be worth further study. But if they are dramatic, astronomers should probably look elsewhere. "Planets in systems that drive orbits to near-misses with the host stars are less promising targets and should be skipped over for other candidates," Barnes said, "even if they are found today on circular orbits in the habitable zone." Further computer modeling will help researchers distinguish between these two possibilities, he said. Powerful tools such as the James Webb Space Telescope will come online in a few years, able to determine the atmospheres of exoplanets, or those outside the solar system. But the work will be expensive, so astronomers will need to choose their objects of study wisely, Barnes 3/4 Powered by TCPDF (www.tcpdf.org) said. More information: "Long-lived Chaotic Orbital Evolution of Exoplanets in Mean Motion Resonances with Mutual Inclinations." arxiv.org/abs/1501.03231 Provided by University of Washington Citation: Some habitable exoplanets could experience wildly unpredictable climates (2015, March 12) retrieved 26 March 2023 from https://phys.org/news/2015-03-habitable-exoplanetswildly-unpredictable-climates.html This document is subject to copyright. Apart from any fair dealing for the purpose of private study or research, no part may be reproduced without the written permission. The content is provided for information purposes only. 4/4
<urn:uuid:ff1f7a31-f886-4375-8a05-109e042a04f4>
CC-MAIN-2023-14
https://phys.org/news/2015-03-habitable-exoplanets-wildly-unpredictable-climates.pdf
2023-03-27T00:39:25+00:00
crawl-data/CC-MAIN-2023-14/segments/1679296946584.94/warc/CC-MAIN-20230326235016-20230327025016-00336.warc.gz
510,105,038
1,018
eng_Latn
eng_Latn
0.99521
eng_Latn
0.999168
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 921, 2635, 4257, 4932 ]
[ 2.71875 ]
1
0
Soil Safari NGSS Objectives: MS-LS2-1: Analyze and interpret data to provide evidence for the effects of resource availability on organisms and populations of organisms in an ecosystem. MS-LS2-4: Construct an argument supported by empirical evidence that changes to physical or biological components of an ecosystem affect populations. MS-LS2-5: Evaluate competing design solutions for maintaining biodiversity and ecosystem services. MS-ESS3-3: Apply scientific principles to design a method for monitoring and minimizing a human impact on the environment. Learning Goals: Students will understand: * The impact of erosion on topsoil and strategies to reduce it. * What soil is and how it helps plants to grow. * How use of chemicals and nutrient supplements affect biotic and abiotic soil factors. * The care and consideration needed when tending to plants. * What monoculture and polyculture mean for biodiversity and ecosystem services. Students will learn how to: * Differentiate different soil types. * Be aware of their surroundings. * Engage in hands-on tasks like weeding and clearing land, applying mulch and compost, seeding ground cover, and preparing beds for dormancy and replanting. Materials: * Clipboards and Pencils * Buckets of Soil Types * Soil Identification Keys *Markers * Sugar Cubes * Gravel * Safari Guidebooks * Laminated Venn Diagrams and Dry-Erase * 2-Liter Erosion Demo Bottles * Dropper Bottles with Red-Dyed Vinegar * Water * Shovels, Digging Forks, and Rakes (seasonal activity) * Buckets, Mulch, and Compost (seasonal activity) * Eager Hands! (And gardening gloves for those hands) Class Set-up: * Make sure that you have enough materials (worksheets, pencils, buckets, etc.) for all the participating students, enough space and materials to engage with the soil types activity and the erosion demos. Make sure the soil flowcharts and the venn diagram sheets are ready, clean, and available. If seasonally activities will be taking place, make sure there are enough shovels, rakes, hand trowels, and gloves available. Safety Precautions: * Tell students that they should be told from the beginning that they need to stay on the trails between the crops, and that they can't leave a designated area (pavilion, hoophouse) unless they're told that it's okay. * Students shouldn't be allowed to wander around the farm during activities, as this could endanger the plants that live there. * Further ground rules include reading the posted signs around the farm, refraining from entering the hoophouse until asked to, and wear gardening gloves while handling certain materials. Introduction (5 minutes) Students are toured around the farm, shown the different varieties of plants that are being grown there as well as various locations of significance, like the hoophouse. Soil safari guidebooks will be handed out. Soil Field Tests ( 15 minutes) Broken into teams, students will be given three minutes at each soil type station. The facilitator will show kids the proper way to perform the soil "feel test", which involves taking soil with a little bit of water and feeling it between your fingers. There will be 4 buckets: sand, clay, sand + clay, and sandy loam. Each group will have 3 minutes in front of each bucket, and using laminated flow charts (which will help them test out and identify the soil types), teams will take time to identify the soil in their bucket and rotate. They will take soil medium from one of the soil buckets, and "test" it in the smaller buckets in front so we can put them back together at the end. There will be a space on the Soil Safari Guidebook for them to note what they identified each bucket as. At the end of the activity, groups share what they identified and compare their results. After this, the facilitator will reveal the actual soil types for each bucket. Feeding Our Soil Right: ( 10 minutes) This fertility exercise is a guess & match answer game. Groups will be given a laminated venn diagram, and a list of bullet point facts. Together, students decide which facts go in which part of the diagram--do they apply to organic fertilizer, inorganic fertilizer, or both? Afterwards, we will go over the answers as a group with the facilitator revealing where each fact belongs on the diagram. As we go, students will fill in the correct answers on the venn diagram in their Soil Safari guides. Erosion: (20 minutes) Students are asked what they know about erosion. After they answer, affirm or clarify that erosion is when the nutrient-rich topsoil is depleted by wind, water, or artificial means (i.e. cars). Tell everyone that they're no longer the students that arrived at the farm mere minutes ago; they're elite soil scientists, or pedo logists, hired to think of ways to prevent erosion in a new organic farm. Armed with their knowledge about erosion, they have three minutes to get in their groups and brainstorm a list of ways to prevent erosion. Afterward, they'll share their thoughts with the other teams of pedologists in attendance. Each group will be given a blank piece of paper, and will use their pencils and clipboards to draft a list of ideas. After three minutes, the facilitator will call everyone back to a central area and ask each group to share out their ideas. Following a group sharing, at least one person from each group (somebody different every time) will say something that they appreciated about the group's ideas. During this time, students will be encouraged to jot down interesting ideas in their guidebooks that they hear voiced by all groups. Physical erosion: * Once all groups have shared, the facilitator will show them the five erosion demo bottles. These are two-liter bottles cut in half and filled with different soil media. They represent the following five types of erosion prevention (or lack thereof): cover crop, mulch, tilled soil, untilled soil, and matting. * Students will be given a minute in their groups to predict which of the setups will have the highest amount of soil erosion, and which will have the lowest amount. Then, the facilitator will run all five demos and have students voice their observations following each one. * Following the demos, a final question will be asked: in what ways are these real-life erosion prevention techniques similar to those that your groups thought of earlier? Chemical erosion: * Similar to the two-liter bottle erosion example, the facilitator will give each group a small clear container, which has gravel inside. On top the gravel are sugar cubes. Each group will be given a dropper filled with red dyed vinegar. * The facilitator will give instructions to each group in order to demonstrate chemical erosion. Each student in the group will take a turn dropping 10 drops of vinegar onto the cubes. * As the sugar cubes disintegrate, the groups will discuss what they see happening. As the vinegar seeps through the gravel and starts to run off, the facilitator will discuss with the students how this activity is symbolic of chemical erosion, and the damage that herbicides cause to the soil. * The facilitator will discuss how chemical burn occurs to roots, and the runoff of the chemical application enters into rivers and streams, and deeper into the soil which eventually enter into our drinking water. Monoculture/Polyculture Drawing: ( 10 minutes) There is a space on the soil safari guidebook with two boxes, and three bullet points corresponding to each box. The first box asks students to sketch out what they think a farm looks like. The second asks students to sketch out what they think a farm should ​ look like, to benefit soil health. For each, they need to bullet point what that style of farming does to the soil. The initial sketch will happen before anything is revealed, and most students will probably sketch out a monoculture. Then, students share out and compare/contrast their drawings. Six laminated copies of the monoculture vs. polyculture table are passed out and the facilitator talks the class through the differences between monoculture and polyculture. Then, students sketch out what a farm should look like and bullet out three things for each type of farming from the table. Every season whatever the reason (dependent upon timing/season): Every season whatever the reason is a seasonally appropriate additional activity to fit in depending on the state of the farm… In the fall, a plot of land will be weeded and cleared, and mulch or compost will be applied for the winter time. In the spring, compost or mulch will be applied to a plot of land, or ground cover will be seeded. Additionally, students will have the opportunity to prepare beds for planting in the springtime. This involves digging and raking of beds, and/or planting of spring crops. This hands on activity will only be available if the farm in the right space seasonally and programmatically, and if the right age group is present. The facilitator will discuss with the farmer in advance whether or not any of these activities are possible. * In the event that this activity is available, the erosion activity will be taken out, and substituted for the seasonal activity. This will also take 20 minutes, and points of learning can be applied to the Soil Safari Guide. Conclusion: (5 minutes) * What are some of the things we need to keep in mind when caring for our soil? * What are some things soil needs in order to be healthy and support plant growth? * How does treating soil well help us in the long run? * What information did you learn during our soil safari that would help you to grow plants at home? * What is one new thing you know about keeping soil healthy that you didn't know before * Did you have fun? Class Tear-Down: (5 minutes) * All soil buckets should be organized, and placed in their original spaces. * Have participants bring all laminated sheets and dry erase markers to the facilitator. * Tinfoil pans and erosion activity materials should be brought to the facilitator. * Kids are encouraged to keep their Soil Safari guides, but if they don't want them they can recycle them. * If the seasonal activity applies, all tools should be put back in their resting place.
<urn:uuid:5e2334cd-1464-4442-98f8-f1e45b4525c0>
CC-MAIN-2023-14
https://tamarackadventure.com/wp-content/uploads/2020/02/Soil-Safari-Final-1.pdf
2023-03-27T01:39:03+00:00
crawl-data/CC-MAIN-2023-14/segments/1679296946584.94/warc/CC-MAIN-20230326235016-20230327025016-00338.warc.gz
651,158,250
2,141
eng_Latn
eng_Latn
0.992787
eng_Latn
0.998499
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1459, 3854, 6188, 8435, 10213 ]
[ 5 ]
4
1
Organizing for Student Success What follows is an overview of the tools and strategies in California Coastal Voices. "Part A" is applicable to all six Projects, both Teacher-Guided and Student-Driven. It includes a description of tools, suggested classroom strategies, two methods of assessment, and a chart showing student and teacher roles over the course of a project. "Part B" provides additional guidance specifically for Student-Driven Projects. Part A: Teacher-Guided and Student-Driven Projects Tools * The Daily Phenomenon is a warm up for use in the first minutes of class. This tool, which is built into the Teacher-Guided Projects, focuses on crosscutting concepts and constructing arguments from evidence. Student-Driven Projects also benefit from implementing this routine. The Daily Phenomenon is the "engage" step of the 5E cycle for a single class session and is often an image (downloadable from the Coastal Voices Website at www.coastal.ca.gov/coastalvoices) for students to analyze independently in their notebooks. * Making Sense of Images and the Guiding Questions for Image Analysis support student acquisition of the crosscutting concepts, geographic familiarity with the coast, and ability to construct arguments from evidence. Both are available in the Readings and Resources section of California Coastal Voices. * Thematic Slideshows featuring the California coast are available as downloads from the Coastal Voices Website and are used in some of the Teacher-Guided activities as well as for the Daily Phenomena. * Go Deep sidebars are opportunities to delve further into significant topics via additional labs, diagrams, readings, or complementary curriculum from partners such as NOAA, Lawrence Hall of Science, and NASA. Key Instructional Strategies Prep for "Just in Time" Personalized Instruction before the project begins. Teachers should spend time with the technical issues addressed in the project, background readings, and NGSS performance expectations to ensure that content knowledge can be deployed as needed. Group Management Contracts are a critical component of managing projectbased learning. Should time allow, guide students through the process of creating group agreements. There are many examples online, ranging from simple to complex. You will find a sample Group Management Contract in the Readings and Resources section. Group Roles help ensure accountability and smooth work flow within student teams. Additionally, they encourage teenagers to try on various professional roles. The following suggested roles are referenced within Student-Driven Projects and may be assigned for Teacher-Guided Projects as well: 3 1. Principal Investigator: The project leader partners with the teacher to advance the project. Specific responsibilities include attending mini-lessons (research strategies, time management, prioritization) given by the teacher, teaching those same concepts/skills to their team, and relaying logistical information to the team. 2. Scientist: In partnership with the teacher, the scientist leads the team in science thinking, attends mini-lessons and labs led by the teacher, and focuses on explaining the natural world using evidence, conceptual models, and reasoning. 3. Engineer: Students in this role define problems and potential engineering solutions. They make choices about solutions based on the best available science, relevant government policies, and availability of resources. They attend engineering briefings as assigned by the teacher and lead designing, building, and testing any material objects the team decides to construct. 4. Policy Analyst: This role requires keeping one foot in environmental science and the other in government policy and benefits from an ability to think and reason following legal frameworks. This person attends policy briefings offered by the teacher and conveys concepts to the team. Get Outside: Leaving the classroom to interact with the community is even better than bringing professionals into the classroom. The enhanced learning experience is worth the effort of coordinating with other teachers, scheduling transportation, and filling out paperwork. Most of the projects in California Coastal Voices can be done without leaving the classroom (or easily altered to that end); however, all are improved by engaging learners with the world beyond the school. Facilitating a field experience may mean partnering with afterschool organizations, local non-profits, and parents. Student Assessment Routines 16 Habits of Mind goals: Self-Assessment with Rubrics Assessment is designed to support students as they learn to manage their own learning, thinking processes, and formative interactions with adults. A key goal is helping students visualize and cultivate desirable Habits of Mind as articulated by Costa and Kallick, especially creative questioning, persisting to completion, and listening with empathy and understanding. How do you make a Habit of Mind visible, learnable, and measurable for students? One answer is to clearly frame a goal referencing a specific Habit of Mind, develop observable indicators with your students, and consistently focus upon those indicators during formative and summative evaluations. Rubrics are a way to frame and assess these goals. Four rubrics to be used with every project are included in the * Persisting * Listening with understanding and empathy * Managing impulsivity * Thinking flexibly * Striving for accuracy * Thinking about thinking (metacognition) * Questioning and posing problems * Thinking and communicating with clarity and precision * Applying past knowledge to new situations * Gathering data through all senses * Responding with wonderment and awe * Creating, imagining, innovating * Taking responsible risks * Thinking interdependently * Finding humor * Remaining open to continuous learning Arthur L. Costa and Bena Kallick, 2000 Readings and Resources section of California Coastal Voices. Designed by the Buck Institute for Education, these rubrics cover critical thinking, creativity and innovation, collaboration, and presentation skills. Two additional rubrics are also available for the evaluation of scientific writing in formal papers, student journals, and exit tickets. Assessment with Science Notebooks Notebooks can help document changes in student thinking and can be a place to build out conceptual models or otherwise make thinking visual. The California Science Framework and the California English Language Arts/English Language Development Framework support science notebooks as a tool to differentiate learning and support student thinking and reflective self-evaluation. Throughout the Projects, students are encouraged to use their notebook for Daily Phenomenon analysis, developing and revising models, and individual reflection on daily Guiding Questions, as well as to keep track of their group project work. Standards Connections Teacher-Guided Projects articulate state education standards within the activity instructions and in a detailed table following each unit. In Student-Driven Projects, learning goals connecting to standards are co-authored with students and included in personal learning plans. 5 Visualizing the Classroom What are the students and the teacher each doing during the different stages of the 5E cycle in California Coastal Voices Projects? The following chart (modified from Bybee, San Diego County Office of Education, and J. Spiegel) offers an overview of both the routine of a single class session as well as the arc of an entire project. Part B: More Guidance for Student-Driven Projects Effective management of learning experiences and careful implementation of classroom routines are the foundation of the Student-Driven Projects. Links to additional resources for teaching using the project-based learning model can be found on the Coastal Voices Website at www.coastal.ca.gov/coastalvoices, but three recommended actions for teachers are briefly explored here: * Initiate a culture of inquiry emphasizing creative questioning, continuous improvement, and student leadership. * Design and execute project entry events and other invigorating, shared learning experiences. * Deploy process management tools: process guides, learning rubrics, contracts, checklists, project roles, and discussion protocols to scaffold learning. Create a Culture of Inquiry Project-based learning classrooms are like road trips in that the quality of the experience depends on who steers, controls the speed of movement, and chooses the destination, with the goal that burdens are shared, questions are raised and answers are sought jointly, and accomplishments and failures are regarded as equal opportunities to learn. Consider reserving a regular period for class activities that support desirable Habits of Mind such as student independence, an inclination to question, attention to quality, personal growth mindset, and team spirit. Visit the Coastal Voices Website for suggestions. Launching Projects with a Powerful Entry Event Effective projects are launched by great entry events, encouraging sustained activity driven by personal interest and the desire to understand. They must be exciting for students, convey the teacher's enthusiastic commitment to the subject, and raise questions that need to be answered. It is these questions that guide the project forward to success. In Student-Driven Projects you are encouraged to start with a high quality speaker with direct experience of the challenging question. If this is not possible, good alternatives include videos or online meetings such as those facilitated by the PORTS program of California State Parks. Process Management Tools included in the Student-Driven Projects I. Teacher Guides include preparation tasks specific to the Project and may provide background reading for teachers along with weekly questions. To encourage strategic questioning by students, an option is to have one student from each group investigate a question in the Teacher Guide and report out to the group. Another strategy is to support the students in finding their own way to these questions. Individual or small group guidance should be provided as needed to ensure that significant facts, concepts, and principles are understood. II. Teacher Checklist for Student-Driven Projects is found in the Readings and Resources section and guides the teacher in their responsibilities from a Project's start to finish. 7 III. Student Readings in the Student-Driven Projects orient students to the tasks inherent to each phase of the Project and provide a tool for accomplishing the task. The readings align to the following sequence (a version of the 5E instructional cycle): 1. Invitation to Engage: This first reading states the challenging problem introduced during the engaging entry event, helps students understand why the Project is important, and helps them determine with whom they will share the work. The Student Checklist points the way forward and should be handed out soon after the Invitation to Engage. 2. Explore Questions: Asking the Right Questions, found in the Readings and Resources section, provides structure and a question formation tool for students as they ask need-to-know questions related to the challenging problem. Teachers use the Teacher Guide to support student efforts to ask significant questions, direct students towards Next Generation Science Standards disciplinary core ideas and performance expectations, and help students find trustworthy sources. 3. Explore and Explain Arguments with the Claims, Evidence, and Reasoning Guide, found in the Readings and Resources section. This tool makes student thinking visible as it provides a template for developing evidence-based arguments. Teachers provide guidance and instruction to groups and support students' self-assessment efforts during this time. Students use the claims, evidence, and reasoning tool to construct arguments from evidence. 4. Extend (Elaborate) into Application: These readings, which are specific to each Project, give guidance on performing the concept-reinforcing, out-ofclassroom activity (leading a field experience, joining a volunteer restoration project, or informational interviewing) that is designed into the Student-Driven Projects. Teachers support students with direct instruction and assist in making connections with organizations and individuals as needed. If necessary, Projects can be altered to remove the out-of-class component. 5. Evaluating, Communicating, and Reflecting: Part inspiration, part instruction, Tips for Effective Communication in Public Settings and Students Taking Action (both found in the Readings and Resources section), guide students as they publicly present the group's learning product. This may be handed out as early as week three when students begin practicing their presentations. Teachers help students self-evaluate, provide peer feedback, and facilitate reflection. IV. Personalized Learning Plans, co-authored between the teacher and each student, are key to a Student-Driven Project. Your objective is to: * Include the student's interests. * Link to significant performance expectations (NGSS/CC), essential content knowledge, and local environmental issues. * Create a foundation for reflective self-assessment, personalized teacher feedback, and parent reporting. One strategy for launching the development of Personalized Learning Plans is to start with a whole group discussion about goal setting by considering the Challenging Question, required learning products, and the rubrics. Do this after the engaging event—if possible the same day. Frame the conversation around desirable Habits of Mind such as persisting to completion or communicating with clarity and precision. The SMART (Specific, Measurable, Achievable, Relevant, Timely) goals format is a tool that can be used for creating personalized learning goals. There are many variations on this goal-setting prompt. A suggested Student's Guide to Personalized Learning Plans can be found in the Readings and Resources section. 9
<urn:uuid:b85c0451-9b8e-4b21-be8f-3aa6978e32c8>
CC-MAIN-2024-33
https://www.coastal.ca.gov/coastalvoices/OrganizingForStudentSuccess.pdf
2024-08-07T12:12:58+00:00
crawl-data/CC-MAIN-2024-33/segments/1722640694449.36/warc/CC-MAIN-20240807111957-20240807141957-00479.warc.gz
558,519,285
2,573
eng_Latn
eng_Latn
0.996551
eng_Latn
0.997145
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 2678, 5931, 7242, 7604, 10522, 13683, 14164 ]
[ 3.6875 ]
2
0
Holy Trinity C of E Primary School A church school community aspiring for all to live life to the full Anti-Bullying Policy Issued March 2022 Next Review October 2024 Committee Full Governors ANTI-BULLYING POLICY This policy is based on DfE guidance "Preventing and Tackling Bullying. Advice for Headteachers, staff and governing bodies", July 2017. This policy also uses guidance provided in Keeping Children Safe in Education (2022). This document is linked to the Behaviour Policy and is part of the school's suite of Safeguarding procedures. STATEMENT OF INTENT Holy Trinity Church of England Primary School is committed to providing a happy, caring and safe environment in which children can learn in a secure and relaxed atmosphere and in which every individual feels valued and respected. The school recognises that bullying, in any of its many forms, is a seriously harmful activity that can have a devastating effect on individuals. It can create a barrier to learning and have serious consequences for mental well-being. Holy Trinity adopts an attitude of zero tolerance towards bullying.  All members of the school community will ensure that all children are strongly encouraged to report all incidents of bullying towards themselves or others. In line with the Equality Act 2010, it is essential that our school: * Eliminates unlawful discrimination, harassment, victimisation and any other conduct prohibited by the Act; * share it; and * Advance equality of opportunity between people who share a protected characteristic and people who do not * Foster good relations between people who share a protected characteristic and people who do not share it. Parents should be reassured that through the Anti-Bullying Policy, the school will respond positively and effectively to any form or degree of bullying. DEFINITION OF BULLYING Bullying is "Behaviour by an individual or a group, usually repeated over time, that intentionally hurts another individual either physically or emotionally". DfE "Preventing and Tackling Bullying", July 2017 Bullying can include: name calling, taunting, mocking, making offensive comments, kicking, hitting, taking belongings, producing offensive graffiti, gossiping, excluding people from groups and spreading hurtful and untruthful rumours. This includes the same inappropriate and harmful behaviours expressed via digital devices (cyberbullying) such as the sending of inappropriate messages by phone, text, Instant Messenger, through websites and social media sites and apps, and sending offensive or degrading images by mobile phone or via the internet. The school recognises that bullying may occur at at any time in any place. This includes child on child abuse. Rude, Mean, Bullying Any accusation or suspicion of bullying must be treated as this in the first instance. The school's approach is to recognise that bullying can happen anywhere and the school has a zero tolerance approach to such behaviour. It is important to determine what constitutes bullying and to educate our pupils and staff so they can spot the signs on bullying or behaviour which may proceed bullying. It is also important that the definitions provided below are used to determine the nature of the behaviour and are used to educate our pupils so we can ensure that choices underpinning conduct and behaviour are positive and meet the high expectations at Holy Trinity Church of England Primary School. Rude This includes singular or seperated and differing instances where an individual makes a comment or gesture which is inappropriate. This may cause offence or upset but is often not intended to be malicious. This is usually considered to be a low-level behaviour incident in the school's behaviour policy. Mean Comments or gestures which are intended to cause offence or upset. This may be targeted and may involve more than one individual. This behaviour is usually considered to be misbehaviour in the school's behaviour policy. Bullying A comprehensive definition of bullying is provided above. Bullying is classified as serious misbehaviour in the school's behaviour policy. Forms and types of bullying covered by this policy include: * Bullying related to physical appearance * Bullying of young carers, children in care or otherwise related to home circumstances * Bullying related to physical/ mental health conditions * Physical bullying * Emotional bullying * Sexual bullying * Bullying via technology (often referred to as online or cyberbullying) * Prejudicial bullying (against people/ pupils with protected characteristics) Cyber-bullying Cyberbullying is an increasingly common form of bullying behaviour which happens on social networks, games and mobile phones. Cyberbullying can include spreading rumours about someone, or posting nasty or embarrassing messages, images or videos. Children may know who is bullying them online – it may be an extension of offline peer bullying - or they may be targeted by someone using a fake or anonymous account. The school recognises that it is easy to be anonymous online and that this may increase the likelihood of engaging in bullying behaviour. Cyberbullying can happen at any time or anywhere. Cyberbullying includes, but is not limited to: * creating and sharing embarrassing images or videos * sending threatening or abusive text messages * 'trolling' - the sending of menacing or upsetting messages on social networks, chat rooms or online games * setting up hate sites or groups about a particular child or person * excluding others from online games, activities or friendship groups * encouraging someone to self-harm * creating fake accounts, hijacking or stealing online identities to embarrass a young person or cause trouble using their name * voting for or against someone in an abusive poll * sending explicit messages, also known as sharing of nudes or semi-nudes or sexting * blackmail and/ or coercive control * pressuring children into sending sexual images or engaging in sexual conversations It is important to note that cyber bullying can very easily fall into criminal behaviour under the Malicious Communications Act 1988 under section 1 which states that electronic communications which are indecent or grossly offensive, convey a threat or false information or demonstrate that there is an intention to cause distress or anxiety to the victim would be deemed to be criminal. This is also supported by the Communications Act 2003, Section 127 which states that electronic communications which are grossly offensive or indecent, obscene or menacing, or false, used again for the purpose of causing annoyance, inconvenience or needless anxiety to another could also be deemed to be criminal behaviour. If the behaviour involves the use of taking or distributing indecent images of young people under the age of 18 then this is also a criminal offence under the Sexual Offences Act 2003. Outside of the immediate support young people may require in these instances, the school has a legal obligation to share this information with the police. Equality Act Duty and Prejudice Related and discriminatory Bullying (Hate Crime) Under the Equalities Act 2010 it is against the law to discriminate against anyone because of: * age * being married or in a civil partnership * being or becoming a transsexual person * being pregnant or having a child * disability * religion, belief or lack of religion/belief * race including colour, nationality, ethnic or national origin including Gypsy Roma, Travellers * sex / gender * sexual orientation These are called 'protected characteristics'. As part of the requirement on schools to promote fundamental British values, schools must proactively challenge derogatory and discriminatory language and behaviour including that which is racist, homophobic, biphobic, transphobic and disabilist in nature. We will record these types of bullying, even that which represents a one-off incident, and report them to the local authority for monitoring purposes. Other vulnerable groups include * bullying related to appearance or health * bullying of young carers or looked after children or otherwise related to home circumstances Hate in the context of behaviour and attitude has been defined as; "Acts of violence, hostility and intimidation directed towards people because of their identity or perceived difference" (Chakraborti, Garland and Hardy 2014:6) What form might this take? * Transphobic related hate crime Any incident or offence which is perceived by the victim or any other person to be motivated by a hostility or prejudice based on a person's transgender or perceived transgender. * Race related hate crime Any incident or offence which is perceived by the victim or any other person to be motivated by a hostility or prejudice based on a person's race or perceived race – includes nationality, national origin, ethnic origin, race and colour. * Sexuality related hate crime Any incident or offence which is perceived by the victim or any other person to be motivated by a hostility or prejudice based on a person's sexual orientation or perceived sexual orientation. * Disability related hate crime Any incident or offence which is perceived by the victim or any other person to be motivated by a hostility or prejudice based on a person's disability or perceived disability. * Prejudice Related Language Words or acts based on preconceived opinion that is not based on reason or actual experience, for example, not liking someone based on their skin colour or sexual identity. * Religious related hate crime Any incident or offence which is perceived by the victim or any other person to be motivated by a hostility or prejudice based on a person's religion or perceived religion. * Age related hate crime Any incident or offence which is perceived by the victim or any other person to be motivated by a hostility or prejudice based on a person's age. Racist, homophobic, biphobic, transphobic and disabilist language includes terms of abuse used towards people because of their race/ethnicity/nationality; because they are lesbian, gay, bisexual, or transsexual, or are perceived to be, or have a parent/carer or sibling who is; because they have a learning or physical disability. Such language is generally used to refer to something or someone as inferior. This may also be used to taunt young people who are different in some way, or their friends, family members or their parents/carers. In the case of homophobic, biphobic and transphobic language particularly, dismissing it as banter is not helpful as even if these terms are not referring to a person's sexual orientation or gender identity they are using the terms to mean inferior, bad, broken or wrong. We will challenge the use of prejudice related language in our school even if it appears to be being used without any intent. Persistent use of prejudice related language and/or bullying will be dealt with as with any other form of bullying. Bullying outside school premises Headteachers have a specific statutory power to discipline pupils for poor behaviour outside of the school premises. Section 89(5) of the Education and Inspections Act 2006 gives head teachers the power to regulate pupils' conduct when they are not on school premises and are not under the lawful control or charge of a member of school staff. This can relate to any bullying incidents occurring anywhere off the school premises, such as on school or public transport, outside the local shops, or in a town or village centre. Where bullying outside school is reported to school staff, it should be investigated and acted on. The head teacher should also consider whether it is appropriate to notify the police of the action taken against a pupil. If the misbehaviour could be criminal or poses a serious threat to a member of the public, the police should always be informed. WHY IT IS IMPORTANT TO RESPOND TO BULLYING * The safety and happiness of pupils. When pupils are bullied their lives are made miserable. They may suffer injury. They may be unhappy about coming to school. Over time, they are likely to lose self-confidence and self-esteem. * The unhappiness of bullied pupils is likely to affect their concentration and learning. * If pupils observe bullying behaviour going unchallenged, other pupils may learn that bullying is a quick and effective way of getting what they want. Those pupils who are being bullied may interpret any inaction as condoning unacceptable behaviour. They will feel badly let down by those adults in authority. * Gaining a reputation as an effective, caring school. No school can claim with absolute confidence that "there is no bullying". Every school has some degree of bullying, even if only slight and infrequent. Parents know this. They will be reassured by a school which demonstrates, both through policy and action, that it deals positively and effectively with any sign of bullying. * Pupils who are bullying need to learn different ways of behaving and those who witness bullying need to learn that to observe bullying behaviour and not report it is unacceptable. IDENTIFYING SIGNS OF BULLYING A child may indicate by signs or behaviour that they are being bullied.  Adults should be aware that these are possible signs that they should investigate if a child: * is unwilling to go to school and has erratic attendance * is frightened to walk to and from school and asks to be taken or driven to school * regularly feels ill in the morning * Is unwilling to go into school or classroom * begins to show deterioration in school work * becomes withdrawn, anxious and lacking in confidence * starts stammering * stops eating * cries themselves to sleep, has nightmares or wets the bed * has unexplained bruises and/or scratches * has clothes or books damaged regularly * has possessions go missing * cries easily * asks for money or begins stealing money (to pay the bully) * is frightened to say what is wrong * attempts or threatens self-harm * becomes disruptive or aggressive * gives improbable excuses to explain any of the above These signs or behaviour could indicate other problems, but bullying should be considered a possibility and should be investigated. PREVENTING BULLYING Environment The whole school community will: * Create and support an inclusive environment which promotes a culture of mutual respect, consideration and care for others, which will be upheld by all. * Recognise that bullying can be perpetrated or experienced by any member of the community, including adults and children (peer on peer abuse). * Recognises the potential for children with SEN and disabilities to be disproportionally impacted by bullying and will implement additional pastoral support as required. * Challenge practice and language (including 'banter') which does not uphold the school values of tolerance, non-discrimination and respect towards others. * Openly discuss differences between people that could motivate bullying, such as: children with different family situations, such as looked after children or those with caring responsibilities, religion, ethnicity, disability, gender, sexuality or appearance related difference. * Be encouraged to use technology, especially mobile phones and social media, positively and responsibly. * Work with staff, the wider community and outside agencies to prevent and tackle concerns including all forms of prejudice-driven bullying. * Actively create "safe spaces" for vulnerable children and young people. * Celebrate success and achievements to promote and build a positive school ethos. Policy and Support The whole school community will: * Provide a range of approaches for pupils, staff and parents/carers to access support and report concerns. * Regularly update and evaluate our practice to consider the developments of technology and provide up-to-date advice and education to all members of the community regarding positive online behaviour. * Take appropriate, proportionate and reasonable action, in line with existing school policies, for any bullying bought to the schools' attention, which involves or effects pupils, even when they are not on school premises; for example, when using school transport or online, etc. * Implement appropriate disciplinary sanctions; the consequences of bullying will reflect the seriousness of the incident, so that others see that bullying is unacceptable. * Use a variety of techniques to resolve the issues between those who bully, and those who have been bullied. Education and Training The school community will: o Train all staff, including: teaching staff, support staff (e.g. administration staff, lunchtime support staff and site support staff) and pastoral staff, to identify all forms of bullying and take appropriate action, following the school's policy and procedures, including recording and reporting incidents. o Collaborate with other local educational settings as appropriate, and during key times of the year, for example during transition. o Consider a range of opportunities and approaches for addressing bullying throughout the curriculum and other activities, such as: through displays, assemblies, peer support, the school/student council, etc. o Ensure anti-bullying has a high profile throughout the year, reinforced through key opportunities such as anti-bullying week. o Provide systematic opportunities to develop pupils' social and emotional skills, including building their resilience and self-esteem. o The school will use specific organisations or resources for help with particular problems. Our school will draw on the experience and expertise of anti-bullying organisations with a proven track record and / or specialised expertise in dealing with certain forms of bullying. Involvement of pupils We will: * Involve pupils in policy writing and decision making, to ensure that they understand the school's approach and are clear about the part they play in preventing bullying. * Regularly canvas children and young people's views on the extent and nature of bullying. * Ensure that all pupils know how to express worries and anxieties about bullying. * Ensure that all pupils are aware of the range of sanctions which may be applied against those engaging in bullying. * Involve pupils in anti-bullying campaigns in schools and embedded messages in the wider school curriculum. * Utilise pupil voice in providing pupil led education and support * Publicise the details of internal support, as well as external helplines and websites. * Offer support to pupils who have been bullied and to those who are bullying to address the problems they have. Involvement and liaison with parents and carers We will: * Take steps to involve parents and carers to ensure they are aware that the school does not tolerate any form of bullying. * Make sure that key information about bullying (including policies and named points of contact) is available to parents/carers in a variety of formats, including via the school website * Ensure all parents/carers know who to contact if they are worried about bullying and where to access independent advice. * Work with all parents/carers and the local community to address issues beyond the school gates that give rise to bullying. * Ensure that parents work with the school to role model positive behaviour for pupils, both on and offline. * Ensure all parents/carers know about our complaints procedure and how to use it effectively, to raise concerns in an appropriate manner. PROCEDURES FOR DEALING WITH BULLYING. Supporting pupils Pupils who have been bullied will be supported by: * Reassuring the pupil and providing continuous pastoral support. * Offering an immediate opportunity to discuss the experience with their teacher, the designated safeguarding lead, or a member of staff of their choice. * Being advised to keep a record of the bullying as evidence and discuss how to respond to concerns and build resilience as appropriate. * Working towards restoring self-esteem and confidence. * Providing ongoing support; this may include: working and speaking with staff, offering formal counselling, engaging with parents and carers. * Where necessary, working with the wider community and local/national organisations to provide further or specialist advice and guidance; this could include support through Early Help or Specialist Children's Services, or support through the Children and Young People's Service (CYPS) Pupils who have perpetrated bullying will be helped by: * Discussing what happened, establishing the concern and the need to change. * Informing parents/carers to help change the attitude and behaviour of the child. * Providing appropriate education and support regarding their behaviour or actions. * If online, requesting that content be removed and reporting accounts/content to service provider. * Sanctioning, in line with school behaviour/discipline policy; this may include official warnings, detentions, removal of privileges (including online access when encountering cyberbullying concerns), and fixed-term or permanent exclusions. * Where necessary, working with the wider community and local/national organisations to provide further or specialist advice and guidance; this may include involvement from the Police or referrals to Early Help, Specialist Children's Services, or the Children and Young People's Service (CYPS). Parents whose child is being bullied: * Encourage your child to discuss with you any problems they are experiencing * Be aware of the signs that your child could be experiencing bullying * Share your concerns with the school through the class/headteacher * Don't encourage your child to hit back * Bullying is not a necessary part of growing up * Boost your child's morale.  Help them to realise that it is the bully who should feel ashamed * Inform the Headteacher of any circumstances at home which may affect your child's behaviour Parents whose child might be exhibiting bullying behaviour: * Share your concerns with the school and ask for help – this will be provided by the staff member most appropriate to work alongside both the parent/s and the child. * Remain calm – talk things over and try to discover why your child is behaving in this way.  A bully, like the victim, needs help and support HOW STAFF SHOULD RESPOND TO INCIDENTS OF BULLYING * All reports of bullying should be taken seriously and the incident dealt with immediately by the member of staff who has been approached * Offer help, advice and support to the victim * Explore the incident as fully as possible with all the parties involved and ascertain whether this was bullying or more of an example of aggressive behaviour * Involve others as appropriate. This could be the class teacher, Phase Lead or Headteacher dependent upon the seriousness of the incident and one's role within the school (eg. dinner supervisor, teaching assistant, teacher etc). If there is any doubt about the seriousness of an incident or the course of action always refer it on * Any member of staff wishing to report an incident of bullying should approach the member of staff responsible for pupil behaviour and welfare * Log all bullying incidents on CPOMS (CP online management system) * Any incident of suspected bullying must be reported to the Headteacher ACTION THAT WILL BE TAKEN BY THE SCHOOL * All concerns will be thoroughly investigated, including conducting teacher/Headteacher 'interviews' with all relevant parties * Children involved in bullying will be reminded of the school's 3 expectations (KIND/SAFE/BEST) and how their behaviour has contravened these expectations. The children will also be reminded of the system of sanctions in place to deal with such incidents * The Headteacher and / or senior staff / teachers and teaching partners may use 'restorative justice' or solution focussed techniques to solve incidents of bullying, ranging from scoring happiness on a scale of 1-10, and developing clear actions to be taken by victim, parents and school. Also, the victim may be asked to write down or articulate the facts and how these facts make them feel. This information may then be shared with the 'bully' * Appropriate sanctions will be imposed upon any child involved in bullying (in line with the school Behaviour Policy). The school will also explore the provision of additional support for any child involved in bullying (counselling, involvement of outside agencies etc) as appropriate * The parents of the victim and the child/children involved in the bullying will be informed of the details of incidents and the course of action that has been/ is being followed by the school * The school will continue to make every effort to develop a positive attitude in all children through the Personal, Social, Health and Citizenship Education (PSHCE) Policy, Circle time, Collective Worship and Class Reflection. Tolerance of others and respect for individual differences are seen as being of paramount importance in relationships with others * Any necessary and appropriate steps will be taken to avoid the recurrence of incidents of bullying. These may include alteration to school policies or procedures * Ensure a record is kept on CPOMS log. Ensure to log the incident for the victim and perpetrator. Links with other school policies and practices This Policy links with a number of other school policies, practices and action plans including: * * Child Protection and Safeguarding Behaviour * Curriculum Policies such as PSHE and computing * Complaints Policy * e-Safety (Online) and Acceptable Use Policies (AUPs) Links to legislation There are a number of pieces of legislation which set out measures and actions for schools in response to bullying as well as criminal law. These may include: * The Education and Inspection Act 2006, 2011The Equality Act 2010 * The Children Act 1989 * Protection from Harassment Act 1997 * The Malicious Communications Act 1988 * Public Order Act 1986 * The Computer Misuse Act 1990 * Keeping Children Safe in Education 2020 Responsibilities It is the responsibility of: * School Governors to take a lead role in monitoring and reviewing this policy. * The Head Teacher to communicate the policy to the school community and to ensure that disciplinary measures are applied fairly, consistently and reasonably. * Governors, the Head Teacher, Senior Leadership Team, teaching and non-teaching staff to be aware of this policy and implement it accordingly. * Staff to support and uphold the policy * Pupils to abide by the policy. * Parents/carers to support their children and work in partnership with the school The school will report on a regular basis to the governing body on incidents of bullying/hate and outcomes. The school will ensure that they regularly monitor and evaluate mechanisms to ensure that the policy is being consistently applied. Any issues identified will be incorporated into the school's action planning. Monitoring the Effectiveness of the Policy Annually (or when the need arises) the effectiveness of this policy will be reviewed by the Behaviour Lead, the Headteacher and the nominated governor and the necessary recommendations for improvement will be made to the Governors. Useful Links and supporting organisations: h ttp://www.anti-bullyingalliance.org.uk/ h ttps://www.kidscape.org.uk/ h ttp://www.childnet.com/ h ttps://www.thinkuknow.co.uk/ h ttp://www.digizen.org/ h ttp://gloshate.co.uk/ h ttps://crimestoppers-uk.org/give-information/give-information-online/ h ttp://www.stonewall.org.uk/ http://www.nspcc.org.uk APPENDIX 1 Checklist for investigating a report of bullying * Who was involved – is there or are there apparent victims(s). If so, who are they? * In what way did the victims suffer? * How did the incident start? Was it spontaneous or premeditated? * What is alleged to have happened - from the perspective of all those involved? * When did the incident take place? * Where did the incident take place? * Who witnessed the incident (pupils, parents, staff and others)? * Who reported it to whom and when? * Is there any background to this incident? * Is there any background to this incident? (a continuing trend of bullying behaviour by a particular child or children) * Why does the reporter or investigator of the incident perceive this to have been a bullying incident? * To what extent did the incident affect others? * What was the response of the victim(s) if such exist? * What was the response of any witnesses? * What does/do the victim(s) wish to see resulting from the investigation?
<urn:uuid:ee89430c-27bd-4142-913b-db3e27274582>
CC-MAIN-2023-14
https://www.holytrinity.gloucs.sch.uk/_files/ugd/b50a64_fa70428a2b0043fdb83c94ec1327c282.pdf
2023-03-27T01:19:25+00:00
crawl-data/CC-MAIN-2023-14/segments/1679296946584.94/warc/CC-MAIN-20230326235016-20230327025016-00338.warc.gz
950,017,440
5,629
eng_Latn
eng_Latn
0.996184
eng_Latn
0.997942
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 197, 2520, 4601, 7394, 9390, 12308, 14287, 16378, 18766, 21012, 23442, 26145, 27748, 28685 ]
[ 2.765625, 2.9375 ]
1
0
How to Critique Your Own Work Copyright N. M. Grigsby, WPW 1. What is the best thing in the picture? Is it an area of color? A special shape in the painting that appeals? Certain texture? Is there an area of especially good contrast? Is the area of darkest/lightest contrast your focal point? Is there a special subject/object in the painting? Literally…What is the "best thing" in the picture? 2. Is the value key working? Do you have a balance with light/mid/dark tones? 3. Is the color expressing the subject and what you want to say? 4. Can you simplify the shapes? Is the painting too busy? Is there a sense of confusion with the shapes in the painting? 5. Is there rhythm, tension and energy in the painting? Is there push-pull movement? In other words, do things come forward? Do things recede into the background? Is your eye invited or encouraged to move around the throughout the painting? Or does the eye go off the edge(s)? Is it balanced? 6. Is the painting as a whole saying what you want to say? 7. Give the work time to grow. If you're having difficulties resolving or finishing your painting, put it away for a few days…a week…a month. Let your preconceptions rest. Later, bring the painting back out and re-ask yourself the above questions. 8. Appreciate your best effort. We are our own worst critics. Don't be overly hard on yourself. Strive for your best work whenever you pick up your brushes. And recognize that you've given the painting your best. 9. Trust your instincts and yourself. No matter how long you've been painting, there's always more to learn. But as long as you continue to paint, you continue to learn. Trust what you've learned about both your skill as an artist and your SELF as an artist. 10. Take risks. Continually push yourself to learn; to try new things. The absolute worst thing that could possibly happen is that you have a foundation (paper or whatever) that you can recycle into a potential masterpiece. 11. MOST IMPORTANT OF ALL…Have fun and enjoy the journey! Anything created from your heart, soul and hand is a joy. You're creating a gift for others to see and share. Take pleasure in the process and have fun! N.M. Grigsby Studios Nancy M. Grigsby, WPW Watercolor & Acrylic/Mixed Media For information about Nancy, her artwork, classes & workshops: www.NMGrigsbyStudios.com firstname.lastname@example.org
<urn:uuid:c6955b58-3984-43d5-907b-0360a4fecc7a>
CC-MAIN-2023-14
https://www.nwws.org/wp-content/uploads/2023/02/Nancy-Grigsbys-How-to-Critique-Your-Own-Work-2-1.pdf
2023-03-27T01:38:04+00:00
crawl-data/CC-MAIN-2023-14/segments/1679296946584.94/warc/CC-MAIN-20230326235016-20230327025016-00337.warc.gz
1,007,585,559
571
eng_Latn
eng_Latn
0.999113
eng_Latn
0.999113
[ "eng_Latn" ]
false
docling
[ 2405 ]
[ 2.25 ]
1
2
Australia at a glance A growing, ageing population, increasingly born overseas. KEY POINTS: - Australia had a population of around 23.5 million people at June 2014. - Most Australians can expect to have a relatively long life—one of the highest life expectancies in the world and 25 years longer than a century ago. A baby boy born between 2011 and 2013 can expect to live to 80.1 years and a baby girl to 84.3 years. - 15% (3.5 million people) of the population were aged 65 and over and by 2054 this is projected to increase to 21% (8.4 million people). This sort of demographic change increases pressure on the welfare system in terms of age-related income support, disability support and the provision of aged care. - About 3% of the population—714,000 people—were Indigenous. The age profile of Australia's Indigenous population is considerably younger than for the nonIndigenous population: at June 2014, half of the Indigenous population was aged 22 or under (compared with aged 37 or under for the non-Indigenous population) and just 4% were aged 65 and over (compared with 15% of the non-Indigenous population). - Around 28% of the population were born overseas (6.6 million people), with the largest number (1.2 million) being born in the United Kingdom, followed by New Zealand, China, India, the Philippines and Vietnam. - Most Australians live in capital cities. At June 2014, nearly three-quarters of people lived in Major cities (71%), while 18% lived in Inner regional areas, 9% in Outer regional areas, 1.4% in Remote and 1% in Very remote areas. - While most households (68%) owned their own homes in 2011–12, either with or without a mortgage, the pattern of ownership (outright compared with mortgaged) has changed over the past decade. o The proportion of households that owned their own homes outright fell from 42% in 1994–95 to 31% in 2011–12. o The proportion of households that owned their own home with a mortgage increased from 30% in 1994–95 to 37% in 2011–12. 1 Thynne Street, Fern Hill Park, Bruce ACT 2617 • GPO Box 570, Canberra ACT 2601 • TEL 02 6244 1000 * FAX 02 6244 1299 * www.aihw.gov.au
<urn:uuid:a179bef8-7f12-48f9-89de-4790573ced47>
CC-MAIN-2023-14
https://www.aihw.gov.au/getmedia/5954019c-2947-46c0-9444-f54a35078fcf/media-AW15-1-Australia-at-a-glance.pdf.aspx
2023-03-27T01:46:37+00:00
crawl-data/CC-MAIN-2023-14/segments/1679296946584.94/warc/CC-MAIN-20230326235016-20230327025016-00338.warc.gz
743,248,527
548
eng_Latn
eng_Latn
0.997844
eng_Latn
0.997844
[ "eng_Latn" ]
false
docling
[ 2137 ]
[ 2.03125 ]
1
1
Download Ebook Chapter 14 The Digestive System And Body Metabolism Answer Key Read Pdf Free The Digestive System The Digestive System The Digestive System The Digestive System The Digestive System Your Digestive System Digestion and Nutrition The Digestive and Excretory Systems The Digestive System The Digestive System Anatomy and Physiology The Digestive System Guts: The Digestive System The Digestive System Guts Physiology and Pathophysiology of Digestion The Digestive System The Digestive System Break It Down The Digestive System Relationships Among the Brain, the Digestive System, and Eating Behavior The Digestive System The Human Body: the Digestive System The Big Slide The Digestive System The Digestive System Digestive System The Digestive System Your Digestive System The Stomach in 3D Digestive System The Mechanics of the Digestive Tract The Digestive System The Human Body: The Digestive System The Digestive System The Digestive System Learning About the Digestive and Excretory Systems Stomach Digestion The Digestive System The Digestive System Oct 29 2023 Text and illustrations explain the purpose, parts, and function of the digetive system. The Digestive System Sep 27 2023 Describes the various parts of the gastrointestinal system and how food is digested, and discusses nutrition, food safety, and related topics. The Digestive System Oct 05 2021 As soon as food touches your tongue, it begins a long process of moving through different parts of your body. This book explains how the human body breaks down food to get nutrients and stay healthy. The Digestive System May 04 2024 This is an integrated textbook on the digestive system, covering the anatomy, physiology and biochemistry of the system, all presented in a clinically relevant context appropriate for the first two years of the medical student course. One of the seven volumes in the Systems of the Body series. Concise text covers the core anatomy, physiology and biochemistry in an integrated manner as required by system- and problem-based medical courses. The basic science is presented in the clinical context in a way appropriate for the early part of the medical course. Learning About the Digestive and Excretory Systems May 31 2021 Author Susan Dudley Gold delves into the functions of the digestive and excretory systems. She explains why these systems are discussed together, how they work, and ways to keep healthy. Fascinating tidbits about these systems add an interesting twist. Stomach Apr 30 2021 The Digestive System Jun 12 2022 Simply describes the functioning of the digestive system and explains the process of digestion. The Digestive and Excretory Systems Nov 29 2023 The digestive and the excretory systems take the food we eat through a marvelous maze. Every bite travels from the mouth to the stomach to the intestines. Food is separated into nutrients and waste products, which both systems expel. Along the way, the digestive system mashes, chops, crushes, dissolves, and breaks down the food into molecules of nutrients. These provide energy to the rest of the body. The excretory system filters the blood and regulates the amount of salt and water in the body. Learn how these remarkable systems work together to bring us life-giving nutrients and rid our bodies of waste. Book jacket. The Human Body: The Digestive System Sep 03 2021 Travel the alimentary canal to learn how food is digested with help from the liver, pancreas, and gallbladder. Find out how nutrition affects digestion and health. Your Digestive System Feb 01 2024 Audisee® eBooks with Audio combine professional narration and text highlighting for an engaging read aloud experience! The digestive system is made up of the tongue, the esophagus, the stomach, the intestines, and other parts. But what does the digestive system do? And how do its parts work together to keep your body healthy? Explore the digestive system in this engaging and informative book. Anatomy and Physiology Aug 27 2023 The Stomach in 3D Jan 08 2022 This investigation into the human abdomen, stomach, and intestines is packed with vivid high-quality, full-color photographs that provide a deep and textured view into the human midsection. The function and position of such body parts as the abdominal muscles, the ribs, the stomach, the intestines, and the colon are covered along with a discussion of the other organs involved in human digestion, such as the liver, the spleen, and the gallbladder. Combined with intense, 3D-like photographs, this tour of the human digestive system will help readers achieve a more complete understanding of how the stomach and surrounding organs work. The Digestive System Mar 02 2024 Describes how the components of the digestive system complete the process of breaking down food, and discusses what happens when food is not properly digested. Break It Down Dec 19 2022 Take a new look at the human body. Find out what happens to the food you eat as it makes its journey through your body. Using interesting photos and facts, this book will really make you think about your body and the amazing things that go on inside you every second. You'll never feel the same way about yourself! The Digestive System Nov 17 2022 Briefly discusses the various ways plants and animals obtain and utilize food, describes the human digestive system and what happens to a roast beef sandwich when it is eaten, and explains the principles of nutrition. The Digestive System Mar 10 2022 The Digestive System Jul 06 2024 The satisfaction derived from savoring a steak or indulging in an ice cream sundae is only one aspect of a larger process that occurs in the human digestive system. From the moment food enters our mouths until long after we have finished a meal, the body engages in an extensive routine designed to retain nutrients and discard waste. This comprehensive book examines all the vital components involved in consuming and digesting food as well as the diseases and disorders that can plague this frequently overlooked area of the human body. The Digestive System May 24 2023 This introductory guide to the digestive system describes the function of related organs, including the stomach, intestines, and kidneys, and explains the path that food travels through the human body. The Human Body: the Digestive System Aug 15 2022 Describes the function of each part of the digestive system. Digestive System Apr 10 2022 Colorful graphics, engaging text, and fun, close-up photographs invite young readers to become familiar with their digestive system. In this book, readers will learn how their mouth, esophagus, stomach, and intestines work together to digest their food and give their body energy. Simple diagrams highlight major parts of the digestive system. Also described are the inner structure of the stomach, the small intestine, and the large intestine as food moves through the body. In addition, readers will learn about nutrition, exercise, and hygiene to keep their digestive system healthy. Features include a table of contents, fun facts, diagrams, health tips, a glossary with phonetics, and an index. Buddy Books is an imprint of ABDO Publishing Group. Digestion Mar 29 2021 Describes how the digestive system processes the foods we eat and discusses such related topics as appetite, upset stomachs, and diabetes. Guts: The Digestive System Jun 24 2023 Introduces the human digestive system, explaining how it works to break food down into nutrients and describing the role of each part or organ. The Digestive System Feb 18 2023 Discusses the organs and fuction of the human digestive system, nutrients essential for good health and how they are processed by the body, and medical treatments of digestive disorders. Your Digestive System Feb 06 2022 Describes how the digestive system processes the foods we eat and discusses how proper nutrition and physical exercise contribute to building a healthy body. The Mechanics of the Digestive Tract Nov 05 2021 Alvarez includes his smooth diet for duodenal ulcer on pg. 111. The Digestive System Sep 15 2022 This is an integrated textbook on the musculoskeletal system, covering the anatomy, physiology and biochemistry of the system, all presented in a clinically relevant context appropriate for the first two years of the medical student course. One of the seven volumes in the Systems of the Body series. Concise text covers the core anatomy, physiology and biochemistry in an integrated manner as required by system- and problem-based medical courses. The basic science is presented in the clinical context in a way appropriate for the early part of the medical course. There is a linked website providing self-assessment material ideal for examination preparation. The Digestive System Jun 05 2024 Examines the role and function of the digestive system, including the esophagus, stomach, and small intestine. The Digestive System Feb 26 2021 "Did you know that there are approximately 500 species of bacteria in the intestines? The surface area of the small intestine is 2,700 square feet (250 square meters). Discover more fascinating facts in How the Human Body Works - The Digestive System. This series guides readers through the fascinating inner workings of the human body. The human body contains several complex systems that work closely together to support life and allow the body to function properly. Each book explores the characteristics and interactions of these systems, their makeup, and their importance"-- The Big Slide Jul 14 2022 The human digestive system plays an important role in processing food in order to provide nutrients that the body can use. This well-illustrated text presents the basics of anatomy, physiology and disease of the human digestive system by answering a series of questions relevant to the various components of this system. For example, in studying the stomach, the following questions are examined: 1) Where is the stomach located? 2) What does the stomach look like? 3) What does the stomach do? 4) Where do gastric juices come from? 5) What causes ulcers? 6) What causes a stomach ache? and 7) What causes burping? Additionally, most chapters are filled with unusual trivia related to the part of the body being discussed. For example, there was a 42-year-old woman who complained of mild abdominal pain and had 2533 objects removed from her stomach, including 947 pins. The text provides a fun and interesting way to learn more about the digestive system. The text is ideal, whether you are looking for an entertaining and informative read on the workings of the human digestive tract or looking for a text or resource for biology or health classes. The Digestive System Jan 20 2023 In this book, text covers the core anatomy and physiology. Coverage of the necessary basic science is clinically driven - clinical cases used throughout chapters. In addition to the extensive use of cases throughout the book, the final chapter gives a coverage of the major diseases of the system, equipping students for the much earlier contact with patients which occurs under the new curriculum. Contents - Overview of the digestive system. Mouth and oesophagus. The stomach basic functions. The stomach control. Pancreas exocrine functions. Liver and biliary system. Small intestine. Digestion and absorption. Absorptive and post-absorptive states. The colon. Gastrointestinal pathology. Relationships Among the Brain, the Digestive System, and Eating Behavior Oct 17 2022 On July 9-10, 2014, the Institute of Medicine's Food Forum hosted a public workshop to explore emerging and rapidly developing research on relationships among the brain, the digestive system, and eating behavior. Drawing on expertise from the fields of nutrition and food science, animal and human physiology and behavior, and psychology and psychiatry as well as related fields, the purpose of the workshop was to (1) review current knowledge on the relationship between the brain and eating behavior, explore the interaction between the brain and the digestive system, and consider what is known about the brain's role in eating patterns and consumer choice; (2) evaluate current methods used to determine the impact of food on brain activity and eating behavior; and (3) identify gaps in knowledge and articulate a theoretical framework for future research. Relationships among the Brain, the Digestive System, and Eating Behavior summarizes the presentations and discussion of the workshop. Digestive System Dec 07 2021 Did you know that more than 2.1 pints (1 liter) of food can be stored in the stomach? Food stays in the stomach for 2 to 5 hours. Discover more fascinating facts in Digestive System, a title in the Body Systems series. Each title in Body Systems guides readers through the fascinating inner workings of the human body. The human body contains several complex systems that work closely together to support life and allow the body to function properly. Each book explores the characteristics and interactions of these systems, their makeup, and their importance. This is an AV2 media enhanced book. A unique book code printed on page 2 unlocks multimedia content that brings the book to life. This book comes alive with audio, video, weblinks, slideshows, activities, quizzes, and much more. The Digestive System Apr 03 2024 How long are your intestines? Why are healthy teeth so important to the digestive system? How does alcohol affect the digestive system? Investigate the miracles of the human body with Body Focus. Find out about the body parts and systems that enable us to eat, run, jump, think, and feel. Discover what sort of things can go wrong with our bodies, form common illnesses to more unusual problems. The Digestive System explores the structure of the different parts of the digestive system, looking at how they work together to digest the food we eat. It explains the different illnesses and injuries that can affect your digestion, from indigestion to ulcers, and outlines ways to keep healthy, including the importance of a balanced diet.-- The Digestive System Aug 03 2021 Introduces the organs used to digest food and the process of digestion. The Digestive System Jul 26 2023 An overview of the digestive system and how it works. The Digestive System brightly coloured design to bring science to life. Guts Apr 22 2023 Why is it important tochew your food? Can you guess how long it takes for food to travel through your body? Could you possibly have twenty feet of small intestines? Where does that bad-smelling gas come from? Your digestive system is out of sight and out of mind -- until things don't go right. Then you may wonder how these important organs work! You'll find the answers in Seymour Simon's smooth, well-organized, and fascinating introduction to the digestive system. He explains how it works twenty-four hours a day, turning pizza, sandwiches, milk, and other food into energy and nutrients and waste. Striking photographs on every spread show how major organs including the stomach and intestines move food through your body, and how, eventually, waste is eliminated. Guts takes the mystery out of something that happens to everyone, every day, while at the same time sharing a sense of wonder about the human body. May 12 2022 How does the digestive system work? How is it linked to other parts of the human body? Find out all about the digestive system in this fascinating and engaging book that uses flowcharts, text boxes and Physiology and Pathophysiology of Digestion Mar 22 2023 This collaboration of two physiologists and a gastroenterologist provides medical and graduate students, medical and surgical residents, and subspecialty fellows a comprehensive summary of digestive system physiology and addresses the pathophysiological processes that underlie some GI diseases. The textual approach proceeds by organ instead of the traditional organization followed by other GI textbooks. This approach lets the reader track the food bolus as it courses through the GI tract, learning on the way each organ's physiologic functions as the bolus directly or indirectly contacts it. The book is divided into three parts: 1) Chapters 1-3 include coverage of basic concepts that pertain to all (or most) organs of the digestive system, salivation, chewing, swallowing, and esophageal function, 2) Chapters 4-6 are focused on the major secretory organs (stomach, pancreas, liver) that assist in the assimilation of a meal, and 3) Chapters 7 and 8 address the motor, transport, and digestive functions of the small and large intestines. Each chapter includes its own pathophysiology and clinical correlation section that underscores the importance of the organ's normal function. The Digestive System Jul 02 2021 Introduces the various parts of the digestive system and the functions they perform. Digestion and Nutrition Dec 31 2023 You can not live without proper nutrition, and the digestive system aids in getting that nutrition into your body. Learn about healthy eating and the process of digestion with this great book. The Digestive System The Digestive System The Digestive System The Digestive System Your Digestive System The Digestive System Digestion And Nutrition The Digestive System The Digestive And Excretory Systems The Digestive System The Digestive System Anatomy And Physiology Guts The Digestive System Guts The Digestive System Physiology And Pathophysiology Of Digestion The Digestive System The Digestive System Break It Down Relationships Among The Brain The Digestive System And Eating Behavior The Digestive System The Digestive System The Big Slide The Human Body The Digestive System The Digestive System Digestive System The Digestive System The Digestive System The Stomach In 3D Your Digestive System Digestive System The Digestive System The Mechanics Of The Digestive Tract The Human Body The Digestive System The Digestive System The Digestive System Learning About The Digestive And Excretory Systems Digestion Stomach The Digestive System
<urn:uuid:de575272-feb5-4562-a99e-0b71ab60fa57>
CC-MAIN-2024-33
https://offsite.creighton.edu/~O9W5C7/tiga?download&FileName=Chapter+14+The+Digestive+System+And+Body+Metabolism+Answer+Key&o=U6J6P4
2024-08-07T12:06:39+00:00
crawl-data/CC-MAIN-2024-33/segments/1722640694449.36/warc/CC-MAIN-20240807111957-20240807141957-00482.warc.gz
330,766,275
3,729
eng_Latn
eng_Latn
0.931087
eng_Latn
0.995921
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 6061, 12502, 17758, 18064 ]
[ 2.921875 ]
1
0
Chestnut Lane School ANTI-BULLYING POLICY This policy is published on our school website and is available, on prior request, in hard copy from the school office. All members of our school community have a responsibility to prevent and tackle bullying behaviour. Linked Policies - Behaviour Policy - E safety and ICT Code of Conduct - Child protection Policy - Home school agreement - Mental Health and Wellbeing Policy - Keeping Children Safe in Education (2023) - Preventing and tackling Bullying (DfE July '17) - SEND Policy - PSHE and RSHE Policy Reviewed: November 2023 Next Review: November 2025 Introduction Section 89 of the Education and Inspections Act 2006 provides that maintained schools must have measures to encourage good behaviour and prevent all forms of bullying amongst pupils. These measures should be part of the school's behaviour policy which must be communicated to all pupils, school staff and parents. At Chestnut Lane School, we are aware that pupils may be bullied in any school or setting and recognise that preventing, raising awareness and consistently responding to any cases of bullying should be a priority to ensure the safety and well-being of our pupils. In line with the Equality Act 2010, it is essential that our school: - Eliminates unlawful discrimination, harassment, victimisation and any other conduct prohibited by the act. - Advances equality of opportunity between people who share a protected characteristic and people who do not share it. - Fosters good relations between people who share a protected characteristic and people who do not share it. Part 6 of the Equality Act makes it unlawful for the responsible body of a school to discriminate against, harass or victimise a pupil or potential pupil in relation to admissions, the way it provides education for pupils, provision of pupil access to any benefit, facility or service, or by excluding a pupil or subjecting them to any other detriment. In England and Wales Part 6 of the Act applies to maintained schools and Academies and to other independent schools. Under the Children Act 1989 a bullying incident should be addressed as a child protection concern when there is 'reasonable cause to suspect that a child is suffering, or is likely to suffer, significant harm'. Where this is the case, the school staff should report their concerns to their local authority children's social care. Even where safeguarding is not considered to be an issue, schools may need to draw on a range of external services to support the pupil who is experiencing bullying, or to tackle any underlying issue which has contributed to a child engaging in bullying. Statement of Intent Our school is driven by our values: respect, kindness, resilience, independence and responsibility. We are committed to providing a caring, friendly and safe environment for all of our pupils so they can reach their potential academically, socially and personally through learning and playing in a relaxed and secure atmosphere. Bullying of any kind is unacceptable at our school. If bullying does occur, all pupils should be able to tell an adult and know that incidents will be dealt with promptly and effectively. Where appropriate staff will also respond to bullying that happens outside of the school premises. We are a TELLING school. This means that anyone who knows that bullying is happening is expected to tell the staff and that any member of staff will help to prevent bullying from happening. We are determined to ensure a safe and secure environment is sustained for all pupils. Objectives of this Policy - All governors, teaching and non-teaching staff, pupils and parents should have an understanding of what bullying is. - All governors, teaching and non-teaching staff should know what the school policy is on bullying, and follow it when bullying is reported. - All pupils and parents should know what the school policy is on bullying, and what they should do if bullying arises. - As a school we take bullying seriously. Pupils and parents should be assured that they will be supported when bullying is reported. - Bullying will not be tolerated. - Governors will monitor the incidents of bullying recorded by school staff to check for patterns. What is Bullying? At Chestnut Lane School, we discuss what bullying is, as well as incidents we would not describe as bullying (see Appendix 1). We agree that: - Bullying is behaviour by a person or group, repeated over time, that intentionally hurts another person or group either physically or emotionally - Bullying usually happens when the relationship is imbalanced - It could be prejudice-based or discriminatory Types of Bullying Bullying can take many forms and is often motivated by prejudice against particular groups. It might be motivated by actual differences between children, or perceived differences. Stopping violence and ensuring immediate physical safety is obviously a school's first priority but emotional bullying can be more damaging than physical; teachers and schools have to make their own judgements about each specific case. Bullying can be: - Child-on-child, teacher to pupil or pupil to teacher - Emotional - being unfriendly, excluding, tormenting (e.g. hiding books, threatening gestures) - Physical - pushing, kicking, hitting, punching or any use of violence - Verbal - name-calling, sarcasm, spreading rumours, teasing Forms of bullying can include, but are not limited to: - Cyber-Bullying The rapid development of, and widespread access to, technology has provided a new medium for 'virtual bullying', which can occur in and outside school. Cyber-bullying is a different form of bullying which can happen beyond the school day into home and private space, with a potentially bigger audience, and more accessories as people forward on content. - Homophobic, Biphobic or Transphobic Bullying This occurs when bullying is motivated by a prejudice against lesbian, gay, bisexual or transsexual people. - Racist Bullying This refers to a range of hurtful behaviour, both physical and psychological, that make the person feel unwelcome, marginalised, excluded, powerless or worthless because of their colour, ethnicity culture, faith community, national origin or national status. Vulnerable Groups We recognise that some groups of pupils may be more vulnerable to bullying, including: - Looked After Children - Gypsy, Roma and Traveller children - Children with caring responsibilities - Children with Special Educational Needs or Disabilities (SEND) - Children entitled to Free School Meals - Children from ethnic minorities - Children for whom English is an additional language - Children who are perceived to be gay, lesbian, bisexual or transsexual - Those suffering from health problems, including mental health Many experts say that bullying involves an imbalance of power between the perpetrator and the victim. This could involve perpetrators of bullying having control over the relationship which makes it difficult for those they bully to defend themselves. The imbalance of power can manifest itself in several ways, it may be physical, psychological (knowing what upsets someone), derive from an intellectual imbalance, or by having access to the support of a group, or the capacity to socially isolate. It can result in the intimidation of a person or persons through the threat of violence or by isolating them either physically or online. Why is it Important to Respond to Bullying? Bullying hurts. It can have a huge negative impact on children, in the short and long term. No one deserves to be a victim of bullying. Everybody has the right to be treated with respect. People who are bullying need to learn different ways of behaving. Schools have a responsibility to respond promptly and effectively to issues of bullying. Signs and Symptoms A child may indicate by signs or behaviour that s/he is being bullied. Adults should be aware of these possible signs and that they should investigate if any child of any age: - is frightened of walking to or from school; - is unwilling to go to school (school phobic); - changes their usual routine; - becomes withdrawn anxious, or lacking in confidence; - attempts or threatens to run away; - starts stammering; - cries themselves to sleep at night or has nightmares; - begins to do poorly in school work; - feels ill in the morning; - has possessions which are damaged or "go missing"; - has unexplained cuts or bruises; - asks for money or starts stealing money (to pay bully); - becomes aggressive, disruptive or unreasonable; - is bullying other children or siblings; - stops eating; - is frightened to say what's wrong; - gives improbable excuses for any of the above; - is afraid to use the internet or mobile phone; if appropriate to - is nervous & jumpy when a cyber-message is received. the age. These signs and behaviours could indicate bullying and therefore they should be investigated. Responding to Bullying In any case of alleged bullying, either the class teacher, the Headteacher, or a senior member of staff should first establish the facts, and build an accurate picture of events over time, through speaking to the alleged perpetrator(s), victim(s) and adult witnesses, as well as parents and pupil witnesses if necessary and appropriate. If the allegation of bullying is upheld, the Headteacher (or senior leader) should seek to use a restorative approach with the perpetrator(s) and victim(s) together. The consequences of their actions on the victim(s) should be fully explained to the perpetrator(s). Both parties should be clear that a repeat of these behaviours will not be acceptable. Listening to Children It is important that children are, and feel that they are listened to when discussing or disclosing any potential incidents of bullying. We will: - listen to the child; - show empathy; - take them seriously; - let the child know it's not their fault; - avoid stereotypes; - follow our procedures for reporting concerns. - reassure them they were right to tell an adult; School Procedures 1. Report bullying incidents to a trusted adult in school as soon as it happens, preferably before home time. 2. Behaviour incidents, including bullying, are logged by the staff member dealing with the incident. 3. Serious behaviour incidents, including bullying, will be referred to a member of the SLT. 4. Where an allegation of bullying is upheld, parents will be informed and will be asked to come into school discuss the incident. 5. The support of external agencies may be requested if a child safeguarding concern is raised. If necessary and appropriate, police will be consulted. 6. The bullying behaviour or threats of bullying must be investigated and the bullying stopped quickly. 7. An attempt will be made to help the bully (bullies) understand and change their behaviour. 8. Parent and carers are encouraged to support the school's Behaviour Policy and this includes dealing with children who have been bullied or are bullying. Parent Procedures 1. Raise any concerns with the class teacher at the earliest opportunity, who will seek support from the SLT as appropriate. 2. Encourage their child to tell the teacher. 3. Not to investigate it themselves. Outcomes 1. The bully (bullies) may be asked to genuinely apologise and a sanction will be administered in line with our school behaviour policy. 2. In serious cases, suspension or even exclusion will be considered. 3. If possible, the pupils will be reconciled. 4. After the incident / incidents have been investigated and dealt with, each case will be monitored to ensure repeated bullying does not take place. Bullying Prevention Preventing and raising awareness of bullying is essential in keeping incidents in our school to a minimum. Through assemblies, as well as PSHE lessons, pupils are given opportunities to discuss what bullying is, as well as incidents we would not describe as bullying, such as two friends falling out or a one-off argument. Pupil voice was sought to create our 'Is it Bullying?' poster, which is clearly displayed in classrooms and in key places around the school (see Appendix 1). We use a range of methods to prevent and raise awareness of bullying. As and when appropriate, these may include: - circle time; - signing a behaviour contract / class charter / home-school agreement; - creating a set of school rules; - writing stories or poems or drawing pictures about bullying/ friendship; - having discussions about bullying and why it matters; - reading stories about bullying / friendship or having them read to a class or assembly; - assemblies on the importance of telling the teacher / a trusted adult; - age appropriate participation in national events such as 'odd socks day' and 'show racism the red card'; - pupil and parent participation in anti-bullying / friendship week; - using the 'time out sign' if a game is getting a bit tough or you want to play a different game with different friends. E-safety is an important part of the Curriculum and information for parents is included in newsletters and on the school's website. E-safety workshops are held to raise parents' awareness of cyber-bullying. Pupils are taught to tell an adult in school if they are concerned that someone is being bullied. Criminal Law Although bullying in itself is not a specific criminal offence in the UK, it is important to bear in mind that some types of harassing or threatening behaviour – or communications – could be a criminal offence, for example under the Protection from Harassment Act 1997, the Malicious Communications Act 1988, the Communications Act 2003, and the Public Order Act 1986. Hate crime on the basis of race, religion, disability sexual orientation or transgender identity are covered by the Crime and Disorder Act 1998 and section 66 of the Sentencing Act 2020. The Protection from Harassment Act 1997 makes provision for protecting people from harassment or similar conduct. If school staff feel that an offence may have been committed they should seek assistance from the police. For example, under the Malicious Communications Act 1988, it is an offence for a person to send an electronic communication to another person with the intent to cause distress or anxiety or to send an electronic communication which conveys a message which is indecent or grossly offensive, a threat, or information which is false and known or believed to be false by the sender. Monitoring and Review: Policy into Practice - The school will ensure that we regularly monitor and evaluate mechanisms to ensure that the policy is being consistently applied. - Any issues identified will be incorporated into the school's action planning. - The Headteacher will be informed of bullying concerns, as appropriate. - Incidents of bullying, including outcomes will be reported to and discussed by the Governing Body. Useful Links and Supporting Organisations*: - Advisory Centre for Education (ACE: https://www.ace-ed.org.uk/ - Childline: www.childline.org.uk - Anti-Bullying Alliance: www.anti-bullyingalliance.org.uk - Childnet: https://www.childnet.com/ - Family Lives: www.familylives.org.uk - Children's Legal Centre: https://www.childrenslegalcentre.com/ - Kidscape: www.kidscape.org.uk - National Bullying Helpline: https://www.nationalbullyinghelpline.co.uk/kids.html - MindEd: www.minded.org.uk - NSPCC: www.nspcc.org.uk - Report Harmful Content: https://reportharmfulcontent.com/ - PSHE Association: www.pshe-association.org.uk - Young Minds: www.youngminds.org.uk - Youth Access: https://www.youthaccess.org.uk/ - Young Carers: www.youngcarers.net *correct at the time of writing This policy is based on the twelve-step guide produced by KIDSCAPE This policy upholds articles 14, 23, 28 and 30 from the United Nations Convention on the Rights of the Child because it respects children's rights to practise a religion, ensures children with disabilities lead full and independent lives, promotes the right to a primary education, and believes children should learn and use the language and customs of their families.
<urn:uuid:73e8147b-ba4e-43f9-8350-56f55292cd36>
CC-MAIN-2024-33
https://chestnutlane.bucks.sch.uk/files/4fce9cdc05836c585d28cc8d9d8456be.pdf
2024-08-07T13:14:08+00:00
crawl-data/CC-MAIN-2024-33/segments/1722640694449.36/warc/CC-MAIN-20240807111957-20240807141957-00480.warc.gz
128,659,815
3,274
eng_Latn
eng_Latn
0.993924
eng_Latn
0.998128
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 607, 3585, 6007, 8653, 11331, 14555, 16201 ]
[ 3.4375 ]
1
0
Title I Reading Program and Parent Involvement * Spirit Lake Elementary (SLE) endorses parent involvement and encourages regular participation of parents in all aspects of our School-Wide Title I Program. * SLE offers opportunities to increase family involvement through: -Meet the Teacher Events -Teacher & Student Led Conferences -Title STEAM & Other Family Nights -Title Google Meet/Zoom Family Events What is Title I and What Does it Have to Do With"Free & Reduced Meals?" * Title I is a program that supports Spirit Lake Elementary (SLE) in meeting the learning needs of all students. The amount of funds SLE receives for this federally funded program is based on the percentage of students at our school that qualify for Free and Reduced Meals, so please apply for Free and Reduced Meals if you haven't done so! * Click Here for Free & Reduced Lunch App. & Info Purpose The purpose of the Title I Program is to ensure that all children have a fair, equal, and significant opportunity to obtain a high-quality education and reach, at a minimum, proficiency on challenging State academic achievement standards and state academic assessments. School-Wide Title I * The emphasis in schoolwide program schools is on serving all students, improving all structures that support student learning, and combining all resources, as allowed, to achieve a common goal. * School-Wide Programs. . . Plan for comprehensive long term improvement Serve all students with highly qualified teachers and paraprofessionals Provide continuous learning for staff, parents and the community Use research-based practices and programs to develop and implement enriched instruction for all students and engage in continuous self-assessments and improvements Maximizes the impact of Title I Title Differentiated Reading * SLE has implemented a school-wide framework for reading. This differentiated reading program has been designed to serve all students and improve all structures that support student learning. Our goal is for all students to demonstrate proficient and advanced levels of academic achievement. * Title Reading Groups are based on student performance on academic screeners, in class performance and teacher recommendations. School-Wide Structure What is Taught During Reading Support Time? The 5 Components of Reading *Phonemic Awareness *Phonics *Fluency *Vocabulary Development *Comprehension Plus Writing Teaches students how to hear and recognize sounds in spoken words. Is the relationship between sounds and letters. Students study words to learn their meaning. This means being able to read, understand, and pronounce text quickly and accurately. Students need to talk and write about what they read. This helps show that they understand, remember and can communicate about what they read. Students need: * frequent opportunities to read and write * access to appropriate books and tasks * explicit strategy instruction * to attend school regularly to benefit from intensive instruction * instruction based on identified skill deficits and strengths 1. Read at least 10-20 minutes every night with your child. 2. Talk about the stories you read. 3. Let your child see you reading. 4. Be mindful that reading and writing are related and integrate the two skills when possible. 5. Plan trips to the library or access books online. When families are involved at home and at school, children achieve higher levels of academic success. Screen Time Facts * Children between the ages of 8 and 18 log about about 7 1/2 hours of video entertainment media per day. (2010 study by Henry J. Kaiser Family Foundation). * Today's parents are the 1 st generation who have to figure out how to limit screen time for their children. (Morin, Amy, LCSW: verywellfamily.com) Suggestions to limit screen time *Encourage family meal time that is device free *Set a time allotment for screen time in the car *Have a weekly family night that is device free *Set and monitor limits on daily use *Put an incentive plan in place to earn screen time minutes Digital Detox * Create a screen-free, family night once a week or commit to unplugging one weekend a month. It could be good for everyone's physical and emotional health, as well your family's relationships. (www.verywellfamily.com)
<urn:uuid:7bb66cd8-d02a-4ce4-aa67-84eb39b50d9b>
CC-MAIN-2024-33
https://resources.finalsite.net/images/v1614203567/lakeland272org/iqudokfmnedmo00c2u4y/TitleOverviewParentInfo2020-21.pdf
2024-08-07T11:28:34+00:00
crawl-data/CC-MAIN-2024-33/segments/1722640694449.36/warc/CC-MAIN-20240807111957-20240807141957-00485.warc.gz
380,778,307
870
eng_Latn
eng_Latn
0.991886
eng_Latn
0.997754
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "unknown", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 405, 872, 1152, 1781, 2235, 2258, 2428, 2496, 2545, 2591, 2678, 2822, 3363, 3466, 3793, 4070, 4306 ]
[ 2.125 ]
1
0
The Baltic's Roads or Estonians in Praegue The hike for Estonian 100th aniversary celebration (Declaration of Independence 24. 2. 1918) Date: 24. 4. 2018 Start: The tram station near the Estonian Street Ruská Agenda: Modrý dům, Estonian - Czech Club, address: Na Špejcharu 3. Duration: 10,5 km Start your hiking until the crossroad and cross the main road. Continue up the stairs until you reach the block of villas. Turn right onto Na Šafránce street and take the first left onto Estonská street (1). From there the first street left (Hradešínská street), continue until the park: on your right, house No. 3 is the Latvian Embassy (2). In the park, take the first right and pass the Husova Church, until you see a water tower on Korunni street (3). Cross this street as well and continue hiking by walking downwards until the crossroad on Slezska street. From here take a left turn and continue on that street until Náměstí Míru, feel free to take a slight detour and visit Svatopluk Čechi, orchard, that run parallel with the street. Walk through Náměstí Míru court and continue downwards on Anglicka Street (on the right of Jugoslávska Street, on which runs the tram towards I. P. Pavlova). Stay on the right side of the street. On the other side of the crossroad, on Balbinova Street, you will find on the wall of the first house, a memorial plate that is dedicated to the National Awakening of Lithuania (4). Continue along Anglicka Street until you reach the crossroad where trams run (Škrétova Street). From here make a right turn and walk until the next crossroad. Then walk down the stairs, diagonally, into the park that sits behind Národní Museum. Go through the tunnel, you will reach the old building of the Národní Museum, pass it and walk in front of the Národní Museum (used to be the Federal Assemble, after that was here Radio Free Europe). (5) Take the crossing and walk into Václav Square, walk down to the end of the street. Continue the hike by crossing the road at Můstek. Then take the first street to the left (Rytířská): on the right side of it, in house No. 25, is the Hungarian Cultural Center. (6). Continue walking until you reach Uhelný trh (Charcoal market) and continue along Martinska Steet, on your left. Right before St Martina's Church, make a left turn and walk through until Národní Street. From here take the first right and continue the journey towards Vltava River. Before reaching the river, you will find house No. 11, where is Národní kavárna (cafe) (7). On the left side, one should not leave unnoticed the National Theatre (8). Cross the Legion Bridge and immediately take a left turn onto Janáčkovo nábřeží. Then continue along the second street, on the right side (Vodní), until you reach the end where you will find Švandovo Theatre in front of you (9). Stand facing the theatre, turn right, and continue along the main road, where trams run as well (walk about 1 km). While crossing the first road, you will pass the Kinsky Gardens (10). After passing the first block of houses, you can enhance your journey by walking slightly up the mountain towards the left, walking through the alley of Statues of the Totalitarian Victims. At the end of the alley you should find your way back to main street called Újezd. Continue walking straight, on the right side of he street. After going through the arch, you will reach the Museum of Music, where Újezd ends and Karmelicka starts: the first house on your right, house No 8, is the Rohanský Palace, where at the moment is situated the Educational, Youth and Sports Ministry (MŠMT) (11). Continue straight until Malostranské Square, here take an immediate left at the arcade. You will reach the end of the walkway where you will take a right turn and walk past the Lichtenštejni Palace, staying on the left side (12), once passed the palace, walk down the hill, keeping towards the right. Walk to the tram stop, cross it and walk until you reach Mostecka Street, moving towards Karl's Bridge. Right before reaching the bridge, turn right onto Lázeňská Street. Continue along this street until taking a left turn onto Velkopřevorské Square, from there cross the small pedestrian bridge Čertovka. After this, take the next right, where you will find yourself at the start of Na Kampě Street. The first building on the left is the Embassy of Estonia (13). Walk back, going under Karl's Bridge, and then take a right onto U Lužického Seminar Street. Continue strolling along this street until Klárova Park and from there walk to the metro station Malostranská. Continue straight, walking slightly upwards the hill on Klarovi Street (trams run threre), until hotel Hoffmeister (14). You can make this journey especially pleasant by walking through the neighbouring parks. To take this beautiful detour, walk up the pedestrian staircase next to Hotel Hoffmeister. Continue straight, walk under a small bridge, then on your right you will reach another bridge which you will cross. In the park turn left onto the Prague Panorama Viewing Platform. After taking in the sights continue along the concrete walkway until the sculpture of J. Zeyeri, stay on the right. Walk up the stairs for roughly 50 meters, then cross a bridge (pass from the right side!) (15). After walking around the sculpture, find your way back onto the little bridge. Cross the bridge, on the left come back to the place on the pedestrian walkway where from you initially walked onto the bridge. Now stand facing away from this bridge and continue walking upwards the street in front of you (where also run trams towards Hradčanská). In about 200 meters you will find in front of you the strictly guarded Embassy of Israel building. Right before reaching the embassy, take a right onto Na Špejcharu Street, house No. 3. This is the final point of the city hike, congratulations, see you inside! There will be arrows to guide you. (16) 1) Estonská street 2) Latvian Embassy 3) Water Tower (Pumphouse). In the street Korunni No 75 is located Restaurace u Vodárny. The Estonian club has organised several jubilee events here. 4) A memorial plaque - in the house on the corner Anglické and Balbínovy street he lived at the end of the 19th century (Lithuanian National Awakening period), doctor Jonas Basanavičius, who published the first Lithuanian newspaper in Prague Aušra. 5) National Museum. The new Národní museum building – the office of the designated ambassador I. Zajedova's was located in the TV Federal Assembly in 1991-1992. V. Macura and I. Zajedova collected Prague's public gathered signatures at the Smetana theatre next door to support Estonia in regaining it's independence in 1990. The signatures were sent to the Helsinki Final Act in '75 inst. At a later time the Radio Free Europe, who also broadcasted shows for Estonia in the Estonian language, had the headquarters in the Federal Assembly. The exhibition „The independent theatre of Estonia" was organised by the Czech-Estonia club in Feb./Mar. 1998. 6) Hungarian Cultural Centrum - Many culture nights for the public were organised by the Czech-Est club in the Hungarian Cultural Centre in 2010. CEK-TEK opened the exhibition „Map Map// Card Card" in house No 31 on the same street (Rytirška). 7) Národní kavárna (café) – this was the meeting point for Estonians during the Second World War. The theatre „Viola" in the neighbouring house No. 7 was used by Estophile Vladimir Macura for poetry nights in 1988-1992. Nowadays you can see the Estonian actress Lilian Malkina perform in some of the plays here. In the neighbouring Czech Academy of Sciences the Czech-Estonian club organised the first Estonian days in Prague, where two exhibitions were set up: EV Academy of Science and Livonian Chronicles of Times in collaboration with CZ Science Academy and the National Library. A historical lecture took place during the Estonian days. 8) National Theatre. During the years 1981-1997 the Estonian Iivi Zajedova was a member of the Czech National theatre ballet company. The 1983 opera „Prodana nevěsta „ (Smetana „The sold fiancé"9 was played by opera singer Anu Kaal (from Estonia) as Marenka and I. Zajedova as the ballerina. One may point out the peculiarity that there were two Estonians taking part in the same show in the National theatre of Prague. 9) Švandovo divadlo (theatre) – Estophil Vladimir Macura founded the Baltic Union Organization, which mainly introduced the literature of Baltic countries, in 1974. Later on in February 1991 the Czeck-Est club was founded on the Res Baltica event in the same theatre. On the same evening, where among the guests was the Minister for Foreign Affairs of the Czech Republic and some of the Charta 77 members. In the performance were shown parts of the impact of the secret Molotov-Ribbendrop Pact and the reasons of the occupation and execution. 10) Kinského zahrada (gardens) – TEK in collaboration with the Dance museum of Estonia and EV Embassy organised an exhibition along with a lecture in the Kinskite summergarden housemuseum in 2017. 11) Rohanský Palace- previously known as Kuronský Palace, which used to belong to the crown nobility during the years 1799-1811 ( Kuronsko used to be autonomous in the framework of the Lithuanian Principality, respectively Polish-Lithuanian Commonwealth. The Princes also owned other lands in Czech, for instance Náchod and Ratibořice Castles, and the daughter of the last Prince Petra Birona's name was Kateřina Vilemína Zaháňská, known as Madam Princess in the book Babička, written by Boženy Němcové. 12) Liechtenstein Palace – HAMU: Music Academy HAMU and University of Tallinn started their collaboration in 2008. The Czech-Est club organised Estonian days, which were dedicated to the 100th anniversary of the Republic of Estonia, in February 2018. There was a ceremonial concert, opening day of the exhibition, screening of the film „Spring" and other University of Tallinn students' films, various workshops. 13) Estonian Embassy - The Embassy of the Republic of Estonia in Prague from 1997 – House near the Blue Fox derives from the 17th century. 14) Hotel Hoffmeister– The president of EV Lennart Meri met with the Baltic Union, the Estonian- Czechoslovakia Association and Czech-Estnian club members. The president was astonished that for the first time in Central Europe he had the chance to hear the Estonian anthem in Estonian. L. Meri was the first official visit of Estonian president of Estonia. 15) Monument J. Zeyera-Pomník Julia Zeyera in Chotkových Gardnens, on which are depicted Olgerda Gejštora and Annu Jagellonskou (Olgerd Geištor is Zeyerovo epic work in an environment of Lithuania). 16) Modrý dům/St Jacobs Church – the address of the Czech-Estonian club which was founded in February 1991 by Iivi Zájedová. Antonin Drábek became the club's first chairman. The purpose of the club was to support the attempt of re-establishing independence in the Baltic states, during the time when they were under the USSR occupation. Many members of the Baltic Union entered the club in the first year of the foundation, e.g Naděžda Slabihoudová, Vladimír Macura, Jonatan Tomeš, Pavel Stoll. The club published the magazines „Estonia" and „Baltica," which passed on news from Estonia and afterwards the publishing office Balt-East was founded by Antonin Drábek. The club members also organized bigger events for the public to introduce Estonia's culture. The Czech-Est club has an annual meeting in Modry dum. Reading material: A collection of articles: Malé Estonsko v Česku, Balt-East, 2008 Iivi Zájedová: Pobaltská regionální spolupráce, Karolinum 2006 F. R. Kreutzwald: Báchorky ze země tisíce ostrovů, Balt – East, 2000, překlad: Naděžda Slabihoudová The hike was prepared by Veronika Škvárová and Iivi Zájedová
<urn:uuid:38505698-6cc3-406b-9f62-3e0448f16e87>
CC-MAIN-2024-33
https://kultuuriseltsid.ee/wp-content/uploads/2018/04/inglise-keelne-Praha.pdf
2024-08-07T12:10:26+00:00
crawl-data/CC-MAIN-2024-33/segments/1722640694449.36/warc/CC-MAIN-20240807111957-20240807141957-00483.warc.gz
271,828,546
2,860
eng_Latn
eng_Latn
0.984785
eng_Latn
0.991086
[ "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 4378, 9235, 11778 ]
[ 2.15625 ]
1
0
PASTRY INFORMATION SHEET DEFINITION Pastry is a mixture of flour, water and fat combined to make a paste. When combined in different proportions, and by varying mixing methods, these basic ingredients make flexible doughs that can be shaped into a range of shapes to hold a variety of sweet or savoury fillings. Paste is the uncooked pastry mixture with the fat added. It has less water and more fat than the dough which is used for bread and scones. HISTORY Pastry was originally made by the Egyptians, who made a flour and water paste to wrap around meat to soak up the juices as it cooked. Pastry was further developed in the Middle East and it was brought to Europe by the Muslims in the 7th century. By medieval times local areas had their own specialty puddings and pies. In the 17th century both flaky and puff pastries were used, and intricate patterns on the pies were a work of art. Today the chief purpose of pastry is to complement the flavour of the fillings and to provide a casing. TYPES OF PASTRY The two major types of pastry in New Zealand are puff and short, but other types will also be defined: Puff pastry is light, flaky and tender. It is made by mixing flour, salt, a little fat and water to form a dough. Puff pastry has a flour to water ratio of 2:1 and is described as a plastic-elastic dough. The dough is then layered with fat, preferably butter, by folding and rolling to form hundreds of layers of fat and dough. When it is baked, water from the dough turns into steam and puffs up the pastry to produce lots of flaky layers. Flaky pastry is made in the same way but has less rolling and folding and is quicker to make. Puff pastry is used for pies and vol-au-vents and can be filled with meat or fruit and spices. See information sheets on Pies and Pastries. Yeasted Pastry – yeast is added to puff pastry ingredients before making yeasted pastry. Yeasted pastries are light flaky pastries that are crisp on the outside, but soft and tender on the inside. The dough, which has yeast added, is layered with fat, so this pastry is a cross between bread and pastry. Yeasted pastries are used in Danishes and croissants. See information sheets on Danish Pastries and Croissants. Short pastry is a soft, tender pastry that is made from flour, fat, salt and water and becomes crispy when cooked. Short pastry has a flour to water ratio of 3:1 and is considered a plastic paste. It is made by mixing the fat and flour together, adding water and then rolling the paste. As the fat is mixed into the dough or paste, the gluten is prevented from developing fully, keeping the pastry 'short' or tender. Different types of short pastry are used for different foods. Short pastry is used to make meat and other savoury pies. Short pastry becomes sweet when sugar and sometimes eggs are added and it is used to make fruit pies, Christmas mince pies and other sweet recipes for desserts. Suet pastry is an old fashioned British pastry used for steamed and boiled sweet and savoury puddings, roly-poly puddings and dumplings. Suet pastry is softer than short pastry, which is crispy when cooked. Suet pastry is made from raw beef or mutton fat, especially the hard fat found around the loins and kidneys (suet). Suet has a melting point of 45–50°C which is higher than butter (32–35ºC) traditionally used in pastry. This melting point means that it is solid at room temperature but easily melts at moderate temperatures, such as in steaming. During cooking, water needs to be kept on the boil to avoid a heavy or soggy pastry. Filo and leaved pastries are found in many parts of the world and popular recipes are traditional strudel from Austria, baklava from the Mediterranean, borek from the Middle East and spring rolls from China. Unlike other pastries, filo (leaved pastry) is made from flour with high gluten content, little fat (butter) and no sugar. Gluten is a protein found in some grains, particularly wheat, and gives bread dough its elastic texture. The flour needs high gluten content to produce an elastic dough that can be stretched into very large, very thin sheets. All leaved pastries (apart from puff pastry) are made from a sheet of dough that is as thin as tissue paper. Traditionally, the dough is made by hand by gently rolling, stretching or pressing it into very thin sheets. Filo pastry's gossamer-thin sheets need careful handling because they're fragile and dry out quickly, so unused sheets are covered with a damp cloth. Before baking, the dough is brushed with butter or oil. It is then used in different ways depending on the recipe. It can be cut into sheets and layered in a tin, cut to make individual rolls or rolled up as one large roll. Strudel pastry, famously used in central Europe for apple strudel, is very similar. Choux pastry is a French speciality used for cream buns, chocolate éclairs and profiteroles. Ingredients include water (or milk), fat (preferably margarine fat with good flavour), eggs (the more added, the better the quality and end result of choux pastry) and flour(high levels of starch), and sometimes a little salt and baking powder. The butter is boiled with a water/milk mix and then flour is added to it. This mixture is then beaten and eggs are added. The mixture is then put in a forcing bag, and placed as rounds or lengths on a baking tray before being baked in a hot oven. During cooking the pastry should triple in size due to natural lift of air. When cool, the pastry is pierced to let out the steam. The pastry is often cut and filled with cream. REFERENCES van Achter J. Choux mix (pate a choux) – how to avoid pitfalls. In: Better baking. Wheat Foods Council 2010(revised). Grains of truth about pastry. 1
<urn:uuid:53f6bf34-7555-4ecf-8c02-850e9d8af903>
CC-MAIN-2024-33
https://gcwgandhinagar.com/econtent/document/1587453120UNIT_3_Pastry_Info_Sheet_5B1_5D.pdf
2024-08-07T11:42:57+00:00
crawl-data/CC-MAIN-2024-33/segments/1722640694449.36/warc/CC-MAIN-20240807111957-20240807141957-00488.warc.gz
214,741,987
1,280
eng_Latn
eng_Latn
0.999448
eng_Latn
0.999448
[ "eng_Latn" ]
false
docling
[ 5716 ]
[ 2.296875 ]
2
0
Planning with Equity in Mind from Culturally Responsive Education in the Classroom: An Equity Framework for Pedagogy by Dr. Adeyemi Stembridge This template was developed by Kristin Monson (NEWESD 101), Jennifer Ireland (NEWESD 101) and Becca Horowitz (PSESD 121) and is offered as an optional resource in conjunction with SGG Module 3. Question One: What do I want learners to understand? 1 What is a deep and meaningful conceptual understanding about your content that matters tremendously for students so that they are able to think like practitioners in your field? What do you remember about your own early emerging understandings of this concept? What did you figure out? How did you figure it out? How did it feel when you first understood? Question Two: What do I want learners to feel? 2 The asking of this question in the design of units and lessons requires us to recognize our students' humanity, particularly as social and cultural beings who bring a wealth of experiences and understandings with them to the classroom - even if these differ culturally and qualitatively from our own. Though the anticipation of what our students will feel is inexact, we should make an effort to place ourselves in their skin and imagine their affect without rejecting their values or projecting our own onto them. Question Three: What are the targets for rigor? 3 How can students perform their rigorous understandings of a concept? When we consider the question, What are the targets for rigor? we are planning for those moments when students will demonstrate cognitive engagement to the point that they own the learning experience so profound that we, the teachers, are no longer in control - and that is, of course, a wonderful thing. We as teachers lose control whenever our students are leveraging their own assets and capital in building their own unique conceptual connections in their developing understandings. 1 Stembridge,Adeyemi Culturally Responsive Education In the Classroom: An Equity Framework for Pedagogy (p. 121-123) 2 Stembridge (p. 125-127) 3 Stembridge (p. 130-131) Planning with Equity in Mind from Culturally Responsive Education in the Classroom: An Equity Framework for Pedagogy by Dr. Adeyemi Stembridge Question Four: What are the indicators of engagement? 4 When we ask the question, What are the indicators of engagement? We are making predictions as to what engagement may look like in the learning experience, and we are prioritizing when and how we might yield some expectations for engagement in favor of others. We are essentially seeking the pathway to Flow - the perfect intersection of challenge and skill that will sustain students' self-driven investment in the learning. The key for teachers is to anticipate what those indicators for engagement might be so that we can authentically coach students along to even greater investment in the learning experience. Question Five: What are the opportunities to be responsive? 5 In considering the question, What are the opportunities to be responsive? We should focus on our most vulnerable learners. Here is where we are deliberate about how we will incorporate meaningful protective factors into the fabric of the learning experience. This question provides a rich opportunity to consider the ways in which my identity in the role of teacher as a cultural being may be limiting the expression of my students' competencies. We should be deliberate in our thinking about how we imagine our students to be capable and creative thinkers. Consider how you will confirm that your students are perceiving the experience as responsive. When planning, I like to predict specific moments when I can be positioned to listen and respond to my students' thinking… these moments of responsiveness support students in developing greater agency and a detailed sense of what they are feeling - which are the essential ingredients of emotional intelligence. It is a powerful thing for a student to give a learning experience their serious attention and have a teacher, the more experienced thinker, acknowledge, support, and validate that effort. 4 Stembridge (133-135) 5 (p. 120)
<urn:uuid:e382c35d-b918-46b1-915b-ced91da3282d>
CC-MAIN-2024-33
https://ospi.k12.wa.us/sites/default/files/2023-08/planning-equity-mind_stembridge-template-module-3.pdf
2024-08-07T12:03:24+00:00
crawl-data/CC-MAIN-2024-33/segments/1722640694449.36/warc/CC-MAIN-20240807111957-20240807141957-00489.warc.gz
342,203,687
820
eng_Latn
eng_Latn
0.997292
eng_Latn
0.997324
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 2099, 4169 ]
[ 2.1875 ]
1
0
Bridgelea Pupil Referral Unit Bridgelea Road Withington Manchester M20 3FB E-Safety and ICT Acceptable Use Policy Bridgelea Primary School Vision & Mission Statement Vision "Understanding People" Mission Statement "We work with people to build aspirations, connect, challenge, change and grow. We are an outstanding school and a proud founding member of the City of Manchester Learning Partnership." - We value SUCCESS. Children achieve academic as well as social and emotional growth. - We value CO-OPERATION. As a school we will endeavour to co-operate with the community to inspire and empower every individual. - We value SAFETY. We care for each other and keep each other safe. - We value COMMUNICATION. We believe that all behaviour is communication. - We value DEVELOPMENT. Learning is understood developmentally. - We value WELLBEING. We have a holistic approach to wellbeing across the school. - We value DIVERSITY. We celebrate each other as unique individuals with rights that we respect. UN Rights of the Child: Bridgelea 10 Articles Through the School Council the children decided they would like to focus on the following 10 Articles, whilst understanding no right is more important than another: Article 12 You have the right to give your opinion, and for adults to listen and take it seriously. Article 13 You have the right to find out things and share what you think with others, by talking, drawing, writing or in any other way unless it harms or offends other people. Article 15 You have the right to choose your own friends and join or set up groups, as long as it isn't harmful to others. Article 24 You have the right to the best health care possible, safe water to drink, nutritious food, a clean and safe environment, and information to help you stay well. Article 27 You have the right to food, clothing, a safe place to live and to have your basic needs met. You should not be disadvantaged so that you can't do many of the things other kids can do. Article 28 You have the right to a good quality education. You should be encouraged to go to school to the highest level you can. Article 29 Your education should help you use and develop your talents and abilities. It should also help you learn to live peacefully, protect the environment and respect other people. Article 30 You have the right to practice your own culture, language and religion - or any you choose. Minority and indigenous groups need special protection of this right. Article 31 You have the right to play and rest. Article 39 You have the right to help if you've been hurt, neglected or badly treated. The Six Principles Of Nurture The nurturing approach offers a range of opportunities for children and young people to engage with missing early nurturing experiences, giving them the social and emotional skills to do well at school and with peers, develop their resilience and their capacity to deal more confidently with the trials and tribulations of life, for life. 1. Children's learning is understood developmentally 2. The classroom offers a safe base 3. The importance of nurture for the development of wellbeing 4. Language is a vital means of communication 5. All behaviour is communication 6. The importance of transition in children's lives Rationale The requirement to ensure that children and young people are able to use the internet and related communications technologies appropriately and safety is addressed as part of the wider duty of care to which all who work in schools are bound. The use of these exciting and innovative tools in school and at home has been shown to raise educational standards and promote pupil and student achievement. However, the use of these new technologies can put young people at risk within and outside the school. Some of the dangers they may face include: - Access to illegal, harmful or inappropriate images or other content - The risk of being subject to grooming by those with whom they make contact on the internet - Un-authorised access to/loss or and sharing of personal information - The sharing/distribution of personal images without an individual's consent or knowledge - Cyber bullying - Inappropriate communication/contact with other, including strangers - Access to unsuitable video/internet games - The potential for excessive use which my impact on the social and emotional development and learning of the young person. Many of these risks reflect situations in the offline world and it is essential that this e-safety policy be used in conjunction with other policies. As with all other risks, it is impossible to eliminate those risks completely. It is therefore essential through good educational provision to build pupils' resilience to the risks to which they may be exposed to and that they have the confidence and skills to face and deal with these risks. Development The Scope of the Policy This policy applies to all members of Bridgelea Primary School (including staff, learners, volunteers, parents/carers, community users, visitors) who have access to and are users of ICT systems, both in and outside of Bridgelea. The Education and Inspections Act 2006 empowers Headteachers to such extent as is reasonable, to regulate the behaviour of students when they are off the school site and empowers members of staff to impose disciplinary penalties for inappropriate behaviour. This is pertinent to incidents of cyber-bullying or other e-safety incidents covered by this policy, which may take place outside of Bridgelea. The 2011 Education Act increased these powers with regard to the search for and of electronic devices and the deletion of data. In the case of both of these acts action can only be taken in relation to our current behaviour policy. This policy is to be read in conjunction with the Acceptable use of ICT Policy, Relationships Policy, Safeguarding Policy, PHSE guidance, RSE Policy and Anti-bullying Policy. The school will deal with such incidents within the policy and associated behaviour and antibullying policies and will, where known, inform parents/ carers of inappropriate e-safety behaviour that takes place out of school. Roles and responsibilities. Governors- Governors are responsible for the approval of the E safety policy and for reviewing its effectiveness. Headteacher and Senior Leadership Team - The Headteacher is responsible for ensuring the safety (including e-safety) of members of the school community- though the day-to-day responsibility of e-safety will be delegated to the DSL and Behaviour and Attitudes Lead of SLT. - The Headteacher is responsible for the implementation and effectiveness of this policy. He is responsible for reporting to the Governing Body on the effectiveness of the policy, and, if necessary, make any necessary recommendations of further improvement - The headteacher/senior leaders are responsible for ensuring that the ICT lead/DSL have adequate training to take out their roles. - The headteacher/Senior Leaders will ensure that there is a system in place to allow for monitoring and support of these in school who carry out the internal e-safety monitoring role. - If there is an allegation against a member of staff, the Headteacher should be aware of the procedures to follow. ICT Lead/DSL/AHT - Take day to day responsibility for e-safety and the responsibility for documents and policies - Report any breaches of policy to SLT - Ensure staff are aware of all procedures - Provide training and advice to staff - Log all reports of e-safety issues on CPOMs - Liaise with the LA where necessary - Are trained in and have shared with staff and awareness and understanding of e-safety issues and the potential for serious child protection issues that can arise from Sharing of Personal Data Access to illegal/inappropriate material Inappropriate online contact with adults/strangers Potential or actual incidents of grooming Cyber-bullying Sexting Revenge pornography Radicalisation (Extreme views) CSE Teaching and Support Staff Teaching and Support Staff are responsible for ensuring that- - They have an up-to date awareness of e-safety matters and of the current school e-safety policy and practices - They have read understood and signed the E-Safety policy and the Acceptable use of ICT policy and adhere to the guidance around communications detailed in the Acceptable use of ICT policy. - They report any suspected issue or problem to the ICT lead/DSL for investigation/action/sanction - Pupils understand and follow the school policies. - Pupils should be aware of how to deal with unsuitable material as detailed in the RSE and ICT curriculum Pupils - Pupils are responsible for using ICT systems in accordance with policy. This is included in the admissions process of Bridgelea - They need to understand the importance of reporting abuse/misuse or access to inappropriate materials and know how to do so. - Should understand that E-safety extends to out of school. Parents/Carer Parents and carers have a crucial role in ensuring that their children understand the need to use the internet and mobile devices in an appropriate way. Research suggests that many parents/carers do not fully understand the issues and are less experienced in the use of ICT than their children are. The school will therefore take every opportunity to help parent s to understand these issues through- - Parent/carer workshops - Drop in meetings with SLT if necessary around E-safety concerns - Letters and newsletters - Website Parents and carers should be aware that school has a responsibility to safeguard pupils. The misuse of non-school provided systems outside of school hours will not be investigated by the school. It remains the responsibility of parents and carers to ensure that they are adequately supervising their child and are positively promoting E-safety awareness within the home. Failure to do this could result in a safeguarding issue, which may need to reported to Children's Social Care or Greater Manchester Police. Parents are advised to monitor all online activities of their children using one of the following apps- - Ourpact - Go Bubble. Curriculum coverage- E-Safety is taught as part of a spiral curriculum, which permeates the curriculum offer. Discrete teaching takes place around E-Safety under RSE education and computing lessons. This is further enhanced by the use of assemblies, theme weeks and pastoral activities as part of our nurturing curriculum. Where there are specific concerns, intervention may be offered via our retreat team. Why is ICT systems access important? Technology offers unimaginable opportunities and is constantly evolving. Access is currently becoming universal and increasingly more mobile, and learners are using technology at an even earlier age. The use of these exciting and innovative tools in school and at home has been shown to raise educational standards and promote pupil achievement. ICT systems at Bridgelea increase the opportunities for learners to access a wide range of resources in support of the curriculum and learning. It supports the professional work of staff and enhances the school's management information and business administration practice. Access to Bridgelea's network and the internet is necessary for staff and learners. It is an entitlement for all learners as it helps them to develop a responsible and mature approach to accessing information. How will internet access within school be authorised? - Internet access is a necessary part of the statutory curriculum. It is an entitlement for learners based on responsible use - Parents will be informed during the admissions meeting that learners will be provided with monitored internet access - Parents will be asked to sign and return the consent form How will the risks be assessed? In common with other media such as magazines, books and video, some material available via the internet is unsuitable for learners. Bridgelea will supervise learners and take all reasonable precautions to limit users access and that users access only appropriate material. However, due to the international scale and linked nature of information available via the Internet, it is not possible to guarantee that unsuitable material will never appear on a terminal. If this does happen it should be reported to a member of the SLT immediately. - The use of computer systems without permission or for purposes not agreed by the school could constitute a criminal offence under the Computer Misuse Act 1990 - Methods to identify, assess and minimise risks will be reviewed regularly - Staff, parents, governors and advisers will work to establish agreement that every reasonable measure is being taken - The Head Teacher will ensure that the policy is implemented effectively. How will Bridgelea ensure internet/ICT access is safe for pupils and staff? (Infrastructure/equipment). - All users will be informed via this policy that Internet use will be monitored - School ICT systems will be managed through the managed service provider in ways that ensure that the schools meets the e-safety technical requirements for Manchester Council. This is provided by One Education. - One Education are the schools internet and ICT provider who are responsible for monitoring our Web filtering alongside the DSL, using Sophos web filtering systems. - Any failure of the filtering systems will be reported directly to the ICT technical team via admin staff at each site - Bridgelea will work in partnership with parents, the statutory authorities, the DFE and the Internet Service Provider to ensure systems to protect learners are reviewed and improved where necessary - If staff or learners discover unsuitable sites, the URL (address) and content will be reported to the ICT technical team via admin staff at each site - Any material that Bridgelea suspects is illegal will be referred to the appropriate authorities - Servers, wireless systems and cabling must be securely located and physical access restricted (server room). - All users will have clearly defined access rights to school ICT systems. - Staff will be made responsible for their username and password, must not allow other users to access the systems using their log on details, and must immediately report any suspicion or evidence that there has been a breach. - Remote management tools are used by the managed service provider to control workstations and view user's activity and there is additional protection against viruses. - Appropriate service measures are in place provided by the service provider to protect the servers, firewalls, routers, wireless systems etc. from accidental or malicious attempts that might threaten the security of the schools systems and data. - Personal data is sent via Egress secure and all personal information is handled in compliance with the GDPR policy How will e-mail be managed? - Communications with persons and organisations will be managed to ensure appropriate educational use and that the good name of Bridgelea is maintained - Any digital communication between staff and parents/ carers must be professional in tone and content and be via official school email - Users need to aware the email communications may be monitored - Users must immediately report to the SLT, in accordance with the school policy, the receipt of any email that makes them feel uncomfortable, is offensive, threatening or bullying in nature and must not respond to any such email How will publishing on the Web be managed? - The Headteacher will delegate editorial responsibility to a members of the SLT to ensure that content is accurate and quality of presentation is maintained - The point of contact on the website will be the school admin email address and telephone number. Home information or individual e-mail identities will not be published - Photographs published on the Web will not have full names attached and anonymity will be protected where necessary as stipulated in admissions paperwork and permissions. - The above rules apply for publication on the school Twitter handle, which is managed by a member of SLT. The use of digital photographs and video The development of digital imaging technologies has created significant benefits to learning, allowing staff and pupils instant use of images that they have recorded themselves or downloaded from the internet. However staff and pupils need to be aware of the risks associated with sharing images and with posting digital images on the internet. Those images may remain available on the internet forever and may cause harm or embarrassment to individuals in the short or longer term. The school will inform and educate users about these risks and will implement policies to reduce the likelihood for potential for harm: - Staff are allowed to take digital/ video images to support educational aims but must follow school policies concerning the storing, sharing distribution and publication of these images. These images should only be taken on school equipment. The personal equipment of staff should not be used for such purposes - Care should be taken when taking digital/ video images that pupils are appropriately dressed and they are not participating in activities that might bring individuals or the school into disrepute - Pupils must not take, share, use, publish or distribute images of others without their permission - Pupils full names will not be used anywhere on a website or blog, particularly in association with photographs - Photographs published on the website or elsewhere, that include pupils, will be selected carefully and will comply with good practice guidance on the use of such images - Written permission from parents/ carers will be obtained before photographs of pupils are published on the school website or newsletter - Staff should refer to the Staff Handbook and code of conduct for guidance around social media and pupils. How will staff and learners be informed of the policy? - All staff will be provided with the E- safety and ICT Acceptable Use policy, and its importance will be explained. The policy will be made available to parents on request. - E-Safety will be a key focus in all areas of the curriculum and staff will reinforce e- safety messages across the curriculum through assemblies and nurture breakfast and lunchtimes. Monitoring The Headteacher and SLT will monitor the impact of the policy using: - Pupils, parent/ carer, governor and staff feedback - Internet monitoring by class teams on a regular basis - Iris and CPOMs logs of reported incidents Appendices 1. Responsible Internet Use Statement for pupils, staff and visitors and guidance for students on cyberbullying 2. Rules for pupils to be displayed in classrooms and next to all computers 3. Letters to parents on Responsible Internet Use 4. Consent Form Responsible Internet Use Rules for Staff, Visitors and pupils - The computer system is owned by the school. This Responsible Internet Use Statement helps to protect pupils, staff and the school by clearly stating what use of the computer resources is acceptable and what is not - Irresponsible use may result in the loss of internet access and could lead to disciplinary proceedings for staff - Network access must be made via the user's authorized account and password, which must not be given to any other person - School computer internet use must be appropriate to the pupils development and curriculum content or to the staff professional activity - The use of chat rooms is not permitted - Copyright and intellectual property must be respected - Email should be written carefully and politely, particularly as messages may be forwarded or printed and be seen by unexpected readers - Users are responsible for emails sent and contacts made - The ICT systems may only be used for private purposes during staff break time and in designated spaces. - The school my exercise its right to monitor the use of the school's computer systems, including access to websites, the interception of email and the deletion of inappropriate materials where it believes unauthorized use of the school's computer system is or may be taking place, or the system is or may be being used for criminal purposes or for storing unauthorized or unlawful text, imagery or sound. Cyberbullying guidance for pupils If you believe you or someone else is the victim of cyberbullying you must speak to an adult as soon as possible. - Do not answer abusive messages and report them to an adult - Do not give out any of your personal IT details - Do not delete anything until it has been shown to an adult (even if it is upsetting) - Do not reply to abusive emails - Never reply to someone you do not know Bridgelea Pupil Referral Unit Rules for responsible computer and internet use The school has installed computers and internet access to help your learning. These rules will keep everyone safe and help us to be fair to others. - I will not log in as another person or access other people's files - I will not bring in USBs or CD ROMs from outside school unless I have been given permission - I will use the internet only when a member of staff is present - I will only use the printer with permission - I will not enter chat rooms - I will only email people I know or a member of staff has approved - My messages will be polite and responsible - I will not give out my home address or telephone number or arrange to meet anyone - I will report any message or websites that make me feel uncomfortable - I understand that school may check my computer files and may monitor the internet sites I visit Dear parents/ carers Responsible Internet Use As part of your child's curriculum and the development of ICT skills, Bridgelea Pupil Referral Unit is providing supervised access to the internet. We believe that the effective use of the World Wide Web and email is worthwhile and is an essential skill for children as they grow up in the modern world. Please read the attached Rules for Responsible Internet Use and sign and return the consent form so that your child may use the internet at school. We have provided you with a copy of the 'E-Safety and Acceptable Use Policy '. If you wish to discuss this with a member of staff please contact school. Although there are concerns about students potentially having access to undesirable materials, we have taken positive steps to reduce this risk in school. Bridgelea Pupil Referral Unit operates a filtering system that restricts access to inappropriate materials. Whilst every endeavor is made to ensure that suitable restrictions are placed on the ability of children to access inappropriate materials, and pupils will not be left unsupervised, the school cannot be held responsible for the nature or content of materials accessed through the Internet. Please support us by ensuring that internet usage at home is supervised and reinforce the rules of appropriate and safe use. Yours sincerely Phil Hoyland Headteacher Consent Form Bridgelea Pupil Referral Unit Responsible Internet Use Please complete, sign and return to the office Pupil name: Pupil's Agreement I have read and I understand the school Rules for Responsible Computer Use. I will use the computer system and Internet in a responsible way and follow these rules at all times. Signed: Parent's Consent for Internet Access I have read and understood the school rules for responsible Internet use and give permission for my son / daughter to access the Internet. I understand that the school will take all reasonable precautions to ensure pupils cannot access inappropriate materials. I will monitor my sons/daughters internet usage at home. Signed: Date: Please print name:
<urn:uuid:92fd67b2-2ce6-41d7-a547-8aa4dc0db999>
CC-MAIN-2024-33
https://www.bridgelea.manchester.sch.uk/serve_file/4442655
2024-08-07T11:31:43+00:00
crawl-data/CC-MAIN-2024-33/segments/1722640694449.36/warc/CC-MAIN-20240807111957-20240807141957-00488.warc.gz
539,072,944
4,729
eng_Latn
eng_Latn
0.935934
eng_Latn
0.998269
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 114, 3284, 5539, 7770, 9540, 10591, 14160, 17169, 18922, 20804, 21704, 23085, 23817 ]
[ 2.984375, 1.8046875 ]
1
0
Noroviruses (Norwalk-like Viruses) December 2014 | Page 1 of 2 What are Norwalk-like Viruses? Norwalk virus, Norwalk-like viruses (NLV) or noroviruses are a group of viruses (germs) that cause diarrheal illnesses. These viruses are named after the original strain that caused an outbreak in Norwalk, Ohio. They are also sometimes referred to as small, round-structured viruses (SRSV) or caliciviruses. What are the symptoms of NLV infection? The symptoms of NLV infection include nausea, vomiting, diarrhea, and abdominal cramps. Other symptoms can include headache, fever, and chills, and muscle aches. These symptoms usually begin 1-2 days after exposure to the virus and will last about 1-2 days in most people, with no long-term effects. How are NLV spread? NLV must be swallowed to cause infection. NLV are then passed in the stool and vomit of infected people from the day they start to feel ill up to as long as 2-3 weeks after they feel better. NLV are usually spread by eating or drinking contaminated food or drinks or by close contact with an infected person. Foods can become contaminated by infected foodworkers. Some foods, like oysters and berries, can be contaminated with NLV before being delivered to a restaurant or store if they come in contact with contaminated water. How common is NLV in Massachusetts? NLV are believed to be one of the most common causes of foodborne illness in the United States. Since it is difficult to test for NLV in the laboratory; it is hard to say how many people get infected by NLV in Massachusetts. Who gets NLV infection? Anyone can get infected with NLV but older children and adults are more likely to get more severe symptoms. Also, since there are many strains of these viruses, people can get sick from them many times during their life. How is NLV infection diagnosed? NLV is difficult to detect in a laboratory, but it can be found by testing stool or vomit from an infected person. Only a few laboratories are able to perform this test so it is only done under special circumstances. Usually, health care providers will first try to rule out other germs that may have caused the illness, then base their diagnosis on symptoms and how long they last. What is the treatment for NLV infection? There is no specific treatment for NLV infection. NLV cannot be treated with antibiotics and people usually get better without medical attention in 1-2 days. There is a risk for dehydration due to vomiting and diarrhea so it is important to drink plenty of fluids. If symptoms persist or worsen, contact your health care provider. What can you do to prevent NLV infection? Follow the tips below; if you make them your habits, you can prevent infection by NLV – as well as other diseases: - Always wash your hands thoroughly with soap and warm water before eating or preparing food, after using the toilet, and after changing diapers. - Make sure all food preparation areas are clean before use. - Cook your food completely. Wash all fruits and vegetables. - When traveling to an area that might have contaminated water, drink bottled, preferably carbonated, beverages and do not use ice. - After episodes of vomiting or diarrhea, clean contaminated surfaces immediately with a bleach-based household cleaner. - If you are taking care of someone who has vomited or who has diarrhea, wash your hands with plenty of soap and warm water after cleaning the bathroom, helping the person use the toilet, or changing diapers, soiled clothes or soiled sheets. - If you or your child has persistent diarrhea (with or without a fever), or the diarrhea is very bad, call your health care provider for advice. Are there any restrictions for people with NLV? Yes. Because NLV can easily be spread to other people, health care providers are required by law to report cases of NLV to the local board of health. In order to protect the public, workers at food-related businesses who have NLV must stay out of work for 72 hours after their symptoms have stopped. In NLV outbreaks at food-related businesses, food handling employees will be required to provide stool specimens for testing. This law also applies to workers in schools, residential programs, day-care and health care facilities who feed, give mouth care or dispense medications to clients or patients. For more information contact: - Your local board of health (listed in the telephone directory under "Government") - Massachusetts Department of Public Health: Division of Epidemiology and Immunization (617) 983-6800 or toll-free at (888) 658-2850 or on the MDPH website at http://www.mass.gov/dph, or Division of Food & Drugs (617) 983-6700 - Your health care provider
<urn:uuid:39c0390f-fed6-4ec7-b888-6a1e2b1b42c9>
CC-MAIN-2024-33
https://archives.lib.state.ma.us/server/api/core/bitstreams/1b65473e-f9f7-41ff-89c9-1a9c71d0dc99/content
2024-08-07T13:25:14+00:00
crawl-data/CC-MAIN-2024-33/segments/1722640694449.36/warc/CC-MAIN-20240807111957-20240807141957-00496.warc.gz
81,359,218
1,001
eng_Latn
eng_Latn
0.998955
eng_Latn
0.999291
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 2597, 4690 ]
[ 3.265625 ]
3
0
Family Preparedness Plan Concept Outline Step One- Family Defining for whom you will be responsible in emergencies is the first step in developing the family emergency plan. Consider those who live in the same residence, as well as extended family members nearby, in care homes and any individuals who are likely to call on you in times of chaos. As well, take note of any special needs they have, mobility restrictions, access to medical devices, allergies and any information that would inform how you intend to care for them during the emergency. In addition, consider all your pets and those who will shelter with you. Step Two – Shelter in Place Plan The recommended option is to shelter at home, where your possessions are and where you feel safe. To prepare the residence to support the family you defined above, we recommend you consider being capable of providing for basic needs over a timeline, from a minimum of 3 days to the recommended level of 14 days, without access to power or utilities. When considering your requirements, reflect that there is no guarantee that a public shelter will be available to feed, water and house you after the initial 72hrs, hence the recommended extended timeline. These basic requirements are food, water, health and safety. Of note, food and water are a system, it includes the storage, preparation, consumption, cleaning and disposal of the product and all the tools necessary. Your home already likely has everything other than an alternate method of heating food when utilities are disrupted. It is possible that the family will be separated when the emergency occurs, thus having a communications plan through texting or social media group chats will enable the exchange of information. The plan should encourage all family members to return to the home at an emergency's onset, even if communication is absent, barring an evacuation order. If applicable, you should become familiar with the school, care home, employer and local municipal emergency plans. This will inform you on how they intend to handle an event. For example, what is your school going to do when an evacuation order is issued? Will you be required to retrieve your children, or will they be transported to a separate location? Before an emergency, determine trusted sources of information on which you will rely for guidance and instruction. The primary source is your municipal emergency services. Ask how they will communicate with you – website, social media and radio. Knowing these in advance and having links or radio pre-sets will ensure clear communications in a crisis. Step Three – Evacuation Plan In the unlikely event you need to evacuate your residence in an emergency, having a well understood and rehearsed plan is key to success. When everyone knows their role, stress and anxiety levels are lower, leading to clearer decision making and less likely that important details and elements will be forgotten. The key elements of an evacuation plan are a known destination, primary and alternate routes and a packing list. A public shelter or hotel is an option, but not a recommended place for privacy, beginning the work of rebuilding your life or navigating the crisis. A family or friend's home out of the danger zone is the recommended evacuation destination. Checklists Having defined for whom you are responsible and their needs, here is the checklist for sheltering in place, as your household already has appropriate clothing, bedding, entertainment, hygiene and other normal support products: 1. Food – up to 14 days for family and pets with alternate cooking equipment & fuel 3. First Aid – Kit and standard training complete 2. Water – 4 litres per person per day with purification system (tablets or filter) 4. Communication – radio, cell phones, power banks, IT data backup drive 5. Safety – lighting, fire extinguisher With an evacuation plan prepared, here is the checklist for evacuation: 1. Paper maps for your primary and alternate routes to your preplanned destination 3. Skill and equipment to repair and change a flat tire 2. Full fuel tank, a normal preparedness behavior is to keep it at a half, minimum. 4. Skill and equipment to independently boost your car battery 6. Portable sanitation system 5. Transportation of the shelter-in-place items 7. Your Go Bag. Go Bag – or evacuation kit: 1. All primary documents – passport, birth certificates, SIN cards, health cards, wills 3. Items that you deem priceless – this list is created in advance of an emergency. 2. Insurance contact information and documentation – for car, household and life. 4. Suitable and comfortable seasonal clothing for everyone Preparedness is the totality of what you do in times of peace and calm to facilitate the navigation of a chaotic situation and to return to normalcy with the least disruption possible. This information is a guide to spur discussion and the creation of a family preparedness plan, written by you and for your family.
<urn:uuid:2f84a819-bedf-41f1-95d9-cfcdde140dae>
CC-MAIN-2024-33
https://img1.wsimg.com/blobby/go/ae6ce55c-1198-47ed-a901-81894cd1b356/downloads/Family%20Preparedness%20Plan%20Handout.pdf?ver=1722353817344
2024-08-07T11:33:12+00:00
crawl-data/CC-MAIN-2024-33/segments/1722640694449.36/warc/CC-MAIN-20240807111957-20240807141957-00493.warc.gz
243,869,679
977
eng_Latn
eng_Latn
0.998595
eng_Latn
0.998752
[ "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1898, 3881, 4995 ]
[ 2.796875 ]
1
6
AQUATIC STUDIES REVIEW OUTDOOR LAB TEACHER'S GUIDE Learning Goal: Learners will review previous key points from fall modules, including water quality, critical habitat, and aquatic plant identification. Objectives: * Identify critical habitat designation of selected area and what species it benefits. * Sample lake water and obtain data on temperature, pH, and dissolved oxygen levels. * Sample and identify aquatic plants at the field site. Safety Considerations: * Emergency boat/pontoon in area to monitor students and prevent major mishaps. * Students should have already had some canoeing experience with previous activities – review. * All canoes and students visible to shoreline/emergency boat/pontoon/instructor at all times. * Life jackets should be worn at all times. Setup: o labeled buoys for each station * Required equipment is located with Module leaders and includes: o Critical Habitat: critical habitat laminated guides and Aquascopes o Water Quality: dissolved oxygen testing kit, thermometer, pH strips, container to sample water o Aquatic Plants: identification books, rakes, and buckets to sample plants * During this session, half of the class is involved in the aquatic studies review while half are participating in the food web lab. There is a separate timeline document provided for each of these concurrent sessions to break down their individual timing. Split student canoe pairs into three groups: A, B, C. These groups will be rotating through the three sections of the aquatic studies review (critical habitat, water quality, and aquatic plant identification). * Timekeeper/director is essential for successfully coordinating the aquatic studies review. * High school helpers - high school helpers should be paired with professionals in a boat at each of the three stations and based on shore to help launch the canoes. * All volunteers (7 minimum) should be anchored at their site locations. In initial setup, select locations that are spaced near each other to reduce travel time and ensure proximity to safety boats. * Logistical orientation should be done in the morning before students arrive. * Student pairs will canoe to each of the stations. 1. Give students an orientation. * Go over safety instructions (reference student safe conduct agreement). Students are directed to keep properly fitting life preservers on at all times. * Introduce the instructors who will be guiding students through the aquatic studies review. * Pictures – remind students to take pictures at each of the stations. 2. Give logistical directions to students. * Student group assignments – tell students which group they're in and where they start. * The timekeeper will ring two bells – a 5-minute warning bell before they need to rotate and a second bell at the start of the next rotation. * Rotation directions – explain how groups will rotate through the three modules. * When the first bell is rung, wrap-up your session – discuss key concepts (if you have additional time connect your topic to a broader lake ecology context), score, and initial their module's section of the lab packet. Make sure to direct students to the next module site. * Remind students that an airhorn will be blown at the end of the session to signify that they should move to the next activity – after the third rotation, students should either switch to the food web session or take their completed lab books and cameras to the designated table before going to the beach for the canoe race. 3. Have students depart in their canoes – high school helpers should assist. The timekeeper should direct students to their assigned aquatic site. Instructors should be prepared and in place at their aquatic module site. Water Quality The module leader and a high school helper should be stationed with the equipment on a pontoon boat. Students will canoe to the site for testing. The high school helper should stabilize the canoe while students conduct the pH, dissolved oxygen, and temperature testing. Remind students to take pictures to document the testing process and the results. Critical Habitat Leaders should have the laminated DNR CH designation sheets and Aquascopes ready for students to use. Module leader and a high school helper should be anchored with the equipment at the critical habitat site. They should have students observe the habitat at the site and lead a discussion about what species the critical habitat benefits. As time allows, extend the discussion to include connections to other critical habitats and species role in the food web. Remind students to take pictures of the site, this could include underwater pictures. Aquatic Plants Module leader and a high school helper should be anchored at a site (predetermined) with aquatic plants. They should have rakes that are suitable to student sampling (students in canoes should use shorter plastic rakes) and buckets in their canoe for the students to use. If possible, an additional aquatic plant expert should be located on shore with a table and identification books. Students should use a rake to collect samples, put them in the bucket, and return to shore to identify. Remind students to take pictures to document the aquatic plants and sampling process. Post-Aquatic Studies Review After both sessions of aquatic studies review have been completed, all instructors and volunteers should consult the schedule to see if they are assigned to assist with signing and collecting student lab books or the setup and running of the canoe race. At this time, canoes and safety boats should be set up for the canoe relay race.
<urn:uuid:e7148e22-76ed-410a-b914-8f9d2dffbcaf>
CC-MAIN-2024-33
https://friendsofeauclairelakesarea.com/wp-content/uploads/2022/10/1-Aquatic-Studies-Review-Outdoor-Lab-Teacher-Guide-2022.pdf
2024-08-07T11:42:30+00:00
crawl-data/CC-MAIN-2024-33/segments/1722640694449.36/warc/CC-MAIN-20240807111957-20240807141957-00497.warc.gz
212,969,293
1,082
eng_Latn
eng_Latn
0.997562
eng_Latn
0.998443
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 2548, 5620 ]
[ 3.59375 ]
1
1
Syllabus and Expectations Revised 7/18/17 Dr. Glogowski – email@example.com http://herget.discoverthought.com 630-301-5794 CLASS RULES: 1. Respect self, others and their property. Treat others, as you want to be treated. 2. Follow directions, be prepared to work. CLASS OBJECTIVES: General Units of Study: Students will learn the basic language of music through exploration of the four elements: Rhythm, Melody, Harmony, Tone Color, and Music History. A week or two will be spent on each element. Students will use voices to sing, play instruments, and create music during class time. Participation is required for all activities. Students will also practice writing music through completing worksheets during class time. Materials / Assessments: On most days NO materials will be need, however on occasion a pencil or pen will be required and the teacher will give adequate notice (the day before). Students will be responsible for turning in all worksheets and participating consistently in all activities and class discussions. (See attached rubrics) Goals: By the end of the course, the student will be able to read basic music notation, sightread a simple melodic line of music, sing with others in harmony, and improvise to basic chord progressions. The student will also be able to understand simple meter and be able to read and perform simple rhythmic phrases by clapping or by using instruments. GRADING: * Daily Participation (singing and playing instruments) 80% (Informal and formal classroom observation) * Worksheets, in class work, and assessments 20% (Written tests, individual, and group song project) Class format: First half of each class period - learn / review concepts. Second half of each class period – use / practice concepts with use of instruments and singing. Poor Behavior and Consequences: Positive behavior and participation is required! Students are graded daily by using the 2 attached rubrics (Singing and Intention). 7 th Grade Music Course Map Priority Learning Targets, National Music Standards, and General Skills Developed: Rhythmic Theory - Students identify and define standard notation symbols for pitch, rhythm, dynamics, tempo, articulation, and expression. * Identify durations of note and rest values: whole, half, quarter, eighth in simple meters (2/4, 3/4, 4/4). * Identify and perform dotted rhythms (dotted half and dotted quarter). * Identify the components of a time signature (simple). * Perform rhythms (including syncopation and triplets) in simple meters (2/4, 3/4, 4/4) using whole, half, quarter, and eighth notes and rests. * Identify the number of beats per measure in a musical example (two or three beats per measure). * Notate simple rhythmic patterns. Melodic Theory - Sing or play melodies accurately and expressively from a written score in at least one clef. * Identify letter names on the grand staff including one ledger line above and below. * Identify solfeggio syllables in C major on the grand staff. * Notate melodies on a staff. * Identify steps and skips on the staff. Singing - Students sing accurately and with good breath control throughout their singing ranges, alone and in small and large ensembles. * Sing a major scale using solfeggio. * Demonstrate musical independence through the performance of a vocal line sung with one or more parts. * Demonstrate proper technique, physical involvement, focus, and discipline. * Demonstrate various timbres through singing (head voice, chest voice, belting, etc.). Music History and Culture - Students describe distinguishing characteristics of representative music genres and styles from a variety of cultures. * Understand the progression of the musical historical periods. o Classical (1750-1825) (Mozart, Haydn, Beethoven) o Baroque (1600-1750) (Bach, Handel, Vivaldi) o Romantic (1825-1900) (Berlioz, Mahler, Brahms) o Modern (1900-now) (Prokofiev, Gershwin) * Identify aural cues specific to each historical period. General activities to cover and develop the above: Playing sticks and drums, singing and playing melody and harmony, composing and performing a group song using xylophones, bells, and glockenspiels.
<urn:uuid:93262abc-7d9e-48d9-bb01-5eced2fd49a6>
CC-MAIN-2019-09
http://herget.discoverthought.com/wp-content/uploads/2017/07/EXPECTATIONS7thG2017.pdf
2019-02-21T12:55:39Z
crawl-data/CC-MAIN-2019-09/segments/1550247504594.59/warc/CC-MAIN-20190221111943-20190221133943-00599.warc.gz
116,699,920
914
eng_Latn
eng_Latn
0.991607
eng_Latn
0.99378
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 1967, 4171 ]
[ 4.125 ]
1
1
JOURNAL OF APPLIED CASE RESEARCH JACR Volume 7, Number 2, 2008 Table of Contents Editors and Reviewers The Journal appreciates the time and commitment of all those who generously give their time in reviewing and editing manuscripts. The following are those who have assisted in this volume. Reviewer names are forthcoming. PREVIOUS EDITORS OF JACR Carl Ruthstrom, University of Houston-Downtown Dan Jennings, Texas A&M University Leslie Toombs, University of Texas at San Antonio Alex Sharland, Barry University Notes To Authors Thank you for considering the Journal of Applied Case Research as an outlet for your work. We would be very pleased to review your manuscript. Please review our guidelines for submission found on the website at www.swcrahome.org. Letter is forthcoming. Letter From The Editor Teaching Case Journal of Applied Case Research Sponsored by the Southwest Case Research Association ______________________________ LIONEL SMITH LTD. Robert L. Smalley Augusta State University Donald P. Howard Augusta State University Nabil A. Ibrahim Augusta State University LIONEL SMITH LTD. INTRODUCTION Lionel Smith Ltd. (LSL) is a family owned small business specializing in fine men's clothing. It is known throughout the Central Savannah River Area (CSRA), which includes Augusta, Georgia and Aiken, South Carolina, for its exceptional service, quality merchandise, and attention to detail. The past success of the organization has been due to the expertise of Mr. Lionel Smith and his high-quality long-term employees. LSL was started in February, 1976. It was opened as a partnership between Mr. Smith and John Lucas, a family friend, on Laurens Street in Aiken, South Carolina. Mr. Smith had worked for sixteen years in the retail clothing business. He gained this experience by working in stores such as Belk's Department Store, Manning Owens Incorporated, and LeGrande's of Aiken, South Carolina. After two years, the partnership was dissolved, Mr. Smith became the sole owner, and LSL was established as a sub-chapter S corporation. This began a period of growth for the company. Between the years of 1979 and 1983, four additional locations were opened. They were located in Aiken and Edgefield, South Carolina, and Augusta, and Savannah, Georgia. By the end of 1983, all four of those locations were closed. Mr. Lionel Smith stated the closings were due to several major factors. They include his inability to hire and retain professionally qualified supervisors and employees, the desire to focus his efforts on establishing an outside sales force, and high interest rates and an unstable economy. In 1982, the main location moved to the other side of Laurens Street in Aiken. The move to the new location was made possible because Lionel Smith was able to purchase the building. This has been the company's only location since 1983. With only one location, its staff and inventory are not divided between two or more venues, and rent, utilities, and other operating costs are lower. The company underwent another major change when it was purchased by Mr. Smith's son, Van, in 1992. THE EXTERNAL ENVIRONMENT Even though the retail sector is a highly competitive industry, there are no other stores selling fine men's clothing in Aiken, South Carolina. The Boardroom in Augusta, Georgia, Granger Owens in Columbia, South Carolina, and several department stores in Augusta, Georgia and Columbia, South Carolina are competitors. It is approximately 20 miles from Aiken to Augusta and approximately 60 miles from Aiken to Columbia. If a very well capitalized business with an experienced staff, strong customer service, higherend merchandise of the type carried by Lionel Smith Ltd., and good location came to the area, it could pose a serious a threat to LSL. There are some major industries in the CSRA, with Augusta as its core, with health care being the largest one. Several major hospitals are in the area as well as an university and Georgia's only public medical school. The 10 largest manufacturing plants have 6,725 employees. Table 1 Two Maps Showing the Location of Lionel Smith Ltd. The first map below shows the location of LSL at 132 Laurens Street in Aiken. The second map below shows the locations of Aiken, SC, Augusta, GA, Columbia, SC, and other smaller towns in the area. There are some major industries in the CSRA, with Augusta as its core, with health care being the largest one. Several major hospitals are in the area as well as an university and Georgia's only public medical school. According to information on the Augusta Metro The Fort Gordon Army facility and Savannah River Site have been two of the largest employers in the CSRA for many years. Fort Gordon is the headquarters for the United States Army Signal Center, but they also have military intelligence, ordnance, hospital, and band units on the base as well. Fortunately, Fort Gordon, the area's largest employer with 17,400 military and civilian employees, was not affected by the latest announced closings of military installations. The Savannah River Site (SRS) was constructed during the 1950's to produce the basic materials used in the fabrication of nuclear weapons, primarily tritium and plutonium239. Five reactors were built on the site. The reactors produced nuclear materials by irradiating materials with neutrons. Also built were support facilities including two chemical separations plants, a water extraction plant, a nuclear fuel and target fabrication facility, and waste management facilities. SRS has been downsizing for the past fifteen years from approximately 22,700 employees to approximately 9,700 employees. Many of these employees are engineers in the middle- and upper-income categories, who purchase fine men's clothing. Additional layoffs could have a huge "ripple effect" throughout the area's economy. The Industry Apparel retailing, in general, is a tough, highly competitive business. The men's fashion apparel category is especially challenging. Many well known chains and independents have experienced the ups and downs of the industry. Efforts to control inventory (quantity and delivery timing) head the list of challenges being addressed through technology. Pricing of products by the major discounters continue to hold margins below historical levels. In every industry, there are key success factors for survival. Location is important; a retailer can either be a tenant in a mall or shopping center or choose a stand-alone location. Compared to the former, a stand-alone location is often less costly, thus allowing the owners to have a larger store. Another key success factor is the ability of the retailer to accept different forms of payment. The vast majority of retailers accept payment in cash, credit cards, and checks. A retailer must decide whether to accept credit cards, for the additional "open-to-buy" opportunity, or to cut costs by refusing to accept them. Unlike retailers of essential goods such as food or drugs, the purchase of clothing items is not essential to most consumers in periods of economic downturn. Higher priced department and fashion apparel stores are especially vulnerable. Clothing and clothing accessory industry financial ratios are shown in Table 6, and the ratios are included in the analyses in question 10 of the instructor's manual. Discount stores and superstores have become highly concentrated and now hold more than ninety-five percent of the men's shoe and apparel market. Efficiencies of scale in purchasing, distribution, and advertising are important success factors in large 4 companies, while small companies compete effectively through brand offerings and different types of merchandise. Supply chain management is important in supplier relationships, product distribution, and inventory management. Long-term relationships with a few suppliers can provide a retailer with a competitive advantage. Computer systems and technology affect supply chain management and are important key success factors. For example, a point-of-sale system will keep track of inventory outflow, including information on each item sold and the number sold. Additional success factors include determining the proper mix of part-time and full-time employees. Employee turnover, wage rates, and benefits are important decisions in retaining employees. Finally, customer service, knowledge of the products, and insights into style changes and other trends, are important ways to achieve success. THE INTERNAL ENVIRONMENT Structure LSL has a simple structure with five full-time and seven to ten part-time employees, depending on the season, and Van Smith. Employees are generalists that are hired to take on many tasks with jobs interchanging daily. The company has a "hands-on" culture. As the owner/manager, Mr. Smith is frequently seen "working on the floor" with his sales staff. Table 2 below shows the company's organizational chart. Table 2 Organizational Chart Shareholder & President Lionel (Van) Smith, Jr. President Emeritus Lionel Smith Full-time Salespersons Kraig Holdman Danny Minilfo Ken Akin Office Manager Gwen Williams Part-time Salespersons 3 to 5 seasonal Part-time Alterations and Shipping Persons 4 to 5 seasonal As the sole owner, Van Smith's major concern is the financial performance of the company. He also engages in activities that enhance the firm's public image, such as supplying tuxedos for photos of the golf team for the University of South Carolina – Aiken. He has been involved in several socially responsible activities in the community, such as donating merchandise and gift certificates to events raising funds for charities. These contributions were acknowledged in the events' program brochures. In addition, several LSL employees are active in community clubs, such as Rotary International. The staff also participates in the decision making processes. When he does consider implementing changes to the store, he is likely to use his father or employees as a sounding board. There is a strong "survivor" instinct present within this operation that will make it competitive for future generations. This involvement, coupled with a generous remuneration and benefits package, encourages very low turnover in personnel. This adds substantially to the stability of the business. However, Mr. Smith points out that since LSL is a privately held company, it is his responsibility to make all final decisions. This makes for quick turnaround and timely decision making. Mr. Smith feels there is no need for outside board members. He knows that board meetings would have to be held on a scheduled basis if the company had outside directors. In addition to part-time salespersons, the company also has part-time employees with duties of in-house alterations and shipping. Van Smith feels that a strong advantage of having alterations performed internally is that the staff within this department is familiar with most of the customers and is aware of special needs and requests. Shipping is especially important for out-of-area customers who often shop when making business or pleasure trips into the area. Mission The company's mission statement is short and simple. It states: "Lionel Smith Ltd. will consistently deliver the finest apparel, most current wardrobing expertise, and exceptional service in a friendly and unpretentious atmosphere." Lionel Smith Ltd. has made it a part of its competitive strategy to always have higher quality merchandise and a quicker response to trends than its competitors. Van Smith, the current owner and manager, describes his implementation of this trend management process by competitively shopping his competitors. He frequently walks the men's section of large department stores such as Macy's, Dillard's, or J.C. Penney to determine when trends have become too stale for his store's most current image. He explains that he strives to be at least one clothing trend ahead of his department store competitors who must appeal to a broader market and have a slower response time to shifts in fashion. He is proud that the company's quality image is further backed by extreme attention to detail and the needs of the customer, as well as a return policy, which is based more on common sense than hard rules as described in the section titled "Policies" later in the paper. All customers who enter the store are greeted immediately by an employee. The atmosphere is friendly, relaxed, and professional. However, the need to refurbish the selling area is quite evident. The building is viewed by Mr. Smith only as a display area for the clothing which plays the starring role. On the other hand, some employees feel that new carpeting, improved shelving, and a few more embellishments could enhance the presentation of the clothing. Objectives According to Van Smith, Lionel Smith Ltd. has developed the following objectives: - Begin upgrading the product mix to achieve $2 million per year in sales without increasing inventory volume - Create a formal staff education program regarding fashion trends and apparel retailing basics - Increase and refine knowledge of customer needs, tastes, and preferences - Create a plan for maintaining/improving outside sales Mr. Smith, however, would like to evaluate his current objectives and consider redeveloping them into both long-term and short-term objectives. He realizes that only one of the objectives he has developed is measurable. Although they provide some motivating power, these objectives, in most cases, are so vague that there is no feeling of urgency to make them a reality. Mr. Smith is the father of triplets and is deeply involved in managing his company's dayto-day activities. While he has little time to engage in long-term issues, he would like to develop a number of long-term objectives. Van Smith, however, admits that "right now" he has more pressing responsibilities that demand his attention and time. He bemoans the fact that carrying this out "will have to wait a little longer." Furthermore, he acknowledges that his wife and family are a major influence on his goals. He feels that he and his wife should jointly make some decisions about their long-term goals for the organization and make a commitment to follow them. After that, he believes that the short-term objectives will follow with ease. The long-term objectives would relate to profitability, productivity, competitive position, employee development, employee relations, technological leadership, and public responsibility. He feels that once long-term goals are produced, he will focus on developing those that focus on the short-term. These would serve to guide his staff on a daily basis. These objectives need to be very specific as to what needs to be done. They need to give a clear time frame for completion and identify who would be responsible for accomplishing each of them. They must be measurable, prioritized, and linked to longterm objectives. As a result, they would give the employees a better understanding of their role in accomplishing the firm's mission, thus increasing their feeling of self-worth and actual value to the firm. Finally, these short-term objectives should provide a basis for control and evaluation, and help managers monitor their progress. Policies Mr. Smith realizes that to achieve success in today's marketplace, speed is critical in allowing decisions to be made in even the lowest levels of an organization. He believes that in a small business such as LSL, policies help guide the decisions and actions of employees. Their purpose is to standardize routine decisions and empower subordinates in implementing the business strategies. One such policy addresses refunds, exchanges, and alterations. LSL is flexible, within reason, in taking items back. While receipts are not required, returns on sale items are exchanged only for gift cards or in exchange for another sale item. Employees keep records of their sales and are able to research any return items. As long as an item is a regular-priced item, it can be returned for a refund without a receipt. The alterations policy is that if an item is altered and is not picked up within three months, LSL returns the item to the floor for sale or donates it to a local charity. Blue dots are placed on the price tags of the most popular items. The store always keeps these items, such as certain sizes of white button-down collar shirts, in inventory. When a "blue dot" item is sold, it is recorded by the salesperson so that a replacement can be ordered so these items stay in stock. Sidewalk sales have been an important part of company policy to sell the previous season's items at a discounted price. Window displays must also be changed once each week since the color of some clothing will fade when exposed to the sun for long periods. Another policy, relating to telephone calls, states that they should be handled in a timely manner. Employees who are unable to immediately answer questions request callers to give their names and telephone numbers and return these calls as quickly as possible. Regarding the speed of service in the store, the employees realize that each customer sets his or her own pace. Keeping the customer happy and satisfied is the primary objective; therefore, no time requirement has been set. From time to time, LSL offers incentives to employees for selling slow moving items. Other policies for employees include meetings that are scheduled once a month; however, the meetings have not been consistently held and, when held, all employees were not required to attend. Policies on handling disasters, such as fire or flood, are posted. All employees know how to evacuate the store and what steps to follow in emergencies. The only discipline policies relate to consistent tardiness and stealing of merchandise or cash. LSL, however, is proud that all employees are honest and have been employed by the company for many years. There is an absence of any staff performance evaluations. It is interesting to note that these and many other policies are unwritten. Policies are more likely to be improvised and changed as needed rather than being formally written in an employee handbook. Since most employees are long-term, they are familiar with the written and unwritten policies and know how to follow them. However, problems are likely to arise when new employees are hired. Strategy Mr. Smith would like to maintain the current stability strategy - LSL has always been located on Laurens Street and has maintained its current employees for more than ten years. At present, there are no plans to enlarge the store. Mr. Smith considers having only one location a strength, because staff and inventory are not divided between two venues. With one operation, rent and utilities, and other operating costs are lower than would be the case if you had multiple locations. According to Van Smith, LSL's inputs are stable in price and quantity and are available in the amounts and at the times needed. Prices are based upon advice from suppliers and a loose formula that is based on an item's salability. The success of this approach is due to LSL's superior use of insights into its product and customer needs. LSL employs a product development strategy by adding closely related products and services. Colors are modified, patterns are rearranged in layout, sequence or components of different patterns, and fashion ideas are reviewed from season to season. This strategy enables LSL to prolong the life cycle of its current products and take advantage of its reputation and brand names. LSL is beginning to focus on a market development strategy to market existing products to customers in related areas by adding channels of distribution or changing the content of advertising campaigns. LSL has expanded its outside sales and advertising to market its present products to areas such as Augusta and Thomson, Georgia; Columbia, South Carolina; and Dothan, Alabama. Van Smith, Lionel Smith, or one of the sales force make trips to customers in these locations at least twice a year. A wine and cheese party is held for the customers in Dothan. Mr. Smith has also expanded his fine quality menswear to include sportswear and accessories. In addition, Mr. Smith would like to target graduating college and medical students, and women who shop for their husbands. He believes that through innovation, LSL can explore ways to create better customer service. One example would be to develop for certain customers a virtual closet, which is a planned wardrobe. Because all employees of LSL have a creative flair, their development of a virtual closet would provide LSL with an important competitive advantage and create barriers to entry for future competition. To compete in its market, LSL employs both a differentiation and focus strategy. It differentiates its product through brand image, quality image, innovative and fashionable designs, and customer service. LSL's inventory includes items any man needs - tuxedos, suits, shirts, pants, socks, and ties. In limited circumstances, LSL has even packed a suitcase for a customer going on at trip. To provide such services, speed has become a major source of competitive advantage at LSL. All of the inventory is "on the floor" and can be found easily. Speed also helps to accelerate new product development and improvement. If Van Smith sees an item displayed at another retail store, he quickly liquidates that item in his store and buys a new item to replace it. LSL is on top of new fashions and is able to have these fashions in stock and out on display in a timely manner. Speed is also of paramount importance in the production processes, so LSL provides onsite seamstresses to hem or alter items as necessary. Also, by providing quick responses to consumers through answers, information, and solutions to mistakes, LSL has built and maintained customer loyalty. At the same time, by focusing on men's apparel, LSL has been able to assess market needs, understand the buyers' behaviors, and build solely on its competencies as described previously. The company has gained a competitive edge by concentrating in product-market segments it knows best. LSL uses the focus strategy on mid- to upperend income consumers. Mr. Smith believes that men are destination shoppers while women tend to shop around and compare prices. LSL's employees travel to various areas in the CSRA to service their customers. An important strength that LSL possesses is a widely respected insight on appropriate taste in clothing. Advice is often requested by customers regarding the suitability of clothing for certain events such as weddings, meetings, or business situations. Minimizing wardrobe gaffes makes these customers far more confident that they will be properly dressed for all business and formal occasions. Delivering the finished garment, altered and pressed to the customer's satisfaction, further enhances customer loyalty. The firm keeps accurate records of these customers' buying habits and special needs for future reference, thus, helping set LSL apart from the competition. Marketing To sell its products, LSL emphasizes comfort, followed by quality and service. Price is less important than the other three attributes to LSL's customers. Although it relies heavily on word-of-mouth advertising, media sources such as television, radio, and newspaper print advertisements are used. Much of the name recognition for LSL is within the "footprint" of coverage for local television and radio stations - an area of about a 60 mile radius. This recognition is bolstered by a long history of operations; this store has consistently advertised throughout its history. The regularity of the advertisements has been a contributing factor to the name recognition of this business. Long term relationships have been built with the customers as a result of the low turnover in the full-time staff. These relationships have been supported by the varying age groups and life experiences of the sales staff and encourage a multi-generational customer base. When asked who his target market was for Lionel Smith Ltd., Mr. Van Smith replied "18 years of age to death." He realizes, however, that this is an unrealistically broad definition of the target market. When pressed, Van acknowledges that few of his customers who are over sixty-five years old can afford his high-end merchandise on their retirement salary. Mr. Lionel Smith indicated the typical customer is between 35 and 59 years of age and has higher than average income, because the LSL line of products is too expensive for most young customers. Young professionals, such as doctors, lawyers, accountants, and managers, are also good customers. Most of the sales personnel are involved in community activities, clubs, and recreation, providing opportunities to meet and interact with many customers outside of the store. In addition, a substantial mailing list of 5,000 existing customers and an email list of 2,300, keep the store and personnel in regular contact with the customers. The customers on these lists have made previous purchases from this business, making them much stronger candidates for future purchases. Fifteen years ago, the need for wardrobe planning as well the need for outside sales and delivery were discovered. Both of these activities have proven to be tremendous growth centers for the business. Customer loyalty has been strongly enhanced because some customers have difficulty finding the time to leave their businesses to shop. For these customers, shopping within their own environment puts them at ease and encourages larger sales. Many customers do not understand how to coordinate their wardrobes, so wardrobe programming has become an important loyalty factor within this facet of the business. A uniquely designed numerical system developed by the store gives the customer a "roadmap" to use in maximizing the number of outfits in their closet. Furthermore, Lionel Smith Ltd. has a competitive advantage through the successful use of relationship marketing. As a family-owned company that has been in business for more than 30 years, it has developed extensive networking capabilities and personal contacts with customers. Careful effort is undertaken to note individual customer shopping trends and habits. Van Smith and all members of his sales staff keep personal lists of their best customers, and they call or contact them when a new shipment arrives or a sale is scheduled. Because Lionel Smith Ltd. is known for its superb quality, style, and service, the firm has developed a powerful reputation for menswear in the CSRA. This reputation has become a valuable form of word-of-mouth advertising. Because the market segment that can afford the highest quality men's clothing is a small, tightly-knit group, the great reputation of Lionel Smith Ltd. has provided the company a significant competitive advantage. Information Systems Recent advances in the use of technology have had a major impact on the retail industry. Consequently, a computer system was purchased by LSL in 1999 to develop a database and help manage the cash register, the inventory system, and the purchasing procedures. The company also made some attempts to use the Internet to help expand their sales. However, these systems and ideas were very difficult to implement due to insufficient technical skills within the company and the lack of support from technology vendors. Although a considerable expenditure was made for a website, LSL has none at this point. The developer defaulted on his agreement to create and maintain a website. The current computer system lacks "user friendly" search capabilities and has limitations on the database. As a result, the company still heavily relies on old fashioned "paper and pencil" techniques in its day-to-day operations. The inventories, sales transactions, and returns have been kept using paper records. A better computer system would allow customer trends – both individually and in aggregate – to be monitored so that tailored sales and marketing decisions could be made. Communication with customers and suppliers has been a vital element for the success of the relationship marketing that LSL utilizes. They have a toll-free (800) telephone number, but their phone system is old. It does not allow for telephone calls to be transferred to other employees or easily forwarded to voice mail. Although Van Smith thinks a new telephone system would be good, he has not investigated the capabilities or cost of an improved system. Inventory LSL does not offer a line of clothing more casual than sports coats and slacks even though the trend is to more casual wear. Even many financial institutions allow their employees to wear jeans on casual Friday. For fine men's clothing, depth and diversity of inventory are strong "draws" for the business. The owner and sales staff travel regularly to New York City and Charlotte, North Carolina to "shop" the markets for new fashions, brands, fabrics and direction from menswear designers. This constant shopping assures the store that no new trends will be overlooked. Additionally, careful study of industry publications and magazines, specific to the menswear industry, further assure that the business is staying abreast of the newest offerings from the designers. Of the five full-time sales persons, there is a cumulative total of 124 years of experience in men's clothing. These experiences are not limited to selling. They also include buying, stocking, pricing, advertising, displaying, shipping, and positioning of inventory. All sales persons assist in reordering and special ordering difficult-to-obtain items. In addition to in-stock reorders, "bespoke" (i.e., made to measure) suits, sports coats, slacks, and shirts are available and are sold by all sales personnel. Mr. Van Smith feels that his company's relationship with its suppliers continues to be of utmost importance and provides it a powerful competitive advantage. His business has a long and proud history of stakeholder relationship management. Therefore, it enjoys a reputation in the industry for paying its bills in a timely manner and being an excellent predictor of consumer taste. Lionel Smith Ltd. is also known for developing extensive and rewarding long-term relationships with its suppliers' sales representatives. Van Smith explained that it is imperative to the reputation of the business that other local retailers do not sell the same brands or lines offered by LSL. This is accomplished by cultivating his supplier relationships through loyalty to the representative and the firm he represents and maintaining strict rules about its territory boundaries. Financial Position Lionel Smith Ltd. is a subchapter S Corporation, which is taxed as a sole proprietorship business. Proprietorships make up about 75% of all business in the United States and are typically small businesses in the wholesale, retail, service, and construction industries. Unfortunately, a sole proprietorship puts the personal assets of the owner at risk whereas an S Corporation protects the personal assets of the owner(s). Another advantage to declaring the S Corporation status relates to taxation. An S corporation allows all of the business' income to be reported as personal income of the owner(s) and not be subject to the double taxation that regular corporations face caused by a corporation paying income tax on the earnings of the business and the recipient of dividends paying individual income taxes on the amounts received.. Although the store has an excellent relationship with its bank, there is no bank debt. A credit line is available, if needed, but has never been accessed. The only debt incurred is from vendors and it is settled on a short term basis, typically within 30 to 60 days, according to terms. LSL utilizes its own version of an in-store credit card through their internally carried accounts receivable, while all major credit cards are also accepted. While there is general agreement that internally carried accounts receivable are a weakness, it is the opinion of the owner of LSL that customer loyalty is strongly enhanced. The accounts receivable average collections period has ranged from 58 to 67 days, and this ratio is acceptable to management. Other weaknesses include a propensity not to follow up on proper handling of cash and other fiduciary matters. The company's recent financial statements are shown in Tables 3, 4 and 5 with certain industry statistics for the clothing and clothing accessories industry shown in Table 6. CHALLENGES Early in 2006, Mr. Smith realized that in spite of the company's outstanding reputation, he must address several new challenges and opportunities. They include expanding the store, pursuing financial leverage opportunities, making technology updates, reevaluating the target market for the firm, improving human resources policies, and developing security procedures. However, he believed that he could not address all of these areas simultaneously and was unable to decide where to start. In addition, a major market shift is taking place, namely the trend toward more casual clothing. In discussions with Mr. Smith, he seemed to downplay the significance of this important development. Another important challenge facing Mr. Smith concerns the intertwining of personal goals with the strategic decisions of a privately-owned business. He is aware that determining the correct balance between family needs and career demands is a never ending challenge for most entrepreneurs. Mr. Smith knows that the company needs to be managed more effectively, but he is not inclined to decrease the time he spends with his family. EPILOGUE Although Mr. Smith has not taken steps to address all these challenges, he has realized the trend towards more casual clothing and now considers that to be the most urgent challenge. He is exploring ways to focus on this trend. He has also expanded his email list of current and potential customers and sends notices of events, such as sales, to those persons. He feels this is a more effective means of communicating with his target market, especially the young professionals. TABLE 3 LIONEL SMITH LTD. Balance Sheets as of December 31, TABLE 4 LIONEL SMITH LTD. Income Statements for the Years Ended December 31, TABLE 5 LIONEL SMITH LTD. Statements of Cash Flows for the Years Ended December 31, TABLE 6 LIONEL SMITH LTD. Men's Clothing and Clothing Accessories Industry Financial Ratios The ratios above were obtained from BizStats. Teaching Case __________________________________________________________ Journal of Applied Case Research Sponsored by the Southwest Case Research Association Charges of Greenwashing at Pacific Gas and Electric Denise T. Ogden Penn State University - Lehigh Valley Shruti Gupta Penn State University – Abington INTRODUCTION The advertising appeared everywhere along the streets of San Francisco. The bright lime-green posters were designed to spread the benefits of "going green". Messages like Green is 4 wheels on the road versus 400, Green is a city with country air, Green is so crazy it just might work, Green is yellow (copy touts benefits of solar energy), Green is brown (copy supports biomass recycling), Green is blue (copy explains water power benefits). Initially the ads were eye-catching to Aliza Wasserman, an environmental activist and concerned citizen. Then she discovered that the sponsor of the public relations campaign was Pacific Gas and Electric (PG&E) Company. She believed the electric company was investing money in the campaign to cover up their past environmental offenses and stop acceptance of a controversial decision to allow San Francisco to buy energy from other companies. According to Wasserman, "Energy companies invested in old, dirty technology should not be advertising that they are green…it's inherently greenwashing." 1 She did something about her concerns and founded Green Guerillas against Greenwash (GGAG), an organization that exposed PG&E's poor environmental record. Contrary to the opinions of GGAG, PG&E believes they have a strong environmental record and have dismissed the charges of greenwashing. Darlene Chiu, Manager of Corporate Communications at PG&E, stated that the letsgreenwashthiscity.org site contains incorrect information and other misinterpreted information about the company. She believes the company is trying to do what's good for the environment and the "Let's Green This City" campaign illustrated those efforts. 2 It is difficult to decide which side is right when there are many issues to consider. BACKGROUND Incorporated in California in 1905, the Pacific Gas and Electric (PG&E) Company is one of the largest combination natural gas and electric utilities in the United States. The company is based in San Francisco and is a subsidiary of the PG&E Corporation. In an effort to make San Francisco the "greenest city in the USA" in Nov. 2006, PG&E started a public relations campaign called "Let's Green This City". The website for the campaign is www.letsgreenthiscity.com. The site provides the residents of San Francisco with information on different practices to support the environment. Though the campaign was well-received by the citizens of San Francisco, there were many who felt that PG&E was engaging in "greenwashing" – using public relations to project an image of a concerned corporate citizen as a cover up to hide the destructive environmental record of the company. Opponents also believed that another motivation of PG&E for the "Let's Green This City" campaign was to stop the final acceptance of a Community Choice Aggregation (CCA) program by attempting to appear more environmentally friendly. Community Choice Aggregation would break PG&E's monopoly and support market competition. Although state laws prohibited PG&E from actively campaigning against aggregation, consumer advocacy groups argued that the company engaged in high profile "green" projects to gain support and prevent the final acceptance of the CCA plan. In response to PG&E's involvement in the "Let's Green This City" campaign, Aliza Wasserman and other detractors of PG&E, started a website called "Let's Greenwash This City", with the corresponding website, www.letsgreenwashthiscity.com. The website details the poor environmental record of PG&E. PG&E Headquartered in San Francisco, PG&E provides natural gas and electricity to approximately 15 million people throughout a 70,000-square-mile service area in northern and central California. PG&E owns and operates one operating nuclear power plant (Diablo Canyon Power Plant), a natural gas-fired power plant, and an extensive hydroelectric system. Two plants are no longer in operation: The Humboldt Bay Unit 3 nuclear plant was shut down in 1976. The Hunters Point (fossil) plant closed in May 2006. The predecessor to PG&E, The San Francisco (SFG&E) Gas Company was founded in 1852 by Peter and James Donahue. Over the years this company merged with rival companies until PG&E was formed in 1905 through a merger of the SFG&E Co. and the California Gas and Electric Corporation. In 1997, PG&E Corporation became the parent company for the PG&E Company. In 2007 the company had approximately 20,000 employees. PG&E is regulated by the California Public Utilities Commission. The Western Power Crisis and Financial Difficulties In May 2000 electricity prices in the West significantly increased resulting in the California Electricity Crisis also known as the Western Power Crisis of 2000 and 2001. Due to price controls in effect, utility companies had to pay more for electricity than what they could charge customers which resulted in the PG&E bankruptcy filing in April 2001. Several market conditions lead to the Western Power Crisis. First, the economic growth in the early 2000s lead to a significant increase in demand for electricity, which far exceeded the equipment and generation capacity of the utility companies. In addition, a restructuring of the electric utility industry in California led to miscalculations in the price that combined with the volatility of the wholesale market led to unprofitable operations for the utility companies. Wholesale prices exceeded retail prices and the California utilities were unable to pass on the higher wholesale prices to customers due to regulated fixed pricing. An environmental factor that compounded the market conditions was a severe water shortage in the Northwest Region that impaired hydropower generation capabilities. 3 The impact of the crisis was so great that investor-owned utilities, such as PG&E, could not recover from its ensuing financial problems. The result of the crisis was rolling blackouts, exorbitant increases in rates and a tax funded bailout of the utility. 4 PG&E filed for Chapter 11 bankruptcy reorganization in April 2001 with $9 billion in electricity debt. 5 After paying $10.2 billion to hundreds of creditors, PG&E emerged from Chapter 11 bankruptcy in April 2004. Over the years, PG&E has slowly regained its financial strength. The parent company, PG&E Corp., was ranked 196 on the 2007 Fortune 500 list with over $12.5 Billion in revenue and profits of $991 million. In 2008 the company was ranked 200 on the list with revenue of over $13.2 Billion and profits of over $1 Billion. 6 "LET'S GREEN THIS CITY" CAMPAIGN In November 2006, PG&E launched a multi-million dollar public relations campaign called "Lets Green This City". According to the website www.letsgreenthiscity.com, the campaign was "a partnership between PG&E and the people of San Francisco." It was part of PG&E's goal to become the nation's greenest utility and to help San Francisco become the greenest city in the nation. 7 According to Darlene Chiu, Manager of Corporate Communications at PG&E, the "Let's Green this City" campaign was a group effort which came about because Peter Darbee, CEO, realized the urgency of climate change and wanted to do something about it. The campaign is a call to action.8 Darbee wanted to make green part of PG&E's image. He is a member of the United States Climate Action Partnership which is a group of business leaders who are committed to bring the issue of global warming and climate change to the attention of governments around the world. According to Peter Darby, "What leaders do is they identify the right thing to do, and they do it early. And that's why PG&E's view is we're stepping out. We've been the leader in industry, way out in front and sometimes taking arrows for it. We believe the nation should step out on this, do the right thing and then convince others in the world that this is urgent and important and they need to follow our lead."9 Mekanism, a creative studio, and the advertising agency, Venables Bell & Partners, created the integrated media campaign which aimed to educate consumers on ways to support the environment. The interactive website consisted of an online manual which provided consumers with tips to conserve energy at home. There were also ten liveaction and animated short films on green issues ranging from a worm that shows the benefits of composting to a flock of winged compact florescent bulbs (CFL) flying through a dreamlike landscape. Articles and downloadable fact sheets were also available on the website. The creators of the campaign integrated entertainment with education. The online campaign complimented the city-wide print campaign designed by Venables Bell & Partners.10 www.letsgreenthiscity.com In addition, the website ( ) listed actions that PG&E had taken to help green the city: * Invested $5 million in new solar installations in San Francisco * Investigated ways to harness the San Francisco Bay tidal current to create pollutionfree energy * Supported the incubation of green energy companies * Instituted a ClimateSmart program which allowed consumers to direct part of their power bill towards an initiative limiting greenhouse gases * Expanded the Solar Schools program According to Darlene Chiu, PG&E had also contacted its partner companies to explain the campaign. Many companies expressed interest and joined the effort immediately while others were added after the campaign began. The company has received many accolades on the campaign. The "Let's Green this City" campaign has also spurred interest in similar initiatives in other cities where PG&E has held symposiums to help these communities to develop similar programs. One of the results of the campaign has been the Energy Watch program, a partnership between the San Francisco Department of the Environment and PG&E. The Energy Watch partnership provided incentive programs, training, education, and technical assistance for small businesses and residential customers. 11 Charges of Greenwashing After the "Let's Green This City" campaign came out, Aliza Wasserman, a former corporate responsibility consultant, along with a group of concerned citizens formed Green Guerrillas Against Greenwash (GGAG) in 2006. The group consisted of four to six main organizers and about 100 other supporters. They were the first to protest PG&E's sponsorship of the "Lets Green This City" campaign as evidence of greenwashing, which is when a company uses public relations to project an image of a concerned corporate citizen to hide the company's destructive environmental history. The leaders of the group believed that PG&E launched the campaign to appear environmentally friendly and as a tactic to divert public and media attention from its negative environmental record. Below is a sample of a greenwash poster the group distributed: Wasserman along with the other members of GGAG also launched the www.letsgreenwashthiscity.org website to expose the poor environmental record of PG&E by posting information about the company and the impact felt by the regional communities. Here are some highlights of the information from the website (accessed June 2007): 12 : * PG&E's power mix includes less than 1% solar energy and only 2% wind, both of which are examples of renewable resources that are environmentally friendly. * Bulk of the power produced by PG&E comes from fossil fuel (45%) and nuclear (24%) resources. Both resources have been shown to be detrimental to the environment than other renewable alternatives. * Feasibility studies found that the San Francisco Bay Area had solar and wind capacity to meet 50% of San Francisco's energy by 2017...without raising customer costs. * PG&E aimed to increase its renewable energy by the legally mandated minimum of 1% a year. The increase would be achieved through contracts with other companies (outsourcing). * PG&E praised itself for its work on energy efficiency and its initiative in 2007 when the company distributed CFLs to customers - when all of that was legally required and funded by tax money (the public goods charged on consumer's monthly bills. * PG&E lobbied for nuclear energy to be the 'green' solution to climate change, despite the fact that there was no safe solution in sight for the nuclear waste it leaves behind for 240,000 years. GGAG contended that the "Let's Green This City" campaign intentionally coincided with the time when the San Francisco Board of Supervisors (similar to a City Council) had voted on the Community Choice Aggregation (CCA) policy. According to GGAG, the timing was an attempt by PG&E to be viewed favorably by the citizens and thereby prevent the passage of CCA. During the same time when the "Let's Green This City" campaign was in full momentum, GGAG organized public demonstrations and engaged in guerrilla ad-busting to expose PG&E's actions against green legislation. Wasserman stated during the first few demonstrations held by GGAG, PG&E representatives approached the group to initiate dialog between GGAG and the company. However, GGAG had decided to stay firm and not engage in any dialog with PG&E until the latter had agreed to policy changes to generate 51% of its electricity from renewable energy sources. 13 In response, Darlene Chiu, of PG&E, expressed her frustration at GGAG's refusal to meet with representatives of PG&E. Chiu believed a meeting between GGAG and PG&E may have cleared up some of the misunderstandings. 14 San Francisco Supervisor, Tom Ammiano agrees that PG&E has engaged in greenwashing. According to Ammiano, "They're trying to co-opt the whole idea of public power and community choice." 15 Ross Mirkarimi, another member of the Board of Supervisors who supported Community Choice Aggregation made the following comment about of PG&E's initiatives to offer grants and donations to community groups, "I think there is also this expectation that those neighborhood community groups show a loyalty to PG&E that also potentially translates into not aligning with any effort than could suggest public power, or could suggest community choice aggregation." 16 COMMUNITY CHOICE AGGREGATION As a result of the Western Power Crisis, San Franciscans wanted a change in electricity management. Proposition F and Measure I, which would have created local ownership of transmission, distribution and some generation of electricity, were defeated by San Franciscans in 2001. 17 PG&E spent $1.28 million to defeat the passage of Proposition F and Measure I. 18 Another proposition (Proposition D) that was introduced in the San Francisco City Council in November 2002, which would have created municipalized public power and closed the Bayview Hunters Point plant was also defeated by popular vote. It has been suggested that PG&E spent $2.1 million to defeat the Proposition D compared to $50,000 spent by supporters of the Proposition. 19 Despite the failure of the above propositions that sought to change electricity management for the San Francisco County, California's Community Choice Law was enacted in September 2002 (also known as Community Choice Aggregation). The law paved the way for regionalization of electricity markets which is accomplished through Community Choice Aggregation (CCA). In traditional state-regulated systems, the Public Utilities set rates and make portfolio decisions. Investor-owned corporations own the wires and power plants and run the administration of utilities. Utilities receive a guaranteed rate of return based on a fixed percentage of their operating costs. Profits are greater when more power is consumed.20 With Community Choice Aggregation (CCA), municipalities and groups of municipalities (or regions) aggregate customer demand and then bid out electricity from other utility companies on a competitive basis. The companies who bid for the contract are referred to as Electric Service Providers (ESP). The Community Choice Aggregators is a group of people from a community that represent consumers and decide on the power types and requirements for that community. As a result, communities would have the option to convert to cleaner and renewable power sources. Other energy sources could include solar photovoltaic, wind power and tidal power. In essence, with CCA, the city becomes a broker for the consumers and represents their interests in the selection of power. Under CCA, San Francisco would rely on the existing power delivery infrastructure owned and operated by PG&E. At the same time, San Franciscans retain the right to opt-out of CCA and remain with PG&E as their power supplier. 21 Massachusetts, Ohio, New Jersey and Rhode Island have Community Choice laws in existence. Proponents of the plan believed that community choice would insulate users from volatile natural gas prices, assist in closing dysfunctional power plants that may contribute to cancer and other diseases, and make San Francisco a leader in environmental stewardship. Dozens of environmental and public good advocates have supported CCA including Sierra Club, Green Party, Women's Energy Matters, Greenpeace, League of Young Voters, Local Power and the Senior Action Network. According to Paul Fenn, author of California's Community Choice Law, 'Throughout the state, municipalities view Community Choice not merely as a vehicle for finding cheaper supply, but an opportunity to invest in the long-term reliability, stability and sustainability of their energy supply. This represents both an unprecedented opportunity for new business development in new energy technologies and distributed generation, and a challenge for ESPs, vendors, integrators, service companies, and financial institutions to form new consortia, subcontracting relationships and partnerships to answer this new opportunity." 22 In a 2005 feasibility study of CCA, Navigant Consulting used three general criteria to assess the benefits of CCA: potential for reduced electricity rates, the ability to increase utilization of renewable energy, and enhanced local control/rate stability of electricity. Other potential benefits of CCA as described in the report included the following: 23 * Allows a community to proactively address energy and infrastructure issues * Reduced energy costs * Expands use of renewable energy resources and increased energy efficiency (e.g., reduce greenhouse gas emissions, reduce dependence on fossil fuels and imported natural gas) * Provide electric rate stability and local control * Position City for provision of expanded electricity service offerings in the future * Entice new business development/jobs by provided lower electricity rates Along with the above benefits, the CCA program also presented the following risks: * Under some scenarios, program rates could be up to 4% higher than those offered by PG&E, particularly within the first three years of the law's implementation * Risks inherent in procuring electricity for retail customers is high and should be either effectively managed to minimize financial impact or assigned to the program's energy suppliers. * Resource obligations and investments taken by the city on behalf of its citizens could result in economic losses. Darlene Chiu stated that PG&E supported the initial CCA legislation but continues to be concerned with consumers' empowerment to exercise their choice of selecting a power company. A second concern for PG&E was that CCA does not require voter approval and PG&E would like consumers to have a vote in the process. In the past, voters in San Francisco turned down public power initiatives (Propositions F, D and Measure I mentioned earlier). The third concern for PG&E is that if a new provider is chosen by the Community Choice Aggregators, customers would have to make an effort to opt out of the new providers in order continue with PG&E, a practice that the company considers unfair because the choice to stay with PG&E will not be made upfront. Finally, PG&E is also not convinced that another provider will deliver the power cheaper. 24 In May, 2004, the Board of Supervisors of San Francisco passed a Community Choice Aggregation Program. This paved the way for the San Francisco Public Utilities Commission and the San Francisco Department of the Environment to develop a draft implementation plan for a CCA program. After the plan was developed, it was presented to the Board of Supervisors for approval. In June 2007, The Board of Supervisors granted approval to the San Francisco Public Utilities Commission to explore if CCA could meet or beat PG&E's current rates. The San Francisco Office of the Controller was not convinced that customers would save money with community choice aggregation. 25 At the present time, CCA is a long way from becoming a reality with many proponents and opponents weighing in. If CCA is implemented more than 50% of San Francisco's energy would come from renewable sources by 2017. 26 PG&E - ENVIRONMENTAL RECORD PG&E has received several mixed reviews on their environmental record. One of the most high profile cases that received media attention was highlighted in the movie Erin Brokovich, based on the experience of legal clerk who uncovers information against PG&E. Erin discovered that PG&E's Hinkley Compressor Station, part of a natural gas pipeline connecting to the San Francisco Bay Area, had leaked hexavalent chromium (chromium 6), a cancer-causing chemical, into unlined ponds in Hinkley, California. The chemical infected the groundwater, causing serious illnesses in livestock and people during the 1960s through the 1980s. 27 In 1996 the case was settled and PG&E had to pay $333 million to more than 600 residents of Hinkley, eliminate the chemical from the township, and stop using chromium 6 at their plant. This was the largest settlement on record in a direct action lawsuit. The second PG&E high profile case that showcases the company's negative record also dates back to the 1990s. In June 1997, a Nevada County jury convicted PG&E of 739 counts of criminal negligence for failing to trim trees near its high-voltage power lines. The negligence lead to fires which destroyed 500 acres, a 19th century schoolhouse, 12 homes, and other properties in the historic Gold Rush town of Rough and Ready. A witness for the prosecution testified that PG&E had diverted $80 million in funds from its tree trimming program into shareholder profits.28 The reliance of PG&E on fossil fuels and nuclear power has sparked criticism of PG&Es environmental record. Critics argue that two-thirds of the electricity supplied by PG&E has contributed to environmental contamination either in the form of greenhouse gases or nuclear waste. Opponents have also pointed that PG&E has strongly opposed California Senate Bill 411 which proposes that utility companies increase the amount of energy produced from renewable sources to 33 percent by 2020. In 2002, the state of California mandated that 20 percent of the energy produced by PG&E should be produced from renewable resources, such as wind or solar power by 2017. In 2006 a Senate Bill 107 was enacted which accelerated the goal of producing 20 percent from renewable sources to 2010. This is known as the Renewable Portfolio Standard (RPS). According to Darlene Chiu of PG&E, they are making progress toward that goal. 29 Currently, 43 percent of the energy produced by PG&E's is generated from fossil fuels while 23 percent is nuclear power. The table below provides a more detailed breakdown of the power profile (type of resources used to generate electricity) from 2004 to present. PG&E Power Profile Source: PG&E bill inserts Note: Eligible renewable includes biomass (organic material made from plants and animals) and waste geothermal, solar, wind and small hydroelectric capabilities. Despite public opinion of PG&E's environmental misdeeds, the company has continued to tout its environmental conservation record. A sample of pro-environmental initiatives implemented by the company include, the June 2007 partnership with The Association of Monterey Bay Area Government to provide free CFL bulbs to homes and hospitality businesses. In addition, the association provided free energy surveys and information on how to save on gas and electricity bills 30 . A second initiative was its collaboration with IBM as a corporate partner to optimize energy efficiency at PG&E's California information technology operations. Together the companies will work to reduce energy consumption at the facilities by 80% by optimizing equipment operation and reducing heat. 31 Evidence of PG&E's pro-environmental record is also evident in the awards and recognition it has received from non-profit organizations. In June 2007, The Natural Resources Defense Council (NRDC), an environmental action group, honored PG&E for the company's record of environmental leadership. According to Ralph Cavanagh, energy program director of the NRDC, "The company's industry-leading energy efficiency programs and its bold leadership on climate change at the state and federal level provide an example of how the actions of one company can make a significant contribution to protecting the environment." 32 This is one of over 140 environmental awards that PG&E has been awarded over their history. Recently the Planning and Conservation League named PG&E the "Environmental Business of the Year" to recognize PG&E's leadership in renewable energy and land stewardship. 33 Despite the many awards that PG&E has received over the years, consumer groups, such as the Utility Reform Network and GGAG point out that some if not all of PG&E's green efforts are funded by consumers. One source of revenue for Utility companies is the "public goods" charge on consumer energy bills, amounting to 1% of each customer's bill. Of this amount nearly half goes toward energy efficient programs. Over the last 30 years, these programs have allowed California to keep its per-capita power consumption relatively flat while consumption has grown in other states by nearly 50%.34 Under a 2006 California law, the state pledged to cut greenhouse gas emissions by 25% by 2020. The fastest way to accomplish this reduction is through energy efficient programs which include adopting appliance and building standards to reduce power intake, eliminating wasteful practices, promoting efficient lighting and offering rebates to customers who install energy saving appliances. When consumers save energy, utility companies experience a decrease in revenue. In the early 1980s, the state of California compensated lost revenue for utility companies that sold less power as a result of energy efficient programs. This move provided an incentive for utility companies to encourage more efficient programs.35 Because of the increased pressure to reduce greenhouse gas emissions, in June 2007, PG&E and other California Utility companies asked for an additional $400 million to $1 billion in cash incentives from their customer's if these companies meet or exceed state efficiency goals. This would add another $2.50 to the typical customer's electricity bill.36 The utility companies believe that their energy efficiency actions should offer these companies the ability to make profits equal to the profit the company could earn if they built power plants and sold the output. The request for more money from customers angered many consumer groups and is being considered by the California Public Utilities Commission. Peter Darbee, CEO of PG&E realizes the challenges ahead, "…this is the hardest thing I've ever done. Trying to convert a classic, regulated utility into a high-performance, competitive, customer-centric organization is a big job, and it's going to take us years to do it, but that's what we're trying to do."37 ENDNOTES 1 Wasserman, Aliza (2008). Personal Interview, March 16, 2008 (via telephone). 3 The Western States Power Crises: Imperatives and opportunities (2001, June 25), An EPRI White Paper, Electric Power Research Institute Inc http://www.epri.com/WesternStatesPowerCrisisSynthesis.pdf 2 Chiu, Darlene, Personal interview, April 1, 2008 (via telephone). 4 Hess, David (2005) Case studies of the greening of local electricity: San Francisco Electric Power. Accessed June 2007. http://www.davidjhess.org/SFPower.pdf 6 Fortune 500 Ranking of America's Largest Companies. Accessed April 2008. http://www.money.cnn.com. 5 James F. Peltz (2005). PG&E bouncing back from fiscal brownout; The largest California utility's emphasis on its core business helps its climb out of Chapter 11. Los Angeles Times, Feb. 26, p. C.1. Retrieved May 31, 2007, from Los Angeles Times database. (Document ID: 798600421). 7 Let's Green This City website. Accessed June 2007. www.letsgreenthiscity.com. 8 9 On the record (2007). San Francisco Chronicle, Nov. 18, p. D1 from National Newspapers (27) database. Chiu, supra note 2. 10 Clarke, Christine (2007). Easy being green Mekanism urges San Franciscans to go green. Boards (June). Retrieved July 11, 2007 from Proquest database. 12 Let's Greenwash this City website. Accessed June 2007. www.letsgreenwashthiscity.org. 11 Chiu, supra note 1. 13 Wasserman, supra note 1. 15 Hammelgarn, Seth (2006). P&E criticized despite "green" programs, Bay Area Reporter [online]. Obtained Oct. 25, 2007. 14 Chiu, supra note 2. 16 Critics Accuse PG&E of trying to undermine spread of community choice aggregation programs (2007). Power Markets Week, Aug. 20, p. 18. p. A.21. Retrieved May 4, 2008, from ProQuest National Newspapers 17 Gordon, Rachel (2001). Power measures dead, not buried / public utilities pushers vow to fight in 2002 :[FINAL Edition]. San Francisco Chronicle, Nov. 11, Premier database. (Document ID: 89269787). Chronicle, p. A.1. Retrieved June 5, 2007, from National Newspapers (27) database. 18 Finnie, Chuck and Susan Sward (2002, October 29). PG&E spends big to defeat Prop. D / $2.1 million to dump public power measure:[FINAL Edition]. San Francisco (Document ID: 225828831). 20 Local Power website (www.local.org). Accessed June 2007. 19 Ibid. 21 Ibid. 23 Navigant Consulting, Inc (2005). Community choice aggregation – Base case feasibility evaluation for the City of Berkeley (April). 22 Fenn, Paul (2003). Community choice aggregation: A huge new opportunity for energy sustainability, security and competition in an otherwise volatile and polluting energy market," Accessed June 2007 from www.local.org. 24 Chiu, supra note 2. 26 Hammelgarn, supra note 15. 25 San Francisco moving on aggregation as group says plans face rough road (2007). McGraw-Hill's Power Markets Week. June 11, pg. 19. 27 Anderson et al vs PG&E case - Superior Court for the County of San Bernardino, Barstow Division, File BCV 00300. 29 Chiu, supra note 2. 28 Doyle, Jim (1997). PG&E guilty in 1994 sierra blaze / 739 counts of negligence for not trimming trees:[Final Edition]. San Francisco Chronicle, June 20, p. A, 1:5. Retrieved July 10, 2007, from National Newspapers (27) database. (Document ID: 12605797). 30 Howe, Kevin (2007). Agencies help you save energy: Government association, PG&E offer programs to help consumers become power efficient. Knight Ridder Tribune Business News, June 7, Washington (wire feed). Retrieved July 7, 2007 from Proquest database. 32 Pacific Gas & Electric sets the bar (2007). Business and the Environment, Vol. 18(6), p. 6. 31 McGee, Marianne Kolbasuk (2007). IBM goes for the green. Optimize, Vol. 6 (6) June. Retrieved July 11, 2007 from Proquest database, pg. 13. 33 PG&E named environmental business of the year by the Planning and Conservation League (2008). Press release (Jan 11) from PG&E News Department. 35 Ibid. 34 Douglass, Elizabeth (2007). Energy: As utilities go green, some are seeing red. Consumer groups rap efforts to gain rewards for conservation. Los Angeles Times, June 15, p. C1. Retrieved July 11, 2007 from Proquest database. 36 Ibid. 37 On the record, supra note 9. Teaching Case Journal of Applied Case Research ______________________________ Sponsored by the Southwest Case Research Association "BUSINESS AS UNUSUAL": A CASE STUDY ON THE BODY SHOP Subhadip Roy ICFAI University, India Lopamudra Ghosh ICFAI University, India "BUSINESS AS UNUSUAL 1 ": A CASE STUDY ON THE BODY SHOP "The business has existed for one reason only – to allow us to use our success to act as a force of change, to continue the education and consciousness-raising of our staff, to assist development in the Third World and above all, to help protect the environment. What we are trying to do is to create a new business paradigm, simply showing that business can have a human face and a social conscience". - Anita Roddick (1991) 2 ANITA RODDICK STEPPED DOWN AS THE BODY SHOP CHAIRPERSON February 2002, the founder of one of the biggest cosmetics companies in the world, Anita Roddick (Anita) stepped down as the chairperson of the Body Shop along with husband Gordon Roddick (Gordon), who was a co-chair along with her. A number of controversies in the mid and end 1990's had badly affected the company's image as doing "business with a human face" as opined by Anita in the quote given above. Periods of losses, coupled with poorly motivated shareholders, de-motivated franchisees, unsuccessful restructuring attempts and public propaganda against the company was proving to be too strong for the company to cope up. Thus, the decision of Anita and Gordon came up after several unsuccessful attempts to find a buyer for the firm. However, they still maintained control over more than 50% of the company's voting rights along with Ian McGlinn, a friend of the Roddick's and an early investor in the company. Around the same time, the then CEO Patrick Gournay, (who actually ascended the throne in 1998 when Anita stepped down as the CEO) resigned and was replaced by Peter Saunders, who was a former director of the North American operations of the company. Adrian Bellamy, the former CEO of the North American operations of the company, took over as executive chairman and assured that he would try to improve the relationships of the company with its 1200 franchisees around the world. The Roddicks, however, were retained as non executive directors on the company's board. Anita Roddick continued to support the company as a consultant primarily responsible for finding new ingredients to be used in Body Shop products. Anita was quoted as saying, "Being a non-exec is going to be much more fun for me because you can be much more a tyrant." 3 The Body Shop was the vision of a lady Anita Roddick which evolved from a small outlet at Brighton in South England to a company having a global presence in more than 50 countries and more than 2000 outlets (mostly franchises). The founder, Anita Roddick had championed social causes and had fought multinational mammoths like Shell and Exxon-Mobil (Refer to Appendix IX). The main reasons behind the success of the company were protesting against the testing on animals, campaigns against human rights abuse, environmental protection and socially uplifting activities. In end 1990's The Body Shop was voted the second most trusted brand in U.K. by a survey conducted by Interbrand. The founder Anita, as she was popularly known, had received numerous awards including the Dame Commander of the British Empire (DBE) (Refer to Appendix IX) in 2003. (Refer to Appendix VI for a list of awards won by Anita Roddick) The company which became popular among the consumers for its social activities was no longer focused on the "ethical business" aspect for generating revenues, a fact emphasized in the mission statement of the company. (Refer to Appendix I). Several new policies were implemented such as use of advertisements as a marketing tool which was not practiced at all during the reign of Anita. Though these were not fully acceptable to the founder and mentor Anita, the then management had no choice. But before going into the issues and challenges before the company, one needs to look into the past to find out how the company came into being and became popular among the consumers. BACKGROUND Back in the year 1976, Anita Roddick founded The Body Shop out of loneliness in one hand and to earn a living on the other. The first Body Shop outlet was established in a small store in Brighton, South England in March 27th. The essence of the products was that it was made of natural ingredients. The customers found the products very unique and as the sole employee of the shop, Anita was very apt in handling her clients. In 1977 when Anita's husband Gordon Roddick came back, he came up with an idea of franchising as a way to expand the company. Thus, the first Body Shop franchisee opened up in Brussels in 1978. This was followed by opening up franchises in Canada (1980) and Australia (1983). The Body Shop took off and in the year 1984 it was decided to make the Body Shop a Public Ltd. Company. The first community trade programs of the Body Shop were started around 1986 in India. By the early 1990's Body Shop was a well spread company all over the world. In 1994, Body Shop came up with its direct selling division known as the Body Shop at Home. In the year 1995, the website of Body Shop was launched on the internet in order to keep pace with the IT revolution. The US operations of Body Shop were sold to Bellamy Retail Group in 1999 which was repurchased back in 2001. In 2002, Anita Roddick stepped down as the Co-chairperson of the Body Shop International PLC but she remained back as non-executive director. In the year 2004, the Body Shop International through its two wholly owned subsidiaries, the Body Shop Canada Ltd. and the Bath-Na-Bodhaige of U.S., acquired operations of its head franchisee in Canada. The Body Shop with its innovative products containing hitherto unknown ingredients such as Aloe Vera, Jojoba Oil, and Cocoa Butter (Refer to Appendix IX) remained very popular among consumers all over the world till date. THE BUSINESS PHILOSOPHY OF THE BODY SHOP The business philosophy of the Body Shop was evident from its mission statement. The mission statement itself signified that the company wanted to do something other than just selling cosmetic items. The values of the company were also evident from the trading charter of the Body Shop. (Refer to Appendix IV). Policies, Programs & Campaigns: The environmental campaigns of the Body Shop started as early as 1985 when the Body Shop entered into an alliance with Greenpeace to promote "Save the Whales" campaign. Throughout the entire journey of the Body Shop as a corporation, Anita had participated into campaigns such as protecting habitats of the Ogoni people in Nigeria to fighting for human rights and against the World Trade Organization (WTO). She flew down to Seattle on November 1999, a few days before the third ministerial conference of the WTO was being held. There, she campaigned against a global trade system she condemned as "unjust and unsustainable". In her words, the WTO was more obsessed with profits and in effect was neglecting issues of human welfare. In her speech, Anita said that the WTO was "blind to the injustice of the pursuit of profits at the expense of people. By default the WTO is a world government, but it is a blind government. It looks at the measurement of money, but it can't see anything else." 4 The ecological and social viewpoint came out from the core values of the company. (Refer to Appendix II). The chief activities of the Body Shop which identified it as a company standing out as an example of ethical business are given as follows. Trade not Aid Program: The "Trade not Aid" program was started by the Body Shop in 1987 to help the people of the Third World countries through self sustenance programs. The most popular among those programs was the production of the Brazil nut oil by the Kayapo Indians (Refer to Appendix IX) of the Amazon basin in Brazil. This particular program was started sometime in 1991. The body Shop began working with the Kayapo Indians to harvest the Brazil nut oil which was used in one of the best selling products of the Body Shop, the Brazil nut hair conditioning. Similar projects were taken up in various other parts of the world such as New Mexico where the Pueblo Indians were associated with providing the Body Shop with Blue Corn. The Body Shop Foundation: The Body Shop Foundation was established in 1990 by the Directors, employees, national and international franchisees to collect funds from the employees as well as customers leading to creation of a fund that would support small organizations at the grass root level in the areas of human rights and ecological protection. Till 2005, the Body Shop had donated over ₤ 5 million in grants and gift-inkind support thereby assisting the work of various organizations. The most important of the projects was the "Brazilian Healthcare Project" aimed at providing healthcare and education to local tribes in Brazil. The other notable projects were, "Children on the Edge" which aimed at alleviation of the suffering of orphan children in Romania, Kosovo and East Timor, "Protect the Child" aimed to bring an end to worldwide children abuse. Political Involvement: Throughout the history of The Body Shop, the company had involved itself into activities which had ultimately led the company into clashes with political factions. For example, around early 1990's the Body Shop started a protest against the oil multinational Shell which had destroyed the natural habitats of the Ogoni tribesmen in Nigeria. Though initially eight Ogoni tribesmen including their spokesperson were executed by the Nigerian Government, 19 others were released by the government as a result of the campaign. In 1997 after four years of the campaign, Shell issued an operating charter which declared the commitment of the company towards human rights and sustainable development. In September 2001, the Body Shop and Greenpeace joined hands with other organizations to protest against Exxon Mobil with charges of global warming. In the same year, Anita Roddick tried to raise her voice against the myths of globalization and WTO. CRITICISM AND CHALLENGES In spite of the socially responsible activities by the Body Shop, the company was accused with a number of charges in the period between 1994 and 2000. The particular issues in which the Body Shop was challenged included its claims of natural ingredients, environmental protection; trade not aid program, animal testing, and charity issues. Natural Products: While the Body Shop claimed its products to contain natural ingredients only, it was found out that many of its products contained chemicals where the source was not mentioned. This implied that those ingredients were made in the laboratories. Beside this there were reports of contaminated products supplies to the consumers. In the year 1993, a batch of 151 bottles of contaminated Banana shampoo were sold to the consumers in the US, as stated in the report of the Food and Drug Administration (FDA) USA (Refer to Appendix IX). However, the company representatives in the Body Shop replied to this incident by saying that the incident was a result of shifting of operations from New Jersey to North Carolina. Still the question that remained was that of claims regarding natural ingredients. Whereas companies that marketed cosmetic products made from natural ingredients mentioned the original sources on the package, the body shop did not do so. For example, the Aloe Hair Gel label read "Water, Rosewater, SD Alcohol 40-B, Aloe Vera Gel, PVP (setting agent), Triethanolamine, PEG-75 Lanoline, Propylene Glycol, Carbomer 940, Phenoxyethanol, Polysorbate 20, Methylparaben, Benzophenone-4, Disodium EDTA, Sodium Dehydroacetate, Propylparaben, Fragrance, FD&C Yellow No. 5, FD&C Blue No. 1." 5 The organic or natural sources were not mentioned. Environmental Claims: While the Body Shop claimed to be a company which actively participated in environmental protection, investigating reporters like Jon Entine had blamed the company for making misleading claims. David Brooke, the Body Shop former manager of environmental affairs had dismissed the company's environmental claims as window dressing. However, the fact still remained that the Body Shop had a good record of environmental audit and disclosure. The Body Shop was a signatory of the CERES principles, an environmental code of conduct that was created by environmentalists and social investors. Apart from that, the Body Shop was one of the few companies to have an efficient environment management system and environment audit which followed the voluntary European Union Eco Management and Audit Regulation. Trade not Aid: Again critics like Jon Entine had highly criticized the trade not aid program taken up by the Body Shop. Terence Turner, an anthropologist at the University of Chicago claimed that the Kayapo Indians made their bulk income from selling logging and mining concessions on their lands, which were actually the activities that the Body Shop claimed to have protected. Turner also observed that the income generated through the trade not aid program by the Kayapos was insignificant compared to their base income. However, it was found out that the Kayapos themselves did not want the Body Shop to pull out. In fact, some villages wanted the Body Shop to establish projects there. Animal Testing: Though the Body Shop was against the testing of products on animals, it was found out according to an internal memo of the company in 1992 that almost 50% of the company's products were tested on animals. One fierce attack came from a British television program entitled "Body Search" which accused The Body Shop of misleading customers with its "Against Animal Testing" product label. The Body Shop's policy, designed as an incentive for companies to eliminate their animal testing, required rejecting all ingredients that had been tested on animals in the previous five years. The TV program, however, charged the company with using ingredients that had been tested on animals. The Body Shop brought a suit against the television station 1993 and won £276,000 in damages. Although the company won the suit, the battle had focused attention on the Body Shop's ethical record and inspired additional criticism. Charity Issues: The reputation of the Body Shop for charitable giving had been an issue among the critics. The critics claim that, while responsible charitable organizations such as Patagonia and Ben & Jerry's contribute 10% and 7.5% of its pre-tax profits for charity, the Body Shop is contributing around 3% of its pre-tax profits. However, the figures do not take into account the voluntary activities undertaken by the employees of the Body Shop and the contributions made by the customers. Different fund raiser activities such as sale of red ribbons during World Aids Day and collection of funds from the customers in 'Violence Against Women' campaigns also contributed to the charity activities conducted by the company. RESTRUCTURING THE COMPANY All these negative propaganda proved to be very hard for the Body Shop which lost its ground somewhat in the period from 1995 to 1997. (Refer to Appendix V for the financial figures of The Body Shop) However the pressures were countered by the Body Shop through some restructuring measures around late 1990's. The mounting financial and competitive pressures forced the company to undergo re-structuring in 1998 when Anita Roddick stepped down from her position as CEO and invited Patrick Gournay, who was then working with the French food giant Danone to turn around the company. Critics believed that the emphasis on social issues rather than business was actually hurting the company. However, the founder, Anita Roddick, refused to accept this fact. Since 1998, Anita had devoted a lot of her time on the Company. She had traveled all over the world every year for sourcing new products and setting up new community trade programs. Anita said she saw herself as guardian of the Body Shop's "DNA" which was the strong social, ethical and environmental stance of the company. She said, "That's what sets us apart. If you took that away from us, we'd be a dime-a-dozen cosmetics company." 6 After his ascent to power, Patrick Gournay immediately implemented a retrenchment of 300 staff aimed at reduction of cost. In spite of the management overhaul, the company ran into losses in the year 2000. Some of the issues yet to be addressed were that of inventory accumulation and excessive new product launches. The inventory management problem was an outcome of a move by the company. In the early 1990's the Body Shop used to operate with the franchisee model. But by the late 1990's the company started to buy back the franchised outlets and the franchisee was offered a job as an employee in the parent company. This created a problem with the franchisees that were not willing to sell off their business. The Body Shop retaliated by restricting the supply of its key products to the franchisee. This had a two way effect on the parent company. On one hand inventory started to accumulate and on the other hand the company lost revenue and customers. The percentage of franchised outlets dropped from 75% in 1993 to around 10% in 2000. Coupled with that, almost 100 new products were launched in the 19992000 period, which only aggravated the problem. In an interview, Mr. Gournay assured that company was taking action to address all the relevant issues. "The Body Shop is restoring margins on last year's products by reducing product costs while also ensuring that current year launches maintain its average margin. The company is also transferring responsibility for inventory management to its regional teams and is this year implementing a much smaller number of new product launches while developing its heritage ranges. For the current year, we are anticipating a reasonable improvement in profit as the benefits of our actions begin to feed through to our results. Overall, we have made significant progress with implementing the structural changes that were needed to refocus the company on its retailing activities." 7 In April 2001, the Body Shop emerged with a brand-new store format and introduced a new skin care line, a fragrance collection and a new color story for its "Colourings" cosmetics line. It also undertook a restructuring of the corporate logo and came up with a new one. The increasing competition forced the company to relax its stance against mass advertising when in July 2001; the company used an outside advertising agency for the first time in the history of the company. In the same month, the partner and CEO of North American operations of the Body Shop, Adrian Bellamy, decided to sell back his stake in the US business to Anita and Gordon Roddick. Bellamy, who sold his stake for $7.9M in shares and cash, opined that the company "should put profits before passion" 8 and that it needed to adapt its hallmark social crusades, which he thought were not being able to move with the times. Things culminated with the step down of Anita and husband Gordon co-chairs of the company. Anita started to write books and devoted more of her time to launch crusades for social and environmental issues. WHAT LIES AHEAD The new management under Adrian Bellamy met with a lot of difficulties in the early 2000's. After suffering from the problems of stiff competition and mismanagement of stocks, the body shop was not in good position in the early 2005. Matters went to such an extent that the founders Anita and Gordon Roddick sold £ 7.4 m of their shares at 185p in February, 2005. This was followed by sell-off of £ 10 m stake by Ronald-de-Waal, a non executive director, in March 2005. The company took on a massive repositioning activity in early 2005. The company tried to make some drastic changes in their product offering to target the up-market consumers. (Refer to Appendix VII for the Product Categories of The Body Shop) According to Andy King (King), the global marketing director of the company, "We repositioned the brand to carve out a differentiated position in a crowded cosmetics market". 9 King described the new brand image as "masstige" i.e. somewhere between mass market and prestige. Changes had taken place in many aspects. The shop interiors had been changed from the traditional dark floors and walls to neutral tiles and hemp-coated backlit screens. (Refer to Appendix VIII for new store décor of the Body Shop outlets) Colorful and bulging shelves had been replaced with attractive glass counters. Even the black-topped bottles, which used to come in three different sizes (fitting every pocket), had been replaced with 'Boston round' containers with white caps which came only in large sizes. The new 'invent your scent' perfume counter and luxurious 'Spa Wisdom' range, introduced in March, had been designed to tempt those customers who would usually shop at the counters of a department store. The 'love your body' loyalty scheme, which offered a 10 percent discount for customers buying a £5 loyalty card, (Refer to Appendix III) had been successful in attracting customers. The program was launched in the UK in 2004 after a successful five-year run in the US, and had amassed half a million members by mid 2005. The global cosmetics and toiletries industry which was growing at a healthy rate from 2000 also acted as a catalyst in this process. (Refer to Appendix IX) The good times seemed to be back with the company with The Body Shop winning the Royal Society for the Prevention of Cruelty to Animals (RSPCA) Award (Refer to Appendix IX) in 2005 for promoting and practicing animal welfare. The RSPCA award was given to corporations employing best practices in terms of treatment to animals in the cosmetics, fashion and food industries. The Body Shop was the winner in the Cosmetics Category. The awards were given out after judging the policies of the nominees in the respective areas: * Product Ingredient testing on animals. * Product testing on animals. * Labeling. Meanwhile, Anita, the co-founder and the one time chief force behind the company, was still associated with the company as a consultant (other than being a non-executive director) for 80 days a year, and gave her advice on product marketing and the ethical dimensions of the company. However, the question that can be raised is 'how ethical is the Body Shop today?' since its new product offering was going against the famous motto of 'reduce, recycle, reuse' of the company in the 1970's and 1980's. Though the staffs still insist that the company's values were maintained as it was and cite the example of one of their new products in the hair care range, where honey was sourced from 6,000 organic beekeepers in Zambia. With a global presence in 53 countries, Body Shop had to strike a balance between the variable demands of global consumers. Though the question of ethical marketing was an important deciding factor for the consumers in Europe and America, but still the Body Shop was considered to be a prestige brand in the Middle East and Asia. The fact that the Middle East and Asia together comprise of more than 25% of the global cosmetics and toiletries market is supposed to provide the leverage the brand needs. (Refer to Appendix IX) However, time would tell whether the new strategy of the company would bring in new laurels or brickbats. APPENDIX I THE MISSION STATEMENT OF THE BODY SHOP * To dedicate our business to the pursuit of social and environmental change. * To creatively balance the financial and human needs of our stakeholders: employees, customers, franchisees, suppliers and shareholders. * To courageously ensure that our business is ecologically sustainable: meeting the needs of the present without compromising the future. * To meaningfully contribute to local, national and international communities in which we trade, by adopting a code of conduct which ensures care, honesty, fairness and respect. * To passionately campaign for the protection of the environment, human and civil rights, and against animal testing within the cosmetics and toiletries industry. * To tirelessly work to narrow the gap between principle and practice, whilst making fun, passion and care part of our daily lives. Source: http://www.thebodyshopinternational.com/web/tbsgl/about_reason.jsp APPENDIX II THE CORE VALUES OF THE BODY SHOP We consider testing products or ingredients on animals to be morally and scientifically indefensible. We support small producer communities around the world who supply us with accessories and natural ingredients. We know that you're unique, and we'll always treat you like an individual. We like you just the way you are. We believe that it is the responsibility of every individual to actively support those who have human rights denied to them. We believe that a business has the responsibility to protect the environment in which it operates, locally and globally. Source: http://www.thebodyshopinternational.com/web/tbsgl/values.jsp APPENDIX III THE LOVE YOUR BODY LOYALTY CARD Source: The Body Shop Interim Results 2005 APPENDIX IV THE BODY SHOP TRADING CHARTER The way we trade creates profits with principles. We aim to achieve commercial success by meeting our customers' needs through the provision of high quality, good value products with exceptional service and relevant information which enables customers to make informed and responsible choices. Our trading relationships of every kind - with customers, franchisees and suppliers - will be commercially viable, mutually beneficial and based on trust and respect. Our trading principles reflect our core values. We aim to ensure that human and civil rights, as set out in the Universal Declaration of Human Rights, are respected throughout our business activities. We will establish a framework based on this declaration to include criteria for workers' rights embracing a safe, healthy working environment, fair wages, no discrimination on the basis of race, creed, gender or sexual orientation, or physical coercion of any kind. We will support long term, sustainable relationships with communities in need. We will pay special attention to those minority groups, women and disadvantaged peoples who are socially and economically marginalized. We will use environmentally sustainable resources wherever technically and economically viable. Our purchasing will be based on a system of screening and investigation of the ecological credentials of our finished products, ingredients, packaging and suppliers. We will promote animal protection throughout our business activities. We are against animal testing in the cosmetics and toiletries industry. We will not test ingredients or products on animals, nor will we commission others to do so on our behalf. We will use our purchasing power to stop suppliers animal testing. We will institute appropriate monitoring, auditing and disclosure mechanisms to ensure our accountability and demonstrate our compliance with these principles. Source: http://www.thebodyshopinternational.com/web/tbsgl/trading.jsp APPENDIX V SUMMARY OF FINANCIAL DATA OF THE BODY SHOP, PLC. Source: The Body Shop International Plc. Annual Reports 2005, 1999 and 1998. APPENDIX VI SELECTED AWARDS WON BY ANITA RODDICK 1984 - Veuve Clicquot Business Woman of the Year 1988 - OBE - Order of the British Empire 1991 - Center for World Development Education's World Vision Award, USA 1993 - Banksia Foundation's Australia Environmental Award 1993 - Mexican Environmental Achiever Award 1993 - National Audubon Society Medal, USA 1994 - Botwinick Prize in Business Ethics, USA 1994 - University of Michigan's Annual Business Leadership Award, USA 1995 - Women's Business Development Center's First Annual Woman Power Award, USA 1996 - Women's Center's Leadership Award, USA 1996 - The Gleitsman Foundation's Award of Achievement, USA 1997 - United Nations Environment Programme (UNEP), Honouree, Eyes on the Environment 1999 - British Environment & Media Award 1999 - Chief Wiper-Away of Ogoni Tears, Movement for the Survival of the Ogoni People, Nigeria 2001 - International Peace Prayer Day Organisation's Woman of Peace 2003 - DBE (Dame Commander of the British Empire) Source: http://www.anitaroddick.com/aboutanita.php APPENDIX VII PRODUCT LINES AND CATEGORIES OFFERED BY THE BODY SHOP Source: http://www.thebodyshopinternational.com APPENDIX VIII A BODY SHOP OUTLET IN THE LATE 1990's A BODY SHOP OULET IN 2005 Source: Reports from www.thebodyshopinternational.com APPENDIX IX Brief on the Cosmetics and Toiletries Industry 10 The global cosmetics and toiletries industry is valued at US$ 254 billion in terms of revenue in 2005. It consists of the following product categories: bath and shower, fragrance, oral hygiene, skin care, men's grooming products, color cosmetics, hair care, depilatories, deodorants and body care. World sales of cosmetics and toiletries sales were US$170 billion in 1997 which rose to US$ 254 billion in 2005. Western Europe constituted the greatest percentage of share of the global market followed by AsiaPacific, North America and Latin America. In terms of the market share in 2005, Procter & Gamble, L'Oreal, and Unilever were the top three companies in the cosmetics and toiletries industry. Some key information about the industry is presented below: APPENDIX X ADDITIONAL INFORMATION The DBE is an Order of Chivalry considered in the group of The Most Excellent Order of The British Empire and was established on 4 th June 1917 by King George V. The Order includes five classes in civil and military divisions, of which, the DBE being the second in hierarchy, entails Knighthood. Dame is the female counterpart of the knight. Aloe is a genus of succulent, flowering plants in the family Asphodelaceae and contains about 400 different species. They are native to the drier parts of Africa, especially South Africa's Cape Province and the mountains of tropical Africa. Aloe contains a number of medicinal substances used as a purgative and produced from various species of aloe, such as Aloe vera and Aloe vulgaris. Jojoba (Scientific Name: Simmondsia chinensis) is a shrub native to the Sonoran and Mojave deserts of southern California, Arizona, and adjacent parts of northwest Mexico. Jojoba is grown for the liquid wax (commonly called jojoba oil) in its seeds used in cosmetics as a moisturizer and as carrier oil for specialty fragrances. Cocoa butter, also called theobroma oil, is the edible natural fat of the cacao bean, extracted during the process of making chocolate and cocoa powder. It is used for its smooth texture in cosmetics and soaps. The Kayapo are the Gê-speaking native peoples of the plain lands of the Matto Grosso in Brazil, south of the Amazon Basin and along Rio Xingu and its tributaries. Shell is the world's third largest publicly traded Oil Company based on revenues. The company was founded in 1907 when Royal Dutch Petroleum Company merged with the "Shell" Transport and Trading Company Plc. Presently, the company has operations in 140 countries around the world and has corporate headquarters in Hague, Netherlands. Exxon Mobil Corporation or ExxonMobil, headquartered in Irving, Texas, is the largest publicly-traded oil producer and distributor in the world. It was formed on 30 th November 1999, by the merger of Exxon and Mobil and currently has operations in about 200 countries around the world. The Food and Drug Administration (FDA) of the United States is the government agency responsible for regulating various drug and food related activities such as food quality (human and animal), dietary supplements, drugs (human and animal), cosmetics, medical devices (human and animal), biological and blood products in the United States. The Royal Society for the Prevention of Cruelty to Animals (RSPCA) is a charity organisation in England and Wales that promotes animal welfare. Founded in 1824, it has been working for animal welfare activities funded by voluntary donations and is one of the largest charities in the UK. REFERENCE Adler, Carlye. (2001) The Disenfranchised Owning a Body Shop store seemed like the perfect business, with great products and earth-friendly management. So why are some franchisees now suing the company?, Fortune, Retrieved http://money.cnn.com/magazines/fortune/fortune_archive/2001/09/17/310263/ index.htm on 02.01.2008. Barker, Barbara.; Corcoran, Cate T. (2005). Body Shop's IT Makeover. Women's Wear Daily, 189 (72), 13. Bird, Maryann. (2004). Nothing Like a Dame. Time Europe. 164 (14). Retrieved http://www.time.com/time/europe/magazine/printout/0,13155,901041011708947,00.html on 10.10.2005. Body Shop's Founders Give Up Control. New York Times, February 13, 2002. Retrieved www.nytimes.com on 29.09.2005. Body Shop sees Profits Fall by Nearly a Quarter. Cosmetics International, May 25, 2001. Retrieved http://www.findarticles.com/p/articles/mi_go2015/is_200103 on 29.09.2005. Body Shop Profits Slide. October 13, 2005. Retrieved http://www.pinsentmasons.com/press/news/news20051013_4.aspx on 10.10.2005. Body Shop Scrutinized. Report By Franklin Insight Inc. September 1994. Retrieved http://www.trilliuminvest.com/pdf/ifbw_9-94.pdf on 25.09.2005. Entine, Jon. (2002). Body Flop: Anita Roddick proclaimed that business could be caring as well as capitalist. Today The Body Shop is struggling on both counts. Retrieved http://www.jonentine.com/articles/bodyflop.htm on 10.10.2005. Hargrave-Silk, Atifa. (2005). Body Shop kicks off brand revamp in Asia. Media Asia May 20, 11. , Jewell, Wendy. (2004). Business Hero: Anita Roddick. Retrieved http://myhero.com/myhero/heroprint.asp?hero=Roddick on 10.10.2005. Jones, Megan. (1998). A New Way of Doing Business: Interview with Anita Roddick. Share International, April. Retrieved http://www.shareintl.org/archives/socialjustice/sj_mjnew.htm on 10.10.2005. Queen of Green's troubled reign. (1998). Retrieved http://news.bbc.co.uk/1/hi/business/91363.stm on 29.09.2005. Saini, Angella. (2005). Body Shop Gives Itself a Facelift. The Observer, July 17. Retrieved http://shopping.guardian.co.uk/beauty/story/0,1587,1530147,00.html on 10.10.2005. Seeing Wisdom in a Clip jar. (2005). Packaging Magazine, 8 (8), 32. Simms, Jane. (2000). The queen of green. Director, 54 (2), 70. Suzuki, Noriko. (1996). The Truth about The Body Shop. Retrieved http://www.tsujiru.net/compass/compass_1996/reg/suzuki_noriko.htm on 25.09.05. Roddick, Anita. (1991). Body and Soul: Profits with Principles The Amazing Success Story of Anita Roddick & The Body Shop. London, Three Rivers Press. The Body Shop International PLC. Report by Datamonitor. Retrieved from EBSCO on 25.09.2005. The Body Shop International Plc. Annual Reports 2005, 2000, 1999, 1998 and Interim Results Presentation, 2005. Retrieved http://www.thebodyshopinternational.com/web/tbsgl/news_financial.jsp on 25.09.2005 on 10.10.2005. The Roddicks Bow Out as Body Shop Terminates Talks. (2002). Cosmetics International, March 10, Retrieved http://www.findarticles.com/p/articles/mi_go2015/is_200203 on 29.09.2005. Venalainen, Marty. (2002). The Body Shop: The Ethics of the Diesel-Driven 'Queen of Green'. Retrieved http://www.students.yorku.ca/~martyv/bodyshop.htm on 10.10.2005. What's wrong with the body shop? - a criticism of 'green' consumerism. Retrieved http://www.mcspotlight.org/beyond/companies/bodyshop.html on 10.10.2005. ENDNOTES 1 Anita Roddick. "Business as Unusual: The Triumph Of Anita Roddick." Thorsons, UK, 2001. 3 "Body Shop's Founders Give Up Control", New York Times, February 13, 2002. 2 Anita Roddick. "Body and Soul: Profits with Principles The Amazing Success Story of Anita Roddick & The Body Shop." Three Rivers Press, UK, 1991. 4 "Roddick blasts world trade body", BBC, 5 "Body Shop Scrutinized." Report By Franklin Insight Inc. September 1994. http://news.bbc.co.uk/1/hi/special_report/1999/11/99/battle_for_free_trade/535663.stm 6 Jane Simms. "The queen of green." Director, Sep2000, Vol. 54 Issue 2, p70. 8 "The Roddicks Bow Out as Body Shop Terminates Talks." Cosmetics International, March 10, 2002. 7 "Body Shop sees Profits Fall by Nearly a Quarter." Cosmetics International, May 25, 2001. 9 Angella Saini. "Body Shop Gives Itself a Facelift." The Observer, July 17, 2005. http://www.in-cosmetics.com/2007/files/pres_euromonitor_global_trends.pdf on 30/1/08 10 Adapted from data published in Report on Key Trends in the Global Cosmetics and Toiletries Market; Claire Briney. Retrieved from Teaching Case Journal of Applied Case Research ______________________________ Sponsored by the Southwest Case Research Association The Really Good Buffalo Project: A "Values Added" Product Carol Cumber South Dakota State University Tim Nichols South Dakota State University Diane Rickerl South Dakota State University Dwaine Chapel Lake Area Improvement Corp. The Really Good Buffalo Project: A "Values Added" Product If God was the creator and overseer of life, if the morning star, the moon, and Mother Earth combined their talents to give birth and hope to the Indians, if the sun was dispatcher of wisdom and warmth, then the buffalo was the tangible and immediate proof of them all, for out of the buffalo came almost everything necessary to daily life, including his religious use as an intermediary through which the Great Spirit could be addressed, and by which the Spirit often spoke to them. In short, the buffalo was life to the Plains Indians until the white man's goods and ways first eliminated and then replaced the animal. - Text from "The Mystic Warriors of the Plains" by Thomas E. Mails INTRODUCTION The American Indian Higher Education Council annual meeting in Fargo, North Dakota was coming to an end. The hand games competition winners proudly wore their ribbons, and the artists from the traditional and modern arts student show were packing up. A participant openly admired a painting of a young woman fancy dancer she had just purchased. The lobby of the conference hotel was crowded with Native Americans, chatting about the conference and catching up on the news from old friends. A group collaborating on a multi-reservation bison research project sat on circular sofas in the lobby, discussing the work and how it might restore the 'life' of the Plains Indians. The re-introduction of bison on the reservations had provided a unique opportunity to study prairie ecosystems and their relevance to Native Americans. Unfortunately, the price of bison meat had plummeted and bulls that once sold for $2100 were going for $500. Many managers were forced to reduce their herd size. The group was diverse-- in age, background, ethnicity, experience, and perspective. There were traditional Native Americans, a young tribal member struggling to establish a buffalo ranch for his family, tribal college (colleges established on Reservations whose mission was to explore tribal cultures and reinforce them using curricula and institutional settings conducive to the success of American Indians) staff members working on curriculum development, university faculty interested in bison research, non-native buffalo producers, and an indigenous spiritual leader grounded in the prayers, ceremonies, songs and stories of the 'buffalo nation'. The pivotal question of "What can we do?" emerged. There was research money available to study ruminants, and buffalo qualified. The "round sofa" conversation evolved into an idea about niche marketing buffalo raised by Native Americans. Immediately 'values' and not just 'value' became part of the discussion. The group parted with an idea of developing into a team that would work on a project regarding a 'values added' brand for buffalo raised by Native Americans. The idea offered something for everyone: a potential market for bison producers; a unique case to be developed by educators; an opportunity for scientists interested in either ecological or marketing research; and an opportunity for cultural leaders to share knowledge with interested audiences. The idea grew and various possibilities were imagined. Several months later, the first meeting of the 'Really Good Buffalo Project' was convened. As the topic of developing a niche market for premium, native raised bison was broached, the team was passionate and optimistic. One participant stressed that, "The buffalo can play a key role in rebuilding our reservation economy." Others were quick to agree, sharing facts and experiences with other programs. The momentum for moving ahead built quickly. As the conversation died down, a quiet Lakota man took the floor and said, "We must never exploit the buffalo nation to make money…for our own selfish interests. Tatanka is our sacred relative…he is our brother." Tatanka (pronounced Ta-TONK-a) was the Lakota word for buffalo. These comments amplified the magnitude and importance of the work to everyone present. This endeavor would not be just another strategic marketing session or business planning process. The team committed themselves to making sure that whatever approach was taken, the indigenous values represented in tribal peoples' relationship with bison would be honored and integrated as the project moved forward. Work, research and conversation over the ensuing months would be devoted to identifying and articulating these values and the essence of this special relationship. But the tension between economic exploitation and spiritual reverence for the buffalo would remain a critical project dynamic. The importance of the diversity of the team, and the respect for multiple, sometimes conflicting viewpoints was paramount. Team members left the meeting with different perspectives…somewhat confused and conflicted, and not sure which way to proceed. The upcoming months would be busy ones as they studied whether they should pursue Really Good Buffalo. THE NATIVE AMERICAN INDIAN AND BISON CULTURAL CONNECTION i To show respect of the Native American oral tradition, the Native American Indian and bison cultural connection should be read in full verse (Appendix A). It is based upon the story of White Buffalo Calf Woman Brings the First Pipe, as told by Joseph Chasing Horse. Chasing Horse explained that a White Buffalo Calf appeared to the Lakota people and changed into a woman. She brought them a sacred bundle that contained the first pipe and taught them the seven sacred ceremonies. Before she left, she promised to return for the bundle and made a prophecy that the birth of a white buffalo calf would be a sign that it was near the time of her return to purify the world. The recent birth of a white buffalo calf named 'Miracle" meant that an age of ensuing harmony and balance was coming. In the words of Joseph Chasing Horse, "We are praying that mankind does wake up and think about the future, for we haven't just inherited the earth from our ancestors, but we are borrowing it from our unborn children." There continued to be a vital connection between the American bison and the Native American Indian, both historically and spiritually. This could be explained as follows: The American bison and the Native American Indians lived together in harmony for many years on the Great Plains before European pioneers and the railroad started to move west. The Plains Indians were almost totally dependent upon the bison. They were a source of food, shelter, utensils, and clothing and most importantly spiritual strength. The American bison sacrificed its life to keep the American Indian in existence. The bison made the people strong because of the spiritual and emotional connection. The Indians watched the herds and gained an understanding of their ways and learned from them. When the bison and Native Americans started to be an obstacle to the westward expansion, the United States government decided both had to be controlled and removed. What was almost the end of the bison was also almost the end of the Native Americans. The Plains Indians depended on the bison for food, shelter, clothing, tools and spiritual strength. Destroying the bison herds and confining Indian families to reservations destroyed the sustainability of their life and culture, and left them dependent on government support for food, housing and health. In addition, government regulations forbade the use of native languages and religious ceremonies and in some cases removed Indian children from their families to be educated in boarding schools far away from Tribal influence. Of the country's 2.1 million Indians, about 400,000 live on reservations. In 1990, census data indicated that 31% of American Indians were living in poverty compared to 13% of all Americans. The Census data indicated an average per capita annual income of $4,124 on the Navajo Reservation compared to $13,461 for all of Arizona. An annual survey done by the Oglala Sioux Tribe reported that unemployment on the Pine Ridge Reservation in 1998 was 73% compared to 4.1% for all of South Dakota. To complicate matters further, there was a lack of consistent data for Indian country. Few people understood the status of American Indian and Alaska Native Nations and the 'trust responsibilities' between the federal government and Indian Tribes. Currently, both the Native Americans and the American bison are seeing an increase in their numbers and are coming back. Again, bison were serving as a source of healthy food and spiritual strength. The bison has the potential to provide spiritual/cultural revitalization, ecological restoration, education, and economic development. Unfortunately, the bison market has been as volatile as the population numbers themselves. Bison numbers estimated at 60 million in the mid-1800s plummeted to 1000 in the late 19 th century. In the late 20 th century numbers were near 250,000 and some models predicted that populations would reach pre-European settlement numbers in as little as 30 years. Buffalo ranching grew rapidly in the 1990's as demand for fancy meat cuts soared. Producers were unable to meet demands, transportation and slaughter regulations could not be met in rural areas, and a lack of central coordination led to the collapse of the newly found market. Bulls selling for $2100 dropped to $500 in 2000. By 2003, the market had begun to climb again. Bison meat was seen as delicious, nutritious, and environmentally sustainable, "At last, steak without guilt." In 2006, bison meat sales had grown by more than 20% and were up another 20% by August 2007. Researchers suggested four requirements to maximize meat quality, land value, and economic return: balanced vegetation, grazing, and predation; minimal handling and artificial input; final product branding; and cooperative ownership. All of these requirements were of interest to the Really Good Buffalo team. CULTURALLY APPROPRIATE TREATMENT OF BISON A non-native ecological researcher shared this personal reflection on Native American treatment of bison: "I was headed out to Mission, South Dakota on the Rosebud Indian Reservation to collect my summer plant samples from the bison range. It was a six hour drive from the University and I pulled into the gas station in Mission before heading out to the pasture. The Rosebud bison herd manager pulled in next to me with a large double cab truck pulling a flatbed trailer. Stretched out on the trailer were two huge bison bulls. The manager had slaughtered them minutes ago and was headed to the closest meat processing plant. Because of federal regulations, he had only two hours to move them from the pasture to the nearest packing plant. The trip from Mission to the processing facility in Nebraska was almost 70 miles and he had already spent time completing sacred ceremonies, loading the animals and leaving the pasture. He warned me that the remaining buffalo were frightened by what had happened, so they would be nervous. He planned to use the buffalo loin to make jerky, which the Tribal students would sell as a fund raiser at the Tribal College Bookstore. The rest of the meat would be given away to elderly in the reservation community and donated for Pow Wows (a gathering to dance, sing, and socialize) or Give Aways (celebrations to honor someone, or for some special event that includes giving gifts). I headed to the pasture and was glad the buffalo were not by the gate. But, when I turned toward the research plot area, I realized that the herd was clustered where I needed to take samples. I drove my small truck to the first area and got out to cut my samples. Three bulls moved toward me and stood between me and the herd. I moved to the other side of my truck and worked rapidly. The bulls were talking. I had never heard them before, or been this close to them. When I got back in the truck and headed for my next plot, the bulls followed me, always staying between me and the herd, and me always keeping on the far side of the truck. They kept talking. I finished my samples and headed back toward the gate. The bulls didn't follow me; they stayed with the herd, glad to see me leave." This story was an illustration of the important aspects of the Really Good Buffalo Project. First, the herd manager was rushing to the meat processing plant because United States Department of Agriculture (USDA) regulations required that the animals reach the plant within two hours of slaughter. To meet cultural concerns, the animals had to be killed in the pasture where prayers and ceremonies could be performed. A goal of the project was to meet both cultural and market demands. Second, the experience of the non-native researcher with the bulls gave her a sense of the spirituality that the Lakota connect with bison. The bulls were 'talking" and 'protecting" the herd. Several factors contributed to the complexity of raising buffalo on the reservation. The bison themselves were not domesticated and often suffered injury or death when manipulated through loading chutes into transport trucks. If the buffalo was spared this trauma and was harvested on site, special rituals were performed before and after the buffalo was killed. Therefore, field harvesting facilitated the requirements of a traditional kill. If harvested in the traditional way, however, the meat was not USDA approved, and could not be sold outside of the state. The bison pastures were located in remote areas, difficult to access and isolated from meat processing facilities. Because of the importance of the sacred connection between Native Americans in the Northern Great Plains and bison, an indigenous homeland philosophy was constructed to guide those interested in bison education work. This philosophy was as follows: Participating tribal colleges and universities of the Northern Plains Bison Education Network believe sacred cultural connections exist between and among the bison, the land, and the people indigenous to the Northern Great Plains. Because of these unique relationships, the bison education work, advanced by NPBEN will be based on an Indigenous homelands philosophy that embraces and promotes the understandings that… a) bison are to be respected as sacred animals and relatives important to the well-being of prairie ecosystems and people, in particular, tribal nations and native people; b) bison will be sustained in a natural, compatible environment with minimal interference, restrictions, and constraints; c) human interaction with bison will be represented in a caretaker role that may be different from the traditional Euro-American or Western agriculture management model; and d) the caretaker role for bison will entail humane, low stress handling methods and resources. ii THE INDUSTRY AND COMPETITION According to 2002 USDA census data, there were 232,000 bison in the United States residing on private ranches and farms, with 4,000 private U.S. ranches and farms raising bison. The industry was very fragmented, and consisted primarily of small producers. Nationally, only 30,000 bison were slaughtered under federal inspection in 2004. This number, although small, was more than double the figure from 2000. Direct sales through the internet was a major marketing technique, for the small producers didn't have well established distribution channels. The National Bison Association existed as a "community bound by the heritage of the American bison/buffalo and the quality of its products." Consumers could visit their website to access a locator map to find bison meat, products and services in their area. A major selling point of bison was that it often earned the "organic" label. According to The Buffalo Guys website, "none of their animals receive growth hormones; artificial insemination is not practiced; the estrus period of the cows is never manipulated; no animal by-products are fed to their animals and sub-therapeutic medicines are never used. The animals breed on their own schedule; they have their calves at their own speed in open pastures, and they grow as their own genes dictate. They depend on their wildanimal-immune-systems to protect them from most illnesses. The lands they manage are rotationally-grazed and are monitored yearly to ensure the range lands health and vitality. Chemical, non-natural solutions are never used when a natural or organic solution is available." iii Although treatment of bison was highlighted in various producers' promotional materials, a values approach that respects the Native American-bison cultural relationship was not evident. BACKGROUND OF THE REALLY GOOD BUFFALO PROJECT For several years, an effort to 'bring back the buffalo' was of key interest in many American Indian communities across the country, and particularly in the Northern Plains. This region was also home to a majority of the nation's 1994 tribal land grant colleges (a government categorization that resulted in designated research funding opportunities), several of which had developed bison curriculum, worked with private tribal producers and established their own university herds. Tribal college faculty approached colleagues at South Dakota State University during a meeting of the American Indian Higher Education Consortium (AIHEC) with the desire to develop a niche market for Native American-raised bison (as described on page 1). The Lakota words for the concept underlying the effort are Tatanka Waste (pronounced Ta-TONK-a Wash-TAY), roughly translated as Really Good Buffalo. Two unique factors influenced the implementation of the Really Good Buffalo projectthe dynamics of collaboration between 1862 and 1994 land grant universities, and the unique historical, cultural, and spiritual relationship between American Indians and bison. These issues, and the diverse consortium of partners involved made it critically important that the project deliberately address values as part of the niche market analysis. As one tribal partner stated, "Great care must be taken when we are working with our brothers, the buffalo." A proposal titled 'Tatanka Waste' was developed by the group and funded through the larger umbrella of the Four-State Ruminant Consortium, a USDA project. Project objectives were: 1. To define a "brand" or term that encapsulates culturally appropriate bison production and processing. 3. To develop and administer surveys to key producers and consumers to determine the market potential for the newly "branded" bison and bison products. 2. To utilize the diversity of the consortium members to brainstorm and define the production and processing guidelines to meet the "brand" requirements. 4. To organize, catalogue, and analyze the results of those surveys. 5. Based on analysis of the data and the parameters set forth in the initial conversations, to develop strategic implications for business development. A CULTURALLY SENSITIVE RESEARCH APPROACH Because there were contrasting values of American Indian and mainstream communities (see Appendix 2), a protocol for researchers interested in working with contemporary American Indian people was developed. Experts submitted that the research agenda be set by the community; that efforts directly involved and were respectful of Native people; that results were openly shared with subjects, and that the research had a tangible benefit for the community. Traditional western scientific methods were criticized because their colonizing methodologies were inappropriate for research with contemporary tribal people. The project was guided by indigenous scholars with unique values, attitudes, and behaviors (see Appendix 3), and by the diverse consortium of stakeholders assembled around Really Good Buffalo. Both qualitative and quantitative methods were used, including focus group discussions, interviews, and a survey with results analyzed statistically. The initial meeting of the consortium included presentations from tribal elders; private, tribal, and tribal college bison producers/managers; and experts in marketing and agricultural finance. This meeting included facilitated focus group discussions around the following questions: >What essential American Indian values should Really Good Buffalo represent? >What are the implications of these values for harvest and processing of Really Good Buffalo? >What are the implications of these values for production of Really Good Buffalo? Responses to these questions shed further light on the complexity and sensitive nature of the topic. Often times, economic concerns were in conflict with the cultural and spiritual values consortia members wanted reflected in the Really Good Buffalo brand. Discussions included a variety of concerns and viewpoints that ranged from, "We must never exploit the buffalo nation to make money" and "How can we sell our brother?" to "Buffalo have always been the mainstay of our people." Among the emergent themes from the focus groups were that Really Good Buffalo should be: premium quality, nutritious, natural, environmentally friendly, chemical and hormone free, raised by American Indians, treated with respect and harvested in the field. Also discussed was the need for the niche marketing effort to ultimately benefit tribal people. For example, participants discussed selling enough Really Good Buffalo at premium prices to help support prairie restoration efforts and the distribution of Really Good Buffalo meat to reservation elderly and school nutrition programs at reduced costs. To help validate this input, a series of in-depth follow up interviews were conducted with tribal elders, nutritionists and bison program managers on the South Dakota Cheyenne River Indian Reservation. Interview results and the compiled focus group results were shared at a subsequent meeting of consortium members. Consensus on the elements for a definition of the Really Good Buffalo brand was reached. Input was collected for the construction of a consumer survey, and for the more formal organization of the producers on the team. Following market research approaches, a 'concept testing' methodology was used. Commonly used in developing corporate marketing campaigns for new products, concept testing was the process of using quantitative and qualitative methods to evaluate consumer responses to a product idea prior to the introduction of the product to the market. A survey was developed and mailed to consumers of buffalo. The consumer survey included 24 items consisting of both open-ended questions and a Likert-type scale. Surveys were mailed to a nation-wide sample of 450 customers of a regional marketer of premium bison meat. These customers had been identified by the Wild Idea Buffalo Company as people who had previously purchased buffalo meat. A follow-up post card was distributed resulting in a total of 235 returned surveys, which was a 52% response rate. Quantitative results were analyzed using SAS. Simple statistics and frequencies were calculated, as were correlations between variables. Open-ended, qualitative responses were transcribed verbatim, and data were coded and classified according to emergent themes. Results were presented and implications for a business plan were discussed at a final meeting of the consortium held in late summer 2005. CHARACTERISTICS OF RESPONDENTS: CONSUMERS Demographic characteristics of consumers indicated that survey respondents were predominantly white males between the ages of 51 – 65 years old, with nearly 80% having at least a four-year degree. More than 90% of the respondents earned greater than $40,000 per year, and 43% held a management/professional position. Results Surveys indicated that an overwhelming majority of the 235 respondents (92%) supported the idea to create a Really Good Buffalo concept of meat production. More than 80% of consumer respondents indicated they would be likely or very likely to purchase the product. The mean response to this item (1 = unlikely, 2 = perhaps, 3 = likely, 4 = very likely) was 3.22. In addition, potential consumers stated that they would be interested in purchasing other, non-meat Really Good Buffalo products, including leather (43%), artwork (31%), hides (18%), and other (9%). In ranking the importance of several Really Good Buffalo criteria, almost 89% of consumers said that environmentally friendly production practices were very important components of the brand, followed by chemical free (86%), nutrition/health benefits (83%), respectful/humane treatment of animals (82%), and supporting prairie restoration (82%). Almost 43% of respondents thought price was very important, while 28% thought the buffalo being raised by American Indians was a very important aspect of the brand (see Appendix 3). When asked for open-ended responses to "other important factors", 18 responded that distribution, shipping, and packaging were important concerns; 12 commented about the importance of the animals being grass-fed and not going to feed lots, and nine expressed concern over humane production and harvesting practices. Four indicated health benefits were most important, while two said product taste and quality were of prime concern. Cost was cited (n = 25) as being an important consideration impacting consumers' likelihood of purchasing Really Good Buffalo. One said, "It will come down to cost." Another cited premium bison meat products currently available as being "too expensive to eat on a regular basis." Several respondents (n=16) cited distribution concerns such as access, shipping, handling and packaging as issues that would impact their buying decision(s). Others (n = 14) indicated loyalty to existing suppliers as a reason not to purchase Really Good Buffalo, while five responded they would 'shop around', indicating they would try the product and would likely purchase again if they had a satisfying consumer experience. One said, "Its flavor would have to be worth the extra money." When asked relative to beef, how much consumers would expect to pay for Really Good Buffalo, 55% of the respondents stated that they would pay 50% more for buffalo than beef. Many respondents (48%) stated that they eat red meat 2-3 times per week, with 48% indicating that they would serve Really Good Buffalo at least 2-3 times per week. REPORT SUMMARY A brand definition for Native American-raised Really Good Buffalo elicited favorable responses during concept testing research among potential producers and consumers of the product. Respondents indicated positive reaction to values associated with this agricultural product, including environmentally friendly, chemical free, nutrition/health benefits, humane treatment of animals, taste, support for prairie restoration and Native American communities. This 'values added' approach represented an important potential niche market and affirmed production, processing and marketing approaches favored by many contemporary tribal bison producers. Other researchers found that consumers in California wanted to know more about their food, including safety, nutrition, and ethical issues, such as treatment of animals, environmental impacts, and wages and working conditions for those who produce their food. South Dakota and other states were attempting to establish premium state-based brands in order to differentiate their products in the marketplace. The concept testing process associated with this project aimed to determine whether or not a brand based on traditional Native American values, which guide treatment of buffalo, could translate into a niche market for Native American-raised premium bison meat and products. Preliminary results presented in the report appeared promising. Results were limited in their generalizability due to a non-random consumer sample. CONCLUSION The diverse group of individuals interested in the Really Good Buffalo project had listened attentively to the results of months of data gathering and concept testing. They had asked intelligent questions, and now had a much better idea of how to brand a product, and whether consumers were interested. They understood that much remained to be done. Central to future discussion would be determining what to conclude from the information they had been given. What would a Really Good Buffalo branding statement entail? What were the strategic implications of what they'd just heard? Should they go ahead with the Really Good Buffalo project? If so, what should be the next steps? Appendix 1 as told by Joseph Chasing Horse White Buffalo Calf Woman Brings the First Pipe (http://www.kstrom.net/isk/arvol/buffpipe.html 3/26/07). We Lakota people have a prophecy about the white buffalo calf. How that prophecy originated was that we have a sacred bundle, a sacred peace pipe, that was brought to us about 2,000 years ago by what we know as the White Buffalo Calf Woman. The story goes that she appeared to two warriors at that time. These two warriors were out hunting buffalo, hunting for food in the sacred Black Hills of South Dakota, and they saw a big body coming toward them. And they saw that it was a white buffalo calf. As it came closer to them, it turned into a beautiful young Indian girl. That time one of the warriors thought bad in his mind, and so the young girl told him to step forward. And when he did step forward, a black cloud came over his body, and when the black cloud disappeared, the warrior who had bad thoughts was left with no flesh or blood on his bones. The other warrior kneeled and began to pray. And when he prayed, the white buffalo calf who was now an Indian girl told him to go back to his people and warn them that in four days she was going to bring a sacred bundle. So the warrior did as he was told. He went back to his people and he gathered all the elders and all the leaders and all the people in a circle and told them what she had instructed him to do. And sure enough, just as she said she would, on the fourth day she came. They say a cloud came down from the sky, and off of the cloud stepped the white buffalo calf. As it rolled onto the earth, the calf stood up and became this beautiful young woman who was carrying the sacred bundle in her hand. As she entered into the circle of the nation, she sang a sacred song and took the sacred bundle to the people who were there to take of her. She spent four days among our people and taught them about the sacred bundle, the meaning of it. She taught them seven sacred ceremonies. One of them was the sweat lodge, or the purification ceremony. One of them was the naming ceremony, child naming. The third was the healing ceremony. The fourth one was the making of relatives or the adoption ceremony. The fifth one was the marriage ceremony. The sixth was the vision quest. And the seventh was the sundance ceremony, the people's ceremony for all of the nation. She brought us these seven sacred ceremonies and taught our people the songs and the traditional ways. And she instructed our people that as long as we performed these ceremonies we would always remain caretakers and guardians of sacred land. She told us that as long as we took care of it and respected it that our people would never die and would always live. When she was done teaching all our people, she left the way she came. She went out of the circle, and as she was leaving she turned and told our people that she would return one day for the sacred bundle. And she left the sacred bundle, which we still have to this very day. The sacred bundle is known as the White Buffalo Calf Pipe because it was brought by the White Buffalo Calf Woman. It is kept in a sacred place (Green Grass) on the Cheyenne River Indian reservation in South Dakota. It's kept by a man who is known as the keeper of the White Buffalo Calf Pipe, Arvol Looking Horse. When White Buffalo Calf Woman promised to return again, she made some prophecies at that time. One of those prophesies was that the birth of a white buffalo calf would be a sign that it would be near the time when she would return again to purify the world. What she meant by that was that she would bring back harmony again and balance, spiritually. No matter what happens to Miracle in the coming months and years, Joseph Chasing Horse says the birth is a sign from the Great Spirit and the ensuing age of harmony and balance it represents cannot be revoked. That doesn't mean, of course, that the severe trials Native Americans have endured since the arrival of Europeans on these shores are over. Indeed, the Lakota nation mounted the longest court case in U.S. history in an unsuccessful effort to regain control of the Black Hills, the sacred land on which the White Buffalo Calf Woman appeared 2,000 years ago. Still, despite their ongoing struggles, Native Americans are heartened by the appearance of a white buffalo in Janesville, and have hope for a harmonious and prosperous future. "Mention that we are praying, many of the medicine people, the spiritual leaders, the elders, are praying for the world," says Joseph Chasing Horse. "We are praying that mankind does wake up and think about the future, for we haven't just inherited this earth from our ancestors, but we are borrowing it from our unborn children." Appendix 2 Model of Contrasting Values (Source: Modified from Teaching and Learning with Native Americans: A Handbook for Non-Native Adult Educators. Accessed on-line at http://www.literacynet.org/lp/namericans/values.html 3/20/07). Appendix 3 Traditional Native American Values, Attitudes and Behaviors Attitudes and Behaviors Values Cooperation Agreement and cooperation among tribal members are all-important. This value is often at odds with the competitive spirit emphasized in the dominant society. Group Harmony The needs of the group are considered over those of the individual. This value is often at variance with the concept of rugged individualism. Modesty Even when one does well and achieves something, one must remain modest. Autonomy Value is placed on respect for an individual's dignity and personal autonomy. Placidity Indians are generally slow to demonstrate signs of anger or other strong emotions. This value may differ sharply from that of the dominant society, which often values action over inaction. Patience To have the patience and ability to wait quietly is considered a good quality among Indians. Generosity While the concept of sharing is advanced by most cultures, it may come into conflict with the value placed by the dominant society on individual ownership. Indifference to Work Ethic Adherence to a rigid work schedule was traditionally not an Indian practice. Moderation in Speech Many Indians find small talk unimportant. In social interactions, Indians emphasize the feeling or emotional component rather than the verbal. Ideas and feelings are conveyed through behavior rather than speech. Many Indians still cover the mouth with the hand while speaking as a sign of respect. Careful Listening Listening skills are emphasized, since Indian culture was traditionally passed on orally. Storytelling and oral recitations were important means of recounting tribal history and teaching lessons. Careful Observation (Source: Modified from The American Indian: Yesterday Today and Tomorrow, A Handbook for Educators. California Department of Education, Bill Honig, State Superintendent of Public Instruction, Sacramento, 1991. Accessed on-line at http://www.literacynet.org/lp/namericans/values.html, 3/20/07). Appendix 4 Consumer identification of the importance of certain characteristics associated with Really Good Buffalo (Source: Author survey) Endnotes: i Whenever possible, native authors have been used as sources of information. iii From "The Buffalo Guys" website http://www.thebuffaloguys.com/who we_are.asp ii Information found in the Bison Education Resource Guide. References: Anderson, A. (2006). Living on the Reservation. Mises Institute. Accessed on-line at http://www.mises.org/story/2324, 8/14/2007. Burros, M. (2007). "Home Again on the Kitchen Range." The New York Times. Accessed on-line at http://www.nytimes.com/2007/08/15/dining/15biso.html, 11/22/2007. Beheler, J. (2001). "Introduction to Northern Plains Bison Education Network." Bison Education Resource Guide, pp. 4-5. Crazy Bull, C. (1997). "A Native Conversation about Scholarship." Tribal College Journal 9(1): 17-24. Howard, P. (2005). "What Do People Want to Know About Their Food? Measuring Central Coast Consumers' Interest in Food Systems Issues." Center Research Brief #5. Santa Cruz, CA: Center for Agroecology and Sustainable Food Systems. Honig, B. (1991). The American Indian: Yesterday Today and Tomorrow, A Handbook for Educators. California Department of Education, Bill Honig, State Superintendent of Public Instruction, Sacramento. Accessed on-line at http://www.literacynet.org/lp/namericans/values.html, 3/20/07. Kraus, B. (2001). "Wealth, Success and Poverty in Indian Country. Poverty and Race. May/June Issue. Accessed on-line at http://www.prrac.org 11/22/2007. Moriarty, M. and M. Venkatesan (1978). "Concept Evaluation and Market Segmentation." Journal of Marketing 42(3): 82-86. Mails, T. (2002). The Mystic Warriors of the Plains: The Culture, Arts, Crafts and Religion of the Plains Indians. New York: Marlowe and Company.Martin, M. and J. Wood. "Bison Research for the Native American Community." Accessed online at http://www.ag.ndsu.nodak.edu/carringt/bison/native_american.htm 2/27/07. North American Bison Cooperative (2007). Accessed on-line at Pearce II, J. and R. Robinson, Jr. (2005). Formulation, Implementation, and Control of Competitive Strategy. Boston: McGraw-Hill/Irwin. http://www.umanitoba.ca/afs/agric_economics/ardi/nabc.html, 8/14/2007. Power Decisions Group. "Concept Testing." Accessed on-line at http://www.powerdecisions.com/consult-brand-development.cfm 3/22/07. Smith, L. (1999). Decolonizing Methodologies: Research and Indigenous Peoples. New York: St. Martin's Press. Schultz, M. and M. Kroeger (compilers). Teaching and Learning with Native Americans: A Handbook for Non-Native Adult Educators. Accessed on-line at http://www.literacynet.org/lp/namericans/values.html 3/20/07. The Buffalo Guys. Accessed on-line at http://www.thebuffaloguys.com/who we_are.asp 12/11/07. Yorks, T. and K. Capels. (2001). "Preparing for the Future: Projecting Bison Herd Sizes, Market Potentials, and the Most Effective Management Pathways." International Symposium on Bison Ecology and Management in North America. Irby, L. and "White Buffalo Calf Woman Brings the First Pipe", as told by Joseph Chasing Horse. Accessed on-line at http://www.kstrom.net/isk/arvol/buffpipe.html 3/26/07. J. Knight, eds. Bozeman, MT: Montana State University. Accessed on-line at http://highlevelresearch.org/Yorksite/Bison.html, 11/26/2007.
<urn:uuid:443249e3-d675-4e44-bb40-1c0af7b0ed17>
CC-MAIN-2019-09
http://swcra.net/Cases/V7_N2.pdf
2019-02-21T11:58:30Z
crawl-data/CC-MAIN-2019-09/segments/1550247504594.59/warc/CC-MAIN-20190221111943-20190221133943-00599.warc.gz
253,175,985
29,740
eng_Latn
eng_Latn
0.927166
eng_Latn
0.998827
[ "lvs_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn"...
false
docling
[ 81, 517, 766, 814, 1095, 4094, 4354, 7653, 9738, 12902, 15809, 19183, 22668, 26058, 29119, 32537, 34557, 34618, 34696, 34781, 34923, 35241, 38316, 41154, 44230, 46239, 49112, 52496, 55298, 58419, 59856, 63084, 65761, 67268, 67538, 70761, 74079,...
[ 0.80078125, 3.015625 ]
1
1
Home Security Survey Study Guide Crime Prevention is the anticipation, recognition, and appraisal of a crime risk and the initiation of some action to remove or reduce it. Several basic crime prevention ideas are: 1. Criminals are less likely to target areas where they feel their actions will be seen, recognized, and reported. 2. Good landscaping and lighting can be used to minimize hiding spots for criminals and maximize the ability of property owners, surrounding neighbors, and passers-by to observe activity on the property. 3. Properties that are well cared for and have clearly defined boundaries are less desirable to criminals because property owners appear more likely to take action to protect their property, and strangers (including criminals) are more easily recognized as being out-of-place. 4. Areas with positive activity increase the reporting of criminal activity, sometimes before the crime can be committed. Crime Prevention Through Environmental Design, or CPTED is a crime control philosophy that attempts to apply physical design, citizen participation and law enforcement strategies in a comprehensive way to protect facilities or neighbors. The goal of CPTED is to reduce the opportunity for crime to occur. CPTED is the proper design and effective use of the built environment that can lead to a reduction in the fear and incidence of crime, and an improvement in the equality of life. Key CPTED concepts are: 1. Natural Surveillance: which is the organization of physical features, activities, and people in such a way as to maximize visibility. It creates a risk of detection to intruders and offenders, and a perception of safety to the legitimate users. 2. Natural Access Control: would be perpetrators of crime like settings or environments they can enter or leave without being notified. The objective of natural access control is to create a perception of risk to potential offenders and deny them access to targets. 3. Territoriality: includes the use of physical attributed that express ownership, such as fences, pavement treatments, art, signage and landscaping. Three steps you can take for improving the safety of your property and neighborhood are: 1. Identify features on your property which increase opportunities for criminal activity. Complete a survey of your own property. Note anything in the physical environment that can give criminals the edge (dark areas, hiding places, etc.). 2. Decide on ways to decrease criminal opportunities by improving landscaping and lighting. 3. Implement your ideas. This is the most important step. Many people don't take action until after they have been the victim of a crime. In 2017, there was an estimated 1.4 million residential burglaries in the United States according to the Uniformed Crime Report released by the FBI. Some of these burglaries could have been prevented simply by making a home more difficult to enter and less appealing to burglars. Remember: Keep your doors and windows locked and your garage doors closed, whether you are at home or not. Most burglaries are committed through unlocked doors/windows. General Recommendations: - Lighting o Be careful about too much glare from lights. Use shielding (no exposed bulbs), when appropriate, and direct light where you want it to go (usually down). o Make sure your lights do not shine into neighbors' windows, causing them to close their blinds. This eliminates natural surveillance to your property. o Lights should be protected from being easily unscrewed or damaged. o Consider photoelectric "eyes" for lights where constant lighting is needed or desired, such as for entry points and certain walkways. o Consider motion sensor lighting for areas where constant lighting is unnecessary or not desired, but where light would be beneficial when activity (either positive or negative) is occurring there, such as certain walkways, driveways, back and side yards, etc. - Landscaping o Bushes/shrubs should be pruned to a maximum height of 3 feet and/or any bushes/shrubs near windows should be pruned at least 6 inches below window level. o Trees should be pruned to remove most or all branches less than 6 feet from the ground. o Areas where you would like to discourage activity (such as below windows) can be landscaped with thorny bushes. o Bushes, shrubs, trees, fences, or other items which prevent you or neighbors from observing people on your property or allow criminals a place to hide or commit crimes out of sight. [x] Think: "Could a criminal break-in through a door or window to my home or attack someone on my property without being easily seen by neighbors or passing street traffic?" o Property lines between public use areas (streets, sidewalks, or neighboring parks) and semi-private (your lawn, driveway, front steps) or private areas (porch, backyard, garage) are not clearly defined. [x] Think: "Can strangers or neighbors easily tell where the boundaries to my property are?" [x] "How easily can neighbors identify if someone is on my property intentionally?" - Physical Security o Deadbolts must throw at least one inch and be made of hardened steel. The cylinder guard must be tapered, round, and free spinning to make it difficult to grip with pliers or a wrench. o A heavy duty strike plate will increase the security of the door frame and make it harder to be kicked in. The heavy duty strike plate uses between four and six, 3 inch screws instead of two or four, quarter inch screws that are in regular plates. - Miscellaneous o Make sure that your house numbers are visible from the street at all times. This is very important and can save police officers, fire fighters, and paramedic's valuable time when responding to your home. Crime Prevention strives to remove the opportunity
<urn:uuid:82d30c6c-f21e-4ce6-9fd8-81ba11c3f9dc>
CC-MAIN-2019-09
https://www.mncpa.net/application/files/3115/4939/8481/CPTED_Study_Guide.pdf
2019-02-21T11:32:12Z
crawl-data/CC-MAIN-2019-09/segments/1550247504594.59/warc/CC-MAIN-20190221111943-20190221133943-00601.warc.gz
896,899,922
1,149
eng_Latn
eng_Latn
0.996381
eng_Latn
0.997638
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 3545, 5795 ]
[ 2.6875 ]
1
0
Recycling as a source of mineral commodities Many existing products provide a low-cost, low-energy source of materials Why Recycle? Just the numbers (U.S.) Quantities of recycled metals (million metric tons per year) 1 * Exports: 18.1 * Total metals recycled: 64.7 Recycling saves energy, money, materials, and natural resources, while reducing landfill use. It supplements the national supply of essential materials, reducing dependence on imports. As more minerals and materials become critically important - particularly in advanced technologies - the role of recycling as a source of these materials is likely to increase. Old Scrap and New Scrap There are two main sources of material for recycling: old scrap (from post-consumer products like cars, electronics, and cans) and new scrap (from the manufacturing process, such as excess material from shaping, cutting, and molding products). Old and new scrap provide different proportions of the recycled material for different metals. Almost all recycled lead comes from old scrap; most recycled copper is from new scrap; and new and old scrap contribute roughly equally to recycled aluminum. Overall, recycling provides 40-50% of the U.S. metal supply. 1,2 Saving Energy Some mineral resources require huge amounts of energy to refine from primary ore. Recycling existing material requires much less energy. In the U.S., recycling saves enough energy to power tens of millions of homes. * Imports: 5.1 Value of recycled metal for the most common industrial metals 1 * $39.5 billion Recycling rates for highly recycled metals (% of apparent supply) 1 * Aluminum, iron & steel: 50-60% * Lead: 70-80% Recycling rates for common items 3 * Iron & steel appliances: 89% * Automobiles: 85% * Steel cans: 70% * Plates & beams: 98% * Construction materials * Rebar & other materials: 71% * Glass containers: 34% Energy savings for production by recycling vs. primary sources * Beryllium: 80% 3 * Aluminum: 92% 4 * Lead: 75% 2 * Iron & steel: 72% 2 Apparent supply is an estimate of the amount of material available to industry, including mine production, recycled material, international trade, and changes in stocks/inventories. Factsheet High recycling rates but low supply For some materials, recycling efficiency is already near its limit. Over 90% 2 of the gold, lead, silver, titanium, and vanadium in recyclable products is currently recycled, but this only provides 30-70% of the necessary supply of these metals. 2 This is largely due to dissipative uses that make recycling products for these metals physically impossible (see "Limitations", below) or economically unfavorable. Limitations * Lag times: A product can only be recycled once it is no longer in use. The "lag time" between the manufacture of a product and its availability for recycling varies between products. For aluminum cans it averages 65 days; for cars it is 12-15 years; for building materials it can be 50 years or more. 4 Although recycling is constantly improving and expanding, there are a number of issues limiting its efficacy: * Dissipation: Many mineral resources are used in dispersive applications or in materials that can't be easily recovered for recycling. These include titanium dioxide in paint, phosphorus in fertilizer, and road salt. * Cost and quality: Some minerals are much cheaper and easier to obtain from their primary sources than from recycling. With the exception of glass, 3 asphalt, and aggregates, 6 recycling is limited for non-metals, especially stones, clays, salts, and silicate minerals. Steel Recycling: more than just iron In 2014, iron and steel accounted for 91% of all metal recycled in the United States. 1 Many mineral resources are mined mainly for use in steel alloys. These include chromium, manganese, molybdenum, nickel, niobium, and vanadium. Steel recycling currently reduces the need for primary production of these elements by 20-40%. 3 Rare Earth Elements There is currently very little recycling of rare earth elements (REE). 7 Many products containing REE are recycled for other components (catalytic converters are recycled for platinum and palladium; colored glass containing REE is recycled for other glass uses). Methods for REE recycling are being developed, and recycling may be a much more important source of REE in the future, particularly in the event of shortages or supply restrictions. Possible sources of scrap containing REE include electronics, lasers, phosphor-based lamps, rare-earth magnets, ceramics, and batteries. More Resources USGS Mineral Resources Program - Recycling: http://minerals.usgs.gov/ minerals/pubs/commodity/recycle/ EPA homepage on reuse and recycling: https://www.epa.gov/recycle References 12014 Minerals Yearbook. U.S. Geological Survey, 2016: http://minerals. usgs.gov/minerals/pubs/commodity/myb/ 2Overview of Flow Studies for Recycling Metal Commodities in the United States. U.S. Geological Survey, 2011: http://pubs.usgs.gov/circ/ circ1196-AA/ 32017 Mineral Commodity Summaries. U.S. Geological Survey, 2017: http://minerals.usgs.gov/minerals/pubs/mcs/ 4U.S. Energy Requirements for Aluminum Production. U.S. Department of Energy, 2007: https://energy.gov/sites/prod/files/2013/11/f4/ al_theoretical.pdf 5Historical Statistics for Mineral and Material Commodities in the United States. U.S. Geological Survey, 2014: https://minerals.usgs.gov/minerals/ pubs/historical-statistics/ 6Recycled Aggregates - Profitable Resource Conservation. U.S. Geological Survey, 2000: https://pubs.usgs.gov/fs/fs-0181-99/fs-0181-99po.pdf 7Rare Earth Elements - End Use and Recyclability. U.S. Geological Survey, 2011: http://pubs.usgs.gov/sir/2011/5094/
<urn:uuid:db92a996-6bdf-49ae-82aa-5d98fede7b6f>
CC-MAIN-2019-09
https://www.americangeosciences.org/sites/default/files/CI_Factsheet_2017_1_recycling_170331_0.pdf
2019-02-21T12:38:19Z
crawl-data/CC-MAIN-2019-09/segments/1550247504594.59/warc/CC-MAIN-20190221111943-20190221133943-00600.warc.gz
740,830,103
1,309
eng_Latn
eng_Latn
0.983459
eng_Latn
0.98446
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 2196, 5705 ]
[ 3.375 ]
2
1
Seasonal Influenza (the Flu) during Pregnancy This sheet talks about exposure to seasonal influenza in a pregnancy or while breastfeeding. This information should not take the place of medical care and advice from your healthcare provider. What is influenza? The typical flu season is from October through May of each year, and usually has the most activity between December and February. The types (strains) of viruses that cause seasonal influenza change a little bit each year. Starting during the 2009-2010 flu season, people got sick from both seasonal influenza viruses and a new type of virus called H1N1. Influenza is an infection of the respiratory (breathing) tract. It is often called the flu. The symptoms of influenza are fever, headache, chills, muscle aches, coughing, congestion, runny nose, and sore throat. Influenza sometimes causes vomiting and diarrhea. Is influenza contagious? How does the virus spread? mouth of infected individuals. When people cough, sneeze, or talk droplets containing the virus are spread through the air. They will travel a few feet from the person, then the droplets will fall and land on surfaces, such as tables and toys. The incubation period (the time between exposure and the development of symptoms) is from 1 to 4 days. Yes, influenza is contagious. The virus is spread through contact with respiratory droplets from the nose and People with flu are most contagious in the first 3 to 4 days after their illness begins. A person with the flu can be contagious for up to 1 week. Can having influenza during pregnancy put my health at risk? Yes. When you are pregnant your body has a harder time fighting infections. Pregnant women have an increased chance of developing serious complications from the flu, such as respiratory distress (severe breathing problems). Does having the flu increase the chance of miscarriage? Miscarriage may occur in any pregnancy. Studies have not associated the flu with a higher chance of miscarriage. A high fever has been associated in some studies with a higher chance of miscarriage. This may be due to birth defects that take place from the high fever or other reasons. Can having influenza during pregnancy cause birth defects or put my baby at risk? Being very sick from the flu may increase the chance of pregnancy complications such as pregnancy loss or premature delivery. It is important to talk with your health care provider if you are pregnant and have symptoms of the flu. In every pregnancy, a woman starts out with a 3-5% chance of having a baby with a birth defect. This is called her background risk. The influenza virus itself has not been shown to cause birth defects. However, having a high fever during early pregnancy might increase the chance for birth defects. Therefore, fever during pregnancy should be treated. Acetaminophen is the drug of choice for reducing fever during pregnancy. Tylenol® is one brand of acetaminophen. MotherToBaby has fact sheets on hyperthermia (fever) and acetaminophen (Tylenol®) at https://mothertobaby.org/fact-sheets/hyperthermia-pregnancy/pdf/ and https://mothertobaby.org/factsheets/acetaminophen-pregnancy/pdf/. How can I protect myself and my baby? A nasal-spray influenza vaccine (FluMist®) is also available. This vaccine contains a live but weakened virus. The nasal-spray influenza vaccine is not recommended during pregnancy. The most important thing you can do for yourself and your baby is to get the injected seasonal influenza vaccine, also known as the flu shot. Because pregnant women are at an increased risk for complications from influenza, women who are pregnant (whether in their first, second, or third trimester), or planning to become pregnant, should get the seasonal flu shot. For more information about the flu vaccines during pregnancy, see the MotherToBaby fact sheet on the Seasonal Influenza Vaccine (Flu Shot) at https://mothertobaby.org/fact-sheets/seasonal-influenza-vaccine-flu-shotpregnancy/pdf/. Wash your hands with soap and water, or use an alcohol based hand sanitizer often In addition to getting the flu shot, be sure that you and others around you are doing the following to help prevent spread of the flu: Do not touch your eyes, nose, or mouth Cover your nose and mouth when you cough or sneeze and ask those around you to do the same. Try to avoid close contact with sick people What should I do if I get sick? . If you have flu-like symptoms, call your healthcare provider right away. Your healthcare provider may recommend antiviral medications to lessen the symptoms of the flu and to reduce the chance of serious illness. The Centers for Disease Control states that antivirals can be used in pregnant women even before confirmation of flu is made by a laboratory. These medications work best if taken early in the course of the illness. For more information about antiviral medications, see the MotherToBaby fact sheet Antiviral Medications to Treat/Prevent Influenza during Pregnancy at https://mothertobaby.org/fact-sheets/antiviral-medications-treatprevent-influenza-the-flu-pregnancy/pdf/ If you are sick, stay home and avoid close contact with others to prevent passing the illness to other people. Drink plenty of fluids. Treat fever with acetaminophen (Tylenol®). Should I talk to my health care provider if one of my family members is sick? Yes. Talk with your healthcare provider if you have been in close contact with someone who has the flu. Your health careprovider can help you decide whether taking an antiviral medication for flu prevention is appropriate for you. Should I stop breastfeeding if I have the flu? It is important to try to protect your baby from getting sick. Wash your hands with soap and water before holding your baby. Avoid coughing or sneezing on your baby. Consider wearing a mask over your nose and mouth while feeding and caring for your baby to help prevent you passing the illness to your baby. While you are ill, you may want to consider having a family member who is not sick help you with caring for your baby. No. There are antibodies in your breast milk that may help prevent your baby from getting sick. If your baby has the flu, it is especially important to breastfeed as often as possible. Your baby will need extra fluids during this time. Your milk is better for this than anything else, even than things like Pedialyte®. Also, antibodies in your milk help your baby fight the infection and get better faster. Be sure to talk to your healthcare provider about all your breastfeeding questions. Please click here for references. October, 2018
<urn:uuid:e4a602be-1a35-4b97-8115-8eea485a0892>
CC-MAIN-2019-09
https://mothertobaby.org/fact-sheets/seasonal-influenza-the-flu-pregnancy/pdf/
2019-02-21T12:38:31Z
crawl-data/CC-MAIN-2019-09/segments/1550247504594.59/warc/CC-MAIN-20190221111943-20190221133943-00604.warc.gz
638,518,523
1,405
eng_Latn
eng_Latn
0.997941
eng_Latn
0.998174
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 3170, 6615 ]
[ 2.890625 ]
2
0
Dan and the Bug A collection of stories for Level - 8 By Clark Ness Visit www.clarkness.com for more free stories and ebooks. Dan and the Bug I see Dan. I see 1 . bug "I am than that ," said Dan. bigger bug "I am Dan," said Dan. "I see sand," said Dan. "I meet the sand," said Dan. "The sand meets me," said Dan "I seem that I see sand," said Dan. happy "I am that I meet the sand," said Dan. happy Dan and the school bus "I am Dan," said Dan. Dan. Dan and the squirrel I see Dan. I see 1 . squirrel "I see 1 ," said Dan. squirrel "I am than that ," said Dan. bigger squirrel "That seems than I am," said Dan. squirrel smaller "See me?" said the ant. "See me? I am 1 ant," said the ant. "See me? I am Nan," said the ant. "See me? I am Nan the ant," said the ant. "See me? I'm an ant," said the ant. "See me? I'm Nan the ant," said Nan. "See me? I am Dan," said the man. "See me? I am Dan the dad," said Dan. "I see Sam, and I see Nan," said Dan. "I see Dad," said Sam. "I need Dad." "I see Dad," said Nan. "I need Dad." "Sam and Nan need me," said Dan the dad. I see Dan the man. I see 1 mat. I see Dan the man, and I see 1 mat. Dan the man needs 1 mat. "I'm Dan the man," said Dan the man. "I need 1 mat," said Dan the man. I see Nan. See that. Nan sat. "I am Nan," said Nan. "I sat," said Nan. Nan seems. happy I Skateboard "I am Dan," said Dan. "I am Sam," said Sam. "I am 1 man, and I am 1 dad," said Sam. Nan and the dog "I am Nan," said Nan. I see Nan. I see sand. I see Nan and sand. Nan sees sand. Nan needs sand. Sam and Nan at the Park I see Sam at the park. I see Nan at the park. I see Sam and Nan at the park. Sam sees Nan. Nan sees Sam. Sam meets Nan. Nan meets Sam. Sam and Nan meet. Story level 8. More free stories and ebooks available at www.clarkness.com and www.readinghawk.com. I see Sam. I see sand. I see Sam and sand. Sam sees sand. Sam needs sand. The Ants and the apple The 3 ants see 1 . apple The seems than the ants. apple bigger The ants seem than the . smaller apple "The seems than I am," said 1 ant. apple bigger
<urn:uuid:2c079123-3e4d-45f0-b877-4db60c77e162>
CC-MAIN-2019-09
http://www.clarkness.com/Reading%20files/Single%20Page%20Stories%20for%20First%20Graders/Beginning%20Reader%20Stories%20Level%2008.pdf
2019-02-21T11:23:40Z
crawl-data/CC-MAIN-2019-09/segments/1550247504594.59/warc/CC-MAIN-20190221111943-20190221133943-00605.warc.gz
320,125,539
676
eng_Latn
eng_Latn
0.993695
eng_Latn
0.999905
[ "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 128, 291, 505, 558, 867, 1082, 1312, 1482, 1577, 1679, 1719, 1798, 1903, 2086, 2165, 2514 ]
[ 3.421875 ]
2
2
Maths Place Value- Identify, represent and estimate numbers using different representations. Find 10 or 100 more or less than a given number. Recognise the place value of each digit in a three-digit number. Compare and order numbers up to 1000. Read and write numbers up to 1000 in numerals and in words. Solve number problems and practical problems. Addition and Subtraction- Add and subtract numbers mentally. Add and subtract numbers with up to three digits, using formal written methods of columnar addition and subtraction. Estimate the answer to a calculation and use inverse operations to check answers. Solve problems, including missing number problems, number facts, place value, addition and subtraction. Multiplication and Division-Count from 0 in multiples of 4, 8, 50 and 100. Recall and use multiplication and division facts for the 3, 4 and 8 multiplication tables. Write and calculate mathematical statements for multiplication and division using knowledge of multiplication tables. Solve problems involving multiplication and division. What you can could do to help: Help your child to learn their times tables. Practise solving calculations using the operations, addition, subtraction, division and multiplication. Help recall number bonds up to 20/50/100. Solve a range of number problems together and show clearly how to work them out. Help your child to understand the place value of different digits up to 1000. Practise reading, writing and ordering numbers up to 1000. Science Light and Shadows - Understand that we need light in order to see things and that dark is the absence of light. Distinguish between light sources and reflectors. Investigate shadows, recording changes in size and identifying patterns. Forces and Magnets - Investigate how objects move on different surfaces and understand what friction is. Investigate materials to find out which ones are magnetic. Computing Search the internet using key words, save websites to favourites, develop and improve word processing skills, insert and format images, using software such as PowerPoint to create and sequence a series of slides, develop own programming skills. RE What is our vision and values? Why are our school values important? What do Christians learn from the creation story? What is life like for a Jewish child living in Britain today? What is the Trinity? PSHE Our themes for PSHE this term are- - Beginning and Belonging. -Family and Friends. -Anti-bullying. English Text Types- Stories with a familiar setting, Recount, Character and Setting description and Instruction Spellings, Punctuation and Grammar- Write in clear sentences using punctuation correctly and consistently. Identify and use adjectives, nouns, similes, verbs, adverbs and alliteration. Use apostrophes correctly. Add suffixes to words and explore different spelling rules. Identify different synonyms for said. Recognise direct speech and inverted commas. Use common homophones correctly. Use the 1 st and 3 rd person when writing. Replace bland verbs with powerful verbs. Use the past and present tense correctly. Respond to texts, identifying the key points and use evidence to support responses. Reading Comprehension, Dictation and Handwriting sessions are carried out weekly. What you can could do to help: Read regularly with your child and discuss the text. Read different types of text, e.g. fiction and nonfiction books, newspapers, leaflets and posters. Ask questions about what they have read, make predictions as to what will happen next and discuss their reasons, find out the meaning of any new words they come across. Practise describing different settings and characters. Write a short story and bring in to share with the class. Maple Class – Year 3 Music Curriculum Overview Autumn Term History/Geography History - Stone Age to Iron Age Britain – Learn about how people lived during the Stone Age and how they made tools and weapons. Investigate Skara Brae (an archaeological site in Orkney) and find out what it tells us about life in the Stone Age. Compare the life of a child during the Stone Age to present day. Learn about Stonehenge and what it may have been used for. Understand why people stopped using stone to make their tools and weapons. Find out about how people lived during the Iron Age. Geography Map out the Orkney Islands and answer positional questions using a compass. Consider where in the world, animals from the Stone Age period would've been located. Let your spirit Fly- R&B Glockenspiel Stage 1 PE Cricket- striking and fielding. Basketball, Football and Hockey. Gymnastics. Art/DT Art Develop skills of drawing, sketching, painting and colour mixing. DT Design and make a Stone age house. Design and create a clay pot Special events and activities Whole school visit to the Pantomime Christmas Activity day Art week History week Useful links MyMath www.mymaths.co.uk www.bbc.co.uk/schools/scienceclips/ www.bbc.co.uk/history/forkids/ http://www.woodlands-junior.kent.sch.uk/Homework/Grivers.html www.maths-games.org/
<urn:uuid:d3556121-2738-4db7-8365-192c56ad40d2>
CC-MAIN-2019-09
http://www.little-waltham-school.co.uk/wp-content/uploads/2019/01/Maple_Class_Curriculum_Overview_Autumn_Term_2018.pdf
2019-02-21T12:25:16Z
crawl-data/CC-MAIN-2019-09/segments/1550247504594.59/warc/CC-MAIN-20190221111943-20190221133943-00603.warc.gz
372,933,079
1,072
eng_Latn
eng_Latn
0.996211
eng_Latn
0.996211
[ "eng_Latn" ]
false
docling
[ 5086 ]
[ 4.28125 ]
1
0
ESOL International English Reading Examination Level C2 Proficient Instructions to learners Check that you have the correct paper. Please complete the information on your mark sheet. Use black or blue ink. Do not use a pencil. You may NOT use a dictionary. There are 30 questions in this examination. You must attempt all the questions. Record your answers on the mark sheet. Total marks available: 30 You have 75 minutes to finish the examination. Text 1 Read the text below and answer the questions. Public health experts have warned that controversial experiments on mutant viruses could put human lives in danger by unleashing an accidental pandemic. Several groups of scientists around the world are creating and altering viruses to understand how natural strains might evolve into more lethal forms that spread easily among humans. But in a report published on Tuesday, researchers at Harvard and Yale universities in the US argue that the benefits of the work is outweighed by the risk of pathogenic strains escaping from laboratorys and spreading around the world. They calculate that if 10 high-containment labs in the US performed such experiments for 10 years, the chance of at least one person becoming infected was nearly 20%. If an infected person left the laboratory, the virus might then spread more widely. "We are not saying this is going to happen, but when the potential is a pandemic, even a small chance is something you have to weigh up very carefully," said Marc Lipsitch, an epidemiologist at Harvard School of Public Health, who wrote the report with Alison Galvani, an epidemiologist at Yale. Those studies, led by Ron Fouchier at Erasmus Medical Centre in Rotterdam and Yoshihiro Kawaoka at the University of Wisconsin-Madison, where eventually published after months of delays. Other researchers have now begun similar experiments. Last year, the US government, ............ funds most of the work, revised it's guidelines for "dual-use research of concern", or DURC. Under the new rules, work can be funded if the potential benefits are substantial and the risks considered to be manageable. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 1. What are the main purposes of the text? b. To persuade and describe a. To entertain and inform c. To give facts and inform d. To instruct and inform 2. The word 'eventually' as used on line 21 can be replaced by: b. finally a. ultimately c. in the long run d. eventfully 3. In paragraph two, which statement affirms they have some sort of control over the situation b. The US performed such experiments for 10 years a. The benefits of the work outweigh the risk c. The chance of one person becoming infected was nearly 20% d. The virus might spread more widely 4. According to the text, which statement is true? a. Researchers say that experiments on viruses are extremely risky. b. Experiments on viruses are very safe. d. There is never 100% security when experimenting with viruses. c. Experiments on viruses have led to pandemics. 5. Last year the US government: b. banned work on viruses conducted by universities. a. banned all work on viruses. c. said it will only fund work if the risk is minimal. d. said it will not fund any work on viruses. 6. There is a grammatical error on: a. Line 2 b. Line 4 c. Line 8 d. Line 10 7. There is a spelling mistake on: a. Line 9 b. Line 11 c. Line 21 d. Line 28 8. A word has been correctly spelt but incorrectly used on: a. Line 16 b. Line 21 c. Line 25 d. Line 26 9. A word has been omitted on line 25. It should be: a. which b. who c. whose d. where 10. A punctuation error has been made on: a. Line 10 b. Line 15 c. Line 25 d. Line 26 Text 2 Whether it is down to Hollywood blockbusters or Scooby Doo, our fascination with Egyptian mummies has lasted for more than 200 years. Now the latest generation of CT scanners - normally used to check living patients - have been used by the British Museum, in London, to shed new light on one of its most popular collections. The findings show we share rather more with the ancient Egyptians than you might expect, including high cholesterol levels and agonizing toothache. Eight of the museum's mummies have been virtually unwrapped - revealing secrets they took to the grave thousands of years ago. Each long-dead individual was painstakingly transported to hospitals across the capital and placed - out of hours and late at night - inside the latest generation of CT scanners. The unprecedented levels of resolution have shown some unexpected developments. They include the revelation that one of the mummies, found in a womans coffin and believed for hundreds of years to be female, was in fact a man. The first mummy entered the museum's collection in 1756, but, for the past 200 years, none of the mummies have been unwrapped because of the damage that would be done. Now, cutting-edge visualisation techniques mean not only curators, but every visitor to the exibition can peel away the wrappings and virtually explore what lies beneath. All the mummies chosen once lived in the Nile Valley, between 3,500BC and 700AD. The exhibition reveals more about how they lived and died and shows the embalming process does not always go to plan - particularly for one man from Thebes. Curator Daniel Antoine told Sky News, "Facial visualisation reveals a tool still stuck in his head. There had been an ............. to remove his brain but, during it, one of the tools used to go through the nose appears to have snapped and surprisingly that tool is still lodged inside him." Like all of the adult mummies, the same man was found to have advanced dental decay - with four separate abscesses in his mouth. Another two individuals still have calcified plaque on their bones, suggesting they may have suffered from cardiovascular disease. Neil MacGregor, Director of the British Museum, said, "This new technology is truly groundbreaking". 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31` 32 33 34 35 11. According to the text, which sentence is true? a. Mummies were unwrapped for the first time. c. Mummies are all males. b. Mummies originated in 1756. d. CT scanners have been used on mummies. 12. What did the tests on mummies reveal? a. Many people had their noses damaged. b. Many people suffered from toothaches. c. Many people had lung problems. d. Many people suffered from cancer. 13. What is a CT scanner normally used for? a. Medical tests on living patients. c. Tests on animals. b. Post-mortem examinations. d. Test archaeological objects. 14. How many mummies have been unwrapped? a. Zero b. Eight d. Three thousand five hundred c. Two hundred 15. The style used in the text can be described as: a. Descriptive and instructive b. Entertaining and instructive d. Informative and entertaining c. Formal and persuasive 16. The wrong tense has been used on: a. Line 6 b. Line 8 c. Line 13 d. Line 24 17. A spelling mistake has been made on: a. Line 15 b. Line 17 c. Line 20 d. Line 24 18. On line 27 a word has been omitted. The word should be: a. effort b. attempt c. challenge d. endeavour 19. The phrase 'cutting-edge' as used on line 19 means: a. sharp b. blunt c. modern d. old 20. There is a punctuation error on: a. Line 15 b. Line20 c. Line 22 d. Line 34 Text 3 British and American intelligence agents attempting to hack the "dark web" are being deliberately undermined by colleagues, it has been alleged. Spies from both countries have been working on finding flaws in Tor, a popular way of anonymously accessing "hidden" sites. But the team behind Tor says other spies are tipping them off, allowing them to quickly fix any vulnerabilities. The agencies declined to comment. The allegations were made in an interview given to the BBC by Andrew Lewman, who is responsible for all the Tor Project's operations. He said leaks had come from both the UK Government Communications Headquarters (GCHQ) and the US National Security Agency (NSA). By fixing these flaws, the project can protect users' anonymity, he said. "There are plenty of people in both organisations who can anonymously leak data to us to say - maybe you should look here, maybe you should look at this to fix this," he said. "And they have." Mr Lewman is part of a team of software engineers responsible for the Tor Browser software designed to prevent it being possible to trace users' internet activity. The programmes involved also offer access to otherwise hard-to-reach websites, some of which are used for illegal purposes. 21. The text suggests, that: a. British and American agents are intelligent. c. There are a lot of spies in Britain and America. b. British and American agents don't give away secrets. d. Some spies pass on secret information. 22. The phrase 'tipping off' as used paragraph 3, is understood as: a. get tips c. reveal secrets b. get drunk d. tell lies 23. What has 'the dark web' been used for? a. Entertainment c. Finding spies b. Criminal activity d. Hacking private sites 24. What is the Tor Project? a. Browser to access difficult sites b. Secret organisation c. British intelligence d. American intelligence 25. Who recently questioned Mr Lewman? a. Tor b. BBC d. GCHQ c. NSA Text 4 Every now and then a story pops up to crumble our hard city hearts and make us want to run away to Peru to look after a few hundred sick cats. Peruvian nurse, Maria Torero, has given a whole new meaning to the phrase 'cat lady'. The 45-yearold mum-of-three has adopted 175 poorly cats suffering from feline leukaemia and looks after them in her two-floor home in a kind of makeshift cat hospital - complete with food bowls and litter trays scattered around. A nurse to humans by day, Torero explained to Associated Press that she's not interested in simply giving a home to healthy strays. "That's not my role. I'm a nurse. My duty is to the cats that nobody cares about," adding: "People don't adopt adult cats, especially if they are terminally ill." She funds the hospital, which spreads throughout her eight-roomed apartment, partly out of donations and tops it up with money she makes from her own day job. And somehow manages to look after her three children (16, 14 and 6) too. Looking after the kitties she estimates costs $1785 (£1070) a month. For the past five years Torero and her family have cared for cats in the last stages of their lives. Feline leukaemia is a retrovirus that lowers the immune system and, though cats can survive for several years with it, their life expectancy is much shorter. The disease can be passed between cats (unlike human leukaemia), so Torero doesn't allow any kittens into her home. It doesn't affect humans or other species but can lead to a variety of other diseases, including a form of fatal blood cancer. Torero finds the cats wandering around the capital, Lima and has them tested for the condition before bringing them home. The majority of the street cats test positive, as well as having a string of other problems including fleas and parasites. Torero administers medicine, sterilises the animals and gets rid of their fleas. Her arms bear the mark of scratches from reluctant felines. The cats sleep in adorably cute plastic drawers instead of baskets and Torero has even sewn them cute cat jumpers to keep them warm in their illness. 26. Where does Maria live? a. Mexico c. Peru b. Torero d. Brazil 27. What did Maria do with the first 175 cats? a. Took them to the vets. c. Took them to a cattery. b. Took them to her improvised hospital. d. Looked after them in the streets. 28. Which statement is true, as stated in the text? a. Maria looks after sick cats only. c. Maria looks after all old cats. b. Maria looks after all cats. d. Maria looks after sick animals. 29. How does she fund her project? a. Donations only c. Donations and her wages b. Her wages and money from the government d. Donations and money from the government 30. How does Maria care for cats? a. She gets rid of fleas. c. She gives them medicine. b. She sterilises them. d. She does all of the above. End of Examination for Reading – Level C2 NOCN The Quadrant Parkway Business Centre 99 Parkway Avenue Sheffield S9 4WG UK E-mail: firstname.lastname@example.org Tel: +44 (0)114 2270500 Fax: +44 (0)114 2270501
<urn:uuid:e484af93-d1ce-42a3-ba05-e97fe2d6449e>
CC-MAIN-2018-51
http://examsesol.gr/downloads/past_papers/B2014_C2_Reading.pdf
2018-12-19T16:41:47Z
crawl-data/CC-MAIN-2018-51/segments/1544376832559.95/warc/CC-MAIN-20181219151124-20181219173124-00223.warc.gz
93,220,794
2,977
eng_Latn
eng_Latn
0.902272
eng_Latn
0.999073
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 458, 2211, 3267, 3724, 6075, 6915, 7383, 8634, 9326, 11432, 12226, 12384 ]
[ 2.3125 ]
1
1
(excursions requiring an overnight stay or the use of a helicopter for day trips) UNESCO Heritage sites Thracian Tomb in Sveshtari (1985) Another unique tomb, located in the North East part of Bulgaria near the city of Isperih. Built using large limestone blocks, the tomb consists of an arched entrance, a long corridor and three square chambers, one of which – presumably the burial chamber of the ruler, is decorated with ten columns in the shape of women with raised arms holding a frescoed plinth. The ten female figures carved in high relief on the walls of the central chamber and the decorations of the lunette in its vault are the only examples of this type found so far in the Thracian lands. It is a remarkable reminder of the culture of the Getae, a Thracian people who were in contact with the Hellenistic and Hyperborean worlds, according to ancient geographers. Madara Rider (1979) The Madara rider represents the only bas-relief in Europe hewn into a vertical rock 23 meters from its base and representing a rider, followed by a dog, and having plunged his spear into a fallen lion. Discovered in 1872, this monument has not seized to raise questions and disputes among historians and archaeologists, regarding what it represents, why there is nothing similar anywhere else in Europe, why the theme of the depiction does not exist anywhere else, why it has remained untouched throughout centuries despite the changing political and religious environment on the Balkans. While the timing of its creation back to 7th c AD seems widely accepted, the discussion about who the rider might be rages along and alternatively identifying him with one of the early Bulgarian kings, with a Persian king and even with God Tangra (Tanangra), the supreme god of the ancient Bulgarian tribes. Rock-Hewn Churches of Ivanovo (1979) A complex maze of monolithic churches, chapels and monasteries, richly decorated in the Middle Ages with beautiful and well preserved frescos of Christian and Bible stories and images of saints, acted as an important Christian religious centre in the Medieval Bulgarian state, often visited by the Bulgarian Tsars, among them Ivan Alexander and Ivan Assen II. This religious centre was hewn out of a solid rock and completely different from other monastery complexes in Bulgaria, located near the village of Ivanovo, 20 km south of Rousse, in the rocky banks high above the Rusenski Lom river (a national park included in the UNESCO tentative list. The caves in the region had been inhabited by monks from the 1220s, when it was founded by the future Patriarch of Bulgaria Joachim, to the 17th century, where they hewed cells, churches and chapels out of solid rock. At the peak of the monastery complex, the number of churches was about 40, while the other premises were around 300, most of which are not preserved today. Srebrenitza Nature Reserve (1983) Srebarna Nature Reserve comprises Lake Srebarna and its surroundings and is located on the east bank of the Danube river on the main bird migration route between Europe and Africa. Srebarna is a wetland habitat for about 180 bird species, both breeding and migrating. Among the most interesting bird species are the Dalmatian peli- can, great egret, night heron, purple heron, glossy ibis and white spoonbill. Ancient City of Nessebar (1983) The town traces its history back to the Thracian tribes, was colonized by the Greek in the 5th c BC, later fortified and enlarged, and became part of the Roman empire in the 1st c AD. Once Christianity was adopted as the official religion of Byzantium, Nessebar became a regional religious seat and witness the construction of numerous churches, which today form the main attraction to visitors and the main reasons for its inclusion in the UNESCO heritage list. Often referred to as the "Pearl of the Black Sea" and "Bulgaria's Dubrovnik", Nesebar is a rich city-museum defined by more than three millennia of everchanging history. Sites included in the UNESCO Tentative List North East * The late ancient tomb of Silistra (1984) * The ancient town of Nicopolis ad Istrum (1984) * The Roussensky Lom National Park (1984) * Pobiti Kamani Natural Monument (2011) North West * Vratsa Karst Nature Reserve (2011) * The Magoura cave with drawings from the bronze age (1984) * Rocks of Belogradchik (2011) * Central Balkan National Park (2011)
<urn:uuid:f0f89eff-3e5b-40eb-a39b-9fcf8138d096>
CC-MAIN-2018-51
http://www.villagella.com/info/VG-UNESCO-Heritage-Sites-FR.pdf
2018-12-19T16:47:36Z
crawl-data/CC-MAIN-2018-51/segments/1544376832559.95/warc/CC-MAIN-20181219151124-20181219173124-00223.warc.gz
484,418,668
977
eng_Latn
eng_Latn
0.993592
eng_Latn
0.996771
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 2862, 4386 ]
[ 3.09375 ]
1
0
Delaware State Standards, Grades 6-8 Leaf Pack Network ® curriculum meets the following Delaware State Standards for grades 6-8. Standard 1: Nature and Application of Science and Technology The practice of science and the development of technology are critical pursuits of our society. These pursuits have involved diverse people throughout history and have led to continuous improvement in the quality of life and in our understanding of nature. Students will study the processes of scientific inquiry and technology development and the history and context within which these have been carried out. Science as Inquiry 1. The design of an investigation, in many cases, is determined by the type of questions asked. Therefore, the thoughtful and informed structuring of such questions is an important part of scientific inquiry. 2. The ultimate goal of any scientific investigation is to obtain evidence precise and thorough enough to answer a question. Various experimental designs and strategies can be developed to answer the same question. The comprehensiveness and sophistication of the investigation depend on the tools and technologies used. 3. Explanations in science result from careful and logical analysis of evidence gained from an investigation. Explanations relate causes to effects and develop relationships based on the evidence. Critical analysis of data is necessary to judge the quality and validity of the proposed explanation. Critical analysis skills learned in the classroom can be applied to judge the validity of claims made in everyday life. Standard 5: Earth's Dynamic Systems Earth's features provide a record of how Earth has changed over time. This dynamic history can be documented and explained by a variety of physical, chemical, biological and geological processes. Students will study and learn to identify components of the various Earth systems and understand the changes and patterns that result from interactions within and between these systems. Components of Earth 4. Water falling to Earth flows over the surface as run-off and collects in ocean basins, rivers, lakes, ice caps, and underground. Water stored underground (sub-surface) and water stored above ground (surface) form a continuum, each supplying water to the other. Human activity and natural events can introduce chemicals affecting the quality of the water supply. Standard 7: Diversity and Continuity of Living Things The natural world consists of a diversity of organisms that transmit their characteristics to future generations. Students will study how living things reproduce, develop and transmit traits, and how these theories of evolution explain the unity and diversity of species found on Earth. Students will also study how knowledge of genetics, reproduction and development is being applied to improve agriculture and human health. Diversity 1. Organisms have many distinct and unique features which they use for survival. Specialized features include those for finding food, building shelters, evading predators, and reproducing. Scientists use similarities and differences in these features to classify and group organisms. Evolution 1. Organisms are currently classified into five kingdoms (monera, protista, fungi, plantal, animalia) based on similarities in structure and behavior. 2. A species is an important biological grouping of organisms whose members have similar structures, normally interbreed, and produce fertile offspring. 3. Each structure in an organism is uniquely adapted to perform a particular function for enhancing the ability of the organism to survive. The great variety of body forms found in different species enable organisms to survive in diverse environments. Standard 8: Ecology Organisms are linked to one another in an ecosystem by the flow of energy and the cycling of materials. Humans are an integral part of the natural system and human activities can alter the stability of ecosystems. Students will acquire a basic understanding of the structure of ecosystems and how they function and change. They will also study how humans can apply scientific and technological knowledge about ecosystems in making informed decisions about the use of natural resources. Technology and Its Influence on the Environment 1. An ecosystem consists of all the organisms that live together and interact with each other and their physical environment. 2. Interactions in an ecosystem result from the transfer of matter and energy from producers to consumers and eventually to decomposers. The total amount of matter and energy in the system remains the same even though its form and location changes. 3. Matter is recycled in an ecosystem, and energy which enters the system as sunlight is either stored in the bodies of organisms, used by consumers to support their activities, or dissipated to the environment as heat energy. Loss of heat from an ecosystem is compensated for by continuous input of solar energy. Change in Ecosystems 1. Changes in the physical or biological conditions of an ecosystem can alter the diversity of species in the system. As the ecosystem changes, populations of organisms must adapt to these changes, move to another ecosystem, or become extinct. 2. The size of populations in an ecosystem may increase or decrease as a result of the interrelationships among organisms, availability of resources, natural disasters, habitat changes, and pollution. Technology and Its Influence on the Environment 1. Agriculture relies heavily on technology to increase productivity. Advances in irrigation allow crops to grow in areas where there is not enough precipitation. Chemicals are used to fertilize crops and to control damage done by rodents, fungi, insects, and weeds. The need to increase agricultural production results in environmental trade-offs (e.g., saltwater intrusion, water table lowering, agricultural runoff into rivers/streams, elimination of beneficial insects, desertification). Interaction of Humans Within Ecosystems 1. The extinction or introduction of species can affect the stability of ecosystems. With careful planning, humans may be able to sustain ecosystems for their use as well as preserve their biodiversity and natural beauty. 2. Decisions about the use of natural resources are often determined by a society's short-term needs for the resources with little regard for long-term consequences. The supply of natural resources such as water and petroleum is finite. Non-material resources (e.g., tranquility, beautiful scenery) cannot be easily quantified but must be preserved. The Leaf Pack Network is an initiative of Stroud™ Water Research Center. The Stroud Center seeks to advance knowledge and stewardship of freshwater systems through global research, education, and watershed restoration. Learn more at www.stroudcenter.org
<urn:uuid:e5fc62af-7e1f-40f4-ade3-75165eba24b6>
CC-MAIN-2018-51
https://tnf9u43u8s42cg8l3sksfn28-wpengine.netdna-ssl.com/wp-content/uploads/de-std-gr6_8.pdf
2018-12-19T16:42:20Z
crawl-data/CC-MAIN-2018-51/segments/1544376832559.95/warc/CC-MAIN-20181219151124-20181219173124-00225.warc.gz
730,325,922
1,237
eng_Latn
eng_Latn
0.995461
eng_Latn
0.995791
[ "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1991, 4408, 6851 ]
[ 4.34375 ]
1
1
What is grief? Grief is a natural response you experience when you lose someone close to you. Grieving is a normal part of life and there is no right way to grieve – everyone is different. It can begin as soon as you become aware of a loss and can continue over the course of the first 12 months. Shock and disbelief that the person has died Longing for the person ; wishing they were around, to be able to touch them or be comforted by them Anger or resentment for being abandoned, for the unfairness of the loss, or towards those seen as responsible for the loss Sadness that the person has gone Guilt that you were unable to save the person or that you survived while they did not Anxiety about the future ; about how things will be without your loved one or about your own safety Difficulty thinking about anything else; always thinking about the person you have lost Difficulty concentrating and remembering things Changes to your sleep patterns and appetite Physical changes including headaches, feeling tired, muscle aches and nausea. Feelings of grief Grief can affect you in many different ways; how you think, what you feel and how you spend your time. You might experience: headspace National Youth Mental Health Foundation is funded by the Australian Government Department of Health under the Youth Mental Health Initiative. Although there are many different kinds of 'loss', this fact sheet looks at grief after the death of someone close. Experiencing grief If you are experiencing grief, try not to stress too much about what's "normal". Everyone goes through grief differently and should be able to grieve at their own pace and in their own way. Grief Things that can help in managing grief It's important to do what's right for you. Some things that might help include: Accepting your feelings. It's okay to feel sad about losing someone special and to take time to cope with what has happened. Losing someone is stressful and upsetting, and it's normal to experience strong emotions. Looking after yourself is really important so try to keep regular routines of sleep, eating and exercise. These things can feel hard to keep up but they can improve how you think, and how you feel. Allowing yourself to feel happy and to move on with your life without feeling guilty. People sometimes feel bad if they let themselves smile or if they seem to be moving on; it doesn't mean that you have forgotten the person you have lost. Your loved one would have wanted good things in your life. Allowing yourself time to grieve and if you can, let yourself cry. You might need a safe place at home or at school to go when you're especially sad. Collecting memories of your loved one and expressing your feelings in a way that feels right for you. Perhaps write about them and the things you did with them. Collect photos, make a scrap book or journal, create a website or blog, write music or poetry, or create some artwork. Taking time out. Being around other people can sometimes be stressful and overwhelming, especially if they are also grieving. Go for a walk, listen to some music, sit in a park or do something enjoyable like shopping or going to a movie. Finding a way to say goodbye in your own way and in your own time. This might mean going to the funeral, writing them a letter or having a memorial service. Planning for times that may be hard, like Christmas, birthdays or anniversaries. Perhaps arrange to spend time with friends or do something enjoyable for yourself. Finding your own way to stay connected, honour and remember the person who has died. Finding help Grief is an experience that can last for weeks, months or over a year. Learning to live with the loss can take time and you may experience ups and downs in the process. If your grief is continuing for a long time, is very upsetting or is stopping you from getting on with life, or you are grieving for someone who has died by suicide then it's important to get help. Getting the right support can help you get back on track sooner and help you to learn to live with your loss. It's important to find someone you trust and feel comfortable with. There are general practitioners (GPs) and other health professionals who are experienced in working with young people who have experienced grief and loss. A good place to start might be your local community health centre or headspace centre. You could talk with a trusted friend, teacher or family member about finding some help. It's important to remember that you don't need to talk about the details of the experience if you don't feel comfortable or safe to do so. For more information, to find your nearest headspace centre or for online and telephone support, visit headspace.org.au Fact sheets are for general information only. They are not intended to be and should not be relied on as a substitute for specific medical or health advice. While every effort is taken to ensure the information is accurate, makes no representations and gives no warranties that this information is correct, current, complete, reliable or suitable for any purpose. We disclaim all responsibility and liability for any direct or indirect loss, damage, cost or expense whatsoever in the use of or reliance upon this information. headspace
<urn:uuid:a87fd7bf-4795-41d9-9b43-0bf600e33abe>
CC-MAIN-2018-51
https://headspace.org.au/assets/Uploads/Resource-library/Young-people/Grief-web.pdf
2018-12-19T16:10:43Z
crawl-data/CC-MAIN-2018-51/segments/1544376832559.95/warc/CC-MAIN-20181219151124-20181219173124-00226.warc.gz
612,436,910
1,093
eng_Latn
eng_Latn
0.998265
eng_Latn
0.998276
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 1669, 5287 ]
[ 3.4375 ]
3
2
Syllabus English 8B Course Overview English is the study of the creation and analysis of literature written in the English language. In English 8B, you will analyze nonfiction texts to explore what they reveal about the process of growing up. You will also analyze elements of poetry such as theme, structure, meter, language, and sound to help you read poems and compose a poem of your own. You will read novels and analyze their literary elements and their use of literary devices. In the final unit, you will reflect upon and evaluate certain aspects of your past, present, and future while reading Charles Dickens's A Christmas Carol. Course Goals This course will help you meet these goals: Understand stages of human growth such as adolescence. Use nonfictional texts such as informative essays, scientific essays, and memoirs to explore aspects of growing up such as body image, gender matters, and body changes. Analyze theme in poetry. Explain structures, metrical patterns, and sound patterns in poetry. Examine language and sound techniques required to compose a poem. Draft a persuasive essay based on a topic related to poetry. Investigate literary elements such as character, setting, conflict, and theme in one of the following novels: Louisa May Alcott's Little Women, Lois Lowry's The Giver, Charlotte Brontë's Jane Eyre, or John Knowles's A Separate Peace. Analyze the use of symbolism in one of the following novels: Louisa May Alcott's Little Women, Lois Lowry's The Giver, Charlotte Brontë's Jane Eyre, and John Knowles's A Separate Peace. Draft an argumentative essay based on how you relate to the characters of the novel you choose. Reflect upon and evaluate aspects of your past, present, and future life as a student by reading Charles Dickens's A Christmas Carol. General Skills To participate in this course, you should be able to do the following: Complete basic operations with word processing software, such as Microsoft Word or Google Docs. Complete basic operations with presentation software, such as Microsoft PowerPoint or Google Docs Presentation. © 2016 EDMENTUM, INC. Perform online research using various search engines and library databases. Communicate through email and participate in discussion boards. For a complete list of general skills that are required for participation in online courses, refer to the Prerequisites section of the Plato Student Orientation document, found at the beginning of this course. Credit Value English 8B is a 0.5-credit course. Course Materials Notebook Pencil Or Pen Computer With Internet Connection And Speakers Or Headphones Microsoft Word Or Equivalent Microsoft PowerPoint Or Equivalent Course Pacing Guide The following course description and pacing guide is intended to help you stay on schedule with your work. Note that your course instructor may modify the schedule to meet the specific needs of your class. Unit 1: How Do Your Mind and Body Change as You Grow? Summary This unit focuses on the changes a growing adolescent's mind and body go through. To explore this topic, you will look at evidence from informative essays about body image and develop your own personal narrative. You will analyze structure and technical meaning in scientific texts about the role hormonal and chemical changes in the body have on mood. You will evaluate structure and reasoning in informative texts about gender development in relation to biology and society. At the end of the unit, you will explore techniques for writing your own short memoir and examine the benefits of peer review. Unit 2: How Can You Change Your Perspective? Summary This unit focuses on various elements of poetry. You will investigate theme and structure in Robert Frost's poem The Road Not Taken and examine the impact of meter and punctuation in Emily Dickinson's poem I'm Nobody! Who Are You? You will explore the language and sound techniques used in Claude McKay's America and Carl Sandburg's Theme in Yellow to compose a poem. Finally, you will prepare and revise a persuasive essay on a topic related to poetry. Unit 3: Who Are You? Summary This unit explores literary elements such as character, setting, conflict, and theme in Louisa May Alcott's Little Women, Lois Lowry's The Giver, Charlotte Brontë's Jane Eyre, or John Knowles's A Separate Peace. You will select one of these four novels and explore how novelists add meaning to their works by referring to other pieces of literature. You will examine the use of symbols in novels. You will also explore how you relate to the characters in a novel by writing an argumentative essay. Unit 4: Who Do You Want to Be? Summary This unit focuses on Charles Dickens's narrative approach with regard to the past, present, and future in A Christmas Carol. You will read the novel and evaluate your identity as a student. You will reflect upon your past, present, and future reading, study, and writing habits.
<urn:uuid:6fdff1e2-fe53-4c28-a97e-a888a81f5c7d>
CC-MAIN-2018-51
https://sdvirtualschools.com/wp-content/uploads/Syllabus_English8B_v4.0.pdf
2018-12-19T16:20:24Z
crawl-data/CC-MAIN-2018-51/segments/1544376832559.95/warc/CC-MAIN-20181219151124-20181219173124-00227.warc.gz
754,554,342
1,001
eng_Latn
eng_Latn
0.997434
eng_Latn
0.99712
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 2116, 3582, 4092, 4622, 4943 ]
[ 2.90625 ]
1
0
Performance Nutrition Fact Sheet Hydration for Swimmers in a Hot Climate Your body is over 70% water so dehydration can have a negative effect on your performance, especially in hot climates when sweat losses are likely to be even higher than normal. It's important to remember the effects of dehydration are cumulative and that you will still lose sweat in the pool. The key to maintaining your hydration is to: * Drink regularly and more than you drink in Scotland * Include foods with a high water content in your diet too * Keep your drinks chilled Top 10 Hydrating foods include: watermelon, cucumber, tomatoes, oranges, blueberries, strawberries, grapefruit, broccoli, raw carrots, pears, star fruit, celery. How much do I need to drink? * Check your weight balance and replace the fluid you lose in a session before the next session Check the colour of your urine to see how hydrated you are Effects of Poor hydration * Headaches * Increased heart rate * Feeling more fatigued than normal * Dizziness * Stomach cramps st 31 May 2017 Performance Nutrition Team Performance Nutrition Fact Sheet As you are likely to be sweating more, electrolytes can help you absorb fluid better. Top Tips This drink will help to (re)hydrate you, but won't provide any energy Sugar free squash (no added sugar), add pinch (1/2 tsp) of salt and water (1L) Make your own isotonic drink to provide you with some energy and electrolytes if doing a longer session. * Regular squash (not "no added sugar") add a pinch of salt (1/2 tsp) and add water (1L). Mix fruit juice (250ml) and water (750ml) add a pinch of salt (1/2 tsp) and pop in your bottle * Keep drinks chilled * Drink regularly throughout the day * Make your own isotonic drink * Start the day hydrated and replace any fluid lost during exercise * If using an electrolyte tablet check Informed-Sport.com to see if it has been batch tested * Drink only bottled and filtered water if tap water is unsafe to drink * Remember to wash any unpeeled fruit and raw vegetables with filtered or bottled water if tap water is unsafe. * Avoid ice cubes unless made from bottled or filtered water * Check your pee to see how hydrated you are st 31 May 2017 Performance Nutrition Team
<urn:uuid:2513f0de-ef23-4dfd-821c-a8ce2e3860d0>
CC-MAIN-2018-51
http://www.bellshillsharksasc.co.uk/app/download/5812578328/Hydration+Fact+Sheet+for+Swimmers.pdf
2018-12-19T15:45:18Z
crawl-data/CC-MAIN-2018-51/segments/1544376832559.95/warc/CC-MAIN-20181219151124-20181219173124-00227.warc.gz
347,167,150
512
eng_Latn
eng_Latn
0.995942
eng_Latn
0.996758
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 1080, 2244 ]
[ 2.9375 ]
1
0
You have 50 minutes to complete this test. You are only allowed a writing utensil, one two-sided 8.5 x 11 sheet of paper with information on it, and two non-programmable, non-graphing calculators. Good luck! SECTION 1: MULTIPLE CHOICE Directions: Circle the best response to the question being asked. (2 points each) 1. What does two capital letters notate in genetics? A. Homozygous recessive B. Homozygous dominant C. Heterozygous recessive D. Heterozygous dominant 2. Which statement is true about blood type? A. It is a polygenic trait. B. It follows rules of mendelian inheritance. C. It is a multiple alleles trait. D. Blood type alleles demonstrate incomplete dominance. 3. What is the term in genetics that describes being heterozygous for a trait? A. Polygenic B. Hybrid C. Half and half D. Multiple Alleles 4. What is another name for a Punnett Square? A. Monohybrid Cross B. Dihybrid Cross C. Trihybrid Cross D. Four-square 5. If both parents are heterozygous for an autosomal trait that follows rules of mendelian genetics, then what is the chance that the offspring will also be heterozygous for that trait? A. 25% B. 50% C. 75% D. 100% 6. Which type of RNA copies the DNA sequence in the nucleus and takes it to the cytoplasm? A. nRNA B. mRNA C. rRNA D. tRNA 7. Which of the following is NOT included in the cell cycle? A. G1 Phase B. Synthesis Phase C. Mitosis D. Meiosis 8. Which of the following results in Downs Syndrome? A. Monosomy 21 B. Trisomy 21 C. Monosomy 23 D. Trisomy 23 9. In which phase of the cell cycle does a cell spend most of its time? A. Interphase B. Mitosis C. Meiosis D. Cytokinesis 10. What is the genotypic ratio for heterozygous x heterozygous on a monohybrid cross? A. 3:1 B. 1:2:1 C. 9:3:3:1 D. 2:2:0 11. During oogenesis, how many of the created cells become viable? A. none B. 1 C. 2 D. 4 12. What is the name of the disorder in which a person has three X chromosomes? A. Klinefelter's syndrome B. Feminine disorder C. Turner's Syndrome D. XXX Syndrome 13. If a DNA sample is 34% thymine, then what percentage of cytosine is there? A. 21% B. 31% C. 34% D. 66% 14. Which of the following is NOT involved in DNA replication? A. Helicase B. DNA Polymerase C. Ligase D. DNA Primer 15. Which of the following genetic disorders is the result of an insertion? A. Cystic Fibrosis B. Polydactyly C. Sickle Cell Anemia D. Cri-du-chat syndrome 16. About how long does mitosis usually last? A. 1 hour B. 2 hours C. 8 hours D. 20 hours 17. What is the scientific term for programmed cell death? A. Necrosis B. Cell Death C. Cancer D. Apoptosis 18. Which of the following ISN'T a stop codon? A. UAG B. UAA C. UGA D. UGG 19. About how long is the human genome (in mega-base pairs) A. 3200 Mb B. 4800 Mb C. 4200 Mb D. 2800 Mb 20. How many phases of meiosis are there? A. 4 B. 6 C. 8 D. 9 SECTION 2: TRUE/FALSE Directions: Mark each statement as true or false on the line next to it. If it is false, change it so that it is true. You do not have to rewrite the whole statement. _____ 21. Transcription occurs before translation. _____ 22. The genotypic ratio for two dihybrid heterozygotes crossed is 9:3:3:1 _____ 23. Adenine and Guanine are purines because they have two rings in their structure. _____ 24. Deoxyribose molecules have 5 carbons while ribose molecules have 4 carbons. _____ 25. On tRNA, on the 3' end is an anticodon and on the 5' end is an amino acid _____ 26. The three stages of transcription, in the correct order, are initiation, elongation, and termination. _____ 27. Polydactyly, a condition which results in extra fingers and toes, is an autosomal recessive disorder _____ 28. Translation occurs in the nucleus. _____ 29. Sickle cell anemia results from a mutation that occurs on chromosome 15. _____ 30. Haploid cells have a number of chromosomes represented by ½ n. _____ 31. DNA can only replicate 3' to 5'. _____ 32. Cancer is caused by cells' inability to stop multiplying constantly. _____ 33. Codominance is displayed in snapdragon flowers. _____ 34. Mutations can be caused by environmental factors like UV radiation, chemicals, and temperature. _____ 35. There are three types of protein structures: primary, secondary, and tertiary. _____ 36. If a trait is Y-linked, then it can only be passed down in males in the generations to come _____ 37. When a trait is polygenic, it means that more than one gene controls the trait. _____ 38. Transcription occurs during G1 and S stages of the cell cycle _____ 39. When humans mate, there is an equal chance for the offspring to be male or female. _____ 40. The Human Genome Project was finished in 2002. SECTION 3: SHORT ANSWER Directions: Follow the directions written for each problem. 41. Drosophila is a genus of fruit flies whose eye color is determined through sex-linked inheritance. The allele for red eyes is dominant while the allele for white eyes is recessive and xlinked. Let R represent the dominant part of the allele and r the recessive. a. Set up and fill out the Punnett square for a female with white eyes and a male with red eyes. b. Among ALL the offspring (both male and female), what is the chance that an offspring will have white eyes? c. If these two Drosophila flies have 4 male children, statistically, how many of them should have red eyes? 42. Mendel's famous experiment involved crossing pea plants and analyzing patterns of inheritance between generations. The two main characteristics that he analyzed were color of the peas (green or yellow) and texture of the seeds (round or wrinkled). The yellow color and the round seed are dominant to the green color and wrinkled seed. The letter Y represents the allele for color while the letter R represents the allele for shape. a. Set up and fill out the dihybrid cross for a plant with seeds that are heterozygous for color and seed shape and another plant with seeds that are homozygous dominant for color and heterozygous for shape. b. List all the genotypes in the cross and their corresponding phenotypes. c. What is the chance that the offspring of these plants will have seeds that are heterozygous for color and homozygous dominant for shape? 43. Identify the following pedigree symbols and write what each of them signifies right next to the symbol. Be as specific as possible. 44. Mary (III-1) has sickle cell anemia. Her paternal grandfather, I-1, was heterozygous for sickle cell anemia. The genotype of Mary's paternal grandmother (I-2) is unknown, as she died many years ago, but they know that she didn't have sickle cell. Mary's father (II-2) has sickle cell. His older brother (II-1) does not have sickle cell, nor does he carry the mutated allele. Mary's maternal grandparents (I-3 & I-4), didn't have sickle cell (but we know that both of them were carriers), nor did Mary's mother (II-3). However, she is heterozygous for sickle cell. a. Draw a pedigree that follows the above scenario. Be sure to label every individual by their generation number. Mark each individual as affected, unaffected, or carrier (heterozygous) for sickle cell. You will need to infer this for a few people. b. If Mary marries a man who is also heterozygous for sickle cell, what is the percent chance that their offspring will have sickle cell anemia? 45. You are given the following strand of DNA: CATCGATAGACATAGCCTAGTGTATAGCTGAGCGAGGCTAGCTAGATC a. Convert the above strand of DNA into an RNA sequence. b. When the DNA sequence is copied onto mRNA in the nucleus, what is this called? c. How many codons are in the sequence of RNA that you created? d. Using the codon to amino acid chart below, convert write the amino acid sequence that corresponds with the RNA sequence above. e. Which of the amino acids in the sequence you made are hydrophobic? f. Which of the amino acids in the sequence you made are hydrophilic? 46. Draw a nucleotide (use adenine as your nitrogenous base in the drawing) in the space below. Make sure to include what each part of the nucleotide is made of (ex. Oxygens, Hydrogens, etc). 47. Identify each of the phases of the cell cycle and describe what occurs during each phase e.
<urn:uuid:40d4ef42-f3f3-4577-a9f4-04d5db812a57>
CC-MAIN-2018-51
https://scioly.org/tests/files/heredity_2019_b_ssss-anomaly_test.pdf
2018-12-19T16:13:17Z
crawl-data/CC-MAIN-2018-51/segments/1544376832559.95/warc/CC-MAIN-20181219151124-20181219173124-00226.warc.gz
714,618,476
2,188
eng_Latn
eng_Latn
0.974257
eng_Latn
0.991802
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 207, 1366, 2248, 2918, 4058, 4733, 6268, 7370, 8135, 8233 ]
[ 2.890625 ]
2
0
Household Energy, Indoor Air Pollution and Health Household energy: three billion left behind Benjamin Disraeli, British statesman and writer (1804—1881) ooking as an enjoyable pastime and passion for a privileged minority – on an electric range or a gas stove in a stylish kitchen in New York, Paris or Tokyo. Cooking as a chore and threat to the lives of the great majority – on an open fire in a shabby hut in rural Africa, south Asia or Latin America. C Worldwide, more than three billion people depend on solid fuels, including biomass (wood, dung and agricultural residues) and coal, to meet their most basic energy needs: cooking, boiling water and heating (Figure 1). Opening the door to their homes makes for a hazy welcome: thick grey smoke fills the air, making breathing unbearable and bringing tears to the eyes. The inefficient burning of solid fuels on an open fire or traditional stove indoors creates a dangerous cocktail of hundreds of pollutants, primarily carbon monoxide and small particles, but also nitrogen oxides, benzene, butadiene, formaldehyde, polyaromatic hydrocarbons and many other health-damaging chemicals. Day in day out, and for hours at a time, women and their small children breathe in amounts of smoke equivalent to consuming two packs of cigarettes per day. Where coal is used, additional contaminants such as sulfur, arsenic and fluorine may also be present in the air. Yet, these families are faced with an impossible dilemma: don't cook with solid fuels, or don't eat a cooked meal. Being poor condemns half of humanity to dependence on polluting household energy practices. With increasing prosperity, cleaner, more efficient and more convenient fuels are replacing, step-by-step, traditional biomass fuels and coal. Climbing up the energy ladder tends to occur gradually as most low- and middle-income households use a combination of fuels to meet their cooking needs (Figure 2). The problem of indoor air pollution has been around since the Stone Age, yet international development agendas still fail to recognize that missing out on clean energy equals missing out on life. Increasing use of cleaner, more efficient and more convenient fuels for cooking Increasing prosperity and development Kerosene Electricity Natural gas Solid fuels Non-solid fuels Very low income Low income Middle income High income Ethanol, methanol Gas, liquefied petroleum gas Wood Charcoal Crop waste, dung Coal Figure 2: The energy ladder: household energy and development inextricably linked Health at the heart of the matter lack soot covers the walls of the dwelling. It is the pollutants in this black soot, as well as many invisible pollutants in the air, that women and children breathe in for many hours every day. Small particles (with a diameter of up to 10 microns (PM10)) are the most widely used indicator of the health hazard of indoor air pollution. Fine particles (with a diameter of up to 2.5 microns (PM2.5)) are able to penetrate deep into the lungs and appear to have the greatest health-damaging potential. It is known that these particles can cause inflammation of the airways and lungs and impair the immune response, yet the precise mechanism by which exposure to indoor air pollution translates into disease is still unknown. B Moreover, some studies have linked exposure to indoor smoke to asthma; cataracts; tuberculosis; adverse pregnancy outcomes, in particular low birth weight; ischaemic heart disease; interstitial lung disease, and nasopharyngeal and laryngeal cancers. New research is needed to shed light on how exposure to indoor smoke contributes to this long list of health problems (see also Box 1). Burning solid fuels produces extremely high levels of indoor air pollution: typical 24-hour levels of PM10 in biomass-using homes in Africa, Asia or Latin America range from 300 to 3000 micrograms per cubic metre (µg/m 3 ). Peaks during cooking may be as high as 10 000 µg/m 3 . By comparison, the United States Environmental Protection Agency has set the standard for annual mean PM10 levels in outdoor air at 50 µg/m 3 ; the annual mean PM10 limit agreed by the European Union is 40 µg/m 3 . As cooking takes place every day of the year, most people using solid fuels are exposed to levels of small particles many times higher than accepted annual limits for outdoor air pollution (Figure 3). The more time people spend in these highly polluted environments, the more dramatic the consequences for health. Women and children, indoors and in the vicinity of the hearth for many hours a day, are most at risk from harmful indoor air pollution. Since the mid-1980s, epidemiological studies have been investigating the impacts of exposure to indoor air pollution on health. The results of these studies have recently been reviewed by WHO (Table 1). Inhaling indoor smoke doubles the risk of pneumonia and other acute infections of the lower respiratory tract among children under five years of age. Women exposed to indoor smoke are three times more likely to suffer from chronic obstructive pulmonary disease (COPD), such as chronic bronchitis or emphysema, than women who cook with electricity, gas or other cleaner fuels. And coal use doubles the risk of lung cancer, particularly among women. 2 Table 1: Health impacts of indoor air pollution 1 Strong evidence: Many studies of solid fuel use in developing countries, supported by evidence from studies of active and passive smoking, urban air pollution and biochemical or laboratory studies. Moderate evidence: At least three studies of solid fuel use in developing countries, supported by evidence from studies on active smoking and on animals. Moderate I: strong evidence for specific age/sex groups. Moderate II: limited evidence. The relative risk indicates how many times more likely the disease is to occur in people exposed to indoor air pollution than in unexposed people. 3 The confidence interval represents an uncertainty range. Wide intervals indicate lower precision; narrow intervals indicate greater precision. Box 1: Better household energy practices to mitigate the HIV/AIDS crisis? Winning the battle against HIV/AIDS calls for effective prevention and treatment. But it also requires that people maintain their energy levels and physical fitness. Household energy plays a crucial role in keeping patients and their caregivers going: It is indispensable for cooking safe, nutritious meals and for boiling water to ensure its safety for drinking. It is essential for preparing hot compresses, heating water for bathing and sterilizing utensils for patients. And it provides warmth for those who are ill and suffering. In Africa, wood tends to be scarce where collected and expensive where purchased. The incomplete combustion of biomass fuels indoors produces dense smoke, a major contributor to respiratory problems – even more so among immunocompromised HIV/AIDS patients. Therefore, more efficient, cleaner household energy practices can help families affected by HIV/AIDS as well as those not affected by the disease to live a healthier life. Adapted from: Gebert N. Mainstreaming HIV/AIDS: Participation or exclusion? Actors in the context of HIV/AIDS and project-induced measures (GTZ) for the optimized utilization of subsistence resources. German Technical Cooperation Programme for Biomass Energy Conservation in Southern Africa (GTZ ProBEC), in press. Available at: http://www.probec.org The killer in the kitchen alaria, tuberculosis, HIV/AIDS and many other diseases compete for newspaper headlines – and the attention of the public. How should decisionmakers prioritize one health problem against another? M The burden of disease combines years of life lost due to death with the years of life lost due to disability in a single measure that applies across diseases and health risks. WHO investigates the contribution of a range of risk factors, such as malnutrition, smoking and lack of physical activity, to the burden of disease. The results for the year 2000 unveiled cooking as a dangerous undertaking and indoor air pollution from burning solid fuel as one of the top ten global health risks. The "kitchen killer" turned out to be responsible for 1.6 million deaths and 2.7% of the global burden of disease. In poor developing countries, only malnutrition, unsafe sex and lack of clean water and adequate sanitation were greater health threats than indoor air pollution. This wake-up call placed indoor air pollution on the international public health agenda for the first time. Yet, the most recent and more accurate estimates show practically no change. Globally, 1.5 million people died from diseases caused by indoor air pollution in the year 2002. This figure includes children who died from pneumonia and adults who died from chronic respiratory disease and lung cancer – only those diseases for which current evidence for a link with indoor air pollution is sufficient (see Table 1). What if indoor smoke also turns out to contribute to low birth weight and tuberculosis? Reliance on polluting solid fuels (Figure 4) and inefficient household energy practices varies widely around the world, as does the death toll due to indoor smoke (Figure 5). In 2002, Sub-Saharan Africa and South-East Asia led with 396 000 and 483 000 deaths due to indoor smoke, respectively. Widespread use of biomass and coal in China plays a key role in chronic respiratory diseases among adults, and was responsible for a large share of the 466 000 deaths in the Western Pacific in 2002. Although the majority of the population in Latin America and the Caribbean, the Eastern Mediterranean and Europe use gas and other cleaner fuels for cooking, the health burden disproportionately falls on the poorest countries in these regions, and on the poorest members of society among whom solid fuel use is still common (see Figure 6 and Trapped by energy poverty). Indoor air pollution continues to ravage rural communities and poor urban dwellers. And it continues to be largely ignored by the world community. "Are we to decide the importance of issues by asking how fashionable or glamorous they are? Or by asking how seriously they affect how many?" Nelson Mandela, South African statesman and winner of the Nobel Prize for Peace (1918–) Figure 4: Widespread solid fuel use ... 1 Percentage of population using solid fuels, by WHO subregion , 2003 or latest available data Figure 5: ... translates into respiratory deaths 1 Deaths attributable to indoor air pollution per 100 000 population, by WHO subregion , 2002 1 WHO distinguishes between the following geographical regions: African Region (Afr); Region of the Americas (Amr); Eastern Mediterranean Region (Emr); European Region (Eur); South-East Asia Region (Sear); Western Pacific Region (Wpr). WHO also differentiates between the following mortality strata: very low child, very low adult (A); low child, low adult (B); low child, high adult (C); high child, high adult (D); high child, very high adult (E).
<urn:uuid:fa7b5069-742b-4afa-a03e-fcdcd9ddb9ce>
CC-MAIN-2016-50
http://www.who.int/indoorair/publications/fflsection1.pdf
2016-12-09T02:35:54Z
crawl-data/CC-MAIN-2016-50/segments/1480698542668.98/warc/CC-MAIN-20161202170902-00132-ip-10-31-129-80.ec2.internal.warc.gz
787,217,599
2,259
eng_Latn
eng_Latn
0.997493
eng_Latn
0.997542
[ "unknown", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 49, 2525, 7456, 11042 ]
[ 2.546875 ]
2
1
Grade 5 Life Science: Meeting Basic Needs and Maintaining a Healthy Body ELEMENTARY SCIENCE CURRICULUM: GRADE 5 99 Unit Overview Introduction Students can develop the understanding that the body has organs and systems that function together to help humans and other animals meet their basic needs. Students should have the opportunity to explore major internal organs through the use of models and simulations, and know where they are located in the body. It is important for students to recognize that many factors may affect a healthy body. The body has its own defences against germs, but students should understand that they must meet their own bodies' requirements for basic needs such as nutrition and exercise. Focus and Context Science Curriculum Links This unit could be integrated with the health/family living program, but it should extend beyond what is normally done to a more inquiryoriented approach. For example, students should investigate first hand the factors that can increase heartbeat rate, build models of organs and systems to see how they function, and experiment to see the function saliva plays in digestion. It is not enough for students to simply be able to draw or label diagrams of the various systems—they need to be involved in investigating the factors that affect them. Integrating with health/family living will facilitate a decision-making focus, and should be set in a context of making choices that lead toward living an active, healthy lifestyle. Students at this age will soon have to make many important decisions about smoking, drugs, and alcohol. This unit will provide them with opportunities to see how their body systems work together, and how these systems can be adversely affected when the wrong choices are made. Students have already investigated the needs and characteristics of living things, as well as growth and life cycles by the end of primary. In this unit, they start to look at human body systems. This will lead to a more in-depth treatment of cells, tissues, organs, and systems in the intermediate grades. Curriculum Outcomes STSE Skills Students will be expected to Nature of Science and Technology 104-2 demonstrate and describe processes for investigating scientific questions and solving technological problems 105-2 identify examples of scientific questions and technological problems addressed in the past Relationships Between Science and Technology 106-2 describe examples of tools and techniques that have contributed to scientific discoveries 106-4 describe instances where scientific ideas and discoveries have led to new inventions and applications Social and Environmental Contexts of Science and Technology 107-2 describe and compare tools, techniques, and materials used by different people in their community and region to meet their needs 107-5 provide examples of how science and technology have been used to solve problems in their community and region 107-8 describe examples of technologies that have been developed to improve their living conditions 107-12 provide examples of Canadians who have contributed to science and technology Students will be expected to Initiating and Planning 204-1 propose questions to investigate and practical problems to solve 204-2 rephrase questions in a testable form Performing and Recording 205-1 carry out procedures to explore a given problem and to ensure a fair test of a proposed idea, controlling major variables 205-2 select and use tools in manipulating materials and in building models 205-7 record observations using a single word, notes in point form, sentences, and simple diagrams and charts Analysing and interpreting 206-2 compile and display data, by hand or by computer, in a variety of formats including frequency tallies, tables, and bar graphs 206-3 identify and suggest explanations for patterns and discrepancies in data 206-4 evaluate the usefulness of different information sources in answering a given question Communication and teamwork 207-5 identify problems as they arise and work cooperatively with others to find solutions 107-14 identify scientific discoveries and technological innovations of people from different cultures ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Knowledge Students will be expected to 301-8 relate bodily changes, such as acne on the skin and growth of body hair, to growth and development 302-4 describe the role played by body systems in helping humans and other animals to grow and reproduce and to meet their basic needs 302-5a describe the structure and function of the major organs (teeth, tongue, esophagus, stomach, small intestine, and large intestine) of the digestive system 302-5b describe the structure and function of the major organs (kidneys, bladder, ureters and urethra, as well as the skin and lungs) of the excretory system 302-5c describe the structure and function of the major organs (nose, trachea, lungs, diaphragm) of the respiratory system 302-5d describe the structure and function of the major organs (heart, blood vessels (arteries, veins, capillaries), and blood) of the circulatory system 302-5e describe the structure and function of the major organs (brain, spinal cord, and nerves) of the nervous system 302-6 demonstrate how the skeletal, muscular, and nervous systems work together to produce movement 302-8 describe the body's defences, such as tears, saliva, skin, certain blood cells, and stomach secretions, against infections 302-7 describe the role of the skin 302-9 describe nutritional and other requirements for maintaining a healthy body Growth and Development Outcomes Students will be expected to * propose questions to investigate about how the body works and what its components are (204-1) * relate bodily changes, such as acne on the skin and growth of body hair, to growth and development (301-8) * describe the role played by body systems in helping humans and other animals to grow and reproduce and to meet their basic needs (302-4) 102 Elaboration–Strategies for Learning and Teaching This unit may be integrated with health/family living units at the elementary level. Video or other media could be used to support and illustrate growth and development outcomes. Students could brainstorm a list of questions about the functions and components of their bodies. The students could focus discussion on the following: "Why do we need to eat?"; "How does food give us energy?"; "What do my lungs do, and how do they work?"; "What happens to food after I eat it?"; "How do our bodies work?". The point of this exercise is to get them thinking about how their bodies perform all the major functions, and to provide a focus for the rest of the unit. In keeping with the decision-making focus in this unit, questions should be raised about how substances like tobacco, alcohol, and drugs affect growth, development and their bodies. Teachers should be prepared for questions and concerns of parents who use tobacco/alcohol. Students could, individually or in groups, make a list of body changes that occur as they grow older. When the list is completed, teachers could initiate a discussion about when these changes occur. Some changes that take place during puberty are gradual, e.g., increases in height and weight, while other changes will have a fairly sudden onset, e.g., acne and hair growth. Students should investigate the structures and functions of the major parts of the reproductive system. Students can use a variety of sources (print, electronic, software) to learn about the major organs of the reproductive system. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Growth and Development Suggested Assessment Strategies Performance * Students could create a chart to help track changes in growth (height). They should collect data on the height of classmates and plot a graph indicating changes of height over a period of time. They should also note differences in gender and other bodily changes. (301-8) Journal * I wonder how my body grows. The things I wonder about most are ... (204-1) Note: Confidentiality should be maintained between the student and the teacher. Paper and Pencil * Students could research bodily changes from birth to puberty. A chart similar to the example below could be used to organize the data. (301-8) Body Changes Presentation * Students could make a poster that includes pictures or drawings of people at various ages. They should include a variety of pictures of life stages (e.g., infant, child, adolescent, young adult, middle, and senior adults), and descriptions of changes that occur for each stage. (301-8) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources Student textbook module: Body Works Questions could be proposed as an introduction to all lessons. The Digestive and Excretory Systems Outcomes Elaboration–Strategies for Learning and Teaching Students will be expected to * describe the structure and function of the major organs of the digestive system (302-5a) * carry out procedures to investigate how simulated saliva can start the digestion process by breaking down substances like starch into simple sugars, and record observations using sentences or charts (205-1, 205-7) * describe the structure and function of the major organs of the excretory system (302-5b) * describe examples of the products/technologies that have been developed in response to a need for the disposal, control, and containment of excrement (107-8) 104 Students should investigate the role of the digestive system in providing food for the body's functions. Major organs include teeth, tongue, esophagus, stomach, small intestine, and large intestine. Modeling/simulating as much of the digestive and excretory processes as possible will make the unit interesting, relevant and motivating. Components and processes of these systems can be investigated using software or print/electronic resources. Students should explore the initial part of the digestive process by investigating the effect of simulated saliva (amylase) on starch. This can be explored by using the iodine test for starch: in the presence of starch, iodine turns a dark blue colour. Caution: Iodine is poisonous. Students can mix a soda cracker with water in a paper cup, add a drop of iodine solution, and show that starch is present by the dark colour. Then they can add their simulated saliva (a solution of amylase, available from science catalogues or health stores) to the mix, and watch the dark colour disappear as the simulated saliva breaks down the starch into simple sugars. Caution: Due to possible spread of germs causing disease, do not use real saliva. Amylase should be used instead of real saliva. In classroom discussion, students can propose explanations about the role of teeth in the digestive process, and phrase these explanations in the form of testable questions. Students may claim that chewing up things speeds up digestion. A testable question could be, "Will smaller pieces of food digest faster than larger pieces?". This could be tested by repeating the simulated saliva experiment using a whole cracker in one paper cup, and a crunched up cracker in another paper cup to simulate the result of teeth action. They can then time how long it takes for the blue iodine colour to fade. Students should investigate the role of the excretory system in ridding the body of harmful wastes and body products. Major organs include kidneys, bladder, ureters and urethra, as well as the skin and lungs. The excretory system deals with getting rid of harmful or useless materials from the body. Waste materials from the blood are collected in the kidneys, and are then sent to the bladder through the ureters, and expelled through the urethra. The lungs can also be considered part of the excretory system, since gasses not needed by the body are expelled through them. The skin also plays a role, as many chemicals are eliminated through sweat. Students can relate increased activity to sweat using their experiences in gym classes. Students should brainstorm and then research products/technologies that have been developed in response to the need for the disposal, control, and containment of excrement or body gasses (e.g., diapers, toilet paper, flush toilets, deodorants.) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 The Digestive and Excretory Systems Suggested Assessment Strategies Performance * Students could complete the chart below for their observations. Teachers could ask "Why do you think there were differences in the times for the iodine to change colour?" (205-1, 205-7) Starting to Digest! Journal * My kidneys are so important to me ... (302-5b) Paper and Pencil Students could: * Label or draw a diagram (teeth, tongue, esophagus, stomach, small intestine, and large intestine) and use it to illustrate their answer. (302-5a) * Label or draw a diagram (kidneys, bladder, ureters and urethra, as well as the skin and lungs) and use it to illustrate their answer. (302-5b) Interview * Why do we need to eat? (302-5a) * How many different products and technologies can you think of that help to reduce or remove the substances released by the excretory system? (107-8) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources The Respiratory and Circulatory Systems Outcomes Elaboration–Strategies for Learning and Teaching Students will be expected to * describe the structure and function of the major organs of the respiratory system (302-5c) * describe the structure and function of the major organs of the circulatory system (302-5d) * propose questions about the factors that affect breathing and heartbeat rate and rephrase these questions in a testable form(204-1, 204-2) * carry out procedures, making sure to control variables, to investigate the factors affecting breathing and heartbeat rate, and compile and display data from these investigations in a graph (205-1, 206-2) * demonstrate and describe the scientific processes used to investigate the factors that affect breathing and heartbeat rate (104-2) 106 Students should investigate the structures and functions of the major parts of the respiratory system. The major organs include nose, trachea, lungs. and diaphragm. Students can use a variety of sources (print, electronic, software) to learn about the major organs of the respiratory system. Students should investigate the structures and functions of the major parts of the circulatory system. Major organs include heart and blood vessels (arteries, veins, capillaries, and blood). Students can use a variety of sources (print, electronic, software) to learn about the major organs of the circulatory system. The circulatory and respiratory systems should be investigated using pulse and breathing rates. Students should pose questions about factors they want to investigate, and design experiments around these questions. An investigation could include seeing how exercise affects breathing and pulse rates. These provide excellent opportunities to control variables, and compile and display results. Caution: Teachers should be aware of any physical problems, like asthma, that students might have, and ensure that the investigations undertaken will not overtax these students. Connections can be made to the excretory system studied earlier. Students may note that as the amount of activity increases, so will their rate of perspiration. Equipment such as stop watches, spirometers and computer interface sensors can be used to accurately measure breathing and pulse rates. Students could measure their lung capacity by blowing into a plastic tube that leads into an inverted jar filled with water. This jar should be partially submerged in a pan of water to keep the water held in the jar. The air that they blow out will displace the water in the jar, and they can measure how much water is displaced. Alternatively, they may want to compare the circumference of balloons that they can blow up in one breath. However, some balloons may be more flexible than others, or get more flexible over time. Alternatively, students could see how far they can blow a light object across a table. Students may be able to think of other ways to test lung capacity; they may have access to a spirometer through the local heart and lung association or from a local high school lab. Students should be aware of the scientific processes they use when they do investigations. Students have just completed a fair test in which they investigated and carried out procedures in which variables were controlled and others measured. Students will have experienced describing what constitutes a fair test, and should be able to recognize if a test is fair or not. They should ensure that all variables are controlled except the one being tested. Students have had experience with the concept of variables. This may be an opportunity for teachers to introduce the term "variables". ELEMENTARY SCIENCE CURRICULUM: GRADE 5 The Respiratory and Circulatory Systems Suggested Assessment Strategies Performance * With a partner, students could take their pulse for 15 seconds and count the number of times they breathe for two minutes. They should record this number in the chart, and then do some gentle exercise (running on the spot, skipping, push-ups, etc.) (Note: substitute other procedures related to other factors they may want to test)/ They should then take their pulse and count the number of times they breathe again. Students should draw a bar graph illustrating their results. (204-1, 204-2, 205-1, 206-2) : Journal * Students could imagine they are in a capsule in the circulatory system. They could describe the parts through which they would move during their voyage (after leaving the heart until you return). (302-5d) Interview * What are some of the variables that need to be controlled to get a fair test during heart and breathing exercises. (104-2) * Could we breathe without a diaphragm? Explain. (302-5c) Presentation * Students could construct a working model of the respiratory system using household materials. (302-5c) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources (205-1, 206-2) Multiple references throughout resources (104-2) The Skeletal, Muscular, and Nervous Systems Outcomes Elaboration–Strategies for Learning and Teaching Students will be expected to * describe the structure and function of the major organs of the nervous system (302-5e) * demonstrate how the skeletal, muscular, and nervous systems work together to produce movement (302-6) * carry out procedures to explore response time, and identify and suggest explanations for patterns and discrepancies in the data collected (205-1, 206-3) * describe various medical technologies, such as exercise machines and artificial limbs, that have arisen from the study of how our body moves (106-4) 108 Students should investigate the structure and function of the major organs of the nervous system. Major organs include brain, spinal cord, and nerves. Students can use a variety of sources (print, electronic, software) to learn about the major organs of the nervous system. Students could construct the skeletal system with attached muscles. These models should illustrate how the muscles are necessary to move the bones, and that the nervous system is the command centre for any movement. Teachers may want to use chicken wings, legs, and thighs to demonstrate whole muscles, tendons, ligaments, and bones, and pull away the muscle tissue to observe the bone structure. Students could compare and contrast the bones of the wing to the human arm and hand bones. The teacher may wish to get x-rays from a local hospital for use. Caution: Chicken parts must be cooked and dried at home by the teacher. Students could do any activity that tests for response time. One student could drop a long object such as a pencil or metre stick, and then measure the point at which a second student, whose arm is stationary, catches the object. They should collect, analyse, and graph the response time data. The further down the ruler or pencil is caught, the slower the reaction time. These activities provide excellent opportunities to show how results from a single student can vary (the student will not be able to catch it in the exact same place every time due to variations in alertness and response time), and this will highlight the need for repeating tests and averaging results. Mathematics outcomes related to determining the mean can be addressed in this context. Students could do research on the variety of artificial limbs that have been developed over the years, noting the improvements. Students may also research the wide variety of exercise machines that have been developed to increase strength and endurance. This will encourage positive attitudes about the role and contribution of science and technology in their understanding of the world. Research information may be collected from rehabilitation centres, prosthetic centres, or companies. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 The Skeletal, Muscular, and Nervous Systems Suggested Assessment Strategies Performance * Students could develop an experiment to test response time or muscular activity during physical exertion. They should compare and analyse the results of their experiment and express in graph form.(205-1, 206-3) Paper and Pencil Students could: * Write a lyric or poem on the interconnection of the skeletal system. (302-6) * Produce a report on how various technologies have arisen from the study of how our body moves. (106-4) Interview * Why do people sometimes become paralysed due to an injury? (302-5e) Presentation * Students could build a model of an arm to show how the skeletal, muscular and nervous system work together. They should prepare an oral presentation using jot notes to explain how all the systems work together to produce movement. After showing their model and notes to the teacher for evaluation, they could take the model home, and give their presentation to a family member or neighbour. Students could ask them to write a brief evaluation of their presentation. (302-5e, 302-6) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources (205-1, 206-3) Multiple references throughout resources Body Systems Outcomes Students will be expected to * select and use tools in building models of organs or body systems (205-2) * identify problems and work cooperatively with other students to refine their design of a model of an organ or system (207-5) * provide examples of Canadians who have contributed to science and technology related to body organs, systems and health issues (107-12) 110 Elaboration–Strategies for Learning and Teaching Students should make and/or use models of the various systems or organs. These would help in the identification of various organs, and/or show the function of those organs. Students could make models and label the various parts. The model would not necessarily be a working model. They could illustrate, using tubes of various diameters, how the diameter of the tube (vein) affects the rate of water (blood) flow. They could also make models using bicycle pumps or syringes to show how water could flow through the various chambers. These last two models may not necessarily look like a heart, but would illustrate how parts of the circulatory system worked. Other possibilities include models of the respiratory system which can be made using a clear plastic bottle and balloons. Students can simulate the effect of the diaphragm by squeezing the bottle and noting the effect on the balloon. Teachers could demonstrate digestive system models that include simulating stomach acid using dilute solutions of hydrochloric acid. A clear bottle containing this solution could be displayed, and food could be added to see how it is affected. Intestines could be made out of panty hose. Models can show how muscles and bones move together. Teachers may want to set up displays or demonstrations using grocery store specimens of organs , such as beef or chicken hearts, or the skeletal system of a chicken. Students can write a report on a local or regional scientist, inventor, or medical practitioner (male/female, variety of ethnic backgrounds) working in the medical field. Past notable Canadians include: Wilfred Bigelow, who invented the cardiac pacemaker; Banting and Best, codiscoveres of insulin; Ray Chu-Jeng Chiu, pioneer of a surgical technique for failing hearts; D. Harold Copp, discoverer of an effective treatment of osteoporosis (a bone disease); Phil Gold, developer of the first blood test for certain types of cancer; and Maude Abbott, developer of a classification for heart diseases. This could include researchers at local universities. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Body Systems Suggested Assessment Strategies Paper and Pencil * Students could choose one of the Canadians studied in this unit, and write a paragraph about how he/she has helped us to keep healthy or contributed to our understanding of organs and/or systems. (107-12) Interview * Describe how respiratory and circulatory systems work together to get oxygen throughout your body. (302-4) * Describe how the digestive and excretory systems work together to make sure the food you eat is processed properly. (302-4) Presentation * Students could create a model of one of the organs in the systems studied in this unit. The model can be made to look like the actual organ or show how the organ works. Students could work in small groups.(205-2) Informal/Formal Observation * During the model design activity, teachers could observe the performance of students working in groups and their ability to problem solve to improve the model. (207-5) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources (205-2)Multiple refer4ences throughout resource module (207-5)Multiple refer4ences throughout resource module (107-12) TR Lesson 5, SR 5, p. 38-44 p. 18-21 Maintaining a Healthy Body Outcomes Elaboration–Strategies for Learning and Teaching Students will be expected to * describe the body's defences against infections (302-8) * describe the role of the skin (302-7) * describe nutritional and other requirements for maintaining a healthy body (302-9) * evaluate the usefulness of different information sources in answering questions about health and diet (206-4) * describe examples of health and fitness programs within their community and region (107-5) * describe and compare the techniques used by different people in their community and region to address their health requirements (107-2) 112 This section can also be integrated with health/family living outcomes. Students should discuss and investigate the body's natural defence mechanisms against diseases and illnesses (e.g., tears, saliva, skin, certain blood cells, and stomach secretions). Students may not be aware of how many germs they come in contact within the course of a day. Students should research the various ways that germs can be spread. In exploring how their own body can defend itself against bacteria, viruses, and germs, it is informative to contrast with people whose immune system is defective. This will highlight how we can take this for granted when it is working well. Students could explore the Canada Food Guide for maintaining a healthy body. Students could explore, through dicussions, how lifestyle plays a role in healthy living. Students could focus on how "life style" advertising affects their choices of nutrition, fitness, and other health care products. Students should choose an ad, or magazine tabloid article, and discuss its merit. This will lead to important discussions about the meaning of a healthy lifestyle, and appropriate role models. Field trips or speakers from health and fitness programs could be arranged for students. Students should explore through field trips, research, or guest speakers, techniques used by people in their community to address their health requirements. This could include in-school resources such as the health and physical education teacher. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Maintaining a Healthy Body Suggested Assessment Strategies Journal * Students could respond to a question such as "What are some things that I eat that are nutritional?" (302-9) Paper and Pencil * Students could write a report about a health and/or fitness program in their community or region. They should describe what the program involves, and who it tries to help. (107-5) Interview * What strategies are used by people in our community to meet our health requirements. (107-2) Presentation * Students could research one of the following topics to find out how it affects the growth and development of their body: tobacco, alcohol, steroids, marijuana, tanning salons, junk food. (302-9, 206-4) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources (302-9) Multiple references throughout resource module (107-2) TR Lesson 3, p. 23-31 SR 3, p. 10-13 Teacher/class will need to identify local examples Maintaining a Health Body (continued) Outcomes Elaboration–Strategies for Learning and Teaching Students will be expected to * describe examples of medical techniques that have been developed by other cultures, past and present, that have contributed to knowledge of maintaining a healthy body (105-2, 107-14, 106-2) 114 Students should investigate medical techniques that have been developed by other cultures, past and present. Topics might include acupuncture (Chinese), sweat lodges (First Nations peoples), chiropractics (various cultures), saunas, whirlpools, and herbal remedies and find out where the technique was developed and how it works to prevent or cure illnesses. Students could also choose a culture and research its traditional medical techniques and practices. Medicinal practice has developed over the years. Students may have no idea where various drugs or medical techniques come from. They can research medicine, doctors, natural herbs and remedies, and show how, in some cases, today's drugs and medical techniques have developed from ancient remedies. A possible choice for class study is the effect that clear cutting the rainforests has had on destroying some exotic plant and animal species that have pharmaceutical importance. An example of a past medical belief that is no longer in use: Doctors used to grind up precious gemstones for their patients to ingest. If (or when) a patient died, it was thought that the gemstone had some flaw, or they had not ingested enough of it. Teachers should have the class take part in a fitness session such as yoga, Tai Chi, or Chi Quong. Caution: Teachers should be aware of the physical limitations of students. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Maintaining a Healthy Body (continued) Suggested Assessment Strategies Presentation * Students could develop a skit, video, song, or lyric on the importance of all the bodily systems working in harmony in maintaining a healthy body. (302-4) Portfolio * Students could select pieces of work from this unit for their portfolio. They should fill out the portfolio self-assessment. Interview * Students could interview a health care professional about changes in health care in various cultures. (105-2) Journal * I am interested in a cultural/medical technique. Why ... ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources Outcomes Students will be expected to 116 Elaboration–Strategies for Learning and Teaching ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Suggested Assessment Strategies Resources Grade 5 Physical Science: Properties and Changes in Materials ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Unit Overview Introduction Materials around us have properties that are important to their use. By studying materials used in various applications, students become aware of properties such as solubility, hardness and buoyancy. They learn the significance of these properties to particular uses and how substances can be changed through reactions to display new properties. Focus and Context Science Curriculum Links 118 The focus in this unit should be on inquiry and investigation. Students should be encouraged to explore a wide range of physical and chemical changes, to investigate how to separate mixtures, and to look closely at the composition of the objects around them. One possible context for this unit is that of household chemistry. Many physical and chemical changes occur as we eat, bake, clean, and repair or renovate the house. Students should relate what they are doing in this unit to household events, and inquire about the types of changes that may be occurring, and/or where the materials originated. Students are introduced to materials and their properties in the primary science program. Students address outcomes related to materials, explore buoyancy, as well as physical and chemical changes, and use their knowledge from earlier units to build structures. In this unit, the concepts of physical and chemical changes are delineated further. This will lead to Mixtures and Solutions, Fluids, and Atoms and Elements in the intermediate grades. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Curriculum Outcomes STSE Skills Students will be expected to Nature of Science and Technology 104-5 describe how results of similar and repeated investigations may vary and suggest possible explanations for variations 104-7 demonstrate the importance of using the languages of science and technology to communicate ideas, processes, and results Relationships Between Science and Technology Social and Environmental Contexts of Science and Technology 107-8 describe examples of technologies that have been developed to improve their living conditions Students will be expected to Initiating and Planning 204-5 identify and control major variables in their investigations 204-7 plan a set of steps to solve a practical problem and carry out a fair test of a science-related idea Performing and Recording 205-3 follow a given set of procedures 205-5 make observations and collect information that is relevant to a given question or problem 205-8 identify and use a variety of sources and technologies to gather pertinent information Analysing and Interpreting 206-1 classify according to several attributes and create a chart or diagram that shows the method of classifying 206-2 compile and display data, by hand or by computer, in a variety of formats including frequency tallies, tables, and bar graphs Communication and Teamwork 207-3 work with team members to develop and carry out a plan ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Knowledge Students will be expected to 300-10 identify properties such as texture, hardness, colour, buoyancy, and solubility that allow materials to be distinguished from one another 300-9 group materials as solids, liquids, or gases, based on their properties 301-9 identify changes that can be made to an object without changing the properties of the material making up the object 301-10 identify and describe some changes to materials that are reversible and some that are not 301-12 describe examples of interactions between materials that result in the production of a gas 301-11 describe changes that occur in the properties of materials when they interact with each other 300-12 identify the source of the materials found in an object and describe the changes to the natural materials required to make the object 300-11 relate the mass of a whole object to the sum of the mass of its parts Properties of Materials Outcomes Students will be expected to * identify properties that allow materials to be distinguished from one another (104-7, 300-10) * classify materials as solids, liquids, or gases, and illustrate this classification in a chart that shows their properties (206-1, 300-9) 120 Elaborations–Strategies for Learning and Teaching The focus in this section is to determine and describe the properties of the different materials. Students should investigate a wide variety of materials (solids, liquids, and gases) and describe their distinguishing characteristics. Properties that students could explore are solids (colour, hardness, ability to pour, buoyancy, odour, solubility, magnetism) and liquids (colour, odour, viscosity, solubility in water, buoyancy, surface tension). Solid substances could include powdered or granular solids such as salt, sugar, baking soda, as well as solid objects such as pencils, cups or coins. Liquids could include water, vegetable oil, liquid soaps, molasses or vinegar. Gases can be illustrated using balloons, jars, or bubbles filled with air, or producing gases using reactions such as mixing vinegar and baking soda. Caution: Any experiments in which gases are produced should be done in containers that are open to air. Producing a gas in a closed gas jar, for example, could cause the jar to break open. Students could brainstorm properties of solids, liquids, and gases. Students should classify materials using their distinguishing properties: – classify solids as substances with a definite shape and volume – classify liquids as substances with a definite volume but no definite shape – classify gases as having no definite shape or volume Teachers can help students by demonstrating some properties of substances (swirling liquids to show that they do not keep the same shape, for example), and leading the discussion by asking questions such as, "Can you compress a liquid or solid?" ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Properties of Materials Suggested Assessment Strategies Performance * Students could explore the distinguishing characteristics or properties of solids or liquids, and record their observations in the table. (A similar table can be constructed for liquids.) (104-7, 300-10) Properties of Solids * Students could test the substances given below for solubility. They should chart their results. (104-7, 300-10) Substances: salt, sugar, baking soda, pepper, baking powder. Interview * How can you tell if something is a liquid? What are some of the properties it wil have. Compare this to the properties of a solid. (206-1, 300-9) Presentation * Students could produce a video or a collage of pictures illustrating the properties of solids, liquids, and gases. (206-1, 300-9) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Physical Changes Outcomes Students will be expected to * observe and identify physical changes that can be made to an object that change the form or size of the material in the object without producing any new materials (301-9, 205-5) * identify and describe some physical changes that are reversible and some that are not (301-10) 122 Elaborations–Strategies for Learning and Teaching Students should investigate physical changes in this part of the unit changes that affect the look, feel, strength, texture of an object, but do not actually change the object into a totally different material (cutting wood is a physical change, burning wood is a chemical change). Teachers and students should understand that in some cases a physical change is obvious, while in others, it is not. For example, shaping putty, breaking a piece of wood, folding paper, sharpening a pencil are clearly physical changes since it is evident that no new materials are formed, but changes such as phase changes (boiling or freezing water, for example), or dissolving materials in water are not obviously physical changes, since in these cases, the change yields materials that have very different properties. Students should explore physical changes to a variety of materials and investigate changing properties. For example, students may explore materials to answer the questions "Does the shape of an object (plasticine, aluminum foil) affect buoyancy?", "Does the temperature of the materials affects its malleability?" Some physical changes are reversible (boiling water, for example) and some are not (sanding wood into sawdust). Teachers should not use reversibility as a distinguishing feature of physical changes, since there are also many chemical changes that are reversible (e.g., litmus paper can change from pink to blue back to pink again), and some reversible changes may be chemical rather than physical (e.g., paper changing colour). ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Physical Changes Suggested Assessment Strategies Performance * In groups, students could design an experiment to measure how temperature affects the flow rate of water, molasses, corn syrup, or milk. They should identify and control variables. Students should share their results with their classmates. They should draw a graph of the class results, and draw conclusions. Caution: Do not exceed 20 o C when heating. (301-9, 205-5) Journal * Some physical changes can be reversed. Some physical changes cannot easily be reversed. For example ... (301-10) Paper and Pencil * Students could write "physical" or "chemical" beside each change in the following list and explain their choice. (301-9, 205-5) Note: This assignment can be done after the section on "Chemical Changes". – crumpling up paper – pouring water on the floor – lighting a match – mixing vinegar and baking soda – boiling water – melting a crayon to make a candle ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources Chemical Changes Outcomes Students will be expected to * describe chemical changes that occur when materials interact with each other to form totally new materials, including those that result in the production of a gas (301-12, 301-11) * identify and describe some chemical changes to materials that are reversible and some that are not (301-10) * work with team members to develop and carry out a plan to systematically distinguish a material based on its chemical properties (204-7, 207-3, 204-5) * compile and display data to present the results of chemical tests used to distinguish materials from each other (206-2) 124 Elaborations–Strategies for Learning and Teaching Students should explore chemical changes of different materials. Many chemical reactions can be done with household chemicals (e.g., vinegar and baking soda; yogurt and baking soda; an apple turning brown after it is peeled; milk and vinegar). While it looks as though these chemical changes are not reversible, teachers should not encourage this thought. Some chemical reactions reverse quite easily, while others virtually never reverse. Instead, students should focus on the fact that new substances are formed. Indicators are chemicals that easily undergo reversible chemical reactions, and in the process, change colours. Students could explore reactions by using blue litmus paper, which will turn pink when it reacts with chemicals such as vinegar, lemon juice, or other acids. It will turn blue when it reacts with chemicals such as baking soda, baking powder, or an anti-acid table (ENO TM ) dissolved in water, or other bases (alkalis). Students can make natural indicators out of substances such as raspberries, blueberries, rhubarb, red cabbage, cherry juice, beet juice, strong tea, and carrot juice, they could simply mix one of these substances in hot water until it becomes coloured (the more colour, the better). The teacher may want to prepare some of these using boiling water. Students could experiment to try to change these indicators from one colour to another using acids and bases. Connection to the Grade 5 Body Systems unit: Many chemical reactions in the body are reversible, for example, oxygen attaches to blood in the lungs, and then is released as the blood travels to other parts of the body. In contrast, a person will suffocate if he/she breathes in enough carbon monoxide, since it attaches to the blood in a virtually non-reversible chemical reaction. The blood is unable to bond with oxygen. Students should develop a plan to distinguish one material from another based on chemical properties. Students should produce a table showing how household substances react when combined. (Some substances are baking powder, baking soda, and chalk which will react with vinegar.) Students should then be given unmarked samples of baking powder, salt, and baking soda. Students can determine from their reactions any chemical changes. Caution: Students should be cautioned not to taste any of the chemicals. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Chemical Changes Suggested Assessment Strategies Performance * Students should explore the chemical changes that take place with approved chemicals. They should complete a table with observations. (301-12, 301-11, 301-10) * After completing a table with their observations, they should then perform the same tests on the unknown (to the student) substance. Students should try to identify which of the substances it is. Note: Teachers should leave some of the tests blank, and let students decide which tests to do. (204-7, 207-3, 204-5, 206-2) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources (301-12, 301-11) TR Lesson 11, SR 11, (301-10) TR Lesson 10, p. 85-93 p. 38-41 p. 78-84 SR 10, p. 34-37 Sources/Masses of Materials in Objects Outcomes Elaborations–Strategies for Learning and Teaching Students will be expected to * follow a given set of procedures to relate the mass of a whole object to the sum of the mass of its parts, and suggest possible explanations for variations in the results (104-5, 205-3, 300-11) * describe examples of manufactured materials that have been developed to improve their living conditions (107-8) * identify the source of the materials found in an object, and use a variety of sources and technologies to gather information to describe the changes to the natural materials required to make the object (205-8, 300-12) 126 Students should use a balance to determine the mass of an object. Students should determine that the total mass of an object equals the sum of its parts. Examples could be a banana in a bottle or a pencil case with various pens, pencils and erasers in it. Alternatively, a piece of some material, like cardboard or fabric, might be cut into pieces. The sum of the pieces should come relatively close to the mass of the total object, but may vary slightly due to errors balancing the scale or taking accurate readings. Teachers might pose the question: "What happens when we burn a piece of paper? What happens to its chemical and physical characteristics? Can we measure changes in mass? Accuracy is very important in doing this activity. Students should take care to measure as accurately as they can. The mass of an object can neither be created nor destroyed, but it can be transformed into smaller components, with different chemical and physical properties (law of the conservation of mass). Students will investigate a variety of manufactured materials produced to improve living conditions. Students should focus on what these manufactured materials are made of (composition) and how the materials have been processed. Students should do research on materials in daily life. These could include nylon, synthetic rubber, latex, Gortex TM , and household barrier wrap. Care must be taken that students do not get into the technical details of manufacturing to the extent that they are simply writing words from an encyclopedia. It is enough to determine the raw material from which the object is made, and then to have a general understanding of the processing involved. Students can look at various ores that contain some common metals, and understand that if the metal is present in its pure, elemental form (gold, for example), the separation of the metal from the rock is largely a physical one. In most cases, the metal is in the ore as a compound, and must undergo chemical reactions to turn it into a pure metal. Students may want to try to process some raw material themselves. They may, for example, want to make their own paper. People from the community may be invited to show how wool from a sheep is spun. Students may take field trips to sawmills, oil refineries, or any manufacturing company. Video or other electronic media could be used to illustrate these processes and products where direct access is not possible. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Sources/Masses of Materials in Objects Suggested Assessment Strategies Journal * Why are materials important? What did you learn about materials, and their physical and chemical changes? (205-8, 300-12) Paper and Pencil * Students could indicate whether the objects listed below are natural or manufactured. If they are manufactured, they should identify the source of the materials in the object as either rock/mineral, petroleum, and/or wood/plant. (107-8, 205-8, 300-12) – paper; glass, nylon tent, orange, car tires, bricks, cotton shirt, boulder, chair Presentation Students could: * Research a product to find out which raw materials it is made from, and how the raw materials are processed to make the final product. (205-8, 300-12) * Make a display of materials and what they are made of. Portfolio * Here is a sample of the paper I made. I started with ... (describe materials and process to make the paper). (105-8, 300-12) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources (104-5, 205-3, 300-11) Outcomes Students will be expected to 128 Elaborations–Strategies for Learning and Teaching ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Suggested Assessment Strategies Resources Grade 5 Physical Science: Forces and Simple Machines ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Unit Overview Introduction The study of motion and the forces causing motion help students begin to build a more sophisticated understanding of forces. Students are able to move from qualitative to simple quantitative descriptions of forces acting on objects as they manipulate simple machines. The effects of friction on the movement of objects are also explored. Students investigate the ability of simple machines to accomplish tasks with less effort, and compare and improve the ability of these machines to function. Simple machines are used in many aspects of life, and students should become familiar with their design and their advantages. Focus and Context Science Curriculum Links 130 The principle focus in this unit is problem solving. Students should get many opportunities for hands-on exploration, finding how various simple machines reduce effort, and then should be given open ended challenges in which they can use simple machines, singly or in combinations, to design solutions. Assessment should focus on the students' abilities to design creative solutions, not the "right" one. Inquiry would also play a role in this unit, especially in the beginning as students explore the effect of forces on motion. There are various contexts in which this unit could be addressed. Relating the outcomes to simple machines in the household (nails, wrench, wheelbarrow) would make the unit relevant and useful. Another interesting context would be to relate the outcomes to the human body, and how biotechnology is developing machines to enhance or replace limbs. In both of these contexts, students can define problems to solve, and then design solutions involving simple machines. Students have investigated factors affecting motion and magnetism in primary. In this unit, a broader investigation of forces is undertaken, with the application of forces to the use of machines. The concept of force as it relates to fluids is addressed in primary science. Motion is dealt with on a more quantitative level in Grade 10, and the relationships between force, motion and work are studied in high school physics. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Curriculum Outcomes STSE Skills Students will be expected to Nature of Science and Technology 104-7 demonstrate the importance of using the languages of science and technology to communicate ideas, processes, and results 105-5 identify examples of scientific knowledge that have developed as a result of the gradual accumulation of evidence Relationships Between Science and Technology 106-4 describe instances where scientific ideas and discoveries have led to new inventions and applications Social and Environmental Contexts of Science and Technology 107-1 describe examples, in the home and at school, of tools, techniques, and materials that can be used to respond to their needs 107-8 describe examples of technologies that have been developed to improve their living conditions Students will be expected to Initiating and Planning 204-1 propose questions to investigate and practical problems to solve 204-3 state a prediction and a hypothesis based on an observed pattern of events 204-5 identify and control major variables in their investigations 204-7 plan a set of steps to solve a practical problem and to carry out a fair test of a science-related idea Performing and Recording 205-2 select and use tools in manipulating materials and in building models 205-4 select and use tools for measuring 205-5 make observations and collect information that is relevant to a given question or problem 205-6 estimate measurements 205-8 identify and use a variety of sources and technologies to gather pertinent information Analysing and Interpreting 206-6 suggest improvements to a design or constructed object 206-9 identify new questions or problems that arise from what was learned Communication and Teamwork 207-1 communicate questions, ideas, and intentions, and listen to others while conducting investigations ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Knowledge Students will be expected to 303-12 investigate different kinds of forces used to move objects or hold them in place 303-13 observe and describe how various forces, such as magnetic, mechanical, wind, and gravitational, can act directly or from a distance to cause objects to move 303-14 demonstrate and describe the effect of increasing and decreasing the amount of force applied to an object 303-15 investigate and compare the effect of friction on the movement of an object over a variety of surfaces 303-16 demonstrate the use of rollers, wheels, and axles in moving objects 303-17 compare the force needed to lift a load manually with that required to lift it using a simple machine 303-18 differentiate between the position of the fulcrum, the load, and the effort force when using a lever to accomplish a particular task 303-19 design the most efficient lever to accomplish a given task 303-20 compare the force needed to lift a load using a single pulley system with that needed to lift it using a multiple pulley system Forces and their Effects Outcomes Students will be expected to * observe, investigate and describe how forces can act directly or from a distance to cause objects to move or hold them in place (303-12, 303-13) * describe forces as contact or non-contact forces (104-7) * demonstrate and describe the effect of increasing and decreasing the amount of force applied to an object (303-14) 132 Elaborations–Strategies for Learning and Teaching Teachers can engage students in a Know-Want to learn-Learned (K-W-L) activity about forces to start this unit. This will allow teachers to find out what are the students' conceptions about forces. It will provide some direction for investigations throughout the unit. A force is a push or a pull. In this introductory section, opportunities should exist for students to experience several types of contact (mechanical, wind) and non-contact (magnetic, gravitational) forces. Students could be encouraged to explore these forces through a series of open-ended activities: * How many ways could you make a paper clip move from one place to another? * Can you make a book move 0.5 m without touching it? Alternatively, teachers could develop activity centres featuring different types of forces in which students rotate through a series of more structured experiences (for example, one centre could feature magnets, another could have students exploring the effect of mechanical forces, another could feature fans for exploring the force of wind). As students are investigating the various types of forces, teachers should encourage them to find out how they can increase or decrease the amount of force that is being exerted, and note what happens. In classroom discussion afterwards, teachers should ask students what they found out. In most cases, changing the amount of force changes the speed at which an objects moves, but in some instances, it may have no effect on the motion of an object. For example, students may push on a wall, but the wall will not move. Students should be able to identify some of the forces acting on objects as contact or non-contact. For example, if a student is lifting a paper clip in the air with a magnet, the forces of gravity and magnetism should be identified. A common misconception of students is that if there is no motion, there is no force. Teachers can explore students' conceptions of this by asking them to identify the forces acting on a book that is resting on a table. If they have a hard time conceptualizing the force of the table on the book (which is equal but opposite to the force of gravity pulling the book downwards), teachers could ask them to hold out their hands, and lay the book on it. They will feel the force of the book on their hand, and feel their hands straining to hold the book up. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Forces and their Effects Suggested Assessment Strategies Performance * Students could move a paper clip 0.5 m along their desk four times using four different forces, and describe the ways they moved the clip. They should identify whether they were contract or noncontact forces. (303-12, 303-13, 104-7) * Without tipping a jar, students could describe how they could get the staple out of it? (303-13) Interview * Is wind a contact or non-contact force? Explain. (104-7) * What force keeps a book on a desk? (303-13) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources (303-12, 303-13) Multiple references throughout Student textbook module: Putting it in Motion resource module Forces and their Effects (continued) Outcomes Elaborations–Strategies for Learning and Teaching Students will be expected to * make observations in order to describe force qualitatively and quantitatively (205-4, 205-5) * estimate the force needed to lift or pull a given load in standard or nonstandard units (205-6) 134 Once students are comfortable with the concept of a force, and how to increase or decrease the amount of a force (using terms such as "more" and "less"), they can measure forces quantitatively (using tools such as a spring scale or elastic bands). Students may construct their own instruments for measuring force, for example, using elastic bands (measuring how far they stretch), or Slinkies TM (measuring how far they stretch from the force of gravity as well as an applied force). Caution: possible injury due to breakage of elastic bands. If possible, students can use force sensors connected to computer interface equipment to measure and graph the force acting on an object as it is lifted in the air or pulled up a ramp. Students may be introduced to the Newton as the unit of force using a spring scale that shows the force measured in Newtons. It is not important that they know the definition of a unit, but simply that it is a standard unit that indicates the amount of force being applied: The greater the force, the greater the number of Newtons. Using spring scales, students can note the number of Newtons it takes to lift or pull various objects. This can be followed by exercises that involve estimating the force required to lift various objects or answering certain questions, such as: "Does the angle of a ramp affect the amount of force required to pull/ push an object up it?"; "Does it take more force to open a door when pushing closer to the hinge or closer to the doorknob?"; "Does it take more force to move an object faster?" Students could estimate the amount of force using standard (Newton) or nonstandard (the length of the elastic band, the amount the Slinky TM stretches) units. These activities encourage attitudes related to appreciating the importance of accuracy, and working collaboratively with others in investigations. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Forces and their Effects (continued) Suggested Assessment Strategies Performance * Students could record the force used to lift the objects listed below. If they are using a spring scale, they could record the force in Newtons. If they are using an elastic band or spring, they could measure its length in centimeters as an indication of the amount of force. (205-4, 205-5) – science book, pencil case, exercise book, scissors, ... Paper and Pencil * A student lifts several objects with an elastic band, and records the force used as follows: – Estimate how far the elastic band would be stretched if it were used to lift an orange. (205-6) – Using a spring scale and a wagon, a student is to measure the force required to move the wagon (empty). Then they should repeat the experiment and add various weights to the wagon and record the results. (205-4) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources Friction Outcomes Students will be expected to * propose questions to investigate, identify variables to control, and plan a set of steps to identify factors that affect friction (204-1, 204-5, 204-7) * investigate and compare the effect of friction on the movement of objects over a variety of surfaces (303-15) * demonstrate the use of rollers, wheels, and axles in moving objects (303-16) * describe how the understanding of the concept of friction has led to the development of products that reduce and enhance friction (106-4, 107-1) 136 Elaborations–Strategies for Learning and Teaching During classroom activities in which students identify the forces acting on various objects in different situations (moving, stationary), teachers should highlight a situation in which an object was pulled (not lifted) along the floor, and the force was measured. Why do they think it took so much force to move the object? How could they reduce this amount of force? Teachers should introduce the term "friction" into the discussion. Can they describe friction? Do they know how to increase or decrease friction? During these activities, teachers can encourage students to propose questions to investigate about the factors that affect friction. For example, if students suggest that heavier objects will experience more friction, teachers should ask them to phrase their proposal into a testable question: "Do heavier objects experience more friction than lighter ones?". They should then work in groups to plan the steps to answer the questions that they propose. These types of activities can be used to further develop the notion of a fair test and the skill of controlling variables. Factors that they may test for are mass, amount of surface that is in contact (for example, is there more friction between a 1 kg wooden cube and a surface? or a 1 kg rectangular-shaped wooden block and the same surface?), the speed at which the object is pulled (they should try to maintain a constant speed in their tests), and the type of surface. The only factors that should have an effect are mass and the type of surface. Using their definition of friction and knowledge of the factors that effect friction, students can suggest ways of reducing friction. Science Olympics activities, for example, challenge students to raise a standard object up an inclined plane with a minimum amount of force by reducing the friction involved. This can be an excellent vehicle for increasing students' understanding of friction and the factors which affect it. Students should be exposed to the use of lubricants, surface smoothness, rollers, and wheels and axles as possible mechanisms for friction reduction. For example, they can measure the force needed to pull a book up a ramp, and then measure the forces when it is rolled up with drinking straws underneath it. Following this, students may spend some time investigating and determining instances when friction is beneficial or necessary or when friction is harmful or unncessary. Many types of writing activities, including fictional pieces about what would happen if there were no friction, can be used to help students clarify and broaden their thinking about the topic. For example, students could write an essay titled "Friction: It can slow you down and speed you up", in which they include examples of how friction can help or hinder. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Friction Suggested Assessment Strategies Performance Students could: * Plan an experiment that investigates factors that affect friction. They could carry out the investigation, make a chart for their results, and fill out, "Let's Experiment" write-up sheet. (204-7, 303-15) * Pull a block across different surfaces, and record the force needed in a chart. Examples of surfaces include carpet, tiled floor, grass, or a soapy board. (303-15) * Pull a block using various rolling objects, and record the force needed in a chart. Examples could include blocks with no wheels or rollers, blocks resting on pencils or straws, blocks resting on a skateboard, or a block resting on a ball. (106-4, 107-1) Paper and Pencil * Students could respond to a question such as "If you were pulling a toy, predict which surface would produce the least amount of friction: carpet, ice, gravel, or a wooden floor". (303-15) * Students could draw a picture of their ideas about friction. (107-1) Interview * Why does a toy car slow down and then stop after you push it? (303-15) * Could you walk if there was no friction? Explain. * Imagine that your hands are covered in frictionless gloves. What would happen? (303-15) Journal * Students could describe an invention: a machine that uses friction in a new way. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources Simple Machines: An Introduction Outcomes Elaborations–Strategies for Learning and Teaching Students will be expected to * use simple machines to reduce effort or increase the distance an object moves (205-2) * compare the force needed to lift or move a load manually with the effort required to lift it using a simple machine (303-17) * identify the problem of the large amount of effort needed to lift or move heavy objects small distances, or smaller objects long distances, that arises from the study of forces (206-9) 138 Simple machines can be used to reduce effort force or increase the amount of distance something moves. Students could rotate through centres that highlight simple machines such as scissors, a bottle opener, a can operner, an egg beater, tongs, a hammer, a clothes line pulley, pliers, a screwdriver, or a monkey wrench. These centres should include common household or school devices that are simple machines, and provide opportunities for students to interact and use these machines as they learn more about them. As students explore these machines, emphasis should be on developing the concepts of "load" and "effort" and the distances that these forces are applied. The load is the amount of force it would take to move an object without the aid of a simple machine, and the effort is the amount of force it takes with the aid of a simple machine. Students can experimentally determine both the load and the effort using spring scales (or the instruments they have devised to measure force) by measuring the force needed without the machine (load), and then measure the force required to move the object with the machine effort. For example, students could measure the force needed to lift an object 0.5 m straight up, and then measure the force needed to slide it up to a 2.0 m inclined plane to the same height. They could note that even though it was easier to slide up the ramp, they had to pull it for a longer distance. In cases where a machine reduces the effort required to lift an object (force advantage), the effort force will always have to be applied over a larger distance. In cases where a machine increases the effort required to lift an object, the effort force will have to be applied over a shorter distance, but the object will be lifted a greater distance (distance advantage). Students should now have a good understanding about how much force it takes to move objects, and how much they can lift unaided. Until now, they have been using spring scales or constructed force sensors on smaller objects or moved things small distances. In classroom discussion, teachers should ask students how they would move something really heavy, or move something a long distance. For example, how can they lift a heavy box? Better yet, how could they lift it to the tenth floor of a building? Students will have seen heavy machinery, such as cranes and tractors, and may suggest using these, or may suggest pulleys or other simple machines that they may be aware of. Students should be encouraged to bring in household machines such as wrenches, hammers, or screwdrivers, or pictures or drawings of more complicated systems of machines so that a classroom display can be set up. As the students explore simple machines, these more complicated pictures can be analysed to try to identify the simple machines that they are made from, and how the machines are connected. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Simple Machines: An Introduction Suggested Assessment Strategies Performance * Students could take the table below with them to the centres around the room. Using a simple machine, they could determine if the force needed to move or lift the object is less than, equal to, or greater than the weight of the object. They should record their findings on the table beside the appropriate activity centre. (104-7, 205-2, 303-7) Simple Machines Can Make My Life Easier * Students should compare their findings. Which simple machine required the least force to move the mass? Which required the most? Do they see any advantage to using a simple machine to move the mass? Journal * Things that I would find very hard to lift or move by myself are ... Things I use to help me move these objects are ... (206-9) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources Simple Machines–Levers Outcomes Students will be expected to * differentiate between the position of the fulcrum, the load, and the effort force when using a lever to accomplish a particular task (303-18) * design the most efficient lever to accomplish a given task (303-19) 140 Elaborations–Strategies for Learning and Teaching Students should be encouraged to investigate the advantages and disadvantages of changing the position of the fulcrum in a lever. Students should become familiar with the common terms used in levers (load, fulcrum, and effort). A variety of household levers (wrenches, nut crackers, wheelbarrows) can be displayed in class. While students should not be required to memorize the characteristics of a first, second, and third class lever, they should explore the differences that occur depending on where the fulcrum is placed. Attention should be paid to the amount of effort needed to lift objects, and the distance that the objects are lifted. Students can experiment with the effort required to lift an object when it is closer or further away from the fulcrum (1 and 2). They can also try to lift the object up from the same side of the fulcrum and vary whether they are between the object and the fulcrum (4), or the object is between the lifting student and the fulcrum (3). They may also try liftng two objects (5 and 6). A teeter totter-like level can be used for this exercise. Students can be given a variety of tasks. Depending on whether the task requires a force advantage (for example, lifting an extremely heavy object) or distance advantage (for example, lifting something a large distance), students can vary the position of the fulcrum to design a lever appropriate to the task. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Simple Machines–Levers Suggested Assessment Strategies Performance * Students could design levers to (i) lift a book a distance of 0.5 m using the least amount of force possible; (ii) project a marshmallow at a target; or (iii) crack a nut. (303-19) Paper and Pencil * Students could describe in words which picture shows the easiest way to lift up a heavy box? Which show the hardest way? Which shows the box being lifted the greatest distance? (303-18, 303-19) fulcrum push box fulcrum push box fulcrum push box fulcrum push box Interview * Show me the fulcrum, the load and the effort when you use a this hammer to remove a nail from a board. (303-19) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources Simple Machines–Pulleys, Systems of Machines Outcomes Elaborations–Strategies for Learning and Teaching Students will be expected to * compare the force needed to lift a load using a single pulley system with that needed to lift it using a multiple pulley system, and predict the effect of adding another pulley on loadlifting capacity (303-20, 204-3) * design a system of machines to solve a task (204-7) * communicate questions, ideas, and intentions, listen to others, and suggest improvements to the systems of machines designed by students in the class (207-1, 206-6) * describe examples of how simple machines have improved living conditions (107-8) * identify examples of sources (e.g., books, software and the Internet) of machines that have been used in the past, and have developed over time (205-8, 105-5) 142 Students can further their investigations of simple machines using pulleys. They can explore various ways of lifting objects using pulleys, and compare, using a spring scale or their own measuring instruments, the differences when two or more pulleys are used in various combinations. Again, students should note the distance that the effort force is applied. This is very easily done with pulleys - simply measure the length of the rope that is used to lift the object in the air. Students will find that while the object may only be lifted to a height of 0.5 m, depending on the pulley combinations they use, it may take rope 2-4 times longer to lift it. They should record their observations in a chart. The focus of the analysis should be qualitative - the easier it becomes to lift objects, the longer the rope is that has to be used. Once students are familiar with the various simple machines, they can be given a task to explore a variety of them. They can then be encouraged to use two or more simple machines in combination. Students can work in groups to try out various combinations of machines. Following this activity, students can demonstrate their designs and discuss the various strategies and simple machines used. They can test their designs to see which group has designed the system that matches the assigned task. Students could dismantle discarded mechanical-based machines of various types (bathroom scales, fishing reel, clocks), label parts and observe the simple machines at work inside. Caution: Do not use electrical appliances. Teachers should encourage students to look around their house and community to find example of machines, such as wheelbarrows and conveyor belts, that facilitate the carrying and transportation of products, or pulleys which are used in a clothesline or in lifting the platforms used by window cleaners. Students can analyze the pictures they have brought in of tractors, cranes, bicycles, scooters, skateboards, and other machinery to identify the simple machines in them. Students can research how simple machines have been used in the past. Examples such as the Egyptian pyramids, Britain's Stonehenge, the First Nation totem poles and inukshuks can intrigue students. During field trips, students could be challenged to identify applications of simple machines. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Simple Machines–Pulleys, Systems of Machines Suggested Assessment Strategies Informal/Formal Observation * Teachers could assess a student's group participation. (201-1, 206-6) Performance * Students could complete the table below as they carry out their investigations into pulleys. What do they notice about the force as the number of pulleys increases? What do they notice about the length of rope? * From the simple machines they have used, students could select two or more to use together as a system of machines. They should use this system to raise a book one metre. Students should test their solution to see how much force it took, and see if they can improve it in any way. (Criteria for assessment: the use of different machines, creativity, how much did they reduce effort, space required for system) (204-7) Pulleys Journal * Two problems that our group had today while designing our system of machines were ... We tried to solve these problems by ... (204-7) Presentation * Students could write a play, skit, or research paper (web page, oral presentation, poster) on machines. They should show how they are used today, and how they have been used in the past. (107-8, 205-8, 105-5) Portfolio * Students could select a piece of their best work from this unit for their portfolio. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources (303-20, 204-3) TR Lesson 12, p. 80-84 SR 12, p. 46-49 Outcomes Students will be expected to 144 Elaborations–Strategies for Learning and Teaching ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Suggested Assessment Strategies Resources Grade 5 Earth and Space Science: Weather ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Unit Overview Introduction Weather is an important aspect of daily life. Students should be provided with opportunities to realize that daily weather conditions are not the result of random occurrences, but rather are part of larger systems and patterns that can be predicted on both a short-term and seasonal basis. An important part of the study of weather is understanding the characteristics of air, its movement, and its ability to hold water. Students consider various aspects of weather such as temperature, wind speed, precipitation, and cloud formation, beginning to recognize the role these aspects play in weather systems. Focus and Context Science Curriculum Links 146 The focus in this unit should be inquiry. Data collection and predicting are processes that are also developed. An appropriate context for this unit is the development and use of a school weather station. Students will be given many opportunities to collect a wide variety of data on the weather using instruments they may have constructed themselves. They will also interact with a variety of people and use a wide variety of sources in order to determine techniques, instruments, and indicators for predicting the weather. Students have been introduced to air, water and weather in primary. In this unit on weather, students further study the factors that affect weather. The topic is studied in further detail in Science 1206 in a unit called Weather Dynamics. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Curriculum Outcomes STSE Skills Students will be expected to Nature of Science and Technology 104-4 compare the results of their investigations to those of others and recognize that results may vary 104-7 demonstrate the importance of using the languages of science and technology to communicate ideas, processes, and results 105-1 identify examples of scientific questions and technological problems that are currently being studied 105-2 identify examples of scientific questions and technological problems addressed in the past Relationships Between Science and Technology 106-4 describe instances where scientific ideas and discoveries have led to new inventions and applications Social and Environmental Contexts of Science and Technology 107-2 describe and compare tools, techniques, and materials used by different people in their community and region to meet their needs 107-5 provide examples of how science and technology have been used to solve problems in their community and region 107-10 identify women and men in their community who work in science and technology-related areas 107-14 identify scientific discoveries and technological innovations of people from different cultures 108-1 identify positive and negative effects of familiar technologies Students will be expected to Initiating and Planning 204-3 state a prediction and a hypothesis based on an observed pattern of events 204-8 identify appropriate tools, instruments, and materials to complete their investigations Performing and Recording 205-4 select and use tools for measuring 205-6 estimate measurements 205-7 record observations using a single word, notes in point form, sentences, and simple diagrams and charts 205-10 construct and use devices for a specific purpose 205-8 identify and use a variety of sources and technologies to gather pertinent information Analysing and Interpreting 206-1 classify according to several attributes and create a chart or diagram that shows the method of classifying 206-2 compile and display data, by hand or by computer, in a variety of formats including frequency tallies, tables, and bar graphs 206-3 identify and suggest explanations for patterns and discrepancies in data 206-5 draw a conclusion, based on evidence gathered through research and observation, that answers an initial question Communicating and Teamwork 207-4 ask others for advice or opinions ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Knowledge Students will be expected to 300-13 describe weather in terms of temperature, wind speed and direction, precipitation, and cloud cover 302-11 describe the key features of a variety of weather systems 303-21 relate the transfer of energy from the sun to weather conditions 300-14 describe situations demonstrating that air takes up space, has weight, and expands when heated 302-10 identify patterns in indoor and outdoor air movement 301-13 relate the constant circulation of water on Earth to the processes of evaporation, condensation, and precipitation 301-14 describe and predict patterns of change in local weather conditions Measuring and Describing Weather Outcomes Elaborations–Strategies for Learning and Teaching Students will be expected to * identify and use weatherrelated folklore to predict weather (105-2) * identify and/or construct, and use instruments for measuring weather information (204-8, 205-4, 205-10) * use appropriate terminology in naming weather instruments and collecting weather data (104-7) * record observations using measuring instruments in order to describe weather in terms of temperature, wind speed, wind direction, precipitation, and cloud cover (205-7, 300-13) * classify clouds as stratus, cumulus, cirrus, or "other", compare results with others, and recognize that results may vary (104-4, 206-1) 148 Outcome Note: Many of the activities done in this section will also address outcomes for describing and predicting weather patterns, which occur later on in this unit. Teachers should introduce students to this unit with weather sayings, folklore and indicators on how people have predicted weather in the past (for example, if cows are lying down, then it is going to rain). Students can try using these to see how well they work. Students should construct and/or collect instruments for measuring weather information such as temperature, wind speed, wind direction, precipitation, humidity, and air pressure. Air and water thermometers, barometers, and other meteorological instruments could be constructed by students, and then used throughout this unit to collect data on the local weather. Students could develop an illustrated glossary of terms related to the study of weather, such as the names of weather instruments, weather systems, and words that describe weather, like "humidity" and "windchill factor". Students could start to tabulate their observations and measurements in charts or tables, for use in describing the weather, and for noting patterns and predicting weather later on in the unit. Students should spend time observing clouds. Classifying clouds can be a challenge, as cloud formations can change quickly. Students could look at pictures of clouds to identify and develop concepts about stratus, cumulus, or cirrus. Some clouds do not fit any of the common classifications. However, observing, classifying and researching what types of clouds are associated with various weather systems is an important part of predicting weather systems. Some students may wish do some research on cloud types to extend their classification scheme to classify clouds based on how high they are in the sky, such as classifying clouds as "nimbostratus" or "cumulonimbus". ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Measuring and Describing Weather Suggested Assessment Strategies Performance * Students could use weather instruments to help they make observations. They should record these in the chart. (205-7, 300-13, 104-4, 206-1) Weather Observations Journal * Some weather sayings that predict the weather that I have heard are.... I have found that these (work/don't work/sometimes work).... (105-2, 107-2, 207-4, 107-10 in "Predicting the Weather" section) Paper and Pencil * Students could print the letter describing each instrument on the line in front of the description of the instrument. (This item can be combined with pictures of the instruments) (204-8, 205-4, 205-10, 104-7) a) wind vane ____ Shows the direction of the wind b) thermometer ____ Tells the air pressure, high or low c) rain gauge ____ Tells the speed of the wind d) anemometer ____ Provides a measure of rainfall e) barometer ____ Tells the temperature ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources Student textbook module: Weatherwise (105-2) TR Lesson 9, SR 9, (204-8, 205-4, 205-10) TR Lesson 8, SR TR SR 8, Lesson 9, p. 61-66 p. 34-37 p. 55-63 p. 30-33 p. 61-66 9, p. 34-37 (104-7) Measuring and Describing Weather (continued) Outcomes Elaborations–Strategies for Learning and Teaching Students will be expected to * use a variety of sources to gather information to describe the key features of a variety of weather systems (205-8, 302-11) * estimate weather measurements for various times of the day, week, or for weather systems (205-6) * identify weather-related technological innovations and products that have been developed by various cultures in response to weather conditions (107-14) 150 Examples of weather systems include hurricanes, tornadoes, sleet storms, and thunderstorms. Many students will be able to watch the weather channel on television. This channel has extremely informative and interesting video clips that answer questions explain how various instruments work, and show the key features of weather systems. There are also many informative sites on the Internet. Students can use the information they have gathered from the variety of sources to estimate things like wind speed, amounts and types of precipitation, when various weather systems are forecast or occur both locally and globally. Students could be encouraged to estimate temperature and wind speed to assist in selecting appropriate outside clothing. Students could be encouraged to estimate the wind speed of a storm, or estimate the amount of precipitation after a rain or snowstorm. Students should be encouraged to investigate the role and contributions of science and technology in the development of weather-related products. Students can use a variety of electronic media (television, Internet), as well as print resources, to identify weather-related products such as storm doors, weather proof clothing, Sou'wester hats, snow fences, dams and dikes in flood zones, hurricane shutters, igloos, snowshoes and sloped roofs. Teachers may wish to have individuals or pairs of students do research, and then display their findings as part of a classroom "Weather Collage/Exibition". ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Measuring and Describing Weather (continued) Suggested Assessment Strategies Performance * Teachers could dhallenge students to estimate temperature and wind speed. They should take the actual temperature and wind speed, and compare predicted to actual results. (104-4, 205-6, 205-7) Paper and Pencil Studetns could: * Think about the many items humans have invented to help them deal with different kinds of weather. What is one item that they would like to see someone invent (like glasses that don't fog up when you come in on a cold day). * Use a variety of sources to find out about weather events such as hurricanes, tornadoes, sleet storms, thunderstorms, and heat waves, using indicators such as ranges of precipitation, wind speed, cloud type, temperature. (205-8, 302-11) Interview * What do you think the wind speed would be in the middle of a winter blizzard? (205-6) * What do you think our average day-time temperature is in February? (205-6) * A hurricane is due to hit land on Wednesday. What do you think the wind speed range will be? (205-6) Presentation * Students could research in magazines, books, or electronic resources to find products that have been developed by various cultures to help them cope with their extreme weather. These products could be special clothing, roofing materials, shapes and structures of buildings, special forms of transportation, for example. Students should cut out or draw pictures for a classroom collage on weather. (107-14) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources Sun's Energy Reaching the Earth Outcomes Elaborations–Strategies for Learning and Teaching Students will be expected to * relate the transfer of energy from the sun to weather conditions (303-21) * identify and use appropriate tools, measuring instruments and materials to measure the temperature of soil and water after exposing them to light and draw conclusions (204-8, 205-4, 206-5) 152 Students have been involved in measuring and describing weather and various weather systems, and in this section they will be introduced to some of the causes of weather phenomena, namely precipitation and winds. Two processes related to weather and air/water movement that students should investigate are the water cycle and temperature-induced winds or convections. Using these two processes, students will be able to understand how the sun can play such an important role in determining the weather. Students should describe that solar energy provides energy for the evaporation of water, and the energy to warm the Earth's lands and oceans. The sun plays an important role in the water cycle and in determining weather conditions. It is the energy from the sun that warms the water and land. Students will discover that when more heat is given to water, evaporation takes place faster. This will result in more water vapour in the air. Conversely, as the moist air cools, condensation occurs, and water falls as various forms of precipitation. Students should investigate the temperature change of soil and water when exposed to a lamp for equal periods of time. They should investigate the temperature change after the lamp is removed, and draw conclusions based on their observations. Water will take longer to heat up and cool down. As the temperature of the water and the land rises, so does the air above it. Because land and oceans do not warm up at the same rate, there will be temperature differences over land and water. These differences, which cause wind convections, will be explored later in the next section. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Sun's Energy Reaching the Earth Suggested Assessment Strategies Performance * With a partner, students could plan an experiment to see which heats up more quickly, water or soil. They should record their results in a chart, and graph their results using a line graph. (204-8, 205-4, 206-5) Paper and Pencil * Students could draw a diagram to show how the following are related: energy, sun, water, land, evaporation, condensation, precipitation (the water cycle). (303-21) Interview * On a hot summer day, which would you expect to be cooler, the water in a lake or the beach rocks or sand on the shoreline? Which do you think would cooler first thing in the morning, before the sun comes up? Explain your answer. (204-8, 205-4, 206-5) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources (303-21) Multiple references throughout resource module. (204-8, 205-4, 206-5) TR Lesson 3, p. 22-27 SR 3, p. 10-13 Properties of Air Outcomes Students will be expected to * describe situations demonstrating that air takes up space, has weight, and expands when heated (300-14) * draw a conclusion, based on evidence gathered through research and observation, about the patterns of air and/ or water flow that result when two air or water masses of different temperature meet (206-5) 154 Elaborations–Strategies for Learning and Teaching Moving air (or wind) is a noticeable part of most weather systems. Students can do many activities to demonstrate the properties of air. Blowing up balloons, lifting boxes by blowing into plastic bags that have been placed under its corners, and trying to fill up a bottle with water by submersing it in a large tub of water (the air bubbles have to escape before it can fill up) will all demonstrate that air takes up space. Students can mass uninflated balloons or air mattresses, and then remass them when they are full of air to demonstrate that air has mass. The mass of the air is also evident by differences in air pressure at different heights above the surface of the Earth. This can be modelled by stacking paper in progressively larger piles to show how the mass increases. Similarly, air has a greater pressure closer to sea level because of all of the air "stacked" on top of it. An example of a way to demonstrate that air expands when heated or contracts when cooled is to submerse a tube or bottle in water until it is partly filled with water, and the rest is air. Invert the bottle or tube so that it is upside down, with the opening sitting in the water, and the water level in the tube or bottle showing above it. Mark the side of the bottle to show the water level (which indicates also how much space the air is taking up above it). Then use a hair dryer to warm the air in the bottle, or take the apparatus outside to cool the air in the bottle, and note the change in the space that the air takes up. Another way is to blow up a small balloon, and completely submerse it in water of room temperature. Mark the water level with the balloon submersed. Then, using an identical amount of warm water, submerse the balloon again, wait a few minutes, and mark the water level with the balloon submersed. It should take up more space when it is warm. This can also be done with cold water. An alternative activity involves placing the balloon under a lamp or in the refrigerator. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Properties of Air Suggested Assessment Strategies Performance * Students could put some plastic wrap over a jar, and secure it with an elastic band. They should put the jar in a pan that has hot water in Plastic wrap and elastic band Water Jar it. After three minutes, they should record their observations of the plastic wrap. Students should repeat with the pan filled with ice-cold water. What happens to air as it heats up? What happens as it cools? (300-14, 206-5) Paper and Pencil * Students could respond to questions such as "Why is the air pressure greater at sea level than at the top of a mountain? Draw a diagram to show your reasoning". (300-14) Interview * What could you do to show me that air takes up space? (300-14) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources (206-5) Movement of Air and Water Outcomes Elaborations–Strategies for Learning and Teaching Students will be expected to * identify patterns in indoor and outdoor air movement (302-10) * relate the constant circulation of water on Earth to the processes of evaporation, condensation, and precipitation (301-13) 156 Patterns of indoor air movement are far more subtle than outdoor patterns of movement. Students can investigate patterns of indoor air movement putting their hands about 0.5 meters above a raditator, and noting the rising warmed air. They may try to detect the direction of the moving air by clapping a chalk eraser over it, or letting small feathers from a down pillow drift over the heater. Caution: adding extra chalk dust and feathers in the classroom may irritate asthmatic students. They will also note moving air with fans or open windows. Outdoor air movement is much more pronounced. Students can easily feel the wind, and can use a wind vane to measure its direction at various times of the day, and an anemometer to measure its speed. Satellite images can show the pattern of air movement on a more global level. To illustrate the air pattern movements, teachers can use the fact that both air and water are considered fluids and behave similarly. Investigations regarding air flow patterns can more easily be shown by experimenting with water. Students can investigate these patterns by heating up one side of a large beaker or aquarium with heat lamps or a heat source. Alternatively, they might put a bag of ice on one side of the aquarium, and float a bowl of hot water on the other side. As the water is warming on one side, a drop of food colouring can be added to show how the water is moving. Students will see that the warm water moves up and over on top of the cold water, and the cold water moves down and across to replace the warm water. The same circular pattern, called convection, holds in air: warm air rises, and cool air sinks and moves over to displace the warm air. These convections can illustrate how winds occur. The bigger the difference in temperatures between two air or water masses, the stronger the convections or winds. Students can now revisit the effect of the sun on weather conditions as they can now propose explanations for "sea breezes": Land heats up more quickly than water. During the daytime, the air over land will warm up more so than the air over water, so the warm air over the land will rise up, while the cool air over water will move in to replace it. In the night-time, this situation reverses as the land cools down quickly once the sun disappears, while the water cools down much more slowly. Students will have explored phase changes in the "Properties and Changes of Materials" unit. Students can investigate the water cycle by making clouds in a jar, distilling water, exploring the evaporation of water from a glass, or letting water vapour condense on a window or glass. This can be related to the bodies of water on Earth and to the moisture in the atmosphere: rivers, lakes and oceans are a water source for rain, snow, and other forms of precipitation. As water evaporates from them into the air, clouds form. Precipitation from these clouds completes the water cycle. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Movement of Air and Water Suggested Assessment Strategies Performance * How often does the wind change direction and speed? Students could keep track by filling in the table for a week. (302-10) Tracking the Wind Journal * One day it could be sunny, and the next day the air is full of clouds, and it is raining. Where does the water come from? Where do clouds come from? I think I know. It comes from ... (301-13) * Places where I can feel moving air when I am inside are: ... It moves (describe pattern, if any). (302-10) * When I am outside, I feel moving air whenever I feel the wind. Over a one week period, ... (describe results of their observations, draw conclusions about patterns of outdoor air movement). (302-10) Paper and Pencil * From their observations, students could draw arrows to show the pattern of food colouring movement. They should write a conclusion about the direction of water movement of different temperatures. They should describe any evidence that air behaves the same way? (206-5) * Students could draw arrows to show the direction of the wind in the middle of a hot summer day. They should explain their arrows. (206-5) Ice Food colouring Aquarium or dish of water Heat Lamp Land Ocean ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources (301-13) Predicting the Weather Outcomes Students will be expected to * compile and display the weather data collected over a period of time in table and/ or graph format, and identify and suggest explanations for patterns or discrepancies in the data (206-2, 206-3) * ask different people in the community and region for advice on how to predict weather, and compare their tools and techniques (107-2, 107-10, 207-4) * provide examples of the way that weather forecasts are used by various people in their community (107-5) * describe and predict patterns of change in local weather conditions (204-3, 301-14) 158 Elaborations–Strategies for Learning and Teaching Students could continue to collect weather data throughout this unit, and will have explored some of the theory behind the causes of wind and precipitation. They should begin to analyze the data, looking for patterns. They should now look at how weather forecasts are made and how they have developed over the years. Students should interview family members, neighbours, students from other schools via e-mail, farmers, fishers, weather reporters or meteorologists, to find ways of forecasting the weather. There are many sites on the Internet that explain how weather is predicted by various groups, and some sites allow questions to be asked directly to a meteorologist. Students should gain the sense from their interviews and research that there is a range of indicators that can be used in predicting weather. To illustrate the degree of uncertainty in weather forecasting, students may wish to record forecasts (short and long term), and then compare these forecasts to the actual weather as it occurs. These activities encourage students to show an interest in the activities of individuals working in scientific and technological fields. This activity might be related to the work students have done on folklore weather predicting. Students could interview people in their neighbourhood or community to see how they use weather forecasts in their daily lives. Farmers, fisherpersons, skiers, school board personnel responsible for school closures, and people involved in transportation are examples of people they could talk to. Students can then make weather forecasts based on the indicators and sayings that they have collected and compiled. Since they have only collected weather data for a limited period of time, they will be able to see some patterns and be able to explain some of these based on the theory investigated in the last section, but the usefulness of this data for making predictions will be limited. They will find that they can make short term forecasts to a fair degree of accuracy using the indicators and sayings, but their ability to make long-range forecasts will be limited. These may improve if they include satellite images in their analysis which are available on the Internet. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Predicting the Weather Suggested Assessment Strategies Performance * In the top row of the table below, students could fill in some of the different ways they have learned to predict the weather based on the people in the community you have talked to. They should fill in the table for a week, and write a paragraph describing their results. (107-2, 107-10, 204-3, 207-4, 301-14) Predicting the Weather Paper and Pencil Students could: * Describe some of the tools that a meteorologist uses to predict weather. (107-2, 107-10, 207-4) * Name three groups of people or professions in their community that use weather forecasts. They should explain why it is important to have accurate weather forecasts. (107-5) Presentation * Students could create a poster that displays graphs of the various weather measurements that have been collected over the course of the unit. They should write a paragraph that describes what they found, and suggest explanations for any patterns or unusual points that they see. Some sample focus questions: Did the temperature steadily increase or decrease? Could you predict the temperature accurately if you knew the temperature the day before? Are weather conditions connected to the air pressure, as measured by a barometer? (204-3, 206-2, 206-3, 301-14) ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources (206-2, 206-3) (107-2, 107-10, 207-4) (107-5) Environmental Issues Outcomes Students will be expected to * identify examples of weather phenomena that are currently being studied (105-1) * identify positive and negative effects of technologies that affect weather and the environment (108-1) * describe how studies of the depletion of the ozone layer, global warming and the increase in acid rain have led to new inventions and stricter regulations on emissions from cars, factories, and other polluting technologies (106-4) 160 Elaborations–Strategies for Learning and Teaching Examples of weather phenomena that can be studied are the effects thought to be caused by the Green House Effect or Global Warming, acid rain, and El Niño/La Niña. In this part of the unit, students should gain some awareness of some current weather and climate related issues. Students will be introduced to the causes and effects of global warming, depletion of the ozone, and acid rain. Other weather/environmental issues can also be addressed, such as volcanic emissions, and deforestation. The depth of treatment for the causes would be limited to identifying the types of activities that contribute to these problems (e.g., refining ores, burning fossil fuels) but would not deal with actual chemical reactions. Students should, however, familiarize themselves with some of the terminology surrounding these issues, for example, they should be aware that "ozone" is a gas in the "upper atmosphere", and that ozone blocks some of the sun's harmful "ultaviolet rays". Students will also explore the effects of these phenomena, such as sun dogs, rainbows, and lunar halos, with information being gathered from a variety of sources, such as videos, television documentaries, newspaper and magazine articles, and news reports. Students may wish to try to simulate some of these effects using models. As an example, students may wish to simulate the effects of acid rain on plant growth. The greenhouse effect can be simulated by comparing the temperatures in two identical jars, one of which is covered in plastic wrap while the other is left open. Students should investigate the positive and negative effects of the technologies that contribute to air pollution. These can include greeenhouse gases, ozone-depleting gases, and/or acidic chemicals. For example, the chemicals that cause ozone depletion in the upper atmosphere were developed as cheap, stable, non-toxic alternatives to air conditioning chemicals in use previously. Acid rain is caused, in large part, by automobile exhaust, and many members of society are dependant on their cars. Students should realize that because of these positive benefits, finding solutions to these problems will not not easy. Finally, students should explore solutions or products that have been developed to reduce the effect of these problems. They could find out what local, provincial and federal governments, and well as international organizations, are doing to find solutions. This part of the unit fosters a realization that the applications of science and technology can have both intended and unintended effects. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Environmental Issues Suggested Assessment Strategies Presentation * Students could create a presentation (cartoon, brochure, poster, report, web page) on a current weather-related environmental topic from the list below. They should give a description of the environmental issue, and suggest inventions or innovations that have been developed because of the problem. (105-1, 106-4, 108-1) – acid rain – global warming – the ozone hole – El Niño or La Niña – volcanic emissions – others Portfolio * Students could select a piece of their best work from this unit for their portfolio. ELEMENTARY SCIENCE CURRICULUM: GRADE 5 Resources (108-1) TR Lesson 10, p. 67-72 SR 10, p. 38-41 Outcomes Students will be expected to 162 Elaborations–Strategies for Learning and Teaching ELEMENTARY SCIENCE CURRICULUM: GRADE 5
<urn:uuid:abb1dd34-1441-4f5f-9063-7457cca0201a>
CC-MAIN-2016-50
http://www.ed.gov.nl.ca/edu/k12/curriculum/guides/science/elementary/gr5.pdf
2016-12-09T01:57:38Z
crawl-data/CC-MAIN-2016-50/segments/1480698542668.98/warc/CC-MAIN-20161202170902-00126-ip-10-31-129-80.ec2.internal.warc.gz
436,869,362
22,877
eng_Latn
eng_Latn
0.943418
eng_Latn
0.996642
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Lat...
false
docling
[ 116, 2080, 5611, 7658, 8805, 12354, 13283, 16995, 18251, 21089, 22307, 24854, 26022, 28201, 29121, 30854, 31485, 31620, 31768, 33288, 35645, 37650, 38477, 40459, 41451, 44516, 45234, 48384, 49404, 49540, 49678, 51845, 54770, 57615, 58306, 60540, ...
[ 4.71875, 4.75 ]
4
1
Teacher's Guide for FOOTSTEPS Mansa Musa September 1999 Teacher Guide prepared by: our staff. The National Center for History in the Schools has published a study unit on Mansa Musa: African King of Gold which includes background materials, lesson plans, and student resources. This is available from Cobblestone Publishing (ISBN 0382409477, $12.00 plus shipping and handling). Compare the maps on pages 24/25 and present-day Africa, page 3. What made Sundiata and Mansa Musa great leaders? Examples: Sundiata - established a strong government, rewarded loyalty, delegated authority, kept a large, welltrained army, encouraged trade, allowed religious diversity. Mansa Musa - generous, introduced new styles of architecture, keen interest in scholarship and law, established schools, upright, just, tolerance for other religions, a great diplomat. After reading the article on pages 12/13, ask students to each come up with a custom or tradition (either past of present) that is specific to a royal court, an ethnic or religious group, or a country. Have them share their findings with the class (examples: at the court of Louis XIV, his getting up and getting dressed ("lever") was public; in Japan one slurps tea or noodle soups; in some Arab countries, it is polite to burp after a good meal to express appreciation; one takes off one's shoes before entering a mosque; the ancient Romans believed that when entering a new home, it should be right foot first since that foot was considered lucky, etc.). Research projects: Have students research a real or mystical hero/heroine from their country of origin and share with the class. Include time period, geographic location, accomplishments, reason why the person was chosen. How far can you trace your roots, or the roots of someone you know in your community? Students can use interviews, photos, news clippings, maps, drawings, etc. to put together a poster to be shared with the class. Where is gold mined in the world today? Working in groups, each researching a region of the world for current mining operations. This could be as simple as locating then on a world atlas to doing a report on various mining companies, economic statistics, political climate. Ask students to chart the price of gold over the past 5 years. Similar research could be done with salt. Muslims try to make a pilgrimage to Mecca once in their lifetime. Ask students to think of other locations that have become sacred places to people of various (religious) beliefs. Perhaps someone in your community has been on such a pilgrimage and could talk to students about it. A project could be for students to do a travel brochure to a holy site."
<urn:uuid:61bb4d2e-428e-4172-af35-a1bd421e117a>
CC-MAIN-2018-51
https://s3.amazonaws.com/cricketmedia-wordpress/pdfs/new+folder/ftp9909t.pdf
2018-12-19T16:48:40Z
crawl-data/CC-MAIN-2018-51/segments/1544376832559.95/warc/CC-MAIN-20181219151124-20181219173124-00228.warc.gz
701,399,515
564
eng_Latn
eng_Latn
0.997206
eng_Latn
0.997206
[ "eng_Latn" ]
false
docling
[ 2688 ]
[ 3.828125 ]
1
0
PROTOCOL FOR HOT TOPICS OF THE WEEK At the first session each coordinator will be prepared with 1 topic, which will be chosen from any news source that appeared during the week prior to class. They will check with each other two days before class to make sure that they each have separate topics. The topics and their sources and links, if possible, will be sent out to the class one to two days prior to class. In the following weeks, 2 class members will each bring in 1 topic for discussion. (If there are not enough participants to have 2 different presenters each week some class participants may be asked to do 2 presentations.) Also, they will check with each other by e-mail 2 days prior to class to assure each has different topics, and will forward their topics, sources and links to a designated coordinator, who will send this information on to the entire class. If the topic is from the print media or the internet and is printable, the presenter is to bring a full printed copy to class, so that if questions arise, there is the original source to refer to. The presenter of the topic will give a 1–2 minute summary of the subject and pose a 1-3 questions to get the discussion started. Suggested questions are: Comparison questions to bring out similarities and differences, i.e. in what ways are Mitt Romney and Sarah Palin similar and in what ways are they different? Inference questions to explore possible conclusions or applications, i.e. what will state and city pensions look like 5 years from now? Application questions to see how certain information applies in different situations, i.e. how could this alternative energy source be used in your home? Problem solving questions to encourage thinking about solutions to real world problems, i.e. what would be the best way to reduce our dependence on foreign oil? Cause and effect questions, i.e. why do powerful politicians continually stumble over their sexuality? Questions could also be as simple as: what do you think about this situation? Why? Once the class feels that we have exhausted a topic, we will move on to the next one on the list. Topics that may be presented are just about anything, i.e. local news, sports, national news, world news, economy, military, etc. We should be able to cover all 4 topics every week by giving 25-30 mins. to each topic. We suggest that all members of the class read the Providence Journal and either the New York Times or the Wall Street Journal or both. However, all news sources, such as Time, Newsweek, The Economist, etc. are acceptable. Suggested web sites are: The Christian Science Monitor, www.csmonitor.com (neutral on-line newspaper); The Huffington Post, www.huffingtonpost.com (liberal on-line newspaper); The Drudge Report, www.drudgereport.com (conservative on-line newspaper); Gary Bauer's Campaign for Working Families, www.cwfpac.com (conservative); Slate Report, http://slatest.com (neutral); Yahoo News, http://news.yahoo.com (neutral); Politico, www.politico.com (neutral); Conservative Byte, www.conservativebyte.com (very conservative); and Propublica.org, www.propublic.org (liberal); The Patriot Post http://patriotpost.us/ (conservative), www.politifact.com (neutral scorecard separating fact from fiction). A Google search of any topic would offer plenty of sources of information. If a search does not turn up much, it is probably too local or arcane to be "hot".The Voice of America, www.namesvoa.gov (short list, which is good for helping prepare presentation with unpronounceable names); and any others you may find. Since this is the election period, we decided last year to allow only 1 topic regarding the Presidential race at any session of the class. We will stick to that policy this upcoming class. It is up to the 2 presenters to decide who may do that topic. The coordinators expect that the class will be conducted with decorum. All of us have been in classes where participants spoke spontaneously after someone else had raised their hand to speak. We request this not be done. The coordinators will try to be aware of the order in which hands are raised and call on class members in that order. Some topics may lead to hot debate. However, we expect everybody to behave courteously.
<urn:uuid:f3b19d62-eb09-4e3b-8418-65e31274ed55>
CC-MAIN-2023-50
https://www.lifelonglearningcollaborative.org/wp-content/uploads/hottopicsmehlman.pdf
2023-12-08T20:27:49+00:00
crawl-data/CC-MAIN-2023-50/segments/1700679100769.54/warc/CC-MAIN-20231208180539-20231208210539-00483.warc.gz
951,559,705
935
eng_Latn
eng_Latn
0.998173
eng_Latn
0.998173
[ "eng_Latn" ]
false
docling
[ 4276 ]
[ 2.125 ]
1
2
Trinity University Digital Commons @ Trinity Understanding by Design: Complete Collection 7-2012 Habitats [3rd grade] Leslie Davenport Trinity University, email@example.com Follow this and additional works at: https://digitalcommons.trinity.edu/educ_understandings Part of the Education Commons Repository Citation Davenport, Leslie, "Habitats [3rd grade]" (2012). Understanding by Design: Complete Collection. 218. https://digitalcommons.trinity.edu/educ_understandings/218 This Instructional Material is brought to you for free and open access by the Understanding by Design at Digital Commons @ Trinity. For more information about this unie, please contact the author(s): firstname.lastname@example.org. For information about the series, including permissions, please contact the administrator: email@example.com. Understanding by Design UNDERSTANDING BY DESIGN Unit Cover Page Unit Title: Habitats Grade Level: 3 – special education Subject/Topic Area(s): Science Designed By: Leslie Davenport Time Frame: 10 days School District: NEISD School: Larkspur Elementary School Address and Phone: 1802 Larkspur San Antonio, TX 78213 (210) 407-4600 Brief Summary of Unit (Including curricular context and unit goals): This is a unit focused on a TEK from the Curriculum Framework for the STAAR Alternate. Students will understand that animals live in specific environments called habitats and that each habitat has its own characteristics. Throughout the unit, students will learn about five different habitats that animals live in. At the end of the unit, students will create a mural of a habitat of their choosing, including at least three elements. Students will then have to describe the elements of the mural. Unit: Habitats Grade: 3 rd Grade – Special Education Stage 1: Desired Results Established Goals (Standards) TEKS (Curriculum Framework for STAAR Alternate) 3.9A) The student is expected to observe and describe the physical characteristics of environments and how they support populations and communities within an ecosystem. Understandings Students will understand that… * Animals live in specific environments called habitats * Every habitat has its own characteristics Essential Questions How do animals decide where to live? What is a habitat? Skills Students will be able to… * Describe the physical characteristics of a habitat * Identify which an environment an animal lives in Knowledge Students will know… * The physical characteristics of a habitat * That the elements of a habitat work together * That animals and people live in different environments Stage 2: Assessment Evidence Performance Task: * Students will create a mural of a habitat with at least three elements (including at least one animal). They will then write a description about their mural and how the animals survive in the habitat. These will be posted in the hall for others to look at. Other evidence: * Pre/Post-assessment – what is a habitat? (Students will be provided three picture choices and have to select the correct one) * Matching test – students will place animal cards into pictures of the correct habitat * Matching test – students will place environmental element cards into pictures of the correct habitat * Checking in – students will sort or place images of animals and elements into the correct environment Stage 3: Learning Activities (Steps taken to get students to answer Stage 1 questions and complete performance task) * Day 1: Overview of habitats * Pre-assessment – ask students what is a habitat? (Provide three picture choices for students to choose from, one being correct) --- See attached power point * Students will draw a picture of the habitat they live in (their house/apartment) --- have visual choices for level 1 students to glue onto a house/apartment. "Today, I want you to draw a picture of the place that you live in. I want you to add a as many details as possible to show me exactly where you live." * "You just drew a picture about where you live. There's actually a fancy name for a place where someone lives. It's called a habitat. We are going to read a book about the different habitats that people and animals live in." Read Crinkleroot's Guide to Knowing Animal Habitats by Jim Arnosky * Closing: "Over the next two weeks, we are going to look at some of the different habitats that animals live in. After we have learned about some of them, you are going to get to pick one and create a mural of it for people to look at." * Day 2: Focus on land vs. water animals * "Yesterday we talked about where we live. Today we are going to focus on the different places that animals live in. Do you have any ideas about where animals live? Most animals either live in the water, or live on land. Today we are going to think about which animals live where." * Read aloud: I See a Kookaburra by Steve Jenkins and Robin Page * Ask students about where different animals would live. "Is the jungle a good place for a fish to live? Why can't a fish live in the jungle? Can a fox live in the ocean? Why can't a fox live in the jungle? etc." * Have students do animal sort (power point slide 2) – what lives on land, and what lives in the water. Students will cut images and glue them into the appropriate box. * Day 3: Focus on desert habitat * Read aloud about the desert: Baby Animals in Desert Habitats by Bobbie Kalman * Show power point (slides 3-7) – "what do you notice about the desert?" After showing the pictures of the dessert, explain the different elements and animals that live in the desert. * Show youtube video about the desert and animals. http://www.youtube.com/watch?v=5scAt0hasIg&feature=autoplay&list=PL9E79643809DDDD75 &playnext=2 * Have students cut and paste the animals and elements onto the desert back ground. * Day 4: Focus on jungle habitat * Read aloud about the jungle: Baby Animals in Rainforest Habitats by Bobbie Kalman * Show power point (slides 8-12) – "what do you notice about the jungle? How is it different than the desert?" * Show clip from Disney Nature's Chimpanzee Movie. Website with images and other facts: http://disney.go.com/disneynature/chimpanzee/#/movies/chimpanzee * After discussing the elements of a jungle, have students cut out and place the animal and element images onto the jungle background. * Formative assessment: Students will do the jungle vs. desert sort. * Day 5: Focus on ocean habitat * Read aloud about the ocean: Baby Animals in Ocean Habitats by Bobbie Kalman * Show power point (slides 13-17) – "what do you notice about the ocean? How is it different that the jungle or the desert?" * Show clip from Disney Nature's Oceans Movie. Website with images and other facts: http://disney.go.com/disneynature/chimpanzee/#/movies/oceans/trailer * Formative assessment: Students will do the jungle vs. ocean sort. * Day 6: Focus on pond/ lake habitat * Read aloud about a pond or lake: What's in the Pond? by Anne Hunter * Show power point (slides 18-21) – "what do you notice about a pond? How is it different from the other habitats?" * Show video clip on pond habitats: http://www.youtube.com/watch?v=kMBGd9FL9_A * As a class, draw/color a mural of a pond--- have the outline of a pond already on the paper and provide images of animals for students to color, cut and glue onto the mural. "At the end of the week, you are going to work on drawing your own mural, so today we are going to practice as a class. I have already drawn an outline of a pond, but we need to add the animals and other things that you would find at a pond. What are some of the things you can find?" * Day 7: Focus on arctic habitat * Read aloud about the arctic: Amazing Arctic Animals by Jackie Glassman * Show power point (slides 22-24) – "what do you notice about the arctic? How is it different from the other habitats? * Frozen Planet video – http://dsc.discovery.com/tv-shows/frozen-planet/videos/on-thin-ice.htm * After discussing the elements of an arctic, have students cut out and place the animal and element images onto the arctic background. * Day 8: * Matching tests. Students will place animal and environmental cards into pictures of the correct habitat. "Today I want to see what you have learned. Who remembers the five different habitats that we learned about this week? What you are going to do it cut out the pictures of animals and match it to the right habitat. Once you have finished that, you are going to do one with the different elements in a habitat." * Day 9: * Work on performance task. Students will create a mural of a habitat with at least three elements (including at least one animal). "We have learned all about five different habitats. Today, you are going to create your very own mural about your favorite habitat. We will then hang it in the hall so that people can see what we learned about and they can learn about it also. After you have colored it the way you want, we are going to write a few sentences that describe the habitat and say how the animals live there. I have big pieces of paper for you, and crayons to draw with. I also have a few print outs of animals and different elements that you can color in and cut out for your mural." * Day 10: * Students will finish creating their mural and writing their describing sentences. * Post-assessment – ask students what is a habitat? (Provide three picture choices for students to choose from, one being correct) --- See attached power point * Other read aloud options: * Baby Animals in Land Habitats by Bobbie Kalman * Cactus Hotel by Brenda Guiberson * Coyote Raid in Cactus Canyon by Jim Arnosky * Watching Desert Wildlife by Jim Arnosky * Nature's Green Umbrella by Gail Gibbons * Welcome to the Green House by Jane Yolen * Pond Walk by Nancy Wallace * Coral Reefs by Sylvia Earle * Magic School Bus on the Ocean Floor by Joanna Cole Performance Task Rubric: Level 3: Student is able to apply knowledge. Requires student to make decisions "on his or her own" without the aid of choices. Level 2: Student is able to recall basic facts Requires the student to make decisions or choices based on information that has just been recently presented or is right in front of the student. Level 1: Student has beginning awareness. Requires students to show an awareness of a task and show that he or she knows that an activity is occurring or that a stimulus is being presented.
<urn:uuid:710f5753-803b-44df-93c4-ff09e3137112>
CC-MAIN-2023-50
https://digitalcommons.trinity.edu/cgi/viewcontent.cgi?article=1217&context=educ_understandings
2023-12-08T20:20:11+00:00
crawl-data/CC-MAIN-2023-50/segments/1700679100769.54/warc/CC-MAIN-20231208180539-20231208210539-00483.warc.gz
241,173,615
2,338
eng_Latn
eng_Latn
0.978064
eng_Latn
0.997642
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 853, 1737, 9860, 10400 ]
[ 4.71875 ]
2
1
Intervertebral Disk Disease Ph: (02) 4397 1157 What is a disk? The spinal column is made up of a number of small bones called vertebrae that are lined up like building blocks. A hole in the centre of each vertebra forms a tunnel in which the spinal cord lies. The spinal cord is extremely important because it carries the messages from the brain to the rest of the body. The spinal cord is extremely delicate, and being surrounded by the bony vertebrae helps to protect it. Between each pair of vertebrae, just underneath the spinal cord, is a little cushion, called an intervertebral disk. Disks cushion the vertebrae from one another and provide flexibility to the spine during movement. What is disk disease? As a part of the normal aging process, disks deteriorate, resulting in socalled disk disease. Normally, each disk consists of an outer fibrous ring and an inner gelatinous centre (a good analogy would be a jelly donut). With age, this "doughnut" changes in consistency; the outer fibrous ring becomes fragmented and the inner "jelly" centre hardens to a consistency of hard cheese. The fragmented outer fibrous ring may no longer be able to hold this hard centre in place, and movement of the vertebrae on either side may suddenly squeeze the disk out of its normal position. Unfortunately, this material usually moves upward and comes to rest against the spinal cord, bruising it in the process. This "slipping" of the disk often occurs explosively, causing significant damage to the spinal cord and pain to the animal. In this abnormal position, the disk presses against the spinal cord causing further damage. Is it more common in certain breeds? This type of disk disease may occur in dogs and cats of any age or breed but most commonly in the "short-legged" breeds, such as the following: Dachshund Ÿ French bulldog Ÿ Welsh corgi Ÿ Pekingese Ÿ What are the symptoms? The parts of the spine most commonly affected by "slipped" disks are the neck and middle to lower back, as the disk "slips" out of place and pushes against the spinal cord. Some common symptoms of disk disease include the following: Ÿ Significant back pain Ÿ Difficulty in using front and/or rear legs – weakness and wobbly Ÿ Toileting problems Ÿ Lameness Ÿ Poor coordination Ÿ Paralysis What tests are required to diagnose the problem? These symptoms indicate that the dog or cat has a problem affecting the spinal cord but not the exact location or cause of the problem. Other diseases may cause the same clinical signs such as a tumuor of the spine, or an infection of the spine. Clinical tests are needed to determine the exact location and cause of the problem and to decide on the appropriate therapy. An initial physical examination is performed. This allows us to determine where any painful areas are and if there is any reduction in the messages getting through to the legs. A lack of proprioception refers to the inability of the brain to realize where the legs are – this is seen as an animal who cannot stand squarely or feel when its foot has been turned over. More extensive injury to the spine may also reduce the sensation of pain in the legs. Further testing may be needed. To accomplish this, the patient must be anesthetized for x-rays and collection of fluid from around the spinal cord. Myelography is an x-ray study in which a special dye is injected into the fluid surrounding the spinal cord. This then allows any disk material pushing against the cord to be identified on the x-rays. Analysis of the fluid around the spinal cord helps to rule out other causes of the problems such as infection. What treatment is required? Initial Occasionally, animals with disk disease are not treated by means of surgery. In these animals, strict cage confinement and immobilization are used. Usually this approach is used for a first bout of back pain in animals that do not have problems walking. Although strict cage confinement does not correct the spinal cord compression, it may temporarily reduce some of the pain and swelling around the spinal cord and permit the ruptured disk to "heal." As time goes on, it is common for animals treated without surgery to suffer repeated bouts of pain, lameness, and paralysis as additional disk material slips and compresses the spinal cord. With each bout of disk disease the spinal cord suffers additional permanent damage. Surgical removal of disk material from the spinal canal is the only treatment that provides rapid and maximal recovery of spinal cord function. Cortisone administration to animals with disk disease is of therapeutic value only during the first 8 hours after the initial spinal cord injury. Current scientific evidence does not support the use of cortisone beyond this time. Furthermore, the adverse effects of cortisone (e.g. stomach ulcers) must always be kept in mind. Severe In some cases, disk disease is a problem requiring surgery to remove the disk material compressing the spinal cord. The surgery used most frequently to remove disk material from around the spine is called laminectomy. A surgical specialist is the best person to perform this type of surgery. What is the prognosis? For animals undergoing a laminectomy (surgery), the speed of recovery and the extent to which normal function of the legs is regained depends on many factors, including; The degree of the damage to the spinal cord and Ÿ The length of time that the spinal cord has been compressed by the disk material. Ÿ Animals exhibiting severe neurologic signs (e.g depressed feeling in their toes), a rapid onset of symptoms (hours), and a long period of time before surgery generally have a prolonged recovery period and may have varying degrees of permanent damage. Can it be prevented? Animals with short legs and long backs are prone to back injury. Prevention will include: Reducing body weight Ÿ Controlled exercise Ÿ Not permitting jumping up or down from objects Ÿ Reduced stair usage Ÿ If you have any further questions about disk disease, please don't hesitate to contact the practice.
<urn:uuid:f4e6e50a-62d8-4356-8114-9d7ac9f9a51e>
CC-MAIN-2023-50
https://toukleyvet.com.au/wp-content/uploads/sites/26/2023/05/Disk-disease.pdf
2023-12-08T18:54:43+00:00
crawl-data/CC-MAIN-2023-50/segments/1700679100769.54/warc/CC-MAIN-20231208180539-20231208210539-00485.warc.gz
651,532,718
1,261
eng_Latn
eng_Latn
0.998422
eng_Latn
0.998633
[ "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 47, 694, 2287, 3627, 5166, 6080 ]
[ 2.515625 ]
2
0
Released SOL Test Questions Sorted by Topic 2002-2012 Compiled by SOLpass – www.solpass.org SOL 5.4 – MATTER Matter is anything that has mass and takes up space; and occurs as a solid, liquid, or gas. Key concepts: a. properties of each phase of matter; of matter; b. the effect of temperature on the phases c. atoms and elements; e. mixtures including solutions d. molecules and compounds; SOLID-LIQUID-GAS – PHASES OF MATTER 1. The circles in the bottles represent the same particles of matter. Which pattern of particles represents a gas in a bottle? (2005-28) 2. What will happen if the lid is removed from a container that holds helium gas? (2004-12) a. The gas will expand and escape from the container. b. The gas will slowly change back into a liquid. c. When light hits the gas, it will change colors. d. Gravity will keep the gas in the container. 3. Oxygen, nitrogen, and carbon dioxide may be grouped together because at room temperature they are all a — (2001-7) a. solid b. liquid c. gas d. colloid 4. Which of these will happen if the temperature of a metal pan is increased? (2001-13) a. The pan will begin to lose heat. b. The molecules of the pan will move faster. c. The metal will change into another metal. d. The pan will contract. 5. Which of the diagrams best shows the arrangement of molecules in a solid? (2006-34) 6. Which picture shows a liquid at room temperature? (2005-4) 7. Gallium is a metal that melts at about 30°C. If a person, whose body temperature is 37°C, held a cube of gallium for five minutes, what will most likely happen to the gallium? (2011-18) a. It will change to a gas. b. It will change to a liquid. c. It will become a solution. d. It will become a mixture. 8. When ice cream is left out of a freezer, the ice cream 9. changes from a — (2009-4) a. solid to a gas b. gas to a liquid c. solid to a liquid d. liquid to a gas 10. Which of these shows how frozen water changes as the temperature of the air increases? (2007-17) a. Gas → liquid → solid b. Solid → gas → liquid c. Liquid → gas → solid d. Solid → liquid → gas 11. The process shown would be classified as — (2010-12) a. precipitation b. condensation c. transpiration d. evaporation 13. Which of these will change solid iron to a liquid? (2006-15) a. Raising the air pressure b. Increasing its temperature c. Crushing the solid iron d. Adding water to the iron 14. Which of the following changes is possible with the addition of heat? (2003-3) a. Liquid water changes to ice. b. Water vapor changes to ice. c. Water vapor changes to liquid water. d. Ice changes to liquid water. ATOMS, ELEMENTS, MOLECULES, COMPOUNDS 15. Water, ice, and steam are alike because they — (2006-28) a. are the same compound b. have the same shape c. look the same d. feel the same 16. The smallest quantity of an element is — (2002-10) a. a compound b. an atom c. a solution d. a molecule 17. The smallest part of matter that is identifiable as an element is the — (2003-36) a. atom b. molecule c. cell d. compound 18. Which of these will most likely happen to the balloon as the chemicals react? (2011-6) a. It will float. b. It will break. c. It will inflate. d. It will change color. MIXTURES & SOLUTIONS 19. Which of these is a mixture? (2006-13) a. Salt b. Water c. Lemonade d. Sugar 20. People put sugar in their tea to make it sweet. The sugar will dissolve fastest when the tea — (2004-16) a. is hot b. is cold c. is in a tall glass d. has lemon in it 21. In which beaker of water will sugar dissolve the fastest? (2005-35) 22. A student makes a fruit drink by stirring a powdered mix into cold water. Why is the fruit drink a solution? (2009-18) a. The powder dissolves in the water. b. The water changes color. c. The student stirs the water. d. The water is the proper temperature. 23. Which set of pictures shows what happens to a glass of salt water when it is left out on a counter for several weeks? (2006-31) a. C → D → A → B b. A → C → B → D c. B → A → C → D d. D → B → A → C
<urn:uuid:4f988d37-b83e-44c9-8a5a-3883928af78c>
CC-MAIN-2023-50
https://www.solpass.org/science4-5/matter/print/5-4-matter-released-questions.pdf
2023-12-08T18:45:57+00:00
crawl-data/CC-MAIN-2023-50/segments/1700679100769.54/warc/CC-MAIN-20231208180539-20231208210539-00484.warc.gz
1,062,449,380
1,136
eng_Latn
eng_Latn
0.989186
eng_Latn
0.991494
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 2213, 4022 ]
[ 3.984375 ]
2
1
Grade Level Overview For more information, visit www.HeritagePrep.org Heritage Preparatory School is a classical, Christian school located in the heart of the city of Atlanta that serves students from 4-year-old preschool to high school. Our vision is to be a school known for graduates who positively shape culture through their faith and intellect. ENRICHMENT I BIBLE * Explore major themes of redemption from the Old Testament, including Creation and promises for a Savior LANGUAGE, GRAMMAR & COMPOSITION * Study the birth, life, and death of Jesus LANGUAGE ARTS * Saxon Phonics with an Orton Gillingham approach to instruction * Phonemic awareness activities are used to train the ear to hear, isolate, and manipulate sounds by deleting or adding new sounds * Students recite sounds and identify with ease both the lower and upper case letters of the alphabet * VIsually recognize phonograms in printed texts and make the connection with the sounds they have memorized HANDWRITING * Zaner-Bloser handwriting is utilized, along with multisensory tools and approaches, to develop the fundamental skills of handwriting * Four handwriting strokes, including pull down lines, slide lines, circle lines, and slant lines, are taught * Develop gross motor skills including skywriting, balancing, skipping, hopping and galloping * Develop fine motor skills through tracing, coloring, cutting, dot-to-dots, geo boards, tangrams and working with clay to strengthen hand muscles * Learn basic writing strokes and formation of the 26 lower case letters of the alphabet * Beginning penmanship focuses on good habits and attention to detail, proper posture, paper position, and pencil grip LITERATURE * Develop vocabulary, make story predictions, sequence main events, and discuss character qualities through reading of texts including Nursery Rhymes, Aesop's Fables, and The Velveteen Rabbit * Narration: Listen to a passage read aloud and then asked to "give back" what they have learned * Develop skills in attention and remembering stories * Students narrate using the author's rich language and organize events in a logical manner * Orally narrate responses to field trips, readings, nature studies, and picture studies * Picture Studies: Study classical art prints and illustrations through pictures in class books to develop an eye for details, observation skills * Develop oral language skills to speak in complete sentences and use descriptive language * Memory Work: Commit to memory scripture, hymns, songs, chants, jingles, and poetry to practice the art of beautiful recitation with good diction, expression and cadence MATH * The emphasis of early math instruction is developing the fundamental number sense and problem solving skills used for all higher-level mathematics * Students spend a great deal of time with hands-on activities that help them experience how the number system works * Students study basic mathematical operations, number identification 0-20, mental math, graphing, estimating, patterns, spatial skills, sorting, and calendar skills HISTORY/ GEOGRAPHY * Students learn about the historical significance of the people and places they encounter in their literature and Bible, picture studies, recitations, art, and music * Continents of the world- map study and developing a heart to pray for people in distant lands MUSIC * Students experience a broad approach to music education through studying classical composers, listening to great works, and learning music theory * Children will sing hymns, and class time will be spent discussing rich theological texts at age appropriate levels so they may sing with lyrical understanding * Performance skills such as posture, breathing, vocal projection will be taught in preparation for school wide musical presentations * Children will be taught to use their voices to bring praise and glory to the Lord HABITS AND CHARACTER * Lessons in Biblical character and developing important habits: obedience, participation, attention, respect, self- control, and eye contact ART * Introduction to the Elements of Art - Line, Shape, Color, Texture, Form, and Space, and create works exploring these elements * Students are introduced to Great Masters - Monet, Van Gogh, Mary Cassat, and Piet Mondrian, just to name a few * Students will engage in great literature that inspires art - Books by Beatrix Potter, Dr. Suess, and Eric Carl NATURE STUDIES * Observe, manipulate, question, learn from, and delight in the details in our surroundings in Nature Class * Explore and interact with nature through scavenger hunts, imaginative play, measurements, and sorting * Delight in plants and animals through hands-on, high sensory tasks * Learn about the lives of animals through stories and observations * Children will be drawn to the world around us as nature is our text
<urn:uuid:0312d8b2-2094-455b-98c5-20e1a858009f>
CC-MAIN-2023-50
https://www.heritageprep.org/wp-content/uploads/2023/10/HPS-2021-PreK-Grade-Level-Overview.pdf
2023-12-08T18:08:21+00:00
crawl-data/CC-MAIN-2023-50/segments/1700679100769.54/warc/CC-MAIN-20231208180539-20231208210539-00484.warc.gz
855,233,969
1,007
eng_Latn
eng_Latn
0.994353
eng_Latn
0.993085
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 363, 4846 ]
[ 3.984375 ]
1
0
BEGINNING OF THE YEAR - What do the first few days look like? For our students in Cohort 1, in-person learning will begin on Tuesday, September 8, while our students in Cohort 2 will start the year at home on a virtual learning day. On Thursday, Sept 10 & Friday, Sept. 11, Cohort 2 will be on-site and Cohort 1 will have virtual learning days. The calendar below outlines the first few months. Please note, due to iPads shortage, our at-home days will likely need to be modified until our iPads arrive. This will likely include some phone check ins and paper pencil activities. Does every student get a device? Is it required they use the school provided one? We are in the process of purchasing iPads for all students to use this school year. Due to the volume of iPads ordered by schools this summer, there is a slight delay in the delivery of these devices. We will communicate with families as they come available. iPads will be used to support learning both at school and virtually. We will need students to bring their iPads back and forth with them each week. For those students with iPads at home, parents may wish to have the school iPads remain at school. If this is the case, please communicate your plan with your child's teacher. What would be a normal class size? Most in-person learning groups are 12-16 students. Will my child be sharing supplies with other students? Students will not be sharing common classroom supplies like they have in the past. Students should have a pencil box to store their individual supply of pencils, markers, scissors, glue, etc. In addition, teachers will direct students on where to store any supplies they were asked to bring for their class. Some items may be collected and stored by the teacher for later use (i.e. extra pencils, extra glue sticks, etc.). BUSING & TRANSPORTATION - How will the busing and drop-off/pick-up be different this year? Drop off times will be from 9:20-9:40. Students will be dropped off in the parent drop-off/pick-up areas and walk directly to their classrooms. If having breakfast, they can pick that up on their way to the classroom. Kindergarten students can walk into the school on their own. The students who do this adapt very quickly and feel empowered to be independent. If they are having breakfast, they should stop by their classroom and then head to the cafeteria for their grab & go breakfast. How will parent pick-up work this year? At the end of the day, students will be dismissed for parent pick up in a similar fashion to past years. Kindergarten students follow the same process as the rest of the students. They adapt to the process very quickly. Usually they need a little help reminding them to watch for their vehicle. It is very helpful to teach them how to identify you and your vehicle. AT SCHOOL DAYS - What will a typical in-school day be like? A typical in-school day will consist of: * Breakfast opportunity (Grab & Go option available to all students) * Class meeting and social-emotional learning experiences * Reading lesson and opportunities to practice their literacy skills * Phonics, Vocabulary and Spelling lesson and practice (Words Their Way) * Writing lesson and practice * Math lesson and practice (Bridges & Number Corner) * Lunch * Recess * Grades 1-4: Art, music, physical education, & computer lab experiences will be done on a rotating basis * Some students may receive additional support during the day (Title 1, ADSIS, English Learner, and/or special education services) Are there plans for recess/lunch procedures? Students will be asked to clean their hands (washing or sanitizing); 1) prior to entering the school, 2) before and after eating, 3) before and after outside activities, and 4) after using the bathroom. The playground areas will be divided into smaller zones. To limit exposure, students will play with classmates from their learning group. Will students be able to get a regular hot lunch and breakfast? Students will order their meal in the morning with their classroom teacher using the same process as they have in the past. There will be two options daily, a hot entree or a cold sandwich option. Staff will serve all components of lunch and place the food items on the trays for the students. Will the students be moving between classrooms? Students will have the same classroom space where they will learn from each day they are at school (students will not be traveling between classrooms). When students have the computer lab aide scheduled with their grade, they may have the opportunity to go to the computer lab for a portion of their day (similar to the experience in a traditional school year. Staff will make sure spaces are disinfected before another group uses the same computer). Will my child see more than one teacher? Yes, at times. In order to provide smaller learning groups while at school, each grade level cohort will be divided into three learning groups. Core instruction will be provided by two of the grade level teachers. By including specialist staff members within this cohort, we are also able to provide students with ongoing instruction within art, music, physical education, and digital learning. MASKS - What are the mask expectations? Students in kindergarten through twelfth grade will be required to wear masks while at school. Masks must cover both a student's nose and mouth. Acceptable masks include the following types: paper or disposable, cloth, scarf, bandanna, neck gaiter, religious face covering. Masks will be provided for students who do not bring one from home. A student must have documentation to be exempt from wearing a face covering. Documentation will be kept in the health office. (A face shield would then be expected). The wearing of masks and social distancing will continue into the recess time to help mitigate risks. We recognize there will be times when students will need to remove their masks while remaining socially distant. AT HOME DAYS - How will distance learning at home this fall differ from this past spring? Here are a few ways distance learning will be different this fall… 1) Teachers are planning lessons to have a learning focus continue through a five day cycle. Each cycle will begin on their first day being onsite for that week. Lessons will be designed to support student learning throughout the five days and gradually release more responsibility onto the students to apply the learning independently by the end of the cycle. 2) Students will have synchronous (live sessions) of small group support by their cohort teachers. This is planned to take place twice a day on the non-flex days. These scheduled lessons will be delivered by their cohort teachers. These live Zoom sessions will be staggered, one in the morning and one in the afternoon, so teachers can review needed material, assignments, and content to help students learn & work independently. 3) Seesaw will have a consistent structure throughout the grade levels to ease support by family members. Flex days will focus on asynchronous (independent) learning activities and expectations. Teachers will have office hours to support students and for families to ask questions/check in. This will allow teachers to make individual connections with families and students that have specific/special needs. Distance learning will focus on synchronous (live) small group sessions where teachers can review earlier learning, deliver new content and set learning/work expectations for that day. We are planning for two, 35 minute sessions on the non-flex days. Even though we made an early decision to order iPads, we have recently learned that our shipment has been delayed. In the event we do not have devices ready for students, all off-site learning days will be asynchronous (independent) and needed materials will be sent home with students on their on-site days. Our Hastings Online Academy students will have priority to get devices that are currently available. Attendance will be taken during students' Zoom sessions. When a student cannot attend the live session, students will have access to content via Seesaw. As students complete their activities, credit for attendance will be updated. Families should continue to notify teachers of vacations/sick days to help gather needed materials for learning to continue. In most cases, students will be able to access learning content remotely. HASTINGS ONLINE ACADEMY - Can you tell us more about the HOA? Students participating in HOA, will get a communication from the building inviting them to sign up for a virtual meeting with the teacher next week, just like Hybrid students. Moving forward, they will get information communicated to them from their HOA teacher. We are working to prioritize iPad inventory to be ready for distribution in order for regular HOA school to start Sept. 8th. In the HOA model, students will have paper/pencil activities as well as digital experiences. In addition, students will have live scheduled Zoom sessions with their teacher. Some will be whole group sessions while others will be small groups. The needed workbook & paper activities will be made available for pick up. Specialist experiences is a work in progress at this time and further details will come late September. Students will need supplies at home to help fulfill their learning needs. Those items may include: pencils, glue, whiteboard marker, whiteboard, and notebooks. HEALTH & WELLNESS - Due to the evolving changes with COVID protocols, what is the school's current expectations? We will follow Dakota County Health and the Minnesota Department of Health's guidelines to support our district's protocols. People's health conditions are confidential. If there is a communication to send out, it will be sent out in collaboration with the district. If there are specific health related questions, please feel free to contact our school nurse. Specifically, if a student needs to be quarantined for a period of time, they will have access to content through distance learning format. Family members are the first line of knowing what their child's symptoms are and how they are changing. Family members should be taking students' temperatures as a precautionary measure. We expect families to monitor this and adhere to the recommendations given when students have symptoms. It is critical that families do not send students showing symptoms to school. In some cases, students will show symptoms at school. In these cases, students will be checked by our licensed medical staff, and when appropriate will wait in an isolated location, families will be contacted and appropriate medical attention/action will be needed to take place. Please do not send sick students to school in hopes they make it through the day. Parent/Guardian Student Daily Symptom Checks One of our best defenses against the spread of COVID-19 is to teach students universal measures, such as maintaining social distance, wearing a mask, and proper hand washing. This summer, students attending Camp Horizons did a great job with all three of these. We anticipate students continuing to do a fantastic job listening to teachers and following our directions. When students aren't following expectations, we will follow similar actions that we use for other behaviors. In the event of a positive case, custodial staff will focus cleaning on the areas where that student was. During short weeks, cleaning will take place after school to help mitigate risks. OTHER If my child gets into kids campus Monday through Friday, will they be able to ride the bus home each day or just on her in-school days? Just on their in-school days. What is being offered for the gifted & talented students? In recent years, students in grades 3 & 4 were clustered with a group of students and placed with the GT teacher. In many cases this remains the same. This year is going to be a little different, as teachers will need to collaborate across Cohort 1 & 2 to ensure differentiation is consistent. What is going to happen with school pictures? School pictures for hybrid students will take place on Tuesday, September 22 for cohort 1(A) students and on Thursday, September 24 for cohort 2(B) students. Online academy students will have their picture day on Tuesday, September 8th from 3-8 PM at the Hastings High School Auditorium. Check out this website for pre-order information and how to schedule a specific appointment. The deadline to pre-order pictures for HOA is Thursday, September 10. If the hybrid choice is not working for any family will we be able to choose the DL model at any time? We are asking families to try and commit to a model, as adapting staff to meet this changing variable is very difficult. Please contact your building principal and the situation will be reviewed on a case by case basis.
<urn:uuid:9dd0c0ec-5d69-44f2-8fbd-39318a58ef55>
CC-MAIN-2020-45
http://kennedy.hastings.k12.mn.us/UserFiles/Servers/Server_92908/File/Frequently%20Asked%20Questions%20Aug.%202020%20.pdf
2020-10-24T12:25:29+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00224.warc.gz
60,211,964
2,620
eng_Latn
eng_Latn
0.999417
eng_Latn
0.999424
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1821, 4781, 8460, 11578, 12936 ]
[ 2.28125 ]
1
0
Targeting early childhood care and education: Myths and realities Executive summary Gillian Doherty This BRIEFing NOTE summarizes Targeting early childhood care and education: Myths and realities by Gillian Doherty (2001). This study reviews research literature about the effectiveness of targeting early childhood programs to selected populations as well as literature on the relative effectiveness of different kinds of programs that are intended to enhance or support child development. circumstances are not at risk. Other known variables that put children's development at risk are: (1) certain types of parenting styles, (2) living with a parent who is stressed, (3) living with a parent who is depressed, and (3) lack of adequate linguistic and/or cognitive stimulation. Targeting early childhood care and education: Myths and realities is available in print from the Childcare Resource and Research Unit or online at <www.childcarecanada.org>. There is growing acknowledgement that optimal early childhood development is crucial not only for the health, well-being, and competence of the individual but also of society at large. This paper focuses on the period from birth to age six and uses research from Canada and other countries to examine the following questions: * What are the known threats to young children's optimal development? * Can children whose development is at risk be identified reliably and at an early age? * Which types of targeted programs (programs restricted to children/families who meet certain criteria) promote the development of vulnerable children and under what circumstances? * To what extent and under what circumstances do nontargeted programs that are open to all children/families promote the development of children at risk for delayed development? * To what extent is the current approach to targeting early childhood programs consistent with what we know about what is required to promote young children's development? * How can we promote the healthy development of the largest number of children? Canadian research supports the belief that there is a higher incidence of vulnerability to developmental problems among children living in poverty and/or living with a lone parent. However, it also demonstrates that most children living in these These variables occur in both lone- and two-parent families and across all income levels. Since the majority of children live in two-parent and middle-income families, numerically the largest number of at-risk children are not living in poverty or with a lone-parent. Thus, restricting early childhood care and education programs for at-risk children to neighbourhoods with a high proportion of low-income and/or lone-parent families inevitably means the exclusion of many at-risk children living in other communities. The earliest we can be sure that all children will come into contact with an adult who is able to identify developmental or behavioural problems is when they enter the formal school system. As a result, we cannot identify individual vulnerable children easily nor at an early age. The research evidence from evaluations of three categories of programs intended to promote the development of at-risk children is discussed. The three categories are: 1. Child-focused programs that solely or primarily provide a centre-based educational experience for the children. Such programs work directly with the children. 2. Parent-focused programs that provide one of or more of: (1) parenting education, (2) the provision of information about child development, and (3) parental support, for example, assisting parents to obtain other services. Some parent-focused programs include a children's component such as a parent/child drop-in program or a part-day centrebased group program for the children. Parent-focused programs hope to promote children's development indirectly through changing parenting style and/or the home as a learning environment. 3. Two-generation programs that combine children's programs and parent-focused services with efforts to improve the parent's employability and thus the family's financial situation. The research evidence clearly demonstrates that the most effective way of enhancing the development of at-risk children is through centre-based, group programs. The research evidence shows that the development of at-risk children is not promoted by programs that are solely parent-focused or by two-generation programs. The effectiveness of centre-based group programs in promoting the development of at-risk children depends upon their quality that is, the extent to which the program involves adults who understand child development and how to promote it, are not responsible for too many children, and provide appropriate levels and amounts of linguistic and cognitive stimulation. At-risk children do not benefit from poor quality group programs. The research also indicates that high-quality centre-based group programs are most effective for children at risk for developmental problems when they begin prior to age three and are provided on a full-day rather than a part-day basis. The research also clearly illustrates that non-targeted, ordinary high-quality community child care centres are effective in promoting the development of both at-risk children and children not deemed to be at risk. Again quality matters. Living in a family that is supportive of children's development does not protect the child from the negative effects of poor quality child care. The current approach of providing centre-based group programs for at-risk children, such as targeted pre-kindergarten programs on a part-time basis starting when the child is age three or four is inadequate to meet the children's needs. Mastery of the developmental tasks faced by the child at age three and four depends heavily on a scaffold of competencies developed at an earlier age. If these competencies have not been adequately developed, the child's ability to develop new skills is compromised. As noted above, there is growing evidence that full-day programs are more effective than part-day programs. In the U.S., the traditional Head Start program for preschoolers has been supplemented by an Early Head Start for children under age three and many Early Head Start and Head Start centres now provide a full-day program. Part-day delivery of programs for at-risk children also limits parents' ability to engage in activities that might make them more employable or to engage in full-time employment and thereby improve their family financial situation. Poverty puts children's development at risk through factors directly related to the family's low income such as poor nutrition and living in substandard housing. Assisting parents to engage in work that pays a decent wage is an effective way of addressing poverty and reducing the incidence of children at risk for developmental problems. Many young children spend nine hours a day, five days a week in child care, often starting when they are infants. This reflects the high workforce participation of mothers with young children and the tendency for them to return to work within six months of giving birth. Research from Canada and other countries consistently reports that conditions supportive of children's development are more likely to be found in regulated child care. However, 62% of children under age five receiving regular child care receive this care in unregulated situations. This is often because their parents cannot afford or cannot find a regulated child care space. This reality means that the development of many of Canada's young children is put at risk, regardless of their home situation. All the evidence suggests that the need for child care will continue. As noted above, high-quality, ordinary community child care programs can promote the development of at-risk children as well as protecting the development of children not deemed to be at risk. Given our inability to reliably identify the majority of at-risk children through easily observed 'markers' such as neighbourhood socio-demographic characteristics, and the current high use of child care for young children, high-quality, affordable child care for any child whose parent wishes to use the service is the most effective way to assist vulnerable children. At the same time, it would protect the development of children not deemed to be at risk but whose development is jeopardized when they are placed in poor quality child care. A cost/benefit analysis by two University of Toronto economists illustrates that Canada would obtain financial benefit from a universal, publicly-funded, high-quality child care system with parent fees geared to income. The first benefit would accrue through costs not incurred for remedial education or as a result of grade repetition. The second benefit would result from increased parental employment and the associated increase in government revenue from taxes. A third benefit would accrue through a more productive workforce both now and in the future with a resultant greater economic growth. In summary, restricting access to early childhood care and education programs either explicitly though targeting children/families in neighbourhoods with certain sociodemographic characteristics or de facto through restricting access to fee subsidy for regulated child care is neither in the best interest of at-risk children nor other children. Canada is paying a high price for the current situation in terms of: (1) high rates of school drop-out, (2) failed attempts to reduce dependency on social assistance due, in part, to lack of reliable, affordable child care, (3) the restriction of parental ability to engage in paid work, (4) reduced employee productivity related to problems with child care, and (4) failure to reduce child poverty. Provision of high-quality, publicly-funded, universal child care is affordable and sustainable. It is also necessary to reduce the price being paid by society for the current situation of actual and de facto targeting of early childhood care and education programs. August 2001
<urn:uuid:bbd77fb7-a01e-4595-bcf7-fb220810bd40>
CC-MAIN-2020-45
https://childcarecanada.org/sites/default/files/targeting.pdf
2020-10-24T11:29:50+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00222.warc.gz
265,739,131
1,821
eng_Latn
eng_Latn
0.998426
eng_Latn
0.99847
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 4146, 10140 ]
[ 2.109375 ]
2
2
Who could be prescribed medication for obesity? The latest medication for obesity, called Xenical or Orlistat stays in the digestive system. The drug stops up to 30% of fat in food being absorbed into the body. Fat that is not absorbed stays in the colon and is washed out in faeces. Xenical acts by stopping, or inhibiting the action of enzymes, called lipases, that break down fat molecules. As part of a controlled diet and exercise programme, Xenical can help obese people lose body mass. Discussion Read the case studies of the three obese people. In your group, work out and discuss: [x] the Body Mass Index (BMI) values for each person [x] why Leanne, Mark and Fiona became so heavy [x] treatment plans that would help Mark, Fiona and Leanne lose weight [x] the one person whose treatment could include Xenical. Fiona Fiona is 27 years old, single, lives alone and has no children. She is 1.57 m tall and has a mass of 78.8 kg. Fiona was teased about being fat while at school, although she dresses attractively and is outgoing. Fiona does not like cooking, so prefers to buy ready meals and heat these in her microwave. Fiona works as a secretary in an estate agents office. She eats high sugar cereal for breakfast, then crisps and cakes at lunch time. Fiona admits to feeling tired all the time and is often breathless, especially when slightly exerted physically at work. She tends to drive everywhere because she feels so tired. Her periods are irregular. Fiona is not in a relationship and has had only one steady boyfriend – this relationship ended four years ago. Fiona says she got a 'bit depressed' after they split, so ate more. Her doctor has told her to lose weight, as her blood pressure is very high, and it is important to get her periods back to normal. Fiona says: 'I have always struggled with my weight and hated being teased. One day I would like to have kids and wear a bikini on the beach with pride.' Mark Mark is 32 years old and has one daughter aged six who he sees most weekends. He is 1.75 m tall and has a mass of 95.2 kg. Mark has always been 'chubby', but was able to control his weight by playing a lot of sport, eating well and not drinking too much. Three years ago he had a serious motorbike accident in which he lost the lower part of his right leg. Since then he has found it impossible to get back into his usual routines. He became extremely depressed and his declining mental state led his partner to leave him, taking their daughter with her. Mark consoled himself by eating, but is now so overweight that he is struggling to walk using his artificial limb, so will soon be in a wheelchair. Mark's own father died from a heart attack at the age of 47, when Mark was 15. His dad's own weight problem was thought to have contributed to his early death. He knows he needs to change his habits to get his life back together. Mark says: 'I've had a very tough period and am doing my best to work my way back to health again. I want to give my daughter something positive and avoid dying young like my Dad.' Leanne Leanne is 30 years old, married and has two children aged two and four. She is 1.68 m tall and has a mass of 85.3 kg. Leanne used to be a size 12, eating a healthy vegetarian diet. In her last year at school she captained the senior netball team to victory in the local schools championship. Leanne worked up to being senior credit controller in a busy advertising company. After she married, Leanne fell pregnant quickly and went back to work full-time after her first child was born. Leanne's weight problems started when she developed diabetes while pregnant with her second child. She was forced to take a lot of time off work. The baby was very large, with a mass of 4.55 kg at birth. Leanne's doctor said that her weight could be controlled through diet and exercise, but this was not effective. Leanne was breast-feeding and continued to eat to curb her hunger. Her weight increased by 19 kg. She is now desperate to get back to 'normal' so she can resume her life. Leanne says: 'Having diabetes and being overweight means I can't enjoy being a mum – or a wife, as I have so little energy and feel unattractive! I would really like to get back to work, but this is impossible until I am healthier.' Calculating Body Mass Index 2 BMI = body mass in kilograms ÷ (height in metres) Values over 25 indicate overweight Values over 30 indicate obesity
<urn:uuid:2195a58b-87ff-4af9-ae37-db07aac892a1>
CC-MAIN-2020-45
https://edu.rsc.org/download?ac=507624
2020-10-24T12:25:22+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00223.warc.gz
301,867,194
998
eng_Latn
eng_Latn
0.999695
eng_Latn
0.99975
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 3062, 4429 ]
[ 2.859375 ]
3
0
Nikita needs to buy notebooks for the 9 classes he's taking this year. At ACME Office Supply, he finds both one-subject and three-subject notebooks. If he buys 2 three-subject notebooks and 3 one-subject notebooks, he will spend all his money. If he buys 3 three-subject notebooks, he will have $2.50 left over. If one-subject notebooks cost $5 each, how much money did Nikita bring to the store? A) $12.50 B) $35.00 C) $37.50 D) $40.00 E) Cannot be determined from the information provided This is a classic sort of SAT or ACT math question – a word problem that can be translated into algebraic equations, which can then be solved to find the answer. In this case, if we define x, y, and M to be the cost of a three-subject notebook, the cost of a one-subject notebook, and the amount of money he brought with him, respectively, we can write the following equations: The second equation could also be written with M alone on the right-hand side: This would allow us to set the left sides of the first and last equations above equal to each other: Since the problem gives us the cost of a one-subject notebook, we can plug in $5 for y, then solve for x: Notice that this is choice (A)! Students who picked (A) made a critical error: they did not Read The Full Question (RTFQ)! Choice (A) is not the only wrong answer based on an error: also notice that choice (C) is the cost of 3 three-subject notebooks – again, this is a possible RTFQ mistake, with the student mistakenly thinking that this represents the amount of money Nikita brought with him. If the student erroneously subtracts $2.50 from this value instead of adding it, then they would end up with choice (B). Choice (E) is a different mistake, which we would call Fool's Gold – although it may seem like the problem is too complicated to solve with the small amount of definite information we're given, there certainly is enough data to find the answer. All of these errors can be avoided with the use of Backsolve! We'll start in the usual place, with choice (C) $37.50: this means that Nikita brought $37.50 with him to the store. From this, we can find the cost of a three-subject notebook by applying the second piece of information: If he buys 3 three-subject notebooks, he will have $2.50 left over. He had $37.50, but he now has $2.50 left over, so we can subtract to find the cost of 3 three-subject notebooks: Next, we can divide by 3 to find the cost of each three-subject notebook: Now that we have the cost of a three-subject notebook, we can use the first piece of information to find the cost of a one-subject notebook: If he buys 2 three-subject notebooks and 3 one-subject notebooks, he will spend all his money. First, the cost of 2 three-subject notebooks would be $23.34, which we get by doubling $11.67. Subtract this from $37.50 to find the cost of 3 one-subject notebooks: Finally, divide by 3 to find the cost of a single one-subject notebook: But we know that the cost of a single one-subject notebook is $5! Thus, choice (C) is wrong, and we should try again. Since $4.72 is too low, go to a bigger number – choice (D) $40.00 – and repeat! Bingo! After running through the exact same process, we find a single one-subject notebook is the correct cost, $5.00, so the answer is (D) $40.00!
<urn:uuid:b656ddf2-bbbb-4fc8-b424-aa4156115c4a>
CC-MAIN-2020-45
https://alisteducation.com/wp-content/uploads/2017/03/Sample-SAT-ACT-Math-Question.pdf
2020-10-24T11:42:56+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00223.warc.gz
207,987,504
827
eng_Latn
eng_Latn
0.999464
eng_Latn
0.999447
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 1928, 3297 ]
[ 3.59375 ]
1
0
Fourth Grade Greek And Latin Roots If you ally habit such a referred fourth grade greek and latin roots ebook that will present you worth, get the definitely best seller from us currently from several preferred authors. If you want to humorous books, lots of novels, tale, jokes, and more fictions collections are plus launched, from best seller to one of the most current released. You may not be perplexed to enjoy every books collections fourth grade greek and latin roots that we will unquestionably offer. It is not around the costs. It's about what you need currently. This fourth grade greek and latin roots, as one of the most in action sellers here will extremely be in the middle of the best options to review. eReaderIQ may look like your typical free eBook site but they actually have a lot of extra features that make it a go-to place when you're looking for free Kindle books. Fourth Grade Greek And Latin Worksheet: Fourth Grade. Latin Roots. Circle the Latin root or roots in each word. Write the meaning of the root in the first column, then write the meaning of the word in the second column. Category: Grammar Vocabulary Acquisition and Use Greek and Latin Affixes and Roots. Get this Worksheet. Greek and Latin Affixes and Roots | Fourth Grade English ... Greek and Latin Roots for 4th Grade is a fun, simple, proven method for mastering 100 Greek and Latin Roots. It is part of a larger system to master 450 Greek and Latin Roots by 6th grade. This system has been used in a classroom setting for over 10 years with a 99% success rate of student memoriz Greek And Latin Roots For 4th Grade Worksheets & Teaching ... Start studying Fourth Grade- Greek and Latin Roots Week 4. Learn vocabulary, terms, and more with flashcards, games, and other study tools. Fourth Grade- Greek and Latin Roots Week 4 Flashcards ... Latin and Greek Word Roots, Grade 4+ includes Latin and Greek word roots related to fourth grade and above. The program is used at higher levels and in different ways depending on student groups and ability levels. Latin and Greek Word Roots, Grade 4+ includes 5 parts. LATIN AND GREEK WORD ROOTS, GRADE 4+ Preview this quiz on Quizizz. "construct"- the building of somethinginstruct- information telling how to build or operate somethingdestruction- the act of destroying something that had been builtAll have the root word struct, what does this word mean? 4th Grade Greek and Latin Roots 4.L.4b Quiz - Quizizz This resource includes everything you need to teach students how to use common, grade-appropriate Greek and Latin affixes and roots to determine the meaning of a word.Everything you need is here! These materials will allow you to explicitly teach, reinforce, and assess this important language concep... Fourth Grade Language Unit Prefixes, Greek and Latin Roots ... Greek and Latin are one of those very few languages that have an important role in the formation of the English language. Most of the words we hear, read, and write in the English language today have come down to us either from Latin or Greek. Greek and Latin elements can either make up the root of a word or its affixes, either prefix or suffix. Using Greek and Latin Roots Worksheets In fourth grade (which is what I teach currently), CCSS L.4.4 asks for students to "Use common, grade-appropriate Greek and Latin affixes and roots as clues to the meaning of a word (e.g., telegraph, photograph, autograph)." Greek and Latin Roots: Classroom Activities - Little ... English Language Arts Standards » Language » Grade 5 » 4 » b Print this page. Use common, grade-appropriate Greek and Latin affixes and roots as clues to the meaning of a word (e.g., photograph, photosynthesis). English Language Arts Standards » Language » Grade 5 » 4 ... The English language uses many Latin and Greek root words, prefixes and suffixes (affixes). In grade 4 students start to learn the most used of these root words and affixes. In these worksheets students are asked write prefix and suffix words and what they mean. Each answer sheet contains sample words. Prefixes and suffixes worksheets | K5 Learning Improve your language arts knowledge with free questions in "Use Greek and Latin roots as clues to the meanings of words" and thousands of other language arts skills. IXL Learning Learning. Sign in ... Fourth grade Z.2 Use Greek and Latin roots as clues to the meanings of words XNX. Share skill Questions. 0 Time elapsed Time. 00: 00: 00: hr min ... IXL | Use Greek and Latin roots as clues to the meanings ... Fourth grade Z.5 Determine the meanings of words with Greek and Latin roots BJ9 IXL | Determine the meanings of words with Greek and Latin ... Learn english 4th grade latin greek latin roots with free interactive flashcards. Choose from 500 different sets of english 4th grade latin greek latin roots flashcards on Quizlet. english 4th grade latin greek latin roots Flashcards and ... Latin and Greek Word Roots, Grade 4+ includes Latin and Greek word roots related to fourth grade. The program is used at higher grade levels with students having different ability levels. Has 140 word roots that Page 1/2 Copyright : atcloud.com translate to understanding thousands of words. A Course of Study, Latin and Greek Word Roots, Grade 4 ... Greek and Latin Roots 4th Grade Worksheets or Greek and Latin Root Words Worksheets While you can usually tell the Plant's family or genus based on the Latin for the Root, it's important to note that it doesn't necessarily mean what you think it means. The Latin for Root is Heterocotylus. Greek and Latin Roots 4th Grade Worksheets Creative Teaching More Greek and Latin Roots 4th Grade - 8th Grade (Teaching Vocabulary to Improve Reading Comprehension) Trisha Callella. 4.4 out of 5 stars 32. Paperback. $19.99. Red Hot Root Words Book 1: Mastering Vocabulary with Prefixes, Suffixes and Root Words Dianne Draze. 4.7 ... Amazon.com: Learning Works Greek and Latin Roots - Grade ... an effective person? GREEK AND LATIN ROOTS 4TH GRADE review is a very simple task. Yet, how many people can be lazy to read? They prefer to invest their idle time to talk or hang out. When in fact, review GREEK AND LATIN ROOTS 4TH GRADE certainly provide much more likely to be effective through with hard work. For everyone, whether you are going to start to join with others to consult a book, this GREEK AND LATIN ROOTS 4TH GRADE is very advisable. And you should get the 16.94MB GREEK AND LATIN ROOTS 4TH GRADE As Pdf, AND GREEK ... Greek and Latin affixes and roots L.6.4b - Use common, grade-appropriate Greek or Latin affixes and roots as clues to the meaning of a word. Greek and Latin affixes and roots - 6th Grade ELA Skill ... This bundle includes my most popular fourth-grade resources: math spiral review, math assessments, language and grammar spiral review, language and grammar assessments, reading comprehension passages for the entire year, and 4th-grade work analogies. For a detailed overview of what's included, please preview each of the individual resources shown above. Stay Connected with Teacher Thrive ... Copyright code: d41d8cd98f00b204e9800998ecf8427e. Page 2/2
<urn:uuid:77bfcf4b-11d7-4c2d-b21e-4229621bc856>
CC-MAIN-2020-45
http://atcloud.com/fourth_grade_greek_and_latin_roots.pdf
2020-10-24T12:47:58+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00225.warc.gz
8,594,361
1,612
eng_Latn
eng_Latn
0.996715
eng_Latn
0.997747
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 5155, 7174 ]
[ 2.203125 ]
1
0
SELECTING COURSES In the curriculum for secondary school, students will choose courses from one or more of four types: academic, applied, open and locally developed. In Grade 9, English, Mathematics, French, Science and Geography are offered as academic, applied, and locally developed; all others are offered as open courses. This streaming of courses is intended to enable students to choose any type of course in Grade 9 while allowing them the possibility of choosing a different type of course in the same subject in Grade 10. Students are not restricted to taking courses of only one type in a subject in Grades 9 and 10. In moving through Grade 10, students will choose courses that give them the necessary prerequisites for entry into the Grade 11 courses. Students in Grades 11 and 12 will choose courses that prepare them for university, college, apprenticeship or the workplace. With help from parents and teachers, students will choose the types of courses (streams) primarily on the basis of their learning needs and previous achievement. * Academic courses cover essential concepts of a subject and draw heavily on theory and abstract examples/problems. These courses are designed for the independent learner who has limited to no gaps in content and who consistently achieves 75% or better. * Applied courses cover the essential concepts of a subject and focus more on using learned knowledge in real-life situations. These courses are designed for students who are experiential learners and who likely have content gaps in the specific discipline. These courses are recommended for those students who consistently achieve 50% – 75% Students in Grade 9 who successfully complete these courses will be prepared for either the applied or the academic course in the same subject in Grade 10, except for mathematics. Students MUST complete the Grade Nine Academic Math before taking the Grade Ten Academic Math. * Open courses are designed to give students additional preparation for grades 10 through 12 and to enrich their education generally. These courses are appropriate for all students. * Locally Developed Courses try to meet students' needs which are not met by the existing provincial curriculum. These courses are for experiential learners who have gaps in knowledge and skills in the specific discipline, and who need more specific support. BEAL INNOVATIVE LEARNING PROGRAM – B.I.L.P. A project-based four credit package that combines the learning expectations from English, Mathematics, Science and Geography that occurs during semester one. Courses can be at either at the academic or applied level. An application is required for this program and due with the H.B. Beal registration form. Please see the back page for more information. (bitly.com/bealinnovates @beal_innovates) THE ARTS DANCE & DRAMA ADA 1O1 Drama, Open This course provides opportunities for students to explore dramatic forms and techniques, using material from a wide range of sources and cultures. Students will use the elements of drama to examine situations and issues that are relevant to their lives. Students will create, perform, discuss, and analyze drama, and then reflect on the experiences to develop an understanding of themselves, the art form, and the world around them. ATC 1O1 Dance, Open This course gives students the opportunity to explore their technical and compositional skills by applying the elements of dance and the tools of composition in a variety of performance situations. Students will generate movement through structured and unstructured improvisation, demonstrate an understanding of safe practices with regard to themselves and others in the dance environment, and identify the function and significance of dance within the global community. ATP 2OE Dance, Performance Practice, Grade 10 Open This course emphasizes the development of choreography and builds on technical skills of experienced dancers. Students will acquire increasingly difficult technical skills as well as learn repertoire pieces. Students will take on the roles found in a professional dance company and perform as such at various times throughout the year. Prerequisite: Teacher recommendation: Interview and/or audition. Grade 9 students can be considered for advanced placement in this course based on previous experience. Please see the Department Head of Dance/Drama for the application and more information. MUSIC AMG 1O1 Guitar, Open Students learn the fundamentals of playing the guitar using classical posture and technique. Students will learn to read TAB and traditional notation and play music from a variety of styles including pop, rock, and classical. By the end of the course, students will be performing music in two parts (using fingers to play a melody, and thumb for a bass line). Solo and ensemble performance opportunities will be provided. Music theory, history and ear training are also included. No previous music experience is necessary. AMI 1O1 Instrumental, Open This course focuses on playing wind instruments including flute, clarinet, oboe, bassoon, saxophone, trumpet, French horn, trombone, baritone, tuba and drums/percussion. Performance, music reading, composition and listening are included and this course is offered during the regular school day as a semester course. Instrumental students may participate in a variety of performing opportunities (Grade 9 Band, Concert Band, Woodwind/Brass/Percussion Ensembles) at school and in the community. Students should also consider taking the corresponding Band Credit (AMR2OB), which runs in the mornings before the school day (see band). AMV 1O1 Vocal, Open Students learn the fundamentals of singing with good vocal technique. The Vocal Programme is scheduled outside regular class time on the Beal Extended Day Schedule (afternoons). Students enrolled in Vocal Music will take a total of 9 courses. The vocal class & concert schedule is announced the first week of September and usually involves 2 classes per week throughout the year. Students in this course can expect significant additional time commitments, including evenings and weekends as members of the Beal Singers. AMR 2OB Band – Repetoire, Open This 0.5 credit course is scheduled on Tuesday and Thursday mornings, 7:15-8:15am, before the regular school day. It runs all year and is usually taken in addition to a full timetable. It includes school and community performances. It is highly recommended that students also enroll in AMI1O1. Seek advice from a music teacher (room 228) to ensure proper course selection. Please note that meeting times for band and choir are as follows: Band meets Tuesday and Thursday from 7:15 – 8:15am and Choir meets Tuesday from 2:55 – 5:00pm and Wednesday or Thursday 2:55 – 4:40pm VISUAL ART AVI 1O1 Visual Art, Open This course offers an overview of visual arts as a foundation for further study. Students will explore, challenge, develop and express ideas using the skills, language, techniques and processes in the arts. Through the elements and principles of design, students may experience drawing, printmaking, 3D and painting. Critical analysis will be developed through the introduction of artists and their personal art styles. AWD 1O1 Studio Fundamentals, Open This course offers a studio focus art credit, which may be taken in addition to the standard Grade 9 AVI art course or as a replacement. The course begins with an introduction to design followed by three studio focus areas, which are printmaking, ceramics and painting. The course focuses on elements and principles of design, sketchbooks, drawing from imagination and observation, art history, critique and analysis, talking and writing about art and technical processes. Note: Application required see bealart.com BUSINESS STUDIES BBI 1O1 Introduction to Business, Open This course introduces students to the world of business. Students will develop an understanding of the functions of business, including accounting, marketing, information and communication technology, human resources, and production, and the importance of ethics and social responsibility. This course builds a foundation for further studies in business and helps students develop the business knowledge and skills they will need in their everyday lives. BTT 1O1 Information and Communication Technology in Business, Open This course introduces students to information and communication technology in a business environment and builds a foundation of digital literacy skills necessary for success in a technologically driven society. Students will develop word processing, spreadsheet, database, desktop publishing, presentation software, and website design skills. Throughout the course, there is an emphasis on digital literacy, effective electronic research and communication skills, and current issues related to its impact. The skills acquired are applicable across the curriculum to other subjects through presentations, essays, reports and spreadsheets CANADIAN AND WORLD STUDIES CGC 1PL Issues in Canadian Geography, Locally Developed This course focuses on current geographic issues that affect Canadians. Students will draw on their personal and everyday experiences as they explore issues relating to food and water supplies, competing land uses, interactions with the natural environment, and other topics relevant to sustainable living in Canada. They will also develop an awareness that issues that affect their lives in Canada are interconnected with issues in other parts of the world. Throughout the course, students will use the concepts of geographic thinking, the geographic inquiry process, and spatial technologies to guide and support their investigations. Optional: Field Trip. CGC 1P1 Issues in Canadian Geography, Applied This course focuses on current geographic issues that affect Canadians. Students will draw on their personal and everyday experiences as they explore issues relating to food and water supplies, competing land uses, interactions with the natural environment, and other topics relevant to sustainable living in Canada. They will also develop an awareness that issues that affect their lives in Canada are interconnected with issues in other parts of the world. Throughout the course, students will use the concepts of geographic thinking, the geographic inquiry process, and spatial technologies to guide and support their investigations. Optional: Field Trip. CGC 1D1 Issues in Canadian Geography, Academic This course examines interrelationships within and between Canada's natural and human systems and how these systems interconnect with those in other parts of the world. Students will explore environmental, economic, and social geographic issues relating to topics such as transportation options, energy choices, and urban development. Students will apply the concepts of geographic thinking and the geographic inquiry process, including spatial technologies, to investigate various geographic issues and to develop possible approaches for making Canada a more sustainable place in which to live. Optional: Field Trip. ENGLISH ENG 1L1 English, Locally Developed This course provides foundational literacy and communication skills to prepare students for success in their daily lives, in the workplace, and in the English Grade 11 Workplace Preparation course. The course is organized by strands that develop listening and talking skills, reading and viewing skills, and writing skills. In all strands, the focus is on developing foundational literacy skills and in using language clearly and accurately in a variety of authentic contexts. Students develop strategies and put into practice the processes involved in talking, listening, reading, viewing, writing and thinking, and reflect regularly upon their growth in these areas. ENG 1P1 English, Applied This course is designed to develop the key oral communication, reading, writing, and media literacy skills students need for success in secondary school and daily life. Students will read, interpret, and create a variety of informational, literary, and graphic texts. An important focus will be on identifying and using appropriate strategies and processes to improve students' comprehension of texts and to help them communicate clearly and effectively. The course is intended to prepare students for Grade 10 Applied English which leads to college or workplace preparation courses in Grades 11 and 12. ENG 1D1 English, Academic This course is designed to develop the oral communication, reading, writing, and media literacy skills that students need for success in their secondary school academic programs and in their daily lives. Students will analyze literary texts from contemporary and historical periods, interpret informational and graphic texts, and create oral, written, and media texts in a variety of forms. An important focus will be on the use of strategies that contribute to effective communication. The course is intended to prepare students for Grade 10 Academic English which leads to university or college preparation courses in Grades 11 and 12. FRENCH AS A SECOND LANGUAGE FSF 141 French, Locally Developed This course will offer students the opportunity to build on the French they learned in elementary school. The focus will be on getting students to use the language to communicate in basic real life conversational settings. This course will concentrate more on the oral use of the language rather than the reading and writing. FSF 1P1 French, Applied This course emphasizes the further development of oral communication skills, using the theme of media; the development of oral communication skills will be integrated with the development of reading and writing skills. Students will expand their ability to understand and speak French through conversations, discussions, and presentations. They will also read media-related short stories, articles, poems, and songs and write brief descriptions, letters, dialogues, and invitations. FSF 1D1 French, Academic This course emphasizes the further development of oral communication, reading, and writing skills. Students will build on and apply their knowledge of French while exploring a variety of themes, such as relationships, trends, and careers. Thematic readings, which include a selection of short stories, articles, and poems, will serve as stepping stones to oral and written activities. FSF 1D9 French Grade 9 & 10 COMPACTED, Academic This course meets all Ontario Curriculum expectations for both the FSF 1D1 course and the FSF 2D1 course. As per the vision of TVDSB secondary gifted programming, this compacted version of FSF1D1 and FSF 2D1 (2.0 credit value) provides an accommodation of acceleration and enrichment for Extended, French Immersion or French First Language students. Prerequisite: Students must have studied in a French Immersion or French First Language program to a minimum of Grade 7 or an Extended French Immersion program for Grades 7 and 8. Note: This compacted course is designed for very capable Extended, FI, or FFL students who wish to complete both credits in one year. 2.0 credits will be earned for successful completion of these two courses compacted into a one period block. HEALTH AND PHYSICAL EDUCATION PPL 1OF (Female) Healthy Active Living, Open This course emphasizes students' daily participation in a variety of enjoyable physical activities that promote lifelong healthy active living. Students will learn movement techniques and principles, ways to improve personal fitness and physical competence, and safety/injuryprevention strategies. They will investigate issues related to healthy sexuality and the use and abuse of alcohol, tobacco, and other drugs and will participate in activities designed to develop goal-setting, communication, and social skills. PPL 1OM (Male) Healthy Active Living, Open This course emphasizes students' daily participation in a variety of enjoyable physical activities that promote lifelong healthy active living. Students will learn movement techniques and principles, ways to improve personal fitness and physical competence, and safety/injuryprevention strategies. They will investigate issues related to healthy sexuality and the use and abuse of alcohol, tobacco, and other drugs and will participate in activities designed to develop goal-setting, communication, and social skills. PPL 1O1 (Coed) Healthy Active Living, Open This course emphasizes students' daily participation in a variety of enjoyable physical activities that promote lifelong healthy active living. Students will learn movement techniques and principles, ways to improve personal fitness and physical competence, and safety/injuryprevention strategies. They will investigate issues related to healthy sexuality and the use and abuse of alcohol, tobacco, and other drugs and will participate in activities designed to develop goal-setting, communication, and social skills. MATHEMATICS Students leaving grade 8 with limited exposure to the Grade 8 curriculum as a result of modified math programming are encouraged to select MAT1L1- Grade 9 Locally Developed Math in order to build prerequisite knowledge, prior to taking Grade 9 Applied Math (MFM1P1). MAT 1L1 Principles of Mathematics, Locally Developed This course emphasizes further development of mathematical knowledge and skills to prepare students for success in their everyday lives, in the workplace, and in the Grade 10 LDC course. The course is organized in three strands related to money sense, measurement, and proportional reasoning. In all strands, the focus is on developing and consolidating key foundational mathematical concepts and skills by solving authentic, everyday problems. Students have opportunities to further develop their mathematical literacy and problemsolving skills and to continue developing their skills in reading, writing, and oral language through relevant and practical math activities. MFM 1P1 Foundations of Mathematics, Applied This course enables students to develop an understanding of mathematical concepts related to introductory algebra, proportional reasoning, and measurement and geometry through investigation, the effective use of technology, and hands-on activities. Students will investigate real-life examples to develop various representations of linear relations, and will determine the connections between the representations. They will also explore certain relationships that emerge from the measurement of three-dimensional figures and twodimensional shapes. Students will consolidate their mathematical skills as they solve problems and communicate their thinking. MPM 1D1 Principles of Mathematics, Academic This course enables students to develop an understanding of mathematical concepts related to algebra, analytic geometry, and measurement and geometry through investigation, the effective use of technology, and abstract reasoning. Students will investigate relationships, which they will then generalize as equations of lines, and will determine the connections between different representations of a linear relation. They will also explore relationships that emerge from the measurement of three-dimensional figures and twodimensional shapes. Students will reason mathematically and communicate their thinking as they solve multi-step problems. FIRST NATION, MÉTIS AND INUIT STUDIES Students who have taken Native languages as a second language instead of French in elementary school and who wish to take Native languages instead of French in secondary school may use the credit earned for the Native language course as a substitute for the compulsory credit in French. LNN AO1 Oneida Language, Open (alternative option for French requirement) This course is open to the entire student body and will allow students who have no prior Native language experience to develop an appreciation for Native language and culture, to explore and experience a unique world view, and to learn to speak a Native language. Students will learn and use the language being studied for greetings and daily routines, become familiar with its writing and sound system, and practice basic vocabulary and phrases. LNO AO1 Ojibway Language, Open (alternative option for French requirement) This course is open to the entire student body and will allow students who have no prior Native language experience to develop an appreciation for Native language and culture, to explore and experience a unique world view, and to learn to speak a Native language. Students will learn and use the language being studied for greetings and daily routines, become familiar with its writing and sound system, and practice basic vocabulary and phrases. NAC 1O1 Expressions of First Nations, Métis, and Inuit Cultures, Open (alternative option for Arts requirement) This course explores various arts disciplines (dance, drama, installation and performance art, media arts, music, storytelling, utilitarian or functional art, visual arts), giving students the opportunity to create, present, and analyse art works, including integrated art works/ productions, that explore or reflect First Nations, Métis, and Inuit perspectives and cultures. Students will examine the interconnected relationships between art forms and individual and cultural identities, histories, values, protocols, and ways of knowing and being. They will demonstrate innovation as they learn and apply art-related concepts, methods, and conventions, and acquire skills that are transferable beyond the classroom. Students will use the creative process and responsible practices to explore solutions to creative arts challenges. SCIENCE SNC 1L1 Science, Locally Developed This course emphasizes reinforcing and strengthening science-related knowledge and skills, including scientific inquiry, critical thinking, and the relationship between science, society, and the environment, to prepare students for success in everyday life, in the workplace, and in the Grade 11 Science Workplace Preparation course. Students explore a range of topics, including science in daily life, properties of common materials, life-sustaining processes in simple and complex organisms, and electrical circuits. Students have the opportunity to extend mathematical and scientific process skills and to continue developing their skills in reading, writing, and oral language through relevant and practical science activities. SNC 1P1 Science, Applied This course enables students to develop their understanding of basic concepts in biology, chemistry, earth and space science, and physics, and to apply their knowledge of science to everyday situations. They are also given opportunities to develop practical skills related to scientific investigation. Students will plan and conduct investigations into practical problems and issues related to the impact of human activity on ecosystems; the structure and properties of elements and compounds; space exploration and the components of the universe; and static and current electricity. SNC 1D1 Science, Academic This course enables students to develop their understanding of basic concepts in biology, chemistry, earth and space science, and physics, and to relate science to technology, society, and the environment. Throughout the course, students will develop their skills in the processes of scientific investigation. Students will acquire an understanding of scientific theories and conduct investigations related to sustainable ecosystems; atomic and molecular structures and the properties of elements and compounds; the study of the universe and its properties and components; and the principles of electricity. SOCIAL SCIENCES HIF 1O1 Exploring Family Studies, Open This course explores, within the context of families, some of the fundamental challenges people face: how to meet basic needs, how to relate to others, how to manage resources, and how to become responsible members of society. Students will explore adolescent development and will have opportunities to develop interpersonal, decision-making, and practical skills related to daily life. They will learn about the diverse ways in which families function in Canada and will use research skills as they explore topics related to individual and family needs and resources. They will be planning and preparing some nutritious meals, learning sewing skills to do minor repairs and simple creative constructions and learning to meet adolescents' needs. SPECIAL EDUCATION GLE 1O1- (Students with an IEP) LEARNING STRATEGIES: Skills for Success in High School, Open This course introduces students to learning skills and strategies, prepares them to become effective independent learners, and helps them increase their personal management skills. Students will learn how to use critical thinking, active reading, memorization, goal setting strategies, and time management skills to identify and work towards their goals. The course will also help students identify their preferred way of learning and use this knowledge to increase their confidence, motivation, and ability to learn. GLS 1O1 - (Students without an IEP) LEARNING STRATEGIES: Skills for Success in High School, Open This course introduces students to learning skills and strategies, prepares them to become effective independent learners, and helps them increase their personal management skills. Students will learn how to use critical thinking, active reading, memorization, goal setting strategies, and time management skills to identify and work towards their goals. The course will also help students identify their preferred way of learning and use this knowledge to increase their confidence, motivation, and ability to learn. TECHNOLOGICAL STUDIES TIJ 1O1 Exploring Technologies, Open This course enables students to further explore and develop technological knowledge and skills introduced in the elementary science and technology program. Students will be given the opportunity to design and create products and/or provide services related to the various technological areas or industries, working with a variety of tools, equipment, and software commonly used in industry. Students will develop an awareness of environmental and training pathways leading to careers in technology-related fields. Students will have hands on experience in wood construction, welding, machining, and automotive and communication technology. ENGLISH AS A SECOND LANGUAGE and LITERACY DEVELOPMENT ESL AO1 English as a Second Language Level 1, Open This course builds on students' previous education and language knowledge to introduce them to the English language and help them adjust to the diversity in their new environment. Students will use beginning English language skills in listening, speaking, reading, and writing for everyday and essential academic purposes. The course also provides students with the knowledge and skills they need to begin to adapt to their new lives in Canada. ELD AO1 English Literacy Development Level 1, Open This course is for English language learners who have had limited access to schooling and have significant gaps in their first-language literacy skills. Students will use basic listening and speaking skills to communicate for everyday purposes; develop readiness skills for reading and writing; begin to read highly structured texts for everyday purposes; and use basic English structures and sentence patterns in speaking and writing. The course will also help students adapt to school routines and their new lives in Canada. Other courses available to ESL / ELD Level 1 students: GLS 1OR Learning Strategies (Open) HIF 1OR Individual and Family Living (Open) BTT 1OR Information Technology in Business (Open) MAT 1LR Essential Mathematics (Locally Developed) ESL BO1 English as a Second Language Level 2, Open This course extends students' listening, speaking, reading and writing skills in English for everyday and academic purposes. Students will participate in conversations in structured situations; read texts designed or adapted for English language learners; expand their knowledge of English grammatical structures and sentence patterns; and link English sentences to compose paragraphs. The course also supports students' continuing adaptation to the Ontario school system by expanding their knowledge of diversity in their new province and country. ELD BO1 English Literacy Development Level 2, Open This course is intended for English language learners who have had limited access to schooling and thus have gaps in their first-language literacy skill. Students will use their developing listening and speaking skills to communicate in English; develop reading strategies to understand a variety of simple tests; produce simple forms of writing; apply increasing knowledge of English grammatical structures; expand their vocabulary; and develop fundamental study skills. The course will also provide opportunities for students to use school and community resources and build their cultural knowledge of Canada. Other courses available to ESL / ELD Level 2 students: CGC 1PR Geography of Canada (Applied) CHV 2OR / GLC 2OR Civics and Careers (Open) MAT 2LR Mathematics (Locally Developed) GLD 2OR Discovering the Workplace (Locally Developed) ESL CO1 English as a Second Language Level 3, Open This course further extends students' skills in listening, speaking, reading, and writing in English for a variety of everyday and academic purposes. Students will make short classroom oral presentations; read a variety of adapted and original texts in English; and write using a variety of text forms. Students will expand their academic vocabulary and their study skills to facilitate their transition to the mainstream school program. This course introduces students to the rights and responsibilities inherent in Canadian citizenship, and to a variety of current Canadian issues. ELD CO1 English Literacy Development Level 3, Open This course builds students' growing literacy and language skills and extends communication about familiar and school-related topics. Students will make oral presentations; improve their literacy skills through contextualized reading and writing tasks; distinguish between fact and opinion in short written and oral texts; complete guided-research projects; and engage in cooperative learning activities. The course will also help students strengthen and extend study skills and personal-management strategies and broaden their understanding of Canadian diversity and citizenship. Other courses available to ESL / ELD Level 3 students: HIP4OR Personal Life Management (Locally Developed) *SNC1PR Science (Applied) ESL DO1 English as a Second Language Level 4, Open This course prepares students to use English with increasing fluency and accuracy in classroom and social situations and to participate in Canadian society as informed citizens. Students will develop the oral-presentation, reading, and writing skills required for success in all school subjects. They will extend listening and speaking skills through participation in discussions and seminars; study and interpret a variety of grade-level texts; write narratives, articles, and summaries in English; and respond critically to a variety of print and media texts. ELD DO1 English Literacy Development Level 4, Open This course extends students' literacy skills and ability to apply learning strategies, and teaches them to use community resources. Students will communicate with increased accuracy and fluency for academic and everyday purposes; perform guided reading, writing and viewing tasks; and use media and community resources to complete guided-research projects. This course further develops critical thinking skills to help students participate in Canadian society as informed citizens. Other courses available to Level 4 ESL/ ELD students: *SNC 1PR Science (Applied) *(MAT 2LR & SNC 1PR prepare students to go on to academic, applied or workplace courses in math and science) Note: Other course options available to ESL/ELD students at all levels through consultation with the ESL
<urn:uuid:2fcee1d2-21cb-4d88-b3a3-b0ac510d6654>
CC-MAIN-2020-45
http://beal.tvdsb.ca/en/resourcesGeneral/Guidance/Grade-9-Course-Calendar-2020-2021.pdf
2020-10-24T11:49:11+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00223.warc.gz
13,503,749
6,089
eng_Latn
eng_Latn
0.996886
eng_Latn
0.99719
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 4448, 9064, 13215, 17089, 21823, 26623, 32367 ]
[ 2.390625, 3.421875 ]
2
0
Peachtree borer Synanthedon exitiosa (Say) Hosts Peachtree borers attack all stone fruits, but can be a major pest of peach. They are found throughout most fruit-growing states and provinces in eastern North America. Time of concern below ground to 25 cm (10 in) above ground. Larger roots are also occasionally attacked. Areas attacked often have masses of gum mixed with frass exuding from the bark. Young trees may be In its northern range, there is only one generation per year. Adult emergence begins in early July, peaking in August and extending into September. Control pro­ grams for the peachtree borer in peach orchards must begin in the first year trees are planted and main­ tained throughout the life of the orchard. Damage, symptoms and pest cycle NYAES completely girdled and eventually die; older trees are debilitated and more susceptible to other insects or diseases. Since the peachtree borer and the lesser peachtree borer (S. pictipes) often occur together, it is import­ ant to note their major distinguishing features. The male peachtree borer can be mistaken for either male or female lesser peachtree borers, except for the location of tufts of pale hair on their heads. In the peachtree borer, the pale hairs will be between the antennae. In the lesser peachtree borer, they are found in back of the eyes. males having four narrow bands or fringes of white or yellow scales. Both sexes will have an amber sheen to their fringed wings and have a tuft of pale-colored hair between their antennae. Adults are clearwing, day-flying moths that may be mistaken for wasps. Their bodies are dark steel-blue with females having a wide band of bright orange scales on their abdomen and Larvae are white or cream-colored and hairless with short legs and a yellow­ ish brown to dark brown head. NRAES-75 These two borers also can be distinguished by the fact that the peachtree borer is active later in the season and most often burrows under bark at or near ground level. The lesser peachtree borer is active ear­ lier in the season, requires already injured trees and infests higher up on the trunks and in lower branches. IPM steps for beginners The larva burrows into the bark, usually near the soil surface, and feeds on the cambium and tunnels between the inner bark and the sapwood. Larvae normally attack the tree trunk between 7.5 cm (3 in) NYAES Examine the bases of trees for frass or sawdust­ like excrement in the exuded gum. Use pheromone traps to monitor species presence and flight activity. Pheromones used to monitor for peachtree borer are not species-specific and will attract other clear-wing moths including dogwood borer and lilac borer. The lesser peachtree borer has a species-specific phero­ mone and will not be attracted to the peachtree borer lure. Mating disruption is an effective option in multiacre plantings; also, summer or post-harvest trunk sprays of contact insecticides can be applied. Acknowledgements: This information was adapted with permis­ sion from "Tree Fruit Field Guide," NRAES, Cornell University. 59
<urn:uuid:de864c64-4d34-4229-9ab4-9eb2154a2e9e>
CC-MAIN-2020-45
https://www.canr.msu.edu/ipm/uploads/files/StoneFruitIPM_Peachtreeborer26.pdf
2020-10-24T12:58:30+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00222.warc.gz
656,680,637
699
eng_Latn
eng_Latn
0.996623
eng_Latn
0.996623
[ "eng_Latn" ]
false
docling
[ 3083 ]
[ 2.234375 ]
1
0
Copyright : bulletinflights.com Concepts And Challenges Physical Science Answer Key Concepts and Challenges in Physical Science, Teacher's ... concepts of physical science challenges Flashcards and ... Concepts and Challenges: Students - Fact Monster 9780130238559: GLOBE CONCEPTS AND CHALLENGES IN PHYSICAL ... Amazon.com: Physical Science: Concepts and Challenges ... Concepts And Challenges Physical Science Physical Science - Albemarle County Public Schools Amazon.com: concepts and challenges in science Concepts and Challenges in Physical Science: Leonard ... Concepts and Challenges in Physical Science, Second ... The Basis of Life (Concepts and Challenges) by GLOBE (2003 ... Concepts and Challenges Physical Science - AbeBooks Concepts and Challenges in Physical Science Teacher's Manual GLOBE CONCEPTS AND CHALLENGES IN PHYSICAL SCIENCE TEXT 4TH ... 8th Grade Homeschool Curriculum: Pearson Education Programs Concepts and Challenges - Physical Science Teacher ... Concepts and Challenges in Physical Science Flashcards ... Concepts and Challenges in Physical Science Unit 17 ... 7th Grade Homeschool Curriculum: Pearson Education Programs Concept Map - TeacherVision Concepts and Challenges in Physical Science, Teacher's ... 5.0 out of 5 stars Concepts and Challenges in Physical Science 2nd Edition Globe Fearon Pub. June 27, 2015. Format: Hardcover Verified Purchase. Hi, I love this text book on Physical Science. It takes hard ideas and makes them simple/fun. Much learning of hard concepts in an enjoyable way. no other text compares. Topics of chemistry/electricity ... concepts of physical science challenges Flashcards and ... A secular science option by Pearson Learning Group, Concepts & Challenges for use at the middle grades that won't overwhelm your reader. The content is written at a 5th to 6th grade reading level, information is presented in manageable pieces, photos and/or illustrations appear on almost every page, and each lesson is contained in a 2-page lesson format. Concepts and Challenges: Students - Fact Monster Concepts and Challenges Life, Earth, and Physical Science. From Pearson's Concepts and Challenges Life, Earth, and Physical Science. Buy This Book. Related Resources. REFERENCE. Idioms and Proverbs . If you say, "The cat's out of the bag" instead of "The secret is given away," you're using an idiom. The meaning of an idiom is... 9780130238559: GLOBE CONCEPTS AND CHALLENGES IN PHYSICAL ... Welcome to Fact Monster, an easy-to-use, reliable source of information for conducting a Web InfoSearch or researching the Big Ideas from Concepts and Challenges. Click on the button below and you'll be taken to the Science and Technology area of Fact Monster. Amazon.com: Physical Science: Concepts and Challenges ... The Basis of Life (Concepts and Challenges) by GLOBE (2003) Hardcover [Globe Fearon] on Amazon.com. *FREE* shipping on qualifying offers. Concepts and Challenges Physical Science Teacher's Edition Concepts And Challenges Physical Science Concepts and Challenges in Physical Science [Leonard Bernstein, Martin Schachter, Alan Winkler, Stanley Wolfe] on Amazon.com. *FREE* shipping on qualifying offers. 1998 Concepts and Challenges in Physical Science Revised Third Edition (H) by Leonard Bernstein, Martin Schachter Physical Science - Albemarle County Public Schools This comprehensive hardcover program offers the right balance of challenging content and text accessibility that helps all levels of students succeed in science. A unique left-hand "Concept" page and right-hand "Challenge" page make each lesson accessible and provide frequent review and reinforcement to build student confidence. Physical Science Amazon.com: concepts and challenges in science Students who need additional support may also use Physical Science (Concepts and Challenges Series) published by Globe-Fearon. This book is designed to present grade level appropriate content at a lower reading level (minus 2-3 grade levels). Concepts and Challenges in Physical Science: Leonard ... Concepts and Challenges in Physical Science, Teacher's Edition [Leonard Bernstein, Martin Schachter, Alan Winkler, Stanley Wolfe] on Amazon.com. *FREE* shipping on qualifying offers. Physical Science The following units are addressed in Physical Science. For information on specific chapters Concepts and Challenges in Physical Science, Second ... This item: Physical Science: Concepts and Challenges by Leonard Bernstein Hardcover $89.95. Only 1 left in stock - order soon. Ships from and sold by mary530. $5.79 shipping . The Giver (1) (Giver Quartet) by Lois Lowry Paperback $6.99. In Stock. Ships from and sold by Amazon.com. The Basis of Life (Concepts and Challenges) by GLOBE (2003 ... concepts and challenges in physical science by winkler schachter and a great selection of related books, art and collectibles available now at AbeBooks.com. Concepts and Challenges Physical Science - AbeBooks Start studying Concepts and Challenges in Physical Science. Learn vocabulary, terms, and more with flashcards, games, and other study tools. Concepts and Challenges in Physical Science Teacher's Manual GLOBE CONCEPTS AND CHALLENGES IN PHYSICAL SCIENCE LAB PROGRAM 4TH EDITION 2003C Paperback. GLOBE. $42.36. The Basis of Life (Concepts and Challenges) by GLOBE (2003) Hardcover Hardcover. Globe Fearon. 4.6 out of 5 stars 5. $45.65. Concepts and Challenges in Physical Science ... GLOBE CONCEPTS AND CHALLENGES IN PHYSICAL SCIENCE TEXT 4TH ... Learn concepts of physical science challenges with free interactive flashcards. Choose from 500 different sets of concepts of physical science challenges flashcards on Quizlet. 8th Grade Homeschool Curriculum: Pearson Education Programs Learn terms science concepts challenges with free interactive flashcards. Choose from 500 different sets of terms science concepts challenges flashcards on Quizlet. Concepts and Challenges - Physical Science Teacher ... GLOBE CONCEPTS AND CHALLENGES EARTH SCIENCE STUDENT TEXTBOOK 4TH EDITION 2003C. by GLOBE | Feb 28, 2002. 4.8 out of 5 stars 7. Hardcover $95.00 $ 95. 00. $3.99 shipping. Only 4 left in stock - order soon. More Buying Choices $5.97 (44 used & new offers) GLOBE CONCEPTS AND CHALLENGES IN PHYSICAL SCIENCE TEXT 4TH EDITION 2003C. by GLOBE | Mar 20 ... Concepts and Challenges in Physical Science Flashcards ... Start studying Concepts and Challenges in Physical Science Unit 17. Learn vocabulary, terms, and more with flashcards, games, and other study tools. Concepts and Challenges in Physical Science Unit 17 ... We use Concepts and Challenges in Physical Science (c) 1986 or 1989 which has excellent presentations and fits well with the aim of our program. This text concentrates on basic formation, not on the accumulation of complex data. Each lesson is a two page spread that introduces the student to a science concept. 7th Grade Homeschool Curriculum: Pearson Education Programs AbeBooks.com: GLOBE CONCEPTS AND CHALLENGES IN PHYSICAL SCIENCE LAB PROGRAM 4TH EDITION 2003C (9780130238559) by GLOBE and a great selection of similar New, Used and Collectible Books available now at great prices. Concept Map - TeacherVision Prepare your child for middle school using Pearson's eighth grade homeschool products. Reinforce skills they learned in earlier grades & subjects. Copyright code : 1f267308f4f0c6e7513cf4ebbe5f01e0. Page 1/1
<urn:uuid:086bf1e2-8220-44e7-bc35-200e4f31759f>
CC-MAIN-2020-45
http://bulletinflights.com/concepts_and_challenges_physical_science_answer_key.pdf
2020-10-24T12:29:00+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00225.warc.gz
17,167,296
1,618
eng_Latn
eng_Latn
0.97545
eng_Latn
0.97545
[ "eng_Latn" ]
false
docling
[ 7404 ]
[ 2.546875 ]
5
0
'It's Not Enough To Be Smart': Students With High 'Emotional Intelligence' Get Better Grades December 14, 2019 by John Anderer (© Monkey Business - stock.adobe.com) SYDNEY — Formative years spent in school can be a turbulent time for adolescents and teens, and it's common for emotions to be at an all-time high. Each student deals with their emotions in her or his own way, and some are naturally better equipped to cope than others. Now, a new study conducted in Sydney, Australia finds that adolescents who are more adept at recognizing and managing their emotions usually end up attaining higher academic grades and standardized test scores. This ability to understand and control one's emotions has been dubbed "emotional intelligence" by the scientific community, and is a relatively new concept, only dating back to the 1990s. "Although we know that high intelligence and a conscientious personality are the most important psychological traits necessary for academic success, our research highlights a third factor, emotional intelligence, that may also help students succeed," comments lead author Carolyn MacCann, PhD, of the University of Sydney, in a release. "It's not enough to be smart and hardworking. Students must also be able to understand and manage their emotions to succeed at school." While there was some pre-existing evidence that schoolbased emotional learning programs can be helpful at improving students' test scores, McCann believes her work is the first ever comprehensive meta-analysis to investigate the relationship between high emotional intelligence and academic performance. CLICK HERE TO SUBSCRIBE TO OUR WEEKLY NEWSLETTER & GET THE LATEST STUDIES FROM STUDYFINDS.ORG BY EMAIL! To come to their conclusions, the research team analyzed a huge dataset consisting of more than 160 previous studies published between 1998-2019. This data encompassed over 42,000 students spread across 27 different countries (just over 76% were English speaking nations). Age-wise, the population sample was diverse, including students as young as elementary school and as old as college. Overall, students with higher emotional intelligence were found to achieve higher grades and standardized test scores than other students with less control over their feelings. After accounting for other factors such as traditional intelligence and personality traits, the findings stayed consistent. Even age, which the research team expected to influence results, did not seem to affect the association between emotional control and grades. As far as why emotional intelligence plays such a significant role in academic performance, the study's authors offered up a few possible explanations. "Students with higher emotional intelligence may be better able to manage negative emotions, such as anxiety, boredom and disappointment, that can negatively affect academic performance," McCann says. "Also, these students may be better able to manage the social world around them, forming better relationships with teachers, peers and family, all of which are important to academic success." Additionally, it is also hypothesized that the same skills that contribute to emotional intelligence, such as the ability to empathize with and understand human emotion and motivation, probably also help students excel in certain academic subjects, such as history or language courses. However, the research team were sure to warn against specifically testing for emotional skills, and subsequently singling out those with lower emotional intelligence for extra guidance. Doing so, they believe, would only stigmatize those students and make matters worse. "Programs that integrate emotional skill development into the existing curriculum would be beneficial, as research suggests that training works better when run by teachers rather than external specialists," McCann concludes. "Increasing skills for everyone – not just those with low emotional intelligence – would benefit everyone." The study is published in the scientific journal Psychological Bulletin. Like studies? Follow us on Facebook!
<urn:uuid:dd8d37d1-8045-4398-a145-3c39904014b5>
CC-MAIN-2020-45
https://selatmeigs.weebly.com/uploads/9/3/2/7/9327727/its_not_enough_to_be_smart__students_with_high_emotional_intelligence_get_better_grades_-_study.pdf
2020-10-24T12:40:31+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00225.warc.gz
506,446,063
757
eng_Latn
eng_Latn
0.998332
eng_Latn
0.998688
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 649, 1617, 2710, 3997, 4109 ]
[ 2.53125 ]
1
0
Trends in Exposure to Substance Use Prevention Messages among Adolescents Adolescents are subjected to influences that may increase their risk for substance use or protect them from it. 1 Substance use prevention programs are designed to reduce the influence of risk factors and increase the influence of protective factors. Parents can also affect substance use through conversations that they have with their children. Substance use prevention messages and programs are also provided through the media, schools, and other sources that have all been shown to have an association with alcohol and illicit drug use. 1 , 2 Providing adolescents with credible, accurate, and age-appropriate information about the harm associated with substance use is a key component in prevention programming because youth perception of the risks associated with substance use are related to their rates of substance use. Prevention programming can be made more effective by gaining a better understanding how youths receive prevention messages. Similarly, prevention programming can be better targeted to address underserved populations if the demographic characteristics of youths not exposed to prevention messages or programs are known. The National Survey on Drug Use and Health (NSDUH) asks adolescents (i.e., youths aged 12 to 17) whether they have been exposed to prevention messages in the past 12 months through parental sources (i.e., talked with at least one of their parents during the past year about the dangers of tobacco, alcohol, or drug use) and media sources (i.e., seen or heard any alcohol or drug prevention messages from sources such as posters, pamphlets, radio, or television). In addition, adolescents are asked whether they have been exposed to prevention messages in the past 12 months through school sources (i.e., special classes about drugs or alcohol in school; films, lectures, discussions, or printed information about drugs or alcohol in regular school classes such as health or physical education; or films, lectures, discussions, or distribution of printed information about drugs or alcohol outside of regular classes such as in a special assembly), as well as whether they have participated in the past February 7, 2013 IN BRIEF X X X X Between the early 2000s and 2011, the percentages of adolescents reporting exposure to drug or alcohol use prevention messages in the past year through media and school sources generally declined X In 2011, 40 percent of adolescents did not talk with their parents about the dangers of substance use, and one quarter did not receive prevention messages through media or school sources X Adolescents aged 12 to 14 were less likely than those aged 15 to 17 to have received prevention messages through media sources and to have talked with a parent about the dangers of substance use but were more likely to have received messages through school sources and to have participated in a substance use prevention program outside of school NSDUH_099b 12 months in an alcohol, tobacco, or drug prevention program outside of school. This issue of The NSDUH Report examines trends in adolescents' exposure to substance use prevention messages from 2002 to 2011. It also uses 2011 data to examine exposure to prevention messages by key demographic characteristics. Trends in Exposure to Prevention Messages The percentage of adolescents who talked with their parents about the dangers of alcohol has been relatively stable at about 58 percent between 2002 and 2011, although it peaked at 60.3 percent in 2004. The percentage who participated in a prevention program outside of school reached a high of 13.9 percent in 2003 but after a decline in 2004, the percentage remained relatively stable between 2004 and 2011 (at about 11.5 percent). These same general patterns were seen for both age groups and for males and females (Tables 1 and 2). to prevention messages in the past year through school sources remained stable between 2002 and 2006, decreased between 2006 and 2007, and then remained relatively stable through 2011 with about 75 percent of students receiving prevention messages through school sources. Similar patterns were seen among both genders and both age groups of adolescents (i.e., those aged 12 to 14 and those aged 15 to 17). Exposure to Prevention Messages in 2011 The percentages of adolescents reporting exposure to drug or alcohol use prevention messages through media sources in the past year remained stable between 2002 and 2004 (at about 83 percent) and then decreased to a low of 75.1 percent in 2011 (Figure 1). The percentage of in-school adolescents (students) reporting exposure The majority of adolescents received prevention messages through media and school sources in 2011 (75.1 and 74.6 percent, respectively), 57.8 percent talked to their parents about the dangers of substance use, and 11.7 percent participated in a prevention program outside of school. Although this indicates most youth are exposed to prevention messages, it is important to note that 40 percent did not report talking with their parents about the dangers of substance use, and about one quarter of adolescents indicated that they did not receive prevention messages through media and school sources. Adolescents aged 12 to 14 were more likely than those aged 15 to 17 to have received prevention messages through school sources and to have participated in a substance use prevention program outside of school Table 1. Exposure to Substance Use Prevention Messages in the Past Year among Adolescents, by Age Group: 2002 to 2011 * Only includes adolescents who were in school or on vacation from school at the time of the interview. a Difference between estimate and estimate for 2010 statistically significant at the .05 level. Source: SAMHSA, Center for Behavioral Health Statistics and Quality, National Survey on Drug Use and Health, 2002 to 2010 (revised March 2012) and 2011. 2 Table 2. Exposure to Substance Use Prevention Messages in the Past Year among Adolescents, by Gender: 2002 to 2011 * Only includes adolescents who were in school or on vacation from school at the time of the interview. a Difference between estimate and estimate for 2010 statistically significant at the .05 level. Source: SAMHSA, Center for Behavioral Health Statistics and Quality, National Survey on Drug Use and Health, 2002 to 2010 (revised March 2012) and 2011. 3 (Table 1). For example, 77.7 percent of adolescents aged 12 to 14 received prevention messages through school sources, compared with 71.9 percent of those aged 15 to 17. Adolescents aged 12 to 14 were less likely than those aged 15 to 17 to have received prevention messages through media sources (70.4 vs. 79.5 percent) and to have talked to a parent about the dangers of substance use (57.7 vs. 58.0 percent). In 2011, females were more likely than males to have talked with a parent about the dangers of substance use, to have received prevention messages through media sources, and to have received prevention messages through school sources in the past year (Table 2). For example, 76.4 percent of females received prevention messages through media sources compared with 73.8 percent of males. Males and females were equally likely to have participated in a substance use prevention program outside of school. Discussion Between the early 2000s and 2011, the percentages of adolescents reporting exposure to drug or alcohol use prevention messages in the past year through media and school sources generally declined; however, in each year of data presented in this report, the majority of adolescents received substance use prevention messages through these sources. The percentage of adolescents The National Survey on Drug Use and Health (NSDUH) is an annual survey sponsored by the Substance Abuse and Mental Health Services Administration (SAMHSA). The survey collects data by administering questionnaires to a representative sample of the population through face-to-face interviews at their place of residence. The NSDUH Report is prepared by the Center for Behavioral Health Statistics and Quality (CBHSQ), SAMHSA, and by RTI International in Research Triangle Park, North Carolina. (RTI International is a trade name of Research Triangle Institute.) Information on the most recent NSDUH is available in the following publication: 4 who talked with their parents about the dangers of substance use remained relatively stable over the 10year period, but 40 percent of adolescents did not have such conversations. Although it is encouraging that the majority of adolescents are receiving prevention messages, practitioners, policymakers, educators, and parents should note the percentage of adolescents who did not receive prevention messages through these sources. For example, about 25 percent of inschool adolescents did not receive prevention messages through school sources. These findings suggest the need for continued vigilance to ensure that our Nation's adolescents are receiving prevention messages. End Notes 1. National Institute on Drug Abuse. (2003). Preventing drug use among children and adolescents: A research-based guide for parents, educators, and community leaders (2nd ed.; NIH Publication No. 04-4212B). Washington, DC: U.S. Department of Health and Human Services, National Institutes of Health. Retrieved from http://www. drugabuse.gov/sites/default/files/preventingdruguse.pdf 2. Skiba, D., Monroe, J., & Wodarski, J. S. (2004). Adolescent substance use: Reviewing the effectiveness of prevention strategies. Social Work, 49(3), 343-353. Suggested Citation Substance Abuse and Mental Health Services Administration, Center for Behavioral Health Statistics and Quality. (February 7, 2013). The NSDUH Report: Trends in Exposure to Substance Use Prevention Messages among Adolescents. Rockville, MD. Center for Behavioral Health Statistics and Quality. (2012). Results from the 2011 National Survey on Drug Use and Health: Summary of national findings (HHS Publication No. SMA 12-4713, NSDUH Series H-44). Rockville, MD: Substance Abuse and Mental Health Services Administration. Also available online: http://www.samhsa.gov/data/NSDUH.aspx. U.S. DEPARTMENT OF HEALTH & HUMAN SERVICES Substance Abuse & Mental Health Services Administration Center for Behavioral Health Statistics and Quality www.samhsa.gov/data
<urn:uuid:f4d44aa0-6705-451d-bb9e-3215a35999d8>
CC-MAIN-2020-45
https://cybercemetery.unt.edu/archive/oilspill/20130218142605/http:/www.samhsa.gov/data/2k13/NSDUH099b/sr099b-trends-prevention-messages.pdf
2020-10-24T12:23:27+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00229.warc.gz
279,841,039
2,128
eng_Latn
eng_Latn
0.98477
eng_Latn
0.992142
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 3012, 5967, 6442, 10405 ]
[ 2.078125 ]
1
0
BBC LEARNING ENGLISH 6 Minute English What makes a superhero? NB: This is not a word-for-word transcript Rob Hello and welcome to 6 Minute English from BBC Learning English. I'm Rob … and … is it a bird? Is it a plane? No, it's Super-Finn! Finn Hello Rob – it's just Finn here actually – I'm no superhero! Rob That's a shame. So you don't have any special superpowers – amazing skills and abilities that can be used for saving people and fighting against evil? Finn Well, lots of powers, but no superpowers. I'm afraid not. Superheroes, of course, tend to be fictional characters – they're made-up characters, who appear in comics and books and movies. Rob You mean characters like Batman, Spiderman and Wonder Woman. Do you have a favourite? Finn I do actually. Spiderman was my favourite when I was growing up. And he can climb up walls and I really wanted to do the same – I tried to climb up the walls in my house and sadly I failed because superheroes are fictional – they aren't real! Rob Well some real-life superheroes do exist and that's what we'll be talking about today and we'll be explaining some words related to superheroes. But first a question … Finn Can I use my superpowers to answer this one? Rob You can try. What year did Superman first appear published in a comic book? a) 1930 b) 1934 c) 1938 Finn My spidey sense tells me it's 1934. Rob I'll tell you if you're right or wrong at the end of the programme. Now let's find out more about some real-life superheroes. These are people who don't really have superpowers but they are doing something extraordinary. Finn So they are doing something special – but most importantly, they are doing something good. Rob People often describe someone who has done something brave, such as saving someone's life, as a hero. Firefighters are sometimes described as heroes because they often risk their lives to save others. Finn But heroes don't have to be life-savers. We sometimes describe a person with great intelligence or amazing abilities as 'our hero' – that could be a musician maybe or an athlete. It's someone we admire and look up to. Rob Well there's a man in Japan who's recently been described as a 'superhero'. To be honest, I don't think his powers are superhuman – that means a power that ordinary humans don't have – but what he does is rather unusual and he gives up his free time doing it. Finn Tell me more Rob. Rob This is Chibatman – named after the city of Chiba where he comes from. His mission – his purpose – is to make the people of the city happy. Finn That's a worthwhile mission. Rob It is. Chibatman has been spotted 'flying' through the streets of Chiba dressed a bit like Batman and riding his custom-built three-wheeled Chibatpod. But why? Is he just a bit crazy or does he have honourable intentions? Finn You mean does he genuinely want to do some good and make things better? Rob Well, listen to what he says, speaking through a translator, and see if you can hear what his reasons are … 'Chibatman' – Chiba superhero I started doing this around three years ago. As for my reasons: during the great earthquake people forgot how to smile. I wanted to help bring the smile back and that's why I started. Finn OK, so because of the devastation caused by the earthquake and tsunami in 2011, he felt people had forgotten how to smile. So his mission was to get people smiling again. That's something we could describe as being 'honourable'. Rob What is interesting about him and other superheroes is they keep their identity closelyguarded – nobody knows who the real man in the costume is. Finn That's also true for another Japanese man who's been called a superhero. Mr Full Moon wears a costume to hide his identity when he goes around cleaning the streets of Tokyo. Rob Yes, he actually talks to people through a voice on his smartphone. He hasn't been employed by anyone to do this – he just claims he wants to keep the city's streets cleaner. We could call him a grime fighter armed with a dustpan and brush! Finn Very good – a 'grime fighter' – someone fighting dirt and dust! Rob Anyway, time now to see if your superpowers helped you answer today's question correctly. Finn Yes Rob, you asked me what year Superman first appeared in a comic book. Rob And you said 1934 and you were wrong. Superman first appeared in Action Comics #1 in June 1938. The character was created by Jerry Siegel and Joe Shuster and originally he wasn't a hero but a villain – the bad guy – but he was changed into a hero before he was published in the comic. Now before you change into your costume, could you save the day by reminding us of some of the words we have heard today? Finn Yes, today we heard: superhero superpowers fictional extraordinary life-savers admire mission honourable closely-guarded Rob Well, that brings us to the end of today's 6 Minute English. We hope you've enjoyed today's programme. Please join us again soon. Bye. Finn Bye. Vocabulary and definitions Read and listen to the story online 06112014 - english/ep - minute - http://www.bbc.co.uk/learningenglish/english/features/6 More on this story: http://www.bbc.co.uk/news/world-asia-29006188
<urn:uuid:6118a71a-0a16-4bc8-b552-789d5302b4dd>
CC-MAIN-2020-45
https://api.mimichome.com/view?id=4036ace5-db7d-4a0b-9076-c848983a1341
2020-10-24T11:58:36+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00226.warc.gz
200,384,993
1,223
eng_Latn
eng_Latn
0.996055
eng_Latn
0.999611
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1312, 2707, 4311, 5007, 5230 ]
[ 3.9375 ]
1
2
1 An Introduction Nature has given us illimitable sources of prepared low - grade heat. Will human organisations cooperate to provide the machine to use nature ' s gift? John A. Sumner (1976) Many of you will be familiar with the term geothermal energy . It probably conjures mental images of volcanoes or of power stations replete with clouds of steam, deep boreholes, whistling turbines and hot saline water. This book is not primarily about such geothermal energy, which is typically high temperature (or high enthalpy, in technospeak) energy and is accessible only at either specifi c geological locations or at very great depths. This book concerns the relatively new science of thermogeolog y. Thermogeology involves the study of so - called ground source heat : the mundane form of heat that is stored in the ground at normal temperatures. Ground source heat is much less glamorous than high - temperature geothermal energy, and its use in space heating is often invisible to those who are not ' in the know ' . It is hugely important, however, as it exists and is accessible everywhere. It genuinely offers an attractive and powerful means of delivering CO 2 - effi cient space heating and cooling. COPYRIGHTED MATERIAL Let me offer the following defi nition of thermogeology : Thermogeology is the study of the occurrence, movement and exploitation of low enthalpy heat in the relatively shallow geosphere. An Introduction to Thermogeology: Ground Source Heating and Cooling, Second Edition. David Banks. © 2012 John Wiley & Sons, Ltd. Published 2012 by John Wiley & Sons, Ltd. By ' relatively shallow ' , we are typically talking of depths of down to 300 m or so. By ' low enthalpy ' , we are usually considering temperatures of less than 40 ° C. 1 1.1 Who should read this book? This book is designed as an introductory text for the following audience: * graduate and postgraduate level students; * civil and geotechnical engineers; * buildings services and heating, ventilation and air conditioning (HVAC) engineers who are new to ground source heat; * applied geologists, especially hydrogeologists; * architects; * planners and regulators; * energy consultants. 1.2 What will this book do and not do? This book is not a comprehensive manual for designing ground source heating and cooling systems for buildings: it is rather intended to introduce the reader to the concept of thermogeology. It is also meant to ensure that architects and engineers are aware that there is an important geological dimension to ground heat exchange schemes. The book aims to cultivate awareness of the possibilities that the geosphere offers for space heating and cooling and also of the limitations that constrain the applications of ground heat exchange. It aims to equip the reader with a conceptual model of how the ground functions as a heat reservoir and to make him or her aware of the important parameters that will infl uence the design of systems utilising this reservoir. While this book will introduce you to design of ground source heat systems and even enable you to contribute to the design process, it is important to realise that a sustainable and successful design needs the integrated skills of a number of sectors: * The thermogeologist * The architect, who must ensure that the building is designed to be heated using the relatively low - temperature heating fl uids (and cooled by relatively high temperature chilled media) that are produced effi ciently by most ground source heat pump/heat exchange schemes. 1 Although in conventional geothermal science, anything up to around 90 ° C is still considered ' low enthalpy ' ! * The buildings services/HVAC engineer, who must implement the design and must design hydraulically effi cient collector and distribution networks, thus ensuring that the potential energetic benefi ts of ground heat exchange systems are not frittered away in pumping costs. * The electromechanical and electronic engineer, who will be needed to install the heat pump and associated control systems * The pipe welder and the driller, who will be responsible for installing thermally effi cient, environmentally sound and non - leaky ground heat exchangers. * The owner, who needs to appreciate that an effi cient ground heat exchange system must be operated in a wholly different way to a conventional gas boiler (e.g. ground source heat pumps often run at much lower output temperatures than a gas boiler and will therefore be less thermally responsive). If you are a geologist, you must realise that you are not equipped to design the infrastructure that delivers heat or cooling to a building. If you are an HVAC engineer, you should acknowledge that a geologist can shed light on the ' black hole ' that is your ground source heat borehole or trench. In other words, you need to talk to each other and work together! For those who wish to delve into the hugely important ' grey area ' where geology interfaces in detail with buildings engineering, to the extent of consideration of pipe materials and diameters, manifolds and heat exchangers, I recommend that you consult one of several excellent manuals or software packages available. In particular, I would name the following: * the manual of Kavanaugh and Rafferty (1997) – despite its insistence on using such unfamiliar units as Btu ft − 1 ° F − 1 , so beloved of our American cousins; * the set of manuals issued by the International Ground Source Heating Association ( IGSHPA ) – IGSHPA (1988) , Bose (1989) , Eckhart (1991) , Jones (1995) , Hiller (2000) , and IGSHPA (2007) ; * the recent book by Ochsner (2008a) ; * the newly developed Geotrainet (2011) manual, which has a specifi cally European perspective and has been written by some of the continent ' s foremost thermophysicists, thermogeologists and HVAC engineers; * the German Engineers ' Association standards (VDI, 2000, 2001a,b, 2004, 2008 ); * numerous excellent booklets aimed at different national user communities, such as that of the Energy Saving Trust (2007) . 1.3 Why should you read this book? You should read this book because thermogeology is important for the survival of planet Earth! Although specialists may argue about the magnitude of climate change ascribable to greenhouse gases, there is a broad consensus (IPCC, 2007 ) that the continued emission of fossil carbon (in the form of CO 2 ) to our atmosphere has the potential to detrimentally alter our planet ' s climate and ecology. Protocols negotiated via international conferences, such as those at Rio de Janeiro (the so - called Earth Summit) in 1992 and at Kyoto in 1997, have attempted to commit nations to dramatically reducing their emissions of greenhouse gases [carbon dioxide, methane, nitrous oxide, sulphur hexafl uoride, hydrofl uorocarbons ( HFC s) and perfl uorocarbon s ( PFC s)] during the next decades. Even if you do not believe in the concept of anthropogenic climate change, recent geopolitical events should have convinced us that it is unwise to be wholly dependent on fossil fuel resources located in unstable parts of the world or within nations whose interests may not coincide with ours. Demand for fossil fuels is increasingly outstripping supply: the result of this is the rise in oil prices over the last decade. This price hike is truly shocking, not least because most people seem so unconcerned by it. A mere 10 years ago, in 1999, developers of a new international oil pipeline were worrying that the investment would become uneconomic if the crude oil price fell below $15 USD per barrel. At the time of writing, Brent crude is some $105 per barrel, and peaked in 2008 at over $140 (Figure 1.1 ). The increasingly effi cient use of the fuel resources we do have access to, and the promotion of local energy sources, must be to our long - term benefi t. I would not dare to argue that the usage of ground source heat alone will allow us to meet all these objectives. Indeed, many doubt that we will be able to adequately reduce fossil carbon emissions soon enough to signifi cantly brake the effects of global warming. If we are to make an appreciable impact on net fossil carbon emissions, however, we will undoubtedly need to consider a wide variety of strategies, including the following: 1. A reduction in energy consumption, for example, by more effi cient usage of our energy reserves. 2. Utilisation of energy sources not dependent on fossil carbon. The most strategically important of these non - fossil - carbon sources is probably nuclear power (although uranium resources are fi nite), followed by hydroelectric power. Wind, wave, biomass, geothermal and solar powers also fall in this category. 3. Alternative disposal routes for fossil carbon dioxide, other than atmospheric emission: for example, underground sequestration by injection using deep boreholes. I will argue, however, that utilisation of ground source heat allows us to signifi cantly address issues (1) and (2). Application of ground source heat pumps (see Chapter 4 ) allows us to use electrical energy highly effi ciently to transport renewable environmental energy into our homes (Box 1.1 ). If the environmental or macroeconomic arguments don ' t sway you, try this one for size: Because the regulatory framework in my country is forcing me to install energy effi cient technologies! The Kyoto Protocol is gradually being translated into European and national legislation, such as the British Buildings Regulations, which not only require highly thermally effi cient buildings, but also low - carbon space heating and cooling technologies. Local planning authorities may demand a certain percentage of ' renewable energy ' before a new development can be permitted. Ground source heating or cooling may offer an architect a means of satisfying ever more stringent building regulations. It may assist a developer in getting into the good books of the local planning committee. BOX 1.1 Energy, Work and Power Energy is an elusive concept. In its broadest sense, energy can be related to the ability to do work . Light energy can be converted, via a photovoltaic cell, to electrical energy that can be used to power an electrical motor, which can do work . The chemical energy locked up in coal can be converted to heat energy by combustion and thence to mechanical energy in a steam engine, allowing work to be done. In fact, William Thomson (Lord Kelvin) demonstrated an equivalence between energy and work. Both are measured in joules (J). Work ( W ) can defi ned as the product of the force ( F ) required to move an object and the distance ( L ) it is moved. In other words, W FL = Force is measured in newtons and has a dimensionality [M][L][T] − 2 . Thus, work and energy have the same dimensionality [M][L] 2 [T] − 2 and 1 J = 1 kg m 2 s − 2 . Power is defi ned as the rate of doing work or of transferring energy. The unit of power is the watt (W), with dimensionality [M][L] 2 [T] − 3 . 1 watt = 1 joule per second = 1 J s − 1 = 1 kg m 2 s − 3 . Finally, the most powerful argument of all: Because you can make money from ground source heat. You may be an entrepreneur who has spotted the subsidies, grants and tax breaks that are available to those who install ground source heating schemes. You may be a consultant wanting to offer a new service to a client. You may be a drilling contractor – it is worth mentioning that, in Norway and the United Kingdom, drillers are reporting that they are now earning more from drilling ground source heat boreholes than from their traditional business of drilling water wells. You may be a property developer who has sat down and looked cool and hard at the economics of ground source heat, compared it with conventional systems and concluded that the former makes not only environmental sense, but also economic sense. 1.4 Thermogeology and hydrogeology You don ' t have to be a hydrogeologist to study thermogeology, but it certainly helps. A practical hydrogeologist often tries to exploit the earth ' s store of groundwater by drilling wells and using some kind of pump to raise the water to the surface where it can be used. A thermogeologist exploits the earth ' s heat reservoir by drilling boreholes and using a ground source heat pump to raise the temperature of the heat to a useful level. The analogy does not stop here, however. There is a direct mathematical analogy between groundwater fl ow and subsurface heat fl ow. We all know that water, left to its own devices, fl ows downhill or from areas of high pressure to low pressure. Strictly speaking, we say that water fl ows from locations of high head to areas of low head (Box 1.2 ). Head is a mathematical concept which combines both pressure and elevation into a single value. Similarly, we all know that heat tends to fl ow from hot objects to cold objects. In fact, a formula, known as Fourier ' s law, was named after the French physicist Joseph Fourier. It permits us to quantify the heat fl ow conducted through a block of a given material (Figure 1.2 ): where Q = fl ow of heat in joules per second, which equals watts (J s − 1 = W), λ = thermal conductivity of the material (W m − 1 K − 1 ), A = cross - sectional area of the block of material under consideration (m 2 ), θ = temperature ( ° C or K), x = distance coordinate in the direction of decreasing temperature (note that heat fl ows in the direction of decreasing temperature: hence the negative sign in the equation), d dx θ = temperature gradient (K m − 1 ). The hydrogeologists have a similar law, Darcy ' s law, which describes the fl ow of water through a block of porous material, such as sand: We know intuitively that water tends to fl ow downhill (from higher to lower elevation). We also know that it tends to fl ow from high to low pressure. We can also intuitively feel that water elevation and pressure are somehow equivalent. In a swimming pool, water is static: it does not fl ow from the water surface to the base of the pool. The higher elevation of the water surface is somehow compensated by the greater pressure at the bottom of the pool. The concept of head ( h ) combines elevation ( z ) and pressure ( P ). Pressure (with dimension [M][L] − 1 [T] − 2 ) is converted to an equivalent elevation by dividing it by the water ' s density ( ρw: dimension [M][L] − 3 ) and the acceleration due to gravity ( g : dimension [L][T] − 2 ), giving the formula Groundwater always fl ows from regions of high head to regions of low head. Head is thus a measure of groundwater ' s potential energy: it provides the potential energy gradient along which groundwater fl ows according to Darcy ' s law. where Z = fl ow of water (m 3 s − 1 ), K = hydraulic conductivity of the material (m s − 1 ), often referred to as the permeability of the material, A = cross - sectional area of the block of material under consideration (m 2 ), h = head (m), x = distance coordinate in the direction of decreasing head (m), dh dx = head gradient (dimensionless). A hydrogeologist is interested in quantifying the properties of the ground to ascertain whether it is a favourable target for drilling a water well (Misstear et al. , 2006 ). Two properties are of relevance. Firstly, the permeability (or hydraulic conductivity ) BOX 1.3 Maslow, Geology and Human Needs Food is the fi rst thing – morals follow on. Bertolt Brecht, A Threepenny Opera Abraham Maslow (1908 – 1970) was an American humanist and psychologist, who studied and categorised fundamental human needs. His ideas are often summarised in some form of tiered structure – a hierarchy of needs – where the lowest levels of need must be fulfi lled before a human can pursue happiness and aspire to satisfy his or her higher - level needs. The most familiar conceptualisation involves the following: Tier 5 – Self - actualisation: includes art, morality Tier 4 – Esteem: self - respect, respect of others, sense of achievement Tier 3 – Belonging: friendship, family Tier 2 – Safety: employment, resources, health, property Tier 1 – The fundamentals: sex, respiration, food, water, homeostasis, excretion, sleep Humble hydrogeologists, environmental geochemists and thermogeologists may not be glamorous, but they can comfort themselves with the fact that they are satisfying basic human needs in Tier 1. Hydrogeologists provide potable water and secure disposal of wastes via pit latrines and landfi lls; environmental geochemists ensure that our soils are fi t for cultivation. Thermogeologists contribute to ensuring homeostasis – a fl ashy word that basically means a controlled environment (shelter), of which space heating and cooling are fundamental aspects. For sex and sleep, the Geologist ' s Directory may not be able to assist you. is an intrinsic property of the rock or sediment that describes how good that material is at allowing groundwater to fl ow through it. Secondly, the storage coeffi cient describes how much groundwater is released from pore spaces or fractures in a unit volume of rock, for a 1 m decline in groundwater head. A body of rock that has suffi cient groundwater storage and suffi cient permeability to permit economic abstraction of groundwater is called an aquifer (from the Latin ' water ' + ' bearing ' ). In thermogeology, we again deal with two parameters describing how good a body of rock is at storing and conducting heat. These are the volumetric heat capacity ( SVC ) and the thermal conductivity ( λ). The former describes how much heat is released from a unit volume of rock as a result of a 1 K decline in temperature, while the latter is defi ned by Fourier ' s law (Equation 1.1 ). We could defi ne an aestifer as a body of rock with adequate thermal conductivity and volumetric heat capacity to permit the economic extraction of heat (from the Latin aestus , meaning ' heat ' or ' summer ' ). 2 In reality, however, all rocks can be economically exploited (depending on the scale of the system required – see Chapter 4 ; Box 1.3 ) for their heat content, rendering the defi nition rather superfl uous. Table 1.1 summarises the key analogies between thermogeology and hydrogeology, to which we will return later in the book. Table 1.1 The key analogies between the sciences of hydrogeology and thermogeology (see Banks, 2009a ). Note that θo = average natural undisturbed temperature of an aestifer, T = transmissivity, t = time, s = drawdown and W ( ) is the well function (see Theis, 1935 ). 2 The word aestifer may sound like a very artifi cial concoction – but it has an ancient pedigree (Banks, 2009a ). Virgil (in the Georgics, Liber II ) and Marcus Cicero (in Aratea ) used the term aestifer astronomically to describe (respectively) the dog - star Sirius and the constellation Cancer as the harbingers of summer ' s heat. Lucretius used the word in around 60 BC in his work " De Rerum Natura " to describe the heat - bearing nature of the sun ' s radiation (Possanza 2001 ). STUDY QUESTIONS 1.1 An aquifer is composed of sand with a hydraulic conductivity of 3 × 10 − 4 m s − 1 and is 30 m thick. It is fully saturated with water, and the groundwater head declines by 8 m every 1 km from north to south. Estimate the total groundwater fl ow through 1 km width of the aquifer every year. 1.2 A small, insulated core of granite, with a thermal conductivity of 3.1 W m − 1 K − 1 , a diameter of 30 mm and a length of 55 mm is placed between two metal plates. One of the plates is kept at 22 ° C, while the other is heated to 28 ° C. What is the fl ow of heat through the core of rock? 1.3 Think about the following sentences: A stream of water, fl owing from high topographic elevation to low elevation is able to turn a water wheel, which can perform mechanical work. We can use mechanical energy (work) to power a pump, which can lift water from a well up to a water tower. Try to construct analogous sentences for the concept of heat fl ow, rather than water fl ow. Take a look at Sections 4.1 and 4.2 if you get into trouble.
<urn:uuid:73a286b6-37bf-42be-ae87-f96d45dc1f02>
CC-MAIN-2020-45
https://catalogimages.wiley.com/images/db/pdf/9780470670347.excerpt.pdf
2020-10-24T11:31:48+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00227.warc.gz
253,468,173
4,593
eng_Latn
eng_Latn
0.995816
eng_Latn
0.997046
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1589, 3656, 6435, 8299, 11056, 13695, 14699, 16812, 19016, 20078 ]
[ 1.40625, 2.375 ]
1
0
DPA Home Learning 22.6.2020 EYFS Choose 1 each day - Design your favourite ice cream dessert - draw it or you could even make it! - Go out into the garden or the street and draw or photograph your shadow. Do this every hour for the rest of the day. How has it changed throughout the day? - Design and draw your own sunglasses, sunhat or flip flops. - Play the memory game: Put summer items on a tray. Look at the items for 1 minute and then cover them. Can you remember all of the items on the tray? Key Stage 1 - Design your favourite ice cream dessert - draw it or you could even make it! - Go out into the garden or the street and draw or photograph your shadow. Do this every hour for the rest of the day. How has it changed throughout the day? - Design and draw your own sunglasses, sunhat or flip flops. - Play the memory game: - Make a postcard on a piece of paper; draw a summer picture on 1 side and write a message on the other side. You could even send it to someone you haven't seen in lockdown. Put summer items on a tray. Look at the items for 1 minute and then cover them. Can you remember all of the items on the tray? Make a list of all of the items. - Make a postcard on a piece of paper; draw a summer picture on 1 side and write a message on the other side. You could even send it to someone you haven't seen in lockdown. Remember to take photos and send them to your teachers so they can see what you have been up to. DPA Home Learning 22.6.2020 Choose 1 or 2 each day - Design your favourite ice cream dessert - draw it or you could even make it! - Go out into the garden or the street and draw or photograph your Years 5 and 6 - Design your favourite ice cream dessert - draw it or you could even make it! - Go out into the garden or the street and draw or photograph your shadow. Do this every hour for the rest of the day. How has it changed throughout the day? Why has this happened? - Design and draw your own sunglasses, sunhat or flip flops. - What is special about 21 st June - Play the memory game: Put summer items on a tray. Look at the items for 1 minute and then cover them. Can you remember all of the items on the tray? Make a list of all of the items. You can remove an item and see which one is missing? - Make a postcard on a piece of paper; draw a summer picture on 1 side and write a message on the other side. You could even send it to someone you haven't seen in lockdown. - Watch: https://www.bbc.co.uk/teach/class- clips-video/science-ks1-ks2-how- summer-weather-affects- behaviour-of-british-animals- plants/zkdkjhv Make some simple food chains; each one containing a plant and an animal that eats it, or an animal that eats another animal. - Write down the weather this week. Record the temperatures and types of weather. Compare it to another place in the world. - Go outside and look at the clouds as often as you can this week. Draw them or photograph them. Find out the names of the clouds shadow. Do this every hour for the rest of the day. How has it changed throughout the day? Why has this happened? - What is the Summer Solstice? Write down all the information you can find. - Make a postcard on a piece of paper; draw a summer picture on 1 side and write a message on the other side. You could even send it to someone you haven't seen in lockdown. - Watch: https://www.bbc.co.uk/teach/classclips-video/science-ks1-ks2-howsummer-weather-affectsbehaviour-of-british-animalsplants/zkdkjhv Make some simple food chains; each one containing a plant and an animal that eats it. - Write down the weather this week. Record the temperatures and types of weather. Compare it to another place in the world. - What can you find out about climates around the world? - How can the heat of the sun affect the world? - Go outside and look at the clouds as often as you can this week. Draw them or photograph them. Find out the names of the clouds. What do different clouds tell us about the weather? - Create a piece of summer art work: a painting, a collage, a print, sewing... - Create a piece of summer art work: a painting, a collage, a print, sewing... Remember to take photos and send them to your teachers so they can see what you have been up to.
<urn:uuid:f5d80a78-d265-414d-b4d7-d7ac774f1172>
CC-MAIN-2020-45
https://www.discoveryprimaryschool.com/attachments/download.asp?file=406&type=pdf
2020-10-24T11:13:38+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00227.warc.gz
679,086,410
1,020
eng_Latn
eng_Latn
0.997372
eng_Latn
0.998464
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 1806, 4219 ]
[ 4.3125 ]
1
0
Topic/Objective:_______________ _____________________________ Full Name: _______________________________ Class: ___________________ Period: _____ _____________________________ Date: _________________ Tutor Use Only: Author Study of William Shakespeare Pages 314-320 in your literature textbook William Shakespeare is generally regarded as the world's greatest writer in the English Language because of his brilliant _____________ ____________ and his keen insight into ____________ ____________. Shakespeare was born in _____________-_________-_________ Northwest of London. His family did NOT have ties to any noble family and were what we would call __________ class. At 18 years old he married ________ ______________, a woman older than he. England was a rising ______________ power in Shakespeare's day. The navy defeated the Spanish __________ and London was a successful _______________. Queen ______________ ___ ruled England and supported the arts. She enjoyed pageants and ________ as well as ____________ literature. London was a busy and growing city of nearly _____________ people. In 1592, Shakespeare was famous enough as a writer to be called an "__________ ________" by Robert Greene. Shakespeare joined the acting company ________ ______________ ______ and helped to make them successful by writing their plays. Even ________ ______________ came to see his plays In 1598 __________ ________ wrote that Shakespeare was "the most excellent" at both comedies and tragedies. Shakespeare's fame and money allowed him to be a partner in the _________ Theatre, buy a large home called ______ __________, and buy his father a ________ ____ ______. When James I became king in 1603, Shakespeare's acting company changed their name to the _________ ______. In 1608, Shakespeare's company leased a second theatre called the ______________ which worked better for __________ performances. Shakespeare died in ________ and was buried in his home church in ____________. His famous epitaph is; "Good friend, for Jesus' sake _________ To ________ the dust enclosed here. Blest be the man that ______ _____ ________, Cursed be he that _________ ____ __________." Some people have said that Shakespeare could not have written his plays because his family was not high class enough, but these claims have NO ________ in solid ________. The Renaissance brought England more interest in __________. Private stage productions were held indoors in ________, royal __________, and ______________ homes. Early public performances were held in the ____________ of inns. In 1576, James ______________ opened the first public theatre outside of London in ______________ and called it the ____________. In 1599, the original __________ was torn down, rebuilt in ____________ near the Rose and the Swan, and renamed the __________. Shakespeare referred to The Globe as the ______________ ___. The Globe was a wooden ______-story building that could hold up to ______ people. Poorer audience members of the Globe had to stand in a roofless courtyard and were called _______________. Wealthier audience member of the Globe sat in ______________ galleries. The stage had NO front _________. If the audience disliked something in the play they would shout out or throw _______. The ________________ of audiences that included pickpockets gave actors a bad reputation. ____________ were NOT allowed to perform, so all of the actors were ______. In 1613, the Globe's _______ caught fire and destroyed the theatre. The Globe was improved and rebuilt on the same spot where it stood for ______ more years until puritan leader ___________ _______________ closed it and all of the theatres outside of London. In 1644, the empty Globe was torn down to build tenement __________. In 1997, American Sam ________________ opened a new Globe theatre just ______ yards from the site of the original. The new theatre only seats __________, because modern audiences would find it too crowded with the ___________ people the original theatre held. Summary:
<urn:uuid:2da106e7-f680-4c0e-94e2-bb2ed3a632d4>
CC-MAIN-2020-45
https://www.lcps.org/cms/lib/VA01000195/Centricity/Domain/5383/ShakespeareAuthorStudy%20Notes%20pgs.%20314-320.pdf
2020-10-24T12:40:27+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00228.warc.gz
780,568,413
838
eng_Latn
eng_Latn
0.998642
eng_Latn
0.998966
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 2286, 4086 ]
[ 3.125 ]
1
0
Home Learning Tuesday 19th May 2020 The Tiny Dragon Design your own Dragon - any size and label it. Can you use our word of the week heroic? SPaG SPaG Remember that a verb is a doing word or an action Weekly Spelling rule Adding 'ly' Adjective to adverb loud quick intelligent beautiful coy wicked Learn these words for a spelling test on Friday Make sure you check the meaning of any words you are not sure about. Other spellings Other spellings By the end of Year 2 all children should know how to spell these. Maths 7. Introduction and comparison of 2p, 5p and 10p coins Introduction and comparison of 2p, 5p and 10p coins For this lesson you will need different types of coins worth different amounts of money. You will also need the tokens you have made in previous lessons. The 2s, 5s and 10s. Introduction and comparison of 2p, 5p and 10p coins Your activity today is to take your 1p, 2p, 5p and 10p and then put them into piles too see how many of each coin you have. Introduction and comparison of 2p, 5p and 10p coins https://docs.google.com/forms/d/e/1F AIpQLSdGX8N489AkRjmxI93wIDKo m_ZpDms9SfNs_TPHRAN66f6-DQ/ viewform?usp=sf_link Click on the link and complete the questions for lesson 7. Times tables Remember by the end of Year 2, you should know you 2, 5, 10, 3, 9 and 11 times tables. Times table rockstars: https://play.ttrockstars.com/auth/school/student Hit the button: https://www.topmarks.co.uk/maths-games/hit-the-button DailyReading There is still an expectation for daily reading to take place at home. Please continue to note this in the school/home contact book. If you have finished your books from home there are e-books available. Oxford Reading https://www.oxfordowl.co.uk/ 2A Username: year2a! Password: year2 2R Username: year2r! Password: year2r! Collins Connect https://connect.collins.co.uk/school/defaultlogin.aspx Reading Everyday at 11am you can listen to David Walliams read one of his World's Worst Children stories. They last about 20 minutes and they are available on the website for the week. https://www.worldofdavidwalliams.c om/elevenses/ Word of the week Heroic means: having the characteristics of a hero or heroine; acting in a brave or determined way. It is a adjective. Example: The heroic knight fought against the evil wizard! Word of the week You can also add ly to make it heroically (an adverb): "The boy heroically stayed at home to make sure that everyone stayed safe." Can you come up with your own sentence using heroically? Guess the object. What might it be called? How old do you think it is? How big do you think it is? Where might you have seen it? How might have used it? We will reveal the answer next week. History Watch Joe Wicks's channel on Youtube and try some videos Also, he is completing daily PE lessons at 9am. PE https://www.youtube.com/playlist?list=PLyCLoPd4VxBuxu3sL ztrvWFehzv-LnR2c Remember our E-safety rules!
<urn:uuid:8c549866-9b76-4fa9-90e2-39c98c950cc4>
CC-MAIN-2020-45
https://whyteleafe.s3.amazonaws.com/uploads/document/Year-2-Tuesday-19.05.2020.pdf?t=1589972374
2020-10-24T12:50:12+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00225.warc.gz
585,346,648
791
eng_Latn
eng_Latn
0.967913
eng_Latn
0.996987
[ "unknown", "eng_Latn", "unknown", "unknown", "eng_Latn", "unknown", "unknown", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 36, 144, 150, 207, 425, 442, 459, 526, 589, 819, 997, 1226, 1474, 1895, 2133, 2334, 2543, 2749, 2964 ]
[ 3.421875 ]
1
0
Quantum Dot Solar Cells: A Potential Game Changer For World Energy Production By Dr. Dennis J. Flood Chief Technical Officer Natcore Technology, Inc. Editor's Note: Natcore Technology (NXT.V; NTCXF) is a long-time supporter of the New Orleans Investment Conference, and a Platinum Sponsor for the 2013 event. The company boasts a number of proprietary, patented technologies that promise to significantly increase the energy output of solar cells while reducing their cost. In particular, Natcore is perhaps the world leader in advancing the application of silicon quantum dots to potentially increase the efficiency of solar cells to the point where solar energy is cheaper than conventional energy production. Dr. Dennis Flood, Natcore's Chief Technology Officer, shares the basic science behind this concept, and why whoever brings quantum dot solar cells to market will transform the world as we know it. The block of single crystal silicon pictured below would have a mass of 28 grams and would contain over 10 23 atoms. That is nearly a quadrillion billion atoms. Examination of the block of silicon under a very powerful electron microscope will reveal that the atoms are arranged in a very definite pattern called the lattice structure. If we were to divide the block in half, then divide one of those pieces in half and repeat the process for a total of 65 times we would end up with a piece of silicon with an average side about 3 nanometers (one nanometer = one billionth of a meter) long and it would contain roughly 200 atoms. This tiny piece of silicon we call a quantum dot. Silicon quantum dots with dimensions as small as 1 nanometer have been made. When the pieces of silicon get to the quantum dot size they start to no longer look like cubes, but more like little pyramids or the caps of hemispheres, hence the name quantum dot. The remarkable thing about silicon quantum dots is that they essentially retain the same lattice structure as the larger block with which we started. The much smaller size, however, means that the usual electronic properties we would see with the larger block of silicon are changed in some very dramatic ways. One of the changes has to do with how silicon interacts with light. Ordinary silicon does not emit radiation in the visible part of the spectrum at all and emits only weakly in the longer wavelength, or infrared, part of the spectrum. All that changes in the quantum dot size regime. Adjusting the dimensions of a silicon quantum dot will enable it to emit light in the visible part of the spectrum. Each one of the vials in the figure below contains silicon quantum dots, with the smallest- sized quantum dot on the left (violet color) and the largest on the right (red color.) What is important, however, is that the different quantum dots will also absorb the same color they emit. Not only that, the quantum dots in any given vial can also absorb the shorter wavelengths of light as well, though with diminishing capability as the wavelengths get shorter. It is this property – the ability to "tune" the quantum dots to absorb different regions of the solar spectrum by changing their size- that makes them useful for solar energy conversion. The technical name for this ability to change the wavelengths of light absorbed by the quantum dots is "bandgap engineering." In order for light to be absorbed by a solar cell, the energy of the incoming light must be greater than the energy bandgap of the absorbing material. A silicon solar cell starts absorbing at a wavelength slightly greater than 1,100 nanometers, and the absorption reaches its maximum value for wavelengths below about 900 nanometers. The absorption typically starts to decrease as the wavelength of the incoming light gets shorter. Making silicon quantum dots with dimensions on the order of 2 nanometers results in a bandgap of about 1.71eV and the corresponding wavelength where absorption starts is about 725 nanometers — a wavelength considerably shorter than the turn-on wavelength for regular silicon solar cells. If a solar cell made of quantum dots is placed on top of an ordinary silicon cell, its absorption starts to "kick in" where the silicon cell absorption starts to fall off. Such a cell configuration is called a tandem solar cell because the two devices work in series. The result is that the overall efficiency goes up because more light is absorbed. Theoretical estimates of the efficiency such a device could exhibit are in the range from 30% to 35% in terrestrial sunlight. The figure below presents a roadmap of sorts for the steps to go through to make an all quantum dot solar cell. The progression passes through the various cell combinations, starting with an ordinary silicon solar cell to a full quantum dot tandem solar cell. It should be pointed out that tandem solar cells are not a new invention. Such devices have been used on space satellite solar arrays for two decades or more. The space cell is made of exotic, very expensive materials that make it impractical for terrestrial solar arrays. In contrast, the all-quantum dot tandem solar cell can be made from readily available materials such as silicon and germanium in roll-to-roll film processing equipment, and has the potential to be extremely low cost as well as highly efficient. How soon can such devices be available to consumers? It may not be as long as previously thought. The past half dozen years has seen an explosion in the number of research papers being published by research groups the world over, and rapid progress is being made in academic and industry research laboratories. Low cost, 30%+ efficient thin film tandem solar cells could start showing up in the marketplace in the next three to five years. The U.S. Department of Energy has set a target for the consumer cost of electrical energy from solar arrays at 5 cents per kilowatt-hour. This price will put solar array generated electricity on a par with fossil fuel power sources. When that happens, the world demand for solar cells and arrays will grow to hundreds to gigawatts (a gigawatt is one billion watts of output) per year, compared to the 35 or so gigawatts now being produced and sold annually. Companies that can address that market with appropriate technology will grow and prosper dramatically. Note: For more information, visit Natcore's website at www.natcoresolar.com. In addition, feel free to contact the company via e-mail at email@example.com, or by telephone at 877-700NATCORE (877-700-6282).
<urn:uuid:af83c741-4895-4f17-a73d-2467e87f5e92>
CC-MAIN-2020-45
http://www.natcoresolar.com/core/wp-content/uploads/2014/04/Natcore-NOIC-Report-Quantum-Dot-Solar-Cells.pdf
2020-10-24T11:26:50+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00232.warc.gz
155,966,142
1,307
eng_Latn
eng_Latn
0.997909
eng_Latn
0.998407
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1251, 2751, 4808, 6543 ]
[ 2.515625 ]
1
1
FERAL DEER Deer were introduced into Australia from Europe in the 19th century as game animals. Today, they occupy many areas throughout Australia and cause a variety of environmental problems. Current management techniques rely heavily on shooting and containment. However, as deer populations expand, new control methods may need to be investigated. History Ecology Deer are indigenous to all continents except Australia and Antarctica. Originally introduced in the 19th century from Europe and Asia as game animals by European settlers, Australia is now home to six species of deer; fallow, red, chital, hog, rusa and sambar. While deer continue to be farmed for venison, the wild populations are causing significant environmental damage. The number of wild deer populations has been expanding in recent years. In 1995, only four populations of red deer were known in Australia but by 2007, 65 red deer populations had been identified. Similar increases are occurring in other deer species populations. Deer populations now exist in many regions across Australia. Deer live predominantly in grassy forests. The habitats they occupy in Australia include rainforests, eucalypt forests and farmlands. Their preferred food is grass but they also eat the leaves of shrubs, trees and herbs, bark and some fruit. The male deer have antlers and all deer have scent glands above their eyes which they use to mark territory. This is done by rubbing this area against trees and saplings. The social behaviours of deer are variable. Sometimes they live in herds with up to 30 deer and other times live as individuals. Deer mate during autumn with usually a single fawn born eight to nine months later. Distribution of feral deer in Australia Sources: National Land & Water Resources Audit (2008) Assessing invasive animals in Australia 2008, NLWRA, Canberra/SEWPaC (2010) Feral animals on offshore islands database located at http://www.environment.gov.au/biodiversity/invasive/ferals/islands/ Impact Where deer density is high, diversity and abundance of plant species is lower. Saplings are commonly destroyed by deer as they rub against them, trample or eat them. Weeds may flourish in areas where deer are not adequately controlled. Deer also assist the spread of weeds into new areas. Deer compete with kangaroos and wallabies for food and generally add to grazing pressure. As hoofed mammals, deer can act as carriers of disease that affect livestock such as cattle and horses. They also contribute to erosion and degrade the water quality in creek and river systems. Control Control measures for deer have not been extensively investigated as priority has been given to other pest species in Australia. One control approach is prevention of the escape of farmed deer so that they do not create new wild populations or bolster existing wild populations. This approach places responsibility and accountability on farmers to ensure that their stock is securely enclosed at all times. Another common control measure is shooting. This may be necessary if herds cannot be easily trapped and transported to a secure, enclosed area or when shooting of a small, isolated population will prevent that population growing in size or distribution. Shooting is carried out by recreational hunters and sometimes by professional marksmen. Where deer populations are well established, containment within defined boundaries may be the most efficient control approach. Photo credits in order: Feral deer stag (Daryl Panther), Feral deer hind (Daryl Panther), Red deer (Michelle McAuley & SEWPaC) © Commonwealth of Australia 2011 This work is copyright. You may download, display, print and reproduce this material in unaltered form only (retaining this notice) for your personal, non-commercial use or use within your organisation. Apart from any use as permitted under the Copyright Act 1968, all other rights are reserved. Requests and inquiries concerning reproduction and rights should be addressed to Commonwealth Copyright Administration, Attorney General's Department, Robert Garran Offices, National Circuit, Barton ACT 2600 or posted at www.ag.gov.au/cca. Disclaimer The views and opinions expressed in this publication are those of the authors and do not necessarily reflect those of the Australian Government or the Minister for Sustainability, Environment, Water, Population and Communities. Further information For further information, contact: Department of Sustainability, Environment, Water, Population and Communities GPO Box 787 Canberra ACT 2601 Phone: 1800 803 772 Email: email@example.com
<urn:uuid:796d2f58-ae13-4a43-ad0c-717e1f8ae1b0>
CC-MAIN-2020-45
https://www.cardiniadeer.org.au/uploads/1/2/2/8/122879958/2011_-_feral_deer_fact_sheet_-_federal_govt.pdf
2020-10-24T11:06:47+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00231.warc.gz
629,516,309
934
eng_Latn
eng_Latn
0.991149
eng_Latn
0.994874
[ "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1712, 2593, 4652 ]
[ 2.828125 ]
2
1
Food Safety and COVID-19 COVID-19 is an infectious disease caused by the novel coronavirus SARS-CoV-2. How Is the Novel Coronavirus That Causes COVID-19 Transmitted? SARS-CoV-2isprimarilytransmittedfrompersontopersonthrough respiratory droplets that enter the mouth, nose, or eyes by contaminated hands. There is no current evidence that SARS-CoV-2 is transmitted through food consumption. How Can I Stay Safe While Grocery Shopping? To prevent transmission, maintain at least 6 feet of distance between yourself and other shoppers. Avoid shaking hands, hugs, or otherphysicalcontact.Trytowipefrequentlytouchedsurfaceslike grocery carts or basket handles with disinfectant wipes, if available.Avoidtouchingyourface.Wearingaclothmaskinthestoremay reduce your risk of getting infected and reminds others to participate in social distancing. Before leaving the store or while waiting in the checkout line, use hand sanitizer if available. Avoid shopping in public if you have symptoms such as fever or cough.Ifyouaresymptomatic,wearingamaskmayhelppreventtransmissiontoothers.Washingyourhandsfrequentlyandmaintainingdistancebetweenyourselfandothersarethebestwaystopreventillness. What Precautions Should I Take When Unpacking Groceries? Time is on your side. Recent studies have shown that SARS-CoV-2 mayremaininfectiousonsurfacesorobjectsforupto72hours,but most virus on the surface of common materials becomes inactive (noninfectious)afterthefirst24hours.Thereislimitedevidencethat virusparticlesonthoseproductstransmitdisease.Virusonthesurface of groceries will become inactivated over time after groceries are put away. The inner contents of sealed containers are unlikely tobecontaminated.Ifusingadisposablegrocerybag,discarditonce you are home. Reusable bags can be stored for later use. After unpackingyourgroceries,washyourhandswithsoapandwaterforat least 20 seconds, or use hand sanitizer that contains at least 60% alcohol.Wipesurfaceswithhouseholddisinfectantsregisteredwith the Environmental Protection Agency. Coronavirus transmission SARS-CoV-2 is the novel coronavirus that causes COVID-19. The virus can spread when a person touches a surface or object that has active virus particles on it and then touches their mouth, nose, or eyes. Virus particles can remain active for up to 72 hours on some surfaces, but they typically become inactive after 24 hours. Virus particles can be eliminated by washing hands with soap and water and cleaning surfaces with disinfectant. After putting groceries away, throw away disposable bags, wash hands, and disinfect countertops and other surfaces. Transmission of SARS-CoV-2 has not been shown to occur through eating, but precautions when shopping for food may prevent viral spread. Disinfect shopping carts and baskets. Keep 6 feet of distance between yourself and other shoppers. 6 feet Food shopping safety Disinfect shopping carts and baskets. Keep 6 feet of distance between yourself and other shoppers. Are There Any Additional Precautions for Older Adults? What Precautions Should I Take When Preparing Food? If you consume foods soon after unpacking your groceries, be sure to practice good hand hygiene before eating. Do not share plates or silverware with others. Rinse off fruits and vegetables thoroughly with water before consumption. Authors: Angel N. Desai, MD, MPH; David M. Aronoff, MD Published Online: April 9, 2020. doi: 10.1001/jama.2020.5877 Author Affiliations: Fishbein Fellow, JAMA (Desai); Vanderbilt University School of Medicine, Nashville, Tennessee (Aronoff). Conflict of Interest Disclosures: Dr Aronoff reported receiving funding from the National Center for Advancing Translational Sciences, Pfizer, Cayman Chemical Co, March of Dimes, National Institute of Allergy and Infectious Diseases, and Eunice Kennedy Shriver National Institute of Child Health and Human Development and serving as an advisory board consultant for Summit Therapeutics, NAEJA-RGM Pharmaceuticals, BLC, and Sanofi Pasteur. Dr Desai reported no disclosures. Sources: US Centers for Disease Control and Prevention. Food Safety and Coronavirus Disease 2019 (COVID-19). Accessed March 29, 2020. https://www.cdc.gov/ foodsafety/newsletter/food-safety-and-Coronavirus.html. Adults older than 65 years and persons with chronic medical conditions are particularly vulnerable to severe disease from COVID-19. If possible, limit shopping in public. Ask a neighbor or friend to pick up groceries and leave them outside your house or bring them into the house while maintaining a distance of at least 6 feet. Some grocery stores offer special hours in the morning for older adults to shop. Try callingyourlocalgrocerystoretoseeifthisisavailablenearyou.Some online suppliers will deliver groceries to your home. FOR MORE INFORMATION Centers for Disease Control and Prevention Ong SWX, Tan YK, Chia PY, et al. Air, surface environmental, and personal protective equipment contamination by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) from a symptomatic patient. JAMA. Published online March 4, 2020. doi:10.1001/jama.2020.3227 van Doremalean N, Bushmaker T, Morris DH, Holbrook MG, Gamble A, Williamson BN. Aerosol and surface stability of SARS-CoV-2 as compared with SARS-CoV-1. N Engl J Med. Published online March 17, 2020. doi:10.1056/NEJMc2004973 The JAMA Patient Page is a public service of JAMA. The information and recommendations appearing on this page are appropriate in most instances, but they are not a substitute for medical diagnosis. For specific information concerning your personal medical condition, JAMA suggests that you consult your physician. This page may be photocopied noncommercially by physicians and other health care professionals to share with patients. To purchase bulk reprints, email email@example.com. (Reprinted) © 2020 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 04/12/2020
<urn:uuid:2561b294-9a08-4103-91de-c70620ccb763>
CC-MAIN-2020-45
http://www.szu.cz/uploads/CZVP/JAMA_COVID.pdf
2020-10-24T11:26:44+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107882581.13/warc/CC-MAIN-20201024110118-20201024140118-00230.warc.gz
178,228,714
1,340
eng_Latn
eng_Latn
0.981984
eng_Latn
0.981984
[ "eng_Latn" ]
false
docling
[ 5958 ]
[ 2.734375 ]
7
0
Letters and Sounds: Phase 1 - Aspect 5 Alliteration Main Purposes Tuning into Sounds To develop understanding of alliteration. Listening and Remembering Sounds To listen to sounds at the beginning of words and hear the differences between them.. Talking About Sounds To explore how different sounds are articulated, and to extend understanding of alliteration. I Spy Names Tuning into Sounds-To develop understanding of alliteration. With a small group of children sitting in a circle, start the game by saying: "I spy someone whose name begins with…" and give the sound of the first letter, for example, 's' for Satish. Then ask: "Who can it be?" Satish stands up, everyone says his name and he carries on the game, saying "I spy someone whose name begins with…", and so on. If any children call out the name before the child with that name, still let the child whose name it is take the next turn. If the children find separating out the first sound too hard in the early stages, the adult can continue to be the caller until they get the hang of it. Assessment Prompts - Look, Listen and Note Look, listen and note how well children: * identify initial sounds of words; * reproduce the initial sounds clearly and recognisably; * make up their own alliterative phrases. twinkl.com Sounds Around Tuning into Sounds-To develop understanding of alliteration. Make sure that word play with initial sounds is commonplace. Include lots of simple tongue twisters to ensure that children enjoy experimenting with words that are alliterative. Use opportunities as they occur incidentally to make up tongue twisters by using children's names, or objects that are of particular personal interest to them (e.g. David's dangerous dinosaur, Millie's marvellous, magic mittens). Assessment Prompts - Look, Listen and Note Look, listen and note how well children: * identify initial sounds of words; * reproduce the initial sounds clearly and recognisably; * make up their own alliterative phrases. Making Aliens Tuning into Sounds-To develop understanding of alliteration. Before the activity begins, think of some strange names for alien creatures. The alien names must be strings of non-words with the same initial sound, for example: Ping pang poo pop, Mig mog mully mo, Fo fi fandle fee. Write them down as a reminder. Talk to the children about the names and help them to imagine what the strange creatures might look like. Provide creative or construction materials for the children to make their own alien. Comment as the children go about shaping the aliens and use the aliens' strange names. Invite the children to display their aliens along with the aliens' names. Make the pattern clearer by emphasising the initial sound of an alien's name. Draw the children's attention to the way you start each word with the shape of your lips, teeth and tongue. Assessment Prompts - Look, Listen and Note Look, listen and note how well children: * identify initial sounds of words; * reproduce the initial sounds clearly and recognisably; * make up their own alliterative phrases. twinkl.com twinkl.com Digging for Treasure Tuning into Sounds-To develop understanding of alliteration. Collect two sets of objects suitable for use in the sand tray. Each set of objects must have names beginning with the same initial sound. Choose initial sounds for each set that sound very different from one another. Bury the objects in preparation for the session. As the children uncover the treasure, group the objects by initial sound and each time another is added recite the content of that set: Wow! You've found a car. Now we have a cup, a cow, a candle and a car. Assessment Prompts - Look, Listen and Note Look, listen and note how well children: * identify initial sounds of words; * reproduce the initial sounds clearly and recognisably; * make up their own alliterative phrases. Bertha Goes to the Zoo Tuning into Sounds-To develop understanding of alliteration. Set up a small toy zoo and join the children as they play with it. Use a toy bus and a bag of animal toys with names starting with the same sound (e.g. a lion, a lizard, a leopard, a llama and a lobster) to act out this story. Chant the following rhyme and allow each child in turn to draw an animal out of the bag and add an animal name to the list of animals spotted at the zoo. "Bertha the bus is going to the zoo, Who does she see as she passes through? … A pig, a panda, a parrot and a polar bear." Assessment Prompts - Look, Listen and Note Look, listen and note how well children: * identify initial sounds of words; * reproduce the initial sounds clearly and recognisably; * make up their own alliterative phrases. twinkl.com twinkl.com Tony the Train's Busy Day Listening and Remembering Sounds-To listen to sounds at the beginning of words and hear the differences between them. Use a toy train and selection of objects starting with the same sound. A small group of children sits in a circle or facing the front so they can see objects placed on the floor. Use the props to act out a story with the train. It was going to be a busy day for Tony. He had lots to do before bedtime. So many packages to deliver and so many passengers to carry. He set out very early, leaving all the other engines at the station, and hurried off down the track, clackedy clack down the track, clackedy clack down the track… But he hadn't gone very far when…!!! He saw something up ahead lying on the tracks. 'Oh no!' yelled Tony. 'I must s – t – o – p.' And he did stop, just in time. To Tony's surprise there on the track lay a big brown bear, fast asleep. 'I had better warn the others,' thought Tony and so he hurried back to the station, clackedy clack going back, clackedy clack going back. Tony arrived at the station quite out of puff. 'Whatever is the matter?' said the other engines. Musical Corners Listening and Remembering Sounds-To listen to sounds at the beginning of words and hear the differences between them. Put a chair in each corner of the room, or outdoors. Collect four sets of objects, each set containing objects with names that start with the same sound. (Four different initial sounds are represented.) Keep back one object from each set and place the remaining sets on each of the four chairs. At first, the children sit in a circle or facing you. Name each of the four sets of objects, giving emphasis to the initial sound. Explain that now there will be music to move around or dance to and that when the music stops the children are to listen. You will show them an object and they should go to the corner where they think it belongs. Assessment Prompts - Look, Listen and Note Look, listen and note how well children: * can recall the list of objects beginning with the same sound; * can offer their own sets of objects and ideas to end the story; * discriminate between the sounds and match to the objects correctly. 'Toot, toot, mind the…big, brown bear' panted Tony. 'He's fast asleep on the track.' 'Thank you,' said the others, 'We certainly will.' Continue with the whole object set and encourage the children to join in with saying the growing list of objects. Remember to give emphasis to the initial sound. The aim is to have the group chant along with you as you recite the growing list of objects that Tony finds lying on the track. Make up your own story using the props and ask: What do you think happens next? Assessment Prompts - Look, Listen and Note Look, listen and note how well children: * can recall the list of objects beginning with the same sound; * an offer their own sets of objects and ideas to end the story; * discriminate between the sounds and match to the objects correctly. twinkl.com twinkl.com Our Sound Box/Bag Listening and Remembering Sounds-To listen to sounds at the beginning of words and hear the differences between them. Make collections of objects with names beginning with the same sound. Create a song, such as 'What have we got in our sound box today?' and then show the objects one at a time. Emphasise the initial sound (e.g. s-s-s-snake, s-s-s-sock, s-s-s-sausage) Assessment Prompts - Look, Listen and Note Look, listen and note how well children: * can recall the list of objects beginning with the same sound; * can offer their own sets of objects and ideas to end the story; * discriminate between the sounds and match to the objects correctly. twinkl.com Name Play Listening and Remembering Sounds-To listen to sounds at the beginning of words and hear the differences between them. Call out a child's name and make up a fun sentence starting with the name (e.g. 'Ben has a big, bouncy ball', 'Kulvinder keeps kippers in the kitchen', 'Tim has ten, tickly toes', 'Fiona found a fine, fat frog'). Ask the children to think up similar sentences for their own names to share with others. Assessment Prompts - Look, Listen and Note Look, listen and note how well children: * can articulate speech sounds clearly; * select an extended range of words that start with the same sound. twinkl.com Mirror Play Talking About Sounds - To explore how different sounds are articulated, and to extend understanding of alliteration. Provide a mirror for each child or one large enough for the group to gather in front of. Play at making faces and copying movements of the lips and tongue. Introduce sound making in the mirror and discuss the way lips move, for example, when sounding out 'p' and 'b', the way that tongues poke out for 'th', the way teeth and lips touch for 'f' and the way lips shape the sounds 'sh' and 'm'. Assessment Prompts - Look, Listen and Note Look, listen and note how well children: * can articulate speech sounds clearly; * select an extended range of words that start with the same sound. Silly Soup Talking About Sounds - To explore how different sounds are articulated, and to extend understanding of alliteration. Provide the children with a selection of items with names that begin with the same sound. Show them how you can make some 'silly soup' by putting 'ingredients' (e.g. a banana, bumble bee and bug) into a pan in the role-play area. Allow the children to play and concoct their own recipes. Play alongside them without influencing their choices. Commentate and congratulate the children on their silly recipes. Recite each child's list of chosen ingredients. Make the pattern clear by emphasising the initial sound. By observing mouth movements draw the children's attention to the way we start each word and form sounds. Assessment Prompts - Look, Listen and Note Look, listen and note how well children: * can articulate speech sounds clearly; * select an extended range of words that start with the same sound. twinkl.com twinkl.com
<urn:uuid:c04f483f-2b35-4960-8aab-81d1be48ebef>
CC-MAIN-2021-49
https://stclements-pri.s3.amazonaws.com/uploads/document/Letters-and-Sounds-Phase-1-Aspect-5-Activity-Cards.pdf?ts=1634430611
2021-12-08T19:10:39+00:00
crawl-data/CC-MAIN-2021-49/segments/1637964363520.30/warc/CC-MAIN-20211208175210-20211208205210-00399.warc.gz
592,316,215
2,360
eng_Latn
eng_Latn
0.996933
eng_Latn
0.998128
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1296, 3117, 4734, 7757, 9086, 10775 ]
[ 4.5 ]
3
1
Don't Feel Like It, Do It Anyway Lesson Content By the time I was 10, I had my tennis goals written down and stuck on my bedroom wall. I was pretty competitive and I wanted to win some junior tennis tournaments. It takes a ton of practice to be any good. My dad was supposed to take me to the tennis courts one Saturday morning for some extra practice, but it was a windy and nasty day. After breakfast Dad said he'd load up the car and get ready to drive to the courts. I said, "Dad, I don't really feel like practicing today." He said, "I understand. I'll go get the car ready." I looked surprised and said again, "It's nasty out there, and I really don't feel like practicing." Again he said, "I know, you're right. I'll go get the car ready." By then I was really frustrated. "Dad! Don't you get it? I don't FEEL like it!" My dad stopped, looked at me and said, "It's perfectly fine that you don't feel like practicing, but what does that have to do with it? Let's do it anyway." LEARNING OBJECTIVE: Student will learn the meaning of self-discipline and list applications of it in their own life. INSTRUCTIONS: Distribute the handout to students after viewing the video. Now I'm thinking, "Why should I practice when I don't feel like it?" But before I could say it my dad said something I'll never forget: "It's possible for you to "not feel like it" all the way to a national championship, if you're willing to keep practicing, ESPECIALLY when you don't feel like it! Just DO IT ANYWAY." Well at first I didn't like the sound of that, but I went to the courts that day and ended up having a great session, in spite of the lousy weather. By the time I got home I was feeling pretty good about myself and my effort. Okay, I know this sounds weird, but those three words my dad said – Do It Anyway – became my little secret weapon. I noticed that there were lots of times during the week when I didn't feel like doing something. I didn't feel like doing my homework, or loading the dishwasher, and I especially didn't feel like picking up my room. I was always looking for the easiest way to get by. But then I read somewhere that winners are people who are willing to do what others won't do, so they can have what others won't have. So now whenever I have that feeling of "I don't feel like" – and I know it's something that's good for me – I just take a deep breath and say those three words – "Do it anyway", and I'm always glad I did. Guess that's why they call it SELF discipline. "Feeling like it" has nothing to do with it! DISCUSSION: Why does living consistently above the land of excuses take courage and self-discipline? What forces are at work that make it tempting to offer excuses for poor performances and mistakes? Which lessons from past weeks have provided insights that can help you master this concept? ©Managing Me #14 Knowing Me #2 Use the space below to reflect on doing the things you don't feel like doing. Do It Anyway! Worksheet What kind of life will a person have by doing only the things he/she feels like doing? An answer to share. Describe two important activities that require your self-discipline and why you should "do it anyway." An answer just for you. ©Managing Me #14
<urn:uuid:35eac3ee-2d95-49fa-9bf7-11f78f0855f5>
CC-MAIN-2021-49
https://santorofoundation.org/wp-content/uploads/2021/06/14-1-STUDENTDoItAnyway_ManagingMe.pdf
2021-12-08T19:47:56+00:00
crawl-data/CC-MAIN-2021-49/segments/1637964363520.30/warc/CC-MAIN-20211208175210-20211208205210-00399.warc.gz
557,866,328
765
eng_Latn
eng_Latn
0.998703
eng_Latn
0.999693
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 2888, 3248 ]
[ 3.8125 ]
2
0
Science Statement Our vision is for pupils to become independent, motivated learners and responsible citizens. Core values Intent We follow the national curriculum for science (2014) and aim to ensure that all pupils: - develop scientific knowledge and conceptual understanding through the specific disciplines of biology, chemistry and physics. - develop understanding of the nature, processes and methods of science through different types of science enquiries that help them to answer scientific questions about the world around them - are equipped with the scientific knowledge required to understand the uses and implications of science, today and for the future. We aim to inspire and maintain our pupils' sense of excitement and curiosity about the world around them. Our pupils will learn about scientific concepts as they observe phenomena and conduct experimental investigations. We hope that this will foster a lifelong enthusiasm for science that our pupils will take with them to secondary school and beyond. Reading and writing is embedded by applying taught skills when making observations, predicting and writing up reports of findings. Implementation We use the National Curriculum for science as the basis of its curriculum planning, which contains yearly required content with sequential content development. Across the school, a scheme of work written by Pearson (Science Bug) is used for planning and resources. Our medium-term plans give details of the work for each unit and make cross curricular links wherever possible. The teaching of science in our school builds upon prior learning and all abilities are given the opportunity to develop their skills, knowledge and understanding in order to work further and deeper. We also build progression into science to ensure that the children are increasingly challenged as they move up through the school. Teachers have been provided with a Progression of Essential Science Skills (Working Scientifically) document. This outlines the key skills pupils should learn and demonstrate during science lessons. Teachers are expected to complete an initial assessment at the start of each Science unit. This could be a KWL grid (what I Know, what I Want to know & what I have Learnt), concept map (using key vocabulary) or any other relevant form. This initial assessment informs planning and is revisited at the end of each unit. At least once a half term, teachers also plan for children to conduct a child-led investigation. In these lessons, children carry a science investigation to answer their own scientific question, applying the key skills and content knowledge outlined for their year group. Children either plan, conduct or write up part of it to showcase their skills in this area. Impact Attainment descriptors are used to determine pupil attainment as either 'Working towards <', 'Working at =' or 'Working above >' age-related expectations for science. Once each term, class teachers will assess children against these descriptors, taking an average from the units covered and the investigations carried out within them. This will then be passed onto the science subject leader. The science subject leader will monitor the subject through work scrutinies; lesson dips; climate walks; and monitoring the profile of science through discussion with children, teachers and parents (if necessary).
<urn:uuid:e2325627-7108-4831-8a46-0ff37f985c1b>
CC-MAIN-2021-49
https://wickfordprimary.uk/wp-content/uploads/2020/12/Science-Statement.pdf
2021-12-08T19:07:50+00:00
crawl-data/CC-MAIN-2021-49/segments/1637964363520.30/warc/CC-MAIN-20211208175210-20211208205210-00400.warc.gz
673,960,574
610
eng_Latn
eng_Latn
0.997078
eng_Latn
0.997415
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 1886, 3392 ]
[ 4.46875 ]
1
0
ISSN: 2321 – 788X PATHA KAVITHA PITHAMAHA – ANNAMACHARYA R. Seethalakshmi Research Scholar, Dept. of Music, Queen Mary's College, Chennai – 4 Abstract Tallapaka Annamacharya (1408-1503) was a Hindu Saint of the 15th Century and the earliest known Indian Musician to compose songs called Sankirtanas in praise of Lord Venkateswara, the deity of seven hills in Tirumala, India where unbroken worship has been offered for over 12 centuries. The musical form of the Keerthana songs that he composed, which are still popular among the Carnatic music concutiartists, have strongly. Influenced the structure of Carnatic music compositions. Sri Annamacharya is remembered for his saintly life and is honoursed as a great bhakta or devotee of Bagawan govinda by devotees and saintly singers. He is believed to have been the reincarnation of the precious sword of Vishnu (Nandakam). He is widely regarded as the Andra Pada Kivita Pitamaha (Grand old man of Telegu Song Writing) Keywords: Tallapaka Annamacharya, Tirumala, Sankirtanas, Venkateswara, Annamacharya, Bagawan govinda, Nandakam, Andra Pada Kivita Pitamaha Personal life A rhyming couplet of poems called Dwipada written by Tallapakka Chinnanna, grandson of Annamacharya, enabled us to learn about the Saint Annamacharya, his life and works. Annamacharya was born on Vaishka Suddha Pournami in the year Sarwadari (May-91408) in Tallapaka, a village in current day kadapa district in Andrapradesh, India. He was born into a Nandavarika Smartha Brahavin family. He caller became a Sri Vaishnavaite Saint, Initiated by Venkatesha. His wife Timmakka, had written Subadrakalyanam, and is considered the first female poet in Telugu literature. Their son, Pedda Tirumalacharya and grandson, Tallapakka Chinnaiah were also composers are considered to have dominated the Influenced the structure of carnatic music compositions. Annamacharya lived for 94 years until Palguna Bagula Dwadashi (12th day after fullmoon) in the year Dundubi (1503). Tirumala Tirupathi Devasthanams have consecrated Annamacharya in two places, on is the Annamacharya mandiram located in the Annamacharya project office premesis at Tirupati and the other one in Annamacharya temple at tallapakka the birth place of Annamacharya. The evidences supporting the fact that Annamacharya in the Incarnation of the lord are found in chinnanna's dwipada. History of Annamacharya: It is believed that in the 10th century a big famine broke out in Varanasi and Scores of scholars migrated to southern part of India for earning their linelihoods. Some the them concentrated in the town called "Nandavanam" in Andra Pradesh which was ruled by Vol. 2 No. 1 the king Nanda. These Immigrants were called 'Nandavarikas' and Annamacharya's fore fathers were then so called Nandavarikas and hence Annamacharya. In the Duipada, the story of Annamacharya goes back three generations to his grandfather Narayana Ayya. It is told that Narayanaayya was blessed with the village goddess appeared before him and advised that a boy with an element of Hari or Vishnu would be born in the third generation of Narayanaayya. Birth of Annamayya: Narayana Suri, the Son of Narayanaayya, did not have children for a long time. Narayana Suri and him wife Lakkamamba visited Tirumala temple and while they were prostrating in front of the Holy Mast (Dwaja Sthamba) a dazzling brilliance from the Sword of lord Venkateswara stuck them like a lightening. Eventually a boy was born to them and they named him Annamayya. Annamayya became Annamacharya when the sage Ghana Vishnu at Tirumala converted him into a vaishnavaite at the age of eight. Literary Career: During his long and prolific career, Annamacharya composed and Sang 32,000 Sankirtanas, 12 Satakas (sets of hundred versers), (Some of the people says that Annamaya has composed 36,000 songs) Ramayana in the form of Dwipadas, Sankirtana Lakshmanan (Characterizes of Sankirtanas) Sringara Manjari, and Venkatachala Mahathmiyam. His works were in Telugu, Sanskrit and a few other languages of India. Chinnanna called the 32,000 Sankirtanas as 32,000 Manthas or Sarred Hymns. It was also recorded in Chinnanna's duripada that purandara dasa, who was 70 years younger to Annamacharya, heard about the miracles of Annamacharya and visited him. Purandara Dasa paid his respects to Annamacharya by calling him the incarnation of lord venkateswara and him Sankirtanas as Sacred Hymns. Annamacharya Considered his compositions as floral offerings to Bagavan Govinda. In the poems, he praises venkateswara, describes his love for him, argues and Quarrels with the lord, confesses the devotes failures and apprehensions and surrenders himself to venkateswara. His songs are classified into the Adhyaatma (spiritual) and Sringaara (romantic) Sankeertomes gerres. His songs in the 'Srigaara' genre worship Bagwaan Venkateswara by describing the amorous and romantic adventures of Venkateswara and Alamelmanga, while others describe the bakthi of his devotees. In this later keertanes, he espoceses subjects such as morality, Dharma and righteousness. He was one of the first few who opposed the social stigma towards the untouchable casters in his era, with his Sankeertamas explaining that the relationship between god and human is the same irrespective of the latter's colour, caste and financial Vol. 2 No. 1 status, in beautiful yet powerful usage of words is his songs "Brahmam Okkate Para Brahmam Okkatte" and "E Kulajudainanemi evvadiananemi". Annamacharya wrote the Sankirtanes on palm leaves and later his son Tirumalacharya got them engraved on copper plates. But for reasons not known, most of there Copper Plates lay hidden in a rock built cell opposite to Hundi in the Tirumala temple unnoticed for over 400 years. Next comes the some of the very famous songs of Annamayya In 1922, twenty five hundred copper plates comprising of about 14,000 Sankirtanas and a few other works, were found in a rock built cell, later named as Sankirtoma Bhandaragam, opposite to the Hundi. Conclusion: Ever since the discovery of this lost treasure Tirumala Devasthanas and other organizations in India are working hard to promote the music and literature of Annamacharya. His choice of words gives a mellifluous tone to his songs, charming the listener. His prodigious literary cauer earned him a place among the all time greats of Telugu literature. References 1. Murty, UA Narasimha. "Padam-Padyam: The Story of Telugu Poetry." Indian Literature 46.1 (207 (2002): 150-154. 2. Rao, B. Rajanikanta. "Andhra's Musical Heritage." Journal of the Indian Musicological Society 8.4 (1977): 35. 3. N_r_ya_ar_vu, V_lc_ru, Velcheru Narayana Rao, and David Shulman. Classical Telugu poetry: an anthology. Vol. 13. Univ of California Press, 2002. 4. Dalal, Roshen. Hinduism: An Alphabetical Guide. Penguin Books India, 2010.
<urn:uuid:75cde091-ff8f-4268-9b8c-01906bcd9d11>
CC-MAIN-2021-49
http://www.shanlaxjournals.in/pdf/ASH/V2N1/Ash_V2_N1_009.pdf
2021-12-08T18:10:11+00:00
crawl-data/CC-MAIN-2021-49/segments/1637964363520.30/warc/CC-MAIN-20211208175210-20211208205210-00402.warc.gz
127,384,324
1,829
eng_Latn
eng_Latn
0.986136
eng_Latn
0.987571
[ "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 2657, 5346, 6868 ]
[ 2.4375 ]
2
0
MAY IS ASIAN PACIFIC AMERICAN HERITAGE MONTH The following information is meant to assist with defining Asia and the Pacific Islands geographically. The term "Asian-American" is a catch-all term that did not gain currency until the late 1960s and early 1970s. It was not until 1980 that the Census Bureau created the "Asian and Pacific Islander" category. Although seemingly a geographic description, "Asian and Pacific Islander" contains racial overtones, given that natives of Australia and New Zealand are not included, nor are whites born in the Asian region of the former Soviet Union. According to Census 2000, the Asian-American population was 10.2 million, making up 3.6 percent of the country's population. ASIANS Following are the regions of Asia. Again, Russia is not included in the "Asian" group even though the country is on the continent of Asia. Eastern Asia includes China, Hong Kong, Japan, Korea, South Korea, North Korea, Macau, Mongolia, Paracel Islands, and Taiwan. South Central Asia includes Afghanistan, Bangladesh, Bhutan, India, Iran, Kazakhstan, Kyrgyzstan, Maldives, Nepal, Pakistan, Sri Lanka, Tajikistan, Turkmenistan, and Uzbekistan. Southeastern Asia includes Brunei, Myanmar (Burma), Cambodia, Indonesia, Laos, Malaysia, Philippines, Singapore, Thailand, and Vietnam. Western Asia includes Armenia, Azerbaijan, Georgia, Bahrain, Cyprus, Iraq, Israel, Jordan, Kuwait, Lebanon, Oman, Qatar, Saudi Arabia, Syria, Turkey, the United Arab Emirates, and Yemen. Note: Regions are defined by the U.S. Census Bureau. PACIFIC ISLANDERS The Pacific Ocean contains an estimated 20,000 to 30,000 islands (the exact number has yet to be precisely determined). Those islands lying south of the tropic of Cancer but excluding Australia are traditionally grouped into three divisions: Melanesia, Micronesia, and Polynesia. Melanesia means black islands. These include New Guinea (the largest Pacific island, which is divided into the sovereign nation of Papua New Guinea and the Indonesian provinces of Maluku, Papua and West Papua), New Caledonia, Vanuatu, Fiji, and the Solomon Islands. Micronesia means small islands. These include the Marianas, Guam, Wake Island, Palau, the Marshall Islands, Kiribati, Nauru, and the Federated States of Micronesia. Most of these lie north of the equator. Polynesia means many islands. These include New Zealand, the Hawaiian Islands, Rotuma, the Midway Islands, Samoa, American Samoa, Tonga, Tuvalu, the Cook Islands, French Polynesia, and Easter Island. It is the largest of the three zones. The region's islands are classified into two groups, high islands and low islands. Volcanoes form high islands, which generally can support more people and have a more fertile soil. Low islands are reefs or atolls, and are relatively small and infertile. Melanesia, the most populated of the three regions, contains mainly high islands, while most of Micronesia and Polynesia are low islands. There are also many other islands located within the boundaries of the Pacific Ocean, but these are not considered part of Oceania. These islands include the Galápagos Islands of Ecuador; the Aleutian Islands in Alaska; the Russian islands of Sakhalin and Kuril Islands; Taiwan; the Philippines; the South China Sea Islands; most of the islands of Indonesia; and the island nation of Japan, which includes the Ryukyu Islands. The inhabitants of these islands are not considered to be Pacific Islanders and are usually identified with their nearest continent.
<urn:uuid:8e9faaf9-f2a1-4d61-bfaf-b02c4009d533>
CC-MAIN-2021-49
https://www.nrcs.usda.gov/Internet/FSE_DOCUMENTS/nrcs142p2_006469.pdf
2021-12-08T18:47:09+00:00
crawl-data/CC-MAIN-2021-49/segments/1637964363520.30/warc/CC-MAIN-20211208175210-20211208205210-00402.warc.gz
980,591,780
782
eng_Latn
eng_Latn
0.973194
eng_Latn
0.983073
[ "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1262, 2564, 3518 ]
[ 2.6875 ]
1
0
Pricing Corn Silage S ilage is the harvest of whole corn plants at 60 to 70 percent whole plant moisture. Optimal harvest occurs when kernels are at 1/2 milk line to black layer. lower boundary price for negotiations with a livestock producer wishing to purchase and harvest a field as silage. The value of silage delivered to storage accounts for harvest and transportation costs incurred by either the crop or livestock farmer. The livestock farmer's interest is in knowing the cost of silage (on a dry matter basis) delivered to the feed bunk, after accounting for storage losses and shrink. Livestock farmers compare silage's delivered cost per ton against costs of other feedstuffs. Silage and other forage crops remove more phosphorus and potassium from the soil than grain crops. Removal of phosphorus and potassium can be an additional expense if the soils are low in those nutrients. But silage can also be used in intensive manure spreading areas to purposefully remove crop nutrients from the soil. In areas that have high concentrations of phosphorus and potassium and where runoff potential exists, planting silage can quickly remove excess nutrients. In addition, the rule of thumb may err in valuing silage because it does not take into account the dry matter percent of the silage. Dry matter percentage has a large effect on the value of silage to the livestock producer considering the purchase. Corn silage can be made from corn planted for silage or from corn planted for harvest as a grain crop. Frequently corn harvested for silage was planted for harvest as a grain crop. Farmers have several reasons to reconsider their harvest method. They or a neighbor may have a need for silage that was not anticipated at planting time. Drought may have reduced grain yields substantially so the value of the crop is greater as silage than for grain. Farmers have priced silage using the rule of thumb that silage value per ton is 8 to 10 times the price of a bushel of corn. A factor of 8 to 9 times is used to price silage in the field; the factor of 9 to 10 times is used for pricing it in storage. A higher factor is used for lower priced corn and a lower factor for higher priced corn. This rule of thumb needs to be reconsidered given current corn and input prices. Currently, silage priced in the field may be closer to 7 times the price of a bushel of corn. This guide is intended to help farmers estimate the breakeven price needed to justify harvesting a corn crop as silage rather than for grain. The estimated breakeven price of the standing crop becomes the corn farmer's Ray Massey Joe Horner , Professor, Agricultural Business and Policy Extension , State Specialist, Agricultural Business and Policy Extension Figure 1. Agricultural producers should consider the current price of corn and inputs for pricing corn silage. Important factors affecting the breakeven price of silage are the price of corn, the expected grain yield of the growing crop and who incurs the costs of harvest and transportation of the silage. A spreadsheet to facilitate a silage value estimation can be downloaded at https:// extension.missouri.edu/publications/g4591. Livestock producers price feed and balance rations on a dry matter basis. This guide shows how to convert the wet basis value to a dry matter value. This guide focuses on the wet basis price of silage. Determining the breakeven price of silage on a wet basis - as it stands in the field - is most normal for grain farmers and for estimating handling and storage costs. Pricing silage in the field Crop farmer perspective: The value calculated is the breakeven price for harvesting as grain or as silage. Negotiate a price for a standing field of grain greater than or equal to this price. Livestock farmer perspective: Recognize that this is the lowest price a crop producer is willing to sell a standing field of grain. Consider the costs of the harvest, transport, storage and use to determine whether this price makes sense for a feedstuff. The basic principle of pricing a crop harvested as silage rather than grain is to estimate the value of the grain in the field, and make additions and subtractions to the value depending on the impact of changing the harvest method. Negotiations between crop and livestock farmers can proceed with this breakeven price in mind. crop themselves with their own equipment. In this situation, because the crop farmer does not incur a harvest cost, the breakeven price of the standing crop is reduced by the cost of grain harvest. Begin calculating the value of the standing grain by first estimating bushels of grain per acre. Yield per acre can be estimated from harvesting a sample area of the field. A few rows can be left throughout the field for later grain harvest to determine yield per acre. Alternatively, harvesting by hand the grain from 174 feet of corn planted in 30-inch rows gives an estimate of the grain yield of 1/100th of an acre. Multiple the grain yield from the sample by 100 to estimate the yield per acre. Silage also removes more biomass – removing more phosphorus and potassium from the soil. The value of the standing crop is increased by the value of nutrients removed by the whole plant versus just the grain. If small plots are harvested by hand with no yield loss, a one to four percent allowance for harvest loss should be deducted from the calculated yield. Choose an estimate that fits your experience in harvest loss. Silage harvest requires specialized equipment. Because silage choppers and wagons are not found on many grain farms, livestock producers who purchase standing corn crops for making silage may harvest the Table 1 presents a process for valuing a growing crop that may be harvested as silage. A breakeven price between harvesting corn for grain or silage is needed. Start by estimating the harvest time market price likely to be received if the corn is harvested as grain. Decrease this price by subtracting the costs such as combining, Table 1. Calculation of silage price for corn standing in field using estimated yield. 1. From harvest of test rows (or from harvest of plots minus 1 to 4 percent estimated harvest loss). 2. Divide custom charge per acre by expected yield to obtain a per bushel cost. 3. Value of phosphorus and potassium removed in forage portion of plant. trucking and drying that will not be incurred by the crop farmer if the crop is harvested as silage by the livestock farmer. Convert any per acre costs, such as grain combining, to a per bushel basis. Increase the price by the cost of additional nutrients that will be extracted because harvesting as silage removes more biomass. Two conversions of the value per acre may be important to the livestock producer. First, the value per ton of silage can be obtained by dividing the value per acre by the expected number of tons of silage to be harvested. Information from Table 2 can be used to estimate the tons of silage expected for various grain yields. Multiply this breakeven corn grain price by the estimated yield to get a value per acre of the standing crop. Table 2. Relationship between grain and silage yield. Source: Lauer and Undersander (2004). The livestock producer may also benefit by knowing the value of the silage on a dry matter basis. To obtain a dry matter value, divide the wet basis price value by the percent dry matter in the silage. Silage moisture content can vary considerably and the variability can affect the dry matter value of silage. Pricing silage delivered to storage Crop farmer perspective: If the crop farmer harvests and delivers the silage to the livestock farmer storage structure, the value calculated is the breakeven price for harvesting as grain or delivered silage. Negotiate a price for harvested and delivered silage greater than or equal to this price. Livestock farmer perspective: If the livestock farmer harvests and transports the silage from a standing corn crop, this step is an intermediate step to determine what can be paid for the silage. Variable costs of storage, shrink and transport to the feed bunk are still needed to determine whether this price makes sense for a feedstuff. When estimating the breakeven price of chopped silage delivered to silage storage, costs of chopping and hauling must be added to the value of the standing crop. Relevant units change from bushels of grain to tons of silage per acre. Table 3 presents steps needed to take the results of Table 1 and estimate the value of silage delivered to storage. Custom silage harvest and transportation are usually priced on wet basis dollars per ton. The costs of harvest and delivery vary substantially depending on hauling distance, type of equipment and volume of silage. Table 3. Calculation of silage price delivered to storage. Custom rates for harvesting and delivering silage are typically charged on a wet basis. It is simplest to compute a wet basis price of silage delivered to the storage structure. Pricing silage delivered to feed bunk Crop farmer perspective: This information is not normally used by a crop farmer whose typical interest stops at delivering a product to a user. Livestock farmer perspective: Estimated price of silage, when converted to a dry matter basis, provides the point of comparison to other feedstuffs available. The livestock producer needs to estimate the dry matter price of silage to make wise feeding decisions. Livestock farmers are interested in cost of silage as a feed delivered to their animals. To estimate the cost of silage delivered to the feed bunk, several additional costs need to be considered. The process is summarized in Table 4. All added costs are made on a wet basis because that is a more common way to estimate silage cost. Livestock producers compare feedstuffs on a dry matter basis. Once a wet basis cost of procuring and using silage is estimated, convert it into a dry matter cost by dividing by the percent dry matter in the silage. costs will vary with type of storage structure. Estimate only the additional costs of handling the silage relative to using other feedstuffs. Table 4 begins with the estimated silage value from Table 3 and adjusts for storage losses and handling costs. Dry matter silage value is of most value at this step because the livestock producer needs to compare it to the cost of other feed stuffs available. Drought-damaged corn Drought-damaged silage results when the growth of most plants is stopped at an immature stage and grain yield is drastically reduced. Drought-damaged silage usually has 80 to 90 percent of the feed value of highgrain corn silage per unit of dry matter if the moisture content of the crop is 70 percent or less when harvested. If moisture content is much above 70 percent, silage tends to be unpalatable and have lower feed value. The costs of dry matter loss and shrink during storage need to be considered. Table 5 contains research estimates of dry matter loss for various storage types. While permanent storage structure costs are not considered in Table 4 computations, it is obvious that different storage structures have varied storage losses and are an important decision for livestock producers wishing to feed silage to their animals. The variable costs associated with storage (e.g., silage bags, bale wrap or silage cover) are added to the price of silage initially delivered to storage. Cost of permanent storage is not added as it is already a sunk cost that does not change with the decision to buy additional silage. When drought causes yield reduction of 20 to 40 percent below normal, the silage produced appears to be equal to much higher yielding corn, but tons per acre are reduced proportionally. Handling cost of removing silage from storage and delivering to the feed bunk needs to be added. Handling Drought stressed corn silage may contain aflatoxin or other mycotoxins that can become worse with improper moisture at ensilaging or lack of proper packing. Dairy producers need to avoid aflatoxin contaminated silage as aflatoxin detection in milk can lead to milk rejected by processors. Segregating suspect silage supplies for further quality control sampling before feeding is a good practice in drought years. Table 4. Calculation of silage value delivered to the feed bunk. Table 5. Estimate of silage losses during filling, storage and feed out. Source: Holmes and Muck (2000). Silage value to the crop producer versus livestock feeder The livestock farmer will be interested in the cost of silage delivered to livestock, which can be compared to other feedstuffs. Cost of silage delivered to livestock estimated in this guide does not value the silage on its nutrient content. It is simply an estimate of its cost relative to harvesting the crop as grain – an estimate of an opportunity before the livestock farmer. The feed value of silage would be established by comparing it to alternative feedstuffs and rations that provide similar nutrients. This guide has looked at breakeven silage prices at three stages. The breakeven price of the standing crop is important information for the crop farmer choosing between harvesting as a grain crop or allowing a livestock producer to harvest as silage. The breakeven price of silage delivered to storage is important information for whoever incurs the costs of silage harvest and transportation to storage. Each of these estimates are probably best understood on a wet basis value. This guide estimates the breakeven price of silage for a mid-season opportunity to change harvest to silage rather than for grain. Because this is a short-term decision, only additional and reduced costs associated with harvest as silage are important. A crop farmer wanting to build a longer-term business as a corn silage supplier to a livestock farmer faces a different set of concerns. Selection of silage corn varieties, optimal harvest maturity and ownership of silage harvest equipment can add feed value to silage. Livestock farmers may be interested in contracting with crop farmers who will regularly supply them with silage. Costs for producing corn silage can be found in MU Extension publication, G664, Corn Silage Planning Budget (https://extension.missouri.edu/publications/ g664). For the livestock farmer, the fact that the silage decision under consideration in this guide is short-term means that the cost of owning silage storage is not a factor in estimating silage cost. Only the incremental costs of acquiring, storing and feeding silage are important at this time. Sources Lauer, J. and D. Undersander. 2004. Pricing corn silage for sale. In Proceedings and Joint Meeting of the Professional Nutrient Applicators of Wisconsin, Wisconsin Custom Operators and Wisconsin Forage Council. Eau Claire, WI. p. 87–91. Holmes, B.J. and R.E. Muck. 2000. Preventing Silage Storage Losses. University of Wisconsin.
<urn:uuid:701e8a69-534a-4e59-9604-bac2d16a59bf>
CC-MAIN-2021-49
https://extension.missouri.edu/media/wysiwyg/Extensiondata/Pub/pdf/agguides/crops/g04591.pdf
2021-12-08T18:05:21+00:00
crawl-data/CC-MAIN-2021-49/segments/1637964363520.30/warc/CC-MAIN-20211208175210-20211208205210-00403.warc.gz
313,261,118
3,062
eng_Latn
eng_Latn
0.995493
eng_Latn
0.997156
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 3556, 6373, 9029, 12363, 12470, 14958 ]
[ 3.25 ]
3
0
Northwood School Academic Program 2021-2022 Phase One: Core Subject Selections Northwood School's Academic Philosophy and Approach to Education The Northwood School academic philosophy builds on the school's mission and serves as the foundation for all aspects of the curriculum. Northwood School prepares students to shape the future. We engage students in the active pursuit of knowledge and believe that students learn best through exploration and inquiry. Students gain resilience, become independent thinkers, and challenge perspectives by forming relationships with their teachers and peers. The Northwood experience is rooted in the Adirondacks and creates confident, globally-minded students, ready to innovate and adapt to our ever-changing world. At the core is a broad and challenging college-preparatory curriculum that includes a variety of Honors and AP courses. Building on the Northwood academic experience, students explore areas of interest with academic programs designed to strengthen intellectual abilities, promote character development and advance interests in specific subject areas. Graduation Requirements The graduation requirements outlined on the following page must be met in order to earn a Northwood diploma. Five academic courses are the standard load for Northwood students. Students are urged to challenge themselves academically which, for many, means taking courses well beyond those required for a diploma. Northwood strongly recommends that students take a rigorous academic program for personal growth as well as for the practical purpose of increasing college options. Graduation Requirements The minimum number of credits required for graduation is 60. A year-long course earns 3 credits, a trimester elective earns 1 credit. Northwood School Phase One Course Offerings: 2021-2022 Honors and Advanced Placement Courses In order to qualify to take AP or Honors-level courses, students must have earned honors grades (a minimum grade of a B+ in the prerequisite Honors course) and have made effort grades of Good or Excellent. Teacher recommendations are also required for placement. Exceptions to these guidelines will only be made for special circumstances and after consultation by the current teacher, the Department Chair, and the Dean of Academic Affairs. All students taking AP courses must take the National AP exam for that course. If a student fails to take an AP exam, he/she may not have the AP name placed on his/her transcript at the end of the year and will lose the course weighting. Humanities Department (Core Subjects: English, Social Science, World Languages) Integrated Humanities 9th and 10th Grade Students All 9th and 10th grade students will be enrolled in an integrated humanities course which counts towards both English and Social Science credits. In combining traditional English and History courses, Integrated Humanities offers a more comprehensive understanding of both literary works and historical events. Students will become familiar with the systems of thought and human organization that have shaped both larger decisions of society and the details of everyday life. Students will examine important historical events and turning points while also exploring artwork and literature vis-à-vis historical points of view. Emphasis will be on analytical skills as well as personal connection to texts. Exploring the ideological context of the ancient and modern world will serve to not only facilitate deeper content knowledge, but a better understanding of the connection between culture and current events. The course will be inquiry-driven and include project-based and collaborative work, emphasizing the mastery of core communication, research and writing skills to prepare students to be independent learners. 11th Grade - PG Students A.P. English Literature and Composition Prerequisites: honors grades in previous courses and teacher recommendation. Offered in alternate years, the AP English Literature and Composition course focuses on reading, analyzing, and writing about imaginative literature (fiction, poetry, drama) from various periods. Students engage in close reading and critical analysis of imaginative literature to deepen their understanding of the ways writers use language to provide both meaning and pleasure. As they read, students consider a work's structure, style, and themes, as well as its use of figurative language, imagery, and symbolism. Writing assignments include expository, analytical, and argumentative essays that require students to analyze and interpret literary works. The course culminates in the A.P. exam in May. Welcome to the 2021-2022 Short Course English offerings! Northwood allows for more student choice in the upper-level English offerings. This is designed to allow you to pursue areas of interest once basic subject skills have been mastered. As you will see from the varied and exciting options below, this approach also allows for teachers to dive deeply into their passions and areas of expertise, ultimately benefiting YOU! Important Points: * A combination of any three short courses fulfills a full year of English requirement. * All of the below classes may also be taken as electives (beyond the English requirement). * All short course offerings meet equal standards of rigor. * Please read the offerings carefully as many mention specific projects or studies that may pique your interest! Process of Selecting Courses: 1. After perusing the offerings below, you will choose the options you like. 2. Keep in mind that you are selecting now for the entire year. 3. You will be placed in a course depending on space availability and your own schedule constraints. 4. More than one section of a popular course may be offered. 5. Priority in classes that fill up will be offered first to PG students and 12 th graders, then to 11 graders. th 6. Priority will also be given to those enrolling to meet their English requirement over those enrolling as electives. English English Course Short Offerings Descriptions 1. The Black Experience in Literature The Black Experience in Literature course provides insight into the Black experience through readings from King, DuBois, Wright, Brooks, Lorde, Baldwin, Hansberry, Sanchez, and Baraka. Students will discuss issues ranging from the relationship between literature of the African American experience and mainstream literature to key concepts of ethnic diversity and cultural inclusion. We will also evaluate literary works through multiple critical methodologies and write thesis-driven essays using the literature as a primary source. 2. The Contemporary American Novel This course will examine selected works of American fiction published over the last four decades, with an emphasis on the relationship between contemporary American literature and the world we live in. What does it mean to read and write literature in the digital age? Possible readings will feature authors such as Cormac McCarthy, Celeste Ng, Colson Whitehead, Margaret Atwood, and Kazuo Ishiguro. 3. The Content of Our Character This is a reading-based course that will include five classic books, each exploring one of Northwood's core values: Respect, Responsibility, Courage, Compassion and Integrity. One of the culminating projects of this course will be a service project for the community. 4. Facing Adversity This course will explore the literary, psychological, philosophical, and emotional components of the way people face difficulty in their lives. Readings will include well-known stories like "Endurance" (Shackleton's Antarctica voyage), literary masterpieces like One Day in the Life of Ivan Denisovich, contemporary autobiography like When Breath Becomes Air, with lessons by Martin Luther King, Maya Angelou, Victor Frankl, and Rollo May. We'll also do two projects. One is an outdoor experience to help students reflect on the nature of adversity from personal experience. The second is an interview and write-up of a person who has faced or is facing significant adversity. 5. From Word to Essay This course will look at the English language as a tool for exploring our place in the world. From word choice, through sentence design, paragraph building and, finally, essay writing, students will get to better understand how deliberate and concise language use helps us both form understandings and communicate with others. On one end, the class will cover structural grammar and at the other end will read and evaluate great non-fiction writing. Students will build and maintain a website for writing hints, good samples, and the publication of their work. 6. Literary Themes and Analytical Writing This course will focus on core reading and writing skills needed for upper-level high school and college English courses. Designed as a survey course, students will engage with both fiction and nonfiction works, from short stories and essays to full-length works. Emphasis will be on comprehension and interpretation as well as reinforcing the skills of clear written and spoken communication. Students will be expected to write descriptive, expository, analytical and persuasive essays throughout the term. Students may elect to take this course or may be recommended for it. 7. Nonfiction Reading and Writing This course will cover a selection of readings from mostly American writers of the 20th century, including long-form journalism like that found in The New Yorker, relatively personal forms of journalism (Joan Didion, Norman Mailer, Tom Wolfe), critical writing (Arthur Danto, Pauline Kael, Camille Paglia, John Leonard, Susan Sontag), memoir (N. Sott Momaday, Jane Brox), and "popular" genres (sports, Red Smith; travel, Bruce Chatwin; food, M.F.K. Fisher). Writing exercises will include personal essays and emulations of the styles of some of the writers studied. 8. Philosophy and Literature 1 (Truth & Beauty) The first trimester of Philosophy and Literature will focus on the nature of truth. We will, in the trimester's first half, study short passages from three of the world's greatest philosophers (Plato, Descartes, and William James) and read poetry and fiction that deals with the questions they raise about the nature of truth. One element of the course will be actual formal debates. In the second half of the term, we will focus on beauty and art, applying the thoughts of Dewey, Tolstoy, and Santayana to everything from literature to paintings and sculpture to rap music. 9. Philosophy and Literature 2 (Goodness & Commitment) The second trimester of Philosophy and Literature will consist of two units. The first will focus upon goodness. After studying the thoughts of Aristotle, Kant, and Buber, we will read poetry and short stories and study three films (Do the Right Thing, The Unforgiven, and Crimes and Misdemeanors). The second unit will cover commitment; for this section, we will study the philosophers Sartre, Stace and Niebuhr and two plays: Antigone and The Skin of Our Teeth. 10. Short Fiction Short Fiction will focus upon reading and writing about some of the greatest novellas and short stories ever written. All will explore a significant moral issue. Authors studied include Joseph Conrad, Herman Melville, Flannery O'Connor, John Steinbeck, Charlotte Gilman, Ivan Bunin, and Stephen Crane. This course is for those who love thought, discussion and debate. 11. Twentieth Century Poetry Twentieth Century Poetry covers controversies, form and technique of the century through the study of its literary movements, major poets, and communities. We will read selections from the early twentieth century, Imagists, Modernists, Objectivists, Formalist, midwestern, mid and late century American, Native American, and African American and more. Students will also develop their creative writing skills with original composition and further develop their written skills in literary criticism, conventions, and terminology appropriate for the genre. 12. Understanding Shakespeare: The Nature of Performance This course will explore Shakespeare's plays with a focus on his tragedies. Possible readings include Hamlet, Julius Caesar and Macbeth as well as selections from Shakespeare's sonnets. We will watch performances in class and stage moments of the plays ourselves to gain greater insight into the way that plays make meaning. Additionally, we'll study Shakespeare's drama through both primary and secondary texts. The course is suitable for students with little or no prior knowledge of Shakespeare and also for those wishing to become more familiar with the playwright's work. 13. The Voice of Toni Morrison Winner of the Pulitzer Prize for Fiction and the Nobel Prize for Literature, Toni Morrison, who passed away in August of last year, ranks as one of America's greatest novelists. As Mason Stokes, a scholar of Toni Morrison, says, "Her work explores contradictions that lie at the heart of American identity: the love of freedom in a country founded on slavery; the fact of racial bigotry in a country allegedly dedicated to equality; and the role of community in a country that worships the individual." In this course, we will focus on understanding Morrison's complex American experience through a selection of her novels, most likely including The Bluest Eye, Sula, and Beloved. We'll also read excerpts from her nonfiction work, Playing in the Dark, as well as a selection of scholarly criticism. 9th and 10th Grade Students See Integrated Humanities above. 11th Grade - PG Students U.S. History is a required course for graduation. All 11th grade - PG students will take U.S. History or A.P. U.S. History if they have not already done so. United States History United States History introduces students to the study of American History. Examination of Colonial British North America, the American Revolution and framing of the Constitution shape our early study. Important themes from this material will then be examined throughout the remainder of the course. Students will develop an understanding of American history and improve their essential communicative and critical thinking skills through emphasis on writing, the formation of historical arguments, and development of analytical reading skills through a variety of media. Film, online databases, books, online journals, and academic web resources expose students to a wide spectrum of opinions and views on American history. From this, students will form their own opinions and produce original work. A.P. United States History Prerequisites: honors grades in previous course and teacher recommendation. This AP course is the equivalent of an introductory level college survey course. It will emphasize the skills, themes, and time periods of American history as laid out by the College Board in their recent curriculum redesign. Students will learn a significant volume of material through classroom instruction as well as independent learning. Through the year, students will familiarize themselves with the issues surrounding the settlement of, development of, and rise of America. Topics include the evolution of Colonial British North America, the American Revolution and Constitution, the growth and expansion of the nation during the 19 th century, the rise of industry in the late 19 th century, Secession, Civil War, and Reconstruction, the evolution of equality, and major historical issues of the 20 th century. A.P. World History: Modern Prerequisites: honors grades in previous courses and teacher recommendation. The course is an introductory college-level modern world history course. Students cultivate their understanding of world history from c. 1200 CE to the present through analyzing historical sources and learning to make connections and craft historical arguments as they explore concepts like humans and the environment, cultural developments and interactions, governance, economic systems, social interactions and organization, and technology and innovation. Social Science A.P. Psychology Prerequisites: honors grades in previous courses and teacher recommendation. This AP course provides an overview of current psychological research methods and theories. Students explore the therapies used by professional counselors and clinical psychologists and examine human reactions: how people learn and think, the process of human development and human aggression, altruism, intimacy, and self-reflection. Students study the core psychological concepts, such as the brain and sense functions, and learn to gauge human reactions, gather information, and form meaningful syntheses. The equivalent of a 100-level college survey course, AP Psychology prepares students for further studies in psychology and life sciences. To help prepare students for the AP exam, each unit exam is designed to replicate the AP Psychology exam. Students also participate in a variety of experiments. These range from quick in-class exercises to replications of famous experiments to self-designed experiments. Advanced Humanities Research Program The Advanced Humanities Research Program provides a platform to engage in independent research within the fields of history, literature, the arts and social sciences. Students with a deep interest in one of these areas will design and implement their own research projects throughout this year-long course. By pursuing preliminary research on their topic of interest, and then generating their own focus questions and ultimately their own study design, students will develop the mastery to critically think about the world. Formal presentations of the results at the end of the year will further develop the students' communication and critical thinking skills. Enrolled students must hold a genuine interest in the humanities and a deep desire to conduct independent research. Depending on the students' interests, mentorships with regional experts may be arranged to support the student with expert advice and exposure to a higher level of academic engagement. Placing a special emphasis on research directly related to the unique institutions and history within the Adirondack Park will further develop the relationship between Northwood School and the community and foster in these young researchers a deeper awareness of their surroundings. Prerequisites: Honors grades in history courses required. Successful completion of an AP history course is beneficial. Interested students must fill out an application to be considered for the course. Enrollment is limited. World Languages Spanish I Spanish I provides a foundation for the development of skills in listening, speaking, reading and writing. Students are encouraged to communicate in Spanish for practice in speaking and listening. The course covers basic vocabulary that allows students to communicate effectively by asking and answering question, describing situations, and expressing needs. Students learn a variety of grammatical concepts so they can communicate in the present and future tenses. As the year progresses, we build on a foundation in vocabulary and grammar to develop reading and writing skills. Students gain appreciation of the cultural diversity within Spanish-speaking countries as they reflect on their own perspectives and experiences. Students also engage in a variety of authentic celebrations that foster appreciation of other cultures. Spanish II Prerequisites: Spanish I. In addition to reinforcing and broadening listening comprehension, speaking, reading and writing skills, this course integrates cultural and historical information about the Spanish-speaking world through short stories, news articles, and poems. In this course, students explore the subtleties of language with an emphasis on the differences between the imperfect and preterite tenses and between the prepositions por and para. Students are expected to communicate in Spanish through sustained speech and are required to write short essays using compound and complex sentences in the imperfect, progressive, present, and preterite tenses. Spanish III Prerequisites: Spanish II. Spanish III continues the building of competence in the language by adding to the students' command of verbs with progressive and perfect constructions, the conditional mood, and imperatives. Sub-units of study look at subtleties in the management of interrogatives and their related adverbial forms; conjunctions; prepositions; and reflexive and object pronouns. Short poems committed to memory—one poem per trimester—give students a lasting acquaintance with the work of some revered writers and serve as a platform for focused refinement of pronunciation skills. Short stories and news items provide authentic reading experience and material for discussion. Films of various lengths, both narrative and documentary, provide listening practice and further material for discussion. Podcast-style audio projects, undertaken in small groups, provide practice in the composing and editing of narrative and descriptive text and in presentational speaking. Spanish IV/V (Honors) Prerequisites: Spanish III or IV with grades of B. This is an advanced honors-level Spanish class for students who have mastered the skills taught in levels I, II, and III, and who have earned at least a B grade. Advanced grammatical skills are reviewed throughout the year in addition to readings of sophisticated literature, compositions, comprehension-based activities, and group projectbased learning. Authors include García Lorca, García Márquez, and Neruda. French II Prerequisites: French I. This course is a continuation of first year French. It strives to cultivate a true interest in French language and culture. Through building on the basics of French I skills, French II enables students to communicate in simple sentences in spoken or written French. It also widens students' worldviews by introducing them to French speaking cultures. French III Prerequisites: French I, II. This course is a continuation of French II. It is designed to broaden the student's outlook on life and the world around him/her. It opens doors to future career choices: it helps students learn about themselves as they become more aware of others, and it aids in communication skills. All basic verb tenses are studied, vocabulary acquisition is emphasized, and daily speaking and listening are an essential part of the course. Students write short compositions in French. French IV / V (Honors) Prerequisites: French I, II, III. This is an advanced honors-level French class offered to qualified students who show genuine interest in mastering the language and understanding the culture. Classes are given in French entirely. During the early part of the year, emphasis is placed on grammar review, verbal expression using basic vocabulary and reading short stories. Later in the course, we concentrate on more difficult grammatical concepts, more sophisticated vocabulary and reading French literature. Throughout the year students are required to present their work both orally and/or in written form. Additional World Languages Some of our students choose to study additional languages online. We have worked with Middlebury Interactive Languages and One Schoolhouse to oversee Mandarin, Latin, German, and AP Spanish courses. STEM Department (Core subjects: Sciences, Mathematics) Sciences Geology Prerequisites: none. Geology investigates the structure of the earth with a focus on landscapes in the Adirondack Park. Topics include Earth's formation, plate tectonics, minerology, weathering/erosion, mountain building, and surface geomorphology. Field trips are an essential component of this course. Local topographic features, including rocks in the High Peaks and Ausable River, will be studied in the field. The course concludes with a scenic flight giving students a bird's eye view of topics students have studied all year. Biology Prerequisites: none. Biology includes the basic concepts of life science with an emphasis on how they relate to the ecosystems in the Adirondack Park. Topics include ecology, chemistry of life, cellular structure and function, genetics, and human systems. Field trips, critical thinking activities, laboratory exercises and classroom discussions reinforce the topics covered. The sixmillion-acre Adirondack Park serves as nature's classroom for this course; the woods, lakes, rivers, and mountains provide unique learning opportunities for students. Chemistry Prerequisites: biology and must be enrolled in Algebra II. Chemistry develops a foundational understanding of major concepts in the field such as atomic theory, periodic law, chemical bonding, and stoichiometry. Critical thinking activities, laboratory exercises, and classroom discussions about chemistry in our everyday lives reinforce this knowledge. Students also gain experience writing lab reports, solving practical problems, and analyzing experimental data. Honors Chemistry Prerequisites: honors grades in biology and math, enrolled in Honors Algebra II, and teacher recommendation. Honors Chemistry introduces the basic concepts of chemistry. The course also provides laboratory experience to develop students' experimental and problem-solving skills and prepares students for college chemistry courses by covering topics in more detail. Topics covered include matter, atomic theory, electrons, chemical bonding, nomenclature, mole concepts, chemical reactions, stoichiometry, gas laws, molecular structures, solutions, equilibrium, acidbase reactions, redox, and nuclear chemistry. Physics Prerequisites: biology, chemistry, and must be enrolled in Pre-calculus. Physics develops the student's observational and analytical problem-solving skills. Theoretical concept development is emphasized along with problem-solving and laboratory skills. A background in algebra is assumed, and trigonometric concepts are needed components of our study. The course covers classical mechanics including kinematics (the description of motion in one and two dimensions), dynamics (the causes of motion, Newton's laws of motion), and the conservation laws (energy and momentum). In addition, we study topics selected from statistics, waves, sound, and light. Several projects through the year integrate physics principles with elements of engineering and technology. Honors Physics Prerequisites: honors grades in math and chemistry, enrolled in Honors Pre-calculus, and teacher recommendation. The course moves at a faster pace than Physics and covers the following material in depth: classical mechanics including kinematics (the description of motion in one and two dimensions), dynamics (the causes of motion, Newton's laws of motion), and the conservation laws (energy and momentum). In addition, we study topics selected from statics, waves, sound, and light. Several projects through the year integrate the physics principles studied with engineering and technology to achieve a deeper understanding of the topics. Environmental Science Prerequisites: biology. Environmental Science is a broad scientific survey course designed to garner a holistic perspective and improve the student's ecological literacy. The goal is to ignite systems thinking and develop the skill set needed to discover answers and analyze options, and to use ecological systems as a successful model to help us deal with environmental issues. This perspective and the accompanying skills help build a framework for decision making for use throughout life. The Adirondack park serves as an extension of the classroom for this course. Human Biology Prerequisites: biology and one other lab science. Human Biology takes a hands-on approach to learning the structure and function of human body systems. The course aims to expand the student's current knowledge of how the human body works by studying the major body systems leading to an understanding of how their daily activities affect their health now and in the future. Students will also relate how disease leads to loss of functioning in the systems. Labs include dissections of a number of major animal organs. Students will also have the opportunity to get American Red Cross First Aid and CPR certified upon successful completion of the First Aid unit. A.P. Environmental Science Prerequisites: honors grades in biology and chemistry, and teacher recommendation. The AP Environmental Science course is the equivalent of a one semester, introductory college course in environmental science; it includes geology, biology, ecology, chemistry, economics, sociology, politics and geography. Classes include lectures, hands-on activities, student presentations, labs, fieldwork, class discussions, group projects, films and guest speakers. The key themes of the course are sustainability, energy transfer, interactions between earth systems, species and the environment. The first trimester explores how these themes play out in ecosystems while the second and third trimesters investigate how humans have altered the environment and are working to find solutions to address the negative impacts of humanity. While designed to prepare students for the AP exam, the course fundamentally creates systems thinkers and holistic problem solvers. The Adirondack park serves as an extension of the classroom for this course. A.P. Biology Prerequisites: honors grades in biology and chemistry, and teacher recommendation. Offered to qualified students who have successfully completed biology and chemistry with a record of high achievement in the sciences. AP Biology is a challenging full-year college-level introduction to the study of biology. The course examines life from the molecular and cellular levels through organisms, genetics, and evolution. Throughout the year, students will develop advanced inquiry and reasoning skills, such as designing a plan for collecting data, analyzing data, applying mathematical solutions, and connecting concepts in and across areas of study. All students must take the national AP Exam in May. Advanced STEM Research Program The Advanced STEM Research Program provides a platform to engage in independent research within the fields of biological sciences, physical sciences, behavioral sciences and engineering. Students with a deep interest in scientific discovery will design and implement their own research projects throughout this year-long, A.P. equivalent-level course. By engaging in literature research, generating a testable hypothesis, implementing an experiment and analyzing the results, students will develop the mastery to critically think about the scientific world. Formal presentations of the results at the end of the year will further develop the students' communication and critical thinking skills. Enrolled students must hold an interest in problem solving and a deep desire to conduct independent research. Depending on the students' interests, mentorships with regional scientists may be arranged to support the student with expert advice and exposure to a higher level of academic engagement. Placing a special emphasis on research directly related to systems within the Adirondack Park will further develop the relationship between Northwood School and the community and foster with these young scientists a deeper awareness of their living environment. Prerequisites: Honors grades in chemistry required. Successful completion of an AP Science course is beneficial. Interested students must fill out an application to be considered for the course. Enrollment is limited. Mathematics Algebra I This is a first-year algebra course in which students learn to reason symbolically. The key content involves writing, solving, and graphing linear and quadratic equations, including systems of two linear equations in two unknowns. Quadratic equations are solved by factoring, completing the square, graphically, or by application of the quadratic formula. The course also includes study of monomial and polynomial expressions, inequalities, exponents, functions, rational expressions, ratio, and proportion. Algebraic skills are applied in a wide variety of problem-solving situations. Geometry Prerequisites: Algebra I. In this course, students' study two- and three-dimensional shapes and their relationships in plane and space. It is a visual as well as analytic subject, integrating spatial and numerical concepts. Students classify and describe shapes in terms of congruence, similarity, and transformations. The course introduces students to different forms of mathematical logic, including inductive and deductive reasoning. Students solve measurement and algebraic problems using properties, proportions, and trigonometric relationships. Algebra is reviewed with geometric applications. Algebra II Prerequisites: Algebra I. Algebra II is intended to help students enrich their skills and develop more concepts beyond basic algebra as they prepare for higher level math courses. This course is designed to help students apply the mathematics they learn in the classroom to real world situations, communicate mathematically, and use technology appropriately. Topics that connect various areas of mathematics to algebra, geometry and trigonometry will be studied. Students will study real numbers, operations, and patterns as they extend their understanding of algebraic concepts. They will work with complex numbers, logarithms, polynomial functions, systems of equations and inequalities, transformations, and mathematical models. Honors Algebra II Prerequisites: Honors grades in earlier courses and teacher recommendation. This course is designed for students who have demonstrated exceptional ability and motivation in math. This course is designed to help students apply the mathematics they learn in the classroom to real world situations, communicate mathematically, and use technology appropriately. Topics that connect various areas of mathematics to algebra, geometry and trigonometry will be studied. Students will study real numbers, operations, and patterns as they extend their understanding of algebraic concepts. They will work with complex numbers, logarithms, polynomial functions, systems of equations and inequalities, transformations, and mathematical models. Pre-Calculus Prerequisites: Algebra II. Pre-calculus builds upon mathematical and analytical concepts introduced in Algebra II and prepares students for upper-level mathematics courses, both at the secondary and collegiate levels. Students study linear, quadratic, polynomial, rational, exponential and logarithmic functions, analytic geometry, triangle trigonometry and trigonometric functions, complex numbers, probability, and statistics. Honors Pre-Calculus Prerequisites: Honors Algebra II or honors grades in previous courses and teacher recommendation. This course is designed to provide students with a strong foundation of precalculus concepts, techniques, skills, and applications necessary to succeed in upper-level mathematics courses, both at the high school and college levels. Students will develop quantitative reasoning and problem-solving skills by being active learners and expanding their ability to analyze and interpret given information. Students will develop the ability to understand and communicate mathematical ideas effectively and develop an appreciation of the wide range of mathematical applications and opportunities in the world around us. Calculus Prerequisites: Pre-calculus, honors grades in earlier courses and teacher recommendation. Calculus explores the concepts of derivative and integral calculus to give students a solid foundation upon which to build mathematical knowledge in future courses. Specifically, students study functions and different representations of functions (graphically, numerically, algebraically, etc.), limits, derivatives and differentiation, applications of derivatives, definite integrals, indefinite integrals, and applications of integrals. Students should have a solid foundation and a proven understanding of functions (polynomials, exponential, logarithmic, trigonometric) from a Precalculus course. Statistics Prerequisites: Algebra II or equivalent. Statistics' students explore statistical concepts central to the analysis of data in many sciences and social science disciplines. Specifically, students explore data to describe patterns, departures from patterns, and associations between variables; plan and conduct experimental studies; investigate chance and random processes using probability and simulation; and learn how to objectively estimate population parameters and scientifically test hypotheses using statistical inference. Critical thinking, inferential reasoning, and communication – both oral and written – are emphasized over calculation and algebraic manipulation. Use of technology – graphing calculators, spreadsheets, and statistical analysis software – is prevalent throughout the course. A.P. Calculus (AB) Prerequisites: Honors Pre-calculus, honors grades in earlier courses and teacher recommendation. This courses prepares students for the AP Calculus exam. The AP course covers topics in differential and integral calculus, including concepts and skills of limits, derivatives, definite integrals, and the Fundamental Theorem of Calculus. The course teaches students to approach calculus concepts and problems when they are represented graphically, numerically, analytically, and verbally, and to make connections amongst these representations. Students learn how to use technology to help solve problems, experiment, interpret results, and support conclusions. A.P. Statistics Prerequisites: Pre-calculus, honors grades in earlier courses and teacher recommendation. This course follows a curriculum that prepares students for the AP Statistics exam. Students explore the major concepts and tools for collecting, analyzing, and drawing conclusions from data. Students are exposed to four broad conceptual themes: exploring data to describe patterns and departures from patterns, planning and conducting an experimental study, exploring random phenomena using probability and simulation to predict patterns, and estimating population parameters and testing hypotheses using statistical inference. Students must show strong critical thinking and inferential reasoning skills as well as excellent communication skills, both oral and written. Use of technology – graphing calculators and statistical analysis software – is prevalent throughout the course.
<urn:uuid:d2a72d89-1f0d-4a57-a237-11acc032647e>
CC-MAIN-2021-49
https://www.northwoodschool.org/sites/default/files/2021-05/Northwood%20School%20Academic%20Program%202021-2022%20Phase%20One.pdf
2021-12-08T19:23:29+00:00
crawl-data/CC-MAIN-2021-49/segments/1637964363520.30/warc/CC-MAIN-20211208175210-20211208205210-00403.warc.gz
982,726,764
7,025
eng_Latn
eng_Latn
0.996358
eng_Latn
0.997222
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1616, 1776, 3806, 6035, 8677, 11434, 13489, 16064, 18592, 21123, 23377, 25025, 27675, 30630, 31642, 34372, 37069, 38642 ]
[ 2.15625, 2.84375 ]
1
0
SILENT WORD READING FLUENCY & TEMPORAL VISION PROCESSING Differences Between Good And Poor Readers Harold A. Solan, O.D., M.A. a Steven Larson, O.D., Psy.D. a John Shelley-Tremblay, Ph.D. b Jana Mounts, O.D. c a. State College of Optometry/State University of New York b. University of South Alabama c. Hillsboro, OR Abstract This investigation examined the relationships between indicators of temporal visual processing ability, visual attention, reading comprehension, and a test of reading fluency. Seventh-grade students (N=37) were divided into "good" and "poor" readers based on a standardized comprehension test. All subjects were subsequently tested for fluency (TOSWRF), visual attention (CAS), reading eye movements (Visagraph), rapid automated naming (RAN) and coherent motion sensitivity (CM). All measures were significantly different between good and poor readers, with the exception of three RAN subscales. Spearman correlations between fluency and vision-related variables were significant, except for one RAN subscale, CM, and the number of regressions while reading. Predictions of students' original reading group (good or poor) were significantwithrelativelyhighsensitivityandspecificity for all vision measures except for RAN subscales and CM. While the current trend in the literature is to emphasize phonological awareness (PA), the current results support the notion that visual attention and visual temporal processing deficits may also contribute to reading problems in children. INTRODUCTION Currently within the area of reading disability, the majority of educational research on the causes and treatments of poor reading has stressed the phonological deficit hypothesis: Among children with difficulties in learning to read, the fundamental problem is poor phonological awareness (PA). 1 Although this line of research has lead to important insights and productive treatments, additional factors may need to be considered in order to fully understand reading problems. For instance, fluency, one of the most critical areas of reading identified by the National Reading Panel, 2 is mostly unaffected by remediation strategies aimed at improving PA. 3 Indeed, other important factors such as visual processing skills may play a role in poor reading performance, particularly impaired fluency. Although it is well established that visual processing skills are related to reading comprehension, 4 currently there is a dearth of information linking reading fluency to comprehension and visual processing skills. Key Words coherent motion, rapid automatized naming (RAN), reading disability, reading fluency, saccadic eye movements, standardized reading test, visual attention Journal of Behavioral Optometry For the purpose of this study and at its most basic level, reading fluency embraces reading rate and accuracy. That is, fluency stresses the ability to silently decode a given visual stimulus rapidly and accurately. Reading fluency also implies grouping words in phrases meaningfully; therefore, it is sometimes called prosodic reading. 5 In this regard, we propose that reading fluency can also involve temporal visual processing skills such as oculomotor efficiency, rapid automatized naming (RAN), coherent motion detection, and visual attention. The current study is intended to examine the following questions: 1. Do good and poor readers differ in measures of temporal visual processing? 2. In a class that includes above and below average readers, to what extent are the temporal visual processing skills, RAN, visual attention, reading eye-movements, and visual motion sensitivityrelatedto readingfluency? 3. Can measures of temporal visual processing predict which students are good or poor readers? RELATED RESEARCH Reading fluency Reading fluency may be thought of as a measure of the child's cumulative reading skills at a particular educational level. In practice, levels of fluency often are based on word identification skills standardized for the child's age and grade placement. Wolf 6 proposed that rapid word naming speed (serial naming) deficits and phonological core deficits are not necessarily mutually exclusive: There exists a population of children whose treatment regimen may require a dual emphasis on phonological processing and naming speed. The research of Bowers and Swanson 7 supported the view that naming speed deficits were primarily related to orthographic aspects of a reading disability, whereas PA was associated with deficits in word attack skills. Although the former requires spatial processing, temporal processing predominates in the latter. In reading, auditory and visual skills are not mutually exclusive functions. 8,9 Solan et al. 10 reported that during grade one, the common variance between auditory and visual processing increases from 12% to 58%. The intersensory research of Birch and Belmont strongly supports the notion that auditory-visual integration differentiates good and poor readers. 11 Finally; Wolf and her associates proposed that classifying individuals according to the nature of their deficit is often helpful in planning educational intervention. For example, the RAN task demands an array of learning processes that includes attention, perceptual, conceptual, memory, lexical, and articulatory skills. 12, 13 Wolf 6 concluded from her research that four diagnostic subtypes were evident within the participants she studied: (1) an average reading group that included normal PA, naming speed skills, and reading skills; (2) a rate group with naming speed deficits, normal phonology, and impaired comprehension; (3) a phonology group of individuals with PA deficit, intact naming speed, and impaired comprehension; and (4) a double-deficit group comprising individuals with naming speed and phonological-awareness deficits that resulted in significant comprehension deficits. As expected, the double deficit group included the poorest readers. More than three decades have elapsed since Denckla and Rudel proposed and initially standardized the relationship of RAN pictured objects, colors, letters and numbers for normal children. 14 Subsequently, they demonstrated that performance on RAN tests differentiated dyslexic children not only from normal controls, but also from non-dyslexic, otherwise learning-disabled children. 15 Although the components of the RAN series of tests are indeed elementary, the child's ability to respond smoothly and rapidly appears to be an important predictor of reading fluency that, in turn, contributes to comprehension. Intact temporal visual processing appears to serve as a foundation for both, rapid naming and phonological processing. Finally, performance on the RAN task not only suggests a measure of oculomotor skills but also auditory-visual integration (see below). The magnocellular (M-cell) visual pathway The magnocellular (M-cell) visual pathway is a motion-detecting area in the brain that is sensitive to visual temporal processing such as the rapid saccadic fixation patterns repeated in the RAN. Thus, it is appropriate to consider the ramifications of defects in the M-cell visual system as a potential impediment to rapid Volume 17/2006/Number 6/Page 150 naming and reading fluency. A number of research studies involving functional Magnetic Resonance Imaging (fMRI) have concluded that visual disorders may be just as much a component of reading disability (RD) as language disorder problems. 16 These studies have provided psychophysical and anatomic evidence of an anomaly of the M-cell visual subsystem in RD subjects. In all of their subjects with RD, lateral motion on the retina failed to produce task related activation in the area V5/MT of the M-cell visual subsystem that was observed in controls. 17 Furthermore, Solan, et al. provided clinical experimental evidence in a controlled study that temporal visual processing therapy is an effective procedure to improve silent reading comprehension. 18 Meta-analyses on factors in reading Recent research has focused on identifying the critical relationships between deficits in reading comprehension level and other reading related skills. In a comprehensive meta-analysis that involved 49 independent population samples (2,257 correlations), Swanson, Trainin, Necoechea, & Hamill made some interesting observations. 19 Even after correcting for variations in socioeconomic status (SES), ethnicity, and age, many of their correlations that related to PA, RAN, and comprehension were in the low range (mean r = 0.38). In general, the average correlations, albeit significant (p < 0.01), remained in the same range between kindergarten and grade 6: r = 0.38 to r = 0.40. That is, each individual test accounted for about 15% of the variance. Age did not play a significant role in moderating the correlations between PA and RAN. The researchers did not find support for the notion that RAN shares important variance with phonological skills. Thus, it appears that much work remains to be done to identify the other factors that contribute to the variance in reading ability. In a related meta-analysis, Scarborough integratedtheresultsof61 research studies to determine that, on average, phonological awareness at kindergarten predicted 21% of the variance in later reading ability scores. 20 While this marks early PAas one of the better correlates of reading ability, the vision-related variables of letter identification and concepts of print similarly predicted 27% and 21% of the variance in later reading ability, respectively. In addi- tion to intact visual functioning, these variables reflect appropriate exposure to, and acquired knowledge of letterforms. Because meta-analytic evidence represents a summary of a large number of peer reviewed data sets, this type of evidence is particularly important in highlighting the multifactorial nature of reading ability and should serve to prompt researchers to search broadly for adequate explanations of RD. Thus, in an effort to explore the relationships between fluency and all of the potentially important factors reviewed above, the current investigation assessed visual attention, reading eye movements, rapid automated naming, and coherent motion sensitivity in a sample of 7 th graders who demonstrated either good or poor reading on standardized tests. It was hypothesized that: 1) Good and poor readers differ in measures of temporal visual processing; 2)Temporal visual processing skills, RAN, visual attention, reading eye-movements, and visual motion sensitivity are related to reading fluency; 3) Measures of temporal visual processing will predict which students are good or poor readers. METHODS Subjects The participants initially were selected from a pool of all grade 7 students at a public middle school in New York City. The authors identified 25 of these students as good readers and twenty-five as poor readers on the basis of routine standardized test scores that had been administered by the classroom teachers the previous spring. The school serves a mixed middle class population consisting of European-Americans, Asian Americans, Hispanic, and African-American children. Fifty-seven percent of the student population qualified for free or reduced cost lunches. All participants were English speaking and attended standard academic classes. At the start of the academic year, the principal investigator administered the Gates-MacGinitie Reading Comprehension subtests 21 to 37 children (M age= 12.84 years) of the original pool of 50, who volunteered for further testing. Standardized directions were observed precisely. Each participant completed a multiple choice test that included main ideas, reasoning, vocabulary in context, and drawing conclusions. Obtained raw Journal of Behavioral Optometry scores were converted to percentiles and grade equivalent scores. The results identified 17 good readers (ND) (M percentile = 90.7; M Grade Equivalent = 12.3) and twenty disabled readers (RD) (M percentile = 26.3; M Grade Equivalent = 5.0). Differences between the two groups in reading comprehension were statistically significant for each measurement (p < 0.01). Letters of informed consent that required a parent and participant to agree to the research program were obtained from each family. The research program was approved by the State University of New York, State College of Optometry's Institutional Review Board (IRB). The investigators completed the CITI human research ethics program. Procedures The authors performed all tests. At the time they were unaware of the reading status of subjects. Additionally, the tests responses were objective. The following areas were assessed for each subject: Coherent motion threshold The researchers used the procedures from Solan et al. 18 to determine CM threshold. Prior research has confirmed that this putative measure of magnocellular integrity distinguishes between above and below average readers by comparing their sensitivity to lateral motion. 22, 23 The participants are differentiated by comparing their ability to distinguish the perception of minimal lateral motion from completely random motion when two rectangles, each with 150 dots, are viewed side-by-side on a computer screen (Figure 1). The random dot kinematogram (RDK) stimulus provides an M-cell sensitivity measure with a high degree of accuracy. Saccadic eye movements In order to quantify the participants eye movements, the Visagraph a was employed using the procedures detailed in Solan et al. 24 The Visagraph is an infrared recording device that accurately records the eye movements of an individual who is reading a selection for comprehension normally (Figure 2). Normal reading is a dynamic vision processing task that requires a succession of saccadic eye movements from one fixation to the next. (Since the responses to the questions are "yes/no", 8 out of 10 correct answers were required to pass.) Research has indicated Journal of Behavioral Optometry Note: All p values were produced using non-parametric Mann-Whitney U tests. SS = Scaled Score. Visagraph recordings of RD individuals reveal a surfeit of fixations and regressions and a reduced rate of reading (Table 1) that contribute to impaired reading fluency, even when the participant is reading athis/herindependentreadinglevel. 24, 25 Visual attention The goal of attention is to facilitate attending to sources of relevant information and, simultaneously, to produce a decrement in responding to sources of irrelevant information. We propose that visual attention is the catalyst that links perception with cognition. Whereas perception makes visual information available, cognition uses the visual information. The question is, where do perception and cognition meet in a particular individual? Or more precisely, when does perception cease and cognitive processing begin? 26 Volume 17/2006/Number 6/Page 152 Figure 3. Test of Silent Word Reading Fluency (TOSWRF) The assessment of visual attention consisted of three subtests that comprise the attention scales in the Cognitive Assessment System (CAS). 2 7 In addition to valuable developmental information, the CAS provides a measure of the student's potential to shift attention (focus). That is, the tests assess how well the child responds to relevant stimuli while being challenged with irrele- vant stimuli. The Expressive Attention subtest, the only verbal response test, uses variations in color as distractors and is similar to the Stroop Test. 28 For example, the word GREEN is printed in blue, and the child is expected respond "Blue." The Number Detection subtest, the first of two timed pencil and paper tests, also measures the ability to shift attention and resist distraction. The child is required to underline certain numbers that appear in regular typeface and others that appear in outline typeface. Similarly, the Receptive Attention subtest matches letters according to physical similarity (t and t) and lexical similarity (t and T). The test scores are based on number of correct answers subtracted by the number of wrong answers, and the time required to complete the test. Therefore, the attention quotient repre- sents the total effects of accuracy and automaticity, i.e., correctness and speed. Combined standard scores of the three subtests are available for statistical purposes. Reading fluency The instrument used in the present research was the Test of Silent Word Reading Fluency (TOSWRF). b The outcome, therefore, measures speed of word identification in silent reading, but not comprehension. In practice, reading fluency is a measure of the ability to read connected text rapidly, meaningfully, and effortlessly, without exceptional conscious attention to the mechanics of reading such as decoding. Others have compromised with a narrower definition that limits fluency to rate and accuracy in oral reading. 29 The TOSWRF (see Figure 3) stresses the abilityto recognizewordsas lexicalunits. The test utilizes 32 lines of unspaced words that become progressively more difficult. Maximum time permitted for the test was 3 minutes. Standardized for ages 6 years, 6 months to 17 years, 11 months, raw scores may be converted to standard scores, percentile ranks, and age and grade equivalents. The TOSWRF was administered individually in this study. The test administrator explained the procedures to each student as in the following example: inyesgomesee The instructor advised the student to place a line exactly between the n and y, where one word ends and the next word begins: in/yes/... When completed it should appear as: in/yes/go/me/see Journal of Behavioral Optometry In summary, the test stresses (1) the ability to recognize words as orthographic units and (2) the speed with which sight words are processed. It is easy to administer in a short time. In addition, the test is well standardized, and it has high test-retest reliability. On the other hand, that word meaning and comprehension are lacking and phonemic decoding difficulties are not appraised represent shortcomings of the test. Rapid automatized naming Denckla and Rudel 14, 15 developed the concept of Rapid Automatized Naming (RAN) as a valuable tool in understanding the nature of reading problems in the primary grades. These tests of visual and verbal processing measure serial naming speed of letters, numbers, objects and colors in sequence. They are dynamic tests that require the integration of visual attention, verbal, and oculomotor skills. In addition to involving both temporal and orthographic processing, a high level of arousal must be maintained in order to match eye movements automatically with the visual symbols to be identified and articulated. We utilized the Rapid Automatized Naming/ Rapid Automatized Stimulus Test (RAN/RAS). 30, c The authors of the RAN tests propose that rapid naming speed is a predictor of reading fluency, a basic requisite for reading comprehension. The RAN/RAS comprise six subtests: Test 1. RAN Objects: Consists of 5 stimuli (hand, book, dog, star, and chair) that are especially related to childhood, are easily pronounced, and have single-syllable word structure (Figure 4). Test 2. RAN Colors: Consists of 5 colors (red, yellow, blue, green, black) that appeared in the original research. Stimulus items in each row appear twice per row with no blatant repetitions on a given line (red, red). Test 3. RAN Numbers: Consists of 5 numbers (2, 4, 6, 7, 9) that appeared in the original research. Stimulus items appear twice per row with no blatant repetitions on a given line (e.g., 2 2, 4 4). Test 4. RAN Letters: Consists of high-frequency lower case letters (a, d, o, p, s) used in the original research. Stimulus items appear twice per row with no blatant repetitions on a given line (e.g., a a, d d). Journal of Behavioral Optometry Tests 5 and 6: RAS 2-Set and 3-Set: Consists of a subset of the stimulus items on the Objects, Colors, Numbers and Letters Tests. A set sequence or stimulus pattern is used throughout each of the tests. In Test 5, stimuli are an alternating pattern of letters and numbers. Test 6 consists of an alternating sequence of letters, numbers and colors. Raw scores were converted to standard scores, age scores, grade scores and percentiles. Wolf and Denckla recommend that RAN/RAS Tests should be administered yearly to each kindergarten, first and second grade child, and subsequently if the child's progress is questionable. 30 The tests are useful reading predictors and assessment tools. Since they often identify children who may develop subsequent reading disabilities (RD), the tests are helpful in pinpointing the children who require extra attention. RESULTS Non-parametric or "distribution-free" tests were used for all of the analyses in this study for a number of reasons. The majority of variables were found to be not normally distributed according to a Kolmogorov-Smirnov test performed on each score. In cases where small sample sizes are found, as in the present study, violations of the normality assumption can lead to invalid statistical outcomes if parametric tests such as the Pearson's r or t-test are employed. Preliminary statistics for central tendencies (see Table 1) using Mann-Whitney Tests indicated that the median scores of good and poor reading groups differed significantly on the Gates MacGinitie Reading Comprehension Test (7.8 yrs., p < .001) and the TOSWRF Test (4.9 yrs., p <. 001). The Rapid Automatized Naming Tests (RAN) results for the good readers were uniformly superior; and poor readers' scores were acceptable for Grade 7 students. On the four CAS Attention Tests, median scores for good readers were significantly better than poor. All subtests of the Visagraph were recorded while reading 100 word selections at each participant's independent reading level (80% comprehension). The average median subtest scores for the good readers were significantly better than poor readers (p < 0.01). Finally, the coherent motion (CM) measure of M-cell sensitivity using the RDK stimulus favored the better readers who detected lateral motion with significantly fewer dots (p < 0.01). Although not statistically significant (p = 0.09), the regression analysis indicated that CM correctly classified 73% of the participants as being either good or poor readers (Table 6). To determine the relationship between Silent Reading Fluency (TOSWRF) and the primary dependent measures in the study, the scores for each participant (good and poor readers) were entered into a Spearman Rho correlation equation (see Table 2). These analyses revealed significant correlations of fluency (TOSWRF Grade Eq.), with reading comprehension level (Gates Grade Eq.), all Rapid Automatized Naming (RAN Grade Eq.) subtests except for Numbers, all visual attention subtests (CAS Grade Eq.), and all Visagraph eye-movements subscales except regressions. However, TOSWRF did not correlate significantly with Coherent Motion. The pattern differed when only poor readers were included in the analysis. Obtained correlations for poor readers only are displayed in Table 3: Among poor readers, TOSWRF did not significantly correlate with GatesMacGinitie Comprehension. Nevertheless, it did correlate significantly with RAN Letters, RAN2, and Visagraph duration and rate in the non-attention subtests. Even with this reduced sample size, the CAS remains significantly associated with fluency in all but the expressive attention subscale. Yet, a different pattern emerged for good readers in isolation. The obtained correlations for good readers only are displayed in Table 4. TOSWRF and Gates-MacGinitie Comprehension approached significance (p < 0.075). In this group, fluency correlates significantly with Expressive Attention, Receptive Attention, and Number Detection subtests as well as the overall sum of CAS scaled score measures. In addition, the RAN subtests of Objects, Colors, and RAN3 correlated significantlywithfluency. Unlikepoor readers, none of the Visagraph eye movement variables are significantly correlated with Fluency. Inferential hypothesis testing (reading level) Mann-Whitney U analyses (Table 5) were performed to determine the effect of reading level (poor or good) on the primary dependent variables. Significant results indicated that poor and good readers differed on several of the variables of interest. Namely, TOSWRF, all CAS, all Visagraph, Coherent Motion, and three of the RAN subtest scores were significantly different between the two groups. RAN Colors, Numbers, and RAN3 tests were not significantly different. Logistic regression analyses Gr.Eq. =Grade Equivalent SS = Scaled Score Gr.Eq. =Grade Equivalent SS = Scaled Score Gr.Eq. =Grade Equivalent Gr.Eq. =Grade Equivalent SS = Scaled Score SS = Scaled Score nificantly greater than chance, while the rest were non-significant. Coherent motion was not significant (p = .093), but the results yielded some practical utility with an overall classification accuracy of 73%. TOSWRF Grade Equivalent is the single best classifier. With all participants, good and poor readers, accuracy is 86.5%; with poor readers, sensitivity, the ability to classify subjects according to disorder of interest, reached 95%. The final statistical analysis performed was a series of logistic regressions on the primary dependent measures in order to determine their ability to classify participants as good or poor reader. 29 The results of these analyses are summarized in Table 6 where it can be seen that Visagraph subtests, the TOSWRF, CAS subtests, and the CAS summed score all predicted correct reading group at better than chance levels. Interestingly, among the RAN series of tests, only the RAN Objects subtest showed a classification rate that was sig- Volume 17/2006/Number 6/Page 154 Discussion The participants provided a significant difference in Grade Equivalent levels on the Gates-MacGinitie and the TOSWRF between good and poor readers (Table 1, p < 0.001). However, it was equally important to examine the interrelationship between the two variables. The correlation of reading comprehension and fluency, for all participants, (r = 0.781, p < 0.01), represents a percent of variance equal to 61% Journal of Behavioral Optometry Table 6. Results of Logistic Regression of Reading Group (Poor Vs Good) by Primary Dependent Variables Note: OCA = Overall Classification Accuracy. All Classification Values are percentages of cases classified correctly. SS = Scaled Score. (Table 2). That 61% of the variations in reading comprehension can be explained by variations in reading fluency is impressive. When the interrelationship between comprehension and fluency is coupled with the logistic regression analysis data (Table 6), the 95% sensitivity level for classifying poor readers using the TOSWRF alone suggests the potential for a neurocognitive linkage. easily explained by the reduction in sample size that occurred when dividing the groups and the inherently bimodal nature of the sample distribution. The RAN subtests correlated moderately and significantly with fluency for all readers, except for the numbers test, a finding best explained by the ceiling effect seen in the median scores. This subtest may well be too easy to be diagnostically useful with a 7 th grade population. On the whole, however, rapid naming proved a consistent correlate to fluency as assessed by the TOSWRF. When good and poor readers are considered separately, different patterns of correlations emerge that warrant further discussion. For the good readers, RAN Objects, Colors, and RAN 3-set were significantly related to fluency, while only RAN Letters and RAN 2-set were correlated for the poor readers. RAN numbers was not significantly related to fluency for either group, a result that suggests the need for further investigation of that subtest's diagnostic utility. Neither group by itself demonstrated a significant correlation between Gates-MacGinitie Reading Level and fluency, a finding most Journal of Behavioral Optometry Despite the reduction in sample size and greater variability in the scores of the poor reader group, the CAS was a strong correlate of fluency for the RD participants. The fact that all four CAS subtest scores also correlated positively with fluency for good readers supports the critical role of visual attention for fluency development at all levels of ability. The CAS subscale of Expressive Attention, which is a Stroop task, was the only CAS component not significantly associated with poor readers' scores, suggesting that perhaps a component of RD involves difficulty deploying the type of selective attention found uniquely in the Stroop task. This is not surprising given the well-documented co-morbidity of RD and ADHD. 31 However, relatively little work has been done to document and treat the exact subtype of attentional failure associated with RD. Further studies should be undertaken on large samples of RD individuals. Perhaps the most interesting finding is that for good readers, all of the functional vision measures obtained from the Visagraph were unrelated to TOSWRF scores. In contrast, for poor readers, duration and rate were significantly related to TOSWRF scores. When considered in conjunction with the overall classification accuracy (OCA) of 83.8% in Table 6, this finding lends further support to the premise that eye movements are important for the assessment of RD students. Apparently, functional vision difficulties play a role in poor reading fluency Wolf, in her conceptualization of the subtypes of reading disability, stressed the double deficit hypothesis, phonological and slow naming speed deficits. 6 Although serial naming speed was named as an extraordinary predictor of RD, she did not examine the possibility that the condition could be influenced by visual and/or auditory disabilities. The potential for multifactorial deficits beyond the double deficit hypothesis requires further consideration. Poor phonological awareness (PA) is represented conspicuously in her double-deficit hypothesis; nevertheless it fails to account for the children with adequate decoding and naming skills, but poor comprehension, a viable option. Furthermore, the question of mutual independence of the two deficits still exists. Their hypothesized independence should be resolved in light of the implications for prediction, diagnosis, and intervention. 32 The children, who lack the prosody necessary for fluent reading, may concurrently be experiencing a temporal vision processing disorder. Is it probable that limited development of fluency in reading would be attributed solely to a breakdown in one specific component (e.g., phonological processing or naming speed) except, perhaps, in the most extreme cases? More likely, the reader would be experiencing the linguistic manifestations of a broader set of temporal limitations with ramifications for word attack, word identification, and comprehension. For example, naming speed has been conceptualized as a complex ensemble of attention, perceptual, conceptual, memory, phonological, semantic, and motoric processing that has precise rapid timing requirements within and across all components. 13 Wolf 6 rightlyasks the question: "Or is naming speed the linguistic tip of a systemic iceberg of temporal problems?" The outcomes of our prior investigations have provided statistical evidence that deficits in temporal vision processing skills are associated with magnocellular (M-cell) deficits in RD children. Moreover, the conditions were ameliorated with vision processing therapy that resulted in significant improvements in visual attention and reading comprehension. 18, 24 The current investigation did not involve either vision or reading therapy, but future studies may wish to consider the potential effects of a vision therapy program that included enhancement of temporal as well as orthographic processing on good and poor readers. The treatment effect on each group would improve our understanding of the malleability of the vision processing subsystem, in general, and reading fluency, in particular. In the current study, it was noted that correlations involving all participants were quite different from those that included solely good or poor readers. The effect of visual temporal therapy on RAN findings is of special interest since the test engages visual–verbal interaction. Furthermore, as our prior research concentrated primarily on rendering temporal vision therapy solely to RD participants, no effort was made to compare the differential effects between good and poor readers. 18 Additional avenues of inquiry are open as well. Although the basic composition of reading fluency initially may have appeared simplistic, a review of available research supports the notion that the antecedents of prosodic reading are indeed multifactorial. For example, a careful examination of Table 2 reveals that five of the six RAN tests, the four CAS attention tests, and four of the five eye-movement tests are significantly correlated with fluency. Another research question that requires further clarification is whether M-cell threshold is modifiable. The CAS visual attention battery correlates significantly with coherent motion (r = 0.41; p < 0.01). 33 CM threshold may be measured using motion sensitivity before and following vision therapy under carefully controlled conditions. Because the CM threshold is a putative measure of visual magnocellular functioning, a magnocellular deficit implies poor motion sensitivity. Therefore, improvements in CM threshold would: (1) imply that vision therapy actually would be working to enhance magnocellular functioning; (2) indicate the development of compensatory strategies associated with better cognitive processing and improved selective attention. Volume 17/2006/Number 6/Page 156 Furthermore, converging methodologies from the cognitive neurosciences could be employed to continue to explore the brain correlates of normal and disordered attention and fluency related subskills. For instance, while Eden, et al 17 and other investigators have illuminated the neural substrates of motion processing as it relates to RD, very little has been done thus far to examine the effects of remediation at the level of neural systems. Therefore, participants in future research should: (1) be selectively trained, using only empirically validated visual attention procedures with adequate control groups and (2) include individuals at multiple reading and disability levels whenever possible. Acknowledgements The authors acknowledge the generosity of Dr. P. C. Hansen, the author of the Coherent Motion Program and the scientists at the University Laboratory of Physiology, Oxford University, United Kingdom for sharing their program with us. We sincerely appreciate their continuing interest in our research. We express our thanks to the College of Optometry in Vision Development (COVD) for their generous support that has enabled this research to be completed; to the administrators and teachers at the Wagner Middle School in New York City for their cooperation in collecting the necessary data; and to the Director and staff of the Harold Kohn Vision Science Library at the State College of Optometry for their continued assistance in locating many of the references. Our appreciation is extended to the colleagues within and outside the college who took the time to critique this article. Finally, we thank the office staff of the Department of Clinical Sciences who contributed to the preparation of the tables and the manuscript. Sources a. Taylor Associates 200-2 E Second St. Huntington Station, NY 11746 b. Lingui Systems 3100 4 th Avenue E. Moline, IL 61244 c. PRO-ED, Inc. 8700 Shoal Creek Blvd. Austin, TX 78757 References 1. Shaywitz S. Overcoming Dyslexia: A New and Complete Science-Based Program for Reading Problems at Any Level. New York: Alfred A. Knopf, 2003. 2. National Reading Panel. Teaching children how to read: An evidence-based assessment of the scientific research literature on reading and its implications for reading instruction. Reports of the Subgroups. (NIH Pub. No. 00-4769). Rockville, MD: U.S. Department of Health and Human Services, National Institute of Child Health and Human Development; 2000. 3. Sandak R, Mencl W E, Frost SJ, Pugh KR. The Neurobiological Basis of Skilled and Impaired Reading: Recent Findings and New Directions. Scientific Studies of Reading 2004;8:273-393. 4. Garzia RP. Vision and Reading. Mosby's Optometry Problem Solving Series. St. Louis: Mosby, 1996. 5. Aulls MS. Developmental and Remedial Reading in the Middle Grades. Boston: Allyn and Bacon, Inc., 1978. 6. Wolf M. What time may tell: Toward a new conceptualization of developmental dyslexia. Ann Dyslexia 1999;49:3-28. 7. Bowers PG, Swanson LB. Naming speed deficits in reading disability: Multiple measures of a singular process. J Exp Child Psychol 1991;51:195-219. 8. Sherrington C. The Integrative Action of the Nervous System. New Haven:Yale; 1947. 9. Rudel RG, Denckla MB. Rapid silent response to repeated target symbols by dyslexic and nondyslexic children. Brain Lang 1978;6:52-62. 10. Solan HA, Usprich, C, Mozlin R, Ali S, Fitzpatrick C. The auditory visual integration test: intersensory or temporal spatial? J Am Optom Assoc, 1983;53:607-16. 11. Birch HG & Belmont L. Auditory-visual integration in normal and retarded readers. Am J Ortho-psychiatr 1964; 34:852-61. 12. Wolf M, Miller L, Donnelly K. Retrieval, automaticity, vocabulary elaboration, orthography (RAV-O): A comprehensive fluency-based reading intervention program. J Learn Disabil 2000;33:375-86. 13. Wolf M, Bowers PG, Biddle K. Naming speed processes, timing, and reading: A conceptual review. J Learn Disabil 2000;33:387-407. 14. Denckla MB, Rudel RG. Rapid Automatized naming of pictured objects, colors, letters, and numbers by normal children. Cortex 1974;10:186-202. 15. Denckla MB, Rudel RG. Rapid Automatized Naming (RAN): Dyslexia differentiated from other learning disabilities. Neuropsychologia 1976;14:471-9. 16. Eden GF, Zeffiro TA. Neuroscience commentary: Looking beyond reading difficulties in dyslexia. J NIH Res 1996;3:31-7. 17. Eden GF, VanMeter JW, Rumsey JM, Zeffiro TA. Abnormal processing of visual motion in dyslexia revealed by functional brain imaging. Nature 1996;382:66-9. 18. Solan HA, Shelley-Tremblay J, Hansen PC, Silverman ME, Larson S, Ficarra A. M-cell deficit and reading disability: a preliminary study of the effects of temporal vision-processing therapy. Optom 2004;75:640-50. 19. Swanson HL, Trainin G, Necoechea DM, Hamill DD. Rapid naming, phonological awareness, and reading: A meta analysis of the correlation evidence. Rev Ed Res 2003 Winter;73:407-40. Journal of Behavioral Optometry 20. Scarborough HS. Early identification for children at risk for reading disabilities: Phonilogical awareness and some other promising predictors. In: Shapiro BK, Arcardo PJ, Capute AJ, eds. Specific Reading Disability: A View of the Spectrum. Timonium, MD: York Press; 1998:75-119. 21. MacGinitie WH, MacGinitie RK, Maria K, Dreyer LG. Gates-MacGinitie Reading Comprehension Test. 3rd ed. Itasca, IL: Riverside; 1989. Level 5/6. 22. Talcott JB, Hansen PC, Assoku, et al. Visual motion sensitivity in dyslexia: evidence of temporal and energy integration deficits. Neuropsychologia 2000;38:935-43. 23. Solan HA, Hansen PC, Shelley-Tremblay J, Ficarra A. Coherent motion threshold measurements for M-cell deficit differ for aboveand below-average readers. Optom 2003;74:727-34. 24. Solan HA, Larson S, Shelley-Tremblay J, Ficarra A, Slverman M. Role of visual attention in cognitive control of oculomotor readiness in students with reading disabilities. J Learn Disabil 2001;34:107-18. 25. Solan HA, Ficarra A, Brannan JR, Rucker. Eye movement efficiency in normal and reading disabled elementary school children: effects of varying luminance and wavelength. J Am Optom Assoc 1998;69:455-64. 26. Solan HA, Shelley-Tremblay J, Ficarra A, Larson S. Effect of attention therapy on reading comprehension. J Learn Disabil 2003;36:556-63. 27. Naglieri J, Das JP. Cognitive Assessment System Interpretive Handbook. Itasca, Il: Riverside; 1997. 28. Stroop J. Studies in interference in serial verbal reactions. J Exp Psychol 1935;18:643-61. 29. Torgeson JK, Rasotte CA, Alexander AW. Principles of fluent instruction in reading. In: Wolf M, ed. Dyslexia, Fluency and the Brain. Timonium, MD: York Press; 2001:344-55. 30. Wolf M, Denckla M. RAN/RAS: Rapid automatized naming and rapid alternating stimulus tests (Examiner's Manual). Austin,TX: PRO-ED; 2005. 31. Kronenberger WG, Meyer RG. The Child Clinician's Handbook. 2nd ed. Boston: Allyn & Bacon; 2001. 32. Wolf M, Bowers PG. Naming speed processes and developmental reading Disabilities: An introduction to the special issue on the doubledeficit hypothesis. J Learn Disabil 2000;33:322-4. 33. Solan HA, Shelley-Tremblay J, Hansen P, Larson S. Is there a common linkage among reading comprehension, visual attention, and magnocellular processing? J Learn Disabil: in press. Corresponding author: Harold A. Solan, O.D., M.A. Schnurmacher Institute for Vision Research State College of Optometry/SUNY 33 West 42 nd Street New York, NY 10036 212-938-5593 Date accepted for publication: September 4, 2006 Journal of Behavioral Optometry EDITORIAL continued seconds and the person is lucid, a yellow ribbon is given. The blanch test for perfusion is accomplished by putting pressure on a finger nail or palm of the hand, and then releasing the pressure. The color of the nail or hand should normally return to a reddish hue within two seconds. If the victim shows no respiration, a black and white ribbon is placed on the body. If the victim can walk, a green ribbon is given. Speed is essential because we are trying to do the most good for the most people in the shortest amount of time. Medical Operations II covers treatment. We were instructed to select an area that is expandable and easily reached by ambulance. Subsequent topics were basic methods of transporting victims to the treatment area and head to toe assessments. We were taught to treat shock, stop the bleeding, and splint broken bones. An underlying concept in this phase of training was team work. Search and Rescue was the subject for the fifth week. We learned how to assess a situation: Do we have enough people for the job? What are the dangers to the CERT team? Adetermination of the type of structure that is involved is made by careful external examination that includes the extent of damage, and the location of entrances and exits. A key aspect of Search and Rescue is how to ascertain the location of people who are in need of help. The action plan involves reporting all information to the team leader in order take actions that are based in proper search techniques, debris removal and victim extrication. Disaster Psychology was the subject of our sixth class. Team members were warned not to over identify with survivors; empathetic engagement is an occupational hazard for rescuers. We were taught to be alert for symptoms of stress in ourselves, team members, and victims. We learned appropriate measures when signs of stress were evident. The next class was a simulated disaster drill. Each team member was called to a staging area where we informed the incident commander of damage we observed on the way to the area. We then decided the particular damaged building that required our immediate attention because people were trapped there. The CERT members were divided into teams for search and rescue, fire suppression, triage and treatment. Treatment areas were determined and the team went into action. I was assigned to search and rescue and triage. When we entered the building there were victims lying on the floor with burns, bruises, broken bones, and some with fake blood. I triaged five victims (four red and one yellow) in what felt like two minutes. The treatment team came in and transported the victims to the treatment area and started dressing, bandaging and splinting. There were twenty-two victims we had to find, triage, transport and treat. It was an exciting exercise that tested all that we had learned. Terrorism was the subject of the final class. Topics included: weapons terrorists use, clues to identify when the attack occurred or may be imminent, CERTprotocols for terrorist incidents, and protective action following an event. At the end of the class, we received a certificate, helmet, goggles, gloves, shirt, flashlights, dressings and bandages in a CERT bag. Two city commissioners gave short speeches and congratulated the class for volunteering to participate in the program. There were eight people in my class: three men and five women, ages from sixteen to seventy-three. We were informed that, depending one's interest, additional training in first aid, CPR, fire suppression and search and rescue procedures are offered. The overwhelming feeling of my class was that we were now well trained to productively support local law enforcement, fire and rescue, emergency medical services, and be effective participants in the four stages of emergency management: prevention, mitigation, response and recovery. We have the potential be important helpers and healers in these very turbulent times. My experience has indicated that optometrists are especially well prepared to be productive members of CERTbecause of our education, training and experience as primary care health care providers. I strongly encourage you to join CERT; doing this will demonstrate a very tangible sincere and laudable interest, concern and dedication to your community and the nation. You can obtain more information about CERT in your locality at http://www.citizencorps.gov. Joseph R. Miele, O.D. 200 Leslie Drive, #704 Hallandale Beach, FL33009-7316 Editors note: Dr. Miele is a past president of the Optometric Extension Program Foundation.
<urn:uuid:560b8e1c-967a-4397-b494-01bcf8e245d3>
CC-MAIN-2021-49
https://oepf.org/wp-content/uploads/2021/08/17-620Solan20Fluency1.pdf
2021-12-08T19:33:19+00:00
crawl-data/CC-MAIN-2021-49/segments/1637964363520.30/warc/CC-MAIN-20211208175210-20211208205210-00406.warc.gz
498,481,310
9,644
eng_Latn
eng_Latn
0.993108
eng_Latn
0.993224
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 4889, 12193, 14126, 17717, 23212, 26364, 31714, 38969, 46173 ]
[ 2, 1.3046875 ]
1
0
What are Conifers? Conifers are trees (and a few ground-hugging woody shrubs) that produce cones. Many conifers, like pines, firs, and spruces, have needles. Others, like cypresses, junipers, and false cedars, have scale-like leaves. Most conifers are evergreen throughout winter— but a few, like larches and dawn redwoods, are deciduous and change color in autumn before dropping their needles. You can identify most conifers by their distinctive cones. But look closely! There are some tricksters in the family. Yews, for instance, have cones that are that are bright red and very berry-like. Find more information at www.seattle.gov/trees 10 Reasons to Plant, Maintain, and Cherish Conifers 1. Evergreen conifers reduce surface run-off — year-round. 4. A variety of conifers add structure and interest to your garden design. Unlike deciduous trees which drop their leaves in winter, evergreen conifers grow and absorb groundwater throughout Seattle's winter rainy season. By sucking up rain, conifers reduce the run-off that pollutes our lakes, rivers, streams, and waterways. 2. Conifers can stabilize slopes and prevent slides — for hundreds of years. Most conifers are long-lived and thrive in the poor-to-moderate soil and hilly terrain of Seattle. Correctly planted, conifers can anchor slopes and prevent soil erosion. 3. Natural birdfeeders, conifers sustain a variety of wildlife. Chickadees, wood warblers, and nuthatches dine on tiny insects they find in conifer branches, bark, and cones. Finches forage for seed they find in broken cones. And berry-eaters—like bluebirds, robins, and thrushes—feast on the fruit-like seed cones of the juniper and yew. Ever since 19th century explorer and plant collector David Douglas sent seed cones back to Scotland's Kew Royal Botanic Gardens, NW conifers have added elegance to formal garden planning. Varying in height, texture, and color, conifers offer yearlong interest to any landscape. 5. Properly placed, conifers provide a living privacy screen. Annoying neighbors? Many conifers, such as our native hemlocks and cedars, have thick evergreen foliage and sweeping low branches that can block unwanted sightlines. Conifers also are effective noise barriers. 6. Conifers keep our air fresh and clean. Not only do most conifers have a pleasant aromatic scent, they also cleanse the air by trapping dust and other pollutants in their dense foliage. And, like all trees and woody shrubs, they store carbon and give off oxygen. 7. Cut energy costs and reduce your carbon footprint—with conifers. A tall conifer can give you shade in the summer and a wind break in the winter. This means a strategically planted tree can keep you comfortable and save you money! 8. In our maritime climate, conifers thrive and need little maintenance. Our native conifers (and many species from Asia) love rain and coastal fog. Although you must water recently planted trees in the dry summer months, after a few years most trees won't need summertime watering. Choose carefully: if you plan for your conifer's eventual size and shape, almost no pruning will be needed. 9. Without conifers, Lewis & Clark would have been up a creek. Led by native guides, early explorers travelled in traditional ways. It is well documented that Lewis and Clark journeyed westward by dugout canoe. Without western redcedar, the wood prized by NW Indians for their boats and totem poles, Lewis & Clark may never have reached the Pacific Ocean. 10. Not only are conifers long-lived, they're older than the dinosaurs! The oldest known conifers appeared on earth nearly 300 million years ago. Some conifers like dawn redwoods and monkey-puzzle trees are "living fossils," virtually unchanged since the Mesozoic Era. Ways to Keep Your Conifers Healthy and Happy 5 1. Never top your trees. Topping deprives a tree of its lead branches and invites decay into the trunk. Most trees never recover from topping and slowly die. 2. Remove ivy and other vines from trunks. Untended, ivy will grow up into the canopy, block life-giving sunlight, and choke the tree. Ivy also harbors unwanted pests like rats and invites decay into the tree trunk. 3. Consider the eventual height and girth of the conifer. Make sure you have appropriate space to plant a large conifer. Trees under power lines must stay below 20' at maturity (eliminating all but the shrubbier conifers). All trees should be planted 5' from sewer and water lines. 4. Choose a variety that will do well. Conifers prefer sun. But do your research. There are some conifers, like hemlocks, that tolerate shade. 5. Prune carefully, if at all. Most conifers require little pruning. A few conifers, like cypresses and junipers can be shaped into hedges, but beware! If you cut back beyond the green growth, those bare spots will take years to recover. Topping makes your tree less safe and more expensive to maintain. Trees react to topping by sending out shoots. Often surpassing the original height of the tree, these shoots are weakly attached to the main trunk and can become unsafe. Photo by Ramie Pierce
<urn:uuid:bd959fd0-0a57-4d74-8961-462c09a0f827>
CC-MAIN-2021-49
https://greenseattle.org/wp-content/uploads/2019/02/Conifer-Brochure-web_reduced.pdf
2021-12-08T18:57:07+00:00
crawl-data/CC-MAIN-2021-49/segments/1637964363520.30/warc/CC-MAIN-20211208175210-20211208205210-00406.warc.gz
366,219,331
1,139
eng_Latn
eng_Latn
0.99849
eng_Latn
0.998365
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 646, 5113 ]
[ 3.296875 ]
1
1
4 Helps: Peace Sometimes things overwhelm us emotionally, but the Holy Spirit can give us peace Group Discussion Flow connect with needs @ Find out how they are doing. Ask also how their action to take and person to tell went last week. @ Pray for wisdom from God for the session. @ Start by stating: "Sometimes things overwhelm us emotionally." Then, surface experiences: "Let me tell you how I have experienced this." "Tell us how you have experienced this." @ Transition to the Bible by saying, "The Holy Spirit can give us peace in these kinds of situations." notes and preparation checklist pray Pray for group members. Pray for wisdom. connect Decide when and how to transition from connect to hear. Think of a good personal example to share. hear what God says @ Read (or tell) a Bible story/passage related to the topic. Choices: Romans 8:5–6 Acts 7:54–60 (story) Galatians 5:22 Two of these passages may be enough to cover in one session. Commentary: Romans 8:5–6 — This passage shows the stark contrast between relying on our flesh and relying on the power of the Holy Spirit. Our sinful nature breeds death, but the Spirit breeds life and peace. Acts 7:54–60 — Stephen was among several men elected by the early church to serve. He was arrested and found himself caught in the middle of an angry crowd. As the crowd dragged him out of the notes and preparation checklist hear Alternate questions to ask: Romans 8:5–6 1. In what ways can the mind of sinful man be characterized as "death"? 2. Similarly, in what ways can the mind controlled by the Spirit be characterized as "life and peace"? Acts 7:54–60 1. What are some adjectives you could use to describe Stephen's state of mind as he was facing both the anger of his accusers and death? city and began to kill him, Stephen was full of the Holy Spirit and experienced peace. Galatians 5:22 — (Part of a passage used earlier) — One fruit (outcome) of being filled with the Holy Spirit is peace. @ Discuss each passage using the following questions, or the alternate questions below: What do you think this passage teaches us? What can we learn about God or our response to God? How do you think this passage relates to the statement we discussed earlier: "Sometimes things overwhelm us emotionally"? 2. Is this a normal response or a supernatural one? Why? It is supernatural, and the source of the power was God's Spirit. The Spirit can provide peace despite emotionally overwhelming circumstances. Galatians 5:22 One fruit of the Holy Spirit is peace. 1. What do you suppose we need to do to appropriate that peace? When we are filled with the Holy Spirit, we have access to that peace. apply that to life @ State the main lesson: "Sometimes things overwhelm us emotionally, but the Holy Spirit can give us peace." Have them write the lesson learned on their Mini-Journal card. @ Discuss: What prevents us from receiving peace through the Holy Spirit? What is one action you can take this week to experience more of that peace? @ Have them write down their specific action to take. Then in groups of two or three, have them share what action they plan to take. Finally, have them pray for one another. notes and preparation checklist apply Be prepared to encourage people to a specific action step. Have an example in mind. Decide when and how to transition from hear to apply. Print Peace Mini Journal. tell someone they know @ Ask whom they know who might be interested in hearing about what they are learning. @ Have them write the name after person to tell. Then, in groups of two or three, have them share whom they plan to tell. Finally, have them pray for one another. @ Encourage them to tell those people in the next few days. notes and preparation checklist tell Look for group members who tell easily. They may be good at leading their own group soon. Encourage people to do this despite their natural tendency not to.
<urn:uuid:5c63467c-62d1-40aa-99bd-670b7e4e813e>
CC-MAIN-2021-49
https://essentials24.net/lesson.php?a=doc&i=D%7C%3E53
2021-12-08T19:47:12+00:00
crawl-data/CC-MAIN-2021-49/segments/1637964363520.30/warc/CC-MAIN-20211208175210-20211208205210-00406.warc.gz
323,914,612
906
eng_Latn
eng_Latn
0.998503
eng_Latn
0.998503
[ "eng_Latn" ]
false
docling
[ 3950 ]
[ 2.640625 ]
1
0
Chess was invented about 1500 years ago in India. Since then, it has spread to every country in the world and is now played by an estimated 700 million people. The 2010 Chess Olympiad had teams from 141 countries. Chess is part of the elementary school curriculum in nearly 30 countries. In Turkey, it is an elective course in all primary schools. On December 17, 1992, New Jersey Governor Jim Florio signed into law a bill to establish chess instruction in public elementary schools. The bill states "In countries where chess is offered widely in schools, students exhibit excellence in the ability to recognize complex patterns and consequently excel in math and science...." Chess benefits all kids. After chess was incorporated into the math curriculum in New Brunswick, Canada, in grades 2‐7, the average problem‐ solving score increased from 62% to 81%. One study (Margulies (1993)) concluded that playing chess enhances reading performance. A related study found that the group receiving instruction in chess and logic had higher reading scores than the control groups, which received additional  instruction reading, math, or social studies. Regular (non‐honors) elementary students in a Chess Club showed twice the improvement of non‐ chess players in Reading and Mathematics between third and Zifth grades on the Texas Assessment of Academic Skills. Chess increases test scores. Chess teaches "impatient kids the value of hard work and delayed gratiZication" (Drummond, 2000) and allows them to channel aggression in a socially acceptable way (Vail, 1995). At one New York City school suspensions and altercations decreased by at least 60% after a chess program was established. (Palm, 1990). Chess allows students from varied socio‐economic backgrounds to compete with each other on an equal footing. Any child who understands the basics of chess belongs in the group. Kids become friends as they analyze games together. With chess in common, kids learn to interact with others who are different, dispelling stereotypes and creating a stronger sense of community. Chess improves social skills. What do Kareem Abdul‐Jabbar, Beethoven, Catherine the Great, Zsa Zsa Gabor, Sigmund Freud, Anwar Sadat all have in common? They all played chess. Chess is the only game that has has been played in multiple centuries and in many cultures.  It is widely believed that more books have been written about chess than all other games combined. The earliest recorded game was played in the 10th century; the astronauts on  the Soyuz spacecraft also played chess. There is even a story that chess contributed to victory in the revolutionary war. General Rahl of the British Army received a note from a spy that George Washington was about to cross the Delaware and attack. The general was so immersed in a chess game that he put the note in his pocket unopened, where it was found when he was killed in the subsequent battle. Chess has a fascinating history. Cognitive scientists showed that good chessplayers are like good scientists.  Instead of trying to corroborate theories, they learn by looking for Zlaws in what they believe. (Nature Magazine, Aug. 8, 2004). Chess is the foundation for artiZicial intelligence.  British mathematician and computer science pioneer Alan Turing asked "Can a machine think?"  His "Turing Test" was to create a machine that could play chess indistinguishably from a strong human player. Chess teaches kids how to think ‐‐ to reject facile solutions and deceptions in favor of careful planning and analysis needed to a reach a goal. Chess is a bridge to future technological innovation World Chess Champion Garry Kasparov planted the seed for the U.S. Chess Center when he came to Washington, D.C., to promote using chess to battle drug use by children. After two pilot programs for kids in public housing, community leaders decided to establish a permanent chess program. Since its founding in 1993, the U.S. Chess Center has taught over 25,000 children the rules and etiquette of chess. Although many of the Chess Center's students have won state and national championships, our greatest successes involve students who used the skills they learned from chess to succeed in school and break the cycle of poverty in which they grew up. The mission of the U.S. Chess Center is to bring these benefits to children, especially disadvantaged youth, in the Washington D.C. metro area.
<urn:uuid:1aaba882-ded6-42e5-958f-ff3e6808b450>
CC-MAIN-2018-30
http://chessctr.org/pdf/Didyouknow.pdf
2018-07-16T21:38:11Z
crawl-data/CC-MAIN-2018-30/segments/1531676589470.9/warc/CC-MAIN-20180716213101-20180716233101-00403.warc.gz
69,171,932
1,384
eng_Latn
eng_Latn
0.99869
eng_Latn
0.999195
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 705, 1395, 2114, 2970, 3637, 4435 ]
[ 3.046875 ]
1
7
® V.4 WORKSHOP LEADER'S GUIDE SCAVENGER HUNT - KEY - PAGE 1 If your computer is online, complete the process of registering Virtual Economics now. PART I - BROWSING ECONOMICS CONCEPTS a. Browse Economics Concepts 1. What are the two major Browse components? b. Browse Economics Lessons 2. List the five categories of Economics Concepts. b. Macroeconomics a. Fundamental Economics c. Microeconomics e. Personal Finance Economics d. International Economics 3. Select one of the International Economics Concepts and examine the screen. What is the purpose of the Overview? The Overview gives a description of the concept with key terms highlighted. 4. What Related Concepts are linked to the concept of Price Ceilings and Floors? Demand, Markets and Prices, Supply Why are Related Concepts included in Virtual Economics? Economics concepts are inter-related. Virtual Economics helps teachers explore and understand relationships between and among concepts. 5. How many teaching Tips are given for the concept of Inflation? 3 What is the purpose of the teaching Tips? They give teachers quick ideas to use in class. 6. What options are given when you click on the word print? The options are Overview, Lessons, Tips, Online Resource, and Quiz. 7. Play the Concept Video for the concept of Productive Resources. What other task is the user asked to complete? To classify each of six resources by one of four categories How many did you answer correctly? Answers will vary 8. Go to the concept of Compound Interest. How many terms are highlighted? 5 What happens when you click on the term save? The definition of save appears on the right-hand side of the screen. View the Concept Video for this concept. Describe the hands-on task. principal saved over time. The user manipulates variables to determine the simple interest, compound interest and 27 ® V.4 SCAVENGER HUNT - KEY - PAGE 2 PART II - BROWSING ECONOMICS LESSONS The database of economics lessons may be searched in four ways: by publication, keyword, national standards and state standards. Use these search functions to answer the following questions. 9. How many lessons are in the publication The Wide World of Trade? 11 What is the title of Lesson 4? Resources and Trade 10. How many print lessons are available on the topic of corporation? 5 11. How many high school print lessons are available to teach economics in world history? 13 12. What is Georgia's Grade 2 standard which is numbered SS2E1? The student will explain that because of scarcity, people must make choices and incur opportunity costs. How many CEE Featured Lessons are displayed for this standard? 20 13. What is the cost of a single copy of the high school publication Economics in Action? $29.95 NOTE: In searching for a publication, you must check the appropriate grade level or all grade levels. 14. How many national economics standards exist? 20 15. Locate the standards for your state and explore them. Write a statement summarizing your reaction to what you find. Answers will vary 16. Search for lessons to teach a standard that you want to teach. How many lessons did you find? Answers will vary 17. If you are online, select a standard for your state and find an online lesson. By clicking on the lesson title, you will automatically be taken to the EconEdLink Web site. Examine the lesson and find each of the following items: Answers will vary for each item 18. Which feature of Virtual Economics seems most promising for meeting your needs as a teacher of economics? Answers will vary 28 WORKSHOP LEADER'S GUIDE
<urn:uuid:1294e399-3297-41a2-8ea5-de7f8c13de5d>
CC-MAIN-2018-30
http://ve.councilforeconed.org/workshops/leaders/ve4_scavengeras.pdf
2018-07-16T22:28:27Z
crawl-data/CC-MAIN-2018-30/segments/1531676589470.9/warc/CC-MAIN-20180716213101-20180716233101-00403.warc.gz
382,523,234
781
eng_Latn
eng_Latn
0.997233
eng_Latn
0.997588
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 1870, 3600 ]
[ 3.234375 ]
2
2
STEP 1. Identify Challenges Carefully read and analyze the Future Scene. Consider the many possible challenges, concerns, and problems related to it. Generate as many challenges as you can. Focus on the 8 challenges you think are the most important and write them in the booklet in the space provided. Explain your challenges clearly. Be sure to word the challenges as possibilities. Do not state challenges as questions. Do not write on the back of any page or in margins. One additional page for both challenges and solutions is provided (page 4). 1. 2. 3. 4. Global Issues Problem Solving Individual Booklet - Novice 1 STEP 1. Identify Challenges (continued) Do not write on the back of any page or in margins. One additional page for both challenges and solutions is provided (page 4). 5. 6. 7. 8. Global Issues Problem Solving Individual Booklet - Novice 2 STEP 2. Select an Underlying Problem Using the possible challenges you listed in Step 1, identify a problem of major importance to the Future Scene situation. Write your Underlying Problem in question form, including a condition phrase and the words, "In what ways might I…?" or "How might I…?" Your problem should clearly explain what you want to do and what you expect to accomplish. Do not write on the back of any page or in margins. To show a connection between Step 1 and Step 2, in the space below, identify by number the Step 1 challenge(s) from which your Underlying Problem was developed. ________________________ Global Issues Problem Solving Individual Booklet - Novice 3 STEP 1 Challenges and/or STEP 3 Solution Ideas extension page, if needed Clearly label the Step and # of the idea being completed. Unreadable text will not be scored. Global Issues Problem Solving Individual Booklet - Novice 4 STEP 3. Produce Solution Ideas Elaborate solutions by including specific details that answer at least 3 or 4 critical questions: who, what, why, and how. Include where and when only if the information further refines parameters already stated in your Underlying Problem. Do not write on the back of any page or in margins. One additional page for both challenges and solutions is provided (page 4). 1. 2. 3. 4. Global Issues Problem Solving Individual Booklet - Novice 5 STEP 3. Produce Solution Ideas (continued) Do not write on the back of any page or in margins. One additional page for both challenges and solutions is provided (page 4). 5. 6. 7. 8. Global Issues Problem Solving Individual Booklet - Novice 6 STEP 4. Select Criteria Individual ID # _______ Generate criteria to determine which solution idea does the best job of solving the Underlying Problem and/or addressing the Future Scene situation. Select the 5 most important criteria for measuring solution ideas and write them in the spaces provided. Be sure to write each criterion as a question. Do not write on the back of any page or in margins. 1. 2. 3. 4. 5. STEP 5. Apply Criteria From the solution ideas written in Step 3, select the 5 ideas with the most potential to solve the Underlying Problem and list them on the grid. Use each criterion to rank the solutions on a scale from 1 (poorest) to 5 (best) and enter the numbers in the appropriate column. Add the numbers in each solution's row and enter the sum in the "total" column. Be sure to use the highest ranking solution in Step 6. Global Issues Problem Solving Individual Booklet - Novice 7 Please write your Underlying Problem from Step 2: Individual ID # _______ STEP 6. Develop an Action Plan Develop your top-scoring solution idea into an Action Plan. Thoroughly explain how the Underlying Problem is solved answering all six of the critical questions: who, what, when, where, why, and how. Explain the importance of your Action Plan in relationship to your Underlying Problem and how the Future Scene will be affected by it. Do not write on the back of any page or in margins. Solution # _________________ Global Issues Problem Solving Individual Booklet - Novice 8 STEP 6 extension page Step 6, if needed Individual ID # _______ Global Issues Problem Solving Individual Booklet - Novice 9 STEP 6 extension page for GRAPHICS, CHARTS, PICTURES, OR DIAGRAMS, if needed Text should be limited to labeling.
<urn:uuid:ce538977-a599-48f1-a8ff-63dbf0b9b0d9>
CC-MAIN-2018-30
http://vafps.org/Resources/Global%20Issues%20PS%20Individual%20Booklet%20Novice.pdf
2018-07-16T21:43:26Z
crawl-data/CC-MAIN-2018-30/segments/1531676589470.9/warc/CC-MAIN-20180716213101-20180716233101-00404.warc.gz
376,667,825
992
eng_Latn
eng_Latn
0.914096
eng_Latn
0.994965
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 631, 881, 1574, 1807, 2290, 2544, 3469, 4059, 4188, 4303 ]
[ 2.84375 ]
2
2
BIROn - Birkbeck Institutional Research Online Enabling open access to Birkbeck's published research output Fifty years of spellchecking Journal Article http://eprints.bbk.ac.uk/1211 Version: Publisher draft Citation: Mitton, R. (2010) Fifty years of spellchecking – Writing Systems Research 2 (1), pp.1-7 © 2010 Oxford Journals Publisher version ______________________________________________________________ All articles available through Birkbeck ePrints are protected by intellectual property law, including copyright law. Any use made of the contents should comply with the relevant law. ______________________________________________________________ Contact: email@example.com Fifty years of spellchecking Roger Mitton Department of Computer Science and Information Systems, Birkbeck, University of London By the standards of the computing industry, spellchecking has a long history. It began in the late fifties - the days of mainframes and punched paper tape – an early publication is (Blair, 1960), and an oft-cited paper is (Damerau, 1964). Most of the methods used a dictionary (meaning, in this context, simply a list of correct spellings) but some did not. One system (Morris and Cherry, 1975), when presented with a text for checking, split it up into three-letter sequences (trigrams), counted the number of each, and then calculated an "index of peculiarity" for each word, based on the frequency of the trigrams it contained, finally drawing the user's attention to the more peculiar-looking ones. The typo exmination, for example, contains exm and xmi, trigrams probably not shared by any other word in the text, so it would be rated as rather peculiar and would appear near the top of the list. Of course the user still had the job of spotting the errors in this list, and many misspellings do not contain unusual trigrams and so would not figure in the list at all, but it often succeeded in highlighting a typo. And, being dictionary-free, it would work just as well for, say, Spanish or Greek. But most systems checked a text by looking up all the words in a dictionary. Publishers were beginning to make use of computer technology, and dictionaries for spellchecking could be extracted from the machine-readable versions of the published ones. A big problem, even into the eighties, was the small size of computer memories. Holding an entire dictionary in main memory (the rapid-access part of the computer's storage) was out of the question. The dictionary had to be held on disc and small portions of it read into main memory as required. Consequently much ingenuity went into compressing the dictionary. One technique used was affix-stripping (McIlroy, 1982). Instead of storing computes, computed, computing, computer, computers, computable, computability, computation, computational, you store just compute, and have a set of rules that strip suffixes and adjust the stem if necessary. Having derived compute from, say, computability, and having found compute in the dictionary, you conclude that computability is an acceptable word. You can do the same with prefixes, deriving civil from uncivil. There needs to be some ordering of the rules, to accept undoubtedly but not undoubtlyed and some way of handling words that look as if they have affixes but don't, such as prosper, seabed and farthing. Though effective for the checking part of a spellchecker's task, this was less useful for suggesting the correct spelling, since simply adding affixes to a stem runs the risk of generating non-existent words – doubtedly? undoubting? Another consequence of holding the dictionary on disc was to make the checking a slow process (by computer standards) since a disc access is thousands of times slower than a main-memory access. A partial solution was to hold, in main memory, a list of the most frequent words in the language. If a spellchecker was checking the first sentence of this paragraph, and it held just the most frequent one hundred words of written English in main memory, it would find of, the, on, was, to, a, by, is and than (i.e. two-fifths of the tokens) without having to consult the main dictionary; if it held the next few hundred, it would find another, make, since and main (Leech et al., 2001). There was some debate about whether a spellchecker's dictionary should be large or small. "The larger, the better," might be one's first reaction. But it was pointed out that mistyping a short word can often produce another word (Peterson, 1986), and that people sometimes write one word for another – bigger then me, the principle function, the teacher tort us (Mitton, 1987). These real-word errors are, of course, not detected by dictionary look-up, and the spellchecker is more likely to let them through if its dictionary is full of rare words. So perhaps the dictionary should not be too big? A study of this problem established, however, that, when people use a rare word, it is very likely to be a correct spelling and not a real-word error, so that a spellchecker with a small dictionary, while it might occasionally detect a real-word error, would more often be raising false alarms over correctly spelt, rare words (Damerau and Mays, 1989). While this is clearly true for a large proportion of rare words – it's unlikely that someone who writes okapi did not mean okapi – there is a subset of rare words that bear a strong resemblance to common words, and the occurrence of one of these words is in fact more likely to be an error than a correct use. Calender (with an e), for example, is in the dictionary (it's a machine for smoothing cloth or paper), and it occurs fourteen times in the BNC (British National Corpus), but all fourteen are misspellings of calendar (though one of the two occurrences of calenders (plural) is correct) (Mitton et al. 2007). Similarly, withe (with), ail (all), tor (for), canvasses (canvases), posses (possess), polices (policies), abut (about), wold (world/would/wild) and rime (time). So, while a larger dictionary is generally preferable, rare words that resemble common words should be treated as potential errors. Correction, as opposed to the detection, of errors consisted of generating a list of words that somewhat resembled the error. An early algorithm, described in (Peterson, 1980), aimed to reverse any of the possible processes that might have given rise to a single-letter typo. Take, for example, the misspelling pord. The typist might have inserted an extra letter, so let's look up ord, prd, pod and por. Or the typist might have transposed two adjacent letters, so look up oprd, prod and podr. Perhaps one letter was substituted for another, so look up aord, bord, cord and so on, then pard, pbrd, pcrd ..., then poad, pobd..., and pora, porb ... down to porz. And finally, let's do something similar on the assumption that the typist omitted a letter: apord, bpord, cpord, ..., paord, pbord, ..., poard, pobrd, ..., porad, porbd, ..., ending with porda to pordz. If any of these variations turn out to be in the dictionary, you offer them to the user: pod, prod, cord, ford, lord, word, pond, pore, pork, porn, port, pored. (There are more efficient ways of achieving the same result – see, for example Oflazer (1996), Savary (2002) or Mihov and Schulz (2004).) This list is in no particular order – there is no notion of the spellchecker's best guess, second-best and so on. And it is restricted, obviously, to single-letter errors. This is not too serious for mistyped words, the great majority of which contain just one single-letter error (Pollock and Zamora, 1984), but it is less useful for misspellings; it would not offer the right word, for example, for "Mother pord the tea." Before the arrival of the PC in the early eighties, wordprocessors were mostly used by secretaries, who were sent on training courses to learn how to use them, so the spellcheckers of the time were designed for people whose spelling was assumed to be pretty good. Generating a long list of suggestions, possibly containing some very obscure words, was seen as more important than ordering the list in a helpful way. The earlier PC-based spellcheckers continued this policy. When offered cort, for example, in, say, "I've cort a cold," WordPerfect 5.1 (circa 1985) responded with the following: cart, cert, coat, colt, cont, coot, copt, cor, cord, corf, cork, corm, corn, corp, corr, cors, corti, cost, cot, court, crt, curt, carat, carate, card, cared, caret, carried, carrot, carte, cerate, cered, ceroid, chaired, charade, chard, chariot, charred, chart, cheered, cheroot, chert, chirred, chord, choreoid, chorioid, choroid, cirrate, cored, corrade, corrode, corrupt, coward, cowered, curate, curd, cured, curet, curette, curried, karate, kart, keyword, scared, scarred, scirrhoid, scored, scoured, scurried. The complaints that most people had with spellcheckers, however, were not with the lists of suggestions but with shortcomings in error detection. On the one hand, the spellchecker would flag names, newly coined words and technical terms as errors – this could be ameliorated by allowing users to build up private dictionaries to be used as supplements to the spellchecker's main dictionary. On the other hand, the spellchecker failed to flag real-word errors, and this was a serious defect since errors of this kind are surprisingly common – several studies, admittedly of handwritten text, found that a quarter to a third of all misspelt words were real-word errors (Wing and Baddeley, 1980; Sterling, 1983; Mitton, 1987; Brooks et al. 1993). Hence a little poem that was in circulation, in different versions: I have a spelling chequer; it came with my pea sea. It plainly marques for my revue miss takes eye cannot sea. I've run this poem threw it, I'm sure yore pleased two no. It's letter perfect in its weigh – my chequer tolled me sew. An approach to this problem, developed in the eighties and nineties, was to use confusion sets (e.g. Golding, 1995; Golding and Roth, 1999). A confusion set is a small set of words – usually two but sometimes three or four – that are likely to be confused with one another, such as {there, their, they're} or {principle, principal}. You provide the spellchecker with a list of confusion sets. It then scans the text, looking for any of the words in the list. Let's say the text contains the sentence, "The sand-eel is the principle food for many birds and animals." Having found an occurrence of principle, it assesses whether any of the other members of the confusion set (here just principal) would be more appropriate in that position. It might make this assessment on the basis of syntax, semantics, collocation or any other information it might have. If it decided that principal would be more appropriate here, it would flag principle as an error and propose principal as a correction. It is important to find a way to calibrate these assessments of appropriateness and only to flag an error if the spellchecker is confident of its assessment, since the great majority of occurrences of the words in confusion sets are in fact correct, and a spellchecker that was constantly raising false alarms would be irritating and effectively unusable. Unfortunately, the early research with this technique used a small list of about twenty confusion sets, and most of the subsequent experiments used the same set, to preserve comparability with earlier work, though (Carlson et al., 2001) scaled it up to 265. Though sufficient for proof of concept, this small list would obviously be inadequate for use in a real-life spellchecker. Only recently, however, has a serious attempt been made to produce a list sufficiently large to tackle unrestricted text (Pedler and Mitton, 2010). Experiments with a test corpus of errors collected from student essays, online bulletin boards and so on, suggest that, with a list of about 6,000 confusion sets, a spellchecker could detect around 70% of the real-word errors. The rapid take-up of PCs in the eighties meant that the use of computers, and particularly of wordprocessors, was no longer confined to professionals. Users could no longer be assumed to be good spellers; in fact they increasingly looked to the spellchecker to help them with their spelling. Poor spellers do not want a list of fifty suggestions, with the required word buried (or possibly not) somewhere in the middle; they want a short list of about half a dozen with the required word preferably at the top. To produce such a list, a spellchecker can begin by assembling a large set of possible candidates, perhaps some hundreds of them. These are words that somewhat resemble the error – perhaps they begin with the same letter, share a couple of consonants in common and are roughly the same length. Each of these candidates is then compared with the error, using some string-matching algorithm. Many algorithms have been proposed, but a simple one would be to count the number of letters or letter-pairs that the candidate has in common with the misspelling. This provides a kind of measurement of how close each of the candidates is to the misspelling, and the spellchecker offers the best few to the user. A simple system like this works quite well for a large proportion of misspellings, matching bicycle to, say, bycicyle. But it works less well for the misspellings of poor spellers; for cort, it would favour court, cert or corm, though caught might well be the target. Another string-matching algorithm is based on the notion of edit-distance (Levenshtein, 1966; Wagner and Fischer, 1974). In its simplest form, you take the misspelling on the one hand and one of the candidates on the other, and you work out how many single-letter changes are required to change the one into the other, where a single-letter change could be the insertion of a letter or the omission of a letter or the changing of one letter into another. (In many systems, the transposition of two adjacent letters is also counted as a single-letter change.) For example, if the misspelling was yot and the candidate was yoke, you could get from yoke to yot by changing the k to a t and omitting the e – two changes, so the edit-distance is 2. The lower the edit-distance, the closer the match. You calculate the edit-distance for each of the candidates and then present them in order, lowest first. So if, say, we had three candidates for yot – yoke, pot and yacht – we would calculate their edit-distance to yot to be 2 for yoke, 1 for pot and 3 for yacht, so we would present them in the order pot, yoke, yacht. In a more elaborate version of edit-distance (Veronis, 1988; Mitton, 1996), you attach costs to each of the single-letter changes; a low cost would be attached to a relatively trivial change, such as doubling a consonant (e.g. harrass for harass), but a high one to an unlikely change, such as changing a p to a y. Let's suppose we attached the following costs in our yot example: So we would present these candidates in the order yacht, pot, yoke. The costs can be held in a general table applicable to all words – you might decide, for instance, that changing a p to a y will always have a cost of 5, while changing a c to a k will cost 3. Or they can take account of the immediate context, e.g. changing a p to an f is normally improbable, say cost of 4 or 5, but if it's the p in ph, it's a lot more likely, say cost of 2. Or they can be tailored for individual words – omitting the t from mortal would attract a high cost, but omitting it from mortgage a much lower one. This system enables a spellchecker to anticipate the sort of misspellings that are caused by the quirks of English orthography; it can make allowance for the ch of yacht, the c of scissors or the w of answer. Although these examples arise from the mismatch of spelling and pronunciation, as many misspellings do, the system can deal with other sorts of misspelling. Rember, for example, is a common misspelling of remember, so we attach a low cost to the omission of the em. Latest is sometimes written lastest, so we attach a low cost to the insertion of an s. (For more detail see Mitton (2008).) By means of these and other techniques, spellcheckers became quite good at offering the required word at the head of the list, and this, paradoxically, gave rise to a new sort of misspelling – the Cupertino. These are caused by people, whether from an excess of faith or a lack of attention, choosing the first suggestion from the spellchecker's list without looking very closely, thus producing sentences such as, "The Wine Bar Company is opening a chain of brassieres," or, "The nightwatchman threw the switch and eliminated the backyard." They are called Cupertinos because a version of Microsoft Word did not have the spelling cooperation in its dictionary, only the hyphenated co-operation. If someone typed cooperation, it would, bizarrely, offer Cupertino, the name of a suburban city in California, as its first suggestion. There are documents on the web containing phrases such as "agreement on bilateral Cupertino". When I began my research into spellchecking in the 1980's, I gave a presentation on my ideas to my colleagues in the Department of Computer Science at Birkbeck, and they asked why I did not adopt the simple and direct approach of assembling a very large database of misspellings and mapping each one onto its target word. When you found a misspelling in the text you were checking, you would just look it up in this database and find the target word that it was matched with. I replied that no such collection of misspellings existed, that it would be an enormous job to create one and, given the inventiveness that people bring to the creation of misspellings, it would be an unmanageably huge database. Twenty five years on and something very like this database now exists, thanks to the internet and the big search engines. The search engine companies – Google, Yahoo and the rest – keep a log of all the queries that people key in, and, since they have been doing this for several years and since millions of people use these engines, the log files are enormous. Many of the queries, of course, contain misspellings. There is, therefore, the possibility of implementing my colleagues' suggestion, or something like it. The spellchecking task that faces a search engine is not the same as that faced by a regular spellchecker. Rather than checking a text of at least a few sentences, the search engine is trying to correct a query consisting of just a few words. The range of possible target words is much wider than for a regular spellchecker, including names of people, places, companies and products. Consequently the dictionary, central to traditional spellchecking, is less useful for query checking; someone who types in Limp Biscuit is probably not interested in biscuits but is trying to find out about the rock group Limp Bizkit. One technique that has been described (Cucerzan and Brill, 2004) makes use of the observation that misspellings follow a certain pattern. Around each correct spelling there is an extended family of potential misspellings, some of them bearing a close resemblance to the target, others more remote. The closer the family resemblance, the more common the misspelling. In other words, near-misses are quite common, whereas weird misspellings, though there may be a lot of them altogether, are individually quite rare. If, for example, you asked a hundred secondary-school children to spell the word scissors, the most frequent effort would be the correct spelling, then you would find quite a lot of sissors and a few each of siccors, scisors, siscors, sisers and sissers, and then lots of wilder variations, such as cezzous, saciarres, sisions and sorriors, but only one or two of each (Mitton, 1996). Given a misspelled query (i.e. it does not correspond to any of the search engine's index terms) – let's call it Q1 – the query checker looks for a match, or a near match, in the log of past queries. This may itself be a misspelled query – call it Q2 – in which case the checker repeats the process, looking for a near-match to Q2 which has also appeared more frequently in the log and is therefore likely to be a closer approximation to the desired search term. This may need to be repeated two or three times until the next nearest match is not another misspelling but a valid search term, as in the following example: Q1: anol scwartegger Q2: arnold schwartnegger Q3: arnold schwarznegger Q4: arnold schwarzenegger (the required search term) Whether this technique can be transferred to your own computer depends on the future of computing. You certainly could not accommodate, on your laptop, the gigantic files required to hold the logs, even supposing that the search engine companies were prepared to part with them. But it may be that the personal computer of the future will do very little processing in its own right but rather will act as your connection into the huge computing power of the internet, so that the spellchecking of your document, along with many other processes, will not actually take place inside your own machine but will be carried out elsewhere, with your machine just showing you the results. So perhaps, when you make a spelling error and the correct spelling pops into your computer from who knows where ("cloud computing" is the term currently given to this sort of internet based computing), it may be that you will be benefitting not so much from the efforts of good spellers who have gone before you, patiently creating dictionaries, but from the efforts of bad ones, misspelling the same word in a thousand different ways. References Blair, C.R. (1960). A program for correcting spelling errors. Information and Control, 3: 60-7. Brooks, G., Gorman, T. and Kendall, L. (1993). Spelling it out: the spelling abilities of 11- and 15-year-olds. Slough: National Foundation for Educational Research. Carlson, A.J., Rosen, J., and Roth, D. (2001). Scaling up context-sensitive text correction. In Proceedings of the 13 th Innovative Applications of Artificial Intelligence Conference, Menlo Park, CA.: AAAI Press, 45-50. Cucerzan, S. and Brill, E. (2004). Spelling correction as an iterative process that exploits the collective knowledge of web users. In Proceedings of EMNLP 2004, 293300. Damerau, F.J. (1964). A technique for computer detection and correction of spelling errors. Communications of the A.C.M., 7: 171-6. Damerau, F.J. and Mays, E. (1989). An examination of undetected typing errors. Information Processing and Management, 25 (6): 659-64. Golding, A.R. (1995). A Bayesian hybrid method for context-sensitive spelling correction. In Proceedings of the Third Workshop on Very Large Corpora, Cambridge MA.: Massachusetts Institute of Technology, 39-53. Golding, A.R. and Roth, D. (1999). A Winnow-based approach to context-sensitive spelling correction. Machine Learning, 34: 107-30. Leech, G., Rayson, P. and Wilson, A. (2001). Word Frequencies in Written and Spoken English. London: Longman. Levenshtein, V.I. (1966). Binary codes capable of correcting deletions, insertions and reversals. Soviet Physics – Doklady 10 (8): 707-10. McIlroy, M.D. (1982). Development of a spelling list. IEEE Transactions on Communications, COM-30 (1): 91-9. Mihov, S. and Schulz, K.U. (2004). Fast approximate search in large dictionaries. Computational Linguistics, 30 (4): 451-77. Mitton, R. (1987). Spelling checkers, spelling correctors and the misspellings of poor spellers. Information Processing and Management, 23 (5): 495-505. Mitton, R. (1996). English Spelling and the Computer. London: Longman. Mitton, R. (2008). Ordering the suggestions of a spellchecker without using context. Natural Language Engineering, 15 (2): 173-92. Mitton, R., Harrison, D. and Pedler, J. (2007). BNC! Handle with care! Spelling and tagging errors in the BNC. In Davies, M., Rayson, P., Hunston, S. and Danielsson, P. (eds), Proceedings of the Corpus Linguistics Conference CL2007, University of Birmingham, ucrel.lancs.ac.uk/publications/CL2007/. Morris, R. and Cherry, L.L. (1975). Computer detection of typographical errors. IEEE Transactions on Professional Communication, PC-18 (1): 54-64. Oflazer, K. (1996). Error tolerant finite-state recognition with applications to morphological analysis and spelling correction. Computational Linguistics, 22 (1): 73-89. Pedler, J. and Mitton, R. (2010). A large list of confusion sets for spellchecking assessed against a corpus of real-word errors. In Language Research and Evaluation Conference LREC2010, Malta. Peterson, J.L. (1980). Computer programs for detecting and correcting spelling errors. Communications of the A.C.M., 23 (12): 676-87. Peterson, J.L. (1986). A note on undetected typing errors. Communications of the A.C.M., 29 (7): 633-7. Pollock, J.L. and Zamora, A. (1984). Automatic spelling correction in scientific and scholarly text. Communications of the A.C.M., 27 (4): 358-68. Savary, A. (2002). Typographical nearset-neighbour search in a finite-state lexicon and its application to spelling correction. In Watson B.W. and Woods, D. (eds), Proceedings of the 6 th International Conference on the Implementation and Application of Automata. Lecture Notes in Computer Science 2494. Berlin: Springer, 251-60. Sterling, C.M. (1983). Spelling errors in context. British Journal of Psychology, 74: 353-64. Veronis, J. (1988). Computerized correction of phonographic errors. Computers and the Humanities, 22: 43-56. Wagner, R.A., and Fischer, M.J. (1974). The string-to-string correction problem. Journal of the A.C.M., 21 (1): 168-73. Wing, A.M. and Baddeley, A.D. (1980). Spelling errors in handwriting: a corpus and a distributional analysis. In Frith U. (ed.), Cognitive Processes in Spelling. London: Academic Press, 251-85.
<urn:uuid:82cb68d7-7adb-4a70-810e-a9edaa501ffd>
CC-MAIN-2018-30
https://core.ac.uk/download/pdf/6293.pdf
2018-07-16T22:37:03Z
crawl-data/CC-MAIN-2018-30/segments/1531676589470.9/warc/CC-MAIN-20180716213101-20180716233101-00402.warc.gz
630,964,949
6,035
eng_Latn
eng_Latn
0.943306
eng_Latn
0.998003
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 698, 4267, 7723, 11230, 14589, 17924, 21274, 24005, 25892 ]
[ 1.1015625, 2.0625 ]
3
0
SPECIAL ISSUE: How should social studies contribute to achieving Sustainable Development Goals? What Does Future-ready Social Studies Education Look Like? Insights from Teaching and Learning Geography Chew-Hung Chang National Institute of Education, Nanyang Technological University, Singapore Abstract The aspirations for social studies education that would prepare our learners for a sustainable future are presented in this paper. Given the complex, ambiguous and volatile times that we are in, there is a need to examine the key capabilities that our students will require in order to flourish in a future world. This cannot be done without consideration for sustainability. This paper will provide an overview of the current realities and attempt to articulate the knowledge, skills and dispositions of a future-ready student with a view to designing good socialstudies education. A specific case in teaching and learning of the climate change topic is argued for students to learn to know, to do, to be and to live together. Keywords: Future-ready, Geography, Knowing, Doing, Being Introduction The term "future-ready" has become more frequently used in discourses about education over the last few years (Wong & Ng, 2021; Fletcher, Warren, & Hernández-Gantes, 2018; Tan, Choo, Kang, & Liem, 2017). To be future-ready requires a forward-looking perspective and a willingness for timely change "in anticipation of the future" (Ng, 2017, p. 42). Indeed, this willingness to change should occur even when things are going well; a change "from a position of strength, rather than one of desperation" (Ng, 2017, p. 42). Serendipitously, the plethora of ideas about future-readiness in education occurred before the global pandemic of 2020. This was helpful in some ways as some countries and jurisdiction were able to implement alternatives to physical classroom learning during times of lockdowns and movement restrictions in many places around the world. However, the adoption of technology in teaching and learning, for example was not equally accessible or efficacious across different contexts. At the global, national and even local level, different schools were at different readiness levels in meeting the demands of online learning. These differences are often contextual within the social, cultural, economic and political milieu across these schools. For instance, the Organisation for Economic Co-operation and Development (OECD) 2018 PISA survey found that while the average percentage of students in disadvantaged schools who have access to a computer for schoolwork is only slightly above 20% in some countries like Indonesia, the global average was about 90% (OECD, 2020 p. 3). Social Studies as an interdisciplinary school subject is well placed to introduce such issues to students, with the hope that they develop stronger awareness of the need to appreciate differences across social, cultural, economic and political contexts. Understanding the Present in Anticipation of the Future The average life expectancies of some developed economies today are exceeding 80 years of age. Consequently, many children born today will live through to the twenty-second century. As educators, we are interested in how our policies, curricula and practices will have an impact on how our children will live beyond the twenty-first century. According to geologists, the earth is currently in the Holocene epoch which began some 11,000 to 12,000 years ago when the climate warmed after the Younger Dryas event. Scholars in other fields such as Chemistry Nobel laureate Paul Crutzen, who works on atmospheric chemistry, introduced the term "Anthropocene" to describe a reality in which human activity has resulted in unprecedented and often abrupt changes to the natural environment. Indeed, a new academic journal titled "Anthropocene" was launched in 2013 as an outlet for scholars working during this remarkable and unparalleled period of time where human activity leaves an indelible mark on the geology. Regardless of the subsequent official status of the term, the notion that introduced aptly refers to the unprecedented environmental change that has resulted from human activity. Access to quality education has been highlighted as one of the 17 Sustainable Development Goals (SDG) by the United Nations Educational, Scientific and Cultural Organisation's (UNESCO). Furthermore, the UNESCO Education 2030 Framework for Action was adopted in November 2015 to provide guidance on how to translate these SDGs into action. At the same time, the Future of Education and Skills 2030 developed by the Organisation for Economic Co-operation and Development (OECD) also aims "to help education systems determine the knowledge, skills, attitudes and values students need to thrive in and [to] shape their future" (OECD, 2020 p. 3). Social studies education, and geographical education in particular, plays a crucial role as it is concerned with helping students deepen their understanding of issues such as "climate change, water management, food security, energy choices" (Commission on Geographical Education, 2016, p. 5). Indeed, education is a key enabler to ensure the sustainable future for our children born today. There is also a certain rhetoric of referring to the current realities as being characterized by volatility, uncertainty, complexity and ambiguity. Indeed, if we were to teach students today as we have taught them in the past, we will be depriving them of a future - a notion that education guru John Dewy was purportedly quoted on, on numerous occasions. Looking towards the future, we will first need to assess what "today" looks like. Inspirations of what the near-term future will be like can perhaps be gleaned from looking at how the current realities have been predicted ten years ago. Predictions about science, society and culture for the year 2020 were made in an article in the United Kingdom newspaper "The Telegraph" on 2 January 2010, (The Telegraph, 2010). The article predicted the widespread use of mobile technologies to access the internet, leading to "a more informed, engaged, and more empathetic global citizenry" by 2020 (The Telegraph, 2010). Interestingly, the current reality falls short of this prediction and we note that people have uneven engagements with the internet across societal contexts, even today. On the other hand, there were other predictions that are more accurate, for example global warming in particular. The four years from 2015 to 2018 were the warmest years ever observed in the 139 years that the National Oceanic and Atmospheric Administration (NOAA) had kept records for (National Oceanic and Atmospheric Administration, 2019). Indeed 2020 ranks as one of the three warmest years in the decade even though there has been significant reduction in emissions from air travel due to widespread curtailment of flights (World Meteorological Organization, 2020). While there were some accurate predictions about what would happen by 2020 back in 2010, there were also many uncertain and complex issues. Looking forward, we may see new developments in immersive technologies, advances in bio-facturing, artificial intelligence driven marketing and even human-technology interfaces through implantables.While these scientific imaginations bring opportunities for humanity, there are also implications for the society, economy and environment that result in complex and uncertain outcomes we cannot ignore. One thing is for certain - uncertainty seems to be a constant. We need to be prepared as a species to respond to the uncertainties of the future. In being future-ready, we will need to consider how best we can prepare our children for these uncertainties. Education is charged with the responsibility to prepare our children for the future, the aspiration is to develop "active citizens in the present and future world" (Commission on Geographical Education, 2016, p. 1). Education has the potential to transform lives. It enables "individual growth, fosters community wellbeing, and can lead to societal change" (Chang & Kidman, 2020, p.2). Unfortunately, not all curricula are designed for the uncertainties and complexities of the future. We need a curriculum that is "dynamic, holistic, adaptive, inclusive, restorative, and contextualized" (Chang, 2019). In other words, we need our children "to be able to understand, question and reflect on the issues that they will face" (Chang & Kidman, 2020, p.2). Consequently, twenty-first century competencies like critical thinking, creativity, collaboration and communication will extend our students' learning beyond an academic exercise to learning that builds the emotional and social intelligence. These aims are well aligned with the broader aspirations of a good social studies education. Indeed, the primary aim of social studies is to "help young people make informed and reasoned decisions for the public good as citizens of a culturally diverse, democratic society in an interdependent world" (National Council for Social Studies, 2010, p. 3). Reflections from Geography Education A future-ready education, and by transitivity for future-ready socials studies education, can be aligned to the goals of education for sustainable development. Discourses in geography education have been inextricably interwoven with discussions about ESD and environmental education since the 1970s. There is much reflection from the development in geographical education that we can refer to as we consider what a future-ready education for social studies can look like. The goals of ESD comprises the aspiration to ensure that all learners acquire the knowledge and skills needed to promote sustainable development, including, among others, through education for sustainable development and "sustainable lifestyles, human rights, gender equality, promotion of a culture of peace and non-violence, global citizenship and appreciation of cultural diversity and of culture's contribution to sustainable development" (SDG-Education 2030 Steering Committee Secretariat, 2020; Chang & Kidman, 2020). Indeed, when students have agency in their learning, they are more likely to have "learned how to learn" - an invaluable skill that they can use throughout their lives (OECD, 2020 p. 3). In comparing that with the notion that a child in a future-ready curriculum should engage the information he or she encounters within the contextual understanding of school knowledge, this will enable the child to ask critical questions that will develop deeper understanding of any issue (Young, Lambert, Roberts, & Roberts, 2014). From the vantage point of a geography educator, I would suggest that Geography is a vital school subject and learning resource for 21st century citizens, who are living in a tightly interrelated world. It enables us to question what it means to live sustainably. Indeed, geographically educated individuals better understand human relationships and their responsibilities to both the natural environment and to others, consequently learning how to live harmoniously with all living species. This is done by building on personal experiences, and learning geography helps us to ask questions, develop intellectual skills and respond to issues affecting our lives. In fact, geographical education is essential for the development of "responsible and active citizens in the present and future world" (Commission on Geographical Education, 2016 p. 1). Geography can be an informing, enabling and stimulating school subject across all levels, and can help deepen the understanding of many contemporary challenges such as urbanization, overexploitation of natural resources and climate change. Indeed, geography allows us to have "new ways of thinking about the world" (Maude, 2018, p. 181) and "powerful ways of analysing, explaining and understanding" (Maude, 2018, p. 182). In addition, it "gives students some power over their own geographical knowledge… and enables [them] to follow and participate in debates on significant local, national and global issues" (Maude, 2018, p. 183). Indeed, geography gives us "knowledge of the world" (Maude, 2018, p. 183). These characteristics are not exclusively found in geography education, and many social studies education curricula have these characteristics as well. Upon closer examination, it is not just knowledge that we endeavour for a future-ready social studies education. We are interested in developing students' capabilities. In referring to Nobel Laurette and welfare economist Amartya Sen's work on capabilities, he refers to "individuals' capability of achieving the kind of lives they have reason to value" (Wells, 2020). In a sense, a person's "capability to live a good life is defined in terms of the set of valuable 'beings and doings' like being in good health or having loving relationships with others to which they have real access." (Wells, 2020). In other words, education provides children with knowledge, skills and understandings so that they not only function well but also flourish in society. These functionalities empower them with capabilities in a 21st century world characterised by volatility, uncertainty, complexity and ambiguity. The volume and velocity of change and the variability in impact these changes bring, both to the environment and society, presents challenges to sustainability. The capabilities approach hence helps us educate children to respond to and flourish despite these challenges. Learning to Know, Do, Be and Live Together In referring to the 1996 UNESCO report titled Learning: The Treasure Within, the report which is often referred simply to as the Delors Report, a holistic and integrated vision of education includes four key ideas of learning to know, learning to do, learning to be and learning to live together. This approach encapsulates the aspirations of social studies education to help children to live sustainability and to exist harmoniously with all living beings. Specifically, the 4 ideas are: 1. Learning to know - having broad general knowledge and also depth in a few subjects. 2. Learning to do - to acquire vocational/occupational skills as well as the capability to respond to many situations. * from skill to competence * the 'dematerialisation' of work and the rise of the service sector * work in the informal economy 3. Learning to be - to develop one's personality and to be able to act with growing autonomy, judgment and personal responsibility. 4. Learning to live together - to develop an understanding of other people and an appreciation of interdependence. * discovering others * working towards common objectives (Delors, 1996, p.97) To illustrate how this approach could be used within social studies education, I shall use the example of teaching and learning about climate change. "While one can argue that it has become more "fashionable" to talk about environmental topics such as climate change, there is no denying that the impacts of climate change necessitates further understanding of the phenomenon, so as to adapt to or even mitigate these impacts." (Chang, 2015, p. 181) Climate change is undoubtedly a very serious problem. However, there are still people who remain apathetic and find the issues of little personal relevance (Adger et al., 2009; Leiserowitz, 2005). In fact some consider it as someone else's problem that has little bearing on their lives and are often unable to think of the variability in extreme weather events as a climate related problem (Whitmarsh, Lorenzoni, & O'Neill, 2012). Indeed "[t]he confusion generated by conflicting stands as presented in political discourse is made worse by the public's inability to observe and remember the short-term impact of climate change" (Chang, 2015, p. 182). I argue that climate change education is crucial in providing students with a critical life skill. In particular, students need to engage the climate change topic critically make sense of what they know and even decide on what to do next (Chang, 2015). It is only with accurate knowledge that students can make good decisions and take purposeful action (Bord, O'Connor, & Fisher, 2000). However even before such a level of criticality can be achieved, we need to ensure that students have solid fundamental knowledge about the topic to begin with. The students' understanding of the topic is often flawed and limited despite heightening general awareness in schools around the world. Among the concepts most commonly misunderstood among the members of public, are the greenhouse effect (Pruneau, Liboiron, Vrain, Gravel, Bourque, & Langis, 2001) and global warming (Henry, 2000; McBean & Hengeveld, 2000). These issues in misunderstanding are frequently found in students (Hansen, 2010; Cordero, Todd, & Abellera, 2008; Kilinc, Stanisstreet, & Boyes 2008; Daniel, Stanisstreet, & Boyes, 2007). In a study by Chang and Pascua (2016), they found that although the students displayed awareness of commonly known concepts such as global warming and the greenhouse effect, they did not have enough content knowledge to define, reason, argue and link these elements together. Some common examples of the misconceptions from the study include thinking that greenhouse gases form a layer that becomes thicker as humans release excessive amounts of CO2 into the atmosphere, thereby enhancing the greenhouse effect. Some consider that the depletion of the ozone layer is due to pollutants and this leads to global warming without an understanding that there is radiation imbalance as a result. Others consider CFCs as the main culprit, even going so far as saying that since CFCs are no longer in use, the world is safe from global warming. To correct these misconceptions, there has to be deliberate efforts to translate these into the learning context through the curriculum making process. In other words, not only do we need to be able to identify these misconceptions in relation to the curricular content, we also need to be able to implement strategies through instruction. In particular, pedagogical devices like refutation texts (Chang, Pascua, & Ess, 2018), help students identify and correct their misconceptions, hopefully taking them beyond just learning to know towards learning to do. I offer a suggestion that beyond cognitive skills, learning to do also includes the capability to respond to many situations. The need to rise above 'just a skill' to developing a willingness to make behavioural change for our common sustainable future. In a study of how community action can be encouraged through awareness raising and knowledge provision, Wi and Chang (2019) introduced a public education programme to see if a programme to provide households with the necessary climate change knowledge will help change the behaviour. The empirical findings show that the programme was successful as there was an improvement in the participants' knowledge and behaviour is depicted in terms of taking "pro-environmental action" (Wi & Chang, 2019, p. 1027), which can provide insights for social studies educators in an Asian context. Extending this example beyond the behavioural changes, Wi and Chang (2019) asserts that besides the knowledge and skills domains of learning outcomes, "values are also important factors in helping individuals understand and adopt pro-environmental behaviour" (Wi & Chang, 2019, p. 1029). In the study, an increase of about 20% in the number of participants believed that an individual can make a difference (Wi & Chang, 2019, p. 1025). Interestingly, the programme introduced by the researchers was to adopt a community approach where the participants came together at the community club to learn more about pro-environmental knowledge and thereby exhibiting the change in attitude and behaviour. These demonstrate the features of the learning to be and learning to live together ideas in the Delors report. The topic of climate change will undoubted be featured prominently across the social studies curricula in many jurisdictions. The exemplification on how the learning goals can be organised according to the Delors' report's learning to know, do, be and live together provides just one way to make social studies future-ready. While we are unable to predict what will happen definitively in the future, we do know that we need to educate children who are able to ask the right questions and have the capability to make sense of new information that they will come into contact with. Conclusion While it is the intent of the author to suggest adopting the Delors 4 "learnings" approach as a way to design future-ready learning, there are two key considerations for us as social studies educators. Firstly, we cannot see these 4 "learnings" in silos. These notions are not mutually exclusive and have a synergistic effect when considered as a whole. Secondly, we should never deprive our children the joy of learning. There must be meaning in what they learn. Having a formula to describe what they should learn may not be authentic. It would be counter intuitive if all we did was to say that we only learn about knowledge and skills in the first 3 lessons and then we spend the last lesson discussing the impact and what action they can take of climate change. This is inauthentic and probably not very enjoyable for the child. To quote Chang (2015), whose argument was based on the examples presented from Asia, the "approach of teaching climate change would need to balance between developing learners who can critically engage new information about the phenomena as well as being empathic individuals who are committed to take action to make their living environment a better one" (p. 183). The example of teaching climate change in Singapore offers several insights about a future-ready social studies education for Asia. Certainly, as a start, we have to decide what we mean by learning about climate change, or learning about sustainability. We also need to consider the cognitive and affective learning outcomes, and any possible change in the learners' behaviour. Ultimately, the goal of education is not to teach a subject but rather in developing the child as a whole. In the case of social studies education, if we refer back to the notion of capabilities, a good social studies education will help our children function and flourish in society. While the seventeen sustainable development goals seem rather daunting at first glance, they outline the key aspirations that we have for our common environmental, social and cultural destiny. Education and social studies education is only one of the enablers to help us reach this goal. Beyond the school curriculum, we need to look to every member of society to play their part in this. Across the local, national and even global scales, we need an active citizenry that will be able to employ criticality in deciphering the deluge of information about our world - with only a portion of accurate and authentic news. Social studies education will therefore be a very important first step toward empowering humanity for our common environmental future. References Adger, W. N., Dessai, S., Goulden, M., Hulme, M., Lorenzoni, I., Nelson, D. R., . . . Wreford, A. (2009). Are there social limits to adaptation to climate change? Climatic Change, 93, 335-354. Bord, R., O'Connor, R., & Fisher, A. (2000). In what sense does the public need to understand global climate change? Public Understanding of Science, 9, 205-218. Chang, C. H. (2015). Teaching climate change-A fad or a necessity? International Research in Geographical and Environmental Education, 24, 181-183. Chang, C.H. (2019). The Singapore declaration on research in education for sustainable development. Retrieved from The Sustainable Earth Office: http://sustainapore.sg/events/s3/6 th -annual-s3-2019/. Chang, C. H., & Kidman, G. (2020). Dawn of a new decade — What can geographical and environmental education offer for the 2020s. International Research in Geographical and Environmental Education, 29, 1-6. Chang, C. H., & Pascua, L. (2016). Singapore students' misconceptions of climate change. International Research in Geographical and Environmental Education, 25, 84-96. Chang, C. H., Pascua, L., & Ess, F. (2018). Closing the "Hole in the Sky": The use of refutation-oriented instruction to correct students' climate change misconceptions. Journal of Geography, 117, 3-16. Commission on Geographical Education. (2016). International charter on geographical education. Retrieved from Commission on Geographical Education: http://www.igu-cge.org/2016-charter/. Cordero, E., Todd, A., & Abellera, A. (2008). Climate Change Education and the Ecological Footprint. Bulletin of the American Meteorological Society, 89, 865-872. Daniel, B., Stanisstreet, M., & Boyes, E. (2007). How can we best reduce global warming? School students' ideas and misconceptions. International Journal of Environmental Studies, 61, 211-222. Delors, J. (1996). Learning: The treasure within. Report to UNESCO of the International Commission on Education for the twenty-first-century, Paris UNESCO 1996. Internationales Jahrbuch der Erwachsenenbildung, 24, 253-258. Fletcher Jr, E. C., Warren, N. Q., & Hernández-Gantes, V. M. (2018). Preparing high school students for a changing world: College, career, and future ready learners. Career and Technical Education Research, 43, 77-97. Hansen, P. (2010). Knowledge about the Greenhouse Effect and the Effects of the Ozone Layer among Norwegian Pupils Finishing Compulsory Education in 1989, 1993, and 2005- What Now? International Journal of Science Education, 32, 397-419. Henry, A. (2000). Public Perceptions of Global Warming. Research in Human Ecology, 7(1), 25-30. Kilinc, A., Stanisstreet, M., & Boyes, E. (2008). Turkish Student's Ideas about global warming. International Journal of Environmental & Science Education, 3, 89-98. Leiserowitz, A. A. (2005). American risk perceptions: Is climate change dangerous? Risk analysis, 25, 1433-1442. Maude, A. (2018). Geography and powerful knowledge: A contribution to the debate. International Research in Geographical and Environmental Education, 27, 179-190. McBean, G., & Hengeveld, H. (2000). Communicating the science of climate change: A mutual challenge for scientists and educators. Canadian Journal of Environmental Education, 5, 9-25. National Council for Social Studies. (2010). National curriculum standards for social studies: A framework for teaching, learning, and assessment. Silver Spring, MD: National Council for Social Studies. National Oceanic and Atmospheric Administration (2019). 2018 was 4 th hottest year on record for the globe. Retrieved from National Oceanic and Atmospheric Administration: https://www.noaa.gov/ news/2018-was-4 th -hottest-year-on-record-for-globe. Ng, P. T. (2017). Learning from Singapore: The power of paradoxes. Taylor & Francis. Organisation for Economic Co-operation and Development. (2020). Student Agency for 2030. Retrieved from OECD Future of Education and Skills: https://www.oecd.org/education/2030-project/teachingand-learning/learning/student-agency/in_brief_Student_Agency.pdf Pruneau, D., Liboiron, L., Vrain, E., Gravel, H., Bourque, W., & Langis, J. (2001) People's ideas about climate change. A source of inspiration for the creation of educational programs. Canadian Journal of Environmental Education, 6, 121-138 SDG-Education 2030 Steering Committee Secretariat. (2020). Sustainable Development Goal 4 (SDG 4). Retrieved from SDG-Education 2030 Steering Committees: https://sdg4education2030.org/the-goal Tan, J. P. L., Choo, S. S., Kang, T., & Liem, G. A. D. (2017). Educating for twenty-first century competencies and future-ready learners: Research perspectives from Singapore. Asia Pacific Journal of Education, 37, 425-436. The Telegraph. (2010). 2020 vision: Where will we be in a decade's time? The Telegraph. Retrieved from https://www.telegraph.co.uk/lifestyle/6917389/2020-vision-where-will-we-be-in-a-decades-time. html. Wells, T. (2020). Sen's Capability Approach. Retrieved from Internet Encyclopedia of Philosophy: https:// iep.utm.edu/sen-cap/ Whitmarsh, L., Lorenzoni, I., & O'Neill, S. (2012). Engaging the public with climate change: Behaviour change and communication. New York, NY: Routledge. Wi, A., & Chang, C.H (2019). Promoting pro-environmental behaviour in a community in Singapore-from raising awareness to behavioural change. Environmental Education Research, 25, 1019-1037. Wong, C. P., & Ng, D. (2021). The roles of school leaders in developing future-ready learners: the case of Singapore. International Journal of Educational Management, 35, 249-269. World Meteorological Organization. (02 12, 2020). 2020 on track to be one of three warmest years on record. Retrieved from World Meteorological Organization: https://public.wmo.int/en/media/pressrelease/2020-track-be-one-of-three-warmest-years-record Young, M., Lambert, D., Roberts, C., & Roberts, M. (2014). Knowledge and the future school: Curriculum and social justice. London, UK: Bloomsbury Publishing.
<urn:uuid:6fbed9be-94f3-430a-8f1b-7083ea1327cd>
CC-MAIN-2021-49
http://jerass.com/jssea/wp-content/uploads/2021/09/Chew-Hung-Chang2021What-Does-Future-ready-Social-Studies-Education-Look-Like.pdf
2021-12-08T18:03:34+00:00
crawl-data/CC-MAIN-2021-49/segments/1637964363520.30/warc/CC-MAIN-20211208175210-20211208205210-00407.warc.gz
36,432,427
6,213
eng_Latn
eng_Latn
0.95032
eng_Latn
0.994502
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 2833, 6659, 10463, 14272, 17771, 21668, 25130, 28316, 29147 ]
[ 1.9296875, 2.5625 ]
1
0
Base your answers to questions 1 and 2 on the informa­ tion and diagram below. UCM-Circular Motion The diagram shows the top view of a 65-kilogram student at point A on an amusement park ride. The ride spins the student in a horizontal circle of radius 2.5 meters, at a constant speed of 8.6 meters per second. The floor is lowered and the student remains against the wall without falling to the floor. 5. A car travels at constant speed around a section of horizontal, circular track. On the diagram below, draw an arrow at point P to represent the direction of the centripetal acceleration of the car when it is at point P. 1. Which vector best represents the direction of the cen­ tripetal acceleration of the student at point A? 2. The magnitude of the centripetal force acting on the student at point A is approximately 2. 1.9 × 10 3 N 1. 1.2 × 10 4 N 3. 2.2 × 10 2 N 4. 3.0 × 10 1 N 3. The magnitude of the centripetal force acting on an object traveling in a horizontal, circular path will de­ crease if the 2. mass of the object is increased 1. radius of the path is increased 3. direction of motion of the object is reversed 4. speed of the object is increased 4. Centripetal force FC acts on a car going around a curve. If the speed of the car were twice as great, the magnitude of the centripetal force necessary to keep the car moving in the same path would be 2. 2FC 1. FC 3. FC/2 4. 4FC 6. A child is riding on a merry-go-round. As the speed of the merry-go-round is doubled, the magnitude of the centripetal force acting on the child 2. is doubled 1. remains the same 3. is halved 4. is quadrupled 7. A ball attached to a string is moved at constant speed in a horizontal circular path. A target is located near the path of the ball as shown in the diagram. At which point along the ball's path should the string be released, if the ball is to hit the target? 1. A 3. C 2. B 4. D 8. Which unit is equivalent to meters per second? 2. Hz∙m 1. Hz∙s 3. s/Hz 4. m/Hz UCM-Circular Motion 9. The diagram at right shows an object moving counterclockwise around a horizontal, circular track. Which diagram represents the direction of both the object's velocity and the centrip­ etal force acting on the object when it is in the position shown? 10. Which graph best represents the relationship between the magnitude of the centripetal acceleration and the speed of an object moving in a circle of constant radius? Base your answers to questions 11 through 13 on the information and data table below. In an experiment, a student measured the length and period of a simple pen­ dulum. The data table lists the length (l) of the pendulum in meters and the square of the period (T 2 ) of the pendu­ lum in seconds 2 . 11. Using the information in the data table, construct a graph on the grid provided by plotting the data points for the square of period versus length, and then drawing the best-fit straight line. 12. Using your graph, determine the time in seconds it would take this pen­ dulum to make one complete swing if it were 0.200 meter long. 13. The period of a pendulum is related to its length by the formula: T 2 = 4 π 2 g ⎛ ⎝ ⎜⎜⎜⎜ ⎞ ⎠ ⎟⎟⎟⎟• l If g represents the acceleration due to gravity, explain how the graph you have drawn could be used to calculate the value of g. 16. The diagram below shows a 5.0-kilogram bucket of water being swung in a horizontal circle of 0.70-me­ ter radius at a constant speed of 2.0 meters per second. The magnitude of the centripetal force on the bucket of water is approximately 2. 14 N 1. 5.7 N 3. 29 N 4. 200 N UCM-Circular Motion 14. A 1.0 × 10 3 -kilogram car travels at a constant speed of 20 meters per second around a horizontal circular track. Which diagram correctly represents the direction of the car's velocity (v) and the direction of the centripetal force (FC) acting on the car at one particular moment? 15. A baby and a stroller have a total mass of 20 ki­ lograms. A force of 36 newtons keeps the stroller moving in a circular path with a radius of 5.0 meters. Calculate the speed at which the stroller moves around the curve. [Show all work, including the equation and substi­ tution with units.] 17. In the diagram below, S is a point on a car tire rotat­ ing at a constant rate. Which graph best represents the magnitude of the centripetal acceleration of point S as a function of time? 18. A 0.50-kilogram object moves in a horizontal cir­ cular path with a radius of 0.25 meter at a constant speed of 4.0 meters per second. What is the magni­ tude of the object's acceleration? 2. 16 m/s 2 1. 8.0 m/s 2 3. 32 m/s 2 2 4. 64 m/s UCM-Circular Motion Base your answers to questions 19 and 20 on the informa­ tion below. Base your answers to questions 22 and 23 on the informa­ tion below. A go-cart travels around a flat, horizontal, circular track with a radius of 25 meters. The mass of the go-cart with the rider is 200 kilograms. The magnitude of the maxi­ mum centripetal force exerted by the track on the go-cart is 1200 newtons. In an experiment, a 0.028-kilogram rubber stopper is at­ tached to one end of a string. A student whirls the stopper overhead in a horizontal circle with a radius of 1.0 meter. The stopper completes 10 revolutions in 10 seconds. 19. What is the maximum speed the 200-kilogram gocart can travel without sliding off the track? 2. 12 m/s 1. 8.0 m/s 3. 150 m/s 4. 170 m/s 20. Which change would increase the maximum speed at which the go-cart could travel without sliding off this track? 2. Decrease the radius of the track. 1. Decrease the coefficient of friction between the go-cart and the track. 3. Increase the radius of the track. 4. Increase the mass of the go-cart. 21. A car moves with a constant speed in a clockwise di­ rection around a circular path of radius r, as repre­ sented in the diagram below. When the car is in the position shown, its accelera­ tion is directed toward the 2. west 1. north 3. south 4. east 22. Determine the speed of the whirling stopper. 23. Calculate the magnitude of the centripetal force on the whirling stopper. [Show all work, including the equation and substitution with units.] 24. The diagram below represents a mass, m, being swung clockwise at constant speed in a horizontal circle. At the instant shown, the centripetal force acting on mass m is directed toward point 2. B 1. A 3. C 4. D Base your answers to questions 25 and 26 on the informa­ tion below. UCM-Circular Motion Base your answers to questions 29 through 31 on the in­ formation below. A 2.0 × 10 3 -kilogram car travels at a constant speed of 12 meters per second around a circular curve of radius 30 meters. 25. What is the magnitude of the centripetal acceleration of the car as it goes around the curve? The combined mass of a race car and its driver is 600 kilograms. Traveling at constant speed, the car completes one lap around a circular track of radius 160 meters in 36 seconds. 2. 4.8 m/s 2 1. 0.40 m/s 2 3. 800 m/s 2 4. 9,600 m/s 2 26. As the car goes around the curve, the centripetal force is directed 2. away from the center of the circular curve 1. toward the center of the circular curve 3. tangent to the curve in the direction of motion 4. tangent to the curve opposite the direction of motion 27. A car round a horizontal curve of constant radius at a constant speed. Which diagram best represents the directions of both the car's velocity, v, and accelera­ tion, a? 28. A 1750-kilogram car travels at a constant speed of 15 meters per second around a horizontal circular track with a radius of 45 meters. The magnitude of the cen­ tripetal force acting on the car is 2. 583 N 1. 5 N 3. 8750 N 4. 3.94 × 10 5 N 29. Calculate the speed of the car. [Show all work, in­ cluding the equation and substitution with units.] 30. On the diagram below, draw an arrow to represent the direction of the net force acting on the car when it is in position A. 31. Calculate the magnitude of the centripetal accelera­ tion of the car. [Show all work, including the equa­ tion and substitution with units.] 32. A ball of mass M at the end of a string is swung in a horizontal circular path of radius R at constant speed V. Which combination of changes would require the greatest increase in the centripetal force acting on the ball? 2. doubling V and halving R 1. doubling V and doubling R 3. halving V and doubling R 4. halving V and halving R UCM-Circular Motion Base your answers to questions 33 through 36 on the information and table below. In a laboratory exercise, a student kept the mass and amplitude of swing of a simple pendulum constant. The length of the pendulum was increased and the period of the pendulum was measured. The student recorded the data in the table. You are to construct a graph on the grid provided following the directions below. 33. Label each axis with the appropriate physical quantity and unit, and mark an appropriate scale on each axis. 34. Plot the data points for period versus pendulum length. 35. Draw the best-fit line or curve for the data graphed. 36. Using your graph, determine the period of a pen­ dulum whose length is 0.25 meter. 37. In the diagram below, a cart travels clockwise at constant speed in a horizontal circle. At the position shown in the diagram, which arrow indicates the direction of the centripetal acceleration of the cart? 2. B 1. A 3. C 4. D 38. The centripetal force acting on the space shuttle as it orbits Earth is equal to the shuttle's 2. momentum 1. inertia 3. velocity 4. weight Base your answers to questions 39 through 42 on the in­ formation and diagram below. UCM-Circular Motion In an experiment, a rubber stopper is attached to one end of a string that is passed through a plastic tube be­ fore weights are attached to the other end. The stopper is whirled in a horizontal circular path at constant speed. 42. The rubber stopper is now whirled in a vertical circle at the same speed. On the diagram, draw and label vectors to indicate the direction of the weight (Fg) and the direction of the centripetal force (FC) at the position shown. 39. On the diagram of the top view (below), draw the path of the rubber stopper if the string breaks at the position shown. 40. Describe what would happen to the radius of the cir­ cle if the student whirls the stopper at a greater speed without changing the balancing weights. 41. List three measurements that must be taken to show that the magnitude of the centripetal force is equal to the balancing weights. 43. An unbalanced force of 40 newtons keeps a 5.0-kilo­ gram object traveling in a circle of radius 2.0 meters. What is the speed of the object? 2. 2.0 m/s 1. 8.0 m/s 3. 16 m/s 4. 4.0 m/s 44. A student on an amusement park ride moves in a cir­ cular path with a radius of 3.5 meters once every 8.9 seconds. The student moves at an average speed of 2. 1.2 m/s 1. 0.39 m/s 3. 2.5 m/s 4. 4.3 m/s 45. A stone on the end of a string is whirled clockwise at constant speed in a horizontal circle as shown in the diagram. Which pair of arrows best represents the directions of the stone's velocity, v, and acceleration, a, at the position shown? UCM-Circular Motion Base your answers to questions 46 and 47 on the infor­ mation below. Base your answers to questions 49 and 50 on the infor­ mation and diagram below. A 28-gram rubber stopper is attached to a string and whirled clockwise in a horizontal circle with a radius of 0.80 meter. The diagram in your answer booklet rep­ resents the motion of the rubber stopper. The stopper maintains a constant speed of 2.5 meters per second. A 1.5 × 10 3 -kg car is driven at a constant speed of 12 meters per second counterclockwise around a horizontal circular track having a radius of 50 meters, as represented below. 46. Calculate the magnitude of the centripetal accelera­ tion of the stopper. [Show all work, including the equation and substitution with units.] 47. On the diagram below, draw an arrow showing the direction of the centripetal force acting on the stopper when it is at the position shown. 48. A 1.0 × 10 3 -kilogram car travels at a constant speed of 20 meters per second around a horizontal circular track. The diameter of the track is 1.0 × 10 2 meters. The magnitude of the car's centripetal acceleration is 2. 2.0 m/s 2 1. 0.20 m/s 2 3. 8.0 m/s 2 4. 4.0 m/s 2 49. On the diagram above, draw a vector to indicate the direction of the velocity of the car when it is at the position shown. Start the arrow on the car. 50. Calculate the magnitude of the centripetal acceleration of the car. [Show all work, including the equation and substitution with units. 51. A body, B, is moving at constant speed in a horizontal circular path around point P. Which diagram shows the direction of the velocity (v) and the direction of the centripetal force (Fc) acting on the body? Name: UCM-Circular Motion 1. 0.30 Hz 52. A boy pushes his sister on a swing. What is the frequency of oscillation of his sister on the swing if the boy counts 90 complete swings in 300 seconds? 2. 2.0 Hz 4. 18 Hz 3. 1.5 Hz
<urn:uuid:abccad2a-4207-48a5-9c30-4cedb95df531>
CC-MAIN-2018-30
http://www.aplusphysics.com/courses/regents/worksheets/UCM-Circular%20Motion.pdf
2018-07-16T21:49:38Z
crawl-data/CC-MAIN-2018-30/segments/1531676589470.9/warc/CC-MAIN-20180716213101-20180716233101-00408.warc.gz
408,872,097
3,480
eng_Latn
eng_Latn
0.994482
eng_Latn
0.995387
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1987, 3307, 4632, 6386, 8423, 9542, 11166, 12869, 13096 ]
[ 4.25 ]
3
5
FCS3-132 2 Months Old In This Issue Z Z What It's Like to Be 2 Months Old Z Z What to Do with a Crying Baby Z Z Feeding Your Baby Z Z Games Babies Play Z Z Single Parenting Z Z Immunizations ZZA Question about Sleeping Z Z Easy Exercises to Help You Relax EXTENSION PARENT EXPRESS A Guide for You and Your Baby Dear Parent: It's fun to watch your baby grow! Your baby is beginning to take interest in everything. While she is awake, she busies herself with looking, listening, and learning. Even though she can't really talk yet, she lets you know how she feels by crying, smiling, or screaming. If she is a quiet baby, she spends time just looking. If she is an active baby, she does a lot of smiling or screaming, depending on how she feels. Your baby is beginning to learn about herself as a person. And you, as her parent, are learning all about her. What It's Like to Be 2 Months Old How I Grow ZZI still wobble my head a little when I am propped up. ZZI hold my head up for a few minutes when I'm on my back. ZZI hold onto things for a little while. ZZI move my arms and legs and "bicycle" with my feet when I get excited. ZZI stay awake for as long as 10 hours a day. ZZI may even sleep for as long as seven hours a night. Be patient with me if I still wake up during the night—pretty soon I'll be able to sleep longer. How I Talk ZZI gurgle, laugh, and smile when I'm happy. ZZI like to try out cooing sounds. ZZI cry to let you know when I want something. How I Respond ZZI blink at shadows—maybe my own hands. ZZI follow you with my eyes when you move around. ZZI like to stare at people and things. ZZI smile at others besides my mother. ZZI quiet down when I suck my fin­ gers, a bottle, or a pacifier. ZZI perform just to get your attention. Crying is the main way your baby communicates. Different cries tell you about your baby's different needs. By listening and watching him closely, you will soon learn more about those needs. How I Understand No Solids Yet ZZI recognize different voices and people. ZZI recognize a few objects, such as my bottle. Z Z He may be hungry. A young baby cannot wait long to be fed. His hungry cry may quickly change to an angry cry if you cannot feed him at once. How I Feel ZZI feel happy, scared, or uncomfort­ able at times. What to Do with a Crying Baby Crying is the main way your baby communicates. Different cries tell you about your baby's different needs. By listening and watching him closely, you will soon learn more about those needs. Your baby may cry for a number of reasons: Z Z If he fusses without any apparent reason at certain times of the day, he may just need to get rid of ex­ tra energy. You may find that he is more calm and alert after he stops crying. Z Z He may cry hard in the evenings because of colic. Please refer to the Parent Express newsletter about 1-month-old babies (FCS3-131) for more information. Z Z He may have a wet or soiled diaper. Check his diaper and change it if you need to. Z Z He may be sick. Check his tem­ perature with a lubricated rectal thermometer. A rectal reading of over 100 degrees Fahrenheit may mean he has a fever. Check with your doctor. Z Z He may be dressed too warmly or not warmly enough. Adjust his clothing to make him more com­ fortable. Z Z He may have an air bubble in his stomach that makes him uncom­ fortable. Air bubbles keep your baby from eating as much as he needs. Gentle burping may help. Try feeding again after burping. Z Z He may have a diaper rash. Leave his diapers off for a while. Free circulation of air helps skin to heal, and most babies love the freedom of not wearing a diaper. If the weather is cold, wrap him loosely in a blanket. Z Z He may want to be held close. Talk to him, cuddle him, and rock him for a while. Z Z He may be bored. Z Z Turn him around in his bed to give him a different view. Z Z Hang something over the bed that he can watch but can't reach. Z Z Play some soft music. It is impossible to spoil a baby dur­ ing the first few months. Respond promptly to your baby's needs, the most urgent needs first. You will be teaching him that he can trust you! Feeding Your Baby Parents used to think that feeding solid foods at bedtime would help their babies sleep through the night. Not true. If your baby is hungry, give her breast milk or iron-fortified for­ mula—it will help her sleep. There are good reasons for waiting to feed solids. Your baby's digestive system is not yet ready to handle foods other than milk. Her tongue and swallowing movements won't develop enough for solid foods until she is 4 to 6 months old. Supplements Babies who are solely breastfed should be receiving a Vitamin D supplement. Vitamin D is important for normal development of bones and teeth. You can get this infant supple­ ment over the counter. Talk with your child's healthcare team. Sleeping through the Night Most babies will sleep through the middle-of-the-night feeding by the age of 3 months or by the time they weigh 12 to 13 pounds, but their sleep patterns may vary for a while after that. If your baby sleeps through the 10 p.m. feeding (or the last feeding of the day), you might want to wake her up at 11 p.m. for a feeding. She will then probably sleep through the night until 5 or 6 a.m. the next morning. However, some 2-month-olds will wake up every four hours to be fed, day or night. You can begin to teach your baby that nights are for sleeping by making night feedings as calm as possible. Leave the lights off (except perhaps for a dim night light), and put her down to sleep after feeding her and changing her diaper, rather than talk­ ing or playing with her. Your baby is the best judge of how much she needs at each feeding. Be careful not to force her to feed longer than she wants. She will change her feeding pattern when she is ready. Games Babies Play Learning to Look: An Eyes and Ears Game Playing with your baby gives her a chance to explore the world and satisfy her growing curiosity. She will enjoy your loving attention and will benefit from it. Purpose This game trains your baby's eyes to follow an object. She also will learn to pay attention. How to Play Z Z Put your baby on her back. Sit be­ hind her and put your hand gently on her stomach. Try to keep her from seeing your face. You want your baby to watch the object and not you. (Remove your hand from her stomach if it bothers her.) Z Z Hold a noisemaking object such as a ring of keys about a foot above her face. Z Z Shake the object gently until she looks at it. Z Z Watch your baby's eyes to see how she follows the object. Z Z Move the object slowly in a circle in the air, around her head. Z Z Change the direction of the circle. If your baby can't follow the object in a circle, make only part of a circle. Other Eyes and Ears Games Z Z When buying a mobile, look under it to see exactly what the baby is seeing. A good mobile should have strong contrasting colors and simple shapes. Primary colors or black and white are better than soft pastels. Z Z Move objects back and forth in a straight line in front of your baby. Single Parenting If you are a single parent, your child's needs will be even more demanding. It is easy for single parents to become so involved with their children that they stop seeing other people. But you need to spend time with other adults. Share activities or outings with family and friends you enjoy being around. Check the following places for news about parent groups and other activities that may interest you: Z Z Local newspapers Z Z Religious groups Z Z Service organizations Z Z Library bulletin boards Don't limit yourself to events and groups labeled as being for single parents. Immunizations Shots (immunizations) should begin at 2 months. Check with your healthcare provider about the shots and other immunizations (rotavirus vaccine is oral) your baby needs. When you im­ munize your baby, you are: Z Z Put mobiles over your baby's crib so she can watch them as they move. You are helping your baby's brain to develop important nerve connections for her eyes. Z Z Protecting your baby's health for the rest of his life Z Z Preventing dangerous diseases that could cause breathing problems and lung damage, brain damage, heart problems, blindness, and death Z Z Making sure your child has all the needed immunizations before go­ ing to childcare or school Learn to keep a record of your child's immunizations. Take the records whenever you take your child to your healthcare provider. Never skip your child's immunizations. Make up missed shots. A Question about Sleeping Should I put my baby to sleep on her back? Is she more likely to choke on her back than on her stomach or side? The U.S. Public Health Service, the American Academy of Pediatrics (AAP), and the SIDS (Sudden Infant Death Syndrome) Alliance strongly recommend that parents and care­ givers put healthy babies to sleep on their backs to prevent SIDS. Since these organizations began sponsoring the Back to Sleep Campaign in 1992, the death rate from SIDS has been reduced by 57 percent, according to a 2005 report by AAP. Check with your healthcare provider for special instruc­ tions. No evidence shows that sleeping on the back causes choking. Babies get used to the back position, even if they protest at first. Scientists are not sure what causes SIDS, also known as "crib death." It is the most common cause of death between 1 month and 1 year. It most commonly occurs between 2 and 4 months of age and is less likely to hap­ pen as babies get older. Shots (immunizations) should begin at 2 months. Check with your healthcare provider about the shots and other immunizations (rotavirus vaccine is oral) your baby needs. Other things you can do to prevent SIDS include: Z Z Keeping the baby away from all to­ bacco smoke Z Z Placing only a tightly fitting sheet on the crib mattress. Take away all soft blankets, pillows, and toys that could cause suffocation. Z Z Dressing your baby warmly in sleeping clothes that keep her nose and mouth free for breathing Z Z Taking your baby for medical checkups often Easy Exercises to Help You Relax Allow time each day for relaxation and exercise—you've earned it! These exercises only take a few minutes and will refresh you. Z Z Lie flat on your back with your knees bent. Take a deep breath. Now breathe out slowly. Repeat five times. Z Z Lie flat with your arms at your sides. Move your arms out to shoulder level, keeping elbows stiff. Then raise your arms over your head and bring your hands together. Repeat five times. Z Z Lie flat, then raise your head, touch­ ing your chin to your chest. Try not to move any other part of your body. Repeat several times. Sources and Recommended Readings American Academy of Pediatrics (2005). Your baby's first year (2nd ed.) (Shelov, S. P. (Ed.). New York: Bantam Books. Birckmayer, J., Mabb, K., Westendorf, B. J., & Wilson, J. (1997). Teens as parents of babies and toddlers: A resource guide for educators (2nd ed.). Ithaca, NY: Cornell Cooperative Extension Service. Brazelton, T. B., & Sparrow, J. D. (2006). Touchpoints: Your child's emotional and behavioral development (2nd ed.). Cambridge, MA: Da Capo. Fogel, A. (2009). Infancy: Infant, family, and society (5th ed.). Cornwall-on-Hudson, NY: Sloan. Gnatuk, C. A., & Quick, S. (2002). Be playful with your child, Key No. 4, FCS7-182. Keys to great parenting: Fun and learn­ ing with your baby or toddler (Rev. ed.) Lexington, KY: Kentucky Cooperative Extension Service. Herr, J., & Swim, T. (2001). Creative resources for infants and toddlers (2nd ed.). Flor­ ence, KY: Thomson Delmar. Lerner, C., & Dombro, A. L. (2000). Learning and growing together: Understanding and supporting your child's development. Washington, DC: Zero to Three. Phone: (800) 899-4301. Pruett, K. D. (2000). Fatherneed: Why father care is as essential as mother care for your child. New York: Broadway. Shore, R. (1997). Rethinking the brain. New York: Families and Work Institute. SIDS Network of Kentucky, Inc., PO Box 5625, Louisville, KY 40255-0625. Phone: (502) 574-6989, (800) 928-SIDS. Contact Carole A. Gnatuk, Ed.D., Extension Child Development Specialist Adapted from a publication originally written by Dorothea Cudaback, D.S.W., and colleagues at the University of California Cooperative Extension. Professionals at the University of Kentucky who have assisted in the preparation of the Parent Ex­ press series: Sandra Bastin, Ph.D., R.D., L.D.; Donna Clore, M.S.; Ruth Ann Crum, M.S.; Darlene Forester, Ph.D., R.D.; Starr Gantz, R.D.; Carole Gnatuk, Ed.D.; Peter Hesseldenz, M.A.; Janet Kurzynske, Ph.D., R.D.; Alex Lesueur, Jr., M.S.L.S.; Suzanne McGough, M.S., R.D.; Marilyn Peterson, R.N., B.S.N.; Larry Piercy, Ph.D.; Sam Quick, Ph.D.; Michael Rupured, M.S.; Tammy Stephenson, Ph.D.; Diane Strangis, M.S.; Janet Tietyen, Ph.D., R.D., L.D. publications in the 27-part series, contact your county Cooperative Extension Service office. Parent Express guides you through parenting of children through age 36 months. For other
<urn:uuid:986c992f-f124-4cd5-9696-82eceb56b01c>
CC-MAIN-2018-30
http://www2.ca.uky.edu/agcomm/pubs/fcs3/fcs3132/fcs3132.pdf
2018-07-16T22:08:25Z
crawl-data/CC-MAIN-2018-30/segments/1531676589470.9/warc/CC-MAIN-20180716213101-20180716233101-00407.warc.gz
584,506,824
3,172
eng_Latn
eng_Latn
0.983458
eng_Latn
0.997248
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1771, 5848, 9748, 13109 ]
[ 3.875 ]
1
1
Swimming - health benefits Summary As well as being fun, swimming is a great way to keep fit and well and make friends. Swimming is a healthy activity that you can continue for a lifetime. Swimming is a low-impact activity that has many physical and mental health benefits. Make sure you know how to swim and do so in a safe environment. Swimming is one of the most popular sports in Australia. Our nation is surrounded by water and swimming is one of our great passions. As well as being fun, swimming is a great way to keep fit, stay healthy and make friends. Swimming is a healthy activity that you can continue for a lifetime. It is a low-impact activity that has many physical and mental health benefits. Swimming for recreation Swimming is a great recreational activity for people of all ages. Recreational swimming can provide you with a lowimpact workout and it's also a good way to relax and feel good. Common swimming styles in recreational swimming are breaststroke, backstroke, side stroke and freestyle. Competitive swimming Some people who enjoy swimming want to take it to a competitive level. This can provide the health benefits of a vigorous workout as well as the fun and thrill of competition. The main strokes used in competitive swimming are breaststroke, freestyle, backstroke and butterfly. The distances swum in competition swimming can vary from 50 metres in a pool to much further distances in open water. Health benefits of swimming Swimming is a great workout because you need to move your whole body against the resistance of the water. Swimming is a good all-round activity because it: keeps your heart rate up but takes some of the impact stress off your body builds endurance, muscle strength and cardiovascular fitness helps maintain a healthy weight, healthy heart and lungs tones muscles and builds strength provides an all-over body workout, as nearly all of your muscles are used during swimming. Other benefits of swimming Swimming has many other benefits including: being a relaxing and peaceful form of exercise alleviating stress improving coordination, balance and posture improving flexibility providing good low-impact therapy for some injuries and conditions providing a pleasant way to cool down on a hot day being available in many places – you can swim in swimming pools, beaches, lakes, dams and rivers. Make sure that the environment you choose to swim in is safe. Getting started with swimming Getting started in swimming is easy. It is a sport for all age groups, skill and fitness levels. Before you get started, you will need to purchase a pair of swimmers and some goggles. Goggles can be purchased for around $15 and upwards. There are public pools throughout Australia that are open to everyone. Entry to public pools usually costs a few dollars and many aquatic centres offer swimming lessons for people of all ages, as well as training and exercise groups. Some general tips for swimming Before you dive in: Make sure you know how to swim. Choose a safe environment. Warm up and stretch your muscles and joints before entering the water. Have plenty of fluids on hand and drink regularly. Don't overdo it if you're just starting out. See your doctor if you haven't exercised for a long time. Where to get help Local leisure centres, public pools and swimming clubs Swimming Australia Tel. (02) 6219 5600 Smartplay Tel. (03) 9674 8777 Things to remember As well as being fun, swimming is a great way to keep fit and well and make friends. Swimming is a healthy activity that you can continue for a lifetime. Swimming is a low-impact activity that has many physical and mental health benefits. Make sure you know how to swim and do so in a safe environment. This page has been produced in consultation with and approved by: Smartplay Content on this website is provided for information purposes only. Information about a therapy, service, product or treatment does not in any way endorse or support such therapy, service, product or treatment and is not intended to replace advice from your doctor or other registered health professional. The information and materials contained on this website are not intended to constitute a comprehensive guide concerning all aspects of the therapy, product or treatment described on the website. All users are urged to always seek advice from a registered health care professional for diagnosis and answers to their medical questions and to ascertain whether the particular therapy, service, product or treatment described on the website is suitable in their circumstances. The State of Victoria and the Department of Health & Human Services shall not bear any liability for reliance by any user on the materials contained on this website. For the latest updates and more information, visit www.betterhealth.vic.gov.au Copyright © 1999/2018State of Victoria. Reproduced from the Better Health Channel (www.betterhealth.vic.gov.au) at no cost with permission of the Victorian Minister for Health. Unauthorised reproduction and other uses comprised in the copyright are prohibited without permission.
<urn:uuid:df44935b-3d69-4018-9612-58b1f9899079>
CC-MAIN-2018-30
https://www.betterhealth.vic.gov.au/health/healthyliving/swimming-health-benefits?viewAsPdf=true
2018-07-16T22:22:20Z
crawl-data/CC-MAIN-2018-30/segments/1531676589470.9/warc/CC-MAIN-20180716213101-20180716233101-00408.warc.gz
835,179,044
1,846
eng_Latn
eng_Latn
0.998251
eng_Latn
0.999102
[ "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1575, 3739, 5123 ]
[ 2.640625 ]
4
1
FOR IMMEDIATE RELEASE Contact: Shelby Tuttle | ANDERSON Advertising & Public Relations (480) 330-9346 | email@example.com PLANET WATER FOUNDATION LAUNCHES "PROJECT 24," A GLOBAL INITIATIVE BRINGING CLEAN WATER TO 24 COMMUNITIES ACROSS FIVE COUNTRIES IN JUST 24 HOURS 2nd Annual Effort to Be Held in Honor of World Water Day on March 22 Scottsdale, Ariz. – (March 16, 2016) – On World Water Day March 22, Planet Water Foundation, one of the leading non-profit organizations focused on bringing clean water to the world's most disadvantaged communities, will install 24 clean water filtration systems (AquaTowers) that will supply the daily drinking water requirements in 24 communities across five countries - in just 24 hours. According to a 2014 update from the World Health Organization and UNICEF, 748 million, or roughly one in ten people worldwide live without access to clean water every day. In many areas of the world, including communities in the Asia Pacific region and Latin America, where Planet Water Foundation focuses its work, the percentage of those lacking access to potable water is much greater. In an effort to draw attention to the world's growing water poverty crisis, Planet Water's "Project 24" initiative will deploy 24 of its signature green technology AquaTowers in just 24 hours – an ambitious plan, as one system typically takes a full day to construct and commission. In relay-style fashion with teams in five countries, project deployments will begin at midnight U.S. Eastern Daylight Time, constructing one AquaTower sequentially every hour, on the hour, in communities across Cambodia, Colombia, India, Indonesia and the Philippines. In cooperation with Arizona State University and Arizona PBS, Project 24 will be featured as a onehour special to air at 6pm Mountain Standard Time on digital 8.3 PBS World, Cox cable Channel 88 and streamed live on Planet Water's website at www.planet-water.org. The show will feature AquaTower installations from projects while illuminating the stories of community members and the impact clean, safe water will have on their lives. Each AquaTower produces up to 10,000 liters of clean, safe drinking water every day – enough to support the needs of 1,000 people, or the size of a typical rural village in impoverished communities. Superior to well water, AquaTowers remove bacteria, protozoa, viruses, pathogens and other contaminants that make people sick to produce safe drinking water that meets World Health Organization standards. The drinking water is accessed through nine faucets positioned around the tower, which are also used for hand washing. According to the World Health Organization, improving access to water, sanitation and hygiene can prevent at least 9.1% of the global burden of disease, and 6.3% of all deaths. "Having access to clean water is often times something we take for granted in the U.S.," said Mark Steele, Founder and CEO of Planet Water Foundation. "Installation of these AquaTowers solves many problems that face these communities in all parts of the world. Providing clean water allows young girls the opportunity to go to school when they would often spend their entire day gathering water for their families. We can help reduce the estimated yearly 500,000 dehydration deaths caused by diarrhea from contaminated water." A vital part of Planet Water's solution, the non-profit also implements water-health and hygiene education programs into the schools and communities where it deploys AquaTowers. These childfriendly, activity-based programs teach children and their caregivers about germs, how they spread, proper hand washing, bathing and tooth brushing Each Project 24 AquaTower project costs $15,000 to deploy, which also includes five years of postproject sustainability support, water quality monitoring, and implementation of the water-health and hygiene education program. AquaTower projects are typically sponsored by companies that are committed to corporate and social responsibility around water and hygiene education initiatives such as; Xylem, Starbucks, Coca-Cola and Capital One. Individuals in the U.S. can support the Foundation's work by purchasing Planet Water's electrolyteenhanced bottled water that is available at a number of leading retailers such as Sprouts, Hi-Health, AJ's Fine Foods, and Bucky's among many others. Each bottle purchased supports the clean, safe water needs of a child for an entire month. Individual donations are also accepted on the foundation's website. Since 2009, Planet Water has deployed nearly 700 projects, bringing clean water to more than 700,000 people across 12 countries through partnerships with organizations such as JP Morgan, Xylem, Levi & Strauss, Timberland, and Habitat for Humanity. For more information about Planet Water's Project 24, please contact Shelby Tuttle of ANDERSON Advertising and Public Relations at firstname.lastname@example.org or (480) 330-9346. Phone, Skype or satellite interviews are available with Planet Water CEO and founder Mark Steele on World Water Day from his remote on-site location in Cambodia. ### About Planet Water Foundation Planet Water Foundation is a non-profit organization focused on bringing clean water to the world's most disadvantaged communities through he installation of community-based water filtration systems (AquaTowers) and the deployment of hygiene education programs. Planet Water Foundation projects are focused on children, schools, and rural/peri-urban communities across Asia and Latin America. About Project 24 On World Water Day, Planet Water's mission will be to again bring clean water to 24 communities in 24 hours – this year across five countries. By providing access to clean, safe water and hygiene education programs, Project 24 will build hope, health and opportunity for communities across Cambodia, India, the Philippines, Indonesia and Colombia.
<urn:uuid:9d1cba4e-dbbb-488e-bd56-26bc8fd81553>
CC-MAIN-2018-30
http://planet-water.org/PlanetWaterPDFs/NewsRelease/PW-Project%2024_Press%20Release_2016.pdf
2018-07-16T22:06:30Z
crawl-data/CC-MAIN-2018-30/segments/1531676589470.9/warc/CC-MAIN-20180716213101-20180716233101-00412.warc.gz
287,982,863
1,203
eng_Latn
eng_Latn
0.995738
eng_Latn
0.995818
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 2917, 5917 ]
[ 2.453125 ]
2
0
POLITICAL SCIENCE (Code-028) CLASS – XII SAMPLE QUESTION PAPER (2014-15) TIME: 3 hrs MM: 100 General Instructions: 1. All questions are compulsory. 2. Question numbers 1-5 are of 1 mark each. The answers to these questions should not exceed 20 words each. 3. Question numbers 6-10 are of 2 marks each. The answers to these questions should not exceed 40 words each. 4. Question numbers 11-16 are of 4 marks each. The answers to these questions should not exceed 100 words each. 5. Question numbers 17-21 are of 5 marks each. The answers to this question should not exceed 150 words. 6. Question numbers 22-27 are of 6 marks each. The answers to this question should not exceed 150 words. 17. Read the passage given below carefully and answer the following questions: We have a Muslim minority who are so large in numbers that they cannot, even if they want, go anywhere else. That is a basic fact about which there can be no argument. Whatever the provocation from Pakistan and whatever the indignities and horrors inflicted on non-Muslims there, we have got to deal with this minority in a civilized manner. We must give them security and the rights of citizens in a democratic State. If we fail to do so, we shall have a festering sore which will eventually poison the whole body politic and probably destroy it. Jawaharlal Nehru, Letter to Chief Ministers, 15 October 1947 Give an account of the background in which the letter was written and explain the challenge that Jawaharlal Nehru is referring to in it? 5 18. Read the passage given below carefully and answer the following questions: One of India's major concerns has been the composition of the Security Council, which has remained largely static while the UN General Assembly membership has expanded considerably. India considers that this has harmed the representative character of the Security Council. It also argues that an expanded Council, with more representation, will enjoy greater support in the world community. Critically examine India's concerns and arguments about the composition of the Security Council. 5 19. Read the passage given below carefully and answer the following questions: While the cold war was an outcome of the emergence of the US and the USSR as two superpowers rival to each other, it was also rooted in the understanding that the destruction caused by the use of atom bombs is too costly for any country to bear. The logic is simple yet powerful. When two rival powers are in possession of nuclear weapons capable of inflicting death and destruction unacceptable to each other, a full-fledged war is unlikely. Explain the cold war scenario and reasons behind it not turning out to be a fullfledged war? 5 20. Study the picture given below carefully and answer the following questions: 22. What were the key controversies regarding development in India? 6 OR Why did the Indian National Congress dominate the first three General Elections after independence? 6 23. 'There is a difference in the approach towards environment between the countries of the North and the South'. Explain the statement with reference to the Earth Summit (1992) and the Kyoto Protocol (1997)? 6 OR How has globalization affected India and what has been India's response? 6 24."India should not give up its policy of non-alignment and align with the United States." Give arguments in support or against this statement. 6 OR Mention the areas of cooperation and disagreement between India and Bangladesh. 6 25. Evaluate the lessons that have been learnt from the popular movements in India along with examples. 6 OR "After the elections in 1989 an era of coalitions started in which political parties are not aligning or realigning on the basis of ideologies." Explain the statement. 6 26. Why was Gorbachev forced to initiate reforms and how did it lead to the disintegration of the Soviet Union? 6 OR Explain how did the Cuban Missile Crisis drive the world on the brink of a nuclear war? 6 27. What was the 'new world order' and how did it lead to the First Gulf War? 6 OR What makes the European Union a highly influential regional organization? 6 _________________________________________________
<urn:uuid:2d3f7afe-82f3-4ecf-819e-4f9e975c33f9>
CC-MAIN-2018-30
http://crskyn.org/2015/Pol%20Science%202014-15.pdf
2018-07-16T22:05:07Z
crawl-data/CC-MAIN-2018-30/segments/1531676589470.9/warc/CC-MAIN-20180716213101-20180716233101-00414.warc.gz
86,652,706
922
eng_Latn
eng_Latn
0.997426
eng_Latn
0.999159
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 894, 2957, 3039, 3377, 5246 ]
[ 3.3125 ]
3
1
APPLIED SCIENCE –I (PHYSICS) OCTOBER 2013 PART A Answer the following questions in one or two sentences. Each question carries 2 marks. I. a) What are nano and femto? (2) Ans: Nano and femto are two prefixes used to indicate multiples and submultiples .Nano stands for 10 -9 and femto for 10 -15 b)Give the relation between angular momentum and angular velocity (2) Ans: Angular velocity = Angular momentum =P.r (Moment of linear momentum) Therefore is the relation between angular velocity and angular momentum. PART B (Answer any two full questions .Each question carries 8 marks) II. a)Derive the equation for the displacement of body during the n th second of its motion (4) Ans: Consider a particle having an initial velocity u and acceleration a .To calculate the distance travelled in n th second, we have to find out the total distance travelled in n sec(S1) and to subtract the total distance travelled in (n-1) seconds(S2) from it. The distance Sn covered in n th seconds is b) Derive an expression for acceleration due to gravity (4) Ans: Suppose a stone is held close to the surface of the earth. Then the distance between the stone of mass m and earth of mass M is equal to radius R of the earth. If g is the acceleration due to gravity, the gravitational attractive force is mg Therefore III. a)Obtain an expression for the period of a simple pendulum using dimensions (4) of the pendulum, of the bob, and the acceleration due to gravity g. Then the period can be expressed as , Ans: Assuming that the period of a simple pendulum depends on the length the mass (1) Here k is the dimensionless constant. Taking dimensions of both sides, Since the powers of L,M & Tare the same on both sides of eq n (2) Solving we get x=1/2, y=0, z=-1/2 Subtracting the values of x, y& z in (1) b) Define torque and angular momentum and give the relation between them (4) Ans: * A torque is required to produce an angular momentum *Torque is defined as the product of force f and perpendicular distance r between the line of action of the force and the axis of rotation. Angular momentum L of a rotating body is the product of its moment of inertia and angular velocity . IV. a)Can a body possess zero velocity and still accelerate ? Give example (4) Ans: Yes. There can be situations in which a body possessing zero velocity can have acceleration. An example is a stone thrown up. When it reaches the topmost point ,its velocity will be zero .At the same time , its acceleration will be double .Same is the case of a simple pendulum at the extreme points. b)Explain Young's modulus, Bulk modulus and Rigidity Modulus of a material (4) Ans: Young's modulus : It is ratio of the longitudinal stress to the longitudinal strain Y= Rigidity modulus : It is the ratio of shearing stress to shearing strain (Answer the full question from each unit. Each question carries 15 mark) V. a)State Newton's second law of motion. Hence Derive the equation for force. (3) Ans: Newton's second law states that the rate of change of momentum of a body is proportional to the applied force and takes place in the direction in which the force acts. Consider a body of mass moving with a velocity u. When an unbalanced force F acts on it for a time t, its velocity changes to v. So, its initial momentum = mu Final momentum = mv Therefore changes in momentum = mv-mu Rate of change of momentum According to the second law ,the rate of change of momentum is proportional to force F. Thus, Here k=1 b) Define recoil of a gun. Applying law of conservation of momentum, obtain an expression for recoil velocity Ans: Recoil velocity is the velocity with a gun moves backward when a bullet fired from it. When a bullet is fired from a gun the bullet moves forward with a high velocity. Since the total momentum of the gun and the bullet before firing is zero, this forward momentum of the bullet is balanced by the backward momentum generated in the gun. M and m are the masses and V and v are the velocities of the gun and the bullet respectively, the law of conservation of momentum implies that Or, [-ve sign shows that the gun recoils backward] c) A stone is dropped into water from a bridge 44.1 m above the water level. Another stone is thrown vertically downward one second later. Both stones reach water surface simultaneously. Find the downward velocity of the second stone (g=9.8 m/s 2 ) (6) Ans: Time taken for the first stone to fall freely from the bridge from 44.1 m height will be t Thus the second stone thrown after 1s with velocity u should cover a distance 44.1 m in 2 seconds. Taking motion of the second stone, VI. a)Why wheels are made circular? Ans: Wheels have to overcome kinetic friction for the vehicle to move.Kinetic friction is of two typessliding and rolling.Since wheels are made circular,the velocity of the point of contact of the wheel with respect to the floor remains zero although the center of wheel moves forward .Thatis rolling friction is quit small compared to sliding friction. Hence wheels are made circular. b)Derive an expression for: (6) The maximum height reached. Horizontal range in the case of a body projected upward. Ans: Consider the vertical displacement H of the projectile. y Initial vertical velocity = Final vertical velocity = 0 Vertical acceleration = -g Vertical displacement = H uy u We have, Therefore 0=u 2 sin 2 Ө -2gH ux x Or, ll. The horizontal displacement of the projectile is R. Acceleration is 0.Hence, Horizontal displacement = R Horizontal acceleration = 0 Time taken = T Horizontal velocity = W have, Therefore .T+0 We know that the time of flight, Therefore, A train moves around a bend of radius 100m with a speed of 72kmphr.Calculate the angle of bending and find the height of outer rail over inner rail if the distance between the rails is 1.52m. UNIT 2 VII. a) Distinguish between deforming force and restoring force. (3) Ans: Deforming force is that which is applied to change the3 configuration of the body. Restoring force is the internal force which tends to bring the body back to its original configuration b) Derive an expression for moment of inertia of a uniform circular disk about an axis passing through its center and perpendicular to its plane. (6) Ans: Let M be the mass and R the radius of the disc. The disc Can be imagined to be made up of a large number of rings of Small width and of gradually increasing radius from 0 to R. Consider such a ring of radius x and width dx. R Total mass of the disc = M. Mass per unit area of the disc = Area of the ring of radius x and width dx = 2πxdx Mass of the ring = = 2xdx M/R 2. Moment of inertia of this ring about the axis passing through the center and perpendicular to its plane is therefore aMx 3 dx/R 2 .Therefore the moment of inertia of the disc can be obtained by integrating between the limits x=0 to x=R. Thus, c) Calculate the orbital velocity required to maintain a satellite in circular orbit at 160km above earth. Radius of earth is 6400km and acceleration due to gravity at this height is 9.8m/s 2 . Also find the time period of the satellite. VIII. a)What is the difference between ordinary and geostationary satellite? Ans: Satellite is an object revolving around a planet. It can be natural or artificial. An artificial satellite whose orbital period is the same as the rotational period of the earth is called a geostationary satellite. ``` b) The distance of moon from earth is 3.8* 10 5 km and its mass is 7.36*10 22 kg. Find the angular momentum of the moon about the earth. The angular velocity of moon around the earth is 6.46*10 -5 rad/sec. Ans: Angular velocity, rad/sec. R= 3.8 * 10 5 km = 3.8 * 10 8 m. M= 7.36*10 22 kg Angular momentum, Here, L =7.36 * 10 22 * (3.8*10 8 ) 2 * 6.46*10 -5 = 6.87 * 10 35 kg rad/sec. c) The diameter of a brass road is 6mm.What force in Newton will stretch by 0.2% of its length? (Y=9*10 10 Nm -2 ). (6) Ans: Diameter = 6 mm , Radius = 3 mm l / L= 0.2% = 0.2/100 Y= 9*10 10 N/m 2 F = 5089.38 N ```
<urn:uuid:bcf834b5-63d6-4cb7-b2a3-f63bbb297d3d>
CC-MAIN-2018-30
http://madinpoly.com/pdf/solved/3/10.pdf
2018-07-16T22:11:47Z
crawl-data/CC-MAIN-2018-30/segments/1531676589470.9/warc/CC-MAIN-20180716213101-20180716233101-00416.warc.gz
232,214,652
2,002
eng_Latn
eng_Latn
0.918144
eng_Latn
0.992578
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1812, 4170, 6105, 7696, 8414 ]
[ 3.765625 ]
3
2
bottomland forest RECREATION canoeing, boating, fishing, hiking, hunting, trapping, wildlife observation and/or photography WHERE IS IT FOUND? Bottomland forests are large timbered areas bordering swamps or rivers. They are found throughout Illinois. Oakwood Bottoms and Greentree Reservoir in Jackson County and Allerton Park in Piatt County are two examples of the many places where a bottomland forest may be easily accessed and visited. CHARACTERISTICS Bottomland forests are large timbered areas bordering swamps or rivers. In Illinois, they cover about 809,000 acres. In the south‐central portion of Illinois, 78 percent of the forested area is within two‐tenths of a mile of the streams. Composed mainly of trees, bottomland forests are subject to repeated flooding. When not flooded, they may lack continuously standing water, or it may be present in oxbow lakes or sloughs. If floods occur frequently, the understory may be very open with rotten logs and woody debris covering the forest floor. Plants that grow in the understory must be able to withstand wet soil and/or reproduce rapidly. If floods are not frequent, the forest floor may have a variety of annual and perennial plants, and the tree species may include oaks, elms and hickories. WHAT LIVES HERE? More than one‐half of Illinois' native flora and one‐half of the threatened or endangered flora are found in Illinois' forests. More than 75 percent of the wildlife habitat in the state is in the forests. Trees, shrubs and vines are the characteristic plants found in bottomland forests. Many animal species utilize this habitat type permanently while others search for food and water here on a regular basis or during migration. Birds that nest in cavities find plenty of dead trees in bottomland forests. White‐tailed deer, squirrels, opossums, racoons, wild turkey, owls, woodpeckers, reptiles and insects  are commonly found in this habitat.
<urn:uuid:2c82bdcd-7fb7-4af7-a8dd-82403e196d0f>
CC-MAIN-2022-49
https://www2.illinois.gov/dnr/education/CDIndex/BottomlandForest.pdf
2022-12-09T15:28:33+00:00
crawl-data/CC-MAIN-2022-49/segments/1669446711417.46/warc/CC-MAIN-20221209144722-20221209174722-00180.warc.gz
1,149,620,979
735
eng_Latn
eng_Latn
0.996862
eng_Latn
0.996862
[ "eng_Latn" ]
false
docling
[ 1915 ]
[ 2.390625 ]
2
0
Multiply Fractions by Whole Numbers Name: Choose the best answer #1 #2 #3 The cattle at the Boone Farm are fed bales of hay each day. The horses are fed as much hay as the cattle. How many bales of hay are the horses fed each day? (Simplify your answer and write it as a proper fraction or a mixed number.) 5 1 2 Show your work Choose the best answer A fish tank can support fish. If a fish bowl can support the number of fish as a fish tank, how many fish can the bowl support? (Simplify your answer and write it as a proper fraction or a mixed number.) 7 1 8 Show your work Choose the best answer An adult cat can eat pounds of cat food a week. If a kitten can only eat as much as an adult cat, how much cat food can a kitten eat in a week? (Simplify your answer and write it as a proper fraction or a mixed number.) 7 5 6 Show your work 2 4 5 2 7 8 2 1 2 2 5 9 7 8 3 7 3 5 9 10 5 1 10 5 5 9 5 5 6 5 3 4 Get more worksheets at http://www.mathgames.com/worksheets CC.7.117 Play online at http://www.mathgames.com/skill/7.117 Page 1 of 4 #4 #5 #6 A large box of waffle cones contains cones and a small box of waffle cones contains as many cones. How many waffle cones are in a small box? (Simplify your answer and write it as a proper fraction or a mixed number.) 7 7 8 Show your work The cattle at the Boone Farm are fed bales of hay each day. The horses are fed as much hay as the cattle. How many bales of hay are the horses fed each day? (Simplify your answer and write it as a proper fraction or a mixed number.) 5 3 8 Show your work The cattle at the Boone Farm are fed bales of hay each day. The horses are fed as much hay as the cattle. How many bales of hay are the horses fed each day? (Simplify your answer and write it as a proper fraction or a mixed number.) 5 3 8 Show your work waffle cones bales of hay bales of hay Get more worksheets at http://www.mathgames.com/worksheets CC.7.117 Play online at http://www.mathgames.com/skill/7.117 Page 2 of 4 #7 #8 #9 Name: A large box of waffle cones contains cones and a small box of waffle cones contains as many cones. How many waffle cones are in a small box? (Simplify your answer and write it as a proper fraction or a mixed number.) 7 7 8 Show your work During a week, Addison writes enough to go through lead pencils. How many pencils will she go through in of the time? (Simplify your answer and write it as a proper fraction or a mixed number.) 2 4 7 Show your work Choose the best answer The cattle at the Boone Farm are fed bales of hay each day. The horses are fed as much hay as the cattle. How many bales of hay are the horses fed each day? (Simplify your answer and write it as a proper fraction or a mixed number.) 7 2 5 Show your work waffle cones pencils 2 4 5 2 1 7 2 1 8 2 4 9 Get more worksheets at http://www.mathgames.com/worksheets CC.7.117 Play online at http://www.mathgames.com/skill/7.117 Page 3 of 4 #10 #11 #12 Name: The cattle at the Boone Farm are fed bales of hay each day. The horses are fed as much hay as the cattle. How many bales of hay are the horses fed each day? (Simplify your answer and write it as a proper fraction or a mixed number.) 1 1 2 Show your work Choose the best answer The cattle at the Boone Farm are fed bales of hay each day. The horses are fed as much hay as the cattle. How many bales of hay are the horses fed each day? (Simplify your answer and write it as a proper fraction or a mixed number.) 3 7 8 Show your work An adult cat can eat pounds of cat food a week. If a kitten can only eat as much as an adult cat, how much cat food can a kitten eat in a week? (Simplify your answer and write it as a proper fraction or a mixed number.) 3 3 4 Show your work bales of hay 2 5 7 2 1 4 2 5 8 2 2 9 pounds Get more worksheets at http://www.mathgames.com/worksheets CC.7.117 Play online at http://www.mathgames.com/skill/7.117 Page 4 of 4 Multiply Fractions by Whole Numbers Get more worksheets at http://www.mathgames.com/worksheets CC.7.117 Play online at http://www.mathgames.com/skill/7.117
<urn:uuid:aeb65ab1-70c4-45c0-87a6-523ef98e2fd3>
CC-MAIN-2022-49
https://pdf.teachme.com/worksheet/7-117.pdf?&t=mg
2022-12-09T16:40:38+00:00
crawl-data/CC-MAIN-2022-49/segments/1669446711417.46/warc/CC-MAIN-20221209144722-20221209174722-00179.warc.gz
475,872,176
1,226
eng_Latn
eng_Latn
0.990065
eng_Latn
0.991856
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1071, 2011, 2956, 3946, 4106 ]
[ 4.34375 ]
1
0
USC SCHOOL OF CINEMATIC ARTS CTWR 250: BREAKING THE STORY Spring 2020 Section number 19360D Mondays, 10-12:50pm SCA 361 DAVID HOWARD email@example.com (or by appointment, set up by email) Office: SCA 354 phone: 213-740-3303 Office hours: Tuesdays 1-4 CLASS OBJECTIVE: A successful screenwriting career is built on the craft of storytelling which in turn depends on the writer's ability to generate and elaborate upon worthwhile ideas. This course is designed to help you develop your skills by approaching story development from a variety of angles and by assisting you in developing your own personal process. By the end of the semester you will create and develop several feature and series ideas and present them in a well-organized portfolio for final review. In the future the material generated in this class will hopefully be developed further, both in subsequent classes in the School of Cinematic Arts and as you pursue your profession as a screenwriter in any media. CLASS GOALS: To explore and develop the story-breaking process. To learn how to develop compelling characters, the source of all stories. To acquire the ability to develop stories quickly. To develop strong verbal as well as written storytelling skills. To exercise imaginative skills and discover hidden sources to tap into. To create a personal connection between you and your work. To build a strong and varied portfolio of material for future use. CLASS SCHEDULE: The class will be given weekly assignments that involve creating and breaking stories from a variety of starting points. These assignments will be accompanied by lecture and class discussion, then completed in differing ways: individually, in teams, in class and at home. WEEKLY ASSIGNMENTS: Part One: Personal Stories Week 1: 1/13 – Where do we find stories? * Discuss class expectations, deadlines and syllabus * How do you find your stories? Experience, learning, imagination....and craft * IN-CLASS: anecdotes about going to or from school as a child * Natural storytelling...set up circumstances, collision/events, impact, aftermath * What can we push, expand, heighten, strengthen....make more dramatic * FOR NEXT CLASS: Bring in a story from your "family lore"....you or someone in the family, a story often told or told in confidence, one that resonates for you. Write in three paragraphs (about a page)...prepare to present verbally. o Who is the main character and why we care about him/her? o What is special about it? Why do you tell it? o Beginning, middle and end of the story. * Homework: Screen and Read: Lady Bird NO CLASS....Martin Luther King Jr. Day Week 2: 1/27 – Memory Stories * Discuss your "family lore" story. How do we create compelling stories from life? Is there a feature film here? Or is there a television series? A podcast? * FOR NEXT CLASS: write (for verbal presentation) about your greatest fear (now or in childhood) or greatest fantasy (now or then)...make it visceral * Homework: Screen Parasite Week 3: 2/3 – Greatest fear or fantasy stories * Discuss greatest fear/fantasy (what scares you the most/what power would you die to have?) Who is your main character? Can you describe their moment (the exact scene) of greatest fear or fantasy? How to build to that moment? * IN-CLASS: break into groups of two and create a pitch for both partners' favorite fear or fantasy story… * FOR NEXT CLASS: bring in something that makes you angry (can be personal or political or social) try to find the scene where that anger explodes * Homework: screen Dark Waters or Erin Brockavich or Michael Clayton Week 4: 2/10 – Writing from emotion to character * Discuss the thing that makes you angry. Is there a story there? A character? Workshop the story in class. * FOR NEXT CLASS: create three groups of three. Bring in three pitches for story episodes of a family sitcom: Blackish, Modern Family, The Simpsons, Broad City, Fleabag, etc. (We will vote on the shows and assign them in class.) * TO HAND IN: Rewrite a two-page pitch of one of your previous stories: your fear/fantasy assignment, your anger assignment, or your memory story Week 5: 2/17 – Writing Family Sitcom pitches * HAND IN: your two page pitch of one of your stories * Pitch and discuss sitcoms. Vote on the episode that gets picked up. * Discuss that sitcoms are always family (of some kind, even workplace) * FOR NEXT CLASS: world building – photo essays (power point) of a world you would like to use for a story. Discuss True Detective, Ladybird, Parasite, Friday Night Lights and how these shows/films rely on a sense of place. * Homework: screen Ford v Ferrari or The Crown Part Two: Using Genre to challenge your character and shape your story Week 6: 2/24 – Writing from place * Present your world to class via powerpoint/keynote with music if you like. Discuss ways to find a story for it. Is there a character who is an outgrowth of your particular place or a guide through it? Where is the conflict?! * Discuss genre and how genre can help shape a story and challenge your character. * FOR NEXT CLASS: write a supernatural or horror-story pitch from a scenario. (Can be a Black Mirror Episode or a feature pitch.) Concentrate on character and WHY the story happens to him/her. Week 7: 3/2 – The Supernatural/Horror Story * Pitch and discuss your supernatural or horror stories. Who is the main character and why do we care? How are we made to believe in the story? * FOR NEXT CLASS: Create a Trip With Destination (Road Trip) pitch. * Homework: screen 1917 Week 8: 3/9 – Road Trip * Discuss Road Trip pitches. * FOR NEXT CLASS: Midterm Project. Chose one of your pitches and develop it into a 5-7 page synopsis: a short pitch/teaser, description of the main character and then tell us the story, beginning-middle-resolution (acts 1-2-3.) Week 9: 3/17 – MIDSEMESTER BREAK Week 10: 3/23 – Writing for an Actor * HAND IN: MIDTERM PROJECTS * IN-CLASS: put actors' names in a hat. Put locations/worlds in a hat. Put genre in a hat. Teams pick and use the class to create a feature story for the actor/place. * FOR NEXT CLASS: Create a character (biography) who is unable to love. * Homework: screen Knives Out or War of the Roses or As Good as it Gets Week 11: 3/30 Rom-Com (Love story) * Present character who is unable to love. What is their NEED? * IN-CLASS: in groups find a perfect foil for that character. (A character MOST able to love or most able to crack the other's inability....a catalyst character) * How to make comedy out of this material? Is the love with the catalyst? * TO HAND IN: write a rom-com pitch (2 pages) How do they meet? What is the conflict? How does location help inform the story? How does it end? Is the character compelling enough? Is his/her need fulfilled? * FOR NEXT CLASS: In teams pitch 2 episodes of a detective series, procedural, hospital drama, HBO series or historical drama (examples to be decided in class). Week 12: 4/6 – One-hour episodic: Detective, Hospital, Procedural Pitches * HAND IN: 2 page rom-com pitch. * IN-CLASS: Teams pitch episodes for one-hour series. Vote on winning episode that gets picked up. * FOR NEXT CLASS: find a myth or character from classical literature that is interesting to you and could inspire a story. Part Three: Finding stories in myth, legend or existing material Week 12: 4/13 - Writing from Existing Material (Myth and Legend and Superheroes) * Discuss and workshop mythical character/story and story possibilities. * FOR NEXT CLASS: find a classical story/fairytale, (talk about how movies have used Shakespeare and Jane Austen) and create a high school story (comedy/romance/drama) using your chosen classical story as a guideline. * OR… Create a hero or superhero and a potential story – series. Who is your Luke, your Harry, your Spiderman. What is their introduction (or creation story?) Who is their guide? Who is their antagonist? Week 13: 4/20 – Writing from Existing Material (Myth and Legend and Superheroes) * Discuss you classical story/fairytale/legend story. Is your main character strong enough? How did the myth help inspire/inform your story? * Or discuss your hero/superhero stories. Talk about Star Wars/Harry Potter/Comic Book Stories. * FOR NEXT CLASS: Bring in a biography story. (*This assignment will be given earlier in the semester to give you time to do some research.) * Homework: screen Theory of Everything or Hidden Figures Week 14: 4/27 – Writing from Existing Material: The Biopic * Discuss your biography pitches. Is the character compelling enough to carry a feature and interest an actor? Are there enough obstacles? How does the world of the character help? Genre? * FINAL PROJECT: rewrite and expand any one of your pitches (not your midterm story) into a 5-10 synopsis. Due May 4 th noon. Last Class Day – April 27 MAY 4 TH , NOON – FINAL PORTFOLIO IS DUE: 1. Two Rewritten Pitches (from class) two pages each 3. Final synopsis (chosen from the second half of class pitches) 5-10 pages 2. Midterm synopsis – 5-7 pages EVALUATION CRITERIA: CNTV 250 grades will be based on careful consideration in the following areas of the students' work: 1. The ability to keep up with the writing required in the course's schedule. 3. Demonstrated understanding how to workshop and develop ideas into stories. 2. The ability to generate compelling characters and ideas for cinema and television. 4. The ability to develop a feature/pilot synopsis. CNTV 250 grades are based on: Writing Division Attendance Policy: Students are expected be on time and prepared for each class. On the third absence, students will have their final grade lowered by 10% and an additional 10% for each absence thereafter. Two late arrivals equals one full absence. Note: This is a change in policy. Instructors will no longer distinguish between an excused or unexcused absence. An absence will be an absence. NOTE: if you are a Writing for Screen and Television major/minor you must receive a grade of a C or better in order to receive degree credit. If you have any questions about the minimum grade required for credit please check with your home department. If you have an emergency and/or know you will miss class please contact your professor prior to class or contact the Writing Division at 213-740-3303. If a student has an emergency and additional accommodations are needed, those accommodations will need to come through the USC Campus Support and Intervention (CSI) office. The Writing Division recommends the student and/or advocate contact CSI at 213-821-4710 and their home department adviser for additional support. Statement on Academic Conduct and Support Systems Academic Conduct: Plagiarism – presenting someone else's ideas as your own, either verbatim or recast in your own words – is a serious academic offense with serious consequences. Please familiarize yourself with the discussion of plagiarism in SCampus in Part B, Section 11, "Behavior Violating University See additional information in SCampus and university policies on scientific Standards" policy.usc.edu/scampus-part-b. Other forms of academic dishonesty are equally unacceptable. misconduct, policy.usc.edu/scientific-misconduct. Support Systems: Student Health Counseling Services - (213) 740-7711 – 24/7 on call Free and confidential mental health treatment for students, including short-term psychotherapy, group counseling, stress fitness workshops, and crisis intervention. engemannshc.usc.edu/counseling Student Health Leave Coordinator – 213-821-4710 https://policy.usc.edu/student-health-leave-absence/ Located in the USC Support and Advocacy office, the Health Leave Coordinator processes requests for health leaves of absence and advocates for students taking such leaves when needed. National Suicide Prevention Lifeline - 1 (800) 273-8255 – 24/7 on call Free and confidential emotional support to people in suicidal crisis or emotional distress 24 hours a day, 7 days a week. suicidepreventionlifeline.org Relationship and Sexual Violence Prevention Services (RSVP) - (213) 740-4900 – 24/7 on call Free and confidential therapy services, workshops, and training for situations related to gender-based harm. engemannshc.usc.edu/rsvp Office of Equity and Diversity (OED) | Title IX - (213) 740-5086 Information about how to get help or help a survivor of harassment or discrimination, rights of protected classes, reporting options, and additional resources for students, faculty, staff, visitors, and applicants. The university prohibits discrimination or harassment based on the following protected characteristics: race, color, national origin, ancestry, religion, sex, gender, gender identity, gender expression, sexual orientation, age, physical disability, medical condition, mental disability, marital status, pregnancy, veteran status, genetic information, and any other characteristic which may be specified in applicable laws and governmental regulations. equity.usc.edu, titleix.usc.edu Bias Assessment Response and Support - (213) 740-2421 Avenue to report incidents of bias, hate crimes, and microaggressions for appropriate investigation and response. studentaffairs.usc.edu/bias-assessment-response-support The Office of Disability Services and Programs - (213) 740-0776 Support and accommodations for students with disabilities. Services include assistance in providing readers/notetakers/interpreters, special accommodations for test taking needs, assistance with architectural barriers, assistive technology, and support for individual needs. dsp.usc.edu USC Support and Advocacy - (213) 821-4710 Assists students and families in resolving complex personal, financial, and academic issues adversely affecting their success as a student. studentaffairs.usc.edu/ssa Diversity at USC - (213) 740-2101 Information on events, programs and training, the Provost's Diversity and Inclusion Council, Diversity Liaisons for each academic school, chronology, participation, and various resources for students. diversity.usc.edu USC Emergency - UPC: (213) 740-4321, HSC: (323) 442-1000 – 24/7 on call Emergency assistance and avenue to report a crime. Latest updates regarding safety, including ways in which instruction will be continued if an officially declared emergency makes travel to campus infeasible. dps.usc.edu, emergency.usc.edu USC Department of Public Safety - UPC: (213) 740-6000, HSC: (323) 442-120 – 24/7 on call Non-emergency assistance or information. dps.usc.edu Diversity and Inclusion Diversity and Inclusion are foundational to the SCA community. We are committed to fostering a welcoming and supportive environment where students of all identities and backgrounds can flourish. The classroom should be a space for open discussion of ideas and self- expression; however, SCA will not tolerate verbal or written abuse, threats, harassment, intimidation or violence against person or property. If students are concerned about these matters in the classroom setting they are encouraged to contact their SCA Diversity and Inclusion Liaison, http://cinema.usc.edu/about/diversity.cfm; email firstname.lastname@example.org. You can also report discrimination based on a protected class here https://equity.usc.edu/harassment-or-discrimination/ Disruptive Student Behavior: Behavior that persistently or grossly interferes with classroom activities is considered disruptive behavior and may be subject to disciplinary action. Such behavior inhibits other students' ability to learn and an instructor's ability to teach. A student responsible for disruptive behavior may be required to leave class pending discussion and resolution of the problem and may be reported to the Office of Student Judicial Affairs for disciplinary action. PLEASE NOTE: FOOD AND DRINKS (OTHER THAN WATER) ARE NOT PERMITTED IN ANY INSTRUCTIONAL SPACES IN THE CINEMATIC ARTS COMPLEX.
<urn:uuid:8c2f0525-9625-4519-aeb1-e1703be0f24f>
CC-MAIN-2022-49
https://web-app.usc.edu/soc/syllabus/20201/19360.pdf
2022-12-09T16:51:22+00:00
crawl-data/CC-MAIN-2022-49/segments/1669446711417.46/warc/CC-MAIN-20221209144722-20221209174722-00181.warc.gz
637,972,553
3,580
eng_Latn
eng_Latn
0.992551
eng_Latn
0.995226
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 2033, 4396, 6598, 8866, 10665, 13279, 15956 ]
[ 2.484375 ]
1
0
TOWN OF WESTFORD HEALTH DEPARTMENT 55 Main Street TOWN HALL WESTFORD, MASSACHUSETTS 01886 (978) 692-5509 Fax (978) 399-2558 November 4 th , 2022 The Massachusetts Department of Agriculture (MDAR) has confirmed Avian Flu in a flock of backyard birds in Dunstable. The Massachusetts Department of Agricultural Resources (MDAR) and the Massachusetts Department of Emergency Management (MEMA) are investigating the case and have asked that all surrounding communities share information on "how to protect your backyard birds"; which includes chickens. Here are some simple steps bird owners can take to try to protect their flocks from avian influenza: * Wild migratory birds are natural carriers for Avian Flu. Preventing wild birds from mixing with domestic flocks is essential to disease control. Poultry owners should assure their birds are kept away from wild birds, particularly waterfowl. * New birds should be completely isolated for at least one month prior to being added into the flock. Birds that are returning home from fairs or shows should also be isolated from the home flock as if they were new arrivals. * Avoid unnecessary movement of poultry between locations and be aware of the potential to carry AFLU contaminated materials onto properties where birds are kept. * Limit the number of people that have access to your flock. * Do not kiss your birds. * Do not share equipment with other bird owners without thoroughly cleaning and disinfecting between locations. * Keep your distance (restrict access to your property and your birds). * Keep it clean (clean and disinfect your clothes, shoes, equipment, and hands). * Do not risk disease from your neighbor (do not borrow lawn and garden equipment, tools, or poultry supplies from other bird owners). * Do not haul disease home (if you have been near other birds or bird owners, clean and disinfect poultry cages and equipment before going home). * Know the warning signs (sudden increase in bird deaths, sneezing, coughing, nasal discharge, watery or green diarrhea, lack of energy, poor appetite, drop in egg production, swelling around the eyes, neck, and head, and purple discoloration of wattles, combs, and legs); and * Report sick birds (call your local or State veterinarian, or USDA toll-free at 1-866-536-7593). For more information: https://www.usda.gov/sites/default/files/documents/avian-influenza-protect-birds-qa.pdf https://www.mass.gov/service-details/avian-influenza For Bird Hunters: https://www.mass.gov/news/attention-bird-hunters
<urn:uuid:a6e8dcc8-3380-4c8d-9a77-78b61380be53>
CC-MAIN-2022-49
https://www.westfordma.gov/DocumentCenter/View/12042/Avian-Flu-in-Birds
2022-12-09T16:13:21+00:00
crawl-data/CC-MAIN-2022-49/segments/1669446711417.46/warc/CC-MAIN-20221209144722-20221209174722-00179.warc.gz
1,122,357,323
557
eng_Latn
eng_Latn
0.992926
eng_Latn
0.992926
[ "eng_Latn" ]
false
docling
[ 2531 ]
[ 2.046875 ]
1
0
#1 #2 #3 Estimate Tips Name: Choose the best answer Estimate the amount of the tip by rounding the bill to the nearest dollar before calculating. 67% tip on a bill of $14.55. Be sure to include the cents. Show your work Choose the best answer Estimate the amount of the tip by rounding the bill to the nearest dollar before calculating. 53% tip on a bill of $9.65. Be sure to include the cents. Show your work Estimate the amount of the tip by rounding the bill to the nearest dollar before calculating. 83% tip on a bill of $9.90. Be sure to include the cents. Show your work $8.91 $10.05 $11.57 $9.19 $5.60 $4.80 $5.30 $3.90 $ Get more worksheets at http://www.mathgames.com/worksheets CC.7.59 Play online at http://www.mathgames.com/skill/7.59 Page 1 of 4 #4 #5 #6 Estimate Tips Name: Estimate the amount of the tip by rounding the bill to the nearest dollar before calculating. 43% tip on a bill of $24.69. Be sure to include the cents. Show your work Choose the best answer Estimate the amount of the tip by rounding the bill to the nearest dollar before calculating. 71% tip on a bill of $23.71. Be sure to include the cents. Show your work Estimate the amount of the tip by rounding the bill to the nearest dollar before calculating. 3% tip on a bill of $14.62. Be sure to include the cents. Show your work $ $13.25 $11.95 $12.56 $17.04 $ Get more worksheets at http://www.mathgames.com/worksheets CC.7.59 Play online at http://www.mathgames.com/skill/7.59 Page 2 of 4 #7 #8 #9 Estimate Tips Choose the best answer Estimate the amount of the tip by rounding the bill to the nearest dollar before calculating. 91% tip on a bill of $15.26. Be sure to include the cents. Show your work Choose the best answer Estimate the amount of the tip by rounding the bill to the nearest dollar before calculating. 3% tip on a bill of $5.58. Be sure to include the cents. Show your work Choose the best answer Estimate the amount of the tip by rounding the bill to the nearest dollar before calculating. 44% tip on a bill of $11.28. Be sure to include the cents. Show your work $14.94 $13.65 $11.70 $17.04 $0.18 $0.22 $0.15 $0.13 $5.30 $4.84 $5.59 $3.87 Get more worksheets at http://www.mathgames.com/worksheets CC.7.59 Play online at http://www.mathgames.com/skill/7.59 Page 3 of 4 #10 #11 #12 Estimate the amount of the tip by rounding the bill to the nearest dollar before calculating. 51% tip on a bill of $21.45. Be sure to include the cents. Show your work Estimate the amount of the tip by rounding the bill to the nearest dollar before calculating. 90% tip on a bill of $11.40. Be sure to include the cents. Show your work Estimate the amount of the tip by rounding the bill to the nearest dollar before calculating. 16% tip on a bill of $16.58. Be sure to include the cents. Show your work $ $ $ Get more worksheets at http://www.mathgames.com/worksheets CC.7.59 Play online at http://www.mathgames.com/skill/7.59 Page 4 of 4 Estimate Tips Get more worksheets at http://www.mathgames.com/worksheets CC.7.59 Play online at http://www.mathgames.com/skill/7.59
<urn:uuid:40cfecd6-786b-44c0-aebf-d2ee586f6329>
CC-MAIN-2022-49
https://pdf.teachme.com/worksheet/7-59.pdf?&t=mg
2022-12-09T15:28:39+00:00
crawl-data/CC-MAIN-2022-49/segments/1669446711417.46/warc/CC-MAIN-20221209144722-20221209174722-00180.warc.gz
489,588,448
926
eng_Latn
eng_Latn
0.996795
eng_Latn
0.999094
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 783, 1522, 2351, 3019, 3155 ]
[ 3.796875 ]
1
0
Skill Building – Delegating Introduction How can you help people in your club prepare for future leadership roles and free up more time in your schedule so you can do other things? DELEGATION. Delegation is the key to a successful organization. Sharing responsibilities keeps members interested and enthusiastic about the group. You might be reluctant to delegate because you want to make sure the job is done right (your way). It might take longer then it would for you to do it on your own, but it will help your mental wellbeing. It will also help your health while improving the quality of the end project. You can make members feel unimportant and become apathetic if you don't share the responsibility of making the organization a success. Both the leader and the group can benefit greatly from delegation. Benefits Members become more involved and committed with effective delegation techniques are used. More projects are completed, and everyone gets a better chance of using their individual skills to help accomplish the greater goal. Student leaders are also less likely to burn out when the delegate – acquiring more experience with 'real life' teamwork scenarios. You Can Delegate By: * Asking for volunteers by a show of hands or passing a sign-up sheet (interest is a great motivator!). However, this method can be impersonal and you could be "stuck" if no one signs up. * Appointing or suggesting someone. Sometimes a member lacks selfconfidence and won't volunteer; appointing a person demonstrates your confidence in them. * Assigning through a committee. This takes the pressure off an individual and reinforces organizational structure. * Choosing "best fit" of person with the task is the most effective. Try to spread the enjoyable and responsible tasks around, giving more members status and value. Considerations for Effective Delegation * Choose the appropriate people for specific tasks. Consider their availability, interest and capabilities. Specific responsibilities to be delegated to a particular person must be something they can complete and want to do. * Explain why individuals were selected and talk about mutually set goals. Share the big picture. * Define clearly the responsibilities being delegated to each person. Explain what is expected of the person(s) and give them freedom to complete the task in their own way. Remember everyone accomplishes tasks differently. * Invite them to ask for help. Give accurate and honest feedback. People want and deserve to know how they are doing. Allow for risk-taking and mistakes. * As a leader, it can be hard for you to "let go;" you like being the doer. Let them do the job! Delegating does not eliminate work; it simply changes it. As you delegate appropriately, a multiplier effect occurs. * Follow up. Check-in periodically to see if people have any questions regarding how a project is supposed to be done.
<urn:uuid:6e9dd09f-a8d3-4186-bb73-1a763bcbd6ad>
CC-MAIN-2022-49
https://www.skidmore.edu/leadership/documents/skillbuilding_delegating.pdf
2022-12-09T15:12:06+00:00
crawl-data/CC-MAIN-2022-49/segments/1669446711417.46/warc/CC-MAIN-20221209144722-20221209174722-00185.warc.gz
1,046,376,124
600
eng_Latn
eng_Latn
0.998319
eng_Latn
0.998444
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 1936, 2904 ]
[ 2.828125 ]
1
0
Foods that are toxic for dogs There are certain foods that you should not feed your dog under any circumstances. Foods that are perfectly suitable for human consumption, as well as other animals, may be toxic and even poisonous to your dog, posing a serious threat to its health and well-being. Why? Because all animals have very different rates of metabolism. Metabolism is basically the process of breaking down food and turning it into energy. List of Foods Not to Feed Your Dog Alcohol – I'm sure you've heard of the birthday parties where the dog accidentally gets into some of the spilled keg beer, and then gets all silly to the amusement of the crowd. While it may be funny to you, it's not funny to your dog. Alcohol can cause not only intoxication, lack of coordination, poor breathing, and abnormal acidity, but potentially even coma and/or death. Apple Seeds – The casing of apple seeds are toxic to a dog as they contain a natural chemical (amygdlin) that releases cyanide when digested. This is really only an issue if a large amount was eaten and the seed were chewed up by the dog, causing it to enter its blood stream. But to play it safe, be sure to core and seed apples before you feed them to your dog. Avocado – Avocados contain Persin, which can cause diarrhea, vomiting, and heart congestion. Baby food – Baby food by itself isn't terrible, just make sure it doesn't contain any onion powder. Baby food also doesn't contain all the nutrients a dog relies on for a healthy, well maintained diet. Cooked Bones – When it comes to bones, the danger is that cooked bones can easily splinter when chewed by your dog. Raw (uncooked) bones, however, are appropriate and good for both your dog's nutritional and teeth. Candy and chewing gum – Not only does candy contain sugar, but it often contains Xylitol, which can lead to the over-release of insulin, kidney failure, and worse. Cat food – Not that they would want this anyway, but cat food contains proteins and fats that are targeted at the diet of a cat, not a dog. The protein and fat levels in cat food are too high for your dog, and not healthy. Chocolate – You've probably heard this before, but chocolate is a definite no no for your pup. And it's not just about caffeine, which is enough to harm your dog by itself, but theobromine and theophylline, which can be toxic, cause panting, vomiting, and diarrhea, and damage your dog's heart and nervous systems. Citrus oil extracts – Can cause vomiting. Coffee – Not sure why you would give your dog coffee, but pretty much the same applies here as to chocolate. This is essentially poison for your dog if ingested. Corn on the cob– This is a sure way to get your dog's intestine blocked. The corn is digested, but the cob gets lodged in the small intestine, and if it's not removed surgically, can prove fatal to your dog. Additionally, too much corn kernels can upset the digestive tract as well so be cautious to not feed too much. Fat trimmings – Can cause pancreatitis. Fish – The primary fish that you need to be careful about are salmon and trout. Raw salmon can be fatal to dogs if the fish is infected with a certain parasite, Nanophyetus salmincola. The parasite itself isn't dangerous to dogs, but is often infected with a bacteria called Neorickettsia helminthoeca, which in many cases is fatal to dogs if not treated properly. If diagnosis occurs early on, the dog has a great chance of recovering. Cooked salmon is fine as it kills the parasite. Grapes and raisins – This is one that lots of dog owners are unaware of. Grapes contain a toxin that can cause severe liver damage and kidney failure. We've heard stories of dogs dying from only a handful of grapes so do not feed your pup this toxic food. Hops – An ingredient in beer that can be toxic to your dog. The consumption of hops by your dog can cause panting, an increased heart rate, fever, seizures, and even death. Human vitamins – Some human vitamins are okay to use, but the key is comparing the ingredients (all of them – active and inactive) to the vitamins your vet subscribes for your dog (often you can get the human equivalent for much less money). Make sure there's no iron – iron can damage the digestive system lining, and prove poisonous for the liver and kidneys. Liver – In small amounts, liver is great but avoid feeding too much liver to your dog. Liver contains quite a bit of Vitamin A, which can adversely affect your pup's muscles and bones. Macadamia nuts – These contain a toxin that can inhibit locomotory activities, resulting in weakness, panting, swollen limbs, and tremors as well as possible damage to your dog's digestive, nervous, and muscle systems. Marijuana – Not that you would pass the bong to your dog, but if you do, you should know that it can adversely affect your pup's nervous system and heart rate, and induce vomiting. Milk and dairy products – While small doses aren't going to kill your dog, you could get some smelly farts and some nasty cases of diarrhea. Why? Dogs are lactose intolerant (as are an increasing number of humans today), and don't have enough of the lactase enzyme to properly digest dairy foods. If you really need to give them dairy, look into lactose-free dairy products. Mushrooms – Just as the wrong mushroom can be fatal to humans, the same applies to dogs. Don't mess with them. Onions and chives – No matter what form they're in (dry, raw, cooked, powder, within other foods), onions are some of the absolute worst foods you could possibly give your pup (it's poisonous for dogs, and it's even worse for cats). They contain disulfides and sulfoxides (thiosulphate), both of which can cause anemia and damage red blood cells. Persimmons, peaches, and plums – If you live in an area that is home to persimmon, peach, or plum trees, look out. Persimmon seeds and peach and plum pits can cause intestinal obstruction and enteritis. You'll want to make sure there aren't any wild persimmon or other fruit trees that produce seeds growing in your backyard. If you notice your dog pooping all over the place, and see a bunch of seeds or pits in their waste, you'll need to break out the saw and chop down some trees. Rhubarb, and tomato leaves – These contain oxalates, which can adversely affect the digestive, nervous, and urinary systems. Raw fish – Another vitamin B (Thiamine) deficiency can result from the regular consumption of raw fish. Loss of appetite will be common, followed by seizures, and in rare instances, death. Salt – Just like salt isn't the healthiest thing for humans, it's even less healthy for dogs. Too much of it can lead to an imbalance in electrolyte levels, dehydration and potentially diarrhea. String – While not a food itself, foods can often contain or be similar to string (ie. meat you've wrapped for the oven). If your dog were to eat a string, it could get stuck in their digestive tract and cause complications. Sugar – This applies to any food containing sugar. Make sure you check the ingredient label for human foods – corn syrup (which is a less expensive form of sugar or glucose) is found in just about everything these days. Too much sugar for your pup can lead to dental issues, obesity, and even diabetes. Tobacco – A major toxic hazard for dogs (and humans). The effects nicotine has on dogs are far worse than on humans. Nicotine can damage your pup's digestive and nervous systems, increase their heart rate, make them pass out, and ultimately result in death. Xylitol – A sugar alcohol found in gum, candies, baked goods, and other sugar-substituted items, Xylitol, while causing no apparent harm to humans, is extremely toxic to dogs. Even small amounts can cause low blood sugar, seizures, liver failure, even death for your pup. Yeast (on its own or in dough) – Just like yeast rises in bread, it will also expand and rise within your pup's tummy. Make sure they don't get any. While mild cases will cause gas, lots of farting, and discomfort – too much of it could rupture their stomach and intestines. If Your Dog Eats What It Shouldn't Dogs explore with their mouth. And, no matter how cautious you are, it's possible your dog can find and swallow what it shouldn't. It's a smart idea to always keep the numbers of your local vet, the closest emergency clinic, and the ASPCA Animal Poison Control Center -- (888) 426-4435 -- where you know you can find them in an emergency. And, if you think your dog has gotten into something toxic, call for emergency help at once.
<urn:uuid:f6f60c1a-6392-4275-ab24-f4d4c64f859e>
CC-MAIN-2022-49
https://www.stayandplaydogcare.com/_files/ugd/9587bf_b4bf6be52c2f4178a83a25d32bc53f6c.pdf
2022-12-09T14:50:58+00:00
crawl-data/CC-MAIN-2022-49/segments/1669446711417.46/warc/CC-MAIN-20221209144722-20221209174722-00184.warc.gz
1,054,263,389
1,891
eng_Latn
eng_Latn
0.9992
eng_Latn
0.999228
[ "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 2488, 5716, 8521 ]
[ 2.546875 ]
2
1
Bible Study # 28 Exodus 16.22–36 03–11–2021 God's intention was that the people would gather a double portion on the sixth day of the week, as the manna was not to be provided on the Sabbath. This they did, and the leaders confirmed this to Moses. He reiterated what God had already said about the seventh day. It was to be 'a Sabbath observance', 'a holy Sabbath to the Lord'. Instructions were given concerning the necessary preparation of food for the Sabbath. Whatever cooking method was adopted (baking or boiling), after partaking of it for that day, the remaining amount was reserved for the next morning. Verses 24–26 record the result of Moses' instruction. There was no corruption of the manna, and hence no tainted smell from it (cf. v. 20). He encouraged the people to eat the remaining cooked manna from the previous day, again reminding them that no new manna was to be provided on the seventh day. The seventh day, the Sabbath, was marked as distinctive by the absence of a fresh supply of manna. The NIV's 'nevertheless', though catching the spirit of the passage, is an unnecessary insertion, 'Nevertheless some of the people went out to gather'. The RSV, NRSV, and ESV all have 'On the seventh day some of the people went out to gather', which is a suitable translation of the Hebrew. This explicit command was met with disobedience. It was a fruitless search for manna on the seventh day, for none was provided. The Lord's message to the people through Moses was a question to them: 'How long will you refuse to keep my commands and my instructions?' They were reminded that God was a generous giver, having given them the Sabbath, and then given them a double portion of food so that they would have sufficient food for the seventh day. No excursions outside the camp were to be permitted on the Sabbath, and as a consequence the people were able to enjoy its rest. This verse picks up the name of the food, 'manna', mentioned already in verse 15. Here reference to its color and taste is added. It was 'white like coriander seed' and tasted 'like wafers made with honey'. Further particulars about the manna are given in Numbers 11:6-9. The Lord gave a particular 'word' concerning preservation of some of the manna. The instruction was that an omer of it was to be kept so that future generations could see the wilderness food that Israel ate after redemption from Egypt. It was the bread that God caused the people to eat, and so there was to be a memorial to that divine provision. Following the instructions, Moses saw to it that Aaron put the manna 'in front of the testimony'. This must have occurred later, as the building of the Tent of Meeting and the ark had not taken place at this time. The ark is variously designated in the Old Testament ('the ark of the covenant', 'the ark of the Lord', 'the holy ark'), and calling it 'the ark of the testimony' occurs thirteen times. The word 'testimony' is applied to God's testimonies, the tabernacle, and the ark, while in a few instances it stands alone to designate the ark (here in 16:34 and in 27:21; 30:36; Lev. 16:13). The final two verses, which may also have been added later than the main narrative here, note that the food of heaven was provided for a period of forty years, and that the size of an omer was one tenth of an ephah. Our study will continue with Exodus 17.1–16.
<urn:uuid:11800266-0785-48c7-bcab-4c7a74d1e537>
CC-MAIN-2022-49
https://www.woodlandschurch.com/hp_wordpress/wp-content/uploads/2021/03/Bible-Study-28-Exodus-16.22-36-03-11-2021.pdf
2022-12-09T17:19:10+00:00
crawl-data/CC-MAIN-2022-49/segments/1669446711417.46/warc/CC-MAIN-20221209144722-20221209174722-00184.warc.gz
1,126,514,302
777
eng_Latn
eng_Latn
0.999304
eng_Latn
0.999304
[ "eng_Latn" ]
false
docling
[ 3378 ]
[ 2.140625 ]
1
0
Age Age 5 to 6 years PreG1 GS An inquiry into: Who We Are An inquiry into the nature of the self; beliefs and values; personal, physical, mental, social and spiritual health; human relationships including families, friends, communities and cultures; rights and responsibilities; what it means to be human Central Idea: People's choices and routines influence their lifestyles Key Concepts: function, causation, responsibility Related Concepts: balance, well-being Lines of Inquiry: * Daily habits and routines (hygiene, sleep, play, eating) * Balanced choices * Consequences of choices AIA Program of Inquiry 2021-2022 An inquiry into: Where We Are in Place and Time An inquiry into: How We Express Ourselves An inquiry into: How the World Works An inquiry into orientation in place and time; personal histories; homes and journeys; the discoveries, explorations and migrations of humankind; the relationships between and the interconnectedness of individuals and civilizations, from local and global perspectives. Central Idea: Exploring family backgrounds allows us to understand who we are and where we come from. Key Concepts: form, connection, perspective Lines of Inquiry: * Family experiences and traditions * Similarities and differences between families * Reflecting on who is important in our family and why An inquiry into the ways in which we discover and express Ideas, feelings, nature, culture, beliefs and values; the ways in which we reflect on, extend and enjoy our creativity; our appreciation of the aesthetic. Central Idea: Cultures can influence celebrations and traditions. Key Concepts: function, perspective connection Related Concepts: culture, traditions Lines of Inquiry: * Types of celebrations and traditions * How people celebrate * Why people celebrate An inquiry into the natural world and its laws; the interaction between the natural world (physical and biological) and human societies; how humans use their understanding of scientific principles; the impact of scientific and technological advances on society and on the environment Central Idea: Different factors affect balance and motion Key Concepts: function, causation, change Related Concepts: equilibrium, mechanics Lines of Inquiry: * How things move * How we can affect the way things move and or balance * How things balance An inquiry into: How We Organize Ourselves An inquiry into the interconnectedness of human-made systems and communities; the structure and function of organizations; societal decision-making; economic activities and their impact on humankind and the environment. Central Idea: Our community can be enriched by our members and their various roles. Key Concepts: change, perspective Related Concepts: continuity and diversity Lines of Inquiry: * What is community * People within a community * The personal stories of community members An inquiry into: Sharing the Planet An inquiry into rights and responsibilities in the struggle to share finite resources with other people and with other living things; communities and the relationships within and between them; access to equal opportunities; peace and conflict resolution. Central Idea All living things go through a process of change. Key Concepts: change, connection, function Related Concepts: cycles, transformation Lines of Inquiry: * Life cycles * How living things change over their life time and the effect of our action on the environment. * Developmental stages of various living things Age 7 to 8 years G2 P2 An inquiry into: Who We Are An inquiry into the nature of the self; beliefs and values; personal, physical, mental, social and spiritual health; human relationships including families, friends, communities and cultures; rights and responsibilities; what it means to be human Central Idea: The five senses can help people explore and understand their environment. Key Concepts: form, function, connection Lines of Inquiry * The five senses and their uses. * Taking care of our senses * Understanding disabilities related to our senses * The role senses play in understanding our environment AIA Program of Inquiry 2021-2022 An inquiry into: Where We Are in Place and Time An inquiry into: How We Express Ourselves An inquiry into: How the World Works An inquiry into orientation in place and time; personal histories; homes and journeys; the discoveries, explorations and migrations of humankind; the relationships between and the interconnectedness of individuals and civilizations, from local and global perspectives. Central Idea: Exploring Egyptian civilization supports the understanding of its influence on the world. Key Concepts: change, form, connection Related Concepts: context, location, orientation Lines of Inquiry: * Egypt's location in the world * Representations of Egypt through time * Egypt, a cradle of civilization An inquiry into the ways in which we discover and express Ideas, feelings, nature, culture, beliefs and values; the ways in which we reflect on, extend and enjoy our creativity; our appreciation of the aesthetic. Central Idea: People use different forms of art to express feelings, ideas, and beliefs. , Key Concepts: form perspective Related Concepts: perception, self-expression Lines of Inquiry: * The diverse ways in which people express themselves * Our artist expression * The role of art in culture and society An inquiry into the natural world and its laws; the interaction between the natural world (physical and biological) and human societies; how humans use their understanding of scientific principles; the impact of scientific and technological advances on society and on the environment Central Idea: Simple machines transfer force and affect the way humans do work. Key Concepts: causation, function, connection Lines of Inquiry: * Natural forces allow movement * How simple machines work * How simple machines affect our lives An inquiry into: How We Organize Ourselves An inquiry into the interconnectedness of human-made systems and communities; the structure and function of organizations; societal decision-making; economic activities and their impact on humankind and the environment. Central Idea: Working together can help people achieve a common goal. Key Concepts: causation, responsibility, function Related Concepts: work, collaboration, entrepreneurship, service Lines of Inquiry * Importance of different types of jobs * Teamwork planning * Our behaviour when working with others An inquiry into: Sharing the Planet An inquiry into rights and responsibilities in the struggle to share finite resources with other people and with other living things; communities and the relationships within and between them; access to equal opportunities; peace and conflict resolution. Central Idea: Climate change affects ecosystems. Key Concepts: connection, causation, responsibility Related Concepts: climate, cycles, pollution, change Lines of Inquiry: * Factors that influence weather * The relation between weather and climate * Cause and effects of climate change * Human responsibility in dealing with climate change
<urn:uuid:3427807a-b97d-4053-8697-e542b0ce042a>
CC-MAIN-2022-49
https://aia-alex.com/wp-content/uploads/sites/8/2022/02/POI-2021-2022-English-1-2.pdf
2022-12-09T15:50:52+00:00
crawl-data/CC-MAIN-2022-49/segments/1669446711417.46/warc/CC-MAIN-20221209144722-20221209174722-00184.warc.gz
112,719,047
1,383
eng_Latn
eng_Latn
0.991181
eng_Latn
0.991064
[ "unknown", "eng_Latn", "eng_Latn" ]
false
docling
[ 5, 3514, 7167 ]
[ 4.25 ]
1
0
For parents and carers Wellbeing support for students during the school holidays This guide provides tips and resources for parents, carers and families to support the mental health and wellbeing of children and young people in their care during the school holidays. This includes services to reach out to if more support is needed. Actions that support positive mental health Encourage your young person to: * Exercise and eat healthily to boost their mood * Prioritise sleep to support mental and emotional wellbeing * Explore relaxation techniques and coping strategies * Stay in touch and catch up with friends and loved ones * Make time to do things they enjoy * Practice positive self-talk, and remind them they are not alone Signs a child or young person may need mental health support In some cases, these actions will not be enough to support positive mental health. Keep an eye out and seek professional help for changes that last two or more weeks such as: * Loss of interest or involvement in activities normally enjoyed * Feeling 'low', unusually stressed or worried * Ordinary things get harder * Being easily irritated or angry * Taking more dangerous risks, like using alcohol or drugs * Withdrawal or feeling overwhelmed * Difficulties with concentration and motivation * Having a lot of negative thoughts * Changing in sleeping and eating. 2 3 * Seek professional help if needed. 1 The Department have developed wellbeing activities and conversation starters for parents and carers of primary school-aged children and secondary school-aged children. Feeling it: mindfulness resources and activities for senior secondary students. Smiling Mind gives tips on self-care, understanding and managing emotions, being mindful, being kind to yourself, navigating uncertainty and preparing for change. Young people supporting each other Young people are most likely to turn to each other for support before seeking out an adult or service provider. Young people can support each other by: * contacting 000 if a friend needs urgent assistance or is at risk of harming themselves or others * reaching out to a friend, offering support and letting them know you care * letting their friend know they may need to tell a trusted adult about their concerns. Having these types of conversations can be difficult for young people. Information for young people on how to support a friend is available on the headspace website: How to help a friend going through a tough time Mental health support * Your local GP * headspace Counselling: Victorian Government secondary school students, including those who have just finished schooling, can access counselling services from headspace. During the holidays, students can self‑refer by calling their local headspace centre. * eheadspace: 1800 650 890 www.headspace.org.au/eheadspace * Kids Helpline: 1800 551 800 www.kidshelpline.com.au * Lifeline: 13 11 14 www.lifeline.org.au * Beyond Blue: 1300 224 636 www.beyondblue.org.au * Head to Help: 1800 595 212 www.headtohelp.org.au * Suicide Call Back Service: 1300 659 467 www.suicidecallbackservice.org.au * Family violence information and supportservices * Contacting 000 for urgent assistance Family violence support and resources * Safe Steps: 1800 015 188 www.safesteps.org.au * 1800RESPECT: 1800 737 732 www.1800respect.org.au * What's okay at home: www.woah.org.au * Family violence support Self‑harm and suicide prevention resources * Getting a mental health care plan (ReachOut) * What you need to know about self‑harm (headspace) * How to help when someone is suicidal (SANE Australia) Mental health resources * Mental Health Toolkit: contains resources for students, parents and carers to support the mental health and wellbeing of children and young people in their care including: o Raising Learners Podcast Series: providing expert advice/information to parents/carers on topics including how to keep your child safe online o Understanding mental health – fact sheet (Orygen) o Learn how to handle tough times (headspace) o Get into life (to keep your headspacehealthy) (headspace) * Supporting your young person during the holidays (headspace)
<urn:uuid:c1c47b89-b6c9-406b-9fe2-8149e42575d6>
CC-MAIN-2022-49
https://gisbornesc.vic.edu.au/wp-content/uploads/2020/12/For-parents-and-carers-Wellbeing-support-for-students-during-the-school-holidays.pdf
2022-12-09T15:13:42+00:00
crawl-data/CC-MAIN-2022-49/segments/1669446711417.46/warc/CC-MAIN-20221209144722-20221209174722-00186.warc.gz
308,444,150
899
eng_Latn
eng_Latn
0.985028
eng_Latn
0.989006
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 1820, 4178 ]
[ 2.671875 ]
5
0
5D Fan Lai Sze, Nancy Educational Inequality in the World's Top Educational System, Hong Kong "Education is the most powerful weapon which you can use to change the world." by Nelson Mandela. Education is believed to be the only way out of poverty, inequality and discrimination. What if inequality exists in education itself? Before we move on to this topic, we must understand the differences between various types of schools in Hong Kong. The types of schools include public local schools, Direct Subsidy Scheme (DSS) schools, private schools and international schools. The major difference between them is that DSS schools, private schools and international schools have more independence regarding admissions and are able to operate with greater autonomy compared with public local schools. As they can charge steep tuition fees to obtain extra resources, it enhances the quality of their teaching. However, the exorbitant fee needed in exchange for good-quality education means that students from a humble family background stand a smaller chance of getting into prestigious schools than students from a privileged background. As the saying goes, "Knowledge changes fate." but it is difficult for grassroots students to climb up the social ladder since their chance of receiving good-quality education is limited. The reduction of social mobility has them trapped in a vicious cycle as they only get poorer, widening the gap between the rich and the poor. The government claims the problem can be relieved with the introduction of fee remission. To ensure students could attend DSS schools without financial obstacles, DSS schools must provide parents in need with tuition reduction or scholarship programs. For example, the Diocesan Girls' School scholarship, which is awarded to academically outstanding students, can total up to 100% to 150% of the annual school fees charged. It is believed that with this great deal of remission, a hand can be given to the grassroots. Scholarship is, of course, undeniably one of the effective ways in relieving grassroots students' financial burden as well as an incentive to encourage them to keep the good work, by rewarding their diligence. However, scholarships are only provided for the top students, to become which requires a lot of prerequisites. Not only you have to be intellectually talented, self-disciplined or hard-working, it also depends very much on your family background. In order to have such high achievements, you need enough financial resources to enroll in additional classes after school or born to well-educated intellectual parents who can introduce you to good resources and discuss academic topics with you. But for grassroots students, all these are far-fetched. They lack financial resources for them to attend tutorial classes. Their parents are mostly low-income workers with relatively low education levels. Therefore, the top students who get scholarships are mostly from a wealthy family, instead of students from a humble family who really needs it. The nature of scholarship has further reinforced inequality between the rich and the poor, making the problem even worse. Instead of providing scholarships, raising the application threshold of DSS schools can also be one of the alternative ways to ease the problem. DSS schools would continue to receive full subsidy from the government until its fee level reaches 2(⅓) of the DSS unit subsidy rate, encouraging schools to turn into DSS schools and receive a higher income. The rise of the application threshold has saved more resources for other public local schools, giving students opportunities to receive additional support services or facilities without paying high school fees in DSS schools. At the same time, DSS schools need to lower the school fees if they want to get government subsidies, resulting in an affordable tuition fee which helps relieve the financial burden of poor students. In this way, not only the rich students stand the chance to receive quality education, but such educational opportunities also become accessible to poor students. The inequality in education has been a long-existed problem for centuries. Educational opportunities should be something that are based on students' ability rather than their family background. An American educator, Claire Fagin once said, "Knowledge will bring you the opportunity to make a difference." Doesn't everyone deserve the opportunity to make a difference through education?
<urn:uuid:d72b86da-cb3b-4657-98e5-26f06a8fa5ad>
CC-MAIN-2022-49
https://www.bhjs.edu.hk/uploads/files/5D%20Fan%20Lai%20Sze%20Nancy(1).pdf
2022-12-09T15:02:21+00:00
crawl-data/CC-MAIN-2022-49/segments/1669446711417.46/warc/CC-MAIN-20221209144722-20221209174722-00186.warc.gz
708,595,076
856
eng_Latn
eng_Latn
0.999094
eng_Latn
0.999203
[ "eng_Latn", "eng_Latn" ]
false
docling
[ 3185, 4524 ]
[ 2.234375 ]
1
0
NEW YORK CORNING-PAINTED POST MIDDLE SCHOOL 2018-2019 SCHOOL STATISTICS Designated in 2019 Re-Designated in Community Size - Rural School Enrollment - 1012 Grade Levels - 6-8 School Calendar - traditional Free & Reduced Lunch - 40% English Learners - 1% Students with Disabilities - 26% Corning-Painted Post Area Schools 35 Victory Highway, Painted Post, NY 14830 Tel 607-654-2966 Principal - Richard A. Kimble 88 Victory Highwhttps://www.corningareaschools.com/2 /h School Characteristics and Replicable Practices Academic Excellence Corning-Painted Post Middle School is an International Baccalaureate World School. Through the IB Learner Profile, the Approaches to Learning skills and the aims and objectives of Middle Years Programme, we ensure that we provide all students with the content-area and affective skills needed to achieve academically at the highest levels. Teachers work in collaborative grade-level and department teams to ensure that instruction is aligned and rigorous standards are maintained at all levels. 2018-2019 School Demographics * African American - 2% * Asian - 3% * Caucasian - 87% * Filipino - 0% * Hispanic - 3% * Native American - 1% * Pacific Islander - 0% * Other - 0% * Two or More - 4% Students are provided with opportunities to explore learning outside of traditional core classes. Students participate in foreign language, music, art, technology, and family and consumer science each year of their middle school experience. Classes in manufacturing, robotics and electronic music allow students to explore new technologies as they learn. Corning-Painted Post is a 1:1 district. All students in the middle school are assigned their own Chromebooks, and learn Digital Citizenship and twenty-first century research and information management skills along with their content area instruction. Developmental Responsiveness All teachers lead a small advisory group of 10-12 students. Advisories meet daily for a short homeroom, where students and advisors are able to monitor goals, connect to help resolve any issues, and build relationships. Additionally, advisory groups meet for longer sessions once a month, focusing on social-emotional learning topics. Advisors serve as an initial point of contact for staff and parents, while helping students set goals and build their Presentations of Learning. Students learn self-management and goal-setting skills by participating in Presentations of Learning, student-led conferences where they share their skills, goals and learning plan with their parents and advisors twice yearly. Behavior and management issues are resolved through Responsibility-Centered Discipline, a student management system that strives to teach students self-regulation and conflict resolution skills, rather than simply apply consequences for self-defeating behaviors. Corning-Painted Post Middle School's philosophy states that we are a "developmental bridge" between middle and high school, and so works extensively on transition programs, both from fifth grade into sixth, and to help eighth graders transition to high school. School visits, orientation events, parent meetings and conferences help ensure that students and families feel prepared, confident and excited about transition events. Social Equity The Corning-Painted Post School District is in the midst of an equity initiative, working as a district to ensure that all students have equal opportunity and voice within the district. CorningPainted Post Middle School is a pilot school within that initiative, taking the lead to develop equity programs among students, parents and staff. Our Hawk Pride program encourages students to "Be a Hawk" by striving to meet the four pillars of "Hawk Pride: Be Safe, Be Respectful, Be Accountable and Be Honest." Students are recognized through Hawk Pride coupons, Student of the Week designation and other programs when they achieve these goals. Every year, students participate in a climate survey, where we ask for feedback from all students in areas ranging from the quality of relationships they have with adults in their building to their perceptions of their own learning experience. Corning-Painted Post Middle School uses this feedback to continue to grow and develop our programs to strengthen areas students identified as helpful, and to fill any gaps identified within the survey. Organizational Support Corning-Painted Post Middle School adheres strongly to the district mission of "Students are the center of all we do." Our Middle School philosophy provides support with how the middle school works to help achieve that district goal, and that student-centered ideal provides the basis for goal-setting and decision-making The school is set up in 3 houses, and students and teachers work in grade-level teams within each house. All houses are assigned a social worker, school counselor and assistant principal, who also meet and work with teams to address student concerns and maintain vertical curricular integrity One executive principal, three assistant principals, four school counselors, four social workers, one dean of students, two resource officers and diverse other instructional and support staff ensure that there are many personnel resources available to meet all student needs Corning-Painted Post Middle School works hard to support instructional staff. There are many and diverse professional development opportunities and a strong, multi-year mentoring program for new teachers to the district and to the profession. We also host student teachers from several local universities, to build relationships and nurture the next generation of educators.
<urn:uuid:c9c2552e-325d-4cd3-8239-edd1e94384dc>
CC-MAIN-2022-49
https://www.middlegradesforum.org/_files/ugd/0b6eef_8bcdb5216bc5487998f370cf28fc321e.pdf
2022-12-09T16:48:03+00:00
crawl-data/CC-MAIN-2022-49/segments/1669446711417.46/warc/CC-MAIN-20221209144722-20221209174722-00188.warc.gz
938,343,062
1,110
eng_Latn
eng_Latn
0.975858
eng_Latn
0.996709
[ "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 1251, 4404, 5699 ]
[ 2.0625 ]
1
0
NOTES AND QUERIES. [Continued from page 130.] _____ III. I HAVE read your letter with much interest. May I say that we quite understand that you do not see your way to adopt a new system in a school which is already doing successful work on the lines for which it was started? Miss Mason was herself entirely averse to offering a "system"—a set of good plans (or even of bright ideas!) which used in and for themselves should produce certain results, and for this reason she did not care to send the programmes for payment only, but only on condition that they should be carried out in the light of the Philosophy of Education which has been her contribution to the cause of education. That she should use certain methods to carry out her work is a sine quâ non, but the methods do not belong to a system which can be bought and administered like a "cure" (which may or may not work) but are the outcome of principles which have resulted from certain "findings" as to the laws of mind. To discuss the method as if it were a system leads nowhere, for a system is cut and dried and the material upon which it is used must be made to fit; whereas a method is the result of principles, living organisms, which have powers of growth, expansion and adaptability. In answer to the objections of your colleague: (1) "I subscribed for the material for one year so that I could see what value it had to offer to us. I may be wrong in my action, but I was unable to get any particular value from it." A subscription for a year's programmes is of no value, as I have already indicated. There is no intrinsic merit in Miss Mason's method apart from the principles on which it is based. (2) "I do feel that the emphasis on 'living books' is important. I should be sorry indeed if our classes were not also stimulated to a wide use of such books. I do not feel, however, that this feature is a 'Mason feature,' despite the fact that it is made the centre of their system." Any schools can get living books and most of them do, but [p 201] the supply of books is regulated not by the children's needs but by the prevalent idea that a child's need is intensive rather than extensive, and also by the fact that though most school authorities are willing to be generous in matters of hygiene and apparatus, books do not as yet take the important place they should occupy. Also, the idea is still uppermost that a teacher, trained to be a specialist in one branch, has extracted the elixir of the subject of which he is master and is able to feed his pupils with it, pigeon-like, without effort on the part of the children. It is the principle that counts as regards "living books." Any good teachers know what they are and can get them without difficulty, but they do not supply books to the child as the food upon which he is to feed and grow. They rather incline to books of the tabloid order from which to supply the information by which the pupil may know what is necessary for examination purposes or for his future career. (3) "You probably remember my questioning of any single system as a supposed educational 'cure-all.'" We do not advocate any system as an educational "cure-all." Miss Mason's method, springing from vital principles and some knowledge of the laws of mind, seems to meet the needs of children at all points. A "school which is open-minded to the best of everything" is apt to become a patch-work of good plans without any unifying principle. (4) "May I add that even in England there are very strong opponents of the Mason method and many who think it very restrictive." That there is opposition goes without saying. No educational method that implies such a volte face from time-honoured practices could be suffered to make way uncriticised, but the opposition comes from those who do not distinguish between a method based on philosophic principles and a system which merely advocates devices that have been found useful. I add a few notes on the questions put by one of your teachers, but what I have already said applies in general to each of the questions, Nos. 2 to 9. (1) "Under this system how are children taught to read?" Miss Mason sketched in her first volume, Home Education, a method she had herself found successful, but she often recommended others, e.g., that contained in The Happy Readers, and we also use The New Beacon Reader (English edition, Ginn). Miss Mason avoided the use of coloured [p 202] letters and all apparatus other than a box of letters or words. She used to tell her students here, "Teachers must in this, as in all other matters, mix their work with brains," for children differ, and a method which helps one child may seem a stumbling block to another. A good teacher usually has a method she prefers, and Miss Mason was quite willing to leave it to the teacher as long as the child learnt to read! The age at which a child should read is also a matter of difference of opinion. Children should read well at 8½, but many read much earlier, some at 6½. Reading, however, is a mechanical art, and before a child is eight he should have become acquainted with many books. A child needs more mental food up to six or seven than he can get for himself, so should have books read to him and should learn to narrate what he has heard. (2) "When and how are the forty-five combinations and the multiplication tables learned? When does formal arithmetic begin?" I enclose a paper, The Teaching of Mathematics to Young Children (by Miss I. Stephens), which was written at the request of the Board of Education and under Miss Mason's supervision, but most children get some sense of number before six years of age. (3) "How can the Mason system be used successfully in a group made up of three or more classes, all the children of which are below the fourth grade? There seems so little time for narration in proportion to the amount of reading it is possible to do, and the children are not yet able to write easily." Narration must be considered from two points of view. It is the teacher's test of a child's knowledge either orally, or in writing, but is also the process by which child or adult gains knowledge and makes it his own. It is expressed silently, orally, or in writing. "We narrate and then we know," said a little girl to a Government Inspector. She had been brought up in a large school working out the P.U.S. programmes and was accustomed to narration in the three kinds above mentioned. Every child cannot narrate aloud every lesson, nor is it necessary. The teacher's part is to see that the children are trained to work by one reading with narration to follow. The teacher may test it in various ways, some of which are indicated in a paper (see answer 7) by the headmaster of a large boys' school; but a slavish adherence to the letter rather than the spirit even in this matter of narration will only court [p 203] disaster. Clever children will sometimes memorise an astonishing amount and will not understand what they have read or narrated. Here again the teacher must test the narration by a wise question which will lead to a discussion and will see to it that next time the passage is too long to allow of verbal memory. (4) "The Mason system insists that there shall be 'no second readings.' Is there not literature that a child delights to read, not twice but many times? Is a second reading always fatal to interest?" There are two kinds of reading. In desultory reading (both for pleasure and profit) a second, third or twentieth reading is necessary if we are to enjoy, or profit, by all that a great author has to say, but when a young scholar is at work "reading" (in the University sense) in order to know, he must perform the act of knowing. One often hears it said of quite a young child—one knows it from sad experience!—"Oh, he never forgets anything he has heard!" Why? Because a child wants to know. The inclination that comes to us, his elders, to procrastinate because we may get another chance, does not occur to him, so he uses his natural power of attention once for all and he knows. The effort of the ordinary teacher is directed towards getting and keeping the attention of the pupil, whose power of attention is dissipated in many ways as soon as he gets to school. The boy knows that he will be prodded by the teacher, that notes and summaries and revision in "prep." will offer another chance and so he lets the first chance slip and the chances are then ten to one that he will ever know! Miss Mason found that this principle was the same for child or adult. We can all pay attention when we want to know and we make the knowledge our own by letting the mind work with its "What next? What next?" until the whole is narrated either silently, orally, or in writing. (6) "If a child is never to be interrupted or corrected, how are wrong impressions removed?" The answer to question six follows here. Question, or correction, while the child's mind is working stops the flow of thought. As a child narrates (unless he is glibly memorising) you can almost watch his mind working. A sudden question produces a blank look and the mind is "off!" The narration of a lesson may quite well be taken up by one child after another in quick succession, continuous narration of the pages read [p 204] once. The teacher's opportunity comes when the narration is done. The children, if invited, will correct each other, and the teacher, by a judicious question, will be able to clear up or discuss any point of difficulty, not quite understood, which has appeared in the narration. (5) "Is a child ever permitted to memorise a poem that cannot be committed after a single reading? Is our idea of a treasury of memorised verse also a fable?" The above answers refer to what may be called mind-work for want of a better phrase. Memory work is a different matter; such work must be word-perfect and the habit is acquired by fixing the attention on details rather than on the whole. Tables, declensions, etc., must be learned "by rote," as we say. In the learning of poetry both mind and memory work must be made use of. Our children have anthologies and are allowed to choose what they would like to learn, or, the teacher may select two or three poems for reading and offer them for choice. The child listens to the whole poem. If for narration, he will hear it once and then narrate. (This is the answer to question 8). If for memory work he will learn it line by line, or phrase by phrase until he knows it. (7) "In a large group are children never bored by the narration of others, especially of those slower at narration?" Yes, of course the children will be bored if the teacher is not prepared for this difficulty. Mr. Husband's paper (see Parents' Review, September, 1924) indicates ways in which this difficulty may be met. As soon as the children can write they will have full scope for working at their own pace, but it is also well that they should learn to help each other and realise that intellectual life, either in school or in the world, has its duties to others. (8) (Answered above) "What is meant by 'telling' Lycidas?" (9) "If there is to be a total absence of praise, blame or marks how is a child to judge his efforts, or set up a standard for himself? Are the judgments of adult minds of no value to the child?" Again the underlying principle must be borne in mind. The teacher's aim should be that the child must know that he may grow; if he learns to walk by means of crutches or artificial stimulants he will become dependent on them, and his growth will be retarded. If he finds that school work is chiefly accomplished by listening to the teacher, or by making a special [p 205] effort to "go one better than his neighbour," he will miss the life-giving stimulus of knowledge itself which only feeds him as he takes and assimilates it for himself. Children of outstanding ability make their own way in spite of the stumbling blocks that we teachers suffer to lie about, but the ordinary child is lulled by the teacher's voice into inertia one minute, or stung the next into a spasmodic effort which only ends in satisfaction at having attained as a goal, not knowledge but marks, or place or prize. Of course the boy has to take his place in school as he does in life; but our mistake has been in letting him think that a place either in school or in life is the thing to aim at. The judgment of his teacher is exercised rather in the teacher's own attitude towards knowledge. The child, who sees that his teacher shares his delight in knowledge of all kinds, looks at his work in a different light. School work is not then a continual struggle to scramble within the limits of a teacher's forbearance and to do what has to be done, but a happiness which brings him interests of all kinds in common with his teacher whom he also looks upon in a new light; and where most subjects bring some kind of pleasure others are accepted (if with some distaste) as the discipline of life is accepted by those who know its joys, while the teacher sees in his pupil a companion with whom his own interests may be shared. (10) "Is the curriculum of the Mason system usable, without change, in American Schools? What place has the literature, art, history and government of America in such a programme?" It would of course be necessary to make some slight modifications in the programmes as they stand for use in American schools, but the answer in the main is that there is a common foundation of world-knowledge which is the birthright of everyone and the P.U.S. programmes are based upon this. There is still an ample margin left for special knowledge belonging to local conditions. Most schools work for longer hours than those of our time-tables and Secondary Schools both here and in America will, we hope, see that boys and girls can get a liberal education in common knowledge as well as the special knowledge for local conditions; and with this foundation the specialised knowledge required for any one Public School Certificate Examination or Public Entrance Examination can be acquired in say a year at most, at the end of a pupil's school career, thus leaving him free from the trammels of public examinations until he has received "a liberal education." E.K.
<urn:uuid:c54dacac-ab38-4e8a-abca-a937541eb37e>
CC-MAIN-2022-49
https://charlottemasonpoetry.org/wp-content/uploads/2022/10/PR37_pp._200-205_Notes_and_Queries.pdf
2022-12-09T16:24:25+00:00
crawl-data/CC-MAIN-2022-49/segments/1669446711417.46/warc/CC-MAIN-20221209144722-20221209174722-00187.warc.gz
199,802,567
3,069
eng_Latn
eng_Latn
0.999528
eng_Latn
0.999571
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 3461, 6897, 10516, 14300 ]
[ 2.5625 ]
1
0
#1 #2 #3 Choose the best answer Julia has the following data: If the median is , which number should be? Show your work Choose the best answer Matthew has the following data: If the median is , which number should be? n, 1, 4, 8, 7 4 n Show your work Choose the best answer Chloe has the following data: If the median is , which number should be? v, 2, 6, 5, 1 5 v Show your work p, 4, 7, 2, 3 4 p 1 6 3 9 10 1 Get more worksheets at http://www.mathgames.com/worksheets CC.7.174 Play online at http://www.mathgames.com/skill/7.174 Page 1 of 4 #4 #5 #6 Choose the best answer Emily has the following data: If the median is , which number should be? u, 3, 10, 4, 8 8 u Show your work Choose the best answer Jayden has the following data: If the median is , which number should be? f, 6, 10, 4, 3 4 f Show your work Choose the best answer Ella has the following data: If the median is , which number should be? e, 4, 4, 1, 2 4 e Show your work 10 1 10 4 3 4 Get more worksheets at http://www.mathgames.com/worksheets CC.7.174 Play online at http://www.mathgames.com/skill/7.174 Page 2 of 4 #7 #8 #9 Choose the best answer Daniel has the following data: If the median is , which number should be? q, 1, 7, 5, 1 2 q Show your work Choose the best answer Brayden has the following data: If the median is , which number should be? w, 6, 3, 5, 4 5 w Show your work Choose the best answer Jackson has the following data: If the median is , which number should be? Show your work 10 2 7 1 j, 2, 3, 2, 9 3 j 4 2 Get more worksheets at http://www.mathgames.com/worksheets CC.7.174 Play online at http://www.mathgames.com/skill/7.174 Page 3 of 4 #10 #11 #12 Choose the best answer Anna has the following data: If the median is , which number should be? a, 2, 9, 3, 5 5 a Show your work Choose the best answer Joshua has the following data: If the median is , which number should be? u, 1, 5, 6, 4 4 u Show your work Choose the best answer Angela has the following data: If the median is , which number should be? m, 1, 1, 3, 7 3 m Show your work 4 10 2 10 4 1 Get more worksheets at http://www.mathgames.com/worksheets CC.7.174 Play online at http://www.mathgames.com/skill/7.174 Page 4 of 4 Median: Find the Missing Number Get more worksheets at http://www.mathgames.com/worksheets CC.7.174 Play online at http://www.mathgames.com/skill/7.174
<urn:uuid:68943115-cd36-4c76-94ec-67032300b3f3>
CC-MAIN-2022-49
https://pdf.teachme.com/worksheet/7-174.pdf?&t=mg
2022-12-09T16:31:13+00:00
crawl-data/CC-MAIN-2022-49/segments/1669446711417.46/warc/CC-MAIN-20221209144722-20221209174722-00186.warc.gz
476,010,508
810
eng_Latn
eng_Latn
0.985539
eng_Latn
0.985206
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 570, 1139, 1715, 2286, 2442 ]
[ 3.375 ]
1
0
Birth of a Tree Farmer – Doug Stinson My wife and I live on a tree farm on a ridge above the Cowlitz River thirty miles west of Mount Saint Helens. This morning I built a fire in our woodstove, did my yoga, and went to work in the woods, as I do everyday. I drove my pickup out to a thirty-year-old alder stand about a half mile from the house. I cut down brush and stunted trees to open an old trail in anticipation of some young visitors later this summer. After I burned a tank of gas, (at 87, this is my daily limit), I rigged up a 100 foot rope to rappel down a particularly steep part of the trail. Everyday I wake up and feel immensely grateful to be here on our family's farm, Cowlitz Ridge Tree Farm. The dream for this farm began in the Missouri Ozarks. I was raised in Mountain View, Missouri, on a hardscrabble farm. My mother was a loving woman who was fond of the forest and wildflowers, and my father a hard working man who always managed to keep food on the table. In the late 1940s, when I was a teenager, the Missouri Conservation Commission took on a new mission. At the time, farmers were burning forests to create grasslands for grazing animals. The Commission wanted to eliminate grazing on forest land and began promoting growing timber as a crop. The Commission constructed a fire lookout three miles from our farm and an active fire crew quickly responded to any smoke. They also started planting shortleaf pine on state forest land. My buddies and I loved to climb the lookout, and as I watched the pine grow, I decided I wanted to plant my own. My folks gave me ten acres on a rocky hillside, and at fifteen I planted my first forest. I knew then I would be a forester. My wife, Fae Marie, and me on our tree farm. The summer after my senior year in high school, I worked the wheat harvest in Kansas for a family called Boylan. I had mentioned my plans to go to college and study forestry, but as fall approached, I wasn't taking any steps toward leaving. One night after dinner, Mrs. Boylan said, "Douglas, you need to go to school. We'd love for you to stay, but it's more important to go to school." I packed up my stuff and drove my 1931 Model A back to Missouri. I sold the car and my mother took me to the University of Missouri at Columbia. It was two weeks after the start of the school year, but somehow, they let me in. In 1952, after my freshman year, I came to Sutherlin, Oregon, to work on a fire suppression crew with the Douglas Forest Protective Association. Our fire camp was located in Upper Hinkle Creek next to a Weyerhaeuser logging camp. The fire boss, Lloyd Thorton, quickly whipped the crew into shape running us through forest trails and cutting endless cords of firewood. Our tools were cross cut saws, wedges and splitting mauls. The summer was a hot one, and it wasn't long before I saw my first crown fire. I was on one of several crews sent to battle a fire burning near the logging camp. A large cold deck of logs was down in a steep canyon. Lloyd sent a buddy and me into the canyon with a fire pump and hose to spray water from a creek onto the cold deck. Just before we dropped down into the canyon, Lloyd grabbed my shoulder and said, "If you see any smoke coming out of the cold deck, drop everything and get up to the ridge as fast as you can." After one hour of spraying the deck of logs, I saw a whisp and then two minutes later, a larger plume of smoke. Lloyd's words flew through my mind: we shut off the pump and scrambled up to the ridge. Within five minutes of reaching the top, the cold deck exploded and flames roared toward us through the tops of the trees. Dodging flying embers, we jumped into the fire trucks and headed to the next ridge, several miles off, where we finally managed to control the fire. During my sophomore year in college, another forestry friend and I went to see the movie "Red Skies Over Montana." As we walked out of the movie I said, "I want to be a smokejumper." He said, "Me, too." He jumped McCall in 1953 and I rookied Cave Junction in 1954. Oregon was love at first sight: big timber, mountains and rivers. I knew I wanted to live and work in the Pacific Northwest. I started dreaming of my own patch of forest land. Upon graduating with a degree in Forestry, I had the choice of being drafted into the Army or joining a service of choice. I chose the Marine Corps, arriving at Quantico on January 1, 1956, for Officer Candidate School. I served four years with time in Japan, Okinawa, and the Philippines. After leaving the Corps, another Marine and I decided to homestead in Alaska. It was 1959 – Alaska had just become a state and there was free land. Our plan was to make a fortune near Talkeetna. To keep the land, 160 acres each, we were required to build a small shack, clear ten acres of brush, and plant a crop. We spent two months bushwacking and camping while looking for possible farm sites. The land was low quality and no markets existed for any crop and we decided against our plan. But "the fishin' and huntin'" was good. I moved to Juneau and got a job as a Junior Forester with the Forest Service. In the fall of 1959, I transferred to Ketchikan where I met a beautiful auburn haired teacher named Fae Marie, who became my bride. We lived in logging camps in Edna Bay and Craig, Alaska and soon had two children, Steve and Ann. A newspaper clipping of a Forest Service firefighting exercise in Edna Bay. We loved our "kingdom by the sea," but there is very little private land in Southeastern Alaska and my urge to become a tree farmer was growing. We purchased 640 acres of timberland near Bonners Ferry, Idaho, and I planned to get a job nearby. But plans do not always work out; there were no "nearby" jobs, and I went to work as a timber cruiser for US Plywood in Roseburg, Oregon. We sold the Idaho land and purchased 200 acres in Roseburg. Our third child, Julie, was born there. In 1970, US Plywood asked me to move to Washington State. After two years in Seattle, we found our land above the Cowlitz River in Toledo, Washington. Since our marriage in 1960, Fae Marie and I had moved twelve times. It was time to settle down. We built a house in 1971 and it has been our home since. In 1973, we did our first logging in Toledo and I was hooked. With the profit, we were able to purchase more acreage in Mossyrock, Washington. By that point, I had a few guidelines for purchasing new ground: no steep ground (maximum side slope of 40%), no more than 30 miles from home and high quality soil. With the purchase of land near Mossyrock, I was getting a very strong desire to become a full-time tree farmer, but I still needed outside income. Tree farming is a long-term business; tree farmers are usually timber rich and cash poor. The children were 11, 9 and 7 when we moved to the tree farm and soon learned to work pulling tansy, mulching trees and planting trees – there is always work to do on a farm. I think our children learned to read in the woods; we mulched newly planted seedlings with newspaper. On Saturdays we would all be out mulching and suddenly I'd realize it was a little too quiet. I'd look around to see them reading Dear Abby, the local sports news, or national politics. In 1978, I left US Plywood to work for Conifer Pacific, a small veneer and plywood company near Elma, Washington. Conifer Pacific did not own timberland; we purchased US Forest Timber sales to sustain our mills. I was in charge of timber procurement and the logging operations. My plan was to do this work for five years. Due to the major economic downturn in the 1980s, I stayed thirteen. In 1990, at 57 years old, it was time to fish or cut bait. I traded my shares in Conifer Pacific for the owner's half interest in a 320 acre timberland we had purchased together. He threw in a D-4 Cat and a pickup and I was in business. With this addition, we had four tracts totaling 1,200 acres. In 1994, we named our forest Cowlitz Ridge Tree Farm and drew up our first management plan. At that time, our son, Steve, was finishing his degree in Environmental Science at Evergreen and Julie was completing a degree in Forest Resources at Oregon State University. We put our heads together and wrote our goals: To earn a living; To live in balance with nature, a "partnership with nature"; and To educate the public and other landowners on the values of good forest stewardship. We base our philosophy on the belief that diversity in our forests is important. Timber, watershed, soil health, wildlife and recreation are values integrated into our management plan. We believe that through the integration of these values we will be leaving the land in better ecological condition than when it was purchased. All waters on the tree farm drain to the Cowlitz River, a steelhead, chinook and coho salmon stream. Forests like ours are essential to providing clean, cool water for fish. In 1998, Steve received a Masters Degree in Silviculture from the University of Washington. I was so pleased he had decided to follow in my tracks as a forester and tree farmer. He took Cowlitz Ridge Tree Farm to a new level. He was instrumental in converting a 33-year-old Douglas Fir Stand, severely infected with root rot, into a Ponderosa Pine and Western Red Cedar plantation. He started the practice of leaving snags in clearcuts to attract woodpeckers and other birds. He negotiated with state and federal agencies to procure alternate plans, allowing us to log closer to streams while still protecting the fish. We worked together every day for many years. On one small logging job (two to three acres) Steve fell the trees and I yarded the logs with our Model 21 Garrett Skidder. It was very satisfying for us, a father/son team, to produce a load of logs. We hired a self-loading log truck to move the logs to the mill. Many times at the end of a long day, we would relax in our wood fired sauna, drink a beer and plan out our next Cowlitz Ridge adventure. The sauna became our "think tank." One idea we discussed often was how to pass the tree farm to the next generation. In 2012, we created a Limited Liability Corporation (LLC) as the legal entity to govern the tree farm. At that time Fae Marie and I transferred the tree farm to Steve, Ann and Julie. Steve became the manager and we continued working together daily. Steve and I logging Late in 2012, after experiencing discomfort he thought was a hernia, Steve was diagnosed with leiomyosarcoma, an aggressive soft tissue cancer. After two years of a bitter fight, he passed away at 52. His death was an earthquake to our family. We decided to dissolve the 2012 LLC. In the end, two parcels were sold to Port Blakely Tree Farms, a 175-year-old forest resource company with a reputation for "doing the right thing." We are very happy our land will remain in timber. In 2016, Ann and Lou Jean, my daughter-in-law, formed a new LLC with the remaining tracts. I am the senior advisor for long-term planning and handle much of the day to day work. As the three of us work in the forest, tending seedlings, or thinning young trees, we see deer, elk, coyotes, porcupines and evidence of black bears and cougars. Eagles, Osprey hawks, Red-tailed hawks, ravens, wild pigeons, swallows, mourning doves, Saw Whet Owls and pileated woodpeckers go about their daily lives in the trees. This year, I discovered a Red-tailed hawk nest 85 feet up in a Cottonwood tree. The adult hawks feed in a twelve acre clear cut we logged in 2018 and fly a half mile to their nest. I have placed two chairs in the woods out of sight of the nest where Fae Marie and I come to watch the nest in the evenings. As I've lived in the forest with my hands in the dirt every day, I've become a keen observer. Two major changes have occured since 1971: Our annual rainfall has decreased, and our summers are longer and drier. Every morning at seven, for the past thirty years, I've recorded the rainfall; the average from 1990-2017 was 53 inches. In 2018, we received only 41 inches, a 23% decrease. In 2019, the rainfall was only 35 inches, a 34% decrease. In the seventies, it was standard practice to move logging operations from dirt roads to rocked roads by the 15th of September; now loggers run on dirt roads through October without being mudded out. That's a plus for the loggers, but the lack of rain and increased, sustained heat is stressing our native tree species. Douglas Fir, Western Red Cedar, and Red Alder are all under duress. Trees are like humans, when their immune system is weakened, they are vulnerable to disease. This lack of moisture is particularly a problem on droughty sites, like our Toledo site. The soil here is a glacial outwash with about one foot of topsoil, then twenty feet of gravel and sand. This lies on top of hardpan clay. Rain perks too fast through the gravel, then, when it hits the impenetrable clay, flows horizontally. We have seen increased damage from laminated root rot, fir twig weevil, and a variety of fungi, all "opportunistic" diseases that attack stressed trees. With adequate rain, trees can still grow well, but with our reduced rainfall we have begun to change species. Eight years ago, we planted one hundred acres of westside Ponderosa Pine; the seed source is the Willamette Valley. A little known fact is that the earliest mills in the Willamette Valley cut Ponderosa Pine. Our pine is doing well. In January of this year, we thinned a ninety-year-old stand in order to remove dead and dying Western Red Cedar. This is the first time mature cedars have died on this tract in our fifty year ownership. We replanted with drought resistant species – Incense Cedar, Port Orford Cedar, and Western White Pine, mixed in with Douglas Fir and Western Red Cedar. We love visitors to come walk through our woods. We let the forest tell its own story as they walk the trails. If you'd like to come visit, please drop me a line at email@example.com. I am most grateful to my daughter, Ann, for giving of her time and skills to make this article happen.
<urn:uuid:53d1767f-2313-4f8c-b6b9-310e96cc15ad>
CC-MAIN-2022-49
https://www.wafarmforestry.com/sites/default/files/pdfs/FeaturedMembers/Stinson-Birth%20of%20a%20Tree%20Farmer.pdf
2022-12-09T15:58:10+00:00
crawl-data/CC-MAIN-2022-49/segments/1669446711417.46/warc/CC-MAIN-20221209144722-20221209174722-00187.warc.gz
1,133,523,184
3,255
eng_Latn
eng_Latn
0.998889
eng_Latn
0.999222
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 2868, 5440, 8600, 11034, 13780, 14073 ]
[ 2.28125 ]
1
2
Nishanth Krishnan Torrey Pines High School San Diego, CA India, Factor 20: Farm to Market India: Limiting Food Waste by Improving the Quality and Capacity of Existing Storage Facilities India—the lush, tropical nation situated prominently in Southern Asia—is the epitome of the resource curse. Farmers across India have record harvests each year as millions of Indians remain malnourished. The situation is fueled by inefficiencies in government and third party farm to market systems, which handle food before it reaches the consumer. Food waste in the systems allows people to go hungry in a nation that produces enough food to sustain its entire population. The lack of adequate physical housing, from grain silos to cold storage centers, leads to the waste of basic crops, which feed most of India's poor. Businesses and the government of India lacked preparation and failed to forecast the rapid growth of harvests in recent years, and both will continue to be unprepared to handle larger amounts of food. The government, which supports many local food subsidy programs, buys large amounts of food from farmers, yet has no appropriate way to store all the purchased food, allowing it to spoil. Meanwhile, businesses with commercial interests give cash crops the priority for cold storage over crops which are a necessity for the poor and rural. Fortunately, the problem does not reach beyond basic infrastructure needs. Simple improvements in food housing and giving priority to crops with sustain the majority of the population—the poor—are two simple ways to start tackling the malnutrition situation in India. Fixing the problem will be direct; the problem lies within physical and organizational inefficiencies in middle man processes between the farm and consumer. Half of the 1.2 billion Indians in India work in agriculture (Artiuch and Kornstein). But, the farms that they work on are miniscule—a result of the practice of splitting land amongst children from generation to generation. Farms average around 5 acres in size, meaning that the average size of a farm has gone down by 50 percent since India's independence in 1947 (Westhead). The small size of each plot, along with the inherent risks in India's produce sector, makes the incomes of crop growers variable and low. Income can shift on a daily basis because of the supply and demand of the day, rather than seasonal or annual trends (Artiuch and Kornstein). Often, a farmer will only have a few dollars to spend on food in a week. The farmer has to provide for his or her entire family as well; families on farms tend to consist of three generations through the father's side, though this trend is declining in some parts of India. The 2011 census of India shows that 47.1% of rural families have less than 4 members, and that 47.6 % of families in all of India have 5-8 members. 70% percent of those who live in rural areas are illiterate and the problem continues to worsen. According to the Unesco Education For All (EFA) program, 126 million children and adolescents in India do not receive schooling, and aid to education fell over 270 million dollars to levels not seen in years. But the government of India has mandated that education for those aged 6-14 be free, thereby giving more children access to education. Upward trends in services, such as health care, are helping the portion of people in India who live in rural areas find more access to public and private health care systems. This allows more of the population to receive treatment for diseases which are curable. Health care is mostly done through private companies rather than through the government in India. Farms in India continue to produce crops that have been part of Indian diets for centuries. Vegetables, such as peas, potatoes, tomatoes, and onions are grown along with grains, fruits, seeds, and pulses. Vegetarian and non-vegetarian diets are influenced by local culture, and the most common crops are wheat and rice. The south of India eats a more rice-based diet while the north incorporates wheat into their diet. Wheat and rice are grown in the millions of tons, and India has become the second largest producer of wheat in the world. In 2013, India harvested a record 93.4 million metric tons of wheat (Mishra and Parija). Wheat takes a special role; the Indian government buys wheat to stockpile for emergencies and intends to distribute it to the poor through food subsidy programs. The government buys and stores wheat through the Food Corporation of India (FCI). But in recent years, the strain on grain storage facilities has grown past the tipping point and the FCI receives more wheat each year than they can store (Pasricha). In 2012, the FCI had the storage capacity for 63 million tons of grain, but was given 75 million tons of wheat to handle. The existing network of storage is of poor quality as well. Graduate students of the Massachusetts Institute of Technology Paul Artiuch and Sam Kornstein describe the storage as "20 foot stacks of 50kg burlap sacks sitting in parking lots and covered with plastic tarps to keep out the rain. Most facilities are open air and offer no protection from humidity, birds or pests—common food waste causes. In many cases, the tarps don't even fully cover the grain". In recent years, up to 20% of the stored grain would be lost (Artiuch and Kornstein). In 2010, 16 million tons of grain went to waste, which is enough to feed 181 million Indians for an entire year. The government failed to account forecasts of increasing production and the rampant food wastage lead to large financial losses. The FCI lost 1.6 billion rupees or around 26.5 million US dollars in 2012. Deficits continue to increase this way, financial pressure is added, and the cycle continues as it becomes even harder to spend more to fix the problem. So while agricultural productivity rises, malnutrition begins to devastate more Indians than ever. 21% of Indians are malnourished, including 40% of all children (Westhead). Rates of malnutrition in the country have gone far past its comparable neighbor China, and are even higher than countries in the sub-Saharan region. Failing infrastructure and massive waste incurred from the lack of basic food housing are the main sources of the problem. The amount of grain wasted in India amounts to the quantity of grain produced in all of Australia (Westhead). But grain was not the only product to be wasted by lack of basic infrastructure. Potatoes, tomatoes, and onions are all foods that are common in many Indian diets and are prone to rotting quickly. The lack of cold storage causes a multitude of problems; both nutrition and farmer income are affected. Cold storage helps fruit and vegetables last beyond their week long shelf life. If they are not sold within the time period, they begin to rot, and become inedible. The rotten produce is often cast into the streets or given to street animals. And, the lack of cold storage causes similar financial problems as the wheat situation. Cold storage can help maintain the quality of fruits and vegetables for a longer time period, especially advantageous when produce prices are at a low period. Preserving the produce for sale at a later date can assist in keeping prices static. Otherwise, prices are at the mercy of random trends and seasons. Farmer incomes, which are constantly shifting due to changing food prices, can maintain stability. This will relieve pressure on the financial situation of farmers. In addition, families across India gain access to fundamental blocks of a proper diet. Fruits and vegetables are needed to maintain overall health, reduce disease risks, and are great sources of energy. Risk from diabetes to heart and bone disease is lowered by fruit and vegetable intake. Potatoes, tomatoes, and onions, squandered through lack of cold storage, contain vital vitamins and nutrients. The lack of basic infrastructure affects both the nutrition of Indians and incomes of crop growers. For India, the gravity of the malnourishment problem is compounded by the incredibly high population of the country. The food demand and production are on a larger scale than most other countries. In India, over 200 million people are malnourished (Pasricha). Most of India's poor live in rural areas, where malnutrition is most common. The most basic of food ingredients, from fruit to vegetables to wheat products, are wasted through simple, curable failures in the food storage and maintenance process both by the government and the middlemen of the farm to market process. The rural suffer most, as staple crops makes up their entire diet. Income fluctuations make it hard for families to purchase any food outside the most basic and required intake. Therefore; the loss of produce causes dramatic problems for the poor and those who live in rural areas. India's explosive population growth adds urgency to the situation. The population growth is a unique factor that adds ever increasing pressure to fix the situation immediately. Current infrastructure is already unable to provide income stability and adequate nourishment for all. As the population continues to grow, India must act immediately in order to provide a food infrastructure for future generations. India already has a massive population base, and according to the United Nations (UN), is expected to become the world's most populous country in the world by 2028 (Times of India). Malnourishment and income instability will continue to rapidly grow as a problem with India's population growth. It will become more of a challenge, and will put more people in danger of starvation and poverty if India delays tackling the problem further. The starvation affects one group the most—children. Four out of ten children in India are malnourished. Consequentially, these children are severely underweight, have learning and memory disabilities, and are prone to illness. The plight of these children is a humanitarian crisis that will have many negative effects on the next generation of citizens. The Indian government has attempted to improve the situation. The passing of legislature through the government can be seen as a good sign of acknowledgment of the crisis. One bill, the Food Security Bill, is an attempt to start solving some of the issues causing malnourishment. Though it is cited for being costly and time consuming, it shows that the government is trying to act. Malnourishment has been in media spotlight and the Indian government and the people know the responsibility they have to improve the situation. Awareness of the problem, both within and outside of the country, can be used as a sign to indicate how the situation might improve. With greater awareness, there will be more pressure on the government to fix its grain storage problems and on the individuals/businesses. India has enough food to feed its entire population (North), and though the country imports food products, it will be over a decade from now before imports are a requirement. Millions of tons of wheat and rice are produced, and a variety of fruits and vegetables are grown across India. The problem continues to be a game of connect the dots; millions still remain malnourished. If there is more than enough food to feed the entire population, then the solution for the malnutrition problem requires a fix for both government and third-party storage. Preventing losses, logically, puts more food into the system. The FCI receives more input grain than it can handle. Even with its status as a leader in wheat production India has a grand total of 20 grain silos, which is miniscule compared to the 400 in Canada (Westhead). Grain silos are a cheap investment, in comparison to large scale government programs. Construction of a full-size, industrial grain silo typically costs less than a hundred thousand US dollars (Farmgate). Physically, the structures only require land, are environmentally safe, and provide all around shelter. This not only gives a designated space for storage but keeps the weather and animals out. Grain silos have optimal designs for grain storage. And even with the costs of facility construction, maintenance, aeration electricity usage, and wheat transfer, additional silos will be a quicker, cheaper, and straight-forward alternative to government programs for wheat. Fruits and vegetables face a similar problem; in their case, cold storage. Fruits and vegetables, with potatoes, onions, and tomatoes being especially common, are highly perishable. If these fruits and vegetables are not sold within the time period, natural changes and bacteria promote rotting within the fruit or vegetable, making it inedible or dangerous to eat. These products are thrown away, wasting food, time and money. If the market is not right at the time for a specific crop, the farmers have no other choice but put the crop up for sale anyhow, also due to the lack of cold storage. Improving cold storage networks in the private sector, since most produce goes through private companies, can solve both wastage and prices. Cold storage increases the longevity of produce by slowing down the degeneration of the live material which makes up fruits and vegetables. The waste, naturally, will go down with a larger network of cooling centers. Lowering the waste from inefficient infrastructure will be extremely effective in fighting malnourishment. Though cooling centers can be expensive to maintain, the government has previously stepped to subsidize cooling technology, making it easier for staple crops to be sold and generate overall profit, like cash crops. Making governmentsubsidized cold storage a long term initiative will be very effective in keeping core foods on the shelves instead of in the trash. While changing storage systems and creating new storage will have beneficial, long-lasting effects on the food market and farmer-income, there are ways to create immediate, short term security in both these areas. An example is the Vegetable and Fruit Produce Council Keralam (VFPCK)—an existing and effective program designed to achieve income stability and efficiently bring food to the market. The group, based in the south Indian state of Kerala, has created over 8,000 self-help groups among farmers. The VFPCK has created 254 new markets in the region—markets which are farmer-oriented to allow the farmer to receive a larger share of the profits. Produce is even processed and marketed through the council, and the group gathers price data for various fruits in various centers and areas in the country in order to make better financial decisions. The council helped sell 101156 metric tons of local produce from 2012 to 2013. The fact that all aspects of farm to market process are handled under the same group allows for improved efficiency at a local level. The VFPCK is a strong example of an effective model for selling produce. However, scaling this particular model up to a national level would be difficult. The produce of Kerala is much different from the crops grown in the north of India, and it would be a financially impossible for one single council to handle all the food processing in India. A better way to apply the VFPCK's model is to take certain aspects of it, as in collecting data, handling food processing, crop marketing, and apply it to existing state organizations. Once the government and third-party businesses revamp their storage systems, it will become easier for a variety of produce to be sold through the normal middle man method, as the government and businesses have many more markets available. Therefore; short term fixes to state-wide programs can improve regional efficiency while the national system, which can distribute produce nationally, is being updated. Smallholder farmers would benefit immensely with the broadening of cold storage across India. In the status quo, farmers who cultivate perishable produce have to sell their food to middlemen who sell immediately because the produce will rot quickly. Prices for produce can shift drastically, so the price the famer sells the produce at can be very different at times. The income the farmer makes off of the produce is variable under these circumstances. To increase cold storage networks would mean extended shelf lives of produce. This allows farmers and middlemen together to sell the produce to markets at an optimal time. Produce will be sold at a better, consistent price. Smallholder farmer incomes will stabilize and alleviate nutritional and financial problems. The market will grow and the economy of the agricultural sector will grow with the introduction of cold storage, since a majority of India's farmland is held by smallholder farmers. Overall stability in the sector can lead to improved production and investment on the farm. The picture could drastically change from farmers who can barely feed themselves and their family to farmers being able to put money into their farms for increasing production. The two main figures in solving food wastes and income instability are the national government and third party groups involved in between the farmer and the marketplace. The national government decided to take on the responsibility of maintaining emergency stores of grain and wants to distribute food to the poor through its nation-wide programs. Though it had good intentions, the FCI, which was to manage the stored grain, did not have the resources to properly store collected grain leading to large food wastes, which were enough to feed millions of people, and faced large financial consequences. The private sector is also burdened with the blame for the problem. Commercially driven motives allowed staple crops to go to waste as cash crops were given priority. The decisions affected millions and put many more at risk. Fortunately, solving the problem requires little more than small investments and regulations. The costs of adding all the necessary infrastructure, housing and preservation, will amount to less than the cost of current programs designed to combat malnourishment and other difficulties. Since the government has cordoned off money for the programs, the money to add infrastructure is already there. The rural and smallholder farmers can take roles as well, acting as indications of the success of additional infrastructure. The people of India can always add pressure to the Indian government to take action and solve the problem as quickly as possible. Currently, the media has put the spotlight on the hunger crisis and spreading awareness of the effects of malnutrition. Individual citizens can do the same—by spreading awareness in where they live. Also, the individual has a large role in influencing the government in passing legislation. The power of ordinary citizens could be seen when people underscored that India cannot have ambitions to be a global leader with its notorious malnutrition and poverty. Because of this, the newly elected majority party stated that "extreme poverty and malnutrition will be a national priority" now (Rao). As for private businesses, Veena S. Rao, a former secretary to the Indian Government, states that the people "must motivate [businesses] to assume some responsibility" for the malnutrition situation. In the 1940s, farmers in the province of Gujarat in India, fed up with income instability, decided to try and stabilize the prices on one of their most produced products—milk. The project, known as Anand Milk Union Limited, or Amul, banded milk producers to create local networks that would help farmers selling milk get the best price for their sales while attempting to give customers the best price for the product. The income instability of the milk producers stemmed from a complicated middle man process which farmers could not circumvent. This, coupled with milk's tendency to spoil in the hot and humid climate of India, caused prices to collapse often. The Amul organization, which was run by the milk farmers themselves, would buy fixed quantity and quality milk regardless of circumstances. But the Amul organization operated at the local level, giving it the advantage over the current, complicated middle man buying process. Milk could be sold quickly, lowering prices for consumers, and locally using this more streamlined process. Surplus milk was then held by Amul, to be distributed at the national level. Eventually, the dairy industry of India was changed completely by Amul. The local organization was drawn up from local branches to the largest food company in India. Maintaining the same values and same method, the corporation sold milk and milk products for lower prices all across India in local groups. Now, the same problems that plagued milk producers in the seventy years ago, affects all farmers from vegetables to wheat. The origins of Amul can be compared with the existing state of the VFPCK today—improving the farm to market process at the regional level. It can be acknowledged that there is no measurement that can give a perfect forecast on how much will be harvested per year. The same can also be said for rates of population growth in the country. Inaccurate forecasting has been, and continues to be, a barrier for the Indian government and other businesses in reforming the farm to market process. Like most countries, India performs a census of its population, and India creates estimates for the upcoming year's harvests and produce. But optimizing storage systems requires finding the perfect balance between predicted growth of harvests, population growth, and costs of storage construction. This means that the Indian government should be gathering more in-depth data about its population and agriculture. Qualitative analysis and finding trends in both these fields will provide more value than flat statistics when planning storage system expansions. The problem with India's food system lies simply within the process that gets food from the farm to the consumers. Before food grown by farmers makes it to the market, the food travels through many middle men, including the government of India and many businesses. Businesses store and transport food to various markets, but tend to have limited cold storage space for the crops that make up foundations in the diets of the poor and rural. The crops, mostly fruits and vegetables, will go bad without adequate cold storage networks. The government of India was unprepared for the extreme growth in the harvests of certain foods such as wheat. Their food subsidizing programs ended up wasting enough food to feed millions more of their population. The food was wasted by lack of proper, long-term storage centers which exposed the food, like wheat, to the elements and animals. Although the food waste is rampant and extremely large, fixing the problem is straightforward in both cases. The government can construct more industrial silos; the problem of food waste lies solely in FCI's incapability to handle larger harvests. Business should adapt methods in which food can be distributed locally, which is more efficient in terms of cold storage use. These fixes will be a strong foundation in the fight against chronic malnutrition across India. In addition, farmer incomes can stabilize, reducing financial strain on families. These steps will be the start of the changes needed to ensure everyone consistent access to foods that are critical in the fight against malnutrition. Works Cited Artiuch, Paul and Sam Kornstein. "Concluding Thoughts on Food Waste". MIT Public Service Center. 20 Feb. 2012. Web. 18 Jun. 2014. "Achievements". Vegetable and Fruit Produce Council Keralam. Web. 19 Aug. 2014. Bakshi, Santnam. "Problems of Food Storage in India". Voices of Youth. 20 Feb. 2014. Web. 8 Jul. 2014. Gohain, Manash Pratim. "India Faced Big Cuts in Aid for Basic Education". Times of India. 15 Jun 2014. Web. 16 Jun 2014. "If You Really Want to Store Grain, Let's Do the Numbers". Farmgate. 25 Sep 2013. Web. 7 Jul 2014. "India to Become World's Most Populous Nation Around 2028: UN". Times of India. 14 Jun 2013. Web. 8 Jul. 2014. Kang, Bhavdeep. "Is the Food Bill Enough to Feed India's Hungry?". Tehelka. 13 Apr. 2013. Web 16 Jun. 2014. Mukherji, Biman. "How to Solve India's Huge Food Wastage". Wall Street Journal (India). Web. 18 Jun 2014. North, Andrew. "India's Enduring Problem with Malnutrition". BBC News. 10 Aug. 2012. Web. 15 Jun. 2014. "Organisation". Gujarat Cooperative Milk Marketing Federation Limited (Amul). Web. 7 Jul 2014. Pasricha, Anjana. "In India, Inadequate Storage Could Mean Wasted Food". Voice of America. 24 Apr. 2012. Web. 18 Jun. 2014. Prabhudatta, Mishra and Pratik Parija. "India Increases Wheat Harvest Estimate To Near Record On Weather". Bloomberg. 3 May 2013. Web. 18 Oct. 2014. Rao, Veena. "For An Aspiring Global Power, India Suffers From Shocking Levels Of Malnutrition. 23 Jun 2014. Web. 18 Aug. 2014 Shrinivasan, Rukmini. "Median Household Size Drop Below Four In Cities". Times of India 25 Mar 2012. Web. 19 Aug. 2014. Sunderajan, P. "Several States In North Cling On To Joint Families". The Hindu. 16 Mar. 2012. Web. 19 Aug. 2014. Thompson, William. "India's Food Security Problem". The Diplomat. 2 Apr. 2012. Web. 15 Jun. 2014 "Top Ten India Crops and Agriculture". Maps of India. 25 Nov. 2011. Web. 16 Jun 2014. Westhead, Rick. "Why India Can't Feed Her People". The Star. 17 Jul. 2011. Web. 16 Jun. 2014. "WTO: India Concerned Over Slow Pace of Talks on Food Security". The Economic Times. 11 Jun. 2014. Web. 14 Jun 2014. "Impact of Malnutrition On Health And Development". Orphan Nutrition. Web. 19 Aug. 2014.
<urn:uuid:600af78a-042b-496c-9a15-fd6474b347c0>
CC-MAIN-2022-49
http://www.worldfoodprize.org/documents/filelibrary/images/youth_programs/research_papers/2014_papers/TorreyPines_NKrishnan_CA_461CB2B4CC731.pdf
2022-12-09T17:03:27+00:00
crawl-data/CC-MAIN-2022-49/segments/1669446711417.46/warc/CC-MAIN-20221209144722-20221209174722-00187.warc.gz
104,135,344
5,303
eng_Latn
eng_Latn
0.902756
eng_Latn
0.998973
[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "zsm_Latn" ]
false
docling
[ 4170, 8627, 13262, 17863, 22534, 25095, 25692 ]
[ 3.359375, 2.515625 ]
1
1
Bradford Bulletin BRADFORDACADEMY'SPARENTUPDATE SPECIALPOINTS OFINTEREST: More Motion * Oct. 20th - End of 1st quarter * Oct. 21st - TEACHER WORKDAY, no school * Oct. 28th - Field trip to Life and Science Museum. * Nov. 10th - Field trip to NC Museum of Art. We plan to tour the general exhibit from 10 until 11 followed by a tour of the special REMBRANDT exhibit at 11. I would like to eat lunch there and return to the general exhibit after lunch. Because the museum is a good distance away I am planning to have kindergarten return later with the rest of the group and dismiss at 2:45 PM. If this causes a conflict for your family please let me know. * Nov. 11th - Veterans' Day (No School) PRAYER * Students - Please pray for spiritual fruit among our students. All their learning will ultimately be in vain if they never learn their chief end. * Staff - Pray for health and creativity as we plan. * Enrollment—Please pray for next year's enrollment! Last Friday we had another great opportunity to get out and move. The Lord blessed us with peculiarly beautiful weather for our annual House soccer tournament. In addition to our regular PE activities we are planning a special monthly excursion on the last Friday. Recall that we went swimming in August and September's trip was to our wonderful city soccer facilities around the corner from the school. Our students competed in a House tournament letting their fierce competitive natures shine. All the students, especially those who don't regularly play league soccer, really stepped up and made great improvements by the end of the day. I was very pleased with the level of effort. I think we should have a very competitive team one day! kindergarten students, each house had six players who played a couple games each to determine this year's champion! The afternoon began with a loss for Austerfield who came back to defeat Plymouth. Scrooby and Leiden won their games to meet for the final match. Each of the houses were warmed up and ready to go. After an intense game, Leiden came out ahead with two goals. The House standings for this event are: 3pts Withoutthe Congratulations to all our students who played well and had a great time out in the sun! Peace and grace! Timor Domini Principium Scientiae P a g e 2 Mr. Johnston 3rd Reading: Black Ships Before Troy— We've reached the half way mark and are at the point where neither Trojan nor Greek can move forward. What will happen next? 4th Reading: Beowulf! The first of the three monsters is defeated. We've looked at author, style, and setting this week. 3rd Math: Mental computation of basic facts, circles with a compass, line segments, and calendars. Be sure to keep review the speed drills when you can. 4th Math: Practicing multiplication, long division and problem solving, parentheses and order of operation. Be sure to ask about Mr. DMSBR. 3rd Latin: Latin for Children A - Chap. 6, 2nd declension nouns. 4th Latin: Latin for Children B Chap. 6, personal pronouns. 3rd & 4th Grammar/Writing: Shurley English Chap. 6, classifying sentences and parts of speech. Continuing the expository essay. 3rd continues learning cursive. 2nd/3rd Grade Science: Unit on North American Mammals and sound off. 4th Grade Science: Continuing insects and other creepy crawlers! Send in your dead bugs please. We are classifying them and beginning to mount our collection. 1st Grade History: Early NC inhabitants and the notorious Edward Teach (AKA Blackbeard the Pirate). 2nd/3rd Grade History: Began learning about our earliest facts about Egyptian pyramids. 4th Grade History: Our 4th graders began Mohammad and the birth of Islam. M r s . O g l e 1st Math: Telling and showing time to the half hour, doubles plus 1 facts, dividing a shape in half. 1st Reading: "My Clara" 1st Grammar: Common nouns as places. 2nd Reading: Little House Chapter 3, First Favorites, and sight word review. 2nd Math: Identifying dozen and half dozen, adding 9, counting dimes, nickels and pennies, and writing fractions using the fraction bar. 2nd Grammar: Adverbs 2nd Latin: mensa: table, sella: chair, stylus:pencil, liber: book. Specials Art 2nd/3rd : Still life and overlapping Art 4th: Finished work on mosaic trivets like those during the time of Justinian the Great Music 2nd/3rd: Singing and tempo Music 4th: This week the students practiced songs with the notes we have learned. P. E. : (2nd/3rd/4th): Endurance games and skills performance assessments. Bradford Bulletin Mrs. Hicks Math: Kindergarten learned a lot about addition and number sentences this week! They also learned about weight and balance. Phonics: We added F to our Phonics Museum this week. We focused on reviewing our Phonics Museum letters and practiced writing and reading the words that we can make with these letters. Centers: Reading Corner, math games, name/number writing, Wrap-Ups and pattern making. Science: This week we talked about tree varieties. K i n d e r g a r t e n observed and colored pictures of different trees. History: Kindergarten continues to learn the B.C. History Fact Song. We are up to verse four now. This week K i n d e r g a r t e n learned the story of Moses. Art (K/1 st ): Kindergarten and 1 st grade learned about shapes this week. They learned to classify Geometric and Organic shapes. 1 st grade made a collage using fruit shapes. Music (K/1 st ): Kindergarten and 1 st grade learned about Bands. We learned that there are different kinds of bands and colored a picture representation of different bands. P.E. (K/1 st ): This week in P.E. Kindergarten and 1 st grade covered Galloping and Springing. The students were able to use these skills in games and relay races. P ro m o t i o n a l P ro m o t i o n a l O p p o rt u n i t i e s O p p o rt u n i t i e s We have a couple opportunities upcoming that can be used to help promote the school. We will have a mini-open house next Wednesday night (10/12) after GRBC's prayer meeting. The elder's have asked me to make a report to the congregation after which we will have the rooms open for families to see the school set up. Be sure to stop by if you're there. The other opportunity is our ANNUAL BRADFORD NIGHT, November 17th at 7:00. This evening is our special time for all the students to demonstrate some of what they have learned. Be sure to mention the evening to friends who may be interested in the school. BradfordAcademy LOGO WEAR Don't forget this opportunity to show your school spirit! T-shirts, mugs, & more! www.cafepress.com/bradacad
<urn:uuid:7a48919f-f1b5-4ee4-a29b-66249ed25336>
CC-MAIN-2020-45
https://bradford_bulletin.s3.amazonaws.com/BB%202011-10-06.pdf
2020-10-31T09:54:49+00:00
crawl-data/CC-MAIN-2020-45/segments/1603107917390.91/warc/CC-MAIN-20201031092246-20201031122246-00145.warc.gz
243,370,902
1,762
eng_Latn
eng_Latn
0.983502
eng_Latn
0.993955
[ "eng_Latn", "eng_Latn", "eng_Latn" ]
false
docling
[ 2298, 5775, 6623 ]
[ 2.15625 ]
1
1